<%BANNER%>

Effect of Dietary Iron Deficiency and Overload on Zip14 Expression in Rats

Permanent Link: http://ufdc.ufl.edu/UFE0042392/00001

Material Information

Title: Effect of Dietary Iron Deficiency and Overload on Zip14 Expression in Rats
Physical Description: 1 online resource (137 p.)
Language: english
Creator: Nam, Hye
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Nutritional Sciences -- Dissertations, Academic -- UF
Genre: Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Zip14 (solute carrier family 39, member of 14, SLC39A14) is a transmembrane metal-ion transporter. The mammalian ZIP (Zrt-, Irt-like Protein) family of transmembrane transporters consists of 14 members. Zip14 has been shown to transport iron as well as zinc into hepatocytes. The studies described here investigated the relationship between Zip14 and iron status by using animal models of dietary iron deficiency and overload. Weanling male Sprague-Dawley rats were fed modified AIN-93G purified rodent diets that contained 10 ppm iron (FeD), 50 ppm iron (FeA) or 1.9% carbonyl iron (2% FeO) for 3 wks. Zip14 expressions in three major iron-loading tissues were analyzed: the liver, pancreas and heart. Hepatic Zip14 protein levels did not differ in response to dietary iron status. In the pancreas and heart, Zip14 protein levels were significantly up-regulated by 2% carbonyl iron. The higher levels of Zip14 protein were not associated with higher levels of Zip14 mRNA, indicating that Zip14 expression is post-transcriptionally regulated by iron. The localization of Zip14 expression was performed by immunohistochemistry with the three major important tissues in the iron metabolism: liver, pancreas, and duodenum. In the liver, Zip14 protein was highly localized in the hepatocyte membrane along with sinusoids by 2% carbonyl iron. In the pancreas, highly intense Zip14 immunostaining was localized on perinuclear regions and the plasma membrane in acinar cells. In the duodenum, the immunostaining of Zip14 was faint in FeD, but unexpectedly, 2% FeO showed strong signals of Zip14 in the basolateral membrane of the villus region. To test whether some of the ZIP family members respond to dietary iron status in the liver, the mRNA expression of ZIP family transporters was analyzed by qRT-PCR. ZIP5 mRNA expression was highly induced in iron-loaded rat livers relative to the control livers. In addition, the levels of ZIP6, ZIP7, and ZIP10 mRNA were significantly down-regulated by dietary iron overload. However, dietary iron deficiency and overload also induced small, but significant, modulation in hepatic levels of other metals. Thus, it is possible that differences in the levels of these metals affected the ZIP expression. Collectively, these observations suggest that ZIP5, ZIP6, ZIP7, ZIP10 may play a role in hepatic iron/metal homeostasis during iron deficiency and iron overload.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Hye Nam.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Knutson, Mitchell D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042392:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042392/00001

Material Information

Title: Effect of Dietary Iron Deficiency and Overload on Zip14 Expression in Rats
Physical Description: 1 online resource (137 p.)
Language: english
Creator: Nam, Hye
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Nutritional Sciences -- Dissertations, Academic -- UF
Genre: Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Zip14 (solute carrier family 39, member of 14, SLC39A14) is a transmembrane metal-ion transporter. The mammalian ZIP (Zrt-, Irt-like Protein) family of transmembrane transporters consists of 14 members. Zip14 has been shown to transport iron as well as zinc into hepatocytes. The studies described here investigated the relationship between Zip14 and iron status by using animal models of dietary iron deficiency and overload. Weanling male Sprague-Dawley rats were fed modified AIN-93G purified rodent diets that contained 10 ppm iron (FeD), 50 ppm iron (FeA) or 1.9% carbonyl iron (2% FeO) for 3 wks. Zip14 expressions in three major iron-loading tissues were analyzed: the liver, pancreas and heart. Hepatic Zip14 protein levels did not differ in response to dietary iron status. In the pancreas and heart, Zip14 protein levels were significantly up-regulated by 2% carbonyl iron. The higher levels of Zip14 protein were not associated with higher levels of Zip14 mRNA, indicating that Zip14 expression is post-transcriptionally regulated by iron. The localization of Zip14 expression was performed by immunohistochemistry with the three major important tissues in the iron metabolism: liver, pancreas, and duodenum. In the liver, Zip14 protein was highly localized in the hepatocyte membrane along with sinusoids by 2% carbonyl iron. In the pancreas, highly intense Zip14 immunostaining was localized on perinuclear regions and the plasma membrane in acinar cells. In the duodenum, the immunostaining of Zip14 was faint in FeD, but unexpectedly, 2% FeO showed strong signals of Zip14 in the basolateral membrane of the villus region. To test whether some of the ZIP family members respond to dietary iron status in the liver, the mRNA expression of ZIP family transporters was analyzed by qRT-PCR. ZIP5 mRNA expression was highly induced in iron-loaded rat livers relative to the control livers. In addition, the levels of ZIP6, ZIP7, and ZIP10 mRNA were significantly down-regulated by dietary iron overload. However, dietary iron deficiency and overload also induced small, but significant, modulation in hepatic levels of other metals. Thus, it is possible that differences in the levels of these metals affected the ZIP expression. Collectively, these observations suggest that ZIP5, ZIP6, ZIP7, ZIP10 may play a role in hepatic iron/metal homeostasis during iron deficiency and iron overload.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Hye Nam.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Knutson, Mitchell D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042392:00001


This item has the following downloads:


Full Text

PAGE 1

1 EFFECT OF DIETARY IRON DEFICIENCY AND OVERLOAD ON ZIP14 EXPRESSION IN RATS By HYEYOUNG NAM A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DE GREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Hyeyoung Nam

PAGE 3

3 To my parents, Youngsoon Youn and Sangkyung Nam

PAGE 4

4 ACKNOWLEDGMENTS The last five years have been the most valuable time in my life. I have been encouraged by many p eople. Without their support, this dissertation would not have been possible I would like to express the deepest appreciation to my advisor, Dr. Mitchell D. Knutson. He gave me the chance to study molecular nutrition i n the U.S.A. At the beginning, I di even the basic s of experimentation. When I made my first mistake, I was very depressed but he taught me that making mistake s in science is good and most success es come from mistakes. I was very imp ressed and adopted a more positive attitude in my research I have been learning from him what I need to know to be a good professor and scientist. Without his persistent help and guidance this dissertation would not have been successful. Additionally, I would like to thank each of my committee members: Dr. Robert J. Cousins, Dr. Bobbi Langkamp Henken, and Dr. Christiaan Leeuwenburgh They were abundantly helpful and offered invaluable assistance, support and guidance. Their efforts for my dissertation were highly valued and appreciated. A s pecial thank you also goes to all my lab members: Ningning Zhao, Supak Jenkitkasemwong, Chia Yu Wang, Charlie Michaudet, Stephanie Duarte, who are my best friends and colleagues. The times that I spen t in Dr. Knutso happy because of their nice personalit ies Finally, I would like to thank my family, especially my mom Youngsoon Youn, and old er sister, Hyeran Nam for their support and encourag ement for me to pursue this degree. I m also appreciati ve to my second family: my best friend, Minjung Shin, and her mom, for teaching me how to be a better person.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 16 History of Iron in Nutrition ................................ ................................ ....................... 16 Iron Metabolism ................................ ................................ ................................ ...... 1 6 Functions of Iron ................................ ................................ ............................... 16 Distribution of Total Body Iron ................................ ................................ .......... 17 Iron Recycling ................................ ................................ ................................ ... 18 Iron Storage ................................ ................................ ................................ ...... 19 Iron Excretion ................................ ................................ ................................ ... 19 Regulation of Iron Metabolism ................................ ................................ ................ 20 Dietary Iron Absorption ................................ ................................ ..................... 20 Regulators of Iron Absorption ................................ ................................ ........... 21 Cellular Iron Uptake and Export Proteins ................................ ......................... 22 Iron Transport to Peripheral Tissues ................................ ................................ 34 Molecular Reg ulation of Iron Transport Proteins ................................ ..................... 35 Transcriptional Regulation ................................ ................................ ................ 36 Post Transcriptional Regulation ................................ ................................ ....... 37 Post Translational Regulation ................................ ................................ .......... 39 Liver Iron Metabolism ................................ ................................ .............................. 40 Function of Livers in Iron Meta bolism ................................ ............................... 40 Hepcidin ................................ ................................ ................................ ........... 41 Hepatic Iron Uptake ................................ ................................ .......................... 43 Dietary Iron Defici ency and Overload ................................ ................................ ..... 51 Dietary Iron Deficiency ................................ ................................ ..................... 51 Iron Overload Disorders ................................ ................................ ................... 53 2 MATERIALS AND METHODS ................................ ................................ ................ 55 Cell Culture ................................ ................................ ................................ ....... 55 Antibodies ................................ ................................ ................................ ......... 55 Rats for Dietary Iron Status and Immunohistochemistry (IHC) ......................... 56 Blood and Tissue Collections ................................ ................................ ........... 57

PAGE 6

6 Serum Iron, Total Iron Bindin g Capacity, and Tf saturation (%) ....................... 57 Non Heme Iron Determination ................................ ................................ .......... 58 RNA Isolation and Quantitative RT PCR ................................ .......................... 58 Isolation of Crude Membrane Protein and Western Blot Analysis .................... 59 Immunoprecipitation (IP) ................................ ................................ .................. 59 Tissues Frozen Sections for Immunohistochemistry ................................ ........ 60 Eosin Staining ................................ ...... 61 Statistical Analysis ................................ ................................ ............................ 62 3 EFFECT OF DIETARY IRON DEFICIENCY AND OVERLOAD ON ZIP14 LEVELS AND LOCALIZATION IN VARIOUS RAT TISSUES ................................ 63 Results ................................ ................................ ................................ .................... 66 Effect of FeD and 2% FeO on Rat Body Weight ................................ ............... 66 Characterization of the Immunoreactivity of Anti Zip14 Antibody ..................... 66 Hepatic Zip14 is Glycosylated ................................ ................................ .......... 67 Effect of FeD and 2% FeO on Hepatic Zip14 mRNA and Protein Levels ......... 67 Effect of FeD and 2% FeO on Pancreatic Zip14 and DMT1 mRNA and Protein Levels ................................ ................................ ............................... 68 Effect of FeD and 2% FeO on Heart Zip14 and DMT1 Protein Levels ............. 68 Histological Examinations of Liver and Pancreas ................................ ............. 68 Localization of Zip14 in Liver, Pancreas, and Duodenum ................................ 69 Discussion ................................ ................................ ................................ .............. 70 4 EFFECT OF DIETARY IRON DEFICIENCY AND OVERLOAD ON THE EXPRESSION OF THE ZIP FAMILY OF METAL ION TRANSPORTERS IN RAT LIVER ................................ ................................ ................................ ............. 77 Results ................................ ................................ ................................ .................... 79 Mineral Contents of the Experiment Diets ................................ ........................ 79 Effect of FeD and 3% FeO on Bod y Weight in Rats ................................ ......... 79 Blood and Tissue Iron Status in FeD, FeA, and 3% FeO Fed Rats .................. 79 Liver Mineral Concentrations in FeD, FeA, a nd 3% FeO Fed Rats .................. 80 Effect of FeD and FeO on Hepatic ZIP Transporter mRNA Levels ................... 80 Relative Transcript Abundances of ZIP Fami ly Transporters in Rat Liver ........ 81 Discussion ................................ ................................ ................................ .............. 82 5 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 105 Conclusions ................................ ................................ ................................ .......... 105 Future Directions ................................ ................................ ................................ .. 108 APPENDIX A CELLULAR IRON DEFICIENCY AND IRON LOADING ON ZIP14 mRNA LEVEL IN MOUSE HEPATOCYTES ................................ ................................ .... 111

PAGE 7

7 B CELLULAR IRON DEFICIENCY ON ZIP14 AND ZIP8 mRNA LEVELS IN RAT HEPATOMA CELLS ................................ ................................ ............................. 112 LIST OF REFERE NCES ................................ ................................ ............................. 113 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 137

PAGE 8

8 LIST OF TABLES Table Page 3 1 Effect of dietary iron def iciency and 2% carbonyl iron on blood iron status in rats ................................ ................................ ................................ ..................... 8 8 3 2 Effect of dietary iron deficiency and 2% carbonyl iron on non heme iron in rat tissues ................................ ................................ ................................ ................ 88 4 1. Primers used for qRT PCR ................................ ................................ ................. 97 4 2. Mineral contents of the experiment diets ................................ ............................ 98 4 3. Blood iron status in iron deficient, adequate and 3% carbonyl iron fed rats ..... 100 4 4. Tissues non heme iron levels in iron deficient, adequate and 3% carbonyl iron fed rats ................................ ................................ ................................ ....... 100

PAGE 9

9 LIST OF FIGURES Figure page 3 1 Effect of dietary iron deficiency and 2% carbonyl iron on body weight in rats. ... 87 3 2 Characterization of the immunoreactivity of anti Zip14 antibody ........................ 8 9 3 3 Hepatic Zip14 is glycosylated. ................................ ................................ ............ 90 3 4 Effect of iron deficiency and 2% carbonyl iron on hepatic Zip14 mRNA and protein levels ................................ ................................ ................................ ...... 91 3 5 Effect of iron defi ciency and 2% carbonyl iron on pancreatic Zip14 and DMT1 mRNA and protein levels. ................................ ................................ ................... 92 3 6 Effect of iron deficiency and 2% carbonyl iron on heart Zip14 and DMT1 protein levels. ................................ ................................ ................................ ..... 93 3 7 Hematoxylin and Eosin staining of liver tissue from rats fed iron deficient, iron adequate and 2% carbonyl iron diets. ................................ ......................... 94 3 8 Perls Prussian blue staining of liver tissue from rats fed iron deficient, iron adequate and 2% carbonyl iron diets ................................ ................................ 94 3 9 Perls Prussian blue staining of pancreas tissue from rats iron deficient, iron adequate and 2% carbonyl iron diets ................................ ................................ 95 3 10 Localization of Zip14 in liver, pancreas, and duodenum from rats fed iron deficient, adequate and 2% carbonyl iron diets. ................................ ................. 96 4 1 Effect of dietary iron deficiency and 3% carbonyl iron on body weight in rats .... 99 4 2 Liver mineral concentrations in iron deficient, adequate and 3% carbonyl iron fed rats. ................................ ................................ ................................ ............ 10 1 4 3 Hepatic mRNA levels of ZIP family members in r esponse to dietary iron deficiency and 3% carbonyl iron. ................................ ................................ ...... 102 4 4 Hepatic mRNA levels of Zip family members in response to dietary iron deficiency and 2% carbonyl iron. ................................ ................................ ...... 103 4 5 Relative transcrip t abundance of ZIP family transporters in iron adequate rat livers. ................................ ................................ ................................ ................ 104 A 1 Cellular iron deficiency and iron loading on Zip14 mRNA levels in mouse hepatocytes. ................................ ................................ ................................ ..... 111

PAGE 10

10 B 1. Cellular iron deficiency on Zip14 and Zip8 mRNA levels in rat hepatoma cells. ................................ ................................ ................................ ................. 112

PAGE 11

11 LIST OF ABBREVIATIONS BMP Bone morphogenetic protein BSA Bovine serum albumin C d Cadmium Co Cobalt Cp Ceruloplas min Cu Copper Dcytb Duodenal cytochrome B DFO Desferrioxamine DMEM DMT1 D ivalent metal transporter 1 FAC Ferric ammonium citrate Fe NTA Ferric nitrilotriacetate FPN1 Ferroportin 1 H&E Hematoxylin and eosin stain GI G astr ointestinal Hb Hemoglobin HCP1 Heme carrier protein 1 HCT Hematocrit HEPES 4 (2 hydroxyethyl) 1 piperazineethanesulfonic acid HFE Gene mutated in the most common form of hemochromatosis HH Hereditary hemochromatosis H IF Hypoxia inducible factor HO H eme oxy genase HRP H orseradish peroxidase

PAGE 12

12 ICP MS Inductively coupled plasma mass spectrometry ID Iron deficiency IDA Iron deficiency anemia IHC Immunohistochemistry IP Immunoprecipitation Irt Iron r egulated t ransporter IRP Iron regulatory protein IRE Iron responsive element kDa Kilodalton KO Knock out LPS L ipopolys accharide mRNA Messenger RNA NTBI Non transferrin bound iron Ni Nickel NO Nitric oxide NTR Non TfR mediated pathway Pb Lead PNGase F Peptide N glycosidase F qRT PCR Quantitative polymerase chain reaction RES Reticulo endothelial system SIH S alicylaldehyde isonicotinoyl hydrazone siRNA Small interfering RNA Slc/SLC Solute carrier Steap S ix transmembrane epithelial antigen of the prostate TBI Transferrin bound iron

PAGE 13

13 TBS Tris buffered saline TBST Tris buffered saline Tween 20 Tf/TF Transferrin TfR1/TFR1 Transfe rrin receptor 1 TfR2/TFR2 Transferrin receptor 2 UTR Untranslated region WT Wild type Zip/ZIP Z rt and I rt like p roteins Zn Zinc Zrt Z inc r egulated t ransporter

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECT OF DIET A RY IRON DEFICIENCY AND OVERLOAD ON ZIP14 EXPRESSION IN RATS By Hyeyoung Nam December 2010 Chair: Mitchell D. Knutson Major: Nutritional Sciences Zip14 (solute carrier family 39, member of 14, SLC39A14) is a transmembrane metal ion transporter. The mammalian ZIP ( Z rt I rt like P rotein) family of transmembrane transporters consists of 14 members. Zip14 has been shown to transport iron as well as zinc into hepatocytes. The studies described here investigate d the relationship between Zip14 and iron status by using animal models of dietary iron deficiency and overload. Weanling male Sprague Dawley rats were fed modified AIN 93G purified rodent diets that contained 10 ppm iron (FeD), 50 ppm iron (FeA) or 1.9% carbonyl iron (2% FeO) for 3 wk. Zip14 expressions in three major iron loading tissues were analyzed: the liver, pancreas and heart Hepatic Zip14 protein level s did not differ in response to diet ary iron status. In the pancreas and heart, Zip14 protein levels were significantly up regulated by 2% carbonyl iron. The higher levels of Zip14 protein were not associated with higher levels of Zip14 mRNA, indicating that Zip14 expression is post transcri ptionally regulated by iron.

PAGE 15

15 The localization of Zip14 expression was performed by immunohistochemistry with the three major important tissues in the iron metabolism: liver, pancreas, and duodenum. In the liver, Zip14 protein was highly localized in the h epatocyte membrane along with sinusoids by 2% carbonyl iron. In the pancreas, highly intense Zip14 immunostaining was localized on perinuclear regions and the plasma membrane in acinar cells. In the duodenum, the immunostaining of Zip14 was faint in FeD, b ut unexpectedly, 2% FeO showed strong signal s of Zip14 in the basolateral membrane of the villus region. To test whether some of the ZIP family members respond to dietary iron status in the liver the mRNA expression of ZIP family transporters was analyze d by qRT PCR. ZIP5 mRNA expression was highly induced in iron loaded rat livers relative to the control livers. In addition, the levels of ZIP6, ZIP7, and ZIP10 mRNA were significantly down regulated by dietary iron overload. However, dietary iron deficien cy and overload also induced small, but significant, modulation in hepatic levels of other metals. Thus, it is possible that differences in the levels of these metals affected the ZIP expression. Collectively, these observations suggest that ZIP5, ZIP6, ZI P7, ZIP10 may play a role in hepatic iron/metal homeostasis during iron deficiency and iron overload.

PAGE 16

16 CHAPTER 1 LI TERATURE REVIEW History of I ron in N utrition Saxon iren and the symbol Fe and words such as fer rous and ferric derive from ferrum the Latin name of iron (1) The special role of iron in health and disease was recognized by the ancient Chinese, Egyptians, Greeks, and Romans (2) For example, the ancient Greeks administered iron to their injured soldiers to improve muscle weakness, which probably derived from hemorrhagic anemia (2) th century as a chlorosis often found in adolescent and young women (3) Chlorosis is from the Greek word chloros (meaning green), as patients had a greenish tint to their skin. In the early eightee nth century, the scientific method was first applied to the study of iron nutrition, and it was demonstrated that iron was a major constituent of human blood (4) The widespread thera peutic use of iron tablets began in 1832; iron tablets were shown to (4) Subsequently, in 1932, it was demonstrate d for the first time that inorganic iron could be used for the synthesis of hemoglobin (3) Since then, the biological functions of iron in the human body have been studied extensively. I ron M etabolism Functions of Iron Iron is a member of the transition elements, which means that it has unfill ed d orbitals. Incomplete orbitals allow for various oxidation states such as Fe 2+ the ferrous form, and Fe 3+ the ferric form. Iron can easily change between these two forms, so this special property permits iron to play a major role in many biochemical reactions.

PAGE 17

17 The most biologically important function of iron is in heme containing proteins. Heme is composed of a porphyrin ring structure with a central iron atom. The major role of heme iron is as the oxygen carrying constituent of the proteins hemoglob in in red blood cells and myoglobin in muscle tissue. Hemoglobin in red blood cells carries oxygen from the lungs to the tissues, whereas myoglobin functions as an oxygen store in muscle. About two thirds of body iron is present in hemoglobin in red blood cells, and myoglobin accounts for 5~10% of total body iron. Another important class of heme containing protein is represented by cytochromes. Cytochromes are essential to cellular energy production as part of the electron transport chain. They serve as ele ctron carriers during the synthesis of ATP, the primary energy storage compound in cells. Most of the iron in the body is found in hemoproteins, however, small amounts of non heme iron containing proteins also have key functions in electron transport. Seve ral enzymes such as cytochrome c reductase, succinate dehydrogenase, and nicotinamide adenine dinucleotide dehydrogenase are included in these non heme iron containing enzymes. Hydrogen peroxidases, such as catalase and peroxidase, are another group of enz ymes that need iron. The main function of these group enzymes is to protect the organism from oxidative damage. Distribution of T otal B ody I ron Total body iron averages approximately 3.8 g in men and 2.3 g in women (5) Iron levels in women are generally lower than men because of smaller muscle and liver mass and menstrual blood loss. Greater than 70% of total body iron is found in hemoglobin in red blood cells. Each red blood cells contains approximately one billion iron atoms; at normal turnover rates, this corresponds to an incorporatio n of 2 10 20

PAGE 18

18 atoms of iron per day (6) Approximately 20~30% of body iron is stored in hepatocytes and in reticuloendothelial (RE) macrophage in the forms of ferritin or its degradation product hemosiderin (6) Approximately 0.1% of the total body iron is found in blood plasma bound to the iron transport protein transferrin, Tf (5) Tf delivers iron to developing eryt hroid precursors, as well as to other tissues of the body. These distributions of body iron are altered by iron disorders or pregnancy. Iron R ecycling Under physiological conditions, about 25 mg of iron per day is consumed for heme biosynthesis by immatu re erythrocytes in the bone marrow (7) To meet the demand for heme production necessary for erythropoiesis, iron must be recycled from senescent red blood cells processed by macrophages of the RE system (RES). The RES is composed of monocytes, macr ophages, and their precursor cells. Monocytes are generated in the bone marrow, released into the blood and tissues, where they differentiate into macrophages. The macrophages mainly responsible for recycling iron from senescent RBCs are found in the live r, spleen, and bone marrow. Red blood cells live for approximately 120 days. When they reach the end of their lifespan, red blood cells are ingested by macrophages. Every day, the RES ingests an estimated 360 billion senescent erythrocytes (8) Within the phagocytic vesicles, heme is metabolized by heme oxygenase and the released iron is exported to the cytoplasm through the action of natural resistance associated macrophage protein 1 (Nramp1) (9) a protein similar to DMT1 (divalent metal transpor ter 1). Iron export from macrophages to Tf is accomplished by ferroportin (FPN), a transmembrane protein located on the macrophage cell surface (10) The release of iron is facilitated by ceruloplasmin, a

PAGE 19

19 multicopp er oxidase (11) Although nearly all cells can take up iron from Tf, most Tf iron is taken up by erythroid precursors and is incorporated into hemoglobin. Iron S torage The main site of iron deposition and storage is in the liver, mainly in hepatocytes. Iron stores for 12.5 % to 25% of total body iron in a healthy adult man (12) About 50% of body iron stores is fou nd in the RES (7) When body iron levels decrease, stored iron is mobilized to meet the erythropoietic and cellular demand. Within cells, iron is stored in a protein complex as ferritin or hemosiderin. Ferritin, the main form of soluble storage iro n in tissues, consists of a protein component apoferritin. Apoferritin is composed of 24 subunits arranged as a hollow sphere and functions by catalyzing the conversion of ferrous to ferric iron. Apoferritin can store up to 4500 atoms of iron (13) Ferritin molecules aggregate eventually to form clusters, probably due to the polymerization of the ferritin protein. These clusters are engulfed by lysosomes and degraded (14) resu lting in aggregate molecule referred to as hemosiderin. In iron overload conditions, the major storage compound is hemosiderin, which is dramatically increased a hundred fold in comparison to that of ferritin, which only increases tenfold (15) Iron E xcretion Unlike with other transition metal nutrients Cu and Zn, there is no physiologic mechanism of iron excretion by the human body (16) Daily loss of body iron is about 1 mg only most of this is through feces and desquamation of cells such as skin GI mucosa, nails, and hair (17) Iron excretion is increased during iron overload in humans and animals (18, 19) However, the amount of ex cretion is insufficient to restore iron

PAGE 20

20 overload to normal iron status, indicating that the excretion mechanisms are extremely limited. Regulation of I ron M etabolism Dietary I ron A bsorption Iron consumed in the diet is either heme iron or non heme iron. H eme iron is present in meat sources, and most of the non heme iron is generally consumed in green leafty vegetables, grains, and legumes. Heme iron is absorbed more efficiently than non heme iron, but most dietary iron is non heme iron (20) The uptake of heme and non heme iron occurs at the apical surface of duodenal enterocytes via different mechanisms. Dietary non heme iron mostly exists in an oxidized form (Fe 3+ ) that is poorly bio available. To be absorbed, t he Fe 3+ must first be reduced to the Fe 2+ form. This was thought to be mediated by the ferrireductase enzyme duodenal cytochrome b (Dcytb) (21) However, ablation of the murine Dcytb gene resulted in no iron defici ent phenotype, implying that other intestinal reductases probably substitute. Once in the Fe 2+ state, ferrous iron is then transported into the intestinal cells by DMT1. Heme iron is absorbed through a candidate low affinity heme transporter, presumably he me carrier protein 1 (HCP1) in the duodenum (22) However, recent research identified that HCP1 is a high affinity proton coupled folate transporter (PCFT) (23) The role o f HCP1 to heme uptake will require more study. Once dietary heme iron has entered the enterocyte, it is likely degraded by intracellular heme oxygenase to release iron (24) which enters the same intracellular iron pool as absorbed non heme iron. Intracellular enterocyte iron can either be stored in the iron storage protein ferritin or transport ed across the basolateral membrane of the enterocyte into the circulation by

PAGE 21

21 FPN (25) To facilitate iron release from intestinal cell, the multi copper ferroxidase protein, hephaestin is thought to convert ferrous iron (transported by FPN) to ferric iron. Ferric iron rapidly binds with high affinity to apo Tf in the portal circulation and is delivered to peripheral tissues via the Tf Tf receptor (TfR) system (26) Regulators of I ron A bsorption Intestinal iron absorption is tightly controlled and is dependent on body iron needs. Two major factors that modulate iron absorption are the amount of iron stores and iron in the erythroid mass (27) Other conditions, such as hypoxia, pregnancy and inflammation, may also alter iron absorption. These f actors mostly affect non heme iron absorption. The absorption of heme iron is also affected, but the extent is more limited (28) Body iron stores appear to be the important factor regulating non heme iron absorption in the normal individual. In a normal adult male, the usual amount of storage iron is approximately 1 g. When iron stores decrease, dietary iron absorption increases until stores are replenished. Con versely, when stores increase, iron absorption will decrease until equilibrium is regained (29, 30) A second important factor influencing iron absorption is erythropoiesis. Within the body, the most significant si nk for iron is the erythroid marrow, where iron is utilized both to meet the metabolic requirement of developing red blood cells and for incorporation into newly synthesized hemoglobin. The erythroid regulator of iron absorption probably dominates over the store regulators (31) Even though iron absorption is regulated by the level of iron storage, the extent is modestly regulated, over a range of no more than 3 fold (31) However, the erythroid regulator is more potent, capable of increasing iron absorption as much as 10 fold or more (31) For example, in thalassemia, a genetic disorder that involves decreased and defective

PAGE 22

22 production of hemoglobin, absorption of iron continue s even though iron stores are massively elevated (32) Previously, these regulators were investigated only as clinical phenomena, but the exact molecul ar mechanisms were not understood. In 2001, two independent groups discovered an iron regulatory hormone, hepcidin (33, 34) Hepcidin regulates body iron homeostasis by interacting with FPN. Hepcidin is secreted in to the blood, where it acts systemically to bind to FPN, resulting in internalization and degradation of FPN (35) FPN is predominantly expressed in macrophages and enterocytes and thus regulates iron entry into th e blood. For example, hepcidin levels are increased in response to iron overload, and iron release from enterocytes and macrophages is reduced (36) Conversely, in iron deficiency when hepcidin levels are decreased, iron release from these tissues is increased by enhanced expression of FPN (37, 38) Cellular I ron U ptake and E xport P roteins Transferrin (Tf) : Tf is an 80 kDa glycoprotein synthesized mainly by the liver. Tf has two homologous lobes (N and C lobe), each containing two domains that are connected by a flexible hinge (39) Both lobes have a high affinity for iron (40) but other metals such as Mn, Co, Cu, and Ca can bind with low affinity (41) In the iron free form, the two domains are open; in the iron carrying form, the two domains are tightly closed. The iron binding site exclusively binds ferric anion iron (42) The affinity of iron for Tf is a pH dependent process. In plasma (pH 7.4), iron is very strongly bound to Tf, whereas iro n is released at acidic pH. Tf does not release all iron until below pH 4.6, however, receptor bound Tf is released more iron at even mildly acidic pH (pH 5.6 ~ pH 6.5) (43, 44)

PAGE 23

23 Tf R eceptor 1 (TfR1): Tf bound iro n (TBI) in the plasma is transported into cells via binding of the ligand to its receptor at the cell surface. The best characterized receptor for human Tf is TfR1. TfR1 was first recognized as a specific receptor for cellular TBI uptake (45) Structurally, TfR1 consists of two identical glycoprotein transmembrane subunits linked by a disulfide bon d (45) Each TfR subunit contains a short N terminal cytoplasmic domain required for receptor endocytosis, a transmembrane domain, and a large C terminal extracellular domain, which plays an important role for Tf binding and receptor dimerization (46) The extracellular domain binds one Tf molecule per subunit, forming a multimeric Tf TfR complex. Binding of TfR1 with Tf depends on pH and the iron content of Tf. At physiological pH (7.4), TfR1 binds only iron carrying Tf, either monoferric or diferric. The TfR1 binding affinity with diferric is 10 fold higher than monoferric Tf, and 2000 fold higher than apo Tf at the physiological pH (47) Conversely, at the low pH of the endosome, the affinity of TfR1 for apo Tf is much higher than at physiological pH. TfR1 is expressed ubiquitously, and the highest levels of expression are in erythroid cells proliferating normal and neoplastic cells as well as placenta (48, 49) The expression of TfR1 is regulated by several factors. TfR1 expression is induced by low intracellular iron levels and down regulated by hi gh iron conditions (50) The change in the TfR1 expression in response to iron status is mainly regulated at the post transcriptional level by interactions of IRP (iron regulatory protein) and IRE (iron response element). This will be discussed later in the regulation of iron metabolism. The expression of TfR is also regulated by the state of cellular differentiation. Immature erythroid cells which synthesize high amounts of hemoglo bin have the higher numbers

PAGE 24

24 of TfR1 (51) As maturation progresses, TfR1 expression gradually decreases. At reaching the mature erythrocyte, TfR1 is not expressed (52) TfR1 mediated TBI uptake is affected by proteins such as HFE, the protein defective in hereditary hemochromatosis (HH). HFE is a protein simila r to class I molecules of the major histocompatibility complex (53) In human embryonic kidney (HEK 293) cells, HFE protein was identified to co precipitate with TfR1, forming a stable complex (49) Both HFE and diferr ic Tf recognize overlapping regions on TfR1 (54) resulting in competition between HFE and diferric Tf for binding to TfR1 (49) suggesting that HFE negatively regulates TB I uptake. The role of HFE in the regulation of hepatic TBI uptake was investigated using Hfe knockout mice. TfR1 mediated TBI uptake was increased by 40 to 70% compared with iron loaded wild type hepatocytes (55) Tf R eceptor 2 (TfR2): A second Tf receptor gene ( TfR2 ) was identified in 1999. TfR2 pro tein has a high degree of homology to TfR1, with 66% primary sequence similarity and 45% identity in the extracellular region (56) Like TfR1, TfR2 interacts with Tf in a pH dependent manner; holo Tf binds at neutral pH and apo Tf binds only at acidic pH (57) However, TfR2 appears to have several different characteristics. For example, TfR2 has a much more restricted tissue distribution. Human TfR2 is highly expressed in liver, normal erythroid precursor c ells and erythroid leukemia cell lines (58) Less TfR2 expression is found in spleen, lung, muscle, prostate and peripheral mononuclear cells. The details of how TfR2 is involved in iron metabolism are unclear. Ho wever, mutations in TfR2 have been identified in Italian patients and unexpectedly, they developed hepatic iron overload (59) Recently, it has been shown that hepatic TfR2

PAGE 25

25 protein is regulated post translationally by holo Tf, which increases the stability as well as half life of TfR2 (60) Hepatic TfR2 protein levels, not mRNA, were up regulated in animal models of iron overload, s uch as mice fed a high iron diet or Hfe knockout mice (61) On the other hand, TfR2 protein was down regulated in hypotransferric mice, an animal model that has a low Tf concentration but hepatic iron loading (61) In light of these observations, it was proposed that the concentration of holo Tf in the blood may be a main regulator of TfR2 protein expression. Divalent M eta l T ransporter 1 (DMT1): DMT1, also known as DCT1 and Nramp2, was identified in 1995 as a homologue of Nramp1, a protein that controls natural resistance to several types of infections (62) Two years later, DMT1 wa s cloned by functional screening of a rat cDNA that induced iron transport activity in Xenopus oocytes (63) Another group also identified a mutation in DMT1 in an inbred mouse strain ( mk ) with severe microcytic an emia (64) Later, the identical missense mutation was also found in the Belgrade (b) rat (65) These two DMT1 mutant animals displayed greatly reduced intestinal iron absor ption and impaired iron use by the erythron, resulting in iron deficient anemia. DMT1 is a transmembrane protein with 12 predicted transmembrane domains (66) There are four mammalian DMT1 isoforms (67) Two isoforms differ by the presence or DMT1 is regulated post transcriptionally by intracellular iron levels via IRE IRP interaction. In iron deficient cond itions, IRE IRP binding may stabilize DMT1 mRNA allowing for more protein translation, followed by increased iron absorption. The duodenum expresses mostly the IRE form of DMT1, whereas erythroblasts express

PAGE 26

26 chiefly the nonIRE form of DMT1. Other tissues s uch as kidney, brain, liver, and thymus express both forms of DMT1 (68) Two other isoforms of DMT1 have been designated as 1A and 1B; these isoforms arise from different promoters and transcription start sites wit h mutually exclusive splicing of the alternative first exons to exon 2 (67) However, the 1A and 1B isoforms of DMT1 have not been well characterized with respect to physiological significance in vivo and tissue ex pression profiles. The physiologic role of DMT1 has been clarified largely by studies of the two DMT1 mutant animal models. These animals display severe hypochromic anemia due to impaired intestinal iron absorption and defective iron utilization in red c ell precursors. DMT1 is expressed at the brush border of enterocytes in the proximal duodenum where most of dietary iron is absorbed. DMT1 mediates uptake of ferrous iron from the gut lumen (69) DMT1 is also prese nt in the endosomal vesicles of hematopoietic precursors where it functions in transport of iron released from the Tf receptor complex into cytosol for utilization or storage (70, 71) Transport of ferrous iron by DMT1 is proton coupled, with highest activity occurring at low pH (below 6) (63) This is consistent with the role of DMT1 as iron importer in the duodenum and endosome where the pH is around 6 (63) At the subcellular level, DMT1 has been detected on the plasma membrane and endosomes, colocalizing with Tf (71 73) implying DMT1 cycles between the endosomal membrane and the plasma me mbrane. DMT1 has been also postulated to be involved in non transferrin bound iron (NTBI) uptake from the plasma (73) Functional expression studies in Xenopus oocytes have shown that DMT1 not only mediates transport of iron but also other divalent metals Zn, Mn, Co, Cd, Cu, Ni, and Pb (63) Competition studies suggest that Pb, Mn, Co, and Zn can share the intestinal

PAGE 27

27 absorption pathway with Fe. This possibility is consistent with the well known increased absorption of Pb i n iron deficiency (74) Z IP 14: ZIP14 is a membrane protein that is predicted to contain 8 transmembrane domains (75) The calculated molecular weight of ZIP14 is 54 kDa, h owever, ZIP14 appears to be a trimer with glycosylation (75) The higher molecular mass bands of ZIP14 are intensified in non reducing conditions. ZIP14 mRNA expression profiles in 16 different human tissues by Nor thern blot analysis exhibited most abundant expression in liver, followed by heart and pancreas (76) A similar pattern of ZIP14 expression was observed by using a multiple human tissue expression array (75) Murine Zip14 transcript abundance by qRT PCR revea led that the highest expression is in liver, whereas a moderate level is in heart, kidney and white adipose tissue (77) Other studies, however, found high expre ssion of Zip14 in the duodenum as well (78, 79) ZIP transporters can be divided into 4 subfamilies, one of which is LIV 1 (80, 81) The members of the LIV 1 subfamily, te rmed LZT ( L IV 1 subfamily of Z IP zinc T ransporters), contain a unique and highly conserved metalloprotease motif (HEXPHEXGD) in predicted transmembrane domain V, which has been shown to be essential for zinc transport (82) Human ZIP14 belongs to the LZT subgroup of ZIP transporters, and it has a slightly altered motif, EEXPHEXGD (75) Interest ingly, human ZIP14 with an altered signature motif can still act as a zinc influx transporter in mammalian cells. This was the first finding that a human LZT protein with an altered motif can transport zinc into cells. ZIP14 (SLC39A14) belongs to the ZIP family of metal ion transporters in mammals. Z rt (zinc regulated transporter), I rt (iron regulated

PAGE 28

28 transporter) like p roteins (83) The first member of the ZIP family to be identified was IRT1, which is expressed in the roots of iron deficient plants (84) The amino acid sequence of IRT1 was nearly identical to those of new member of proteins ZRT1 and ZRT2 (85) Z RT1 is a primary zinc influx transporter with high affinity activity in yeast, whereas ZRT2 encodes the low affinity zinc transport protein (85) Since the initial discoveries of these ZIP proteins, 14 ZIP family m embers in mammals have been identified. Many of these proteins have been shown to transport a variety of cations, including Zn, Fe, Mn, and Cd (82) IRT1 was originally identified as an iron transporter in plants, but when expressed in yeast, IRT1 mediates the uptake of zinc and manganese as well (86) Recently, Zip14 has been demonstrated to b e a metal transporter of zinc, iron, and cadmium and manganese (78, 79, 87) Hepatic Zip14 expression is modulated by infection and inflammation, perhaps serving to enhance the uptake of zinc (87) or iron (88) Significant alterations in host zinc and iron metabolism occur during various acute and chronic infectious diseases, including hypozincemia and hypoferremia. The depletion of zinc and iron in the blood has been considered to he lp host defense against invading microorganisms. The development of hypoferremia during inflammation is caused by highly induced hepatic hepcidin. Hepcidin regulates serum iron levels during inflammation by the rapid internalization and degradation of the main iron export protein FPN, making iron less available for invading substances (89) On the other hand, zinc is redistributed from the serum to several tissues, particularly the liver (90) The plasma and ti ssue redistribution of zinc constitutes a well characterized step of the acute phase response of the organism. The acute phase protein, IL 6, has been shown to regulate hepatic Zip14

PAGE 29

29 expression in response to inflammation (87) Up regulation of Zip14 expression was associated with an increase in zinc taken up by the liver, suggesting a role of Zip14 in zinc mediated cytoprotection (87) The increase in Zip14 expression was a lso observed after administration of lipopolysaccharide (LPS) but was partially independent of IL 6. Instead, LPS mediated Zip14 expression was found to be modulated via nitric oxide (NO) signaling pathways in murine hepatocytes (91) LPS stimulated pro inflammatory mediators such as IL 1 which signals for the producti on of NO, an inorganic reactive nitrogen species synthesized in the liver. NO increases binding of the transcription complex, AP 1, to the Zip14 promoter leading to transcriptional up regulation of the gene in hepatocytes, which consequently lead to hepati c zinc accumulation (91) NO is currently being considered as a fun damental cellular signaling molecule that is critical for the maintenance of homeostasis, functioning either as a cytoprotective mediator or as an apoptosis inducer (92, 93) Therefore, up regulation of hepatic Zip 14 by NO signaling pathway may serve to protect hepatocytes in response to LPS. Zip14 has also been shown to be involved in transporting NTBI into cells (94) NTBI is rapidly cleared from the plasma by the liver, mainly by hepatocytes (95, 96) and other tissues, e.g., pancreas and heart (97) Suppression of endogenous Zip 14 expression by using siRNA led to a decrease in iron and zinc uptake in AML12 hepatocytes (78) In addition, the tissues that abundantly express Zip14 also selectively accumulate iron during iron overload (98) Interestingly, the highly induced NTBI uptake by Zip14 is down regulated by HFE expression in HepG2 cells (99) HFE expression promoted the degradation of Zip14 protein by post transcriptional regulation. The iron transport features and tissue expression profile suggest that Zip14 may play a role in

PAGE 30

3 0 iron metabolism. Indeed, a recent study also localized Zip14 in early endosomes and that suppression of endogenous Zip14 in HepG2 cells decreased the uptake of iron from Tf, suggesting that Zip14 plays a role in TBI uptake in addition to NTBI uptake (88) Zip14 has also been shown to transport Cd and Mn (100) Cadmium is a toxic non essential divalent cation that induces adverse health effects in humans (101) Because Cd is a non essential element, it has long been supposed that the transport system of investigate the mechanisms of cellular Cd uptake in mammalian cells, a cadmium resistant cell line was used (102) The cadmium resistant cell line exhibited a marked decrease of Cd uptake. Interestingly, this cell line also displayed diminished Mn uptake, suggesting that Cd and Mn share the same transporter for their entry into cells (103) Consistent with t his possibility is a recent study that showed a down regulation of Zip14 in cadmium resistant cells (104) Girijashanker et al reported that Zip14 mediates Cd and Mn uptake in mouse kidney polarized epithelial cells (79) Cd uptake by Zip14 was competitively inhibited by Zn, and next by Mn. Ferroportin (FPN ): The iron exporter ferroportin (FPN)/iron regulated transporter 1 (IREG 1)/metal transporter protein 1 (MTP 1) was discovered independently by three groups (25, 105, 106) FPN has 12 transmembrane domains and a c alculated molecular weight of 62 kDa (107) The tissue expression profile of FPN indicated highest expression in duodenum as well as macrophages of the liver, spleen and bone marrow (106) Macrophage FPN expression was induced after erythrophagocytosis, implying that FPN 1 is involved in iron recycling (7) FPN is also highly expressed in the placenta and is likely to be essential for the delivery of iron to the fetus (108) The importance of

PAGE 31

31 FPN in iron homeostasis was formally demonstrated by the generation of Fpn knockout mice. They accumulated iron in en terocytes, macrophages, and hepatocytes (108) Intestine specific inactivation of FPN confirmed that FPN is critical for intestinal iron absorp tion. FPN is regulated by iron through transcriptional and post transcriptional events. First, iron loading upregulates the levels of FPN heterogeneous nuclear RNA and mRNA via transcriptional mechanisms (109) FPN mRNA contains an IRE sequence in transcriptional regulation through IRE IRP interaction (110) FPN is also regulated post translationally via hepcidin. Hephaestin (Hp): Hp is a multi copper ferroxidase necessary for iron release from intestinal enterocytes into the blood circulations. The function of Hp was discovered from a study of the sla (sex linked anemia) mouse, which has a block in intestinal iron transport. In sla mice, iron uptake from the brush border of enterocytes is normal, but the iron accumulates within the enterocytes without being transferred to plasma circula tion (111, 112) It turns out that Hp is defective in the sla mice (113) Hp is 50% identical with Cp, a copper containing protein with ferroxidase activity. Hp mRNA is most a bundantly expressed in the small intestine and colon (114) In the intestine, Hp expression is regulated by iron and copper levels. For example, Hp mRNA levels in rats increased in response to iron deficiency, and decreased after low iron repletion (115) In addition, Hp expression is affected by copper. Copper supplementation stimulated an increase of Hp mRNA expression and promoted iron depletion of intestinal Caco 2 cells (116) Copper is likely to be important factor for Hp

PAGE 32

32 synthesis and ferroxidase function but also for Hp stability. Depletion of copper leads to proteosome mediated degradation of Hp (117) Ceruloplasmin (118) : Cp, a serum ferroxidase, is the principal copper binding protein, containing over 95% of the copper present in plasma (11) Human Cp encodes a 132 kDa glycoprotein containing 1046 amino acids (119) Cp is synthesized predomi nantly by hepatocytes and secreted into the circulation (119) Cp mRNA expression is detected in the liver, macrophage, lung, testis, brain and lymphocytes (120, 121) 2 globulin in human plasma that binds six copper atoms. An increase in the hepatic copper pool leads to an increase in the serum Cp level, whereas a nutritional copper deficiency brings out a marked decrease in serum Cp level (122, 123) Although copper does not affect hepatic Cp mRNA or the rate of Cp biosynthesis, copper deficiency results in a complete loss of serum Cp oxidase activity (124) Interestingly, kinetic and metabolic studies have shown that Cp has no essential role in copper transport or metabolism (125, 126) Cp appears to mobilize iron from storage tissues by catalyzing the oxidation of ferrous iron to the ferric iron, which can be incorporated into apo Tf. Copper deficiency resulted in not only a marked decrease in circulating iron but also accumulation of iron in macrophage (127) Interestingly, the administration of Cp to these animals brings about a release of iron into the circulation (128) A role for Cp in macrophage iron release is supp orted by Cp knockout mice (129) Interestingly, copper transport and metabolism are normal in Cp knockout mice (126) but they accumulated higher amo unts of iron in macrophage (129) An essential role for Cp in iron metabolism was confirmed by the identification of patients with aceruloplasminemia (130) The absence

PAGE 33

33 of serum Cp in these patients leads to a slow accumulation of iron in compartments where iron is normally mobilized for recycling. Liver biopsy revealed significant iron accumulation in both hepatocytes and macrophages (11) Patients with aceruloplasminemia have only mild anemia, however, presumably owing to an alternative oxidase enzyme in plasma. Aceruloplasminemia does not result in impaired intestinal iron absor ption, as Hp, a Cp homologue, plays a role in the duodenum (11) Duodenal C ytochrome b (Dcytb): Dcytb is a plasma membrane protein containing 286 amino acids w ith six predicted transmembrane domains (114) McKie et al. (21) screened genes that were up regulated in the duodenum of hypotransferrinemic ( hpx ) mice, which have a high rate of dietary iron absorption. Among the up regulated genes, Dcytb was identified, and it shared approximately 50% sequence homology to the cytochrome b561 family of plasma membrane reductases. Cytochrome b561 is a reductase enzyme involved with regenera tion of ascorbate from dehydroascorbate (131) Dcytb is highly expressed in the brush border membrane of duodenum (21) The localization of Dcytb supports the idea that Dcytb supplies ferrous iron to DMT1. Dcytb was also found in mature red blood cells from humans and guinea pigs, whereas in mice which make their own ascorbate, Dcytb wa s not present in erythrocyte (132) These observations suggest that Dcytb plays role in ascorbate regeneration in some cell types. The iron reduction and uptake by Dcytb was demonstrated in MDCK (Madin Darby canine kidney) cells and Caco 2 cells (133) In these two cell lines, overexpression of Dcytb demonstrated enhanced ferric reductase activity as well as increased Fe 59 uptake (134, 135) Like iron, copper is also required to be reduced before it transfers across the

PAGE 34

34 c ell membrane. In MDCK cells, overexpression of Dcytb stimulated cupric reductase activity, suggesting that Dcytb probably reduces copper as well as iron on the brush border of duodenal enterocytes. However, targeted disruption of Dcytb suggests that Dcytb is not necessary for dietary iron absorption in mice fed a normal iron diet (136) The loss of Dcytb had little or no impact on liver non heme iron in mice fed an iron deficient diet. An alternative explanation is that endogenously produced ascorbate in m ice is enough to reduce ferric iron to ferrous iron. It is well known that mice absorb ferric iron well, whereas humans absorb this form of iron poorly (137) Crossing the Dcytb KO mice with one unable to make ascorbate will help us to understand better the role of Dcytb in human and mice. Iron T ransport to P eripheral T issues TfR1 M ediated Tf B ound iron (TBI) U pta ke: Ideally, nearly all plasma iron is bound to Tf. The major iron uptake mechanism by peripheral tissues is through a TfR1 mediated process. The process is triggered by the binding of holo Tf to TfR1 on the cell surface (138) The complex of holo Tf and TfR1 then internalizes in clathrin coated vesicles to endosomes. The acidic pH of the endosomal lumen induces a conformational change in Tf that results in iron release. The free Fe 3+ released to endosomes is reduced to Fe 2+ by a ferrireductase enzyme such as Steap3 in developing erythroid cells (139) Fe 2+ is subsequently transported out of the Tf cycle endosome and into the cytosol (65) Once in the cytosol, iron is utilized as a cofactor in proteins such as aconitase, the cytochromes, and heme, o r it is stored in ferritin. After release of iron into the endosome, apo Tf is still tightly bound to TfR1 at endosomal pH, and this complex recycles back to the cell surface. When the apo Tf and TfR1 complex reaches

PAGE 35

35 the cell surface or a compartment at ne utral pH, apo Tf dissociates from its receptor, and then is ready for a new cycle of internalization (138) Tf carries ferric iron, whereas DMT1 is selective for ferrous iron. Therefore, iron must be reduced in the Tf cycle endosome. Recently it was identified that Steap3 (six transmembrane epithelial antigen of the prostate 3) is the major ferrireductase of the Tf cycle endosome in developing erythroid cells. Mice lacking Steap3 presented with severe microcytic anemia, and over expression of Steap3 stimulated the reduction of iron in erythroid cells (139) suggesting that steap3 is an endosomal ferrireductase essential for efficient Tf dependent iron uptake. DMT1 is essential for the endosomal iron efflux pathway in developing erythroid cells. The insight has come from the identification of DMT1 mutation animal models, such as mk mice and b rats. These animals have an autosomal recessively inherited, microcytic, and hypochromic anemia, and they display defect of iron transport out of endosomes within the Tf cycle (65, 72) In addition, subcellular localization studies showed that DMT1 is localized to endosomes, where it colocalizes with Tf. The transport activity of DMT1 is pH dependent and optimal at acidic pH (5.5 to 6.0), consistent with its pr esence in the acidic environment of endosomes (63) In hepatocyte, Zip14 may play a role in endosomal iron efflux (88) Molecular R egulation of I ron T ransport P roteins Mammalian iron homeostasis is maintained through the regu lation of iron transport proteins at the transcriptional or post transcriptional levels. Regulation of gene transcription allows for critical developmental, cell cycle, and cell type specific controls on iron metabolism. Post transcriptional regulation thr ough the actions of IRP1 and IRP2 synchronize the use of mRNA encoding proteins that play roles in iron uptake,

PAGE 36

36 storage, and use of iron in all cells. Moreover, there can be regulation by post translational mechanisms that alter subcellular targeting or de gradation of iron related proteins. Transcriptional R egulation Several factors regulate iron related genes at the transcriptional level. First, gene expression is transcriptionally regulated by iron status. For example, FPN mRNA levels have been shown to increase in response to iron (106) FPN mRNA levels are increased after iron loading in macrophage cells, and iron loading does not affect the stabilization of FPN mRNA, suggesting that FPN is transcriptionally re gulated by iron (109) TfR expression was also transcriptionally controlled by iron, as shown by experiments in which actinomycin D prevented the increase in TfR mRNA expression triggered by iron chelatio n (140) Second, transcriptional regulation of iron related gene expression results from activation of transcription factors. A transcriptional factor is a pro tein that binds to specific DNA sequences and thus partially controls the transcription of DNA to RNA. One of the best known transcription factors that affects iron related gene expression is hypoxia inducible factor 1 (HIF 1). HIF 1 is a heterodimeric DNA binding complex subunit (141) Germ line deletion of either HIF subunit is normoxia, the regulator proteasome pathway such that the transcription complex can not form (142) Under hypoxic zes with HIF and the heterodimer form relocates to the nucleus (143) The heterodimer form

PAGE 37

37 can bind to a specific DNA consensus sequence HRE, which is contained in the promoter regions of the target genes. Hypox ia itself is known to regulate iron transport since the demand for iron requ ired in erythropoiesis is raised. Three regulatory HIF subunits have been (144) the major isoform regulating erythropoiesis in adults (145) mobilizes iron to support erythrocyte production through the down regulation of hepcidin and up regulation of erythropoietin and FPN (146) The transcription of other iron transport proteins, such as Tf and TfR1 are also up regulated during hypoxia to increase iron delivery to the erythron (147, 148) Moreover, a recent study generated ine (149) They found directly regulated the transcription of DMT1, the major iron import protein in intestine. Other iron related proteins including Dcytb and Cp have also been shown to be induced by hypoxia (105, 150) Post T ranscriptional R egulation Cellular iron levels are post transcriptionally regulated by two cytoplasmic iron regulatory proteins (IRPs). IRPs are cytoplasmic RNA binding proteins that bind with high affinity to mRNA stem loop structures known as IREs (151) Many iron transport unt ranslated regions (UTRs) of their mRNA. IREs inhibits the binding of the 43S pre initiation complex to the mRNA, causing translation inhibition. In contrast, IRP bindi UTR of mRNA increase the half life of mRNA by protecting the mRNAs from endonuclease activity (152)

PAGE 38

38 Two IRPs called IRP1 and IRP2 have been characterized in mammalian cells. IRP1 exhibits consider able sequence homology with mitochondrial aconitase that catalyzes the isomerization of citrate to isocitrate (153) Aconitases are iron sulfur proteins and a [4Fe 4S] cluster is required for their enzymatic activity (154) IRP1 also contains a [4Fe 4S] cluster and has aconita se activity. Under high iron conditions, IRP1 assembles a cubane [4Fe 4S] cluster, and this cluster assembly provides it to be a cytosolic aconitase, resulting in the loss of its IRE binding activity (155) IRP2 is 61% identical to IRP1 in amino acid sequence (156) Even though they hav e similar characteristics, they differ in several ways. IRP1 is a long lived protein whose degradation rate and cellular abundance is not altered by cellular iron status (157) The abundance of IRP2 is decreased, a nd its rate of degradation is remarkably increased in iron replete cells (156) IRP2 has conserved the active site to bind a [4Fe 4S] cluster (158) however, there is no aconitase activity detectable in IRP2 (157) (TfR1, DMT1) U TR of their mRNAs. For instance, in iron depleted cells, IRPs binds to (159) This stabilizes the mRNAs of TfR1 and DMT1, thus inducing p rotein synthesis to and FPN mRNA blocks translation, thereby reducing protein levels. On the other hand, under higher iron conditions, IRPs fails to bind IRE, and f erritin and FPN mRNA are translated, whereasTfR1 and DMT1 mRNA are rapidly degraded. Multiple isoforms of DMT1 transcripts have been identified with two isoforms (67) On ly the IRE form of DMT1 is

PAGE 39

39 markedly up regulated in the duodenum of iron deficient animals (63) supporting that the IRE mediates iron regulation of DMT1 mRNA stability. However, the iron dependent regulation of DM T1 expression is apparently cell type specific. In human hepatoma Hep3B cells, the IRE form of DMT1 was slightly up regulated by iron deficiency, compared to that of the Caco2 intestinal cell line (160) DMT1 mRNA levels in HeLa cells (160) HT29 cells (human intestinal epithelial cells) did not respond to iron status (68) Even though the IRE forms of DMT1 interact with IRP1 and IR P2 (160) it does not appear to regulate the stability of DMT1 (68) Therefore, further studies will be required to determine how IRE is responsible for regulating DMT1 exp ression. Post T ranslational R egulation Post translational regulation refers to the control of protein levels by reversible ways (post translational modifications) or irreversible ways (proteolysis) (161) Most proteins undergo some form of modification following translation. Post translational modifications such as glycosylation, phosphorylation, and ubiquination r esult in mass changes and serve many important functions in iron regulated proteins. For example, several plasma membrane proteins appear to be protected from proteolytic cleavage by O linked glycosylation (162) One of the best examples is TfR. The human TfR has three N linked and one O linked glycosylation sites. The single O linked oligosaccharide is near the transmembrane domain of the TfR at threonine 104. Interestingly, deletion of the O lined glycosylation o f the TfR results in the generation of a soluble human TfR (163) O linked carbohydrate pr obably involves in suppressing proteolytic cleavage of the TfR to a soluble form. Another protein that is affected by post translational regulation is FPN. FPN is post translationally regulated by hepcidin. Hepcidin induces

PAGE 40

40 the internalization of FPN at th e cell surface and its subsequent degradation in lysosomes (38) In addition, TfR2 protein is post translationally regulated by diferric Tf. Differic Tf redirects TfR2 from a degradative pathway through lysosomes into a recycling pathway through endosomes (145) Duodenal DMT1 protein expression is also affected by high iron conditions via post translational regulation. High iron levels induce duodenal DMT1 internalization from the apical membrane of duodenal enterocytes to cytosol. Interestingly, membra ne levels of DMT1 protein are reduced following high iron in Caco 2 cells, but total cellular levels of DMT1 are unaffected, implying that some regulatory mechanism probably participates in the re distribution of DMT1 (164) Liver I ron M etabolism Function of L ivers in I ron M etabolism The liver plays a central role in iron metabolism. It is responsible for approximately 8% of plasma iron turnover in humans (165) When plasma iron levels are low, the liver releases iron into the circulati on to meet tissue iron needs. In addition, liver is the major storage organ for iron, because it has first pass access to absorbed iron entering the portal circulation from the gut (166) The liver also clears the plasma of excess iron during iron overload conditions (167) and stores iron in ferritin and hemosiderin. T he liver is made up of several different types of cells: parenchymal cells (hepatocytes), endothelial cells, Kupffer cells and fat storing (stellate) cells. Parenchymal cells occupy 71.9% of the total liver volume, and as many as 35% of the cells found in the liver are non parenchymal cells, representing 5.8%, by volume, of the liver (168) Hepatocytes synthesize and secrete virtually all circulating Tf (169)

PAGE 41

41 Hepatocytes also express a number of other genes participating in iron homeostasis including hepcidin, TfR2, and hemojuvelin. Functional loss of any of these genes results i n the HH, suggesting that hepatocytes function both in sensing and modulating body iron status. Kupffer cells are resident macrophages in the liver. Kupffer cells ingest senescent or damaged red blood cells, catabolize the hemoglobin and release the iron i nto the circulation. The quantity of the recycled iron through the macrophage on a daily basis is 10~20 times more than that taken up through the intestine (170) Hepcidin In 2001, two independent groups identified a new iron regulatory hormone, hepcidin (33, 34) Hepcidin is a 25 amino acid peptide with antimicrobi al properties that has been identified as an important regulator of iron homeostasis. Hepcidin was first identified in human urine and plasma (33) Hepcidin is synthesized and secreted predominantly by hepatocytes (34) A potent ial role for hepcidin in iron homeostasis was suggested by the unexpected observation that Usf2 (upstream stimulatory factor2) knockout mice develop a severe iron overload in various tissues, such as liver, pancreas and heart (171) As the Usf2 gene is located immediately upstream of hepcidin, disruption of Usf2 gene resulted in the inactivation of hepcidin. Transgenic mice over expressing hepcidin in the liver developed severe iron deficiency anemia (172) After the discovery of hepcidin, its key role in iron homeostasis was intensely studied. Hepcidin regulates body iron homeostasis by interacting with FPN. FPN is predominantly expressed in macrophages and enterocytes, whe re it regulates most of iron entry into blood. Hepcidin binding to FPN triggers FPN internalization and subsequently degradation (38) thus reducing iron export cells. Hepcidin levels are

PAGE 42

42 relatively high when the b ody iron is replete, but when body iron levels are low, hepcidin secretion is down regulated and subsequently iron entry into the plasma is stimulated. Hepcidin expression is also regulated by other stimuli similar to iron deficiency. For instance, phlebot omy, phenlyhdrazine induced acute hemolysis, and hypoxia in mice decrease hepcidin expression (172) In addition, hepcidin expression is induced by inflammation. Several studies have elucidated an important link be tween inflammatory cytokines and hepcidin. Using both mice and humans as experimental models, hepcidin production is stimulated by directly IL 6, a pro inflammatory and anti inflammatory cytokine (38, 89) Administ ration of IL 6 to human subjects increased serum hepcidin concentrations and decreased serum iron levels (hypoferremia) (38) Recently, much effort has been directed at understanding how hepcidin expression is regu lated and several proteins are involved in inducing hepcidin expression such as hemojuvelin (HJV), HFE and TfR2. Hemojuvelin (HJV), also known as RGMc, is a member of the repulsive guidance molecule (RGM) family (17 3) HJV is a co receptor for BMP2, BMP4, BMP5 and BMP6 and enhances hepatic hepcidin expression by inducing BMP signaling (174) BMPs are multi functional growth factors that belong to the transforming growth fact or beta (TGF (175) The BMP subfamily signals through one set of receptor activated SMADs. Their binding to the BMP1 and 2 receptors activates the phosphorylation of SMADs 1, 5 and 8, which then inte ract with SMAD4, the central mediator in TGF increase the transcription of hepcidin mRNA (176) Liver specific disruption of SMAD4 results in mark edly decreased hepcidin expression and accumulation of iron in the liver as well as in other organs, implying a major role of TGF

PAGE 43

43 expression (177) BMP2, BMP4, and BMP6 are endogenous ly expressed in liver cells (178) However, BMP6 appears to play a major role as an endogenous regulator of hepcidin expression and iron metabolism. Targeted disruption of BMP6 in mice causes a massive accumulation of iron in the liver, and marked suppression of hepcidin expression (179, 180) Patients with mutations in the HFE, TfR2, HJV or HAMP genes all show a histological pattern of iron deposition in livers, and lead to inappropriately low hepcidin levels. These all proteins also highly expressed in livers. Thus TfR2 and HFE, like HJV, are probably involved in the regulation of hepcidin expression and the two molecules may be part of the same regulatory pathway. Howev er, mechanisms involved in the modulation of hepcidin expression related to TfR2 and HFE are not fully understood. TfR2 interacts with HFE in transfected mammalian cells like TfR1 (181) however, the binding site is quite different. The differences in HFE binding to TfR2 and TfR1 allow HFE/TfR2 and Tf to form a complex. These complexes are responsible for regula tion hepcidin expression in response to iron loaded Tf. The response was abolished when endogenous TfR2 was suppressed or in primary hepatocytes lacking either TfR2 or HFE (182) In immunoprecipitation experiments, HFE can be found in a complex with TfR1 in the absence of holo Tf (183) However, when holo Tf is present, HFE dissociates from TfR1 and is found in complex with TfR2 and Tf (182) This suggests that Tf induced hepcidin expression is dependent on the interaction of TfR2 with HFE. Hepatic I ron U ptake Liver cells have two main pathways for the uptake of non heme iron from the circulation: TBI at physiological iron concentrat ions (94) and NTBI in iron overload conditions. Both TBI and NTBI are mainly cleared by the liver (184) The liver can also

PAGE 44

44 take up iron from circulating heme, hemoglobin, and ferritin. The levels of these in the plasma are very low in normal conditions, but in the face of hemolysis or ferritin release from damaged tissues, the liver can play an important scavenging role in removing these molecules from the circulation. TfR 1 M ediated TBI U ptake : Studies on the uptake of TBI by the liver showed that there are at least two pathways (55, 185) The first is a Tf receptor mediated pathway with a high affinity, but low capacity due to the limited number of receptors. TBI uptake by livers increased linearly as the extracellular differic Tf concentration was elevated above that required to saturate the TfRs (186, 187) It suggests that there is a seco nd pathway, a non TfR mediated pathway (188) NTR is a low affinity, but high capacity process that operates at higher Tf concentration. The TfR1 mediated pathway in livers s aturates at low extracellular Tf between 50 to 100 nM in vitro (55, 185) In iron overload disorders, most of TBI is taken up by the low affinity process (189) while under low iron conditions the high affinity process occupies greater significance (190) Within the liver, TfR1 are expr essed on all cell types, but TBI uptake by liver is mainly directed to hepatocyte (191) There are several pathways that affect the TBI uptake by TfR1 mediated pathway in livers. First, it is dependent on the expression level of TfR1. In iron deficie nt hepatocytes, TfR1 expression and subsequent TBI uptake is up regulated (192) In iron overload disorders such as HH, hepatic TfR1 was not detactable had no detectable in untreated HH patients (189) Probably, TfR1 dependent TBI uptake is not major role in iron loading. Second, the TBI uptake by TfR1 is affected by HFE. In vivo and in vitro studies showed that HFE associates with TfR1 at cell surface (193) and the binding site for HFE and Tf overlap in TfR1 (194) However, HFE

PAGE 45

45 decreases intracellular iron levels in the cells lacking endogenous TfR1 (195) These studies point out that HFE can lower intracellular iron levels independently of its interaction with the TfR1. Recent studies suggest that HFE inhibits iron uptake by down regulation of Zip14 in HepG2 cells, indicating that the interaction of HFE with Zip14 (99) Third, TBI uptake by TfR1 is influenced by inflammation. In chronic inflammation, serum iron is depleted and hepatic iron accumulates because of RE system iron block ade. Interestingly, hepatocyte also increases the uptake of TBI after in vivo stimulation with IL 6 (196) TfR2 M ediated TBI U ptake : Several studies provide support for a TfR1 independent pathway for TBI uptake in the liver. One of the possible mechanisms is TfR2. Exogenous expression of human TfR2 in Chinese ham ster ovary (CHO) cells line, which does not express either TfR1 or TfR2, markedly increased Tf uptake and binding of Tf at the cell surface (57) Comparison of the subcellular distribution with TfR1 and TfR2 by immunoelectron microscopy demonstrated that the two proteins colocalize at the plasma membrane and in endosomes (61) implying that th e process of TfR2 mediated TBI uptake is similar to that of TfR1. However, TfR2 is not able to fully compensate for TfR1, because TfR1 knockout mice die in utero due to severe anemia, and TfR +/ mice have significantly less hepatic iron (197) Although TfR1 and TfR2 can both mediate TBI uptake, they differ in several respects. TfR2 is highly expressed in the liver and its expression in murine liver increases during development, while TfR1 decreases ( 58) Both receptors bind holo affinity for holo Tf is significantly lower than that of TfR1 (57) The intracellular movement of Tf taken up b y TfR1 and TfR2 also differ. TfR1 recycles apo Tf back to the

PAGE 46

46 cell surface after the release of iron, whereas Tf taken up through TfR2 is deposited in late endosomal compartments (61) sug gesting that TfR2 is involved in intracellular iron deposition. TfR1 mRNA expression is inversely regulated by cellular iron levels through untranslated region of TfR 1 mRNA. In contrast, TfR2 mRNA levels do not change with cellular iron levels. In mice fed iron deficient or iron loaded diets, hepatic TfR2 mRNA expression did not change (198) Similarly, in HepG2 cells treated w ith an iron chelator or ferric nitrate, TfR2 mRNA and protein levels did not show any difference (57) However, mutations in the TfR2 gene cause an autosomal recessive type of HH that is clinically similar to HFE related to HH (199) Transgeni c mice with a targeted mutation in TfR2 had a severe hepatic iron accumulation, despite no TfR2 as well as down regulation of TfR1. Thus, TfR2 appears to play an important role in iron homeostasis that is not principally involved in iron uptake. Tf R ecepto r I ndependent P athways : There are several explanations that liver can take up TBI by NTR. For example, the expression of TfRs on the cell surface of hepatocytes is relatively low (200) When hepatocytes are treated with diferric Tf, TfR2 protein expression is up regulated but the iron uptake is unchanged (55) In addition, the suppression of TfR expression in human hepatoma cell line HuH7 cell does not affect the Tf uptake mediated by NTR pathway (185) One possible mechanism of NTR mediated iron uptake is via fluid phase endocytosis (201) This process takes up iron from the fluid phase of the endocytic vesicles, which are usually di rected to the lysosome and degraded or exocytosed (202,

PAGE 47

47 203) The rate of fluid phase endocytosis reported for hepatocytes is sufficient to account for less than 20% of observed uptake of TBI (187, 204) Another possible way is that iron is released from Tf at the cell surface and then transported across the cell membrane by an iron transporter. First, it has been proposed that the iron is reduced by a redox reaction and re leased from Tf at the cell surface (187, 205) Support for the presence of a reductase in liver plasma membranes has been provided by the action of iron chelators on iron uptake. Ferrous iron chelators that cannot pass through the cell membrane have been reported to inhibit the uptake of iron from Tf by hepatocytes (206) suggesting that the iron is reduced to its ferrous form outside the cell. This is supported by the findi ng of a plasma membrane NADH:ferricyanide oxidoreductase (207, 208) Second, the released iron from Tf is transported across the cell membrane by an iron transporter. This iron is likely taken up by the same pathwa y as NTBI in livers. For example, the TBI uptake by hepatocyte and hepatoma cell is inhibited by the uptake of NTBI (209) Conversely, the uptake of NTBI in livers is reduced by the TBI (209, 210) Interestingly, the uptake of NTBI does not compete with the uptake of TBI by the TfR1 mediated pathway, and also not affect in the rate of Tf endocytosis by the NTR process (209) This indicates that iron from TBI and NTBI is taken up by a common pathway, however, which iron trans porter is involved is unknown. NTBI U ptake in L ivers : As free iron is toxic to cells, the body has developed systems to transport and stor e iron in non toxic forms. Under normal conditions most, if not all, of the iron in blood plasma is bound to Tf (211) Usually Tf is only 20~50% saturated with iron, which allows for sufficient capacity to normally prevent the

PAGE 48

48 appearance of free toxic iron into the circul ation. However, in abnormal conditions such as genetic iron overload disorders; plasma Tf becomes saturated, giving rise to NTBI (212, 213) NTBI is defined as iron bound to low molecular weight molecules rather th an the serum protein Tf. The major fraction of NTBI form in the blood (over 50%) is in the form of ferric citrate (95) In a healthy individual, NTBI levels are usually less than 1 M; however, in patients with iron overload, they can increase up to 10 M (213, 214) NTBI induces cell damage by generating highly reactive free radicals (215) Such free radical induced damage is increasingly implicated as a contributor to the pathogenesis of cancer, cardiovascular disease, aging and other degenerative diseases (216, 217) NTBI is rapidly cleared from the plasma by the liver, mainly by hepatocytes (95, 218, 219) Perfusion studies using isolated rat liver have demonstrated that plasma NTBI is efficiently cleared by the liver (70% first pass extraction) (95) whereas the clearance of Tf by the liver is usually less than 1% (188) In an animal study, mice were first given sufficient int ravenous iron to saturate their circulating Tf, and a subsequent dose of radioactive NTBI was given either orally or intravenously (96) Over 70% of the radioactive iron, irrespective of whether it was given orally or intravenously, was taken up by the liver, indicating how effective this process is. Autoradiography showed that the NTBI was predominantly removed by hepatocytes, whereas removal by Kupffer cells appeared quantitatively much less important (95) The feature of the NTBI uptake process is its possible relationship to accumulation of other metal ions. Previous studies have s hown that a number of divalent metal cations such as Zn, Co and Mn inhibit competitively the uptake of iron by cells (95, 167, 220) suggesting a common divalent metal ion carrier might be involved. In general,

PAGE 49

49 pla sma NTBI are taken up in a two step process. In the first step, ligand bound plasma NTBI dissociates as a consequence of interacting with cell surface binding proteins or reductase. The most preferred one assumes activity of a surface transmembrane oxidore ductase that reduces ferric iron and thereby creates the soluble ferrous iron, which binds only loosely to Tf (221 223) Stimulation of iron uptake by ascorbate is consistent with an important role for the reduced form of iron in NTBI uptake, and this is further supported by the ability of the Fe 2+ chelators. The Fe 2+ specific chelators markedly inhibited iron uptake whether ascorbate was present or not, indicating that Fe 3+ uptake is dependent on reduction to the f errous state (222) The ferrous form of iron is then delivered into the cell by a transporter (167, 224) Precisely how NTBI makes its way across the plasma membrane and in to cells is unclear, but several candidates have been proposed. To date, DMT1 is the best characterized candidate for mediating NTBI transport. Its role as a candidate NTBI transport protein was confirmed by expression in Xenopus oocytes, where it stimulat ed the uptake of Fe 2+ by 200 fold (63) Immunohistochemical studies of rat liver showed that DMT1 is expressed along the cell membranes of hepatocytes lining the sinusoidal space, and that its expression increased during iron loading (73) DMT1 expression has been detected at the plasma membrane of hepatocytes, and its mRNA and protein expression were also up regulated in hepatocytes from Hfe KO mice (225) However, DMT1 has severa l limitations observed in transporting NTBI. DMT1 transport activity proceeds optimally at pH 5.5 (63) which adapts the transporter well to the environment of the endosome and proximal duodenum, but seemingly not to the neutral pH (7.4) at the plasma membrane of the

PAGE 50

50 hepatocyte. The mRNA expression of DMT1 is highest in duodenum, but to a lesser extent in liver, heart and pancreas (63) which are main storage organs of NTBI. Questions also remain regarding the cellular localization of DMT1 in the liver. qRT PCR studies on isolated liver cell populations indicate that the highest levels of DMT1 is observed in the Kupffer cells and the lowest levels is in the hepatocyte (226) Moreover, DMT1 KO mice were born anemic but without developmental abnormalities. When they were injected with iron dextran, dramatically accumulated NTBI into the liver occurred (136) This is similar to human pati ents with DMT1 mutations. They suffered from microcytic anemia, but also showed hepatic iron loading (227, 228) ]. Clearly the liver appears to have an alternative way of acquiring iron independent of DMT1. To date none of the known ion channels seem to be involved in hepatic iron uptake, although Fe 2+ uptake by an L type Ca 2+ channel has been observed in adult rat myocardium and myocytes (229) Mammals produce 4 nearly ident ical L type Ca 2+ channels with overlapping patterns of tissue expression. However, information about any role for calcium channels in liver iron uptake is scant. One of studies investigated the transcripts coding for calcium channel subunits is expressed i n the liver, but the level of mRNA is relatively low (230) Therefore, more research will be necessary to test that L type Ca 2+ channel mediates NTBI uptake into livers. Another possible mechanism for uptake of NT BI is Zip14. That Zip14 may be physiologically relevant for NTBI uptake is supported by studies of the tissue expression of the protein. The first study to identify Zip14 used Northern blot analysis of 16 different human tissues and found most abundant exp ression in liver, heart and pancreas (76) Th ese three tissues are especially important to iron homeostasis and also selectively

PAGE 51

51 accumulate iron during iron overload. Murine Zip14 transcript abundance by qRT PCR revealed that the highest expression is in liver, whereas a moderate level is in heart an d kidney (77) Recently, Zip14 has been shown to transport Zn 2+ as well as Fe 2+ in cells. Suppression of the endogenous Zip14 expression led to the decrease of i ron and zinc uptake in AML12 hepatocyte cells (78) Recent studies showed that the highly induced NTBI uptake by Zip14 is down regulated by HFE expression in HepG2 cells (99) HFE expression promotes the degradation of Zi p14 protein by post transcriptional regulation. It is possible that hepatic iron accumulation from the mutation of HFE is probably due to transporting NTBI in livers. Dieta ry I ron D eficiency and O verload Dietary I ron D eficiency Iron deficiency (ID) is the most common nutritional deficiency in the world. A report of the World Health Organization estimates, 39% of children younger than 5 years, 48% of children between 5 and 14 years, 52% of pregnant women in developing countries suffer from the anemia (231) with half having iron deficiency anemia (IDA) (232) A significant prevalence was observed in the industrialized cou ntries among certain population groups. In the USA, 9~11% of non pregnant women aged between 16 and 49 years are iron deficient, 2~5% have IDA (233) Nutritional ID occurs when the physiological iron requirement cannot be met by iron absorption from the diet. Iron absorption is influenced by the type of dietary iron consumed. Dietary iron bioavailability is low in populations who frequently consume a plant based diet such as legumes and cereals along with little meat (234) In plant based diets most iron is from non heme iron. The absorption of non heme iron is

PAGE 52

52 significantly inhibited by phytates, polyphenols and calcium (235) Phytic acid (phytate) is the storage form of phosphorous in unrefined cereals, legumes, nuts and seeds. Since phyate is negatively charged, it complexes with positively charged iron, resulting in poor bioavailability of iron (236) Polyphenols commonly present in many vegetables contain phenolic acids, flavonoids and their polymerization products (237) There are several kinds of phenolic compounds in beverages such as tea and co ffee, herbal teas, cocoa and red wine. These phenolic compounds form insoluble complexes with iron and thus inhibit iron absorption. The influence of calcium on iron bioavailability is not so clear. However some studies suggest that when calcium supplement s are given with a test meal, it significantly impaired retention of 59 Fe in the whole body (238) Interestingly, when calcium supplements ar e added with orange juice, the impairment of iron retention was not observed. Orange juice contains ascorbate or citrate, known enhancers of iron absorption (237) IDA is a very common nutritional disorder amo ng premenopausal women. Approximately 1 mL loss of blood means the around 0.5 mg of iron loss, and a heavy menstrual blood loss (>80mL per month in about 10% women) dramatically induces the risk for ID (239) The loss of iron in a woman is also highly induced during pregnancy. The t otal daily iron requirement in pregnant woman is approximately double that of other women. In developing countries, the high prevalence of ID is most often from nutritional deficiencies worsened by chronic blood loss due to parasitic infections and malar ia (240) In industrialized countries, it is commonly contributed by the reduced absorption

PAGE 53

53 because of the pres ence of inhibitors of iron uptake in the diet, excessive iron loss, and repeated pregnancies in women with marginal iron intakes. IDA is characterized by pallor, fatigue and weakness. Several studies have documented associations between IDA and poor cogni tive and motor development and behavioral problems (241 ) In anemic children, either an infant developmental assessment or an IQ test were significantly poorer ( 242) IDA at the beginning of pregnancy is associated with preterm delivery and low birth weight infants (243) During pregnancy, IDA is more dangerous because it significantly increases the risk of maternal and i nfant death. Iron O verload D isorders Hereditary H emochromatosis (HH): Genetic susceptibility to overload disease hereditary hemochromatosis (HH), the most common autosomal recessive disorder, affects 1 in every 200 ~ 400 individuals in Caucasians (244) It is an inborn error of iron metabolism described by increased intestinal iron absorption, which leads to a progressive accumulation of iron in the body (245) A moderat e but constantly increased basal iron absorption from the diet leads to an increased body iron burden of 20 ~ 40 g (normal body iron content = 5g) over a time period of 40 ~ 60 years (246) Excess of iron is deposited in parenchymal cells of liver, heart, and pancreas. Characteristically, macrophage iron may be decreased despite severe parenchymal iron deposition. At the beginning, symptoms of HH include fatigue, arthralgias, depression, impotence, and increased skin pigmentation. As the disease progress, HH patients develop serious liver inflammation, an d which result in hepatic fibrosis and cirrhosis. The frequency of hepatocellular carcinoma is increased in HH patient (247) Other symptoms in untreated HH patients include progressive increases in skin pigmentation, diabetes mellitus,

PAGE 54

54 congestive heart failure and arrhythmias. Males have a clinically more opportunity to accumulate iron in the bodies than females, pa rtially due to the loss of iron in women caused by menstruation and pregnancy. HH is a heterogeneous genetic disease that may result from mutations in at least 4 genes. The most common form of HH results from the mutation of HFE gene. HFE KO mice rapidly d evelop iron overload, similar to human patients (197) The HFE gene was discovered in 1996 and belongs to the major histocompatibility complex 1 family which is ubiquitously expressed on cell surfaces (248) Several mutation forms of HFE were identified in HH patients, and the most prevalent mutation (homozygous in 83% of patients) was a substitution of tyrosine for cysteine at amino acid residue 282 (C282Y) (49 ) HFE complexes with 2 microglobulin but has no role in immunoregulation (248) The HFE C282Y mutation results in the disruption of a critical disulfide bridge which is critical for the interaction with 2 micro globulin. Further study for the importance of these interactions is provided by the observation in 2 microglobulin KO mice. The lack of 2 microglobulin alters the expression and function of HFE, developing parenchymal iron overload similar to that observ ed with HH (249) The molecular function of HFE in iron homeostasis is unknown, but studies indicate that HH patients and HFE KO mice have inappropriately low levels of hepcidin. The relations between hepcidin a nd HFE still remain uncertain. However, the lack of hepcidin expression in iron overload disorders implies that HFE plays an important part in the regulation of hepcidin expression in response to iron overload. This is further supported by the observation that constitutive over expression of hepcidin inhibits the iron accumulation normally in HFE KO mice (250)

PAGE 55

55 C HAPTER 2 MATERIALS AND METHODS Cell C ulture A ML12 mouse hepatocytes, a non transformed mouse hepatocyte cell line (251) 12 50/50 mix medium supplemented with 10% fetal bovine serum, 40 ng/mL dexamethasone, and H4IIE cells, initially derived from a Reuber H35 hepatoma (252) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 4.5 g/L glucose and 2 mM L glu tamine, supplemented with 10% fetal bovine serum. Both media contained 100 units/mL penicillin and 100 atmosphere at 37C with 5% CO 2 After incubations with iron chelators or Fe nitrilotriaceta te (Fe NTA ), cells were washed once with phosphate buffered saline (PBS) prior to isolating RNA. Antibodies Anti Zip14 antiserum was generated in rabbit against peptide ENEQTEEGKPSAIEVC, corresponding to amino acids 138 153 in rat and 137 152 in mouse Zip 14. Antibodies specific to the Zip14 peptide immunogen were affinity purified by using a peptide agarose column of Sulfo Link coupling gel (253) Rabbit anti DMT1 antiserum was kindly supplied by Dr. Philippe Gross (McGill University, Montreal, Canada). Anti scavenger receptor B1 (SR B1) antibody was obtained from Novus Biologicals.

PAGE 56

56 Rats for D ietary I ron S tatus and I mmunohistochemistry (IHC) Weanling male Sprague Dawley rats (n=18) were obtained from Charles Rive r Laboratories. After 3 days acclimation, rats were randomly assigned to three dietary groups: iron deficient (FeD), iron adequate (FeA) and iron overload (FeO). Rats were fed modified TestDiet 5755 diets formulated to contain no added iron (FeD), 200 ppm iron as ferric citrate (FeA), or 30,000 ppm iron as carbonyl iron (FeO). Iron concentrations of the diets, as determined by inductively coupled plasma mass spectroscopy (ICP MS), were found to be 9 ppm (FeD), 215 ppm (FeA), and 27,974 ppm (3% FeO). The se cond diet was based on a modified AIN 93G purified rodent diet formulations, supplemented with no added iron (FeD), 35 ppm iron as ferric citrate (FeA), or 20,000 ppm iron as carbonyl iron (FeD) (Research Diets). These diets contained 20% sucrose instead of 10% in an effort to make the iron loaded diet more palatable and Avicel instead of cellulose to reduce any contaminant iron. To adjust for the increased sucrose in the diets, the amount of cornstarch was reduced accordingly. The iron concentrations of t he diets, as analyzed by ICP MS, were 10 ppm (FeD), 50 ppm (FeA), and 18916 ppm (2% FeO). Animals were provided with the diets for 3 wk and body weights were measured every third day. Another animal study was performed to collect the liver, duodenum and pa ncreas for immunohistochemistry. Weanling male Sprague Dawley rats (n=18) were fed an iron deficient (9 ppm), iron adequate (50 ppm) or iron overloaded (2% carbonyl iron) diet for 3 wk. Animal Protocols for the animal studies were approved by the Universit y of Florida Institutional Animal Care and Use Committee.

PAGE 57

57 Blood and T issue C ollections At the end of animal study, rats were anesthetized with vaporized isoflurane delivered by a Surgivet Isotech 4 vaporizer (Smiths Medical). Upon deep anesthesia, animal s were sacrificed by exsanguination via the descending aorta. Blood was collected via a heparinized syringe. Hemoglobin was measured with a HemoCue 201+ hemoglobin analyzer (HemoCue). Hematocrit was determined by centrifugation of blood collected into hepa rinized microcapillary tubes. To collect plasma, whole blood was fractionated by centrifuging at 10,000 x g for 15 min at room temperature. Plasma was frozen at 80C until use. Serum I ron, Total Iron Binding Capacity, and T f saturation (%) Serum iron and TIBC (total iron binding capacity) measurements were determined colorimetrically as described previously (254) Briefly, serum iron or working iron standard solution (2 g/ml) was added with an equal volume of protein precipitation solution (0.61 M tricholoroacetic acid, 1M hydrocholoric acid an d 3% thioglycolic acid). Contents were mixed vigorously and allowed to stand for 5 min. The samples were centrifuged at 1500 x g for 15 min and the superna ta nt was mixed with chromogen reagent containing ferrozine. After standing for 10 min, the optical de nsity was measured at 562 nm. TIBC serum was determined by adding an equal volume of saturation solution (0.3 M ferric chloride and 1 M HCl). After incubation at room temperature for 15 min, 20 mg magnesium carbonate was added and tube s were placed on a rotator for 30 min. Following centrifuging at 3000 x g for 15 min, the supern at ant was transferred to a new tube and the centrifugati on was repeated. The superna ta nt was used to measure iron

PAGE 58

58 concentration as described for the serum iron assay. Tf saturati on percentage (%) was calculated as serum iron/TIBC x 100. Non H eme I ron D etermination Non heme iron content of tissues was measured by using the standard method of Torrance and Bothwell (255) A sample of frozen tissue (~50 mg) was weighed and acid digested in 3M HCL and 10% trichloroacetic acid. After incubating for 20 h at 65 o C, an aliquot of the supernatant was mixed with co lor reagent (bathophenanthroline sulfphonate, thioglycollate, and sodium acetate) and the optical density was measured at 535 nm. Optical densities were compared to those obtained from a certified iron reference solution (Fisher Scientific). RNA I solation and Quantitative RT PCR To isolate total RNA, approximately 50 mg of tissue was homogenized in RNABee RNA isolation reagent (TelTest). To remove cell debris, each sample was centrifuged at 4 o C for 10 min at 10,000 x g and the supernatant was handled foll owing the free kit (Ambion, Austin, TX), and the purified RNA was quantified by measuring optical density at 280 nm in a Nanophotometer (Implen). Integrity of isolated total RNA w as evaluated by agarose gel electrophoresis and glyoxal sample denaturing buffer (Ambion). To isolate RNA from pancreas, the RNeasy Mi + ni Kit (Qiagen) was used synthesis using the High Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA). The cDNA was then used as template for quantitative reverse transcription polymerase chain reaction (RT PCR) with rat gene specific primers. For PCR, Power SYBR Green PCR Mast er Mix (Applied Biosystems) was used with five log 10 standard

PAGE 59

59 curves on an Applied Biosystems 7300 Real Time PCR System. The specificity of gene specific primers was confirmed by dissociation curve analysis of PCR products. Isolation of C rude M embrane P ro tein and Western B lot A nalysis Crude membrane was isolated by dounce homogenization of the tissue samples in ice cold HEM buffer (20 mM Hepes, pH 7.4/1mM EDTA/300 mM mannitol) containing a protease inhibitor cocktail (Roche). Lysates were centrifuged at 10 ,000 x g for 10 min at 4 o C to pellet nuclei and insoluble debris. The supernatant was centrifuged at 100,000 x g for 30 min at 4 o C to pellet membranes, which were then suspended in HEM buffer and stored at 80 o C until analysis. Protein concentrations we re determined colorimetrically by using the RC DC Protein Assay Kit (Bio Rad). Proteins were mixed with Laemmli buffer and incubated for 15 min at 37 o C. Proteins was separated electrophoretically on an SDS 7.5% polyacrylamide gel, transferred to nitrocellu lose, and incubated for 1 h in blocking solution [5% nonfat dry milk in Tris buffered saline Tween 20 (TBS T)]. Blots were incubated overnight at 4 o C in blocking buffer containing 2.5 g/ml affinity purified rabbit anti Zip14 antibody. After washing in TB S T, blots were incubated for 40 min with a 1:2,000 dilution of peroxidase conjugated donkey anti rabbit IgG secondary antibody (Amersham Biosciences). To confirm equivalent loading, blot was stripped and reprobed for SR B1 (Novus Biologicals) followed by peroxidase conjugated goat anti mouse IgG (Zymed). Cross reactivity was visualized by using enhanced chemiluminescence and x ray film. Immunoprecipitation (IP) For IP HEK 293T cells were transfected with pCMVSport6/rat Zip14 (rZip14), and rat liver memb rane (RLM) was isolated. The affinity purified anti Zip14 (400 g) was incubated with the covalently cross linked beads (Pierce co IP kit) in a spin cup colum n

PAGE 60

60 for 4 h with gentle end over end mixing at room temperature. After washing several times with co upling buffer (0.14 M sodium chloride, 0.008 M sodium phosphate, 0.002 M potassium phosphate and 0.01 M KCl, pH 7.4), quenching buffer (1 M Tris HCl, pH 7.4) was added. The antibody coupled beads were washed four times with 0.4 ml wash solution (1 M NaCl) and two times with coupling buffer, and then stored at 4C until analysis. After placing spin cup into new tubes, 400 g of RLM was incubated with Zip14 antibody coupled beads for 2 h at room temperature in a spin column. The spin column was centrifuged at 5,000 x g for 1 min, and washed several times with coupling buffer. Zip14 protein was eluted with elution buffer, and immediately the column was regenerated with coupling buffer. For IP with rZip14 (positive control), rZip14 (400 g) was also incubated wi th the regenerated beads as the same procedure. The original samples and elution fraction from IP with RLM or rZip14 were analyzed by Western blotting. Tissues F rozen S ections for Immunohistochemistry Upon deep anesthesia, rats were sacrificed by exsanguin ation via the descending aorta. The liver, pancreas and duodenum were rapidly excised and washed in ice cold PBS. The duodenum was washed out several times with cold PBS and cut into 2 4 mm length transverse sections. The liver and pancreas were cut into 2 4 mm length pieces. The slices of these tissues were immediately embedded in OCT. Compound (Sakura) and frozen in dry ice. Seven micrometer serial sections were prepared by using a cryostat. After the sections were air dried overnight at room temperature, they were incubated in acetone at 20C for 5 min. The sections were air dried for 15 min at room temperature, and then they were washed in TBS for 5 min. Nonspecific immunoglobulin binding was blocked with 2% normal goat serum (Vector lab) for 30 min, an d the

PAGE 61

61 endogenous avidin and biotin were blocked with avidin/biotin blocking solution (Vector lab). The primary antibodies, diluted as 2 g/mL with antibody diluents (Invitrogen), were applied to tissue sections and incubated at 4C overnight in a humidifie d chamber. The slides were then incubated with biotinylated goat anti rabbit IgG (Vector lab), diluted 1:500 in 2% normal goat serum in TBS for 40 min. The biotinylated antibody was visualized using streptavidin Alexa 488 (Invitrogen) with 1:500 ratio for 30 min. After post fixation with 10% formalin buffered saline for 3 min, the sections were mounted on cover slips with Vectashield diamino 2 phenylindole (Vector lab). Confocal microscopy and subsequent data analysis were done by using the Olympus IX2 DSU spinning disk confocal fluorescent microscope and proprietary software. B lue and H ematoxylin E osin S taining Portions of liver were placed in 10% buffered formalin for 16 h, transferred int o 70% ethanol, processed, and embedded in paraffin. Tissue sections were cut into 5 m using a sliding microtome. Sections were air dried overnight and counterstained with slides were deparaffinized with xylene, followed by the rehydration with alcohol series. The slides were stained with Harris haematoxylin. Following dehydration in alcohol, the slides were counterstained with eosin, dehydrated through alcohol series and xy lene, and mounted with mou n ting medium. For the iron staining, deparaffinized and rehydrated slides were incubated in freshly prepared 2% aqueous potassium ferrocyanide hydrochloric acid incubating solution for 15 min. After washing the slides with water, slides were counterstaining with 1% Neutral Red for 2 min. Images were taken using an Olympus IX70 inverted fluorescen ce microscope.

PAGE 62

62 Statistical Analysis Results are expressed as mean S.E.M from representative one of three independent experiments. The significance of variability was determined by an unpaired 2 t test or by one hoc test (GradphPad Prism).

PAGE 63

63 CHAPTER 3 EFFECT OF DIETARY IRON DEFICIENCY AND OVERLOAD ON ZIP14 LEVELS AND LOCALIZATION IN VARIOUS RAT TISSUES Disturbances of iron metabolism such as iron deficiency and iron overload are common in humans. For example, about two billion people in the world suffer from iron deficiency (231) Although iron deficiency is more common in developing countries, it is also prevalent in the United States among certain population groups, such as toddlers and females of child bearing age (256) The iron overload disorder called hereditary hemochromatosis (HH) is prevalent in individuals of Northern European descent, affecting approximately 1 in 400 with a carrier frequency of 1 in 10 (248) HH is an inherited disorder of iron metabolism that is characterized by excessive iron deposition in major organs such as the liver, heart and pancreas. Chronic hyperabsorption of dietary iron loads the body with iron, increasing the risk of d eveloping cirrhosis of the liver, hepatocellular carcinoma, diabetes, and cardiomyopathy (257) Under normal conditions, circulating Tf is only 20 50 % saturated with iron. In iron overload conditions, plasma Tf becomes saturated and iron appears in the plasma as NTBI (212, 213) NTBI is rapidly cleared from the plasma by the liver, mainly by hepatocytes (95, 218, 219) Other tissues such as the pancreas and heart also take up NTBI. However, it is uncertain which iron import proteins are involved in taking up NTBI in these tissues One of the best characterized importer p roteins for NTBI is DMT1 (227) DMT1 is a transmembrane, proton coupled metal ion transporter that is present in hepatocytes, where it is postulated to be involved in NTBI uptake (160) However, DMT1 mediated iron transport in Xenopus oocytes is optimal pH at 5.5. The transport activity of DMT1 is also weak at neutral pH, the pH for the plasma membrane of the hepatocyte (258) A r ecent study reported that human patients with DMT1 mutations

PAGE 64

64 suffer from microcytic anemia but also show hepatic iron loading (227) DMT1 KO mice became anemic; but when they were injected with iron dextran, their livers still took up the NTBI (136) Probably, there is an alternative w ay to take up NTBI in liver. Zip14, a member of the ZIP family of metal ion transporters, has recently been shown to transport iron in addition to zinc (78) That Zip14 is probably involved in transporting NTBI is consistent with its tissue expression profile. The three major tissues expressing Zip14 are the liver, heart and pancreas (Taylor, 2005 #44) T hese three tissues are major iron loading tissues during iron overload. Recently, Zip14 was observed in the endo some and endosomal Zip14 mediated the TBI uptake in hepatocyte (88) A number of studies have focused on how iron is handled by the three important tissues involved in iron metabolis m: the duodenum, liver and spleen. The duodenum is the site of dietary iron absorption ; the liver is the main site of iron storage; and the spleen recycles iron from senescent red blood cells. However, relatively few studies have focused on the pancreas, which also accumulates iron in iron overload disorders. Iron overload in the pancreas c cell s resulting in decreased insulin secretion and possible development of diabetes mellitus (259) Interestingly, a recent study found that the endocrine pancreas is an additional sour ce of hepcidin, the iron regulatory peptide hormone (260) cell s also highly express DMT1 (261) Iron overload in the rat pancreas following portacaval shunting showed marked iron deposition in acinar cells (262) Rats fed a carbonyl iron diet for 4 to 15 months showed an accumulation of iron in acinar cells as well as the beta cells (263) At present, it is unknown which iron import protein is involved in the accumulation of iron in pancreas

PAGE 65

65 Th e aim of the present study was to investigate the relationship between Zip14 and iron status by using animal models of iron deficiency and overload. Male Sprague Dawley rats were assigned to 3 dietary groups (control, iron deficient, and 2% carbonyl iron). After 3 weeks of feeding, tissues were harvested and analyzed for non heme iron concentrations Zip14 mRNA and protein levels. The localization of Zip14 protein in the liver, pancreas, and duodenum was a lso determined by immunohistochemistry.

PAGE 66

66 Results Effect of FeD and 2% FeO on Rat Body Weight Weanling male Sprague Dawley rats were fed a modified AIN 93G purified rodent diet that contained 10 ppm Fe (FeD), 50 ppm Fe (FeA) or 18916 ppm Fe (2%FeO) for 3 wk (n=6/group). At the beginning of t he study, both the FeD and 2% FeO rats showed normal rates of weight gain. After 12 days, the body weight gains in the FeD and 2% FeO animals were slower relative to FeA controls. The final body weights of the FeD and 2% FeO rats were 20% less than those o f the FeA animals (Fig. 3 1). At sacrifice, FeD rats became anemic, as indicated by reduced Hb (4.6 0.2) and H CT (18.7 1.0) relative to those of the FeA (13.2 g/dL and 42.4%, respectively) (Table 3 1). The levels of Hb were slightly increased in the 2% FeO rats. The FeD animals had significantly lower serum iron and Tf saturation, and higher TIBC than the FeA and 2%FeO rats. Non heme iron concentrations were determined for the liver, spleen, heart, pancreas, and kidneys (Table 3 2). In FeD rats, liver a nd kidneys non heme iron levels were reduced by 57% and 42%, respectively, relative to FeA controls. Liver and spleen non heme iron levels were dramatically increased by 2% FeO (60 and 29 times higher than those of FeA rats). The heart, pancreas, and kidne ys also accumulated higher levels of non heme iron in 2% FeO rats when compared to controls. Characterization of the Immunoreactivity of Anti Zip14 Antibody We generated an antibody against a Zip14 peptide that is 100% conserved between rats and mice, b ut not humans. Specificity of the antibody was investigated by using immunoprecipitation (IP), peptide competition, and pre immune serum. The IP was performed using HEK 293T cells that over expressed rat Zip14 (rZip14) and (rat liver membrane) RLM. Rat Zip 14 was detected in both the IP and RLM samples as an

PAGE 67

67 immunoreactive band with an apparent molecular mass of 140 kDa (Fig. 3 2A). Pre incubation of the anti Zip14 antibody with 50 fold excess immunogenic peptide abolished the Zip14 immunoreactive bands (Fig 3 2B). Immunoreactive bands of rZip14 were detected at ~50, 60 and 140 kDa. The 60 kDa band was also observed in the vector only, suggesting that the 60 kDa immunoreactive band is not Zip14. No immunoreactive bands were obtained when pre immune serum was used (Fig. 3 2C). Collectively, a Zip14 immunoreactive band was detected at ~140 kD in both RLM and HEK293T cells transfected with Zip14. In the latter, Zip14 was also detected around 50 kDa, similar to the calculated molecular mass of 54 kDa for rat Zip1 4. Hepatic Zip14 is Glycosylated rZip14 and two RLM samples were incubated with PNGase F, an enzyme that cleaves N linked glycans, prior to Western blot analysis. Treatment of rZip14 and RLM with PNGaseF decreased the apparent molecular mass of Zip14 f rom ~ 140 kDa to ~ 100 kDa (Fig. 3 3 ), indicating that this immunoreactive band is glycosylated. Effect of FeD and 2% FeO on Hepatic Zip14 mRNA and Protein Levels Transcript abundances of Zip14 and other iron related genes in rat livers were analyzed by qRT PCR. Rat Zip14 is predicted to be encoded by at least two transcript variants, referred to here as short and long transcripts (L Zip14). Zip14 primers were designed to target either both isoforms or the L isoform specifically. Compared to FeA controls, Zip14 mRNA levels were 50% higher in FeD rat liver, but were no different in 2% FeO livers (Fig. 3 4A). L Zip14 transcripts did not respond to dietary iron status. Two isoforms of DMT1 (with (+IRE) or without ( IRE) ) were increased by 90% and 40% in FeD but no change was observed in 2% FeO. To demonstrate iron related difference s in mRNA levels, hepcidin (the iron regulatory hormone) (33, 34) and TfR1 (an indicator

PAGE 68

68 of cellular iron status) mRNA levels were measure d (Fig. 3 4A). Hepcidin mRNA was not detectable in FeD and increased 10 fold in response to 2% FeO. Conversely, hepatic TfR1 mRNA was highly induced in FeD but showed no difference in 2% FeO, compared to that of FeA. Zip14 protein levels in the rat liver d id not differ among dietary iron treatment groups (Fig. 3 4B). Consistent with mRNA data in rat livers, hepatic DMT1 and TfR1 protein levels were up regulated in FeD (Fig. 3 4B). Interestingly, DMT1 immunoreactive bands were not detectable in 2%FeO. Effec t of FeD and 2% FeO on Pancreatic Zip14 and DMT1 mRNA and Protein Levels Pancreatic Zip14 (Zip14 or L Zip14) transcripts were not affected by dietary iron status (Fig. 3 5A). In contrast, DMT1 (either with or without IRE) transcripts were significantly do wn regulated by 2% FeO. Surprisingly, pancreatic Zip14 protein levels were markedly up regulated in 2% FeO (Fig. 3 5B). The pancreatic Zip14 band was detected around 50 kDa similar to the PC (HEK 293T cells overexpressing rat Zip14). No difference was ob served in DMT1 protein levels among the dietary iron treatment group s (Fig. 3 5B). Effect of FeD and 2% FeO on Heart Zip14 and DMT1 Protein Levels The heart Zip14 protein band was detected around 50 kDa, similar to the band pattern of pancreatic Zip14. H eart Zip14 protein levels were significantly induced by 2% FeO, but there were no change s in heart DMT1 protein levels (Fig. 3 6). Histological Examinations of Liver and Pancreas Rat liver sections were stained with hematoxylin and eosin for morphologica l evaluation (Fig. 3 7). While FeA and 2%FeO livers contained no visible fat droplets, rats fed the FeD diet had abundant accumulation of fat droplets in their hepatocytes. Rat

PAGE 69

69 nt of iron loading (Fig. 3 8 and Fig.3 9). No visible iron staining was observed in the FeD rat livers (Fig. 3 8). In FeA rat livers, some iron staining was observed around the hepatic duct in Kupffer cells. The 2% FeO animals showed considerable iron accu mulation in liver Kupffer cells and hepatocytes along with the sinusoid. A gradient was produced, such that the periportal area (PV) had more than the central vein area (264) In the pancreas of 2% FeO rats, iron s taining was only observed around acinar cells and not in cells (Fig. 3 9). Localization of Zip14 in Liver, Pancreas, and Duodenum Immunohistochemistry was used to investigate the localization of Zip14 in the liver, pancreas, and duodenum. In the livers of the FeA rats, the immunostaining with Zip14 was clearly detected at the sinusoidal borders of the hepatocyte membrane and partially in the cytoplasm (Fig. 3 10A). Interestingly, in the 2% FeO rats, Zip14 was observed at the plasma membrane and the peri nuclear region of hepatocyte s along with the sinusoid. In the FeD rats, the intense signal of Zip14 disappeared. Immunofluoresecent localization of Zip14 in the rat pancreas showed that Zip14 localizes on perinuclear regions and plasma membrane in acinar cells (Fig. 3 10B). The perinuclear region of Zip14 staining was more intense in the 2% FeO rats than in the FeA or FeD rats. In the duodenum, Zip14 protein was localized at the basolateral membrane in the FeA rats (Fig 3 10C). The immunostaining of Zip14 was faint in the FeD rats, but unexpectedly, the 2% FeO rats showed a strong signal of Zip14 in the basolateral membrane in the villus region (Fig. 3 10C).

PAGE 70

70 Discussio n Zip14, one of the ZIP family members in mammals, has been identified to transport iron in addition to zinc in hepatocytes (78) However, there is no information about how Zip14 expression is regulated in the liver and other tissues in response to dietary deficiency and overload. In the present study, t wo independent animal studies were performed with weanling male rats fed an iron deficient, adequate, and 2% carbonyl iron diet for 3 wks. Carbonyl iron was chosen to induce iron overload because this form of iron has a good bioavailability and extremely l ow toxicity due to its slow rate of solubilization (265) After 3 wk of feeding the rats on the respective diets the main tissues that load iron (liver, pancreas, and heart) were collected and analyzed fo r Zip14 mRNA and protein levels. The localization of Zip14 in the liver, pancreas, and duodenum was investigated. Under normal conditions, iron is bound to Tf. However, in iron overload, Tf can become fully saturated and excess iron is present in blood pl asma as a NTBI. NTBI is quite toxic, so it is rapidly cleared by the liver, heart and pancreas. The molecular mechanism of NTBI uptake has not been fully understood; however, early studies suggest that NTBI occurs by a carrier mediated process (167, 220) Candidates for the carrier include Zip14, which has been shown to transport NTBI into hepatocytes (78) In the present study, liver Zip14 protein levels did not respond to dietary iron deficiency and 2% carbonyl iron. This observation was not consistent with the Zip14 protein levels in the pancreas and heart. Zip14 protein levels in these two tissues were significantly up regulated by 2% FeO. One possible explanation of thi s difference is that liver NTBI uptake is not regulated by iron status. Several studies have reported that the iron loaded liver cells can induce the increased rate of NTBI transport

PAGE 71

71 (222, 266, 267) In these exper imental designs, liver cells were treated with ferric ammonium citrate (268) (268) The up regulation of NTBI uptake by FAC also markedly led to the depression of the activ ities of free radical scavengers (269) The decrease of protective effect from free radical scavengers will cause the cell membrane damage and the increased iron permeability into cells. It probably leads to an app arent up regulation of NTBI uptake. Indeed, in iron overload patients with high levels of NTBI, serum from these patients can induce both the peroxidation of membrane lipids and the formation of free radicals (270) More importantly, bo th iron overloaded and iron deficient animals took up NTBI as efficiently and with the same kinetic parameters as iron adequate rats (167, 220, 271) There was no apparent difference in the uptake and internalizati on of NTBI by normal and iron loaded hepatocytes (272) Alternatively it is possible that the uptake of NTBI may contribute significantly in the earlier stage of iron loading. Compared to the non heme iron levels in rat tissues, liver non heme iron levels were massively greater (60 fold) in the 2 %FeO rats than in the iron adequate rats. T h e heart and pancreas in 2%FeO rats only accumulated 2 or 4 times higher an amount of non heme iron, compared to that of the FeA rats. Even though the liver is a major storage organ for excess iron, too much iron can lead to liver damage. It could be possible that some other mechanism s can suppress NTBI uptake, when the liver is overwhelmed with massive amounts of iron. Interestingly, a recent study reported that the Zip14 mRNA copy numbers are 10 fold greater than that of DMT1 in the HepG2 human hepatoma cell line (88) In addition, Zip14 transcript s had higher levels in HepG2 cells (11 fold greater than in HEK 293 T cells) (88) The observation that Zip14 levels did not respond to dietary iron status may be related to the high basal leve ls of Zip14 in the liver.

PAGE 72

72 There is little information about the regulation and function of DMT1 in the liver. Liver DMT1 levels by in situ hybridization were not regulated by dietary iron in adult rats (73) but others found that liver DMT1 mRNA levels are signi ficantly decreased in animals fed a high iron diet (273) I found that liver DMT1 mRNA and protein levels were highly up regulated by dietary iron deficiency, and DMT1 protein was not detectable in liver from rats fed a 2% carbonyl iron diet. This observation was opposite to the result s obtained by others. For example, i mm u nohistochemical studies of rat liver showed that DMT1 protein staining was greatest in the 3% carbonyl iron supplementation and the least in iron deficiency (73) In addition, hepatic DMT1 mRNA and protein expression w ere increased from HFE KO mice (225) However, there were several points that DMT1 does not have major role in transporting NTBI. The optimal pH of DMT1 is 5.5 but not at the neutral pH at the plasma membrane where most NTBI take up into cells (63) DMT1 transcripts are present in all liver cell types and show the highest levels in K upffer cells and stellate cells but not in hepatocyte s where most NTBI accumulates (226) Iron loading was also observed in DMT1 KO mice (136) The results from LMTK cells, a mouse fibroblast cell line, showed that iron has no significant effect on the expression of DMT1 mRNA and protein (274) Moreover, in animal studies, high iron loading in kidney and heart causes the decrease of DMT1 protein levels (275, 276) In the present study, DMT1 protein levels were not affected by dietary iron status in the pancreas and heart Tissue specific DMT1 knockout mice will be needed to define the in vivo role of DMT1 in these tissues. T h e immunoreactive band observed for hepatic Zip14 was observed at a different position in the pancreas and heart. A more intense band in the liver was detected at 140

PAGE 73

73 kDa, but the pancreas and heart were at 50 kDa. These two immunoreactive bands were also observed in HEK 293T cells over expressing rat Zip14. The detection of different sized immunoreactive band s in the different tissues is not without precedent. For example, glucose transporters of different molecular weights were detected in different cells and tissues likely reflecting differences in the degree of glycosylation (277) Zip14 expression is also probably affected by the different extent of glycosylation in the liver The increase of Zip14 protein levels in the pancreas was not consistent with Zip14 mRNA levels, indicating that Zip14 is probably post transcriptionally regulated by iron. T he post transcriptional regulation of a Zip protein by iron was investigated with IRT1, the iron re gulated transporter gene of the plant Arabidopsis thaliana IRT1 mRNA was constitutively expressed in these plants, but the protein level of IRT1 could only be detected in the iron deficient plants (278) The second goal of these studies was to investigate the localization of Zip14 in the liver, pancreas and duode num and how it is affected by dietary iron deficiency and 2% carbonyl iron. Previously, mouse Zip14 has been shown to localize at the plasma membrane in hepatocytes (87) A r ecent study with the subcellular localiz ation indicated that Zip14 is also localized at the endosome in HepG2 cells (88) I found that liver Zip14 is pre dominantly distributed at the sinusoidal borders of the hepatocyte membrane and partially at the cytoplasm region. In 2% FeO rats, the intense signal of Zi p14 was observed along the sinusoids, consistent with the expression of the transporter on the microvilli of hepatocytes, where most NTBI from sub endothelial space is taken up. Interestingly, Zip14 was also localized at the intracellular region in the 2% FeO rat livers.

PAGE 74

74 The liver acquires iron from TBI by a Tf receptor or NTR mediated pathway and from NTBI. Previous studies identified that one pathway appears to transport both NTBI and TBI, since NTBI uptake is inhibited by TBI (210, 225, 279) Recent studies identified that endosomal Zip14 mediates TBI uptake suggesting that Zip14 may be involved in this common pathway. The most prominent difference of liver morphology was observed in the FeD rats. T h e iron defici ent rats had large lipid droplets in their livers, but it was not present in the FeA or 2% FeO rats. Severe iron deficiency in animals was found to be related with abnormal lipid accumulation in the liver. Increased serum triglyceride, cholesterol and phos pholipids plus increased liver triglycerides have been observed in iron deficient rats (280) In the duodenum, Zip14 protein was localized at the basolateral membrane in the FeA rats. The si gnal of Zip14 at the basolateral membrane in the duodenum was highly intense in the 2% FeO animals. In general, iron absorption consists of the coordinated activity of the influx iron importer DMT1 in the apical membrane (106) and iron exporter FPN in the basolateral membrane (106) However, there are limited but convincing observations that FPN (281, 282) and DMT1 (283) are located in both the apical and basolateral membrane in the duodenum. Over expression of HFE protein led to the redistribution of DMT1 from the apical to the basolateral membrane (28 3) DMT1 is probably required for iron transport out of the endocysotic vesicle during basolateral Tf endocytosis (284) A more detailed explanation was followed by steady state membrane localization of DMT1 and F PN and iron uptake in Caco 2 cells (285) Iron loading redistributed the DMT1 to the basolateral membrane and FPN to the apical membrane

PAGE 75

75 in rats and Caco 2 cells. Interestingly iron flux was regulated by iron stat us in Caco 2 cells. High iron decreased apical uptake and basal efflux but increased basal uptake and apical efflux. In iron overload disorders, NTBI is present in the blood plasma. In a healthy individual, NTBI levels are usually less than 1 M, however, in patients with iron overload, they increased markedly up to 10 M (213, 214) Most NTBI is efficiently taken up by the liver (95, 218, 219) T he translocation of NTBI fro m blood or livers to lumen could be possible Indeed, in dietary iron loaded rats, biliary iron excretion from hepatocyte lysosomes was coupled, compared to FeA rats (286) This excreted iron in bile then probably enters the intestine, and direct excretion into the luimen of the gastrointestinal tract. In higher iron conditions, duodenal Zip14 may also be in volved in transporting iron from blood or the excreted iron in bile to lumen at the basolateral membrane in the duodenum. In the pancreas, Zip14 was ex pressed in the plasma membrane and intracellular region in the acinar cells in FeA rats. The immunostaining of Zip14 between the FeA and FeD rats was not different, but much more intense staining of Zip14 was seen in 2% FeO rats. Previously, Zip14 transcri pts were expressed in islet cells (287) but preliminary data showed that Zip14 is not co localized with insulin, which is mostly expressed in islet cells. A r ecent paper found that the pancreatic islets were an ex tra source of hepcidin (260) cell s are also expressed with DMT1 (261) However, iron overloaded animal s showed that high iron is accumulated in acinar cells (262) Zip14 may be involved in transporting iron into acinar cells. In conclusion, pancreas and heart Zip14 protein levels were significantly increased by 2% dietary iron overloaded diets. Pancreas and heart DMT1 protein levels did not

PAGE 76

76 change in response to dietary iron status. Liver Zip14 protein was highly localized at the plasma membrane and intracellular region of hepatocyte along with the sinusoid Collectively, these data are consisted with the hypothesis that Zip14 plays a role in transporting NTBI in these three tissues.

PAGE 77

77 CHAPTER 4 E FFECT OF DIETARY IRON DEFICIENCY AND OVERLOAD ON THE EXPRESSION OF THE ZIP FAMILY OF METAL ION TRANSP OR TERS IN RAT LIVER An i mbalance of iron homeostasis induces disturbances of iron metabolism such as iron deficiency and iron overload. Dietary iron deficiency and overload lead to the redistribution of mineral levels in the liver. For example, dietary iron deficiency results in higher levels of copper in the liver (64). On the other hand, dietary iron overload results in an accumulation of zinc and manganese in the liver and in other tissues (4). The liver is the most important organ for mineral storage and expresses a number of genes participating in iron homeostasis including hepcidin, TfR2, and hemojuvelin. Functional loss of any of these gene s results in genetic iron overload disorders, suggesting that the liver plays a role in sensing and modulating body iron status. The liver can acquire iron from plasma Tf bound to the TfR or from NTBI. During iron overload, hepatic TfR levels decrease wher eas plasma NTBI levels increase, resulting in the accretion of NTBI in the liver (210, 211). Most NTBI accumulates in hepatocytes (95, 216, 217). Precisely how NTBI makes its w ay across the plasma membrane in to the hepatocytes is unclear, but several possi ble import proteins have been proposed. Metal ion uptake by the liver may be mediated by ZIP proteins. The name ZIP stands for Z rt I rt like P rotein ( z inc r egulated t ransporter; i ron r egulated t ransporter) (285), and the mammalian ZIP family consists of 14 members. The first member of the ZIP transporter family to be identified was IRT1 in the plant A. thaliana. In this plant, IRT1 is expressed in the roots and induced by iron deficiency. IRT1 is also involved in transporting iron across the plasma membra ne of plant cells (84). The highly similar homologue to IRT1, IRT2 was also up regulated by iron deficiency in plants (286). Two other ZIP proteins have also been shown to transport iron: ZUPT ( E. coli ) (287) and

PAGE 78

78 LIT1 ( L. amazonensis) (288). Most mammalian ZIP family members have been almost exclusively investigated to import zinc into the cytosol from the plasma membrane or intracellular organelles. However, there is limited information about whether ZIP family members are involved in transporting iron as well as other cation metals. Recently, ZIP8, which is highly homologous to Zip14, has been shown to transport Cd and Mn (289). Moreover, when ZIP2 KO mice were fed a zinc deficient diet, hepatic iron levels were found to be significantly lower than those i n normal animals (290), suggesting that Zip2 plays a role in iron homeostasis. The purpose of the present study was to determine how other metals are affected by dietary iron deficiency and overload, and to identify which ZIP family members are responsive to dietary iron deficiency and overload. Two independent animal studies with different diet compositions were conducted.

PAGE 79

79 Results Mineral Contents of the Experiment Diets To induce iron deficient and overloaded animals, two independent animal st udies were conducted with the different diets The mineral contents of these two diets were analyzed by ICP MASS. In the first study, the iron levels were determined to be 10 ppm (FeD), 50 ppm (FeA), and 18916 ppm (2%FeO). In the second study, the iron con centrations were found to be 9 ppm (FeD), 215 ppm (FeA), and 27,974 ppm (3%FeO). The other mineral levels (Zn, Cu, Mn, Mo, and Co) did not differ in each study (Table 4 2). Effect of FeD and 3% FeO on Body Weight in Rats At the beginning of the study, the FeD and FeA rats grew at the same rate, but the 3% carbonyl iron diet resulted in marked growth suppression. In the 3%FeO group, some animals suffered from dehydration. After 3 wks of the feeding study, body weights of FeD rats were 15% lower than in the F eA control group (Figure 4 1 ). The rats fed a 3% carbonyl iron diet experienced a marked decrease in body weight (50 % less than control animals) (Figure 4 1 ). Blood and Tissue Iron Status in FeD, FeA, and 3% FeO Fed Rats Rats fed the FeD diets became anem ic, as indicated by lower levels of Hb and HCT, and higher level of Tf saturation, compared to control and 3%FeO animals (Table 4 3). Hematocrit levels, but not hemoglobin, were slightly increased in FeO rats relative to FeA rats (Table 4 3). FeD rats were iron deficient, as based on the lower amounts of non heme iron in their livers, spleens and kidneys (83%, 88%, and 67% less than FeA rats) (Table 4 4) In 3%FeO rats, levels of liver non heme iron were 60 times higher

PAGE 80

80 than those in FeA rats. Excess non he me iron was also present in the spleen, heart, pancreas and kidneys of 3%FeO rats. Liver Mineral Concentrations in FeD, FeA, and 3% FeO Fed Rats Liver Fe (non heme and heme) levels and also other metals including Zn, Cu, Mn, Mo, Co, and Se were analyzed b y ICP MS (Figure 4 2 ). In FeD rats, the Fe level was decreased by 70%, but Cu, Mn, and Se levels were significantly increased (75%, 33%, and 89 %, respectively). Compared to FeA rats, Zn and Mo levels did not differ in FeD rats. 3%FeO rats accumulated massi ve amounts of iron in their livers (27 fold), consistent with the non heme iron levels. 3%FeO rats had 21% higher levels of liver Zn and Mn and 42% lower levels of Co. Effect of FeD and FeO on H epatic ZIP T ransporter mRNA L evels To measure relative mRNA l evels of all 14 ZIP family members in the livers of FeD, FeA, and 3% FeO rats, qRT PCR were performed. Among the 14 ZIP family members, the levels of ZIP5, ZIP6, ZIP7, and ZIP10 mRNA were affected by dietary iron status (Fig. 4 3). The most remarkable modu lation was observed for ZIP5; its mRNA levels were 8 fold higher in 3% FeO rats compared to FeA rats. Liver transcript levels of ZIP6, ZIP7, and ZIP10 were 30 40% lower in 3% FeO rats relative to FeA animals. The iron related changes in ZIP transporters we re confirmed in a second study. Liver transcript levels of ZIP5 were significantly higher in 2% FeO rats, and mRNA levels of ZIP6, ZIP7, ZIP10 were 30 40% lower in 2% FeO rats relative to FeA control (Fig. 4 4). In FeD rat liver, ZIP14 levels were 50% hig her than controls. To demonstrate iron related differences in mRNA levels, transcript levels of BMP6 were measured. BMP6 mRNA has been shown to be positively regulated by iron (288) Transcript levels of the each g ene were normalized to the average of two housekeeping genes, cyclophlin A and

PAGE 81

81 RPL13A. These two genes were strongly correlated (r=0.91) and did not vary among the dietary iron treatment groups. Relative T ranscript A bundances of ZIP F amily T ransporters i n R at L iver To compare the basal expression levels of ZIP family members, transcript abundances were determined by qRT PCR on a sample of pooled rat liver RNA from all six FeA rat livers. As shown in Figure 4 5, ZIP14 and ZIP1 appeared to be the most abund antly expressed ZIP mRNA in rat liver. Moderate transcript levels were found for ZIP3, ZIP4, ZIP9, ZIP8, and ZIP7. T h e most weakly expressed ZIPs were ZIP5, ZIP10, ZIP13, ZIP11, and ZIP6. For comparison, the transcript abundance of DMT1, a well characteriz ed iron import protein was also determined by qRT PCR. Both DMT1 isoforms were found to be weakly expressed in FeA liver.

PAGE 82

82 Discussion The mammalian ZIP (Zrt Irt like Protein) family of transmembrane transporters consists of 14 members. ZIPs have been characterized largely by their ability to transport Zn ; however, some ZIP proteins are not specific for Zn transport but can also transport other metals including Fe and Mn (289) Zip14 is involved in the uptake of Zn and Fe into the liver (78, 88) In the preliminary study, cellular iron deficiency induced the increase of ZIP14 mRNA levels in mouse hepatocyte (Fig. A 1). ZIP14 mRNA levels did not change upon iron loading (F i g. A 1C). Because ZIP transporters share significant homology, it is probable that other ZIP proteins can involve in transporting iron. One of the possible candidates is ZIP8, the most similar to ZIP14 (79) To test if rat ZIP8 as well as ZIP14 responds to cellular iron deficiency, H4IIE cells were treated with 200 M DFO for over a 20 h time course (Fig. B 1). After the cells we re treated with DFO for 16 h, cells became iron deficient, based on the higher mRNA levels of TfR1. Cellular iron deficiency stimulated the Zip14 and Zip8 mRNA levels (2 fold). The pattern of TfR1 mRNA was similar with those of Zip14 and Zip 8 after the ce lls were treated with DFO. These observations indicated that at least one other mammalian ZIP can responds to cellular iron status. To determine that some ZIP family members are regulated by dietary iron deficiency and overload, the mRNA levels of hepatic ZIP family members were analytzed by qRT PCR. This is the first observation of hepatic ZIP family members expression by dietary FeD or FeO. In two independent feeding studies, FeO rat liver consistently demonstrated different expression of ZIP5, ZIP6, ZI P7, and ZIP10. Especially, the most remarkable finding was the expression of ZIP5; its mRNA levels were 3 and 8 fold higher in 2% carbonyl iron and 3% carbonyl iron overloaded rat livers. In contrast to

PAGE 83

83 ZIP5, mRNA levels of ZIP6, ZIP7, and ZIP10 were sign ificantly lower (by 24 45%) in FeO rat livers relative to FeA rats. The only ZIP whose expression was higher in FeO liver was ZIP5. ZIP5 is a plasma membrane protein that is highly expressed in the duodenum as well as the pancreas, liver, and kidney s (290) ZIP5 is localized in the basolateral membrane of enterocytes and acinar cells under high Zn condition s but is internalized during Zn deficient condition s (291) The baso lateral localization of ZIP5 in acinar cells has led to the hypothesis that ZIP5 functions to transport Zn from the blood into acinar cells (291) In HEK cells, expression of ZIP5 stimulates Zn uptake and its upta ke is not inhibited by Fe, indicating that ZIP5 is specific for Zn as a substrate (290) However, ZIP5 mRNA levels were unaffected by oral gavage of Zn or by Zn deficiency in mice intestine s (292) There are no studies about how ZIP5 is involved in iron metabolism. I found that hepatic ZIP5 mRNA leve ls markedly up regulated under high iron condition s However, we cannot exclude the possibility that ZIP5 is involved in transp orting Zn into the liver. I r on overloaded rat liver mildly but significantly accumulated Zn (21% higher in FeO livers compared to FeA livers). Therefore, further studies will be required to test that ZIP5 has a transport activity of iron by iron uptake exp eriment Further studies will need to determine if the higher ZIP5 mRNA levels result in more ZIP5 protein. It will also be important to identify which cell types of the liver express ZIP5, as well as the subcellular localization of ZIP5 in hepatic cells. Unlike ZIP5, mRNA levels of ZIP6, ZIP7, and ZIP10 mRNA were down regulated by dietary iron overload. ZIP6, ZIP7, and ZIP10 have been shown to be involved in metastatic breast cancer. ZIP6 is highly expressed in tissues sensitive to steroid

PAGE 84

84 hormones such as the placenta, mammary gland, and prostate (289) ZIP6 was localized to the plasma membrane of certain cell types and it acts as a Zn imp ort protein (81) ZIP6 was initially identified as a gene which is stimulated by estrogen treatment of human breast cancer cells (293) As a result, ZIP6 has been suggested as a useful prognostic marker f or estrogen receptor positive breast cancer (294) ZIP7 mRNA is ubiquitously expressed in mouse and human tissues, and mouse ZIP7 was most abundantly expressed in the liver (295) Unlikely in other ZIP proteins, ZIP7 is localized in the Golgi apparatus, and the ZIP7 protein transported intracellular Zn from the Golgi apparatus to the cytosol of the cells (295) ZIP7 mRNA does not cha nge under either Zn limiting or excess condition s The down regulation of ZIP7 by dietary iron overload probably does not contribute to the elevated hepatic Zn levels. In contrast to ZIP7, ZIP10 is expressed differently in response to changed Zn status. T he expression of ZIP10 was up regulated by Zn deficiency and down regulated by Zn excess in both the gill s and kidney s of Zebrafish (296) The up regulation of ZIP10 expression by Zn deficiency was also observed in mice (297) ZIP10 was the firs t ZIP gene characterized as an MTF 1 target, and the induction of MTF 1 suppressed Zip10 (298) MTF 1 (metal response element binding transcription factor 1) binds to DNA sequences motifs known as metal response el ements (MREs), which are present in the promoters of metal responsive genes (299) Sequence analysis of the ZIP10 promoter has revealed that mice, humans and zebrafish have a conserved MRE for ZIP10, but rat ZIP10 does not. ZIP10 has been purified, cloned and characterized from rat renal basolateral membrane s (300, 301) The functional data suggested that ZIP10 mRNA is Zn dependent and ZIP10 could import Zn across renal basolateral membrane s (300) Rat

PAGE 85

85 Z IP10 up regulated in response to high Zn conditions, which was inconsistent wi th the data that mice and zebrafish ZIP10 are down regulated by Zn. In the present study, even though iron overloaded rat livers had higher zinc concentrations (by 14 21%) ZIP10 mRNA levels were down regulated by 30 to 40%. Thus, the down regulation of Z IP10 was not likely to be related to the Zn level. In addition the rat ZIP10 expression is increased by the stimulation of thyroid hormones (302) These observations indicate that rat ZIP10 is regulated by a varie ty of stimuli I ron deficiency and overload have been associated with various disorders in the human body. For example, iron deficiency, with or without anemia, can impair the immune response, limitation in physical performance, and neurological dysfuncti on (241) In iron overload, an excess of iron is depos ited in the parenchymal cells of the liver (95, 96) heart, and pancreas (97) Iron overload patients develop s erious liver diseases, diabetes mellitus, and congestive heart failure (216, 217) In addition, iron deficiency and overload provoke marked alterations in the metabolism of other metals. For example, i n iron defici ent rats, the absorption of Mn, Co, and Fe was increased (303) Other studies found that there occur a greater absorption of Cu occurs in iron deficiency, while that of Zn remains unchanged (304) In the present study, iron deficient rat liver s accumulated Cu and Mn In iron deficiency, a marked up regulation of iron absorption occurs in the duodenum via DMT1, a well characterized iron import protein (63) DMT1 is also able to transport a multitude of other metals including Mn, Co, Cu and Zn (63) The up regulation of DMT1 in iron deficiency probably leads to an increase in the absorption of other metals in the duodenum and these metals probably accumulate in the liver. In iron overloaded rat liver s massive amount s of Fe were

PAGE 86

86 deposited, and small but significant levels of Zn and Mn were also accumulated. Other studies also found that the Zn and Mn levels increased significantly, while the Cu level remained almost unaffected (305) The h epatic Zn level was also increased approximately five fold in iron overloaded patients (306) The re was a concomitant hepatic accumulation of Zn, Mn and Fe, possibly by elevated intestinal absorption and hepatic import. In conclusion, ZIP5, ZIP6, ZIP7, and ZIP10 mRNA levels vary according to iron status, suggesting that these ZIP proteins may play a role in iron metabolism. However, dietary iron deficiency and overload also resulted in small, but significant, alterations in hepatic concentrations of other metals including Cu, Zn and Mn. Thus, it is possible that differences in the levels of these meta ls affected ZIP expression. Additional cell culture studies in hepatocyte cell lines may help to clarify if iron alone directly modulates the expression of ZIP5, ZIP6, ZIP7, ZIP10. Given their apparent regulation by iron, future studies will determine if t hese ZIPs are capable of transporting iron.

PAGE 87

87 Figure 3 1. Effect of dietary iron deficiency and 2% carbonyl iron on body weight in rats Weanling male Sprague Dawley rats were fed modified AIN 93G purified rodent diets containing 10 ppm Fe (FeD), 50 ppm Fe (FeA) or 18916 ppm Fe (2% FeO) for 3 wk. Final body weights were compared by one way ANOVA n=6. Means without a common letter differ, P < 0.05.

PAGE 88

88 Table 3 1 Effect of dietary iron deficiency and 2% carbonyl iron on blood iron status in rats FeD FeA 2% FeO Hb (g/dL) 4.6 0.2 a 13.2 0.2 b 1 4.6 0.5 c HCT (%) 18.7 1.0 a 42.4 0.9 b 44.8 1.3 b Serum iron (g/dL) 29.4 7.2 a 336.8 19.5 b 210.8 67.2 b TIBC (g/dL) 792.2 45.1 b 523.5 38.6 a 394.1 17.3 a Tf Saturation (%) 3.7 0.8 a 64.8 3.3 b 51.7 15.3 b FeD iron deficient, FeA iron adequate, 2% FeO 2% carbonyl iron, Hb hemo globin, HCT hematocrit, TIBC (total iron binding capacity) and Tf saturation (transferrin saturation). Values are means SEM, n=6. Data were analyzed by one way ANOVA followed by superscript are different ( P < 0.05). Table 3 2 Effect of dietary iron deficiency and 2% carbonyl iron on non heme iron in rat tissues Non heme iron FeD FeA 2% FeO Liver 12.9 0.5 a 30.1 5 b 1812.5 380 c Spleen 8.7 0.6 a 18.6 4.8 a 5 33.3 78 b Heart 13.6 1.3 a 18.6 2.1 a 27.7 1.1 b Pancreas 4.6 0.2 a 4.7 0.6 a 18.7 2.5 b Kidney 11.1 1.4 a 18.9 1.8 b 45.9 5.1 c F eD iron deficient, FeA iron adequate, 2% FeO 2% carbonyl iron Each tissue was acid digested fo r 20 h, and nonheme iron levels were determined spectrophotometrically by measuring the absorbance of the Fe 2+ bathophenanthroline complex. Values are means S EM, n=6. Data were analyzed by one way ANOVA multiple comparison test. In a ny row, numbers not sharing a common superscript are different ( P < 0.05).

PAGE 89

89 Figure 3 2. Characterization of the immunoreactivity of anti Zip14 antibody A) Total cell lysate from HEK 293T cells overexpressing rat Zip14 and rat liver membrane (RLM) wer e either immunoprecipitated (IP) or not (no IP) with an anti ZIP14 antibody followed by immunoblotting with an anti Zip14 antibody. B) Total cell lysates from HEK 293T cells transfected with either an empty vector (vector) or vector encoding rZip14 (rZip14 ) or RLM were immunoblotted with anti Zip14 antibody with or without pre incubation with 50 fold excess of the Zip14 immunizing peptide. C) Total cell lysates from HEK 293T cells transfected with either an empty vector or vector encoding rZip14 and RLM wer e immunoblotted with pre immune serum or anti serum specific to Zip14.

PAGE 90

90 Figure 3 3. Hepatic Zip14 is glycosylated. Total cell lysate from HEK 293T cells overexpressing rZip14 (rZip14) and rat liver membrane (RLM) were incubated in the absence ( ) or presence (+) of PNGase F prior to immunoblotting with anti Zip14 antibody.

PAGE 91

91 A B Figure 3 4. Effect of iron deficiency and 2% carbonyl iron on hepatic Zip14 mRNA and protein levels. A) Transcript abundance of Zip14 (either Zip14 or l ong isoform of rZip14 (L Zip14)), DMT1with (+) or without ( ) IRE, hepcidin and TfR1 were determined by qRT PCR. Relative transcript abundances were normalized to levels of cyclophilin A. Values are means SEM, n=6. Asterisks indicate difference relative to FeA controls (* P < 0.05, ** P < 0.01). B) Immunoblot analysis of Zip14, TfR1 and DMT1 in rat liver membrane fractions (100 g protein/lane) of iron deficient (FeD), iron adequate (FeA) and 2% carbonyl iron (2%FeO). Membranes were stripped and reprobed wi th scavenger receptor B1 (SRB1) to indicate lane loading.

PAGE 92

92 A B Figure 3 5. Effect of iron deficiency and 2% carbonyl iron on pancreatic Zip14 and DMT1 mRNA and protein levels. A) Transcript abundances of Zip14 (either Zip14 or long isoform of rZip14 (L Zip14)) and DMT1 with (+) or without ( ) IRE were determined by qRT PCR. Relative transcript abundances were normalized to levels of cyclophilin A. Values are means SEM, n=6. Asterisks indicate difference relative to FeA controls (* P < 0.05). B) Immu noblot analysis of Zip14 and DMT1 protein expression in rat pancreas membrane fractions (100 g protein/lane) from iron deficient (FeD), iron adequate (FeA) and 2% carbonyl iron loaded (2% FeO) rats. Membranes were stripped and reprobed for pan cadherin to indicate lane loading.

PAGE 93

93 Figure 3 6. Effect of iron deficiency and 2% carbonyl iron on heart Zip14 and DMT1 protein levels. Immunoblot analysis of Zip14 and DMT1 in rat heart membrane fractions or total heart lysate (100 g protein/lane) of iron defici ent (FeD), iron adequate (FeA), and 2% carbonyl iron loaded (2%FeO) rats. Blots were stripped and reprobed with Na/K ATPase or tubulin to indicate lane loading.

PAGE 94

94 Figure 3 7. Hematoxylin and Eosin (H&E) staining of liver tissue from rats fed iron deficient, iron adequate and 2% carbonyl iron diets. Liver samples were fixed in 10% neutral buffered formalin and embedded in paraffin; 5 m sections of rat liver were used for H&E staining. Original magnification, X40. Figure 3 8. Perls Prussia n blue staining of liver tissue from rats fed iron deficient, iron adequate and 2% carbonyl iron diets. Paraffin sections (5m) of rat liver were stained with Perls Prussian blue (blue iron staining). (a) Iron deficient liver. (b) Iron adequate liver. (c ) 2% carbonyl iron liver. Original magnification, x40. (d) 2% carbonyl iron liver (x20). HD hepatic duct, CV central vein, PV periportal vein.

PAGE 95

95 Figure 3 9. Perls Prussian blue staining of pancreas tissue from rats iron deficient, iron adequate and 2% carbonyl iron diets. Frozen sections (7 m) of rat pancreas stained with Perls Prussian blue (blue iron staining). Original magnification, x40

PAGE 96

96 Figure 3 10. Localization of Zip14 in liver, pancreas, and duodenum from rats fed iron deficient, adequate and 2% carbonyl iron diets. Cryosections (7m) of each tissue were incubated overnight with rabbit anti Zip14 antibody. Biotinylated Zip14 antibody was visualized using streptavidin Alexa 488 (green) and nuclei were labeled with 4,6 diamidino 2 phenylindo le (blue). AM, apical membrane, BM, basolateral membrane. Images are representative of four independent animals with similar results.

PAGE 97

97 Table 4 1. Primers used for qRT PCR mRNA Forward primer Reverse primer ZIP1 5' TCTGGACTTGCTGCCTGACTAC 3' 5' CGTCACATGAAGAGCCTCCAA 3' ZIP2 5' GCCTGAGGCTGGTGAAGATC 3' 5' CACAGGAGACATGAGAGCTAAGGA 3' ZIP3 5' GGCACACCGCTCCAAGAA 3' 5' AAGACGCCACCCCCAAA 3' ZIP4 5 ATGCCGGGCTGACTGTGA 3' 5' TGAGCGCTGAGGCCAGAT 3' ZIP5 5' CCTCAGCACTACCCTAGCAGTCTT 3' 5' TGCAAAGTCACCCAGTTCATG 3' ZIP6 5' CACGTTGGCCTGGATGGT 3' 5' GGCCGTCGCTGAAATTGT 3' ZIP7 5' TTGACTGCAATTGGAGCATTG 3' 5' CTGCCCCTCCCTCAGT GA 3' ZIP8 5' CCAGATAACCAGCTCGAACTTCA 3' 5' TGTGGATCCTCACAGGGATGA 3' ZIP9 5' CAGCTGCATGCCTACATTGG 3' 5' CCACGAGCAACATGAAAACG 3' ZIP10 5' GGCCCTTCAACAGAGACCAA 3' 5' CTCCTGACCTTCCCTGACTTCA 3' ZIP11 5' GGGTCTCGCTGTC GGTGTAG 3' 5' TCGAAGGTGGCAGATGCA 3' ZIP12 5' AATGTGCCAGCCTCCAACA 3' 5' GGACCATAACAGCCAACAAGCT 3' ZIP13 5' GGTCCGGAACCTCAAAGTCA 3' 5' TGGGTGAAGTTGTCAATGGTATTG 3' ZIP14 5' CCTCACGAGCTGGGAGACTTC 3' 5' AGAGGGCCTGCTGGATACTCA 3' BMP6 5' CGCCGCAATCCTCCTCTT 3' 5' CTTTTGCATCTCCCGCTTCT 3' DMT1+IRE 5' TGTGGCCTGGCGTTACG 3' 5' CGCAGAAGAACGAGGACCAA 3' DMT1 IRE 5' TTTGAACCAAGGCGAAGAAGA 3' 5' ACCCATTCACAGCCGTTAGC 3 Cyclophilin B 5' CGCACAGCCGGGACAA 3' 5' TTCGATCTTGCCACAGTCTAC 3' RPL13A 5' GCATTTTTTGGCGCACTG 3' 5' GCCTGGCCTCTTTTGGTCTT 3' Primers were designed by using Primer Express, version 3.0, Applied Bi osystems.

PAGE 98

98 Table 4 2. Mineral contents of the experiment diets FeD FeA 2%FeO FeD FeA 3%FeO Fe 9.7 50.3 18916 8.5 215 27974 Zn 38.3 47.7 52.0 29.0 23.6 30.3 Cu 6.0 10.3 10.0 13.1 17.5 13.5 Mn 9.7 14.0 13.0 52.5 58.9 61.0 Mo <1.0 <1.0 <1. 0 1.9 <0.9 <0.9 Co <0.5 <0.5 <0.5 2.8 3.3 3.4 In the 2% FeO study, diets were based on AIN 93G purified rodent diet formulations, modified to contain no added iron (FeD), 35 ppm iron as ferric citrate (FeA), or 20,000 ppm iron as carbonyl iron (2% FeO) (Research Diets). In the 3% FeO study, an iron deficient diet (FeD) was designed with the TestDiet 5755 diets formulated to contain no added iron (FeD), 200 ppm iron as ferric citrate (FeA), or 30, 000 ppm iron as carbonyl iron (3% FeO). Mineral composit ions of diets (ppm) were analyzed by ICP MS.

PAGE 99

99 Figure 4 1 Effect of dietary iron deficiency and 3% carbonyl iron on body weight in rats. Weanling male Sprague Dawley rats were fed low iron purified diets containing 9 ppm Fe (FeD), 215 ppm Fe ( FeA) or 27974 ppm Fe (3% FeO) for 3 wk s Final body weights were compared by one way ANOVA followed by without a common letter differ, P < 0.05

PAGE 100

100 Table 4 3. Blood iron stat us in iron deficient, adequate and 3% carbonyl iron fed rats FeD FeA 3%FeO Hb (g/dL) 6.9 0.4 a 13.1 0.3 b 14.4 0.4 b H crit (%) 29.4 1.6 a 44.7 0.6 b 49.5 1.2 c Serum iron (g/dL) 49.0 3.0 a 292.6 19.5 b 347.1 10.2 b TIBC (g/dL) 733.3 42.3 b 391.2 11.9 a 479.4 52.6 a Tf Saturation (%) 6.7 0.2 a 74.6 2.7 b 74.4 6.0 b Values are means SEM of 6 rats per group. Data were analyzed by one way ANOVA follow common superscript are different ( P < 0.05). Table 4 4. Tissues non heme iron levels in iron deficient, adequate and 3% carbonyl iron fed rats Non heme iron FeD FeA 3%FeO Liv er 15.0 4.6 a 87.4 16.0 b 5223.7 344.7 c Spleen 7.2 1.8 a 58.1 7.2 b 375.5 60.1 c Heart 13.6 1.3 a 18.6 2.1 a 27.7 1.1 b Pancreas 4.1 2.3 a 7.0 2.4 a 32.0 7.6 b Kidney 7.7 4.0 a 23.2 10.3 b 62.1 7.6 c Each tissue was acid digested for 20 h, and non heme iron levels were determined spectrophotometrically by measuring the absorbance of the Fe 2+ bathophenanthroline complex. Values are means S EM of 6 rats per group. Data were analyzed by one way ANOVA followed by T sharing a common superscript are different ( P < 0.05).

PAGE 101

101 Figure 4 2 Liver mineral concentrations in iron deficient, adequate and 3% carbonyl iron fed rats. Fe iron, Zn zinc, Cu copper, Mn manganese, Co cobalt, Se selenium. Iron Liver mineral concentrations (ppm) were determined by ICP MS. Values are means SEM, n=6. Data were analyzed by one way ANOVA. Values not sharing a common superscript are different ( P < 0.05).

PAGE 102

102 Figure 4 3 H epatic mRNA levels of ZIP family members in response to dietary iron deficiency and 3% carbonyl iron. Transcript abundances of 14 ZIP family members were determined by qRT PCR. The relative transcript abundance of each gene was normalized to the average of two housekeeping genes, cyclophilin A and RPL13A. Values for the FeD and 3%FeO groups are shown relative to the FeA group. Values are means SEM, n=6. Data were analyzed by one way ANOVA. Asterisks indicate differences from the FeA group (*P < 0.05 and *P<0.01 respectively). Transcript levels of bone morphogenetic protein 6 (BMP6) were used as a positive control to demonstrate iron related differences in mRNA levels.

PAGE 103

103 Figure 4 4 Hepatic mRNA levels of Zip family members in response to dietar y iron deficiency and 2% carbonyl iron. Transcript abundances of 14 ZIP family members were determined by qRT PCR. The relative transcript abundance of each gene was normalized to the average of two housekeeping genes, cyclophilin A and RPL13A. Values for the FeD and 2%FeO groups are shown relative to the FeA group. Values are means SEM, n=6. Data were analyzed by one way ANOVA. Asterisks indicate differences from the FeA group (*P < 0.05 and **P<0.01 respectively). Transcript levels of bone morphogenet ic protein 6 (BMP6) were used as a positive control to demonstrate iron related differences in mRNA levels.

PAGE 104

104 Figure 4 5 Relative transcript abundance of ZIP family transporters in iron adequate rat liver s Transcript abundances were determined by qRT PCR on a sample of pooled rat liver s RNA from 6 FeA rats. Abundances are shown relative to Zip14, the most abundantly expressed mRNA in rat liver s

PAGE 105

105 CHAPTER 5 CONCLUSIONS AND FUTURE DIRECTIONS Conclusions The specific aim of my dissertation w as to investigate if Zip14 responds to dietary iron deficiency and overload in vivo To test that Zip14 is regulated by iron status, two independent animal studies were conducted Weanling male rats were randomized into the three different diets containing 9 pp m Fe (FeD), 50 ppm Fe (FeA), or 1.8% carbonyl Fe (2% FeO) After a 3 wk feeding study, Zip14 mRNA and protein levels were analyzed in the three major iron loading tissues: the liver, pancreas, and heart. Liver Zip14 mRNA and protein did not change in respo nse to dietary iron deficiency and overload. Pancreas and heart Zip14 protein levels were markedly increased by 2% carbonyl iron. Pancreatic Zip14 mRNA was not consistent with protein level s suggesting that pancreas Zip14 is post transcriptionally regulat ed by iron. A well characterized iron import protein, DMT1 was also examined in these three iron loading tissues. DMT1 protein was not detectable in the iron overloaded rat liver s Pancreatic and heart DMT1 protein levels were not changed by dietary iron deficiency and overload. The regulation of ZIP14, but not DMT1 in these tissues suggests that ZIP14 may play a more important role in importing NTBI in to these tissues. The localization of Zip14 was observed in the liver, pancreas, and duodenum. In the li ver of FeA rats Zip14 was clearly stained at the sinusoidal borders of the hepatocyte membrane and partially in the cytoplasm. I ntense immunostaining of Zip14 was observed in 2% FeO rat livers. Immunoflu o rescent localization of Zip14 in rat pancreas showe d that Zip14 localizes to perinuclear regions and the plasma membrane of acinar cells. These regions of Zip14 staining were stronger in 2% FeO rats than in

PAGE 106

106 FeA or FeD groups In rat duodenum, Zip14 was observed at the basolateral membrane of the duodenum. Surprisingly, 2% FeO showed the strong est signal of Zip14 in the basolateral membrane in the villus regions. Collectively, Zip14 is probably involved in transporting NTBI into hepatocyte and acinar cells. Duodenal Zip14 possibly imports iron from blood int o the duodenum in order to export iron into the lumen in an iron overloaded condition. The second specific aim of my dissertation was to investigate if the expression of hepatic ZIP protein s is regulated by dietary iron deficiency and overload. Two indepe ndent animal studies were performed. In study 1, weanling male rats were fed three different diets containing 9 ppm Fe (FeD), 215 ppm Fe (FeA), or 3% carbonyl iron (3% FeO) for 3 wks. The 3% FeO diet resulted in marked growth suppression compared to both t he FeD and FeD groups. Because the growth retardation could be a possible variable among the group s a second study was performed with the 2% carbonyl iron diet. In this study, the basal diet was followed with the AIN 93G diets (standard American Institute of Nutrition formulation). Weanling male rats were randomized into the three diet group s containing 9 ppm Fe (FeD), 50 ppm Fe (FeA), or 2% carbonyl Fe (2% FeO). The final body weight of rats in the 2% FeO group was similar to that of those in the FeD rat s. Rat livers were harvested, and the mRNA expression of 14 ZIP family members was analyzed by using qRT PCR. Among the 14 ZIP members, a remarkable observation was the modulation of ZIP5 in iron overloaded rat livers. Hepatic ZIP5 mRNA levels were 3 to 8 fold higher in iron overloaded rat livers relative to FeA livers. ZIP6, ZIP7, and ZIP10 mRNA levels are reduced in FeO rat liver s Transcript

PAGE 107

107 levels of ZIP6, ZIP7, and ZIP10 were 30 ~ 45% lower in FeO rat liver compared to FeA liver. To test that dietary i ron deficiency and overload affect the redistribution of other metals in the liver, the levels of Fe (non heme and heme iron), Zn, Cu, Mn, Co, and Se were analyzed by ICP MS. In iron overloaded rat liver s the dramatic amount of Fe was loaded and small but significant amounts of Zn and Mn were also observed. Collectively, ZIP5, ZIP6, ZIP7, and ZIP10 mRNA levels modulate d according to iron overload, indicating that these ZIP s may play a role in iron overloaded conditions. However, dietary iron deficiency an d overload also resulted in small, but significant, alterations in hepatic levels of other metals. Thus, it could be possible that the modulations of ZIP proteins are affected by the other metal s, but not iron. Therefore, further study will be vital to val idate that ZIP5, ZIP6, ZIP7, and ZIP10 directly respond to iron in the liver.

PAGE 108

108 Future Directions The proposed studies investigated more fully the relationship between Zip14 and iron status by using the cell culture system and animal in vivo mode l. Further research will be essential to understand the iron dependent regulation of Zip14. It may help in the development of new strategies to treat disorders of iron metabolism. Zip14 was regulated by dietary iron overload in the pancreas and heart but not in the liver. Utilization of Zip14 KO mice will be the best model to demonstrate the role of Zip14 in iron metabolism. Especially, liver specific Zip14 KO mice will give a more detailed explanation about the role of Zip14 in iron metabolism. To test t hat the liver continuously accumulates iron without Zip14, liver specific Zip14 KO mice could be fed high iron diets. It has been found that over expression of HFE led to decreased Zip14 stability and reduced both TBI and NTBI uptakes in HepG2 cells (99) Furthe r studies will be needed to measure the hepatic Zip14 protein levels in HFE KO mice. Hfe / Zip14 / animals would also provide more understanding about the role of Zip14 in iron overload. Previous study found that HFE can compete with holo Tf for binding to TfR1 (307) To test if Zip14 protein also binds to TfR1, co IP experiment will be essential. The localizations of Zip14 in the liver, pancrea s and duodenum were investigated. Previous studies investigated the subcellular localization of Zip14 in hepatocytes (87, 88) ; however, there is no information about the subcellular localization of Zip14 in the pan crea tic cells and duodenal enterocytes. Future studies will be required to define the subcellular localization of Zip14 in the pancreatic cells and duodenal enterocytes. In the duodenum, Zip14 was localized at the basolateral membrane. The immunofluoresce nt signal of Zip14 was more intense in the 2% FeO rat duodenums

PAGE 109

109 than in the FeA rat duodenums. Further study will be required to test if duodenal Z i p14 is involved in importing or exporting iron at the basolateral membrane. In addition, there is no data re garding whether Zip14 is involved in transporting iron or other metals in the duodenum. To shed light on the regulation of duodenal Zip14 by iron iron uptake experiments will be performed with Caco 2 cells. The human intestinal Caco 2 cell line has been e xtensively used over the last few years as a model of the intestinal barrier. Caco 2 cells are able to differentiate in long term cultures and to polarize, when seeds on semi permeable membranes, on which they form a continuous monolayer with tight junctio ns, mimicking the intestinal barrier (308) To test if iron is the only substrate for Zip14 in the duodenum, the competition experiment with other metals wi ll be also analyzed. In the pancreas, the immunostaining of Zip14 was observed at the acinar cells. However, a recent study has shown that Zip14 transcript is the most abundant in pancreatic islet cells (287) Fu ture studies will be investigated regarding the co localization of Zip14 with insulin, which is produced in the islets of Langerhans in the pancreas. S everal iron related proteins have been reported to have several different isoforms. For example, four di fferent isoforms of DMT1 have been identified (67) Previously, mouse Zip14 was found to have two isoforms and showed similar tissue distributions (Liuzzi, 2006 #45) Additional study will be required to investigate if rat Zip14 has alternatively spliced products and a different role in iron metabolism. Zip5, ZIP6, ZIP7, and ZIP10 mRNA were regulated by dietary iron overload. To test that these ZIP proteins specifically transport iron, HEK293T cells will be needed to

PAGE 110

110 transfect with individual human ZIP full length cDNAs, and an iron uptake experiment will be performed. Furthermore, it will be best to use a hepatocyte cell line to determine if iron directly modulates the expression of these ZIP proteins. In additions it will be required to measure these ZIP protein levels in response to dietary iron status. Several ZIP expressions are ubiquitously expressed, but it will be important to test that which ZIP proteins are highly expressed in some specific tissues that ar e important to iron metabolism. Dietary iron overload resulted in small, but significant, alternations in hepatic Zn levels. Intracellular Zn homeostasis is regulated by two families of Zn transporters: ZIP transporters involved in Zn influx and ZnT transp orters mediated in Zn influx (289) It will be useful information to investigate the effect of FeO on the expression of the ZnT family of Zn transport proteins.

PAGE 111

111 APPENDIX A CELLULAR IRON DEFICIENCY AND IRON LOADING ON ZIP14 mRNA LEVEL IN MOUSE HEPATOCYTES A B C Figure A 1. Cellular iron deficiency and iron loa ding on Zip14 mRNA levels in mouse hepatocyte s A) To deplete cells of iron, AML12 mouse hepatocytes were incubated in the absence or presence of 50 M of either desferrioxamine (DFO) or salicylaldehyde isonicotinoyl hydrazone (SIH). C) To induce iron load NTA (Fe nitrilotriacetic acid) for 24h. After 24 h, the total RNA was isolated and transcript levels of Zip14 (both short and long isoforms), and TfR1 were determined by using qRT PCR. Data a re expressed as means SEM for 3 independent experiments, performed in triplicate in each setting. Asterisks indicate a statistically significant difference from respective untreated controls ( P <0.05).

PAGE 112

112 APPENDIX B CELLULAR IRON DEFICIENCY ON ZIP14 AND ZI P8 mRNA LEVELS IN RAT HEPATOMA CELLS Figure B 1 Cellular iron deficiency on Zip14 and Zip8 mRNA levels in rat hepatoma cells. H4IIE rat hepatoma cells were treated with 200 M DFO for over a 20 h time course. At each time point, cells were harvested, and transcript levels of Zip14, Zip8 and TfR1 were determined by using qRT PCR. Data are expressed as means SEM for 2 independent experiments, performed in triplicate in each setting.

PAGE 113

113 LIST OF REFERENCES 1 Welch S. Transferrin :The Iron Carrier: CRC Press, Inc.; 1992. 2. Vannotti A, Delachaux A. Iron Metabolism and Its Clinical Significance: Frederick Muller; 1949. 3. Guggenheim KY. Chlorosis: the rise and disappearance of a nutritional disease. J Nutr. 1995;125:1822 5. 4. McCol lum EV. A history of nutrition. Boston: Houghton Mifflin Company 1957. 5. Andrews NC, Schmidt PJ. Iron homeostasis. Annu Rev Physiol. 2007;69:69 85. 6. Andrews NC. Disorders of iron metabolism. N Engl J Med. 1999;341:1986 95. 7. Knutson M, Wessling Resnick M. Iron metabolism in the reticuloendothelial system. Crit Rev Biochem Mol Biol. 2003;38:61 88. 8. Bratosin D, Mazurier J, Tissier JP, Slomianny C, Estaquier J, Russo Marie F, Huart JJ, Freyssinet JM, Aminoff D, et al. Molecular mechanisms of erythrophago cytosis. Characterization of the senescent erythrocytes that are phagocytized by macrophages. C R Acad Sci III. 1997;320:811 8. 9. Soe Lin S, Apte SS, Andriopoulos B, Jr., Andrews MC, Schranzhofer M, Kahawita T, Garcia Santos D, Ponka P. Nramp1 promotes ef ficient macrophage recycling of iron following erythrophagocytosis in vivo. Proc Natl Acad Sci U S A. 2009;106:5960 5. 10. Beaumont C, Canonne Hergaux F. [Erythrophagocytosis and recycling of heme iron in normal and pathological conditions; regulation by h epcidin]. Transfus Clin Biol. 2005;12:123 30. 11. Hellman NE, Gitlin JD. Ceruloplasmin metabolism and function. Annu Rev Nutr. 2002;22:439 58. 12. Andrews NC. Iron homeostasis: insights from genetics and animal models. Nat Rev Genet. 2000;1:208 17. 13. Har rison PM, Arosio P. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta. 1996;1275:161 203. 14. Bridges KR. Ascorbic acid inhibits lysosomal autophagy of ferritin. J Biol Chem. 1987;262:14773 8.

PAGE 114

114 15. Seld en C, Owen M, Hopkins JM, Peters TJ. Studies on the concentration and intracellular localization of iron proteins in liver biopsy specimens from patients with iron overload with special reference to their role in lysosomal disruption. Br J Haematol. 1980;4 4:593 603. 16. Widdowson EM, McCance RA. The absorption and excretion of iron before, during and after a period of very high intake. Biochem J. 1937;31:2029 34. 17. Green R, Charlton R, Seftel H, Bothwell T, Mayet F, Adams B, Finch C, Layrisse M. Body iron excretion in man: a collaborative study. Am J Med. 1968;45:336 53. 18. Crosby WH, Conrad ME, Jr., Wheby MS. The Rate of Iron Accumulation in Iron Storage Disease. Blood. 1963;22:429 40. 19. Kreuzer M, Kirchgessner M. Endogenous iron excretion. A quantitat ive means to control iron metabolism? Biol Trace Elem Res. 1991;29:77 92. 20. Beard JL, Dawson H, Pinero DJ. Iron metabolism: a comprehensive review. Nutr Rev. 1996;54:295 317. 21. McKie AT, Barrow D, Latunde Dada GO, Rolfs A, Sager G, Mudaly E, Mudaly M, Richardson C, Barlow D, et al. An iron regulated ferric reductase associated with the absorption of dietary iron. Science. 2001;291:1755 9. 22. Shayeghi M, Latunde Dada GO, Oakhill JS, Laftah AH, Takeuchi K, Halliday N, Khan Y, Warley A, McCann FE, et al. Identification of an intestinal heme transporter. Cell. 2005;122:789 801. 23. Qiu A, Jansen M, Sakaris A, Min SH, Chattopadhyay S, Tsai E, Sandoval C, Zhao R, Akabas MH, Goldman ID. Identification of an intestinal folate transporter and the molecular basis for hereditary folate malabsorption. Cell. 2006;127:917 28. 24. Rosenberg DW, Kappas A. Characterization of heme oxygenase in the small intestinal epithelium. Arch Biochem Biophys. 1989;274:471 80. 25. Donovan A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, M oynihan J, Paw BH, Drejer A, Barut B, et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature. 2000;403:776 81. 26. Ponka P, Lok CN. The transferrin receptor: role in health and disease. Int J Biochem Cel l Biol. 1999;31:1111 37. 27. Hentze MW, Muckenthaler MU, Andrews NC. Balancing acts: molecular control of mammalian iron metabolism. Cell. 2004;117:285 97.

PAGE 115

115 28. Hallberg L, Bjorn Rasmussen E, Howard L, Rossander L. Dietary heme iron absorption. A discussion of possible mechanisms for the absorption promoting effect of meat and for the regulation of iron absorption. Scand J Gastroenterol. 1979;14:769 79. 29. Gavin MW, McCarthy DM, Garry PJ. Evidence that iron stores regulate iron absorption -a setpoint theory Am J Clin Nutr. 1994;59:1376 80. 30. Hallberg L, Hulten L, Gramatkovski E. Iron absorption from the whole diet in men: how effective is the regulation of iron absorption? Am J Clin Nutr. 1997;66:347 56. 31. Finch C. Regulators of iron balance in humans. Blood. 1994;84:1697 702. 32. Erlandson ME, Walden B, Stern G, Hilgartner MW, Wehman J, Smith CH. Studies on congenital hemolytic syndromes, IV. Gastrointestinal absorption of iron. Blood. 1962;19:359 78. 33. Krause A, Neitz S, Magert HJ, Schulz A, Forssman n WG, Schulz Knappe P, Adermann K. LEAP 1, a novel highly disulfide bonded human peptide, exhibits antimicrobial activity. FEBS Lett. 2000;480:147 50. 34. Park CH, Valore EV, Waring AJ, Ganz T. Hepcidin, a urinary antimicrobial peptide synthesized in the l iver. J Biol Chem. 2001;276:7806 10. 35. Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, Ganz T, Kaplan J. Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science. 2004;306:2090 3. 36. Knu tson MD, Vafa MR, Haile DJ, Wessling Resnick M. Iron loading and erythrophagocytosis increase ferroportin 1 (FPN1) expression in J774 macrophages. Blood. 2003;102:4191 7. 37. Weinstein DA, Roy CN, Fleming MD, Loda MF, Wolfsdorf JI, Andrews NC. Inappropriat e expression of hepcidin is associated with iron refractory anemia: implications for the anemia of chronic disease. Blood. 2002;100:3776 81. 38. Nemeth E, Rivera S, Gabayan V, Keller C, Taudorf S, Pedersen BK, Ganz T. IL 6 mediates hypoferremia of inflamma tion by inducing the synthesis of the iron regulatory hormone hepcidin. J Clin Invest. 2004;113:1271 6. 39. Baker HM, Anderson BF, Baker EN. Dealing with iron: common structural principles in proteins that transport iron and heme. Proc Natl Acad Sci U S A. 2003;100:3579 83. 40. Yang F, Lum JB, McGill JR, Moore CM, Naylor SL, van Bragt PH, Baldwin WD, Bowman BH. Human transferrin: cDNA characterization and chromosomal localization. Proc Natl Acad Sci U S A. 1984;81:2752 6.

PAGE 116

116 41. Aisen P, Aasa R, Redfield AG. T he chromium, manganese, and cobalt complexes of transferrin. J Biol Chem. 1969;244:4628 33. 42. Harris WR. Estimation of the ferrous transferrin binding constants based on thermodynamic studies of nickel(II) transferrin. J Inorg Biochem. 1986;27:41 52. 43. Sipe DM, Murphy RF. Binding to cellular receptors results in increased iron release from transferrin at mildly acidic pH. J Biol Chem. 1991;266:8002 7. 44. Nunez MT, Gaete V, Watkins JA, Glass J. Mobilization of iron from endocytic vesicles. The effects o f acidification and reduction. J Biol Chem. 1990;265:6688 92. 45. Jandl JH, Katz JH. The plasma to cell cycle of transferrin. J Clin Invest. 1963;42:314 26. 46. Schneider C, Owen MJ, Banville D, Williams JG. Primary structure of human transferrin receptor deduced from the mRNA sequence. Nature. 1984;311:675 8. 47. Klausner RD, Ashwell G, van Renswoude J, Harford JB, Bridges KR. Binding of apotransferrin to K562 cells: explanation of the transferrin cycle. Proc Natl Acad Sci U S A. 1983;80:2263 6. 48. Cornol di C, Fattori LC. Age spacing in firstborns and symbiotic dependence. J Pers Soc Psychol. 1976;33:431 4. 49. Feder JN, Penny DM, Irrinki A, Lee VK, Lebron JA, Watson N, Tsuchihashi Z, Sigal E, Bjorkman PJ, Schatzman RC. The hemochromatosis gene product com plexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci U S A. 1998;95:1472 7. 50. Ward JH, Jordan I, Kushner JP, Kaplan J. Heme regulation of HeLa cell transferrin receptor number. J Biol Chem. 1984;259:13235 40 51. Chan RY, Seiser C, Schulman HM, Kuhn LC, Ponka P. Regulation of transferrin receptor mRNA expression. Distinct regulatory features in erythroid cells. Eur J Biochem. 1994;220:683 92. 52. Iacopetta BJ, Morgan EH, Yeoh GC. Transferrin receptors and iro n uptake during erythroid cell development. Biochim Biophys Acta. 1982;687:204 10. 53. Pietrangelo A. Physiology of iron transport and the hemochromatosis gene. Am J Physiol Gastrointest Liver Physiol. 2002;282:G403 14. 54. West AP, Jr., Bennett MJ, Seller s VM, Andrews NC, Enns CA, Bjorkman PJ. Comparison of the interactions of transferrin receptor and transferrin receptor 2 with transferrin and the hereditary hemochromatosis protein HFE. J Biol Chem. 2000;275:38135 8.

PAGE 117

117 55. Chua AC, Herbison CE, Drake SF, Gr aham RM, Olynyk JK, Trinder D. The role of Hfe in transferrin bound iron uptake by hepatocytes. Hepatology. 2008;47:1737 44. 56. Trinder D, Baker E. Transferrin receptor 2: a new molecule in iron metabolism. Int J Biochem Cell Biol. 2003;35:292 6. 57. Kawa bata H, Germain RS, Vuong PT, Nakamaki T, Said JW, Koeffler HP. Transferrin receptor 2 alpha supports cell growth both in iron chelated cultured cells and in vivo. J Biol Chem. 2000;275:16618 25. 58. Kawabata H, Germain RS, Ikezoe T, Tong X, Green EM, Gomb art AF, Koeffler HP. Regulation of expression of murine transferrin receptor 2. Blood. 2001;98:1949 54. 59. Roetto A, Totaro A, Piperno A, Piga A, Longo F, Garozzo G, Cali A, De Gobbi M, Gasparini P, Camaschella C. New mutations inactivating transferrin re ceptor 2 in hemochromatosis type 3. Blood. 2001;97:2555 60. 60. Johnson MB, Enns CA. Diferric transferrin regulates transferrin receptor 2 protein stability. Blood. 2004;104:4287 93. 61. Robb AD, Ericsson M, Wessling Resnick M. Transferrin receptor 2 media tes a biphasic pattern of transferrin uptake associated with ligand delivery to multivesicular bodies. Am J Physiol Cell Physiol. 2004;287:C1769 75. 62. Gruenheid S, Cellier M, Vidal S, Gros P. Identification and characterization of a second mouse Nramp ge ne. Genomics. 1995;25:514 25. 63. Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA. Cloning and characterization of a mammalian proton coupled metal ion transporter. Nature. 1997;388:482 8. 64. Fleming MD, Trenor CC, 3rd, Su MA, Foernzler D, Beier DR, Dietrich WF, Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet. 1997;16:383 6. 65. Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD, Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci U S A. 1998;95:1148 53. 66. Andrews NC. The iron transporter DMT1. Int J Biochem Cell Biol. 1999;31:991 4. 67. Hubert N, Hentze MW. Previously uncharacterized isoforms of divalent metal transporter (DMT) 1: implications for regulation and cellular function. Proc Natl Acad Sci U S A. 2002;99:12345 50.

PAGE 118

118 68. Tchernitchko D, Bourgeois M, Martin ME, Beaumont C. Expression of the two mRN A isoforms of the iron transporter Nramp2/DMTI in mice and function of the iron responsive element. Biochem J. 2002;363:449 55. 69. Canonne Hergaux F, Gruenheid S, Ponka P, Gros P. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood. 1999;93:4406 17. 70. Canonne Hergaux F, Zhang AS, Ponka P, Gros P. Characterization of the iron transporter DMT1 (NRAMP2/DCT1) in red blood cells of normal and anemic mk/mk mice. Blood. 2001;9 8:3823 30. 71. Gruenheid S, Canonne Hergaux F, Gauthier S, Hackam DJ, Grinstein S, Gros P. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J Exp Med. 1999;189:831 41. 72. Su M A, Trenor CC, Fleming JC, Fleming MD, Andrews NC. The G185R mutation disrupts function of the iron transporter Nramp2. Blood. 1998;92:2157 63. 73. Trinder D, Oates PS, Thomas C, Sadleir J, Morgan EH. Localisation of divalent metal transporter 1 (DMT1) to t he microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut. 2000;46:270 6. 74. Park JD, Cherrington NJ, Klaassen CD. Intestinal absorption of cadmium is associated with divalent metal transporter 1 in r ats. Toxicol Sci. 2002;68:288 94. 75. Taylor KM, Morgan HE, Johnson A, Nicholson RI. Structure function analysis of a novel member of the LIV 1 subfamily of zinc transporters, ZIP14. FEBS Lett. 2005;579:427 32. 76. Nomura N, Nagase T, Miyajima N, Sazuka T, Tanaka A, Sato S, Seki N, Kawarabayasi Y, Ishikawa K, Tabata S. Prediction of the coding sequences of unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041 KIAA0080) deduced by analysis of cDNA clones from human cell line KG 1. DNA Res. 1994;1:223 9. 77. Tominaga K, Kagata T, Johmura Y, Hishida T, Nishizuka M, Imagawa M. SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc. Febs J. 2005;272:1590 9. 78. Liuzzi JP, Aydemir F, Nam H, Knutson MD, Cousins RJ. Zip14 (Slc 39a14) mediates non transferrin bound iron uptake into cells. Proc Natl Acad Sci U S A. 2006;103:13612 7. 79. Girijashanker K, He L, Soleimani M, Reed JM, Li H, Liu Z, Wang B, Dalton TP, Nebert DW. Slc39a14 gene encodes ZIP14, a metal/bicarbonate symporter : similarities to the ZIP8 transporter. Mol Pharmacol. 2008;73:1413 23.

PAGE 119

119 80. Eide DJ. The SLC39 family of metal ion transporters. Pflugers Arch. 2004;447:796 800. 81. Taylor KM, Nicholson RI. The LZT proteins; the LIV 1 subfamily of zinc transporters. Bioch im Biophys Acta. 2003;1611:16 30. 82. Guerinot ML. The ZIP family of metal transporters. Biochim Biophys Acta. 2000;1465:190 8. 83. Gaither LA, Eide DJ. The human ZIP1 transporter mediates zinc uptake in human K562 erythroleukemia cells. J Biol Chem. 2001; 276:22258 64. 84. Eide D, Broderius M, Fett J, Guerinot ML. A novel iron regulated metal transporter from plants identified by functional expression in yeast. Proc Natl Acad Sci U S A. 1996;93:5624 8. 85. Zhao H, Eide D. The yeast ZRT1 gene encodes the zin c transporter protein of a high affinity uptake system induced by zinc limitation. Proc Natl Acad Sci U S A. 1996;93:2454 8. 86. Korshunova YO, Eide D, Clark WG, Guerinot ML, Pakrasi HB. The IRT1 protein from Arabidopsis thaliana is a metal transporter wit h a broad substrate range. Plant Mol Biol. 1999;40:37 44. 87. Liuzzi JP, Lichten LA, Rivera S, Blanchard RK, Aydemir TB, Knutson MD, Ganz T, Cousins RJ. Interleukin 6 regulates the zinc transporter Zip14 in liver and contributes to the hypozincemia of the acute phase response. Proc Natl Acad Sci U S A. 2005;102:6843 8. 88. Zhao N, Gao J, Enns CA, Knutson MD. ZRT/IRT like protein 14 (ZIP14) promotes the cellular assimilation of iron from transferrin. J Biol Chem. 2010. 89. Nemeth E, Valore EV, Territo M, Sch iller G, Lichtenstein A, Ganz T. Hepcidin, a putative mediator of anemia of inflammation, is a type II acute phase protein. Blood. 2003;101:2461 3. 90. Cousins RJ, Leinart AS. Tissue specific regulation of zinc metabolism and metallothionein genes by inter leukin 1. FASEB J. 1988;2:2884 90. 91. Lichten LA, Liuzzi JP, Cousins RJ. Interleukin 1beta contributes via nitric oxide to the upregulation and functional activity of the zinc transporter Zip14 (Slc39a14) in murine hepatocytes. Am J Physiol Gastrointest L iver Physiol. 2009;296:G860 7. 92. Kim PK, Zamora R, Petrosko P, Billiar TR. The regulatory role of nitric oxide in apoptosis. Int Immunopharmacol. 2001;1:1421 41. 93. Wendehenne D, Pugin A, Klessig DF, Durner J. Nitric oxide: comparative synthesis and sig naling in animal and plant cells. Trends Plant Sci. 2001;6:177 83.

PAGE 120

120 94. Garrick M, Scott D, Walpole S, Finkelstein E, Whitbred J, Chopra S, Trivikram L, Mayes D, Rhodes D, et al. Iron supplementation moderates but does not cure the Belgrade anemia. BioMetal s. 1997;10:65 76. 95. Brissot P, Wright TL, Ma WL, Weisiger RA. Efficient clearance of non transferrin bound iron by rat liver. Implications for hepatic iron loading in iron overload states. J Clin Invest. 1985;76:1463 70. 96. Craven CM, Alexander J, Eldri dge M, Kushner JP, Bernstein S, Kaplan J. Tissue distribution and clearance kinetics of non transferrin bound iron in the hypotransferrinemic mouse: a rodent model for hemochromatosis. Proc Natl Acad Sci U S A. 1987;84:3457 61. 97. Cabantchik ZI, Breuer W, Zanninelli G, Cianciulli P. LPI labile plasma iron in iron overload. Best Pract Res Clin Haematol. 2005;18:277 87. 98. Nomura N, Nagase T, Miyajima N, Sazuka T, Tanaka A, Sato S, Seki N, Kawarabayasi Y, Ishikawa K, Tabata S. Prediction of the coding seque nces of unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041 KIAA0080) deduced by analysis of cDNA clones from human cell line KG 1 (supplement). DNA Res. 1994;1:251 62. 99. Gao J, Zhao N, Knutson MD, Enns CA. The hereditary hemochr omatosis protein, HFE, inhibits iron uptake via down regulation of Zip14 in HepG2 cells. J Biol Chem. 2008;283:21462 8. 100. Himeno S, Yanagiya T, Fujishiro H. The role of zinc transporters in cadmium and manganese transport in mammalian cells. Biochimie. 2009;91:1218 22. 101. Waisberg M, Joseph P, Hale B, Beyersmann D. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology. 2003;192:95 117. 102. Yanagiya T, Imura N, Enomoto S, Kondo Y, Himeno S. Suppression of a high affinity transport sys tem for manganese in cadmium resistant metallothionein null cells. J Pharmacol Exp Ther. 2000;292:1080 6. 103. Williamson JA, Thompson JC. An impurity in the buffer 2 amino 2 methyl 1 propanol, which correlates with depression of measured alkaline phosphat ase activity. Clin Chem. 1978;24:1611 3. 104. Fujishiro H, Okugaki S, Kubota K, Fujiyama T, Miyataka H, Himeno S. The role of ZIP8 down regulation in cadmium resistant metallothionein null cells. J Appl Toxicol. 2009;29:367 73. 105. McKie AT, Marciani P, R olfs A, Brennan K, Wehr K, Barrow D, Miret S, Bomford A, Peters TJ, et al. A novel duodenal iron regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell. 2000;5:299 309.

PAGE 121

121 106. Abboud S, Haile DJ. A novel mam malian iron regulated protein involved in intracellular iron metabolism. J Biol Chem. 2000;275:19906 12. 107. Rice AE, Mendez MJ, Hokanson CA, Rees DC, Bjorkman PJ. Investigation of the biophysical and cell biological properties of ferroportin, a multipass integral membrane protein iron exporter. J Mol Biol. 2009;386:717 32. 108. Donovan A, Lima CA, Pinkus JL, Pinkus GS, Zon LI, Robine S, Andrews NC. The iron exporter ferroportin/Slc40a1 is essential for iron homeostasis. Cell Metab. 2005;1:191 200. 109. Ay demir F, Jenkitkasemwong S, Gulec S, Knutson MD. Iron loading increases ferroportin heterogeneous nuclear RNA and mRNA levels in murine J774 macrophages. J Nutr. 2009;139:434 8. 110. Eisenstein RS. Iron regulatory proteins and the molecular control of mamm alian iron metabolism. Annu Rev Nutr. 2000;20:627 62. 111. Manis J. Active transport of iron by intestine: selective genetic defect in the mouse. Nature. 1970;227:385 6. 112. Pinkerton PH, Bannerman RM. Hereditary defect in iron absorption in mice. Nature. 1967;216:482 3. 113. Bannerman RM, Cooper RG. Sex linked anemia: a hypochromic anemia of mice. Science. 1966;151:581 2. 114. Frazer DM, Vulpe CD, McKie AT, Wilkins SJ, Trinder D, Cleghorn GJ, Anderson GJ. Cloning and gastrointestinal expression of rat hep haestin: relationship to other iron transport proteins. Am J Physiol Gastrointest Liver Physiol. 2001;281:G931 9. 115. Chen H, Su T, Attieh ZK, Fox TC, McKie AT, Anderson GJ, Vulpe CD. Systemic regulation of Hephaestin and Ireg1 revealed in studies of gene tic and nutritional iron deficiency. Blood. 2003;102:1893 9. 116. Han O, Wessling Resnick M. Copper repletion enhances apical iron uptake and transepithelial iron transport by Caco 2 cells. Am J Physiol Gastrointest Liver Physiol. 2002;282:G527 33. 117. Ni ttis T, Gitlin JD. Role of copper in the proteosome mediated degradation of the multicopper oxidase hephaestin. J Biol Chem. 2004;279:25696 702. 118. McNamara L, MacPhail AP, Mandishona E, Bloom P, Paterson AC, Rouault TA, Gordeuk VR. Non transferrin bound iron and hepatic dysfunction in African dietary iron overload. J Gastroenterol Hepatol. 1999;14:126 32.

PAGE 122

122 119. Yang F, Naylor SL, Lum JB, Cutshaw S, McCombs JL, Naberhaus KH, McGill JR, Adrian GS, Moore CM, et al. Characterization, mapping, and expression o f the human ceruloplasmin gene. Proc Natl Acad Sci U S A. 1986;83:3257 61. 120. Aldred AR, Grimes A, Schreiber G, Mercer JF. Rat ceruloplasmin. Molecular cloning and gene expression in liver, choroid plexus, yolk sac, placenta, and testis. J Biol Chem. 198 7;262:2875 8. 121. Klomp LW, Gitlin JD. Expression of the ceruloplasmin gene in the human retina and brain: implications for a pathogenic model in aceruloplasminemia. Hum Mol Genet. 1996;5:1989 96. 122. Holtzman NA, Elliott DA, Heller RH. Copper intoxicati on. Report of a case with observations on ceruloplasmin. N Engl J Med. 1966;275:347 52. 123. Olivares M, Uauy R. Copper as an essential nutrient. Am J Clin Nutr. 1996;63:791S 6S. 124. Gitlin JD, Schroeder JJ, Lee Ambrose LM, Cousins RJ. Mechanisms of caeru loplasmin biosynthesis in normal and copper deficient rats. Biochem J. 1992;282 ( Pt 3):835 9. 125. Gitlin D, Janeway CA. Turnover of the copper and protein moieties of ceruloplasmin. Nature. 1960;185:693. 126. Meyer LA, Durley AP, Prohaska JR, Harris ZL. Copper transport and metabolism are normal in aceruloplasminemic mice. J Biol Chem. 2001;276:36857 61. 127. Osaki S, Johnson DA, Frieden E. The possible significance of the ferrous oxidase activity of ceruloplasmin in normal human serum. J Biol Chem. 1966; 241:2746 51. 128. Roeser HP, Lee GR, Nacht S, Cartwright GE. The role of ceruloplasmin in iron metabolism. J Clin Invest. 1970;49:2408 17. 129. Harris ZL, Durley AP, Man TK, Gitlin JD. Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux. Proc Natl Acad Sci U S A. 1999;96:10812 7. 130. Yoshida K, Furihata K, Takeda S, Nakamura A, Yamamoto K, Morita H, Hiyamuta S, Ikeda S, Shimizu N, Yanagisawa N. A mutation in the ceruloplasmin gene is associated with systemic hemosid erosis in humans. Nat Genet. 1995;9:267 72. 131. Srivastava M, Duong LT, Fleming PJ. Cytochrome b561 catalyzes transmembrane electron transfer. J Biol Chem. 1984;259:8072 5. 132. Su D, May JM, Koury MJ, Asard H. Human erythrocyte membranes contain a cytoch rome b561 that may be involved in extracellular ascorbate recycling. J Biol Chem. 2006;281:39852 9.

PAGE 123

123 133. McKie AT. The role of Dcytb in iron metabolism: an update. Biochem Soc Trans. 2008;36:1239 41. 134. Latunde Dada GO, Simpson RJ, McKie AT. Duodenal cyt ochrome B expression stimulates iron uptake by human intestinal epithelial cells. J Nutr. 2008;138:991 5. 135. Wyman S, Simpson RJ, McKie AT, Sharp PA. Dcytb (Cybrd1) functions as both a ferric and a cupric reductase in vitro. FEBS Lett. 2008;582:1901 6. 1 36. Gunshin H, Fujiwara Y, Custodio AO, Direnzo C, Robine S, Andrews NC. Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver. J Clin Invest. 2005;115:1258 66. 137. Hallberg L. Bioavailability of dieta ry iron in man. Annu Rev Nutr. 1981;1:123 47. 138. Morgan EH, Laurell CB. Studies on the Exchange of Iron between Transferrin and Reticulocytes. Br J Haematol. 1963;9:471 83. 139. Ohgami RS, Campagna DR, Greer EL, Antiochos B, McDonald A, Chen J, Sharp JJ, Fujiwara Y, Barker JE, Fleming MD. Identification of a ferrireductase required for efficient transferrin dependent iron uptake in erythroid cells. Nat Genet. 2005;37:1264 9. 140. Louache F, Pelosi E, Titeux M, Peschle C, Testa U. Molecular mechanisms regu lating the synthesis of transferrin receptors and ferritin in human erythroleukemic cell lines. FEBS Lett. 1985;183:223 7. 141. Chachami G, Paraskeva E, Georgatsou E, Bonanou S, Simos G. Bacterially produced human HIF 1alpha is competent for heterodimeriza tion and specific DNA binding. Biochem Biophys Res Commun. 2005;331:464 70. 142. Sutter CH, Laughner E, Semenza GL. Hypoxia inducible factor 1alpha protein expression is controlled by oxygen regulated ubiquitination that is disrupted by deletions and misse nse mutations. Proc Natl Acad Sci U S A. 2000;97:4748 53. 143. Jewell UR, Kvietikova I, Scheid A, Bauer C, Wenger RH, Gassmann M. Induction of HIF 1alpha in response to hypoxia is instantaneous. FASEB J. 2001;15:1312 4. 144. Gu YZ, Moran SM, Hogenesch JB, Wartman L, Bradfield CA. Molecular characterization and chromosomal localization of a third alpha class hypoxia inducible factor subunit, HIF3alpha. Gene Expr. 1998;7:205 13. 145. Gruber M, Hu CJ, Johnson RS, Brown EJ, Keith B, Simon MC. Acute postnatal ab lation of Hif 2alpha results in anemia. Proc Natl Acad Sci U S A. 2007;104:2301 6.

PAGE 124

124 146. Peyssonnaux C, Zinkernagel AS, Schuepbach RA, Rankin E, Vaulont S, Haase VH, Nizet V, Johnson RS. Regulation of iron homeostasis by the hypoxia inducible transcription factors (HIFs). J Clin Invest. 2007;117:1926 32. 147. Lok CN, Ponka P. Identification of a hypoxia response element in the transferrin receptor gene. J Biol Chem. 1999;274:24147 52. 148. Rolfs A, Kvietikova I, Gassmann M, Wenger RH. Oxygen regulated transf errin expression is mediated by hypoxia inducible factor 1. J Biol Chem. 1997;272:20055 62. 149. Mastrogiannaki M, Matak P, Keith B, Simon MC, Vaulont S, Peyssonnaux C. HIF 2alpha, but not HIF 1alpha, promotes iron absorption in mice. J Clin Invest. 2009;1 19:1159 66. 150. Mukhopadhyay CK, Mazumder B, Fox PL. Role of hypoxia inducible factor 1 in transcriptional activation of ceruloplasmin by iron deficiency. J Biol Chem. 2000;275:21048 54. 151. Henderson BR, Menotti E, Bonnard C, Kuhn LC. Optimal sequence a nd structure of iron responsive elements. Selection of RNA stem loops with high affinity for iron regulatory factor. J Biol Chem. 1994;269:17481 9. 152. Binder R, Horowitz JA, Basilion JP, Koeller DM, Klausner RD, Harford JB. Evidence that the pathway of t ransferrin receptor mRNA degradation involves an endonucleolytic cleavage within the 3' UTR and does not involve poly(A) tail shortening. EMBO J. 1994;13:1969 80. 153. Kim HY, LaVaute T, Iwai K, Klausner RD, Rouault TA. Identification of a conserved and fu nctional iron responsive element in the 5' untranslated region of mammalian mitochondrial aconitase. J Biol Chem. 1996;271:24226 30. 154. Beinert H, Kennedy MC, Stout CD. Aconitase as Ironminus signSulfur Protein, Enzyme, and Iron Regulatory Protein. Chem Rev. 1996;96:2335 74. 155. Klausner RD, Rouault TA, Harford JB. Regulating the fate of mRNA: the control of cellular iron metabolism. Cell. 1993;72:19 28. 156. Samaniego F, Chin J, Iwai K, Rouault TA, Klausner RD. Molecular characterization of a second iro n responsive element binding protein, iron regulatory protein 2. Structure, function, and post translational regulation. J Biol Chem. 1994;269:30904 10. 157. Guo B, Yu Y, Leibold EA. Iron regulates cytoplasmic levels of a novel iron responsive element bind ing protein without aconitase activity. J Biol Chem. 1994;269:24252 60.

PAGE 125

125 158. Philpott CC, Haile D, Rouault TA, Klausner RD. Modification of a free Fe S cluster cysteine residue in the active iron responsive element binding protein prevents RNA binding. J B iol Chem. 1993;268:17655 8. 159. Yang F, Liu XB, Quinones M, Melby PC, Ghio A, Haile DJ. Regulation of reticuloendothelial iron transporter MTP1 (Slc11a3) by inflammation. J Biol Chem. 2002;277:39786 91. 160. Gunshin H, Allerson CR, Polycarpou Schwarz M, R ofts A, Rogers JT, Kishi F, Hentze MW, Rouault TA, Andrews NC, Hediger MA. Iron dependent regulation of the divalent metal ion transporter. FEBS Lett. 2001;509:309 16. 161. Rechsteiner M. Regulation of enzyme levels by proteolysis: the role of pest regions Adv Enzyme Regul. 1988;27:135 51. 162. Jentoft N. Why are proteins O glycosylated? Trends Biochem Sci. 1990;15:291 4. 163. Rutledge EA, Root BJ, Lucas JJ, Enns CA. Elimination of the O linked glycosylation site at Thr 104 results in the generation of a s oluble human transferrin receptor. Blood. 1994;83:580 6. 164. Yeh KY, Yeh M, Watkins JA, Rodriguez Paris J, Glass J. Dietary iron induces rapid changes in rat intestinal divalent metal transporter expression. Am J Physiol Gastrointest Liver Physiol. 2000;2 79:G1070 9. 165. Eh M. Iron metabolism and transport. Sydney: W.B. Saunders Company 1996. 166. Wheby MS, Jones LG. Role of transferrin in iron absorption. J Clin Invest. 1963;42:1007 16. 167. Wright TL, Brissot P, Ma WL, Weisiger RA. Characterization of no n transferrin bound iron clearance by rat liver. J Biol Chem. 1986;261:10909 14. 168. Blouin A, Bolender RP, Weibel ER. Distribution of organelles and membranes between hepatocytes and nonhepatocytes in the rat liver parenchyma. A stereological study. J Ce ll Biol. 1977;72:441 55. 169. Schreiber G, Dryburgh H, Millership A, Matsuda Y, Inglis A, Phillips J, Edwards K, Maggs J. The synthesis and secretion of rat transferrin. J Biol Chem. 1979;254:12013 9. 170. Cook JD, Barry WE, Hershko C, Fillet G, Finch CA. Iron kinetics with emphasis on iron overload. Am J Pathol. 1973;72:337 44. 171. Nicolas G, Bennoun M, Devaux I, Beaumont C, Grandchamp B, Kahn A, Vaulont S. Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 ( USF2) knockout mice. Proc Natl Acad Sci U S A. 2001;98:8780 5.

PAGE 126

126 172. Nicolas G, Chauvet C, Viatte L, Danan JL, Bigard X, Devaux I, Beaumont C, Kahn A, Vaulont S. The gene encoding the iron regulatory peptide hepcidin is regulated by anemia, hypoxia, and inf lammation. J Clin Invest. 2002;110:1037 44. 173. Papanikolaou G, Samuels ME, Ludwig EH, MacDonald ML, Franchini PL, Dube MP, Andres L, MacFarlane J, Sakellaropoulos N, et al. Mutations in HFE2 cause iron overload in chromosome 1q linked juvenile hemochroma tosis. Nat Genet. 2004;36:77 82. 174. Zhang AS, Yang F, Meyer K, Hernandez C, Chapman Arvedson T, Bjorkman PJ, Enns CA. Neogenin mediated hemojuvelin shedding occurs after hemojuvelin traffics to the plasma membrane. J Biol Chem. 2008;283:17494 502. 175. S amad TA, Rebbapragada A, Bell E, Zhang Y, Sidis Y, Jeong SJ, Campagna JA, Perusini S, Fabrizio DA, et al. DRAGON, a bone morphogenetic protein co receptor. J Biol Chem. 2005;280:14122 9. 176. Babitt JL, Huang FW, Wrighting DM, Xia Y, Sidis Y, Samad TA, Cam pagna JA, Chung RT, Schneyer AL, et al. Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet. 2006;38:531 9. 177. Wang RH, Li C, Xu X, Zheng Y, Xiao C, Zerfas P, Cooperman S, Eckhaus M, Rouault T, et al. A role of SM AD4 in iron metabolism through the positive regulation of hepcidin expression. Cell Metab. 2005;2:399 409. 178. Casanovas G, Mleczko Sanecka K, Altamura S, Hentze MW, Muckenthaler MU. Bone morphogenetic protein (BMP) responsive elements located in the prox imal and distal hepcidin promoter are critical for its response to HJV/BMP/SMAD. J Mol Med. 2009;87:471 80. 179. Andriopoulos B, Jr., Corradini E, Xia Y, Faasse SA, Chen S, Grgurevic L, Knutson MD, Pietrangelo A, Vukicevic S, et al. BMP6 is a key endogenou s regulator of hepcidin expression and iron metabolism. Nat Genet. 2009;41:482 7. 180. Meynard D, Kautz L, Darnaud V, Canonne Hergaux F, Coppin H, Roth MP. Lack of the bone morphogenetic protein BMP6 induces massive iron overload. Nat Genet. 2009;41:478 81 181. Goswami T, Andrews NC. Hereditary hemochromatosis protein, HFE, interaction with transferrin receptor 2 suggests a molecular mechanism for mammalian iron sensing. J Biol Chem. 2006;281:28494 8. 182. Gao J, Chen J, Kramer M, Tsukamoto H, Zhang AS, En ns CA. Interaction of the hereditary hemochromatosis protein HFE with transferrin receptor 2 is required for transferrin induced hepcidin expression. Cell Metab. 2009;9:217 27.

PAGE 127

127 183. Zhang AS, Davies PS, Carlson HL, Enns CA. Mechanisms of HFE induced regula tion of iron homeostasis: Insights from the W81A HFE mutation. Proc Natl Acad Sci U S A. 2003;100:9500 5. 184. Gardiner ME, Morgan EH. Transferrin and iron uptake by the liver in the rat. Aust J Exp Biol Med Sci. 1974;52:723 36. 185. Trinder D, Zak O, Aise n P. Transferrin receptor independent uptake of differic transferrin by human hepatoma cells with antisense inhibition of receptor expression. Hepatology. 1996;23:1512 20. 186. Sibille JC, Octave JN, Schneider YJ, Trouet A, Crichton RR. Transferrin protein and iron uptake by cultured hepatocytes. FEBS Lett. 1982;150:365 9. 187. Cole ES, Glass J. Transferrin binding and iron uptake in mouse hepatocytes. Biochim Biophys Acta. 1983;762:102 10. 188. Zimelman AP, Zimmerman HJ, McLean R, Weintraub LR. Effect of i ron saturation of transferrin on hepatic iron uptake: an in vitro study. Gastroenterology. 1977;72:129 31. 189. Lombard M, Bomford A, Hynes M, Naoumov NV, Roberts S, Crowe J, Williams R. Regulation of the hepatic transferrin receptor in hereditary hemochro matosis. Hepatology. 1989;9:1 5. 190. Trinder D, Morgan E, Baker E. The mechanisms of iron uptake by fetal rat hepatocytes in culture. Hepatology. 1986;6:852 8. 191. Hershko C, Cook JD, Finch DA. Storage iron kinetics. 3. Study of desferrioxamine action by selective radioiron labels of RE and parenchymal cells. J Lab Clin Med. 1973;81:876 86. 192. Trinder D, Batey RG, Morgan EH, Baker E. Effect of cellular iron concentration on iron uptake by hepatocytes. Am J Physiol. 1990;259:G611 7. 193. Lebron JA, Benne tt MJ, Vaughn DE, Chirino AJ, Snow PM, Mintier GA, Feder JN, Bjorkman PJ. Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor. Cell. 1998;93:111 23. 194. Lebron JA, West AP, Jr., Bjorkman P J. The hemochromatosis protein HFE competes with transferrin for binding to the transferrin receptor. J Mol Biol. 1999;294:239 45. 195. Carlson H, Zhang AS, Fleming WH, Enns CA. The hereditary hemochromatosis protein, HFE, lowers intracellular iron levels independently of transferrin receptor 1 in TRVb cells. Blood. 2005;105:2564 70.

PAGE 128

128 196. Kobune M, Kohgo Y, Kato J, Miyazaki E, Niitsu Y. Interleukin 6 enhances hepatic transferrin uptake and ferritin expression in rats. Hepatology. 1994;19:1468 75. 197. Levy JE, Jin O, Fujiwara Y, Kuo F, Andrews NC. Transferrin receptor is necessary for development of erythrocytes and the nervous system. Nat Genet. 1999;21:396 9. 198. Fleming RE, Migas MC, Holden CC, Waheed A, Britton RS, Tomatsu S, Bacon BR, Sly WS. Transferr in receptor 2: continued expression in mouse liver in the face of iron overload and in hereditary hemochromatosis. Proc Natl Acad Sci U S A. 2000;97:2214 9. 199. Camaschella C, Roetto A, Cali A, De Gobbi M, Garozzo G, Carella M, Majorano N, Totaro A, Gaspa rini P. The gene TFR2 is mutated in a new type of haemochromatosis mapping to 7q22. Nat Genet. 2000;25:14 5. 200. Aisen P. Iron metabolism in isolated liver cells. Ann N Y Acad Sci. 1988;526:93 100. 201. Page MA, Baker E, Morgan EH. Transferrin and iron up take by rat hepatocytes in culture. Am J Physiol. 1984;246:G26 33. 202. Ose L, Ose T, Reinertsen R, Berg T. Fluid endocytosis in isolated rat parenchymal and non parenchymal liver cells. Exp Cell Res. 1980;126:109 19. 203. Blomhoff R, Nenseter MS, Green MH Berg T. A multicompartmental model of fluid phase endocytosis in rabbit liver parenchymal cells. Biochem J. 1989;262:605 10. 204. Thorstensen K, Romslo I. Uptake of iron from transferrin by isolated hepatocytes. Biochim Biophys Acta. 1984;804:200 8. 205. Thorstensen K, Romslo I. Uptake of iron from transferrin by isolated rat hepatocytes. A redox mediated plasma membrane process? J Biol Chem. 1988;263:8844 50. 206. Thorstensen K. Hepatocytes and reticulocytes have different mechanisms for the uptake of ir on from transferrin. J Biol Chem. 1988;263:16837 41. 207. Clark MG, Partick EJ, Patten GS, Crane FL, Low H, Grebing C. Evidence for the extracellular reduction of ferricyanide by rat liver. A trans plasma membrane redox system. Biochem J. 1981;200:565 72. 208. Sun IL, Crane FL, Grebing C, Low H. Transmembrane redox in control of cell growth. Stimulation of HeLa cell growth by ferricyanide and insulin. Exp Cell Res. 1985;156:528 36.

PAGE 129

129 209. Trinder D, Morgan E. Inhibition of uptake of transferrin bound iron by human hepatoma cells by nontransferrin bound iron. Hepatology. 1997;26:691 8. 210. Scheiber B, Goldenberg H. Hepatic uptake of iron by receptor mediated and receptor independent mechanisms. Z Gastroenterol. 1996;34 Suppl 3:95 8. 211. Schade AL, Caroline L. An Iron binding Component in Human Blood Plasma. Science. 1946;104:340 1. 212. Hershko C, Graham G, Bates GW, Rachmilewitz EA. Non specific serum iron in thalassaemia: an abnormal serum iron fraction of potential toxicity. Br J Haematol. 1978;40:255 63. 2 13. Batey RG, Lai Chung Fong P, Shamir S, Sherlock S. A non transferrin bound serum iron in idiopathic hemochromatosis. Dig Dis Sci. 1980;25:340 6. 214. Hershko C, Peto TE. Non transferrin plasma iron. Br J Haematol. 1987;66:149 51. 215. Halliwell B, Gutte ridge JM. Oxygen free radicals and iron in relation to biology and medicine: some problems and concepts. Arch Biochem Biophys. 1986;246:501 14. 216. Halliwell B, Gutteridge JM. Role of free radicals and catalytic metal ions in human disease: an overview. M ethods Enzymol. 1990;186:1 85. 217. Esposito BP, Breuer W, Sirankapracha P, Pootrakul P, Hershko C, Cabantchik ZI. Labile plasma iron in iron overload: redox activity and susceptibility to chelation. Blood. 2003;102:2670 7. 218. Wheby MS, Umpierre G. Effec t of Transferrin Saturation on Iron Absorption in Man. N Engl J Med. 1964;271:1391 5. 219. Fawwaz RA, Winchell HS, Pollycove M, Sargent T. Hepatic iron deposition in humans. I. First pass hepatic deposition of intestinally absorbed iron in patients with lo w plasma latent iron binding capacity. Blood. 1967;30:417 24. 220. Wright TL, Fitz JG, Weisiger RA. Non transferrin bound iron uptake by rat liver. Role of membrane potential difference. J Biol Chem. 1988;263:1842 7. 221. Oshiro S, Nakajima H, Markello T, Krasnewich D, Bernardini I, Gahl WA. Redox, transferrin independent, and receptor mediated endocytosis iron uptake systems in cultured human fibroblasts. J Biol Chem. 1993;268:21586 91. 222. Randell EW, Parkes JG, Olivieri NF, Templeton DM. Uptake of non t ransferrin bound iron by both reductive and nonreductive processes is modulated by intracellular iron. J Biol Chem. 1994;269:16046 53.

PAGE 130

130 223. Inman RS, Coughlan MM, Wessling Resnick M. Extracellular ferrireductase activity of K562 cells is coupled to transfe rrin independent iron transport. Biochemistry. 1994;33:11850 7. 224. Graham RM, Morgan EH, Baker E. Characterisation of citrate and iron citrate uptake by cultured rat hepatocytes. J Hepatol. 1998;29:603 13. 225. Chua AC, Olynyk JK, Leedman PJ, Trinder D. Nontransferrin bound iron uptake by hepatocytes is increased in the Hfe knockout mouse model of hereditary hemochromatosis. Blood. 2004;104:1519 25. 226. Zhang AS, Xiong S, Tsukamoto H, Enns CA. Localization of iron metabolism related mRNAs in rat liver in dicate that HFE is expressed predominantly in hepatocytes. Blood. 2004;103:1509 14. 227. Mims MP, Guan Y, Pospisilova D, Priwitzerova M, Indrak K, Ponka P, Divoky V, Prchal JT. Identification of a human mutation of DMT1 in a patient with microcytic anemia and iron overload. Blood. 2005;105:1337 42. 228. Beaumont C, Delaunay J, Hetet G, Grandchamp B, de Montalembert M, Tchernia G. Two new human DMT1 gene mutations in a patient with microcytic anemia, low ferritinemia, and liver iron overload. Blood. 2006;107 :4168 70. 229. Tsushima RG, Wickenden AD, Bouchard RA, Oudit GY, Liu PP, Backx PH. Modulation of iron uptake in heart by L type Ca2+ channel modifiers: possible implications in iron overload. Circ Res. 1999;84:1302 9. 230. Graf EM, Bock M, Heubach JF, Zaha nich I, Boxberger S, Richter W, Schultz JH, Ravens U. Tissue distribution of a human Ca v 1.2 alpha1 subunit splice variant with a 75 bp insertion. Cell Calcium. 2005;38:11 21. 231. Stephenson LS, Latham MC, Ottesen EA. Global malnutrition. Parasitology. 2 000;121 Suppl:S5 22. 232. DeMaeyer E, Adiels Tegman M. The prevalence of anaemia in the world. World Health Stat Q. 1985;38:302 16. 233. Scholl TO. Iron status during pregnancy: setting the stage for mother and infant. Am J Clin Nutr. 2005;81:1218S 22S. 23 4. Zimmermann MB, Chaouki N, Hurrell RF. Iron deficiency due to consumption of a habitual diet low in bioavailable iron: a longitudinal cohort study in Moroccan children. Am J Clin Nutr. 2005;81:115 21. 235. Hurrell R. How to ensure adequate iron absorptio n from iron fortified food. Nutr Rev. 2002;60:S7 15; discussion S43.

PAGE 131

131 236. Zhou JR, Erdman JW, Jr. Phytic acid in health and disease. Crit Rev Food Sci Nutr. 1995;35:495 508. 237. Gillooly M, Bothwell TH, Torrance JD, MacPhail AP, Derman DP, Bezwoda WR, Mil ls W, Charlton RW, Mayet F. The effects of organic acids, phytates and polyphenols on the absorption of iron from vegetables. Br J Nutr. 1983;49:331 42. 238. Deehr MS, Dallal GE, Smith KT, Taulbee JD, Dawson Hughes B. Effects of different calcium sources o n iron absorption in postmenopausal women. Am J Clin Nutr. 1990;51:95 9. 239. Harvey LJ, Armah CN, Dainty JR, Foxall RJ, John Lewis D, Langford NJ, Fairweather Tait SJ. Impact of menstrual blood loss and diet on iron deficiency among women in the UK. Br J Nutr. 2005;94:557 64. 240. Wu AC, Lesperance L, Bernstein H. Screening for iron deficiency. Pediatr Rev. 2002;23:171 8. 241. Lozoff B, Klein NK, Nelson EC, McClish DK, Manuel M, Chacon ME. Behavior of infants with iron deficiency anemia. Child Dev. 1998;69 :24 36. 242. Hurtado EK, Claussen AH, Scott KG. Early childhood anemia and mild or moderate mental retardation. Am J Clin Nutr. 1999;69:115 9. 243. Scholl TO, Hediger ML, Fischer RL, Shearer JW. Anemia vs iron deficiency: increased risk of preterm delivery in a prospective study. Am J Clin Nutr. 1992;55:985 8. 244. Merryweather Clarke AT, Pointon JJ, Shearman JD, Robson KJ. Global prevalence of putative haemochromatosis mutations. J Med Genet. 1997;34:275 8. 245. Worwood M. Inherited iron loading: genetic t esting in diagnosis and management. Blood Rev. 2005;19:69 88. 246. Stremmel W, Karner M, Manzhalii E, Gilles W, Herrmann T, Merle U. Liver and iron metabolism -a comprehensive hypothesis for the pathogenesis of genetic hemochromatosis. Z Gastroenterol. 200 7;45:71 5. 247. Fargion S, Valenti L, Fracanzani AL. Hemochromatosis gene (HFE) mutations and cancer risk: expanding the clinical manifestations of hereditary iron overload. Hepatology. 2010;51:1119 21. 248. Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Rud dy DA, Basava A, Dormishian F, Domingo R, Jr., Ellis MC, et al. A novel MHC class I like gene is mutated in patients with hereditary haemochromatosis. Nat Genet. 1996;13:399 408.

PAGE 132

132 249. Rothenberg BE, Voland JR. beta2 knockout mice develop parenchymal iron o verload: A putative role for class I genes of the major histocompatibility complex in iron metabolism. Proc Natl Acad Sci U S A. 1996;93:1529 34. 250. Nicolas G, Viatte L, Lou DQ, Bennoun M, Beaumont C, Kahn A, Andrews NC, Vaulont S. Constitutive hepcidin expression prevents iron overload in a mouse model of hemochromatosis. Nat Genet. 2003;34:97 101. 251. Wu JC, Merlino G, Fausto N. Establishment and characterization of differentiated, nontransformed hepatocyte cell lines derived from mice transgenic for t ransforming growth factor alpha. Proc Natl Acad Sci U S A. 1994;91:674 8. 252. Reuber MD. A transplantable bile secreting hepatocellular carcinoma in the rat. J Natl Cancer Inst. 1961;26:891 9. 253. West AP, Jr., Giannetti AM, Herr AB, Bennett MJ, Nangiana JS, Pierce JR, Weiner LP, Snow PM, Bjorkman PJ. Mutational analysis of the transferrin receptor reveals overlapping HFE and transferrin binding sites. J Mol Biol. 2001;313:385 97. 254. Knutson MD, Walter PB, Ames BN, Viteri FE. Both iron deficiency and da ily iron supplements increase lipid peroxidation in rats. J Nutr. 2000;130:621 8. 255. Torrance JD, Bothwell TH. A simple technique for measuring storage iron concentrations in formalinised liver samples. S Afr J Med Sci. 1968;33:9 11. 256. Looker AC, Dall man PR, Carroll MD, Gunter EW, Johnson CL. Prevalence of iron deficiency in the United States. JAMA. 1997;277:973 6. 257. Adams PC. The natural history of untreated HFE related hemochromatosis. Acta Haematol. 2009;122:134 9. 258. Mackenzie B, Ujwal ML, Cha ng MH, Romero MF, Hediger MA. Divalent metal ion transporter DMT1 mediates both H+ coupled Fe2+ transport and uncoupled fluxes. Pflugers Arch. 2006;451:544 58. 259. Cooksey RC, Jouihan HA, Ajioka RS, Hazel MW, Jones DL, Kushner JP, McClain DA. Oxidative s tress, beta cell apoptosis, and decreased insulin secretory capacity in mouse models of hemochromatosis. Endocrinology. 2004;145:5305 12. 260. Kulaksiz H, Fein E, Redecker P, Stremmel W, Adler G, Cetin Y. Pancreatic beta cells express hepcidin, an iron upt ake regulatory peptide. J Endocrinol. 2008;197:241 9. 261. Koch RO, Zoller H, Theuri I, Obrist P, Egg G, Strohmayer W, Vogel W, Weiss G. Distribution of DMT 1 within the human glandular system. Histol Histopathol. 2003;18:1095 101.

PAGE 133

133 262. Horne WI, Tandler B Dubick MA, Niemela O, Brittenham GM, Tsukamoto H. Iron overload in the rat pancreas following portacaval shunting and dietary iron supplementation. Exp Mol Pathol. 1997;64:90 102. 263. Iancu TC, Ward RJ, Peters TJ. Ultrastructural changes in the pancreas of carbonyl iron fed rats. J Pediatr Gastroenterol Nutr. 1990;10:95 101. 264. McVicker BL, Tuma DJ, Kharbanda KK, Kubik JL, Casey CA. Effect of chronic ethanol administration on the in vitro production of proinflammatory cytokines by rat Kupffer cells in the presence of apoptotic cells. Alcohol Clin Exp Res. 2007;31:122 9. 265. Huebers HA, Brittenham GM, Csiba E, Finch CA. Absorption of carbonyl iron. J Lab Clin Med. 1986;108:473 8. 266. Richardson D, Baker E. Two mechanisms of iron uptake from transferrin by melanoma cells. The effect of desferrioxamine and ferric ammonium citrate. J Biol Chem. 1992;267:13972 9. 267. Parkes JG, Randell EW, Olivieri NF, Templeton DM. Modulation by iron loading and chelation of the uptake of non transferrin bound iron by hum an liver cells. Biochim Biophys Acta. 1995;1243:373 80. 268. Yang FM, Friedrichs WE, Cupples RL, Bonifacio MJ, Sanford JA, Horton WA, Bowman BH. Human ceruloplasmin. Tissue specific expression of transcripts produced by alternative splicing. J Biol Chem. 1 990;265:10780 5. 269. Richardson DR, Ponka P. Identification of a mechanism of iron uptake by cells which is stimulated by hydroxyl radicals generated via the iron catalysed Haber Weiss reaction. Biochim Biophys Acta. 1995;1269:105 14. 270. Gutteridge JM, Rowley DA, Griffiths E, Halliwell B. Low molecular weight iron complexes and oxygen radical reactions in idiopathic haemochromatosis. Clin Sci (Lond). 1985;68:463 7. 271. Baker E, Baker SM, Morgan EH. Characterisation of non transferrin bound iron (ferric citrate) uptake by rat hepatocytes in culture. Biochim Biophys Acta. 1998;1380:21 30. 272. Chua AC, Ingram HA, Raymond KN, Baker E. Multidentate pyridinones inhibit the metabolism of nontransferrin bound iron by hepatocytes and hepatoma cells. Eur J Bioche m. 2003;270:1689 98. 273. Leong WI, Bowlus CL, Tallkvist J, Lonnerdal B. Iron supplementation during infancy -effects on expression of iron transporters, iron absorption, and iron utilization in rat pups. Am J Clin Nutr. 2003;78:1203 11.

PAGE 134

134 274. Wardrop SL, R ichardson DR. The effect of intracellular iron concentration and nitrogen monoxide on Nramp2 expression and non transferrin bound iron uptake. Eur J Biochem. 1999;263:41 9. 275. Wareing M, Ferguson CJ, Delannoy M, Cox AG, McMahon RF, Green R, Riccardi D, S mith CP. Altered dietary iron intake is a strong modulator of renal DMT1 expression. Am J Physiol Renal Physiol. 2003;285:F1050 9. 276. Ke Y, Chen YY, Chang YZ, Duan XL, Ho KP, Jiang DH, Wang K, Qian ZM. Post transcriptional expression of DMT1 in the heart of rat. J Cell Physiol. 2003;196:124 30. 277. Haspel HC, Birnbaum MJ, Wilk EW, Rosen OM. Biosynthetic precursors and in vitro translation products of the glucose transporter of human hepatocarcinoma cells, human fibroblasts, and murine preadipocytes. J Biol Chem. 1985;260:7219 25. 278. Connolly EL, F ett JP, Guerinot ML. Expression of the IRT1 metal transporter is controlled by metals at the levels of transcript and protein accumulation. Plant Cell. 2002;14:1347 57. 279. Graham RM, Morgan EH, Baker E. Ferric citrate uptake by cultured rat hepatocytes i s inhibited in the presence of transferrin. Eur J Biochem. 1998;253:139 45. 280. Rothenbacher H, Sherman AR. Target organ pathology in iron deficient suckling rats. The Journal of nutrition. 1980;110:1648 54. 281. Laftah AH, Sharma N, Brookes MJ, McKie AT, Simpson RJ, Iqbal TH, Tselepis C. Tumour necrosis factor alpha causes hypoferraemia and reduced intestinal iron absorption in mice. Biochem J. 2006;397:61 7. 282. Thomas C, Oates PS. Ferroportin/IREG 1/MTP 1/SLC40A1 modulates the uptake of iron at the api cal membrane of enterocytes. Gut. 2004;53:44 9. 283. Arredondo M, Tapia V, Rojas A, Aguirre P, Reyes F, Marzolo MP, Nunez MT. Apical distribution of HFE beta2 microglobulin is associated with inhibition of apical iron uptake in intestinal epithelia cells. BioMetals. 2006;19:379 88. 284. Tabuchi M, Tanaka N, Nishida Kitayama J, Ohno H, Kishi F. Alternative splicing regulates the subcellular localization of divalent metal transporter 1 isoforms. Mol Biol Cell. 2002;13:4371 87. 285. Nunez MT, Tapia V, Rojas A, Aguirre P, Gomez F, Nualart F. Iron supply determines apical/basolateral membrane distribution of intestinal iron transporters DMT1 and ferroportin 1. Am J Physiol Cell Physiol. 2010;298:C477 85.

PAGE 135

135 286. LeSage GD, Kost LJ, Barham SS, LaRusso NF. Biliary exc retion of iron from hepatocyte lysosomes in the rat. A major excretory pathway in experimental iron overload. J Clin Invest. 1986;77:90 7. 287. Gyulkhandanyan AV, Lu H, Lee SC, Bhattacharjee A, Wijesekara N, Fox JE, MacDonald PE, Chimienti F, Dai FF, Wheel er MB. Investigation of transport mechanisms and regulation of intracellular Zn2+ in pancreatic alpha cells. J Biol Chem. 2008;283:10184 97. 288. Jenkitkasemwong S, Broderius M, Nam H, Prohaska JR, Knutson MD. Anemic copper deficient rats, but not mice, di splay low hepcidin expression and high ferroportin levels. J Nutr. 2010;140:723 30. 289. Lichten LA, Cousins RJ. Mammalian zinc transporters: nutritional and physiologic regulation. Annu Rev Nutr. 2009;29:153 76. 290. Wang F, Kim BE, Petris MJ, Eide DJ. Th e mammalian Zip5 protein is a zinc transporter that localizes to the basolateral surface of polarized cells. J Biol Chem. 2004;279:51433 41. 291. Dufner Beattie J, Kuo YM, Gitschier J, Andrews GK. The adaptive response to dietary zinc in mice involves the differential cellular localization and zinc regulation of the zinc transporters ZIP4 and ZIP5. J Biol Chem. 2004;279:49082 90. 292. Weaver BP, Dufner Beattie J, Kambe T, Andrews GK. Novel zinc responsive post transcriptional mechanisms reciprocally regulat e expression of the mouse Slc39a4 and Slc39a5 zinc transporters (Zip4 and Zip5). Biol Chem. 2007;388:1301 12. 293. Manning DL, Daly RJ, Lord PG, Kelly KF, Green CD. Effects of oestrogen on the expression of a 4.4 kb mRNA in the ZR 75 1 human breast cancer cell line. Mol Cell Endocrinol. 1988;59:205 12. 294. Kasper G, Weiser AA, Rump A, Sparbier K, Dahl E, Hartmann A, Wild P, Schwidetzky U, Castanos Velez E, Lehmann K. Expression levels of the putative zinc transporter LIV 1 are associated with a better outc ome of breast cancer patients. Int J Cancer. 2005;117:961 73. 295. Huang L, Kirschke CP, Zhang Y, Yu YY. The ZIP7 gene (Slc39a7) encodes a zinc transporter involved in zinc homeostasis of the Golgi apparatus. J Biol Chem. 2005;280:15456 63. 296. Zheng D, F eeney GP, Kille P, Hogstrand C. Regulation of ZIP and ZnT zinc transporters in zebrafish gill: zinc repression of ZIP10 transcription by an intronic MRE cluster. Physiol Genomics. 2008;34:205 14.

PAGE 136

136 297. Ryu MS, Lichten LA, Liuzzi JP, Cousins RJ. Zinc transpo rters ZnT1 (Slc30a1), Zip8 (Slc39a8), and Zip10 (Slc39a10) in mouse red blood cells are differentially regulated during erythroid development and by dietary zinc deficiency. J Nutr. 2008;138:2076 83. 298. Wimmer U, Wang Y, Georgiev O, Schaffner W. Two majo r branches of anti cadmium defense in the mouse: MTF 1/metallothioneins and glutathione. Nucleic Acids Res. 2005;33:5715 27. 299. Searle PF, Stuart GW, Palmiter RD. Building a metal responsive promoter with synthetic regulatory elements. Mol Cell Biol. 198 5;5:1480 9. 300. Kaler P, Prasad R. Molecular cloning and functional characterization of novel zinc transporter rZip10 (Slc39a10) involved in zinc uptake across rat renal brush border membrane. Am J Physiol Renal Physiol. 2007;292:F217 29. 301. Kumar R, Pr asad R. Functional characterization of purified zinc transporter from renal brush border membrane of rat. Biochim Biophys Acta. 2000;1509:429 39. 302. Pawan K, Neeraj S, Sandeep K, Kanta Ratho R, Rajendra P. Upregulation of Slc39a10 gene expression in resp onse to thyroid hormones in intestine and kidney. Biochim Biophys Acta. 2007;1769:117 23. 303. Pollack S, George JN, Reba RC, Kaufman RM, Crosby WH. The Absorption of Nonferrous Metals in Iron Deficiency. J Clin Invest. 1965;44:1470 3. 304. Rodriguez Matas MC, Lisbona F, Gomez Ayala AE, Lopez Aliaga I, Campos MS. Influence of nutritional iron deficiency development on some aspects of iron, copper and zinc metabolism. Lab Anim. 1998;32:298 306. 305. Vayenas DV, Repanti M, Vassilopoulos A, Papanastasiou DA. I nfluence of iron overload on manganese, zinc, and copper concentration in rat tissues in vivo: study of liver, spleen, and brain. Int J Clin Lab Res. 1998;28:183 6. 306. Adams PC, Bradley C, Frei JV. Hepatic zinc in hemochromatosis. Clin Invest Med. 1991;1 4:16 20. 307. Giannetti AM, Bjorkman PJ. HFE and transferrin directly compete for transferrin receptor in solution and at the cell surface. J Biol Chem. 2004;279:25866 75. 308. Hosoya KI, Kim KJ, Lee VH. Age dependent expression of P glycoprotein gp170 in Caco 2 cell monolayers. Pharm Res. 1996;13:885 90.

PAGE 137

137 BIOGRAPHICAL SKETCH Hyeyoung Nam was born in Seoul, South Korea. She received a Bachelor of Science from Jang An College and transferred to KonKuk University She received her Bachelor of Science degre KonKuk University in 2003. I n August 2005, she came to the Department of Food Science and Human Nutrition at University of Florida for the PhD program in nutritional science s She worked with Dr. Mit chell Knutson and focused on iron metabolism. She will receive her Ph.D. from the University of Florida in the d ecember of 2010.