<%BANNER%>

Molecular Properties of Texas Phoenix Decline Phytoplasma, a Subgroup 16sriv-D Strain Associated with Lethal Diseases of...

Permanent Link: http://ufdc.ufl.edu/UFE0042425/00001

Material Information

Title: Molecular Properties of Texas Phoenix Decline Phytoplasma, a Subgroup 16sriv-D Strain Associated with Lethal Diseases of Sabal Palmetto and Other Palms in Florida
Physical Description: 1 online resource (85 p.)
Language: english
Creator: Ntushelo, Khayalethu
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: decline, florida, palm, phoenix, phytoplasma, texas
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: A decline of sabal or cabbage palm (Sabal palmetto) with symptoms similar to those of coconut (Cocos nucifera) lethal yellowing (LY) was first observed in west central Florida, USA in 2008. Characterization of the causal agent implicated a phytoplasma, which closely resembled a subgroup 16SrIV-D phytoplasma previously associated with declining Canary Island date palms (Phoenix canariensis), edible date (P. dactylifera), silver date (P. sylvestris) and Queen (Syagrus romanzoffiana) palms. The phytoplasma strain associated with the Florida native S. palmetto was therefore also referred to as Texas Phoenix decline (TPD) phytoplasma, and classified as a subgroup 16SrIV-D strain. Although this phytoplasma had been classified based on the 16S rRNA sequence, further characterization of its genome remained crucial. Twenty five S. palmetto plants in west central Florida showing symptoms of decline were selected for sampling of the phytoplasma associated with the disease. DNA was extracted from tissue samples and the intergenic spacer region between 16S rRNA and 23S rRNA genes was amplified by a nested polymerase chain reaction assay. The sequence of the 16S-23S intergenic spacer (IGS) of TPD phytoplasma infecting S. palmetto was compared with IGS sequences derived from six 16SrIV-D phytoplasma strains infecting Phoenix spp., a 16SrIV-D strain infecting Syagrus romanzoffiana, a 16SrIV-F strain infecting Washingtonia robusta, two strains each comprising a mixture of 16SrIV-A and 16SrIV-F phytoplasmas, one LY phytoplasma strain from P. canariensis and finally those of three 16SrIV-A strains associated with LY disease of C. nucifera. The TPD phytoplasma population associated with S. palmetto appears homogenous. On the basis of the ribosomal operon, the TPD phytoplasma in S. palmetto is similar to other TPD strains found in Phoenix spp. and S. romanzoffiana, but different from the subgroup 16SrIV-A phytoplasma associated with C. nucifera and Phoenix spp. For further analysis, three genes were selected: the nusA gene, the hflB gene, and the gcp gene. All genes (nusA, hflB and gcp) differentiated the strains in this study similarly, TPD phytoplasma strain infecting S. palmetto is similar to the TPD strain infecting Cocos and Phoenix spp. but different from the LY strains associated with C. nucifera.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Khayalethu Ntushelo.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Elliott, Monica L.
Local: Co-adviser: Harrison, Nigel A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042425:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042425/00001

Material Information

Title: Molecular Properties of Texas Phoenix Decline Phytoplasma, a Subgroup 16sriv-D Strain Associated with Lethal Diseases of Sabal Palmetto and Other Palms in Florida
Physical Description: 1 online resource (85 p.)
Language: english
Creator: Ntushelo, Khayalethu
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: decline, florida, palm, phoenix, phytoplasma, texas
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: A decline of sabal or cabbage palm (Sabal palmetto) with symptoms similar to those of coconut (Cocos nucifera) lethal yellowing (LY) was first observed in west central Florida, USA in 2008. Characterization of the causal agent implicated a phytoplasma, which closely resembled a subgroup 16SrIV-D phytoplasma previously associated with declining Canary Island date palms (Phoenix canariensis), edible date (P. dactylifera), silver date (P. sylvestris) and Queen (Syagrus romanzoffiana) palms. The phytoplasma strain associated with the Florida native S. palmetto was therefore also referred to as Texas Phoenix decline (TPD) phytoplasma, and classified as a subgroup 16SrIV-D strain. Although this phytoplasma had been classified based on the 16S rRNA sequence, further characterization of its genome remained crucial. Twenty five S. palmetto plants in west central Florida showing symptoms of decline were selected for sampling of the phytoplasma associated with the disease. DNA was extracted from tissue samples and the intergenic spacer region between 16S rRNA and 23S rRNA genes was amplified by a nested polymerase chain reaction assay. The sequence of the 16S-23S intergenic spacer (IGS) of TPD phytoplasma infecting S. palmetto was compared with IGS sequences derived from six 16SrIV-D phytoplasma strains infecting Phoenix spp., a 16SrIV-D strain infecting Syagrus romanzoffiana, a 16SrIV-F strain infecting Washingtonia robusta, two strains each comprising a mixture of 16SrIV-A and 16SrIV-F phytoplasmas, one LY phytoplasma strain from P. canariensis and finally those of three 16SrIV-A strains associated with LY disease of C. nucifera. The TPD phytoplasma population associated with S. palmetto appears homogenous. On the basis of the ribosomal operon, the TPD phytoplasma in S. palmetto is similar to other TPD strains found in Phoenix spp. and S. romanzoffiana, but different from the subgroup 16SrIV-A phytoplasma associated with C. nucifera and Phoenix spp. For further analysis, three genes were selected: the nusA gene, the hflB gene, and the gcp gene. All genes (nusA, hflB and gcp) differentiated the strains in this study similarly, TPD phytoplasma strain infecting S. palmetto is similar to the TPD strain infecting Cocos and Phoenix spp. but different from the LY strains associated with C. nucifera.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Khayalethu Ntushelo.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Elliott, Monica L.
Local: Co-adviser: Harrison, Nigel A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042425:00001


This item has the following downloads:


Full Text

PAGE 1

1 M OLECULAR PROPERTIES OF T EXAS P HOENIX D ECLINE P HYTOPLASMA A SUBGROUP 16SrIV D STRAIN ASSOCIATED WITH LETHAL DISEASES OF S ABAL PALMETTO AND OTHER PALMS IN FLORIDA By KHAYALETHU NTUSHELO A DISSERTATION PRESENTED TO THE GRAD UATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Khayalethu Ntushelo

PAGE 3

3 To my family for their unconditional love and support

PAGE 4

4 ACKNO WLEDGMENTS I sincerely thank my academic mentor Dr. Nigel Harrison. Dr. Harrison facilitated my understanding of scientific research with his guidance and thoughtful discussions. He passed to me his rich knowledge which has become my valuable inheritance. I thank Dr. Monica L. Elliott f o r serv ing as the chair of my Ph.D committee I also thank her for academic guidance and for providing the necessary administrative and financial support. I am indebted to Dr. Elliott for this unwavering support during my stu dy period. A note of gratitude is extended to other committee members, Drs. Robin Giblin Davis of the Department of Entomology and Nematology and Michael J. Davis of the Department of Plant Pathology. Their valuable contribution to my research cannot be m easured. I thank Ericka Helmick who taught me the laboratory techniques I needed to undertake my research. I also thank Elizabeth Des J ardin and Rafael Gonzalez, my laboratory colleagues for their friendly interactions I express my gratitude to the facul ty and support staff of the departments of Plant Pathology, Microbiology and Cell Science, and the Interdisciplinary Center for Biotechnology Research for the support I received from them. Of significant mention is Dr. Raghavan Charudattan whose encounter in South Africa presented me with this study opportunity. My life as a student was made pleasurable by many friends and colleagues, Neil Young, Nurmastini Sufina Bujan Nickman, Dr. Seemanti Chakrabarti, Jeet Sengupta, Mikhail Ryabin, Bill Latham, Dr. Thoma s Chouvenc, Dr. Pauric Mc Groary, Teresa Ferreira, Dr. Hou Feng Li, Dr. Rou Kanzaki, Dr. Nan Yao Su Dr. Rudolf H. Scheffrahn Dr. Timothy K. Broschat, Wenlan

PAGE 5

5 Tian, Irina Ogneviem, Joanne Korvick, Sarah Kern, Sergio Gallo, Barb Center, Mim Harrison and Dennis DesJardin The faculty and support staff of the Fort Lauderdale Research an d Education Center offered an excellent environment for learning and personal growth. Funding for my studies was provided jointly by the University of Florida, Manatee County Friends of Extension of Florida, U nited S tates of A merica and the National Resea rch Foundation (NRF) of South Africa. The financial assistance of these organizations towards this research is hereby acknowledged. Opinions expressed and conclusions arrived at, are those of the author and are not necessarily to be attributed to the se fun ding organizations. Additional funding for my studies was provided by The Ernest Oppenheimer Memorial Trust of South Africa I wish to express my thanks to thi s trust for this wonderful support. The love of my lord Jesus Christ was shown to me by the encou ragement I received from many disciples I interacted with during the course of my studies. I very much enjoyed being part of the First Assembly church of Gainesville and the South Florida Church of Christ. I would like to thank my family in South Africa fo r their love and support during my studies.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 REVIEW OF DECLINE DISEASES OF PALMS WITH SPECIFIC REFERENCE TO THE MOLECULAR PROPERTIES OF SUBGROUP 16SrIV D PHYTOPLASMA CAUSING TEXAS PHOENIX DECLINE OF SABAL PALMETTO ................................ ................................ ................................ ............ 13 Introduction ................................ ................................ ................................ ............. 13 General Characteristics of Phytoplasmas ................................ ............................... 13 Taxonomy of Phytoplasmas ................................ ................................ .................... 14 G roup 16SrIV Phytoplasmas ................................ ................................ .................. 17 The Sabal Genus ................................ ................................ ................................ .... 20 Taxonomy ................................ ................................ ................................ ......... 20 Distribution and Ecology ................................ ................................ ................... 20 Morphology ................................ ................................ ................................ ....... 21 Sabal palmetto ................................ ................................ ................................ 21 Symptoms of Texas Phoenix Decline on Sa bal palmetto ................................ 22 Molecular Characterization of Phytoplasmas with Reference to Texas Phoenix Decline on Sabal palmetto ................................ ................................ ................... 23 Ribosomal RNA Genes ................................ ................................ .................... 23 The 16S 23S Intergenic Spacer Region ................................ ........................... 24 nusA Gene ................................ ................................ ................................ ....... 25 hfl B Gene ................................ ................................ ................................ ......... 25 O sialoglycoprotein Endopeptidase Gene, the Glycoprotease ( gcp ) Gene ...... 26 Problem Statement and Purpose of the Study ................................ ........................ 27 2 MOLECULAR SURVEY OF THE TEXAS PHOENIX DECLINE PHYTOPLASMA POPULATION ................................ ................................ ................................ ......... 30 Introduction ................................ ................................ ................................ ............. 30 Materials and Methods ................................ ................................ ............................ 31 Plant Material and DNA Extraction ................................ ................................ ... 31 Polymerase Chain Re action ................................ ................................ ............. 32 Cloning ................................ ................................ ................................ ............. 33

PAGE 7

7 Sequence Analysis ................................ ................................ ........................... 34 Restriction Fragment Length Polymorphisms ................................ ................... 34 Results and Discussion ................................ ................................ ........................... 34 3 DIFFERENTIATION OF PHYTOPLASMA STRAINS CAUSING DECLINE OF SABAL PALMETTO AND COCONUT LETHAL YELLOWING BASED ON SEQU ENCES OF THE RIBOSOMAL RNA OPERON ................................ ............ 42 Introduction ................................ ................................ ................................ ............. 42 Materials and Methods ................................ ................................ ............................ 42 Plant Material, DNA Extraction Polymerase Chain Reaction and Cloning ........ 42 Sequence Analysis ................................ ................................ ........................... 4 3 Results ................................ ................................ ................................ .................... 43 Discussion ................................ ................................ ................................ .............. 45 4 GENETIC CHARACTERIZATION OF SUBGROUP 16SrIV D PHYTOPLASMA INFECTING SABAL PALMETTO USING HFL B, NUSA AND GLYCOPROTEASE GENE SEQUENCES ................................ ............................. 59 Introduction ................................ ................................ ................................ ............. 59 Materia ls and Methods ................................ ................................ ............................ 60 Plant Material and Polymerase Chain Reaction ................................ ............... 60 Cloning, Sequencing and Restriction Fragment Length Polymorphisms .......... 60 Sequence Analysis ................................ ................................ ........................... 61 Results and Discussion ................................ ................................ ........................... 61 nusA Gene ................................ ................................ ................................ ....... 61 Polymerase chain reaction and analysis by restriction fragment length polymorphism ................................ ................................ ......................... 61 Molecular comparisons ................................ ................................ .............. 62 hfl B Gene ................................ ................................ ................................ ......... 62 Polymerase chain reaction ................................ ................................ ......... 62 Analysis by restriction fragment l ength polymorphism ............................... 63 Molecular comparisons ................................ ................................ .............. 63 gcp Gene ................................ ................................ ................................ .......... 64 Polymerase chain reaction and analysis by restriction fragment length pol ymorphism ................................ ................................ ......................... 64 Molecular comparisons by phylogenetic analysis ................................ ...... 64 5 RESULTS OBTAINED AND CONCLUDING REMARKS ................................ ........ 76 APPENDIX: SOME PHYTOPLA SMAS REFEREED TO IN THIS MANUSCRIPT ......... 78 LIST OF REFERENCES ................................ ................................ ............................... 79 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 85

PAGE 8

8 LIST OF TABLES Table page 2 1 Phytoplasma samples included in the study, listed with palm host species, location and strain identity. ................................ ................................ ................. 38 3 1 Primers and product size of polymeras e chain reaction amplification of ribosomal RNA operon genes. ................................ ................................ ........... 48 4 1 Phytoplasma samples included in this study listed with host palm species and location. ................................ ................................ ................................ ....... 66 4 2 Primers used to amplify phytoplasma gene products from total DNA extracted from symptomatic plants ................................ ................................ ..... 67 4 3 Sequence comparisons of the nusA gene. ................................ ......................... 67

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Orientation of genes of the ribosomal RNA operon of five phytoplasma species.. ................................ ................................ ................................ ............. 28 1 2 The syndrome of Texas Phoenix decline in Sabal palmetto caused by a 16SrIV D phytoplasma in Hillsborough county in west central Florida.. .............. 29 2 1 Agarose gel sho wing polymerase chain reaction amplification of the 16S 23S intergenic spacer region. ................................ ................................ .................... 39 2 2 Restriction fragment length profiles of phytoplasma DNA (ca. 800 bp) amplified from symptomatic pa lms.. ................................ ................................ ... 40 2 3 Inferred molecular relationships of phytoplasma strains based on the 16S 23S intergenic spacer sequence. ................................ ................................ ....... 41 3 1 S equence comparison of the ribosomal RNA operon.. ................................ ....... 49 3 2 Schematic representation of the ribosomal operon of the Texas Phoenix decline phytoplasma strain isolated from Sabal palmetto .. ................................ 50 3 3 Inferred molecular relationship of phytoplasma strains based on ribosomal RNA operon ................................ ................................ ................................ ........ 51 3 4 Inferred molecular relationship of phytoplasma strains based on 16S ribosomal RNA (rrns) gene using the neighbor joining method.. ........................ 53 3 5 Inferred molecular relationship of phytoplasma strains based on 16S 23S intergenic space r using the neighbor joining method.. ................................ ....... 55 3 6 Inferred molecular relationship of phytoplasma strains based on 23S ribosomal RNA (rrns) gene using the neighbor joining method.. ........................ 57 4 1 Nested PCR products amplified using primer pair nusA F1 and nusA R1 followed by nusA F2 and nusA R2.. ................................ ................................ ... 68 4 2 Restriction fragment lengt h polymorphism of nusA F2 and nusA R2 PCR product.. ................................ ................................ ................................ ............. 68 4 3 Restriction fragment length polymorphism of phytoplasma hfl B gene copies. .... 69 4 4 Agarose gel electrophoresis showing amplification of the glycoprotease ( gcp ) gene in different DNA samples co llected from symptomatic palms. .................. 72 4 5 Restriction fragment length polymorphisms of a polymerase chain reaction (PCR) fragment amplified with primer pair GCPFI/GCPR1. ............................... 73

PAGE 10

10 4 6 Molecular tree of the glycoprotease ( gcp ) gene sequences of palm lethal disease stra ins inferred by neighbor joining method.. ................................ ........ 74

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Phil osophy M OLECULAR PROPERTIES OF T EXAS P HOENIX D ECLINE P HYTOPLASMA A SUBGROUP 16SrIV D STRAIN ASSOCIATED WITH LETHAL DISEASES OF S ABAL PALMETTO AND OTHER PALMS IN FLORIDA By Khayalethu Ntushelo December 2010 Chair: Monica Elliott Cochair: Nigel Harrison Major: Plant Pathology A d ecline of sabal or cabbage palm ( Sabal palmetto ) with symptoms similar to those of coconut ( Cocos nucifera ) lethal yellowing (LY) was first observed in west centra l Florida USA in 2008. C haracterization of the causal agent implicated a phytoplasma which closely resembled a subgroup 16SrIV D phytoplasma previously associated with declining C anary Island date palms ( Phoenix canariensis ) edible date ( P. dactylifera ) silver date ( P. sylvestris ) and Queen ( Syagrus romanzoffiana ) palms The phytoplasma strain associated with the Florida native S. palmetto was therefore also refe rr ed to as Texas Phoenix decline (TPD) phytoplasma and classified as a sub group 16SrIV D strain Although this phytoplasma had been classified based on the 16 S rRNA sequence, further characterization of its genome remained crucial Twenty f ive S. palmetto plants in west central Florida showing symptoms of decline were selected for sampling of the phytoplasma associated with the disease. DNA was extracted f rom tissue samples and the intergenic spacer region between 16S rRNA and 23S rRNA genes was amplified by a nested polymerase chain reaction assay The sequence of the 16S 23S intergenic spacer (IGS) of TPD phytoplasma infecting S.

PAGE 12

12 palmetto was compared with IGS sequences derived from six 16SrIV D phytoplasma strains infecting Phoenix spp., a 16SrIV D strain infecting Syagrus romanzoffiana a 16SrIV F strain infecting Washingtonia robusta two strains each comprising a mixture of 16SrIV A and 16SrIV F phytoplasmas, one LY phytoplasma strain from P. canariensis and finally those of three 16SrIV A strains associated with LY disease of C. nucifera T he TPD phytoplasma population associated w ith S. palmetto appears homogenous On the basis of the ribosomal operon, the TPD phytopla sma in S. palmetto is similar to other TPD strains found in Phoenix spp and S. romanzoffiana but different from the subgroup 16SrIV A phytoplasma associated with C. nucifera and Phoenix spp For further analysis, three genes were selected: the nus A gene, the hfl B gene, and the gcp gene. All genes ( nusA hfl B and gcp ) differentiated the strains in this study similarly T PD phytoplasma st rain infecting S. palmetto is similar to the TPD strain infecting Cocos and Phoenix spp. but different from the LY strains associated with C. nucifera

PAGE 13

13 CHAPTER 1 REVIEW OF DECLINE DISEASES OF PALMS WITH SPECIFIC REFERENCE TO THE MOLECULAR PROPERTIES OF SUBGROUP 16S r IV D PHYTOPLASMA CAUSING TEXAS PHOENIX DECLINE OF SABAL PALMETTO Introduction A widespread yellows disease on aster was first reported in 1902 (Kunkel 1926 cited by Lee et al. 2000 ). Y ellows disease s were originally considered to be caused by viruses until a group of Japanese scientists using electron microscopy discovered mycoplasma like organisms (MLOs) i n ultra thin sections of the phloem of plants showing typical yellows symptoms (Doi et al. 1967 cited by Lee et al. 2000 ). However, an i nability to culture MLOs in cell free media limited further efforts to study and understand them. Later adoption of molecular b a sed techniques especially sequencing of the ribosomal operon facilitated their classification. Based up on t he sequence of the 16S rRNA gene MLOs share between 88% and 99% similarity among themselves and between 87% and 88.5% similari ty with a choleplasma s which proved to be their closest relatives (Gundersen et al. 1994; Seemller et al. 1998) Subsequently t he name phytoplasma was adopted by the Phytoplasma Working Team of the 10 th Congress of International Organization of Mycoplasmology to refer to MLO s (Int. Comm. Syst. Bacteriol., Subcomm. Taxon. Mollicutes. 1993; Int. Comm. Syst. Bacteriol. Subcomm. Taxon. Mollicutes. 1997) General C haracteristics of P hytoplasmas Phytoplasmas are mollicutes that inhabit phloem sieve tube elements of their respecti ve plant hosts. Ultrastructural observation of phytoplasmas frequently reveal cells with a r ounded pleiomorphi sm with a diameter between 200 and 800 nm Other observations indicated that phytoplasmas are at times filamentous in form [ (Haggis and

PAGE 14

14 Sinha 1978 ; Lee and Davis 1983; Waters and Osborne 1978 ) cited by Lee et al. 2000 ] For dissemination they depend up on phloem feeding insect vectors of t he order Hemiptera (Kirkpatrick 1992 cited by Liefting et al. 2004 ). These insects primarily leafhoppers, plant hoppers and psyllids transmit phytoplasmas to different plants in a plant insect phytoplasma relationship known as the matrimonial triangle. Phytoplasmas are associated with diseases of hundreds of plant species worldwide (Lee at al. 2000; Seemller et al 1998) T ypical symptoms on infected plants include virescence (development of green flowers and the loss of flower pigmentation), phyllody brooms, abnormal internode elongation, stunting, discoloration of the foliage, leaf distortion, malformation of stem tip s and eventual plant decline. However, some plan t species are tolerant o f phytoplasma infection and consequently display mild or no symptoms. Phytoplasmas possess small geno mes ranging between 530 and 1200 kb a G + C content between 23 and 29 %, two rRNA operons (Figure 1 1) (except for Western X disease phytoplasma which has only one (Kirkpatrick et al. 1987) ) few tRNAs and limited metabolic activity (Bai et al. 2006; Bov 19 97; Kube et al. 2008 ; Marcone et al. 1999; Oshima et al. 2004; Razin 1985 ; Tran Nguyen et al. 2008 ) B e cause phytoplasmas are unculturable thus far their taxonomic characterization ha s been limited primarily to molecular based methods. Taxonomy of P hyt oplasmas Before a comprehensive classification was devised, phytoplasmas were named according to prominent biological properties such as symptoms or types of the diseases they caused. The shortfall of this system was that mol ecularly distinct phytoplasmas can cause very similar or the same symptoms on shared plant hosts and, as such, might be

PAGE 15

15 assigned the same name. Molecular based methods that had gained prominence in the study of prokaryotes w ere then adopted to design a new classification scheme. Initial molecular methods to identify and classify unknown phytoplasmas were based on phylogenetic analysis of the 16Sr RNA gene ( Kuske and Kirkpatrick 1992; Namba et al. 1993). The difficulty with this method of classification was that many phytoplasma laborator ies were ill equipped to obtain reliable sequences of the 16S rRNA gene. A classification scheme based on universal amplification and restriction fragment length polymorphism (RFLP) of the 16S rRNA gene was then adopted and originally reported by Lee et al ( 1993 ) and used to differentiate a collection of 40 phytoplasmas from three continents into nine major groups and 14 subgroups. This classification scheme was later revised by further differentiation of the 14 major groups into 32 strain subgroups using RFLP data derived from PCR amplified ribosomal protein genes (Lee et al. 1998 2000). With the wide acceptance of 16S rRNA analysis as a reliable tool for identification a nd classification, an in silico RFLP analytical method was developed (Wei et al. 2008 ) and automated (Zhao et al. 2009). Used to examine 16S rRNA sequences of phytoplasmas a vailable in the public nucleotide databases, this method delineated 28 major groups and at least 100 subgroups of strains (Wei et al. 2007). Phylogenetic analysis of 16S rRNA gene sequences (Gundersen et al. 1994; Namba et al. 1993; Seem ler et al. 1998) were consistent with a molecular classification of phytoplasmas based upon RFLP analysis. Based upon a global analysis of the 16S rRNA gene and r ibosomal p rotein gene operon sequences, phytoplasmas form a distinct monophyletic clade within the class Mollicutes ( Gundersen et al. 1994 ; Lim and Sears 1992 ). Within the clade numerous subclades (i. e. major groups) of

PAGE 16

16 phytoplasmas were delineated and presumed to represent s eparate species. With the advent of phylogenetic classification of prokaryotes based upon the evolutionary conserved 16SrRNA gene, to accommodate assignment of binomial names to unculturable taxa of prokaryotes defined by very limited data, such as nucleo tide sequence, derived from a very small portion of the genome (e.g. 16Sr RNA gene) Murray and Schleifer (1994) proposed the Candidatus Phytoplasma genus Subsequently, it was proposed to accommodate phytoplasmas within the novel genus Candidatus Phyto IRPCM Phytoplasma/Spiroplasma Working Team Phytoplasma taxonomy group 2004 ). Ca Ph y species designations have been separately assigned to reference strains representative of 27 phytoplasma groups. Current guidelines f Ca significantly unique 16S rRNA gene sequence >1,200 bp in length. The strain from which the sequence is obtained should be designated as the reference strain. Strains with minimal d ifferences in the 16S rRNA sequence, relative to the reference strain, should be referred to as related strains. In general, t wo phytoplasma strains are the same species if they share more than 97.5% of their 16S rRNA gene (IRPCM Phytoplasma/Spiroplasma Wo rking Team Phytoplasma taxonomy group 2004) However, if two such strains that share mo re than 97.5% of their 16S rRNA are vectored by different insects, have different hosts, behave differently in the same host, or are molecularly distinct in hybridizatio n tests with cloned DNA, or in serotyping or in PCR assays, then two separate species may be proposed ( IRPCM Phytoplasma/Spiroplasma Working Team Phytoplasma taxonomy group 2004 ).

PAGE 17

17 Group 16SrIV P hytoplasmas Yellowing syndrome of coconut palm has bee n known for more tha n one hundred years. This syndrome was rife in the Cayman Islands in the 1830s but it was not until the mid 1900s that the first reliable r eports of mortality of coconut palm were made (Nutman and Roberts 1955 cited by Eden Green 1997 ) In these first credible reports of coconut palm mortality which were made in Jamaica Nutman and Roberts (1955) cited by Eden Green ( 1997 ) first used the term lethal yellowing (LY) to refer to this disease. Symptoms observed on the highly susceptible J amaica tall variety (i.e. Atlantic tall ecotypes) begin with premature falling of most or all coconuts (fallen coconuts have a brownish discoloration on the part immediately under the calyx of the stem) Closely f ollowing th e nut fall is the blackening of new inflorescences T he n yellowing of leaves begin s at the base of the crown, gradually advancing to reach mid crown and eventually discoloring the entire crown The leaves ultimately turn brown droop and fall. Foliage discoloration is accompanied by deat h of the spear leaf Finally, the tree canopy falls leaving a bare trunk More reports of LY on coconut palm came from Cuba, the Dominican Republic Haiti the Bahamas and the disease became established in Florida in the USA in the early 1970s (McCoy et al. 1983) Other outbreaks were also report ed in the Yu catn Peninsula of Mexico and Belize (Eden Green 1997). By 1997 LY of palms was present on the Pacific coast of Mexico (Harrison et al. 2002 a ). Most lethal yellows disease reports were made on C ocos n ucifera L which has been devastated in vari ous epidemics. In Florida and Jamaica, LY epidemics were responsible for the death of most coconut palms of the Jamaican Tall variety from the 1970s until the 1990s. This occurred concurrently with spread of th is disease to neighboring regions including the

PAGE 18

18 Pacific coast o f the Americas (Harrison et al. 2002 a ) I n the late 1990s most disease activity was along the Atlantic coasts of Belize and Honduras (Ashburner et al. 1996; Harrison and Oropeza 1997). D isease s symptomatologically resembling LY have been reported from East and West Africa since the beginning of the 1900s [ (Bull 1955; Ekpo and Ojomo 1990; Osagie and Asemota 1995; Schuiling et al. 1992 ) cited by Eden Green 1997 ] In some communities these epidemi cs caused severe economic losses. In subtropical southern Florida where a wide selection of palm species are cultivated for use in landscape and amenity plantings at least 35 species in addition to coconut are known to be affected by LY. The initial app lication of DNA based molecular diagnostics to studies on phytoplasma diseases have identified and classified phytoplasmas that are consistently associated with LY disease of palms in the Caribbean region, Mexico and Central America as members of the 16S R FLP group 16SrIV (Lee et al. 1998) or as the representative of group VII according to a classification system based on phylogeny of 16S rRNA gene (Gundersen et al. 1994). Within group 16SrIV several subgroups have been resolved (Harrison et al. 1992; Harri son and Richardson 1994; Harrison et al. 1994; Harrison et al. 2002 a ; Harrison et al. 2008) Although LY is most associated with coconut, LY type disease s have a significant impact in other palm species. In Canary Island date palms ( P hoenix canariensis C hab. ) a LY type phytoplasma was detected in Brownsville and Rio Grande Valley in southern Texas during the late 1970s (McCoy et al. 1980) The same symptoms were later observed o n the Canary Island date palms in Corpus Christi, Texas in 2001 and classifie d as subgroup 16SrIV D (Harrison et al. 2002 b ). Most recently, records of LY type diseases

PAGE 19

19 on palms were also made on silver date [ P. sylvestris (L.) Roxb. ] Canary Island date, edible date ( P. dactylifera L. ), Queen [ Syagrus romanzoffiana (Cham.) Glassman ] and Mexican fan ( Washington ia robusta Wendl. ) palms in west central Florida (Harrison et al. 2008). A lethal decline of sabal or cabbage palms [ S abal palmetto (Walter) Lodd. ex Schult. & Schult. f. ] was also recorded in west central Florida in 2008 (Har rison et al. 2009) For the lethal decline in S. palmetto i nitial DNA based characterization found a phytoplasma which wa s identical to the strain previously affecting P hoenix spp in Texas and later on P. dactylifera P. sylvestris and S. romanzoffiana i n west central Florida (Harrison et al. 2009 ; McCoy et al. 1980 ). Work done on the project herein focus ed on the phytoplasma strain infecting S palmetto Infected cabbage palms develop a reddish brown foliage followed by decline of the spear leaf and ev entual mortality. Infected palms die within a few months once symptoms become visible. Unlike the LY phytoplasma associated with C. nucifera this phytoplasma strain appears to spread slowly and its intensity was still confined in the area of first disease records, namely Hillsborough and Manatee counties in west central Florida two years after its discovery with fewer disease records in Polk and Desoto counties This introduction of the pathogen by shipment could warrant restrictions on movement of plant s given the evidence that it can perpetuate this disease. T he new strain is similar to the Texas Phoenix palm decline (TPD) phytoplasma the strain originally associated with Phoenix palms in Corpus Christi, Texas I t was also referred to as TPD, a sub grou p 16SrIV D phytoplasma.

PAGE 20

20 The Sabal G enus Sabal has always been an important part of the new world. Ecologically, its fruit provide s food to migratory birds and historically it was used for roof thatching and crafting because of its tough but p liant leaves. It is also an important ornamental plant. Taxonomy Kingdom: Plantae Order: Arecales Family: Arecaceae Subtribe: Sabalinae Tribe: Corypheae Genus: Sabal Distribution and E cology Fossil records of Sabal point to a range of distrib ution that includes the Soviet Union (Takhtajan 1958 cited by Zona 1990 ), G reat Britain (Reid and Chandler 1933 cited by Zona 1990 ), Alaska (Wolfe 1972 cited by Zona 1990 ), Vancouver Island and Japan (Kryshtofovich 1918 cited by Zona 1990 ) and the states o f New Jersey, Delaware, Maryland, South Carolina, Kentucky, Tennessee, Arkansas, Texas, Montana, Wyoming, Colorado, New Mexico and California in the USA [ (Daghlian 1978 ; Noe 1936 ; Read and Hickey 1974 ) cited by Zona 1990 ] Presently Sabal is only found in the new world. Primarily it is found in Mexico, southeastern USA and the Caribbean (including Bermuda). Principal pollinators for the genus are Hymenoptera especially solitary bees of the Megachilidae and Halictidae (Zona 1990) The fruits are dispersed by birds (Guppy 1917 cited by Zona 1990 ) a nd according to Brown (1973) cited by Zona ( 1990 ), water dispersal is the primary mode for long range dispersal for S. palmetto

PAGE 21

21 Morphology In Sabal stem formation begins underground where seedling gr owth first proceeds. Aerial stem growth is preceded by many years of this underground growth. For fully matured plants the aerial trunk ranges from 3 to 25 m tall. Most caulescent species reach heights between 5 and 15 m tall. Trunk diameter is between 15 cm and 60 cm, with most species ranging between 35 and 45 cm. Sabal has an extensive adventitious root system. Leaf petioles are between 30 and 250 cm long depending on conditions during growth. The leaves are alternate and spirally arranged, flabelliforus be between 0.4 to 3 m in length with varying degrees of branching density. The flowers protrude singly with a creamy white appearance and a pungent sweet fragrance. They are ca. 3.5 to 7 mm in diameter. Generally across species there is uniformity in flower morphology. Sabal berries range in size from 6.5 to 27.5 mm in diameter (Zona 1990) Sabal palmetto S abal or c abbage palm, Sabal palmetto is a palm native in the ce ntral part of the A mericas. Used as an indicator of poor soil S. palmetto is important in the ecology of its habitat. Culturally it is an important ornamental plant and also a very important symbol in the identity of the state s of Florida and South Carol ina (official state trees in both states) S. palmetto is most abundant in Cuba and the Bahamas, southeastern United States specifically Florida, along the coast of the states of Georgia and South Carolina and its range also extends to Cape Fear, Smiths I sland and North Carolina. Its natural habitat is mesic hammocks, pine forests, and along water bodies (rivers and the beach). It survives well in environments with salt spray and brackish water [ (Brown 1973; Zona

PAGE 22

22 1983 ) cited by Zona 1990 ] in periodically flooded grass plains as well as in disturbed vegetation (Alain 1961 cited by Zona 1990 ). In the northern part of its geographic range S. palmetto flowers in July and very sparingly during the remainder of the year. I t flowers between June and August i n c entral Florida throughout the year in southern Florida and the Bahamas and only in spring in Cuba (Zona 1990) s horticultural characteristics include high salt tolerance, high drought tolerance, wide soil adaptation, high light requirement a nd low nutritional requirements. Morphologically, it has a solitary canopy, and the stem is gray, smooth and usually covered with split leaf bases. The leaves are costapalmate, induplicate with a dull green color. The plant is monoecious and has bisexual f lowers which are white (Meerow 2006). Symptoms of Texas Phoenix D ecline on S abal palmetto Phytoplasma i nfection of mature S. palmetto palms begins with inflorescence necrosis which is closely followed by foliage discolor ation beginning with the oldest le aves w hich turn varying shades of reddish brown to dark brown to grey. The onset of f oliage discoloration is accompanied by death of the spear leaf and shortly thereafter by the mortality of the apical meristem. Palms with advanced symptoms can be pushed o ver easily indicat ing a loss of the structural integrity of the root system due to decay Eventually the remaining canopy declines before toppling to the ground leaving just a bare stem often referred to as a telephone pole (Harrison et al. 2009). Certa in stages of disease development are depicted in Figure 1 2.

PAGE 23

23 Molecular Characterization of Phytoplasmas with Reference to Texas Phoenix D ecline on S abal palmetto Because phytoplasmas are unculturable their classification is presently best achieved by the use of molecular techniques. Among the molecular procedures useful in characterizing phytoplasmas is the analysis of conserved genes (Gundersen et al 1994; Schneider et al 1997). For the purposes of the research reported herein focus was on characteriz ing the sequences of ribosomal RNA genes and the intergenic spacer between the 16S rRNA and 23S rRNA genes However, less conserved non ribosomal protein genes are required to differentiate closely related phytoplasmas (phytoplasmas within a given 16Sr gr oup). Moreover some of these non ribosomal coding genes may have different evolutionary rates and therefore may add to the knowledge on evolution and adaptation. Attention was focused additionally on using the sequences of the transcription factor gene nusA the hfl B gene, which is a possible virulence factor, and an ATP dependent membrane associated Zn 2+ protease and gcp gene, which is a metal dependent endopeptidase gene Ribosomal RNA G enes Ribosomal RNA genes are an essential component of the protein synthesis apparatus and are therefore universally present in all organisms. They are conserved but have sufficient variation to allow distinction between taxa (Woose 1987). Signature sequences of the 16S rRNA gene have been used to distinguish phytoplasma s from other prokaryotes. Ribosomal RNA coding genes occur in multiple copies i n eukaryotic genomes sometimes reach ing several thousand copies In prokaryotes the rRNA gene copy number is far less, averaging three or four copies in a single genome (Fogel et al. 1999). Schneider and Seem ller ( 1994 ) analyzed 28 phytoplasmas and found two

PAGE 24

24 copies of rRNA operons and their work has been confirmed by the sequencing the entire genomes of Ca ndidatus Phytoplasma asteris ( phytoplasma ) Ca Phytoplasma australiense Ca. Phytoplasma mali and Ca Phytoplasma asteris ( onion yellows phytoplasma OY M ) (Oshima et al. 2004; Bai et al. 2006; Kube et al. 2008; Tran Nguyen et al. 2008) which also revealed different gene orientations (Fig ure 1 1) The exception is Western X disease phytoplasma which may have only one copy of the rRNA operon (Kirkpatrick et al. 1987). Phytoplasma ribosomal RNA operons also contain a tRNA Ile in the intergenic spacer between the 16S and the 23S rRNA genes (R azin et al. 1998; Smart et al. 1996). Although analysis of the 16S rRNA gene is the primary parameter for classification of phytoplasmas the 23S rRNA gene which is almost twice the size of the 16S rRNA gene has potential to provide additional informatio n for differentiating strains (Guo et al. 2000) Successful differentiation of the 16SrIV (LY and TPD) strains using 23S rRNA gene including the TPD strain infecting S. palmetto remain to be explored. The 16S 23S I ntergenic S pacer R egion Length and nucle otide polymorphisms of the 16S 23S intergenic spacer (IGS) region between the 16S rRNA and the 23S rRNA genes offer s an alternative for classification of phytoplasmas. The IGS region is less conserved than the 16S rRNA gene, has fewer evolutionary constrai nts and has proved useful in classifying subspecies of the gram positive bacterium Clavibacter michiganensis (Li and DeBoer 1995). This IGS region of phytoplasmas also has a highly conserved tRNA Ile flanked by variable regions (Lim and Sears 1989; Kuske a nd Kirkpatrick 1992) The se qualities make it useful for detection and differentiation of closely related phytoplasma strains. T he classification scheme of Lee and associates ( 1998 ) which groups phytoplasmas

PAGE 25

25 according to RFLP profiles of the 16S rRNA gene when combined with sequence analysis of ribosomal protein genes categorize s phytoplasmas causing lethal diseases of palms as members of group 16SrIV, with the TPD ( P. canariensis ) phytoplasmas infecting palms in coastal southwestern Texas (Harrison et al 2002 b ) and other palm species in west central Florida (Harrison et al. 2008 2009 ) as subgroup 16SrIV D strain Although a preliminary analysis of the 16S rRNA gene identified the TPD phytoplasma infecting S. palmetto as subgroup 16SrIV D strain a popul ation wide survey would allow determin ation of the diversity of the strain population in Florida and the qualities of the 16S 23S region spacer would be useful for accomplish ing th is task. nusA G ene T he nusA gene like the 16S rRNA gene is ubiquitous and conserved among bacteria (Borukhov et al. 2005). T he branching order of a phylogenetic tree inferred from the nusA gene sequence was similar to the branching order inferred from the 16S rRNA gene sequence for the same phytoplasma isolates (Shao et al. 2006 ) suggesting that this gene has a potential for strain typing The consistency of the nusA gene in resolving phytoplasma strains was also demonstrated by correlations between nusA phylogenetic trees with trees inferred from the sequences of ribosomal prote in genes (Lee et al. 2004) tuf gene sequences (Schneider et al. 1997; Marcone et al. 2000) as well as glycoprotease gene sequences (Davis et al. 2003). This demonstration of nusA as a pertinent taxonomic tool argued for using nusA to differentiate betwee n the TPD and the LY phytoplasmas hfl B G ene U ntil a wider array of gene s equ e nces became available t he scope of strain differentiation in phytoplasmas was restricted to the conserved 16S rRNA gene (Lorenz

PAGE 26

26 et al. 1995 ; Martini et al. 2008; Seemller and S chneider 2007; Danet et al. 2008). Information generated from completing the sequences of four phytoplasma genomes has made it easier to find genes that have a potential for strain differentiation. In most bacteria th e hfl B gene is present as a single cop y but up to 24 copies may be present in phytoplasmas (Bai et al. 2006; Arashida et al. 2008). Because the hfl B gene is present in many copies in phytoplasmas, it is reasonable to suspect that it is a critical biological component. Th is gene is possibl y as sociated with strain virulence (Beier et al. 1997; Lithgo w et al. 2004). Characterizing the hfl B gene, which possibl y has adaptive traits, could give clues to the adaptability of group 16SrIV phytoplasmas. Its inclusion in the differentiation of TPD and LY phytoplasma s was based on its success in resolving Candidatus Seemller and Schneider 2007). O sialoglycoprotein E ndopeptidase G ene the G lycoprotease ( gcp ) G ene Phytoplasmas share a common gcp gene that is derived from thei r bacterial ancestors. This is clearly shown by the homology of portions of the phytoplasmal gcp gene with bacterial gcp genes. Only one copy of the gcp gene is present in phytoplasmas (Gundersen et al. 1994) The protein encoded by the gcp gene O galacto sidase endopeptidase is possibl y a host adaptation and virulence factor and is a member of the M22 peptidase family ( Rawlings and Barret 1995 cited by Davis et al. 2003). Because branching of phytoplasmas from other bacteria shown by analysis of the gcp g ene sequence was similar to the pattern shown by the 16SrRNA gene (Gundersen et al. 1994), the gcp gene may have taxonomic value, and its ability to differentiate phytoplasmas within a 16Sr group was an objective of this project. In th e study reported here in the sequence of the gcp gene in the TPD phytoplasma was compared with sequences of the gene in other phytoplasma strains.

PAGE 27

27 Problem Statement and Purpose of the S tudy Since the first record of TPD in S. palmetto in west central Florida in 2008 initial work was directed at identifying this new phytoplasma strain using sequence analysis of 16S rRNA gene. In this initial DNA based classification a nested polymerase chain reaction (PCR) assay employing TCC TGGGCT CAGGATTAAC 3/LY16 T TGAGAATTTACGTTGTTTATCTAC AACGGGTGAGTAACACGTAAG TTAGACTGGTGGGCCTAAATG followed by restriction fragment length polymorphism of the resulting PCR product reveal ed that this phytoplasma is similar to the strain previously a ffecting P hoenix canariensis, P. dactylifera P. sylvestris and Syagrus romanzoffiana in Texas and Florida (Harrison et al. 200 9 ). This preliminary work set the stage for complete elucidation of the TPD phytoplasma infecting S. palmetto Although the phyto plasma strain ha s been classified based on the 16S rRNA sequence as subgroup 16SrIV D many questions still remain ed For example, h ow different is the TPD phytoplasma associated with diseased S. palmetto from the LY phytoplasma that infects C nucifer a an d from the TPD phytoplasma previously associated with P canariensis in Texas and Florida and from other palm associated phytoplasma strains distributed throughout Mexico, the Caribbean and Africa? This study was aimed at genetically characterizing, using informative genes, the TPD phytoplasma that in fect s S. palmetto in Florida and whe re possible compare this pathogen with the TPD strain infecting P. canariensis the coconut LY phytoplasma, and other strains from symptomatic C. nucifera or other palms in different geographic locations

PAGE 28

28 Ca ndidatus Phytoplasma asteris (o nion yellows strain ) rrnA rrnB 16S 23S 5S 5S 23S 16S Oshima et al. 2004. Ca Phytopl asma australiense rrnA rrnB 5S 23S 16S 5S 23S 16S Tran Nguyen et al. 2008. Ca. Phytoplasma asteris ( ) rrnA rrnB 16S 23S 5S 5S 23S 16S Bai et al. 2006 Ca Phytoplasma mali rrnA rrnB 16S 23S 5S 16S 23S 5S Kube et al. 2008. Ca Phytoplasma palmae (16SrIV A phytoplasma causing lethal yellowing of Cocos nucifera ) rrnA rrnB 16S 23S 5S 16S 23S 5S (N. Harrison, u npublished data ) Figure 1 1. Orientation of genes of the ribosomal RNA operon of five phytoplasma species rrn stands for ribosomal RNA operon.

PAGE 29

29 A B C D Figure 1 2 The syndrome of T exas Phoenix d ecline in Sabal palmetto caused by a 16SrIV D phytoplasma in Hillsborough county in west central Florida. A) Initial stages of the disease beginning with the lower leaves. B) The disease has advanced to mid crown. C) The spear leaf and inflor escences are dead. D) The entire palm is dead (see white arrow).

PAGE 30

30 CHAPTER 2 MOLECULAR SURVEY OF THE TEXAS PHOENIX DECLINE PHYTOPLASMA POPULATION Introduction Until the 1980s differentiation and classification of phytoplasmas relied solely on biological pr operties such as host plant range specificity vector, geographic distribution and symptom differences on affected plants. Because determination of biological properties is time consuming and sometimes unreliable, there was a need to develop more efficient and reliable methods of study. Nucleic acid based methods introduced in the late 1980s for studies in phytoplasmas have been less time consuming and more reliable (Lee et al. 2000; Bertaccini 2007). To date numerous phytoplasma universal primer pairs for use in polymerase chain reaction (PCR) assays have been designed making detection and differentiation of phytoplasmas more practical. According to molecular analyses based on the PCR amplified 16S rRNA gene phytoplasmas form a distinct monophyletic clade within the class Mollicutes (Gundersen et al. 1994; Lim and Sears 1992). Although the 16S rRNA gene is informative in phytoplasma classification its usefulness in differentiat ing closely related phytoplasmas ha s been limited because of its relatively hi gh level of conservation. Similarities in the 16S rRNA gene between two distinct phytoplasma 16Sr groups range from 88 to 94% and between two subgroups within a given 16Sr group from 95 to 98% (Gundersen et al. 1994). When classifying closely related phyto plasmas the non transcribed intergenic spacer (IGS) between the 16S rRNA and the 23S rRNA may offer more variation because of less evolutionary constraints on this region than on the 16S rRNA gene (Barry et al. 1991). The 16S 23S intergenic spacer has a h ighly conserved tRNA Ile flanked by variable regions (Lim and

PAGE 31

31 Sears 1989; Kuske and Kirkpatrick 1992 ) Its usefulness was demonstrated when it successfully reinforced clustering of phytoplasmas based on the well characterized 16S rRNA gene (Kirkpatrick et a l. 1994). Association of the T exas P hoenix decline (TPD) phytoplasma with the native sabal or cabbage palm ( S abal palmetto ) has caused great concern as its biology its genetic characteristics and the extent of devastation to be expected we re not known. Th e purpose of this work was to survey the composition of the TPD phytoplasma population in west central Florida using the 16S 23S rRNA intergenic spacer region sequence Reference strains of the lethal yellowing (LY) and other decline phytoplasmas from beyo nd the west central Florida region were included for comparative purposes Materials and Methods Plant Material and DNA E xtraction Samples were taken from symptomatic plants The first set of samples ( a total of 2 4 ) consisting of interior tissue shavings w as collected from the lower stems of symptomatic S. palmetto plants with foliar symptoms indicative of decline in west central Florida. Samples were harvested from symptomatic p alm s in the adjacent counties of Hillsborough and Manatee w h ere diseased S. pal metto were most numerous A second set of stem samples was obtained from nine symptomatic Phoenix p alms [ ( Canary Island date ( P. canariensis ) edible date ( P. dactylifera ) and silver date ( P. sylvestris ) ] one symptomatic Q ueen palm ( Syagrus romanzoffiana ) and one symptomatic Mexican fan palm ( Washingtonia robusta ) The latter samples also originated mostly from palms in Hillsborough and Manatee counties, however, three were from pa l ms in Sara s o t a county. Th e s econd set of samples also formed part of a prev ious study reported by Harrison et al. ( 2008 ) A final set of samples w ere obtained from apical bud tissues from

PAGE 32

32 a symptomatic S. palmetto palm in west central Florida (Sabal1) a symptomatic Cocos nucifera palm from Broward county in southeastern Florida (LYFL) a symptomatic C. nucifera p alm in Jamaica (LYJAM) and a symptomatic palm in Mexico (LYMEX5) Information on the phytoplasma samples is given in Table 2 1 Stem samples we re removed from palms by drilling the stem using a portable electric drill fit ted with a wood boring bit as previously described (Harrison et al. 2002 b ) and shavings we re collected into clean sealable plastics b ags. Apical bud tissues were collected by felling the palm and excising immature leaf bases of the stem apex. Total n uclei c acid s were extracted from 3 g quantities of stem tissue or from 100 g of bud tissues. DNA from bud tissues was extracted following the phytoplasma enrichment method of Harrison and associates (1994). From stem tissue, DNA was extracted using CTAB extract ion buffer according to the procedure of Doyle and Doyle (1990). Nucleic acid was precipitated with 95% ethanol and pellets were recovered by centrifugation at 12000 x g for 15 min. The pellets were resuspended in 200 L TE buffer (10 mM Tris, 1 m M ethylen ediaminetetraacetic acid [EDTA, pH 8]). Presence of DNA in the pellets was confirmed by agarose gel electrophoresis. Polymerase Chain R eaction DNA preparations from the symptomatic plants were evaluated by PCR assay, together with a negative control which consisted of DNA from a healthy plant and a water control (no DNA template). The PCR reaction was conducted using primer pair 16S1064F TTG GAG GAAGGTGGGGATTAC TTCGCCTTTCCCTCACGGTACT TPD 16 23SF AGCTTAAACGCGAGTTTTTGGCAA TPD 16 23SR 5' GTTTCGCTCGTCGCTACTACCAGA 3' for the nested reaction. The s e primers were

PAGE 33

33 designed specifically for this study to amplify the 16S 23S rRNA IGS region Each PCR reaction contained 33.8 L H 2 O; 5 L buffer (1.675 L H 2 O; 1.25 L 1 M KCl; 1 L 1 M Tris; 0.5 L 5% Tween 20; 0.5 L 1% gelatin; 0.075 L 1 M MgCl 2 ); 0.1 g of each of the two primers; 0.04 mM of each of the dNTPs and 0.2 L Taq DNA polymerase. The total volume per reaction wa s 50 L and the reaction was run for 35 cycles. Each cycle was and 3 min at The 35 thermal cycles were a 7 min final L of the PCR mixture w as mixed with 7 L of gel l oading dye, electrophoresed through 1% agarose gel using TAE buffer (40 mM Tris acetate, 1 mM EDTA) and visualized by UV transillumination following staining with ethidium bromide. Cloning PCR products were purified using Wizard PCR preps pu rification kit (Promega Corp, Madison, WI ) and then were quantified by visualizing on agarose gel with a serial dilution of uncut lambda DNA. The PCR fragments were ligated (mixed with and T vector (Promega Corp, Madison, WI ). The ligated PCR product was transformed into Top 10 chemically competent Escherichia coli cells (Invitrogen Life Technologies, Carlsbad, CA, USA) The transformed bacterial cultures were grown Luria Bertani (LB) media amended with isopropyl D 1 thiogalactopyranoside and X gal for blue/white colony screening. After 24 hour incubation white colonies which were regarded as carryi ng the cloned PCR fragment were selected, inoculated into LB hours. Cells were lysed using lysis buffer, to recover the ligated plasmid vectors. The plasmids were purified, resuspended in TE buffer a nd sent for sequencing. Sequencing

PAGE 34

34 of cloned fragments was done using the M13 forward and M13 reverse primers by the Gainesville Sequence A nalysis Sequences of the cloned fragments were assem bled with SeqMan software searching was performed using BLAST in NCBI (website: http://www.ncbi.nlm.nih.gov/BLAST). Sequences were compared pairwise using ClustalW (Larkin et al. 200 7). Almost all sequences were submitted to NCBI. A phylogenetic tree was constructed from the alignment by the neighbor joining method using MEGA 4.1 s oftware (Tamura et al. 2007). Only sequences from a subset of the strains were used to infer the phylogen etic tree. Restriction Fragment Length Polymorphisms P olymerase chain reaction products of the PCR amplified 16S 23S intergenic spacer region were digested separately using restriction enzymes, Ase I, Hha I and Rsa I ( New England BioLabs, Waverley, MA, USA ) a t 37C for a minimum of 16 h. Th e s e enzymes best differentiate d between the phytoplasma strains as shown in a virtual test of sequence data using pDRAW32 (AcaCl one, http://www.acaclone.com). Products of the restriction digests were separated by electrophor esis through 8% denaturing polyacrylamide gel in TBE buffer (90 m M Trisborate, 2 m M EDTA). Profiles were visualized using a UV transillumination following staining with ethidium bromide. Results and Discussion From DNA samples from 3 9 symptomatic p alms P CR fragments ca. 800 bp in length were amplified by nested PCR a s say No amplification of products was observed in reactions containing DNA from the healthy palm or the water control (Fig ure 2 1).

PAGE 35

35 Assembled nucleotide sequences derived from PCR fragments w ere submitted for similarity analysis using BLAST to http://www.ncbi.nlm.nih.gov/BLAST Significant BLAST matches of phytoplasma origin gave assurance that the PCR fragments were amplified from phytoplasma DNA Based on analysis of RFLP profiles generated by digestion of each amplified PCR fragment with Ase I restriction enzyme, 16SrIV D strains all ha d the same profiles which were distinct from the profiles attributed to 16SrIV A strains (Figure 2 2) However, SP6 and SP7 sample s obtained from S. palmetto had each an additional band which distinguished them from all other TPD samples This could be a result of heterogeneity between the ribosomal RNA operons possessed by phytoplasmas, assuming that 16SrIV D phytoplasmas have more than one ribosomal operon co p y Two samples (BCT and VW), each containing a mixture of strains 16SrIV A and 16SrIV F had different profiles, one was most similar to the 16SrIV D sub group of strains and the other similar to the 16SrIV A group. The segregation of the mixed strains in this manner was probably due to selective PCR amplification of one strain in the mixture. The 16SrIV D strain in S. romanzoffiana and the 16SrIV F strain collected from W. robusta had Ase I RFLP profiles most similar to those of the TPD strains. Restrictio n enzyme Hha I differentiated the strains similarly except that two strains collected from S. palmetto (SP6 and SP7 ) showed unique profile (Figure 2 2) Restriction enzyme Rsa I also differentiated the strains similarly with SP6 and SP7 again showing unique profiles (Figure 2 2 ). Restriction fragment digestion by Rsa I of the S5 PS PCR amplified fragment revealed a probable mixed infection. The secondary bands

PAGE 36

36 in some samples in the RFLP profiles are common whenever DNA is amplified from palm samples, and prob ably indicating non specific PCR amplification. The phylogenetic tree that was inferred from the sequence comparisons of the 16S 23S intergenic spacer region showed that all 16SrIV D strains tested were similar and clustered separately from the 16SrIV A strains (Figure 2 3) as in the RFLP profiles, with strains VW and BCT that each represented a 16SrIV A and 16SrIV F mix ture segregating (falling into different clusters BCT was similar to 16SrIV A strains and VW to 16SrIV D strains ) as in the RFLP profil es and SP6 and SP7 that showed unique RFLP profiles clustering with other TPD strains. Texas Phoenix d ecline phytoplasma was first reported in S. palmetto in west central Florida in 2008 (Harrison et al. 2009). Although a similar phytoplasma had been previ ously reported in P canariensis in Corpus Christi, Texas and in west central Florida, the attack of S. palmetto by a phytoplasma caused grave concern because S. palmetto is a native species important in the natural landscape of the state of Florida and ot her states in the southern USA. Characterizing the pathogen population was important in order to understand the phytoplasma population diversity. The 16S 23S intergenic spacer region was chosen in this analysis because it has s ufficient heterogeneity to di fferentiate phytoplasma strains that are closely related. Sequence analysis of 16S 23S rRNA intergenic spacer region from the strains representing the population of the TPD phytoplasma in west central Florida show ed that in this region of Florida the phyto plasma population is homogenous. Th e homogeneity of the TPD phytoplasma is found across host palm species ( S. palmetto Phoenix spp. and S. ramonzoffiana ) However, it should be understood that this conclusion was based only on sequence analysis of the 16S 23S intergenic spacer

PAGE 37

37 region and that other parts of the genome might reveal differences between the phytoplasma strains that were homogenous based on the ribosomal intergenic spacer region Sequence homogeneity of the 800 bp 16S 23S intergenic spacer reg ion could also mean that only one strain of the phytoplasma was introduced into west central Florida and since its introduction this strain has multiplied and spread throughout this part of the state. Should this be the case, prediction of the TPD epidemi c should be easier tha n if the phytoplasma population had been heterogeneous Presently t he question still remains about the apparent sudden extension of the host to include S. palmetto Further characterization of the 16SrIV D usi ng other regions of the g enome i s necessary to determine the genetic basis of host specificity of 16Sr IV D phytoplasma s. T he clustering of the phytoplasma strains included in this study was significantly correlated with 16Sr IV sub group designation (Table 2 1 and Figure 2 3). In so me instances rRNA gene nucleotide polymorphisms may imply biological differences For instance, i n ash yellows phytoplasma differ ences in rDNA RFLP patterns were correlated with differences in aggressiveness (Sinclair et al. 2000; Sinclair and Griffiths 2 000).

PAGE 38

38 Table 2 1. Phytoplasma s amples included in the study listed with palm host species, location and strain identi ty The location is a Florida, U nited S tates of A merica county unless otherwise stated Phytoplasma s ample i dentity Palm species Location Phytoplasma strain identity EGS1 Sabal palmetto Hillsborough 16SrIV D EGS2 S. palmetto Hillsborough 16SrIV D EGS3 S. palmetto Hillsborough 16SrIV D EGS4 S. palmetto Hillsborough 16SrIV D EGS5 S. palmetto Hillsborough 16SrIV D EGS6 S. palmetto Hillsbo rough 16SrIV D EGS7 S. palmetto Hillsborough 16SrIV D EGS8 S. palmetto Hillsborough 16SrIV D EGS9 S. palmetto Hillsborough 16SrIV D EGS10 S. palmetto Hillsborough 16SrIV D EGS11 S. palmetto Hillsborough 16SrIV D Sab1 S. palmetto Manatee 16SrIV D Sab 2 S. palmetto Manatee 16SrIV D Sab3 S. palmetto Manatee 16SrIV D Sab4 S. palmetto Manatee 16SrIV D Sab5 S. palmetto Manatee 16SrIV D Sab6 S. palmetto Manatee 16SrIV D Sab7 S. palmetto Manatee 16SrIV D SP1 S. palmetto Hillsborough 16SrIV D SP2 S. pal metto Hillsborough 16SrIV D SP4 S. palmetto Hillsborough 16SrIV D SP6 S. palmetto Hillsborough 16SrIV D SP7 S. palmetto Hillsborough 16SrIV D SP9 S. palmetto Hillsborough 16SrIV D Sabal1 S. palmetto Hillsborough 16SrIV D RPA Phoenix dactylifera Hills borough 16SrIV D PC1 P. canariensis Hillsborough 16SrIV D PC2 P. canariensis Hillsborough 16SrIV D SEG P. canariensis Hillsborough 16SrIV D SA1 P. canariensis Manatee 16SrIV A S1 QP Syagrus romanzoffiana Manatee 16SrIV D S5 PS P. sylvestris Manatee 1 6SrIV D VW P. dactylifera Sarasota 16SrIV A and 16SIV F BCT P. dactylifera Sarasota 16SrIV A and 16SIV F PCT3 P. canariensis Texas USA 16SrIV D FP Washingtonia robusta Sarasota 16SrIV F LYFL Cocos nucifera Broward 16SrIV A LYJAM C. nucifera Jamaica 16SrIV A LYMEX5 C. nucifera Mexico 16SrIV A

PAGE 39

39 M Figure 2 1 Agarose gel showing polymerase chain reaction amplification of the 16S 23S intergenic spacer r egion The fragment (ca. 800 bp) was amplified from DNA extracted from symptomatic palm samples included in th is study. The first lane (marked by M) represents uncut lambda DNA which was used as a size marker and t he last two lanes show no amplification and represent a healthy plant control and a water control (no DNA t emplate) respectively 800 bases

PAGE 40

40 A B C D E F G H I Figure 2 2. Restriction fragment length profiles of phytoplasma DNA (ca. 800 b p ) amplified from symptomatic palms. See Table 2 1 for sample identity The PCR amplification was done by primer pair 16S1064F /23SRev followed by primer pair TPD 16 23SF / TPD 16 S 23SR A C) D igestion was with Ase I D F ) D igestion was with Hha I and G I ) D igestion was with Rsa I M stands for t he pGEM molecular size (bp) markers in descending order: 2465, 1605, 1198, 676, 517, 460, 396, 350, 222, 179, 126, 75, 65, 51 and 36 M EGS1 EGS2 EGS3 EGS4 EGS5 EGS6 EGS7 EGS8 EGS9 EGS10 EGS11 FP Sabal1 M Sab1 Sab2 Sab3 Sab4 Sab5 Sab6 Sab7 SP1 SP2 SP4 SP6 SP7 SP9 M RPA PC1 PC2 SEG SA1 S1 QP S5 PS VW BCT PCT3 LYFL LYJAM LYMEX M EGS1 EGS2 EGS3 EGS4 EGS5 EGS6 EGS7 EGS8 EGS9 EGS10 EGS11 Sabal1 M Sab1 Sab2 Sab3 Sab4 Sab5 Sab6 Sab7 SP1 SP2 SP4 SP6 SP7 SP9 M EGS1 EGS2 EGS3 EGS4 EGS5 EGS6 EGS7 EGS8 EGS9 EGS10 EGS11 Sabal1 M Sab1 Sab2 Sab3 Sab4 Sab5 Sab6 Sab7 SP1 SP2 SP4 SP6 SP7 SP9 M RPA PC1 PC2 SEG SA1 S1 QP S5 PS VW BCT PCT3 LYFL LYJAM LYMEX FP M RPA PC1 PC2 S EG SA1 S1 QP S5 PS VW BCT PCT3 LYFL LYJAM LYMEX FP

PAGE 41

41 Figure 2 3. Inferred molecular relationship s of phytoplasma strains based on the 16S 23S intergenic spacer sequence. The tree was constructed by the neighbor joining method and bootstrap values are shown on branches. rrn me ans ribosomal RNA operon. The National Center for Biotechnology Information ( www. ncbi .nlm.nih.gov) GenBank accession numbers are written in brackets. SP6 ( HQ438074) S5 PS (HQ438065) SP7 ( HQ414250) Sabal1 (HQ414252) PC1 (HQ438060) VW (HQ438066) Sab1 (HQ438224) PCT3 (HQ438067) RPA (HQ438059) S1 QP (HQ438064) FP (EU241512) BCT (EU241516) LYFL rrna (100% similar to EU241516.1) SA1 (HQ438063) LYMEX5 (HQ414261) LYJAM (HQ414262) LYFL rrnb (100% similar to EU241516.1) Acholeplasma laidlawii (FJ590758.1) 92 93 0.05

PAGE 42

42 CHAPTER 3 DIFFERENTIATION OF P HYTOPLASMA STRAINS C AUSING DECLINE OF SABAL PALMETTO AND COCONUT LETHAL YELLOWING BASED ON S EQUENCES OF THE RIBOSOMAL RNA OP ERON Introduction According to n ested polymerase chain reaction (PCR) assays using primers P1m/LY16 23Sr followed by LY16Sf2/LY 16 23Sr2 and subsequent sequence analysis of the amplified fragment, as well as restriction fragment length polymorphisms (RFLPs) of the PCR product the lethal decline of sabal or cabbage palm ( Sabal palmetto ) observed in west central Florida in 2008 appear s similar to the Texas Phoenix decline ( TPD ) phytoplasma originally causing decline of the Canary Island date palm ( Phoenix canariensis ) in Texas the same strain which was later recorded in edible date ( P. dactylifera ), silver date ( P. sylvestris ), Queen ( Syagrus romanzoffiana ) palms and also in P. canariensis in west central Fl orida The phytoplasma infecting S. palmetto belongs to subgroup 16SrIV D (Harrison et al. 2009). The ribosomal operon of the TPD phytoplasma infecting S. palmetto was sequenced and annotated and molecular compar isons with the operon s of other palm phytop lasma strains were performed Other strains belonging to other 16Sr groups w ere also included in these analyses. Furthermore, the usefulness of the different portions of the ribosomal operon in differentiating between palm phytoplasma strains was also inve stigated Materials and M ethods Plant Material DNA E xtraction Polymerase Chain R eaction and Cloning Some of the DNA preparations from chapter 2 (Sabal1, PCT 3, LYJAM, S5 PS, S1 QP, SA1 ) ( see Table 2 1 ) were included in this study. The sequence of the

PAGE 43

43 r ibosomal operon of LY from Florida (LYFL) had already been obtained by 454 sequencing (N. Harrison, unpublished data). Fragments of the ribosomal RNA operon were amplified with primer pairs P1 /P7; 16S1064F/23SRev; 23S25F/23S1684C; 23S 791F/23S 2757C and C 41 8640F/tRNA phe 31C (Table 3 1 ) from the DNA preparations Two controls, DNA from a healthy palm and a water control (no DNA template) were included in the analysis. PCR was conducted as described in chapter 2 For the PCR products that required cloning the cloning was performed following the procedure outlined in chapter 2. Sequence A nalysis Sequencing similarity searches and inference of molecular trees were performed as described previously in chapter 2 Ribosomal operon from an entry of Acholeplasma laidlawii ( GenBank accession number CP000896.1 ) was used to root the tree. The distance tree drawn using the neighbor joining algorithm was based on alignment performed using ClustalW (Thom p son et al. 1994) with the following settings: gap opening penalty 5.0, gap extension penalty 0.2, delay divergent cutoff 30% and DNA transition weight 0.5. Results Polymerase chain reaction p roducts of different sizes representing overlapping portions of the ribosomal operon were amplified in the PCR runs Only fr actions from the diseased palms had bands showing amplification by the five primer pairs used. No amplification was observed on the healthy palm or the water control. The PCR fragments were sequenced and failed sequencing reactions resulted in certain po rtions of the ribosomal RNA missing in some of the strains included in the study. From each of the two samples whose entire operon was sequenced [ S. palmetto from west central

PAGE 44

44 Florida (Sabal1) and C ocos nucifera from Jamaica (LYJAM)] the assembled sequenc e w as approximately 5 kb, with a G C content of ca. 44%. Further comparative analysis of the sequence of ribosomal RNA amplified from the TPD phytoplasma showed high similarity between the S. palmetto TPD and other strains included in th is study. The riboso mal operon of TPD from S. palmetto was 98% similar to each of the operons o f the LY (16SrIV A) phytoplasmas from C. nucifera or P. canariensis (Figure 3 1) Any of the ribosomal RNA portions amplified from the S. palmetto TPD phytoplasma were 100% similar to corresponding portions from any of the subgroup 16SrIV D phytoplasmas except for the near full length 16S rRNA gene of P. sylvestri s (S5 P S ) which was 99% similar to the S. palmetto TPD 16S rRNA gene (Figure 3 1 ). The gene or ientation from the assembled sequence f o r each of the strains sequenced in this study tRNA Ile gene 23SrRNAgene 5SrRNAgene tRNA Val as represented by the ribosomal RNA operon with defined boundaries for the TPD S. palmetto phytoplasma strain (Figure 3 2) Phylog enetic trees were inferred using the complete sequences of the ribosomal RNA operon obtained in this study and NCBI BLAST entries of the ribosomal RNA operon of phytoplasmas belonging to other 16Sr groups, ( GenBank accessi on number AF086621.2 ), Candidatus (GenBank a Ca Y M strain ( GenBank a Ca broom strain ( GenBank a ccession number Ca australiense ( GenBank a ccession number AM422018.1). Both ribosomal operons from each of the phytoplasma strains retrieved from NCBI and for the LY strain from C.

PAGE 45

45 nucifera in Florida were included in this molecular analysi broom for which only one ribosomal operon was analysed. Phylogenetic analysis based on the entire ribosomal operon showed that although the TPD phytoplasma infecting S. palmetto is different from the LY strains, all the 16SrIV phytoplasmas are more similar to each other than to phytoplasmas belonging to other 16Sr groups (Fig ure 3 3 ). Grouping of the phytoplasmas included for molecular analysis agree d with the widely accepted phytoplasma classification of Lee and associates ( 19 98 ) that employs RFLP profiles of the 16S rRNA gene combined with sequence analysis of ribosomal protein genes, in that group 16SrIV strains namely LY and TPD formed a distinct clade from other phytoplasma strains representing other 16Sr groups. All four phylogenetic trees inferred using either 16S rRNA, 16S 23S intergenic spacer, 23S rRNA or the entire ribosomal RNA operon differentiated the group 16SrIV strains similarly (Fig ures 3 3 3 4, 3 5 and 3 6 ). Discussion The organization of the ribosomal R NA operon found in the palm yellows phytoplasma strains whether subgroup 16SrIV A or 16SrIV D (i.e. tRNA Ile 23S ) is similar to that of Candidatus Phytoplasma asteris O Y M rrna (Oshima et al. 2004), Ca Phytoplasma asteris aster yellows witc rrna (Bai et al. 2006), Ca Phytoplasma mali rrna and rrnb (Tran Nguyen et al. 2008) and the rrns of This similarity in gene composition and orientation can be understood by studying Figure 1 1. T o amplify the 16S rRNA the universal primer pair P1 / P7 which has shown consistency in detecting phytoplasmas (Deng and Hiruki 1991; Smart et al. 1996) was used Other primers used in th is study

PAGE 46

46 were designed specifically for this study using conserved s tretches of the ribosomal operons and on the tRNA P he gene downstream of the 5S rRNA gene. The assembled ca. 5 kb sequence covered all the genes of the ribosomal operon. Alignment of the 16SrIV D phyto plasma infecting S. palmetto with LY phytoplasmas (16 SrIV A) showed that there are numerous polymorphisms between the S. palmetto TPD and the LY phytoplasma s Because those polymorphisms occur on a non coding region they are unlikely to have biological significance. Biologically, TPD and LY have been record ed in different host plant s. Texas Phoenix palm decline is prevalent in Phoenix spp. and since 2008 has been observed in S. palmetto whereas LY is associated mainly with C nucifera Presently no link between the differences in the ribosomal operons of TP D and LY to the differences in the biology of these palm yellows phytoplasma strains can be made The 2% dissimilarities i n the 16S rRNA gene between TPD and any of the LY strains is insufficient to explain the difference between these phytoplasma strains and therefore more work is needed to explore other portions of the genome. All of the molecular trees i.e. the tree s based on the entire ribosomal operon, 16S rRNA gene, 16S 23S and 23S rRNA gene we re similar which suggest ed that ribosomal operon g enes evolve uniformly. This similarity in strain clustering shown with the analysis using the different ribosomal portions is in agreement with analysis of the Ca Phytoplasma genus by Hodgetts and associates ( 2008 ) who showed that trees inferred with 16S rRNA, 16S 23S intergenic spacer region and 23S rRNA ar e similar except for differences in branch lengths. Because the 16S rRNA gene is highly conserved and offers little use in differentiating closely related phytoplasma strains, the

PAGE 47

47 16S 23S intergenic spacer and 23S rRNA were also used to differentiate between phytoplasmas belonging to 16SrIV group. The 23S rRNA gene which is almost twice the size of the 16S rRNA gene was expected to provide additional information for differentiating the strains becaus e previous work conducted on the 23S rRNA gene show ed that this gene is useful in differentiating phytoplasma groups with the potential for finer differentiation among the groups (Guo et al. 2000). The 100% sequence similarity between the TPD strain from S palmetto and other decline strains from Phoenix spp. and S. romanzoffiana may mean that a common 16SrIV D strain infects all these palm species. Although the first record of TPD in the southern USA was made in P. canariensis in Texas, it cannot be conclu ded that Texas is the original source of TPD. The phytoplasma could have long been in west central Florida. Because the vector for the phytoplasma is not known, it is difficult to trace the movement of the phytoplasma. The difference between 16SrIV D and 1 6SrIV A phytoplasmas ha d already been demonstrated in previous studies (Harrison et al. 2008: Harrison et al. 2009). Studies on palm phytoplasmas have so far shown that the hosts for 16SrIV D phytoplasmas are Phoenix spp., S. romanzoffiana and S. palmetto and those of 16SrIV A phytoplasmas are C nucifera and Phoenix spp. (Harrison et al. 2008). Presently no host determinants have been discovered in these phytoplasmas and therefore the potential host range for each is not known. Because of this, it is im portant to monitor the landscape and sample tissue from symptomatic palms to identify new palm phytoplasma associations.

PAGE 48

48 Table 3 1. Primers and product size of p olymerase chain reaction a mplification of ribosomal RNA operon genes The gene s were amplified from coconut lethal yellowing phytoplasma from Jamaica (LYJAM) and from the Texas Phoenix decline ( Sabal1 ) phytoplasma infecting Sabal palmetto in Florida. Primer pairs Size of the amplified fragment (base pairs) LYJAM Sabal1 R eferences for the primers AAGAGTTTGATCCTGGCTCAGGATT CGTCCTTCATCGGCTCTT 1847 1849 Deng and Hiruki 1991 Kirkpatrick et al. 1994 1117 1106 This study This study 1626 1626 This study This study 23S 23S 1969 1969 This study This study C41 tRNA phe 807 867 This study This study The phytoplasma s amples listed are the ones wh ose entire ribosomal operon was sequenced in this study.

PAGE 49

49 Figure 3 1 Sequence compa rison of the ribosomal RNA operon Texas Phoenix decline (TPD) phytoplasma (isolate Sabal1) was compared with other phytoplasma strains sampled from palms showing symptoms of lethal yellowing (LY) and decline. The numbers indicate base positions on the Sab al1 operon. Red lines indicate 100% sequence similarity, green 99%, and brown 98%. Strai ns compared are LY from Cocos nucifera in Jamaica (LYJAM), LY phytoplasma from C. nucifera in Florida (LYFL), TPD strain from Phoenix canariensis in Texas (PCT4), TPD s train from P. sylvestris in Florida (S5 PS), TPD strain from Syagrus romanzoffiana in Florida (S1 QP) and an LY strain from P. canariensis in Florida (SA1). rrn stands for ribosomal RNA operon. The diagram is not drawn according to scale. The sequences are represented in

PAGE 50

50 Figure 3 2 Schematic representation of the ribosomal operon of the Texas Phoenix decline phytoplasma strain isolated from S abal palmetto Numbers represent base positions of the boundaries of the four genes that make up the operon as well as the tRNA Val downstream of the 5S rRNA gene

PAGE 51

51 Fig ure 3 3 Inferred molecular relationship of phytoplasma strains based on ribosomal RNA operon (rrns) Genes 16S rRNA: tRNA Il e : 23S rRNA: 5S rRNA were analyzed using the neighbor joining method. For lethal yellowing strain from Florida (LY FL ) Ca ndidatus Phytoplasma mali Ca P hytoplasma australiense Ca P hytoplasma asteris (OY M strain ), and Ca P hytoplasma asteris Ast broom (AYWB) both ribosomal RNA copies were included whereas one copy was included for Texas Phoenix decline ( Sabal1) phytoplasma and the lethal yellowing strain from Jamaica (LYJAM). Phytoplasma strains that had their ribosomal RNA operon sequenced in this study are in bold type. Numerical labels at branch nodes are for bootstrap values. National Center for Biotechnology Information ( www. ncbi .nlm.nih.gov ) GenBank accession numbers are written in brackets.

PAGE 52

52 Coconut LYFL rrna ( HQ613874) Coconut LYFL rrnb ( HQ613875) Coc onut LYJAM rrn ( HQ613873) Sabal TPD rrn ( HQ613895) Loofah witches broom rrn (AF086621.2) Ca CU469464.1) Ca CU469464.1) Ca AM422018.1) Ca AM422018.1) Ca M rrnb ( AP006628.2) Ca M rrna ( AP006628.2) Ca WB rrna ( CP000061.1) Ca WB rrnb ( CP000061.1) Acholeplasma laidlawii rrna ( CP000896) 100 82 100 100 100 100 69 100 100 100 100 0.01

PAGE 53

53 Fig ure 3 4 Inferred molecular relationship of phytoplasma strains based on 16S ribosomal RNA (rrns) gene using the neighbor joining method. For lethal yellowing strain from Florida (LY FL ) Candidatus Phytoplasma mali Ca. P hytoplasm a australiense Ca P hytoplasma asteris (OY M strain ), Ca P hytoplasma asteris Aster yellows witches broom (AYWB) both ribosomal RNA copies were included whereas one copy was included for Texas Phoenix decline ( Sabal1) phytoplasma and the leth al yellowing strain from Jamaica (LYJAM). Phytoplasma strains that had their 16S rRNA gene sequenced in this study are in bold type. Numerical labels at branch nodes are for bootstrap values. National Center for Biotechnology Information ( www. ncbi .nlm.nih. gov ) GenBank accession numbers are written in brackets.

PAGE 54

54 LYFL rrna ( HQ613874) LYFL rrnb ( HQ613875) LYJAM rrn ( HQ613873) Sabal1 rrn ( HQ613895) Loofah witches broom phytoplasma (AF086621) Ca CU469464.1) Ca CU469464.1) Ca verted) (AM422018.1) Ca Ca M rrna operon (AP006628.2) Ca M rrnb operon (AP006628.2) Ca Ca Acholeplasma laidlawii rrna (CP000896) 100 79 97 100 10 0 93 100 100 99 100 94 0.01

PAGE 55

55 Figure 3 5 Inferred molecular relationship of phytoplasma strains based on 16S 23S intergenic spacer using the neighbor joining method. For l ethal yellowing strain from Florida (LY FL ) Candidatus Phytoplasma mali Ca. P hytoplasma australiense Ca P hytoplasma asteris (OY M strain ), Ca P hytoplasma asteris Aster yellows witches broom (AYWB) both intergenic spacer copies were inclu ded whereas one copy was included for each of Texas Phoenix decline ( Sabal1) phytoplasma and lethal yellowing strain from Jamaica (LYJAM). Phytoplasma strains that had their 16S 23S intergenic spacer sequenced in this study are in bold type. Numerical lab els at branch nodes are for bootstrap values. National Center for Biotechnology Information ( www. ncbi .nlm.nih.gov) GenBank accession numbers are written in brackets.

PAGE 56

56 Ca M rrna operon (AP006628.2 ) Ca M rrnb operon (AP006628.2) Ca Ca Ca Ca 422018.1) Ca CU469464.1) Ca CU469464.1) Loofah witches broom phytop lasma (AF086621) Sabal1 rrn ( HQ613895) LYJAM rrn ( HQ613873) LYFL rrna ( HQ613874) LYFL rrnb ( HQ613875) Acholeplasma laidlawii rrna (CP000896) 100 69 100 100 99 100 67 100 90 61 99 0.02

PAGE 57

57 Figure 3 6 Inferred molecular relationship of phytoplasma strains based on 23S ribosomal RNA (rrns) gene using the neighbor joining method. For lethal yellowing strain from Florida (LY FL ) Candidatus Phytoplasma mali Ca. P hytoplasma australiense Ca P hytoplasma asteris (OY M strain ), Ca P hytoplasma asteris Aster yellows witches broom (AYWB) copies from both ribosomal RNA operons were included whereas one copy was includ ed for Texas Phoenix decline ( Sabal1) phytoplasma and lethal yellowing strain from Jamaica (LYJAM). Phytoplasma str ains sequenced in this study are in bold type. Numerical labels at branch nodes are for bootstrap values. National Center for Biotechnology Information ( www. ncbi .nlm.nih.gov ) GenBank accession numbers are written in brackets.

PAGE 58

58 LYFL rrna ( HQ613874) LYFL rrnb ( HQ613875) LYJAM rrn ( HQ613873) Sabal1 rrn ( HQ613895) Loofah witches broom phytoplasma (AF086621) Ca CU469464.1) CU469464.1) Ca ) (AM422018.1) Ca Ca M rrna operon (AP006628.2) Ca M rrnb operon (AP006628.2) Ca Ca Acholeplasma laidlawii rrna (CP000896) 100 87 100 100 100 100 44 100 100 100 100 0.01

PAGE 59

59 CHAPTER 4 GENETIC CHARACTERIZATION OF SUBGROUP 16S r IV D PHYTOPLASMA INFECTING SABAL PALMETTO USING HFL B NUSA AND GLYCOPROTEASE GENE SEQUENCE S Introduction Based on consistent observations of phytoplasmas in symptomatic tissues of palms gr owing in Florida lethal diseases of palms are caused by phytoplasmas in that part of the world (Thomas 1979). In addition, remission of symptoms on palms in response to tetracycline treatment further implicates phytoplasmas as the causal agents of palm le thal diseases in Florida (McCoy et al. 1983 ). The Texas Phoenix decline (TPD) phytoplasma identified in sabal or cabbage palm ( Sabal palmetto ) in west central Florida in 2008 had to be characterized to elucidate its identity and based on the sequence of p ortions of the ribosomal RNA operon this phytoplasma is similar to the TPD strains found in Canary Island date ( Phoenix canariensis ), edible date ( P. dactylifera ), silver date ( P. sylvestris ) and Queen ( Syagrus romanzoffiana ) palms and different from all known subgroups 16SrIV A strains associated with Cocos nucifera and P. canariensis (Harrison et al. 2009) By c haracterization of the ribosomal RNA operon of the phytoplasma strain from S. palmetto it was found that this strain was similar to an already k nown strain i.e. the strain that in fects Phoenix spp. and S. romanzoffiana and different from all 16SrIV A strains However, since S. palmetto was a new host and also an endemic palm species, more characterization of the phytoplasma strain was n ecessary The purpose of this study was to amplify, sequence and characterize the nusA hfl B and gcp gene s from the subgroup 16SrIV D phytoplasma causing TPD in S. palmetto and use the obtained sequenc es to compare S. palmetto TPD with other TPD

PAGE 60

60 strains found in P hoenix spp. and S. romanzoffiana as well as with palm lethal yellowing (LY) and LY like phytoplasma strains collected from different geographic localities. Materials and M ethods Plant Material and Polymerase C hain R eaction Details of samples used in the e xperiment are illustrated in Table 4 1. For the nusA gene n ested polymerase chain reactions (PCR) were conducted using the primer pair nusA F1 /nusA R1 followed by nusA F2/nusA R2 For the t wo copies of the hfl B gene PCR amplification was done using primer s hflB2 f1/ hflB2 r1 for one copy and primer s hflB1 f2 / hflB1 r2 for the other copy The nested PCR assay for the gcp gene required GCPF3 / GCPR2 for the primary a nd GCPF1 / GCPR1 for the nested run. Primer sequences for the PCR amplifications are listed i n Tabl e 4 2. PCR and PCR product purification were conducted as previously described in chapter 2 except that the annealing temperature was 50 C in the nusA gene PCR runs and 56 C in the hfl B gene PCR runs Cloning S equencing and Restriction Fragment Length Polymorphisms Cloning and s equencing PCR fragments was conducted according to the procedure explained in chapter 2. Analysis of restriction fragment length polymorphism was performed on the PCR fragments of the nusA hfl B and gcp genes. For the nusA gene, the restriction enzymes used were Dde I, Eco RI Hha I and Rsa I (incubation at 37C for a minimum of 16 h ). For the hfl B gene, s eparate digest ions of the obtained PCR products were performed using for the primers hflB2 f1/ hflB2 r1 restriction enzymes Alu I Apo I, Dra I Eco RI Hha I Hind III, Mse I Rsa I, Sau 3AI Ssp I and Taq I and for the hflB1 f2 / hflB1 r2 PCR product Alu I Apo I, Ase I, Bst U I Dde I, Dra I, Hae I II Hha I, Hind III, Mse I, Sau 3AI, Ssp I and Tsp I. For the gcp gene Rsa I w as selected for the RFLP

PAGE 61

61 analysis. The se restriction enzymes were purchased from New England BioLabs, Waverley, MA, USA. V irtual test s performed on pDRAW32 (AcaClone, http: //www.acaclone.com ) preceded the actual RFLP experiment Products of the restriction digests were separated by electrophoresis through 8% denaturing polyacrylamide gel in TBE (90 m M Trisborate, 2 m M EDTA) buffer. Profiles were visualized using a UV transil lumination following staining with ethidium bromide. Sequence A nalysis Sequences of the amplified DNA fragments of the nusA hfl B and gcp gene s from tissue of the symptomatic plants examined were assembled as described in chapter 2 D atabase similarity searches and inference of the phylogenetic tree were also done following the procedure previously described in chapter 2 Pairwise similarity comparison was performed by ClustalW (Larkin et al. 2007) For the gcp gene a phylogenetic tree was constructed f rom the alignment by the neighbor joining method using MEGA 4.1 s oftware (Tamura et al. 2007). The tree was based on sequences of the gcp gene obtained in this study and sequences of organisms retrieved through the NCBI ( www. ncbi .nlm.nih.gov) BLAST Resul ts and Discussion nus A Gene Polymerase c hain r eaction and a nalysis by r estriction fragment l ength p olymorphism The nested primers nusA F2/nusA R2 targeting the nusA gene amplified a fragment ca. 1.2 kb from DNA samples collected from symptomatic plants (Sa bal1, LYFL and LYJAM) (Figure 4 1) No amplification was observed from the healthy p alm or the water controls. Polymerase chain reaction products resulting from amplification of

PAGE 62

62 the nusA gene fragment from S. palmetto (Sabal1), C. nucifera (LYFL, LYJAM and LYMEX5) were separately digested with Dde I, Eco RI Hha I and Rsa I restriction enzymes. Based on the profiles obtained by using these enzymes, the 16SrIV D phytoplasma from S. palmetto (Sabal1) was clearly distinguished from the C. nucifera LY phytoplasmas (LYFL, LYJAM and LYMEX5) similar to the predict ion by the pDRAW32 software (AcaClone, http://www.acaclone.com ) (F ig ure 4 2). These RFLP results suggest that the phytoplasma causing decline of S. palmetto is different from LY strains in C. nucifera reinforc ing the results obtained by analysis of the ribosomal RNA operon in chapters 2 and 3. Molecular comparisons Nested primers nusA F2/nusA R2 targeting the nusA gene amplified PCR fragment from DNA extracted from tissue of palms showing symptoms of decline a nd yellowing. Based on pairwise similarity comparison of approximately 600 bases of the nusA gene, t he two LY strains we re more similar to each other ( 99% ) than to the S. palmetto (Sabal1) strain which was 92% or 93% similar to LY ( Table 4 3 ) From the re sults of the nusA gene, it could be concluded that the phytoplasma infecting S. palmetto is different from the phytoplasma infecting C. nucifera These results were positively correlated with those based on analysis of the ribosomal operon (Chapter 2 and C hapter 3). hfl B G ene Polymerase chain reaction Fr om both symptomatic samples ( Sabal1 and LY MEX5 ) bands of approximately 1.3 kb were amplified in the PCR assays using primer pair hfl B 1 f2 / hfl B 1 r2. S maller fragments about 0.6 kb bases were amplified from the same samples when primers

PAGE 63

63 hfl B 2 f1 and hfl B 2 r1 were used. No amplification was observed in the healthy palm or the water controls. Analysis by r estriction fragment l ength p olymorphism Two sets of p roducts of PCRs, the first set primed by hflB2 f1 a nd hflB2 r1 from S. palmetto (Sabal1) and C. nucifera (LYMEX5) and the second primed by hflB1 f2 / hflB1 r2 from the same plant samples were digested separately using restriction enzymes Patterns representing these digestions are illustrated in F ig ure 4 3 Sabal1 and LYMEX5 were differentiated clearly when the PCR fragment obtained by amplification using hflB1 f2 / hflB1 r2 were digested with restriction enzymes Apo I Ase I Dde I Dra I Hha I Hind III Sau 3AI and Tsp 509I (Figure 4 3 A, G and H). Differences be tween Sabal1 and LYMEX5 were also demonstrated when the PCR fragment primed with the hflB2 f1 and hflB2 r1 primer pair was digested with enzymes Apo I Dde I Taq I and Tsp 509I (Figure 4 3 B F). In Figures 4 3 A D multiple fragments from different clones of e ach of the strains were tested whereas one fragment from a single clone was tested in the rest of the figures. This was believed to be sufficient to demonstrate differences between the two phytoplasma strains. Findings obtained by RFLP analysis of the hfl B gene also show that the TPD phytoplasma from S. palmetto is different from the LY phytoplasma from C. nucifera Molecular comparisons The ORF of the PCR fragment amplified with the hflB 1 f2 /hflB 1 r2 primer pair from the LY MEX5 sample was ca 120 bp longer than the ORF of the fragment amplified by the same primers from the phytoplasma infecting S. palmetto (Sabal1) The differences between these phytoplasma strains we re also shown by a few base substitutions between the two PCR fragments ampl ified with hflB 1 f2 /hflB 1 r2 The ORF of the PCR

PAGE 64

64 fragment amplified from the S. palmetto phytoplasma with the hflB2 f1 and hflB2 r1 primers wa s almost twice as long as the fragment amplified from the DNA sampled from C. nucifera showing symptoms of LY A f ew base substitutions also show ed the differences between the TPD and the LY phytoplasmas in th e fragment amplified by the hflB2 f1 and hflB2 r1 primers. In this work differences between the TPD and the LY phytoplasma were demonstrated gcp G ene Polymeras e chain r eaction and a nalysis by r estriction fragment l ength p olymorphism S eventeen P CR product s corresponding to approximately 1.5 kb nucleotides (with about 1 kb representing gcp gene) were amplified using the gcp gene primer s for all the phytoplasmas st rains listed in Table 4 1 N o amplification was observed for the healthy plant or the water controls (Fig ure 4 4 ). The RFLP analysis of the gcp gene fragment shows that 16SrIV D strains are different from 16SrIV A strains as shown by the digestions of the gcp PCR fragment by Rsa I restriction enzyme (Figure 4 5 ). T he RFLP was performed on samples fewer than the samples on which the PCR testing was performed due to the insuffiency of diseased plant tissue Molecular comparisons by p hylogenetic a nalysis S equence analysis of the gcp gene showed that the strains belonging to subgroup 16SrIV A namely, the Mexican strains LYM EX 3 and LYM EX 5, the Florida strain LYFL, the Jamaican strain LYJAM, SA1 strain from P. canariensis the subgroup 16SrIV C Tanzanian st rain LDT and the group 16SrXXII Nigerian strain Awka are all similar (Fig ure 4 6 ) Another cluster grouped together the TPD phytoplasma strains (16SrIV D), Sabal1 from S. palmetto CID3, PCT3, PCT4, JLL RPA and SEG obtained from

PAGE 65

65 Phoenix spp. and the coc onut lethal decline strain CLDO from C. nucifera in Honduras, and the C OYOL strain from Acrocomia aculeata (Jacq.) Lodd. ex Mart. in Honduras (Fig ure 4 6 ). The TPD phytoplasma is the only phytoplasma known to be associated with S. palmetto A nalysis of th e sequence of the gcp gene demonstrated that the TPD phytoplasma strain infecting S. palmetto is not different from the TPD strains infecting Phoenix spp. A. aculeata C. nucifera and S. romanzoffiana (Figure 4 6 ). When analyzing TPD phytoplasma strains, the gcp gene has not proved more variable relative to the 16S rRNA gene where the TPD strains are 98.2% to 100% similar (Harrison et al. 2008). It was also shown that the gcp gene is not variable among subgroup 16SrIV A and group 16SrXXII strains. Based on evidence gathered in this study i t can be concluded that the TPD strain infecting S. palmetto is similar to TPD strains infecting Phoenix spp. However, it is possible that strain variation may be revealed by studying other genes

PAGE 66

66 Table 4 1. Phytoplasma s a mples included in this study listed with host palm species and location The origin of the samples is the United States of America unless otherwise mentioned Sample name Disease Palm species Strain Origin Awka c CID3 c CLDO c C OYOL c JLL c LDT c LYFL a,c LYJA M a, c LYMEX3 c LYMEX5 b, c PCT3 c PCT4 c RPA c S1 QP c SA1 c Sabal1 a,b, c SEG c Awka wilt Texas Phoenix decline Coconut lethal decline Coyol palm decline Texas Phoenix decline Lethal disease Lethal yellowing Lethal yellowing Lethal yellowing Lethal yellowing Texas Phoenix decline Texas Phoenix decline Texas Phoenix decline Texas Phoenix decline Lethal yellowing Texas Phoenix decline Texas Phoenix decline Cocos nucifera Phoenix canariensis C. nucifera Acrocomia aculeata Phoenix spp C. nucifera C. nucifera C. nuc ifera C. nucifera C. nucifera P. canariensis P. canariensis P. dactylifera Syagrus romanzoffiana P. canariensis Sabal palmetto P. canariensis 16Sr XXII 16SrIV D 16SrIV D 16SrIV D 16SrIV D 16SrIV C 16SrIV A 16SrIV A 16SrIV A 16SrIV A 16SrIV D 16SrIV D 16Sr IV D 16SrIV D 16SrIV A 16SrIV D 16SrIV D Nigeria Saras o t a c ounty, Florida Olancho, Honduras Olancho, Honduras Corpus Christi Texas Tanzania Broward c ounty, Florida Jamaica Yucatn Peninsula, Mexico Yucatn Peninsula, Mexico McClellan, Texas McClellan Te xas Hillsborough c ounty, Florida Manatee c ounty Florida Manatee c ounty, Florida Hillsborough c ounty, Florida Hillsborough c ounty, Fl o ri da a Positive amplification with nusA F2/nusA R2 b Positive amplification with hflB2 f1/hflB2 r1 and hflB1 f2/hflB1 r2 c Positive amplification with GCPF1/GCPR1 The se primer pairs were tested on all the samples.

PAGE 67

67 Table 4 2. Primers used to amplify phytoplasma gene products from to tal DNA extracted from symptomatic plants Gene target Primer sequence Reference for the prime rs nusA nusA F1 ATTTTGTTATATTTTGAAGGAGTGTT nusA R1 CAAAAAGCT TCATGACCCGGAGTATCTA nusA F2 ACATCTAAAGCTGAATTAGGACA nusA R2 GCACCAATATGTTGAGTAATTCCA This study This study This study This study hfl B gcp hflB2 CCAG AAAATTATGATCCAGATGTTATA hflB2 CTACAGGAAAACTCTCAATAAG hflB1 TGTTTTGGAACCAGAAGATCCTTATT hflB1 TTGTTGTCCGTGTTGAGAAAATTG This study This study This study This study This study This study This study This study Table 4 3. Sequence comparisons of the nusA gene. Comparison was between sequence of a fragment of the nusA gene of the Texas Phoenix decline ( S abal1 ) phytoplasma infecting Sabal palmetto with phytoplasma strains from Cocos nucifera [ ( Lethal yellowing (LY) from Florida ( LYFL ) and LY from Jamaica ( LY J AM ) ] Name Length (base pairs) Name Length (base pairs) Score (%) LYFL LYF L LY J AM 603 603 603 LYJ AM Sabal1 Sabal1 603 602 602 99 92 9 3 The alignment and calculation of sequence similarity comparison was done by ClustalW (Larkin et al. 2007)

PAGE 68

68 Figure 4 1. Nested PCR products amplified using primer pair nusA F1 and nusA R1 followed by nusA F2 and nusA R2. Lane 1. Lambda DNA Hind III digest; Lane 2. Empty lane. Lane 3. Sabal palmetto (Sabal1) ; Lane 4. Lethal yellowing on coconut, Florida (LYFL) ; Lane 5. Lethal yellowing on coconut, Jamaica (LYJAM) ; Lane 6. Healthy control; Lane 7. Water contro l. Figure 4 2. Restriction fragment length polymorphism of nusA F2 and nusA R2 PCR p roduct The nusA gene fragment was amplified from DNA fractions of Sabal palmetto (Sabal1), Cocos nucifera (LYFL, LYJAM, LYMEX5) and was digested with r estriction enzymes Dde I, Eco RI, Hha I and Rsa I. M on the first lane is for pGEM molecular (bp) size marker in descending order: 2465, 1605, 1198, 676, 517, 460, 396, 350, 222, 179, 126, 75, 65, 51 and 36. The second lane is empty. 1.2 kb M Sabal1 LYFL LYJAM LYMEX5 S abal1 LYFL LYJAM LYMEX5 Sabal1 LYFL LYJAM LYMEX5 Sabal1 LYFL LYJAM LYMEX5 Dde I Eco RI Hha I Rsa I

PAGE 69

69 Figure 4 3 Restric tion fragment length polymorphism of phytoplasma hfl B gene copies Polymerase chain reaction ( PCR ) amplicon was amplified with different primer pairs from DNA of declining Sabal palmetto and Cocos nucifera palms showing yellowing symptoms. A) PCR fragment amplified with hflB1 f2/hflB1 r2 from C. nucifera and S. palmetto was digested with Ase I and Dra I. B) PCR fragment amplified with hflB2 f1/hflB2 r1 from C. nucifera and S. palmetto was digested with Apo I. C) PCR fragment amplified with hflB2 f1/hflB2 r1 fr om S. palmetto was digested with Dde I. D) PCR fragment amplified with hflB2 f1/hflB2 r1 from C. nucifera was digested with Dde I. E) PCR fragment amplified with hflB2 f1/hflB2 r1 from S. palmetto and C. nucifera was digested with Alu I, Dra I, Eco RI, Hha I, Hi nd III, Sau 3AI. F) PCR fragment amplified with hflB2 f1/hflB2 r1 from S. palmetto and C. nucifera was digested with Mse I, Rsa I, Ssp I, Taq I and Tsp 509I G) PCR fragment amplified with hflB1 f2/hflB1 r2 from S. palmetto and C. nucifera H) PCR fragment amplifi ed with hflB1 f2/hflB1 r2 from S. palmetto and C. nucifera was digested with Sau 3AI, Mse I, Ssp I and Tsp I. M on the first lane is for pGEM molecular size (bp) marker in descending order: 2465, 1605, 1198, 676, 517, 460, 396, 350, 222, 179, 126, 75, 65, 51 a nd 36. Lane 2 is empty.

PAGE 70

70 A B C D S. palmetto C. nucifera M Ase I Dra I Ase I Dra I S. palmetto C. nucifera M Apo I S. palmetto M Dde I C. nucifera M Dde I PCR fragment amplified with hflB1 f2/hflB1 r2 PCR fragment amplified with hflB 2 f 1 / hflB2 r 1 PCR fragment amplified with hflB 2 f 1 /hflB 2 r 1 PCR fragment amplified with hflB 2 f 1 /hflB 2 r1

PAGE 71

71 E F G H Figure 4 3 Continued M Alu I Dra I Eco RI Hha I Hind III Sau 3AI Alu I Dra I Eco RI Hha I Hind III Sau 3AI M Mse I Rs a I Ssp I T aq I Tsp 509 I Mse I Rsa I Ssp I Taq I Tsp 509I S. palmetto C. nucifera S. palmetto C. nucifera M Alu I Apo I Bst U I Dde I Hae III Hha I Hind I II Alu I Apo I Bst U I Dde I Hae III Hha I Hind I II S. palmetto C. nucifera S. palmetto C. nucifera M Sau 3AI Mse I Ssp I Tsp I Sau 3AI Mse I Ssp I Tsp 509 I PCR fragment amplified w ith hflB 2 f 1 /hflB 2 r 1 PCR fragment amplified with hflB 2 f 1 /hflB 2 r 1 PCR fragment amplified with hflB 1 f 2 /hflB 1 r 2 PCR fragment amplified with hflB1 f2/hflB1 r2

PAGE 72

72 Figure 4 4 Agarose gel electr ophoresis showing amplification of the glycoprotease ( gcp ) gene in different DNA samples collected from symptomatic palms T he first lane is Hind III digested lambda DNA serving as a size marker and the last two lanes are healthy palm and water control s (n o phytoplasma DNA) respectively 1.5 kb

PAGE 73

73 Figure 4 5 Restriction fragment length polymorphisms of a polymerase chain reaction ( PCR ) fragment amplified with primer pair GCPFI/GCPR1 DNA preparations were from symptoma tic tissue of palms from various localities. PCR fragment was digest ed with enzyme Rsa I M on the first lane is for pGEM molecular size (bp) marker in descending order: 2465, 1605, 1198, 676, 517, 460, 396, 350, 222, 179, 1 26, 75, 65, 51 and 36. Lane 2 is e mpty M COYOL LYMEX5 LYJAM LYFL PCT3 Sabal1 RPA SEG SA1 S1 QP CID3 PCT4

PAGE 74

74 Fig ure 4 6 Molecular tree of the glycoprotease ( gcp ) gene sequences of palm lethal disease strains inferred by neighbor joining method. Approximately 470 bases of the gcp gene were used to infer the tree. Phytoplasma strains (as listed in Table 4 1) sequenced in this study are in bold type and the rest were retrieved from the National Center for Biotechnology Information ( www. ncbi .nlm.nih.gov) GenBank GenBank accession number are written in brackets.

PAGE 75

75 PCT3 P. canariensis 16SrIV D ( HQ613877) JLL Phoenix spp 16SrIV D ( HQ613888) COYOL Acrocomia aculeata 16SrIV D ( HQ613876) PCT4 P. canariensis 16SrIV D ( HQ613884) RPA P. dactylifera 16SrIV D ( HQ613878) CLDO Cocos nucifera 16SrIV D ( HQ613887) SEG Phoenix canariensis 16SrIV D ( HQ613879) CID3 P. canariensis 16SrIV D ( HQ613886) Sabal1 Sabal palmetto 16SrIV D ( HQ613883) S1 QP Syagrus romanzoffiana 16SrIV D LYMex3 C. nucifera 16SrIV A ( HQ613881) LDT C. nucifera 16SrIV C ( HQ613889) Awka C. nucifera 16SrXXII ( HQ613885) LYMex5 C. nucifera 16SrIV A ( HQ613882) SA1 P. canariensis 16SrIV A ( HQ613880) LYFL C. nucifera 16SrIV A ( HQ613890) LYJAM C. nucifera 16SrIV A (Identical to LYFL) PnWB (AY327624) CX (AY327623) P ulmi (AY3 27625) P mali (AY327626) BBS (AY327620) PaWB( AY327621) AY Md (AY327618) IOWB (AY327622) CPh (AY348874) CPh (AY327627) TBB (AY327619) AYWB (CP000061) Acholeplasma laidlawii ( CP000896) 9 2 9 9 10 0 9 9 4 1 6 1 10 0 5 9 1 4 4 3 5 4 10 0 9 9 10 0 2 6 0.0 2

PAGE 76

76 CHAPTER 5 RESU LTS OBTAINED AND CON CLUDING REMARKS T he population of TPD phytoplasma (subgroup 16SrIV D) infecting S abal palmetto in west central Florida was surveyed and it was found that the phytoplasma strain population in that region is genetically homogenous. This was determined through molecular analysis of the 16S 23S intergenic spacer (IGS) region and verified by analysis of restriction fragment length polymorphisms I t was hypothesized that a single strain was introduced into west central Florida. Because this S. palmetto strain is similar to the strain infecting Phoenix canariensis P. dactylifera P. sylvestris and Syagrus ramonzoffiana it was also hypothesized that the same phytoplasma strain affects these other palm species. Sequence analysis of the entire ribosomal RNA operon and glycoprotease ( gcp ) gene reinforced these conclusions Furthermore, the TPD phytoplasma (subgroup 16SrIV D) was shown to be different from the lethal yellowing (LY) phytoplasma (subgroup 16SrIV A) common in Cocos nucifera as shown by sequence analysis of the ribosomal RNA operon, and the nusA hfl B and gcp gene s Although t he development of TPD epi phytotics in west central Florida could not be completely elucidated speculations about the most recent events could be made. TPD in P hoenix spp. was first observed in 2006, coinciding with massive property development which resulted in increase d Phoenix plantings. Presumably the onset of mild winters in west central Florida could have favored disease development. In 2008, observations of S. palmetto with similar foliar discoloration in west central Florida as the Phoenix spp. were reported The most plausible explanation for the infection of S. palmetto was that the same phytoplasma infecting Phoenix spp. was spread by a vector or vect ors to the S. palmetto in the vicinity This explanation can be hypothesized from

PAGE 77

77 this work which found similarities between the TPD phytoplasma in Phoenix spp. and the strain in S. palmetto However, further comparative studies are required. Sequence ana lysis of more genes and a search for the insect vector for the TPD phytoplasma will help further understand the epidemiology of TPD.

PAGE 78

78 APPENDIX SOME PHYTOPLASMAS RE FEREED TO IN THIS MA NUSCRIPT Phytoplasma Identity Host plant 16Sr group/subgroup s Y M broom Ca. Ca. Ca (LY) Lethal disease Tanzania Onion Numerous Numerous Numerous Cocos nucifera Phoenix spp. C. nucifera 16SrI 16SrI 16SrXII 16SrX 16SrIV A 16SrIV C Texas Phoenix decline Sabal palmetto 16SrIV D LY type Phoenix spp Syagrus romanzoffiana Washingtonia robusta Phoenix spp 16SrIV F Source: Harrison et al. 2008; Lee et al. 199 8.

PAGE 79

79 LIST OF REFERENCES Arashida, R., Kakizawa, S., Hoshi A., Ishii Y., Jung H. J., Kagiwada S., Yamaji Y., Oshima K., and Namba, S. 2008. Heterogen e ic dynamics of the structures of multiple gene clusters in two pathogenetically different lines originating from the same phytoplasma. DNA Cell Biol. 27:209 217. Ashburner G. R ., Crdova I I ., Oropeza C Illingworth R and Harrison N A. 1996. First report of coconut lethal yellowing disease in Honduras Plant Dis 80:960. Bai, X., Zhang J., Ewing, E., Mi ller, S. A., Radek, A., Schevchenko, D., Tsukerman, K., Walunas, T., Lapidus, A., Campbell, J. W., and Hogenhout S. A 2006. Living with genome instability: T he adaptation of phytoplasmas to diverse environments of their insect and plant hosts. J Bacteri ol. 188: 3682 3696. Barry, T., Colleran, G., Glennon, M., Dunican, L. K., and Gannon, F. 1991. The 16s/23s ribosomal spacer region as a target for DNA probes to identify eubacteria. PCR Methods Appl. 1:51 56. Beier D., Spohn G., Rappuoli R., and Scarlato V. 1997. Identification and characterization of an operon of Helicobacter pylori that is involved in motility and stress adaptation. J Bacteriol 179: 4676 4683. Bertaccini, A. 2007. Phytoplasmas: D iversity, taxonomy, and epidemiology. Front. Biosci. 12: 673 689. Borukhov S., Lee J. and Laptenko O. 2005. Bacterial transcription elongation factors: N ew insights into molecular mechanism of action. Mol Microbiol 55:1315 1324. Bov, J. M. 1997. Spiroplasmas: I nfectious agents of plants, arthropods and ve rtebrates. Wien. Klin. Wochenschr. 109: 604 612. Danet, J. L., Bahriz, H., Cimerman, A., and Foissac, X. 2008. New molecular typing tools to monitor fruit tree phytoplasma variability in the 16SrX taxonomic group. Acta Hortic. 4 :343 349. Davis, R. E., Joman tiene, R., Zhao, Y., Ellen, L., and Dally, E. L. 2003. Folate biosynthesis pseudogenes folP and folK and an O s ialoglycoprotein endopeptidase gene homolog in the phytoplasma genome. DNA Cell Biol. 22(11):697 706. Deng, S. and Hiruki, C. 1991. Genetic relatedness between two nonculturable mycoplasmalike organisms revealed by nucleic acid hybridization and polymerase chain reaction. Phytopathology 81 : 1475 1479. Doyle, J. J., and Doyle J. L 1990. Isolation of plant DNA from fresh tissue. Focus 12:13 15.

PAGE 80

80 Eden Green S J. 1997. History, distribution and present status of lethal yellowing li ke disease of palms. Pages 9 25 in: Proc. Int. Workshop Lethal Yellowing Like Diseases of Coconut, 1995, Elmina, Ghana. S. J. Eden Green and F. Ofori, eds. Natural Resources Institute, Chatham, U.K. Fogel, G. B., Collins, C. R., Li, J., and Brunk, C. F. 19 99. Prokaryotic g enome s ize and SSU rDNA c opy n umber: E stimation of m icrobial r elative a bundance from a mixed p opulation. Microb. Ecol 38:93 113. Gundersen, D. E., Lee, I. M., Rehner, S. A., Davis, R. E., and Kingsbury, D. T. 1994. Phylogeny of mycoplasm a like organisms (phytoplasmas): A basis for their classification. J. Bacteriol. 176: 5244 5254. Guo, Y. H., Cheng, Z. M., and Walla, J. A. 2000. Amplification of the 23S rRNA gene and its application in differentiation and detection of phytoplasmas. Can. J. Plant Pathol. 22:380 386. Harrison, N. A., Bourne, C. M., Cox, R. L., Tsai, J H. and Richardson, P. A. 1992. DNA probes for detection of mycoplasmalike organisms ascociated with lethal yellowing disease of palms in Florida. Phytopathol ogy 82 : 216 224. Harrison, N. A. and Richardson, P. A. 1994. Comparative investigation of MLOs associated with Caribbean and African coconut lethal decline diseases by DNA hybridization and PCR assays. Plant Dis 78 : 507 5 1 1. Harrison, N. A., Richardson, P. A., Kramer J. B., and Tsai, J. H. 1994. Detection of lethal yellowing disease of palms in Florida by polymerase chain reaction. Plant Pathol. 43:998 1008. Harrison, N. A., and Oropeza, C. 1997. Recent studies on detection of lethal yellowing disease phytoplasmas i n the Americas. Pages 221 234 in: Proc. Int. Workshop Lethal Yellowing Like Diseases of Coconut, 1995, Elmina, Ghana. S. J. Eden Green and F. Ofori, eds. Natural Resources Institute, Chatham, U.K. Harrison, N. A., Narvez, M., Almeyda, H., Cordova, I., Car pio, M. L., and Oropeza C. 2002a. First report of group 16SrIV phytoplasmas infecting coconut palms with leaf yellowing symptoms on the Pacific coast of Mexico. Plant Pathol. 51:808. Harrison, N. A., Womack, M., and Carpio, M. L. 2002 b Detection and char acterization of a lethal yellowing (16SrIV) group phytoplasma in Canary Island Date palms affected by lethal decline in Texas. Plant Dis. 86:676 681. Harrison, N. A., Helmick, E. E., and Elliott, M. L. 2008. Lethal yellowing type diseases of palms associat ed with phytoplasmas newly identified in Florida. Ann. Appl. Biol. 153(1 ):85 94. Harrison, N. A., Helmick, E. E., and Elliott, M. L. 2009. First report of a phytoplasma associated lethal decline of Sabal palmetto in Florida, USA. Plant Pathol. 58:792.

PAGE 81

81 Ho, K. C., Tsai, C. C., and Chung, T. L. 2001. Organization of ribosomal RNA genes from a Loofah witches' broom phytoplasma. DNA Cell Biol. 20(2):115 122. Hodgetts, J., Boonham, N., Mumford, R., Harrison, N., and Dickinson, M. 2008. Phytoplasma phylogenetics based on analysis of the secA and 23S rRNA gene Candidatus Phytopl J. Syst. Evol. Microbiol. 58: 1826 1837. International Committee on Systematic Bacteriology Subcommittee on the Taxonomy of Mollicutes. 1993. Minutes of the interim meetings, 1 and 2 August, 1992, Ames, Iowa. Int. J. Syst. Bacteriol 43: 394 3 97. International Committee on Systematic Bacteriology Subcommittee on the Taxonomy of Mollicutes. 1997. Minutes of the interim meetings, 12 and 18 July, 1996, Orlando, Florida, USA. Int. J. Syst. Bacterol 47:911 9 14. International Research Programme on Comparative Mycoplasmology. Phytoplasma/Spiroplasma Working Team Phytoplasma t axonomy g roup. 2004. Candidatus a taxon for the wall less, nonhelical prokaryotes that colonize plant phloem and insects. Int. J. Syst. Evol. Microbiol. 54: 1243 1255. Kirkpatrick, B., Smart, C., Gardner, S., Gao, J. L. Ahrens, U ., Maurer, R ., Schneider, B., Lorenz, K. H. Seemller, E., Harrison, N., Namba, S., and Daire, X. 1994. Phylogenetic relationships of plant pathogenic MLOs established by 16/23S rDNA s pacer sequences. IOM Lett. 3:228 229. Kirkpatrick, B. C., Strenger, D. C., Morris, T. J., and Purcell, A. H. 1987. Cloning and deletion of DNA from a nonculturable plant pathogenic mycoplasma like organism. Science 238 : 197 200. Kube, M., Schneider, B., Kuh l, H., Dandekar, T., Heitmann, K., Migdoll, A.M., Reinhardt, R., and Seem ller, E. 2008. The linear chromosome of the plant pathogenic mycoplasma Candidatus Phytoplasma mali'. BMC Genomics 9:306. Kuske C R and Kirkpatrick B C. 1992. Phylogenetic rel ationships between the western aster yellows mycoplasmalike organisms and other prokaryotes established by 16S rRNA gene sequence. Int. J. Syst. Bacteriol. 42:226 2 33 Larkin M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R., Thompson, J. D., Gibson, T. J., and Higgins, D. G. 2007. ClustalW and ClustalX version 2. Bioinformatics 23(21):2947 2948. Lee, I. M., Hammond, R. W., Davis, R. E., and Gundersen, D. E. 1993. Univers al amplification and analysis of pathogen 16S rRNA for classification and identification of mycoplasmalike organisms. Phytopathology 83:834 842.

PAGE 82

82 Lee, I M., Gundersen Rindall, D. E., Davis R. E., and Bartoszky, I. M. 1998. Revised classification scheme of phytoplasmas based on RFLP analysis of 16S rRNA and ribosomal protein gene sequences. Int. J. Syst. Bacteriol. 48:1153 1169. Lee, I. M., Davis, R. E., and Gundersen Rindal, D. E. 2000. Phytoplasmas: P hytopathogenic mollicutes. Annu. Rev. Microbiol. 54: 22 1 255. Lee I. M., Gundersen D. E., Davis R. E., Bottner K. D., Marcone C., and Seemller Candidatus associated with aster yellows and related diseases. Int. J. Syst. Evol. Microbiol 54:1037 1048. Li, X., and DeBoer, S. H. 1995. Selection of polymerase chain reaction primers from an RNA intergenic spacer region for specific detection of Clavibacter michiganen sis subsp. sepedonicus Phytopathology 85:837 842. Liefting, L. W., Shaw, M. E., and Kirkpatrick, B. C. 2004. Sequence analysis of two plasmids from the phytoplasma beet leafhopper transmitted virescence agent Microbiology 150:1809 1817. Lim P O ., and S ears B B 1989. 1 6S rRNA sequence indicates that plant pathogenic mycoplasmalike organisms are evolutionary distinct from animal mycoplasmas. J. Bacteriol. 171:5901 5906. Lim, P. O., and Sears, B. B. 1992. Evolutionary relationships of plant pathogenic my coplasmalike organisms and Acholeplasma laidlawii deduced from two ribosomal protein gene sequences. J. Bacteriol. 174: 2606 2611. Lithgow J. K., Ingham E., and Foster S. J. 2004. Role of the hprT ftsH locus in Staphylococcus aureus Microbiology 150:37 3 38 1 Lorenz K. H., Schneider B., Ahrens U., and Seemller E. 1995. Detection of the apple proliferation and pear decline phytoplasmas by PCR amplification of ribosomal and nonribosomal DNA. Phytopathology 85 :771 776. Marcone, C., Neimark, H., Ragozzi no, A., Lauer, U., and Seemller, E. 1999. Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopathology 89: 805 810. Marcone, C., Lee I. M., Davis R. E., Ragozzino, A., and Seemller, E. 2000. Classification of aster y ellows group phytoplasmas based on combined analyses of rRNA and tuf gene sequences. Int. J. Syst. Evol. Microbiol. 50 :1703 1713. Martini, M., Ermacora, P., Falginella, L., Loi, N., and Carraro, L. 2008. Molecular differentiation of Candidatus Phytoplasma mali and its spreading in Friuli Venezia Giulia region (north east Italy). Acta Hort. 781 :395 402.

PAGE 83

83 McCoy, R. E., Miller, M. E., Thomas, D. L., and Amador, J. 1980. Lethal decline of Phoenix palms in Texas asssociated with mycoplasmalike organisms. Plant Dis. 64:1038 1040. McCoy, R. E., Howard, F. W., Tsai, J. H., Donselman, H. M., Thomas, D. L., Basham, H. G., Atilano, R. A., Eskafi, F. M., Britt, L., and Collins, M. E. 1983. Lethal y ellowing of p alms. Univ. Fla Agric. Exp. Stn. Bull. 834. Meerow, A. W. 2006. Landscape palms. Betrock Information Systems. Hollywood, Florida. Murray R. G. E., and Schleifer K. H. 1994. Taxonomic notes: A proposal for recording the properties of putative taxa of prokaryotes. Int. J. Syst. Bacteriol. 44 :174 176. Namba S Oyaizu H Kato S Iwanami S and Tsuchizaki T. 1993. Phylogenetic diversity of phytopathogenic mycoplasmalike orgnisms. Int. J. Syst. Bacteriol. 43:461 467 Oshima, K., Kakizawa, S., Nishigawa, H., Jung, H. Y., Wei, W., Suzuki, S., Arashida, R., Na kata, D., Miyata, S., Ugaki, M., and Namba, S. 2004. Reductive evolution suggested from the complete genome sequence of a plant pathogenic phytoplasma. Nat. Genet. 36: 27 29. Razin S. 1985. Molecular biology and genetics of mycoplasmas ( Mollicutes ). Microb ial. Rev. 49 : 419 455. Razin, S., Yogev, D., and Naot, Y. 1998. Molecular b iology and p athogenicity of m ycoplasmas. Microbiol. Mol. Biol. R. 62(4):1094 1156. Schneider, B., and Seem ller, E. 1994. Presence of two sets of ribosomal genes in phytopathogenic mollicutes. Appl. Environ. Microbiol. 60 : 3409 3412. Schneider, B., Gibb, K. S., and Seemller, E. 1997. Sequence and RFLP analysis of the elongation factor Tu gene used in differentiation and classification of phytoplasmas. Microbiology 143 :3381 3389. See m ller, E., Marcone, C., Lauer, C., Ragozzino, A., and Gschl M. 1998. Current status of molecular classification of the phytoplasmas. J. Plant Pathol. 80: 3 26. Seemller E., and Schneider B. 2007. Differences in virulence and genomic features of strain s of Candidatus Phytoplasma mali the apple proliferation agent. Phytopathology 97 :964 970. Shao J., Jomantiene R., Dally E.L. Zhao Y., L ee, I. M., Nuss, D. L., and Davis, R. E. 2006. Phylogeny and characterization of phytoplasmal NusA and use of t he nusA gene in detection of group 16SrI strains. J Plant Pathol 88(2):193 201.

PAGE 84

84 Sinclair W A ., Gleason M L Griffiths H M Iies J K Zriba N Charlson D V Batzer J C and Whitlow T H. 2000 Responses of 11 Fraxinus cultivars to ash yellows phytoplasma strains of differing aggressiveness Plant Dis 84 : 725 730 Sinclair W A and Griffiths H M. 2000 Variation in aggressiveness of ash yellows phytoplasmas Plant Dis. 84 : 282 288. Smart, C. D., Schneider, B., Blomquist, C. L., Guerr a, L. J., Harrison, N. A., Ahrens, U. Lorenz, K. H., Seemller, E. and Kirkpatrick, B. C. 1996. Phytoplasma specific PCR primers based on sequences of the 16S 23S rRNA spacer region. Appl. Environ. Microbiol. 62 : 2988 2993. Tamur a K Dudley J Nei M. and Kumar S. 2007 MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596 1599. Thomas D. L. 1979. Mycoplasma like bodies associated with lethal decline of palms in Florida. Phytopathology 69:928 934. Thom pson, J. D., Higgins, D. G., and Gibson, T. J. 1994. CLUSTALW: I mproving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22 : 4673 4680. Tran Nguyen, L. T T ., Kube, M., Schneider, B., Reinhardt, R. and Gibb, K. S. 2008. Comparative genome analysis of Candidatus Phytoplasma australiense' (S ubgroup tuf Australia I ; rp A) and 'Ca Phytoplasma asteris' S trains OY M and AY WB. J. Bacteriol. 190 (11 ) : 3979 3991. Wei, W., Lee, I. M., Robert, E., Davis, R. E., Suo, X. B., and Zhao, Y. 2007. Virtual RFLP analysis of 16S rDNA sequences identifies new subgroups in the clover proliferation phytoplasma group. B Insectol 60 : 349 350. Wei, W., Lee, I. M., D avis, R. E., Suo, X. and Zhao, Y. 2008. Automated RFLP pattern comparison and similarity coefficient calculation for rapid delineation of new and distinct phytoplasma 16Sr subgroup lineages. Int J Syst Evol Microbiol 58 : 2368 2377. Woose, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51 : 221 271. Zhao, Y., Wei, W., Lee, I. M., Shao, J., Suo, X., and Davis, R. E. 2009. Construction of an interactive online phytoplasma classification tool, i PhyClassifier, and its application in analysis of the peach X disease phytoplasma group (16SrIII) Int J Syst Evol Microbiol 59 : 2582 2593 Zona, S. 1990. A monograph of Sabal (Arecaceae: Coryphoideae). Aliso 12(4):583 666.

PAGE 85

85 BIOGRAPHICAL SKETCH Khayalethu Ntushelo was born in South Africa in 1973. As a child h e developed a passion for learning. His interest in science grew in high school and after graduating with matric he studied towards a B achelor of S cience ( b otany and m icrobiology) degree at the University of the Western Cape South Africa Obtaining his B S degree in 1995, he proc e e d ed to study towards a M aster of S cience degree majoring in plant pathology at the University of Stellenbosch South Africa A short spell after earning his M aster of S cience degree found him with employment as a plant patholog ist at the Agricultural Research Council (ARC) of South Africa. His c areer experiences at the ARC helped him to make informed choices on the field of study in which to undertake his Ph.D and also the university w he re he could enroll for his doctorate Wit h the help of, among other people Drs Raghavan Charudattan and Monica Elliott of the Department of Plant Pathology University of Florida, K hayalethu would then pursue his ambition. He enrolled for a Ph.D degree in plant pathology at the Department of Pla nt Pathology, University of Florida, in the fall of 2007, and his research focused on molecular characterization of a phytoplasma associated with Sabal palmetto He conducted his research under the guidance of Dr. Nigel Harrison in the Department of Plant Pathology, Fort Lauderdale Research and Education Center, University of Florida. Khayalethu received his Ph.D degree in December 2010.