<%BANNER%>

Transcriptional Regulation of Group IVC Phospholipase A2 by TNF-Alpha

Permanent Link: http://ufdc.ufl.edu/UFE0042365/00001

Material Information

Title: Transcriptional Regulation of Group IVC Phospholipase A2 by TNF-Alpha
Physical Description: 1 online resource (155 p.)
Language: english
Creator: Bickford, Justin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: gene, inflammation, phospholipase, regulation, transcription
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Lipid metabolites are an integral part of normal physiology as well as the inflammatory cascade. At the apex of this cascade is the release of arachidonic acid from membrane phospholipids. Physiologically relevant lipid mediators are derived from arachidonate through the activity of various enzymes, most relevantly the cyclooxygenase and lipoxygenase pathways. This study uniquely identifies group IVC phospholipase A2 (PLA2G4C/cPLA2gamma) as a potentially important player in the inflammatory response. In a mouse model of allergic asthma, cPLA2gamma was found to be induced at the mRNA level in the lungs of sensitized and challenged mice compared to control animals. From these results, this study goes on to characterize the molecular regulation of the cPLA2gamma gene in cell culture. It was hypothesized that the pro-inflammatory cytokines most likely responsible for the induction of cPLA2gamma in the mouse model were TNF-alpha and IL-1beta. Utilizing promoter deletion analyses, the first 114 bp upstream of the cPLA2gamma transcriptional start site was identified as a minimal promoter element able to confer TNF-alpha responsiveness. Tethering this fragment to a heterologous promoter confirmed that this fragment also possesses cytokine-specific enhancer-like properties mediated through three potential transcription factor binding sites. These sites were initially identified by in silico analysis, and their functional relevance was verified by mutagenesis studies through specific site deletions. Based on chromatin immunoprecipitation analyses, the cognate transcription factors binding to these sites within the cPLA2gamma enhancer/promoter were found to be ATF-2/c-Jun, p65, and USF1/USF2. Overexpression studies demonstrate the importance and cooperation of these factors in both basal and stimulated gene expression. Additionally, a unique response to extracellular DNA resulting in increased cPLA2gamma expression has been identified and will be a focus of future studies. Overall, the data presented here demonstrate that cPLA2gamma is an important member of the inflammatory cascade controlled by transcriptional regulation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Justin Bickford.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Nick, Harry S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042365:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042365/00001

Material Information

Title: Transcriptional Regulation of Group IVC Phospholipase A2 by TNF-Alpha
Physical Description: 1 online resource (155 p.)
Language: english
Creator: Bickford, Justin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: gene, inflammation, phospholipase, regulation, transcription
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Lipid metabolites are an integral part of normal physiology as well as the inflammatory cascade. At the apex of this cascade is the release of arachidonic acid from membrane phospholipids. Physiologically relevant lipid mediators are derived from arachidonate through the activity of various enzymes, most relevantly the cyclooxygenase and lipoxygenase pathways. This study uniquely identifies group IVC phospholipase A2 (PLA2G4C/cPLA2gamma) as a potentially important player in the inflammatory response. In a mouse model of allergic asthma, cPLA2gamma was found to be induced at the mRNA level in the lungs of sensitized and challenged mice compared to control animals. From these results, this study goes on to characterize the molecular regulation of the cPLA2gamma gene in cell culture. It was hypothesized that the pro-inflammatory cytokines most likely responsible for the induction of cPLA2gamma in the mouse model were TNF-alpha and IL-1beta. Utilizing promoter deletion analyses, the first 114 bp upstream of the cPLA2gamma transcriptional start site was identified as a minimal promoter element able to confer TNF-alpha responsiveness. Tethering this fragment to a heterologous promoter confirmed that this fragment also possesses cytokine-specific enhancer-like properties mediated through three potential transcription factor binding sites. These sites were initially identified by in silico analysis, and their functional relevance was verified by mutagenesis studies through specific site deletions. Based on chromatin immunoprecipitation analyses, the cognate transcription factors binding to these sites within the cPLA2gamma enhancer/promoter were found to be ATF-2/c-Jun, p65, and USF1/USF2. Overexpression studies demonstrate the importance and cooperation of these factors in both basal and stimulated gene expression. Additionally, a unique response to extracellular DNA resulting in increased cPLA2gamma expression has been identified and will be a focus of future studies. Overall, the data presented here demonstrate that cPLA2gamma is an important member of the inflammatory cascade controlled by transcriptional regulation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Justin Bickford.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Nick, Harry S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042365:00001


This item has the following downloads:


Full Text

PAGE 1

TRANSCRIPTIONAL REGULATION OF GROUP IVC PHOSPHOLIPASE A2 BY TNFALPHA By JUSTIN SCOTT BICKFORD A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010 1

PAGE 2

2010 Justin Scott Bickford 2

PAGE 3

To my grandparents 3

PAGE 4

ACKNOWLEDGMENTS I thank my family for thei r unyielding curiosity in both my research and its anticipated completion. Without their support, I doubt I would have made it all the way to my doctoral graduation ceremony. A lot has happened while Ive been in graduate school, and I look forward to spending some time with them when this is completed. I thank my coworkers for their assist ance, training and support. Dr. Amy Hearn gave me an opportunity to be deeply involved in the details of carrying out a research project as a technician. This was an opportunity that I never take for granted. Dr. Kimberly Newsom followed up on this opportunity until I began graduate school. Dr. Nan Su performed the very first experiment to give my project a breath of life during his lab rotation. Drs. Xiaolei Qiu and Jewell Walters were also instrumental in keeping my project moving by helping to develop protocols and develop experiments. Although Sarah Barilovits is the newest addition to the laboratory, she has been helpful with a positive attitude and wonderful baking. Additional ly, I do not know how the lab would get by without Dawn Beachy, a technici an, lab manager, and a peer. She has been amazing in keeping the lab functional and fo llowing in the work of her predecessor, Joan Monnier. I thank my mentor, Dr. Harry Nick, for gi ving me a chance to prove myself in a laboratory. With little laborat ory experience to speak of, he hired me into a position where I had the chance to work closely with Dr. Amy Hearn and him on both the technical side of a research project as well as having input into the direction of the project. I do not think I could have found an opportunity such as that in any other lab and I certainly would not be here otherwise. 4

PAGE 5

I thank my fiance, Dr. Shermi Liang, fo r support and guidance over the last 4 years. I also thank her for her for comple ting her dissertation fi rst. Her expertise on graduating requirements and deadlines was inval uable. I look forward to moving on to the next stages of our lives together. 5

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDG MENTS .................................................................................................. 4LIST OF TABLES ............................................................................................................ 9LIST OF FI GURES ........................................................................................................ 10LIST OF ABBR EVIATION S ........................................................................................... 13ABSTRACT ................................................................................................................... 15 CHAPTER 1 INTRODUC TION .................................................................................................... 17 Arachidonic Acid Metabol ism .................................................................................. 17Metabolism by the Cy clooxygenases ............................................................... 17Metabolism by the Lipoxygenas es ................................................................... 18Eicosanoids and Inflammati on ................................................................................ 19Prostaglandins and Thrombox anes .................................................................. 19Leukotrienes and Lipoxins ................................................................................ 20Phospholipas e A2s ................................................................................................. 21Secretory Phospholipase A2s (sPLA2s) ........................................................... 22Intracellular Calcium-Independent Phos pholipase A2s (group VI or iPLA2s) .... 22Cytosolic Phospholipase A2s (group IV or cPLA2s).......................................... 23Gene regulat ion ...................................................................................................... 29Promoter El ements ........................................................................................... 29Defining an Enhancer Element an d Promoter Inte ractions ............................... 30The Process of Transcription and Transcription Factors .................................. 312 METHOD S .............................................................................................................. 36Mouse model of Alle rgic Asth ma ............................................................................ 36RNA Isolation and Purification ................................................................................ 36Northern Blot Analysis ............................................................................................ 37Real-Time Reverse-Transcription PCR ................................................................... 38Cell Cult ure ............................................................................................................. 39Cloning the cPLA2 Promoter and Human Growth Hormone (hGH) Reporter Constructs for Promoter Deletion A nalysis .......................................................... 40hGH Reporter Constructs for Site -Directed Deleti on Analysis ................................ 41Transient Transfection of Promoter Constructs ...................................................... 41Immunoblot A nalysis ............................................................................................... 42Chromatin Immunoprecip tiation A nalysis ................................................................ 42Overexpression of Transcription Fa ctors ................................................................ 45Interferon Stimulating DNA ..................................................................................... 45 6

PAGE 7

Statistical Analyses ................................................................................................. 463 MOUSE MODEL OF A LLERGIC AST HMA ............................................................ 51Introducti on ............................................................................................................. 51Allergic Asthma ................................................................................................ 51Characteristics of an allergic re sponse ...................................................... 51Cytokine pathways leading to the pr oduction of lipid mediators ................. 52Inflamma tion ..................................................................................................... 52Results .................................................................................................................... 55Cytokine and Chemokine Induction in Mice Treated with Ovalbumin (OVA) or Apsergillus fumigatus (Af) Extract ............................................................. 55Steady State mRNA Levels of t he Cyclooxygenase Family in Af Treated Mice .............................................................................................................. 56Steady State mRNA Levels of the Lipoxygenase Family in Af Treated Mice .... 57Steady State mRNA Levels of Phospholi pase A2 s .......................................... 58Secretory phospholipase A2s (groups II, V, X, and XI II) ............................. 58Cytosolic phospholipase A2s (group IV) ..................................................... 59Discussio n .............................................................................................................. 604 CYTOSOLIC PHOSPHOLIPASE A2 GAMMA ........................................................ 72Introducti on ............................................................................................................. 72Tumor Necrosis Factor-Alpha (TNF) ............................................................. 73Transcription Factors (ATF-2/ c-Jun, p65, and USF) ......................................... 73cPLA2 Gene, Transcript and Protein Stru cture ............................................... 75Results .................................................................................................................... 76cPLA2 Expression in Response to the antigen Aspergillus fumigatus ( Af ) ...... 76cPLA2 Expression in Response to a Panel of Cytokines and Chemokines ..... 76Promoter Deletion Analysis of cPLA2 .............................................................. 78Characterization of the Pr oximal Promoter of cPLA2 Containing Enhancer Activity ........................................................................................................... 81Identification of Functi onal Transcription Factor Binding Sites within the cPLA2 Enhancer/Pro moter .......................................................................... 82Chromatin Immunoprecipitation Analysis of the cPLA2 Enhancer/Promoter Region ........................................................................................................... 83Effects of Overexpression of ATF-2/ c-Jun, p65, and USF1 on the Proximal cPLA2 Enhancer/Pro moter .......................................................................... 86Delineating Interplay between Transcription Factor Binding Sites by Cooverexpres sion .............................................................................................. 87Knockdown of ATF-2/c-Jun, p65, and USF1 by siRNA .................................... 88Discussio n .............................................................................................................. 895 INDUCTION OF CPLA2 GAMMA BY EXPOSURE TO EXTRACELLULAR DNA 115Potential Pathways for a Transcriptional Response to Extrac ellular DNA ............ 115Results .................................................................................................................. 116 7

PAGE 8

Induction of cPLA2 Following Plasmid Transfectio n ...................................... 116Effect of Interferon-Stimulating DNA on cPLA2 Expression .......................... 117Implication of the RNA Sensing Pathway in Transfection-Dependent cPLA2 Induction ...................................................................................................... 118IFN -Independence of Transcripti onal Activa tion ........................................... 119Defining the Specific Stimulus Invo lved in the DNA-Dependent Induction of cPLA2 ........................................................................................................ 120Discussio n ............................................................................................................ 1216 FUTURE DIRE CTIONS ........................................................................................ 131Role of cPLA2 in the Inflammato ry Respons e ..................................................... 131Therapeutic Control of Inflammation by Regulating the Expression of cPLA2 ..... 132The Role of cPLA2 at the Phospholip id Membr ane ............................................. 133Role of cPLA2 in the Innate Imm une Response .................................................. 133LIST OF REFE RENCES ............................................................................................. 136BIOGRAPHICAL SK ETCH .......................................................................................... 155 8

PAGE 9

LIST OF TABLES Table page 2-1 List of mouse primers for cytoki nes, chemokines, growth factors and cyclophili n ........................................................................................................... 472-2 List of mouse primers for cycloo xygenase and lipoxyge nase pathways ............. 482-3 List of mouse primer s for phospholip ase A2 s ..................................................... 492-4 List of human primer s for real-t ime PCR ............................................................ 492-5 List of primers used for promoter deletion analysi s of the human cPLA2 enhancer/promo ter ............................................................................................. 502-6 List of primers used for quickchange mutagenesis of the human cPLA2 enhancer/promo ter ............................................................................................. 50 9

PAGE 10

LIST OF FIGURES Figure page 1-1 Chemistry of arachidonic acid me tabolism ......................................................... 321-2 Diagram of eicosanoid metabolism ..................................................................... 331-3 Phylogenetic tree of group IV phospholipase family members. .......................... 341-4 Amino acid sequence alig nment of group IV phospholipase family members .... 353-1 Comparative cytokine analysis in OVA (OVA) and Aspergillus fumigatus ( Af ) sensitization and chall enge in C57BL/6J mice .................................................... 663-2 Comparative growth factor and chemokine analysis in OVA (OVA) and Aspergillus fumigatus ( Af ) sensitization and challeng e in C57BL/6J mice .......... 673-3 Gene expression analysis of enzymes involved in prostanoid synthesis in Af sensitized and challenged C57BL/6J mice ......................................................... 683-4 Gene expression analysis of lipoxyge nase family members in sensitized and challenged C57BL/ 6J mice ................................................................................. 693-5 Secretory phospholipase A2 gene expression levels in sensitized and challenged C57BL/ 6J mice ................................................................................. 703-6 Cytosolic phospholipase A2 gene ex pression levels in sensitized and challenged C57BL/ 6J mice ................................................................................. 714-1 Evaluation of steady st ate mRNA levels of cPLA2 in human eosinophils .......... 944-2 Evaluation of steady st ate mRNA levels of cPLA2 in pulmonary cells in response to a panel of cytoki nes ........................................................................ 954-3 Evaluation of steady st ate mRNA levels of cPLA2 in various human pulmonary cells ................................................................................................... 964-4 Immunoblot analysis of cPLA2 in A549 cells ..................................................... 974-5 Steady-state mRNA levels of cPLA2 in S9 cells up to eight hours .................... 984-6 Heterogeneous nuclear RNA (hnRNA) levels of cPLA2 in S9 cells up to eight hour s .......................................................................................................... 994-7 Diagram of the cPLA2 gene structure and subsequent promoter constructs ... 1004-8 Determination of the IL-1 and TNFresponsive cPLA2 promoter ................ 101 10

PAGE 11

4-9 Determination of the TNFresponsive cPLA2 promoter ................................ 1024-10 Determination of the minimal TNFresponsive cPLA2 promoter................... 1034-11 Determination of enhancer activity within the minimal TNFresponsive cPLA2 promoter .............................................................................................. 1044-12 Site deletions of the cPLA2 enhancer/pro moter .............................................. 1054-13 Northern blot analysis of cPLA2 enhancer/promoter site deletions ................. 1054-14 Real-time RT-PCR analysis of cPLA2 enhancer/promoter site deletions ........ 1064-15 ChIP of CRE, NFB and E-Box specific transcr iption factors after 12 hours of TNFtreatment ........................................................................................... 1074-16 ChIP of RNA Polymerase II within one hour of TNFstimulation .................... 1084-17 ChIP of p65 and p50 within one hour of TNFstimulation .............................. 1094-18 ChIP of USF1 wit hin one hour of TNFstimulat ion ......................................... 1104-19 ChIP of ATF-2 and c-Jun within two hours of TNFstimulation ...................... 1114-20 Effect of overexpression of wild-type transcription factors on the activity of the cPLA2 enhancer/promoter ......................................................................... 1124-21 Effect of overexpression of dominant negative (DN) forms of transcription factors on the activity of the cPLA2 enhancer/promo ter .................................. 1134-22 Effect of co-overexpression of wild-ty pe transcription factors on the activity of the cPLA2 enhancer/promoter ......................................................................... 1145-1 Endogenous cPLA2 expression in S9 cells transfected with pcDNA3.1 .......... 1235-2 Endogenous cPLA2 expression in indicated ce ll lines exposed to interferonstimulating oligonuc leotides .............................................................................. 1245-3 cPLA2 induction by transfection reagent alone, transfected plasmid, or PS2006 in HEK293 cells with and without TLR9 expr ession ................................. 1255-4 Expression of genes associated with the RNA sensing pathway in response to plasmid transfecti on in S9 ce lls .................................................................... 1265-5 cPLA2 expression in S9 cells fo llowing treatm ent with TNFor IFN........... 1275-6 Real-time RT-PCR analysis of cPLA2 and RIG-I in HFL-1 cells with various treatment s ........................................................................................................ 128 11

PAGE 12

12 5-7 Real-time RT-PCR analysis of cPLA2 and cPLA2 in response to various DNA treatments in S9 cells ............................................................................... 1295-8 Real-time RT-PCR analysis of cPLA2 in S9 cells primed with IFN and transfected wit h pcDNA .................................................................................... 130

PAGE 13

LIST OF ABBREVIATIONS ATF Activating transcription factor bp basepair ChIP Chromatin Immunoprecipitation COX Cyclooxygenase DN Dominant negative HETE Hydroxyeicos atetraenoic acid hGH Human growth hormone hnRNA Heterogeneous nuclear RNA HPETE Hydroperoxyeicosatetraenoic acid IFN Interferon IL Interleukin kb kilo-basepair LO Lipoxygenase LT Leukotriene LX Lipoxin mRNA Messenger RNA PBS Phosphate buffered saline PCR Polymerase chain reaction PG Prostaglandin PLA2 Phospholipase A2 PO Phosphodiester PS Phosphorothioate RT-PCR Reverse-transcription PCR TF Transcription factor 13

PAGE 14

14 TNF Tumor necrosis factor TSS Transcriptional start site TX Thromboxane USF Upstream stimulating factor

PAGE 15

Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy TRANSCRIPTIONAL REGULATION OF GROUP IVC PHOSPHOLIPASE A2 BY TNFALPHA By Justin Scott Bickford December 2010 Chair: Harry S. Nick Major: Medical Sciences--Bioch emistry and Molecular Biology Lipid metabolites are an in tegral part of normal physi ology as well as the inflammatory cascade. At the apex of this cascade is the release of arachidonic acid from membrane phospholipids. Physiologically relevant lipid mediators are derived from arachidonate through the activity of various enzymes, most relevantly the cyclooxygenase and lipoxygenase pathways. This study uniquely identifies group IVC phospholipase A2 (PLA2G4C/cPLA2) as a potentially important player in the inflammatory response. In a mouse model of allergic asthma, cPLA2 was found to be induced at the mRNA level in the lungs of sensitized and challenged mice compared to control animals. From these results, this study goes on to characterize the molecular regulation of the cPLA2 gene in cell culture. It wa s hypothesized that the proinflammatory cytokines most likely responsible for the induction of cPLA2 in the mouse model were TNFand IL-1 Utilizing promoter deletio n analyses, the first 114 bp upstream of the cPLA2 transcriptional start site was i dentified as a minimal promoter element able to confer TNFresponsiveness. Tetheri ng this fragment to a heterologous promoter confi rmed that this fragment also possesses cytokine-specific enhancer-like properties mediated through thr ee potential transcripti on factor binding 15

PAGE 16

16 sites. These sites were initially identified by in silico analysis, and their functional relevance was verified by mutagenesis studie s through specific site deletions. Based on chromatin immunoprecipitation analyses, the cognate transcription factors binding to these sites within the cPLA2 enhancer/promoter were found to be ATF-2/c-Jun, p65, and USF1/USF2. Overexpression studies dem onstrate the importance and cooperation of these factors in both basal and stimulated gene expression. Additionally, a unique response to extracellular DNA resulting in increased cPLA2 expression has been identified and will be a focus of future studies. Overall, t he data presented here demonstrate that cPLA2 is an important member of the inflammatory cascade controlled by transcriptional regulation.

PAGE 17

CHAPTER 1 INTRODUCTION Arachidonic Acid Metabolism Arachidonic acid is a 20-carbon omega-6 fatty acid which resides in the tails of membrane phospholipids (Figure 11). Free arachidonic acid within the cell comes from either cleavage from membrane phospholipids by the phospholipases or synthesis from the 18-carbon linoleic acid. Once released, ar achidonic acid is further metabolized by the cyclooxygenases or lipoxygenases into downstream signaling molecules. The roles of eicosanoids and their downstream metabo lites have been studied extensively [1]. The phospholipase A2s (PLA2s) release arachidonic acid (AA), its precursor linoleic acid, or platelet activating factor (PAF), from membrane phospho lipids through specific cleavage at the sn-2 position [2]. AA is then further metabolized by downstream pathways involving either the cyclooxygenases or lipoxygenases as shown in Figure 12. Metabolism by the Cyclooxygenases The cyclooxygenase (COX) family of en zymes produce prostaglandin H2 (PGH2), and thus are also known as PGH2 synthase enzymes (PGHS). The products of this pathway are illustrated in Figure 1-1. COX enzymes incorporate a single covalent bond between carbons 8 and 12 in the arachidonic acid backbone, a peroxy bridge between carbons 9 and 11, as well as an additional OOH group at carbon 15. The OOH group is then converted to an OH to yield PGH2, which is then used by all subsequent prostanoid synthases. Prostacyclin synthase opens up the peroxy bridge, resulting in a hydroxyl group at carbon 11, whilst formi ng an ether bond between carbons 6 and 9 to form PGI2, or prostacyclin. Splitting open the peroxy bridge of PGH2 by their respective 17

PAGE 18

prostaglandin synthases yields the rema inder of the prost aglandins, with PGD2, PGE2, and PGF2 differing in the final state of these two oxygens. PGD2 contains a hydroxyl and ketone at carbons 9 and 11, respectively, while PGF2 contains two hydroxyl groups and PGE2 contains a ketone and a hydroxyl at these two sites. Repositioning by thromboxane A2 synthase (TXAS) of an ox ygen from the peroxy bridge into an ether bond in the cyclopentane ring between carbons 11 and 12 results in the production of TXA2. Metabolism by the Lipoxygenases The lipoxygenase family of enzymes in corporate an oxygen into the carbon backbone of linoleic or arachidonic acid to create the leukotrienes and lipoxins. Lipoxygenases are named based on the position within arachidonic acid to which an oxygen is added via reduction of a hydroperoxy intermediate, hydroperoxyeicosatetraenoic acid (HPETE) (Figure 1-1). Initially, metabolism by 5-LO forms an oxygen bridge between carbons at positions 5 and 6 to form the leukotrienes. The result of this first reaction is the formation of the leukotriene A4 (LTA4) via a 5HPETE intermediate. LTB4 is formed by the addition of a water molecule to LTA4 resulting in the addition of a second oxygen at carbon 12. Further metabolism of LTA4 by addition of the sulphur atom of glutathione (a tripeptide of L-cysteine, L-glutamic acid and glycine) to carbon 6 results in the formati on of the cysteinyl leukotrienes, initially LTC4. LTD4, LTE4 are formed by the removal of porti ons of the glutat hione. Removal of the glutamic acid portion resu lts in the formation of LTD4 and further removal of the glycine creates LTE4. In all three of these cysteinyl leukotrienes, the presence of the central cysteine from the glutathione re mains bound to carbon 6. Lipoxins, or lipoxygenase interaction products (LXs), were first identified by Serhan et al. in 1984 [3]. 18

PAGE 19

The lipoxins are synthesized through the action of 5-LO on the 15-LO product 15HPETE resulting in the trihydroxytetraene structure of LXA4 with hydroxyl groups at carbons 5, 6 and 15 and double bonds at car bons 7, 9, 11 and 13 (Figure 1-1). The lipoxins possess anti-inflammatory properties in opposition to the leukotrienes by stimulating vasodilation [4 5]; they also participate in the resolution phase of inflammation and can be synthesized by COX-2 in response to aspirin [6]. Eicosanoids and Inflammation As a result of metabolism by the cycl ooxygenases, COX-1, -2 or -3, the prostaglandins (PGs) and thromboxanes (TXs ) are produced. The main functions of thromboxanes are facilitation of vasoc onstriction and platelet aggregation while the prostaglandins have the opposite effect and mediate vasodilation along with other tissue-specific physiological activities [7]. This metabolic pathway has been the major focus in the treatment of pain and inflamma tion and is blocked at the level of the COX enzymes by non-steroidal anti-inflammatory drugs, or NSAIDs, such as aspirin and Vioxx [8]. While the prostanoids are one cla ss of targets for in flammation, several asthma medications have targeted either the lipoxygenases or the leukotriene receptors. Prostaglandins and Thromboxanes The prostaglandins are comprised of a comp lex family of bioactive eicosanoids as shown in Figure 1-2, each of which have va rying effects on inflammation and, given the focus of this proposal, will be discussed pred ominantly in relation to the lung. PGD2 can induce sleep, decrease body te mperature, and modulate odor and pain responses and, more relevant to this proposal, both PGD2 and PGF2 have been shown to act as bronchoconstrictors [9, 10]. PGE2 has the opposite effect and acts to reduce 19

PAGE 20

inflammation by relieving bronchoconstriction [11]. Finally, PGI2 acts as a bronchodilator and exists in a delicate balance with TXA2, which induces platelet clumping and bronchoconstriction [12]. Leukotrienes and Lipoxins The second major branch point in eicosano id metabolism results from the action of the lipoxygenases on arachidonic acid producing the leukotrienes (LTs) (Figure 1). The leukotrienes are also import ant in both initiating and maintaining the inflammatory response [13]. Their physiological relevance is best illustrated by the action of leukotriene antagonists as effective preventative measures in the treatment of asthma by relieving bronchoconstriction [14, 15]. LTB4 acts primarily as a chemotactic substance to recruit eosinophils to the lung while the cysteinyl leukotrienes (LTC4, LTD4 and LTE4) act as powerful stimulators of br onchoconstriction, with each one being less potent than the previous [16, 17]. Lipoxins (LXs), such as LXA4, promote downregulation of PGE2, cell clearance and resolution of inflammation [18]. Inhibition of this pathway by cysLT receptor antagonists or 5-LO inhibitors, Singulair or Zyflo, has been used for treatment of asthma [19, 20]. 15-LO converts arachidonic acid to 15HPETE. 15-HPETE is converted to LXA4 by 5-LO and epoxide hydrolase [3]. The activation of 5-LO reduces further production of the leukotrienes, breaking the cyclical nature of the inflammatory cascade. The lipoxins can be produced by the action of 12-LO on LTA4 as well, also diminishing the pool of leukotriene precursors. The lipoxins are r apidly produced and involved in the resolution phase of inflammation and possess anti-infla mmatory properties. The production of these signaling molecules prevents further damage from the inflammatory response. 20

PAGE 21

Phospholipase A2s As described, the eicosanoids play a pivo tal role in inflammation, ultimately mediating vasoconstriction and dilation [21, 22] and possessing proand antiinflammatory properties [23]. Although this me tabolism leads to the biosynthesis of the bioactive lipids including the prostaglandins, thromboxanes, leukotrienes and lipoxins, lipid mediators are initia lly metabolized from membrane phospholipids, yielding the ubiquitous fatty acid, arachidonic acid. At the apex of this pathway are the phospholipases, which liberate arachidonate, t he sole substrate for the downstream enzymatic cascade. The phospholipase superfam ily is present in all organisms and is comprised of ten groups of secretory phospholipases (sPLA2s), with group XIV being recently identified in prokaryo tes [24, 25], two groups of plat elet activating factor acyl hydrolases (groups VII and VIII) [26] and two cytosolic groups (groups IV and VI). Of the cytosolic groups, one contains calcium i ndependent phospholipases (group VI, iPLA2s) whilst the other is almost exclusively composed of calcium dependent phospholipases (group IV, cPLA2s). Prior to formation of the eicosanoids, phos pholipases first cleave arachidonic acid from membrane phospholipids, providing the substrate for the downstream metabolic pathway. The phospholipases were first identifi ed in snake venom in the late 1800s and, since then, have been characterized as an impor tant family of enzymes across species [27]. PLA2 enzymes catalyze the cleavage of fatty acids, such as arachidonic acid, from phospholipids and are disti nguished from the PLA1 enzymes by their propensity to catalyze an sn-2 dependent cleavage reaction. Several PLA2 enzymes have been identified in mammals and are cat egorized into groups I, II, III, V, VI, X, and XII [25, 28]. Group XIII phos pholipase A2 has subsequently been reclassified as a group XII 21

PAGE 22

phospholipase isozyme. These enzymes are further grouped based on sequence homology, localization and calcium r equirements as secretory (sPLA2s) and cytosolic calcium-dependent (cPLA2s) and calcium-independent (iPLA2s). The sPLA2s are small proteins (~14 kDa), have little fatty acid specificity and all require millimolar concentrations of calcium, while the iPLA2 are intracellular, have a wide range of specificities and lack any calcium require ment for enzymatic activity [29-31]. Secretory Phospholipase A2s (sPLA2s) The most diverse group of phospholipases are members of the low-molecular weight category of se creted phospholipases, sPLA2s. All of the sPLA2s are calcium dependent, and, with the exception of group III, they are all smaller than 20 kDa. The secretory phospholipases also have very little preference for arachidonic acid over any other fatty acid. The impact of secretory phospholipases va ries greatly from breaking down low-density lipoprotein co mplexes to possessing antibacte rial properties [32, 33]. Intracellular Calcium-Independent Phospholipase A2s (group VI or iPLA2s) The group VI calcium-independe nt phospholipase A2s, iPLA2s, are grouped together based on their lack of r egulation by calcium, although they share the distinction of being intracellular with the cPLA2 family, to be discussed later. While this group contains six members, only one has been studied extensively, iPLA2 Despite this familys independence from calcium, one member, iPLA2, is partially regulated by direct interactions with calmodulin [34]. This family of phospholipases share a catalytic serine, but are grouped toget her based on their calciu m independence rather than sequence homology. While the iPLA2s do cleave fatty acids from the sn-2 position of phospholipids, they have very low substrate specificity. 22

PAGE 23

Cytosolic Phospholipase A2s (group IV or cPLA2s) Of specific relevance to the current studi es are the recently identified cytosolic phospholipase A2s (cPLA2), of which six isozymes have been identified in mammals beginning with cPLA2 and, more recently, and [35-37]. The human isozymes are labeled as group IVA through IVF and also designated with the corresponding Greek letters as cPLA2 , and The majority of the cPLA2s contain a C2 calcium binding domain and hence require micr omolar concentrations of calcium for activity with the exception of cPLA2, which lacks both the regulatory phosphorylation sites and the calcium binding C2 domain thus having no requirement for Ca2+ [38, 39]. However, cPLA2 is included in this family based on conservation, most importantly, of the conserved catalytic triad, Arg54, Se r82, Asp385 [36]. An analysis of the six cPLA2 isoforms by amino acid alignment using Clustal software (ClustalW v1.83, European Bioinformatics Institute, www.ebi.ac.uk/Tools/clustalw ) along with a phylogenetic tree (as determined by a BLOSUM62 matrx) illustrate the clustering of the and isoforms in a more highly conserved gr oup versus the alpha and gamma isoforms (Figures 1-3 and 1-4). By far, cPLA2 has been the most widely studied of the group IV phospholipases since its discovery and cloni ng in 1990 [40, 41]. Cu rrent studies are also focusing on acquiring a better understandi ng of the remaining group members [28, 42, 43]. As illustrated in Figure 1-4, cPLA2 is also the smallest member of the group at 61 kDa, due to the exclusion of the C2 domain, while cPLA2 and are 85, 114 and 92, 100 and 96 kDa, respectively [39, 43, 44]. cPLA2 was first identified in 1998 from analysis of human brain expressed sequence tags (ESTs) and found to be highly expressed in heart and skeletal muscle [42]. Simultaneously, cPLA2 was being studied by Unde rwood and colleagues in much 23

PAGE 24

greater detail and found to be localized to the same tissues [38]. In the paper by Underwood, et al., cPLA2 was analyzed and determined to possess phospholipase activity specific to the sn-2 position by in vitro assays. According to these investigators, the presence of the C-terminal prenylation domain was not required for association with the membrane fraction. Since its discovery, approximately fourteen papers have studied cPLA2 at the RNA or protein levels in the past nine years. One of the first papers follo wing the discovery of cPLA2 briefly addressed its transcriptional regulation. The first study to reveal cPLA2 regulation was by Lindbom, et al., in 2001 [45]. This study identified a number of expressed phospholipases in human nasal mucosa, including cPLA2. In 2002, the same group went on to investigate the regulation of cPLA2 in nasal epithelial cells (RPMI 2650) as well as bronchoepithelial cells (BEAS-2B) [46]. Of the panel of 19 phospholipases in th is study, it was found that cPLA2 was substantially induced at the mRNA level by TNFin the two airway epithelial cells lines. These studies revealed that, in response to TNF, a proinflammatory cytokine, both cPLA2 and cPLA2 were induced at the mRNA level. Also in 2002, the Leslie laboratory published a study on the proposed enzymatic activity of purified cPLA2 [47]. They confirmed that isolated cPLA2 possesses the proposed PLA2 activity, but will also subsequently hydrolyze the fatty acid in the sn-1 position with little preference fo r any fatty acid over another This observation was also confirmed in a mouse cell line derived from cPLA2 knockout mice. In early 2003, the Shimizu lab studied the role of cPLA2 in a human embryonic kidney cell line, HEK293, overexpressing cPLA2 [48]. When cPLA2 was conjugated to GFP in a pcDNA vector, it was found to be lo calized to the ER and Golgi. Furthermore, 24

PAGE 25

they found that, by mass spectrometry, the relative abundance of phospholipids containing ethanolamine and 16-carbon fatty acid chains was reduced in these cPLA2 overexpressing cells relative to their cont rol cells. Lastly, they also observed an increase in free arachidonic acid follo wing hydrogen peroxide exposure in cPLA2 overexpressing cells. Based on these studies, Asai, et al. proposed a role for cPLA2 in membrane remodeling, particularl y under oxidative stress [48]. Later in 2003, Murakami, et al. also utilized HEK293 cells stably expressing cPLA2 [49]. They observed that the addition of either IL-1 or serum to the media of these cells were able to increase arachidonic acid release relative to control cells. They also observed that the increas e in arachidonic acid was accompanied by an increase in PGE2 via a COX-2 dependent pathway. In addition, Murakami, et al. also confirmed the requirement of the catalytic serine, S82, on enzymatic activity of cPLA2 by mutagenesis. They found that in HEK293 cells expressing this mutant, the levels of arachidonic acid release were equivalent to the levels seen in control cells. These studies also confirmed that cPLA2 is strongly associated with membrane fractions in these cells and localized to the ER, as previously demonstrated [48]. Despite being associated with membrane fractions in multiple studies, neither this association nor the enzymatic activity was found to be dependent on C-terminal prenylat ion. These results did not fully exempt the C-terminal preny lation from contributing to membrane association due to the fact that phospholipase activity was observed in both the isolated cytosolic and membrane fractions at levels well above those containing the wild-type protein. Most significantly, Murakami et al. have strongly argued that cPLA2 is second only to cPLA2 in the generation of spontaneous and st imulus induced arachidonic acid 25

PAGE 26

release [49], thus providing evidence fo r the importance of this isoform to the inflammatory response as implied in the present study. Although the C-terminal prenylation moti f (-CCLA) was found to affect the localization of phospholipase acti vity to the membrane fraction, the details of this moiety were not studied until later in 2003. That year Jenkins, et al. performed experiments on purified cPLA2 to analyze this modification [50]. Prenylation occurs by the covalent addition of a farnesyl or ger anyl-geranyl group to the protei n. Therefore, by utilizing radiolabeled farnesyl or geranyl-gerany l precursors, they determined that cPLA2 did contain a farnesyl moiety. They next proceeded to more accurately determine the nature of this modification by mass spec trometry and found that, within the CCLA motif, the first of these two cysteines (C538) contains the farnesyl modification while C539 is cleaved from the modified protei n. These results were corroborated by two studies in 2005 investigating pos t-translational prenylation on cPLA2 and the effect on its activity [51, 52]. Utilizing a different methodology, the studies by Tucker et al. confirmed the presence of a C-terminal fa rnesyl group by HPLC (high-performance liquid chromatography) [51]. Both of t hese subsequent studies found that the prenylation is neither required for the activity nor the very tight membrane association of the protein, which is retained even in the presence of a high salt concentration. It has been shown that the appetite-regulating hormone, leptin, can increase leukotriene synthesis in macrophages from l eptin-deficient mice [53]. Following up on this data, in 2004 Mancuso et al. invest igated the effects of leptin on cPLA2 protein levels [54]. They found that, in isolated m ouse alveolar macrophages, leptin was able to induce cPLA2 protein expression by 80%. Because the concomitant increase in 26

PAGE 27

leukotriene synthesis was calcium indepen dent, they proposed that the increase in cPLA2 protein contributed to downstream pr oduction of leukotrienes in the mouse alveolar macrophage cells, although a dire ct link between the two events was not shown. Also in 2005, Vitale et al. cloned the mouse homolog of cPLA2 [55]. Despite being 56% identical to the human cDNA sequence for cPLA2, the mouse form lacked any clear C-terminal prenylation mo tif. Interestingly, when investigating the tissue specificity of the cPLA2 protein, they did not observe any detectable expression in heart, skeletal muscle or lung, as had been observed fo r the human protein. The mouse cPLA2 protein appeared to be specific only to the ovary and embryo out of the tissues which they examined. Unlike previous studies investigating cellular localization of overexpressed and tagged cPLA2, this study examined the endogenous protein by immunofluorescence and found it to be distributed in the cytop lasm and targeted to the nuclear envelope, perhaps participating in germinal vesicle breakdown. Worth noting, however, is that the differenc e in cellular localization between the overexpressed human protein and the endogenous mouse protein may be an effect of the C-terminal prenylation or an artifact of overexpression. In 2007, Tithof et al. undertook a st udy to determine which phospholipase was contributing to downstream prostaglandin production in bovine endometrial cells [56]. It has been known that prostaglandins PGE2 and PGF2 participate in the regulation of estrous and that, in cattle, the downregulation of PGF2 in response to interferon tau (IFN ) is required to maintain pregnancy. In t hese studies, they observed that, of the calcium independent phospholipase A2s, only cPLA2 was substantially increased in 27

PAGE 28

response to IFN Concomitantly, there was an increase in PGE2 production relative to PGF2, implying that arachidonic acid produced by cPLA2 preferentially produces PGE2. In 2008, the first studies we re performed in which cPLA2 was investigated in a physiological disease state. In this study, Br own et al. infected mice with the parasitic nematode, Trichinella spiralis and found that cPLA2 protein levels in the intestinal epithelium were increased substantially such that it became one of the most abundant cellular proteins [57]. It was also shown that cPLA2 is highly sensitive to degradation by the extracellular -chymase, Mcpt-1. It is proposed that this sensitivity may be beneficial in rapidly degrading cPLA2 protein if it is released from cells or presented on the cellular surfaces. Subsequent to these studies, in 2009, cPLA2 mRNA was found to be elevated in mouse intestines, as well as lungs, in response to IL-9 in an IL-13 dependent manner [58]. Again, in 2009, studies were performed to investigate the subcellular localization of cPLA2. The Yamashita laboratory revisited this topic from their 2005 paper [52] in order to better define the localization as well as to contribute to the knowledge about the enzymatic activities of this protein [ 59]. By utilizing a C-terminal FLAG-tagged cPLA2, which would disrupt any possible C-terminal prenylation, or an N-terminal FLAG-tag, Yamashita et al. further confirmed that the C-terminal processing of the cPLA2 protein is not required for its subcellular localizati on. With each of these modifications, cPLA2 was found to be localized to the ER membrane. Upon further investigation, they found that a portion of this protein was localized to the mitochondria. The most substantial observation in this manuscript was not the contribution to previous bodies of work 28

PAGE 29

detailing the membrane association of cPLA2, but the enzymatic st udies involving the transacylase activity of cPLA2. Purified cPLA2 has previously been shown to have specificity for arachidonic acid, although Yamash ita et al. utilized shorter acyl chains of 8-18 carbons. cPLA2 was found to preferentially cleave these fatty acids from phospholipids containing choline or ethanolamine head-groups suggesting that cPLA2 has specificity not only for fatty acids, but also for the head-groups of phospholipids as seen by the Shimizu laboratory in 2003 [48]. In addition to the studies detailed here, cPLA2 was briefly investigated in 2005 due to an association of this locus with sch izophrenia by the Wei lab in a series of studies involving Chinese schizophrenia patients [60-63]. The chromosomal region of 19q13.3 is also a common deletion in human gliomas and thus the lack of cPLA2 has been suspected of contributing to this form of cancer [64]. It has since been dismissed as a contributing factor, but this region is still a useful marker for tumor aggressiveness [65]. Gene regulation Promoter Elements Transcription can be driven by cis -regions of DNA in close proximity the transcriptional start site (TSS), referred to as promoters. The best studied of these is the TATA box which lies 35 bp upstream of a small fracti on of promoters and is a recognition site for the TATA binding prot ein of the TFIID complex. Genes lacking a TATA box often contain dow nstream promoter elements (DPEs) or pyrimidine-rich initiator elements (INRs). Any number of these elements are capable of directing the binding of transcription factors such as TFIID and, subsequently, the rest of the preinitiation complex (PIC). Although most genes contain some combination of these 29

PAGE 30

elements, some genes lack any known promoter element and it is not well characterized as to what defines the specific start sites of these genes. It has been established that a competent PIC can form at other transcription factor binding sites, such as those involving NFB, and subsequently be transferred to a TATA-less promoter for transcription initiation [66]. Regardless of the particular components present in a promoter, it always contains the TSS and is bound by the general transcription factors. Defining an Enhancer Element and Promoter Interactions Promoters are often regulat ed by the activity of enhancer elements. Enhancer elements can be found upstream, dow nstream or within a gene as a cis -regulatory element, or they may be found on a different chromosome as a trans -regulatory element. Enhancer elements are defined as being both position and orientation independent as well as being able to functi on with a heterologous promoter. Because these regions must be accessi ble to various transcription factors when the gene is in an active state, these regions of open chroma tin structure may be identified by DNase I hypersensitivity assays. The transcription factors that are known to bind DNA also have specific consensus sequences to which they bind as well as cofact ors that they may bind to. Although some enhancer elements are proximal to their respective promoters and may interact directly, many lay hundreds or even several thousand base-pairs from their promoters. There are a number of ways in which a distal enhancer can interact with a promoter including tracking, reeling, or looping [67-69]. Several other proteins are often involved in helping to arrange thes e regions so that the bound proteins may interact or even transfer between the enhancer and promoter elements. 30

PAGE 31

The Process of Transcription and Transcription Factors Two of the first steps required for transcr iption to occur at the gene level are the recruitment of chromatin modifying proteins and the opening of the chromatin structure. This process is also directed by other fact ors which bind to the enhancer or promoter and act to direct this process. Once the DNA at the promoter is accessible, TATAbinding protein (TBP) binds upstream of the TSS and the TFIID complex assembles. This is followed by assembly of the remainin g factors of the pre-initiation complex (PIC) at the promoter. The c-terminal domain (CTD ) of RNA Polymerase II is phosphorylated at serine-5 when the PIC is primed and this mark disappears shortly after transcription initiation. As transcription initiation begi ns, serine-2 of the RNA Pol II CTD becomes phosphorylated and synthesis of t he new mRNA transcript begins. 31

PAGE 32

Figure 1 -1. Chemi s acid and thrombo x product s moiety a s try of arac h three dow n x anes), 5L s are listed i nd subseq u h idonic aci d n stream m e L O (leukotri e i n bold whil u ent produ c 32 d metaboli s e tabolic pa t e nes), and e enzyme s c ts are pre s s m. Illustra t t hways via 15-LO (lip o s are listed s ented wit h t ed here ar e COX (pro s o xins). Eic o in italics. T h a grey ba c e arachido n s taglandins o sanoid he glutathi o c kground. n ic and o ne

PAGE 33

Figure 1 -2. Diagra m arachid o enzyme s gray bo x black bo x action o f then utili z cycloox y prostagl a HETEs, c m of eicos a nic acid p a s (which w e x es with th e x es. AA is l f the phosp h z ed by eith y genases p r a ndins or t h c ysLTs, L T a noid meta b a thway are s e re evaluat e e products p l iberated fr o h olipase A 2 er the cycl o r oduce PG H h romboxan e T A4, LTB4, 33 b olism. Th e s hown in b o e d in this s t p roduced fr o m the ph o 2 enzymes o oxygenas e H 2 which i s e A2; the li p and lipoxin e enzyme f a o ld with th e t udy by rea om these r e o spholipid m (both cyto s e or lipoxy g s converte d p oxygenas e s. a milies wit h e correspo n l-time PC R e actions s h m embrane t s olic and s e g enase en z d by specifi c e s produc e h in the n ding speci f R ) in the sh a h own in the t hrough th e e cretory). A z ymes. The c synthase s e HPETEs, f ic a ded e A A is s to

PAGE 34

34 Figure 1 -3. Phylog e e netic tree of group I V V phospholi pase famil y y members

PAGE 35

35 Figure 1-4. A mino a Beneath score at a cid seque the seque n each amin o nce align m n ces for thi s o acid resi d m ent of gro u s family of d ue. u p IV phos p phospholi p p holipase f a p ases is a c a mily mem b onsensus b ers.

PAGE 36

CHAPTER 2 METHODS Mouse model of Allergic Asthma All animal experiments were done in acco rdance with the IACUC at the University of Florida. Mouse sensitiz ation and challenge experiments were carried out as described by Mller et al. [70]. Briefly, C 57BL/6J mice were sensitized to 200 g of Aspergillus fumigatus ( Af ) extract (Greer Laboratories) in phosphate buffered saline (PBS), ovalbumin (OVA), or mo ck sensitized with PBS alone by intraperitoneal injection on days 0 and 14. OVA sensitized mice were then exposed to aerosolized OVA, while all other mice were exposed to aerosolized Af extract for 20 min on days 28, 29 and 30. Lungs were subsequently harvested on day 32 and used for RNA isolation. RNA Isolation and Purification RNA used for northern analyses and animal st udies was isolated from cells or lungs as described by the Chomczynski and Sa cchi with modifications [71]. For lung tissue, the lungs were flash frozen in liquid nitrogen followed by pulverization in a liquid nitrogen cooled mortar and pestle prior to lysis. For cultured cells, the media was aspirated and the dishes were washed once with phosphate-buffered saline (PBS). All samples were subsequently lysed in 500 L of guanidinium thiocyonate (GTC) denaturing solution consisting of 4 M GTC, 25 mM sodium citrate at pH 7.0, 0.5% sarcosyl and 0.1 M -mercaptoethanol. After vortexing brie fly to help lyse the cells, 50 L of 2 M sodium acetate at pH 4.0, and 500 L of water-saturat ed phenol was added. The solution was then vortexed and incubat ed at room temperat ure for 5 min. 110 L of a 49:1 chloroform:isoamyl alcohol mixture was added to the lysate, vortexed vigorously and centrifuged at 12,000 g at room temper ature for 20 min. The aqueous phase was 36

PAGE 37

then transferred to a clean tube, an equal amount of isopropanol was added, and this solution was incubated at -20 C for 30 min. The RNA was then pelleted by centrifugation at 12,000 g at 4 C for 15 min, the supernat ant was decanted, and the remaining pellet was resuspended in 75 L of diethyl pyrocarbonate (DEPC)-treated water. Following resuspension of the pellet for 10 min at 50 C, 25 L of 8 M LiCl was added and incubated at -20 C for 30 min. The RNA was again pelleted by centrifugation at 12,000 g at 4 C for 20 min and the super natant was decanted. The remaining pellet was rinsed with 100 L of 70% ethanol followed by the addition of 200 L of 70% ethanol prior to c entrifugation at 12,000 g at 4 C for 10 min. The ethanol was then decanted and the remaining pellet comple tely dried for 1 min under vacuum. The purified RNA pellet was finally resuspended by addition of 100 L of DEPC-treated water and incubated at 50 C for 5 min. RNA concentrations were determined in a spectrophotometer by absorbance at 260 nm. Total RNA from cell culture studies used for real-time RT-PCR analysis was purified with an RNeasy Mini Kit from Qi agen as per manufacturers instructions. Additionally, this RNA was treated with RNase-f ree DNase (Qiagen) to insure that there was neither genomic nor plasmid contamination. RNA concentrations were determined in a spectrophotometer by absorbance at 260 nm. Northern Blot Analysis 10-20 g of total RNA was lyophilized, resuspended in 30 L loading buffer (500 L deinozided formamide, 302 L H2O, 175 L formaldehyde, 2 L sodium acetate, 1 L EDTA), fractionated on a 1% agarose, 6% formaldehyde gel, electrotransferred to a Zetabind membrane (Bio-Rad) and UV crosslinked. Membranes were then incubated 37

PAGE 38

for 1 h in a prehybridization buffer consisti ng of 0.45 M sodium pho sphate, 6% sodium dodecyl sulfate (SDS), 1 mM EDTA, and 1% bovine serum albumin (BSA) [72]. The membranes were then incubated overnight at 60C in the same hybridization buffer with a 32P-radiolabeled gene specific probe for cPLA2 or L7a, generated by random primer extension. The membrane was then was hed three times for 5 min each at 65 C in a high stringency buffer composed of 0.04 M sodium phosphate, 2 mM EDTA and 1% SDS, placed in a cassette with autoradiograp hic film and the film was subsequently developed and used for densitometry. Dens itometry was performed using ImageJ software imaging software, distributed by the NIH. Real-Time Reverse-Transcription PCR One g of total RNA was used to synthes ize first strand cDNA by reverse transcriptase PCR using the Superscript First-Strand Synthesis System for RT-PCR from Invitrogen and the final product was diluted to 100 L. Two L of the newly synthesized cDNA were added to the following in duplicate in a 96-well tray: 1.5 L of 5 mM stocks of each forward and revers e gene specific primers, 12.5 L of SYBR Green master mix (Invitrogen), and 7.5 L water for a total volume of 25 L. Primers for cyclophilin A were used as a loading cont rol and the subsequent real-time PCR was carried out in an ABI Prism 7000 Sequence Dete ction System. Crossing threshold (CT) values were defined as the cycle number at which amplification crossed a designated threshold level within the exponential amplification range of the samples. Normalized CT values ( CT) were obtained by subtracting cyclophi lin A CT values from CT values of the indicated genes. CT values were obtained by subtracting the CT value of the 38

PAGE 39

control sample from the CT value of the target sample for the indicated experiment. Finally, fold induction values were defined as 2CT as per the CT method [73]. Cell Culture EoL-1 (a human eosinophilic leukemia ce ll line [74]) and THP-1 cells (a human monocytic cell line [75]), were maintained in RPMI-1640 medium supplemented with 25 mM NaHCO3, 4 mM glutamine, antibiotic/antimycotic (ABAM) and 10% FBS at 37 C with 5% CO2. A549 (a human epithelial-like lung adenocarcinoma cell line), HFL-1 (a human fetal lung fibroblast cell line [76]), as well as S9 cells (a human cystic fibrosis transmembrane conductance regulator (CFTR)-corre cted cell line [77]) were maintained in Hams F12K medium with the same supplements. S9 cells are derived from IB3.1 cells [78], but they express a functional CFTR which was inserted by adeno-associated viral transduction. IB3.1 cells are a bronchoepi thelial cell line derived from a cystic fibrosis patient containing both a 508 deletion, resulting in a misfolded CFTR protein, and a W1282X mutation, resulting in a pr emature stop codon; these cells were immortalized with SV40 T-antigen. HEK293 (a human embryonic kidney cell line) and HEK293 cells stably expressing Toll-like re ceptor 9 (HEK-TLR9, a kind gift from Dr. Golenbock, University of Massachusetts) we re grown similarly in Eagles Minimum Essential Medium (MEM) while J774A.1 cells (a mouse monocytic cell line [79]) were grown in Dulbecco's Modified Eagle's M edium. The cells were grown to ~50% confluency in 10 cm dishes and treated with the indicated compounds. After 12 h of treatment (unless otherwise indicated) cells were collected and gene or protein expression was determined by real-time RT-P CR, northern or imm unoblot analyses. Treatment concentrations, unless other wise specified, were as follows: Af 100 g/mL; 39

PAGE 40

LPS, 0.5 g/mL; IFN 5 ng/mL; TNF, 10 ng/mL; IL-1 2 ng/mL; IL-2, 5 ng/mL; IL-3, 5 ng/mL; IL-4, 20 ng/mL; IL-6 10 ng/mL; IL -10, 20 ng/mL; or IL-13, 20 ng/mL. Cloning the cPLA2 Promoter and Human Growth Hormone (hGH) Reporter Constructs for Promoter Deletion Analysis A promoterless human growth hormone repor ter vector, pGH, was utilized for the analysis of promoter fragment s. This vector contains the five-exon genomic sequence for human growth hormone (hGH) immediately downstream of a multicloning site with no upstream regulatory sequences [80]. To obtain the cPLA2 promoter fragments to be cloned into pGH, primers which include Hind III restriction sites were made in the forward direction to position -3776, -1177 and in the reverse direction beginning at +174 relative to the cPLA2 transcription initiation site at +1 as listed in Table 2-5. These primers were used to clone the 3.9 kb and 1.3 kb promoters from a BAC clone containing the cPLA2 gene. Once the 3.9 kb and 1.3 kb promoters were obtained by PCR and verified by gel electrophoresis, they were gel purified and cloned into TOPOXL using the TOPO cloning kit. From this point, they were cut and isolated from the TOPO-XL vector using the flanking HindIII re striction enzyme sites and ligated into the HindIII site of pGH lying immediately upstream of the hGH s equence. Subsequent promoter fragments were amplif ied from the 1.3 kb pGH c onstruct using the appropriate 5 primers for promoter fragments 490 and 288 and the 3 primers within the pGH backbone immediately after the previously inse rted fragment with prim ers listed in Table 2-5. Each of these were similarly cloned into TOPO-XL before being cleaved by HindIII and cloned into the HindIII site of pGH. The 762 bp promoter was obtained by a restriction digest of the 1.3 kb promoter in pGH at uni que KpnI sites at -588 bp and immediately upstream of the 5 HindIII cloning site. The -114/-1 fragment was generated 40

PAGE 41

by quick-change mutagenesis of the -114/+174 construct to remove the sequence of DNA from +1 to +174 with the primer set in Table 2-6 labeled as hGH Reporter Constructs for Si te-Directed Deletion Analysis These constructs were all made by QuikChange site-directed mutagenesis (Agilent, formerly Strat agene) of the -114/-1 cPLA2 promoter construct in pGH and verified by sequencing. The primers used are listed in Table 2-6. Forward and Reverse primers were made to be complimentary to each other and to remove the following elements at sequences illustrated in Figure 4-12: CRE (del I), NF-B (del II), or E-Box (del III). Transient Transfection of Promoter Constructs Cells were grown to ~50% confluency on 60 mm dishes prior to transfection with the specified plasmid. Reporter plasmids were transfected using the FuGENE 6 transfection reagent (Roche). For promoter delet ion studies, 2 g of the empty vector was used or an equimolar amount of a plasmid containing one of the cPLA2 promoter constructs. Six L of FuGENE 6 was used with the empty vector and this amount was adjusted for each plasmid to maintain the recommended ratio of g of plasmid to L of FuGENE at 1:3. Initially, an amount of medium lacking any supplements was added to each tube necessary to obtain a final volume of 288 L. Next, the appropr iate amount of FuGENE 6 was carefully added and the mixture left to stand. After 5 min, the DNA was added and gently mixed. Following a 15 min incubation, this mixture was added to 3.5 mL of medium on a 60 mm dish of cells to be transfected. After leaving the transfection mixture on the cells for three hours, the cells were rinsed with PBS and fresh media was added. The following day, each plate of cells was split 1:2 and left to grow overnight. After an additional day, cells were treated with TNFfor the designated amounts of 41

PAGE 42

time and total RNA was collected for s ubsequent northern or real-time RT-PCR analysis. Immunoblot Analysis Cells were incubated in media with or without TNFfor the specified amounts of time, washed twice with ice cold PBS and ly sed with a 50 L of a buffer containing a proteinase inhibitor mini-tablet (Roche), 500 L of 1 M Tris at pH 7.5, 200 L of 5 M NaCl, 100 L of 0.5 M EDTA at pH 8 and 100 L of Triton X-100 with H2O to a final volume of 10 mL. Protein concentrations we re then determined with a bicinchoninic acid (BCA) assay [81]. 20-50 g of total cellular protein were separated on a 10% SDS/polyacrylamide gel and transferred to a Hybond ECL nitrocellulose membrane (GE Healthcare). The membrane was then blocked for 1 hour with 7.5% Carnation instant non-fat dry milk powder dissolved in Tris-Buffered Saline Tween-20 (TBST) at room temperature. The membrane was t hen incubated overnight with rabbit anti-cPLA2 polyclonal antibody (a kind gift from Dr. Christ ina Leslie, University of Colorado [47]), diluted 1:1,000 in 7.5% bovine serum albumin (BSA) in TBST, washed three times with TBST, incubated with a goat anti-rabbit horser adish peroxidase conjugated antibody diluted 1:10,000 in 7.5% non-fat/TBST for 1 h, washed again three times, subjected to enzymatic chemiluminescence (ECL, GE Healthcare) and used to expose autoradiographic film. Chromatin Immunopreciptiation Analysis Cells used for ChIP were grown in two 150 mm dishes for each condition. Following TNFtreatment, formaldehyde was added at a final concentration of 1% to crosslink the DNA and proteins and the plates were shaken at room temperature for 10 min. 0.125 M of glycine was added to stop the crosslinking and the plates were shaken 42

PAGE 43

for an additional 5 min. The cells were t hen scraped into 50 mL tubes and either flash frozen in liquid nitrogen for overnight stor age or immediately centrifuged at 3000 rpm for 10 minutes before removing the medium and rinsing twice with PBS. The remaining pellet was resuspended in 1 mL of nucle i swelling buffer (5 mM PIPES, 85 mM KCl, 0.5% NP-40) and transferred to a 1.5 mL tube. The tubes were then centrifuged at 5000 rpm for 5 min at 4 C and the pellet was re suspended in 1 mL of SDS lysis buffer (1% SDS, 10 mM EDTA pH 8.0, 50 mM Tris-HCl pH 8.0). This solution was transferred to 4 mL conical tubes and incubated on ice. The ch illed tubes were sonicated in ice five times each for 25 s with two min rests in betw een. The samples were then transferred to 1.5 mL tubes and centrifuged at 13000 rpm for 10 min and then transferred to 15 mL tubes. 100 L of this solution was reverse crosslinked by addition of 4 L of 5 mM NaCl and incubated at 65 C for 2 hours prior to a phenol/chloroform extraction and analysis on a 1.6% agarose gel to verify that the samples were soni cated to an average of 500 bp. The remaining sample was diluted to 5 mL in ChIP dilution buffer (0.01% SDS, 1.1 % Triton X-100, 1.2 mM EDTA, 20 mM Tris-HCl pH 8.0), 50 L of protein A-Sepharose beads were added for each mL of ChIP dilution buffer and the solution was precleared by rotating at 4 C for 2 h. This solu tion was then centrifuged at 1000 rpm for 10 min and 1 mL of the supernatant was aliq uoted into 1.5 mL tubes for each immunoprecipitation to be performed. 2 mg/mL of antibody to the indicated protein was added to the lysates and incubated overnight at 4 C. Antibodies to the following human proteins were purchased from Santa Cruz with the organism of origin listed for each: rabbit c-Jun (sc-1694), rabbit ATF-2 (sc187), rabbit p65 (sc372), mouse p50 (sc8414), rabbit RNA Polymerase II (sc-899), rabbit USF1 (sc-229), rabbit USF2 (sc-862), 43

PAGE 44

mouse IgG (sc-2025), r abbit IgG (sc-2027). 60 L of protein A-sepharose beads, blocked in bovine serum albumin (BSA) the night before, were added to the lysate using a wide-boar pipette tip and rotated at 4 C for 2 h. The beads were pelleted by centrifugation at 1000 rpm for 2 min and su pernatants other than the no-antibody control were discarded. The no-antibody control supernatant was kept as input. The beads were then washed with 1 mL of a low sa lt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, 150 mM NaCl) follow ed by a high salt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA 20 mM Tris-HCl, 500 mM NaCl) and rotated at 4 C for 5 min. The beads were subsequently washed with a LiCl wash (250 mM LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl), spun at 1000 rpm for 1 min and rinsed twice with Tris-EDTA. The protein-DNA complexes were obtained by eluting with 275 L ChIP elution buffer (0.1% SDS, 0.1 M NaHCO3), vortexing, shaking at 37C for 15 min, centrifugation at 1000 rpm for 1 min and collection of the supernatant. At this point, 20 L of 5 M NaCl was added to each tube, including the 500 L of input taken as supernatant at an earlier step, and reverse cr osslinked at 65 C for 5 h. The samples were then treated with proteinase K (Qiagen) by addition of 10 L 0.5 M EDTA, 20 L 1 M Tris-HCl and 1 L of 20 mg/mL proteinase K to each tube and incubated at 4 C for 1 h. Finally, using a Qiaprep Spin Miniprep Ki t (Qiagen), samples were diluted with 2 mL buffer PB, put through a column, washed with buffer PE and eluted in 100 L TrisEDTA. For the input sample, only 100 L of the sample was used as opposed to the 500 L of each of the others. T he purified DNA was subjected to real-time PCR using primers specific to the enhancer/promoter of an intergenic region located 5 of the cPLA2 gene with primers spec ified in Table 2-4. 44

PAGE 45

Overexpression of Transcription Factors Transient transfection was performed simila rly as above with modifications. 0.25 g of each indicated transcription factor ex pression plasmid and 0. 1 g of the -114/-1 promoter/reporter construct were added to pc DNA-3.1 for a total amount of 2 g of plasmid for each transfection. Overexpression of transcription factor proteins or their respective dominant negative forms was performed using a mammalian expression plasmid (pcDNA3.1) containing the coding r egion for the following transcription factors or their respective dominant negativ e forms: c-Jun or Tam67 [82], p65 or TA, ATF-2 (kind gift from Dt. Alt Zantema, Leiden University Medical Center Netherlands [83]) or A-ATF2 (kind gift from Dr. Charles Vinson, NI H [84]), or USF1 (kind gift from Dr. Jrg Bungert, University of Florida [85]) or A-USF (Dr. Vinson [ 86]). After the cells were rinsed and supplied with fresh medium, they were allowed to grow for 48 h prior to harvesting of total RNA for subsequent analyse s. Overexpression of each transcription factor was also verified by immunoblot analysis. Interferon Stimulating DNA Oligodeoxynucleotides (ODNs) were synthesized based on the human TLR9specific ODN, termed O DN-2006, with the sequence 5TCGTCGTTTTGTCGTTTTGTCGTT-3. This sequence constructed with normal deoxyribonucleotides joined with a norma l phosphodiester backbone is designated PO2006. When synthesized with a phosphorot hioated backbone, this sequence was designated as PS-2006. When the CG dinucleoti des in this sequence were replaced by GC dinucleotides, the result ing oligonucleotides were des ignated as PO-GC or PS-GC. The indicated ODNs were added to the cells at 10 ng/mL and RNA was collected after 48 h of treatment. 45

PAGE 46

Statistical Analyses All graphs are plotted as the mean of the indicated number of experiments with error bars representing +/SEM A is used to denote p .05 as determined by a Students t-test. For TNFtreated samples, a one-tailed t-test was used to determine induction, while a two-tailed t-test was used in all other cases. A paired t-test was used for experiments in which samples were paired, such as with batch transfections and time-courses, while unequal variance was assumed for all other analyses. 46

PAGE 47

Table 2-1. List of mouse primers for cyt okines, chemokines, growth factors and cyclophilin. Gene Sequence IL-4 GCG ACA AAA ATC ACT TGA GAG AG GCA CCT TGG AAG CCC TAC AG IL-13 TTG CTT GCC TTG GTG GTC TC CCT CTG GGT CCT GTA GAT GGC IL-1 GCC TGT GTT TTC CTC CTT GC CAG TGC GGG CTA TGA CCA A IL-2 CAC CCT TGC TAA TCA CTC CTC A CTG CTG TGC TTC CGC TGT AG IL-3 TCC TGA TGC TCT TCC ACC TG CCA CTT CTC CTT GGC TTT CC IL-6 TGG GAC TGA TGC TGG TGA CA TCA TTT CCA CGA TTT CCC AGA G IL-10 CCA GTA CAG CCG GGA AGA CA TTT CTG GGC CAT GCT TCT CT EOTAXIN GCT CAC GGT CAC TTC CTT CAC GTG CTT TGT GGC ATC CTG G KC GCA CCC AAA CCG AAG TCA TAG CAG ACA GGT GCC ATC AGA GC GM-CSF CAA GTT ACC ACC TAT GCG GAT TT CAT TAC GCA GGC ACA AAA GC TGFAGA CAG CAA AGA TAA CAA ACT CCA C GCC GCA CAC AGC AGT TCT T Cyclophillin A GCG GCA GGT CCA TCT ACG GCC ATC CAG CCA TTC AGT CT All sequences are listed in the 5-> 3 direction for ea ch primer with the forward strand primer listed first followed by the reverse strand primer. 47

PAGE 48

Table 2-2. List of mouse primers fo r cyclooxygenase and lipoxygenase pathways. Gene Sequence COX-1 GCT CAC AGG AGA GAA GGA GAT G GGA GCC CCC ATC TCT ATC ATA C COX-2 GGC TTC GGG AGC ACA ACA CAA TGC GGT TCT GAT ACT GGA mPGES-1 TTA GAG GT G GGC AGG TCA GAG CCA CTC GGG CTA AGT GAG AC TXAS AAG AGG AAG TAT CCC CAG AAC C TGT CCA GAT ACG GCA GAC CTT L-PGDS GTC AGT CAG AGG GCT GGT CAC GGA CTC TTA TCC TTC TCC TCA CG PGIS TTC CAT CCC TAT GCC ATC TTC TGA GCA GGG CGT GTA GGA 3-LO CGG TTC CCA GAG TTG TCA TCC AAG CCC GCC AAG AAT GTT ATC 5-LO TGT TCC CAT TGC CAT CCA G CAC CTC AGA CAC CAG ATG CG FLAP ATC AAG AGG CTG TGG GCA AC TAG ACC CGC TCA AAG GCA AG Platelet 12(S)-LO TGA CG A TGG AGA CCG TGA TG GCT TTG GTC CTT GGG TCT GA 12(R)-LO GCA CTT TGG TCC TGA TGG C CCT CGT GGC TGT AGA ACT CC Epidermal 12(S)-LO CCT TTT TCC CCT GCT ACA GTT G CCC CAC CGA TAC ACA TTC CT 12/15-LO AAA GGC ACT CTG TTT GAA GCG CAC CAA GTG TCC CCT CAG AAG 8-LO CCT GCC CAG CGA TGA CAC CCG AAT GTG AGG AAT CAA TAG C All sequences are listed in the 5-> 3 direction for ea ch primer with the forward strand primer listed first followed by the reverse strand primer. 48

PAGE 49

Table 2-3. List of mouse primers for phospholipase A2s. Gene Sequence PLA2G2C CCA ACC CAT CTT GAA TGC CTA CC GGA GTT TGT CCC TGC CAC A PLA2G2D AAC CTG AAC AAG ATG GTC ACA CAC GGT GGG CAT AGC AAC AAT CAT PLA2G2E CAG TGG AC G AGA CGG ATT GG CAG GTT GTG GCG AAA GCA G PLA2G5 CTA CTG CCT GCC GAG AAA CC ACA CAT CAG GAA TAC AGC AGA GG PLA2G10 GAA ATA CCT CTT CTT CCC CTC C CAG GTG GCT TTA GCA CTT GG PLA2G13 GGT GCC TCC ACT CAA TCT GC GCT GCC CGC TGA CTG TTC PLA2G4A CAG CCA CAA CCC TCT CTT ACT TC CGG CAT TGA CCT TTT CCT TC PLA2G4B GCA CAA GGA CCA CTA TGA GAA TC ACC ACC CTA AAA GTG CCC TC PLA2G4C CAC AAA CGC AGT CCC AAG G AGA CCC CTG CGA GGT ATG TG All sequences are listed in the 5-> 3 direction for ea ch primer with the forward strand primer listed first followed by the reverse strand primer. Table 2-4. List of human pr imers for real-time PCR. Gene Sequence Cyclophilin A CAT CC T AAA GCA TAC GGG TCC GCT GGT CTT GCC ATT CCT G PLA2G4C hnRNA TAC CCT TCT TCT TGT TCC CAC C ATC CAG AGA CCC CTG CGA G PLA2G4C CAC CTG GCT GAC TGA GAT GCT CGC AAA TGC CTG TTT TCT TC hGH GAA CCC CCA GAC CTC CCT CAT CTT CCA GCC TCC CCA T ChIP enhancer CTG GTC TCG GGT GCC TAA TG TCT GTG GTC CTC CTG CTT TCC ChIP 3'UTR TTG ACA CCA CCA TAA CTT CAC ACC TGG AGG ATT AGA GCA GAC GGC All sequences are listed in the 5-> 3 direction for ea ch primer with the forward strand primer listed first followed by the reverse strand primer. 49

PAGE 50

Table 2-5. List of primers used for prom oter deletion analysi s of the human cPLA2 enhancer/promoter. Construct Sequence 3.9 aag ctt TGG CTT CTT CCT CCG TCC aag ctt GCA GGA GGA CCA CAG AAG C 1.3 aag ctt TGG TGA TAC TCC TGC CTT GG aag ctt GCA GGA GGA CCA CAG AAG C 490 aag ctt ATC CGC CTG CCT CAG CCT CC aag ctt GGA AAG CAG GAG GAC CAC AG 288 aag ctt TGA ATA CTG GTC TCG GGT GCC TAA TG aag ctt GGA AAG CAG GAG GAC CAC AGA AGC Letters in lower-case denote HindIII restriction sites. All sequ ences are listed in the 5-> 3 direction for each primer with the forward strand primer lis ted first followed by the reverse strand primer. Table 2-6. List of primers used fo r quick-change mutagenesis of the human cPLA2 enhancer/promoter. Construct Sequence 114 TAGCTCCGGGTGAGCTCT GG/AAGCTTGGGCTGCAGGTCGA TCGACCTGCAGCCCAAGCTT/ CCAGAGCTCACCCGGAGCTA del I TGCCTAATGACAGAA/TAAGGAAGCCTGGAA TTCCAGGCTTCCTTA/ TTCTGTCATTAGGCA del II TCACTAAGGAAGCCT/AGCCCTCCACGTGAT ATCACGTGGAGGGCT/ AGGCTTCCTTAGTGA del III AAAGTCCCAGCCCT C/ATCCCACGGATGAAA TTTCATCCGTGGGAT/GAGGGCTGGGACTTT The region that was removed by quick-change mutagene sis has been replaced with / in each of these primer sequences. All sequences are listed in the 5-> 3 direction for each primer with the forward strand primer listed first followed by the reverse strand primer. 50

PAGE 51

CHAPTER 3 MOUSE MODEL OF ALLERGIC ASTHMA Introduction Allergic Asthma Asthma is a disease of chronic lung inflammation that affects roughly 5% of the worlds population. Asthma can be divided in to several groups including, but not limited to, allergen induced (extrinsic), exerci se induced and occupational asthma [87]. Regardless of the type of asthma, an atta ck is characterized by airway hyperresponsiveness, bronchoconstriction and diffi culty breathing. More specifically, proinflammatory cytokines are released in response to allergen or stress which cause inflammation of the bronchi and restricted ai rflow. This disease has predominantly been associated with a strong Th2 re sponse involving cytokines such as interleukins 4 and 13 (IL-4 and IL-13). However, more recent studies have also associated chronic asthma with a Th1 response via tumor necrosis factor-alpha (TNF) release [88, 89]. This has been specifically linked to TNFrelease from alveolar macrophages as a result of allergen exposure as well as induced releas e in mast cells of the asthmatic lung [90]. Asthma sufferers also exhibit an upr egulation of cyclooxygenase-2 (COX-2) and downstream production of prostaglandin E2 (PGE2) [11, 91]. The upregulation of prostaglandins is predomi nantly associated with the early phase of asthma, whereas increased production of lipoxins corresponds with a decrease of prostaglandins and resolution of inflammation [18, 92, 93]. Characteristics of an allergic response One of the primary risk fact ors for asthma is exposure to allergens that can trigger an allergic asthmatic response. In this contex t, the allergic response is characterized by 51

PAGE 52

elevated serum IgE and an increase in eosinophi ls both circulating and in the lung [94, 95]. Initially, an allergen comes into cont act with antigen presenting cells. The antigen presenting cells stimulat e T cells, which in turn activate B cells to produce IgE. Once the IgE attaches to mast cells, they are pr imed for activation upon reexposure to the antigen. Reexposure to the antigen tri ggers an allergic res ponse and subsequent inflammatory cascades are similar regardless of the stimulus, although they may vary in their severity. Cytokine pathways leading to the production of lipid mediators Cytokine effects range from proliferat ion or death at the cellular level to inflammation and fever on the organismal scale. Cytokines are categorized based on their role in the cell-mediated Th1 response versus the humoral Th2 response [96, 97]. Th1 cytokines include the tumor necrosis factors (TNFs), interferons (IFNs) and interleukin-2 (IL-2) and this is the primary response pathway for viruses, intracellular pathogens and cancer, while Th2 cytokines include IL-4, IL-10 and IL-13 and act in response to extracellular bacteria, parasites or other toxins [98]. The Th1 and Th2 pathways are not distinct from each other and, in fact, modulate each other in order to maintain a balance between them [99]. An imbalance between these two pathways in either direction can be harmful. A prol onged Th1 response and exposure to Th1 cytokines leads to tissue damage whereas t he Th2 response is implicated in increased IgE and allergic reactions such as asthma [100, 101]. Inflammation The initial physiological response to infect ion or tissue injury is inflammation. A defining event in this respons e is the liberation of eicosanoids, the bioactive lipid metabolites of arachidonic acid (AA). T he eicosanoids play a pivotal role in 52

PAGE 53

inflammation, ultimately mediating vasodilation vascular permeability, bronchoconstriction, chemotax is, and the transcription of pro-inflammatory enzymes as well as being involved in cancer [21-23, 102, 103]. This extensive family of fatty acids includes the prostaglandins (PGs), prostacyclin, thromboxanes, leukotrienes (LTs), hydroperoxyeicosatetranoic acids (HPETEs), hydroxyeicosatetraenoic acids (HETEs), lipoxins, resolvins and protectins [102, 103]. The hydrolysis of membrane phos pholipids by the phospholipase A2 (PLA2) family of enzymes yields both lysophospholipids and AA which in turn produce platelet activating factor (PAF) and the eicosanoids respectively [35, 104]. AA is further metabolized into various bioactive lipids by specific downstream enzymes. In addition to their roles as inflammatory mediators, the eicosanoids arbitrate many general cellular processes, such as cell differentiation [104], apoptosis [105, 106], lipid membrane integrity [107] and vascular homeostasis [108]. T herefore, their import ant role in general cellular processes and, in particular, in the inflammatory process underscores the relevance of this pathway and importance of these metabolites in driving the inflammatory and immune responses. Airway inflammation is an important underlying factor in the pathogenesis of allergic bronchopulmonary aspergillosis (ABPA) [109-111] and asthma [112, 113]. These pathophysiological events are also c haracterized by the elevated production of eicosanoids, with the LTs and prostanoids regulating many aspects of airway inflammation and reactivity [114]. Recently studies have focused not only on the release of histamine and acet ylcholine, but also the impact of AA metabolites on the inflammatory cascade that predominates in asthmatic airways. Prostaglandins normally 53

PAGE 54

maintain a balance in airway responsiveness; both PGD2 and thromboxane A2 are bronchoconstrictors, while PGE2 and prostacyclin serve in bronchoprotection. On the other hand, the action of LTs appears to be principally pro-inflammatory, with LTB4 possessing potent chemoattractive activity fo r neutrophils and eosinophils in the airways [115]. Furthermore, the cysteiny l leukotrienes (cysLTs), LTC4, LTD4 and LTE4, elicit bronchoconstriction and increased endothelial membrane permeability leading to airway edema and enhanced mucosal secretion, which are also physiological hallmarks of asthma [116]. As a consequence, pharmacol ogic agents potentially important for the management of inflammatory diseases have been designed to target the eicosanoidmediated elements of the inflammatory ca scade; these include cysLT antagonists, zafirlukast, montelukast/Singul air and pranlukast, as well as the 5-lipoxygenase (5-LO) inhibitor, zileuton/Zyflof [19, 20]. However, even with their widespread use as a treatment regimen in the different forms of asthma, the effectiveness of anti-LT pharmaceuticals in the treat ment and management of asthma remains controversial [117]. Therefore, we hypothesized that a more detailed evaluat ion of expression levels for the eicosanoid pathway enzymes in an animal model that involves both cell mediated (Th1) and humoral immunity (Th2) w ould be valuable in predicting other points in eicosanoid metabolism relevant to inflammation. In collaboration with the laboratory of Dr. Terrence Flo tte, a model of allergic asth ma was recently developed that employs crude Aspergillus fumigatus (Af ) extract as the sensitizing and challenging agent evaluated in C57BL/6J mice. The Af sensitized mice develop a Th2 mediated allergic inflammatory response, including elev ated levels of the Th2 cytokines IL-4, IL-5 54

PAGE 55

and IL-13, increased total serum IgE, goblet cell hyperplasia and airway eosinophilia [70]. More specifically, an increase in Af specific IgE and IgG are found in the serum of sensitized mice, demonstrating an Af specific immune response [70]. In the present study, the gene expression leve ls of many of the enzymes involved in eicosanoid metabolism are analyzed by real-time RT-PCR after sensitization and challenge to the Af extract in C57BL/6J mice. These data demons trate alterations in gene expression for a unique subset of eicosanoid pathway enzymes which may provide relevant alternative targets in the development of therapeutic regimens fo r allergic asthma and ABPA. Results Cytokine and Chemokine Induction in Mi ce Treated with Ovalbumin (OVA) or Apsergillus fumigatus (Af) Extract Af crude extract was recently evaluated in no rmal C57BL/6J mice as an allergen in an animal model of allergic asthma or ABPA [70]. As a comparison to the more commonly used sensitizing antigen, OVA [118 119], mice were either mock sensitized or sensitized to OVA or Af on days 0 and 14 and then, on days 28-30, airway challenged with the relevant antigen or PBS. Adjuvant was included with the OVA sensitization as an immune stimulant, as compared to Af extract alone, which contains natural immune activating epitopes. Pr evious reports demonstrate that Af sensitized mice develop a Th2 mediated response typical of asthma as indicated by increases in total serum IgE, goblet cell hyperplasia an d airway eosinophilia [70]. Therefore, the gene expression of relevant Th2 cytoki nes was evaluated by comparing OVA and Af sensitized and challenged mice. First the ge ne expression of two Th2 cytokines, IL-4 and IL-13, was determined. Al though a portion of this data was previously reported showing only the response to Af [70], it is repeated here fo r comparison to treatment 55

PAGE 56

with OVA as well. Figure 3-1A demonstrates that the expr ession of IL-4 and IL-13 was significantly more pronounced in the animals treated with Af (IL-4, ~42 fold; IL-13, ~124 fold) than OVA (IL-4, ~5 fold; IL-13, ~25 fold). As the prev ious reports have shown, the Af extract elicits a stronger Th2 response, potentially functioning as a more potent natural stimulus for a model of allergic asthma. The mRNA of several other cytokines (IL-1 IL-2, IL-3, IL-6 and IL-10) (Figure 31B), growth factors (GM-CSF and TGF) and chemokines (eotaxin-1 and KC) (Figure 3-2) thought to be involved in the asthmatic response was also evaluated. The increases in many of these factors had been previously shown to occur following Af treatment [70], but included in Figures 3-1 and 3-2 are the comparisons to treatment with OVA as well as the other factors not previously reported such as IL-3, IL-6, GMCSF and TGF. Increased mRNA levels in IL-4, IL13, IL-6, IL-10, eotaxin-1, KC, GMCSF and TGFwere observed in Af sensitized mice as compared to the mock sensitized (PBS) animals. The mRNA induction in response to Af was significantly higher than in animals exposed to OVA for the IL-6 and eotaxin-1, whereas IL-10, KC, GM-CSF and TGFresponded similarly to both sensitizing agents. Primer sequences for these experiments can be found in Table 2-1. Steady State mRNA Levels of th e Cyclooxygenase Family in Af Treated Mice Having established a physiologically and environmentally relevant allergen, Af changes in eicosanoid gene ex pression in the lungs of C57BL/6J mice with Afinduced asthma were evaluated next. Eicosanoid biosyn thesis following the lib eration of AA from membrane phospholipids bifurcates into two pat hways (Figure 1-2). As illustrated, the left branch involves the metabolism of AA by cyclooxygenases (COXs) and specific 56

PAGE 57

downstream synthases into prostaglandi ns, prostacyclin and thromboxane A2. The relative expression levels of COX-1 and CO X-2, microsomal pros taglandin E synthase (mPGES-1), thromboxane A2 synthase (TXAS), lipocalin-type prostaglandin D synthase (L-PGDS) and prostaglandin I2 synthase (P GIS) involved in the metabolism of their respective prostanoids were analyzed (Figur e 3-3 with primers in Table 2-2). Although there were specific upward trends observed for mPGES-1 as well as a downward trend for L-PGDS, none of these data reach statistica l significance. These results imply that although there may be a significant increas e in AA levels potentially derived from cPLA2 in response to Af sensitization/challenge, the flux of this metabolite is not likely to follow down the cyclooxygenase branch. Steady State mRNA Levels of the Lipoxygenase Family in Af Treated Mice The alternate fate of AA is peroxidati on by the lipoxygenase (LO) family of enzymes leading to the production of HPETEs, which naturally breakdown to HETEs. The specific HPETEs produced depend on the LOs present in t he cell at the time of AA release. 5-LO requires the cofactor 5-LO ac tivating protein (FLAP), which is believed to aid in the delivery of AA to 5-LO [120]. T he 5-LO metabolite, 5-HPETE, can be further metabolized to the potent inflammatory lipid mediators called leukotrienes (LTs), LTB4 and the cysLTs (LTC4, LTD4) [114, 121]. The LTs have ph ysiological roles in innate immune responses in the lung an d in the pathology of inflammatory diseases, such as asthma, allergic rhinitis and atherosclerosis [114, 121]. To this end, several anti-LT drugs have been developed that target either 5-LO/FLAP or the cysLTs including zileuton or montelukast, zafirlukast and pranl ukast, respectively [20]. Therefore, the intuitive hypothesis would be that 5-LO or FLAP might show altered gene expression in 57

PAGE 58

our model of allergen sensitiz ation and challenge. However, as Figure 3-4A illustrates, the gene expression levels for 3-LO, 5-LO a nd FLAP are not elevated in these animals. Other members of the LO family were also evaluat ed and are listed with gene names with common names in parentheses [122, 123]: Alox12 (platele t 12(S)-LO) [124], Alox12e (epidermal 12(S)-LO) [125], Alox12b (12(R)-LO) [ 126], Alox15 (12/15-LO) with a human ortholog of ALOX15 ( 15-LO-1) [127], and Alox8 (8-LO) with a human ortholog of ALOX15B (15-LO-2) [128] (F igure 3-4B with primers in Table 2-2). Uniquely in mice, the epidermal-derived 12(S)-LO (e-12(S)-LO) is functionally expressed [125] while the only homologous human ortholog exists as an expressed pseudogene designated ALOX12P2 [129]. 12(S)-LO was induced 20 fold in the Af challenged mice (Figure 3-4B with primers listed in Table 22). There was also a signific ant increase (31 fold) in the expression of 12/15-LO as a result of Af sensitization/challenge and a 5 fold induction of 8-LO. Immunohistochemistry fo r 12/15-LO demonstrated that alveolar macrophages in mice stain positively for this enzyme wit h an increase in stai ning following antigen challenge (data not shown). This increase in staining of 12/15-LO in alveolar macrophages may be due, in part, to increas ed mRNA levels, as has been previously reported in mouse alveolar macrophages and human lung epithel ial cells in response to IL-4 [130]. Steady State mRNA Levels of Phospholipase A2s Secretory phospholipase A2s (groups II, V, X, and XIII) The aforementioned lipid metabolites and the PLA2 family of enzymes which are responsible for the initial rel ease of the primary metabolite, arachidonic acid (AA), all have important roles in inflammation and lung disease. Metabolica lly upstream of the previously measured enzymes lie the phospholipases (PLA2s). The PLA2 family is 58

PAGE 59

composed of several groups of secretory PLA2s and two groups of cytosolic PLA2s, calcium-dependent group IV (cPLA2s) and calcium-independent group VI (iPLA2s). Figure 1-2 illustrates the eicosanoid pathway with the relevant PLA2s as well as the remaining downstream enzymes whose gene expression levels were previously evaluated. The secretory PLA2s (sPLA2s) are low-molecular-weight enzymes that require Ca2+ and have been shown to have roles in inflammation, host defense and atherosclerosis [131]. The gene expression le vels evaluated by real-time RT-PCR for the sPLA2s are illustrated in Figure 3-5. Only sPLA2-IIE and sPLA2-V levels were increased in the Af sensitized and challenged animals (Figure 3-5 with primers listed in Table 2-3). In contrast, Af resulted in a ~45% reduction in the basal expression of sPLA2-XIII. The alteration of expression for these sPLA2s may be of significant importance to future studies of Af as a complicating factor in ABPA [109-111] and asthma [112, 113]. Cytosolic phospholipase A2s (group IV) We next evaluated the expression leve ls of three members of the cPLA2 family, cPLA2 cPLA2 and cPLA2 (Figure 3-6). We hypothesiz ed that an increase in the expression of cPLA2 would coincide with the developm ent of allergic asthma. This hypothesis was based on data from Uozumi et al. [132], which showed cPLA2 -/mice sensitized and challenged wit h OVA had a significant reduction of anaphylactic responses and bronchial reactivity to met hacholine. Furthermore, the transcriptional activation of cPLA2 mRNA expression has also been shown to be increased in response to other pro-inflammatory stimuli [ 133]. Interestingly, the expression of neither cPLA2 nor cPLA2 increased; however, the relative expression of cPLA2 did increase 59

PAGE 60

significantly in Af sensitized and challenged mice and th is result lead to the further studies of this gene (Figure 3-6 with primer s listed in Table 23) as described in subsequent chapters. Discussion Eicosanoids constitute a diverse family of physiologically active fatty acids that play important roles in regulating airway inflammation and reactivity and are linked to the pathophysiology of asthma [114, 134]. T he two major subsets of these bioactive lipids are the cyclooxygenase met abolites or prostanoids [134] including prostaglandins (PGs) and thromboxane A2 (TXA2), and the 5-LO-derived LTs [114], including LTB4 and cysLTs. Both sets of these AA metabolites have been implicated in the inflammatory cascade that occurs in allergic responses and the asthmatic airways, representing both proand anti-inflammatory activities. The goal of this study was to determine if enzymes in the eicosanoid pathway display distinct alterations in gene expre ssion in an allergen sensitization/challenge model of asthma or ABPA, potentially highli ghting novel therapeutic targets. To achieve this, two approaches were employed, the use of quantitative real-time RT-PCR to address reproducible changes in gene expression levels and an allergen model where the sensitizing agent was more indicative of a naturally encountered allergen. While gene array analyses would allow for a broader analysis of many more genes, the use of real-time RT-PCR has distinct advantages in t hat logical assumptions for relevant genes are made upfront and this analysis affords the opportunity to immediately generate reproducible and statistically significant results. Given the recent studies which have linked the ubiquitous fungus, Aspergillus fumigatus ( Af ), with an increased prevalence in asth matics [113, 135], we employed a 60

PAGE 61

mouse model which could mimic the patholog y of allergen-induced asthma or ABPA using an Af extract in both sensitization and chall enge. We first evaluated the responses in gene expression of a small subset of cy tokines, growth factors and chemokines between sensitization/c hallenge with the complex Af extract and the classically employed allergen, OVA [118, 119]. We obse rved a significant difference in the expression of the Th2 cytokines IL-4, IL-13, the acute phase cytokine IL-6 and the CC chemokine, eotaxin-1 (CCL11) in the Af animals as compared to OVA (Figures 3-1 and 3-2). These data further est ablish the relevancy of the Af model and demonstrate that the enhanced responses from critical mediator s of asthma pathology like IL-4, IL-13 and eotaxin-1 may be more reflective of the hu man pathology [136] than sensitization with a non-clinical, simple protein allergen. Another interesting yet conflicting result is the lack of any response from the enzymes on the COX branch of AA metabolism (Figure 3-3) which, at least at the transcriptional level, implies t hat the prostanoids may have a limited role in this allergy model. These data directed attention to the LO branch where the lite rature [114] and the significant pharmaceutical investment in ant i-LT therapies would argue that alterations in the expression of either 5-LO or FLAP in response to Af could be expected. As with the prostanoid enzymes, no changes were observ ed with these enzymes or in the levels of 3-LO (Figure 3-4A). Af sensitization/challenge did, however, c ause a significant increase for the 12/15LO, 8-LO and the epidermal-derived 12(S)-LO, which is unique to the mouse (Figure 34B). 12/15-LO has previously been shown to be induced in res ponse to IL-4 [137], hence it is unsurprising that this gene is upregulated in this model. The mouse data for 61

PAGE 62

12/15-LO induction are also in line with recent studies by Andersson et al. who demonstrated that 12/15-LO-/mice in a systemic OVA sensitization model had impaired airway inflammation, reduced levels of eosinophils, lymphocytes and macrophages in BAL fluid along with lower levels of the Th2 cytokines (IL-4, IL-5 and IL13) [138]. The presented data and that of Ander sson et al. [138] w ould imply that 12/15LO (mouse homolog of human 15-LO-1) i nhibition may provide an alternative therapeutic target for asthma and/or ABPA patients. This would also be consistent with studies that have demonstrated an increased le vel of 15-LO metabolites in asthmatics, where 15(S)-HETE levels in BAL fluid we re elevated and associated with tissue eosinophil numbers, sub-membrane thick ness and the observation that severe asthmatics presenting with persist ent airway eosinophils exhibit high levels of 15(S)HETE in BALF [139, 140]. 8-LO is the mouse orthol og of human 15-LO-2 with 78% protein identity, while another ortholog was recently crystallized from coral [141]. Evidence exists implicating both enzymes as potential tumor suppressors [128], with the most convincing evidence in prostate cancer where this genes expr ession is decreased or lost in high-grade prostate intraepithelial neopl asia and prostate cancer [142]. It has also been demonstrated that the 15-LO -2 gene may be negatively regulated by its own product [143], while being upregulated by aldosterone [ 144]. The significance of the induction of 8-LO seen in these mice is not clear, although it has been postulated that human 15LO-1 and 15-LO-2 (or mouse 12/15-LO and 8-LO by association) may have opposing effects on inflammation by metabolizing linoleic and arachidonic acids respectively [145]. 62

PAGE 63

It is also interesting to note that th e mouse specific, epidermal 12(S)-LO was significantly induced in the asthmatic mi ce. Although this gene does not exist as a functional enzyme in humans, its role here c ould be postulated based on it possessing a function similar to that of other 12(S)-LOs The cells of the lung may be expected to preferentially express the epidermal form over t he platelet form, thus explaining why this particular 12(S)-LO is induced while the platelet form is not. It is al so possible that, in this instance, the downstream effect is specif ic to mice and thus it would be of interest to determine the effect on functional 12(S)-LOs in humans and human cell lines under similar conditions. In addition to its role in the synthesis of pro-inflammatory products, 15-LO also participates, through transcellular biosynthes is, in the production of anti-inflammatory bioactive lipid mediators of resolution, the lipoxins [146, 147]. Lipoxins, LXA4 and LXB4 being the main components, are lipid mediator s generated from AA that act to reduce inflammation and promote resolution. Li poxins are generated through the combined action of 5-LO and 15-LO during cell-cell interactions. The metabolic flux through the eicosanoid pat hway initially requires the release of AA from membrane phospho lipids, and the exami nation of the PLA2s has provided new insights into the role these enzymes may play in ABPA and asthma. The data in Figure 3-5 have defined sPLA2-IIE, sPLA2-V and sPLA2-XIII as secretory phospholipases with intriguing potential roles in allergen sens itization and challenge. Examined next were the cytosolic group IV PLA2s, which have been directly linked to the liberation of AA as a consequence of the inflammatory response [36]. The vast majority of studies have focused on cPLA2 [148], which responds to a variety of stimuli and is regulated both at 63

PAGE 64

the transcriptional and post-translational levels Most surprisingly, as shown in Figure 36, a significant induction of cPLA2 was observed with no effect on cPLA2 or cPLA2. To date, the physiological roles for cPLA2 have not been concretely elucidated; this group IV family member was fi rst identified by searching the EST database for orthologs to cPLA2 to which it has ~30% overall sequence identity [42, 48, 52, 54, 55]. This is the second observation of an increase in the expression of cPLA2 in a disease, with the first being an increase in response to a parasitic infection in mice [57]. In addition to its PLA2 activities, Yamashita et al. [52] have also reported that this enzyme displays coenzyme A (CoA)independent transacylati on and lysophospholipid (LPL) dismutase (LPLase/transacylase) activities and have suggested a possible role in fatty acid remodeling of phospholipids and the clear ance of toxic lysophospholipids. Based on this evidence, it is hypothesized that the coupled induction of both cPLA2 and 15-LO in this mouse model of al lergic asthma or ABPA provide for the generation of both arachidonic acid and 15-HETE as potent mediators in the pathology of asthma and/or ABPA. With this rationale, it was import ant to further evaluate the regulation of cPLA2, as shown in the subsequent chapter. An important component missing from the animal studies using wh ole lung is the know ledge of the cells expressing cPLA2 during the development of the allergic response. Unfortunately, attempts to localize t he expression of cPLA2 in the lung by immunohistochemistry and in situ hybridization were unsuccessful. In summary, efforts were designed to demonstrate the effectiveness of an Af sensitization/challenge mouse model in combination with real-time RT-PCR in the identification of unique genes with altered mRNA expression. To this end, a number of 64

PAGE 65

genes in the eicosanoid pathway have been identified that display altered gene expression that may be associated with a llergic asthma and ABPA. The results have also helped to highlight a cPLA2 15-LO axis where the dow nstream metabolites can act as potentially important mediators in the inflammatory response in these diseases. 65

PAGE 66

66 Figure 3 3 -1. Comp a sensitiz a PCR an a represe n IL-3, IL6 represe n compar e rative cyto k a tion and c h a lysis was p n t steady st a 6 and IL-10 n t the mea n e d to PBS a k ine analy s h allenge in p erformed o a te mRNA with cycl o n s of CT a nd OVA s e s is in OVA ( C57BL/6J m o n RNA ex t levels of A) o philin A us e +/SEM ( n e nsitized a n ( OVA) and A m ice. Gen e t racted fro m ) IL-4 and I e d as an in n 3). an d n d challeng A spergillu s e specific r e m whole lu n L-13 and B ternal cont d + indicat e ed mice, r e s fumigatus e al-time R T n gs. Graph s B ) IL-1 ILrol. Data p o e p 0.05 a e spectively. ( Af ) T s 2, o ints a s

PAGE 67

67 Figure 3 3 -2. Comp a Aspergil l Gene sp from wh o factors, G cyclophil +/SEM sensitiz e rative gro w l us fumigat u ecific realt o le lungs. G G M-CSF a n in A used a (n 3). a e d and chal w th factor a n u s ( Af ) sen s t ime RT-P C G raphs rep r n d TGF, a a s an inter n nd + indic a lenged mi c n d chemok s itization a n C R analysi s r esent stea a nd chem o n al control. a te p 0.0 5 c e, respecti v ine analysi s n d challen g s was perfo r dy state m R o kines, eot a Data point s 5 as compa r v ely. s in OVA ( O g e in C57B L r med on R N R NA levels a xin-1 and K s are the m r ed to PBS O VA) and L /6J mice. N A extract e of growth K C, with m eans of and OVA e d CT

PAGE 68

Figure 3 3 -3. Gene e sensitiz e and chal extracte d of COX1 and pro s Genes a points a r e xpression a e d and chal lenged wit h d from who 1 COX-2 a s tacyclin sy re denoted r e the mea n a nalysis of lenged C5 7 h PBS or A f le lungs. T h a nd mPGE S nthase (P G by mouse n s of C T 68 enzymes i n 7 BL/6J mic e f as descri b h e graph r e S thrombo x G IS) as det e and huma n T +/SEM ( 7 n volved in p e C57BL/ 6 b ed in Met h e presents s x ane A 2 sy n e rmined by n homolog s 7 n 10) p rostanoid 6 J mice we r h ods and R teady-stat e n thase (TX A real-time R s (mouse/h u synthesis i r e sensitiz e NA was e mRNA le v A S), L-PD G R T-PCR. u man). Da t n Af e d v els G S t a

PAGE 69

Figure 3 3 -4. Gene e challeng e with Af a The gra p determi n SEM (n = 12(S)-L O human h SEM (7 e xpression a e d C57BL/ 6 s describe d p hs repres e n ed by real = 7-10). B) S O 12(R)-L O h omologs ( m n 10). a nalysis of 6 J mice. C 5 d in Metho d e nt steady s time RT-P C S teady stat e O 12/15-L O m ouse/hu m indicates p 69 lipoxygen a 5 7BL/6J m i d s and RN A s tate mRN A C R. Data p e mRNA le v O and 8-LO m an). Data p p 0.05 as a se family m i ce were s e A was extr a A levels of 3 oints are t h v els of plat e Genes ar e p oints are t compared m embers in e nsitized a n a cted from w 3 -LO, 5-L O h e means o e let 12(S)L e denoted b he means o to PBS. sensitized n d challeng e w hole lung s O and FLAP o f CT +/L O, epider m b y mouse a o f CT + / and e d s A) as m al a nd /

PAGE 70

Figure 3 3 -5. Secret o challeng e with PB S lungs. T h sPLA2-II C determi n homolog n 10). o ry phosph o e d C57BL/ 6 S or Af as d h e graph r e C sPL A 2-II n ed by real s (mouse/ h indicates o lipase A2 g 6 J mice. C 5 escribed i n e presents s t D and sPL A time RT-P C h uman). D a p 0.05 a s 70 g ene expr e 5 7BL/6J m i n Methods a t eady-stat e A 2-IIE, as w C R. Genes a ta points a s compare d e ssion level i ce were s e a nd RNA w e mRNA le v w ell as gro u are denot e re the mea d to PBS. s in sensiti z e nsitized a n w as extract e v els of grou u p V, X an d e d by mou s ns of C T z ed and n d challeng e e d from wh o p II PL A 2s, d XIII sPL A 2 s e and hu m T +/SEM ( e d o le 2 s as m an ( 7

PAGE 71

71 Figure 3 3 -6. Cytoso l challeng e with PB S lungs. T h cPLA2 denoted means o PBS. l ic phosph o e d C57BL/ 6 S or Af as d h e graph r e cPL A 2 an by mouse a o f CT +/o lipase A2 g 6 J mice. C 5 escribed i n e presents s t d cPL A 2 a a nd huma n SEM (7 n g ene expr e 5 7BL/6J m i n Methods a t eady-stat e a s determi n n homologs n 10). i n e ssion level i ce were s e a nd RNA w e mRNA le v n ed by real (mouse/h u n dicates p s in sensiti z e nsitized a n w as extract e v els of grou time RT-P C u man). Dat a 0.05 as c o z ed and n d challeng e e d from wh o p IV PL A 2 s C R. Genes a points ar e o mpared t o e d o le s are e the o

PAGE 72

CHAPTER 4 CYTOSOLIC PHOSPHOLIPASE A2 GAMMA Introduction Regarding the regulation of group IVC phospholipase A2 (cPLA2), Lindbom et al. [46] first showed that, amongst a survey of 19 other phospholipases, cPLA2 was selectively induced by tumor necrosis factor alpha (TNF) and interferon gamma (IFN) in human bronchial epithelial (BEAS-2B ) and nasal epithelial (RPMI 2650) cells. Additionally, Mancuso et al. show ed a significant increase in cPLA2 protein in response to leptin in rat alveolar macrophages [54]. More recent studies have shown that, while cPLA2 is normally undetectable in normal mouse jejunal epithelium, parasitic infection by Trichinella spiralis in the intestine causes a signifi cant increase in the expression of this phospholipase [57]. Experiments in C hapter 3 have also demonstrated that this phospholipase is significantly induced in an ani mal model of allergic asthma induced by sensitization and challenge with the ubiquitous fungus, Aspergillus fumigatus in the lung. Additionally, it has been demonstrated by Nakae, et al. that TNF is a critical component of a mouse model of allergic mice involving ovalbumin [149]. It is hypothesized that the observed in vivo increases in cPLA2 expression are mediated by associated increases of TNFor other cytokines in the lung. This hypothesis is based on the known role of TNFin inflammation as well as the studies by Lindbom et al. [46]. Therefore, because incr easing evidence points to a potent ially critical role for this phospholipase in the inflammatory response as well as in the control of membrane phospholipid composition, the regulation of cPLA2 has been further characterized here. In the present studies, the cytokines responsible for cPLA2 gene activation are 72

PAGE 73

analyzed, followed by a promoter deletio n analysis to identify the cytokine responsive elements in the proximal promoter region. Subsequently this region is used for computer analysis coupled with deletion of putative transcription factor consensus sequences to demonstrate the importance of potential transcrip tion factor binding sites. Lastly, ChIP and over-expression are utilized to verify the specific transcription factors in a functionally relevant manner. Thes e experiments demonstrate that TNF-dependent cPLA2 gene regulation is mediated by complexes of activating transcription factor 2 (ATF-2) and c-Jun, p65/RelA, and upstream stimulatory factors 1 and 2 (USF1/USF2) each binding to a proximal enhancer/promoter region in close juxtaposition to each other to allow for transcripti onal activation of this gene. Tumor Necrosis Factor-Alpha (TNF) TNFhas been shown to be both proand antiinflammatory. Studies in both wildtype and TNFknockout mice have strongly implicated TNFin the allergic asthma in OVA treated mice [149]. Following binding of TNFto the TNF receptor, several potential signaling pathways are activated. Activation of TN F receptor-associated death domains may lead to apoptosis [150], while activation of MAP/ERK kinases (MEK) or I B kinase may lead to activation of gene tr anscription [151]. Activation of MEK, and subsequently, JNK or p38 MAPK can lead to phosphorylation and activation of transcription factors such as c-Jun and ATF-2 [152, 153]. Activation of I B kinase (IKK) leads to phosphorylation and degradation of I B, which in turn releases the NFB complex into the nucleus to drive transcription. Transcription Factors (ATF-2/ c-Jun, p65, and USF) Several transcription factors have been found to be activated and interact in response to TNF, including p65, ATF-2 and c-Jun [154 155]. Many examples of ATF73

PAGE 74

2/c-Jun activation and interactions exist, wit h the best characterized occurring at the IFN and TNFpromoters [156, 157]. c-Jun and ATF-2 can be activated by stimulation with TNF, which causes phosphorylation of c-Jun and ATF-2 kinases, JNK and p38 MAPK. These activated proteins heterodimeri ze and bind to CRE (5-TGACGTCA-3) or AP-1 (5-TGACTCA-3) sites on the DNA. In th is case, the identified binding site (5TGACATCA-3) is identical to a CRE consensus sequence with the exception of one of the less conserved central bases. Based on thermodynamics, it has been recently postulated that the dimerization of these proteins may occur after DNA binding as monomers [158], although this finding is stil l novel and not thoroughly studied. The AP-1 family of transcription factors consists of the Jun and Fos subfamilies Typically, the Jun subfamily can heterodimerize with either t he Fos subfamily to bind AP-1 sequences or select ATF family members to bind CRE seq uences. Each of these transcription factor families contain a basic zipper (bZIP) domai n which binds DNA and a helix-loop-helix domain for dimerization. The NFB family is made up of five protei ns, p50, p52, p65/RelA, RelB and cRel, each containing an N-terminal Rel homology domain, which bind to a 10 bp B consensus binding site (5GGGA/GNA/TC/TC/TCC-3). In this case, the identified sequence (5-GGAAAGTCCC-3) differs from the consensus in only the third and sixth base-pair. p65, cRel and RelB are the only family members to contain a C-terminal activation domain. Similar to the AP1/CRE families of proteins, the NFB family can also be activated by TNF, but in a different manner. The NFB complex is retained in the cytosol by the IB protein until I B kinase (IKK) is activated by a stimulus such as 74

PAGE 75

TNF. This results in phosphorylation of IB, causing its degradat ion and release of NFB which can then traffic to the nucleus to bind DNA and regulate gene expression. The upstream stimulating factor (USF) genes produce the ubiquitously expressed basic helix-loop-helix leucine zi pper (bHLH-LZ) proteins USF1 and USF2, which bind to E-Box consensus sequences, 5-CANNTG-3. In this case, the identified sequence (5CACGTG-3) is a perfect match. The USF proteins are very highly conserved with nearly 60% homology between orthologs (USF1 and USF2) and 90-99% conservation between species at the DNA and protein levels for USF1 [159, 160]. USFs have also been implicated in the immune response and regulation of tumor suppressing genes, although the action of TNFhas not been previously linked to the activity of the USF transcription factors. cPLA2 Gene, Transcript and Protein Structure The cPLA2 gene consists of 17 exons spanning 63 kb of chromosome 19 at position 19q13.33 and is illustrated in the top portion of Figure 4-7. The TSS and surrounding promoter region fully lack any TATA element, INR, DPE or other well defined promoter elements. The fully splice d mRNA transcript is 2541 bp with a 1624 bp coding region resulting in a protein of 541 amino acids. To date, no phosphorylation sites have been identified on the resulting prot ein, although lipid modification sites do exist. The cPLA2 protein has been shown to be far nesylated at the C-terminal end of the protein and it is associated with membrane fractions of cells. Even in the absence of this modification, the association of cPLA2 protein with the membrane fractions of cell lysates is resistant to high salt concentration s, implying that this modification is not wholly responsible for the membr ane association [38, 48, 51, 52]. 75

PAGE 76

Results cPLA2 Expression in Response to the antigen Aspergillus fumigatus ( Af ) To date, very little has been identified about the transcriptional induction and regulation of cPLA2 gene expression [36]. The data fr om Chapter 3 demonstrate that cPLA2 can be induced at the mRNA level in mice sensitized and challenged with Af What is not clear from this result is prec isely which cells in t he lung are causing this induction. Due to the fact t hat one of the major changes in the lungs of these mice was the infiltration of eosinophils into the lungs [70], a human eosinophilic leukemia cell line (EoL-1) was employed. As shown in Figur e 4-1, when EoL-1 cells are treated with increasing concentrations of the same crude Af extract, cPLA2 mRNA levels are induced up to 15 fold by real-time RT-PCR. cPLA2 Expression in Response to a Panel of Cytokines and Chemokines Going a step beyond basal expression in the initial studies of cPLA2, Lindbom et al. [46] first showed the induction of cPLA2 mRNA levels by TNFin human bronchial epithelial (BEAS-2B) and nasal epi thelial (RPMI 2650) cells from a screen of 19 different PLA2 types. Also within the respiratory system, t he studies in a mouse model of allergic asthma in C57BL/6J mice have physiologically demonstrated that a llergen sensitization and challenge can cause a si gnificant induction of cPLA2 mRNA levels in intact lung (Figure 3-6). Based on our research and the studies by Lindbom in bronchial epithelial cells, a human bronchial epithelial cell line, S9, was em ployed. This cell line is derived from IB3.1 cells which are SV40 T-antigen transformed cells from a cystic fibrosis patient and hence deficient for a functional cystic fibrosis transmembrane conductance regulator (CFTR) gene [78]. S9 cells were subsequent ly derived from the IB3.1 cells by AAV 76

PAGE 77

mediated reintroduction of the wild type CFTR gene and so therefor e are representative of a normal human bronchial epithelial ce ll [77]. S9 cells were exposed to Af LPS, and a panel of cytokines. The data in Figure 4-2 demonstrate that Af is unable to induce cPLA2 in S9 cells, although IL-1 does induce the mRNA of cPLA2 (~3 fold) with TNFbeing the most potent stimulus (>6 fo ld). These data also show that cPLA2 does not respond to LPS in these cells. These data indicate that, although immune cells may be inducing cPLA2 in response to the allergen, the levels of this gene are also increased in epithelial cells as part of the downstream inflammatory response. Specifically, the TNFpossibly originating from Af -mediated activation of resident alveolar macrophages would then mediate the induction of cPLA2 in the epithelial cells of the lung. To further confirm this response within lu ng cells, two other cells lines were also evaluated. A human lung adenocarci noma epithelial-like cell line (A549), a human fetal lung fibroblast cell line (HFL-1), and S9 cells were all treated with TNFfor 12 or 24 hours and cPLA2 mRNA levels were analyzed by real-time RT-PCR. As shown in Figure 3-2, following 12 and 24 hours of TNFexposure cPLA2 mRNA levels are significantly increased in eac h of these cell lines by ~4-5 fold in A549 and HFL-1 cells and ~9-10 fold in S9 cells at each time point. In order to verify t hat this induction of mRNA was physiologically significant and corresponded to an increase in protein levels, A549 cells were treated with TNFfor up to 48 hours. Figure 4-4 illustrates a representative immunoblot and corresponding densitometry confirming that cPLA2 protein levels are indeed elevated by ~3 fold by 24 hours following TNFexposure in A549 cells. 77

PAGE 78

To characterize the temporal pattern of this induction, human S9 cells were exposed to TNFfor increasing durati ons and changes in cPLA2 mRNA levels were analyzed by real-time RT -PCR (Figure 4-5). cPLA2 mRNA levels displayed a statistically significant induction by four hours and, by eight hours had reached six fold, implying that the 9 fold induction seen at 12 hours (Figure 4-3) was the maximal induction of cPLA2 mRNA by TNF. Based on this observation, a 12 hour treatment of S9 cells with TNFwas used for many of the remaining studies. An increase in mRNA steady state levels as measured by real-time RT-PCR may be a result of de novo transcription of the gene or due to increased stability of the mRNA transcript. To help elucidate the mechanism underlying the increase in cPLA2 mRNA levels, cPLA2 heterogeneous nuclear RNA (hnRNA) levels were measured [161]. Analogous to a nuclear run-on study, th is method assesses the levels of introncontaining precursor mRNA by real-time RT-PCR as a dire ct evaluation of the level of de novo transcription. This was accomplished by using PCR primers within an exon and an adjoining intron that span the exon-i ntron boundary, thus making the amplicon specific for the hnRNA species (Table 2-4). These results (Figure 4-6) demonstrate that hnRNA levels are rapidly induced within 30 min and become maximal at 1 h with a ~9 fold induction. These data demonstrate that TNFmediated induction of the human cPLA2 gene occurs primarily due to de novo transcription. Promoter Deletion Analysis of cPLA2 Figure 4-7 illustrates the genomic structure of human cPLA2 on chromosome 19 as predicted from a comparison of the human cDNA sequence [38] comprised of 2541 bp (Accession NM_003706) to the human genome. This gene structure was derived from Ensembl ( www.ensembl.org ). The predicted transcriptional initiation site was 78

PAGE 79

based on RACE analysis by Pickard et al. [ 42]. It is important to note that the cPLA2 promoter lacks a CAAT or TATA box and does not have a GC rich island in the promoter, often indicative of housekeepi ng genes. In addition, the lack of these canonical sites is sometimes associated with Initiator (INR) [162] and/or downstream promoter element (DPE) [163] sites, however neither of these exist in the cPLA2 locus. The cPLA2 locus contains 17 exons spanning ~63 kb, encoding a protein of 541 amino acids with a predicted mole cular mass of 60.9 kDa. Figure 4-7 also illustrates the various prom oter constructs that were generated to identify the TNFresponse element. These elements were coupled to a human growth hormone (hGH) in an hGH reporter constr uct [161] at the HindIII cloning site immediately upstream of the transcription start site for hGH. These fragments were amplified by PCR using t he primers listed in Table 2-5 with the 3.9 and 1.3 kb constructs being amplified directly from a BAC clone and the 490 and 288 bp constructs being amplified later from the 1.3 kb promoter fragment in the hGH plasmid. The 762 bp construct was made by a KpnI digestion of a re striction site immedi ately upstream of the cloning site and the other lyi ng 588 bp upstream of the cPLA2 transcription start site. All of these fragments were confirmed by sequence analysis and the 3 ends of each fragment extends 174 bp into ex on 1. Initially, the -3.9 and -1.3 kb promoter fragments were analyzed by northern analysis in response to both IL-1 and TNFwith L7a used as a loading control (Figure 4-8). Both of these fragments were found to contain sequences that responded to cytokine treatment thus potentially constituting a cPLA2 inducible promoter. Therefore, three smaller fragments were constructed starting at 588, -316 and -114 bp relative to the cPLA2 transcription start site, also referred to by 79

PAGE 80

their total bp sizes, including the fi rst 174 bp of exon 1, as 762, 490, and 288, respectively. These remaining promoter del etion fragments were also confirmed by sequence analysis and evaluated following transi ent transfection in S9 cells. Figure 4-9 (top) depicts a representative northern bl ot analysis. To eliminate problems of transfection efficiency, each individual vector construct was batch transfected into cells, split 12 h later into plates for control and stimulus treatment, and then allowed to recover for 12 h followed by TNFexposure for 12 h. Total RNA was isolated from cells and the RNA was then fractionated on 1% formaldehyde/agarose gels, electrotransferred to a nylon membrane and then hybridized to 32P-radiolabeled probes specific to hGH or the large ribosomal RNA subunit, L7a, as a loading control. These results demonstrate that the smallest construct, spanning from -114 to +174, retains TNFresponsiveness. Densitometric data from three independent experiments are shown in Figure 4-9 (bottom), where the fold i nduction is reported relative to that of the untreated control cells normalized to a value of 1. This was necessary since the basal level of expression from each of these promoter deletion fragments is undetectable in S9 cells as well as other pulm onary cells that we have tested. All of these promoter fragments included 174 bp of exon ic sequence, so the next step was to determine whether this region c ontained important regulatory sequences by comparing the expression of the -114/+174 fragment to a fragment where this region had been deleted. The -114/-1 fragment of the cPLA2 promoter lacks any transcribed portion of the cPLA2 gene and was created by quickchange mutagenesis of the 114/+174 fragment with the primers listed in Table 2-6. A representative northern blot is provided in Figure 4-10 (top) with the corresponding densit ometric data from three 80

PAGE 81

independent experiments shown in Figure 4-10 (bottom). These data confirm that the minimal promoter construct from -114 to -1 retains the majority of the TNF-dependent transcriptional induction. Given our inability to accurately detect the basal expression, we are not at this time conf ident that there is any statis tical difference between these two constructs (Figure 4-10), thus our fu rther analyses focuses on the sequences 5 to the transcriptional initiation site utilizing the -114/-1 cPLA2 promoter fragment. Characterization of the Pr oximal Promoter of cPLA2 Containing Enhancer Activity To further characterize the exact nature of this proximal promoter sequence, we tested its ability to function as a stimulus-dependent enhancer. True enhancer elements, by definition, should be able to dr ive a heterologous promoter and function in both an orientation and position independent manner. We therefore generated constructs coupling the -114/-1 fragment in the forward an d reverse orientation to a minimal viral thymidine kinase (TK) promoter that has low level expression in most cell types. S9 cells were batch transfected with each construct, exposed to TNFand evaluated by northern analysis for hGH expression. As shown in Figure 4-11, this fragment is able to drive the heterologous TK promoter and do so in an orientationindependent manner. Due to the fact that the plasmid is circular DNA, the element is essentially located before and after the promoter which is essentially a circular argument for position independen ce. We therefore concl ude that this proximal promoter region essent ially satisfies the definition of a stimulus-specific enhancer element. 81

PAGE 82

Identification of Functional Transcription Factor Binding Sites within the cPLA2 Enhancer/Promoter Potential consensus binding sites within the -114/-1 cPLA2 enhancer/promoter fragment for CRE, NFB and an E-Box were identifi ed using the TESS software ( www.cbil.upenn.edu/cgi-bin/tess/tess ) designed to identify putat ive transcription factor consensus elements based on the TRASFAC database. Figure 4-12 illustrates the sequence of the -114/-1 cPLA2 enhancer/promoter fragment with potential regulatory factor consensus binding sites underlined an d the sequences that were sequentially deleted in italicized bold text. Each of the respective cognate elements were deleted from the -114/-1 enhancer/promoter fragm ent by quick-change mutagenesis with the primers listed in Table 2-6 and evaluated following transient tr ansfection in S9 cells by northern analysis (Figure 4-13). These results illu strate that deletion of the respective protein binding sites inhibits the TNFmediated induction to varying degrees. The potential effects of these deletions may be a reduction in the relative fold induction conferred by TNFtreatment, or simply a broad reduction in total levels of transcription. Due to the relative lack of detectable basal activity by northern analysis, these potential effects could not be determined, therefore th ese fragments were also analyzed by realtime RT-PCR. Figure 4-14 is a real-time RT-PCR analysis of three independent experiments with the -114/-1 cPLA2 enhancer/promoter fragment illustrating that deletion of either the CRE or NFB sites results in a statistica lly significant reduction of both basal levels as well as relative fold inductions as compared to the wild type -114/-1 enhancer fragment. Although deletion of the E-Box (del III) does not affect the relative induction conferred by TNF(9.53 versus 9.18 fold), delet ion of this site does have a 82

PAGE 83

statistically significant impact on the basal levels of transcription from the cPLA2 enhancer/promoter conferring a 34% reduction in basal activity. Chromatin Immunoprecipitati on Analysis of the cPLA2 Enhancer/Promoter Region To test the hypothesis that each of the respective consensus binding elements within the stimulus-dependent enhancer interacts specifically with a cognate transcription factor in the endogenous chroma tin environment, we employed chromatin immunoprecipitation (ChIP) analysi s. As identified prior, t he -114/-1 region contains a cAMP response element (CRE), TGACATCA, near ly identical to the perfect consensus CRE sequence, TGACGTCA, with the onl y difference being the fifth base-pair substitution of an adenine for guanidine while maintaining the critical palindromic TGANNTCA. ATF-2/c-Jun heterodimers have been identified previously, with one of the most studied of these occurring in the IFNpromoter [156] as well as in the TNFpromoter [157]. This heterodimerization and binding to CRE sites have also been previously documented in response to TNF[157, 164]. Therefore the potential interaction of c-Jun and ATF-2 in response to TNFwith the -114/-1 enhancer/promoter region by ChIP was evaluated followed by quantific ation by real-time PCR (Figure 4-15A). Three controls were utilized in the ChIP analyses to ensure specificity of the results: no primary anti body (noAb), nonspecific IgG (IgG) and ChIP analysis in an unrelated 3 untrans lated region (3UTR) of the cPLA2 gene with primers listed in Table 2-4. These ChIP results demonstrate the inducible interaction of both ATF-2 and c-Jun (~4 fold each relative to respective untreated controls) with the enhancer element as compared to the 3UT R and the other control samples after 12 hours of TNFexposure. This data, along with the aforementioned studies regarding 83

PAGE 84

ATF-2/c-Jun heterodimers strongly indica te that the CRE site in the cPLA2 promoter is most likely occupied and stimulated by such a heterodimer. The NFB consensus element can potentiall y be occupied by a family of transcription factors, includi ng p50, p52, p65 (RelA), c-Rel and RelB, that have a shared N-terminal Rel homology domain (RHD) in volved in DNA binding and homoand heterodimerization [165, 166]. Co mbinations of these family members are believed to bind as dimers to B consensus sites in promoters and enhancers of target genes. Gene activation is mediated through the tran scriptional activation domain which is a region present only in p65, c-Rel, and RelB Therefore the -114/-1 enhancer/promoter region was analyzed by ChIP with a p65/RelA specific antibody with real-time PCR (Figure 4-15B). The results with p65/RelA-speci fic ChIP clearly demonstrate that p65 is inducibly associated with the human cPLA2 enhancer/promoter region following 12 hours of TNFstimulation (~21 fold relati ve to untreated control). The E-Box sequence (5'-CANNTG-3') is f ound in the transcriptional regulatory region of a number of genes with a repertoire of cognate factors that share the evolutionary conserved basic-Helix-Loop-Helix-Leuc ine Zipper (b-HLH-LZ) motif [167]. This motif and the ability to interact with the E-Box element is common to the Myc family, including Mad, Max, and Mxi1, as well as the upstream stimulating factors, USF1 and -2. USF-1 and -2 proteins are thought to be ubiquitously expressed and can function as transcriptional activators, thr ough interaction with other co-activators and members of the pre-initiation complex as well as in t he recruitment of chromatin remodeling enzymes [167]. The basic region s of USF-1 and -2 comprise the DNA binding domain whilst the HLH and LZ domains participate in homoand 84

PAGE 85

heterodimerization between USF-1 and -2, as we ll as other partners. We next evaluated the interaction of USF-1 and -2 with the cPLA2 enhancer by ChIP and found that both of these factors associated with the element in an inducible manner (Figure 4-15C, ~14 fold each relative to respective untreated controls). This data, along with supporting evidence of USF1/USF2 heterodimers in the liter ature strongly imply t hat this region is associated with such a dimer. Due to the combined apparent presence of all of these factors at the enhancer/promoter region of cPLA2 following 12 hours of stimulation, this phenomenon was next evaluated immediatel y following stimulation in or der to determine a potential temporal association of these factors. Firstly, the associat ion of RNA polymerase II (Pol II) was analyzed at 15, 30, and 60 minutes following TNFtreatment. Due to the rapid induction of cPLA2 transcription by 30 minutes as indicated by hnRNA data in Figure 46, it was expected that Pol II would rapidly bind to this element. The data in Figure 4-16 confirms this hypothesis with Pol II bindi ng inducibly within 15 minutes of TNFexposure. This timing was also tested with p65 as well as its potent ial binding partner p50. The data in Figure 4-17 demonstrates t hat p65 is also inducibly associated with this region while it would appe ar that it is not partnered with p50. Next, the same time points were used to analyze USF1 associati on by ChIP and, as shown in Figure 4-18, USF1 is also found in this region within 15 minutes of exposure to TNF. It is assumed that the USF1 found here is similarly associated with USF2 as demonstrated in Figure 4-15. Finally, ATF-2 and c-Jun were analyzed at these earlier time points. Interestingly, no statistically significant binding of either of these factors was observed following up to one hour of TNFtreatment (Figure 4-19). Despite th is observation, when an additional 85

PAGE 86

time point was added at two hours, there does appear to be an upward trend in the association with the promoter for both of these factors. Effects of Overexpression of ATF-2/c-Jun, p65, and USF1 on the Proximal cPLA2 Enhancer/Promoter To further demonstrate the functional rele vance of c-Jun, ATF-2, p65, and the USFs to the regulation of the human cPLA2 enhancer/promoter region, each of these factors have been over-expressed in combin ation with the hGH reporter construct driven by the cPLA2 enhancer/promoter. Total RNA was isolated and treated with DNase I to remove potential plasmid and ge nomic contamination and samples were analyzed for hGH expression by real-time RT -PCR. The data in Figure 4-20 shows that overexpression of c-Jun (~4 fold), USF1 (~8 fold), or p65 (~30 fold) individually are sufficient to activate tr anscription from the cPLA2 enhancer/promoter with p65 being the most potent activator. The fold induction was calculated relative to cells transfected with an empty mammalian expression vector (p cDNA3.1) and no transcription factors (no TF) which was normalized to 1. In order to further define specific roles fo r each of these factors, dominant negative (DN) constructs for each of these factors were utilized to determine their effects on both the uninduced levels of transcription as well as their impact on the TNFinduction (Figure 4-21). The DN forms of c-Jun and p65, Tam67 and TA, lack the activation and DNA binding domains, whereas the DN fo rms of ATF-2 and USF1/2, A-ATF2 and AUSF, lack not only the activation domains but have also had their basic DNA binding domains replaced with acidic residues. The USF DN, A-USF functions as a DN for both USF1 and USF2. Studies on the ATF-2 DN, AATF2, were performed separately from the other DN experiments and thus are shown with its own control in triplicate. The data 86

PAGE 87

presented in Figure 4-21B demon strate that only the DN for ATF-2, A-ATF2, is capable of reducing the basal level of transcription from the cPLA2 enhancer/promoter (54% reduction). The only other DN that had an effect on basal transcription is the c-Jun DN, Tam67 (Figure 4-21A, 2.6 fold induction). It is hypothesized that the activation seen here is a result of Tam67 recruiting the endogenous heterodimerization partner, ATF-2, to the enhancer/promoter, which contains an activation domain capable of showing increased expression. Interestingly, A-ATF2 is also the only DN to have no effect on the observed relative fold induction by TNF. Each of the other DN proteins diminish the effect of TNFover basal transcription by at least half, with the p65 DN, TA, completely blocking any effect of TNFon the ability of the cPLA2 enhancer/promoter to activate transcripti on (Figure 4-21A,C,D). Delineating Interplay between Transcr iption Factor Binding Sites by Cooverexpression Having established c-Jun, p65 and US F1 as activators of the cPLA2 enhancer/promoter and the DNs A-ATF2, Tam67, TA and A-USF as potential repressors of either basal or induced acti vity, potential interplay between these factors was analyzed. Because ATF-2 was not confirm ed to be able to activate transcription by itself, it was included as having possible inhibi tory properties for thes e studies. Firstly, p65 was co-overexpressed with ATF-2, A-ATF2, Tam67, AUSF, or p50 (Figure 4-22). As seen here, the DNs for both ATF-2 and US F1 are capable of interfering with the induction seen by p65 overexpression. p50 was included here because the lack of observed association by ChIP does not complete ly rule out the possi bility of a potential role for this protein. As shown p50 does not seem to provide any additive effect on the observed activation by p65, further indicating, in conjunction with the ChIP data that p50 87

PAGE 88

does not play a role in this activation. Due to the weak activator properties of Tam67 (Figure 4-21A), it was unclear whether it would have any effect on the induction caused by p65 and, as shown, co-expression of p65 and Tam67 was not different than p65 alone. Next, c-Jun was overexpressed wi th the factors ATF-2, A-ATF2, TA and A-USF. As predicted, A-ATF2 was able to reduce the induction seen by c-Jun alone. This is less surprising than the effect of A-ATF2 on p65 due to the known interactions between ATF2 and c-Jun. Also of note is that the induction seen by c-Jun is not dependent on USF as the DN, A-USF, has no e ffect on the induction imparted by c-Jun. Lastly, the induction seen by USF1 does not seem to be dependent on any of the other factors utilized in these studies. Knockdown of ATF-2/c-Jun, p65, and USF1 by siRNA Due to the established relevance of ATF2/c-Jun, p65, and USF1 to the regulation of cPLA2, attempts were made to individually knock down each of these factors. Despite attempts utilizing various transfe ction reagents (DharmaFECT from Dharmacon and HiPerFect from Qiagen) as well as siRNAs fr om each of these sources, no effect on cPLA2 mRNA levels was observed. The efficien cy of knockdown of transcription factors was measured by both real-t ime RT-PCR and immunoblot dem onstrating a decrease in the targeted transcription factor s at both the mRNA and protein levels. It is now believed that the efficacy of these siRNA experimen ts was likely hindered due to each factor contributing to a portion of the cPLA2 transcriptional regulation. This cooperation in the transcriptional regulation is supported by overexpression studi es in Figure 4-22. 88

PAGE 89

Discussion Group IVC phospholipase A2 (cPLA2) has been implicated in cellular functions ranging from alteration of membrane composit ion to a possible critical role in the liberation of bioactive lipids that mediat e the inflammatory response. Furthermore, recent studies have associated either SN Ps or chromosomal deletions of cPLA2 with schizophrenia [60, 63] or human gliomas [6 4, 168], respectively. With regards to membranes, the cPLA2 protein is found to be membra ne associated with either the ER/Golgi [48, 49] or mitochondrial membrane s [51] in human cells. The constitutive association of cPLA2 to membrane phospholipids coupl ed to the proteins ability to catabolically alter membrane composition may pl ay an important role in the regulation of integral membrane protein occupancy, membr ane fluidity and the formation of lipid rafts [169]. As shown in Figure 4-1, cPLA2 mRNA can be induced in human eosinophils-like cells by a physiologically relevant antigen, Af In addition to this direct immune response, immune cells produce an array of cyt okines, some of which were examined in Figure 4-2. As demonstrat ed, the levels of cPLA2 mRNA can also be induced in response to pro-inflammatory stimuli, such as TNFand IL-1 thus further connecting the physiological role of cPLA2, through its effects on downstream eicosanoid production, to inflammation. Additionally, to date cPLA2 has been associated with two pathologies with relevant immunological responses. This phospholipase is induced in response to the parasite Trichinella spiralis in mouse jejunal epithelium [57] and from our studies in mouse lungs in response to airw ay sensitization/challenge by the allergen Aspergillus fumigatus (Figure 3-6). In each of these conditions, the induction of cPLA2 occurred in association with an increas e in cytokine levels such as TNF. These data 89

PAGE 90

further imply that the regulation of the cPLA2 gene may be closely associated with the inflammatory response. Therefore, it was hypothesized that the TNF-dependent induction of this phospholipase and thus the underlying regulator y mechanisms will be of significant importance to events leading to tissue inflammation. The examination of other pulmonary cells lines in Figure 4-3, as well as studies in nasal epithelia by Lindbom, et al. and intestinal epithelium by Brown, et al. help to substantiate the importance of this gene across tissues with diffe rent inflammatory stimuli [46, 57]. The data in Figures 4-4, -5, and -6 also demonstrate that this induction is both transcriptional and results in a concomitant increase in cPLA2 protein levels. The subsequent efforts shown here have focused on the identification of regulatory elements in the pr oximal promoter that mediate cytokine induction. The relevant sequences have been narrowed down to 114 base pairs immediately upstream of the cPLA2 transcription initiation site (Figur es 4-8, -9, -10) and it has been demonstrated that this region can functi on as a stimulus-dependent enhancer element (Figure 4-11). Three separat e putative consensus sites have been identified, CRE, NFB and E-Box, by computational analysis (F igure 4-12) and their functional relevance has been verified through mutagenesis (Figures 4-13, -14). The transcription factor occupancy of this region has been determi ned by ChIP analyses, demonstrating the TNF-dependent inducible association of A TF-2/c-Jun, p65/RelA and USF1/USF2 (Figure 4-15). While p65, USF1 and RNA Pol II are all recruited to this region within 15 minutes of TNFtreatment (Figs. 416, -17, -18), c-Jun and ATF-2 may be arriving slightly slower to participate in this induc tion (Fig. 4-19). Many of these factors have previously been shown to be involved in TNFsignaling pathways. ATF-2 and c-Jun 90

PAGE 91

are known to heterodimerize and bind DNA to activate transcription of genes such as IFN and TNF, while the NF-B pathway is the prom inent target of TNF. The involvement of USF proteins is not well characterized in response to TNF, although, due to the ubiquitous nature of this family, it is not particularly surprising. Furthermore, the functional importance of these transcription factors to the induction of the cPLA2 enhancer/promoter was substantiated by over-expression. The data in Figure 4-20 show that overexpression of select transcription factors can activate the minimal cPLA2 enhancer/promoter. The one exception to this is overexpression of ATF-2. It has been argued that t he overepxression of ATF-2 is only mildly effective as an analytical tool due to a requirement of phosphorylation by JNK and p38 MAPK [170], therefore this may explain why no additional activity wa s seen with overexpressed wildtype ATF-2. Additionally, the requirement for each of these factors in the TNFinduction of the cPLA2 enhancer/promoter was analyzed by ov erexpression of dominant negative forms of these transcription factors. The data in Figure 4-21 demonstrate that, although c-Jun and USF1/2 are contributing to the induction by TNF, p65 appears to be essential for this induction to occur. Surp risingly, only ATF-2 appe ars to be required for normal basal transcription to occur through the cPLA2 enhancer/promoter. The involvement of ATF-2 in this basal activity is supported by the fact that only the c-Jun dominant negative can increase basal activity, presumably by acting as an activator by recruiting endogenous ATF-2 to the cPLA2 enhancer/promoter. The potential for Tam67 to function as an activator has been previously documented [171]. 91

PAGE 92

Lastly, these transcription factors were analyzed in relation to each other to determine possible interactive effects of potential activating factors with potential inhibitory factors (Figure 4-22). It is belie ved that the increased activity of the cPLA2 enhancer/promoter by transcription factor overexpression is not identical to the effect of TNF. The impact of p65 on the cPLA2 enhancer/promoter appears to be at least partially dependent on the functional activity of the neighboring transcription factors as demonstrated by co-expression of DNs for ATF-2 and USF1 and the resulting ~50% reduction in the p65 dependent increase in cPLA2 enhancer/promoter activity. Whereas, the effect of c-Jun appears to be only dependent on its binding partner, ATF2. Finally, the action of USF is independ ent of the other factors based on the observation that this induction cannot be blocked by any dominant negative proteins even though A-USF can reduce p65 induction, as already noted. Based on the above data, it is clear that TNFcan induce the cPLA2 gene via an enhancer/promoter element which dependent on the interplay of c-Jun, p65, and USF1/2. These data also support the idea that ATF-2 may be involved in basal transcription from the identified enhancer/promoter element, although this hypothesis needs to be investigated further. USF1/2 have previously been implicated in chromatin remodeling and it is believed that this may explain their tacit interactions with the other members of the cPLA2 regulatory machinery [172, 173]. Overall, the regulatory dat a presented here are importa nt to the understanding of this unique phospholipases role in the inflamma tory response. This data will be crucial to understanding this enzymes function in both the generation of bioactive lipids and its effects on membrane composit ion. The similarities between the transcriptional 92

PAGE 93

regulation of cPLA2 and many other components of the inflammatory cascade, such as IFN and TNF[174-176], further support the importance of this gene in this cascade. It is our hope that the newly establis hed transcriptional regulation of cPLA2 will lead to a new target for therapeutics for in flammatory disease and mitigation. 93

PAGE 94

94 Figure 4 4 -1. Evalua t Real-tim e EoL-1 c e mRNA l e of CT t ion of stea e PCR of c e lls were tr e e vels were a dy state m R PL A 2 in r e e ated with t a nalyzed b R NA levels e sponse to t he indicat e y real-time of cPL A 2 Af in the e o e d amount s RT-PCR. D in human e o sinophil c e s of Af and s D ata point s e osinophil s e ll line, Eo L s teady stat e s are the m e s L -1. e e ans

PAGE 95

95 Figure 4 4 -2. Evalua t respons e respons e SEM (n = t ion of stea e to a pane e to the ind = 3). indic a dy state m R l of cytokin icated cyto a tes p 0.0 R NA levels es. Real-ti m kines. Dat a 5 as comp a of cPLA2 m e RT-PC R a points ar e ar ed to the in pulmon a R of cPLA2 e the mean s untreated c a ry cells in in S9 cell s s of CT + c ontrol. s in + /

PAGE 96

Figure 4-3. Evaluati on of steady state mRNA levels of cPLA2 in various human pulmonary cells. Real-time RT-PCR of cPLA2 in A549, HFL-1 and S9 cells following treatment of TNFfor the indicated amounts of time. Data points are the means of CT +/SEM (n = 3). indicates p 0.05 as compared to their respective untreated controls. 96

PAGE 97

Figure 4-4. Immunoblot analysis of cPLA2 in A549 cells. A549 cells were treated with TNF-a for the indicated amounts of time and protein was harvested and for an immunoblot analysis with an antibody to cPLA2 (top). The bottom panel illustrates densitometry of the aforementioned immunoblot. 97

PAGE 98

Figure 4-5. Steady-state mRNA levels of cPLA2 in S9 cells up to eight hours. S9 cells were treated with TNF-a for the indicated periods of time and total RNA was collected and used for real-time RT-P CR. Data points are the means of CT +/SEM (n = 3). indicates p 0.05 as compared to the untreated (0 h) sample. 98

PAGE 99

Figure 4-6. Heterogeneous nuclear RNA (hnRNA) levels of cPLA2 in S9 cells up to eight hours. S9 cells were treated with TN F-a for the indicated periods of time and total RNA was collected, DNase-tr eated, and used for real-time RT-PCR. Data points are the means of CT +/SEM (n = 3). indicates p 0.05 as compared to the untreated (0 h) sample. 99

PAGE 100

Figure 4 4 -7. Diagra m The 63 k blown u p other pr o reporter m of the c P k b, 17-exon p on botto m o moter frag plasmid ar e P L A 2 gene cPLA2 g e m The tran s ments to b e e also illust 100 structure a e ne is illust r s cription st a e cloned in t rated belo w a nd subseq r ated at to p a rt site is d e t o the pro m w uent prom o p with the 3 e signated a m oterless g r o ter constr u .9 kb prom o a s +1, an d r owth hor m u cts. o ter d m one

PAGE 101

Figure 4 4 -8. Deter m were tra n RNA wa s loading c m ination of t n sfected wi s subjecte d c ontrol. 101 he IL-1 a n th the indi c d to norther n d TNFr e c ated hGH r n analysis f e sponsive c r eporter co f or hGH wi t c PL A 2 pro nstructs a n t h L7a bein mote r S9 c n d the colle c g utilized a c ells c ted a s a

PAGE 102

Figure 4-9. Determination of the TNFresponsive cPLA2 promoter. S9 cells were transfected with the indicated cPLA2 promoter tethered to the hGH reporter construct and the collected RNA was s ubjected to northern analysis for hGH with L7a being utilized as a loading cont rol. A representative northern (top) and corresponding densitomet ric data (bottom) are s hown. Data points are represented as means +/SEM (n = 3) and signifies p 0.05 as compared to their respective controls. 102

PAGE 103

Figure 4-10. Determination of the minimal TNFresponsive cPLA2 promoter. S9 cells were transfected with the indicated cPLA2 promoters tethered to the hGH reporter construct and the collected RNA was subjected to northern analysis for hGH with L7a being utilized as a loading control. A representative northern (top) and corresponding densitometric data (bottom) are shown. Data points are represented as means +/SE M (n = 3) and signifies p 0.05 as compared to their respective controls. 103

PAGE 104

Figure 4 4 -11. Deter m cPLA2 p promote r the hGH northern m ination of p romote r S r driving th e reporter c o analysis f o 104 enhancer a S 9 cells we r e minimal v o nstruct (p T o r hGH wit h a ctivity wit h r e transfec t v iral thymid i T KGH) and h L7a being h in the mini t ed with th e i ne kinase p the collect utilized as mal TNFe indicated c p romoter ( T ed RNA w a a loading c responsiv e c PL A 2 T K) tethere d a s subjecte c ontrol. e d to d to

PAGE 105

Figure 4 Figure 4 4 -12. Site d e bp cPLA NF-kB a n italicized and the c 4 -13. North e were tra n tethered e letions of 2 enhanc e n d an E-bo letters ha v c onstructs a e rn blot an a n sfected wi to the hG H the cPL A 2 e r/promote r x sites und v e been del a re named a lysis of c P th the indi c H reporter g 105 enhancer / r is shown w erlined an d eted by m u with the la b P L A 2 enha n c ated -114/ g ene. / promote r T w ith conse n d labeled u n u tagenesis b els writte n n cer/prom o 1 enhanc e T he seque n n sus sites f o n der the se for subseq n above th e o ter site del e r/promoter n ce of the 1 o r the CR E quence. T h uent studi e e sequence 1 14 E h e e s etions. S9 constructs cells

PAGE 106

Figure 4 4 -14. Realt S9 cells w construc construc represe n to untre a level of T t ime RT-P C w ere trans f ts tethered t are listed n ted as me a a ted -114/1 T NFindu c 106 C R analysi s f ected with to the hG H above eac a ns +/SE M 1 control, w c tion seen s of cPL A 2 the indicat H reporter g h TNFd a M (n = 3) a n w hile signi f in the -114 / enhancer/ p ed -114/-1 g ene. Relat a ta point. D n d signifi e f ies p 0. 0 / -1 constru c p romoter s i enhancer/ p ive fold ind D ata points a e s p 0.05 0 5 as comp a c t. i te deletion p romoter uctions of e a re as compa r a red to the s. e ach r ed

PAGE 107

Figure 4-15. ChIP of CRE, NFB and E-Box specific transcrip tion factors after 12 hours of TNFtreatment. ChIP was performed with antibodies to IgG and A) ATF2 or c-Jun, B) p65, or C) USF1 or US F2. Association of these factors was analyzed by real-tim e PCR at the cPLA2 enhancer/promoter as well as a nonspecific region of the cPLA2 3UTR. In addition to IgG, a no-antibody (noAb) control was also evaluated. Data points are represented as means +/SEM (n = 3) and signifies p 0.05 as compared to the respective untreated control. 107

PAGE 108

Figure 4 4 -16. ChIP o A ssociat enhance addition are repr e compar e o f RNA Pol ion of RN A r/promoter to IgG, a n o e sented as e d to the re s 108 ymerase II A Pol II was as well as o -antibody means +/s pective 0 m within one analyzed b a nonspec i (noAb) co n SEM (n = 3 m in time p o hour of T N b y real-tim e i fic region o n trol was al s 3 ) and si g o int. N Fstimul a e PCR at th o f the cPL A s o evaluat e g nifies p 0 a tion. e cPLA2 A 2 3UTR. I e d. Data p o 0 .05 as I n o ints

PAGE 109

109 Figure 4 4 -17. ChIP o these fa c enhance addition are repr e compar e o f p65 and c tors was a r/promoter to IgG, a n o e sented as e d to the re s p50 within a nalyzed b y as well as o -antibody means +/s pective 0 m one hour o y real-time P a nonspec i (noAb) co n SEM (n = 3 m in time p o o f TNFst i P CR at the i fic region o n trol was al s 3 ) and si g o int. i mulation. A cPLA2 o f the cPL A s o evaluat e g nifies p 0 A ssociation A 2 3UTR. I e d. Data p o 0 .05 as of I n o ints

PAGE 110

Figure 4 4 -18. ChIP o was ana l nonspec (noAb) c SEM (n = point. o f USF1 wi l yzed by re ific region o ontrol was = 3) and s 110 thin one h o al-time PC R o f the cPL A also evalu a s ignifies p o ur of TNFR at the c P A 2 3UTR. a ted. Data p 0.05 as c o stimulati o P L A 2 enha n In addition p oints are r o mpared t o o n. Associ a n cer/prom o to IgG, a n r epresente d o the respe c a tion of US F o ter as well o-antibody d as mean s c tive 0 min F 1 as a s +/time

PAGE 111

111 Figure 4 4 -19. ChIP o A ssociat enhance addition are repr e o f ATF-2 a n ion of thes e r/promoter to IgG, a n o e sented as n d c-Jun w i e factors w a as well as o -antibody means +/i thin two h o a s analyze d a nonspec i (noAb) co n SEM (n = 3 o urs of TN F d by real-ti m i fic region o n trol was al s 3 ). F stimula t m e PCR at o f the cPL A s o evaluat e t ion. the cPLA2 A 2 3UTR. I e d. Data p o I n o ints

PAGE 112

112 Figure 4 4 -20. Effect the cPL A hGH co n analyze d no trans c control. D p 0.05 of overex p A 2 enhanc e n struct as w d by real-ti m c ription fac t D ata point s as compa r p ression of w e r/promote w ell as the i n m e RT-PC R t or control ( s are repre s r ed to their w ild-type t r r S9 cells w n dicated tr a R and the r e ( no TF). C y s ented as m respective r anscriptio n w ere trans f a nscription e sulting da t y clophilin A m eans +/S controls. n factors on f ected with factors, h G t a were no r was used a S EM (n = 3 ) the activit y the -114/-1 G H levels w r malized to a s a loadin ) and sign y of w ere the g ifies

PAGE 113

113 Figure 4 4 -21. Effect factors o transfec t negative ATF-2, A were an a to the n o loading c signifies relative t of overex p o n the activi t ed with th e transcripti o A -ATF2; C) a lyzed by r e o transcripti o c ontrol. Da t p 0.05 a s o the fold i n p ression of ty of the c P e -114/-1 h G o n factors a DN for p6 5 e al-time R T o n factor c o t a points ar e s compare d n duction of dominant n P L A 2 enh a G H constru c a s follows: A 5 TA; D) D T -PCR and o ntrol (noT F e represen t d to the unt r the noTF m n egative (D a ncer/prom o c t as well a A ) DN for c D N for US F the resulti n F ). Cyclop h t ed as me a r eated noT m easurem e N) forms o f o te r S9 ce l a s the indic a c -Jun, Tam 6 F 1/2, A -US F n g data we r h ilin A was a ns +/SE M F while si e nts. f transcripti l ls were a ted domin 6 7; B) DN f F hGH lev e r e normaliz used as a M (n = 3) a n gnifies p on ant f or e ls ed n d 0.05

PAGE 114

114 Figure 4 4 -22. Effect of the c P hGH co n analyze d no trans c control. D p 0.05 of co-over e P L A 2 enha n struct as w d by real-ti m c ription fac t D ata point s as compa r e xpression ncer/prom o w ell as the i n m e RT-PC R t or control ( s are repre s r ed to the r e of wild-typ o te r S9 cel n dicated tr a R and the r e ( no TF). C y s ented as m e spective t r e transcrip t ls were tra n a nscription e sulting da t y clophilin A m eans +/S r anscriptio n t ion factors n sfected w i factors, h G t a were no r was used a S EM (n = 3 ) n factor alo n on the act i i th the -11 4 G H levels w r malized to a s a loadin ) and sign n e. i vity 4 /-1 w ere the g ifies

PAGE 115

CHAPTER 5 INDUCTION OF CPLA2 GAMMA BY EXPOSURE TO EXTRACELLULAR DNA Potential Pathways for a Transcrip tional Response to Extracellular DNA There are several DNA sensing pathways t hat exist in non-immune cells. Most of these pathways rely on DNA being taken into a cell and recognized by an internal receptor. One of the better studi ed receptors is Toll-like recept or 9 (TLR9). This receptor exists endosomally and recognizes unmethyla ted CG dinucleotides on DNA that has been endocytosed. The optimal human consensus sequence for this intracellular endosomal receptor has been identified as GTCGTT by stimulation of an 6xNFB promoter construct in H EK-293 cells stably expressing human or mouse TLR9 [177]. Although this data is the basis for many TL R9 related studies, this information is still disputed and it is not clear whether the observed effects are purely due to the DNA sequence or the fact that the DNA us ed for these studies had a synthetic phosphorothioated backbone [178, 179]. Upon acti vation, TLR9 signals through MyD88 and TNF-receptor associated fact ors (TRAFs) to activate NFB and interferon regulatory factors, IRFs, result ing in the activation of type I interferons. Although TLR9 is the only known endosomal DNA sensor, many cytosolic DNA sensing pathways have been recently identified. The AIM2 inflammasome was characteriz ed in 2009, is composed of the caspase1-activating adaptor protein ASC, and is also referred to as a pyroptosome due to the requirement of an active pyrin domain within the interferon-inducible AIM2 [180, 181]. Activation of the AIM2 infla mmasome by cytosolic DNA resu lts in the activation of caspase-1, which cleaves pro-IL-1 and pro-IL-18 into the active forms of IL-1 and IL18, respectively. This results in proinflamma tory programmed cell death similar to that of 115

PAGE 116

apoptosis; this method of cell death is caspase-1-dependent and referred to as pyroptosis [182]. Newly designated DAI, formerly known as DLM-1 or ZBP1, was first identified in 1999, but in 2007, the Taniguchi lab defined t he cytosolic DNA sensing properties of this gene [183, 184]. Activation of DAI initiate s a signaling cascade through TRAF family member-associated NFB kinase, or TBK1. As with TLR9, the end result of the activation of DAI is the activation of type I interferons. The RNA sensor RIG-I has also been contro versially referred to as a DNA sensor, but recent studies have attempted to explain away this controversy. The new models implicating RIG-I as a DNA s ensor are focused around the fact that RNA Polymerase III has long been known to exist in the cyt oplasm for unknown reasons [185]. It was recently found that cytosolic RNA Pol III ca n transcribe cytosolic DNA, and the resulting small RNAs can be recognized by RIG-I RNA s ensing domains [186]. Due to the lack of other RNA processing enzymes in the cytosol, the RNA transcribed by cytosolic RNA Pol III contains a 5 triphosphate, which is a requirement for IFN-stimulating RNA as well as detection by RIG-I. Results Induction of cPLA2 Following Plasmid Transfection During the course of attempting to ov erexpress transcription factors in the regulation studies detaile d in Chapter 4, it wa s found that endogenous cPLA2 mRNA levels were elevated even in the presence of empty plasmid vectors. This observation led to the hypothesis that plasmid trans fection was capable of inducing the cPLA2 gene. To test this hypothesis, S9 cells were transfected with pcDNA3.1 for 24, 48 or 72 hours. After the indicated am ount of time, total RNA was collected and used to assay 116

PAGE 117

cPLA2 mRNA levels by real-time RT-PCR. As shown in Figure 5-1, the cPLA2 message is elevated 48 hours post-transfection. A single TNFtreatment was performed as a positive control for cPLA2 induction. None of the transfection reagents tested (FuGene, HiPerFECT, or Lipofecta mine) were capable of inducing cPLA2 expression in the absence of tran sfected DNA (data not shown). Effect of InterferonStimulating DNA on cPLA2 Expression One of the primary ways in which forei gn DNA is recognized by the cell is by pattern recognition receptors. Of these, Toll-like receptor 9 (TLR9) is capable of recognizing unmethylated CGs. The comm only used oligodeoxynucleotide (ODN) used to stimulate human TLR9 is referred to as ODN-2006, which contains the human specific recognition sequence flanking the CG dinucleotide. Therefore, this ODN was used to determine if cPLA2 was being induced via a TLR9-dependent pathway. Due to the ability of cells to rapidly degrade small linear DNA fragm ents, ODN-2006 was constructed with both a normal phosphodiester backbone (PO-2006) as well as a more stable phosphorothioated backbo ne (PS-2006). For negative controls, each of these ODNs were also constructed with each of the CGs replaced with GCs. As shown in Figure 5-2A, none of these ODNs were capable of stimulating cPLA2 in S9 cells as determined by real-time RT-PCR. It would stand to reason that an immune cell would be more responsive to foreign DNA and that a stronger response could be elicited from such cells. Unfortunately, neither muri ne monocytes, J774, nor human monocytes, THP-1, responded to the ODNs with an increase in cPLA2 expression (Figure 5-2B,C). Although the sequence used is human-specific, mice still respond, albeit to a lesser extent. 117

PAGE 118

Finally, HEK293s were utilized due to the fa ct that they have been established to respond to this treatment. In addition, many researchers in the TLR9 field have employed an HEK293 cell line stably expressing TLR9 wh ich has been clearly shown to demonstrate the involvement of this DNA receptor [187]. As with the previously tested cells, neither parental HEK293 cell line or the TLR9 over expressing cells seemed to induce cPLA2 in response to the TLR9 specific sequences (Figure 5-3). In order to verify that the previously observed phenomenon was not specific to the S9 cell line, HEK293 cells were also transient ly transfected. Within this experiment, the cells were also treated with FuGENE alone to determine if perhaps the aforementioned response was simply due to the presence of the transfection reagent. Figure 5-3 shows that the effect seen in S9 cells is not ce ll specific and that HEK293 cells can respond similarly to transiently transfected plasmid DNA. Inclusion of the wild-type HEK293 as well as the HEK293 cells stabl y expressing TLR9 strongly impl ies that this observation is not based on TLR9 since the plasmid sequ ence contains multiple CG dinucleotides which are identical to the human TLR9 recognition sequence. Implication of the RNA Sensing Pathway in Transfection-Dependent cPLA2 Induction RIG-I and MDA5 have long been considered cytosolic RNA sensors with a questionable tie to cytosolic DNA sensing [1 88, 189]. In 2009, it was reported by two groups that this elusive connection was via transcription of cytosolic DNA to RNA by RNA Polymerase III [186, 190]. To determine if this novel sensing pathway was involved, S9 cells were transfected with the pcDNA3.1 plasmid and mRNA levels were assayed by real-time RT-PCR. As shown in Figure 5-4, both RIG-I and MDA5 were induced nine and eight fold, respectively, in response to transfection. Additionally, the 118

PAGE 119

prominent downstream target of this pathway is transcription of IFN therefore, the levels of this gene were also analyzed. The nearly 1500 fold induction of IFN confirms that this pathway is indeed intact in these cells. Interestingly, a transcriptional regulator of IFN IRF7, was not found to be induced at t he mRNA level despite this transcription factor being regulated at the mRNA level [191]. The next st ep in this pathway is binding of IFN to cell surface receptors to activate IF N-specific genes such as Mx1. Hence, levels of this IFN target gene were also analyzed by real-time RT-PCR and, as shown in Figure 5-4, it was also induced by 35 fold. The data compiled in Figure 5-4 firmly supports the function of the ent irety of this particular DNA-s ensing pathways in S9 cells. IFN -Independence of Transcriptional Activation Having established the RIG-I/MDA5 pathway as being both responsive and functional in these cells, it was next determined whether this was the pathway responsible for cPLA2 activation in response to plasmid transfection. The obvious mode of action for this pathway would be to induce genes via IFN Therefore, S9 cells were treated with IFN at both low (10 U/mL) and high (1000 U/mL) concentrations with TNFbeing used as a positive control for cPLA2 gene induction. As shown in Figure 5-5A, IFN has no effect on cPLA2 levels even at (1000 U/mL). A positive control for IFN treatment, Mx1, was included in Figure 5-5B. The data for Mx1 confirms that these cells did in fact respond to IFN treatment in a dose-dep endent manner. These results imply that the activation of cPLA2 by transient transfection is occurring concomitantly with the induction of IFN or secondarily by another activated pathway. 119

PAGE 120

Defining the Specific Stimulus Involved in the DNA-Dependent Induction of cPLA2 Within the realm of cytosolic DNA and RNA sensors, some specific stimuli exist. One such compound is an activator of the RIGand MDA5 pathways and is a synthetic RNA, poly(I:C), constructed by annealing a st rand of polyinositol to polycytidine. Therefore, HFL-1 cells were treated with poly(I:C) as well as IFN As shown in Figure 5-6, poly(I:C) is incapable of inducing cPLA2 in these cells, however, the RIG-I is also not induced. Therefore, studies with poly(I:C ) will require additional experimentation to unravel the role of the RNA sensing pat hway in response to extracellular DNA. Additionally, HFL-1 cells were transfect ed with bacterial and mammalian DNA from E. coli and genomic DNA isolated from HFL-1 cells. Bacterial DNA appears to induce RIG-I in these cells (~13 fold) without affecting cPLA2 expression while mammalian DNA seems to only modestly (2 fold) induce both cPLA2 and RIG-I. To determine the specificity of the response to extracellular DNA, the effects on the other prominent cPLA2 family member, cPLA2 were investigated. To identify potentially broader effect on cPLA2 inducibility, another time course was performed and cPLA2 was analyzed alongside cPLA2 As observed before, cPLA2 is induced 4-5 old at the mRNA level in response to transfected plasmid DNA, and is also induced two fold in response to bacterial or mammalian genomic DNA (Figure 5-7). Most significantly, cPLA2 is not affected by transfection of plasmid, bacterial or mammalian DNA, implying that cPLA2 may be a dominant phospholipase in this unique inflammatory response. Having confirmed that plasmid transfecti on is the most potent DNA inducer of cPLA2 and that this response also induces IFN it was possible that priming the cells 120

PAGE 121

with a pretreat ment of IFN would elicit a more potent response to transfected plasmid DNA. In order to test this hypothesi s, S9 cells were treated with IFN for 12 hours prior to transfection with plasmid DNA and collected 24, 48 or 72 hours after DNA transfection. As illustrated in Fi gure 5-8, pretr eatment with IFN did not enhance the cPLA2 induction seen by plasmid transfection. At this point, it has been identified that cPLA2 can respond uniquely to extracellular DNA without the central involvement of IFN Therefore future studies are necessary to complete the understanding and physiological relevance of this response. Discussion These DNA sensing pathways provide a gr eat deal of variety for recognition of foreign DNA in cells. The data pr esented here demonstrate that cPLA2 mRNA levels are elevated in response to DNA in a TLR9 and IFN -independent response. It has also been shown here that transient transfection concomitantly i nduces the RIG-I and MDA5 pathways leading to production of IFN and a subsequent autocrine response to the newly secreted IFN confirmed by elevated levels of Mx1. These results indicate that cPLA2 may be induced directly by a DNA sensing pathway such as RIG-I, MDA5 or DAI, while it does not rule out the possibility that the observed induction is due to a secondary response, for example, to the se cretion of a different type I interferon. Although these data demonstrat e that transfection of pl asmid DNA definitively activates the RIG-I pathway as well as IFN it does not rule out the DAI or even AIM2 pathways. Potential future directions regarding these studies are described in more detail in Chapter 6. In summary, the AIM2 DAI and RIG-I pathways are still considered possible pathways for cPLA2 gene induction by cytosolic DNA. Irrespective of the exact 121

PAGE 122

mechanism of cPLA2 induction observed here, it is clear that cPLA2 has as of yet undiscovered roles in this response. 122

PAGE 123

123 Figure 5 5 -1. Endog e Cells we with pcD prior to c cPLA2 l control. D e nous cPL A re treated w NA3.1. Tr a c ollection o f e vels by re D ata point s A 2 expres s w ith TNFa nsfected c e f RNA. Tot a al-time RT s are repre s s ion in S9 c as a positi v e lls were a l a l RNA wa s PCR com p s ented as m c ells transf e v e control o l lowed to r e s collected a p ared to cy c m eans +/S e cted with p o r transien t e st for 24, 4 a nd used t o c lophilin A S EM (n = 3 ) p cDNA3.1. t ly transfec t 4 8, or 72 h o o measure as an inter n ) t ed o urs n al

PAGE 124

124 Figure 5 5 -2. Endog e stimulati n monocyt were tre a analyze d expressi o (TLR9+) contains backbon similar t o GC. Cell expressi o real-tim e e nous cPL A n g oligonu c es (J774A. a ted with i n d by real-ti m o n of TLR 9 has also b a phosph o e; 2006 co n o 2006 alth o s were als o o n. Total R e RT-PCR c A 2 expres s c leotides. A 1), C) hum a n dicated oli g m e RT-PC R 9 (TLR9-) w een utilize d o diester ba c n tains the h o ugh all of t o treated w i R NA was c o c ompared t o s ion in indi c A ) Broncho e a n monoc y g onucleoti d R Wild-typ e w hile an HE K d Oligonuc c kbone; P S h uman TL R t he CG din i th TNF as o llected an d o cyclophili c ated cell li n e pithelial c e y tes (THP-1 d es and cP L e HEK293 c K 293 cell li leotides ar e S contains a R 9 recogniti ucleotides a positive c d used to m n A as an i n es expos e e lls (S9), B ) ), or D) H E LA 2 expre c ells contai n ne overex p e labeled a a stable ph on sequen c have been c ontrol for c easure cP L nternal co n e d to interf e ) murine E K293 cells ssion was n minimal p ressing T L s follows: P osphorothi o c e; GC is replaced w c PL A 2 LA 2 levels n trol. e ronL R9 P O, o ate w ith by

PAGE 125

125 Figure 5 5 -3. cPLA2 2006 in H cells co n overexp r transfec t (pcDNA ) measur e internal c induction b H EK293 c e n tain minim a r essing TL R t ion reagen or expos e e cPL A 2 le v c ontrol. b y transfec e lls with an d a l expressi o R 9 (TLR9+ ) t alone (Fu e d to PS-2 0 v els by rea tion reage n d without T L o n of TLR 9 ) has also b GENE), tr a 0 06. Total R l-time RTP n t alone, tr a L R9 expre s 9 (TLR9-) w b een utilize d a nsiently tr a R NA was c o P CR comp a a nsfected p s sion. Wild w hile an HE K d Cells w e a nsfected w o llected an d a red to cycl p lasmid, or P type HEK 2 K 293 cell li e re treated w w ith plasmi d d used to ophilin A a s P S2 93 ne w ith d s an

PAGE 126

126 Figure 5 5 -4. Expres s to plasm used to m to cyclo p s ion of gen id transfec t m easure th p hilin A as a es associa t ion in S9 c e indicated a n internal c ted with th e c ells. Total R genes lev e c ontrol an d e RNA sen s R NA was c e ls by reald graphed o s ing pathw a ollected fr o time RT-P C o n a logarit h a y in respo o m S9 cells C R compa r h mic scale. nse and r ed

PAGE 127

127 Figure 5 5 -5. cPLA2 cells we r with IFN collecte d time RT included expressio n r e untreate d at two dif f d and used PCR com p as a positi v n in S9 cell d (control 1 f erent con c to measur e p ared to cy c v e control f s following or control c entrations e A) cPLA2 c lophilin A a f or IFN tr e treatment w 2), treated as indicat e or B) Mx 1 a s an inter n e atment. w ith TNFwith TNFe d. Total R N 1 mRNA le v n al control. or IFN. S or treate d N A was v els by real Mx1 is S 9 d

PAGE 128

128 Figure 5 5 -6. Real-ti m treatme n transfec t of E. coli Total R N analyze d m e RT-PC R n ts. HFL-1 c t ion reagen or mamm a N A was coll e d compare d R analysis o c ells were t t for 24 ho u a lian geno m e cted and c d to cyclop h o f cPL A 2 a t reated wit h u rs, or cell s m ic DNA is o c PL A 2 or R h ilin A as a n a nd RIG-I i n h TNF, IF s were tran s o lated from R IG-I, a cy t n internal c o n HFL-1 ce l N poly(I: C s fected wit h HFL-1 cel l t osolic RN A o ntrol. l ls with vari C ) or FuG E h 6 or 10 g l s for 24 h o A sensor, w ous E NE g /mL o urs. ere

PAGE 129

Figure 5 5 -7. Real-ti m DNA tre a with pcD amount s real-tim e as an int m e RT-PC R a tments in S NA, E. coli s of time. F o e RT-PCR a ernal contr o R analysis o S 9 cells. S 9 DNA, or m o llowing tre a nalysis of c o l. 129 o f cPL A 2 a 9 cells wer e m ammalian atment, tot c PL A 2 an d a nd cPL A 2 e treated w (HFL) DN A al RNA wa s d cPL A 2 c in respon s ith TNFo A for the in d s collected ompared t o s e to vario u o r transfect e d icated and used f o cyclophili n u s e d f or n A

PAGE 130

Figure 5 5 -8. Real-ti m transfec t IFN for of time. F after the cyclophil m e RT-PC R t ed with pc D 4 hours pr i F ollowing t r indicated a in A as an R analysis o D NA. S9 c e i or to trans f r ansfection a mounts of internal co n 130 o f cPL A 2 i n e lls were u n f ected with cells wer e time for a n n trol. n S9 cells p n treated (c o pcDNA3.1 e given fres n alysis of c P p rimed wit h o ntrol) or tr e for the indi h media a n P L A 2 com p h IFN and e ated TNF cated amo n d collecte d p ared to or unts d

PAGE 131

CHAPTER 6 FUTURE DIRECTIONS Role of cPLA2 in the Inflammatory Response Although the data in Chapter 3 imply t hat the 15-LO pathway may be associated with cPLA2 gene induction, the downstream effects of this genes induction is unclear. Previously published data have not thoroughly investigated any possible connection to 15-LO, but they have implied that cPLA2 leads to downstream production of prostaglandins, specifically PGE2 [56]. These uncertainties leave open the possibility that cPLA2 may be contributing to the resolution phase of inflammation or to the acute phase. Due to this lack of understanding, it still needs to be determined whether the function of this gene is benefic ial or harmful to the organism in the context of the inflammatory response. In order to fully analyze t he downstream effects of cPLA2, complete knockdown of the gene must be obtained, ideally through the generation of a cPLA2 knockout mouse line. At the ti me of writing, cPLA2 knockout mice are in the final stages of production by the Knockout Mouse Project (KOMP, current progress available at www.sanger.ac.uk/htgt/report/proj ect_gene_report?project_id=40524 ). Utilizing cells derived from knockout mice alongside the a parental control cell line, prostanoid and leukotriene synthesis must be measured. T hese two cell lines should be analyzed in the absence and presence of TNFto stimulate endogenous gene transcription, along with low and high serum levels, 1% and 10% to effe ct enzymatic activity [49]. Enzyme-linked immunoassays (ELISAs) can then be performed to identify the relative abundances of released downstream eicosanoid produc ts. If it is determined that cPLA2 has a positive influence on anti-inflammatory eicosanoid produc ts, such as lipoxins, then increasing 131

PAGE 132

cPLA2 activity relative to other phospholipases may prove to be beneficial in controlling inflammation. If the opposite is found to be true, then methods of inhibition of cPLA2 need to be determined, potentially utilizing knowledge of how the cPLA2 is transcriptionally regulated. Figure 4-2 demonstrated that cPLA2 mRNA induction observed in Chapter 3 was not a direct response to Aspergillus fumigatus in lung epithelial cells. It remains likely that immune cells that have responded to the Af extract secrete a cytokine, likely TNF, which is responsible for the induction of cPLA2 mRNA seen in epithelial cells. Currently, studies are being pursued in coll aboration with Dr. Shannon Wallet at the University of Florida to determine the cytok ine or cytokines being produced by mouse alveolar macrophages which is eliciting the response seen in parenchymal cells. Therapeutic Control of Inflammation by Regulating the Expression of cPLA2 In order to determine the impact that this gene has on the inflammatory cascade and inflammation in general, cPLA2 needs to be studied in an animal model. Because a mouse model of allergic asthma has alre ady been established, it would be reasonable to use this model as the starting point. Ei ther knockout mice would be utilized (when available), or mice would be treated with inhaled siRNA specific to cPLA2. In order to induce allergic asthma and an inflammato ry response, mice would be similarly sensitized and challenged with Af and indicators of inflammation would be measured as before [70]. Based on the dow nstream mediators that hav e been determined by ELISAs in the previously described experiments, either an exacerbati on or ablation of inflammation would be expected when cPLA2 is knocked down or absent from the lungs of these mice. The results of such a study would demonstr ate the impact that 132

PAGE 133

cPLA2 has on the inflammatory cascade and thus define the direction to take to utilize induction or repression of cPLA2 for potential therapies targeting inflammation. The Role of cPLA2 at the Phospholipid Membrane Although attempts have been made to determine specificity of cPLA2 for both head-groups and acyl chains of phospholipids, all of these experiments have been performed in in vitro assays which do not recapitulate the endogenous environment of the cPLA2 protein [48, 59]. In order to gain a true understanding of the role that this enzyme has on membrane composition, and perhaps membrane remodeling, phospholipid content would have to be anal yzed in the presence and absence of endogenous cPLA2 activity in whole cells. It has previously been shown that specific phospholipid species can be identified by MALDI IMS (matrix-assisted laser desorption/ionization imaging mass spectr ometry) and their distribution can be determined in several day old mouse embryos [192]. Knowing the precise phospholipid species and how their relative abundances are affected by cPLA2 expression would provide the most accurate representation of both head-group and acyl chain specificity to date. Additionally, if this imaging can be refined to visualize molecules on subcellular levels, then local changes in phospholipid species could be determined, this would serve to codify which membranes cPLA2 acts upon, whether it is endoplasmic reticulum, Golgi, mitochondrial membranes, or, in the case of mouse oocytes, the nuclear envelope. Role of cPLA2 in the Innate Immune Response The studies provided here are preliminary in regards to identifying the role that cPLA2 plays as a target of the DNA sensing pathway. This is a critical pathway in the innate response to DNA based viruses and is present in all cell types. Upon infection, 133

PAGE 134

viral DNA is released into the cytoplasm whic h is then sensed by this part of the innate immune response. In order to determine if cPLA2 is involved in a physiological response upon infection with a DNA virus, collaboration will be pu rsued with Dr. David Bloom at the University of Florida. Curr ently, he has offered mouse brain tissue from mice that have been infected with HSV, a DNA based virus. The possibility still exists that the response seen by the induction of cPLA2 could be due to other type I interferons, su ch as any of the various IFN subtypes. In order to eliminate some of the re maining pathways from the possible causes of cPLA2 gene induction, an RNA Polymerase III inhibitor, such as ML-60218, will be employed. If treatment with such an inhibitor blocks cPLA2 induction upon plasmid transfection, then the DAI and AIM2 pathways can be eliminated since an RNA Pol III inhibitor would not affect the direct sensors of DNA. Al though no interferon-sensitive response element (ISRE) was found within 2 kb upor downstream of the cPLA2 start site by in silico analysis, identification of such a si te would be useful for codifying cPLA2 as a primary response to cytosolic DNA and not a secondary response to something such an IFN Additionally, the AIM2 pathway needs to be investigated further because IL-1 is a prominent end-product of this response, and, as shown in Figure 4-2, IL-1 is an inducer of cPLA2. This pathway can be eliminated or codified by treatment with an IL1 receptor antagonist or IL-1 antibodies to prevent a po ssible autocrine response of IL-1 following DNA transfection. Also, inhibitors or siRNA can be used to specifically inhibit these pathways, while other antibodies or receptor antagonists can be used to analyze potential autocrine responses if cPLA2 is a secondary product of cytosolic134

PAGE 135

135 DNA sensing. Regardless of the pr ecise method of induction of cPLA2, it is clear that this gene may have roles in the inflammatory response as a first-responder to infection.

PAGE 136

LIST OF REFERENCES 1 Lagarde, M., Gualde, N. and Rigaud, M. (1989) Metabolic interactions between eicosanoids in blood and vascular cells. Biochem J. 257 313-320 2 Derksen, A. and Cohen, P. (1975) Patterns of fa tty acid release from endogenous substrates by human platel et homogenates and membranes. J Biol Chem. 250 9342-9347 3 Serhan, C. N., Hamberg, M. and Samuelss on, B. (1984) Lipoxins: novel series of biologically active compounds formed from arachidonic acid in human leukocytes. Proc Natl Acad Sci U S A. 81, 5335-5339 4 Bratt, J. and Gyllenhammar, H. (1995) The role of ni tric oxide in lipoxin A4induced polymorphonuclear neutrophil-dependent cytotoxic ity to human vascular endothelium in vitro. Arthritis Rheum. 38, 768-776 5 Dahlen, S. E., Raud, J., Serhan, C. N., Bjork, J. and Samuelsson, B. (1987) Biological activities of lipoxin A incl ude lung strip contraction and dilation of arterioles in vivo. Acta Physiol Scand. 130 643-647 6 Serhan, C. N. (1997) Lipoxi ns and novel aspirin-trigger ed 15-epi-lipoxins (ATL): a jungle of cell-cell interactions or a therapeutic opportunity? Prostaglandins. 53, 107-137 7 Samuelsson, B. (1978) Prostaglandins and thromboxanes. Recent Prog Horm Res. 34, 239-258 8 Vane, J. R., Bakhle, Y. S. and Botting, R. M. (1998) Cycl ooxygenases 1 and 2. Annu Rev Pharmacol Toxicol. 38, 97-120 9 Eguchi, N., Minami, T., Shirafuji, N ., Kanaoka, Y., Tanaka, T., Nagata, A., Yoshida, N., Urade, Y., Ito, S. and Ha yaishi, O. (1999) Lack of tactile pain (allodynia) in lipocalin-type prostaglandin D synthase-deficient mice. Proc Natl Acad Sci U S A. 96, 726-730 10 Robinson, C., Hardy, C. C. and Holgate, S. T. (1985) Pulmonary synthesis, release, and metabolism of prosta glandins. J Allergy Clin Immunol. 76, 265-271 11 Chung, K. F. (2005) Evaluation of selective prostaglandin E2 (PGE2) receptor agonists as therapeutic agents for the treatment of asthma. Sci STKE. 2005 pe47 136

PAGE 137

12 Utsonomiya, T., Krausz, M. M., Levine, L., Shepro, D. and Hechtman, H. B. (1982) Thromboxane mediation of cardi opulmonary effects of embolism. J Clin Invest. 70, 361-368 13 Drazen, J. M., Austen, K. F., Lewis, R. A., Clark, D. A ., Goto, G., Marfat, A. and Corey, E. J. (1980) Comparative airway and vascular activities of leukotrienes C1 and D in vivo and in vitro. Proc Natl Acad Sci U S A. 77, 4354-4358 14 Nakamura, Y., Hoshino, M. Sim, J. J., Ishii, K., Hosaka, K. and Sakamoto, T. (1998) Effect of the leukotriene rec eptor antagonist pranlukast on cellular infiltration in the bronchial mucosa of patients with asthma. Thorax. 53, 835-841 15 Taylor, I. K., O'Shaughnessy, K. M., Fuller, R. W. and Dollery, C. T. (1991) Effect of cysteinyl-leukotriene receptor antagonist ICI 204.219 on allergen-induced bronchoconstriction and airway hyperreac tivity in atopic subjects. Lancet. 337 690-694 16 Klein, A., Talvani, A., Cara, D. C., Gome s, K. L., Lukacs, N. W. and Teixeira, M. M. (2000) Stem cell fa ctor plays a major role in the recruitment of eosinophils in allergic pleurisy in mice via the production of leukotriene B4. J Immunol. 164 4271-4276 17 Leff, A. R. (2001) The biology of leuk otrienes, eosinophils, cytokines and nitric oxide in airway inflammation. Clinica l & Experimental Allergy Reviews. 1 133136 18 Levy, B. D., De Sanctis, G. T., Devchand, P. R., Kim, E., Ackerman, K., Schmidt, B. A., Szczeklik, W., Drazen, J. M. and Serhan, C. N. (2002) Multi-pronged inhibition of airway hyper-responsiveness and inflammation by lipoxin A(4). Nat Med. 8 1018-1023 19 Jones, T. R., Labelle, M., Belley, M., Cham pion, E., Charette, L., Evans, J., FordHutchinson, A. W., Gauthier, J. Y., Lord, A., Masson, P. and et al. (1995) Pharmacology of montelukast sodium (Singulair), a potent and selective leukotriene D4 receptor antagoni st. Can J Physiol Pharmacol. 73, 191-201 20 Kemp, J. P. (2003) Recent advances in the management of asthma using leukotriene modifiers. Am J Respir Med. 2 139-156 21 Collins, X. H., Harmon, S. D., Kaduce, T. L., Berst, K. B., Fang, X., Moore, S. A., Raju, T. V., Falck, J. R., Weintraub, N. L. Duester, G., Plapp, B. V. and Spector, A. A. (2005) Omega-oxidati on of 20-hydroxyeicosatetraenoic acid (20-HETE) in cerebral microvascular smooth muscle and endothelium by alcohol dehydrogenase 4. J Biol Chem. 280 33157-33164 137

PAGE 138

22 Shirasaka, M., Takayama, B., Sekiguchi M., Konno, S. and Kikuchi, S. (2008) Vasodilative effects of prostaglandin E1 derivate on arteries of nerve roots in a canine model of a chronically comp ressed cauda equina. BMC Musculoskelet Disord. 9 41 23 Boyce, J. A. (2008) Eicosanoids in as thma, allergic inflammation, and host defense. Curr Mol Med. 8 335-349 24 Sugiyama, M., Ohtani, K., Izuhara, M., Koike, T., Suzuki, K., Imamura, S. and Misaki, H. (2002) A novel prokaryotic phos pholipase A2. Characterization, gene cloning, and solution structure. J Biol Chem. 277 20051-20058 25 Six, D. A. and Dennis, E. A. (2000) The expanding su perfamily of phospholipase A(2) enzymes: classification and char acterization. Biochim Biophys Acta. 1488 1-19 26 Dennis, E. A. (1997) The growing phospholipase A2 supe rfamily of signal transduction enzymes. Trends Biochem Sci. 22, 1-2 27 Stephens, J. W. W. and My ers, W. (1898) The acti on of cobra poison on the blood: A contribution to the study of passi ve immunity. The Journal of Pathology and Bacteriology. 5 279-301 28 Gelb, M. H., Valentin, E., Ghomashchi, F., Lazdunski, M. and Lambeau, G. (2000) Cloning and recombinant expression of a structurally novel human secreted phospholipase A2. J Biol Chem. 275 39823-39826 29 Dennis, E. A. (1994) Diversity of group types, regulation, and function of phospholipase A2. J Biol Chem. 269 13057-13060 30 Cho, W. (2000) Structur e, function, and regulati on of group V phospholipase A(2). Biochim Biophys Acta. 1488 48-58 31 Balsinde, J. (2002) Roles of vari ous phospholipases A2 in providing lysophospholipid acceptors for fatty acid phospholipid incorporation and remodelling. Biochem J. 364 695-702 32 Beers, S. A., Buckland, A. G., Koduri, R. S., Cho, W., Gelb, M. H. and Wilton, D. C. (2002) The antibacterial properties of secreted phospholipases A2: a major physiological role for the group IIA enzym e that depends on the very high pI of the enzyme to allow penetration of the bacterial cell wall. J Biol Chem. 277 1788-1793 138

PAGE 139

33 Sartipy, P., Johansen, B., Camejo, G ., Rosengren, B., B ondjers, G. and HurtCamejo, E. (1996) Binding of human phosphol ipase A2 type II to proteoglycans. Differential effect of glycosaminoglyc ans on enzyme activity. J Biol Chem. 271 26307-26314 34 Jenkins, C. M., Wolf, M. J., Mancuso, D. J. and Gross, R. W. (2001) Identification of the calmodulin-binding domain of recombinant calcium-independent phospholipase A2beta. implications for structure and function. J Biol Chem. 276 7129-7135 35 Schaloske, R. H. and Dennis, E. A. (2006) The phospholipase A2 superfamily and its group numbering system Biochim Biophys Acta. 1761 1246-1259 36 Ghosh, M., Tucker, D. E., Burchett, S. A. and Leslie, C. C. (2006) Properties of the Group IV phospholipase A(2) family. Prog Lipid Res. 45, 487-510 37 Ohto, T., Uozumi, N., Hir abayashi, T. and Shimizu, T. (2005) Identification of novel cytosolic phospholipas e A(2)s, murine cPLA(2){de lta}, {epsilon}, and {zeta}, which form a gene cluster with cPLA(2){beta}. J Biol Chem. 280 24576-24583 38 Underwood, K. W., Song, C., Kriz, R. W., Chang, X. J., Knopf, J. L. and Lin, L. L. (1998) A novel calcium-independent phospholipase A2, cPLA2-gamma, that is prenylated and contains homolog y to cPLA2. J Biol Chem. 273 21926-21932 39 Lucas, K. K. and Dennis, E. A. (20 04) The ABC's of Group IV cytosolic phospholipase A2. Biochim Biophys Acta. 1636 213-218 40 Clark, J. D., Milona, N. and Knopf, J. L. (1990) Purification of a 110-kilodalton cytosolic phospholipase A2 from the human monocytic ce ll line U937. Proc Natl Acad Sci U S A. 87, 7708-7712 41 Sharp, J. D., White, D. L., Chiou, X. G., Goodson, T., Gamboa, G. C., McClure, D., Burgett, S., Hoskins, J., Skatrud, P. L., Sportsman, J. R. and et al. (1991) Molecular cloning and expression of human Ca(2+)-sensitive cytosolic phospholipase A2. J Biol Chem. 266 14850-14853 42 Pickard, R. T., Strifler, B. A., Kramer, R. M. and Shar p, J. D. (1999) Molecular cloning of two new human paralogs of 85kDa cytosolic phospholipase A2. J Biol Chem. 274 8823-8831 139

PAGE 140

43 Chiba, H., Michibata, H ., Wakimoto, K., Seishima, M. Kawasaki, S., Okubo, K., Mitsui, H., Torii, H. and Imai, Y. (2004) Cloning of a gene for a novel epitheliumspecific cytosolic phospholipase A2, cPLA2 delta, induced in psoriatic skin. J Biol Chem. 279 12890-12897 44 Hirabayashi, T., Murayama, T. and Shim izu, T. (2004) Regulatory mechanism and physiological role of cytosolic phospholipase A2. Biol Pharm Bull. 27, 11681173 45 Lindbom, J., Ljungman, A. G., Lindahl, M. and Tagesson, C. (2001) Expression of members of the phospholipase A2 fam ily of enzymes in human nasal mucosa. Eur Respir J. 18, 130-138 46 Lindbom, J., Ljungman, A. G., Lindahl, M. and Tagesson, C. (2002) Increased gene expression of novel cytosolic and se cretory phospholipase A(2) types in human airway epithelial cells induced by tumor necrosis factor-alpha and IFNgamma. J Interferon Cytokine Res. 22, 947-955 47 Stewart, A., Ghosh, M., Spencer, D. M. and Leslie, C. C. (2002) Enzymatic properties of human cytosolic phospholipase A(2)gamma. J Biol Chem. 277 29526-29536 48 Asai, K., Hirabayashi, T., Houjou, T., Uozumi, N., Taguchi, R. and Shimizu, T. (2003) Human group IVC phospholipase A2 (cPLA2gamma). Roles in the membrane remodeling and activation induced by oxidative stress. J Biol Chem. 278 8809-8814 49 Murakami, M., Masuda, S. and Kudo, I. (2003) Arachidonate release and prostaglandin production by group IVC phospholipase A2 (cytosolic phospholipase A2gamma). Biochem J. 372 695-702 50 Jenkins, C. M., Han, X., Yang, J., Mancus o, D. J., Sims, H. F., Muslin, A. J. and Gross, R. W. (2003) Purification of recombinant human cPLA2 gamma and identification of C-terminal farnesyl ation, proteolytic processing, and carboxymethylation by MALDI-TOF-TOF analysis. Biochemistry. 42 1179811807 51 Tucker, D. E., Stewart, A., Nallan, L., Bendale, P., Gh omashchi, F., Gelb, M. H. and Leslie, C. C. (2005) Group IVC cytosolic phospholipase A2gamma is farnesylated and palmitoylated in mammalian cells. J Lipid Res. 46 2122-2133 140

PAGE 141

52 Yamashita, A., Kamata, R., Kawagishi, N ., Nakanishi, H., Suzu ki, H., Sugiura, T. and Waku, K. (2005) Roles of C-terminal processing, and involvement in transacylation reaction of human group IVC phospholipase A2 (cPLA2gamma). J Biochem (Tokyo). 137 557-567 53 Mancuso, P., Gottschalk, A ., Phare, S. M., Peters-Gol den, M., Lukacs, N. W. and Huffnagle, G. B. (2002) Leptin-deficient mice exhibit impaired host defense in gram-negative pneumonia. Journal of Immunology. 168 4018-4024 54 Mancuso, P., Canetti, C., Gottschalk, A., Tithof, P. K. and Peters-Golden, M. (2004) Leptin augments alveolar macrophage leukotriene synthesis by increasing phospholipase activity and enhancing group IVC iPLA2 (cPLA2gamma) protein expression. Am J Physiol Lung Cell Mol Physiol. 287 L497-502 55 Vitale, A., Perlin, J., Leonel li, L., Herr, J., Wright, P ., Digilio, L. and Coonrod, S. (2005) Mouse cPLA2gamma, a nove l oocyte and early embryo-abundant phospholipase A2 gamma-like protein, is ta rgeted to the nuclear envelope during germinal vesicle breakdown. Dev Biol. 282 374-384 56 Tithof, P. K., Roberts, M. P., Guan, W. Elgayyar, M. and G odkin, J. D. (2007) Distinct phospholipase A2 enzymes r egulate prostaglandin E2 and F2alpha production by bovine endometrial epithel ial cells. Reprod Biol Endocrin. 5 57 Brown, J. K., Knight, P. A., Thornton, E. M., Pate, J. A., Coonrod S., Miller, H. R. and Pemberton, A. D. (2008) Trichinella spiralis induces de novo expression of group IVC phospholipase A2 in the intest inal epithelium. Int J Parasitol. 38, 143147 58 Steenwinckel, V., Louahed, J., Lemaire, M. M., Sommereyns, C., Warnier, G., McKenzie, A., Brombacher, F., Van Snick, J. and Renauld, J. C. (2009) IL-9 promotes IL-13-dependent panet h cell hyperplasia and up-regulation of innate immunity mediators in intestinal mucosa. Journal of Immunology. 182 4737-4743 59 Yamashita, A., Tanaka, K., Kamata, R. Kumazawa, T., Suzu ki, N., Koga, H., Waku, K. and Sugiura, T. ( 2009) Subcellular localization and lysophospholipase/transacylation activiti es of human group IVC phospholipase A2 (cPLA2gamma). Biochim Biophys Acta. 1791 1011-1022 60 Tao, R., Yu, Y., Zhang, X., G uo, Y., Shi, J., Xie, L., Li u, S., Ju, G., Xu, Q., Shen, Y. and Wei, J. (2005) Cytosolic PLA2 genes possibly contribute to the etiology of schizophrenia. Am J Med Genet B Neuropsychiatr Genet. 137B, 56-58 141

PAGE 142

61 Tao, R., Yu, Y., Zhang, X., Shi, J., Guo, Y., Wang, C., Han, B., Xu, Q., Shang, H., Xie, L., Liu, S., Ju, G., Shen, Y. and Wei, J. ( 2005) A family based study of the genetic association between t he PLA2G4D gene and schizophrenia. Prostaglandins Leukot Essent Fatty Acids. 73, 419-422 62 Wei, J. and Hemmings, G. P. (2005) A study of the combined effect of the CLDN5 locus and the genes for the phospholipid metabolism pathway in schizophrenia. Prostaglandins Le ukot Essent Fatty Acids. 73, 441-445 63 Yu, Y., Tao, R., Shi, J., Zhang, X., Kou, C., Guo, Y., Lin, X., Liu, S., Ju, G., Xu, Q., Shang, H., Shen, Y. and Wei, J. (2005) A genetic study of two calciumindependent cytosolic PLA2 genes in schizophrenia. Prostaglandins Leukot Essent Fatty Acids. 73, 351-354 64 Hartmann, C., Johnk, L., Sasaki, H., Jenk ins, R. B. and Louis, D. N. (2002) Novel PLA2G4C polymorphism as a molecular diagnostic assay for 19q loss in human gliomas. Brain Pathol. 12, 178-182 65 Mariani, L., Deiana, G., Vassella, E., Fathi, A., Murtin, C., Arnold, M., Vajtai, I., Weis, J., Reinert, M. and Seiler, R. W. (2006) Loss of heterozygosity 1p36 and 19q13 is a prognostic factor for overall surv ival in patients with diffuse who grade II gliomas treated without chemotherapy. Neuro-Oncology. 8 336-336 66 George, A. A., Sharma, M. Singh, B. N., Sahoo, N. C. and Rao, K. V. (2006) Transcription regulation from a TATA and INR-less promoter: sp atial segregation of promoter function. EMBO J. 25, 811-821 67 Blackwood, E. M. and Kadonaga, J. T. (1998) Going the distance: a current view of enhancer action. Science. 281 60-63 68 Bulger, M. and Groudine, M. (1999) Looping versus linking: toward a model for long-distance gene activation. Genes Dev. 13, 2465-2477 69 Dorsett, D. (1999) Distant liaisons: l ong-range enhancer-promoter interactions in Drosophila. Curr Opin Genet Dev. 9 505-514 70 Muller, C., Braag, S. A., He rlihy, J. D., Wasserfall, C. H., Chesrown, S. E., Nick, H. S., Atkinson, M. A. and Flotte, T. R. (2006) Enhanced IgE allergic response to Aspergillus fumigatus in CFTR-/mice. Lab Invest. 86, 130-140 71 Chomczynski, P. and Sacchi, N. (1987) Single-step met hod of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162 156-159 142

PAGE 143

72 Church, G. M. and Gilbert, W. (1984) Genomic sequencing. Proc Natl Acad Sci U S A. 81, 1991-1995 73 Livak, K. J. and Schmittgen, T. D. ( 2001) Analysis of relative gene expression data using real-time quantit ative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25 402-408 74 Saito, H., Bourinbaiar, A., Ginsburg, M., Minato, K., Cere si, E., Yamada, K., Machover, D., Breard, J. and Mat he, G. (1985) Establishment and characterization of a new human eosin ophilic leukemia cell line. Blood. 66, 12331240 75 Tsuchiya, S., Yamabe, M., Yamaguchi, Y., Kobayashi, Y., Konno, T. and Tada, K. (1980) Establishment and characteri zation of a human acute monocytic leukemia cell line (THP-1). Int J Cancer. 26, 171-176 76 Horwitz, A. L., Hance, A. J. and Crystal, R. G. (1 977) Granulocyte collagenase: selective digestion of type I relative to ty pe III collagen. Proc Natl Acad Sci U S A. 74, 897-901 77 Egan, M., Flotte, T., Afi one, S., Solow, R., Zeitlin, P. L., Carter, B. J. and Guggino, W. B. (1992) Defect ive regulation of outwardly rectifying Clchannels by protein kinase A corrected by insertion of CFTR. Nature. 358 581-584 78 Flotte, T. R., Solow, R., Owens, R. A., Af ione, S., Zeitlin, P. L. and Carter, B. J. (1992) Gene expression from adeno-associat ed virus vectors in airway epithelial cells. Am J Respir Cell Mol Biol. 7 349-356 79 Ralph, P., Prichard, J. and Cohn, M. ( 1975) Reticulum cell sarcoma: an effector cell in antibody-dependent cell-mediated immunity. J Immunol. 114 898-905 80 Selden, R. F., Howie, K. B., Rowe, M. E., Goodman, H. M. and Moore, D. D. (1986) Human growth hormone as a reporter gene in regulation studies employing transient gene ex pression. Mol Cell Biol. 6 3173-3179 81 Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K ., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J. and Klenk, D. C. (1985) Measurement of pr otein using bicinchoninic acid. Anal Biochem. 150 7685 82 Brown, P. H., Alani, R., Preis, L. H., Szabo, E. and Birre r, M. J. (1993) Suppression of oncogene-induced transformati on by a deletion mutant of c-jun. Oncogene. 8 877-886 143

PAGE 144

83 Duyndam, M. C., van Dam, H., Smits, P. H., Verlaan, M., van der Eb, A. J. and Zantema, A. (1999) The N-te rminal transactivation domain of ATF2 is a target for the co-operative activation of the c-jun promoter by p300 and 12S E1A. Oncogene. 18, 2311-2321 84 Ahn, S., Olive, M., Aggarwal, S., Krylov D., Ginty, D. D. and Vinson, C. (1998) A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol. 18, 967-977 85 Crusselle-Davis, V. J., Vieira, K. F., Zhou, Z., Anantharaman, A. and Bungert, J. (2006) Antagonistic regulatio n of beta-globin gene expre ssion by helix-loop-helix proteins USF and TFII-I. Mol Cell Biol. 26, 6832-6843 86 Qyang, Y., Luo, X., Lu, T., Ismail, P. M., Krylov, D., Vinson, C. and Sawadogo, M. (1999) Cell-type-dependent activity of the ubiquitou s transcription factor USF in cellular proliferation and transcr iptional activation. Mol Cell Biol. 19, 1508-1517 87 Humbert, M., Menz, G., Ying, S., Corrigan, C. J., Robinson, D. S., Durham, S. R. and Kay, A. B. (1999) The immunopathology of extrinsic (atopic) and intrinsic (non-atopic) asthma: more similariti es than differences. Immunol Today. 20, 528533 88 Wills-Karp, M., Luyimbazi, J. Xu, X., Schofield, B., Neben, T. Y., Karp, C. L. and Donaldson, D. D. (1998) In terleukin-13: central mediator of allergic asthma. Science. 282 2258-2261 89 Holgate, S. T. (2004) Cytokine and anti-cytokine therapy for the treatment of asthma and allergic disease. Cytokine. 28, 152-157 90 Bradding, P., Roberts, J. A., Britten, K. M., Montefort, S., Dj ukanovic, R., Mueller, R., Heusser, C. H., Howarth, P. H. and Holgate, S. T. (1994) Interleukin-4, -5, and -6 and tumor necrosis factor-alpha in normal and asthmatic airways: evidence for the human mast cell as a s ource of these cytokines. Am J Respir Cell Mol Biol. 10, 471-480 91 Sousa, A., Pfister, R., Christie, P. E., Lane, S. J. Nasser, S. M., SchmitzSchumann, M. and Lee, T. H. (1997) Enhanced expression of cyclo-oxygenase isoenzyme 2 (COX-2) in asthmatic airways and its cellular distribution in aspirinsensitive asthma. Thorax. 52, 940-945 92 Wenzel, S. E., Westcott, J. Y. and Lars en, G. L. (1991) Br onchoalveolar lavage fluid mediator levels 5 minutes after allergen challenge in atopic subjects with asthma: relationship to the development of late asthmatic responses. J Allergy Clin Immunol. 87, 540-548 144

PAGE 145

93 Serhan, C. N. (2002) Lipoxins and aspirin-triggered 15epi-lipoxin biosynthesis: an update and role in anti-inflammation and pro-resolution. Prostaglandins Other Lipid Mediat. 68-69 433-455 94 Bousquet, J., Chanez, P., Lacoste, J. Y., Barneon, G., Ghav anian, N., Enander, I., Venge, P., Ahlstedt, S., Simony-Lafont aine, J., Godard, P. and et al. (1990) Eosinophilic inflammation in asthma. N Engl J Med. 323 1033-1039 95 Burrows, B., Martinez, F. D., Halonen, M. Barbee, R. A. and Cl ine, M. G. (1989) Association of asthma with se rum IgE levels and skin-test reactivity to allergens. N Engl J Med. 320 271-277 96 Tada, T., Takemori, T., Okumura, K., Nonaka, M. and Tokuhisa, T. (1978) Two distinct types of helper T cells involved in the secondary antibody response: independent and synergistic effects of Ia and Ia+ helper T cells. J Exp Med. 147 446-458 97 Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A. and Coffman, R. L. (1986) Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol. 136 2348-2357 98 Feghali, C. A. and Wright, T. M. (1997) Cytokines in acute and chronic inflammation. Front Biosci. 2 d12-26 99 Ito, S., Ansari, P., Sakatsume, M., Di ckensheets, H., Vazquez, N., Donnelly, R. P., Larner, A. C. and Finbloom, D. S. (1999) Interleukin10 inhibits expression of both interferon alphaand interferon gammainduced genes by suppressing tyrosine phosphorylation of STAT1. Blood. 93, 1456-1463 100 Dinarello, C. A. (1992) Interleukin-1 and tumor necrosis factor: effector cytokines in autoimmune diseases. Semin Immunol. 4 133-145 101 Kapsenberg, M. L., Jansen, H. M., Bos, J. D. and Wierenga, E. A. (1992) Role of type 1 and type 2 T helper cells in allergic diseases. Curr Opin Immunol. 4 788793 102 Heller, A., Koch, T., Sc hmeck, J. and van Ackern, K. (1998) Lipid mediators in inflammatory disorders. Drugs. 55 487-496 103 Serhan, C. N., Yacoubian, S. and Y ang, R. (2008) Anti-inflammatory and proresolving lipid mediators. Annu Rev Pathol. 3 279-312 145

PAGE 146

104 Diaz, B. L. and Arm, J. P. (2003) Phospholipase A(2). Prostaglandins Leukot Essent Fatty Acids. 69, 87-97 105 Panini, S. R., Yang, L., Rusinol, A. E., Sinensky, M. S., Bonventre, J. V. and Leslie, C. C. (2001) Ar achidonate metabolism and the signaling pathway of induction of apoptosis by oxidiz ed LDL/oxysterol. J Lipid Res. 42, 1678-1686 106 Taketo, M. M. and Sonoshita, M. (2002) Phospolipase A2 and apoptosis. Biochim Biophys Acta. 1585 72-76 107 Barbour, S. E., Kapur, A. and De al, C. L. (1999) Regulation of phosphatidylcholine homeostasis by calcium-independent phospholipase A2. Biochim Biophys Acta. 1439 77-88 108 Egan, K. and FitzGerald, G. A. (2006) Eicosanoids and the vascular endothelium. Handb Exp Pharmacol, 189-211 109 Virnig, C. and Bush, R. K. (2007) Allergic bronchopulmonary aspergillosis: a US perspective. Curr Opin Pulm Med. 13, 67-71 110 Tillie-Leblond, I. and Tonnel, A. B. (2005) Allergic bronchopulmonary aspergillosis. Allergy. 60, 1004-1013 111 Zander, D. S. (2005) Allergic bronchopul monary aspergillosis: an overview. Arch Pathol Lab Med. 129 924-928 112 Hogaboam, C. M., Blease, K. and Schuh, J. M. (2003) Cytokines and chemokines in allergic bronchopulmonary aspergillosis (ABPA) and experimental Aspergillus-induced allergic airway or asthmatic disease. Front Biosci. 8 e147156 113 Hogaboam, C. M., Carpent er, K. J., Schuh, J. M. and Buckland, K. F. (2005) Aspergillus and asthma--any link? Med Mycol. 43 Suppl 1 S197-202 114 Peters-Golden, M. and Henderson, W. R ., Jr. (2007) Leukotrienes. N Engl J Med. 357 1841-1854 115 Smith, M. J., Ford-Hutchinson, A. W. and Bray, M. A. (1980) Leukotriene B: a potential mediator of infla mmation. J Pharm Pharmacol. 32, 517-518 116 Montuschi, P. (2008) L eukotrienes, antileukotrienes and asthma. Mini Rev Med Chem. 8 647-656 146

PAGE 147

117 Polosa, R. (2007) Critical apprai sal of antileukotriene use in asthma management. Curr Opin Pulm Med. 13, 24-30 118 Kumar, R. K. and Foster, P. S. (2002) Modeling allergic asthma in mice: pitfalls and opportunities. Am J Respir Cell Mol Biol. 27, 267-272 119 Shinagawa, K. and Kojima, M. (2003) Mouse model of ai rway remodeling: strain differences. Am J Respir Crit Care Med. 168 959-967 120 Peters-Golden, M. and Brock, T. G. (2003) 5-lipoxygenase and FLAP. Prostaglandins Leukot Essent Fatty Acids. 69, 99-109 121 Murphy, R. C. and Gijon, M. A. (2007) Biosynthesis and metabolism of leukotrienes. Biochem J. 405 379-395 122 Furstenberger, G., Krieg, P., Muller-Decker, K. and Hab enicht, A. J. (2006) What are cyclooxygenases and lipoxygenases doing in the driver's seat of carcinogenesis? Int J Cancer. 119 2247-2254 123 Kuhn, H. and Thiele, B. J. (1999) The diversity of the lipoxygenase family. Many sequence data but little information on bi ological significance. FEBS Lett. 449 711 124 Yoshimoto, T. and Takahashi, Y. (2002) Arachidonate 12-lipoxygenases. Prostaglandins Ot her Lipid Mediat. 68-69 245-262 125 Siebert, M., Krieg, P., Lehmann, W. D., Marks, F. and Furstenberger, G. (2001) Enzymic characterization of epidermi s-derived 12-lipoxygenase isoenzymes. Biochem J. 355 97-104 126 Ashoor, G., Masse, M., Garcia Luciano, L. M., Sheffer, R ., Martinez-Mir, A., Christiano, A. M. and Zlot ogorski, A. (2006) A novel mutation in the 12(R)lipoxygenase (ALOX12B) gene underlies no nbullous congenital ichthyosiform erythroderma. Br J Dermatol. 155 198-200 127 Kelavkar, U. P., Parwani, A. V., S happell, S. B. and Ma rtin, W. D. (2006) Conditional expression of human 15-lipoxygenase-1 in mouse prostate induces prostatic intraepithelial neoplasia: t he FLiMP mouse model. Neoplasia. 8 510522 128 Schweiger, D., Furstenberger, G. and Krieg, P. (2007) Inducible expression of 15-lipoxygenase-2 and 8-lipoxygenase inhi bits cell growth via common signaling pathways. J Lipid Res. 48, 553-564 147

PAGE 148

129 Sun, D., Elsea, S. H., Patel, P. I. and Funk, C. D. (1998) Cloning of a human "epidermal-type" 12-lipoxygenase-relat ed gene and chromosomal localization to 17p13. Cytogenet Cell Genet. 81, 79-82 130 Huang, J. T., Welch, J. S., Ricote, M. Binder, C. J., Willson, T. M., Kelly, C., Witztum, J. L., Funk, C. D., Conrad, D. and Glass, C. K. (1999) Interleukin-4dependent production of PPAR-gamma ligands in macrophages by 12/15lipoxygenase. Nature. 400 378-382 131 Triggiani, M., Granata, F., Giannattasio, G. and Marone, G. (2005) Secretory phospholipases A2 in inflammatory and a llergic diseases: not just enzymes. J Allergy Clin Immunol. 116 1000-1006 132 Uozumi, N., Kume, K., Nagase, T., Nakat ani, N., Ishii, S., Ta shiro, F., Komagata, Y., Maki, K., Ikuta, K., Ou chi, Y., Miyazaki, J. and Sh imizu, T. (1997) Role of cytosolic phospholipase A2 in allerg ic response and parturition. Nature. 390 618622 133 Dolan-O'Keefe, M., Chow, V., Monnier, J., Visner, G. A. and Nic k, H. S. (2000) Transcriptional regulation and structural organization of the human cytosolic phospholipase A(2) gene. Am J Physiol Lung Cell Mol Physiol. 278 L649-657 134 Park, G. Y. and Christman, J. W. (2006) Involvement of cyclooxygenase-2 and prostaglandins in the mo lecular pathogenesis of infla mmatory lung diseases. Am J Physiol Lung Cell Mol Physiol. 290 L797-805 135 Maurya, V., Gugnani, H. C., Sarma, P. U., Madan, T. and Shah, A. (2005) Sensitization to Aspergillus ant igens and occurrence of allergic bronchopulmonary aspergillosis in patients with asthma. Chest. 127 1252-1259 136 Kasaian, M. T. and Miller, D. K. (2 008) IL-13 as a therapeutic target for respiratory disease. Biochem Pharmacol 137 Conrad, D. J. and Lu, M. (2000) Regulation of human 12/15-lipoxygenase by Stat6-dependent transcription. Am J Respir Cell Mol Biol. 22, 226-234 138 Andersson, C. K., Claesson, H. E., Rydell-Tormanen, K., Swedmark, S., Hallgren, A. and Erjefalt, J. S. (2008) Mice Lacking 12/15-Lipoxygenase have Attenuated Airway Allergic Inflammation and Remodeling. Am J Respir Cell Mol Biol 148

PAGE 149

139 Chu, H. W., Balzar, S., We stcott, J. Y., Trudeau, J. B., Sun, Y., Conrad, D. J. and Wenzel, S. E. (2002) Expression and acti vation of 15-lipoxygenase pathway in severe asthma: relationship to eosinop hilic phenotype and collagen deposition. Clin Exp Allergy. 32, 1558-1565 140 Nasser, S. M. and Lee, T. H. (2002) Products of 15-lipoxygenase: are they important in asthm a? Clin Exp Allergy. 32, 1540-1542 141 Oldham, M. L., Brash, A. R. and Newcomer, M. E. ( 2005) Insights from the X-ray crystal structure of coral 8R-lipoxy genase: calcium activation via a C2-like domain and a structural basis of product chirality. J Biol Chem. 280 3954539552 142 Tang, D. G., Bhatia, B., Tang, S. and Schneider-Brou ssard, R. (2007) 15lipoxygenase 2 (15-LOX2) is a functional tumor suppressor that regulates human prostate epithelial cell differentia tion, senescence, and growth (size). Prostaglandins Ot her Lipid Mediat. 82, 135-146 143 Subbarayan, V., Krieg, P., Hsi, L. C., Kim, J., Yang, P., Sabichi, A. L., Llansa, N., Mendoza, G., Logothetis, C. J., Newman, R. A., Lippman, S. M. and Menter, D. G. (2006) 15-Lipoxygenase-2 gene regulation by its product 15-(S)hydroxyeicosatetraenoic acid through a negative feedback mechanism that involves peroxisome proliferator-a ctivated receptor gamma. Oncogene. 25, 60156025 144 Limor, R., Kaplan, M., S haron, O., Knoll, E., Naidich, M., Weisinger, G., Keidar, S. and Stern, N. (2009) Aldoster one up-regulates 12and 15-lipoxygenase expression and LDL oxidation in human vascular smooth muscle cells. J Cell Biochem. 108 1203-1210 145 Kelavkar, U., Glasgow, W. and Eling, T. E. (2002) The effect of 15-lipoxygenase1 expression on cancer cells. Curr Urol Rep. 3 207-214 146 Parkinson, J. F. (2006) Lipoxin and synthetic lipoxin analogs: an overview of antiinflammatory functions and new concepts in immunomodulation. Inflamm Allergy Drug Targets. 5 91-106 147 Serhan, C. N. (2005) Li poxins and aspirin-triggered 15-epi-lipoxins are the first lipid mediators of endogenous anti-inflammation and resolution. Prostaglandins Leukot Essent Fatty Acids. 73, 141-162 148 Gijon, M. A., Spencer, D. M. and Lesli e, C. C. (2000) Recent advances in the regulation of cytosolic phosphol ipase A(2). Adv Enzyme Regul. 40, 255-268 149

PAGE 150

149 Nakae, S., Lunderius, C., Ho, L. H., Schaf er, B., Tsai, M. and Galli, S. J. (2007) TNF can contribute to multiple feat ures of ovalbumin-induced allergic inflammation of the airways in mice. J Allergy Clin Immunol. 119 680-686 150 Vandenabeele, P., Declercq, W., Beyaer t, R. and Fiers, W. (1995) Two tumour necrosis factor receptors: struct ure and function. Trends Cell Biol. 5 392-399 151 Baud, V. and Karin, M. (2001) Signal tr ansduction by tumor necrosis factor and its relatives. Trends Cell Biol. 11, 372-377 152 Hibi, M., Lin, A., Smeal, T., Minden, A. and Karin, M. (1993) Identification of an oncoproteinand UV-responsive protein kina se that binds and potentiates the cJun activation domain. Genes Dev. 7 2135-2148 153 Raingeaud, J., Gupta, S., Rogers, J. S., Dickens, M., Han, J., Ulevitch, R. J. and Davis, R. J. (1995) Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem. 270 7420-7426 154 Brenner, D. A., O'Hara, M., Angel, P., Chojkier, M. and Karin, M. (1989) Prolonged activation of jun and collagenase genes by tumour necrosis factoralpha. Nature. 337 661-663 155 Osborn, L., Kunkel, S. and Nabel, G. J. (1989) Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc Natl Acad Sci U S A. 86, 2336-2340 156 Panne, D. (2008) The enhanceoso me. Curr Opin Struct Biol. 18, 236-242 157 Tsai, E. Y., Jain, J., Pesavento, P. A ., Rao, A. and Goldfeld, A. E. (1996) Tumor necrosis factor alpha gene regulation in acti vated T cells involves ATF-2/Jun and NFATp. Mol Cell Biol. 16, 459-467 158 Seldeen, K. L., McDonald, C. B., Deegan, B. J. and Fa rooq, A. (2008) Evidence that the bZIP domains of the Jun transcr iption factor bind to DNA as monomers prior to folding and homodimeri zation. Arch Biochem Biophys. 480 75-84 159 Galibert, M. D., Bouconte t, L., Goding, C. R. and Meo, T. (1997) Recognition of the E-C4 element from the C4 comp lement gene promoter by the upstream stimulatory factor-1 tran scription factor. J Immunol. 159 6176-6183 150

PAGE 151

160 Sirito, M., Lin, Q., Maity, T. and Saw adogo, M. (1994) Ubiqui tous expression of the 43and 44-kDa forms of transcription factor USF in mammalian cells. Nucleic Acids Res. 22, 427-433 161 Aiken, K. J., Bickford, J. S., Kilberg, M. S. and Nick, H. S. (2008) Metabolic regulation of manganese super oxide dismutase expressi on via essential amino acid deprivation. J Biol Chem. 283 10252-10263 162 Gross, P. and Oelgeschlager, T. (2006) Core promoter-selective RNA polymerase II transcription. Biochem Soc Symp, 225-236 163 Kadonaga, J. T. (2002) The DPE, a core promoter element for transcription by RNA polymerase II. Exp Mol Med. 34, 259-264 164 Brinkman, B. M., Telliez, J. B., Schieve lla, A. R., Lin, L. L. and Goldfeld, A. E. (1999) Engagement of tumor necrosis factor (TNF) receptor 1 leads to ATF-2and p38 mitogen-activated protein kinase-dependent TNF-alpha gene expression. J Biol Chem. 274 30882-30886 165 Perkins, N. D. (2007) Integrating cellsignalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol. 8 49-62 166 Hayden, M. S. and Ghosh, S. (2008) S hared principles in NF-kappaB signaling. Cell. 132 344-362 167 Corre, S. and Galibert, M. D. (2005) Upstream stimulat ing factors: highly versatile stress-responsive transcription factors. Pigment Cell Res. 18, 337-348 168 Tews, B., Felsberg, J., Hartmann, C., Kunitz, A., Hahn, M., Toedt, G., Neben, K., Hummerich, L., von Deimling, A., Reif enberger, G. and Lichter, P. (2006) Identification of novel oligodendroglioma-associated candidate tumor suppressor genes in 1p36 and 19q13 using microarraybased expression profiling. Int J Cancer. 119 792-800 169 van Meer, G., Voelker, D. R. and Fe igenson, G. W. (2008) Membrane lipids: where they are and how they behave. Nat Rev Mol Cell Biol. 9 112-124 170 Li, X. Y. and Green, M. R. (1996) Intramolecular inhibition of activating transcription factor-2 function by its DNA-binding domain. Genes Dev. 10, 517527 151

PAGE 152

171 Wu, Y., Zhang, X. and Zehner, Z. E. (2003) c-Jun and the dominant-negative mutant, TAM67, induce vimentin gene expression by interacting with the activator Sp1. Oncogene. 22, 8891-8901 172 Crusselle-Davis, V. J., Zhou, Z., Anantharaman, A., Moghimi, B., Dodev, T., Huang, S. and Bungert, J. (2007) Recruitm ent of coregulator complexes to the beta-globin gene locus by TFII-I and ups tream stimulatory factor. FEBS J. 274 6065-6073 173 Huang, S., Li, X., Yusufz ai, T. M., Qiu, Y. and Fe lsenfeld, G. (2007) USF1 recruits histone modification complexes an d is critical for maintenance of a chromatin barrier. Mol Cell Biol. 27, 7991-8002 174 Kramer, B., Wiegmann, K. and Kronke, M. (1995) R egulation of the human TNF promoter by the transcription factor Ets. J Biol Chem. 270 6577-6583 175 Maniatis, T., Falvo, J. V ., Kim, T. H., Kim, T. K., Li n, C. H., Parekh, B. S. and Wathelet, M. G. (1998) Structure and function of the interferon-beta enhanceosome. Cold Spring Harb Symp Quant Biol. 63 609-620 176 Rhoades, K. L., Golub, S. H. and Economou J. S. (1992) The regulation of the human tumor necrosis factor alpha promoter region in macrophage, T cell, and B cell lines. J Biol Chem. 267 22102-22107 177 Bauer, S., Kirschning, C. J., Hacker, H., Redecke, V., Hausm ann, S., Akira, S., Wagner, H. and Lipford, G. B. (2001) Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG mo tif recognition. Proc Natl Acad Sci U S A. 98, 9237-9242 178 Roberts, T. L., Sweet, M. J., Hume, D. A. and Stacey, K. J. (2005) Cutting edge: species-specific TLR9-mediat ed recognition of CpG and non-CpG phosphorothioate-modified oligon ucleotides. J Immunol. 174 605-608 179 Gangloff, M. and Gay, N. J. (2008) Baseless assumptions: activation of TLR9 by DNA. Immunity. 28, 293-294 180 Fernandes-Alnemri, T., Yu, J. W., Datta P., Wu, J. and Alnemri, E. S. (2009) AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 458 509-513 152

PAGE 153

181 Rathinam, V. A., Jiang, Z., Waggoner, S. N., Sharma, S., Cole, L. E., Waggoner, L., Vanaja, S. K., Monks, B. G., Ganesan, S., Latz, E. Hornung, V., Vogel, S. N., Szomolanyi-Tsuda, E. and Fitzgerald, K. A. (2010) The AIM2 inflammasome is essential for host defense against cytosolic bacteria and DNA viruses. Nat Immunol. 11 395-402 182 Fernandes-Alnemri, T., Wu, J., Yu, J. W. Datta, P., Miller, B., Jankowski, W., Rosenberg, S., Zhang, J. and Alnemri, E. S. (2007) The pyroptosome: a supramolecular assembly of ASC dimers mediating inflammatory cell death via caspase-1 activation. Cell Death Differ. 14, 1590-1604 183 Fu, Y., Comella, N., Togna zzi, K., Brown, L. F., Dvor ak, H. F. and Kocher, O. (1999) Cloning of DLM-1, a novel gene th at is up-regulated in activated macrophages, using RNA diffe rential display. Gene. 240 157-163 184 Takaoka, A., Wang, Z., Choi, M. K., Yanai, H., Negishi, H., Ban, T., Lu, Y., Miyagishi, M., Kodama, T. Honda, K., Ohba, Y. and Taniguchi, T. (2007) DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature. 448 501-505 185 Jaehning, J. A. and Roeder, R. G. (1977) Transcription of specific adenovirus genes in isolated nuclei by exogenous RNA polymerases. J Biol Chem. 252 8753-8761 186 Chiu, Y. H., Macmillan, J. B. and Chen, Z. J. (2009) RNA polymerase III detects cytosolic DNA and induces type I interfer ons through the RIG-I pathway. Cell. 138 576-591 187 Latz, E., Schoenemeyer, A., Vi sintin, A., Fitzgerald, K. A ., Monks, B. G., Knetter, C. F., Lien, E., Nilsen, N. J., Espevik, T. and Golenbock, D. T. (2004) TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat Immunol. 5 190-198 188 Cheng, G., Zhong, J., Chung, J. and Chis ari, F. V. (2007) Double-stranded DNA and double-stranded RNA induce a common antiviral signaling pathway in human cells. Proc Na tl Acad Sci U S A. 104 9035-9040 189 Wang, F., Gao, X., Barrett, J. W., Shao, Q., Bartee, E., Mohamed, M. R., Rahman, M., Werden, S., Irvine, T., Cao, J., Dekaban, G. A. and McFadden, G. (2008) RIG-I mediates the co-induction of tumor necro sis factor and type I interferon elicited by myxoma viru s in primary human macrophages. PLoS Pathog. 4 e1000099 153

PAGE 154

154 190 Ablasser, A., Bauernfeind, F., Hartm ann, G., Latz, E., Fi tzgerald, K. A. and Hornung, V. (2009) RIGI-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-tran scribed RNA intermediate. Nat Immunol. 10, 1065-1072 191 Ning, S., Huye, L. E. and Pagano, J. S. (2005) Regulation of the transcriptional activity of the IRF7 promoter by a pathway independent of interferon signaling. J Biol Chem. 280 12262-12270 192 Burnum, K. E., Cornett, D. S., Puolitai val, S. M., Milne, S. B., Myers, D. S., Tranguch, S., Brown, H. A., Dey, S. K. and Caprioli, R. M. (2009) Spatial and temporal alterations of phospholipids determined by mass spectrometry during mouse embryo implantation. J Lipid Res. 50 2290-2298

PAGE 155

BIOGRAPHICAL SKETCH Justin was born to Alan and Cindy Bickford in South Florida in the winter of 1980. He grew up in the subtropi cal climate with an early intere st in science starting with paleontology, then progressing to marine biology. In high school, he followed every available avenue for science and theatre. While in college, Justin undertook various leadership positions and founded an improvisational theatre troupe and, in his senior year, he finally settled on pursuing a degree in chemistry while working as an engineer for BellSouth. After two su mmers as an engineer, he opted for a laboratory technician position in a research labor atory and found himself working for Dr. Amy Hearn in the laboratory of Dr. Harry Nick. Upon the realization that a Ph .D. program did not require a 30 mortgage on his education, he chose to pursue a research Ph.D. in biomedical science. 155