<%BANNER%>

Manipulating the Ovulatory Follicle

Permanent Link: http://ufdc.ufl.edu/UFE0042380/00001

Material Information

Title: Manipulating the Ovulatory Follicle Impacts on Reproductive Tissue Gene Expression and Fertility of Dairy Cows
Physical Description: 1 online resource (204 p.)
Language: english
Creator: Bisinotto, Rafael
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: anovulation, conceptus, corpus, cow, dairy, embryo, endometrium, estradiol, follicle, gene, insemination, luteum, management, physiology, progesterone, prostaglandin, reproduction, uterus, wave
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: MANIPULATING THE OVULATORY FOLLICLE: IMPACTS ON REPRODUCTIVE TISSUE GENE EXPRESSION AND FERTILITY OF DAIRY COWS Experiments were conducted to further elucidate the effects of the environment on which the ovulatory follicle develops and its relationship with the reduction of fertility observed in anovular dairy cows, and to evaluate alternative management programs that incorporate this knowledge to improve reproductive performance of dairy cows. In the first study, data from 5,607 lactating cows enrolled in synchronization programs for artificial insemination (AI) were evaluated. Cows had blood analyzed for progesterone 7 to 14 days apart, with the second sample collected on the day of the first injection of gonadotropin-releasing hormone (GnRH1). Cows were classified as cyclic if progesterone ? 1 ng/mL in at least one of the two samples, and anovular if both samples were < 1.0 ng/mL. Cyclic cows were categorized as low (CLOW; < 1.0 ng/mL) or high (CHIGH; ? 1.0 ng/mL) based on progesterone concentration at GnRH1, which would result in ovulation of the dominant follicle of the first (FW) and second (SW) follicular wave, respectively, at AI. Pregnancy per AI (P/AI) on day 30 after AI was greater for CHIGH than anovular and CLOW cows (43.0 vs. 29.7 vs. 31.3%, respectively). Short inter-AI intervals differed among groups and were 7.1, 11.9, and 15.7% for CHIGH, anovular and CLOW, respectively. Pregnancy loss differed only 18 between anovular and CLOW (10.0 vs. 15.0%), and it was intermediate for CHIGH (13.5%). In a second experiment, 220 cyclic Holstein cows received 2 injections of prostaglandin (PG) F2? administered 14 days apart. The Ovsynch protocol (day 0 GnRH, day 7 PGF2?, day 9 GnRH, day 9.5 timed AI) was initiated either 3 or 10 days after the second PGF2? to result in AI to the FW or SW dominant follicles. Blood was analyzed for progesterone and ovaries were scanned to determine ovulatory responses and follicle diameter. The proportion of cows with progesterone > 1.0 ng/mL at GnRH1 was 9.8 and 97.2% for FW and SW, respectively. Concentrations of progesterone at GnRH1 and PGF2? injections of the Ovsynch protocol were greater for SW than FW. Pregnancy per AI was greater for SW than FW (41.7 vs. 30.4%) despite less ovulation to GnRH1 in SW than FW (78.7 vs. 88.3%). Results indicate that follicular wave of the ovulatory follicle and not cyclic status influences fertility of dairy cows. Objectives of the second study were to investigate 2 intervals from induction of ovulation to AI in synchronization programs, and the effect of supplemental progesterone for resynchronization on fertility of lactating dairy cows subjected to a 5-day timed AI program. In experiment 1, 1,227 Holstein cows had their estrous cycle presynchronized with 2 injections of PGF2? at 46 and 60 days in milk (DIM). Timed AI protocols were initiated with GnRH at 72 DIM, followed by 2 injections of PGF2? at 77 and 78 DIM and a second injection of GnRH at either 56 (OVS56) or 72 hours (COS72) after the first PGF2? of the timed AI protocols. All cows received timed AI at 72 hours after the first PGF2?. The proportion of cows detected in estrus at AI was greater for COS72 than OVS56 (40.6 vs. 32.4%); however, P/AI on day 32 after AI did not differ between OVS56 (46.4%) and COS72 (45.5%). In experiment 2, 675 nonpregnant 19 Holstein cows had their estrous cycle resynchronized starting at 34 days after the first AI. Cows received the OVS56 with (RCIDR) or without (RCON) supplemental progesterone from GnRH1 to the first PGF2?. Subsets of cows had their ovaries scanned by ultrasonography at GnRH1, the first PGF2?, and second GnRH injections. Blood was analyzed for progesterone on the day of AI and 7 days later. Cows were considered to have a synchronized ovulation if progesterone was < 1 ng/mL and > 2.26 ng/mL on the day of AI and 7 days later, respectively, and if no ovulation was detected between the first PGF2? and second GnRH injections. Cows supplemented with progesterone had greater P/AI compared with unsupplemented cows (51.3 vs. 43.1%). Premature ovulation tended to be greater for RCON than RCIDR cows (7.5 vs. 3.6%), although synchronization of the estrous cycle after timed AI was similar between treatments. Results indicate that timing of induction of ovulation with GnRH relative to insemination did not affect P/AI of dairy cows enrolled in a 5-day timed AI program, and that supplementation with progesterone improved P/AI in cows subjected to the 5-d timed AI protocol during resynchronization starting on day 34 after the first AI. In the third study, the effects of wave of the ovulatory follicle and concentrations of progesterone during follicular growth on reproductive responses of dairy cows were evaluated. Non-pregnant and non-lactating Holstein cows had their estrous cycle presynchronized with an injection of GnRH and a controlled internal drug-release (CIDR) insert containing progesterone, followed 7 days later by CIDR removal and 2 injections of PGF2? 24 hours apart. All cows received an injection of GnRH 1 day after the second PGF2?, which was the first GnRH of the synchronization protocol (day -9 GnRH1, day -2 and day -1 PGF2?, day 0 GnRH) for cows induced to ovulate a FW 20 follicle (FW, n = 13) or a FW follicle supplemented with progesterone (FWP4, n = 8). Cows induced to ovulate a SW follicle (SW, n = 12) received the GnRH1 on day 6 of the new estrous cycle. Cows in FWP4 received 3 CIDR inserts at 12, 24 and 48 hours after the GnRH1 (day -9). Inserts were removed at the injection of PGF2? (day -2). Cows were inseminated at the final GnRH (day 0) and again 16 hours later. Cows were killed on day 17 after the final GnRH. Progesterone concentration during follicular growth was greater for SW, intermediate for FWP4 and lesser for FW. Cows in FW ovulated larger follicles, which resulted in larger corpora lutea (CL) and greater concentrations of progesterone from days 4 to 16 of the estrous cycle after AI. The relative mRNA abundance for steroidogenic acute regulatory protein (StAR) was greater for FW than for other treatments. Nonetheless, the ratio between circulating progesterone and CL volume was not affected by treatment. A greater proportion of FW cows had a peak concentration of estradiol on the day before the final GnRH in comparison to other treatments. Maximum concentration of estradiol was greater for FW than for FWP4 and SW. The proportion of pregnant cows on day 17 tended to be less for FW than for FWP4 and SW. The length of conceptuses did not differ among treatments. There was a trend for SW conceptuses to produce less INF-?; however, no differences in the relative abundance of INF-? mRNA were detected. Ovulation of FW follicles reduced fertility in dairy cows and this negative effect was mediated by suboptimal concentrations of progesterone during ovulatory follicle growth. Furthermore, luteal function during early gestation and capability of elongated conceptuses to produce IFN-? were not involved with reduction of fertility in cows that ovulated FW follicles.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rafael Bisinotto.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Santos, Jose.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042380:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042380/00001

Material Information

Title: Manipulating the Ovulatory Follicle Impacts on Reproductive Tissue Gene Expression and Fertility of Dairy Cows
Physical Description: 1 online resource (204 p.)
Language: english
Creator: Bisinotto, Rafael
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: anovulation, conceptus, corpus, cow, dairy, embryo, endometrium, estradiol, follicle, gene, insemination, luteum, management, physiology, progesterone, prostaglandin, reproduction, uterus, wave
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: MANIPULATING THE OVULATORY FOLLICLE: IMPACTS ON REPRODUCTIVE TISSUE GENE EXPRESSION AND FERTILITY OF DAIRY COWS Experiments were conducted to further elucidate the effects of the environment on which the ovulatory follicle develops and its relationship with the reduction of fertility observed in anovular dairy cows, and to evaluate alternative management programs that incorporate this knowledge to improve reproductive performance of dairy cows. In the first study, data from 5,607 lactating cows enrolled in synchronization programs for artificial insemination (AI) were evaluated. Cows had blood analyzed for progesterone 7 to 14 days apart, with the second sample collected on the day of the first injection of gonadotropin-releasing hormone (GnRH1). Cows were classified as cyclic if progesterone ? 1 ng/mL in at least one of the two samples, and anovular if both samples were < 1.0 ng/mL. Cyclic cows were categorized as low (CLOW; < 1.0 ng/mL) or high (CHIGH; ? 1.0 ng/mL) based on progesterone concentration at GnRH1, which would result in ovulation of the dominant follicle of the first (FW) and second (SW) follicular wave, respectively, at AI. Pregnancy per AI (P/AI) on day 30 after AI was greater for CHIGH than anovular and CLOW cows (43.0 vs. 29.7 vs. 31.3%, respectively). Short inter-AI intervals differed among groups and were 7.1, 11.9, and 15.7% for CHIGH, anovular and CLOW, respectively. Pregnancy loss differed only 18 between anovular and CLOW (10.0 vs. 15.0%), and it was intermediate for CHIGH (13.5%). In a second experiment, 220 cyclic Holstein cows received 2 injections of prostaglandin (PG) F2? administered 14 days apart. The Ovsynch protocol (day 0 GnRH, day 7 PGF2?, day 9 GnRH, day 9.5 timed AI) was initiated either 3 or 10 days after the second PGF2? to result in AI to the FW or SW dominant follicles. Blood was analyzed for progesterone and ovaries were scanned to determine ovulatory responses and follicle diameter. The proportion of cows with progesterone > 1.0 ng/mL at GnRH1 was 9.8 and 97.2% for FW and SW, respectively. Concentrations of progesterone at GnRH1 and PGF2? injections of the Ovsynch protocol were greater for SW than FW. Pregnancy per AI was greater for SW than FW (41.7 vs. 30.4%) despite less ovulation to GnRH1 in SW than FW (78.7 vs. 88.3%). Results indicate that follicular wave of the ovulatory follicle and not cyclic status influences fertility of dairy cows. Objectives of the second study were to investigate 2 intervals from induction of ovulation to AI in synchronization programs, and the effect of supplemental progesterone for resynchronization on fertility of lactating dairy cows subjected to a 5-day timed AI program. In experiment 1, 1,227 Holstein cows had their estrous cycle presynchronized with 2 injections of PGF2? at 46 and 60 days in milk (DIM). Timed AI protocols were initiated with GnRH at 72 DIM, followed by 2 injections of PGF2? at 77 and 78 DIM and a second injection of GnRH at either 56 (OVS56) or 72 hours (COS72) after the first PGF2? of the timed AI protocols. All cows received timed AI at 72 hours after the first PGF2?. The proportion of cows detected in estrus at AI was greater for COS72 than OVS56 (40.6 vs. 32.4%); however, P/AI on day 32 after AI did not differ between OVS56 (46.4%) and COS72 (45.5%). In experiment 2, 675 nonpregnant 19 Holstein cows had their estrous cycle resynchronized starting at 34 days after the first AI. Cows received the OVS56 with (RCIDR) or without (RCON) supplemental progesterone from GnRH1 to the first PGF2?. Subsets of cows had their ovaries scanned by ultrasonography at GnRH1, the first PGF2?, and second GnRH injections. Blood was analyzed for progesterone on the day of AI and 7 days later. Cows were considered to have a synchronized ovulation if progesterone was < 1 ng/mL and > 2.26 ng/mL on the day of AI and 7 days later, respectively, and if no ovulation was detected between the first PGF2? and second GnRH injections. Cows supplemented with progesterone had greater P/AI compared with unsupplemented cows (51.3 vs. 43.1%). Premature ovulation tended to be greater for RCON than RCIDR cows (7.5 vs. 3.6%), although synchronization of the estrous cycle after timed AI was similar between treatments. Results indicate that timing of induction of ovulation with GnRH relative to insemination did not affect P/AI of dairy cows enrolled in a 5-day timed AI program, and that supplementation with progesterone improved P/AI in cows subjected to the 5-d timed AI protocol during resynchronization starting on day 34 after the first AI. In the third study, the effects of wave of the ovulatory follicle and concentrations of progesterone during follicular growth on reproductive responses of dairy cows were evaluated. Non-pregnant and non-lactating Holstein cows had their estrous cycle presynchronized with an injection of GnRH and a controlled internal drug-release (CIDR) insert containing progesterone, followed 7 days later by CIDR removal and 2 injections of PGF2? 24 hours apart. All cows received an injection of GnRH 1 day after the second PGF2?, which was the first GnRH of the synchronization protocol (day -9 GnRH1, day -2 and day -1 PGF2?, day 0 GnRH) for cows induced to ovulate a FW 20 follicle (FW, n = 13) or a FW follicle supplemented with progesterone (FWP4, n = 8). Cows induced to ovulate a SW follicle (SW, n = 12) received the GnRH1 on day 6 of the new estrous cycle. Cows in FWP4 received 3 CIDR inserts at 12, 24 and 48 hours after the GnRH1 (day -9). Inserts were removed at the injection of PGF2? (day -2). Cows were inseminated at the final GnRH (day 0) and again 16 hours later. Cows were killed on day 17 after the final GnRH. Progesterone concentration during follicular growth was greater for SW, intermediate for FWP4 and lesser for FW. Cows in FW ovulated larger follicles, which resulted in larger corpora lutea (CL) and greater concentrations of progesterone from days 4 to 16 of the estrous cycle after AI. The relative mRNA abundance for steroidogenic acute regulatory protein (StAR) was greater for FW than for other treatments. Nonetheless, the ratio between circulating progesterone and CL volume was not affected by treatment. A greater proportion of FW cows had a peak concentration of estradiol on the day before the final GnRH in comparison to other treatments. Maximum concentration of estradiol was greater for FW than for FWP4 and SW. The proportion of pregnant cows on day 17 tended to be less for FW than for FWP4 and SW. The length of conceptuses did not differ among treatments. There was a trend for SW conceptuses to produce less INF-?; however, no differences in the relative abundance of INF-? mRNA were detected. Ovulation of FW follicles reduced fertility in dairy cows and this negative effect was mediated by suboptimal concentrations of progesterone during ovulatory follicle growth. Furthermore, luteal function during early gestation and capability of elongated conceptuses to produce IFN-? were not involved with reduction of fertility in cows that ovulated FW follicles.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rafael Bisinotto.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Santos, Jose.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042380:00001


This item has the following downloads:


Full Text

PAGE 1

1 MANIPULATING THE OVU LATORY FOLLICLE: IM PACTS ON REPRODUCTIV E TISSUE GENE EXPRESSI ON AND FERTILITY OF DAIRY COWS By RAFAEL SISCONETO BISINOTTO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Rafael Sisconeto Bisinotto

PAGE 3

3 To my parents for their perseverance and endless support

PAGE 4

4 ACKNOWLEDGMENTS Most of all, I am grateful to God for His infinite blessing throughout my life that made everything possible. I would like to express my profound acknowledgments to my advisor, Dr. Jos Eduardo Portela Santos for the opportunity of pursuing my degree of Master of Science at the University of Florida I am thankful for his guidance and unremitting commitment with the quality of my research manuscripts and presentations And finally for his enthusiasm with science that pushes his students forward. I extend my appr ec iation to my committee, Dr. Carlos A. Risco and Dr. William W. Thatcher, for all the discussions and ideas that helped with conducting my projects A special thanks to Dr. Thatcher for the financial support that allowed me to finish my program. I would like to e s pecially thank Dr. Alan D. Ealy for helping me with ideas, anti viral assays, and PCR procedures. I would like to extend my appreciation to the Animal Molecular and Cellular Biology program for funding my graduate program. I would like to express my deep a ppr e ciation to all the students from our lab Leandro F. Greco Eduardo S. Ribeiro F bio S. Lima Maur cio G. Favoreto Henderson Ayres Leonardo Tondello, Rafael S. Marsola, Ana Paula Monteiro, A na Lcia Sevarolli and Mari ana R. Carvalho Without their valuable help, none of the work presented here would have be en possible. I would like to extend this acknowledgments to Ronaldo L. A. Cerri Iza bella M. Thompson and Milerky C. Perdomo for their helping hand s with elaborating and executing the experiments I would like to thank the students Dan Wang and Miriam O. Garcia for sharing the responsibilities of our lab; Sha Tao for his help with procedures for collection and

PAGE 5

5 processing of samples; and Qi En Yang for his help with RNA extraction and PCR analysis I also would like to thank the s taff and faculty of the Department of Animal Science at the University of Florida. In particular, Dr. Joel Yelich, Sergji Sennikov and Joyce Hayen for their assistance with sample processing and general lab procedures I would like to t h ank Joann M. Fis c her for all her help with our paperwork and with the final submission of this thesis. A s pecial thanks to William Rembert for his appreciated help with collection of samples at the slaughter house. Finally, I would like to thank Eric Diepersloot and Jay Lemmermen at the University of Florida Dairy Unit for their assistance with animal handling. I extend my sincere appreciation to Ronald St. John, Nilo Francisco, Frankling, Antnio, Geraldo, Tommy and Junia at Alliance Dairy for allowing us to use their cows and facilities which made the research presented here possible. I also would lik e to acknowledge the manager and staff at the Center Hill slaughter house for the chance of collecting our samples within their establishment. I owe special recognition to my entire family back in Brazil. To my grandparents, Terclio and Catarina Bisinotto for their indefatigable prayers that have guided me and protect ed me always. Furthermore, I am grateful for the model of humbleness and moral that they represent to all their sons, daughters, and grandchild I would like to extend my deepest appreciation to my parents, Celso and Suerli, for their sacrifice and support. I can only imagine that the pain of being parted from be supplanted only by that of parents being parted from their children I would like to especially thank my sisters Helosa and Mariana, for their friendship and great support during my

PAGE 6

6 experience abroad. Finally, I would like to thank all my cousins that, by means of e mails and on line conferences, kept me a little more confortable of being away from home. Not to be redundant, I would like to express my sincere appreciation to all my friends that strengthened me in every step. To my friends in the lab, Lea n dro, Fbio, and Edu a rdo for sharing this experience with me this includes all the greetings as well as the frus trations. All their help with experiments was vital for the completion of this thesis, nevertheless, was much smaller than the personal support that I got from them I would also like to thank my friends from the Department of An imal Sciences Ronaldo, Davi, and Guilherme (including the endless supply of terer that helped me finishing this thesis) for their companionship and helping hand throughout my master program. I would like to sincerely thank my best friends from Brazil, F bio, Adilson, Rafael, Leydson, Flvio, Diego, Maurcio N., Maurcio S., Douglas, Mrio, Jos, and Fernando, for their indifference to the distance between us and all the encouragement they provided during these 2 years Finally, I would like to thank my g irlfriend Brittany A. Wall for all her love, friendship, and patience. I would like to extend my appreciation to Scott and Tracy Wall and to all the Wall family for having received me in their home while I was 4,700 miles away from mine.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ .......... 10 LIST OF FIGURES ................................ ................................ ................................ ........ 11 LIST OF ABBREVIATIONS ................................ ................................ ........................... 13 ABSTRACT ................................ ................................ ................................ ................... 17 CHAPTER 1 INTRODUCTI ON ................................ ................................ ................................ .... 21 2 LITERATURE REVIEW ................................ ................................ .......................... 25 The Estrous Cycle of Dairy Cows ................................ ................................ ........... 25 Follicular Growth and Oocyte Development ................................ ............................ 28 Formation of the CL, Luteal Function and Luteolysis ................................ .............. 34 Early Embryogenesis: From the Zygote to Shedding of the Zona Pellucida ........... 46 Elongation of the Conceptus ................................ ................................ ................... 51 Maternal Recognition of Pregnancy ................................ ................................ ........ 57 Synchronization of Estrus and Ovulation and Timed AI ................................ .......... 59 Delayed Ovulation Postpart um in Dairy Cows ................................ ........................ 70 Overall Hypotheses and Objectives ................................ ................................ ........ 73 3 FOLLICULAR WAVE OF T HE OVULATORY FOLLICL E AND NOT CYCLIC STATUS INFLUENCES FE RTILITY OF DAIRY COW S ................................ ......... 76 Introduction ................................ ................................ ................................ ............. 77 Materials and Methods ................................ ................................ ............................ 79 Experiment 1 ................................ ................................ ................................ .... 79 Reproductive man agement ................................ ................................ ........ 80 Blood sampling and progesterone analysis ................................ ............... 81 Classification of cows according to progesterone status ............................ 81 Pregnancy diagnosis ................................ ................................ .................. 82 Experiment 2 ................................ ................................ ................................ .... 83 Animals, housing, and feeding ................................ ................................ ... 83 Treatments ................................ ................................ ................................ 83 Ovarian ultrasonography ................................ ................................ ............ 84 Blood sampling and progesterone analysis ................................ ............... 85 Body condition score (BCS) and milk yield ................................ ................ 85 Pregnancy diagnosis and calculation of reproductive responses ............... 85 Study Design and Statistical Analyses ................................ ............................. 86

PAGE 8

8 Experiment 1 ................................ ................................ .............................. 86 Experiment 2 ................................ ................................ .............................. 86 Results ................................ ................................ ................................ .................... 88 Experiment 1 ................................ ................................ ................................ .... 88 Experiment 2 ................................ ................................ ................................ .... 89 Ovarian responses and progesterone concentration during the Ovsynch .. 90 Pregnancy per AI and pregnancy loss ................................ ....................... 90 Discussion ................................ ................................ ................................ .............. 91 Conclusion ................................ ................................ ................................ .............. 97 4 EFFECT OF WAVE O F THE OVULATORY FOLL ICLE AND CONCENTRATION OF PRO GESTERONE DURING FOL LICULAR GROWTH ON LUTEAL FUNCTION A ND CONCEPTUS DEVELOP MENT IN DAIRY COWS ................................ ................................ ................................ ................... 102 Introduction ................................ ................................ ................................ ........... 103 Materials and Methods ................................ ................................ .......................... 106 Animal s ................................ ................................ ................................ ........... 106 Synchronization of Follicular Wave and Supplementation with Progesterone 107 Ultrasonography of Ovaries and Eligibility Criteria ................................ ......... 108 Blood Collection and Analyses of Hormonal Concentrations in Plasma ......... 109 Collection of Conceptuses, U terine and CL Samples ................................ ..... 110 Measurement of IFN ................................ .......................... 111 RNA isolation and Quantitative Real Time Reverse Transcription PCR ......... 113 Experimental Design and Statistical Analysis ................................ ................. 114 Results ................................ ................................ ................................ .................. 115 Ovarian Responses and Hormonal Profiles ................................ .................... 116 Expression of Steroidogenenic and Angiogenic Factors in the CL ................. 117 Pregnancy, Conceptus Development and IFN ........................... 118 Discussion ................................ ................................ ................................ ............ 119 Conclusion ................................ ................................ ................................ ............ 123 5 EFFECT OF INTERVAL B ETWEEN INDUCTION OF OVULATION AND AI AND SUPPLEMENTAL PRO GESTERONE FOR RESYN CHRONIZATION ON FERTILITY OF DAIRY C OWS SUBJECTED TO A 5 D TIMED AI PROGRAM .... 144 Introduction ................................ ................................ ................................ ........... 145 Materials and Methods ................................ ................................ .......................... 147 Experiment 1 ................................ ................................ ................................ .. 147 Cows, housing and diets ................................ ................................ .......... 147 Treatments ................................ ................................ ............................... 148 Pregnancy diagnosis and calculation of reproductive outcomes .............. 149 Milk yield and BCS ................................ ................................ ................... 149 Experiment 2 ................................ ................................ ................................ .. 149 Cows, housing, and diets ................................ ................................ ......... 1 49 Treatments ................................ ................................ ............................... 150 Ultrasonography of ovaries ................................ ................................ ...... 150

PAGE 9

9 Blood sampling and analysis of progesterone in plasma ......................... 151 Evaluation of protocol synchronization ................................ ..................... 152 Pregnancy diagnosis and calculation of reproductive outcomes .............. 152 Milk yield ................................ ................................ ................................ .. 152 Experimental design and statistical analyses ................................ ................. 153 Experiment 1 ................................ ................................ ............................ 153 Experiment 2 ................................ ................................ ............................ 154 Results ................................ ................................ ................................ .................. 155 Experiment 1 ................................ ................................ ................................ .. 155 Experiment 2 ................................ ................................ ................................ .. 156 Ovarian responses and progesterone concentrations in plasma ............. 156 Estrus at AI, pregnancy per AI, and pregnancy loss ................................ 158 Discussion ................................ ................................ ................................ ............ 159 Conclusion ................................ ................................ ................................ ............ 164 6 GENERAL DISCUSSION AND CONCLUSION ................................ .................... 171 LIST OF REFERENCES ................................ ................................ ............................. 179 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 204

PAGE 10

10 LIST OF TABLES Table page 3 1 Effect of cyclic status and follicular wave at insemination on fertility responses of dairy cows Experiment 1 ................................ ............................ 98 3 2 Effect of follicular wave at insemination on ovarian responses of cyclic dairy cows during the Ovsynch protocol Experiment 2 ................................ ............. 99 3 3 Effect of follicular wave at insemination following the Ovsynch protocol on fertility responses of cyclic dair y cows Experiment 2 ................................ ..... 100 4 1 Primer sequences used for quantitative real time reverse transcription PCR ... 125 4 2 Effect of follicular wave and concentration of progesterone during the development of the ovulatory follicle on ovarian responses and hormonal pro file ................................ ................................ ................................ ................ 126 4 3 Effect of follicular wave and concentration of progesterone during the development of the ovulatory follicle on conceptus development and production of IFN ................................ ................................ ........................... 127 5 1 Effect of moment of administration of the final GnRH relative to timed AI on fertility responses of dairy cows Experiment 1 ................................ ............... 165 5 2 Effect of supplementation with progesterone during the resynchronization protocol on fertility responses of dairy cows Experiment 2 ............................ 166 5 3 Effect of supplementation with progesterone during the resyn chronization protocol on fertility responses of dairy cows Experiment 2 ............................ 167

PAGE 11

11 LIST OF FIGURES Figure page 3 1 Diagram of activities during experiment 2 ................................ ......................... 101 4 1 Diagram of activities during experiment ................................ ............................ 128 4 2 Receiver operating characteristic curve representing the accuracy with which concentrations of IFN predicted the presence of a conceptus on day 17 after insemination ................................ ........................... 129 4 3 Concentrations of progesterone in plasma during treatm ent period in cows according to follicular wave and concentration of progesterone during follicle growth ................................ ................................ ................................ ............... 130 4 4 Concentrations o f estradiol in plasma of cows according to follicular wave and concentration of pr ogesterone during follicle grow th ................................ 131 4 5 Concentrations of progesterone in plasma after the final GnRH in cows according to follicular wave and concentration of pr ogesterone during follicle grow th ................................ ................................ ................................ ............... 132 4 6 Fold change expression from qRT PCR analysis for steroidogenic acute regulatory protein, cytochrome P 450 side h 5 4 isomerase according to follicular wave and concentrat ion of progesterone during follicle growrth ................................ 133 4 7 Fold change expression from qRT PCR analysis for vascular endothelial growth factor fms like tyrosine kinase receptor 1 and kinase insert domain containing region according to follicular wave and concentration of pr ogesterone during follicle grow th ................................ ................................ ... 134 4 8 Correlation between conceptus length and concentration of interferon tau in uterine flush samples and total amount of interferon tau recovered ................. 136 4 9 Concentration and total amount of interferon tau recovered by post mortem flushing of the uterus on d ay 17 of gestation. ................................ ................... 138 4 10 Relative e xpression of interferon tau in conceptuses on day 17 of gestation. .. 139 4 11 Correlation between conceptus length and expression of interferon tau in conceptuses on day 17 of gestation ................................ ................................ 141 4 12 Concentrations of progesterone in plasma of cows that had small or large conceptuses on day 17 of gestation ................................ ................................ 142

PAGE 12

12 4 13 Concentrations of progesterone in plasma of cows that had small or large conceptuses on day 17 of gestation ................................ ................................ 143 5 1 Diagram of activities during experiment 1 ................................ ......................... 168 5 2 Diagram of activities during experiment 2 ................................ ......................... 169 5 3 Pregnancy per AI according to presence of CL at the first GnRH of the resynchronization protocol E experiment 2 ................................ ..................... 170

PAGE 13

13 LIST OF ABBREVIATION S HSD 3 beta 5 4 isomerase AI artificial insemination ANOVA analysis of variance AOR adjusted odds ratio Bax B cell lymphoma 2 associated X protein Bcl 2 B cell lymphoma 2 BCS body condition score bFGF basic fibroblast growth factor bTP 1 bovine trophoblast protein 1 BMP bone morphogenic protein cAMP cyclic adenosine monophosphate cDNA complementary d eoxyribonucleic acid CI confidence interval CIDR controlled internal drug release CL corpora lutea / corpus luteum COX cyclooxygenase Ct comparative threshold CV coefficient of variation DAG 1,2 diacylglycerol DIM days in milk DMEM DNA d eoxyribonucleic acid DPBS EDTA e thylenediaminetetraacetic acid

PAGE 14

14 EGA embryonic genome activation ELISA e nzyme linked immunosorbent assay FGF fibroblast growth factor FSH follicle stimulating hormone FW first follicular wa ve of the estrous cycle GDF growth differentiating factor GH growth hormone GlyCAM 1 g lycosy lated cell adhesion molecule 1 GnRH gonadotropin releasing hormone GnRH1 the first injection of gonadotropin releasing hormone of a protocol for synchronization of the estrous cycle and timed artificial insemination hCG human chorionic gonadotropin HDL high density lipoprotein HGF hepatocyte growth factor ICM inner cell mass IGF insulin like growth factor IGFBP insulin like growt h factor binding proteins INF interferon tau IP 3 inositol 1,4,5 trisphosphate IU international units LDL low density lipoprotein LH luteinizing hormone LU l aboratory units of antiviral activity mRNA messenger ribonucleic acid MSY2 multifunctional Y box protein 2

PAGE 15

15 MDBK Madin Darby Bovine Kidney mTOR mammalian target of rapamycin OCT optimal cutting temperature oTP 1 ovine trophoblast protein 1 P450arom cytochrome P450 aromatase P450c17 cytochrome P450 17 alpha hydroxylase P450scc cytochrome P450 side chain cleavage P/AI pregnancy per artificial insemination PAPP A plasma associated pregnancy protein A PGF prostaglandin F2 alpha PGFM 15 keto 13,14 dihydro prostaglandin F2 alpha PKA protein kinase A PKC protein kinase C PLC phospholipase C qRT PCR quantitative real time reverse transcription polymerase chain reaction RIA radioimmunoassay RNA ribonucleic acid ROC r eceiver operating characteristic RT reverse transcriptase SPP1 secreted phosphoprotein 1 or oestopontin StAR steroidogenic acute regulator y protein SW second follicular wave of the estrous cycle TBP TATA box binding protein TMR total mixed ration VEGF vascular endothelial growth factor

PAGE 16

16 VSV vesicular stomatitis virus VWP voluntary waiting period

PAGE 17

17 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science MANIPULATING THE OVU LATORY FOLLICLE: IM PACTS ON REPRODUCTIV E TISSUE GENE EXPRESSI ON AND FERTILITY OF DAIRY C OWS By Rafael Sisconeto Bisinotto December 2010 Chair: Jos Eduardo Portela Santos Major: Animal Molecular and Cel l ular Biology Experiments were conducted to further elucidate the effects of the environment on which the ovulatory fol licle develops and its relationship with the reduc tion of fertility observed in anovular dairy cows, and to evaluate alternative management programs that incorporate this knowledge to improve reproductive performance of dairy cows In the first study, data from 5,607 lactating cows enrolled in synchronization programs for artificial insemination ( AI ) were evaluated Cows had blood analyzed for progesterone 7 to 14 d ays apart, with the second sample collected on the day of the first injection of gonadotropin releasing hormone ( GnRH1 ) Cows were classified as samples were < 1.0 ng/mL. Cyclic cow s were categorized as low ( CLOW ; < 1.0 ng/mL) or high ( CHIGH ; 0 ng/mL) based on progesterone concentration at GnRH1, which would result in ovulation of the dominant follicle of the first ( FW ) and second ( SW ) follicular wave respectively, at AI. P regnancy per AI ( P/AI ) on d ay 30 after AI was greater for CHIGH than an ovular and CLOW cows (43.0 vs. 29.7 vs. 31.3%, respectively). Short inter AI intervals differed among groups and were 7.1, 11.9, and 15.7% for CHIGH, anovular and CLOW, respectively. Pregnancy loss differed only

PAGE 18

18 between anovular and CLOW (10.0 vs. 15.0%), and it was intermediate for CHIGH (13.5%). In a second experiment, 220 cyclic Holstein cows received 2 injections of prostaglandin ( PG ) F administered 14 d ays apart. The Ovsynch protocol (d ay 0 GnRH, d ay 7 PGF d ay 9 GnRH, d ay 9.5 timed AI) was initiated either 3 or 10 d ays after the second PGF to result in AI to the FW or SW dominant follicles. Blood was analyzed for progesterone and ovaries were scanned to determine ovulatory responses and follicle diameter. The proportion of cows with proges terone > 1.0 ng/mL at GnRH1 was 9.8 and 97.2% for FW and SW, respectively. Concentrations of progesterone at GnRH1 and PGF injections of the Ovsynch protocol were greater for SW than FW. Pregnancy per AI was greater for SW than FW (41.7 vs. 30.4%) despit e less ovulation to GnRH1 in SW than FW (78.7 vs. 88.3%). Results indicate that follicular wave of the ovulatory follicle and not cyclic status influences fertility of dairy cows. Objectives of the second study were to investigate 2 intervals from inductio n of ovulation to AI in synchronization programs, and the effect of supplemental progesterone for resynchronization on fertility of lactating dairy cows subjected to a 5 d ay timed AI program. In experiment 1, 1,227 Holstein cows had their estrous cycle pre synchronized with 2 injections of PGF at 46 and 60 days in milk ( DIM ) T imed AI protocols were initiated with GnRH at 72 DIM, followed by 2 injections of PGF at 77 and 78 DIM and a second injection of GnRH at either 56 ( OVS56 ) or 72 h ours ( COS72 ) after the first PGF of the timed AI protocols. All cows received timed AI at 72 h ours after the first PGF T he proportion of cows detected in estrus at AI was greater for CO S72 than OVS56 (40.6 vs. 32.4%); however, P / AI on day 32 after AI did not differ between OVS56 (46.4%) and COS72 (45.5%). In experiment 2, 675 nonpregnant

PAGE 19

19 Holstein cows had their estrous cycle resynchronized starting at 34 d ays after the first AI. Cows received the OVS56 with ( RCIDR ) or without ( RCON ) supplemental progesterone from GnR H 1 to the first PGF Subsets of cows had their ovaries scanned by ultrasonography at GnRH 1 the first PGF and second GnRH injections. Blood was analyzed for progesterone on the day of AI and 7 d ays later Cows were considered to have a synchronized ov ulation if progesterone was < 1 ng/mL and > 2.26 ng/mL on the day of AI and 7 d ays later, respectively, and if no ovulation was detected between the first PGF and second GnRH injections. C ows supplemented with progesterone had greater P/AI compared with un supplemented cows (51.3 vs. 43.1%). Premature ovulation tended to be greater for RCON than RCIDR cows (7.5 vs. 3.6%), although synchronization of the estrous cycle after timed AI was similar between treatments. Results indicate that t iming of induction o f ovulation with GnRH relative to insemination did not affect P/AI of dairy cows enr olled in a 5 day timed AI program, and that supplementation with progesterone improved P/AI in cows subjected to the 5 d timed AI protocol during resynchronization starting on d ay 34 after the first AI In the third study, the effects of wave of the ovulatory follicle and concentrations of progesterone during follicular growth on reproductive responses of dairy cows were evaluated Non pregnant and non lactating Holstein cow s had their estrous cycle presynchronized with an injection of GnRH and a controlled internal drug release ( CIDR ) insert containing progesterone followed 7 d ays later by CIDR removal and 2 injections of PGF 24 h ours apart. All cows r eceived an injection of GnRH 1 d ay after the second PGF which was the first GnRH of the synchronization protocol (d ay 9 GnRH 1 d ay 2 and d ay 1 PGF d ay 0 GnRH) for cows induced to ovulate a FW

PAGE 20

20 follicle ( FW n = 13) or a FW follicle supplemented wit h progesterone ( FWP4 n = 8). Cows induced to ovulate a SW follicle ( SW n = 12) received the GnRH1 on day 6 of the new estrous cycle Cows in FWP4 received 3 CIDR inserts at 12, 24 and 48 h ours after the GnRH 1 (d ay 9) Inserts were removed at the injecti on of PGF (d ay 2). Cows were inseminated at the final GnRH (d ay 0) and again 16 h ours later. Cows were killed on d ay 17 after the final GnRH. Progesterone concentration during follicular growth was greater for SW, intermediate for FWP4 and lesser for FW Cows in FW ovulated larger follicles, which resulted in larger corpora lutea ( CL ) and greater concentrations of progesterone from d ays 4 to 16 of the estrous cycle after AI The relative mRNA abundance for steroidogenic acute regulatory protein ( StAR ) was greater for FW than for other treatments. Nonetheless, the ratio between circulating progesterone and CL volume was not affected by treatment. A greater proportion of FW cows had a peak concentration of estradiol on the day before the final GnRH in c omparison to other treatments. Maximum concentration of estradiol was greater for FW than for FWP4 and SW. The p roportion of pregnant cows on d ay 17 tended to be less for FW than for FWP4 and SW. The length of conceptuses did not differ among treatments. T here was a trend for SW conceptuses to produce less INF s in the relative abundance of INF ere detected. Ovulation of FW follicles reduced fertility in dairy cows and this negative effect was mediated by suboptimal concentr ations of progesterone during ovulatory follicle growth. Furthermore, luteal function during early gestation and capability of elongated conceptuses to produce IFN FW follicles.

PAGE 21

21 CHAPTER 1 INTRODUCTION Resumption of ovulation postpartum in dairy cows is affected by a multitude of factors, such as health disorders and nutritional status during early lactation (Walsh et al., 2001; Santos et al., 2009). Studies in the US have shown that 24.1% of the lactating dairy cows have not resumed ovulation by 65 days postpartum with within herd prevalence of anovular cows of 18.6 up to 41.2% (Santos et al., 2009). This is particularly relevant because this period coincides with the end of the voluntary waiting period ( VWP ) in most of commercial dairy herds. The negative impact of anovulation on fertility responses is well documented. Anovular cows are less likely to be detected in estrus, which clearly reduces their chance to be inseminated in herds that adopted traditional reproductive management systems. Protocols for synchronization of ovulation and timed artificial insemination ( AI ) allow for the insemination of anovular cows ( Chebel et al., 2006 ); however, independent of the method of insemination, anovular cows have reduced pregnancy per AI ( P/AI ) and are at a greater risk of losing their pregnancies compared with cyclic cows ( Gmen et al ., 2003; Santos et al., 2004c; Santos et al., 2009). It has been suggested that the mechanisms involved with the reduced fertility of anovular cows is the lack of exposure to progesterone in the postpartum period up to the first insemination ( Crowe, 2008 ). Nonetheless, recent studies have suggested that even a short term exposure to reduced concentration of progesterone during the development of the ovulatory follicle is capable of modulating fertility of dairy cows. Induction of low concentrations of pro gesterone during follicular growth altered the morphology of uterine glands on the subsequent cycle (Shaham Albalancy et al., 1997),

PAGE 22

22 enhanced oxytocin induced release of prostaglandin ( PG ) F (Shaham Albalancy et al., 2001; Cerri et al., 2008 a ), and incre ased the proportion of cows with short luteal phase ( Cerri et al., 2008 a ) Similarly, t he first wave ( FW ) dominant follicle grows under lower systemic concentrations of progesterone than the second wave ( SW ) follicle Therefore, it is expected that cows in duced to ovulate the FW dominant follicle would have reduced fertility compared with cows that ovulate SW dominant follicles. The ovulatory response to the first gonadotropin releasing hormone ( GnRH1 ) is high in anovular cows (Gmen et al., 2003) which sy nchronize s the emergence of the FW Therefore, when subjected to GnRH PGF based synchronization programs, anovular cows ovulate the FW at AI Collectively, these observations indicate that the ovulation of a FW follicle at AI might reduce fertility respo nses of dairy cows and it is likely that, follicular wave of the ovulatory follicle and the inherit low concentration of progesterone during the development of the FW dominant follicle are part of the of the mechanisms that lead to poor fertility in anovular cows. S ystematic breeding programs based on protocols for synchronization of ovulation and timed AI ha ve been shown to maximize submission of eligible cows to AI without decreasing P/AI or altering the risk of pregnancy loss ( Pursley et al., 1997b ; Chebel et al., 2006) It has been demonstrated that prolonged periods of follicular dominance reduced embryo quality (Cerri et al., 2009). Accordingly, Santos et al. (2010) found that reducing the interval between the GnRH1 and the injection of PGF fro m 7 to 5 days in a timed AI protocol, thus shortening the period of dominance by 2 days, improved P/AI in lactating dairy cows. Nonetheless, it also reduced ovulatory diameter, estradiol concentrations in plasma and the proportion of cows detected in estru s on the day of AI,

PAGE 23

23 which have been shown to be associated with fertility in previous studies ( Vasconcelos et al., 2001; Lopez et al., 2007 ). In beef cows, restricting follicular dominance was beneficial only when the period of proestrus was extended from 60 to 72 hours (Bridge et al., 2008) Taken together, these results suggest that, in a 5 day timed AI protocol, the ovulatory follicle might need additional time to maturate The administration of the final GnRH 16 hours before AI resulted in the greatest P/AI in a 7 day protocol (Pursley et al., 1998; Brusveen et al., 2008); however, a delay of the ovulatory stimulus might be beneficial in the 5 day protocol. The stage of the estrous cycle on which the synchronization protocol is initiated affects the resp onse to hormonal treatments, overall synchrony and subsequent fertility (Vasconcelos et al., 1999). Programs of presynchronization conveniently allow for the initiation of the timed AI protocol during early diestrus and enhanced P/AI of dairy cows (Moreira et al., 2001 ; El Zarkouny et al., 2004 ). Nevertheless, presynchronization is only suitable for the first AI postpartum because it would delay re insemination if used in subsequent services Supplementation with exogenous progesterone reduc es the pulse fre quency of luteinizing hormone ( LH ) and prevent s ovulation (Rathbone et al., 2001) It also serves to boost concentrations of progesterone in blood of cows with low endogenous concentrations Therefore, it becomes an attractive alternative to improve synchrony of ovulation and to increase progesterone concentrations during development of the ovulatory follicle during resynchronized inseminations Reproductive physiology of dairy cows, aspects of early embryonic development, and current status of programs for synchronization of ovulation and timed AI were reviewed in Chapter 2 Chapters 3 through 5 describe original research on reproductive

PAGE 24

24 biology of dairy cows. The study presented in Chapter 3 describes the effects of cyclic status and wave of the ovulatory follicle on fertility responses of lactating dairy cows. Chapter 4 provides further understanding on the mechanisms associated with luteal function and embryonic development that underlies the changes in fertility observed following the ovul ation of FW and SW dominant follicles in dairy cows. Finally, Chapter 5 describes the effects of timing of AI in relation to induction of ovulation using GnRH on P/AI and risk of pregnancy loss in dairy cows. It also describes the effects of supplemental p rogesterone during resynchronization on subsequent synchrony of the estrous cycle and fertility responses of lactating dairy cows.

PAGE 25

25 CHAPTER 2 LITERATURE REVIEW The E strous C ycle of D airy C ows Early studies on the duration of the estrous cycle in dairy cows reported a modal length of 22 days and that 82.8% of the inter estrus intervals ranged from 17 to 26 days (Olds and Seath, 1951). The use of ultrasonography to access ovarian dynamic has somewhat confirmed previous results. Evaluation of non ins eminated lactating dairy cows resulted in an average length of the estrous cycle, defined as the interval between two consecutives ovulations, of 23 days (Savio et al., 1990; Sartori et al., 2004). The estrous cycle can be divided into four periods, name ly proestrus, estrus, metestrus, and diestrus (Senger, 2003a; Peter et al., 2009). The proestrus initiates with structural and functional regression of the corpora lutea ( CL ) and is characterized by increasing synthesis of estradiol by the pre ovulatory fo llicle (Wettermann et al., 1972). Estradiol concentrations in plasma of lactating dairy cows rise from approximately 2.5 pg/mL on the day of luteolysis to 7.9 pg/mL during estrus (Sartori et al., 2004). The maximal concentration of estradiol preceding ovul ation reported for lactating dairy cows was less than that observed in dairy heifers (9.7 to 11.3 pg/mL; Wettermann et al., 1972; Sartori et al., 2004) or non lactating cows (16.7 pg/mL; De La Sota et al., 1993). Elevated concentrations of estradiol in the absence of progesterone act on the mediobasal hypothalamus to induce sexual behavior (Blache et al., 1991; Allrich, 1994), which determines the end of proestrus and beginning of estrus (Senger, 2003a; Peter et al., 2009). The period of estrus extends from the onset of sexual receptivity to the ovulation of the dominant follicle (Senger, 2003a; Peter et al., 2009). Gonadotropin releas ing

PAGE 26

26 hormone ( GnRH ) is produced by neurons in the arcuate nucleus region of the hypothalamus and by the pre optic chiasmatic a rea. The neurons located in the arcuate nucleus are responsible for the tonic release of GnRH, whereas those in the pre optic chiasmatic area (pre optic nuclei, anterior hypothalamic area, and supra chiamastic nucleus) are responsible for the large surges in GnRH release. During estrus, the elevation in ovarian estrogens induces the pre ovulatory surge of GnRH from the surge center in the hypothalamus. The release of GnRH, in turn, stimulates the pre ovulatory release of luteinizing hormone ( LH ) by the pituitary gland (Hafez et al., 2008). The pre ovulatory surge of LH is detected approximately 2.8 hours after the onset of estrus and is followed by ovulation roughly 22 hours later (Chenault et al., 1974). An abrupt increa se in the circulating concentrations of estradiol (from 6 to 7.4 pg/mL) was observed concurrently with the pre ovulatory surge of LH. After the peak, estradiol declined 50% within the first 5 hours and returned to basal concentrations by 14 hours (Chenault et al., 1974). The characteristics of estrus in dairy cows have been evaluated using HeatWatch a radiotelemetric system for estrous detection (Walker et al., 1996; Xu et al., 1998; Lopez et al., 2002; Dransfield et al., 2008). The average duration of th e estrus was 7.2 hours and it ranged from 3.6 to 9.5 hours, which is slightly shorter than previously reported (10 hours; Chenault et al., 1974). Cows were mounted 8.5 times per period of estrus (4.3 to 11.2 mounts/estrus) and the average duration per moun t was 2.8 seconds (2.4 to 3.4 seconds/mount). It has been demonstrated that duration of estrus is negatively associated with milk yield (Lopez et al., 2004). The average length of estrus of high producing Holstein cows housed in a free stall barn was 8.7 h ours and

PAGE 27

27 hours) than for cows with production below the average (< 39.5 kg/day, 10.9 hours). Proestrus and estrus compose the follicular phase of the estrous cycle, which g enerally ranges from 2 to 5 days (Savio et al., 1990; Sartori et al., 2004) and represent 20% of the duration of the entire estrous cycle (Peter et al., 2009). Longer follicular phases have been reported for cows on which the dominant follicle present on t he day of luteolysis fails to ovulate (Sartori et al., 2004). For those cows, the ovulatory wave emerged after the regression of the CL and the follicular phase length averaged 14 days. Interestingly, cows were detected in estrus in the presence of the ano vulatory follicle, in other words, they displayed estrus but did not ovulate. In contrast to the follicular phase, the luteal phase of the estrous cycle is characterized by the presence of a functional CL. The pre ovulatory surge of LH induces structural a nd functional changes of the granulosa cells of the pre ovulatory follicle called luteinization which support further development after ovulation and formation of the CL The period from ovulation to the presence of a mature CL capable of producing large amounts of progesterone is called metestrus (Peter et al., 2009). The first significant increase in circulating concentrations of progesterone is detected on day 4 after ovulation (Stabenfeldt et al., 1969), an event that terminates the metestrus. During d iestrus, the concentration of progesterone increases rapidly from days 4 (1.5 ng/mL) to 8 of the estrous cycle (5.5 ng/mL; Stabenfeldt et al., 1969). After this point, progesterone concentration increases at a slower rate and reach es its maximum value on d ay 16 of the estrous cycle at approximately 7 ng/mL (ranging from 6.1 to 10.2 ng/mL; Stabenfeldt et al., 1969). These absolute values change considerably with

PAGE 28

28 lactational status and level of milk production because of the increased catabolic rate o f ovaria n steroids in the liver as dry matter intake increases (Sartori et al., 2004). Non pregnant cows undergo spontaneous luteolysis between days 17 and 19 of the estrous cycle in response to the pulsatile release of prostaglandin ( PG ) F by the endometrium (K indahl et al., 1976a; Savio et al., 1990; Sartori et al., 2004). Follicular G rowth and Oocyte D evelopment The development of ovarian follicles in ruminants begins during fetal life and is a multifaceted process controlled at the endocrine, paracrine and au tocrine levels (McNatty et al., 2007). Bovine follicles have been classified according to the stage of development into 6 types, namely primordial (type 1), transitory (type 1+), primary (type 2), small pre antral (type 3), large pre antral (type 4), and s mall antral follicles (type 5; Braw Tal and Yossefi, 1997). Primordial follicles (< 40 m) are composed by the oocyte (29.7 m) surrounded by a single layer of flattened granulosa cells (< 10 cells at the largest cross section). In the transitory stage, mu ltiplying granulosa cells begin to become cuboidal. Primary follicles (40 to 80 m) are composed of an o ocyte (31.1 m) surrounded by 1 or 1.5 layers of cuboidal granulosa cells (10 to 40 cells at the largest cross section). Small pre antral follicles (81 to 130 m) are composed of an oocyte (49.5 m) surrounded by 2 to 3 layers of cuboidal granulosa cells (41 to 100 cells at the largest cross section). Large pre antral follicles (131 to 250 m) are composed of an oocyte (68.6 m) surrounded by 4 to 6 layer s of cuboidal granulosa cells (101 to 250 cells at the largest cross section). Finally, small antral follicles (25 0 to 500 m) are composed of an oocyte (92.9 m) surrounded by more than 6 layers of cuboidal granulosa cells (> 250 cells at the largest cross section) and presence of an antrum The zona pellucida first appears in small pre antral follicles in a sparse fashion,

PAGE 29

29 becoming a complete ring around the oocyte only in large pre antral follicles. A distinguishable theca i nterna layer was present in some of the large pre antral and in all small antral follicles. The first significant change in oocyte diameter was observed in small pre antral type 3 follicles with 41 to 60 granulosa cells in the largest cross section. Expre ssion of several growth and differentiating factors, such as bone morphogenic protein 6 ( BMP 6 ) and growth differentiating factor 9 ( GDF 9 ) can be detected at the primordial stage (McNatty et al., 2007). The underlying mechanism that activates primordial follicles to start developing is not fully understood. Culture of bovine ovarian cortex explants suggested that a paracrine communication with the ovarian stroma is required to prevent activation of primordial follicles and control the pace of follicular d evelopment (Fortune et al., 1998). Nevertheless, results from in vitro studies demonstrated that primordial follicles entered the growing phase without gonadotropic stimulus (Braw Tal and Yossefi, 1997; Fortune et al., 1998), which is in agreement with the absence of receptors for follicle stimulating hormone ( FSH ) and LH in primordial follicles (McNatty et al., 2007). With the advance to the primary stage, the ovine follicle becomes responsive to progestins, estrogens, androgens, and gonadotropins; however an acute control by FSH/LH such that observed in antral follicles is still absent. Furthermore, copious factors involved in the control of follicular growth begin to be synthesized by the oocyte (BMP 6, BMP 15, GDF 9), granulosa (inhibin, follistatin), a nd theca cells ( transforming growth factor 1 and 2, progestins, androgens; McNatty et al., 2007). Interaction between GDF 9 and BMP 15 produced by the oocyte induces cell proliferation and controls responsiveness to gonadotropins in a spatial dependent m anner because cells that diverge to become the cumulus and mural granulosa are

PAGE 30

30 affected differently (McNatty et al., 2007). This interaction is critical for the development of ovarian follicles in ruminants as immunization of ewes against GDF 9 and BMP 15 resulted in impaired ovulation and subsequent luteal function (Juengel et al., 2002). The transition from pre antral to antral stages is characterized by a decline in somatic cell proliferation and enhanced differentiation into cells capable of respond ing to gonadotropins to produce increasing amounts of steroids (Webb and Campbell, 2007). Beginning of antrum formation was observed in follicles with 200 to 500 m of diameter that had at least 250 granulosa cells in the largest cross section, a clearly defi ned theca interna, and an oocyte surrounded by a thick zona pellucida (Turnbull et al., 1977; Braw Tal and Yossefi, 1997). Development of antral follicles in cows occurs in a wave fashion, with the development of 2 to 3 follicular waves per estrous cycle ( Savio et al., 1988; Sirois and Fortune, 1988; Ginther et al., 1989). The emergenc e of follicular waves was detected on days 0.2 and 9.6 relative to previous ovulation in heifers that had 2 follicular waves in an estrous cycle, compared with days 0.5, 9.0 and 16.0 in heifers that had 3 follicular waves (Ginther et al., 1989). The emergence of follicular waves is preceded by a surge of FSH (Adams et al., 1982). Circulating concentrations of FSH began to increase 2 to 2.3 days before follicular wave emergenc e, whereas maximum concentrations were observed between 0.4 and 0.9 days before emergence. The vast majority of recruited follicles will cease growing and become atretic, which allows for the specie specific control of the final number of ovulatory follicl es. In cows, generally only one follicle out of the developing cohort is selected to become dominant over its counterparts. The time of follicular deviation has been defined as the beginning of the difference in growth rates between the future dominant fol licle and its

PAGE 31

31 largest subordinate (Ginther et al., 1996a). In Holstein heifers, deviation occurs, on average, 2.8 days after the emergence of follicular wave, when the future dominant follicle reaches a diameter of 8.5 mm and is 1.3 mm larger than the larg est subordinate follicle The underlying mechanisms that lead to follicular deviation in cows involve a shift in primary gonadotropin dependency from FSH to LH by the dominant follicle, whereas the FSH dependent subordinates are deprived of FSH. In fact, c irculating concentrations of FSH declines as the cohort of selected follicles develops and become basal at the time of deviation (Ginther et al., 1996a). The suppression of FSH is mainly determined by the presence of dominant follicles. Cauterization of th e dominant follicle induced a transient increase in circulating concentrations of FSH (Adams et al., 1992). Conversely, treatment of heifers with proteinaceous fraction of follicular fluid, presumably a source of inhibin, suppressed FSH concentrations duri ng the treatment period (Adams et al. 1992). The inhibition of FSH by the dominant follicle appears to be selective and does not affect LH concentrations (Quirk and Fortune et al., 1986). In spite of a transient increase on the expression of FSH receptors in theca cells on day 4 after emergence, the expression of FSH receptors in granulosa and theca cells of growing follicles was somewhat constant and independent of changes in follicular diameter (Xu et al., 1995). Nevertheless, messenger ribonuc leic acid ( mRNA ) encoding for LH receptors in theca cells increased with follicular size. Expression of LH receptors in granulosa cells was detected only in healthy follicles past the diameter of deviation (Xu et al., 1995a). Furthermore, mRNA expression o f LH receptors in granulosa cells in the largest follicle occurred at a smaller diameter than differences in size or

PAGE 32

32 intrafollicular estradiol concentrations between the largest compared to the second largest follicles (Beg et al., 2001). Changes in the i ntrafollicular insulin like growth factor ( IGF ) system have been suggested to trigger the variations in responsiveness to gonadotropins that lead to morphological and functional de viation. Supplementation with I G F 1 increased proliferation and production o f estradiol by granulosa cell in vitro (Spicer et al., 1993; Gong et al., 1994). The same authors reported that IGF 1 acted in synergy with FSH to enhance steroidogenesis in granulosa cells. The bioavailability of IGF 1 and 2 in vivo is modulated by the p resence of insulin like growth factor binding proteins ( IGFBP ) Accordingly, follicular diameter and steroidogenic activity have been described to be negatively correlated with intrafollicular amounts of IGFBP 2, 4 and 5 in vivo (Echternkamp et al., 1994 ). Moreover, increased amounts of free IGF 1 associated with reduced concentrations of IGFBP were detected in the largest compared to the second largest follicles (Beg et al., 2001). Mihm et al. (2000) used an interesting approach to evaluate changes in in trafollicular factors associated with deviation in heifers. Follicular fluid was collected from the 3 largest follicles approximately 1 day after the emergence of the wave, therefore before deviation. Collection was performed surgically using a very thin n eedle (27 gauge) inserted approximately 2 mm below the interface of the surface of the follicle with the ovary to minimize leakage of intrafollicular fluid after needle withdrawal. The technique associated with the small amount of fluid collected (15 to 20 L) allowed follicular development and deviation following aspiration. The authors reported that, before morphological deviation, the cohort follicle which later became the dominant follicle already had reduced amounts of IGFBP 4 in the follicular

PAGE 33

33 fluid. The control of intrafollicular IGFBP 4 in humans has been associated with the proteolytic activity of plasma associated pregnancy protein A ( PAPP A ) secreted by granulosa cells (Conover et al., 2001). On the day of deviation, the concentration of estradiol in the follicular fluid of the future dominant follicle was slightly, but not significantly greater than those of its largest subordinate (Ginther et al., 1997). Nevertheless, one day after deviation the estradiol concentration in follicular fluid of the dominant follicle was approximately 300 fold greater than that of its largest subordinate. The results from Ginther et al. (1997) agree with the pattern of expression of cytochrome P450 side chain cleavage ( P450scc ) cytochrome P450 17 alpha hydroxylase ( P450c17 ) and cytochrome P450 aromatase ( P450arom ) in bovine follicles around the time of deviation (Xu et al., 1995b). From the emergence of the cohort to just before deviation, no changes in mRNA expression of P450scc and P450c17 were detected, whereas e xpression of P450arom was higher on day 2 after emergence than on day 0. Nonetheless, maximal expression for all 3 enzymes was observed following deviation. During diestrus, the presence of a functional CL and elevated circulating concentrations of progest erone prevent the increase in frequency of LH pulses released by the pituitary and the pre ovulatory surge of gonadotropins. Because of inadequate LH support, the dominant follicle of non ovulatory waves stops growing and undergoes atresia. On day 6 after emergence, expression of P450scc and P450c17 mRNA begins to decline (Xu et al., 1995b). Following the emergence of the second wave, dominant follicles from the first wave were at an advanced stage of atresia. By that time, P450scc and P450arom mRNAs were u ndetectable in granulosa cells, and very low P450scc and P450c17 mRNAs

PAGE 34

34 expression could be detected in theca cells (Xu et al., 1995b). Conversely, the dominant follicle present at the time of luteolysis continues to grow and secrete s increasing amounts of estradiol. In absence of elevated progesterone, follicular estradiol acts in the hypothalamus to induce a pre ovulatory surge of GnRH, followed by a surge of gonadotropins by the pituitary that culminates with ovulation. Formation of the CL, L uteal F unctio n and L uteolysis The CL is a transient gland that remains functional for 17 to 19 days for non pregnant cows with regular estrous cycle (Kindahl et al., 1976a; Savio et al., 1990; Sartori et al., 2004). Its primary function is to synthesize progesterone, w hich is required for adequate control of the estrous cycle, development of the embryo/conceptus and maintenance of gestation. The CL is formed following morphological and functional changes on the remaining cells of the ovulated follicle induced by the pr e ovulatory surge of LH, in a process entitled luteinization. The first event associated with CL formation is the shift from estradiol to progesterone production by luteal cells. Studies on granulosa and theca cells gene expression during the peri ovulator y period and cell culture systems indicate that steroidogenesis is initially inhibited in a coordinated manner. The transport of cholesterol across the outer mitochondrial membrane remains unaffected during the late stages of development of the ovulatory f ollicle based on steroidogenic acute regulatory protein ( StAR ) mRNA abundance (Nimz et al., 2009). The expression of P450scc, 3 beta 5 4 isomerase ( HSD ) P450arom in the granulosa cells, and P450 c HSD in the the ca cells w ere extensively reduced within 18 hours of the pre ovulatory surge of LH (Voss and Fortune, 1993a; Voss and Fortune, 1993b). As a result, concentrations of androstenedione,

PAGE 35

35 testosterone and estradiol in the follicular fluid were reduced between 4 and 10 hours after the pre ovulatory surge of LH (Komar et al., 2001). Accordingly, circulating concentrations of estradiol declined 50% within the first 5 hours of the pre ovulatory surge of LH, and returned to basal values within the next 9 hours (Chena ult et al., HSD, but not P450 c 17 and P450arom, was restored in follicular cells (Voss and Fortune, 1993a; Voss and Fortune, 1993b). These results are consistent with increasing production o f progesterone in vitro by granulosa and theca cells (i.e.: luteinization) between 24 and 72 hours of culture not associated with an increase in androgen production (Voss and Fortune, 1993a; Voss and Fortune, 1993b). The secretory function of the CL does not rely exclusively on the steroidogenic capacity of luteal cells, but also on the amount of steroidogenic tissue and the blood flow through the gland. It has been shown that ovulation of larger follicles results in s ubsequent formation of a larger CL which resulted in greater concentration of progesterone in serum of dairy cows (Vasconcelos et al., 2001), possibly because of increased number of secretory luteal cells. The CL is composed by small and large luteal cells vascular tissue, immune cells and extracellular matrix (Farin et al., 1986). Large and small luteal cells originate from granulosa and theca cells, respectively (Alila and Hansel, 1984) and are responsible for the production of progesterone. In the sheep large luteal cells range from 20 to 31 m in diameter and encompass only 4% of the total number of cells in a CL; however, they represent approximately 25% of the total volume of the gland and are responsible for 80 to 90% of the progesterone production (Fitz et al., 1982; Farin et al., 1986). Small luteal cells (16 to 18 m) represent 19% of

PAGE 36

36 the total number of cells and 18% of the luteal volume. In spite of a greater basal steroidogenic capacity, large luteal cells are not stimulated by LH, whereas the production of progesterone by small luteal c ells increased from 2.3 to 12.4 fold when cells were cultured in the presence of LH (Fitz et al., 1982). The absence of LH induced progesterone production by large luteal cells is not caused by lack of LH recepto rs; however, large luteal cells from bovine CL had less binding sites per unit of area than small luteal cells (Chegini et al., 1991). After ovulation, the remaining follicular tissue is extensively reorganized during CL formation in non primates mammals. Electronic microscopy analysis of the rat CL revealed that membranes and interstitium are restructured so as to minimize transport distances (Dharmarajan et al., 1985). Consequently, approximately 60% of luteal cell surface directly faces a capillary, 37% faces interstitial spaces which probably extended to a capillary surface, and only 3% is in direct contact with a neighboring luteal cell. Another important feature of the developing CL is the fast rate of tissue growth and cellular proliferation that res ults in a 17.5 fold increase in luteal mass within a few days (Farin et al., 1986; Jablonka Shariff et al., 1993). The number of large luteal cells remains somewhat constant throughout the development of the ovine CL; whereas their volume increases 3 fold between days 4 and 16 of the estrous cycle (Farin et al., 1986). During the same period, the total number of fibroblasts, small luteal cells, and endothelial cells increases 2.5, 3, and 6.5 times, respectively (Farin et al., 1986). Exposure to LH after ovu lation is critical for CL development, cellular differentiation, and production of increasing amounts of progesterone in ruminants. Hypophysectomy of ewes on day 5 of the estrous cycle reduced the number of small luteal cells, fibroblasts,

PAGE 37

37 capillary endoth elial cells and pericytes per CL, as well as the diameter of steroidogenic and non steroidogenic cells (Farin et al., 1990a). Consequently, hypophysectomized ewes had a 4 fold decrease in CL weight and content of progesterone per milligram of CL on d ay 12 of the estrous cycle. These changes are associated with reduced HSD (Juengel et al., 1995a; Juengel et al., 1995b). The same authors reported that the parameters mentioned above were either reestablished or improved in hypophysectomized ewes following supplementation with exogenous LH. The treatment of heifers with a GnRH antagonist from days 2 to 7 of the estrous cycle diminished LH pulsatility, reduced luteal function and compromised CL formation (Peter s et al., 1994). This is in agreement with data from in vitro studies on which adding LH to the culture media increased the expression HSD in luteinized cells and the production of progesterone (Voss and Fortune, 1993). The control of an giogenesis and angiolysis is crucial for CL development and maintenance. Nearly 45% of the ovine CL is composed of non steroidogenic tissue (Farin et al., 1986). The establishment of a new vascular network during early CL development involves interaction o f the vascular endothelial growth factor ( VEGF ) and basic fibroblast growth factor ( bFGF ) systems. Intraluteal injection of specific antibodies against VEGF and bFGF during metestrus clearly reduced CL volume and concentrations of progesterone in plasma of Holstein cows (Yamashita et al., 2008). Suppression of bFGF and VEGF were associated with reduction of mRNA expression of angiopietin 1 and 2, respectively. Angiopietin 1 is necessary to maintain and stabilize blood vessels (Yancopoulos et al., 2000). Ne vertheless, stable vessels are unsuitable to

PAGE 38

38 angiogenic sprouting. A n increase in the angiopietin 2: angiopietin 1 ratio destabilizes the vascular structure and, in the presence of angiogenic factor such as VEGF, reverts endothelial tissue into a more plast ic state and allows for vascular network formation (Yancopoulos et al., 2000). Therefore, the balance in the angiopietin system is likely to play an important role in the development of the CL. Surprisingly, PGF produced by the newly formed CL acts as a regulator to enhance luteal growth and progesterone secretion. Infusion of bFGF and VEGF into a microdialysis system increased the production of progesterone and PGF by the early cycle bovine CL (Kobayashi et al., 2001). Furthermore, infusion of PGF in duced a transient increase in the release of progesterone by the early cycle bovine CL, whereas infusion of PGF together with angiotensin 2 induced a sustained increase in progesterone release (Kobayashi et al., 2001). The substrate for luteal synthesis of progesterone is cholesterol, generally obtained from the blood circulation as low density lipoprotein ( LDL ) and high density lipoprotein ( HDL ) or from hydrolysis of cholesterol esters stored in lipid droplets with in the cytoplasm by cholesterol esterase (Caffrey et al., 1979; Niswender et al., 2002). In the bovine, the uptake of cholesterol from the bloodstream is expected to be mainly in the form of HDL. This is because approximately 90% of the pre formed cholesterol circulates into HDL in this species. Once in the cytoplasm, free cholesterol is transported to the mitochondria via sterol binding proteins and cytoskeleton interaction. Cholesterol is then transported from the outer to the inner mitochondrial membrane by StAR. In the mitochondrial matrix, c HSD associated with

PAGE 39

39 the smooth endoplasmic reticulum (Niswender et al., 2002). Continuous support of LH and growth hormone ( GH ) is required for C L maintenance and expression of StAR, HSD in ruminants; however, pulsatile release of LH by the pituitary gland was shown to be unnecessary to preserve progesterone production by fully mature CL in heifers (Peters et al., 1994). Gonadotropin s also control the synthesis of progesterone in an acute manner without affecting gene expression patterns (Niswender et al., 2000). The binding of LH to its receptor in small luteal cells activates adenylate cyclase, leading to increased concentrations of cyclic adenosine monophosphate ( cAMP ) and ultimately activation of protein kinase A ( PKA ) Activation of PKA increases cholesterol esterase activity and the amount of StAR in the phosphorylated form, stimulating the transport of cholesterol to the inner m itochondrial membrane. Progesterone has been shown to stimulate its own synthesis by bovine luteal cells. Treatment of luteal cells with onapristone, a highly specific progesterone inhibitor, reduced in vitro production of progesterone by 35% (Okuda et al., 2004). This reduction might be partially explained by a genomic effect of progesterone. Incubation of bovine luteal cells with progesterone increased the expression of StAR, P450scc and HSD in comparison to the control group, suggest ing that the ablation of this effect could compromise synthesis of progesterone (Rekawiecki et al., 2005). If the cow is not pregnant, the CL must be regressed at the end of the estrous cycle to provide another opportunity for ovulation and conception. Be cause the circulating PGF is extensively degraded after its first passage through the lungs in Guinea pigs, and presumably cows (Piper et al., 1970; Davis et al., 1985), PGF dynamics is assessed by measuring circulating concentrations of its main metab olite

PAGE 40

40 15 keto 13,14 dihydro PGF ( PGFM ; Kindahl et al., 1976b). The process of luteolysis is triggered by the endometrial release of 4 to 5 pulses of PGF within a 2 day interval (Kindahl et al., 1976a). The duration of each pulse, measured as the interv al between two consecutive nadirs, ranges from 6 to 8 hours (Ginther et al., 2010). Low amplitude pulses of PGFM (120 pg/mL) have been shown to occur before a noticeable reduction in circulating concentrations of progesterone (Ginther et al., 2010). During the period of luteal regression, the amplitude of the PGFM pulses decreases from the first (578 pg/mL) to the final pulse (131 pg/mL). Consistent with previous data (Kindahl, et al., 1976a), progesterone concentrations declined after the first pulse of PG F (Ginther et al., 2010). A transient increase on concentrations of progesterone was observed between 1 and 2 hours after the first luteolytic pulse of PGF followed by a constant decrease until basal values (Ginther et al., 2010). It has been suggeste d that the coordinated actions of progesterone, estradiol and oxytocin are responsible for the endometrial synthesis of PGF in ruminants (McCracken et al., 1999). The induction of endometrial synthesis of PGF by oxytocin in the sheep is mediated by an increase in the activity of phospholipase A 2 (Lee and Silvia, 1994). Nevertheless, in vitro treatment of bovine endometrial cells with oxytocin failed to enhance phospholipase A 2 mRNA expression; however, it induced synthesis of PGF associated with great er expression of cyclooxygenase 2 ( COX 2 ; Asselin et al., 1997). Treatment of heifers with oxytocin between days 17 and 19 of the estrous cycle induced an acute peak of PGFM 5 to 15 minutes after the treatment (LaFrance and Goff, 1985). However, a similar response was not observed when treatment was administrated between days 6 and 13 of the estrous cycle (LaFrance and Goff, 1985).

PAGE 41

41 This temporal change in uterine responsiveness to oxytocin is likely to set the proper timing of luteolysis. Endometrial expres sion of oxytocin receptors in the luminal epithelium and superficial glands is low during diestrus (Robinson et al., 2001). Greater abundance of mRNA and protein encoding for oxytocin receptors are detected only after day 16 of the estrous cycle, after dow nregulation of progesterone receptors on day 12 (Robinson et al., 2001). In spite of this temporary inhibition of oxytocin receptors, exposure to progesterone was shown to be needed for of oxytocin induced release of PGF Treatment with oxytocin failed t o increase PGFM concentration in bilaterally ovariectomized heifers if no progesterone priming was provided (LaFrance and Goff, 1988). Interestingly, receptors for oxytocin were present in the uterus of ovariectomized cows that did not respond to an inject ion of oxytocin (Lamming and Mann, 1995). Progesterone has been associated with accumulation of triglycerides into cytoplasmic lipid droplets in endometrial cells of rats (Boshier et al., 1981) In ewes, most of the lipids in the endometrium are present as phospholipid and linoleic and arachidonic acids increase during mid to late luteal phase before luteolysis (Meier et al., 1997). Therefore, exposure to progesterone during diestrus enriches the phospholipid pool of endometrial cells with precursors for pr ostaglandin synthesis possibly to stimulate the luteolytic process. In addition, administration of exogenous progesterone enhanced expression of mRNA encoding for COX 2 in uterine luminal epithelium and superficial glands of sheep (Eggleston et al., 1990; Charpigny et al., 1997). The permissive effect of progesterone on oxytocin induced release of PGF in ovariectomized heifers was enhanced following treatment with estradiol (LaFrance and Goff, 1988). Estradiol enhanced expression of mRNA encoding for COX 2 in the uterus

PAGE 42

42 of ovariectomized sheep, but only after priming with progesterone (Charpigny et al., 1997). Moreover, estradiol stimulated phospholipase A 2 activity in human endometrium (Bonney and Franks, 1987). In fact, a single injection of estradiol o n day 18 of the estrous cycle induced an acute release of PGF beginning from 2 to 3 hours after the treatment (Knickerbocker et al., 1986a). Similar responses were observed in heifers treated with estradiol on days 13 of the estrous cycle, which was also associated with anticipated luteolysis compared with non treated heifers (Thatcher et al., 1986). Conversely, suppression of follicular growth and, consequently, reduction of plasmatic concentrations of estradiol have been shown to delay luteolysis. Treat ment of heifers with follicular fluid free of steroids, a source of inhibin, restrained follicular development and extended luteal lifespan (Salfen et al., 1999). Electrocauterization of all visible follicles and subsequent X irradiation of ovaries either on days 9, 12 or 15 (Villa Godoy et al., 1985) or on day 10 of the estrous cycle (Fogwell et al., 1985) prevented spontaneous regression of the CL, which was associated with inhibition of pulsatile release of PGF (Fogwell et al., 1985). Nevertheless, reg ression of the CL was inhibited only transiently by ablation of ovarian follicles. In Holstein heifers from which occurred during the period of aspiration and preceded t he first significant rise in estradiol concentration (Araujo et al., 2009). In ruminants, uterine PGF is transported to the ovaries through a direct exchange between the uterine vein and the ovarian artery. This countercurrent mechanism was described initially in sheep (McCracken et al., 1971). Later studies used the cow as an animal model and confirmed that intrauterine infusion of PGF

PAGE 43

43 induced an increase in the luteolysin concentration in the ovarian artery that was not associated with an increase in the carotid artery (Hixon and Hansel, 1974). Accordingly, unilateral hysterectomy ipsi lateral to the CL inhibits luteolysis in response to oxytocin in heifers (Ginther et al., 1967). This mechanism is crucial for efficient regression of the CL because of the extensive degradation of PGF in the lungs (Piper et al., 1970). The increase in luteal peripheral blood flow is one of the earliest physiological events observed during the luteolytic cascade in the cow. Using color Doppler ultrasonography, an ac ute increase in luteal blood flow was observed within 30 minutes to 2 hours of the administration of PGF to cows between days 10 and 12 of the estrous cycle (Acosta et al., 2002). This response was followed by a sustained reduction in luteal blood flow, CL volume and circulating concentrations of progesterone. Endothelin 1 has been implicated as a mediator of the early effects of the luteolytic cascade. Bovine endothelial cells have receptors for PGF (Mamluck et al., 1998) and PGF induced synthesis of endothelin 1 has been reported from in vitro and in vivo systems (Girsh et al., 1996a; Ohtani et al., 1998). Furthermore, these changes in CL blood flow result from PGF action in vascular tissue, since endothelin 1 can be produced by endothelial cells o f the bovine CL, but not by luteal cells (Girsh et al., 1996b). Endothelin 1 is a potent vasoconstrictor and may initiate luteolysis by depriving the gland of nutrients, substrates for steroidogenesis, and luteotropic support (Niswender et al., 2002). More over, high affinity binding sites for endothelin 1 are present in large and small luteal cells. Endothelin 1 inhibited basal and LH stimulated production of progesterone in small luteal cells, whereas incubation with a selective inhibitor for endothelin 1 prevented the anti steroidogenic effect of PGF on luteal cells

PAGE 44

44 (Girsh et al., 1996b). Elevated concentrations of endothelin 1 and expression of prepro endothelin 1 were observed in the bovine CL around the time of spontaneous luteolysis and as soon as 2 hours after exogenous treatment with PGF (Girsh et al., 1996b). A positive feedback loop between endothelin 1/angiotensin II and PGF synthesis in the CL has been proposed as one of the mechanisms involved in regression of the CL in cows (Miyamoto et al ., 2009). Angiotensin II also suppressed progesterone secretion stimulated by LH in bovine luteal cells (Stirling et al., 1990). Either mediated by vasoactive factors or via direct action in luteal cells, the administration of PGF was shown to reduce mR NA expression for StAR by 50% within 12 hours and to undetectable concentrations within 24 hours of treatment (Pescador et al., 1996). The same authors reported that the downregulation of P450scc was observed after that of StAR. Prostaglandin F acts in l arge luteal cells by binding to a high affinity specific G protein coupled receptor and inducing activation of membrane bound phospholipase C ( PLC ; Niswender et al., 2002). Phospholipase C catalyzes the hydrolysis of phosphatidylinositol 4,5 bisphosphate t o inositol 1,4,5 trisphosphate ( IP 3 ) and 1,2 diacylglycerol ( DAG ) stimulating the release of free Ca 2+ from the smooth endoplasmic reticulum into the cytoplasm. Free Ca 2+ and DAG stimulate the activity of Ca 2+ dependent protein kinase C ( PKC ) and Ca 2+ dependent endonucleases, which are expected to reduce StAR activity and stimulate apoptosis (Niswender et al., 2002). In addition, progesterone exerts a protective effect in luteal cells, which might impact CL development and steroidogenesis. Treatment of bovine luteal cells with progesterone stimulated the expression of B cell lymphoma 2 ( Bcl 2 ) mRNA and reduced the ratio of B cell lymphoma 2 associated X protein ( Bax ): Bcl 2 in comparison to untreated cells

PAGE 45

45 (Liszewska et al., 2005), which was shown to red uce cell death in the human CL (Sugino et al., 2000). Conversely, incubation of bovine luteal cells with onapristone enhanced apoptosis through stimulation of Fas antigen and caspase 3 mRNA expression and caspase 3 activation (Okuda et al., 2004). The upre gulation of the caspase apoptotic pathway reduced cell viability to 70% of the control group. Therefore, the acute reduction of luteal progesterone in the mid cycle CL might activate apoptotic pathways (Okuda et al., 2004; Liszewska et al., 2005) that in a ssociation with reduced blood supply, leads to complete regression of the CL. The involvement of vascular responses in the initiation of CL regression might be a component of the inability to induce luteolysis of newly formed CL (Acosta et al., 2002; Santos et al., 2010). In fact, the absence of receptors for PGF or the affinity of those receptors for its ligand does not seem to explain the unresponsiveness of the young CL (Wiltbank et al., 1995). The early CL has a much smaller mass of vascular tiss ue to respond to a luteolytic stimulus (Farin et al., 1986). Accordingly, increase in the mRNA expression for endothelin 1 was observed following treatment of exogenous PGF on day 10, but not on day 4 of the estrous cycle (Levy et al., 2000). Furthermore no changes in blood flow were observed following administration of PGF when cows were treated on day 4 of the estrous cycle (Acosta et al., 2002). It was reported that exogenous PGF stimulated COX 2 luteal mRNA expression on day 11 of the estrous cyc le, whereas it inhibited this response in a day 4 CL (Tsai and Wiltbank, 1998). The lesser production of PGF and endothelin 1 by the newly formed CL could compromise the positive feedback that stimulates luteolysis.

PAGE 46

46 Early Embryogenesis: F rom the Zygote t o S hedding of the Zona P ellucida After the zygote stage, embryos undergo sequential mitotic divisions. The interval between cellular divisions has been determined for bovine embryos using in vitro culture systems and it varies according to the stage of the embryo. The first cleavage occurs from 27 to 32 hours after fertilization (Holm et al., 2002; Lequarre et al., 2003) and i t is followed by two short cell cycles leading to the 4 cell (8.1 hours) and the 8 cell stages (7.1 hours; Holm et al., 2002). Early embryogenesis is mainly controlled by maternal gene expression. In fact, the competent ooplasm was shown to contain the mRNA needed to support embryonic development up to the fourth cell cycle (Plante et al., 1994; Memili and First, 1998). Moreover, it has been suggested that oocytes with a greater mRNA content in the cytoplasm generate embryos that are less likely to express cell death transcripts later i n development and more likely to develop to the blastocyst stage (Meirelles et al., 2004). The process by which the embryo becomes able to synthesize its own mRNA has been named transition from maternal to embryonic control of development or embryonic genome activation ( EGA ). The initial reports on embryonic gene expression stated that bovine embryos are transcriptionally inactive before the fourth cell cycle (i.e.: during the 8 cell stage) and rely exclusively on maternal mRNA and proteins synthesized during oogenesis (Kope ncy, 1989). Recent studies have contested the classic view that EGA occurs only after the 8 cell stage. Incorporation of uridine triphosphate labeled with radioactive sulfur (i.e.: 35 S) was shown to occur in 2 cell embryos and to remain constant until the 8 cell stage, demonstrating active RNA translation during early embryogenesis (Memili et al., 1998). Furthermore, the expression of ribonucleic acid ( RNA ) polymerase II was detected in 2 cell embryos and inhibition of RNA polymerase

PAGE 47

47 II dependent transcript ion during any of the first four cell cycles blocked embryonic development beyond the 16 cell stage (Memili and First, 1998). The classic view that EGA takes place at the 8 cell stage (Kopency, 1989) is somewhat supported by recent data, which shows a shar p increase on embryonic transcription during the 8 cell stage (Memili et al., 1998). Therefore, genome activation in bovine embryos has been described as a gradual process that encompasses a minor EGA between the 1 and 4 cell stages and a major EGA starti ng at the 8 cell stage (Memili and First, 2000). The mechanisms by which the embryonic genome is activated in mammals include depletion of maternal mRNA and acquisition of essential transcription factors (Schier, 2007). Although the maternal mRNA stored i n the oocyte is protected from degradation through the binding of MSY2 a germ cell specific Y box protein (Yu et al., 2004), this protection begins to be removed because of MSY2 phosphor y lation following germinal vesicle breakdown and MSY2 is entirely abs ent as early as the 2 cell stage, which correspond to the EGA in the mouse embryo (Yu et al., 2001). Similar responses were observed in bovine embryos, on which the amount of MSY2 protein decreased beginning at the germinal vesicle breakdown and was reduce d significantly at the 8 cell stage (Vigneault et al., 2009). The unstable maternal mRNA is then largely degraded during this period (Paynton et al., 1988, Wang et al., 2004), including gene products that might interfere with later development (Schier, 200 7). Concomitantly, the amount of TATA box binding protein ( TBP ) begins to increase from the 8 cell through to the blastocyst stages in bovine embryos (Vigneault et al., 2009). Th e TBP is the first component of the pre initiation complex that binds to the T ATA box motif of a typical RNA polymerase II promoter in order to initiate gene transcription (Nelson and Cox,

PAGE 48

48 2008). Another mechanism considered to be responsible for the embryonic genome inactivation before the major EGA is the occurrence of rapid cell cycles lacking G1 and G2 phases (Schier, 2007). In fact, the fourth cell cycle that leads the bovine embryo to the 8 cell stage and to the major EGA is longer (45.1 hours) than the second and third cycles (8.1 and 7.1 hours, respectively; Holm et al., 2002 ). Bovine embryos reach the stage of morula between days 4 and 5 of gestation (Holm et al., 2002), which is characterized by lack of polarization and free movement of molecules across the embryo. Compaction of the morula is the first morphogenetic event of pre implantation development (Watson et al., 2004). Cell to cell contact increases until the individual blastomere outlines disappear. Initial attachment is promoted by heteromeric cadherin based structures, called adherens junctions. E cadherin is a sing le pass transmembrane protein which extra cellular domain interacts with other E cadherins molecules via a Ca 2+ dependent homophilic association and approaches adjacent blastomeres. E catenin, whi catenin and reinforces cell to cell adhesion. Furthermore, activation of embryo compaction coincides with cell apicobasal polarization of blastomeres (Pratt et al., 2002), which is an important st ep on cell differentiation. The process of compaction involving E cadherin has been shown to be crucial for further embryonic development (Kan et al., 2007). Bovine embryos leave the oviduct and reach the uterine horn between days 4 and 7 of gestation. Bla stocyst formation occurs between days 6 and 7 of gestation (Holm et al., 2002; Senger, 2003b). It marks the segregation of the first two cell lineages during

PAGE 49

49 embryogenesis: the inner cell mass ( ICM ) and the trophectoderm (Senger, 2003b). Proper cell differ entiation relies on downregulation of signals for pluripotency on trophectoderm cells, but not in the ICM. The initial differentiation of the trophectoderm depends on the asymmetric positional signals generated following compaction that induces cell polari zation and epithelialization (Yamanaka et al., 2006). Using the mouse embryo as a model, the expression of the transcription factor Cdx2 was detected at the 8 cell stage and its protein was identified in the outer cells of early morula (Strumpf et al., 200 5). Expression of Cdx2 is critical for trophectoderm cell fate specification. In the absence of this transcription factor, such as in Cdx2 / mutant embryos, Oct4, a repressor of the trophectoderm cell fate (Nichols et al., 1998; Niwa et al., 2000) was exp ressed by the trophectoderm (Strumpf et al., 2005). Consequently, Cdx2 / blastocysts failed to maintain their blastocel, did not express specific markers of differentiated trophoblast giant cells such as Hand1 and Pl1 and had greater incidence of program med cell death at the expanded blastocyst stage (Strumpf et al., 2005). Conversely, the expression of Cdx2 has to be restricted to the trophectoderm in order to prevent embryonic stem cells to differentiate into trophectoderm cells (Nichols et al., 1998). In fact, by the expanded blastocyst stage Cdx2 protein is restricted to trophectoderm nuclei (Strumpf et al., 2005). The ICM further differentiates to give rise to epiblast pluripotent cells and cells committed with the primitive endoderm fate (Plusa et al ., 2008). Initially, lineage specific transcription factors for epiblast ( Nanog ; Chambers et al., 2003; Mitsui et al., 2003) and primitive endoderm ( Gata6 ; Fujikura et al., 2002) cell lineages are stochastically expressed among the ICM, often by the same c ell (Plusa et al., 2008). These pathways become mutually inhibitory, which generates exclusive

PAGE 50

50 epiblast and primitive endoderm precursors. This is followed by cell sorting and reallocation involving cell movement, adhesion and apoptosis (Plusa et al., 2008 ). These changes in gene expression are accompanied by morphological alterations of the embryo. Early after embryo compaction, tight junctions begin to be assembled (Eckert and Fleming, 2008). Tight junction formation is affected by cell contact pattern an d is restricted to the outer trophectoderm cells of the bastocyst. Differently from the non compact embryo, the movement of molecules across the embryo is no longer unrestrained. The dependency on Na + /K + ATPase pumps in the basolateral membrane of trophect of the blastocel has been challenged (Watson et al., 2004). The osmotic gradient across the rabbit trophectoderm averages 8 mOsm, demonstrating that the blastocel is near iso osmol ar compared with the culture media (Borland et al., 1977). This defies the main mechanism attributed to ion pumps. In fact, Na + /K + ATPase null mice are able to develop to the blastocyst stage (James et al., 1999). Aquaporins are capable of moving water in presence of low osmotic gradients and have been shown to be present in the trophectoderm and to participate in diffusion processes during blastocel filling (Barcroft et al., 2003). Until the stage of expanded blastocyst, embryonic growth is restricted by the zona pellucida. Bovine embryos hatch from the zona pellucida between days 8 and 9 of gestation (Holm et al. 2002; Senger, 2003 b) primarily because of the physical distention induced by the expanding blastocoel (Coates and Menino, 1994). Results from cinematographic and morphometric analyses of bovine blastocysts cultured in vitro have shown that the expansion preceding hatching c an be either continuous or

PAGE 51

51 discontinuous, but in a pulsatile fashion (Massip et al., 1982). Furthermore, low to moderate pulsatile activity were compatible with normal hatching, whereas high pulse frequency was associated with failure to hatch (Massip et a l., 1982). The involvement of proteases in the process of hatching of the zona pellucida has been discarded based on results of in vitro production of bovine embryos. Bovine embryos produce plasminogen activator, a serine protease (Menino and Williams, 198 7). Moreover, embryos that are able to hatch in vitro produce more plasminogen activator than those that fail to hatch (Kaaekuahiwi and Menino, 1990). Nevertheless, culture of embryos in the presence of a human plasminogen activator inhibitor did not reduc e the proportion of hatched blastocysts, whereas incorporation of ouabain, a Na + /K + ATPase that inhibits blastocelic expansion, impaired hatching in a dose dependent manner (Coates and Menino, 1994). The lack of proteolytic activity involved in hatching of bovine embryos agree with the observation that empty zonae can be recovered from uterine flush, meaning that they were not degraded during hatching (Besenfelder et al., 2001). Elongation of the C onceptus Early after hatching, the bovine embryo remains det ached from the uterus and relies on a synchronous cross talk with the maternal unit during the pre implantation period for further development and maintenance of pregnancy (Spencer et al., 2007). Initially, the blastocyst remains spherical and grows from 1 60 shape changes to ovoid during a transitory phase preceding elongation of the conceptus (i.e.: embryo and extraembryonic membranes). The conceptus b egins to enlongate between days 12 and 14 of gestation and rapidly develops into a filamentous structure that can reach 25 cm within 3 to 5 days (Lucy et al,. 1995). The fast elongation

PAGE 52

52 of the conceptus is critical for maintenance of gestation, since its c apability to produce interferon tau ( IFN ) and prevent the regression of the CL relies on its length between days 17 and 19 of gestation (Robinson et al., 2006). Proper establishment of gestation after hatching from the zona pellucida encompasses embryoni c contact with uterine luminal and glandular epithelium, orientation of the blastocyst, apposition between the trophectoderm and endometrium, extensive elongation, inhibition of CL regression, and adhesion of trophectoderm to uterus (Bazer et al., 2008). T he stimuli and nutritional support for conceptus elongation in ruminants are provided by copious molecules secreted by the endometrial glandular epithelium, collectively referred as to histotroph. The importance of endometrium secretory function has been d emonstrated in sheep using the uterine gland knockout model (Gray et al., 2002). The authors reported that the blastocysts from ewes which uterine glands were absent hatched normally; however they failed to elongate. Seven out of 8 control ewes had filamen tous conceptuses on day 14 of gestation, whereas uterine gland knockout ewes had either no conceptus present (5 of 12), tubular conceptuses (6 of 12), or a fragmented filamentous conceptus (1 of 12). Histotroph secretion has been shown to be stimulated by progesterone. Nevertheless, the expression of progesterone receptors is downregulated in luminal epithelium and superficial glandular epithelium between days 10 and 12 of the estrous cycle in cows (Robinson et al., 2001), which seems contradictory. It has been hypothesized that after day 12 of the estrous cycle, progesterone acts on receptors located in the uterine stroma and the effects on endometrium and conceptus are then mediated by progestamedins such as fibrobastic growth factors ( FGF ) and hepatocyte growth factors

PAGE 53

53 ( HGF ; Bazer et al., 2008). In fact, progesterone receptors are present in the sub epithelial stroma throughout the entire estrous cycle in cows (Robinson et al., 2001). The uterine expression of FGF 2 and FGF 10 in cows and the expression of its receptors in the ovine luminal endometrium and pre attachment bovine embryos have been described (Michael et al., 2006; Satterfield et al., 2008; Cooke et al., 2009). Fibroblastic growth factor 2 has been associated with increase in d eoxyribonucleic a cid ( DNA ) synthesis, and IFN lines (Michael et al., 2006). Conversely, the levels of FGF 2 mRNA were not affected by pregnancy status (Michael et al., 2006), suggesting that a maternal factor other than conceptus derived factors controls uterine FGF expression. The treatment of ewes with progesterone from days 1.5 to 9 of the estrous cycle increased the levels of FGF 10 mRNA in the subepithelial stroma compared with untreated control group. Furthermo re, the administration of progesterone antagonist reduced FGF 10 mRNA abundance on day 12 of the estrous cycle compared with animals treated with progesterone only (Satterfield et al., 2008). Mucin is a large glycosylated protein constituent of the endomet rial glycocalyx which main function is to prevent molecules from attaching to the endometrium. Mucin is locally reduced at implantation sites by the activity of cell surface proteases, which indicates that this process is triggered by the conceptus (Spence r et al., 2004). The exact mechanism responsible for initial adhesion of the trophectoderm to endometrial epithelium in ruminants is no fully understood; however it is likely to be a multifaceted process (Spencer et al., 2004; Bazer et al., 2010). Glycosy l ated cell adhesion molecule 1 ( GlyCAM 1 ) functions as the carbohydrate ligand for L selectin, which has been

PAGE 54

54 shown to mediate adhesion of humans embryos (Genbacev et al., 2003). In non pregnant ewes, GlyCAM 1 expression increases in the endometrial luminal and superficial glandular epithelium between days 1 and 5 of the estrous cycle and declines from day 11 to 15 (Spencer et al., 1999). Conversely, GlyCAM 1 expression increases between days 15 and 19 in pregnant ewes. Furthermore, the reduced amount of immunoreactive GlyCAM 1 measured in uterine flushing samples collected between days 11 and 13 of gestation is largely increased from day 15 to 17 of gestati on. Galectins are proteins with a conserved carbohydrate recognition domain that bind b galactosides, thereby cross linking glycoproteins as well as glycolipid receptors on cell surface. Galectin 15 mRNA was not detected in the endometrium of ewes before d ay 10 of the estrous cycle. Nonetheless, galectin 15 expression increased 13 fold between days 10 and 14. This increase was only transient for non pregnant females, but not for pregnant ewes (Gray et al., 2004). It is interestingly to notice that expressio n of galectin 15 in the endometrium was induced by progesterone and further stimulated by IFN response suitable for the specific control of conceptus elongation (Gray et al., 2004). Integrins are heterodimeric transmembrane glycoprotein receptors that mediate cellular adhesion and motility. Integrins have been suggested to bind extracellular matrix ligands, such as secreted phosphoprotein 1 or oestopontin ( SPP1 ) IGFBP 1, and Galectin 15, to induce reorganization of the cytoskeleton and enhance cell mi gration during i nitial adhesion of the conceptus (Spencer et al., 2004; Bazer et al., 2010). In v 4 5 1 3 5 w ere detected on the apical surfaces of trophectoderm and endometrial luminal epithelium dur ing the peri implantation period in the sheep (Johnson et al., 2001). Furthermore, changes in the

PAGE 55

55 expression of integrins have been linked with infertility in women (Lessey, 1998). Finally, the interaction between integrins, extracellular matrix ligands, a nd contractile actin microfilaments from the cytoskeleton allows for the trophectoderm to respond to internal and external mechanical forces, which might enhance cell migration (Bazer et al., 2010). In face of increasing energetic demands, embryonic energe tic metabolism switches from oxidation of pyruvate to a more complex process that involves anaerobic glycolysis during morula compaction (Thompson et al., 1996). Because elongating conceptuses are incapable of gluconeogenesis, the glucose used by the conce ptus is dependent on the availability of this molecule with in the uterine lumen (Kalhan and Parimi, 2000; Riley and Moley, 2006). Bovine embryos express both facilitative (GLUT1, GLUT3, GLUT8) and sodium dependent glucose transporters (SGLT 1) as early as the 2 cell stage and additional transporters begin to be expressed at the 16 cells stage (GLUT5), blastocel formation (GLUT4) and during elongation (GLUT2; Augustin et al., 2001). Moreover, the expression of additional glucose transporters coincides with t he timing of rises in glucose uptake by the embryo (Rieger et al., 1992; Thompson et al., 1996). Hexokinase catalyzes the phosphorilation of glucose to glucose 6 phosphate and allows the influx of hexoses into the glycolytic pathway. Phosphofruc tokinase ca talyzes the phosphory lation of fructose 6 phosphate to fructose 1,6 bisphosphate and is considered the primary site of control of glycolysis. There are evidences that the expression of these glycolitic enzymes is enhanced as the embryo develops and might b e associated with the elongation process (Lequarre et al., 1997). There are indicatives that the cross talk between the conceptus of ruminants and the maternal unit is

PAGE 56

56 responsible to enhance the transport of glucose into the uterine lumen. Total recoverabl e glucose in the uterine fluid increased as the pregnancy develops and was greater for pregnant compared with cyclic ewes during the period of conceptus elongation (Gao et al., 2009a). Endometrial expression of glucose transporters is stimulated by progest erone and IFN and this effect was abolished after the administration of a progesterone receptor antagonist (Gao et al., 2009b). Accordingly, the increase in uterine levels of glucose was coordinated with the expression of both facilitative (GLUT1 and GL UT4) and sodium dependent (SGLT 1 and SGLT 6) glucose transporters, which was also greater in pregnant compared with cyclic ewes (Gao et al., 2009b). Conceptually, this remarkable mechanism supports conceptus development in pregnant ewes, but alternatively allows for the non pregnant females to spare glucose. Similarly to the transport of glucose into the uterine lumen, the mechanisms that ensure adequate supply of amino acids to support embryonic development are also modulated by progesterone and IFN ring early pregnancy in ruminants. The uterine concentrations of the vast majority of basic, acid ic and neutral amino acids between days 13 and 16 of the estrous cycle were highly affected by pregnancy (Gao et al., 2009a). Amino acids are required for tiss ue production and can be used as a source of energy by the elongating conceptus. Fluctuations i n arginine availability during early embryogenesis have been evaluated because the effects of this amino acid in cell signaling pathways. No changes in uterine c oncentration of arginine were observed in non pregnant ewes throughout the estrous cycle (Gao et al., 2009a). Conversely, concentrations for pregnant animals increased 138% from day 3 to 14 of gestation. Intrauterine concentrations of arginine were control led at the transporter level (Gao et

PAGE 57

57 al., 2009c). Accordingly, Na + independent arginine transporter CAT1 (SLC7A1) increase d slightly on days 14 of gestation and markedly increase d on day 20, whereas CAT2 (SLC7A2) increased linearly after day 16 of gestation (Gao et al., 2009c). Abundance of mRNA encoding CAT1 in luminal and glandular endometrium was slightly upregulated following long term exposure to progesterone (1.5 and 1.8 fol d increase, respectively). Furthermore, endometrial CAT2 mRNA expression was 4.1 fold greater in animals primed with progesterone and an additional 1.7 fold increase was observed in animals that also received IFN of the mammalian target of rapamycin ( mTOR ) pathway in ovine trophectoderm cells (Bazer et al., 2010). The mTOR pathway is composed by 2 complexes, the mTORC1 involved in cell proliferation and mRNA translation, and the mTORC2 involved in cytoskeletal alt erations, cell migration and survival. M aternal Recognition of P regnancy Spontaneous regression of the CL between days 17 and 19 of the estrous cycle must be inhibited for successful maintenance of the gestation in cows. It was shown early that the elongat ing conceptus plays a key in the maternal recognition of pregnancy. Removal of embryos from the uterus on day 13 of gestation had no effect on the length of the estrous cycle compared with non inseminated heifers, whereas heifers that kept their embryos un til days 17 or 19 of gestation had the inter estrus interval extended from 21 to 25 and 26 days, respectively (Northey and French, 1980). Furthermore, the same authors reported an extension of luteal lifespan in non inseminated heifers following intrauteri ne infusions with a homogenate prepared from 17 to 18 days old conceptuses. Infusions were administered between days 14 and 18 of the estrous cycle. Knickerbocker et al (1986b) demonstrated that the anti luteolytic

PAGE 58

58 factor secreted by elongating conceptus i s a protein and suggested that it acts to prevent the pulsatile release of PGF by endometrial cells. Helmer et al. (1987) demonstrated that the protein complex secreted by bovine conceptuses cross reacted with antiserum to ovine trophoblast protein 1 ( oT P 1 ) and labeled it as bovine trophoblast protein 1 ( bTP 1 ) Analysis of complementary DNA ( cDNA ) revealed that bTP 1 entire sequence was 85% identical to that of oTP 1 and 79% identical to that of bovine interferon alpha II (Imakawa et al., 1989). Bovine and ovine trophoblast protein 1 were then labeled as IFN Interferon tau prevents CL regression by inhibiting the endometrial release of PGF stimulated by estradiol and oxytocin. Intrauterine infusion of enriched bTP 1 twice daily between days 15 and 2 1 of the estrous cycle abolished pulses of PGF measured in the vena cava and resulted in extension of CL function in Jersey cows (Helmer et al., 1989). After 5 intrauterine infusions of oTP 1 between days 12 and 14 of the estrous cycle, ewes had no incre ase in PGFM concentrations following an injection of estradiol on day 14 of the estrous cycle, whereas concentrations increased from 6 to 10 hours after the injection in controls (Vallet et al., 1988). Similarly, ewes treated with oTP 1 had a smaller incre ase in PGFM after an injection of oxytocin on day 15 of the estrous cycle than did untreated ewes (Vallet et al., 1988). The presence of IFN uterine lumen of non pregnant ewes reduced mRNA expression and, consequently, the abundance of receptors f or estrogen and oxytocin (Spencer and Bazer, 1996; Spencer et al., 1996). The expression and, consequently, production of IFN developmentally regulated in the bovine embryo. Low mRNA expression of IFN

PAGE 59

59 detected as early as the blastocyst stage (Bertolini et al., 2002). The production of IFN by bovine conceptuses increases after day 16 of gestation, reaches a maximum level on day 22 and is no longer present after day 24 (Bartol et al., 1985). Studies that evaluated mRNA express ion of bTP 1 demonstrated an earlier upregulation (day 13 of gestation) and showed that the expression was restricted to the trophectoderm (Farin et al., 1990b). Nonetheless, the massive increase in IFN maternal recognitio n of pregnancy is consider to be a function of extensive elongation of the conceptus and increas e in cell mass capable of producing the protein. Similar gene expression was reported for conceptuses between d 14 and 18 of gestation in spite of increasing am ounts of IFN conceptuses were categorized according to their length into smaller than 5, from 5 to 10, and greater than 10 cm, no difference in mRNA abundance was reported in face of a 500 fold increa se in the amount of IFN Synchronization of E strus and O vulation and T imed AI Reproductive efficiency has a major impact on profitability of high producing dairy herds, with the average value of a pregnancy estimated in $278.00 fo r US farms (De Viries, 2006). The advent of large scale artificial insemination ( AI ) allowed for a faster selection and spreading of superior gene s for selected traits, which largely improved the potential for milk production since the application of AI over 6 decades Nevertheless, implementation of AI generated the need for detection of estrus. Visual detection of standing estrus is challenging and might be poor and inaccurate. Dairy cows remain in estrus for 7.2 hours on average and stand 8.5 when moun ted during this period (Dransfield et al, 1998). Previous studies reported that the efficiency of estrous detection is usually below 50% in dairy herds (Senger, 1994). Furthermore, evaluation

PAGE 60

60 of individual herds revealed that the proportion of cows subject ed to AI without being in estrus ranged from 0 to 60%, and was above 10% in at least 30% of the herds (Reimers et al., 1985; Nebel et al., 1987). This scenario can be worsened by health disorders and poor nutritional status that lead to delayed cyclicity p ostpartum (Walsh et al., 2007; Santos et al., 2009). Therefore, programs for synchronization of estrus and ovulation have been developed to maximize submission to AI after the end of the voluntary waiting period ( VWP ) and improve reproductive performance o f dairy herds. Initial attempts to synchronize the estrus of dairy cows were based on administration of PGF to induce regression of the CL and anticipate the return to estrus (Lauderdale et al., 1974). Nonetheless, the use of PGF to synchronize the ret urn to estrus has little or no effect when administrated during metestrus or to anovular cows (Rowson et al., 1972; Moreira et al., 2001). When 2 injections of PGF are given 10 to 14 days apart, more than 90% of the cycling cows are expected to respond t o the second injection; however, the proportion of cows detected in estrus following the second injection ranged between 50 and 60% (Bruno et al., 2005; Chebel et al., 2006). Furthermore, the interval from PGF administration to the onset of estrus varies according to the phase of the estrous cycle and stage of follicular development. Treatment of dairy heifers with PGF on days 7, 11 and 15 of the estrous cycle resulted in similar proportions of animals displaying estrus (Tanabe and Hann, 1984). Neverthe less, the interval between injection and onset of estrus was shorter (43.9 8.2 hours) for heifers treated on day 7, intermediate (53.0 12.2 hours) for heifers treated on day 15, and longer (71.5 14.3 hours) for heifers treated on day 11. Approximatel y 60% of cows that were synchronized after 2 injections of PGF administ e red 14 days

PAGE 61

61 apart were detected in estrus between 3 and 6 days after the second injection; however, the interval that encompasses all detected estruses ranged from 0 to 13 days after the second injection (Chebel et al., 2006). The variability between days of estrous cycle when animals were treated, as well as the variation within the same day, makes the use of timed AI following administration of PGF highly inefficient. Improved syn chrony of the estrous cycle was obtained when both luteal and follicular development were manipulated. Turnover of follicles can be achieved by treatment with GnRH, which induces an endogenous surge of LH and FSH culminat ing in the ovulation of a dominant follicle and subsequent recruitment of a new cohort of follicles (Fernandes et al., 1978; Macmillan and Thatcher, 1991). The efficacy of GnRH to recruit a new follicular wave depends upon the presence of a dominant follicle in the ovary that is responsive to LH. Follicular deviation, and subsequent acquisition of receptors for LH in granulosa cells, was observed at a diameter of 8.5 mm in Holstein heifers (Ginther et al., 1996a). Nonetheless, consistent ovulatory response to LH was observed only when domina nt follicles reached 10 mm of diameter in Holstein cows (Sartori et al., 2001). It was shown that the treatment of cows with GnRH followed 7 days later by an injection of PGF increased the number of animals synchronized within a 5 day period and also enh anced the precision of synchrony during days 2 and 3 after PGF injection as compared to cows treated with PGF only (Thatcher et al., 1989). The incorporation of a final injection of GnRH to synchronize the ovulation of a competent follicle gave rise to the Ovsynch protocol and allowed for AI at fixed time (Pursley et al., 1995). The protocol consisted of an injection of GnRH followed 7 days later by an injection of PGF A second injection of GnRH was administrated 48 hours

PAGE 62

62 after the PGF and females were inseminated 20 to 24 hours later. Ovulation was detected from 26 to 32 hours after the final GnRH in 38 of 44 animals, and the protocol resulted in acceptable pregnancy per AI ( P/AI ) From the report of the Ovsynch protocol, the impact of timed AI pr ograms on reproductive efficiency of dairy herds has been compared with conventional breeding systems based on estrous detection. Injection of the final GnRH at 24 h after the PGF and timed AI 15 hours later reduced P/AI in heifers compared with AI follo wing estrous detection (25.8 vs. 48.7%; Schmmit et al., 1996). Conversely, P/AI in heifers that received the final GnRH 48 h after the PGF and timed AI 15 hours later was similar to that observed in heifers inseminated in estrus (45.5 vs. 48.0%; Schmmit et al., 1996). Pursley et al. (1997a) evaluated P/AI in lactating dairy cows and heifers subjected to the Ovsynch protocol or to a synchronization program based on PGF Cows in the PGF treatment received as many as 3 injections 14 days apart if signs o f estrus had not been observed. All control cows not detected in estrus after the third injection of PGF received timed AI 72 to 80 hours later. Pregnancies per AI were similar between the two programs. For the lactating cows, the proportion of cows dete cted in estrus after the first 2 injections of PGF averaged 54.0 % following each injection, with an overall 81.8% for the 28 d ay period. Because of the low estrous detection rate in the PGF group, cows enrolled in the Ovsynch protocol experienced grea ter pregnancy rate. In a subsequent study, lactating dairy cows were subjected to either the Ovsynch protocol or AI based on estrous detection with periodic use of PGF (Pursley et al., 1997b). After a non pregnancy diagnosis, cows were re inseminated usi ng the original treatment. Median days postpartum to first AI (54 vs. 83) and days open (99 vs. 118) were reduced

PAGE 63

63 in cows subjected to the Ovsynch protocol compared with cows inseminated following detection of estrus. A meta analysis of the results from ti med AI in contrast to estrous detection programs, however, showed that the pregnancy rate for Ovsynch programs did not differ from that observed for systems based on estrous detection (Rabiee et al., 2005). Nonetheless, positive effects of timed AI compare d with reproductive programs based on detection of estrus were only observed when P/AI was not reduced by timed AI and detection of estrus was deficient (Tenhagen et al., 2004). Synchronization programs have been modified to improve fertility of lactating dairy cows in response to timed AI and to minimize the labor associated with administration of treatments. The timing of induction of ovulation after luteolysis and subsequent interval to AI has been shown to modulate P/AI. Pregnancy per AI was significan tly reduced only when insemination was performed 32 hours after the final GnRH of the Ovsynch protocol (Pursley et al., 1998). Nonetheless, the same authors reported a quadratic effect of the interval between the final GnRH injection and timed AI, and maxi mal P/AI was observed when cows were inseminated at approximately 16 hours after the injection. In order to avoid the handling of cows twice within the same day, the Cosynch protocol was proposed and consisted of the administration of the final GnRH concur rently with the timed AI. Portaluppi and Stevenson (2005) reported increased P/AI and reduced pregnancy loss between day 40 of gestation and term for cows that received the final GnRH and timed AI at 72 hours after PGF compared with cows that received th e final GnRH 48 hours after the PGF and were inseminated 48 or 72 hours later. However, others have reported either similar responses between Ovsynch and

PAGE 64

64 Cosynch protocols (DeJarnette and Marshall, 2003) or a decrease in fertility for cows subjected to C osynch programs (Brusveen et al., 2008). Reduction in the period of follicular dominance was shown to improve embryo quality and subsequent fertility of dairy cows (Bleach et al., 2004; Cerri et al., 2009). An approach to incorporate this knowledge into sy nchronization protocols is to shorten the interval from follicle recruitment to luteal regression. Traditional GnRH/PGF based timed AI programs use 7 days between the first injection of GnRH and the injection of PGF which results in the ovulation of a follicle of approximately 10 days. Shortening the interval between the initial GnRH and the injection of PGF from 7 to 5 days increased P/AI in lactating dairy cows (Santos et al., 2010). This 5 day protocol requires an additional injection of PGF to ensure that a newly formed CL in response to the initial GnRH is fully regressed (Santos et al., 2010). Corpus luteum regression (96.3 vs. 91.5 %) and P/AI (37.9 vs. 30.9 %) were greater for cows subjected to the 5 day Cosynch with 2 injections of PGF co mpared with cows that received the 7 day Cosynch. The stage of the estrous cycle at which the synchronization protocol is initiated affects ovarian responses to hormonal treatments, synchrony of ovulation and, consequently, P/AI (Vasconcelos et al., 1999). Initiation of the Ovsynch protocol in various stages of the estrous cycle showed that the interval between days 5 to 9 resulted in greatest fertility. When the protocol was initiated after day 10 of the estrous cycle, a large proportion of cows have spont aneously regressed their CL before the injection of PGF which has been associated with a decline in fertility (Chebel et al., 2006). Furthermore, the ability of the initial GnRH to induce ovulation of the dominant

PAGE 65

65 follicle and synchronize the emergence of a new follicular wave was largely reduced when the injection was administered between days 1 and 4 of the estrous cycle (Vasconcelos et al., 2009; Cerri et al., 2009). Failure to ovulate in response to the initial GnRH was associated with the presence o f a larger follicle at the end of the protocol and with reduced fertility (Vasconcelos et al., 1999; Cerri et al., 2009). When given at random stages of the estrous cycle, it is expected that only 50 to 60% of the treated cows will ovulate in response to G nRH, although only 41.1% ovulated when this concept was tested in postpartum dairy cows (Navanukraw et al., 2004). Therefore, presynchronization protocols have been developed to optimize fertility in response to timed AI programs to assure that the first G nRH is administered at the stages of the estrous cycle with greatest ovulatory response. The use of 2 injections of PGF 14 days apart with 12 days between the second PGF and the initial GnRH of the timed AI protocol enhanced P/AI on day 32 after insemi nation from 36.6% for the control to 48.5% for the treated group (Moreira et al., 2001). This improvement in fertility was associated with an increase in the proportion of cyclic cows that had a functional CL at the initial GnRH and PGF injections of the timed AI protocol. Consequently, presynchronization reduced the proportion of cyclic cows that had sub luteal concentrations of progesterone at either the initial GnRH or PGF injections, two conditions associated with reduced fertility (Vasconcelos et a l., 1999; Chebel et al., 2006). Similarly, El Zarkouny et al. (2004) demonstrated an increased proportion of cows with high progesterone concentrations at initiation of Ovsynch (59 vs. 72%) and greater P/AI (37.5 vs. 46.8%) for cows presynchronized with PG F Because the interval between the second injection of PGF and the timed AI protocol affects the

PAGE 66

66 stage of follicular development at the initial GnRH, different intervals have been evaluated. Although presynchronizing cows 14 days before initiating the Ovsynch improved P/AI compared with no presynchronization (Navanukraw et al., 2004), this interval is not optimal and results in poor ovulation rate to the initial GnRH of the Ovsynch (Chebel et al., 2006; Galvo et al., 2007). Recently, it was demonstrat ed that reducing the interval between presynchronization and timed AI from 14 to 11 days increased ovulatory response to the initial GnRH of the timed AI protocol and improved P/AI (Galvo et al., 2007). The second injection of PGF of presynchronization programs frequently coincides with the end of the VWP, in a way that cows that return to estrus are eligible for breeding. Inseminated cows do not receive any further treatment, whereas those not detected in estrus are enrolled in the timed AI program. Stu dies have shown that P/AI improves as the lactation progresses up to 70 to 90 days postpartum (Pursley et al., 1997a; Tenhagen et al., 2003). Accordingly, cows inseminated on estrus following the presynchronization had less P/AI than those subjected to tim ed AI in some (Bruno et al., 2005) but not all studies (Chebel et al., 2006). On the other hand, insemination of cows i n estrus during presynchronization reduces the interval to first AI and costs associated with hormones and labor. Following a presynchron ization protocol composed by PGF injections on days 35 and 49 postpartum and a controlled internal drug release ( CIDR ) insert containing progesterone from days 42 to 49 postpartum, cows were assigned to either a short or a long VWP (Chebel and Santos, 20 10). Cows in the short VWP were inseminated if observed in estrus from 49 to 62 days postpartum and those not inseminated were submitted to the Ovsynch timed AI protocol beginning at 62 days

PAGE 67

67 postpartum whereas cows assigned to the long VWP were all insemi nated following timed AI at 72 days postpartum. The proportion of short VWP cows inseminated in estrus was 58.9% and the interval from parturition to first AI was shorter for short VWP cows than for long VWP cows (64.7 0.4 vs. 74.2 0.5 days). The P/AI after first insemination postpartum did not differ between short and long VWP on day 32 (33.0 vs. 39.6%, respectively) and 60 after AI (25.3 vs. 31.1%, respectively). Nevertheless, the median days to pregnancy for cows in the short VWP was 125 compared wit h 134.5 days for cows in the long VWP. Collectively, these results suggest that insemination of cows after the second PGF of the presynchronization anticipates pregnancy and might be an alternative to the enrollment of all eligible cows in timed AI progr ams depending upon the costs of hormonal treatments and efficiency of estrous detection. Excluding beneficial effects in uterine health, presynchronization with PGF is only effective in cyclic cows (Moreira et al., 2001); therefore, it is possible that methods that expose cows to GnRH and/or progesterone prior to the first AI postpartum enhance synchrony of the estrous cycle, induce cyclicity in a portion of anovular cows, and benefits fertility. The comparison between conventional PGF based presynchronization protocols (2 injections of PGF 14 days apart and initiation of the timed AI protocol 12 days later) and the insertion of a CIDR for 7 days associated with a n injection of PGF at insert removal 3 days before the initiation of the timed AI protocol showed no differences in P/AI and pregnancy loss (Rutigliano et al., 2008). A novel method of presynchronization has been developed on which an Ovsynch was perform ed before the Ovsynch that synchronizes ovulation for timed AI (Double Ovsynch; Souza et al., 2008). The Double Ovsynch (day 0 GnRH, day 7 PGF day 10

PAGE 68

6 8 GnRH, day 17 GnRH, day 24 PGF followed 56 hours later by an injection of GnRH and timed AI 16 hours later) enhanced P/AI in primiparous (65.2 vs. 45.2%) but not multiparous cows (37.5 vs. 39.3%) in comparison to a conventional Presynch protocol (2 PGF 14 days apart, 12 days before the Ovsynch protocol). In a recent study, similar strategies were eval uated for presynchronization of lactating dairy cows managed under a grazing system (Ribeiro et al., 2009). Cows were either subjected to a Presynch program (2 PGF 14 days apart, 11 days before the synchronization protocol) or to a G6G program ( PGF followed 3 days later by GnRH, 6 days before the synchronization protocol ). The synchronization protocol consisted of an injection of GnRH followed 5 and 6 days later by 2 injections of PGF A second GnRH was administered concurrently with timed AI 3 da ys after the first PGF There were no overall differences in fertility between presynchronization programs. Intravaginal inserts for controlled release of progesterone have been used to improve synchrony of ovulation and P/AI in response to timed AI pro tocols (Lima et al., 2009; Chebel et al., 2010). Progesterone released by the CIDR insert acts to reduce LH pulsatility and to block the pre ovulatory LH surge (Rathbone et al., 2001); therefore, it potentially minimizes the negative effects of spontaneous luteolysis before the injection of PGF and reduces the occurrence of premature ovulations during a timed AI protocol. When cows have their estrous cycle presynchronized before a timed AI program, incorporation of a CIDR insert to the synchronization pro tocol was not beneficial to fertility (El Zarkouny et al., 2004; Galvo et al., 2004). Conversely, when cows were not presynchronized, the incorporation of a CIDR insert to the Ovsynch protocol improved P/AI from 40 to 50% on day 28 after AI, and from 33 t o 38% on days

PAGE 69

69 56 after AI (Stevenson et al., 2006). However, these results are not in agreement with others that reported no benefit for the incorporation of a CIDR insert to the Ovsynch protocol for non presynchronized cows compared with those subjected t o a Presynch program (El Zarkouny et al., 2004). After the first postpartum AI, 55 to 65% of the cows remain nonpregnant and should receive a new insemination soon after the nonpregnancy diagnosis. The initiation of the protocol for resynchronization with GnRH before the pregnancy diagnosis has been shown to anticipate the second AI postpartum without affecting P/AI and pregnancy loss to the first and second AI (Chebel et al., 2003). A single injection of GnRH administrated from 28 to 38 days after previou s AI induced ovulation in 57.1% of the treated cows, whereas the ovulatory response following administration of different doses of human chorionic gonadotropin ( hCG ) ranged from 35.7 to 85.7% (Buttrey et al., 2010). Induction of ovulation with hCG tended t o increase the risk of pregnancy loss relative to previous AI in that particular study. Overall P/AI was low ; however, did not differ between cows that received the resynchronization protocol before the nonpregnancy diagnosis. Chebel et al. (2003) reported that the initiation of the Ovsynch protocol on day 21 after previous AI resulted in acceptable P/AI following the second AI postpartum. Furthermore, P/AI for cows that received the resynchronization protocol beginning 7 days before the nonpregnancy diagno sis was similar to that observed for cows that received the resynchronization protocol beginning on the day of nonpregnancy diagnosis. The stage of the estrous cycle at which the resynchronization protocol is initiated affects ovarian responses to hormonal treatments, synchrony of ovulation and, consequently, P/AI (Vasconcelos et al., 1999; Fricke et al., 2003).

PAGE 70

70 Pregnancy per AI was greater for cows that received the resynchronization protocol beginning on days 26 and 33 after previous AI than for cows that had this interval reduced to 19 days (Fricke et al., 2003). In the same study, no difference was found for P/AI between cows resynchronized on days 26 and 33 after previous AI. Conversely, Sterry et al. (2006) reported an increase in P/AI for cows resynch ronized beginning on day 33 rather than 26 after previous AI. It was shown that the administration of PGF 12 days before the initial GnRH of the resynchronization protocol reduced pregnancy losses between days 31 and 66 after AI, resulting in greater P/A I on day 66 after AI (Silva et al., 2007). Nonetheless, the stage of the estrous cycle at the beginning of resynchronization protocols is generally unknown, mainly because presynchronization would delay subsequent AI and increase overall days to pregnancy. As mentioned earlier, the use of CIDR inserts improved synchrony of ovulation (Lima et al., 2009; Chebel et al., 2010) and P/AI for cows that were not presynchronized before timed AI protocols (Stevenson et al., 2006). Delayed O vulation P ostpartum in Dair y C ows Elevated circulating concentrations of estradiol and progesterone during late gestation suppress the release of gonadotropins by the pituitary gland and development of ovarian follicles (Ginther et al., 1996b). Resumption of FSH release is observed within the first and second week postpartum (Beam and Butler, 1997); however, the pulsatile release of LH to support growth of dominant follicles and ovulation prevent early ovulation postpartum (Roche et al., 1992). The extent of anovulation postpartum is affected by several factors, such as health disorders and negative energy balance (Santos et al., 2009), and might range from 18 to 24 days up to 2 to 3 months. Wiltbank et al. (2002) characterized 3 primary physiological patterns of anovulatory conditions in

PAGE 71

71 dairy cows. The terms inactive or static ovaries have been used to describe cows on which ovarian follicles do not grow larger than the diameter of deviation (e.g.: 8.5 mm ) This condition is observed in cows that undergo exte nsive feed deprivation and severe emaciation. Nonetheless, delayed ovulation postpartum associated with inactive ovaries is rare in US dairy herds. Development of ovarian follicles past the diameter of deviation that fail to ovulate is the most prevalent a novulatory condition of dairy cows (Gmen et al., 2003). It has been associated with reduced production of estradiol by the dominant follicle and increased sensitivity of the hypothalamus to the negative feedback induced by follicular estradiol. Early lact ation cows have high concentrations of GH and low concentrations of IGF 1 because of uncoupling of the somatotropic axis in the liver. As feed intake increases and energy balance improves, the concentrations of insulin in plasma also increases because of t he greater flux of propionate and synthesis of glucose by the liver. The increase in plasma concentrations of insulin as energy balance improves seems to be one of the signals to reestablish the GH receptor population in the liver of cows (Butler et al., 2 003). This increase in GH receptor 1A in the hepatic tissue re couples the GH/IGF 1 axis causing substantial increases in plasma concentrations of IGF 1 and enhancing the steroidogenic capacity of ovarian follicles (Butler et al., 2004). Furthermore, under nutrition has been linked to incapacity of the hypothalamus to sustain high frequency of LH pulses, which would compromise growth and steroidogenesis in the pre ovulatory follicle (Schillo, 1992). Collectively, these conditions lead to reoccurring follicul ar waves that are anovulatory (Beam and Buttler, 1997). Finally, follicular cysts has been defined as structures larger than 18 mm in diameter in the absence of CL that are associated with variable sexual behavior, such

PAGE 72

72 as lack of standing estrus, nymphoma nia, and masculinization. The underlying mechanism involves a lack of estrogen receptor activity in the hypothalamus, which blocks the estradiol positive feedback on GnRH/LH release and subsequent ovulation (Gmen and Wiltbank, 2002; 2005; Nanda et al., 19 91). The prevalence of anovular cows at 65 days postpartum averaged 24.1% in US dairy herds and ranged from 18.6 to 41.2% among herds (Santos et al. 2009). Cows that suffered from calving difficulty, twin births, retained placenta, displacement of abomasu m, and lameness during the first 66 days of lactation were more prone to have delayed resumption of cyclicity (Walsh et al., 2007; Santos et al., 2009). Furthermore, the prevalence anovulation at the end of the VWP was greater for primiparous than multipar ous cows (Santos et al., 2009). In accordance with the underlying mechanisms suggested by Wiltbank et al., (2002), cows with low body condition score ( BCS ) and cows that lost excessive BCS in the first weeks postpartum were at a higher risk of being diagno sed as anovular at the end of the VWP (Santos et al., 2009). It is important to indicate that, within herds, more productive cows are not at a higher risk of having delayed postpartum ovulation. In fact, Santos et al. (2009) observed that lower producing c ows, those with average milk yield of 32.1 kg/d in the fir st 3 months postpartum, were 21 % less likely to have resumed ovulation by 65 days postpartum compared with cows producing 50 kg/d in the same period postpartum. Delayed return of cyclic activity in postpartum dairy cows typically results in impaired reproductive performance of the herd because of depressed estrous expression, reduced P/AI, and increased risk of pregnancy loss (Santos et al., 2009). Anovulation likely has a greater negative impact in herds that perform AI following

PAGE 73

73 estrous detection because anovular cows would be less likely to be inseminated compared with cyclic cows The ovulatory follicle of anovular cows subjected to GnRH/PGF based timed AI programs develops under low concentr ations of progesterone as they are typically in metestrus and early diestrus when ovulation is induced and AI is performed. This is because anovular cows generally have high ovulatory response to an injection of GnRH (Gmen et al., 2003); therefore, a new estrous cycle is initiated following the first injection of GnRH of synchronization protocols. The development of the ovulatory follicle under low concentrations of progesterone influences the composition of the follicular fluid (Cerri et al., 2008a) alte rs subsequent morphology of uterine glands (Shaham Albalancy et al., 1997) increases oxytocin induced release PGF (Shaham Albalancy et al., 2001; Cerri et al., 2008a ) and the incidence of short ened luteal phases (Cerri et al., 2008a) and compromise emb ryo quality (Cerri et al., 2008b; Rivera et al., 2009). Not only anovular cows have reduce P/AI after the first AI postpartum, but they also have increased risk of pregnancy loss (Santos et al., 2004; McDougall et al., 2005), and reduced overall pregnancy rate (Walsh et al., 2007). Overall Hypotheses and Objectives The understanding of the processes that orchestrate the biology of dairy cows is crucial to develop technology to improve the reproductive performance of dairy herds. The oocyte carries the needed to sustain embryonic development up to the 8 cell stage (Memili and First, 2000) and changes in the oocyte can be expressed later during embryonic development. The oocyte develops enclosed into the follicle and participates in a delicate co ncert that responds to endocrine, paracrine and autocrine signals (McNatty et al., 2007). Moreover, modulation of the endocrine milieu on which

PAGE 74

74 the follicle develops ha s been shown to affect not only the oocyte, but also uterine morphology and luteal funct ion in the first weeks after insemination (Shaham Albalancy et al., 1997, 2001; Cerri et al., 2008 a ). M inimizing the proportion of cows that have not resumed ovarian cyclicity by the end of the VWP is critical to fertility ( Santos et al., 2004; Walsh et al ., 2007 ; Santos et al., 2009 ). Meanwhile, the understanding of the mechanisms by which anovulation leads to impaired fertility would provide means to counteract these effects. Particularly, it might lead to development of new technologies that target the c ritical period in which postpartum anovulation depresses fertility. Previous results have suggested that the negative effects of anovulation on fertility of dairy cows subjected to timed AI protocols might be mediated by the ovulation of a first wave ( FW ) follicle that grow s under reduced concentrations of progesterone (Shaham Albalancy et al., 1997, 2001; Gmen et al., 2003; Cerri et al., 2008 a, 2008b ; Denicol et al., 2009; Rivera et al., 2009). Therefore, the hypotheses for the study presented in the Chap ter 3 were that ovulation of FW dominant follicle at AI would result in fertility similar to that of anovular cows and lesser than that of cows that ovulate the second wave ( SW ) dominant follicle. Furthermore, it was hypothesized in Chapter 4 that this reduction in fertility would be mediated by low concentrations of progesterone during follicular growth associated with impaired embryonic development, but not to poor luteal function during early gestation. T he length of follicular dominance a ffects oocyte competence, embryo viability and subsequent fertility of dairy cows (Revah and Butler, 1996; Cerri et al., 2009 ; Bleach et al., 2004 ). Th is knowledge resulted in a 5 day timed AI protocol that enhanced P/AI in lactating dairy cows compared w ith the traditional 7 day program

PAGE 75

75 (Santos et al., 2010). Nevertheless, the reduced ovulatory diameter, estradiol concentrations in plasma and proportion of cows detected in estrus on the day of timed AI (Santos et al., 2010) suggest that the ovulatory fol licle might benefit from a longer proestrus in this type of program (Bridges et al., 2008). It has been demonstrated that, within the 7 day protocol, induction of ovulation with GnRH 16 hours before AI resulted in the greatest P/AI (Pursley et al., 1998; B rusveen et al., 2008). I t was hypothesized in the first experiment presented in Chapter 5 that, in a 5 day timed AI protocol, the delay of the final GnRH to induce ovulation from 16 hours before AI to the time of AI would not alter fertility. Finally, the stage of the estrous cycle on which cows have their ovulation resynchroniz ed is generally unknown, which might reduce response to hormonal treatments and subsequent fertility (Vasconcelos et al., 1999). The hypothesis of the second experiment presented in Chapter 5 was that supplementation with progesterone during resynchronization would improve synchronization of ovulation by minimiz ing the effects of premature luteolysis thereby enhanc ing fertility of lactating dairy cows.

PAGE 76

76 CHAPTER 3 FOLLICULAR WAVE OF THE OVULATORY FOLLIC LE AND NOT CYCLIC ST ATUS INFLUENCES FERTILITY OF DAIRY COWS Two experiments evaluated the influence of follicular wave at artificial insemination ( AI ) on fertility of dairy cows. In experiment 1, data from 5,607 lactating cows enrolled in estrous and ovulation synchronization programs was analyzed for progesterone 7 to 14 d apart, with the second sample collected on the day of the first GnRH ( GnRH1 ) of the synchronization protocol. Cows were classified as cyclic samples and as anovular if both samples were <1 ng/mL. Cyclic cows were categorized as low ( CLOW ; < 1 ng/mL) or high ( CHIGH the day of GnRH1, which would result in o vulation of the dominant follicle of the first ( FW ) and second ( SW ) follicular waves, respectively, at AI. Pregnancy per AI ( P/AI ) was determined 30 and 53 d after AI. In experiment 2, 220 cyclic Holstein cows received 2 injections of prostaglandin ( PG ) F 2 administered 14 d apart. The Ovsynch protocol (d 0 GnRH, d 7 PGF d 9 GnRH, d 9.5 timed AI) was initiated either 3 or 10 d after the second PGF of the presynchronization to result in insemination to the FW or SW dominant follicles. Blood was analyzed for progesterone and ovaries were scanned to determine ovulatory responses and follicle diameter. Pregnancy was determined on d 32 and 67 after timed AI. In experiment 1, P/AI on d 30 was greater for CHIGH cows than for CLOW and anovular cows (43.0, 31.3, and 29.7%, respectively), but because of pregnancy loss, P/AI on d 53 was lowest for anovular c ows. Proportions of cows with short reinsemination intervals differed among groups and were 7.1, 15.7, and 11.9% for CHIGH, CLOW, and anovular cows, respectivel y. Pregnancy loss was greater for anovular cows than for CLOW cows (15.0 vs. 10.0%) and was intermediate for CHIGH cows (13.5%). In experiment 2, 9.8 and

PAGE 77

77 97.2% of the FW Concentrations of progesterone at the GnRH1 and PGF injections of the Ovsynch protocol were greater for SW cows than FW cows. Pregnancy per AI was greater for SW cows than for FW cows (41.7 vs. 30.4%) despite less ovulation to GnRH1 in SW cows than in FW cows (78.7 vs. 88 .4%). Collectively, these data indicate that follicular wave of the ovulatory follicle and not cyclic status caused the greatest reduction in P/AI in dairy cows. Whether the culprit is the follicle itself or the hormonal milieu characteristic of the first follicular wave and the early stage of the estrous cycle remains to be elucidated. Synchronization programs that induced ovulation of the FW follicle at AI reduced P/AI in lactating dairy cows, and ovulation of the FW follicle, or development of the ovulat ory follicle under low progesterone concentrations, or both, might be mechanisms for reduced fertility in anovular cows. Introduction Protocols for synchronization of ovulation and timed AI based on GnRH and PGF maximize the proportion of cows inseminate d early after the end of the voluntary waiting period and result in satisfactory pregnancy per AI when implemented in commercial dairy herds (Chebel et al., 2006). Optimal P/AI in response to the Ovsynch protocol in lactating dairy cows has been associated with successful ovulation to the first GnRH injection and the presence of a functional corpus luteum ( CL ) at the injection of PGF (Vasconcelos et al., 1999; Moreira et al., 2001; Chebel et al., 2006). The proportion of lactating dairy cows that ovulate to the GnRH1 is greater when it is administered in the presence of a dominant follicle, usually between d 5 and 9 and d 17 and 21 of the estrous cycle (Vasconcelos et al., 1999; Bello et al., 2006; Cerri et al., 2009). However, the proportion of cows with concentrations of progesterone <1 ng/mL

PAGE 78

78 at the injection of PGF and the incidence of ovulation before the final GnRH was higher when the Ovsynch protocol was initiated after d 10 of the estrous cycle (Vasconcelos et al., 1999). Inducing ovulation of the dominant follicle of the first follicular wave during early diestrus (i.e.: d 5 to 9 of the estrous cycle) with the GnRH1 results in recruitment of the second follicular wave which will generate the ovulatory follicle at timed AI. In contrast, when GnRH1 i s administered before the acquisition of ovulatory capacity by the FW follicle (d 1 to 4 of the estrous cycle; Sartori et al., 2001) or when ovulation of the SW dominant follicle is induced during proestrus (d 17 to 21 of the estrous cycle), the FW dominan t follicle is induced to ovulate at completion of the timed AI protocol before AI. The FW dominant follicle grows under smaller systemic concentrations of progesterone than the SW follicle, which has been associated with changes in the rate of follicle gro wth and follicular fluid composition (Cerri et al., 2008 a ), increased endometrial synthesis of PGF (Shaham Albalancy et al., 2001), and incidence of short estrous cycles (Cerri et al., 2008 a ). Consequently, cows that received the GnRH1 of the timed AI pr greater P/AI than cows with progesterone <1 ng/ Ml (Cerri et al., 2004; Stevenson et al., 2008). Anovular cows are more likely to ovulate to GnRH1 (Gmen et al., 2003) and, among those that ovulate to GnRH1, the follicl e induced to ovulate at the end of the synchronization protocol is the FW dominant follicle. Therefore, cyclic cows that initiate the timed AI protocol when progesterone is <1 ng/mL and anovular cows are similar in that they both ovulate the FW dominant fo llicle at AI. It is known that anovular cows have reduced reproductive performance (Cerri et al., 2004; Santos et al., 2009). Therefore, if fertility of anovular cows and that of cyclic cows that ovulate the FW

PAGE 79

79 dominant follicle are similar and they are both less than that of cyclic cows ovulating the SW dominant follicle, it is then reasonable to speculate that some of the underlying mechanisms responsible for the reduced P/AI are similar between them, particularly the fact that these cows are induced to ovulate follicles that develop under progesterone concentrations often <1ng/mL. The hypothesis of the present study was that ovulation of the FW dominant follicle at AI reduces fertility in lactating dairy cows compared with ovulation of the SW dominant f ollicle. It was expected that cows ovulating the FW dominant follicle for AI would have reduced P/AI compared with cows induced to ovulate the SW dominant follicle for AI despite cyclic status at the beginning of the timed AI protocol. In experiment 1, the objectives were to determine the associations of cyclic status and follicular wave at AI with P/AI and risk of pregnancy loss in lactating dairy cows; in experiment 2, the objective was to evaluate the effect of follicular wave on ovulatory responses and P/AI of lactating dairy cows. M aterials and M ethods Experiment 1 Data from previously completed experiments (Cerri et al., 2004; Galvo et al., 2004; Santos et al., 2004a,b; Chebel et al., 2006; Juchem, 2007; Hillegass et al., 2008; J. E. P. Santos; unpublished data) were collated into a single data set containing a total of 5,607 cows subjected to presynchronized timed AI or estrous synchronization protocols for first postpartum AI. Only cows that did not receive supplemental progesterone during the timed AI or estrous synchronization protocols were used. Detailed description of animals and management are presented in the published papers. In those studies, the proportion of cows calving in the fall, winter, spring, and

PAGE 80

80 summer were 26.7, 52.2, 13.8, and 7.3%, respectively. Inseminations were performed between the months of September and May to avoid the negative effects of heat stress on fertility. Reproductive m anagement Detailed description of reproductive management is presented in the published p apers. Briefly, the estrous cycles of cows were presynchronized (Moreira et al., 2001) with 2 injections of 25 mg of PGF (Lutalyse, 5 mg/mL of dinoprost tromethamine sterile solution, Pfizer Animal Health, New York, NY) administered 14 d apart, and eithe r 12 or 14 d after the second injection of PGF they were enrolled in an estrous or ovulation synchronization protocol. For both synchronizations, the initial portion of the protocols was similar and consisted of a 100 of GnRH (Cystorelin, 50 g/mL of gonadorelin diacetate tetrahydrate, Merial Ltd., Iselin, NJ) followed 7 d later by an injection of 25 mg of PGF Cows subjected to insemination upon detection of estrus did not receive any further treatment. These cows were observed for signs of estrus once daily, in the morning, by tail chalking using paint sticks (All weather Paintstik, La Co Industries, Chicago, IL), and those observed in estrus based on rubbed chalk were inseminated in the same morning in 3 studies (Cerri et al., 2004; Santos et al., 2004a,b). Cows assigned to timed AI either received an injection of 1 mg of estradiol cypionate (ECP, 2 mg/mL of estradiol cypionate, Pfizer Animal Health) and were inseminated 48 h later (Cerri et al., 2004; Galvo et al., 2004) or received an in jection of GnRH 48 to 56 h after PGF and were timed AI 12 to 24 h later (Santos et al., 2004a; Chebel et al., 2006; Juchem, 2007). In one study (Hillegass et al., 2008), all cows received GnRH concurrent with AI at either 48 or 72 h after PGF to induce ovulation, and half of them were supplemented with estradiol cypionate 24 h after PGF

PAGE 81

81 After the first AI, all cows observed to have the tail head paint removed were reinseminated. Cows with an inter insemination interval between 5 and 17 d after the first AI were considered to have short inter AI interval. Blood s ampling and p rogesterone a nalysis Blood was sampled 7 to 14 d apart for analysis of progesterone. The second sample was collected on the day of the GnRH1. The first sample was collected eithe r 7 (Hillegass et al., 2008), 12 (Santos et al., 2004a; J. E. P. Santos; unpublished data), 13 (Chebel et al., 2006), or 14 d earlier (Cerri et al., 2004; Galvo et al., 2004; Santos et al., 2004b; Juchem, 2007). Approximately 7 mL of blood was collected b y puncture of the median coccygeal vein or artery using evacuated tubes with K 2 e thylenediaminetetraacetic acid ( EDTA ; Vacutainer, Becton Dickinson, Franklin Lakes, NJ). The samples were immediately placed in ice and were later centrifuged at 2,000 g for 15 min for separation until later analysis by e nzyme linked immunosorbent assay ( ELISA ; Cerri et al., 2004; Galvo et al., 2004; Santos et al., 2004a; Chebel et al., 2006; Juchem, 2007; Hillegass et al., 2008; J. E. P. Santos; unpublished data) or radioimmunoassay ( RIA ; Santos et al., 2004b) for progesterone Classification of c ows a ccording to p rogesterone s tatus Cows were classified as having initiated estrous cycles if progesterone ng/mL in at least 1 of the 2 samples, or as anovular when both samples were <1 ng/mL. Cyclic cows were further classified as having progesterone concentration <1 ng/mL on the day of GnRH1 (cyclic low; CLOW ) or as ng/mL on the day of GnRH1 (cyclic high; CHIGH ). Therefore, 3 groups of cows were created: anovular, CLOW, and CHIGH. The rationale for such categories was that

PAGE 82

82 presynchronized cyclic cows that had low concentration of progesterone on the day of GnRH1 were in either proestrus, estrus, or m etestrus and, therefore, when completing the synchronization protocol, were expected to have the FW dominant follicle induced to ovulate. On the other hand, presynchronized cows classified as CHIGH were expected to be in early or mid diestrus and likely ov ulated the SW dominant follicle at the end of synchronization protocol. A small proportion of CHIGH cows could also ovulate the SW dominant follicle to GnRH1 if on d 13 of the estrous cycle, which would result in ovulation of the third wave dominant follicle at AI. Similar to FW cows, anovular cows subjected to the synchronization programs based on GnRH and PGF were expected to be inseminated to an ovulation of the FW dominant follicle. Pregnancy d iagnosis Cows were examined for pregnancy twice. The first diagnosis was performed by ultrasonography between 27 and 32 d after AI (Cerri et al., 2004; Galvo et al., 2004; Santos et al., 2004a,b; Chebel et al., 2006; Juchem, 2007; J. E. P. Santos; unpublished data) or by transrectal palpation at 40 d after AI (Hillegass et al., 2008). Pregnant cows in the first exam were reevaluated for pregnancy at 2 (Galvo et al., 2004; Santos et al., 2004a, b; J. E. P. Santos; unpublished data) or 4 wk later (Cerri et al., 2004; Chebel et al., 2006; Juchem, 2007; Hilleg ass et al., 2008). Throughout the paper, the first diagnosis is designated as d 30 and the second as d 53 after AI because those were the average intervals from AI to pregnancy diagnosis for all studies combined. Pregnancy per AI was calculated as the prop ortion of inseminated cows pregnant at either 30 or 53 d after AI. Pregnancy loss was calculated by dividing the number of cows diagnosed not pregnant on d 53 by the number of cows pregnant on d 30.

PAGE 83

83 Experiment 2 Animals, h ousing, and f eeding Holstein cows (n = 220) from a commercial dairy farm were enrolled in this experiment. Cows were housed in free stall barns and primiparous and multiparous cows were housed separately throughout the experiment. Cows were fed diets formulated by CPM Dairy software (Corne ll Penn Miner version 3.0.8; Miner Institute, Chazy, NY) to meet the metabolizable energy and protein, mineral, and vitamin requirements for lactating Holstein cows weighing 650 kg and producing 45 kg of 3.5% FCM when consuming 26 kg/d of DM (NRC, 2001). A ll diets were mixed as complete rations and offered twice daily at 0600 and 1600 h to allow for 3 to 5% refusals. Ingredients were alfalfa hay, alfalfa silage, corn silage, steam flaked corn, citrus pulp, whole cottonseed, solvent extracted soybean meal, e xpeller treated soybean meal, a protein blend of animal marine byproducts, Ca salts of palm oil, and a mixture of vitamins and minerals. Treatments Weekly, cohorts of 8 to 22 lactating dairy cows at 37 3 days in milk ( DIM ) were blocked by parity (lactati on 1 or lactation >1) and milk yield in the first month postpartum and, within each block, were randomly assigned to 1 of the 2 treatments, insemination to the dominant follicle of the FW (42 primiparous and 70 multiparous) or SW (36 primiparous and 72 mul tiparous). The estrous cycles of cows were presynchronized with 2 subcutaneous injections of 25 mg of PGF as dinoprost tromethamine (5 mL of Lutalyse Sterile Solution, Pfizer Animal Health) given 14 d apart, with the injections given at 44 3 and 58 3 DIM for cows in treatment FW and at 37 3 and 51 3 DIM for cows in treatment SW (Figure 3

PAGE 84

84 1 ). These schemes for presynchronization were designed such that cows in FW and SW would initiate the timed AI protocol 3 and 10 d after the second PGF respectively, and they would be inseminated on the same day postpartum. The Ovsynch protocol was initiated at 61 3 DIM of and consisted of an tetrahydrate, Merial Ltd.) followed 7 d later by a subcutaneous injection of 25 mg of PGF on d 68 3 postpartum and 48 h later by an intramuscular injection GnRH on d 70 3 postpartum, with timed AI performed 12 h after the final GnRH injection of the Ovsynch prot ocol. The same technician inseminated all cows in the experiment with semen from 5 different sires equally allocated across treatments. Ovarian u ltrasonography Transrectal ultrasonography of the ovaries was performed using an ultrasound equipped with a 7.5 MHz linear transducer (Sonovet 2000, Universal Medical System, Bedford Hills, NY) on the day of the second PGF of the presynchronization protocol. Initially, 247 cows were evaluated, but only those with a visible CL > 18 mm in diameter remained in the e xperiment (n = 220 cows) to ensure that all cows were cyclic, which was later confirmed by a plasma 1 ng/mL. The 220 cows that continued the experiment also had their ovaries scanned on the day of GnRH1 and again 7 d later, on th e day of the PGF injection of the Ovsynch protocol. Ovarian maps were drawn and diameter and position of 8 mm in diameter were recorded. 8 mm on the day of GnRH1 injection of the timed AI protocol and with a newly formed CL 7 d later on the ipsilateral ovary were considered to have ovulated in response to GnRH1.

PAGE 85

85 Blood s ampling and p rogesterone a nalysis Approximately 7 mL of blood was collected by puncture of the coccygeal artery or vein using evacuated tubes w ith K 2 EDTA (Vacutainer, Becton Dickinson, Franklin Lakes, NJ). Samples were collected on the day of the second PGF of the presynchronization protocol, on the day of GnRH1, and again on the day of the PGF of the Ovsynch protocol (Figure 3 1). Samples w ere placed in ice upon collection and were transported to the laboratory within 5 h. Blood samples were centrifuged and and later analyzed for progesterone concentration by a validated ELISA (Cerri et al., 2004). In dividual samples were analyzed in duplicate and samples with a coefficient of variation >15% were reanalyzed. Sensitivity of the assay was 0.10 ng/mL and the intra and interassay coefficients of variation were 5.4 and 9.9%, respectively. Body c ondition s core (BSC) and m ilk y ield Cows were scored for body condition (1 = emaciated, 5 = obese) according to Ferguson et al. (1994) on the day of GnRH1. Cows were milked twice daily and milk yield from the first 3 mo postpartum was recorded for individual cows, a nd the average milk production in those months was used in the statistical analysis. Pregnancy d iagnosis and c alculation of r eproductive r esponses Pregnancy was diagnosed by transrectal ultrasonography on d 32 after the timed AI. Presence of an amniotic vesicle with an embryo was used as indicators of pregnancy. Pregnant cows were reexamined for pregnancy 5 wk later, on d 67 of gestation. Pregnancy per AI was calculated by dividing the number of cows diagnosed pregnant at 32 or 67 d after AI by the numbe r of cows receiving AI. The proportion of

PAGE 86

86 cows having experienced pregnancy loss was calculated as the number of cows that lost pregnancy between 32 and 67 d after AI divided by the number of cows diagnosed pregnant on d 32 after AI. Study Design and Stati stical Analyses Experiment 1 Information from individual studies was collated into a single data set for statistical analysis. Data were analyzed by a multivariate logistic regression using the LOGISTIC procedure of SAS (SAS/STAT version 9.2, SAS Institute Inc., Cary, NC). A backward stepwise regression model was used, and explanatory variables were sequentially removed from the model by the Wald statistic criterion if P > 0.10. Pregnancy per AI and incidence of pregnancy loss and short inter AI interval were analyzed with a model that included group (anovular, CLOW, and CHIGH), study (1 to 8), season of calving (fall, winter, spring, and summer), parity (primiparous and multiparous), method of AI (timed AI or synchronized estrus), BCS, milk yield, and int eraction between group and method of AI. Adjusted odds ratio ( AOR ) and 95% confidence interval were generated by the logistic regression. Comparisons were performed among individual groups (anovular vs. CLOW vs. CHIGH), and an orthogonal comparison was per formed to determine the effect of follicular wave (anovular + CLOW vs. CHIGH) on reproductive responses of dairy cows. Experiment 2 Experiment 2 was a completely randomized design with blocks. Based on results of experiment 1, it was expected that a 12 per centage units decrease (e.g., 31 vs. 43%) in P/AI would be observed in cows inseminated when the FW dominant follicle was induced to ovulate compared with cows inseminated following induction of ovulation of

PAGE 87

87 the SW dominant follicle. One hundred eighty cow s were initially planned (90/treatment) to provide enough replicates to detect statistical significance with a 12 percentage unit improvement in tailed test). Because of potential attrition before completion of the study, 220 cows were enrolled. Binary data were analyzed by logistic regression using the LOGISTIC procedure of SAS (SAS Institute Inc.). The models included the effects of treatment, parity, BCS, and milk yield. Additional covariates were included when r elevant. Variables with P > 0.10 were sequentially removed from the model by a backward elimination based on the was forced in the final models. Concentrations of progesterone on the day of GnRH1 and PGF of the Ovsynch protocol were analyzed by analysis of variance ( ANOVA ) using the GLM procedure of SAS. For concentration of progesterone on the day GnRH1, the model included the effects of treatment, parity, BCS, milk yield, and interaction of treatment an d parity. For concentration of progesterone on the day of the PGF of the Ovsynch, the model also included the effects of ovulation to GnRH1 and interaction between treatment and ovulation to GnRH1. Diameter of the largest follicle at PGF injection was analyzed by ANOVA using the GLM procedure of SAS, and the model included the effects of treatment, parity, BCS, milk yield, ovulation to GnRH1, and interactions between treatment and parity and treatment and ovulation to GnRH1. In both experiments, differe nces with P considered significant, and those with 0.05 < P

PAGE 88

88 R esults Experiment 1 The proportion of cows classified as anovular at the beginning of the synchronization protocol was 22.6%. Among the cyclic cows, 14.8 and 85.2% had low and high progesterone at GnRH1, respectively. Ovulation of the SW dominant follicle reduced ( P < 0.0001) incidence of short inter AI interval, and CLOW cows had increased ( P = 0.03) incidence of short inter AI interval compared with anovular cows (Table 3 1). Of the nonpregnant cows, a lesser ( P < 0.0001) proportion had short inter AI interval when inseminated in estrus than when receiving timed AI (4.0 vs. 11.1%; AOR = 0.31; 95% CI = 0.20 to 0.50); however, no interaction ( P = 0.16) between method of insemination and cyclic status or follicular wave was observed for short inter AI interval. The overall P/AI on d 30 after first postpartum AI averaged 38.8% and differed accordi ng to the follicular wave at insemination (Table 3 1). Cows that ovulated the SW dominant follicle had greater ( P < 0.001) P/AI compared with cows that ovulated the FW dominant follicle (43.0 vs. 30.2%; AOR = 4.18; 95% CI = 2.51 to 6.95). In addition, cows ovulating to the dominant follicle of the FW had similar ( P = 0.31) P/AI whether they were previously cyclic or anovular. Pregnancy per AI at d 30 after AI was greater ( P < 0.0001) for cows inseminated in estrus than those receiving timed AI, but no inter action ( P = 0.74) between method of insemination and cyclic status or follicular wave was observed. For anovular cows, P/AI for those inseminated in estrus or receiving timed AI were 38.2 and 26.8% respectively ; for CLOW, they were 41.8 and 28.8%, respect ively; and for CHIGH they were 50.0 and 39.8%, respectively.

PAGE 89

89 Responses at d 53 after AI were similar to those observed on d 30 (Table 3 1). Cows ovulating the SW dominant follicle had greater ( P < 0.001) P/AI compared with cows that ovulated the FW dominan t follicle (36.9 vs. 26.0%; AOR = 2.45; 95% CI = 1.87 to 3.21). Of the cows ovulating the dominant follicle of the FW, those classified as CLOW had greater P/AI (AOR = 1.28; 95% CI = 1.02 to 1.62; P = 0.04) than anovular cows. Cows inseminated in estrus ha d greater ( P < 0.0001) P/AI than those receiving timed AI (42.0 vs. 29.9%; AOR = 1.77; 95% CI = 1.52 to 2.06), but no interaction ( P = 0.44) between method of AI and cyclic status or follicular wave was observed. Pregnancy loss averaged 13.5% and there w as no overall effect ( P = 0.30) of cows ovulating the FW or SW on losses of pregnancy between 30 and 53 d of gestation (Table 3 1 ). Nevertheless, anovular cows had greater (AOR = 2.04; 95% CI = 1.12 to 3.72; P = 0.02) and CHIGH cows tended (AOR = 1.71; 95% CI = 1.00 to 2.93; P = 0.06) to have greater pregnancy loss than CLOW cows. Cows inseminated in estrus had less ( P = 0.05) pregnancy loss than those receiving timed AI (10.4 vs. 15.2%), but no interaction ( P = 0.30) between method of AI and follicular wave or cyclic status was observed. Experiment 2 Milk yield during the first 3 mo postpartum was similar (P = 0.76) for both treatments and averaged 46.9 0.7 kg/d for multiparous cows and 36.3 0.9 kg/d for primiparous cows. Average BCS did not differ ( P = 0.61) between treatments, but primiparous cows (2.96 0.04) had greater ( P = 0.01) BCS compared with multiparous cows (2.83 0.03).

PAGE 90

90 Ovarian r esponses and p rogesterone c oncentration d uring the O vsynch The proportion of cows with high concentration o f progesterone on the day of GnRH1 was greater ( P < 0.001) for SW than for FW cows (Table 3 2). Accordingly, the mean concentration of progesterone on the day of GnRH1 was greater ( P < 0.0001) for SW than for FW cows (Table 3 2). The ovulatory response to GnRH1 was greater ( P = 0.05) for FW cows. On the day of the PGF of the Ovsynch protocol, the proportion of cows with a visible CL tended to be less ( P = 0.10) for SW than for FW cows, although mean concentration of progesterone was greater ( P = 0.002) fo r cows in the SW than for cows in the FW treatment ( Table 3 1 ). The dominant follicle at the PGF of the Ovsynch protocol was larger ( P < 0.001) for FW cows compared to SW cows ( Table 3 1 ). Pregnancy per AI and p regnancy l oss Pregnancy per AI on d 32 and 67 after AI averaged 35.9 and 34.1%, respectively. Cows induced to ovulate to the SW had greater P/AI on d 32 and 67 after AI (Table 3 3). In addition, cows that ovulated to GnRH1 of the Ovsynch protocol across treatments were more likely ( P < 0.01) to be diagnosed pregnant on d 32 (39.7 vs. 16.7%; AOR = 3.37; 95% CI = 1.30 to 8.74) and 67 (38.0 vs. 13.9%; AOR = 4.08; 95% CI = 1.47 to 11.28) after AI than cows that did not ovulate to GnRH1. No interaction between treatment and o vulation to GnRH1 was observed for pregnancy on d 32 ( P = 0.63) and 67 ( P = 0.85). Cows with high progesterone on the day of the PGF of the Ovsynch protocol had greater ( P = 0.02) P/AI on d 32 after insemination than cows with low progesterone (37.4 vs. 4.6%; AOR = 10.91; 95% CI = 1.40 to 84.91) across treatments

PAGE 91

91 Pregnancy loss between d 32 and 67 of gestation was not affected by treatment (Table 3 3). Similarly, ovulation to GnRH1 did not influence ( P = 0.22) the risk of cows losing their pregnancy in the first 67 d of gestation. D iscussion Studies have consistently shown that cows that have not resumed ovulation before the first postpartum AI have reduced P/AI and increased risk of pregnancy loss when inseminated following timed AI protocols or following estrus (Gmen et al., 2003; Santos et al., 2004c; Santos et al., 2009). Although the association between anovulation and impaired reproductive performance is clear, the specific mechanisms by which it reduces fertility remain undefined. Results from experiment 1 showed that P/AI did not differ between anovular cows and cyclic cows that were induced to ovulate the FW dominant follicle before AI. According to Wiltbank et al. (2002), anovular postpartum dairy cows generally have continuous developme nt of follicles that fail to ovulate spontaneously and, in some cases, develop follicular cysts. Nevertheless, the majority of these cows respond to an injection of GnRH through either ovulation or luteinization (Gmen et al., 2003). In that sense, anovula r cows that successfully respond to a GnRH PGF based synchronization protocol (i.e., ovulate to GnRH1, regress the newly formed CL in response to the PGF and ovulate after the final GnRH) are expected to ovulate the FW dominant follicle at AI. Because a large proportion of anovular cows are expected to respond to a GnRH PGF based synchronization protocol (Gmen et al., 2003), results observed in experiment 1 indicate that the ovulation of a FW dominant follicle might be one of the components of the p oor fertility observed in anovular dairy cows.

PAGE 92

92 Cyclic status and follicular wave before AI were characterized in experiment 1 based on the concentration of progesterone in samples collected on the day of GnRH1 and 7 to 14 d earlier. For cyclic cows with p rogesterone it was assumed that these cows were in diestrus, which would likely result in the ovulation of the SW dominant follicle in lactating dairy cows after a GnRH PGF based synchronization protocol. On the other hand, cyclic cows with progesterone <1 ng/mL at GnRH1 would likely be in proestrus, estrus, or metestrus and they would likely ovulate the FW dominant follicle at AI. The exception would be cows in metestrus, around d 3 of the cycle, that might ovulate to GnRH1 and recruit a SW dominant follicle to ovulate at the end of the synchronization program. Nevertheless, this proportion is expected to be very low (Vasconcelos et al., 1999; Cerri et al., 2009) and unlikely to change the interpretation of the results of this study. In fact, when cows were on d 3 of the estrous cycle, ovulation to GnRH1 and recruitment of the SW was observed in only 7.1% of them (Cerri et al., 2009). In addition, the small proportion of cows in diestrus at GnRH1 in FW cows in experiment 2 reinforces the criteria used in the first experiment to stage the estrous cycle and determine the follicular wave at AI. Because cyclic cows initiating the synchronization protocol with progesterone <1 ng/mL in experiment 1 had reduced P/AI, but similar to that of anovular cows, experiment 2 was designed to specifically test the hypothesis that ovulation of the FW dominant follicle impairs P/AI in lactating dairy cows. Results from experiment 2 confirm the findings of experiment 1: P/AI was greater for cows induced to ovulate the SW dominant follicle at the end of the protocol. A major difference between FW and SW dominant follicles is the hormonal milieu on which they develop. The FW dominant follicle emerges early in cycle and grows

PAGE 93

93 under low and increasin g concentrations of progesterone, whereas the SW grows during diestrus concurrent with a mature CL. Progesterone exerts a negative feedback on the pulsatility of luteinizing hormone ( LH ) and the latter stimulates the growth and steroidogenesis of dominant follicles (Evans et al., 1997). In accordance, cows induced to ovulate the FW dominant follicle had lower concentration of progesterone from the GnRH1 to the PGF of the Ovsynch protocol, resulting in a larger preovulatory follicle in experiment 2. Previ ous studies have reported that the ovulation of larger follicles with increased steroidogenic capacity resulted in larger CL, greater concentration of progesterone during the subsequent diestrus, and increased P/AI (Vasconcelos et al., 2001; Lopes et al., 2007). Despite evidence of a greater steroidogenic capacity in luteinized theca cells from FW dominant follicles, no difference in progesterone production was found in luteinized granulosa cells originated from FW and SW dominant follicles or in concentration of progesterone of cows ovulating FW or SW dominant follicles (Wolfenson et al., 1999). Therefore, although the FW ovulatory follicle was larger at AI than the SW follicle, it is unlikely that progesterone concentrations in the subsequent est rous cycle differed in experiment 2. Low concentration of progesterone during the development of the ovulatory follicle reduced the concentration of total Insulin like growth factor 1 ( IGF 1 ) in the follicular fluid of the preovulatory follicle (Cerri et a l., 2008 a ). Insulin like growth factor 1 increases ovarian responsiveness to gonadotropins, steroidogenic capacity, and proliferation of granulosa cells and protects the oocyte and granulosa cells from apoptosis (Quirk et al., 2000; Wasielak and Bogacki, 2 007; Velazquez et al., 2008). The FW dominant follicle develops under lower concentrations of progesterone than the SW

PAGE 94

94 dominant follicle. Low concentrations of progesterone might result in increased LH pulsatility, which can disrupt oocyte quality (Revah a nd Butler, 1996), thereby influencing fertility. Superstimulated lactating dairy cows used for embryo collection had improved embryo quality when follicle stimulating hormone ( FSH ) treatment was initiated at the emergence of the second follicular wave, or at the first follicular wave with supplemental progesterone compared with the first follicular wave without progesterone (Rivera et al., 2009). Denicol et al. (2009) observed a tendency for increased P/AI on d 38 after timed insemination in cows induced t o ovulate the FW dominant follicle supplemented with progesterone during the development of the ovulatory follicle compared with unsupplemented cows. P rogesterone concentrations during the development of the ovulatory follicle were approximately 1 and 3 n g/mL for unsupplemented and supplemented cows, respectively (Denicol et al., 2009). Collectively, these data suggest that induction of ovulation of the FW dominant follicle impairs fertility of dairy cows because of the low concentrations of progesterone during the development of the ovulatory follicle, which might compromise oocyte and embryo quality. Anovulation and consequent long term lack of exposure to progesterone has been associated with shortened luteal lifespan after the first postpartum ovulatio n and reduced P/AI in dairy and beef cattle (Crowe, 2008). Nevertheless, recent data suggest that insufficient concentration of progesterone during the development of the ovulatory follicle and not necessarily throughout the entire postpartum period is ass ociated with poor fertility. In fact, supplementation with progesterone from 20 to 15 d before ovulation was unable to extend the interestrus interval (Kyle et al., 1992). Conversely, the

PAGE 95

95 increase in the concentration of 13,14 dihydro 15 keto PGF ( PGFM ) in response to an injection of oxytocin on d 15 or 16 of the estrous cycle was higher for cyclic cows with low compared with cows with high concentrations of progesterone during the development of the ovulatory follicle (Shaham Albalancy et al., 2001; Cerr i et al., 2008 a ). In fact, cows ovulating the SW dominant follicle that developed under low concentrations of progesterone had increased incidence of short luteal phase (25%) compared with cows developing the ovulatory follicle under high (0%) concentratio ns of progesterone (Cerri et al., 2008 a ). In experiment 1, CLOW cows had increased incidence of short inter AI interval compared with CHIGH cows, suggesting either lack of synchronization or potentially premature luteolysis. The endometrial expression of o xytocin receptors is prevented by the action of progesterone until mid diestrus, at which time progesterone receptors are downregulated in the luminal epithelium and superficial glands and the binding of oxytocin to its receptors triggers the luteolytic cascade (McCracken et al., 1999). It has been proposed that exposure to progesterone before ovulation programs the endometrial dynamics of progesterone and oxytocin receptors in the subsequent cycle and, consequently, has an effect on interestrus interval. Postpartum beef cows supplemented with a progestogen (i.e., norgestomet) during the development of the ovulatory follicle had increased endometrial expression of receptors for progesterone and reduced expression of receptors for oxytocin at d 5 of the sub sequent cycle compared with untreated controls (Zollers et al., 1993). This is likely to be the cause of premature endometrial responsiveness to oxytocin in cows not exposed to progesterone in the preceding estrous cycle (Zollers et al., 1989). S Filho et al. (2009) reported

PAGE 96

96 smaller abundance 5 relative to ovulation in postpartum beef cows pretreated with progesterone, but no changes in expression of progesterone receptor mRNA were found during the same period Therefore, it is plausible that inadequate exposure to progesterone during the development of the ovulatory follicle might enhance the responsiveness of the endometrium to oxytocin and result in premature luteolysis in more cows ovulating the FW compared with the SW dominant follicle. The success of AI programs is related to cyclic status and the stage of the estrous cycle at which synchronization protocols are initiated (Vasconcelos et al., 1999; Santos et al., 2004c; Cerri et al., 2009). Increased ovul ation to GnRH1 combined with the presence of a functional CL at the induced luteolysis and ovulation to the final GnRH were achieved when the protocol was initiated from d 5 to 10 of the estrous cycle (Vasconcelos et al., 1999; Bello et al., 2006) and have been linked with improved embryo quality (Cerri et al., 2009) and increased P/AI (Vasconcelos et al., 1999; Moreira et al., 2001; Chebel et al., 2006). Conversely, in experiment 2 of the present study the proportion of cows that ovulated to GnRH1 was grea ter and the proportion of cows with a functional CL at the PGF of the Ovsynch protocol tended to be greater in FW cows than SW cows; however, these same cows had reduced P/AI on d 32 and 67 after AI. It is known that anovular cows and cows in proestrus are more likely to ovulate to GnRH1 (Gmen et al., 2003), but the growth of the FW dominant follicle under reduced concentrations of progesterone and the induced ovulation of the FW dominant follicle at AI likely negate the benefits of high ovulation to Gn RH1 on P/AI. Because anovular cows subjected to GnRH PGF based synchronization protocols ovulated the

PAGE 97

97 FW dominant follicle at AI, it is suggested that reduced P/AI in these cows is caused by the ovulation of the FW dominant follicle that develops under l ow concentrations of progesterone and not by complete lack of previous exposure to progesterone. C onclusion The follicular wave of the ovulatory follicle affected fertility of dairy cows submitted to synchronization protocols. Pregnancy per AI increased in cows that ovulated the SW dominant follicle compared with cows induced to ovulate the dominant follicle of the FW. Furthermore, the reproductive responses evaluated for cows that ovulated the FW dominant follicle and for anovular cows were similar. Collec tively, these data indicate that follicular wave of the ovulatory follicle and not cyclic status had the greatest effect reducing P/AI of dairy cows. Nevertheless, in experiment 1, both follicle wave and, to a lesser extent, cyclic status influenced P/AI o n d 53 after insemination. Whether the culprit for reduced fertility in cows ovulating the FW dominant follicle is the follicle itself or the hormonal milieu characteristic of the FW and the early stage of the estrous cycle remains to be elucidated. These data indicate that some of the underlying mechanisms by which delayed resumption of ovulation reduces fertility are associated with the ovulation of the FW dominant follicle and the related changes in the hormonal milieu during growth of the ovulatory follicle. Furthermore, they also indicate that synchronization programs for lactating dairy cows should be designed to result in ovulation of the SW dominant follicle at AI or a follicle that develops under high concentrations of progesterone to optimize fertility of lactating dairy cows.

PAGE 98

98 Table 3 1. Effect of cyclic status and follicular wave at insemination on fertility responses of dairy cows Experiment 1 Group 1 Anovular CLOW CHIGH P % (n/n) Short AI interval 2 11.9 (106/891) b 15.7 (59/376) a 7.1 (154/2165) c < 0.001 Pregnant Day 30 29.7 (377/1268) b 31.3 (171/546) b 43.0 (1630/3793) a < 0.001 Day 53 25.1 (318/1265) c 28.1 (153/545) b 36.9 (1392/3773) a < 0.001 Pregnancy loss 15.0 (56/374) a 10.0 (17/170) b,e 13.5 (218/1610) d 0.0 8 a c Means in the same row with different superscripts differ (P < 0.04). d,e Means in the same row with different superscripts tend to differ (P = 0.06). 1 Anovular = cows with progesterone < 1 ng/mL in two sequential blood samples collected 7 to 14 d apart with the second sample collected on the day of the first GnRH of the synchronization protocol. These cows were expected to ovulate the dominant follicle of the first follicular wave; CLOW = cyclic cows but with progesterone < 1 ng/mL on the first GnRH of the synchronization protocol presumed to ovulate a first wave follicle at AI; CHIGH = cyclic cows with progesterone ulate a second wave follicle at AI. 2 Nonpregna nt cows re inseminated between 5 and 17 d after the first AI.

PAGE 99

99 Table 3 2. Effect of follicular wave at insemination on ovarian responses of cyclic dairy cows during the Ovsynch protocol Experiment 2 Follicular wave 1 FW SW AOR 2 95 % CI 3 P % (n/n) Ovulation to GnRH1 4 88.4 (99/112) 78.7 (85/108) 0.47 0.22 1.00 0.05 CL at PGF 96.4 (108/112) 90.7 (98/108) 0.36 0.11 1.20 0.10 GnRH1 9.8 (11/112) 97.2 (105/108) 322 87 999 0.001 PGF 92.0 (103/112) 88.0 (95/108) 0.63 0.26 1.55 0.31 Progesterone, ng/mL GnRH1 0.39 0.08 2.55 0.08 ----0.001 PGF 2.10 0.20 2.92 0.17 ----0.002 Follicle at PGF mm 17.9 0.3 15.7 0.2 ----0.001 1 Follicular wave of the ovulatory follicle at the timed AI. FW = first wave; SW = second wave. 2 AOR = adjusted odds ratio (first wave set as reference for comparison). 3 CI = confidence interval. 4 First GnRH of the Ovsynch protocol.

PAGE 100

100 Table 3 3. Effect of follicular wave at insemination following the Ovsynch protocol on fertility responses of cyclic dairy cows Experiment 2 Follicular wave 1 FW SW AOR 2 95 % CI 3 P Pregnant Day 32 30.4 (34/112) 41.7 (45/108) 1.85 1.04 3.30 0.04 Day 67 27.7 (31/112) 40.7 (44/108) 2.06 1.15 3.70 0.02 Pregnancy loss 8.8 (3/34) 2.2 (1/45) 0.20 0.02 2.18 0.19 1 Follicular wave of the ovulatory follicle at the timed AI. FW = first wave; SW = second wave. 2 AOR = adjusted odds ratio (first wave set as reference for comparison). 3 CI = confidence interval.

PAGE 101

101 Figure 3 1 Diagram of ac tivities during experiment 2. AI = artificial insemination; BCS = body condition score; BS = blood samples for analysis of progesterone concentration; DIM = days in milk; FW = ovulation of the first wave dominant follicle at AI; GnRH = injection of 100 g of gonadorelin diacetate tetrahydrate; PGF = injection of 25 mg of dinoprost as tromethamine salt; SW = ovulation of the first wave dominant follicle at AI; US = ultrasonography of the ovaries.

PAGE 102

102 CHAPTER 4 EFFECT OF WAVE OF TH E OVULATORY FOLLICLE AND CONCENTRATION OF PROGESTERONE DURING FOLLICULAR GROWTH ON LUTEAL FUNCTION AND CONCEPTUS DEVELOPMEN T IN DAIRY COWS Objectives were to determine the effects of wave of the ovulatory follicle and concentrations of progesterone during follicular growth on reproductive responses of dairy cows. Non pregnant and non lactating Holstein cows had their estrous cycle presynchronized with an injection of gonadotropin releasing hormone ( GnRH ) and an intravaginal controlled internal drug release ( CIDR ) insert contai ning progesterone, followed 7 d later by CIDR removal and 2 injections of prostaglandin ( PG ) F 24 h apart. All cows received an injection of GnRH at 1 d after the second PGF which was the first GnRH of the synchronization protocol (d 9 GnRH, d 2 and d GnRH) for cows induced to ovulate a first wave follicle ( FW n = 13) or a first wave follicle supplemented with progesterone ( FWP4 n = 8). Cows induced to ovulate a second wave follicle ( SW n = 12) received the synchronization protocol b eginning 6 d after the previous GnRH injection. Cows in FWP4 received 3 CIDR inserts at 12, 24 and 48 h after the injection of GnRH (d 9) that were removed at the injection of PGF (d 2). Cows were inseminated at the final GnRH (d 0) and again 16 h late r. Cows were killed on d 17 after the final GnRH. Progesterone concentration during follicular growth was greater for SW, intermediate for FWP4 and lesser for FW. Cows in FW ovulated larger follicles, which resulted in larger corpora lutea ( CL ) and greater concentrations of progesterone from d 4 to 16 after the final GnRH. The relative messenger ribonucleic acid ( mRNA ) abundance for steroidogenic acute regulatory protein ( StAR ) in the CL was greater for FW than for other treatments. Nonetheless, the ratio between circulating progesterone and luteal volume was not affected by treatment. A greater proportion of

PAGE 103

103 FW cows had a peak of estradiol on the day before the final GnRH in comparison to other treatments. Maximum concentration of estradiol was greater for FW than for FWP4 and SW. Proportion of pregnant cows on d 17 tended to be less for FW than for FWP4 and SW. The length of conceptuses did not differ among treatments. There was a trend f or SW conceptuses to produce less interferon tau ( INF ); however, no statistical difference in the relative abundance of INF t reatments. Ovulation of first w ave dominant follicles reduced fertility in dairy cows and this negativ e effect was mediated by suboptimal concentrations of progesterone during ovulatory follicle growth. Furthermore, luteal function during early gestation and capability of elongated conceptuses to produce IFN of fertility in cows that ovulated follicles from the first wave. Introduction Programs for synchronization of ovulation and timed artificial insemination ( AI ) have been widely used to improve reproductive efficiency in dairy herds (Chebel et al., 2006). The timing of events within a timed AI protocol affects not only the response to hormonal treatments (Vasconcelos et al., 1999), but also the environment on which the ovulatory follicle grows. Recent studies have shown that ovulation of a FW dominant follicle reduced th e risk of pregnancy compared with the ovulation of a follicle from the SW and that this reduction in fertility is likely to be related with reduced concentrations of progesterone during follicular growth (Denicol et al., 2009; Bisinotto et al., 2010). Ther efore, further understanding of the effects of wave of the ovulatory follicle and progesterone concentration during follicular growth is critical to improve timed AI programs.

PAGE 104

104 During early gestation, the elongating conceptus must be able to produce large a mounts of IFN to inhibit endometrial release of PGF and block luteolysis (Helmer et al., 1989). It has been suggested that a more rapid increase in concentrations of progesterone following AI enhances conceptus development and production of IFN (Mann and Lamming, 2001; Robinson et al., 2006). The diameter of the ovulatory follicle is positively associated with subsequent CL volume and progesterone concentration in plasma (Vasconcelos et al., 2001). Because the dominant follicle of the FW develops conc urrently with the newly formed CL under lesser concentrations of progesterone, it grows at a faster rate and reaches a larger diameter compared with a SW dominant follicle (Sirois and Fortune, 1988). In fact, concentrations of progesterone in plasma follow ing the ovulation of FW follicles were either similar or greater than those observed following the ovulation of SW follicles (Wolfenson et al., 1999). Moreover, in vitro production of p rogesterone by luteinized theca cells was greater in samples derived fr om FW dominant follicles, suggesting that differences in size of the CL might not account for all the fluctuation in progesterone concentration observed in vivo (Wolfenson et al., 1999). Synthesis of progesterone encompasses the transport of cholesterol fr om outer to inner mitochondrial membrane by StAR conversion into pregnenolone by cytochrome P450 side chain cleavage ( P450scc ), and conversion into 5 4 isomerase ( HSD ) associated with the smooth endoplasmic reticulum (Niswender, 2002). Modulation of these enzymatic pathways might be involved in the differential production of progesterone per cell described previously (Wolfenson et al., 1999). Hence, luteal

PAGE 105

105 support duri ng early embryogenesis is unlikely to be the cause of the poor fertility observed in cows that ovulate a FW follicle. Exposure to progesterone during the development of the ovulatory follicle has been implicated in proper timing of the luteolytic cascade. The lack of previous exposure to progesterone advanced endometrial downregulation of progesterone receptors and responsiveness to oxytocin during the subsequent estrous cycle in beef cows (Zollers et al., 1989, 1993). Reduced concentrations of progesteron e before ovulation enhanced subsequent uterine release of PGF in response to oxytocin between d 15 and 16 of the estrous cycle in dairy cows (based on circulating concentrations of its major metabolite 13,14 dihydro 15 keto PGF : PGFM ; Shaham Albalancy et al., 2001; Cerri et al., 2008 a ). Accordingly, inadequate concentrations of progesterone before ovulation also increased the incidence of shortened luteal phases (Cerri et al., 2008 a ). Therefore, the ovulation of a FW dominant follicle might create an as ynchrony between the production of IFN responsiveness to oxytocin, impairing maternal recognition of gestation. In addition to the effect of hastening luteolysis, the advancement in downregulation of progesterone receptor s could disturb the secretory function of the endometrium. Progesterone stimulates histotroph secretion by uterine glands, which is critical for embryonic development and maintenance of gestation (Ba zer et al., 2008). A reduction i n the abundance of proges terone receptors could overcome the expected increase in luteal production of progesterone following the ovulation of a FW dominant follicle, diminish embryo development and its capacity to produce large amounts of IFN

PAGE 106

106 The hypotheses of the present study are that ovulation of a FW dominant follicle would result in a larger CL and greater concentrations of progesterone during the subsequent estrous cycle compared with the ovulation of a SW dominant follicle; however, this increase would be associated with reduced conceptus length and lesser capability to produce IFN effects would be mediated by the concentration of progesterone during the development of the ovulat ory follicle. Objectives were to evaluate ovarian dynamics, hormonal profiles, CL expression of steroidogenenic and angiogenenic factors, length of conceptuses and their capability to produce IFN lactating Holstein cows induced to ovulate either a FW or a SW dominant follicles. Moreover, to evaluate if the effects from the ovulation of a FW dominant follicle are induced by reduced concentrations of progesterone during follicular growth. Materials and Methods Animals All experimental procedures were in compliance with the Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching and approved by the Animal Research Committee of the University of Florida (IFAS/ARC#: 018 09ANS). Non lactating and non pregnant Holstein cows were kept on pasture and had access to water ad libitum. Cows were fed a total mixed ration once a day, at 6:00 a.m., to meet or exceed the requirements of a 650 kg non lactating Holstein cow (NRC, 2001). Diet was composed of corn silage, Bermuda grass si lage, ground corn, citrus pulp, soybean meal, wet brewers grain, minerals, and vitamins.

PAGE 107

107 Synchronization of Follicular Wave and Supplementation with Progesterone Synchronization of follicular wave and supplementation with progesterone were performed as de scribed in Figure 4 1. Cows were blocked by parity (nulliparous, primiparous, or multiparous) and body condition score ( BCS ; Ferguson et al., 1994) and, within each block, randomly assigned to one of three treatments: ovulation of a first wave dominant fol licle ( FW n = 13); ovulation of a first wave dominant follicle and supplementation with progesterone during follicular development ( FWP4 n = 8); or ovulation of a second wave dominant follicle ( SW n = 12). Cows had their estrous cycle presynchronized wi th an injection of GnRH (100 g of gonadorelin diacetate tetrahydrate, i.m., Cystorelin, Merial Ltd., Duluth, GA) administered concurrently with the insertion of a intravaginal CIDR insert (1.38 g of progesterone, Eazi Breed CIDR, Pfizer Animal Health, Kal amazoo, MI). Inserts were removed 7 d later and cows received two injections of PG F (25 mg of dinoprost tromethamine, i.m., Lutalyse, Pfizer Animal Health, Kalamazoo, MI) administered at the moment of insert removal and 1 d later. All cows received an injection of GnRH at 1 d after the second PGF of presynchronization, which was the fi rst GnRH of the synchronization protocol (d 9 GnRH, d 2 and d 1 PGF d 0 GnRH) for FW and FWP4. Cows assigned to SW received the synchronization protocol beginning 6 d after the GnRH injection. Cows assigned to FWP4 received 3 CIDR inserts, placed seq uentially at 12, 24 and 48 h after the first injection of GnRH and removed at the first injection of PGF of the synchronization protocol. Cows were inseminated twice using the semen of a single bull of proven fertility concurrently with the final GnRH of the synchronization protocol and again 16 h later.

PAGE 108

108 Ultrasonography of Ovaries and Eligibility Criter ia Cows had their ovaries assessed by ultrasonography (Aloka SSD 500 equipped with a 7.5 MHz linear transducer, Aloka Co., Tokyo, Japan) during presynchron ization and synchronization protocols to ensure response to hormonal treatments (Figure 4 1). Position and diameter of all follicles > 4 mm and CL were recorded at each examination. Ovulation in response to GnRH was defined as the disappearance of one or m ore Only cows that ovulated in response to all injections of GnRH and had their CL regressed following injections of PGF (based on ultrasonographic evaluations) wer e kept in the study. Two FWP4 and three SW cows did not ovulate in response to the first GnRH of the synchronization protocol. Nonetheless, they were kept in the study because the emergence of a new follicular wave was detected within 48 h of the injection Cows had their ovaries scanned on d 7 and 13 and diameters of the CL and its cavity (if present) were determined by averaging the largest cross sectional width and height. Area and volume the CL were calculated as follows: where: W CL = largest cross sectional width and H CL = largest cross sectional height of the CL; R CL = average radius of the CL (W CL + H CL )/2; W cavity = largest cross sectional width and H cavity = largest cross sectional height of the cavity (if CL does not bear a cavity, W cavity = H cavity = 0); R cavity = average radius of the cavity (W cavity + H cavity

PAGE 109

109 Blood Collection and Analyses of Hormonal Concentrations in Plasma Blood was collected daily from d 9 to 17 by puncture of the coccygeal artery or vein using evacuated tubes with K 2 e thylenediaminetetraacetic acid ( EDTA ; Vacutainer, Becton Dickinson, Franklin Lakes, NJ). Samples were immediately placed in ice and transported to the laboratory within 3 h of collection. Blood tubes were centrifuged at 2,000 x g for 15 min in a refrigerated centrifuge (4C) and plasma sample s were frozen at 20 C for later analyses. Concentrations of progesterone were analyzed in all plasma samples by radioimmunoassay ( RIA ) using a commercial kit (Coat a Count, Siemens Healthcare Diagnostics, Los Angeles, CA). The sensitivity of the assay w as 0.1 ng/mL calculated at 2 standard deviations below the mean counts per minute at maximum binding. Samples were analyzed in three assays. Moderate (1.5 ng/mL) and high (2.5 ng/mL) concentration samples were incorporated several times in each assay and u sed to calculate the intra and inter assay coefficient of variation ( CV ) The intra assay CV were 6.3, 5.1 and 4.4% for the first, second and third assays, respectively; and the inter assay CV was 7.0%. Concentrations of estradiol were analyzed in plasma samples collected from experimental d 2 to 1 by RIA using a commercial kit (Estradiol Double Antibody, Siemens Healthcare Diagnostics, Los Angeles, CA) validated previously for use in bovine samples (Siddiqui et al., 2009). The sensitivity of the assay wa s 0.16 pg/mL calculated at 2 standard deviations below the mean counts per minute at maximum binding. Samples were analyzed in duplicate and repeated when the coefficient of variation between duplicates was > 0.15. Samples were analyzed in three assays. Pl asma from a cow exhibiting standing activity and charcoal stripped plasma from a male calf were used as positive and negative quality controls, respectively. High

PAGE 110

110 (10 pg/mL), moderate (5 pg/mL) and low (2.5 pg/mL) concentration samples were incorporated to each assay and used to evaluate the extraction. The intra assay CV were 10.1, 8.0 and 9.7% for the first, second and third assays, respectively; and the inter assay CV was 17.0%. Collection of Conceptuses, Uterine and CL Samples Cows were killed on d 17 a fter first insemination via insensibilization by captive bolt followed by exsanguination. The reproductive tract was collected, immediately placed on ice and processed within 1 h. The uterine horn ipsi lateral to the CL was dissected free from the intercor nual and broad ligaments, and isolated from the contra lateral horn using a Doyen forceps. A transversal incision was performed approximately 2 cm caudal to the uterotubal junction. The horn was flushed with 30 mL of sterile aline ( DPBS ) solution containing 0.01% poly vinyl alcohol from the cervix towards the incision using a 14 gauge needle coupled to a 60 mL syringe. The fluid was collected into a petri dish and evaluated for the presence of a conceptus. Conceptuses were mea sured, snap frozen in liquid N 2 and stored at 80 o C for further analysis. Remaining fluid was clarified by centrifugation (2,000 x g for 30 min at 4 o C), quantified and stored at 80 o C until assayed. The horn was opened longitudinally and samples of inter c aruncular endometrium were dissected from the myometrium, snap frozen in liquid N 2 and stored at 80 o C. Additionally, two circular sections of the uterine wall (1 cm of diameter) were collected from the inter caruncular region using a cork hole hand drill. One of the samples was fixed in 4% formaldehyde (prepared in DPBS; 16% Methanol free Formaldehyde Solution, Thermo Scientific, Rockford, IL) for 16 min, washed in DPBS 3 times for 10 min, frozen into an embedding mold containing an optimal cutting tempera ture ( OCT ) compound (Tissue Tek, Sakura

PAGE 111

111 Finetek USA Inc., Torrance, CA), and stored at 80 o C. The remaining sample was fixed in 4% formaldehyde for 20 h, washed in DPSB for 10 min, and stored in 70% ethanol at 4 o C until embedding in paraffin. The CL was di ssected from the ovary, measured using a caliper and weighted. Corpus luteum was divided into four semi hemispheres and processed as described for uterine samples. Briefly, two of the quarters were snap frozen in liquid N 2 and stored at 80 o C, one was fixe d in 4% formaldehyde and frozen embedded OCT compound, and the remaining sample was fixed in 4% formaldehyde and embedded in paraffin. Double ovulation was observed in one cow from FW and one cow from FWP4 treatments. In both cases, ovulations were detecte d in separate ovaries; therefore, each horn and its respective ovary were processed individually. Measurement of IFN Concentrations of IFN antiviral activity as described previous ly (Rodina et al., 2009) with few modifications. DMEM ; Invitrogen, Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone, Logan, UT), 1% sodium pyruvate (Invitrogen, Grand Island, NY), 1% L glutamine (Invitrogen, Grand Island, NY), and 1% penicillin/streptomycin (Invitrogen, Grand Island, NY) was added to each well of a 96 well plate. Serial 1:3 dilutions of either a recombinant human IFN 8 IU/mg; EMD Biosciences Inc., Gibbstown, NJ) or the uterine flush mixing to the subsequent well. Madin Darby Bovine Kidney ( MDBK ) cells were plated and cultured at 37 o C (95% a ir/5% CO 2 ) for 24 h. Cells were challenged with vesicular stomatitis virus ( VSV ) for 1 h and incubated in supplemented DMEM for 20 h. Cells

PAGE 112

112 were fixed with 70% ethanol and stained with 0.5% gentian violet diluted in 70% ethanol. Laboratory units of antivi ral activity ( LU ) were calculated for each sample as the inverse of 1/3 of the dilution factor for the well that VSV induced lysis of MDBK cells was prevented by 50% which was accessed visualy Laboratory units were converted to international units ( IU ) b y dividing the amount of IFN multiplying by the LU of individual samples. The activity of bovine IFN described (8.0310 8 IU/mg; Rodina et al., 2009) and was used to calculate the concentration of IFN present in individual samples The calculations for a hypothetical sample that inhibited VSV induced lysis of MDBK cells by 50% on the tenth well, considering that the same inhibition was achieved by the standard on the eighth well, would be performed as follows. The dilution factor on the first well is 1:3 (by default, 1 LU) and samples were diluted 3 times in each well in relation to the previous one Therefore, the dilution factor on the eighth well is 1:6,561, which means that the standard has 2,187 LU. Because 5, 000 IU of IFN were added to first well, 1 LU represents 2.29 IU. The dilution factor on the tenth well is 1:59,049; therefore, the unknown sample has 19,683 LU and a total of 45,000 IU. As the initial volume was 50 L, the concentration of IFN ample is 900,000 IU/mL which based in the activity of bovine IFN determined previously represents 1,120 ng/mL. The sensitivity of the assay was 0.06 ng/mL. All plates were duplicated. Samples were analyzed in a single assay and the intra assay coefficient of variation was 9.9%. The accuracy with which concentrations of IFN p resence of a conceptus on d 17 after insemination was determined using receiver

PAGE 113

113 operating characteristic ( ROC ) curves (Figure 4 2). All samples on which antiviral activity were not detected (0.0 ng/mL) were associated with nonpregnant cows. The false posit ive rate (proportion non pregnant cows that yield concentrations of IFN above the sensitivity of the assay ) was 4.4%. RNA isolation and Quantitative Real Time Reverse Transcription PCR The relative abundance mRNA was assessed for genes of interest using quantitative real time reverse transcription polymerase chain reaction ( qRT PCR ). Total RNA was extracted using TRIzol reagent (Inviotrogen, Carlsbad, CA) and purified recomm endation. Integrity and concentration of the RNA was analyzed using a micro volume spectrophotometer (NanoDrop 2000, Thermo Fisher Scientific, Waltham, MA). Samples of RNA (250 ng/reaction) were treated with RNase free DNase (Applied Biasystems Ambion Inc ., Fo ster City, CA) for 30 min at 35 o C, heat denatured at 75 o C for 15 min. Total RNA was reverse transcribed ( RT ) using a high capacity complementary DNA ( cDNA ) archive kit and random hexamers (Applied Biosystems Inc., Foster City, CA). Reverse transcripti on was performed at 25 o C for 10 min, 37 o C for 60 min, and 85 o C for 5 min. Gene HSD, CYP11A1, FLT 1, KDR, StAR, VEGFA ( in the CL) and IFN in the conceptuses) were selected and GAPDH was used as internal control (Table 4 1). Qu antitative real time reverse transcription PCR was performed (ABI 7300 Sequence Detector; Applied Biosystems Inc., Foster City, CA) using a SybrGreen detector system (Applied Biosystems Inc., Foster City, CA). Reactions were run in triplicates using the RT positive product and 1 replicate was run using a RT negative control. After an initial a ctivation/denaturation step (60 o C for 2 min; 95 o C for 10 min), 40 cycles of a two step amplification protocol (60 o C for 1 min; 95 o C for

PAGE 114

114 15 s) were completed and subsequent cooling (4 o C) terminated the reaction. Primer efficiency ranged from 89 to 103%. The abundance of target genes mRNA was calculated relative to that of GAPDH using the comparative threshold ( Ct ) method as described previously (Pfaffl, 2001). Brie Ct for the same gene within the reference group (reference groups for each comparison w ere indicated accordingly througho then corrected by raising the efficiency of the primer to the power of its The relative expression ratio was calculated by dividing the corrected corrected the internal control and was used in the statistical analyses. Experimental Design and Statistical Analysis Cows were assigned to treatments in a randomized block design. Cows were blocked by parity and body condition score at enrollment and, within each block, randomly assigned t o one of three treatments. Tests for normality of residu als (Shapiro Wilk test) and homogeneity of variances (F Max test) were conducted for each variable. Data which did not fulfill the assumptions for analysis of variance ( ANOVA ) were transformed accordi ngly. For clarity, only untransformed data were presented. Continuous data were analyzed by ANOVA using the GLIMMIX procedure of SAS version 9.2 (SAS/STAT, SAS Institute Inc., Cary, NC) for normal distribution. The effects of treatment, parity and interact ion between treatment and parity were included in the model as independent variables. Concentrations of estradiol and progesterone were analyzed as repeated measures by ANOVA using the GLIMMIX procedure of SAS for normal distribution. The effects of parity treatment, day and interaction between treatment and day were included in the model as independent variables, whereas cow

PAGE 115

115 nested within treatment was considered a random effect. The first order autoregressive was selected as covariance structure because Bayesian information criterion value. Correlations between the length of the conceptuses and production of IFN mRNA abundance were performed using the REG procedure of SAS. Binary responses were analyzed by multiv ariate logistic regression using the GLIMMIX procedure of SAS for binary distribution. The effects of treatment, parity and interaction between treatment and parity were included in the model as independent variables. Evaluation of the individual effects of follicular wave (FWP4 vs. SW) and progesterone concentration during development of the ovulatory follicle (FW vs. FWP4 +SW) were conducted using a CONTRAST statement whenever suitable. Treatment considered tendencies. Receiver operating characteristic curves were generated using the ROC curve analysis option of MedCalc version 11.2.1 (MedCalc Software, Mariakerke, Belgium) to determine the accuracy with which concentrations of IFN predict the presence of a conceptus on d 17 after insemination. Results Two cows were not included in the statistical analyzes because they had either an abnormal oviduct detected at sla ughter (7187; SW) or a hyperechogenic mass in the ovary that was capable of producing progesterone during the growth of the ovulatory follicle (5708; FW).

PAGE 116

116 Ovarian Responses and Hormonal Profiles The concentration of progesterone during the development of t he ovulatory follicle differed ( P < 0.0001) among treatments (Figure 4 3). Cows that did not receive exogenous progesterone exhibited a constant increase in the concentration of progesterone throughout the treatment period. Moreover, progesterone concentra tion was consistently greater ( P < 0.01) for SW than for FW. The incorporation of 3 CIDR inserts to the synchronization protocol increased concentrations of progesterone during the development of the first follicular wave. Following the insertion of the se cond and third CIDR inserts, the concentration of progesterone in plasma for FWP4 was greater ( P < 0.01) than that of FW and similar ( P > 0.50) to SW. The concentration of progesterone in FWP4 cows remained somewhat constant from d 6 to 2 whereas it incr eased in FW and SW cows. The proportion of cows bearing a CL at PGF injection ( d 2 ) tended ( P = 0.06) to be less for FWP4 (Table 4 2); however, the pattern of progesterone concentration in plasma did not change when only cows bearing a CL were included in the statistical analysis. The luteal volume for cows bearing a CL on d 2 was similar ( P = 0.22) between FWP4 and FW. Progesterone concentration was reduced to basal values following the treatment with PGF which indicates similar luteolysis among tre atments. The diameter of the ovulatory follicle was larger ( P concentrations of progesterone during follicular growth, which resulted in greater ( P = 0.05) concentrations of estradiol on the day of the peak (Table 4 2). Conve rsely, the wave of the ovulatory follicle did not affect ( P > 0.10) ovulatory diameter and maximum concentration of estradiol. An interaction between treatment and day ( P = 0.03) was found to influence concentration of estradiol in plasma between d 1 and 1, because the

PAGE 117

117 average concentration for FW increased earlier than for other treatments (Figure 4 4). On the day before the final GnRH, estradiol concentrations for FW were greater ( P < 0.001) than for SW and tended ( P < 0.06) to be greater than for FWP4. This can be partially explained by the fact that the incidence of premature peaks of estradiol was greater ( P = 0.01) among FW cows (Table 4 2). Progesterone concentration during the growth of the ovulatory follicle affected the size of the newly formed C L (Table 4 2). The greater luteal volume observed in FW cows was associated with increased concentrations of progesterone (Figure 4 5). Nevertheless, the capacity of the CL to produce progesterone, calculated as the ratio between the concentration of proge sterone in plasma and CL volume or weight at slaughter was not affected ( P > 0.10) by concentration of progesterone during follicular growth or wave of the ovulatory follicle. None of the cows in the present study had their CL regressed before d 17 of the estrous cycle, based on visual evaluation on the day of slaughter and on concentrations of progesterone in plasma. Expression of Steroidogenenic and Angiogenic Factors in the CL Luteal expression of mRNA encoding StAR on d 17 of the estrous cycle was grea ter ( P < 0.05) for FW than for other treatments (Figure 4 6). The expression of P450scc was reduced ( P < 0.05) for FWP4, whereas no difference between FW and HSD was greater ( P < 0.05) for FW than for FWP4 and SW had an intermediate relative abundance. The expression of mRNA expression encoding VEGF tended ( P < 0.10) to be greater for FW than for FWP4 and SW (Figure 4 7). Nonetheless, the expression of VEGF receptors KDR and Flt 1 did not differ among treatments.

PAGE 118

118 Pregnancy, Conceptus Development and IFN Conceptuses were recovered from 21 of the initial 31 cows (Table 4 3). One FW (5183) and one FWP4 cow (5448) ovulated one follicle from each ovary. On the day of slaugh ter, uterine horns were flushed individually and two conceptuses were recovered from each cow. The risk of pregnancy on d 17 after insemination tended ( P = 0.10) to be less for cows exposed to low concentrations of progesterone during the development of th e ovulatory follicle. Conceptus length was not affected ( P > 0.10) by follicular wave or concentration of progesterone during follicular growth. Conseptuses were categorized in relation to the mean length observed in the present study (14 cm) as large ( > 1 4 cm; n = 12) or small ( n = 11). Effectively, the average length for large conceptuses was greater ( P < 0.001) than for small conceptuses (19.9 1.0 vs. 7.5 1.5 cm). The proportion of small conceptuses did not differ ( P > 0.01) among treatments Ovulation of a SW dominant follicle tended ( P < 0.10) to reduce the concentration of IFN The ratio between IFN recovered and conceptus length indicated that conceptus from SW cows were less ( P 0.05) capable of producing IFN encoding for IFN P = 0.31) among treatments. The linear regression of both, the concentration of IFN in the uterine flush and the total amount of IFN per uterus, and c onceptus length demonstrated a positive relationship ( P < 0.001 ; Figure 4 8). Large conceptuses were associated with greater ( P < 0.001) concentration of IFN recovered (Figure 4 9). The increase in uterine concentration and total amount of IFN per centimeter of conceptus was greater ( P < 0.05) for large conceptuses. However, the

PAGE 119

119 di fference in capacity to synthesize IFN increase in mRNA relative abundance (Figure 4 10). Nonetheless, a positive correlation between IFN 4 11). S urprisingly, concentrations of progesterone in plasma from d 5 to 3 relative to AI were greater for cows that produced small conceptuses (Figure 4 12). Concentrations of progesterone during the first 5 d of gestation did not differ ( P = 0.71) between cow s that had small and large conceptuses; however, they were greater ( P = 0.004) from d 6 to 17 of gestation for cows that had large conceptuses compared with cows that produced small conceptuses (Figure 4 13). Discussion Results from the current study confirmed our initial hypotheses that ovulation of FW dominant follicles reduces fertility in dairy cows and that this effect is mediated by suboptimal concentrations of progesterone during ovulatory follicle growth. Nonethel ess, the present results indicate that the underlying mechanisms are related with the final maturation of the oocyte, fertilization and embryonic development before the elongation period. The reduction on the risk of pregnancy for cows induced to ovulate a FW dominant follicle that grew under reduced concentrations of progesterone was evident on d 17 after AI. However, the average length and the proportion of conceptus classified as small in relation to the overall mean were similar for FW compared to SW an d FWP4. Furthermore, the capability of conceptuses to produce IFN are supported by previous studies on which dairy cows were superstimulated during the FW or SW of follicul ar development (Rivera et al., 2009). Embryo viability on d 6 after AI

PAGE 120

120 was markedly reduced following superstimulation of the FW in comparison to the SW. Likewise, the negative effects were mediated by reduced concentration of progesterone during growth of the ovulatory follicle, since no differences on embryo quality were found between cows that ovulated SW dominant follicles and cows that were supplemented with progesterone during the development of the FW. Furthermore, no differences in pregnancies per e mbryo transfer or in pregnancy loss between d 21 and 63 of gestation were reported for viable embryos derived from superstimulation of the FW, FW supplemented with progesterone, and SW (Rivera et al., 2009). These observations further support the present c onclusion that follicular wave of the ovulatory follicle and progesterone concentrations during follicular growth affects the final maturation of the oocyte, fertilization and/or embryonic development before the elongation period. Post hatching development of bovine embryos is highly dependent on growth factors and nutrients secreted by the endometrium in response to progesterone (Bazer et al., 2008). The rise in progesterone concentration after AI occurred more rapidly for FW than for SW and FWP4. The augm ent ation in progesterone production observed for FW was supported by the ovulation of a larger follicle followed by the development of a larger CL (Vasconcelos et al., 2001). The relationship between the concentration of progesterone in plasma and luteal v olume indicates a similar steroidogenic capacity of the CL among treatments. Nonetheless, an increase in CL relative abundance of mRNA encoding for StAR was detected for FW compared to SW and FWP4. This result agrees with the finding that progesterone outp ut per cell differed between in vitro luteinized cells from FW and SW dominant follicles (Wolfenson et al., 1999). Luteinized the ca cells

PAGE 121

121 derived from FW dominant follicle produced 2 to 3 times more progesterone than the SW derived counterparts. Nonetheles s, no difference was found for luteinized granulosa cells. Because granulosa cells give rise to large luteal cells after the pre ovulatory surge of luteinizing hormone ( LH ) and become responsible for 80 to 90% of the production of progesterone by the CL (F itz et al., 1982; Farin et al., 1986), the overall improvement in steroidogenic capacity per cell is expect to be secondary to the increase in luteal volume in the present study. Taken together, results from luteal dynamics after induced ovulation supports the results regarding conceptus morphology and IFN (Mann and Lamming, 2001; Robinson et al., 2006). Because of the experimental design presented here, the lifespan of the ovulatory follicle is expected to be similar among treatments. Nonethe less, ovulatory follicles from the FW were significantly larger than those derived from the SW. This is in accordance with previous studies that reported a faster rate of growth and a greater maximum diameter for FW compared with SW dominant follicles (Sir ois and Fortune, 1988). The presence of a fully mature CL and greater concentrations of progesterone are negatively correlated with LH pulse frequency, which diminishes follicular growth during the SW (Evans et al., 1997). In fact, supplementation with exo genous progesterone reduced growth of the FW dominant follicle and resulted in ovulatory diameters similar to those observed for SW follicles in the present study. On account of these changes in follicular development, the greatest concentration of estradi ol in plasma and the proportion of cows that had their greatest concentration detected on the day before of the final GnRH were greater for FW compared to other treatments. It is possible that some of these cows had endogenous surge of LH and ovulated shor tly after AI; thus,

PAGE 122

122 the reduction in fertility observed for FW might have been, at least in part, due to an asynchrony between ovulation and AI. Nevertheless, estradiol concentrations in plasma are expected to decrease by 50% within 5 h of the peak and to return to basal values during the following 9 h (Chenault et al., 1974). Estradiol concentration s 32 h after the maximum concentration had decrease d by less than 50% in 2 of 8 cows, and w ere greate r than those observed on the day before the peak in 5 of 8 cows in the present study. The present scheme of blood sampling does not allow for the determination of the highest concentration of estradiol; however, for the majority of the cows that had a premature peak of estradiol is expected that the maximum conce ntration occured within 14 h of the final GnRH Therefore, the the effect of spontaneous ovulation in the present study is expected to be of minor importance. The oocyte enclosed in FW dominant follicles were exposed to greater concentrations of estradiol for a longer period of time than oocytes from SW and FWP4 dominant follicles. It has been shown that reduction of circulating concentrations of progesterone during early diestrus increased concentrations of estradiol and induced maturation related changes in the cumulus oocyte complex (Inskeep, 2004). These changes were detected within 48 h after lowered progesterone and included hastening of stage II of meiosis. Similar a lterations were described in persistent follicles (Revah and Buttler, 1996), and have been linked to decreased embryo quality and increased mortality before the 16 cell stage (Ahmad et al., 1995; Cerri et al., 2009). Nonetheless, further studies are needed to accurately determine the effects of wave

PAGE 123

123 and concentration of progesterone during follicular development on parameters of oocyte competence in dairy cows. The concentration of IFN recovered were hi ghly correlated with the length of the conceptus. This response agrees with previous literature regarding IFN conceptuses (Mann and Lamming, 2001; Robinson et al., 2006). Nevertheless, the classification of conceptuses int o small and large showed that conceptuses that were longer than the mean for the present study produced more IFN those that were shorter than the mean length. This finding contradicts the dogma that modulation of IFN ovine conceptuses relies only on differences in length (Robinson et al., 2006). It has been shown that IFN developmentally regulated in the bovine embryo (Bertolini et al., 2002). Nonetheless, similar IFN for conceptuses between d 14 and 18 of gestation and among conceptus that measured less than 5, from 5 to 10, and more than 10 cm (Robinson et al., 2006). The latter is consistent with our finding that the relative IFN conceptuses classified as small and large. Simple linear regression analyses demonstrated a weak correlation between IFN significantly accounted for part of the fluctuation in r elative abundance of IFN Conclusion Ovulation of FW dominant follicles reduces fertility in dairy cows and this negative effect is mediated by suboptimal concentrations of progesterone during ovulatory follicle growth. The results presented here su ggest that the underlying mechanisms are related with oocyte maturation, fertilization and embryonic development before the elongation

PAGE 124

124 period. Furthermore, our results indicate that luteal function during early gestation and capability of elongated concept uses to produce IFN fertility observed in cows induced to ovulate FW dominant follicles.

PAGE 125

125 Table 4 1. Primer sequences used for quantitative real time reverse transcription PCR Target gene Primer 1 HSD GCCCAACTCCTACAGGGAGAT TTCAGAGCCCACCCATTAGCT CYP11A1 CTGCAAATGGTCCCACTTCT CACCTGGTTGGGTCAAACTT FLT 1 GCCTGAAATCTACCAGATCATGTTG primer AAGATTCGTGGAGCTTGTGGAA GAPDH ACCCAGAAGACTGTGGATGG CAACAGACACGTTGGGAGTG IFN GCCCGAATCAACAGACTCCC GATCCTTCTGGAGCTGGCTG KDR ACTGCAGTGATGGCGTCTT TGGAAATGATACTGGAGCCTACAAG StAR CCCATGGAGAGGCTTTATGA TGATGACCGTGTCTTTTCCA VEGFA GCCCACTGAGGAGT TCAACAT GATCAAACCTCACCAAAGCCAG

PAGE 126

126 Table 4 2. Effect of follicular wave and concentration of progesterone during the development of the ovulatory follicle on ovarian responses and hormonal profile Treatment 1 P 2 Variables FW FWP4 SW Treat. Wave P4 Ovulatory follicle, cm at PGF injection (d 2) 3 1.29 0.07 1.04 0.09 1.16 0.08 0.10 0.29 0.05 at GnRH injection (d 0) 1.79 0.06 1.53 0.07 1.47 0.06 < 0.01 0.47 < 0.01 Premature peak of estradiol, % (n/n) 4 58.3 (7/12) 12.5 (1/8) 0.0 (0/11) 0.04 0.77 0.01 Estradiol concentration at peak, pg/mL 7.98 0.58 6.98 0.71 5.87 0.61 0.06 0.25 0.05 CL volume at PGF (d 2), cm 3 All cows 8.30 1.04 4.62 1.27 10.95 1.08 < 0.01 < 0.01 0.70 Only cows with CL 8.30 0.99 6.15 1.40 10.95 1.03 0.03 0.01 0.85 Cows with a CL at PGF % (n/n) 100.0 (12/12) 75.0 (6/8) 100.0 (11/11) 0.06 0.16 0.51 CL on d 7 after the final GnRH Volume, cm 3 5.23 0.46 3.55 0.56 4.20 0.50 0.07 0.39 0.03 Progesterone in plasma, ng/mL/cm 3 0.70 0.09 0.86 0.11 0.72 0.10 0.63 0.38 0.63 CL on d 13 after the final GnRH Volume, cm 3 6.81 0.67 5.44 0.80 7.03 0.73 0.30 0.15 0.51 Progesterone in plasma, ng/mL/cm 3 1.08 0.11 0.91 0.14 0.93 0.12 0.50 0.83 0.26 CL on d 17 after the final GnRH Volume, cm 3 11.15 0.99 7.62 1.15 9.00 1.15 0.08 0.41 0.04 Progesterone in plasma, ng/mL/cm 3 0.65 0.11 0.90 0.13 0.78 0.12 0.37 0.58 0.19 Weight, g 6.33 0.45 4.94 0.52 6.30 0.55 0.11 0.08 0.24 Progesterone in plasma, ng/mL/g 1.06 0.12 1.30 0.14 1.06 0.14 0.46 0.24 0.67 1 FW = ovulation of a first wave dominant follicle; FWP4 = ovulation of a first wave dominant follicle and supplementation with progesterone during follicular growth; SW = ovulation of a second wave dominant follicle. Responses are indicated as LS means S EM unless specified. 2 Statistical significance for the effect of treatment, follicular wave (FWP4 vs. SW) and concentration of progesterone during the development of the ovulatory follicle (FW vs. FWP4 + SW). 3 Day 0 = final injection of GnRH of the synch ronization protocol administered concurrently with the first insemination. 4 Proportion of cows in which the peak of estradiol was detected on the day before the final injection of GnRH (d 1).

PAGE 127

127 Table 4 3. Effect of follicular wave and concentration of p rogesterone during the development of the ovulatory follicle on conceptus development and production of IFN Treatment 1 P 2 Variables FW FWP4 SW Treat Wave P4 Pregnant cows, % (n/n) 50.0 (6/12) 87.5 (7/8) 72.7 (8/11) 0.24 0.45 0.10 Length of the conceptus, cm 17.5 2.8 13.7 2.6 11.2 2.6 0.29 0.52 0.15 Range 4.40 24.00 4.20 23.00 0.35 22.00 ------Small conceptuses 3 % (n/n) 28.6 (2/7) 50.0 (4/8) 62.5 (5/8) 0.45 0.62 0.25 Concentration of IFN n g/mL 4 299.5 91.9 211.0 85.9 60.1 91.8 0.09 0.06 0.22 Per centimeter of conceptus, n g/mL/cm 16.1 4.9 13.1 4.6 3.7 4.9 0.04 0.31 0.02 Total amount of IFN g 5 4.6 1.3 3.0 1.2 1.5 1.3 0.14 0.09 0.25 Per centimeter of conceptus, g/cm 0.22 0.05 0.21 0.05 0.09 0.05 0.05 0.02 0.37 I FN Ct ratio 6 All conceptuses 1.83 0.29 2.03 0.28 1.27 0.28 0.15 0.06 0.62 Elongated conceptuses 7 1.47 0.23 1.64 0.22 1.15 0.23 0.31 0.13 0.78 1 FW = ovulation of a first wave dominant follicle; FWP4 = ovulation of a first wave dominant follicle and supplementation with progesterone during follicular growth; SW = ovulation of a second wave dominant follicle. Responses are indicate d as LS means SEM unless specified. 2 Statistical significance for the effect of treatment, follicular wave (FWP4 vs. SW) and concentration of progesterone during the development of the ovulatory follicle (FW vs. FWP4 + SW). 3 Conceptuses were classified as small or large in relation to the mean length (small 14 cm, and large > 14 cm). 4 Concentration of interferon tau in the uterine flush. 5 Calculated by multiplying concentration of interferon tau in the uterine flush by the total amount of uterine fl ush recovered. 6 Expression of interferon tau mRNA relative to GAPDH. The treatment SW was used as reference for comparisons. 7 One SW cow (5686) was excluded from the analysis because its conceptus was not elongated.

PAGE 128

128 Figure 4 1. Diagram of activities during experiment. AI = artificial insemination; BS = blood sampling for analysis of concentration of estradiol and/or progesterone in plasma; Slaughter = c ows were killed via insensibilization by captive bolt followed by exsanguinations; US = ultrasonography of ovaries.

PAGE 129

129 Figur e 4 2. Receiver operating characteristic curve representing the accuracy with which concentrations of IFN n g/mL) predicted the presence of a conceptus on d 17 after insem ination. Highest combined sensitivity (95.7%; 95% confidence interval = 78.1 to 99.9%) and specificity (91.7%; 95% confidence interval = 61.5 to 99.8%) was detected at 0.34 pg/mL (open circle). The area under the curve was 0.94 (95% confidence interval = 0 .81 to 0.99). 100 Specifity

PAGE 130

130 F igure 4 3 Concentrations of progesterone in plasma during treatment period in cows induced to ovulate either the dominant follicle of the first wave (FW, solid circles), first wave concurrent with su pplemental progesterone (FWP4, open triangles), or second wave (SW, solid squares). a,b,c Means with different superscripts differed ( P < 0.05) among treatments within the same day. A,B Means with different superscripts tended (0.05 < P treatments within the same day.

PAGE 131

131 Figure 4 4. Concentrations of estradiol in plasma of cows induced to ovulate the dominant follicle of the first wave ( FW, solid circles), first wave concurrent with supplemental progesterone ( FWP4, open triangles), or second wave ( SW, solid squares). a,b Means with different superscripts differed ( P < 0.05) among treatments within the same day A,B Means with different superscripts tended ( 0.05 < P 0. 10) to dif fer among treatments within the same day

PAGE 132

132 Figure 4 5. Concentrations of progesterone in plasma after the final GnRH in cows induced to ovulate either the dominant follicle of the first wave (FW, solid circles), the dominant follicle of the first wave concurrent with supplemental progesterone (FWP4, open triangles), or the dominant follicle of the second wave (SW, solid sq uares). Daily means are greater ( P < 0.05) for FW than for SW and FWP4 has an intermediate value. ** Daily means are greater ( P < 0.05) for FW; however, did not differ ( P > 0.05) between FWP4 and SW.

PAGE 133

133 Figure 4 6. Fol d change expression from qRT PCR analysis for steroidogenic acute regulatory protein (StAR), cytochrome P 450 side chain cleavage enzyme ( P 450scc), and hydroxysteroid dehydro HSD) for FW (black bars), FWP4 (light gray), and SW cows (dark gray) a,b Means with different superscripts differed ( P < 0.05) among treatments.

PAGE 134

134 Figure 4 7. Fold change expression from qRT PCR analysis for vascular endothelial growth factor (VEGF) fms like tyrosine kinase receptor 1(Flt 1) and kinase insert domain containing region (KDR) for FW (black bars), FWP4 (light gray), and SW cows (dark gray) A,B Means with different superscripts tended ( 0.05 < P 0. 10) to differ among treatments.

PAGE 135

135

PAGE 136

136 Figure 4 8. Regression of conceptus length and concentration of interferon tau in uterine flush samples ( n g/mL ; panel A) and total amount of interferon tau recovered ( g; panel B) One SW cow (5686) was considered an outlie r and was removed from the statistical analyse s. Solid lines represent the value predicted by the regression equation. Dotted lines represent the 95% confidence interval for the mean. Dashed lines represent the 95% confidence interval for a predicted value.

PAGE 137

137

PAGE 138

138 Figure 4 9. Concentration and total amount of interferon tau recovered by post mortem flushing of the uterus on d 17 of gestation Absolute values (panels A and B) and values per centimeter of conceptus (panels C and D) are presented C onceptuses were classified as small or large in relation to the mean length a,b Means with different superscript letters differ (P < 0.0 5 ).

PAGE 139

139 Figure 4 10. Expression of interferon tau in relation to GAPDH in conceptuses on d 17 of gestation Data from all conceptuses (panel A) and only intact conceptuses (panel B) are presented Conceptuses were classified as small or large in

PAGE 140

140

PAGE 141

141 Figure 4 11. Regression of conceptus length and expression of interferon tau in conceptuses on d 17 of gestation. Data from all conceptuses (panel A) and intact conceptuses (panel B) are presented Solid lines represent the value predicted by the regression equation. Dotted lines represent the 95% confidence interval for the mean. Dashed lines represent the 95% confidence interval for predicted value.

PAGE 142

142 Figure 4 12. Concentrations of progesterone in plasma of cows that had small (open circles) or large (solid circles) conceptuses on d 17 of gest ation. ** Means differed ( P < 0.05) between categories within the same day Means tended ( 0.05 < P 0. 10) to differ between categories within the same day

PAGE 143

143 Figure 4 13. Concentrations of progesterone in plasma of cows that had small (open circles) or large (solid circles) conceptuses on d 17 of gestation. ** Means differed ( P < 0.05) between categories within the same day Means tended ( 0.05 < P 0. 10) to differ between categories within the same day

PAGE 144

144 CHAPTER 5 EFFECT OF INTERVAL B ETWEEN INDUCTION OF OVULATION AND AI AND SUPPLEMENTAL PROGEST ERONE FOR RESYNCHRON IZATION ON FERTILITY OF DAIRY COWS SUBJEC TED TO A 5 D TIMED AI PROGRAM Objectives were to investigate 2 intervals from induction of ovulation to artificial insemination ( AI ) and the effect of supplemental progesterone for resynchronization on fertility of lactating dairy cows subjected to a 5 d timed AI program. In experiment 1, 1,227 Holstein cows had their estrous cycle presynchronized with 2 injections of prostaglandin ( PG ) F at 46 and 60 days in milk ( DIM ) The timed AI protocols were initiated with gonadotropin releasing hormone ( GnRH ) at 72 DIM, followed by 2 injections of PGF at 77 and 78 DIM and a second injection of GnRH at either 56 ( OVS56 ) or 72 h ( COS72 ) after the first PGF of the timed AI protocols. All cows were timed inseminated at 72 h after the first PGF injection. Pregnancy was diagnosed on d 32 and 60 after AI. In experiment 2, 675 n onpregnant Holstein cows had their estrous cycle resynchronized starting at 34 d after the first AI. Cows received the OVS56 with ( RCIDR ) or without ( RCON ) supplemental progesterone, as an intravaginal insert, from the first GnRH to the first PGF Pregna ncy diagnoses were performed on d 32 and 60 after AI. Subsets of cows during the experiment 2 had their ovaries scanned by ultrasonography at the first GnRH, the first PGF and second GnRH injections of the resynchronization protocol. Blood was sampled o n the day of AI and 7 d later, and concentrations of progesterone were determined in plasma. Cows were considered to have a re synchronized ovulation if they had progesterone < 1 ng/mL and > 2.26 ng/mL on the day of AI and 7 d later, respectively, and if no ovulation was detected between the first PGF and second GnRH injections during resynchronization. In experiment 1, the proportion of cows detected in estrus at AI was greater for COS72 than OVS56

PAGE 145

145 (40.6 vs. 32.4%). Pregnancy per AI ( P/AI ) did not differ between OVS56 (46.4%) and COS72 (45.5%). In experiment 2, cows supplemented with progesterone had greater P/AI compared with unsupplemented cows (51.3 vs. 43.1%). Premature ovulation tended to be greater for RCON than RCIDR cows (7.5 vs. 3.6%), although sy nchronization of the estrous cycle after timed AI was similar between treatments. In conclusion, t iming of induction of ovulation with GnRH relative to insemination did not affect P/AI of dairy cows enrolled in a 5 d timed AI program. Furthermore, during r esynchronization starting on d 34 after the first AI, supplementation with progesterone improved P/AI in cows subjected to the 5 d timed AI protocol. I ntroduction Reproductive programs based on GnRH and PGF for timed AI maximize the proportion of cows inseminated early after the end of the voluntary waiting period and typically result in pregnancy per AI similar to that observed in breeding programs based on estrous detection (Chebel et al., 2006). From the first report of the Ovsynch protocol (d 0 GnRH, d 7 PGF d 9 GnRH, d 10 timed AI; Pursley et al., 1995), synchronization programs have been modified to improve fertility responses of inseminated lactating dairy cows. Recently, the reduction of the interv al between the initial GnRH and the PGF injections from 7 to 5 d (5 d Cosynch program) was shown to improve P/AI in lactating dairy cows (Santos et al., 2010). Nevertheless, all cows in that particular experiment were inseminated simultaneously with the final GnRH, which was administered 72 h after the injection of PGF Pursley et al. (1998) suggested that maximum P/AI in the conventional Ovsynch protocol was achieved when the interval between the final GnRH and AI was 16 h. In fact, when the interval b etween synchronization of follicular wave with GnRH and injection of PGF to promote

PAGE 146

146 luteolysis was 7 d, induction of ovulation with the final GnRH injection 16 h before AI improved fertility of dairy cows compared with GnRH concurrent with AI (Brusveen e t al., 2008). When cows are subjected to the 5 d program, the period of ovulatory follicle development is reduced by approximately 2 d compared with conventional programs (Santos et al., 2010). This reduction resulted in ovulatory follicles of smaller dia meter, reduced concentration of estradiol in plasma, and a smaller proportion of cows in estrus at AI compared with cows in the conventional 7 d program (Santos et al., 2010). Although insemination of dairy cows 4 to 16 h after the onset of estrus (Dransfi eld et al., 1998) or 16 h after induction of ovulation (Pursley et al., 1998; Brusveen et al., 2008) improved P/AI, this response might not be the same in cows subjected to a shorter period of ovulatory follicle maturation in the 5 d program. The additiona l 16 h of follicle development might result in increased concentrations of estradiol in plasma and proportion of cows in estrus at AI, which has been linked with fertility of cows in timed AI programs (Santos et al., 2010). In a series of experiments with beef cows subjected to the 5 d program, extending proestrus from 60 to 72 h was beneficial to fertility (Bridges et al., 2008). Therefore, it is possible that the improved synchrony between ovulation/oocyte competence and numbers of viable sperm available for fertilization (Saacke, 2008) might be offset by the shortened proestrus and reduced proportion of cows in estrus when GnRH is given 56 compared with 72 h after luteolysis. The hypothesis for experiment 1 was that induction of ovulation concurrent with insemination would not compromise P/AI of lactating dairy cows subjected to a 5 d synchronization protocol compared with the administration of the final GnRH 16 h before AI.

PAGE 147

147 After the first postpartum AI, 55 to 65% of the cows remain nonpregnant. These cow s should receive a new insemination soon after the nonpregnancy diagnosis; however, the stage of the estrous cycle at which the resynchronization protocol is initiated affects ovarian responses to hormonal treatments, synchrony of ovulation and, consequent ly, P/AI (Vasconcelos et al., 1999). During resynchronized inseminations, the stage of the estrous cycle at the beginning of the protocol is generally unknown. This can influence synchrony of ovulation when cows are inseminated. The use of a controlled in ternal drug release ( CIDR ) containing progesterone improved synchrony of the estrous cycle when used in a timed AI protocol (Lima et al., 2009) and increased fertility of dairy cows in the first postpartum AI in some (Chebel et al., 2010) but not all studi es (Lima et al., 2009). The hypothesis for experiment 2 was that supplementation with progesterone during the resynchronization with the 5 d protocol would enhance synchrony of the estrous cycle and improve fertility responses in lactating dairy cows. The objectives of this study were to investigate 2 intervals between induction of ovulation relative to AI and supplemental progesterone during resynchronization on fertility when lactating dairy cows are subjected to a 5 d timed AI program. Materials and Met hods Experiment 1 Cows, h ousing and d iets Lactating Holstein cows, 498 primiparous and 769 multiparous, from a single dairy herd in Central Florida were assigned to the study. Primiparous and multiparous cows were housed separately in free stall barns equ ipped with sprinklers and fans. Inseminations were performed from January 1 st to April 9 th 2009. Primiparous and multiparous cows received the same total mixed ration ( TMR ) to meet or exceed the

PAGE 148

148 nutrient requirements for a lactating Holstein cow producing 45 kg of milk per day with 3.5% fat and 3.2% true protein (NRC, 2001). Cows were fed twice daily and milked thrice daily. Diet consisted of rye grass silage, corn silage, alfalfa hay, ground corn, citrus pulp, soybean meal, molasses, minerals and vitamins Treatments Cow enrollment lasted 15 weeks, and in a given week all cows at 46 3 DIM were blocked by parity such that each block had either 2 primiparous or 2 multiparous cows. Within each block, a cow was assigned randomly to 1 of 2 treatments (Figure 5 1). Cows had their estrous cycle presynchronized with 2 i.m. injections of 25 mg of PGF (Lutalyse, 5 mg/mL dinoprost tromethamine sterile solution, Pfizer Animal Health, New York, NY) given 14 d apart, at 46 3 and 60 3 DIM. At 72 3 DIM, cows rece ived an i.m. injection of 100 g of GnRH (Cystorelin, 50 g/mL of gonadorelin diacetate tetrahydrate, Merial Ltd., Duluth, GA) followed by injections of PGF 5 and 6 d later (Santos et al., 2010). Cows then received either 1) a second injection of GnRH 56 h after the first PGF of the synchronization protocol and timed AI 16 h later ( OVS56 n = 634; 241 primiparous and 393 multiparous); or 2) a second injecti on of GnRH and timed AI at 72 h after the first PGF of the synchronization protocol ( COS72 n = 593; 236 primiparous and 357 multiparous). Cows were painted with chalk on their tailheads daily after the first GnRH of the timed AI protocol and removal of chalk was used as indication of estrus. Forty of the original 1,267 cows were observed in estrus and inseminated before the scheduled timed AI; therefore, they did not receive any of the treatments evaluated in the present experiment. These cows were not i ncluded in the statistical analyses and a total of 1,227 cows remained in the study.

PAGE 149

149 Pregnancy d iagnosis and c alculation of r eproductive o utcomes Pregnancy was diagnosed by transrectal ultrasonography (Easi Scan equipped with 7.5 MHz linear transducer, BCF Technology, Livingston, UK) on d 32 after the timed AI. Presence of an amniotic vesicle with a live embryo (i.e., with heart beat) was used as determinants of pregnancy. Pregnant cows on d 32 were re examined for pregnancy by transrectal palpation 4 wk la ter, on d 60 of gestation. Pregnancy per AI was calculated by dividing the number of cows diagnosed pregnant at 32 or 60 d after AI by the number of cows receiving AI. Proportion of pregnancy loss was calculated as the number of cows that lost a pregnancy between d 32 and 60 after AI divided by the number of cows diagnosed pregnant on d 32 after AI. Milk yield and BCS Body condition score ( BCS ) of all cows was recorded (Ferguson et al., 1994) on the day of the first PGF of the presynchronization protocol at 46 3 DIM. For analysis an on farm milk meter (Tru Test Ltd., Manukau, New Zealan d). The average for the first 3 mo postpartum was used in the statistical analysis. Cows were categorized according to milk production above or below the mean value within parity. Experiment 2 Cows, h ousing, and d iets Lactating Holstein cows, 285 primiparo us and 390 multiparous, from a single site in Central Florida were assigned to the study. Cows were housed and fed as described in experiment 1. Inseminations were performed from February 2nd to June 4th, 2009.

PAGE 150

150 Treatments Cows diagnosed as nonpregnant by t ransrectal ultrasonography on d 32 after the first AI postpartum (112 3 DIM) were enrolled in experiment 2. Cows were blocked by parity and method of synchronization at first AI (from experiment 1: AI at estrus, OVS56, or COS72) at 112 3 DIM. Within ea ch block of 2 cows, they were assigned randomly to 1 of 2 treatments (Figure 5 2). All cows received an injection of GnRH 2 d after the nonpregnancy diagnosis (d 34 after the previous AI), followed by an injection of PGF 5 and 6 d after the first GnRH. A second injection of GnRH was administered 56 h after the first PGF and insemination was performed 16 h later. Cows assigned to control ( RCON n = 334) did not receive any further treatment, whereas cows assigned to supplemental progesterone ( RCIDR n = 341) received an intravaginal insert containing 1.38 g of progesterone (Eazi Breed CIDR Cattle Insert, Pfizer Animal Health, New York, NY) from the first GnRH to the first PGF of the resynchronization protocol. Cows were painted with chalk on their tailh eads daily after the first GnRH of the resynchronization protocol and removal of chalk was used as an indication of estrus. Thirty nine of the 675 cows were observed in estrus after the first PGF of the resynchronization and before the day of timed AI. Because they received the treatments and display of estrus might have been influenced by supplemental progesterone, these cows remained in the statistical analyses. Ultrasonography of o varies A subs et of 576 cows had their ovaries examined on the day of the first GnRH of the resynchronization by transrectal ultrasonography and the presence of a CL was recorded to determine if responses to resynchronization treatments differed according to ovarian sta tus of cows. Another subset of cows from both RCON (n = 173) and

PAGE 151

151 RCIDR (n = 167) treatments were scanned during the resynchronization protocol on the days of the first PGF and second GnRH injections (Figure 5 2). A map of each ovary was drawn and the pos Ovulation in response to the first GnRH of the resynchronization protocol was determined as the presence of a newly formed corpora lutea ( CL ) on the day of the first PGF injection; therefore it was considered only for cows evaluated at both injections. 8 mm in diameter present at the first PGF and absent at the second GnRH injection. Blood s ampling and a nalysi s of p rogesterone in p lasma Blood was sampled from 398 cows by puncture of the coccygeal vein or artery into evacuated tubes containing K 2 e thylenediaminetetraacetic acid ( EDTA ; Vacutainer; Becton Dickinson, Franklin Lakes, NJ). Blood was sampled on the da y of AI and 7 d later. Samples were immediately cooled by placing them on ice and they arrived at the laboratory within 6 h of collection. Blood tubes were centrifuged at 3,000 x g for 15 min in a refrigerated centrifuge at 4C for plasma separation. Pl asm a samples were frozen at 20 C for later analyses. Concentration of progesterone was analyzed in all plasma samples by radioimmunoassay ( RIA ) using a commercial kit (Coat a Count, Siemens Healthcare Diagnostics, Los Angeles, CA). The sensitivity of the ass ay was 0.1 ng/mL calculated at 2 SD below the mean counts per minute at maximum binding. Samples were analyzed in 3 assays. A moderate (1.5 ng/mL) and a high (2.5 ng/mL) concentration sample was incorporated several times in each assay and used to calculat e the intra assay coefficient of variation ( CV ) The intra assay CV were 5.3, 5.2 and 5.7% for the first, second and third assays, respectively. The inter assay CV was 7.1%.

PAGE 152

152 Evaluation of p rotocol s ynchronization Synchronization of the estrous cycle after treatments was evaluated in 409 cows based on two different criteria. In both cases, cows that had premature ovulation (between PGF and final GnRH) were considered to not have a synchronized estrous cycle. First, the standard 1 ng/mL concentration of pro gesterone was used to determine Cows with low and high progesterone on the day of AI and 7 d later, respectively, were considered to have a synchronized estrous cycle. A second criterion was used based on the cut point for concentrations of progesterone in plasma that best predicted pregnancy on d 32 after AI. Receiver operator characteristic ( ROC ) curves were used to determine the concentrations of .41 ng/mL) and on d 7 after AI (> 2.26 ng/mL) that resulted in highest accuracy for prediction of pregnancy on d 32 after insemination. Cows with were considered to have a s ynchronized estrous cycle. Pregnancy d iagnosis and c alculation of r eproductive o utcomes Pregnancy diagnosis and calculation of reproductive outcomes were performed as described in experiment 1. Milk yield Milk production during the first 3 mo postpartum considered for experiment 1 were used in experiment 2. Cows were categorized according to milk production as described for experiment 1.

PAGE 153

153 Experimental d esign and s tatistical a nalyses Experiment 1 Cows were assigned to treatments in a randomized block desig n. Weekly, cows in the range of 43 to 49 DIM were blocked by parity (primiparous or multiparous) and randomly assigned to 1 of 2 treatments within each block. A sample size calculation was performed (Minitab ver. 15, Minitab Inc., State College, PA) to all ow for sufficient experimental units to detect a difference of 6 percentage units between treatments of 518 to 534 experimental units per treatment were calculated to be needed to detect a statistical effect under the range of expected P/AI. More cows were added to secure that potential attrition during the study would not limit the number of experimental units initially planned. Binary responses were analyzed by logistic regression using the LOGISTIC procedure of SAS version 9.2 (SAS/STAT, SAS Institute Inc., Cary, NC, USA). A backward stepwise regression model was used and variables were removed continuously from the model by the Wald statistic criterion if the significan ce was > 0.10. Initial models included the effects of treatment, parity, BCS, milk yield, and interactions of treatment and parity, treatment and BCS, and treatment and milk yield. Treatment was forced into the final model in all analyses. Effects of insem inator and sire, and their interactions with treatment were included in the models for P/AI and pregnancy loss. Additional covariates and their interactions with treatment were added to the models if univariate analyses identified them as significant ( P < 0.10). Adjusted odds ratio ( AOR ) and 95% confidence interval ( CI ) were reported.

PAGE 154

154 Treatment differences with P P 0.10 were considered as a tendency. Experiment 2 Cows were assigned to treatments in a randomize d block design. Weekly, cows diagnosed as nonpregnant after the first AI were blocked by method of insemination at first insemination (from experiment 1: AI on estrus, OVS56, or COS72) and parity (primiparous or multiparous) and, within each block, they we re randomly assigned to 1 of 2 resynchronization treatments. Binary responses were analyzed as described in experiment 1. Initial models included the effects of treatment, parity, milk yield, and interactions between treatment and parity, and treatment and milk yield. Effects of inseminator and sire, and their interactions with treatment were included in the models for P/AI and pregnancy loss. Concentrations of progesterone at AI and on d 7 after AI were analyzed by analysis of variance ( ANOVA ) using the GL IMMIX procedure of SAS for normal distribution. The models included the effects of treatment, parity, milk yield, and interactions between treatment and parity. Receiver operating characteristic curve were generated using the ROC curve analysis option of MedCalc version 11.2.1 (MedCalc Software, Mariakerke, Belgium) to determine the optimal concentration of progesterone at AI and on d 7 after AI that results in greatest sensitivity and specificity to predict pregnancy in dairy cows. Treatment differences with P P 0.10 were considered as a tendency.

PAGE 155

155 Results Experiment 1 Average BCS and milk yield did not differ between OVS56 (2.81 0.01 and 44.1 0.43 kg/d) and COS72 (2.79 0.01 and 43.6 0.43 kg/d). Cows in COS72 were more likely (P < 0.001) to be detected in estrus on the day of AI than cows in OVS56 (Table 5 1). A tendency (P = 0.08) for an interaction between treatment and milk yield was detected, and most of the effect was observed in cows with milk yi eld below the mean (45.1 vs. 31.7% for COS72 and OVS56, respectively), and less so for cows with milk above the mean (36.2 vs. 32.9% for COS72 and OVS56, respectively). Primiparous cows were more likely (P = 0.03) to be detected in estrus at AI than multip arous cows (40.3 vs. 33.8%; AOR = 1.32; 95% CI = 1.03 to 1.68), but no interaction between treatment and parity was observed. Expression of estrus did not differ between cows classified as low or moderate BCS. Treatment did not affect P/AI on either d 32 o r 60 after AI (Table 5 1). Expression of estrus at AI was not associated with P/AI on either d 32 (estrus = 45.6 vs. no estrus = 46.2%) or d 60 after AI (estrus = 39.6 vs. no estrus = 39.9%). Parity and milk yield did not influence P/AI, but cows with moderate BCS had greater (P < 0.001) P/AI than those with low BCS (43.1 vs. 31.0%; AOR = 1.68; 95% CI = 1.29 to 2.19). The risk of pregnancy loss between d 32 and 60 of gestation did not differ between treatments (Table 5 1). Pregnancy loss was not influenced by expression of estrus at AI, milk yield, and BCS, or by their interactions with treatment. Although pregnancy loss did not differ between multiparous (14.9%) and primiparous (10.0%), an interaction (P = 0.02) between treatment and parity was observed. For multiparous cows, pre gnancy loss tended (P = 0.06) to increase when receiving COS72 compared with OVS56 (19.5 vs.

PAGE 156

156 10.7%; AOR = 1.82; 95% CI = 0.99 to 3.34); however, for primiparous cows no difference was observed for cows receiving COS72 and OVS56 (7.1 vs. 12.8%; AOR = 0.52, 95% CI = 0.20 to 1.37). Experiment 2 The average milk yield in the first 3 mo postpartum did not differ between RCON (42.8 0.56 kg/d) and RCIDR cows (42.8 0.59 kg/d). On the day of the first GnRH at 34 d after previous AI, 72.2% of the cows had a visi ble CL present in the ovaries and the proportion was not different between treatments (RCON = 71.6 vs. RCIDR = 72.8%). Ovarian r esponses and p rogesterone c oncentrations in p lasma Ovulation to the first GnRH of the resynchronization on d 34 after the previo us AI was low, and it did not differ between treatments (Table 5 2). Cows without a CL had greater ( P < 0.001) ovulation in response to GnRH than those with a CL (77.4 vs. 20.8%; AOR = 16.40; 95% CI = 8.62 to 31.25), but no interaction between method of re synchronization and presence of CL was observed for ovulation rate. The proportion differ between RCON and RCIDR. Similarly, the diameter of the largest follicle on th e day before AI was not affected by treatment. A small proportion of cows ovulated between the first PGF and second GnRH injections of the resynchronization protocol (5.6%; 19/340). The risk of premature ovulation tended ( P = 0.08) to be less for cows s upplemented with progesterone during the resynchronization protocol than for non supplemented cows (Table 5 2). Occurrence of premature ovulation was not affected by the presence of a CL at the beginning of the resynchronization protocol and no interaction between treatment and

PAGE 157

157 the presence of a CL was found to affect occurrence of premature ovulation. The proportion of cows that ovulated between the first PGF and second GnRH injections of the resynchronization protocol tended ( P = 0.08) to be greater for primiparous than for multiparous cows (7.7 vs. 3.5%; AOR = 2.65; 95% CI = 0.91 to 7.75). Concentration of progesterone in plasma on the day of AI and 7 d later did not differ between treatments (Table 5 2). Parity did not affect plasma concentration of progesterone at AI. Primiparous cows, however, had a greater ( P = 0.02) concentration of progesterone in plasma on d 7 after AI than multiparous cows (2.97 0.11 vs. 2.64 0.10 ng/mL). Concentration of progesterone in plasma was similar between cows with milk production above and below the average on both the day of AI and 7 d later. Receiver operating characteristic curves were generated to determine the concentration of progesterone in plasma sampled on the day of AI and 7 d later with greatest accurac y to predict pregnancy on d 32 after insemination. On the day of AI, the concentration that resulted in the greatest combined sensitivity (94.6%; 95% CI = 90.3 after AI, t he best cut off concentration was > 2.26 ng/mL, resulting in a sensitivity of 83.2% (95% CI = 77.1 to 88.3) and specificity of 47.6% (95% CI = 40.6 to 54.6). 1.0 ng/mL on the d ay of AI were not affected by treatment (Table 5 2). Similarly, the d after AI did not differ between treatments. Synchronization of estrous cycle after treatments eithe r using progesterone concentration of 1 ng/mL at AI and 7 d later, or

PAGE 158

158 points were not influenced by supplementation with progesterone during resynchronization. Estrus at AI, pregnancy per AI, a nd p regnancy l oss The incorporation of a CIDR insert to the resynchronization protocol did not affect expression of estrus at AI (Table 5 3). The presence of a visible CL at the beginning of the resynchronization protocol did not influence expression of es trus at AI and no interaction between presence of a CL and treatment was observed. Milk production was not associated with expression of estrus. Nonetheless, an interaction ( P = 0.04) between treatment and milk yield was observed for detection of estrus be cause supplementation with progesterone tended ( P = 0.10) to increase the proportion of cows in estrus at AI for those with production above the mean (39.1 vs. 29.8%; AOR = 1.52; 95% CI = 0.92 to 2.49), but not for cows with production below the mean (RCID R = 26.8 vs. RCON = 33.1%; AOR = 0.74; 95% CI = 0.45 to 1.21). Expression of estrus at AI was not affected by parity or by the interaction between treatment and parity. Supplementation with progesterone during the resynchronization protocol increased ( P 0.05) P/AI on d 32 and 60 after the second AI postpartum (Table 5 3). Interestingly, the benefit from the CIDR was observed only in cows that had a CL when the resynchronization protocol was initiated, and these differences were 8 and 9 percentage units g reater on d 32 and 60 after AI, respectively (Figure 5 3). Pregnancies per AI on d 32 and 60 after insemination were not affected by detection of estrus at AI, and no interaction between expression of estrus and supplementation with progesterone on P/AI wa s observed. Primiparous had greater ( P = 0.03) P/AI than multiparous cows on d 60 after AI (46.8 vs. 37.9%; AOR = 1.43; 95% CI = 1.05 to 1.95). No interactions between treatment and parity were observed on P/AI. Cows with a CL

PAGE 159

159 of the resynchronization had greater ( P < 0.05) P/AI on d 32 (47.7 vs. 29.7%; AOR = 2.25; 95% CI = 1.07 to 4.76) and on d 60 after AI (41.4 vs. 24.3%; AOR = 2.36; 95% CI = 1.06 to 5.24). The risk of pregnancy loss was not affected by supplementation with progesterone during the resynchronization protocol (Table 5 3). Cows detected in estrus at AI tended ( P = 0.09) to have less risk of pregnancy loss than those not in estrus (6.5 vs. 12.8%; AOR = 0.45; 95% CI = 0.17 to 1.15). Parity and milk yield were not associated with risk of pregnancy loss in the first 60 d of gestation. Discussion The success of programs for synchronization of the estrous cycle and ovulation depends on an orchestrated manipulation of physiological processes such as recruitment of a new follicular wave, control of follicular dominance (Cerri et al., 2009), length of proestrus (Bridges et al., 2008), and the interval between induction of ovulation with GnRH and AI (Pursle y et al., 1998). Reduction in the period of follicular dominance was shown to improve embryo quality (Cerri et al., 2009). Accordingly, shortening the interval between the initial GnRH and the injection of PGF from 7 to 5 d increased P/AI in lactating da iry cows (Santos et al., 2010). No differences in P/AI were observed when induction of ovulation using GnRH was performed either 16 h before or concurrent with timed AI at 72 h after the first PGF injection in the 5 d program. This is contrary to previo us research with cows subjected to a standard 7 d (from GnRH to PGF injections) Ovsynch program in which optimal P/AI was achieved when AI was performed 16 h after GnRH induction of ovulation, and it was significantly reduced when cows were inseminated s imultaneously with induction of ovulation (Pursley et al., 1998; Brusveen et al., 2008). In the present

PAGE 160

160 experiment, delaying the final GnRH to 72 h allowed for a longer period of proestrus for COS72 than for OVS56, which resulted in a greater proportion of cows detected in estrus on the day of AI. The longer proestrus period for the COS72 treatment occurred with a comparable period of low progesterone from luteolysis to AI in both treatments. The advantage of performing AI 16 h after the final GnRH has bee n attributed to the synchrony between oocyte and numbers of viable sperm available for fertilization (Saacke, 2008). Cows subjected to the 7 d program are expected to ovulate approximately 28 h after the final GnRH (Pursley et al., 1995), which is similar to the time of ovulation relative to the onset of estrus described for lactating dairy cows (27.6 h; Walker et al., 1996). Insemination of dairy cows at the onset of estrus reduced fertilization rate (Dalton et al., 2001) and P/AI (Dransfield et al., 1998) compared with AI 12 h later. This reduction was associated with a decrease in the number of accessory spermatozoa per embryo/ovum, suggesting a continuous loss of functional sperm reservoirs in the additional 12 h preceding ovulation (Dalton et al., 2001) Therefore, insemination of cows 16 h after the final GnRH might increase the number of sperm available for fertilization compared with insemination concurrent with the final GnRH. Although administration of the final GnRH 16 h before the AI has been sho wn to benefit fertility of cows in the standard 7 d timed AI program, the additional 16 h of proestrus for cows in COS72 would allow for further growth of the ovulatory follicle (Peters and Pursley, 2003), greater concentrations of estradiol, and more cows in estrus at the time of AI (Hillegass et al., 2008). This might be particularly important in a program with a reduced period of follicle development. Fertility of dairy cows has been positively associated with the diameter of the ovulatory follicle (Vasc oncelos et al.,

PAGE 161

161 2001) and concentrations of estradiol in plasma (Lopes et al., 2007). In fact, P/AI in response to timed AI programs are generally superior for cows detected in estrus on the day of insemination compared with cows that do not exhibit signs of estrus (Hillegass et al, 2008; Santos et al., 2010). In the 5 d program, the period of follicular growth is shortened by 2 d compared with the 7 d programs, which results in smaller ovulatory follicles, reduced concentrations of estradiol and a lesser p roportion of cows in estrus at AI (Santos et al., 2010). Although administration of ther final GnRH concurrently with timed AI reduced P/AI in a 7 d program (Pursley et al., 1998; Brusveen et al., 2008) it is possible that the additional 16 h of proestrus might benefit fertility of dairy cows in the 5 d program and may have offset the better synchrony between induction of ovulation and AI offered by the OVS56. Indeed, experiments conducted with beef cows have shown that reducing the interval from the initi al GnRH to the PGF increased P/AI only when the period of proestrus was extended from 60 to 72 h (Bridges et al., 2008). This might be even more important for high producing dairy cows considering the extensive metabolism of steroids (Sangsritavong et al ., 2002) and the generally low concentrations of estradiol in plasma during proestrus (Lopes et al., 2007; Hillegass et al., 2008). Intravaginal inserts for controlled release of progesterone have been used to improve synchrony of ovulation and P/AI in re sponse to timed AI protocols with variable success (Chebel et al., 2006; Lima et al., 2009). After the first postpartum AI, approximately 55 to 65% of the cows are expected to be diagnosed as nonpregnant 28 to 35 d after insemination. The stage of the estr ous cycle on which the first GnRH of resynchronization protocol is administered influenced the subsequent P/AI in some

PAGE 162

162 (Fricke et al., 2003; Sterry et al., 2006), but not all studies (Silva et al., 2009). In experiment 2, cows received the first GnRH of th e resynchronization protocol 34 d after the previous AI. The length of the estrous cycle in lactating dairy cows averages 22.9 0.7 d (Sartori et al., 2004); therefore, on average, it is expected that most of the cows would be on d 11 of the estrous cycle when the resynchronization protocol was initiated. This is important because approximately 50% of the cows treated with GnRH between d 10 and 16 of the estrous cycle failed to ovulate (Vasconcelos et al., 1999), which in association with spontaneous regre ssion of the CL before the injection of PGF resulted in increased premature ovulation at the end of the synchronization program and reduced fertility (Vasconcelos et al., 1999). In the present study, 11.6% of the cows did not bear a CL at the injection of PGF which reduced P/AI. A greater than anticipated proportion of cows did not have a visible CL by ultrasonography on the day of the first GnRH of the resynchronization (27.8%). This is similar to results reported by Bartolome et al. (2009), but also indicates that a large proportion of the resynchronized cows were not on the expected days of the new estrous cycle as one might expect. Although ovulation to the first GnRH has been shown to decline in cows that receive a CIDR (Galvo et al., 2004; Stev enson et al., 2006), this response has not been consistent (Lima et al., 2009). A possible reason for lack of effect of CIDR on ovulation to GnRH in the current study was the day when the protocol was initiated. Overall, the ovulatory response was low, onl y 35.6%, which indicates that most cows did not have a follicle responsive to a GnRH/ luteinizing hormone ( LH ) surge, thereby limiting a potential effect of progesterone blocking ovulation. Progesterone released by the CIDR insert acts to reduce LH pulsatil ity and to block the preovulatory LH surge

PAGE 163

163 (Rathbone et al., 2001); therefore, it potentially reduces the occurrence of premature ovulations during a timed AI protocol. In fact, the odds of ovulating before the final GnRH injection tended to be lesser for cows supplemented with progesterone during the resynchronization protocol in experiment 2. It is possible that a portion of cows that did not ovulate prematurely as assessed here had an endogenous surge of LH before the final injection of GnRH, which would result in ovulation early after AI and reduce P/AI (Saacke, 2008). The supplementation with progesterone is also expected to reduce the incidence of endogenous surges of LH which could account for some of the increased fertility observed in RCIDR cows in the present study. High producing dairy cows have reduced plasma concentrations of progesterone during follicular development (Sartori et al., 2004), which may increase LH pulsatility and reduce oocyte competence and embryo quality (Inskeep, 2004). In fac t, greater concentrations of progesterone during development of the ovulatory follicle have been associated with improved fertility in dairy cows (Bisinotto et al., 2010 ; Chapters 3 and 4 ). Use of a single CIDR insert increased the concentration of progest erone in plasma by approximately 0.9 ng/mL (Lima et al., 2009); therefore, it is inadequate to increase progesterone in cows not bearing a CL to concentrations comparable to those of cows in diestrus (Lima et al., 2009). Nonetheless, it is possible that th e additional progesterone from the CIDR insert complemented luteal synthesis of progesterone and allowed for adequate follicular maturation, which resulted in increased P/AI. Similar to our findings, supplementation with progesterone tended to improve P/AI only in cows that had an active CL at the initiation of the Ovsynch protocol (Bartolome et al., 2009).

PAGE 164

1 64 Conclusion Fertility of lactating dairy cows subjected to a 5 d timed AI protocol was not affected by the time of administration of the final GnRH relat ive to AI. As opposed to standard timed AI programs with an interval of 7 d from the first GnRH to induction of luteolysis, in the 5 d program induction of ovulation with GnRH administered concurrently with AI resulted in similar fertility compared with in ducing ovulation 16 h before AI. During resynchronization starting on d 34 after the previous AI, the incorporation of a CIDR insert in to the 5 d timed AI program improved P/AI, primarily in cows with a CL at the initiation of the resynchronization The b enefits of the CIDR were observed despite major changes in synchronization of the estrous cycle after AI.

PAGE 165

165 Table 5 1. Effect of moment of administration of the final GnRH relative to timed AI on fertility responses of dairy cows Experiment 1 Treatment 1 OVS56 COS72 AOR (95% CI) 2 P Estrus at timed AI 3 32.4 (199/615) 40.6 (235/579) 1.44 (1.13 1.83) <0.001 Pregnant Day 32 46.4 (294/634) 45.5 (270/593) 1.00 (0.78 1.26) 0.99 Day 60 40.7 (256/629) 38.6 (228/591) 0.94 (0.75 1.18) 0.60 Pregnancy loss 4 11.4 (33/289) 14.9 (40/268) 1.37 (0.84 2.25) 0.21 1 All cows had their estrous cycle presynchronized with 2 injections of PGF given 14 d ays apart and the timed AI protocols initiated 12 d ays later. COS72 = d ay 0 GnRH, d ays 5 and 6 PGF d ay 8 GnRH + timed AI; OVS56 = d ay 0 GnRH, d ays 5 and 6 PGF d ay 7.3 GnRH, d ay 8 timed AI. 2 AOR = adjusted odds ratio; CI = confidence interval. OVS56 is the reference for comparison. 3 Evaluated based on removal of tail chalk at timed AI. 4 Number of pregnant cows on d ay 32 that were not pregnant on d ay 60 divided by the number of pregnant cows on d ay 32. Five OVS56 and two COS72 cows left the study before reconfirmation of pregnancy on d ay 60 after AI.

PAGE 166

166 Table 5 2. Effect of supplementation with progesterone during the resynchronization protocol on fertility responses of dairy cows Experiment 2 Treatment 1 RCON RCIDR AOR (95% CI) 2 P Ovulation to 1 st GnRH, % (n/n) 36.5 (58/159) 34.8 (56/161) 1.07 (0.62 1.86) 0.81 CL at PGF 2 % (n/n) 86.8 (138/159) 90.1 (145/161) 1.34 (0.66 2.71) 0.42 Diameter of largest follicle 3 mm 16.4 0.4 15.5 0.4 --0.13 Premature ovulation 4 % (n/n) 7.5 (13/173) 3.6 (6/167) 0.38 (0.13 1.12) 0.08 Progesterone, ng/mL Day of AI 0.24 0.04 0.31 0.04 --0.12 7 d ays after AI 2.88 0.11 2.73 0.11 --0.35 Progesterone 5 % (n/n) < 1.00 ng/mL at AI 96.4 (186/193) 95.1 (195/205) 0.73 (0.27 1.97) 0.54 ng/mL 7 d ays after AI 94.3 (182/193) 90.2 (185/205) 0.56 (0.26 1.20) 0.14 89.1 (172/193) 90.2 (185/205) 1.13 (0.59 2.16) 0.71 > 2.26 ng/mL 7 d ays after AI 66.3 (128/193) 67.3 (138/205) 1.04 (0.68 1.58) 0.87 Synchronization 6 % (n/n) Progesterone at 1 ng/mL 84.9 (169/199) 84.3 (177/210) 0.95 (0.56 1.63) 0.86 Greatest accuracy 52.8 (105/199) 59.1 (124/210) 1.29 (0.87 1.91) 0.20 1 Nonpregnant cows had their estrous cycle resynchronized 34 d ays after the first postpartum AI. RCON = d ay 0 GnRH, d ays 5 and 6 PGF d ay 7.3 GnRH, d ay 8 timed AI; RCIDR = d ay 0 GnRH + CIDR insertion, d ay 5 PGF + CIDR removal, d ay 6 PGF d ay 7.3 GnRH, d ay 8 timed AI. 2 AOR = adjusted odds ratio; CI = confidence in terval. RCON is the reference for comparison. 3 Measured on the day before AI. 4 and absent at the second GnRH injection. 5 Concentration of progesterone in plasma on the day of AI and 7 d later using conventional cut off values (1 ng/mL) or optimized ay 7 (> 2.26 ng/mL) according to greatest accuracy from the receiv er operator characteristic curves to predict pregnancy on d ay 32 after AI. 6 d ay 7 after AI; Greatest accuracy = cows without prematur 2.26 ng/mL on d ay 7 after AI.

PAGE 167

167 Table 5 3. Effect of supplementation with progesterone during the resynchronization protocol on fertility responses of dairy cows Experiment 2 Treatment 1 RCON RCIDR AOR (95% CI) 2 P Estrus at timed AI 3 31.5 (90/286) 32.5 (96/295) 1.05 (0.74 1.48) 0.80 Pregnant Day 32 43.1 (144/334) 51.3 (175/341) 1.38 (1.02 1.88) 0.04 Day 60 37.8 (126/333) 45.5 (153/336) 1.37 (1.00 1.87) 0.05 Pregnancy loss 4 11.9 (17/143) 10.0 (17/170) 0.82 (0.40 1.68) 0.59 1 Nonpregnant cows had their estrous cycle resynchronized 34 d ays after the first postpartum AI. RCON = d ay 0 GnRH, d ays 5 and 6 PGF d ay 7.3 GnRH, d ay 8 timed AI; RCIDR = d ay 0 GnRH + CIDR insertion, d ay 5 PGF + CIDR removal, d ay 6 PGF d ay 7.3 GnRH, d ay 8 timed AI. 2 AOR = adjusted odds ratio; CI = confidence interval. RCON is the reference for comparison. 3 Evaluated based on removal of tail chalk at timed AI. 4 Number of pregnant cows on d ay 32 that were not pregnant on d ay 60 divided by the number of pregnant cows on d ay 32. One RCON and 5 RCIDR cows left the study before reconfirmation of pregnancy on d ay 60 after AI.

PAGE 168

168 Figure 5 1 Diagram o f activities during experiment 1 COS72 = Cosynch 72, induction of ovulation with GnRH concurrent with AI; OVS56 = Ovsynch 56, induction of ovulation with GnRH 16 hours before AI

PAGE 169

169 Figure 5 2. Diagram of activities during experiment 2. BS = b lood samples for analysis of progesterone concentration in plasma; CIDR = controlled internal drug release containing 1.38 g of progesterone; RCIDR = treatment with CIDR; RCON = no treatment with CIDR; US = ultrasonography of ovaries.

PAGE 170

170 Figure 5 3 Pregnancy per AI according to presence of CL at the first GnRH of the resynchronization protocol (experiment 2). Solid bars = RCON (d ay 0 GnRH, d ays 5 and 6 PGF d ay 7.3 GnRH, d ay 8 timed AI); Open bars = RCIDR (d ay 0 GnRH + CIDR insertion, d ay 5 PGF + CIDR removal, d ay 6 PGF d ay 7.3 GnRH, d ay 8 timed AI). Number of cows were: RCON with CL = 204; RCIDR with CL = 215; RCON without CL = 79 ; and RCIDR without CL = 78.

PAGE 171

171 CHAPTER 6 GENERAL DISCUSSION A ND CONCLUSION According to reports from the USDA, the US produced a total of 190,396 millions of pounds of milk in the year of 2009. The yearly milk production per cow has grown approximately 1.3% per year during the last decade, which resulted in a n increment of 16,500 lbs/cow/year from the average cow in the 1940s to the current American dairy cow. This remarkable boost was obtained through advances in genetic selection and spreading of superior lineages, nutrition plans for both dry and lactating cows, sanitary contro l of herds, and systematic reproductive management. Reproductive performance exert s been estimated in $ 278.00, whereas the cost of losing a pregnancy is $ 555.00 (De Vries, 2006). This is because submission rate, pregnancy per AI ( P/AI ) and risk of pregnancy loss have a direct effect on time to conception, which in turns determine the average days in milk ( DIM ) of the herd and, consequently, the average milk yield According would allow for further improve ment in reproductive efficiency. Delayed resumption of ovulation postpartum is an endemic condition among dairy herds. Reports from Canada and the US have shown that, within h erds, the proportion of anovular cows between 60 and 65 DIM might be greater than 40 % (Walsh et al., 2007; Santos et al., 2009). This becomes critical because, when subjected to timed artificial insemination ( AI ) programs, anovular cows were 40.1% less lik ely to conceive and twice as likely to lose their pregnancies compared to cyclic cows (Santos et al., 2009 ,2004 ). Consequently, the interval from calving to pregnancy was 30 days longer for anovular cows (Walsh et al., 2007). Ovulation in response to the f irst injection of

PAGE 172

172 gonadotropin releasing hormone ( GnRH1 ) was greater for anovular cows, whereas corpora lutea ( CL ) regression in response to prostaglandin ( PG ) F and ovulation following the final GnRH did not differ between anovular and cyclic cows (Gmen et al., 2003). The refore, the response to hormonal treatments is unlikely to explain the negative effect of anovulation on fertility. The results from the first experiment presented in Chapter 3 also showed a reduction in P/AI for anovular cows; however, when cyclic cows were classified according to their concentration of progesterone at the GnRH1, it became clear that the difference was between anovular cows and cyclic cows with a functional CL at the initiation of the synchronization protocol. Anovular cows and cyclic cows with low progesterone at the GnRH1 had similar P/AI. C yclic cows with progesterone at the GnRH1 likely in diestrus, which would likel y result in the ovulation of a SW dominant follicle after a GnRH PGF based synchronization protocol. Conversely cyclic cows with progesterone <1 ng/mL at GnRH1 would likely be in proestrus, estrus, or metestrus and they would likely ovulate a first wave ( FW ) dominant follicle at AI. Similarly, anovular cows that successfully respond to a GnRH PGF based synchronization protocol are expected to ovulate the dominant follicle from the FW at AI which suggests that the ovulation of a FW dominant follicle mi ght be one of the components of the poor fertility observed in anovular dairy cows. Results from the second experiment confirmed that cows induced to ovulate FW dominant follicles were less fertile than those induced to ovulate follicles from the second wave ( SW ) The mechanisms that underlie the reduction in fertility observed in anovular cows have been associated with lack of exposure to progesterone after calving (Crowe, 2008). Nonetheless, results from the first study presented here suggest that, if m ediated

PAGE 173

173 by low concentrations of progesterone, the negative effects of anovulation require a much shorter period on which progesterone is reduced. The lack of progesterone priming in anovular cows was suggested to reduce CL lifespan during subsequent estro us cycle (Crowe, 2008); however, supplementation with progesterone 20 to 15 days before ovulation was unable to extend subsequent interestrus interval (Kyle et al., 1992) Conversely, using a model that induces low concentrations of progesterone via treatm ent with PGF early after ovulation, others have shown an increase in oxytocin induced release of PGF (Shaham Albalancy et al., 2001; Cerri et al., 2008 a ) associated with an increase in the proportion of cows with shortened luteal phases (Cerri et al., 2008 a ) In beef cows, this phenomena has been attributed to a premature downregaulation of progesterone receptors and an early and increased expression of receptors for oxytocin in the endometrium (Zollers et al., 1989, 1993). Current results regarding lut eal function and CL lifespan following the ovulation of FW and SW dominant follicles are somewhat controversial. In Chapter 3, cows on which reduced concentrations of progesterone during development of the ovulatory follicle were expected (anovular and CLO W cows) had increased incidence of short cycles. On the other hand, in a controlled study (Chapter 4 ), none of the cows had regressed their CL before day 17 of the estrous cycle, in disregard of wave of the ovulatory follicle and concentration of progester one during follicular growth. Indeed, luteal function was enhanced in cows subjected to reduced concentrations of progesterone. Cows that ovulated FW follicles and were not supplemented with progesterone ovulated a larger follicle and produced more estradi ol (Chapter 4 ), presumably caused by enhanced luteinizing hormone ( LH ) pulse frequency (Evans et al., 1987) which resulted in a larger

PAGE 174

174 CL and greater circulating concentrations of progesterone after ovulation. This is in agreement with previous studies th at reported that ovulation of larger follicles resulted in the formation of larger CL and greater concentration of progesterone in plasma (Vasconcelos et al., 2001). Further more Wolfenson et al. (1999) reported that circulating concentrations of progesterone following ovulation of FW follicles was either greater (1 st replicate) or similar (2 nd replicate) to those observed following ovulation of SW follicles. Furthermore, no difference on the day of CL regression was reported (Wolfenson et al., 199 9). A greater capability of theca cells, but not granulosa cells, to produce progesterone after luteinization in vitro was reported for FW follicular cells (Wolfenson et al., 1999). In the present study (Chapter 4 ), messenger ribonucleic acid ( mRNA ) abunda nce for steroidogenic acute regulatory protein ( StAR ) was greater in FW derived CL when no progesterone was supplemented. This might partially explain the increase in steroidogenesis per cells described by Wolfenson et al. (1999). Nonetheless, the ratio be tween circulating progesterone and CL measures (Chapter 4 ) indicates that the greater total mass of cells producing progesterone is more important than the in crease in progesterone production per cell. The results presented in the current thesis (Chapters 3 and 4 ) clearly show that 1) ovulation of FW dominant follicles reduces fertility of dairy cows; 2) that this negative effect is mediated by reduced concentrations of progesterone during the development of the ovulatory follicle; and 3) that ovulation of FW that grow under low concentrations of evaluation of the effects on endometrium and oocyte are needed to the precise the underlying mechanisms. It has been shown tha t cows induced to ovulate FW dominant

PAGE 175

175 follicles had less P/AI (Chapter 3) and that a tendency for reduced P/AI was detected as early a s day 17 of gestation (Chapter 4 ). One of our initial hypotheses was that the hormonal milieu that precedes ovulation of F W follicles would modulate endometrial gene expression during subsequent cycle. Particularly, that exposure to reduced circulating progesterone would reduce endometrial expression of progesterone receptors and enhance that of oxytocin receptors (Zollers et al., 1989, 1993). The first obvious consequence of that would the hastening of luteolysis (Cerri et al., 2008 a ). This hypothesis was somewhat supported in Chapter 3, but could not be confirmed based o n results presented in Chapter 4 Nonetheless, the acti on of progesterone on its receptors is crucial for endometrial secretion of the histotroph (Bazer et al., 2008). Therefore, it is possible that a slight modulation of endometrial receptors would have differential effects, impacting embryo development witho ut changing luteal function and lifespan. A simplistic interpretation of the data presented here might lead to erroneous conclusions, and further evaluation of endometrial gene expression and protein abundance, as well as oocyte maturation related events, ought to be performed before final inferences. Nevertheless, results suggest that changes in fertilization and/or pre elongation processes, and not related with conceptus elongation, are triggering differences in fertility. No indicatives of impaired elong ation in conceptus generated from FW follicles were found. Indeed, the average length and the proportion of conceptus classified as small in relation to the overall mean were similar for FW compared to SW and FWP4 (Chapter 4 ) Furthermore, the capability o f conceptuses to produce IFN similar or superior for FW compared to other treatments (Chapter 4 ) These results are supported by previous studies on which dairy cows were superstimulated during the FW

PAGE 176

176 or SW of follicular development (Rivera et al., 2009). Embryo viability on d 6 after AI was markedly reduced following superstimulation of the FW in comparison to the SW. Likewise, the negative effects were mediated by reduced concentration of progesterone during growth of the ovulatory follicle, since no differences on embryo quality were found between cows that ovulated SW dominant follicles and cows that were supplemented with progesterone during the development of the FW. Furthermore, no differences in pregnancies per embryo transfer or in pregnancy loss between d 21 and 63 of gestation were reported for viable embryos derived from superstimulation of the FW, FW supplemented with progesterone, and SW (Rivera et al., 2009). It has been shown previously th at reduction of circulating concentrations of progesterone during early diestrus induced maturation related changes in the cumulus oocyte complex in the existing follicles (Inskeep, 2004). These changes included degeneration of cumulus cell processes, irre meiosis. Similar alterations were described in persistent follicles (Revah and Buttler, 1996), and have been linked to decreased embryo quality and increased mortality before the 16 cell st age (Ahmad et al., 1995; Cerri et al., 2009). The fine control of length of proestrus and exposure of the oocyte to estradiol is crucial for enhancement of fertility. At the same time that prolonged dominance ( Ahmad et al., 1995; Revah and Buttler, 1996 ; C erri et al., 2009) and exposure to reduced progesterone and increased estradiol (Inskeep, 2004) might compromise oocyte and embryo quality, inadequate follicular maturation was shown to reduce P/AI (Bridge et al., 2008). Results from Chapter 5 suggest that in order to benefit from shorter periods of dominance and ovulation of younger follicles (Cerri et al., 2009; Santos et al., 2010),

PAGE 177

177 additional time for follicular maturation during proestrus is needed. Our attempt in the first experiment presented in Cha pter 5 was not to establish the optimal interval between induction of CL regression, induction of ovulation and AI during a 5 day protocol as it was done for the 7 day protocol (Pursley et al., 1998). Conversely, our hypothesis was that younger follicles w ould benefit from longer period of proestrus and allow for the administrati on of the final GnRH concurrently with timed AI. From the management standpoint, t his modification would save the handling of cows in the afternoon before AI which is undesirable b y dairy farmers. No differences in P/AI were observed when induction of ovulation using GnRH was performed either 16 h ours before or concurrent with timed AI at 72 h ours after the first PGF injection in the 5 d ay program. This is contrary to previous res earch with cows subjected to a standard 7 d ay Ovsynch pro tocol in which optimal P/AI was achieved when AI was performed 16 h ours after GnRH induction of ovulation (Pursley et al., 1998; Brusveen et al., 2008). Administration of the final GnRH 16 h ours befo re the AI is expect to result in a better synchrony between ovulation and semen availability ( Walker et al., 1996 ; Dransfield et al., 1998 ; Dalton et al., 2001 ; Saacke, 2008 ). Nonetheless, in a 5 day program allowing additional 16 hours for the dominant fo llicle to finish it maturation overcame a possible asynchrony and resulted in similar fertility. The stage of the estrous cycle on which the GnRH 1 of resynchronization protocol is administered is expected to influence synchrony of the estrous cycle in response to hormonal treatments (Vasconcelos et al., 1999). Consequently, it modulated subsequent P/AI in some (Fricke et al., 2003; Sterry et al., 2006), but not all studies (Silva et al., 2009). In the second experiment presented in Chapter 5 cows recei ved the

PAGE 178

178 GnRH 1 34 d ays after the previous AI. Considering that the average length of the estrous cycle in lactating dairy cows in 2 3 d ays (Sartori et al., 2004) is expected that most of the cows would be on d ay 11 of the estrous cycle when the resynchroniz ation protocol was initiated. This is important because approximately 50% of the cows treated with GnRH between d ays 10 and 16 of the estrous cycle failed to ovulate (Vasconcelos et al., 1999), which in association with spontaneous regression of the CL bef ore the injection of PGF resulted in increased premature ovulation at the end of the synchronization program and reduced fertility (Vasconcelos et al., 1999). The benefit from supplemental prtogesterone on overall synchrony was minor. It tended to decre ase premature ovulation; however, the occurrence of cows ovulating ahead of time per se was unimportant ( 5.6% ). Strikingly the great est increment in fertility came from supplementatio n of cows that had a visible CL at the GnRH1. High producing dairy cows have reduced plasma concentrations of progesterone during follicular development (Sartori et al., 2004), which may increase LH pulsatility and reduce oocyte competence and embryo quality (Inskeep, 2004). Use of a single CIDR insert increased the concentrat ion of progesterone in plasma by approximately 0.9 ng/mL (Lima et al., 2009); therefore, it is inadequate to increase progesterone in cows not bearing a CL to concentrations comparable to those of cows in diestrus (Lima et al., 2009). Nonetheless, it is po ssible that the additional progesterone from the CIDR insert complemented luteal synthesis of progesterone and allowed for adequate follicular maturation, which resulted in increased P/AI. Similar to our findings, supplementation with progesterone tended t o improve P/AI only in cows that had an active CL at the initiation of the Ovsynch protocol (Bartolome et al., 2009).

PAGE 179

179 LIST OF REFERENCES Acosta, T.J., N. Yoshizawa, M. Ohtani, and A. Miyamoto. 2002. Local changes in blood flow within the early and midcycle corpus luteum after prostaglandin F injection in the cow. Biol. Reprod. 66:651 658. Adams, G.P., R.L. Matteri, J.P. Kastelic, J.C.H. Ko, and O.J. Ginther. 1982. Association between surges of follicle stimulating hormone and the emergence of follicular waves in heifers. J. Reprod. Fertil. 94:177 188. Ahmad, N., F.N. Schrick, R.L. Butcher, and E.K. Inskeep. 1995. Effect of persistent follicles on early embryonic losses in beef cows. Biol. Reprod. 52:1129 1135. Ali la, H.W., and W. Hansel. 1984. Origin of different cell types in the bovine corpus luteum as characterized by specific monoclonal antibodies. Biol. Reprod. 31:1015 1025. Allrich, R.D. 1994. Endocrine and neural control of estrus in dairy cows. J. Dairy Sc i. 77:2738 2744. Araujo, R.R., O.J. Ginther, J.P. Ferreira, M.M. Palho, M.A. Beg, and M.C. Wiltbank. 2009. Role of follicular estradiol 17beta in timing of luteolysis in heifers. Biol. Reprod. 81:426 437. Asselin, E., P. Drolet, and M.A. Fortier. 1997. Cellular mechanisms involved during oxytocin induced prostaglandin F2alpha production in endometrial epithelial cells in vitro: role of cyclooxygenase 2. Endocrinology 138:4798 4805. Augustin, R., P. Pocar, A. Navarrete Santos, C. Wrenzycki, F. Gandolfi, H. Niemann, and B. Fischer. 2001. Glucose transporter expression is developmentally regulated in in vitro derived bovine preimplantation embryos. Mol. Reprod. Dev. 60:370 376. Barcroft, L.C., H. Offenberg, P. Thomsen, and A.J. Watson. 2003. Aquaporin prot eins in murine trophectoderm mediate trans epithelial water movements during cavitation. Dev. Biol. 256:342 354. Bartol, F.F., R.M. Roberts, F.W. Bazer, G.S. Lewis, J.D. Godkin, and W.W. Thatcher. 1985. Characterization of proteins produced in vitro by pe riattachment bovine conceptuses. Biol. Reprod. 32:681 693. Bartolome, J.A., J.J. Van Leeuwen, M. Thieme, O.G. S Filho, P. Melendez, L.F. Archbald, and W.W. Thatcher. 2009. Synchronization and resynchronization of inseminations in lactating dairy cows with the CIDR insert and the Ovsynch protocol. Theriogenology 72: 869 878.

PAGE 180

180 Bazer, F.W., G. Wu, T.E. Spencer, G.A. Johnson, R.C. Burghardt, and K. Bayless. 2010. Novel pathways for implantation and establishment and maintenance of pregnancy in mammals. Mol. Hum. Reprod. 16:135 152. Bazer, F.W., R.C. Burghardt, G.A. Johnson, T.E. Spencer, and G. Wu. 2008. Interferons and progesterone for establishment and maintenance of pregnancy: interactions among novel cell signaling pathways. Reprod. Biol. 8:179 211. Beam, S.W., and W.R. Butler. 1997. Energy balance and ovarian follicle development prior to the first ovulation postpartum in dairy cows receiving three levels of dietary fat. Biol. Reprod. 56:133 142. Beg, M.A., D.R. Bergfelt, K. Kot, M.C. Wiltbank, a nd O.J. Ginther. 2001. Follicular fluid factors and granulosa cell gene expression associated with follicle deviation in cattle. Biol. Reprod. 64:432 441. Bello, N.M., J.P. Steibel and J.R. Pursley. 2006. Optimizing ovulation to first GnRH improved outco mes to each hormonal injection of Ovsynch in lactating dairy cows. J. Dairy Sci. 89:3413 3424. Bertolini, M., S.W. Beam, H. Shim, L.R. Bertolini, A.L. Moyer, T.R. Famula, and G.B. Anderson. 2002. Growth, development, and gene expression by in vivo and in vitro produced day 7 and 16 bovine embryos. Mol. Reprod. Dev. 63:318 328. Besenfelder, U., V. Havlicek, G. Msslacher, and G. Brem. 2001. Collection of tubal stage bovine embryos by means of endoscopy. A technique report. Theriogenology 55:837 845. Bett eridge, K.J., and J.E. Flchon. 1988. The anatomy and physiology of pre attachment bovine embryos. Theriogenology 29:155 187. Bisinotto, R.S., R.C. Chebel, and J.E.P. Santos. 2010. Follicular wave of the ovulatory follicle and not cyclic status influences fertility of dairy cows. J. Dairy Sci. 93: 3578 3587. Blache, D., C.J. Fabre Nys, and G. Venier. 1991. Ventromedial hypothalamus as a target for oestradiol action on proceptivity, receptivity and luteinizing hormone surge of the ewe. Brain Res. 546:241 249. Bleach, E.C.L., R.G. Glencross, and P.G. Knight. 2004. Association between ovarian follicle development and pregnancy rates in dairy cows undergoing spontaneous oestrous cycle. Reproduction 127:621 629. Bonney, R.C., and S. Franks. 1987. Mo dulation of phospholipase A2 activity in human endometrium and amniotic membrane by steroid hormones. J. Steroid. Biochem. 26:467 472.

PAGE 181

181 Borland, R.M., J.D. Biggers, and C.P. Lechene. 1977. Fluid transport by rabbit preimplantation blastocysts in vitro. J. R eprod. Fertil. 51:131 135. Boshier, D.P., H. Holloway, and N.M. Millener. 1981. Triacylglycerols in the rat uterine epithelium during the oestrous cycle and early pregnancy. J. Reprod. Fertil. 62:441 446. Braw Tal, R., and S. Yossefi. 1997. Studies in vivo and in vitro on the initiation of follicle growth in the bovine ovary. J. Reprod. Fertil. 109:165 171. Bridges, G.A., L.A. Helser, D.E. Grum, M.L. Mussard, C.L. Gasser, and M.L. Day. 2008. Decreasing the interval between GnRH and PGF from 7 to 5 da ys and lengthening proestrus increases timed AI pregnancy rates in b eef cows. Theriogenology 69:843 851. Bruno, R.G.S., H.M. Rutigliano, R.L.A. Cerri, and J.E.P. Santos. 2005. Effect of addition of a CIDR insert prior to a timed AI protocol on pregnancy rates and pregnancy losses in dairy cows. J. Dairy Sci. 88:87. Abstr. Brusveen, D.J., A.P. Cunha, C.D. Silva, P.M. Cunha, R.A. Sterry, E.P.B. Silva, J.N. Guenther, and M.C Wiltbank. 2008. Altering the time of the second gonadotropin releasing hormone injection and artificial insemination (AI) during Ovsynch affects pregnancies per AI in lactating dairy cows. J. Dairy Sci. 91:1044 1052. Butler, S.T., A.L. Marr, S.H. Pelton R.P. Radcliff, M.C. Lucy, and W.R. Butler. 2003. Insulin restores GH responsiveness during lactation induced negative energy balance in dairy cattle: effects on expression of IGF I and GH receptor 1A. J. Endocrinol. 176:205 217. Butler, S.T., S.H. Pelto n, and W.R. Butler. 2004. Insulin increases 17 beta estradiol production by the dominant follicle of the first postpartum follicle wave in dairy cows. Reproduction 127:537 545. Buttrey, B.S., M.G. Burns, and J.S. Stevenson. 2010. Ovulation and pregnancy o utcomes in response to human chorionic gonadotropin before resynchronized ovulation in dairy cattle. Theriogenology 73:449 459. 1979. The activity of ovine luteal cholestero l esterase during several experimental conditions. Biol. Reprod. 21:601 608. Cerri, R.L., H.M. Rutigliano, R.C. Chebel, and J.E.P. Santos. 2009. Period of dominance of the ovulatory follicle influences embryo quality in lactating dairy cows. Reproduction 137: 813 823.

PAGE 182

182 Cerri, R.L.A., F. Rivera, C.D. Narciso, R.A. Oliveira, R.C. Chebel, M.A. Amstalden, W.W. Thatcher and J.E.P. Santos. 2008 a Progesterone concentration during follicular wave development affects follicular fluid composition and uterine relea se of PGF in dairy cows. J. Dairy Sci. 91:245. Abstr. Cerri, R.L.A., R.C. Chebel, F. Rivera, C.D. Narciso, R.A. Oliveira, and J.E.P. Santos. 2008 b Effect of progesterone concentration during follicular development on fertilization and embryo quality in dairy cows. J. Dairy Sci. 91: 463 Abstr. Cerri, R.L.A., J.E.P. Santos, S.O. Juchem, K.N. Galvo and R.C. Chebel. 2004. Timed artificial insemination with estradiol cypionate or insemination at estrus in high producing dairy cows. J. Dairy Sci. 87:3704 3715. Chambers, I., D. Colby, M. Robertson, J. Nichols, S. Lee, S. Tweedie, and A. Smith. 2003. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113:643 655. Charpigny, G., P. Reinaud, J.P. Tamby, C.C. Minon, J. Martal, J. Maclouf, and M. Guillomot. 1997. Expression of cyclooxygenase 1 and 2 in ovine endometrium during the estrous cycle and early pregnancy. Endocrinology 138:2163 2171. Chebel, R.C., and J.E.P. Santos. 2010. Effect of extending the voluntary waiting period on reproductive and lactation performances. J. Dairy Sci. 93: in pre ss. Chebel, R.C., M.J. Al Hassan, P.M. Fricke, J.E.P. Santos, J.R. Lima, C.A. Martel, J.S. Stevenson, R. Garcia, and R.L. Ax. 2010. Supplementation of progesterone via controlled internal drug release inserts during ovulation synchronization protocols in lactating dairy cows. J. Dairy Sci. 93:922 931. Chebel, R.C., J.E.P. Santos, R.L.A. Cerri, H.M. Rutigliano, and R.G.S. Bruno. 2006. Reproduction in dairy cows following progesterone insert presynchronization and resynchronization protocols. J. Dairy Sci. 89:4205 4219. Chebel, R.C., J.E.P. Santos, R.L.A. Cerri, K.N. Galvo, S.O. Juchem, and W.W. Thatcher. 2003. Effect of resynchronization with GnRH on day 21 after artificial insemination on pregnancy rate and pregnancy loss in lactating dairy cows. Theriog enology 60:1389 1399. Chegini, N., Z.M. Lei, Ch.V. Rao, and W. Hansel. 1991. Cellular distribution and cycle phase dependency of gonadotropin and eicosanoid binding sites in bovine corpora lutea. Biol. Reprod. 45:506 513. Chenault, J.R., W.W. Thatcher, P .S. Kalra, R.M. Abrams, and C.J. Wilcox. 1974. Transitory changes in plasma progestins, estradiol, and luteinizing hormone approaching ovulation in the bovine. J. Dairy Sci. 58:709 717.

PAGE 183

183 Coates, A.A., and A.R. Menino. 1994. Effects of blastocoelic expansio n and plasminogen activator activity on hatching and zona pellucida solubility in bovine embryos in vitro. J. Anim. Sci. 72:2936 2942. Conover, C.A., C.F. Faessen, K.E. Ilg, Y.A. Chandrasekher, M. Christiansen, M.T. Overgaard, C. Oxvig, and L.C. Giudice. 2001. Pregnancy associated plasma protein A is the insulin like growth factor binding protein 4 protease secreted by human ovarian granulosa cells and is a marker of dominant follicle selection and the corpus luteum. Endocrinology 142:2155 2158. Cooke, F. N.T., K.A. Pennington, Q. Yang, and A.D. Ealy. 2009. Several fibroblast growth factors are expressed during pre attachment bovine conceptus development and regulate interferon tau expression from trophectoderm. Reproduction 137:259 269. Crowe, M.A. 2008. Resumption of ovarian cyclicity in post partum beef and dairy cows. Reprod. Domest. Anim. 43:20 28. Dalton, J.C., S. Nadir, J.H. Bame, M. Noftsinger, R.L. Nebel, and R.G. Saacke. 2001. Effect of time of insemination on number of accessory sperm, fertiliza tion rate, and embryo quality in nonlactating dair y cattle. J. Dairy Sci. 84:2413 2418. Davis, A.J., I.R. Fleet, P.A. Hansford, F.A. Harrison, and F.M.M. Walker. 1985. Pulmonary metabolism of prostaglandin F2a in the conscious non pregnant cow. J. Physiol. 358:107 Abstr. De La Sota, R.L., M.C. Lucy, C.R. Staples, and W.W. Thatcher. 1993. Eff ects of recombinant bovine somatotropin (Sometribove) on ovarian function in lactating and nonlactating dairy cows. J. Dairy Sci. 76:1002 1013. De Vries, A. 2006. Economic value of pregnancy in dairy cattle. J. Dairy Sci. 89:3876 3885. DeJarnette, J.M, and C.E. Marshall. 2003. Effects of pre synchronization using combinations PGF and (or) GnRH on pregnancy rates of Ovsynch and Cosynch treated lactating Holstein cows. Anim. Reprod. Sci. 77:51 60. Denicol, A.C., G. Lopes Jr., L.G.D. Mendona, F.A. Rive ra, F. Guagnini, R.V. Perez, J.R. Lima, R.G.S. Bruno, J.E.P. Santos, and R.C. Chebel. 2009. Low progesterone concentration during the development of the first follicular wave impairs fertility of lactating dairy cows. J. Anim. Sci. 87:138. Abstr. Dharmarajan, A.M., N.W. Bruce, and G.T. Meyer. 1985. Quantitative ultrastructural characteristics relating to transport between luteal cell cytoplasm and blood in the corpus luteum of the pregnant rat. Am. J. Anat. 172:87 99.

PAGE 184

184 Dransfield, M.B.G., R.L. Nebe l, R.E. Pearson, and L.D. Warnick. 1998. Timing of insemination for dairy cows identified in estrus by a radiotelemetric estrus detection system. J. Dairy Sci. 81:1874 1882. Echternkamp, S.E., H.J. Howard, A.J. Roberts, J. Grizzle, and T. Wise. 1994. Rela tionships among concentrations of steroids, insulin like growth factor I, and insulin like growth factor binding proteins in ovarian follicular fluid of beef cattle. Biol. Reprod. 51:971 981. Eckert, J.J., and T.P. Fleming. 2008. Tight junction biogenesis during early development. Biochim. Biophys. Acta. 1778:717 728. Eggleston, D.L., C. Wilken, E.A. Van Kirk, R.G. Slaughter, T.H. Ji, and W.J. Murdoch. 1990. Progesterone induces expression of endometrial messenger RNA encoding for cyclooxygenase (sheep). Prostaglandins 39:675 683. El Zarkouny, S.Z., J.A. Cartmill, B.A. Hensley, and J.S. Stevenson. 2004. Pregnancy in dairy cows after synchronized ovulation regimens with or without presynchronization and progesterone. J. Dairy Sci. 87:1024 1037. Evans, A.C .O., C.M. Komar, S A Wandji and J.E. Fortune. 1997. Changes in androgen secretion and luteinizing hormone pulse amplitude are associated with the recruitment and growth of ovarian follicles during luteal phase in bovine estrous cycle. Biol. Reprod. 57:394 401. Farin, C.E., T.M. Nett, and G.D. Niswender. 1990a. Effects of luteinizing hormone on luteal cell populations in hypophysectomized ewes. J. Reprod. Fertil. 88:61 70. Farin, C.E., K. Imakawa, T.R. Hansen, J.J. McDonnell, C.N. Murphy, P.W. Farin, and R.M. Roberts. 1990b. Expression of trophoblastic interferon genes in sheep and cattle. Biol. Reprod. 43:210 218. Farin, C.E., C.L. Moeller, H.R. Sawyer, F. Gamboni, and G.D. Niswender. 1986. Morphometric analysis of cell types in the ovine corpus luteum throughout the estrous cycle. Biol. Reprod. 35:1299 1308. Ferguson, J.D., D.T. Galligan and N. Thomsen. 1994. Principal descriptors of body condition score in Holstein cows. J. Dairy Sci. 77:2695 2703. Fernandes, L.C., W.W. Thatcher, C.J. Wilcox, and E.P. Call. 1978. LH release in response to GnRH during the postpartum period of dairy cows. J. Anim. Sci. 46:443 448. Fitz, T.A., M.H. Mayan, H.R. Sawyer, and G.D. Niswender. 1982. Characterization of two steroidogenic cell types in the ovine corpus luteu m. Biol. Reprod. 27:703 711.

PAGE 185

185 Fogwell, R.L., J.L. Cowley, J.A. Wortman, N.K. Ames, and J.J. Ireland. 1985. Luteal function in cows following destruction of ovarian follicles at midcycle. Theriogenology 23:389 398. Fortune, J.E., S. Kito, S.A. Wandji, and V Srsen. 1998. Activation of bovine and baboon primordial follicles in vitro. Theriogenology 49:441 449. Fricke, P.M., D.Z. Caraviello, K.A. Weigel, and M.L. Welle. 2003. Fertility of dairy cows after resynchronization of ovulation at three intervals foll owing first timed insemination. J. Dairy Sci. 86:3941 3950. Fujikura, J., E. Yamato, S. Yonemura, K. Hosoda, S. Masui, K. Nakao, J. Miyazaki, and H. Niwa. 2002. Differentiation of embryonic stem cells is induced by GATA factors. Genes Dev. 16:784 789. Ga lvo, K.N., M.F. S Filho, and J.E.P. Santos. 2007. Reducing the interval from presynchronization to initiation of timed artificial insemination improves fertility in dairy cows. J. Dairy Sci. 90:4212 4218. Galvo, K.N., J.E.P. Santos, S.O. Juchem R.L.A. Cerri, A.C. Coscioni, and M. Villasenor. 2004. Effect of addition of a progesterone intravaginal insert to a timed insemination protocol using estradiol cypionate on ovulation rate, pregnancy rate, and late embryonic loss in lactating dairy cows. J. Ani m. Sci. 82:3508 3517. Gao, H., G. Wu, T.E. Spencer, G.A. Johnson, X. Li, and F.W. Bazer. 2009a. Select nutrients in the ovine uterine lumen. I. Amino acids, glucose and ions in uterine luminal flushings of cyclic and pregnant ewes. Biol. Reprod. 80:86 93. Gao, H., G. Wu, T.E. Spencer, G.A. Johnson, and F.W. Bazer. 2009b. Select nutrients in the ovine uterine lumen. II. Glucose transporters in the uterus and peri implantation conceptuses. Biol. Reprod. 80:94 104. Gao, H., G. Wu, T.E. Spencer, G.A. Johnson and F.W. Bazer. 2009c. Select nutrients in the ovine uterine lumen. III. Cationic amino acid transporters in the ovine uterus and peri implantation conceptuses. Biol. Reprod. 80:602 609. Genbacev, O.D., A. Prakobphol, R.A. Foulk, A.R. Krtolica, D. Ilic, M.S. Singer, Z.Q. Yang, L.L. Kiessling, S.D. Rosen, and S.J. Fisher. 2003. Trophoblast L selectin mediated adhesion at the maternal fetal interface. Science 299:405 408. Ginther, O.J., H.K. Shrestha, M.J. Fuenzalida, A.K.M. Shahiduzzaman, and M.A. Beg. 2010. Characteristics of pulses of 13,14 dihydro 15 keto prostaglandin F2alpha before, during, and after spontaneous luteolysis and temporal intrapulse relationships with progesterone concentrations in cattle. Biol. Reprod. 82:1049 1056.

PAGE 186

186 Ginther, O.J., K. Kot, L.J. Kulick, and M.C. Wiltbank. 1997. Sampling follicular fluid without altering follicular status in cattle: oestradiol concentrations early in a follicular wave. J. Reprod. Fertil. 109:181 186. Ginther, O.J., M.C. Wiltbank, P.M. Fricke, J.R. Gibbon s, and K. Kot. 1996a. Selection of the dominant follicle in cattle. Biol. Reprod. 55:1187 1194. Ginther, O.J., K. Kot, L.J. Kulick, S. Martin, and M.C. Wiltbank. 1996b. Relationships between FSH and ovarian follicular waves during the last six months of p regnancy in cattle. J. Reprod. Fertil. 108:271 279. Ginther, O.J., L. Knopf, and J.P. Kastelic. 1989. Temporal associations among ovarian events in cattle during oestrous cycles with two and three follicular waves. J. Reprod. Fertil. 87:223 230. Ginther, O.J., C.O. Woody, S. Mahajan, K. Janakiraman, and L.E. Casida. 1967. Effect of oxytocin administration on the oestrus cycle of unilaterally hysterectomized heifers. J. Reprod. Fertil. 14:225 229. Girsh, E., W. Wang, R. Mamluk, F. Arditi, A. Friedman, R.A Milvae, and R. Meidan. 1996a. Regulation of endothelin 1 in the bovine corpus luteum: elevation by prostaglandin F2 alpha. Endocrinology 137:5191 5196. Girsh, E., R.A. Milvae, W. Wang, and R. Meidan. 1996b. Effect of endothelin 1 on bovine luteal cell f unction: role in prostaglandin F2alpha induced antisteroidogenic action. Endocrinology 137:1306 1312. Gong, J.G., D. McBride, T.A. Bramley, and R. Webb. 1994. Effects of recombinant bovine somatotrophin, insulin like growth factor I and insulin on bovine granulosa cell steroidogenesis in vitro. J. Endocrinol. 143:157 164. Gray, C.A., D.L. Adelson, F.W. Bazer, R.C. Burghardt, E.N. Meeusen, and T.E. Spencer. 2004. Discovery and characterization of an epithelialspecific galectin in the endometrium that forms crystals in the trophectoderm. PNAS 101:7982 7987. Gray, C.A., R.C. Burghardt, G.A. Johnson, F.W. Bazer, and T.E. Spencer. 2002. Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elong ation. Reproduction. 124:289 300. Gmen, A., J.N. Guenther, and M.C. Wiltbank. 2003. Follicular size and response to Ovsynch versus detection of estrus in anovular and ovular lactating dairy cows. J. Dairy Sci. 86:3184 3194.

PAGE 187

187 Gmen, A., and M.C. Wiltba nk. 2002. An alteration in the hypothalamic action of estradiol due to lack of progesterone exposure can cause follicular cysts in cattle. Biol. Reprod. 66:1689 1695. Gmen, A., and M.C. Wiltbank. 2005. Follicular cysts occur after a normal estradiol induced GnRH/LH surge if the corpus hemorrhagicum is removed. Reproduction. 129:737 745. Hafez, E.S.E., M.R. Jainudeen, and Y. Rosnina. 2008. Hormones, growth factors and reproduction. Pages 33 54 in Functional Anatomy of Reproduction. Reproduct ion in Farm Aniamls 7 th ed. E.S.E Hafez and B. Hafez. Blackwell Publishing Professional, Ames, IA. Helmer, S.D., P.J. Hansen, W.W. Thatcher, J.W. Johnson, and F.W. Bazer. 1989. Intrauterine infusion of highly enriched bovine trophoblast protein 1 complex exerts an antiluteolytic effect to extend corpus luteum lifespan in cyclic cattle. J. Reprod. Fertil. 87:89 101. Helmer, S.D., P.J. Hansen, R.V. Anthony, W.W. Thatcher, F.W. Bazer, and R.M. Roberts. 1987. Identification of bovine trophoblast protein 1, a secretory protein immunologically related to ovine trophoblast protein 1. J. Reprod. Fertil. 79:83 91. Hillegass, J., F.S. Lima, M.F. S Filho and J.E.P. Santos. 2008. Effect of time of artificial insemination and supplemental estradiol on reproduction o f lactating dairy cows. J. Dairy Sci. 91:4226 4237. Hixon, J.E., and W. Hansel. 1974. Evidence for preferential transfer of prostaglandin F to the ovarian artery following intrauterine administration in cattle. Biol. Reprod. 11:543 552. Holm, P., P.J. Booth, and H. Callesen. 2002. Kinetics of early in vitro development of bovine in vivo and in vitro derived zygotes produced and/or cultured in chemically defined or serum containing media. Reproduction 123:553 565. Imakawa, K., T.R. Hansen, P.V. Malathy, R.V. Anthony, H.G. Polites, K.R. Marotti, and R.M. Roberts. 1989. Molecular cloning and characterization of complementary deoxyribonucleic acids corresponding to bovine trophoblast protein 1: a comparison with ovine trophoblast protein 1 and bovin e interferon alpha II. Mol. Endocrinol. 3:127 139. Inskeep, E.K. 2004. Preovulatory, postovulatory, and postmaternal recognition effects of concentrations of progesterone on embryonic survival in the cow. J. Anim. Sci. 82:E24 E39.

PAGE 188

188 Jablonka Shariff, A., A.T. Grazul Bilska, D.A. Redmer, and L.P. Reynold. 1993. Growth and cellular proliferation of ovine corpora lutea throughout the estrous cycle. Endocrinology 133:1871 1879. James, P.F., I.L. Grupp, G. Grupp, A.L. Woo, G.R. Askew, M.L. Croyle, R.A. Walsh, and J.B. Lingrel. 1999. Identification of a specific role for the Na,K as a regulator of calcium in the heart. Mol. Cell 3:555 563. Johnson, G.A., F.W. Bazer, L.A. Jaeger, H. Ka, J.E. Garlow, C. Pfarrer, T.E. Spencer, and R.C. Burghardt. 2001. Muc 1, integrin, and osteopontin expression during the implantation cascade in sheep. Biol. Reprod. 65:820 828. Juengel, J.L., N.L. Hudson, D.A. Heath, P. Smith, K.L. Reader, S.B. Lawrence, A.R. O'Connell, M.P. Laitinen, M. Cranfield, N.P. Groome, O. Ritvos, and K.P. McNatty. 2002. Growth differentiation factor 9 and bone morphogenetic protein 15 are essential for ovarian follicular development in sheep. Biol. Reprod. 67:1777 1789. Juengel, J.L., B.M. Meberg, A.M. Turzillo, T.M. Nett, and G.D. Niswender. 1995a. Hormonal regulation of mRNA encoding steroidogenic acute regulatory protein in ovine corpora lutea. Endocrinology 136:5423 5429. Juengel, J.L., T.M. Nett, T.M. Tandeski, D.C Eckery, H.R. Sawyer, and G.D. Niswender. 1995b. Effect of luteinizing hormone and growth hormone on luteal development in hypophysectomized ewes. Endocrine 3:323 326. Juchem, S.O. 2007. Lipid digestion and metabolism in dairy cows: effects on productio n, reproduction and health. PhD thesis, University of California Davis. Kaaekuahiwi, M.A., and A.R. Menino. 1990. Relationship between plasminogen activator production and bovine embryo development in vitro. J. Anim. Sci. 68:2009 2014. Kalhan, S., and P. Parimi. 2000. Gluconeogenesis in the fetus and neonate. Semin. Perinatol. 24:94 106. Kan, N.G., M.P. Stemmler, D. Junghans, B. Kanzler, W.N. de Vries, M. Dominis, and R. Kemler. 2007. Gene replacement reveals a specific role for E cadherin in the formati on of a functional trophectoderm. Development 134:31 41. Kindahl, H., L.E. Edqvist, E. Granstrm, and A. Bane. 1976a. The release of prostaglandin F as reflected by 15 keto 13,14,dihydroprostaglandin F in the peripheral circulation during normal luteolysis in heifers. Prostaglandins 11:871 878.

PAGE 189

189 Kindahl, H., L.E. Edquist, A. Bane, and E. Granstrm E. 1976b. Blood levels of progesterone and 15 keto 13,14 dihydro prostaglandin F2alpha during the normal o estrous cycle and early pregnancy in heifers. Acta. Endocrinol. 82:134 149. Knickerbocker, J.J., W.W. Thatcher, D.B. Foster, D. Wolfenson, F.F. Bartol, and D. Caton. 1986a. Uterine prostaglandin and blood flow responses to estradiol cyclic cattle. Prostaglandins 31:757 776. Knickerbocker, J.J., W.W. Thatcher, F.W. Bazer, M. Drost, D.H. Barron, K.B. Fincher, and R.M. Roberts. 1986b. Proteins secreted by Day 16 to 18 bovine conceptuses extend corpus luteum function in cows. J. Reprod. Fertil. 77:381 391. Kobayashi, S., B. Berisha, W.M. Amselgruber, D. Schams, and A. Miyamoto. 2001. Production and localisation of angiotensin II in the bovine early corpus luteum: a Endocrino l. 170:369 380. Komar, C.M., A.K. Berndtson, A.C.O. Evans, and J.E. Fortune. 2001. Decline in circulating estradiol during the periovulatory period is correlated with decreases in estradiol and androgen, and in messenger RNA for P450 aromatase and P450 17 hydroxylase, in bovine preovulatory follicles. Biol. Reprod. 64:1797 1805. Kopency, V. 1989. High resolution autoradiographic studies of comparative nucleologenesis and genome reactivation during early embryogenesis in pig, man and cattle. Reprod. Nutr. Dev. 29:589 600. Kyle, S.D., C.J. Callahan and R.D. Allrich. 1992. Effect of progesterone on the expression of estrus at the first postpartum ovulation in dairy cattle. J. Dairy Sci. 75:1456 1460. LaFrance, M., and A.K. Goff. 1988. Effects of progesterone and oestradiol oxytocin induced release of prostaglandin F 82:429 436. LaFrance, M., and A.K. Goff. 1985. Effect of pregnancy on oxytocin induced release of prostaglandin F in heifers. Biol. Reprod. 33:1113 1119. Lamming, G.E., and G.E. Mann. 1995. Control of endometrial oxytocin receptors and prostaglandin F production in cows by progesterone and oestradiol. J. Reprod. Fertil. 103:69 73. Lauderdale, J.W., B.E. Seguin, J.N. Stellflug, J.R. Chenaul t, W.W. Thatcher, C.K. Vincent, and A.F. Loyancano. 1974. Fertility of cattle following PGF2 alpha injection. J. Anim. Sci. 38:964 967.

PAGE 190

190 Lee, J.S., and W.J. Silvia. 1994. Cellular mechanisms mediating the stimulation of ovine endometrium secretion of prosta phospholipase A2. J. Endocrinol. 141:491 496. Lequarre, A.S., J. Marchandise, B. Moreau, A. Massip, and I. Donnay. 2003. Cell cycle duration at the time of maternal zygotic transition for in vitro produced bovine embryos: effect of oxygen tension and transcription inhibition. Biol. Reprod. 69:1707 1713. Lessey, B.A. 2002. Adhesion molecules and implantation. J. Reprod. Immunol. 55:101 112. Levy, N., S. Kobayashi, Z. Roth, D. Wolfenson, A. Miyamoto, and R. Meidan. 2000. Administration of prostaglandin F during the early bovine luteal phase does not alter the expression of ET 1 and of its type A receptor: A possible cause for corpus luteum refractoriness. Biol. Reprod. 63:377 382. Lima, J.R., F.A. Rivera, C.D. Narciso, R. Oliveira, R.C. Chebel, and J.E.P. Santos. 2009. Effect of increasing amounts of supplemental progesterone in a timed artificial insemination protocol on fertility of lactating dairy cows. J. Dairy Sci. 92:5436 5446. Liszewska, E., R. Reka wiecki, and J. Kotwica. 2005. Effect of progesterone on the expression of bax and bcl 2 and on caspase activity in bovine luteal cells. Prostaglandins Other Lipid Mediat. 78:67 81. Lopes, A.S., S.T. Butler, R.O. Gilbert and W.R. Butler. 2007. Relationship of pre ovulatory follicle size, estradiol concentrations and season to pregnancy outcome in dairy cows. Anim. Reprod. Sci. 99:34 43. Lopez, H., L.D. Satter, and M.C. Wiltbank. 2004. Relationship between level of milk p roduction and estrous behavior of lactating dairy cows. Anim. Reprod. Sci. 81:209 223. Lopez, H., T.D. Buncha, and M.P. Shipka. 2002. Estrogen concentrations in milk at estrus and ovulation in dairy cows. Anim. Reprod. Sci. 72:37 46. Lucy, M.C., W.W. Thatcher, R.J. Collier, F.A. Simmen, Y. Ko, J.D. Savio, and L. Badinga. 1995. Effects of somatotropin on the conceptus, uterus, and ovary during maternal recognition of pregnancy in cattle. Domest. Anim. Endocrinol. 12:73 82. Macmillan, K.L., and W.W. Tha tcher. 1991. Effects of an agonist of gonadotropin releasing hormone on ovarian follicles in cattle. Biol. Reprod. 45:883 889.

PAGE 191

191 Mamluk, R., D. Chen, Y. Greber, J.S. Davis, and R. Meidan. 1998. Characterization of messenger ribonucleic acid expression for prostaglandin F2a and luteinizing hormone receptors in various bovine luteal cell types. Biol. Reprod. 58:849 856. Mann, G.E., and G.E. Lamming. 2001. Relationship between maternal endocrine environment, early embryo development and inhibition of the lute olytic mechanism in cows. Reproduction 121:175 180. Massip, A., J. Mulnard, P. Vanderzwalmen, C. Hanzen, and F. Ectors. 1982. The behaviour of cow blastocyst in vitro: cinematographic and morphometric analysis. J. Anat. 134:399 405. McCracken J.A., E.E. Custer, and J.C. Lamsa. 1999. Luteolysis: A neuroendocrine mediated event. Physiol Rev 45:263 323. McCracken J.A., D.T. Baird, and J.R. Goding. 1971. Factors affecting the secretion of steroids from the transplanted ovary in the sheep. Rec. Prog. Horm. Re s. 27:537 582. McDougall, S., F.M. Rhodes, and G. Verkerk. 2005. Pregnancy loss in dairy cattle in the Waikato region of New Zealand. N. Z. Vet. J. 53:279 287. McNatty, K.P., K. Reader, P. Smith, D.A. Heath, J.L. Juengel. 2007. Control of ovarian follicu lar development to the gonadotrophin dependent phase: a 2006 perspective. Soc. Reprod. Fertil. Suppl. 64:55 68. Meier, S., M.A. Trewhella, R.J. Fairclough, and G. Jenkin. 1997. Changes in uterine endometrial phospholipids and fatty acids throughout the oe strous cycle and early pregnancy in the ewe. Prost aglandins Leuk ot Essent. Fatty Acids 53:341 349. Meirelles, F.V., A.R. Caetano, Y.F. Watanabe, P. Ripamonte, S.F. Carambula, G.K. Merighe, and S.M. Garcia. 2004. Genome activation and developmental block in bovine embryos. Anim. Reprod. Sci. 82 83:13 20. Memili, E., and N.L. First. 2000. Zygotic and embryonic gene expression in cow: a review of timing and mechanisms of early gene expression as compared with other species. Zygote 8:87 96. Memili, E., and N.L. First. 1998. Developmental changes in RNA Polymerase II in bovine oocytes, early embryos, and effect of a amanitin on embryo development. Mol. Reprod. Dev. 51:381 389. Memili, E., T. Dominko, and N.L. First. 1998. Onset of transcription in bovine oocytes and preimplantation embryos. Mol. Reprod. Dev. 51:36 41.

PAGE 192

192 Menino, A.R., and J.S. Williams. 1987. Activation of plasminogen by the early bovine embryo. Biol. Reprod. 36:1289 1295. Michael, D.D., I.M. Alvarez, O.M. Ocn, A.M. Powell, N.C. Talbot, S. E. Johnson, and A.D. Ealy. 2006. Fibroblast growth factor 2 is expressed by the bovine uterus and stimulates interferon 147:3571 3579. Mihm, M., E.J. Austin, T.E.M. Good, J.L.H. Ireland, P.G. Knight, J. F. Roche, and J.J. Ireland. 2000. Identification of potential intrafollicular factors involved in selection of dominant follicles in heifers. Biol. Reprod. 63:811 819. Mitsui, K., Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi, M. Maruyama, M. Maeda, and S. Yamanaka. 2003. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113:631 642. Miyamoto, A., K. Shirasuna, and K. Sasahara. 2009. Local regulation of corpus luteum development and regression in the cow: Impact of angiogenic and vasoactive factors. Domest. Anim. Endocrinol. 37:159 169. Moreira, F., C. Orlandi, C.A. Risco, R. Mattos, F. Lopes, and W.W. Thatcher. 2001. Effects of presynchronization and bovine somatotropin on pregnancy rates to a timed artificial insemination protocol in lactating dairy cows. J. Dairy Sci. 84:1646 1659. Nanda, A.S., W.R. Ward, and H. Dobson. 1991. Lack of LH response to oestradiol treatment in cows with cystic ovarian disease and effect of progesterone treatment or manual rupture. Res. Vet. Sci. 51:180 184. Navanukraw C., D.A. Redmer, L.P. Reynolds, J.D. Kirsch, A.T. Grazul Bilska, and P.M. Fricke. 2004. A modified presynchronization protocol improves fertility to timed artificial insemination in lacta ting dairy cows. J. Dairy Sci. 87:1551 1557. Nebel, R.L., W.D. Whittier, B.G. Cassell, and J.H. Britt. 1987. Comparison of on farm and laboratory milk progesterone assays for identifying errors in detection of estrus and diagnosis of pregnancy. J. Dairy S ci. 70:1471 1476. Nelson, D.L., and M.M. Cox. 2008. Regulation of gene expression. Pages 1115 1158 in Lehninger: Principles of Biochemistry. Nelson, D.L., and M.M. Cox, ed. W. H. Freeman and Company, New York, USA. Nichols, J., B. Zevnik, K. Anastassiadi s, H. Niwa, D. Klewe Nebenius, I. Chambers, H. Scholer, and A. Smith. 1998. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95: 379 391.

PAGE 193

193 Nimz, M., M. Spitschak, F. Schneider, R. Frbass, and J. Vanselow. 2009. Down regulation of genes encoding steroidogenic enzymes and hormone receptors in late preovulatory follicles of the cow coincides with an accumulation of intrafollicular steroids. Domest. Anim. Endocrinol. 37:45 54. Niswender, G.D. 2002. Molecular control of luteal secretion of progesterone. Reproduction 123:333 339. Niswender, G.D., J.L. Juengel, P.J. Silva, M.K. Rollyson, and E.W. McIntush. 2000. Mechanisms controlling the function and life span of the corpus luteum. Physiol. Rev. 80:1 29. Niwa, H., J. Miyazaki, and A.G. Smith. 2000. Quantitative expression of Oct 3/4 defines differentiation, dedifferentiation or self renewal of ES cells. Nat. Genet. 24: 372 376. Northey, D.L., and L.R. French. 1980. Effect of embryo removal and in trauterine infusion of embryonic homogenates on the lifespan of the bovine corpus luteum. J. Anim. Sci. 50:298 302. NRC. 2001. Nutrient Requirements of Dairy Cattle. 7th rev. ed. Natl. Acad. Press, Washington, DC. Ohtani, M., S. Kobayshi, A. Miyamoto, K Hayashi, and Y. Fukui. 1998. Real time relationships between intraluteal and plasma concentrations of endothelin, induced luteolysis in the cow. Biol. Reprod. 58:103 108. Okuda, K., A. Korzekwa, M. Shibaya, S. Murakami, R. Nishimura, M. Tsubouchi, I. Woclawek Potocka, and D.J. Skarzynski. 2004. Progesterone is a suppressor of apoptosis in bovine luteal cells. Biol. Reprod. 71:2065 2071. Olds, D., and D.M. Seath. 1951. Repeatability of the estrous cy cle length in dairy cattle. J. Dairy Sci. 34:626 632. Paynton, B.V., R. Rempel, and R. Bachvarova. 1988. Changes in state of adenylation and time course of degradation of maternal mRNAs during oocyte maturation and early embryonic development in the mouse Dev. Biol. 129:304 314. Pescador, N., K. Soumano, D.M. Stocco, C.A. Price, and B.D. Murphy. 1996. Steroidogenic acute regulatory protein in bovine corpora lutea. Biol. Reprod. 55:485 491. Peter, A.T., H. Levine, M. Drost, and D.R. Bergfelt. 2009. Comp ilation of classical and contemporary terminology used to describe morphological aspects of ovarian dynamics in cattle. Theriogenology 71:1343 1357.

PAGE 194

194 Peters, M.W., and J.R. Pursley. 2003. Timing of final GnRH of the Ovsynch protocol affects ovulatory follic le size, subsequent luteal function, and fertility in dai ry cows. Theriogenology 60:1197 1204. Peters, K.E., E.G. Bergfeld, A.S. Cupp, F.N. Kojima, V. Mariscal, T. Sanchez, M.E. Wehrman, H.E. Grotjan, D.L. Hamernik, R.J. Kittok, and J.E. Kinder. 1994. Lut einizing hormone has a role in development of fully functional corpora lutea (CL) but is not required to maintain CL function in heifers. Biol. Reprod. 51:1248 1254. Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real time RT P CR. Nucleic Acid Res. 29:2002 2007. Piper, P.J., J.R. Vane, and J.H. Wyllie. 1970. Inactivation of prostaglandins by the lungs. Nature 225:600 604. Plante, L., C. Plante, D.L. Shepherd, and W.A. King. 1994. Cleavage and 3H uridine incorporation in bovine embryos of high in vitro developmental potential. Mol. Reprod. Develop. 39:375 383. Plusa, B., A. Piliszek, S. Frankenberg, J. Artus, and A.K. Hadjantonakis. 2008. Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blast ocyst. Development 135:3081 3091. Portaluppi, M.A., and J.S. Stevenson. 2005. Pregnancy rates in lactating dairy cows after presynchronization of estrous cycles and variations of the Ovsynch protocol. J. Dairy Sci. 88:914 921. Pratt, H.P.M., C.A. Ziomek, W.J.D. Reeve, and M.H. Johnson. 1982. Compaction of the mouse embryo: an analysis of its components. J. Embryol. Exp. Morph. 70:113 132. Pursley, J.R., R.W. Silcox, and M.C. Wiltbank. 1998. Effect of time of artificial insemination on pregnancy rates, ca lving rates, pregnancy loss, and gender ratio after synchronization of ovulation in lactating dairy cows. J. Dairy Sci. 81:2139 2144. Pursley, R.J., M.C. Wiltbank, J.S. Stevenson, J.S. Ottobre, H.A. Garverick, and L.L. Anderson. 1997a. Pregnancy rates per artificial insemination for cows and heifers inseminated at a synchronized ovulation or synchronized estrus. J. Dairy Sci. 80:295 300. Pursley, J.R., M.R. Kosorok, and M.C. Wiltbank. 1997b. Reproductive management of lactating dairy cows using synchroni zation of ovulation. J. Dairy Sci. 80:301 306.

PAGE 195

195 Pursley, J.R., M.O. Mee, and M.C. Wiltbank. 1995. Synchronization of ovulation in dairy cows using PGF and GnRH. Theriogenology 44:915 923. Quirk, S.M., R.M. Harman and R.G. Cowan. 2000. Regulation of Fas antigen (Fas, CD95) mediated apoptosis of bovine granulosa cells by serum and growth factors. Biol. Reprod. 63:1278 1284. Quirk, S.M., and J.E. Fortune. 1986. Plasma concentrations of gonadotrophins, preovulatory f ollicular development and luteal function associated with bovine follicular fluid induced delay of oestrus in heifers. J. Reprod. Fertil. 76:609 621. Rabiee, A.R., I.J. Lean, and M.A. Stevenson. 2005. Efficacy of ovsynch program on reproductive performanc e in dairy cattle: a meta analysis. J. Dairy Sci. 88:2754 2770. Rathbone, M.J., J.E. Kinder, K. Fike, F. Kojima, D. Clopton, C.R. Ogle, C.R. Bunt. 2001. Recent advances in bovine reproductive endocrinology and physiology and their impact on drug delivery system design for the control of the estrous cycle in cattle. Adv. Drug Deliv. Rev. 50:277 320. Reimers, T.J., R.D. Smith, and S.K. Newman. 1985. Management factors affecting reproductive performance of dairy cows in the northeastern United States. J. Dai ry Sci. 68:963 972. Rekawiecki, R., M. Nowik, and J. Kotwica. 2005. Stimulatory effect of LH, PGE 2 and progesterone on StAR protein, cytochrome P450 cholesterol side chain cleavage Prostaglandins Other Lipid Mediat. 78:169 184. Revah, I., and W.R. Butler. 1996. Prolonged domin ance of follicles and reduced viability of bovine oocytes. J. Reprod. Fertil. 106:39 47. Rieger, D., N.M. LosLoskutoff, and K.J. Betteridge. 1992. Developmentally related changes in the metabolism of glucose and glutamine by cattle embryos produced and co cultured in vitro. J. Reprod. Fertil. 95:585 595. Riley, J.K., and K.H. Moley. 2006. Glucose utilization and the PI3 K pathway: mechanisms for cell survival in preimplantation embryos. Reproduction 131:823 835. Ribeiro, E.S., R.L.A. Cerri, R.S. Bisinotto, F.S. Lima, F.T. Silvestre, W.W. Thatcher, and J.E.P. Santos. 2009. Reproductive performance of grazing dairy cows following presynchronization and resynchronization protocols. J. Dairy Sci. 92:266. Abstr.

PAGE 196

196 Riv era, F.A., L.G.D. Mendona, G. Lopes Jr., R.V. Perez, F. Guagnini, M. Amstalden, R.G.S. Bruno, J.E.P. Santos, and R.C. Chebel. 2009. Low progesterone concentration during superstimulation of the first follicular wave impairs embryo quality of lactating dai ry cows. J. Anim. Sci. 87:267. Abstr. Robinson, R.S., M.D. Fray, D.C. Wathes, G.E. Lamming, and G.E. Mann. 2006. In vivo expression of interferon tau mRNA by the embryonic trophoblast and uterine concentrations of interferon tau protein during early pregn ancy in the cow. Mol. Reprod. Dev. 73:470 474. Robinson R.S., G.E. Mann, G.E. Lamming, and D.C. Wathes. 2001. Expression of oxytocin, oestrogen and progesterone receptors in uterine biopsy samples throughout the oestrous cycle and early pregnancy in cows. Reproduction 122:965 979. Roche, J.F., M.A. Crowe, and M.P. Boland. 1992. Postpartum anoestrus in dairy and beef cows. Anim. Reprod. Sci. 28:371 378. Rodina, T.M., F.N.T. Cooke, P.J. Hansen, and A.D. Ealy. 2009. Oxygen tension and medium type actions on blastocyst development and interferon tau secretion in cattle. Anim. Reprod. Sci. 111:173 188. Rowson, L.E., R. Tervit, and A. Brand. 1972. The use of prostaglandins for synchronization of oestrus in cattle. J. Reprod. Fertil. 29:145. Rutigliano, H.M., F.S. Lima, R.L.A. Cerri, L.F. Greco, J.M. Villela, V. Magalhes, F.T. Silvestre, W.W. Thatcher, and J.E.P. Santos. 2008. Effects of method of presynchronization and source of selenium on uterine health and reproduction in dairy cows. J. Dairy Sci. 91:3323 3336. S Filho, O.G., D.M. Guerra and J.L.M. Vasconcelos. 2009. Endometrial gene expression of estradiol, progesterone, and oxytocin receptors in anestrous Bos Indicus cows treated with progesterone. J. Dairy Sci. 92:441 Abstr. Saacke, R.G. 2008. Insemination factors related to timed AI in cattle. Theriogenology 70:479 484. Salfen, B.E., J.R. Cresswell, Z.Z. Xu, B. Bao, and H.A. Garverick. 1999. Effects of the presence of a dominant follicle and exogenous oestradiol on the duration of the luteal phase of the bovine oestral cycle. J. Reprod. Fertil. 115:15 21. Sangsritavong, S., D.K. Combs, R. Sartori, L.E. Armentano, and M.C. Wiltbank. 2002. High feed intake increases liver blood flow and metabolism of progesterone and estradiol y catt le. J. Dairy Sci. 85:2831 2842.

PAGE 197

197 Santos, J.E.P., C.D. Narciso, F. Rivera, W.W. Thatcher, and R.C. Chebel. 2010. Effect of reducing the period of follicle dominance in a timed AI protocol on reproduction of dairy cows. J. Dairy Sci. 93:2976 2988. Santos, J.E.P., H.M. Rutigliano, and M.F. S Filho. 2009. Risk factors for resumption of postpartum estrous cycles and embryonic survival in lactating dairy cows. Anim. Reprod. Sci. 110:207 221. Santos, J.E.P., S.O. Juchem, R.L.A. Cerri, K.N. Galvo, R.C. Chebel, W.W. Thatcher, C.S. Dei and C.R. Bilby. 2004a. Effect of bST and reproductive management on reproductive performance of Holstein dairy cows. J. Dairy Sci. 87:868 881. Santos, J.E.P., J.A. Bartolome, R.L.A. Cerri, S.O. Juchem, O. Hernandez, T. Trigg and W.W. Thatcher. 2004b. Effect of a deslorelin implant in a timed artificial insemination protocol on follicle development, luteal function and reproductive performance of lactating dairy cows. Theriogenology 61:421 435. Santos, J.E.P., W.W. Thatcher, R.C. Chebel, R.L.A Cerri and K.N. Galvo. 2004c. The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Anim. Reprod. Sci. 82 83:513 535. Sartori, R., J.M. Haughian, R.D. Shaver, G.J.M. Rosa, and M.C. Wiltbank. 2004. Comparison of ovarian function and circulating steroids in estrous cycles of holstein heifers and lactating cows. J. Dairy Sci. 87:905 920. Sartori, R., P.M. Fricke, J.C.P. Ferreira, O.J. Ginther, and M.C. Wiltbank. 2001. Follicular deviation and ac quisition of ovulatory capacity in bovine follicles. Biol. Reprod. 65:1403 1409. Satterfield, M.C., K. Hayashi, G. Song, S.G. Black, F.W. Bazer, and T.E. Spencer. 2008. Progesterone regulates FGF10, MET, IGFBP1, and IGFBP3 in the endometrium of the ovine uterus. Biol. Reprod. 79:1226 1236. Savio, J.D., M.P. Boland, and J.F. Roche. 1990. Development of dominant follicles and length of ovarian cycles in post partum dairy cows. J. Reprod. Fertil. 88:581 591. Savio, J.D., L. Keenan, M.P. Boland, and J.F. Roche. 1988. Pattern of growth of dominant follicles during the oestrous cycle of heifers. J. Reprod. Fertil. 83:663 671. Schier, A.F. 2007. The maternal zygotic transition: death and birth of RNAs. Science 316:406 407. Schillo, K.K. 1992. Effects of die tary energy on control of luteinizing hormone secretion in cattle and sheep. J. Anim. Sci. 70:1271 1282.

PAGE 198

198 Schmitt, E.J., T. Diaz, M. Drost, and W.W. Thatcher. 1996. Use of a gonadotropin releasing hormone agonist or human chorionic gonadotropin for timed in semination in cattle. J. Anim. Sci. 74:1084 1091. Senger, P.L. 2003a. Reproductive cyclicity: Terminology and basic concepts. Pages 144 163 Pathways to pregnancy and parturition. P.L. Senger, ed. Current Conceptions Inc., Pullman, USA. Senger, P.L. 2003b Early embryogenesis and maternal recognition of pregnancy. Pages 284 303 Pathways to pregnancy and parturition. P.L. Senger, ed. Current Conceptions Inc., Pullman, USA. Senger, P.L. 1994. The estrus detection problem: new concepts, technologies, and possibilities. J. Dairy Sci. 77:2745 2753. Shaham Albalancy, A., A. Nyska, M. Kaim, M. Rosemberg, Y. Folman, and D. Wolfenson. 1997. Delayed effect of progesterone on endometrial morphology in dairy cows. Anim. Reprod. Sci. 48:159 174. Shaham Albalancy, A., Y. Folman, M. Kaim, M. Rosemberg, and D. Wolfenson. 2001. Delayed effect of low progesterone concentrations on bovine uterine PGF(2alpha) secretion in the subsequent estrous cycle. Reproduction 122:643 648. Siddiqui, M.A.R., E.L. Gastal, M.O. Gastal, M. Almamun, M.A. Beg, and O.J. Ginther. 2009. Relationship of vascular perfusion of the wall of the preovulatory follicle to in vitro fertilization and embryo development in heifers. Reproduction 137:689 697. Silva, E., R.A. Sterry, D. Kolb, N. Mathialaga n, M.F. McGrath, J.M. Ballam, and P.M. Fricke. 2009. Effect of interval to resynchronization of ovulation on fertility of lactating Holstein cows when using transrectal ultrasonography or a pregnancy associated glycoprotein enzyme linked immunosorbent assa y to diagnose pregnancy status. J. Dairy Sci. 92:3643 3650. Silva, E., R.A. Sterry, D. Kolb, M.C. Wiltbank, and P.M. Fricke. 2007. Effect of pretreatment with prostaglandin F before resynchronization of ovulation on fertility of lactating dairy cows. J. Dairy Sci. 90:5509 5517. Sirois, J., and J.E. Fortune. 1988. Ovarian follicular dynamics during the estrous cycle in heifers monitored by real time ultrasonography. Biol. Reprod. 39:308 317. Souza, A.H., H. Ayres, R.M. Ferreira, M.C. Wiltbank. 2008. A new presynchronization system (Double Ovsynch) increases fertility at first postpartum timed AI in lactating dairy cows. Theriogenology 70:208 215.

PAGE 199

199 Spencer, T.E., G.A. Johnson, F.W. Bazer, R.C. Burghardt, and M. Palmarini. 2007. Pregnancy recognition and conceptus implantation in domestic ruminants: roles of progesterone, interferons and endogenous retroviruses. Reprod. Fertil. Dev. 19:65 78. Spencer, T.E., G.A. Johnson, F.W. Bazer, and R.C. Burghardt. 2004. Implantation mechanisms: insights from the shee p. Reproduction 128:657 668. Spencer, T.E., F.F. Bartol, F.W. Bazer, G.A. Johnson, and M.M. Joyce. 1999. Identification and characterization of glycosylation dependent cell adhesion molecule 1 like protein expression in the ovine uterus. Biol. Reprod. 60:241 250. Spencer, T.E., and F.W. Bazer. 1996. Ovine interferon tau suppresses transcription of the estrogen receptor and oxytocin receptor genes in the ovine endometrium. Endocrinology 137:1144 1147. Spencer, T.E., M.A. Mirando, J.S. Mayes, G.H. Watso n, T.L. Ott, and F.W. Bazer. 1996. Effects of interferon tau and progesterone on oestrogen stimulated expression of receptors for oestrogen, progesterone and oxytocin in the endometrium of ovariectomized ewes. Reprod. Fertil. Dev. 8:843 853. Spicer, L.J., E. Alpizar, and S.E. Echternkamp. 1993. Effects of insulin, insulin like growth factor I, and gonadotropins on bovine granulosa cell proliferation, progesterone production, estradiol production, and(or) insulin like growth factor I production in vitro. J. Anim. Sci. 71:1232 1241. Stabenfeldt, G.H., L.L. Ewing, and L.E. McDonald. 1969. Peripheral plasma progesterone levels during the bovine oestrus cycle. J. Reprod. Fertil. 19:433 442. Sterry, R.A., M.L. Welle, and P.M. Fricke. 2006. Effect of interval fr om timed artificial insemination to initiation of resynchronization of ovulation on fertility of lactating dairy cows. J. Dairy Sci. 89:2099 2109. Stevenson, J.S., D.E. Tenhouse, R.L. Kriser, G.C. Lamb, J.E. Larson, C.R. Dahlen, J.R. Pursley, N.M. Bello, P.M. Fricke, M.C. Wiltbank, D.J. Brusveen, M. Burkhart, R.S. Youngquist and H.A. Garverick. 2008. Detection of anovulation by heatmount detectors and transrectal ultrasonography before treatment with progesterone in a timed AI protocol. J. Dairy Sci. 91:2 901 2915. Stevenson, J.S., J.R. Pursley, H.A. Garverick, P.M. Fricke, D.J. Kesler, J.S. Ottobre, and M.C. Wiltbank. 2006. Treatment of cycling and noncycling lactating dairy cows with progesterone during Ovsynch. J. Dairy Sci. 89:2567 2578.

PAGE 200

200 Stirling, D ., R.R Magness, R. Stone, M.R. Waterman, and E.R. Simpson. 1990. Angiotensin II inhibits luteinizing hormone stimulated cholesterol side chain cleavage expression and stimulates basic fibroblast growth factor expression in bovine luteal cells in primary cu lture. J. Biol. Chem. 265:5 8. Strumpf, D., C.A. Mao, Y. Yamanaka, A. Ralston, K. Chawengsaksophak, F. Beck, and J. Rossant. 2005. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 132:2093 2102. Sugino, N., T. Suzuki, S. Kashida, A. Karube, S. Takiguchi, and H. Kato. 2000. Expression of Bcl 2 and Bax in the human corpus luteum during the menstrual cycle and in early pregnancy: regulation by human chorionic gonadotropin. J. Clin. Endocrinol. Metab. 85:4379 4386. Tanabe, T.Y., and R.C. Hann. 1984. Synchronized estrus and subsequent conception in dairy heifers treated with prostaglandin F I. Influence of stage of cycle at treatment. J. Anim. Sci. 58:805 811. Tenhagen, B .A., M. Drillich, R. Surholt, and W. Heuwieser. 2004. Comparison of timed AI after synchronized ovulation to AI at estrus: reproductive and economic considerations. J. Dairy Sci. 87:85 94. Tenhagen, B.A., C. Vogel, M. Drillich, G. Thiele, and W. Heuwieser 2003. Influence of stage of lactation and milk production on conception rates after timed artificial insemination following Ovsynch. Theriogenology 60:1527 1537. Thatcher, W.W., K.L. Macmillan, P.J. Hansen, and M. Drost. 1989. Concepts for regulation of corpus luteum function by the conceptus and ovarian follicles to improve fertility. Theriogenology 31:149 164. Thatcher, W.W., M. Terqui, J. Thimonier, and P. Mauleon. 1986. Effect of estradiol on peripheral plasma concentrations of 15 feto 13,14 dih luteolysis in cyclic cattle. Prostaglandins 31:745 756. Thompson, J.G., R.J. Patridge, F.D. Houghton, C.I. Cox, and H.J. Leese. 1996. Oxygen uptake and carbohydrate metabolism by in vitro derived bovine embryos. J. Reprod. Fertil. 106:299 3 06. Tsai, S.J., and M.C. Wiltbank. 1998. Prostaglandin F regulates distinct physiological changes in early and mid cycle bovine corpora lutea. Biol. Reprod. 58:346 352. Turnbull, K.E., A.W. Braden, and P.E. Mattner. 1977. The pattern of follicular grow th and atresia in the ovine ovary. Aust. J. Biol. Sci. 30:229 241.

PAGE 201

201 Vallet, L., F.W. Bazer, M.F.V. Fliss, and W.W. Thatcher. 1988. Effect of ovine conceptus secretory proteins and purified ovine trophoblast protein 1 on interoestrous interval and plasma c oncentrations of prostaglandins F 2 and E and of 13,14 dihydro 15 keto prostaglandin F 2 in cyclic ewes. J. Reprod. Fertil. 84:493 504. Vasconcelos, J.L., R. Sartori, H.N. Oliveira, J.G. Guenther, and M.C. Wiltbank. 2001. Reduction in size of the ovulatory follicle reduces subsequent luteal size and pregnancy rate. Theriogenology 56:307 314. Vasconcelos, J.L.M., R.W. Silcox, G.J. Rosa, J.R. Pursley, and M.C. Wiltbank. 1999. Synchronization rate, size of the ovulatory follicle, and pregnancy rate a fter synchronization of ovulation beginning on different days of the estrous cycle in lactating dairy cows. Theriogenology 52:1067 1078. Velazquez, M.A. L.J. Spicer, and D.C. Wathes. 2008. The role of endocrine insulin like growth factor I (IGF I) in fema le bovine reproduction. Domest. Anim. Endocrin. 35:325 342. Vigneault, C.S. McGraw, and M.A. Sirard. 2009. Spatiotemporal expression of transcriptional regulators in concert with the maternal to embryonic transition during bovine in vitro embryogenesis. Reproduction 137:13 21. Villa Godoy, A., J.J. Ireland, J.A. Wortman, N.K. Ames, T.L. Hughes, and R.L. Fogwell. 1985. Effects of ovarian follicles on luteal regression in heifers. J. Anim. Sci. 60:519 527. Voss, A.K., and J.E. Fortune. 1993a. Levels of me ssenger ribonucleic acid for cytochrome P450 17 alpha hydroxylase and P450 aromatase in preovulatory bovine follicles decrease after the luteinizing hormone surge. Endocrinology 132:2239 2245. Voss, A.K., and J.E. Fortune. 1993b. Levels of messenger ribo nucleic acid for cholesterol side chain cleavage cytochrome P 450 and 3 beta hydroxysteroid dehydrogenase in bovine preovulatory follicles decrease after the luteinizing hormone surge. Endocrinology 132:888 894. Walker, W.L., R.L. Nebel, and M.L. McGillia rd. 1996. Time of ovulation relative to mounting activity in dairy cattle. J. Dairy Sci. 79:1555 1561. Walsh, R.B., D.F. Kelton, T.F. Duffield, K.E. Leslie, J.S. Walton, and S.J. LeBlanc. 2007. Prevalence and risk factors for postpartum anovulatory condit ion in dairy cows. J. Dairy Sci. 90:315 324.

PAGE 202

202 Wang, Q.T., K. Piotrowska, M.A. Ciemerych, L. Milenkovic, M.P. Scott, R.W. Davis, and M. Zernicka Goetz. 2004. A genome wide study of gene activity reveals developmental signaling pathways in the preimplant ation mouse embryo. Dev. Cell 6:133 144. Wasielak, M., and M. Bogacki. 2007. Apoptosis inhibition by insulin like growth factor (IGF) I during in vitro maturation of bovine oocytes. J. Reprod. Dev. 53:419 426. Watson, A.J., D.R. Natale, and L.C. Barcroft. 2004. Molecular regulation of blastocyst formation. Anim. Reprod. Sci. 82 83:583 592. Webb, R., and B.K. Campbell. 2007. Development of the dominant follicle: mechanisms of selection and maintenance of oocyte quality. Soc. Reprod. Fertil. Suppl. 64:141 163. Wettemann, R.P., H.D. Hafs, L.A. Edgerton, and L.V. Swanson. Estradiol and progesterone in blood serum during the bovine estrous cycle. J. Anim. Sci. 34:1020 1024. Wiltbank, M.C., A. Gmen and R. Sartori. 2002. Physiological classification of anovulatory conditions in cattle. Theriogenology 57:21 52. Wiltbank, M.C., T.F. Shiao, D.R. Bergfelt, and O.J. Ginther. 1995. Prostaglandin F receptors in the early bovine corpus luteum. Biol. Reprod. 52:74 78. Wolfenson, D., H. Sonego, A. Shaham Albalancy, Y. Shpirer and R. Meidan. 1999. Comparison of the steroidogenic capacity of bovine follicular and luteal cells, and corpora lutea originating from dominant follicles of the first or second follicular wave. J. Reprod. Fertil. 117:241 247. Xu, Z.Z., D.J. McKnight, R. Vishwanath, C.J. Pitt, and L.J. Burton. 1998. Estrus detection using radiotelemetry or visual observation and tail painting for dairy cows on pasture. J. Dairy Sci. 81:2890 2896. Xu, Z., H.A. Garverick, G.W. Smith, M.F. Smith S.A. Hamilton, and R.S. Youngquist. 1995a. Expression of follicle stimulating Hormone and luteinizing hormone receptor messenger ribonucleic acids in bovine follicles during the first follicular wave. Biol. Reprod. 53, 951 957. Xu, Z., H.A. Garverick, G .W. Smith, M.F. Smith, S.A. Hamilton, and R.S. Youngquist. 1995b. Expression of messenger ribonucleic acid encoding Cytochrome P450 Side Hydroxylase, and Cytochrome P450 Aromatase in bovine follicles during the first fol licular wave. Endocrinology 136:981 989.

PAGE 203

203 Yamanaka, Y., A. Ralston, R.O. Stephenson, and J. Rossant. 2006. Cell and molecular regulation of the mouse blastocyst. Dev. Dyn. 235:2301 2314. Yamashita, H., D. Kamada, K. Shirasuna, M. Matsui, T. Shimizu, K. K ida, B. Berisha, D. Schams, and A. Miyamoto. 2008. Effect of local neutralization of basic fibroblast growth factor or vascular endothelial growth factor by a specific antibody on the development of the corpus luteum in the cow. Mol. Reprod. Dev. 75:1449 1 456. Yancopoulos G.D., S. Davis, N.W. Gale, J.S. Rudge, S.J. Wiegand, and J. Holash. 2000. Vascular specific growth factors and blood vessel formation. Nature 407:242 248. Yu, J., M. Deng, S. Medvedev, J. Yang, N.B. Hecht, and R.M. Schultz. 2004. Transge nic RNAi mediated reduction of MSY2 in mouse oocytes results in reduced fertility. Dev. Biol. 268:195 206. Yu, J., N.B. Hecht, and R.M. Schultz. 2001. Expression of MSY2 in mouse oocytes and preimplantation embryos. Biol. Reprod. 65:1260 1270. Zollers, W .G., H.A. Garverick, M.F. Smith, R.J. Moffatt, B.E. Salfen and R.S. Youngquist. 1993. Concentrations of progesterone and oxytocin receptors in endometrium of postpartum cows expected to have a short or normal oestrus cycle. J. Reprod. Fertil. 97:329 337. Zollers, W.G., H.A. Garverick and M.F. Smith. 1989. Oxytocin induced release of partum beef cows: comparison of short versus normal luteal phases. Biol. Reprod. 41:262 267.

PAGE 204

204 BIOGRAPHICAL SKETCH Rafael Sisconeto Bisinotto was born in Campinas, state of So Paulo, Brazil. In 2001, he was an intern at the Agr icultural Institute of Campinas and worked with biotechnologies applied to the potato cropping. In the spring of 2003, he began his studies in veterinary medicine in the School of Veterinary Medicine and Animal Sciences at the University of So Paulo, So Paulo, Brazil. From January of 2005 to December of 2006, he worked under the supervision of Dr. Mrio Binelli in the Laboratory of Molecular Ph ysiology and Endocrinology. During this time, h e studied the effects of follicular estradiol on luteal lifespan and length of the estrous cycle in beef cows In the fall of 2007, he came to the U nited States to work with nutrition and reproduction of dairy cows under the supervision of Dr. Jos Eduardo P. Santos at the Veterinary Medicine Teac hing and Research Center U niversity of California Davis, Tulare, CA. He graduated in veterinary medicine on December 2007. He returned to the U nited States in the fal l of 2008 to begin his Master of Science program in Animal Molecular and Cellular Biology under the supervision of Dr. Jos Eduardo P. Santos at the University of Florida with emphasis on dairy c attle reproduction.