<%BANNER%>

The Actions of Fibroblast Growth Factors during Peri-implantation Conceptus Development in Cattle

Permanent Link: http://ufdc.ufl.edu/UFE0042426/00001

Material Information

Title: The Actions of Fibroblast Growth Factors during Peri-implantation Conceptus Development in Cattle
Physical Description: 1 online resource (188 p.)
Language: english
Creator: Yang, Qien
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: blastocyst, bovine, conceptus, embryo, epiblast, fgf, interferon, mapk, migration, pkc, trophectoderm, trophoblast, uterus
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In ruminants, the trophoblast product interferon tau (IFNT) acts as an anti-luteolytic hormone to maintain a pregnant state and promote uterine receptivity for subsequent embryo development and implantation. Defects in early embryo development and miscues between the embryo and uterus result in pregnancy failure in various species. Lactating dairy cattle are especially prone to early pregnancy losses and these pregnancy loss lead to low reproductive efficiency and substantial economic losses. The fibroblast growth factor (FGF) family plays critical roles in regulating early embryonic development in mammals. In cattle and sheep, it is clear that several uterine-derived FGFs stimulate IFNT production in trophoblast cells. One of particular interest is FGF2. It is synthesized by epithelial cells and released into the uterine lumen in cyclic and pregnant animals. In the presence of a conceptus, FGF2 binds to its receptors on trophoblast cells and increases IFNT mRNA transcription and bioactive protein synthesis and release. Herein, three projects were completed to examine the signaling component that mediates FGF-induced IFNT production in bovine trophoblast cells and to discover additional biological roles of uterine- and conceptus-derived FGFs during bovine embryogenesis. The first set of studies investigated the signaling pathways triggered by FGF2 to stimulate IFNT production. Using two bovine trophoblast cell lines and primary trophoblast outgrowths as model systems, the work revealed that ERK1/2 and p38MAPK are critical for basal expression of IFNT, while protein kinase C (PKC) delta mediates FGF2-induced IFNT expression. Another set of studies revealed a new activity for FGF2 during bovine embryo development. Specifically, FGF2 promoted primitive endoderm formation in bovine blastocysts. Activation of FGF signaling or inhibition of FGFR kinase activity in blastocysts modulated early lineage marker expression. A final set of experiments was completed to test the hypothesis that FGF2 or FGF10, a conceptus derived FGF, regulated trophoblast cell migration. FGF2 and FGF10 activated multiple MAPK pathways and the ERK1/2, p38 MAPK and SAPK/JNK signaling modules regulated FGF-mediated systems to stimulate trophoblast migration in vitro. Also, treatment of blastocysts or trophoblast cells with FGF2 modulated the expression of migration-related genes (ITGA2B, ITGB6 and MMP-2). Taken together, current data suggest that FGF-dependent signals play crucial roles in conceptus growth and differentiation during pre- and peri-implantation development. Understanding the fundamental biology of embryo development at this stage will provide the basis to develop strategies to reduce early pregnancy loss.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Qien Yang.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Ealy, Alan.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042426:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042426/00001

Material Information

Title: The Actions of Fibroblast Growth Factors during Peri-implantation Conceptus Development in Cattle
Physical Description: 1 online resource (188 p.)
Language: english
Creator: Yang, Qien
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: blastocyst, bovine, conceptus, embryo, epiblast, fgf, interferon, mapk, migration, pkc, trophectoderm, trophoblast, uterus
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In ruminants, the trophoblast product interferon tau (IFNT) acts as an anti-luteolytic hormone to maintain a pregnant state and promote uterine receptivity for subsequent embryo development and implantation. Defects in early embryo development and miscues between the embryo and uterus result in pregnancy failure in various species. Lactating dairy cattle are especially prone to early pregnancy losses and these pregnancy loss lead to low reproductive efficiency and substantial economic losses. The fibroblast growth factor (FGF) family plays critical roles in regulating early embryonic development in mammals. In cattle and sheep, it is clear that several uterine-derived FGFs stimulate IFNT production in trophoblast cells. One of particular interest is FGF2. It is synthesized by epithelial cells and released into the uterine lumen in cyclic and pregnant animals. In the presence of a conceptus, FGF2 binds to its receptors on trophoblast cells and increases IFNT mRNA transcription and bioactive protein synthesis and release. Herein, three projects were completed to examine the signaling component that mediates FGF-induced IFNT production in bovine trophoblast cells and to discover additional biological roles of uterine- and conceptus-derived FGFs during bovine embryogenesis. The first set of studies investigated the signaling pathways triggered by FGF2 to stimulate IFNT production. Using two bovine trophoblast cell lines and primary trophoblast outgrowths as model systems, the work revealed that ERK1/2 and p38MAPK are critical for basal expression of IFNT, while protein kinase C (PKC) delta mediates FGF2-induced IFNT expression. Another set of studies revealed a new activity for FGF2 during bovine embryo development. Specifically, FGF2 promoted primitive endoderm formation in bovine blastocysts. Activation of FGF signaling or inhibition of FGFR kinase activity in blastocysts modulated early lineage marker expression. A final set of experiments was completed to test the hypothesis that FGF2 or FGF10, a conceptus derived FGF, regulated trophoblast cell migration. FGF2 and FGF10 activated multiple MAPK pathways and the ERK1/2, p38 MAPK and SAPK/JNK signaling modules regulated FGF-mediated systems to stimulate trophoblast migration in vitro. Also, treatment of blastocysts or trophoblast cells with FGF2 modulated the expression of migration-related genes (ITGA2B, ITGB6 and MMP-2). Taken together, current data suggest that FGF-dependent signals play crucial roles in conceptus growth and differentiation during pre- and peri-implantation development. Understanding the fundamental biology of embryo development at this stage will provide the basis to develop strategies to reduce early pregnancy loss.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Qien Yang.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Ealy, Alan.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042426:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE ACTIONS O F FIBROBLAST GROWTH FACTOR S DURING PERI I MPLANTATION CONCEPTUS DEVELOPMENT I N CATTLE By QIEN YANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Qien Yang

PAGE 3

3 To my parents, sister and wife

PAGE 4

4 ACKNOWLEDGMENTS This dissertation would not have been possible without the expert guidance of my advisor Dr. Alan Ealy. I remember how great I felt when he accepted me as a PhD student in this lab even I knew nothing about molecular regulation of Interferon tau. He alway s has great patience, encourages me to try different ideas when there is a chance of failure, he always cares about his students and does his best to help us succeed. His guidance has been an invaluable experience and will be greatly appreciated throughout my scientific career. I still feel great to be his student and work in this fun lab. I wo uld like to express my deep appreciation to all my committee members for their willingness to serve on the committee. Dr. Sally Johnson has been my second advisor and treated me as her own student. Her invaluable input and direction throughout my graduat e career set the standard for me Dr. Peter Hansen has allowed me to use his l ab and learn embryo techniques; one chapter of this dissertation would not have been finished without the IVF system in his lab. Dr. Naohiro Teradas expertise in embryonic stem cell biology has been an excellent source for me in the last 4 and half years. I would like to gratefully acknowledge our former technician Idania Alvarez. She t aught me most of my lab skills, how to be a productive bench worker and how to be a good lab mate. Her help and encouragement will be appreciated forever. Special thanks also go to all the girl scientists in the Ealy lab. Flavia Cooke helped me with lab protocols when I first got here. Kathleen Pennington helped my English and converted me to be a football fan. Her friendship will be treasured throughout my lifetime. Thanks to Susan Rodgers, Teresa Rodina, Krista DeRespino, Jessica Van Scyoc, Claudia Klein and others for good discussion during the lab meetings and other occasions. They all

PAGE 5

5 helped me improve my English and speaking skills. Mariana Giassetti did a preliminary study with me and conducted CT1 cell migration experiments. I owe my deepest gratitude to all current members in the Ealy and Hansen lab oratories Sarah Fields helped m e on IVF and other experiments. O ne of the experiments described here would not be possible without her help. Thanks to Kun Zhang, we fortunately reunited at UF and w orked together again. His kind help on many things will be appreciated. Dr. Manabu Ozawas know ledge and willingness to assist have pushed my research further. Special thanks to Manabu for his friendship, advice and support. Silvia Carambula always likes to share her research with us and lead very informative discussion s. It is truly a pleasure to w ork with her. Paula Morelli always smiles and makes our lab a happy place. I also thank IVF master Luciano Bonilla for his generous help. I would regret of my doctoral years at UF if I did not join the Animal Molecular and Cellular Biology Graduate Program Thanks all AMCB coordinators and conference committee for their hard work and excellent organization skills. I thank Dr. Peter Hansen, Dr. Badi n ga Lokenga and Ms. Joann Fischer. Life would be lonely without many friends I have made here at the University of Florida. Thanks to Dr. Cha nghao Bi, Ju Li, Kesi Liu, Sha Tao, Lilian Oliveira, Fei Chen, Haiyan Xing Guizhi Zhu, Rong Shi, and John Midolo for their friendship and support. Finally, I would like to thank my parents, sister and wife Words cannot express my gratitude and love to them. They are the reason I work hard and do what I should do every day. They are the reason I try my best to be a better researcher, a better person.

PAGE 6

6 TABLE OF CONTENTS p age ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF FIGURES ........................................................................................................ 11 LIST OF ABBREVIATIONS ........................................................................................... 13 ABSTRACT ................................................................................................................... 15 CHAPTER 1 INTRODUCTION .................................................................................................... 17 2 LITERATURE REVIEW .......................................................................................... 21 Pre and Per i implantation Development ................................................................ 21 Conceptus Elongation in Ruminant Species ..................................................... 21 Preimplantation development and genomic activation ............................... 22 Cell differentiation and blastocyst formation............................................... 23 Conceptus elongation and germ layer formation ........................................ 25 Embryo Implantation and Early Placentation .................................................... 26 Blastocyst activation for implantation in mice ............................................. 27 Embryo implantation in ruminant species .................................................. 28 The major types of placentation in different species .................................. 29 Molecular Regulation of Early Lineage Specification .............................................. 30 Specification of Trophoblast Cell Lineage ........................................................ 31 Asymmetric cell division and cell polarity ................................................... 31 Molecular control of trophectoderm specification ....................................... 31 Trophoblast cell differentiation ................................................................... 33 Molecular Regulation of Primitive Endoderm Development .............................. 35 Pluripotent stem cell self renewal .............................................................. 35 Primitive endoderm specification ............................................................... 36 Primitive endoderm development in ruminant ............................................ 38 Control of Conceptus Development and Interferon tau Expression ........................ 40 Maternal Recognition of Pregnancy in Ruminants ............................................ 40 The function of interferon tau during early pregnanc y ................................ 41 Transcriptional regulation of interferon tau production ............................... 43 Signaling pathways controlling interferon tau production ........................... 45 Regulation of Preand Peri development by Growth Factors .......................... 46 Factors shown beneficial effects on preimplantation development ............ 47 Regulation of trophoblast cell migration ..................................................... 48 Uterine derived factors stimulate IFNT production ..................................... 50 Roles for FGFs in mediating conceptus development in ruminants ........... 51

PAGE 7

7 3 PROTEIN KINASE C DELTA MEDIATES FIBROLBAST GROWTH FACTOR 2 INDUCED INTERFERON TAU EXPRESSION IN BOVINE TROPHOBLAST ........ 55 Materials and Methods ............................................................................................ 57 Materials ........................................................................................................... 57 Trophoblast Cell Culture ................................................................................... 58 Quantitative Real Time RTPCR ...................................................................... 60 We stern Blot Analyses ..................................................................................... 60 Antiviral Activity ................................................................................................ 62 Bovine Conceptus Collection and Endpoint RTPCR ...................................... 63 RNAinterference .............................................................................................. 64 Statistical Analyses .......................................................................................... 64 Results .................................................................................................................... 65 ERK1/2 and p38 MAPK dependent Regulation of IFNT Expression ............... 65 PKCdependent Regulation of IFNT Expression .............................................. 66 PKCdelta Expression and Activation in Trophectoderm .................................. 68 Impact of PKC delta Knockdown on Vivot Cell Responsiveness to FG F2 ....... 68 PKCdelta Regulates IFNT Expression through ERK1/2 independent Pathways ....................................................................................................... 69 Discussion .............................................................................................................. 70 4 PRIMITIVE ENDODERM DEVELOPMENT IS STIMULATED BY FIBROBLAST GROWTH FACTOR 2 IN BOVINE BLASTOCYSTS ............................................... 86 Materials and Methods ............................................................................................ 89 Materials ........................................................................................................... 89 In Vitro Production of Bovine Embryos ............................................................. 90 Blastocyst Outgrowth Culture ........................................................................... 90 Propagation of Primary Trophoblast and Primitive Endoderm Cultures ........... 91 RNA Isolation and Quantitative RTPCR .......................................................... 91 Immunofluorescence Microscopy ..................................................................... 92 We stern Blot Analyses ..................................................................................... 93 Proliferation Assay ........................................................................................... 94 Statistical Analyses .......................................................................................... 94 Results .................................................................................................................... 95 Effect of FGF2 on Blastocyst Outgrowth Formation ......................................... 95 Effect of FGF2 on Trophoblast and Primitive Endoderm Outgrowth Formation ...................................................................................................... 95 Profiling of Lineage Marker in Primitive Endoderm and Trophoblast Outgrowths and IVP Embryos ....................................................................... 97 Expression of FGFRs in Primitive Endoderm and Trophoblast Cultures .......... 99 Po ssible Modes of FGF2 Action on Primitive Endoderm ................................ 100 Discussion ............................................................................................................ 101

PAGE 8

8 5 FIBROBLAST GROWTH FACTORS ACTIVATES MITOGEN ACTIVATED PROTEIN KINASE PATHWAYS TO PROMOTE MIGRATION OF OVINE TROPHOBLAST CELLS ....................................................................................... 118 Materials and Methods .......................................................................................... 120 Reagents ........................................................................................................ 120 Trophoblast Cell Culture ................................................................................. 121 Migration Assay .............................................................................................. 121 Western Blots ................................................................................................. 122 Statistical Analyses ........................................................................................ 123 Results .................................................................................................................. 123 FGF2 and FGF10 Stimulate Migration of Ovine Trophoblast Cells ................ 123 FGF2 and 10 Stimulate ERK1/2, p38 MAPK and SAPK/JNK Activity in oTr Cells ............................................................................................................ 124 ERK1/2, p38 MAPK and SAPK/JNK Mediate FGF2/10 Effects on oTr Cell Migration ..................................................................................................... 125 FGF2 and FGF10 Stimulate Migration of Bovine Trophoblast Cells ............... 126 Discussion ............................................................................................................ 127 6 SUMMARY AND DISCUSSION ............................................................................ 138 APPENDIX A FIBROBLAST GROWTH FACTOR 2 AND 10 MEDIATE TRANSCRIPT ABUNDANCE OF SELECTIVE INTEGRINS AND METALLOPROTEASE 2 IN BOVINE BLASTOCYSTS AND TROPHOBLAST CELLS ..................................... 142 Materials and Methods .......................................................................................... 143 Reagents ........................................................................................................ 143 In vitro Production of Bovine Blastocysts ........................................................ 143 Trophoblast Cell Cultures ............................................................................... 144 RNA Isolation and Quantitative, Real Time RTPCR ...................................... 144 Statistical Analys es ........................................................................................ 145 Results .................................................................................................................. 145 FGF2and 10dependent Changes in Selective ITGs and MMP2 in Bovine Blastocysts .................................................................................................. 145 FGF2and 10dependent Changes in Selective ITGs and MMP2 in CT1 Cells ............................................................................................................ 146 Discussi on ............................................................................................................ 147 B DELIVERY OF SIRNA OLIGOS INTO BOVINE TROPHOBLAST CELLS ............ 153 Trophoblast Cell Culture ....................................................................................... 153 Prepar ation of siRNA Complex ............................................................................. 154 Cell Maintenance .................................................................................................. 154

PAGE 9

9 LIST OF REFERENCES ............................................................................................. 156 BIOGRAPHICAL SKETCH .......................................................................................... 188

PAGE 10

10 LIST OF TABLES Table page 3 1 Primers and siRNA oligo sequences .................................................................. 77 4 1 Primers used for quantitative Real Time RTPCR ............................................ 107 4 2 Blastocyst outgrowth formation on days 13 and 15 post in vitro fertilization ..... 108 4 3 Primitive endoderm formation on days 13 and 15 post in vitro fertilization ....... 109 A 1 Primers used for quantitative Real Time RTPCR ............................................ 150

PAGE 11

11 LIST OF FIGURES Figure page 2 1 Early lineage s egregation dur ing preimplantation development ......................... 54 3 1 The dependence of constitutive and FGF2induced IFNT ex pression by ERK1/2 and p38 MAPK ...................................................................................... 78 3 2 PKCdependent systems regulate IFNT mRNA levels in CT1 cells .................... 79 3 3 Examination of how isoform specific PKC inhibitors affect FGF2induced IFNT expression in CT1 cells. ............................................................................. 80 3 4 Rottlerin prevents FGF2 or PMA from increasing IFNT protein concentrations in conditioned CT1 medium ................................................................................ 81 3 5 Rottlerin prevents FGF2 from increasing IFNT mRNA levels in two additional bovine trophoblast cell systems .......................................................................... 82 3 6 The expression and activation of PKC delta in bovine trophoblast cells. ............ 83 3 7 siRNA knockdown of P KCdelta mRNA and protein in trophoblast cells impacts the ability of FGF2 to increase IFNT mRNA levels. ............................... 84 3 8 ERK1/2 dependent systems are not required for FGF2dependent increases in IFNT mRNA abundance ................................................................................. 85 4 1 FGF2 dependent derivation of primitive endoderm ........................................... 110 4 2 Lineage marker expression in primitive endoderm and trophoblast cells. ........ 111 4 3 Immunostaining of CDX2 and GATA4 protein in trophobl ast and Primitive endoderm cells ................................................................................................. 112 4 4 Lineage marker expresion proling during early development ........................... 113 4 5 Immunostaining of CDX2 and GATA4 protein in blastocyst ............................. 114 4 6 FGFR expression profling is different between primitive endoderm and trophectoderm lineage. ..................................................................................... 115 4 7 FGF2 promotes primitive endoderm proliferation in vitro .................................. 116 4 8 Activation or inhibition of FGF signal changes mRNA abundance of early lineage marker in blastocyst ............................................................................. 117 5 1 Supplementation with FGF2 and FGF10 promotes ovine trophoblast cell (oTr) migration. ................................................................................................. 132

PAGE 12

12 5 2 Erk1/2 phosphorylation status before and after oTr supplementation with FGF2 or FGF10. ............................................................................................... 133 5 3 p38 MAPK phosphorylation status is enhanced by FGF2 and FGF10 in oTr cells. ................................................................................................................. 134 5 4 SAPK/JNK phosphorylation status is increased in oTr cells after supplementation with FGF2 or FGF10 ............................................................. 135 5 5 Delineation of MAPK molecules involved with FGF2and FGF10dependent increases in oTr cell migration .......................................................................... 136 5 6 FGF2 and FGF10 treatment promotes the migration of bovine trophoblast cells (CT1) ........................................................................................................ 137 6 1 The actions of FGF signaling during peri i mplantation development in bovine: a suggested model ........................................................................................... 141 A 1 FGF2 and FGF10 modulates selected gene expression in bovine blastocysts. ...................................................................................................... 151 A 2 FGF2 modulates select ed gene expression in CT1 cells ................................. 152 B 1 FGF2 increases IFNT mRNA abundance in Vivot cells. ................................... 155

PAGE 13

13 LIST OF ABBREVIATIONS CDX2 Caudal Related Homeobox 2 CSF2 Colony stimulating Factor 2 CT1 Cow Trophoblast Cell Line 1 DAPI 4', 6 diamidino2 phenylindole DMEM Dulbeccos Modified Eagles Medium DMSO Dimethyl Sulfoxide ECM Extracellular Cell Matrix ERK Extracellular Signal Regulated Kinase ESC Embryonic Stem Cell FGF Fibroblast Growth Factor GAPDH Glyceraldehyde 3phosphate dehydr ogenase GATA4 GATA family transcription factor 4 GCM1 Glial Cells Missing 1 HAND1 Heart and Neural Crest Derivatives expressed protein 1 ID2 Inhibitor of Differentiation 2 IFNT Interferon Tau IGF Insulin like Growth Factor IVP Embryo In V itro Produced Embr yo ITG Integrin ITS Insulin Transferrin Selenium LGALS Galectin 15 MAPK Mitogen Activated Protein Kinase MASH2 Mammalian AchaeteScute Homolog 2 MMP2 Matrix Metalloproteinase2

PAGE 14

14 NP40 Nonidet 40 OCT4 Octamer binding Transcription Factor 4 oTr1 Ovine Trophoblast Cell Line 1 PBS Phosphate Buffered S aline PCR Polymerase Chain R eaction PGE Prostaglandin E PI Propidium Iodide PKC Protein Kinase C PMA Phorbol 12 Myristate 13 Acetate PVDF Polyvinylidene Fluoride RNA R ibonucleic Acid RT PCR Reverse Transcriptase Polymerase Chain Reaction SAPK/JUN Stress activated protein kinase/c Jun NH2 terminal kinase SDSPAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis SLC Solute Carrier Protein SOX17 Sex Determining Region Y Box 17 SPP1 Secreted Phosphoprotein 1 TBST Tris Buffered Saline and Tween 20 YAP Yes Associated Protein

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ACTIONS O F FIBROBLAST GROWTH FACTOR S DURING PERI I MPLANTATION CONCEPTUS DEVELOPMENT I N CATTLE By Qien Yang December 2010 Chair: Alan D. Ealy Major: Animal Molecular and Cellular Biology In ruminants, the trophoblast product interferon tau ( IFNT ) acts as an anti luteolytic hormone to maintain a pregnant state and promote uterine receptivity for subsequent embryo development and implantation. Defects in early embryo development and miscues between the embryo and uterus result in pregnancy failure in various species. Lactating dairy cattle are especially prone to early pregnancy loss es and these pregnancy loss lead to low reproductive efficiency and substantial economic losses. The fi broblast growth factor (FGF ) family plays critical roles in regulating early embryonic development in mammals. In cattle and sheep, it is clear that several uterine derived FGFs stimulate IFNT production in trophoblast cells. One of particular interest is FGF2. It is synthesized by epithelial cells and released into the uterine lumen in cyclic and pregnant animals. In the presence of a conceptus, FGF2 binds to its receptors on trophoblast cel ls and increases IFNT mRNA transcription and bioactive protein synthesis and release. Herein, three projects were completed to examine the signali ng component that mediates FGFinduced IFNT production in bovine trophoblast cells and to discover additional biological roles of uterineand conceptus derived FGFs during bovine embryogenesis.

PAGE 16

16 The first set of studies investigated the signaling pathways triggered by FGF2 to stimulate IF NT production. U sing two bovine trophoblast cell lines and primary trophoblast outgrowths as model systems, the work revealed that ERK1/2 and p38MAPK are critical for basal expression of IFNT while protein kinase C (PKC) delta mediates FGF2induced IFNT expression. Another set of studies revealed a new activity for FGF2 during bovine embryo development. Specifically, FGF2 promoted primitive endoderm formation in bovine blastocysts. Activation of FGF signaling or inhibition of FGFR kinase activity in blastocysts modulated early lineage marker expression. A final set of experiments was completed to test the hypothesis that FGF2 or FGF10, a conceptus derived FGF, regulated trophoblast cell migration. FGF2 and FGF10 activated multiple MAPK pathways and the ERK1/2, p38 MAPK and SAPK/JNK signaling modules regulated FGFmediated syst ems to stimulate trophoblast migration in vitro Also, treatment of blastocysts or trophoblast cells with FGF2 modulated the expression of migrationrelated genes ( ITGA2B ITGB6 and MMP 2 ) Taken together, current data suggest that FGFdependent signals pl ay crucial roles in conceptus growth and differentiation during preand peri implantation development. Understanding the fundamental biology of embryo development at this stage will provide the basis to develop strategies to reduce early pregnancy loss.

PAGE 17

17 CHAPTER 1 INTRODUCTION Early p regnancy loss has a major influence on economic outcomes in farm animal operations. I t is well documented that the modern dairy cow is subfertile in the US and other countries [1 4] In lactating dairy cattle, a paltry 40% of initial pregnancies develop to term [5] Among all the various reasons for pregnancy failure in cattle embryonic death within the first month of pregnancy accounts for approximately 57% of all pregnancy losses [5, 6] Furthermore, multiple reports estimated that as much as 70% to 80% of total embryoni c loss occurs between days 8 to 17 of gestation [3, 5] Pregnancy failures in dairy cattle have become progressively greater as intense selection for milk yield traits has been conducted over the past several decades [7] Butler (1998) showed that the first service conception rate has declined from 65% to 40% over the past two decades in US dairy cattle [8] Royal (2002 ) estimated that pregnancy rate to first service declined from 55.6 to 39.7% between 1975 and 1998 [9] In the dairy industry more than $500 of income from lifetime production is lost by each pregnancy failure [10] Developmental problems occurring during early pregnancy also may have significant economic implications later in gestation in dairy cattle. Although the initial pregnancy rates of cloned bovine embryos were similar to embryos derived from artificial insemination s, continued pregnancy loss occurred throughout gestation in cattle [11] It has been suggested that pregnancy failure in middle or late gestation originates from miscues during peri implantation development before day 2125 of gestation [12, 13] Based on these observations, several key development events, including

PAGE 18

18 blastocyst formation, maternal recognition of pregnancy and early placental formation l ikely can have a significant impact on mid and late gestational success or failure. Periimplantation development in ruminants (cattle, sheep, goats, and deer) is dramatically different from rodents or primates. After hatching from the zona pellucida, r uminant blastocysts float freely in the uterine lumen and transform from a small, ovoid shape of less than 1 mm to a filamentous conceptus that can reach 40 cm in length over a period of approximately 10 days [14] After trophoblast lineage specification, the blastocyst starts to express several factors, including IFNT a type I interferon that acts as the signal for mate rnal recognition of pregnancy [1517] The level of IFNT mRNA in trophoblast cells and amount of IFNT protein released into the uterine lumen the increases significantly during the period of conceptus elongation [18] Defects in conceptus elongation and miscues in IFNT production can, therefore, represent one reason for pregnancy loss in cattle [19] Many growth factors and cytokines likely control c onceptus. For example, providing bovine blastocysts with insulinlike growth factor 1 ( IGF 1 ) increased post transfer survival under heat stress conditions [20] Also, treatmen t of bovine trophoblast cells with colony stimulating factor 2 (CSF 2 previously knonw as GMCSF or Granulocytemacrophage Colony stimulating Factor ) enhanced trophoblast production of IFNT [21] CSF 2 supplementation to bovine in vitro produced (IVP) embryos improved pregnancy rates after transfer and limited late pregnancy losses [22] In the ovine uterus, IGF 2 and IGF binding protein 3 ( IGFBP 3 ) directly stimulate trophoblast cell proliferation and migration [22, 23]

PAGE 19

19 Another group of important growth factors linked with successful peri implantation development in cattle is the FGF family. The FGFs are composed of more than 19 members and associate with at least 4 main r eceptors with different ligand binding affinities and tissue specificit ies in mammal [24] FGF signaling is essential for embryogenesis in several species. The mouse embryo begins producing FGF4 and its receptor, FGFR2, after the fifth blastomere division. FGF4 released by the undifferentiated inner cell mass stimulates trophoblast stem cell proliferation and regulates cell fate decisions [2527] A similar role of FGF4 during embryonic development has not been established in ruminants, but other FGFs certainly are important during early bovine development. In ruminants, FGF2 is present in uterine lumen throughout early pregnancy, and it is able to bind to its receptors and stimulate IFNT production by trophoblast cells while having little to no impact on trophoblast cell proliferation [28, 29] Supplementation of bovine blastocyst s and cultured trophoblast cells with different FGF 1, FGF7 and FGF10 also stimulates IFNT production [30, 31] In the ovine uterus, the synthesis of FGF10 by stromal cells is controlled by progesterone and FGF10 acts as a mediator of progesterone signaling to regulate conceptus development [32, 33] The bovine conceptus produces FGF10, and FGF10 mRNA abundance increases dramatically when conceptus elongation occurs [30] The mechanisms that underline FGF regulation of IFNT pr oduction and other cellular events during bovine preand peri implantation remain unclear. It is clear that uterineand conceptus derived growth factors, including various FGFs impact embryo development in ways that promote conceptus development, diffe rentiation and the establishment and maintenance of pregnancy. It is important,

PAGE 20

20 therefore, to understand the specific developmental aspects of bovine embryogenesis affected by FGFs so that new strategies for reducing pregnancy losses can be conceived and t ested. This dissertation work tested the hypothesis that FGF signaling plays a multifunctional role in regulating embryonic and trophoblast development during the first 2 weeks of gestation in cattle. Specifically, we propose that FGF2 and other FGFs funct ion as key regulators of IFNT production, early lineage specification and trophoblast migration. A series of experiments was conducted to address three specific aims: Describe the signaling pathways that mediate FGF2induced IFNT production in bovine trophoblast cells. Delineate the roles of FGFdependent signaling for trophoblast and primitive endoderm lineage determination in bovine blastocysts. Elucidate how FGFdependent signals impact integrin gene expression and trophoblast cell migration.

PAGE 21

21 C HAPTER 2 LITERATURE REVIEW Pre and Peri implantation Development In mammals, preimplantation development refers to the period from fertilization to embryo implantation. The progression of this stage of development is marked by several important mole cular events including maternal to zygote transition, blastocoel formation and early germ layer formation within the inner cell mass [34, 35] The peri implantation period of development encompasses the time from embryo release from the zona pellucida to the initiation of placenta formation [36, 37] These complex and highly regulated development al processes are responsive to many factors present in uterine environment P roblems associated wi th embryouterine interactions are assoc iated with high rates of pregnanc y lo ss es in various placental animals. Early embryo death is common to many species and it is part of selection events to ensure the survival of only most competent embryos. Meanwhile, undesired embryo loss frequently occurs in humans and other species. An overall goal of work in this field of study is to better understand the various problems that may occur during preand peri implantation development so that schemes can be developed to minimize early embryonic pregnancy loss in humans and domesticated cattle, sheep, and pigs [3] Conceptus Elongation in Ruminant Species The mouse serves as the conventional mammalian model for studying preimplantation development because of its ease of propagation and maintenance and because techniques exist to genetically modifies this species. Genetic modification of ca ttle and other ruminants is more challenging and expensive. There is no unified scheme of embryogenesis that can be applied to all mammals, but several critical

PAGE 22

22 cellular and molecular events occur in most mammalian species. For example, trophoblast cell linage specification and maintenance of a pluripotent inner cell mass is required for embryo implantation in all mammals. However, several aspects of peri implantation development and gastrulation vary dramatically between species. The following sections of this review will describe the similarities and distinctions as they relate to bovine conceptus development. Preimplantation development and genomic activation Reproduction in mammalian species requires the merger of two parental haploid genomes by fertilization of the oocyte with the spermatozoa and activation of the new embryonic genome. Maternally stored mRNA and protein are loaded into oocytes during oogenesis to provide ample material for regulating embryo development for the first few blastomere divisions. After fertilization, maternal mRNA starts to degrade and must be replaced with newly synthesized mRNA derived from the embryonic genome. These new transcripts are especially important for establishing cell polarity, maintaining cell division rate, and specifying early embryo lineage segregation [38] The timing of the maternal to zygote transition (M ZT) in genome control over the newly formed embryo differs among species. This event occurs at 2cell stage in mice, at the 4cell or 8cell stage in humans, and at the 8to 16 cell stage in cattle [39] Normal progression of embryonic development requires that MZT occur in a timely manner. Interestingly, one function of the new embryonic genome is to destroy remnants of the maternal genome. In the mouse, 90% of maternally stored transcripts are degraded in 2cell embryos [40] Proteins responsible for mRNA stability in oocytes, for example MSY2, represent some of the initial targets of the new embryonic genome. [41] Another function of the new embryonic genome is to restore specific transcripts

PAGE 23

23 that were inadvertently destroyed after fertilization but are required for embryo development. A classic example of this activity is the fate of actin mRNA during early embryo development in mi ce. Around 90% of maternally derived actin mRNA is degraded b y the 2cell stage, and since actin is indispensable for several basic cellular functions, it is readily transcribed from the embryonic genome as MZT is initiated [35] The third function of the new embryonic genome is to generate new transcripts not produc ed by the maternal system that are required for embryonic programming. Interestingly, not all m aternally derived mRNAs are degraded at MZT and remain able to influence embryonic development after MZT is complete [42] For example, maternally derived CDX2 plays an important role in cell allocation at the blastocyst stage [4 3] Current data in mic e suggest that two transient waves of transcription are observed during embryonic genome activation. Using globe gene expression analyses, Hamatani et al., (2004) found that two major transient waves of de novo transcription activation occurred after ferti lization [44] The first wave refers to the zygotic genome activation (ZGA), occurs between the 2to 4cell stages and leads to a robust expression of embryonic transcripts. The second wave, termed the midpreimplantation gene activation (MGA), occurs at the 8cell stage. The MGA results in the expression of gene products that are involved in blastomere polarity and morula compaction. In cattle the major embryonic genome transcription occurs at 8 to 16cell stage, although, a minor onset of gene transcription is detectable at earlier stages [45] Cell differentiation and blastocyst formation The hallmark of early embryonic development is the formation of a blastocyst with polarized epithelial cells called trophectoderm arranged along the outside border of the

PAGE 24

24 embryo and pluripotent cells located inside the embryo termed inner cell mass (ICM). This initial lineage segregation begins at early morula stage when t otipotent blastomere loses plasticity Blastomere from 2 cell, 4 cell or 8cell stage embryos can contribute to all tissues of the embryo [46] ,but lineage tracing experiments in mice reveal that after the late 8cell stage, polarized cells located outside of an embryo contribute to trophectoderm lineage whereas unpolarized inside blastomere maintain their pluripotency [26, 47, 48] Embryonic genome activation builds the foundation for cell differentiation and blastocoel formation. Intracellular and cell surface adhesion molecules that are transcribed after the second wave of embryonic genome activation play a critical role in the morphogenesis of the blastocyst and the appearance of the trophectoderm [49] E cadherin mediates the first cell adhesion event leading to individual cells lose their outlines termed embryo compaction in 8 cell mouse embryo or 32cell bovine embryo [50] Mouse embryos lacking E cadherin fail to form organized blastocysts [51, 52] Moreover, activation of protein kinase C (PKC) regulates E cadherin localization and induces compaction in mouse embryos [53] The specific PKC isoforms that control E cadherin activation are undefined. After compaction, the formation of tight junction complexes separates outside cells from cells located inside the embryo. Tight junctions are multimolecular membrane complexes that restrict paracellular diffusion and fl uid movement. Two major types of proteins are required for these tight junctions ; the tight junction peripheral membrane protein, zonula occludens and transmembrane protein, claudins [54] The tight junction complex dictates the formation of the blastocoel cavity along with Na/K ATPase. The

PAGE 25

25 Na /K ATPase serves as a Na+ and K+ transporter, and movement of Na+ out of cell and transport of K+ into the cell creates an ion gradient that promotes fluid accumulation [55] It is interesting to note that embryo compaction coincides with the onset of cytoplasmic and mic rovillus polarity in blastomere. Recent advances in preimplantation biology have linked cell position and the expression of key transcription factors that are gateways of cell fate commitment. For example, the knockdown of Pard6b expression, one component of Par aPKC (atypical PKC) complex, leads to the cavitation failure and abnormal distribution of tight junctions [56] The segregation of trophectoderm during early embryogenesis is imperative since mammals have viviparous placentae, which requires nutrition and gas exchange between the fetal and maternal units (placenta and uterus, respectively). Trophectoderm gives rise to all the tissue types needed to form the outer layers of the placenta. The blastocoel is important for providing room for embryo rearrangement during gastrulation and embryo morphogenesis [57] Eventually the blastocoel will become the fluidfilled component of the yolk sac. Conceptus elongation and germ layer formation One unique feature of development in ruminants is conceptus elongation (a conceptus contains embryo/fetus and associated extraembryonic membranes) [58] In rodents, humans, and many other mammals, conceptuses begin attaching to uterine epithelial cells immediately after hatching from the zona pellucida. However, in ruminants the free floati ng conceptus transition from an ovoid to spherical and finally to a filamentous shape prior to uterine attachment [59, 60] The hatched blastocyst is spherical and ranges in diameter from 0.125 to 0.5 mm around days 8 to 11 of pregnancy. At approximately 14, bovine blastocyst begins elongating and ranges in

PAGE 26

26 length from 0.85 to 2.5 cm [61] By day 17, conceptuses usually occupy most of one uterine horn (1530 cm) and at day 21 the trophoblast finally begins attaching to uterine carunc ular and intercaruncular areas Conceptus elongation is required for the establishment of pregnancy in ruminants and significant insights into understanding of this developmental puzzle have been made in last decades. However, the molecular basis of conceptus elongation and early cell patterning remains to be completely understood [59] The ontogeny of gastrulation differs between cattle and mice. In rode nts, gastrulation occurs right after embryo implantation [19] These events occur more slowly in cattle [62] A distinctive trophectoderm usually is evident at day 7 after fertilization. The generat ion of primitive endoderm usually begins on day 9, and then the emergence of primitive ectoderm occurs around day 12. Primitive mesoderm forms around day 14 within the epiblast [14, 63] Changes in trophoblast also occur around this period of development in ruminants. Specifically, the polar trophectoderm that covers the epiblast, called Raubers layer, is degenerat ed around day 14. This results in the embryonic disk becoming exposed to the uterine lumen [63] The gastrulation marker, brachyury which encodes a mesoderm specific transcription factor, is detectable in embryonic discs and t hese nascent mesoderm cells is close to the basal membrane of epiblast in day 15 bovine conceptus [64] On day 21, visible somites and several germ layers appear within the primitive steak. The neural groove, neuroectod erm, mesoderm and amnion are present at this time [65] Embryo Implantation and Early Placentation Embryo implantation is a twoway communication between a competent blastocyst and a r eceptive uterus. Irrespective of the differences in peri implantation development,

PAGE 27

27 Enders and Schlafke suggested that the process of implantation could be dissected into three steps: apposition, adhesion and penetration [66] Apposition refers to the step when tr ophoblast cells become juxtaposed to the uterine luminal epithelial cells. Adhesion involves the attachment of the trophoblast cells and uterine epithelium mediated by adhesion molecules such as integrins. The final step of implantation is penetration. During invasive im plantation in humans and mice, trophoblast cell penetration is coupled by the stromal cell differentiation and loss of epithelial cells, a process known as deciduation. Penetration does not occur in species that contain relatively noninvasive placentae such as bovine and sheep. Instead, a syncytial structure is formed by the fusion of trophoblast and luminal epithelium [36, 67] Blastocyst activation for implantation in mice The mouse embryo escapes from zona pellucida on day 3.5 and immediately initiates the process of implantation under normal conditions [68] Progesterone and estrogen from corpus luteum are master regulators of embryo implantation. That activation of the mouse embryo for implantation is dependent on an estrogen signal, and blocking this estrogen signal can induce blastocyst dormancy in rodents and several other species [69] Attachment of the blastocyst to the uterine lining induces stromal cell deciduation and trophoblast cell differentiation, which ensure the production of prolactin and prolactinrelat ed proteins from decidual cells These factors prevent corpus luteum regression [70] Blastocyst attachment is initiated by adhesion molecules. Heparin Binding EGF (HBEGF) is the first identified marker that initiates embryo implantation in mice. The expression of HB EGF by uterus epithelium is dependent the presence of blastocysts [71] HBEGF interacts with its receptors ErbB1 and ErbB4 on blastocysts to promote

PAGE 28

28 trophoblast transition to an adhesive stage [72] Interestingly, blastocysts also produce HBEGF, and exposure of blastocyst size beads soaked with HB EGF induces HBEGF in uterine epithelium, s uggesting this signal autoamplifies itself during embryo attachment [73] In the human, in addition to containing a conserved HB EGF system, attachment is mediated by Lselectin and various integrin subunits [74, 75] It is interesting to note that several molecules not directly involved with cell adhesion play active roles in regulating blastocyst implantation. For example, inactivation of the Wnt /catenin signaling system in early mouse embryos does not affect blastocyst formation but blocks implantation [76] Emerging evidenc es in m ous e models and human clinical work reveal the importance of cannobiniods and its receptor signaling in pregnancy, especially in the process of embryo implantation [77] Cannobiniod released from the uterus interacts with its receptor (CB1 and CB2) to control embryo activation for implantation [78] The involvement of these molecules in embryo implantation in other species, including ruminants, awaits investigation. Embryo implantation in ruminant species In ruminants, the extended post hatching development that occurs before attachment and adhesion requires that mechanisms controlling cell attachment be blocked. This occurs by the extended presence of anti adhesive agents. One primary component to the anti adhesive nature of the uterus during early pregnancy is the production of mucins. Secretion of mucins and specifically MUC1 occurs within the endometrial epithelium until day 17 of pregnancy, and as MUC1 concentrations decrease, trophoblast cells initiate adhesion with the uterine epithelium [79] The conceptus also plays an active role in prepari ng for uterine adhesion. G lobal gene expression changes were examined on days 7, 14 and 21 by microarray Between

PAGE 29

29 days 7 and 14 the predominant gene expression changes related to cytoskeleton remodeling and cell metabolism, reflecting the dramatic morphological changes that occur during blastocyst elongation. However, between days 14 and 21 the expression of many genes associated with cell adhesion and extracellular matrix (ECM ) including alpha2 collagen, MMPs, several integrins and integrin binding prot eins were increased [80] The formation of focal adhesions at the maternal fetal inter face during embryo implantation seems to be controlled by integrin signaling [8183] In ruminants, a recent study found that multiple integrin subunits such as ITGAV ITGA4 ITGA5 and their binding proteins LGALS15 and SPP1 were present in luminal epithelium and trophoblast surfaces, indicating the assembly of focal adhesion components along maternal trophoblast interfaces [84] The major types of placentation in different species The major function of the placenta is to ensure the efficient gas and nutrient exchange between fetus and mother. The mission is accomplished by remarkable growth and terminal differentiation of trophoblast cells so that they may support embryonic and fetal development. Establishment of an efficient placenta is vital for pregnancy success. For instance, in women, the ratio of fetal to placental weight increases more than 40 fold as the gestation continues towards term [37, 85] The placenta in most mammals falls into three major categories: hemochorial, endotheliochorial and epitheliochorial [86, 87] Hemochorial placentae are found in most primates and rodents. In this type of placenta, trophoblast cells invade into the maternal uterine arteries and directly embed in maternal blood. Endotheliochorial placenta refers to the placenta that present in most

PAGE 30

30 carnivores and some other species like elephants. In an endotheliochorial placenta, the trophoblast is in direct contact with the endothelium of the uterine blood vessels. In epitheliochorial placentae, trophoblast cells are noninvasive or show limited invasion. This type of placenta is found in most eventoed ungulates such as ruminant and pig. The epitheliochorial placenta is so called because trophoblast is directly connected with uterine epithelium. The initiation of bovine placentation occurs when trophoblast starts to be in touch with uterine epithelium and fetal blood vessels are evident about 33 days of gestation [88] Despite of difference types of placentation, most placental specific genes are conserved between rodents and cattle. For example, there are 1217 genes exclusively expressed in placentae in mammals, 1000 of these genes ar e present in both mice and cattle [89] However, the expression pattern and regulatory network of particular genes within placental tissues may vary in different animals because of mutations in transcription binding sites or insertion of cis regulatory modules [90] This likely led to the diversity in early lineage determination and placentation among species. Molecular Regulation of Early Lineage Specification The adaption of viviparity in placental mammals involves the appearance of the chorioallantois placenta and a short lived yolk sac [91] The trophectoderm and primitive endoderm are two early cell lineages that contribute to these extraembryonic tissues. The term trophoblast is derived from the Greek term, trephein (to feed), [92] Primitive endoderm give rises to parietal and visceral endoderm in mice [93, 94] A general scheme of lineage segregation is described in Fig 21B.

PAGE 31

31 Specification of Trophoblast Cell Lineage As discussed previously, the first lineage specification involves the emergence of polarized epithelial cell layer termed trophectoderm. There is a debate about whether cell fate is already decided by the 2to 4 cell stage in mice, but it is clear that embryo compaction and cell polarity at the 8to 16 cell stage leads to redistribution of cytoplasm and several key factors that determine the fate of different blastomeres [43, 9597] A symmetric cell division and cell polarity After cell adhesion is evidence and blastomeres reorganizes into a compact morula, cell quickly polarizes with cell nuclei relocate to basolateral area [98] and the membrane protein Par3, Par6, aPKC move to the apical domain [99101] Interestingly, polarity protein Par1 becomes localized to the basolateral region of a blastomere [101] As in o ther epithelial or polarized cells, the functions of these polarity proteins have been implicated in the formation of tight junctions and undergoing asymmetric cell divisions [102, 103] In preimplantation embryo, cell polarity is important because it affects cell localization and lineage decision. Downregulation aPKC in a random blastomere from a 4cell embryo directs daughter cells of this blastomere into the inside part of the embryo [100, 104] Once cell polarization is established, outside cells become trophectoderm, while inside cells contribute to the inner cell mass with distinguishable gene expression (Fig 21A). Molecular control of trophectoderm specification Several key transcriptional regulators dictate trophoblast committal in mammals. In mice, trophectoderm speci fication is regulated by caudal type homeobox 2 ( CDX2 ). CDX2 mRNA localizes at the apical region of 8cell blastomeres, and as asymmetrical

PAGE 32

32 cleavage occurs, the progeny containing CDX2 is destined to become trophoblast cells whereas the inner dividing cell s do not [43] CDX2 is not required for cell polarity [105, 106] or E cadheri n mediated cell adhesion events, indicating that E cadherin directs blastomere allocation independent of early lineage specification [105] However, CDX2 is essential for blastocyst survival. Mouse embryos lacking CDX2 form blastocysts but fail to implant. The epithelial features of trophoblast are lost in these CDX2 null embryos. Moreover, CDX2 null blas tomeres continue to produce pluripotent genes, including OCT4 and NANOG [107] Forced expression of CDX2 will induce p luripotent cells to become trophoblast cells [108] Upstream mediators of CDX2 have been partially identified in the mouse. Two independent groups have established a role for TEAD4 a transcription factor from TEA domain family. TEAD4 null embryos are preimplantation lethal, do not form blastocysts [109, 110] and upregulate CDX2 expression. The regulation of TEAD4 expression is controlled by the t ranscription factor Yes asso ciated protein 1 (YAP) [111] YAP a TEAD4 coactivator, is phosphorylated YAP and actively transported out of the nuclei of blastomeres within the inner regions of embryos. By contrast, YAP is maintained within the nucleus of cells found along the outer region of embryos, consistent with the concept that these cells will produce CDX2 in response to TEAD4 stimulation and become committed to trophectoderm. The kinase responsible for YAP phosphorylation may be Hippo pathway [111113] The GAT A family transcription factor, GATA3 is controlled by TEAD4 and plays a role in trophectoderm lineage segregation [114] In the preimplantation mouse embryo, GATA3 is first expressed at the 4 cell stage and its expression continues in cells from

PAGE 33

33 trophectoderm lineage. Deletion of GATA3 in trophoblast stem cell leads to reduced levels of CDX2 transcripts [115] GATA3 acts independently of CDX2 and controls its own sets of genes in trophoblast stem cells [114] ERK2 also plays a role in trophectoderm specification. ERK2 becomes localized in the apical membrane of 8cell embryo before embryo compaction and is distributed into daughter cells with different concentrations. For example, cells located outside receive higher dose of ERK2 and eventually allocate to trophectoderm. Activat ion of the upstream signal Ras MAPK promotes trophectoderm formation in mouse blastocysts [116] It is unclear whether ERK2 co ntrols GATA3 and CDX2 expression. CDX2 is detectable in bovine bl astocysts and the elongating conceptus but the essential role of trophoblast lineage specifies in cattle has not been examined using loss of function experiments R etrospective studies suggest that CDX2 expression is lower in blastocysts that produced a failed pregnancy following transfer to synchronized hosts [117, 118] Further experiments are needed to explore the mechanisms that drive trophoblast differentiation and other extraembryonic lineage formation in cattle. Trophoblast cell differentiation Gene targeting experiments have generated a long list of genes that are critical for trophoblast cell function, although they are not necessarily needed for the first lineage specification. Most of these genes maintain the proliferation of a trophoblast stem population or induce differentiation. In rodents, trophoblast stem cells differentiate into different cell types including trophoblast giant cells, spongiotrophoblast, and syncytiotrophoblast cells [119] After trophectoderm specification occurs, this tissue layer from a quiescent state into a rapid proliferation state. ICM derived FGF4 maintains the p olar trophoblast cells,

PAGE 34

34 those cells in close pr oximity to the inner cell mass in a proliferative, undifferentiated state because of begin acted upon by [27] Genetic ablation of FGF4 or its receptor FGFR2, results in proliferation defects and loss of proliferative trophoblast cells [120] Similarly, trophoblast cells readily differentiate in culture once separated from the inner cell mass, and this outcome can be blocked by supplementing FGF4. Deprivation of FGF4 induces trophoblast stem cell differen tiation to t rophoblast giant cells. It is proposed that cell cycle regulator CDK1 is required for FGF4deprived trophoblast stem cell differentiation [121] Trophoblast differentiation is regulated, in part by basic helix loop helix (bHLH) transcription factors in mice. Several of these factors can override FGF4 to induce differentiation in cultured trophoblast cells. HAND1 over expression promotes giant cell formation in FGF4treated trophoblast cells while GCM1 forces cell cycle exit and directs trophoblast stem cell towards forming syncytiotrophoblast cells [119] MASH2 an inhibitor of HAND1 promotes trophoblast proliferation in the absence of FGF4. There also appears to be other mechanisms that control trophoblast differentiation in rodents. As an example, retinoic acid promotes giant cell formation in mouse trophoblast stem cells colonies [122] The involvement of these systems in regulating bovine trophoblast differentiation is less clear. In cattle and other ruminants, a differentiated cell known as the binucleate cells (BNCs, also called the trophoblast giant cell) can be detected beginning on day 1617 of gestation [123] These cells serve as hormonesecreting cells and control angiogenesis [124] Several of the major transcription factors that direct trophoblast giant cell formation in rodents ( HAND1 MASH2 ID2 ) also are abundant in bovine BNCs

PAGE 35

35 [62, 125] but the precise functions of these factors in bovine trophoblast development still needs clarification Mole cular R egulation of Primitive Endoderm Development Several key transcription factors govern the differentiation of pluripotent cells in the inner cell mass. In general, transcription factors OCT4 and NANOG controls the maintenance of pluripotent epiblast c ells, GATA4 and GATA6 plays a central role in directing the primitive endoderm lineages. Direct or indirect interactions of these transcription factors determine the fate of early lineages. Pluripotent stem cell self renewal The first segregated inner cell mass cells can give rise to all tissues in fetus and therefore, often are called pluripotent cells. Pluripotency requires the transcription factors OCT4 and NANOG Other transcription factors, notably SOX2 and cMYC are involved with NANOG and control over maintenance of epiblast self renewal [126] The POU transcription factor OCT4 is the first transcription factor found to dictate the formation of the inner cell mass. Without OCT4 embryo fails to form a pluripotent inner cell mass; instead, these inside cells express markers for trophectoderm [127] Trophoblast cells from OCT4 null embryos cannot be maintained in vivo because they lack FGF4 production. The scrutiny of OCT4 responsive genes in early embryo reveals that OCT4 and CDX2 mutually inhibit each other. Dominant expression of OCT4 in the inner cell mass turns off trophectoderm specific genes [108] OCT4 expression is evident in all blastomeres at late morula stage and it becomes restricted to the inner cell ma ss when a blastocyst forms. In embryonic stem ( ES) cells, OCT4 acts in a dose dependent manner to control cell fate [128] Repression of OCT4 results in trophoblast

PAGE 36

36 cell differentiation whereas, over expression OCT4 by 2fold induces endoderm and mesoderm differentiation. NANOG is specifically exp ressed in undifferentiated cells in early blastocysts and it is required for the maintenance of pluripotency in mice and likely other mammals. Similar to OCT4 NANOG is specifically expressed in the inner cell mass, later in the epiblast [126] At the late blastocyst stage in mice, NANOG expression is restricted to a population of undifferentiated cells that likely are the progeny for t he epiblast. Deletion of NANOG results in embryonic lethal. Although NANOG null embryos develop into morphologically normal blastocysts that induce decidualization, these embryos fail to form a proper epiblast and fail soon after implantation is initiated. It was originally thought that downregulation of NANOG resulted in primitive endoderm development in mice blastocysts [129] A recent report reveals that NANOG knockout embryos lose the potential to self renew and differentiate into endoderm [130] Attempts have been made by generations of animal scientists to generate stem cells in large animals; however, lines that have a convincing resemblance to mouse stem cell lines are still not available [131] Part of the reasons is that basic knowledge about epiblast development and differentiation is missing. For example, OCT4 is present in trophoblast cells in elongating bovine conceptus, suggesting that regulatory network for pluripotency may be different [62, 132] Pr imitive endoderm specification Similar to other early lineages, the derivation and differentiation of primitive endoderm is also controlled by several key transcription factors. At the blastocy st stage in mice, a population of the inner cell mass loses its pluripotency and begins expressing GATA6 and GATA4 At this stage, NANOG positive cells and GATA6 positive cells co -

PAGE 37

37 exist in blastocysts and exhibit a Salt and Pepper staining pattern when using dual immunofluorescence labeling [26] These two populations of cells are already pre patterned and cannot switch their fates no matter what kind of niche is provided. The zinc finger containing transcription factors GATA4 and GATA6 are master regulators of primitive endoderm development. In early mouse embryos, GATA6 and GATA4 expressi on is restricted to the primitive endoderm and its derivatives, visceral endoderm and parietal endoderm [133] GATA4 knockout embryos produce a post implantation lethal phenotype, and embryos contain defects in endoderm development [134] Similarly, GATA6 null embryos die at day 5.5 due to the absence of a functional extraembryonic endoderm [135] Ectopic expression of GATA6 and GATA4 in ES cells is sufficient to direct ES cells to differentiate into primitive endoderm [136, 137] Mouse ES cells contain a subset of cells that are negative for NANOG but positive for GATA6 Forced expression of NANOG can repress GATA6 and increase homogeneity of ES cells [138] Also, GATA4 or GATA6 nul l ES cells cannot form primitive endoderm in vitro [139] Although both are essential, GATA4 and GATA6 have distinctive roles during primitive endoderm development. GATA4 is required for cell arrangement and positioning while GATA6 pr imarily functions as a sensor to receive extracellular signals, such as retinoic acid [139] An FGF signal may play an important role in establishing primitive endoderm in the mouse blastocyst and ES cells. Embryos lacking FGFR2 cannot form a functional primitive endoderm [140] Data from ES cells suggested that an FGF4dependent signal induces primitive endoderm formation in vitro by repressing NANOG expression [141, 142] This certainly appears to be the case in mouse blastocysts. Manipulation of

PAGE 38

38 FGF signaling either by providing blastocysts with high concentrat ions of recombinant FGF4 or inhibiting its key downstream signaling (e.g. Grb2 or ERK MAPK) can alter cell fates of inner cell mass cells. For example, FGF4 promotes primitive endoderm formation while inhibition of the FGFdependent signal increases the population of epiblast and enhances the ground state of pluripotency [26, 142144] Primitive endoderm development is a complicated process involves cell movement, apoptosis and proliferation. Additional growth factor signaling is required to control the fate of primitive endoderm segregation and differentiation. Platelet derived growth factor receptor alpha (PDGFRa) has been identified exclusively in primitive endoderm lineages in blastocysts, and PDGF signaling controls proliferation of primitive endoderm cells [104, 145] Taken together, NANOG and potential other pluripotent factors repress the activa tion of GATA6 GATA4 and other transcriptional regulators of differentiation, therefore maintaining stemness of epiblast cells [146] In cont rast, two of GATA family transcription factors drive the appearance and maintenance of primitive endoderm lineages in blastocyst or in ES cell. Primitive endoderm development in ruminant In rodents, primitive endoderm gives rise to parietal endoderm and v isceral endoderm, two morphologically different lineages that form yolk sac and play important role in regulation of embryonic patterning formation [147] In rodents, these two layers form the egg cylinder, which provides structural support for placentation and secret es factors that regulate epiblast differentiation [93] In cattle and other ruminants studied, primitive endoderm formation begins after hatching and a completed layer can be identified in the early elongating conceptus. The

PAGE 39

39 formation of a yolk sac is marked by the development of a visceral endoderm layer, which occurs around day 16 post fertilization [148] The yolk sac is ventral to the embryonic disc and covered by trophoblast cells in the filamentous conceptus. When gastrulation occurs, nascent mesoderm cells are adjacent to visceral endoder m and form vascular structures [149] The functions of the yolk sac include facilitation of nutrient transport between the trophectoderm and mesoderm vascular network and production of several proteins, incl uding alphafetoprotein, which direct s early blood cell formation [148] The yolk sac begins to be degenerated when placentation occurs and a chorioallantosis takes over nutrient tr ansportation [149] Primitive endoderm like cells can maintain similar cellular morphology for extended periods in vitro Bovine blastocysts can f orm a primitive endoderm layer in an extended culture system containing feeder layer conditioned medium [150152] H owever, the lineage markers for primitive endoderm and the cues that direct primitive endoderm development and survival in bovine remain largely unknown. One study suggests that GATA6 exists in bovine blastocysts [153] The molecular basis of this part of development biology is important because problems in primitive endoderm develo pment and yolk sac formation likely represent one type of developmental miscues that contribute to pregnancy failures in cattle. Since genetic manipulation of embryo is difficult to achieve in domestic animals, much of our current knowledge about placental abnormalities in ruminant has been completed by examining placental mutations. A high degree of placental defects exist in bovine embryos derived from somatic cell nuclear transfer (SCNT) [154, 155] SCNT blastocysts have aberrant FGFR expression, indicating potential lineage segregation

PAGE 40

40 problems [12] Indeed, pregnancy loss frequently occurs in these embryos, and this may be caused by impaired trophoblast differentiation and yolk sac formation [156158] In summary, the yolk sac plays an indispensable role in facilitating nutrient exchange and regulating embryo differentiation. Key transcription factors mainly CDX2 NANOG and GATA4/GATA6 controls the early lineage segregation of trophoblast, epiblast and primitive endoderm. Although the role of these factors and some of their upstream regulators have been elucidated in rodent models, such invaluable knowledge is missing in cattle and other ruminant species. Control of Conceptus Development and Interferon tau Expression Maternal recognition of pregnancy refers to the biolo gical pathways used by the conceptus to modify the maternal reproductive system so pregnancy can be maintained beyond the length of a normal estrous cycle. In various species where this phenomenon has been studied, these signals also induce uterine recepti vity of pregnancy, specifically by increasing uterine blood supply, modifying the maternal immune system. Progesterone from corpus luteum is the master regulator of these events [159] In ruminant species, elongating conceptus produce a hormone that prevents corpus luteum regression, thus maintaining a uterine environment for the conceptus to continue to develop. Maternal Recognition of Pregnancy in Ruminant s A groundbreaking finding in peri implantation embryo biology in ruminants was the identification of interferon tau ( IFNT ) as the maternal recognition of pregnancy factor. This factor initially was named trophoblastin, proteinX and trophoblast protein1 [160] In the 1960s, embryo transfer and removal experiments revealed a phenomenon that trophoblast cells from elongating conceptus but not from mature placenta produce a

PAGE 41

41 compound to extend the lifespan of the corpus luteum [161, 162] In 1982 this secreted protein released by t he peri implantation ovine conceptus was identified at the University of Florida [163] The existence of bovine trophoblast protein1 was confirmed soon after [164] Trophoblast protein1 shows high homology with type I interferon (IFN), 65% of its amino acids are identical to interferon alpha [165, 166] and functionally, IFNT possesses antiviral, anti proliferation activities like other type I IFNs. Because of these simi larities, this protein is now referred to as trophoblast interferon, or interferontau [15] The primary function of IFNT is to prevent corpus luteum regression. However, recent data has uncovered additional functions of IFNT in the female reproductive system. IFNT is specifically expressed in trophoblast cells and current information suggest that growth factors and cytokines secreted by the uteri ne endometrium play a critical role in promoting transient IFNT production during conceptus elongation. The function of interferon tau during early pregnancy IFNT is the major protein secreted by mononuclear trophoblast cells in elongating conceptuses. In ruminants, the structural and functional regression of the CL, an event [167] ovaries through countercurrent exchange in response to pituitary and luteal derived oxytocin (OXY) [168] In pregnant animals, conceptus production of IFNT prevents this OXYinduced release of [169] IFNT achieves its effects on the uterus by interacting with specific receptors found on the endometrial epithelium. Binding of IFNT to these type I interferon receptor s (IFNR) which also react with many other Type I IFNs, triggers the JAK/STAT signaling

PAGE 42

42 pathway which modifies the expression level of numerous genes, and specifi cally those known as interferon stimulated genes (ISGs) [170] In sheep, the presence of a conceptus or intrauterine injection of recombinant IFNT also prevents the transcription of estrogen receptor and oxytocin receptor, key components of PGF2 synthesis machinery [171, 172] In bovine endometrium, the effect of IFNT depends not only on release by endometrium but also on promotion of PGE 2 a luteoprotective compound [173] Recent advances in large scale transcriptome analysis led to the discovery of many novel IFNT responsive genes in the ruminant endometrium and have suggested that various additional activities of IFNT likely exist during early pregnancy. Specifically, IFNT directs the transcription of several genes associated with angi ogenesis, hypoxia and adhesion [174, 175] For instance, IFNT induced expression of WNT7A functions as a mediator of t rophectoderm proliferation and potentially promotes binucleate cell formation [176] Importantly, IFNT facilitates the nutrient input to the conceptus from uterine endometrium by selectively increasing the expres sion of glycogenesis enzymes as well as glucose and amino acids transporters like SLC2A a nd SLC5A11 [177, 178] Additional mechanisms independent of this paracrine effect have been proposed. During pregnancy, the IFNT mediated antiviral activity of uterine vein blood increases dramatically. Infusion of recombinant IFNT in uterine vein of nonpregnant sheep induces interferon stimulated genes and delays corpus luteum regression. These data support the idea that IFNT is released into uterine vein and acts in an endocrine manner to modulate the ovarian expression of I SGs to prevent luteolysis [179, 180]

PAGE 43

43 In summary, IFNT plays an indispensable role in mediating conceptus and maternal interactions earl y in pregnancy. IFNT directly and indirectly modulates genes required for prevention of corpus luteum regression in ruminants. Also, it is important to note that IFNT regulates key transcripts that, in turn, promote conceptus development and implantation. Transcriptional regulation of interferon tau production The expression pattern of IFNT is unique in several aspects. First, IFNT transcripts are first detected in the trophectoderm of blastocysts and are evident in peri attachment trophoblast cells but not in other fetal tissues [181] Second, IFNT demonstrates a dynamic expression pattern. Conceptus secretion of IFNT is maximal on d 1617 when elongation occurs. IFNT secretion ceases when placent ation takes place around day 21 [ 182] Lastly, IFNT genes are not induced by exposure to virus es or other pathogens like most other IFNs. Indeed, the IFNT promoter lacks functi onal viral responsive elements [183] Instead, the 5 flank region is unique among IFN genes, and provides IFNT with the specific ability to be expressed early during early embry onic development in ruminants [2, 51, 54]. IFNT is only present in ruminants and there is no clear homolog in mice or human. The mechanisms that govern IFNT expression have been partially elucidated. The first discovered transcription factor essential for IFNT expression was ETS2. ETS2 is specifically expressed by trophoblast cells during early development. In mice, e limination of ETS2 activity results in defects in extraembryonic tissue and failure of ectoplacental cone development [184] Further analysis revealed that ETS2 function is essential to maintain the trophoblast stem cell population in mice [185] ETS2 is also a trophoblast specific transcript in the elongated bovine conceptus [62] Bovine IFNT

PAGE 44

44 genes contain a conserved Ets binding domain, which allows ETS2 to enhance IFNT transcription [186] EST 2 is essential for IFNT expression because deletion of ETS2 binding moti f eliminates IFNT promoter activity in vitro. Interestingly, some IFNT gene isoforms that lack the ETS2 binding site show minimal expression and replacement of this region with a functional promoter sequence can rescue those genes [187] Another transcription factor known to interact with the IFNT promoter is AP1 (c fos and c Jun) Although the exact binding site for AP1 remains controversi al, ectopic expression of c fos and c Jun can enhance IFNT transcription [188] In the ovine embryo, c fos and c jun protein accumulates in trophoblast cells and the expression pattern of these transcription factor subunits is coincident with IFNT expression [189] Not surprisingly, transcription factors essential for trophoblast lineage specification play an important rol e in regulating IFNT production. In ovine trophoblast cells, CDX2 binds to the IFNT promoter region and enhances IFNT transcription [190] Usually the transcription of IFNT only takes place in trophoblast cells ; however, endogenous IFNT ca n be induced in MDBK cells by over expression of CDX2 suggesting that CDX2 is one of the core drivers that control IFNT transcription [191] Interestingly, GATA3 also appears to be a key player in IFNT transcription. Over expression of a GATA3 construct alone does not increases IFNT production, but cotransfection with ETS2 and CDX2 synergistically enhances IFNT promoter activity and mRNA abundance in bovine trophoblast cells [192] Another trophoblast specifying factor, DLX3 regulates IFNT expression. DLX3 a transcription factor essential for trophoblast differentiation and labyrinthine layer formation in mice has been recently identified to control IFNT

PAGE 45

45 transcription in bovine trophoblast cells [193, 194] The putative binding region for DLX3 in bovine IFNT gene is overlapped by the ETS2 site In contrast to transcription factors permissive for IFNT expression in trophoblast cells, OCT4 negatively regulates IFNT gene transcription. OCT4 is detectable in bovine trophectoderm at the bl astocyst stage and trophoblast expression of OCT 4 continues in spherical and ovoid conceptuses [62, 195] Ectopic expression of OCT4 inhibits ETS2 mediated increase in IFNT promoter activity but it does not bind to the DNA directly. OCT4 forms a complex with ETS2 through binding of the POU domain of OCT4 to a site adjacent to ETS2 DNA binding domain [196] These observations indicate that one of the reasons that OCT4 remains in trophoblast cells is to sequester ETS2 induced IFNT transcription for a few days until the conceptus begins to elongate. Signaling pathways controlling interferon tau production S everal extracellular regulated signaling systems have been linked with regulating IFNT expression. Most signaling work in this area have been completed in two human carcinoma cell lines, JEG or JAR cells, or in the mouse NIH3T3 cell line. Ras MAPK is lik ely the key regulator of IFNT gene transcription. Treatment of NIH3T3 cells with CSF 2 quickly stimulates ERK1/2 phosphorylation, and t hese kinase cascades mediate CSF 2 induced increases in IFNT promoter activity [197] The potential targets for ERK1/2 in trophoblast likely include CDX2 and ETS2 In mice trophoblast stem cells, FGF4 directly activate ERK1/2 to enhance CDX2 expression [198] Whether MAPK dependent CDX2 directly involves in IFNT regulation remains unsolved. Also, ERK1/2 phosphorylates the Thr72 site on ETS2 and thereby dramatically increases this factors activity to stimulate IFNT transcription [197]

PAGE 46

46 PKA is involved with mediating IFNT promoter activity. ETS2 is not a direct target for PKA but it apparently synergizes with PKA. In CT1 cells, cAMP response element binding proteinbinding protein (CBP)/p300, the known substrate for PKA, binds to the proximal promoter region of IFNT gene [199] T reatment of day 16 ovine conceptuses with phorbol ester, PMA significantly increased IFNT mRNA abundance, suggesting that a PKCdependent pathway is involved with regulating IFNT transcription [200] Eleven PKC family are categorized into three subgroups of protein kinases based on structural similarities and conserved responsive elements [201] PKC members are present in early mice trophectoderm and several appear important for controlling embryo compaction and blastocoel formation [202, 203] The PKC isoform involved with embryo development or IFNT gene expression remained discovered until recently, and this will be described in more detail in chapter 3. Reg ulation of Preand Peri development by Growth Factors In cattle, the independence of preimplantation development in vitro is not limitless, but rather it is clear that current culture conditions cannot fully support conceptus development beyond the blastocyst stage. It was originally thought that the structural support by uterus is the key mediator for the continuation of embryo development in vitro This is partially true because limited trophoblast elongation can be induced when hatched blastocysts wer e placed in an aga rose gel tunnel filled with growth medium containing serum and glucose [60, 151] However a normal, healthy looking primitive st r eak could not be observed in these elongating embryos. These experiments suggest that uterine secr etions are needed for epiblast differentiation and normal conceptus elongation.

PAGE 47

47 Further support for the contention that uterinederived factors are required for preimplantation conceptus development is observed by using uterine gland knockout models [204] In ewes, exposure to neonatal progesterone alters uterine morphology and impairs the uterine glands development [205, 206] Morphological normal blastocysts can be recovered in these animals, but pregnancy cannot be established mainly because of severe defects in the process of conceptus elongation. Several key factors that regulate conceptus development have been identified using this model. To follow is an overview of uterine and conceptus factors that regulate v arious aspects of preand peri implantation conceptus development. Factors shown beneficial effects on preimplantation development Growth factors help embryo development in vitro or in vivo through different ways. For example, some factors are known for their mitogenic effects on trophoblast cells while others are involved in preventing cell death or controlling trophoblast migration. Numerous growth factors and cytokines have been investigated in different in vitro systems for these and other activities. The insulin growth factor (IGF) family promotes bovine embryo development in vitro. IGF system is a complex family including two ligands IGF1 and IGF2 binding proteins (IGFBP16) and type I receptor. Supplementation of in vitro produced bovine embryos w ith IGF 1 increases the blastocyst rates and total cell numbers of blastocysts [207] This action is mediated by increasing the number of cells committed to trophectoderm lineage and reducing cell apoptosis [208] IGF1 also pr otects embryos from stress. IGF 1 increased thermot olerance of embryos in vitro [209] and promoted the survival rates after trans fer to cows during summer months [20]

PAGE 48

48 Anot her uterinederived factor, CSF2, which initially was described as a cytokine has also been shown pivotal for embryo implantation and placental formation [210] Bovine embryos exposed to CSF2 from day 5 to 7 post f ertilization had improved developmental competency as recorded by higher pregnancy rates and lower pregnancy loss after embryo transfer [22] Further data suggested that this factor modulates early germ layer differentiation and likely provides an important survival signal to the inner cell mass. Other factors that promote preimplantation development include members of the EGF family of proteins [208] as well as TGFbeta1, LIF and FGF2 [211] These growth factors accelerate embryo development alone or show a synergistic effect when providing embryos with the combination of two or three factors [211, 212] Providing in vitro produced em bryos with various growth factors that are present in either oviduct fluid or uterus lumen activate key molecular pathways that are important for embryo development [213] Regulation of trophoblast cell migration The rapid growth and remodeling events that r elate to conceptus elongation are not fully understood, but epithelial cell migration is central to development and tissue remodeling in various tissues and undoubtedly is involved with controlling elongation in ruminant conceptuses. Directional migration is controlled by various extracellular molecules in other cell systems [214] Changes in extracellular environment such as the gradient of growth factors and cytokines or ECM alter ac tin cytoskeleton dynamics and cell adhesion. Cells express various adhesion receptors; however, integrins are vitally important transmembrane receptors that sense and integrate ECM and cytoskeleton signals during epithelial cell migration in various cells including trophoblast

PAGE 49

49 cells [215, 216] For example, disruption of an integrinactin linkage compromises cell adhesion and migration [217] In ruminants, integrin systems are also actively involved in modulating the migratory ability of trophoblast cells. Several uterine factors have been linked wit h controlling trophoblast migration. One of the best known examples of this is the effects noted for galectin 15 (LGALS15). This protein is synthesized by uterine epithelial cells and is released into the uterus lumen where it interacts with trophoblast cells. LGALS15 directly promotes the assembly of integrinactin complexes and stimulates ovine trophoblast cell migration [218] Another factor, SPP1 (also known as osteopontin), is a common binding partner for several integrins, and its presence also mediates the cell migration [219] Integrin and ECM dynamics also potentially mediate the migration of bovi ne trophoblast giant cells in bovine placenta because a descriptive study demonstrated those bovine trophoblast giant cells were immunoreactive for integrin subunits (alpha 6, alpha 2 and beta 1) and laminin, the major protein of basal membrane at the maternal fetal interface [220] Although a series of experiments were carried out to examine the expression profiling of integrins in bovine blastocysts and elongating conceptus [221, 222] because of the complexity of integrin family, the major integrin subunits responsible for post hatching development and trophoblast cell migration is inconclusive. The IGF and their binding proteins increase trophoblast migration in vitro. IGF2 and its binding partner IGFBP 1 are both present in uterus lumen, and treatment of ovine trophoblast cells with recombinant IGF2 or IGFBP1 increases trophoblast cell migration in vitro [223] Interestingly, IGFBP 1 concentrations are elevated during conceptus elongation in cattle, suggestive of its potential role in mediating elongation in utero. The

PAGE 50

50 signaling systems involved with this activity also have been examined. Block ing ERK1/2 or p38 MAPK phosphorylation prevents IGF 2 induced cell migration, suggesting that ERK1/2 and p38 MAPK mediated systems control trophoblast cell migration [23] Immunohistochemistry work revealed that ERK1/2 and p38 MAPK are activated in trophoblast cells during elongation [223] Further studies that attempt to uncover the additional underlying mechanisms controlling trophoblast cell migration will be invaluable because this kind of knowledge will enhance our understanding of conceptus elongation and potentially will provides additional clues of how normal conceptus development progresses in ruminants. Uterine derived factors stimulate IFNT production Another well studied but far from complete area of research is describing how the uterus mediates IFNT production. We hypothesize that optimal production of IFNT requires specific uterine secreted factors. The bases for this argument can be found in several studies. Firstly, coculturi ng bovine blastocysts with uterine flushing from cyclic animals in the late luteal phase increases IFNT production [224] Furthermore, treatment of bovine primary trophoblast outgrowths or isolated trophoblast cell lines with specific growth factor s or cytokines found in the uterine lumen enhances IFNT mRNA and protein abundance [197] Also, conceptus growth and IFNT secretion is compromised in conceptuses exposed to a uterus devoid of uterine glands, the primary producers of uterine histotrophic agents [204, 225] Lastly, several extracellular regulated signals described previously in this literature review activate signaling factors that control the IFNT transcription. For example, PKC and ERK dependent systems are controlled by CSF2 to increase IFNT production in ovine trophectoderm and human choriocarcinoma cells transected with IFNT promoter reporter constructs [197, 226]

PAGE 51

51 The fact that other growth factors and cytokines stimulate IFN T promoter activity or IFNT production by trophoblast cells indicates that more than a signal signaling mechanism is involved. A good example is that the day 13 ovine whole conceptus is cultured in serum free medium. In this embryo, neither IGF1 or IGF 2 a lone is able to induced IFNT production but the combination of those two factors significantly enhances IFNT secretion [227] CSF2 also promotes IFNT production by primary t rophoblast cells from elongated conceptuses or isolated trophoblast cell lines [21, 226] The cellular mechanisms that mediate CSF 2 induced IFNT expression is under discussion because experiments using ovine primary trophoblast cells or investigating IFNT promoter activity in a nontrophoblast cell line result in different conclusion. For example, CSF2 induced IFNT in ovine trophoblast cells is mediated by a PKC dependent system, but in a different study, the authors conclude that RASMAPK is essential for CSF 2 induced IFNT promoter activity [197, 200, 226] Roles for FGFs in mediating conceptus development in ruminants As described earlier FGF4 plays a pivotal role in regulating early embryo development in mice. The inner cell mass derived FGF4 binds to its trophectoderm specific receptor FGFR2 to regulate trophoblast stem cell proliferation [27, 152] Most recently, a new role of FGF signal in promot ing primitive endoderm lineage commitment has been described [1 52] In bovine, it is not clear whether FGF4 is produced by blastocyst and this factor plays a similar role in controlling trophoblast cell proliferation, however, considerable evidence suggests that FGF family proteins are important regulators of preand peri implantation conceptus development. FGFs are a family of growth factors that have a wide variety of biology effects including angiogenesis, cell proliferation, migration and maintenance the pluripotency of

PAGE 52

52 human ES cells [228] The first FGF to be identified in this regards was FGF2 or basic FGF. Specifically the luminal and glandular epithelium of pregnancy and cyclic cows is positive for FGF2 transcripts, and uterine lumen contains immunoreactive FGF2 protein. The FGFs that present in uterus lumen is not limited to FGF2, FGF10 is synthesized by stromal cel ls and the amount of FGF10 secreted increases with the rising of progesterone level [32] It is thought that FGF10 works as a mediator of progesterone during the peri implantation period to control conceptus growth and development, although the exact function of FGF10 is unclear [32] Bovine blastocyst and elongation conceptus itself is also a source of FGFs in embryos [28] FGF2, FGF4, FGF7 and FGF10 transcripts are all present in bovine blastocysts, ovoid and elongating conceptus [12, 29, 30, 229] Multiple FGF receptors exist on bovine trophoblast cells. Four functional FGF receptors (FGFR14) have been identified in mammalian species [230] FGF receptor contains of an extracellular domain, a transmembrane domain and an intracellular tyrosine kinase domain. The extracellular domain of FGF receptor consists of three immunoglobulinlike domains and the third IgG like domain of FGFR13 is encoded by alternate mRNA splicing and creates two different isoforms (IIIb, IIIc) [231, 232] Various FGFRs and isoforms show distinct tissue specific expression pattern and provide different recognition sites for FGF ligands. Bovine blastocysts, elongating conceptuses, and trophoblast giant cells all contain FGF receptors including a trophoblast specific FGFR2b [30, 233] This receptor subtype also has been identified in ovine conceptuses [32]

PAGE 53

53 The most potent effect of FGFs is to stimulate IFNT production by bovine trophoblast cells. Providing bovine trophoblast cells or in vitro produced blastocysts with as low as 1 ng/ml FGF2 increases IFNT mRNA and protein abundance. Interestingly, the amount of immunoreactive FGF2 in uterus increases days 1213 after estrus in both cyclic and pregnant ewe, associated with conceptus elongation and maximal production of IFNT [29] It also is worth mentioning that FGF2 has little to no effect on trophoblast cell proliferation, suggesting that intracellular pathways distinct from those used to control mitogenesis are being triggered by FGF2 other than mitogenic mechanism [28, 31] In conclusion, several l ines of evidences support the model that emphasizes the significant role that growth factors play in regulating conceptus development and IFNT production, however, further experiments are absolutely required to provide critical information about how these growth factors. It is of particular important to understand how FGF2 regulates IFNT expression in bovine trophoblast cells and whether this relationship is necessary for maternal recognition of pregnancy in ruminants. Also special attention should be paid to uncover the other actions of FGF signaling during preand peri implantation development in cattle and other economically important ruminant species.

PAGE 54

54 Figure 2 1. Early lineage s egregation during preimplantation development. At the late 8 cell stage, after compaction blastomere undergoes two types of cell division, symmetric an d asymmetric cell division. A blastomere with asymmetric division gives to one outside cell and another inside cell. The cell located outside the embryo eventually forms trophectoderm, while inside blastomeres contribute to inner cell mass. In the new form ed blastocyst cell with the inner cell mass start to differentiate to epiblast and primitive endoderm.

PAGE 55

55 CHAPTER 3 PROTEIN KINASE C DELTA MEDIATES FIBRO LBAST GROWTH FACTOR 2 INDUCED INTERFERON TAU EXPRESSION IN BOVINE TROPHOBLAST Interferon tau ( IFNT ) is the trophectoderm secreted factor responsible for establishing and maintaining early pregnancy in cattle, sheep, goats, deer and likely other ruminants [181, 234] IFNT is best k nown as an antiluteolytic agent; i t prevents production [181, 234] IFNT also stimulates endometrial PGE2 synthesis, a putative luteotrophic agent [173, 235] More recently IFNT has been linked to additional activities, such as inducing uterine factors that promote conceptus development [174, 236, 237] increasing endometrial glucose and amino acid transporter expression [177, 238] regulating uterine and systemic immune responses to pregnancy [239, 240] and impacting gene expression in the corpus luteum (CL) [180, 241] It is not surprising that miscues in IFNT production and action are linked with pregnancy failures in cattle [5, 242, 243] Dynamic changes in IFNT production occur as the conceptus develops and elongates prior to uterine attachment. Bovine embryos begin producing IFNT at the morul a and blastocyst stages coincident with trophoblast lineage specification [244, 245] The relative abundance of IFNT transcripts and protein increases dramatically at days (d) 14 15 of pregnancy as conceptus elongation begins [246, 247] Expression decreases abruptly as trophectoderm attaches to the uterine epithelium on or after d 21 of pregnancy [246, 248] Exposure to viruses or other pathogens do not impact IFNT expression as they do for most other Type I IFNs [249, 250] Instead, IFNT transcription is controlled developmentally by at least two trophoblast specifying transcription factors

PAGE 56

56 ( CDX2 and DLX3 ) and by ETS2 a member of a family of transcriptional regulators involved with vari ous cellular activities [186, 190, 194, 197] Over the past several years it has become clear that several fibroblast growth factors (FGFs) regulate IFNT production in bovine trophoblast cells and blastocysts [28, 30, 31] Multiple FGFs exist in mammals, and most serve as paracrineacting regulators of proliferation, differentiation, morphogenesis and angiogen esis during embryonic, fetal and post natal development [251] Several FGFs are produced by the bovine conceptus and uterus prior to implantation. Most uterinederived FGFs are produced within the endometrial stroma or smooth muscle layers surrounding local blood vessels [32, 252] and may not reach the uterine lumen to influence conceptus development before implantation. However, FGF2 is produced by luminal and glandular epithelium and released into the uterine lumen throughout early pr egnancy in sheep and cattle [28, 29] Elevated quantities of FGF2 protein are released into the uterine lumen coincident with conceptus elongation and maxima l IFNT production in sheep [29] Bovine conceptuses also produce several FGFs, most notably FGF2 and FGF10, prior to implantation [30] Several FGF receptors (FGFRs) also exist in bovine and ovine conceptuses [29, 30] Four genes encode tyrosine kinase receptors (FGFR14) [251, 253] and transcripts for each FGFR exists in ovine and bovine conceptuses at the blastocyst stage (d 78 post insemination) and thereafter [29, 30] It is unclear how FGFs regulate IFNT production. ETS2 activity is crucial for IFNT transcription, and maximal ETS2 activity requires tyrosine phosphorylation within its pointeddomain. A Ras mediated MAPK pathway controls this phosphorylation event [186, 197] Protein kinases A and C

PAGE 57

57 (PKA and PKC, resp ectively) also regulate IFNT transcription. Stimulating PKA activity with dibutyryl (db) cAMP increases IFNT promoter/enhancer activity [199] Similarly, exposure to phorbol ester, a diacylglycerol (DAG) mimic and PKC activator, increases IFNT mRNA concentrations in ovine conceptus explants and stimul ates IFNT promoter/enhancer activity in various human cell lines [254, 255] The overall goal of this study was to describe the signaling mechanisms used by FGF2 to regulate IFNT production. This report provides evidence that PKC delta, a member of the novel PKC subfamily, mediates IFNT mRNA abundance during early pregnancy in bovine trophectoderm. PKCs are grouped within three subfamilies based on structural similarities and commonality of responses to various stimuli [201] 2+, DAG and 2+ dependent but are responsive to DAG and phorbol esters. The third subfamily, termed atypic al PKCs, represents lipiddependent kinases that are not controlled by Ca2+ or phorbol esters. Identifying a role for PKC delta in bovine trophoblast cells provides new insight into the mechanisms controlling early conceptus development in this species and offers another function for this signal transducer molecule. Materials and Methods Materials Dulbeccos modified essential medium containing high glucose ( DMEM ), Opti MEM fetal bovine serum (FBS), insulin/transferring/selenium solution (ITS), cell culture supplements PCR primers, siRNAs, Trizol PureLink Total RNA Purification System, SuperScript III First Stand Synthesis kit ThermalAce DNA Polymerase pCRBlunt TOPO vector and Cy3 lab eled control siRNA were purchased from Invitrogen Corp.

PAGE 58

58 (Carlsbad, CA, USA). HiPerFect siRNA transfection reagent was purchased from Qiagen Sciences (MD, USA) MatrigelTM was purchased from BD Bioscien ces (San Jose, CA, USA). RNase free DNase was purchased from New England Biolabs (Ipswich, MA). Pharmacological inhibitor s for MEK (U0126 and PD98059), p38 MAPK (SB203580), PKCs ( calphostin C, G, rottlerin), phorbol 12myristate 13acetate (PMA) and PMA were purchased from EMD Chemicals (Gibbstown, NJ USA). The FGFR inhibitor, PD173074 was purchased from S temgent (Cambridge, MA, USA). All ant ibodies were purchased from Cell Signaling Technology (Danvers, MA USA). The High Capacity cDNA Reverse Transcription kit and SYBR Green Detector System were purchased from Applied Biosystems Inc. (Foster City, CA, USA). Polyvinylidene Difluoride (PVDF) (Immobilon P) membrane was purchased from Millipore Co. (Bedford, MA USA). E n hanced chemiluminescence (ECL) w estern blot detection system was purchased from Amersham ( GE Healthcare, USA). The Cell Titer 96 Aqueous One Solution Cell Proliferation Assay was purchased from Promega Corp., (Madison, WI, USA). Recombinant human IFN (Gibbstown, NJ, USA). Reagents and materials for superovulation and conceptus collecti ons were purchased from Agtech Inc ( Waukesha, WI ). All other reagents were purchased from Sigma Aldrich Co. (St. Louis, MO) or Thermo Fisher Scientific (Pittsburgh, PA). Trophoblast Cell C ulture The CT1 and Vivot bovine trophoblast cell lines were isola ted by Talbot et. al. [256, 257] The CT1 line was derived from an in vitro produced bovine blastocyst whereas the Vivot line was developed from an in vivo derived bovine blastocyst [256, 257] Each cell line w as propagated without a feeder cell as described previously [28]

PAGE 59

59 on Matrigel coated plates in DMEM containing 10% [v/v] FBS, 100 M nonessential a mino acids mercaptoethanol and antibiotic antimyc otic (100 U/ml penicillin G, C with 5% CO2 in air. Cells were passaged manually by separating them from plates with a cell scraper and dissociating them into small clumps w ith repeated dissociation through a 20ga needle. Cells were seeded onto 12or 24well plates containing Matrigel. After 3 d, medium was removed and replaced with DMEM lacking FBS but containing all other supplements and ITS ( 10 g/ml insulin, 5.5 g/ml transfer r in and 6.7 ng/ml sodium selenium ). After 2022 h, pharmacological inhibitors or vehicle ( 0.01% [v/v] DMSO) w as added. After 2 h, medium was replaced and cells were supplemented with 50 ng/ml boFGF2, 100 nM PMA or vehicle (1% w/v BSA) in fresh serum PMA, an inactive phorbol ester, served as a control for PMA in some studies. After 2224 h exposure to FGF2 or PMA, total cellular (tc) RNA was extracted using Trizol and the PureLink Microto Midi Total RNA Purification System. P rimary bovine trophoblast outgrowths were generated from in vitro produced bovine embryos as described previously with modifications (40). On d 8 post fertilization, individual expanded blastocysts were placed in Matrigel coated wells of 48well plates with DMEM containing 10% FBS, 100 M nonessential amino acids 55 mercaptoethanol and antibiotic antimycotic A morphological assessment of was completed on d 15 post IVF (monolayers of tightly packed cells with prominent nuclei and numerous secretory granules; dome formation were evident in some outgrowths). On d 20 post fertilization, trophoblast outgrowths were scraped and dissociated manually. Outgrowths were pooled together within each replicate study (n=3 replicates)

PAGE 60

60 and used to seed 12well plates containing Matrigel. After 4 to 5 d, outgrowths were serum starved and treatments were supplemented as described for CT1 and Vivot cells. Quantitative Real Time RTPCR TcRNA concentration and purity was determined using a NanoDrop Spectrophotometer (Thermo Scientific). Samples (10 ng tcRNA; 1.8 A260/A280 ratio) were incubated with RNase free DNase for 30 min at 37C. After heat inactivat ion the DNase (75C for 10 min), RNA was reverse transcribed using the High Capacity cDNA Reverse Transcription kit and random hexamers. Primers (200 n M) specific for IFNT PRKCD (gene abbreviation for PKC delta), PRKCQ (gene abbreviation for PKC theta) or 18S (internal control) (Table 3 1) were used in combination with a SYBR Green Detector System and a 7300 RealTime PCR System (Applied Biosystems Inc.) to quantify gene target gene abundance [28, 30] A dissociation curve analysis (6095C) was used to verify the amplification of a single product. E ach sample was completed in triplicate reactions A fourth reaction lacking reverse transcr iptase was included to control for genomic DNA contamination. Standard curves generated from serial dilutions of bovine conceptus tcRNA collected on d 17 of pregnancy [30] were used to determine IFNT primer efficiency (94%). The comparative threshold cycle (CT) method was used to quantify mRNA abundance [2 8] The average T value for each sample was calculated (gene of interest CT CT for 18S ) and used to calculate the fold changes in relative abundance of each transcript. Western Blot Analyses CT1 cells were seeded onto 6well plates containing Matrigel. After 3 d, medium was removed and replaced with DMEM lacking FBS but containing all other supplements and ITS. After 2022 h, pharmacological inhibitors or carrier only was

PAGE 61

61 added. After 2 h m edium was removed and replaced with fresh serum free medium containing 50 ng/ml boFGF2 or 100 nM PMA. Cells were collected either immediately before (time 0) or at several time points after FGF2 and PMA supplementation. Cells were rinsed in 0.1 M PBS [pH 7.4] and dissolved using NP 40 buffer (20 mM Tris HCl pH 8, 137mM NaCl, 20 mM EDTA, 1% [ v/v] NP40) supplemented with protease and phosphatase inhibitor cocktails. Cell lysates were sonicated for 15s and centrifuged (10 min at 10,000 x g). Protein concentr ations of supernatants were determined using a BCA Protein Assay. In one study, CT1 cells were cultured in serum free medium without ITS to examine whether the inclusion of these factors affected ERK1/2 phosphorylation status. In another study, CT1 cells w ere treated with 100 nM PD173074, an FGFR kinase inhibitor [258] or its carrier only (0.01% [ v/v ] DMSO) during serum starvation and FGF2 challenge to examine whether endogenous FGFs impacted ERK1/2 activity. This concentration of inhibitor effectively blocked FGF2 induced increases in IFNT mRNA abundance in CT1 cells without altering apoptosis rate (M. Ozawa and A. D. Ealy, Unpublished observations) Identical amounts of protein ( 15 to 35 g depending on the study) were loaded and electrophoresed in 10 or 12% [w/v] SDS PAGE gels. Samples were e lectrotransferred onto 0.45m PVDF using a semi dry membrane blotter (Amersham Biosciences ). Membranes were blocked with 5% [w/v] nonfat dry milk in TBST (50mM Tris HCl pH 7.4, 150 mM NaCl, 0.1% [v/v] Tween20) then incubated overnight at 4C with total (pan) or phosphospecific ERK1/2 (T202/Y204) (1:2000), p38 MAPK (1:1000) or PKC delta Y311 (1: 1000) in TBST containing 3% [w/v] BSA. H orseradish

PAGE 62

62 peroxidase conjugated anti rabbit IgG ECL and exposure to BioMax film were used to visualize reactive bands. After detection, membranes were washed with TBST and incubated in stripping buffer (2% SDS, 1 mercaptoethanol, 50 mM Tris HCl pH 6.8) at 50C for 30 min with gentle shaking. For ERK and p38MAPK studies, blots were blocked and used again so that total and phosphospecific bands could be visualized on the same blot. For P K C delta antiserum studies, blots were blocked and incubated in anti tubulin ( 1:3000). Three independent W estern blot s generated from different CT1 cultures were completed for each study. Representative blots were photographed for presentation. Anti viral Activity CT1 cells were serum starved for 24 h and then were treated with 5 carrier only (0.01% DMSO) for 2 h. Medium was exchanged and cells were cultured in serum free medium containing either FGF2 ( 0 or 50 ng/ml ) or PMA ( 0 or 100 nM) depending on the study. After 48 h, conditioned medium was collected and stored at 80C Viable cell number was determined by using the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay. Absorbance at 490 nm was recorded using SpectraMax 340PC384 (Molecular Devices, Sunnyvale, CA, USA). The amount of biologically active IFNT in CT1 conditioned medium was determined by using an antiviral assay as described previously [29] The ability of conditioned medium sampl es to inhibit vesicular stomatitis virus induced death of MadinDarby bovine kidney cells by 50% was compared with the activity of recombinant 8 IU antiviral activity per mg protein). The antiviral activity of conditioned medi um was adjusted based on this standard to represent the IU

PAGE 63

63 activity/ml of sample. Data also were adjusted to account for potential variations in cell number by normalizing for cell titer readings (A490). Bovine C oncept us Collection and E ndpoint RTPCR All animal studies were performed in accordance with guidelines and with the approval of the Institutional Animal Care and Use at the University of Florida (UF). Conceptuses were harvested on d 14 and 17 post insemination from nonlactating Holstein cows housed at the UF Dairy Unit (Hague, FL, USA). Conceptuses were either collected nonsurgically by transcervical uterine flushing (d 14) or after cows were slaughtered at the UF Meats Laboratory as described previously [30] Approximately half of the d 14 conceptuses collected were ovoid. The remaining d 14 conceptuses were elongated and ranged fr om 0.5 to 3 cm in length. All d 17 conceptuses were filamentous and ranged from 5 to 45 cm in length. From 3 to 5 conceptuses were pooled together and snapfrozen in liquid nitrogen. Each of the d 14 samples contained at least one ovoid and one elongating conceptus. Corpora lutea (C L; n=3) were collected from ovaries of nonsuperovulated cows at slaughter. All samples were stored at 80C until RNA isolation using T rizol reagent. For endpoint RTPCR analysis, tcRNA (500 ng) from CT1cells d 14 and 17 conceptuses and CLs were incubated in RNasefree DNase as described previously. Reverse transcription was completed using the SuperScript III First Stand Synthesis kit and random hexamers according to manufacturers instructions. PCR amplification was completed with pr imers for PRKCD, PRKCQ or ACTB (Table 3 1) using ThermalAc e DNA Polymerase (35 cycles of 95 C for 1 min 5860C for 1 min, 72 C for 1 min and a final extension of 72 C for 10 min). Products were electrophoresed in a 1.5% [w/v] agarose gel containing ethidium bromide (100 ng/ml ) and visualized under ultraviolet

PAGE 64

64 light. Amplicons were cloned into the pCRBlunt TOPO vector and inserts were sequenced to verify correctness of amplification at the UF DNA Sequencing Core Facility. RNAinterference Three small, interfering RNA ( siRNA) duplexes were used (Table 3 1). siRNA # 1 was examined previously in a bovine endothelial cell line [259] siRNAs#2 and #3 w ere designed by using the BLOCK iT RNAi Designer Program (Invitrogen Corp.) based on the Bos taurus sequence for PRKCD in Gen B ank (GeneID: 505708) Cy3 lab eled control siRNA served as the negative control. For transfection, Vivot cells were scraped off plates at 30 40% confluence in Opti MEM and passed through a 22ga needle 3 5 times before being placed onto Matrigel coated 24siRNA cocktail containing 25 nM of each siRN A was combined with 4.5 l HiPerFect siRNA transfection reagent in 100 l Opti MEM and incubated at room temperature for 10 min before mixing with Vivot cells. Opti MEM and siRNA reagents were removed after 9 h and replaced with DMEM containing 10% FBS and other additives For qRTPCR studies, cells were serum starved after 2 d in culture as described previously and exposed to 50 ng/ml FGF2 or vehicle only for 24 h before tcRNA extraction. For Western blot analysis, cells were cultured for 3 d before col lecting protein lysates. Statistical Analyses All analyses were performed by least squares ANOVA using the General Linear M odel Procedure of the Statistical Analysis System (SAS Institute Inc., Cary, NC). Fold differences of real time analyses were log transformed to remove heterogeneity of variances [28, 30] Differences between individual means were contrasted with pair -

PAGE 65

65 wise analysis (PDIFF [probability of difference] analysis in SAS). Results are presented as arithmetic means SEM. R esults ERK1/2 and p38 MAPK dependent R egulation of IFNT E xpression Ras mediated pathways regulate IFNT tra nscription [197] and the objective of the first set of studies was to determine if ERK and/or p38MAPK pathways control constitutive and FGF2dependent increases in IFNT mRNA levels in bovine trophoblast cells. CT1 cells were exposed to p38 medium was then changed and replaced with fresh serum free medium supplemented with 0 or 50 ng/ml FGF2 for 2224 h. This duration of FGF2 treatment was chosen based on outcomes of preliminary studies. In those studies FGF2 responses could first be realized after 8 to 12 h of FGF2 treatment but were maximal after 24 h exposure to FGF2 (Data not shown). Constitutive phosphorylation of ERK1/2 was evident in CT1 cells, and addition of FGF2 did not influence ERK1/2 phosphorylation status (Fig. 3 1A) Supplementation with U0126 abolished constitutive ERK1/2 phosphorylation, and no ERK1/2 phosphorylation was observed in the first 2 h after providing FGF2 (Fig. 3 1A). Studies were not completed to examine if ERK1/2 phosphorylation was interrupted for more than 2 h. Supplementation with U0126 had a major impact on the relative abundance of IFNT mRNA in CT1 cells (Fig. 3 1B). As seen in previous reports [28, 30, 31] FGF2 increased (P<0.05) the relative abundance of IFNT mRNA in the absence of MEK inhibitor. Exposure to the MEK inhibitor reduced (P<0.05) IFNT mRNA levels below that of the control value in cells supplemented with 0 or 50 ng/ml FGF2.

PAGE 66

66 The phosphorylation status of p38MAPK was affected by FGF2 (Fig. 3 1C). Specifically, increases in phospho p38MAPK abundance were detected within 5 min of FGF2 treatment. This effect was transient and p38MAPK phosphorylation status returned to baseline levels within 60 min. Exposure to SB203580 prevented FGF2induced phosphorylation of p38 MAPK (Fig. 3 1C ). However, modifying p38 MAPK phosphorylation status did not affect FGF2induced IFNT mRNA conc entrations in CT1 cells (Fig. 31D). Increases in IFNT abundance (P<0.05) were evident regardless of whether the p38MAPK inhibitor was provided. In the absence of FGF2 this inhibitor reduced (P<0.05) basal IFNT concentrations (Fig. 3 1D ). PKCdependent R egulation of IFNT E xpression A separate set of studies was completed to determine if FGF2 utilized PKC dependent systems to regulate IFNT abundance in bovine trophoblast cells. Initially, a series of pharmacological PKC inhibitors and mimics were examined. In the first study, supplementing medium with the panPKC inhibitor, calphostin C, [260] for 2 h prevented FGF2 from increasing IFNT abundance (Fig. 3 2A ). Constitutive concentrations of IFNT were not affected by calphostin C treatment but FGF2 induction of IFNT was blocked (P<0.05) in cells exposed to calphostin C. In a follow up study PMA, a phorbol ester commonly used to activate PKC pathway, was used to determine if FGF2 effects in CT1 cells could be replicated by DAG activation (Fig. 3 2B). Supplementation with 100 nM PMA for 22 24 h increased (P<0.05) IFNT abundance in CT1 cells to the same degree as FGF2 (Fig. 3 3B). C ombining FGF2 and PMA did not have additive or synergistic effect s on IFNT concentrations.

PAGE 67

67 A subsequent set of studies was completed to define the PKC subtype utilized by FGF2 and PMA in CT1 cells. Two pharmacological inhibitors were tested; G6976, an inhibitor of classical [261] and rottlerin, an inhibitor of PKC delta and PKCtheta [262264] (Fig. 3 3). Pre treatment with G for 2 h at a concentration FGF2or PMA induced IFNT levels in CT1 c ells (Fig. 3 3A&B). By contrast, FGF2 and PMA responses were inhibited (P<0.05) after a 2 h exposure to rottlerin (Fig. 3 3C&D). Rottlerin did not affect constitutive IFNT concentrations. Also, rottlerin had no effect on tcRNA quality and quantity, 18S RNA concentrations or rate of apoptosis (as determined by TUNEL analysis) (data not shown). A subsequent study was completed to determine if rottlerin also affected the amount of IFNT protein secreted into conditioned CT1 medium after FGF2 or PMA treatmen t (Fig. 3 4). IFNT protein concentration was determined by examining the antiviral activity of conditioned medium. Both FGF2 and PMA increased (P<0.001) the antiviral activity of CT1 conditionedmedium (Fig. 3 4 A & B). Furthermore, pre incubation with rottlerin prevented the FGF2 and PMA effects without affecting basal antiviral activities (Fig. 3 4A & B). The FGF2and rottlerindependent effects on IFNT mRNA concentrations were extended to Vivot cells and primary trophoblast outgrowths to examine whether the effects noted were also apparent in other cell models for bovine trophoblast. Both trophoblast cell systems responded similarly to FGF2 and rottlerin (F ig. 3 5 A & B). Exposure to FGF2 increased (P<0.05) IFNT abundance, and this effect was abolished (P<0.05) with prior exposure to rottlerin.

PAGE 68

68 PKCdelta E xpression and A ctivation in T rophectoderm A series of studies were completed to identify the PKC t arget for rottlerin in CT1 cells and verify that FGF2 activates this target. Initially the presence or absence of PKCdelta and PKCtheta was determined by using endpoint RTPCR ( Fig. 3 6A) PKCdelta amplicons were identified in CT1 cells, d 14 and 17 bovine conceptuses, and CL (positive control). In other work, PKCdelta mRNA also was identified in Vivot cells, bovine blastocysts and bovine primary trophoblast outgrowths (data not shown). PKCtheta mRNA was detected in CT1 cells, d 14 and 17 concept uses and CL (Fig.36A), but the intensity of this product was lower than that for PKCdelta in CT1 and d 17 conceptuses. When using qRTPCR, the relative amounts of PKCdelta mRNA were 89.87.3 fold greater than the concentration of PKCtheta in CT1 cells. The ability of FGF2 to mediate PKC delta activity was examined by determining if FGF2 affected the phosphorylation status of PKC delta (Fig. 3 6B). FGF2 supplementation increased phosphorylation of Y311within 30 min and sustained this effect for at least 2 h in CT1 cells. This phosphorylation event is important for PKC delta activation in several cell systems [265] Also, PMA mimic ked the effects of FGF2 and increased Y311 phosphorylation status in CT1 cells (Fig. 3 6B). Impact of PKC delta Knockdown on Vivot Cell R esponsiveness to FGF2 RNA i was used to establish the involvement of PKCdelta in mediating FGF2 effects on IFNT production ( Fig. 3 7 ). Sufficient amounts of siRNA could not be transfected into CT1 cells to impact overall PKCdelta mRNA abundance (data not shown) However, V ivot cells could be transfected well enough to reduce PKCdelta concentrations by approximately 70% when using a cocktail of three PKCdelta siRNAs (Fig 3 7A ). PKCdelta protein abundance also was decreased in Vivot cells exposed to

PAGE 69

69 the PKCdelta siRNA cocktail ( Fig. 3 7B). The PKCdelta siRNA cocktail did not affect constitutive concentrations of IFNT However, cells containing the PKCdelta siRNA were less able to respond to FGF2 than those containing the control siRNA (Fig. 3 7). FGF2 supplementation increased (P<0.05) IFNT abundance in cells containing the control siRNA but not in cells containing the PKCdelta siRNA. The IFNT response in these cells was not statistically different from the FGF2and nonFGF2treated controls. PKCdelta Regulates IFNT E xpression through ERK1/2independent P athways PKCdelta regulates the activity of various downstream signaling molecules, including ERK1/2 [266, 267] Previous findings indicated that FGF2 supplementation did not increase ERK1/2 phosphorylation status in CT1 cells (Fig. 3 1), and a set of followup studies were completed to determine whether ERK1/2 was required for PKC deltamediated effects on IFNT abundance (Fig. 3 8). The first study was designed to examine whether rottlerin treatment altered ERK1/2 phosphorylation status in CT1 cells (Fig. 3 8A). No change in the phosphorylation status of ERK1/2 was evident after 2 h exposure to rottlerin. A subsequent study was completed to determine if ITS serum substitute used in the serum free medium formulation affected ERK1/2 phosphorylation status i n CT1 cells. Cells cultured in serum free medium without ITS for 24 h still exhibited pronounced basal phosphor ERK1/2 and remained unresponsive to FGF2 challenge (Fig. 3 8B; left panel). A subset of CT1 cells also were treated with 100 nM PD173074, a pharmacological inhibitor of FGFRs, before exposure to FGF2 (Fig. 3 8B; right panel). No changes in phosphorylation status were detected before or after FGF2 challenge in cells exposed to this inhibitor.

PAGE 70

70 Since slight modifications in ERK1/2 phosphorylati on status may go unnoticed in Western blot analyses, the ERK1/2 inhibitor, PD98059 (25 nM), also was used to examine whether ERK1/2 is required for FGF2 effects on CT1 cells (Fig. 3 8C). Unlike the MEK inhibitor, U0126, which targets both active and inact ive MEK1/2, PD98059 functions primarily to prevent phosphorylation of inactive MEK1/2 [268] Exposure to this inhibitor did not affect basal levels of ERK1/2 phosphorylation (Fig. 3 8C). Exposing CT1 cells to this inhibitor before supplementing FGF2 did not affect constitutive or FGF2induced IFNT concentrations (Fig. 3 8D ) indicating that ERK1/2 likely was not required for exerting FGF2 effects on IFNT abundance. Discussion Work presented here provides evidence that PKCs, and specifically PKC delta, mediate FGF2induced production of IFNT Measurement of IFNT mRNA abundance was used to describe these changes. The relative abundance of IFNT mRNA is directly associated with IFNT protein concentrations in trophoblast cell lysates and conditioned medium, this is consistent with previous reports [28, 30, 269, 270] No di rect evidence that FGF2 affected IFNT transcription was provided in this study. IFNT promoter/enhancer reporter constructs were not used because the bovine trophoblast cell lines used here were difficult to transfect with calcium phosphate precipitation and commercially available lipid and aminebased transient transfection reagents (Yang and Ealy; Unpublished observations). Unpublished work from this laboratory determined that maximal increases in IFNT abundance were evident after 6 to 8 h exposure to FGFs, suggesting that FGF2 and other FGFs manipulate IFNT transcription rates. However, it remains possible that FGF2 may also control IFNT concentrations by mediating RNA stability. Additional work is required to describe the precise

PAGE 71

71 transcriptional and post transcriptional steps influenced by FGF2 in bovine trophoblast cells. Various PKCs are linked to preimplantation embryo developmen t. From seven to ten PKC isotypes are expressed in mouse embryos [43, 202, 271, 272] Various PKC isoforms also are expressed in human placentae [273] In this work, PKC dependent regulation of IFN T abundance initially was established by inhibiting PKC activity with calphostin C and stimulating PKC activity with PMA. Basal concentrations of IFNT were unaffected by calphostin C supplementation, indicating that low endogenous PKC activity exists in t hese cells, but this inhibitor prevented FGF2 from increas ing IFNT levels in bovine cells. PMA supplementation stimulated IFNT mRNA and protein production in CT1 cells. Others have linked PKC activity with IFNT production in ovine trophectoderm. Adding PMA increased IFNT concentrations and calphostin C treatment abolished CSF2mediated increases in IFNT concentrations in ovine conceptus explants [254] In addition, reporter plasmids containing 5' UTR regions of the IFNT promoter/enhancer were stimulated in JEG3 human choriocarcinoma cells treated with PMA [255, 274] Additional PKC inhibitors were used to identify the specific PKC isoform employed by FGF2 to control IFNT expression in bovine trophoblast cells. Atypical PKCs were not examined since these kinases are not responsive to PMA and other phorbol esters [201] E xposing CT1, Vivot and bovine troph oblast outgrowths to the PKC delta inhibitor, rottlerin blunted FGF2induced increases in IFNT levels. Rottlerin also blocked FGF2 and PMA from increasing IFNT protein concentrations in conditioned medium. Rottlerin effectively inhibits PKCdelta in other cell types at concentrations used in this

PAGE 72

72 work (effective range: 3[263] Preliminary studies found that rottlerin was treatment provided full inhibition of this response. Rottlerin also inhibits other kinases. Notably, it blocks the activity of PKC theta, another novel PKC, when used at 1020 M [264, 275] PKCtheta expression is less widespread throughout tissues and primarily is studied in regards to platelet activation and T cell function [201] It is present in CT1 cells, but its level of expression is substantially less than PKCdelta. Exposing CT1 cells to G, an inhibitor of classical PKC molecules ( ability of FGF2 to stimulate IFNT levels in CT1 cells. A single concentration of this inhibitor was examined herein (5 M), and although this concentration of inhibitor blocked classic PKC activity in other cells [261] no attempts were made in the present work to verify its effectiveness in CT1 cells. Therefore, the role of classic PKCs on IFNT gene expression regulation cannot be discounted based on the present findings. The involvement of PKC delta in FGF2mediated effects on trophoblast cells was confirmed by RNA i Diff iculties in obtaining highefficiency transfection precluded using CT1 cells for siRNA studies. However, a contemporary trophoblast cell line derived from an in vivo generated blastocyst (V ivot line) could be transfected with moderate efficiency and reductions in PKC delta mRNA and protein concentrations were associated with diminished FGF2 effects on IFNT concentrations. The siRNA treatment did not generate a complete loss in FGF2induced effects in Vivot cells. This likely reflects limitations in the knockdown efficiency of PKCdelta mRNA and PKC delta protein. Both were still evident after transfection. It remains possible that additional PKCs, such as PKCtheta, may also be involved with mediating FGF2 actions, but

PAGE 73

73 observing a partial reduction in FGF2mediated events after PKC DELTA siRNA treatment provides conclusive evidence that PKC delta is one of the signaling molecules involved with this process. PKCdelta is a widely expressed, multifunctional kinase that is best known as a regulator of apoptosis [276, 277] However, it also can promote cell survival in some instances [276, 277] Moreover, it also contains apposing activities in regards to cell proliferation and tumorigenesis [276, 278] There are several reports describing how PKCdelta regulates peri implantation embryo development and trophoblast f unction. PKCdelta is detected throughout early embryo development in mice [271] It associates with the spindle apparatus during meiosis and localizes to the nucleus during initial cleavage events where it regulates mRNA processing [62, 279] At the blastocyst stage, PKC delta localizes prim arily to the plasma membrane in trophoblast cells and is a central regulator of tight junction formation and ion transport during blastocoel formation [202, 203] The PMA responses observed in this work are consistent with previous descriptions of PMA effects on ovine IFNT transcription [254, 255, 274, 280] Both PMA and FGF2 likely a ffect IFNT abundance in bovine trophoblast cells by acting through PKCdelta No additive or synergistic effects were noted upon FGF2 and PMA co treatment, and rottlerin effectively blocked the ability of both FGF2 and PMA to stimulate IFNT levels in various bovine trophoblast cell lines. However, PKCdelta probably is not the only signaling molecule impacted by PMA in trophoblast cells. P horbol esters are best known for their ability to stimulat e DAG mediated events, but many of these agents, including PMA, interact with nonPKC targets [201] This is especially germane

PAGE 74

74 when considering previous work using JEG3 cells to study IFNT promoter/enhancer activity. JEG3 cells lack PKC delta [281] (unpublished observations by authors), yet PMA treatment stimulated promoter/enhancer activity in this and other human cell lines [255, 274, 280] Therefore, it appears that PMA acts on PKC delta to impact IFNT transcription and/or RNA stability in homologous cell systems but acts on different signaling molecules in heterogonous system s to regulate IFNT expression. PKCdelta can impact a variety of downstream signaling molecules. There are several examples of FGFinduced PKC delta activation events that subsequently impact ERK1/2 activity [266, 267] Activation of ERK1/2 did not appear to be required for FGF2 to increase IFNT abundance in this work. Rottlerin did not influence ERK1/2 phosphorylation status. Also, preventing ERK1/2 phosphorylation with PD98059, an inhibitor that limits phosphorylation of ERK1/2 without affecting the activity of previously phosphorylated ERK1/2, did not affect the ability of FGF2 to increase IFNT levels. However, abolishing all of the active ERK1/2 in CT1 cells with U0126 (including constitutively active molec ules) dramatically decreased IFNT abundance, and FGF2 supplementation was not effective at increasing IFNT abundance in the absence of activated ERK1/2. This suggests that ERK1/2 is requisite for basal IFNT transcription. It must be noted, however, that FGF2 studies were completed over a 2224 h time period whereas effects of the inhibitors on ERK1/2 activity were only examined for the first 2 h of this period. Therefore, the possibility that FGF2 affected ERK1/2 activity after 2 h from the beginning of FGF2 treatment cannot be discounted. It also remains unknown how long the inhibitors blocked ERK1/2 activity in these studies. Therefore, ERK1/2 does not appear to be directly involved with transducing the FGF2 signal, but these

PAGE 75

75 molecules do appear to be essential for basal responses in CT1 cells. The direct control of IFNT transcription by Ras dependent pathways has been reported by others [197] In that work MAPK dependent systems impacted ETS2 activity. It also is possible that Ras MAPK affects other transcriptional regulators of IFNT In mice, MAPK controls CDX2 expression in preimplantation embryos [116] Thi s trophectoderm specification factor is a central component of IFNT promoter/enhancer activity [190] It was interesting to note that CT1 cells and Vivot cells (data not shown) contained ample amounts of phosphorylated ERK1/2 prior to FGF2 administration. Constitutive phosphorylation of ERK1/2 als o exists in mouse trophoblast cells, and ERK1/2 activity is essential for trophoblast development and differentiation in this species [116, 282, 283] Endogenous ERK1/2 activity could not be reduced by removing the serum substitute from cultures (insulin/transferrin, selenium). Also, blocking endogenous FGFs with a pharmacological inhibitor to FGFRs did not influence constitutive phosphorylation of E RK1/2. An association between p38 MAPK and IFNT abundance has not been described until now. FGF2 induced a rapid and transient phosphorylation of p38 MAPK. Blocking this induction did not impact the ability of FGF2 to increase IFNT levels. However, IF NT concentrations were decreased in nonFGF2 treated cells. It remains uncertain whether this outcome resulted from the specific interference with a p38 MAPKdependent signaling module targeting IFNT transcription or whether an i ndirect or nonspecific mec hanism caused this response. The importance of p38 MAPK during early placental development is established in mice where loss of p38 MAPK function is an embryonic lethal phenotype characterized with s pongiotrophoblast defects [284] Also, p38 MAPK

PAGE 76

76 is recruited by FGF4 for maintenance of trophoblast stem cells in mice [285] Thus, it is reasonable to suspect that p38 MAPK i s important for trophoblast gene expression in bovids, but the specific targets of this kinase remain unknown. To conclude, based on the present work, it is reasonable to propose that PKC delta acts as a signaling module for uterineand conceptus derived FGFs and potentially other molecules in peri attachment bovine conceptuses. Several uterinederived factors, including multiple FGFs can increase IFNT production in ovine and bovine trophoblast cells Moreover, several FGFs are produced by conceptuses throughout preand peri attachment development coincident with maximal IFNT production [30] This work provides new insight into how uterinea nd conceptus derived factors impact conceptus development and gene expression during preand peri attachment development. Further exploration is needed to understand the full extent of PKC delta activities during peri attachment development in bovine conceptuses.

PAGE 77

77 Table 3 1. Primers and siRNA oligo sequences Primer/ siRNA oligo Sequence (5' 3') PRKCD forward* PRKCD reserve* PRKCQ forward* PRKCQ reverse* PRKCD siRNA#1 sense PRKCD siRNA#1 antisense PRKCD siRNA#2 sense PRKCD siRNA#2 antisense PRKCD siRNA#3 sense PRKCD siRNA#3 antisense AACTGGGACCTACGGCAAG TGCAGAAGAGGTGGGTGAGA TCCAGTTGAAATTGGTCTCC GCACTCCACGTCATCGTCCA GGUUCAAGGUUUAUAACUA UAGUUAUAAACCUUGAACGG AGAAAUGCAUCGACAAGAU AUCUUGUUGAUGCAUUUCU GCUGCCAUCCACAAGAAAU AUUUCUUGUGGAUGGCAGC *Primer sets were used for qRTPCR and endpoint RTPCR. PRKCD GeneID: 505708. PRKCQ GeneID: 505901 Other primer sets used are referenced elsewhere [30]

PAGE 78

78 Figure 3 1. The dependence of constitutive and FGF2induced IFNT expression by ERK1/2 and p38 MAPK. Panel A: Western blot analysis was completed to determine whether FGF2 affected ERK1/2 phos phorylation status and to assess how U0126 (10 M) affected ERK1/2 phosphorylation status. Cells were exposed to inhibitors or DMSO (control) for 2 h, then were harvested either immediately before FGF2 supplementation (time 0) or at specific times after F GF2 treatment. Estimates of phosphorylated (p) ERK1/2 and total ERK1/2 concentrations were determined using Western blotting. Three replicate studies were completed and representative blots are provided. Panel B: The effect of MEK inhibition on basal a nd FGF2induced IFNT abundance was examined by exposing CT1 cells to each inhibitor for 2 h, changing medium and incubating in the presence or absence of FGF2 for 24 h. tcRNA was isolated and qRTPCR was used to determine the relative abundance of IFNT 18S RNA was used as the internal control. Panel C: Western blot analysis was completed on CT1 cell lysates exposed to FGF2 in the presence or absence of the p38 MAPK inhibitor, SB203580 (25M) using the same experimental approaches as described previously Panel D: The effect of p38 MAPK inhibition on basal and FGF2induced IFNT abundance was examined as described previously. In both sets of studies, qRTPCR data are represented as mean folddifferences SEM from the control value (n=3 replicate studies). Differences (P<0.05) are denoted within each panel with different superscripts.

PAGE 79

79 Figure 3 2 PKCdependent systems regulate IFNT mRNA levels in CT1 cells. Panel A : The role of PKC in regulating FGF2dependent increases in IFNT mRNA carrier (DMSO) for 2 h. Cells were then incubated with or without FGF2 for 24 h. Panel B : A separate experiment was completed to determine if exposure to PMA mimicked the eff ect of FGF2 in CT1 cells. Cells were incubated in the presence or absence of FGF2 and/or PMA for 24 h. In both experiments, tcRNA was isolated at the end of the incubation period and qRT PCR was used to determine the relative abundance of IFNT mRNA. 18S RNA was used as the internal control. Data are represented as mean folddifferences SEM from the control value (n=4 replicate studies within each panel). Differences (P<0.05) are denoted within each panel with different superscripts.

PAGE 80

80 Figure 3 3 Examination of how isoform specific PKC inhibitors affect FGF2induced IFNT expression in CT1 cells A series of experiments were completed in CT1 cells to determine whether an inhibitor of classical PKCs (G; 5 or PKCdelta (rottlerin and PMA dependent increases in IFNT levels. Cells were provided inhibitors for 2 h, and then medium was replaced with medium containing or lacking FGF2 or PMA. Panel A : treatments included G and FGF2; Panel B : treatments includ ed G and PMA; Panel C : treatments include rottlerin and FGF2; Panel D: treatments include rottlerin and PMA. After 24 h exposure to FGF2 or PMA, tcRNA was isolated and qRTPCR was used to determine the relative abundance of IFNT 18S RNA was used as the internal control. Data are represented as mean folddifferences SEM from the control value (n=3 replicate studies within each panel). Differences (P<0.05) are denoted within each panel with different superscripts

PAGE 81

81 Figure 3 4. Rottlerin prevents FGF2 or PMA from increasing IFNT protein concentrations in conditioned CT1 medium CT1 cells were serum starved for 24 h then were treated medium was removed and replaced with medium containing 0 or 50ng/ml FGF2 ( Panel A ) or with 0 or 10 nM PMA ( Panel B). After 48 h, conditioned medium was harvested and antiviral assays were used to determine IFNT secretion. Antiviral results (IU/ml conditioned medium) were normalized based on viable cell number (measuring the amount of tetrazolium oxidation; A490 readings). Data are represented as mean IU/ml/A490 SEM (n=5 replicate studies within each panel). Differences (P<0.01) are denoted within each panel with different superscripts.

PAGE 82

82 Figure 3 5. Rottlerin prevents FGF2 from increasing IFNT mRNA levels in two additional bovine trophoblast cell systems. Vivot cells ( Panel A) and primary trophoblast outgrowths ( Panel B ) wer e exposed to rottlerin or its carrier control for 2 h, then cult ured were exposed to FGF2 or BSA control. After 24 h, tcRNA was isolated and qRTPCR was used to determine the relative abundance of IFNT mRNA. 18S RNA was used as the internal control. Data are represented as mean folddifferences SEM from the control value (n=3 replicate studies within each panel). Differences (P<0.01) are denoted within each panel with different superscripts.

PAGE 83

83 Figure 3 6. The expression and activation of PKC delta in bovine trophoblast cells. Panel A: End point RTPCR was used to establish that PKCdelta ( PRKCD) and PKCtheta ( PRKCQ ) mRNA was evident in CT1 cells and e longating bovine conceptuses. t cRNA was collected from CT1 cells, d 14 and 17 conceptus, and bovine CLs (positive control). PCR produc ts were electrophoresed on an agarose gel and visualized with ethidium bromide staining. No amplified products were detected in nonreverse transcribed tcRNA samples (data not shown). Panel B: The ability of FGF2 and PMA to affect PKC delta phosphorylati on status at Y311 was examined by Western blot analysis. CT1 cell lysates were collected either immediately before (time 0) or at specific periods after treatment with 50 ng/ml FGF2 or 100 nM PMA. Lysates were electrophoresed, blotted onto PVDF membrane and immunoblotted with antibodies recognizing phosphorylated Y311 within PKC delta. Three replicate studies were completed and a representative blot is provided. A single immunoreactive band of the correct molecular mass was observed in all blots. Blots were stripped and reused to detect the relative amounts of tubulin to ensure appropriate sample loading.

PAGE 84

84 Figure 3 7 siRNA knockdown of PKCdelta mRNA and protein in trophoblast cells impacts the ability of FGF2 to increase IFNT mRNA levels. Panel A: The relative abundance of PKCdelta mRNA ( PRKCD) was determined. At 60 h post transfection, cells were cultured in the presence or absence of FGF2 for 24 h. tcRNA was isolated and used for qRTPCR. Panel B: Relative amounts of PKCdelta were determined by Western blot analysis. Panel C: The relative abundance of IFNT mRNA was determined after FGF2 challenge. At 60 h post transfection, cells were cultured in the presence or absence of FGF2 for 24 h. tcRNA was isolated and used for qRTP CR. 18S RNA was used as the internal control. Data are represented as mean folddifferences SEM from the control value (n=4 replicate studies). In Panels A & C, differences (P<0.05) are denoted within each panel with different superscripts.

PAGE 85

85 Figure 3 8 ERK1/2 dependent systems are not required for FGF2dependent increases in IFNT mRNA abundance. Panel A : Western blot analysis of ERK1/2 phosphorylation status affected by rottlerin Panel B : Western blot analysis of ERK1/2 phos phorylation status in serum free medium without ITS in the presence or absence of FGFR inhibitor PD173074 (100nM). Panel C : Western blot analysis ERK1/2 phosphorylation in the presence of PD98059 (25M) Panel D: The effect of MEK inhibition on basal and FGF2induced IFNT mRNA abundance was examined by qRTPCR. Data are represented as mean folddifferences SEM from the control value (n=3 replicate studies). Differences (P<0.05) are denoted within each panel with different superscripts. For western blot analysis, t hree replicate studies were completed and a representative blot is provided.

PAGE 86

86 CHAPTER 4 PRIMITIVE ENDODERM DEVELOPMENT IS STIMULATED B Y FIBROBLAST GROWTH FACTOR 2 IN BOVINE BLASTOCYST S Early conceptus development in ruminants is notably different from rodents, primates and many other species because of the prolonged preand peri implantation development occurring in these species. Bovine and ovine blastocysts hatch from the zona pelluc ida between days 8 and 10 post fertilization and remain free floating for another week or more [59, 286] These conceptuses begin elongating during the second and third weeks of pr egnancy due to the reorganization and proliferation of trophectoderm and occupy nearly the entire length of one uterine horn before attaching to the uterine lining on or after day 17 and 19 in sheep and cattle, respectively [67, 287] This rapid trophectoderm development maximizes early placental s urface area interactions with the uterus and ensures the production of sufficient amounts of interferontau (IFNT), the maternal recognition of pregnancy factor in these species [18, 288] Formation of the three primary germ layers and gastrulation also occurs as bovine and ovine conceptuses fl oat freely in the uterine lumen. P rimitive endoderm is evident between day 8 and 10 post fertilization, primitive ectoderm emerges aro u nd day 12 and primitive mesoderm forms on day 14 to 16 [14, 63, 289] It is not surprising, therefore that miscues in germ cell generation, hypoblast/epiblast formation and gastrulation are linked with early pregnancy failures in cattle [59, 290] Early pregnancy failures are common in domesticated ruminants, and especially in lactating dairy cattle, where from 25 to 50% of pregnancies are lost within the first 6 weeks of gestation [5] After blastocyst formation and specification of trophectoderm has occurred, the inner cell mass (ICM) develops into distinct primitive endoderm and epiblast lineages. The epiblast is a pluripotent lineage that forms additional extraembryonic and embryonic

PAGE 87

87 tissues. The primitive endoderm is an extraembryonic lineage that forms the hypoblast and the inner layer of the yolk sac [291, 292] Little is known about primitive endoderm formation in ruminants. Bovine primitive endoderm cultures can be established from bovine blastocysts after their attachment to feeder cells [150, 293] but no information exists to explain how their formation and growth is controlled. The lineage specification of primitive endoderm has been examined to a greater extent in mice. In this species, determination of primitive endoderm and epiblast fates is not solely defined by their lo cation within the inner cell mass, but rather also is controlled by differential expression of specific transcription factors. Cells that become epiblast express high levels of NANOG whereas cells that segregate to primitive endoderm express high levels of GATA4 and GATA6 [141, 294, 295] GATA4 and GATA6 are essential for normal primitive endoderm development. Targeted disruption of GATA4 or GATA6 expression blocks primitive endoderm formation in ES cells [296, 297] Also, ectopic expression of GATA4 or GATA6 induces ES cell differentiat ion to the primitive endoderm lineage [136, 137] Roles of GATA4 and GATA6 are not clear in the bovine conceptus, but immunoreact ive GATA6 localizes to specific cells within the ICM of bovine and porcine blastocysts, suggesting this factor may also be involved with controlling primitive endoderm/epiblast fate determination in these species [153] There is good evidence that fibroblast growth factor (FGF) signaling and MAPK activation play key roles in initiating primitive endoderm formation in mouse embryos. Embryos that lack ICM derived FGF4, its cognate receptor FGFR2, or the receptor adapter protein Grb2 do not form primitive endoderm [298301] Overexpression of a dominant negative FGFR in ES cells also prevents primitive endoderm formation in ES

PAGE 88

88 cells [302] FGF signaling through Grb2 induces primitive endoderm format ion via GATA factor activation. Grb2 mutant embryos do not produce GATA6 and all ICM cells become NANOG positive EPI [294] Also, inhibition of FGFR or MAPKactivation using specif ic pharmacological inhibitors prevents GATA6 expression and primitive endoderm formation in mouse blastocysts whereas supplementation with FGF4 increases the number of GATA6 positive primitive endoderm cells in the ICM [303] Although similar work has not been completed in cattle and other ruminants to establish a linkage between FGF/MAPK signals and primitive endoderm development, several FGFs are produced in bovine embryos during early pregnancy. Transcripts for FGF4 are detected in bovine blastocysts, and levels of this transcript are reduced in cloned bovine embryos [12, 229] which suffer from extensive post transfer pregnancy failure [11] Another FGF, FGF2 or basic FGF, also is expressed in bovine blastocysts [28, 30, 229] FGF2 also is produced by endometrial epithelium and detectable quantiti es of this FGF can be detected in the uterine lumen throughout the preand peri implantation period in ewes and cattle [28, 29] FGF2 and FGF4 utilize many of the same FGFR isotypes (e.g. FGFR1IIIc, R2IIIc, R3IIIc), and the commercial availability of bovine recombinant FGF2 permits the exploration of how this and other FGFs may control early fate determination in bovine embryos. Work outlined in this study d escribes how supplementation with FGF2 promotes primitive endoderm lineage emergence and examines how this activity may be controlled in bovine preimplantation embryos.

PAGE 89

89 Materials and Methods Materials All cell culture reagents, including Dulbeccos modifi ed essential medium containing high glucose (DMEM) and Fetal Bovine Serum (FBS), PCR primers and EdU Cell Proliferation Assay were purchased from Invitrogen Corp. (Carlsbad, CA). Synthetic Oviduct Fluid (SOF) medium was purchased as a custom formulation f rom the Specialty Media Division of Millipore Corp. (Billerica, MA). Bovine recombinant FGF2 and MatrigelTM Basement Membrane Matrix was purchased from BD Biosciences (San Jose, California). The PicoP ur e TM RNA isolation kit was purchased from MDS Analytical Technologies ( Sunnyvale, CA ). RNase free DNase was purchased from New England Biolabs (Ipswich, MA). The High Capacity cDNA Reverse Transcription kit and SybrGreen Detector System were purchased from Applied Biosystems Inc. (Foster City, CA). 4 6 diamidino2 phenylindo (DAPI) was from Invitrogen Mouse monoclonal Anti CDX2 antibody was purchased from BioGenex (San Ramon, CA, USA). Rabbit polyclonal Anti GATA4 antibody was from Santa Cruz Biotechnology (Santa Cruz, CA, USA).FITC labeled AntiM ouse IgG was from Abcam ( Cambridge, MA, USA), Alexa Fluor 555 labeled anti r abbit IgG and HRP labeled anti r abbit IgG were from Cell Signaling Technology (Beverly, MA, USA). Goat a nti transferrin antiserum was purchased by SigmaAldrich Inc. (St. Louis, MO). The c hemical inhibitor for FGFR (PD173074 ) was purchased from EMD Chemicals (Gibbstown, NJ). The proteinase and phosphatase inhibitors cocktails, BCA Protein Assay and BioMax film were purchased from Thermo Fisher Scientific (Pittsburgh, PA). Polyvinyli dene Difluoride (PVDF) (Immobilon P) membrane was purchased from Millipore Co. (Bedford, MA ). The

PAGE 90

90 enhanced chemiluminescence (ECL) Western blot detection system was purchased from Amersham (GE Healthcare, USA). In Vitro Production of Bovine Embryos In vitro produced (IVP) bovine blastocysts were generated using maturation, fertilization and culture procedures described pr eviously [22, 209] using bovine ovaries collected from a local slaughterhouse (Center Hill FL) and transferred in 0.9% (w/v) NaCl at room temperature. Matured oocytes were fertilized with 1 x 106 Percoll purified spermatozoa from frozen thawed semen collected from three bulls. Different bulls were used throughout the studies. After fertiliz ation, putative zygotes were denuded by vortexing and placed in groups of 20 to 30 in 50 SOF at 38.5C in a humidified atmosphere containing 5% oxygen (5% [v/v] O2, 5% [v/v] CO2, 90% [v/v] N2). On specific days post fertilization embryos were c ollected based on morphology (morula; regular, expanded, hatched blastocyst). For one study, nonexpanded (Day 7) or expanded (Day 8) blastocysts (n=10/50 l drop) were exposed to 50 ng/ml FGF2 or 1 containing 5% FBS and other supplements (100 M nonessential amino mercaptoethanol and 250 U/ml antibiotic antimycotic) at 38.5 C in a 5% oxygen environment as described previously [31] After 24 h, RNA was isolated using the PicoPure isolation kit. Blastocyst Outgrowth Culture On day 8 post fertilization, nonexpanded and expanded blastocyst s w ere placed individually into Matrigel coated 48wells plate (0.75 5%FBS and other supplements described earlier at 38.5C in a 5% oxygen environment. Medium was changed on days 13 and 15 post fertilization (day 5 and 7

PAGE 91

91 after beginning individual culture) without disrupting blastocysts that had attached to the matrix. For embryos that had not attached by days 13 or 15, approximately half of the medium was exchanged on each day. In one study different concentrations of FGF2 (0.5, 5, 50 ng/ml in DMEM containing 1% [w/v] BSA) or controls (carrier only) was provided at the beginning of culture on day 8 post fertilization. On day 13 and 15 post fe rtilization each blastocyst was assessed under phase contrast microscopy and for its attachment and viability status (floating/unattached; attached; outgrowth formation; degenerating). Propagation of Primary Trophoblast and Primitive Endoderm Cultures O utgrowths were generated from individual blastocysts as described in the previous section. Outgrowths formed by day 15 were cultured for an additional 5 days to obtain sufficient cells for RNA isolation. To establish pure cell lines, single putative trophoblast or primitive endoderm colony was treated with trypsin and cultured several passages. Primitive endoderm cells continued to maintain trophoblast specific morphology such as dome formation within the cell monolayer, large nuclei and numerous secretory granules, while primitive endoderm cells showed similar morphology as mouse XEN cells an extraembryonic endoderm cell line isolated from mouse blastocyst (Fig 4 1) [137, 304] RNA I solation and Quantitative RTPCR T otal cellul ar RNA (tcRNA) was isolated from individual trophoblast and primitive endoderm colonies and from groups of embryos (n=1012) by using the PicoP ur e RNA isolation kit. Q uality and concentration of tcRNA was determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific). Samples were incubated with RNasefree DNase for 30 min at 37C. After heat inactivating the DNase (75C for 10 min), RNA

PAGE 92

92 was reverse transcribed using the High Capacity cDNA Reverse Transcription kit and random hexamers. The SybrGreen Detection System was used in combination with p rimer pairs (200 nM) depicted in Table 41 and a 7300 Real Time PCR System (Applied Biosystems) to quantify the relative abundance of specific transcripts. Suitable primer efficiencies (>94%) were verified for each primer pair before their use. The same amount of tcRNA was used for each sample within each study. GAPDH mRNA level was used to normalize values. GAPDH mRNA abundance did not change based on cell type or treatment (data not shown). A dissocia tion curve analysis (6095C) was used to verify the amplification of a single product. Each sample was completed in triplicate reactions. A fou rth reaction lacking reverse transcriptase was included to control for genomic DNA contamination. The comparat ive threshold cycle (CT) method was used to quantify mRNA abundance [30] Immunof luorescence Microscopy Primary trophoblast and primitive endoderm cells were fixed with 4% [w/v] paraformaldehyde for 15 min, permeabi lized with 0.5% [v/v] Triton X 100 in 0.01 M PBS [pH 7.4] for 30 min and blocked with 10% [v/v] goat serum for 60 min. Primary antibodies used i ncluded rabbit anti GATA4 (1:200 in 10% [v/v] goat serum) and mouse anti CDX2 (ready to use in PBS). Secondary antibodies (1:500 in PBS) were conjugated to FITC (goat anti rabbit) or Al ex aFluor 555 ( goat anti mouse). Nuclei were labeled with 4 6 diamidin o 2 phenylindole (DAPI). Immunoreactive complexes were visualized with a n Eclipse TE2000U inverted microscope (Nikon, Lewisville, TX) equipped with an X Cite 120 epifluorescence illumination system (EXFO; Mississauga. Ontario, Canada). Images were captured with a Nikon DXM 1200F digital camera and assembled with NISElements Software (Nikon).

PAGE 93

93 Bovine blastocysts were fixed and stained with CDX2 and GATA4 antibodies as described above. Immunoreactive signals were visualized with an Olympus IX81DSU Spin ning Disk Confocal Mi croscope (Center Valley, PA, USA ) Images were captured with a Hamamatsu C47428012AG Monochrome CCD Camera (Hamamatsu Corporation, Bridgewater, NJ) and assembled with SlideBook software (Intelligent Imaging Innovations, Denver, CO, USA). Western Blot Analyses The primitive endoderm and trophoblast outgrowths (n=3 for each) were seeded onto Matrigel coated plates (25 mm diameter). A fter 3 days cell ular protein was extracted and SDS PAGE and Western blotting was completed as described previously (Chapter 3). In brief, cells were dissolved using NP 40 buffer (20 mM Tris HCl pH8, 137 mM NaCl, 20 mM EDTA, 1% [v/v] NP40) supplemented with protease and phosphatase inhibitor cocktails. C ell lysates were sonicated and protein concentrations of supernatants were determined using a BCA Protein Assay. Protein ( 20 g) was loaded and separated on 10% [w/v] SDSPAGE gels and electrotransferred onto 0.45m PVDF. Membranes were blocked with 5% [ w/v] nonfat dry milk in TBST (50 mM Tris HCl pH 7.4, 150 mM NaCl, 0.1% [v/v] Tween20) and incubated with anti transferrin antiserum described previously [256] Horseradish peroxidaseconjugated anti rabbit IgG was used in combination with ECL to vi sualize reactive bands after exposure to BioMax film. After detection membranes were stripped and tubulin was detected (1:3000 dilution in 3% nonfat dry milk) t o serve as a loading control Three independent western blots generated from independent primitive endoderm or TE cultures were completed.

PAGE 94

94 Proliferation Assay The m itogenic index of trophoblast and primitive endoderm colonies was determined using the Click iTTM Ed U (5 ethynyl 2 deoxyuridine) Cell Proliferation Assay. Cells were seeded on Matrigel coated plates (25 mm diameter). At 40 50% confluence, cells were serum starved for 12 h and then FGF2 was added (0, 5 or 50 ng/ml). After 11 h, EdU reagent was added ( ) and cells were incubated for 60 min before fixation in 4% paraformaldehyde in PBS for 15 min. Ed U positive cells were determined by reaction with Alexa Fluor 488 azide. All nuclei were visualized after staining with Hoe ch st 33342 ( 1 0 Total and EdU positive nuclei were counted in 5 representative fields ( about 100cells/field) in each well using NISElements Softwar e (Nikon) after capture on an Eclipse TE2000 U inverted microscope equipped with an X Cite 120 epifluorescence illumination system and Nikon DXM 1200F digital camera (described previously). Statistical Analyses All analyses were performed by least squares ANOVA using the General Linear M odel Procedure of the Statistical Analysis System (SAS Institute Inc., Cary, NC). Differences between individual means were compared using pairwise comparisons ( PDIFF [ probability of difference] analysis in SAS) For qRTPCR, CT values were used for the statistical analyses and results were presented as fold differences from the control expression value [28, 30] Differences between individual means were contrasted with pair wise analysis (PDIFF [probability of difference] analysis in SAS). Results are presented as arithmetic means SEM. A P value 0.05 was considered significant.

PAGE 95

95 Result s Effect of FGF2 on Blastocyst Outgrowth Formation The primary objectives of the first study were to determine the proficiency of generating outgrowths from bovine blastocysts and to determine whether FGF2 supplementation impacts their rate of formation. A majority of the outgrowths began forming between Days 13 and 15 post IVF. The overall percentage of outgrowth formation averaged 61.56 2.97% at Day 13 and incr eased (P<0.05) to 78.52 6.06% at Day 15 post IVF. The percentage of attached blastocysts that had not formed outgrowths and the percentage of unattached blastocysts were greater (P<0.05) at Day 13 than Day 15 (62.654.63% vs. 73.274.7% for unattached bl astocysts; 71.985.18% vs. 80.914.66% for attached blastocysts), suggesting that blastocysts still were actively attaching and forming new outgrowths beyond Day 13. No new outgrowths formed after Day 15. Lastly, the incidence of observing degenerated em bryos was similar at Days 13 and 15 (average 6.582.28% over both days). The effects of FGF2 supplementation on outgrowth formation at day 13 and 15 post IVF is provided in Table 4 2 Treatment with 0.5, 5 or 50 ng/ml FGF2 did not affect the percentage of blastocysts that formed outgrowths on days 13 and 15 when compared with nontreated controls. FGF2 treatment also did not affect have a substantial effect on the percentage of attached blastocysts that had not formed outgrowths. Effect of FGF2 on Trophoblast and Primitive Endoderm Outgrowth Formation Examination of outgrowths revealed striking difference in response to FGF2 supplementation ( Table 43 ). In the absence of FGF2 nearly all of the outgrowths (78/79) contained trophoblast cells based on a morphological assessment (small,

PAGE 96

96 cobblestonelike cells containing prominent nuclei and small cytoplasmic areas) ( Fig. 41A). The remaining outgrowth contained a preponderance of cells that wer e larger than trophoblast cells, polyhedral in shape and were less densely arranged that trophoblast outgrowth (Fig. 41B). The morphology of these cells suggested they were primitive endoderm [256, 293] Enumeration of the trophoblast outgrowth and primitive endoderm colonies in response to FGF2 is summarized in Table 42 and 43. FGF2 altered the incidence of trophoblast and primitive endoder m outgrowth formation (Fig. 43). Treatment with 0.5 ng/ml FGF2 on day 8 post IVF caused a numerical but statistically nonsignificant increase ( P= 0.1196) in the percentage of outgrowths c ontaining primitive endoderm at day 13. A greater (P<0.05) proport ion of primitive endoderm outgrowths were observed at day 15 in blastocysts treated with 0.5 ng/ml FGF2. Treatment with 5 or 50 ng/ml FGF2 produced more profound effects on the percentage of primitive endoderm outgrowths, and both FGF2 treatments increas e d (P<0.05) the percentage of primitive endoderm outgrowth when compared with 0 and 0.5 ng/ml FGF2 treatments at day 13 and 15. Concurrent reductions in the percentage of outgrowths containing trophoblast cells and devoid of primitive endoderm cells were noted in FGF2treated blastocysts forming outgrowths (Table 43 ). Reductions (P<0.05) in the percentage of trophoblast only outgrowths were evident at day 13 in cultures treated with 5 or 50 ng/ml FGF2 and at day 15 in cultures containing 0.5, 5 or 50 ng/ml FGF2. No examples of outgrowths containing substantial amounts of both primitive endoderm and trophoblast cells were detected at day 15 and thereafter (see following work). The primitive endoderm containing outgrowths rapidly overran cultures that initi ally contained both cell types,

PAGE 97

97 and by day 15 few to no trophoblast cells were evident in primitive endoderm outgrowths (data not shown). A followup study was completed to verify that the nontrophoblast cells identified in this work were primitive endoderm cells. Several primitive endoderm and trophoblast outgrowths were combined (n=510 outgrowths/group; 3 separate groups) and processed for western blot assessment of transferrin production, a primitive endoderm specific product [256, 293] Immunoreactive transferrin was detected in each of the 3 groups of primitive endoderm outgrowths and w as absent in each of the protein lysates from trophoblast outgrowths (Fig. 41C). Profiling of Lineage Marker in Primitive Endoderm and Trophoblast Outgrowths and IVP E mbryos Several transcriptional regulators that serve as lineage markers for primitive endoderm, trophectoderm and pluripotency in rodents and the human were examined to further verify primitive endoderm and trophoblast phenotypes and examine the similarities and distinctions in lineage marker expression in the bovid. In the first study, t cRNA was extracted and qRTPCR was completed to examine the relative abundance of lineage markers in a subset of primitive endoderm and trophoblast outgrowths (n=6) cultured until Day 20 post IVF (Fig. 42). The putative primitive endoderm specifying genes, GATA4 GATA6 and SOX17 were examined for their lineage specification in bovine primitive endoderm and trophoblast cells. GATA4 mRNA was readily detected in all primitive endoderm outgrowths and was not detectable in trophoblast cells. GATA6 mRNA was identified in both primitive endoderm and trophoblast cells and greater (P<0.05) levels of GATA6 were detected in primitive endoderm than trophoblast cells. By contrast, SOX1 7, a

PAGE 98

98 primitive endoderm marker in mice was not detected in primitive en doderm. Rather, they were observed in trophoblast cells. Markers of pluripotency ( NANOG, OCT4 ) and trophoblast ( CDX2 IFNT ) also were examined to describe how expression of these genes differs in bovine primitive endoderm and trophoblast cells (Fig.42). None of the primitive endoderm and trophoblast outgrowths contained detectable amounts of NANOG (data not shown) whereas all primitive endoderm and trophoblast cells contained similar amounts of OCT4 Both CDX2 and IFNT were very abundant in trophobl ast cells. CDX2 was not detected in any primitive endoderm outgrowths but small amounts of IFNT could be detected in some colonies This most likely reflects a low level trophoblast cells contamination in some primitive endoderm outgrowths at day 20. A subsequent study was completed to verify that GATA4 and CDX2 protein existed in primitive endoderm and trophoblast outgrowths (Fig. 4 3). Antibodies against human GATA4 and mouse CDX2 protein were crossreacted with their bovine counterparts. GATA4 was detected solely within the nuclei of primitive endoderm cells whereas C DX2 was detected only within nuclei of trophoblast cells. The ontogeny of selective pluripotency, primitive endoderm and trophectoderm markers were determined in IVP bovine embryos (Fig. 44). The relative abundance of NANOG CDX2 and GATA4 transcripts were examined between the morula and hatched blastocyst stage in cultured embryos (day 6 to 8). Transcripts for NANOG and CDX2 were detected at the morula stage, and the relative abundance of both transcripts increased (P<0.05) at the blastocyst stage. The abundance of both transcripts did not change thereafter. The expression profile of GATA4 differed from the other transcripts.

PAGE 99

99 GATA4 was detected throughout all stages examined but the abundance of this transcript increased (P<0.05) coincident with blastocyst expansion and hatching. Changes in the localization of CDX2 and GATA4 protein also were observed in expanded and hatched bovine blastocysts (Fig. 4 5). CDX2 protei ns localized within nuclei of trophectoderm whereas GATA4 protein localized to some but not all ICM cells. DAPI was used as a counterstain to identify all nuclei in this study. Human and rodent NANOG antibody exhibited high nonspecific staining and therefore was not included. Expression of FGFRs in Primitive Endoderm and Trophoblast Cultures Differences in the relative expression of FGFR is otypes were determined as a first step in describing how FGF2 differentially regulates bovine primitive endoderm and trophoblast development. Each of the four major tyrosine kinase FGFRs ( R1 4 ) were examined (Fig. 46A). Transcripts for FGFR1 and FGFR2 were detected in primitive endoderm and trophoblast cells, and the relative abundance of FGFR1 was greater (P<0.001) in primitive endoderm than TE whereas FGFR2 was greater (P<0.001) in trophoblast than primitive endoderm cells. FGFR3 was detected in trophoblast cells but not primitive endoderm. Trace amounts of FGFR4 could be detected in both primitive endoderm and trophoblast, and no differences in abundance were detected between cell types. To better define FGFR isotype profiles in primitive endoderm and trophoblast cells, a subsequent study was completed to examine the expression profile for the predominant splice variant forms of FGFR1 and FGFR2 (IIIb and IIIc variants; referred to herein as (FGFR 1b, FGFR1c FGFR2b and FGFR2c ) (Fig. 4 6B). Transcri pts for FGFR1b and FGFR1c were greater (P<0.0 1) in primitive endoderm than trophoblast cells whereas FGFR2b was more abundant (P<0.001) in trophoblast cells than primitive

PAGE 100

100 endoderm. The FGFR2c was detected in low abundance in both cells and its relative a bundance was not difference between cell types. Possible Modes of FGF2 Action on Primitive Endoderm One way that FGF2 may promote primitive endoderm outgrowth formation is through stimulation of primitive endoderm proliferation. To determine whether FG F2 treatment differentially regulates primitive endoderm and trophoblast cell proliferation during outgrowth culture, changes in the mitotic index of trophoblast and primitive endoderm outgrowths was determined by examining the proportion of cell incorporating EdU after treatment with 5 or 50 ng/ml FGF2 (Fig. 47). Neither concentration of FGF2 affected the percentage of EdU positive trophoblast cells (Fig. 4 7A). By contrast, both concentrations of FGF2 increased (P<0.05) the percentage of EdU positive pr imitive endoderm cells when compared with the control (Fig. 4 7B). To determine how FGF signals influence PE formation and/or proliferation in bovine blastocysts, embryos were treated for 24 h with 50 ng/ml FGF2 or with a pharmacological inhibitor of FGF any endogenously produced FGFs. The concentration of inhibitor was chosen because it was effective at blocking FGF2induced effect in bovine trophoblast cultures (Ozawa & Ealy, Unpublished observations). Blastocysts were incubated in treatments prior to primitive endoderm lineage specification ( i.e. day 6 to 7 post fertilization) or as primitive endoderm lineage specification began ( i.e. day 78 post IVF). An immunofluorescencebased approach could not be used to determine numbers of GATA4 positive ICM cells in this study because it was too difficult to reliably count GATA4 posi tive and total ICM cells. Therefore, changes in GATA4 and NANOG abundance were used to predict changes in gene expression and/or cell number after treatment with FGF2 or the FGFR

PAGE 101

101 inhibitor ( Fig.48A). FGF dependent changes in GATA4 abundance were evident at both stages of embryo development ( Fig. 48A ). Specifically exposure to FGF2 did not affect GATA4 abundance embryos were treated between day 6 and 7 but increased (P<0.05) GATA4 abundance when embryos were treated between day 7 and 8 of development. Also, exposure to the FGFR inhibitor did not affect GATA4 abundance when embryos were treated between day 6 and 7 but decreased (P<0.05) GATA4 abundance when embryos were treated between day 7 and 8. Changes in the relative abundance of NANOG mRNA also were observed in this study ( Fig. 48B ). Treating embryos with FGF2 from day 6 to 7 decreased (P<0.05) NANOG abundance but had no effect on NANOG abundance in embryos treated between day 7 and 8. Treatment with the FGFR inhibitor did not affect NANOG abundance when provided between day 6 and 7 but increased (P<0.05) N ANOG abundance when provided between day 7 and 8. Discussio n Previous work has demonstrated that bovine blastocysts contain transcripts of multiple FGFs including FGF2 and FGF4 [30, 229] Several FGFs such as FGF2 and FGF4 demonstrate similar receptor binding pr eference and potentially trigger similar intracellular events [305, 306] In the present study, bovine recombinant FGF2 was used to activate FGF downstr eam signal to examine its role in cell fate decisions during bovine embryogenesis using a blastocyst outgrowth system. Trophoblast outgrowth formation is the default pathway when a single bovine blastocyst was placed in an extended culture. Several bovine trophoblast cell lines such as BT1, CT1 and Vivot were derived from in vivo or in vitro produced blastocysts and some of those lines show the ability to form binucleate trophoblast cells [150, 307, 308] Exogenous FGFs or other growth factors were not required for the self renewal of those

PAGE 102

102 trophoblast cell lines; strikingly, FGF supplementation stimulates IFNT production from several trophoblast lines and blastocyst [28, 31, 309] IFNT is exclusively produced by trophoblast cells and acts as a signal for the maternal recognition of pregnancy in ruminants [15, 16] In this study, FGF2 did not increase the ratio of proliferative trophoblast cells and did not change CDX2 expression in expande d blastocysts, indicating FGF2 did not acts as a mitogenic factor to bovine trophoblast cells. This observation is different from mouse because FGF4 supplementation induces trophoblast stem cell proliferation from single blastocyst and blocking FGF4 signal leads to trophoblast giant cell formation in vit ro [310] In human, FGF2 works with acti vin to maintain a proliferative state of ES cell in the absence of feedcell layers, however, withdraw FGF2 does not cause human ES cell t o trophoblast lineage commitment [311, 312] The mechanisms mediating this difference between species remain to be elucidated. Lineage marker expression in bovine peri implantation conceptus shows distinct pattern compare to other species. To address the question whether those primitive endoderm like colonies were truly bovine primitive endoderm lineage, firstly we used a welldefined marker transferrin [150] As expected, those nontrophoblast like cells produced transferrin along with other primitive endoderm marke rs such as GATA4 and GATA6 which were tested using at the message level. Interestingly, trophoblast cells also contained high amount of GATA6 mRNA, although this level was lower than that in primitive endoderm colonies. GATA4 mRNA was exclusively present and its protein was localized in the nuclei of primitive endoderm cells thus were selected as a marker for this lineage. As expected, CDX2 and IFNT were highly abundant in trophoblast

PAGE 103

103 outgrowths and only a trace amount of mRNA was detected in primitive endo derm colonies, probably because of trophoblast cell contamination. Previous work has provided evidences that OCT4 is not restricted in ICM of blastocyst or epiblast in bovine elongating conceptus. For example, trophoblas t cells were stained positive for O CT4 both at mRNA and protein level [62, 313] In t his study, we found that OCT 4 transcripts were remained high in both trophoblast and primitive endoderm colonies. Therefore this factor was not used as a pluripotent marker in our oncoming studies. In contrast to OCT 4 NANOG mRNA was high in blast ocyst, but was missing from both of our cell lines. FGF receptor profiling is distinct between different cell lineages. We hypothesized that trophoblast and primitive endoderm cells have distinctive FGF receptor expression signatures and thus respond differently to same FGF signal. 4 functional receptors and their 7 splicing variants have been identified for more than 20 FGF members in a variety of tissues in vertebrates [24, 305] Notably, FGFR2 was found highly expressed in trophectoderm of mouse blastocyst and its deletion leaded to embryo lethal, because of defects during gastrulation [140, 314] FGFR1 was also shown produced by mouse blastocyst and abruption of this gene caused severe growth retardation and defects in primitive steak formation [315, 316] Here we showed that FGFR2 was highly expressed in bovine trophoblast outgrowth while FGFR1 was the primary FGF receptor in primitive endoderm lineage, although their expression was not exclusive. Surprisingly, FGFR3 transcripts were only detectable in trophoblast colonies. We further examined the specific isoforms of FGFR1 and FGFR2; two receptors were present in primitive endoderm cells. Again, those two lines showed different patterns in relative mRNA

PAGE 104

104 concentration of b and c isoforms. In general, FGFR1c was the most abundant receptor in primitive endoderm cells while FGFR2b was the highest in trophoblast outgrowths. It is quite interesting because FGFR1c has been considered as a receptor mediating mitogenic response in various cellular system studies [317, 318] All together, we showed firstly that bovine trophoblast and primitive endoderm lineage contained distinguished FGFR subtypes. FGF signal is required for the derivation of primitive endoderm from bovine blastocyst but not nec essary for its continued culture in vitro Previous study has shown that bovine blastocyst could form visceral endoderm when providing with a feed cell layer and this cell line proliferated for multiple passages. In the present study, we used a feed layer free system to examine the effect of exogenous FGF on embryo outgrowth formation. Although the Matrigel used in this study contains low amount of growth factors, only one embryo formed primitive endoderm colony in the absence of FGF2 supplementation. In th e presence of 5 ng/ml or 50 ng/ml FGF2, more than 20% of embryos gave rise to primitive endoderm and the proliferation rates of these cells increased dramatically. However, when the isolated cells were cultured in vitro extra FGF2 was not required since the cell number doubled in 48 h and continued to growth on a Matrigel surface for at least 15 passages without any signs of senescence. It is therefore reasonable to conclude that the role of FGF signal was not only providing the cues to induce over prolif eration of this specific lineage, it was possible to induce differentiation as well. To address whether FGF signal induces epiblast differentiation in blastocyst, we tested the possibility that FGF supplementation repressed NANOG expression and

PAGE 105

105 promoted pr imitive endoderm markers in bovine blastocyst. NANOG is considered to be the key factor governing the self renewal and pluripotency of ES cell and induced pluripotent stem cells [129, 130, 310] NANOG and GATA6 were present in a salt and pepper manner in blastocyst and a heterogeneous expression pattern for NANOG was identified in mice ES cells [138, 142, 294] In this model, a subpopulation of ES cells was stained positive for some pluripotent mark ers such as OCT4 and SSEA1, but not for NANOG further evidences suggested that t hese cells also expressed GATA6 a primitive endoderm marker in mice. During early development, the primary function of NANOG is to the repression differentiate to primitive endoderm and FGFR was the key to mediate this effect in murine stem cells [138, 142, 143, 319] In the present study, we found that blastocyst receiving FGF2 on day 7 showed lower level of NANOG mRNA on day 8, 24 h later, compared to the control, NANOG expression was no longer repressed by FGF2; however, the level of GATA4 mRNA was elevated by 50ng/ml of FGF2. These observations support the idea that FGF signal changes the ground state of pluripotency of ICM and allows them diff erentiate to primitive endoderm. It appeared that endogenous FGFs also important to maintain the level of differentiation. For example, on day 8 no differences were found in NANOG and GATA4 mRNA level in blastocyst treated with FGFR inhibitor PD173074, how ever, on day 9, the same inhibitor increased the level of NANOG mRNA abundance and repressed the relative level of GATA4 mRNA. The appearance of bovine primitive endoderm plays a critical role in conceptus elongation and placentation. An excellent study done by Maddox Hyttel et al described that a layer of hypoblast emerged underneath t he ICM on day 8 when embryo escaped

PAGE 106

106 from zona pellucida and continued to develop and cover the trophoblast layer on day 14 [14] Proper development of primitive endoderm is critical for embryonic axis formation and subsequent implantation [59, 63] I t is therefore not surprising compared to in vivo derived embryos, in vitro produced embryos especially embryos generated from somatic nuclear transfer showed abnormal development of hypoblast and yolk sac formation [320] However, no transcription factors potentially controlling this lineage commitment has been described. In the present st udy, bovine embryos started to transcribe NANOG mRNA when blastocyst formation occurs and GATA4 mRNA level began to increase when blastocyst expansion took place. We could conclude that in bovine first lineage segregation occurs between trophectoderm and i nner mass on day 6 when embryo starts to form blastocoel and the second lineage differentiation between epiblast and primitive endoderm happens on day 8 as blastocyst expands despite the fact that no immunostaining work has been done in this study because of lack of costaining antibodies in bovine. Together, the present study provide evidence that the segregation of primitive endoderm in bovine embryos started on day 8 and GATA4 could be used as a marker for this lineage. Further we showed that FGF2 signal was required for the derivation of primitive endoderm cells in vitro and activation or inhibition of this signal pathway modulates NANOG or GATA4 expression in bovine blastocyst. Further study should be done to find the exogenous or intrinsic cues that regulate bovine embryo development.

PAGE 107

107 Table 41. Primers used for quantitative Real Time RTPCR Gene GenBank No. Primers NANOG NM_001025344.1 F 5GACACCCTCGACACGGACAC -3 R 5 CTTGACCGGGACCGTCTCTT 3 GATA4 GATA6 CDX2 OCT4 SOX17 FGFR1 XM_616466.4 XM_001253596.2 XM_871005 NM_174580.1 XM_868600.3 NM_001110207.1 F 5 ATGAAGCTCCATGGCGTCCC 3 R 5 -CGCTGCTGGAGCTGCTGGAA -3 F 5 -ATACTTCCCCCACCACACAA -3 R 5 -AGCCCGTCTTGACCTGAGTA -3 F 5 -CCTGTGCGAGTGGATGCGGAA -3 R 5 -CCTTTGCTCTGCGGTTCT -3 F 5 -GGTGGAGGAAGCTGACAACAAC -3 R 5 -GGCGATGTGGCTAATTTGCTGC -3 F 5 -CAGAACCCAGATCTGCACAA -3 R 5 -TAGTTGGGATGGTCCTGCAT -3 F 5 TGGTCACAGCCACGCTCTGC 3 FGFR2 FGFR3 FGFR4 XM_001789706.1 AB059430.1 XM_602166.4 R 5 GAACATCGTCCCGCAGCCGA 3 F 5 -GACCTGGTGTCGTGTACCTACCA -3 R 5 -CTGGCAGCTAAATCTCGATGAA -3 F 5 -GGGGACACCGTGGAGCTGAG-3 R 5 -GAACATCGTCCCGCAGCCGA -3 F 5 -GCAGACGCTCCTCACCCGAC-3 R 5 CGAGACTCACGAGGCCAGCG

PAGE 108

108 Table 4 2 Blastocyst outgrowth formation on days 13 and 15 post in vitro fertilization No. of Embryo Cultured FGF2 (ng/ml) Floating Embryo % Attached Embryo % Outgrowth % Degenerated % Day 13 79 76 76 76 Day 15 79 76 76 76 0 0.5 5 50 0 0.5 5 50 11.654.57 14.337.69 12.257.43 9.173.69 4.080.19 1.121.11 5.423.56 4.453.29 20.225.45 17.673.11 13.924.20 20.373.45 10.823.48 16.322.49 10.733.22 12.021.96 61.562.97 62.654.63 71.985.18 63.526.17 78.526.06 73.274.70 80.914.66 74.633.74 6.582.28 7.083.43 1.671.67 8.974.17 6.582.28 9.323.24 2.951.89 9.823.68

PAGE 109

109 Table 43. Primitive endoderm formation on days 13 and 15 post in vitro fertilization No. of outgrowths FGF2 (ng/ml) Trophoblast cell Colony (%) Primitive Endoderm Colony (%) Day13 63 55 61 56 Day15 63 55 61 56 0 0.5 5 50 0 0.5 5 50 98.483.71 a 90.246.43 a 76.853.52 b 66.363.65 c 98.811.19 a 88.517.50 b 76.402.82 c 69.684.33 c 1.511.51 a 9.766.44 a 23.153.52 b 32.123.74 c 1.191.19 a 11.497.50 b 23.602.82 c 30.324.33 c

PAGE 110

110 Figure 41. FGF2 dependent derivation of primitive endoderm. Bovine day 8 blastocysts were individually cultured in 48well plate coated with Matrigel in growth medium containing 50ng/ml bovine recombinant FGF2. After 5 days, the morphology of blastocyst outgrowths were examined using a light microscope and the representative pictures of a trophoblast colony ( Panel A ) and putative primitive endoderm col ony ( Panel B) were recorded. To validate the lineage of this new cell type, cells were cultured for extra 5 days and cell lysates were electrophoresed, blotted onto PVDF membrane and immunoblotted with antibodies recognizing transferrin. Membrane were stri pped and reprobed with an alphatubulin to serve as a loading control.

PAGE 111

111 Figure 42. Lineage marker expression in primitive endoderm and trophoblast cells. Bovine day 8 blastocysts were individually cultured in 48well plate coated with Matrigel in growth medium containing 50 ng/ml bovine recombinant FGF2. On day 20 post fertilization single trophoblast and putative primitive endoderm colony (n=2 each) were collected for lineage marker expression analyses using real time RTPCR. TcRNA we re isolated and qRTPCR was used to determine the relative abundance of GATA4 GATA 6 SOX1 7 OCT4 CDX2 IFNT and NANOG GAPDH RNA was used as the internal control. NANOG was under detectable in both lines, relative mRNA abundance of other genes was compared between trophoblast and primitive endoderm colonies. Data are represented as mean folddifferences SEM from the control value (n= 3 replicate studies within each panel). The asterisk (*) denotes a difference ( P < 0.01).

PAGE 112

112 Fig ure 4 3. Immunostaining of CDX2 and GATA4 protein in trophoblast and primitive endoderm cells. Bovine trophoblast or primitive endoderm cells were fixed and costained with antibody against CDX2 and GATA4 CDX2 was only localized in the nucleus of trophoblast (TE) while GATA4 was only positive in primitive endoderm cells (PE).

PAGE 113

113 Fig ure 4 4 Lineage marker expression profi ling during early development. Bovine in vitro produced morula, early blastocyst, blastocyst, expanded blastocyst and hatched blastocyst were collected between day 6 to day 8 (1218 per group). TcRNA were isolated and qRTPCR was used to determine the relative abundance of CDX2, GATA4 and NANOG GAPDH RNA was used as the internal control. Relative mRNA abundance was compared between trophoblast and primitive endoderm colonies. Data are represented as mean fold differences SEM from the control value (n= 3 replicate studies within each panel). Differences (P<0.05) are denoted within each panel with different superscripts

PAGE 114

114 Fig ure 4 5 Immunostaining of CDX2 and GATA4 protein in blastocyst. Immunostaining of CDX2 and GATA4 in trophoblast and Primitive endoderm cells. bovine trophoblast or primitive endoderm cells were fixed and costained with antibody against CDX2 and GATA4 CDX2 was only localized in the nucleus of trophoblast (TE) while GATA4 was only positive in a subpopulation cells within the inner cell mass.

PAGE 115

115 Fig ure 4 6 FGFR expression profiling is different between primitive endoderm and trophectoderm lineage. Bovine day 8 blastocysts were individually cultured in 48well plate coated with Matrigel in growth medium containing 50ng/ml bovine recombinant FGF2. On day 20 post fertilization single trophoblast and primitive endoderm colony (n=2 each) were collected for lineage marker expression analyses using real time RTPCR. TcRNA were isolated and qRTPCR was used to determine the relative abundance of FGFR1, FGFR2, FGFR3, FGFR1b FGFR1c, FGFR2b and FGFR2c. FGFR4 is nondetect able (ND). GAPDH RNA was used as the internal control. Relative mRNA abundance was compared between trophoblast and primitive endoderm colonies. Data are represented as mean folddifferences SEM fro m the control value (n= 3 replicate studies within each panel). The asterisk (*) denotes a difference ( P < 0.01).

PAGE 116

116 Fig ure 4 7 FGF2 promotes primitive endoderm proliferation in vitro Trophoblast or primitive endoderm cells were serum starved for 24 h followed by 50 ng/ml FGF2 treatment for 2 h. At the end of FGF2 treatment, EdU reagent (20 M) was added into each wells for 50 min. Cells were than fixed in 4% paraformaldehyde and proliferative index was examin ed using a fluorescence microscope. The ratio of EdU positive cells to total cell number (stained with 10 M DAPI ) are represented as mean SEM (n= 3 replicate studies within each panel). Differences (P<0.05) are denoted within each panel with different su perscripts

PAGE 117

117 Fig ure 4 8 Activation or inhibition of FGF signal changes mRNA abundance of early lineage marker in blastocyst. Bovine day 8 blastocysts ( Panel A) or hatched blastocysts ( Panel B ) (12 per group) were treated with 50 ng/ml FGF2, 1 M PD173043 f or 24 h. TcRNA were isolated and qRTPCR was used to determine the relative abundance of GATA4 and NANOG GAPDH RNA was used as the internal control. R elative mRNA abundance of each transcript was represented as mean folddifferences SEM from the control value (n= 3 replicate studies within each panel). Differences (P<0.05) are denoted within each panel with different superscripts

PAGE 118

118 CHAPTER 5 FIBROBLAST GROWTH FACTORS ACTIVATES MITO GEN ACTIVATED PROTEI N KINASE PATHWAYS T O PROMOTE MIGRATION OF OVINE TROPHOBLAST CELLS Substantial conceptus development occurs in cattle, sheep and other ruminants prior to uterine adhesion and implantation. Unlike rodents and primates, where conceptuses begin implanting soon after hatching fr om the zona pellucida, ruminant conceptuses remain freefloating for an extended period. In cattle, trophoblast adhesion to the uterine lining is not evident until day 1921 of pregnancy [321] Extensive morphological changes in the conceptus occur prior to uterine attachment. Gastrulation and germ layer formation occur within the inner cell during this period. Notable changes also occur within the trophectoderm. Around day 1213 in sheep and day 1416 in cattle, a combination of rapid trophoblast cell proliferation and changes in trophoblast cell morphology cause the transformation of a spherical conceptus into an elongated and eventually a filamentous structure that occupies the majority of one uterine horn prior to implantation [247, 321, 322] The rapid expansion in trophectoderm greatly increases surface area contact with the uterine epithelium and increases the overall production of interferontau ( IFNT ), the maternal recognition of pregnancy factor in these species [18, 247] The timely achievement of both these events is required to maintain pregnancy in cattle and sheep [242, 243] Uterine gland secretions, also known as histotroph, are required for ovine conceptus elongation [60, 206] and several uterinederived cy tokines and growth factors play critical roles in regulating preand peri implantation conceptus development in cattle and sheep. Several members of the fibroblast growth factor (FGF) family have been implicated in controlling peri implantation development. FGF2 is detected in luminal and glandular epithelial endometrium throughout the estrous cycl e and early

PAGE 119

119 pregnancy in cattle and sheep [28, 29] FGF10 likely also affects peri implantation development in ruminants. It is produced by stromal endometrium and functions as a paracrine mediator of epithelial cell function in the uterus [32] Receptors for FGF2, FGF10 and many other FGFs are evident in bovine and ovine blastocysts and peri implantation bovine and ovine conceptuses [29, 30, 32, 323] One known activity of FGF2 and FGF10 in bovine trophoblast cell lines and blastocysts is the stim ulation of IFNT mRNA and protein production [28, 30, 31, 324] Additional activities of these paracrine factors likely exist, and one activity that was pursued in work described herein is the ability of FGFs to regulate mi gratory abilities of bovine and ovine trophoblast cells. Trophoblast cell migration is one component to trophoblast cell reorganization and morphogenesis that plays an important role in mediating conceptus elongation [67, 321, 325] Several uterineand conceptus derived factors induce trophoblast cell migration. These include epidermal growth factor (EGF), insulinlike growth factor 2 (IGF2), galectin15 (SGAL15), Wnt5a and periostin (POSTN) [23, 176, 218, 223, 326, 327] Several signaling molecules have been linked with this activity, and several of the aforementioned factors utilize mitogenactiva ted protein kinases (MAPK), phosphoinositide 3kinase (PI3K), Rhokinase or a combination of these pathways to control migration rates [176, 223, 327] The potential involvement of FGFs in trophoblast cell migration has not been examined in ruminant species, but specific FGFs regulate cell migration in other systems [24, 267, 328330] Also, an embr yonic lethal phenotype exists in mice lacking FGF receptor 1 (FGFR1) because of failures in extraembryonic and mesoderm cell migration during gastrulation [331, 332] A series experiments were conducted to establish that FGF2 and FGF10 stimulates ovine and

PAGE 120

120 bovine trophoblast cell migration and determine whether ERK1/2, p38MAPK and JNK pathways are required for this activity. Materials and Methods Reagents Unle ss indicated otherwise, cell culture reagents were purchased from Invitrogen Corp. (Carlsb ad, CA). Bovine recombinant (br ) FGF2 was purchased from R&D Systems (Minneapolis, MN) and human recombinant (hr ) FGF10 was purchased from Invitrogen Corp. (Carlsbad, CA). MatrigelTM was purchased from BD Biosciences ( San Jose, California). Transwell inserts were purchased from Corning Inc. (Lowell, MA). Prolong antifade reagent and 4', 6 diamidino 2 phenylindole (DAPI) were purchased from Invitrogen Corp. (Carlsbad, CA) Pharmacologi cal inhibitors for MAPK kinases (MEK1/2; PD98059; upstream mediators of extracellular signal related kinases [ERK1/2]), p38 MAPK (SB203580) and stress activated protein kinase and Jun kinase (SAPK/JNK; JNK inhibitor I, cell permeable) were purchased from EMD Chemicals (Gibbstown, NJ). Antibodies recognizing phosphorylated or total ERK1/2, p38 MAPK and SAPK/JNK were purchased from Cell Signaling Technology (Beverly, MA, USA). The proteinase a nd phosphatase inhibitors cocktails, BCA Protein Assay and BioMax film were purchased from ThermoFisher Scientific (Pittsburgh, PA). Polyvinylidene Difluoride (PVDF) membrane (ImmobilonP) was purchased from Millipore Co. (Bedford, MA). Enhanced chemilumi nescence (ECL) western blot detection system was purchased from GE Healthcare (Piscataway, NJ ). All other reagents were purchased from Sigma Aldrich (St. Louis, MO).

PAGE 121

121 Trophoblast Cell C ulture The ovine trophoblast cell line (oTr) was kindly provided by Dr. Thomas E. Spencer (Texas A&M University). Cells were cultured on plastic (nonMatrigel coated) in DMEM/F12 medium containing 10% [v/v] fetal bovine serum (FBS), 700 nM insulin 100 M NEAA lfate, and 250 ng/ml amphotericin B Cells were passaged by enzymatic disruption (0.25% [w/v] trypsin ) as described previously [218] Cells were serum starved by replacing medium with DMEM/F12 lacking FBS but containing all other supplements. Bovine CT1 cells were propagated on Matrigel coated plates in DMEM (with high glucose) containing 10% FBS, 100 M nonessential amino acids (NEAA), 55 mercaptoethanol and antibiotic streptomycin sulfate, 250 ng/ml amphotericin B) at 38.5C with 5% CO2 in air as described previously [28, 150] CT1 cells were passaged manually by separating them from plates with a cell scraper and dissociati ng them into small clumps with repeated dissociation through a 20ga needle. Cells were serum starved by replacing medium with DMEM lacking FBS but containing all other supplements and a serum substitute mix ( 10 g/ml insulin, 5.5 g/ml transferrin and 6. 7 ng/ml sodium selenium ). Migration Assay Trophoblast cell migration assays were completed as described previously [223] with minor modifications. Cells were serum starved for 24 h before harvesting from plates. Cells (30,000 oTr or 50,000 CT1 in 100 L serum free medium) were seeded onto Transwell inserts (8 m pores; Costar #3422). Treatmen ts were added to each well (0, 0.5, 5 or 50 ng/ml FGF2 or FGF10) (n=3 wells/treatment). After 8 h for oTr1 cells and 12 h for CT1 cells medium in the top chamber was removed and cells remaining on

PAGE 122

122 the top chamber were removed with a cotton swab. Cells migrating through to the bottom side of the insert evaluated by fixation in 4% [w/v] paraformaldehyde for 15 min at room temperature and staining with 10 M Hoechst 33342. After staining, m embranes w ere removed from inserts and mounted on a glass slides with the migrating surface facing up, were overlaid with Prolong antifade reagent and then with a coverslip. Migrated cells were counted in seven no overlapping locations in each membrane using a Niko n TE2000 inverted phase epifluorescence microscope and CoolPix CCD cam era and NISElements Software (Nikon Corp., Melville, NY). Each study was repeated on at least three separate occasions with different batches of cells. For studies examining the effects of pharmacological inhibitors on basal and FGFinduced cell migration, oTr cells were serum starved for 24 h and treated with 50M PD08059, 25 M SB203580, 2 M SAPK/JNK inhibitor or carrier only (0.1% DMSO) for the final 2 hours of serum starvation. Cells then were harvested and seeded onto Transwell inserts cont aining 0, 50 ng/ml FGF2 or FGF10. The migrati on assay was terminated after 8 h as described previously. Western B lots Ovine cells (oTr) were serum starved for 24 h, and then either 0 or 50ng/ml FGF2 or FGF10 was added to culture medium. Cells were harvested either immediately before adding FGFs (time 0) or 5, 15, 30, 60 or 120 min after treatment Cells were rinsed with Dulbeccos PBS (DPBS) and dissolv ed in NP40 buffer (20 mM Tris HCl pH 8, 137 mM NaCl, 20 mM EDTA, 1% [v/v] NP40) supplemented with protease and phosphatase inhibitor cocktail C ell lysates were sonicated and supernatant protein concentrations were determined using a BCA Protein Assay. Protein samples ( 20 g) were loaded and separated on 10% [w/v] SDSPAGE gels and transferred onto 0.45 m

PAGE 123

123 PVDF Membranes were blocked with 5% [w/v] nonfat dry milk in TBST (50 mM Tris HCl pH 7.4, 150 mM NaCl, 0.1% [v/v] Tween20), then incubated overnight at 4C with antibodies against phosphorylatedERK1/2 (1:2000), phosphorylatedp38 MAPK (1:2000) or phosphorylated SAPK/JNK (1:1000). Horseradish peroxidas e conjugated anti rabbit IgG were used in combination with ECL to vi sualize reactive bands after exposure to BioMax film. After detecti on, membr anes were washed with TBST, str ipped according to manufacturers instructions and used to detect total ERK1/2 (1:2000), total p38MAPK (1:2000) and total SAPK/JNK (1:2000). Three independent western blots generated from different batches of oTr c e lls were completed, and band intensities were quantified after scanning using ImageJ software (NIH, USA). Representative immunoblots were photographed and presented in figures. Statistical Analyses All analyses were performed by least squares ANOVA usi ng the General Linear M odel Procedure of the Statistical Analysis System (SAS Institute Inc., Cary, NC). Differences between individual means were compared using pairwise comparisons [PDIFF (probability of difference) analysis in SAS]. Results were present ed as the mean SEM. A p value < 0.05 was considered to be significant Results FGF2 and FGF10 S timulate M igration of Ovine Trophoblast Cells Several FGFs, including FGF2 and 10 stimulate chemotaxis and migration in several cell types [24, 267, 328330] Since these FGFs are present in the uterus during peri implantation development in cattle and sheep, we set out to determine if FGF2 and 10 regulate trophoblast cell migratory activity by examining how these factors impact oTr cell migration in vitro This cell line was developed from trophoblast cells

PAGE 124

124 derived from an elongating ovine conceptus (day 15 of gestation) [218] and has been used extensively to examine how uterine factors affect various aspects of trophoblast activity, including cell migration [23, 176, 218, 326, 333] Studies were completed using a previously described assay examining the movement of oTr cells through Corning Transwell inserts containing 8[218, 223] Supplementation with 0.5 ng/ml FGF2 or 10 did not affect oTr migration but providing 5 or 50 ng/ml FGF2 or 10 increased (P<0.05) the percentage of migrated c ells after 8 h when compared with nontreated controls (Fig. 5 1A&B). FGF2 and 10 Stimulate ERK1/2, p38 MAPK and SAPK/ JNK Activity in oTr C ell s Several MAPK pathways have been linked with trophoblast cell migration [325, 327] Since FGFs utilize MAPK signals for various purposes in many cell types [334] studies were completed to identify specific MAPKs involved with basal and FGFinduced migration of oTr cells. The first MAPKs examined wer e ERK1/2. Western blot analyses (Fig. 52A&C) and subsequent analysis of densitometry scanning of ERK1/2 band intensities (Fig. 2B&D) determined that both FGF2 and FGF10 increased (P<0.05) ERK1/2 phosphorylation status within 5 min of treatment. This sti mulation in phosphorylation remained greater (P<0.05) than controls for 60 min for ERK2 and at least 120 min for ERK1. Changes in ERK1/2 phosphorylation status were not assessed after 120 min. A separate set of studies determined that FGF2 and 10 als o stimulated p38 MAPK activation in oTr cells (Fig.53). Increases (P<0.05) in p38 MAPK phosphorylation were evident within 5 min after initiating FGF2 and 10 treatments. Effects were short lived, and phosphorylation status of p38 MAPK returned to pretreatment levels after 15 min

PAGE 125

125 for FGF2treated samples (Fig. 3 A&B) and after 30 min for FGF10treated samples (Fig. 3C&D). Another set of studies determined that FGF2 and 10 also regulate SAPK/JNK in oTr cells (Fig. 54). FGF2 induced a rapid increase (P <0.05) in SAPK/JNK phosphorylation within 5 min after treatment (Fig. 54A&B). This effect was short lived, and SAPK/JNK phosphorylation status returned to basal levels 15 min after FGF2 treatment. FGF10 treatment also caused a rapid phosphorylation in S APK/JNK within 5 min (Fig. 54C&D). However, SAPK activation remained greater (P<0.05) than the pretreatment level at 15 min and returned to basal levels after 30 min whereas JNK phosphorylation remained elevated at 15 and 30 min and returned to pretrea tment levels after 60 min. ERK1/2, p38 MAPK and SAPK/ JNK Mediate FGF2/10 Effects on oTr C ell Migration Specific pharmacological inhibitors against ERK1/2 (PD98059), p38MAPK (SD203580) and SAPK/JNK (JNK inhibitor I) were utilized to examine whether these kinases are utilized by FGF2 and/or 10 to mediate oTr cell migration. Each inhibitor was added to cultures 2 h before FGF supplementation. Similar concentrations of each inhibitor were used in previous studies on oTr cells [223, 335] Western blot analys es verified that treating oTr cells with each inhibitor for 2 h prevented phosphorylation of each respective MAPK after FGF2 or FGF10 treatment (data not shown). None of the pharmacological inhibitors increased the incidence of apoptosis in oTr cells (dat a not shown). Specific MAPKs that transduced FGF2 and FGF10 effects in oTr cells were described by pretreating oTr cells with specific MAPK inhibitors 2 h before FGF supplementation and initiation of the migration assay (Fig. 55). In the absence of

PAGE 126

126 in hibitors, FGF2 and FGF10 increased (P<0.05) oTr migration. Pretreatment with PD98059 (ERK1/2 inhibitor) did not affect oTr migration in nonFGFtreated samples but prevented FGF2and FGF10induced increases in cell migration. Similarly, pretreatment w ith SB203580 (p38 MAPK inhibitor) did not affect migration in nonFGFtreated cells but prevented FGF2 and FGF10 dependent increases in cell migration. The SAPK/JNK inhibitor (JNK inhibitor I) caused a slight numerical reduction in oTr migration in nonFG F treated cells that did not reach statistical significance (P=0.1). The SAPK/JNK inhibitor blocked FGF2and FGF10dependent increases in cell migration. FGF2 and FGF10 S timulate Migration of Bovine Trophoblast Cells A final study was completed to determine if the migratory activity of a bovine trophoblast cell line could be influenced by FGF2 and 10. The CT1 cell s w ere used [28, 256] These cells migrated across 8compared with oTr cells, and the assay time was extended from 8 to 12 h to compensate for t his difference in basal migratory activity (data not shown). FGF2 or FGF10 influenced t he migratory activity of CT` cells (Fig. 56). Migration of CT1 cells was increased (P<0.05) by supplementation with 0.5 ng/ml FGF2 and greater concentrations of FGF2 induced further increases in CT1 migration rates (Fig. 56A). Specifically, CT1 migration rate was increased further (P<0.05) in cells supplemented with 50 ng/ml FGF2 (2.6 0.6 fold increase over nontreated controls). In FGF10treated CT1 cells, suppl ementation at 0.5 ng/ml did not affect cell migration but supplementation with 5 or 50 ng/ml FGF10 increased (P<0.05) migration indices over nontreated controls (2.0 0.2 fold increase in cells treated with 50 ng/ml FGF10 versus nontreated controls) (Fi g. 5 6B).

PAGE 127

127 Dis cussion The purpose of this work was to describe new biological activities for FGF2 and 10 during early conceptus development in ruminants. The timing of uterine and conceptus FGF2 and 10 production suggest they may be important regulator s of early conceptus development in ruminants. FGF2 is produced primarily in luminal and glandular epithelium throughout the estrous cycle and early pregnancy in cattle and sheep [29, 30] In the ewe, uterine luminal FGF2 protein concentrations increase at days 1213 post estrus coincident with conceptus elongation in this species [29] It is unknown if cattle also experience an increase in uterine FGF2 during conceptus elongation. FGF2 mRNA also is detected in bovine conceptuses throughout preand peri implantation periods but the predominant conceptus derived FGF transcript identified in elongating and filamentous bovine conceptuses is FGF10 [30] The uterine stroma also produces FGF10 throughout the estrous cycle and early pregnancy and it is likely that some of this reaches the uterine lumen before implantation [32, 33] It also is evident that conceptuses are responsive to FGFs during early pregnancy. Bovine and ovine preand peri implantation conceptus expresses multiple FGF receptor isoforms, including those that interact with FGF2 and 10 [29, 30, 32] One recently identified activity of FGFs in bovine trophoblast cells is the stimulation of IFNT production [2831] FGF2 and likely other FGFs increase IFNT mRNA and protein abundance in trophoblast cell lines and blastocysts by regulating the activity of a novel protein kinase C, termed PKCdelta (Chapter 3). Also, FGF2 supplementation to bovine blastocysts increased the incidence of primitive endoderm outgrowth formation in extended cultures (Chapter 4). This activity was controlled by FGF2 stimulating

PAGE 128

128 endoderm proliferation and potentially by promoting endoderm lineage commitment in IVF derived blastocysts. This project was completed to determine if FGF2 and 10 participate in conceptus elongation in ruminants. The mechanisms controlling conceptus elongation are not well understood in ruminants, but there is ample evidence that uterine histotroph is required for elongation to proceed normally. In the ewe, conceptuses generated in ewes lacking uterine glands, the primary source of histotroph, fail to elongate properly [204, 225] Also, ovine conceptuses collected at day 12 post mating failed to elongate after their removal from the uterus, but reacquired the ability to elongate after their transfer back into uteri of surrogates [336] In cattle, blastocysts cultured for extended periods in agarose tubes with medium containing large amounts of serum acquire an elongatedlike phenotype, but the rate of this elongation is much slower than observed in utero [337, 338] Trophoblast migratory activity is one of several cell activities that likely contribute to conceptus development and elongation. It has been postulated that the differentiation, morphogenesis and reorganization events controlling conceptus development and elongation in ruminants may be examined in vitro by studying how uterine factors regulate cell migration, proliferation, adhesion and motility [67, 339] This work demonstrated that supplementation with FGF2 or FGF10 increased ovine and bovine trophoblast cell migration in vitro The oTr cell has been used previously to discover several uterinederived migratory factors [218, 327] Several other uterine factors are implicated in controlling conceptus development. Two uterine factors identified in the sheep are IGFBP1 and LGALS15. The expression of both factors i ncreases in luminal and glandular epithelium around the time of conceptus

PAGE 129

129 elongation, and supplementing these factors increased oTr cell migration and adhesion [23, 218, 340] In cattle, IGFBP1 expression also increases around the time of elongation [23] suggesting it plays similar roles during peri implantation development in both species. The same may not be said f or LGALS15. The bovine homolog is not produced in the bovine uterus during diestrus and early pregnancy [340] and currently it is unclear whether a paralog for LGALS15 contains a uterinedependent expression profile or if this factor or a related molecule is not required during early pregnancy in cattle. Another interesting facet of previous work is that these migratory factors have little influence of trophoblast proliferation. IGFBP1 and LGALS15 have little to no effect on oTr cell proliferation [23, 218, 340] FGF2 and 10 also have littl e to no effect on bovine trophoblast or blastomere proliferation [28, 30, 31] (Yang et al., endoderm Chapter 4). These observations indicate a divergence in trophoblast control of these activities. The MAPK signaling modules were examined t o describe those utilized by FGF2 and 10 in regulating oTr migration. FGFs are well known activators of MAPK pathways in several cells [334] and examining the Ras/MEK/ERK pathway was of special interest given the importance of this pathway, and ERK2 in particular, in promoting trophoblast lineage specification and placental cell differentiation in mouse embryos [116, 341] FGF2 and 10 increased ERK1/2 phosphorylation status in oTr cells. The ERKs exhibited differential responses to FGF activation, with ERK1 phosphorylation lasting longer lasting than for ERK2 (>120 versus 60 min). The importance of this outcome remains unclear. Exposure to the MEK1/2 inhibitor prevented FGF1 and 10 from activating ERK1/2, and exposure to this inhibitor prevented both FGFs from stimulating

PAGE 130

130 oTr migr ation. The results implicate ERK1 or 2, or perhaps both, as mediator s of FGF2and 10dependent migration in these cells. Other factors also utilize the Ras/MEK/ERK pathway to control ovine and bovine trophoblast migration. Kim et al (2008) determined that IGF2 activated ERK1/2 in oTr cells and stimulated oTr migration. The essentiality of ERK1/2 for this activity was not examined in that work. EGF also activated ERK1/2 in F3 cells, a bovine trophoblast line derived from a midgestation bovine placenta, and inhibiting these kinases interfered with EGFinduced cell migrat ion and motility [327, 342] The p38 MAPK and SAPK/JUNK pathways also are activated by FGF2 and 10 in oTr cells, and inhibiting these kinases prevented FGFmediated migration in these cells. FGF2 also induces p38 MAPK in CT1 cells (Yang, PKC chapter), and several uterine factors regulate p38 and SAPK/JNK phosphorylation in oTr cells [176, 218, 223] These observations indicate that several MAPK systems must be activated to promote trophoblast migration. It also remains possible that other signaling systems also are required for FGF2 and 10 to control cell migration. PI3K, FRAP1 and Rhokinase pathways are associated with uterinedependent activation of trophoblast cell migration in other studies [176, 218, 223, 327] The need for such multiplicity of signaling for controlling migratory activity in trophoblast cells is not clear. Perhaps migratory activity is highly coordinated in these cells to ensure that conceptus development only progresses when several uterine factors exist in concentrations needed to induce the correct combination of signaling molecules. Although our understanding of conceptus development and elongation in ruminants is far from complete, this work describes a new activity for uterineand

PAGE 131

131 conceptus derived FGFs that may be of importance in regulating conceptus development during the second and third weeks of pregnancy in cattle and sheep. Insight also was made describing cellular mechanisms that respond to FGFs and control trophoblast cell migration.

PAGE 132

132 Figure 51. Supplementation with FGF2 and FGF10 promotes ovine trophoblast cell (oTr) migration. C ells were serum starved for 24h, then were trypsiniz ed and seeded on Transwell inserts containing 8(30 000 cells/insert) in serum free medium containing 0, 0.5, 5 or 50 ng/ml b r FGF2 ( Panel A ) or h r FGF10 ( Panel B) Cells migrati ng to the lower chamber of the insert were counted 8 h later. Results represent means and SEM of fold differences relative to control values (n=5 replicate studies in Panel A and 4 replicate studies in Panel B ). Differen t superscripts denote differences (P<0.05) between FGF treatments within each panel

PAGE 133

133 Figure 52. Erk1/2 phosphorylation status before and after oTr supplementation with FGF2 or FGF10. Western blotting was used to examine changes in ERK1/2 phosphorylation status. oTr cell lysates were collected either immediately before (time 0) or at specific periods after treatment with 50 ng/ml FGF2 or FGF10. Lysates were electrophoresed, blotted onto PVDF membrane and immunoblotted with antibodies recognizing phosphorylated ERK1/2 (P ERK1/2) or total ERK1/2 Four independent studies were completed and a representative blot for outcomes from supplementing FGF2 ( Panel A ) and FGF10 ( Panel C ) is provided. As anticipated, t wo immunoreactive bands of the correct molecular mass were observed in all blots. The higher molecular mass band represents ERK1 and the lower band represents ERK2. The relative intensities of ERK1 ( gray) and ERK2 (black) bands over time were quantified and analyzed for cells supplemented with FGF2 ( Panel B ) or FGF10 ( Panel D ) Data are presented as mean folddifferences SEM from the control value. An asterisk (*) denotes an effect of FGF2 or 10 treatment that differed from the control value ( P < 0.01).

PAGE 134

134 Figure 53. p38 MAPK phosphor ylation status is enhanced by FGF2 and FGF10 in oTr cells. Western blotting was used to examine changes in p38 MAPK phosphorylation status. oTr cell lysates were collected either immediately before (time 0) or at specific periods after treatment with 50 ng/ml FGF2 or FGF10. Lysates were electrophoresed, blotted onto PVDF membrane and immunoblotted with antibodies recognizing phosphorylated (P p38) or total (p38) p38 MAPK. Three independent studies were completed, and a representative blot for outcomes from supplementing FGF2 ( Panel A ) and FGF10 ( Panel C ) is provided. A single immunoreactive band of the correct molecular mass was observed in all blots. The relative intensities of bands over time were quantified and analyzed to determine the effects of treatm ent with FGF2 ( Panel B ) or FGF10 ( Panel D ). Data are presented as mean folddifferences SEM from the control value. An asterisk (*) denotes an effect of FGF2 or 10 treatment that differed from the control value (P < 0.01).

PAGE 135

135 Figure 54. SAPK/JNK phosphorylation status is increased in oTr cells after supplementation with FGF2 or FGF10. Western blotting was used to examine changes in SAPK/JNK phosphorylation status. oTr cell lysates were collected either immediately before (time 0) or at specific periods after treatment with 50 ng/ ml FGF2 or FGF10. Lysates were immunoblotted with antibodies recognizing phosphorylated (P SAPK/JNK) or total (SAPK/JNK) MAPK. Four ind e pendent studies were completed, and a representative blot for outcomes from supplementing FGF2 ( Panel A ) and FGF10 ( Panel C ) is provided. Two immunoreactive bands of the correct molecular mass were detected in all blots. The higher molecular mass band represents SAPK and the lower band represents JNK. The relative intensities of SAPK (gray) and JNK (black) bands over time were quantified and analyzed to determine the effects of treatment with FGF2 ( Panel B ) or FGF10 ( Panel D ) Data are presented as mean folddifferences SEM from the control value. An as terisk (*) denotes an effect of FGF2 or 10 treatment that differed from the control value ( P < 0.01).

PAGE 136

136 Figure 55. Delineation of MAPK molecules involved with FGF2and FGF10dependent increases in oTr cell migration. Cells were serum starved for 24 h. Either 50M PD98059 (ERK1/2 inhibitor), 25 M SB203580 (p38 MAPK inhibitor), 2 M JNK inhibitor (SAPK/JNK inhibitor) or DMSO (vehicle) was added to cultures for the last 2 h of serum starvation. Cells were trypsinized and seeded on Transwell insert s containing 8(30 000 cells/insert) in serum free medium containing 0 or 50 ng/ml FGF2 ( Panel A) or 0 or 50 ng/ml FGF10 ( Panel B ) Cell s migrati ng to the lower chamber of the insert were counted 8 h later. Results represent means and SEM of folddifferences relative to control values (n=4 replicate studies in each panel). An asterisk (*) denotes treatment effect s that differ significantly from the control value (P<0.05)

PAGE 137

137 Figure 5 6 FGF2 and FGF10 treatment promotes the migration of bovine trophoblast cells (CT1). C e lls were serum starved for 24 h prior to their collection. Cells were seeded onto Transwell inserts containing 8( 5 0 000 cells/insert) in serum free medium containing 0, 0.5, 5 or 50 ng/ml rbFGF2 ( Panel A ) or rh F GF10 ( Panel B ) Cells migrati ng to the lower chamber of the insert were counted 12 h later. Results represent mean s and SEM of fold differences relative to control values (n=5 replicate studies in Panel A and 4 replicate studies in Panel B). Differen t superscripts denote differences (P<0.05) between FGF treatments within each panel.

PAGE 138

138 CHAPTER 6 SUMMARY AND DISCUSSION Multiple lines of evidences suggest that defects in conceptus elongation and miscues in IFNT signaling are prominent causes of early pregnancy loss in dairy cattle [1, 2, 6] This lab previously described that uterinederived FGFs regulate IFNT produc tion [28] The focus of the present work was to elucidate the underlying mechanisms by whi ch FGF signaling regulates IFNT production in bovine trophoblast cells. At the same time, an attempt was made to discover the new roles for FGF in regulating conceptus growth and development in bovine. Firstly, using two established cell lines (CT1 and Viv ot ) and primary trophoblast outgrowths, the novel protein kinase C member, PKC delta was identified as the predominant mediator of FGF2induced IFNT production in trophoblast cells. The working hypothesis in this lab is that uterinederived FGFs stimulate the maximal IFNT production and therefore play an important role in establishing the twoway communication between the embryo and uterus during the establishment of a pregnant state in ruminants. Because of the multiplicity of FGFRs found in trophoblast cells, it is unlikely to expect that a single FGFR subtype is targeted by FGFs. FGFR1, FGFR2, FGFR3 all were detectable in trophoblast cell and it is well established that these receptors can play compensatory role during development. By contrast, PKC delta is a conserved intracellular molecule potentially used by multiple FGFR subtypes, and this factor likely serves as bridge for several FGFs to stimulate IFNT production. For this reason, PKC delta would be ideal target for testing some of the FGFR mediated effects in peri implantation conceptuses. It is unclear if PKC delta serves other critical roles

PAGE 139

139 during conceptus elongation, and addressing this question should be given high priority in future work. A second project was conducted to uncover the rol e of FGF2 and potentially other FGFs in mediating early bovine embryogenesis. Bovine trophoblast stem cell like cell lines have been established in several labs using in vitro and in vivo derived blastocysts as well as blastocysts generated from somatic c ell nuclear transfer. Different from mouse trophoblast stem cells, the derivation and maintenance of these cells were not dependent on FGF4 supplementation. The generation of endoderm outgrowths required FGF4 and its signaling effects in mice and until completion of this work it was unknown if FGFs also were needed to mediate primitive endoderm lineage specification and proliferation in ruminants. The FGF2dependent signaling modulates the expression of lineage markers in blastocysts, suggesting that they likely affect lineage specification in addition to promoting endoderm proliferation. Future lineage trace experiments should be completed to further examine how this signal changes other gene expression. One gene of particular interest is NANOG Current findings suggest that FGF signaling plays a role in controlling the expression level of NANOG This is important because no convincing stem cell lines have been reported in ruminant animals. Future work should address if blocking FGF downstream signaling could maintain the pluripotency of epiblast. Conceptus elongation is one of the development puzzles that have attracted the attention of several animal scientists over the last a couple of decades. Conceptus elongation does not occur in cultur e systems spontaneously or even in the uterus with impaired uterine glands [206] Based on an early observation that cell activities such as

PAGE 140

140 migration and invasion are associated with phenotypes that trophoblast cells behavior during blastocyst elongation [343] endeavors have focused on discovering the role of uterine derived factors on these activities in trophoblast cells [218, 223, 344, 345] Trophoblast migration was sued as the endpoint for examining i f FGF2 and 10 potentially are involved with events associated with elongation. As a potent factor that stimulates migration of other cell types, FGF2 and 10 are discovered as migration inducers in ruminant trophoblast cells. Using two different cell lines from bovine and ovine, this study concluded that FGF2 and FGF10 activates multiple MAPK signaling transduction cascades to regulate trophoblast cell migration. The cellular pathways utilized by FGF2 to control cell migration are different from the one used to regulate IFNT production. Further experiments are necessary to elucidate how this factor triggers different cellular events through different intracellular mechanisms. In summary (as shown in figure 61), uterine derived FGF2, mesenchymal secreted FGF10 and potentially other FGFs produced by uterine endometrium or embryo participates several events including primitive endoderm development, IFNT production and trophoblast migration to regulate conceptus development and influence uterine response to pregnancy. Understanding the cellular and molecular mechanisms that regulate early embryogenesis and conceptus elongation is crucially important not only because this kind of knowledge will fulfill our scientific curiosity but also because it is the inevitable step toward recovering a serious problem in mordent dairy industry: early pregnancy loss.

PAGE 141

141 Figure 61. The actions of FGF signaling during peri i mplantation development in bovine: a suggested model. Embryogenesis and peri im p lantation development i n ruminant is a unique process featured by conceptus elongation which occurs between days 14 to 17 post fertilization. During this period of development, trophoblast cells undergo proliferation, migration and differentiation. Meanwhile, mononucleate trophoblast cells secret interferon tau ( IFNT ) to initiate the maternal recognition of pregnancy. Uterine epithelial derived fibroblast growth factor 2 (FGF2) and stromal cell secreted FGF10 regulate trophoblast functions such as IFNT production and trophoblast migration. In expanded blastocysts, although FGF signaling also stimulates IFNT secretion by cells from trophectoderm lineage (TE), more importantly, FGF plays a critical role in promoting primitive endoderm development, thus contributing early lineage segr eg ation in this species

PAGE 142

142 APPENDIX A FIBROBLAST GROWTH FACTOR 2 AND 10 MEDIATE TRANSCRIPT ABUNDANCE OF SELECTIVE INTEGRI NS AND METALLOPROTEA SE 2 IN BOVINE BLASTOCYSTS AND TROPHOBLAST CELLS This laboratory recently completed a preliminary examination of how FGF2 and FGF10 affects the bovine blastocyst transcriptome by using a bovine microarray (Zhang, Yang and Ealy; Unpublished observations), and several molecules involved with cell attachment, migration and invasion were induced with FGF2 and/or FGF10 treatment. One of these was metalloprotease 2 ( MMP2 ), a gelatinase that is well studied for its involvement with controlling trophoblast cell attachment, migration, invasion and other aspects of implantation [325, 346] This and other MMPs, notably M MP9 and their inhibitors are expressed throughout gestation in the bovine endometrium and placenta [347] Increases in MMP2 mRNA abundance are detected in mouse trophoblast stem cells treated with FGF4, and increases the enzymatic activity of MMP9 occur in human cytotrophoblasts treated with FGF4 or FGF10 but not FGF2 [285, 348] Roles for FGF mediation of MMP expression and biological activity has not been described in ruminant placentae. Several transcripts that encode integrins also were found in greater abundance in FGF2 and FGF10treated blastocysts in the preliminary microarray analysis. These transmembrane proteins mediate various aspects of cell to cell and cellto extracellular matrix interactions during implantation [349] Integrins are essential components of trophoblast cell attachment, adhesion and migration in various species [333, 350352] Potential roles for FGFs in regulating integrin expression and activ ity in trophoblast cells have not been described. We hypothesize that FGF2 and 10 control trophoblast cell migration and other aspects of early placental development and implantation by

PAGE 143

143 controlling the expression of selective integrins and MMP2 An expression profile study was completed to determine whether FGF2 and 10 affects the relative abundance of integrin and MMP2 transcript abundance in bovine blastocysts and trophoblast cells. Materials and Methods Reagents Unless indicated otherwise, cell culture reagents were purchased from Invitrogen Corp. (Carlsbad, CA). MatrigelTM was purchased from BD Biosciences ( San Jose, California). Bovine recombinant (br ) FGF2 was purchased from R&D Systems (Minneapolis, MN) and human recombinant (hr) FGF10 was purchased from Invitrogen Corp. (Carlsbad, CA). The PicoPureTM RNA isolation kit was purchased from MDS Analytical Technologies (Sunnyvale, CA). Trizol TM reagent and the PureLink TM RNA M ini Kit were purchased from Invitrogen. RNase free DNase was purchased from New E ngland Biolabs (Ipswich, MA). PCR primers were synthesized by Invitrogen. The High Capacity cDNA Reverse Transcription kit SYBR Green Detector System and consumables for qRTPCR were purchased from App lied Biosystems Inc. (Foster City, CA). In vitro P roduction of Bovine B lastocysts In vitro production of bovine embryos was completed as described previously [30, 353] In brief, bovine ovaries collected from a local slaughterhouse (Cent er Hill, FL) were transported to the laboratory and sliced to liberate cumulus oocyte complexes (COCs) COCs with compact cumulus were matured in a 50maturation medium (~30 COCs/drop) overlaid with mineral oil for 20 22 h at 38.5C in a humidified atmosphere of 5% (v/v) CO2 in air. Matured oocytes were fertilized with Percol l purified spermatozoa from fr ozenthawed semen from at least three bulls.

PAGE 144

144 Putative zygotes were denuded of cumulus cells and incubated i n 50 s of modified synthetic oviduct fluid (mSOF) [30] at 38.5C in a humidified atmosphere of 5% CO2, 5% O2, 90% N2 (~30 presumptive zygotes/drop). On day 8 post fertilization, blastocysts were collected and placed in Dulbeccos modified essential medium (DMEM) containing high glucose (25 mM) and 1% [w/v] BSA and 0, 5 or 100 ng/ml br FGF2 or hr FGF10 (n=1215 blastocysts/well). Both FGFs w ere prepared in DMEM containing 1% BSA. After 8 h at 38.5C in a humidified atmosphere of 5% CO2 in air, blastocysts were collected, snapfrozen in liquid nitrogen and stored at 80C until RNA isolation. Trophoblast Cell C ultures Bovine CT1 cells were pr opagated on Matrigel coated plates in DMEM (with high glucose) containing 10% [v/v] fetal bovine serum ( FBS) 100 M nonessential amino acids (NEAA) mercaptoethanol, sulfate, and 250 ng/ml amphoterici n B at 38.5C with 5% CO2 in air as described previously [28, 150] CT1 cells were passaged manually by separating them from plates with a cell scraper and dissociating them into small clumps with repeated dissociation through a 20ga needle. Cells were serum starved by replacing medium with DMEM lacking FBS but containin g all other supplements and a serum substitute mix ( 10g/ml insulin, 5.5g/ml transferrin and 6.7ng/ml sodium). RNA Isolation and Q uantitative R eal T ime RT PCR Total cellular RNA (tcRNA) was isolated from blastocysts using the PicoPure RNA isolation kit and from CT1 cells using Trizol reagent and the PureLink RNA Mini Kit. Tc RNA quality and concentration was determined using a NanoDrop Spectrophotometer (Thermo Scientific). Samples with A260/A280 ratios were

PAGE 145

145 incubated with RNase free DNase for 30 m in at 37C. After heat inactivating the DNase (75C for 10 min), RNA was reversetranscribed using the High Capacity cDNA Reverse Transcription kit and random hexamers. Primers (200 nM) for ITGs MMP2 and the i nternal loading control ( GAPDH) (Ta ble A 1) were used in combination with a SYBR Green Detector System and a 7300 Real Time PCR System (Applied Biosystems Inc.) to quantify transcript abundance in embryos and CT1 cells as described previously [30] A dissociation curve analysis (6095C) was used to verify the amplification of a single product. Each sample was completed in triplicate reactions. A forth reaction lacking reverse transcriptase was included to control for genomic DNA contamination. The comparative threshold cycle (CT) method was used to quantify mRNA abundance relative to the reference control ( GAPDH). Statistical A nalyses All analyses were performed by least squares ANOVA using the General Linear M odel Procedure of the Statistical Analysis System (SAS Institute Inc., Cary, NC). Differences betw een individual means were compared using pairwise comparisons [PDIFF (probability of difference) analysis in SAS]. qRT PCR data (fold differences between treatments) were analyzed after logtransformation. Results were presented as the mean SEM. A p va lue < 0.05 was considered statistically significant Results FGF2and 10dependent Changes in Selective ITGs and MMP2 in Bovine Blastocysts Several ITGs and MMP2 were identified as candidates for FGF2 or FGF10 regulation in bovine blastocysts after a preliminary microarray analysis (Zhang, Yang & Ealy; Unpublished observations). Quantitative RTPCR was used to examine whether

PAGE 146

146 the abundance of selective transcript s were indeed regulated by FGF2 or FGF10 in bovine blastocysts. Each of the six ITGs examined (See Fig. A 1 and A 2, panels A F) were readily detected by qRTPCR ( dCT values using GAPDH as the reference control). According the delta CT value, integrin alpha 6 ( ITGA6 ) is highly expressed by bovine blastocyst (3.560.12 vs 7.040.34 ( ITGA3 ), 7.980.18 ( ITGA7 ), 8.310.55 ( IGTA2B ), 12.270.36 ( ITGB4 ), 10.580.49 ( ITGB6 )). 5ng/ml FGF10 increased ITGA7 (P<0.05). 5ng/ml FGF2 tended to increase I TGB 4 (P=0.07), 50ng/ml FGF2 significantly increased ITGB4 (P<0.05). ITGA3, ITGA6, ITGB6, and ITGA2B was not affected by FGF treatments. Interestingly, FGF2 increased the MMP2 level (P<0.05) FGF2and 10dependent Changes in Selective ITGs and MMP2 in CT1 Cells Bovine blas tocysts contain multiple cell types (trophoblast, epiblast and primitive endoderm) [14] therefore a follow up study was completed using CT1 cells to examine how FGF2 and 10 influence trophoblast specific expression of selective ITG s and MMP2 To evaluate whether FGF2 or FGF10 changes the integrin expression in trophoblast cells, a bovine trophoblast cell line (CT1) was t reated with FGF2 or FGF10 for 8 h. Accor ding to the blastocyst data, 5ng/ml FGF2 or FGF10 could induce changes in integrin expression so lower doses of FGF2 or FGF10 (5 or 50ng/ml) was used in this study. In CT1 cells, ITGA6 was the most abundant integrin as indicated by the CT value (3.420.32 vs. 12.871.03 ( ITGA3 ), 16.550.31 ( ITGA7 ), 12.280.55 ( IGTA2B ), 6.331.11 ( ITGB4 ), 6.130.71 ( ITGB6 )). Similar to blastocyst, 3 alpha subunits of selected integrin were not responsiv e to FGF2 or FGF10 treatment. ITGA2B was stimulated by 5ng/ml and 50ng/ml FGF2 (P<0.01). ITGB4 was consistent among different treatments. ITGB6 was also stimulated by 5ng/ml and 50ng/ml FGF2

PAGE 147

147 treatments (P<0.05) 5ng/ml or 50ng/ml FGF2 treatment significant ly increased the mR NA level of MMP 2 in CT1 cells (P<0.01). Discussion Conceptus elongation is a complex and highly regulated process that features cell differentiation, proliferation and migration. Trophoblast cell migration has been noticed during this period of development and several factors have been identified directly controlling the migration of ovine or bovine trophoblast cells in vitro In the present study, we found that FGF2 and FGF10, two growth factors previously described having a role in ruminant uterus changes the abundance of several ITGs and increases MMP 2 mRNA concentration in both blastocyst and trophoblast cells. The switch in integrin expression is related with trophoblast cell migration. Previous work in mouse demonstrated that the dynamic changes in integrin expression during the period of embryo implantation play a critical role in trophoblast differentiation, migration and attachment [354, 355] Several integrins were selected in the present study not only because a previous microarray study suggested that several integrin can be regulated by FGFs in bovine blastocysts (data not shown), but also because those integrins play a crucially important r ole in trophoblast migration and development in other species. For example, ITGA2B was expressed by trophoblast cells and it paired with ITGB3 to mediate the trophoblast attachment and migration during peri implantation development in mice [355, 356] ITGA7 was specifically expressed by trophoblast cells and highly unregulated in trophoblast giant cells, which migrate and invade into uterine lining during embryo implantation in the mouse [354, 357] In elongating bovine conceptus, ITGA3 and ITGA6 were constitutively detectable in mononucleated trophoblast cells and a subpopulation of binucleated trophoblast cells

PAGE 148

148 while ITGA5 was only s tained in endoderm cells [222, 358] Here we showed that ITGA3 and ITGA6 were abundantly present in bovine blastocyst and trophoblast cells. ITGB4 and ITGB6 were also transcribed by bovine trophoblast cells. The interaction integrin and extracellular matrix mediates trophoblast cell migration in ruminant. It has been proposed that changes in ITG expression and its extracellular molecules govern the migration of binucleated cells in bovine placenta [220] It is not surprising because one of the well known characteristics of bovine binucleated cells is migration. However, several experiments have established the role of integrin signaling in mediating mononucleated trophoblast cell migration and suggested that this type of cell migration is important for conceptus elongation in ruminant species [219, 349] Here we showed that FGF2 and FGF10 supplementation elevated mRNA levels of ITGA2B and ITGB6 indicating that changes in integrin expression may be related with FGF induced cell migration. FGF2induced changes in integrin expression have been found in many cell types and it is directly linked to cell migration and adhesion [359, 360] In the present study, the FGF response is moderate, however, changes in integrin expression does not need to be robust to induce a physiological event [361] MMP activity is critical for cell migration. MMPs are a group of enzymes that responsible for the turnover of structural protein in extracellular matrix [345] MMP 2 and MMP 9 have been considered as key enzymes for trophoblast invasion [362] For example, In human placenta, FGFR14 were identified in trophoblast cells and supplementation FGF10 to cultured trophoblast cell increases outgrowth formation and cell migration through a Matrigel coated membrane by modulating MM9 activity [363] Bovine trophoblast cells have restricted invasive ability; therefore MMP seems play a

PAGE 149

149 role in promoting trophoblast migration. Indeed, a recent study showed that EGF stimulates bovine trophoblast migration by MMP9 and TIMP 1 activities [344] Here we demonstrated that MMP 2 was induced by FGF2 in both blastocyst and trophoblast cells and potentially plays a role in bovine trophoblast migration. The reason that FGF10 showed less effect on MMP 2 expression in bovine trophoblast is unclear.

PAGE 150

150 Table A 1. Primers used for quantitative Real Time RT PCR Gene GenBank No. Primers ITGA3 ITGA6 ITGA7 ITGA2B ITGB4 ITGB6 MMP2 GAPDH BC149926.1 XM_616466.4 NM_001191305.1 NM_001014929.1 NM_001193257.1 NM_174698.2H NM_174745.2 NM_001034034.1 F 5 GGACATGTGGCTCGGCGTGA 3 R 5 -GCCAGTCATCCCTGGCGTCC -3 F 5 -TGCGAGGGCTGGACAGCAAG-3 R 5 -ACCTGAGTGCCTGCGTTGGG -3 F 5 -TGGAGGAGTACTCAGCTGTG -3 R 5 -AGCAAGTTCTTGATGGAGGATT -3 F 5 -GGGCAAGGACTCGGAGCGTC -3 R 5 -CTGTGCGGTCGCCGTTTGG -3 F 5 -GCTACGAGGGTCAGTTCTGC -3 R 5 TCCGTGTAGAGCGACTGTTG -3 F 5 -CTCGTGCAGTGGGAGAGGCG-3 R 5 -CGCAGAGCAGCCCCTTGTGT -3 F 5 -GGGCCTGAGCACCAGGGAAG -3 R 5 -ATGGAGGGGGAGGGACACCC -3 F 5 -ACCCAGAAGACTGTGGATGG-3 R 5 -CAACAGACACGTTGGGAGTG3

PAGE 151

151 Figure A 1. FGF2 and FGF10 modulate selected gene expression in bovine blastocysts. Results represent means and SEM of folddifferences relative to control values (n=5). The asterisk (*) denotes a difference (P < 0.05).

PAGE 152

152 Figure A 2. FGF2 modulates selected gene express ion in CT1 cells. Results represent means and SEM of folddifferences relative to control values (n=5). The asterisk (*) denotes a difference (P < 0.05).

PAGE 153

153 APPENDIX B DELIVERY OF SIRNA OLIGOS INTO BOVINE TROPHOBLAST CELLS This protocol has provided successf ul knockdown results when tested three PKC delta (PRKCD) siRNA s in a bov ine trophoblast cell line, Vivot cells. The reasons of using this cell line are Vivot cells produce high amount of IFNT mRNA, which makes it a good model to study IFNT gene expression (Figure B 1), and the individual cell has different membrane structure when compare with CT1 cells by a light microscopy. This protocol describes the key points of using Hiperfect transfection reagent (Cat.No. 301705, Qiagen) in Vivot cells. In this protocol, cell plating and siRNA transfection are conducted on the same day (reverse transfection). Trophoblast Cell Culture V ivot cells will be cultured in T75 flask for 4 or 5 days with a confluence of 50%. At this time, the cells are at rapid proliferation stage. On the day of transfection (Day 0) cells will be washed with PBS 3 times and suspended in 3 ml of OPI MEM medium using a scraper. Transfer cell suspension to a 15 ml conical tube and split cells physically by breaking the cell clump using a 22G syringe needle. Dependent upon the size of the colonies, 2 or 3 times will be enough to dissociate all cell clumps. each well in a 24well plate. The plate must be coated with Matrigel 4 hours earlier. To distribute cells equally, shake the tube well each time. Cell confluence determines the efficiency of siRNA. I ncubate cells under normal conditions or this step can be done after step 2 of this protocol.

PAGE 154

154 Preparation of siRNA Complex siRNA: d OPI MEM with proper concentration. This should be 2 times higher than the final siRNA concentration in the well For example, if working concentration is 50 nM, prepare 100nM siRNA at this step. Mix by vortexing. Transfection compl ex: HiPerFect from Qiagen will be used in this protocol. Based on the preliminary results, the optimal dose of this reagent in each transfection is 10s.Incubate the solution for 10 min in the hood to allow formation of transfection complexes. siRNA delivery: Add siRNA complexes in the cells in a dropwise manner. Gently shake the plate to distribute the complexes equally Incubate cells under normal condition. 18 hours later, add 400 culture the cells. Cell Maintenance Day 2: Check cell viability 48 hours after transfection, if needed, add 200 serum containing medium in each well. Day 3: Check cell viability, 72 hours later, dependent upon experimental setup, the effect of siRNA could be checked using real time PCR or western blot analysis Day 3 (Optional): If the purpose is to study the effect of siRNA on IFNT 60 hours after siRNA delivery, the medium containing siRNA complexes will be replaced by serum free medium (ITS medium ) and the cells will be starved for 12 hours. 72 hours post transfection; cells will be treated with FGF2 for 20 hours. Day 4 (Optional): Normally the cell confluence will be around 30 to 40%. Isolate tcRNA with appro priate approach and dilute into PCR will be used to If the confluence is lower than 15%, no endpoint should be conducted because tcRNA quality will be a concern. If the cells are over confluent, endpoint should not be perform ed since the effect of siRNA will be limited.

PAGE 155

1 55 Figure B 1. FGF2 increases IFNT mRNA abundance in Vivot cells. Cells were serum starved from 24h then treated with 0.5, 5, 50, 500 ng/ml FGF2 or vehicle (1% BSA in ITS medium) for 24 h. tcRNA was isolated at the end of the incubation period and qRTPCR was used to determine the relative abundance of IFNT mRNA. 18S RNA was used as the internal control.

PAGE 156

156 LIST OF REFERENCES 1. Diskin MG, Murphy JJ, Sreenan JM. Embryo survival in dairy cows managed under pastoral conditions. Anim Reprod Sci 2006; 96:297311. 2. Diskin MG, Morris DG. Embryonic and early foetal losses in cattle and other ruminants. Reprod Domest Anim 2008; 43 Suppl 2:260267. 3. Thatcher W W, Bilby TR, Bartolome JA, Silvestre F, Staples CR, Santos JE. Strategies for improving fertility in the modern dairy cow. Theriogenology 2006; 65:3044. 4. Betteridge KJ, Flechon JE. The anatomy and physiology of preattachment bovine embryos. Theriogenology 1988; 29:155187. 5. Santos JE, Thatcher WW, Chebel RC, Cerri RL, Galvao KN. The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Anim Reprod Sci 2004; 8283:513535. 6. Inskeep EK, Dailey RA. Embryonic death in cattle. Vet Clin North Am Food Anim Pract 2005; 21:437461. 7. Moore K, Thatcher WW. Major advances associated with reproduction in dairy cattle. J Dairy Sci 2006; 89:12541266. 8. Butler WR. Review: effect of protein nutrition on ovarian and ut erine physiology in dairy cattle. J Dairy Sci 1998; 81:25332539. 9. Royal MD, Flint AP, Woolliams JA. Genetic and phenotypic relationships among endocrine and traditional fertility traits and production traits in HolsteinFriesian dairy cows. J Dairy Sci 2002; 85:958967. 10. De Vries A. Economic value of pregnancy in dairy cattle. J Dairy Sci 2006; 89:38763885. 11. Heyman Y, ChavattePalmer P, LeBourhis D, Camous S, Vignon X, Renard JP. Frequency and occurrence of lategestation losses from cattle clo ned embryos. Biol Reprod 2002; 66:613. 12. Daniels R, Hall VJ, French AJ, Korfiatis NA, Trounson AO. Comparison of gene transcription in cloned bovine embryos produced by different nuclear transfer techniques. Mol Reprod Dev 2001; 60:281288. 13. Mansouri Attia N, Sandra O, Aubert J, Degrelle S, Everts RE, GiraudDelville C, Heyman Y, Galio L, Hue I, Yang X, Tian XC, Lewin HA, et al. Endometrium as an early sensor of in vitro embryo manipulation technologies. Proc Natl Acad Sci U S A 2009; 106:56875692.

PAGE 157

157 14. Maddox Hyttel P, Alexopoulos NI, Vajta G, Lewis I, Rogers P, Cann L, Callesen H, TvedenNyborg P, Trounson A. Immunohistochemical and ultrastructural characterization of the initial post hatching development of bovine embryos. Reproduction 2003; 125:607623. 15. Roberts RM. Interferon tau. Nature 1993; 362:583. 16. Bazer FW, Spencer TE, Ott TL. Placental interferons. Am J Reprod Immunol 1996; 35:297308. 17. Thatcher WW, Hansen PJ, Gross TS, Helmer SD, Plante C, Bazer FW. Antiluteolytic effects of b ovine trophoblast protein1. J Reprod Fertil Suppl 1989; 37:9199. 18. Ealy AD, Yang QE. Control of interferontau expression during early pregnancy in ruminants. Am J Reprod Immunol 2009; 61:95106. 19. Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, Wang H. Molecular cues to implantation. Endocr Rev 2004; 25:341373. 20. Block J, Fischer Brown AE, Rodina TM, Ealy AD, Hansen PJ. The effect of in vitro treatment of bovine embryos with IGF1 on subsequent development in utero to Day 14 of gestation. Theriogenology 2007; 68:153161. 21. Michael DD, Wagner SK, Ocon OM, Talbot NC, Rooke JA, Ealy AD. Granulocytemacrophage colony stimulating factor increases interferontau protein secretion in bovine trophectoderm cells. Am J Reprod Immunol 2006; 56:6367. 22. Loureiro B, Bonilla L, Block J, Fear JM, Bonilla AQ, Hansen PJ. Colony stimulating factor 2 (CSF2) improves development and posttransfer survival of bovine embryos produced in vitro. Endocrinology 2009; 150:50465054. 23. Simmons RM, Erikson DW, Kim J, Burghardt RC, Bazer FW, Johnson GA, Spencer TE. Insulinlike growth factor binding protein1 in the ruminant uterus: potential endometrial marker and regulator of conceptus elongation. Endocrinology 2009; 150:42954305. 24. Bottcher RT, Niehrs C. Fibroblast growth factor signaling during early vertebrate development. Endocr Rev 2005; 26:6377. 25. Chai N, Patel Y, Jacobson K, McMahon J, McMahon A, Rappolee DA. FGF is an essential regulator of the fi fth cell division in preimplantation mouse embryos. Developmental Biology 1998; 198:105115.

PAGE 158

158 26. Chazaud C, Yamanaka Y, Pawson T, Rossant J. Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2MAPK pathwa y. Developmental Cell 2006; 10:615624. 27. Tanaka S, Kunath T, Hadjantonakis AK, Nagy A, Rossant J. Promotion of trophoblast stem cell proliferation by FGF4. Science 1998; 282:20722075. 28. Michael DD, Alvarez IM, Ocon OM, Powell AM, Talbot NC, Johnson SE, Ealy AD. Fibroblast growth factor 2 is expressed by the bovine uterus and stimulates interferontau production in bovine trophectoderm. Endocrinology 2006; 147:35713579. 29. OconGrove OM, Cooke FN, Alvarez IM, Johnson SE, Ott TL, Ealy AD. Ovine endometrial expression of fibroblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Domest Anim Endocrinol 2008; 34:135145. 30. Cooke FN, Pennington KA, Yang Q, Ealy AD. Several fibroblast growth factors are expressed during preattachment bovine conceptus development and regulate interferontau expression from trophectoderm. Reproduction 2009; 137:259269. 31. Rodina TM, Cooke FN, Hansen PJ, Ealy AD. Oxygen tension and medium type actions on blastocyst development and interferontau secretion in cattle. Anim Reprod Sci 2009; 111:173188. 32. Chen C, Spencer TE, Bazer FW. Fibroblast growth factor 10: a stromal mediator of epithelial function in the ovine uterus. Biol Reprod 2000; 63:959966. 33. Satterfield MC, Haya shi K, Song G, Black SG, Bazer FW, Spencer TE. Progesterone regulates FGF10, MET, IGFBP1, and IGFBP3 in the endometrium of the ovine uterus. Biol Reprod 2008; 79:12261236. 34. Cockburn K, Rossant J. Making the blastocyst: lessons from the mouse. J Clin Invest 2010; 120:9951003. 35. Schultz RM. The molecular foundations of the maternal to zygotic transition in the preimplantation embryo. Hum Reprod Update 2002; 8:323331. 36. Wang H, Dey SK. Roadmap to embryo implantation: clues from mouse models. Nat Rev Genet 2006; 7:185199. 37. Maltepe E, Bakardjiev AI, Fisher SJ. The placenta: transcriptional, epigenetic, and physiological integration during development. J Clin Invest 2010; 120:10161025.

PAGE 159

159 38. Schier AF. The maternal zygotic transition: death and birth of RNAs. Science 2007; 316:406407. 39. Telford NA, Watson AJ, Schultz GA. Transition from maternal to embryonic control in early mammalian development: a comparison of several species. Mol Reprod Dev 1990; 26:90100. 40. Nothias JY, Majumder S, Kaneko KJ, DePamphilis ML. Regulation of gene expression at the beginning of mammalian development. J Biol Chem 1995; 270:2207722080. 41. Yu J, Hecht NB, Schultz RM. RNAbinding properties and translation repression in vitro by germ cell specific MSY2 protein. Biol Reprod 2002; 67:10931098. 42. Li L, Zheng P, Dean J. Maternal control of early mouse development. Development 2010; 137:859870. 43. Jedrusik A, Parfitt DE, Guo G, Skamagki M, Grabarek JB, Johnson MH, Robson P, ZernickaGoetz M. Role of Cdx2 and cell polarity in cell allocation and specification of trophectoderm and inner cell mass in the mouse embryo. Genes Dev 2008; 22:26922706. 44. Hamatani T, Carter MG, Sharov AA, Ko MS. Dynamics of global gene expression changes during mouse preimplantati on development. Dev Cell 2004; 6:117131. 45. Brevini TA, Cillo F, Antonini S, Tosetti V, Gandolfi F. Temporal and spatial control of gene expression in early embryos of farm animals. Reprod Fertil Dev 2007; 19:3542. 46. Kelly SJ. Studies of the develop mental potential of 4and 8cell stage mouse blastomeres. J Exp Zool 1977; 200:365376. 47. Rossant J. Lineage development and polar asymmetries in the peri implantation mouse blastocyst. Semin Cell Dev Biol 2004; 15:573581. 48. Fleming TP. A quantitative analysis of cell allocation to trophectoderm and inner cell mass in the mouse blastocyst. Dev Biol 1987; 119:520531. 49. Fleming TP, Sheth B, Fesenko I. Cell adhesion in the preimplantation mammalian embryo and its role in trophectoderm diff erentiation and blastocyst morphogenesis. Front Biosci 2001; 6:D10001007. 50. Collins JE, Fleming TP. Epithelial differentiation in the mouse preimplantation embryo: making adhesive cell contacts for the first time. Trends Biochem Sci 1995; 20:307312.

PAGE 160

160 51. De Vries WN, Evsikov AV, Haac BE, Fancher KS, Holbrook AE, Kemler R, Solter D, Knowles BB. Maternal betacatenin and E cadherin in mouse development. Development 2004; 131:44354445. 52. Ohsugi M, Larue L, Schwarz H, Kemler R. Cell junctional and cytoskeletal organization in mouse blastocysts lacking E cadherin. Dev Biol 1997; 185:261271. 53. Winkel GK, Ferguson JE, Takeichi M, Nuccitelli R. Activation of protein kinase C triggers premature compaction in the four cell stage mouse embryo. Dev Biol 1990; 138:115. 54. Steed E, Balda MS, Matter K. Dynamics and functions of tight junctions. Trends Cell Biol 2010; 20:142149. 55. Watson AJ, Barcroft LC. Regulation of blastocyst formation. Front Biosci 2001; 6:D708730. 56. Alarcon VB. Cell polarity regulator PARD6B is essential for trophectoderm formation in the preimplantation mouse embryo. Biol Reprod 2010; 83:347358. 57. Eckert JJ, Fleming TP. Tight junction biogenesis during early development. Biochim Biophys Acta 2008; 1778:717728. 58. Spenc er TE, Bazer FW. Uterine and placental factors regulating conceptus growth in domestic animals. J Anim Sci 2004; 82 E Suppl:E4 13. 59. Blomberg L, Hashizume K, Viebahn C. Blastocyst elongation, trophoblastic differentiation, and embryonic pattern formation. Reproduction 2008; 135:181195. 60. Brandao DO, Maddox Hyttel P, Lovendahl P, Rumpf R, Stringfellow D, Callesen H. Post hatching development: a novel system for extended in vitro culture of bovine embryos. Biol Reprod 2004; 71:20482055. 61. Menezo Y, Renard JP, Delobel B, Pageaux JF. Kinetic study of fatty acid composition of day 7 to day 14 cow embryos. Biol Reprod 1982; 26:787790. 62. Degrelle SA, Campion E, Cabau C, Piumi F, Reinaud P, Richard C, Renard JP, Hue I. Molecular evidence for a critical period in mural trophoblast development in bovine blastocysts. Dev Biol 2005; 288:448460. 63. Vejlsted M, Avery B, Schmidt M, Greve T, Alexopoulos N, Maddox Hyttel P. Ultrastructural and immunohistochemical characterization of the bovine epiblas t. Biol Reprod 2005; 72:678686.

PAGE 161

161 64. Hue I, Renard JP, Viebahn C. Brachyury is expressed in gastrulating bovine embryos well ahead of implantation. Development Genes and Evolution 2001; 211:157159. 65. Alexopoulos NI, Maddox Hyttel P, TvedenNyborg P, D 'Cruz NT, Tecirlioglu TR, Cooney MA, Schauser K, Holland MK, French AJ. Developmental disparity between in vitroproduced and somatic cell nuclear transfer bovine days 14 and 21 embryos: implications for embryonic loss. Reproduction 2008; 136:433445. 66. Enders AC, Schlafke S. Cytological aspects of trophoblast uterine interaction in early implantation. Am J Anat 1969; 125:129. 67. Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G. Comparative aspects of implantation. Reproduction 2009; 138:195209. 68. Carson DD, Bagchi I, Dey SK, Enders AC, Fazleabas AT, Lessey BA, Yoshinaga K. Embryo implantation. Dev Biol 2000; 223:217237. 69. Paria BC, Reese J, Das SK, Dey SK. Deciphering the cross talk of implantation: advances and challenges. Science 2002; 296:21852188. 70. Stocco C, Telleria C, Gibori G. The molecular control of corpus luteum formation, function, and regression. Endocr Rev 2007; 28:117149. 71. Das SK, Wang XN, Paria BC, Damm D, Abraham JA, Klagsbrun M, Andrews GK, Dey SK. Heparin binding EGF like growth factor gene is induced in the mouse uterus temporally by the blastocyst solely at the site of its apposition: a possible ligand for interaction with blastocyst EGFreceptor in implantation. Development 1994; 120:10711083. 72. Wang J, May ernik L, Schultz JF, Armant DR. Acceleration of trophoblast differentiation by heparinbinding EGFlike growth factor is dependent on the stagespecific activation of calcium influx by ErbB receptors in developing mouse blastocysts. Development 2000; 127:33 44. 73. Lim HJ, Dey SK. HBEGF: a unique mediator of embryo uterine interactions during implantation. Exp Cell Res 2009; 315:619626. 74. Genbacev OD, Prakobphol A, Foulk RA, Krtolica AR, Ilic D, Singer MS, Yang ZQ, Kiessling LL, Rosen SD, Fisher SJ. Trophoblast Lselectin mediated adhesion at the maternal fetal interface. Science 2003; 299:405408. 75. Ilic D, Genbacev O, Jin F, Caceres E, Almeida EA, BellingardDubouchaud V, Schaefer EM, Damsky CH, Fisher SJ. Plasma membraneassociated pY397FAK is a marker of cytotrophoblast invasion in vivo and in vitro. Am J Pathol 2001; 159:93108.

PAGE 162

162 76. Xie H, Tranguch S, Jia X, Zhang H, Das SK, Dey SK, Kuo CJ, Wang H. Inactivation of nuclear Wnt betacatenin signaling limits blastocyst competency for implantation. Development 2008; 135:717727. 77. Wang H, Guo Y, Wang D, Kingsley PJ, Marnett LJ, Das SK, DuBois RN, Dey SK. Aberrant cannabinoid signaling impairs oviductal transport of embryos. Nat Med 2004; 10:10741080. 78. Wang H, Matsumoto H, Guo Y, Paria BC, Roberts RL, Dey SK. Differential G proteincoupled cannabinoid receptor signaling by anandamide directs blastocyst activation for implantation. Proc Natl Acad Sci U S A 2003; 100:1491414919. 79. Johnson GA, Bazer FW, Jaeger LA, Ka H, Garlow JE, Pfarrer C, S pencer TE, Burghardt RC. Muc 1, integrin, and osteopontin expression during the implantation cascade in sheep. Biol Reprod 2001; 65:820828. 80. Ushizawa K, Herath CB, Kaneyama K, Shiojima S, Hirasawa A, Takahashi T, Imai K, Ochiai K, Tokunaga T, Tsunoda Y, Tsujimoto G, Hashizume K. cDNA microarray analysis of bovine embryo gene expression profiles during the preimplantation period. Reprod Biol Endocrinol 2004; 2:77. 81. Lessey BA. Adhesion molecules and implantation. J Reprod Immunol 2002; 55:101112. 82. Aplin JD. Adhesion molecules in implantation. Rev Reprod 1997; 2:8493. 83. Hannan NJ, Salamonsen LA. CX3CL1 and CCL14 regulate extracellular matrix and adhesion molecules in the trophoblast: potential roles in human embryo implantation. Biol Reprod 2008; 79:5865. 84. Burghardt RC, Burghardt JR, Taylor JD, 2nd, Reeder AT, Nguen BT, Spencer TE, Bayless KJ, Johnson GA. Enhanced focal adhesion assembly reflects increased mechanosensation and mechanotransduction at maternal conceptus interface and uterine wall during ovine pregnancy. Reproduction 2009; 137:567582. 85. Benirschke K. Remarkable placenta. Clin Anat 1998; 11:194205. 86. Moffett A, Loke C. Immunology of placentation in eutherian mammals. Nat Rev Immunol 2006; 6:584594. 87. Mess A, Carter AM. Evolution of the placenta during the early radiation of placental mammals. Comp Biochem Physiol A Mol Integr Physiol 2007; 148:769779.

PAGE 163

163 88. Schlafer DH, Fisher PJ, Davies CJ. The bovine placenta before and after birth: placental development and funct ion in health and disease. Anim Reprod Sci 2000; 6061:145160. 89. Elsik CG, Tellam RL, Worley KC, Gibbs RA, Muzny DM, Weinstock GM, Adelson DL, Eichler EE, Elnitski L, Guigo R, Hamernik DL, Kappes SM, et al. The genome sequence of taurine cattle: a window to ruminant biology and evolution. Science 2009; 324:522528. 90. Xie D, Chen CC, Ptaszek LM, Xiao S, Cao X, Fang F, Ng HH, Lewin HA, Cowan C, Zhong S. Rewirable gene regulatory networks in the preimplantation embryonic development of three mammali an species. Genome Res 2010; 20:804815. 91. Amoroso EC. The evolution of viviparity. Proc R Soc Med 1968; 61:11881200. 92. Kurman RJ. The morphology, biology, and pathology of intermediate trophoblast: a look back to the present. Hum Pathol 1991; 22:847 855. 93. Bielinska M, Narita N, Wilson DB. Distinct roles for visceral endoderm during embryonic mouse development. Int J Dev Biol 1999; 43:183205. 94. Rossant J. Stem cells and lineage development in the mammalian blastocyst. Reprod Fertil Dev 2007; 19:111118. 95. Dietrich JE, Hiiragi T. Stochastic patterning in the mouse preimplantation embryo. Development 2007; 134:42194231. 96. ZernickaGoetz M. First cell fate decisions and spatial patterning in the early mouse embryo. Semin Cell Dev Biol 2004; 15:563572. 97. ZernickaGoetz M. The first cell fate decisions in the mouse embryo: destiny is a matter of both chance and choice. Curr Opin Genet Dev 2006; 16:406412. 98. Fleming TP, Pickering SJ. Maturation and polarization of the endocytotic syst em in outside blastomeres during mouse preimplantation development. J Embryol Exp Morphol 1985; 89:175208. 99. Louvet S, Aghion J, SantaMaria A, Mangeat P, Maro B. Ezrin becomes restricted to outer cells following asymmetrical division in the preimplant ation mouse embryo. Dev Biol 1996; 177:568579. 100. Plusa B, Frankenberg S, Chalmers A, Hadjantonakis AK, Moore CA, Papalopulu N, Papaioannou VE, Glover DM, ZernickaGoetz M. Downregulation of Par3 and aPKC function directs cells towards the ICM in the preimplantation mouse embryo. J Cell Sci 2005; 118:505515.

PAGE 164

164 101. Vinot S, Le T, Ohno S, Pawson T, Maro B, Louvet Vallee S. Asymmetric distribution of PAR proteins in the mouse embryo begins at the 8cell stage during compaction. Dev Biol 2005; 282:307319. 102. Joberty G, Petersen C, Gao L, Macara IG. The cell polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat Cell Biol 2000; 2:531539. 103. Ohno S. Intercellular junctions and cellular polarity: the PAR aPKC complex, a conserved core cassette playing fundamental roles in cell polarity. Curr Opin Cell Biol 2001; 13:641648. 104. Plusa B, Piliszek A, Frankenberg S, Artus J, Hadjantonakis AK. Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blastocyst. Development 2008; 135:30813091. 105. Stephenson RO, Yamanaka Y, Rossant J. Disorganized epithelial polarity and excess trophectoderm cell fate in preimplantation embryos lacking E cadherin. Development 2010. 106. Strumpf D, Mao CA, Yamanaka Y, Ral ston A, Chawengsaksophak K, Beck F, Rossant J. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 2005; 132:20932102. 107. Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, Rossant J. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 2005; 132:20932102. 108. Niwa H, Toyooka T, Shimosato D, Strumpf D, Takahashi K, Yagi R, Rossant J. I nteraction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 2005; 123:917929. 109. Nishioka N, Yamamoto S, Kiyonari H, Sato H, Sawada A, Ota M, Nakao K, Sasaki H. Tead4 is required for specification of trophectoderm in preimplantat ion mouse embryos. Mech Dev 2008; 125:270283. 110. Yagi R, Kohn MJ, Karavanova I, Kaneko KJ, Vullhorst D, DePamphilis ML, Buonanno A. Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development. Development 2007; 134:38273836. 111. Nishioka N, Inoue K, Adachi K, Kiyonari H, Ota M, Ralston A, Yabuta N, Hirahara S, Stephenson RO, Ogonuki N, Makita R, Kurihara H, et al. The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Dev Cell 2009; 16:398410.

PAGE 165

165 112. Nishioka N, Inoue K, Adachi K, Kiyonari H, Ota M, Ralston A, Yabuta N, Hirahara S, Stephenson RO, Ogonuki N, Makita R, Kurihara H, et al. The Hippo Signaling Pathway Components Lats and Yap Pattern Tead4 Activity to Distinguish Mouse Trophectoderm from Inner Cell Mass. Developmental Cell 2009; 16:398410. 113. Zhao B, Ye X, Yu J, Li L, Li W, Li S, Lin JD, Wang CY, Chinnaiyan AM, Lai ZC, Guan KL. TEAD mediates YAP dependent gene induct ion and growth control. Genes Dev 2008; 22:19621971. 114. Ralston A, Cox BJ, Nishioka N, Sasaki H, Chea E, Rugg Gunn P, Guo G, Robson P, Draper JS, Rossant J. Gata3 regulates trophoblast development downstream of Tead4 and in parallel to Cdx2. Development 2010; 137:395403. 115. Home P, Ray S, Dutta D, Bronshteyn I, Larson M, Paul S. GATA3 Is Selectively Expressed in the Trophectoderm of Peri implantation Embryo and Directly Regulates Cdx2 Gene Expression. Journal of Biological Chemistry 2009; 284:2872928737. 116. Lu CW, Yabuuchi A, Chen L, Viswanathan S, Kim K, Daley GQ. Ras MAPK signaling promotes trophectoderm formation from embryonic stem cells and mouse embryos. Nat Genet 2008; 40:921926. 117. Parks JC, McCallie BR, Janesch AM, Schoolcr aft WB, Katz Jaffe MG. Blastocyst gene expression correlates with implantation potential. Fertil Steril. 2010: doi:10.1016/j.fertnstert.2010.08.009. 118. ElSayed A, Hoelker M, Rings F, Salilew D, Jennen D, Tholen E, Sirard MA, Schellander K, Tesfaye D. Largescale transcriptional analysis of bovine embryo biopsies in relation to pregnancy success after transfer to recipients. Physiol Genomics 2006; 28:8496. 119. Hughes M, Dobr ic N, Scott IC, Su L, Starovic M, St Pierre B, Egan SE, Kingdom JC, Cross JC. The Hand1, Stra13 and Gcm1 transcription factors override FGF signaling to promote terminal differentiation of trophoblast stem cells. Dev Biol 2004; 271:2637. 120. Cross JC, B aczyk D, Dobric N, Hemberger M, Hughes M, Simmons DG, Yamamoto H, Kingdom JC. Genes, development and evolution of the placenta. Placenta 2003; 24:123130. 121. Ullah Z, Kohn MJ, Yagi R, Vassilev LT, DePamphilis ML. Differentiation of trophoblast stem cell s into giant cells is triggered by p57/Kip2 inhibition of CDK1 activity. Genes Dev 2008; 22:30243036.

PAGE 166

166 122. Yan J, Tanaka S, Oda M, Makino T, Ohgane J, Shiota K. Retinoic acid promotes differentiation of trophoblast stem cells to a giant cell fate. Dev Bi ol 2001; 235:422432. 123. Morgan G, Wooding FB, Godkin JD. Localization of bovine trophoblast protein1 in the cow blastocyst during implantation: an immunological cryoultrastructural study. Placenta 1993; 14:641649. 124. Adamson SL, Lu Y, Whiteley KJ, Holmyard D, Hemberger M, Pfarrer C, Cross JC. Interactions between trophoblast cells and the maternal and fetal circulation in the mouse placenta. Dev Biol 2002; 250:358373. 125. Pennington KA, Oliveira LJ, Yang QE, Ealy AD. The enrichment of trophoblas t giant cells from midgestation bovine placentae using fluorescenceactivated cell sorting. Placenta 2010; 31:738740. 126. Loh YH, Wu Q, Chew JL, Vega VB, Zhang W, Chen X, Bourque G, George J, Leong B, Liu J, Wong KY, Sung KW, et al. The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet 2006; 38:431440. 127. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe Nebenius D, Chambers I, Scholer H, Smith A. Formation of pluripotent stem cells in the mammali an embryo depends on the POU transcription factor Oct4. Cell 1998; 95:379391. 128. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct 3/4 defines differentiation, dedifferentiation or self renewal of ES cells. Nat Genet 2000; 24:372376. 129. Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003; 113:631642. 130. Silva J, Nichols J, Theunissen TW, Guo G, van Oosten AL, Barrandon O, Wray J, Yamanaka S, Chambers I, Smith A. Nanog is the gateway to the pluripotent ground state. Cell 2009; 138:722737. 131. Talbot NC, Blomberg le A. The pursuit of ES cell lines of domesticated ungulates. Stem Cell Rev 2008; 4:235254. 132. Keefer CL, Pant D, Blomberg L, Talbot NC. Challenges and prospects for the establishment of embryonic stem cell lines of domesticated ungulates. Anim Reprod Sci 2007; 98:147168.

PAGE 167

167 133. Morrisey EE, Ip HS, Lu MM, Parmacek MS. GA TA 6: a zinc finger transcription factor that is expressed in multiple cell lineages derived from lateral mesoderm. Dev Biol 1996; 177:309322. 134. Narita N, Bielinska M, Wilson DB. Wild type endoderm abrogates the ventral developmental defects associated with GATA4 deficiency in the mouse. Dev Biol 1997; 189:270274. 135. Koutsourakis M, Langeveld A, Patient R, Beddington R, Grosveld F. The transcription factor GATA6 is essential for early extraembryonic development. Development 1999; 126:723732. 136. Fujikura J, Yamato E, Yonemura S, Hosoda K, Masui S, Nakao K, Miyazaki Ji J, Niwa H. Differentiation of embryonic stem cells is induced by GATA factors. Genes Dev 2002; 16:784789. 137. Shimosato D, Shiki M, Niwa H. Extra embryonic endoderm cells der ived from ES cells induced by GATA factors acquire the character of XEN cells. BMC Dev Biol 2007; 7:80. 138. Singh AM, Hamazaki T, Hankowski KE, Terada N. A heterogeneous expression pattern for Nanog in embryonic stem cells. Stem Cells 2007; 25:25342542. 139. CapoChichi CD, Rula ME, Smedberg JL, Vanderveer L, Parmacek MS, Morrisey EE, Godwin AK, Xu XX. Perception of differentiation cues by GATA factors in primitive endoderm lineage determination of mouse embryonic stem cells. Dev Biol 2005; 286:574586. 140. Arman E, Haffner Krausz R, Chen Y, Heath JK, Lonai P. Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad Sci U S A 1998; 95:50825087. 141. Li L, Arman E, Ekblom P, Edgar D, Murray P, Lonai P. Distinct GATA6and laminin dependent mechanisms regulate endodermal and ectodermal embryonic stem cell fates. Development 2004; 131:52775286. 142. Hamazaki T, Kehoe SM, Nakano T, Terada N. The Grb2/Mek pathway represses Nanog in murine embryonic stem cells. Mol Cell Biol 2006; 26:75397549. 143. Nichols J, Silva J, Roode M, Smith A. Suppression of Erk signalling promotes ground state pluripotency in the mouse embryo. Development 2009; 136:32153222.

PAGE 168

168 144. Yamanaka Y, Lanner F, Rossant J. FGF signal dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development 2010; 137:715724. 145. Artus J, Panthier JJ, Hadjantonakis AK. A role for PDGF signaling in expansion of the ex tra embryonic endoderm lineage of the mouse blastocyst. Development 2010; 137:33613372. 146. Smith KN, Singh AM, Dalton S. Myc represses primitive endoderm differentiation in pluripotent stem cells. Cell Stem Cell 2010; 7:343354. 147. Gardner RL. Origi n and differentiation of extraembryonic tissues in the mouse. Int Rev Exp Pathol 1983; 24:63133. 148. Janzen RG, Mably ER, Tamaoki T, Church RB, Lorscheider FL. Synthesis of alphafetoprotein by the preimplantation and post implantation bovine embryo. J Reprod Fertil 1982; 65:105110. 149. Russe I, Sinowatz F, Richter L, Lehmann M, Schallenberger E. The development of the yolk sac in ruminants (sheep and cattle). Anat Histol Embryol 1992; 21:324347. 150. Talbot NC, Caperna TJ, Edwards JL, Garrett W, W ells KD, Ealy AD. Bovine blastocyst derived trophectoderm and endoderm cell cultures: interferon tau and transferrin expression as respective in vitro markers. Biol Reprod 2000; 62:235247. 151. Vejlsted M, Du Y, Vajta G, Maddox Hyttel P. Post hatching development of the porcine and bovine embryo--defining criteria for expected development in vivo and in vitro. Theriogenology 2006; 65:153165. 152. Yamanaka Y, Ralston A, Stephenson RO, Rossant J. Cell and molecular regulation of the mouse blastocyst. Dev Dyn 2006; 235:23012314. 153. Kuijk EW, Du Puy L, Van Tol HT, Oei CH, Haagsman HP, Colenbrander B, Roelen BA. Differences in early lineage segregation between mammals. Dev Dyn 2008; 237:918927. 154. Li S, Li Y, Du W, Zhang L, Yu S, Dai Y, Zhao C, Li N. Aberrant gene expression in organs of bovine clones that die within two days after birth. Biol Reprod 2005; 72:258265. 155. Farin PW, Piedrahita JA, Farin CE. Errors in development of fetuses and placentas from in vitro produced bovine embryos. Theriogen ology 2006; 65:178191.

PAGE 169

169 156. Arnold DR, Bordignon V, Lefebvre R, Murphy BD, Smith LC. Somatic cell nuclear transfer alters peri implantation trophoblast differentiation in bovine embryos. Reproduction 2006; 132:279290. 157. Arnold DR, Fortier AL, Lefebvre R, Miglino MA, Pfarrer C, Smith LC. Placental insufficiencies in cloned animals a workshop report. Placenta 2008; 29 Suppl A:S108 110. 158. Hashizume K, Ishiwata H, Kizaki K, Yamada O, Takahashi T, Imai K, Patel OV, Akagi S, Shimizu M, Takahash i S, Katsuma S, Shiojima S, et al. Implantation and placental development in somatic cell clone recipient cows. Cloning Stem Cells 2002; 4:197209. 159. de Ziegler D, Fanchin R, de Moustier B, Bulletti C. The hormonal control of endometrial receptivity: estrogen (E2) and progesterone. J Reprod Immunol 1998; 39:149166. 160. Martal J, Lacroix MC, Loudes C, Saunier M, Wintenberger Torres S. Trophoblastin, an antiluteolytic protein present in early pregnancy in sheep. J Reprod Fertil 1979; 56:6373. 161. Mo or RM, Rowson LE. Local maintenance of the corpus luteum in sheep with embryos transferred to various isolated portions of the uterus. J Reprod Fertil 1966; 12:539550. 162. Martal J. Control of luteal function during early pregnancy in sheep. J Reprod Fertil Suppl 1981; 30:201210. 163. Godkin JD, Bazer FW, Roberts RM. Ovine trophoblast protein 1, an early secreted blastocyst protein, binds specifically to uterine endometrium and affects protein synthesis. Endocrinology 1984; 114:120130. 164. Helmer SD Hansen PJ, Anthony RV, Thatcher WW, Bazer FW, Roberts RM. Identification of bovine trophoblast protein1, a secretory protein immunologically related to ovine trophoblast protein1. J Reprod Fertil 1987; 79:8391. 165. Imakawa K, Anthony RV, Kazemi M, M arotti KR, Polites HG, Roberts RM. Interferon like sequence of ovine trophoblast protein secreted by embryonic trophectoderm. Nature 1987; 330:377379. 166. Charpigny G, Reinaud P, Huet JC, Guillomot M, Charlier M, Pernollet JC, Martal J. High homology between a trophoblastic protein (trophoblastin) isolated from ovine embryo and alphainterferons. FEBS Lett 1988; 228:1216.

PAGE 170

170 167. Xiao CW, Liu JM, Sirois J, Goff AK. Regulation of cyclooxygenase 2 and prostaglandin F synthase gene expression by steroid horm ones and interferontau in bovine endometrial cells. Endocrinology 1998; 139:22932299. 168. Thatcher WW, Bazer FW, Sharp DC, Roberts RM. Interrelationships between uterus and conceptus to maintain corpus luteum function in early pregnancy: sheep, cattle, pigs and horses. J Anim Sci 1986; 62 Suppl 2:2546. 169. Helmer SD, Hansen PJ, Thatcher WW, Johnson JW, Bazer FW. Intrauterine infusion of highly enriched bovine trophoblast protein1 complex exerts an antiluteolytic effect to extend corpus luteum lifespan in cyclic cattle. J Reprod Fertil 1989; 87:89101. 170. Binelli M, Subramaniam P, Diaz T, Johnson GA, Hansen TR, Badinga L, Thatcher WW. Bovine interferontau stimulates the Janus kinasesignal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol Reprod 2001; 64:654665. 171. Asselin E, Drolet P, Fortier MA. Cellular mechanisms involved during oxytocininduced prostaglandin F2alpha production in endometrial epithelial cells in vitro: role of cyclooxygenase2. Endocrinology 1997; 138:47984805. 172. Spencer TE, Bazer FW. Ovine interferon tau suppresses transcription of the estrogen receptor and oxytocin receptor genes in the ovine endometrium. Endocrinology 1996; 137:11441147. 173. Arosh JA, Banu SK, Kimmins S, Chapdelaine P, Maclaren LA, Fortier MA. Effect of interferon tau on prostaglandin biosynthesis, transport, and signaling at the time of maternal recognition of pregnancy in cattle: evidence of polycrine actions of prostaglandin E2. Endocrinology 2004; 145:52805293. 174. Chen Y, Green JA, Antoniou E, Ealy AD, Mathialagan N, Walker AM, Avalle MP, Rosenfeld CS, Hearne LB, Roberts RM. Effect of interferontau administration on endometrium of nonpregnant ewes: a comparison with pregnant ewes. Endocrinology 2006; 147:21272137. 175. Kim S, Choi Y, Bazer FW, Spencer TE. Identification of genes in the ovine endometrium regulated by interferon tau independent of signal transducer and activator of transcription 1. Endocrinology 2003; 144:52035214. 176. Hayashi K, Burghardt RC, Bazer FW, Spencer TE. WNTs in the ovine uterus: potential regulation of periimplantation ovine conceptus development. Endocrinology 2007; 148:34963506.

PAGE 171

171 177. Gao H, Wu G, Spencer TE, Johnson GA, Bazer FW. Select nutrients in the ovine ut erine lumen. ii. glucose transporters in the uterus and peri implantation conceptuses. Biol Reprod 2009; 80:94104. 178. Gao H, Wu G, Spencer TE, Johnson GA, Li X, Bazer FW. Select nutrients in the ovine uterine lumen. I. Amino acids, glucose, and ions in uterine lumenal flushings of cyclic and pregnant ewes. Biol Reprod 2009; 80:8693. 179. Bott RC, Ashley RL, Henkes LE, Antoniazzi AQ, Bruemmer JE, Niswender GD, Bazer FW, Spencer TE, Smirnova NP, Anthony RV, Hansen TR. Uterine vein infusion of interferon tau (IFNT) extends luteal life span in ewes. Biol Reprod 2010; 82:725735. 180. Oliveira JF, Henkes LE, Ashley RL, Purcell SH, Smirnova NP, Veeramachaneni DN, Anthony RV, Hansen TR. Expression of interferon (IFN) stimulated genes in extrauterine tissues during early pregnancy in sheep is the consequence of endocrine IFN tau release from the uterine vein. Endocrinology 2008; 149:12521259. 181. Demmers KJ, Derecka K, Flint A. Trophoblast interferon and pregnancy. Reproduction 2001; 121:4149. 182. Robinson RS, Fray MD, Wathes DC, Lamming GE, Mann GE. In vivo expression of interferon tau mRNA by the embryonic trophoblast and uterine concentrations of interferon tau protein during early pregnancy in the cow. Mol Reprod Dev 2006; 73:470474. 183. Cros s JC, Roberts RM. Constitutive and trophoblast specific expression of a class of bovine interferon genes. Proc Natl Acad Sci U S A 1991; 88:38173821. 184. Yamamoto H, Flannery ML, Kupriyanov S, Pearce J, McKercher SR, Henkel GW, Maki RA, Werb Z, Oshima R G. Defective trophoblast function in mice with a targeted mutation of Ets2. Genes Dev 1998; 12:13151326. 185. Wen F, Tynan JA, Cecena G, Williams R, Munera J, Mavrothalassitis G, Oshima RG. Ets2 is required for trophoblast stem cell self renewal. Dev Biol 2007; 312:284299. 186. Ezashi T, Ealy AD, Ostrowski MC, Roberts RM. Control of interferon tau gene expression by Ets 2. Proc Natl Acad Sci U S A 1998; 95:78827887. 187. MatsudaMinehata F, Katsumura M, Kijima S, Christenson RK, Imakawa K. Differen t levels of ovine interferontau gene expressions are regulated through the short promoter region including Ets 2 binding site. Mol Reprod Dev 2005; 72:715.

PAGE 172

172 188. Yamaguchi H, Ikeda Y, Moreno JI, Katsumura M, Miyazawa T, Takahashi E, Imakawa K, Sakai S, Christenson RK. Identification of a functional transcriptional factor AP 1 site in the sheep interferon tau gene that mediates a response to PMA in JEG3 cells. Biochemical Journal 1999; 340:767773. 189. Xavier F, Lagarrigue S, Guillomot M, GaillardSanchez I. Expression of c fos and jun protooncogenes in ovine trophoblasts in relation to interferontau expression and early implantation process. Mol Reprod Dev 1997; 46:127137. 190. Imakawa K, Kim MS, Matsuda Minehata F, Ishida S, Iizuka M, Suzuki M, Chang KT, Echternkamp SE, Christenson RK. Regulation of the ovine interferontau gene by a blastocyst specific transcription factor, Cdx2. Mol Reprod Dev 2006; 73:559567. 191. Sakurai T, Sakamoto A, Muroi Y, Bai H, Nagaoka K, Tamura K, Takahashi T, Hashizume K, Sakatani M, Takahashi M, Godkin JD, Imakawa K. Induction of endogenous interferon tau gene transcription by CDX2 and high acetylation in bovine nontrophoblast cells. Biol Reprod 2009; 80:12231231. 192. Bai H, Sakurai T, Kim MS, Muroi Y, Ideta A, Aoyag i Y, Nakajima H, Takahashi M, Nagaoka K, Imakawa K. Involvement of GATA transcription factors in the regulation of endogenous bovine interferontau gene transcription. Mol Reprod Dev 2009; 76:11431152. 193. Morasso MI, Grinberg A, Robinson G, Sargent TD, Mahon KA. Placental failure in mice lacking the homeobox gene Dlx3. Proc Natl Acad Sci U S A 1999; 96:162167. 194. Ezashi T, Das P, Gupta R, Walker A, Roberts RM. The role of homeobox protein distal less 3 and its interaction with ETS2 in regulating bov ine interferontau gene expression synergistic transcriptional activation with ETS2. Biol Reprod 2008; 79:115124. 195. van Eijk MJ, van Rooijen MA, Modina S, Scesi L, Folkers G, van Tol HT, Bevers MM, Fisher SR, Lewin HA, Rakacolli D, Galli C, de Vaureix C, et al. Molecular cloning, genetic mapping, and developmental expression of bovine POU5F1. Biol Reprod 1999; 60:10931103. 196. Ezashi T, Ghosh D, Roberts RM. Repression of Ets 2 induced transactivation of the tau interferon promoter by Oct 4. Mol Cell Biol 2001; 21:78837891. 197. Ezashi T, Roberts RM. Regulation of interferontau (IFN tau) gene promoters by growth factors that target the Ets 2 composite enhancer: a possible model for maternal control of IFN tau production by the conceptus during earl y pregnancy. Endocrinology 2004; 145:44524460.

PAGE 173

173 198. Murohashi M, Nakamura T, Tanaka S, Ichise T, Yoshida N, Yamamoto T, Shibuya M, Schlessinger J, Gotoh N. An FGF4FRS2alpha Cdx2 axis in trophoblast stem cells induces Bmp4 to regulate proper growth of early mouse embryos. Stem Cells 2010; 28:113121. 199. Das P, Ezashi T, Gupta R, Roberts RM. Combinatorial roles of protein kinase A, Ets2, and 3',5'cyclicadenosine monophosphate response element binding proteinbinding protein/p300 in the transcriptional control of interferontau expression in a trophoblast cell line. Mol Endocrinol 2008; 22:331343. 200. Imakawa K, Carlson KD, McGuire WJ, Christenson RK, Taylor A. Enhancement of ovine trophoblast interferon by granulocyte macrophagecolony stimulating f actor: possible involvement of protein kinase C. J Mol Endocrinol 1997; 19:121130. 201. Griner EM, Kazanietz MG. Protein kinase C and other diacylglycerol effectors in cancer. Nat Rev Cancer 2007; 7:281294. 202. Eckert JJ, McCallum A, Mears A, Rumsby MG, Cameron IT, Fleming TP. Specific PKC isoforms regulate blastocoel formation during mouse preimplantation development. Dev Biol 2004; 274:384401. 203. Eckert JJ, McCallum A, Mears A, Rumsby MG, Cameron IT, Fleming TP. Relative contribution of cell cont act pattern, specific PKC isoforms and gap junctional communication in tight junction assembly in the mouse early embryo. Dev Biol 2005; 288:234247. 204. Gray CA, Taylor KM, Ramsey WS, Hill JR, Bazer FW, Bartol FF, Spencer TE. Endometrial glands are required for preimplantation conceptus elongation and survival. Biol Reprod 2001; 64:16081613. 205. Bartol FF, Johnson LL, Floyd JG, Wiley AA, Spencer TE, Buxton DF, Coleman DA. Neonatal exposure to progesterone and estradiol alters uterine morphology and luminal protein content in adult beef heifers. Theriogenology 1995; 43:835844. 206. Gray CA, Bazer FW, Spencer TE. Effects of neonatal progestin exposure on female reproductive tract structure and function in the adult ewe. Biol Reprod 2001; 64:797804. 2 07. Prelle K, Stojkovic M, Boxhammer K, Motlik J, Ewald D, Arnold GJ, Wolf E. Insulin like growth factor I (IGF I) and long R(3)IGF I differently affect development and messenger ribonucleic acid abundance for IGFbinding proteins and type I IGF receptors in in vitro produced bovine embryos. Endocrinology 2001; 142:13091316.

PAGE 174

174 208. Sirisathien S, Brackett BG. TUNEL analyses of bovine blastocysts after culture with EGF and IGFI. Mol Reprod Dev 2003; 65:5156. 209. Jousan FD, Hansen PJ. Insulinlike growth factor I as a survival factor for the bovine preimplantation embryo exposed to heat shock. Biol Reprod 2004; 71:16651670. 210. Robertson SA. GM CSF regulation of embryo development and pregnancy. Cytokine Growth Factor Rev 2007; 18:287298. 211. Neira J A, Tainturier D, Pena MA, Martal J. Effect of the association of IGFI, IGF II, bFGF, TGFbeta1, GM CSF, and LIF on the development of bovine embryos produced in vitro. Theriogenology 2010; 73:595604. 212. Larson RC, Ignotz GG, Currie WB. Transforming gr owth factor beta and basic fibroblast growth factor synergistically promote early bovine embryo development during the fourth cell cycle. Mol Reprod Dev 1992; 33:432435. 213. Paria BC, Dey SK. Preimplantation embryo development in vitro: cooperative interactions among embryos and role of growth factors. Proc Natl Acad Sci U S A 1990; 87:47564760. 214. Parsons JT, Horwitz AR, Schwartz MA. Cell adhesion: integrating cytoskeletal dynamics and cellular tension. Nat Rev Mol Cell Biol 2010; 11:633643. 215. Vicente Manzanares M, Choi CK, Horwitz AR. Integrins in cell migration--the actin connection. J Cell Sci 2009; 122:199206. 216. Damsky CH, Librach C, Lim KH, Fitzgerald ML, Mc Master MT, Janatpour M, Zhou Y, Logan SK, Fisher SJ. Integrin switching regulates normal trophoblast invasion. Development 1994; 120:36573666. 217. Jiang G, Giannone G, Critchley DR, Fukumoto E, Sheetz MP. Twopiconewton slip bond between fibronectin and the cytoskeleton depends on talin. Nature 2003; 424:334337. 218. Farmer JL, Burghardt RC, Jousan FD, Hansen PJ, Bazer FW, Spencer TE. Galectin 15 (LGALS15) functions in trophectoderm migration and attachment. FASEB J 2008; 22:548560. 219. Kim J, Eriks on DW, Burghardt RC, Spencer TE, Wu G, Bayless KJ, Johnson GA, Bazer FW. Secreted phosphoprotein 1 binds integrins to initiate multiple cell signaling pathways, including FRAP1/mTOR, to support attachment and forcegenerated migration of trophectoderm cell s. Matrix Biol 2010; 29:369382.

PAGE 175

175 220. Pfarrer C, Hirsch P, Guillomot M, Leiser R. Interaction of integrin receptors with extracellular matrix is involved in trophoblast giant cell migration in bovine placentomes. Placenta 2003; 24:588597. 221. Goossens K, Van Soom A, Van Zeveren A, Favoreel H, Peelman LJ. Quantification of fibronectin 1 (FN1) splice variants, including two novel ones, and analysis of integrins as candidate FN1 receptors in bovine preimplantation embryos. BMC Dev Biol 2009; 9:1. 222. Mac Laren LA, Wildeman AG. Fibronectin receptors in preimplantation development: cloning, expression, and localization of the alpha 5 and beta 1 integrin subunits in bovine trophoblast. Biol Reprod 1995; 53:153165. 223. Kim J, Song G, Gao H, Farmer JL, Satte rfield MC, Burghardt RC, Wu G, Johnson GA, Spencer TE, Bazer FW. Insulinlike growth factor II activates phosphatidylinositol 3kinaseprotooncogenic protein kinase 1 and mitogenactivated protein kinase cell Signaling pathways, and stimulates migration of ovine trophectoderm cells. Endocrinology 2008; 149:30853094. 224. Kubisch HM, Larson MA, Kiesling DO. Control of interferontau secretion by in vitro derived bovine blastocysts during extended culture and outgrowth formation. Mol Reprod Dev 2001; 58:390397. 225. Gray CA, Burghardt RC, Johnson GA, Bazer FW, Spencer TE. Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction 2002; 124:289300. 226. Imakawa K, Helmer SD, Nephew KP, Meka CS, Christenson RK. A novel role for GMCSF: enhancement of pregnancy specific interferon production, ovine trophoblast protein1. Endocrinology 1993; 132:18691871. 227. Ko Y, Lee CY, Ott TL, Davis MA, Simmen RC, Bazer FW, Simmen FA. Insulin like growth factors in sheep uterine fluids: concentrations and relationship to ovine trophoblast protein1 production during early pregnancy. Biol Reprod 1991; 45:135142. 228. Villega s SN, Canham M, Brickman JM. FGF signalling as a mediator of lineage transitions --evidence from embryonic stem cell differentiation. J Cell Biochem 2010; 110:1020. 229. Daniels R, Hall V, Trounson AO. Analysis of gene transcription in bovine nuclear tran sfer embryos reconstructed with granulosa cell nuclei. Biol Reprod 2000; 63:10341040.

PAGE 176

176 230. Turner N, Grose R. Fibroblast growth factor signalling: from development to cancer. Nat Rev Cancer 2010; 10:116129. 231. Chellaiah AT, McEwen DG, Werner S, Xu J, Ornitz DM. Fibroblast growth factor receptor (FGFR) 3. Alternative splicing in immunoglobulinlike domain III creates a receptor highly specific for acidic FGF/FGF 1. J Biol Chem 1994; 269:1162011627. 232. Ito M, Matsui T, Taniguchi T, Chihara K. Alternative splicing generates two distinct transcripts for the Drosophila melanogaster fibroblast growth factor receptor homolog. Gene 1994; 139:215218. 233. Pfarrer C, Weise S, Berisha B, Schams D, Leiser R, Hoffmann B, Schuler G. Fibroblast growth factor (FGF) 1, FGF2, FGF7 and FGF receptors are uniformly expressed in trophoblast giant cells during restricted trophoblast invasion in cows. Placenta 2006; 27:758770. 234. Spencer TE, Burghardt RC, Johnson GA, Bazer FW. Conceptus signals for establishment and maintenance of pregnancy. Anim Reprod.Sci. 2004; 8283:537550. 235. Asselin E, Bazer FW, Fortier MA. Recombinant ovine and bovine interferons tau regulate prostaglandin production and oxytocin response in cultured bovine endometrial cells. Biol Reprod 19 97; 56:402408. 236. Bazer FW, Spencer TE, Johnson GA. Interferons and uterine receptivity. Semin Reprod Med 2009; 27:90102. 237. Kim S, Choi Y, Bazer FW, Spencer TE. Identification of genes in the ovine endometrium regulated by interferon tau independe nt of signal transducer and activator of transcription 1. Endocrinology 2003; 144:52035214. 238. Gao H, Wu G, Spencer TE, Johnson GA, Bazer FW. Select Nutrients in the Ovine Uterine Lumen. IV. Expression of Neutral and Acidic Amino Acid Transporters in O vine Uteri and Periimplantation Conceptuses. Biol Reprod 2009. 239. Gifford CA, Assiri AM, Satterfield MC, Spencer TE, Ott TL. Receptor transporter protein 4 (RTP4) in endometrium, ovary, and peripheral blood leukocytes of pregnant and cyclic ewes. Biol R eprod 2008; 79:518524. 240. Gifford CA, Racicot K, Clark DS, Austin KJ, Hansen TR, Lucy MC, Davies CJ, Ott TL. Regulation of interferonstimulated genes in peripheral blood leukocytes in pregnant and bred, nonpregnant dairy cows. J.Dairy Sci. 2007; 90:274 280.

PAGE 177

177 241. Bott RC, Ashley RL, Henkes LE, Antoniazzi AQ, Bruemmer JE, Niswender GD, Bazer FW, Spencer TE, Smirnova NP, Anthony RV, Hansen TR. Uterine vein infusion of interferon tau (IFNT) extends luteal life span in ewes. Biol Reprod; 82:725735. 242. Thatcher WW, Guzeloglu A, Mattos R, Binelli M, Hansen TR, Pru JK. Uterineconceptus interactions and reproductive failure in cattle. Theriogenology 2001; 56:14351450. 243. Inskeep EK, Dailey RA. Embryonic death in cattle. Vet.Clin.North Am.Food Anim Pra ct. 2005; 21:437461. 244. Wrenzycki C, Herrmann D, Niemann H. Timing of blastocyst expansion affects spatial messenger RNA expression patterns of genes in bovine blastocysts produced in vitro. Biology of Reproduction 2003; 68:20732080. 245. Kubisch HM, Larson MA, Roberts RM. Relationship between age of blastocyst formation and interferontau secretion by in vitroderived bovine embryos. Mol.Reprod.Dev. 1998; 49:254260. 246. Ealy AD, Larson SF, Liu L, Alexenko AP, Winkelman GL, Kubisch HM, Bixby JA, Ro berts RM. Polymorphic forms of expressed bovine interferontau genes: relative transcript abundance during early placental development, promoter sequences of genes and biological activity of protein products. Endocrinology 2001; 142:29062915. 247. Robins on RS, Fray MD, Wathes DC, Lamming GE, Mann GE. In vivo expression of interferon tau mRNA by the embryonic trophoblast and uterine concentrations of interferon tau protein during early pregnancy in the cow. Mol.Reprod.Dev. 2006; 73:470474. 248. Xavier F, Lagarrigue S, Guillomot M, GaillardSanchez I. Expression of c fos and jun protooncogenes in ovine trophoblasts in relation to interferontau expression and early implantation process. Mol.Reprod.Dev. 1997; 46:127137. 249. Cross JC, Roberts RM. Constitu tive and trophoblast specific expression of a class of bovine interferon genes. Proc.Natl.Acad.Sci.U.S.A 1991; 88:38173821. 250. Leaman DW, Roberts RM. Genes for the trophoblast interferons in sheep, goat, and musk ox and distribution of related genes am ong mammals. J.Interferon Res. 1992; 12:111. 251. Itoh N. The Fgf families in humans, mice, and zebrafish: their evolutional processes and roles in development, metabolism, and disease. Biol Pharm Bull 2007; 30:18191825.

PAGE 178

178 252. Satterfield MC, Hayashi K, Song G, Black SG, Bazer FW, Spencer TE. Progesterone Regulates FGF10, MET, IGFBP1, and IGFBP3 in the Endometrium of the Ovine Uterus. Biol Reprod 2008. 253. Powers CJ, McLeskey SW, Wellstein A. Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer 2000; 7:165197. 254. Imakawa K, Carlson KD, McGuire WJ, Christenson RK, Taylor A. Enhancement of ovine trophoblast interferon by granulocyte macrophagecolony stimulating factor: possible involvement of protein kinase C. J.Mol.Endocrinol. 1997; 19:121130. 255. Yamaguchi H, Ikeda Y, Taylor A, Katsumura M, Miyazawa T, Takahashi E, Imakawa K, Sakai S. Effects of PMA and transcription factors on ovine interferontau transactivation in various cell lines. Endocr.J. 1999; 46:383388. 256. Talbot NC, Caperna TJ, Edwards JL, Garret t W, Wells KD, Ealy AD. Bovine blastocyst derived trophectoderm and endoderm cell cultures: interferon tau and transferrin expression as respective in vitro markers. Biol.Reprod. 2000; 62:235247. 257. Talbot NC, Powell AM, Camp M, Ealy AD. Establishment of a bovine blastocyst derived cell line collection for the comparative analysis of embryos created in vivo and by in vitro fertilization, somatic cell nuclear transfer, or parthenogenetic activation. In Vitro Cell Dev Biol Anim 2007; 43:5971. 258. Grand EK, Chase AJ, Heath C, Rahemtulla A, Cross NC. Targeting FGFR3 in multiple myeloma: inhibition of t(4;14) positive cells by SU5402 and PD173074. Leukemia 2004; 18:962966. 259. Rask Madsen C, King GL. Differential regulation of VEGF signaling by PKC alpha and PKC epsilon in endothelial cells. Arterioscler Thromb Vasc Biol 2008; 28:919924. 260. Sun Q, Zang WJ, Chen C. Growth hormone secretagogues reduce transient outward K+ current via phospholipase C/protein kinase C signaling pathway in rat ventricular myocytes. Endocrinology; 151:12281235. 261. Rotmann A, Simon A, Martine U, Habermeier A, Closs EI. Activation of classical protein kinase C decreases transport via systems y+ and y+L. Am J Physiol Cell Physiol 2007; 292:C22592268. 262. Peluso JJ, Pappalardo A, Fernandez G. Basic fibroblast growth factor maintains calcium homeostasis and granulosa cell viability by stimulating calcium efflux via a PKC delta dependent pathway. Endocrinology 2001; 142:42034211.

PAGE 179

179 263. Gschwendt M, Muller HJ, Kielbassa K, Zang R, Kittstein W, Rincke G, Marks F. Rottlerin, a novel protein kinase inhibitor. Biochem Biophys Res Commun 1994; 199:9398. 264. Staal RG, Hananiya A, Sulzer D. PKC theta activity maintains normal quantal size in chromaffin cells. J Neurochem 2008; 105:16351641. 265. Konishi H, Yamauchi E, Taniguchi H, Yamamoto T, Matsuzaki H, Takemura Y, Ohmae K, Kikkawa U, Nishizuka Y. Phosphorylation sites of protein kinase C delta in H2O2treated cells and its activation by tyrosine kinase in vitro. Proc Natl Ac ad Sci U S A 2001; 98:65876592. 266. Jackson TA, Schweppe RE, Koterwas DM, Bradford AP. Fibroblast growth factor activation of the rat PRL promoter is mediated by PKCdelta. Mol Endocrinol 2001; 15:15171528. 267. Kuriyama S, Mayor R. A role for Syndecan4 in neural induction involving ERK and PKC dependent pathways. Development 2009; 136:575584. 268. Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR. PD 098059 is a specific inhibitor of the activation of mitogenactivated protein kinase kinase in vitro and in vivo. J Biol Chem 1995; 270:2748927494. 269. Hansen TR, Cross JC, Farin CE, Imakawa K, Roberts RM. Slowed transcription and rapid messenger RNA turnover contribute to a decline in synthesis of ovine trophoblast protein1 during in vitro culture. Biol.Reprod. 1991; 45:94100. 270. Imakawa K, Helmer SD, Nephew KP, Meka CS, Christenson RK. A novel role for GMCSF: enhancement of pregnancy specific interferon production, ovine trophoblast protein1. Endocrinology 1993; 132:18691871. 271. Dehghani H, Hahnel AC. Expression profile of protein kinase C isozymes in preimplantation mouse development. R eproduction 2005; 130:441451. 272. Pauken CM, Capco DG. The expression and stagespecific localization of protein kinase C isotypes during mouse preimplantation development. Dev Biol 2000; 223:411421. 273. Ruzycky AL, Jansson T, Illsley NP. Differential expression of protein kinase C isoforms in the human placenta. Placenta 1996; 17:461469. 274. Yamaguchi H, Ikeda Y, Moreno JI, Katsumura M, Miyazawa T, Takahashi E, Imakawa K, Sakai S, Christenson RK. Identification of a functional transcriptional factor AP 1 site in the sheep interferon tau gene that mediates a response to PMA in JEG3 cells. Biochem.J. 1999; 340 ( Pt 3):767773.

PAGE 180

180 275. Ahmed S, Shibazaki M, Takeuchi T, Kikuchi H. Protein kinase Ctheta activity is involved in the 2,3,7,8tetra chlorodibenzop dioxin induced signal transduction pathway leading to apoptosis in L MAT, a human lymphoblastic Tcell line. FEBS J 2005; 272:903915. 276. Reyland ME. Protein kinase Cdelta and apoptosis. Biochem Soc Trans 2007; 35:10011004. 277. Yoshid a K. PKCdelta signaling: mechanisms of DNA damage response and apoptosis. Cell Signal 2007; 19:892901. 278. Jackson DN, Foster DA. The enigmatic protein kinase C delta: complex roles in cell proliferation and survival. FASEB J 2004; 18:627636. 279. Viv eiros MM, O'Brien M, Wigglesworth K, Eppig JJ. Characterization of protein kinase C delta in mouse oocytes throughout meiotic maturation and following egg activation. Biol Reprod 2003; 69:14941499. 280. Yamaguchi H, Nagaoka K, Imakawa K, Sakai S, Christenson RK. Enhancer regions of ovine interferontau gene that confer PMA response or cell type specific transcription. Mol.Cell Endocrinol. 2001; 173:147155. 281. Bamberger AM Bamberger CM, Wald M, Jensen K, Schulte HM. PKC isoenzyme expression and cellular responses to phorbol ester in JEG 3 choriocarcinoma cells. Endocrine 1997; 6:111116. 282. SabaElLeil MK, Vella FD, Vernay B, Voisin L, Chen L, Labrecque N, Ang SL, Melo che S. An essential function of the mitogenactivated protein kinase Erk2 in mouse trophoblast development. EMBO Rep 2003; 4:964968. 283. Wang Y, Wang F, Sun T, Trostinskaia A, Wygle D, Puscheck E, Rappolee DA. Entire mitogen activated protein kinase (MA PK) pathway is present in preimplantation mouse embryos. Dev Dyn 2004; 231:7287. 284. Mudgett JS, Ding J, GuhSiesel L, Chartrain NA, Yang L, Gopal S, Shen MM. Essential role for p38alpha mitogenactivated protein kinase in placental angiogenesis. Proc N atl Acad Sci U S A 2000; 97:1045410459. 285. Abell AN, Granger DA, Johnson NL, Vincent Jordan N, Dibble CF, Johnson GL. Trophoblast stem cell maintenance by fibroblast growth factor 4 requires MEKK4 activation of Jun N terminal kinase. Mol Cell Biol 2009; 29:27482761. 286. Curran S, Pierson RA, Ginther OJ. Ultrasonographic appearance of the bovine conceptus from days 10 through 20. J Am Vet Med Assoc 1986; 189:12891294.

PAGE 181

181 287. Wooding FB. Current topic: the synepitheliochorial placenta of ruminants: bin ucleate cell fusions and hormone production. Placenta 1992; 13:101113. 288. Thatcher WW, Guzeloglu A, Meikle A, Kamimura S, Bilby T, Kowalski AA, Badinga L, Pershing R, Bartolome J, Santos JE. Regulation of embryo survival in cattle. Reprod Suppl 2003; 61:253266. 289. Hue I, Renard JP, Viebahn C. Brachyury is expressed in gastrulating bovine embryos well ahead of implantation. Dev Genes Evol 2001; 211:157159. 290. Fischer Brown AE, Lindsey BR, Ireland FA, Northey DL, Monson RL, Clark SG, Wheeler MB, K esler DJ, Lane SJ, Weigel KA, Rutledge JJ. Embryonic disc development and subsequent viability of cattle embryos following culture in two media under two oxygen concentrations. Reprod Fertil Dev 2004; 16:787793. 291. ZernickaGoetz M, Morris SA, Bruce AW Making a firm decision: multifaceted regulation of cell fate in the early mouse embryo. Nat Rev Genet 2009; 10:467477. 292. Vejlsted M, Avery B, Schmidt M, Greve T, Alexopoulos N, Maddox Hyttel P. Ultrastructural and immunohistochemical characterization of the bovine epiblast. Biol.Reprod. 2005; 72:678686. 293. Talbot NC, Caperna TJ, Powell AM, Ealy AD, Blomberg lA, Garrett WM. Isolation and characterization of a bovine visceral endoderm cell line derived from a parthenogenetic blastocyst. In Vitro Cell Dev.Biol.Anim 2005; 41:130141. 294. Chazaud C, Yamanaka Y, Pawson T, Rossant J. Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2MAPK pathway. Dev Cell 2006; 10:615624. 295. Cai KQ, Capo Chichi CD, Rula ME, Yang DH, Xu XX. Dynamic GATA6 expression in primitive endoderm formation and maturation in early mouse embryogenesis. Dev Dyn 2008; 237:28202829. 296. Soudais C, Bielinska M, Heikinheimo M, MacArthur CA, Narita N, Saffitz JE, Simon MC, Leiden JM, Wilson DB. Targeted mutagenesis of the transcription factor GATA 4 gene in mouse embryonic stem cells disrupts visceral endoderm differentiation in vitro. Development 1995; 121:38773888. 297. Morrisey EE, Tang Z, Sigrist K, Lu MM, Jiang F, Ip HS, Parmacek MS. GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo. Genes Dev 1998; 12:35793590.

PAGE 182

182 298. Cheng AM, Saxton TM, Sakai R, Kulkarni S, Mbamalu G, Vogel W, Tortorice CG, Cardiff RD, Cro ss JC, Muller WJ, Pawson T. Mammalian Grb2 regulates multiple steps in embryonic development and malignant transformation. Cell 1998; 95:793803. 299. Feldman B, Poueymirou W, Papaioannou VE, DeChiara TM, Goldfarb M. Requirement of FGF4 for postimplantat ion mouse development. Science 1995; 267:246249. 300. Arman E, Haffner Krausz R, Chen Y, Heath JK, Lonai P. Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc. Natl.Acad.Sci.U.S.A 1998; 95:50825087. 301. Goldin SN, Papaioannou VE. Paracrine action of FGF4 during periimplantation development maintains trophectoderm and primitive endoderm. Genesis 2003; 36:4047. 302. Chen Y, Li X, Eswarakumar VP, Seger R, Lonai P. Fibroblast growth factor (FGF) signaling through PI 3kinase and Akt/PKB is required for embryoid body differentiation. Oncogene 2000; 19:37503756. 303. Yamanaka Y, Lanner F, Rossant J. FGF signal dependent segregation of primitive endoderm and epibl ast in the mouse blastocyst. Development; 137:715724. 304. Kunath T, Arnaud D, Uy GD, Okamoto I, Chureau C, Yamanaka Y, Heard E, Gardner RL, Avner P, Rossant J. Imprinted X inactivation in extraembryonic endoderm cell lines from mouse blastocysts. Devel opment 2005; 132:16491661. 305. Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev 2005; 16:139149. 306. Mohammadi M, Olsen SK, Ibrahimi OA. Structural basis for fibroblast growth factor receptor activation. Cytokine Growth Factor Rev 2005; 16:107137. 307. Talbot NC, Blomberg LA, Mahmood A, Caperna TJ, Garrett WM. Isolation and characterization of porcine visceral endoderm cell lines derived from in vivo 11day blastocysts. In Vi tro Cell Dev Biol Anim 2007; 43:7286. 308. Nakano H, Shimada A, Imai K, Takahashi T, Hashizume K. The cytoplasmic expression of E cadherin and betacatenin in bovine trophoblasts during binucleate cell differentiation. Placenta 2005; 26:393401.

PAGE 183

183 309. Cooke FN PK, Yang Q, Ealy AD. Several fibroblast growth factors are expressed during preattachment bovine conceptus development and regulate interferontau expression from trophectoderm. Reproduction 2009; 137:10. 310. Niwa H, Toyooka Y, Shimosato D, Str umpf D, Takahashi K, Yagi R, Rossant J. Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 2005; 123:917929. 311. Levenstein ME, Ludwig TE, Xu RH, Llanas RA, VanDenHeuvel Kramer K, Manning D, Thomson JA. Basic fibroblast growth factor support of human embryonic stem cell self renewal. Stem Cells 2006; 24:568574. 312. Vallier L, Alexander M, Pedersen RA. Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J Cell Sci 2005; 118:44954509. 313. Kurosaka S, Eckardt S, McLaughlin KJ. Pluripotent lineage definition in bovine embryos by Oct4 transcript localization. Biol Reprod 2004; 71:15781582. 314. Haffner Krausz R, Gorivodsky M, Chen Y, Lonai P. Expression of Fgfr2 in the early mouse embryo indicates its involvement in preimplantation development. Mech Dev 1999; 85:167172. 315. Deng CX, Wynshaw Boris A, Shen MM, Daugherty C, Ornitz DM, Leder P. Murine FGFR 1 is required for early postimplantation growth and axial organization. Genes Dev 1994; 8:30453057. 316. Rappolee DA, Patel Y, Jacobson K. Expression of fibroblast growth factor receptors in peri implantation mouse embryos. Mol Reprod Dev 1998; 51:254264. 317. Iseki S, Wilkie AO, Morriss Kay GM. Fgfr1 and Fgfr2 have distinct differentiationand proliferationrelated roles in the developing mouse skull vault. Development 1999; 126:56115620. 318. Schwertfeger KL. Fibroblast growth factors in development and cancer: insights from the mammary and prostate glands. Curr Drug Targets 2009; 10:632644. 319. Guo G, Huss M, Tong GQ, Wang C, Li Sun L, Clarke ND, Robson P. Resolution of cell fate decisions revealed by singlecell gene expression analysis from zygote to blastocyst. Dev Cell; 18:675685. 320. Alexopoulos NI, Maddox H yttel P, TvedenNyborg P, D'Cruz NT, Tecirlioglu TR, Cooney MA, Schauser K, Holland MK, French AJ. Developmental disparity between in vitroproduced and somatic cell nuclear transfer bovine days 14 and 21 embryos: implications for embryonic loss. Reproduct ion 2008; 136:433445.

PAGE 184

184 321. Guillomot M. Cellular interactions during implantation in domestic ruminants. J Reprod Fertil Suppl 1995; 49:3951. 322. Ashworth CJ, Bazer FW. Changes in ovine conceptus and endometrial function following asynchronous embryo transfer or administration of progesterone. Biol.Reprod. 1989; 40:425433. 323. Munoz M, Rodriguez A, Diez C, Caamano JN, Fernandez Sanchez MT, Perez Gomez A, De Frutos C, Facal N, Gomez E. Tyrosine kinase A, C and fibroblast growth factor 2 receptors in bovine embryos cultured in vitro. Theriogenology 2009; 71:10051010. 324. OcnGrove OM, Cooke FN, Alvarez IM, Johnson SE, Ott TL, Ealy AD. Ovine endometrial expression of fibroblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Domest Anim Endocrinol 2008; 34:10. 325. Ferretti C, Bruni L, Dangles Marie V, Pecking AP, Bellet D. Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts. Hum Reprod Update 2007; 13:121141. 326. Ahn HW, Farmer JL, Bazer FW, Spencer TE. Progesterone and interferon tauregulated genes in the ovine uterine endometrium: identification of periostin as a potential mediator of conceptus elongation. Reproduction 2009; 138:813825. 327. Dilly M, Hambruch N, Haeger JD, Pfarrer C. Epidermal growth factor (EGF) induces motility and upregulates MMP 9 and TIMP 1 in bovine trophoblast cells. Mol Reprod Dev; 77:622629. 328. NatansonYaron S, Anteby EY, Gr eenfield C, GoldmanWohl D, Hamani Y, Hochner Celnikier D, Yagel S. FGF 10 and Sprouty 2 modulate trophoblast invasion and branching morphogenesis. Mol Hum Reprod 2007; 13:511519. 329. Tao H, Shimizu M, Kusumoto R, Ono K, Noji S, Ohuchi H. A dual role of FGF10 in proliferation and coordinated migration of epithelial leading edge cells during mouse eyelid development. Development 2005; 132:32173230. 330. VerganoVera E, Mendez Gomez HR, HurtadoChong A, Cigudosa JC, Vicario Abejon C. Fibroblast growth factor 2 increases the expression of neurogenic genes and promotes the migration and differentiation of neurons derived from transplanted neural stem/progenitor cells. Neuroscience 2009; 162:3954. 331. Rossant J, Ciruna B, Partanen J. FGF signaling in mous e gastrulation and anteroposterior patterning. Cold Spring Harb Symp Quant Biol 1997; 62:127133.

PAGE 185

185 332. Ciruna BG, Schwartz L, Harpal K, Yamaguchi TP, Rossant J. Chimeric analysis of fibroblast growth factor receptor 1 (Fgfr1) function: a role for FGFR1 in morphogenetic movement through the primitive streak. Development 1997; 124:28292841. 333. Erikson DW, Burghardt RC, Bayless KJ, Johnson GA. Secreted phosphoprotein 1 (SPP1, osteopontin) binds to integrin alpha v beta 6 on porcine trophectoderm cells and integrin alpha v beta 3 on uterine luminal epithelial cells, and promotes trophectoderm cell adhesion and migration. Biol Reprod 2009; 81:814825. 334. Turner N, Grose R. Fibroblast growth factor signalling: from development to cancer. Nat Rev Cancer; 10:116129. 335. Shyu KG, Wang BW, Yang YH, Tsai SC, Lin S, Lee CC. Amphetamine activates connexin43 gene expression in cultured neonatal rat cardiomyocytes through JNK and AP 1 pathway. Cardiovasc Res 2004; 63:98108. 336. Flechon JE, Guillomot M, Charlier M, Flechon B, Martal J. Experimental studies on the elongation of the ewe blastocyst. Reprod Nutr Dev 1986; 26:10171024. 337. Alexopoulos NI, Vajta G, Maddox Hyttel P, French AJ, Trounson AO. Stereomicroscopic and histological examination of bov ine embryos following extended in vitro culture. Reprod Fertil.Dev. 2005; 17:799808. 338. Brandao DO, Maddox Hyttel P, Lovendahl P, Rumpf R, Stringfellow D, Callesen H. Post hatching development: a novel system for extended in vitro culture of bovine embryos. Biol.Reprod 2004; 71:20482055. 339. Spencer TE, Johnson GA, Bazer FW, Burghardt RC, Palmarini M. Pregnancy recognition and conceptus implantation in domestic ruminants: roles of progesterone, interferons and endogenous retroviruses. Reprod Fertil D ev 2007; 19:6578. 340. Lewis SK, Farmer JL, Burghardt RC, Newton GR, Johnson GA, Adelson DL, Bazer FW, Spencer TE. Galectin 15 (LGALS15): a gene uniquely expressed in the uteri of sheep and goats that functions in trophoblast attachment. Biol Reprod 2007; 77:10271036. 341. Nadeau V, Guillemette S, Belanger LF, Jacob O, Roy S, Charron J. Map2k1 and Map2k2 genes contribute to the normal development of syncytiotrophoblasts during placentation. Development 2009; 136:13631374. 342. Hambruch N, Haeger JD, D illy M, Pfarrer C. EGF stimulates proliferation in the bovine placental trophoblast cell line F3 via Ras and MAPK. Placenta; 31:6774.

PAGE 186

186 343. Curran S, Pierson RA, Ginther OJ. ultrasonographic appearance of the bovine conceptus from days 10 through 20. Jour nal of the American Veterinary Medical Association 1986; 189:12891294. 344. Dilly M, Hambruch N, Haeger JD, Pfarrer C. Epidermal growth factor (EGF) induces motility and upregulates MMP 9 and TIMP 1 in bovine trophoblast cells. Mol Reprod Dev 2010; 77:622 629. 345. Kessenbrock K, Plaks V, Werb Z. Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 2010; 141:5267. 346. Cohen M, Bischof P. Factors regulating trophoblast invasion. Gynecol Obstet Invest 2007; 64:126130. 347. Kizaki K, Ushizawa K, Takahashi T, Yamada O, Todoroki J, Sato T, Ito A, Hashizume K. Gelatinase (MMP 2 and 9) expression profiles during gestation in the bovine endometrium. Reprod Biol Endocrinol 2008; 6:66. 348. Anteby EY, Greenfield C, NatansonYaron S, GoldmanWohl D, Hamani Y, Khudyak V, Ariel I, Yagel S. Vascular endothelial growth factor, epidermal growth factor and fibroblast growth factor 4 and 10 stimulate trophoblast plasminogen activator system and metalloproteinase9. Mol Hum Reprod 2004; 10:229235. 349. Burghardt RC, Johnson GA, Jaeger LA, Ka H, Garlow JE, Spencer TE, Bazer FW. Integrins and extracellular matrix proteins at the maternal fetal interface in domestic animals. Cells Tissues Organs 2002; 172:202217. 350. Massuto DA, Hooper RN, Kneese EC, Johnson GA, Ing NH, Weeks BR, Jaeger LA. Intrauterine Infusion of Latency Associated Peptide (LAP) During Early Porcine Pregnancy Affects Conceptus Elongation and Placental Size. Biol Reprod 2009. 351. Zeiler M, Leiser R, Johnson GA, Tinneberg HR, Pfarrer C. Development of an in vitro model for bovine placentation: a comparison of the in vivo and in vitro expression of integrins and components of extracellular matrix in bovine placental cells. Cells Tissues Organs 2007; 186:229242. 352. Butler TM, Elustondo PA, Hannigan GE, Macphee DJ. Integrinlinked kinase can facilitate syncytialization and hormonal differentiation of the human trophoblast derived BeWo cell line. Reprod Biol Endocrinol 2009; 7:51. 353. Brad AM, Hendricks KE, Hansen PJ. The block to apoptosis in bovine twocell embryos involves inhibition of caspase9 activation and caspasemediated DNA damage. Reproduction 2007; 134:789797.

PAGE 187

187 354. Klaffky E, Williams R, Yao CC, Ziober B, Kramer R, Sutherland A. Trophoblast specific expressio n and function of the integrin alpha 7 subunit in the peri implantation mouse embryo. Dev Biol 2001; 239:161175. 355. Rout UK, Wang J, Paria BC, Armant DR. Alpha5beta1, alphaVbeta3 and the platelet associated integrin alphaIIbbeta3 coordinately regulate adhesion and migration of differentiating mouse trophoblast cells. Dev Biol 2004; 268:135151. 356. Schultz JF, Mayernik L, Rout UK, Armant DR. Integrin trafficking regulates adhesion to fibronectin during differentiation of mouse peri implantation blastocysts. Dev Genet 1997; 21:3143. 357. Parast MM, Aeder S, Sutherland AE. Trophoblast giant cell differentiation involves changes in cytoskeleton and cell motility. Dev Biol 2001; 230:4360. 358. MacIntyre DM, Lim HC, Ryan K, Kimmins S, Small JA, MacLaren LA. Implantationassociated changes in bovine uterine expression of integrins and extracellular matrix. Biol Reprod 2002; 66:14301436. 359. Klein S, Giancotti FG, Presta M, Albelda SM, Buck CA, Rifkin DB. Basic fibroblast growth factor modulates integrin expression in microvascular endothelial cells. Mol Biol Cell 1993; 4:973982. 360. Klein S, Bikfalvi A, Birkenmeier TM, Giancotti FG, Rifkin DB. Integrin regulation by endogenous expression of 18kDa fibroblast growth factor 2. J Biol Chem 1996; 271:2258322590. 361. Jovanovic M, Stefanoska I, Radojcic L, Vicovac L. Interleukin8 (CXCL8) stimulates trophoblast cell migration and invasion by increasing levels of matrix metalloproteinase (MMP)2 and MMP9 and integrins alpha5 and beta1. Reproduction 2010; 139:789798. 362. Bischof P, Meisser A, Campana A. Involvement of trophoblast in embryo implantation: regulation by paracrine factors. J Reprod Immunol 1998; 39:167177. 363. NatansonYaron S, Anteby EY, Greenfield C, GoldmanWohl D, Hamani Y, Hochner Celnikier D, Yagel S. FGF 10 and Sprouty 2 modulate trophoblast invasion and branching morphogenesis. Molecular Human Reproduction 2007 13:8.

PAGE 188

188 BIOGRAPHICAL SKETCH Qien Yang grew up in Qinghai province northwest of China. He attended the Chi na Agricultural University in Beijing and rec eived his bachelors degree in animal s cience in July 2004. Following graduation, Qien began his master s program i n Dr. Zhu Shiens group in the key l aboratory for embryonic biotechnology at the same university He continued his undergraduate research on mouse embryo development and embryo cryopreservation and received a Master of Science in animal reproductive biology. 2006, Qien came to the University of Florida and started his PhD in animal molecular and cel lular biology graduate program under Dr. Alan Ealys guidance. His research project has been on early embryonic development and maternal recognition of pregnancy in cattle, with particular focus on molecular regulation of early lineage segregation and trophoblast function in cattle. Following his PhD, Qien plans on pursue a postdoctoral position to gain more training in developmental biology and finally start his own lab in the field of reproductive biology. He is a trainee member of the Society for the Study of Reproduction.