<%BANNER%>

Adeno Associated Viral Vector Delivered Somatostatin as a Candidate for Gene Therapy for Temporal Lobe Epilepsy

Permanent Link: http://ufdc.ufl.edu/UFE0042433/00001

Material Information

Title: Adeno Associated Viral Vector Delivered Somatostatin as a Candidate for Gene Therapy for Temporal Lobe Epilepsy
Physical Description: 1 online resource (108 p.)
Language: english
Creator: Zafar, Rabia
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: epilepsy, gene, kindling, neuropeptides, somatostatin
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adeno-Associated Viral Vector Delivered Somatostatin as a Candidate for Gene Therapy for Temporal Lobe Epilepsy Epilepsy is a debilitating neurological disorder that affects millions worldwide. Even with severe surgical interventions like hippocampal resection and administration of several antiepileptic drugs, a third of the population affected continues to have seizures. Not only are such therapies costly, they also lend patients susceptible to serious side effects and cognitive impairments. Gene delivered neuropeptides provide a much less invasive alternative to resective surgery as well as a solution to drug resistance. Somatostatin (SST) is an endogenous neuropeptide, and has many functions in the central nervous system. A growing body of evidence now supports the general conclusion that the presence of SST inhibits or reduces seizure severity and its absence makes seizures worse. Gene therapy therefore provides a promising alternative to treating intractable epilepsy. We packaged the preprosomatostatin gene into serotype 5 of the adeno-associated viral (AAV) vector and delivered it directly into the rat dentate gyrus and CA1 sub-regions of the hippocampus. The efficacy of this gene therapy was assessed in an electrically kindled animal model of limbic epilepsy by monitoring behavioral responses 11 as well as EEG dynamics. All animals over-expressing SST had a higher threshold to generalized seizures, and seventy percent did not have a single grade 5 (generalized) seizure after 30 electrical stimulations. We also tested learning and memory impairments, which are common co-morbidities associated with epilepsy, using the Morris water maze. Finally, electrophysiological techniques were used to try and unravel the physiological basis for observed behavioral changes between control and gene injected animals.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rabia Zafar.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Carney, Paul R.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042433:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042433/00001

Material Information

Title: Adeno Associated Viral Vector Delivered Somatostatin as a Candidate for Gene Therapy for Temporal Lobe Epilepsy
Physical Description: 1 online resource (108 p.)
Language: english
Creator: Zafar, Rabia
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: epilepsy, gene, kindling, neuropeptides, somatostatin
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adeno-Associated Viral Vector Delivered Somatostatin as a Candidate for Gene Therapy for Temporal Lobe Epilepsy Epilepsy is a debilitating neurological disorder that affects millions worldwide. Even with severe surgical interventions like hippocampal resection and administration of several antiepileptic drugs, a third of the population affected continues to have seizures. Not only are such therapies costly, they also lend patients susceptible to serious side effects and cognitive impairments. Gene delivered neuropeptides provide a much less invasive alternative to resective surgery as well as a solution to drug resistance. Somatostatin (SST) is an endogenous neuropeptide, and has many functions in the central nervous system. A growing body of evidence now supports the general conclusion that the presence of SST inhibits or reduces seizure severity and its absence makes seizures worse. Gene therapy therefore provides a promising alternative to treating intractable epilepsy. We packaged the preprosomatostatin gene into serotype 5 of the adeno-associated viral (AAV) vector and delivered it directly into the rat dentate gyrus and CA1 sub-regions of the hippocampus. The efficacy of this gene therapy was assessed in an electrically kindled animal model of limbic epilepsy by monitoring behavioral responses 11 as well as EEG dynamics. All animals over-expressing SST had a higher threshold to generalized seizures, and seventy percent did not have a single grade 5 (generalized) seizure after 30 electrical stimulations. We also tested learning and memory impairments, which are common co-morbidities associated with epilepsy, using the Morris water maze. Finally, electrophysiological techniques were used to try and unravel the physiological basis for observed behavioral changes between control and gene injected animals.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rabia Zafar.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Carney, Paul R.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042433:00001


This item has the following downloads:


Full Text

PAGE 1

1 ADENO ASSOCIATED VIRAL VEC TOR DELIVERED SOMATO STATIN AS A CANDIDATE FOR GENE T HERAPY FOR TEMPORAL LOBE EPILEPSY By RABIA ZAFAR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULF ILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Rabia Zafar

PAGE 3

3 To Papa, Mama, Saira and Sadia

PAGE 4

4 ACKNOWLEDGMENTS The journey that has led me to this point in my life has not been easy, and there have been a multitude of people who I owe sincere gratitude to. First and foremost, I want to thank my parents, Drs. Zafar Iqbal and Nasim Zafar for their unconditional love n them than they were on me. I would also like to thank my sisters Saira and Sadia, who have always been one phone call away when I needed them, and who have always been role models. Many thanks to all the collaborators who have helped me shape my project and learn the many techniques that I have become proficient in over the last 5 years. Special thanks to my mentor Dr. Paul Carney, who gave me the opportunity to do science the way it should be done with the freedom to ask questions that interested me an d the resources to find answers. My gratitude also goes to Dr. William Ogle, Dr. Jason Frazier and Dr. Michael King for serving on my committee. Special thanks go to Dr. King for the many hours he has spent listening to my idle banter and giving me directi on. I would also like to thank Dr. Kevin Foust, Dr. Arun Srivastava and Dr. Jayandharan G. Rao for their help and guidance with my first attempt at cloning. I am also thankful to Dr. Alex Cadotte for his help with statistical analysis. I am eternally grate ful to all the wonderful friends I have made through graduate school, especially Ekta Patel who has lent me her shoulder many a times. My deepest gratitude also goes to my lab mates, who at the end of these five years have become very close friends, and th e best group of people I could ever hope to work with. Thank you Mansi for always being by my side, literally and figuratively. Without your ears and thoughtful advice, I would be so lost in graduate school. Thank you Stephen for being

PAGE 5

5 my partner in crime everything. Thank you Svetlana for being the radiant person you are, and bringing so much humor into my life. Most importantly, thank you Frank for always being such a source of comfort and s upport. My experience in graduate school would definitely not have been this smooth had it not been for the unfaltering advice of Dr. Sue Semple Rowland, who took it upon herself to see us all succeed. I also thank BJ Streetman, who always brought order to my chaos.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 12 Epilepsy ................................ ................................ ................................ .................. 12 Temporal Lobe Epilepsy ................................ ................................ ................... 14 Limbic anatomy ................................ ................................ .......................... 15 Animal models ................................ ................................ ........................... 17 Gene Therapy ................................ ................................ ................................ ......... 22 Pharmacology of Neuropeptides ................................ ................................ ............. 25 2 EXPERIMENTAL METHODS ................................ ................................ ................. 29 Surgical Implantation of Electrodes ................................ ................................ ........ 29 Gene Injection ................................ ................................ ................................ ......... 30 Kindling Pr otocol ................................ ................................ ................................ ..... 30 Histology ................................ ................................ ................................ ................. 31 Somatostatin Immunohistochemistry ................................ ................................ 32 Glia l Fibrillary Acidic Protein (GFAP) Immunohistochemistry ........................... 32 Microglial Immunohistochemistry ................................ ................................ ..... 33 Fluorojade C Staining ................................ ................................ ....................... 33 Cresyl Violet Staining ................................ ................................ ....................... 33 Microscopy ................................ ................................ ................................ .............. 33 Behavioral Testing Using the Morr is Water Maze ................................ ................... 34 Statistical Analysis ................................ ................................ ................................ .. 35 3 PREPARATION OF VIRAL VECTORS ................................ ................................ ... 38 Background ................................ ................................ ................................ ............. 38 Methods ................................ ................................ ................................ .................. 39 Cloning ................................ ................................ ................................ ............. 39 AAV CBa GFP ................................ ................................ ........................... 39 AAV CBa SST ................................ ................................ ........................... 40 AAV CBa SST GFP ................................ ................................ ................... 40 Viral Vector Packaging ................................ ................................ ..................... 41 Results ................................ ................................ ................................ .................... 44

PAGE 7

7 AAV CBa GFP ................................ ................................ ................................ 44 AAV CBa SST ................................ ................................ ................................ .. 44 AAV CBa SST GFP ................................ ................................ ......................... 44 Discussion ................................ ................................ ................................ .............. 45 4 EFFECTS OF SOMATOSTATIN OVER EXPRESSION IN VIVO .......................... 55 Background ................................ ................................ ................................ ............. 55 Results ................................ ................................ ................................ .................... 57 Discussion ................................ ................................ ................................ .............. 59 5 IN VITRO ASSESSMENT OF SPONTANEOUS POST SYNAPTIC EVENTS ACROSS ANIMAL GROUPS ................................ ................................ .................. 7 1 Background ................................ ................................ ................................ ............. 71 Methods ................................ ................................ ................................ .................. 72 Slice Preparation ................................ ................................ .............................. 72 Solutions and Drugs ................................ ................................ ......................... 72 External solution ................................ ................................ ........................ 72 Internal solution ................................ ................................ .......................... 73 Drugs ................................ ................................ ................................ ......... 73 Electrophysiological Recordings ................................ ................................ ....... 73 Data Analysis ................................ ................................ ................................ ... 74 Results ................................ ................................ ................................ .................... 74 Discussion ................................ ................................ ................................ .............. 76 6 CONCLUSIONS ................................ ................................ ................................ ..... 81 Findings and Future Directions ................................ ................................ ............... 81 Highlights in Epileps y Research How Far We Have Come ................................ .. 83 The Future of Gene Therapy ................................ ................................ .................. 86 SST in the CNS ................................ ................................ ................................ ...... 88 APPENDIX: SEQUENCE OF PREPROSOMATOSTATIN ................................ ........... 91 LIST OF REFERENCES ................................ ................................ ............................... 94 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 108

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Production of active forms of SST through alternate cleavage of its precursors ................................ ................................ ................................ ........... 28 2 1 Ground/reference electrode (top) and bipolar twist electrode (bottom) ............... 36 2 2 Stereotactic surgery for electrode implantation in a rodent ................................ 37 3 1 Plasmid map for pCBa GFP (UF 11) ................................ ................................ .. 48 3 2 Plasmid map for AAV CBa SST ................................ ................................ ......... 49 3 3 Temporal expressio n of GFP using AAV. ................................ ........................... 50 3 4 Histological analysis of SST in nave (A), AAV SST injected (B), and uninjected control (C) animals ................................ ................................ ............ 51 3 5 Transfection of HeLa cells with AAV CMV SST GFP. ................................ ........ 52 3 6 Transfection of HeLa cells with AAV CBa SST GFP ................................ .......... 53 3 7 Histologica l verification of the AAV SST GFP vector. ................................ ......... 54 4 1 Percentage of animals fully kindled to spontaneous recurrent seizures in each treatment group ................................ ................................ ......................... 65 4 2 Trajectory of Seizure Quantification Index (SQI) calculated for all animal groups ................................ ................................ ................................ ................ 66 4 3 Average duration of afterdischarges per seizure in each treatment group ......... 67 4 4 Assessment of neurodegeneration in the dentate gyrus as a result of electrical kindling using FJC/DAPI staining ................................ ........................ 68 4 5 Analysis of inflammation in control and AAV SST injected animals .................... 69 4 6 Analysis of behavioral effects using the Morris water maze ............................... 70 5 1 F requency and amplitude of sEPSCs ................................ ................................ 79 5 2 Frequency and amplitude of sIPSCs ................................ ................................ .. 80

PAGE 9

9 LIST OF ABBREVIATION S AAV Adeno associated virus ACSF Artificial cerebral spinal fluid AD Afterdischarge AED Anti epileptic drug AMPA amino 3 hydroxyl 5 methyl 4 isoxazole propionate APV (2R) amino 5 phosphonovaleric acid CNS Central nervous system DG Dentate gyrus DNQX 6,7 dinitroquinoxaline 2,3 dione EEG Electroencephalography GFP Green fluorescent protein IP Intraperitoneal ITR Inve rted terminal repeat LTLE Lateral temporal lobe epilepsy LTP Long term potentiation MTLE Mesial temporal lobe epilepsy NMDA N methyl D aspartic acid NPY Neuropeptide Y PTX Picrotoxin sEPSC Spontaneous excitatory post synaptic current sIPSC Spontaneous inhi bitory post synaptic current SQ Subcutaneous SST Somatostatin TLE Temporal lobe epilepsy

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Do ctor of Philosophy ADENO ASSOCIATED VIRAL VEC TOR DELIVERED SOMATO STATIN AS A CANDIDATE FOR GENE T HERAPY FOR TEMPORAL LOBE EPILEPSY By Rabia Zafar December 2010 Chair: Paul Richard Carney Major: Medical Sciences Neuroscience Epilepsy is a debilitati ng neurological disorder that affects millions worldwide. Even with severe surgical interventions like hippocampal resection and administration of several antiepileptic drugs, a third of the population affected continues to have seizures. Not only are suc h therapies costly, they also lend patients susceptible to serious side effects and cognitive impairments. Gene delivered neuropeptides provide a much less invasive alternative to resective surgery as well as a solution to drug resistance. Somatostatin (SS T) is an endogenous neuropeptide, and has many functions in the central nervous system. A growing body of evidence now supports the general conclusion that the presence of SST inhibits or reduces seizure severity and its absence makes seizures worse. Gen e therapy therefore provides a promising alternative to treating intractable epilepsy. We packaged the preprosomatostatin gene into serotype 5 of the adeno associated viral (AAV) vector and delivered it directly into the rat dentate gyrus and CA1 sub regio ns of the hippocampus. The efficacy of this gene therapy was assessed in an electrically kindled animal model of limbic epilepsy by monitoring behavioral responses

PAGE 11

11 as well as EEG dynamics. All animals over expressing SST had a higher threshold to generaliz ed seizures, and seventy percent did not have a single grade 5 (generalized) seizure after 30 electrical stimulations. We also tested learning and memory impairments, which are common co morbidities associated with epilepsy, using the Morris water maze. Fi nally, electrophysiological techniques were used to try and unravel the physiological basis for observed behavioral changes between control and gene injected animals.

PAGE 12

12 CHAPTER 1 INTRODUCTION Epilepsy Epilepsy is a disorder of diverse etiologies, with over forty different types defined on the basis of location or distribution and cause (http://www.epilepsyfoundation.org/) Although the disorder can be classified as a syndrome with divergent symptoms, the hallmark of all seizures remains aberrant electrical activity in the brain that results in the onset of recurren t, spontaneous seizures (Bennewitz and Saltzman 2009, Sashindranath, et al. 2010) Epilepsy is one of the most common neurological conditions, with over 50 million people affected worldwide, and a prevalence rate of 1 per 118 in the United States ( http://www.wrongdiagnosis.com/e/epilepsy/stats.htm) Most epileptic seizures can be characterized as partial, or generalized, depending on the localization and distribution of excitatory activity in the brain (Bancaud, et al. 1981) Partial or focal seizures may be triggered within a small focus of the brain, and later spread in a proce ss known as secondary generalization. Generalized seizures may range from absence seizures (petit mal) to tonic clonic (grand mal) seizures, all involving the loss of consciousness. The etiology of epilepsy is very diverse. Mutations in several genes inclu ding those coding for proteins in voltage gated and ligand gated channels have been implicated in the induction of generalized seizures (Meisler and Kearney 2005, Turnbull, et al. 2005) Additionally, childhood bra in trauma, prolonged febrile activity (Crompton, et al. 2010) or infection (Akins, et al. 2010, Jequier Gygax, et al. 2010) may also lead to epilepsy later on in life. Although the causes of epilepsy can be divergent as menti oned above, the basic manifestation of the disease is an offset in the balance between excitation and inhibition

PAGE 13

13 in the brain which leads to altered synchronization and firing patterns of neurons. Although epilepsy may be controlled to an extent, 30% of pa tients suffering seizures remain refractory to currently available therapies including anti epileptic drugs (AEDs), the vagus nerve stimulator (VNS), ketogenic diet, and in extreme cases, surgical resection of the epileptic focus (Noe, et al. 2009, Strom, et al. 2010) The focus of our lab is expanding our knowledge of a specific type of epilepsy known as Temporal Lobe Epilepsy (TLE). TLE is the most common type of the partial epilepsies, and also the most intract able (Cascino 2009) Experiment s in our lab cover the entire spectrum of the disorder, from trying to understand the underlying cause of seizures to devising alternative treatment strategies for intractable epilepsy. The specific scope of this dissertation is to describe the neuroprotec tive effects of the neuropeptide somatostatin (SST) when delivered into highly epileptogenic regions of the brain using the adeno associated viral (AAV) vector. To this effect, we have described the cloning of three viral vectors that were used in this stu dy to assess neuronal tropism and transduction efficiency using pseudotype 5 of the AAV vector in Chapter 3. Chapter 4 discusses the behavioral outcomes of over expressing somatostatin in vivo in electrically kindled rats, while also assessing the issue of cognitive impairment, which is a common co morbidity in patients suffering from temporal lobe epilepsy (Chiu, et al. 2010, Jansari, et al. 2010) Possible cellular changes underlying the differences observed acros s animal groups in vivo were discussed in Chapter 5, which delves into preliminary electrophysiological experiments performed on brain slices of animals from control and SST over expressing groups.

PAGE 14

14 The following subsections of this chapter give a more tho rough understanding of the disease, the choice of animal model utilized to assess the efficacy of this gene therapy, as well as a fundamental understanding of what gene therapy entails including state of the art findings. Temporal Lobe Epilepsy Temporal Lobe Epilepsy is the single most common form of partial epilepsy causing intractable seizures TLE is further divided into Lateral Temporal Lobe Epilepsy (LTLE) involving the more lateral structures of the temporal lobe, e.g. the neocortex at the onset of seizures, and Mesial Temporal Lobe Epilepsy (MTLE), with seizures arising from midline structures of the temporal lobe, e.g. the hippocampus, amygdala or parahippocampal gyrus. MTLE, the more common of the two, is poorly controlled with pharmacological int ervention and surgical treatment is often necessitated by the nature of these complex partial seizures. Co morbidities like learning impairment and memory loss are often associated with TLE since the hippocampus is also the seat of memory formation (Cascino 2009) The hallmark pathology of the underlying epileptogenic zone in MTLE is mesial temporal sclerosis (Cascino 2008) which is defined as partial loss of neurons in the CA1 as well as the dentate hilus in addition to granule cell dispersion and glial activation (Sloviter 2008) The initial response to medication is of prognostic importance and will, in most cases, be paramount to predicting a seizure free status for the patient (Hauser 1992) Patients experiencing developmental delay, foreign tissue lesions or remote symptomatic neurological diseases will seldom at tain a seizure free status. The fundamental goal of using anti epileptic drugs is to achieve this seizure free status without drug toxicity. The past decade has witnessed the FDA approval of a number of

PAGE 15

15 new AEDs including gabapentin (1993), lamotrigine (19 94), tiagabine (1997), topiramate (1996), oxcarbazepine (1999), levetiracetam (1999) and zonisamide (2000). Although these additions to the older generation AEDs have offered seizure control with fewer side effects to some patients, they have not had a ma jor impact on the overall number of patients who achieve seizure free status. Approximately 400,000 of the 2 million individuals with partial epilepsy in the United States have a medically refractory partial seizure disorder (Hauser 1990) Despite the development of newer AEDs, almost 50% of these patients will not attain seizure remission with pharmacological intervention (Kwan and Brodie 2003) The need for alternative therapies therefore stems from the inability to manage intractable partial seizure disorders, especially for cases that are not surgic ally remediable. Limbic anatomy Hippocampus. A more thorough understanding of hippocampal cytoarchitecture is important to gain an understanding of which structures are primarily responsible for the generation of seizures in MTLE and how they are connecte d. It will also serve to illustrate why we chose the amygdala as the focus of seizure induction, and how this structure communicates with the hippocampus, sub regions of which we chose to inject have been used interchangeably in the scientific community. The hippocampus is considered one of the many related regions of the brain that constitute the hippocampal formation. The hippocampus proper is defined as having three subdivisions: the CA3, CA2 and CA1 (Amaral and Lavenex 2007) (De Garengeot 1742) The hippocampal formation includes

PAGE 16

16 neighboring structures as well, like the dentate gyrus, the subiculum, presubiculum, parasubic ulum, and entorhinal cortex. The dentate gyrus and CA subfields form two interlocking C shaped structures, with a predominantly unidirectional flow of information. C A sub regions (Andersen, et al. 1969) I nformation comes into the dentate gyrus from the entorhinal cortex through the perforant pathway. The second part of this loop is through mossy fibers, which are axons of dentate granule cells that synapse on CA3 pyramidal cells. The last part of this loo p is the connection between CA3 and CA1 pyramidal cells through the Schaffer collaterals. It is now also known that there are direct connections to the CA3 and CA1 regions from the entorhinal cortex. Stimulation of many of these fiber bundles including the perforant pathway (Orban, et al. Sloviter 1987) and Schaffer collaterals (Ghijsen, et al. 2007, Salmani, et al.) has been used extensively in animal models to evoke seiz ures both in vivo and in vitro with robust, reproducible results. Amygdala. The amygdalae are almond shaped nuclei embedded in the medial aspect of the temporal lobes. The primary role of the amygdala is to process and recall emotional reactions. The amyg daloid complex is comprised of several nuclei: the basolateral complex, which is further subdivided into the lateral, basal and accessory basal nuclei; the centromedial nucleus and the cortical nucleus (Amunts, et a l. 2005, Solano Castiella, et al. 2010) The amygdala has strong efferent connections to the entorhinal cortex (Amunts, et al. 2005) The majority of these connections stem from the lateral, basal and accessory ba sal nuclei to layer III of the entorhinal cortex, which in turn projects to the stratum lacunosum moleculare of CA1 (Steward and Scoville 1976)

PAGE 17

17 Tract tra cer studies in rats have shown that in addition to the entorhinal cortex, a few of these projections also terminate in a narrow zone between the CA1 and subiculum (Krettek and Price 1977) In MTLE, the ep ileptic focus often resides in the amygdala, in addition to the hippocampus. In some cases, amygdalectomy alone is sufficient to eliminate seizures (Aroniadou Anderjaska, et al. 2008) Animal studies have suggested that the amygdala is even more prone to seizure activity than the hippocampus (Goddard 1967, Racine et al. 1988) Therefore, kindling develops at a faster rate in the amygdala and interictal discharges tend to originate from the amygdala/piriform cortex irrespective of the site of kindling (Kairiss, et al. 1984 Racine, et al. 1988) The basolateral nucleus in particular plays the most fundamental role in the initiation and spread of seizures, even if seizures are initiated in extra amygdaloid regions (Aroniadou Anderjaska, et al. 2008) Additionally, pathological alterations are seen most often within the basal and lateral nuclei of the amygdala. Like the d entate hilus, SST positive interneuronal populations are also particularly sensitive to seizure induced damage in the amygdala. Somatostatin containing neurons here exhibit calbindin, but no calretinin or parvalbumin (McDonald and Mascagni 2002) and how this differential expression of calcium binding proteins affe cts the amygdala circuitry during epileptogenesis is yet to be determined. It is due to such extensive involvement of the amygdala in the generation and maintenance of epileptic seizures that we chose the amygdala as the site of electrical stimulation to i nduce seizures in our experimental model. Animal models A number of animal models have been suggested and are in use for studying TLE to get a better understanding of the underlying pathophysiology and progression of the

PAGE 18

18 disease. The generation of such ro bust, translational models becomes imperative not only to further our understanding of the changes occurring in the brain during epileptogenesis but also to potentially lead to novel effective therapies. Epileptogenesis is the process by which a normal br ain undergoes structural and functional changes to ultimately develop epilepsy after an initial insult. The choice of both animal species and modality of seizure induction depends on the type of epilepsy desired to be developed and studied. Rodents have b een one of the most common models of choice for developing seizures. They are the lowest phylogenetic species that have brain tissue sufficiently similar to humans for these experiments. The rat provides a very useful animal model to develop a variety of e xperimental approaches and to provide a first stage evaluation of their merit. In addition, there is a wealth of accumulated data on the neuroanatomy, pathology and immunology of the rat relevant to the objectives of the study we are undertaking Furthermo re, elicitation of seizures through chemical and electrical means in rodents reflects behavioral and electroencephalographic characteristics of human seizures. The scientific community as a whole has gathered a wealth of information about the underlying me chanisms of epilepsy, epileptogenesis and therapeutics through the use of animal models. The utility of animal models, however, is to be taken with a grain of salt since they require rigorous validation. This validation is more complex than a simple verifi cation of how similar the model is to the human condition. Additionally, there are questions of scaling up from small animal models to non human primates to humans, a progression crucial to the translation of these findings to human disease.

PAGE 19

19 Kindling One phenomenon discovered through animal experimentation is that repeated low level electrical stimulation to some brain sites can lead to permanent incr eases in seizure susceptibility in other words, a permanent decrease in seizure threshold. This phenomen on known as kindling was first discovered by Dr. Graham Goddard in 1967 (Goddard 1967) Kindling involves the progressive intensification of both electrographic and behavioral seizures as a result of daily, low intensity electrical or chemical stimulation to a par ticular structure of the brain that ma nifests a permanent progressive functional reorganization of the neuronal network Characterized almost 40 years ago, kindling has become a well established model to study epileptogenesis and the mechanisms that maintain an epileptic state. The electrical kindling model requires the surgical implantation of electrodes stereotactically in a specific brain area like the hippocampus or amygdala, which is a rapidly kindling limbic structure, and then stimulating the region by passing a low intensity current th rough it and electrographic seizures increase both in duration and complexity. Additionally, there is an orderly progression from mild to severe behavioral seizure activity with successive stimulations. Rat will reliably trigger a motor seizure characterized as grade 5 on the Racine Scale, involving rearing and falling over of the animal (Racine 1972) Most kindling paradigms consider elicitation of 3 consecuti ve grade 5 seizures as the endpoint. The mechanisms that lead to the increased susceptibility towards electrical stimulation are many, and it is difficult to attribute these changes to a single structure. It is the harmonious changes in a number of structu res and molecular cascades that

PAGE 20

20 render the neuronal network able to produce and maintain an epileptic state. Neuronal systems within the brain are particularly sensitive to inhibitory tone, and the concept of disinhibition therefore becomes an attractive m echanism through which an epileptic state may develop during kindling. High frequency electrical stimulation delivered to limbic sites produces a concurrent increase in glutamate and GABA release into the synaptic clefts from presynaptic terminals ( Morimoto, et al. 2004) Glutamate then activates post synaptic AMPA receptors, but this depolarization is immediately antagonized by GABA A mediated recurrent inhibition. If the stimulus intensity is sufficiently above threshold, inhibition failure occurs with continuous AMPA receptor activation, which results in burst firing and synchronization which manifests as the onset of afterdischarges (AD) on EEG. The prolonged depolarization also activates NMDA receptors, which mediates calcium influx in a voltage dependent manner (Morimoto, et al. 2004) The activation of both AMPA and NMDA receptors ultimately leads to the reorganization of glutamate and GABA systems. These changes are both activity dependent and compensatory and may not be directly relate d to epileptogenesis. In the early stages of kindling, NMDA receptor dependent potentiation develops in multiple brain regions, thus promoting and amplifying focal ADs to more distal brain sites (Morimoto, et al. 2004) During kindling, the dentate gyrus becomes a substrate for enhancement of NMDA mediated currents. The hippocampal CA1 sub region and amygdala experience the highest failure of GABA mediated inhibition, while recurrent inhibition strengthens in the dentate gyrus and some parts of the piriform cortex, likely as compensatory mechanisms (Morimoto, et al. 2004) Late stages of kindling

PAGE 21

21 encompassing generalized seizures experience more morphological changes like neurogenesis, synaptogenesis, axonal sprouting and astroglial activatio n. As with electrical kindling, chemical kindling can also evoke repetitive epileptic spikes (an afterdischarge, or AD), gradually increasing the duration of these spikes and permanently increasing seizure susceptibility. Various agents with diverse pharm acological profiles have been used to induce such chemical kindling, a few of those being carbachol (Saucier and Cain 1996) pentylenetetrazole (Ma ciejak, et al. 2010, Mehla, et al. 2010) and bicuculline (Bertram, et al. 2008) The disparate nature of all these stimul ating agents suggests that the underlying mechanism for kindling is the repeated occurrence of ADs, or episodes of network synchronization. After a period of acquisition, the responses to stimulation are quite stable for each animal over a number of mont hs. The two measures of seizure activity in the kindling model are: 1) spread to other regions of the brain as measured by an increase in seizure grade as scored on the Racine scale, and 2) length of seizure activity as measured by the duration of afterdis charges on EEG. Kindling has been extensively studied and employed as a model of temporal lobe epilepsy, yet its relevance to human epilepsy is still debated. It is well established that kindling leads to a predictable sequence of evolving cellular and mol ecular alterations in neural circuits, but the slow progression to spontaneous seizures limits its credibility as a clinical model. Nonetheless, the ability of obtaining the kindled response in multiple species, from amphibians to primates, underscores its clinical relevance. As a chronic model, kindling has broadened our understanding of how repeated brief seizures affect the brain. It has also been very useful for learning about circuits in that seizures can be induced by a

PAGE 22

22 highly focal stimulation Conse quently, the pattern of initiation and the spread throughout the brain can be readily examined. It also offers a tool to evaluate the initiating circuitry as it allows precise selection of the site of stimulation and seizure initiation (Bertram 2007) Gene Therap y Gene delivered neuropeptides provide a novel approach to treating patients who are either pharmacoresistant to AEDs or are not candidates for epilepsy surgery. Appropriate gene replacement may enhance or faci litate restoration of limbic network properties through fundamental neuromodulation of a hyperexcitable limbic system. Targeted, cell specific delivery of therapeutic agents into the brain can be achieved using vectors like adeno associated viral (AAV) vec tors that can deliver the gene of interest into the central nervous system (CNS) with minimum toxicity. Viral vectors, in addition to other methods of in vivo gene transfer, are novel tools for studying gene function in the mammalian central nervous syst em. Furthermore, such approaches can induce expression of therapeutic molecules that provide potential alternatives for treating nervous system disorders. Neurotropic viral vectors can express single or multiple foreign genes and can be engineered at sever al levels to induce long lasting, highly specific gene transfer. Many viral vectors like adenoviruses (Doloff and Waxman 2010, Wilmott, et al. 1994) herpes simplex virus (Manservigi, et al. 2010) and lentiviruses (Dreyer 2010) are currently in use for gene therapy. The use of adeno associated viral vecto rs appears to have several advantages over the use of other vectors. AAV vectors are most importantly nonpathogenic, and are capable of infecting many different cell types in a wide variety of host organisms. They lack the machinery for viral replication a nd hence, infection is limited to the site of injection. Additionally,

PAGE 23

23 they have a high efficiency of infection and minimal induction of host immune and inflammatory responses (Janson, et al. 2001, Mori, et al. 2004 ) As of 2006, there have been 11 naturally occurring AAV serotypes described, based on distinct variations between subspecies. A serotype is a classification at the subspecies level due to characteristics that differentiate between two members of the sam e species. These characteristics can be differences in cell surface antigens, virulence or phages. Of the AAV serotypes, serotype 2 is the most excessively studied (Choi, et al. 2005b) However, it has also been shown that ot her serotypes can be more effective as gene delivery vectors. For instance, AAV6 seems to be more efficient in infecting airway epithelial cells, while AAV7 presents a very high transduction rate of murine skeletal muscle cells similar to AAV1 and AAV5, bo th of which are also very efficient in gene delivery to vascular endothelial cells (Chen, et al. 2005, Flotte and Berns 2005a, Halbert, et al. 2001, Rabinowitz, et al. 2004) AAV5 has also demonstrated a larger dis tribution and higher number of neurons transduced than AAV2 in the central nervous system (Sun, et al. 2007) which is why we employed the use of AAV5 in our study to express SST in portions of the hippocampal formation of rats. Additionally, approximately 80% of the population has had prior exposure to AAV2, which incurs the presence of antibodies to this pseudotype of AAV whereas there are no such known complications with the use of AAV5. AAV5 was originally isolated from a human clinical sample (Bantel Schaal and zur Hausen 1984, Rutledge, et al. 1998) and contains inverted t erminal repeats (ITRs) that are structurally analogous to AAV2, but are only 58% identical at the sequence level (Chiorini, et al. 1999) AAV5 is the most divergent of the AAV serotypes (Chiorini, et al.

PAGE 24

24 1999) Its rep nucleotide sequence is 67% identical to AAV2 rep while the cap sequence is only 56% identical to AAV2 cap Prior to gene expression, AAV goes through a series of steps to attain transduction (Choi, et al. 2005b) These include binding or attachment to surface receptors. AAV5 specifically binds to t he platelet derived growth factor receptor. This is followed by endocytosis and trafficking to the nucleus of the host cell where the virus un coats to release the genome. The final step involves conversion of the genome from single stranded to double stra nded DNA which A number of clinical trials are currently underway using different serotypes of AAV for cystic fibrosis (Flotte 2005) hemophilia (Wang and Herzog 2005) disease (Kaplitt, et al. 2007, Mandel and Burger 2004) (Mandel 2010) to name a few. There are promising pre clinical trials underway for epilepsy as well using galanin and neuropeptide Y (NPY) (Noe, et al. 2007, Richichi, et al. 2004, Schlifke, et al. 2006) NPY and galanin are neuropeptides present in the CNS and both are known to have antiepil eptic properties, as shown by their direct application to the CNS, or through use of their analogs. It is generally accepted that both these neuropeptides suppress epileptic seizures by antagonizing excitatory neurotransmission and hyperpolarizing neurons (Colmers, et al. 1985, Schlifke, et al. 2006, Sorensen, et al. 2009) However, little is known about the specific mechanisms of either of these neuropeptides. SST and NPY are extensively co localized (Kohler, et al. 1987, Mikkelsen and Woldbye 2006, Noe, et al. 2007, Sloviter and Nilaver 1987) and results from studies on NPY therefore provide clues about the potential mechanism of action for SST. SST was the focus of our stu dy because of the extensive in vitro data available

PAGE 25

25 including precise knowledge about its receptors and corresponding pharmacological analogs (Csaba, et al. 2005, Csaba, et al. 2004, Qiu, et al. 2008) Somatostatin acts through a family of 5 G protein couples receptors, each of which have been thoroughly characterized. It has also been identified that SST receptor subtype 2 is specifically dominant in rats, and it is through this receptor that most of the neuroprote ctive functions are carried out (Tallent and Qiu 2008) There is a relative sparing of dentate granule cells despite the loss of SST somatostatinergic interneurons in the hilus after electrical stimulation (Richichi, et al. 2004) Axons of hilar SST positive interneurons synapse on distal dendrites of granule cells in the outer molecular layer (Amaral, et al. 1988, Csaba, et al. 2004) which may present a target for exogenously applied SST in the electrically kindled animals. Several other studies h ave addressed the changes in spontaneous and evoked neuronal activity that occurs as a result of loss of somatostatinergic neurons in vitro (Gavrilovici, et al. 2006, Shoji, et al. 1998, Stief, et al. 2007, Tallent and Qiu 2008) Based on such findings, it is imperative that the role of SST be further investigated in a pre clinical setting, and our in vivo study is translationally relevant to the development of SST as a novel therapeutic agent for patients. Pharmac ology of Neuropeptides Neuropeptides are small molecules similar to proteins that are used as signaling molecules within the CNS. The presence of a specific neuropeptide confers a biochemical phenotype to the particular neuron that expresses it. Currently there are approximately 100 different neuropeptides identified, each released by different neuronal populations within the mammalian brain (http://www.neuropeptides.nl/) For the scope of this dissertation, we will focus on neuropeptides found within interneurons.

PAGE 26

26 A number of neuropeptides co localize with the classical interneurona l neurotransmitter GABA. However, these neuropeptides differ in their size, synthesis, and release pattern when compared to GABA. Most neuropeptides are confined to dense core vesicles as opposed to synaptic vesicles, and are released at a slower rate (<50 ms) for a sustained duration (Baraban and Tallent 2004) Additionally, contrary to synaptic vesicles that are released at axon terminals, dense core vesicles are released at more diverse locations like dendrites and axons (Ludwig and Pittman 2003) The release of neuropeptides from these dense core vesicles is a Ca 2+ dependent process (Kits and Mansvelder 2000) and their physical distan ce from Ca 2+ channels may be why neuropeptide release requires a higher level of activity than neurotransmitter release. The list of neuropeptides expressed by interneurons is by no means short, yet NPY, SST, galanin and opioid peptides like dynorphin A 1 13 are of special importance due to their abundance within the hippocampus (Mazarati and Wasterlain 2002) There is much evidence for modulation of excitatory synaptic transmission by t hese neuropeptides within the hippocampus by antagonizing pre synaptic glutamate release (Cherubini and North 1985, Tallent and Siggins 1997, Whittaker, et al. 1999) which subsequently also has inhibitory effects on the generation of long term potentiation (LTP). Evidence for modulation of GABA mediated synaptic transmission is sparse; nonetheless, such activity does occur and fits with the overall mechanism of neuropeptide mediated modulation of neurotransmitter r elease. For example, SST in the subiculum has been shown to reduce inhibitory post synaptic potentials (IPSPs) (Greene and Mason 1996)

PAGE 27

27 Amongst the numerous interneuronal neuropeptides, SST is the most well studied and well characterized in its effects on post synaptic neuronal excitability. The two act ive forms of SST are SST 14 and SST 28, which are produced through alternate cleavage of the preprosomatostatin precursor (Fig 1 1) (Bowen 2002) the full sequence for w hich has been provided in the appendix. The specific effects of SST on CA1 and CA3 firing properties are described in Chapter 4. Like other neuropeptides in the dentate gyrus, SST is also involved in learning and memory. Deficits in spatial learning and me mory have been observed in studies utilizing knockout mice models. It is speculated that SST may facilitate acquisition of spatial maps by filtering out to (Tallent 2007) SST is also memory loss show a reduction in the levels of cortical SST (Davies, et al. 1980, Davis, et al. 1999) The role of neuropeptides in epilepsy becomes apparent when considering their antagonistic effects towards excitatory activity within the brain. Additionally, neuropeptide release from interneurons is a sequel to high fre quency stimulation, similar to seizure like activity. Given that seizures induce changes in neuronal populations expressing these neuropeptides, as well as mRNA and peptide expression, it only follows that this endogenous anti epileptic system be studied m ore in depth to understand the precise mode of action for full exploitation of alternative therapeutic agents for temporal lobe epilepsy.

PAGE 28

28 Figure 1 1. Production of active forms of SST through alternate cleavage of its precursors. SST 14 and SST 28 are produced by cleavage of prosomatostatin, which is derived from preprosomatostatin.

PAGE 29

29 CHAPTER 2 EXPERIMENTAL METHODS Surgical Implantation of Electrodes All animal procedures were approved by the University of Florida I nstitutional Animal Care and Use Com mittee (I ACUC ) and conformed to animal welfare guidelines issued by the National Institutes of Health. Male Sprague Dawley rats (Harlan) weighing 225 250g were pre medicated with xylazine (10 mg/kg, SQ) and anesthesia induced with 4% isoflurane in 1 L/min oxygen. Anesthesia was maintained at 1.5% isoflurane and 0.4 L/min oxygen while placed in a Kopf stereotaxic frame. The surgical surface was sterilized using three alternate scrubs of 70% alcohol and Prepodyne. A midline incision was made to expose the lan dmarks bregma a nd lambda on the skull surface after loosening the muscle and underlying periosteum. The surface of the skull was then wiped with 3% hydrogen peroxide. Holes for screws were drilled using a rotary drill bit, and a dremmel used to punch holes in the skull for electrode implantation. Care was taken to not puncture through the brain. Bipolar teflon coated stainless steel electrodes 330 m in diameter (Figure 2 1) were implanted bilaterally in either amygdala specifically in the basolateral nucl ei of the amygdala ( 2.2 mm behind Bregma, 5 mm lateral to midline, and 8.3 mm ventral from dura). Two screw electrodes were placed, one rostral to bregma and the other caudal to lambda to serve as ground and reference respectively. All electrodes were attached to male Amphenol pins and secured to the skull with two each placed on either side of the midline suture and coated with dental acrylic (Figure 2 2). The rats were allocated to three groups; Group 1 being uninjected controls, Gro up 2 being AAV SST injected and Group 3 AAV GFP

PAGE 30

30 injected All rats were allowed to recover for 1 3 weeks post surgery before further experimentation was initiated. Gene Injection A 10 l Hamilton syringe fitted with a 27G st eel needle with an internal diameter of ~ 200 m and attached to an infusion pump was used for injecting all vector s The plunger on the Hamilton syringe was depressed using two 10 ml airtight water filled syringes connected by a hose. One of the 10 ml syr inges was clamped into the infusion pump, while the other 10 ml syringe was hoisted on the stereotax arm above the Hamilton syringe so the two plungers just touched. Depressing the plunger on the 10 ml syringe placed on the pump caused the plunger on the o ther to pull out, thereby depressing the plunger on the Hamilton syringe. Two l of the vector was infused bilaterally into each dentate gyrus (DG) and CA1 sub region of the hippocampus at the rate of 0.5 l /min for a total of 8 l of vector in each animal ( 3 72 mm behind Bregma, 2.2 mm lateral to midline, and 3.4 mm ventral from dura for the DG, and 2.4 mm ventral from dura for CA1). The needle was kept in place for 5 additional minutes after cessation of injection to allow for complete distribution of the vector. The needle was then slowly retracted after each injection and flushed with hydrogen peroxide followed by de ionized water. E lectrode implantation proceeded as normal after cessation of the fourth injection Kindling Protocol One to three week s after surgery, an afterdischarge threshold was determined for each animal using a 2 s, 50 Hz biphasic square wave. An afterdischarge is described as spikes with a frequency greater than or equal to 1 Hz and an amplitude at least twice greater than the pr e stimulation baseline present in the EEG recorded from the site of

PAGE 31

31 stimulation. The current intensity used for kindling acquisition was the minimum current necessary to evoke an afterdischarge on the EEG for each animal (238 +/ 124 A). Beginning 24 hou r s post threshold determination, the rats were stimulated twice daily, with at least 6 hours separating stimulations. The protocol produced cons istent Racine grade 5 seizures in all age matched nave controls and age matched AAV GFP injected animals, and st imulation was terminated once three consecutive Racine grade 5 seizures had been produced. Two scores were used to measure the effect of the gene on seizures: behavioral seizure score and the afterdischarge (EEG seizure) duration. The behavioral seizure sc ore was determined using the standard Racine Scale (1: staring and immobility, 2: head nodding, 3: unilateral forelimb clonus, 4: bilateral forelimb clonus without rearing, 5: bilateral forelimb closure with loss of balance and falling) (Racine 1972) The afterdischarge duration was measured in seconds, with onset measured at the end of stimulation and termination at the last regular clon ic spike before EEG suppression These measures are stable from stimulus to stimulus in untreated animals. Histology Twenty four hours following the last stimulation, a nimals were deeply anesthetized by an initial injection of xylazine (SQ) followed by ketamine (IP), and continuous exposure to isoflurane in oxygen. Animals were perfused through the ascending aorta with 200 300 ml NaCl followed by 3 00 350 ml of phosphate buffered formalin. The bodies were refrigerated for 2 h ou rs post fixation to allow for additional in situ fixation after which the brain was dissected out and kept in 30% sucrose solution containing 0.02% sodium azide for 24 48 hours for cryoprotection. The brains were then excised to

PAGE 32

32 obtain a block containing both hippocampi and sect ioned with a microtome into 50 m coronal sections. Somatostatin Immunohistochemistry Brain slices were collected in vials and stained for SST as free f loating sections Prior to primary antibody incubation, sections were subjected to the antigen retrieval step, which involved incubation in 10 mM citrate buffer for 25 minutes at 80 o C (Jiao, et al. 1999) The secti ons were then briefly washed once and incubated in 10% methanol containing 0.5% hydrogen peroxide for 15 minutes. Sections were then washed and incubated with a blocking solution for an hour, after which they were incubated overnight with primary monoclona l somatostatin antibody (Biomeda) at a concentration of 1:100 On day 2, the sections were incubat ed with biotinylated mouse anti IgG secondary antibody (1:10,000). The tissue was then reacted with extravidin peroxidase (1:1000) for 2 hours followed by vis ualization Diaminobenzidine (DAB) in 0.0012% hydrogen peroxide G lial F ibrillary A cidic P rotein (GFAP) Immuno histochemistry Astrocytosis w as visualized with GFAP staining, using a 1:400 dilution of a primary monoclonal anti GFAP clone (G A 5, Sigma, St. Louis, MO) in PBS incubated overnight after the antigen retrieval step mentioned above. Sections were then washed and incubated with biotinylated mouse anti IgG secondary antibody (1:10,000) overnight The tissue was then reacted with extrav idin peroxidase (1:1000) for 2 hours followed by visualization Diaminobenzidine (DAB) in 0.0012% hydrogen peroxide

PAGE 33

33 Microglial Immunohistochemistry Microgliosis was assessed by means of the same general technique using overnight incubation with the primary mouse anti rat CD68 antibody at a dilution of 1: 4 00 (AbD Serotec, Raleigh, NC). Fluorojade C Staining Neuronal degeneration w as analyzed using Fluoro Jade C (FJC) staining as described in Schmued, et al., 2005 (Schmued, et al. 2005) 50 m sections were mounted on subbed slides and im mersed in a basic alcohol solution consisting of 1% sodium hydroxide in 80% ethanol for 5 min utes The original protocol was modified and slides were then incubated in 70% ethanol for 20 minutes f ollowed by a 3 minute incubation in 0.02% potassium permanganate. Slides were then rinsed and incubated in a 0.0002% solution of FJC (Histo Chem Inc., Jefferson, AR) in a 0.1% acetic acid vehicle for 30 minutes to complete stai ning (modified protocol obtained from Sung J. Lee via personal communication). The slides were then rinsed with water, air dried, and cover slipped with Eukitt mounting medium (Fisher Scientific, Pittsburgh, PA) Cresyl Violet Staining Sections stained for GFAP and microglia were submerged in cresyl violet solution for 2 3 minutes, dehydrated by passing through increasing concentrations of alcohol (70% 95% 100%), and finally xylene before cover slipping with Eukitt mounding medium. Microscopy Following sta ining and mounting, slides were examined on an Olympus BH 2 bright field and epifluorescence microscope (Olympus America Inc., Center Valley, PA) with a Hitachi KP D581 color digital video camera (Hitachi Medical Systems America,

PAGE 34

34 Inc., Twinsburg, OH) inter faced with an Integral Technologies frame grabber (Pelco, Clovis, CA) on a desktop computer. Motorized stage and focus (Prior Scientific, Rockland, MA), and image acquisition were controlled through ImagePro Plus (Media Cybernetics, Silver Springs, MD). Be havioral Testing Using t he Morris Water Maze The Morris water maze swim task was used to test any learning or memory impairments. The water maze apparatus consisted of a black tank, 1.7 meters in diameter, placed in a well lit room with walls painted black Water temperature was maintained at 27 1 o C with the water level maintained at about 8 cm below the edge of the tank. A submerged hidden black platform 29 cm in diameter was placed in the middle of one quadrant, about 1 cm below the water level. The maz e was surrounded The Morris water maze swim task consisted of cue, spatial and probe trials (Aenlle, et al. 2009) over a 4 day period. The cue trial began with rats being habituated to the testing conditions by releasing them from 4 different locations within the tank and all owing them to swim freely for 20 seconds. At the end of this period, the rats were gently guided to the platform where they were allowed to rest for about 10 seconds. The cue trial constituted placing the platform 1 cm over the water level with a flag atta ched to the platform. The rats were released from different quadrants of the water maze across 3 trials and allowed to swim and find the platform in a 60 second time frame, at the end of which they were guided to the platform if they failed to reach it on their own. There was a 20 second interval between each trial and about a 15 20 minute interval between each block of 3 trials, during which the animals were housed in standard cages

PAGE 35

35 lined with towels. On Day 2, the rats went through a spatial trial where t hey were allowed to navigate to the submerged platform using the visual cues placed around the periphery of the tank. Each trial lasted 60 seconds with 5 blocks of 3 trials each, with a probe trial before the 5th block. The probe trial involved removing th e platform and allowing the animal to swim for 60 seconds. The duration of time spent in the goal quadrant and number of times the position of the platform was crossed was noted. The animals were allowed to rest on Day 3 and tested on the probe trial alone on Day 4 again. Statistical Analysis All statistical analysis was done in MATLAB (Mathworks Natick, MA ). Significance at a 95% confidence interval was assessed using a combination of the nonparametric one way analysis of variance (anova1.m) and a Bonfer roni correction (multcompare.m) for multiple comparisons.

PAGE 36

36 Figure 2 1. Ground/reference electrode (top) and bipolar twist electrode (bottom). The bipolar twist is cut to size before implantation.

PAGE 37

37 Figure 2 2. Stereotactic surgery for electrode impla ntation in a rodent. (A) Landmarks showing bregma, lambda and midline suture, along with injection and electrode coordinates. (B) Implantation of ground and reference electrodes, bipolar twist electrodes in the amygdala and anchoring screws on either side of the midline suture. (C) Amphenol pins inserted through plastic casing and enclosed in dental acrylic.

PAGE 38

38 CHAPTER 3 PREPARATION OF VIRAL VECTORS Background Viral vectors, in addition to other methods of in vivo gene transfer are novel tools for studying gen e function in the mammalian central nervous system. Furthermore, such approaches can induce expression of therapeutic molecules that provide potential alternatives for treating nervous system disorders. Neurotropic viral vectors can express single or multi ple foreign genes and can be engineered at several levels to induce long lasting, highly specific gene transfer. Many viral vectors like adenoviruses, retroviruses and lentiviruses are currently in use for gene therapy. Adeno Associated Viral Vectors The a deno associated virus (AAV) is a single stranded DNA virus that belongs to the genus Dependovirus in the family Parvovirus It is a small virus, with a capsid diameter of 26 nm (Choi, et al. 2005b) The single stranded geno me is flanked by inverted terminal repeats (ITRs) at each end, which is the only cis acting element required for genome replication and packaging. The genome carries two viral genes: rep and cap which generate four replication proteins and three structura l capsid proteins respectively, through three promoters and alternate splicing. As a replication deficient virus, AAV requires Adenovirus (Ad) or Herpes Simplex Virus (HSV) as a helper virus to complete its lytic life cycle (Berns and Linden 1995) Recombinant AAV vectors can be produced by removing the two viral gen es ( rep and cap ) and inserting a transgene between the two ITRs, with rep and cap provided in trans. Due to a lack of viral genes, minimal toxicity is associated with AAV vectors, which is the most attractive feature of this viral vector for use as a thera peutic agent.

PAGE 39

39 The use of AAV vectors appears to have several other advantages over the use of other vectors as well. Other than being nonpathogenic, these vectors are capable of infecting many different cell types, both dividing and non dividing in a wide variety of host organisms. Additionally, they have a high efficiency of infection and minimal induction of host immune and inflammatory responses. Long lasting transduction has been observed with the use of these vectors and a variety of promoters, with g ene expression lasting as long as 1.5 years in rodents (Klein, et al. 2002, Niwa, et al. 1991, Peel and Klein 2000, Xiao, et al. 1997) and more than 6 years in primates (Riv era, et al. 2005) As of 2006, there have been 11 naturally occurring AAV serotypes described, with serotype 2 being the most excessively studied. In addition to these, there are numerous engineered, hybrid serotypes that are also currently being used for research purposes. Methods Cloning AAV CBa GFP Standard cloning techniques were used to construct all recombinant AAV based plasmids. The Green Fluorescent Protein (GFP) vector served as a viral control for animals and had the cytomegalovirus (CMV) imme diate early enhancer, the chicken beta actin (CBa) promoter and a hybrid intron that is part chicken beta actin and part rabbit beta globin. The vector was packaged in serotype 5 of the AAV vector by the University of Florida Vector Core as described below This vector had a titer of 1.02x10 13 vector genomes (vg)/ml at the time of use. The plasmid map is shown in Figure 3 1. For an initial assessment of vector transduction, 8 l of this vector was injected into the dentate gyrus and CA1 sub regions of the h ippocampus bilaterally in

PAGE 40

40 three animals. These animals were perfused 1, 2 or 3 weeks post injection respectively to assess extent of gene transduction. AAV CBa SST The AAV SST vector encoded preprosomatostatin and was a kind gift from the lab of Dr. Terre nce Flotte. The entire promoter construct was similar to the GFP vector described above and had the CMV immediate early enhancer, the CBa promoter and a hybrid intron that is part chicken beta actin and part rabbit beta globin. The vector was also packaged in serotype 5 of the AAV vector. The vector was kept at 20 o C till the time of injection, at which point it was thawed on ice for further use. The viral titer at the time of injection was 4.99x 10 12 vg /ml. The plasmid map is shown in Figure 3 2. A total o f 8 l of the viral vector was injected into the DG and CA1 sub regions of the hippocampus bilaterally (n=3) as described in Chapter 2. Animals were perfused 24 hours after the last stimulation and SST immunostaining was compared against nave (n=3) and un injected fully kindled animals (n=3). AAV CBa SST GFP A plasmid containing a GFP tag on the SST vector was also cloned so as to better identify cells expressing exogenous SST. The backbone used was the CMV GFP plasmid, a kind gift from the lab of Dr. Arun Srivastava, and was cut open using the EcoRI and XhoI restriction enzymes. This was followed by the end filling Klenow reaction for making blunt ends. The DNA was isolated using phenol chloroform extraction after which a reaction with T4 polymerase was car ried out. The DNA was extracted again using phenol chloroform. The SST insert was digested out of the CBa SST plasmid using the EcoRI restriction enzyme. After purification and quantification of digested SST and GFP fragments, the two were ligated and E.co li DH5 alpha cells

PAGE 41

41 transformed. Transformed cells were then plated and colonies were picked out 24 hours later to screen for successfully cloned CMV SST GFP plasmids. The second step of cloning involved swapping out the CMV promoter for the CBa promoter. T he CBa promoter was digested out of the CBa SST using the BglII enzyme and the CMV promoter was deleted from the new CMV SST GFP plasmid using MluI and ClaI restriction enzymes. Standard extraction and purification techniques mentioned above were carried o ut and colonies screened and sequenced for successfully cloned CBa SST GFP. HeLa cells were first transfected in duplicates with both CMV SST GFP and CBa SST GFP plasmids to assess successful cloning of both plasmids. One successfully cloned colony for CB a SST GFP was sent to the University of Florida Vector Core for packaging into serotype 5 of the AAV vector. The titer of this vector at the time of use was 4.24 x10 13 vg/ml. Two animals were injected with 8 l total of this viral prep into the DG and CA1 sub regions as described in Chapter 2 and perfused 3 weeks post injection to allow for maximal gene expression. Following perfusion and sectioning in the brain into 50 m coronal sections, the sections were incubated with a 1:1000 primary monoclonal antibo dy to SST (Santa Cruz Biotechnology, Inc) overnight, followed by overnight incubation with Invitrogen Alexa Fluor 594 goat anti mouse IgG secondary antibody (Cat. No. A 11005). Once sections were washed, they were mounted on to slides and cover slipped wi th Vectashield containing DAPI (Vector Laboratories, Inc). Viral Vector Packaging All viral vectors were packaged at the University of Florida Vector Core. Methods for constructing the pXYZ5 helper plasmid for creating the pseudotype with capsid

PAGE 42

42 genes from AAV 5 are described in Potter, Zolotukhin, Byrne et al 2002 (Zolotukhin, et al. 2002) Human kidney epithelial 293 cells from ATCC were transfected with the modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum and 1% penicillin/streptomycin. In order to attain a confluency of 70 80% or 1x10 9 293 cells were split 1:3 in a Nunc cell factory 24 hours prior to transfection. Transfections were per formed using the conventional calcium phosphate method. The precipitate was formed by combining 1 .8 mg of helper plasmid pXYZ5 mixed with 0.6 mg of the rAAV vector plasmid of interest in a total volume of 50ml of 0.25M CaCl 2 followed by 50 ml of 2 x HBS, p H 7.05, to the DNA/CaCl 2 This mixture was incubated at room temperature for about 2 minutes at which point precipitate formation was halted by adding 1100 ml of pre warmed DMEM. This fresh precipitate containing media was then promptly added to the cells after removal of the culture medium, and allowed to incubate for 60 hours at 37 o C and 5% CO 2 Discarding the culture medium and rinsing the cells with PBS marked the end of the incubation period. The cells were dislodged from the cell factory by using 5 mM EDTA, and pelleted by centrifugation at 1000 g for 10 minutes to be re suspended with 60 ml lysis solution (150mM NaCl, 50mM Tris, pH 8.4). Cells were subsequently lysed by three freeze/thaw cycles using dry ice ethanol and 37 o C water baths. Benzonase (Si gma, St. Louis, MO) was then added to the cell lysates for 30 minutes at 37 o C to remove any nucleic acids. The crude lysate was clarified by centrifugation at 4000 g for 20 minutes, after which the supernatant was loaded onto a discontinuous iodixanol grad ient. The tubes were then sealed and the less dense cell lysate displaced by using four gradients going from 60% to 15%

PAGE 43

43 iodixanol. Tubes were then sealed and centrifuged in a Type 70 Ti rotor at 69,000 rpm/350,000g for an hour at 18 o C. Five mls of viral p articles settled at the 60 40% step interface were then aspirated by side puncturing each tube with a syringe attached to an 18G needle. In order to purify and concentrate AAV5 vectors, an equilibrated 5 ml HiTrap Q column (Pharmacia) was used. The column was equilibrated at 5 ml/min with 5 column volumes of 25 ml Buffer A (20mM Tris, 15mM NaCl, pH 8.5), then by Buffer B (20mM Tris, 500mM NaCl, pH 8.5), followed by 25 ml of Buffer A using a Pharmacia ATKA FPLC system. The 20 ml iodixanol fraction containin g the vector was then diluted 1:1 with Buffer A and passed through the column at the rate of 3 5 ml/min. After loading of the sample, the column was washed with 10 volumes of Buffer A to be eluted with Buffer B. The virus was then desalted and concentrated using Biomax 100K concentrator (Millipore, Bedford, MA) by three cycles of centrifugation. The virus was concentrated into PBS. Vector stocks were analyzed by silver staining to check for protein purity after electrophoresis on 10% SDS polyacrylamide gels To quantify the number of virions containing viral particles, a dot blot assay was performed on the concentrated viral stocks. In order to detect only packaged DNA, the sample was first digested for 1 hour at 37 o C with a solu tion of DN ase I (Roche) with 10m M Tris HCl at pH 7.5 and 1mM Mg Cl 2 This digested any of the unpackaged DNA prior to lysing the virion and releasing the packaged DNA. To release the encapsulated DNA, a solution of 2x proteinase K buffer (20mM Tris Cl, pH 8.0, 20mM EDTA, pH 8.0, 1% SD S) was used to incubate the sample for 1 hour at 37 o C. This degraded the protein capsid and released the single stranded genomes within the virions. The DNA

PAGE 44

44 wa s then precipitated with a phenol and ethanol extraction using glycogen as a carrier. The precip itated DNA was dissolved in 40 l of distilled water. A two fold dilution series of the plasmid DNA that was packaged was prepared in water and diluted into 0.4N NaOH/10mM EDTA. Denatured vector DNA was then loaded onto a slot blot and immobilized onto a n ylon membrane along with a plasmid standard curve. The nylon membrane was then probed for the transgene or the promoter and exposed on film. The signal of the sample wa s then calculated and compared to the standards, which was then extrapolated to a titer. This titer represented DNAse resistant particles. Results AAV CBa GFP Increasing expression of GFP was observed within the entire hippocampal formation from the time of injection to the time of perfusion. GFP expression peaked at 3 weeks post injection (F ig 3 3). This expression was robust and long lasting, as seen in an animal perfused 2 months post injection (Fig 3 3 D). AAV CBa SST Fully kindled animals had a reduced number and immunolabeling intensity of SST positive cells when compared to baseline lev els viewed in a nave animal (Fig 3 4). However, there were a higher number of SST positive hilar cells visualized in injected animals when compared to both control and nave animals. Most SST positive cells were observed within the dentate hilus and strat um oriens of CA3 and CA1 subfields. AAV CBa SST GFP Successful transduction of HeLa cells was obtained with both the CMV (Fig 3 5) and CBa promoters (Fig 3 6). To be consistent with other promoters used, we used the CBa promoter for further experimentatio n with this vector. Confocal images of sections

PAGE 45

45 from AAV CBa SST GFP injected rodent brains show successful transduction of SST and GFP (Fig 3 7). SST positive cells (red) tagged with GFP (green) and nuclei stained with DAPI (blue) were seen within the den tate hilus and granule cell layer. Cells not co expressing green fluorescence were therefore endogenous SST containing cells whereas doubly labeled cells were transduced cells. Discussion Efficient cell transduction and gene expression is subject to a com bination of the promoter used, as well as the viral serotype. A number of naturally occurring and engineered serotypes exist for AAV and the utility of these various serotypes has been optimized for use in specific regions of the body. AAV5 is of particula r interest for gene therapy since it has little to no pathogenicity (Flotte and Berns 2005b) as opposed to AAV2, antibodies to which are present in 80% of the human population (Daya and Berns 2008) The temporal analysis of GFP expression using AAV5 showed some faint green fluorescing cells in the dentate hilus as early as 1 week post injection, but the expression increased with time to reach a maximum at 3 weeks, after which it remained stable. Robust expression of GFP within the hippocampal formation was observed as far as 2 months post injection in this study. This is in agreement with other studies using AAV that also show maximal expression occurring at 3 4 weeks post administration (Klein, et al. 1998, Reimsnider, et al. 20 07) and stable expression of genes for up to 1.5 years in rodents (Klein, et al. 2002, Niwa, et al. 1991, Peel and Klein 2000) and 6 years or longer in primates (Rivera, et al. 2005) Analysis of expression levels in our animals showed high levels of localized transduction with minimal spread to adjoining limbic structures. This specificity and long term expression is crucial since SST and its

PAGE 46

46 receptors are widespread in t he CNS, and localized, well targeted expression would limit interruption of endogenous SST effects. Transduction was observed only within neuronal cells and their associated fibers, and this can be attributed to the significant neuronal tropism of these ve ctors. SST expression followed a similar temporal profile, with maximal neuronal transduction observed 3 weeks post injection. Fully kindled animals had a marked reduction of SST positive interneurons within the hilus, which is in accordance with previou s studies (Tuunanen, et al. 1997) SST is known to down regulate with seizures (Sloviter 1987, Tuunanen, et al. 1997) and even with the limited pathology associated with the electrical kindled model, a marked reduction of inhibitory neurons was observed in kindled animals. This could be due to a downregulation of SST mRNA, o r degeneration of SST containing cells, both of which have been described as plausible mechanisms of neuropeptide downregulation (Schwarzer, et al. 1996, Tallent 2007) and further explored in Chapter 4 of this diss ertation. In AAV SST injected animals, however, immunolabeling of SST was more reflective of nave animals in that robust expression was seen within the hilus and surrounding strata of the CA3 CA1. Exogenously expressed SST compensated for the loss of this neuropeptide seen in fully kindled animals most likely due to transduction of previously non somatostatinergic cells, as well as protection against atrophy that may have resulted from the occurrence of generalized seizures in the same cohort of animals. Although the over expression of SST was significant enough to be visualized when compared against a fully kindled animal, the level of expression was not as robust as GFP. This can be attributed to the fact that GFP is an inert protein, which is not

PAGE 47

47 inhere ntly processed, or downregulated within the CNS. SST expression on the other hand, is regulated by the enzymes that catabolize this protein within the brain, as well as saturation profiles of SST receptors within the CNS. It is therefore plausible that a level of expression matching that of GFP is limited by the natural enzymatic cleavage of the protein. Additionally, SST being a much smaller protein than GFP, may also be more sensitive to the perfusion protocol as well as the reagents used throughout the histological procedure. Nonetheless, our results show that expression of viral vector delivered SST was sufficient to ameliorate the generalization of seizures in rats. Additionally, by use of the AAV CBa SST vector alone, it is impossible to distinguish exogenously expressed SST from endogenous SST. It is for this reason that we cloned the AAV CBa SST GFP plasmid to tag the exogenous SST. The AAV CBa SST GFP vector allowed us to visualize exogenously expressed somatostatin within the hippocampal formatio n. Since the plasmid construct was a fusion controlled by the single chicken beta actin promoter, with the SST gene upstream of GFP, any green fluorescence follows the presence of SST as well. We initially tested this construct by transfecting HeLa cells, and saw robust expression of GFP. Confocal microscopy after injection of 8 l of this construct into adult rats as described above also showed vast expression within the dentate hilus, where most endogenous SST is also expressed.

PAGE 48

48 Figure 3 1. Plasmid m ap for pCBa GFP (UF 11). ITR= Inverted Terminal Repeat, TR= Terminal repeat, CMV enh= Cytomegalovirus immediate early enhancer, CB promoter= Chicken beta actin hybrid promoter, GFP= Green Fluorescent Protein, poly(A)= Poly adenylation sequence

PAGE 49

49 Figure 3 2. Plasmid map for AAV CBa SST. rSST= Recombinant somatostatin

PAGE 50

50 Figure 3 3. Temporal expression of GFP using AAV. Bright green cells show GFP expression. A C show expression in the dentate hilus 1,2 and 3 weeks post injection respectively. D shows exp ression 2 months post injection within the entire hippocampal formation bilaterally.

PAGE 51

51 Figure 3 4. Histological analysis of SST in nave (A), AAV SST injected (B), and uninjected control (C) animals. A marked reduction of SST levels was seen in uninjected fully kindled animals (C) as compared to nave, unstimulated animals (A). Higher level of SST expression was observed in AAV SST injected animals that did not reach a fully kindled state after 30 stimulations (B). Insets show higher magnification of hila r SST positive neurons. Scale bar represents 100 um.

PAGE 52

52 Figure 3 5. Transfection of HeLa cells with AAV CMV SST GFP. Top panels show bright field images. Bottom panels show fluorescent images. (A) Mock infection, (B) Prep 1, (C) Prep 2. Bright g reen cells are GFP expressing.

PAGE 53

53 Figure 3 6. Transfection of HeLa cells with AAV CBa SST GFP. Top panels show bright field images. Bottom panels show fluorescent images. (A) Mock infection, (B) Prep 1, (C) Prep 2. Bright green cells are GFP expressing

PAGE 54

54 Figure 3 7. Histological verification of the AAV SST GFP vector. Bright green neurons are cells expressing GFP clones downstream of SST within the dentate hilus. Higher magnification shows co localization of a red SST expressing cel l with GFP. Blue denotes nuclear staining using DAPI. Scale bar represents 50 um.

PAGE 55

55 C HAPTER 4 EFFECTS OF SOMATOSTATIN OVER EXPRESSION IN VIVO 1 Background Somatostatin (SST) positive interneurons form the most abundant local circuit type in the hilus and ac count for 50% of all hilar GABA ergic neurons (Buckma ster, et al. 2002) SST was initially identified as a hypothalamic cyclic tetradecapeptide in 1973 (Brazeau, et al. 1973) and subsequently described as a neuro transmitter and neuromodulator (Reichlin 1983) There are two biologically active forms of SST; SST 14 and SST 28, both products of alternate cleavage of a single prepropeptide precursor gene. SST 14 is the predominant form of the gene in the nervous system (Epelbaum 1986) and acts through a family of 5 G coupled receptors (SSTR1 5) (Hoyer, et al. 1994) SST is known to have diverse functions ranging from the control of endocrine and exocrine hormones, inhibition of tumor cells, mod ulation of cognition, sleep and motor activity. Additionally, levels of SST have seen to be altered in several brain (Robbins, et al. 1991) A few studies have alluded to the correlation between reduction in SST levels in the brai n and exacerbation of seizures; the first one being the observation of a loss of a selective SST positive neuronal population in the dentate hilus post seizure induction (Slov iter 1987) The loss of hilar somato statinergic interneurons reduce functional inhibition of dentate granule cells (de Lanerolle, et al. 1989) and thus may play a role in neuromodulation of the epileptic network. Although the full breadth of SST action is not yet fully understood in relation to epilepsy, its role in the modulation of sei zures is becoming more and more apparent. A selective loss of the SST neuronal population is 1 Parts of this chapter have been submitted for publication.

PAGE 56

56 observed post seizure induction both in humans (Sloviter 1987) and several animal models including kainate (Buckmaster and Dudek 1997) pilocarpine (Choi, et al. 2005a) and electrical stimulation (Sun, et al. 2007, Tuunanen, et al. 1997) Presynaptic somatostatin receptors in the hippocampus have also been shown to selectively inhibit excitatory transmission via G proteins of the G i /G o family and through a t least two separate mechanisms; modulation of Ca 2+ channels and an effect downstream of Ca 2+ entry (Boehm and Betz 1997) This reduction in synaptic potentiation in the dentate gyrus is probably what leads to a reduction in long term potentiation (LTP), manifesting itself as profound impairments in spatial learning and memory observed with over expression of SST and the rel ated peptide cortistatin (Tallent 2007) SST has also shown inhibitory actions in the CA3 and CA1 hippocampal sub fields. SST increases two different types of K + currents, the v oltage sensitive M current (Moore, et al. 1988, Schweitzer, et al. 1990, Tallent and Qiu 2008) and a voltage independent leak current (Schweitzer, et al. 1990) in the CA1. It also reduces excitatory synaptic input at Schaffer collateral synapses from CA3 (Tallent and Qiu 2008) Based we tested the hypothesis that over expression of SST by use of viral vectors directly into highly epileptogenic areas of the temporal lobe will alleviate seizures b y protecting against hyperexcitation of the neuronal network, w hich is a hallmark of epileptic activity. We found that over expression of SST in approximately three fourths of our animals prevented the generalization of seizures, and reduced the rate of k indling in the remaining one fourth when compared to control and AAV GFP injected animals. Furthermore, we evaluated activation of micro and astroglia as markers of inflammation and possible cell death as

PAGE 57

57 a result of gene injections, which could possibly impede the therapeutic benefits of the treatment. These results therefore provide proof of principle for the validity of SST as a neuromodulatory agent that increases seizure threshold in an electrical kindling model of epilepsy. Furthermore it justifies f urther investigation of SST as a novel neuroprotective and therapeutic agent for patients with intractable epilepsy. Results After an initial assessment of effective viral transduction, all animals were electrically stimulated. B ehavioral seiz ures were gr aded on the Racine s cale and duration of seizures was noted based on duration of afterdischarges on EEG All uninjected controls (n= 10 ) and AAV GFP animals (n=6 ) reached a fully kindled state (which was set a priori as the occurrence of 3 consecutive grade 5 seizures ) after 22 0.8 and 19 1 stimulations respectively (p >0.05). 9 of the 1 3 AAV SST animals never reached this fully kindled state (Fig 4 1), and kindling was terminated after the 30th stimulation, as this was at least 3 standard deviations hig her than the average for uninjected controls (p < 0.01 when compared to uninjected and AAV GFP injected controls). No significant difference was seen in the number of stimulations requi red to reach the first grade 1 3 seizure across all animal groups. The remaining four AAV SST animals took 26 1 stimulations to reach a fully kindled state (p <0.05 when compared to uninjected and AAV GFP injected controls) To take into account both the behavioral severity of the seizure as well as the duration, we measure follows; SQI = seizure grade x duration of seizure, where the seizure grade was a number between 1 5, as defined by the Racine scale, and the duration of seizure was

PAGE 58

58 calculated in seconds by marking the start and end of electrical stimulation evoked afterdischarge s on EEG. The trajectory (T) of the SQI was also measured across all animal groups over the entire duration of the kindling proto col. The trajectory of the SQI is quantified by fitting a linear model to the SQI versus sequential stimulations (in temporal order). Specifically, T is quantified by calculating the slope of the linear model fit for each animal (rate of change of SQI/stim ulation). All AAV SST injected animals had a significantly lower (p <0.01) T as compared to uninjected controls and AAV GFP animals. The value of T for uninjected controls was 18.2 1.98, for AAV SST injected animals was 4.5 2.09 and for AAV GFP injecte d animals was 25.9 2.55 (Fig. 4 2). The average duration of each seizure through the entire kindling protocol for uninjected controls, AAV SST and AAV GFP animals was 62.5 6.4s, 55.2 5.6 s and 67.9 8.2 s respectively (Fig 4 3) N o statistically signi ficant difference in the duration of seizures across the three groups (p > 0.05) was observed To further understand whether the reduction of SST expression seen in Group 1 animals was due to neurodegeneration versus downregulation of SST mRNA, tissue fro m both Group 1 and 2 animals was stained with Fluoro jade C and the nucleic marker, DAPI. No neuronal degeneration within the hippocampal formation was observed in fully kindled or A AV SST injected animals (Fig 4 4 A and B) when compared to a nave animal (Fig 4 4 C). The full extent of neurodegeneration is seen in Fig 4 4 D, as observed in a spontaneously seizing animal from another study in our lab, to serve as a positive control.

PAGE 59

59 To verify that the over expression of SST or presence of viral particles di d not induce any side effects by way of brain inflammation or neuronal damage, we measured activation of micro and astroglia. This was assessed by using antibodies against CD68 and GFAP in uninjected control and AAV SST animals (n=3 each) The same histol ogical procedure was carried out on a nave control animal (n=1) to serve as negative control (Fig 4 5 A). A representative figure showing positive GFAP staining is shown in panel D of Fig 4 5 No significant difference was observed in microglial or astroc ytic activation amongst uninjected and SST injected animals (Fig 4 5 B and C ). A positive control for both micro and astro gliosis was included by staining a brain from a spontaneously seizing animal from a separate study in our lab (Fig 4 5 D). The reduct ion in the generation of LTP mentioned above may lead to cognitive impairments, and to this effect we also tested nave, uninjected kindled animals and SST over expressing animals in the Morris water maze. A preliminary assessment of learning and memory wa s performed by testing rats in the water maze 24 and 36 hours post training. We observed no significant difference in the percentage of time spent in the goal quadrant during the probe trial between control and AAV SST injected rats. Additionally, the numb er of crossings made over the platform position was also not significantly different between the two animal groups (Fig 4 6). Discussion The hypothesis of SST as a neuromodulator for epilepsy stems from the experimental evidence of preferential SST relea se following elevated neuronal activity (Bartfai, et al. 1988, Hokfelt 1991, Vezzani, et al. 1993) marked alterations in the level of the protein, mRNA and receptors in experimental models of epilepsy (Schwarzer, et al. 1996, Sun, et al. 2007, Tuunanen, et al. 1997) and applications of SST analogs both

PAGE 60

60 in vivo and in in vitro preparations to alter seizures and epileptogenesis (Mazar ati and Telegdy 1992, Piwko, et al. 1996) It has also previously been described that loss of hilar somatostatinergic interneurons reduces functional inhibition of dentate granule cells (de Lanerolle, et al. 1989) Our data are in agreement with the notion of SST as an important antiepileptogenic and neuroprotective agent for epilepsy an d is consistent with results from other studies using inhibitory neuropeptides like galanin and neuropeptide Y (NPY) (McCown 2006, Noe, et al. 2009, Richichi, et al. 2004) NPY and galanin are neur o peptides present in the CNS and both are known to have antiepileptic properties, as shown by their direct application to the CNS, or through use of their analogs. It is generally accepted that both these neuropeptides suppress epileptic seizures by antagonizing excitatory neurotransmission and hyperpolarizing neurons (Ito 2009) However, little is known about the specific mechanisms of either of these neuropeptides. SST and NPY are extensively co localized (Kohler, et al. 1987, Mikkelsen and Woldbye 2006, Richichi, et al. 2004, Sloviter and Nilaver 1987) and results from studies on NPY therefore provide clues about the potential mechanism of action for SST. We focused on SST for our study b ecause of the extensive in vitro data available on SST including precise knowledge about its receptors and corresponding pharmacological analogs (Csaba, et al. 2005, Csaba, et al. 2004, Qiu, et al. 2008) Somatosta tin acts through a family of 5 G protein coupled receptors, each of which has been thoroughly characterized (Tallent and Qiu 2008, Zeyda and Hochgeschwender 2008) It has also been identified that SST receptor subt ype 2 is specifically dominant in rats, and it is through this receptor that most of the antiepleptic functions are carried out (Tallent and Qiu 2008) There is a relative sparing of dentate granule cells despite the

PAGE 61

61 loss of SST somatostatinergic interneurons in the hilus after electrical stimulation (Richichi, et al. 2004) Axons of hilar SST positive interneurons synapse on distal dendrites of granule cells in the outer molecular layer (Amaral, et al. 1988, Csaba, et al. 2005) which may present a target for exogenously applied SST in the electrically kindled animal. Several other studies have also addressed the changes in spontaneous and evoked neuronal activity that occurs as a result of loss of somatostatinergic neurons in vitro (Gavrilovici, et al. 2006, Shoji, et al. 1998, Stief, et al. 2007, Tallent and Qiu 2008) Based on such findings, it is imperative that the role of SST be further investigated in a pre clinical setting, and our in vivo study is he nce prudent to the development of SST as a novel therapeutic agent for patients. Nine out of thirteen AAV SST injected animals did not experience a single grade 5 seizure after elicitation of 30 electrical stimulations. The remaining four rats did reach a fully kindled state, albeit after a significantly higher number of stimulations when compared to age matched control and AAV GFP injected animals. It is expected that not all animals in our experimental cohorts would have the same response to over express ion of SST, similar to the inherent variability in drug responsiveness that exists in the patient population (Ichikou, et al. 1990, Jannetto and Bratanow 2010) Therefore, some rats could have been more responsive to the protective effects of SST over expression, while leaving the others less susceptible. Additionally, we cannot exclude the possibility that targeting and transduction of SST may have been lower as compared to other animals since the brains of the fou r AAV SST injected rats that were fully kindled were used for other experimental procedures and not processed for histology. Finally the over expression of SST did not elicit an inflammatory response which

PAGE 62

62 further underscores the potential of gene delive red SST as an alternative therapy for epilepsy in humans. Trajectory analysis is an increasingly common method to study trends across groups of individuals with similar temporal behavioral patterns (Levine, et al., McCoy, et al.) For this study in particular, the trajectory of the Seizure Quantification Index in progresses, seizures become more intense both in behavioral severity as well as duration. The SQI therefore includes both parameters to give an estimate of changes in neuronal networks that lower the threshold for seizures, so that the same amplitude of current evokes a more severe behavioral response from day to day. A lo wer trajectory of SQI per stimulation for AAV SST injected animals when compared to control and AAV GFP injected animals is significant as it reflects protection against the development and recruitment of additional neuronal networks that would intensify b oth the behavioral seizure grade as well as its duration. For all animal groups, stimulations required to reach the first grade 1 3 seizures, i.e. the initial insult, did not differ significantly across groups as is reflected by the comparable SQIs acros s all animal groups during the first 10 13 stimulations. A higher separation between SQIs was apparent as control and AAV GFP injected animals began to have grade 5 (generalized) seizures, while AAV SST injected animals did not. This supports the role of S ST gene therapy as an antiepileptogenic treatment that does not suppress the severity of the initial insult, which induces epileptogenesis. In other words, no alteration of individual stimulation evoked seizures leading to the generation of fully kindled a nimals was observed. This result speaks to one of the main criticisms of

PAGE 63

63 gene therapy which states that therapies shown to alter the rate of kindling may also suppress individual stimulation evoked seizures (Dudek 2009) In doing so, these therapies suppress the initial insult leading to the final kindled state. S ince the rate of kindling depe nds on the ro bustness of the evoked seizures, such initial suppressions would no doubt credit the therapy for altering the rate of kindling erroneously. However, since our study did not suppress the initial low grade seizures that eventually lead up to gen eralized grade 5 seizures, we can attribute the over expression of SST as the cause for prevention of generalized seizures in a majority of our SST injected animals and delayed kindling in a few. The duration of each stimulation evoked seizure was shorter in all AAV SST animals as compared to controls and AAV GFP injected animals, although this did not reach statistical significance. Results from the Morris water maze show that unlike neuropeptide Y, there was no impairment in learning and memory, and SST over expressing rats performed just as well as control animals. Measures of latency and percentage of time spent in the goal quadrant allow the analysis of a number of variables. Firstly, analysis of time taken to reach the platform over successive trials Ideally, the animals should take less time to reach the submerged platform over successive trials since they learn to navigate to the platform based on navigational cues. Additionally, once the platform is removed in the probe trial, the percentage of therefore is a measure of memory. Our findings are one of the first in vivo demonstrations of the antiepileptogenic and neuro protective roles of SST over expression in electrically kindled animals. The

PAGE 64

64 degree of protection is not limited to the abatement of seizures, but may also have important restorative cognitive effects. A vast population of patients with epilepsy suffers fr om impaired memory and learning skills, and it is therefore prudent that this be addressed before the utility of a new therapy is over stated. A previous study showed promising results with the use of AAV delivered neuropeptide Y in seizing animals, but ob served impairments in learning and memory (Sorensen, et al. 2008) Therefore any new therapy that is tested for epilepsy must address these concerns for it to be beneficial to the patient population. Future explora tion of the effects of SST in a chronic model of temporal lobe epilepsy will further validate its use as an effective alternative for preventing and treating intractable epilepsy.

PAGE 65

65 Figure 4 1. Percentage of animals fully kindled to spontaneous recurr ent seizures in each treatment group. 100% of all control and AAV GFP injected animals were fully kindled, whereas only 30% of AAV SST injected animals reached a fully kindled state, after a significantly higher number of stimulations.

PAGE 66

66 Figure 4 2. Trajectory of Seizure Quantification Index (SQI) calculated for all animal groups. (Top) AAV SST injected animals had a significantly lower trajectory of SQI per stimulation as compared to control and AAV GFP injected animals. (Bottom) Co ntrol and AAV GFP injected animals had a progressive increase in seizure grade and duration, as shown by the rising slope of the SQI. AAV SST injected animals had a lower SQI than other animal groups and eventually reached a plateau.

PAGE 67

67 Figure 4 3. Average duration of afterdischarges per seizure in each treatment group. There was no significant difference in the average duration of seizures between control (62.5 6.4 s ), AAV SST injected (55.2 5.6 s ) and AAV GFP injected (67.9 8.2 s ) animals (p>0.05).

PAGE 68

68 Figure 4 4. Assessment of neurodegeneration in the dentate gyrus as a result of electrical kindling using FJC/DAPI staining. (A) Uninjected kindled animal and (B) AAV SST injected animal showing no degeneration like a nave animal (C). (D) shows a positive control from a spontaneously seizing animal from another study with significant neuronal degeneration. Bright green neurons are degenerating. Blue fluorescence shows nuclei stained by DAPI. Scale bar represents 50 m.

PAGE 69

69 Figure 4 5. Analysis of inflammation in control and AAV SST injected animals. Upper panel: immunoreactivity for CD68; Lower panel: immunoreactivity for GFAP. A) shows staining in a representative nave animal. B) and C) show no activation of micro or astro glia in uninjected kindled controls and AAV SST injected animals respectively. D) is a positive control showing activated microglia and astrocytes within the hilus. Scale bar represents 50 m.

PAGE 70

70 Figure 4 6. Analysis of behavioral effects usin g the Morris water maze. No signficant difference was observed in percentage of time spent in the goal quadrant and number of crossings over the platform position across control and AAV SST injected animals. Probe Day 1 signified testing 24h post trainini ng and probe Day 2 was 48h post training. 0 5 10 15 20 25 30 35 40 AAV-SST Nave Control % Time Spent in Goal Quadrant Treatment Probe Day 2 n =4 n=4 0 0.5 1 1.5 2 2.5 3 AAV-SST Nave Control Number of crossings Treatment Probe Day 1 n =4 n =4 0 0.5 1 1.5 2 2.5 3 AAV-SST Nave Control Number of crossings Treatment Probe Day 2 n=4 n=4 0 5 10 15 20 25 30 35 40 AAV-SST Nave control % Time Spent in Goal Quadrant Treatment Probe Day 1 n =4 n =4

PAGE 71

71 CHAPTER 5 IN VITRO ASSESSMENT OF SPONTANEOUS POST SYNAPTIC EVENTS ACROSS ANIMAL GROUPS Background A number of studies have attempted to unravel the mechanism of action of somatostatin using slice physiology to g ain a better understanding of its inhibitory effects against seizures. Since the role of SST in the abatement of seizures is becoming increasingly apparent, a better understanding of where this neuropeptide is found and its specific effects in enhancing th e inhibitory tone of the brain becomes prudent. Somatostatin is primarily expressed in GABA ergic Hilar perforant path (HIPP) associated cells within the dentate gyrus (Bouilleret, et al. 2000a, Cossart, et al. 200 1, Dinocourt, et al. 2003, Ramos, et al. 2006) HIPP cells are long spined multipolar cells within the dentate gyrus that have long and often branched spines over the soma and dendrites. The axonal plexus can extend as long as 3.5mm along the dorso ventra l axis of the dentate gyrus (Fr eund and Buzsaki 1996) These morphological features of the HIPP cells make it unique as an interneuron since most interneurons are typically aspiny with local axonal plexuses. Besides SST, these neurons are also known to co express NPY (Chan Palay 1987) Additionally hilar somatostatinergic neurons also co express, mGluR1 and substance P receptors (Freund and Buzsaki 1996) SST positive interneurons have been reported to form approximately 16% of all GABA ergic neurons in the dentate gyrus (Kosaka, et al. 1988) Axons of hilar SST positive interneurons synapse on the distal dendrites of granule cells in the outer molecular l ayer in both humans and rats. These terminals on granule cells are in close approximation with excitatory synapses formed by perforant path input (Leranth, et al. 1990, Milner and

PAGE 72

72 Bacon 1989) SST positive interneu rons are therefore situated to modulate excitatory afferent connections from the entorhinal cortex into the hippocampus. Based on in vivo data presented in Chapter 4, we wanted to measure the in vitro nges in behavior of SST over expressing rats to cellular mechanisms within the hippocampal formation. We recorded from granule cells of the dentate gyrus since these are the putative primary targets of SST positive interneurons. Additionally, the highest l evel of viral mediated transduction of SST was observed within the hilus, and these neurons presumably synapse on granule cells as mentioned above. Methods Slice Preparation Male Sprague Dawley rats aged 15 16 weeks after cessation of electrical stimulati on as well as age matched nave animals were given a 0.5 ml intraperitoneal injection of ketamine and decapitated using a small guillotine. Brains were rapidly dissected out and placed in ice cold artificial cerebro spinal fluid (ACSF). Horizontal sections 300 m thick were obtained using a Pelco Series 3000 Vibratome (Pelco, Redding, CA), after which they were incubated at 30 35 o C in a water bath for 30 minutes. The slices were then allowed to equilibrate to room temperature for another 30 minutes, while c onstantly bubbled with 95%oxygen/5%carbondioxide. Solutions and Drugs External solution A high magnesium, low calcium ACSF was used for all recordings to prevent excitotoxic cell death. The constituents of the ACSF were as follows:

PAGE 73

73 124 mM NaCl, 2.5 mM KCl 1.23 mM NaH 2 PO 4 2.5 mM MgSO 4 10 mM D glucose, 1 mM CaCl 2 and 25.9 mM NaHCO 3 Internal solution For whole cell patch clamp recordings, recording pipettes were filled with an internal solution adjusted to pH 7.3 with the following composition: 140 mM K gluconate, 8 mM KCl, 0.1 mM CaCl 2 2 mM MgCl 2 1 mM EGTA, 2 mM Na 2 ATP, 0.3 mM Na GTP, 10 mM HEPES, and 0.063 sulforhodamine 101. Drugs All drugs were prepared as aliquots and stored at 20 o C before diluting for use. 20 M DNQX was used to block AMPA and kainate receptors while 40 M APV was used as an NMDA antagonist when recording spontaneous inhibitory post synaptic currents (sIPSCs). PTX was used to block GABA A receptors when recording spontaneous excitatory post synaptic currents (sEPSCs). All chemica ls used to prepare internal and external solutions were purchased from Sigma (St. Louis, MO), or Fisher Scientific (Pittsburgh, PA). Electrophysiological Recordings Hippocampal slices were placed in a recording chamber and temperature maintained at approxi mately 30 o C. Cells were visualized using an Olympus BX51WI infrared differential interference contrast microscope. Pipettes used for recording were pulled for whole cell patch clamp recordings using a Flaming/Brown electrode puller (Sutter P 97, Sutter Ins truments, Novatto, CA). Standard electrode tip resistance was between 3 The access resistance was observed throughout the duration of the experiments and ranged between 1 2 3 0 Recordings were performed from granule cells in the

PAGE 74

74 dentate gyrus in voltage clamp mode using an Axon Multiclamp 700A amplifier (Molecular Devices, Sunnyvale, CA). Data was sampled at 20 kHz and recorded by Digidat a 1322A using Clampex 10 (Molecular Devic es, Sunnyvale, CA). A holding potential of 70 mV was maintained in all experiments. A 3 minute baseline recording was obtained after successful patching of granule cells, followed by a 16 minute bath application of both DNQX and APV when recording sIPSCs or PTX when recording sEPSCs. Data Analysis Spontaneous EPSCs and IPSCs were detected using appropriate parameter based event detection software written in Origin by Dr. Charles Jason Frazier. Further analysis of detected events was then performed using O riginPro 8. Statistical analysis was carried out using Excel 2003/2007 (Microsoft, Seattle, WA) or OriginPro8. test. Results The goal of these experiments was to investigate changes in spontaneous excitatory and inhibitory post synaptic activity of granule cells within the dentate gyrus of nave, uninjected fully kindled, and AAV SST injected animals that were subjected to 30 stimulations but never achieved a grade 5 seizure. Dentate granule cells were patch clamped for whole cell recordings in voltage clamp mode. We recorded both frequency and amplitude of sEPSCs and sIPSCs. For acquisition of sEPSCs, 50 M PTX was bath applied to block GABA A receptors 3 minutes post baseline recording. The drug was bath appl ied for a total of 16 minutes. The first 6 minutes were considered drug wash in periods, and the following 10 min were used for actual sEPSC acquisition. The frequency (in Hz) of sEPSCs recorded from the three groups was as follows: nave

PAGE 75

75 animals (n=11): 2 .54 0.27, uninjected fully kindled animals (n=12): 2.88 0.21 and AAV SST (n=7) injected animals: 2.81 0.91. There was no significant difference observed between these frequencies, p >0.05 (Fig. 5 1 B). There was no significant difference in the ampli tude (in pA) of these responses either; nave: 16.43 0.47, uninjected fully kindled animals: 16.6 0.58, and AAV SST injected animals: 15.4 0.0.49, p >0.05 (Fig. 5 1 C). Next we recorded sIPSCs from the same three cohorts of animals. 20 M DNQX and 4 0 M APV were bath applied after 3 minutes of baseline recording. Similar to sEPSCs, the last 10 minutes of data segments were used for analysis of sIPSC acquisition. No significant difference was observed in these events when comparing frequency or amplit ude of events, p >0.05 (Fig. 5 2 B and Fig. 5 2 C). Frequency of sIPSCs (in Hz) were as follows: nave (n=17): 3.01 0.23, uninjected fully kindled animals (n=9): 2.67 0.61, and AAV SST injected animals (n=12): 2.91 0.72. Amplitude of events (in pA) w ere: nave: 27.34 1.46, uninjected fully kindled animals: 27.84 3.86, and AAV SST injected animals: 33.81 4.23. The cells patched in slices of brains from AAV SST injected animals did not have a GFP tag on them, and we therefore proceeded to inject animals with the AAV SST GFP vector described in Chapter 3. Animals were stimulated as before and brains from those not achieving a single grade 5 seizure were processed as described for sEPSC and sIPSC recordings. We patched only those granule cells that were in close apposition to fluorescing axonal processes, so a more direct effect of SST over expression could be measured instead of recording from granule cells more distant from transduced cells. Frequency and amplitude of both sEPSCs and sIPSCs were re corded

PAGE 76

76 and compared with data acquired from the previous 3 groups but no significant difference was found between frequency or amplitude of either event, p >0.05 (Fig. 5 1 and Fig. 5 2 respectively). Frequency (in Hz) of sEPSCs recorded from AAV SST GFP in jected animals (n=6) was: 2.49 0.57, amplitude (pA): 17.04 0.76. Frequency and amplitude of sIPSCs (n=8) was: 3.31 1.13 Hz and 27.23 2.44 pA. Discussion There have been conflicting reports on the role of SST in epilepsy, suggesting an increase in both excitatory and inhibitory drive within the brain (Shoji, et al. 1998, Stief, et al. 2007, Tallent and Siggins 1999) Results of our in vivo study show an inhibitory effect of SST over expression in adult rats by increasing the threshold for generalized seizures. We wanted to tie in the behavioral results observed with firing properties of cells intimately associated with SST in the cytoarchitecture of the hippocampus. The rationale for recording from granule ce lls comes from previous studies showing an innervation of dentate granule cells by the axons of SST positive hilar interneurons (Tallent and Qiu 2008) An over expression of SST in the hilus of injected rats would mean an increase in the inhibitory drive on granule cells, thereby decreasing excitatory activity of these cells. Cont rary to our expectation, we found no difference in the frequency or amplitude of spontaneous excitatory or inhibitory post synaptic currents recorded from dentate granule cells of nave, fully kindled and AAV SST injected animals. Our initial result promp ted the use of a vector that co expressed both SST and GFP, so better visualization of SST containing cells and axonal processes could be attained. This would ensure that only those granule cells would be patched and

PAGE 77

77 subsequently recorded from that were di rectly synaptically innervated by SST positive interneurons. Even with the use of the AAV SST GFP vector, we found no substantial differences in excitatory or inhibitory activity of granule cells. Some in vitro studies have shown that EPSCs generated at mo ssy fiber synapses, which are the output of dentate granule cells are insensitive to SST (Tallent and Siggins 1999) This study also showed that SST inhibits epileptiform activity specifically in the CA1 and CA3 sub regions of the hippocampus. Augmentation of the K + M current is identified as the major mechanism (Moore, et al. 1988, Schweitzer, et al. 1990, Schweitzer, et al. 1998) The M current (I M ) has been identified as a sustained voltage dependent potassium conductance in a wide variety of peripheral and central neurons (Womble and Moises 1992) It is therefore possible that the output of granule cells is not substantially affected by the over expression of SST, and that most effects are dominant in either CA3 or CA1. SST has also been implicated in memory impairments experienc disease, and most of these are in part due to an inhibition of LTP. The major mechanism of LTP inhibition is postulated to be a blockage of voltage gated calcium channels on dentate granule cells (Tallent 2007) It is therefore plausible that most effects of SST are dendritic and not somatic. Studies observing cellular responses from the basolateral amygdala neurons of kindled rats have showed an increase in the amplitude of evoked excitatory post synaptic potentials (EPSPs), with no change in inhibitory post synaptic potentials (IPSPs) (Shoji, et al. 1998) Another study recorded from layers II and III of the anterior pi riform cortex bilaterally in kindled rats, miniature IPSCs (mIPSCs) were recorded from

PAGE 78

78 pyramidal and non pyramidal neurons. They found an increase in the amplitude of mIPSCs from non pyramidal cells on the side that was stimulated, suggesting an increased inhibitory synaptic strength on interneurons as a result of kindling (Gavrilovici, et al. 2006) It is therefore possible actions and therefore our analysis of the very broad spontaneous activity of granule cells may not have been specific enough to pick up differences in cellular alterations as a result of SST over expression. Additionally, as mentioned previously, neuropeptide release from interneurons is a result of high frequency stimulation. The SST gene contains a cyclic AMP response element (CRE). The presence of this regulatory element confers activity dependence to the gene, switching it on when neuronal activity is high (Tallent 2007) Consequently, somatostatin may not be released under basal conditions unless tetanus is applied to the slice. Hence, spontaneous excitatory and inhibitory activity may not change as a result of somatostatin over expression without some degree of perturbation to the system.

PAGE 79

79 Figure 5 1. Frequency and amplitude of sEPSCs. A) shows a 1s epoch of raw data traces recorded from nave (n=11) kindled (n=12) AAV SST (n=7) and AAV SST GFP (n=6) injected rats. B) shows frequency of events recorded from the same animal groups, and C) shows amplitude of events. No significant difference was observed in frequency or ampli tude of sEPSCs (p>0.05 n denotes number of cells).

PAGE 80

80 Figure 5 2. Frequency and amplitude of sIPSCs. A) shows a 1s epoch of raw data traces recorded from nave (n=17) kindled (n=9) AAV SST (n=12) and AAV SST GFP (n=8) injected rats. B) shows frequency of events recorded from the same animal groups, and C) shows amplitude of events for the same. No significant difference was observed in frequency or amplitude of sIPSCs (p>0.05, n denotes number of cells)

PAGE 81

81 CHAPTER 6 CONCLUSIONS Findi ngs and Future Directions Although epilepsy is one of the oldest conditions to be described in ancient Babylonian texts dating 3000 years ago, the mechanisms that cause seizures still elude us. Due to the complex etiology of epilepsy, no one therapeutic pa radigm has been able to achieve a seizure free status in patients. At best, there has been some success in controlling seizures with anti epileptic drugs, but these have also not been without caveats. Supplementary to the usage of medication, the Vagus Ner ve Stimulator was approved by the FDA in 1997 (Schachter 2002) to be used as an adjunct therapy for pati ents whose seizures were refractory. In addition, there has been developing interest in Deep Brain Stimulation (DBS) to be used for epilepsy therapy as well. Although DBS (Collins, et al. 2010) Given the significant population of people afflicted with epilepsy in the United States as well as world wide, and the 30% from this pool that currently have medically refractory epilepsy, the need for an alternate, safe therapy becomes imminent. The rationale for the project described in this dissertation was not only to devise an alternative treatment for intractable temporal lobe seizures, but also to encompass all the NIH benchmarks in the field of epilepsy research. We utilized gene therapy to construct viral vectors coding for the SST gene to be tested in a rodent model of epilepsy. The details of the construction of three viral vectors we used in our study are discussed in Chapter 3. We saw ro bust transduction of hippocampal neurons with the use of AAV5 vectors, with sustained temporal and spatial gene expression. The next

PAGE 82

82 step in our approach was to introduce viral vector delivered SST into hippocampal regions of the rodent brain and then indu ce seizures by use of electrical stimulation. We observed that 70% of the SST over expressing animal group did not have a single grade 5 (generalized) seizure compared to control animals. Additionally, the seizure quantification index, calculated by takin g into account the behavioral grade as well as seizure length at each stimulation was lower in SST over expressing rats as compared to controls. This shows a protective effect of SST against the progression of epilepsy. We next performed preliminary testin g of these animals in the Morris water maze to modulation of such cognitive tasks (Gahete, et al.) We observed that SST over expressin g animals performed just as well as nave and control animals. There was a trend in SST over expressing animals to perform slightly better in the testing phase 24 hours post training in the water maze, but it is difficult to say this unequivocally due to l ow sample size. Impairments in memory and learning are also common co morbidities in patients with epilepsy, so our preliminary assessment is promising for use of SST with this patient population. Lastly, we also attempted to corroborate our in vivo findin gs with in vitro mechanisms by using whole patch clamp techniques to record spontaneous excitatory and inhibitory post synaptic currents in gene injected animals versus controls. We did not see a difference in the frequency or amplitude of sEPSCs or sIPSCs We plan to parse out the in vitro effects more in detail by more stringent identification of the substrates that may be responsible for the behavioral changes observed and discussed in Chapter 4.

PAGE 83

83 This study is the first undertaking to identify the in vi vo effects of SST over expression by use of viral vectors in an electrical kindling model of temporal lobe epilepsy. There has been a plethora of information obtained from the use of in vitro models and how SST may play a role in modulating seizure activit y, yet no attempt to demonstrate its neuroprotective effects has thus far been made which would validate its use as a therapeutic agent. We used the electrical kindling model not only because it provides a nice transition from low grade to high grade seizu res, but also makes it easier to quantify the severity of seizures. We utilized gene therapy as the approach to deliver SST as a therapeutic agent within the CNS, since the technique utilizes viral vectors to deliver the gene without itself having patholog ical effects within the CNS. Additionally, using a vector with a constitutively active, non specific promoter allows maximal transgene expression with limited deleterious effects to the host. Future exploration of the effects of SST in a chronic model of t emporal lobe epilepsy will further validate its use as an effective alternative for preventing and treating intractable epilepsy. Additionally, assessment of how potassium M currents and other putative mechanisms are modulated in SST gene injected animals will also help validate our in vivo findings with the current knowledge of the mechanisms of SST. Highlights in Epilepsy Research How Far We Have Come possession by evil spirits, witchcraft or poisoning and believed by many to be contagious Later on, seizures were believed to arise from an imbalance in bodily humors and trepanation and disorder was recogni zed as early as about 400 BC, reflected by H ippocrates remark ing that epilepsy would cease to be considered divine the day it was understood

PAGE 84

84 Since then, much work has been done to unravel the underlying cause of seizures as well as identification of elec troencephalographic biomarkers that could point to the onset of an imminent seizure. The understanding of the complex nature of seizures is important since they are a common phenotypic feature not just of epilepsy but also a myriad of other neurological di seases like multiple sclerosis (Catenoix, et al. 2010) (Jayadev, et al. 2010) t uberous sclerosis (Zamponi, et al. 2010) etc. Additionally, the cost of epilepsy is estimated to be about $15.5 billion annually in the U.S. in direct and indirect costs (http://www.epilepsyfoundation.org/) The adverse effects of epilepsy and its treatments are often highlighted among the patient population that is refractory to current medical treatments. About 50% of patients diagnosed with epilepsy become seizure free after their first antiepileptic drug (Kwan and Brodie 2001) However, it is generally accepted that 30% of patients with epilepsy never achieve a seizure free status with AEDs (Brodie 2005, Kwan a nd Brodie 2000) Refractory epilepsy is generally diagnosed after two AEDs fail to control seizures, either because of low efficacy or serious side effects that make the drug intolerable (Kwan and Brodie 2002) Current treatments for this patient populati on that does not achieve remission with AEDs include the use of the vagus nerve stimulator (VNS), the ketogenic diet and surgical resection of the seizure focus in severe instances. The United States Food and Drug Administration (FDA) approved the use of t he VNS in 1997 as an adjunctive therapy for partial onset epilepsy. It has been reported that about 50% of patients with the VNS observe a seizure reduction of greater than 50%, but less than 10% become completely seizure free (Jobst 2010) The exact mechanism of the VNS is currently unknown, but it is believed that stimulation of the vagus nerve increases the inhibitory

PAGE 85

85 GABA er gic tone and inhibition of abnormal cortical activity due to activation by the reticular system (Ghanem and Early 2006) The ketogenic d iet is a specialized diet with a high fat and low carbohydrate content. Although the mechanism of action of this therapy is also unknown, it is believed that the high fat diet metabolizes to produce fatty acids and ketone bodies. These ketone bodies pass i nto the brain and replace glucose as the major energy source. The resulting ketosis, or high level of ketones in the blood leads to a reduction in the frequency of seizures (Freeman, et al. 2007) The option of surgical resec tion is intuitively the most invasive and also carries the most risk. Surgical resection is only an option for patients whose seizure focus can be identified with the use of imaging and EEG techniques. Surgical resection, no doubt has the highest risk due to the invasiveness of the procedure. Nonetheless, even this treatment is not without caveats, and a percentage of the population will go into remission for a period of time before the epileptic focus shifts and seizures emerge again. It is therefore prude nt that new treatment options be evaluated for the vast population of patients suffering from refractory epilepsy. Not only should the treatment be effective, but also have limited side effects. The National Institute of Health has laid benchmarks for epil epsy to guide future research. The first benchmark area is the co morbidities associated with epilepsy and its trying to optimize gene delivery with the use of viral vectors and promoters that will achieve best transgene expressio n into specific regions of the brain. We have also

PAGE 86

86 shown that SST lends protection against the generalization of seizures in our animal model, with no exacerbation of potential co morbidities. The Future of Gene Therapy The use of gene therapy has not bee n without controversy. The first reports of were made in 1972 (Friedmann and Roblin 1972) The first human gene therapy trial in the United States took place in 2002, and since then there have been many subsequent ones for the treatment of a plethora of diseases. The successes of gene therapy have been received with mixed reviews, both due to medical as well as ethical reasons. The death of Jesse Gelsinger in 1999 after a gene therapy trial for ornithine transcarbamylase deficiency (Wilson 2009) using the adenovirus vector was a big setback for scientists. It raised concerns about the safety of using viral vectors as vehicles for delivering therapeutic genes to the human body. Th ere have been tremendous advances in the development of safer and more efficient viral vectors since then. The development of self complementary AAV (scAAV) vectors has been a milestone in increasing the efficiency of AAV vectors, since the conversion of s ingle stranded DNA to double stranded DNA is the rate limiting step in gene expression (McCarty, et al. 2001) Furthermore, engineering viral capsids to alter surface exposed tyrosine residues has also increased the efficiency of transgene expression by many fold due to the avoidance of ubiquitination that leads to de gradation (Markusic, et al. 2010) AAV also infects a wide variety of cell types within the body, thereby being a vector of choice for treating many diseases with disparate phenotypes. Many human gene therapy trials involving the use of AAV are currently in Phase I/II clinical trials for the tr eatment of hemophilia (Manno, et al. 2003) cystic fibrosis (Flotte

PAGE 87

87 and Laube 2001) (Kaplitt, et al. 2007) (Worgall, et al. 2008) and muscular dystrophy (Mandel, et al. 2006) to name a few. The intractable nature of temporal lobe seizures has also spurred research involving the use of neuropeptides in gene therapy. The use of endogenous neuropeptides like galanin and NPY fo r epilepsy has recently shown beneficial effects by prolonging the latent period following administration of proconvulsants (McCown 2006, Noe, et al. 2009, Noe, et al. 2007, Schlifke, et al. 2006) Pre clinical suc cesses of these neuropeptides have further strengthened the rationale behind human clinical trials that are currently under evaluation by the FDA (Vezzani 2007) Our study with SST has further enhanced this field by reporting protective effects in vivo that have thus far been unexplored. With the use of such peptides that are endogenous to the CNS, the looming threat of an immune response can be minimized. This same property however, makes the use of such peptides a little more risky since they have a variety of functions withi n the body and alterations in the levels of the molecules and their cognate receptors may have disastrous outcomes. The use of neuron specific promoters has made this problem trivial to some extent. The only drawback of using AAV has thus far been the limi ted size of transgene that can be packaged into the vector since most therapeutic Experimentation is currently underway to overcome the problem of limited cloning capacity. The introd uction of transgenes can also be facilitated with the use of non viral vectors. The use of naked DNA and lipoplexes was deemed favorable because of the low cost of production, as well as low immunogenicity. However, a major drawback for

PAGE 88

88 using such vectors has been low levels of transfection and gene expression in addition to risk of in vivo toxicity. Furthermore, direct application of exogenous peptides like SST may also not be a viable option due to the short half life of the peptide (~3 minutes). Additio nally, peptides and peptide analogs may not be able to cross the blood brain barrier to reach the site of interest, which makes the usage of largely benign viral vectors attractive as tools for delivering these therapeutic agents. SST in the CNS All somat ostatin positive neurons in the hippocampus have been classified as interneurons based on morphology, distribution and frequency of occurrence (Freund and Buzsaki 1996) They are all also immunoreactive for GAD, the enzyme responsible for the conversion of glutamate to GABA. SST containing interneurons in the dentate hilus are synonymous with HIPP cells (Freund and Buzsaki 1996) The dendritic arbors of practically all Cajal (Cajal 1893) and Amaral (Amaral 1978) using Golgi impregnation. HIPP cells were first iden tified with dendritic arborization limited exclusively to the dentate hilus with extensive axonal innervations to the outer two thirds of the outer molecular layer of the hippocampus (Han, et al. 1993) HIPP cells largely form symmetrical (inhibitory) synapses on dentate granule cells in conjunction with entorhinal afferents. Dendrites of HIPP cells are also recurrently innervated by axons of granule cells called mossy fibers. Thus, there exists a feedback inhibition of granule cells through these HIPP cells. The laminar d istribution of SST positive axons is consistent from animal to animal within the dentate hilus. Another subset of neurons within the hippocampal CA1 subfield that contains SST are the O LM cells; interneurons with soma and dendrites in the stratum oriens a nd axons in lacunosum moleculare. SST containing cells are more widespread

PAGE 89

89 in the CA3, with multipolar dendritic trees and frequently occur in stratum pyramidale, stratum lucidum and stratum radiatum. Some cells can also be found in the myelinated axon bun dles of the alveus in both regions, but especially in the CA1. SST positive cells are also immunoreactive for mGluR1 and substance P receptors. Similar to the hilus, SST positive cells receive excitatory inputs from principal cells in the CA3 and CA1, and thus are likely to mediate feedback inhibition of these principal innervating neurons. SST containing interneurons in the hilus do not contain calcium binding proteins like parvalbumin, calretinin, or calbindin (Tallent 2007) on the contrary most CA3 and CA1 SST interneurons contain at least one of these (Bouilleret, et al. 2000b) Dentate hilar interneurons containing SST have gained i nterest due to studies showing upregulation as a result of mild seizures and vulnerability as a result of severe seizures (Tallent 2007) Additionally, a novel role of SST with i mplications on neprilysin activity, which is an A degrading peptidase. SST knockout models have shown an increase in A 42 levels, which is the amyloid fragment most closel y (Saito, et al. 2005) Changes in C NS SST levels have also been reported in other neurodegenerative diseases associated with cognitive impairment. Reduced levels of SST in the CSF were reported in people suffering from depression (Agren and Lundqvist 1984) decline (Epelbaum, et al. 1983) multiple sclerosis (Vecsei, et al. 1990) and schizophrenia (Gabriel, et al. 1996) The contribution of this dissertation has been to highlight the novel role of SST as a potentially new therapeutic agent for temporal lobe epilepsy through a proof of

PAGE 90

90 pr inciple, pre clinical study. Our data adds an in vivo dimension to the existing in vitro literature highlighting the role of this ubiquitous neuropeptide in the modulation of an epileptic network. Our proof of principle findings necessitate further testing of SST in more robust, translational models of epilepsy before it can be considered a valid candidate for testing in human patients. Nonetheless, the protection rendered by somatostatin against the generalization of seizures in a rodent model is a signifi cant first step towards addressing the need for alternative therapies for intractable epilepsy, which may ultimately also be utilized for other diseases.

PAGE 91

91 APPENDIX SEQUENCE OF PREPROSOMATOSTATIN ATGCTGTCCTGCCGTCTCCAGTGCGCGCTGGCCGCGCTCTGCATCGTCCTGGCTT TGGGCG GTGTCACCGGGGCGCCCTCGGACCCCAGACTCCGTCAGTTTCTGCAGA AGTCTCTGGCGGCTGCCACCGGGAAACAGGAACTGGCCAAGTACTTCTTGGCAGA ACTGCTGTCCGAGCCCAACCAGACAGAGAACGATGCCCTGGAGCCTGAGGATTTG CCCCAGGCAGCTGAGCAGGACGAGATGAGGCTGGAGCTGCAGAGGTCTGCCAAC TCGAACCCAGCCATGGCACCCCGGGAACGCAAAGCTGGCTGCAA GAACTTCTTCT GGAAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCTCAGCCAGACCTCTGAAG GGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGCG GATCCGTCGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGC CATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCC ACTGTCCTTTCCTAATAAAATG AGGAAATTGCATCGCATTGTCTGAGTAGGTGTCAT TCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAC AATAGCAGGCATGCTGGGGAGAGATCTAGGAACCCCTAGTGATGGAGTTGGCCAC TCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCG TCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGG GAGTG GCCAACCCCCCCCCCCCCCCCCCTGCAGCCCTGCATTAATGAATCGGCCA ACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACT GACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAG GCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAG CAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGT TGCTGGCGTTTTT CCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGG TGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCC

PAGE 92

92 TCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTC CCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGT GTAGGTCGTTCGCTCCAAGCT GGGCTGTGTGCACGAACCCCCCGTTCAGCCCGAC CGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTT ATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGC GGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAG TATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGC TCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCA GCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGG GGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTA TCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCT AAAGTATATATGAGTAAACTTGGTCTGACA GTTACCAATGCTTAATCAGTGAGGCAC CTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGT AGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACC GCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGA AGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTA ATTGTTG CCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT GTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATT CAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAA AAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGT GTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTT ACTGTCATGCCATCCGT AAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTAT GCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACAT

PAGE 93

93 AGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACT GATCTTCAGCATCTT TTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGG CAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACT CTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGA AAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATT AACCTATAAAAAT AGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACC TCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGG GAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCT GGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTG TGAAATACCGCACAGATGCGTAAGG AGAAAATACCGCATCAGGAAATTGTAAACGT TAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAAT AGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTG AGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGT CAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACC C TAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGG GAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGA AGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCAC GCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTC GCGCCATTCGCCATTCAGGCTACGCAACTGTTGGGAA GGGCGATCGGTGCGGGC CTCTTCGCTATTACGCCAGGCTGCA

PAGE 94

94 LIST OF REFERENCES Aenlle KK, Kumar A, Cui L, Jackson TC, Foster TC. (2009) Estrogen effects on cognition and hippocampal transcription in middle aged mice. Neurobiol Aging 30:932 945. Agren H Lundqvist G. (1984) Low levels of somatostatin in human CSF mark depressive episodes. Psychoneuroendocrinology 9:233 248. Akins PT, Belko J, Uyeki TM, Axelrod Y, Lee KK, Silverthorn J. (2010) H1N1 Encephalitis with Malignant Edema and Review of Neurologi c Complications from Influenza. Neurocrit Care Amaral DG. (1978) A Golgi study of cell types in the hilar region of the hippocampus in the rat. J Comp Neurol 182:851 914. Amaral DG, Insausti R, Campbell MJ. (1988) Distribution of somatostatin immunoreacti vity in the human dentate gyrus. J Neurosci 8:3306 3316. Amaral DG, Lavenex P. (2007) Hippocampal Neuroanatomy. In: The Hippocampus Book Oxford University Press, New York. Amunts K, Kedo O, Kindler M, Pieperhoff P, Mohlberg H, Shah NJ, Habel U, Schneider F, Zilles K. (2005) Cytoarchitectonic mapping of the human amygdala, hippocampal region and entorhinal cortex: intersubject variability and probability maps. Anat Embryol (Berl) 210:343 352. Andersen P, Bliss TV, Lomo T, Olsen LI, Skrede KK. (1969) Lamella r organization of hippocampal excitatory pathways. Acta Physiol Scand 76:4A 5A. Aroniadou Anderjaska V, Fritsch B, Qashu F, Braga MF. (2008) Pathology and pathophysiology of the amygdala in epileptogenesis and epilepsy. Epilepsy Res 78:102 116. Bancaud J, Henriksen O, Rubio Donnadieu F, Seino M, Dreifuss FE, Perry JK. (1981) Proposal for revised clinical and electroencephalographic classification of epileptic seizures. From the Commission on Classification and Terminology of the International League Against Epilepsy. Epilepsia 22:489 501. Bantel Schaal U, zur Hausen H. (1984) Characterization of the DNA of a defective human parvovirus isolated from a genital site. Virology 134:52 63. Baraban SC, Tallent MK. (2004) Interneuron Diversity series: Interneuronal neuropeptides -endogenous regulators of neuronal excitability. Trends Neurosci 27:135 142. Bartfai T, Iverfeldt K, Fisone G, Serfozo P. (1988) Regulation of the release of coexisting neurotransmitters. Annu Rev Pharmacol Toxicol 28:285 310.

PAGE 95

95 Bennewitz MF, S altzman WM. (2009) Nanotechnology for delivery of drugs to the brain for epilepsy. Neurotherapeutics 6:323 336. Berns KI, Linden RM. (1995) The cryptic life style of adeno associated virus. Bioessays 17:237 245. Bertram E. (2007) The relevance of kindling for human epilepsy. Epilepsia 48 Suppl 2:65 74. Bertram EH, Zhang D, Williamson JM. (2008) Multiple roles of midline dorsal thalamic nuclei in induction and spread of limbic seizures. Epilepsia 49:256 268. Boehm S, Betz H. (1997) Somatostatin inhibits exci tatory transmission at rat hippocampal synapses via presynaptic receptors. J Neurosci 17:4066 4075. Bouilleret V, Loup F, Kiener T, Marescaux C, Fritschy JM. (2000a) Early loss of interneurons and delayed subunit specific changes in GABA(A) receptor expres sion in a mouse model of mesial temporal lobe epilepsy. Hippocampus 10:305 324. Bouilleret V, Schwaller B, Schurmans S, Celio MR, Fritschy JM. (2000b) Neurodegenerative and morphogenic changes in a mouse model of temporal lobe epilepsy do not depend on the expression of the calcium binding proteins parvalbumin, calbindin, or calretinin. Neuroscience 97:47 58. Bowen R. (2002) Hypertexts for Biomedical Sciences. Brazeau P, Vale W, Burgus R, Ling N, Butcher M, Rivier J, Guillemin R. (1973) Hypothalamic polypep tide that inhibits the secretion of immunoreactive pituitary growth hormone. Science 179:77 79. Brodie MJ. (2005) Diagnosing and predicting refractory epilepsy. Acta Neurol Scand Suppl 181:36 39. Buckmaster PS, Dudek FE. (1997) Neuron loss, granule cell ax on reorganization, and functional changes in the dentate gyrus of epileptic kainate treated rats. J Comp Neurol 385:385 404. Buckmaster PS, Otero Corchon V, Rubinstein M, Low MJ. (2002) Heightened seizure severity in somatostatin knockout mice. Epilepsy Re s 48:43 56. Cajal Ry. (1893) Estructura del asfa de Ammon y fascia dentata. Ann SOC Esp Hist Nat 22. Cascino GD. (2008) When drugs and surgery don't work. Epilepsia 49 Suppl 9:79 84. Cascino GD. (2009) Temporal lobe epilepsy is a progressive neurologic dis order: Time means neurons! Neurology 72:1718 1719.

PAGE 96

96 Catenoix H, Marignier R, Ritleng C, Dufour M, Mauguiere F, Confavreux C, Vukusic S. (2010) Multiple sclerosis and epileptic seizures. Mult Scler Chan Palay V. (1987) Somatostatin immunoreactive neurons in the human hippocampus and cortex shown by immunogold/silver intensification on vibratome sections: coexistence with neuropeptide Y neurons, and effects in Alzheimer type dementia. J Comp Neurol 260:201 223. Chen S, Kapturczak M, Loiler SA, Zolotukhin S, G lushakova OY, Madsen KM, Samulski RJ, Hauswirth WW, Campbell Thompson M, Berns KI, Flotte TR, Atkinson MA, Tisher CC, Agarwal A. (2005) Efficient transduction of vascular endothelial cells with recombinant adeno associated virus serotype 1 and 5 vectors. H um Gene Ther 16:235 247. Cherubini E, North RA. (1985) Mu and kappa opioids inhibit transmitter release by different mechanisms. Proc Natl Acad Sci U S A 82:1860 1863. Chiorini JA, Kim F, Yang L, Kotin RM. (1999) Cloning and characterization of adeno assoc iated virus type 5. J Virol 73:1309 1319. Chiu MJ, Lin CW, Chen CC, Chen TF, Chen YF, Liu HM, Chu CP, Liou HH, Hua MS. (2010) Impaired gist memory in patients with temporal lobe epilepsy and hippocampal sclerosis. Epilepsia 51:1036 1042. Choi IS, Cho JH, L ee MG, Choi BJ. (2005a) Pilocarpine induced seizure susceptibility in rats following prenatal methylazoxymethanol treatment. Biol Pharm Bull 28:1408 1413. Choi VW, McCarty DM, Samulski RJ. (2005b) AAV hybrid serotypes: improved vectors for gene delivery. C urr Gene Ther 5:299 310. Collins KL, Lehmann EM, Patil PG. (2010) Deep brain stimulation for movement disorders. Neurobiol Dis 38:338 345. Colmers WF, Lukowiak K, Pittman QJ. (1985) Neuropeptide Y reduces orthodromically evoked population spike in rat hipp ocampal CA1 by a possibly presynaptic mechanism. Brain Res 346:404 408. Cossart R, Dinocourt C, Hirsch JC, Merchan Perez A, De Felipe J, Ben Ari Y, Esclapez M, Bernard C. (2001) Dendritic but not somatic GABAergic inhibition is decreased in experimental ep ilepsy. Nat Neurosci 4:52 62. Crompton DE, Scheffer IE, Taylor I, Cook MJ, McKelvie PA, Vears DF, Lawrence KM, McMahon JM, Grinton BE, McIntosh AM, Berkovic SF. (2010) Familial mesial temporal lobe epilepsy: a benign epilepsy syndrome showing complex inher itance. Brain

PAGE 97

97 Csaba Z, Pirker S, Lelouvier B, Simon A, Videau C, Epelbaum J, Czech T, Baumgartner C, Sperk G, Dournaud P. (2005) Somatostatin receptor type 2 undergoes plastic changes in the human epileptic dentate gyrus. J Neuropathol Exp Neurol 64:956 9 69. Csaba Z, Richichi C, Bernard V, Epelbaum J, Vezzani A, Dournaud P. (2004) Plasticity of somatostatin and somatostatin sst2A receptors in the rat dentate gyrus during kindling epileptogenesis. Eur J Neurosci 19:2531 2538. Davies P, Katzman R, Terry RD. (1980) Reduced somatostatin like immunoreactivity in cerebral cortex from cases of Alzheimer disease and Alzheimer senile dementa. Nature 288:279 280. Davis KL, Mohs RC, Marin DB, Purohit DP, Perl DP, Lantz M, Austin G, Haroutunian V. (1999) Neuropeptide a bnormalities in patients with early Alzheimer disease. Arch Gen Psychiatry 56:981 987. Daya S, Berns KI. (2008) Gene therapy using adeno associated virus vectors. Clin Microbiol Rev 21:583 593. De Garengeot RJC. (1742) Splanchnologie ou l'anatomie des visc res Paris. de Lanerolle NC, Kim JH, Robbins RJ, Spencer DD. (1989) Hippocampal interneuron loss and plasticity in human temporal lobe epilepsy. Brain Res 495:387 395. Dinocourt C, Petanjek Z, Freund TF, Ben Ari Y, Esclapez M. (2003) Loss of interneurons innervating pyramidal cell dendrites and axon initial segments in the CA1 region of the hippocampus following pilocarpine induced seizures. J Comp Neurol 459:407 425. Doloff JC, Waxman DJ. (2010) Dual E1A oncolytic adenovirus: targeting tumor heterogeneity with two independent cancer specific promoter elements, DF3/MUC1 and hTERT. Cancer Gene Ther Dreyer JL. (2010) Lentiviral Vector Mediated Gene Transfer and RNA Silencing Technology in Neuronal Dysfunctions. Mol Biotechnol Dudek FE. (2009) Commentary: a skeptical view of experimental gene therapy to block epileptogenesis. Neurotherapeutics 6:319 322. Epelbaum J. (1986) Somatostatin in the central nervous system: physiology and pathological modifications. Prog Neurobiol 27:63 100. Epelbaum J, Ruberg M, Moy se E, Javoy Agid F, Dubois B, Agid Y. (1983) Somatostatin and dementia in Parkinson's disease. Brain Res 278:376 379. Flotte TR. (2005) Adeno associated virus based gene therapy for inherited disorders. Pediatr Res 58:1143 1147.

PAGE 98

98 Flotte TR, Berns KI. (2005a ) Adeno Associated Viral Vectors for Gene Therapy. Laboratory Techniques in Biochemistry and Molecular Biology 31. Flotte TR, Berns KI. (2005b) Adeno associated virus: a ubiquitous commensal of mammals. Hum Gene Ther 16:401 407. Flotte TR, Laube BL. (2001) Gene therapy in cystic fibrosis. Chest 120:124S 131S. Freeman JM, Kossoff EH, Hartman AL. (2007) The ketogenic diet: one decade later. Pediatrics 119:535 543. Freund TF, Buzsaki G. (1996) Interneurons of the hippocampus. Hippocampus 6:347 470. Friedmann T Roblin R. (1972) Gene therapy for human genetic disease? Science 178:648 649. Gabriel SM, Davidson M, Haroutunian V, Powchik P, Bierer LM, Purohit DP, Perl DP, Davis KL. (1996) Neuropeptide deficits in schizophrenia vs. Alzheimer's disease cerebral corte x. Biol Psychiatry 39:82 91. Gahete MD, Rubio A, Duran Prado M, Avila J, Luque RM, Castano JP. Expression of Somatostatin, cortistatin, and their receptors, as well as dopamine receptors, but not of neprilysin, are reduced in the temporal lobe of Alzheimer 's disease patients. J Alzheimers Dis 20:465 475. Gavrilovici C, D'Alfonso S, Dann M, Poulter MO. (2006) Kindling induced alterations in GABAA receptor mediated inhibition and neurosteroid activity in the rat piriform cortex. Eur J Neurosci 24:1373 1384. G hanem T, Early SV. (2006) Vagal nerve stimulator implantation: an otolaryngologist's perspective. Otolaryngol Head Neck Surg 135:46 51. Ghijsen WE, Zuiderwijk M, Lopes da Silva FH. (2007) Electrically evoked GABA release in rat hippocampus CA1 region and i ts changes during kindling epileptogenesis. Brain Res 1135:69 76. Goddard GV. (1967) Development of epileptic seizures through brain stimulation at low intensity. Nature 214:1020 1021. Greene JR, Mason A. (1996) Effects of somatostatin and related peptides on the membrane potential and input resistance of rat ventral subicular neurons, in vitro. J Pharmacol Exp Ther 276:426 432. Halbert CL, Allen JM, Miller AD. (2001) Adeno associated virus type 6 (AAV6) vectors mediate efficient transduction of airway epit helial cells in mouse lungs compared to that of AAV2 vectors. J Virol 75:6615 6624.

PAGE 99

99 Han ZS, Buhl EH, Lorinczi Z, Somogyi P. (1993) A high degree of spatial selectivity in the axonal and dendritic domains of physiologically identified local circuit neurons in the dentate gyrus of the rat hippocampus. Eur J Neurosci 5:395 410. Hauser AH, D. (1990) Epilepsy: frequency, causes and consequences Demos, New York. Hauser WA. (1992) The natural history of drug resistant epilepsy: epidemiologic considerations. Epi lepsy Res Suppl 5:25 28. Hokfelt T. (1991) Neuropeptides in perspective: the last ten years. Neuron 7:867 879. Hoyer D, Lubbert H, Bruns C. (1994) Molecular pharmacology of somatostatin receptors. Naunyn Schmiedebergs Arch Pharmacol 350:441 453. http://www.epilepsyfoundation.org/ http://www.neuropeptides.nl/ http://www.wrongdiagnosis.com/e/epilep sy/stats.htm Ichikou N, Ieiri I, Higuchi S, Hirata K, Yamada H, Aoyama T. (1990) Analysis of the factors influencing anti epileptic drug concentrations -carbamazepine. J Clin Pharm Ther 15:337 349. Ito M. (2009) Functional roles of neuropeptides in cereb ellar circuits. Neuroscience 162:666 672. Jannetto PJ, Bratanow NC. (2010) Pharmacogenomic considerations in the opioid management of pain. Genome Med 2:66. Jansari AS, Davis K, McGibbon T, Firminger S, Kapur N. (2010) When "long term memory" no longer mea ns "forever": analysis of accelerated long term forgetting in a patient with temporal lobe epilepsy. Neuropsychologia 48:1707 1715. Janson CG, McPhee SW, Leone P, Freese A, During MJ. (2001) Viral based gene transfer to the mammalian CNS for functional gen omic studies. Trends Neurosci 24:706 712. Jayadev S, Leverenz JB, Steinbart E, Stahl J, Klunk W, Yu CE, Bird TD. (2010) Alzheimer's disease phenotypes and genotypes associated with mutations in presenilin 2. Brain 133:1143 1154. Jequier Gygax M, Deonna T, Maeder P, Mayor Dubois C, Roulet Perez E. (2010) Acute infantile encephalopathy predominantly affecting the frontal lobe (AIEF): A European case. Eur J Paediatr Neurol

PAGE 100

100 Jiao Y, Sun Z, Lee T, Fusco FR, Kimble TD, Meade CA, Cuthbertson S, Reiner A. (1999) A simple and sensitive antigen retrieval method for free floating and slide mounted tissue sections. J Neurosci Methods 93:149 162. Jobst BC. (2010) Electrical stimulation in epilepsy: vagus nerve and brain stimulation. Curr Treat Options Neurol 12:443 453. Kairiss EW, Racine RJ, Smith GK. (1984) The development of the interictal spike during kindling in the rat. Brain Res 322:101 110. Kaplitt MG, Feigin A, Tang C, Fitzsimons HL, Mattis P, Lawlor PA, Bland RJ, Young D, Strybing K, Eidelberg D, During MJ. (200 7) Safety and tolerability of gene therapy with an adeno associated virus (AAV) borne GAD gene for Parkinson's disease: an open label, phase I trial. Lancet 369:2097 2105. Kits KS, Mansvelder HD. (2000) Regulation of exocytosis in neuroendocrine cells: spa tial organization of channels and vesicles, stimulus secretion coupling, calcium buffers and modulation. Brain Res Brain Res Rev 33:78 94. Klein RL, Hamby ME, Gong Y, Hirko AC, Wang S, Hughes JA, King MA, Meyer EM. (2002) Dose and promoter effects of adeno associated viral vector for green fluorescent protein expression in the rat brain. Exp Neurol 176:66 74. Klein RL, Meyer EM, Peel AL, Zolotukhin S, Meyers C, Muzyczka N, King MA. (1998) Neuron specific transduction in the rat septohippocampal or nigrostri atal pathway by recombinant adeno associated virus vectors. Exp Neurol 150:183 194. Kohler C, Eriksson LG, Davies S, Chan Palay V. (1987) Co localization of neuropeptide tyrosine and somatostatin immunoreactivity in neurons of individual subfields of the r at hippocampal region. Neurosci Lett 78:1 6. Kosaka T, Wu JY, Benoit R. (1988) GABAergic neurons containing somatostatin like immunoreactivity in the rat hippocampus and dentate gyrus. Exp Brain Res 71:388 398. Krettek JE, Price JL. (1977) Projections from the amygdaloid complex and adjacent olfactory structures to the entorhinal cortex and to the subiculum in the rat and cat. J Comp Neurol 172:723 752. Kwan P, Brodie MJ. (2000) Early identification of refractory epilepsy. N Engl J Med 342:314 319. Kwan P, Brodie MJ. (2001) Effectiveness of first antiepileptic drug. Epilepsia 42:1255 1260. Kwan P, Brodie MJ. (2002) Refractory epilepsy: a progressive, intractable but preventable condition? Seizure 11:77 84.

PAGE 101

101 Kwan P, Brodie MJ. (2003) Clinical trials of antiepi leptic medications in newly diagnosed patients with epilepsy. Neurology 60:S2 12. Leranth C, Malcolm AJ, Frotscher M. (1990) Afferent and efferent synaptic connections of somatostatin immunoreactive neurons in the rat fascia dentata. J Comp Neurol 295:111 122. Levine SZ, Lurie I, Kohn R, Levav I. Trajectories of the course of schizophrenia: From progressive deterioration to amelioration over three decades. Schizophr Res Ludwig M, Pittman QJ. (2003) Talking back: dendritic neurotransmitter release. Trends N eurosci 26:255 261. Maciejak P, Szyndler J, Lehner M, Turzynska D, Sobolewska A, Bidzinski A, Plaznik A. (2010) The differential effects of protein synthesis inhibition on the expression and reconsolidation of pentylenetetrazole kindled seizures. Epilepsy Behav 18:193 200. Mandel RJ. (2010) CERE 110, an adeno associated virus based gene delivery vector expressing human nerve growth factor for the treatment of Alzheimer's disease. Curr Opin Mol Ther 12:240 247. Mandel RJ, Burger C. (2004) Clinical trials in neurological disorders using AAV vectors: promises and challenges. Curr Opin Mol Ther 6:482 490. Mandel RJ, Manfredsson FP, Foust KD, Rising A, Reimsnider S, Nash K, Burger C. (2006) Recombinant adeno associated viral vectors as therapeutic agents to treat neurological disorders. Mol Ther 13:463 483. Manno CS, Chew AJ, Hutchison S, Larson PJ, Herzog RW, Arruda VR, Tai SJ, Ragni MV, Thompson A, Ozelo M, Couto LB, Leonard DG, Johnson FA, McClelland A, Scallan C, Skarsgard E, Flake AW, Kay MA, High KA, Glader B. (2003) AAV mediated factor IX gene transfer to skeletal muscle in patients with severe hemophilia B. Blood 101:2963 2972. Manservigi R, Argnani R, Marconi P. (2010) HSV Recombinant Vectors for Gene Therapy. Open Virol J 4:123 156. Markusic DM, Herzog RW Aslanidi GV, Hoffman BE, Li B, Li M, Jayandharan GR, Ling C, Zolotukhin I, Ma W, Zolotukhin S, Srivastava A, Zhong L. (2010) High efficiency Transduction and Correction of Murine Hemophilia B Using AAV2 Vectors Devoid of Multiple Surface exposed Tyrosine s. Mol Ther Mazarati A, Wasterlain CG. (2002) Anticonvulsant effects of four neuropeptides in the rat hippocampus during self sustaining status epilepticus. Neurosci Lett 331:123 127.

PAGE 102

102 Mazarati AM, Telegdy G. (1992) Effects of somatostatin and anti somatos tatin serum on picrotoxin kindled seizures. Neuropharmacology 31:793 797. McCarty DM, Monahan PE, Samulski RJ. (2001) Self complementary recombinant adeno associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 8:1248 1254. McCown TJ. (2006) Adeno associated virus mediated expression and constitutive secretion of galanin suppresses limbic seizure activity in vivo. Mol Ther 14:63 68. McCoy SI, Jewell NP, Hubbard A, Gerdts CE, Doherty IA, Padian NS, Minnis AM. A trajectory analysis of alcohol and marijuana use among latino adolescents in san francisco, california. J Adolesc Health 47:564 574. McDonald AJ, Mascagni F. (2002) Immunohistochemical characterization of somatostatin containing interneurons in the rat basolateral amygdala. Brain Res 943:237 244. Mehla J, Reeta KH, Gupta P, Gupta YK. (2010) Protective effect of curcumin against seizures and cognitive impairment in a pentylenetetrazole kindled epileptic rat model. Life Sci Meisler MH, Kearney JA. (2005) Sodium channel mutations in epilepsy and other neurological disorders. J Clin Invest 115:2010 2017. Mikkelsen JD, Woldbye DP. (2006) Accumulated increase in neuropeptide Y and somatostatin gene expression of the rat in response to repeated electroconvulsiv e stimulation. J Psychiatr Res 40:153 159. Milner TA, Bacon CE. (1989) Ultrastructural localization of somatostatin like immunoreactivity in the rat dentate gyrus. J Comp Neurol 290:544 560. Moore SD, Madamba SG, Joels M, Siggins GR. (1988) Somatostatin au gments the M current in hippocampal neurons. Science 239:278 280. Mori S, Wang L, Takeuchi T, Kanda T. (2004) Two novel adeno associated viruses from cynomolgus monkey: pseudotyping characterization of capsid protein. Virology 330:375 383. Morimoto K, Fahn estock M, Racine RJ. (2004) Kindling and status epilepticus models of epilepsy: rewiring the brain. Prog Neurobiol 73:1 60. Niwa H, Yamamura K, Miyazaki J. (1991) Efficient selection for high expression transfectants with a novel eukaryotic vector. Gene 10 8:193 199. Noe F, Frasca A, Balducci C, Carli M, Sperk G, Ferraguti F, Pitkanen A, Bland R, Fitzsimons H, During M, Vezzani A. (2009) Neuropeptide Y overexpression using recombinant adeno associated viral vectors. Neurotherapeutics 6:300 306.

PAGE 103

103 Noe F, Nissin en J, Pitkanen A, Gobbi M, Sperk G, During M, Vezzani A. (2007) Gene therapy in epilepsy: the focus on NPY. Peptides 28:377 383. Orban G, Volgyi K, Juhasz G, Penke B, Kekesi KA, Kardos J, Czurko A. Different electrophysiological actions of 24 and 72 hour aggregated amyloid beta oligomers on hippocampal field population spike in both anesthetized and awake rats. Brain Res 1354:227 235. Peel AL, Klein RL. (2000) Adeno associated virus vectors: activity and applications in the CNS. J Neurosci Methods 98:95 10 4. Piwko C, Thoss VS, Samanin R, Hoyer D, Vezzani A. (1996) Status of somatostatin receptor messenger RNAs and binding sites in rat brain during kindling epileptogenesis. Neuroscience 75:857 868. Qiu C, Zeyda T, Johnson B, Hochgeschwender U, de Lecea L, Ta llent MK. (2008) Somatostatin receptor subtype 4 couples to the M current to regulate seizures. J Neurosci 28:3567 3576. Rabinowitz JE, Bowles DE, Faust SM, Ledford JG, Cunningham SE, Samulski RJ. (2004) Cross dressing the virion: the transcapsidation of a deno associated virus serotypes functionally defines subgroups. J Virol 78:4421 4432. Racine RJ. (1972) Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr Clin Neurophysiol 32:281 294. Racine RJ, Paxinos G, Mo sher JM, Kairiss EW. (1988) The effects of various lesions and knife cuts on septal and amygdala kindling in the rat. Brain Res 454:264 274. Ramos B, Baglietto Vargas D, del Rio JC, Moreno Gonzalez I, Santa Maria C, Jimenez S, Caballero C, Lopez Tellez JF, Khan ZU, Ruano D, Gutierrez A, Vitorica J. (2006) Early neuropathology of somatostatin/NPY GABAergic cells in the hippocampus of a PS1xAPP transgenic model of Alzheimer's disease. Neurobiol Aging 27:1658 1672. Reichlin S. (1983) Somatostatin. N Engl J Med 309:1495 1501. Reimsnider S, Manfredsson FP, Muzyczka N, Mandel RJ. (2007) Time course of transgene expression after intrastriatal pseudotyped rAAV2/1, rAAV2/2, rAAV2/5, and rAAV2/8 transduction in the rat. Mol Ther 15:1504 1511. Richichi C, Lin EJ, Stefa nin D, Colella D, Ravizza T, Grignaschi G, Veglianese P, Sperk G, During MJ, Vezzani A. (2004) Anticonvulsant and antiepileptogenic effects mediated by adeno associated virus vector neuropeptide Y expression in the rat hippocampus. J Neurosci 24:3051 3059.

PAGE 104

104 Rivera VM, Gao GP, Grant RL, Schnell MA, Zoltick PW, Rozamus LW, Clackson T, Wilson JM. (2005) Long term pharmacologically regulated expression of erythropoietin in primates following AAV mediated gene transfer. Blood 105:1424 1430. Robbins RJ, Brines ML, Kim JH, Adrian T, de Lanerolle N, Welsh S, Spencer DD. (1991) A selective loss of somatostatin in the hippocampus of patients with temporal lobe epilepsy. Ann Neurol 29:325 332. Rutledge EA, Halbert CL, Russell DW. (1998) Infectious clones and vectors der ived from adeno associated virus (AAV) serotypes other than AAV type 2. J Virol 72:309 319. Saito T, Iwata N, Tsubuki S, Takaki Y, Takano J, Huang SM, Suemoto T, Higuchi M, Saido TC. (2005) Somatostatin regulates brain amyloid beta peptide Abeta42 through modulation of proteolytic degradation. Nat Med 11:434 439. Salmani ME, Fathollahi Y, Mirnajafizadeh J, Semnanian S. Epileptogenic insult alters endogenous adenosine control on long term changes in synaptic strength by theta pattern stimulation in hippocamp us area CA1. Synapse Sashindranath M, McLean KJ, Trounce IA, Cotton RG, Cook MJ. (2010) Early hippocampal oxidative stress is a direct consequence of seizures in the rapid electrical amygdala kindling model. Epilepsy Res 90:285 294. Saucier D, Cain DP. (1 996) Competitive NMDA receptor antagonists do not block cholinergic kindling with carbachol. Epilepsy Res 24:9 18. Schachter SC. (2002) Vagus nerve stimulation therapy summary: five years after FDA approval. Neurology 59:S15 20. Schlifke I, Kuteeva E, Hokf elt T, Kokaia M. (2006) Galanin expressed in the excitatory fibers attenuates synaptic strength and generalized seizures in the piriform cortex of mice. Exp Neurol 200:398 406. Schmued LC, Stowers CC, Scallet AC, Xu L. (2005) Fluoro Jade C results in ultra high resolution and contrast labeling of degenerating neurons. Brain Res 1035:24 31. Schwarzer C, Sperk G, Samanin R, Rizzi M, Gariboldi M, Vezzani A. (1996) Neuropeptides immunoreactivity and their mRNA expression in kindling: functional implications for limbic epileptogenesis. Brain Res Brain Res Rev 22:27 50. Schweitzer P, Madamba S, Siggins GR. (1990) Arachidonic acid metabolites as mediators of somatostatin induced increase of neuronal M current. Nature 346:464 467.

PAGE 105

105 Schweitzer P, Madamba SG, Siggins G R. (1998) Somatostatin increases a voltage insensitive K+ conductance in rat CA1 hippocampal neurons. J Neurophysiol 79:1230 1238. Shoji Y, Tanaka E, Yamamoto S, Maeda H, Higashi H. (1998) Mechanisms underlying the enhancement of excitatory synaptic transm ission in basolateral amygdala neurons of the kindling rat. J Neurophysiol 80:638 646. Sloviter RS. (1987) Decreased hippocampal inhibition and a selective loss of interneurons in experimental epilepsy. Science 235:73 76. Sloviter RS. (2008) Hippocampal ep ileptogenesis in animal models of mesial temporal lobe epilepsy with hippocampal sclerosis: the importance of the "latent period" and other concepts. Epilepsia 49 Suppl 9:85 92. Sloviter RS, Nilaver G. (1987) Immunocytochemical localization of GABA chole cystokinin vasoactive intestinal polypeptide and somatostatin like immunoreactivity in the area dentata and hippocampus of the rat. J Comp Neurol 256:42 60. Solano Castiella E, Anwander A, Lohmann G, Weiss M, Docherty C, Geyer S, Reimer E, Friederici A D, Turner R. (2010) Diffusion tensor imaging segments the human amygdala in vivo. Neuroimage 49:2958 2965. Sorensen AT, Kanter Schlifke I, Carli M, Balducci C, Noe F, During MJ, Vezzani A, Kokaia M. (2008) NPY gene transfer in the hippocampus attenuates sy naptic plasticity and learning. Hippocampus 18:564 574. Sorensen AT, Nikitidou L, Ledri M, Lin EJ, During MJ, Kanter Schlifke I, Kokaia M. (2009) Hippocampal NPY gene transfer attenuates seizures without affecting epilepsy induced impairment of LTP. Exp Ne urol 215:328 333. Steward O, Scoville SA. (1976) Cells of origin of entorhinal cortical afferents to the hippocampus and fascia dentata of the rat. J Comp Neurol 169:347 370. Stief F, Zuschratter W, Hartmann K, Schmitz D, Draguhn A. (2007) Enhanced synapti c excitation inhibition ratio in hippocampal interneurons of rats with temporal lobe epilepsy. Eur J Neurosci 25:519 528. Strom LA, Koh S, Frey L. (2010) New antiepileptic drugs: lacosamide, rufinamide, and vigabatrin. Curr Treat Options Neurol 12:287 299. Sun C, Mtchedlishvili Z, Bertram EH, Erisir A, Kapur J. (2007) Selective loss of dentate hilar interneurons contributes to reduced synaptic inhibition of granule cells in an electrical stimulation based animal model of temporal lobe epilepsy. J Comp Neuro l 500:876 893. Tallent MK. (2007) Somatostatin in the dentate gyrus. Prog Brain Res 163:265 284.

PAGE 106

106 Tallent MK, Qiu C. (2008) Somatostatin: An endogenous antiepileptic. Mol Cell Endocrinol 286:96 103. Tallent MK, Siggins GR. (1997) Somatostatin depresses exci tatory but not inhibitory neurotransmission in rat CA1 hippocampus. J Neurophysiol 78:3008 3018. Tallent MK, Siggins GR. (1999) Somatostatin acts in CA1 and CA3 to reduce hippocampal epileptiform activity. J Neurophysiol 81:1626 1635. Turnbull J, Lohi H, K earney JA, Rouleau GA, Delgado Escueta AV, Meisler MH, Cossette P, Minassian BA. (2005) Sacred disease secrets revealed: the genetics of human epilepsy. Hum Mol Genet 14 Spec No. 2:2491 2500. Tuunanen J, Halonen T, Pitkanen A. (1997) Decrease in somatostat in immunoreactive neurons in the rat amygdaloid complex in a kindling model of temporal lobe epilepsy. Epilepsy Res 26:315 327. Vecsei L, Csala B, Widerlov E, Ekman R, Czopf J, Palffy G. (1990) Lumbar cerebrospinal fluid concentrations of somatostatin and neuropeptide Y in multiple sclerosis. Brain Res Bull 25:411 413. Vezzani A. (2007) The promise of gene therapy for the treatment of epilepsy. Expert Rev Neurother 7:1685 1692. Vezzani A, Ruiz R, Monno A, Rizzi M, Lindefors N, Samanin R, Brodin E. (1993) Ex tracellular somatostatin measured by microdialysis in the hippocampus of freely moving rats: evidence for neuronal release. J Neurochem 60:671 677. Wang L, Herzog RW. (2005) AAV mediated gene transfer for treatment of hemophilia. Curr Gene Ther 5:349 360. Whittaker E, Vereker E, Lynch MA. (1999) Neuropeptide Y inhibits glutamate release and long term potentiation in rat dentate gyrus. Brain Res 827:229 233. Wilmott RW, Whitsett JA, Trapnell B, Wert S, Baughman R, Cuppoletti J, Tolstohev P. (1994) Gene thera py for cystic fibrosis utilizing a replication deficient recombinant adenovirus vector to deliver the human cystic fibrosis transmembrane conductance regulator cDNA to the airways. A phase I study. Hum Gene Ther 5:1019 1057. Wilson JM. (2009) Lessons learn ed from the gene therapy trial for ornithine transcarbamylase deficiency. Mol Genet Metab 96:151 157. Womble MD, Moises HC. (1992) Muscarinic inhibition of M current and a potassium leak conductance in neurones of the rat basolateral amygdala. J Physiol 45 7:93 114.

PAGE 107

107 Worgall S, Sondhi D, Hackett NR, Kosofsky B, Kekatpure MV, Neyzi N, Dyke JP, Ballon D, Heier L, Greenwald BM, Christos P, Mazumdar M, Souweidane MM, Kaplitt MG, Crystal RG. (2008) Treatment of late infantile neuronal ceroid lipofuscinosis by CNS administration of a serotype 2 adeno associated virus expressing CLN2 cDNA. Hum Gene Ther 19:463 474. Xiao X, Li J, McCown TJ, Samulski RJ. (1997) Gene transfer by adeno associated virus vectors into the central nervous system. Exp Neurol 144:113 124. Zamp oni N, Petrelli C, Passamonti C, Moavero R, Curatolo P. (2010) Vagus nerve stimulation for refractory epilepsy in tuberous sclerosis. Pediatr Neurol 43:29 34. Zeyda T, Hochgeschwender U. (2008) Null mutant mouse models of somatostatin and cortistatin, and their receptors. Mol Cell Endocrinol 286:18 25. Zolotukhin S, Potter M, Zolotukhin I, Sakai Y, Loiler S, Fraites TJ, Jr., Chiodo VA, Phillipsberg T, Muzyczka N, Hauswirth WW, Flotte TR, Byrne BJ, Snyder RO. (2002) Production and purification of serotype 1, 2, and 5 recombinant adeno associated viral vectors. Methods 28:158 167.

PAGE 108

108 BIOGRAPHICAL SKETCH Rabia Zafar was born in Islamabad, Pakistan in 1982. She resided in Islamabad till g this, she University of Florida. She graduated summa cum laude in 2005 after obtaining a Bachelor of Science in microbiology with a minor in chemistry. She enrolled in the neuroscience concentration of the Interdisciplinary Program in Biomedical Sciences for a Doctor of Philosophy in 2005. Since then, she worked in the lab of Dr. Paul R. Carney to develop a novel gene therapy approach to treating intractable temporal lobe epilepsy using animal models. The skills she obtained during her graduate school career include development of animal models, cloning of viral vectors, analysis of behavi oral seizure data and in vitro culminated in a Ph.D. from the University of Florida in the fall of 2010.