<%BANNER%>

Development of Aptamers for Targeted Therapy and Biomarker Discovery

Permanent Link: http://ufdc.ufl.edu/UFE0042402/00001

Material Information

Title: Development of Aptamers for Targeted Therapy and Biomarker Discovery
Physical Description: 1 online resource (142 p.)
Language: english
Creator: Meng, Ling
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: apoptosis, aptamer, biomarker, cancer, colon, doxrubicin, liver, ptk7, selex
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Cancer, as the second leading cause of death worldwide, is one of the major public health concerns. Though great efforts have been made globally in cancer research, the incidence of cancer is still rising. The most difficult part for effective diagnosis and treatment of most cancers is the lack of effective and specific molecular markers. Defining molecular characteristics of cancer cells is useful in the prediction of tumor behavior and monitoring the response to treatment. The identification of molecular markers for cancers using antibody and mass spectrometry methodologies has been challenging. Therefore, the development of new strategies to identify new molecular markers specific for cancers is important. Oligonucleotides were once considered mainly as molecules for the storage and translation of genetic information. However, the discovery of RNAzymes, and later, DNAzymes, revealed the potential use of oligonucleotides in many other biological applications. In the last two decades, these applications have been expanded through the introduction of Systematic Evolution of Ligands by EXponential enrichment (SELEX) which generates, by repeated rounds of in vitro selection, a type of molecular probe termed aptamers. Aptamers are oligonucleic acid (or peptide) molecules that can bind 18 to various molecular targets and are viewed as complements to antibodies. Aptamers have found applications in many areas, such as biotechnology, medicine, pharmacology, microbiology, and chemistry. The potential of aptamers in cancer research has been intensively studied in the past few decades, as a result of the unique ability of aptamers to identify molecular signatures of cancer cells. In this dissertation we have demonstrated the potential of aptamers in recognition of surface markers for human liver cancers and in targeted drug-delivery. We believe the successful development of these molecular probes will contribute immensely to the efforts in many research facilities to understand and manage human cancers.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ling Meng.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042402:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042402/00001

Material Information

Title: Development of Aptamers for Targeted Therapy and Biomarker Discovery
Physical Description: 1 online resource (142 p.)
Language: english
Creator: Meng, Ling
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: apoptosis, aptamer, biomarker, cancer, colon, doxrubicin, liver, ptk7, selex
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Cancer, as the second leading cause of death worldwide, is one of the major public health concerns. Though great efforts have been made globally in cancer research, the incidence of cancer is still rising. The most difficult part for effective diagnosis and treatment of most cancers is the lack of effective and specific molecular markers. Defining molecular characteristics of cancer cells is useful in the prediction of tumor behavior and monitoring the response to treatment. The identification of molecular markers for cancers using antibody and mass spectrometry methodologies has been challenging. Therefore, the development of new strategies to identify new molecular markers specific for cancers is important. Oligonucleotides were once considered mainly as molecules for the storage and translation of genetic information. However, the discovery of RNAzymes, and later, DNAzymes, revealed the potential use of oligonucleotides in many other biological applications. In the last two decades, these applications have been expanded through the introduction of Systematic Evolution of Ligands by EXponential enrichment (SELEX) which generates, by repeated rounds of in vitro selection, a type of molecular probe termed aptamers. Aptamers are oligonucleic acid (or peptide) molecules that can bind 18 to various molecular targets and are viewed as complements to antibodies. Aptamers have found applications in many areas, such as biotechnology, medicine, pharmacology, microbiology, and chemistry. The potential of aptamers in cancer research has been intensively studied in the past few decades, as a result of the unique ability of aptamers to identify molecular signatures of cancer cells. In this dissertation we have demonstrated the potential of aptamers in recognition of surface markers for human liver cancers and in targeted drug-delivery. We believe the successful development of these molecular probes will contribute immensely to the efforts in many research facilities to understand and manage human cancers.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ling Meng.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042402:00001


This item has the following downloads:


Full Text

PAGE 1

1 DEVELOPMENT OF APTAMER S FOR TARGETED THERAPY AND BIOMARKER DISCOVERY By LING MENG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Ling Meng

PAGE 3

3 To my loving parents, husband and daughter

PAGE 4

4 ACKNOWLEDGMENTS It has been more than five years since I joined Univ ersity of Florida as a graduate student in 2005. It is an interesting journey fulfilled with encourage, support, friendship and, of course, pains. There have been so many things and people I will always remember. First of all I would like to express my deep gratitude to my advisor, Dr. Weihong Tan, who has guided me through my five years of study Dr. Tan not only provided many suggestions and support for my research, but also encouraged and enlightened me to seriously investigate the correct attitude to my future career and life. In addition, I would like to thank my committee members: Dr. Gail Fanucci Dr. Richard Moyer Dr. Jon Stewart and Dr. Vaneica Young. Their advice, suggestions, and encouragement have helped me to refine this dissertation. Also, I appreciate the great help from Department of Chemistry f aculties and staffs, especially Dr.Kathryn R. Willams, Dr. Benjamin W. Smith and Lori Clark. I appreciate the tremendous efforts from Dr. Xiangxuan Zhao and Lucy Zhang from Dr. Chen Lius group on the liver cancer drug project. This is a collaborative wor k between Dr Weihong Tan and Dr. Lius Labs. The success was through the collective efforts of all members. I also thank Dr. Lei Zhou and Dr. Siqing Wang for discussion and suggestions on PTK7 function project. Tan group is more like a big family than a research group and I am proud and thankful to have been a member of this family All former and current members have contributed to my research and life. Here, and helped me in different aspect s. I want to thank all of them, especially Dr. Shangguan Dihua, Dr. Zhiwen Tang, Dr. Kwame Sefah, Dr. Prabodhika Mallikaratchy, Dr. Liu Yang, Dr. Yanrong Wu, Dr. Yan Chen, Hui Wang

PAGE 5

5 for their continuous support, suggestions and discussions of my research, as well as their ki nd friendship and encouragement There has been nothing more valuable and precious than my family to me. I am exceedingly thankful to my parents, Hongying Su and Xiangting Meng, and my husband, Yan Li, for their understanding, support, encouragement and love. I also thank my daughter, Connie M. Li for the endless happiness and joy that she has brought to me. Without these help and support, I would never a chieve any success. I would like to acknowledge all of them at this special moment.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 LIST OF ABBREVIATIONS ........................................................................................... 13 ABSTRACT ................................................................................................................... 17 CHAPTER 1 INTRODUCTION .................................................................................................... 19 Human Cancer ........................................................................................................ 19 Overview .......................................................................................................... 19 Cancer Genomics ............................................................................................. 20 Gene Expression Profiling in Cancer ................................................................ 20 Protein Profiling in Cancer ................................................................................ 21 Aptamers ................................................................................................................ 23 Overview .......................................................................................................... 23 SELEX .............................................................................................................. 23 Aptamers versus Antibodies ............................................................................. 25 Applications of Aptamers ........................................................................................ 26 Biosensor and Bioanalytical Applications ........................................................ 27 Biomarker Identification .................................................................................... 28 Therapeutic Applications .................................................................................. 29 Overview of Dissertation Research ......................................................................... 31 2 IDENTIFICATION OF LIVER CANCERSPECIFIC APTMERS USING WHOLE LIVE CELLS ............................................................................................................ 34 Introduction ............................................................................................................. 34 Materials and Methods ............................................................................................ 36 Cell Lines and Buffers ...................................................................................... 36 SELEX Library and Primers .............................................................................. 37 SELEX Procedures .......................................................................................... 38 Flow Cytometric Analysis ................................................................................. 39 Confocal Imaging of Cells Stained with Aptamer .............................................. 41 Mice Tumor Detection by Aptamers ................................................................. 41 Results .................................................................................................................... 42 Liver Cancer Cell SELEX ................................................................................. 42 Monitoring the Progress ion of Aptamer Selection ............................................ 43 Identification of Selected Aptamers for Liver Cancer Cells ............................... 44

PAGE 7

7 The Selected Aptamers can Recognize Target Cells with High Specificity ...... 45 The Selected Aptamers are Effective Molecular Probes for Liver Cancer in Mice .............................................................................................................. 46 Discussion .............................................................................................................. 47 Conclus ion .............................................................................................................. 49 3 TARGETING DELIVERY OF CHEMOTHERAPY AGENTS BY A CANCER SPECIFIC APTAMER ............................................................................................. 60 Introduction ............................................................................................................. 60 Materials and Methodology ..................................................................................... 62 Cell Culture and Reagents ............................................................................... 62 Conjugation of Aptamer Dox ............................................................................ 62 Determination of Aptamer Affinity ..................................................................... 63 Confocal Microscopy of Cultured Cells ............................................................. 64 Protease Assay ................................................................................................ 65 Monitoring of Complex Formation by Fluorescence ......................................... 65 Assessment of Cellular Uptake of Dox by Confocal Microscopy ...................... 65 MTS Cell Viability Assay ................................................................................... 66 Hoechst 33258 Staining for Apoptotic Cells ..................................................... 66 Western Blotting Analysis ................................................................................. 67 In vivo Experiments of Dox TS11a Conjugates ................................................ 68 Results .................................................................................................................... 68 Binding Affinity of Aptamer TLS11a .................................................................. 68 Preliminary Determination of Aptamer Target Molecule ................................... 69 Conjugation of Aptamer Dox Complex ............................................................. 70 Characterization of Aptamer Dox Complexes .................................................. 72 Cell Toxicity of Aptamer Dox Conjugates ......................................................... 72 In vivo Studies .................................................................................................. 74 Discussion .............................................................................................................. 75 Conclusion .............................................................................................................. 76 4 SILENCING OF PTK7 IN COLON CANCER CELLS: CASPASE10DEPENDENT APOPTOSIS VIA MITOCHONDRIAL PATHWAY ............................ 90 Introduction ............................................................................................................. 90 Materials and Methodology ..................................................................................... 93 Materials ........................................................................................................... 93 Cell Culture ....................................................................................................... 94 T ransfection of siRNA ...................................................................................... 95 Flow Cytometry Analysis .................................................................................. 95 Quantitative RTPCR ........................................................................................ 95 Cell Number Detection by Trypan B lue Exclusion Assay ................................. 96 Proliferation Assay ........................................................................................... 97 Annexin V/Propidium Iodide DoubleStaining Assay ........................................ 97 Western Blot Analyses ..................................................................................... 98 Measurement of Mitochondrial Membrane Potential ........................................ 99

PAGE 8

8 Caspase10 Activity Measurement ................................................................... 99 Results .................................................................................................................. 100 Inhibition of PTK7 Expression by PTK7 siRNA ............................................... 100 Inhibition of PTK7 protein expression ...................................................... 100 Inhibition of PTK7 mRNA expression ....................................................... 100 Viability of PTK7 siRNATreated HCT 116 Cells ............................................ 101 Proliferation of PTK7 siRNATreated HCT 116 Cells ..................................... 102 Increase of Apoptosis of PTK7 siRNA Treated HCT 116 Cells ...................... 102 Changes in Mitochondrial Membrane Potential and Activation of Caspase9 103 Role of Caspase10 in PTK7KnockdownInduced Apoptosis ........................ 104 p53 involvement in PTK7knockdowninduced Apoptosis .............................. 106 Discussion ............................................................................................................ 107 Conclusion ............................................................................................................ 110 5 SUMMARY AND FUTURE PLAN ......................................................................... 125 Future Work .......................................................................................................... 127 Biomarker Discovery ...................................................................................... 127 Clinical Application ......................................................................................... 128 LIST OF REFERENCES ............................................................................................. 130 BIOGRAPHICAL SKETCH .......................................................................................... 142

PAGE 9

9 LIST OF TABLES Table page 2 1 Sequences and Kds of selected aptamers for liver cancer. ................................. 53 2 2 Aptamers binding to different kinds of cell lines .................................................. 59 3 1 Different aptamer sequences .............................................................................. 78 4 1 RT PCR preparation ......................................................................................... 113

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Schematic representation of the cell based aptamer selection. .......................... 32 1 2 Antiprostatespecific membrane antigen (PSMA) aptamer mediated small interfering (si)RNA delivery. ................................................................................ 33 2 1 Schematic of a flow cytometer. ........................................................................... 51 2 2 Binding assay of selected pool with BNL 1ME A.7R.1 and BNL CL.2 cells. A: Flow cytometry assay to monitor the binding of selected pool with BNL 1ME A.7R.1 cells (target cells) and BNL CL.2 cells (control cells). ............................. 52 2 3 Flow cytometry assay for the binding of the FITC labeled sequence aptamer TLS9a and TLS11a with BNL 1ME A.7R.1 cells (target cells) and BNL CL.2 cells (control cells). ............................................................................................. 54 2 4 Fluorescence confocal images and optical images of (A) BNL 1ME A.7R.1 cells and (B) BNL CL.2 cells stained by unselected library (top), aptamers TLS9a (middle) and TLS11a (bottom) labeled with FITC. .................................. 55 2 5 Microscopic examination of the formation of tumors. Formalin fixed normal (A) liver tissues and (B) tumor tissue embedded in paraffin were stained with hematoxylin and eosin. ....................................................................................... 56 2 6 Fluorescence confocal images and optical images of (A) frozen tumor sections and (B) frozen normal liver sections stained by unselected library (top), aptamers TLS11a (bottom) labeled with FITC.. ......................................... 57 2 7 Flow cytometry assay for the binding of the FITC labeled sequence aptamer TLS9a and TLS11a (50 nM) with isolated (A) tumor cells and (B) normal liver ce lls. ................................................................................................................... 58 3 1 The secondary structure of aptamer TLS11a and its binding ability to LH86 and human normal liver cells, Hu1082. .............................................................. 79 3 2 Representative binding curve of TLS11a aptamer with LH86 cells. .................... 80 3 3 Preliminary determination of the type of cell surface molecules which bind to TLS11a ............................................................................................................... 81 3 4 Co localization of (A) TLS11a or (B) control TD05 and Lysosensor in endosomes after two hour incubation at 37C. ................................................... 82 3 5 The intercalation of Dox into GC modified aptamers to form physical conjugates .......................................................................................................... 83

PAGE 11

11 3 6 Fluorescence spectra of doxorubicin solution (10 M ) (dark blue) with modified TLS 11aGC (red) or TD05GC (green) ................................................ 84 3 7 The binding affinity of (A) TLS11a GC or (B) TD05 GC to LH86 cells monitored using flow cytometry. ......................................................................... 85 3 8 Internalization of (A) Dox, (B) TLS11agc Dox, and (C ) TD05GC Dox observed by confocal microscopy. ...................................................................... 86 3 9 Relative cell viability of cells treated with either TLS11aGC, TD05 GC, free Doxorubicin, TLS11aGC Dox or TD05GC D ox. (A ) Relative cell viabilit y of LH86 (target cell line); (B ) Relative cell viability of Hu 1229 (human normal liver cells). ........................................................................................................... 87 3 10 A poptosis of cells treated with either TLS11aGC, TD05 GC, free Doxorubicin, TLS11aGC Dox or TD05GC Dox ................................................ 88 3 11 Tumor inhibition of the aptam er Dox complex in mice model ............................. 89 4 1 Crosstalk between apoptosis signaling pathways following activation of death receptors .......................................................................................................... 111 4 2 Short interfering (si)RNAs and t he siRNA pathway. ......................................... 112 4 3 PTK7 expression in HCT 116 cells after treatment with vehicle, nonspecific siRNA and PTK7 siRNA. .................................................................................. 114 4 4 Suppression of PTK7 mRNA expression in HCT 116 cells by PTK7 siRNAs. Cells were harvested after 48 h of treatment. ................................................... 115 4 5 Cell viability in HCT 116 cells after treatm ent with vehicle, nonspecific siRNA and PTK7 siRNA. ............................................................................................. 116 4 6 BrdU incorporation relative to untreated cells detected by flow cytometr y.. ...... 117 4 7 Apoptosis occurrence in HCT 116 cells detected by Annexin V/PI stain on days 14 after transfection ................................................................................ 118 4 8 Involvement of mitochondrial pathway in apoptosis induced by PTK7 scilencing. ......................................................................................................... 119 4 9 Activation of caspase9 involved in apoptosis induced by knocking down PTK7. ............................................................................................................... 120 4 10 Cell viability after incubation with caspase inhibitors prior to transfection of PTK7 siRNA. .................................................................................................... 121 4 11 The activation of cas pase10 in apoptosis induced by knocking down of PTK7.. .............................................................................................................. 122

PAGE 12

12 4 12 PTK7 expression and cell apoptosis induced by knocking down of PTK7 in p53null HCT 116 cells. .................................................................................... 123 4 13 Mitochondria and caspase10 involvement in the apoptosis induced by knocking down of PTK7 in p53null HCT 116 cells. .......................................... 124 5 1 Outline of the protocol for the identification of IGHM on Ramos cells using selected aptamers targeting whole cells. .......................................................... 129

PAGE 13

13 LIST OF ABBREVIATIONS 7 AAD 7 Aminoactinomycin D AEBSF 4 (2 aminoethyl)benzenesulfonyl fluoride AFC 7 amino4 trifluoromethyl coumarin AFP Alpha fetoprotein ALL Acute lymphoblastic leukemia AMA A mmonium hydroxide/40% aqueous methylamine 1:1 AMD A g e related macular degeneration AML A cute myeloid leukemia ATCC American Type Culture Collection Bid BCL 2 Interacting Domain BrdU B romodeoxyuridine BSA Bis( trimethylsilyl)acetamide Caspase C ysteineasp artic protease CCK4 C olon carcinoma kinase4 cDNA C omplementary DNA CGH C om parative genomic hybridization CT Computed tomography C y5 .5 C yanine derivative 5.5 DISC D eathinducing signaling complex DMEM Dulbecco's Modified Eagle Medium DNA D eoxyribonucleic acid DNase D eoxyribonuclease dNTP D eo xyribonucleotide triphosphate Dox Doxorubicin

PAGE 14

14 DPBS Dulbecco's phosphate buffered saline dsRNA D oublestraned RNA ECL E nhanced chemiluminescence EDTA Ethylenediaminetetraacetic acid EGF E pithelial growth factor EGFR2 E pi dermal growth factor receptor 2 EGTA E thylene glycol tetraacetic acid FADD Fas Associated protein with Death Domain FBS F etal bovine serum FISH F luorescence in situ hybridization FITC F luorescein isothiocyanate FMK Fluoromethyl ketone FSC Forward Scatter GAPDH Glyceraldehyde 3phosphate dehydrogenase H&E Stain H ematoxylin and eosin stain HBSS Hank's buffered salt solution HBV Hepatitis B virus HCC Hepatocellular carcinoma HCV Hepatitis C virus HER2 Human epidermal growth factor receptor 2 HEPES 4 (2 hydroxyethyl) 1 piperazineethanesulfonic acid HPLC H igh performance liquid chromatography HRP H orseradish peroxidase IDT Integrated DNA Technologies IGF Insulin like growth factors

PAGE 15

15 IgG Immunoglobulin G JC 1 5,5',6,6'tetrachloro1,1',3,3'tetraethylbenzimidazolylcarbocyanine iodide Kd D issociation constant kD K iloDalton MEAR BNL 1ME A.7R.1 mouse hepatoma cell line miRNA microRNA MRI Magnetic resonance imaging mRNA M essenger ribonucleic acid MTS (3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulfophenyl) 2H tetrazolium) NP40 Nonidet P 40 PAGE P olyacrylamide gel electrophoresis PBS Phosphate buffered saline PBST Phosphate buffered saline buffer containing 0.2% Tween 20 PCP P lanar cell polarity PCR P olymerase chain reaction PDGF Platelet derived growth factor PE R phycoerythrin PET Positron emission tomography PI P ropidium iodide PMS Phenazine methosulfate Poly(A) P olyadenylate PS Phosphatidylserine PSMA Prostate Specific Membrane Antigen rRNA R ibosomal RNA

PAGE 16

16 PTK7 Protein tyrosine kinase 7 PVDF Polyvinylidene Fluoride RISC RNAinduced silencing complex RNA R ibonucleic acid RNAi RNA interference RTKs Receptor tyrosine kinases RT PCR Reverse transcription polymerase chain reaction SELEX S ystematic E volution of L igands by EXponential enrichment siRNA S mall interfering RNA SDS S odium dodecyl sulfate SSC Side Scatter ssDNA S ingle stranded deoxyribonucleic acid tBid T runcated BCL 2 Interacting Domain T cell ALL T cell acute lymphoblastic l eukemia Tm M elting temperature TMR Tetramethylrhodamine TNF T umor necrosis factor tRNA Transfer RNA VEGF Endothelial growth factors WB W estern blot

PAGE 17

17 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENT OF APTAMERS FOR TARGETED THERAPY AND BIOMARKER DISCOVERY By Ling Meng December 2010 Chair: Weihong Tan Major: Chemistry Cancer as the second leading cause of death worldwide, is one of the major public health concerns. Though great efforts have been made globally in cancer research, the incidence of cancer is still rising. The most difficult part for effective diagnosis and treatment of most cancers is the lack of effective and specific molecular markers Defining molecular characteristics of cancer cells is useful in the prediction of tumor behavior and monitor ing the response to treatment. The identification of molecular markers for cancers using antibody and mass spectrometry methodologies has been challenging. Therefore, the development of new strategies to identify new molecular markers specific for cancers is important. Oligonucleotides were once considered mainly as molecules for the storage and translation of genetic information. However, the discovery of RNAzymes, and later, DNAzymes, revealed the potential use of oligo nucleotides in many other biological applications. In the last two decades, these applications have been expanded through the introduction of Systematic Evolution of Ligands by EXponential enrichment (SELEX) which generates by repeated rounds of in vitro selection, a type of molecular probe termed aptamers. Aptamers are oligonucleic acid (or peptide) molecules that can bind

PAGE 18

18 to various molecular targets and are viewed as complements to antibodies. Aptamers have found applications in many areas, such as biot echnology, medicine, pharmacology, microbiology, and chemistry. The potential of aptamers in cancer research has been intensive ly studied in the past few decades, as a result of the unique ability of aptamers to identify molecular signatures of cancer cell s. In this dissertation we have demonstrated the potential of aptamers in recogni tion of surface markers for human liver cancers and in targeted drugdelivery We believe the successful development of these molecular probes will contribute immensely to the efforts in many research facilities to understand and manage human cancers.

PAGE 19

19 CHAPTER 1 INTRODUCTION Human Cancer Overview Cancer is the general name for a group of different diseases which are characterized by uncontrolled cell growth and spread of abnormal cells Cancer starts when cells in a part of the body start to grow out of control. Normal cells grow, divide, and die in a very ordered fashion, but cancer cells continue growing and forming new cancer cells. Cancer cells can invade other tissues but normal cells cannot. So uncontrolled cell growth and the capability to invade other tissue make cancer cells different from normal cells. C ancer is caused by lifestyle and environmental factors ( tobacco, diet and obesity infections radiation, stress, lack of physical activity, and environmental pollutants ) and genetics (oncogene activation and tumor suppressor gene inactivation).1 C urrently cancer is the second most common leading cause of death worldwide and in the United States, exceeded only by heart disease. In 2010, 1,529,560 new cancer cases are expected to be diagnosed and about 569,490 Americans are expected to die of cancer, accounting for nearly 1 of every 4 deaths.2 Cancer diagnosis methods include X rays, computed tomography (CT), magnetic resonance imaging (MRI), and ultrasound, all of which help physicians determine the tumors location and size. A biopsy is usually performed to confirm most cancer diagnoses; tissue samples are surgically removed from the suspected malignancy and studied under a mic roscope to check for cancer cells. Treatment varies based on the type and stage of the tumor, and is typically determined by the tumor size and whether it has metasized, or spread from its original location. If the cancer is confined to one

PAGE 20

20 location and has not spread, the most common treatment is surgery. If surgery cannot remove all of the cancer tissue, treatment can include radiation, chemotherapy, or both. For some cancer cases, a combination of surgery, radiation, and chemotherapy is required. Cancer Genomics Cancer is characterized as a complex disease of genomic alteration, exploiting many different molecular mechanisms. All cancers occur due to abnormalities in DNA sequences. The identification of genes that are mutated and hence induce cancer has b een a central aim of cancer research, although the actual number of mutations required for a particular cancer development is still unknown .3 In order to understand the fundamental biology of cancers, it is important to identify these genetic alterations during cancer development. These gene mutations change the proteomic patterns of t he cell and then induce abnormal cell proliferation. Many techniques have been introduced as genome screening tools for chromosomal aberrations the identification of cancer cells including fluorescence in situ hybridization (FISH), multicolor spectral kar yotype (SKY)/multicolor FISH (mFISH), comparative genomic hybridization (CGH), and array based CGH. But there are limitations in using these methods For instance, prior knowledge of genes is required for FISH, and CGH is unable to detect balanced translocations and inversions Gene Expression Profiling in C ancer Gene expression profiling is a technique to measure the expression of thousands of genes simultaneously. In the context of cancer, gene expression profiling has been used to more accurately classify tumors and to predict a patients clinical outcome. Microarrays of cDNA and oligonucleot ides have been used as efficient tools for cancer

PAGE 21

21 gene expression profiling. Microarray analysis can provide quantitative gene expression information allowing for the generation of a molecular signature and the classification of tumors into subtypes.47 For example, acute lymphoblastic leukemia (ALL) was distinguished from acute myeloid leukemia (AML) by gene expression profiling. Comparison of the gene expression between cancer cells and normal cells can help identify the genes whic h are associated with cancer development. DNA/RNA microarrays, which offer relatively high sensitivity and throughput have been used as efficient tools for gene expression profiling. However, there are 25,000 genes in the human genome which produce 1,000,000 distinct proteins through posttranslational modification, such as cleavage, protein phosphorylation, and glycosylation. So a given gene serves as the basis for many different proteins. On the other hand, cells use many other mechanisms to regulate proteins without altering the amount of mRNA, so these genes may stay consistently expresse d even when protein concentrations are rising and falling. For example proteolysis, recycling, and isolation in cell compartments can affect protein concentration, without gene influence. Therefore, gene expression profiling alone is not sufficient for dis ease (such as cancer) biomarker identification. Protein Profiling in C ancer A ll living cells rely on proteins for their survival and growth. T he alteration of proteins, by changes in expression levels, posttranslational modifications (glycosylation, phenylation, formylation, acetylation) or mutations at the genetic level, can induce uncontrolled cell growth leading to cancer. Therefore, detection of alterations of protein expression levels and protein modifications is an important goal, which can lead to the invention of novel diagnostic approaches and targeted therapy strategies.

PAGE 22

22 Many of the key cancer related proteins discovered so far are membrane associated proteins, because they confer specific cellular functions and are easily accessible The membrane proteins represent about 1/3 of all cell proteins and play important role s in the survival of the cell. S everal growth factor proteins, such as epidermal growth factor receptor 2 (EGFR2),8 vascular endothelial growth factors (VEGF),9 platelet derived growth factor (PDGF),10 and insulinlike growth factors (IGF),11 are classic tumor related cell membrane proteins and their misregulation play s a key role in tumor initiation. Membrane proteins are generally used as markers to classify cell types12 and in drug therapy.13 Seventy percent of all known drug targets are cell membrane proteins such as HER2 ( human epidermal growth factor receptor 2) and G protein coupled receptors .13 However, n ot all cell membrane proteins are significant for cancer study and therapy, as most of these m ay also be equally expressed on normal cells. Therefore, i t is important and clinically significant to exploit technologies that have the capacity to identify useful markers which associate with cancer To achieve this goal, many monoclonal antibodies against cell surface proteins have been prepared. C ells can be classified or immunophenotyped according to their cell su rface protein expression. However, most cell membrane proteins remain undetectable due to the lack of suitable antibodies or recognition probes.14 Hence, the cell SELEX strategy (described further below) provides an opportunity to generate probes, called aptamers, to recognize target cancer cells with high specifi city and can be used for further discovery of new cancer biomarkers.

PAGE 23

23 Aptamers Overview Aptamers are oligonucleic acid or peptide molecules that specific ally bind to a target molecule. Nucleic acid aptamers are singlestranded oligonucleotides (DNA or RNA), and t hey typically contain fewer than 100 bases and have unique three dimensional structures for target recognition through interactions such as van der Waals surface contacts, hydrogen bonding and base stacking. Nucleic acid aptamers are developed from random oligonucleotide pools through a process called Systematic Evolution of Ligands by EXpon ential enrichment (SELEX), and they bind to various molecular targets, such as small molecules ( metal ions, organic dyes or amino acids ), nucleic acids, and proteins, as well as to viruses and virus infected cells, bacterial cells, tissues and organisms.1552 Both DNA and RNA aptamers can form complex secondary and tertiary structures, but the range of 3D structures ac hieved by RNA aptamers is more diverse compared to DNA aptamers.53,54 However, DNA aptamers are more stable and less expensive than RNA aptamers. Peptide aptamers consist of a short variable peptide domain attached at both ends to a protein scaffold to interfere with other protein interactions inside cells. Aptamers were first developed i n1990, and they are now widely used in biotechnology, medicine, pharmacology, cell biology, microbiology and bioanalysis .55,56 This dissertation focuses on DNA aptamer selection and application. SELEX Aptamers are obtained through an in vitro selection process k nown as SELEX (Systematic Evolution of Ligands by EXponential enrichment) in which aptamers are selected from a library of random sequences of synthetic DNA or RNA by repetitive binding of the oligonucleotides to target molecules. Briefly, the SELEX process starts

PAGE 24

24 with the incubation of the oligonucleotide library pool (DNA or RNA) with the target of interest. After incubation, the bound complex es (target and oligonucleotide sequences) are separated from the unbound sequences. After that, the sequences binding to the target are eluted and then incubated with the control and the remaining sequences are amplified by PCR. The process is repeated and monitored until the pool is enriched for sequences that specifically recognize the target of interest. Then t he enriched pool is cloned and sequenced to obtain the individual sequences. P otential aptamer candidates, usually grouped into families, are chemically synthesized, labeled with fluorescent dye and tested against the target Most aptamers reported so far have been selected by using simple targets, such as a purified protein. Recently, aptamer selection against complex targets, such as red blood cell membranes and endothelial cells, was also demonstrated.36,38,57,58 To identify unique molecular features of target cancer cells, we have developed a cell based SELEX (cellSELEX) for the selection of a panel of target cell specific aptamers.4044 The use of whole cells as targets to select aptamers offers several advantages : first, a panel of aptamers can be selected to target multiple proteins for the cancer study without prior knowledge of up/down regulat ion of proteins; second, the aptamers are selected against the native state of the proteins in the cellular environment; finally, a ptamers selected against whole cells can lead to the discovery of novel biomarkers Our cell SELEX process is illustrated in Figure 1 1. A counter selection strategy is used to collect DNA sequences that interact only with the target cells but not the control cells. Consequently, aptamer candidates exclusively binding to the target cells are enriched. The membrane protein targets of the selected aptamers represent the

PAGE 25

25 molecular level differences between the two cell lines used in this study. Not only can molecular signatures of the cancer cells be easily discovered, but probes that can recognize such unique features with very high affinity and specificity are also generated at the same time. More importantly, the use of a panel of probes has a clear advantage over the singlebiomarker based assays in clinical practice, providing much more information for accurate disease diagnosis and prognosis. At the same time, the probes recognize the targets in their native states, creating a true molecular profile of the disease cells. This is important in clinical application s of the molecular probes. In addition, the aptamers selected from cell SELEX offer valuable tools for isolating and identifying new biomarkers of the diseased cells if desired. The development of specific probes for molecular signatures on the cancer cell surface will provide new opportunities in personalized medicine. Aptamers versus Antibodies As they serve simi lar functions, aptamers are often compared to antibodies. While both can offer selective binding and high affinity, aptamers have some advantages over antibodies: Through in vitro selection, aptamers can be made for any target molecule. Antibody production requires the induction of an animals immune response, which can kill the animal. The use of animals in antibody production results in batchto batch variation. However, aptamers are chemically synthesized and purified, which prevents batchto batch variation.

PAGE 26

26 Modification is much easier for aptamers than for antibodies. The modification of antibodies can cause the loss of binding affinity to the target molecules, but the modification position in aptamers can be easily changed to positions where binding is not affected. Nucleic acid aptamers are short DNA/RNA oligonucleotides, and they are more stable at high temperature and can be regenerated easily after denaturation. So aptamers have much longer shelf life compared to antibodies. Aptamers have low toxicity or immunogenicity (if any) compared to antibodies and these are important features when used for in vivo applications such as imaging. Aptamers have better tissue penetration ability than antibodies, which is important for in vivo studies, such as targeted drug delivery. One of the most important disadvantages of nucleic acid aptamers is their susceptibility to enzymatic degration. However, this can be overcome by modification of nuclease resistance bases, such as locked nucleic acids and 2 O methyl nucleotide analogues, to further enhance nuclease resistance when adopted for in vivo study .5961 Applications of A ptamers Aptamers, synthesized nucleic acid or short peptides, specifically recognize a wide range of targets with high binding affinity. Also they are easily modified. These properties allow wide application of aptamers for biosensors, targeted therapy, cancer imaging and detection.

PAGE 27

27 B iosensor and Bioanalytical A pplications A biosensor is a device co nsisting of two main parts: a biological component, which reacts with a target substance, and a signal generating component, which detects the resulting products. The specificity and high affinity of aptamers to a wide range of targets, coupled with the ease of design and molecular engineering, make aptamers hi ghly suitable for development of molecular biosensors. Recently, the use of aptamers in different types of biosensor designs has been reviewed extensively. 6266 T here are three general paradigms that have appeared most frequently for the rational design of aptamer biosensors: structure switching, enzymebased, and aptazymebased biosensors.62 S tructure switching aptamer biosensors are t he most common designs in the literature.6772 These usually utilize the aptamers complementary DNA, which can either act as a separate molecule or can link to the aptamer. The easiest design for aptamer biosensors is to simply add the cDNA of an aptamer to act as a competitor to ligand binding. cDNA usually ca rries a signaling moiety that can be either enhanced or suppressed when in complex with the aptamer. So when the target molecule replaces the cDNA and binds to the aptamer, a signal change can be observed. If proteins or enzymes are involved in the design, it is called enzymebased aptamer biosensor design.73 75 These designs require good understanding of both aptamers and enzyme reactions. As many enzymes can be reused and have high catalytic rates, enzymebased biosensors can give significant signal enhancement. In addition to protein enzymes, oligonucleotides themselves can act as catalytic molecules (DNAzymes and RNAzymes). In these aptazymebased designs for biosensors, the fundamental strategy calls for the binding of an analyte t o the aptazyme complex leading to activation of the enzyme activity.

PAGE 28

28 Biomarker I dentification Disease biomarkers play critical roles in the management of various pathological conditions of diseases including diagnosis prediction of disease progression, and monitoring the efficacy of treatment by charting the levels of the biomarker Although there have been many attempts to identify specific disease biomarkers using a variety of technologies, the effective use of diseasespecific biomarkers is still not routine. Recently, cell SELEXbased biomarker identification has been explored.76,77 As described above, a panel of aptamers for the molecular recognition of diseased cells can be generated without prior knowledge of the target molecule or cell biomarker population. And selected aptamers hav e high binding affinity to specific targets.40,4244,78. Dr. Dihua Shangguan directed the first use of the cell SELE X based method for biomarker identification.76 The strategy included two steps: aptamer selection and biomarker discovery. First, a gr oup of aptamers was generated for a T cell acute lymphoblastic leukemia (TALL) cell line, CCRF CEM .78 Aptamer sgc8 as one of the selected aptamers, showed high specificity and binding affinity to surface targets on most of T ALL and acute myeloid leukemia (AML) cells, as well as some B cell acute lymphoblastic leukemia (B ALL) cells. However, sgc8 did not show a detectable level of binding to either lymphoma cells or normal human bone marrow cells.40,78 This indicated that the target of sgc8 may act as an important biomarker for leukemia. Then, sgc8 was conjugated with magnetic beads and used to capture and purify the binding targets on the leukemia cell surface. P rotein tyrosine kinase 7 (PTK7) was identified as the target protein of sgc8 on the cell surface, and was thereby established as a biomarker.76 (The function of PTK7 is discussed in Chapter 4.) A cross linking strategy was proposed by Dr. Probodhika Mallikaratchy, and the target protein of aptamer TD05 was identified

PAGE 29

29 successfully.77 Thus, cell SELEXbased biomarker identification shows great promise for efficient discovery of new disease biomarkers. Therapeutic A pplications In the past few years t he therapeutic application of aptamers has been demonstrated in model systems .37,57,7983 The potential advantage of aptamers in therapeutic applications is that so far there is no indication that aptamers are immunogenic, whereas antibodi es can elicit immune responses even within short periods of treatment .84 One the other hand, the potential disadvantage of aptamers is their rapid clearance and correspondingly short circ ulation time in vivo But this problem can be overcome by various modificati ons, such as conjugation with cholesterol,85 polyethyleneglycol groups ,85 liposomes,86 or modification with locked nucleic acids.59 A ptamer function is not affected in a majority of these modifications. Effective early diagnosis of cancer is very important in the management of the disease. Currently, a number of techniques have been used to image tumors such as positron emission tomography (PET) m agnetic resonance imaging (MRI), computed tomography (CT), ultrasound methods and optical technologies. However, these techniques lack sensitivity and cause many false positive readings, leading to unnecessary procedures. Use of tumor specific imaging probes would improve sensitivity and decrease misdiagnosis. In this regard, aptamers can serve as effective probes for sensitive cancer detection, while providing rapid blood clearance and tumor penetration. For example, aptamer TTA1A ( selected against tenascinC ) was modified with 99mTc and used as an imaging probe to specifically recognize tenascinabundant cell surfaces in vivo .87 Another example is in vivo fluorescence imaging of tumors using the DNA aptamer TD05,88 which was selected against Ramos (B cell lymphoma) The

PAGE 30

30 aptamer was modified with Cy5 dye and injected into mice bearing grafted tumors, followed by whole body fluorescence imaging. The results demonstrated that the aptamers could effectively recognize tumors with high sensitivity and specificity in vivo Furthermore, approaches have been investigated to conjugate aptamers with nanomaterials or q uantum dot s for cancer cell or tissue detection and imaging.8992 In addition, aptamers generated by cellSELEX have been used to reveal molecular differences of cancer cells in patient samples, demonstrating applicability of aptamers to real clinical settings.40,44 Currently, a number of aptamers targeting specific cell membrane receptors have been successfully investigated for the targeted delivery of active drugs both in vitro and in vivo including anti cancer drugs89,9397, toxins98, viruses99 and siRNAs100 105. For example, anti PSMA (Prostate Specific Membrane Antigen, a cell surface receptor overexpressed in prostate cancer cells and tumor vascular endothelium106) aptamers were conjugated to gelonin, a toxin which can cleave a specif ic glycosidic bond in rRNA, resulting in disruption of protein synthesis and cell death The aptamer toxin conjugates showed IC50 (Inhibition Concentration) of 27 nM for PSMA positive prostate cancer cells and displayed a 600fold toxicity increase when compared to nonPSMA expressing cells.98 In addition, t hree independent groups have specifically delivered siRNAs to target cells using anti PSMA RNA aptamers (Figure 12 ).107 Other aptamers that can be used for targeted delivery include anti CD4 aptamer, anti HIV gp120 aptamer, anti PTK7 aptamer, anti TfR aptamer. In addition to conjugating aptamers to therapeutic drugs or siRNAs, some aptamers, like those for VEGF, thrombin, and nucleolin, have therapeutic effects

PAGE 31

31 themselves. The binding of anti VEGF aptamer to VEGF effectively inhibits VEGF from binding to its cellular receptors and therefore prevents further initiation and growth of unwanted blood vessels in patients with agerelated macular degeneration (AMD) .108 Antithrombin aptamer, a 15nucleotide G quadruplex forming DNA aptam er, binds thrombins active site, making it a potent anticoagulant.109,110 In addition, AS1411, another quadruplex forming oligonucleotide aptamer that targets nucleolin, inhibits cancer cell proliferation by affecting the activities of certain nucleolincontaining complexes.111,112 AS1411 is currently in clinical trials as a treatment for various cancers. Overview of Dissertation Research The research presented in this dissertation focuses on the development of aptamers for targeted therapy and biomarker discovery. Chapter 2 demonstrates suc cessful utilization of cell SELEX strateg ies to develop useful, specific and high affinity DNA aptamers for liver cancer cells. Chapter 3 demonstrates the concept of targeted drug delivery to cancer cells using aptamers. Chapter 4 describes the discovery of the functional role of PTK7, a biomarker identified as the target protein of aptamer sgc8, in cancer cell apoptois and proliferation. Chapter 5 summarizes the overall significance and further direction of this research.

PAGE 32

32 Figure 11. Schematic representation of the cell based aptamer selection. Briefly, the ssDNA pool is incubated with target cells After washing, the bound DNAs are eluted by heating to 95C. The eluted DNAs are then incubated with negative cells for counterselection. After centrifugation, the supernatant is collected and the selected DNA is amplified by PCR. The PCR products are separated into ssDNA for the next round of selection or are cloned and sequenced for aptamer identification in the final round of selection.78 (copyright permission acquired)

PAGE 33

33 Figure 12. Anti prostatespecific membrane antigen (PSMA) aptamer mediated small interfering (si)RNA delivery. (a) Schematic of anti PSMA aptamer streptavidin siRNA conjugates. The 27mer Dicer substrate RNA duplex and RNA aptamers were chemically conjugated with a biotin group. Thus, two biotinylated siRNAs and two aptamers were noncovalently assembled via a streptavidin platform. (b) Schematic of the first generation anti PSMA aptamer siRNA chimeras. The 2 fluoromodified aptamer and siRNA sense strand were cotranscribed, followed by annealing of the complementary siRNA antisense s trand to complete the chimeric molecule. (c) Schematic of the optimized second generation chimeras. Compared with the first generation chimeras, the aptamer portion of the chimera was truncated from 71 to 39 nucleotides, and the sense and antisense strands of the siRNA portion were swapped. A 2 nucleotide (UU) overhang and a polyethylene glycol tail were added to the 3 end of the guide strand and the 5 end of passenger strand, respectively.107 (copyright permission acquired)

PAGE 34

34 CHAPTER 2 IDENTIFICATION OF LIVER CANCERSPECIFIC APTMERS USING WHOLE LIVE CELLS Introduction Hepatocellular carcinoma (HCC) is one of the most common and highly malignant cancers in the world. Despite its severity and clinical significance, there is a limited understanding of the pathogenesis. Currently, surgical resection or liver transplantation is the only effective treatment for early cancers. However, the majority of the se cancers are diagnosed at later stages when there are only a few therapeutic options with poor clinical outcomes .113 It is known that most of liver cancers arise from patients who have long standing chronic infect ion with hepatitis B virus (HBV) hepatitis C virus (HCV) or other chronic liver diseases. The carcinogenesis usually takes decades, which provides a window of opportunity to detect the cancer in its earl iest stages, a key factor for patient survival. Cur rent screening methodologies for liver cancer in at risk patients rely on measuring the serum level of alphafetoprotein (AFP), a biomarker, as well as ultrasound imaging. AFP's sensitivity and specificity are very limited since many other liver diseases c an result in a very high blood level of AFP similar to that observed in HCC. In addition, AFP is not always elevated in the early stages of cancer development, when therapy is most effective. Imaging, on the other hand, only gives limited information with morphology .114 To achieve the goal of early diagnosis, it is essential to have cancer specific biomarkers or molecular probes. Recent studies using genomic and proteomic approaches have generated a wealth of information on biomarkers.113,114 The diagnostic values of these markers remain to be investigated clinically. One limitation of these approaches is the fact that the biomarker discovery is conducted by analyzing gene expression and protein

PAGE 35

35 products out of contac t of cancer cells. Alternative approaches that identification of biomarkers in context of intact cancer cells are clearly needed. Recently, a new class of molecular probes termed aptamer s has attracted much attention as molecular probes for disease diagnosis and therapy Aptamers are singlestranded DNA (ssDNA), RNA, or modified nucleic acids. They have the ability to bind specifically to targets, which range from small organic molecules to proteins .115 The basis for target recognition is the tertiary structures formed by the si nglestranded oligonucleotides .116 A ptamers have the following attractive features: low molecular weight, easy and reproducible synthesis, high binding affinity and molecular specificity, easy modification,61,117 119 fast tissu e penetration and low toxicity ,120 tunability in binding af finity and longterm stability .115 These advantages have made aptamers excellent alternative molecular probes for biomedical studies and clinical applications. Previously, our lab had developed an effective method to generate cancer cell specific aptamers by employing the differences at the molecular level between any two cell lines .78 Using this method known as cell SELEX, we have systematically generated new probe s recognizing molecular signatures of target cells without any prior knowledge of target molecules. Using a human Tcell acute lymphoblastic leukemia cell line, CCRF CEM, as target and a human Burkitt's lymphoma cell line, Ramos, as control, we have generated a group of aptamers that specifical ly recognize leukemia cells .78 The selected aptamers can bind to target cells with an equilibrium dissociation constant (Kd) in the nM to pM range. They can specifically recognize target leukemia cells mixed with normal human bone marrow aspirates, and can also identify cancer cells closely related to the target cell line in real clinical specimens .40,78 We are also able to identify the

PAGE 36

36 target of one of the binding aptamer by using the aptamer as ligand to capture it in leukemia cell lysate.76 All of these demonstrated the great potential of the cell SELEX in cancer research and clinical applications. In previous studies, we mainly used suspension cell lines derived from different sources. However, solid tumor cells are more common in clinics. Thus, developing methods using solid tumors are needed. In this chapter, we establish a selection method for solid tumor cells (adherent cells). Using a paired noncancer liver cell line and cancer liver cell line, we have selected and validated several liver cancer specific aptamers. These aptamers have a great potential to be used for liver cancer studies and even diagnosis. Moreover, the method we developed would be a novel tool for biomarker discovery of other solid tumor cells. Materials and Methods Cell L ines and B uffers The BNL 1ME A. 7R .1 (MEAR) mouse liver hepat oma cell line and its normal counterpart BNL CL 2 (BNL) cell line, derived from Balb/cJ mice, were obtained from ATCC (Manassas, VA) and maintained in tissue culture at 37 C and 5% CO2 in Dulbeccos minimal essential medium (DMEM)/F 12 media (1:1) medium (Cellgro) supplemented with 10% Fetal bovine serum (FBS) (heat inactivated, GIBCO), 5 g/mL insulin, 5 g/mL transferin, 5 ng/mL selenium, 100 U/mL penicillin streptomycin (Cellgro), 40 ng/mL dexamethasone and 50 ng/mL EGF. Huh7 (a human Liver cancer) were cultured in Dulbeccos minimal essential medium (DMEM) (Cellgro) supplemented with 10% Fetal bovine serum (FBS) (heat inactivated, GIBCO), 5 g/mL insulin, 5 g/mL transferin, 5 ng/mL selenium, 100 U/mL penicillin streptomycin (Cellgro). CCRF CEM

PAGE 37

37 (human acute lymphoblastic leukemia), Ramos, (human Burkitt's lymphoma), Jurkat (human acute T cell leukemia), K562 (chronic myelogenous leukemia) and H23 (nonsmall cell lung cancer) were purchased from ATCC (Manassas, VA), all the cells were cultured in RPMI 1640 medium (ATCC) supplemented with 10% fetal bovine serum (FBS) (heat inactivated, GIBCO) and 100 IU/mL penicillinStreptomycin (Cellgro). Cells were washed before and after incubation with wash buffer (4.5 g/L glucose and 5 mM MgCl2 in Dulbeccos phosphate buffered saline with calcium chloride and magnesium chloride (Sigma)). Binding buffer used for selection was prepared by adding yeast tRNA (0.1 mg/mL) (Sigma) and BSA (1 mg/mL) (Fisher) into wash buffer to reduce background binding. SELEX Library and P ri mers HPLC purified library contained a central randomized sequence of 45 nucleotides (nt) flanked by 20nt primer hybridization sites (ACGCTCGGATGCCACTACAG 45nt CTCATGGACGTGCTGGTGAC). A fluorescein isothiocyanate (FITC) labeled 5 primer (5 FITC ACGCTCGG ATGCCACTACAG 3) or a tetramethylrhodamine anhydride (TMR)labeled 5 primer (5 TMR ACGCTCGGATGCCACTACAG 3); and a biotinylated (Bio) 3primer (5 Bio GTCACCAGCACGTCCATGAG 3) were used in the PCR reactions for the synthesis of doublelabeled, doublestranded DNA molecules. After denaturing in alkaline condition (0.2 M NaOH), the FITC or TMR conjugated sense ssDNA aptamer is separated from the biotinylated anti sense ssDNA strand by streptavidin coated sepharose beads (Amersham Bioscience) and used for next round selection. The selection process was monitored using flow cytometry and confocal imaging.

PAGE 38

38 SELEX Procedures The procedure of selection was as follows: ssDNA pool (200 pmol) dissolved in 500 L binding buffer was denatured by heating at 95 C for 5 min and cooled on ice for 10 min before binding. Then the ssDNA pool was incubated with BNL 1ME A.7R.1 cell monolayer in T25 flask (target cells) on ice for 30 min. After washing, the adhesive cells were scraped off and washed again. The bound DNAs wer e eluted by heating at 95 C for 5 min in 500 L of binding buffer. The eluted DNAs were then incubated with BNL CL.2 cell monolayer in 60 cm2 dish (control cells) for counter selection on ice for 1 hour. The supernatant was desalted and then amplified by PCR with FITCor TMR and biotin labeled primers (1020 cycles of 0.5 min at 94 C, 0.5 min at 58 C, and 0.5 min at 72 C, followed by 5 min at 72 C; the Taqpolymerase and dNTPs were obtained from Takala). The selected sense ssDNA is separated from t he biotinylated anti sense ssDNA strand by streptavidincoated sepharose beads (Amersham Bioscience). In the first round of selection, the amount of initial ssDNA pool was 10 nmol, dissolved in 1 mL binding buffer; and the counter selection step was elimin ated. In order to acquire aptamers with high affinity and specificity, the wash strength was enhanced gradually by extending wash time (from 1 min to 10 min), increasing the volume of wash buffer (from 1 mL to 5 mL) and the number of washes (from 3 to 5). Additionally, 20% FBS and 50300 fold molar excess 88 mer random DNA library were added to incubation solution. After 16 rounds of selection, selected ssDNA pool was PCR amplified using unmodified primers and cloned into Escherichia coli using the TA cloni ng kit (Invitrogen). Cloned sequences were determined by Genome Sequencing Services Laboratory in University of Florida. The whole procedure of cellSELEX was shown in Figure 1 1.

PAGE 39

39 Flow Cytometric A nalysis Flow cytometry is a technique for counting and examining particles and cells in the size range of 0.2 m to 15 0 m diameter. It allows simultaneous multi parametric analysis of the chemical and/or physical characteristics of up to thousands of particles or cells per second by suspending them in a stream of sheath fluid and passing them by an electronic detection apparatus flow cytometer. Inside a flow cytometer, cells or particles in suspension are drawn into a stream created by a surrounding sheath of isotonic fluid, and then pass individually through a point. At that point, the cells or particles of interest intercept a beam of monochromatic light, usually a laser light, so they scatter light and fluorochromes are excited to a higher energy state. Scattered and emitted light from cells or particles is converted to electrical pulses by optical detectors. Forward SCatter (FSC) gives information on relative size and Side SCatter (SSC) give data on relative internal complexity. Figure 2 1 is a schematic diagram of the fluidic and optical components of a flow cytometer .121 Fluorescent dyes and antibodies or aptamers conjugated to fluorescent dyes may bind or intercalate with different cellul a r components such as DNA, RNA and specific proteins on cell membranes or inside cells. When labeled cells intercept a light source, the fluorescent molecules are excited to a higher energy state. Upon returning to their resting states, the fluorochromes e mit light energy at higher wavelengths compared to excitation light source. By using multiple fluorochromes, each with similar excitation wavelengths but different em ission wavelengths different cell properties can be measured simultaneously. To monitor t he enrichment of aptamers in selected DNA pool s or to test the binding capacity of selected aptamer s, cells monolayer s were detached by non-

PAGE 40

40 enzymatic cell dissociation solution (Cellgro) and filtered with 40 m Cell Strainer (BD Falcon) then washed with w ash ing buffer FITC labeled ssDNA pool were incubated with 3 x 105 cells respectively in 200 L of binding buffer containing 20% FBS on ice for 30 min. Cells were washed twice with 0.7 ml of binding buffer (with 0.1% NaN2), and suspended in 0.3 ml of binding buffer (with 0.1% NaN2). The fluorescence was determined with a FACScan cytometer (Becton Dickinson Immunocytometry systems, San Jose, CA) by counting 40000 events. The FITC labeled unselected ssDNA library was used as negative control. The binding af finity of aptamers was determined by incubating detached BNL 1ME A.7R.1 cells (3 105) with varying concentrations of FITC labeled aptamer in 500 L volume of binding buffer containing 20% FBS on ice for 30 min in the dark. Cells were then washed twice with 0.7 ml of the binding buffer with 0.1% sodium azide, suspended in 0.4 ml of binding buffer with 0.1% sodium azide and subjected to flow cytometric analysis within 30 min. The FITC labeled unselected ssDNA library was used as negative control for the nonspecific binding. All the experiments for binding assay were repeated 24 times. The mean fluorescence intensity of target cells labeled by aptamers was used to calculate specific binding by subtracting the mean fluorescence intensity of nonspecific binding produced by unselected library DNA. The equilibrium dissociation constants (Kd) of the fluorescent ligands were obtained by fitting the fluorescence intensity of binding (Y, Bmax) and the concentration of the ligands (X) to the equation: Y=BmaxX/(Kd+X) using the SigmaPlot software (Jandel Scientific, San Rafael, Calif.).

PAGE 41

41 Confocal Imaging of C ell s Stained with A ptamer For confocal imaging, the selected ssDNA pools (200 nM) or aptamers (25 nM) labeled with TMR or FITC incubated with cell monolayer in 35 mm Glass Bottom Culture Dish (Mat Tek Corp) in binding buffer containing 20% FBS on ice for 30 min. After washing, the dishes with cells in 1 mL binding buffer were placed above a 40x objective on the confocal microscope. The imaging of cells was performed with an Olympus FV500IX81 confocal microscope (Olympus America Inc., Melville, NY). A 5 mW 543 nm He Ne laser was the excitation for TMR and a 5 mW 488 nm Ar+ laser was the excitation for FITC. The objective used for imaging was an Olympus LC Plan F1 40X /0.60 ph2 40x objective. M ice Tumor Detection by A ptamer s Balb/cJ mice, 6 8 weeks old, were purchased from the Jackson Laboratory (Bar Harber, ME) and housed in the animal facility at the University of Florida with institutional regulatory approval (Insti tutional Animal Care and Use Committee). Balb/cJ mice were inoculated with either 1 x 107 in vitro propagated BNL 1ME A.7R.1 or BNL CL.2 cells subcutaneously injected into each flank. W hen the tumors exceeded 1 cm in diameter, the tumors and normal livers were taken out. S ome tumor and normal liver tissues were formalin fixed and embedded in paraffin. Five micron sections were cut from each paraffin block and stained with hematoxylin and eosin for microscopic examination. Some tumor and normal liver tissue s w ere snap frozen in liquid nitrogen and stored at 80C. Five micron sections were cut from frozen tissue and fixed by acetone for 15 min at room temperature and incubated with the unselected ssDNA library or aptamers ( 100 nM) labeled with FITC in binding buffer containing 20% FBS at 4 C for 1 h. After washing, the slides were imaged with a confocal microscope (2 0x

PAGE 42

42 objective). The rest of tumor and liver tissues were put into a cell culture dish and cut into small pieces. T he tissue fragments were r esuspended with non enzymatic cell dissociation solution (Cellgro) and filtered with a 40 m Cell Strainer (BD Falcon ) then washed three times with wash buffer Then the isolated cells were incubated with FITC labeled aptamers (50 nM) in 200 L of binding buffer containing 20% FBS on ice for 30 min. Cells were washed twice with 1 ml of binding buffer (with 0.1% NaN2), and suspended in 0.3 ml of binding buffer (with 0.1% NaN2). The fluorescence was determined with a FACScan cytometer by counting 10 0 000 ev ents. The FITC labeled unselected ssDNA library (100 nM) was used as negative control. Results Liver Cancer C el l SELEX In liver cancer cell selection, we expanded the cell SELEX strategy to solid tumor and adherent cell lines, BNL 1ME A.7R.1 and BNL CL.2. Additionally, the relationship of thes e two cell lines was very close. BNL CL.2 is a nontumor, immortalized hepatocyte cell line derived from a Balb/cJ mouse liver. BNL 1ME A.7R.1 is a tumor cell line derived from BNL CL.2 by transformation w ith methylcholanthrene epoxide.122,123 BNL CL.2 cells do not form tumor s in Balb/cJ mice, while BNL 1ME A.7R.1 cells form tumor s in Balb/cJ mice in two to three weeks. Morphologically, the difference between these two cell lines was considered to be minor. However, biologically, the two cell lines are significantly different: only BNL 1MEA7R.1 cells produce tumor when injected into the sygenic Balb/cJ mice. Using BNL 1ME A.7R.1 as target cell line and BNL CL.2 cell line as the negative control for counter select ion, we have generated aptamers for target molecules only present on BNL 1ME A.7R.1 cells surface. The aptamers would be

PAGE 43

43 useful for diagnosis or therapy of this kind of cancer. In addition, this is an excellent model pair for the development of the cellSELEX protocol for solid tumor samples. In this selection, a single stranded DNA library that contained 45mer random DNA sequences flanked by two 20mer PCR primer sequences is used. After incubation with DNA pool and washing, the adherent cells were scraped off from the bottom of flask. Scraping was used to detach cells because it would not affect the binding of aptamers on cell membrane surfaces. The conventional detaching method by trypsin could not be used because it was demonstrated that trypsin could cleav e the proteins on the cell sur face to which aptamers bind.78 Monitoring the P rogression of A ptamer S election The progress of the selection process was monitored using confocal imaging and flow cytometry. For cell based SELEX, a flow cytometry assay is the best way to monitor the selection process because of the excellent reproducibility, a high degree of statistical precision due to the large number of cells measured, the quantitative nature of the analysis and the high speed. We have successfully applied flow cytometry to monitor the enrichment of aptamer selection process and to test the aptamer binding for suspension cells .42,78 H ere we explored the flow cytom etry for adherent cell selection. Before incubation of the cells with DNA pool or the aptamer pool we used nonenzy me cell dissociation solution (C ellgro) including EDTA to detach the adherent cells from the flask. After removing the dissociation solution, cells were resuspended in binding buffer and passed through a 40 m strainer to remove the cell clusters which would block the flow cytomet er The cells can then be treated as suspension cells for flow cytometry

PAGE 44

44 assay. For confocal imaging, cells were detected while still attached to the bottom of the dishes. With increased numbers of selection cycles, the DNA probes with better binding affinity to the target cells were enriched in the first 5 rounds. Increases in fluorescence intensity on BNL 1ME A.7R.1 cells (target cells) were o b served in flow cytometry analysis. However, there was no significant change in fluorescence intensity on BNL CL.2 cells (control cells) (Figure 2 2 A ). These results indicate that the DNA probes specifically recogniz ing cell surface markers on BNL 1ME A.7R.1 cells were enriched. The specific binding of the selected pools to the target cells was also confirm ed by confocal imaging (Figure 22 B) A fter incubation with the TMR dyelabeled aptamer pool, the BNL 1ME A.7R.1 cells showed bright fluorescence on the periphery of the cells, while the BNL CL.2 cells displayed no significant fluorescence. After 16 round of selection, the enriched aptamer pools were cloned and sequenced by the highthroughput g enome sequencing method. Ident ification of Selected Aptamers for Liver Cancer C ells About 300 clones were sequenced in our experiments. After alignment, the sequences were found to be distributed into different families based on their sequence similarities, and many repeats were observ ed in each family. Eleven sequences were chosen from different sequence families for further characterization. These sequences become the candidates as aptamers for liver cancer. To confirm whether they are indeed aptamers for liver cancer, a series of experiments were done to confirm their target binding affinity and specificity.

PAGE 45

45 The Selected Aptamers can Recognize Target Cells with High S pecificity The binding assay of these sequences was performed by flow cytometry (Figure 23 ). Seven aptamers (TLS1, TLS3, TLS4, TLS6, TLS7, TLS9 and TLS11) were found to have high affinity for BNL 1ME A.7R.1 cells with Kd in the nM range (Table 2 1) and did not show obvious binding to BNL CL.2 cells (Figure23 B ). The Kd values were analogous to those of antibodies. The full length aptamers selected from this library are 85 mer sequences. Generally, not all the nucleotides are necessary for target binding. Thus, three of these aptamers were further optimized based on the predicted secondary structure .61 The optimized aptamer s TLS1c, TLS9a and TLS11a have the same or better binding affinity to their target s compared to the original fulllength aptamer s (TLS1, TLS9, TLS11) (T able 2 1) However, their length is greatly reduced; for example, the length of optimized aptamer TLS9a is less than half of the original sequence. The shorter sequences greatly increas e the yield and decrease the cost of chemical synthesis and are therefore preferred. The specific cell recognition by the selected aptamers was further demonstrated by confocal imaging using FITC labeled aptamers. As shown in Figure 2 4 the BNL 1ME A.7R.1 cells presented very bri ght fluorescence (green) on the periphery of cells after incubation with aptamers, while the BNL CL.2 cells displayed no obvious fluorescence. None of BNL 1ME A.7R.1 and BNL CL.2 cells displayed any significant fluorescence after incubation with unselected DNA library. These results demonstrated that aptamers only recognized targets presenting on the surface of BNL 1ME A.7R.1 cells. It further implied that these aptamers would be potential molecular probes for liver cancer analysis.

PAGE 46

46 The Selected Aptamers are Effective M olecular Probes for Liver Cancer in M ice We tested whether the newly selected aptamers can recognize tumors grown inside a mouse. Total 5 Balb/cJ mice were injected with 10 million BNL 1ME A.7R.1 subcutaneously. All the mice inoculated with the cells form ed tumor s in two to three weeks (Figure 2 5 ) However, the five Balb/cJ mice inoculated with BNL CL.2 cells did not form tumors. The tumor size formed with IMEA cells ranges from 1.0 cm to 1.5 cm. Tumor tissues were removed and processed according to specific molecular analysis procedure developed in our pathology laboratory T he tumor cell recognition by aptamers was demonstrated by both confocal imaging (Figur e 2 6 ) an d flow cytometry assay (Figure 2 7 ) using FITC labeled aptamers. As shown in Figure 2 6 the frozen tumor section gave bright green fluorescence after incubation with FITC labeled aptamer TLS11a compared with FITC labeled unselected DNA library and no fluorescence signal was observed from frozen normal liver tissue sections st ained with FITC labeled TLS11a or unselected library. T he flow cytometry data (Figure 2 7 ) also demonstrated the specific binding ability of aptamers TLS9a and TLS11a to tumor cells; the cells isolated from tumor showed greatly higher fluorescence intensit y after incubation with FITC labeled aptamer TLS9a and TLS11a, respectively compared to FITC labeled unselected DNA library. The isolated normal liver cells did not show obvious fluorescence enhancement after incubation with aptamers compared to unselected DNA library. These results clearly indicated that the selected aptamers were highly specific to the tumor cells and did not bind to the cells in normal liver tissue. They showed promise as specific molecular probes for liver cancer recognition and analysi s.

PAGE 47

47 To further test the specificity of these aptamers, FITC l abeled aptamers were incubated with different kinds of cells and then test ed by flow cytometer. As shown in T able 22 all of the aptamers did not bind to human leukemia cells, lymphoma cells bes ides the control cells, BNL CL.2. Most of the aptamer except aptamers TLS1 and TLS11 did not bind to human lung cancer cell line H23 or the human l iver cancer cell line, Huh7. This indicated that some of the aptamers are specific to the target cells, BNL 1ME A.7R.1 cells, and their targets are only highly expressed on BNL 1ME A.7R.1 cells These aptamers could be important molecular probes for the recognition of biomarkers for liver cancer diagnosis and studies. Aptamer TLS1 slightly bo u nd to H23 and Huh7. Aptamer TLS11 bou nd slightly to H23 and strongly to human liver cancer cell line, Huh7. Because aptamer TLS1 and TLS11 did not bind to cells in normal liver tissue and suspended tumor cells, such as leukemia and lymphoma, they would bind to the cell surface targets related to solid tumor. It indicated that their target molecules would provide useful information for explaining the mechanism of oncogenesis Discussion Liver cancer is one of the most common malignancies in the world and unfortunately there are few clinical options for patients who have this disease, because most patients are diagnosed at late stages. The urgent task for liver cancer research is to develop novel molecular approaches to diagnose this cancer early. E vidence su pports th at liver cancer undergoes multiple steps during its development 124 126. During this process, there are genetic changes that affect the cell proliferation and apoptosis. Thus, the prevailing view is that biomarkers can be identified for liver cancer diagnosis. Recent work with cDNA microarray and proteomics indeed provide arrays of protein markers that are potentially appli cable for liver cancer diagnosis and therapy 127-

PAGE 48

48 129. However, the identification of a true biomarker for liver cancer studies is still a major difficulty. In our study, we adopted a novel approach to identif y biomarkers for liver cancer. Aptamer technology has been used for proteinprotein interaction research and for molecular recognition. It is a robust technology to identify unknown targets. We hypothesized that aptamer binding principle s can be applied for cancer biomarker identification. The study we did with human leukemia cells provided the proof of concept of aptamer technology. However, the technology was using flow cytometric analysis, which is feasibl e with suspension tumor cells. It was unknown whether the similar approach could be adopted for solid cancers, which usually attach to the cultur e surface. The current report provides convincing evidence of cellSELEX as a tool to solid tumors. For proof of concept, we decided to use murine cell lines, because of their availability in our laboratories. T his pair of positive and negative cells prov ides significant advantages for our purposes in this study: the generation of aptamers that can be used to distinguish liver cancer cells. The BNL cell lines are a paired cell line derived from the same mouse; these two cell lines have a distinctive biolog ical phenotype; one is a cancer cell line and the other is not. The MEAR cells can form a tumor in Balb/c mice within 3 weeks, which is an excellent model for validating the aptamer markers in vivo Our results clearly show that specific cancer cell specif ic aptamers are identified (i. e. TLS9a and TLS11a in Figure 23 ). We found that the binding affinity is promising for potential diagnostic applications. We tested these aptamers using

PAGE 49

49 immunofluorescence studies. The data suggested that they could specific ally react with cancer cells, either in homogenous state or mi xed with other cells (Figure 24 and Table 2 2). Since one of the eventual applications of aptamers is in vivo diagnosis, we therefore injected BNL 1ME A.7R.1 cells into Balb/c mice. Using labeled aptamers, we found that these aptamers could only bind to tumor cells, not normal mouse hepatocytes. These results strongly support the potential of these aptamers for future in vivo applications. The cellSELEX process allows the selection of highly specific aptamers with high binding affinities without prior knowledge of any biomarkers or proteins on the cell surfaces. While it has been established that the understanding of the molecular nature of diseases is vital to medicine from detection to treat ment of the disease, exploiting this has been undermined from an incomplete understanding of the biomolecular processes that cause the diseases. It is from these biomolecular processes that would allow detection, diagnosis, and treatment of the disease. Th e cellSELEX process allows for aptamers to be selected from diseased cells in their native disease state. Thus, diseases can be detected and treated with aptamers without any knowledge of the molecular processes of the disease. This represents a shift in the paradigm of medical research in which new probes and techniques can be developed regardless of the level of knowledge or understanding of the disease. Conclusion In summary, our results demonstrat e that cell SELEX can produce a group of cell specific aptamers for adherent cells. The selection process is reproducible, simple, and straightforward. Using the modified strategy for adherent cells, we have successfully

PAGE 50

50 generated seven effective aptamers for the liver cancer cell line, BNL 1ME A.7R.1 with Kds in the nanomolar range. Flow cytometry assay s and confocal imaging show that the selected aptamers not only recognize the target liver cancer cells specifically but also d o not bind to its parent liver cells, BNL CL.2. Most of the selected aptamer s also do not recognize other cell lines, such as human leukemia cell lines, lymphoma cell line, and lung cancer cell line. The cell SELEX shows that the newly generated aptamers could be excellent molecular probes for liver cancer analysis and diagnosis. The close relationship between BNL 1ME A.7R.1 cells and BNL CL.2 cells indicated that cellSELEX can be used to identify minor molecular level differences among cells. It further indicates that the target molecules would be spec ific biomarker s for this kind of liver cancer, and would provide useful information for explaining the mechanism of oncogenesis O ur study establishes cell SELEX as a great tool for the generation of effective molecular probes for clinically meaningful analysis.

PAGE 51

51 Figure 21 Schematic of a flow cytometer. A single cell suspension i s hydrodynamically focused with sheath fluid to intersect an argonion laser. Signals are collected by a forward angle light scatter detector, a sidescatter detector ( 1 ), and multiple fluorescence emission detectors ( 2 4 ). The signals are amplified and converted to digital form for analysis and display on a computer screen.121 (copyright permission acquired)

PAGE 52

52 Figure 2 2 Binding assay of selected pool with BNL 1ME A.7R.1 and BNL CL.2 cells A: Flow cytometry assay to monitor the binding of selected pool with BNL 1ME A.7R.1 cells (target cells) and BNL CL.2 cells (control cells). The red curve represents the background binding of unselected DNA library. For BNL 1ME A.7R.1 cells, there wa s an increase in binding capacity of the pool as the selection wa s progressing, while there wa s little change for the control BNL CL.2 cells. The final concentration of selected pool in binding buffer was 200 nM B: Confocal imaging of cells stained by the 14th round selected pool labeled with t etramethylrhodamine dye molecules. Top left: image of BNL CL.2 cells after incubated with DNA library; top right: image of BNL 1ME A.7R.1 cells after incubated with DNA library. Bottom left: image of BNL CL.2 cells after incubated with 14th round selected pool; bottom right: image of BNL 1ME A.7R.1 cells after incubated with 14th round selected pool. In each picture, left is the fluorescence image, right is the overlay of fluorescence image and optical image.

PAGE 53

53 Table 2 1 Sequences and Kds of selected aptamers for liver cancer. Aptamers S equences K d s (nM) TLS1 ACGCTCGGATGCCACTACAG GAGTGATGGTTGTTATCT GGCCTCAGAGGTTCTCGGGTGTGGTCA CTCATGGACGT GCTGGTGAC 10.340.96 TLS1c ACAG GAGTGATGGTTGTTATCTGGCCTCAGAGGTTCTC GGGTGTGGTCA CTCCTG 9.790.30 TLS3 ACGCTCGGATGCCACTACAG TGGGAATATTAGTACCGT TATTCGGACTCCGCCATGACAATCTGG CTCATGGACGT GCTGGTGAC 10 .91.8 TLS 4 ACGCTCGGATGCCACTACAG ACGGTGGTCGTACACGG CCATTTTATTCCCGGAATATTTGTCAAC CTCATGGACGT GCTGGTGAC 33.92.3 TLS6 ACGCTCGGATGCCACTACAG ATACGGCCTGGGTCTTTA TTCGCCCCGAATATTTCTTAACGTCGG CTCATGGACGT GCTGGTGAC 157.016.9 TLS7 ACGCTCGGATGCCACTACAG TGCGCCCAAAGTTCCCAT ATTGCTTCCCTGTTGGTGAGTGCCGAT CTCATGGACGT GCTGGTGAC 68.17.6 TLS9a AGTCCATTTTATTCCTGAATATTTGTTAACCTCATGGAC 7.380.28 TLS11a ACAGCATCCCCATGTGAACAATCGCATTGTGATTGTTAC GGTTTCCGCCTCATGGACGTGCTG 4.510.39 The fixed regions of original aptamer are denoted in underline

PAGE 54

54 Figure 23 A. Flow cytometry assay for the binding of the FITC labeled sequence aptamer TLS9a and TLS11a with BNL 1ME A.7R.1 cells (target cells) and BNL CL.2 cells (control cells). The red curve represents the background binding of unselected DNA library. The concentration of the aptamers in the binding buffer was 20 nM. B: Using flow cytometry to determine the binding affinity of the FITC labeled aptamer sequence TLS11a to BNL 1ME A.7R.1 cells. The nonspecific binding was measured by using FITC labeled unselected library DNA.

PAGE 55

55 Figure 24 Fluorescence confocal images and optical images of (A) BNL 1ME A.7R.1 cells and (B) BNL CL.2 cells stained by unselected library (top), aptamers TLS9a (middle) and TLS11a (bottom) labeled with FITC. In each picture, L eft is the fluorescence images and Right is the optical images for BNL 1ME A.7R.1 cells and B NL CL.2 cells respectively.

PAGE 56

56 Figure 2 5 M icroscopic examination of the formation of tumors. F ormalin fixed n ormal (A) liver tissues and (B) tumor tissue embedded in paraffin were stained with hematoxylin and eosin.

PAGE 57

57 Figure 2 6 Fluorescence confocal images and optical images of (A) frozen tumor sections and (B) frozen normal liver sections stained by unselected library (top), aptamers TLS11a (bottom) labeled with FITC. In each picture, L eft is the fluorescence images and Right is the optical images respectively.

PAGE 58

58 Figure 2 7 Flow cytometry assay for the binding of the FITC labeled sequence aptamer TLS9a and TLS11a (50 nM) with isolated (A) tumor cells and (B) normal liver cells The red curve represents the background binding of unselected DNA lib rary (50 nM)

PAGE 59

59 Table 22 Aptamers binding to different kinds of cell lines Cell Line TLS1 TLS3 TLS4 TLS6 TLS7 TLS9 TLS11 BNL 1ME A.7R.1 ( M ouse) ++++ ++ ++ ++ ++ +++ ++++ BNL CL.2 ( M ouse) CCRF CEM(leukemia, Human) Ramos(Lymphoma, Human) Jurkat(leukemia, Human) K562 (leukemia, Human) H23(lung cancer, Human) + + Huh7(Liver cancer, Human) + ++ A threshold based on fluorescence intensity of FITC in the flow cytometry analysis was chosen so that 95 percent of cells incubated with the FITC labeled unselected DNA library would have fluorescence intensity below it. A fter binding with FITC labeled aptamer, the percentage of the cells with fluorescence above t he set threshold was used to evaluate the binding capacity of the aptamer to the cells. : <10% +: 1035%, ++: 35 60%, +++: 60 85%, ++++: >85%; the final concentration of aptamer in binding buffer is 100 nM

PAGE 60

60 CHAPTER 3 TARGETING DELIVERY OF CHEMOTHERAPY AGENTS BY A CANCER SPECIFIC APTAMER Introduction The major problem s associated with traditi onal cancer chemotherapy are caused by side effects when the drugs non specifically target normal cells, often killing them. Non targeted chemotherapy agents can and often do cause lifethreatening toxicity effects for patients undergoing chemotherapy treatment. Patients are given the highest dose of these nontargeted drugs which can be tolerated. To overcome this problem and achieve specif ic drug delivery, our group and other investigators have used antibodies130,131 or aptamers89,93,95,98,132,133 to design ligand linked drug conjugates for targeteddelivery applications. Aptamers are singlestranded oligonucleotides which can specifically bind to small molecules,134 peptides and proteins.135 Aptamers not only provide the advantages of antibodies, such as high specificity and affinity, but they also have low immunogenicity, and are stable and easy to synthesize and modify. Recently, a process called cell SELEX ( s ystematic e v olution of l igands by ex ponential enrichment) has been developed to generate aptamers for specific recognition of target cancer cells, including Tcell acute lymphoblastic leukemia (Tcell ALL), smallcell lung cancers, liver cancers and virus infected cel ls. 4143,49,57,58,78 These aptamers are highly specific for different types of tumor cells and have excellent binding affinities. Because aptamers provide specificity at the molecular level, it is believed that aptamer drug conjugates may enhance the efficiency of drug delivery and decrease systemic toxicity. Hepatocellular carcinoma (HCC) is recognized as one of the most common and deadly cancers in the w orld. Currently, treatments for early liver cancer have relied on

PAGE 61

61 liver transplantation and surgical resection. Traditional chemotherapy has not been efficient on liver cancer patients and the traditional chemotherapeutic agents are not specific for liver tumor cells, leading to toxic side effects. In Chapter 2, we reported the development of a series of specific aptamers based on a mouse model.41 O ne of these aptamers can also specifically rec ognize human liver cancer cells. This chapter details the use of this aptamer for the targeted delivery of Doxorubicin (Dox) to liver cancer cells. Doxorubicin (Dox) a topoisomerase inhibitor, is a widely used drug for the treatment of liver cancer, but its efficacy is impeded by toxic side effects. This problem can be overcome by conjugating Dox into an aptamer probe. Dox is known to intercalate into the DNA strand due to the presence of flat aromatic rings in this mol ecule. Recent research has shown that Doxorubicin can intercalate into aptamer A10 to provide specific killing efficiency to prostate cancer cells.93,97 Aptamer TLS11a was previously selected by cell SELEX against the BNL 1ME A.7R.1 (MEAR) mouse hepatoma cell line41 and described in chapter 2 It was chosen for this application because it showed great binding affinity for LH86 established from a patient with liver cancer.136 In order to achieve greater intercalation efficiency, a long GC tail was added to TLS11a to form a modified aptamer, TLS11aGC. T hrough the interaction, the ratio between Doxorubicin and TLS11a GC was 25:1, so the delivery efficiency of Doxorubicin was much higher compared to the original TLS11a. Also, in vitro and in vivo experiments showed TLS11aGC Dox conjugates have much better specific killing efficiency for target cancer cells compared to free Dox and control aptamer Dox conjugates.

PAGE 62

62 Materials and Methodology Cell Culture and R eagents The liver cancer cell line, LH86, was derived from resected well differentiated hepatocellular carcinoma tissue with adequate patient consent. Tumor tissue was first rinsed with phosphatebuffered saline (PBS) and minced into small pieces. The tissue fragments were then digested with liver digestion medium (Invitrogen, Carlsbad, CA). Single tumor cells were cultured in Dulbeccos modified Eagle medium (DMEM) with 10 ng/mL human epithelial growth factor (EGF). One clone survived in a longterm culture, this clone became the LH86 cell line .136 LH86 cells were cultured in DMEM supplemented with 10% fetal bovine s erum (FBS) (heat inactivated) and 100 IU/mL penicillin streptomycin at 37C in a humid atmosphere with 5% CO2. Doxorubicin hydrochloride (Dox) was purchased from Fisher Scientific (Houston, TX, USA). All reagents for DNA synthesis were purchased from Glen Research. Unless otherwise noted, reactants buffers and solvents were obtained commercially from Fisher Scientific. Conjugation of A ptamer Dox The sequences of aptamer TLS11a, a control sequence TD05, modified aptamer TLS11A GC and modified control sequence TD05GC are shown in table 31. A ll DNA aptamers were synthesized on an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA, USA). The completed sequences were then deprotected in AMA (ammonium hydroxide/40% aqueous methylamine 1:1) at 65C for 30 min and further purified by reversedphase HPLC (ProStar, Varian, Walnut Creek, CA, USA) on a C 18 column. To make aptamer Dox conjugates, TLS11aGC or TD05GC was mixed with

PAGE 63

63 Doxorubicin in binding buffer (PBS containing 5 mM MgCl2, 4.5 mg/mL glucose, 0.1 mg/mL yeast tRNA, 1 mg/mL BSA) or DMEM medi a at 1:25 aptamer:Dox ratio. Determination of Aptamer Affinity The binding affinity of aptamer TLS11a was determined using flow cytometry. T he LH86 cells were detached from dishes using nonenzymatic cell dissociation solution (Cellgro) and then washed with washing buffer (PBS containing 5 mM MgCl2, 4.5 mg/mL glucose). The binding affinity of TLS11a was determined by incubating LH86 cells (105 cells ) on ice for 30 min with a series of concentrations of biotin labeled TLS11a in binding buffer (100 mL). Cells were then washed twice with washing buffer (1.0 mL) and suspended in fluoresceinlabeled streptavidin (0.1 mL) for further incubation (15 min on ice). Before flow cytometric analysis, cells were was hed with washing buffer twice and suspended in washing buffer (0.2 mL). The mean fluorescence intensity of cells was used to calculate the equilibrium dissociation constant (Kd) of TLS11a and LH86 cell interaction by fitting a plot of fluorescence intensit y (F) on the concentration of the biotin labeled TLS11a (L) to the following equation: F = Bmax [L ]/(Kd + [L ]) Where F, Bmax, [L] and Kd represent fluorescence intensity, the maxi m um fluorescence intensity, the dissociation constant and the concentration of biotin labeled TLS11a, respectively The binding assay experiments were repeated at least three times. To monitor the binding affinity of TLS11GC, a competition experiment was carried out. Briefly, 200 nM TLS11aGC was incubated with LH86 cells for 20 min on ice, and then 1 M biotinlabeled TLS11a was added for 15 min further incubation. Cells were then w ashed twice with washing buffer (1.0 mL) and suspended in fluorescein labeled streptavidin (0.1 mL) for further incubation (15 min on ice). Before flow cytometric

PAGE 64

64 analysis, cells were washed with washing buffer twice and suspended in washing buffer (0 .2 mL ). Confocal Microscopy of Cultured Cells The binding of TLS11a with LH86 cells was then assessed by confocal microscopy Here, LH86 cells were seeded in a 35mm P etri dish, 10 mm microwell (MatTek Corporation) and cultured overnight. The cells showing more than 60% confluence were carefully washed and then incubated with the biotin labeled TLS11a or control TD05 at a final concentration of 200 nM. After incubation at 4C for 30 min, cells were carefully washed before further incubation with a 1:200 dilution (optimized) of streptavidin conjugated Alexafluor 633 (Invitrogen) for 15 min. Excess probes were removed by washing off and the signal was detected by confocal microscopy (FV 500IX81 confocal microscope, Olympus America Inc., Melville, NY), using a 40x oil immersion objective (NA=1.40, Olympus, Melville, NY). A 633 nm laser line was used for e xcitation and the emitted light was passed through a LP650 filter prior to detection. For the internalization study, a co localization experiment was carried out. As described above, LH86 cells were first incubated with biotin labeled TLS11a or TD05 and then future incubated with a 1:400 dilution (optimized) of streptavidin conjugated PEC y5.5 (Invitrogen). After washing, DMEM media with 1:1000 dilution of LysoSensor Green DND 189 (Invit rogen) was added to the dishes. After incubation at 37C for 2 h, cells were w ashed twice with washing buffer, and the fluorescence signal was detected by confocal microscopy A 488 nm laser line was used for excitation and the emitted light was passed through a LP 515 filter prior to detection.

PAGE 65

65 Protease Assay E xtracellular membrane proteins are common target s of cell SELEX as demonstrated by many cell SELEX schemes. In this work, protease assays was performed to determine the type of surface molecules that the aptamers bind. LH86 cells were dissociated with nonenzymatic dissociation solution. The cells were washed twice with washing buffer and incubated wit h trypsin (Cellgro) solution (0.05% trypsin/0.53 mM EDTA in HBSS) for 10 min at 37C. After incubation, ice cold washing buffer containing 20% FBS was added to halt the protease activity. Cells were quickly centrifuged at 1000 rpm for 5 min and washed twice with washing buffer. The cell pellets were incubated with aptamers in a binding buffer and then the signal was detected by flow cytometry. Monitoring of Complex Formation by Fluorescence Physical conjugates between aptamer (TLS11a or TD 05) and Doxorubicin were fluorescence was monitored at 500720 nm (1.5 mm slit) on a FluorologTau3 Spectrofluorometer (Jobin Yvon) with excitation at 480 nm. Assessme nt of Cell ular U ptake of Dox by Confocal M icroscopy The cellular uptake of Dox was assessed by confocal microscopy. LH86 cells were seeded in a 35 mm P etri dish, 10 mm microwell (MatTek Corporation) and cultured overnight. The cells showing more than 60% c onfluence were carefully washed and then incubated with Dox or aptamer Dox conjugates in DMEM media (without FBS) at 37C for 1 h. T he concentration of Dox in all samples was kept constant at 7.5 M. After washing once using media, fresh media was added to the dis hes for further incubation at 37 C. for 3 h; t hen, the dishes with cells were placed above the 40 objective of an

PAGE 66

66 Olympus FV500IX81 confocal microscope (Olympus America Inc., Melville, NY). A 5mW, 488nm Ar+ laser was the used for excitation of Dox. The objective used for imaging was an Olympus LC Plan F1 40X/0.60 PH2 40 objective. MTS Cell Viability A ssay Chemosensitivity of LH86 to Dox or aptamer Dox conjugates was determined using the CellTiter 96 cell proliferation assay (Promega, Madison, W I, USA). Briefly, a 104 cells/mL) were seeded in 96 well plates ( n =3) and allowed to grow overnight. They were then treated for 1 h one of the following: 1) control aptamer TD05GC; 2) aptamer TLS11aGC; 3) Do x; 4) TD05GC Dox physical conjugate (25:1 Dox orubicin to TD05GC mole ratio); or 5) TLS11aGC Dox physical conjugate (25:1 Doxorubicin to TLS11a mole ratio). The cells were washed, and further incubated in fresh media for a total of 48 hrs. For cytotoxici ty measurement s, media was removed from each well. Then CellTiter reagent (20 L) and media (100 L) were added to each well and incubated for 3 h. Using a plate reader (Tecan Safire microplate reader, AG, Switzerland), the absorption was recorded at 490 n m. The percentage of cell viability was determined by comparing Dox and aptamer Dox conjugatetreated cells with the untreated control. Hoechst 33258 Staining for Apoptotic C ells Cell apoptosis was determined by nucleus morphology change. LH86 cells in exp onential growth were placed in a 48well plate at a final concentration of 1.5 104 cells per well. After 12 h, cells were treated with different concentrations of TD05GC Dox physical conjugate (25:1 Doxorubicin to TD05GC mole ratio) or TLS11aGC Dox physical conjugate (25:1 Doxorubicin to TLS11a mole ratio) for 1 hour, washed, and further incubated in fresh media for a total of 48 hrs. Subsequently, cells were washed

PAGE 67

67 twice with PBS, and stained with Hoechst 33258 staining solution according to the manuf acturers instructions. After incubation at 37 C for 10 min, cell nucleus fragmentation/condensation was detected by fluorescence microscopy. Apoptotic cell death was assessed by calculating the number of apoptotic cells with condensed nuclei in six to ei ght randomly selected areas. The results presented below represent three independent experiments. Western Blotting A nalysis Cells were harvested and washed twice with phosphate saline buffer. The cell pellets were resuspended in lysis buffer containing Nonidet P 40 ( 10 mM (4 (2 hydroxyethyl) 1 piperazineethanesulfonic acid (HEPES) pH 7.4, 2 mM ethylene glycol tetraacetic acid ( EGTA) 0.5 % Nonidet P 40, 1mM NaF, 1 mM NaVO4, 1 mM aprotinin, and leupeptin) and incubated on ice for 30 min. After centrifugation at 12000g at 4C for 15 min, the supernatant was transferred to a fresh tube, and the were subjected to SDS PAGE on 12% gels. The proteins were transferred onto nitrocellulose membranes and probed with the indicated primary antibodies (cleaved caspase3 antibody, Cell S ignaling), followed by the appropriate secondary antibodies conjugated w ith horseradish peroxidase (HRP, Santa Cruz Biotechnology, Inc.). Immunoreactive bands were detected using enhanced chemiluminescence (ECL, Pierce). The molecular sizes of the proteins detected were determined by comparison with prestained protein markers (Bio Rad). All band densities were calculated using ImageJ software.

PAGE 68

68 I n vivo E xperiment s of DoxTS11a Conjugates The NOD. Cg Prkdc (scid) IL2 mice were purchased from the Jackson Laboratory (Bar Harber, ME) and housed in the animal facility at the University of Florida with institutional regulatory approval (Institutional Animal Care and Use Committee). Forty NOD. Cg Prkdc ( scid) IL2 mice were subcutaneously injected with 7 x 106 in vitro propagated LH86 cells. When the tumors could be easily seen and measured, mice were divided into four groups: (1) group 1, untreated; (2) group 2, treated with free Dox; (3) group 3, treated with TLS11aGC DOX complex; (4) group 4, treated with TD05GC DOX complex. The Dox dosage was kept the same in groups 2, 3 and 4 at 2 mg/kg. All treatments continued for 12 days. Drugs were injected through tail vein on days 1, 2, 3, 4, 5, 9, 10, 11, and all samples were collected on day 12. The tumor size for each mouse was measured every other day. Heart, lung, liver, kidney and tumor of each mouse were collected on day 12 and fixed using 10% formalin for 24 h at room temperature, and then hematoxylin and eosin staining (H&E staining) was carried out. Results Binding Affinity of A ptamer TLS11a Aptamer TLS11a (Figure 31 A ) was generated against the BNL 1ME A.7R.1 (MEAR) mouse hepatoma cell line41 and showed strong binding affinity (Kd= 4.510.39 nM). 41 The LH86 cell line was established from a patient with liver cancer.136 When TLS11a was used to test LH86 cells, obvious bindi n g ability was observed (Figure 31 B ). Also, human normal liver cells, Hu1082, were tested using TLS11a and no significa nt binding was observed (Figure 31 C). In Figure 1 the green histogram shows the background binding (control aptamer, TD05), and the red fluorescence intensities show the binding of TLS11a with target and control cells. Compared to the control

PAGE 69

69 aptamer, there is a significant difference between the binding strength of TLS11a to LH86 and to Hu1082 cells. There is no probe that has been previously reported to differentiate between liver cancer cells and human normal liver cells. Also, the Kd of TLS11a to LH86 was 7.16 0.59 nM (Figure 32 ) compared to 4.51 0.39 nM to BNL 1ME A.7R.1.41 Immunohistological imaging and fluorescence microscopy have been widely used in the study of solid tumors, so we also assesse d whether TLS11a can be used for tumor imaging with LH86, the positive cell line. In this study, we performed binding assays in culture dishes with cell confluency of over 60%. After washing, the signal was detected with streptavidinalexafluor 633. Figure 3 1 D shows the confocal images of LH86 detected with TLS11a and a control sequence, TD05. There was significant signal strength of TLS11a com pared with negative control, and t he signal pattern shows that the aptamers bind to the surface of the cells Prel iminary Determination of Aptamer Target Molecule It is usually assumed that aptamers selected against cell lines bind to cell membrane proteins. This has been demonstrated in most of the SELEX protocols involving tumor cell lines.76,77 In order to investigate the target molecule of TLS11a, we performed a protease assay in which LH86 cells were treated with trypsin for 10 min at 37C. After the incubation period, the protease activity was stopped with the addition of ice cold PBS containing 20% FBS. The cells were quickly washed twice by centrifugation and then incubated with the aptamers. As shown in Figure 33 TLS11a lost recognition for trypsin treated cells. The fluorescence signals reduced to the background indicating that the treatment of the cells with the proteases caused

PAGE 70

70 d igestion of the target protein, showing that the target molecule of TLS11a is a membrane protein. An internalization assay was then performed to see if TLS11a can be internalized when it binds to the target. LH86 cells were first incubated with biotin labeled TLS11a or TD05 and then further incubated with streptavidin conjugated PECy5.5. The binding event was observed by c onfocal microscopy (Figure 31 D ). TLS11a bound the outer margins of the cell indicating that it is binding to molecules on the cell surface. Then the buffer was removed and culture medium with of LysoSensor Green DND 189 ( ex c=443 nm, em=505 nm) was added to the cells and incubated at 37C for two hours. The LysoSensor dyes which act as fluorescent pH indicator s, are acidotropic probes that appear to accumulate in acidic organelles (lysosome) as the result of protonation. This protonation also relieves the fluores cence quenching of the dye by its weak base side chain, resulting in an increase in fluorescence intensit y. So LysoSensor served as an indicator of the lysosome location in the cells. As shown in Figure 34 there was clear internalization of the aptamer. The TLS11a signal was inside the cells rather than on the outer margins and it colocated with LysoSensor The control sequence did not show any signal in both 4C and 37C assays. The results suggest that TLS11a may be binding to a protein that can be internalized. Conjugation of Aptamer Dox C omplex Dox is known to intercalate within the DNA strand due to the presence of flat aromatic rings, and it preferentially binds to doublestranded 5 GC 3 or 5 CG 3 sequences.137,138. The secondary structure of TLS11a, predicted by NUPACK software ( http://www.nupack.org/ ), is shown in Fi gure 31 According to the structure, there are two 5 GC 3 or 5 CG 3 sequences in the TLS11a sequence, so that one TLS11a

PAGE 71

71 sequence could intercalate a maximum of two Doxorubicin molecul es. In order to intercalate more Doxorubicin molecules, a long GC tail was added to the 5 end of TLS11a to generate a modi fie d aptamer, TLS11aGC (Figure 35 ). Because of the long GC tail, TLS11aGC forms a dimer structure. Nupack calculation indicated that one TLS11aGC dimer can intercalate up to 56 Doxorubicin molecules to produce a TLS11aGC to Doxorubicin ratio of 1:28. A control aptamer sequence, TD05, was also modified with a long GC tail to make the same aptamer to Dxorubicin ratio (Figure 35 ). Ev en though the TLS1aGC and TD05GC dimers can intercalate up to 28 Dox per aptamer, in these experiments the ratio between aptamer and Doxorubicin was kept at 1:25. It is well known that Dox has fluorescence properties but the intercalation of Dox into D NA aptamer quenches the fluorescence of Dox because of the formation of chargetransfer complexes between the DNA bases and the anthracycline ring.139141 To examine whether such interaction occurs with modified TLS11aGC and TD05GC aptamers, fluorescence was acquired for Dox in the absence and in the presence of one of the aptamers (Figure 36 ). The solution of free Dox had the highest fluorescence signal compared to the black group (binding buffer). When modified aptamer (TLS11aGC or TD05GC) was added to Dox solution at 1:28 ratio and mixed well, the fluorescence dramatically decreased almost to the background level, indicating that the intercalation of Dox into DNA aptamer is feasible and rapid. Even after the aptamer Dox complex solution was kept at room temperature for 3 h, the fluorescence stayed the same, indicating that the aptamer Dox complex is very stable.

PAGE 72

72 Characterization of Aptamer Dox C omplexes The binding affinity of TLS11aGC was determined by a competition assay After incubating with unlabeled TLS11a GC, the binding sites on LH86 cells were completely occupied. Then all cells were further incubated with dye labeled TLS11a. Because all binding sites on the cell membrane were oc cupied by unlabeled TLS11aGC, dye labeled TLS11a could not bind to LH86 cells, and after washing, no fluorescence signal was detected (Figure 37 A ). At the same time, a competition experiment between TD05GC and dye labeled TLS11a was carried out. Becaus e TD05 GC did not bind to LH86, the binding sites were available for interaction with dyelabeled TLS11a, resulting in a high fluorescence signal (Figure 37 B ). The flow cytometry data clearly showed that, after modification with the long GC tail, TLS11aGC could still bind to LH86 cells, while TD05 GC could not bind to LH86. Dox internalization and release was investigated using confocal microscopy. After 1 h incubation with Do x or aptamer Dox conjugates, cells were further incubated for 3 h a t 37C before imagin g. Figure 38 showed that cells treated with free Dox had the most Dox in their nuclei, while the nuclei for cells treated with TLS11aGC Dox c onjugates also contained Dox. However, the nuclei of cells treated with TD05 GC Dox conjugates contained almost no Dox. This experiment confirmed that TLS11aGC Dox conjugates had specific binding affinity to LH86 cells compared to TD05GC Dox conjugates. Furthermore, Dox could be released from TLS11aGC Dox conjugates after internalization and could enter t he nucleus. Cell Toxicity of Aptamer Dox C onjugates The cell viability of LH86 treated with either TLS11aGC Dox, TD05 GC Dox, Doxorubicin, TLS11aGC, or TD05 GC was tested and compared to that of untreated

PAGE 73

73 cells (Figure 39 A). The Dox concentration in TLS11aGC Dox, TD05 GC Dox, and free Dox was kept at 7.5 M, and the ratio of Doxorubicin to aptamer was 25:1. The aptamer co ncentration in the TLS11aGC, TD05GC, TLS11aGC Dox, and TD05GC Dox groups was kept at 300 nM Cell viability was tested by MTS ass ay, which is a colorimetric method for measuring the activity of enzymes that reduce MTS (3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulfophenyl) 2H tetrazolium a yellow color ), in the presence of phenazine methosulfate ( PMS), to produce a formazan product (a purple color) that has an absorbance maximum at 490500 nm.142 The main application of MTS is to assess the cell viability and proliferation. F rom the data shown in Figure 39 TLS11aGC and TD05GC had no significant effect on cell viability. And it is obvious that treatment with TLS11aGC Dox conjugates decreas ed cell viability. The efficiency of cell toxicity was Dox > TLS11aGC Dox > TD05GC Dox. Even though the cell toxicity of TLS11aGC Dox was less than that of free Dox, the toxicity effect of TD05GC Dox was much poorer. Further experiments using Hu1229 hu ma n normal liver cells (Figure 39 B ) showed that free Dox had significant toxicity, while TLS11aGC Dox and TD05GC Dox had similar and very limited toxicity. These data demonstrate the specific toxicity of TLS11aGC Dox to target cells only, achieved bec ause of the specificity of aptamer TLS11aGC to LH86 cells. Cell apoptosis was investigated using Ho echst 33258 ( exc=350 nm and em=461 nm) staining (Figure 310 A ). Hoechst 33258 is a fluorescent stain for label ing DNA in live or fixed cells. From the fl uorescence images, when the Dox concentration was 60 M, there were more apoptotic and dead cells in the TLS11aGC Dox group (35.1%) than in the TD05GC Dox group (13.7%), further indication of the specificity of aptamer -

PAGE 74

74 Dox conjugates. In additions caspase 3 activation was monit ored using western blot (Figure 310 B ). The caspase 3 protein is a member of the cysteineaspartic acid protease ( caspase) family. Caspase 3 plays an important role in cell apoptosis and cleaved caspase 3 indicates the activation of caspase 3. Caspase3 is activated in the apoptotic cell both by extrinsic ( death ligand) and intrinsic (mitochondrial) pathways.143,144 From the data shown, when the Dox concentration was 60 M, the band density of cleaved caspase 3 in cells treated w ith TLS11aGC Dox was 3.3 times higher than in cells treated with TD05GC Dox. I n vivo S tudies Forty NOD Cg Prikdc (sccd) IL2 mice were treated as described in the experiment al section. The tumor size of each mouse was measured every other day and the average tumor v olume was calculated (Figure 311 A ). The data show s that free Dox, TLS11aGC DOX complex and TD05GC DOX complex all had significant tumor inhibition compared to the untreated group. And TLS11aGC DOX complex had the most efficient effect comp ared to free Dox and TD05GC DOX, indicating that TLS11aGC Dox conjugates targeted the tumor cells and achieved higher local Dox concentration in the tumor site compared to free Dox and TD05GC Dox. Also, tumors of each mouse were collected and fixed usin g 10% formalin for 24 h. Then all samples were sent to the molecular pathology core lab for hematoxylin and eosin stain ing ( H&E staining) H&E is the most widely used staining method in histology, hemalum stains the cell nuclei blue and eosin colors other structures various shades of red, pink and orange. From the H&E stained slides, the TLS11aGC DO X c omplex treated tumor (Figure 311 B right) showed significant tumor cell necrosis compared to the untreated tumor (Figure 311 B left).

PAGE 75

75 Discussion TLS11a w as generated using mouse liver cancer cells but it also binds human liver cancer cel l s with high affinity Meanwhile, it is the first aptamer to be identified as specific for human liver cancer cells. Our results showed that the target molecule of TLS11a is very likely a membrane protein which can be internalized into cells. These results indicate TLS11a may be a useful apt a mer for targeted drug delivery in liver cancer treatment. Dox plays a very important role in liver cancer treatment and it is one of the most utilized anticancer drugs worldwide. Dox inhibit s cell proliferation through intercalation of DNA in the cell s nucleus and subsequent inhibition of topoisomerase II Several reports have demonstrated that free Dox is membrane permeable and can be uptaken by cells through passive diffusion, rapidly transported to the nuclei, where it binds to chromosomal DNA.145 As it is readly and nonspecifically internali zed it i s toxic to all proliferating cells, including normal cells This toxicity limits the therapeutic activity of Dox in clinical use. B y ma king use of modification of a specific liver cancer aptamer and the intercalation propert ies of Dox, we generated an easy, rapid, and efficient method to target deliver y of Dox to cancer cells. During in vitro experiments, we showed TLS11aGC target s LH86 cells, and not normal h uman liver cells. Fut her more, we demonstrated the specific toxicity of TLS11aGC Dox compl ex to target cells, compared to normal liver cells thereby limit ing its toxic ity only to target cells. This targeting was achieved through the specific binding affinity of the TLS11a aptamer During MTS assay, al though TLS11aGC Dox achieved good cell toxicity compared to control TD05GC Dox, less toxicity was observed in the TLS11aGC Dox group than in the free Dox group. Also, less internalization and release of Dox in the TLS11aGC Dox group than in the free

PAGE 76

76 Do x group was observed using confocal microscopy. Dox itself is a small molecule and it can be rapidly uptaken by cells through a passive diffusion mechanism. Within 15 min, cells treated with free Dox show an intense red fluorescence in the nuclear region i ndicating that the uptake speed is very rapid.145 However, once Dox was intercalated into the DNA aptamer to form a much larger molecule, the cell uptake of the aptam er Dox complex was mainly dependent on the aptamer and its cell membrane target. And the internal ization of aptamer required more time (about 2 h) than free Dox, thus slowing down the internalization of aptamer Dox complex and the release of Dox fro m the complex Therefore, less toxicity was observed in the TLS11a GC Dox group than in the free Dox group during in vitro experiments. By contrast during in vivo experiment s, al though TLS11aGC Dox had decreased cell internaliza tion speed compared to free Dox TLS11aGC Dox increased the local concentration of Dox very much compared to free Dox, because of the target recognition by TLS11a aptamer. Hence, higher tumor inhibition efficacy was achieved in the TLS11aGC Dox treated mouse group. Conclusion In summa ry, by making use of the ability of anthracycline drugs to intercalate between bases of nucleotides, a new design to modify aptamer TLS11a to TLS11aGC and to make Dox and TLS11aGC conjugates was investigated. The specificity and efficacy of this conjugat e to serve as a drugdelivery platform was further demonstrated in vitro and in vivo Our data showed that the modified aptamer retains its specificity and can load much more Dox than the unmodified aptamer. Also, the aptamer Dox conjugates are stable in c ell culture medium and can differentially target LH86 cells. The specificity of this system was further demonstrated by treatment of human normal liver

PAGE 77

77 cells, which lack the aptamer binding target. The aptamer Dox conjugate prevents the nonspecific uptake of Dox and decreases cellular toxicity to the nontarget cells. Furthermore, the in vivo experiment showed better tumor inhibition by the TLS11aGC Dox group compared to all other control groups, indicating the successful delivery of Dox by the modified aptamer. This targeting specificity assured a higher local Dox concentration in the tumor. In addition, aptamer Dox conjugates are smaller than antibody based drug delivery systems, presumably allowing faster penetration and fewer immunoreactions We anticipate that the design of aptamer modification and aptamer Dox conjugation platform technology based on the intercalation of anthracyclines may be utilized in distinct ways to develop novel targeted therapeutic modalities for more effective cancer chemotherapy.

PAGE 78

78 T able 31. Different aptamer sequences Aptamer Sequence TLS11a ACAGCATCCCCATGTGAACAATCGCATTGTGATTGTTACGGTTTCCG CCTCATGGACGTGCTG TD05 CACCGGGAGGA TAGTTCGGTGGCTGTTCAGGGTCTCCTCCCG GTG TLS11a GC CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC GCGCGCGCGCGCGCGACAGCATCCCCATGTGAACAATCGCATTGT GATTGTTACGGTTTCCGCCTCATGGACGTGCT G TD05 GC CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC GCGCGCGCGCGCGCGCGAACACCGTGGAGGATAGTTCGGTGGCT GTTCAGGGTCTCCTCCCGGTG

PAGE 79

79 Figure 3 1. (A) The secondary structure of aptamer TLS11a and its binding ability to (B) LH86 and (C) human normal liver cells, Hu1082. The green histogram shows the background binding (control aptamer, TD05), and the red fluorescence intensities show the binding of TLS11a with target and control cells. All probes were labeled with PhycoerythrinCy5.5. (D) Confocal images of aptamer staining with cultured LH86 cells. Cells were incubated with aptamer conjugated with biotin and the binding event was observed with A lexaFluor 633 conjugated streptavidin. Non binding sequence TD05 showed the background binding. Aptamers show significant binding over the background signal.

PAGE 80

80 Figure 32. Representative binding curve of TLS11a aptamer with LH86 cells. Cells were incubated with varying concentrations of Biotinlabeled TLS11a aptamer in duplicate. The florescence signal was detected with streptavidinPEcy5.5. The mean fluorescence intensity of the unselected library (background binding) at each concentr ation was subtracted from the mean fluorescence intensity of the corresponding aptamer. The actual fluorescence intensity was fitted using Origin to determine the apparent Kd.

PAGE 81

81 Figure 33. Preliminary determination of the type of cell surface molecules w hich bind to TLS11a. Cells were treated with trypsin for 10 min and then incubated with aptamer.

PAGE 82

82 Figure 34. Co localiz ation of (A) TLS11a or (B) control TD05 and Lysosensor in endosomes after two hour incubation at 37C

PAGE 83

83 Figure 35 The intercalation of Dox into GC modified aptamers to form physical conjugates. (A ) Structure of Doxrubicin; (B) Structure of TLS11aGC Dox. ( C ) Structure of TD05GC Dox.

PAGE 84

84 Figure 36 Fluorescence spec tra of doxorubicin solution (10 M ) (dark blue) with modi fied TLS11aGC (red) or TD05GC (green) The background fluorescence was obtained in bind ing buffer sample (light blue).

PAGE 85

85 Figure 37 The binding affinity of (A) TLS11a GC or (B) TD05 GC to LH86 cells monitored using flow cytometry. A competition experim ent was carried out. Unlabeled TLS11aGC or TD05GC was first incubated with LH86 cells, followed by biotin labeled TLS11a Then cells were further incubated with streptavidin PEcy5.5. The binding buffer and unselected DNA library were used as negative controls The fluorescence signal is from PhycoerythrinCy 5.5. The black histogram shows the background binding.

PAGE 86

86 Figure 38 Internalization of (A) Dox, (B) TLS11agc Dox, and (C ) TD05GC Dox observed by confocal microscopy.

PAGE 87

87 Figure 39 Relative cell viability of cells treated with either TLS11aGC, TD05 GC, free Doxorubicin, TLS11aGC Dox or TD05GC D ox. (A ) Relative cell viabilit y of LH86 (target cell line); (B ) Relative cell viability of Hu 1229 (human normal liver cells).

PAGE 88

88 Figure 310 A p optosis of cells treated with either TLS11aGC, TD05 GC, free Doxorubicin, TLS11aGC Dox or TD05GC Dox. (A ) Hoechst 33258 staining for apoptotic and dead LH86 cells treated with a series of concentrations of TLS11agc Dox or TD05GC D ox; (B ) Western blot results for cleaved caspase 3 in LH86 cells treated with a series of concentrations of TLS11agc Dox or TD05GC Dox.

PAGE 89

89 Figure 311 Tumor inhibition of the aptam er Dox complex in mice model. (A ) Average tumor volume of mice treated with either nothing (black), Doxrobicin (red), TLS11aGC Dox (bl ue), or TD05GC Dox (purple); (B ) Microscopy images of H&E stained tumor tissue slides.

PAGE 90

90 CHAPTER 4 SILENCING OF PTK7 IN COLON CANCER CELLS: CASPASE10DEPENDENT APOPTOSIS VIA MITOCHONDRIAL PATHWAY Introduction Receptor tyrosine kinases (RTKs) compose a class of transmembrane signaling proteins that transmit extracellular signals to the interior of the cell. Misregulation of RTKs plays an important role in the development and/or progression of many forms of cancer .146 Protein tyr osine kinase 7 (PTK7), which is also known as colon carcinoma kinase4 (CCK4), is a relatively new and little studied member of the RTK superfamily. It contains an extracellular domain with seven immunoglobulinlike loops, a transmembrane domain, and a cat alytically inactive tyrosine kinase domain.147,148 However, as a result of an ancient and well conserved amino acid substitution within the catalytic domain, PTK7 is a pseudokinase without detectable catalytic tyrosi ne kinase activity .146,149 It was origina lly identified as a geneexpressed in colon cancer derived cell line, but not in human adult colon tissues .147 In contrast, high levels of PTK7 expression are seen in fetal mouse colons .146,147,149 The expression of PTK7 is upregulated in many common human cancers, including colon cancer, lung cancer, gastric cancer and acute myeloid leukemia.76,147,150153 Recently, PTK7 was identified as a novel regulator of noncanonical WNT or planar cell polarity (PCP) signaling.154,155 PTK7 also appears to play an important role in tube formation, migration, invasion of endothelia and angiogenesis in HUVEC cells .156 However, the functional role of PTK7 in cell proliferation and apoptosis remains unclear. Our lab became interested in PTK7 when it was identified as the target molecule of the aptamer sgc8.76 Aptamer sgc8 was ident ified through Cell SELEX procedure against T cell acute lymphoblastic leukemia

PAGE 91

91 (ALL) cell line, CCRF CEM since then it has been shown that sgc8 can effectively be used as a molecular probes for recognition of neoplastic cells in patient samples.40 Ap o totosis is programmed cell death, typically mediated by a family of cysteine proteases known as caspases .157 Caspases are synthesized as inactive proenzymes with either a long (caspase8, 9 and 10) or a short (caspase3, 6 and 7) prodomain.158,159 These latter proteases are called executioner or effector caspases, and their activation leads to programmed cleav age of a series of essential intracell ular proteins leading to cell death.160 Two main apoptosis pathways ha ve been identified and the mechanism of apoptosis is shown in Figure 41.161 The intrinsic pathway (mitochondria pathway) involves a decrease in mitochondrial membrane potential and release of cytochrome c162 which activates caspase9 through the apoptosome. Then, caspase9 initiates a proteol ytic caspase cascade that kills the cells. The extrinsic pathway (death receptor pathway) involves the tumor necrosis factor (TNF) receptor superfamily. In response to TNF ligand binding, these membrane receptors recruit adapter molecules and activate caspase8 /10 in the deathinducing signaling complex (DISC). Activated caspase 8 /10 either directly activates downstream effector caspases, such as caspase3, or connects to the intrinsic pathway through cleavage of BCL2 Interacting Domain (Bid) to truncated Bid (tBid) .163 The caspase10 gene is linked to the caspase8 gene at the human chromosome locus 2q33 34.164 While the physiological functions of caspase10 remain poorly understood, it is thought to play a role in the death receptor pathway. Recently c aspase10 was also reported to be activated downstream of the mitochondria in cytotoxic druginduced apoptosis of tumor cells .165 Acquired inactivating mutations of caspase10 have

PAGE 92

92 been identifi ed in tumor cells from patients with solid tumors .166168 Recently, caspase10 was shown to play a role in apoptosis induced by paclitaxel, an anticancer drug, through a Fas Associated protein with Death Domain (FADD) dependent mechanism 169 The term RNA interference (RNAi) was first used by Fire et al. 170 in their work on Caenorhabditis elegans RNAi is a cellular mechanism which helps to control which genes are active and how active they are. RNAi is an RNA dependent gene silencing process controlled by the RNAinduced silencing complex (RISC) There are two types of small RNA molecular, microRNA (miRNA) and small interfering RNA (siRNA), which are central to RNAi. miRNAs are genomically encoded approximately 21nucleotidelong noncoding RNAs which regulate gene expression, particularly during development .171,172 miRNAs typically have incomplete base pairing to a target and inhibit the translation of many different mRNAs with similar sequences. In contrast, siRNAs ( 2125 nucleotides in length) are artificial, typically basepair perfectly and trigger the degradation of single specific mRNA.170,173 The siRNA structure and the mechanism of RNAi induced by siRNA is shown in Figure 42. In the first step, the ribonuclease enzyme Dicer cleaves long doublestran d e d RNA (dsRNA) molecules to produce 21 25 base pairs long siRNAs with a few unpaired overhang bases on each end.174176 S tudies suggest this length maximizes target gene specificity and minimizes nonspecific effects.177 These siRNAs are incorporated into a multiprotein RNA inducing silencing complex (RISC). After integration into the RISC, siRNAs are unwound, leaving the antisense strand to guide RISC to its homologous target mRNA for endonucleolytic cleavage, preventing mRNA from being used as a translation template.178 It has been

PAGE 93

93 demonstrated that siRNAs can silence cognate gene expression via the R NAi pathway in mammalian cells .179 The properties of RNAi, including stringent target gene specificity and simplicity of design and testing,180 have greatly widened the potential for mechanistic studies of proteins, as well as for therapeutic approaches to treat diseases, including cancer .181,182 In this study, a siRNA targeting human PTK7 mRNA was used for maximal inhibition of PTK7 expression in order to probe the role of PTK7 in apoptosis and proliferation. Knocking down PTK7 i n HCT 116 cells inhibited cell proliferation and induced apoptosis. Furthermore, this apoptosis was characterized by decreased mitochondrial membrane potential and activation of caspase9 and 10. Addition of a caspase10 inhibitor totally blocked this apoptosis, suggesting that caspase10 may play a critical role in PTK7knockdowninduced apoptosis downstream of mitochondria. Therefore, these observations may indicate a role for PTK7 in cell proliferation and cell apoptosis. Materials and Methodology Mate rials McCoys 5A media were purchased from ATCC; fetal bovine serum (FBS) (heat inactivated) was purchased from GIBCO, and penicillinstreptomycin was purchased from Cellgro. HiPerFect transfection reagent, HP validated siRNA specific for PTK7, named PTK 7 siRNA (sense: 5'CGGGATGATGTCACTGGAGAA 3'), and a nonspecific siRNA were purchased from Qiagen. MicroFastTrack 2.0 Kit was purchased from Invitrogen. A colorimetric bromodeoxyuridine (BrdU) kit was from BD Pharmingen. IScript One Step RT PCR Kit with SYBR Green was from Biorad. Protease inhibitor cocktail (mixture of 4 (2 aminoethyl)benzenesulfonyl fluoride (AEBSF), E 64, bestatin,

PAGE 94

94 leupeptin, aprotinin, and sodium EDTA) and 0.4% trypan blue were from Sigma. The protein assay kit was from BioRad. Antibodies against caspaseactin were from Cell Signaling Technology. Anti caspase 10 antibody was purchased from Millipore. Antibody against PTK7 was from Abnova. Goat anti mouse IgG HRP conjugated secondary antibody and goat anti rabbit IgG HRP conjugated secondary antibody were purchased from Cell Signaling Technology. Vybrant Apoptosis Assay Kit #2, 4 NuPAGE LDS sample buffer, 412% NuPAGE Bis Tris gels, 20 NuPAGE MOPS SDS running buffer, and 20 NuPAGE transfer buffer were from Invitrogen. Immobilo n P transfer membrane was from Millipore. SuperSignal West Dura ExtendedDuration Substrate and Restore plus Western blot Stripping buffer were from Thermo Scientific. Xray films were from ISCBioExpress. JC 1 (5,5',6,6'tetrachloro1,1',3,3'tetraethylbenzimidazolylcarbocyanine iodide) was purchased from Anaspec Caspase9 inhibitor (ZLEHDFMK), caspase3 inhibitor (ZDEVDFMK), caspase 8 inhibitor (ZIETDFMK), caspasefamily inhibitor (Z VADFMK), caspase1 inhibitor (Z YVADFMK), caspase10 inhibitor (Z AEVDFMK) and caspase2 inhibitor (ZVDVADFMK) were purchased from BioVision. Caspase10 Fluorometric Protease Assay Kit was from Millipore. Cell C ulture HCT 116 (colon carcinoma) cells were obtained from ATCC (Manassas, VA) and maintained in culture at 37 C and 5% CO2. p53null HCT 116 cells were provided by Dr. Bert Vogelstein (The Johns Hopkins Kimmel Cancer Center). Cells were cultured in McCoys 5A medium supplemented with 10% fetal bovine serum (FBS) (heat inactivated) and 100 IU/mL penicillin streptomycin. Cells were split at regular intervals and were not allowed to overgrow.

PAGE 95

95 Transfection of siRNA HCT 116 cells were transfected with siRNA by HiPerFect transfection reagent. On day 1, cells in exponential growth phase were harvested and suspended in growth medium. Cells were divided into four groups and were treated with PTK7 siRNA, a nonspecific siRNA as negative control, HiPerFect vehicle only, or were left untreated. For each transfection, a 500 L cell suspension was transfected wi th 25 nM siRNA using 4 L transfection reagent in 24well plates. Cells were kept in normal culture conditions and collected 2, 3 or 4 days after transfection for analysis. Flow Cytometry Analysis During our study, after transfection with siRNAs as described above, cells were detached using nonenzymatic cell dissociation solution (Cellgro), washed twice in PBS, and counted using a hemocytometer. Aliquots of 5x105 cells were incubated with excess phycoerythrin (PE) labeled anti PTK7 in 200 L of binding buff er (PBS containing 5 mM MgCl2, 4.5 mg/mL glucose, 0.1 mg/mL yeast tRNA, 1 mg/mL BSA and 20% FBS) on ice for 30 min. Cells were then washed twice with 1 mL of binding buffer and suspended in 0.3 mL of binding buffer. The fluorescence was determined with a F ACScan cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA). PE labeled anti IgG was used as a negative control. Quantitative RTPCR Total mRNA from cells treated with various siRNAs was extracted with MicroFastTrack 2.0 Kit according to the manufacturer's instructions. In eukaryotic organisms, most mRNA molecules are polyadenylated at the 3' end. Here in order t o separate mRNA from the majority of the RNA found in the cell s, affinity b inding to oligo(dT) cellulose was used. Briefly, DNA and proteins were removed from samples, and mRNA

PAGE 96

96 bound to oligo(dT) cellulose under high salt conditions. After removing rRNA by washing using a low salt buffer, mRNA was eluted with a very low ionic strength buffer. Isolated mRNA was kept at 80C. To determine the concentration of the eluted mRNA samples were diluted by adding Elution Buffer from the kit. Elution Buffer was used to blank the spectrophotometer at 260 nm. And then the absorbances of diluted samples were read at 260 nm. The following for mula was used to determine RNA concentration: [ RNA ] = ( A 260 ) 0 .04 g D Where, [RNA], A260 and D represent RNA concentration, absorbance at 260 nm and the dilution factor respectively. Real time PCR was performed on mRNA (50 ng) with iScript OneStep RT PCR Kit using SYBR Green with a Biorad iCycler. All reactions were performed in a 50L volume in triplicate. Primers for human PTK7 were purchased from Qiagen (QT00015568). The PCR preparation was shown in Table 41.RT PCR procedure parameters were as follows: 50 C for 30 min, 5 min of Taq activation at 95 C, followed by 45 cycles of PCR: 95 C 30 s, 57 C 60 s, and 72C 60 s. The relative amount of target mRNA was normalized to GAPDH mRNA. Specificity was verified by melting curve analysis. Cell Number Detection by Trypan Blue Exclusion A ssay For four days after treatment, cell suspensions were prepared by detaching cell from a dish using nonenzymatic solution and resuspending them in 1 mL media. To 25 was added, and cells were counted using a hemocytometer. Trypan blue is a diazo dye which cannot be absorbed by viable

PAGE 97

97 cells, but can travers e the membrane in a dead cell So trypan blue stains only dead cells blue under a microscope. Proliferation A ssay Cell proliferation was studied using a colorimetric bromodeoxyuridine (BrdU) kit according to the manufacturer's instructions. First, cells were transfected with siRNA. After 48 h of treatment, 10 M BrdU solution was added to the medium. The media was dis carded after 2 h, and cells were fixed and permeabilized with BD Cytofix/Cytoperm Buffer for 30 min at room temperature. After removing Cytofix/Cytoperm Buffer cells 3 7C to expose incorporated BrdU. Perm/Wash Buffer containing diluted FITC labeled anti BrdU and incubated for 20 the 7 Aminoactinomycin D ( 7 AAD) solution which is a fluorescent chemical compound with a strong affinity for DNA. 7 AAD cannot pass through intact cell membranes, but in this experiment, the cell membrane had been permeabilized, so 7AAD stained whole cell population. Sampl es were analyzed by flow cytometry. M eans and standard errors of at least three replicates of each experiment were calculated. Significance was determined by t test; a p value Annexin V /Propidium Iodide DoubleStaining A ssay Annexin V /propidium iodide (PI) doublestaining was performed using the Invitrogen Vybrant Apoptosis Assay Kit #2. Cells were washed twice in icecold PBS buffer and centrifuged at 900 rpm for 3 min. The pellets were resuspended in binding buffer at a dens ity of 106 doublestained with 5 V

PAGE 98

98 ere analyzed by f low cytometry. Western Blot A nalyses Western blot is a widely used analytical technique for detect ing specific proteins in a given sample such as tissue homogenate and cell lysate. G el electrophoresis was used to separate proteins by the length of the polypeptide (denaturing conditions) or by the 3D structure of the protein (native/ nondenaturing conditions). All proteins are then transferred to a nitrocellulose or PVDF membrane, where antibodies specific to the target protein was used to probe the proteins.183,184 In our study, Western blot was carried out to detect PTK7 expression, caspase 9, 10 and Bid activation. Briefly, after HCT 116 cells were transfected with PTK7 siRNA for 12 h, 24 h, 30 h, and 48 h, whole cells were harvested and washed twice with ice cold PBS. Then cells were lysed in radioimmunoprecipitation buffer (150 mM NaCl, 1% Triton X 100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 50 mM Tris HCl, pH 7.5, and 2 mM EDTA) in the presence of proteinase inhibitor cocktail for 20 min on ice. Lysates were centrifuged at 14,000 rpm for 20 min at 4C, and the protein content in the supernatant was measured using the BioRad protein assay. Fifty micrograms of supernatant proteins were mixed with 4 NuPAGE LDS sample buffer and heated at 70C for 10 min. The proteins were separated on 412% NuPAGE Bis Tris gels with 1 NuPAGE MOPS SDS running buffer and then electrotransferred onto a PVDF transfer membrane with NuPAGE transfer buffer at 50 V for 1 h. The membranes were blocked with 5% nonfat dry milk in PBS buffer containing 0.2% Tween 20 (PBST) for 2 h at room temperature. The membranes were probed with primary antibodies in PBST containing 5% nonfat dry milk overnight at 4C. After three successive washings

PAGE 99

99 with PBST for 10 min, the membranes were incubated with horseradish peroxidaseconjugated goat anti mouse IgG antibody or goat anti rabbit IgG antibody in PBST containing 5% nonfat dry milk for 1 h at room temperature. After three successive washings with PBST for 10 min, the proteins signals were developed with a SuperSignal West Dura Extended Duration Substrate kit and transferred from the membrane to X ray films. Protein loading was normalized by probing the same membrane with anti actin actin detection, previously used membranes were soaked in Restore Plus Western Blot Stripping Buffer at room temperature for 30 min and hybridized with anti Measurement of Mitochondrial Membrane P otential Dye JC 1 (5,5',6,6'tetrachloro1,1',3,3'tetraethylbenzimidazolylcar bocyanine m), the loss of which is regarded as a crucial step in the apoptosis pathway. HCT 116 cells were transfected with siRNA for 48 h or 72 h, after which the cells were washed with col d PBS and stained by incubating with 2 M JC 1 for 20 min at 37C. Then, the mitochondrial membrane potential was detected by fluorescence microscopy and flow cytometry at 590 nm. Caspase10 Activity Measurement Caspase10 activity was measured using the Caspase10 Fluorometic Protease Assay Kit. Briefly, cells were transfected with PTK7 siRNA, and after 24 h or 48 h cells were harvested. Two million cells were resuspended in chilled lysis buffer and incubated on ice for 10 min. Then, 50 L of 2 Reaction Buffer and 5 L of the 1 mM AEVD AFC substrate (50 M final concentration) were added to each sample. After incubation at 37C for 2 h, samples were analyzed using a microplate reader equipped with a 400 nm

PAGE 100

100 excitation filter and a 505 nm emission filter. M eans and standard errors of at least three replicates of each experiment were calculated. Significance was determined by t test, a p value Results Inhibition of PTK7 E xpression by PTK7 siRNA Expression of PTK7 in HCT 116, human colon carcinoma cells, was investigated by flow cytometry (Fig ure 4 3 A, unt re ated) and Western blot (Figure 43 B, 0 h). Comparing the fluorescence signal of PE labeled anti PTK7 to PElabeled anti mouse IgG clearly shows that PTK7 is expressed in H CT 116 cells. Inhibition of PTK7 protein expression Expression of PTK7 was knocked down using PTK7targeted siRNA and the flow cytometry results for the targeted cells were compared to those exposed to vehicle only, nonspecific siRNA or untreated as shown in Fig ure 43 A. After 48 hours, the peak of anti PTK7 PE in HCT 116 transfected with PTK7 siRNA shifted back to the peak of the background control protein, anti IgG PE, indicating that the PTK7 expression level in HCT 116 cells transfected with PTK7 siRN A greatly decreased. At the same time, there was no corresponding shift in the control siRNA or vehicletreated groups, indicating that neither the HiPerFect transfection reagent nor the nonspecific siRNA affected PTK7 expression. When PTK7 expression was probed after 12 h, 24 h, 30 h and 48 h of transfection using Western blot (Figure 43 B), the results clearly showed that the level of PTK7 expression decreased after 48 h of transfection. Inhibition of PTK7 mRNA expression In addition, total mRNA was ext racted from the untreated, vehicle, nonspecific siRNA, and PTK7 siRNA groups. mRNA is a molecule of RNA which is transcribed from

PAGE 101

101 a DNA template, and carries coding information protein synthesis In eukaryotic organisms, most mRNA molecules are polyadenylated at the 3' end. The poly(A) tail and the protein bound to it aid in protecting mRNA from degradation by exonu cleases. Here in order t o separate mRNA from the majority of the RNA from cell lysate oligo(dT) cellulose was used to bind to the poly(A) tail and isolate mRNA After mRNA isolation, quantitative RTPCR was performed to access the PTK mRNA level in different groups. Basically, the RNA strand was first reverse transcribed into its co mplementary DNA ( cDNA) using reverse transcriptase, and the resulting cDNA was amplified using real time PCR. SYBR Green I is an asymmetrical cyanine dye185 which can binds to DNA and the resulting DNA dyemax = 488 nm) and emits green max = 522 nm) So SYBR Green I was used as a dye for the quantification of double stranded real time PCR.186 At the same time, GAPDH, as a house keeping gene, was measured in the same sample and the amount of PTK7 mRNA was normalized to it. As shown in Figure 44 PTK7 siRNA induced 7580% reduction of PTK7 mRNA in HCT 116 cells. These results indicated that both PTK7 protein and mRNA expression levels were greatly decreased by PTK7 siRNA. This proved the function and efficiency of PTK7 siRNA and provided a solid basis for our study of PTK7s functional role. Viability of PTK7 siRNA Treated HCT 116 C ells The effect of PTK7 suppression on the viability of HCT 116 cells was investigated by counting the total number of live cells every day after transfection. Trypan blue, as a diazo dye which cannot be absorbed by viable cells, but can travers e the membrane in a dead cell was used to count the live cells number. U nder a microscope, trypan blue can color dead cells blue, but live cells are excluded from staining. As shown in Figure

PAGE 102

102 4 5 the number of live HCT 116 cells transfected with PTK7 siRNA was shown to be significantly lower than untreated groups on day 4. This finding demonstrated a significant inhibition of cell viability in the HCT 116 cells treated with PTK7 siRNA. To confirm that the decrease of cell viability resulted from suppression of PTK7, the same assays were carried out with HCT 116 cells transfected with nonspecific siRNA or treated only with vehicle. The results showed that the PTK7 siRNA treated sample contained the smallest number of cells. Although vehicle treated and nonspecific siRNAtreated cells had smaller cell numbers than untreated cells, there were significantly fewer cells in the PTK7 siRNA treated sample. Proliferation of PTK7 siRNA Treated HCT 116 C ells To ascertain the effect of suppression of PTK7 on HCT 116 cell proliferation, a BrdU incorporation experiment was performed to measure DNA synthesis. BrdU is an analog of the deoxythymidine which can be incorporated into newly synthesized DNA by cells entering and progressing through the S (DNA synthesis) phase of the cell cycle. And then dyelabeled BrdU antibody can determine the amount of BrdU incorporation. After 48 h of transfection, cells were seeded in 24well culture plates and were incubated with 10 M BrdU for 2 h. Cells were then fixed, and BrdU incorporation was detected using a FITC la beled anti BrdU antibody (Figure 46 ). Silencing of PTK7 significantly inhibited BrdU incorporation in HCT 116 cells, suggesting a direct effect of PTK7 protein on HCT 116 cell proliferation. Increase of Apoptosis of PTK7 siRNA Treated HCT 116 C ells An Annexin V /PI staining experiment was carried out to study the possibility that knocking down PTK7 could affect the apoptosis of HCT 116 cells. Phosphatidylserine (PS) is located in the inner leaflet of the cell membrane in healthy cells. During

PAGE 103

103 apoptosis, PS becomes translocated to the outer surface of the cell membrane, and Alex 488 labeled Annexin V recognizes the PS on the outer. Propidium iodide ( PI) is an intercalating agent and a fluorescent molecule which can be used to stain DNA. PI is membrane impermeant and generally excluded from viable cells so PI is commonly used for identifying dead cells in a population. The results in Figure 47 show that the PTK7 siRNA g roup showed significant increase in apoptotic cells on day 3 and 4 compared with untreated, vehicle, and nonspecific siRNA control groups. Changes in Mitochondrial Membrane Potential and Activation of Caspase9 A variety of signalling pathways may be involved in apoptosis, and the mitochondria play a major role in apoptosis signa lling Mitochondrial dysfunction causes mitochondrial membrane potential decrease and the release of cytochrome c which activ ates caspase9, in turn fueling apoptosis. Dye JC 1 (5,5',6,6'tetrachloro1,1',3,3'tetraethylbenzimidazolylcarbocyanine iodide) was used to determine mitochondrial m), the loss of which is regarded as a crucial step in the apoptosi s pathway. In healthy cells, intact mitochondria have a negative charge, which allows JC1 dye with delocalized positive charge to enter the mitochondrial matrix and accumulate there. When the critical concentration is exceeded, JC 1 forms J aggregates, and cells become fluorescent red (FL2). In apoptotic cells, the mitochondrial membrane potential collapses, and JC 1 cannot accumulate within the mitochondria. In these apoptotic cells, JC 1 remains in the cytoplasm in a green fluorescent monomeric form (FL1 ). To study the mechanism through which knocking down PTK7 induces apoptosis in m was determined by flu orescence microscopy (Figure 48 A ) and flow cytometry (Figure 48 B). After cells

PAGE 104

104 were transfected with siRNA or control as described above and incubated for 48 h or 72 m in HCT 116 cells transfected with PTK7 siRNA was observed. After 72 h of transfection, the percentage of cells with intact mitochondria was 90%, 87% and 88% for cells in the untreated, vehicle and nonspecific siRNA groups, respectively. However, only 35% of total cells in the PTK7 siRNA group had intact mitochondria. This trend was seen even at 48 h when only 58% cells had intact mitochondria. These data suggested t hat mitochondrial dysfunction was involved in the apoptosis induced by PTK7 knockdown. Caspase9 are first synthesized as inactive procaspase9 (47 kD) and activated during apoptosis through mitochondrial pathway. M itochondrial membrane potential decrease causes release of cytochrome c which turns inactive procaspase9 into active caspase9 (37 Kd and 17 kD). Caspase9 activation was detected by Western blot after HCT 116 cells were transfected with PTK7 siRNA and cultured for 12 h, 24h, 30 h, and 48 h, r e spectively. As shown in Figure 49 caspase9 was activated and involved in the apoptosis induced by PTK7 knockdown. Role of Caspase10 in PTK7Knockdown I nduced A poptosis To determine whether caspases mediate the apoptosis induced by knock down of PTK7, cells were pretreated with a pancaspase inhibitor or one of several singlecaspasespecific inhibitors which are short peptides and can bind to the active sites of caspases to inhibit the function of caspases Rescue of the cells from apoptosis would mean that the inhibited caspase was implicated in PTK7 deficient cell death. After preincubation of the HCT 116 cells with 20 M pancaspase family inhibitor at 37C for 3 h, the cells were transfected with siRNA for 48 h. After incubation for 48 h, cell viabil ity was tested using Annexin V /PI (Figure 410 A ). Cells pre incubated with pancaspase-

PAGE 105

105 family inhibitor showed good cell viability (8013%) after transfection with PTK7 siRNA, within uncertainty of the cell viability of the nonspecific siRNA group (837.5%). Meanwhile, cells directly transfected with PTK7 siRNA had significantly lower cell viability (3612%). Pancaspasefamily inhibitor blocked all caspase activity and also blocked apoptosis induced by knock down of PTK7, indicating that the apoptosis induced by knockdown of PTK7 is caspasedependent. To investigate which caspase plays the c ritical role in this apoptosis, HCT 116 cells were pretreated with caspase9 inhibitor (ZLEHDFMK), caspase3 inhibitor (ZDEVDFMK), caspase8 inhibitor (ZIETDFMK), caspasefamily inhibitor (Z VADFMK), caspase1 inhibitor (ZYVADFMK), caspase10 inhibitor (Z AEVDFMK), caspase2 inhibitor (ZVDVADFMK), or DMSO vehicle at 37C for 3 h, followed by transfection with PTK7 siRNA. After incubation for 48 h, cell viability was tested by Annexin V /PI using fl ow cytometry. Fluoromethyl ketone (FMK)derivatized peptides act ed as effective irreversible inhibitors As shown in Figure 410 B inhibition of caspase10 blocked apoptosis, with 793% of cells viable. This meant that caspse10 may play a critical role in the apoptotic pathway induced by knock down of PTK7. To confirm the activation of caspase10 in apoptosis induced by PTK7 knockdown, procaspase10 (59 kD) protein levels in cell lysates transfected with PTK7 siRNA were ex amined using Western blot (Figure 411 A). Procaspase10 decreas ed after 12 h of transfection and increased after 30 h of transfection. Also, as the linkage between intrinsic pathway and extrinsic pathway, the cleavage of Bid (22 kD) to tBid (15 kD) was investigated, and there was no obvious tBid, indicating that there was no signal transfer from the extrinsic pathway to the intrinsic pathway. In another experiment, PTK7

PAGE 106

106 expression in HCT 116 was initially suggested using PTK7 siRNA, resulting in apoptosis in these cells. The ability of cell lysates to cl eave the peptide substrates ( AEVDAFC) was tested as an indicator of caspase10 activity. AEVDAFC emits blue light (lmax=400 nm); upon cleavage of the substrate by caspase10, free AFC emits a yellow green fluorescence (lmax=505 nm), which can be quantified using a fluo rescence microtiter platereader. Comparison of the fluorescence of AFC from PTK7 siRNA treated sample with an untreated control allows determination of the fold increase in AEVD dependent caspase10 activity. The results in Figure 411 B show significant i ncrease in caspase 10 activity in cells treated with PTK7 siRNA. p53 involvement in PTK7knockdowninduced A poptosis The protein p53 is a proven a tumor suppressor protein in humans187, and HCT 116 cells express widetype p53.188,189 In order to study the involvement of p53 in the apoptosis induced by PTK7 knockdown, p53 null HCT 116 was used as the second cell line to carry out PTK7 knockdown and other related experiments. First, the PTK7 expression level with or without siRNA treatment was monitored by flow cytometry (Fig ure. 4 12 A). The p53null HCT 116 cells express a high amount of PTK7 on the cell membrane, but after 48 hours of PTK7 siRNA transfection, the peak for anti PTK7 PE in p53null HCT 116 shifted back to the peak of the background control protein, anti IgG PE. This indicated that the PTK7 expressi on level in p53 null HCT 116 cells transfected with PTK7 siRNA was greatly decreased. Next, the number of live p53null HCT 116 cells transfected with PTK7 siRNA was shown to be significantly different from that of untreated groups on day 4, demonstrating a significant inhibition of cell viability in p53null HCT 116 cells by treating with PTK7 siRNA (Figure 412 B). And in the BrdU incorporation experiment, silencing of PTK7 significantly inhibited BrdU incorporation in

PAGE 107

107 p53null HCT 116 cells, suggesting a direct effect of PTK7 protein on cell proliferation (Fig ure 412 C). On the other hand, the Annexin V /PI staining experiment showed that the PTK7 siRNAtreated p53null HCT 116 showed significant increase in apoptotic and dead cells on day 4 compared with untreated, vehicle, and nonspecific siRNA control groups (Figure 412 D) The apoptosis induced by PTK7 knockdown has been shown to be caspase10 dependent in wild type HCT 116. So the apoptosis pathway in p53null HCT 116 induced by PTK 7 knockdown was further investigated. JC 1 experiment was monitored by both fluorescence microscopy (Figure 413 A) and flow cytometry (Figure 4 13 B). Clearly, mitochondrial membrane potential decreased in p53null HCT 116 cells treated with PTK7 siRNA. At the same time, a caspase inhibitor experiment was carried out using p53null HCT 116 cells. As shown in Figure 413 C, pancaspase inhibitor or caspase10 inhibitor treatment inhibited the apoptosis induced by PTK7 knockdown compared to all other inhibitors, which indicated the apoptosis in p53null HCT 116 cells induced by PTK7 knockdown was also caspased10 dependent. D iscussion The present work demonstrates that RNAi suppression of PTK7 induces caspase10dependent apoptosis in colon cancer cel ls. Small interfering RNA is a very popular reverse genetic tool, allowing researchers to identify the role of a protein by inhibit ing gene expression through sequencespecific degradation of target mRNA. This study showed that siRNA efficiently suppressed PTK7 expression at the level of both mRNA and protein. A nonspecific siRNA was used as a negative control to confirm that suppression of PTK7 was the result of the specific silencing effect of PTK7 siRNA.

PAGE 108

108 After confirming suppression of PTK7 by siRNA, we then considered whether the inhibition of PTK7 would affect cell viability and proliferation. Trypan Blue Exclusion Assay showed that the number of live HCT 116 cells transfected with PTK7 siRNA was remarkably less than that of the control groups on day 4. Compared to nonspecific siRNA group as negative control, it was clear that suppression of PTK7 accounted for the inhibition of cell viability. To assess the effect of PTK7 knockdown on HCT 116 cell proliferation, a BrdU incorporation experiment was performed to measure DNA synthesis. Interestingly, PTK7 silencing significantly inhibited BrdU incorporation in HCT 116 cells, indicating that knock down of PTK7 expression had a direct effect on HCT 116 cell growth. In fact, PTK7 has been identified as a gene expressed in primary colon carcinoma, and overexpression of PTK7 is often found in colon carcinoma cells. Furthermore, knock down of PTK7 induced cell apoptosis, verified through Annexin V/PI stain. After knock down of PTK7, ratios of apoptotic HCT 116 cel ls revealed by Annexin V/PI stain, which showed a large increase of percentage of apoptotic HCT 116 cells. These results provide evidence that suppression of PTK7 can significantly increase the occurrence of apoptosis in HCT 116 cells, and that an excess of PTK7 can be associated with resistance of cancer cells to induction of cell death. The results further demonstrated that knock down of PTK7 caused a large decrease in mitochondrial membrane potential of HCT 116 cells, suggesting that mitochondria dysfunc tion maybe involved in this apoptosis and that the mitochondrial pathway to cell death may play an important role in apoptosis induced by knock down of PTK7. Caspase9 was also activated after PTK7 siRNA treatment. At the same time, apoptosis inhibition ex periments showed that caspase10 also plays a critical role in

PAGE 109

109 apoptosis induced by knock down of PTK7. Interestingly, caspase8 inhibitor had no effect on this apoptosis at all, even though it has always been thought that caspase8 and caspase10 play identical roles in the extrinsic pathway to cell death. Western blot was used to examine the procaspase8, 10 and active caspase8 levels in PTK7 siRNAtreated cells. Procaspase10 level changes were significant but active caspase8 was not detectable. Addi tionally, Bid/t Bid level changes were examined, an d no t Bid was found (Figure 411 A) indicating that there was no signal transfer from the extrinsic pathway to the intrinsic pathway. Thus, the extrinsic pathway was not involved as reported by Filomenko P. et al.165. Furthermore, p53null HCT 116 cells were used to study the involvement of p53 in the apoptosis induced by PTK7 knockdown. When treated with PTK7 siRNA, cell proliferation decreased and apoptosis increased in p53null HCT 116 cells. Also, mitochondria were involved in the apoptosis, which was caspase10 dependent. When comparing the results between wild type HCT 116 and p53null HCT 116, PTK7 knockdown had less effect on cell proliferation and apoptosis in p53 null HCT 116 cells, but the apoptosis induced by PTK7 knockdown was caspase10 dependent in both cell lines. Therefore, the effect of PTK7 knockdown on cell apoptosis was p53 related but not dependent Altogether, the results show that the knock down of PTK7 in HCT 116 cells induces cell apoptosis and affects cell proliferation. Also, caspase10 activation plays a critical role in the caspase cascade downstream of mitochondria after knock down of PTK7.

PAGE 110

110 Conclusion In conclusion, suppression of PTK7 significantly increases apoptosis and inhibits cell proliferation in HCT 116 cells, indicating that PTK7 may play an important role in maintaining cancer cell viability. Apoptosis induced by knockdown of PTK7 was caspase10 dependent, and caspase10 activation was downstream of mitochondria l damage. Therefore, the use of PTK7 siRNA, or other methods that counteract PTK7 function, may be valuable in the development of anti cancer therapeutic agents.

PAGE 111

111 Figure 4 1. Crosstalk between apoptosis signaling pathways following activation of death receptors. Death receptors trigger the cell intrinsic pathway by activation of caspase8 and caspase10. Cleaved BID interacts with Bax and Bak, which in turn, activate caspase 9 and caspase3, resulting in apoptosis induction through the cell extrinsic pathway.161 (copyright permission acquired)

PAGE 112

112 Figure 42. (A) Short interfering (si)RNAs. Molecular hallmarks of an siRNA include 5' phosphorylated ends, a 19nucleotide (nt) duplexed region and 2nt unpaired and unphosphorylated 3' ends that are characteristic of RNase III cleavage products.190 (B) The siRNA pathway. Long doublestranded (ds)RNA is cleaved by the RNase III family member, Dicer, into siRNAs in an ATP dependent reaction104. These siRNAs are then incorporated into the RNA inducing silencing complex (RISC). Although the uptake of siRNAs by RISC is independent of ATP, the unwinding of the siRNA duplex requires ATP. Once unwound, the singlestranded antisense strand guides RISC to messenger RNA that has a complementary sequence, which results in the endonucleolytic cleavage of the target mRNA.191 (copyright permission acquired)

PAGE 113

113 Table 41. RT PCR preparation Component Volume per reaction 2X SYBR Green RT PCR Reaction Mix PTK7 PTK7 Reverse primer Nuclease free H 2 O X L RNA template (50 ng mRNA) X L RNA template (1 pg to 100 ng total RNA) Total Volume 50 L

PAGE 114

114 Figure 4 3 PTK7 expression in HCT 116 cells after treatment with vehicle, nonspecific siRNA and PTK7 siRNA. (A) Flow cytometry assay for the binding of the PE labeled anti PTK7 with HCT 116 cells (Grey curves). The black curve s represent the background binding of anti IgG PE. The concentration of the antibody in the binding buffer was 2 g/L. (B) Western blot analysis of PTK7 in HCT 116 cells transfected by PTK7 siRNAs. The membrane was stripped and reprobed by actin antibody as a loading control.

PAGE 115

115 Figure 44. Suppression of PTK7 mRNA expression in HCT 116 cells by PTK7 siRNAs Cells were harvested after 48 h of treatment. RTPCR was performed using genespecific primers. T he amount of PTK7 mRNA expression was normalized to the untreated group. Data are mean s.d. of three independent experiments. *Students t test: P<0.05.

PAGE 116

116 Figure 45 Cell viability in HCT 116 cells after treatment with vehicle, nonspecific siRNA and PTK7 siRNA. Data are mean s.d. of th ree independent experiments. The number of live cells was co unted daily for 4 days using Trypan blue

PAGE 117

117 Figure 46. BrdU incorporation relative to untreated cells detected by flow cytometry. Cells were incubated with 10 M BrdU for 2 h after 48 h of treatment Data are mean s.d. of three independent experiments. Student s t test: P < 0.05.

PAGE 118

118 Figure 47. Apoptosis occurrence in HCT 1 16 cells detected by Annexin V/PI stain on day s 1 4 after transfection. Cells stained negative for both Annexin V and PI were considered healthy.

PAGE 119

119 Figure 48 Involvement of mitochondrial pathway in apoptosis induced by PTK7 scilencing. (A) Fluorescence microscope detection of mitochondrial membrane potential in treated HCT 116 cells. (B) Flow cytometry detection of mitochondrial membrane potential in treated HCT 116 cells.

PAGE 120

120 Figure 49. Activation of caspase9 involved in apoptosis induced by knocking down PTK7. The membrane was stripped and reprobed by actin antibody, as a loading control.

PAGE 121

121 Figure 410 Cell viability after incubation with caspase inhibitors prior to t ransf e ction of PTK7 siRNA. (A) Apoptosis induced by knocking down PTK7 was caspasedependent. Data are mean s.d. of three independent experiments. (B) Caspase10 inhibitor totally blocked the apoptosis induced by knock down of PTK7. Data: mean s.d. of thre e independent experiments, Student s t test: P < 0.05.

PAGE 122

122 Figure 411. The activation of caspase10 in apoptosis induced by knocking down of PTK7. (A) Western blot analysis of procaspase10 and Bid in HCT 116 cells transfected by PTK7 siRNAs. The membrane was stripped and reprobed by actin antibody, as a loading control. (B) Caspase10 activity in HCT 116 cells: untreated and treated with vehicle, nonspecific siRNA and siRNA. Results were given as ratios to caspase10 activity in untreated cells. Data are mean s.d. of three independent experiments. Student s t test: P < 0.05.

PAGE 123

123 Figure 412 PTK7 expression and cell apoptosis induced by knocking down of PTK7 in p53null HCT 116 cells. (A) Flow cytometry assay for the binding of the PE labeled anti PTK7 with p53 null HCT 116 cells (Grey curves). The black curves represent the background binding of anti IgG PE. The concentration of the antibody in the binding buffer was 2 g/L. (B) The number of live p53null HCT 116 cells was counted on day 4 after treatment with vehicle, nonspecific siRNA and PTK7 siRNA. Data are mean s.d. of three independent experiments. *Students t test: P < 0.05. (C) BrdU incorporation relative to untreated cells detected by flow cytometry. p53null HCT 116 Cells were incubated with 10 M BrdU for 2 h after 48 h of treatment. T he amount of BrdU incorporation was normalized t o the untreated group. Data are mean s.d. of three independent experiments. *Students t test: P < 0.05. (D) Apoptosis occurrence in p53null HCT 116 cells detected by Annexin V/PI stain on days 4 after transfection. Cells stained negative for both Annexin V and PI were considered healthy and percentage was shown in the F igure.

PAGE 124

124 Figure 413 Mitochondria and caspase10 involvement in the apoptosis induced by knocking down of PTK7 in p53null HCT 116 cells. (A) Fluorescence microscope detection of mitochondr ial membrane potential in treated p53null HCT 116 cells. (B) Flow cytometry detection of mitochondrial membrane potential in treated p53null HCT 116 cells. (C) Cell viability after incubation with caspase inhibitors prior to transfaction of PTK7 siRNA. C aspase10 inhibitor totally blocked the apoptosis induced by knock down of PTK7. Data: mean s.d. of three independent experiments, *Students t test: P < 0.05.

PAGE 125

125 CHAPTER 5 SUMMARY AND FUTURE PLAN Currently c ancer classification, monitoring, diagnosis, and therapy are a major driver of research in the world. Considering all the properties and advantages of aptamers, they will be an unparalleled tool in cancer related research. In this dissertation, we have successfully developed a panel of useful high affinity aptamers for liver cancer cells achieved targeted drug delivery using a modified aptamer, and discovered the functional role of a biomarker in cancer cell apoptosis and proliferation. In C hapter 2, we demonstrated that cell SELEX could produce a group of cell specific aptamers for adherent cells. The selection process is reproducible, simple, and straightforward, and seven effective aptamers have been successfully generated for a liv e liver cancer cell line with Kds in the nM range. Flow cytometry assays and confocal imaging show that the selected aptamers not only recognize the target liver cancer cells specifically but also d o not bind to its parent liver cells, BNL CL.2. T he close relationship between BNL 1ME A.7R.1 cells and BNL CL.2 cells indicates that cellSELEX can be used to identify minor molecular level differences among cells. The cell SELEX shows that the newly generated aptamers could be excellent molecular probes for liver cancer analysis and diagnosis. It further indicates that the target molecule s could be specific biomarker s for this kind of liver cancer, and would provide useful information for explaining the mechanism of oncogenesis In C hapt er 3, a targeted drug delivery platform was investigated. B y making use of the ability of ant hracycline drugs to intercalate between bases of nucleotides, a TLS11aGC Dox conjugate was made, and t he specificity and efficacy of this conjugate to serve as a drugdelivery platform was further demonstrated in vitro and in vivo T he modified

PAGE 126

126 aptamer retains its specificity and can load much more Dox than the unmodified aptamer. The specificity of this system was further demonstrated by treatment of human normal liver cells, which lack the aptamer binding target. The aptamer Dox conjugate prevents the nonspecific uptake of Dox decreas ing cellular toxicity to nontarget cells and potentially reducing sideeffects increasing the therapeutic index for the drug. Furthermore, the in vivo experiment showed better tumor inhibition by the TLS11aGC Dox group compared to all other control groups, indicating the successful delivery of Dox by the modified aptamer. This targeting specificity assured a higher local Dox concentration in the tumor. In addi tion, aptamer Dox conjugates are smaller than antibody based drug delivery systems, allowing faster penetration and fewer immunoreactions We anticipate that the design of aptamer modification and aptamer Dox conjugation platform technology based on the intercalation of anthracyclines may be utilized in distinct ways to develop novel targeted therapeutic modalities for more effective cancer chemotherapy In C hapter 4, the functional role of a biomarker, PTK7, w as investigated by siRNA silencing. S uppression of PTK7 significantly increases apoptosis and inhibits cell proliferation in HCT 116 cells, indicating that PTK7 may play an important role in maintaining cancer cell viability. Apoptosis induced by knock dow n of PTK7 was caspase10 dependent, and caspase10 activation was downstream of mitochondria l damage. Therefore, the use of PTK7 siRNA, or other methods that counteract s PTK7 function, may be valuable in the development of cancer therapeutic agents.

PAGE 127

127 Future W ork Biomarker Discovery Cell membrane proteins are of considerable interest for diseases diagnosis and therapeutic applications so it is important to identify these proteins of interest. A lot of approaches have been investigated to achieve this, such as antibodies. However most of these antibody targets are also expressed on normal cells, which limit their relevance in diagnostic and therapeutic applications. T herefore, i t is important to identify unknown biomarkers with differential expression on cancer cells as opposed to healthy ones One of the advantages of c ellSELEX is its ability to develop molecular probes for upregulated or unique targets without prior knowledge of the identity of those targets T he target of an aptamer can be identified through affinity precipitation and subsequent polyacrylamide gel electrophoresis (PAGE) and mass spectrometry.76,77 O nce the targets of these aptamers are identified they will provide an opportunity to expand the aptamers application. So far, a lot of effort has been made to identify the target protein of aptamer TLS11a, but we have not yet been successful In the future, we will try cross linking to increase the interaction between the aptamer and target protein. This method was used to find the target to TD05, IgM in Ramos cells, and the scheme for that method is shown in Figure 51. Briefly, aptamer TLS11a will be modified with biotin and photoactive 5dUI, which will facilitate the cross linking between TLS11a and the target protein and help to maintain the aptamer protein complex through the cell membrane protein isolation and solubilization Then the aptamer protein complex will be extracted by streptavidin conjugated magnetic beads. The enriched proteins will then be separated by PAGE and identi fied by mass spectrometry.77

PAGE 128

128 Clinical A pplication T here is always a concern whether cell culture data can be translated to real clinical samples. Though cultured cell s can grow unchecked and proliferate rapidly providing readily assessable tumor specimen in cancer research, established cell lines often change in morphology and protein expression from their parental tumor as a result of their isolation and maintenance outside the body. Furthermore, creat ing a useful test to define a cancer type usually requires multiple cancer specific molecular probes In view of this, to really assess the real world applicability of our selected liver cancer, theyneed to be tested on real clinical samples

PAGE 129

129 Figure 5 1. Outline of the protocol for the identification of IGHM on Ramos cells using selected aptamers targeting whole cells.77

PAGE 130

130 LIST OF REFERENCES (1) Anand, P.; Kunnumakkara, A. B.; Sundaram, C.; Harikumar, K. B.; Tharakan, S. T.; Lai, O. S.; Sung, B.; Aggarwal, B. B. Pharm Res 2008, 25, 2097116. (2) Society, A. C. Cancer Facts & Figures 2010. (3) Weber, B. L. Cancer Cell 2002, 1 3747. (4) Ferrando, A. A.; Neuberg, D. S.; Staunton, J.; Loh, M. L.; Huard, C.; Raimondi, S. C.; Behm, F. G.; Pui, C. H.; Downing, J. R.; Gilliland, D. G.; Lander, E. S.; Golub, T. R.; Look, A. T. Cancer Cell 2002, 1 7587. (5) Golub, T. R.; Slonim, D. K.; Tamayo, P.; Huard, C.; Gaasenbeek, M.; Mesirov, J. P.; Coller, H.; Loh, M. L.; Downing, J. R.; Caligiuri, M. A.; Bloomfield, C. D.; Lander, E. S. Science 1999 286, 5317. (6) Alizadeh, A. A.; Eisen, M. B.; Davis, R. E.; Ma, C.; Lossos, I. S.; Rosenwald, A.; Boldrick, J. C.; Sabet, H.; Tran, T.; Yu, X.; Powell, J. I.; Yang, L.; Marti, G. E.; Moore, T.; Hudson, J., Jr.; Lu, L.; Lewis, D. B.; Tibshirani, R.; Sherlock, G.; Chan, W. C.; Greiner, T. C.; Weisenburger, D. D.; Armitage, J. O.; Warnke, R.; Levy, R.; Wilson, W.; Grever, M. R.; Byrd, J. C.; Botstein, D.; Brown, P. O.; Staudt, L. M. Nature 2000, 403, 50311. (7) Basso, K.; Liso, A.; Tiacci, E.; Benedetti, R.; Pulsoni, A.; Foa, R.; Di Raimondo, F.; Ambrosetti, A.; Califano, A.; Klein, U.; Dalla Favera, R.; Falini, B. J Exp Med 2004, 199, 5968. (8) Osborne, C. K.; Hamilton, B.; Titus, G.; Livingston, R. B. Cancer Res 1980, 40, 23616. (9) Olsson, A. K.; Dimberg, A.; Kreuger, J.; Claesson Welsh, L. Nat Rev Mol Cell Biol 2006, 7 35971. (10) Ariad, S.; Seymo ur, L.; Bezwoda, W. R. Breast Cancer Res Treat 1991, 20, 117. (11) Chan, J. M.; Stampfer, M. J.; Giovannucci, E.; Gann, P. H.; Ma, J.; Wilkinson, P.; Hennekens, C. H.; Pollak, M. Science 1998 279, 5636. (12) Hosen, N.; Park, C. Y.; Tatsumi, N.; Oji, Y .; Sugiyama, H.; Gramatzki, M.; Krensky, A. M.; Weissman, I. L. Proc Natl Acad Sci U S A 2007, 104, 1100813. (13) Hopkins, A. L.; Groom, C. R. Nat Rev Drug Discov 2002, 1 72730. (14) Zola, H. Mol Med 2006, 12, 3126.

PAGE 131

131 (15) Osborne, S. E.; Ellington, A D. Chem Rev 1997, 97, 349370. (16) Ciesiolka, J.; Yarus, M. RNA 1996 2 78593. (17) Hofmann, H. P.; Limmer, S.; Hornung, V.; Sprinzl, M. RNA 1997, 3 1289300. (18) Rajendran, M.; Ellington, A. D. Anal Bioanal Chem 2008, 390, 106775. (19) Geiger, A.; Burgstaller, P.; von der Eltz, H.; Roeder, A.; Famulok, M. Nucleic Acids Res 1996, 24, 102936. (20) Connell, G. J.; Illangesekare, M.; Yarus, M. Biochemistry 1993, 32, 5497502. (21) Harada, K.; Frankel, A. D. EMBO J 1995, 14, 5798811. (22) Wallis, M. G.; Streicher, B.; Wank, H.; von Ahsen, U.; Clodi, E.; Wallace, S. T.; Famulok, M.; Schroeder, R. Chem Biol 1997, 4 35766. (23) Wallace, S. T.; Schroeder, R. RNA 1998, 4 11223. (24) Nieuwlandt, D.; Wecker, M.; Gold, L. Biochemistry 1995, 34, 56519. (25) Williams, K. P.; Liu, X. H.; Schumacher, T. N.; Lin, H. Y.; Ausiello, D. A.; Kim, P. S.; Bartel, D. P. Proc Natl Acad Sci U S A 1997, 94, 1128590. (26) Tuerk, C.; MacDougal, S.; Gold, L. Proc Natl Acad Sci U S A 1992 89, 698892. (27) Chen, H.; McBroom, D. G.; Zhu, Y. Q.; Gold, L.; North, T. W. Biochemistry 1996, 35, 692330. (28) Dang, C.; Jayasena, S. D. J Mol Biol 1996, 264, 26878. (29) Kubik, M. F.; Stephens, A. W.; Schneider, D.; Marlar, R. A.; Tasset, D. Nucleic Acids Res 199 4 22, 261926. (30) Green, L. S.; Jellinek, D.; Jenison, R.; Ostman, A.; Heldin, C. H.; Janjic, N. Biochemistry 1996, 35, 1441324. (31) Wiegand, T. W.; Williams, P. B.; Dreskin, S. C.; Jouvin, M. H.; Kinet, J. P.; Tasset, D. J Immunol 1996, 157, 22130. (32) Davis, K. A.; Lin, Y.; Abrams, B.; Jayasena, S. D. Nucleic Acids Res 1998, 26, 391524. (33) Smith, D.; Kirschenheuter, G. P.; Charlton, J.; Guidot, D. M.; Repine, J. E. Chem Biol 1995, 2 74150.

PAGE 132

132 (34) Mallikaratchy, P.; Stahelin, R. V.; Cao, Z.; Cho, W.; Tan, W. Chem Commun (Camb) 2006, 322931. (35) Mendonsa, S. D.; Bowser, M. T. Anal Chem 2004, 76, 538792. (36) Morris, K. N.; Jensen, K. B.; Julin, C. M.; Weil, M.; Gold, L. Proc Natl Acad Sci U S A 1998, 95, 29027. (37) Hicke, B. J.; Marion, C.; Chang, Y. F.; Gould, T.; Lynott, C. K.; Parma, D.; Schmidt, P. G.; Warren, S. J Biol Chem 2001 276, 4864454. (38) Wang, C.; Zhang, M.; Yang, G.; Zhang, D.; Ding, H.; Wang, H.; Fan, M.; Shen, B.; Shao, N. J Biotechnol 2003, 102, 1522. (39) Cerchia, L.; Duconge, F.; Pestourie, C.; Boulay, J.; Aissouni, Y.; Gombert, K.; Tavitian, B.; de Franciscis, V.; Libri, D. PLoS Biol 2005, 3 e123. (40) Shangguan, D.; Cao, Z. C.; Li, Y.; Tan, W. Clin Chem 2007, 53, 11535. (41) Shangguan, D.; Meng, L.; Cao, Z. C.; Xiao, Z.; Fang, X.; Li, Y.; Cardona, D.; Witek, R. P.; Liu, C.; Tan, W. Anal Chem 2008, 80 7218. (42) Tang, Z.; Shangguan, D.; Wang, K.; Shi, H.; Sefah, K.; Mallikratchy, P.; Chen, H. W.; Li, Y.; Tan, W. Anal Chem 2007 79, 4900 7. (43) Chen, H. W.; Medley, C. D.; Sefah, K.; Shangguan, D.; Tang, Z.; Meng, L.; Smith, J. E.; Tan, W. ChemMedChem 2008, 3 9911001. (44) Sefah, K.; Tang, Z. W.; Shangguan, D. H.; Chen, H.; Lopez Colon, D.; Li, Y.; Parekh, P.; Martin, J.; Meng, L.; P hillips, J. A.; Kim, Y. M.; Tan, W. H. Leukemia 2009, 23, 23544. (45) Pan, W.; Craven, R. C.; Qiu, Q.; Wilson, C. B.; Wills, J. W.; Golovine, S.; Wang, J. F. Proc Natl Acad Sci U S A 1995, 92, 1150913. (46) Kumar, P. K.; Machida, K.; Urvil, P. T.; Kaki uchi, N.; Vishnuvardhan, D.; Shimotohno, K.; Taira, K.; Nishikawa, S. Virology 1997 237, 27082. (47) Misono, T. S.; Kumar, P. K. Anal Biochem 2005, 342, 3127. (48) Gopinath, S. C.; Misono, T. S.; Kawasaki, K.; Mizuno, T.; Imai, M.; Odagiri, T.; Kumar, P. K. J Gen Virol 2006, 87, 47987. (49) Tang, Z.; Parekh, P.; Turner, P.; Moyer, R. W.; Tan, W. Clin Chem 2009, 55, 81322. (50) Bruno, J. G.; Kiel, J. L. Biosens Bioelectron 1999, 14, 45764.

PAGE 133

133 (51) Hamula, C. L.; Zhang, H.; Guan, L. L.; Li, X. F.; Le, X. C. Anal Chem 2008, 80, 78129. (52) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 81822. (53) Gopinath, S. C. Anal Bioanal Chem 2007, 387, 17182. (54) Ch ou, S. H.; Chin, K. H.; Wang, A. H. Nucleic Acids Res 2003, 31, 246174. (55) Fang, X.; Sen, A.; Vicens, M.; Tan, W. Chembiochem 2003, 4 82934. (56) Guo, K.; Wendel, H. P.; Scheideler, L.; Ziemer, G.; Scheule, A. M. J Cell Mol Med 2005, 9 7316. (57) Daniels, D. A.; Chen, H.; Hicke, B. J.; Swiderek, K. M.; Gold, L. Proc Natl Acad Sci U S A 2003, 100, 15416 21. (58) Blank, M.; Weinschenk, T.; Priemer, M.; Schluesener, H. J Biol Chem 2001, 276, 164648. (59) Schmidt, K. S.; Borkowski, S.; Kurreck, J.; Stephens, A. W.; Bald, R.; Hecht, M.; Friebe, M.; Dinkelborg, L.; Erdmann, V. A. Nucleic Acids Res 2004 32, 575765. (60) Di Giusto, D. A.; Wlassoff, W. A.; Gooding, J. J.; Messerle, B. A.; King, G. C. Nucleic Acids Res 2005, 33, e64. (61) Shangguan, D .; Tang, Z.; Mallikaratchy, P.; Xiao, Z.; Tan, W. Chembiochem 2007, 8 6036. (62) Sefah, K.; Phillips, J. A.; Xiong, X.; Meng, L.; Van Simaeys, D.; Chen, H.; Martin, J.; Tan, W. Analyst 2009, 134, 176575. (63) Mairal, T.; Ozalp, V. C.; Lozano Sanchez, P.; Mir, M.; Katakis, I.; O'Sullivan, C. K. Anal Bioanal Chem 2008, 390, 9891007. (64) Navani, N. K.; Li, Y. Curr Opin Chem Biol 2006, 10, 27281. (65) Lee, J. O.; So, H. M.; Jeon, E. K.; Chang, H.; Won, K.; Kim, Y. H. Anal Bioanal Chem 2008, 390, 102332. (66) Willner, I.; Zayats, M. Angew Chem Int Ed Engl 2007, 46, 640818. (67) Lai, R. Y.; Plaxco, K. W.; Heeger, A. J. Anal Chem 2007 79, 22933. (68) Wu, Z. S.; Guo, M. M.; Zhang, S. B.; Chen, C. R.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Anal Ch em 2007, 79 29339.

PAGE 134

134 (69) Su, S.; Nutiu, R.; Filipe, C. D.; Li, Y.; Pelton, R. Langmuir 2007, 23, 13002. (70) Xiao, Y.; Piorek, B. D.; Plaxco, K. W.; Heeger, A. J. J Am Chem Soc 2005, 127, 17990 1. (71) Rupcich, N.; Nutiu, R.; Li, Y.; Brennan, J. D. An al Chem 2005, 77, 43007. (72) Huang, Y. C.; Ge, B.; Sen, D.; Yu, H. Z. J Am Chem Soc 2008, 130, 80239. (73) Fischer, N. O.; Tarasow, T. M.; Tok, J. B. Anal Biochem 2008, 373, 1218. (74) Zhou, L.; Ou, L. J.; Chu, X.; Shen, G. L.; Yu, R. Q. Anal Chem 2 007 79, 7492500. (75) Yang, L.; Fung, C. W.; Cho, E. J.; Ellington, A. D. Anal Chem 2007 79, 33209. (76) Shangguan, D.; Cao, Z.; Meng, L.; Mallikaratchy, P.; Sefah, K.; Wang, H.; Li, Y.; Tan, W. J Proteome Res. 2008, 7 21332139. (77) Mallikaratchy, P.; Tang, Z.; Kwame, S.; Meng, L.; Shangguan, D.; Tan, W. Mol Cell Proteomics 2007, 6 22308. (78) Shangguan, D.; Li, Y.; Tang, Z.; Cao, Z. C.; Chen, H. W.; Mallikaratchy, P.; Sefah, K.; Yang, C. J.; Tan, W. Proc Natl Acad Sci U S A 2006, 103, 11838 43. (79) White, R. R.; Shan, S.; Rusconi, C. P.; Shetty, G.; Dewhirst, M. W.; Kontos, C. D.; Sullenger, B. A. Proc Natl Acad Sci U S A 2003, 100, 502833. (80) Sullenger, B. A.; Gilboa, E. Nature 2002, 418, 2528. (81) Nimjee, S. M.; Rusconi, C. P.; Harrington, R. A.; Sullenger, B. A. Trends Cardiovasc Med 2005, 15, 415. (82) Famulok, M.; Hartig, J. S.; Mayer, G. Chem Rev 2007, 107, 371543. (83) Osborne, S. E.; Matsumura, I.; Ellington, A. D. Curr Opin Chem Biol 1997, 1 5 9. (84) Hicke, B. J.; Stephens, A. W. J Clin Invest 2000, 106, 9238. (85) Healy, J. M.; Lewis, S. D.; Kurz, M.; Boomer, R. M.; Thompson, K. M.; Wilson, C.; McCauley, T. G. Pharm Res 2004, 21, 223446. (86) Willis, M.; Forssen, E. Adv Drug Deliv Rev 1998, 29, 249271.

PAGE 135

135 (87) Hicke, B. J.; Stephens, A. W.; Gould, T.; Chang, Y. F.; Lynott, C. K.; Heil, J.; Borkowski, S.; Hilger, C. S.; Cook, G.; Warren, S.; Schmidt, P. G. J Nucl Med 2006, 47, 66878. (88) Shi, H.; Tang, Z.; Kim, Y.; Nie, H.; Huang, Y. F.; He, X.; Deng, K.; Wang, K.; Tan, W. Chem Asian J 5 220913. (89) Farokhzad, O. C.; Jon, S.; Khademhosseini, A.; Tran, T. N.; Lavan, D. A.; Langer, R. Cancer Res 2004, 64, 766872. (90) Dellaire, G.; Nisman, R.; Eskiw, C. H.; BazettJones, D. P. Nucleic Acids Res 2004, 32, e165. (91) Borbas, K. E.; Ferreira, C. S.; Perkins, A.; Bruce, J. I.; Missailidis, S. Bioconjug Chem 2007 18, 120512. (92) Bagalkot, V.; Zhang, L.; Levy Nissenbaum, E.; Jon, S.; Kantoff, P. W.; Langer, R.; Farokhzad, O. C. N ano Lett 2007, 7 306570. (93) Bagalkot, V.; Farokhzad, O. C.; Langer, R.; Jon, S. Angew Chem Int Ed Engl 2006, 45, 814952. (94) Dhar, S.; Gu, F. X.; Langer, R.; Farokhzad, O. C.; Lippard, S. J. Proc Natl Acad Sci U S A 2008, 105, 17356 61. (95) Farok hzad, O. C.; Cheng, J.; Teply, B. A.; Sherifi, I.; Jon, S.; Kantoff, P. W.; Richie, J. P.; Langer, R. Proc Natl Acad Sci U S A 2006, 103, 631520. (96) Wang, A. Z.; Bagalkot, V.; Vasilliou, C. C.; Gu, F.; Alexis, F.; Zhang, L.; Shaikh, M.; Yuet, K.; Cima, M. J.; Langer, R.; Kantoff, P. W.; Bander, N. H.; Jon, S.; Farokhzad, O. C. ChemMedChem 2008, 3 13115. (97) Zhang, L.; Radovic Moreno, A. F.; Alexis, F.; Gu, F. X.; Basto, P. A.; Bagalkot, V.; Jon, S.; Langer, R. S.; Farokhzad, O. C. ChemMedChem 2007, 2 126871. (98) Chu, T. C.; Marks, J. W., 3rd; Lavery, L. A.; Faulkner, S.; Rosenblum, M. G.; Ellington, A. D.; Levy, M. Cancer Res 2006, 66, 598992. (99) Tong, G. J.; Hsiao, S. C.; Carrico, Z. M.; Francis, M. B. J Am Chem Soc 2009, 131, 111748. (100) McNamara, J. O., 2nd; Andrechek, E. R.; Wang, Y.; Viles, K. D.; Rempel, R. E.; Gilboa, E.; Sullenger, B. A.; Giangrande, P. H. Nat Biotechnol 2006, 24, 100515.

PAGE 136

136 (101) Dassie, J. P.; Liu, X. Y.; Thomas, G. S.; Whitaker, R. M.; Thiel, K. W.; Stockdale, K. R.; Meyerholz, D. K.; McCaffrey, A. P.; McNamara, J. O., 2nd; Giangrande, P. H. Nat Biotechnol 2009, 27, 83949. (102) Zhou, J.; Li, H.; Li, S.; Zaia, J.; Rossi, J. J. Mol Ther 2008, 16, 14819. (103) Zhou, J.; Swiderski, P.; Li, H.; Zhang, J.; Neff, C. P.; Akkina, R.; Rossi, J. J. Nucleic Acids Res 2009, 37, 3094109. (104) Wullner, U.; Neef, I.; Eller, A.; Kleines, M.; Tur, M. K.; Barth, S. Curr Cancer Drug Targets 2008, 8 55465. (105) Chu, T. C.; Twu, K. Y.; Ellington, A. D.; Levy, M. Nucleic Acid s Res 2006, 34, e73. (106) Tasch, J.; Gong, M.; Sadelain, M.; Heston, W. D. Crit Rev Immunol 2001, 21, 24961. (107) Zhou, J.; Rossi, J. J. Silence 2010 1 4. (108) Ng, E. W.; Shima, D. T.; Calias, P.; Cunningham, E. T., Jr.; Guyer, D. R.; Adamis, A. P. Nat Rev Drug Discov 2006, 5 12332. (109) Griffin, L. C.; Toole, J. J.; Leung, L. L. Gene 1993, 137, 2531. (110) Li, W. X.; Kaplan, A. V.; Grant, G. W.; Toole, J. J.; Leung, L. L. Blood 1994, 83, 67782. (111) Bates, P. J.; Laber, D. A.; Miller, D. M.; Thomas, S. D.; Trent, J. O. Exp Mol Pathol 2009, 86, 15164. (112) Teng, Y.; Girvan, A. C.; Casson, L. K.; Pierce, W. M., Jr.; Qian, M.; Thomas, S. D.; Bates, P. J. Cancer Res 2007, 67, 10491500. (113) Farazi, P. A.; DePinho, R. A. Nat Rev Cancer 2006, 6 67487. (114) ElAneed, A.; Banoub, J. Anticancer Res 2006, 26, 3293300. (115) Jayasena, S. D. Clin Chem 1999 45, 162850. (116) Breaker, R. R. Nature 2004, 432, 83845. (117) Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, N. J.; Tan, W. Proc Natl Acad Sci U S A 2005, 102, 1727883. (118) Nutiu, R.; Li, Y. Angew C hem Int Ed Engl 2005, 44, 54647. (119) Liu, J.; Lu, Y. Angew Chem Int Ed Engl 2005, 45, 904.

PAGE 137

137 (120) Cerchia, L.; Hamm, J.; Libri, D.; Tavitian, B.; de Franciscis, V. FEBS Lett 2002, 528, 126. (121) Brown, M.; Wittwer, C. Clin Chem 2000, 46, 12219. ( 122) ATCC http://www.atcc.org/common/catalog/numSearch/numResults.cfm?atccNum)TIB 75 (123) Tatsumi, T.; Takehara, T.; Kanto, T.; Miyagi, T.; Kuzushita, N.; Sugimoto, Y.; Jinushi, M.; Kasahara, A.; Sasaki, Y.; Hori, M.; Hayashi, N. Cancer Res 2001, 61, 75637. (124) Rougier, P.; Mitry, E.; Barbare, J. C.; Taieb, J. Semin Oncol 2007, 34, S12 20. (125) Wang, X. W.; Hussain, S. P.; Huo, T. I.; Wu, C. G.; Forgues, M.; Hofseth, L. J.; Brechot, C.; Harris, C. C. Toxicology 2002, 181182, 437. (126) Lee, H. C.; Kim, M.; Wands, J. R. Front Biosci 2006, 11, 190115. (127) Thorgeirsson, S. S.; Lee, J. S.; Gri sham, J. W. Hepatology 2006, 43, S14550. (128) Paradis, V.; Bedossa, P. J Hepatol 2007, 46 9 11. (129) Seow, T. K.; Liang, R. C.; Leow, C. K.; Chung, M. C. Proteomics 2001, 1 124963. (130) Carter, P. J.; Senter, P. D. Cancer J 2008, 14, 15469. (131) Chari, R. V. Acc Chem Res 2008, 41, 98107. (132) Huang, Y. F.; Shangguan, D.; Liu, H.; Phillips, J. A.; Zhang, X.; Chen, Y.; Tan, W. Chembiochem 2009, 10 8628. (133) Mallikaratchy, P.; Tang, Z.; Tan, W. ChemMedChem 2008, 3 4258. (134) Flinders, J.; DeFina, S. C.; Brackett, D. M.; Baugh, C.; Wilson, C.; Dieckmann, T. Chembiochem 2004 5 6272. (135) Patel, D. J.; Suri, A. K.; Jiang, F.; Jiang, L.; Fan, P.; Kumar, R. A.; Nonin, S. J Mol Biol 1997, 272, 64564. (136) Zhu, H.; Dong, H.; Eksioglu, E.; Hemming, A.; Cao, M.; Crawford, J. M.; Nelson, D. R.; Liu, C. Gastroenterology 2007, 133, 164959. (137) Chaires, J. B.; Herrera, J. E.; Waring, M. J. Biochemistry 1990, 29, 614553.

PAGE 138

138 (138) Lipscomb, L. A.; Peek, M. E.; Zhou, F. X.; Bertrand, J. A.; VanDerveer, D.; Williams, L. D. Biochemistry 1994, 33, 364959. (139) N. Husain; R. A. Agbaria; Warner, I. M. J. Phys. Chem. 1993, 97, 1085710861. (140) Yan, Q.; Priebe, W.; Chaires, J. B.; Czernuszewicz, R. S. Biospectroscopy 1997, 3 307316. (141) Haj, H. T.; Salerno, M.; Priebe, W.; Kozlowski, H.; GarnierSuillerot, A. Chem Biol Interact 2003, 145, 34958. (142) Cory, A. H.; Owen, T. C.; Barltrop, J. A.; Cory, J. G. Cancer Commun 1991, 3 20712. (143) Salvesen, G. S. Cell Death Differ 2002, 9 3 5. (144) Ghavami, S.; Hashemi, M.; Ande, S. R.; Yeganeh, B.; Xiao, W.; Eshraghi, M.; Bus, C. J.; Kadkhoda, K.; Wiechec, E.; Halayko, A. J.; Los, M. J Med Genet 2009, 46, 497510. (145) Lee, Y.; Park, S. Y.; Mok, H.; Park, T. G. Bioconjug Chem 20 08, 19 52531. (146) Boudeau, J.; MirandaSaavedra, D.; Barton, G.; Alessi, D. Trends Cell Biol. 2006, 16, 443452. (147) Mossie, K.; Jallal, B.; Alves, F.; Sures, I.; Plowman, G.; Ullrich, A. Oncogene 1995, 11, 21792184. (148) Park, S. K.; Lee, H. S. ; Lee, S. T. J. Biochem 1996, 119, 235239. (149) Kroiher, M.; Miller, M.; Steele, R. Bioessays. 2001, 23, 6976. (150) Saha, S.; Bardelli, A.; Buckhaults, P.; Velculescu, V. E.; Rago, C.; Croix, B. S.; Romans, K. E.; Choti, M. A.; Lengauer, C.; Kinzler, K. W.; Vogelstein, B. Science 2001 294, 13431346. (151) Gorringe, K. L.; Boussioutas, A.; Bowtell, D. D. Genes Chromosomes Cancer 2005, 42, 247259. (152) Endoh, H.; Tomida, S.; Yatabe, Y.; Konishi, H.; Osada, H.; Tajima, K.; Kuwano, H.; Takahashi, T. ; Mitsudomi, T. J Clin Oncol. 2004, 22, 811819. (153) Mller Tidow, C.; Schwble, J.; Steffen, B.; Tidow, N.; Brandt, B.; Becker, K.; Schulze Bahr, E.; Halfter, H.; Vogt, U.; Metzger, R.; Schneider, P.; Bchner, T.; Brandts, C.; Berdel, W.; Serve, H. Clin Cancer Res. 2004, 10, 12411249. (154) Katoh, M.; Katoh, M. Int J Mol Med. 2007, 20, 405409.

PAGE 139

139 (155) Lu, X.; Borchers, A.; Jolicoeur, C.; Rayburn, H.; Baker, J.; Tessier Lavigne, M. Nature 2004, 430, 9398. (156) Shin, W.; Maeng, Y.; Jung, J.; Min, J.; Kwon, Y.; Lee, S. Biochem Biophys Res Commun. 2008, 371, 793798. (157) Alnemri, E.; Livingston, D.; Nicholson, D.; Salvesen, G.; Thornberry, N.; Wong, W.; Yuan, J. Cell 1996, 18, 171. (158) Thornberry, N.; Lazebnik, Y. Science 1998, 281, 13121316. (159) Earnshaw, W.; Martins, L.; Kaufmann, S. Annu Rev Biochem. 1999, 68, 383424. (160) Boatright, K.; Salvesen, G. Curr Opin Cell Biol. 2003, 15, 725731. (161) Carlo Stella, C.; Lavazza, C.; Locatelli, A.; Vigano, L.; Gianni, A. M.; Gianni, L. Clin Cancer Res 2007, 13, 23137. (162) Green, D.; Kroemer, G. Science 2004, 305, 626629. (163) Scaffidi, C.; Fulda, S.; Srinivasan, A.; Friesen, C.; Li, F.; Tomaselli, K.; Debatin, K.; Krammer, P.; Peter, M. EMBO J. 1998, 17, 16751687. (164) Fernandes Alnemri, T.; Armstrong, R.; Krebs, J.; Srinivasula, S.; Wang, L.; Bullrich, F.; Fritz, L.; Trapani, J.; Tomaselli, K.; Litwack, G.; Alnemri, E. Proc Natl Acad Sci U S A. 1996, 93, 74647469. (165) Filomenko, R.; Prvotat, L.; Rb, C.; Cortier, M.; Jeannin, J.; Solary, E.; Bettaieb, A. Oncogene 2006, 7 76357645. (166) Harada, K.; Toyooka, S.; Shivapurkar, N.; Maitra, A.; Reddy, J.; Matta, H.; Miyajima, K.; Timmons, C.; Tomlinson, G.; Mastrangelo, D.; Hay, R.; Chaudhary, P.; Gazdar, A. cancer R es. 2002, 62, 58975901. (167) MS, S.; HS, K.; CS, K.; WS, P.; SY, K.; SN, L.; JH, L.; JY, P.; JJ, J.; CW, K.; SH, K.; JY, L.; NJ, Y.; SH, L. Blood 2002 99, 409404099. (168) Shin, M.; Kim, H.; Lee, S.; Lee, J.; Song, Y.; Kim, Y.; Park, W.; Kim, S.; Lee, S.; Park, J.; Lee, J.; Xiao, W.; Jo, K.; Wang, Y.; Lee, K.; Park, Y.; Kim, S.; Lee, J.; Yoo, N. Oncogene 2002, 21, 41294136. (169) Park, S.; Wu, C.; Gordon, J.; Zhong, X.; Em ami, A.; Safa, A. J Biol Chem. 2004, 278, 5105751067. (170) Fire, A.; Xu, S.; Montgomery, M.; Kostas, S.; Driver, S.; Mello, C. Nature 1998, 391, 806811. (171) Zhao, Y.; Srivastava, D. Trends Biochem Sci 2007, 32, 18997.

PAGE 140

140 (172) Pillai, R. S.; Bhattach aryya, S. N.; Filipowicz, W. Trends Cell Biol 2007, 17, 11826. (173) Zamore, P.; Tuschl, T.; Sharp, P.; Bartel, D. Cell 2000, 101, 2533. (174) Siomi, H.; Siomi, M. C. Nature 2009, 457, 396404. (175) Vermeulen, A.; Behlen, L.; Reynolds, A.; Wolfson, A .; Marshall, W. S.; Karpilow, J.; Khvorova, A. RNA 2005, 11, 67482. (176) Castanotto, D.; Rossi, J. J. Nature 2009, 457, 42633. (177) Qiu, S.; Adema, C. M.; Lane, T. Nucleic Acids Res 2005, 33, 183447. (178) Ahlquist, P. Science 2002, 296, 12703. ( 179) Elbashir, S.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Nature 2001, 411, 494498. (180) McNamara, J. n.; Andrechek, E.; Wang, Y.; Viles, K.; Rempel, R.; Gilboa, E.; Sullenger, B.; Giangrande, P. Nat Biotechnol. 2006, 24, 10051015. (181) Devi, G. Cancer Gene Ther. 2006, 13, 819829. (182) Karagiannis, T.; El Osta, A. Cancer Gene Ther. 2005, 12 787795. (183) Towbin, H.; Staehelin, T.; Gordon, J. Proc Natl Acad Sci U S A 1979 76, 43504. (184) Renart, J.; Reiser, J.; Stark, G. R. Proc Natl Acad Sci U S A 1979, 76, 311620. (185) Zipper, H.; Brunner, H.; Bernhagen, J.; Vitzthum, F. Nucleic Acids Res 2004, 32, e103. (186) Mackay, I. M.; Arden, K. E.; Nitsche, A. Nucleic Acids Res 2002, 30, 1292305. (187) Matlashewski, G.; Lamb, P.; Pim, D.; Peacock, J.; Crawford, L.; Benchimol, S. EMBO J 1984, 3 325762. (188) Bunz, F.; Dutriaux, A.; Lengauer, C.; Waldman, T.; Zhou, S.; Brown, J. P.; Sedivy, J. M.; Kinzler, K. W.; Vogelstein, B. Science 1998 282, 1497501. (189) Kaeser, M. D.; Pebernard, S.; Iggo, R. D. J Biol Chem 2004, 279, 7598605. (190) Dornburg, R.; Pomerantz, R. J. Adv Pharmacol 2000, 49, 22961.

PAGE 141

141 (191) Dykxhoorn, D. M.; Novina, C. D.; Sharp, P. A. Nat Rev Mol Cell Biol 2003, 4 45767.

PAGE 142

142 BIOGRAPHICAL SKETCH Ling Meng was born in Urumchi, China in 1980. She spent her childhood mainly in Binzhou, Shandong. After completing the basic and senior high school, she attended the Shandong University and obtained her bachelors degree in Microbiology in 2003. Inspired by the environment of the school, her family and friends she deci ded to go abroad to continue her research career. She joined the University of Florida in 2005 and received her PhD degree in Chemistry in December 2010 under the tutorage of Dr Weihong Tan.