<%BANNER%>

Characterization of the CAG 140 Mouse Model of Huntington's Disease and the Effects of rAAV Delivered shRNA and hGFP

Permanent Link: http://ufdc.ufl.edu/UFE0042408/00001

Material Information

Title: Characterization of the CAG 140 Mouse Model of Huntington's Disease and the Effects of rAAV Delivered shRNA and hGFP
Physical Description: 1 online resource (156 p.)
Language: english
Creator: Rising, Aaron
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: behavior, cag, darpp, gfp, huntington, mouse, polyglutamine, raav, rnai, transcript
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Huntington?s disease (HD) is a fatal neurodegenerative disease caused by a poly-glutamine expansion in the huntingtin gene. Currently there is no treatment or cure for HD which afflicts approximately 3 to 8 individuals out of 100,000. Since the discovery of the huntingtin gene in 1993, several rodent models have been generated to study HD. Here we examine the behavioral and histopathologic characteristics of one HD mouse model (CAG 140).consisting of 140 CAG repeats knocked into the 5? mouse huntingtin gene. Rearing, rotarod and gait behavioral analysis were performed once a month starting at 2.5 months out to 18 months. Histopathological examinations, including mRNA transcriptional analysis and neuronal intranuclear inclusion (NIIs) quantification, were performed on a cross-sectional cohort of mice starting at 3 months of age and examined out to 18 months. We found significant behavioral and histopathological abnormalities in the knock-in mice when compared to non-transgenic mice. The work performed here shows that the CAG 140 mouse is a suitable model for HD studies. The CAG 140 model exhibit aspects of the HD in a more protracted natural history compared to other murine HD models. As seen in other HD models and in humans, the transcriptional down-regulation in the knock-in mice as they age is one of the best characteristics of this model. In addition, the progressive NIIs increase over time could be used as marker of the disease progression. We explored the use of rAAV delivered RNAi as a potential therapeutic for the disease by using a shRNA targeting the expanded htt allele. While knock-down of mutant htt mRNA reduced the number of NIIs, mice also displayed significant transcriptional dysregulation. Additionally, the non-specific shRNA and Green Fluorescent Protein (GFP) controls showed significant reductions in striatally enriched mRNA transcripts. Further investigation into the effects of the GFP controls indicated a significant loss of DARPP-32 protein, apparent loss of NeuN positive cells and an increase in glial fibrillary acidic protein (GFAP) positive astrocytes in the injected side. Our work here indicates GFP may not be the best reporter transgene and other less toxic reporters might need to be examined.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Aaron Rising.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Mandel, Ronald J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042408:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042408/00001

Material Information

Title: Characterization of the CAG 140 Mouse Model of Huntington's Disease and the Effects of rAAV Delivered shRNA and hGFP
Physical Description: 1 online resource (156 p.)
Language: english
Creator: Rising, Aaron
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: behavior, cag, darpp, gfp, huntington, mouse, polyglutamine, raav, rnai, transcript
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Huntington?s disease (HD) is a fatal neurodegenerative disease caused by a poly-glutamine expansion in the huntingtin gene. Currently there is no treatment or cure for HD which afflicts approximately 3 to 8 individuals out of 100,000. Since the discovery of the huntingtin gene in 1993, several rodent models have been generated to study HD. Here we examine the behavioral and histopathologic characteristics of one HD mouse model (CAG 140).consisting of 140 CAG repeats knocked into the 5? mouse huntingtin gene. Rearing, rotarod and gait behavioral analysis were performed once a month starting at 2.5 months out to 18 months. Histopathological examinations, including mRNA transcriptional analysis and neuronal intranuclear inclusion (NIIs) quantification, were performed on a cross-sectional cohort of mice starting at 3 months of age and examined out to 18 months. We found significant behavioral and histopathological abnormalities in the knock-in mice when compared to non-transgenic mice. The work performed here shows that the CAG 140 mouse is a suitable model for HD studies. The CAG 140 model exhibit aspects of the HD in a more protracted natural history compared to other murine HD models. As seen in other HD models and in humans, the transcriptional down-regulation in the knock-in mice as they age is one of the best characteristics of this model. In addition, the progressive NIIs increase over time could be used as marker of the disease progression. We explored the use of rAAV delivered RNAi as a potential therapeutic for the disease by using a shRNA targeting the expanded htt allele. While knock-down of mutant htt mRNA reduced the number of NIIs, mice also displayed significant transcriptional dysregulation. Additionally, the non-specific shRNA and Green Fluorescent Protein (GFP) controls showed significant reductions in striatally enriched mRNA transcripts. Further investigation into the effects of the GFP controls indicated a significant loss of DARPP-32 protein, apparent loss of NeuN positive cells and an increase in glial fibrillary acidic protein (GFAP) positive astrocytes in the injected side. Our work here indicates GFP may not be the best reporter transgene and other less toxic reporters might need to be examined.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Aaron Rising.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Mandel, Ronald J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042408:00001


This item has the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF THE CAG 140 MOUSE MODEL OF HUNTINGTONS DISEASE AND THE EFFECTS OF RAAV DELIVERED SHRNA AND HGFP By AARON COATES RISING A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Aaron Coates Rising

PAGE 3

3 To my f amily, who have helped me through it all

PAGE 4

4 ACKNOWLEDGMENTS I thank my parents and brother for their continuing support throughout the graduate school experience and trying to get me to keep me motivated. I thank my grandparents who would always call to see how I was doing and find out if I could drive out and have a good home cooked meal and chat about everything and anything. My family has constantly kept my mind interested in everything that goes on in the world and every one of them was instrumental in my desire to purse a PhD. My friends both here and outside of Gainesville have been of up most import ance in reassuring me that there is life outside of graduate school and helping me relax and enjoy the last 6 years. Life is more than work, and my friends have helped keep that in prespective. To Star, my best friend and companion, the last 2 years have been wonderful and I hope to have many more with you. I would like to thank the Mandel, Lewin and DenovanWright labs that span two countries I would lastly like to thank Dr. Ron Mandel, Dr. Al Lewin and Dr. Eileen DenovanWright for their constant suppor t and guidance throughout my time here in the PhD program. I could not have done any of this without everyones support, words and thoughts. I thank you all!

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 LIST OF ABBREVIATIONS ........................................................................................... 11 ABSTRACT ................................................................................................................... 14 CHAPTER 1 INTRODUCTION .................................................................................................... 16 Huntingtons Disease .............................................................................................. 16 HD Pathology ................................................................................................... 18 Direct Pathway ................................................................................................. 19 Indirect Pathway ............................................................................................... 19 Cellular Signaling in the D1 and D2 Neurons ................................................... 19 HD and the Striatal Pathways ........................................................................... 20 Transcriptional Factors Associated with Huntingtin .......................................... 21 Neuronal Intranuclear Inclusions ...................................................................... 23 HD Models .............................................................................................................. 24 Mouse Models of HD ........................................................................................ 25 Knock Out Mouse Models of HD ...................................................................... 25 Conditional Knock Outs .................................................................................... 26 Transgenic Mouse Models of HD ..................................................................... 27 Tetracycline regulated transgenic .............................................................. 27 R/6 model ................................................................................................... 27 N17182Q .................................................................................................. 28 YACs .......................................................................................................... 29 Knock Ins ......................................................................................................... 29 Gain of Toxic Function ..................................................................................... 32 Adeno Associated Virus (AAV) ............................................................................... 33 Basic Biology .................................................................................................... 33 Serotypes ......................................................................................................... 34 Receptor Binding and Entry .............................................................................. 34 rAAV ................................................................................................................. 35 AAV Pseudotyping ........................................................................................... 36 Neuronal Targeting ........................................................................................... 36 RNAi ....................................................................................................................... 37 siRNA Pathway ................................................................................................ 37 miRNA Pathway ............................................................................................... 38 shRNAs ............................................................................................................ 39

PAGE 6

6 RNAi considerations ......................................................................................... 39 Hypothesis .............................................................................................................. 40 2 MATERIALS AND METHODS ................................................................................ 44 Animals and Ti ssue Preparation ............................................................................. 44 Plasmid and rAAV Preparations ............................................................................. 45 Intrastriatal Surgical Injections of rAAV Vectors ...................................................... 46 Rearing Behavior .................................................................................................... 47 Rotarod ................................................................................................................... 47 Gait Analysis ........................................................................................................... 48 In Situ Hybridization ................................................................................................ 48 Quantification of Transcripts ................................................................................... 49 Immunohistochemistry ............................................................................................ 49 Quantification of Inclusion Bodies and NeuN Positive Cells ................................... 50 Cortical Thickness .................................................................................................. 51 Qualitative Analysis of GFAP Staining .................................................................... 51 Statistical Analysis .................................................................................................. 51 3 CHARACTERIZATION OF THE CAG 140 MOUSE MODEL OF HUNTINGTONS DISEASE .................................................................................... 53 Introduction ............................................................................................................. 53 Results .................................................................................................................... 54 Behavioral Abnormalities in HD Mice ............................................................... 54 Rearings ..................................................................................................... 54 Rotarod ...................................................................................................... 54 Gait analysis .............................................................................................. 55 Expression of the CAG140 Allele Leads to Transcriptional Anomalies in the Mouse Brain .................................................................................................. 55 Older CAG140 Mice Exhibit an Increase in NIIs ............................................... 56 Cortical Thickness ............................................................................................ 57 Weight .............................................................................................................. 58 Discussion .............................................................................................................. 58 Behavioral Abnormalities .................................................................................. 59 Transcriptional Dysfunction .............................................................................. 60 Neuronal Intranuclear Inc lusions ...................................................................... 62 Cortical Thinning .............................................................................................. 63 4 RAAV5 SHRNA TREATMENT OF THE CAG 140 MOUSE MODEL ...................... 76 Introduction ............................................................................................................. 76 Results .................................................................................................................... 78 Behavioral Analysis .......................................................................................... 78 Transcriptional Analysis for rAAV5siHUNT1 and siHUNT2siHUNT2 Mice ..... 79 NII decreases with shRNA treatment ............................................................... 81 Discussion .............................................................................................................. 82

PAGE 7

7 Behavioral Improvements ................................................................................. 83 Transcriptional Dysregulation ........................................................................... 84 N II Reductions .................................................................................................. 87 Compounding Factor ........................................................................................ 88 5 LONG TERM EFFECTS OF rAAV5 HGFP INJECTIONS IN THE CAG 140 MOUSE MODEL ..................................................................................................... 93 Introduction ............................................................................................................. 93 Results .................................................................................................................... 94 Transcriptional DownRegulation in GFP injected Mic e ................................... 94 DARPP32 Protein Reductions ......................................................................... 95 Total Striatal Cell Count .................................................................................... 96 NeuN Positive Cell Reductions ......................................................................... 96 Astrocytic Activation ......................................................................................... 97 Discussion .............................................................................................................. 97 mRNA Transcript Down regulation After rAAV5hGFP Injections .................... 97 Medium Spiny Neuron Population and Markers ............................................... 98 GFAP Activ ation after rAAV5hGFP Injections ............................................... 100 Conclusions .................................................................................................... 101 6 DISCUSSION ....................................................................................................... 110 Characterization of the CAG 140 HD Mouse Model ............................................. 110 Overview of CAG Characterization ................................................................. 110 Future Directions of Study in the CAG 140 HD Model .................................... 113 Therapeutic Treatment in the CAG 140 HD Model ............................................... 114 Huntingtin Knock Down .................................................................................. 1 14 Future Direction and Studies .......................................................................... 117 Compounding Variables ........................................................................................ 118 Convection Enhanced Delivery ...................................................................... 118 Transgene Toxicity ......................................................................................... 119 GFP toxicity .............................................................................................. 119 Double transgene toxicity ......................................................................... 121 Concluding Remarks ............................................................................................ 122 REFERENCES ............................................................................................................ 124 BIOGRAPHICAL SKETCH .......................................................................................... 156

PAGE 8

8 LIST OF TABLES Table page 1 1 Differences in infectivity rates of AAV serotype between rats and mice ............. 43 5 1 Qualitative analysis of GFAP positive labeled cells in the striatum ................... 109

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Schematic diagram of the indirect and direct pathways found in the Basal Ganglia. .............................................................................................................. 41 1 2 Diagram of RNAi pathways in a mammalian cell. ............................................... 42 3 1 Longitudinal rearing behavior of the CAG140 knock in mouse model of Huntington s disease shows a deficit in heterozygous and homozygous mice. ................................................................................................................... 65 3 2 Latency to fall of the CAG140 mouse model on the accelerating and c onstant speed Rotarod .................................................................................................... 66 3 3 Stride length and width gait analysis for the CAG 140 mous e model of Huntingtons Disease .......................................................................................... 67 3 4 Striatal mRNA transcript in situ 33P hybridization of heterozygote CAG140 knock in mouse model of Huntingtons disease. ................................................. 68 3 5 Striatal mRNA transcript in situ 33P hybri dization of homozygote CAG140 knock in mouse model of Huntingtons disease. ................................................. 70 3 7 Cortical thickness of the CAG 140 knock in mice decrease over time compared to the nTG mice. ............................................................................... 73 3 8 No significant weight differences in the CAG 140 mouse model. ....................... 74 3 9 Representative images of NIIs and neuronal NeuN quantification ...................... 75 4 1 Slight behavioral improvements after rAAV5siHUNT2 injections are evident in Rearing behavior but not in the Accelerating Rotarod.. .................................. 89 4 2 in situ 33P hybridization of striatally enriched transcripts 14 and 26 weeks after rAAV5 siHUNT1 injections. ........................................................................ 90 4 3 in situ 33P hybridization of striatally enriched transcripts 14 and 26 weeks after rAAV5 siHUNT2 injections.. ....................................................................... 91 4 4 Reductions of NIIs are evident after shRNA injection into the striatum of CAG 140 heterozygous and homozygous mice. ......................................................... 92 5 1 Transcriptional downregulation of striatally enriched mRNA transcripts 14 and 26 weeks following rAAV5hGFP injections. .............................................. 103 5 2 Example of 33P radioactive in situ mRNA hybridization of various transcripts and verification of the hGFP transcript. ............................................................ 104

PAGE 10

10 5 3 Total DARPP32 protein reductions after rAAV5hGFP injection.. .................... 105 5 4 Quantification of total striatal cells shows no significant difference following rAAV5 hGFP injections in nTG mice. ............................................................... 106 5 5 NeuN stain ing reductions after rAAV5hGFP injections.. .................................. 107 5 6 GFAP positive staining 26 weeks after rAAV5hGFP injections in a nTG mouse. .............................................................................................................. 108

PAGE 11

11 LIST OF ABBREVIATIONS A2a Adenosine Receptor AAV AdenoAssociated Virus cAMP cyclic A denosine monophosphate CB1 Cannabinoid Receptor Type 1 CBA Chicken Actin cDNA complementary DNA CED Convection Enhanced Delivery CMV Cytomegalovirus CNS Central Nervous System CRB CREB binding protein CREB cAMP response element binding D1 Dopamine Type Receptor 1 D2 Dopamine Type Receptor 2 DARPP32 Dopamineand cAMP r egulated phosphoprotein of 32 kDa DNA Deoxyribonucleic acid eGFP Enhanced GFP GFAP Glial fibrillary acidic protein GFP Gree n Fluorescent Protein GPe Globus Pallidus External segments GPi Globus Pallidus Internal segments HD Huntington's Disease Hdh mouse huntingtin gene HEAT Huntingtin, Elongation factor 3, protein phosphatsase 2A, TOR1 HET Heterozygous

PAGE 12

12 hGFP Humanized Green Fluorescent Protein HOM Homozygous HSV Herpes Simplex Virus Htt H uman huntingtin gene IHC Immunohistochemistry KA Kainic ac id KI Knock In KO Knock Out mRNA messenger RNA Het Heterozygous Hom Homozygous NeuN Neuronal Nuclei NF nuclear factor kappalight chainenhancer of activated B cells NGFI A Nerve Grow th Factor Inducible A NIH National Institute of Health NIIs Neuronal Intranuclear Inclusions NMDA N methyl D aspartic acid nTG Non Transgenic PBS Phosphate Buffer Solution PCR Polymerase Chain Reaction PDE10a Phosphodiesterase 10a PDE1b Phosph odiesterase 1b PKA Protein Kinase A ppENK preproenkephalin QA Quinolinic acid

PAGE 13

13 rAAV recombinant AAV REST/NRSF Repressor Element Silencing Transcription Factor/Neuronrestrictive Silencing Factor RNA Ribonucleic Acid RNAi RNA Interferance RPM Revolutions P er Minute SCA Spinocerebellar ataxia shRNA Short Hairpin RNA siRNA Small Interfering RNA TBP Tata Binding Protein TAF TBP Associated Factor trs T erminal resolution sites YAC Yeast Artificial Chromosome vg Viral genomes

PAGE 14

14 Abstract of Dissert ation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF THE CAG 140 MOUSE MODEL OF HUNTINGTONS DISEASE AND THE EFFECTS OF RAAV DELIVERED SHRNA AND HGFP By AARON COATES RISING December 2010 Chair: Ronald J. Mandel Major: Medical Sciences Neuroscience Huntingtons disease (HD) is a fatal neurodegenerative disease caused by a poly glutamine expansion in the huntingtin gene. Currently there is no treatment or cure for HD which afflicts approximately 3 to 8 individual s out of 100,000. Since the discovery of the huntingtin gene in 1993, several rodent models have been generated to study HD. Here we e xamine the behavioral and histopathologic characteristics of one HD mouse model (CAG 140). consisting of 140 CAG repeats knocked into the 5 mouse huntingtin gene. Rearing, rotarod and gait behavioral analysis were performed once a month starting at 2.5 months out to 18 months Histopathological examinations, including mRNA transcriptional analysis and neuronal intranuclear inclusion (NIIs) quantification, were performed on a cross sectional cohort of mice starting at 3 months of age and examined out to 18 months We found significant behavioral and histopathological abnormalities in the knock in mice when compared to nontransgenic mice. The work performed here shows that the CAG 140 mouse is a suitable model for HD studies The CAG 140 model exhibit aspects of the HD in a more protracted natural history compared to other murine HD models As seen in other HD models and in

PAGE 15

15 humans, the transcriptional downregulation in the knock in mice as they age is one of the best characteristics of this model. In addition, the progressive NIIs increase over time could be used as marker of the disease progression. W e explored the use of rAAV delivered RNAi as a potenti al therapeutic for the disease by using a shRNA target ing the expanded htt allele. While knock down of mutant htt mRNA reduced the number of NIIs mice also displayed significant transcriptional dysregulation. Additio nally, the nonspecific shRNA and Green Fluorescent Protein ( GFP ) control s showed significant reductions in striatally enriched mRNA transcripts. Further investigation into the effects of the GFP controls indicated a significant loss of DARPP32 protei n, apparent loss of NeuN positive cells and an increase in g lial fibrillary acidic protein ( GFAP) positive astrocytes in the injected side. Our work here indicates GFP may not be the best reporter transgene and other l ess toxic reporters might need to be ex amined.

PAGE 16

16 CHAPTER 1 INTRODUCTION Huntingtons Disease Huntingtons disease (HD) is a fatal progressive neurodegenerat ive disease characterized by the gradual development of sporadic, involuntary motor movement called chorea. Other HD s ymptoms include depression dementia and personality changes as well as other motor skill abnormalities including clenching of the teeth (bruxism), and gait and ocular motor abnormalities (1 8) W hile HD is most associated with sporadic motor movement ; rigidity ataxia and slowed movements (bradykinesia) can also be seen in the later stages (2, 9) Symptoms early in the disease are slight and usually include chorea and the ocular motor deficits. As the disease progresses, motor skills continue to deteriorate and more cognitive and psychiatric abnormalities manifest themselves (10) The o nset of symptoms usually occurs in 30 to 50 year olds and the symptoms progress with the patients age. Histopathologically, HD mainly affects the medium spiny neurons in the striatum (11, 12) In addition, progressive cortical thinning (1318) striata l atrophy (1921) and striatal specific transcriptional dysregulation (2226) are also seen in HD patients. The main cause of death, which usually occurs within 10 to 20 years after diagnosis is pneumonia primarily due to the eventual ly bed ridden state the patients reach in the later stages of the disease (2729) Approximately 3 to 8 out of 100,000 individuals are estimated to have HD i n the United States. The prevalence of HD individuals ranges from 1 in 100,000 individuals in some European countries and Japan to as high as 7 in 1,000 in the Lak e Maracaibo region in Venezuela (3032) However, as noted by Spinney and Rawlins (33, 34) the prevalence may in fact be higher than what has been claimed.

PAGE 17

17 In 1993, the Huntingtons Disease Group discovered a single gene, huntingtin ( htt ) located on human chromosome 4 was directly linked with the occurrence of HD. The group found that in the first exon of htt the tri nucleotide CAG (which encodes for the amino acid glutamine) repeat region is abnormally expanded in HD patients (35) Normal individuals have between 6 and 35 CAG repeats whereas those with HD have T here are reports of indiv iduals with 36 to 39 repeats that do not exhibit any clinical manifestations (36, 37) but these are rare cases The age of HD symptom onset cannot be predicted but the development of symptoms tends to be inversely related to the number of CAG repeats in huntingti n (3840) HD patients typically have one expanded copy and one normal copy of the htt gene, but in some rare cases they have two expanded copies (41, 42) Disease progression in the homozy gous patients is much faster than the heterozygous HD patients (42) though the severity of the disease does not appear to be any greater in the homozygous individuals compared to heterozygotes (43, 44) Lengths of CAG repeats ranging from 2735 repeats have been shown to be unstable and as certain cells proliferate, CAG repeat regions can either expand or shrink If this CAG expansion occurs in germ line cells, these mutations can be passed on to the individuals children and potentially manifest into symptomatic HD (37, 45, 46) Triplet expansion is not limited to germ lines and has been reported in somatic cells for example in the striatum (47) There are a number of other CAG repeat diseases that have been collectively called polyglutamine diseases. These polyglutamine diseases include a number of the spinocerebellar ataxia s (SCA types 1 2, 3 6, 7 and 17), spinobulbar muscular atrophy

PAGE 18

18 (SBMA) also called K ennedys disease, Dentatorubropallidoluysian atrophy ( DRPLA) and HD. All of the diseases have a motor function component which may include ataxia, chor ea or dystonia and some l ike HD, SCA 1 ,SCA17 and DRPLA have cognitive deficits a ssociated with the disease (4852) Because all of these disorders are caused by the same expansion of a polyglutamine tract, it is thought that similar pathological pathways occur in each disease. If a treatment or therapy can be designed and successfully implemented in one expanded pol yglutamine disorder the same therapeutic concept might be able to be applied to the other diseases. HD Pathology Huntingtin is ubiquitously expressed in all cells throughout the body, but the central nervous system (CNS) and particularly the basal ganglia and cortex appears to be primarily affected (53 55) Other tissues and organs such as testes (53, 54, 56, 57) and muscle (5860) have displayed various adverse functional and physiological problems due to mutant htt While the testes and muscles do appear to be affected by the huntingtin expansion, the primary cause of the HD symptoms stem from the dy sfunction in the basal ganglia. The basal ganglia consists of the s triatum (c audate and putamen), g lobus p allidus ( e x ternal and internal segments), substantia nigra and the subthalamic nucleus. These structures are responsible for coordinating voluntary movements and suppressing unwanted involuntary movements. In the basal ganglia circuitry, there are two m ain pathways involved in the process of motor movement; the direct and indirect pathways (see Figure 11) The direct pathway involves neurons containing D1 receptors (called D1 neurons, which contain e nkephalin) and the indirect pathway involving neurons with D2 receptors (called D2 neurons which contain substance P) (6164)

PAGE 19

19 Direct P athway In nor mal functioni ng basal ganglia, the D1 neurons have inhibitory projections to the globus pallidus i nternal segment (GPi) The GPi has inhibitory projections to the thalmus which, in turn, has excitatory projections to the motor cortex. Overall, a ctivation of the D1 receptors results in the excitation of the motor cortex. Disruption of the direct pathway by the D1 neuronal loss or decreased D1 neuron activation induces more inhibitory signals being sent to the thalamus, leading to less excitatory input to the motor cortex and, subsequently, suppress ion of motor function (6568) A diagram of the pathway can be seen in Figure 11. Indirect P athway In the indirect pathway, striatal medium spiny neurons bearing D2 receptors project to the globus pallidus external segment (G Pe ) which, in turn, will generate an opposite net result to the D1 pathway. The GPe has inhibitory projections to both the GPi and the subthalamic nucleus. The subthalamic nucleus subsequently has excitatory projections to the GPi. Overall, in the indirect pathway, D2 receptor activation causes motor cortex inhibition Thus, D2 neuronal loss or decreased D2 activation promotes more excitatory input to the motor cortex (65 68) Cellu lar Signaling in the D1 and D2 N eurons D1 receptor activation increases cyclic adenosine monophosphate ( cAMP) levels inducing activation of protein kinase A ( PKA) which phosphorylates a highly enriched protein in the medium spiny neurons of the striatum called dopamineand cAMP regulated phosphoprotein of 32 kDa ( DARPP32) (6975) DARPP 32 modulat es various downstream neuronal targets, such as phosphotase protein ( PP1 ) inhibition (7679) The D2 rec eptors, when activated, cause a decrease in cAMP which will, i n

PAGE 20

20 turn, reduces the concentrati on of phosphorylated DARPP 32 (71, 74, 80) The downstream signaling of D2 activation is therefore the opposite of what is seen in D1 activatio n In addition to the D1 and D2 receptors, medium spiny neurons also express other receptors that help modulate the cAMP signaling pathways and subsequent regulation of DARPP32 and PP 1 such as cannabinoid type one (CB1) and adenosine (A2a) receptors (81, 82) Activation of CB1 receptors without D2 receptor activation on a D2 neuron decreases cAMP levels similar to D2 receptor activation alone (83) However, when both CB1 and D2 receptors are coactivated, there is an increase in cAMP accumulation (84) Adenosine receptors are expressed specifically on D2 neurons and upon activation induces cAMP accumulation similar to activation of D1 receptor s (81) Adenosine activation may potentially be a mechanism that is directly counteracting t he D2 activation in the D2 neurons (85) Two phosphodiesterases (PDE) that are found to be enriched in the striatum also regulate cAMP and DARPP32. Both PDE10a and PDE1b have be en found in the striatum (8688) and have been shown to catalyze the hydrolysis of cAMP and other cyclic nucleotide s (89, 90) These two proteins play a role in the activation of DARPP32 and the subsequent signaling pathways of the basal ganglia. HD and the Striatal P athways Reinier et al. determined that HD affected t he two striatal projection neuron populations neurons differently (91) Ensuing studies demonstrated that HD preferentially causes cellular dysfunction in the D2 neurons resulting in a stro nger motor cortex activation (6568) This strong motor cortex activation induces the characteristic c horea observed in HD patients. D2 subtype neur ons are the first striatal

PAGE 21

2 1 projection neuron population to be damaged and lose their inhibitory signaling in HD As the disease progresses, the D1 neurons also become damaged generating the rigid ataxia associated with the end stages of the disease (91, 92) As a marker for D2 neurons, enkephalin mRNA and protein levels were shown to be reduced in HD patients (24, 25, 63, 64, 91, 93, 94) The D2 receptor, CB1 and other striatal specific gene transcripts have also been reported to be reduced in patients (23, 9597) Recent mRNA microarray studies demonstrated that the expression of a significant number of transcripts and proteins were abnormally dysregulated in early stage HD patients compared to healthy individuals prior to D1/D2 neuronal degeneration. Differences in specific mRNA and protein levels before and after neuronal degenerat ion suggest that these genes and/or proteins can be used as pathological markers for HD progression (98, 99) Transcriptional Factors A ssociated with Huntingtin Decreased mRNA described in the previous section suggests transcriptional dysregulation in HD patients which might indicate that the mutant htt affects gene transcriptional regulation. One of the first trans cription al factors associated with htt was CREB binding protein (CBP). Although no direct interaction has been determined between CBP and wild type htt, various groups have shown mutant htt interacts with CBP in vivo and in vitro (100104) Steffan et al. concluded mutant htt appears to bind to CBP while Shimohata and Dunah found that TATA binding protein (TBP) associated factor II130 (TAFII130), a coactivator for CREB transcri ptional activation, can bind to long stretches of glutamines, which are found in mutant htt They also showed TAFII130 and TBPs in inclusion bodies of another human poly glutamine disease spinocer e bellar ataxia type 3 (SCA3)

PAGE 22

22 Another study examining the CBP regulated transcriptional pathways, found nuclear factor kappalight chainenhancer of activated B cells (NFregulated in the presence of mutant htt (105) Interestingly, NFhuntingtin protein via the several HEAT (huntingtin, elongation factor 3, protein phosphatase 2A, TOR1) motifs c ontained in huntingtin (106) Further evidence for NFet al. who showed that wild type huntingtin helped regulate the transport of activated NFthe nucleus (107) In the study Marcora et al. mutated huntingtin reduced the speed at which the neuron transported the N F (107) .The group suggested huntingtin associated protein 1 (HAP1) might be the intermediate between NFhuntingtin and the transport to the nucleus is hampered by the poly glutamine expansion in mutant huntingtin (107) The same group previously has shown that HAP 1 interacts with NeuroD, another neuronal specific transcription factor. The interaction appears to be modulated by huntingtin itself and helps with the activation of NeuroD (108) Wild type htt has been shown to sequester the transcriptional repressor factor REST/NRSF (repressor element silencing transcription factor/neuronrestrictive silencing factor) to the cytoplasm (109) Wild type htts ability to sequester a transcriptional repressor would results in an increase of downstream transcripts mutant htt appears to lose the ability to sequester REST/NRSF and allows larger quantities of the repressor to enter the nucleus. The net effect is a downregulation of a variety of transcripts, many of which are important in neuronal development, signaling and other transcriptional regulation (110, 111)

PAGE 23

23 In addition to the transcript ional factors mentioned above, Sp1 (102, 112) p53 (100, 113) NCoR (114, 115) and PGC (116, 117) are other transcription factors that have been shown to have their functions altered by the presence of mutant htt Regardless of htt function, the fact tha t mutant htt does associate with transcription factors is an important feature when examining the e ffect of the expanded poly glutamine mutation in mutant htt These mutant htt related aberrant transcriptional associations have radical downstream effects that could be the ultimate cause of the disease. In the current rodent models of HD, which will be discussed later in this chapter, there is clear evidence of transcriptional down regulation. DARPP 32 (118120) ppENK (119, 121) D2 (119, 122) CB1 (123125) and PDE10a (22, 26) as well as many other (119) have all been shown to be down regulated in various mouse models. More importantly these transcriptional abnormalities in the models of HD re capitulate what is seen in the human disease (126) Transcriptional and translational dysregulation could have major implications in HD pathology and the behavioral abnormalities of HD. Neuronal Intranuclear I nclusions Neuronal intranuclear i nclusions (NIIs) were first discovered in the striatum of the R6 /1 HD mouse model by Davies e t al. in 1997 (127) U sing an antibody (clone mEM48 ) against the aminoterminal of the mutant htt protein, a distinct nuclear staining pattern was observed in the R6/1 brain sections. The inclusion bodies that were stained with the EM48 antibody were f ound to be inside the nucleus and were dubbed neuronal intranuclear inclusions or NIIs In addition to the discovery and localization of the NIIs ubiquitin staining was colocalized to the same inclusion bodies. Later the same year

PAGE 24

24 DiFiglia found these N IIs in human post mortem patients and has subsequently been used as a pathological marker of HD (128) HD Models The first attempts to generat e a suitable animal model to study HD focused on inducing HD symptoms via injections of excitotoxic chemical s to induce neuron lesions O ne of the first excitotoxic chemicals used in an attempt to simulate the characteristic human HD symptoms and/or pathol ogy in rats was kainic acid (KA) When injected in the striatum of rats, KA induces an axon sparing lesion which causes a variety of motor and behavioral abnormalities similar to characteristic HD symptoms documented in human patients (129131) However KA also induces nonspecific cellular degeneration of the olfactory cortex hippocampus and other limbic structures which is not typical to human HD pathology (132, 133) In 1986, another excitotoxic reagent q uinolinic acid ( QA), a N methyl D aspar tic acid ( NMDA) receptor antagonist, was first characterized by Beal et al. (134) QA induced lesions cause rodents to display behaviors and pathology that more accurately imitates HD compared to other excitotoxic chemicals (13 4) In contrast to KA, QA lesions does not induce excessive nonspecific cyto toxicity and does not affect the striatum somatostatin and neuropeptide Y expressing medium spiny neuron subpopulations which are usually retained in HD patients (135137) Since QA lesions can cause HDlike behavior in rats and it is expressed endogenously in both human and rodent brain tissues, it was hypothesized that elevated QA levels could be the possible cause of HD (138) Later studies determined that although QA is present in HD patient tissues, QA expression is not upregulated in comparison to normal individuals (139141) W hile QAinduced lesions facilitated the

PAGE 25

25 study of the HD, the discovery of the causative gene in HD, hungingtin, allowed for genetic models of HD to be developed which mor e accurately model the disease. Mouse Models of HD Various HD rodent models have been developed to help understand the mammalian cellular pathways involved in HD. There are three general types of rodent models; the knock outs, transgenic and knock in models All three models have been extensively used to study HD and as well as to test therapeutic s. A general overview of a few of the most commonly used mouse models of HD are described below. KnockOut Mouse Models of HD The mouse homolog of the huntingtin gene, h dh, is approximately 90% homologous with human htt which suggests that the two homologs likely share similar functions in both species (142) Therefore studying mouse hdh in HD murine models may elucidate how wild type human htt functions and potentially the role of mutant htt in HD. Hdh k nock out (KO) models were generated to determine whether the lack of a functional wildtype hdh can induce HD like symptoms. Duyao et al. generated a null hdh mutant in 1995 by delet ing the 4th and 5th exons of the hdh gene. H omozygote Hdh( / ) null mice died around embryonic day 7.5 but heterozygote mice were not affected by the deletion (143) Similarly Nasir et al. inserted a neomycin resistance cassette into the hdh 5th exon to create a truncated Hdh mutant (~20 kDa vs. the normal ~340 kDa). The homozygote truncated Hdh mutation was also embryonic lethal. Homozygote truncated Hdh mice died anywhere from 7.5 to 12.5 days and like the Duyao null hdh mutant mice, the heterozygote mice were viable. (144) However the heterozygote mice from Nasir study displayed phenotypical differences from nTG mice which were not reported in the heterozygotes from the Duyao et al. study Heterozygote

PAGE 26

26 mice from the Nasir et al. report were more active in both light phases and their memory was impaired, as tested by the Morris water maze (144) Another Hdh KO mouse model was developed by Zeitlin et al. in which the promoter through the f irst intron of the hdh gene was replaced with the neomycin resistance cassette similar to how Nasir generated a truncated hdh mutant. Just like the previous KO models, homozygous mutant mice were embryonic lethal at approximately embryonic day 7.5. Disput ing Nasir but confirming Duyao, the heterozygote mice in the Zeitlin study did not appear to have any phenotypical differences when compared to the nTG (145) Conditional KnockO uts The insertion of either a human htt fragment or the expansion of the native hdh gene in mice has been invaluable in the study of HD. Just as useful has been the study of conditional knock outs where the reducti on of hdh or the removal of the wildtype hdh can be controlled. Dragatis et al. in 2000 developed a cr e lox system to re move the hdh only in the brain and after neonatal development (146) The cre gene is under the tissue specific promoter CamK2a and only activates post natally in the forebrain (147) When the hdh gene was turned off by the crelox system the gross morphology of the brains is similar to the nTG littermates up until 4 months where neuronal degeneration is observed in the cortex. Further neuronal degeneration is observed in these mice at approximately 8 months in the hippocampus, striatum, amygdala and cortex. Behaviorally these mice showed the classical HD clasping phenotype at about 2 months, and wire rod hanging and cage top rotation motor skill tasks showed abnormalities at around 3 to 4 months of age (146) Near or complete loss of huntingtin, as thi s study shows, is detrimental.

PAGE 27

27 Transgenic Mouse M odels of HD Transgenic model s have either the full length human huntingtin or a certain fragment of the human gene inserted into the mouse genome, with either the normal or an expanded CAG repeat region. The i nsertion is in addition to the endogen ous hdh gene. Examples of these transgenic mouse models are described below. The R6, N17182Q and the YAC transgenic mice models are among the most widely used in the field. Tetracycline regulated transgenic Yamamoto et al. generated a tetracycline regulated transgenic HD mouse model (148) Here a tetracycline responsive element is placed in control of an htt transgene with 94 repeats. When tetracycline is introduced to the diet of the mice, the transgene is turned off. Transgenic huntingtin mice, when administered tetracycline, showed a decrease in the hind limb clasping phenotype and aggregations in striatal tissue was reduced in the treated animals. In particular the tetracycline feed mice showed an increase in striatum s ize compared to t he mice not feed tetracycline (148) While the tetracycline mouse line is conditional knock out model and not an ideal model for HD, it was utilized as a method of determining if removal of mutant htt would alleviate all symptoms of the di sease. In this study, reductions of the mutant htt appear to alleviate the HD like symptoms. R/6 m odel T he first transgenic mouse models of HD was developed in 1996 by Mangiarini et al. (149) The R6 models contain the 5 of the untr anslated region, the first exon, and 262 base pairs of the first intron of the htt which is inserted into the mouse genome. The entire human transgene is driven by the htt promoter. There are two main lines

PAGE 28

28 generated in this fashion that are commonly used, the R6/1 and the R6/2 which have 116 and 144 repeats respectively placed into the CBA x C57BL/6 mouse background. The gene expres sion levels of the R6/1 and R6/2 in relation to the endogenous mouse huntingtin are 75% and 35% respectively. Cognitive deficits are observed at about 4 weeks in R6/2 mice and at 10 to 12 weeks in the R6/1 mice (150153) These R6 mice show resting tremors, clasping behavior when held by the tail, gait abnormalities and other motor skill deficits occurring approximately at 5 to 9 weeks in the R6/2 mice and 8 and 9 weeks in the R6/1 line (149, 154) The pathological hallmark of HD, NIIs were found first in the R6 lines and has since been one of the most utilized histopathological marker in models of HD as well as in humans (127, 1551 58) Transcript levels, similar to what is seen in humans, are dysregulated in the R6 mice (22, 26, 124, 125, 159, 160) N17182Q N17182Q model uses the prion promoter that creates the first 171 amino acid residues of htt The expanded glutamine repeat region contains 82 repeats and causes a progressive neurodegenerative disease simi lar to HD (157) Phe notypical l y these mice did not show any major differences until approximately 12 weeks of age. At 12 weeks the transgenic mices weight plateaus unlike their nTG counter parts who continual gain weight. Like the R/6 mice, subsequent studies have shown large amounts of gliosis and neuronal a poptosis that appear at around 12 weeks (161) Tremors are evident at 16 weeks and hypoactivity is observed at around 20 weeks of age (157) Behaviorally the N17182Q mice showed little differences to the nTG control mice in rotarod latency to fall or beam walking tasks ou t to 12 weeks where after the mice p rogressive accelerating rotarod deficits (157, 162) Gait abnormalities in

PAGE 29

29 particular the stride length of both front and rear paws, is significantly shorter at 16 weeks (163) The N17182Q mice have an shortened life span and usually die at ~20 to 24 weeks of age (157) YACs The same year the Bates R/6 mouse models w ere being developed, Hodgson et al. (164) developed a full length model of HD in the mouse. Using yeast artificial chromosomes, the group inserted the full length human HD gene into the mouse. Localization and expression of the transgene was similar to hdh and these YAC mice usually have one or two transgene copies inserted into the genome. Three YAC mice were developed that contained 18, 46 and 72 CAG repeats in the YAC transgene (164, 165) The full length expanded gene inserted into the mouse genome displays neuronal degeneration in the 72 CAG repeat line. The degeneration observed was anywhere from 4 to 40% medium spiny neurons at approximately 12 months of age. There was no obvious degeneration in the YAC18 or the YAC46 lines. Histopathologically the YAC72 mouse line shows an increase of htt N terminal staining in the nucleus Behaviorally these mice showed early hyperac tivity and late hypoactivity (164, 165) A larger poly glutamine mouse was created in 2003 with a 128 CAG insertion. The YAC128 s showed significantly early onset of the hyperactivity starting at 3 months compared to the 7 month onset of the YAC72 mice. Twelve month ol d YAC128 mice showed an average of 18% neuronal loss (166) KnockI ns The Knock in models have portions of the human htt replacing the corresponding mouse hdh hom olog. Another version of a knock in is the artificial expansion of the

PAGE 30

30 endogenous hdh polyQ region. The knock in models, therefore, have the ability to have a heterozygote and a homozygote genotype. Initial studies of human htt knock in mice by Levine et al. created a model of HD by replacing the 5 portion of the hdh gene with the corresponding human portion of the htt gene. The 5 portion of the hdh exon 1 starting at 18 bas pairs before the polyglutamine region into the first intron was replaced with the corresponding human htt Two lines were generated with either 71 CAG repeats or 94 repeats. The CAG 71 mi ce did not show any behavioral or histopathological abnormalities associated with HD in mouse models. The CAG 94 line, however, showed hyperactivity at approximately 2 months and hypoactivity at 4 months. Micro aggregates show up at 6 months and progress to NIIs at 18 months. The CAG 94 knock in model also showed cellular dysfunction but no noticeable cellular loss (121, 167, 168) The same group later created a knock in model with 140 repeats (169) Similar to the previous models with 94 repeats there is an early hyperactivity followed by a decrease in activity when compared to their nTG litter mates. Aggregates (NIIs) are present in the striatum, cerebellum, cortex and olfactory tubercles of the CAG 140 mouse model at approximately 4 months of age. More recent studies have shown that homozygote CAG140 mice had behavioral abnormalities such as open field and running wheel activity deficiencies at select time points early in the course of the disease and slight sex differences in home cage activities The later studies also showed DARPP 32 protein reductions and cortical gliosis that start at 12 months along with striatal gliosis starting around 23 months (170, 171)

PAGE 31

31 Striatal electrophysiological properties in the CAG 140 mice exhibit similar properties to the R6 mouse line. These include lower spontaneous excitatory postsynaptic currents (EPSCs) and higher spontaneous inhibitory postsynaptic currents (IPSCs) in the medium spiny neurons of the striatum (172) Pre frontal cortex electrophysiology examinations have revealed that the CAG 140 mice tend to have no significant differences in spontaneous firing rates or bursting activity when compared to their nTG counterparts, unlike the R6 mice which showed significant increases (173) However, t he same study found that cortical spike synchrony was diminished in both the CAG 14 0 and the R6 mice. The group suggested that some of the phenotypical motor differences observed between the R6 and the CAG 140 mice could be due to differential spontaneous firing and bur sting activities but that the similar asynchronous firing may contribute to the striatal signaling abnormalities observed in both mice (173) Th e CAG 140 model will be the model used in our studies and will be further characterized in the first part of the work done here. Another knock in models include s the Hdh (CAG 150) model and was created by Lin et al. and showed a similar phenotype to other full length knock in HD models (174) Behaviorally both heterozygous and homozygous Hdh (CAG 150) mice showed lower homecage activity, clasping phenotype, gait abnormalities and NIIs. A longitudinal study of the Hdh (CAG 150) has shown that the majority of m easurable behavioral phenotypes are not significant till around 70 to 100 weeks of age. Rotarod deficits, beam walking abnormalities and clasping behavior were all observed between 70 and 100 weeks. Histopathologically the Hdh (CAG 150) mice show an increase in NIIs at around

PAGE 32

32 52 weeks and a decrease in NeuN (a neuronal marker) staining decreases at around 100 weeks (174, 175) Shelbourne et al. expanded the CAG region in hdh to 72 or 80 repeats and the resulting mice exhibited social abnormalities such as higher aggression (176) The Shelbourne mice did not show any significant histological difference other than a 1015% reduction in overall brains size when compared to their wildtype littermates (176) Inclusion bodies associated with HD appear in the 80 CAG expanded hdh model at approximately 15 months (176) Both the 72 and the 80 CAG repeat mice showed early aggression com pared to their nTG littermates. In a similar fashion to the mice generated by Levine and Menalled created a chimeric hdh/htt expanded CAG knock in mice that either expressed 92 or 111 repeats (177) These Q92 and Q111 knock in mice show the hallmark aggregates starting at as diffuse staining and progress to full NII inclusions. Full NIIs were evident starting at 40 weeks in the Q111 mice. Both the heterozygote and the homozygot e mice in the 111 repeat model have shown abnormal gait which consists of a shortening of the stride length and an increase in stride width at 96 weeks (178) Like other knock in mice, life span was not drastically affected (178) Gain of Toxi c Function HD pathology is generally thought to be caus ed by a gain of toxic function by mutant htt Aberrant transcriptional factor binding (100, 102104, 112, 113, 115117, 179) would suggest that mutant htt has gained an additional role that would bind these transcriptional factors more tightly than wild type huntingtin. Furthermore, heterozygous mice generated from the knock out mice created by Zeitlin and Dauyo (143, 145) and the viability of homozygous knock in mice (168, 169) suggest that a lack of wildtype

PAGE 33

33 huntingtin is not the cause of HD. If the mutant htt did not perform the wildtype functions, then both the heterozygous knock out mice and homozygous knock in mice would not be viable and would be embryonic lethal, as seen in the homozygous KO mice If HD is caused by a gain of toxic function in the mutant htt then removing the toxic protein should alleviate the disease. Adeno Associated Virus (AAV) Basic B iology AdenoAssociated Virus (AAV) is a single stranded DNA (ssDNA) parvovirus which requires a helper virus, either a herpes virus or adenovirus, to assist in its replication AAV is able to infect both dividing and nondividing cells. Although AAV can incorporate s its genome into that of the host cell it does not cause any known disease and stimulates only a weak immune res pons e Wild type AAV genome is approximately 4.7 kilobases and encodes two genes cap and rep (180) The cap gene contains three open reading frames for the capsid proteins VP1, VP2 and VP3 (181) The rep gene is responsible for the viral genome r eplication and encodes for the proteins Rep78, Rep68, Rep52 and Rep40. Two promoters and alternative splicing creat e s the four polypeptides from just rep gene. T he adenovirus proteins E1A, E4 and E2A help facilitate the AAV genome transcription, gene regulation and translation respectively together with the 4 AAV rep proteins, Rep78, Rep68, Rep52 and Rep40 (180, 181) At the 5 and 3 ends of the AAV genome are palindromic repeat regions referred to as invers e terminal repeats (ITRs) which act as the start sites for DNA replication and packaging signals (182) The 3 ITR acts as the primer for replication, allowing DNA polymerase to begin synthes i s of the second DNA strand. After replication of the AAV

PAGE 34

34 genome, the ITRs help in the loading of the genome into the viral capsid, if the ITRs are not present or lost, genome packaging can not occur (180) Serotypes There are many different types of AAVs serotypes that have been discovered over the years (183185) Most of these serotypes can be divided into groups or clades that are related to one another by their similar genetics. Gao defined a clade as a group of three or more AAVs that were phylogenetically similar. As of now, there are 6 clades and a variety of independent clones (183) Each of the AAVs in a particular clade has little or no serologic cross reactivity to o ther clades. Thus if a new AAV is discovered and does not have serological cross reactivity to any of the known clades, it would be considered an independent clone. If two more clones were found to be serologically related to this virus a new clade could be identified Receptor Binding and E ntry Two receptors are responsible for AAV infectivity, one for cell surface bindi ng and the second for endocytosis. AAV2 was shown to bind to a cell surface protein in permissive cell lines and the entry could be abolished by tryps i nization of the culture (186) Further studies determined that the proteins involved in particle binding were glycosylated and led groups to determine that the proteoglycan, heparin sulfate proteoglycan, was responsible for AAV2 binding to cell surfaces (186 188) The coreceptor for endocytosis is not a single receptor in AAV2. Human fibroblast growth factor receptor 1 (FGFR1) (186) V 5 integrin (189, 190) hepatocyte growth factor receptor (c Met) (191) (192) and laminin (193) have all been implicated as coreceptor of AAV 2 binding and subsequent internalization. Similarly there are a wide variety of coreceptors for the various serotypes that have been

PAGE 35

35 isolated (189, 193197) PDGFR and 2,3 N linked sialic acid are coreceptors for AAV 5 (194, 195) ; 2,3 N linked sialic acid and 2,6 N linked sialic acid are coreceptors for AAV 1 and 6 (196) ; and l aminin has been found to be the coreceptors for AAV 2, 3, 8 and 9 (193) After the internalization and creation of an early endosome, the virus particle exposes nuclear localization signals on the VP1 and VP2 subunits of the capsid (198) The exact route to the nucleus i s currently still under debate and various groups have suggested passage to lysosom es or to the Golgi apparatus (181, 199) Once the particle reaches the nucleus, whether uncoated or not, the ssDNA genome of the AAV needs to be synthesized into dsDNA in order to produce viable gene expression. rAAV The use of AAV as a potential vector in gene therapy was not fully explored until it was determined that the capsid protein could be provided in trans and yield a viable virus particle that does not replicate after infection (200) The cap gene was replaced with a neomycin cassette, and a plasmid containing the cap gene was introduced separately in to the culture. The resulting virus produced expressed the resistance gene when culture cells were infected (200) The only component s necessary in cis from the original AAV genome are the 145 base pairs ITRs. The cap and rep genes can be provided in trans to produce a viable recombinant AAV (rAAV) with a transgene cassette between the ITRs (182) Production of rAAV took a step further when the helper proteins from Ad were also provided in trans in another plasmid (201) The additional plasmid containing the necessary helper proteins negates the need for using an actual helper virus (201) The most current and effective producti on of rAAV have

PAGE 36

36 come from using baculovirus or HSV helper proteins on separate plasmids rather than using the Ad helper proteins (202 205) AAV Ps eu dotyping Since product ion of rAAV has been streamlined for the AAV2 serotype, various ps eudotypes of the virus have been made. Utilizing the ITRs in the genome of the AAV2 genome, these ps eudotypes have the cap proteins of the desired serotype but use the rep protein from the A AV2 virus (206) The subsequent production is exactly the same descr ibed in the previous section. To differentiate between these different types the nomenclature, rAAV 2/n is sometimes used. The n here depicts the capsid type. Cell tropism of the pseudotyped rAAVs is determined by its capsid identity. Neuronal Targeting One of the first examples of neuronal AAV tropism was performed by Davidson et al. in 2000 (207) Here, the group examined the AAV serotypes 2, 4 and 5 and found that AAV 2 and 5 transduced striatal neurons effectively while AAV4 transduced ependymal cells. Bur ger et al in 2004 compared AAV 1, 2 and 5 and found that while AAV 2 does appear to infect a wide variety of brain structures including the striatum, thalamus, substantia nigra and spinal cord, both AAV 1 and 5 give a greater trans duction efficiency and distributi on (208) These studies along with numerous others have greatly expanded the known tropisms in the brain of the widely used AAVs (185, 207212) To date, there are approximately 10 main serotypes being used in studies infecting various regions of the brai n and each serotype has a varying degree of expression depending on the region being infected. AAV 1, 2 and 5 can all infect the striatum, but the degree of transduction is not t he same. The degree of transduction

PAGE 37

37 may also vary from species to species. For instance, in mice rAAV5 infectivity is overall greater degree than rAAV8 but in rats rAAV8 appears to infect neurons to a greater extent than rAAV5 Table 11 give the relative hierarchy of serotype infectivity in the rodent CNS of AAV 1, 2, 5, 8, 9 and 10 (207209, 211214) RNAi Fire et al. in 1998 discovered that injecting both sense and anti sense RNA corresponding t o endogenous mRNA resulted in a reduction of t he corresponding protein (215) This phenomenon, called RNA interference (RNAi), has become an import ant tool in the field of biology. The importance of RNAi discovery was recognized with the awarding of the Nobel Prize to both Andrew Fire and Craig Mello in 2006. Currently there is a wide use of variations of the RNAi, such as short interfering RNA (siRNA), short hairpin RNA (shRNA) and microRNAs (miRNA). Each of these versions degrades the corresponding mRNA but the proc essing of the different forms varies slightly There are two main pathways associated with RNAi, the siRNA pathway and the miRNA pathway Both reduce the production of protein but in slightly different ways. siRNA pathway causes protein reduction by degradation of the mRNA while the miRNA pathway inhibits translation of the mRNA by creation of P bodies. Below are brief descriptions of both pathways. si RNA Pathway The siRNA pathway begins with dsRNA that has been introduced to the cell by a virus or other artificial means. Dicer, an endonuclease, cleaves longer dsRNA (>25nts) into shorter ~21 nucleotide siRNA fr agments with 2 nucleotide 3 o verhangs (216218) In mammals and C. e legans only one Dicer is responsible for cleaving these long

PAGE 38

38 dsRNA into the smaller siRNAs (219, 220) Other species such as Drosophila and many plants, m ultiple Dicer or Dicer like proteins help in the processing of dsRNA (220222) After Dicer cleaves the long dsRNA into ~21 nucleotide siRNAs the catalytic protein Argonaut e is recruited and forms the RNA induced silencing complex (RISC) (223) The Argonaut e protein is comprised of 2 basic functional regions, the PAZ (224226) and the PIWI regions (227229) The PAZ region loads the 3 overhang of the siRNA into the RISC in part (224, 225) The PIWI domain is considered to be an RNAse H like domain (230) and helps in the degradation of the passenger strand of the siRNA (231234) After the degradation of passenger strand, the PIWI domain facilitates in the degradation of the mRNA (228, 229) The target mRNA is cleaved by the PIWI domain of Argonaute between the base pairs corresponding to the 10th and the 11th nucleotides of the siRNA (235, 236) A simplified pathway can be seen in Figure 12. miRNA Pathway Normally miRNAs are encoded in the genome of organism s and are transcribed into an ssRNA which form large secondary structures These long ssRNAs, called pri mRNA, produce large stem and loop structures ( See Figure 12 ) In the nucleus Drosha with the help of DGCR8, cleaves the pri miRNA at certain points in the stems to produce smaller stem loop structures called premiRNAs (237240) After Drosha/DGCR8 cleavage, the premiRNA is exported out of nucleus and into the cytoplasm the by the RanGTP dependent Exportin 5 (241243) Once in the cytoplasm the premiRNA is cleaved at the stem loop base by the endoribonuclease protein, Dicer and conver ted to the final miRNA (216, 217) From here the process is similar to the siRNA with one exception at the end. miRNAs are normally not 100% complementary to their target mRNAs and these mismatches can

PAGE 39

39 result in translational repression rather than mRNA degradation. In addition, in mammals miRNA binding sites are typically in the 3 UTR of mRNA, rather than in the coding regions. The RISC containing the mismatched miRNA can bind with the corresponding mRNA and for m P bodies where the mRNA can either be degraded or sequestered (244248) If the miRNA does not have mismatches, the mRNA will be degraded as seen in the siRNA pathway. shRNAs One for m o f commonly used RNAi is shRNA which consists of one continual RNA strand with a stem and a loop, similar to miRNAs. The stem is what contains the sense and anti sense portions of the RNAi. The shRNA construct can be constitutively expressed when placed after an appropriate Pol III promoter and can be introduced to a cell as plasmid or viral vector. Similar to miRNAs, the shRNAs are generated in the nucleus and transported out by Exportin5 (241) Unlike the miRNAs however, the shRNA enters siRNA pathway at Dicer and the loop is cleaved off approximately 22 nucleotides from the 3 terminus of the stem (249) The resulting siRNA enters the RISC and subsequently degrades its target mRNA (250, 251) RNAi considerations One problem of RNAi is the off targeting phenomena. An RNAi molecule that is meant to knock down a transcript may inadvertently reduce expression of another mRNA. The inadvertent off targeting has primarily to do with the target sequence itself. Because the siRNA and shRNAs that are incorporated into the RISC are approximately 21 nucleotides long, it is quite likely to have some sequence homology to another mRNA that was not intended to be targeted. Lewis et al. found that the nucleotides from 2 7 in the 5 portion of the anti sense strand, called the seed sequence, are the primary

PAGE 40

40 sequences used by the RISC to suppress translation and lead to RNA turnover in the miRNA pathway (252) The smaller seed sequence greatly increases the likelihood of potential off targeting. Not surprisingly, Jackson et al. found multiple transcripts that contained the complementary regions to seed sequence of one siRNA were reduced regardless of the si RNA or shRNA concentration or delivery method (253) Work performed since the seed sequence discovery has indicated that the region is a requirement for target recognition (254, 255) While the seed sequence may allow for other mRNAs with a complement to t he region to be down regulated, nucleotides 9 11 appear to assist mRNA recognition (256) Hypothesis In order to better understand the progression of the CAG 140 mouse model, we tested the hypothesis that the insertion of 140 CAG repeats in the mutant huntingtin allele in the CAG 140 mouse model would elicit behavioral and histopathological differences. With the use of RNAi and the ability to specifically knock down one allele in the CAG 140 mouse model we also hypothesized that reductions of the mutant huntingtin would lead to im provements in the CAG 140 phenotype.

PAGE 41

41 Figure 11 Schematic diagram of the indirect and dir ect pathways found in the Basal Ganglia. Image modified from Yin et al. 2003 (257)

PAGE 42

42 Figure 12 Dia gram of RNAi pathways in a mammalian cell Image modified from diagram in Cullen 2005 (258)

PAGE 43

43 Table 11 Differences in infectivity rates of AAV serotype between rats and mice RAT: AAV 10 MOUSE: AAV 10 > AAV 9 > AAV 7

PAGE 44

44 CHAPTER 2 MATERIALS AND METHODS Animals and Tissue P reparation Ten week old CAG140 knock in mice on the C57/ BL6 background strain (169) were used for behavioral and histological experiments (a kind gift of Scott Zeitlin). A portion of the first exon of the hdh gene was replaced with the human equivalent (169) The knockedin region spans from 18 base pairs upstream of the CAG repeat region through the 100 base pairs of the first intron and introduces approximately 140 CAG repeats (169) Genotype determination was performed by PCR analysis after isolation of genomic DNA from tail snips. PCR primers for the nTG gene are as follows: F5 ACGCATCCGCCTGTCAATTCTG 3 and R 5 CTGAAACGACTTGAGCGACTC 3. Primers for the knock in gene are F5 GCCCGGCATTCTGCACGCTT 3 and R5GAGTACGTGCTCGCTCGATG 3. An initial 5 minute 94oC was followed by 36 cycles of 30 seconds at 94 oC, 30 seconds at 65 oC and 1 minute at 72 oC. Following the last cycle a final elongation step was performed at 72 oC for 7 minutes. PCR samples were run on a 2 % agarose gel and genotype was determined by either the presence of the nTG band at 534 base pairs and /or the knock in band at 287 base pairs. For all behavioral experiments 8 nTG mice, 13 heterozygous, and 4 homozygous mice were tested. In addition, mice at 3, 6, 9, 18, and 24 months of age were used for the in situ hybridization study as well as the immunohistochemistry (IHC) quantification of inclusion bodies and cortical thickness. The number of mice used in these cross sectional studies varies and are indicated in t he appropriate figure legends. No gender differences were observed in the study.

PAGE 45

45 Mice were euthanized with a pentobarbital overdose (>150mg/kg) the brains were removed and stored at 80C until further processing. All appropriate housing and handling procedures were followed in accordance with the Institutional Animal Care and Use Committees at the University of Florida. Plasmid and rAAV Preparations siHUNT1 and siHUNT2 were developed previously by Rodriguez Lebron et al. (259) T he shRNAs were originally designed to target the R6/1 transgene and in the CAG 140 model, only siHUNT2 targets the knock in htt gene. The siHUNT1 shRNA targets the sequence: 5GCCG CGAGTCGGCCCGAGGC 3 which originally targeted the human 5 UTR region which is not present in the CAG 140 mouse strain siHUNT2 targets the sequence 5 GGCCTTCGAGTCCCTCAAGTCC 3 which is immediately upstream of the CAG repeat region in the human portion of the knock in htt gene. The shRNAs were cloned into the rAAV pSOFF H1p hrGFP vec tor backbone with BglII/HindIII restriction enzyme sites. The shRNAs expression is driven by the human RNase P H1 promoter while the hrGFP gene is driven by the herpes simplex virus thymidine kinase promoter. hrGFP was originally cloned from cDNA encoding the humanized Renilla reniformis GFP (Stratagene, La Jolla, CA, USA). Control rAAV5 GFP was cloned using the UF11 vector backbone containing the hGFP created by Zolotukhin et al. (260) The hGFP transgene is driven by the CMV enhancer/ CBA promoter. rAAV viral production was performed by the U niversity of Florida Powell Gene Therapy Center Vector Core Facility as described previously (261) Viral titers ranged from 1.7 to 5.7 x 1013 vg/ml.

PAGE 46

46 Intrastriatal Surgical Injections of rAAV Vectors Mice were anesthetized with isoflurane by inhalation. After the mice were anesthetized, hair was shaved from their heads and a 2 mg/kg intraperitoneal injection of Mannitol (stock solution 30% v/v) was given approximately 15 minutes prior to the ster e otaxic injections. Mice were then placed in a ster e otaxic frame (Kopf Instruments, Tujunga, CA) for intr acranial injections. The anterior posterior (AP) and medial lateral (ML) stereotaxic coordinates (AP +1.0, ML 1.8 and AP +0.4, ML 2.1) were measured from bregma with an empirically determined flat skull. A burr hole was drilled in the skull at the desired coordinates determined from bregma and the dorsal lateral ster e otaxic coordinates was then measured from the dural surface (DV 3.3 and DV 3.4 respectively). A glass micropipette was fitted onto a 10 l Hamilton microsyringe and both were attached to a continuous infusion system (Carnegie Medicin, Sweden) to coordinates indicated above. The rAAV was injected at a rate of 0 5 l /min and the needle was allowed to stay in place for 1 additional minute. Following the 5 minutes the needle was retracted 1m m for an additional 4 minutes. After a total of 9 minutes the needle was removed entirely. Two injections sites in the right striatum were used for the unilateral histological studies and 2 injections sites in both striatal regions were injected for the behavioral studies. All appropriate housing, handling and surgical procedures were followed in accordance with the Institutional Animal Care and Use Committees at the University of Florida.

PAGE 47

47 Rearing Behavior nTG, heterozygous and homozygous mice were individually placed in 1 L beakers in the dark and videotaped for 10 minutes. Testing was performed at the end of t he light cycle for the mice. The tapes were viewed by an individual who was ignorant of the mouse genotype whom determine the number of times the mice reared up and touched the side of the beaker with their front paws. Rears that did not include a front paw touch were not counted. Average number of rears per minute was calculated. The rearing task was performed once every two weeks initially and then once a month w hen the mice were 4 months old. Rota r od The accelerating rotarod (Columbus Instruments, Colum bus OH ) started at 5 RPM and increased in speed at 0.3 RPM per second. The mice were allowed to stay on the apparatus until they fell off. The time that each mouse fell off was noted. The test was performed 4 consecutive times per day over 3 consecutive d ays. The maximum speed was then calculated from the latency to fall. A minimum of 1 .5 minutes between each trial was allowed. We were unable to perform the r otarod test in the 15 month year old mice In addition, we measured the latency to fall off the rotarod at two different constant speeds. The constant speed rotarod had two speeds. Starting at 10 RPMs, the mice were allowed to continue to run on the rod until they fell or until 60 seconds elapsed. The test was performed again at 18 RPM The test consis ted of two consecutive 10 RPM 18 RPM switches over two consecutive days following the accelerating rotarod task described above. A minimum of 1 .5 minutes between each trial was allowed. We were unable to perform the r otarod test on the 15th month.

PAGE 48

48 Gait A nalysis A gait apparatus with a runway of 50 cm by 10 cm wide with 10 cm high walls was used to test gait. Each mouse was initially placed in a dark goal box for 5 minutes with a Froot Loop. The mouse was then taken out of the goal box shown the well lit runway corridor and then placed back into the dark goal box for 1 minute. Next, the front paws of the mouse were painted blue and the rear paws painted orange with nontoxic water bas ed paint. White paper was laid down along the corridor floor The mouse was then placed at the opposite end of the corridor from the goal box and allowed to return to the goal box on its own volition. Based on the marked colored foot prints, the distance b etween the front and rear paws ( g ait w idth ), and the distance between the front footprints of the consecutive steps ( g ait l ength) were measured. In subsequent tests, mice were only allowed in the goal box for 1 minute before their feet were painted. In Si tu H ybridization Freshfrozen mouse brain tissue was sectioned at 14m on a cryostat. Approximately 25 slides with 4 to 5 sections per slide for each animal were used for both IHC (see next section). In situ hybridization was performed on representative coronal mouse brain sections (bregma +1.70 to 0.50) mounted on slides by using radiolabeled (33P) genespecific antisense oligonucleotide probes. The probes targeted dopamine and cyclic AMP regulated phosphoprotein with molecular weigh t 32 kDa ( DARPP32), pre pro e nkephalin (ppENK), p hosphodiesterase 10a (PDE10a), p hosphodiesterase 1b (PDE1b), d opamine r eceptor t ype 2 (D2), cannabinoid r eceptor t ype 1 (CB1), n euronal g rowth f actor I A ( NGFi A also known as zif 268) d ynamin and acti n. The methods employed for in situ hybridization and hybridization signal quantification have been described previously in detail (22, 26, 119, 124, 259)

PAGE 49

49 Quantification of Transcripts To determine the relative mRNA transcript levels, optical density (OD) was calculated using the Quanti t y One analysis software from BioRad (Hercules, CA). B ackground intensity was subtracted and the resulting actin transcript levels. Heterozygo te and homozygote percentages were determined based on nTG levels. For analysis after rAAV5 injections, transcripts from the injected side were compared with those from the uninjected side Immunohistochemistry Slides for IHC staining were washed 3 times with PBS, fixed with 4% paraformaldhyde for 15 minutes. The slides were then washed 3 times with PBS, and then the samples were treated with 3% (v/v) hydrogen peroxide and 10% methanol solution for 10 minutes. Subsequently a blocking st ep was performed using 7.5% (v/v) natural horse serum (NHS) and 0.1% TritonX100 solution for 2 hours at room temperature. Primary mouse antibodies anti htt mEM48 (MAB5374, Millipore Billerica, MA, 1:2000 dilution), anti NeuN (MAB377, Millipore, 1:1000 di lution), and anti GFAP (mouse anti GFAP MAB360, Millipore, 1:1500 dilution ) were diluted in 1% NHS and 0.1% TritonX100. Primary antibody solutions were applied to the slides overnight at 4oC using HybriwellsTM (Grace Bio Labs, Bend, OR) After washing sl ides with PBS, they were incubated in biotinylated horse anti mouse secondary antibody with 1% NHS and 0.1% TritonX100 for 2 hours at room temperature. ABC solution from the Vectastain ABC kit (Vector Laboratories, Burlingame, CA) was applied to prime the secondary antibodies on the tissue for an hour before NovaRed (Vector Laboratories) visualization was performed. Slides were then allowed to dry overnight and an alcohol dehydration procedure was performed before coversliping the slides.

PAGE 50

50 Near infrared (I R) staining was preformed to quantify the DARRP 32 protein levels in the striatum of the injected mice. A similar fixing and blocking procedure was performed as described previously without the hydrogen peroxide/methanol incubation step. Slides were incubated with antibodies against DARPP 32 (Rabbit anti DARPP 32 EP720Y, Cambridge MA, 1:7,500 dilution) and GFP (Goat anti GFP ab5450, Abcam, 1:1000 dilution) with 1% natural donkey serum (NDS) and 0.1% TritonX100 was applied to the slides overnight at 4oC us ing HybriwellsTM (Grace Bio Labs, Bend, OR) After washing the slides with PBS, they were incubated in 1% NDS, 0.1% TritonX100 and donkey anti rabbit and donkey anti goat IR 2nd antibodies at a 1:500 dilution (Donkey anti Goat 800 CW, 9263324 and Donk ey anti rabbit 680 CW, 92632223, Li Cor Lincoln, NE) for 2 hrs at room temperature. Slides were then allowed to dry overnight and an alcohol dehydration procedure was performed before cover slipping the slides and collecting data with the Li Cor IR Odyssey scanner. Quantification of Inclusion Bodies and NeuN P ositive Cells Using the program Stereo Investigator (MBF Bioscience, Williston, VT) striatal regions of the brain sections were outlined using the optical fractionator function. Using approximately 300m separation between each stop in the setup parameters a representative number of inclusion bodies were counted in one brain section. Five sections left and right, were counted for the initial quantification of the CAG 140 model. Two sections, left and right, were quantified for the therapeutic assessment following rAAV injections. Average number of inclusions per stop was calculated from at least three animals per analysis group. Because each section was 14 m thick a true unbiased stereological estimat ion of NIIs or NeuN positive cells was impossible. However, this sampling method yielded an estimated of NII and NeuN cell density

PAGE 51

51 identically for each animal. To avoid reporting the estimated numbers which may not be truly representative of actual NII num bers, we normalized each animal to the mean of the 6 month NII density in order to give an index of percentage increase over the sixth month time point in the initial quantification for the characterization A percentage of the uninfected striatal region w as calculated for the animals in the AAV injections studies. We calculated the percentage decrease on the injected side from the uninfected side for the NeuN positive cells. For analysis after rAAV5 injections, injected stri a tal regions NII levels / NeuN positive cells were compared with uninjected striatal regions Cortical Thickness Measurements of cortical thickness were determined using the Quantity One program from BioRad The average thickness of 3 sections from the left and right hemispher es was determined from the anti dynamin in situ hybridization films. Animals with less than 2 sections available to measure were not included in the average. Qualitative Analysis of GFAP Staining Qualitative analysis of the GFAP + cells was performed by an individual who did not have knowledge of the genotype, age or injection location. Astrocytic like cell bodies were assessed from the anti GFAP stained sections and the score for each animal was given as follows; no observable astrocytic bodies: 0 ( ), few astr o cytic bodies present: 1 (+), moderate number of astrocytic bodies present : 2 (++) and high number of astrocytic bodies present: 3 (+++). After all animals were examined, the average score for injectionside or control side and genotype was calculated. Statistical Analysis Oneway or TwoWay analysis of variance ( ANOVA) was performed where applicable. Twoway ANOVA was followed by Bonferoni/Dunn post hoc tests. All

PAGE 52

52 longitudinal data were analyzed using repeated measures ANOVA. In these repeated measures analysis, no post hoc comparisons between groups at individual time points was performed due to the lack of a time X genotype interaction in all cases. Statistics and Graphs were generated in Graph Pad Software (Prism, La Jolla, CA) or Statview 5.1 (SAS I nstitute, Inc. Cary, NC). P values of <0.05 were accepted to be significant.

PAGE 53

53 CHAPTER 3 CHARACTERIZATION OF THE CAG 140 MOUSE MODEL O F HUNTINGTONS DISEASE Introduction Since the R6 and other HD models that are transgenic and have both the expanded 5 por tion of the human mutant htt gene and the endogenous mouse hdh alleles, these models do not perfectly match the genetics of HD. To more accurately model HD, various knock in models have been developed. These models have replaced one of the hdh alleles with either a fused human/mouse mutant htt chimera (168, 169, 177, 178) or simply expanded the CAG region of the mouse hdh gene itself (174) The knock in mouse models, like the transgenic mouse models, have been created with various lengths of the expanded CAG region (168, 169, 174, 177, 178) These knock in mice tend to have a longer life span than the transgenic with a slower progression towards neuropathology seen in the models (157, 165169, 177, 178) Menalled et al. (169) have developed a mouse knock in model characterized by 140 CAG repeats. This CAG 140 model contains a small port ion of the human gene, starting from 18 base pairs upstream of the CAG repeat region through 100 base pairs of the first intron and was initially characterized by the Menalled group (169) The CAG 140 model further characterized by Dorner and Hickey (170, 171) To date, all characterizations of the CAG 140 mouse were restricted in the timing of the behavioral testing and the pathological aspects examined. Thus, here, we have undertaken a longitudinal study of the CAG 140 model to provide a comprehensive picture of the progression of disease in this mouse model. Additionally, the initial CAG 140 characterization studies were performed with the homozygous mice (169171) No study, to date, has directly compared the nontransgenic (nTG), heterozygot e and the

PAGE 54

54 homozygote genotypes. To this end, we perfor med monthly rotarod, rearing, and gait behavioral analysis as well as a cross sectional analysis of transcripts and NII levels at 3 month intervals for approximately 18 months in nTG, heterozygote and homozygote CAG140 mice. The longitudinal and cross sect ional study reported here expands the characterization of the CAG140 mouse model phenotype and provides a comprehensive set of dependent variables that can be used for future testing of therapeutics in the CAG 140 model. Results Behavioral Abnormalities in HD M ice Rearings We placed individual mice in a 1 L beaker for 10 minutes in the dark and the number of rears was recorded. From the beginning the nTG mice reared significantly mo re times than the knock in mice. nTG mice averaged 2.74 rears per minute whi le both heterozygote and homozygote averaged 1.36 time per minute (Figure 31 ). There was no difference in rearing between the heterozygote CAG140 and homozygote CAG140 mice. While there was a significant difference between the knock in and the nTG mice, this difference was no t progressive. Rotarod We used two different rotarod tests to determine if the CAG140 mice exhibited a deficiency in motor skills. The accelerating rotarod started at a speed of 5 RPM and increased in speed by 0.3 RPM each second (Figure 32A). nTG mice reached an average max speed of 21.3 RPM before falling, whereas the heterozygote and homozygote reached 16.8 and 17.2 RPM, respectively. The maximum speed that the nTG mice were able to perform was significant ly higher than either the heterozygous or

PAGE 55

55 the homozygous CAG 140 mice. There was no significant difference between the maximum rotarod performance speeds of the heterozygous or homozygous CAG 140 mice. T he constant speed rotarod performance was tested at two different speeds, 10 RPM and 18 RPM (Figure 2B and 2C). While the accelerating rotarod showed a difference between the genotypes, these tests showed no difference between nTG and either the heterozygous CAG140 or the homozygous CAG140 mice. Each of the genotypes showed considerable variability at each time point. On the 10 RPM constant speed rotarod the nTG, heterozygous and homozygous stayed on an average of 50.9 seconds 43. 7 seconds and 47.2 respectfully. The 18 RPM constant speed rotarod showed the nTG, heterozygous and homozygous stayed on an average of 31. 8, 19.4 and 22.7 respectfully. Gait a nalysis Like the rearings, gait analysis was performed once a month. The results for both stride length and stride width did not indicate any overall difference between any of the genotypes ( Figure 3 3 ). The ratio between the two measurements did not show any significant differences either. Expression of the CAG 140 Allele Leads to Transcriptional Anomalies in the Mouse B rain In situ hybridization of transcripts was performed on nTG, heterozygote and homozygous mice to ascertain the transcriptional changes associated with the expression of the CAG140 allele of hdh. The striatally enriched transcripts examined here were DARPP32 ppENK, PDE10a PDE1b D2 CB1 and NGFiA actin was used to normalize the other transcripts. We examined 3 month old mice through 19/20

PAGE 56

56 months at intervals of approximately 3 months. We examined the homozygous mice only out to 12 months. Transcriptional levels of heterozygote compared to nTG ( Figure 3 4 ) started to decrease at 6 months in four transcripts (PDE1b, NGFiA, CB1 and ppENK). W e saw a transcript reduction of approximately 20% when compared to nTG transcript levels at 9 months with the exception of ppENK and DARPP 32 which showed a 7 % increase and a 15 % decreases respectively Transcripts continued to decrease over time and eventually by 19/20 months the transcripts were approximately reduced by 30% compared to controls. The tr anscript with the greatest reduction levels compared to nTG was PDE10a which decreased by 36%, while ppENK transcript levels decreased the least, by14%, at the final time point. Dynamin transcript levels did not show any differences in the heterozygous mic e at any point Similar to heterozygous CAG 140 mice, hom ozygote transcript levels ( Figure 35 ) began to decr ease at 6 months. At 12 months, the aver age transcript reduction was 35% with the greatest reduction being CB 1 at 56%, and the lowest reduction being DARPP32 at 18% when compared to nTG mice transcript levels. For comparison, heterozygous mi ce at 12 months have an average reduction of 22% across the transcripts while homozygote mice at 12 months transcripts reduced by an average of 35% compared to nTG. Dynamin transcript levels did not show any differences in the homozygous mice, similar to what was observed in the heterozygous mice. Older CAG 140 Mice E xhibit an I ncrease in NIIs Sections from each genotype at the various ages were stained with EM48 for semi quantification of the NIIs. Figure 3 6 shows the percentage increase over the baseline levels of NIIs at 6 months. 6 months was the first time NIIs became evident in

PAGE 57

57 any of our mice, and we used 6 months as our normalization baseline. Similar to the heterozygous mice, the homozygote NIIs show ed an increase over tim e compared to the 6 month baseline but these differences did not reach statistical significance. nTG mice, as expected, did not show significant inclusion staining at any time point ( Figure 3 9 C ). Significant increase in the percent of NIIs seen above bas eline did not occur until 15 months for the heterozygous mice At 19/20 months the heterozygous mice had 5.3 inclusions per 1mm2 equating to 8.8 times as many inclusions compared to the 6 month time point. There was no significant difference between heterozygote and homozygote inclusion counts. For an example of the NII stain see Figure 39 Cortical Thickness Using the sections probed for dynamin from the in situ hybridization experiments, we measured the cortical thickness. Cort ical thinning has been recently found to decrease in HD patients (1318) and because dynamin transcript signal was found to be located primarily in the cortex it provided a reasonable metric of cortical dimensions. When compared to the nTG animals, the cortices of the heterozygous and homozygous CAG 140 mice showed a significant difference across the genotypes (Figure 37; ANOVA, p=0.0001) Using NeuN staining, the number of neurons in this cortical region were counted and showed no significant decrease in the homozygotic mice (Figure 39 D). Thus, a neuronal population decline is unlikely to explain the loss of cortical thickness observed here. I n Figure 39 B, the region that was counted is outlined.

PAGE 58

58 Weight I n order to determine if there was abnormal weight gain in our CAG 140 mouse model, we examined the cross sectional weight of our colony. In our behavioral group, we did not have enough of each gender to calculate a proper average. In Figure 38 shows there was no overall weight gain or loss differential between the nTG and the afflicted mice. Mice were placed into two month groups in order to have enough mice at certain time points to be significant. Discussion Behavioral and pathological abnormalities in HD mouse models range greatly in severity. The more severe transgenic R6/2 line developed by Mangiarini et al. (149) exhibits a clasping phenotype and motor skill deficits as early as 5 weeks and usually die from the disease at 13 weeks (149, 154) T he R6 mice lines show some similar histopathology features to the human disease, i n particular, the presence of the NIIs at 5 weeks are (262) evi dence of the similar pathology of HD (127, 156) Transcriptional dysregulation is another hallmark of HD and is evident in the R6 mice (22, 26, 118, 120, 124, 125, 159, 160) Another commonly used transgenic model is the N17182 line developed by Schilling et al. (157) which develops motor abnormalities, inc luding clasping, at 16 weeks and dies at approximately 30 weeks (162) The N17182 mice also produce the NIIs at 6 months and transcriptional irregularities are evident as well (119, 121, 263, 264) While both of these transgenic models have been used extensively for the study of HD, they may not represent the correct genetics of HD Both the R6 and the N171 transgenic models have the expanded human htt gene in addition to the endogenous mouse hdh.

PAGE 59

59 Recently developed knock in models have the advantage of modeling the human disease by having one or two copies of the gene, as would be the case in the HD. When the present study started, there was very little information on the time course of the disease in the knock in CAG140 mouse model. The model was initially characterized by Menalled et al. (169) and more recently studied by Dorner and Hickey (170, 171) but each of these characterizations examined only a few select time points and only examined homozygous mice. Rot arod deficits were observed at 4 months slight rearing behavioral differences detected at 6.5 months in a novel cage environment, and night time running wheel dif ferences were detected at 4, 6 and 8 months (170) These studies, while examining differences between nTG and the CAG 140 mice at selected time points, did not investigate both heterozygous and homozygous mice. In the present study, we examined the behavioral characteristics over a longitudinal time course in one set of mi ce a corresponding timematched time course of striatal specific transcripts and NIIs in a s eparate cross sectional study. The present study also examined both the heterozygous and the homozygous CAG 140 mice which to date have not been compared in a si ngle study The CAG 140 mice do not exhibit the shortened lifespan like the other more widely used models such as the R6/1, and thus allow for a more extended examination of the HD progression. Behavioral Abnormalities Behaviorally, the CAG 140 model exhi bit ed slight and subtle overt differences between afflicted and nTG animals. There were no obvious gait, size or activity differences between the genotypes by simple observations. However, behavioral testing revealed a relatively mild pathological phe notype. As early as 3 months we observed a significant difference in the rearing behavior in the knock in mice (Figure 3 1 ). In HD

PAGE 60

60 patients, individuals have been reported to have slight motor, language and cognitive skill deficits that precede the major HD symptoms and could be an early indication of the disease (265268) and it is not inconceivable that CAG 140 rearing behavior may be a manifestation of similar s ubtle early or developmental deficit in HD mice. While other models have shown gait abnormalities, no significant differences were observed in our study. Neither gait width and gait length (Figure 33) nor the ratio between the two was significantly differ ent from nTG (data not shown). In HD, motor and cognitive skills progressively worsen as the individual ages (8, 269, 270) In the CAG 140 knock in mouse model examined here, there was little to no progressive decline in the behavioral tasks Rearing and rotarod behavioral tasks showed a large significant deficit when comparing nTG mice to the knock in mice, but this deficit did not increase as the mice aged. In fact, for the rearing behavior, nTG mice approached the knock in rearing numbers towards the end of this study. In our rearing behavior task it is possible that the mice, both the nTG and the knock in mice, may show some habituation to the task and this habituation may explain the nTGs slow decrease in rearing behavior. We attempted to limit this habituation effect by spacing the tests by one month. The lack of a progressive behavioral deficit in the CAG140 mouse model is a drawback of the model but does not preclude the possibility that other behavioral paradigms might uncover a progressive deficit especially in light of the progressive neuropathological deficits uncov ered in this study (see below). Transcriptional Dysfunction In humans with HD, as w ell as other mouse models of HD, striatal specific transcript and protein levels are known to be altered. We examined striatal DARPP32 ppENK, PDE10a, PDE1b, D2, CB1, and NGFiA transcripts because of various reports

PAGE 61

61 that have shown these transcripts are altered in HD (2226, 118, 119, 121, 124, 125, 263) The transcripts examined here, are all enriched in the striatum and have a role in cell signaling to varying degrees (63, 64, 82, 91, 271274) Both D2 and CB1 receptors, when activated, help to the regulate the intracellular levels of cAMP (74, 75, 80, 83, 84) which in turn regulates the phosphorylation of the striatal specific protein DARRP 32 (74, 75, 80) PDE10a and PDE1b are also striatal speci fic and have been shown to hydrolyze cAMP (275279) Studies regarding upstream binding sites of the gene that codes PDE10a revealed that there is a NGFiA binding site which suggests that NGFiA could help regulate the transcription of PDE 10a (22) The interconnections between these striatally enriched transcripts highlight their functional significance especially since mutant htt has been associated with decreases in these transcripts Indeed, j ust as seen in the transgenic R6 mouse model (22, 26, 118, 120, 124, 125, 159, 160) various other mouse models of HD (119, 121, 263, 264) there was an agedependent decrease of striatal specific transcripts in the CAG 140 model. T here was a decrease of mRNA level s in heterozygous CAG140 mice starting at 6 months of age and a reduction of nearly 20% in most transcripts by 9 months of age. Th e trend for reduced striatal specific transcripts in CAG140 mice continued as the mice age and at 19/20 months an average reduction of 30% was observed. Homozygous mice show ed a reduction of 20% already by 6 months, and at 12 months, the homozygous mice show ed a reduction of approximately 35% The difference between the heterozygous and the homozygous striatal transcript levels observed at 12 months may indicate a gene dosing effect of the two expanded k nock in htt alleles present in the homozygous mice compared to the single copy in the heterozygotes. The decrease in relative mRNA

PAGE 62

62 of these various transcripts in the CAG140 mice corroborated what has been seen in HD as well as what h as been observed in other mouse models of HD (22, 26, 119, 125, 126, 159) Neuronal Intranuclear Inclusions Another well established pathological component in HD and HD models, in addition to transcript dysregulation, is the presence of the NIIs. To date, there have been few attempts to accurately quantify NII in HD mouse models In the present study, we have used an unbiased sampling method to determine NII density over the lifespan of the CAG140 mouse. W e normalized the NII densities to the six month time point which was the first age where we could detect significant NIIs Visualizing these data demonstrated an age related progression in CAG140 mice (Figure 36) W ild type htt has been shown to associate with various transcription factors and that association is altered when mutant htt is present (100, 105110) It would follow that the function and or availability of the transcription factors to perform their tasks might be alter ed if sequestered by the insoluble precursors to the NIIs or in the NIIs themselves. Our observations support the hypothesis that transcription factor segregation due to mutant htt could in turn decrease mRNA levels ( Figures 33 and 34 ). We see significan t decrease of transcripts before a significant increase of NIIs in the CAG 140 mice. This may suggest sequestering of transcriptional factors before the actual formation of distinct inclu sion bodies (250, 280, 281) While sequestering of transcription factors may account for our early behavioral data, from our data we can not conclude conclusively that this is the cause of the behavior in the CAG 140 model.

PAGE 63

63 Cortical Thinning C ortica l thinning has recently been examined during the progression of HD and a number of studies have determined via functional magnetic resonance imaging ( fMRI ) that as the disease progresses in humans cortical areas begin to thin or atrophy (13, 15, 16) The CAG 140 mouse model display ed an overall signi ficant difference between the genotypes (ANOVA, p = 0.0001) (Figure 3 7 ). nTG mice also showed a significant decline in the cortical thickness over time (1 way ANOVA, p = 0.01). The nTG cortical thinning could be attributed to aging which has been seen i n normal human aging (282284) Here, the CAG 140 mice might reach a threshold of cortical thinning, and the nTG mice reach that point at a later stage. Examining neuron density at 9 and 12 mont hs of the homozygous mi ce, did not reveal a consistent decrease in the number of neurons ( Figure 39 D) This lack of NeuN staining suggests that atrophy or loss of cell types other than neurons might potentially be responsible for the observ ed cortical thinning. The implications of such cortical thinning in the CAG 140 mice can not be determined from the present study. More precise learning behavioral tasks may provide a clue as to the effects of such cortical loss. While a noninvasive method of determining transcript and/or NIIs in humans has not been developed, post mortem studies have indicated that, in all likelihood, a progressive decrease of transcripts and a progressive increase of NIIIs occur s in HD. These histopathological characteri stic s make the CAG 140 mice a good model to test early intervention to HD and their affects at a cellular level. Cortical thinning may provide a real time measurable progressive pathological marker for the CAG 140 mice. Experimental therapeutics that help return the various transcript levels to normal levels, reduce or eliminate the NIIs associated with HD or help stem the associated cortical

PAGE 64

64 thinning in HD could be tested first in the CAG 140 mouse model Additionally we have found a series of behavioral tests that show longterm, quantifiable, nonprogressive deficits when compared to nTG. In conclusion, the CAG140 knock in mouse model of HD has many aspects that are similar to the human disease. Not all of the aspects mimic the human disease perfectly but the histopathol ogical characteristics do recapitulate what is observed in the human disease and would provide good benchmarks for determining the efficacy of drugs and treatments. The progressive decreases in transcripts and cortical thinning as well as the increase in N IIs over time allow us to gauge treatments at various points in the disease. Determining the ideal window for treatment is especially important in HD since it is purely a genetic disorder and early intervention in the human disease is possible.

PAGE 65

65 Figure 31 Longitudinal rearing b ehavior of the CAG140 knock in mouse model of Huntington s disease shows a deficit in heterozygous and homozygous mice. Mice were videotaped in a 1 L beaker for 10 minutes in the dark starting every two wee ks for the first four testing periods then once a month after. nTG mice reared significantly more than heterozygous and homozygous mice ( ANOVA; p< 0 .0001). There was no difference between heterozygous and homozygous mice ( p>0. 05) (N : n TG= 8, Het= 13, Hom= 4).

PAGE 66

66 Figure 32 Latency to fall of the CAG140 mouse model on the accelerating and c onstant speed r otarod. A) CAG 140 mice ( heterozygous and homozygous ) displayed rotarod per formance deficits beginning at 11 months of age (ANOVA; P< 0 .05). There was no difference between the performance of the heterozygous and the homozygous mice. B) 10 RPM constant speed rotarod testing revealed no differences between nTG and CAG 140 mice. C) All genotypes performed similarly in the 18 RPM constant speed rotarod test, although performance at this task was generally reduced with age (ANOVA ; p< 0 .001) (N : n TG= 8, Het= 13, Hom= 4).

PAGE 67

67 Figure 33 Stride length and width gait analysis for the CAG 140 mouse model of Huntingtons d isease. Gait analysis for each mouse was done once a month. Stride length was measured as the distance between subsequent front foot steps. Stride width was measured as the horizontal distance between the placement of the front paw and the rear paw. All measurements were performed from the center of the paw pad. Only the last homozygous time point was significant for the stride length (p< 0 .001) Overall no significant difference was observed in either analysis (ANOVA p> 0 .05) (N : n TG= 8, Het= 13, Hom= 4).

PAGE 68

68 Figure 34 Striatal mRNA transcript in situ 33P hybridization of heterozygote CAG140 knock in mouse model of Huntingtons disease. The striatal area of the heterozygous mice was analyzed for optical density after mRNA transcript radioactive in situ hybridization in relation to the nTG mRNA transcripts after actin mRNA transcript optical density. An overall transcriptional downregulation was observed in A) D2, B) DARPP32, C) ppENK, D) PDE1b, E) CB1, F) PDE10a and G) NGFiA (ANOVA; p<0. 001) In D2, DARPP32 and PDE1b (A, B and D) the transcriptional down regulation begins at 9 months and continues through the last age group. In CB1 and PDE10a transcripts (E and F), reductions begin earlier at 6 months continue to be significant through the course of the cross sectional analysis. ppENK and NGFiA (C and G) showed variable but over all transcriptional down regulation. Asterisk represent significant differences between heterozygote transcript levels and the nTG transcript levels at the corresponding age (p< 0 .05) (N: 3 Months: n TG=6, Het =9, 6 Months: n TG=7 Het= 5, 9 Months: nTG =7, Het=6, 12 Months: nTG =3, Het=12, 15 Months: nTG =11, Het=12, 19/20 Months: nTG =12 Het=13)

PAGE 69

69

PAGE 70

70 Figure 35 Striatal mRNA transcript in situ 33P h ybridization of homozygote CAG140 knock in mouse model of Huntingtons disease. The striatal area of the homozygous mice was analyzed for optical density after mRNA transcript radioactive in situ hybridization in relation to the nTG mRNA transc ripts after actin mR NA transcript optical density. An overall transcriptional downregulation was evident similar to what was observed in the heterozygous mice, in A) D2, B) DARPP32, C) ppENK, D) PDE1b, E) CB1, F) PDE10a and G) NGFiA transcripts (ANOVA; p< 0 .001) All transcripts except D2 and DARPP32 showed significant reduction star ting at 6 months (C G). Overall transcriptional differences between heterozygous and homozygous mice are significant ( ANOVA; p< 0 .01) Asterisk represent significant differences between homozygote transcript levels and the nTG transcript levels at the corresponding age (p< 0 .05) (N: 3 Months: nTG =6, Hom=6, 6 Months: nTG =7 Hom=11, 9 Months: nTG =7, Hom=7, 12 Months: nTG =3, Hom=8)

PAGE 71

71

PAGE 72

72 Figure 36 Quantification of Neuronal Intranuclear Inclusions (NIIs). NIIs were quantified using a sterologically based sampling regime. Count s were estimated identically for each group and normalized to the 6 month age group. 6 months was chosen because NIIs were first detected at this age group. At 6 months there is no significant difference between nTG background staining and heterozygote NII numbers (p> 0 .05). A significant increase in NIIs is evident as the mice age ( OneWay AN OVA; p< 0 .0001). Starting at 15 months there is a significant difference in the percent of inclusion bodies over the 6 month baseline. (N: 6 Months: nTG =3, Het= 4, Hom=3, 9 Months: nTG =3, Het= 5, Hom=3, 12 Months: nTG =3, Het= 4, Hom=4, 15 Months: nTG = 4, Het= 3, 18/19 Months: nTG = 3, Het= 5)

PAGE 73

73 Figure 37 Cortical thickness of the CAG 140 knock in mice decrease over time compared to the nTG mice. Using the Dynamin in situ film images of the mice examined previously, cortical thickness of t he nTG, heterozygous, and homozygous mice were measured in millimeters using the Quantity One program. There is an overall significant difference between the nTG and the knock in mice (ANOVA; p = 0.0001) (N: 3 Months: nTG =6, Het =9, Hom=6, 6 Months : nTG =7, Het= 5, Hom=11, 9 Months: nTG =7, Het=6, Hom=7, 12 Months: nTG =3, Het=12, Hom=8, 15 Months: nTG =11, Het=12, 19/20 Months: nTG =12 Het=13)

PAGE 74

74 Figure 38 No significant weight differences in the CAG 140 mouse model. Weights of our CAG 140 mouse colony showed little differences in the weight of either the male or the female mice in any of the genotypes. Male nTG only showed slightly lower weights at the earliest time point (p<0 .01), but this did not appear to be a permanent weight diff erence. Females showed one time point at 56 months of age where the nTG was significantly increased (p<0.001), but this returned to the other weights in the following time points. Overall there was no weight difference in either the males or the females across the ages examined here ( ANOVA, p>0.05) (Male N: 12 months; nTG =7, Het= 15, Hom=9, 34 months; nTG= 5, Het= 12, Hom= 9, 5 6 months; nTG= 13, Het= 9, Hom= 10, 7 8 months; nTG=19, Het=13, Hom=5, 910 months; nTG= 7, Het= 6, Hom= 9; Female N: 12 months; nTG = 5, Het= 21, Hom= 13; 3 4 months, nTG= 11, Het= 5, Hom= 8; 56 months, nTG= 13, Het= 12, Hom= 7; 7 to 8 months, nTG= 10, Het= 10, Hom= 10; 910 months nTG= 13, Het=12, Hom= 4)

PAGE 75

75 Figure 39 Representative images of NIIs and neuronal NeuN quantif ication A ) Representative images of a ( i )nTG, ( ii)heterozygous, and ( iii)homozygous striatal area containing NIIs at 12 months. Arrow s show examples of N IIs. B ) Representative image of cortical region that was counted (black box) and (A and B ) for better visualization in this figure. C ) Homozygous progression of NIIs as a perc ent over the 6 month baseline. D ) NeuN positive cells average per 1mm2. 9 month and 12 month old nTG and homozygous mice were stained with NeuN to determine the total cortical neurons in the given area seen in B ) CC: Corpus Collosum

PAGE 76

76 CHAPTER 4 RAAV5 SHRNA TREATMENT OF T HE CAG 140 MOUSE MODEL Intro duction As discussed in the introduction, HD pathology is generally thought to be caused by a gain of toxic function by mutant htt Various group have demonstrated that mutant htt associates more closely with transcription factors such as CBP than the wildtype htt (100, 102104, 112, 113, 115117, 179) Additionally studies by Zeitlin and Dauyo have demonstrated that mice with only one copy of huntingtin, mice are phenotypically normal (143, 145) If the disease is caused of a loss of one of the copies of huntingtin, then the heterozygous knock out mice, generated by Zeitlin and Dauy o would have shown HD like symptoms Lastly, with the generation of knock in mice and the viability of the homozygous mice from these lines (168, 169) it can be concluded that mutant htt still retains its ability to perform some wild type htt functions but also gains a toxic function. If HD is caused by a gain of toxic function in mutant htt then remov ing the toxic protein should alleviate the disease. As described in the introduction, RNAi is a useful tool in specifically targeting mRNA for degradation, which, in turn, reduces protein levels. Various groups have attempted to reduce the mutant htt transgene in the R6/1 and N171Q82 mouse lines with some success (163, 259, 285) Others have introduced a mutant htt gene by viral vector and showed pathological similarities to HD that were alleviated by the introduction of siRNAs (286, 287) Both of the transgenic and the viral mediated introduction of HD studies showed behavioral and histopathological improvements H owever, the transgenic and viral induced models of HD sti ll contain both endogenous copies of hdh. A knock in model of the disease is a closer genetic approximation of the

PAGE 77

77 disease, and the results from a reduction of the mutant htt in the knock in model would be more suitable gauge of therapeutic benefit i n humans. O ur lab previously designed two shRNAs that target the R6/1 HD model (259) siHUNT1 and siHUNT2 effectively reduced the mRNA of mutant htt in the R6/1 mouse line. siHUNT1 targets a region in the human untranslated region (UTR) and not in the mouse untranslated region. In the development of the CAG 140 mouse model, the UTR and 5 region of the hdh was left intact, allowing us to use siHUNT1 as a control (169) We decided to use siHUNT2 as our experimental shRNA, because it targets the region immediately upstream of the CAG repeat region in our CAG 140 mouse model The 18 base pairs immediately upstream of the CAG repeat region is a human sequence and is different enough to allow for specific targeting (169, 259) However, there appears to be some off targeting effects with siHUNT2 in the background line, CBA x C57BL/6, of the R6/1 transgenic mice where siHUNT2 was originally targeted to (169) While effectively reducing the mRNA and protein levels in culture, siHUNT2 showed some downregulation of DARPP 32 and ppENK mRNA levels in vivo after 10 weeks after injection in the R6/1 mice ( (259) ). The CAG 140 knock in have a slightly different background strain (129Sv x C57BL6 ) (259, 288) and this difference could potentially produce less toxic side effect s after siHUNT2 administration. We decided that the slightly different mouse background and a longer term expression of siHUNT2 might be able to show if the reductions of the mutant protein would be of therapeutic value despite the potential off targeting effects previously seen in the R6/1 mouse line.

PAGE 78

78 After the CAG 140 characterization, we concluded that 10 weeks of age would be an appropriate time point to start a treatment in this model. While there will be rearing behavior differences at ten weeks this was the earliest point at which we could do surgery on the animals before the onset of transcriptional downregulation and the appearance of NIIs. This early therapeutic intervention would allow us to demonstrate that RN Ai intervention maybe possible. Because the disease has histopathological progressi v e traits and later intervention may prove inefficient, if improvements are detected after early intervention in the CAG 140 model, it is possible later term i nter vention may also be beneficial. Results Behavioral Analysi s Five heterozygous mice were injected bilaterally with the rAAV5siHUNT2 vector along with three GFP control injected heterozygous mice for behavioral analysis. Six weeks after injections, at 4 month of age, the mice were test ed for r earing behav ior ( Figure 41 A ) Significant increases in the average number of rearings were observed at both the 4 month and 5 month ages after siHUNT2 injected mice. The increase in average rearing w as significantly above the uninjected heterozygous averages. The rearing average reached slightly above the nTG rearing averages that was reported previously ( chapter 3) GFP animals did not show significant improvements in rearings compared to the uninjected heterozygous mice. When the rearing behavior testing was performed at 9 months and later, we did not see the same improvements The rearing averages of the siHUNT2 injected mice returned to about the same levels as the heterozygous uninjected mice. Similarly the GFP injected animals showed no difference to the heterozygous uninjected animals.

PAGE 79

79 No significant difference in the bilateral ly injected siHUNT2 mice was detected on the accelerating rotarod t ask (Figure 41 B). Early time point s showed no significant differences between the injected and uninjected heterozygous mice (p>0.05). The rotarod behavior is consistent with our earlier observations in chapter 3 that showed no significant differences in the heterozygous mice and the nTG until 10 months. At the 12 month age point, the non transgenic mice could stay on the device at a significantly higher speed than all the heterozygous mice (p<0.05) Transcr iptional Analysis for rAAV5siHUNT1 and siHUNT2siHUNT2 M ice Ten week old mice were injected with rAAV 5 siHUNT1 or siHUNT2 and were analyzed for transcriptional effects at 14 weeks and 26 weeks post injection. GFP control animals were also injecte d at 10 weeks, but the results will be described in chapter 5. Figure 42 ( siHUNT1 ) and 4 3 ( siHUNT2 ) displays the results from the radioactive in situ hybridization as a comparison between the uninjected and the injected striatal regions In the siHUNT1 injected mice, which should not target either the endogenous or the mutant huntingtin mRNA, there was significant decreases in the injected side when compared to the uninjected striatal regions ( Figure 42 ). Starting at 14 week post injection o f nTG mice showed a significant decreases on the injected side when compared to the uninjected side (Figure 42 A ANOVA, p<0.001 ). The transcriptional downregulation continued in the nTG 26 week post injection shown in Figure 42 A ( ANOVA, p<0.0001) Examining the transcript downregulation over time revealed no significant differences between the 14 and 26 week time points (ANOVA, p>0 05) Heterozygous mice also showed a similar decrease in transcripts at 14 weeks post i njection ( Figure 41 B ANOVA, p<0.001). These decreases observed in the

PAGE 80

80 heterozygous mice are below the normal disease related decreases reported in chapter 3 No significant difference between the transcripts was evident at the heterozygous 26 week tim e point (Figure 42 B ; ANOVA, p>0.0 5 ) The apparent increase in transcript levels from the 14 to 26 week time points in the heterozygous mice was significant ( siHUNT1 HET transcripts 14 weeks vs. 26 weeks, ANOVA, p<0.0001). Homozygous transcripts in mic e injected with siHUNT1 also showed significant decreases at 14 weeks ( Figure 42 C; ANOVA, p<0.0001) and at 26 weeks ( Figure 42 C ; ANOVA, p<0.005) ppENK mRNA transcript in the homozygous mice at 26 weeks post injection was the only transcript that showed any increase above the disease level transcript levels. The homozygous siHUNT1 26 week post injection ppENK transcript levels were significantly above the uninjected side by 26% ( t test p<0. 01) but still significantly below the uninjected 26 week uninjected nTG ppENK levels (t test, p<0.05). Figure 4 3 depicts the results from the siHUNT2 injected mice which targets the mutated huntingtin mRNA and show ed an overall decrease in transcriptional levels compared to the uninjected side. Again, these transcriptional decreases are in relation to the disease related decreases reported in chapter 3. siHUNT2 caused significant transcriptional downregulation at the 14 week time point ( Figure 43 ANOVA, p<0.0001) and at the 26 week time point in nTG mice (ANOVA, p<0.05) Comparing the 14 week transcript levels to the 26 week transcript levels after injections with siHUNT2, shows that there was a significant increase ( siHUNT2 nTG 14 week vs. 26 week; ANOVA, p<0.05) Heterozygous mice did not appear to be significantly affected by the injections of siHUNT2 at either post injection time point s ( Figure 43 B; ANOVA, both p>0.05)

PAGE 81

81 siHUNT2 injected homozygous mice showed significant mRNA transcript reductions at 14 weeks (ANOVA, p<0.001) but at the 26 week time point massive atrophy was observed in half of the homozygous striatums Because the trans cript levels could not be accurately calculated due to the atrophy, only a small number of animals could be quantified and no significant difference in transcripts were observed in the 26 week siHUNT2 injected homozygous mice (ANOVA, p> 0 .05) There was no significant difference between any of the siHUNT1 siHUNT2 or GFP transcripts level except for the heterozygous mice at 14 weeks. At 14 week time point siHUNT1 showed a significantly lower level of transcripts than the GFP injected animals (ANOVA, p<0. 0 5). At all the other time points and genotypes there were no significant differences between the vector injections. NII decreases with shRNA treatment NIIs were quantified by counting the number of observed NIIs seen in the given field after a sterologic ally based sampling at 100x and has been described in chapter 3. siHUNT1 and siHUNT2 inject ions of heterozygous mice at 14 weeks showed no overall reductions in the amounts of NIIs compared to the uninjected striatal regions of the heterozygous mice (Figure 44 A ; ANOVA, p>0.05 ) H eterozygous mice at the 26 week time point show ed an overall significant reductions in NIIs with injections of siHUNT1 and siHUNT2 ( Figure 44 B ; ANOVA, p< 0. 0 1 ). Similarly the homoz ygous injected mice showed significant overall NII reductions after both shRNA injections at the 14 and the 26 week post injection time points (Figure 44 C and D ANOVA, both p<0.01). These reductions of NIIs in the injected striatum are in despite of the fact that siHUNT1 does not target either mutant htt or hdh. GFP injections did not reduce the number of NIIs on the injected side significantly in either genotype or at either time points.

PAGE 82

82 Discussion We hypothesiz ed that the reduction of the mutant huntingtin protein via RNAi would improve some of the observed abnormalities seen in our characterization of the CAG 140 model. As described in the introduction, Yamamoto et al. created a mouse model of HD which had the mutant huntingtin fragment in a tetracycline controlled pr omoter (148) Addition of tetracycline lowered the expression of the mutant huntingtin and the HD neuropathology and HD behavior observed previously in the mouse was rescued. Har per et al. and Rodriquez Lebron et al. have both successfully reduced the mutant huntingtin fragment from both the N17182Q and R6/1 transgenic mouse models of HD by rAAV mediated RNAi deliv ery and showed neuropathological and behavioral improvements (163, 259) Other studies have introduced mutant htt into either a mouse or rat by a viral method and successfully rescued the resulting HD phenotype with either siRNAs or shRNAs (286, 289, 290) With these studies, we theorized that reductions in mutant huntingtin in a knock in model of HD could show similar neuropathological and behavioral improvements. Our allele specific shRNA, siHUNT2 was designed by our lab and targets a region immediately upstream of the CAG repeat region. As a control we had another shRNA siHUNT1, that in the CAG 140 model does not target either the knock in allele or the endogenous h dh (259) The siHUNT2 had previously shown off targeting; however the region that it targets is specifically human in the expanded CAG allele and is the only region that can be specifically targeted for allelespecific knock down (259, 288) The siHUNT1 shRNA did not show any significant off target in the R6/1 mice previously and should have been a suitable control shRNA in the CAG 140 model (259)

PAGE 83

83 Behavioral Improvements Bilateral injections of the rAAV5 siHUNT2 vector was performed in heterozygous mice in order to determine if any behavioral therapeutic effect was evident despite the transcriptional irregularities. The injections were performed at the same time as the unilateral injections (10 weeks) and showed early improvements in rearing behavior 6 weeks and 10 weeks post injection ( Figure 4 1 A). While these results are from a small cohort of animals (5 siHUNT2 and 3 GFP) the slight improvement in rearing suggests that RNAi mediated knock down of mutant htt may provide some therapeutic benefit in the early months after injection. Behavioral improvements were not evident later at 26 weeks post injection or beyond. R otarod motor performance at 6 26 and 38 weeks post injection showed no overall improvement in the siHUNT2 and GFP injected mice compared to the uninjected heterozygous mice (F igure 41 B). While we observe some early behavioral improvements, these come at a time ( 1 0 weeks post injectio n) immediately before we see transcriptional dysregulation, in our unilateral siHUNT2 injections (discussed below) It is possible that the improvements detected at the 6 and 10 week post injectiontime points come prior to sign ificant downregulation of the transcripts in the CAG 140 knock in mice The fact that we see little improvements at later time points after we observe siHUNT2 induced transcriptional downregulation may indicate that such transcriptional dysregulation would abrogate any behavioral improvements generated by knock down of the mutant huntingtin. With the present data we can not make any concrete conclusions about the connection between the transcript levels and the slight behavioral improvements seen at the early time points after injection. Behavioral analysis was not performed on the R6/1 mice with siHUNT2 so it is impossible to say if a similar early behavioral improvement could be

PAGE 84

84 elicited in the R6/1 mice with the siHUNT2 shRNA before the transcriptional irregularities are seen. Transcriptional Dysregulation Despite the fact that previous work with our shRNA constructs indicated that the siHUNT1 should have been a suitable control, as it did not have any noticeable off targeting effects (259, 288) we have found that there was further downregulation of the disease related striatal transcripts as reported in chapter 3. The direct correlation between the further transcriptional downregulation caused by siHUNT1 or siHUNT2 and any neuropathology or behavior can only be speculative. In work previously done by Rodriguez Lebron et al from our lab had utilized the R6/1 mouse line that contained the full first exon of the mutant htt fragme nt inserted into the mouse genome (149) a nd both siHUNTs targeted the transgene (259) The viral constructs generated by Rodriguez Lebron et al was a rAAV5 vector with a titer at approximately 1 to 5 x 1013 vg/ml, which matches our construct and titers in this project (259) T he R6/1 mice were injected with both the siHUNT vectors and transcript and NIIs were examined at 10 weeks post injection, approximately one month prior to our histopathological examinations (259) The mouse model differences along with the longer rAAV5siHUNT experimental time points may explain some of the discrepancies seen between the st udies. In particular, the extended time of shRNA exposure may explain the transcript down regulation. A longer experimental time course in the R6/1 mice may produce similar transcriptional results as seen here. As characterized in chapter 3, there are mRN A transcript decreases in the heterozygous and homozygous mice over time and it is possible that reductions beyond the normal mRNA transcript decreases could have further detrimental outcomes

PAGE 85

85 However, because we do not see further behavioral deficits (Figure 41) after injections of siHUNT2 it is hard to gauge exactly what the consequences of further transcriptional downregulation would be. siHUNT2 was not examined for behavioral improvements in the previous work done by Rodriguez Lebron (259) siHUNT1 bilateral injections for behavior showed delayed onset of the clasping behavior that i s characteristic of the R6/1 mouse line (259) Various groups have determined that s hRNAs may themselves be toxic in vitro as well as in vivo (285, 291297) Grimm et al. showed that over expression of shRNAs in mice liver caused lethality (291) Investigating further, a large number of the native regulatory miRNAs in the liver were significantly reduced which was directly c orrelated with the morbidity of the mice ( 291) The reduction in the miRNA s, after shRNA administration, has been theorized to be caused by an overloading of the Exportin5 complex that helps regulate the export of both shRNAs as well as miRNAs (241, 294) The over expression of shRNAs creates an accumulation of premiRNAs t hat can not be handled properly by Exportin5 which can lead to cellular death (241, 294) McBride et al. showed the potential for shRNA toxicity in the CAG 140 mouse model (292) Using three different shRNAs targeted towards the hdh and the mutant htt t he group showed two of the three shRNAs tested had micoglial (Iba 1) act ivation and downregulation of DARPP 32 protein. Examining the amount of anti sense and sense sequences present, McBride showed that the microglial activation and protein reductions were linked to the amount of mature anti sense sequence in the neurons (292) Lower levels of mature anti sense showed less toxicity in mouse brains. We did not exam ine our shRNA injected mice for microglial activation and this would be a good

PAGE 86

86 future examination to determine if our shRNAs toxi city in CAG 140 mice is caused by the same mechanism reported in the McBride paper. In our work, despite siHUNT1 not being targeted to known sequence in the CAG 140 model, we see transcriptional downregulation. If, as suggested by McBride (292) the levels of the anti sense sequence are at a high enough level, the fact that siHUNT1 doesnt target anything may become irrelevant. Our observed transcriptional downregulation might be a result of high mature anti sense levels. McBride and later Boudreau, demonstrated that the shRNA mediated toxicity could be ameliorated by placing the RNAi cassette into a miRNA backbone (292, 295) Boudreaus study showed a similar phenomena to Grimm (291) and Yis (294) work that showed significant reductions in endogenous miRNAs if shRNAs are used. When shRNAs are placed in a miRNA backbone, the endogenous miRNA levels were restored and as in McBrides study observed toxicity was reduced (292, 295) Bourdeau and McBride s work would suggest that placing our siHUNT1 and siHUNT2 constructs into miRNA backbones may help eliminate the observed toxicity. Gene dosing could also be playing a role in the effectiveness of the shRNA treatment here. At any one time point, the only variable in the groups is the genotype. When comparing transcript reductions across genotypes, there are some slight significant differences. In particular transcripts from the 26 week old mice treated with siHUNT1 show ed significantly less reductions than either the nTG or the homozygous mice ( ANOVA, p<0.001). In the siHUNT2 injections at 14 weeks nTG transcripts were reduced further than the heterozygous ones ( ANOVA, p<0.05). In both of these cases the heterozygous mice appear to be less effected than t heir nTG counterparts. It is

PAGE 87

87 possible that heterozygous mice, for some unknown reason, are not affected by the shRNA toxicity as much as their nTG or homozygous counter parts NII Reductions In both the siHUNT1 and siHUNT2 injected mice, the number of NII s were significantly reduced. P revious work with either siHUNT1 or siHUNT2 did not quantify the NIIs past 10 weeks post injection, and Rodriguez Lebron showed that a control shRNA and GFP did not reduce the amount of NIIs after 10 weeks in the R6/1 line while both siHUNT1 and siHUNT2 reduced the NIIs considerably (259) T he work performed here does not refute the previous work; however it suggests that the reductions seen in the R6/1 model may not have been solely due to reductions of mutant htt siHUNT1 which does not target any known transcript in the CAG 140 mice, induced NII reductions at 26 w eeks indicating that something other than mutant htt knock down is altering the levels of NIIs. If the R6/1 study had gone out further it is possible the control shRNA may have shown some similar toxic attributes that we s ee here in the siHUNT1 and siHUNT2 shRNAs. As mentioned previously, shRNAs have been shown to potentially be toxic (285, 291297) Our work here with NII reductions may help support that notion. Since both siHUNT1 and siHUNT2 reduce NIIs considerably b ut only siHUNT2 actually targets the mutant htt it is suggestive that any presence of shRNAs could contribute to the reduction of the inclusion bodies The mechanism by which shRNAs would reduce inclusion bodies is unknown. Thus, r eductions of NIIs by shRNA treatments may not be indicative of any actual therapeutic benefit.

PAGE 88

88 Compounding Factor Despite our best efforts to have proper controls, we did not have an appropriate viral injection control. The GFP control in our experiments was the hGFP designed by Zolotukhin et al. (260) a humanized Aqueforia GFP and the GFP in the siHUNT vectors is a humanized version of the Renilla GFP. In addition to the GFP discrepancy the promoters that drive each GFP are different. This GFP differences creates a problem when evaluating our work performed with the siHUNT vectors since we do not have proper controls to determine if the GFP is contributing to the observed effects We can not definitively conclude that humanized Renilla GFP has no effect outc ome measurements T he transcriptional downregulatio n can not be definitively declared to be the result of shRNA toxicity solely In the next section we will address the hGFP issue as stand alone problem.

PAGE 89

89 Figure 41 Slight behavioral improvements after r AAV5 siHUNT2 injections are evident in Rearing behavior but not in the Accelerating Rotarod. A) Early rearing behavior improvements in siHUNT2 injected mice. The siHUNT2 injected mice showed a significant increase in rearing behavior compared to the rearing behavior observed previously in the heterozygous mice (p<0.05). siHUNT2 injected mice reached nTG rearing levels (p>0.05). Examining the heterozygous mice at 9 months the improvement did not continue (p>0.05) B) 12 month Accelerating Rotarod behavior sho wed no improvement Early time points (4 and 9 months) did not show differences between any of the groups (p>0.05), consistent with earlier reports where no early accelerating rotarod deficits are noticed. At 12 months, all h eterozygous mice were significa ntly different than the uninjected nTG (p<0.05).

PAGE 90

90 Figure 42 I n situ 33P hybridization of striatally enriched transcripts 14 and 26 weeks after rAAV5siHUNT1 injections. The striatal area of the rAAV5siHUNT1 injected mice was analyzed for O.D after mR NA transcript radioactive in situ hybridization, normalized actin mRNA density and reported as percent of the uninjected region. A) 14 week and 26 week nTGs were both signi ficantly reduced ( ANOVA, p<0.001 and p<0.0001). B) Heterozygous transcripts at 14 weeks ( ANOVA, p<0.001) but not at 26 weeks (p>0.05) were significant reduced compared to uninjected sides. C ) H omozygous 14 week and 26 week transcripts had an overall reduction compar ed to uninjected ( ANOVA, p<0.0001 and p< 0.005). Heterozygous transcripts showed a significant increase over time ( ANO VA, p<0.001). ppENK h omozygous 26 week transcript level was significantly greater than uninjected side (ttest, p<0.01) ) but did not reach nTG ppENK levels at the same age (t test, p<0.05) (nTG: 14 week N=5, 26 weeks post injection N=7, HET: 14 week pos t injection N=6, 26 week N=7, HOM: 14 week N= 7, 26 week N=5) Asterisk = significant difference between injected and injected, + = indicates significa ntly higher than the 14 week time point .

PAGE 91

91 Figure 43 In situ 33P hybridization of striatally enriched t ranscripts 14 and 26 weeks after rAAV5siHUNT2 injections. Values are percent of the uninjected striatal region. A) nTG 14 and 26 week transcr ipt levels showed an overall reduction compared to the uninjected side ( ANOVA, p<0.0001, and p<0.05) B ) H eteroz ygous 14 26 week transcript levels did not show significant reductions ( ANOVA, p>0.05) C ) H omozygous 14 week transcripts were overall significantly lower ( ANOVA, p<0.00 1 ) but homozygous 26 week transcripts were not reduced ( ANOVA, p>0.05) nTG CB1 transc ript increased significantly from 14 weeks to 26 weeks (p<0.05) nTG:14 N= 7 (PDE10a, PDE1b N=5; NGFiA N=4) ), 26 weeks N=6 ( D2, PDE10a and NGFiA N=5), HET: 14 week N=5 (D2 N=4), 26 week N=7 (D2, PDE10a and CB1 N=6), HOM: 14 week N=6 ( DARPP32 and ppENK N= 7, D2 PDE10a and PDE1b N=5), 26 week N=3 Asterisk = significant difference between injected and injected, + = in dicates significantly higher than the 14 week time point. nTG= nontransgenic, HET= heterozygous, HOM = h omozygous .

PAGE 92

92 Figure 44 Reductions of N IIs are evident after shRNA injection into the striatum of CAG 140 heterozygous and homozygous mice A) Heterozygous 14 week siHUNT1 and siHUNT2 injections did not show any significant difference between injected and uninjected B) Significant difference was evident when comparing injected to uninjected in the heterozygous 26 week post injections ( ANOVA, p <0.01) C) Homozygous 14 week injections showed a significant reductions after shRNA injections ( ANOVA, p<0.01) as did the D) Homozygous 26 weeks post inje ctions ( ANOVA, p<0.001) siHUNT1 (HET: 14 week N=5, 26 week N=5; HOM: 14 week N=5, 26 week N= 4) siHUNT2 (HET: 14 week N=5, 26 week N=6; HOM: 14 week N= 4, 26 week N= 3) GFP (HET: 14 week N= 6, 26 week N=6; HOM: 14 week N= 3, 26 week N=5)

PAGE 93

93 CHAPTER 5 LONG TERM EFFECTS OF R AAV5 HGFP INJECTIONS IN T HE CAG 140 MOUSE MODEL Introduction The GFP protein discovered by Shimomura et al. (298) has become widely used in biological studies as a way to monitor intracellular protein trafficking and localization, cellular migration and proliferation, and to assess the transduction efficiency of plasmids and viral vectors in vitro and in vivo GFP is a highly stable (299, 300) and relatively long lasting protein with a half life of ~26 hours in vitro (301) GFP is one of many different types of fluorescent proteins that are used in the biological fields Other fluorescent proteins include dsRED mCherry, y ellow fluorescent protein (YFP) and cyan fluorescent protein (CFP) which are all derivatives of the original GFP or derived from other organisms such as Discosoma striata and the sea corals Anthozoa (302306) There are over 38 variants of the monomeric fluorescent proteins and over 19 dimeric or trimeric fluorescent proteins and many more are being generated to facilitate in the need for tracking and localizat ion of multiple intracellular proteins and process (for a comprehensive review see Chudakov et al. 2010 (307) ) Humanized GFP (hGFP) is a modification of the original Aequorea victoria GFP developed by Zolotukhin et al. which modified the Aequorea victoria jellyfish GFP cDNA sequence to allow for a more effi cient translation into protein (260) Different organisms translational machinery recognizes certain codons more frequently than others (308310) and by changing these codons to mat ch appropriately with the mammalian translation preferences, Zolotukhin et al. designed an GFP cDNA that was more efficiently translated into protein. The humanized modifications produced 70fold more signal than the original GFP (260)

PAGE 94

94 We have used the hGFP in our rAAV viral preparations for many years as a control for viral infection as well as in our experimental vectors to monitor the localization of the viral transduction (208, 259, 288, 311315) hGFP is an ideal protein marker because it is more efficiently translated into protein and the peak emission (509 nm) spectra is the same as the original GFP (260, 298, 316) Additionally, hGFP can be stained with Aequorea GFP or eGFP antibodies to determine the full extent of the rAAV hGFP transduction. During shRNA work in the previous section, we found that the rAAV5 hGFP had negative effects on the levels of mRNA transcripts that are striatal specifi c. These mRNA transcript reductions were surprising and alarming because our lab, as well as many other labs have used rAAV hGFP as a control for years T he implications that at least there is transcriptional dysregulation when using rAAV h GFP might call into question a number of studies where such transcriptional dysregulation may have had a direct impact on the results. T hus, w e decided to further investigate the rAAV hGFP effect by looking at various histopathological differences between the injected and uninjected side of the brain. Results Transcriptional DownRegulation in GFP injected Mice Striatal rAAV5 hGFP Injections in 10 week old nTG, heterozygous and h omozygous mice produced transcriptional downregulation at 14 and 26 weeks post injection (Figure 5 1 ) The nTG mice injected with rAAV5h GFP displayed significant reductions in D2, DARPP32, ppENK, PDE10a, PDE1b and CB1 transcript s at the 1 4 week post injection compared to the uninjected side (Figure 51 A ; ANOVA, p<0.001). At the 24 week post injection time point transcripts were also significantly reduced

PAGE 95

95 (Fig ure 51 A ; ANOVA, p<0.0001) There was no significant difference between the t ranscripts at 14 and 26 weeks in the nTG injected with hGFP ( ANOVA, p>0.05) The heterozygous mice did not display any significant reductions in mRNA transcripts at the 14 week post in jection time point (Figure 5 1 B ; ANOVA, p > 0 .05). Heterozy gous striatal mRNA transcript levels were reduced significantly compared to the uninjected sides at the 26 week post injection (Fig ure 51 B ; ANOVA, p<0.05 ). Like the heterozygotes, h omozygous mice displayed no significant reductions in the mRNA transcript levels at 14 weeks ( Fig ure 5 1 C ; ANOVA, p>0.05 ) but at the later 26 week post injection, significant reductions in comparison to the uninjected side were evident (Figure 51 C ; ANOVA, p<0.0005 ) An example of the transcript reduction from our rAAVhGFP injections can be seen in Figure 52. DARPP 32, ppENK and PDE10a transcript levels are clearly reduced on the injected side (right side of images). DARPP32 Protein Reductions Reductions of the mRNA levels suggested there could be significant protein level reductions as well. We examine d the protein levels of DARPP32 in rAAV5 hGFP injected mice to determine if the mRNA reductions observed above resulted in protein level reductions Examining the nTG there was significant reductions in DARPP32 protein after the injection of rAAV5 hGFP Figure 53 A and B depicts an example of a 26 week post injection nTG mice stained for GFP and DARPP32. Clear reductions of DARPP32 protein staining were visible on the injected side(Fig ure 53 A and B ). Using the Odyssey Near infrared (IR) imaging system we were able to calculate a 40% relative reduction of DARPP32 protein in the injected vs. the uninjected striatal regions at both 14 and 26 weeks of transgene expressi on ( Figure 53 C ; ANOVA, p < 0 .0 5 ). D espite DARPP32 mRNA reductions in the heterozygote and homozygous mice at 26

PAGE 96

96 weeks, we did not see a significant reduction of DARPP32 protein (Figure 53 D ; ANOVA, p > 0 .05) Total Striatal Cell Count Cryesl violet st aining was performed in order to determine the total number of cells in the striatum. Stereological like sampling was performed in the exact same manner as NeuN cell counts to determine the number of cells in the uninjected and the injected mice. No signif icant difference was observed between the two striatal regions counted ( Figure 5 3 ; p>0. 05) NeuN Positive Cell Reductions NeuN is a nuclear protein antibody stain that is specific for post mitotic, differentiated neurons (317) Using NeuN IHC, we attempted to determine if neuronal loss was evident. Quantification of the NeuN stain, using the stereological like technique described in the methods section, showed a significant reduction overall as well as at each of the time points in the number of NeuN positive neurons of nTG mice ( Figure 55 D ; ANOVA, p<0.0001, asterisk = p<0.001) Reductions in the homozygous mice were not as significant but still showed considerable decreases (Figure 55 D, ANOVA, p<0.001, asterisk = p<0.01). This reduction in NeuN staining was easily detectable in photomicrographs Figure 5 5 A shows a low power magnification of an nTG 24 week post injection mouse. Higher power images of u ninjected and injected striatal regions can be seen in Figur e 5 5 B and Figure 55 C There was no significant difference in the number of NeuN stained neurons between the uninjected sides of the nTG and homozygous at either 14 or 26 weeks post injection (Figure 55 E ; ANOVA, p > 0.05).

PAGE 97

97 Astrocytic A ctivation The astrocyte specific marker, glial fibrillary acidic protein (GFAP), was used to determine if there was an increase in the number of activated astrocytes in the injected stri atum of the nTG mice. Figure 56 indicates that there was an increase in the obser vable number of activated astrocytes as seen by G FAP positive staining at low magnification (Figure 56 A) At higher magnification (Figure 56 C) activated astrocytes can be identified by cell morphology. Qualitative analysis of the staining of GFAP was performed by an individual that did not know the injection type or age. Relative amounts are qualitatively assessed by a scale ranging from 0 to 3. The qualitative analysis shows an overall increase in the amount of GFAP cells in the injected striatum when compared to the uninjected side (Table 51). Discussion In the course of the shRNA portion of the project we utilized the rAAV hGFP as our control injection. However, when examining one of our experimental outputs, in situ hybridization of mRNA transcripts, we noticed that control rAAV hGFP reduced mRNA transcript levels significantly. The implication of a widely used control that causes significant experimental differences is concerning because it may call into question any experiment where hGFP has been us ed. We investigate here some of the histopathological abnormalities that are occurring with the rAAV5 hGFP injections. mRNA Transcript Down regulation After rAAV5 hGFP I njections rAAV almost exclusively transduces neurons and has rarely been shown to transduce other cell types in the brain (208, 212, 214, 318) We used the serotype 5 of rAAV and have not attempted to alter the tropism of the virus, so neurons should be the

PAGE 98

98 only target of our viral vector. The stri atal transcripts investigated in this study are neuronal specific and therefore the reductions in these transcripts are likely due to the rAAV5 hGFP viral injection. In all three genotype (nTG, heterozygote and homozygote) as well as most of the time points ( 14 and 26 week post injections) we detect ed transcriptional downregulation, similar to what was seen in the siHUNT injections described earlier in chapter 4. Similarly, we d id not see a significant change in transcript levels in any genotype over time (ANOVA, p>0.05) NGFiA appear ed to be the only consistently transcript that was not down regulated (See Figure 51) A recent study by Beck et al. in 2008 has shown that NGFiA can be regulated in astrocytes in and around a glial s car after an ischemic injury by astrocytes (319) While we did not induc e an ischemic injury and the Beck study w as examining the NGFiA protein levels not mRNA transcript levels it is suggestive that our NGFiA transcript levels could in fact be due in part to nonneuronal cells (319) We have no way to determine if the NGFiA transcript levels we are measuring are from neurons or from other types of cells in the striatum. If nonneuronal cells are up regulati ng NGFiA after our injections it may explain why we do not see a loss of NGFiA. Medium Spiny Neuron Population and Markers The significant decreases in mRNA transcripts after injection of rAAV5hGFP suggested the possibility that the protein levels associ ated with the transcripts might also be decreased. Staining of the DARPP32 protein, one of the transcripts that decreased in almost all of the genotypes and post injection times, showed a significant reduction in DARPP32 protein when compared to the uninjected side ( Figure 53 B and C ). Our DARPP32 staining looked at the total reductions of DARPP 32, not just the activated phosphoylated form s. Such alterations in the DARPP 32 total concentrations

PAGE 99

99 could impact downstream transcriptional machiner y as DARPP32 plays an important role in gene regulation (71, 77, 320, 321) While we did not investigate the protein levels of the other translational down regulated genes, if they are reduced in a similar manner as DARPP32, there could be significant consequences in cellular signaling. Figure 53 B show s a remarkable reduction of DARPP32 staining in the nTG section and such reductions could be due to neuronal loss S taining for a neuronal specific marker would tell if the rAAV5 hGFP injections are causing neuronal death, or simply causing cellular dysfuncti on characterized by the transcriptional and translational dysregulations seen in Figure 51 and 53 One widely used neuronal marker that specifically labels post mitotic and differentiated neurons is NeuN (317) When we stai ned the rAAV5hGFP injected mice we observed reductions in NeuN positive cell s in the injected striatum compared to the uninjected striatum (Figure 5 5 ) Not only were there fewer cells overall, the cells that were positive on the injected side showed lighter staining when compared to the uninjected side. These reductions in NeuN may suggest there is neuronal loss after rAAV5 hGFP injections. Despite the evidence that there might be neuronal cell loss in our rAAV5hGFP injected animals, t here have been a few reports that have suggest that NeuN reductions may not indicate neuronal loss (322, 323) W e still saw GFP staining in the regions of the most significant DARPP 32 loss Unfortunately, we were unable to stain for other neuronal markers such as MAP 2 or Tau which would help indicate if neuronal loss was occurring. If in fact the NeuN reductions do not indicate neuronal loss, then NeuN protein reductions are potentially another translationally dysregulated protein result ing o f the injections of rAAV5hGFP.

PAGE 100

100 The protein that the NeuN antibody binds to is called Fox3 and is part of the Fox RNA splicing family (324) The fact that NeuN (Fox3) is involved in RNA splicing may be important in the transcriptional down regulation that we have seen with our injections. The Fox proteins enhance RNA splicing when the Fox bindi ng element ( UGCAUG) is present in introns (324329) The amino acid region in Fox 1 that binds the U GCAUG intronic sequence is homologous to a region in the Fox 3 protein, suggesting Fox 3 could bind the same intronic region and help enhance RNA splicing (324, 330) Underwood et al. showed that the protein levels of Fox 1 and Fox 2 directly affect both mRNA and protein levels of R NA sequences that contain the intronic Fox binding element in neurons (329) If NeuN/Fox 3 is being down regulated by hGFP then it would not be surprising that downstream transcripts could be adversely affected as well Zhang et al. found a number of potential binding sites for the Fox 1 and Fox 2 RNA splicing proteins. A search of the database generated from Zhangs study revealed that PDE10a has one predicted splice variant regulated by Fox1/2 (331) While it has not been confirmed as of 2008, it is intriguing that one of the transcripts decreased in our studies has potential alternative splicing derivatives controlled by a protein (NeuN/Fox3) that is down regulated. If NeuN/Fox3 function is somehow being altered by the presence of hGFP, the splicing that is necessary for proper mRNA processing would be effected. NeuN/Fox3 downregulation might be one explanation for the transcriptional dysregulation we are observing in our hGFP injected mice. GFAP Activation aft er rAAV5 hGFP I njections Single s ter e otaxic injections into the brain have shown some increase in astrocytic activation by GFAP staining (314, 315) but such effects are usually restricted to the needle tract. Peden et al. showed that striatal rAAV re administration to the opposite

PAGE 101

101 side in rats showed considerable increases in astrocyte activation (314) but no significant astrocytic activation was observed in their singl e administration studies. Peden also showed that the transgene, hGFP, showed little apparent toxicity because repeated administrations of the same hGFP cassette with a different serotype showed no reductions of hGFP expression and little immune response, e ither astrocytic or mic ro glial. Our results here show that 14 weeks and 26 weeks after a single rAAV5 hGFP injection we saw relatively large astrocytic activation on the injected side of the brain not confined to the needle tract. The two studies by Peden et al. showed single injections have little GFAP activation, but both studies only examined rats at 4 to 8 weeks post injection. Not only did the study not go past 8 weeks, Peden et al.s injections were done in rats, not mice. It is possible that there is a species dependent variable in the astrocytic response to the rAAV5hGFP injection. McBride et al. have examined microglia (Iba1 positive staining) at 16 weeks post injection of an GFP vector using the CAG 140 heterozygous mice but showed no si gnificant increases (292) Though, the hrGFP was used in their studies rather than the hGFP that we are using here. It would still be useful to know if any astrocyte activation was present at the same time in the McBride study. A more robust study of both astrocytic and micglial activation in long term injected mice would be prudent to determine if hGFP, or GFP in general, has any effect Conclusions The results of the work done here, demonstrate that there was d ramatic negative effects following rAAV5 hGFP injections into mice These toxic side effects were apparent at 14 and 26 weeks post injection in our nTG and also in our CAG 140

PAGE 102

102 homozygous mice. Transcriptional downregulation, DARPP32 protein reductions, NeuN reductions, and GFAP activation were all evident in the rAAV5hGFP injected mice. These results possible indicate that the rAAV5hGFP injections have potential long term toxic side effects and further investigation is warranted to determine the exact extent and role either rAAV5 or hG FP may have in mice long term.

PAGE 103

103 Fi gure 51 Transcriptional downregulation of striatally enriched mRNA transcript s 14 and 26 weeks following rAAV5 hGFP injections. The striatal area of the rAAV5 hGFP injected mice was analyzed for optical density and normaliz actin Values shown are percent of the uninjected striatal region. A) nTG transcripts 14 and 26 weeks post injection showed significant reductions compared to uninjected side ( ANOVA, p<0.0001 and p<0.0001). B) H eterozygous transcripts 14 weeks ( ANOVA, p>0.05) did not show significant differences from uninjected sides while 26 weeks post injection were significantly reduced ( ANOVA, p<0.05) C) Like the heterozygous transcripts homozygous transcripts were not reduced at 14 weeks ( ANOVA, p>0.05) but were at 26 weeks ( ANOVA, p<0.0005) nTG:14 week post injection N=6 26 weeks post injection N=8 HET: 14 week post injection N=5 (D2 N=3), 26 week post injection N=7 (DARPP32 N=6 ppENK N=5), HOM: 14 week post injection N=5, 26 week post injection N=5) asterisk = significant differences between injected and injected.

PAGE 104

104 Figure 52 Example of 33P radioactive in situ mRNA hybridization of various transcripts and verification of the hGFP transcript DARPP32, ppENK and PDE10a transcript reductions are cl early seen in the images above. Injection side is evident by the presence of hGFP transcript seen on the right side of the far left image. The pattern shown here is also evident in the other transcripts shown in Figure 51.

PAGE 105

105 Figure 53 Total DARPP32 pr otein reductions after rAAV5hGFP injection. A) Representative section of GFP stained 28 week old rAAV5hGFP injected mouse with a near IR antibody. B) Same section stained with a near IR antibody for DARPP32. Injected side is shown on the right. C ) Quan tification of total DARPP32 from the uninjected and injected striatal regions showed an overall reduction by ANOVA (ANOVA, p < 0 .05) 14 week post injection N=5, 26 week post injection N=4, D ) Het and Hom DARPP32 quantification of DARPP32 at 26 weeks pos t injection. No significant difference s in the Het and Hom mice individually or overall was observed (ANOVA, p> 0 .05)

PAGE 106

106 Figure 54 Quantification of total striatal cells shows no significant difference following rAAV5 hGFP injections in nTG mice. Cresol violet staining shows no significant differences between uninjected and injected striatal regions of nTG mice. Total cells were quantified using a sterologically based sampling regime. Bars represent the percentage of the uninjected side. (14 weeks post in jection N=3, 26 weeks post injection N=4).

PAGE 107

107 Figure 55 NeuN staining reductions after rAAV5hGFP injections. A) Low power representative image of an nTG 14 weeks post injection, scale bar = 1mm B) High power representative images of uninjected and C) injected of image in A). D ) Quantification of NeuN positive cells in the nTG animals injected with rAAV5hrGFP have an overall reduction compared to the uninjected side (ANOVA, p<0.0001) as well as in the homozygous injected mice (ANOVA, p<0 .001) ( nTG: 14 weeks post injection N=4, 26 weeks post injection N=4; HOM: 14 weeks post injection N=3, 26 weeks post injection N=5; asterisk = p<0.001). E) Average NeuN positive cells per 1mm2 from uninjected side of nTG and homozygous mi ce NeuN positive cells were quantified using a ster ologically based sampling regime. All asterisk represent significant differences from c orresponding uninjected sides. Scale b ar = 50 m.

PAGE 108

108 Fig ure 56 GFAP positive staining 26 weeks after rAAV5hGFP injections in a nTG mouse. A) Low magnification of a 14 week post injection nTG mouse inject ed with rAAV5 hGFP. Scale bar = 1mm B and C) show the highlighted region in A). B) High magnification o f the uninjected side and C) High magnification of the injected side. Scale bar= 50 m.

PAGE 109

109 Table 51 Qualitative analysis of GFAP p ositive l abeled cells in the s triatum Genotype 14 Weeks Post Injection 26 Weeks Post Inject ion nTG Uninjected + + Injected ++/+++ ++ Homozygote Uninjected + +/ Injected ++/+++ ++

PAGE 110

110 CHAPTER 6 DISCUSSION Characterization of the CAG 140 HD Mouse M odel Overview of CAG Characterization The CAG 140 mouse model characterized in this project is one of the many models that have been developed to study HD (145, 146, 149, 157, 164, 165, 168, 178) At the start of this project little was known about the longterm behavioral or histopathological progression of the HDlike symptoms in CAG 140 model In order to determine if this HD knock in mouse line was a viable and representative model of HD, a long term study was needed. Here we have shown that there are aspects of the CAG 140 model that are similar to HD and previous HD mouse models Similarities include the disease related transcriptional downregulation and the progressive increase of NIIs. In the CAG 140 model, we observed significant rearing behavioral and rotarod deficit ; however these were not progressive. We started our behavioral testing at 10 weeks of age and found there was a difference in the number of rearings in a novel environment between the nTG and the afflicted mice. The knock in hypoactiv i ty is congruent with what was seen before in M enalleds initial study of CAG140 mice (169) G ait abnormalities were observed in the knock in mice at 12 mont hs in Menalleds study but in the work performed here neither the heterozygous nor the homozygous m ice displayed gait abnormalities compared to the nTGs. U nlike what is observed in the R6, N171 and other transgenic models, we did not detect any abnormal clasping behavior at any point during the course of these studies. A dditionally we did not observe any significant overall weight differences (Figure 38) This is contrary to what has been described previously in the

PAGE 111

111 CAG 140 mice over a similar time course. In the Dorner study (171) female knock in mice weighed significantly less than their nTG counter parts RNA transcript analysis of this model showed disease related downregulation in a variety of striatal specific genes. Over time, CAG 140 mice displayed a downregulation of a variety of striatal specific transcripts which is congruent with both humans and all other HD mouse models (2325, 63, 64, 91, 9397) The mRNA transcriptional downregulation began between 6 to 9 months and after the onset of rearing behavior deficits. The progressive decreases in the mRNA transcripts did not cor relate with the rearing behavioral abnormalities observed. The transcriptional changes seen here may not be associated with the behavioral abnormalities and suggests that other factors are contributing to the observed behavior. There is a progressive increase in the density of striatal NIIs in the CAG 140 mice, which are present in both humans as well as the other mouse models of HD (127, 128, 157, 168, 169, 178) We bega n to observe NIIs at approximately 6 mont hs in the CAG 140s, which is about the same time we bega n to see transcript downregulation. Numerous groups have shown that mutant htt has an effect on the function of various transcript ional factor s (104108, 110, 111) and in some cases transcriptional factors have been found to be colocalized to inclusion bodies (105) Previous characterizations of the CAG 140 mice has shown that NIIs begin to form earli er at approximately 4 months but the discrepancies between these studies and ours might be due to the fact we are missing the actual window of the NIIs between our 3 month and 6 month age groups.

PAGE 112

112 In the wor k performed here, we observed progressive increases in NIIs but we did not see progressive behavioral abnormalities. Like the transcript levels discussed above, the presence of NIIs may have no real bearing on the behavioral aspects in this mouse model. There is some evidence that instead of being detrimental the NIIs may in fact be beneficial. Two such studies have found that NIIs are a protective aspect of HD as the decreases in NIIs causes higher neuronal death (332) while increased NII formation showed greater neuronal survival (333) The latter study by Arrasate in 2004 was supported by a recent study in 2010 by Miller et al. that showed a direct quantitative relationship between neuronal survival and the formation of NIIs in an cell culture model of HD (334) When an NII is formed, the soluble mutant huntingtin decreases dramatically and the neuronal survival time increases. Those cells that did not form NIIs but did contain the mutant protein died much sooner than the NII containing neurons (334) From these studies, NIIs as a measure of disease progression or therapeutic value may not be useful. In conclusion, while there is no progressive behavioral phenotype in the CAG 140 mice from the tasks performed here, these mice do display progressive histopathological abnormalities that mimic similar data from other HD models as well as from the human disease (2325, 6264, 91, 93, 94, 96, 97, 127, 128, 157, 168, 169, 178) Additionally the CAG 140 model may be a more genet ically accurate model for HD than other transgenics because they have the correct gene dosing associated with HD. The R6, N171Q82, YACs and virally generated models of HD, still contain both copies of the endogenous hdh, and as such, may represent confounded HD models T he knock in model s of HD, including the CAG 140 mice, have the correct gene dosing

PAGE 113

113 and exhibit the phenotypes that have been classically associated with HD. Both the transgenics and the knock in models of HD have been invaluable to t he study of HD. Future Directions of S tudy in the CAG 140 HD M odel Despite the work performed here and previous work on the CAG 140 model, more characterizations could be performed. Cognitive and psychological abnormalities are present in the human disease and might be present in the CAG 140 mouse model as well. Detailed cognitive testing such as the Morris water maze task or the recently designed What Where When task might be warranted to test such potential abnormalities (335, 336) De Vito et al. designed the What Where When task to test a rodents ability to remember if an object is novel the location of that object spatially as well as when the object was placed in its original location (336) The What WhenWher e task as might give invaluable information about the learning and memory impairments that might be present in the CAG 140 mice. Moreover, a longitudinal study of these tasks might show if the mice showed an initial inability to learn the task or a gradu al impairment as the mice age. Our transcriptional analysis of the mice is an important but equally as important would be a protein profile of the CAG 140 mice. An analysis of the potential protein downregulation in this model would be another i mportant analysis. DARPP32 as an example, has been shown to be down regulated in other HD mice models (118, 120) as well as in this model by Hickey et al. (170) It would be invaluable to determine which proteins are being downregulated and at what time the downregulation occurs. Various groups have demonstrated that cortical thinning is progressive in HD and is one method of detecting the progression of the disease in humans (13, 1518) In our hands some slight cortical thinning differences between the nTG and the knock in mice

PAGE 114

114 were observed. Slight cortical thinning is congruent with the previous studies on thinning in humans with HD (1318, 337) Lon gitud i nal studies in the R6 and YAC mice using MRI have shown not only cortical but other morphological changes as the mice age (338340) Such lo n gitudi nal studies of cortical thinning in the knock in mice models would be more beneficial and potentially more significant than the crosssectional study performed here. Therapeutic Treatment in the CAG 140 HD M odel Huntingtin KnockDown Previous work showing that the reductions of mutant htt in transgenic lines can improve the HD associated phenotypes (148, 163, 259) In particular two studies, Harper et al. and Rodri guez Lebron et al showed shRNA mediated knock down of the mutant htt showed improvements in both behavior and some neuropathological aspects of the transgenic mouse models (163, 259) These three studies showing reductions of mutant htt in transgenic models of HD lead us to investigate the possibility that knock down of the mutant htt in a knock in model would elicit the same improvements Our use of shRNA mediated knock down of mutant htt in the CAG 140 knock in model did not show the same improvements observed previously in the transgenic models of HD Despite the NII reductions seen in the siHUNT2 injected mice, we did not detect an improvement in the striatal mRNA transcript levels but rather we saw additional decreases in the diseaserelated striatal specific transcript s. Additionally we observed a similar pattern in our siHUNT1 shRNA, which does not target the mutant htt present in CAG 140 mice Not only did our shRNA control show NII reductions and further transcriptional downregulat ion, but our GFP control injections also showed transcriptional downregulation. Slight behavioral improvements were seen early in

PAGE 115

115 rearing behavior after injections with siHUNT2, but these improvements did not continue and returned to the uni njected heterozygote averages Because of the disconnect between any long term overt behavioral improvements and the further transcriptional down regulation, we can not definiti ve ly conclude that reductions in NIIs are either beneficial or detrimental H omozygous CAG 140 mice 26 week s after siHUNT2 injection show ed massive striatal atrophy in half of the injected animals. The only copy of htt present in these mice is the expanded mutant htt and the observed atrophy suggests total loss of huntingtin maybe detrimental. The mice that did not show siHUNT2 induced atrophy did not have reductions in transcripts below that of the disease related reductions These nonatrophied siHUNT2 26 week post injection homozygous mice did have significant reductions in NIIs. It is impossible to conclude any therapeutic advantage when half of the animals treated with the shRNA show massive atrophy and the half show no real improvement other than a reduction in the NIIs. Based on our siHUNT2 26 week data that showed atrophy, and previous work done on hdh reductions (146) c omplete reduction of striatal htt may not be the best approach. Dragatis et al. in 2000 showed total reductions of hdh in the brain via a crelox system displayed significant neuronal loss and some behavioral abnormalities (146) O ur homozygous mice injected with the siHUNT2 would be a localized version of the Dragatis study, and the massive atrophy could be equivalent to the neuronal loss seen in the Dragatis mice. The atrophy seen in half of our homozy gous mice injected with siHUNT2 at 26 weeks may support the Dragatis study that reported complete reduction of htt is potentially toxic It should be noted though that the Dragatis study reduces all

PAGE 116

116 hdh in the CNS of the mice. This total reduction would not be realistic in a human genetherapy treatment as of right now. There is no current method of transducing the entire CNS with a vector that would reduce all mutant htt or htt However, the Dragatis is a good proof of concept study that should be cons idered when examining complete knock down of mutant htt T wo recent studies by Drouet and Boudreau show that endogenous reduction of hdh in addition to the reduction mutant htt via RNAi is tolerable in contrast to the Dragatis hdh knock down (285, 287) In the Dr ouet paper, the mutant htt was introduced via lentivirus injections to the striatum (287) and Boudreau used the N171Q82 transgenic HD model (285) The RNAi knockdown of mutant htt and hdh in both of these latter studies yi elded some transcriptional abnormalities (285, 287) but showed an overall significant improvement in both NIIs as well as the behavioral phenotype. While these two studies show some promise for nonallele specific siRNA targeting in HD, it should be noted that i n a heterozygous mice knock in mice there is half as much endogenous hdh as there is in a transgenic model (one copy of hdh vs two copies). Reducing the hdh protein levels in a transgenic mouse line to 50% would be equivalent to the normal hdh levels in a heterozy gous knock in mouse. A similar 50% reduction of hdh in a heterozygous knock in mouse would be equivalent to a 25% reduction in a transgenic mouse model. The fact that both models used in the Drouet and Boudreau studies have two copies of the endogenous hdh, creates a gene dosing issue that may confound the interpretation of the RNAi treatments. To study the complete removal of all huntingtin further a knock down of both the endogenous and the mutant HD allele specifically in the striatum of a rodent knock in

PAGE 117

117 model would be of great benefit and would determine if significant knock down of htt and mtt would be of any benefit. McBride et al. attempted this approach by injecting their shRNAs that target both hdh and mtt into the heterozygous CAG 140 model, but their shRNAs proved to be toxic and showed microglia l activation along with DARPP 32 protein reductions. Converting their shRNAs into miRNAs, McBride et al. showed the toxicity could be reduced, but no further studies into the effectiveness of t heir miRNAs on HD pathology or behavior in the CAG 140 mice was performed (292) F uture Direction and Studies As discussed previously in chapter 4, shRNA might be toxic in vivo (285, 291293, 295) and i f the shRNA toxicity is playing a role in the transcript downregulation, it might be overshadow ing any therapeutic effect due to the mutant htt knock down. shRNA toxicity appears to be alleviated by using miRNA backbones (285, 292, 295) or by using a different promoter that produces less of the shRNA (341) While Giering showed that by changin g the RNA Pol (III) promoter, that is normally used to drive shRNAs, with the RNA Pol (II) promoter reduced the observed toxicity when used in the liver (341) T his is promising for the use of shRNAs in general but there has not been an attempt in neurons to show the same amelioration. Additionally, Gier ing et al. did not examine the possibility of off targeting due to the imprecise start transcriptional start site associated with the Pol (II) promoter. As recent ly as 2010, groups have still been utilizing the Pol (III) promoter and seeing shRNA toxicity in neurons (293) Our work here does not utilize either the miRNA backbone or the Pol (II) promoter system that would modulate the amount of RNA i being produced b y neurons. These two issues may explain the potential siHUNT1 toxicity that we observe. While we can not explain the exact mechanism by which siHUNT1 is causing such toxicity, it maybe due

PAGE 118

118 to over loading the endogenous miRNA pathways described by Grimm and Boudreau (291, 295) To determine if the observed toxicity in our study is due to the overloading of the miRNA pathways siHUNT1 could be converted to a mi RNA form an d tested for transcriptional dysregulations. siHUNT1 should not target either the mutant or the normal allele and the effect of the shRNA vs. miRNA could then be examined directly. Once a less toxic, and ideally non toxic, method of RNAi production is desi gned, the effectives of huntingtin knock down can be examined without complications. T here are approximately 45 to 50% of individuals with polymorphisms in the mutant huntingtin allele that could be specifically targeted by designing custom a RNAi (342, 343) I t would be important to determine if there is a single target sequence in htt that could be used which w ould both reduce the mutant htt enough to relieve the effects of HD, bu t leave enough normal htt so neurons can function normally. Such an RNAi sequence would target everyone afflicted with the disease would be much easier and more cost effective than designing specific sequences to target an individual whose sequence is unique. Unfortunately the exact role of huntingtin is still a mystery and the threshold levels of normal huntingtin are unknown. Compounding Variables Convection Enhanced Delivery Mannitol has been shown in the clinic to help alleviate brain swelling (344346) b y allowing water to move from the brain towards the blood str eam to relieve the pressure. V arious groups including our lab, have demonstrated that this osmotic pressure differential can greatly increased the viral transduction area i f mannitol is given prior to intracranial injections (347351) This method of increasing viral spread has been named con vection enhanced delivery (CED) and was used in this study.

PAGE 119

119 I ncreasing the volume of transduced cells in the brain would be ideal, as long as no adverse effects arise from the transgene or the virus itse lf. S mall negative effects caused by the transgene and or viru s, might be increased substantially due to the larger transduction volume if CED is used Additionally, the introduction of the differential osmotic pressure between the CNS and the circulatory system might allow for immunological peptides (such as the vir al particle) to flow from the brain to the periphery, after breaking the dura during our stereotaxic injections, were there is a greater probability of an imm une response would be elicited. We observed an increase in astrocytic proliferation in our mice on the injected side. This increased astrocytic activity could be part of an imm une response. H owever, b ecause we do not observe an exaggerated astrocytic proliferation in the uninjected hemisphere, the mannitol injections by themselves are not the cause of the astroc ytic response. It is most likely the combination of the mannitol and ster e otaxic injection that cause the astrocytic response. Further studies into the possibility that mannitol contributes to an inflammatory / immunological response would be necessary if such osmotic CED is to be used in the future. Transgene Toxicity GFP toxicity There have also been a number reports of GFP toxicity in vitro (352, 353) as well as in vivo (213, 354358) Klein et al. in 2006 showed that after i njections of rAAV8 GFP into the substatia nigra (SN) there was loss of t yrosine hydroxylas e positive cells but no substantial cellular loss due to the presence of the GFP (213) Kleins work is congruent with our studies in that we still see both the mRNA transcript of hGFP and hGFP anti body staining even though both DARPP 32 and NeuN protein staining are reduced.

PAGE 120

120 Cellular dysfunction might be a better explanation than cellular death. While Klien s study did not show NeuN loss as was observed in our study the loss of t yrosine hydroxylas e positive cells in the SN suggests a similar process might be happening (213) One study in 2009 and t wo re cent study in 2010 showed that GFP may become toxic if it is placed behind a strong promoter. In 2009 Ulusoy et al. used rAAV5 at varying titers in the SN to test the dose optimiz ation for various shRNAs and found that at high titers (1012 and 1013 vg/ml), their h GFP control showed cellular loss (359) Beltran et al. saw that h GFP was possibly the cause of cone cell loss after delivery of rAAV5 hGFP vectors to the retina of canines (355) W hen placed behind either the CBA promoter, or the a human G proteincoupled receptor protein kinase 1 promoter (hGRK1) at v arious high titers (1012 and 1013 vg/ml), hGFP showed retinal atrophy and detachment The mouse opsin promoter (mOP) was also examined but did not show the same cellular atrophy at any of the titers examined. Another study by S awada et al. injected P0 wistler rat pups with a l entiviral vector containing GFP driven by a strong murine stem cell virus promoter (MSCV) and showed that after three weeks Purkinje cells had significant morphological and electrophysiological abnormalities (354) PBS injections and lenti viral vector injections containing a GFP driven by a weaker Purkinje specific promoter did not show any noticeable abnormalities. While the group showed significant neuronal abnormalities after the MSCV driven GFP injections no microglial activation was observed (354) These three studies support the evidence in our work here that rAAV5 hGFP injections to the striatum of mice may have some toxic effect s. In both t he Ulu soy and

PAGE 121

121 the Beltran study, t he rAAV5 hGFP (created by the UF11 vector) as well as titers used ( 1012 t o 1013 vg/ml ) match what was used in our mice ( rAAV5 hGFP at 1.69 x 1013 vg/ml). The fact that the same vector construct and titer that we used in our study showed similar toxicity in another species and at another injection site gives the work performed here more credence. It is possible that GFP driven by a strong promoter and or high viral titers containing GFP may lead to cellular toxicity Double transgene toxicity Krestel et al. in 2004 generated a mouse line that expressed both eGFP and galactosidase at the same protein levels and showed significant neuropathology and cellular death in neurons (356) Significant pathology was evident in these double transgenic mice which included aggregates, large glial proliferation, as well apoptotic markers (cleaved caspase3). Mice also exhibited muscle weakness compared to nTG littermates and died within 1 month of birth. As a comparison, eGFP transgenic mice that express double the amount of e GFP compared to the eGFP/ galactosidase mice do not show the same phenotype except for aggregations of eGFP. galactosidase transgenic mice also do not show such a dramatic phenotype as was noted by Krestel et al. (356, 357) The group suggested that the expression of two exogenous proteins expressed in together cause a synergetic effect leading to the toxicity. The recent development of the Brainbow mice helps to support the concept that fluorescent proteins themselves are not toxic N o reports so far have come out suggesting that the multiple fluorescently colored mice have any neuropathological abnormalities (360) In our rAAV5hGFP construct there is a neomycin resistance gene downstream of the hGFP. The neomycin gene was originally placed in the UF1 1 plasmid construct for cell selection in in vitro studies. If the neomycin gene is being expressed along with

PAGE 122

122 hGFP (and the shRNAs for that matter) we maybe seeing a similar effect to what Krest el observed in their double transgenic mice. The glial proliferation is an interesting similarity between our rAAV5 hGFP injections and the Krestel double transgenic mice and might indicated a similar toxic process. Removing the neomycin resistance gene th at is present in our UF11 vector would be a good first step in trying to reduce toxicity. Concluding Remarks At the end of the study, the hypothesis regarding a phenotypical difference between the nTG and the knock in mice proved to be correct. There is a behavioral and histopathological difference between the nTG and the knock in mice. Our second hypothesis that RNAi could reduce the phenotypical differences by reducing the mutant huntingt in was not fully proven. Because of potential shRNA and or GFP tox icity we can not definitively state that RNAi can rescue the CAG 140 knock in mice. In conclusion, long term expression ( 14 to 26 weeks ) of shRNAs and hGFP by rAAV delivery has shown signs of neuronal toxicity. RNAi and transgene ex pression l evels, whether generated by the promoter or the efficiency of the viral delivery method, is an important factor to consider in the future. CED is a useful tool to maximize the area transduced by rAAV or other viral vectors, but if such enhancements in transduction lead to toxic protein and or RNAi over load in neurons, such methods might need to be re evaluated. A s the genetherapy field generates newer and more efficient rAAV serotypes effects seen in this study may become more common. GFP will probably not be a factor when designing a product for human use, but the use of GFP as a control has been a cornerstone of biology for years and any toxicity due to GFP may call into question past research. Similarly, if shRNAs themselves are

PAGE 123

123 directly causing toxicity, results from past shRNA studies could be called into question and less toxic substitutes, such as miRNA, may need to replace them

PAGE 124

124 REFERENCES 1. Thompson, J.C., Snowden, J.S., Craufurd, D. and Neary, D. (2002) Behavior in Huntington's disease: dissociating cognition based and moodbased changes. J Neuropsychiatry Clin Neurosci, 14, 3743. 2. Naarding, P., Kremer, H.P. and Z itman, F.G. (2001) Huntington's disease: a review of the literature on prevalence and treatment of neuropsychiatric phenomena. Eur Psychiatry, 16, 43945. 3. van Duijn, E., Kingma, E.M. and van der Mast, R.C. (2007) Psychopathology in verified Huntington's disease gene carriers. J Neuropsychiatry Clin Neurosci, 19, 4418. 4. Grimbergen, Y.A., Knol, M.J., Bloem, B.R., Kremer, B.P., Roos, R.A. and Munneke, M. (2008) Falls and gait disturbances in Huntington's disease. Mov Disord, 23, 9706. 5. Lasker, A.G. and Zee, D.S. (1997) Ocular motor abnormalities in Huntington's disease. Vision Res, 37, 363945. 6. Craufurd, D., Thompson, J.C. and Snowden, J.S. (2001) Behavioral changes in Huntington Disease. Neuropsychiatry Neuropsychol Behav Neurol, 14, 21926. 7. Law rence, A.D., Hodges, J.R., Rosser, A.E., Kershaw, A., ffrench Constant, C., Rubinsztein, D.C., Robbins, T.W. and Sahakian, B.J. (1998) Evidence for specific cognitive deficits in preclinical Huntington's disease. Brain, 121 ( Pt 7), 132941. 8. Lawrence, A .D., Sahakian, B.J., Hodges, J.R., Rosser, A.E., Lange, K.W. and Robbins, T.W. (1996) Executive and mnemonic functions in early Huntington's disease. Brain, 119 ( Pt 5), 163345. 9. Louis, E.D., Lee, P., Quinn, L. and Marder, K. (1999) Dystonia in Huntingt on's disease: prevalence and clinical characteristics. Mov Disord, 14, 95 101. 10. Rosenblatt, A. and Leroi, I. (2000) Neuropsychiatry of Huntington's disease and other basal ganglia disorders. Psychosomatics, 41, 2430. 11. Vonsattel, J.P., Myers, R.H., S tevens, T.J., Ferrante, R.J., Bird, E.D. and Richardson, E.P., Jr. (1985) Neuropathological classification of Huntington's disease. J Neuropathol Exp Neurol, 44, 55977. 12. Graveland, G.A., Williams, R.S. and DiFiglia, M. (1985) Evidence for degenerative and regenerative changes in neostriatal spiny neurons in Huntington's disease. Science, 227, 7703.

PAGE 125

125 13. Rosas, H.D., Salat, D.H., Lee, S.Y., Zaleta, A.K., Pappu, V., Fischl, B., Greve, D., Hevelone, N. and Hersch, S.M. (2008) Cerebral cortex and the clinic al expression of Huntington's disease: complexity and heterogeneity. Brain, 131, 105768. 14. Hobbs, N.Z., Barnes, J., Frost, C., Henley, S.M., Wild, E.J., Macdonald, K., Barker, R.A., Scahill, R.I., Fox, N.C. and Tabrizi, S.J. (2010) Onset and progression of pathologic atrophy in Huntington disease: a longitudinal MR imaging study. AJNR Am J Neuroradiol, 31, 103641. 15. Hobbs, N.Z., Henley, S.M., Ridgway, G., Wild, E.J., Barker, R., Scahill, R.I., Barnes, J., Fox, N.C. and Tabrizi, S. (2009) The Progressi on of Regional Atrophy in Premanifest and Early Huntington's Disease: A Longitudinal Voxel Based Morphometry Study. J Neurol Neurosurg Psychiatry 16. Gomez Anson, B., Alegret, M., Munoz, E., Monte, G.C., Alayrach, E., Sanchez, A., Boada, M. and Tolosa, E. (2009) Prefrontal cortex volume reduction on MRI in preclinical Huntington's disease relates to visuomotor performance and CAG number. Parkinsonism Relat Disord, 15, 213 9. 17. Rosas, H.D., Hevelone, N.D., Zaleta, A.K., Greve, D.N., Salat, D.H. and Fischl B. (2005) Regional cortical thinning in preclinical Huntington disease and its relationship to cognition. Neurology, 65, 7457. 18. Rosas, H.D., Lee, S.Y., Bender, A.C., Zaleta, A.K., Vangel, M., Yu, P., Fischl, B., Pappu, V., Onorato, C., Cha, J.H. et al. (2010) Altered white matter microstructure in the corpus callosum in Huntington's disease: implications for cortical "disconnection". Neuroimage, 49, 29953004. 19. Ruocco, H.H., Lopes Cendes, I., Li, L.M., Santos Silva, M. and Cendes, F. (2006) Striata l and extrastriatal atrophy in Huntington's disease and its relationship with length of the CAG repeat. Braz J Med Biol Res, 39, 112936. 20. Halliday, G.M., McRitchie, D.A., Macdonald, V., Double, K.L., Trent, R.J. and McCusker, E. (1998) Regional specifi city of brain atrophy in Huntington's disease. Exp Neurol, 154, 66372. 21. Peinemann, A., Schuller, S., Pohl, C., Jahn, T., Weindl, A. and Kassubek, J. (2005) Executive dysfunction in early stages of Huntington's disease is associated with striatal and insular atrophy: a neuropsychological and voxel based morphometric study. J Neurol Sci, 239, 119. 22. Hu, H., McCaw, E.A., Hebb, A.L., Gomez, G.T. and DenovanWright, E.M. (2004) Mutant huntingtin affects the rate of transcription of striatum specific isofo rms of phosphodiesterase 10A. Eur J Neurosci, 20, 335163. 23. Augood, S.J., Faull, R.L. and Emson, P.C. (1997) Dopamine D1 and D2 receptor gene expression in the striatum in Huntington's disease. Ann Neurol, 42, 21521.

PAGE 126

126 24. Albin, R.L., Qin, Y., Young, A. B., Penney, J.B. and Chesselet, M.F. (1991) Preproenkephalin messenger RNA containing neurons in striatum of patients with symptomatic and presymptomatic Huntington's disease: an in situ hybridization study. Ann Neurol, 30, 5429. 25. Richfield, E.K., Magu ire Zeiss, K.A., Cox, C., Gilmore, J. and Voorn, P. (1995) Reduced expression of preproenkephalin in striatal neurons from Huntington's disease patients. Ann Neurol, 37, 33543. 26. Hebb, A.L., Robertson, H.A. and DenovanWright, E.M. (2004) Striatal phosphodiesterase mRNA and protein levels are reduced in Huntington's disease transgenic mice prior to the onset of motor symptoms. Neuroscience, 123, 96781. 27. Sorensen, S.A. and Fenger, K. (1992) Causes of death in patients with Huntington's disease and in unaffected first degree relatives. J Med Genet, 29, 9114. 28. Beighton, P. and Hayden, M.R. (1981) Huntington's chorea. S Afr Med J, 59, 250. 29. Walker, F.O. (2007) Huntington's disease. Lancet, 369, 21828. 30. Wexler, N.S., Lorimer, J., Porter, J., Gomez, F., Moskowitz, C., Shackell, E., Marder, K., Penchaszadeh, G., Roberts, S.A., Gayan, J. et al. (2004) Venezuelan kindreds reveal that genetic and environmental factors modulate Huntington's disease age of onset. Proc Natl Acad Sci U S A, 101, 3498503. 31. Folstein, S.E., Chase, G.A., Wahl, W.E., McDonnell, A.M. and Folstein, M.F. (1987) Huntington disease in Maryland: clinical aspects of racial variation. Am J Hum Genet, 41, 16879. 32. NIH (2010) Huntington disease. http://ghr.nlm.nih.gov/condition=huntingtondisease 33. Spinney, L. (2010) Uncovering the true prevalence of Huntington's disease. Lancet Neurol, 9, 7601. 34. Rawlins, M. (2010) Huntington's disease out of the closet? Lancet 35. The Huntington's Disease Collaborative Research Group (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell, 72, 97183. 36. Rubinsztein, D.C., Leggo, J., Coles, R., Almqvis t, E., Biancalana, V., Cassiman, J.J., Chotai, K., Connarty, M., Crauford, D., Curtis, A. et al. (1996) Phenotypic characterization of individuals with 3040 CAG repeats in the Huntington disease (HD) gene reveals HD cases with 36 repeats and apparently normal elderly individuals with 36 39 repeats. Am J Hum Genet, 59, 16 22.

PAGE 127

127 37. Sequeiros, J., Ramos, E.M., Cerqueira, J., Costa, M.C., Sousa, A., Pinto Basto, J. and Alonso, I. (2010) Large normal and reduced penetrance alleles in Huntington disease: instabil ity in families and frequency at the laboratory, at the clinic and in the population. Clin Genet 38. Brinkman, R.R., Mezei, M.M., Theilmann, J., Almqvist, E. and Hayden, M.R. (1997) The likelihood of being affected with Huntington disease by a particular age, for a specific CAG size. Am J Hum Genet, 60, 120210. 39. Rosenblatt, A., Abbott, M.H., Gourley, L.M., Troncoso, J.C., Margolis, R.L., Brandt, J. and Ross, C.A. (2003) Predictors of neuropathological severity in 100 patients with Huntington's disease. Ann Neurol, 54, 48893. 40. Rosenblatt, A., Liang, K.Y., Zhou, H., Abbott, M.H., Gourley, L.M., Margolis, R.L., Brandt, J. and Ross, C.A. (2006) The association of CAG repeat length with clinical progression in Huntington disease. Neurology, 66, 101620. 41. Durr, A., Hahn Barma, V., Brice, A., Pecheux, C., Dode, C. and Feingold, J. (1999) Homozygosity in Huntington's disease. J Med Genet, 36, 1723. 42. Squitieri, F., Gellera, C., Cannella, M., Mariotti, C., Cislaghi, G., Rubinsztein, D.C., Almqvist, E.W. Turner, D., BachoudLevi, A.C., Simpson, S.A. et al. (2003) Homozygosity for CAG mutation in Huntington disease is associated with a more severe clinical course. Brain, 126, 94655. 43. Myers, R.H., Leavitt, J., Farrer, L.A., Jagadeesh, J., McFarlane, H. Mastromauro, C.A., Mark, R.J. and Gusella, J.F. (1989) Homozygote for Huntington disease. Am J Hum Genet, 45, 6158. 44. Wexler, N.S., Young, A.B., Tanzi, R.E., Travers, H., Starosta Rubinstein, S., Penney, J.B., Snodgrass, S.R., Shoulson, I., Gomez, F., Ramos Arroyo, M.A. et al. (1987) Homozygotes for Huntington's disease. Nature, 326, 1947. 45. Semaka, A., Collins, J.A. and Hayden, M.R. (2010) Unstable familial transmissions of Huntington disease alleles with 2735 CAG repeats (intermediate alleles). A m J Med Genet B Neuropsychiatr Genet, 153B, 314 20. 46. Myers, R.H., MacDonald, M.E., Koroshetz, W.J., Duyao, M.P., Ambrose, C.M., Taylor, S.A., Barnes, G., Srinidhi, J., Lin, C.S., Whaley, W.L. et al. (1993) De novo expansion of a (CAG)n repeat in sporadi c Huntington's disease. Nat Genet, 5, 16873. 47. Swami, M., Hendricks, A.E., Gillis, T., Massood, T., Mysore, J., Myers, R.H. and Wheeler, V.C. (2009) Somatic expansion of the Huntington's disease CAG repeat in the brain is associated with an earlier age of disease onset. Hum Mol Genet, 18, 303947.

PAGE 128

128 48. Duenas, A.M., Goold, R. and Giunti, P. (2006) Molecular pathogenesis of spinocerebellar ataxias. Brain, 129, 135770. 49. Finsterer, J. (2009) Bulbar and spinal muscular atrophy (Kennedy's disease): a revie w. Eur J Neurol, 16, 55661. 50. Kang, S. and Hong, S. (2009) Molecular pathogenesis of spinocerebellar ataxia type 1 disease. Mol Cells, 27, 6217. 51. Takahashi, T., Katada, S. and Onodera, O. (2010) Polyglutamine diseases: where does toxicity come from? what is toxicity? where are we going? J Mol Cell Biol, 2, 18091. 52. Yamada, M., Sato, T., Tsuji, S. and Takahashi, H. (2008) CAG repeat disorder models and human neuropathology: similarities and differences. Acta Neuropathol, 115, 7186. 53. Li, S.H., S chilling, G., Young, W.S., 3rd, Li, X.J., Margolis, R.L., Stine, O.C., Wagster, M.V., Abbott, M.H., Franz, M.L., Ranen, N.G. et al. (1993) Huntington's disease gene (IT15) is widely expressed in human and rat tissues. Neuron, 11, 98593. 54. Strong, T.V., Tagle, D.A., Valdes, J.M., Elmer, L.W., Boehm, K., Swaroop, M., Kaatz, K.W., Collins, F.S. and Albin, R.L. (1993) Widespread expression of the human and rat Huntington's disease gene in brain and nonneural tissues. Nat Genet, 5, 25965. 55. Hoogeveen, A.T. Willemsen, R., Meyer, N., de Rooij, K.E., Roos, R.A., van Ommen, G.J. and Galjaard, H. (1993) Characterization and localization of the Huntington disease gene product. Hum Mol Genet, 2, 206973. 56. Van Raamsdonk, J.M., Murphy, Z., Slow, E.J., Leavitt, B .R. and Hayden, M.R. (2005) Selective degeneration and nuclear localization of mutant huntingtin in the YAC128 mouse model of Huntington disease. Hum Mol Genet, 14, 382335. 57. Papalexi, E., Persson, A., Bjorkqvist, M., Petersen, A., Woodman, B., Bates, G.P., Sundler, F., Mulder, H., Brundin, P. and Popovic, N. (2005) Reduction of GnRH and infertility in the R6/2 mouse model of Huntington's disease. Eur J Neurosci, 22, 15416. 58. Squitieri, F., Falleni, A., Cannella, M., Orobello, S., Fulceri, F., Lenzi, P. and Fornai, F. (2010) Abnormal morphology of peripheral cell tissues from patients with Huntington disease. J Neural Transm, 117, 7783. 59. Ciammola, A., Sassone, J., Alberti, L., Meola, G., Mancinelli, E., Russo, M.A., Squitieri, F. and Silani, V. (20 06) Increased apoptosis, Huntingtin inclusions and altered differentiation in muscle cell cultures from Huntington's disease subjects. Cell Death Differ, 13, 206878.

PAGE 129

129 60. Strand, A.D., Aragaki, A.K., Shaw, D., Bird, T., Holton, J., Turner, C., Tapscott, S. J., Tabrizi, S.J., Schapira, A.H., Kooperberg, C. et al. (2005) Gene expression in Huntington's disease skeletal muscle: a potential biomarker. Hum Mol Genet, 14, 186376. 61. Smith, Y., Bevan, M.D., Shink, E. and Bolam, J.P. (1998) Microcircuitry of the d irect and indirect pathways of the basal ganglia. Neuroscience, 86, 35387. 62. AbordoAdesida, E., Follenzi, A., Barcia, C., Sciascia, S., Castro, M.G., Naldini, L. and Lowenstein, P.R. (2005) Stability of lentiviral vector mediated transgene expression i n the brain in the presence of systemic antivector immune responses. Hum Gene Ther, 16, 741 51. 63. Le Moine, C., Normand, E. and Bloch, B. (1991) Phenotypical characterization of the rat striatal neurons expressing the D1 dopamine receptor gene. Proc Natl Acad Sci U S A, 88, 42059. 64. Le Moine, C., Normand, E., Guitteny, A.F., Fouque, B., Teoule, R. and Bloch, B. (1990) Dopamine receptor gene expression by enkephalin neurons in rat forebrain. Proc Natl Acad Sci U S A, 87, 2304. 65. DeLong, M.R. (1972) A ctivity of basal ganglia neurons during movement. Brain Res, 40, 12735. 66. Crutcher, M.D. and DeLong, M.R. (1984) Single cell studies of the primate putamen. I. Functional organization. Exp Brain Res, 53, 23343. 67. Delong, M.R., Georgopoulos, A.P., Cru tcher, M.D., Mitchell, S.J., Richardson, R.T. and Alexander, G.E. (1984) Functional organization of the basal ganglia: contributions of single cell recording studies. Ciba Found Symp, 107, 6482. 68. DeLong, M.R. and Strick, P.L. (1974) Relation of basal ganglia, cerebellum, and motor cortex units to ramp and ballistic limb movements. Brain Res, 71, 32735. 69. Zhuang, X., Belluscio, L. and Hen, R. (2000) G(olf)alpha mediates dopamine D1 receptor signaling. J Neurosci, 20, RC91. 70. Herve, D., Le Moine, C., Corvol, J.C., Belluscio, L., Ledent, C., Fienberg, A.A., Jaber, M., Studler, J.M. and Girault, J.A. (2001) Galpha(olf) levels are regulated by receptor usage and control dopamine and adenosine action in the striatum. J Neurosci, 21, 43909. 71. Nishi, A., Bibb, J.A., Snyder, G.L., Higashi, H., Nairn, A.C. and Greengard, P. (2000) Amplification of dopaminergic signaling by a positive feedback loop. Proc Natl Acad Sci U S A, 97, 128405.

PAGE 130

130 72. Ouimet, C.C., Miller, P.E., Hemmings, H.C., Jr., Walaas, S.I. and Greengard, P. (1984) DARPP32, a dopamineand adenosine 3':5'monophosphateregulated phosphoprotein enriched in dopamineinnervated brain regions. III. Immunocytochemical localization. J Neurosci, 4, 11124. 73. Ouimet, C.C., Langley Gullion, K.C. and Gre engard, P. (1998) Quantitative immunocytochemistry of DARPP 32expressing neurons in the rat caudatoputamen. Brain Res, 808, 8 12. 74. Stoof, J.C. and Kebabian, J.W. (1981) Opposing roles for D 1 and D 2 dopamine receptors in efflux of cyclic AMP from rat neostriatum. Nature, 294, 3668. 75. Nishi, A., Snyder, G.L. and Greengard, P. (1997) Bidirectional regulation of DARPP32 phosphorylation by dopamine. J Neurosci, 17, 814755. 76. Gustafson, E.L., Girault, J.A., Hemmings, H.C., Jr., Nairn, A.C. and Greeng ard, P. (1991) Immunocytochemical localization of phosphatase inhibitor 1 in rat brain. J Comp Neurol, 310, 17088. 77. Hemmings, H.C., Jr., Greengard, P., Tung, H.Y. and Cohen, P. (1984) DARPP 32, a dopamineregulated neuronal phosphoprotein, is a potent inhibitor of protein phosphatase1. Nature, 310, 5035. 78. Svenningsson, P., Fienberg, A.A., Allen, P.B., Moine, C.L., Lindskog, M., Fisone, G., Greengard, P. and Fredholm, B.B. (2000) Dopamine D(1) receptor induced gene transcription is modulated by DARP P 32. J Neurochem, 75, 24857. 79. Fienberg, A.A., Hiroi, N., Mermelstein, P.G., Song, W., Snyder, G.L., Nishi, A., Cheramy, A., O'Callaghan, J.P., Miller, D.B., Cole, D.G. et al. (1998) DARPP32: regulator of the efficacy of dopaminergic neurotransmission. Science, 281, 83842. 80. Stoof, J.C. and Verheijden, P.F. (1986) D 2 receptor stimulation inhibits cyclic AMP formation brought about by D 1 receptor stimulation in rat neostriatum but not nucleus accumbens. Eur J Pharmacol, 129, 2056. 81. Svenningsson, P., Le Moine, C., Kull, B., Sunahara, R., Bloch, B. and Fredholm, B.B. (1997) Cellular expression of adenosine A2A receptor messenger RNA in the rat central nervous system with special reference to dopamine innervated areas. Neuroscience, 80, 117185. 82. Herkenham, M., Lynn, A.B., de Costa, B.R. and Richfield, E.K. (1991) Neuronal localization of cannabinoid receptors in the basal ganglia of the rat. Brain Res, 547, 26774. 83. Bidaut Russell, M. and Howlett, A.C. (1991) Cannabinoid receptor regulated cy clic AMP accumulation in the rat striatum. J Neurochem, 57, 176973.

PAGE 131

131 84. Glass, M. and Felder, C.C. (1997) Concurrent stimulation of cannabinoid CB1 and dopamine D2 receptors augments cAMP accumulation in striatal neurons: evidence for a Gs linkage to the CB1 receptor. J Neurosci, 17, 532733. 85. Svenningsson, P., Lindskog, M., Rognoni, F., Fredholm, B.B., Greengard, P. and Fisone, G. (1998) Activation of adenosine A2A and dopamine D1 receptors stimulates cyclic AMP dependent phosphorylation of DARPP 32 in distinct populations of striatal projection neurons. Neuroscience, 84, 2238. 86. Fujishige, K., Kotera, J. and Omori, K. (1999) Striatum and testis specific phosphodiesterase PDE10A isolation and characterization of a rat PDE10A. Eur J Biochem, 266, 1118 27. 87. Polli, J.W. and Kincaid, R.L. (1992) Molecular cloning of DNA encoding a calmodulindependent phosphodiesterase enriched in striatum. Proc Natl Acad Sci U S A, 89, 1107983. 88. Furuyama, T., Iwahashi, Y., Tano, Y., Takagi, H. and Inagaki, S. (1994) Localization of 63kDa calmodulinstimulated phosphodiesterase mRNA in the rat brain by in situ hybridization histochemistry. Brain Res Mol Brain Res, 26, 3316. 89. Polli, J.W. and Kincaid, R.L. (1994) Expression of a calmodulindependent phosphodiest erase isoform (PDE1B1) correlates with brain regions having extensive dopaminergic innervation. J Neurosci, 14, 125161. 90. Kotera, J., Fujishige, K., Yuasa, K. and Omori, K. (1999) Characterization and phosphorylation of PDE10A2, a novel alternative spli ce variant of human phosphodiesterase that hydrolyzes cAMP and cGMP. Biochem Biophys Res Commun, 261, 5517. 91. Reiner, A., Albin, R.L., Anderson, K.D., D'Amato, C.J., Penney, J.B. and Young, A.B. (1988) Differential loss of striatal projection neurons in Huntington disease. Proc Natl Acad Sci U S A, 85, 57337. 92. Berardelli, A., Noth, J., Thompson, P.D., Bollen, E.L., Curra, A., Deuschl, G., van Dijk, J.G., Topper, R., Schwarz, M. and Roos, R.A. (1999) Pathophysiology of chorea and bradykinesia in Hunti ngton's disease. Mov Disord, 14, 398 403. 93. Richfield, E.K., Maguire Zeiss, K.A., Vonkeman, H.E. and Voorn, P. (1995) Preferential loss of preproenkephalin versus preprotachykinin neurons from the striatum of Huntington's disease patients. Ann Neurol, 38, 85261. 94. Augood, S.J., Faull, R.L., Love, D.R. and Emson, P.C. (1996) Reduction in enkephalin and substance P messenger RNA in the striatum of early grade Huntington's disease: a detailed cellular in situ hybridization study. Neuroscience, 72, 102336.

PAGE 132

132 95. Richfield, E.K. and Herkenham, M. (1994) Selective vulnerability in Huntington's disease: preferential loss of cannabinoid receptors in lateral globus pallidus. Ann Neurol, 36, 57784. 96. Glass, M., Dragunow, M. and Faull, R.L. (2000) The pattern of neurodegeneration in Huntington's disease: a comparative study of cannabinoid, dopamine, adenosine and GABA(A) receptor alterations in the human basal ganglia in Huntington's disease. Neuroscience, 97, 50519. 97. Glass, M., Faull, R.L. and Dragunow, M. ( 1993) Loss of cannabinoid receptors in the substantia nigra in Huntington's disease. Neuroscience, 56, 5237. 98. Hodges, A., Strand, A.D., Aragaki, A.K., Kuhn, A., Sengstag, T., Hughes, G., Elliston, L.A., Hartog, C., Goldstein, D.R., Thu, D. et al. (2006) Regional and cellular gene expression changes in human Huntington's disease brain. Hum Mol Genet, 15, 96577. 99. Zabel, C., Mao, L., Woodman, B., Rohe, M., Wacker, M.A., Klare, Y., Koppelstatter, A., Nebrich, G., Klein, O., Grams, S. et al. (2009) A lar ge number of protein expression changes occur early in life and precede phenotype onset in a mouse model for huntington disease. Mol Cell Proteomics, 8, 72034. 100. Steffan, J.S., Kazantsev, A., Spasic Boskovic, O., Greenwald, M., Zhu, Y.Z., Gohler, H., W anker, E.E., Bates, G.P., Housman, D.E. and Thompson, L.M. (2000) The Huntington's disease protein interacts with p53 and CREB binding protein and represses transcription. Proc Natl Acad Sci U S A, 97, 67638. 101. Jiang, H., Poirier, M.A., Liang, Y., Pei, Z., Weiskittel, C.E., Smith, W.W., DeFranco, D.B. and Ross, C.A. (2006) Depletion of CBP is directly linked with cellular toxicity caused by mutant huntingtin. Neurobiol Dis, 23, 54351. 102. Dunah, A.W., Jeong, H., Griffin, A., Kim, Y.M., Standaert, D.G. Hersch, S.M., Mouradian, M.M., Young, A.B., Tanese, N. and Krainc, D. (2002) Sp1 and TAFII130 transcriptional activity disrupted in early Huntington's disease. Science, 296, 223843. 103. Cong, S.Y., Pepers, B.A., Evert, B.O., Rubinsztein, D.C., Roos, R.A., van Ommen, G.J. and Dorsman, J.C. (2005) Mutant huntingtin represses CBP, but not p300, by binding and protein degradation. Mol Cell Neurosci, 30, 56071. 104. Shimohata, T., Nakajima, T., Yamada, M., Uchida, C., Onodera, O., Naruse, S., Kimura, T., Ko ide, R., Nozaki, K., Sano, Y. et al. (2000) Expanded polyglutamine stretches interact with TAFII130, interfering with CREB dependent transcription. Nat Genet, 26, 2936.

PAGE 133

133 105. Sugars, K.L., Brown, R., Cook, L.J., Swartz, J. and Rubinsztein, D.C. (2004) Decr eased cAMP response element mediated transcription: an early event in exon 1 and full length cell models of Huntington's disease that contributes to polyglutamine pathogenesis. J Biol Chem, 279, 498899. 106. Takano, H. and Gusella, J.F. (2002) The predomi nantly HEAT like motif structure of huntingtin and its association and coincident nuclear entry with dorsal, an NFkB/Rel/dorsal family transcription factor. BMC Neurosci, 3, 15. 107. Marcora, E. and Kennedy, M.B. (2010) The Huntington's disease mutation i mpairs Huntingtin's role in the transport of NF{kappa}B from the synapse to the nucleus. Hum Mol Genet 108. Marcora, E., Gowan, K. and Lee, J.E. (2003) Stimulation of NeuroD activity by huntingtin and huntingtinassociated proteins HAP1 and MLK2. Proc Na tl Acad Sci U S A, 100, 957883. 109. Zuccato, C., Ciammola, A., Rigamonti, D., Leavitt, B.R., Goffredo, D., Conti, L., MacDonald, M.E., Friedlander, R.M., Silani, V., Hayden, M.R. et al. (2001) Loss of huntingtinmediated BDNF gene transcription in Huntin gton's disease. Science, 293, 4938. 110. Zuccato, C., Belyaev, N., Conforti, P., Ooi, L., Tartari, M., Papadimou, E., MacDonald, M., Fossale, E., Zeitlin, S., Buckley, N. et al. (2007) Widespread disruption of repressor element 1 silencing transcription f actor/neuronrestrictive silencer factor occupancy at its target genes in Huntington's disease. J Neurosci, 27, 697283. 111. Coulson, J.M. (2005) Transcriptional regulation: cancer, neurons and the REST. Curr Biol, 15, R6658. 112. Li, S.H., Cheng, A.L., Zhou, H., Lam, S., Rao, M., Li, H. and Li, X.J. (2002) Interaction of Huntington disease protein with transcriptional activator Sp1. Mol Cell Biol, 22, 127787. 113. Suhr, S.T., Senut, M.C., Whitelegge, J.P., Faull, K.F., Cuizon, D.B. and Gage, F.H. (2001) Identities of sequestered proteins in aggregates from cells with induced polyglutamine expression. J Cell Biol, 153, 28394. 114. Boutell, J.M., Thomas, P., Neal, J.W., Weston, V.J., Duce, J., Harper, P.S. and Jones, A.L. (1999) Aberrant interactions of t ranscriptional repressor proteins with the Huntington's disease gene product, huntingtin. Hum Mol Genet, 8, 164755. 115. Yohrling, G.J., Farrell, L.A., Hollenberg, A.N. and Cha, J.H. (2003) Mutant huntingtin increases nuclear corepressor function and enhances liganddependent nuclear hormone receptor activation. Mol Cell Neurosci, 23, 2838.

PAGE 134

134 116. Cui, L., Jeong, H., Borovecki, F., Parkhurst, C.N., Tanese, N. and Krainc, D. (2006) Transcriptional repression of PGC 1alpha by mutant huntingtin leads to mitoch ondrial dysfunction and neurodegeneration. Cell, 127, 5969. 117. Weydt, P., Pineda, V.V., Torrence, A.E., Libby, R.T., Satterfield, T.F., Lazarowski, E.R., Gilbert, M.L., Morton, G.J., Bammler, T.K., Strand, A.D. et al. (2006) Thermoregulatory and metabol ic defects in Huntington's disease transgenic mice implicate PGC1alpha in Huntington's disease neurodegeneration. Cell Metab, 4, 34962. 118. Bibb, J.A., Yan, Z., Svenningsson, P., Snyder, G.L., Pieribone, V.A., Horiuchi, A., Nairn, A.C., Messer, A. and Greengard, P. (2000) Severe deficiencies in dopamine signaling in presymptomatic Huntington's disease mice. Proc Natl Acad Sci U S A, 97, 680914. 119. Luthi Carter, R., Strand, A., Peters, N.L., Solano, S.M., Hollingsworth, Z.R., Menon, A.S., Frey, A.S., S pektor, B.S., Penney, E.B., Schilling, G. et al. (2000) Decreased expression of striatal signaling genes in a mouse model of Huntington's disease. Hum Mol Genet, 9, 125971. 120. van Dellen, A., Welch, J., Dixon, R.M., Cordery, P., York, D., Styles, P., Blakemore, C. and Hannan, A.J. (2000) N Acetylaspartate and DARPP 32 levels decrease in the corpus striatum of Huntington's disease mice. Neuroreport, 11, 37517. 121. Menalled, L., Zanjani, H., MacKenzie, L., Koppel, A., Carpenter, E., Zeitlin, S. and Chess elet, M.F. (2000) Decrease in striatal enkephalin mRNA in mouse models of Huntington's disease. Exp Neurol, 162, 32842. 122. Cha, J.H., Kosinski, C.M., Kerner, J.A., Alsdorf, S.A., Mangiarini, L., Davies, S.W., Penney, J.B., Bates, G.P. and Young, A.B. (1998) Altered brain neurotransmitter receptors in transgenic mice expressing a portion of an abnormal human huntington disease gene. Proc Natl Acad Sci U S A, 95, 64805. 123. Lastres Becker, I., Fezza, F., Cebeira, M., Bisogno, T., Ramos, J.A., Milone, A., Fernandez Ruiz, J. and Di Marzo, V. (2001) Changes in endocannabinoid transmission in the basal ganglia in a rat model of Huntington's disease. Neuroreport, 12, 21259. 124. DenovanWright, E.M. and Robertson, H.A. (2000) Cannabinoid receptor messenger RN A levels decrease in a subset of neurons of the lateral striatum, cortex and hippocampus of transgenic Huntington's disease mice. Neuroscience, 98, 70513. 125. McCaw, E.A., Hu, H., Gomez, G.T., Hebb, A.L., Kelly, M.E. and Denovan Wright, E.M. (2004) Struc ture, expression and regulation of the cannabinoid receptor gene (CB1) in Huntington's disease transgenic mice. Eur J Biochem, 271, 490920.

PAGE 135

135 126. Kuhn, A., Goldstein, D.R., Hodges, A., Strand, A.D., Sengstag, T., Kooperberg, C., Becanovic, K., Pouladi, M.A ., Sathasivam, K., Cha, J.H. et al. (2007) Mutant huntingtin's effects on striatal gene expression in mice recapitulate changes observed in human Huntington's disease brain and do not differ with mutant huntingtin length or wildtype huntingtin dosage. Hum Mol Genet, 16, 184561. 127. Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H., Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L. and Bates, G.P. (1997) Formation of neuronal intranuclear inclusions underlies the neurological dys function in mice transgenic for the HD mutation. Cell, 90, 53748. 128. DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel, J.P. and Aronin, N. (1997) Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neuri tes in brain. Science, 277, 19903. 129. Divac, I., Markowitsch, H.J. and Pritzel, M. (1978) Behavioral and anatomical consequences of small intrastriatal injections of kainic acid in the rat. Brain Res, 151, 52332. 130. Sanberg, P.R., Pisa, M. and Fibiger, H.C. (1979) Avoidance, operant and locomotor behavior in rats with neostriatal injections of kainic acid. Pharmacol Biochem Behav, 10, 13744. 131. Mason, S.T. and Fibiger, H.C. (1978) Kainic acid lesions of the striatum: behavioural sequalae similar to Huntington's chorea. Brain Res, 155, 31329. 132. Schwarcz, R. and Coyle, J.T. (1977) Striatal lesions with kainic acid: neurochemical characteristics. Brain Res, 127, 23549. 133. Onley, J. and de Gubareff, T. (1978) Extreme sensitivity of olfactory cort ical neurons to kainic acid toxicity. In Kainic Acid as a Tool in Neurobiology Raven Press, New York, pp. 201217. 134. Beal, M.F., Kowall, N.W., Ellison, D.W., Mazurek, M.F., Swartz, K.J. and Martin, J.B. (1986) Replication of the neurochemical character istics of Huntington's disease by quinolinic acid. Nature, 321, 16871. 135. Ferrante, R.J., Beal, M.F., Kowall, N.W., Richardson, E.P., Jr. and Martin, J.B. (1987) Sparing of acetylcholinesterasecontaining striatal neurons in Huntington's disease. Brain Res, 411, 1626. 136. Furtado, J.C. and Mazurek, M.F. (1996) Behavioral characterization of quinolinateinduced lesions of the medial striatum: relevance for Huntington's disease. Exp Neurol, 138, 15868. 137. Ferrante, R.J., Kowall, N.W., Beal, M.F., Martin, J.B., Bird, E.D. and Richardson, E.P., Jr. (1987) Morphologic and histochemical characteristics of a spared subset of striatal neurons in Huntington's disease. J Neuropathol Exp Neurol, 46, 1227.

PAGE 136

136 138. Wolfensberger, M., Amsler, U., Cuenod, M., Foster, A.C., Whetsell, W.O., Jr. and Schwarcz, R. (1983) Identification of quinolinic acid in rat and human brain tissue. Neurosci Lett, 41, 24752. 139. Schwarcz, R., Tamminga, C.A., Kurlan, R. and Shoulson, I. (1988) Cerebrospinal fluid levels of quinolinic ac id in Huntington's disease and schizophrenia. Ann Neurol, 24, 5802. 140. Heyes, M.P., Rubinow, D., Lane, C. and Markey, S.P. (1989) Cerebrospinal fluid quinolinic acid concentrations are increased in acquired immune deficiency syndrome. Ann Neurol, 26, 275 7. 141. Heyes, M.P., Garnett, E.S. and Brown, R.R. (1985) Normal excretion of quinolinic acid in Huntington's disease. Life Sci, 37, 18116. 142. Lin, B., Nasir, J., MacDonald, H., Hutchinson, G., Graham, R.K., Rommens, J.M. and Hayden, M.R. (1994) Seque nce of the murine Huntington disease gene: evidence for conservation, alternate splicing and polymorphism in a triplet (CCG) repeat [corrected]. Hum Mol Genet, 3, 8592. 143. Duyao, M.P., Auerbach, A.B., Ryan, A., Persichetti, F., Barnes, G.T., McNeil, S.M., Ge, P., Vonsattel, J.P., Gusella, J.F., Joyner, A.L. et al. (1995) Inactivation of the mouse Huntington's disease gene homolog Hdh. Science, 269, 40710. 144. Nasir, J., Floresco, S.B., O'Kusky, J.R., Diewert, V.M., Richman, J.M., Zeisler, J., Borowski, A., Marth, J.D., Phillips, A.G. and Hayden, M.R. (1995) Targeted disruption of the Huntington's disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell, 81, 81123. 145. Zeitlin, S., Liu, J.P., Chapman, D.L., Papaioannou, V.E. and Efstratiadis, A. (1995) Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington's disease gene homologue. Nat Genet, 11, 15563. 146. Dragatsis, I., Levine, M.S. and Zeitlin, S. (2000) Inactivati on of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice. Nat Genet, 26, 3006. 147. Lin, C.R., Kapiloff, M.S., Durgerian, S., Tatemoto, K., Russo, A.F., Hanson, P., Schulman, H. and Rosenfeld, M.G. (1987) Molecular cloning of a brainspecific calcium/calmodulindependent protein kinase. Proc Natl Acad Sci U S A, 84, 59626. 148. Yamamoto, A., Lucas, J.J. and Hen, R. (2000) Reversal of neuropathology and motor dysfunction in a conditional model of Huntington's disease. Cell, 101, 5766.

PAGE 137

137 149. Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. et al. (1996) Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell, 87, 493506. 150. Murphy, K.P., Carter, R.J., Lione, L.A., Mangiarini, L., Mahal, A., Bates, G.P., Dunnett, S.B. and Morton, A.J. (2000) Abnormal synaptic plasticity and impaired spatial cognition in mice transgenic for exon 1 of the human Huntington's disease mutation. J Neurosci, 20, 511523. 151. Lione, L.A., Carter, R.J., Hunt, M.J., Bates, G.P., Morton, A.J. and Dunnett, S.B. (1999) Selective discrimination learning impairments in mice expressing the human Huntington's disease mutation. J Neurosci, 19, 1042837. 152. Mazarakis, N.K., Cybulska Klosowicz, A., Grote, H., Pang, T., Van Dellen, A., Kossut, M., Blakemore, C. and Hannan, A.J. (2005) Deficits in experiencedependent cortical plasticity and sensory discrimination learning in presymptomatic Huntington's disease mice. J Neurosci, 25, 305966. 153. Nithianantharajah, J., Barkus, C., Murphy, M. and Hannan, A.J. (2008) Geneenvironment interactions modulating cognitive function and molecular cor relates of synaptic plasticity in Huntington's disease transgenic mice. Neurobiol Dis, 29, 490504. 154. Carter, R.J., Lione, L.A., Humby, T., Mangiarini, L., Mahal, A., Bates, G.P., Dunnett, S.B. and Morton, A.J. (1999) Characterization of progressive mot or deficits in mice transgenic for the human Huntington's disease mutation. J Neurosci, 19, 324857. 155. Morton, A.J., Lagan, M.A., Skepper, J.N. and Dunnett, S.B. (2000) Progressive formation of inclusions in the striatum and hippocampus of mice transgen ic for the human Huntington's disease mutation. J Neurocytol, 29, 679702. 156. Becher, M.W., Kotzuk, J.A., Sharp, A.H., Davies, S.W., Bates, G.P., Price, D.L. and Ross, C.A. (1998) Intranuclear neuronal inclusions in Huntington's disease and dentatorubral and pallidoluysian atrophy: correlation between the density of inclusions and IT15 CAG triplet repeat length. Neurobiol Dis, 4, 38797. 157. Schilling, G., Becher, M.W., Sharp, A.H., Jinnah, H.A., Duan, K., Kotzuk, J.A., Slunt, H.H., Ratovitski, T., Coope r, J.K., Jenkins, N.A. et al. (1999) Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N terminal fragment of huntingtin. Hum Mol Genet, 8, 397407. 158. Gutekunst, C.A., Li, S.H., Yi, H., Mulroy, J.S., Kuemmerle, S., J ones, R., Rye, D., Ferrante, R.J., Hersch, S.M. and Li, X.J. (1999) Nuclear and neuropil aggregates in Huntington's disease: relationship to neuropathology. J Neurosci, 19, 252234.

PAGE 138

138 159. Hebb, A.L., Robertson, H.A. and DenovanWright, E.M. (2008) Phosphodi esterase 10A inhibition is associated with locomotor and cognitive deficits and increased anxiety in mice. Eur Neuropsychopharmacol, 18, 33963. 160. Dowie, M.J., Bradshaw, H.B., Howard, M.L., Nicholson, L.F., Faull, R.L., Hannan, A.J. and Glass, M. (2009) Altered CB1 receptor and endocannabinoid levels precede motor symptom onset in a transgenic mouse model of Huntington's disease. Neuroscience, 163, 45665. 161. Yu, Z.X., Li, S.H., Evans, J., Pillarisetti, A., Li, H. and Li, X.J. (2003) Mutant huntingtin causes context dependent neurodegeneration in mice with Huntington's disease. J Neurosci, 23, 2193202. 162. Schilling, G., Jinnah, H.A., Gonzales, V., Coonfield, M.L., Kim, Y., Wood, J.D., Price, D.L., Li, X.J., Jenkins, N., Copeland, N. et al. (2001) Dis tinct behavioral and neuropathological abnormalities in transgenic mouse models of HD and DRPLA. Neurobiol Dis, 8, 40518. 163. Harper, S.Q., Staber, P.D., He, X., Eliason, S.L., Martins, I.H., Mao, Q., Yang, L., Kotin, R.M., Paulson, H.L. and Davidson, B. L. (2005) RNA interference improves motor and neuropathological abnormalities in a Huntington's disease mouse model. Proc Natl Acad Sci U S A, 102, 58205. 164. Hodgson, J.G., Smith, D.J., McCutcheon, K., Koide, H.B., Nishiyama, K., Dinulos, M.B., Stevens, M.E., Bissada, N., Nasir, J., Kanazawa, I. et al. (1996) Human huntingtin derived from YAC transgenes compensates for loss of murine huntingtin by rescue of the embryonic lethal phenotype. Hum Mol Genet, 5, 187585. 165. Hodgson, J.G., Agopyan, N., Gutekunst, C.A., Leavitt, B.R., LePiane, F., Singaraja, R., Smith, D.J., Bissada, N., McCutcheon, K., Nasir, J. et al. (1999) A YAC mouse model for Huntington's disease with full length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegener ation. Neuron, 23, 181 92. 166. Slow, E.J., van Raamsdonk, J., Rogers, D., Coleman, S.H., Graham, R.K., Deng, Y., Oh, R., Bissada, N., Hossain, S.M., Yang, Y.Z. et al. (2003) Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease. H um Mol Genet, 12, 155567. 167. Levine, M.S., Klapstein, G.J., Koppel, A., Gruen, E., Cepeda, C., Vargas, M.E., Jokel, E.S., Carpenter, E.M., Zanjani, H., Hurst, R.S. et al. (1999) Enhanced sensitivity to N methyl D aspartate receptor activation in transgenic and knockin mouse models of Huntington's disease. J Neurosci Res, 58, 51532. 168. Menalled, L.B., Sison, J.D., Wu, Y., Olivieri, M., Li, X.J., Li, H., Zeitlin, S. and Chesselet, M.F. (2002) Early motor dysfunction and striosomal distribution of huntingtin microaggregates in Huntington's disease knock in mice. J Neurosci, 22, 826676.

PAGE 139

139 169. Menalled, L.B., Sison, J.D., Dragatsis, I., Zeitlin, S. and Chesselet, M.F. (2003) Time course of early motor and neuropathological anomalies in a knock in mouse model of Huntington's disease with 140 CAG repeats. J Comp Neurol, 465, 1126. 170. Hickey, M.A., Kosmalska, A., Enayati, J., Cohen, R., Zeitlin, S., Levine, M.S. and Chesselet, M.F. (2008) Extensive early motor and nonmotor behavioral deficits are followed by striatal neuronal loss in knock in Huntington's disease mice. Neuroscience, 157, 28095. 171. Dorner, J.L., Miller, B.R., Barton, S.J., Brock, T.J. and Rebec, G.V. (2007) Sex differences in behavior and striatal ascorbate release in the 140 CAG knock in mouse model of Huntington's disease. Behav Brain Res, 178, 907. 172. Cummings, D.M., Cepeda, C. and Levine, M.S. (2010) Alterations in striatal synaptic transmission are consistent across genetic mouse models of Huntington's disease. ASN Neuro, 2, e00036. 173. Walker, A.G., Miller, B.R., Fritsch, J.N., Barton, S.J. and Rebec, G.V. (2008) Altered information processing in the prefrontal cortex of Huntington's disease mouse models. J Neurosci, 28, 897382. 174. Lin, C.H., Tallaksen Greene, S., Chien, W.M., C earley, J.A., Jackson, W.S., Crouse, A.B., Ren, S., Li, X.J., Albin, R.L. and Detloff, P.J. (2001) Neurological abnormalities in a knock in mouse model of Huntington's disease. Hum Mol Genet, 10, 13744. 175. Heng, M.Y., Tallaksen Greene, S.J., Detloff, P.J. and Albin, R.L. (2007) Longitudinal evaluation of the Hdh(CAG)150 knock in murine model of Huntington's disease. J Neurosci, 27, 898998. 176. Shelbourne, P.F., Killeen, N., Hevner, R.F., Johnston, H.M., Tecott, L., Lewandoski, M., Ennis, M., Ramirez, L., Li, Z., Iannicola, C. et al. (1999) A Huntington's disease CAG expansion at the murine Hdh locus is unstable and associated with behavioural abnormalities in mice. Hum Mol Genet, 8, 76374. 177. Wheeler, V.C., White, J.K., Gutekunst, C.A., Vrbanac, V., Weaver, M., Li, X.J., Li, S.H., Yi, H., Vonsattel, J.P., Gusella, J.F. et al. (2000) Long glutamine tracts cause nuclear localization of a novel form of huntingtin in medium spiny striatal neurons in HdhQ92 and HdhQ111 knock in mice. Hum Mol Genet, 9, 50313. 178. Wheeler, V.C., Gutekunst, C.A., Vrbanac, V., Lebel, L.A., Schilling, G., Hersch, S., Friedlander, R.M., Gusella, J.F., Vonsattel, J.P., Borchelt, D.R. et al. (2002) Early phenotypes that presage lateonset neurodegenerative disease allow testing of modifiers in Hdh CAG knock in mice. Hum Mol Genet, 11, 63340. 179. Senut, M.C., Suhr, S.T., Kaspar, B. and Gage, F.H. (2000) Intraneuronal aggregate formation and cell death after viral expression of expanded polyglutamine tracts in the adult rat brain. J Neurosci, 20, 21929.

PAGE 140

140 180. Berns, K.I. (1990) Parvovirus replication. Microbiol Rev, 54, 31629. 181. Berns, K.I. (1990) Parvoviridae and Their Replication. In Fields, B. N. and D. M. Knipe pp. 17431764. 182. McLaughlin, S.K., Collis, P., Hermonat, P. L. and Muzyczka, N. (1988) Adenoassociated virus general transduction vectors: analysis of proviral structures. J Virol, 62, 196373. 183. Gao, G., Vandenberghe, L.H., Alvira, M.R., Lu, Y., Calcedo, R., Zhou, X. and Wilson, J.M. (2004) Clades of Adenoass ociated viruses are widely disseminated in human tissues. J Virol, 78, 63818. 184. Mori, S., Wang, L., Takeuchi, T. and Kanda, T. (2004) Two novel adenoassociated viruses from cynomolgus monkey: pseudotyping characterization of capsid protein. Virology, 330, 37583. 185. Gao, G.P., Alvira, M.R., Wang, L., Calcedo, R., Johnston, J. and Wilson, J.M. (2002) Novel adenoassociated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci U S A, 99, 118549. 186. Mizukami, H., Young, N. S. and Brown, K.E. (1996) Adenoassociated virus type 2 binds to a 150kilodalton cell membrane glycoprotein. Virology, 217, 12430. 187. Summerford, C. and Samulski, R.J. (1998) Membraneassociated heparan sulfate proteoglycan is a receptor for adenoasso ciated virus type 2 virions. J Virol, 72, 143845. 188. Ponnazhagan, S., Wang, X.S., Woody, M.J., Luo, F., Kang, L.Y., Nallari, M.L., Munshi, N.C., Zhou, S.Z. and Srivastava, A. (1996) Differential expression in human cells from the p6 promoter of human parvovirus B19 following plasmid transfection and recombinant adenoassociated virus 2 (AAV) infection: human megakaryocytic leukaemia cells are nonpermissive for AAV infection. J Gen Virol, 77 ( Pt 6), 111122. 189. Summerford, C., Bartlett, J.S. and Samul ski, R.J. (1999) AlphaVbeta5 integrin: a co receptor for adenoassociated virus type 2 infection. Nat Med, 5, 7882. 190. Sanlioglu, S., Benson, P.K., Yang, J., Atkinson, E.M., Reynolds, T. and Engelhardt, J.F. (2000) Endocytosis and nuclear trafficking of adenoassociated virus type 2 are controlled by rac1 and phosphatidylinositol 3 kinase activation. J Virol, 74, 918496. 191. Kashiwakura, Y., Tamayose, K., Iwabuchi, K., Hirai, Y., Shimada, T., Matsumoto, K., Nakamura, T., Watanabe, M., Oshimi, K. and Daida, H. (2005) Hepatocyte growth factor receptor is a coreceptor for adenoassociated virus type 2 infection. J Virol, 79, 60914.

PAGE 141

141 192. Asokan, A., Hamra, J.B., Govindasamy, L., AgbandjeMcKenna, M. and Samulski, R.J. (2006) Adenoassociated virus type 2 c ontains an integrin alpha5beta1 binding domain essential for viral cell entry. J Virol, 80, 89619. 193. Akache, B., Grimm, D., Pandey, K., Yant, S.R., Xu, H. and Kay, M.A. (2006) The 37/67kilodalton laminin receptor is a receptor for adenoassociated vir us serotypes 8, 2, 3, and 9. J Virol, 80, 98316. 194. Di Pasquale, G., Davidson, B.L., Stein, C.S., Martins, I., Scudiero, D., Monks, A. and Chiorini, J.A. (2003) Identification of PDGFR as a receptor for AAV 5 transduction. Nat Med, 9, 130612. 195. Walt ers, R.W., Yi, S.M., Keshavjee, S., Brown, K.E., Welsh, M.J., Chiorini, J.A. and Zabner, J. (2001) Binding of adenoassociated virus type 5 to 2,3linked sialic acid is required for gene transfer. J Biol Chem, 276, 206106. 196. Wu, Z., Miller, E., Agbandj e McKenna, M. and Samulski, R.J. (2006) Alpha2,3 and alpha2,6 N linked sialic acids facilitate efficient binding and transduction by adenoassociated virus types 1 and 6. J Virol, 80, 9093103. 197. Qiu, J. and Brown, K.E. (1999) Integrin alphaVbeta5 is not involved in adenoassociated virus type 2 (AAV2) infection. Virology, 264, 43640. 198. Sonntag, F., Bleker, S., Leuchs, B., Fischer, R. and Kleinschmidt, J.A. (2006) Adenoassociated virus type 2 capsids with externalized VP1/VP2 trafficking domains are generated prior to passage through the cytoplasm and are maintained until uncoating occurs in the nucleus. J Virol, 80, 1104054. 199. Ding, W., Zhang, L., Yan, Z. and Engelhardt, J.F. (2005) Intracellular trafficking of adenoassociated viral vectors. Ge ne Ther, 12, 87380. 200. Hermonat, P.L. and Muzyczka, N. (1984) Use of adenoassociated virus as a mammalian DNA cloning vector: transduction of neomycin resistance into mammalian tissue culture cells. Proc Natl Acad Sci U S A, 81, 646670. 201. Xiao, X., Li, J. and Samulski, R.J. (1998) Production of hightiter recombinant adenoassociated virus vectors in the absence of helper adenovirus. J Virol, 72, 222432. 202. Urabe, M., Ding, C. and Kotin, R.M. (2002) Insect cells as a factory to produce adenoassociated virus type 2 vectors. Hum Gene Ther, 13, 193543. 203. Kang, W., Wang, L., Harrell, H., Liu, J., Thomas, D.L., Mayfield, T.L., Scotti, M.M., Ye, G.J., Veres, G. and Knop, D.R. (2009) An efficient rHSV based complementation system for the production of multiple rAAV vector serotypes. Gene Ther, 16, 22939.

PAGE 142

142 204. Conway, J.E., Rhys, C.M., Zolotukhin, I., Zolotukhin, S., Muzyczka, N., Hayward, G.S. and Byrne, B.J. (1999) High titer recombinant adenoassociated virus production utilizing a recombinant her pes simplex virus type I vector expressing AAV2 Rep and Cap. Gene Ther, 6, 98693. 205. Aslanidi, G., Lamb, K. and Zolotukhin, S. (2009) An inducible system for highly efficient production of recombinant adenoassociated virus (rAAV) vectors in insect Sf9 cells. Proc Natl Acad Sci U S A, 106, 505964. 206. Harding, T.C., Dickinson, P.J., Roberts, B.N., Yendluri, S., Gonzalez Edick, M., Lecouteur, R.A. and Jooss, K.U. (2006) Enhanced gene transfer efficiency in the murine striatum and an orthotopic glioblas toma tumor model, using AAV 7 and AAV8 pseudotyped vectors. Hum Gene Ther, 17, 80720. 207. Davidson, B.L., Stein, C.S., Heth, J.A., Martins, I., Kotin, R.M., Derksen, T.A., Zabner, J., Ghodsi, A. and Chiorini, J.A. (2000) Recombinant adeno associated vi rus type 2, 4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system. Proc Natl Acad Sci U S A, 97, 342832. 208. Burger, C., Gorbatyuk, O.S., Velardo, M.J., Peden, C.S., Williams, P., Zolotukhin, S., Reier, P.J., Mandel, R.J. and Muzyczka, N. (2004) Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol Ther, 10, 30217. 209. Cearley, C.N. and Wolfe, J.H. (2006) Transduction characteristics of adenoassociated virus vectors expressing cap serotypes 7, 8, 9, and Rh10 in the mouse brain. Mol Ther, 13, 528 37. 210. Schmidt, M., Voutetakis, A., Afione, S., Zheng, C., Mandikian, D. and Chiorini, J.A. (2008) Adenoassociated virus type 12 (AAV12): a novel AAV serotype with sialic acid and heparan sulfate proteoglycanindependent transduction activity. J Virol, 82, 1399406. 211. Cearley, C.N., Vandenberghe, L.H., Parente, M.K., Carnish, E.R., Wilson, J.M. and Wolfe, J.H. (2008) Expanded repertoire of AAV vector serotypes mediate unique patterns of transduction in mouse brain. Mol Ther, 16, 17108. 212. Taymans, J.M., Vandenberghe, L.H., Haute, C.V., Thiry, I., Deroos e, C.M., Mortelmans, L., Wilson, J.M., Debyser, Z. and Baekelandt, V. (2007) Comparative analysis of adenoassociated viral vector serotypes 1, 2, 5, 7, and 8 in mouse brain. Hum Gene Ther, 18, 195206. 213. Klein, R.L., Dayton, R.D., Leidenheimer, N.J., J ansen, K., Golde, T.E. and Zweig, R.M. (2006) Efficient neuronal gene transfer with AAV8 leads to neurotoxic levels of tau or green fluorescent proteins. Mol Ther, 13, 51727.

PAGE 143

143 214. Klein, R.L., Dayton, R.D., Tatom, J.B., Henderson, K.M. and Henning, P.P. ( 2008) AAV8, 9, Rh10, Rh43 vector gene transfer in the rat brain: effects of serotype, promoter and purification method. Mol Ther, 16, 8996. 215. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. and Mello, C.C. (1998) Potent and specific genetic interference by doublestranded RNA in Caenorhabditis elegans. Nature, 391, 80611. 216. Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T. and Zamore, P.D. (2001) A cellular function for the RNA interference enzyme Dicer in the ma turation of the let 7 small temporal RNA. Science, 293, 8348. 217. Ketting, R.F., Fischer, S.E., Bernstein, E., Sijen, T., Hannon, G.J. and Plasterk, R.H. (2001) Dicer functions in RNA interference and in synthesis of small RNA involved in developmental t iming in C. elegans. Genes Dev, 15, 26549. 218. Billy, E., Brondani, V., Zhang, H., Muller, U. and Filipowicz, W. (2001) Specific interference with gene expression induced by long, doublestranded RNA in mouse embryonal teratocarcinoma cell lines. Proc Na tl Acad Sci U S A, 98, 1442833. 219. Bernstein, E., Caudy, A.A., Hammond, S.M. and Hannon, G.J. (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature, 409, 363 6. 220. Lee, Y.S., Nakahara, K., Pham, J.W., Kim, K., He, Z., Sontheimer, E.J. and Carthew, R.W. (2004) Distinct roles for Drosophila Dicer 1 and Dicer 2 in the siRNA/miRNA silencing pathways. Cell, 117, 6981. 221. Xie, Z., Johansen, L.K., Gustafson, A.M., Kasschau, K.D., Lellis, A.D., Zilberman, D., Jacobsen, S.E. and Carrington, J.C. (2004) Genetic and functional diversification of small RNA pathways in plants. PLoS Biol, 2, E104. 222. Liu, Q., Feng, Y. and Zhu, Z. (2009) Dicer like (DCL) proteins in plants. Funct Integr Genomics, 9, 27786. 223. Hammond, S.M. Bernstein, E., Beach, D. and Hannon, G.J. (2000) An RNA directed nuclease mediates post transcriptional gene silencing in Drosophila cells. Nature, 404, 2936. 224. Lingel, A., Simon, B., Izaurralde, E. and Sattler, M. (2004) Nucleic acid 3'end recognit ion by the Argonaute2 PAZ domain. Nat Struct Mol Biol, 11, 5767. 225. Ma, J.B., Ye, K. and Patel, D.J. (2004) Structural basis for overhangspecific small interfering RNA recognition by the PAZ domain. Nature, 429, 31822. 226. Yan, K.S., Yan, S., Farooq, A., Han, A., Zeng, L. and Zhou, M.M. (2003) Structure and conserved RNA binding of the PAZ domain. Nature, 426, 46874.

PAGE 144

144 227. Song, J.J., Smith, S.K., Hannon, G.J. and JoshuaTor, L. (2004) Crystal structure of Argonaute and its implications for RISC slicer activity. Science, 305, 14347. 228. Rivas, F.V., Tolia, N.H., Song, J.J., Aragon, J.P., Liu, J., Hannon, G.J. and JoshuaTor, L. (2005) Purified Argonaute2 and an siRNA form recombinant human RISC. Nat Struct Mol Biol, 12, 3409. 229. Liu, J., Carmell, M.A., Rivas, F.V., Marsden, C.G., Thomson, J.M., Song, J.J., Hammond, S.M., JoshuaTor, L. and Hannon, G.J. (2004) Argonaute2 is the catalytic engine of mammalian RNAi. Science, 305, 143741. 230. Yang, W. and Steitz, T.A. (1995) Recombining the structures of HIV integrase, RuvC and RNase H. Structure, 3, 1314. 231. Wang, B., Li, S., Qi, H.H., Chowdhury, D., Shi, Y. and Novina, C.D. (2009) Distinct passenger strand and mRNA cleavage activities of human Argonaute proteins. Nat Struct Mol Biol, 16, 125966. 232. Khvorova, A., Reynolds, A. and Jayasena, S.D. (2003) Functional siRNAs and miRNAs exhibit strand bias. Cell, 115, 20916. 233. Schwarz, D.S., Hutvagner, G., Du, T., Xu, Z., Aronin, N. and Zamore, P.D. (2003) Asymmetry in the assembly of the RNAi enzym e complex. Cell, 115, 199208. 234. Matranga, C., Tomari, Y., Shin, C., Bartel, D.P. and Zamore, P.D. (2005) Passenger strand cleavage facilitates assembly of siRNA into Ago2containing RNAi enzyme complexes. Cell, 123, 60720. 235. Elbashir, S.M., Lendeck el, W. and Tuschl, T. (2001) RNA interference is mediated by 21and 22nucleotide RNAs. Genes Dev, 15, 188200. 236. Elbashir, S.M., Martinez, J., Patkaniowska, A., Lendeckel, W. and Tuschl, T. (2001) Functional anatomy of siRNAs for mediating efficient R NAi in Drosophila melanogaster embryo lysate. Embo J, 20, 687788. 237. Landthaler, M., Yalcin, A. and Tuschl, T. (2004) The human DiGeorge syndrome critical region gene 8 and Its D. melanogaster homolog are required for miRNA biogenesis. Curr Biol, 14, 21627. 238. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S. et al. (2003) The nuclear RNase III Drosha initiates microRNA processing. Nature, 425, 4159. 239. Lee, Y., Jeon, K., Lee, J.T., Kim, S. and Kim, V .N. (2002) MicroRNA maturation: stepwise processing and subcellular localization. Embo J, 21, 466370. 240. Han, J., Lee, Y., Yeom, K.H., Kim, Y.K., Jin, H. and Kim, V.N. (2004) The Drosha DGCR8 complex in primary microRNA processing. Genes Dev, 18, 30162 7.

PAGE 145

145 241. Yi, R., Qin, Y., Macara, I.G. and Cullen, B.R. (2003) Exportin 5 mediates the nuclear export of premicroRNAs and short hairpin RNAs. Genes Dev, 17, 30116. 242. Calado, A., Treichel, N., Muller, E.C., Otto, A. and Kutay, U. (2002) Exportin5 mediated nuclear export of eukaryotic elongation factor 1A and tRNA. Embo J, 21, 621624. 243. Bohnsack, M.T., Czaplinski, K. and Gorlich, D. (2004) Exportin 5 is a RanGTP dependent dsRNA binding protein that mediates nuclear export of premiRNAs. Rna, 10, 18591. 244. Rossi, J.J. (2005) RNAi and the P body connection. Nat Cell Biol, 7, 6434. 245. Bhattacharyya, S.N., Habermacher, R., Martine, U., Closs, E.I. and Filipowicz, W. (2006) Relief of microRNA mediated translational repression in human cells subjected to stress. Cell, 125, 111124. 246. Sen, G.L. and Blau, H.M. (2005) Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat Cell Biol, 7, 6336. 247. Liu, J., Rivas, F.V., Wohlschlegel, J., Yates, J.R., 3rd, Parker, R. a nd Hannon, G.J. (2005) A role for the P body component GW182 in microRNA function. Nat Cell Biol, 7, 12616. 248. Liu, J., ValenciaSanchez, M.A., Hannon, G.J. and Parker, R. (2005) MicroRNA dependent localization of targeted mRNAs to mammalian P bodies. N at Cell Biol, 7, 71923. 249. Vermeulen, A., Behlen, L., Reynolds, A., Wolfson, A., Marshall, W.S., Karpilow, J. and Khvorova, A. (2005) The contributions of dsRNA structure to Dicer specificity and efficiency. Rna, 11, 67482. 250. Yu, J.Y., DeRuiter, S.L and Turner, D.L. (2002) RNA interference by expression of short interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci U S A, 99, 604752. 251. Paul, C.P., Good, P.D., Winer, I. and Engelke, D.R. (2002) Effective expression of small int erfering RNA in human cells. Nat Biotechnol, 20, 5058. 252. Lewis, B.P., Burge, C.B. and Bartel, D.P. (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell, 120, 1520. 253. Jackson, A.L., Burchard, J., Schelter, J., Chau, B.N., Cleary, M., Lim, L. and Linsley, P.S. (2006) Widespread siRNA "off target" transcript silencing mediated by seed region sequence complementarity. Rna, 12, 117987.

PAGE 146

146 254. Wightman, B., Ha, I. and Ruvkun, G. (1993) Posttranscriptional regulation of the heterochronic gene lin 14 by lin4 mediates temporal pattern formation in C. elegans. Cell, 75, 85562. 255. Lai, E.C. (2002) Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post transcr iptional regulation. Nat Genet, 30, 363 4. 256. Aleman, L.M., Doench, J. and Sharp, P.A. (2007) Comparison of siRNA induced off target RNA and protein effects. Rna, 13, 385 95. 257. Wang, H., Lim, P.J., Yin, C., Rieckher, M., Vogel, B.E. and Monteiro, M.J. (2006) Suppression of polyglutamineinduced toxicity in cell and animal models of Huntington's disease by ubiquilin. Hum Mol Genet, 15, 102541. 258. Cullen, B.R. (2005) RNAi the natural way. Nat Genet, 37, 11635. 259. Rodriguez Lebron, E., DenovanWrigh t, E.M., Nash, K., Lewin, A.S. and Mandel, R.J. (2005) Intrastriatal rAAV mediated delivery of anti huntingtin shRNAs induces partial reversal of disease progression in R6/1 Huntington's disease transgenic mice. Mol Ther, 12, 618 33. 260. Zolotukhin, S., P otter, M., Hauswirth, W.W., Guy, J. and Muzyczka, N. (1996) A "humanized" green fluorescent protein cDNA adapted for highlevel expression in mammalian cells. J Virol, 70, 464654. 261. Zolotukhin, S., Potter, M., Zolotukhin, I., Sakai, Y., Loiler, S., Fraites, T.J., Jr., Chiodo, V.A., Phillipsberg, T., Muzyczka, N., Hauswirth, W.W. et al. (2002) Production and purification of serotype 1, 2, and 5 recombinant adenoassociated viral vectors. Methods, 28, 15867. 262. Bacos, K., Bjorkqvist, M., Petersen, A., Luts, L., Maat Schieman, M.L., Roos, R.A., Sundler, F., Brundin, P., Mulder, H. and Wierup, N. (2008) Islet betacell area and hormone expression are unaltered in Huntington's disease. Histochem Cell Biol, 129, 6239. 263. Chan, E.Y., Luthi Carter, R., Strand, A., Solano, S.M., Hanson, S.A., DeJohn, M.M., Kooperberg, C., Chase, K.O., DiFiglia, M., Young, A.B. et al. (2002) Increased huntingtin protein length reduces the number of polyglutamineinduced gene expression changes in mouse models of Huntington's disease. Hum Mol Genet, 11, 193951. 264. Luthi Carter, R., Strand, A.D., Hanson, S.A., Kooperberg, C., Schilling, G., La Spada, A.R., Merry, D.E., Young, A.B., Ross, C.A., Borchelt, D.R. et al. (2002) Polyglutamine and transcription: gene expression changes shared by DRPLA and Huntington's disease mouse models reveal context independent effects. Hum Mol Genet, 11, 192737.

PAGE 147

147 265. Ghilardi, M.F., Silvestri, G., Feigin, A., Mattis, P., Zgaljardic, D., Moisello, C., Crupi, D., Marinelli, L., Dirocco, A. and Eid elberg, D. (2008) Implicit and explicit aspects of sequence learning in presymptomatic Huntington's disease. Parkinsonism Relat Disord, 14, 457 64. 266. Gabrieli, J.D., Stebbins, G.T., Singh, J., Willingham, D.B. and Goetz, C.G. (1997) Intact mirrortraci ng and impaired rotary pursuit skill learning in patients with Huntington's disease: evidence for dissociable memory systems in skill learning. Neuropsychology, 11, 27281. 267. Feigin, A., Ghilardi, M.F., Huang, C., Ma, Y., Carbon, M., Guttman, M., Paulse n, J.S., Ghez, C.P. and Eidelberg, D. (2006) Preclinical Huntington's disease: compensatory brain responses during learning. Ann Neurol, 59, 539. 268. Robins Wahlin, T.B., Lundin, A. and Dear, K. (2007) Early cognitive deficits in Swedish gene carriers of Huntington's disease. Neuropsychology, 21, 3144. 269. Harper, P.S. (1993) Clinical consequences of isolating the gene for Huntington's disease. Bmj, 307, 3978. 270. Josiassen, R.C., Curry, L.M. and Mancall, E.L. (1983) Development of neuropsychological deficits in Huntington's disease. Arch Neurol, 40, 7916. 271. Walaas, S.I. and Greengard, P. (1984) DARPP 32, a dopamineand adenosine 3':5'monophosphateregulated phosphoprotein enriched in dopamineinnervated brain regions. I. Regional and cellular di stribution in the rat brain. J Neurosci, 4, 8498. 272. Scott, L., Forssberg, H., Aperia, A. and Diaz Heijtz, R. (2005) Locomotor effects of a D1R agonist are DARPP32 dependent in adult but not weanling mice. Pediatr Res, 58, 77983. 273. Moratalla, R., R obertson, H.A. and Graybiel, A.M. (1992) Dynamic regulation of NGFI A (zif268, egr1) gene expression in the striatum. J Neurosci, 12, 260922. 274. Tsou, K., Brown, S., SanudoPena, M.C., Mackie, K. and Walker, J.M. (1998) Immunohistochemical distribution of cannabinoid CB1 receptors in the rat central nervous system. Neuroscience, 83, 393411. 275. Fujishige, K., Kotera, J., Michibata, H., Yuasa, K., Takebayashi, S., Okumura, K. and Omori, K. (1999) Cloning and characterization of a novel human phosphodies terase that hydrolyzes both cAMP and cGMP (PDE10A). J Biol Chem, 274, 1843845. 276. Reed, T.M., Browning, J.E., Blough, R.I., Vorhees, C.V. and Repaske, D.R. (1998) Genomic structure and chromosome location of the murine PDE1B phosphodiesterase gene. Mamm Genome, 9, 5716.

PAGE 148

148 277. Lakics, V., Karran, E.H. and Boess, F.G. (2010) Quantitative comparison of phosphodiesterase mRNA distribution in human brain and peripheral tissues. Neuropharmacology, 59, 36774. 278. Bender, A.T. and Beavo, J.A. (2006) Cyclic nuc leotide phosphodiesterases: molecular regulation to clinical use. Pharmacol Rev, 58, 488520. 279. Loughney, K., Snyder, P.B., Uher, L., Rosman, G.J., Ferguson, K. and Florio, V.A. (1999) Isolation and characterization of PDE10A, a novel human 3', 5'cycli c nucleotide phosphodiesterase. Gene, 234, 10917. 280. Schaffar, G., Breuer, P., Boteva, R., Behrends, C., Tzvetkov, N., Strippel, N., Sakahira, H., Siegers, K., Hayer Hartl, M. and Hartl, F.U. (2004) Cellular toxicity of polyglutamine expansion proteins: mechanism of transcription factor deactivation. Mol Cell, 15, 95105. 281. Takahashi, T., Nozaki, K., Tsuji, S., Nishizawa, M. and Onodera, O. (2005) Polyglutamine represses cAMP responsiveelement mediated transcription without aggregate formation. Neuroreport, 16, 2959. 282. Scahill, R.I., Frost, C., Jenkins, R., Whitwell, J.L., Rossor, M.N. and Fox, N.C. (2003) A longitudinal study of brain volume changes in normal aging using serial registered magnetic resonance imaging. Arch Neurol, 60, 98994. 283. Fotenos, A.F., Snyder, A.Z., Girton, L.E., Morris, J.C. and Buckner, R.L. (2005) Normative estimates of cross sectional and longitudinal brain volume decline in aging and AD. Neurology, 64, 10329. 284. Resnick, S.M., Pham, D.L., Kraut, M.A., Zonderman, A. B. and Davatzikos, C. (2003) Longitudinal magnetic resonance imaging studies of older adults: a shrinking brain. J Neurosci, 23, 3295301. 285. Boudreau, R.L., McBride, J.L., Martins, I., Shen, S., Xing, Y., Carter, B.J. and Davidson, B.L. (2009) Nonallelespecific silencing of mutant and wildtype huntingtin demonstrates therapeutic efficacy in Huntington's disease mice. Mol Ther, 17, 105363. 286. DiFiglia, M., SenaEsteves, M., Chase, K., Sapp, E., Pfister, E., Sass, M., Yoder, J., Reeves, P., Pandey, R. K., Rajeev, K.G. et al. (2007) Therapeutic silencing of mutant huntingtin with siRNA attenuates striatal and cortical neuropathology and behavioral deficits. Proc Natl Acad Sci U S A, 104, 172049. 287. Drouet, V., Perrin, V., Hassig, R., Dufour, N., Aureg an, G., Alves, S., Bonvento, G., Brouillet, E., Luthi Carter, R., Hantraye, P. et al. (2009) Sustained effects of nonallelespecific Huntingtin silencing. Ann Neurol, 65, 27685.

PAGE 149

149 288. DenovanWright, E.M., Rodriguez Lebron, E., Lewin, A.S. and Mandel, R.J. (2008) Unexpected off targeting effects of anti huntingtin ribozymes and siRNA in vivo. Neurobiol Dis, 29, 44655. 289. Franich, N.R., Fitzsimons, H.L., Fong, D.M., Klugmann, M., During, M.J. and Young, D. (2008) AAV vector mediated RNAi of mutant huntingtin expression is neuroprotective in a novel genetic rat model of Huntington's disease. Mol Ther, 16, 94756. 290. Huang, B., Schiefer, J., Sass, C., Landwehrmeyer, G.B., Kosinski, C.M. and Kochanek, S. (2007) Highcapacity adenoviral vector mediated reduc tion of huntingtin aggregate load in vitro and in vivo. Hum Gene Ther, 18, 30311. 291. Grimm, D., Streetz, K.L., Jopling, C.L., Storm, T.A., Pandey, K., Davis, C.R., Marion, P., Salazar, F. and Kay, M.A. (2006) Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature, 441, 537 41. 292. McBride, J.L., Boudreau, R.L., Harper, S.Q., Staber, P.D., Monteys, A.M., Martins, I., Gilmore, B.L., Burstein, H., Peluso, R.W., Polisky, B. et al. (2008) Artificial miRNAs mitigate shRNAmediated toxicity in the brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci U S A, 105, 586873. 293. Ehlert, E.M., Eggers, R., Niclou, S.P. and Verhaagen, J. (2010) Cellular toxicity following application of adenoassociated viral vector mediated RNA interference in the nervous system. BMC Neurosci, 11, 20. 294. Yi, R., Doehle, B.P., Qin, Y., Macara, I.G. and Cullen, B.R. (2005) Overexpression of exportin 5 enhances RNA interference mediated by short hairpin RNAs and microRNAs. Rna, 11, 2206. 295. Boudreau, R.L., Martins, I. and Davidson, B.L. (2009) Artificial microRNAs as siRNA shuttles: improved safety as compared to shRNAs in vitro and in vivo. Mol Ther, 17, 169 75. 296. Stewart, C.K., Li, J. and Golovan, S.P. (2008) Adv erse effects induced by short hairpin RNA expression in porcine fetal fibroblasts. Biochem Biophys Res Commun, 370, 1137. 297. Witting, S.R., Brown, M., Saxena, R., Nabinger, S. and Morral, N. (2008) Helper dependent adenovirus mediated short hairpin RNA expression in the liver activates the interferon response. J Biol Chem, 283, 21208. 298. Shimomura, O., Johnson, F.H. and Saiga, Y. (1962) Extraction, purification and properties of aequorin, a bioluminescent protein from the luminous hydromedusan, Aequor ea. J Cell Comp Physiol, 59, 22339.

PAGE 150

150 299. Ward, W.W. and Bokman, S.H. (1982) Reversible denaturation of Aequorea greenfluorescent protein: physical separation and characterization of the renatured protein. Biochemistry, 21, 453540. 300. Bokman, S.H. and Ward, W.W. (1981) Renaturation of Aequorea greefluorescent protein. Biochem Biophys Res Commun, 101, 137280. 301. Corish, P. and Tyler Smith, C. (1999) Attenuation of green fluorescent protein half life in mammalian cells. Protein Eng, 12, 103540. 302. Cubitt, A.B., Woollenweber, L.A. and Heim, R. (1999) Understanding structurefunction relationships in the Aequorea victoria green fluorescent protein. Methods Cell Biol, 58, 1930. 303. Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N., Palmer, A.E. and Tsien, R.Y. (2004) Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol, 22, 156772. 304. Heim, R., Prasher, D.C. and Tsien, R.Y. (1994) Wavelength mutations and postt ranslational autoxidation of green fluorescent protein. Proc Natl Acad Sci U S A, 91, 125014. 305. Gurskaya, N.G., Fradkov, A.F., Terskikh, A., Matz, M.V., Labas, Y.A., Martynov, V.I., Yanushevich, Y.G., Lukyanov, K.A. and Lukyanov, S.A. (2001) GFP like chromoproteins as a source of far red fluorescent proteins. FEBS Lett, 507, 1620. 306. Matz, M.V., Fradkov, A.F., Labas, Y.A., Savitsky, A.P., Zaraisky, A.G., Markelov, M.L. and Lukyanov, S.A. (1999) Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol, 17, 96973. 307. Chudakov, D.M., Matz, M.V., Lukyanov, S. and Lukyanov, K.A. (2010) Fluorescent proteins and their applications in imaging living cells and tissues. Physiol Rev, 90, 110363. 308. Nakamura, Y., Wada, K., Wada, Y., Doi, H., Kanaya, S., Gojobori, T. and Ikemura, T. (1996) Codon usage tabulated from the international DNA sequence databases. Nucleic Acids Res, 24, 2145. 309. Ikemura, T. (1982) Correlation between the abundance of yeast transfer RNAs and the occurrence of t he respective codons in protein genes. Differences in synonymous codon choice patterns of yeast and Escherichia coli with reference to the abundance of isoaccepting transfer RNAs. J Mol Biol, 158, 57397. 310. Wada, K., Wada, Y., Ishibashi, F., Gojobori, T. and Ikemura, T. (1992) Codon usage tabulated from the GenBank genetic sequence data. Nucleic Acids Res, 20 Suppl, 21118.

PAGE 151

151 311. Manfredsson, F.P., Burger, C., Rising, A.C., Zuobi Hasona, K., Sullivan, L.F., Lewin, A.S., Huang, J., Piercefield, E., Muzyczk a, N. and Mandel, R.J. (2009) Tight Longterm dynamic doxycycline responsive nigrostriatal GDNF using a single rAAV vector. Mol Ther, 17, 185767. 312. Manfredsson, F.P., Burger, C., Sullivan, L.F., Muzyczka, N., Lewin, A.S. and Mandel, R.J. (2007) rAAV me diated nigral human parkin over expression partially ameliorates motor deficits via enhanced dopamine neurotransmission in a rat model of Parkinson's disease. Exp Neurol, 207, 289301. 313. Manfredsson, F.P., Tumer, N., Erdos, B., Landa, T., Broxson, C.S., Sullivan, L.F., Rising, A.C., Foust, K.D., Zhang, Y., Muzyczka, N. et al. (2009) Nigrostriatal rAAV mediated GDNF overexpression induces robust weight loss in a rat model of agerelated obesity. Mol Ther, 17, 98091. 314. Peden, C.S., Burger, C., Muzyczka N. and Mandel, R.J. (2004) Circulating anti wild type adenoassociated virus type 2 (AAV2) antibodies inhibit recombinant AAV2 (rAAV2) mediated, but not rAAV5mediated, gene transfer in the brain. J Virol, 78, 634459. 315. Peden, C.S., Manfredsson, F.P. Reimsnider, S.K., Poirier, A.E., Burger, C., Muzyczka, N. and Mandel, R.J. (2009) Striatal readministration of rAAV vectors reveals an immune response against AAV2 capsids that can be circumvented. Mol Ther, 17, 524 37. 316. Tsien, R.Y. (1998) The green fluorescent protein. Annu Rev Biochem, 67, 50944. 317. Mullen, R.J., Buck, C.R. and Smith, A.M. (1992) NeuN, a neuronal specific nuclear protein in vertebrates. Development, 116, 201 11. 318. Foust, K.D., Nurre, E., Montgomery, C.L., Hernandez, A., Chan, C.M. and Kaspar, B.K. (2009) Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol, 27, 5965. 319. Beck, H., Semisch, M., Culmsee, C., Plesnila, N. and Hatzopoulos, A.K. (2008) Egr 1 regulates expression of the gl ial scar component phosphacan in astrocytes after experimental stroke. Am J Pathol, 173, 7792. 320. Greengard, P., Allen, P.B. and Nairn, A.C. (1999) Beyond the dopamine receptor: the DARPP 32/protein phosphatase1 cascade. Neuron, 23, 43547. 321. Snyder G.L., Fienberg, A.A., Huganir, R.L. and Greengard, P. (1998) A dopamine/D1 receptor/protein kinase A/dopamineand cAMP regulated phosphoprotein (Mr 32 kDa)/protein phosphatase1 pathway regulates dephosphorylation of the NMDA receptor. J Neurosci, 18, 1 0297303.

PAGE 152

152 322. Unal Cevik, I., Kilinc, M., Gursoy Ozdemir, Y., Gurer, G. and Dalkara, T. (2004) Loss of NeuN immunoreactivity after cerebral ischemia does not indicate neuronal cell loss: a cautionary note. Brain Res, 1015, 16974. 323. Cannon, J.R. and Gr eenamyre, J.T. (2009) NeuN is not a reliable marker of dopamine neurons in rat substantia nigra. Neurosci Lett, 464, 147. 324. Kim, K.K., Adelstein, R.S. and Kawamoto, S. (2009) Identification of neuronal nuclei (NeuN) as Fox 3, a new member of the Fox 1 gene family of splicing factors. J Biol Chem, 284, 3105261. 325. Zhou, H.L., Baraniak, A.P. and Lou, H. (2007) Role for Fox 1/Fox 2 in mediating the neuronal pathway of calcitonin/calcitonin generelated peptide alternative RNA processing. Mol Cell Biol, 27, 83041. 326. Ponthier, J.L., Schluepen, C., Chen, W., Lersch, R.A., Gee, S.L., Hou, V.C., Lo, A.J., Short, S.A., Chasis, J.A., Winkelmann, J.C. et al. (2006) Fox 2 splicing factor binds to a conserved intron motif to promote inclusion of protein 4.1R alternative exon 16. J Biol Chem, 281, 1246874. 327. Black, D.L. (1992) Activation of c src neuronspecific splicing by an unusual RNA element in vivo and in vitro. Cell, 69, 795807. 328. Nakahata, S. and Kawamoto, S. (2005) Tissuedependent isoforms of mammalian Fox 1 homologs are associated with tissuespecific splicing activities. Nucleic Acids Res, 33, 207889. 329. Underwood, J.G., Boutz, P.L., Dougherty, J.D., Stoilov, P. and Black, D.L. (2005) Homologues of the Caenorhabditis elegans Fox 1 protein are neuronal splicing regulators in mammals. Mol Cell Biol, 25, 1000516. 330. Auweter, S.D., Fasan, R., Reymond, L., Underwood, J.G., Black, D.L., Pitsch, S. and Allain, F.H. (2006) Molecular basis of RNA recognition by the human alternative splicing fac tor Fox 1. Embo J, 25, 16373. 331. Zhang, C., Zhang, Z., Castle, J., Sun, S., Johnson, J., Krainer, A.R. and Zhang, M.Q. (2008) Defining the regulatory network of the tissuespecific splicing factors Fox 1 and Fox 2. Genes Dev, 22, 255063. 332. Saudou, F., Finkbeiner, S., Devys, D. and Greenberg, M.E. (1998) Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell, 95, 5566. 333. Arrasate, M., Mitra, S., Schweitzer, E.S., Segal, M.R. and Finkbeiner, S. (2004) Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death. Nature, 431, 80510.

PAGE 153

153 334. Miller, J., Arrasate, M., Shaby, B.A., Mitra, S., Masliah, E. and Finkbeiner, S. (2010) Quantitative relati onships between huntingtin levels, polyglutamine length, inclusion body formation, and neuronal death provide novel insight into huntington's disease molecular pathogenesis. J Neurosci, 30, 1054150. 335. Morris, R. (1984) Developments of a water maze proc edure for studying spatial learning in the rat. J Neurosci Methods, 11, 4760. 336. Devito, L.M. and Eichenbaum, H. (2010) Distinct contributions of the hippocampus and medial prefrontal cortex to the "what wherewhen" components of episodic like memory in mice. Behav Brain Res, 215, 31825. 337. Thu, D.C., Oorschot, D.E., Tippett, L.J., Nana, A.L., Hogg, V.M., Synek, B.J., Luthi Carter, R., Waldvogel, H.J. and Faull, R.L. (2010) Cell loss in the motor and cingulate cortex correlates with symptomatology in Huntington's disease. Brain, 133, 1094110. 338. Zhang, J., Peng, Q., Li, Q., Jahanshad, N., Hou, Z., Jiang, M., Masuda, N., Langbehn, D.R., Miller, M.I., Mori, S. et al. (2009) Longitudinal characterization of brain atrophy of a Huntington's disease mouse model by automated morphological analyses of magnetic resonance images. Neuroimage, 49, 234051. 339. Sawiak, S.J., Wood, N.I., Williams, G.B., Morton, A.J. and Carpenter, T.A. (2009) Use of magnetic resonance imaging for anatomical phenotyping of the R6/ 2 mouse model of Huntington's disease. Neurobiol Dis, 33, 129. 340. Sawiak, S.J., Wood, N.I., Williams, G.B., Morton, A.J. and Carpenter, T.A. (2009) Voxel based morphometry in the R6/2 transgenic mouse reveals differences between genotypes not seen with manual 2D morphometry. Neurobiol Dis, 33, 207. 341. Giering, J.C., Grimm, D., Storm, T.A. and Kay, M.A. (2008) Expression of shRNA from a tissue specific pol II promoter is an effective and safe RNAi therapeutic. Mol Ther, 16, 16306. 342. Warby, S.C., Mo ntpetit, A., Hayden, A.R., Carroll, J.B., Butland, S.L., Visscher, H., Collins, J.A., Semaka, A., Hudson, T.J. and Hayden, M.R. (2009) CAG expansion in the Huntington disease gene is associated with a specific and targetable predisposing haplogroup. Am J H um Genet, 84, 35166. 343. Liu, W., Kennington, L.A., Rosas, H.D., Hersch, S., Cha, J.H., Zamore, P.D. and Aronin, N. (2008) Linking SNPs to CAG repeat length in Huntington's disease patients. Nat Methods, 5, 9513. 344. Singhi, S.C. and Tiwari, L. (2009) Management of intracranial hypertension. Indian J Pediatr, 76, 51929.

PAGE 154

154 345. Cruz, J., Minoja, G., Okuchi, K. and Facco, E. (2004) Successful use of the new highdose mannitol treatment in patients with Glasgow Coma Scale scores of 3 and bilateral abnormal pupillary widening: a randomized trial. J Neurosurg, 100, 37683. 346. Knapp, J.M. (2005) Hyperosmolar therapy in the treatment of severe head injury in children: mannitol and hypertonic saline. AACN Clin Issues, 16, 199211. 347. Burger, C., Nguyen, F.N., Deng, J. and Mandel, R.J. (2005) Systemic mannitol induced hyperosmolality amplifies rAAV2mediated striatal transduction to a greater extent than local coinfusion. Mol Ther, 11, 32731. 348. Vulchanova, L., Schuster, D.J., Belur, L.R., Riedl, M.S., Podetz Pedersen, K.M., Kitto, K.F., Wilcox, G.L., McIvor, R.S. and Fairbanks, C.A. (2010) Differential adenoassociated virus mediated gene transfer to sensory neurons following intrathecal delivery by direct lumbar puncture. Mol Pain, 6, 31. 349. McCarty, D.M., DiRosario, J., Gulaid, K., Muenzer, J. and Fu, H. (2009) Mannitol facilitated CNS entry of rAAV2 vector significantly delayed the neurological disease progression in MPS IIIB mice. Gene Ther, 16, 134052. 350. Mastakov, M.Y., Baer, K., Xu, R., Fitzsimon s, H. and During, M.J. (2001) Combined injection of rAAV with mannitol enhances gene expression in the rat brain. Mol Ther, 3, 225 32. 351. Ghodsi, A., Stein, C., Derksen, T., Martins, I., Anderson, R.D. and Davidson, B.L. (1999) Systemic hyperosmolality i mproves betaglucuronidase distribution and pathology in murine MPS VII brain following intraventricular gene transfer. Exp Neurol, 160, 10916. 352. Detrait, E.R., Bowers, W.J., Halterman, M.W., Giuliano, R.E., Bennice, L., Federoff, H.J. and Richfield, E .K. (2002) Reporter gene transfer induces apoptosis in primary cortical neurons. Mol Ther, 5, 72330. 353. Lamhonwah, A.M. and Tein, I. (1999) GFP Human highaffinity carnitine transporter OCTN2 protein: subcellular localization and functional restoration of carnitine uptake in mutant cell lines with the carnitine transporter defect. Biochem Biophys Res Commun, 264, 90914. 354. Sawada, Y., Kajiwara, G., Iizuka, A., Takayama, K., Shuvaev, A.N., Koyama, C. and Hirai, H. (2010) High transgene expression by lentiviral vectors causes maldevelopment of Purkinje cells in vivo. Cerebellum, 9, 291302. 355. Beltran, W.A., Boye, S.L., Boye, S.E., Chiodo, V.A., Lewin, A.S., Hauswirth, W.W. and Aguirre, G.D. (2010) rAAV2/5 genetargeting to rods:dosedependent efficien cy and complications associated with different promoters. Gene Ther, 17, 116274.

PAGE 155

155 356. Krestel, H.E., Mihaljevic, A.L., Hoffman, D.A. and Schneider, A. (2004) Neuronal co expression of EGFP and betagalactosidase in mice causes neuropathology and premature death. Neurobiol Dis, 17, 3108. 357. Mayford, M., Bach, M.E., Huang, Y.Y., Wang, L., Hawkins, R.D. and Kandel, E.R. (1996) Control of memory formation through regulated expression of a CaMKII transgene. Science, 274, 167883. 358. Hanazono, Y., Yu, J.M., Dunbar, C.E. and Emmons, R.V. (1997) Green fluorescent protein retroviral vectors: low titer and high recombination frequency suggest a selective disadvantage. Hum Gene Ther, 8, 13139. 359. Ulusoy, A., Sahin, G., Bjorklund, T., Aebischer, P. and Kirik, D (2009) Dose optimization for longterm rAAV mediated RNA interference in the nigrostriatal projection neurons. Mol Ther, 17, 157484. 360. Livet, J., Weissman, T.A., Kang, H., Draft, R.W., Lu, J., Bennis, R.A., Sanes, J.R. and Lichtman, J.W. (2007) Trans genic strategies for combinatorial expression of fluorescent proteins in the nervous system. Nature, 450, 5662.

PAGE 156

156 BIOGRAPHICAL SKETCH Aaron Coates Rising was born in Lexington, Kentucky on April 23rd, 1982 to James and Leah Rising. He spent the first five years of his life in a small town in eastern Kentucky named Irvine. At the age of five, Aaron moved with his parents and his 3 year old brother, Andrew, to Saudi Arabia. Living overseas for 17 years in Saudi Arabia allowed for many exotic travel experienc es and adventures Aaron came back to the United States for the last three years of high school and attended St. Geroges School in Newport, Rhode Island. After graduation Aaron went to Carnegie Mellon University in Pittsburgh, Pennsylvania where he studied biology. Working in two different labs, Aaron got experience in immunohistochemistry, microscopy and basic neuroscience skills. Receiving his B.S in b iology and minors in b usiness administration and c hemistry he went on to graduate school In 2004 Aaron began his graduate career at the University of Florida. In 2005 Aaron joined Dr. Ron Mandels Lab where he worked on the projected presented here. In addition to working with Dr. Mandel, he has worked closely with Dr. Alfred Lewin in the Molecular Genetics and Microbiology Department at the University of Florida as well as Dr. Elieen DenovanWright in the Pharmacology Department at the University of Dalhousie in Halifax, Nova Scotia, Canada.