<%BANNER%>

Epigenetic Regulation of Pro-Apoptotic Genes in Drosophila

Permanent Link: http://ufdc.ufl.edu/UFE0042411/00001

Material Information

Title: Epigenetic Regulation of Pro-Apoptotic Genes in Drosophila
Physical Description: 1 online resource (180 p.)
Language: english
Creator: Lin, Nianwei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: apoptosis, barrier, chromatin, drosophila, epigenetic
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: EPIGENETIC REGULATION OF PRO-APOPTOTIC GENES IN DROSOPHILA It is known that Drosophila embryos are highly sensitive to ionizing radiation (IR)-induced apoptosis at early but not later stages, but the underlying molecular mechanism is unknown. The Irradiation Responsive Enhancer Region (IRER), responsible for the induction of pro-apoptotic genes rpr and hid in response to irradiation, was mapped to a ~33 kb evolutionarily conserved intergenic region upstream of the pro-apoptotic gene reaper (rpr). The IRER region undergoes a chromatin structure change from a permissive state to a blocked state at developmental stage 12, and stays for the rest of embryonic stages. When blocked, the IRER region is highly enriched with repressive chromatin marks, such as H3K27me3 and H3K9me3, and also bound by PcG proteins. This switch of chromatin structure is responsible for the radiation sensitivity transition during the embryogenesis. The functions of histone-modifyer proteins, including Hdac1(rpd3), Su(var)3-9, Su(z)12 and Pc are required for this process. Thus, direct epigenetic regulation of IRER controls cellular sensitivity to cytotoxic stimuli. The fact that there is little radiation stress in the natural environment suggests that IRER may have important biological functions during development. Indeed, several IRER deletion mutants showed downregulation of rpr in the stripped epidermis at stage 10-11 embryos. To monitor the chromatin accessibility of the IRER region in live animals, a DsRed reporter gene controlled by an ubiquitin promoter was inserted into the endogenous IRER locus. The association of DsRed expression level and the chromatin accessibility of IRER were validated by analyzing the FACS sorted cells. The DsRed expressing cells showed some specific pattern in various tissues. Interestingly, rapid induction of DsRed upon irradiation was found in the larval imaginal discs. Also, nutrition-deprivation resulted in increased DsRed in IRER{ubi-DsRed} larvae. Its dynamic epigenetic status suggests that IRER is responsive to environmental stresses and adjusts the cellular sensitivity to stress-induced apoptosis by changing its chromatin configuration. The chromatin barrier element functions against the propagation of condensed heterochromatin into the euchromaitn regions. The epigenetic blocking is restrained in the IRER without affecting the rpr promoter and basic enhancer region, suggesting the existence of a barrier element at the chromatin transition region. The essential chromatin barrier element was narrowed down to a 167bp region at the IRER left barrier (ILB) with a reporter assay. The ILB barrier is sufficient to prevent the propagation of heterochromatin associated with PRE-mediated silencing, and this barrier activity requires the binding of Cut protein, which may recruit the histone acetyltransferase CBP. Unlike all of the known insulators identified from Drosophila, the ILB does not contain enhancer-blocking activity. The study of the enhancer specific epigenetic suppression delimited by the ILB barrier greatly contributes to our knowledge of the advanced gene regulation beyond the DNA sequence in eukaryotic genomes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Nianwei Lin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Zhou, Lei.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042411:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042411/00001

Material Information

Title: Epigenetic Regulation of Pro-Apoptotic Genes in Drosophila
Physical Description: 1 online resource (180 p.)
Language: english
Creator: Lin, Nianwei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: apoptosis, barrier, chromatin, drosophila, epigenetic
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: EPIGENETIC REGULATION OF PRO-APOPTOTIC GENES IN DROSOPHILA It is known that Drosophila embryos are highly sensitive to ionizing radiation (IR)-induced apoptosis at early but not later stages, but the underlying molecular mechanism is unknown. The Irradiation Responsive Enhancer Region (IRER), responsible for the induction of pro-apoptotic genes rpr and hid in response to irradiation, was mapped to a ~33 kb evolutionarily conserved intergenic region upstream of the pro-apoptotic gene reaper (rpr). The IRER region undergoes a chromatin structure change from a permissive state to a blocked state at developmental stage 12, and stays for the rest of embryonic stages. When blocked, the IRER region is highly enriched with repressive chromatin marks, such as H3K27me3 and H3K9me3, and also bound by PcG proteins. This switch of chromatin structure is responsible for the radiation sensitivity transition during the embryogenesis. The functions of histone-modifyer proteins, including Hdac1(rpd3), Su(var)3-9, Su(z)12 and Pc are required for this process. Thus, direct epigenetic regulation of IRER controls cellular sensitivity to cytotoxic stimuli. The fact that there is little radiation stress in the natural environment suggests that IRER may have important biological functions during development. Indeed, several IRER deletion mutants showed downregulation of rpr in the stripped epidermis at stage 10-11 embryos. To monitor the chromatin accessibility of the IRER region in live animals, a DsRed reporter gene controlled by an ubiquitin promoter was inserted into the endogenous IRER locus. The association of DsRed expression level and the chromatin accessibility of IRER were validated by analyzing the FACS sorted cells. The DsRed expressing cells showed some specific pattern in various tissues. Interestingly, rapid induction of DsRed upon irradiation was found in the larval imaginal discs. Also, nutrition-deprivation resulted in increased DsRed in IRER{ubi-DsRed} larvae. Its dynamic epigenetic status suggests that IRER is responsive to environmental stresses and adjusts the cellular sensitivity to stress-induced apoptosis by changing its chromatin configuration. The chromatin barrier element functions against the propagation of condensed heterochromatin into the euchromaitn regions. The epigenetic blocking is restrained in the IRER without affecting the rpr promoter and basic enhancer region, suggesting the existence of a barrier element at the chromatin transition region. The essential chromatin barrier element was narrowed down to a 167bp region at the IRER left barrier (ILB) with a reporter assay. The ILB barrier is sufficient to prevent the propagation of heterochromatin associated with PRE-mediated silencing, and this barrier activity requires the binding of Cut protein, which may recruit the histone acetyltransferase CBP. Unlike all of the known insulators identified from Drosophila, the ILB does not contain enhancer-blocking activity. The study of the enhancer specific epigenetic suppression delimited by the ILB barrier greatly contributes to our knowledge of the advanced gene regulation beyond the DNA sequence in eukaryotic genomes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Nianwei Lin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Zhou, Lei.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042411:00001


This item has the following downloads:


Full Text

PAGE 1

1 E PIGENETIC REGULATION OF PRO APOPTOTIC GENES IN D ROSOPHILA By NIANWEI LIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Nianwei Lin

PAGE 3

3 To J ie my dear wife and to our families

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank all of those people who helped make this dissertation possible. First, I wish to thank my advis or, Dr. Lei Zhou for all his guidance, encouragement, support, and patience through out my Ph.D. training His sincere interest in science has been a great inspiration to me. Since I joined the lab, I have been encouraged to become an independent researche r but not a technician in the laboratory. As a rigorous scientist, he always told us not to be too excited to make any conclusion that beyong the available evidence. Whe I felt frustrated about the repeated negative data, he taught me how to learn from my failure, and knowing when to make an end of a project is actually a nessesary capability for a successful scientist. From the beginning of my Ph.D. study I have been trained that a good scientist needs to have good taste about what is worthwhile and what is not. Without this sense of taste and his continuous guidance, I would have not really enjoyed the charm of science as I d o today. I would like to acknowledge the inspirational instruction and guidance of my committee members, Dr. Thomas Yang, Dr. Jorg Bungert, Dr. Suming Huang, as well as the former committee members Dr. Lei Xiao and Dr. Keith Robertson. Their helpful insights, comments and suggestions really shaped my research work. I would also like to acknowledge and thank IDP program for offering m e such wonderful opportunity and supportive environment for the graduate training. My thanks must also go to the current and former members of the Zhou lab, Hailong Meng, Yanping Zhang, Can Zhang, Bo Liu, Guangyao Li John Pang, Micheal Novo, and etc.. I

PAGE 5

5 and debating during the lab meetings. More important, we had a delightful and friendly environment which makes any successful work possible. Finally, I would like to thank my family and my wi fe for their encouragement and consistent support. A spe cial thanks to my beloved wife Jie Xu whom I met and marr ied in this small magical town She fulfill s my life and make s everything meaningful to me.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 16 CHAPTER 1 B ACKGROUND AND INTRODUCTION ................................ ................................ 18 Apoptosis and Cell Death Regulation ................................ ................................ ..... 18 Patterns of Cell Death D uring Embryogenesis ................................ ........................ 20 Polycomb Silencing and Genom ic Programmes ................................ ..................... 24 PcG Complexes ................................ ................................ ............................... 25 PRC1 complex ................................ ................................ ........................... 25 PRC2 complex ................................ ................................ ........................... 26 PhoRC complex ................................ ................................ ......................... 27 Targeting of PcG Repression ................................ ................................ ........... 28 Recruitment of PcG Complexes ................................ ................................ ....... 29 PcG Silencing and Biological Functions ................................ ........................... 30 PcG proteins and development ................................ ................................ .. 31 PcG proteins and the cell cycle ................................ ................................ .. 33 Insulators ................................ ................................ ................................ ................ 34 2 EPIGENETIC BLOCKING OF AN ENHANCER REGION CONTROL S IRRADIATION INDUCED PRO APOPTOTIC GENE EXPRESSION IN DROSOPHILA EMBRYOS ................................ ................................ ..................... 40 Abstract ................................ ................................ ................................ ................... 40 Introduction ................................ ................................ ................................ ............. 40 Materials and Methods ................................ ................................ ............................ 43 Fly Strains and Genetic Crosses ................................ ................................ ...... 43 Embryo Staging and Irradiat ion ................................ ................................ ........ 43 Gene Expression Analysis ................................ ................................ ................ 43 Microarray Data Analysis ................................ ................................ .................. 44 S tatistical Analysis ................................ ................................ ............................ 45 DNase I Sensitivity Assay ................................ ................................ ................. 45 Chromatin Immuno precipitation (ChIP) Assay ................................ ................ 47 Histology ................................ ................................ ................................ ........... 49 Results ................................ ................................ ................................ .................... 49

PAGE 7

7 Sensitivity to Ray Induced Apoptosis Is Developmental Stage Depende nt ... 49 Rapid Sensitive to Resistant Transition of Pro Apoptotic Gene Responsiveness during Developmental Stage 12 ................................ ......... 51 Mapping the Genomic Region Responsible for Mediating Ray Responsiveness ................................ ................................ ............................ 52 Formation of DNaseI Resistant Structure in the IRER But Not the Promoter and Transcribed Region of reaper in Post Stage 12 Embr yos ...................... 56 Histone Modifications in the IRER Region ................................ ........................ 58 Discussion ................................ ................................ ................................ .............. 63 Differentiation Stage Specific Sensitivity to Irradiation Induced Cell Death ...... 65 Silencing by a Non Canonic Mechanism? ................................ ........................ 66 3 STRE SS RESPONSIVE EPIGENETIC REGULATION OF IRER ........................... 85 Abstract ................................ ................................ ................................ ................... 85 Introduction ................................ ................................ ................................ ............. 8 6 Materials and Methods ................................ ................................ ............................ 89 Fly strains ................................ ................................ ................................ ......... 89 In Situ Hybridizaition ................................ ................................ ......................... 89 Southern Blot ................................ ................................ ................................ .... 89 Fluorescence Activated Cell Sorting (FACS) with Whole Larvae ..................... 90 Raising animal ................................ ................................ ........................... 90 Isolation of cells ................................ ................................ ......................... 90 RNA/DNA Ratio ................................ ................................ ................................ 91 Results ................................ ................................ ................................ .................... 91 IRER Is Invovled in the Regulation of reaper During Development .................. 91 Monitor the Accessibility of IRER in vivo ................................ .......................... 93 Discussion and Future Directions ................................ ................................ ........... 95 4 A NOVEL CHROMATIN BARRIER ELEMENT DELIMITS THE FORMATION OF FACULTATIVE HETEROCHROMATIN WITHOUT BLOCKING ENHANCER FUNCTION ................................ ................................ ................................ ........... 106 Abstract ................................ ................................ ................................ ................. 106 Introduction ................................ ................................ ................................ ........... 106 Materials and Methods ................................ ................................ .......................... 110 Constructions of Transgenes ................................ ................................ .......... 110 Fly Strains, Germ Line Transformation and Genetic Crosses ........................ 111 Chromatin Immunoprecipitation (ChIP) ................................ .......................... 111 Gene Expression Analysis ................................ ................................ .............. 112 Results ................................ ................................ ................................ .................. 113 Epigenetic Blocking of IRER Is Restricted to the Upstream Regulatory Region of reaper ................................ ................................ ......................... 113 Verification and Identification of the IRER Left Barrier (ILB) ........................... 115 ILB Prevents PRE Mediated Transcriptional Silencing of Nearby Genes ....... 118 ILB Prevents the Propagation of H3K27 Trimethylation ................................ 119 ILB Lacks Enhancer Blocking Activity ................................ ............................ 120

PAGE 8

8 Cut Binds to ILB ................................ ................................ ............................. 121 ILB I s Evolutionarily Conserved ................................ ................................ ...... 122 Discussion and Future Directions ................................ ................................ ......... 123 ILB as A Barrier Only Boundary Element ................................ ....................... 124 A Novel Barrier Element? ................................ ................................ ............... 125 5 PERSPECTIVES ................................ ................................ ................................ .. 145 Non Canonical Epigenetic Regulati on of IRER ................................ ..................... 145 Coordinated Regulation of hid and reaper ................................ ...................... 147 Differentiation Stage Specific Sensitivity to Irradiation Induced Ce ll Death .... 148 A Non Canonical Epigenetic Silencing ................................ ........................... 151 Functional Significance of the Epigenetic Regulation of IRER .............................. 154 A Novel Chromatin Barrier Element ILB Delimits the Ehancer Specific Epigenetic Regulation without Blockign the Enhancer Function ........................ 156 An E fficient Barrier Testing Strategy ................................ .............................. 157 A Novel Chromatin Berrier Lacking the Enhancer Blocking Activity ............... 158 APPENDIX: THE PRIMERS USED FOR QPCR IN CHIP EXPERIMENTS ................ 161 LIST OF REFERENCES ................................ ................................ ............................. 162 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 180

PAGE 9

9 LIST OF TABLES Table page 1 1 Components of PcG complexes ................................ ................................ ......... 39 2 1 Genes induced in resistant stage (9 12 hr AEL) embryos at 2 0 minutes ray irradiation ................................ ................................ .................... 80 2 2 Mutant strains used in this study ................................ ................................ ........ 81 2 3 Primer pairs used for QPCR measurement of each locus ................................ .. 82 2 4 Irradiation responsiveness of reaper and hid in various mutant embryos ........... 84 4 1 Transformant lines ................................ ................................ ............................ 143 4 2 BT1 ILB9kb transgenic lines ................................ ................................ ............. 144

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Cell death regulatory pat hways in different organisms. ................................ ...... 38 2 1 Stage specific sensitivity to ray in duced cell death ................................ ........ 68 2 2 Rapid transition of reaper s ensitivity to irradiation between 8 9 hr AEL ............. 69 2 3 Embryos viewed at lower magnifications show the contrast of reaper and hid responsiveness in embryos at diff erent developmental stages (St) ................... 70 2 4 Comparable DNA damage induced cellular response and DmP53 expression at both sensitive and resistant stages ................................ ................................ 71 2 5 Mapp ing of the irradiation responsive region. ................................ ..................... 72 2 6 I RER is required for the responsiveness of reaper and hid ................................ 73 2 7 Formation of c losed heterochromatin structure in the Irradiation Re sponsive Enhancer Region (IRER) ................................ ................................ ................... 74 2 8 Examples of QPCR measurements of DNase I sensitivity ................................ 75 2 9 Chromatin modification of IRER ................................ ................................ ......... 76 2 10 Histone deacetylase (Hdac) and Su(z)12 functions are required for the sensitive to resistant transition ................................ ................................ ........... 78 2 11 Delayed formation of DNase I resistant region in Hdac and Su(var)3 9 mutants ................................ ................................ ................................ ............... 79 3 1 Summary of mechanisms that controls cell death during Drosop hila embryogenesis ................................ ................................ ................................ ... 98 3 2 Genomic regulatory block of the IAP antagonists ................................ ............... 99 3 3 Dynamic expression pattern of reaper and hid ................................ ................. 100 3 4 Downregulation of reaper in IRER deletion mutants ................................ ......... 101 3 5 Southern blot verification of X3 insertion ................................ .......................... 102 3 6 Insertion of ubi DsRed reporter into endogenous IRER region did not alter the chromatin profiles of this region in X3 flies ................................ ................. 103 3 7 Validation of IRER{ubi DsRed} ................................ ................................ ......... 104

PAGE 11

11 3 8 The DsRed expression patterns in different tissues of t he IRER{ubi DsRed} reporter flies ................................ ................................ ................................ ...... 105 4 1 Formation of facultative heterochrom atin was restricted to IRER and without reaching the reaper promote r and proximal enhancer regions ......................... 126 4 2 Verification of barrier activity and narrowing down the IRER left barrier ........... 127 4 3 The barrier activity in ILF9kb is independent on the insertion sites .................. 129 4 4 Example of PCR verification of somatic excision of ILF fragments ................... 130 4 5 Verifying the tested fragments that did not demonstrate barrier activity in the original screen ................................ ................................ ................................ .. 131 4 6 PCR v erification of the germline excision of ILF9kb from BT1 ILF9kb transgenic line 47 2 ................................ ................................ .......................... 133 4 7 ILB294bp does not have eye specific enhancer activity ................................ ... 134 4 8 ILB prevents transcriptional silencing mediated by PRE ................................ .. 135 4 9 ILB blocks the propagation of repressive histone mark initiated by PRE .......... 137 4 10 The IRER left barrier does not contain enhancer blocking activity ................... 139 4 11 Cut is required for the ILB barrier activity ................................ ......................... 140 4 12 ILB is evolutionally conserved ................................ ................................ .......... 142

PAGE 12

12 LIST OF ABBREVIATION S AEL After egg laying AO Acridine orange BEAF Boundary element associated factor CBP CREB binding protein CDP CCAAT di splacement protein ChIP Chromatin Immuno precipitation cHS4 Chicken hypersensitive site 4 CNS Central nervous system CPE Chromosomal position effect CtBP C terminal binding protein CTCF CCCTC binding factor dIAP Drosophila inhibitor of apoptosis prote in Dsp1 dorsal switch protein1 EGFR Epidermal growth factor receptor en engrailed EST Expressed sequence tag ESC Extra sex combs ESCL Extra sex combs like E(z) Enhancer of zeste FACS Fluorescence a ctivated c ell s orting GAF GAGA factor GFP Green fl uorescent protein Grh Grainyhead GSC G erm line stem cell

PAGE 13

13 H3K9me3 Trimethylated histone 3 lysine 9 H3K27me3 Trimethylated histone 3 lysine 27 HCNE Highly c onserved n on coding e lement Hdac1 Histone deacetylase 1 HMTase histone methyltransferase HP1 Heteroc hromatin protein 1 IAP Inhibitor of apoptosis protein IBM IAP binding motif ICC immunocytochemistry ILB IRER left barrier ILF IRER left fragment IRER Irradiation responsive enhancer region ISH in situ hybridization JNK Jun amino terminal kinase MG Mi dline glial mx michelob_x MY Million years P53RE P53 response element PAT P hotoacoustic tomography Pc Polycomb PcG Polycomb group PCR Polymerase chain reaction Pcl Polycomb like Ph Polyhomeotic PHD Polyhomeotic distal

PAGE 14

14 Pho Pleiohomeotic Phol Pleioh omeotic like PHP Polyhomeotic proximal PIC Protease inhibitor cocktails PRC P olycomb repressive complex PRE Polycomb r esponse e lements Psc Posterior s ex c ombs Psq Pipsqueak puma p53 upregulated modulator of apoptosis QPCR Quantitative polymerase chai n reaction rpr reaper RT Room temperature SAM Significance analysis of microarrays Sce Sex c ombs e xtra s cs Specialized chromatin structure sickle skl Su(Hw) Suppressor of h airy w ing Su(var)3 9 Suppressor of variegation 3 9 Su(z)12 Suppressor of zeste 12 SU(Z)2 Suppressor of zeste 2 TAFII TATA box binding protein (TBP) associated factor TBP TATA box binding protein TRE Trithorax response element trxG T rithorax group Trl Trithorax like

PAGE 15

15 TSS T ranscription starting site TUNEL Terminal deoxynucleotidyl transferase dUTP nick end labeling UAS Upstream activation sequence Ubx Ultrabithorax USF 1 U pstream stimulatory factor 1 VEZF1 V as c ular endothelial zinc finger 1 Zw5 Zeste white 5

PAGE 16

16 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EPIGENETIC REGUL ATION OF PRO APOPTOTIC GENES IN D ROSOPHILA By Nianwei Lin December 2010 Chair: Lei Zhou Major: Medical Sciences Genetics It is known that Drosophila embryos are highly sensitive to ionizing radiation (IR) induced apoptosis at early but not later stage s, but the underlying molecular mechanism is unknown. T he Irradiation Responsive Enhancer R egion (IRER), responsible for the induction of pro apoptotic genes rpr and hid in response to irradiation was mapped to a ~33 kb evolutionarily conserved intergenic region upstream of the pro apoptotic gene reaper ( rpr ). The IRER region undergoes a chromatin structure change from a permissive state to a blocked state at developmental stage 12, and stays for the rest of embryonic stages. When blocked, the IRER region is highly enriched with repressive chromatin marks, such as H3K27me3 and H3K9me3, and also bound by PcG proteins. T hi s switch of chromatin structure is responsible for the radiation sensitivity transition during the embryogenesis. The functions of histone modifyer proteins, including Hdac1(rpd3), Su(var)3 9, Su(z)12 and P c are required for this process. Thus, direct epigenetic regulation of IRER controls cellular sensitivity to cytotoxic stimuli. The fact that there is little radiation stress in the natural environment suggests that IRER may have important biological functions during development. Indeed, several IRER deletion mutants showed downregulation of rpr in the stripped epidermis at stage

PAGE 17

17 10 11 embryos. T o monitor the chromatin accessibility of the I RER region in live animals, a DsRed reporter gene controlled by an ubiquitin promoter was inserted into the endogenous IRER locus The association of DsRed expression level and the chromatin accessibility of IRER were validated by analyzing the FACS sorted cells The DsRed expressing cells showed some specific pattern in various tissues. Interesting ly, rapid induction of DsRed upon irradiation was found in the larval imaginal discs. Also, nutrition deprivation result ed in increased DsRed in IRER{ubi DsRed} larvae. Its dynamic epigenetic status suggests that IRER is responsive to environmental stresses and adjust s the cellular sensitivity to stress induced apoptosis by changing its chromatin configuration. The chromatin barrier element functions against the p ropagation of condensed heterochromatin into the euchromaitn regions. The epigenetic blocking is restrained in the IRER without affecting the rpr promoter and basic enhancer region suggesting the existence of a barrier element at the chromatin transition region. T he essential chromatin barrier element was narrow ed down to a 167bp region at the IRER left barrier (ILB) with a reporter assay The ILB barrier is sufficient to prevent the propagation of heterochromatin associated with PRE mediated silencing an d this barrier activity requires the binding of Cut protein, which may recruit the histone acetyltransferase CBP Unlike all of the known insulators identified from Drosophila the ILB does not contain enhancer blocking activity. The study of the enhancer specific epigenetic suppression delimited by the ILB barrier greatly contributes to our knowledge of the advanced gene regulation beyond the DNA sequence in eukaryotic genomes.

PAGE 18

18 CHAPTER 1 BACKGROUND AND INTRO DUCTION Apoptosis and Cell Death Regulation Ap optosis is a n essencial biological process in multicellular organisms to eliminate the damaged, aged, infected or excessive cells (Bergmann et al. 1998c; Horvitz 1999; Vaux and Korsmeyer 1999) The apoptotic program is triggered by the activation of caspase s Caspases are ubiquitously expressed as the inactive pro caspase in most cells. Upon activation effector caspases will cleave structural proteins, enzyme inhibitors, etc. which in turn will lead to destruction, fragmentation and engulfing of the dying/dead cell s (Steller 199 5) Although caspase activation and apoptosis can proceed without de novo protein synthesis under certain special circumstances, an abundance of evidence suggests that transcriptional mechanisms play a pivotal role in apoptosis initiation. Transcriptional activation of pro apoptotic genes is especially important for initiating apoptosis in response to cytotoxic stimuli. The genetic requirement of transcription factors such as P53 in irradiation induced cell death underscores the importance of the transcrip tional response (Lowe et al. 1993; Chao et al. 2000) A general observation of the cell death regulatory pathways reveals that downstream players such as caspases tend to be ubiquitously expressed and with their a ctivity mostly regulated by post translational mechanisms. I n contrast, most, if not all, upstream regulators are regulated at the transcriptional level and are selectively expressed during development or in res ponse to cytotoxic stimuli (Figure 1 1 ). I n t he Bcl 2 (ced 9) pathway, the pro apoptotic upstream initiators, such as the BH3 only protein coded by egl 1 gene in C. elegans (Conradt and Horvitz 1999; Thellmann et al. All gene names are italicized. Protein names are non italicized and capitali zed.

PAGE 19

19 2003) are regulated at the transcriptiona l level. Human BH3 only pro apoptotic genes such as puma ( p 53 u pregulated m odulator of a poptosis ) and noxa are the direct transcriptional targets of P53 (Nakano and Vousden 2001; Yu et al. 2001; Villunger et al. 2003 ) Correspondingly, p53 dependent irradiation induced cell death is inhibited or totally blocked in noxa and/or puma knockout mice, depending on the tissue examined (Jeffers et al. 2003; Shibue et al. 2003) In Dr osophila the I nhibitor of A poptosis P rotein ( D IAP ) 1 protein plays an essential role in inhibiting programmed cell death during development. Diap1 is ubiquitously expressed and inhibits the activation of caspases. In embryos mutated for diap1 essentially all cells die when the maternally deposited Diap1 is exhausted (Wang et al. 1999; Goyal et al. 2000) During development, specific elimination of cells is accomplished by selected expression of the IAP antagonists, including reaper (White et al. 1994) hid (Grether et al. 1995) grim (C hen et al. 1996) and sickle (Christich et al. 2002; Srinivasula et al. 2002; Wing et al. 2002) which remove the IAP inhibition and cause caspase activation (reviewed in (Ca shio et al. 2005; Ditzel and Meier 2005; Vaux and Silke 2005) ). Interestingly, all of the 4 genes are located in a genomic region of about 350kb and are transcribed in the same direction. During development, reaper grim and sickle are specifically expre ssed in cells that are destined to die (White et al. 1994; Chen et al. 1996; Christich et al. 2002; Srinivasula et al. 2002; Wing et al. 2002) suggesting the importance of a transcriptional mechanism in achieving t he appropriate level of cell death in each tissue. The expression of hid is largely limited to dying cells although it is expressed in cells that do not die, possibly due to the fact that unlike the other three, the pro apoptotic activity of Hid is subject to post translational modification

PAGE 20

20 (Bergmann et al. 1998b) In addition to mediating developmental cell death, transcriptional activation of these genes is responsible for the tissue degeneration induced by ecdyson e during metamorphosis. Not surprisingly, reaper hid and sickle are transcriptionally activated following ionizing irradiation to mediate cell death (White et al. 1994; Christich et al. 2002; Brodsky et al. 2004; Z hang et al. 2008a; Zhang et al. 2008b) In mutant embryos lacking reaper and hid irradiation induces little apoptosis (White et al. 1994) Patterns of C ell D eath d uring E mbryogenesis Cell death has long been noticed for embryos mutated for g enes which govern differentiation and development (Magrassi and Lawrence 1988; Smouse et al. 1988) Systematic analysis of cell death during Drosophila embryogenesis in wild type embryos was first carried out by Abr ams et al (Abrams et al. 1993) T hey showed that most cell death during Drosophila embryogenesis share the canonic al characteristics of apoptosis. The vital dye Acridine Orange (AO) was found especially sensitive to the apoptotic cells in Drosophila embryo s, although it seems to preferentially label cell s in later stage of apoptosis. Often, it also labels the apoptotic bodies phagocytosed by migrating macrophages (Abrams et al. 1993) AO positive cells first appear at embryonic stage 11 (about 7 hour after egg laying (AEL)) in the precephalic region. However, the AO labeling pattern quickly spreads out to the other segments and reaches a peak level at stages 12 and 13 (8 10hr AEL), when nearly all segments have AO positive cells. The level of cell death wane s after stage 14, and becomes mainly restricted to the ventral nerve cord at the end stage of embryogenesis (Stage 16 17, after 15hr AEL).

PAGE 21

21 The overall pattern of cell death is quite dynamic throughout the course of Drosophila embryogenesis after 7 hr aft er egg laying as revealed by AO staining or t erminal deoxynucleotidyl transferase dUTP nick end labeling ( TUNEL ) (Abrams et al. 1993; Pazdera et al. 1998) Although the general pattern associated with a particular developmental stage is highly reproducible, the exact number and positions of dying cells at a give n point may vary significantly. For instance, the pattern of AO or TUNEL positive cells in the ventral epidermis between stages 12 14 shows a rough segmenta lly repeated pattern associated with segment boundaries (Pazdera et al. 1998) However, the positions and numbers of dying/dead cells are only partially symmetrical on the two sides of the midline. A genetic screen identified t hat the genomic region deleted in the H99 deficiency mutant is required for almost all developmental cell death in Drosophila embryogenesis (White et al. 1994) Three genes in this region, reaper (White et al. 1994) hid (Grether et al. 1995) and grim (Chen et al. 1996) encode pro apoptotic proteins that functio n as IAP (Inhibitor of Apoptosis) antagonists. These proteins share an IAP binding motif (IBM), which can bind to IAP and relieve its inhibition on caspases. A 4 th IAP antagonist, sickle reside just upstream of reaper but was not deleted in the H99 defi ciency (Christich et al. 2002; Srinivasula et al. 2002; Wing et al. 2002) The four IAP antagonists reside in a ~350kb region that is highly conserved as a synteny in the sequenced Drosophila genomes. With the excep tion of hid expression of the IAP antagonist genes appears to be limited to cells destined to die during embryogenesis. The pro apoptotic function of Hid can be suppressed by the MAP kinase pathway and hid is the only one of the four whose mRNA can be det ected in cells that do not die.

PAGE 22

22 The central nervous system (CNS) of the H99 mutant embryo is about 3 4 times larger than the wild type at the end of embryogenesis, indicating that approximately 70% of the cells in the embryonic CNS die during embryogenesis (White et al. 1994) A similar ratio was observed in monitoring the developmental cell death of the glia cells at the CNS midline (Sonnenfeld and Jacobs 1995a; Zhou et al. 1995) Cell lineage specific makers allowed monitoring of these cells during wild type embryogenesis as well as in H99 mutant. While there are about 8 slit1.0 lacZ expressing midline glial (MG) cells per segment at early stage 12, only 3 cells remain there at the end of embryogenesis. The rest undergo cell death, which depends on the function of the three IAP antagonist genes deleted in H99 mutant (Zhou et al. 1995) However, not every cell lineage undergoes cell death during embryogenesis. For instance, the number of ventral unpaired neurons in the CNS midline remains unchanged during both wild ty pe and H99 embryogenesis (Zhou et al. 1995) Interestingly, man y dying cells are quickly phagocytosed by migrating hemocytes / macrophages during embryogenesis (Abrams et al. 1993; Tepass et al. 1994; Sonnenfeld and Jacobs 1995b; Zhou et al. 1995) It seems that dying cells are from their original location towards the space through which hemocytes will migrate. The display of phagocytotic signal on the dying cells depends on the function of IAP antagonists and caspas e activation. On the macrophage side, Croquemort, is r equired for recognizing the apoptotic cells (Franc et al. 1996; Franc et al. 1999) However, the genesis of hemocytes in the cephalic mesoderm and their stereotypic migration in the embryo are independent of cell de ath, as both were largely normal in the H99 mutant

PAGE 23

23 background (Tepass et al. 1994; Zhou et al. 1995) Reciprocally, cell death can procee d normally in embryos that lack macrophage s (Tepass et al. 1994) The majority of cell death during embryogenesis occurs between stage 11 to stage 13. In post stage 15 embryos, only discrete cells in the ventral nerve cord can be detected as AO or TUNEL positive (Abrams et al. 1993; Zhang et al. 2008a) Most of these late dying cells appear to be neuroblasts (Karcavich and Doe 2005; Rogulja Ortmann et al. 2007) Unlike cell death at earlier stages, dying neuroblasts do not appear to be phagocytosed by macrophages. Why should cells be generated in the embryo only to be e liminated in just a few hours? The reason may differ depending on the circumsta nce. For example, the midline glial cells guide the crossing over of the axons from each hemisphere, eventually forming the commissural axon tract. Interestingly, midline glia l cell death concurs with the end of commissural axon formation and separation, suggesting that the MG cell death may be a mechanism to eliminated obsolete cells (Sonnenfeld and Jacobs 1995a) On the other hand, c ell death of the abdominal neuroblasts cells is timed to terminate their potential to proliferate (Bello et al. 2003; Maurange et al. 2008) In H99 deficiency mutant that lacks reaper hid and grim t he rescued neu roblasts continue to proliferate and ge nerate supernumerary cells. This indicates that cell death also serves to prevent over proliferation. Toyama et al. also demonstrated that cell death in the aminoserosa cells actually contribute to the movement of cel l sheet during morphogenesis (Toyama et al. 2008) The delamination and extrusion of the apoptotic cell produces a force that is required for bringing the cell sheet t ogether during dorsal closure. This wa s a rather surprising

PAGE 24

24 finding. Clearly, the functional significance of cell death may well surpass what we have already known or thought about so far. Polycomb Silencing and Genomic Programmes DNA is compacted into the nucleus as the chromatin in eukaryotic genomes The nucle osome is the subunit of chromatin and is composed of 14 7 bp of DNA wrapped around an octamer of histones. Each nucleosome core consists of two copies of each of the histones H2A, H2B, H3 and H4. The nucleosomes form an approximately 11 nm on a str ing The N terminal tails of histones are subject to different post transcriptional modifications, such as methylation, acetylation, phosphorylation and ubiquitination. Different combination s of histone modification s also known as histone code, wil l confer the chromatin different structure, and thereby control the expression of the associated genes. E pigenetic s refers to the study of a heritable gene expression pattern that is due to the information contained in chromatin, other than the associated DNA sequence. There may be s everal mechanisms involved in epigenetic regulation: (1) ATP dependent chromatin remodeling (Flaus and Owen Hughes 2004) (2) post translational covalent modifications of the histones, (3) histone variant replacement (Kamaka ka and Kadonaga 1994) and (4) DNA methylation at CpG sites (Scarano et al. 2005) These mechanisms may work in an inexclusive way in higher eukaryotes. The cell fate is determined by the specific gene expression pattern and maintained by e pigenetic mechanism This pr ocess is also known as cellular memory, and Polycomb group (PcG) proteins play important roles in maintain ing the silenced state of their target genes active expression.

PAGE 25

25 PcG Complexes Polycomb group (PcG) proteins are required to prevent inappropriate expression of Hox genes (Lewis 1978) The expression pattern of homeotic genes is initially established by proteins coded by segmentation gene s which act as activators and repressors. After early embryogenesis, the PcG silencing mechanisms take over to maintain the repressed state through the rest of development (Zhang and Bienz 1992; Qian et al. 1993; Pirrotta 1998) PcG silencing involves at least three kinds of polycom b repressive complex es (PRC) including PRC1, PRC2 and PhoRC complexes (Table 1 1) (Schwartz and Pirrotta 2007) PRC1 complex The core of Drosophila PRC1 contains Polycomb (Pc), Polyhomeotic (Ph), Posterior Sex Combs (Psc), and dRING (also known as Sex Combs Extra [Sce]). The PRC1 complex contains multiple chromatin modifying activitie, and is believed to be the maintenance unit directly responsible for actual repre ssion of gene expression through the combination of two mechanisms chromatin compaction or direct interaction with general transcription machinery (Shao et al. 1999; King et al. 2002; Francis et al. 2004; Lavigne et al. 2004; Levine et al. 2004; Wang et al. 2004a) For instance the PRC1 and hPRC H complexes interact with chromatin and block the chromatin remodeling process by the SWI/SNF complex (Shao et al. 1999; Francis et al. 2001) as well as the transcription by RNA polymerase II (King et al. 2002; Dellino et al. 2004) TATA box binding protein (TBP) associated factors (TAFIIs) were also found as one of the components of PRC1 (Breiling et al. 2001; Saurin et al. 2001) Pc protein contains an N terminal chromodomain and a Pc box at the C terminal domain The chromodomain is responsible for the binding of Pc to H3K27me3 (Fischle

PAGE 26

26 et al. 2003; Min et al. 2003) whereas t he small Pc box is necessary for the transcriptional repression function of Pc protein and is required for its interaction with dRING. M ammalian PRC1 component RING1B contains the E3 ubiqu itin ligase activity, and this enzymatic activity is stimulated by two other components BMI1 and RING1A (Cao et al. 2005) Similarly, dRING i n Drosophila PRC1 complex also ha s the ubiquitin ligase activ ity (Wang et al. 2004a) Psc, another component of Drosophila PRC1, is responsible for the inhibition of nucleosome remodeling in vitro (King et al. 200 5) Psc is also a co factor for dRING, and is essential for its H2A ubiquitination function. Finally, it is proposed that Ph protein might be necessary for the spreading of PcG complexes (Kim et al. 2002) PRC2 complex In PRC2 complex, the SET domain containing subunit E(z) is the only catalytically active component, which is responsible for trimethylation of H3K27 (Cao et al. 2002; Czermin et al. 2002; Muller et al. 2002; Cao and Zhang 2004a) and may also trimethylate H3K9 in vitro (Czermin et al. 2002) H3K27 trimethylation recruits PRC1 through the chromodomain of PC protein and consequentially repress gene expression by condensing the chromatin structure and inhibiting transcriptional process es T he histone methyltransferase (HMTase) activity requires a minimum of three components E(z), Esc and Su(z)12 (Cao and Zhang 2004b; Nekrasov et al. 2005) In vitro studies showed that the Su(z)12 and Nurf 55 form the minimal nucleosome binding module of PRC2, but this is not sufficient for HMTase activity (Nekrasov et al. 2005) It is shown that Esc is crucial for the HMTase activity of E(z), and also required for the nucleosome binding of PRC2 (Ketel et al. 2005; Nekrasov et al. 2005) Studies of mammalian PRC2

PAGE 27

27 showed that SUZ12 is also essential for HMTase activity and the silencing function of the mammalian PRC2 complex (Cao and Zhang 2004b; Pasini et al. 2004) Recently the Polycomb like (Pcl) protein has been discovered in a variant of the PRC2 complex in flies which was only found on polytene chromosomes (Tie et al. 2003; Papp and Muller 2006) This Pcl PRC2 has a very similar HMTase activity as the PRC2 complex containing the core subunit E(z), Esc and Su(z)12, but it seems that their functions are not completely redundant (Tie et al. 2003; Nekrasov et al. 2007) Pcl mutants did not show significant changes in the genome wide H3K27 mono and dimethylation, but the high level of H3K27me3 at PcG target genes demonstrated a great reduction in the mutants (Nekrasov et al. 2007) PhoRC complex A novel PcG protein complex called PhoRC was discovered and characterized with r ecent biochemical purification of the Pho protein complex. Pho and Pho like (Phol) are sequence specific DNA bindin g proteins (Brown et al. 1998; Fritsch et al. 1999; Busturia et al. 2001; Mishra et al. 2001; Brown et al. 2003; Klymenko et al. 2006) dSfmbt is another component of PhoRC, which contains t he MBT (malignant brain t umour) repeats responsible for the interaction with mono or dimethylated H3K9 or H4K20 (Klymenko et al. 2006) Specifically, in the in vitro GST pull down assays conducted by Wang et al. (Wang et al. 2004b) showed that Pho directly interacts with E(z) and Esc, while Phol directly interacts with Esc but not E(z). PhoRC dependent E(z) recruitment and H3K27me3 deposit are required for Pc binding to the Ubx PRE. Also the study using DNA mobility shift assays showed that Pho and a PRC1 core complex bind synergistically to the bxd PRE (Mohd Sarip et al. 2005) Moreover, it has been suggested that the spacer region of Pho is implicated in interactions with Pc and Ph in

PAGE 28

28 both in vitro binding assays (Mohd Sarip et al. 2002) and tethering assays (Klymenko et al. 2006) It is worth noting that in phol;pho double mutant imaginal discs, derepression of Ubx was observed accompanying with disrupted distribution of PRC1 a nd/or PRC2 components. However mutation of Pho and Phol did not sho w significant affect on the binding of PRC1 and PRC2 on polytene chromosomes (Brown et al. 2003) suggesting that the Pho/Phol dependent PcG recruitment is absent in nonmitotic tissues. Targeting of PcG Repression It is always an enigma in the study of PcG mechanism s how the PcG complexes are recruited to their target genes. In Drosophila it has been known for a long time that Polycomb Response Elements (PREs), the specific regulatory region of several hundred base pairs, serve as docking platforms for PcG proteins and confer PcG dependent repression on their associated reporter genes. Cytological studies during the 90s suggested that there may be more than a hundred PREs in the Drosophila genome, and some of them had been verified experimentally (Ringrose and Paro 2007; Schwartz and Pirrotta 2008) However, their DNA sequences did not show clear homology so it is very difficult reveal a PRE consensus sequence only by sequence homology Some sequence specific DNA binding proteins were found at the PREs, including Pleiohomeotic (Pho), Pleiohomeotic like (Phol), GAGA factor (GAF; also known as Trithorax like [Trl]), Pipsqueak (Psq), Zeste, Grainyhead (Grh; also known as neuronal transcription factor 1 [NTF 1]), dorsal switch protein1 (Dsp 1) and Sp1/KLF family members (Muller and Kassis 2006) The s e proteins have been proposed to recruit PcG complexes to PREs, and Ringrose et al. (Ringrose et al. 2003) developed an algorithm based on the clustered pairs of these transcription factors binding sites and predicted 167 PREs in the Drosophila genome. However, three Drosophila genome wide ChIP

PAGE 29

29 on chip analyses (Negre et al. 2006; Schwartz et al. 2006; Tolhuis et al. 2006) found only limited overlap between the identified PcG protein binding sites and the predicted PREs described in the Ringrose et al. study. Actually mutations of many of these DNA binding proteins do not show any of the classic PcG phenotypes, and the number and distribution of their binding sites is quite variable. In addition, none of th em can be found at all identified PcG sites. It is possible that the recruitment of PcG complexes to the ha ve yet to be discovered. Alternatively, PcG complexes can be recruited to their target genes by different sets of combination of the DNA binding proteins in a tissue specific or developmental stage specific manner. Recruitment of PcG Complexes Wang et al. (Wang et al. 2004b) described a hierarchical recruitment pathway of P cG complexes at the Ubx PRE in the bxd region in both Drosophila SL2 cells and larval wing imaginal discs. In this model, the only DNA binding PcG protein Pho in the PhoRC complex binds to sites within PREs, and recruit s the PRC2 complex through direct i nteraction with E(z) and/or Esc. The PRC2 subunit E(z) trimethylates H3K27 at the PREs, which contributes to the recruitment and/or stabilization of the PRC1 complex to these particular sites. After sequentially recruited to the PREs, the PcG complexes int eract with the preinitiation complex at the remote promoter by looping out the chromatin region in between, and repress expression of the associated genes. However, this model was challenged by the findings of recent chromatin mapping experiments by ChIP a nd microarray techniques. These studies detected PcG proteins of both PRC1 and PRC2 complexes peaking sharply at known or putative PREs in D. melanogaster whereas the Pc protein covers a broader domain than other PcG

PAGE 30

30 proteins. On the other hand the distr ibution of H3K27me3 at a silenced gene usually covers more than ten kilobases including the entire tr anscribed region and the upstream regulatory region (Kahn et al. 2006; Papp and Muller 2006; Schwartz et al. 2006) (Wang et al. 2004b) the distribution of Pc protein does not correlate with that of H3K27me3, and dropped down gradually from the PRE peak. Moreover the PREs seem to have very low occupancy of methylated H3 which may be due to the depletion of nucleosomes at these regions (Kahn et al. 2006; Mohd Sarip et al. 2006; Papp and Muller 2006; Schwartz et al. 2006) Based on this evidence Schwartz and Pirrotta (Schwartz and Pirrotta 2007) proposed an alternative looping model in which DNA binding proteins such as Pho and GAF bind to the nucleosome free PRE and recruit PRC1 and PRC2 complexes. The PRE bound complexes methylate flanking nucleosomes, and the methylation domain is extended by looping of the PRE bound complexes to contact nuceosomes over a broad domain. The looping is facilitated by the interaction between the Pc chromodomain and methylated nucleosomes, and possibly other methyl binding domains, such as PHD fingers, MBT repeats Tudor and SET domains in other PcG proteins. PcG Silencing and Biological Functions Besides the best studied Drosophila Hox genes, there are many other PcG target genes Recent genome wide studies suggested that, PcG mechanisms are involved in processes of development and cell fate decisions, cell cycle progression, and possibly programmed cell death in both mammals and Drosophila (Sanchez Elsner et al. 2006 ; Struhl 1983; Riley et al. 1987; Kuziora and McGinnis 1988; Jones and Gelbart 1990; Moazed and O'F arrell 1992; Simon et al. 1992)

PAGE 31

31 PcG proteins and development PcG proteins were first discovered in Drosophila melanogaster as negative trans regulators that are required to prevent inappropriate expression of homeotic (Hox) genes (Lewis 1978) In Drosophila segmentation requires expression of the engrailed ( en ) gene in the posterior gr oup of cells in each segment, while segmental identity is specified by the selective expression of the Bithorax and Antennapedia complexes, two clusters of genes known as Hox genes. In early embryogenesis, the homeotic genes are first turned on in the 3 ho ur old embryo, and their characteristic domains of expression are shaped by maternal and transiently expressed zygotic proteins coded by pair ru le genes gap genes and segmentation genes (McGinnis and Krumlauf 1992) The majority of the early transcription factors disappear at mid embryogenesis when gastrulation begins (Orlando et al. 1998) and the expressio n pattern of homeotic genes is spatially maintained by PcG and trithorax (trxG) proteins throughout development. The derepression of engrailed and Hox genes in the PcG mutants is only observed after the completion of the early tiers of regulation that esta blish and refine the pattern of these genes (Struhl 1983; Riley et al. 1987; Kuziora and McGinnis 1988; Jones and Gelbart 1990; Moazed and O'Farrell 1992; Simon et al. 1992) suggesting that the maintenance of patte rned expression involves a molecular mechanism distinct from those that guide pattern establishment. As a consequence of this cellular memory, if a homeotic gene was not previously active in the early embryos at a specific tissue or cell lineage, it remain s repressed by PcG silencing over cell cycles. In contrast, a gene is activated at later stages only in the progeny of cells in which it was active in the early embryos. Genetic analysis has suggested that PcG proteins maintain the repressed gene state pos sibly through setting a repressive mark, such as H3K27me3. At the same

PAGE 32

32 time, trxG proteins maintain the active state of those previously transcribed genes by deposit ing the a ctive mark, such as H3K4me3 ans acetylated histones In addition to Hox genes, the re is a growing list of PcG target genes that are important for cell fate decision and development. The products of many of these genes are transcription factors, as well as secreted morphogens ( wingless hedgehog decpentaplegic ), and even some PcG protei n themselves ( Psc Ph ) (Schwartz and Pirrotta 2007) These genes are regulated in a tissue specific or developmental stage specific manner. In any given cell type, only those genes required for specifying the cell identity are active, while othe rs remain silenced by PcG mechanisms. Recently, several studies have noted that non coding RNAs play a role in regulating PcG silencing, and might also involved in the switching or resetting epigenetic state. Schmitt et al. showed that (Schmitt et al. 2005) the establishment of PcG mediated silencing was abolished by intergenic transcription through the Fab 7 PRE. Although this model is supported by some other reports ( Bender and Fitzgerald 2002; Hogga and Karch 2002; Rank et al. 2002) another study did not detect such non coding transcription after resetting of the state mediated by a minimal Fab7 PRE (Dejardin and Cavalli 2004) Interesti ngly, a recent paper reported that non coding transcripts of a Trithorax Response Element (TRE) play an important role in epigenetic activation of gene expression by recruiting Drosophila ASH1 histone methyltransferase to the TRE of the Ubx gene (Sanchez Elsner et al. 2006) Although the mechani sms of how these non coding RNAs are regulated and recruited to the target genes still remain unknown, more investigation in this field will definitely broaden our understanding in epigenetic maintenance and switching.

PAGE 33

33 PcG proteins and the cell cycle It ha s long been noticed that Drosophila PcG mutations can cause cell cycle defects. For example, E(z) 1 alleles display a small disc phenotype with no discernible mitotic figures (Phillips and Shearn 1990) However, it remains unclear how PcG complexes control cell cycle progres sion. Martinez et al. (Martinez et al. 200 6) found that depletion of PcG protein PC by RNAi alters the cell cycle in proliferating S2 cells, then they identified a PRE as the target region for PC and PH within the promoter, the first exon and the first intron of the CysA gene. This PRE sequence c an cause PcG dependent variegation of the min white reporter gene in transgenic files, as this phenotype is reversed in a PcG mutant background. Remarkably, in homozygous Pc / embryos, endogenous CycA expression is upregulated, while downregulation of CycA was observed when Pc and Ph are overexpressed in dividing embryonic cells. They thus proposed that PcG complexes can act as direct transcriptional repressors of cell cycle genes. It has been known that CycA level is crucial for controlling mitosis as the only essential mitotic cyclin in Drosophila (Jacobs et al. 1998) CycA inhibits the Fizzy related protein (Fzr), which is a single inhibitor of mitosis (Dienemann and Sprenger 2004) Another study found that PcG complexes inhibit the accum ulation of mitotic CycA and affect the G2/M transition (Martinez et al. 2006) In addition to directly regulating cell cycle genes, PcG complexes might regulate the cell cycle by modulating general chromatin condensation. For instance, chromatin perturbations could result in genome instability a nd mitotic defects. Lupo et al. (Lupo et al. 2001) showed that Drosophila Topoisomerase II and Barren proteins, which are required for proper mitotic condensation interact in vivo with PcG target sequences in the bithorax complex. Similarly, another study reported that a Drosophila centrosomal

PAGE 34

34 and chromosomal factor Ccf, also required for condensation in mitosis shares the same binding sites on polytene chromosomes with Psc protein (Kodjabachian et al. 1998) Finally, mutations in Ph Pc and Psc demonstrated segregation defects with the formation of anaphase bridges during syncytial embryonic mitoses (O'Dor et al. 2006) All of this evidence sug gest s an important function of PcG proteins in mitosis. Insulators The eukaryotic genome is organized in the way that discrete functional domains lie next to one another. Insulator/boundary elements are regulatory DNA sequences that create the boundaries b etween these domains and prevent promiscuous gene regulation There are two biochemical activities associated with insulators/boundaries: one is enhancer blocking activity which prevents enhancer promoter communication when positioned in between them; the other is chromatin barrier activity, which blocks the silencing effect mediated by heterochromatin (Gaszner and Felsenfeld 2006) Several functional assays were developed to evaluate these two activities. The enhancer blocking function was demonstrated by the ability of the potential insulator to prev ent an enhancer from activating a reporter gene on the other side (Kellum and Schedl 1992) T he reporter assays for testing barrier activity were based on the postulate that the candidate barrier sequences should p rotect a reporter gene against position effects due to the local chromatin environment (Kellum and Sc hedl 1991) or preventing the silencing effect initiated by some silencing elements such as Polycomb Response Elements (PREs) in Drosophila or HM silencers in yeast (Sigrist and Pirrotta 1997; Bi and Broach 1999; D onze et al. 1999) Although the molecular mechanism of insulator/boundary elements is not as clear as other well studied regulatory elements such as promoters and enhancers, some

PAGE 35

35 models for insulator action have been proposed in the light of recent invest igations on yeast, Drosophila and chicken. There are three models for how enhancer blocking insulators disrupt the interaction between enhancers and promoters, namely the promoter decoy model, the physical barrier model, and the loop domain model (Bushey et al. 2008; Raab and Kamakaka 2010) Each of these models has its own supporting evidence and may not be exclusive. Meanwhile, the working models for chromatin barrier function are mainly derived from the studies o n yeast and chicken cells. The observations in several yeast boundary elements prompt ed the proposition of the nucleosome gap model (Bi and Broach 2001) In this model, recruitment of specific transcription factors, such as Rap1 and Reb1, at a barrier precludes nucleosome assembly and creates a gap in a regular nucleosome array (Bi and Broach 1999; Do nze et al. 1999; Fourel et al. 1999) This nucleosome free gap prevents the spread of heterochromatin mediated by Sir2/Sir3/Sir4 complexes which may otherwise propagate along the chromatin fiber to the neighboring regions (Bi and Broach 1999) Another globin locus, one of the best studied insulators in vertebrates. A series of elaborate analyses in this insulator indicated that its enhancer blocking and barrier activities are separable and carried out by distinct DNA elements (Bell et al. 1999; Recillas Targa et al. 2002; West et al. 2004; Gaszner and Felsenfeld 2006) Deletion of the CTCF binding site (footprint II or FII), which is responsible for the enhancer blocking activity, did not affect the ba rrier activity mediated by the other four footprints (Recillas Targa et al. 2002) The DNA sequences required for the barrier activity can be further dissected into two functional units. FIV interacts with upstream stimulatory factor 1

PAGE 36

36 (USF1) which recruits specific chromatin modifyin g enzymes that catalyze the histone modifications favoring euchromatin, including histone acetylations, H3K4 and H4R3 methylations (West et al. 2004; Huang et al. 2007) This results in a local chromatin environmen t that is unfavorable to the propagation of heterochromatin. Whereas another three footprints FI, FIII and FV restrict the spread of DNA methylation through the recruitment of vascular endothelial zinc finger 1 (VEZF1) (Dickson et al. 2010) Although the enhancer blocking and barrier activities are separable in chicken cells, it is not clear whether this is common in other organisms. There are at least five types of insulators reported in Drosophila defined by their associated proteins, including Suppressor of Hairy Wing [Su(Hw)] in gypsy insulator, Zeste white 5 (Zw5) in scs element, B oundary Element Associated Factors (BEAF32) in element, Drosophila CTCF (dCTCF) in Fab 8 insulator, and GAGA binding Factor (GAF) in multiple insulators (Maeda and Karch 2007; Gurudatta and Corces 2009) The r eporter based assays revealed that most if not all of the known Drosophila insulators exhibit both enhancer blocking and barrier activities (Kellum and Schedl 1991; Roseman et al. 1993; Sigrist and Pirrotta 1997; Ba rges et al. 2000; Majumder et al. 2009) However, there is a good possibility that separable elements responsible for either activity resides within the Drosophila insulators. One evidence comes from the observation that evolutionarily conserved E(y)2/Sus 1 protein is required for the barrier activity of the Wari insulator as well as Su(Hw) dependent insulators in vivo (Kurshakova et al. 2007; Erokhin et al. 2010) It is likely that different domains of Su(Hw) inter act with different protein complexes that are responsible for either enhancer blocking or barrier activities. In addition, a recent study on the Drosophila SF1 insulator showed that the chromosomal

PAGE 37

37 position effect (CPE) blocking activity was independent of GAF binding sites that are essential for the embryonic insulator activity (Majumder et al. 2009) Therefore the SF1 may contain multiple non overlapping regions responsible for diverse functions, though the cis elements accounting for the CPE blocking activity and the related trans factors have yet to be determined.

PAGE 38

38 Figure 1 1. Cell death regulatory pathways in different organisms. A) Simplified schematic presentation of the three major apoptosis pathways, which, when activated, all lead to the activation of caspases (in dashed square). Colors distinguish the organism to which the gene/protein belongs (eg. C elegans Drosophila and Mammals ). Upstream pro apoptotic gene s that are subject to transcriptional regulation were underlined B) Summarization of the observation of that many downstream players in the apoptotic pathways tends to be ubiquitously distributed (Dis.) and their activities are mostly regulated (Reg.) by post translational mechanism such as cleavage of pro caspases. In contrast, most up stream regulators tend to be transcriptionally regulated and are only expressed in selected cells.

PAGE 39

39 Tab le 1 1 Components of PcG complexes PcG protein paralogs Protein domains Functions Drosophila melanogaster Human Mouse PRC1 maintenance complex Pc* CBX2/HPC1 CBX4/HPC2 CBX8/HPC3 CBX2/M33 CBX4/MPC2 CBX8/PC3 Chromodomain Preferentially binds to H3K27me 3 SUMO E3 ligase Ph* EDR1/HPH1 EDR2/HPH2 EDR3/HPH3 EDR1/MPH1/Rae28 EDR2/MPH2 EDR3/MPH3 Zinc finger SPM domain Stoichiometric components of PRC1 and required for silencing Psc* BMI1/PCGF4 MEL 18/RNF110/ZFP144 MBLR/RNF134/PCGF6 BMI1/PCGF4 MEL 18/RNF110/ZFP 144 MBLR/RNF134/PCGF6 RING finger domain Co factor for dRING, essential for its H2A ubiquitination function dRING* RING1/RNF1/RING1A RNF2/RING2/RING1B RING1/RNF1/RING1A RNF2/RING1B RING finger domain E3 Ubiquitin ligase for H2AK119 Scm SCMH1 SCMH2 SCMH1 Zinc finger SPM domain ? PRC2 initiation complex E(z)* EZH1 EZH2 EZH1/ENX2 EZH2/ENX1 SET domain Methylation of H3K9, H3K27 Su(z)12* SUZ12 SUZ12 Zinc finger Co factor for E(z) Esc* EED EED WD40 repeats Co factor for E(z) Escl EED EED WD40 repeats Co factor for E(z) Nurf 55 RbAp46/48 WD repeat Binds to histone, involved in nucleosome remodeling Pcl PHF1 PHF1/PCL1 PHD, Tudor Interacts with E(z) via PHD domain, required for high levels of H3K27me3 specifically at PcG target genes PhoRC sequence spec ific DNA binding complex Pho* YY1 YY1 Zinc finger Sequence specific DNA binding Phol YY2 YY2 Zinc finger Sequence specific DNA binding dSfmbt* L3MBTL2/SFMBT1 L3MBTL2 Zinc finger MBT repeat, SAM Binds to mono and dimethylated H3K9 and H4K20 Owing to th e tremendous diversity of PcG homologues in vertebrates, this table is not exhaustive. *The se proteins are the core components of each PcG complex they belong to. Nurf 55: nu cleosome r emodeling f actor 55 Sfmbt: Scm related gene containing four mbt domains MBT: malignant brain tumor SAM: sterile motif

PAGE 40

40 CHAPTER 2 EPIGENETIC BLOCKING OF AN ENHANCER REGIO N CONTROLS IRRADIATI ON INDUCED PRO APOPTOTIC GENE EXPRE SSION IN DROSOPHILA EMBRYOS Abstract Drosophila ray induced ap optosis at early but not later, more differentiated stages during development. Two pro apoptotic genes, reaper and hid are up regulated rapidly following irradiation. However, in post stage 12 embryos, in which most cells have begun differentiation, neith er pro apoptotic gene can be induced by high doses of irradiation. Our study indicates that the sensitive to resistant transition is due to epigenetic blocking of the Irradiation Responsive E nhance r R egion (IRER), which is located upstream of reaper but is also required for the induction of hid in response to irradiation. This IRER, but not the transcribed regions of reaper / hid becomes enriched for trimethylated H3K27/H3K9 and forms a heterochromatin like structure during the sensitive to resistant transit ion. The functions of histone modifying enzymes Hdac1(rpd3), Su(var)3 9, and PcG proteins Su(z)12 and Polycomb are required for this process. Thus, direct epigenetic regulation of two pro apoptotic genes controls cellular sensitivity to cytotoxic stimuli. Introduction Although caspase activation and apoptosis can proceed without de novo protein synthesis under certain special circumstances, abundant evidences suggest that transcriptional and translational mechanisms play crucial roles in regulating apoptosi s induced by cytotoxic stimuli. The genetic requirement of transcription factors such as P53 in irradiation induced cell death underscores the importance of the transcriptional response. Several pro apoptotic genes, including puma ( p53 upregulated modulato r of apoptosis ), are the direct transcriptional targets of P53. In puma knockout mice,

PAGE 41

41 irradiation induced cell death in hematopoietic cells and the developing nervous system is almost completely blocked (Jeffers et al. 2003) Although much has been revealed about the molecular mechanism of P53 mediated pro apoptotic gene expression and apopt osis, we understand very little as to why different tissue/cell types can have dramatically different sensitivity to irradiation. In Drosophila the Inhibitor of Apoptosis Protein (IAP) antagonists play a pivotal role in regulating programmed cell death during development. Upon its initial identification, the IAP antagonist reaper was found to be transcriptionally activated upon irradiation (White et al. 1994) The H99 genomic region, which also includes two other IAP antagonists hid and grim is required for mediating irradiation induced cell death in Drosophila A reporter construct containing the immediate 11kb sequence upstream of the reaper transcribed region gives a much broader expression pattern in transgenic animals than that of the e ndogenous reaper mRNA (Nordstrom et al. 1996) suggesting that key inhibitory cis regulatory function is not present in the reporter construct. This 11kb reporter construct is responsive to ionizing irradiation and contains at least one putative P53 response eleme nt (P53RE) that conforms to the patterns of mammalian P53 binding sites (Brodsky et al. 2000) Correspondingly, genetic analysis indicated that the function of Drosophila P53 (DmP53) is required for mediating ionizing irradiation induced reaper expression and apoptosis (Lee et al. 2003; Sogame et al. 2003; Brodsky et al. 2004) However, several questions remain to be addressed. First, the sensitivity to irradiation induced cell death is tissue/cell type specific and restricted to ce rtain developmental stages. The difference in sensitivity has no direct correlation with the availability of DmP53. Rather, the windows of sensitivity seem correlated with

PAGE 42

42 developmental marks such as high proliferation. Second, over expression of DmP53 fai led to induce reaper expression or apoptosis in many tissues, indicating that DmP53 alone is not sufficient in inducing reaper expression, or (and) the P53RE is not always accessible. It has been observed that during development, the sensitivity to irradi ation induced cell death can change rapidly even for the same cell linage. For instance, while the proliferating neural precursor cells in the mammalian hippocampus are extremely sensitive to ionizing irradiation, differentiating or differentiated neurons in the same region are resistant (Peissner et al. 1999; Mizumatsu et al. 2003) A similar switch of sensitivity to irradiation was observed during Drosophila embryogenesis. While both reaper and hid are induced to m ediate cell death in young embryos with mostly proliferating cells, neither can be induced in embryos developed a few hours further when most cells are differentiating or differentiated. This system offered us a valuable model to explore the molecular mech anisms underlying the sensitive to resistant transition accompanying cellular differentiation. In this study, we found that the IRER upstream of the reaper locus, including the putative P53RE, is subject to epigenetic regulation during development. Histone modification and chromatin condensation specific to the IRER, but not the promoter region, are capable of switching off the sensitivity to irradiation induced pro apoptotic gene expression and cell death. To our knowledge, this is the first evidence that direct epigenetic regulation of pro apoptotic gene(s) controls cellular sensitivity to cytotoxic stimuli.

PAGE 43

43 Materials and Methods Fly Strains and Genetic Crosses Canton S and yw Drosophila strains were used as wild type in this study. The Exelixis insertion strains were obtained from Dr. Artavanis Medical School. The Hdac mutant alleles 303, 313, 326, 328, def 8, and def24 were kindly provided to us by Drs. Mottus and Grigliatti (Mottus et al. 2000) The Su(z)12 alleles were provided to us by Dr. Jurg Muller (Birve et al. 2001) The E(z) alleles were obtained from Dr. Rick Jones. Other mutant strains were obtained from the Bloomington Stock Center. Genetic crosses for generating defined deletions using the Exelixis insertional strains and tool kit were performed strictly as described (Thibault et al. 2004 ) Embryo Staging and Irradiation Wild type as well as mutant embryos were collected for a defined period on standard juice/agar plates and aged to the desired developmental stages. Collections of embryos were randomly sorted into treatment and control gr oups. The control group ray irradiation applied using a Model M Gammator (Radiation Machinery Corporation, NJ). For microarray and in situ hybridization RNA analysis, embryos were incubated at room te mperature (RT) for 15 30 min after irradiation. For quantitative PCR experiments, embryos were incubated for the indicated time length following irradiation. After incubation, embryos were dechorionated using 50% bleach, rinsed three times with ddH 2 O, and snap frozen with the dry ice/ethanol bath. Samples were stored at 80 C prior to RNA extraction. Gene E xpression A nalysis Total RNA and mRNA were extracted with RNeasy Mini Kits (QIAGEN, CA) or Poly(A) Pure (Ambion, TX), respectively.

PAGE 44

44 Real time PCR. Tota l RNA samples were treated with DNase I to remove genomic DNA. cDNA were prepared by reverse transcription of total RNA with High Capacity cDNA Archive Kit (Applied Biosystems). Quantitative real time PCR (QPCR) followed protocols provided by the manufactu rer. The real time PCR step used 100ng total cDNA/PCR well with triplicates per gene per sample. For primer sequences and detailed procedures please refer to the supplementary information. Microarray Data Analysis Identifying ray responsive genes : Gene expression levels in ray treated and control samples were first compared using Affymetrix Analysis Suite 5.0 by setting the set through this analysis. To minimize the non syst ematic error caused by random measurements were analyzed by (SAM) (Tusher et al. 2001) Genes (Probe sets) ranked at the top 50 based on the (Tusher et al. 2001) and whose selected as potential ray responsive genes. Comparison and visualization of array data: For further analysis and visualization of array data, outputs from the Affymetrix Analysis Suite were loaded into the GeneSpring (Silicon Genetics) array analysis package. Genomi c sequence and coordinates for each gene were extracted from datasets obtained from the Berkeley Drosophila Genome Project ( http://www.fruitfly.org/ ). Gene lists for functional groups,

PAGE 45

45 such as apoptosis genes, were compiled based on functional annotation s from Flybase ( http://www.flybase.org/ ) using Functional annotation of gene lists Initial analysis of DNA array data as outlined above resulted in extensive gene (probe set) lists. To facilitate functional analysis, we annotated the li sts using a Python supplementary data ST1). Statistical Analysis We performed comparisons on the proportions of detectable genes to be cell death regulatory genes using the Chi square test for paired samples. A 95% confidence i nterval was calculated for the proportion difference, e.g., where and are detectable proportions at the sensitive and resistant stages respectively and n equals 39. In addition, exact p value was evaluated for the statistical significance of observing two cell death related genes among 11 induced genes at the sensitive stage based on hyper geometric probability distributions. DNase I Sensitivity Assay Using the Apollo Genome Annotation a nd Curation Tool sequence s and annotations were inputted covering the 75C1 2 locus (18,060k 18,460k) from the Drosophila melanogaster Genome Annotation 4.0 (http://www.fruitfly.org/). For each selected 1,000 bp interval the sequence was used as input to P rimer3 for designing/selecting a set of primers that are 150 400 bp apart. The specificity of the primer set for quantitative PCR was first verified by dissociation curve as well as checking on agarose gel after electrophoresis. Only primer sets that consi stently

PAGE 46

46 amplified one fragment of the predicated size were used for downstream experiments. The amplified fragments were also sequenced to further verify the accuracy of the selected primer sets. For the simplification of our discussion, the primer sets ar e referred to using the middle three digits. For instance, primer set designed for 18, 363,000 DNase I sensitivity assay was performed based on modification of published methods (Carr and Biggin 2000; Kalmykova et al. 2005) About 50 150ul of staged embryos were washed with distilled water, dechorionated with 3% sodium hypochloride, and washed again to remove traces of bleach. The embryos were then transferred to 10 ml cold Buffer A (15 mM Tris pH 7.4, 60 mM KCl, 15 mM NaCl, 1 mM EDTA, 1 mM EGTA) supplemented with 1% protease inhibitor cocktails (PIC, Sigma, P8340) and pes tle. The homogenate was then centrifuged at 400g for 1 min to remove tissue chunks. The supernatant was transferred to a new tube and centrifuged at 1,100g for 10 min to pellet the cells. The cell pellet was then resuspended with Buffer B (10mM Tris, PH 7. 5, 5mM MgCl 2 10mM NaCl, 25% Glycerol) supplemented with 1% protease inhibitor cocktail (PIC) (2 times the starting volume of embryos). The resuspended cells were aliquoted, snap frozen with dry ice/ethanol bath and kept at 80 O C. For DNase I treatment, ab out 100 ul samples were thawed briefly on ice and resuspend with 1,000ul cold Buffer A supplemented with PIC. NP 40 were added to final concentration of 0.1% and incubated on ice for 5 min. The permeablized cells were pelleted by centrifuge at 1,500g for 8 min at 4 O C. The cell pellet was then resuspended in 1x DNase I buffer (New England Biolab), and aliquoted (200ul) to three tubes each treated with 0U

PAGE 47

47 (control), 5U, and 50U per ml DNase I (New England Biolab), respectively. After 5 min the treatment was stopped by adding EDTA to 25 mM. Cells were then lysed with 45ul 6xSDS lysis buffer (6% SDS, 300 mM Tris HCl, pH 8.0, and 120 mM EDTA) and incubated overnight with 0.5mg/ml protease K. Geomic DNA was then purified with phenol and phenol/chloroform extracti on and resuspended in 10 mM Tris (PH 8.0) and diluted to 5ng or 10ng per ul. Two to three 1ul samples of the treated or control DNA were then analyzed with QPCR. The primer sets for each 1,000bp region of the IRER were designed with the help of Apollo and Primer 3 (Rozen and Skaletsky 2000; Lewis et al. 2002) and verified by dissociation curves, gel electrophoresis, and DNA sequencing. Ct values for each locus were obtained with an ABI 7500Fast Real Time PCR System u sing manufacturer recommended protocol and PCR labeling kits. Chromatin Immuno precipitation (ChIP) Assay ChIP analysis of staged embryos were performed essentially using a protocol provided to us by Ian Birch Machin and Shan Gao (Birch Machin et al. 2005) Dechorionated embryos (200 500ul) were fixed for 15 min in 3.7% formaldehyde in the presence of n haptane. After fixation, embryos were homogenized with a Wheaton Dounce Tissue Grinder (pestle Loose) in cold PBT (0.1% triton in PBS) s upplemented with PIC. Tissue chunks were removed by centrifugation for 1 minute at 400g, after which cells were pelleted by centrifugation for 10 min at 1,100g. The cell pellet was then resuspended in 15ml ice cold Cell Lysis Buffer (5mM PIPES pH 8, 85mM K CL, 0.5% NP40, 1% PIC), and dounced (10X) using a Wheaton 15ml Dounce Tissue Grinder with The homogenate was centrifuged at 2000g for 4min at 4 o C to pellet the nuclei, which was resuspended in Nuclear Lysis Buffer (50mM Tris.HCl pH 8.1,

PAGE 48

48 10mM EDTA.Na 2 1% SDS, 1% PIC) and incubated for 20 min at 4 o C. At the end of the incubation, 0.3g of acid washed glass beads (Sigma, G 1277) were added, and the samples were sonicated on ice using a Branson Sonifer 450 to obtain fragmented DNA with an av erage size of approximately 500bp. For immunoprecipitation, the sheared fixed chromatin samples (~5mg DNA) were diluted (1:5) with IP buffer (1% Triton X 100, 2 mM EDTA, 20 mM Tris HCl, pH 8.0, 150 mM NaCl, 1% PIC) and incubated for 1 hr at 4 o C with 50 ul of equilibrated Protein A beads (Protein A Sepharose CL 4B; Amersham Biosciences). After removing the Protein A beads, the samples were aliquoted and each equal volume aliquot was incubated with appropriate antibody or served as input control. After overn ight incubation, the complex was precipitated by adding Protein A beads. The pelleted beads were resuspended with 500ul TSE I buffer (1% Triton X 100, 0.1% SDS, 2 mM EDTA, 200 mM Tris HCl, pH 8.0 and 150 mM NaCl) and transferred to the basket of a Spin X c olumn. Using the column, the beads were washed again with 500 ul TSE I buffer and twice with 500ul TSE II buffer (1% Triton X 100, 0.1% SDS, 2 mM EDTA, 200 mM Tris HCl, pH 8.0 and 500mM NaCl). Then the beads were washed twice with Wash Buffer III (0.25M Li Cl, 1% NP 40, 1% sodium deoxycholate, 1 mM EDTA and 10 mM Tris HCl, pH 8.0) and twice with TE. The DNA samples were eluted with freshly prepared elution buffer (1% SDS and 0.1 M NaHCO 3 ) and incubated for 6 h at 65 C to reverse formaldehyde cross links. DNA was then purified using the Qiagene PCR purification kit. Two to three 1ul samples of each elute (including the parallel processed input control sample) were subjected to QPCR quantification.

PAGE 49

49 Histology The Procedures for TUNEL, in situ hybridization (ISH ), and immunocytochemistry (ICC) were performed as described (Zhou and Steller 2003) For distinguishing homozygous mutant embryos, embryos colle cted from Df(3L18,365 399)/TM3Ubi GFP were first subjected to ICC with anti GFP (Santa Cruz, 1:2000) and then subjected to ISH or TUNEL procedures. Results Sensitivity to Ray Induced Apoptosis Is Developmental Stage Dependent During the 20 hrs of embryo genesis, the sensitivity of fly embryos to irradiation changes dramatically between 7 9 hr after egg laying (AEL). When measured by embryonic lethality, embryos before 7 hr AEL (developmental stage 1 11) (Campos Ortega and Hartenstein 198 5) are extremely sensitive to irradiation (Figure 2 1A), while embryos after 9hr AEL (developmental stage 12) become highly resistant. This dramatic change of sensitivity to irradiation was first noticed decades ago (Wurgler and Ullrich 1976; Ashburner 1989) but the underlying cellular and molecular mechanisms remain unclear. This shift of sensitivity to irradiation at the organismic level coincides with changes of sensitivity at the cel lular level. Irradiation induced cell death, as measured by TUNEL, appears about 45 60 mins post irradiation and reaches the peak at about 75 90 mins. The most dramatic induction of TUNEL positive cell ray was observed in stage 10 11 embryos (Figure 2 1 C vs. B). In sharp contrast, there is little increase of TUNEL positive cells in germ band retracted embryos post developmental stage 12 (Figure 2 1 E vs. D). For the clarity of the discussi on, we will refer to embryos before or

PAGE 50

50 at stage 11 as sensitive (stage) embryos, and those after stage 12 as resistant (stage) embryos. To gain a comprehensive picture of genomic responses to ray irradiation, we used the Affymetrix DrosGenome1 GeneCh ips to measure the immediate transcriptional response elicited by ray. For both sensitive and resistance stage embryos, total RNA was extracted 15 mins after irradiation from treated and parallel processed control samples. Among the 11 genes induced sign ificantly in the sensitive stage, two are known cell death regulatory genes, reaper and hid (Figure 2 1G). The probability of observing two or more known pro apoptotic genes in 11 randomly selected genes from the genome is calculated as 2 x 10 4 indicatin g that cell death genes are selectively activated following ray treatment in sensitive embryos. In contrast, none of the two genes, or any other pro apoptotic gene, was significantly induced by ray in resistant embryos (Table 2 1). The specific induct ion of reaper and hid by ray in sensitive but not resistant embryos was verified by both Northern hybridization (Figure 1H) and quantitative PCR (QPCR) (Figure 2 1I). The QPCR result indicates that, in sensitive embryos, both reaper and hid are induced r apidly (within 20 mins), and reach a peak at about 40 60 min after irradiation. In contrast, neither can be significantly induced in resistant stage embryos at any time points (up to 2 hrs). Interestingly, a similar responsive pattern was observed for anot her IAP antagonist sickle which is upstream of reaper (Figure 2 2A). The other IAP antagonist, grim showed no radiation induction in either sensitive or resistant stage.

PAGE 51

51 Irradiation induced cell death is largely blocked in the H99 deficiency mutant that lacks reaper hid, and grim (White et al. 1994) The selective and rapid induction of reaper and hid post irradiation indicates that the two genes are responsible for mediating irradiation induced cell death in sensitive stage embryos. Their c oordinated induction is likely essential for the rapid induction of apoptosis, as has been demonstrated before (Zhou et al. 1997) The IAP antagonists sickle is not deleted in the H99 mutant; however it is also induced upon ionizing irradiation (Christich et al. 2002; Brodsky et al. 2004) In this study, we focus on the immediate induction of reaper and hid in sensitive embryos and the sensitive to resistant transition of the responsiveness of these two genes. Rapid Sensitive to Resistant Trans ition of Pro Apoptotic Gene Responsiveness d uring Developmental Stage 12 To pinpoint the timing of the sensitive to resistant transition during development, pooled embryos (0 16 hr AEL) were treated with 20Gy ray and then monitored for expression of pro apoptotic genes at 20 30 mins following irradiation. The pooled embryos were collected overnight, irradiated on the same plate, fixed together, and processed for in situ hybridization in the same tube. Our data indicated that both reaper and hid can be ind uced by ray in embryos developed beyond developmental stage 6, when the gastrulation begins. The responsiveness of the two pro apoptotic genes peaks at stage 10 and remains responsive at developmental stage 11 (Figures 2 2 D vs. A; E vs. B; F vs. C). How ever, once the germ band starts to retract at early stage 12, the responsiveness begins to diminish rapidly (Figures 2 2 G L). By the time most of the germ band has retracted to the ventral side (late stage 12), the responsiveness of both genes is totally lost (Figures 2 2 K vs. H; L vs. I; Figure 2 3 ). The contrast of reaper or

PAGE 52

52 hid in situ hybridization (ISH) signals in sensitive versus resistant embryos following irradiation is most apparent when viewed under low magnification (Figure 2 3 ). Increasing the ray dosage up to 120 Gy failed to induce any detectable increase of reaper and hid expression at 30 mins post irradiation (data not shown). The rapid sensitive to resistant transition was also verified independently with QPCR (Figure 2 2M). It is clear that compared to embryos at stage 9 11 (4 7 hr AEL), there is little induction of reaper or hid at stage 12 or 13. The change of radiation responsiveness of pro apoptotic genes is unlikely due to reduced amount of DNA damage or a suppressed cellular signal ing response in resistant stage embryos. Two DNA repair genes, ku70 and ku80 were also significantly induced by irradiation in sensitive stage embryos through a DmP53 dependent mechanism (Brodsky et al. 2004) However, in sharp contrast to the pro apoptotic genes, not only did the two genes remain responsive to irradiation at resistant stage, but their inducti on levels were significantly higher in the resistant stage than in the sensitive stage (Figure 2 4 ). This suggests that the loss of responsiveness is specific to the pro apoptotic genes. Mapping the Genomic Region Responsible for Mediating Ray Responsive ness To map the genomic region responsible for mediating the ray responsiveness of reaper and hid we took advantage of the insertional mutants generated by Exelixis (Thibault et al. 2004) These insertion lines w ere generated in an isogenic background with transposon vectors containing the Su(Hw) insulator sequences. If the insertion is located between the promoter and the enhancer region mediating ray responsiveness, it could interrupt the responsiveness of the pro apoptotic genes. In addition, these

PAGE 53

53 transposon s have FRT sequences that can be used for making well defined genomic deletions (Parks et al. 2004) Both reaper and hid reside in the 75C1 2 region, together wit h the other two IAP antagonists grim and sickle The organization of the genomic region harboring the fo ur genes is depicted in Figure 2 5A Interestingly, all four pro apoptotic genes are transcribed in the same direction. Remarkably long gene less region s surround the reaper locus: from grim to reaper is approximately 93 kb and from reaper to sickle is about 40 kb. In contrast, left of hid and right of sickle are gene dense regions (more than five genes in 50 60 kb). When compared to homologous regions in D.Pseudoobscura ( D.pseu ) and D.virilis ( D.viri ), the intergenic genomic region is better conserved than the transcribed and coding region of reaper a t the nucleotide level (Figure 2 5B ). The two species diverged from D.mela 40 and 60 MY ago, respectively. The exceptional conservation of non transcribed sequences around reaper suggests that vital regulatory functions may reside in these regions. From the Exelixis collections, we obtained a total of 45 strains that were recorded as having a single insertion in the 75C1 2 region. Their insertion sites were verified by inverse PCR (Table 2 2 ). Analysis of these strains indicated that a 20kb region between 3L : 18,366,171 and 18,386,107 is required for the ray responsiveness of reaper Three insertions (R1, R2, and R3) between this region and the reaper promoter all blocked the ray responsiveness of reaper (Figures 2 5 C E) In contrast, the insertions (R4, R5, and R6) after this region did not block the ray responsiveness (Figures 2 5 F and G). Significant ray responsiveness of reaper transcription was clearly visible in homozygous R4 and R5 embryos, indicating that the essential ray responsible region

PAGE 54

54 for reaper transcriptional regulation is located between R3(18,366,171) and R4(18,386,107). However, th ere may be additional enhancer element(s) in the DNA region between R5(18,387,288) and R6(18,398,861), as the ray responsiveness of reaper is conceivably stronger in homozygous R6 embryos than that in R5 and R4. In terms of reaper transcriptional respons e to irradiation, there is no detectable difference between R6 and wild type embryos, indicating all essential elements are on the left side of R6. We then generated deletions that removed the interval 3L:18,365,736 18,398,898 between R2 and R6 (referre d to as Df(3L:18,366 398)), the interval 3L:18,365,736 18,386,300 between R2 and R4 (Df(3L:18,366 386)), and the interval 3L: 18,386,300 18,398,898 between R4 and R6 (Df(3L:18,386 398)). For each deficiency, 5 10 independent deletion strains were obtaine d. The span of the deletion was verified by PCR using primers flanking the deletion, and the breaking point was verified by sequencing the PCR product. None of these deficiencies removed the transcribed region of reaper or sickle The left breaking points for the deficiencies are more than 2 kb away from the reaper transcription starting site. In embryos homozygous for either Df(3L:18,366 386) or Df(3L:18,366 398) (identified with a GFP balancer), the responsiveness of reaper to ray irradiatio n was totally abolished (Figure 2 6 A H), indicating that essential enhancer elements are located in the Df(3L:18,366 386) interval. Homozygous Df(3L:18,386 398) showed a significantly decreased level of reaper responsiveness (Figure 2 6 C and G), which reconfirms that the region between R4 and R6 has non essential enhancer(s). These results are in perfect agreement with our insertion mapping data described above. The

PAGE 55

55 insulators in the original insertions were removed during the deletion gen eration process so there is no Su(Hw) insulator in Df(3L:18,366 386) or Df(3L:18,366 398). There is one remaining insulator left in Df(3L:18,386 398), but that should not affect the conclusion of the results. Thus both approaches unequivocally indicated t hat the enhancer region responsible for mediating reaper irradiation responsiveness resides in the interval between R2 and R6, i.e. 3L : 18,365,736 18,398,861. We named this region I rradiation R esponsive E nhancer R egion (IRER). The previously identified p utative P53RE (18,368,516) is within this region and close to the left boundary. Since over expression of P53 alone was not sufficient to induce reaper expression in the embryo, it is very likely that other enhancer element(s) in this region is(are) also r equired for mediating irradiation induced reaper expression. In addition, our data indicate that there is(are) non essential enhancer element(s) in the region between R5 and R6. To facilitate the discussion, we will refer to the region between R2 and R6 as IRER, and the deletion of this region as Df(IRER). Correspondingly, we will refer to the genomic region between R2 and R4 as IRER_left, and the region between R5 and R6 as IRER_right. For the responsiveness of reaper IRER_left is essential, and IRER_righ t is supplemental. An unexpected result from the deletion analysis is that the responsiveness of hid ray irradiation was also significantly reduced in the Df(IRER_left) mutant and abolished i n the Df(IRER) mutant (Figure 2 6 I P). This is surprising since the insulator ray induced hid expression (data not shown). It indicates that there may exist a high order arrangement which enables the IRER to interact with the hid promoter. The essent ial region

PAGE 56

56 mediating this interaction most likely resides in the interval between R4 and R6 (IRER_right). In homozygous Df(IRER_right), hid responsiveness is lost even though reaper is still responsive (albeit reduced). To rule out the possibility of unint ended damage to the hid locus in the process of the FLP/FRT mediated deletion, we performed complementation tests between Df(IRER) and hid mutant alleles, including [05014], [A206], and [8d]. All of the hid mutant alleles are homozygous lethal and homozygo us Df(IRER) has greatly reduced viability. Invariably, the lethality of the hid alleles was complemented by the Df(IRER) chromosome, indicting the developmental function of hid is intact in the Df(IRER) mutant. In addition, we tested hid responsiveness in the X38 deletion mutant, which removes the reaper transcription unit and all of the IRER region (Peterson et al. 2002) In both X38/X38 and Df(IRER)/X38, the responsiveness of hid is abolished, indicating that indeed hid responsiveness to irradiation is mediated by IRER. Formation of DNaseI Resistant Structure in the IRER But Not the Prom oter and Transcribed Region of reaper in Post Stage 12 Embryos Like its mammalian ortholog, DmP53 is required for mediating irradiation and DNA damage induced cellular responses including apoptosis and/or DNA repair. However, the sensitive to resistant tr ansition we observed for the induction of pro apoptotic genes is unlikely due to the unavailability of DmP53 since it is ubiquitously expressed in the embryo at both sensitive and resistant stages (Jin et al. 2000) (Figure 2 4B ). DmP53 mediated induction of DNA repair genes ku70 and ku80 is not diminished, and actually incressed, after the transition observed for the pro apoptotic genes (Figure 2 4 A). We tried over expressing DmP53 using UAS DmP53 but it fa iled to convey any detectable radiation sensitivity in resistant stage embryos (data not

PAGE 57

57 shown). Previous studies using reporter constructs containing part of the IRER_left have found that the reporter remained responsive to x ray till the end of embryogen esis (Qi et al. 2004) All of these evidences suggest that the transition is not due to unavailability or lack of activatio n of DmP53, rather they point to epigenetic regulation of the IRER that controls its accessibility. A DNase I sensitivity assay was performed to scan the DNA accessibility around IRER. A primer set was designed and verified for a selected 1,000 bp interva l, e.g. 18,363,000 2 3 ). Unl ess otherwise Ct(0U). For constitutively active genes such as the act5c 5 in resistant stage embryos. In contrast, heterochromatin areas such as the H23 (22,000 to 24,000 of chr2 heterochromatin) locus are refractory to the DNase I treatment, with the 2 7A and Figure 2 8 ). In resistant stage embryos, the reaper transcribed region and proximal promoter and enhancer regio ns (363 365) remain as sensitive to DNase I as the constitutively active actin5c locus. In sharp contrast, most of the IRER region is almost as inaccessible as the heterochromatin locus (H23). The only region in IRER that remains relatively open at the res istant stage is 18,386 387, which is probably the shared enhancer/promoter region of two putative non coding RNAs that are transcribed in opposite directions (represented by EST sequences RE73107 (3L : 18,383 379) and RE07245 (3L: 18,388 392), respectively) It is also where R4 and R5 insertions are located. This is unlikely just a coincidence, rather we believe the relative openness of this region allowed R4 and R5 to be recovered from the mutagenesis.

PAGE 58

58 To monitor the dynamics of the accessibility of IRER, we performed the DNase I sensitivity assay in staged embryos that were 3.5 5 hr, 5.5 7.0 hr, 9 10 hr, 10 1 3 hr, and 14 17 hr AEL (Figure 2 7 B). A significant decrease of DNase I sensitivity was found in IRER between 7 and 9 hr AEL, consistent with the sen sitive to resistant transition observed for irradiation induced reaper / hid expression and cell death. act5c locus, it was apparent that the reaper transcribed region and imm ediate promoter and enhancer region (primer set 363, 365, respectively) remained as open as the act5c locus throughout embryogenesis. However, the IRER region (detected with primer sets 368, 370, 372, 377, 382) underwent a dramatic shift of accessibility b etween the 7 hr and the 9 hr AEL (Figure 2 7 B). Within the IRER, it seems that the center of the IRER_left, represented by probe sets 371 382, becomes inaccessible first. While the left boundary of IRER, represented by probe sets 368 370, becomes inaccessi ble to DNase I at relatively later stages. The control H23 heterochromatic region also changes dramatically in DNase I sensitivity between sensitive and resistant stages, which is consistent with the timing of heterochromatin formation in Drosophila embryo genesis (Lu et al. 1998) Histone Modifications in the IRER Region The formation of heterochromatin like structure is associated with post translational modification of histones (Jenuwein and Allis 2001) To monitor histone modification in and around IRER, Chromatin Immuno Precipitation (ChIP) experiments were performed in parallel with sensitive and re sistant stage embryos (Figure 2 9 B and C) using antibodies against trimethylated H3K9 and H3K27 (Gift from T. Jenuwein). As shown in Figure 2 9 B, w e observed a dramatic increase of H3K27 trimethylation in the

PAGE 59

59 IRER at the resistant stage. For the region 18,366 368, the recovery rates of resistant embryos are over 100 fold higher than those of sensitive embryos. As expected, the level of H3K27Me3 in the positive control Ultrabithorax ( Ubx ) promoter region also increased at the resistant stage. However, the magnitude of the increase in the Ub x promoter is much smaller than that observed for 18,366 368, probably reflecting the fact that the Ubx promoter remains ope n in the posterior segments while the blocking of IRER is for the whole embryo. There is also a significant increase of H3K9 trimethylation throughout the IRER (Figu re 2 9 C), especially in the center of IRER_left (18,371 382), which corresponds to the reg ion that has the strongest resistance to DNase I (Figure 2 7 ). It is interesting to note that, in comparison, the highest level of H3K27 trimethylation is at the left boundary of IRER (18,366 368). To test whether trimethylated H3K9 is indeed associated wi th the formation of heterochromatic structure in IRER, the antibody against Heterochromatin Protein 1 (HP1) was used for ChIP assay. The distribution profile of HP1 in the tested region is quite similar with that of trimethylated H3K9 (Figure 2 9 E), furthe r indicating that the IRER indeed undergoes the transition from a relatively open structure to a heterochromatin like structure. Just as trimethylated H3K9 is often bound by HP1, trimethylated H3K27 is associated with the Polycomb Repressive Complex 1 (PR C1), including Polycomb (Pc) and Posterior Sex Combs (Psc). The Bithoraxoid Polycomb Response Element (BXD PRE) region, known to be bound by PRC1, was used as the positive control. Significant increase of specific Pc and Psc binding to the IRER was detecte d in the resistant embryos (Figure 2 9 D and F), suggesting that PcG mediated silencing is involved in

PAGE 60

60 blocking the IRER. However, instead of specifically binding to a localized PRE, we found that the binding of Pc and Psc is widespread in all of the teste d loci in IRER. Several other types of histone modification, including di and tri methylation of H3K4, di methylation of H3K9 and H3K27, acetylation of H3K9, and phosphorylation of H3S10 were investigated in the same region as well (data not shown). Of those, only a moderate decrease (30 50%) of H3 acetylation was observed in resistant stage embryos compared t o sensitive stage ones (Figure 2 9 G). This may also contribute to the structural transition since acetylated H3 is considered as one of the euchrom atic marks (Jenuwein and Allis, 2001). However, the magnitude of change is not comparable to that observed for trimethylated H3K27 and H3K9. To determine the timing of histone modifications, we performed ChIP analysis in embryos between 7 9 hr AEL (late st 2 9 H and I). Compared to sensitive stage, both H3K27 and H3K9 trimethylation profiles changed Thus, it is impossible to distinguish which of the two modifications happens first. It is quite possible that the two distinct modifications happen s in parallel. Interestingly, the enrichment of trimethylated H3K27 at region 366 during middle stage is already as high as that at the resistant stage, while at ot her sites in IRER there is an increase of H3K27 trimethylation between the middle stage and the late resistant stage. This suggests that this modification may be initiated from the left boundary of IRER. Another difference between H3K9 and H3K27 trimethyla tion is that there is a relatively low level, but significant increase, of H3K27 trimethylation in the reaper promoter and immediate enhancer region (363 & 365), whereas the H3K9 trimethylation is much more limited to the core of IRER.

PAGE 61

61 Histone Modifiers Ar e Required for the Sensitive to Resistant Transition Trimethylation of H3K27 is carried out by the Polycomb Repressive Complex 2 (PRC2), which contains three core components, Suppressor of zeste 12 (Su(z)12), Extra sexcombs (ESC), and Enhancer of zeste (E (z)). Trimethylation of H3K9 is catalyzed by the histone methyltransferase Su(var)3 9. The histone deacetylase (Hdac1/rpd3) is involved in and required for both modifications. In searching for the key chromatin modifiers responsible for putting the inhibit ory markers in IRER, we examined the ray responsiveness in embryos mutated for genes involved in chromatin modulation. The list of the genes/alleles tested is presented in Table 2 4 In summary, we found that a significant delay of the sensitive to resis tant transition was observed in embryos mutated for Hdac1, Su(var)3 9, Su(z)12, and Pc. The timing of the transition is monitored via in situ hybridization for reaper and hid respectively, in irradiated embryos. There is a remarkable synchronicity between the responsiveness of reaper and hid in all of the tested mutants (Table 2 4 ), which strongly indicates that the same mechanism controls the responsiveness of both genes. In wild type embryos the sensitivity of reaper and hid to ray is diminished once the germ band begins to retract (early or middle stage 12). In all of the Hdac, Su(var)3 9, Su(z)12, and Pc mutants, the responsiveness remained during the germ band shortening process and in some mutant alleles, after the germ band has fully retracted to the ventral side (stage 13 14) (Figure 2 10 A F). There is a noticeable increase of base level reaper (and hid ) expression in untreated Hdac mutant embryos (Figure 2 10 C vs A), which probably reflects the general loss of suppression in these mutants. How ever, there is no increase of base level reaper ( hid ) expression in the Su(z)12

PAGE 62

62 mutants which nonetheless showed similar delay of the sensitive to resistant transition. All of these alleles were originally identified as dominant modifiers. For instance, th e Hdac alleles were identified as dominant suppressors of position effect variegation observed for In(1)w m4 (Mottus et al. 2000) For mos t of the alleles tested, we noticed that the delay of transition was perceivable even in heterozygous embryos although it was much more profound with homozygous mutants (distinguished with GFP balancer). When pooled embryos laid by heterozygous parents wer e tested for DNase I sensitivity, there is a detectable difference in the center of IRER_left (18,371 382) between the mutant strains and the wild type strain at 10 13 hr AEL (stage 12 13) (Figure 2 11 ). Although the function of Su(z)12 and Pc is required for turning off the sensitivity, we were not able to observe similar delay in mutant alleles of E(z) or Psc. This may due to the rescuing effect of the maternal deposit of E(z), which has been shown to have a longer lasting effect than that of Pc (or Su(z )12). However, there is also little delay of transition in mutant eggs laid by homozygous E(z)S2e or transheterozygous S2e/S4e mutant female at the restrictive temperature (29 o C) (Table 2 4 ). This discrepancy needs to be clarified in future studies and see ms to indicate that the blocking of IRER, although involving trimethylation of H3K27 and requiring the function of some PcG proteins, is distinct from the canonic silencing mechanism observed for PRE mediated silencing. Furthermore, we did not observe any significant precociousness or delay of the sensitive to resistant transition in trithorax group mutants (Table 2 4). In all of the mutants tested, eventually the sensitivity is lost after about 13 hr AEL, indicating that these mutants delayed but did not block the sensitive to resistant (open to closed chromatin) transition. The timing of transition varied among the mutant alleles,

PAGE 63

63 however, by developmental stage 15 (about 13 14 hr AEL), none of the mutants was responsive to irradiation as measured by reap er or hid ISH. Since the P53RE reporter construct remained responsive to irradiation till the end of embryogenesis (18 20hr AEL) (Qi et al. 2004) the loss of responsiveness in these mutants is unlikely due to the absence of trans factor(s). Our DNase I sensitivity data also indicate that although there is a delay, eventually IRER in the mutants becomes as inaccessible as in wi ld type embryos. The blocking of IRER in embryos mutated for the key epigenetic regulators (Hdac1, Su(var)3 9, Su(z)12, and Pc) may be mediated by other proteins that have overlapping function with the four genes. In addition, given the fact that trimethyl ation of H3K27 and H3K9 were initiated at about the same time, it is possible that they represent redundant mechanisms in blocking IRER. Discussion The irradiation responsiveness appears to be a highly conserved feature of reaper like IAP antagonists. A re cently identified functional ortholog of reaper in mosquito genomes, michelob_x ( mx ), was also responsive to irradiation (Zhou et al. 2005) These evidences highlighted that stress responsiveness is an essential aspect of functional regulation of upstream pro apoptotic genes such as reaper / hid It is also worth mentioning that several mammalian BH3 domain o nly proteins, the upstream pro apoptotic regulators of the Bcl 2/Ced 9 pathway, are also regulated at the transcriptional level. In this study we showed that the irradiation responsiveness of reaper and hid is subject to epigenetic regulation during develo pment. The epigenetic regulation of the IRER is fundamentally different from the silencing of homeotic genes in that the change of DNA accessibility is limited to the enhancer region while the promoter of the pro

PAGE 64

64 apoptotic genes remains open. Thus, it seem s more appropriate to refer this as the This region, containing the putative P53RE and other essential enhancer elements, is required for mediating irradiation responsiveness. Our Ch IP analysis indicates that histones in this enhancer region are quickly trimethylated at both H3K9 and H3K27 at the sensitive to resistant transition period, accompanied by a significant decrease in DNA accessibility. DNA accessibility in the putative P53R E locus (18,368k), when measured by the DNase I sensitivity assay, did not show significant decrease until sometime after the transition period. It is possible that other enhancer elements, in the core of IRER_left, are also required for radiation responsi veness. An alternative explanation is that the strong and rapid trimethylation of H3K27 and association of PRC1 at 18,366 368 are sufficient to disrupt DmP53 binding and/or interaction with the Pol II complex even though the region remains relatively sensi tive to DNase I. Eventually, the whole IRER is closed with the exception of an open island around 18,387. The finding that epigenetic regulation of the enhancer region of pro apoptotic gene controls sensitivity to irradiation induced cell death may have implications in clinical applications involving ionizing irradiation. It suggests that applying drugs that modulate epigenetic silencing may help increase the efficacy of radiation therapy. It also remains to be seen as to whether the hyper sensitivity of some tumors to irradiation is due to the de differentiation and reversal of epigenetic blocking in cancer cells. On the other hand, loss of proper stress response to cellular damage is implicated in tumorigenesis (Baylin and Ohm 200 6) The fact that the formation of heterochromatin in the sensitizing enhancer region of pro apoptotic genes is sufficient to convey resistance to stress

PAGE 65

65 induced cell death suggests it could contribute to tumorigenesis. In addition, it could also be the u nderlying mechanism of tumor cells evading irradiation induced cell death. This is a likely scenario given that it has been well documented that oncogenes such as Rb and PML RAR fusion protein cause the formation of heterochromatin through recruiting a hum an ortholog of Su(v)3 9. In this regard, the reaper locus, especially the IRER, provides an excellent genetic model system for understanding the cis and trans acting mechanisms controlling the formation of heterochromatin associated with cellular different iation and tumorigenesis. Differentiation Stage Specific Sensitivity to Irradiation Induced Cell Death The developmental consequence of epigenetic regulation of the IRER is the tuning down (off) of the responsiveness of the pro apoptotic genes, and thus d ecreasing cellular sensitivity to stresses such as DNA damage (Figure 2 10 G). Epigenetic blocking of the IRER corresponds to the end of major mitotic waves when most cells begin to differentiate. Similar transitions were noticed in mammalian systems. For i nstance, proliferating neural precursor cells are extremely sensitive to irradiation induced cell death while differentiating/differentiated neurons become resistant to ray irradiation, even though the same level of DNA damage was inflicted by the irradi ation (Nowak et al. 2006) Our findings here suggest that such a dramatic transition of radiation sensitivity could be achieved by epigenetic blocking of sen sitizing enhancers. Later in Drosophila development, around the time of pupae formation, the organism becomes sensitive to irradiation again, with LD50 values similar to what was observed for the 4 7 hr AEL embryos (Ashburner 1989 ) Interestingly, it has also been found that during this period, the highly proliferative imaginal discs are sensitive to

PAGE 66

66 irradiation induced apoptosis, which is mediated by the induction of reaper and hid through P53 and Chk2 (Brodsky et al. 2004) However, it remains to be studied as whether the reemergence of sensitive tissue is due to the reversal of the epigenetic blocking in IRER or the proliferation of undifferentiated stem cells that have an unblocked IRER. Silencing by a Non Canonic Mechanism? The blocking of IRER differs fundamentally from the silencing of homeotic genes in several aspects. First, t he change of DNA accessibility and histone modification is largely limited to the enhancer region. The promoter regions of reaper (and hid ) remain open, allowing the gene to be responsive to other stimuli. Indeed, there are a few cells in the central nervo us system that could be detected as expressing reaper long after the sensitive to resistant transition. Even more cells in the late stage embryo can be found having hid expression. Yet, the irradiation responsiveness of the two genes is completely suppress ed in most if not all cells, transforming the tissues into radiation resistant state. Secondly, the histone modification of IRER has a mixture of features associated with pericentromeric heterochromatin formation and the canonic PcG mediated silencing. B oth H3K9 and H3K27 are trimethylated in IRER. Both HP1, the signature binding protein of the pericentromeric heterochromatin, and the PRC1 are bound to IRER. As demonstrated by genetic analysis, the function of both Su(var)3 9 and Su(z) 12/Pc ar e required for the silencing. Preliminary attempts to verify specific binding of PRC2 proteins to this region was unsuccessful. The fact that none of the mutants tested could completely block the transition seems to suggest that there is a redundancy of the two pathw a ys in modifying/blocking IRER. It is also possible that the genes we tested

PAGE 67

67 are not the key regulator of IRER blocking but only have participatory role in the process. Finally, within the IRER, there is a small region around 18,387 (18,386k 388k) that r emains relatively open till th e end of embryogenesis (Figure 2 7 A). Interestingly, this open region is flanked by two putative non coding RNA transcripts represented by EST sequences. If they are indeed transcribed in the embryo as suggested by the mRNA so their shared enhancer/promoter region. Sequences of both cDNAs revealed that there is no intron or reputable open rea ding frame in either sequence. Despite repeated effo rts, we were not able to confirm their expression via ISH or Northern. Over expression of either cDNA using an expression construct also failed to show any effect on reaper/hid induced cell death in S2 cells. Yet, sections of the two non coding RNAs are st rongly conserved in divergent Drosophil a genomes. The potential role of these two non coding RNAs in mediating reaper/hid expression and/or blocking of the IRER remains to be studied.

PAGE 68

68 Figure 2 1 Stage specific sensitivity to ray induced cell death A ) Embryonic lethality induced by ray is dependent on developmental stage. Embryos collected 0 3 hr AEL (developmental stages 0 6), 4 7 hr AEL (stages 9 11), 9 12 hr AEL (stage 13 16), 14 17 hr AEL (stages 16 17) were irradiated with various dosages of irradiation. Each data point represents the average of two to three treatments. Each time an average of 595 eggs were treated. To count for unfertilized eggs, controls were processed in parallel without ray treatment. Embryos that failed to hatch after a 30 hr incubation at 25 C were counted as lethal. B E) TUNEL labeling of embryos at 75 mins post 40 Gy of irradiation ( C, E) or control treatment ( B, D). B) and C) are stage 10/11 embryos, D) and E) are stage 16 17 embryos. F) Venn diagram depicting the overlap of detectable genes in sensitive and resistant stage embryos u sing the pan genome DNA array. G) Venn diagram indicating no overlap between ray inducible genes detected in sensitive (4 7 hr AEL) and resistant (9 12 hr AEL) embryos. H) Northern hy bridization analysis confirms the ray responsiveness of the three cell death genes: reaper hid, and corp (companion of reaper) and actin was used as a non responsive control. I) hid (red square), reaper (green triangle), sickle (yellow diamond) and g rim (blue cross) RNA levels (measured by QPCR) in sensitive (continuous lines) and resistant (dashed line) embryos at 20, 40, 60, 90, and 120 mins following ray treatment. Data were represented as the fold changes comparing ray treated with parallel pr ocessed control samples (mean + Std).

PAGE 69

69 Figure 2 2 Rapid transition of reaper sensitivity to irradiation between 8 9 hr AEL. Pooled embryos (0 ray or served as non treatment control. Significant increase of reaper mRNA was observed in stage 7 11 embryos (A F), with the peak of responsiveness observed in stage 10 embryos (E vs. B). This responsivene ss is dramatically decreased once the germ band starts to retract, which happens around 7.5 hr AEL (J vs G). By the time the germ band is half way retracted on the dorsal side, the responsiveness of reaper is almost completely diminished (K vs H). None o f the embryos at the end of stage 12 (8.5 9 hr AEL) or stage 13 has detectable reaper responsiveness (L vs I). A very similar transition is also observed for hid responsiveness (Figure 2 3 ). The sensitive to resistant transition was also verified with QPC R (M).

PAGE 70

70 Figure 2 3. Embryos viewed at lower magnifications show the contrast of reaper and hid responsiveness in embryos at different developmental stages (St). Irradiation induced significant expression of reaper and hid in germ band extended embryos (St 9 11). In contrast, there is no detectable increase of reaper and hid expression in dorsal germ band retracting (St 12) or dorsal germ band retracted embryos (St 13 16). Embryos on the same slide were collected and treated together and were processed f or ISH in the same tube.

PAGE 71

71 Figure 2 4. Comparable DNA damage induced cellular response and DmP53 expression at both sensitive and resistant stages. A) Two DNA repair genes, ku70 and ku80 are induced upon irradiation at both sensitive and resistant stages RNA level was measured at 120min after ray treatment by QPCR. The induction fold was indicated by the ratio of IR treated samples and non treated controls. Housekeeping gene rp49 was used as the non responsive control control. Higher induction of DNA r epair genes may account for the post irradiation survival at resistant stage. B) Ubiquitous expression of Drosophila p53 in both sensitive and resistant stages. RNA level was represented by semi quantitative PCR. rp49 was used as the endogenous control.

PAGE 72

72 Figure 2 5 Mapping of the i rradiation responsive region. A) Organization of the 75C1 2 region that harbors four IAP antagonist genes (red arrows). Other annotated genes in this region were marked with blue arrows. The region underlined by the red line i s represented in B). B) Conservation of the intergenic region around the reaper locus. Figure drawn with Vista (Mayor et al. 2000) the curve indicating the percent of identity (wi ndow size 100bp). The region is colored if the identity is higher than 75%. Color code: pink untranscribed or intronic region; light blue untranslated transcribed regio n; dark blue coding region. C) The Exelixis insertions localized between reaper an d sickle R1(P d11052), R2 (P d00909), R3 (PBac f02826), R4(PBac f03056), R5(PBac f07603), and R6(PBac f03389). Induction of reaper ray irradiation was totally blocked by R1, R2, or R3 but is only slightly attenuated by R4 and R5 and is not at all affected by R6. no response. For insertion site in formation, refer to Table 2 2 D ) and E) reaper ISH of control and irradiated homozyg ous R3 embryos, respectively. F ) and G) reaper ISH of control and irr adiated homozygous R6 embryos, respectively.

PAGE 73

73 Figure 2 6 IRER is required for the responsiveness of reaper and hid Df(IRER_left) abolished the responsiveness of reaper to irradiation (B, F). hid responsiveness to ray was also significantly reduced (J, N). Df(IRER_right) reduced reaper responsiveness (C, G vs A, E) but blocked hid responsiveness (K,O). Df(IRER) blocked the responsiveness of both reaper and hid (D, H, L, P). In P, the dark embryo is a heterozygous (Df(IRER)/TM3ubi GFP) embryo that is also stained for GFP.

PAGE 74

74 Figure 2 7 Formation of closed heterochromatin structure in the Irradiation Resp onsive Enhancer Region (IRER). A) DNase I sensitivity assay of the IRER in resistant stage embryos. In resistant embryo, most of the IRER is as res istant to DNase I as the pericentromeric heterochromatin locus H23. The only exception is a relatively open island around 18,387, flanked by two putative non codin g RNAs (open arrows). B) Change of DNase I sensitivity in the IRER in staged embryos. There i s a dramatic transition of DNase I sensitivity around 18,368 382 between the 7 hr and the 9 hr AEL. Data were The 6.420 + 0.424 (3.5 5hr), 7.278 + 0.797 (5.5 7hr), 5.043 + 0.34 (9 10hr), 4.460 + 0.339 (10 13hr), 4.988 + 0.256 (17 20hr). Data r epresented as mean + std; n=3 or 4 for all age groups.

PAGE 75

75 Figure 2 8. Examples of QPCR measurements of DNase I sensitivity. Permeablized nuclei were treated with 0 or 50U of DNase I for 5 min. The Genomic DNA was then extracted. 5ng of genomic DNA were su bjected to QPCR analysis for each locus. In open locus (Act5C) there is a significant difference (delta Ct>4) between the treated and untreated samples, indicating over 90% (1 2 delta Ct ) of the DNA in the tested locus has been digested by DNase I. In con trast, in the heterochromatin region (H23), there is little difference between the treated and untreated samples, indicating this locus is un accessible to DNase I.

PAGE 76

76 Figure 2 9 Ch romatin modification of IRER. A) Schematic representation of the IRER loc us, including IRER_left (red bar) and IRER_right (orange). The positions of DNA amplicons for quantification of ChIP results are shown below the IRER map relative to the DNA sequence coordinates of chromoso me 3L (Dm genome release 4.3). B G) ChIP assays pe rformed on embryos at sensitive stage (red) and resistant stage (blue) using anti H3K27Me3 (B), anti H3K9Me3 (C), anti Pc (D), anti HP1 (E), anti Psc (F), and anti Ac H3 (G). Precipitation of DNA fragments with antibodies was quantified by QPCR and shown i n recovery rates. The coding region of Act5C was used as background control for all the antibodies. For positive controls, Ubx promoter region was chosen for anti H3K27Me3; H23 for anti H3K9Me3, anti HP1 and anti Ac H3; and the BXD PRE for anti Pc and anti Psc. Several independent assays were performed for each antibody and a rep resentative figure was shown. H ) and I) Timing of H3K27 and H3K9 trimethylation, respectively. ChIP results from embryos at sensitive stage (3 7 hr AEL, red), middle stage (7 9 hr A EL, yellow) and resistant stage (13 16 hr AEL, blue) were normalized to the recovery rate of the positive controls in the resistant stage. Three independent assays were performed for each stage and the values are shown as mean + std.

PAGE 77

77 Figure 2 9. Continu ed.

PAGE 78

78 Figure 2 10 Histone deacetylase (Hdac) and Su(z)12 functions are required for the sensitive to resistant transition. Responsiveness of reaper (and hid ) following irradiation was measured with ISH in stage 13 embryos. In wild type embryos, there is no response at all (A, B). However, embryos mutated for Hdac (C, D), Su(z)12 (E, F), or Su(v)3 9, Pc, etc. (Table 2 4 ) remained responsive till stage 13 14. G)Schematic diagram summarize our findings. Epigenetic regulation of the sensitizing enhancer regio n (IRER) determines whether the pro apoptotic gene(s) can be induced by cellular stresses such as DNA damage, and thus controls the sensitivity to stress induced cell death. Such an epigenetic modification may be reversible and regulated by developmental c ues.

PAGE 79

79 Figure 2 11 Delayed formation of DNase I resistant region in Hdac and Su(var)3 9 mutants. The sensitivity to DNase I digestion was measured for wild type (w[67c23]) embryos and embryos laid by heterozygous parent s of Hdac/TM3 and Su(var)3 9/TM3, respectively, at 10 13hr AEL. The measurements were processed as described in the Material and Methods section and normalized against corresponding measurements for the act5c locus. The values represent the average of 3 4 measurements and the error bars represent standard deviation. Since none of the GFP balancers we tested allowed reliable distinction of homozygous mutant embryos at this stage, the assays for mutants were performed using pooled embryos laid by heterozygous parents (1/4 homozygous, heterozygous, and wt). Because so, the measurements are underestimates of the DNase I sensitivity in homozygous mutants, which should be considerably higher than the values represented here. In wild type embryos, by 10 13 hr A EL the center region of IRER_left (18,371 382) has become inaccessible, however, the DNase I accessibility of the pooled mutant embryos is conceivably higher, indicating a delay in blocking IRER.

PAGE 80

80 Table 2 1 Genes induced in resistant stage (9 12 hr AEL) e mbryos at 20 minutes ray irradiation Probe_set Name Function 142200_at dib 148753_at CG9238 protein phosphatase 1 binding protein phosphatase type 1 \ regulator 153742_at polo protein kinase protein serine/threonine kinase mitosis 154516_at smg RNA binding translation repressor 143339_i_at Ser99Db serine type endopeptidase digestion 147469_at CG15098 146882_at CG11804 143538_at Top1 larval development (sensu Insecta) oogenesis DNA topoisomerase I 143834_a t CycB3 mitotic spindle assembly cyclin dependent protein kinase \ regulator 153799_at CG1823 148648_at CG4300 spermidine synthase 147364_at CG14478 155087_at CG8390 154485_at kel ring canal formation oogenesis actin binding 1 55049_at CG7129 146589_at CG3305 152304_at CG11963 succinate CoA ligase (ADP forming) 154844_at cdc2 cyclin dependent protein kinase G2/M transition of mitotic cell cycle G1/S transition of mitotic cell cycle 154416_at BcDNA:LD27979 154041_at BcDNA:LD21675 154399_at UbcD4 ubiquitin conjugating enzyme ubiquitin cycle 154941_at CG1962 154506_at Srp54 mRNA splice site selection pre mRNA splicing factor RNA binding

PAGE 81

81 Table 2 2 Mutant strains used in this study Name (Flybase ID) Molecular information Reference Point mutations Hdac[303] (Mottus et al. 2000) Hdac[326] As above Hdac[328] As above Su(v)3 9[1] Flybase Su(v)3 9[2] Flybase Su(z)12[3] (Birve et al. 2001) Su(z)12[4] As above Su(z)12[5] As above Deficiencies Df(18,366 398) Deleted region (3L:18,365,730 18,398,861), replaced by PXP5/PBac5 This study Df (18,366 386) Deleted region (3L:18,365,730 18,386,306), replaced by PXP5/PBac5 This study Df(18,386 398) Deleted region (3L:18,386,306 18,398,861), replaced by PBac5/PBac3 This study Transposon insertion strains P [XPd11052] (referred to as R1) Inse rted after 3L:18,363,856. (Verification by IVPCR indicated that, for the strain we obtained, there were multiple insertions on the 3 rd chromosome.) (Thibault et al. 2004) P [XPd00909] (R2) Inserted after 3L:18,3 65,729 (Thibault et al. 2004) single insertion, position verified by this study. PBac[WHf02826] (R3) Inserted after 3L:18,366,170 As above PBac[WHf03056] (R4) Inserted after 3L:18,386,307 As above PBac[WHf07603 ] (R5) Inserted after 3L:18,387,288 As above PBac[WHf03389] (R6) Inserted after 3L:18,398,861 As above P (Keyse et al.) rpd3[04556] Flybase

PAGE 82

82 Table 2 3. Primer pairs used for QPCR measurement of each locus Symbol Target region Forward (f) and backward (b) primers Act5c Act5c Ac5c_f CACGGTATCGTGACCAACTG Act5c_b GCCATCTCCTGCTCAAAGTC H23 Ch 2h (centro meric heterochromatin) 23,000 25,000 H23(939)_f CCAAGTTGGCCAGTTTTGAT H24(104)_b AGTTCAAGCCCGGGTATTCT 363 Ch 3L: 18,363,000 18,363,999 (reaper promoter) 363(689)_f GCGATGGTTGCTTTTCAACT 363(972)_b TGGCAACAACAACACAACCT 364 Ch 3L: 18,364,000 18,364,9 99 364(552)_f CAAGGAAGAGTTCCGTTCCA 364(879)_b ACTTTAAGCCGCAGGGAAAT 365 Ch 3L: 18,365,000 18,365,999 365(313)_f GTGCGTCTCAAGTGTTTCCA 365(741)_b CGAAAGCAGACCCAAAACAT 366 Ch 3L: 18,366,000 18,366,999 366(325)_f TGGGAAGTGTGTCAATCGAA 366(638)_b CGCAA GTTATCGCATTGTTG 368 Ch 3L: 18,368,000 18,368,999 368(604)_f TTTTCGGAATGGGTTTTCAG 368(830)_b ACACACACGAACCGAATGAA 370 Ch 3L: 18,370,000 18,370,999 370(695)_f GTCCGATCTCGCAATCAAAT 370(900)_b ACATCCGAAAGGCAGAAAGA 371 Ch 3L: 18,371,000 18,371,999 371( 263)_f TTTTGATACCCCGTGATGGT 371(673)_b CAACAATTTGAGCAGGAGCA 372 Ch 3L: 18,372,000 18,372,999 372(552)_f CCCGAGTTGAGCGTAGAGTC 372(944)_b ATGAAGTCCCTGGCAAACAC 375 Ch 3L: 18,375,000 18,375,999 375(161)_f ATGGGATACAGTGCGTGTCA 375(491)_b AGGTGAGCAGCT TAGGACCA 377 Ch 3L: 18,377,000 18,377,999 377(539)_f AGCAGCATCCTGACTGTCCT 377(683)_b CGCTTGGTTGAAATTTGGTT 380 Ch 3L: 18,380,000 18,380,999 380(584)_f AGAAACCACCCACTCACAGG 380(830)_b TGACTTTAAGCGGCTTCGAT 382 Ch 3L: 18,382,000 18,382,999 382(413)_f TTGGGCCCCTTTTAAATACC 382(610)_b AAAAACCGGAGCCTAAAGGA 384 Ch 3L: 18,384,000 18,384,999 384(540)_f ACGAATAAACGTGCCAAAGG 384(678)_b CCACACTCCGAATTTCCACT 386 Ch 3L: 18,386,000 18,386,999 386(214)_f GTTTTGGCATCAGCTTGTGA 386(354)_b TGTCGATCCGATTTTCCCT A

PAGE 83

83 Table 2 3. Continued Symbol Target region Forward (f) and backward (b) primers 387 Ch 3L: 18,387,000 18,387,999 387(463)_f CGTTTGACCCGTTGAGATTT 387(862)_b GATAAGGCCGAAGGAAAAGG 390 Ch 3L: 18,390,000 18,390,999 390(315)_f TACCAACTCGGTCCTTCCAC 390( 441)_b TTCTGCACCCATTCTCCTCT 395 Ch 3L: 18,395,000 18,395,999 395(575)_f TATGCTGGCTGATGGAAGTG 395(801)_b GCAGCAGAATGCATAACGAA 399 Ch 3L: 18,399,000 18,399,999 399(296)_f CAGCATTAGCAAGGCAAACA 399(716)_b TATCGGGCGAAAGTCAAAAC Ubx Ch 3R, Ubx promoter (Schwartz et al. 2006) Ubx +54 CCGCTGATAATGTGGATAA Ubx 177 CACCCCGATAAACTTAAAC BXD PRE bxd PRE region (Wang et al. 2004b) b4_F ATGGCCTCATAATCGTTTGC b4_B CTTTTCATAGCCGCTTTTGC Sequence and coordinates were based on D. melanogaster Genome Annotation 4.0.

PAGE 84

84 Table 2 4 Irradiation r esponsiveness of reaper and hid in v arious m utant e mbryos Gene Allele Responsiveness of reaper Responsiveness of hid w [67c23] Stops at stage 12 Stops at stage 12 [1118] Stops at stage 12 Stops at stage 12 Su(var)3 9 [1] Extended+ Extended+ [2] Extended+ Extended+ HDAC1 (rpd3) [04556 ] Extended+ Extended+ [303] Extended++ Extended++ [326] Extended+ Extended+ [328] Extended+ Extended+ Su(Z)12 [3] Extended + Extended+ [4] Extended+ Extended+ [5] Extended+ Extended+ trithorax [1] No change No change [KG04195] No change N/A [EY13717] No change N/A brm [2] No change No change zeste [a] No change N/A [ae(bx)] No change N/A [v77h] No change N/A Polycomb [1] Extended++ Extended++ [3] Extended+ Extended+ [7] Extended+ Extended+ [1]/[3] Extended++ Extended++ psc [ e22] No change N/A [1.d20] No change N/A E(Z) [S2e] No change No change [S4e] No change N/A [S3e] No change N/A M: [S2e]/ [S2e] Slightly Extended N/A M: [S2e]/ [S4e] Slightly Extended N/A In wild type embryo, the responsiveness of both gen es is turned off at stage 12. significant change of the timing of sensitive to resistant transition was found in the homozygous mutant that in homozygous mutant embryos the gene is stil l responsive till stage 12/13 or 14/15 (respectively). Mutant strains were balanced with GFP or lacZ balancer and homozygous mutants were identified as la cking anti GFP or anti Gal staining. M, maternal mutant genotype (parental genotype E(z)[S2e]/TM3 ubi GFP).

PAGE 85

85 CHAPTER 3 STRESS RESPONSIVE EPIGENETI C REGULATION OF IRER Abstract The irradiation responsive enhancer region (IRER) was originally characteriz ed as a 33 kb intergenic region required for mediating irradiation induced expression of two pro apoptotic genes, reaper and hid It has been shown that the epigenetic status of the IRER determines the cellular sensitivity to exogenous stimuli such as irra diation. The IRER is better conserved during evolution th a n the reaper coding region and d eletion of this region results in significantly reduced viability suggesting a vit al role of IRER in development. In order to monitor the chromatin accessibility of the IRER region in live animals, we inserted a DsRed reporter gene controlled by an ubiquitin promoter into the endogenous IRER locus through homologous recombination. The insertion was verified by Southern blot, and the local chromatin structure was not affected by the insertion. The association of DsRed expression level and the chromatin accessibility of IRER was validated by chromatin immunoprecipitation with sorted DsRed positive and negative cells from IRER{ubi DsRed} larvae. DsRed positive cells also showed a significant higher level of reaper expression than DsRed negative cells, indicating that the cells with open IRER are more sensitive to stress induced cell death. The DsRed expressing cells were observe d at the apex of the testis disc and the tip s of the female ovarioles, where the germ line stem cells usually reside. Besides these specific localization s sporadic DsRed positive cells were also found in various tissues, suggesting that the epigenetic regulation of IRER is not cell lineage s pecific Unexpectedly, rapid induction of DsRed upon irradiation was found in the larval imaginal discs. Also, nutrition deprivation results in increased DsRed in IRER{ubi DsRed} larvae Its dynamic

PAGE 86

86 epigenetic status suggest s that IRER is responsive to different environmental stresses and adjust the cellular sensitivity to stress induced apoptosis by changing its chromatin configuration. Introduction Cell death plays an essential role during Drosophila embryogenesis. However, it remains an enigma as to what mechan isms determine (or select) the specific cells to be eliminated at a particular developmental stage. Is it mostly dependent on the lineage of the cell and can be viewed as genetically predetermined? Or, is it due to the failure of a cell in the competition for growth factor, which is more or less by chance? Recent developments in studying the molecular mechanism of cell death during Drosophila embryogenesis has provided much insight into our understanding of the relative importance of, and the interaction be tween, these two mechanisms in shaping the embryo. The fact that almost all developmental cell death is blocked in H99 mutant embryos underscores the importance of the IAP antagonists in regulating c ell death during embryogenesis. In the developing embryo, both Caspases and DI AP1 are ubiquitously expressed. It seems that in all of the analyzed embryonic systems, expression of the IAP antagonists reaper hid or grim is required for inducing cell death. The expression pattern of reaper grim and sickle i n post stage 11 embryos corresponds very well with the cell death pattern, indicating that these genes are specifically expressed in cells de stined to die. Hid is the only one of the four IAP antagonists that are expressed in cells that do not die at the e nd of embryogenesis, which at least in part is due to the fact that its pro apoptotic activity can be suppressed by phosphorylation mediated by MAPK. In the case of the MG cells, both hid and reaper

PAGE 87

87 are expressed in these cells to mediate cell death in a s ynergistic fashion (Zhou et a l. 1997) Removing the function of one of the genes will result in a partial rescue compared to the total blocking of cell death in H99 mutant (Zhou et al. 1997) Coordinated expression of reaper and hid have also been observed in several other systems, such as ecdysone induced dege neration of the midgut and salivary gland during metamorphosis (Jiang et al. 1997) In these systems, removing th e function of one of the IAP antagonists often has only mild or minor effect (Peterson et al. 2002; Yin and Thummel 2004) Although all four IAP antagonists induce cell death mainly through their IAP binding motif, their functions are not merely redundant (Wing et al. 2001; Zachariou et al. 2003) R eaper, Grim, and Sickle also have a C terminal motif that could induce cell death at least in over expression settings (Claveria et al. 2002; Olson et al. 2003; Claveria et al. 2004; Freel et al. 2008) Interestingly, coordinated expression of reaper and hid is also observed when embryos at or before stage 11 were irradiated with ionizing irr adiation. This coordinated induction is mediated by enhancers within the IRER upstream of reaper as discussed in Chapter 2 (Zhang et al. 2008a) When this enhancer region is deleted, both reaper and hid lost their responsiveness to irradiation, suggesting that the same set of enhancers can regulate the expression of both genes. The responsiveness of reaper and hid to irradiation induced DNA damage is developmental stage specific. Both genes became irresponsive to irradiation in embryos post stage 12. It turned out that this sensitive to resistant tr ansition is due to epigenetic regulation of the IRER. Around stage 12, this region forms a heterochromatin like structure that is inaccessible to DNase I, accompanied with the enrichment of repressive chromatin marks, such as H3K27me3

PAGE 88

88 and H3K9me3 and the binding of HP 1 and Polycomb group proteins (Z hang et al. 2008a) It seems that understanding the transcriptional regulation of the IAP antagonistss will hold the key to understand how cells are specifie d to die during embryogenesis. Even for the MG cells, although the EGFR pathway is responsible for determining the number of cells survival during embryogenesis, the specific expression of hid (and reaper ) in these cells appears to be the pre requisite for cell death in this lineage (Figure 3 1) However, fully characterization of the transcription al regulation of the IAP antagonists will unlikely to be a s imple task. The four genes are located in a 350kb region that is conserved as synteny in the sequenced Drosophila genomes (Figure 3 2). All four genes transcribe toward the same di rection (telomer e of Chr. 3L). Remarkably long geneless intergenic regions (99kb and 40 kb, respectively ) are flanking the reaper transcripts. These two long intergenic regions are highly conserved in distantly related Drosophila species and are enriched for Highly Conser v ed Non coding Elements (HCNE). HCNEs are 50 150bp genomic sequences that are over 90 95% identical in different species. The clustering of HCNE, such as the pattern associated with the IAP a genomic regulatory block (GRB) in both insects and vertebrates (Engstrom et al. 2007; Kikuta et al. 2007) GRBs often have several genes that are coordinated regulated by the enhancers located in HCNE. It is very likely that the four IAP antagonists are in a genomic regulatory block. However, identifying all of the enhancers and interactions between/among the enhancers and promoters will be a challenge that demands much dedicated effort.

PAGE 89

89 Materials and Methods Fly strains B11 ( Df(3L:18,366 398) ), L1 ( Df(3L:18,366 386) ) and JR44 1 (Df(3L: 18,365 367) deletion mutants are partially lethal. The homologous flies were grown for embryo collection. The overnight pool embryo collection was used for reaper ISH, and the stage 9 12 embyros (4.5 10.5 hr AEL) were collected for QPCR dete ction of pro apoptotic genes. X3 reporter line ( IRER{ubi DsRed} ) is viable. Homozygous flies were used in this study. In Situ Hybridizaition Embryos were collected and processed for immunocy tochemistry and in situ hybridization as described previously (Zhou et al. 1995) cDNA clones 13B2 ( rpr ) and 5A1B ( hid ) were used to generate single stranded digoxigenin labeled cRNA probes using T3 RNA polymerase (Roche). Southern Blot The genomic DNA was extracted by phenol/chloroform from adult files, followed by restriction digestion for 5 6 hr. The digested DNA was loaded on 0.7% agarose gel and run overnight at low votage. The gel was then treated by Denaturization buffer (1.5M NaCl, 0.5M NaOH) for 45 min and washed twice by Neutralization buffer (1.5M NaCl, 0.5M Tris, pH7.5) for 30 min. The DNA was transfered to the membrane (Amersham HybondTM XL) in the presence of 10x SSC buffer overnight. The membrane was then removed and rinse briefly with 6x SSC, followed by UV c ross link ing The hybridization was perfo rmed using Amersham Rapid Hyb Buffer (GE Healthcare, RPN1635 or RPN1636). The DNA probe was prepared with Amersham Rediprime II Random Prime Labelling System (GE Healthcare, RPN1633 or RPN1634). The membrane was washed

PAGE 90

90 with stringency washing steps. T he me mbrane was dried and visualized by Typhoon F luorescence I maging system (Amersham Biosciences, Typhoon 9410). Fluorescence Activated Cell Sorting (FACS) with Whole Larvae Raising animal The overnight collection of eggs was wash ed and treat ed with 50% bleac h for 3 minutes, then t ransfer ed to a 10cm culture dish containing SY food ( 100g sucrose, 100g baker's yeast 1 L of boiled water, 20 ml 15% Nipagin in ethanol, 3ml propionic acid ). After growing at 25 o C or RT for 3 days, the larvae were rinsed and transfe r ed to a new petri dish with fresh SY food. The live larvae were collected by rinsing on the 350um nylon mesh and transered to clean petri dish es with 7% Sucrose, 2ug/ml Amphotericin B (AmB) (fungizone, Fisher BioSci) Isolation of cells The live larvae w ere homogenized with a mortar in the presence of dissociation buffer (Trypsin/EDTA (Sigma T4049)). Homogernized larvae were i ncubate d at 28 o C water bath for 10 minutes, followed by the centrifugation at 200g for 1 minute. The tissue chunks was r esuspend ed in Dissociation Buffer (1:1 mixture of T4049 and T4174 (10x trypsin/EDTA from Sigma)) and further processed by homogenizer at low speed for 2 3 minutes The homogenized tissues were i ncubate d at 28 o C for 60 90 minutes with shaking. The remaining large tis sue chunks were removed by centrifugation at 200g for 1 minute at 4 o C The supernatant was tranfered to a new 15ml/50ml tube first, and then pass ed through a 100 um cell strainer mesh into a new 50ml tube. Cells were collected by centrifugation at 600g for 5 minutes at 4 o C then r esuspend ed with Cell Culture Medium (M3 with 10%FBS, 1xP/S, 1ug/ml AmB), followed by another centrifugation at 500g for 3 minutes to remove small cell debris and further enrich

PAGE 91

91 DsRed+ cells. Cells were then r esuspend ed in ~ 10 ml c ell sorting medium (M3, without FBS, 1xP/S, 1ug/ml A mB) per gram of original tissue At least 20 min prior to FACS analysis, Hoechst 33342 was added to the sample at a final concentration of 1 ng / ml (up to 500 ng / ml), followed by a short vortex. FACS d ata were collected (DAKO MoFlo High Speed Sorter) and analysed with Summit software. RNA/DNA Ratio The 3 rd instar lavae of IRER {ubi DsRed} strain were homogenized, and the DsRed positive and negative cells were sorted by Fluorescence Activated Cell Sorting (FACS). The simultaneous purification of g enomic DNA and total RNA were performed with AllPrep DNA/RNA mini kit (Qiagen Cat#80204). Reverse transcription of RNA samples was done with High Capacity cDNA Archive Kit (ABI). The DNA fragments containing the t arget sequences were PCR amplified and purified for the preparation of standards. Measure the DNA concentration by OD and calculate the molecular concentration based on the following formula: nmole DNA = (OD 260 units x 90) / (length of DNA). The absolute q uantification of DNA and RNA was performed by real time PCR with standards. Results IRER I s Invovled in the Regulation of reaper D uring Development U nderstanding the transcriptional regulation of the IAP antagonists is crucial to understand how cells are specified to die during embryogenesis A reporter construct containing the immediate 11kb sequence upstream of the reaper transcribed region gives a much broader expression pattern in transgenic animals than that of the endogenous reaper mRNA (Nordstrom et al. 199 6) suggesting that there are missing elements that regulate endogenous r eaper expression in the embryo

PAGE 92

92 The irradiation responsiveness was greatly decreased or completedly abolished in our IRER deletion mutants, suggesting this region contains cis eleme nt(s) responsible for the stress induced cell death. Also, d eletion of IRER results in significantly reduced viability at the organism level; only 10 15% of homozygous animals survive to adulthood So i t is very likely that IRER is not only required for ir radiation responsiveness, but also plays an important role in developmental process. Indeed, we found greatly reduced reaper expression in stage 10 11 embryos in three homozygous deletion mutants ( Figure 3 3 and Figure 3 4 A ): B11 ( Df(3L:18,366 398) ), L1 ( D f(3L:18,366 386) ) and JR44 1 (D f(3L: 18,365 367)), especially in the segmental strips where the cell competition induced apoptosis (cell death by chance) happens during development. However, the reaper expression in CNS was not affected. The stage 9 12 hom ozygous embryos (4.5 10.5 hr AEL) were collected and the expression of pro apoptotic genes was measured by QPCR. Only a slightly decreased expression level of reaper was observed compared to wild type (Figure 3 4B). The discrepancy between QPCR and ISH may be attributed to the disruption of normal embryonic development in the mutants. The pool of embryos with the same age for QPCR may vary in developmental stage between muant and wild type embryos. Whereas the embryos for ISH were checked under the microsco pe to make sure they were at the same stage. The deleted region in B11 and L1 flies contains one at least one putative P53 response element (P53RE 3L:18,368,516 535 ) that conforms to the patterns of mammalian P53 binding sites (Brodsky et al. 2000) Correspondingly, gene tic analysis indicated that the function of Drosophila P53 (DmP53) is required for mediating ionizing irradiation induced reaper expression and apoptosis (Lee et al. 2003; Sogame et al.

PAGE 93

93 2003; Brodsky et al. 2004) I t is possible that the reduction of reaper expression is due to the loss of binding of DmP53 or other transcription factors which is required for developmental cell death in some tissues at stage 10 11 Monitor the Accessibility of IRER in vivo The IRER i s important for regulation of developmental apoptosis through recruiting regulatory transcription factors such as DmP53. It has been shown at least one P53RE reside in the IRER region (Brodsky et al. 2000) However over expression of DmP53 failed to induce reaper express ion or apoptosis in many tissues, indicating that DmP53 alone is not sufficient in inducing reaper expression, or (and) the P53RE is not always accessible. As discussed in Chapter 2, IRER is subject to epigenetic regulation during the embryogenesis. Around stage 12, this region forms a heterochromatin like structure that is inaccessible to DNase I, accompanied with the enrichment of repressive chromatin marks, such as H3K27me3 and H3K9me3 and the binding of Heterochromatin Protein 1 and Polycomb group prot eins (Zhang et al. 2008a) This epigenetic m odification of IRER may also make it inaccessible to transcription factors, probably including DmP53, that bind to this region otherwise. The developmental consequence of epigenetic regulation of the IRER is tuning down (off) of the responsiveness of the p ro apoptotic genes, and thus decreasing cellular sensitivity to stresses such as DNA damage (Figure 2 10 G). We generated a reporter line X3 ( IRER{ubi DsRed} ) to monitor the accessibility of IRER. The ubi DsRed reporter gene was inserted into the endogenou s IRER region (18,375,553) through homologous recombination (Figure 3 5A and Figure 3 6A). The insertion locus is within the region that has the highest enrichment of H3K27me3 and H3K9me3 at resistant stage. The DsRed gene is controlled by ubiquitin promot er so that

PAGE 94

94 the expression level will reflect the chromatin accessibility of its surrounding IRER. The insertion was veri fied by southern blot (Figure 3 5B). And the ChIP assays in homozygous embryos showed that the insertion does not interrupt the chromati n accessibility of the endogenous IRER region (Figure 3 6), consistent with the DNaseI accessibility assay (unpublished data by Can Zhang) Before we use the X3 line to study the accessibility of IRER during Drosophila development, we need to validate the association between DsRed fluorescence signal and the chromatin structure of the insertion site We used fluorescence activated cell sorting (FACS) to separate DsRed positive and negative cells, and did ChIP assays around the insertion site. As we expected DsRed negative cells had much higher H3K27me3 level at inserted reporter gene locu s than positive cells (Figure 3 7A), indicating that the DsRed signal is indeed associated with open chromatin. Accordingly, DsRed positive cells showed higher reaper expre ssion level than DsRed negative cells, indicates a more permissive chromatin state of IRER in positive cells with which the related trans factors might interact (Figure 3 7B) With these validations, we ha ve confidence to use the reporter line to monitor t he openness of IRER in vivo which may help us to understand the transcriptional regulation of pro apoptotic genes. Unsurprisingly, all cells before embryonic stage 11/12 have DsRed expression, which start to diminish in most cells after stage 12. Followin g the status of IRER in post embryonic development brought several interesting findings. For instances, in male third instar larvae, a group of cells at the apex of the testis disc exhibit a much brighter DsRed signal than any other tissues (Figure 3 8 A a nd B). The location of these DsRed expression cells suggests that they are male germ line stem cells ( GSC s), which will be

PAGE 95

95 verified by staining for GSC specific markers in the future. In contrast, DsRed signal is turned off in the progenies of GSC, i.e. th e spermatocytes that situated just posterior to the GSCs. This suggests that the epigenetic regulation of IRER is not cell lineage s pecific ; rather, it is development stage/differentiation status s pecific Similarly, the most concentrated DsRed signals wer e found at the tips of the female ovarioles, where the female GSCs are localized (Figure 3 8C). In the 3 rd instar larvae eye discs, most cells have no (or very low level) DsRed signal. However, discrete cells have significant levels of DsRed (Figure 3 8D). We also looked at the DsRed pattern in live pupae a high resolution photoacoustic tomography (PAT) approach, because there is an abundance of proliferation, differentiation, and apoptosis in pupal development. (Figure 3 8E, preliminary results). Some spec ific areas lighted up by DsRed suggest that those cells are particularly sensitive to developmental stress induced apoptosis, although it is difficult to distinguish these cells due to the lack of specific markers. Discussion and Future Directions As desc ribed in Chapter 2, our initial measurement IRER accessibility was through DNase I sensitivity assay performed on nuclei extracted from staged embryos (Zhang et al. 2008a) This approach succeeded because nearly all cells in early stage embryos respond to irradiation, indicating that IRER is open in these cells. In post stage 12 embryos, most, if not all, cells lost their responsiveness to irradiation, indicating that IRER is closed. However, it is simply not feasible to use this method to follow the status of IRER in tissues after embryonic developm ent or in individual cells. It is well known that later during development, certain tissues, such as the wing and eye discs in 3 rd instar larvae, regain responsiveness to irradiation induced cell death (Ollmann et al 2000; Wichmann et al. 2006) To test whether IRER becomes open again in these

PAGE 96

96 tissues, we generated the IRER{ubi DsRed} reporter strain in which the DsRed was used as a cellular reporter for monitoring its surrounding chromatin accessibility. The DsRed reporter gene within IRER should only be expressed in cells that have an open IRER, such as the undifferentiated cells in early stage embryos. In this reporter strain, we observed t he ubiquitously expressed DsRed in early stage embryos. After stage 12, DsR ed mRNA began to decrease. By the end of embryogenesis, only a few cells and the salivary gland have detectable level of DsRed mRNA by ISH (The DsRed protein has a half life of over 40hrs). At 3 rd instar larvae, most cells have no (or very low level) DsRed signal. However, discrete cells in the gut, eye and wing disc, and the male testis have significant levels of DsRed (Figure 3 8). Some of our observations indicate that the epigenetic status of the IRER is quite dynamic. Significant i ncreased DsRed signa ls were found in the larvae imaginal discs upon irradiation or heat shock treatment (unpublished data by Can Zhang) Also, n utrition deprivati on resulted in increased DsRed in IRER{ubi DsRed} larvae (unpublished data by Michael Novo) Therefore, unlike the traditional view of epigenetic regulation, IRER is responsive to different environmental stresses and controls the cellular sensitivity to stress induced apoptosis by altering its chromatin configuration. It is possible that the IRER is also required for cell death resulting from the developmental stresses, such as cell competition for growth factors. One of o ur focus es of this work will be documenting the expression pattern of the IRER{ubi DsRed} reporter. In addition to ad dressing the general questions such as cells is IRER open/closed? W e will also address questions such as

PAGE 97

97 etc. by monitoring DsRed signal together with othe r cellular markers. The lacks of specific markers may be a limitation. For instant, we are interested in knowing whether the discrete DsRed positive cells in the midgut are the pluripotent stem cells described by Ohlstein and Spradling (Ohlstein and Spradling 2006) However, there is no specific marker to distinguish these cells. We could potentially perfo rm mosaic clone assay in the background of IRER{ubi DsRed}, but that would be rather time consuming. Collaboration with other interested groups is a possibility. There is an abundance of proliferation, differentiation, and apoptosis in pupal development. B ut the DsRed signal from tissues inside the pupa is hard to monitor due to the deflection and reflection of the cocoon shell. Engineering (UF) to develop a high resolution photoacous tic tomography (PAT) approach to monitor the dynamics of DsRe d expression in live pupae (Figure 3 8E preliminary results). The development and optimization of the technology will not and can not be covered by this project. However, if it is successful, th is will allow us to perform real time monitoring of epigenetic status of IRER in live developing animals.

PAGE 98

98 Figure 3 1. Summary of mechanisms that controls cell death during Drosophila embryogenesis. Developmental cues control the expression of IAP a ntagonists through specific transcription factors and through epigenetic regulation of the enhancer regions. The EGFR pathway suppresses the expression of hid and inhibits the pro apoptotic activity of HID protein, thus determines the number of cells that can survive.

PAGE 99

99 Figure 3 2 Genomic regulatory block of the IAP antagonists (figure generated in http://ancora.genereg.net/ ). The four pro apoptotic genes, hid ( h ), grim ( g ), reaper ( r ), and sickle ( s ), are in the same synteny that has high density of HCNE in the middle. The blue dotted lines indicated the minimum syntenic region that is conserved in all sequenced Drosophila genomes. The green dotted lines indicate the non coding genomic regions surrounding reaper which is enriched with HCNE (coordinates b ased on genome release 5.0).

PAGE 100

100 Figure 3 3 Dynamic expression pattern of reaper and hid The distribution of reaper (A, B) and hid (C, D) mRNA in embryos at different stages was revealed via in situ hybridization. (A) Sagittal view of stage 11 embryo, reaper is expressed in a segmentally repetitive pattern in the epidermis. However there is significant variation among segments. At later stage (B), reaper is only expressed in discrete cells in the ventral nerve cord (arrow). At stage 11 12 (C), hid is ex pressed in the epidermis as well as the CNS midline (arrow head). Some of these hid expressing MG cells remain alive at the end of embryogenesis (D).

PAGE 101

101 Figure 3 4 Downregulation of reaper in IRER deletion mutants. A) ISH signals of reaper gene were decre ased in IRER deficiency homozygous mutant embryos at stage 10 11, compared to wild type w 1118 B11 ( Df(3L:18,366 398) ), L1 ( Df(3L:18,366 386) ) and JR44 1 (Df(3L: 18,365 367)). B) QPCR of three pro apoptotic genes reaper hid and sickle in IRER deletion hom ozygous mutant embryos and wild type embryos at stage 9 12.

PAGE 102

102 Figure 3 5 Southern blot verification of X3 insertion. A) Schematic map of X3 insertion locus. The ubi DsRed reporter gene was inserted into the endogenous IRER region (18,375,553) by homol ogous recombination. Both wild type and X3 genomic DNAs were digested with BglII and analyzed with the probe near the left Bgl II site, shown by the red bar. B) Southern blot with genomic DNA from wt, CFP12 donor strain and X3 flies. Both wt and CFP12 had t he specific 13.4kb bands, while the band in X3 DNA was about 8kb.

PAGE 103

103 Figure 3 6 Insertion of ubi DsRed reporter into endogenous IRER region did not alter the chromatin profil es of this region in X3 flies. A) The ubi DsRed reporter gene was inserted into the endogenous IRER region (18,375,553) by homologous recombination. The black bars below are primer sets for DNase I sensitivity and ChIP assays. B ) and C ) ChIP assays with H3K27me3, H3K9me3, PSC and HP1 in X3 homozygous embryos at late stage (14 20 AEL). Act5C was used as negative control bxd PRE region was positive control for H3K27me3 and PSC, while pericentromeric H23 locus was used as positive control for H3K9me3 and HP1.

PAGE 104

104 Figure 3 7 Validation of IRER{ubi DsRed} A) X3 pupae were collected and hom ogenized, followed by the Fluorescence activated cell sorting to separate the DsRed positive and negative cells. The cell sorting and ChIP was done once, QPCR measurement was repeated twice and the results were consistent. Only one set of QPCR data was sho wn. Both DsRed positive and negative cells are ChIP with H3K27me3 antibody, and the recovery rate was normalized to the positive control bxd PRE locus. B) reaper expression levels in DsRed positive cells and DsRed negative cells

PAGE 105

105 Figure 3 8. The DsRed expression patterns in different tissues of t he IRER {ubi DsRed P reporter flies A ) DsRed signal (red) at the apex of the testis in third instar larvae. B) testis. A ) and B ) are pictures of the same tissue however the picture in B is of a slightly different focus plan and was taken with both DIC and fluorescence filters. C) DsRed signal concentrated at the tip of the ovarioles. D ) Distribution of DsRed and DAPI signal in the antenna eye imaginal discs. IRE R{ubi DsRed} is expressed in cells at the posterior tip of the eye disc and at the do (arrow) but not at the morphogenetic furrow. E) P reliminary data of PAT detection of DsRed expression in the pupae.

PAGE 106

106 CHAPTER 4 A NOVEL CHROMATIN BA RRIER ELEMENT DELIMI TS THE FORMATION OF FACULTATIVE HETEROCH ROMATIN WITHOUT BLOC KING ENHANCER FUNCTION Abstract Insulators are discrete DNA elements at the boundaries of genes that protect the gene from the positive or negative regulatory influences of its neighboring environme nt. Insulators have two biological functions: blocking enhancer promoter interaction and stemming heterochromatin propagation. In this study we identified a chromatin barrier that specifically limits the epigenetic regulation to a distal enhancer region so that repressive histone modification cannot reach the promoter and proximal enhancer regions of reaper Unlike all of the known insulators identified from Drosophila the I RER (irradiation responsive enhancer region) l eft b arrier (ILB) does not contain en hancer blocking activity. This is in accordance with the fact that epigenetic regulation of IRER is dynamic and reversible following certain stresses, under which circumstances the enhancer function of IRER is required for stress induced pro apoptotic gene expression. The barrier activity of ILB requires the binding of Drosophila Cut proteins, which might recruit histone modifier enzymes, such as histone acetyltransferase CBP, and change the local chromatin environment into the conformation that favors the euchromatin formation. This study broadens the knowledge about the insulator/boundary elements and their roles in eukaryotic genome organization, and discovers the potential molecular mechanism for the pleiotropic phenotype in Cut mutants Introduction Wh ile every cell has a complete genome, only a portion of the genomic information is expressed in accordance with the distinct property of each cell. Histone modifications

PAGE 107

107 play a fundamental role in determining the accessibility and expressivity of the u nder lying genetic information. We have long known that distinct histone modifications are associated with open (euchromatin) or closed (heterochromatin) conformations (Jenuwein and Allis 2001) Recent high resolution epigenomic analyses further revealed that even within a gene, distinct patterns of histone modifications are associated with different anatomic part s of the gene, such as the promoter, enhancer, or the transcribed region, etc. (Wang et al. 2009) However, the mechanisms that determine the range of a particular histone modification remain enigmatic. Insulator/boundary elements are regulatory DNA sequences t hat help to organize the genome into distinct domains and prevent promiscuous gene regulation Most of the previously characterized insulator/boundary elements in high eukaryotes harbor two activities. One is enhancer blocking, which prevents the enhancer promoter interaction when it is positioned in between. The other is chromatin barrier activity, which blocks the spread of heterochromatin formation into euchromatic regions (Gaszner and Felsenfeld 2006) The molecular mechanisms of insulator/boundary elements are not well understood. Much of our kn owledge about the mechanism of the enhancer blocking activity came from studying insulators in Drosophila where all of the characterized insulators have enhancer blocking activity (Gurudatta and Corces 2009) Several non exclusive models have been proposed for the mechanism of enhancer blocking function, including the promoter decoy model, the physical barrier model, and the loop domain model (Bushey et al. 2008; Raab and Kamakaka 2010)

PAGE 108

108 A few model systems have been exploited to understand the mechanism of chromatin barrier activity. In the yeast mating locus, the binding of specific transcriptional factors creates a gap in the nucleo some array, which prevents the propagation of heterochromatin formation (Bi and Broach 2001) In high eukaryotes, much of what we know abo ut chromatin barrier activity came from studying cHS4, the globin locus. The complete cHS4 has bot h enhancer blocking and barrier activity. However, a series of elaborate dissection indicated that its enhancer blocking and barrie r activities are separable and are carried out by distinct DNA elements (Bell et al. 1999; Recillas Targa et al. 2002; West et al. 2004; Gaszner and Felsenfeld 2006) Deletion of the CTCF binding site, which is resp onsible for the enhancer blocking activity, did not affect the barrier activity of cHS4 (Recillas Targa et al. 2002) Rather, a binding site for USF1 (upstream stimulatory factor 1) is responsible for the recruitment of chromatin modifying enzymes, which catalyze euchromatin specific histone modifications that are incompatible with heterochromatin formation (West et al. 2004; Huang et al. 2007) Although the enhancer blocking and barrier activities are clearly separable and are mediated by dis tinct cis elements in the case of cHS4, it is not clear whether this is common for other metazoan insulators. Many insulators have been characterized in Drosophila which could be categorized into at least 5 types based on the responsible binding proteins (Maeda and Karch 2007; Gurudatta and Corces 2009) All of these insulators have enhancer blocking activity (Maeda and Karch 2007; Gurudatta and Corces 2009) Several of them such as the Su(Hw)/ gypsy insulator, also have strong barrier activity (Roseman et al. 1993) However, there is no evidence that the two

PAGE 109

109 functions are mediated by distinct cis elements. In the case of Su(Hw)/ gypsy it appears that different domains of the binding protein Su(Hw) can interact with distinct proteins for enhancer blocking and for barrier activity ( Kurshakova et al. 2007) In searching for the mechanism that controls the responsiveness of pro apoptotic genes following cytotoxic stress, we found that the i rradiation r esponsive e nhancer r egion (IRER) is subject to epigenetic regulation (Zhang et al. 2008b) IRER, located upstream of reaper is actually required for mediating irradiation induced expression of three pro apoptotic genes reaper hid and sickle, all of which locate in a 200kb region and are transcri bed in the same direction IRER is open in undifferentiated proliferating cells during early embryogenesis, conferring high sensitivity to ionizing irradiation induced apoptosis. However, in most differentiating and differentiated cells in late embryogenes is, IRER forms a heterochromatin like structure that is inaccessible to DNase I. Consequently, the epigenetic repression of IRER renders the pro apoptotic genes irresponsive to irradiation in these cells. This epigenetic blocking, signified by enrichment o f H3K27me3 and H3 K9me3 and binding of Polycomb group (PcG) proteins, is strictly limited to IRER. The promoter and transcribed regions of reaper do not have repressive histone marks and remain open in later stage embryos. This restriction of heterochromati n formation is functionally significant. While reaper becomes irresponsive to irradiation in later stage embryos, it is expressed under developmental cues in neuroblasts (Maurange et al. 2008) and differentiated motor neurons (Rogulja Ortmann et al. 2008) and required for programmed cell death at late embryogenesis. In this study we identified a segment of sequence at the left boundary of IRER that has strong barrier activity in blocking the propagation of repressive histone marks.

PAGE 110

110 However, unlike the Su(Hw)/ gypsy insulator, the I RER l eft b arrier (ILB) could not block the reporter gene from bei ng activated by the UAS/GAL4 enhancer when placed in between them. Thus it appears that ILB is a barrier only insulator that lacks enhancer blocking activity. Materials and Methods Constructions of T ransgenes The polylinker sequence was synthesized and cl oned into pBluescript KS between EcoR V and BamH I sites. The multiclonal site of the reconstructed vector contains the following restriction sites: Kpn I Hind III EcoR V Nde I Pst I Nru I Nco I BamH I Xba I sequences were PCR amplified from pP{EndsOut2} ( Jeff Sekelsky ) and verified by sequencing, then inserted in the vector restricted with Kpn I/Hind III and BamH I/Xba I respectively. The bacterial attachment (attB) site was amplified from P[acman] vector (Venken et al. 2006) and subcloned at the Nde I site. The 3xP3 DsRed fragment was amplified from M{3xP3 RFPattP} and subcloned at the BamH I site. The 416 bp fragment containing two FRT sequences and a Spe I restrict ion site in between was inserted at the Nco I site. The experimental ILB fragments were amplified by PCR from w 1118 flies using primers containing Spe I site and inserted between two FRT sequences in the vectors described below. pBT1 : A 661 bp Nde I Pst I fragment containing the Ubx PRE sequence was kindly provided by V. Pirrotta. This fragment was subcloned between Nde I and Pst I sites in the reconstructed vector mentioned above. pBT3: The fragment containing a Mlu I restriction site, flanked by two l oxP sites, was synthesized and inserted into pBT1 vector at the Pst I site, between the UBX PRE and FRT sequences. PCR amplified Su(Hw) binding region was subcloned into the Mlu I site between the two loxP sequences. pIT1: The UBX PRE sequence in pBT1 was substituted by five tandemly arrayed optimized GAL4 binding sites amplified from pUAST (Brand and Perrimon 1993)

PAGE 111

111 Fly S trains, Germ Line Transformation and Genetic C rosses Flies were grown on standard rich media and maintained at 25 o C. The transgenic flies were generated by either P element mediated transformation or system (Rainbow Transgenic Flies, Inc., California). The w 1118 Drosophila strain was used for P element insertion. PBac{y[+] attP 3B}VK00037 and PBac{y[+] attP 3B}VK00003a ) were used for site specific integration into the 2 nd chromosome (Ven ken et al. 2006) The transformants were verified by PCR analysis. The transformation efficiency was recorded in Table S1. Germline excision of the ILB9kb barrier sequence was performed by crossing the BT1 ILB9kb line 47 2 with flies carrying a heat shoc k inducible FLP transposase ( y 1 w 1118 hsFLP ). The progeny were heat shocked for 1.5 hr at 37 o C on 3 5 successive days during larval growth. The female progeny were collected and crossed with TM3/TM6 males. In the following generation, flies were selected for a change in the eye specific DsRed signals, and PRE excision was confirmed by PCR analysis with the CGCCAGCAACAAAGAACTAA GGCCGCTCTAGTGGATCTTG GATA G GACTACGCGCACCAT TGTTCAGCTGCGCTTGTTTA The BT3 lines with gypsy excisions were obtained by crossing the flies with the Cre line ( y 1 w 67c23 ; Sco/CyO, Crew1 ). The female progeny were crossed with Sco/Cyo males, and the desired flies were selected from the next generation based on the eye specifi c DsRed signals. The excisions were verified by PCR analysis. Chromatin I mmunoprecipitation (ChIP) (Chanas et al. 2004) with some modifications. H3K27me3 and H3K9me3 polyclonal antibodies were kindly

PAGE 112

112 provided by Thomas Jenuwein. 150 200 mg adult flies were collected 5 days post eclosure and cross linked in 5 ml of Buffer A1 (60 mM KCl, 15 mM NaCl, 4 mM MgCl 2 15 mM HEPES (pH7.6), 0.5% Triton X 100, 0.5 mM DTT, 10 mM sodium butyrate, and 1% Protease Inhibitors Cocktail (PIC) [Sigma]), in the presence of 1.8% formaldehyde, pestle (three strokes each), followed by incubation for 20 min at room temperature. Cross linking was stopped by adding glycine to 225mM for 5 min on ice. The homogenate was centrifuged for 5 min, 4000 g at 4C, then the supernatant was discarded and the crude nuclei pellet was washed three times in 3 ml Buffer A1and once in 3 ml Buffer A2 (140 mM NaCl, 15 mM HEPES pH 7.6, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X 100, 0.5 mM DTT, 0.1% sodium deoxycholate 10 mM sodium butyrate, 1% PIC) at 4C. After the washes, nuclei were resuspended in 3 ml Buffer A2 in the presence of 0. 1% SDS and 0.5% N lauroylsarcosine, and incubated for 10 min in a rotating wheel at 4C. At the end of the incubation, 0.3g of acid washed glass beads (Sigma, G 1277) were added, and the samples were sonicated on ice using a Branson Sonifer 450 to obtain f ragmented DNA with an average size of approximately 500bp. The immunoprecipitation and QPCR quantification were performed as previously described (Zhang et al. 2008b) For primer sequences please refer to APPENDIX A Gene Expression Analysis mRNA was extracted with RNeasy Mini Kits (QIAGEN) cDNA was prepared by reverse transcription of m RNA with a High Capacity cDNA Archive Kit (Applied Biosystems). Quantitative real time PCR (QPCR) followed protocols provided by t he manufacturer. The real time PCR step used 10 ng cDNA/PCR well with triplicates per gene per sample.

PAGE 113

113 GAAGCTGAAAGACGGTGGTC CGTCCCTCGGTTCTTTCATA CAACAGCACCAGCAGATGTC CTCTGGCTCTGGCTCTGACT Results Epigenetic B locking of IRER I s R estricted to the Upstream Regulatory R egion of reaper In our previous work we showed that in later stage embryos, the Irradiation R esponsive Enhancer Region forms a facultativ e heterochromatin structure that is resistant to DNase I. IRER in later stage embryos is enriched for both H3K27me3 and H3K9me3 and is bound by Polycomb group (PcG) proteins and HP1 (Zhang et al. 2008b) While PcG g roup genes are required for epigenetic blocking of IRER, the spatial characteristics of epigenetic regulation of IRER is rather different from that of canonical PcG mediated silencing of homeotic genes. The distribution of repressive histone marks and the binding of the PcG proteins are strictly limited t o IRER which is more than 2 kb away from t he basic promoter and coding region of reaper (Figure 4 1A ) Chromatin immunoprecipitation (ChIP) analysis with adult flies confirmed that repressive histone modi fications remain to be restricted to IRER The enrichment levels of H3K27me3 and H3K9me3 in the central part of IRER is comparable, or higher than, the respective positive control regions of Ubx promoter and H23 (Figure 4 1 B). The homeotic gene Ubx is sile nced by PRE mediated suppression in most cells in the adult and H23 is a pericenteremeric heterochromatin locus on the 2 nd chromosome. The levels of both repressive marks associated with IRER decrease significantly at the left

PAGE 114

114 boundary of IRER, approximate ly 2 to 5kb upstream of reaper transcription starting site (TSS) The restriction of the repressive histone marks H3K27me3 to IRER but not the reaper transcribed region and the immediate enhancer region was verified by independent ChIP S eq analysis in c ultured Drosophila S2 cells. Neither reaper nor hid is responsive to irradiation in the S2 cells (Lin et al, unpublished data). The distribution of the H3K27me3 upstream of the reaper locus resembles what we observed with adult flies (Figure 4 1 C). High re solution ChIP Seq analysis also verified that the reaper transcriptional start site is located as previously annotated and is enriched for H3K4me3 and engaged by RNA Polym erase II (Figure 4 1 C). Since the level of reaper expression is barely detectable in populations of S2 cells, most likely not expressed in most non dying S2 cells, the significant enrichment of H3K4me3 and Pol II binding indicate that similar to heat shock genes, reaper quick induction (Rougvie and Lis 1988; Zeitlinger et al. 2007) The restriction of repressive histone marks and heterochromatin formation to IRER but not the reaper promoter and coding region is functionally important. Although reaper is no longer responsive to irradiation in later stage embryos, it is expressed in late stage embryos and is required for eliminating obsolete neuroblasts (Peterson et al. 2002; Bello et al. 2003) Thus the restricted formation of heterochromatin in IRER but not other enhancer or coding regions of reaper is necessary for continued developmental expression of reaper while significantly tuning down its responsiveness to environmental stress. Since the transition of repres sive histone modifications was about 5kb upstream of reaper it is unlikely that the transition is simply due to the presence of the TSS and

PAGE 115

115 TSS associated histone modifications. Rather, we hypothesized that a chromatin boundary element is responsible for restricting the repressive histone marks from reaching the reaper promoter and the proximal enhancer regions. Verification and I dentification of the IRER Left B arrier (ILB) Due to the large size of the candidate region that needs to be tested, we develop which allows us to test barrier activity for DNA fragments up to 9 kb via either p insertion or phiC31 mediated docking (Figure 4 2A) In this construct, the compact 3xP3 DsRed reporter/marker gene gives strong DsRed (RFP) expression in the eye (Sheng et al. 1997; Bischof et al. 2007) The Polycomb Response Element (PRE) from the Ubx locus was placed upstream of the 3xP3 DsRed This PRE has been shown to function as a gene ral silencer that can initiate PcG mediated silencing in different loci (Chan et al. 1994; Sengupta et al. 2004) Restriction sites in between of the PRE and the reporter allow insertion of DNA fragments to be teste d for barrier activity. The inserted DNA fragment is flanked by two FRT sites to allow FLP mediated excision. Similar designs, with different (larger) reporter genes, have been used successfully to demonstrate that the Su(Hw)/ gypsy and other insulators can block PRE mediated silencing (Sigrist and Pirrotta 1997; Mallin et al. 1998) We reasoned that if the tested DNA sequence contains a barrier activity that is able to counteract the repressive effect of the PRE, t hen the DsRed reporter will be expressed and allow the recovering of insertion events. To test the feasibility of this approach, a 9kb fragment (ILF9kb; Chr 3L:18 391 265 18 399 880 D. melanogaster genome release 5) that covers from left side of IRER to t he reaper promoter, was cloned into in pBT1 (Figure 4 2 B) P mediate insertions were recovered by monitoring the 3xP3 DsRed e xpression in the adult eye (Figure 4 2C, left).

PAGE 116

116 The expression of DsRed suggests that the reporter gene was protected from PRE medi ated silencing by the inserted fragment. To verify that indeed the inserted fragment was responsible for blocking PRE mediated silencing, the transgenic lines were crossed to fly stain carrying ey FLP. This resulted in a great reduction of the DsRed signal in the eye, indicating that the reporter gene is been silenced/suppressed in the absence of ILF9kb (Figure 4 2C, right; Figure 4 3 ). The successful excision of ILF9kb in flies carrying ey FLP was v erified by PCR analysis (Figure 4 4 ). The level of DsRed e xpression was fully restored when ey FLP was crossed out (Figure 4 2C, top). Similar findings were confirmed with all of the 7 independent insertion lines, suggesting it is indepen dent of insertion site (Figure 4 3 ). All the evidence indicate that ILF9kb i s capable of blocking PRE mediated silencing effect of PRE from reaching the reporter gene. To locate the essential barrier element within the 9kb, and to rule out that the observed suppression of PRE mediated silencing was simply due to the length of th e fragment, we tested a series of DNA fragments within the ILB9kb region to narrow down the region that conta ins the barrier activity (Figure 4 2 B). In order to make the expression level comparable, the testing constructs for the sub fragments were inserte d into the same attP docking site on the 2 nd chromosome (line 9752; PBac{y[+] attP 3B}VK00037 ). The barrier activities of these fragments were initially screened based on the expression of the marker gene. Positive fragments were then verified by comparing the relative expression levels of the reporter in the abs ence or presence of ey FLP (Figure 4 2D, Table 4 1 and Table 4 2 ).

PAGE 117

117 To safeguard against false negatives due to problem associated with generating the transgenic insertion, the F 1 progeny of each in jection were verified by PCR analysis using a pair of primers flanking the two FRT sequences (Fig ure 4 5 A). This PCR analysis confirmed that the transgenic efficiency of the negative constructs were about the same as the posi tive ones (Figure 4 6 B and Tabl e 4 1 ). Some of the negative fragments from the original screen were further verified using a modified version of Barrier Tester 1. This construct, pBT3, contains a gypsy insulator flanked by two loxP sequences in between the PRE and the tested fragment (F igure 4 5 C). In the presence of the gypsy insulator, both BT3 ILF395bp and BT3 ILF1kb transgenic adults ha d similar DsRed expression levels in the eye. However, after the removal of gypsy insulator with Cre mediated recombination, BT3 ILF395bp lost the e ye expression of DsRed. In contrast, BT3 ILF1kb was not affected by the removal of gypsy (Figure 4 5 D). This indicates that without the gypsy element, only the ILF1kb, but not ILF395bp sequence, could counteract the silencing effect of PRE. Testing of pro gressively shorter fragments led to the identification of a 294bp fragment that ha d full barrier activity as compared to the original longer fragments. The barrier activity associated with this 294bp fragment i s orientation independent, as the barrier func tion was not affected when this sequence was inserted in a reversed orientation bet ween the reporter and PRE (Figure 4 2E). The expression of the reporter in the presence of ILF294bp and the almost complete diminishing of DsRed sign al in the absence of it strongly suggest that ILF294 functions as a chromatin barrier against PRE mediated silencing. However, one alternative explanation is that the tested ILF fragments contain a strong eye specific

PAGE 118

118 enhancer, and that the excision of this enhancer resulted in the down regulation of 3xP3 DsRed expression in the eye. To rule out this possibility, we replaced the PRE with a UAS sequence, and performed the sa me assay. As shown in Figure 4 7 excision of ILF294bp from UAS>ILF294bp>P3DsRed fly did not cause any reduc tion of DsRed signal, indicating that ILF294bp fragment does not have enhancer activity. With this validation, we are reasonably confident to conclude that there is a chromatin barrier activity within this 294bp sequence. We will hereby refer to this activ ity as IRER Left Barrier (ILB). Further verification indicated that most of the barrier activity resides in a smaller 167bp fragm ent (Figure 4 2 B). We will refer to these two fragments as ILB294 bp and ILB167 bp respectively. ILB P revents PRE Mediated T ra nscriptional Silencing of Nearby G enes QPCR verified that the diminishing of the DsRed signal following removal of the ILB containing fragments was due to transcriptional silencing of th e 3xP3 DsRed reporter gene (Figure 4 8A and B). Crossing the positive Barrier Tester lines with ey FLP reduced the level of DsRed mRNA to less than 10% of that of the original lines which carry one copy of the Barrier Tester. This reduction was largely independent of the insertion site since lines with different original ex pression level showed similar relative reduction following remove of the ILB containing sequence. Considering that ey FLP may not led to the excision of the tested ILB containing fragment in all eye disc cells, the level of mRNA reduction assayed by QPCR s uggest that the Ubx PRE is very efficient in silencing the transcription of the 3xP3 DsRed reporter gene. We noticed that for two of the p mediated insertion lines carrying PRE>ILF9kb>reporter, crossing with ey FLP not only led to suppression of the Ds Red signal in the eye, it also led t o eye ablation phenotype (Figure 4 8C and Figure 4 3 ).

PAGE 119

119 Using inverse PCR, we mapped one of the lines, 67 2, to about 400bp upstream of the gene corto with the 3xP3 DsRed at the proximal site and PRE at the distal site ( Figure 4 8 D). When the ILB containing sequence was excised by ey FLP, not only was the DsRed mRNA reduced to less than 10 percent of the original line, the level of the corto mRNA was also reduced to about 3 0% of the original level (Figure 4 8 E). The eye a blation phenotype associated with the removal of ILB is reminiscent to what was described for homozygous corto mutants (Kodjabachian et al. 1998) The more than 50% reduction of the corto mRNA seemed contradictory t o the fact that unlike the DsRed reporter, which only had one copy in cis with the PRE, there was another copy of corto on the homologous chromosome without the PRE. However, it has been shown that PRE mediated silencing can work in trans through homologou s pairing (Sigrist and Pirrotta 1997 ) and our observation with corto is in accordance with that. The combination of these evidences indicates that the Ubx PRE could silence multiple genes over a long range. However, the silencing is ef fectively blocked by the presence of ILB. ILB Prevent s the Propagation of H3K27 T rimethylation To understand the mechanism of ILB barrier activity, we examined the changes of chromatin structure at the reporter gene before and after the removal of the ILB. The ILB containing sequence in the transgenic line 47 2 was removed by germline recombination mediated by hs FLP and verified by PCR analysis (Fig ure 4 6 ). The flies without ILB showed complete loss of DsRed signal in the eye (Figure 4 9 A). Adult flies of the same age were collected for ChIP analysis. In t he absence of ILB, all of the four loci within the tester construct had high levels of H3K27me3 enrichment comparable to that of the Ubx PRE locus (Figure 4 9 B, ILB). In contrast, in the presence of the barrier

PAGE 120

120 sequence (+ILB), only the locus before ILB h ad high level of H3K27me3 while the P3 promoter and DsRed coding regions had significantly lower levels of the suppressive histone mark (Figure 4 9 C, +ILB). This indicates that ILB is capable of blocking PRE initiated propagation of H3K27me3. It has been shown in cHS4 that the barrier activity is mediated by formation of euchromatic histone marks that are incompatible with repressive histone marks at the barrier site. We first monitored the distribution of euchromatic marks in and around the endogenous I LB locus in later stage embryos in which the IRER is heavily methylated. We found that there are significantly higher levels of H3 acetylation at the ~300bp region encompassing ILB294bp (b1 & b2 loci in Figure 4 9 C) than the immediately adjacent regions ( 5k and 7k). Specifically, the levels of H3K9 and H3K27 acetylation in ILB is as high, or higher, than the positive control rp49 locus, respectively. Not surprisingly, the immediate right side of ILB ( 7k) has very low levels of histone H3 (K9 and K27) acety lation. However, the levels of H3 acetylations at ILB are also significantly higher than loci left to ILB (such as 5k). This is true not only for late stage embryos, but also for samples prepared from adult fly or the S2 cells. These observations strongly indicate that ILB is subject to specific histone acetylation activity. ILB Lacks E n hancer B locking A ctivity As aforementioned, all of the known Drosophila boundaries/insulators have enhancer blocking activity. To test the enhancer blocking activity of ILB we modified the Barrier Tester construct by replacing the PRE with the Upstrean Activation Sequen ce (UAS) (Figure 4 10 A). When a gypsy insulator was inserted between the UAS and the DsRed reporter, the interaction between UAS/GAL4 and the DsRed promoter was totally blocked as indicated by the absence of epidermal DsRed

PAGE 121

121 expression in the presence of the en Gal4 transgene (Figure 4 10 B, panel B and B When the gypsy insulator was removed in the presence of a copy of UAS FLP transgene, DsRed became express ed in the en grailed pattern (Figure 4 10B, panel C and C This validated that this constructs is sensitive and suitable for testing the enhancer blocking activity of insulators. However, no enhancer blocking activity was observed for the ILB294bp fragm ent. The insertion of ILB294 in between of the UAS and the reporter did not affect at all the expression of DsRed in engrailed pattern (Figure 4 10B, panel D ). To rule out the possibility that enhancer blocking components of ILB was missing or damaged in I LB294bp, we tested a 3.7kb fragment encompassing the ILB294. This much longer fragment failed to block the expression of DsRed in engrailed pattern although it was albeit weaker (Figure 4 10B, panel E) Given the length of the fragment, which is much longe r than the ~400bp gypsy insulator, we consider that this reduction of DsRed expression is likely due to the increased distance between UAS and the DsRed promoter rather than enhancer blocking activity. Cut B inds to ILB It has been reported recently that the Drosophila ortholog of CREB binding protein (dCBP or Nej) specifically acetylates H3K27 and antagonizes PcG mediated silencing (Tie et al. 200 9) The analysis of potential binding sites in the 167 bp ILB region identified a site that conforms to the V$CDP_02 matrix (TRANSFAC M00102) (Figure 4 11 A). The matrix was generated based on SELEX analysis using the human CCAAT displacement protein (CDP; HGNC: Cutl1(Cut like 1)) (Andres et al. 1994) CDP is the human orthologs of th e Drosophila Cut. CDP and Cut demonstrate exceptional conservation at sequence level and display s imilar DNA binding specificity (Neufeld et

PAGE 122

122 al. 1992) The Drosophila gene cut originally named according to the notched wing phenotype associated with hypom orph alleles, was later found to be an essential gene required for the proper development of a variety of distinct tissues and organs such as central and peripheral nervous systems, muscles, and ovarian follicle cells, etc. (reviewed in (Nepveu 2001) ). Although it has not been demonstrated for Cut CDP/Cutl1 interacts with CBP (Li et al. 2000) In order to verify whether Cut binds to ILB, we performed ChIP with a monoclonal antibody against Cut. In both S2 cells and the Adult fly, Cut specifically binds to ILB (Figure 4 11 B). We then carried out experiments to te st whether cut activity is required for ILB barrier function and whether the Cut bi nding site in ILB is essential. Indeed, a reducetion in DsRed singal was found in cut mutant ct C145 compared to wild type (Figure 4 11C). Therefore, Cut protein is required for ILB barrier activity through the direct interaction. ILB I s E volutionari ly C onserved The 167bp ILB sequence is highly conserved even in distantly related Drosophila species such as D. virilis and D. mojavensis both of which diverged from D. melanogas ter approximat ely 60 million years ago (Figure 4 12 A). To test whether the function of ILB is conserved, we extracted a 2kb D. pseudoobscura genomic sequence harboring the orthologous ILB167bp region and tested its activity in pBT1. We found that this orth ologous sequence have complete barrier activity in D. melanogaster (Figure 4 12 B) This indicates that ILB function existed before the separation of the two species about 40 million years ago and has not changed significantly ever since.

PAGE 123

123 Discu s sion and Fu ture Directions Eukaryotic genome s are compartmentalized with euchromatic regions juxtapose d with heterochromatic regions. Heterochromatic regions can be categorized into constitutive heterochromatin and facultat ive heterochromatin (Trojer and Reinberg 2007) Unlike constitutive heterochromatin which is consistent and rarely changes, facultative heterochromatic regions are subject to cell specific regulation and may adopt euchromatic formation in certain cells or under specific conditions What controls the formation for facultative heterochromatin is not fully understood However, heterochromatin has an intrinsic property to spread until its propa gation is blocked. For instance, PRE could recruit PRC2, which has the enzymatic activity to catalyze the formation of repressive histone mark H3K27me3 in the nearby chromatin. The formed H3K27me3 could in turn recruit PRC1 and PRC2 complex, which leads to the spread of the heterochromatin formation until this cyclic reaction is stopped by a barrier Several kinds of epigenomic landmarks, such as an active transcribing promoter or a strong enhancer, may serve as a nature barrier to the spread of heterochrom atin (Raab and Kamakaka 2010) Yet, under many circumstances specific boundary elements are needed to specifically demarcate the range of heterochromatin formation. Using a strategy that specifically testing barrier activity against PRE induced heterochromatin formation, we verified the existence of a chromatin barrier at the left boundary of IRER and narrowed it down to a 167bp DNA region. This boundary element is very efficient at b lock ing the spread of PRE initiated heterochromatin formation Similar to what was described for USF mediated chromatin barrier activity in the cHS4 insulator, ILB is associated with high acetylation of histone that is incompatible with the H3K27 trimethyl ation catalyzed by PcG repressive complexes. Unlike any previously

PAGE 124

124 identified boundary elements in Drosophila ILB does not display enhancer blocking activity. ILB a s A B arrier O nly Boundary E lement Although the barrier activity and enhancer blocking acti vity of the cHS4 insulator are mediated by distinct cis elements, these elements interpose with each other in close proximity. To our knowledge, ILB is the only boundary element that neither contains nor in close proximity to enhancer blocking activity. Th is distinction of ILB, although a little surprising, may suite well with the enhancer specific epigenetic regulation of IRER. IRER is an enhancer region that controls the stress responsiveness of not one, but three pro apoptotic genes located in the same synteny (Zhang et al. 2008b; Lin et al. 2009) This synteny contains four IAP antagonist genes, hid grim reaper and sickle which together are required for most development cell death as well as cell death in res ponse to a variety of environmental stimuli (Steller 2008) Coordinate expressio n of reaper and hid are observed during development and are required for eliminating o bsolete cells (Zhou et al. 1997) These two genes, and sickle are induced within 15 minutes following ionizing irradiation (Brodsky et al. 2004) When IRER is deleted, none of the three genes can be induced by irradiation (Zhang et al. 2008b) While IRER is required for the stress, it is not required for other aspects of transcriptional regulation, such as the expression of reaper in differentiate d motor neurons or neuroblasts (Bello et al. 2003; Rogulja Ortmann et al. 2008) Thus the formation of DNase I resistant heterochromatin at IRER serves specifically to block or down regulate the responsiveness of the three genes to environmental stress. However, at the same time, the basic promoter and other enhancer regions r emain open and the genes can still be expressed under other developmental control.

PAGE 125

125 A barrier only boundary may be necessary for this type of enhancer specific epigenetic regulation. Using a fluorescent reporter knocked into IRER via homologous recombi nation, we found that epigenetic blocking of IRER is dynamic and reversible. In specific cells of the developing larval imaginal disc, IRER could change from closed conformation (lack of reporter expression) to open conformation (high level reporter expres sion) following environmental stress such as heat shock, irradiation, or food deprivation. Consequently, cells with open IRER are sensitive to stress induced reaper / hid expression. When IRER is open, a boundary with enhancer blocking activity would have bl ocked the stress responsive enhancers in IRER to interact with the reaper promoter. Indeed, our earlier work has shown that several gypsy containing p and piggyBac insertions between IRER and the reaper promoter totally blocked irradiation induced reaper e xpression (Zhang et al. 2008b) A Novel Barrier E lement? In searching for the potential tr ans factors that is responsible for the barrier activity of ILB we checked the modENCODE database for the occupancy of all of the known Drosophila insulator/boundary associated proteins, including Su(Hw), CTCF, BEAF32, GAF, CP190 and Mod(mdg4) etc. Despite the fact that many data sets are available for a variety of tissues and cultured cells, there is no indication that any of these known insulator proteins is enriched in the vicinity of ILB294 bp.

PAGE 126

126 Figure 4 1. Formation of facultative heterochromatin was restricted to IRER and without reaching the reaper promoter and proximal enhancer regions. A ) Schematic diagram of the i ntergenic region between reaper and sickle IRER ( I rradiation r esponsive e nhancer r egion) is required for mediating irradiation induced expression of pro apoptotic genes reape r, hid and sickle (Zhang et al. 2008b) Accessibility of IRER is controlled by a PcG protein dependent mechanism, which forms an impermissive structure in irradiation resistant cells in post stage 12 embryos. The decrease of DNA accessibility, accompanied by enrichment of repressive histone ma rks and binding of PcG proteins, was specifically limited to the IRER (red box) without affecting the reaper promoter and proximal enhancer region (green box) (Zhang et al. 2008b) B ) Chromatin Immunoprecipit ation ( ChIP) assays performed with wild type adult fly tissue s Pericentromeric heterochromatin locus H23 (H23) and the Ubx promoter region (Ubx) were used as positive controls for repressive histone marks H3K9Me3 (blue) and H3K27Me3 (red) respectively The codi ng region of house keeping gene Act5C was used as a background control Enrichment of the repressive histone marks in IRER was normalized against respective positive controls and presented as Mean + Std. The high enrichment of both H3K27me3 and H3K9me3 in the central part of IRER drop s down significantly a t the left boundary of the IRER, about 2kb to 5kb relative to reaper TSS. C ) Distribution of histone marks H3K4me3, H3K27me3 and binding of Pol II in Drosophila S2 cells revealed by ChIP Seq which was p rovided laboratory in NIH The relative locations of reaper and sickle are indicated by blue arrows. The doted vertical lines denote the region that might possess putative chromatin barrier activity.

PAGE 127

127 Figure 4 2. Verificati on of barrier activity and narrowing down the IRER left barrier. A ) The B arrier Tester construct pBT1 Eye specific 3xP3 DsRed served as the reporter /marker The P olycomb Response Element (PRE) from Ubx promoter was placed upstream of the 3xP3 DsRed to ini tiate the formation facultative heterochromatin The test ed fragments (ILFs) were cloned in between of the reporter gene and PRE, and flanked by two FRT sequences. The transgenic flies we re generated by either P mediated insertion or C31 mediated integra tion. B ) A series of fragments within the IRER left boundary region were tested with the pBT1 vector for barr ier activity. The fragments with or without barrier activity are shown as red or black ba rs, respectively The essential barrier region was narrowe d down to the ILB167bp region C ) An example of verification of barrier activity The left and right panel s show the same group of flies under either the RFP fluorescence channel or bright field, respectively Transgenic line 47 2 carrying one copy of the pBT1 ILF9kb (>ILF9kb>; the fly head on the left) has strong eye specific DsRed signal, which was diminished when the IL F 9k b fragment was removed by crossing to ey FLP strain ( ey FLP; the fly head on the right) T he DsRed signal was fully restored w hen ey F LP was crossed out (top). D ) pBT1 constructs carrying sub fragments of ILF9kb were integrated to the same attP docking site on the 2 nd chromosome. Barrier activity was verified as aforementioned. The fly heads of the original transgenic strains are on the left, while the those also have ey FLP are on the right side of each panel. This series of testing indicated that the ILB167 fragment posses full barrier activity as compared to longer fragments. E ) The barrier activity was not affected when the ILB294bp f ragment was inserted into pBT1 with the reversed direction. Indicating ILB is orientation independent.

PAGE 128

128 Figure 4 2. Continued.

PAGE 129

129 Figure 4 3 The barrier activity in ILF9kb is independent on the insertion sites Seven independent P insertion lines were recovered for {PRE>ILF9kb>3xP3DsRed}. DsRed channel (bottom panels) and bright light channel (top panels) are shown for the same pair of flies. The one on the left is the original transgenic flies, and the one on the right also contains a copy of ey FLP tr ansgene. All of the seven lines showed decreased DsRed signal after the removal of ILF9kb by ey FLP. Two lines, 31 3 and 67 2, also showed eye ablation phenotype in the absence of the barrier.

PAGE 130

130 Figure 4 4. Example of PCR verification of somatic excisio n of ILF fragments A ) The primer set used for the PCR analysis is shown by the black arrows below the schematic structure of the transgene pBT1 ILF9kb. B ) In the presence of the 9kb barrier sequence, the PCR reaction failed to amplify the large amplicons. The progeny with ey FLP showed a 1.1kb PCR product, indicating successful somatic excision of the ILF9kb sequence.

PAGE 131

131 Figure 4 5. Verifying the tested fragments that did not demonstrate barrier activity in the original screen A ) and B ) PCR verification of the transformation events with BT1 ILF616bp DNA, from which no DsRed positive flies was recovered. The progeny from each individual vial were collected for genomic DNA extraction, and PCR analysis was performed with a pair of primers flanking the two F RT sequences ( A ). The genomic DNA from five out of ten tested vials showed PCR products around 1kb, indicating a ~50% transformation rate ( B ) These evidence indicate that the failure of recovering BT1 ILF616bp was not due to problem associated with transf ormation, rather it is due to the silencing of the report gene by PRE, in another word, the lack of barrier activity of the tested fragment. C) Some of the negative fragments were further verified with the reporter construct pBT3, which contains a gypsy el ement flanked by two loxP sequences in between of the PRE and the test DNA fragment. Transgenic gypsy element was performed by crossing the transgenic flies to a strain providing the source of Cre recombinase ( y w; Sco/CyO,crew1 ). ILF395b p was negative while ILF1kb tested positive in the original BT1 mediated assay. Both BT3 ILF395bp and BT3 ILF1kb transgenic files had similar level of DsRed in the presence of the gypsy insulator ( D + gypsy ). However, the level of DsRed in the BT3 ILF395bp line diminished after the excision of gypsy ( D left panel, gypsy ), indicating that the ILF395bp does not have barrier activity. In contrast, the excision of gypsy insulator from BT3 ILF1kb did not lead to any detectable decrease of DsRed signal ( D righ t panel, gypsy ), indicating ILF1kb is sufficient in blocking heterochromatin formation initiated by the PRE.

PAGE 132

132 Figure 4 5. Continued.

PAGE 133

133 Figure 4 6 PCR verification of the germline excision of ILF9kb from BT1 ILF9kb transgenic line 47 2 A ) The two pair s of primers are presented by black and red arrows below the schematic map of the transgene. The ILF9kb sequence was removed by germline excision with hs FLP. B ) The original transgenic flies showed a 400bp PCR band with a1+a2 primers (lane 1), but not wit h the two primers b1+b2 flanking the 9kb barrier sequence (lane 3). When the ILF9kb barrier was completely removed from the genome, b1+b2 primers produced a 650bp amplicon (lane4), while PCR with a1+a2 primers failed (lane3).

PAGE 134

134 Figure 4 7. ILB294bp does n ot have eye specific enhancer activity Transgenic lines carrying BT1 ILB294bp (PRE>ILB294bp>P3DsRed) or IT1 ILB294bp (UAS>ILB294bp>P3DsRed) were crossed to flies carrying ey FLP. The BT1 ILB294 transformant line showed a significant reduction of DsRed sig nal after the somatic excision mediated by ey FLP. In contrast, flies carrying IT ILB294bp had little change after crossing with ey FLP. This indicates that there is no eye specific enhancer activity associated with the 294bp fragment. The reduction of DsR ed expression following removal of ILB is due to PRE mediated silencing of P3DsRed.

PAGE 135

135 Figure 4 8 ILB prevents transcriptional silencing mediated by PRE. A ) and B ) The mRNA level of the 3xP3 DsRed reporter gene, detected by QPCR, was significantly reduced after the excision of the ILB containing fragments by ey FLP. BT1 ILF9kb transgenic lines 47 2 and 67 2 were generated by P insertions ( A ), while the BT1 ILF1kb and BT1 ILB294bp lines were generated mediated integration ( B ). C ) When crossed to e y FLP, in addition to decreased DsRed signal, the BT1 ILF9kb transgenic line 67 2 showed eye ablation phenotype similar to the corto mutant. D ) inverse PCR identified that the transgene BT1 ILF9kb in line 67 2 was inserted about 400bp upstream of the gene corto by P insertion. E ) For Line 67 2, the level of corto expression was significantly reduced to less than 50% of the original level after the excision of IL F9kb by ey FLP

PAGE 136

136 Figure 4 8. Continued.

PAGE 137

137 Figure 4 9 ILB blocks the propagation of repressive histone mark initiated by PRE. A ) hs FLP was used to remove the ILB containing fragment through germline recombination. No DsRed signal was detectable in the resulti ng PRE>3xP3 DsRed fly ( ILB). B ) The enrichment of H3K27me3 in and around the reporter gen e before (+ILB) and after ( ILB) the removal of ILB via germline recombination. Targeted loci for primer pairs for the ChIP assays are indicated by black bars below the schematic map of the transgene. Removal of ILB led to significant enrichment of H3K27me 3 in the reporter gene loci P3, DsR1, and DsR2 (* p<0.05, # p= 0.06847 ). Note the level of H3K27me3 remains about the same for the PRE FRT locus, which is not shielded by ILB. C ) Higher levels of histone H3 acetylation at the barrier site. The ILB294bp regi on (b1 and b2, approximately 6k from the reaper TSS) has significantly higher level of H3 acetylation compared to the surrounding region. Specifically, both H3K9 and H3K27 are hyper acetylated in the ILB294 region. ChIP were performed with late stage embr yo (H3Ac & H3K9Ac), S2 cells (H3K27Ac) and adult flies (H3K27Ac). Data were normalized against the recovery rate for the rp49 locus before statistical analysis.

PAGE 138

138 Figure 4 9 Continued.

PAGE 139

139 Figure 4 10 The IRER left barrier does not contain enhancer block ing activity. A ) The reporter construct pIT1 was used to test the enhancer blocking activity. DNA fragments, flanked by FRT, were inserted in between of a UAS sequence and the 3xP3 DsRed reporter. Transgenic fly carrying pIT1 can be crossed to an engrailed ( en ) GAL4, UAS GFP strain. B) If the DNA fragment has enhancer blocking activity, such as the gyps y insulator, DsRed cannot be expressed in engrailed pattern ) is GFP channel of the same larval representing expression of en Gal4.) When the g ypsy insulator was removed by FLP, DsRed was expressed in the same engrailed pattern as the GFP. D) With this testing scheme, the ILB294bp barrier element, which had the complete barrier activity, did not display any detecta ble enhancer blocking activity. E) Even a 3.7kb fragment encompassing ILB167 failed to block the expression of DsRed in engrailed pattern

PAGE 140

140 Figure 4 11 Cut is required for the ILB barrier activity. A ) Sequence of the ILB167bp fragment that contains a putative CDP/Cut binding site (la rge font capital letters). The logo representation of the V$CDP_02 matrix was aligned on the bottom, which contains a palindromic ATCGAT motif (highlighted in red in the corresponding putative binding site) overlapping with the homeodomain binding motif AT TA (italic sequence). B ) Cut protein was highly enriched in the 300bp region encompassing ILB294bp (b1 and b2) as shown by ChIP analysis in both S2 cells and adult flies. C) BT1 ILB294bp homozygous females were crossed to either w 1118 males or ct C145 males and the DsRed levels of their female progeny (aged for two days) were shown. A decreased DsRed level was found in ct C145 compared to wt.

PAGE 141

141 Figure 4 11. Continued.

PAGE 142

142 Figure 4 12 ILB is evolutionally conserved. A ) The orthologous sequence s of the ILB294 bp region in 5 Drosophila species were aligned using CLUSTAL_X The 167bp essential barrier sequence (the black line) contains a highly conserved long AT rich stretch. B ) The 2kb D. pseudoobscura genomic sequence encompass ing the ILB294bp orthologous regio n (pseILB) displayed similar level of barrier activity in D. melanogaster as the native ILB The transgenic flies were generated by mediated integration.

PAGE 143

143 T able 4 1. Transformant lines Vectors Test fragments attP lines Cross number (vials) Recovery number (vials) Recovery rate DsRed intensity ** BT1 ILF3kb 9752 26 0 0% -ILF4.2kb 9752 20 6 30% ++ ILF3.7kb 9752 22 11 50% ++ ILF2kb 9752 22 14 63.6% ++ ILF1kb 9752 26 13 50% ++ ILF319bp 9752 13 0 0% -ILF616bp 9752 28 0 0% -ILB294bp 9752 17 3 17.6% ++ ILB167bp 9752 22 7 31.8% ++ pseILB 9752 24 10 41.7% ++ ILB294bp_r 9724 18 1 5.6% ++++ BT3 ILF1kb 9752 15 3 20% ++ ILF395bp 9752 23 10 43.5% ++ IT1 Su(Hw)BR 9752 11 5 45% ++ ILF3.7kb 9752 22 5 22.7% ++ ILF3.7kb 9724 13 4 30% ++++ ILB294bp 9724 12 5 41.7% ++++ The numbers of vials containing at least one DsRed positive flies were counted. ** In heter ozygous flies, two weeks after eclosure

PAGE 144

144 Table 4 2. BT1 ILB9kb transgenic lines Individual lines DsRed intensity DsRed intensity after barrier excision Homozygous lethality Chromosome mapping Insertion sites 31 3 +++ + ** Lethal Chromosome 2 N/A 47 2 ++++ ++ Lethal Chromosome 3 Chr 3R: 27763042 63 2 +++ + Viable Chromosome X Chr X: 12648036 67 1 +++++ +++ Lethal Chromosome 3 N/A 67 2 ++++ + ** Lethal Chromosome 3 Chr 3R:912,861 69 1 ++ + Viable Chromosome 2 Chr 2R: 16146045 79 1 +++ + Viable Ch romosome 2 N/A In heterozygous flies, 5 days after eclosure. **Some flies had eye ablation phenotype together with reduced DsRed fluorescence.

PAGE 145

145 CHAPTER 5 PERSPECTIVES Non Canonical Epigenetic Regulation of IRER In this study we showed that the irradi ation responsiveness of reaper and hid is subject to epigenetic regulation during development. To our knowledge, this is the first evidence that epigenetic modification controls the expre ssion of a pro apoptotic gene. The epigenetic regulation of the Irrad iation Responsive Enhancer Region (IRER) is fundamentally different from the silencing of homeotic genes in that the change of DNA accessibility is limited to the enhancer region with the p romoter region remaining open. Thus, it seems more appropriate to r silencing of the gene. Much effort has been devoted to understand the transcriptional regulation of reaper Almost all of these studies used transgenic flies carrying reporter constructs inserted into d ifferent (mostly unidentified) chromosomal locations (Brodsky et al. 2000; Jiang et al. 2000) The cargo size limitation of the P element mediated transgenic technology constrained these analyses to the immediate up stream promoter /enhancer region, with the longest reporter construct containing about 11 kb upstream from the reaper identification of an ecdysone responsive element as well as a P53 responsive element (Brodsky et al. 2000; Jiang et al. 2000) However, there are many discrepancies between the transcriptional regulation of the reporter gene and the endogenous reaper gene. While only a few c ells in the post stage 12 embryonic nervous system can be detected as having reaper expression by ISH, the reporter constructs gave extensive expression patterns after stage 12 (Nordstrom et al. 1996; Lohmann 2003) There are

PAGE 146

146 also many seemingly conflicting observations in regard to the role of DmP53 in mediating DNA damage ( ray) induced reaper expression. Like its mammalian orthologs, DmP53 has been implicated in mediating ionizing irradiation induced cell death (Brodsky et al. 2000; Jin et al. 2000; Ollmann et al. 2000; Sogame et al. 2003) In DmP53 mutant flies, ionizing irradiation induced apoptosis in the wing imaginal discs is greatly reduced, and ray induced expressi on of reaper in the embryo is blocked (Lee et al. 2003; Sogame et al. 2003) However, over expression of the DmP53 gene in many tissues failed to induce reaper expression or significantly increase the sensitivity to ray induced cell death. A reporter construct containing the putative reaper P53RE in front of a hsp70 promoter is responsive to ray, but it remains responsive to irradiation even in stage 16/17 embryos (over 15 hr AEL) long after the endogenous gene l ost its responsiveness (Qi et al. 2004) This strongly indicates that the sensitive to resistant transition is not due to a vailability or activation of DmP53. In light of our data presented here, the discrepancies between the transcriptional regulation of the reporter genes and the endogenous reaper are due to the epi genetic silencing of the IRER. This region, containing the p utative P53RE and other essential enhancer elements, is required for mediat ing irradiation responsiveness. Our ChIP analysis indicates that histones in this enhancer region are quickly trimethylated at both H3K9 and H3K27 at the sensitive to resistant tran sition period, accompanied by a significant decrease in DNA accessibility. DNA accessibility in the putative P53RE locus (18,368k), when measured by the DNase I sensitivity assay, did not show significant decrease until someti me after the transition period It is possible that other enhancer elements, in the core of IRER_left that is quickly transformed into the DNase I resistant

PAGE 147

147 structure, are also required for radiation responsiveness. Alternatively, it could be that the strong and rapid trimethylation of H3K27 and association of PRC1 at 18,366 368 are sufficient to disrupt DmP53 binding and/or interaction with the Pol II complex even though the region remains relative ly sensitive to DNase I. Eventually, the whole IRER is closed with the exception of an op en island around 18,387. Coordinated R egulation of hid and reaper A surprising outcome of this study is that the IRER upstream of the reaper locus is also required for ray responsiveness of hid (Figure 2 6). It has been shown that hid and reaper hav e different expression patterns during embryogenesis. There is a significant temporal and spatial overlap in the expression of these two genes, especially in cells destined to die during embryogenesis. For example, both genes are expressed in the CNS midli ne cells before the onset of developmental cell death, and the function of hid as well as reaper are required for the proper cell death pattern of these cells (Zhou et al. 1997) However, there are also significant differences in the transcriptional regulation of these two genes. In the later stage (stage 12 16) embryos, there is still a significant number of cells expressing hid Many of these hid expressing cells do not seem to be destined for elimination and remain till the end of embryogenesis, presumably because the pro apoptotic function of the Hid protein is also subject to post translational modifications (Bergmann et al. 1998a) In contrast, there are only a few scattered cells in the central nervous system expressing reaper in post stage 14 embryos. Despite the appa rent difference in expression pattern and the fact that the two genes are more than 200 kb apart, there is a remarkable synchronicity in terms of their

PAGE 148

148 responsiveness to irradiation Both genes are responsive to ray between stage 6 and stage 11. The resp onsiveness of both genes is lost in germ band retracting/retracted embryos. In our analysis of the Su(z)12, Hdac, and Su(v)3 9 mutants affecting the epigenetic silencing of the IRER, whenever a mutant allele delayed the sensitive to resistant transition of one gene, it affects the sensitivity transition of the o ther gene to a similar degree. In the Df(IRER) mutant, responsiveness of hid to irradiation is lost together with that of reaper This indicates that the IRER is also responsible for mediating ray responsiveness of hid To achieve this, there has to be a formation of higher order chromosome configuration (looping) to bring the IRER to the proximity of the hid promoter r egion. Such higher order DNA/chromatin complex has been noticed in mammalian syst ems as documented by 3C (Chromosome Conformation Capture) assays (Tolhuis et al. 2002) (Dekker et al. 2002) The formation of the higher order chromatin complex seems to require elements reside between R4 and R6, as the hid responsiveness i s blocked in Df(IRER_right) even though reaper remains responsive. The detailed mechanism of such an arrangement remains to be studied. Differentiation Stage Specific S ensitivity to Irradiation Induced Cell Death The developmental consequence of epige netic regulation of the IRER is the tuning down (off) of the responsiveness of the pro apoptotic genes, and thus decreasing cellular sensitivity to stres ses such as DNA damage (Figure 2 10G). Epigenetic silencing of the IRER, and the sensitive to resistant transition, happens at a time (7 9 hr AEL) corresponding to the end of major mitotic waves when most cells begin to differentiate (Foe et al. 1993) It is interesting to note that differentiation stage specific sensitivity to irradiation has long bee n noticed in mammalian systems. For instance,

PAGE 149

149 proliferating neural precursor cells are extremely sensitive to irradiation induced cell deat h while differentiating/differentiated neurons become resistant to ray irradiation (Mizumatsu et al. 2003) even though the same level of DNA damage was inflicted by the irradiation (Nowak et al. 2006) Our findings here suggest that such a dramatic transition of radiation sensitivity accompanying cellular differentiation could be achieved by epigenetic blocking of sensitizing enhancers of pro apoptotic genes (Figure 2 10G ). The responsiveness of reaper to irradiation and its role in mediating irradiation induced cell death was noticed upon its initial identification (White et al. 1994) Interestingly, the irradiation responsiveness appears to be a highly conserved feature of reaper like IAP antagonists. A recently identified functional ortholog of reaper in mosquito genomes michelob_x ( mx ), was also responsive to irradiation (Zhou et al. 2005) Mosquitoes ( Aedes and Anophel es ) were separated from Drosophila around 250 million years ago. The resemblance between Mx and Reaper/Hid at the protein sequence level is so low that it could not be identified by a routi ne sequence similarity search. The conservation of irradiation resp onsiveness highlighted that stress responsiveness is an essential aspect of functional regulation of upstream pro apoptotic genes such as reaper / hid It is also worth mentioning that several mammalian BH3 domain only proteins, the upstream pro apoptotic re gulators of the Bcl 2/Ced 9 pathway, are also regulated at the transcriptional level. BH3 only genes such as puma are induced upon irradiation and required for mediating irradiation induced cell death in developing nervous systems as well as hematopoietic cells (Nakano and Vousden 2001; Villunger et al. 2003)

PAGE 150

150 Later in Drosophila development, around the time of pupae formation, the organism becomes sensitive to irradiation again, with LD50 values similar to what was observed for the 4 7 hr AEL embryos (Ashburner 1989) Interestingly, it has also been found that during this period, the highly proliferative imaginal discs are sensitive to irradiation induced apoptosis, which is mediated by th e induction of reaper and hid through P53 and Chk2 (Brodsky et al. 2004) The ability for UV irradiation to induce hid in eye imaginal discs appears to be limited to a small time window corresponding to the early highly proliferative period of imaginal disc development and differentiation (Jassim et al. 2003 ) After this short window, irradiation can no longer induce apoptosis. Our finding here suggests that the sensitive to resistant transition could very well be achieved by epi genetic regulation of the IRER. However, it remains to be studied as whether th e reemergence of sensitive tissue is due to the reversal of the epigenetic blocking in IRER or the proliferation of undifferentiated stem cells that have an unblocked IRER. The finding that epigenetic regulation of enhancer region of pro apoptotic gene co ntrols sensitivity to irradiation induced cell death may have implications in clinical applications involving ionizing irradiation. It suggests that applying drugs that modulate epigenetic silencing may help increase the efficacy of radiation therapy. It a lso remains to be seen as to whether the hyper sensitivity of some tumors to irradiation is due to the de differentiation and reversal of epigen etic blocking in cancer cells. On the other hand, loss of proper stress response to cellular damage is implicate d in tumorigenesis (reviewed by (Baylin and Ohm 2006) The fact that the formation of heterochromatin in the sensitizing enhancer region of pro apoptotic genes is sufficient to convey resistance

PAGE 151

151 to stress induced cell death suggests it could contribut e to tumorigenesis. In addition, it could also be the underlying mechanism of tumor cells evading i rradiation induced cell death. This is a likely scenario given that it has been well documented that oncogenes such as Rb (Narita et al. 2003; Ait Si Ali et al. 2004) and PML RAR fusion protein (Carbone et al. 2006) cause the formation of heterochromatin through recruiting a human ortholog of Su(v)3 9. In this regard, the reaper locus, especially the IRER, provides an excellent genetic model system for dissecting the cis and trans acting mechanisms controlling the formation of heterochromatin associated with cellular differentiation and tumorigenesis. A Non C a nonic al Epigenetic Silencing The blocking of IRER differs fundamentally with the silencing of home otic genes in several aspects. First, the change of DNA accessibility and histone modification is largely l imited to the enhancer region. The promoter regions of reaper (and hid ) remain open, allowing the gene to be responsive to other stimuli. Indeed, there are a few cells in the central nervous system that could be detected as expressing reaper long after the sen sitive to resistant transition. Even more cells in the late stage embryo can be found having hid expression. Yet, the irradiation responsiveness of the two genes is completely suppressed in most if not all cells, transforming the tissues into radiation resistant state. Secondly, the histone modificat ion of IRER has a mixture of features associated with pericentromeric heterochromatin formation and the ca nonic PcG mediated silencing. Both H3K9 and H3K27 are trimethylated wi th a large overlapping region. Both HP1, the signature binding protein of the p ericentromeric heterochromatin, a nd the PRC1 are bound to IRER. As demonstrated by genetic analysis, the function of both

PAGE 152

152 Su(var)3 9 and Su(z) 12/Pc a re required for the silencing. However, despite the enrichment of trimethylated H3K27 in IRER, we did not observe significant delay of sensitive to resistant switch in several E(Z) mutant alleles. When analyzed with the most updated PRE identification software (Fiedler and Rehmsmeier 2006) only a sub optimal match was identified around 18,370 371. However, binding of Pc or Psc to this region is about the same as other IRER regions (Data no t shown). The fact that none of the mutants tested could completely block the transition seems to suggest that there is a redundancy of the two pathw ays in modifying/blocking IRER. It is also possible that the genes we tested are not the key regulator of I RER blocking but only have par ticipatory role in the process. Needless to say, the detailed me chanisms await to be explored. The uniqueness of this epigenetic regulation warrants an unbiased screen for key regulators of this process. In addition, there i s n o clear Polycomb Response element ( PRE ) can be predicted in or around IRER u sing the algorithm developed by Ringrose group based on GAGA factor, PHO and Zeste binding motifs (Fiedler and Rehmsmeier 2006; Ringrose and Paro 2007) However, the ChIP based genome wide study of PcG binding sites did not correspond well with the predicted sites (Schwartz et al. 2006) suggesting that additional criteria are necessary to predict most PREs reliably. Moreover, t he binding pattern of several PcG proteins to IRER also differs from the pattern observed for homeotic genes such as Ub x where the PcG proteins are tightly associated with their PREs, usually relative small regions of several hundred base pairs (Schwartz et al. 2006) Here in IRER, we found the enrichment of PSC, PC and E(z) across a large chromatin region of more than 30kb (Figu re 2 9) similar to the distribution of

PAGE 153

153 H3K27me3 This scenario resembles the distribution pattern s of PcG in mammals in which PRC2 association to chromatin follows the distribution of H3K27me3 on most of target genes (Hansen et al. 2008) This suggests that the mechanisms of the PcG initiation and maintenance between Drosophila and mammals might share more features than people have thought. The observations in IRER{ubi DsRed} reporter strain indicate that the epi genetic regulation is not cell lineage dependent. For instances, in male third instar larvae, a group of cells at the apex of the testis disc, where the male GSCs usually reside, exhibit a much brighter DsRed signal than any other tissues (Figure 3 8 A and B). Whereas DsRed signal is turned o ff in the progenies of GSC, such as the spermatocytes that situated just posterior to the GSCs. This is somehow distict from the role of PcG silencing as the epigenetic memory of cell identity (Bantignies and Cavalli 2006; Ringrose and Paro 2007) although dynamic regulation of PcG proteins has previously been reported (Bantignies and Cavalli 2006) Finally, w ithin the IRER, there is a small region around 18,387 (1 8,386k 388k) that remains relatively open till the end of embryogenesis (Figure 2 7 A). Interestingly, this open region is flanked by two putative non coding RNA transcripts represented by EST sequences, RE73107 (3L : 18,383 379 ) and RE07245 (3L : 18,388 392) If they are indeed transcribed in the embryo as suggested by the mRNA source of the cDNA their shared enhancer region. Sequences of both cDNAs revealed that there is no intron or reput able open rea ding frame in either sequence. Despite repeated efforts, we were not able to confirm their e xpression via ISH or Northern. Over expression of either cDNA using an

PAGE 154

154 expression construct also failed to show any effect on reaper/hid i nduced cell d eath in S2 cells. Yet, sections of the two non coding RNAs are strongly conserved in divergent Drosophil a genomes. The potential role of these two non coding RNAs in mediating reaper/hid expression and/or blocking of the IRER remains to be studied. In orde r to fully understand this kind of non canonical epigenetic mechanism, we will try to answer the following questions: 1) which cis elements are responsible for initiating and setting up the boundary of chromatin modification in IRER? We already knew the an swer to the second question, and the results were discussed in detail in Chapter 4; 2) what are the chromatin modulators responsible for histone modification in IRER? 3) W hat looping structure enables IRER to interact with hid ? These studies will contribut e to our knowledge of sophisticated regulation of apoptosis during normal development and under stress condition. Functional Significance of the Epigenetic Regulation of IRER A paramount of evidence suggests that when cell death (apoptosis) occurs in res ponse to cytotoxic stimuli such as ionizing irradiation, it is often mediated through the transcriptional activation of upstream cell death regulators involving transcription factors such as P53 (Zhou et al. 2003) However, this does not explain why there is dramatic d ifference among tissues and cell types in their sensitivity to irradiation induced cell death. First the sensitive to resistant transition for the induction of pro apoptotic genes is unlikely due to the unavailability of DmP53, since it is ubiquitously ex pressed throughout the whole embryogenesis (Jin et al. 2000) In addition, DmP53 mediated DNA repair genes ku70 and ku80 remain responsive to irradiation in both sensitive and resistant stage embryos. Fur thermore, over expression of DmP53 failed to induce

PAGE 155

155 reaper expression or apoptosis in resistant stage embryos. All of the evidence suggests that DmP53 alone is not sufficient to determine cellular sensitivity to DNA damage. Our study in Chapter 2 showed t hat the epigenetic status of the IRER enhancer region determined the embryonic sensitivity to ionizing radiation induced cell death. Around stage 12, this region forms a heterochromatin like structure that is inaccessible to DNase I, accompanied with the e nrichment of repressive chromatin marks, such as H3K27me3 and H3K9me3 and the binding of HP1 and Polycomb group proteins (Zhang et al. 2008a) The resistence to irradiation at the later stages is likely due to the inaccessibility of the IRER to some upstream transcription factors, such as DmP53, wh ich otherwise bind s to the P53RE within the IRER. Indeed, a recent study showed that some p53 target genes could be silenced by E4 ORF3, a small adenovirus protein, through de novo H3K9me3 heterochromatin formation upon the virus infection. This epigenetic silencing of p53 target genes prevented p53 DNA binding, and is irrespective of p53 phosphorylation and stabilization (Soria et al. 2010) Therefore, the epigenetic mechanism in transcriptional regulation of stress induced genes might be evolutionally conserved. Besides its role in regulating the ionizting radiation induced cell death, the IRER might also be required for modulating the cell death resulting from the developmental stresses, such as cell competition fo r growth factors. Indeed, we found the down regulation of reaper expression in the IRER deletion mutants in the segmental strips where the cell competition induced cell death happens (Figure 3 4). This suggests that IRER is also involved in the apoptosis d uring the normal development.

PAGE 156

156 By investigating the expression pattern of the IRER{ubi DsRed} reporter, we will be abel to know when and in which cells is IRER open/closed And our cell sorting data showed that the accessibility of IRER can reflect the cel lular sensitivity to stress induced cell death. It will be intriguing to know whether IRER is specifically open in mitotic cells, such as the cells in the early stage embryos. Our preliminary data suggest that the openness of IRER could be quite dynamic up on various environmental stimuli, such as irradiation, heat shock and starvation. To our knowledge, this is the first established system for in vivo mornitoring the chromatin structure of a genomic region in single cell resolution during developmental proc ess or under stress conditions. This will greatly A Novel Chromatin Barrier Element ILB Delimits the Ehancer Specific Epigenetic Regulation without Blockign the Enhancer Function Euka ryotic genome is composed of two types of functional compartments euchromatin and heterochromatin, usually juxtaposed to each other. The regions of DNA packed into heterochromatin are found in two varieties: constitutive heterochromatin and facultative he terochromatin, the distinction lies in the inconsistency of the latter form in different cell types within a species. T he formation of heterochromatin is launched by the initiating elements bound by repressor proteins which recruit enzymes that modify the chromatin to create binding sites for these repressor proteins, leading to the recruitment of these proteins and the subsequent spread of heterochromatin over several hundreds of kilobase pairs (Raab and Kamakaka 2010) Chromatin barrier is defined as a type of DNA elements that can block the self propagation of heterochromatin into the neighboring regions.

PAGE 157

157 An Efficient Barrier Testing Strategy The traditional chromatin barrier assay in Drosophila is to test the ability of the candidate barrier sequences to protect a reporter gene, usually a mini white gene flanked by two insulators/barriers, against the position effect when randomly inserted into the genome (Kellum and Schedl 1991) However, there are three problems with this system. First, generating a relatively large amount of tr ansformant lines for each recombinated DNA is necessary for statistic analysis of the eye color variation with or without the flanking insulators/barriers. Secondly, not only the difference of chromatin accessibility at the insertion loci, but also the pro ximity of an enhancer can result in position effect variation (Weiler and Wakimoto 1995) So both enhancer blocking and barrier activities of a tested DNA may attribute to the protection against the variation. In addition, insertions of an unprotected reporter gene within a closed genomic region will not be recovered due to the complete heterochromatin silencing, so comparison between the protected and unprotected transgenes based on the variation of eye color could be misl eading. Using a modified version of the previously described reporter construct (Sigrist and Pirrotta 1997) by testing the ability to prevent the heterochromatin spread initiated by a PRE, we identified a chromatin barrier element ILB ( chr 3L: 18,397, 175 18,397,341 ) at the transition regio n between the permissive reaper promoter and the highly condensed IRER enhancer region in adult flies. One advantage of this strategy comparing to the traditional assay is that only the barrier activity will be detected, but not the enhancer blocking activ ity. Another merit of this barrier testing vector is that it contains two P elements and an attB integration sequence, thus t he transgenic flies could be generated by either P element mediated insertion or system

PAGE 158

158 common genomic locus, the efficiency of different candidate barrier sequences could be compared directly based on the levels of eye specific expressed DsRed without worrying the position effect, therefore it is not necessary to screen and keep numerous transgenic lines. A Novel Chromatin Berrier Lacking the Enhancer Blocking Activity The ILB barrier does not contain the enhancer blocking activity because it did not interrupt the interaction between the DsRed promot er and UAS/GAL4 enhancer. This is the first pure chromatin barrier identified in Drosophila as all the currently known Drosophila insulator/boundary elements are also enhancer blockers. In vertebrates, although the barrier and enhancer blocking activities can be separated as in the case of chicken HS4 insulator, the cis elements responsible for these two activities are intertwined and localized in a relatively small region. However, the situation in ILB region is different from this functional complex. Fir st, ILB barrier resides in between of the reaper promoter and IRER enhancer region, any endogenous enhancer blocking activity in the transition region would prevent the IRER from activating the transcription of reaper gene. Indeed, our previous study showe d that P or piggyBac transposons containing a gypsy insulator inserted b etween IRER and the reaper promoter completely blocked the irradiation responsiveness of reaper in early embryos (Zhang et al. 2008b) This rul ed out the possibility of the existence of enhancer blockers within this region. More importantly, here we showed that ILB294bp and the larger 3.7kb fragment did not block the interaction between DsRed promoter and UAS/GAL4 enhancer complex in a reporter a ssay, while the interaction could be blocked by the gypsy insulator. Therefore, the evolutionally conserved ILB barrier probably represents a novel

PAGE 159

159 type of standalone cis elements that maintain the distinct chromatin domain by blocking the spreading of het erochromatin, but do not disrupt the enhancer/promoter interaction. None of the known Drosophila insulator/boundary associated proteins showing strong enrichment in the essential ILB167bp barrier region confirmed its distinction from these known cis eleme nts Mutagenesis of the AT rich region that resembles the mammalian SATB1 binding site did not affect the barrier function, suggesting the barrier may function through a different mechanism from MARs mediated PEV blocking activity (Girard et al. 1998; Nabirochkin et al. 1998) Isolating and characterizing the ILB associated trans factor(s) will certainly promote the understanding of its underlying mechanism, and will also facilitate the identification of more of thi s type of standalone barrier elements. Our previous work showed that the epigenetic blocking of IRER enhancer region ( chr 3L: 18, 393,577 18,426,702) controls the sensitivity to the irradiation induced apoptosis during embryogenesis (Zhang et al. 2008b) Our recent findings suggest that this epigenetic regulation could be quite dynamic upon exogenous or developmental stresses. By inserting a DsRed reporter gene into the middle of IRER region to monitor the real time chromatin structure of this region, we found an increased DsRed signals in the larvae imaginal discs after irradiation (unpublished data). Also, the IRER region seems to be able to sense the calorie restriction and other stresses by altering the chromatin accessibility (unpublished data). In this study we showed that the ILB barrier at the left boundary of IRER protects the permissive reaper promoter from epigenetic silencing by restraining the propagation of the facultative heterochromatin initiated by the unknown initiating element(s) within the IRER. The pure barrier activity may be

PAGE 160

160 critical for the dynamic epigenetic regulation of IRER by delimiting the particular silenced domain in the enhancer region while allowing the enhancer function on the promoter when the silencing is withdrawn upon stress. Considering its unique role, it will be of great interest to see whether similar standalone chromatin barriers exist in other genomic.

PAGE 161

1 61 APPENDIX THE PRIMERS USED FOR QPCR IN CHIP EXPERIM ENTS Act5C: CACGGTATC GTGACCAACTG, GCCATCTCCTGCTCAAAGTC H23: CCAAGTTGGCCAGTTTTGAT, AGTTCAAGCCCGGGTATTCT Ubx: GCCATAACGGCAGAACCAAAG, ATGAGGCCATCTCAGTCGC pro: GCGATGGTTGCTTTTCAACT, TGGCAACAACAACACAACCT 2k: GTGCGTCTCAAGTGTTTCCA, CGAAAGCAGACCCAAAACAT 3k: TGGGAAGTGTGTCAATCGAA, CGC AAGTTATCGCATTGTTG 5k: TTTTCGGAATGGGTTTTCAG, ACACACACGAACCGAATGAA 8k: GAGCTGGGTGATTTGTGGTT, CAACAATTTGAGCAGGAGCA 11k: CCATCCACAGGAACTGGACT, GGCAAGTCCCCAGACATTTA 14k: AGCAGCATCCTGACTGTCCT, CGCTTGGTTGAAATTTGGTT 19k: TTGGGCCCCTTTTAAATACC, AAAAACCGGAGCCTAA AGGA 27k: TACCAACTCGGTCCTTCCAC, TTCTGCACCCATTCTCCTCT PRE FRT: GATAGGACTACGCGCACCAT, CACTGTTCACGTCGCAAGAT P3: TCAATTAGGATCCAAGCTTATCG, TGTTCAGCTGCGCTTGTTTA DsR1: GCAGGATGGCTGTTTCATCT, AATGACCACCGTCTTTCAGC DsR2: GAAGCTGAAAGACGGTGGTC, CGTCCCTCGGTTCTTTCATA

PAGE 162

162 LIST OF REFERENCES Abrams JM, White K, Fessler LI, Steller H. 1993. Programmed cell death during Drosophila embryogenesis. Development 117 : 29 43. Ait Si Ali S, Guasconi V, Fritsch L, Yahi H, Sekhri R, Naguibneva I, Robin P, Cabon F, Polesskaya A, Harel Bellan A. 2004. A Suv39h dependent mechanism for silencing S phase genes in differentiating but not in cycling cells. Embo J 23 : 605 615. Andres V, Chiara MD, Mahdavi V. 1994. A new bipartite DNA binding domain: cooperative interactio n between the cut repeat and homeo domain of the cut homeo proteins. Genes Dev 8 : 245 257. Ashburner M. 1989. Drosophila. A Laboratory Handbook. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Bantignies F, Cavalli G. 2006. Cellular memory and dynamic regulation of polycomb group proteins. Curr Opin Cell Biol 18 : 275 283. Barges S, Mihaly J, Galloni M, Hagstrom K, Muller M, Shanower G, Schedl P, Gyurkovics H, Karch F. 2000. The Fab 8 boundary defines the distal limit of the bithorax complex iab 7 domain and insulates iab 7 from initiation elements and a PRE in the adjacent iab 8 domain. Development 127 : 779 790. Baylin SB, Ohm JE. 2006. Epigenetic gene silencing in cancer a mechanism for early oncogenic pathway addiction? Nat Rev Cancer 6 : 107 116. Bell AC, West AG, Felsenfeld G. 1999. The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell 98 : 387 396. Bello BC, Hirth F, Gould AP. 2003. A pulse of the Drosophila Hox protein Abdominal A schedules th e end of neural proliferation via neuroblast apoptosis. Neuron 37 : 209 219. Bender W, Fitzgerald DP. 2002. Transcription activates repressed domains in the Drosophila bithorax complex. Development 129 : 4923 4930. Bergmann A, Agapite J, McCall K, Steller H. 1998a. The Drosophila Gene hid Is a Direct Molecular Target of Ras Dependent Survival Signaling. Cell 95 : 331 341. 1998b. The Drosophila gene hid is a direct molecular target of Ras dependent survival signaling. Cell 95 : 331 341. Bergmann A, Agapit e J, Steller H. 1998c. Mechanisms and control of programmed cell death in invertebrates. Oncogene 17 : 3215 3223.

PAGE 163

163 Bi X, Broach JR. 1999. UASrpg can function as a heterochromatin boundary element in yeast. Genes Dev 13 : 1089 1101. 2001. Chromosomal boun daries in S. cerevisiae. Curr Opin Genet Dev 11 : 199 204. Birch Machin I, Gao S, Huen D, McGirr R, White RA, Russell S. 2005. Genomic analysis of heat shock factor targets in Drosophila. Genome Biol 6 : R63. Birve A, Sengupta AK, Beuchle D, Larsson J, Ken nison JA, Rasmuson Lestander A, Muller J. 2001. Su(z)12, a novel Drosophila Polycomb group gene that is conserved in vertebrates and plants. Development 128 : 3371 3379. Bischof J, Maeda RK, Hediger M, Karch F, Basler K. 2007. An optimized transgenesis sys tem for Drosophila using germ line specific phiC31 integrases. Proc Natl Acad Sci U S A 104 : 3312 3317. Brand AH, Perrimon N. 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118 : 401 415. B reiling A, Turner BM, Bianchi ME, Orlando V. 2001. General transcription factors bind promoters repressed by Polycomb group proteins. Nature 412 : 651 655. Brodsky MH, Nordstrom W, Tsang G, Kwan E, Rubin GM, Abrams JM. 2000. Drosophila p53 binds a damage r esponse element at the reaper locus. Cell 101 : 103 113. Brodsky MH, Weinert BT, Tsang G, Rong YS, McGinnis NM, Golic KG, Rio DC, Rubin GM. 2004. Drosophila melanogaster MNK/Chk2 and p53 regulate multiple DNA repair and apoptotic pathways following DNA dam age. Mol Cell Biol 24 : 1219 1231. Brown JL, Fritsch C, Mueller J, Kassis JA. 2003. The Drosophila pho like gene encodes a YY1 related DNA binding protein that is redundant with pleiohomeotic in homeotic gene silencing. Development 130 : 285 294. Brown JL, Mucci D, Whiteley M, Dirksen ML, Kassis JA. 1998. The Drosophila Polycomb group gene pleiohomeotic encodes a DNA binding protein with homology to the transcription factor YY1. Mol Cell 1 : 1057 1064. Bushey AM, Dorman ER, Corces VG. 2008. Chromatin insula tors: regulatory mechanisms and epigenetic inheritance. Mol Cell 32 : 1 9. Busturia A, Lloyd A, Bejarano F, Zavortink M, Xin H, Sakonju S. 2001. The MCP silencer of the Drosophila Abd B gene requires both Pleiohomeotic and GAGA factor for the maintenance o f repression. Development 128 : 2163 2173.

PAGE 164

164 Campos Ortega JA, Hartenstein V. 1985. The Embryonic Development of Drosophila melanogaster Springer Verlag, Berlin. Cao R, Tsukada Y, Zhang Y. 2005. Role of Bmi 1 and Ring1A in H2A ubiquitylation and Hox gene s ilencing. Mol Cell 20 : 845 854. Cao R, Wang L, Wang H, Xia L, Erdjument Bromage H, Tempst P, Jones RS, Zhang Y. 2002. Role of histone H3 lysine 27 methylation in Polycomb group silencing. Science 298 : 1039 1043. Cao R, Zhang Y. 2004a. The functions of E( Z)/EZH2 mediated methylation of lysine 27 in histone H3. Curr Opin Genet Dev 14 : 155 164. 2004b. SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED EZH2 complex. Mol Cell 15 : 57 67. Carbone R, Botru gno OA, Ronzoni S, Insinga A, Di Croce L, Pelicci PG, Minucci S. 2006. Recruitment of the histone methyltransferase SUV39H1 and its role in the oncogenic properties of the leukemia associated PML retinoic acid receptor fusion protein. Mol Cell Biol 26 : 128 8 1296. Carr A, Biggin MD. 2000. Accessibility of transcriptionally inactive genes is specifically reduced at homeoprotein DNA binding sites in Drosophila. Nucleic Acids Res 28 : 2839 2846. Cashio P, Lee TV, Bergmann A. 2005. Genetic control of programmed cell death in Drosophila melanogaster. Semin Cell Dev Biol 16 : 225 235. Chan CS, Rastelli L, Pirrotta V. 1994. A Polycomb response element in the Ubx gene that determines an epigenetically inherited state of repression. Embo J 13 : 2553 2564. Chanas G, L avrov S, Iral F, Cavalli G, Maschat F. 2004. Engrailed and polyhomeotic maintain posterior cell identity through cubitus interruptus regulation. Dev Biol 272 : 522 535. Chao C, Saito S, Kang J, Anderson CW, Appella E, Xu Y. 2000. p53 transcriptional activi ty is essential for p53 dependent apoptosis following DNA damage. Embo J 19 : 4967 4975. Chen P, Nordstrom W, Gish B, Abrams JM. 1996. grim a novel cell death gene in Drosophila Genes Dev 10 : 1773 1782. Christich A, Kauppila S, Chen P, Sogame N, Ho SI, Abrams JM. 2002. The Damage Responsive Drosophila Gene sickle Encodes a Novel IAP Binding Protein Similar to but Distinct from reaper, grim, and hid. Curr Biol 12 : 137 140.

PAGE 165

165 Claveria C, Caminero E, Martinez AC, Campuzano S, Torres M. 2002. GH3, a novel pr oapoptotic domain in Drosophila Grim, promotes a mitochondrial death pathway. Embo J 21 : 3327 3336. Claveria C, Martinez AC, Torres M. 2004. A Bax/Bak independent mitochondrial death pathway triggered by Drosophila Grim GH3 domain in mammalian cells. J Bi ol Chem 279 : 1368 1375. Conradt B, Horvitz HR. 1999. The TRA 1A sex determination protein of C. elegans regulates sexually dimorphic cell deaths by repressing the egl 1 cell death activator gene. Cell 98 : 317 327. Czermin B, Melfi R, McCabe D, Seitz V, I mhof A, Pirrotta V. 2002. Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111 : 185 196. Dejardin J, Cavalli G. 2004. Chromatin inheritance upon Zeste mediated Brahma recru itment at a minimal cellular memory module. Embo J 23 : 857 868. Dekker J, Rippe K, Dekker M, Kleckner N. 2002. Capturing chromosome conformation. Science 295 : 1306 1311. Dellino GI, Schwartz YB, Farkas G, McCabe D, Elgin SC, Pirrotta V. 2004. Polycomb si lencing blocks transcription initiation. Mol Cell 13 : 887 893. Dickson J, Gowher H, Strogantsev R, Gaszner M, Hair A, Felsenfeld G, West AG. 2010. VEZF1 elements mediate protection from DNA methylation. PLoS Genet 6 : e1000804. Dienemann A, Sprenger F. 20 04. Requirements of cyclin a for mitosis are independent of its subcellular localization. Curr Biol 14 : 1117 1123. Ditzel M, Meier P. 2005. Ubiquitylation in apoptosis: DIAP1's (N )en(d)igma. Cell Death Differ 12 : 1208 1212. Donze D, Adams CR, Rine J, Ka makaka RT. 1999. The boundaries of the silenced HMR domain in Saccharomyces cerevisiae. Genes Dev 13 : 698 708. Engstrom PG, Ho Sui SJ, Drivenes O, Becker TS, Lenhard B. 2007. Genomic regulatory blocks underlie extensive microsynteny conservation in insect s. Genome Res 17 : 1898 1908. Erokhin M, Parshikov A, Georgiev P, Chetverina D. 2010. E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster. Chromosoma 119 : 243 253.

PAGE 166

166 Fiedler T, Rehmsmeier M. 2006. jPREdictor: a versatile tool for the prediction of cis regulatory elements. Nucleic Acids Res 34 : W546 550. Fischle W, Wang Y, Jacobs SA, Kim Y, Allis CD, Khorasanizadeh S. 2003. Molecular basis for the discrimination of repressive methyl lysine marks in histone H3 by Polycomb and HP1 chromodomains. Genes Dev 17 : 1870 1881. Flaus A, Owen Hughes T. 2004. Mechanisms for ATP dependent chromatin remodelling: farewell to the tuna can octamer? Curr Opin Genet Dev 14 : 165 173. Foe V, Odell G, Edgar B. 1993. Mitosis and Morp hogenesis in the Drosophila embryo: Point and counter point. in The Development of Drosphila Melanogaster (eds. B M, M A A). Cold Spring Harbor laboratory Press, Cold Spring Harbor. Fourel G, Revardel E, Koering CE, Gilson E. 1999. Cohabitation of insulat ors and silencing elements in yeast subtelomeric regions. Embo J 18 : 2522 2537. Franc NC, Dimarcq JL, Lagueux M, Hoffmann J, Ezekowitz RA. 1996. Croquemort, a novel Drosophila hemocyte/macrophage receptor that recognizes apoptotic cells. Immunity 4 : 431 4 43. Franc NC, Heitzler P, Ezekowitz RAB, White K. 1999. Requirement for Croquemort in Phagocytosis of Apoptotic Cells in Drosophila Science 284 : 1991 1994. Francis NJ, Kingston RE, Woodcock CL. 2004. Chromatin compaction by a polycomb group protein comp lex. Science 306 : 1574 1577. Francis NJ, Saurin AJ, Shao Z, Kingston RE. 2001. Reconstitution of a functional core polycomb repressive complex. Mol Cell 8 : 545 556. Freel CD, Richardson DA, Thomenius MJ, Gan EC, Horn SR, Olson MR, Kornbluth S. 2008. Mito chondrial localization of Reaper to promote inhibitors of apoptosis protein degradation conferred by GH3 domain lipid interactions. J Biol Chem 283 : 367 379. Fritsch C, Brown JL, Kassis JA, Muller J. 1999. The DNA binding polycomb group protein pleiohomeo tic mediates silencing of a Drosophila homeotic gene. Development 126 : 3905 3913. Gaszner M, Felsenfeld G. 2006. Insulators: exploiting transcriptional and epigenetic mechanisms. Nat Rev Genet 7 : 703 713.

PAGE 167

167 Girard F, Bello B, Laemmli UK, Gehring WJ. 1998. In vivo analysis of scaffold associated regions in Drosophila: a synthetic high affinity SAR binding protein suppresses position effect variegation. Embo J 17 : 2079 2085. Goyal L, McCall K, Agapite J, Hartwieg E, Steller H. 2000. Induction of apoptosis by Drosophila reaper, hid and grim through inhibition of IAP function. Embo J 19 : 589 597. Grether ME, Abrams JM, Agapite J, White K, Steller H. 1995. The head involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes & Dev 9 : 1694 1708. Gurudatta BV, Corces VG. 2009. Chromatin insulators: lessons from the fly. Brief Funct Genomic Proteomic 8 : 276 282. Hansen KH, Bracken AP, Pasini D, Dietrich N, Gehani SS, Monrad A, Rappsilber J, Lerdrup M, Helin K. 2008. A model for t ransmission of the H3K27me3 epigenetic mark. Nat Cell Biol 10 : 1291 1300. Hogga I, Karch F. 2002. Transcription through the iab 7 cis regulatory domain of the bithorax complex interferes with maintenance of Polycomb mediated silencing. Development 129 : 49 15 4922. Horvitz HR. 1999. Genetic control of programmed cell death in the nematode Caenorhabditis elegans. Cancer Res 59 : 1701s 1706s. Huang S, Li X, Yusufzai TM, Qiu Y, Felsenfeld G. 2007. USF1 recruits histone modification complexes and is critical fo r maintenance of a chromatin barrier. Mol Cell Biol 27 : 7991 8002. Jacobs HW, Knoblich JA, Lehner CF. 1998. Drosophila Cyclin B3 is required for female fertility and is dispensable for mitosis like Cyclin B. Genes Dev 12 : 3741 3751. Jassim OW, Fink JL, C agan RL. 2003. Dmp53 protects the Drosophila retina during a developmentally regulated DNA damage response. Embo J 22 : 5622 5632. Jeffers JR, Parganas E, Lee Y, Yang C, Wang J, Brennan J, MacLean KH, Han J, Chittenden T, Ihle JN et al. 2003. Puma is an es sential mediator of p53 dependent and independent apoptotic pathways. Cancer Cell 4 : 321 328. Jenuwein T, Allis CD. 2001. Translating the histone code. Science 293 : 1074 1080. Jiang C, Baehrecke EH, Thummel CS. 1997. Steroid regulated programmed cell de ath during Drosophila metamorphosis. Development 124 : 4673 4683.

PAGE 168

168 Jiang C, Lamblin AF, Steller H, Thummel CS. 2000. A steroid triggered transcriptional hierarchy controls salivary gland cell death during Drosophila metamorphosis. Mol Cell 5 : 445 455. Jin S, Martinek S, Joo WS, Wortman JR, Mirkovic N, Sali A, Yandell MD, Pavletich NP, Young MW, Levine AJ. 2000. Identification and characterization of a p53 homologue in Drosophila melanogaster. Proc Natl Acad Sci U S A 97 : 7301 7306. Jones RS, Gelbart WM. 19 90. Genetic analysis of the enhancer of zeste locus and its role in gene regulation in Drosophila melanogaster. Genetics 126 : 185 199. Kahn TG, Schwartz YB, Dellino GI, Pirrotta V. 2006. Polycomb complexes and the propagation of the methylation mark at th e Drosophila ubx gene. J Biol Chem 281 : 29064 29075. Kalmykova AI, Nurminsky DI, Ryzhov DV, Shevelyov YY. 2005. Regulated chromatin domain comprising cluster of co expressed genes in Drosophila melanogaster. Nucleic Acids Res 33 : 1435 1444. Kamakaka RT, Kadonaga JT. 1994. The soluble nuclear fraction, a highly efficient transcription extract from Drosophila embryos. Methods Cell Biol 44 : 225 235. Karcavich R, Doe CQ. 2005. Drosophila neuroblast 7 3 cell lineage: a model system for studying programmed cel l death, Notch/Numb signaling, and sequential specification of ganglion mother cell identity. J Comp Neurol 481 : 240 251. Kellum R, Schedl P. 1991. A position effect assay for boundaries of higher order chromosomal domains. Cell 64 : 941 950. 1992. A g roup of scs elements function as domain boundaries in an enhancer blocking assay. Mol Cell Biol 12 : 2424 2431. Ketel CS, Andersen EF, Vargas ML, Suh J, Strome S, Simon JA. 2005. Subunit contributions to histone methyltransferase activities of fly and worm polycomb group complexes. Mol Cell Biol 25 : 6857 6868. Keyse SM, Amaudruz F, Tyrrell RM. 1988. Determination of the spectrum of mutations induced by defined wavelength solar UVB (313 nm) radiation in mammalian cells by use of a shuttle vector. Mol Cell Biol 8 : 5425 5431. Kikuta H, Laplante M, Navratilova P, Komisarczuk AZ, Engstrom PG, Fredman D, Akalin A, Caccamo M, Sealy I, Howe K et al. 2007. Genomic regulatory blocks encompass multiple neighboring genes and maintain conserved synteny in vertebrates. Genome Res 17 : 545 555.

PAGE 169

169 Kim CA, Gingery M, Pilpa RM, Bowie JU. 2002. The SAM domain of polyhomeotic forms a helical polymer. Nat Struct Biol 9 : 453 457. King IF, Emmons RB, Francis NJ, Wild B, Muller J, Kingston RE, Wu CT. 2005. Analysis of a polycomb g roup protein defines regions that link repressive activity on nucleosomal templates to in vivo function. Mol Cell Biol 25 : 6578 6591. King IF, Francis NJ, Kingston RE. 2002. Native and recombinant polycomb group complexes establish a selective block to te mplate accessibility to repress transcription in vitro. Mol Cell Biol 22 : 7919 7928. Klymenko T, Papp B, Fischle W, Kocher T, Schelder M, Fritsch C, Wild B, Wilm M, Muller J. 2006. A Polycomb group protein complex with sequence specific DNA binding and se lective methyl lysine binding activities. Genes Dev 20 : 1110 1122. Kodjabachian L, Delaage M, Maurel C, Miassod R, Jacq B, Rosset R. 1998. Mutations in ccf, a novel Drosophila gene encoding a chromosomal factor, affect progression through mitosis and inte ract with Pc G mutations. Embo J 17 : 1063 1075. Kurshakova M, Maksimenko O, Golovnin A, Pulina M, Georgieva S, Georgiev P, Krasnov A. 2007. Evolutionarily conserved E(y)2/Sus1 protein is essential for the barrier activity of Su(Hw) dependent insulators in Drosophila. Mol Cell 27 : 332 338. Kuziora MA, McGinnis W. 1988. Different transcripts of the Drosophila Abd B gene correlate with distinct genetic sub functions. Embo J 7 : 3233 3244. Lavigne M, Francis NJ, King IF, Kingston RE. 2004. Propagation of sile ncing; recruitment and repression of naive chromatin in trans by polycomb repressed chromatin. Mol Cell 13 : 415 425. Lee JH, Lee E, Park J, Kim E, Kim J, Chung J. 2003. In vivo p53 function is indispensable for DNA damage induced apoptotic signaling in Dr osophila. FEBS Lett 550 : 5 10. Levine SS, King IF, Kingston RE. 2004. Division of labor in polycomb group repression. Trends Biochem Sci 29 : 478 485. Lewis EB. 1978. A gene complex controlling segmentation in Drosophila. Nature 276 : 565 570. Lewis SE, S earle SM, Harris N, Gibson M, Lyer V, Richter J, Wiel C, Bayraktaroglir L, Birney E, Crosby MA et al. 2002. Apollo: a sequence annotation editor. Genome Biol 3 : RESEARCH0082.

PAGE 170

170 Li S, Aufiero B, Schiltz RL, Walsh MJ. 2000. Regulation of the homeodomain CCAAT displacement/cut protein function by histone acetyltransferases p300/CREB binding protein (CBP) associated factor and CBP. Proc Natl Acad Sci U S A 97 : 7166 7171. Lin N, Zhang C, Pang J, Zhou L. 2009. By design or by chance: cell death during Drosophila embryogenesis. Apoptosis Lohmann I. 2003. Dissecting the regulation of the Drosophila cell death activator reaper. Gene Expr Patterns 3 : 159 163. Lowe SW, Schmitt EM, Smith SW, Osborne BA, Jacks T. 1993. p53 is required for radiation induced apoptosis i n mouse thymocytes. Nature (London) 362 : 847 849. Lu BY, Ma J, Eissenberg JC. 1998. Developmental regulation of heterochromatin mediated gene silencing in Drosophila. Development 125 : 2223 2234. Lupo R, Breiling A, Bianchi ME, Orlando V. 2001. Drosophila chromosome condensation proteins Topoisomerase II and Barren colocalize with Polycomb and maintain Fab 7 PRE silencing. Mol Cell 7 : 127 136. Maeda RK, Karch F. 2007. Making connections: boundaries and insulators in Drosophila. Curr Opin Genet Dev 17 : 394 399. Magrassi L, Lawrence PA. 1988. The pattern of cell death in fushi tarazu, a segmentation gene of Drosophila. Development 104 : 447 451. Majumder P, Roy S, Belozerov VE, Bosu D, Puppali M, Cai HN. 2009. Diverse transcription influences can be insulat ed by the Drosophila SF1 chromatin boundary. Nucleic Acids Res 37 : 4227 4233. Mallin DR, Myung JS, Patton JS, Geyer PK. 1998. Polycomb group repression is blocked by the Drosophila suppressor of Hairy wing [su(Hw)] insulator. Genetics 148 : 331 339. Marti nez AM, Colomb S, Dejardin J, Bantignies F, Cavalli G. 2006. Polycomb group dependent Cyclin A repression in Drosophila. Genes Dev 20 : 501 513. Maurange C, Cheng L, Gould AP. 2008. Temporal transcription factors and their targets schedule the end of neura l proliferation in Drosophila. Cell 133 : 891 902. Mayor C, Brudno M, Schwartz JR, Poliakov A, Rubin EM, Frazer KA, Pachter LS, Dubchak I. 2000. VISTA : visualizing global DNA sequence alignments of arbitrary length. Bioinformatics 16 : 1046 1047.

PAGE 171

171 McGinnis W, Krumlauf R. 1992. Homeobox genes and axial patterning. Cell 68 : 283 302. Min J, Zhang Y, Xu RM. 2003. Structural basis for specific binding of Polycomb chromodomain to histone H3 methylated at Lys 27. Genes Dev 17 : 1823 1828. Mishra RK, Mihaly J, Bar ges S, Spierer A, Karch F, Hagstrom K, Schweinsberg SE, Schedl P. 2001. The iab 7 polycomb response element maps to a nucleosome free region of chromatin and requires both GAGA and pleiohomeotic for silencing activity. Mol Cell Biol 21 : 1311 1318. Mizumat su S, Monje ML, Morhardt DR, Rola R, Palmer TD, Fike JR. 2003. Extreme sensitivity of adult neurogenesis to low doses of X irradiation. Cancer Res 63 : 4021 4027. Moazed D, O'Farrell PH. 1992. Maintenance of the engrailed expression pattern by Polycomb gro up genes in Drosophila. Development 116 : 805 810. Mohd Sarip A, Cleard F, Mishra RK, Karch F, Verrijzer CP. 2005. Synergistic recognition of an epigenetic DNA element by Pleiohomeotic and a Polycomb core complex. Genes Dev 19 : 1755 1760. Mohd Sarip A, va n der Knaap JA, Wyman C, Kanaar R, Schedl P, Verrijzer CP. 2006. Architecture of a polycomb nucleoprotein complex. Mol Cell 24 : 91 100. Mohd Sarip A, Venturini F, Chalkley GE, Verrijzer CP. 2002. Pleiohomeotic can link polycomb to DNA and mediate transcri ptional repression. Mol Cell Biol 22 : 7473 7483. Mottus R, Sobel RE, Grigliatti TA. 2000. Mutational analysis of a histone deacetylase in Drosophila melanogaster: missense mutations suppress gene silencing associated with position effect variegation. Gene tics 154 : 657 668. Muller J, Hart CM, Francis NJ, Vargas ML, Sengupta A, Wild B, Miller EL, O'Connor MB, Kingston RE, Simon JA. 2002. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111 : 197 208. Muller J, Kassis JA. 2006. Polycomb response elements and targeting of Polycomb group proteins in Drosophila. Curr Opin Genet Dev 16 : 476 484. Nabirochkin S, Ossokina M, Heidmann T. 1998. A nuclear matrix/scaffold attachment region co localizes with the gypsy retrotransp oson insulator sequence. J Biol Chem 273 : 2473 2479. Nakano K, Vousden KH. 2001. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 7 : 683 694.

PAGE 172

172 Narita M, Nunez S, Heard E, Lin AW, Hearn SA, Spector DL, Hannon GJ, Lowe SW. 2003. Rb mediated hete rochromatin formation and silencing of E2F target genes during cellular senescence. Cell 113 : 703 716. Negre N, Hennetin J, Sun LV, Lavrov S, Bellis M, White KP, Cavalli G. 2006. Chromosomal distribution of PcG proteins during Drosophila development. PLoS Biol 4 : e170. Nekrasov M, Klymenko T, Fraterman S, Papp B, Oktaba K, Kocher T, Cohen A, Stunnenberg HG, Wilm M, Muller J. 2007. Pcl PRC2 is needed to generate high levels of H3 K27 trimethylation at Polycomb target genes. Embo J 26 : 4078 4088. Nekrasov M, Wild B, Muller J. 2005. Nucleosome binding and histone methyltransferase activity of Drosophila PRC2. EMBO Rep 6 : 348 353. Nepveu A. 2001. Role of the multifunctional CDP/Cut/Cux homeodomain transcription factor in regulating differentiation, cell grow th and development. Gene 270 : 1 15. Neufeld EJ, Skalnik DG, Lievens PM, Orkin SH. 1992. Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut. Nat Genet 1 : 50 55. Nordstrom W, Chen P, Steller H, Abrams JM. 1996. Activation of the reaper gene during ectopic cell killing in Drosophila. Dev Biol 180 : 213 226. Nowak E, Etienne O, Millet P, Lages CS, Mathieu C, Mouthon MA, Boussin FD. 2006. Radiation induced H2AX phosphorylation and neural precursor apoptosis in the developing bra in of mice. Radiat Res 165 : 155 164. O'Dor E, Beck SA, Brock HW. 2006. Polycomb group mutants exhibit mitotic defects in syncytial cell cycles of Drosophila embryos. Dev Biol 290 : 312 322. Ohlstein B, Spradling A. 2006. The adult Drosophila posterior mid gut is maintained by pluripotent stem cells. Nature 439 : 470 474. Ollmann M, Young LM, Di Como CJ, Karim F, Belvin M, Robertson S, Whittaker K, Demsky M, Fisher WW, Buchman A et al. 2000. Drosophila p53 is a structural and functional homolog of the tumor suppressor p53. Cell 101 : 91 101. Olson MR, Holley CL, Gan EC, Colon Ramos DA, Kaplan B, Kornbluth S. 2003. A GH3 like domain in reaper required formitochondrial localization and induction of IAP degradation. J Biol Chem 13 : 13.

PAGE 173

173 Orlando V, Jane EP, Chinw alla V, Harte PJ, Paro R. 1998. Binding of trithorax and Polycomb proteins to the bithorax complex: dynamic changes during early Drosophila embryogenesis. Embo J 17 : 5141 5150. Papp B, Muller J. 2006. Histone trimethylation and the maintenance of transcri ptional ON and OFF states by trxG and PcG proteins. Genes Dev 20 : 2041 2054. Parks AL, Cook KR, Belvin M, Dompe NA, Fawcett R, Huppert K, Tan LR, Winter CG, Bogart KP, Deal JE et al. 2004. Systematic generation of high resolution deletion coverage of the Drosophila melanogaster genome. Nat Genet 36 : 288 292. Pasini D, Bracken AP, Jensen MR, Lazzerini Denchi E, Helin K. 2004. Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity. Embo J 23 : 4061 4071. Pazdera TM, Janardh an P, Minden JS. 1998. Patterned epidermal cell death in wild type and segment polarity mutant Drosophila embryos. Development 125 : 3427 3436. Peissner W, Kocher M, Treuer H, Gillardon F. 1999. Ionizing radiation induced apoptosis of proliferating stem ce lls in the dentate gyrus of the adult rat hippocampus. Brain Res Mol Brain Res 71 : 61 68. Peterson C, Carney GE, Taylor BJ, White K. 2002. reaper is required for neuroblast apoptosis during Drosophila development. Development 129 : 1467 1476. Phillips MD, Shearn A. 1990. Mutations in polycombeotic, a Drosophila polycomb group gene, cause a wide range of maternal and zygotic phenotypes. Genetics 125 : 91 101. Pirrotta V. 1998. Polycombing the genome: PcG, trxG, and chromatin silencing. Cell 93 : 333 336. Qi D, Larsson J, Mannervik M. 2004. Drosophila Ada2b is required for viability and normal histone H3 acetylation. Mol Cell Biol 24 : 8080 8089. Qian S, Capovilla M, Pirrotta V. 1993. Molecular mechanisms of pattern formation by the BRE enhancer of the Ubx ge ne. Embo J 12 : 3865 3877. Raab JR, Kamakaka RT. 2010. Insulators and promoters: closer than we think. Nat Rev Genet 11 : 439 446. Rank G, Prestel M, Paro R. 2002. Transcription through intergenic chromosomal memory elements of the Drosophila bithorax comp lex correlates with an epigenetic switch. Mol Cell Biol 22 : 8026 8034.

PAGE 174

174 Recillas Targa F, Pikaart MJ, Burgess Beusse B, Bell AC, Litt MD, West AG, Gaszner M, Felsenfeld G. 2002. Position effect protection and enhancer blocking by the chicken beta globin in sulator are separable activities. Proc Natl Acad Sci U S A 99 : 6883 6888. Riley PD, Carroll SB, Scott MP. 1987. The expression and regulation of Sex combs reduced protein in Drosophila embryos. Genes Dev 1 : 716 730. Ringrose L, Paro R. 2007. Polycomb/Tri thorax response elements and epigenetic memory of cell identity. Development 134 : 223 232. Ringrose L, Rehmsmeier M, Dura JM, Paro R. 2003. Genome wide prediction of Polycomb/Trithorax response elements in Drosophila melanogaster. Dev Cell 5 : 759 771. Ro gulja Ortmann A, Luer K, Seibert J, Rickert C, Technau GM. 2007. Programmed cell death in the embryonic central nervous system of Drosophila melanogaster. Development 134 : 105 116. Rogulja Ortmann A, Renner S, Technau GM. 2008. Antagonistic roles for Ultr abithorax and Antennapedia in regulating segment specific apoptosis of differentiated motoneurons in the Drosophila embryonic central nervous system. Development Roseman RR, Pirrotta V, Geyer PK. 1993. The su(Hw) protein insulates expression of the Droso phila melanogaster white gene from chromosomal position effects. Embo J 12 : 435 442. Rougvie AE, Lis JT. 1988. The RNA polymerase II molecule at the 5' end of the uninduced hsp70 gene of D. melanogaster is transcriptionally engaged. Cell 54 : 795 804. Roz en S, Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132 : 365 386. Sanchez Elsner T, Gou D, Kremmer E, Sauer F. 2006. Noncoding RNAs of trithorax response elements recruit Drosophila Ash1 to Ultrabi thorax. Science 311 : 1118 1123. Saurin AJ, Shao Z, Erdjument Bromage H, Tempst P, Kingston RE. 2001. A Drosophila Polycomb group complex includes Zeste and dTAFII proteins. Nature 412 : 655 660. Scarano MI, Strazzullo M, Matarazzo MR, D'Esposito M. 2005. DNA methylation 40 years later: Its role in human health and disease. J Cell Physiol 204 : 21 35.

PAGE 175

175 Schmitt S, Prestel M, Paro R. 2005. Intergenic transcription through a polycomb group response element counteracts silencing. Genes Dev 19 : 697 708. Schwartz YB, Kahn TG, Nix DA, Li XY, Bourgon R, Biggin M, Pirrotta V. 2006. Genome wide analysis of Polycomb targets in Drosophila melanogaster. Nat Genet 38 : 700 705. Schwartz YB, Pirrotta V. 2007. Polycomb silencing mechanisms and the management of genomic prog rammes. Nat Rev Genet 8 : 9 22. 2008. Polycomb complexes and epigenetic states. Curr Opin Cell Biol 20 : 266 273. Sengupta AK, Kuhrs A, Muller J. 2004. General transcriptional silencing by a Polycomb response element in Drosophila. Development 131 : 1959 1965. Shao Z, Raible F, Mollaaghababa R, Guyon JR, Wu CT, Bender W, Kingston RE. 1999. Stabilization of chromatin structure by PRC1, a Polycomb complex. Cell 98 : 37 46. Sheng G, Thouvenot E, Schmucker D, Wilson DS, Desplan C. 1997. Direct regulation of rhodopsin 1 by Pax 6/eyeless in Drosophila: evidence for a conserved function in photoreceptors. Genes Dev 11 : 1122 1131. Shibue T, Takeda K, Oda E, Tanaka H, Murasawa H, Takaoka A, Morishita Y, Akira S, Taniguchi T, Tanaka N. 2003. Integral role of Noxa in p53 mediated apoptotic response. Genes Dev 17 : 2233 2238. Sigrist CJ, Pirrotta V. 1997. Chromatin insulator elements block the silencing of a target gene by the Drosophila polycomb response element (PRE) but allow trans interactions between PREs on dif ferent chromosomes. Genetics 147 : 209 221. Simon J, Chiang A, Bender W. 1992. Ten different Polycomb group genes are required for spatial control of the abdA and AbdB homeotic products. Development 114 : 493 505. Smouse D, Goodman C, Mahowald A, Perrimon N. 1988. polyhomeotic: a gene required for the embryonic development of axon pathways in the central nervous system of Drosophila. Genes Dev 2 : 830 842. Sogame N, Kim M, Abrams JM. 2003. Drosophila p53 preserves genomic stability by regulating cell death. Proc Natl Acad Sci U S A 100 : 4696 4701. Sonnenfeld MJ, Jacobs JR. 1995a. Apoptosis of the midline glia during Drosophila embryogenesis: a correlation with axon contact. Development 121 : 569 578.

PAGE 176

176 1995b. Macrophages and glia participate in the removal of apoptotic neurons from the Drosophila embryonic nervous system. J Comp Neurol 359 : 644 652. Soria C, Estermann FE, Espantman KC, O'Shea CC. 2010. Heterochromatin silencing of p53 target genes by a small viral protein. Nature 466 : 1076 1081. Srinivasu la SM, Datta P, Kobayashi M, Wu JW, Fujioka M, Hegde R, Zhang Z, Mukattash R, Fernandes Alnemri T, Shi Y et al. 2002. sickle, a Novel Drosophila Death Gene in the reaper/hid/grim Region, Encodes an IAP Inhibitory Protein. Curr Biol 12 : 125 130. Steller H. 1995. Mechanisms and Genes of Cellular Suicide. Science 267 : 1445 1449. 2008. Regulation of apoptosis in Drosophila. Cell Death Differ 15 : 1132 1138. Struhl G. 1983. Role of the esc+ gene product in ensuring the selective expression of segment specif ic homeotic genes in Drosophila. J Embryol Exp Morphol 76 : 297 331. Su TT, Jaklevic B. 2001. DNA damage leads to a Cyclin A dependent delay in metaphase anaphase transition in the Drosophila gastrula. Curr Biol 11 : 8 17. Tepass U, Fessler LI, Aziz A, Har tenstein V. 1994. Embryonic origin of hemocytes and their relationship to cell death in Drosophila. Development 120 : 1829 1837. Thellmann M, Hatzold J, Conradt B. 2003. The Snail like CES 1 protein of C. elegans can block the expression of the BH3 only ce ll death activator gene egl 1 by antagonizing the function of bHLH proteins. Development 130 : 4057 4071. Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, Singh CM, Buchholz R, Demsky M, Fawcett R, Francis Lang HL et al. 2004. A complementary trans poson tool kit for Drosophila melanogaster using P and piggyBac. Nat Genet 36 : 283 287. Thomas BJ. 2005. Cell cycle control during development: taking it up a notch. Dev Cell 8 : 451 452. Tie F, Banerjee R, Stratton CA, Prasad Sinha J, Stepanik V, Zlobin A, Diaz MO, Scacheri PC, Harte PJ. 2009. CBP mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Development 136 : 3131 3141. Tie F, Prasad Sinha J, Birve A, Rasmuson Lestander A, Harte PJ. 2003. A 1 megadalton ESC/E(Z) complex from Drosophila that contains polycomblike and RPD3. Mol Cell Biol 23 : 3352 3362.

PAGE 177

177 Tolhuis B, de Wit E, Muijrers I, Teunissen H, Talhout W, van Steensel B, van Lohu izen M. 2006. Genome wide profiling of PRC1 and PRC2 Polycomb chromatin binding in Drosophila melanogaster. Nat Genet 38 : 694 699. Tolhuis B, Palstra RJ, Splinter E, Grosveld F, de Laat W. 2002. Looping and interaction between hypersensitive sites in the active beta globin locus. Mol Cell 10 : 1453 1465. Toyama Y, Peralta XG, Wells AR, Kiehart DP, Edwards GS. 2008. Apoptotic force and tissue dynamics during Drosophila embryogenesis. Science 321 : 1683 1686. Trojer P, Reinberg D. 2007. Facultative heterochr omatin: is there a distinctive molecular signature? Mol Cell 28 : 1 13. Tseng AS, Hariharan IK. 2002. An overexpression screen in Drosophila for genes that restrict growth or cell cycle progression in the developing eye. Genetics 162 : 229 243. Tusher VG, Tibshirani R, Chu G. 2001. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98 : 5116 5121. Vaux DL, Korsmeyer SJ. 1999. Cell Death in Development. Cell 96 : 245 254. Vaux DL, Silke J. 2005. IAPs, RI NGs and ubiquitylation. Nat Rev Mol Cell Biol 6 : 287 297. Venken KJ, He Y, Hoskins RA, Bellen HJ. 2006. P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314 : 1747 1751. Villunger A, Michalak EM Coultas L, Mullauer F, Bock G, Ausserlechner MJ, Adams JM, Strasser A. 2003. p53 and drug induced apoptotic responses mediated by BH3 only proteins puma and noxa. Science 302 : 1036 1038. Wang H, Wang L, Erdjument Bromage H, Vidal M, Tempst P, Jones RS, Zhang Y. 2004a. Role of histone H2A ubiquitination in Polycomb silencing. Nature 431 : 873 878. Wang L, Brown JL, Cao R, Zhang Y, Kassis JA, Jones RS. 2004b. Hierarchical recruitment of polycomb group silencing complexes. Mol Cell 14 : 637 646. Wang L, Tu Z, Sun F. 2009. A network based integrative approach to prioritize reliable hits from multiple genome wide RNAi screens in Drosophila. BMC Genomics 10 : 220.

PAGE 178

178 Wang SL, Hawkins CJ, Yoo SJ, Muller HA, Hay BA. 1999. The Drosophila caspase inhibitor DIAP1 is e ssential for cell survival and is negatively regulated by HID. Cell 98 : 453 463. Weiler KS, Wakimoto BT. 1995. Heterochromatin and gene expression in Drosophila. Annu Rev Genet 29 : 577 605. West AG, Huang S, Gaszner M, Litt MD, Felsenfeld G. 2004. Recrui tment of histone modifications by USF proteins at a vertebrate barrier element. Mol Cell 16 : 453 463. White K, Grether ME, Abrams JM, Young L, Farrell K, Steller H. 1994. Genetic control of programmed cell death in Drosophila. Science 264 : 677 683. Wichm ann A, Jaklevic B, Su TT. 2006. Ionizing radiation induces caspase dependent but Chk2 and p53 independent cell death in Drosophila melanogaster. Proc Natl Acad Sci U S A 103 : 9952 9957. Wing JP, Karres JS, Ogdahl JL, Zhou L, Schwartz LM, Nambu JR. 2002. Drosophila sickle Is a Novel grim reaper Cell Death Activator. Curr Biol 12 : 131 135. Wing JP, Schwartz LM, Nambu JR. 2001. The RHG motifs of Drosophila Reaper and Grim are important for their distinct cell death inducing abilities. Mech Dev 102 : 193 203. Wurgler FE, Ullrich H. 1976. Radiaosensitivity of embryonic stages. in The Genetics and Biology of Drosophila (eds. M Ashburner, E Novitski), pp. 1269 1298. Academic press, London and New York. Yin VP, Thummel CS. 2004. A balance between the diap1 death inhibitor and reaper and hid death inducers controls steroid triggered cell death in Drosophila. Proc Natl Acad Sci U S A 101 : 8022 8027. Yu J, Zhang L, Hwang PM, Kinzler KW, Vogelstein B. 2001. PUMA induces the rapid apoptosis of colorectal cancer cells Mol Cell 7 : 673 682. Zachariou A, Tenev T, Goyal L, Agapite J, Steller H, Meier P. 2003. IAP antagonists exhibit non redundant modes of action through differential DIAP1 binding. Embo J 22 : 6642 6652. Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S Adelman K, Levine M, Young RA. 2007. RNA polymerase stalling at developmental control genes in the Drosophila melanogaster embryo. Nat Genet 39 : 1512 1516.

PAGE 179

179 Zhang CC, Bienz M. 1992. Segmental determination in Drosophila conferred by hunchback (hb), a rep ressor of the homeotic gene Ultrabithorax (Ubx). Proc Natl Acad Sci U S A 89 : 7511 7515. Zhang Y, Lin N, Carroll P, Chan G, Guan B, Xiao H, Yao B, Wu S, Zhou L. 2008a. Epigenetic Blocking of an Enhancer Region Controls Irradiation Induced Proapoptotic Gen e Expression in Drosophila Embryos. Developmental Cell 14 : 481 493. Zhang Y, Lin N, Carroll PM, Chan G, Guan B, Xiao H, Yao B, Wu SS, Zhou L. 2008b. Epigenetic blocking of an enhancer region controls irradiation induced proapoptotic gene expression in Dro sophila embryos. Dev Cell 14 : 481 493. Zhou L, Hashimi H, Schwartz LM, Nambu JR. 1995. Programmed cell death in the Drosophila central nervous system midline. Curr Biol 5 : 784 790. Zhou L, Jiang G, Chan G, Santos CP, Severson DW, Xiao L. 2005. Michelob_x is the missing inhibitor of apoptosis protein antagonist in mosquito genomes. EMBO Rep 6 : 769 774. Zhou L, Schnitzler A, Agapite J, Schwartz LM, Steller H, Nambu JR. 1997. Cooperative functions of the reaper and head involution defective genes in the pro grammed cell death of Drosophila central nervous system midline cells. Proc Natl Acad Sci U S A 94 : 5131 5136. Zhou L, Steller H. 2003. Distinct pathways mediate UV induced apoptosis in Drosophila embryos. Dev Cell 4 : 599 605. Zhou L, Yuan R, Lananta S. 2003. Molecular mechanisms of Irradiation induced cell death. Frontiers of Bioscience 8:d9 19

PAGE 180

180 BIOGRAPHICAL SKETCH Nianwei Lin was born in 1979, in Longyan, a small mountainous city in south China. He received his B.S. degree from the Department of Bi ology at Xiamen University (China) in 2002, and continued his graduate study under the supervision of Dr. Runying Zeng. In 2005, he completed his thesis and graduated with a Master of Science degree. In the same year, he traveled from China to the United S tates of America, and enrolled as a graduate student in the Interdisciplinary Program in Biomedical Sciences (IDP) at the University of Florida. In 2006, h e joined the laboratory of Dr. Lei Zhou in the Department of Molecular Genetics and Microbiology. He pas sed his qualifying exam and became an official Ph.D. candidate in October 2007. He finished his dissertation in November 2010 and received his Ph.D. degree in December 2010.