<%BANNER%>

Effect of Calcium on Peanut (arachis Hypogaea L.) Pod and Seed Development under Field Conditions

Permanent Link: http://ufdc.ufl.edu/UFE0042339/00001

Material Information

Title: Effect of Calcium on Peanut (arachis Hypogaea L.) Pod and Seed Development under Field Conditions
Physical Description: 1 online resource (81 p.)
Language: english
Creator: Pathak, Bhuvan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: bhuvan, calcium, cdpk, development, enzyme, field, fruit, gypsum, kinase, peanuts, pod, protein, seed, sensors, supplementation
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The effect of gypsum supplementation on peanut seed and pod development was studied for two varieties the field. Pod length was not affected by gypsum treatment. However, fewer two-segmented pods (P = 0.006), fewer pods with two seeds (P = 0.006), more immature or aborted distal seeds (P = 0.002), and more asynchronized fruit (P = 0.01) were observed in plots without gypsum applications. Non-treated gypsum plots at 100 and 130 DAP had the highest amount of aborted seeds (8%) and asynchronized fruits. The effect of gypsum onseed and fruit development was greater for C-99R than for Georgia Green. Additionally, subsamples were analyzed for their mineral composition (Ca, Mg, K, P, S,Fe, Zn, Mn, Cu, Ni, and Na). All nutrients, except Cu and Mn, had their highest concentrations in immature pods and seeds and these levels decreased as fruits matured. Gypsum application increased Ca and S concentrations of both pods and seeds, decreased Mg concentrations only in seeds, and decreased Na and P concentrations of both pods and seeds. Calcium concentrations were two times higher in pods compared to seeds. Georgia Green accumulated more Ca in pods and seeds than did C-99R. A linear increase in Ca concentration was observed in pods and seeds at the same physiological stages when sampled over time. Peanut seeds and pods also were analyzed for CDPK expression during their development in gypsum-treated and non-treated soils. In seeds, CDPK transcript and protein expression profiles were biphasic. High CDPK levels were observed in very immature seed stages and these levels dropped in immature stages, rose again to high levels in mature stages and then dropped significantly in very mature stages. In pods, CDPK transcript and protein levels were consistently high until the very mature stage when levels were significantly diminished. Seeds at all developmental stages showed 2- to 3-foldlower CDPK transcript and protein levels under gypsum treatment. Histolocalization data showeddecoration of immunoreactive CDPK primarily in the outer most cell layers of the pericarp and around vascular bundles, as well as in the single vascular trace that supplies nutrients to the developing ovule.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Bhuvan Pathak.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Gallo, Maria.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042339:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042339/00001

Material Information

Title: Effect of Calcium on Peanut (arachis Hypogaea L.) Pod and Seed Development under Field Conditions
Physical Description: 1 online resource (81 p.)
Language: english
Creator: Pathak, Bhuvan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: bhuvan, calcium, cdpk, development, enzyme, field, fruit, gypsum, kinase, peanuts, pod, protein, seed, sensors, supplementation
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The effect of gypsum supplementation on peanut seed and pod development was studied for two varieties the field. Pod length was not affected by gypsum treatment. However, fewer two-segmented pods (P = 0.006), fewer pods with two seeds (P = 0.006), more immature or aborted distal seeds (P = 0.002), and more asynchronized fruit (P = 0.01) were observed in plots without gypsum applications. Non-treated gypsum plots at 100 and 130 DAP had the highest amount of aborted seeds (8%) and asynchronized fruits. The effect of gypsum onseed and fruit development was greater for C-99R than for Georgia Green. Additionally, subsamples were analyzed for their mineral composition (Ca, Mg, K, P, S,Fe, Zn, Mn, Cu, Ni, and Na). All nutrients, except Cu and Mn, had their highest concentrations in immature pods and seeds and these levels decreased as fruits matured. Gypsum application increased Ca and S concentrations of both pods and seeds, decreased Mg concentrations only in seeds, and decreased Na and P concentrations of both pods and seeds. Calcium concentrations were two times higher in pods compared to seeds. Georgia Green accumulated more Ca in pods and seeds than did C-99R. A linear increase in Ca concentration was observed in pods and seeds at the same physiological stages when sampled over time. Peanut seeds and pods also were analyzed for CDPK expression during their development in gypsum-treated and non-treated soils. In seeds, CDPK transcript and protein expression profiles were biphasic. High CDPK levels were observed in very immature seed stages and these levels dropped in immature stages, rose again to high levels in mature stages and then dropped significantly in very mature stages. In pods, CDPK transcript and protein levels were consistently high until the very mature stage when levels were significantly diminished. Seeds at all developmental stages showed 2- to 3-foldlower CDPK transcript and protein levels under gypsum treatment. Histolocalization data showeddecoration of immunoreactive CDPK primarily in the outer most cell layers of the pericarp and around vascular bundles, as well as in the single vascular trace that supplies nutrients to the developing ovule.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Bhuvan Pathak.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Gallo, Maria.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042339:00001


This item has the following downloads:


Full Text

PAGE 1

1 EFFECT OF CALCIUM ON PEANUT ( Arachis hypogaea L.) POD AND SEED DEVELOPM E NT UNDER FIELD CONDITIONS By BHUVAN P. PATHAK A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Bhuvan P. Pathak

PAGE 3

3 To ParBrahmn, my parents, sister, advisor and beloved teachers Ashok Kumar Vishwakarma, Dali Varghese, Sanjay Jambhulkar and Tapas Chaudhuri

PAGE 4

4 ACKNOWLEDGMENTS I am greatly indebted to Dr. Maria Gallo, chairperson of my graduate supervisory c ommittee for her encouragement, moral support, inspiration, financial assistance, and expert guidance throughout this project I am also grateful to Dr. Barry Tillman, committee member, for his guidance in statistical analysis, as well as financial support. I would like to express my sincere gratitude to Dr Alice Harmon for her help with the CDPK experiments and membership on my committee. I w ould like to thank Dr Kenneth Boote and Dr. Cheryl Mackowiak for their support as members of my supervisory committee. I would like to thank Dr. Michael Grusak at Baylor College of Medicine, Houston, Texas, for his benevolent help in the analysis of calci um and other minerals. I am heartily thankful to my lab members Dr. Mukesh Jain, Dr. Victor i a Hurr, Dr. Yolanda Lopez, Dr. Sivananda Varma Tirumalaraju Dr. Sunil Joshi, Mike Petefish, Scott Burns, Steven Thornton, Fanchao Yi and Jeffery Seib for their friendship and kind and generous help during my work. I am also thankful to Justin McKinney and C.J. Boggs at the Plant Science Research and Education Unit, Citra, Florida for their help with the field work and James Colee, statistics consultant at the IFAS Statistics unit, University of Florida, Gainesville, Florida, for his help with statistical analyses. I am thankful to my friends Payal Nagwekar, Pratik Nagwekar, cute Ruhan, Hetal Kalariya, Shruti B. Seshadri, Roger A. Haring, Sharon Tan and Jasjit Kaur Deol for their constant moral support. I owe my deepest gratitude to my parents, my sister Dhruva, my fianc Samarth, Sumit, my mother in law and father in law, Shrirangbhai and Shivanibhabhi, and my lovely nephew Rudransh whose love, affection and support in all respect s has allowed me to finish my thesis

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................9 ABSTRACT ...................................................................................................................................10 CHAPTER 1 INTRODUCTION ..................................................................................................................12 Cultivated Peanut .............................................................................................................12 Peanut Reproduction and Calcium ..................................................................................12 2 LITERATURE REVIEW .......................................................................................................15 Peanut Geocarpy .....................................................................................................................15 The Peanut Flower ...........................................................................................................15 Pollination and Peg Initiation ..........................................................................................15 Fruit Initiation ..................................................................................................................16 Fruit Developmen t Classification ...........................................................................................16 Stage 1: Very Immature ...................................................................................................16 Stage 2: Immature ............................................................................................................17 Stage 3: Mature ................................................................................................................17 Stage 4: Very Mature .......................................................................................................18 Calcium Movement and Location in Peanut ..........................................................................18 Factors Affecting Calcium Availability, Concentration and Distribution in Peanut .......19 Interactions of Calcium (Gypsum) and Other Ions in Peanut .........................................20 Calcium as a Secondary Messenger .......................................................................................21 Functions of CDPKs ...............................................................................................................22 Responses to Stress Signals .............................................................................................23 Responses During Reproductive Development ...............................................................24 3 THE EFFECT OF CALCIUM ON DEVELOPING PEANUT ( Arachis hypogaea L.) SEEDS AND PODS IN THE FIELD .....................................................................................27 Introduction .............................................................................................................................27 Materials and Methods ...........................................................................................................28 Data Analysis ..........................................................................................................................29 Results .....................................................................................................................................30 Pod Length .......................................................................................................................30 Number of Pod Segments ................................................................................................30 Number of Seeds per Pod ................................................................................................30

PAGE 6

6 Proximal Seed ..................................................................................................................31 Distal Seed .......................................................................................................................31 Fruit Development ...........................................................................................................32 Discussion ...............................................................................................................................32 4 THE EFFECT OF GYPSUM APPLICATIONS ON THE ACCUMULATION OF MINERALS IN PEANUT ( Arachis hypogaea L.) PODS AND SEEDS ...............................41 Introduction .............................................................................................................................41 Materials and Methods ...........................................................................................................41 Macronutri ents and Micronutrients Analysis .........................................................................42 Results .....................................................................................................................................43 Gypsum Application Differences ....................................................................................43 Cultivar Differences ........................................................................................................44 Macro and Micronutrients During Fruit Development ...................................................45 Discussion ...............................................................................................................................45 5 THE EFFECT OF CALCIUM ON EXPRESSION AND LOCALIZATION OF CALCIUM DEPENDENT PROTEIN KINASES I N PEANUT FRUIT DEVELOPMENT ...................................................................................................................57 Introduction .............................................................................................................................57 Materials and Methods ...........................................................................................................59 Peanut Fru it Samples .......................................................................................................59 Total Protein Isolation .....................................................................................................59 SDS PAGE ......................................................................................................................59 CDPK Antibody ..............................................................................................................60 Western Blot ....................................................................................................................60 Total RNA Isolation ........................................................................................................61 First Strand cDNA Synthesis ...........................................................................................62 Quantitative RT PCR of CDPK ......................................................................................62 Immunolocalization of CDPK in Peanut Fruits ...............................................................63 Results .....................................................................................................................................63 Discussion ...............................................................................................................................64 6 CONCLUSION AND FUTURE RESEARCH ......................................................................72 LIST OF REFERENCES ...............................................................................................................73 BIOGRAPHICAL SKETCH .........................................................................................................81

PAGE 7

7 LIST OF TABLES Table page 31 Pod length at three stages of pod development for peanuts. ..............................................36 32 Pod length of two cultivars for peanuts .............................................................................36 33 Frequency percentage for number of pod segments and number of seeds/pod for gypsum treatments .............................................................................................................36 34 Frequency percentage for number of pod segments and number of seed/pod for two peanut cultivars ..................................................................................................................37 35 ANOVA probability value s determined for proximal and distal seeds .............................37 36 ANOVA probability values determined in the seed stages for position effect ..................37 37 Frequency percentage of proximal and distal seed developmental stages .........................38 38 Frequency percentage of proximal seed developmental stages determined for 70,100 and 130 days after planting (DAP) ....................................................................................38 39 Frequency percentage of distal developing stages for gypsum treatment.. .......................38 310 Frequency percentage of distal seed developmental stages determined for 70,100 and 130 days after planting (DAP). ..........................................................................................39 311 ANOVA probability values determined for developing peanut fruit. ...............................39 312 ANOVA probability values determined for asynchronized peanut fruit at various growth stages for. ...............................................................................................................39 313 Frequency percentage of asynchronized peanut fruit at diff erent growth stages determined for gypsum treatment ......................................................................................40 314 Frequency percentage of asynchronized fruit at different growth stages determined for two peanut cultivars .....................................................................................................40 41 ANOVA probability values for pod macronutrients. .........................................................48 42 ANOVA probability values for pod micronutrients .........................................................48 43 Mineral analysis of peanut pods for Ca, P and Zn for two peanut cultivars. .....................48 44 ANOVA probability values of seed macronutrients .........................................................48 45 ANOVA probability values for seed micronutrients. ........................................................49

PAGE 8

8 46 Mineral analysis of peanut seed for Ca, P and Z n for two peanut cultivars.. ....................49 47 Monthly average rainfall data for the 2007, 2008 and 2009 peanut growing seasons at Citra, FL.. .......................................................................................................................49 48 Ca and S content of pods and seeds at 70,100 and 130 DAP for peanuts .........................50 51 Primers for qRT PCR of CDPK and eEF1 at four stages of peanut fruit development ....69

PAGE 9

9 LIST OF FIG URES Fig ure page 21 Stages of peanut fruit development ....................................................................................26 41 Effect of gypsum treatment on pod nutrient composition. ................................................51 42 Effect of gypsum application on seed nutrient composition. .............................................52 43 Ca concentration of peanut pods at for four developmental stages sampled at 70,100 and 130 DAP ......................................................................................................................53 44 Ca concentration of peanut seeds at for four developmental stages sampled at 70,100 and 130 DAP. .....................................................................................................................54 45 Concentration of macronutrients in four stages of peanut pod and seed development.. ...55 46 Concentration of micronutrients in four stages of peanut pod and seed development.. ....56 51 CDPK expression in four seed developmental stages of cv. Georgia Green at 100 DAP ....................................................................................................................................70 52 CDPK expression in four pod developmental stages of cv. Georgia Green at 100 DAP ....................................................................................................................................71 53 CDPK immunolocalization in very immature fruit of CV. Georgia Green .......................71

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the R equirements for the Degree of Master of Science EFFECT OF CALCIUM ON PEANUT ( Arachis hypogaea L.) POD AND SEED DEVELOP ME NT UNDER FIELD CONDITIONS By Bhuvan P. Pathak December 2010 Chair: Maria Gallo Major: Agronomy The effect of gypsum supplementation on peanut seed and pod development was studied for two varieties the field. Pod length was not affected by gypsum treatment However, fewer two segmented pods (P = 0.006), fewer pods with two seeds (P = 0.006), more immature or aborted distal seeds (P = 0.002) and more asynchronized fruit (P = 0.01) w ere observed in plots without gypsum applications. Nontreated gypsum plots at 100 and 130 DAP had the highest amount of aborted seeds (8%) and asynchronized fruits. T he effect of gypsum onseed and fruit development was greater for C 99R than for Georgia Green. Additionally, subsamples were analyzed for their mineral composition ( Ca, Mg, K, P, S, Fe, Zn, Mn, Cu, Ni, and Na ). All nutrients except Cu and Mn had their highest concentrations in immature pods and seeds and these levels decreased as fruit s mat ured Gypsum application increased Ca and S conc entrations of both pods and seeds, decreased Mg concentrations only in seeds, and decreased Na and P concentrations of both pods and seeds Calcium concentrations were two times higher in pods compared to seeds. Georgia Green accumulated more Ca in pods and seeds than did C 99R. A linear increase in Ca concentration was observed in pods and seeds at the same physiological stages when sampled over time

PAGE 11

11 Peanut seeds and pods also were analyzed for CDPK expression during their development in gypsum treated and nontreated soils In seeds, CDPK transcript and protein expression profiles were biphasic. High CDPK levels were observed in very imma ture seed stages and these levels dropped in immature stages, rose again to high levels in mature stages and then dropped significantly in very mature stages. In pods, CDPK transcript and protein levels were consistently high until the very mature stage wh en levels were significantly diminished. S eeds at all developmental stages showed 2to 3foldlower CDPK transcript and protein levels under gypsum treatment. Histolocalization data showed decoration of immunoreactive CDPK primarily in the outer most cell layers of the pericarp and around vascular bundles, as well as in the single vascular trace that supplies nutrients to the developing ovule.

PAGE 12

12 CHAPTER 1 INTRODUCTION Cultivated Peanut Peanut or groundnut ( Arachis hypogaea L.) is one of the most widely cultivated oil seed crops. Its seed is used directly for food or as a source of oil It is produced primarily in India and China followed by the US Sixty five percent of the worlds peanut production is consumed by China, the US and India. In 2008 09, compared to a global total production of 34.3 million metric tons (Mmt), the US produced 2.34 Mmt of peanuts (USDA FAS 2010). Due to its low cost and good flavor, Americans eat approximately 1.7 billion lbs. of peanuts per year The seed has high nutrient content containing essential vitamins, folic acid, good fat s and high protein levels. Peanut Reproduction and Calcium Peanut reproduces via geo carpy, which is rare in the plant kingdom However, geocarpy is a characteristic of all Arachis species The underground developing fruits of peanut differ in a number of ways from those that develop aerially. First, peanut fruits are not photosyntheticall y active. Additionally, developing peanut fruits uptake nutrients directly from the soil and this process affect s seed maturation. It is well established that calcium is critical for proper peanut seed development ( Cox et al. 1982; Gascho and Davis 1994) and that maximum calcium levels in the seed are reached approximately 60 days after the peg enters the soil (Mizuno, 1959). However, when an adequate amount of calcium is unavailable to developing seed tissues, it results in pods containing no seed or s everely underdeveloped seed. To avoid deficiencies, calcium is supplied to the soil as gypsum or limestone. Previous research has focused on the effect of calcium early in the season to: 1) identify specific calcium requirements for various peanut cultiva r s (Gascho et al ., 1994; Cox et al ., 1982; Walker et al. 1976), 2) determine factors

PAGE 13

13 affecting calcium uptake and the mechanisms of uptake (Kvein et al. 1988; Boote et al. 1982; Skelton and Shear, 1971), 3) define fruit filling characteristics (Colwel l and Brady, 1945), 4) or at the end of the season to determine the effect on final yield (Sorensen and Butts, 2008). However, the seed developmental stage at which calcium is most crucial for normal maturation is unknown. Thus, the first objective of the current research was to address this question using t wo runner varieties, C 99R and Georgia Green, under field conditions in low calcium soils with and without calcium supplementation. Macronutrient and micronutrient accumulation or composition in the de veloping peanut fruit and seed is affected by Ca ( Pickett, 1950; Pattee et al. 1974). This effect has been extensively studied in solution culture (Zharare et al ., 2009a and b; Zharare et al ., 1998; Zharare et al. 1993; Pal and Lal oraya 1967). However, the effect of calcium sources, such as gypsum, on nutrient composition and nutrient changes within pods and seeds are not well understood. Therefore, a second objective of the above study was to determine the effect of gypsum supplementation on the co ncentration of calcium and other minerals in the developing peanut frui t. The physiological basis of calcium uptake by the peanut fruit has been reported (Skelton and Shear, 1971; Wiersum, 1951) However, the molecular mechanism s involved in this process are not understood. One approach to understand the molecular basis of calcium uptake is to study a class of calcium sensors known as Calcium Dependent Protein Kinase s (CDPK s ) These proteins are ubiquitous in plants ; there are at least 34 genes encoding CDPK s in the Arabidopsis genome ( Cheng et al ., 2002; Harmon et al. 2001). There is evidence that CDPKs are important for normal seed development. Frattini et al. (1999) showed that two rice CDPK isoforms, OsCDPK2 and OsCDPK11, were differentially expressed during seed development. Low

PAGE 14

14 expression of the OsCDPK2 protein was observed during early developmental stages increasing through maturity, while OsCDPK11 showed down re gulation during later stages of development. In a later study, over expression of OsCDPK2 in transgenic rice blocked seed development at a very early stage (Morello et al. 2000). In Arabidopsis knockouts of the CDPK, CPK28, resulted in embryo lethality (Harper et al. 2004). Likewise a CDPK was identified in sandalwood embryogenic cultures that accumulated to high levels during somatic and zygotic embryogenesis, endosperm development and seed germination, but was undetectable in mature organs such as shoots and flowers (Anil et al. 2000). Dasgupta (1994) characterized a 53 kDa peanut CDPK (GnCDPK) from mature seed. However, little is known regarding a role for CDPKs in peanut fruit development. Because peanuts subterranean seed development relies prima rily upon the sensing and response of the young, underground developing fruit to calcium levels in the soil, the third objective of this research was to examine changes in CDPK expression during peanut fruit development in low calcium soils and the same soils supplemented with calcium.

PAGE 15

15 CHAPTER 2 LITERATURE REVIEW Peanut Geocarpy Angiosperms during reproduction usually flower and fruit aerially. However, in peanut ( Arachis hypogaea L.), flowers are produced aerially but fruits form underground. This phenomenon is called geocarpy and it is an atypical trait in the plant kingdom. Lev Yadun (2 000) reported 20 active geocarpic species in Israel. In addition, Barker (2005) reported 50 species including leguminosae members exhibiting an active, passive, amphi or geophytic geocarpy in African and Madagascan flora. However, geocarpy is a characteristic of all Arachis species. The Peanut Flower The papillionaceous, sessile and often orange colored peanut flowers are borne on a spike inflorescence present on the primary and secondary braches of the plant (Pattee and Stalker, 1995; Smith, 1950). In the gynoecium, the ovary is unilocular, sessile and inferior. The ovules are anatropus, crassinucellate and bitegmic (Periasamy and Sampoornam, 1984). Pollination and Peg Initiation The flower opens after sunrise. Self pollination occurs in the enclosed keel. The flower usually withers within 24 hrs after pollination. Fertilization and syngamy occur 10 to 18 hrs following pollination ( Smith, 1956). After syngamy, the peanut fruit is initiated as a stalk like structure that carries the fertilized ovules within 1 mm of the tip. Botanically, this stalk is widely known as gynophore, colloquially it is known as a peg (Smith, 1950). Within t he peg, the intercalary meristem behind the fertilized ovules divides resulting in elongation. Anatomically and morphologically, the peg is a stem like structure, however due to its positively geotropic

PAGE 16

16 nature it behaves like a root (Moctezuma, 2003). The peg continues to elongate until it reaches the soil. Fruit I nitiation Once the peg enters the soil, the intercalary meristem ceases its activity (Periasamy and Sampoornam, 1984). Thompson et al. (1992) showed that seven days after entry into the soil phyto chrome is present in the developing ovules and embryos, but not in the peg tissues. The cells derived from the innermost layers of the peg increase around the proximal ovule first followed by the distal ovule, forming an inner zone. This marks fruit initia tion. Then cells surrounding the inner zone divide rapidly on the dorsal side near the proximal ovule. Due to this unequal growth of the inner zone tissue, the fruit assumes a horizontal position and runs parallel to the soil. The inner zone has spongy par enchymatous tissue contributing to the major portion of the fruit wall (Periasamy and Sampoornam, 1984). The epidermis of the outer zone is replaced by the periderm due to an increase in cell number. As the fruit enlarges in the soil, the vascular bundles become interlinked by lateral connections through fibrous plates. Based on physiological growth and biochemical changes, fruit development has been classified into various stages (Young et al. 2004; Boote, 1982; Pattee et al. 1974). The current classifi cation system of peanut fruit development (Figure 21) described below has been adapted from Young et al. (2004) and Paik Ro et al. (2002). Fruit D evelopment Classification Stage 1: Very Immature Pod The pod is very watery, soft and spongy. This appearance is due to the presence of parenchymatous tissue. The wall consists of an inner zone, outer zone, and 1013 vascular bundles joined by lateral connections. At this stage, the pod acts as a storage organ for the developing seeds and has the highest level s of sugar and starch compared to later stages.

PAGE 17

17 Seed The seed is very small and flat with a white seed coat. Anatomically, the seed has an outer and inner surface epidermis having rectangular (20 40 m) and irregular cells, respectively. The epidermal cells consist of a dense cytoplasmic network surrounding the organelles including starch grains and protein bodies. The provascular bundles range from 3 8 m in diameter and are placed equidistant. The mid region parenchyma cells consist of numerous vacuo les, protein bodies and starch granules. Lipid bodies can also be seen at this stage. Stomata cannot be distinguished with electron microscopy at this stage. Stage 2: Immature Pod. The pod is watery and soft. However, it begins to show signs of dehydration. Seed The seed is round. Its seed coat is pink at the tip of the embryo axis, but the remainder is white. Sugar levels are high in the seed coat. Cells of the outer epidermis are now 30 50 m and the cells of the outer epidermis are angular. At this stage, stomata can be easily seen on the inner surface of the epidermis. At this stage of development, starch and sugar levels are approximately equal (Pattee et al. 1974); however the lipid content is low. The seed weight is approximately 300 mg Stage 3: Mature Pod. The parenchymatous tissue begins to disintegrate; the inner pericarp dries and cracks giving a white papery appearance. Sugar and starch content decreases, however the content of hemicelluloses increases. Seed The seed coat begins t o dry out and turn a light pink. The epidermal cells of the outer surface increase in size to 60 80 m. The inner surface epidermal cells possess angular sha ped cells with distinct stomata L ipid bodies start accumulating in the seed. S tarch and sugar co ntent gradually decreases in the seed coat and increases in the seed. The seed weight is approximately 600 mg.

PAGE 18

18 Stage 4: Very Mature Pod. The parenchymatous tissue is gone The outer and inner cell layers contain hemicellulose deposits. The 10 13 vascular bundles are interconnected through the sclerenchymatous layers. In cross secti on, the vascular bundles are in a Y shaped groove of the sclerid layer. This Y shaped grove is responsible for the reticulation of the outer surface of the pod ( Halliburton et al. 1975) Brown black splotches are on the inner pericarp as a result of complete loss of parenchymatous tissue. Seed The seed coat is completely dry and dark pink. The rounder outer surface epidermal cells are 70 100 m in size and the inner surface epidermis possesses angular shaped cells. Vascular bundles can be seen in both cotyledons (Young and Schadel, 1990). A major portion of the cotyledons consist of parenchyma cells. Lipid bodies reach their maximal levels. Starch and sugar levels in the seed coat are the lowest since development initiated and are the highest in the cotyledons. The seed weight is approximately 600 mg. Calcium M ovement and Location in Peanut In peanut roots, calcium moves upward via the xylem, but a nonsignificant amount of calcium moves back from the leaves downward to the developing reproductive organs (Mizuno, 1959; W ier sum 1951; Bledsoe et al. 1949). M ass flow also supplies low amounts of calcium through the upward movement of water from the gynophores to the plant tops. Skelton and Shear (1971) showed the presence of radiolabeled calcium in fruit exposed to the air and very little still in solution. They concluded that there was water movement by transpiration which transporte d calcium from root to gynophore, but not enough to satisfy the requirements of normal seed development. This result shows that the developing pod absorbs calcium directly from the soil solution in the fruiting zone Consequently, calcium within the soil f ruiting zone is required in relatively high concentrations. The first 20 days following entry of the peg in the soil

PAGE 19

19 is critical for development because 92% of the total calcium is taken up during that period (Pattee and Stalker, 1995). Electron microgr aph analysis of peanut fruits revealed that calcium was mainly concentrated in the exocarp and mesocarp of the pod and in the inner and outer surface of the seed coat. The lignified pod endocarp and the seed had the lowest calcium concentration (Smal et al 1989). Because ca lcium cannot be mobilized from older tissues and redistributed via the phloem, it creates pressure on the developing tissue s to use the immediately available c a lcium supply from the xyl em. Since the calcium supply in the xylem is trans piration dependent, and transpiration is low in developing fruit s young leaves and other developing tissues, calcium deficiency can result. In peanut, calcium deficiency results in an increased number of pods that contain no seed s or seeds that are severely u nderdeveloped. The deficiency can also result in a darkened plumule or black heart. It also can adversely affect pod production, seed viability and germination rates (Pattee and Stalker, 1995). Factors Affecting Calcium Availability, Concentration an d Distribution in Peanut Sumner et al. (1988) found that larger seeded pods with less surface area to weight ratio require a higher soil calcium concentration since they are less efficient in diffusion compared to smaller seeded pods. In addition, other fa ctors including pod maturity period, weight, thickness and volume also contribute to differences in calcium requirements for different cultivar s (Kvien et al. 1988). Abiotic factors also influence the availability, concentration and distribution of calcium in peanut fruits Murata et al. (2008) showed that low pH can adversely affect normal pod setting irrespective of calcium levels in solution culture They showed that a pH of 3.5 at three different calcium levels, 500 M, 1000 M and 2000 M, pr oduced only 58 % normal pods

PAGE 20

20 compared to 94 % normal pods produced in all three calcium levels with a pH of 5.0 and 6.5. The seed calcium concentration was highly reduced at pH 3.5, as well. Oxygen supply is also an essential component for normal fruit development. In a solution culture experiment, Zharare et al. (1998) showed that failure to provide the proper aeration (oxygen) resulted in poor seed formation at the proximal end and no seed formation at the distal end. Drought has a severe effect on calcium uptake by developing fruits. Boote et al. (1982) showed poor calcium uptake during a drought period. It resulted in severe calcium deficiency symptoms with reduced seed and pod calcium concentrations compared to a well watered treatment. C ultivar di fferences may also affect moisture requirements. Wright (1989) showed that the yield of a Virginia peanut was unaffected by low moisture, while a reduction in yield was obtained for a Spanish variety under the same conditions. Gypsum particle size and its date of application can affect the availability of calcium in the soil. Walker et al. (1981) found that application of coarse gypsum at planting in a sandy loam soil resulted in higher calcium availability than fine particle gypsum applied at early flow ering. However, yield was unaffected by these factors. Soil texture also affects leaching ability of soil calcium. Leaching ability of calcium in a gypsum amended sandy loam soil was higher than in a sandy clay loam (Alva and Gascho, 1991). The gypsum amen dment also increased the leaching ability of K and Mg in the sandy loam. The authors postulated that the high leaching ability of K and Mg in the gypsum amended sandy loam maintained the appropriate cationic balance to produce high quality peanuts. Intera ctions of Calcium (Gypsum) and Other Ions in Peanut Pal and Laloraya (1967) showed that adding NaCl to a peanut solution culture significantly reduced pod set. Peg tips turned brown and showed necrosis. Pods that did develop were small

PAGE 21

21 and had necrotic les ions. Sodium was inhibiting the active uptake of calcium by the developing pods. Addition of gypsum to the saline stressed plants alleviated the calcium deficiency and increased fruit yield. Gypsum also affects potassium concentrations Sulliv an et al (1974) showed that when gypsum was applied in combination with potassium, the potassium did not affect seed quality or yield; however, a potassium only application reduced the total yield. A soil calcium to potassium ratio of 3:1 resulted in the best yield s because it increased the chances for calcium uptake. A high concentration of potassium and a low concentration of calcium also resulted in poor peanut seed germination. Magnesium is also inversely correlated with calcium. The addition of K2SO4 or MgSO4 in the cultivation of Virginia Bunch increased pod breakdown, external damage to the seeds, and reduced seed calcium concentrations (Hallock and Garren, 1968). Addition of gypsum also influences phosphorus uptake. Zhu and Alva (1994) showed a 54% decrease in phosphorus transport in a gypsum amended sandy loam soil. It was postulated that the calcium precipitated the phosphorus and thereby decreased its transport in the soil. Boron, like calcium, is phloem immobile and can decrease peanut yields under def icient conditions. Keeratikasikorn et al. (1991) showed that calcium and boron probably act in concert. Deficiencies of both ions resulted in a reduction of seed size, shelling percentage, number of pods per plant, and number of seeds per pod. Application of both ions increased the yield and seed quality. Calcium as a Secondary Messenger Calcium, apart from being a nutrient as described above, is also a central key ion that serves as a secondary messenger in a diverse array of plant signal transduction pathways. A stimulus spe cific increase in the [calcium]cyt is known as a calcium signature There are numerous calcium signatures. The basic unit is a single spike. Other types include double

PAGE 22

22 (biphasic) and multiple re s ponses (oscillations). In theory, the signaling information can be encoded in a spikes magnitude, duration, frequ ency or sub cellular location. Proteins are the receptors of these calcium signatures, known as calcium binding proteins. These proteins include the following (Harmon et al. 2001): 1. C alcium D ependent P rotein K inases (CDPKs) 2. C alcium Dependent Protein Kinase R elated K inases (CRKs) 3. Ca l m odulin D ependent P rotein K inases (CaMKs) 4. Ca l cium and Ca l m odulin A ctivated K inases (CCaMKs) 5. Sn f1 R elated K inases (SnRKs) 6. C alcineurin B L ike Calcium Binding Proteins (CBLs) 7. C aM B inding Protein K inase (CBKs) Based on the mechanism of activation, these calcium sensors are either sensor responders or sensor relays ( 2007; Harmon et al. 2001). CDPKs are calcium responders, while CRKs, CCaMKs, and SnRK3s are sensor relays. CDPKs are found in plants and protists including the malarial parasite Plasmodium falciparum (Harper et al., 2004), but not in mammals, fungi or insects (Harmon et al. 2001). CDPK genes are thought to have evolved from the combination of protein kinase and calmodulin genes through recombination of ancient introns (Zhang and Choi, 2001). Functions of CDPKs CDPKs have been associated with a wide array of functions in signal transduction. An in depth discuss ion of all the functions is beyond the scope of this literature review. However, in broad terms, they are involved in stress and hormone responses, and reproductive and vegetative growth ( 2007; Ludwig et al. 2004; White and Broadle y, 2003). Such a wide range of diverse functions probably contributes to their phylogenetic grouping into

PAGE 23

23 several subfamilies due to differences in structure, site specific localization ( Klimecka and 2007) and requirement for different promoter s for tissue specific expression (Harper et al. 2004). Responses to Stress Signals In rice, out of the 31 identified CDPKs, 11 have been reported to play an active role in stress signaling of 10 day old seedlings. Transcript levels were either up regulat ed or down regulated when exposed to different stress stimuli. CDPK sequence analysis revealed the presence of cis acting elements upstream of the promoter region that were correlated to stress responses (DeFalco et al. 2010; Ye et al. 2009). In tobacco, the NtCDPK1 and NtCPK4 genes were transcriptionally up regulated after 1 2 hrs of osmotic stress. In Arabidopsis the zinc finger domain AtDi19, a drought responsive element, was phosphorylated by AtCPK4 and AtCPK11. These zinc finger domains are thoug ht to have an important role in stress tolerance to salinity and drought. AtCPK23 played a positive role in stomatal opening and the acquisition of potassium ions when plants were under salinity stress (Ma and Wu, 2007). Salt stress also affects the subce llular localization of CDPKs. The ice plant McCPK1 was associated with actin filaments during osmotic stress and was translocated from the plasma membrane to the trans cytoplasmic ER and then to the nucleus where it phosphorylated MsCSP1, a pseudo response regulator of salt stress (Patharkar and Cushman, 2000). CDPKs also play a role in elicitor and wound induced responses. The tobacco NtCDPK1 gene was up regulated by fungal chitin elicitor. Similar fungal elicitor responses also have been reported for NtC DPK2 (Romeis et al. 2001), and in in vitro analysis of maize ZmCPK10 (Murillo et al. 2001).When tomato leaves were wounded, the LeCDPK1 transcript displayed a transient increase at the wound site. The transient increase was correlated with an increase in the

PAGE 24

24 amount and activity of cytosol soluble CDPKs suggesting a role in plant defense. A similar response was observed in maize when ZmCPK11 transcripts showed an increase during injury ( 2007) Responses During Reproductive D evelopment CDPK levels change during fruit ripening ( Leclercq et al. 2005; Duan et al. 2003) and seed development (Frattini et al. 1999). The role of CDPKs in fruit development has been studied in apple (Duan et al. 2003), tomato ( Anguenot et al. 2006), sandalwood (Anil et al. 2003) and grape berry (Shen et al. 2004). The role of CDPKs in seed development has been reported only in rice (Frattini et al. 1999). CDPK involvement in fruit development mainly has been related to sucrose metabolism ( Angu enot et al. 2006; Duan et al. 2003). In tomato, a 55 kDa membrane associated and soluble CDPK was identified in developing tomato fruit. The membrane associated CDPK activity was highest in young fruits and gradually decreased as the fruit matured. This membrane CDPK phosphorylated sucrose synthase which was responsible for partitioning of sucrose synthase during fruit development. Duan et al. (2003) obtained phosphatidylserine (PS) activated and membrane associated membrane CDPK and calcium independent mitogen activated protein kinase like (MAPK like) proteins from developing apple fruit. CDPK expression was highest in young fruit and middle fruit stages and decreased with maturity. Anil et al. (2000) characterized two CDPKs of 55 to 60 kD a in sandalwood (swCDPK). swCDPK levels were high in mature fruits, but insignificant in shoots and flowers. The 55 kD CDPK was strongly associated with oil bodies (Anil et al. 2003). The high swCDPK activity and amount during oil body maturation suggests a regulatory role of CDPK in oil body biogenesis.

PAGE 25

25 Kawasaki et al. (1993) reported that the spk gene encoding CDPK was located upstream of the gene encoding the starch branching enzyme, sbe1 in developing rice. The expression of spk was found to be similar to the expression of sbe1 It was exclusively expressed in developing seeds. It was postulated that spk might be involved in the partitioning of starch during seed maturation. Frattini et al. (1999) showed that two rice CDPK isoforms, OsCDPK2 and OsCDPK11, were p resent at different levels during seed development. OsCDPK2 protein was low in early seed development and increased in later stages, while the converse was true for OsCDPK11. In a later study, over expression of OsCDPK2 in transgenic rice resulted in a dr astic reduction of seed production (Morello et al. 2000). Only 7% of the transgenic flowers produced seed. The conclusion was that the abnormally high expression of OsCDPK2 blocked early seed development. The mechanism for this inhibition of seed devel opment is not known.

PAGE 26

26 Figure 21. Stages of peanut fruit development. (A) Pod stages; (B) Seed stages. 1: Very Immature; 2: Immature; 3: Mature; 4: Very Mature (Pattee et al ., 1974) A) B)

PAGE 27

27 CHAPTER 3 THE EFFECT OF CALCIUM ON DEVELOPING PEANUT ( Arachis hypogaea L.) SEEDS AND PODS IN THE FIELD Introduction Peanut ( Arachis hypogaea L.) is one of the most widely cultivated oil seed crops of the 21st century. Peanut seed is a major source of oil and protein and it is used directly for food consumption. Although the anatomy and morphology of the developing peanut fruit has been described (Gregory et al. 1951), the physiological and molecular mechanisms governing its development are not well understood. However, it is certain that calcium is the most critical nutrient in the soil for peanut production, particularly seed development (Cox et al. 1982; Gas cho and Davis, 1994). Once the peanut peg has penetrated the soil, root absorbed calcium is no longer translocated to the developing fruit. The peanut pod must absorb calcium directly from the soil (Skeleton and Shear, 1971). Consequently, soil calcium l evels in the fruiting zone (0 10 cm) must be in the range of 1200 to 1600 lbs/ acre in order to produce high quality seed. A calcium deficiency, whether due to insufficient levels in the soil or to drought conditions which inhibit calcium uptake by the pod, results in seed abortion and numerous empty pods (Smith, 1956). To amend a deficiency, calcium is applied to the soil as gypsum or limestone. Previous research has examined the effect of calcium on peanut production either very early in the growing seas on or as it relates to yield at the end of growing season (e.g. Sorenson and Butt s 2008). Other studies have examined the calcium requirements of various cultivars (Cox et al. 1982; Walker et al. 1976), factors affecting calcium uptake and the mechanisms controlling uptake (Kvein et al. 1988; Boote et al. 1982; Skelton and Shear, 1971), and the influence of calcium on fruit filling characteristics ( Colwell and Brady, 1945). Although it is known that peanut can absorb calcium for as long as 60 days afte r the peg enters the soil (Mizuno, 1959), the

PAGE 28

28 time during development at which calcium is most crucially required for normal maturation is unknown. In an attempt to answer this question, two runner varieties, C 99R (large seeded) and Georgia Green (small seeded), were studied under field conditions with low calcium soils supplemented with gypsum. Materials and Methods Two peanut runner cultivars, C 99R (large seeded) and Georgia Green (small seeded), were grown at the University of Floridas Plant Science Research and Education Unit (Citra, FL) on Candler fine sand (Buster, 1979) in 2007, 2008 and 2009. This soil is composed of 97% sand sized particles and 2% silt (Gregory et al. 2006). Soil samples were analyzed (Waters Agricultural Laboratories, Camilla, GA) 4 wks before planting for P (51, 43 and 62 lbs/acre), K (40,19 and 66 lbs/acre), Mg (35,14 and 63 lbs/acre), Ca (333, 201 and 1011 lbs/acre), B (1.1, 0.2 and 0.4 lbs/acre), Mn (4, 2 and 5 lbs/acre), and pH (5.5, 5.4 and 7.85) in 2007, 2008 and 2009, respectively. Every year, each cultivar was given two external gypsum (68.5% Ca) applications of 1500 lbs/acre each at 30 and 60 days after planting (DAP). The plots were arranged in a split plot design with two calcium treatments (low calcium soil and two external gypsum applications to that low calcium soil) as the main plot and cultivars as the subplot with six replications. Each plot was comprised of two rows with an area of 4.5 m x 2 m. In order to make terms simpler, a pod with seeds will be refer red to as a fruit, unless otherwise stated. Developing fruits were sampled and analyzed for six parameters from a randomly measured 1 m section per replication at 70, 100 and 130 DAP. Parameters were measured on each fruit sampled for all sampling dates ex cept 70 DAP in 2007. Pod length was measured in cm by a calibrated digital V ernier caliper (Fisher Scientific, Pittsburgh, PA). Seed and pod developmental stages were classified as described by Pattee et al. (1974) as 1, 2, 3 or 4

PAGE 29

29 with 1 being very immatur e and 4 being very mature. Pod segments were noted based on the number of segments observed for each fruit. In two segmented fruit the seed closest to the peg was classified as a proximal seed and the seed nearest the apical end was classified as a distal seed. The number of seeds per pod were also scored. Fruit development was classified into two categories and was based on the synchronization of seed and pod stages. Seeds and pods at the same stage of development were classified as synchronized fruit, whereas aborted seeds, shriveled or immature seeds in a mature pod i.e. seeds which did not synchronize with the pod developmental stages were termed as asynchronized fruit. Data Analysis For pod length, number of pod segments, number of seeds per pod, and fruit development, the very immature stage 1 fruits were not included in the analyses. An overall Analysis of Variance (ANOVA) was performed by PROC GLIMMIX (SAS v. 9.2, 2008). Y ear and replication were r andom effect s while gypsum treatments, cultivars, a nd stages of development were fixed effects. For pod length, the ANOVA was performed on the average pod length over all stages of pod development. For the number of segments, the aver age frequency percent at the three sampling dates was calculated for each plot in all three years and an ANOVA was performed For the number of seeds per pod, the average frequency percent of one seed per one segmented pod, one seed per twosegmented pod and two seeds per twosegmented pod was calculated for each plot and sampl ing date for all three years and an ANOVA was performed. For seed developmental stages, the frequency percent of each seed stage at the proximal and distal ends was calculated for each plot in all three years and sampling dates. An ANOVA was performed for the sampling date, cultivar and treatment. For fruit development, the frequency percent of proximal and distal seed stages was calculated for each pod stage and ANOVA was performed on the frequency percentage for differences in fruit development due to gy psum

PAGE 30

30 treatment and cultivars. The probability values were from t tests of the mean differences based on planned comparisons (P 0.05). Results Pod Length Pods increased in length for both cultivars throughout development regardless of gypsum treatment (T able 31). However, cultivar differences were observed (Table 32). As expected, C 99R had longer pods than Georgia Green, since C 99R is a larger seeded cultivar compared to Georgia Green. Number of Pod Segments A higher percentage of one segmented pods (13.7 %) was obtained in control plots (nontreated ) than when gypsum was applied (10.3 %; P = 0.006) (Table 3 3). Cultivars also differed in the number of pod segments. Georgia Green had a higher percentage of twosegmented pods (90.6 %) than C 99R (85.5 %; P < 0.0001) (Table 34). Number of Seeds per Pod For two segmented pods, there was a higher percentage of two seeds (84.2 % versus 78.1%, P= 0.006, Table 3 3) when gypsum was applied. Cultivars also differed in the number of seeds per pod. Georgia Gre en had a higher percentage of two segmented pods filled with two seeds (85 .0 %) than C 99R (77.3 %) (Table 34). Since low soil calcium can result in one seed in two segmented pods, the total number of fruits with one seed in a two segmented p od was also a nalyzed. In this case, t here was no difference observed due to gypsum treatment (P = 0.8, Table 33) or cultivar (P = 0.38, Table 34). However, the control plots produced more one segmented pods containing one seed (20.7 %) than those plots receiving gyps um (15.2%) (Table 33).

PAGE 31

31 Proximal Seed The percentage of proximal seeds was n ot affected by gypsum treatment, cultivar or sampling date (Table 3 5 ). However proximal seed development was affected (seed stage < 0.0001) and there were significant interacti ons of cultivar*seed stage and seed stage* sampling date (Table 3 5). Georgia Green produced a higher percentage of very mature proximal seeds (18.66 %) compared to C 99R (14.38 %, P < 0.0001), but had a similar percentage of proximal seeds in all other se ed stages (Table 3 7). In the seed stage* sampling date interaction (Table 3 8) more very immature and immature proximal seeds were produced at 70 DAP than at 100 DAP and 130 DAP. However, more mature proximal seeds were found at 100 DAP than at 70 or 130 DAP. No very mature proximal seeds were found at 70 DAP compared to 18.25 % at 100 DAP and 31.73 % at 130 DAP (P < 0.0001). Distal Seed Similar to proximal seeds, the number of distal seeds produced was not affected by the gypsum treatment, cultivar or sampling date, but seed stage and the interaction effects of gypsum treatment*seed stage (P = 0.0033), cultivar*seed stage (P < 0.0001) and seed stage*sampling date (P < 0.0001) influenced the percentage of distal seeds (Table 35). A seed position analysis revealed that it was significant for all three sampling dates (Table 3 6). Georgia Green produced more very mature distal seeds (17.68 %, P = 0.002) and fewer aborted seeds (4.48 %, P = 0.05) than C 99R (Table 37), however no differences were obser ved in other seed stages for these cultivars. When gypsum was applied, fewer aborted distal seeds (4.68 %, P = 0.005) and more very mature distal seeds (16.61 % P = 0.022) were produced compared to the control However, other stages were similar regardless of gypsum treatment (Table 39). In the sampling date *seed stage analysis, seed stages were inconsistent among sampling dates. For instance, more aborted seeds were observed in the distal section at 100 (6.9 %) and 130 DAP ( 6.76 %) than at 70 DAP

PAGE 32

32 (4 .33 % ) (Table 310 ). At 70 DAP, more immature and very immature seeds were produced than were produced at 100 and 130 DAP. When sampled at 100 and 130 DAP, more mature and very mature seeds were produced (Table 310). Asynchronized Fruit F ruit development wa s based on the overall degree and synchronization of pod and seed physiological stage development. For example, i f pods were staged as mature or very mature and seeds within them were staged as immature, aborted or shriveled then fruits were characterized as asynchronized. I f pods and seeds were at the same stage of development, then fruits were characterized as synchronized or fully developed. The overall production of a synchronized fruit was not affected either by gypsum application or cultivar, but frui t stages were significantly different (P < 0.0001, Table 311). W hen each fruit stage was analyzed separately the frequency percent age of immature fruits was not affected by gypsum treatment (P = 0.97), cultivar (P = 0.63), or an interaction of cultivar*gypsum treatment ( P = 0.58, Table 312), but differences were significant for mature and very mature fruit stages due to gypsum treatment (P = 0.01 and 0.02, respectively ) and cultivar (P = 0.02, Table 3 12). In the nontreated condition, a higher percenta ge of asynchronized mature (24.27 %) and very mature (12.91 %) fruits were obtained than in the gypsum treated condition which had 16.57 % mature (P = 0.01) and 8.34 % (P = 0.02) very mature fruits (Table 313) respectively Georgia Green had a lower percentage of asynchronized mature (17.71 %, P = 0.02) and very mature (8.60%, P = 0.02) fruits than C 99R (Table 314 ). Discussion The effect of calcium and its supplementation in field studies have mainly focused on yield at the end of the growing season. This study examined the effect of the addition of calcium via gypsum application to low calcium soils during the development of p eanut seeds and pods

PAGE 33

33 throughout the growing season. Six parameters were measured at three sampling dates and at harvest for two cultivars that differed in seed size. Pod length was not affected by gypsum treatment. However, C 99R had longer pods than Geor gia Green. This result was expected since C 99R is a larger seeded variety that normally has greater pod length, breath and width than Georgia Green. It is possible that pod length is controlled more by genetic factors, like other pod characteristics inclu ding surface area and volume (Kvein et al. 198 8), than by the external environment, particularly soil calcium levels. However, pods were affected by gypsum application in the number of segments that formed. Higher percentages of twosegmented pods were fo rmed when gypsum was applied. Additionally, these twosegmented pods were more likely to contain two seeds when gypsum was applied. These effects were more pronounced for the smaller seeded Georgia Green than the larger seeded C 99R. These results support the observations made by Colwell and Brady (1945) where they obtained more twosegmented pods and more twoseeded pods when gypsum was applied to Spanish and Runner cultivars. Botanically, the two ovules in a unilocular ovary form the proximal and distal segments. These segments can be either marked by the depth and form of constrictions depending on the shapes and orientation of the seeds (Smith, 1950). Since, the distal ovule is farther from the stigma during fertilization, it is not uncommon to have th at ovule abort in the leguminosae due to being unfertilized (Teixeira et al. 2006). In peanut, the abortion of mostly unfertilized ovules is more common in the distal segment (Periasamy and Sampoornam, 1984) and results in a one segmented pod. Calcium s role in promoting fertilization is wellknown (Ge et al. 2007). Hence it is possible that calcium may exert an early effect on peanut reproduction by increasing the successful fertilization of the distal ovule, thereby increasing the number of two segm ented

PAGE 34

34 pods carrying two seeds. Additionally, distal ovules can abort even if properly fertilized due to the competition of nutrients (Teixeira et al. 2006). During peanut fruit development, the proximal ovule begins to develop first and it is closer to the peg Thus nutrient loading is more likely to favor the proximal ovule than the distal ovule. Colwell and Brady (1945 ) were unable to determine when peanut ovule abortions took place. Periasamy and Sampoornam (1984) showed that either little or no pa renchymatous tissues were present surrounding unfertilized peanut ovules. Hence, it is likely that unfertilized ovules are aborted before or soon after the gynophore enters the soil. We observed that when soil did not receive gypsum supplementation, distal seed abortion was higher ( ~ 7 % versus ~ 5 %) (Table 39 ). Similarly, more aborted distal seeds were observed at 100 DAP and 130 DAP ( ~ 7 %) than at 70 DAP ( ~ 4 %) (Table 310). The indeterminate nature of peanut could play a role in calcium availability to pods set later in the season. Boote et al (1982) showed that peanut has exponential growth in fruit load from 49 89 DAP and later it slow s Mizuno ( 1959) and Kvein et al. (1988) showed that the peak time for calcium absorption by the developing pod is up to 60 days after the gynophore enters the soil. Hence the initial fruit load receives all maternal assimilates and enough calcium to progress toward maturity. However, after 89 DAP when fruit set decreases and peanut has reached its maximum fruit l oad capacity, the newly set seeds particularly the distal seeds, may receive an insufficient amount of calcium supply thus slowing seed maturation and leading to a higher rate of abortion as was observed at 100 and 130 DAP in the control plots From the present research, it is clear that the majority of ovule abortions due to nutrient deficiency manifest themselves sometime between 70 and 100 DAP at a time well after pod segmentation is evident.

PAGE 35

35 Georgia Green had a lower percentage of aborted seeds than C 99R (Table 37). Georgia Green also had higher calcium concentration s in both pods and seeds in the nongy psum treatment than C 99R (see Chapter 4). C 99R is a larger seeded cultivar with greater length, breadth, width and hull thickness than Georgia Green. However the surface area to weight ratio is less than Georgia Green. Sumner et al. (1988) showed that a larger seeded pod is less efficient in diffusion than a smaller seeded pod due to less surface area to pod ratio. Hence it is possible that C 99R would not have been able to receive enough calcium by diffusion compared to Georgia Green and thus had a higher rate of seed abortion The analysis of fruit development showed that immature fruits appeared normal under low er calcium conditions with seed and pod developmental stages synchronized. However, a higher percentage of mature asynchronized fruits i.e. mature pods with immature, aborted or shriveled seeds occurred in the nongypsum treated condition. Hence, the analysis revealed that pod maturity was unaffected while seed maturity was delayed in low calcium soils. Therefore, it can be hypothesized that under low soil calcium conditions two phenomena occur that affect peanut reproduction. First, distal ovules abort at a hi gher frequency most likely due to being unfertilized resulting in more one segmented pods. Second, see d and pod development becomes a synchronized with seed maturity lagging behind pod maturity detectable by the middle (100 DAP) of the growing season.

PAGE 36

36 Table 31. Pod length at three stages of pod development for peanuts grown near Citra, FL in 2007, 2008 and 2009. Each value represents the mean of two cultivars, three sampling dates and two calcium levels. Means followed by a different letter in the pod length column are different based on Tukeys mean separation (P Pod stage Pod Length (cm) 2 2.40 a 3 2.45b 4 2.57 c Table 32. Pod length of two peanut cultivars grown near Citra, FL in 2007, 2008 and 2009. Each value represents the mean of three pod stages, three sampling dates and two gypsum treatments. Means followed by a different letter are different based on Tukeys mean separation (P 0.05) Cultivar Pod Length (cm) C 99R 2.57a Georgia Green 2.37b Table 33. Frequency percentage for number of pod segments and number of seeds/pod for gypsum treatments for peanuts grown near Citra, FL in 2007, 2008 and 2009 and their P values Each value represents the mean of two cultivars and three sampling dates. Gypsum Treatment No of pod segments No of seeds / pod 1 2 1 seed /1 seg pod 1 seed/2 seg pod 2 seed/2 seg pod Non Treated 13.7 86.3 20.7 1.2 78.1 Treated 10.3 89.7 15.2 0.5 84.2 P values 0.006 0.006 0.0006 0.38 0.006

PAGE 37

37 Table 34. Frequency percentage for number of pod segments and number of seed/pod for two peanut cultivars grown near Citra, FL in 2007, 2008 and 2009 and their P values Each value represents the mean of two calcium levels and three sampling dates. Cultivars No of pod segments No of seeds / pod 1 2 1 seed /1 seg pod 1 seed/2 seg pod 2 seed/2 seg pod C 99R 14.5 85.5 21.9 0.8 77.3 Georgia Green 9.4 90.6 14 0.91 85 P values < 0.0001 < 0.0001 < 0.001 0.8 < 0.0001 Table 35. ANOVA probability values determined for proximal and distal seeds with gypsum treatment, two cultivars and sampling date for peanut s grown near Citra, FL in 2007, 2008 and 2009. Effect Proximal Distal Gypsum Treatment 0.45 0.47 Cultivar 0.44 0.46 Sampling Date (sdate) 0.86 0.9 Seed Stage < 0.0001 < 0.0001 Gypsum Trt*Seed Stage 0.1 0.0033 Cultivar*Seed Stage 0.0003 < 0.0001 Seed Stage*sdate < 0.0001 < 0.0001 Table 36. ANOVA probability values determined in the seed stages for position effect with gypsum trea tment for two peanut cultivars grown near Citra, FL in 2007, 2008 and 2009. Effect 70 100 130 Gypsum Treatment 0.21 0.0048 0.06 Cultivar 0.001 0.2962 0.001 Position < 0.0001 < 0.0001 < 0.0001 Cultivar* Gypsum Trt 0.77 0.12 0.23 Gypsum Trt*position 0.91 0.12 0.34 Genotype*position 0.007 0.25 0.12

PAGE 38

38 Table 37. Frequency percentage of proximal and distal seed deve lopmental stages for peanuts grown near Citra, FL in 2007, 2008 and 2009. Each value represents the average of two cultivars, gypsum treatments and three sampling dates. The probability values result from t tests of the mean differences based on planned comparisons Seed Stage Proximal Distal C 99R Georgia Green P value C 99R Georgia Green P value Aborted 1.49 0.82 0.44 7.51 4.48 0.05 Very Immature 6.89 5.72 0.21 6 5.8 1.00 Immature 8.81 8.46 0.7 8.1 7.78 1.00 Mature 18.25 17.71 0.53 15.43 15.68 1.00 Very Mature 14.38 18.66 <0.0001 12.94 17.68 0.002 Table 38. Frequency percentage of proximal seed developmental stages determined at 70,100 and 130 days after planting (DAP) for peanuts grown near Citra, FL in 2007, 2008 and 2009. Each value represents an average of two gypsum treatments and two cultivars. The probability values result from ttests of the mean differences based on planned comparisons. Seed Stage DAP Differences (P value) 70 100 130 70 100 100 130 70 130 Aborted 0.48 1.87 1.11 0.22 0.44 0.58 Very Immature 14.3 3.13 1.48 < 0.0001 0.15 < 0.0001 Immature 18.56 4.82 2.53 < 0.0001 0.0.4 < 0.0001 Mature 16.51 22.58 14.86 < 0.0001 <0.0001 0.97 Very Mature 18.25 31.73 <0.0001 Table 39. Frequency percentage of distal seed developmental stages for gypsum treatment s for peanuts grown near Citra, FL in 2007, 2008 and 2009. Each value represents the mean of two cultivars and three sampling dates. The probability values result from t tests of the mean differences based on planned comparisons Treatment Seed S tage Non Treated Gypsum Treated P value Aborted 7.31 4.68 0.005 Very Immature 6.12 5.68 0.66 Immature 7.56 8.31 0.45 Mature 14.82 16.28 0.11 Very Mature 14.19 16.61 0.022

PAGE 39

39 Table 310. Frequency percentage of distal seed developmental stages determined at 70,100 and 130 days after planting (DAP) for peanuts grown near Citra, FL in 2007, 2008 and 2009. Each value represents an average of two gypsum treatments and two cultivars. The probability values result from t tests of the mean differences based on planned comparisons. DAP Differences (P value) Seed Stage 70 100 130 70 100 100 130 70 130 Aborted 4.33 6.90 6.76 0.040 0.89 0.05 Very Immature 13.33 2.78 1.59 < 0.0001 0.34 < 0.0001 Immature 17.49 4.04 2.29 < 0.0001 0.13 < 0.0001 Mature 15.13 19.88 11.65 < 0.0001 < 0.0001 0.18 Very Mature 17.23 29.53 < 0.0001 Table 311. ANOVA probability values determined for developing peanut fruit for gypsum treatment, cultivar, developing fruit stage and the interaction of fruit stage by gypsum treatment, cultivar and cultivar by gypsum treatment for peanuts grown near Citra, FL in 2007, 2008 and 2009. Effect Asynchronized Gypsum Treatment 0.17 Cultivar 0.38 Fruit Stage < 0.0001 Cultivar*Gypsum Trt 0.27 Gypsum Trt*Fruit Stage 0.46 Cultivar*Fruit Stage 0.29 Table 312. ANOVA probability values determined for asynchronized peanut fruit at various developmental stages for gypsum treatment, cultivar and the interaction effect of gypsum treatment by cultivar for peanuts grown near Citra, FL in 2007, 2008 and 2009. Effect Fruit Stages Immature Mature Very Mature Gypsum Treatment 0.97 0.01 0.02 Cultivar 0.63 0.02 0.02 Cultivar*Gypsum Trt 0.58 0.47 0.33

PAGE 40

40 Table 313. Frequency percentage of asynchronized peanut fruit at different developmental stages determined for gypsum treatment for peanuts grown near Citra, FL in 2007, 2008 and 2009. Each value represents an average of two cultivars and three different sampling dates. The probability values result from t tests of the mean differences based on planned comparisons. Gypsum Treatment Fruit Stages Mature Very Mature Non Treated 24.27a 12.91a Treated 16.57b 8.34b Table 314. Frequency percentage of asynchronized fruit at different developmental stages determined for two peanut cultivars grown near Citra, FL in 2007, 2008 and 2009. Each value represents an average of gypsum treatments and three different sampling dates. The probability values result from t tests of the mean differences based on p lanned comparisons. Effect Fruit Stages Cultivars Mature Very Mature C 99R 23.12a 12.6a Georgia Green 17.71b 8.6b

PAGE 41

41 CHAPTER 4 THE EFFECT OF GYPSUM APPLICATIONS ON THE ACCUMULATION OF MINERALS IN PEANUT ( Arachis hypogaea L.) PODS AND SEEDS Introduction Peanut seed is high ly nutritious because it contains essential vitamins, folic acid, good fat s and high protein levels. In the US, it is grown on sandy loam soil s in seven states in the Southe ast (Alabama, Florida, Georgia, Mississippi, South Carolina, North Carolina, and Virginia), and in Texas, Oklahoma and New Mexico in the Southwest These soils are often deficient in calcium which is essential for proper seed development To alleviate calcium deficiency, gypsum (CaSO4) is applied to the soil. The effect of gypsum application on peanut has been widely studied for its effect on yields at the end of the growing season (Sorens e n and Butts 2008). The effect of calcium on the accumulation of other nutrients in peanut has been extensively studied in solution culture (Zharare et al ., 2009a and b; Zharare et al ., 1998; Zharare et al. 1993; Pal and Lal oraya 1967). However, little is known about the accumulation of other nutrients in peanut pods and seeds following gypsum application to low calcium soils The refore, the objective of the present study was to investigate the effect of gypsum when applied to low calcium soils on the composition of minerals in the devel oping peanut fruit. To the best of our knowledge, t his is the first report describing the mineral content of developing peanut fruit s under the influence of gypsum. Materials and Methods Two peanut runner cultivar s, C 99R (large seeded) and Georgia Green (small seeded), were grown at the University of Floridas Plant Science Research and Education Unit near Citra, FL on Candler fine sand (Buster, 1979) in 2007, 2008 and 2009. This soil is composed of 97% sand size d particles and 2% silt (Gregory et al. 2006) and are low in calcium. Soil samples were examined (Waters Agricultural Laboratories, Camilla, GA) 4 wks before planting for P (51, 43

PAGE 42

42 and 62 lbs/acre), K (40, 19 and 66 lbs/acre), Mg (35, 14 and 63 lbs/acre), B (1.1, 0.2 and 0.4 lbs/acre), Mn (4, 2 and 5 lbs/acre), and pH (5.5, 5.4 and 7.85) in 2007, 2008 and 2009, respectively. Every year of the study, each cultivar was given two external gypsum (68.5 % Ca) applications of 1500 lbs/acre each at 30 and 60 day s after planting (DAP). The calcium levels in nontreated plots were 333, 201 and 1011 lbs/A in 2007, 2008 and 2009, respectively. The plots were arranged in a split plot design with two gypsum treatments (no treatment and external gypsum application) as t he main plot and cultivar s as the subplot with six replications. Each plot was comprised of two rows with an area of 4.5 m x 2 m. The underground developing fruits were sampled from random one meter sections at 70, 100 and 130 DAP. Macronutrient and Mic ronutrient Analyse s S amples were washed with distilled water and then surface sterilized with 70 % alcohol Seed and pod developmental stages were classified as described by Pattee et al. (1974) as 1, 2, 3 or 4 with 1 being V ery Im mature (VIm), 2 being Im m ature (Im), 3 being Ma ture (Ma) and 4 being V ery Ma ture (VMa). P ods and seeds of all stages were separated and dried at 70 C until a constant dry weight was achieved. In 2007, Ma and VMa stages for all three sampling dates were analyzed only for Ca by Waters Agriculture Laboratories (Camilla, GA) by inductively c ouple d a rgon plasma e mission s pectrophotometer y / vacuum Fungal contamination in younger peanut fruits precluded their use. In 2008 and 2009, dried samples were ground to a fine powder using a st ainless steel coffee grinder. The powdered samples were sent to Dr. Michael Grusak, Baylor College of Medicine (Houston, TX) for mineral analysis. A minimum of two subsamples (~ 0.25 g/ DW) of each ground sample were digested and processed for elemental analysis. Specifically, sub samples were weighed and placed in 100 mL borosilicate glass tubes for pre digestion overnight

PAGE 43

43 with 3 mL ultra pure nitric acid. The following day, tubes were placed in a digestion block (Magnum Series; Martin Machine, Ivesdale, IL, USA) and maintained at 125 C for a minimum of four hrs (with refluxing). If reddish nitric smoke was still emanating from certain samples after four hrs, this step of the protocol was lengthened until the smoke dissipated. Then tubes were removed fr om the block and cooled for 5 min before adding 2 mL of hydrogen peroxide, and then they were put back on the block at 125 C for one hr. This hydrogen peroxide procedure was repeated two more times. Finally, the digestion block temperature was raised to 200 C and samples were maintained at this temperature until they were dry. Once cooled (after removal from the block), digestates were resuspended in 2 % ultra pure nitric acid overnight, then vortexed and transferred to plastic storage tubes until analysis for Ca, Mg, K, P, S, Fe, Zn, Mn, Cu, Ni, and Na concentrations. Elemental analysis was performed using inductively coupled plasma optical emission spectroscopy (ICP OES) (CIRO S ICP Model FCE12; Spectro, Kleve, Germany) with the instrument calibrated daily with certified standards Tomato lea f standards (SRM 1573A; National Institute of Standards and Technology, Gaithersburg, MD) were digested and analyzed along with the peanut samples to ensure accuracy of the instrument calibration. The micronutrient and macronutrient data w ere analyzed using PROC GLIMMIX of SAS v 9.2 (SAS, 2008). Calcium levels, cultivars and developmental stages were the fixed effects while year and replicati on were considered as random effects. Analysis of Variance (ANOVA) was performed for all minerals using P Results Gypsum Application Differences Gypsum application affected the concentration of Ca, S, and P in both pods (Table 41) and seeds (Table 4 4), and the Mg concentration only in the seed (Table 4 4) Of the

PAGE 44

44 micronutrients tested, only Na in pods (Table 4 2) and Zn in seeds (Table 45) were significantly affected by gypsum treatment. Ca concentr ation increased in pods and seeds due to the gypsum application when averaged across (a) cultivars, developmental stages and sampling dates (Figures 41 and 4 2); (b) developmental stages and cultivars for three different sampling dates (Table 4 8); and (c ) sampling dates, cultivars, and calcium treatments for different developmental stages (Figures 4 3 and 44). Likewise, S showed an increase due to gypsum application in case (a) and (b), but not (c) as mentioned for Ca (Figures 4 1 and 42; Table 4 8). Ex cept for Ca, other minerals did not show any significant differences in their concentrations at different sampling dates. A reduction in P and Na concentration was observed in pods (Figure 41) and in P concentration in seeds (Figure 4 2) M g concentratio n was reduced in the seed (P = 0.006) but not in the pod. Zn concentration in the pod was not affected by gypsum application, al though it was reduced in the seed (P = 0.005) when treated with gypsum Other macronutrients and micronutrients did not differ significantly in concentration due to gypsum application. There was no significant calcium level interaction with cultivars, developmental stages or sampling dates for any mineral analyzed. Cultivar Differences C ultivar differences w ere observed for Ca (Ta bles 4 1 and 44) P (Table 4 4) and Zn (Table 4 5). Georgia Green had a higher calcium concentration in both pods (Table 43) and seeds (Table 4 6) compared to C 99R while P was higher in C 99R seeds and the Zn concentration w as higher in Georgia Green seeds (Table 4 6). Other minerals did not show significant cultivar differences for pod or seed composition.

PAGE 45

45 Macro nutrients and Micronutrients During Fruit Development Generally, t he concentration of all macro nutrients (Figure 4 5) and micronutrients (Figure 46) showed a decline during the maturation of both pods and seeds with the exception of Mn whose concentration increased in both pods and seeds (Figure 46) When the concentration of nutrients was compared between pods and see ds the differences were unaffected by cultivar, gypsum treatment or stage of development. The concentrations of Cu K and Ni were found to be almost equal in both pods and seeds. Concentrations of Ca, Fe, Na, and Mn were 1.5 to 2 times higher in pods than seeds. However, t he reverse trend was observed for S, P, Mg and Zn where concentration s were 1.5 to 2 times higher in seeds than pods Discussion Sorens e n and Butts (2008) reported no differences in Ca and S concentrations in leaves, pegs and immature p ods for three different gypsum rates (0, 504, 1008 lbs/A) at 80 DAP. In the present study, gypsum application increased Ca and S concentratio n in both the pods and seeds (Table 4 8) starting at the initial sampling of 70 DAP Differences in these two resul ts can be attributed to drought and the leaching ability of gypsum. Sorens e n and Butts (2008) mentioned that at the time of sampling, precipitation was very low, thus lowering gypsums ability to leach into the rooting and fruiting zone. However, at the ti me of harvest, precipitation was relatively high, thus allowing gypsum to leach into the soil, and as a result Ca concentration in mature seeds increased with an increase in the gypsum application rate. During the sampling times in 2007, 2008 and 2009 of t he present study, there was sufficient precipitation throughout the growing season (Table 3 7), allowing gypsum to leach into the fruiting zone and become available to the developing fruit, therefore showing significant differences even at 70 DAP. In the current study, a linear increase in Ca concentration was observed (Figures 4 3 and 4 4) for pods and seeds at the same physiological stages sampled over time However, this trend

PAGE 46

46 was not observed for S or other nutrients that were affected by gypsum appli cation. It can be hypothesized that the increase in calcium in the soil solution due to gypsum applications combined with increased transpiration rates as the plants grew over time, led to these linear increases in Ca concentration. There was a small dec rease in the P of both pods and seeds (Figures 41 and 42) sampled from the gypsum amended soils relative to the control Gypsum amendment to a Pineda sand soil type resulted in a 54 % decrease in P transport in the soil (Zhu and Alva, 1994) probably due to Ca P precipitation. It is possible that gypsum applications in the present study also precipitated the P, thus reducing its ability to leach into the soil and its availability to the developing tissues in the soil solution for absorption, ultimately resulting in reduced uptake by the peanut plant. G ypsum application significantly decreased the concentration of Na ions in pods compared to the nontreated control (Figure 4 1). Several studies have shown an interaction between Ca and Na ions in relation to fruit development. For example, high sodium or salinity restricts Ca uptake, availability, and transport to the growing regions of plant s and reduces fruit yield s (Cramer 2004; Kaya et al. 2002; Pal and Laloraya 1967). Gypsum application a meliorates the effect of high saline conditions (Khosla et al. 1979) and increases fruit yields (Kaya et al. 2002; Mizrahi 1982). Pal and Laloraya (1967) showed that the addition of NaCl to a peanut pod culture solution did not allow the pegs to develop into pods. They suggested that the Na ions may have played a role in inhibiting the uptake of Ca ions by the growing pegs. Kaya et al. (2002) obtained higher strawberry yield s when supplementary Ca was given to salt stressed plant s thus alleviat ing Ca deficiency symptoms. We observed a higher Ca concentration in the pods (Table 43) and seeds (Table 46) of the smaller seeded Georgia Green compared to the larger seeded C 99R. These values for each

PAGE 47

47 cultivar agree with previously reported values (Tillma n et al ., 2010; Sorenson and Butts 2008). C 99R has a thicker, denser hull (20.3%) compared to hulls of Georgia Green (18.5%, P 0.0001) with a smaller surface area:weight ratio. Sumner et al. (1988) found that larger seeded pods with a smaller surface area:weight ratio require a higher soil calcium concentration since they are less efficient in diffusion compared to smaller seeded pods. Consequently, it is likely that C 99R may have absorbed less Ca than Georgia Green, resulting in a lower Ca concentration. Similar to studies examining changes in mineral composition of developing Persimmon fruit (Clark and Smith, 1990) and primrose seeds (Zerche and Ewald, 2005), in the present study the concentration of all nutrients except Mn, was highest in immatur e peanut pod and seed st ages and declined with maturity The Persimmon study also showed that 80 % of Ca uptake was completed before the seed beg a n to mature. Pattee et al. (1974) described the pod as the initial metabolic reserve for developing seed s The young developing pod takes up Ca via passive diffusion from the soil solution for subsequent seed development and later the pod becomes metabolically inert due to lignifications of the pod wall. Ultra structural analysis of peanut cotyledons (Young et al ., 2004) showed active synthesis of starch granules during early stage s of seed development. This requires the activation of plastidial ADP glucose pyrophosphorylase. Sukhija et al. (1987) reported that 1015 days after pod formation ( stage 2 of frui t development) was the crucial time period for oil bod y formation. P, S, and Zn are required for the formation of oil bodies. Thus, the high concentration of nutrients in immature p eanut pods and seeds is required for their high metabolic activit y.

PAGE 48

48 Ta ble 41. ANOVA probability values for macronutrients determined for gypsum treatment, cultivar and pod developmental stage for peanuts grown near Citra, FL in 2007, 2008 and 2009. Probability values for Ca were calculated for 2007, 2008 and 2009 while those for S, Mg, K and P were calculated for 2008 and 2009. Effect Mineral P Values Ca S Mg K P Gypsum Treatment <0.0001 <0.0001 0.36 0.45 0.01 Cultivar <0.0001 0.6 0.02 0.48 0.48 Stage <0.0001 <0.0001 <0.0001 0.0007 <0.001 Table 42. ANOVA probability values for micronutrients determined for gypsum treatment, cultivar and pod developmental stage for peanuts grown near Citra, FL in 2008 and 2009. Effect Mineral P Values Cu Mn Ni Fe Na Zn Gypsum Treatment 0.33 0.28 0.33 0.05 0.03 0.72 Cultivar 0.08 0.15 0.23 0.34 0.4 0.86 Stage 0.33 0.33 0.26 0.002 0.006 <0.0001 Table 43. Mineral analysis of peanut pods for Ca, P and Zn for two peanut cultivars. Each value for Ca represents the mean of at least three replicates taken in 2007, 2008 and 2009, while each value for P and Zn represents the mean of at least three replicates taken in 2008 and 2009. Means followed by the same letter within each element are not different at P Effect Mineral Composition Cultivar Ca P Zn C 99R 1.75 a 1.52 a 19.73 a Georgia Green 2.15 b 1.46 a 19.58 a Concentration in mg/g Concentration in g/g Table 44. ANOVA probability values of macronutrients determined for gypsum treatment, cultivar and seed developmental stage for peanuts grown near Citra, FL in 2007, 2008 and 2009. Probability values for Ca were calculated for 2007, 2008 and 2009 while those for S, Mg, K and P were calculated for 2008 and 2009. Effect Mineral P Values Ca S Mg K P Gypsum Treatment < 0.0001 <0.0001 0.006 0.29 0.045 Cultivar 0.0022 0.78 0.15 0.62 0.03 Stage <0.0001 0.0002 0.001 <0.0001 0.004

PAGE 49

49 Table 45. ANOVA probability values for micronutrients determined for gypsum treatment, cultivar and seed developmental stages for peanuts grown near Citra, FL in 2008 and 2009. Effect Mineral P Values Cu Mn Ni Fe Na Zn Gypsum Treatment 0.17 0.9 0.88 0.27 0.12 0.005 Cultivar 0.24 0.08 0.67 0.22 0.29 0.02 Stage 0.04 <0.0001 0.0002 <0.0001 0.001 <0.0001 Table 46. Mineral analysis of peanut seed for Ca, P and Zn for two peanut cultivars. Each value for Ca represents the mean of at least 3 replicates taken in 2007, 2008 and 2009, while each value for P and Zn represents the mean of at least 3 replicates taken in 2008 and 2009. Means followed by different letter s within each element are different at P Effect Mineral Composition Cultivar Ca P Zn C 99R 0.83 a 3.93 a 38.13 a Georgia Green 1.07 b 3.81 b 39.16 b Concentration in mg/g Concentration in g/g Table 47. Monthly average rainfall data for the 2007, 2008 and 2009 peanut growing seasons at Citra, FL. Data obtained from the Florida Automated Weather Network (FAWN). Period 2m Rain tot al (in ches ) May 07 0.16 Jun 07 4.36 Jul 07 6.5 Aug 07 3 Sep 07 5.69 Oct 07 6.85 May 08 0.6 Jun 08 7.04 Jul 08 4.05 Aug 08 4.57 Sep 08 1.74 Oct 08 1.73 May 09 9.01 Jun 09 6.48 Jul 09 4.31 Aug 09 4.21 Sep 09 4.59 Oct 09 1.52

PAGE 50

50 Table 48. Ca and S content of pods and seeds at 70,100 and 130 DAP for peanuts grown near Citra, FL in 2007, 2008 and 2009 with and without gypsum treatment. Each value for Ca represents the mean for two peanut cultivars and all developmental stages in 2007, 2008 and 2009, while each value for S represents the mean for two peanut cultivars and all developmental stages in 2008 and 2009. Means followed by different letters in each DAP are significantly different at P Gypsum Treatment Days After Plan ting 70 100 130 Pod Ca Non Treated 1.2 a 1.64a 1.72a Treated 2.06 b 2.55b 2.68b Seed Ca Non Treated 0.55 a 0.87a 0.77a Treated 1.07 b 1.14b 1.16b Pod S Non Treated 1.15a 1. 08a NA Treated 2.17b 2.08b Seed S Non Treated 2.11a 1.97a NA Treated 2.62b 2.64b *Concentration in mg/g

PAGE 51

51 Gypsum Treatment Non Treated TreatedConcentration (mg/g) 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Calcium Sulphur Phosphorus Concentration (ug/g) 40 60 80 100 120 140 160 Sodium Figure 41. Effect of gypsum treatment on pod nutrient composition. Each value represents the mean of at least three replicates. Values for calcium represent means of at least three replicates for the years 2007, 2008 and 2009. Values for the other minerals repre sent the mean of three replicates for the years 2008 and 2009. The Y axis on the right estimates the Na concentration and the Y axis on the left estimates Ca, P and S concentration. Gypsum application increased the Ca (P < 0.0001) and S (P < 0.0001) concen trations, and decreased the P (P = 0.01) and Na (P = 0.03) concentrations

PAGE 52

52 Gypsum Treatment Non-Treated TreatedConcentration (mg/g) 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 Calcium Sulphur Phosphorus Figure 4 2. Effect of gypsum application on seed nutrient composition. Each value represents the mean of at least three replicates. Values fo r calcium represent the mean of at least three replicates for the years 2007, 2008 and 2009. Values for the other minerals represent means of three replicates for the years 2008 and 2009. Gypsum application increased the Ca (P < 0.0001) and S (P < 0.0001) concentrations, and decreased the P (P = 0.04) concentrations.

PAGE 53

53 Figure 43. Ca concentration of peanut pods for four developmental stages sampled at 70,100 and 130 DAP. Each value represents the mean of at least three replicates averaged over gypsum treatment and two cultivars during 2007, 2008 and 2009. Standard errors are represented as vertical bars. Mean value data points followed by the same letter in the same graph are similar based on Tukey Kramer s mean separation (P 0.05).

PAGE 54

54 Figure 4 4. Ca concentration of peanut seeds at for four developmental stages sampled at 70,100 and 130 DAP. Each value represents the mean for at least three replicates averaged over gypsum treatment and two cultivars during 2007, 2008 and 2009. Standard errors are represented as vertical bars. Different letters within the same graph are different based on Tukey Kramers mean separation (P

PAGE 55

55 Concentration (mg/g) a b b ab a b b b 0 0.5 1 1.5 2 2.5 3 a b c d a ab b b 0 0.5 1 1.5 2 2.5 3 Concentration (mg/g) a a b c a ab b b 0 0.5 1 1.5 2 2.5 VIm Im Ma VMa ab a bc c a a b b 0 2 4 6 8 10 12 14 a b c d a b b b 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 VIm Im Ma VMa Pod Seed Calcium Sulphur Magnesium Potassium Phosphorus Peanut Fruit Developmental Stages Figure 45. Concentration of macronutrients in four stages of peanut pod and seed development. Except for calcium, each value represents the mean of at least three replicates for the years 2008 and 2009 with standard errors shown by vertical bars. Values for calcium represent the mean of at least three replicates for the years 2007, 2008 and 2009. Mean value data points with the same letter in the same tissue within each graph are not different based on Tukey Kramers mean s eparation (P 0.05). VIm: Very Immature; Im: Immature; Ma: M ature; VMa: Very Mature.

PAGE 56

56 a a a a a a a a 5 6 7 8 9 10 a b c d a b c c 0 10 20 30 40 50 a ab b b a ab bc c 20 40 60 80 100 120 140 160 a ab b b a ab b b 0 50 100 150 200 VIm Im Ma VMa Pod Seed Concentration (g/g) Concentration (g/g) Peanut Fruit Developmental Stages Copper Nickel Manganese Zinc Iron Sodium c bc a ab c c b a 10 20 30 40 VIm Im Ma VMa a a a a a a b b 0 1 2 3 4 Figure 46. Concentration of micronutrients in four stages of peanut pod and seed development. Each value represents the mean of at least three replicates for the years 2008 and 2009 with standard e rror s shown by vertical bars. Mean value data points followed by the same letter in the same tissue within each graph are not different based on Tuk ey Kramers mean separation (P 0.05). VIm: Very Immature; Im: Immature; Ma: Mature; VMa: Very Mature.

PAGE 57

57 CHAPTER 5 THE EFFECT OF CALCIU M ON EXPRESSION AND LOCALIZATION OF CALC IUM DEPENDENT PROTEIN KI NASES IN PEANUT FRUI T Introduction Arachis hypogaea L., cultivated peanut, is a relatively large seeded legume that differs from most other plant species in its geo carpic reproductive growth, which is marked by underground development of fruit following pollination and fertilization of air borne flowers. Consequently, the young, developing fruit is photosynthetically inactive and relies on a maternal assimilate suppl y. Calcium can not be repartitioned from older to actively growing tissue via the phloem route. Therefore, younger and actively growing fruit must fulfill its requirement utilizing either immediately available xylemmobile calcium or that passively absorbed via epidermal layers of pod, thus posing additional burden on the growing fruit developing underground and lacking significant transpirational pull. Although low soil calcium concentrations do not inhibit the developmental progression of pods, they do inc rease seed abortion rates resulting in pops or empty pods (Smith, 1956). The physiological basis of calciums effect on peanut fruit development has been reported (Skelton and Shear, 1971; Wiersum, 1951). However, the molecular mechanisms involved in these processes are not understood. One approach to understanding the molecular basis of calcium signaling in peanut is to study a class of calcium sensors known as Calcium Dependent Protein Kinase s (CDPK s ) CDPKs are unique to vascular and nonvascular plants, green algae and protists, and possess a calcium regulated calmodulinlike regulatory domain located at the C terminal end of the enzyme (Chandran et al ., 2006). CDPKs recognize changes in intracellular calcium concentrations as a result of calcium d irectly binding to their C terminal domain which allows for conformational change and the activation of an N terminal kinase domain ( Klimecka and 2007). Along with CDPK related kinases (CRKs), phosphoenol pyruvate

PAGE 58

58 carboxylase kinases (PPCKs), PEP carboxylase kinaserelated kinases (PEPRKs), calmodulin dependent protein kinases (CaMKs), calcium and calmodulindependent protein kinases (CCaMKs), and Sucrose nonfermenting 1 related kinases (SnRK1, 2 and 3), CDPKs form the highly diverse and widespre ad Ser/Thr protein kinase superfamily, and represent 4% of the predicted 25,500 genes in Arabidopsis (Hrabak et al 2003). There is evidence that CDPKs are important for normal seed development. Frattini et al. (1999) showed that two rice CDPK isoforms, O sCDPK2 and OsCDPK11, were differentially expressed during seed development. Low expression of the OsCDPK2 protein was observed during early developmental stages increasing through maturity, while OsCDPK11 showed down regulation during later stages of deve lopment. In a later study, over expression of OsCDPK2 in transgenic rice blocked seed development at a very early stage (Morello et al. 2000). In Arabidopsis knockouts of CPK28 resulted in embryo lethality (Harper et al. 2004). Likewise, a CDPK was identified in sandalwood embryogenic cultures that accumulated to high levels during somatic and zygotic embryogenesis, endosperm development, and seed germination, and was undetectable in mature organs such as shoots and flowers (Anil et al. 2000). Dasgupta (1994) characterized a 53 kD peanut CDPK (GnCDPK) from mature seed. However, little is known regarding a role for CDPKs in peanut fruit development. Because peanuts subterranean seed development relies primarily upon the sensing a nd response of the young, underground developing fruit to calcium levels in the soil, changes in CDPK expression were examined during peanut fruit development in low calcium soils and in the same soils supplemented with calcium via gypsum application.

PAGE 59

59 Materials and Methods Peanut Fruit Samples In 2008, soil samples (Candler fine sand, Citra, FL) from experimental plots were analyzed (Waters Agriculture Laboratories, Camilla, GA) four wks before planting and contained Ca at 221 lbs/acre, P at 43 lbs/acre, K at 19 lbs/acre, Mg at 14 lbs/acre, B at 0.2 lbs/acre and Mn at 2 lbs/acre with a pH of 5.4. Peanut fruit of cv. Georgia Green at all four developmental stages, V ery Im mature (VIm), Im mature (Im), M a ture (Ma) and V ery Ma ture (VMa), was collected at 100 DA P from untreated (Ca at 221 lbs/acre) and gypsum treated (2500 lbs/acre) soils, as described in previous chapters. Pod and seed samples were immediately frozen in liquid nitrogen upon collection and stored at 80 C until further use. Total Protein Isolation Total protein was isolated using modified protocols from Koppelman et al. (2001) and Anil et al. (2000) as follows. Frozen seeds and pods were separated and ground to a fine powder in liquid nitrogen. To 100 mg of this ground powder, 1 ml of protein extraction buffer was added which contained 20 mM Tris mercaptoet hanol and 10 l of plant protease inhibitor cocktail (Sigma Aldrich, St. Louis, MO). The homogenate was stirred at room temperature for 10 min, and then centrifuged at 5000 rpm (4 C) for 30 min. The clear supernatant was removed and further centrifuged a t 10,000 rpm (4 C) for 60 min to remove traces of oil bodies. Protein extracts were stored at 20 C until further use. Protein concentration was determined using the Dc Protein Assay kit with BSA as the standard following the manufacturers instructions (Bio Rad Laboratories, Hercules, CA). SDS PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis was performed by a modified method of Lammeli (1970) using the Mini Tran system (Invitrogen Corporation, Carlsbad, CA).

PAGE 60

60 Protein extracts were mixed with 2 sample buffer and 1 mM DTT and denatured at 70 C for 10 min followed by centrifugation for 15 sec. Total protein was resolved on precasted 4 12 % NuPAGE gels (Invitrogen Corporation, Carlsbad, CA) in running buffer (5.23 g/L 3(N morpholino) pr opanesulfonic acid (MOPS), 3.03 g/L Tris Base, 0.5 g/L SDS and 0.15 g/L EDTA) at 120 V for 90 min. Prior to transfer and Western blotting, an identical gel was stained and checked for equal sample loading by staining in 0.1 % Commassie Brilliant Blue R 250 (CBB) for 3 to 5 hrs and then destaining (40 % methanol, 10 % glacial acetic acid and 50 % D/W) for 1 hr followed by dehydrating the CBB stained gels on a gel dryer (Model 583, BioRadLaboratories, Hercules, CA). SeaBlue Plus2 prestained molecular weigh t markers (191 14 kD) were used as the standard marker (Invitrogen Corporation, Carlsbad, CA). CDPK Antibody A polyclonal soybean CDPK antibody was kindly provided by Dr. Alice Harmon (Dept. of Biology, University of Florida). The antibody was raised in r abbits against the calmodulin like domain of and affinity purified using the recombinant calmodulinlike domain (Bachmann et al. ,1996). This antibody recognizes many isoforms including soybean CDPK alpha, gamma, beta and Ar abidopsis CPK1 and CPK4 (Harmon, personal communication). Western Blot Proteins were transferred onto nitrocellulose membranes (GE Water and Process Technologies, Trevose, PA) using a transfer buffer of 25 mM Tris Base, 192 mM Glycine and 20 % methanol overnight at 15 mA. Then the membranes were stained with Ponceau S (0.5 % in 3 % tricarboxylic acid) to verify the transfer efficiency. Membranes were destained with 1x TBS buffer for 15 min.

PAGE 61

61 The Westernbreeze chemiluminescent immunodetection kit (Invitrogen Corporation, Carlsbad, CA) was used for Western blot analysis. The polyclonal soybean CDPK antibody was diluted to 1:6000 with blocking solution. The Western blot was performed as described by the manufacturer. The nitrocellulose membrane was incubated wi th blocking solution for 30 min, followed by a wash with distilled water for 5 min. The membrane was incubated for 1 hr with primary CDPK antibody on a glass plate covered with a piece of parafilm ironed on the surface to make it adhere. The blot was washe d 3 times for 5 min each. The alkaline phosphatase conjugated secondary antibody was incubated for 30 min with the blot in a similar manner as the CDPK antibody incubation, followed by 3 antibody washes each for 5 min and 2 washes of distilled water each for 2 min. The chemiluminescent substrate with enhancer was added to the membrane and the signal was developed for 5 min. Any excessive substrate was soaked with blotting paper and the blot was sandwiched between two transparency sheets. The sandwich was t hen exposed to X ray film (Kodak BioMax, Rochester, NY). Seeds protein blots were exposed for 7 min, while pod protein blots were exposed for 15 min due to lower protein concentrations. Total RNA Isolation Total RNA was isolated using the Trizol method (I nvitrogen Corporation, Carlsbad, CA). Frozen tissue (100 mg) was ground to a fine powder, resuspended in 1 ml Trizol reagent and incubated at room temperature for 1015 min. Chloroform (200 l) was added and the extracts were vortexed for 10 sec, followed by gentle shaking for 10 min. The two phases were separated by centrifugation at 13,000 rpm for 15 min at 4 C. The upper aqueous phase was removed to a new tube, and RNA was precipitated by adding 500 l isopropanol and incubated at room temperature for 1 0 min, followed by centrifugation at 13,000 rpm for 10 min at 4 C. The RNA pellet was washed in 200 l of 75 % ethanol (in DEPC treated water), air dried for 10 min and

PAGE 62

62 resuspended in 80 l of DEPC treated water. The concentration of total RNA was quantif ied using the Nano drop (Thermo Scientific, Wilmington, DE). First Strand cDNA S ynthesis First strand cDNA synthesis was performed using the VILO cDNA synthesis kit (Invitrogen Corporation, Carlsbad, CA) according to the manufacturers instructions. 5VILO reaction mix, 10 reverse transcriptase, and DEPC treated water were added to 2.5 g total RNA in a 20 l final volume. The reaction contents were gently mixed and incubated at 25 C for 10 min followed by further incubation at 42 C for 5 min. The reacti on was terminated by incubating at 85 C for 5 min. Quantitative RT PCR of CDPK Real time quantitative PCR was performed using the Brilliant II SYBR Green qPCR mix on an Mx3000P platform (Stratagene, Agilent Technologies, Santa Clara, CA) The PCR reacti ons were prepared according to the manufacturers instructions and contained 200 nM of both the forward and reverse genespecific primers (Table 5 1) and 2 L of the 5fold diluted RT reaction in a final volume of 25 L. The thermal cycling protocol entail ed activation of SureStart Taq DNA polymerase at 95 C for 15 min. The PCR amplification was carried out for 40 cycles with denaturation at 94 C for 10 s, and primer annealing and extension at 56 C and 72 C for 30 s each, respectively. Optical data were acquired following the extension step, and the PCR reactions were subject to melting curve analysis beginning at 55 C through 95 C, at 0.2 C s1. Elongation factor 1 alpha ( EF1a ) was used as the endogenous reference gene for normalizing the transcript profiles The primers used for qRT PCR analysis are summarized in Table 5 1. The real time PCR data were calibrated relative to the transcript levels in VIm stages following the 2method for relative quantification (Livak and Schmittgen 2001). The data are presented as

PAGE 63

63 an average S.D. of three independently made RT preparations used for the PCR run, each having three replicates. Immunolocalization of CDPK in P eanut F ruits CDPK was localized i n VIm fruits by the SuperPicTure Polymer Detection Kit (Zymed, Invitrogen Immunodetection, Carlsbad, CA). Thin hand cut transverse sections of peanut pods were floated on PBS buffer, and incubated in 30 % H2O2: methanol (1:9 v/v) for 10 min, followed by washing twice in PBS for 2 min each. The sections wer e incubated in primary Ab (1:6000 dilution, 1 hr, 4 C) in a moist chamber. The sections were washed in PBS, and covered in HRP polymer conjugate for 10 min. The color was developed after washing the sections again in PBS, and incubating in DAB chromogen f or 5 min. The peroxidase catalyzes the substrate ( H2O2) and converts the chromogen to a brown deposit to visualize the location of the antigen. The peroxidase reaction was stopped by flushing water. The sections were dehydrated in a series of alcohol and x ylene, and mounted in HistomountTM (Invitrogen Corporation, Carlsbad, CA) prior to imaging. Results Transcript profiles of CDPK during development of peanut seeds and pods are represented in Figures 5 1A and 52A, respectively. In seed, quantitative RT PC R data showed that CDPK expression is spatiotemporally regulated, and is also responsive to gypsum. Regardless of gypsum treatment, CDPK transcripts had a bimodal profile with the highest levels observed in VIm seed and in Ma seed with significantly lower levels in Im seed and the lowest levels in VMa seed (Figure 5 1A). Gypsum treatment resulted in down regulating the expression of CDPK with 2to 3fold lower transcript levels observed at each seed developmental stage. Unlike developing seed tissue, CDPK transcription was similar for VIm, Im and Ma pods, and was unaffected by gypsum application (Figure 52A).

PAGE 64

64 The fidelity of the qPCR amplification product was confirmed by cloning and sequencing of the PC R amplification product, and by diss ociation curve analysis. T he cloned amplified product was 100 % identical to the Arachis CDPK (GenBank Acc. # DQ074454), and the melting curve analysis also showed a single sharp peak centered around 80.5 C Therefore, even though the deduced amino acid sequence for th e qRT PCR product spans the extremely conserved CDPK catalytic kinase domain (spanning the 213 248 aa residue region), it is highly unlikely that the qRT PCR primers used in the present investigation yielded any nonspecific reaction products. The CDPK prot ein expression patterns corroborated the qRT PCR data (Figures 5 1B and 52B) excluding the likelihood of posttranscriptional regulation of CDPK expression during development of either the peanut seed or pod. In seeds and pods, a 53 kDa band was obtained, as previously reported by Dasgupta (1994), for the VIm, Im and Ma stages of development. VMa fruit stages consistently showed negligible (seed) or undetectable (pod) expression of CDPK protein. Tissue specific expression of CDPK was further validated by i mmunolocalization in VIm fruits. The immunoreactive CDPK was primarily found in the outer most cell layers of the pericarp and around vascular bundles linked by lateral connections in the pod (Figure 5 3A) as well as in the single vascular trace that supplies nutrients to the developing ovule (Figure 5 3B) Discussion To the best of our knowledge, this is the first report describing developmentally regulated CDPK expression profiles in peanut fruits. Given that a) calcium is phloem immobile, and b) consequently peanuts hypogeal reproductive development is entirely dependent upon sensing and response of the young, underground developing fruit to calcium levels in the soil; changes in

PAGE 65

65 CDPK expression were examined during peanut fruit development under deficient and adequate calcium levels following gypsum treatment. Developing peanut fruit is highly heterogeneous, consisting of the maternal seed coat and pod tissues and the filial embryonic and cotyledonary tissues Their successive development and differentiation is a s equential and continuous process and must rely on successful integration of environmental and developmental cues, supported by adequate assimilate partitioning from the mother plant. Calcium is an important macronutrient passively absorbed through the soil, and required by developing peanut fruits both for nutritional needs, as well as signaling functions. Generally, CDPK expression was higher in young developmental stages, in both seeds and pods, and declined considerably in mature desiccated fruit, reflective of its high metabolic status and steep grow th kinetics. Notably, young seeds showed a bimodal profile for CDPK transcript and protein abundance (Figure 51), in sharp contrast to pods (Figure 5 2). Dynamic reorganization of cytoskeleton elements is deemed essential for mitotic growth of young developing seeds, and may be dependent upon CDPK activity. In plant cells, G and F actins co localize with CDPK (Putnam Evans et al 1989 ), and Ca dependent reversible phosphorylation of G and F actins is necessary for actin mediated interactions (Grabski et al., 1998, Smertenko et al ., 1998). While seed mitotic activity is restricted to early developmental stages followed by cell expansion and storage product accumulation later on, pods have to undergo continued cellular proliferation and rapid expansion in order to accommodate cotyledonary growth during the storage phase, thus explaining consistently high CDPK expression in pods throughout the early developmental stages. In addition to a role in early mitotic growth, CDPKs also have a significant influence on storage product biosyntheses. Carbohydrates are the major storage metabolite during early

PAGE 66

66 development of peanut seed, until lipid bodies take over later during maturation (Basha et al ., 1976, Pattee et al ., 1974). Hale (1978) showed that regardless of the calcium level in the soil fruiting zone, the highest concentration of sucrose on a dry weight basis was found in immature fruit. Sucrose is the primary photoassimilated metabolite transported through phloem to sink organs, where it is hydrolyzed by sucrose synthase or invertase ( Chourey et al 1998, Winter and Huber 2000) Sucrose synthase mediated reversible conversion of sucrose in the presence of UDP to UDP glucose and fructose is the committed step in storage starch biosynthesis ( Chourey et al 1998). CDPKmediated phosphorylation has earlier been implicated in activation of sucrose synthase (SuSy) dependent post phloem assimilate unloading in developing filial tissue. Highly abundant SuSy transcript levels in developing seeds in rice (Shimada et al ., 2009), tomato (Anguenot et al ., 2006) and Vicia faba (Weber et al ., 1996) are reflective of active sucrose turnover reactions. Sucrose synthase activity is regulated by reversible phosphorylation. Shimada et al (2009) showed that SPK (CDPK) mediated phosphorylation of serine residue at the RXXS site is essential for the degradation of sucrose by SuSy in endosperm. Furthermore, transgenic rice plants expressing antisense SPK showed normal vegetative growth and reproductive phase transition, however, failed to accumulate storage starch thus compromising the sink strength (Shimada et al ., 2004). Transient upregulation of a sucrose inducible CDPK, and transcript localization in sucrose accumulating cell layers was observed in stolon tips during tuber formation in potato (Raices et al ., 2003). In tomato, Auguenot et al (2006) reported the association of membrane associated CDPK enhancing the efficiency of SuSy for sucrose metabolism in young tomato fruits. Phosphorylation of sucrose synthase by CDPK, represents a key event during transition from mitotic to growth/expansion phase, and metabolic switch to sucrose synthase mediated control of storage product accumulation. The elevated CDPK

PAGE 67

67 expression (Figure 51) during transition to storage phase supports the regulatory role of CDPK during peanut seed development. Higher CDPK expression in the Ma seed stages, as compared to the Im stages, may also be related to the biogenesis of oil bodies which accumulate dur ing late stages of seed maturity (Pattee et al ., 1974). Li et al. (2009) showed that two peanut seed specific oleosin gene transcripts, AhOleo17.8 and AhOleo18.5, were highly abundant in the mature embryo. Oleosins are small molecular mass proteins located on the oil body surface that prevent the phospholipid layers from contacting and coalescing with each other. Anil et al (2003) showed immunoreactive CDPK in the oil body associated protein fraction of mature seeds of sandalwood, sunflower, safflower, se same, cotton and peanut. This suggests a direct role of CDPKs with oil body biogenesis and oil formation. Studies addressing the physiological and biochemical properties of the peanut pod are limited. Pattee et al (1974) showed higher levels of total s ugar and starch in the pod of VIm and Im stages declining rapidly as maturity was reached, in line with the metabolic role of sucrose supporting high growth rate and mitotic activity in young pods and for providing C moieties for cell wall biosynthesis dur ing maturation. Also, an increase in the residue weight due to deposition of lignocellulosic material was observed as the pod was maturing. The authors postulated that the decline in sugar levels and the increase in lignocellulosic material were due to the conversion of sugars to lignocelluloses. The high CDPK transcript levels observed in the first three developmental stages indicates that the pod is metabolically active. Unlike seeds, soil calcium levels did not affect the expression of CDPK in pod tissue (Figure 5 2) Phenotypic analysis revealed that pods developed (length) normally with or without gypsum amendement (see Chapter 3, Table 31). Also, low soil calcium has more

PAGE 68

68 deleterious effects on seed filling than pod development (Colwell and Brady, 1945). At maturity, calcium is required for the structural integrity of the pod, while for seed it is required primarily as a nutrient and signaling molecule. Hence the data reported here on pod CDPK expression supports observations made by Pattee et al ( 1974) that at young stages, the pod is a nutritional reservoir for the developing seed and at maturity it is a protective barrier. Gypsum amendment may adversely affect mobility, transport and bioavailability of soil phosphorus by precipitating it out of the soil solution (Zhu and Alva 1994 ). Also, CDPK expression has been shown to be elevated when phosphorus availability is low, for example in the moss Funaria hygrometrica (Mitra and Johri 2000) and in Arabidopsis roots (Wu et al ., 2003). Despite the significantly lower total phosphorus content in both peanut pods and seeds produced under gypsum amended soil conditions (Figures 4 3 and 44, Chapter 4), no such regulatory role of phosphorus availability on CDPK expression was discernible dur ing peanut pod and seed development (Figures 51 and 52). The addition of gypsum to the soil also provides sulphur to the developing peanut fruit As with phosphorus, sulphur starvation was shown to increase the transcript levels of CDPK in the mo ss Funaria hygrometrica (Mitra and Johri, 2000). In the present study, seeds from the non gypsum amended soil had high CDPK transcript levels and protein expression compared to those from gypsum amended soil, however the sulphur concentration in both tiss ues did not increase when gypsum was supplied (Table 4 8, Chapter 4). Therefore, it decreases the possibility that enhanced CDPK expression under the nongypsum condition was a result of sulphur starvation. It may, therefore, be argued that CDPK expressio n in peanut fruit is primarily dependent on the direct availability of soil calcium, rather than other macronutrients.

PAGE 69

69 Table 51. Primers for qRT PCR of CDPK and EF1 at four stages of peanut fruit developmental for cv. Georgia Green produced under gypsum treated or gypsum nontreated soils in Citra, FL during 2008. Type Accession No Forward Reverse CDPK DQ074454 5 TCA AAC GAG AAC CTT GGC CGA GTA 3 5 GCT CAA GCA CCT GTT TGG CAG TTA 3 EF1 EZ748096 5 AGTTTGCTGAGCTCCAGACCAAGA 3 5 TCCCTCACAGCAAACCTTCCAAGT 3

PAGE 70

70 Figure 51. CDPK expression in four seed developmental stages of cv. Georgia Green at 100 DAP produced under gypsum treated or gypsum nontreated soils in Citra, F L during 2008. A) Quantitative RT PCR with the Very Immature (VIm) seed under gypsum treatment used to calibrate expression levels Elongation factor 1 alpha ( EF1 was used as the endogenous reference gene for normalizing transcript profiles. The data rep resent av g +/ SD for three independently made RT reactions, each having three technical replicates. (B) W estern blot analysis with s oybean CDPK antibody (1:6000). Developmental stages are described below the western blot image. VIm Very I mmature seed; Im I mmature seed; MaM ature seed; VMaVery Mature seed A) B)

PAGE 71

71 Figure 52. CDPK expression in four pod developmental stages of cv. Georgia Green at 100 DAP produced under gypsum treated or gypsum nontreated soils in Citra, FL during 2008. A) Quantitative RT PCR with the Very Immature (VIm) pod under gypsum treatment used to calibrate expression levels. Elongation factor 1 alpha (EF1 ) was used as the endogenous reference gene for normalizing transcript profiles.The data represent av g +/ SD fo r three independently made RT reactions, each having three technical replicates. (B) Western blot analysis with s oybean CDPK antibody (1:6000). Developmental stages are described below the Western blot image. VIm Very Immature seed; Im Immature seed; MaMature seed; VMaVery Mature seed. Figure 53. CDPK immunolocalization in very immature fruit of cv Georgia Green. (A) Transverse section of fruit; (B) Transverse section of fruit with developing seed evident. Dark stained regions indicate the presence of CDPK. Magnification bar is 1mm. C) Transverse section of fruit as the CDPK negative control usin g secondary antibody. Pa: Parechymatous Tissue; P: Pericarp; O: Developing Ovule; VB: Vascular Bundles. Pa P A) B) A) B) C)

PAGE 72

72 CHAPTER 6 CONCLUSION AND FUTURE RESEARCH It is clear that calcium plays a major role in peanut fruit development, particularly as it relates to distal seed production and proper fruit maturation with the effects being significant by mid season. The present study used destructive sampling to investigate the effect of calcium on the development of peanut pods and seed. Future research should focus on rea l time tracking of calcium under different calcium regimes to more accurately assess its role in peanut fruit development. Likewise, controlled environment experiments should be developed to eliminate the variability associated with field environmental fa ctors such as rainfall, light, temperature and pests. Apart of fromits role as a nutrient, calcium also acts as a secondary messenger. Calcium dependent protein kinases (CDPK) are a class of calcium sensors that play a vital role in sensing different calcium levels as a response to environmental stimuli and developmental processes. In peanut fruit, CDPK expression appears to be under transcriptional control. Pod analysis showed that CDPK expression was not affected by gypsum treatment or by development ex cept at the most mature stage. In contrast, seeds had lower CDPK transcript and protein levels under gypsum treatment, suggesting that seed CDPKs, unlike pod CDPKs, can sense differences in soil calcium levels. Additionally, seeds showed a bimodal express ion pattern over maturation indicating that seed CDPKs are also regulated by developmental cues. In the future, CDPK expression should be examined in other peanut tissues such as roots, leaves, stems and flowers. Additionally, since peanut is an allotetra ploid with a relatively large genome, there are probably numerous peanut CDPK genes. This study was limited in that it could not distinguish members of the peanut CDPK gene family. Future work should focus on the cloning of peanut CDPK genes to characteri ze them and to better understand their contributions to peanut development.

PAGE 73

73 LIST OF REFERENCES Alva A.K., Gascho G.J. (1991) Differential leaching of cations and sulfate in gypsum amended soils. Communications in Soil Science and Plant Analysis 22:11951206. Anguenot R., NguyenQuoc B., Yelle S., Michaud D. (2006) Protein phosphorylation and membrane association of sucrose synthase in developing tomato fruit. Plant Physiology and Biochemistry 44:294 300. Anil V.S., Harmon A.C., Rao K.S. (2000) Spatio temporal accumulation and activity of calciumdependent protein kinases during embryogenesis, seed development, and germination in sandalwood. Plant Physiology 122:10351043. Anil V.S., Harmon A.C., Rao K.S. (2003) Temporal association of Ca2+depende nt protein kinase with oil bodies during seed development in Santalum album L.: Its biochemical characterization and significance. Plant and Cell Physiology 44:367376. Bachmann M., Shiraishi N., Campbell W.H., Yoo B.C., Harmon A.C., Huber S.C. (1996) Iden tification of Ser 543 as the major regulatory phosphorylation site in spinach leaf nitrate reductase. Plant Cell 8:505 517. Barker N.P. (2005) A review and survey of basicarpy, geocarpy, and amphicarpy in the African and Madagascan flora. Annals of the Mis souri Botanical Garden 92:445462. Basha S.M.M., Cherry J.P., Young C.T. (1976) Changes in free amino acids, carbohydrates, and proteins of maturing seeds from various peanut ( Arachis hypogaea L. ) cultivars. Cereal Chemistry 53:586597. Bledsoe R.W., Comar C.L., Harris H.C. (1949) Absorption of radioactive calcium by the peanut fruit. Science 109:329330. Boote K.J. (1982) Growth stages of peanut ( Arachis hypogaea L.). Peanut Science 9:3540. Boote K.J., Stansell J.R., Stansell A.M., Stone J.T. (1982) Irrigation, water use and water relations, in: P. HE and Y. CT (Eds.), Peanut Science and Technology, American Peanut Research and E ducation Society Inc., Yoakum, TX 164205. Buster T.P (1979) Soil survey of Marion county, Florida Soil Conse rvation Service, Washington, D.C. Chandran V., Stollar E.J., Lindorff Larsen K., Harper J.F., Chazin W.J., Dobson C.M., Luisi B.F., Christodoulou J. (2006) Structure of the regulatory apparatus of a calcium dependent protein kinase (CDPK): A novel mode of calmodulintarget recognition. Journal of Molecular Biology 357:400410. Cheng S.H., Willmann M.R., Chen H.C., Sheen J. (2002) Calcium signaling through protein kinases. The Arabidopsis calcium dependent protein kinase gene family. Plant Physiology 129:469485.

PAGE 74

74 Chourey P.S., Taliercio E.W., Carlson S.J., Ruan Y.L. (1998) Genetic evidence that the two isozymes of sucrose synthase present in developing maize endosperm are critical, one for cell wall integrity and the other for starch biosynthesis. Molecular and General Genetics 259:8896. Clark C.J., Smith G.S. (1990) Seasonal changes in the composition, distribution and accumulation of mineral nutrients in persimmon fruit. Scientia Horticulturae 42:99 111. Colwell W.E., Brady N.C. (1945) The effect of calcium on certain characteristics of peanut fruit. Journal of the American Society of Agronomy 37:696708. Cox F.R., Adams F., Tucker B B. (1982) Liming, fertilization, and mineral nutrition, in: P. HE and Y. CT (Eds.), Peanut Science and Technology, American Peanut Research and E ducation Society Inc., Yoakum, TX. 139163. Cramer G. (2004) Sodium c alcium i nteractions under s alinity s tress, s alinity: e nvironment plants m olecules, Springer Netherlands. 205227. Dasgupta M. (1994) Characterization of a calcium dependent prote in kinase from Arachis hypogea (groundnut) seeds. Plant Physiology 104:961969. DeFalco T.A., Bender K.W., Snedden W.A. (2010) Breaking the code: Ca2+ sensors in plant signalling Biochemical Journal 425:2740. Duan C.Q., Shen Y.Y., Liang X.E., Zhang D.P. (2003) Membrane associated protein kinase activities in developing apple fruit. Physiologia Plantarum 118:105113. Frattini M., Morello L., Breviario D. (1999) Rice calcium dependent protein kinase isoforms OsCDPK2 and OsCDPK11 show different responses to light and different expression patterns during seed development. Plant Molecular Biology 41:753764. Gascho G.J., and J. G. Davis. (1994) Mineral nutrition of groundnut, in: J. Smartt (Ed.), In: The Groundnut Crop: A Scientific Basis for Improvement London: Chapman and Hall. 214254. Ge L.L., Tian H.Q., Russell S.D. (2007) Calcium function and distribution during fertilization in angiosperms. American Journal of Botany 94:10461060. Grabski S., Arnoys E., Busch B., Schindler M. (1998) Regulation of actin te nsion in plant cells by kinases and phosphatases. Plant Physiology 116:279290. Gregory J.H., Dukes M.D., Jones P.H., Miller G.L. (2006) Effect of urban soil compaction on infiltration rate. Journal of Soil and Water Conservation 61:117124. Gregory W.C., Smith B.W., Yarbrough J.A. (1951) Morphology, Genetics, and Breeding, in The Peanut The Unpredictable Legume. pp. 2888.,Washington D.C., National Fertilizer Assoc iation.

PAGE 75

75 Hale M.G. (1978) Calcium concentration and exudation of sugars from pegs and fruits of axenic peanut plants. Soil Biology and Biochemistry 10:6769. Halliburton B.W., Glasser W.G., Byrne J.M. (1975) Anatomical study of pericarp of Arachis hypogaea, with special emphasis on scleroid component. Botanical Gazette 136:219223. Hallock D.L., Garren K.H. (1968) Pod breakdown yield and grade of V irginia type peanuts as affected by Ca, Mg and K sulfates. Agronomy Journal 60:253. Harmon A.C., Gribskov M., Gubrium E., Harper J.F. (2001) The CDPK superfamily of protein kinases. New Phytologist 151:175183. Harper J.E., Breton G., Harmon A. (2004) Decoding Ca2+ signals through plant protein kinases. Annual Review of Plant Biology 55:263288. Hrabak E.M., Chan C.W.M., Gribskov M., Harper J.F., Choi J.H., Halford N., Kudla J., Luan S., Nimmo H.G., Sussm an M.R., Thomas M., Walker Simmons K., Zhu J.K., Harmon A.C. (2003) The Arabidopsis CDPKSnRK superfamily of protein kinases. Plant Physiology 132:666680. Kawasaki T., Hayashida N., Baba T., Shinozaki K., Shimada H. (1993) The gene encoding a calcium dep endent proteinkinase located near the sbe1 gene encoding starch branching enzyme is specifically expressed in developing rice seeds. Gene 129:183189. Kaya C., Kirnak H., Higgs D., Saltali K. (2002) Supplementary calcium enhances plant growth and fruit yi eld in strawberry cultivars grown at high (NaCl) salinity. Scientia Horticulturae 93:6574. Keeratikasikorn P., Bell R.W., Loneragan J.F. (1991) Response of 2 peanut ( Arachis hypogaea L. ) cultivars to boron and calcium. Plant and Soil 138:6166. Khosla B.K., Gupta R.K., Abrol I.P. (1979) Salt leaching and the effect of gypsum application in a salinesodic soil. Agricultural Water Management 2:193202. Klimecka M., Muszy ska G. (2007) Structure and functions of plant calcium dependent protein kinases. Acta Biochimica Polonica 54:219233. Koppelman S.J., Vlooswijk R.A.A., Knippels L.M.J., Hessing M., Knol E.F., van Reijsen F.C., Bruijnzeel Koomen C. (2001) Quantification of major peanut allergens Ara h 1 and Ara h 2 in the peanut varieties Runner, Spanish, Virginia, and Valencia, bred in different parts of the world. Allergy 56:132137. Kvien C.S., Branch W.D., Sumner M.E., Csinos A.S. (1988) Pod characteristics influencing calcium concentrations in the seed and hull of peanut. Crop Science 28:666 671. Laemmli U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680.

PAGE 76

76 Leclercq J., Ranty B., Sanchez Ballesta M.T., Li Z.G., Jones B., Jauneau A., Pech J.C., Latche A., Ranjeva R., Bouzayen M. (2005) Molecular and biochemical characterization of LeCRK1, a ripening associated tomato CDPK related kinase. Journal of Experimental Botany 56:2535. Lev Yadun S. (2000) Why are underground flowering and fruiting more common in Israel than anywhere else in the world? Current Science 79:289 289. Li C.L., Wu K.Q., Fu G.H., Li Y., Zhong Y.J., Lin X.D., Zhou Y., Tian L.N., Huang S.Z. (2009) Regulation of oleosin expression in developing peanut ( Arachis hypogaea L.) embryos through nu cleosome loss and histone modifications. Journal of Experimental Botany 60:43714382. Livak K.J., Schmittgen T.D. (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2(T) ( Delta Delta C) method. Methods 25:402408. Ludwig A.A., Romeis T., Jones J.D.G. (2004) CDPK mediated signaling pathways: specificity and cross talk. Journal of Experimental Botany 55:181188. Ma S.Y., Wu W.H. (2007) AtCPK23 functions in Arabidopsis responses to drought and salt stresses. Plant Mol ecular Biology 65:511518. Mitra D., Johri M.M. (2000) Enhanced expression of a calcium dependent protein kinase from the moss Funaria hygrometrica under nutritional starvation. Journal of Biosciences 25:331338. Mizrahi Y. (1982) Effect of salinity on tomato fruit ripening. Plant Physiology 69:966970. Mizuno S. (1959) Physiological studies on fruc tification of peanut. I. Distribution of radiaoactive calcium administered to the fruiting zone on the fruiting organ. Proceedings of Crop Science Society of Japan. pp. 8385. Moctezuma E. (2003) The peanut gynophore: a developmental and physiological perspective. Canadian Journal of Botany 81:183190. Morello L., Frattini M., Giani S., Christou P., Breviario D. (2000) Overexpression of the calcium dependent pr otein kinase OsCDPK2 in transgenic rice is repressed by light in leaves and disrupts seed development. Transgenic Research 9:453 462. Murata M.R., Zharare G.E., Hammes P.S. (2008) pH of the podzone affects reproductive growth of groundnut. Journal of Plant Nutrition 31:6979. Murillo I., Jaeck E., Cordero M.J., Segundo B.S. (2001) Transcriptional activation of a maize calcium dependent protein kinase gene in response to fungal elicitors and infection. Plant Molecular Biology 45:145158. Paik Ro O.G., Seib J.C., Smith R.L. (2002) Seedspecific, developmentally regulated genes of peanut. Theoretical and Applied Genetics 104:236240.

PAGE 77

77 Pal R.N., Laloray a M.M. (1967) Calcium sodium interaction in the pod development of the peanut, Arachis hypogaea L. Experientia 23:383383. Patharkar O.R., Cushman J.C. (2000) A stress induced calcium dependent protein kinase from Mesembryanthemum crystallinum phosphorylates a twocomponent pseudoresponse regulator. Plant Journal 24:679691. Pattee H.E., Johns E.B., Singleton J.A., Sanders T.H. (1974) Composition changes of peanut fruit parts during maturation. Peanut Science 1:5762. Pattee H.E., Stalker H.T. (1995) Advances in Peanut Science. American Peanut Research and Education Society, Inc., Stillwater,OK Periasamy K., S ampoornam C. (1984) The morphology and anatomy of ovule and fruit development in Arachis hypogaea L. Annals of Botany 53:399411. Pickett T.A. (1950) Composition of developing peanut seed. Plant Physiology 25:210224. Putnam Evans C., Harmon A.C., Palevitz B.A., Fechheimer M., Cormier M.J. (1989) Calcium dependent protein kinase is localized with F actin in plant cells. Cell Motility and the Cytoskeleton 12:1222. Raices M., Ulloa R.M., MacIntosh G.C., Crespi M., Tellez Inon M.T. (2003) StCDPK1 is expressed in potato stolon tips and is induced by high sucrose concentration. Journal of Experimental Botany 54:25892591. Romeis T., Ludwig A.A., Martin R., Jones J.D.G. (2001) Calcium dependent protein kinases play an essential role in a plant defence response. E MBO Journal 20:55565567. SAS 9.2. (2008) SAS Institute Inc ., Cary, North Carolina. Shen Y.Y., Duan C.Q., Liang X.E., Zhang D.P. (2004) Membrane associated protein kinase activities in the developing mesocarp of grape berry. Journal of Plant Physiology 161:1523. Shimada H., Takeda H., Tsunoda A., Sasaki T. (2009) Regulatory mechanism on sucrose metabolism in rice endosperm by a specific protein kinase, SPK. The Proceedings of the International Plant Nutrition Colloquium XVI University of California, Davi s, Sacramento, CA. Shimada H., Koishihara H., Saito Y., Arashima Y., Furukawa T., Hayashi H. (2004) A rice antisense SPK transformant that lacks the accumulation of seed storage substances shows no correlation between sucrose concentration in phloem sap and demand for carbon sources in the sink organs. Plant and Cell Physiology 45:11051109. Skelton B.J., Shear G.M. (1971) Calcium translocation in peanut ( Arachis hypogaea L). Agronomy Journal 63:409412.

PAGE 78

78 Smal H., Kvien C.S., Sumner M.E., Csinos A.S. (1989) Solution calcium concentration and application date effects on pod calc ium uptake and distribution in Florunner and T ifton 8 peanut. Journal of Plant Nutrition 12:3752. Smertenko A.P., Jiang C.J., Simmons N.J., Weeds A.G., Davies D.R., Hussey P.J. (1998) Ser6 in the maize actin depolymerizing factor, ZmADF3, is phosphorylated by a calcium stimulated protein kinase and is essential for the control of functional activity. Plant Journal 14:187193. Smith B.W. (1950) Arachis hypogaea aerial flower and subter ranean fruit. American Journal of Botany 37:802815. Smith B.W. (1956) Arachis hypogaea normal megasporogenesis and syngamy with occasional single fertilization. American Journal of Botany 43:81 89. Sorensen R.B., Butts C.L. (2008) Pod yield and mineral concentration of four peanut cultivars following gypsum application with subsurface drip irrigation. Peanut Science 35:8691. Sukhija P.S., Randhawa V., Dhillon K.S., Munshi S.K. (1987) The influence of zinc and sulfur deficiency on oil filling in peanut ( Arachis hypogaea L. ) kernels. Plant and Soil 103:261267. Sullivan G.A., Jones G.L., Moore R.P. (1974) Effects of dolomitic limestone, gypsum, and potassium on yield and seed quality of peanuts. Peanut Science 1:7377. Sumner M.E., Kvien C.S., Smal H., Csi nos A.S. (1988) On the C a nutrition of peanut ( Arachis hypogaea L. ) conceptual model. Journal of Fertilizer Issues 5:97102. Teixeira S.D., Pereira R.A.S., Ranga N.T. (2006) Components of fecundity and abortion in a tropical tree, Dahlstedtia pentaphylla (Leguminosae). Brazilian Archives of Biology and Technology 49:905913. Thompson L.K., Burgess C.L., Skinner E.N. (1992) Localization of phytochrome during peanut ( Arachis hypogaea ) gynophore and ovule development. American Journal of Botany 79:828832. T illman B.L., Gomillion M.W., Person G., Mackowiak C.L. (2010) Variation in r esponse to c alcium f ertilization among f our r unner t ype p eanut c ultivars. Agronomy Journal 102:469474. USDAFAS (2010) Table 13 Peanut a rea, y ield and production. ht tp://www.fas.usda.gov/psdonline. Walker M.E., Keisling T.C., Drexler J.S. (1976) Responses of 3 peanut cultivars to gypsum. Agronomy Journal 68:527528.

PAGE 79

79 Walker M.E., Mullinix B.G., Keisling T.C. (1981) Calcium level in the peanut fruiting zone as influence d by gypsum particle size and application rate and time. Communications in Soil Science and Plant Analysis 12:427439. Weber H., Buchner P., Borisjuk L., Wobus U. (1996) Sucrose metabolism during cotyledon development of Vicia faba L is controlled by the c oncerted action of both sucrose phosphate synthase and sucrose synthase: Expression patterns, metabolic regulation and implications for seed development. Plant Journal 9:841850. White P.J., Broadley M.R. (2003) Calcium in plants. Annals of Botany 92:487511. Wiersum L.K. (1951) Water transport in the xylem as related to calcium uptake by groundnuts ( Arachis hypogaea L). Plant and Soil 3:160169. Winter H., Huber S.C. (2000) Regul ation of sucrose metabolism in higher plants: Localization and regulation of activity of key enzymes. Critical Reviews in Plant Sciences 19:3167. Wright G.C. (1989) Effect of pod zone moisture content on reproductive growth in 3 cultivars of peanut ( Arach is hypogaea L ). Plant and Soil 116:111114. Wu P., Ma L.G., Hou X.L., Wang M.Y., Wu Y.R., Liu F.Y., Deng X.W. (2003) Phosphate starvation triggers distinct alterations of genome expression in Arabidopsis roots and leaves. Plant Physiology 132:12601271. Y e S.F., Wang L., Xie W.B., Wan B.L., Li X.H., Lin Y.J. (2009) Expression profile of calcium dependent protein kinase (CDPKs) genes during the whole lifespan and under phytohormone treatment conditions in rice ( Oryza sativa L. ssp indica). Plant Molecular B iology 70:311325. Young C.T., Schadel W.E. (1990) Light and scanning electronmicroscopy of the peanut ( Arachis hypogaea L. cv F lorunner) cotyledon after roasting. Food Structure 9:6973. Young C.T., Pattee H.E., Schadel W.E., Sanders T.H. (2004) Microst ructure of peanut ( Arachis hypogaea L. cv. 'NC 7') cotyledons during development. Lebensmitt el Wissenschaft Und Technologie 37:439445. Zerche S., Ewald A. (2005) Seed potassium concentration decline during maturation is inversely related to subsequent ge rmination of primrose. Journal of Plant Nutrition 28:573603. Zhang X.R.S., Choi J.H. (2001) Molecular evolution of calmodulinlike domain protein kinases (CDPKs) in plants and protists. Journal of Molecular Evolution 53:214224. Zharare G.E., Blamey F.P.C., Asher C.J. (1998) Initiation and morphogenesis of groundnut ( Arachis hypogaea L.) pods in solution culture. Annals of Botany 81:391396. Zharare G.E., Asher C.J., Blamey F.P.C. (2009a) Calcium nutrition of peanut grown in solution culture. i. genetic v ariation in Ca requirements for vegetative growth. Journal of Plant Nutrition 32:18311842.

PAGE 80

80 Zharare G.E., Blamey F.P.C., Asher C.J. (2009b) Calcium nutrition of peanut grown in solution culture. ii. podzone and tissue calcium requirements for fruiting of a Virginia and a Spanish peanut. Journal of Plant Nutrition 32:18431860. Zharare G.E., Asher C.J., Blamey F.P.C., Dart P.J. (1993) Pod development of groundnut ( Arachis hypogaea L.) in solut ion culture. Plant and Soil 155/ 156:355358. Zhu B., Alva A.K. (1994) The effect of gypsum amendment on transport of phosphorus in a sandy soil. Water Air and Soil Pollution 78:375382.

PAGE 81

81 BIOGRAPHICAL SKETCH Bhuvan P. Pathak was born in Ahmedabad, India. She graduated from Sardar Patel University with a B.S. in bota ny (Gold Medal) in 2002 and M.S. in biotechnology in 2004. During her m asters degree at Sardar Patel University, she joined Bhabha Atomic Research Centre for an internship where she worked on the molecular characterization of Indian mustard. In May 2006, she joined Charotar Institute of Technology, Changa, India as a Lecture r in Biotechnology where she taught plant biology to undergraduate pharmacy students. In 2007, she joined the University of Florida for her m asters degree in a gronomy. She is the eldest daughter of Pareshchandra Pathak and Jayshree Pathak followed by a yo unger sister Dhruva Pathak and a wife to Samarth Bhatt, Postdoctoral Associate in Human Genetics at the Institute of Anthropology and Human Genetics, University of Jena, Jena, Germany.