<%BANNER%>

Impacts of Bmp6 on Myogenic Cell Proliferation, Differentiation, and Satellite Cell Population

Permanent Link: http://ufdc.ufl.edu/UFE0042281/00001

Material Information

Title: Impacts of Bmp6 on Myogenic Cell Proliferation, Differentiation, and Satellite Cell Population
Physical Description: 1 online resource (62 p.)
Language: english
Creator: Sun, Wenli
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: bmp6, satellite
Animal Sciences -- Dissertations, Academic -- UF
Genre: Animal Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bone morphogenetic protein 6 (BMP6), a member of TGF-beta superfamily, plays an important role in modulateing epithelial and neural tissue development. The expression of BMP6 in young ( < 7 days) bovine semimembranosus muscle tissue suggests a potential regulatory effect in bovine muscle. Exogenous BMP6 treatment was examined in three different myogenic cell cultures: bovine satellite cells, 23A2 mouse myoblasts, and C2C12 mouse satellite cells. The treatment effect was confirmed by BRE-Luc activity in all cells. BMP6 caused different responses inn different cells. The proliferation rate was decreased by BMP6 in BSC, 23A2 and C2C12 cells. Myogenic differentiation and fiber formation were suppressed in BSC, 23A2 and C2C12 cells. Alkaline phosphatase activity was induced by BMP6 in C2C12 but not in 23A2 or BSC. Furthermore, BMP6 treatment changed proportion of cells defined by Pax7 and Myf5 in BSC. In all 3 types of cells, western blotting was used to demonstrate phosphorylation and activation of SMAD 1/5/8. These data indicate that BMP6 signals through SMAD1/5/8 to regulate myogenic cell proliferation and differentiation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Wenli Sun.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Johnson, Sally.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042281:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042281/00001

Material Information

Title: Impacts of Bmp6 on Myogenic Cell Proliferation, Differentiation, and Satellite Cell Population
Physical Description: 1 online resource (62 p.)
Language: english
Creator: Sun, Wenli
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: bmp6, satellite
Animal Sciences -- Dissertations, Academic -- UF
Genre: Animal Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bone morphogenetic protein 6 (BMP6), a member of TGF-beta superfamily, plays an important role in modulateing epithelial and neural tissue development. The expression of BMP6 in young ( < 7 days) bovine semimembranosus muscle tissue suggests a potential regulatory effect in bovine muscle. Exogenous BMP6 treatment was examined in three different myogenic cell cultures: bovine satellite cells, 23A2 mouse myoblasts, and C2C12 mouse satellite cells. The treatment effect was confirmed by BRE-Luc activity in all cells. BMP6 caused different responses inn different cells. The proliferation rate was decreased by BMP6 in BSC, 23A2 and C2C12 cells. Myogenic differentiation and fiber formation were suppressed in BSC, 23A2 and C2C12 cells. Alkaline phosphatase activity was induced by BMP6 in C2C12 but not in 23A2 or BSC. Furthermore, BMP6 treatment changed proportion of cells defined by Pax7 and Myf5 in BSC. In all 3 types of cells, western blotting was used to demonstrate phosphorylation and activation of SMAD 1/5/8. These data indicate that BMP6 signals through SMAD1/5/8 to regulate myogenic cell proliferation and differentiation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Wenli Sun.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Johnson, Sally.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042281:00001


This item has the following downloads:


Full Text





IMPACTS OF BMP6 ON MYOGENIC CELL PROLIFERATION, DIFFERENTIATION,
AND SATELLITE CELL POPULATION




















By

WENLI SUN


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2010

































2010 Wenli Sun









ACKNOWLEDGMENTS

It is an honor to thank those who made this thesis possible. First of all, I owe my

deepest gratitude to the chair of my committee, Dr. Sally Johnson, who gave me the

chance to study at the University of Florida and work under her direction. This thesis

would not have been possible without her guidance and support. I also thank Dr. Alan

Ealy and Dr. Peter Hansen, for serving on my supervisory committee and for making

excellent suggestions and ideas.

It is also a pleasure for me to show my gratitude to my former and present

colleagues: Ju Li, Dillon Walker, Diana Delgado, John Michael Ganzalez, Sarah Reed,

and Marni Lapin. Thank you for kindly providing me the necessary help for my work.

I would like to thank my beloved families and friends for being my back-up all the

time. The love from my parents was always a source of courage. It is my friends that

keep me smiling through the hard times. Special thanks to Hsiu and Shadow the cat;

thank you for your company which comfort me a lot.

Lastly, I offer my regards and blessings to all of those who supported me in any

way during the completion of my thesis.









TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ................ .... ......... ................. 3

L IS T O F F IG U R E S .......................................................................................................... 5

A B S T R A C T ........................................................... .. ....................................... 6

CHAPTER

1 LITERATURE REVIEW ............... ............... ..... ............... 7

Satellite Cells: Definition and Functions............................... .... ...... ............... 7
Extracellular Surface Marker-Associated Satellite Cell Identification................. 8
M olecular Identification of Satellite Cells ................. .................................. 10
Satellite Cell Self-Renewal and Progenitor Production.................. ......... 12
Microenvironmental Control of Satellite Cell Biology .................. ........... 14
Notch, W nt and Self-Renew al ............................... ... ................................... 15
Hepatocyte Growth Fator and Activation ............ .................................... 17
G row th D ifferentiation Factor 8 ..................................................... ............... 20
Bone Morphogenetic Protein 6 ...... .... ........ ....................... ............... 22

2 MATERIALS AND METHODS ....................... ......... ......... .......... 25

Bovine Satellite Cell Isolation........................................ .. ............... 25
Cell Culture ......................................... 25
Im m unocytochem istry ...................... .................. .. .. ............................... 26
A lkaline P hosphatase H istology..................................................... ... ................. 27
Western Blots ............. ..... ...................... 27
Luciferase Reporter Assay.................................................... ............................ 28
BMP6 RT-PCR .......................... ............. ....................... 29
S ta tis tic s ............. ......... .. .............. .. ..................................................... 2 9

3 RESULTS ......... ..... ........... .. ..........................30

BMP6 is Expressed in Bovine Skeletal Muscle............................. ............... 30
BMP6 Affects Distinct Aspects of Satellite Cell Myogenesis................................ 30
Repression of BSC Myogenesis is Independent of Transdifferentiation ................. 32

4 DISCUSSION ................. ......... ........................ ...... ........... 46

LIST O F REFERENCES ............................. ........................................... 51

B IO G RA P H ICA L S KETC H ............. ...................................................... ............... 62










LIST OF FIGURES

Figure page

3-1 Bovine muscle tissue expresses BMP6.................................... .................. 34

3 -2 B M P 6 p hy lo ge netic tre e ........................................................................... .... 3 5

3-3 BMP6 inhibits EdU incorporation ............................................... 36

3-4 BMP6 changes BSC subpopulation proportions.................................... 37

3-5 BMP6 inhibits myofiber formation ............................................... 38

3-6 BMP6 inhibits differentiation of BSC and myoblasts.......... ......... ....... ........ 40

3-7 BMP6 induces alkaline phosphatase (ALP) activity in C2C12 myoblasts but
not 23A 2 m yoblasts and B S C ..................................................... .... .. ............... 4 1

3-8 BMP6 activates SMAD1/5/8 in BSC, 23A2 and C2C12 myoblasts ................ 43

3-9 BMP6 stimulates transcription of BRE-Luc.............. ....................... 45

4-1 Illustration of satellite cell subpopulations and myogenesis............................. 50









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

IMPACTS OF BMP6 ON MYOGENIC CELLS PROLIFERATION, DIFFERENTIATION,
AND SATELLITE CELLS POPULATION

By

Wenli Sun

August 2010

Chair: Sally E. Johnson
Major: Animal Sciences

Bone morphogenetic protein 6 (BMP6), a member of TGF-beta superfamily, plays

an important role in modulateing epithelial and neural tissue development. The

expression of BMP6 in young (<7 days) bovine semimembranosus muscle tissue

suggests a potential regulatory effect in bovine muscle. Exogenous BMP6 treatment

was examined in three different myogenic cell cultures: bovine satellite cells, 23A2

mouse myoblasts, and C2C12 mouse satellite cells. The treatment effect was confirmed

by BRE-Luc activity in all cells. BMP6 caused different responses inn different cells. The

proliferation rate was decreased by BMP6 in BSC, 23A2 and C2C12 cells. Myogenic

differentiation and fiber formation were suppressed in BSC, 23A2 and C2C12 cells.

Alkaline phosphatase activity was induced by BMP6 in C2C12 but not in 23A2 or BSC.

Furthermore, BMP6 treatment changed proportion of cells defined by Pax7 and Myf5 in

BSC. In all 3 types of cells, western blotting was used to demonstrate phosphorylation

and activation of SMAD 1/5/8. These data indicate that BMP6 signals through

SMAD1/5/8 to regulate myogenic cell proliferation and differentiation.









CHAPTER 1
LITERATURE REVIEW

Satellite Cells: Definition and Functions

In 1961, Alexander Mauro described a minor population of heterochromatin dense

cells positioned immediately adjacent to the mature muscle fiber in frogs (Mauro, 1961).

These cells, which he termed satellite cells, reside immediately beneath the fiber basal

lamina and appear quiescent. He proposed that satellite cells were dormant embryonic

myoblasts or unknown infiltrating cells that may explain "the vexing problem of skeletal

muscle regeneration". While numerous groups had noted the unique ability of muscle to

repair itself, the source of new muscle fibers and myonuclei within the fibers remained

unresolved.

Bintliff and Walker (1960) reported that neofibers formed during mouse skeletal

muscle regeneration did not contain 3H-thymidine labeled nuclei when the isotope was

administered 2-3 days after damage, leading the group to conclude that myonuclei are

mitotically inactive (Bintliff and Walker, 1960). These results were extended to chick

embryonic myofiber formation by Stockdale and Holtzer (1961) who found that somite

myofibers fail to incorporate radiolabeled thymidine (Stockdale and Holtzer, 1961).

However, the source of the proliferative cells that allow postnatal muscle growth and

repair remained unclear.

In 1970, Moss and LeBlond performed a time course stand of 3H-thymidine

incorporation into muscle nuclei of rapidly growing rat pups (Moss and Leblond, 1970).

Conclusive evidence was obtained by electron microscopy demonstrating that satellite

cells were mitotically active and capable of fusion with adjacent muscle fibers. Thus,

Mauro's contention that satellite cells are a source of myonuclei was validated.









The ability of satellite cells to reside within the muscle throughout the lifespan of

an individual enables both growth and repair capabilities. The numbers of satellite cells

in rat muscle decline from birth to adulthood coincident with increased myonuclei and

muscle mass (Cardasis and Cooper, 1975). However, their supply is never abrogated

with advanced age. Electron microscopy revealed that a small percentage of satellite

cells, less than 1% of total muscle nuclei, are retained in the muscles of people over the

age of 70 (Schmalbruch and Hellhammer, 1976). These pioneering efforts provided the

first glimpse of what is now considered the adult muscle stem cell.

Extracellular Surface Marker-Associated Satellite Cell Identification

Satellite cells, historically, are identified by their physical position under the basal

lamina adjacent to the muscle fiber. Isolation and culture of the population often was

hindered by the presence of non-fusing cells that most investigators classified as

fibroblasts. Early attempts at molecular definition of rodent satellite cells revealed that

many of these cells expressed the structural protein, desmin. Satellite cells isolated

from juvenile rat pups express desmin prior to induction of the myogenic gene

regulatory network and differentiation (Foster et al., 1987; Kaufman and Foster, 1988).

These results further substantiated that satellite cells are myogenic precursor cells that

are distinct from embryonic myoblasts. Similar to the rat, proliferating cultures of human

satellite cells express the intermediate filament protein (van der Ven et al., 1992).

Although greater than 95% of human satellite cells contain desmin, progeny of these

cells exhibit divergent myogenic potential (Baroffio et al., 1995).

The majority of human satellite cells commit to differentiate as indicated by

expression of skeletal actin, myosin and fusion. By contrast, a small number of clonal

satellite cells retain desmin expression but fail to proceed into the terminal differentiation









program. The non-fusing desmin expressing population is the first report of a muscle-

derived stem cell. This cell is retained as a mononucleate in the presence of

differentiation permissive conditions (Baroffio et al., 1996). Subculture of these cells

leads to the emergence of myoblast progeny capable of biochemical and morphological

differentiation as well as self-renewal.

The isolation and characterization of desmin-positive myogenic precursors from

humans and rodents provided the initial evidence for heterogeneity within the satellite

cell compartment. Indeed, four desmin-expressing satellite cell subpopulations are

found in humans with each demonstrating variable degrees of differentiation capabilities

(Edom-Vovard et al., 1999). However, desmin is not a cross-species marker of satellite

cells. Primary cultures of bovine satellite cells are less than 15% desmin

immunopositive (Allen et al., 1991). Importantly, these cells fail to incorporate thymidine

analogs suggesting they are at an early stage of terminal differentiation.

The inability of desmin to denote all satellite cells and the documented level of

heterogeneity within the compartment underscored the search for universal markers of

the adult muscle population. Cell surface proteins, including integrins, adhesion

molecules and extracellular matrix glycoproteins, were explored for their value as

isolation tools for satellite cell enrichment. Postnatal rat muscle fibers exhibit limited

surface expression of a7-integrin but a substantial number of putative satellite cells are

immunoreactive for the adhesion molecule (Song et al., 1992). It was further noted that

antibodies against a splice variant of a7-integrin are effective satellite cell enrichment

tools (Ziober et al., 1993). Human myoblasts obtained by fluorescence activated cell

sorting (FACS) for a7-integrin are 95% myogenic in nature (Blanco-Bose et al., 2001).









In addition to serving as an isolation aid, the laminin receptor formed by a7l31-integrin

association plays a critical role in migration of myogenic cells in vitro (Schober et al.,

2000; Yao et al., 1996). While a7l31-integrin serves as a convenient marker of satellite

cells and myoblasts, it is not exclusive to myogenic cells and enrichment for muscle

precursors using anti-a731 integrin is species-specific (Flintoff-Dye et al., 2005;

Gardiner et al., 2005; Kallestad and McLoon, ; Mayer et al., 1997; Welser et al., 2007a;

Welser et al., 2007b).

A host of extracellular matrix-associated molecules used for satellite cell

purification has evolved substantially since the early efforts employing anti-a7-integrin.

Immunohistochemical elucidation of muscle progenitors in postnatal animals often

employs antibodies directed against neural cell adhesion molecule (NCAM) (Cashman

et al., 1987), M-cadherin (Irintchev et al., 1997), c-Met (Tatsumi et al., 1998) and nestin

(Day et al., 2007). Each antibody denotes mononucleated cells beneath the fiber basal

lamina that become mitotically active during muscle regeneration. Isolation of satellite

cells for therapeutic intervention of muscle damage and disease typically utilizes

Hoechst dye exclusion and/or immunofluorescent enrichment with flow cytometry.

FACS methodology includes combinations of antibodies for syndecan-3 and -4

(Cornelison et al., 2001; Cornelison et al., 2004), surface heparin sulfate proteoglycans,

CXCR4 (Sherwood et al., 2004), a chemokine receptor, SM/C2.6 (Fukada et al., 2004),

a poorly characterized surface antigen, and CD34 (Montarras et al., 2005), a sialomucin

protein that denotes progenitor cells.

Molecular Identification of Satellite Cells

Substantive advances in the field of satellite cell biology occurred following

elucidation of key transcription factors involved in lineage commitment of muscle









precursor. Early research determined that the adult satellite cell expressed coordinately

members of the myogenic regulatory factor (MRF) family (Smith et al., 1994). The

MRFs, Myf5, MyoD, myogenin and MRF4, exhibit the unique ability to initiate the

skeletal muscle gene expression program in non-muscle cells in vitro (Chanoine et al.,

2004). Myf5 and MyoD are expressed during early mouse embryogenesis and are

responsible for establishment of the myogenic lineage. Mice genetically ablated of these

two transcription factors die in utero and are devoid of a myoblast population (Rudnicki

et al., 1993).

As the skeletal myoblast transits into the myogenic program, it begins to express

myogenin, the requisite transcriptional mediator for terminal differentiation. Myogenin-/-

mice die shortly after birth; they contain myoblasts but are deficit in contractile-

competent muscle fibers (Hasty et al., 1993). With regards to satellite cells, Myf5 and

MyoD are expressed during the early proliferative period in vitro followed by down-

regulation of the genes and up-regulation of myogenin. Due to the identical expression

pattern found in embryonic myoblasts, it was thought that the satellite cell may

represent an arrested embryonic myoblast. However, satellite cells are retained

throughout the lifetime of an individual due to self-renewal of the population, a feature

distinct from the embryonic myoblast.

To identify genetic factors critical to satellite cell development and postnatal

function, Seale et al. (2000) performed representational difference analysis (RDA) to

enrich for transcripts unique to satellite cells. The genetic screen identified Pax7 as an

abundant transcript in the adult muscle precursor population. Pax7 is a paired box

transcription factor orthologous to Pax3, a regulatory factor expressed prior to the MRFs









and required for initiation of Myf5 transcription (Maroto et al., 1997). Mice null for Pax7

typically die prior to weaning with both neural and muscle defects (Mansouri et al.,

1996; Seale et al., 2000). Electron microscopy revealed that the Pax7-/- skeletal muscle

is severely compromised in satellite cell numbers. However, a portion of the genetic null

mice survive to adult with no apparent reduction in muscle fiber numbers or cross-

sectional area (Oustanina et al., 2004). Injection of cardiotoxin, a myonecrotic agent,

into Pax7-/- hindlimb muscles caused a severe reduction in neofiber formation and

muscle regeneration. Serial culture of putative satellite cells isolated from Pax7-/-

revealed a decline in the numbers of muscle progenitor cells and their ability to form

fibers when compared to heterozygous controls. Thus, it was concluded that Pax7 is not

required for specification of the lineage but is necessary for self-renewal of satellite

cells.

An elegant confirmation and extension of these findings was performed using

conditional ablation of the transcription factor. Genetic ablation of Pax7-/- in young mice

(P60-90) did not disrupt growth, regeneration or satellite cell self-renewal (Lepper et al.,

2009). By contrast, conditional removal of Pax7 in utero or during the early juvenile

period (
analogous to germline null mice. Two important findings are noted. First, Pax7 is

required through initial entry of satellite cells into GO. Secondly, adult muscle satellite

cells acquire a regulatory network that is not dependent upon Pax7 for either self-

renewal or myogenicity.

Satellite Cell Self-Renewal and Progenitor Production

Due to the sustained regenerative capacity of skeletal muscle tissue over the

lifetime of an individual, the muscle stem cell(s) present must both self-renew and









generate a pool of progenitors. Early work in both rodent and human models indicated

that not all satellite cells were functionally equivalent, suggestive of distinct stem and

progenitor subgroups. Mixed populations of satellite cells with different cell cycle

kinetics were reported in rats (Schultz, 1996). Also, primary cultures of human satellite

cells display different proliferation and differentiation capabilities (Baroffio et al., 1995).

In the search for protein fingerprints unique to quiescent muscle progenitors,

Beauchamp (2000) noted a degree of heterogeneity within the satellite cell pool based

upon Myf5 expression. Myofibers with attached satellite cells isolated from Myf5-nLacZ

mice revealed that two subpopulations exist based upon differential expression of the

transgene. All satellite cells expressed CD34 and M-cadherin but a minor myogenic

population did not exhibit 3-galactosidase activity, the assay product for nLacZ. Kuang

et al (2007) extended these observations to the Pax7-expressing satellite cells with 90%

of the population exhibiting expression of Myf5 and 10% expressing Pax7-only.

Moreover, Pax7-only muscle cells divide asymmetrically, a hallmark of stem cell self-

renewal, to yield a daughter cell expressing both Pax7 and Myf5. Transplantation of

Pax7-only cells into the tibialis anterior of Pax7-/- mice revealed that the cell could both

restore muscle growth and re-populate the niche. By contrast, Pax7+/Myf5+ expressing

satellite cells were unable to reconstitute the sublaminar pool and exhibited only limited

amounts of muscle repair. These efforts provide a framework for definition of satellite

cell stem and progenitors based upon differential Myf5 expression.

Although Pax7 is regarded as the definitive marker of adult muscle satellite cells, it

is not exclusive. A portion of satellite cells exhibit Pax3 expression and others are

defined by Pax3 and Pax7 co-expression (Otto et al., 2006; Relaix et al., 2005). Pax3









and Pax7 exhibit overlapping, as well as unique, expression patterns during

embryogenesis in rodents and chicks (Borycki et al., 1999; Goulding and Paquette,

1994; Williams and Ordahl, 1994). Moreover, the two control distinct elements within

embryonic and adult myogenesis. Pax3 initiates transcription of Myf5 to establish the

early myogenic lineage during embryogenesis, an event that precedes MyoD

expression (Tajbakhsh et al., 1997). Mice homozygous null for both Pax3 and Myf5 lack

body muscles and MyoD expression. Sequential activation of Myf5 and MyoD does not

occur in all satellite cells indicating at least two distinct subpopulations exist (Cooper et

al., 1999).

Following cardiotoxin-induced injury in mice, satellite cells express Myf5, MyoD or

a combination of the two MRFs. Unlike Cornelison and Wold (1997), Myf5 was not

detected in quiescent satellite cells; the protein was evident only upon activation. The

ability of Myf5 to denote quiescent satellite cells was explored further using

heterozygous Myf5-nLacZ mice, which contain nuclear LacZ knocked into the one allele

of Myf5 (Beauchamp et al., 2000). 3-galactosidase expressing M-cadherin

immunopositive satellite cells were evident in non-injured adult muscles supporting the

hypothesis that Myf5 is a marker of quiescent muscle progenitors in vivo. Satellite cells

isolated from heterozygous Myf5-nLacZ mice and expanded in vitro successfully engraft

into diseased muscle (mdxnu/nu) with a small number assuming the satellite position

(Heslop et al., 2001).

Microenvironmental Control of Satellite Cell Biology

Numerous growth factors, morphogens and hormones exert effects on both

muscle fibers and satellite cells. Several members of the fibroblast growth factor (FGF)

superfamily serve as potent mitogens while suppressing myofiber formation









(Buckingham, 2003). Platelet-derived growth factor (PDGF) exerts effects similar to the

FGFs and may be one of the first blood-borne growth factors delivered to sites of

myotrauma (Christov et al., 2007). Insulin-like-growth factor I (IGF-I) has little effect on

satellite cell proliferation but strongly supports myoblast fusion into mature fibers

(Clemmons, 2009). Although these growth factors are important to satellite cell actions

and muscle function, they are often delivered systemically and are not regarded as

niche factors for the purposes of this discussion.

Notch, Wnt and Self-Renewal

The niche localized signals that direct self-renewal and progenitor development

remain poorly understood. Asymmetric cell division leading to fate decisions occurs in

many organisms and tissues and commonly employs a Notch signal. Notch, a

transmembrane receptor, binds Delta and Jagged ligands leading to y-secretase

cleavage of the intracellular domain (ICD) (Fortini, 2009). ICD proteolytic maturation

allows for nuclear translocation and modification of gene transcription. The Notch

pathway is intact in mouse satellite cell: myofiber explant cultures and receptor

activation causes increased proliferation (Conboy and Rando, 2002). Immunostaining

for the Notch inhibitor, Numb, demonstrated a portion of the dividing satellite cells

exhibited asymmetric distribution of the protein. Importantly, the daughter cell with

intense Numb localization failed to contain detectable Pax3 indicating a more committed

progenitor cell. No differential Numb localization was observed in Pax7-expressing

satellite cells. Pax7+/Myf5- satellite cells expressed abundant amounts of Notch-3 by

comparison to Pax7+/Myf5+ progenitors, which express greater amounts of Delta-1

transcripts (Kuang et al., 2007). In vivo BrdU pulse labeling experiments followed by

myofiber explant culture demonstrated that asymmetric division of attached satellite









cells involved co-segregation of template DNA and Numb to the putative muscle stem

cell (Shinin et al., 2006).

The importance of Notch inhibition via Numb as a determinant of progenitor

commitment was challenged by experiments with targeted mis-expression in mouse

embryos. Ectopic expression of Numb in Pax3 and Pax7 somitic cells prior to progenitor

fate commitment revealed that Numb increased the numbers of Pax3+/Pax7+ stem

cells, contrary to expectations (Jory et al., 2009). While it is safe to state that Notch

signals affect myogenic decisions, it remains unclear if the various satellite cell

subpopulations respond to the fate determinant analogously.

The Drosophila Wingless gene and the vertebrate homolog, Int-1, are commonly

referred to as Wnts. In mammals, this large family of secreted proteins binds to frizzled

(Fz) receptors to elicit canonical responses through nuclear 3-catenin accumulation as

well as non-canonical effects that include activation of Rac and Rho GTPases (Sethi

and Vidal-Puig). Early work using chick somite explant cultures detailed the ability of

Wntl, produced by the neural tube, to activate Myf5 in the dorsal aspects of somite

committing cells to the myogenic lineage (Munsterberg and Lassar, 1995; Stern, 1995).

A similar fate decision occurs through surface ectoderm-derived Wnt7a induction of

MyoD in the dermamyotome compartment of the somite (Tajbakhsh et al., 1998). These

early fate decisions were extrapolated to regenerating muscle and satellite cells. Wnt5a,

5b and 7a are transcribed by primary mouse myofiber explant cultures and treatment of

CD45+/Scal + hematopoeitic progenitors with a cocktail of the Wnts is sufficient to instill

the myogenic gene network (Polesskaya et al., 2003). The authors conclude that niche









production of the Wnts during muscle regeneration serves to recruit non-myogenic cells

into the lineage and improve regenerative capabilities.

Direct involvement of Wnts on satellite cell biology was reported by Steelman et al

(2006) who found that Wnt4 acts a mitogen for mouse satellite cells en masse. By

contrast, Otto et al. (2008), using single fiber explant cultures, found that Wnt4 inhibits

proliferation of the associated satellite cells while Wntl, 3 and 5a increased satellite cell

proliferation (Otto et al., 2008).

The ability of the Wnts to alter satellite cell myogenesis appears to be age-

dependent. Satellite cells from old mice tend to lose their myogenicity at the expense of

a fibroblast-like lineage (Brack et al., 2007). In contrast to embryonic myoblasts, Wnt

signaling causes transdifferentiation of aged satellite cells. The identity of the circulating

Wnt or niche-localized Wnts responsible for the fate modification remain unknown.

Interestingly, the fate altering Wnt activity is absent from the serum of young mice.

Hepatocyte Growth Fator and Activation

It was noted that satellite cells attached to intact, viable muscle fibers exited

quiescence sooner if the culture contained damaged or dead fibers (Bischoff, 1986).

Crude preparations of crushed muscle extract (CME) contained a mitogen that

shortened the time to G1/S phase in satellite cells cultured in vitro and increased the

numbers of proliferative satellite cells following injection in vivo. The unknown activator

and mitogen elicited similar activity on rat satellite cells as hepatocyte growth factor

(HGF) (Allen et al., 1995). HGF reduced the time delay between GO and G1/S in

cultures of satellite cells isolated from mature rats, analogous to CME. Due to the

functional similarities and satellite cellexpression of c-Met, the HGF receptor, Allen et al.

(1995) postulated that HGF was the activator of CME. Validation of HGF as the satellite









cell activation factor was provided by Tatsumi et al (1998) whereby it was demonstrated

that HGF was present in CME and that immunodepletion of HGF from CME prevented

satellite cell activation.

HGF is synthesized and released by the satellite cell to create an autocrine loop

that facilitates proliferation (Sheehan et al., 2000) and prevents precocious

differentiation (Gal-Levi et al., 1998). Due to its inhibitory effects on fiber formation, the

therapeutic potential of HGF may be limited. Injection of the growth factor into

regenerating skeletal muscle caused an increase in the numbers of proliferating satellite

cells but also suppressed neofiber formation (Miller et al., 2000). The inhibitory actions

of HGF toward myoblast fusion and differentiation are mediated, in part, through c-Met

initiated intracellular signals that culminate in up-regulation of Twist, a basic helix-loop-

helix transcriptional repressor (Leshem et al., 2000). Translational inhibition of Twist

mRNA with a putative antisense RNA molecule partially restores biochemical and

morphological parameters of myogenesis to chick satellite cells treated with HGF.

The importance of HGF to satellite cell function during myotrauma and

regeneration often overshadows the influence of the regulatory protein as a mediator of

muscle hypertrophy. Resistance exercise, stretch and the normal process of muscle

growth are dependent upon the activation of satellite cells. Rat satellite cells that

received a 2-hr mechanical stretch stimulus re-entered the cell cycle sooner than non-

stretched cells and the improved activation kinetics were prevented by immunosorption

of the autocrine HGF (Tatsumi et al., 2002; Tatsumi et al., 2001). Young men that

performed an acute bout of eccentric exercise to achieve contraction-induced muscle









damage released more active HGF from the muscle tissue (O'Reilly et al., 2008). In

turn, the active HGF stimulated satellite cell activation and proliferation.

The release of HGF from the muscle fiber and receptor docking on the adjacent

satellite cell rapidly alters cell cycle dynamics. Expeditious release of HGF from the

extracellular matrix reservoir necessitates both a shear detection mechanism and a

proteolytic system for processing and activation of the growth factor.

Anderson (2000) proposed that nitric oxide (NO), an abundant, diffusible molecule

found in muscle, participated in the initial signal for HGF-initiated activation of satellite

cells. Treatment of dystrophic mice (mdx) with L-NAME, a chemical inhibitor of the NOS

enzyme response for NO production, resulted in a substantial delay in muscle

regeneration that was attributed to a block in HGF release from the fiber ECM and a

subsequent blunting of satellite cell activation (Anderson, 2000). These results were

extended by demonstration that stretch-induced HGF release from satellite cells is

prevented by inhibition of NO production thereby, delaying in vitro activation. Although

release of HGF is instrumental to receptor mediated actions on the satellite cell, these

experiments did not address the proteolytic processing of HGF or its shedding from the

ECM. HGF is synthesized as a large precursor protein that requires proteolytic

processing into a and 3 chains that assemble into the functional heterodimeric HGF

(Naka et al., 1992). Tatsumi and Allen (2004) demonstrated that HGF is tethered to the

myofiber ECM in both an active and inactive configuration. Pro-HGF is rapidly cleaved

to its active form upon incubation with crushed muscle extract indicating that a matrix-

associated protease system is present for production of mature HGF. Importantly,









treatment of intact muscle with nitroprusside, a NO donor, resulted in the release of

mature HGF heteromeric complexes from the matrix (Tatsumi and Allen, 2004).

HGF release likely is mediated through NO activation of matrix metalloproteinases

(MMPs), a family of endopeptidases that degrade multiple ECM components. Treatment

of satellite cells with TIMP, an inhibitor of MMPs, prevented HGF release from the ECM

during cyclic stretch and blunted activation (Yamada et al., 2008). These results provide

the basis for a working model of satellite cell activation in health and disease that

includes near instantaneous synthesis and release of NO from the myofiber leading to

MMP-mediated release of HGF, the growth factor required for exit from GO.

Growth Differentiation Factor 8

One of the best examples of unrestricted skeletal muscle size is the Belgian Blue

breed of cattle. These animals are noted for their massive amounts of muscle

deposition to the extent that they are often referred to as "double-muscled". However,

the animals do not possess duplicate muscles but simply contain twice as many muscle

fibers per muscle (Ashmore et al., 1974; Swatland, 1974; Swatland and Kieffer, 1974).

Due to the extreme amounts of muscle, problems with dystocia and unconventional

carcass parameters, this breed has had limited acceptance as a big cattle breed in the

United States.

In 1997, a new member of the transforming growth factor beta (TGF-3)

superfamily, referred to as growth and differentiation factor 8 (GDF8) or myostatin, was

described (McPherron et al., 1997). The gene is highly expressed in skeletal muscle

during embyrogenesis through adulthood. Mice genetically null for GDF8 exhibited 2-3

times the amount of muscle found in wildtype animals. The phenotypic resemblance of

the GDF-/- mice to double muscled cattle provided a causative explanation for the









excess muscle hypertrophy. Sequence analysis of GDF8 in Belgian Blue cattle

demonstrated an 11-bp deletion in the coding sequence for the bioactive carboxy-

terminus leaving the protein inactive (McPherron and Lee, 1997). Pietmontese, another

double-muscled breed, contain a point mutation in GDF8 that leads to production of a

biologically inactive protein. From these results it was concluded that GDF8 is a

negative regulator of muscle size.

GDF8 is synthesized as a propeptide that requires cleavage of the amino-terminal

domain for bioactivity (Thies et al., 2001). The prodomain acts to inhibit GDF8 and

injection or ectopic expression of the peptide enhances muscle size and attenuates the

severity of muscle disease and cachexia (Bogdanovich et al., 2002; Whittemore et al.,

2003; Zimmers et al., 2002). Although GDF8 circulates systemically, its major actions

are regarded as autocrine and paracrine. GDF8 exerts its effects through the activin

receptor lib (ActRllb) and includes phosphorylation and activation of Smad2 and Smad3

(Rebbapragada et al., 2003; Walsh and Celeste, 2005). Mice expressing a dominant

negative form of ActRllb in skeletal muscle display a 4-fold increase in muscle mass by

comparison to the 2-fold increase observed in GDF8-/- animals (Lee and McPherron,

2001). The increased severity suggests that additional ActRllb ligands participate in the

regulation of muscle fiber size. GDF11, a structurally similar subfamily member to

GDF8, does not modulate muscle size in the embryonic or neonatal mouse (McPherron

et al., 2009; McPherron et al., 1999). Mice homozygous null for GDF8 and GDF11 in

muscle are phenotypically no different than GDF8-/- with regard to fiber numbers and

size (McPherron et al., 2009). Thus, the identity of additional ActRllb ligands remains

unknown.









Bone Morphogenetic Protein 6

The majority of bone morphogenetic protein (BMP) effects on myogenesis are

noted during embryogenesis (Buckingham et al., 2003). BMP2 and BMP4, secreted by

the neural tube and notochord, serve to limit the size of the developing somitic myotome

in chick embryos (Reshef et al., 1998). Inhibition of BMP activity by Noggin allows for

expansion of the embryonic myoblast pool. However, neither BMP2 nor BMP4 is

activated during muscle regeneration arguing that they play an insignificant role during

postnatal muscle growth and repair (Zhao and Hoffman, 2004).

BMP6, originally named Vgr-1, is expressed by adult skeletal muscle (Lyons et al.,

1989). Although BMP6-/- mice display no phenotypic abnormalities in muscle size or

ambulatory function, the growth factor may act as a paracrine mediator of satellite cell

activity (Solloway et al., 1998). BMP6 stimulates iNOS expression, a known mediator of

satellite cell activation, in macrophages (Kwon et al., 2009). Moreover, treatment of

C2C12 satellite cells with BMP6 suppresses MyoD expression and muscle fiber

formation (Ouyang et al., 2006). It remains unclear if inhibition of myogenesis is a direct

effect or a consequence of initiation of the osteogenic gene program and subsequent

myoblast transdifferentiation (Ebisawa et al., 1999). An intriguing possibility is that

BMP6 secreted by the muscle fiber serves as niche-localized factor that promotes

satellite cell activation through NO production and suppresses precocious

differentiation.

BMP6 regulatory effects are mediated through phosphorylation and activation of

Smadl, Smad5 and Smad8, collectively referred to as Smadl/5/8, shortly after docking

with an oligomerized BMP receptor (Valdimarsdottir et al., 2002). Unlike BMP2 and 4,









BMP6 exhibits high affinity binding with the type II receptor, activin receptor 2A or ALK2,

prior to receptor oligomerization with BMPRI (Vukicevic and Grgurevic, 2009).

The unique nature of BMP6 further extends to co-receptor interactions. The

receptor guidance molecule (RGM) family contains four members that serve as specific

co-receptors for the BMPs (Corradini et al., 2009). RGMa, RGMb/DRAGON and

RGMc/hemojuvelin (HJV) are expressed in mammals with RGMd found only in fish.

RGMs are GPI-linked proteins with an extracellular ligand binding interface and no

apparent cytosolic signaling motif. The three RGMs are expressed in several mouse

tissues and are particularly abundant in skeletal muscle (Kanomata et al., 2009). RGMa

is constitutively expressed during myogenesis and genetic ablation in mice causes

neural tube defects with no apparent effect on skeletal muscle (Kanomata et al., 2009;

Niederkofler et al., 2004). RGMb is up-regulated during C2C12 myoblast differentiation

with ectopic expression inhibitory to BMP2 induced myoblast transdifferentiation

(Kanomata et al., 2009). RGMb-/- mice are neonatal lethal with possible neural mapping

defects (Mueller et al., 2006). RGMc increases dramatically prior to C2 myoblast fusion

(Kuninger et al., 2006). However, forced expression of the putative signaling modulator

neither promotes nor deters myofiber formation. RGMc-/- mice are viable with no

discernible muscle defects but suffer juvenile hemochromatosis (Andriopoulos et al.,

2009; Huang et al., 2005; Niederkofler et al., 2005). In a like manner, BMP6-/- animals

accumulate extreme amounts of iron in the liver, pancreas and heart, a hallmark of

juvenile hemochromatosis (Meynard et al., 2009). Infusion of soluble RGMc into mice

effectively binds and inactivates BMP6 and induces iron accumulation in the serum and

liver (Andriopoulos et al., 2009). Soluble RGMb bound BMP6 in vitro but failed to









interact with the growth factor in vivo. Thus, RGMc is a specific binding partner for

BMP6, a critical mediator of iron homeostasis.

Since BMP6 is widely expressed in embryonic and adult tissue, including muscle,

in many species, it is supposed that BMP6 is also expressed in bovine muscle. Thus

BMP6 may have regulatory effects via SMAD pathway in bovine satellite cells, such as

regulating proliferation, differentiation. Activated BSC can be divided into three groups

based on Pax7 and Myf5 expression. Since the proportion of these groups is closely

related to BSC lineage progression, BMP6 may also change the ratio of them.

Moreover, BSC could be converted to osteogenic cells under the effect of BMP6 as the

mouse myogenic cell, C2C12.









CHAPTER 2

MATERIALS AND METHODS

Bovine Satellite Cell Isolation

The semimembranosus muscle (5455g) was harvested intact from Holstein bull

calves (3-7 days of age) following euthanasia. Visible connective tissue was removed,

and the muscle was finely minced with a commercial meat grinder. The tissue was

incubated with 0.8 mg/ml Type XIV protease (Sigma, St Louis, MO) in Earle's Balanced

Salt Solution (EBSS; Sigma, St Louis, MO) for 1 hour at 37 C with gentle mixing at 10

minute intervals. The tissue slurry was centrifuged at 1500 X g for 10 minutes and the

protease decanted. An equal volume of sterile phosphate buffered saline (PBS, pH 7.4)

was added to the tissue and the slurry was vigorously shaken for 5 minutes to liberate

the fiber-associated satellite cells. Cells were collected by centrifugation at 500 X g for

10 minutes and retention of the supernatant. The process was repeated for a total of 4

times. Cell pellets were collected by centrifugation at 1500 X g for 10 minute,

resuspended in growth medium (low glucose Dulbeccos modified Eagle medium

supplemented with 10% (v/v) horse serum (HS), 1% (v/v) 5000 Units/ml penicillin-

streptomycin, 200 mM L-glutamine and 0.1% (v/v) 10mg/ml gentimicin). Cells were

further purified by sequential filtration through 70 pm and 40 pm cell strainers (BD

Falcon, Durham, NC). The resulting bovine satellite cells (BSC) were stored frozen in

growth medium containing 10% (v/v) dimethyl sulfoxide in liquid nitrogen until use.

Cell Culture

All cell culture reagents were purchased from Invitrogen (Carlsbad, CA) unless

otherwise noted. C2C12 mouse satellite cells and 23A2 embryonic myoblasts were

cultured on 0.1% (w/v) gelatin coated tissue culture plasticware in high-glucose









Dulbecco's modified Eagle's medium (DMEM) containing 10% (v/v) fetal bovine serum

(FBS), 1% (v/v) penicillin/streptomycin, L-glutamine, and 0.1% (v/v) gentamicin or basal

Eagle medium (BME) containing 15% (v/v) FBS, 1% v/v penicillin/streptomycin, L-

glutamine, and 0.1% (v/v) gentamicin, respectively. BSC were seeded at a density of

1.6X104/cm2 on tissue cultureware coated with entactin-collagen IV-laminin cell

attachment matrix (ECL) in high glucose DMEM containing 10% (v/v) horse serum (HS),

1% (v/v) penicillin/streptomycin, 1% (v/v) L-glutamine, and 0.1% (v/v) gentamicin

reagent solution. Differentiation was induced by culture for 3 days in low glucose

DMEM supplemented with 2% (v/v) HS, 1% (v/v) penicillin/streptomycin, and 0.1% (v/v)

gentamycin. Where indicated, recombinant human BMP6 (R&D Systems, Minneapolis,

MN) was supplemented at 50 ng/ml in growth or differentiation medium. Proliferation

was measured by 5-ethynyl-2'-deoxyuridine (EdU), a nucleoside analog to thymidine,

incorporation into DNA during the final 30 minutes or 2 hours of experimental treatment.

Immunocytochemistry

Myoblast cells were fixed with 4% (v/v) formaldehyde in PBS for 10 minutes at

room temperature. Myofiber cultures were fixed with Alcohol-Formalin-Acetic Acid (AFA,

85% alcohol: 16% formaldehyde: 5% glacial acetic acid, v/v) for 15 minutes at room

temperature. Fixed cells were washed thoroughly with PBS and non-specific binding

sites were blocked with the blocking buffer (PBS containing 5% (v/v) HS and 0.1% (v/v)

Triton X-100 (Fisher Scientific, NJ)) for 30 minutes at room temperature. Subsequently,

cells were incubated with primary antibodies under the following conditions: mouse anti-

Pax7 hybridoma supernatant (Developmental Studies Hybridoma Bank, University of

Iowa, Iowa City, IA), 1:10 in 0.1X Blocking Buffer, 4 C overnight; rabbit anti-Myf5 (C-20;

Santa Cruz Biotechnology, Santa Cruz CA), 1:100 in 0.1X Blocking Buffer, 4 C









overnight; mouse anti-myosin heavy chain (MyHC) hybridoma supernatant (MF20;

Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA), 1:20 in

Blocking Buffer, room temperature, 1 hour. Primary antibodies were removed by

washing with PBS (3 X 5 min). Immune complexes were detected with the appropriate

anti-mouse AlexaFluor 488 and anti-rabbit AlexaFluor 527 (Invitrogen, Carlsbad, CA)

diluted 1:200 in Blocking Buffer. Hoechst 33342 (5 pg/ml in PBS) was used to identify

nuclei. After a final PBS wash, fluorescent-labeled complexes were visualized using an

Eclipse TE 2000-U microscope (Nikon, Lewisville, TX) equipped with an X-Cite 120

epifluorescence illumination system (EXFO, Mississauga, Ontario, Canada).

Photomicrographs were captured using a Photometrics Cool Snap EF digital camera

(Nikon, Lewisville, TX).

Alkaline Phosphatase Histology

Semiconfluent myoblasts and BSC were cultured with 50 ng/ml BMP6 for 48 hours

following fixation with 4% (v/v) formaldehyde for 10 minutes. After washing with PBS,

the fixed cultures were incubated at 37 C for 18 hours with nitroblue tetrazolium and 5-

bromo-4-chloro-3'-indolyphosphate p-toluidine (NBT-BCIP). Colorimetric alkaline

phosphatase activity was visualized under bright field and phase microscopy.

Representative images were captured with a DXM 1200F digital camera.

Western Blots

BSC, C2C12 and 23A2 myoblasts were treated with 10 pg/ml protamine sulfate

(EMD Chemicals, Gibbstown, NJ) in serum free medium for 10 minutes at 37 C to

remove surface associated growth factors. The cells were further incubated for one hour

in serum free medium to reduce intracellular signaling events. BMP6 (50 ng/ml) was

added to the medium and cells were lysed in 4X Lammeli buffer (250 mM Tris, pH 6.8,









8% (w/v)SDS, 40% (v/v) glycerol, and 0.4% (v/v) 3-mercaptoethanol ) at the indicated

times. Lysates were sonicated and heated for 5 minutes at 95 C. Total cellular protein

from an equivalent number of cells was separated electrophoretically through 10% (v/v)

polyacrylamide gels and transferred to nitrocellulose membrane. The membranes were

incubated with 5% w/v nonfat dry milk in TBST (10 mM Tris, pH 8.0, 150 mM NaCI, and

0.1% (v/v) Tween 20) for 30 minutes at room temperature to block non-specific antigen

binding sites. Primary antibodies diluted in blocking solution were incubated with blots

under the following conditions: rabbit anti-phospho-Smadl (Ser463/465)/Smad5

(Ser463/465)/Smad8 (Ser426/428) (Cell Signaling Technology, Danvers, MA), 1:1000, 4

C overnight; rabbit anti-SMAD 1/5/8/9 (Abcam, Cambridge, MA), 1:1000, 4 C overnight;

mouse anti-alpha tubulin (Abcam, Cambridge, MA), 1:5000, room temperature for 1

hour. After incubation, the blots were washed with TBST 3 times for 5 minutes each,

then incubated with peroxidase-labeled anti-mouse or anti-rabbit antibody (Invitrogen,

Carlsbad, CA) in blocking solution for 1 hour at room temperature. After washing with

TBST, immune complexes were visualized with chemiluminescence and exposure to x-

ray films (X-OMAT LS Scientific Imaging Films, Kodak, Rochester, NY).

Luciferase Reporter Assay

Cells were transiently transfected by DNA-calcium phosphate precipitate formation

(C2C12, 23A2) or liposome-mediated DNA delivery (BSC; Lipofectamine 2000,

Invitrogen, Carlsbad, CA). Plasmid DNA included BRE-Luc, a mulitmerized BMP

response element driving luciferase expression, and pRL-tk, a plasmid coding for

Renilla luciferase under control of a minimal thymide kinase promoter. The cells were

cultured in the presence of transfection reagents for 5 hours. After 18 hours in growth

medium, the cells were treated with 50 ng/ml BMP6 for 48 hours. Cells were lysed and









luciferase activities were measured using a Dual-Luciferase Reporter Assay System

(Promega, Madison, WI).

BMP6 RT-PCR

Total RNA (1 pg) isolated from the semimembranosus of a young bull calf was

digested with RNase-free DNase (Ambion, Austin, TX) for 30 minutes at 37 C prior to

reverse transcription with 60 pM random hexamers (Promega, Madison, WI), 1 mM

dNTP (Promega, Madison, WI), 40 units RNase inhibitor (New England Biolabs,

Ipswich, MA), and M-MLV reverse transcriptase (200 units, New England Biolabs,

Ipswich, MA). The resulting cDNA was amplified with bovine BMP6 forward (5'

TTGCCCCCAAGGGCTACGCT 3') and reverse (5' AGCACCGAGATGGCGTTCAGT 3')

primers and AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA) under

the following conditions; 95 C 2 minutes, 40 cycles of 95 C 30 seconds, 65 C 30

seconds, and 72 C 40 seconds and a final extension step of 72 C 10 minutes. The

BMP6 amplicon was visualized following electrophoresis through ethidium bromide

impregnated agarose gels, extracted and sequenced on both strands.

Statistics

All data presented in this study represents at least three independent experiments

with a minimum of two to three replicates per treatment group. All numerical data was

analyzed with the PROC ANOVA procedure of the Statistical Analysis System (SAS,

SAS inst. Inc., Cary, NC) where treatment, repeat, and their interaction were the fixed

effects. Data was presented as Means standard error of the mean (SEM). Treatments

were considered significantly different when P<0.05.









CHAPTER 3
RESULTS

BMP6 is Expressed in Bovine Skeletal Muscle

BMP6 is widely expressed throughout mouse embryonic and adult tissues

including skeletal muscle (Lyons, 1989). In an analogous manner, BMP6 is expressed

in the newborn calf. Total RNA was isolated from the semimembraneous muscle of a

young Holstein bull calf (57 days) and analyzed by RT-PCR using gene specific primers

(Figure 3-1). The resulting DNA amplification of 175 bp was sequenced on both strands.

NCBI database search using the BLASTN engine revealed 100% homology to bovine

BMP6. The gene is conserved with 45 orthologs present in genomes ranging from

lizards (Anolis carolinensis) to dolphins (Tursiops truncates), fruitflies (Drosophila

melanogaster) and humans (Figure 3-2). The extensive conservation of BMP6 suggests

that it may participate in an integral developmental, metabolic or regulatory function.

BMP6 Affects Distinct Aspects of Satellite Cell Myogenesis

Members of the TGF-3 superfamily, which includes BMP6, are noted inhibitors of

satellite cell and myoblast proliferation and differentiation. The effects of BMP6 on

bovine satellite cell (BSC) proliferation and myofiber formation were examined. BSCs

were isolated, seeded on gelatin-coated tissueware and cultured in growth medium for

48 hours. Subsequently, the medium was replaced with low-serum medium

supplemented with 50 ng/ml BMP6 or vehicle for 48 hours. Embryonic mouse myoblasts

(23A2) and mouse satellite cells (C2C12) were treated in an analogous manner. All

cells were pulsed with the thymidine analog, EdU, prior to fixation. The numbers of cells

that incorporated EdU were measured and expressed as a percent of total cells (Figure









3-3). A modest decline (~5%) in cell proliferation was apparent for all myogenic cells

types treated with BMP6.

The limited response suggests that muscle-derived BMP6 does not serve as a

primary mediator of satellite cell quiescence and proliferative activity. Although no

robust change in total cell numbers were observed, BMP6 may affect satellite cell

lineage progression. Satellite cells are a heterogeneous population comprised of both

muscle stem and progenitor cells. Muscle stem cells, defined by Pax7 expression, give

rise to myoblast progenitors that express both Pax7 and Myf5 (Buckingham, 2007). The

effects of BMP6 on the two subpopulations were examined following 48 hrs of treatment

(Figure 3-4). In brief, BSC were cultured in growth permissive medium supplemented

with 50 ng/ml BMP6 for 48 hours followed by fixation and immunodetection of Pax7 and

Myf5. The numbers of Pax7-only, Pax7+/Myf5+ and Myf5-only cells were measured and

expressed as a percentage of total cells. BMP6 did not affect the percent of Pax7-only

muscle stem cells. However, a reduction in the percent of Pax7+/Myf5+ progenitors and

an increase in the numbers of Myf5-only myoblasts were evident. The population shift

from progenitor to committed myoblast indicates that BMP6 promotes satellite cell

myogenesis independent of an effect on global proliferation rate.

The ability of BMP6 to accelerate the transition from progenitor to myoblast also

may hasten myofiber formation. BSC cultures were placed in differentiation permissive

medium supplemented with 50 ng/ml BMP6. 23A2 and C2C12 myogenic cells were

treated in a similar manner. After 48 or 72 hours, the cells were fixed and

immunostained for myosin heavy chain (MyHC). Total nuclei were visualized with

Hoechst 33245. As shown in Figure 3-5A, BSC readily form large myosin-expressing,









multinucleated fibers in vitro. Many of these structures contain over 100 nuclei. A

substantial reduction in the myofibers was noted following BMP6 treatment.

Enumeration of myofiber nuclei revealed an approximate 50% reduction in

differentiation in response to growth factor treatment (Figure 3-6). These results

demonstrate that BMP6 exerts strikingly different effects on satellite cell myogenesis by

promoting myoblast pool expansion and suppression of myofiber formation. A similar

50% reduction in myofiber formation was observed for 23A2 myoblasts treated with

BMP6 (Figure 3-5B). By contrast, a dramatic inhibitory effect was noted for C2C12

satellite cells treated with BMP6 (Figure 3-5C). Less than 1% of the total nuclei were

contained within MyHC immunopositive cells.

Repression of BSC Myogenesis is Independent of Transdifferentiation

C2C12 myoblasts are notably responsive to BMP2, 4 and 6 whereby they undergo

transdifferentiation to an osteogenic phenotype (Yamamoto, 1997, Li, 2005, Ebisawa,

1999). The ability of BMP6 to block BSC differentiation by initiation of the osteogenic

gene program was examined. In brief, BSC, 23A2 and C2C12 myogenic cells were

treated for 48 hours with BMP6 followed by fixation and histological staining for alkaline

phosphatase activity. As expected, C2C12 myoblasts readily adopted the osteogenic

phenotype as indicated by strong AP activity. By contrast, neither 23A2 nor BSC

expressed the bone enzyme in response to the growth factor (Figure 3-7).

The inability of the cells to convert to the osteogenic lineage is not due to a

defective SMAD1/5/8 signaling pathway. Subconfluent cultures were serum-deprived for

one hour followed by treatment with BMP6. Cells were lysed and evaluated by Western

blot for total and phosphorylated SMAD content. BSC activate the SMAD signaling axis

within 5 minutes of BMP6 treatment and exhibit maximal, sustained activity within 30









minutes (Figure 3-8A). Both 23A2 and C2C12 myoblasts demonstrate abundant

amounts of phosphorylated SMAD1/5/8 (Figure 3-8B, C).

The ability of the myogenic cells to activate SMADs and elicit a transcriptional

response was examined using a BMP-response element reporter gene (BRE-Luc). The

myogenic cells were transiently transfected with BRE-Luc and pRLtk-Luc, a transfection

efficiency monitor, prior to treatment with BMP6. After 48 hours, the cells were lysed

and luciferase activities measured. All three myogenic cells directed transcription from

the BMP-response reporter gene, although at differing levels (Figure 3-9). By

comparison to 23A2 and C2C12 myoblasts, BSC direct higher levels of basal BRE-Luc

transcription. These results demonstrate that the SMADs are phosphorylated in

response to BMP6, and translocate to the nucleus to initiate transcriptional change.












BMP6 GAPDH


603bp





234bp

194bp





Figure 3-1. Bovine muscle tissue expresses BMP6. RT-PCR was performed on bovine
semimembranosus total RNA using primers specific for bovine BMP6 and
GAPDH transcripts. Both transcripts were expressed. Representative photo is
shown.























































LEGND
- x branch length
... nO branch length
.. x100branchlength


a4 omoir Immd


jj- SWostaiomuseor

-E mErincpeus
IBtPPMioicill merin


Chordat: 07 homdlop


Gene ID cunret gene
Gene ID within-sp.palog


I peciation node
i duplication node
ambiguousnode


Ei I Ia 1
PII ll

U II 1111i iI
IHIl i I,, ,*


I
II


vii;


S1ll Ill I 111 I M I Mi1


m1 1Rill l I lV Ii


m I mill' II I USI
i II I 11 11


E lie l lir ii 1111 i ] I
*I U il lI IIII I 111 I IIll n






i I i lIi II II III
II II I e11 1111 lIll Bll

n m11 11 iII WI 1111 MlN

i i II IIII IIIIII E111 1111

iim II I 11111E111 1111 lie n





i i *i i 111 i in
I i II Ili I 11 I I
,~ ~ lr ml ,,l ,,, ,.


4 collapsed sublree
collapsed currentt gnt
collapsed (pa ralog)


SM Aalignment matcmismtch
I AA consensus 566% (mis)mtch
I A consensus> 33% (is)mach
AA alignment gap


Figure 3-2. BMP6 phylogenetic tree (Source:
http://uswest.ensembl.org/Bos_taurus/Gene/Compara_Tree?db=core;g= ENS
BTAG00000019234;r=23:48406821-48416543;t=ENSBTAT00000025614.
Last accessed May, 2010)


111 1 111111111 1111 1111 1
















45%
-* control
40%
400 U BMP6
35%
30% *
25%
S20%
15%
0%
5%

0%
23A2 C2C12 BSC


Figure 3-3. BMP6 inhibits EdU incorporation. BSC (pre-cultured for 24 hours), 23A2 and
C2C12 myoblasts were treated with 50 ng/ml BMP6 for 48 hours and pulsed
with EdU for the last 30 minutes (23A2 and C2C12) or 2 hours (BSC). Cells
were fixed and immunostained quantify the percent of cells that incorporated
EdU. All experiments were repeated 3 times. Error bars indicate SEM.
Asterisks indicates significant difference, p<0.05 (*) or p<0.0001 (**).



















90%
80% **
O 70% O- control
S60% BMP6
50%
o 40%
a 30% *
20%
10% 0
0%
Pax7+/Myf5+ Pax7+/Myf5- Pax7-/Myf5+

Figure 3-4. BMP6 changes BSC subpopulation proportions. BSC were cultured with 50
ng/ml BMP6 for 48 hours. Cells were fixed and immunostained for Pax7 and
Myf5. Hoescht dye was used to identify nuclei. The proportion of different
BSC subpopulations in response to treatment was quantified. All experiments
were repeated 3 times. Error bars indicate standard error of the mean (SEM).
Asterisks indicates significant difference, p<0.05 (*) or p<0.0001 (**).












control


Hoechst




MyHC



A

Figure 3-5. BMP6 inhibits myofiber formation. BSC (pre-cultured for 3 days), 23A2, and
C2C12 were cultured with 50 ng/ml BMP6 or vehicle-only for 48 or 72 hours.
Cells were fixed and immunostained for myosin heavy chain (MyHC). Total
nuclei were identified with Hoechst 33245. A) BSC myofiber formation was
inhibited by BMP6. B) 23A2 myofiber formation was repressed by BMP6. C)
C2C12 myofiber formation was restrained by BMP6.


BMP6














control


Hoechst









MyHC











BMP6 control




Hoechst









MyHC









Figure 3-5. Continued.


BMP6














80%


70%

60% O control
BMP6
50%

4 40%

03 30% **

20%

10%
/*

0%
BSC 23A2 C2C12






Figure 3-6. BMP6 inhibits differentiation of BSC and myoblasts. BSC (pre-cultured for 3
days), 23A2 and C2C12 were cultured with 50 ng/ml BMP6 or vehicle-only for
48 hours (BSC) or 72 hours (23A2 and C2C12). Cells were fixed and
immunostained for myosin heavy chain (MyHC). Total nuclei were identified
with Hoechst staining. Fusion index was calculated as numbers of nuclei in
MyHC positive fibers (containing at least 3 nuclei) divided by number of total
nuclei. BMP6 suppressed differentiation and fusion in all three types of cells.
All experiments were repeated 3 times. Error bars indicate SEM. Asterisks
indicate significant difference, p<0.05 (*) or p<0.0001 (**).














BMP6 control


Bright Field








Phase



A

Figure 3-7. BMP6 induces alkaline phosphatase (ALP) activity in C2C12 myoblasts but
not 23A2 myoblasts and BSC. BSC, C2C12 and 23A2 myoblasts were
treated with 50 ng/ml BMP6 for 48 hours. Cells were fixed and ALP activity
was measured by colorimetrical reaction with NBT/BCIP. Representative
photomicrographs at 100X are shown. A) BMP6 induced ALP activity in
C2C12 myoblasts. B) BMP6 did not induced ALP activity in 23A2 myoblasts.
C) BMP6 did not induced ALP activity in BSC.

















control


Bright Field










Phase


BMP6


Bright Field









Phase








Figure 3-7. Continued.


control


BMP6













0 5 30 60


min


a p-SMAD 1/5/8




a SMAD 1/5/8/9




a tubulin


Figure 3-8. BMP6 activates SMAD1/5/8 in BSC, 23A2 and C2C12 myoblasts. A) BSC
were treated with 50 ng/ml BMP6 for 0, 5 minutes, 30 minutes and 1 hour
after serum-starvation. Total protein isolates were harvested and analyzed by
Western blot for SMAD1/5/8/9, phosphorylate SMAD1/5/8 or tubulin protein
expression. B) 23A2 myoblasts were treated with 50 ng/ml BMP6 for 0 and 30
minutes after serum-starvation. Total protein isolates were harvested and
analyzed by Western blot for SMAD1/5/8/9, active SMAD1/5/8 or tubulin
protein expression. C) C2C12 myoblasts were treated with 50 ng/ml BMP6 for
0 and 30 minutes after serum-starvation. Total protein isolates were
harvested and analyzed by Western blot for SMAD1/5/8/9, active SMAD1/5/8
or tubulin protein expression.


time














0 30

______ ^


0 30


a p-SMAD 1/5/8


a SMAD 1/5/8/9


a tubulin


min

p-SMAD 1/5/8


SMAD 1/5/8/9


tubulin


Figure 3-8. Continued.


time


time


min


^^^^^^A&fO-A 14
1I7-2 bL.ILM MM

















1600 *


S1400

S1200
a0 control
S1000 BMP6

S800

600

400 **

S200 -


BSC 23A2 C2C12


Figure 3-9. BMP6 stimulates transcription of BRE-Luc. BSC (pre-cultured for 3 days),
23A2 and C2C12 myoblasts were transfected with BRE-Luc reporter and
pRL-tk. Cells were treated with 50 ng/ml BMP6 for 48 hours. Cell lysis were
harvested and analyzed using a Dual-Luciferase Reporter Assay System.
Reporter luciferase activity was normalized to the amount of Renilla luciferase
activity. All experiments were repeated 3 times. Error bars indicate SEM.
Asterisks indicate significant difference, p<0.05 (*) or p<0.0001 (**).









CHAPTER 4
DISCUSSION

Bone morphogenetic protein (BMP6) belongs to transforming growth factor beta

(TGF-3) super family which contains many important growth factors involved in

myogenesis regulation. Previous researches display wide expression of BMP6 in

embryonic and adult tissue, including skeletal muscle. It is documented that BMP6 can

convert a myogenic cell line, C2C12, to osteogenic cells (Fujii et al., 1999). And also,

BMP6 can stimulates iNOS expression, a known mediator of satellite cell activation, in

macrophages (Kwon et al., 2009). Thus, BMP6 is indicated a potential role as a niche-

localized regulatory factor of satellite cells.

To characterize the regulatory effects of BMP6 in satellite cells, especially in

bovine satellite cell. Three types of cells were used in this study: two commonly used

mouse satellite cell models, C2C12 and 23A2 cell lines, and an bovine in vitro satellite

cell model, BSC.

First of all, the endogenous BMP6 expression in immature bovine muscle tissue

was demonstrated by the RT-PCR. The expression of BMP6 indicates potential

regulation effects of BMP6 in bovine muscle. To determine the effects, Three different

types of muscle cells were used: BSC, 23A2 myoblast, and C2C12 myoblast.

It was noticed that BMP6 inhibited proliferation of all three cell types; however, the

decline in proliferation was not large enough to conclude that BMP6 plays the main role

in mediating satellite cell quiescence and proliferative activity. Although no notable

change in total cell numbers were observed, BMP6 affects satellite cell lineage

progression. As Figure 4-1 shows, quiescent satellite cells are a heterogeneous

population comprised of both muscle stem and progenitor cells. Once they are









activated, Pax7-only muscle stem cells can not only selfrenew but also give rise to

committed myo-progenitors which express both Pax7 and Myf5. Pax7+/Myf5+ myo-

progenitors can become Myf5-only myoblasts during myogenesis. In BSC cultures, cells

were already activated and there were three main subpopulations: Pax7-only muscle

stem cells, Pax7+/Myf5+ muscle progenitors, and Myf5-only myoblasts. BMP6 did not

significantly affect the percent of cells that were muscle stem cells. However, the

percent of Pax7+/Myf5+ progenitors decreased and the percent of Myf5-only myoblasts

increased. The population shift from progenitor to myoblast indicates that BMP6

promotes satellite cells myogenesis independent of an effect on global proliferation rate.

Nevertheless, BMP6 does not accelerate myofiber formation. In contrast, a

substantial reduction in the myofibers was noted following BMP6 treatment on BSC. A

similar reduction in myofiber formation was observed in 23A2 treated with BMP6, also a

dramatic inhibitory effect was noted in BMP6 treated C2C12. These results demonstrate

that BMP6 exerts strikingly different effects on satellite cell myogenesis by promoting

myoblast pool expansion and suppression of myofiber formation.

It is documented that BMP6 can induce many different cells in vivo (Gitelman,

1994) or in vitro (Gruber, 2003; Ouyang, 2006; Estes, 2006) to endochondral bone

pathway in previous studies. C2C12 myoblasts in particular are notably responsive to

BMP2, 4 and 6 whereby they undergo trans-differentiation to an osteogenic phenotype

(Yamamoto, 1997, Li, 2005, Ebisawa, 199). Strong ALP activity was observed in C2C12

treated with BMP6 in the study as expected, which indicated the osteogenic trans-

differentiation. Interestingly, neither 23A2 nor BSC expressed the bone enzyme in

response to the growth factor. This shows that the repression of BSC myogenesis









differentiation was not because of osteogenic trans-differentiation. Also the inability of

the cells to be converted to the osteogenic lineage is not due to a defective SMAD1/5/8

signaling. In all three cell types, BMP6 activated SMAD1/5/8, and trigger a

transcriptional level response in nuclei.

Thus, the intracellular pathway of BMP6 in BSC is intact. BMP6 regulates BSC

through SMAD pathway and in two distinct aspects: the proliferation and the myogenic

differentiation are inhibited by BMP6, which are negative regulatory effect of

myogenesis; relatively more muscle progenitors were converted into myoblasts under

the effect of BMP6, which is positive regulatory effect of myogenesis. But BMP6 fails to

convert myogenic differentiation to osteogenic differentiation in BSC.

The different responses to BMP6 between BSC and other cells does not simply

relate to species difference. BSC, 23A2, and C2C12 are all in vitro satellite cell model.

BSC are primary cells, so they can better mimic the in vivo situation. 23A2 myoblasts

were induced from a mouse embryonic cell line C3H10T1/2 (Konieczny and Emerson,

1984) and C2C12 myoblasts were isolated from dystrophic mouse muscle (Yaffe and

Saxel, 1977).They are both mouse cells. Regarding to differentiation, the response

modes to BMP6 of 23A2 and BSC are more alike than C2C12. Although the differences

of their intracellular pathways are not yet clear, it seems that 23A2 may be a better mice

mouse model to use in comparative studies with BSC, especially studies relating to

BMP6.

BSC is an important in vitro satellite cell model in muscle studies. Because of the

bigger muscle size and larger satellite cell amount of bovine than other commonly used

animals, it is more efficient to obtain satellite cells from bovine, which is benefit for









repeating studies in one animal or certain muscle if necessary. Some breeds have

natural mutation of genes, such as Belgium Blue and Piedmontese cattle, which have

GDF8 mutation and are known as double muscling (Kambadur, 1997). So satellite cells

from those breeds are good to be used in studies of those genes and their interaction of

other genes. Also, cattle are an important kind of meat-producing animal. An

understanding of muscle biology in bovine can help improve production efficiency in the

cattle industry. Muscle contains abundant storage iron. Iron overload can cause

hemochromatosis, while iron deficiency can convert the red Fast Oxidative-Glycolytic

(FOG) muscle fibers into white Fast Glycolytic (FG) fibers, which will decline the meat

tenderness (Gordeuk et al., 1987; Klont et al., 1998; Ohira and Gill, 1983). Since BMP6

is a critical mediator of iron homeostasis (Andriopoulos et al., 2009), it is indicated that

the expression of BMP6 is related to meat quality. If the mechanism behind can be

found out, it may promote meat producing by optimizing breeding or feeding.

This work revealed some regulatory effects of BMP6 in BSC, 23A2 and C2C12,

but still left some unknown and unexplored. The BMP inhibitor, Noggin, or small

interfering RNA (siRNA) can be applied to block BMP6 effects and observe the

responses of the cells. To find out the different response mechanism of BSC and 23A2

from C2C12, some factors in the signaling pathway, such as RGMs, need to be

considered in the future work. Also the in vivo responses of satellite cells to BMP6

should be studied later.



















muscle stem cell





BMP6


muscle
progenito


r


Pax7+Myf5+


committed
myoblast
Myf5-only


Figure 4-1. Illustration of satellite cell subpopulations and myogenesis. (Modified from
Winata and Gerace's figure in
http://www.bio.purdue.edu/people/faculty/konieczny/lab/MyoDresearch.htm)


quiescent
satellite
cell


BMP6

~^^^ ^MMM^)









LIST OF REFERENCES


Allen, R. E., L. L. Rankin, E. A. Greene, L. K. Boxhorn, S. E. Johnson, R. G. Taylor, and
P. R. Pierce. 1991. Desmin is present in proliferating rat muscle satellite cells but
not in bovine muscle satellite cells. J Cell Physiol 149: 525-535.

Allen, R. E., S. M. Sheehan, R. G. Taylor, T. L. Kendall, and G. M. Rice. 1995.
Hepatocyte growth factor activates quiescent skeletal muscle satellite cells in
vitro. J Cell Physiol 165: 307-312.

Anderson, J. E. 2000. A role for nitric oxide in muscle repair: Nitric oxide-mediated
activation of muscle satellite cells. Mol Biol Cell 11: 1859-1874.

Andriopoulos, B., Jr., E. Corradini, Y. Xia, S. A. Faasse, S. Chen, L. Grgurevic, M. D.
Knutson, A. Pietrangelo, S. Vukicevic, H. Y. Lin, and J. L. Babitt. 2009. Bmp6 is a
key endogenous regulator of hepcidin expression and iron metabolism. Nat
Genet 41: 482-487.

Ashmore, C. R., W. Parker, H. Stokes, and L. Doerr. 1974. Comparative aspects of
muscle fiber types in fetuses of the normal and "Double-muscled" Cattle. Growth
38: 501-506.

Baroffio, A., M. L. Bochaton-Piallat, G. Gabbiani, and C. R. Bader. 1995. Heterogeneity
in the progeny of single human muscle satellite cells. Differentiation 59: 259-268.

Baroffio, A., M. Hamann, L. Bernheim, M. L. Bochaton-Piallat, G. Gabbiani, and C. R.
Bader. 1996. Identification of self-renewing myoblasts in the progeny of single
human muscle satellite cells. Differentiation 60: 47-57.

Beauchamp, J. R., L. Heslop, D. S. Yu, S. Tajbakhsh, R. G. Kelly, A. Wernig, M. E.
Buckingham, T. A. Partridge, and P. S. Zammit. 2000. Expression of cd34 and
myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J Cell
Biol 151: 1221-1234.

Bintliff S., a. W. B. E. 1960. Radioautographic study of skeletal muscle regeneration.
American Journal of Anatomy 106: 223-345.

Bischoff, R. 1986. A satellite cell mitogen from crushed adult muscle. Dev Biol 115: 140-
147.

Blanco-Bose, W. E., C. C. Yao, R. H. Kramer, and H. M. Blau. 2001. Purification of
mouse primary myoblasts based on alpha 7 integrin expression. Exp Cell Res
265: 212-220.

Bogdanovich, S., T. O. Krag, E. R. Barton, L. D. Morris, L. A. Whittemore, R. S. Ahima,
and T. S. Khurana. 2002. Functional improvement of dystrophic muscle by
myostatin blockade. Nature 420: 418-421.









Borycki, A. G., J. Li, F. Jin, C. P. Emerson, and J. A. Epstein. 1999. Pax3 functions in
cell survival and in pax7 regulation. Development 126: 1665-1674.

Brack, A. S., M. J. Conboy, S. Roy, M. Lee, C. J. Kuo, C. Keller, and T. A. Rando. 2007.
Increased wnt signaling during aging alters muscle stem cell fate and increases
fibrosis. Science 317: 807-810.

Buckingham, M. 2003. How the community effect orchestrates muscle differentiation.
Bioessays 25: 13-16.

Buckingham, M. 2007. Skeletal muscle progenitor cells and the role of pax genes. C R
Biol 330: 530-533.

Buckingham, M., L. Bajard, T. Chang, P. Daubas, J. Hadchouel, S. Meilhac, D.
Montarras, D. Rocancourt, and F. Relaix. 2003. The formation of skeletal muscle:
From somite to limb. J Anat 202: 59-68.

Cardasis, C. A., and G. W. Cooper. 1975. An analysis of nuclear numbers in individual
muscle fibers during differentiation and growth: A satellite cell-muscle fiber
growth unit. J Exp Zool 191: 347-358.

Cashman, N. R., J. Covault, R. L. Wollman, and J. R. Sanes. 1987. Neural cell
adhesion molecule in normal, denervated, and myopathic human muscle. Ann
Neurol 21: 481-489.

Chanoine, C., B. Della Gaspera, and F. Charbonnier. 2004. Myogenic regulatory
factors: Redundant or specific functions? Lessons from xenopus. Dev Dyn 231:
662-670.

Christov, C., F. Chretien, R. Abou-Khalil, G. Bassez, G. Vallet, F. J. Authier, Y.
Bassaglia, V. Shinin, S. Tajbakhsh, B. Chazaud, and R. K. Gherardi. 2007.
Muscle satellite cells and endothelial cells: Close neighbors and privileged
partners. Mol Biol Cell 18: 1397-1409.

Clemmons, D. R. 2009. Role of igf-i in skeletal muscle mass maintenance. Trends
Endocrinol Metab 20: 349-356.

Conboy, I. M., and T. A. Rando. 2002. The regulation of notch signaling controls
satellite cell activation and cell fate determination in postnatal myogenesis. Dev
Cell 3: 397-409.

Cooper, R. N., S. Tajbakhsh, V. Mouly, G. Cossu, M. Buckingham, and G. S. Butler-
Browne. 1999. In vivo satellite cell activation via myf5 and myod in regenerating
mouse skeletal muscle. J Cell Sci 112 ( Pt 17): 2895-2901.

Cornelison, D. D., M. S. Filla, H. M. Stanley, A. C. Rapraeger, and B. B. Olwin. 2001.
Syndecan-3 and syndecan-4 specifically mark skeletal muscle satellite cells and
are implicated in satellite cell maintenance and muscle regeneration. Dev Biol









239: 79-94.


Cornelison, D. D., S. A. Wilcox-Adelman, P. F. Goetinck, H. Rauvala, A. C. Rapraeger,
and B. B. Olwin. 2004. Essential and separable roles for syndecan-3 and
syndecan-4 in skeletal muscle development and regeneration. Genes Dev 18:
2231-2236.

Corradini, E., J. L. Babitt, and H. Y. Lin. 2009. The rgm/dragon family of bmp co-
receptors. Cytokine Growth Factor Rev 20: 389-398.

Day, K., G. Shefer, J. B. Richardson, G. Enikolopov, and Z. Yablonka-Reuveni. 2007.
Nestin-gfp reporter expression defines the quiescent state of skeletal muscle
satellite cells. Dev Biol 304: 246-259.

Ebisawa, T., K. Tada, I. Kitajima, K. Tojo, T. K. Sampath, M. Kawabata, K. Miyazono,
and T. Imamura. 1999. Characterization of bone morphogenetic protein-6
signaling pathways in osteoblast differentiation. J Cell Sci 112 ( Pt 20): 3519-
3527.

Edom-Vovard, F., V. Mouly, J. P. Barbet, and G. S. Butler-Browne. 1999. The four
populations of myoblasts involved in human limb muscle formation are present
from the onset of primary myotube formation. J Cell Sci 112 ( Pt 2): 191-199.

Estes, B. T., A. W. Wu, and F. Guilak. 2006. Potent induction of chondrocytic
differentiation of human adipose-derived adult stem cells by bone morphogenetic
protein 6. Arthritis Rheum 54: 1222-1232.

Flintoff-Dye, N. L., J. Welser, J. Rooney, P. Scowen, S. Tamowski, W. Hatton, and D. J.
Burkin. 2005. Role for the alpha7betal integrin in vascular development and
integrity. Dev Dyn 234: 11-21.

Fortini, M. E. 2009. Notch signaling: The core pathway and its posttranslational
regulation. Dev Cell 16: 633-647.

Foster, R. F., J. M. Thompson, and S. J. Kaufman. 1987. A laminin substrate promotes
myogenesis in rat skeletal muscle cultures: Analysis of replication and
development using antidesmin and anti-brdurd monoclonal antibodies. Dev Biol
122: 11-20.

Fukada, S., S. Higuchi, M. Segawa, K. Koda, Y. Yamamoto, K. Tsujikawa, Y. Kohama,
A. Uezumi, M. Imamura, Y. Miyagoe-Suzuki, S. Takeda, and H. Yamamoto.
2004. Purification and cell-surface marker characterization of quiescent satellite
cells from murine skeletal muscle by a novel monoclonal antibody. Exp Cell Res
296: 245-255.

Gal-Levi, R., Y. Leshem, S. Aoki, T. Nakamura, and 0. Halevy. 1998. Hepatocyte
growth factor plays a dual role in regulating skeletal muscle satellite cell
proliferation and differentiation. Biochim Biophys Acta 1402: 39-51.











Gardiner, N. J., P. Fernyhough, D. R. Tomlinson, U. Mayer, H. von der Mark, and C. H.
Streuli. 2005. Alpha7 integrin mediates neurite outgrowth of distinct populations
of adult sensory neurons. Mol Cell Neurosci 28: 229-240.

Gitelman, S. E., M. S. Kobrin, J. Q. Ye, A. R. Lopez, A. Lee, and R. Derynck. 1994.
Recombinant vgr-l/bmp-6-expressing tumors induce fibrosis and endochondral
bone formation in vivo. J Cell Biol 126: 1595-1609.

Gordeuk, V. R., B. R. Bacon, and G. M. Brittenham. 1987. Iron overload: Causes and
consequences. Annu Rev Nutr 7: 485-508.

Goulding, M., and A. Paquette. 1994. Pax genes and neural tube defects in the mouse.
Ciba Found Symp 181: 103-113; discussion 113-107.

Gruber, R., W. Graninger, K. Bobacz, G. Watzek, and L. Erlacher. 2003. Bmp-6-induced
osteogenic differentiation of mesenchymal cell lines is not modulated by sex
steroids and resveratrol. Cytokine 23: 133-137.

Hasty, P., A. Bradley, J. H. Morris, D. G. Edmondson, J. M. Venuti, E. N. Olson, and W.
H. Klein. 1993. Muscle deficiency and neonatal death in mice with a targeted
mutation in the myogenin gene. Nature 364: 501-506.

Heslop, L., J. R. Beauchamp, S. Tajbakhsh, M. E. Buckingham, T. A. Partridge, and P.
S. Zammit. 2001. Transplanted primary neonatal myoblasts can give rise to
functional satellite cells as identified using the myf5nlaczl+ mouse. Gene Ther 8:
778-783.

Huang, F. W., J. L. Pinkus, G. S. Pinkus, M. D. Fleming, and N. C. Andrews. 2005. A
mouse model of juvenile hemochromatosis. J Clin Invest 115: 2187-2191.

Irintchev, A., M. Langer, M. Zweyer, R. Theisen, and A. Wernig. 1997. Functional
improvement of damaged adult mouse muscle by implantation of primary
myoblasts. J Physiol 500 ( Pt 3): 775-785.

Jory, A., I. Le Roux, B. Gayraud-Morel, P. Rocheteau, M. Cohen-Tannoudji, A.
Cumano, and S. Tajbakhsh. 2009. Numb promotes an increase in skeletal
muscle progenitor cells in the embryonic somite. Stem Cells 27: 2769-2780.

Kallestad, K. M., and L. K. McLoon. Defining the heterogeneity of skeletal muscle-
derived side and main population cells isolated immediately ex vivo. J Cell
Physiol 222: 676-684.

Kambadur, R., M. Sharma, T. P. Smith, and J. J. Bass. 1997. Mutations in myostatin
(gdf8) in double-muscled belgian blue and piedmontese cattle. Genome Res 7:
910-916.











Kanomata, K., S. Kokabu, J. Nojima, T. Fukuda, and T. Katagiri. 2009. Dragon, a gpi-
anchored membrane protein, inhibits bmp signaling in c2c12 myoblasts. Genes
Cells 14: 695-702.

Kaufman, S. J., and R. F. Foster. 1988. Replicating myoblasts express a muscle-
specific phenotype. Proc Natl Acad Sci U S A 85: 9606-9610.

Klont, R. E., L. Brocks, G. Eikelenboom. 1998. Muscle fiber type and meat quality. Meat
Science 49: S219-S229.

Konieczny, S. F., and C. P. Emerson, Jr. 1984. 5-azacytidine induction of stable
mesodermal stem cell lineages from 10t1/2 cells: Evidence for regulatory genes
controlling determination. Cell 38: 791-800.

Kuang, S., K. Kuroda, F. Le Grand, and M. A. Rudnicki. 2007. Asymmetric self-renewal
and commitment of satellite stem cells in muscle. Cell 129: 999-1010.

Kuninger, D., R. Kuns-Hashimoto, R. Kuzmickas, and P. Rotwein. 2006. Complex
biosynthesis of the muscle-enriched iron regulator rgmc. J Cell Sci 119: 3273-
3283.

Kwon, S. J., G. T. Lee, J. H. Lee, W. J. Kim, and I. Y. Kim. 2009. Bone morphogenetic
protein-6 induces the expression of inducible nitric oxide synthase in
macrophages. Immunology 128: e758-765.

Lee, S. J., and A. C. McPherron. 2001. Regulation of myostatin activity and muscle
growth. Proc Natl Acad Sci U S A 98: 9306-9311.

Lepper, C., S. J. Conway, and C. M. Fan. 2009. Adult satellite cells and embryonic
muscle progenitors have distinct genetic requirements. Nature 460: 627-631.

Leshem, Y., D. B. Spicer, R. Gal-Levi, and 0. Halevy. 2000. Hepatocyte growth factor
(hgf) inhibits skeletal muscle cell differentiation: A role for the bhlh protein twist
and the cdk inhibitor p27. J Cell Physiol 184: 101-109.

Li, G., Y. Cui, L. Mcllmurray, W. E. Allen, and H. Wang. 2005. Rhbmp-2, rhvegf(165),
rhptn and thrombin-related peptide, tp508 induce chemotaxis of human
osteoblasts and microvascular endothelial cells. J Orthop Res 23: 680-685.

Li, S., T. Zhao, H. Xin, L. H. Ye, X. Zhang, H. Tanaka, A. Nakamura, and K. Kohama.
2004. Nicotinic acetylcholine receptor alpha7 subunit mediates migration of
vascular smooth muscle cells toward nicotine. J Pharmacol Sci 94: 334-338.

Lyons, K., J. L. Graycar, A. Lee, S. Hashmi, P. B. Lindquist, E. Y. Chen, B. L. Hogan,
and R. Derynck. 1989. Vgr-1, a mammalian gene related to xenopus vg-1, is a
member of the transforming growth factor beta gene superfamily. Proc Natl Acad









Sci U S A 86: 4554-4558.


Mansouri, A., A. Stoykova, M. Torres, and P. Gruss. 1996. Dysgenesis of cephalic
neural crest derivatives in pax7-/- mutant mice. Development 122: 831-838.

Maroto, M., R. Reshef, A. E. Munsterberg, S. Koester, M. Goulding, and A. B. Lassar.
1997. Ectopic pax-3 activates myod and myf-5 expression in embryonic
mesoderm and neural tissue. Cell 89: 139-148.

Mauro, A. 1961. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 9: 493-
495.

Mayer, U., G. Saher, R. Fassler, A. Bornemann, F. Echtermeyer, H. von der Mark, N.
Miosge, E. Poschl, and K. von der Mark. 1997. Absence of integrin alpha 7
causes a novel form of muscular dystrophy. Nat Genet 17: 318-323.

McPherron, A. C., T. V. Huynh, and S. J. Lee. 2009. Redundancy of myostatin and
growth/differentiation factor 11 function. BMC Dev Biol 9: 24.

McPherron, A. C., A. M. Lawler, and S. J. Lee. 1997. Regulation of skeletal muscle
mass in mice by a new tgf-beta superfamily member. Nature 387: 83-90.

McPherron, A. C., A. M. Lawler, and S. J. Lee. 1999. Regulation of anterior/posterior
patterning of the axial skeleton by growth/differentiation factor 11. Nat Genet 22:
260-264.

McPherron, A. C., and S. J. Lee. 1997. Double muscling in cattle due to mutations in the
myostatin gene. Proc Natl Acad Sci U S A 94: 12457-12461.

Meynard, D., L. Kautz, V. Darnaud, F. Canonne-Hergaux, H. Coppin, and M. P. Roth.
2009. Lack of the bone morphogenetic protein bmp6 induces massive iron
overload. Nat Genet 41: 478-481.

Miller, K. J., D. Thaloor, S. Matteson, and G. K. Pavlath. 2000. Hepatocyte growth factor
affects satellite cell activation and differentiation in regenerating skeletal muscle.
Am J Physiol Cell Physiol 278: C174-181.

Montarras, D., J. Morgan, C. Collins, F. Relaix, S. Zaffran, A. Cumano, T. Partridge, and
M. Buckingham. 2005. Direct isolation of satellite cells for skeletal muscle
regeneration. Science 309: 2064-2067.

Moss, F. P., and C. P. Leblond. 1970. Nature of dividing nuclei in skeletal muscle of
growing rats. J Cell Biol 44: 459-462.

Mueller, B. K., T. Yamashita, G. Schaffar, and R. Mueller. 2006. The role of repulsive
guidance molecules in the embryonic and adult vertebrate central nervous
system. Philos Trans R Soc Lond B Biol Sci 361: 1513-1529.











Munsterberg, A. E., and A. B. Lassar. 1995. Combinatorial signals from the neural tube,
floor plate and notochord induce myogenic bhlh gene expression in the somite.
Development 121: 651-660.

Naka, D., T. Ishii, Y. Yoshiyama, K. Miyazawa, H. Hara, T. Hishida, and N. Kidamura.
1992. Activation of hepatocyte growth factor by proteolytic conversion of a single
chain form to a heterodimer. J Biol Chem 267: 20114-20119.

Niederkofler, V., R. Salie, and S. Arber. 2005. Hemojuvelin is essential for dietary iron
sensing, and its mutation leads to severe iron overload. J Clin Invest 115: 2180-
2186.

Niederkofler, V., R. Salie, M. Sigrist, and S. Arber. 2004. Repulsive guidance molecule
(rgm) gene function is required for neural tube closure but not retinal topography
in the mouse visual system. J Neurosci 24: 808-818.

O'Reilly, C., B. McKay, S. Phillips, M. Tarnopolsky, and G. Parise. 2008. Hepatocyte
growth factor (hgf) and the satellite cell response following muscle lengthening
contractions in humans. Muscle Nerve 38: 1434-1442.

Ohira, Y., and S. L. Gill. 1983. Effects of dietary iron deficiency on muscle fiber
characteristics and whole-body distribution of hemoglobin in mice. J Nutr 113:
1811-1818.

Otto, A., C. Schmidt, G. Luke, S. Allen, P. Valasek, F. Muntoni, D. Lawrence-Watt, and
K. Patel. 2008. Canonical wnt signalling induces satellite-cell proliferation during
adult skeletal muscle regeneration. J Cell Sci 121: 2939-2950.

Otto, A., C. Schmidt, and K. Patel. 2006. Pax3 and pax7 expression and regulation in
the avian embryo. Anat Embryol (Berl) 211: 293-310.

Oustanina, S., G. Hause, and T. Braun. 2004. Pax7 directs postnatal renewal and
propagation of myogenic satellite cells but not their specification. EMBO J 23:
3430-3439.

Ouyang, X., M. Fujimoto, R. Nakagawa, S. Serada, T. Tanaka, S. Nomura, I. Kawase,
T. Kishimoto, and T. Naka. 2006. Socs-2 interferes with myotube formation and
potentiates osteoblast differentiation through upregulation of junb in c2c12 cells.
J Cell Physiol 207: 428-436.

Polesskaya, A., P. Seale, and M. A. Rudnicki. 2003. Wnt signaling induces the
myogenic specification of resident cd45+ adult stem cells during muscle
regeneration. Cell 113: 841-852.

Rebbapragada, A., H. Benchabane, J. L. Wrana, A. J. Celeste, and L. Attisano. 2003.
Myostatin signals through a transforming growth factor beta-like signaling









pathway to block adipogenesis. Mol Cell Biol 23: 7230-7242.


Relaix, F., D. Rocancourt, A. Mansouri, and M. Buckingham. 2005. A pax3/pax7-
dependent population of skeletal muscle progenitor cells. Nature 435: 948-953.

Reshef, R., M. Maroto, and A. B. Lassar. 1998. Regulation of dorsal somitic cell fates:
Bmps and noggin control the timing and pattern of myogenic regulator
expression. Genes Dev 12: 290-303.

Rudnicki, M. A., P. N. Schnegelsberg, R. H. Stead, T. Braun, H. H. Arnold, and R.
Jaenisch. 1993. Myod or myf-5 is required for the formation of skeletal muscle.
Cell 75: 1351-1359.

Schmalbruch, H., and U. Hellhammer. 1976. The number of satellite cells in normal
human muscle. Anat Rec 185: 279-287.

Schober, S., D. Mielenz, F. Echtermeyer, S. Hapke, E. Poschl, H. von der Mark, H.
Moch, and K. von der Mark. 2000. The role of extracellular and cytoplasmic
splice domains of alpha7-integrin in cell adhesion and migration on laminins. Exp
Cell Res 255: 303-313.

Schultz, E. 1996. Satellite cell proliferative compartments in growing skeletal muscles.
Dev Biol 175: 84-94.

Seale, P., L. A. Sabourin, A. Girgis-Gabardo, A. Mansouri, P. Gruss, and M. A.
Rudnicki. 2000. Pax7 is required for the specification of myogenic satellite cells.
Cell 102: 777-786.

Sethi, J. K., and A. Vidal-Puig. Wnt signalling and the control of cellular metabolism.
Biochem J 427: 1-17.

Sheehan, S. M., R. Tatsumi, C. J. Temm-Grove, and R. E. Allen. 2000. Hgf is an
autocrine growth factor for skeletal muscle satellite cells in vitro. Muscle Nerve
23: 239-245.

Sherwood, R. I., J. L. Christensen, I. M. Conboy, M. J. Conboy, T. A. Rando, I. L.
Weissman, and A. J. Wagers. 2004. Isolation of adult mouse myogenic
progenitors: Functional heterogeneity of cells within and engrafting skeletal
muscle. Cell 119: 543-554.

Shinin, V., B. Gayraud-Morel, D. Gomes, and S. Tajbakhsh. 2006. Asymmetric division
and cosegregation of template DNA strands in adult muscle satellite cells. Nat
Cell Biol 8: 677-687.

Smith, C. K., 2nd, M. J. Janney, and R. E. Allen. 1994. Temporal expression of
myogenic regulatory genes during activation, proliferation, and differentiation of
rat skeletal muscle satellite cells. J Cell Physiol 159: 379-385.









Solloway, M. J., A. T. Dudley, E. K. Bikoff, K. M. Lyons, B. L. Hogan, and E. J.
Robertson. 1998. Mice lacking bmp6 function. Dev Genet 22: 321-339.

Song, W. K., W. Wang, R. F. Foster, D. A. Bielser, and S. J. Kaufman. 1992. H36-alpha
7 is a novel integrin alpha chain that is developmentally regulated during skeletal
myogenesis. J Cell Biol 117: 643-657.

Stern, C. D. 1995. Common molecular pathways for patterning of the body axis, limbs,
central nervous system, and face during embryonic development. Cleft Palate
Craniofac J 32: 525-527.

Stockdale, F. E., and H. Holtzer. 1961. DNA synthesis and myogenesis. Exp Cell Res
24: 508-520.

Swatland, H. J. 1974. Fetal and neonatal development of spindle capsules and
intrafusal myofibers in the porcine sartorius. J Anim Sci 39: 42-46.

Swatland, H. J., and N. M. Kieffer. 1974. Fetal development of the double muscled
condition in cattle. J Anim Sci 38: 752-757.

Tajbakhsh, S., U. Borello, E. Vivarelli, R. Kelly, J. Papkoff, D. Duprez, M. Buckingham,
and G. Cossu. 1998. Differential activation of myf5 and myod by different wnts in
explants of mouse paraxial mesoderm and the later activation of myogenesis in
the absence of myf5. Development 125: 4155-4162.

Tajbakhsh, S., D. Rocancourt, G. Cossu, and M. Buckingham. 1997. Redefining the
genetic hierarchies controlling skeletal myogenesis: Pax-3 and myf-5 act
upstream of myod. Cell 89: 127-138.

Tatsumi, R., and R. E. Allen. 2004. Active hepatocyte growth factor is present in skeletal
muscle extracellular matrix. Muscle Nerve 30: 654-658.

Tatsumi, R., J. E. Anderson, C. J. Nevoret, O. Halevy, and R. E. Allen. 1998. Hgf/sf is
present in normal adult skeletal muscle and is capable of activating satellite cells.
Dev Biol 194: 114-128.

Tatsumi, R., A. Hattori, Y. Ikeuchi, J. E. Anderson, and R. E. Allen. 2002. Release of
hepatocyte growth factor from mechanically stretched skeletal muscle satellite
cells and role of ph and nitric oxide. Mol Biol Cell 13: 2909-2918.

Tatsumi, R., S. M. Sheehan, H. Iwasaki, A. Hattori, and R. E. Allen. 2001. Mechanical
stretch induces activation of skeletal muscle satellite cells in vitro. Exp Cell Res
267: 107-114.

Thies, R. S., T. Chen, M. V. Davies, K. N. Tomkinson, A. A. Pearson, Q. A. Shakey, and
N. M. Wolfman. 2001. Gdf-8 propeptide binds to gdf-8 and antagonizes biological
activity by inhibiting gdf-8 receptor binding. Growth Factors 18: 251-259.













Valdimarsdottir, G., M. J. Goumans, A. Rosendahl, M. Brugman, S. Itoh, F. Lebrin, P.
Sideras, and P. ten Dijke. 2002. Stimulation of idl expression by bone
morphogenetic protein is sufficient and necessary for bone morphogenetic
protein-induced activation of endothelial cells. Circulation 106: 2263-2270.

van der Ven, P. F., G. Schaart, P. H. Jap, R. C. Sengers, A. M. Stadhouders, and F. C.
Ramaekers. 1992. Differentiation of human skeletal muscle cells in culture:
Maturation as indicated by titin and desmin striation. Cell Tissue Res 270: 189-
198.

Walsh, F. S., and A. J. Celeste. 2005. Myostatin: A modulator of skeletal-muscle stem
cells. Biochem Soc Trans 33: 1513-1517.

Welser, J. V., N. Lange, C. A. Singer, M. Elorza, P. Scowen, K. D. Keef, W. T.
Gerthoffer, and D. J. Burkin. 2007a. Loss of the alpha7 integrin promotes
extracellular signal-regulated kinase activation and altered vascular remodeling.
Circ Res 101: 672-681.

Welser, J. V., N. D. Lange, N. Flintoff-Dye, H. R. Burkin, and D. J. Burkin. 2007b.
Placental defects in alpha7 integrin null mice. Placenta 28: 1219-1228.

Whittemore, L. A., K. Song, X. Li, J. Aghajanian, M. Davies, S. Girgenrath, J. J. Hill, M.
Jalenak, P. Kelley, A. Knight, R. Maylor, D. O'Hara, A. Pearson, A. Quazi, S.
Ryerson, X. Y. Tan, K. N. Tomkinson, G. M. Veldman, A. Widom, J. F. Wright, S.
Wudyka, L. Zhao, and N. M. Wolfman. 2003. Inhibition of myostatin in adult mice
increases skeletal muscle mass and strength. Biochem Biophys Res Commun
300: 965-971.

Williams, B. A., and C. P. Ordahl. 1994. Pax-3 expression in segmental mesoderm
marks early stages in myogenic cell specification. Development 120: 785-796.

Yaffe, D., and 0. Saxel. 1977. Serial passaging and differentiation of myogenic cells
isolated from dystrophic mouse muscle. Nature 270: 725-727.

Yamada, M., Y. Sankoda, R. Tatsumi, W. Mizunoya, Y. Ikeuchi, K. Sunagawa, and R.
E. Allen. 2008. Matrix metalloproteinase-2 mediates stretch-induced activation of
skeletal muscle satellite cells in a nitric oxide-dependent manner. Int J Biochem
Cell Biol 40: 2183-2191.

Yamamoto, N., S. Akiyama, T. Katagiri, M. Namiki, T. Kurokawa, and T. Suda. 1997.
Smadl and smad5 act downstream of intracellular signalings of bmp-2 that
inhibits myogenic differentiation and induces osteoblast differentiation in c2c12
myoblasts. Biochem Biophys Res Commun 238: 574-580.









Yao, C. C., B. L. Ziober, R. M. Squillace, and R. H. Kramer. 1996. Alpha7 integrin
mediates cell adhesion and migration on specific laminin isoforms. J Biol Chem
271: 25598-25603.

Zimmers, T. A., M. V. Davies, L. G. Koniaris, P. Haynes, A. F. Esquela, K. N.
Tomkinson, A. C. McPherron, N. M. Wolfman, and S. J. Lee. 2002. Induction of
cachexia in mice by systemically administered myostatin. Science 296: 1486-
1488.

Ziober, B. L., M. P. Vu, N. Waleh, J. Crawford, C. S. Lin, and R. H. Kramer. 1993.
Alternative extracellular and cytoplasmic domains of the integrin alpha 7 subunit
are differentially expressed during development. J Biol Chem 268: 26773-26783.









BIOGRAPHICAL SKETCH

Wenli Sun was born in Shanghai, China, to Yongxian Sun and Caizhen Pan. She

grew up as the only child of this family and completed all of her educations until

university in this large city. In July 2006, Wenli Sun graduated with a bachelor's degree

in veterinary medicine from Shanghai JiaoTong University. She then moved to the

United States and began study at the University of Florida under the advisement of Dr.

Sally Johnson in 2007. Wenli Sun currently resides in Gainesville, Florida with Tony the

fish and Shadow the cat. Upon receiving the master's degree, Wenli Sun will go back to

her hometown and stay with her families. She hopes to find a position in related area

there, continue exploring the sea of knowledge, and ultimately find her interest.





PAGE 1

IMPACTS OF BMP6 ON MYOGENIC CE LL PROLIFERATION, DIFFERENTIATION, AND S ATELLITE CELL POPULATION By WENLI SUN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010 1

PAGE 2

2010 Wenli Sun 2

PAGE 3

ACK NOWLEDGMENTS It is an honor to thank those who made this thesis possible. First of all, I owe my deepest gratitude to the chair of my committ ee, Dr. Sally Johnson, who gave me the chance to study at the University of Flori da and work under her direction. This thesis would not have been possible without her gui dance and support. I also thank Dr. Alan Ealy and Dr. Peter Hansen, for serving on my supervisory committee and for making excellent suggestions and ideas. It is also a pleasure for me to show my gratitude to my former and present colleagues: Ju Li, Dillon Walker, Diana Delg ado, John Michael Ganzalez, Sarah Reed, and Marni Lapin. Thank you for kindly provid ing me the necessary help for my work. I would like to thank my beloved families and friends for being my back-up all the time. The love from my parents was always a s ource of courage. It is my friends that keep me smiling through the hard times. Special thanks to Hsiu and Shadow the cat; thank you for your company which comfort me a lot. Lastly, I offer my regards and blessings to all of those who supported me in any way during the completion of my thesis. 3

PAGE 4

TABL E OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................3 LIST OF FI GURES..........................................................................................................5 ABSTRACT .....................................................................................................................6 CHAPTER 1 LITERATURE REVIEW............................................................................................7 Satellite Cells: Definition and Functions....................................................................7 Extracellular Surface Marker-Associa ted Satellite Cell Identification..................8 Molecular Identificatio n of Satellit e Cells ..........................................................10 Satellite Cell Self-Renewal and Progenitor Producti on.....................................12 Microenvironmental Control of Satellite Ce ll Biol ogy..............................................14 Notch, Wnt and Self-Renewal..........................................................................15 Hepatocyte Growth Fa tor and Acti vation ..........................................................17 Growth Differentiation Factor 8.........................................................................20 Bone Morphogenetic Protein 6.........................................................................22 2 MATERIALS A ND METHOD S................................................................................25 Bovine Satellite Ce ll Isolat ion..................................................................................25 Cell Cult ure.............................................................................................................25 Immunocytochem istry.............................................................................................26 Alkaline Phosphatas e Histolo gy..............................................................................27 Western Blots.........................................................................................................27 Luciferase Repor ter Assay......................................................................................28 BMP6 RT -PCR .......................................................................................................29 Statisti cs.................................................................................................................29 3 RESULT S...............................................................................................................30 BMP6 is Expressed in Bo vine Skeletal Muscle.......................................................30 BMP6 Affects Distinct Aspects of Satellite Ce ll Myogenesi s...................................30 Repression of BSC Myogenesis is I ndependent of Transdi fferentiation.................32 4 DISCU SSION.........................................................................................................46 LIST OF RE FERENCES ...............................................................................................51 BIOGRAPHICAL SKETCH ............................................................................................62 4

PAGE 5

LIST OF F IGURES Figure page 3-1 Bovine muscle tiss ue expresse s BMP6..............................................................34 3-2 BMP6 phylogenetic tr ee.....................................................................................35 3-3 BMP6 inhibits Ed U incorpor ation........................................................................36 3-4 BMP6 changes BSC subpopulation pr oportions .................................................37 3-5 BMP6 inhibits my ofiber fo rmation.......................................................................38 3-6 BMP6 inhibits different iation of BSC and myoblas ts...........................................40 3-7 BMP6 induces alkaline phosphatase (A LP) activity in C2C12 myoblasts but not 23A2 myoblasts and BSC.............................................................................41 3-8 BMP6 activates SMAD1/5/8 in BSC, 23A2 and C2C 12 myobla sts.....................43 3-9 BMP6 stimulates tr anscription of BRELuc.........................................................45 4-1 Illustration of satellite cell subpopulations and myogene sis................................50 5

PAGE 6

Abstract of Thesis Pres ented to the Graduate School of the University of Fl orida in Partial Fulf illment of the Requirements for t he Degree of Master of Science IMPACTS OF BMP6 ON MYOGENIC CE LLS PROLIFERATION, DIFFERENTIATION, AND SATELLITE CELLS POPULATION By Wenli Sun August 2010 Chair: Sally E. Johnson Major: Animal Sciences Bone morphogenetic protein 6 (BMP6), a me mber of TGF-beta superfamily, plays an important role in modulateing epit helial and neural tissue development. The expression of BMP6 in young (<7 days) bovine semimembranosus muscle tissue suggests a potential regulatory effect in bovine muscle. Exogenous BMP6 treatment was examined in three different myogenic ce ll cultures: bovine satellite cells, 23A2 mouse myoblasts, and C2C12 mouse satellite ce lls. The treatment effect was confirmed by BRE-Luc activity in all cells. BMP6 caused different responses inn different cells. The proliferation rate was dec reased by BMP6 in BSC, 23A 2 and C2C12 cells. Myogenic differentiation and fiber formation were suppressed in BSC, 23A2 and C2C12 cells. Alkaline phosphatase activity was induced by BMP6 in C2C12 but not in 23A2 or BSC. Furthermore, BMP6 treatment changed proportion of cells defined by Pax7 and Myf5 in BSC. In all 3 types of cells, western blo tting was used to demonstrate phosphorylation and activation of SMAD 1/5/8. These data indicate that BMP6 signals through SMAD1/5/8 to regulate myogenic cell proliferation and differentiation. 6

PAGE 7

CHA PTER 1 LITERATURE REVIEW Satellite Cells: Definition and Functions In 1961, Alexander Mauro described a mi nor population of het erochromatin dense cells positioned immediately adjac ent to the mature muscle fibe r in frogs (Mauro, 1961). These cells, which he termed satellite cells, reside immediately beneath the fiber basal lamina and appear quiescent. He proposed that satellite cells were dormant embryonic myoblasts or unknown infiltrating cells that may explain the vexing problem of skeletal muscle regeneration. While numerous groups had noted the unique ability of muscle to repair itself, the source of new muscle fi bers and myonuclei within the fibers remained unresolved. Bintliff and Walker (1960) reported that neofibers formed during mouse skeletal muscle regeneration did not contain 3H-thymidine labeled nucle i when the isotope was administered 2-3 days after damage, leading the group to conclude that myonuclei are mitotically inactive (Bintliff and Walker, 1960 ). These results were extended to chick embryonic myofiber formation by Stockdale and Holtzer (1961) who found that somite myofibers fail to incorporate radiolabeled thymidine (Stockdale and Holtzer, 1961). However, the source of the proliferative cells that allow postnatal muscle growth and repair remained unclear. In 1970, Moss and LeBlond performed a time course standy of 3H-thymidine incorporation into muscle nuclei of rapi dly growing rat pups (Moss and Leblond, 1970). Conclusive evidence was obtained by electr on microscopy demonstrating that satellite cells were mitotically active and capable of fusion with adjacent muscle fibers. Thus, Mauros contention that satellite cells ar e a source of myonuc lei was validated. 7

PAGE 8

The ability of satellite cells to reside within th e muscle throughout the lifespan of an individual enables both growth and repair c apabilities. The numbers of satellite cells in rat muscle decline from birth to adult hood coincident with in creased myonuclei and muscle mass (Cardasis and Cooper, 1975). Howe ver, their supply is never abrogated with advanced age. Electron microscopy rev ealed that a small percentage of satellite cells, less than 1% of total muscle nuclei, are retained in the muscles of people over the age of 70 (Schmalbruch and Hellhammer, 1 976). These pioneering efforts provided the first glimpse of what is now c onsidered the adult muscle stem cell. Extracellular Surface Marker-Associat ed Satellite Cell Identification Satellite cells, historically, are identifi ed by their physical pos ition under the basal lamina adjacent to the muscle fiber. Isolat ion and culture of the population often was hindered by the presence of non-fusing cells that most investigators classified as fibroblasts. Early attempts at molecular defin ition of rodent satellite cells revealed that many of these cells expressed the structural protein, desmin. Satellite cells isolated from juvenile rat pups express desmin prior to induction of the myogenic gene regulatory network and differentiation (Foster et al., 1987; Kaufman and Foster, 1988). These results further substantiated that sa tellite cells are myogenic precursor cells that are distinct from embryonic my oblasts. Similar to the rat, pro liferating cultures of human satellite cells express the intermediate fila ment protein (van der Ven et al., 1992). Although greater than 95% of human satellite cells contain desmin, progeny of these cells exhibit divergent myogenic po tential (Baroffio et al., 1995). The majority of human satellite cells co mmit to differentiate as indicated by expression of skeletal actin, myosin and fusi on. By contrast, a small number of clonal satellite cells retain desmin expression but fail to proceed into the terminal differentiation 8

PAGE 9

program. The non-fusing desmin express ing population is the first report of a musclederived stem cell. This cell is retai ned as a mononucleate in the presence of differentiation permissive conditi ons (Baroffio et al., 1996). Subculture of these cells leads to the emergence of myoblast progeny capable of biochemical and morphological differentiation as well as self-renewal. The isolation and characterization of desmin-positive myogenic precursors from humans and rodents provided the initial ev idence for heterogeneity within the satellite cell compartment. Indeed, four desmin-expressing satellit e cell subpopulations are found in humans with each demonstrating variabl e degrees of differentiation capabilities (Edom-Vovard et al., 1999). However, desmin is not a cross-species marker of satellite cells. Primary cultures of bovine sa tellite cells are less than 15% desmin immunopositive (Allen et al., 1991). Importantly, these cells fa il to incorporate thymidine analogs suggesting they are at an early stage of terminal differentiation. The inability of desmin to denote all sate llite cells and the documented level of heterogeneity within the compar tment underscored the search for universal markers of the adult muscle population. Cell surface pr oteins, including integrins, adhesion molecules and extracellular matrix glycoproteins, were ex plored for their value as isolation tools for satellite cell enrichment. Postnatal rat muscle fi bers exhibit limited surface expression of 7-integrin but a substantial numbe r of putative satellite cells are immunoreactive for the adhesion molecule (Song et al., 1992). It was further noted that antibodies against a splice variant of 7-integrin are effectiv e satellite cell enrichment tools (Ziober et al., 1993). Human myoblasts obtained by fluorescence activated cell sorting (FACS) for 7-integrin are 95% myogenic in nat ure (Blanco-Bose et al., 2001). 9

PAGE 10

In addition to serving as an isolat ion aid, the laminin receptor formed by 7 1-integrin association plays a critical ro le in migration of myogenic cells in vitro (Schober et al., 2000; Yao et al., 1996). While 7 1-integrin serves as a convenient marker of satellite cells and myoblasts, it is not exclusive to myogenic cells and enrichment for muscle precursors using anti7 1 integrin is species-specif ic (Flintoff-Dye et al., 2005; Gardiner et al., 2005; Kallest ad and McLoon, ; Mayer et al., 1997; Welser et al., 2007a; Welser et al., 2007b). A host of extracellular matrix-associ ated molecules used for satellite cell purification has evolved s ubstantially since the early efforts employing anti7-integrin. Immunohistochemical elucidat ion of muscle progenitors in postnatal animals often employs antibodies directed against neural cell adhesion molecule (NCAM) (Cashman et al., 1987), M-cadherin (Irintchev et al., 1997), c-Met (Tatsumi et al., 1998) and nestin (Day et al., 2007). Each antibody denotes mononucleated cells beneath the fiber basal lamina that become mitotically active during muscle regeneration. Isolation of satellite cells for therapeutic intervention of muscle damage and disease typically utilizes Hoechst dye exclusion and/or immunofluor escent enrichment with flow cytometry. FACS methodology includes combinations of antibodies for syndecan-3 and -4 (Cornelison et al., 2001; Cornelison et al., 2004), surface heparin su lfate proteoglycans, CXCR4 (Sherwood et al., 2004), a chemokine receptor, SM/C2.6 (Fukada et al., 2004), a poorly characterized surface antigen, and CD 34 (Montarras et al., 2005), a sialomucin protein that denotes progenitor cells. Molecular Identification of Satellite Cells Substantive advances in the field of satellite cell biology occurred following elucidation of key transcription factors involved in lineage commitment of muscle 10

PAGE 11

precursor. Early research determi ned that th e adult satellite cell expressed coordinately members of the myogenic regulatory factor (MRF) family (Smith et al., 1994). The MRFs, Myf5, MyoD, myogenin an d MRF4, exhibit the unique ability to initiate the skeletal muscle gene expression program in non -muscle cells in vitro (Chanoine et al., 2004). Myf5 and MyoD are expressed dur ing early mouse embryogenesis and are responsible for establishment of the myogenic lineage. Mice genetically ablated of these two transcription factors die in utero and ar e devoid of a myoblast population (Rudnicki et al., 1993). As the skeletal myoblast transits into t he myogenic program, it begins to express myogenin, the requisite transcrip tional mediator for terminal differentiation. Myogenin-/mice die shortly after birth; they contai n myoblasts but are deficit in contractilecompetent muscle fibers (Hasty et al., 1993). With regards to satellite cells, Myf5 and MyoD are expressed during the early proliferative period in vitro followed by downregulation of the genes and up-regulation of myogenin. Due to the identical expression pattern found in embryonic myoblasts, it was thought that the satellite cell may represent an arrested embryonic myoblast. However, satellite cells are retained throughout the lifetime of an i ndividual due to self-renewal of the population, a feature distinct from the embryonic myoblast. To identify genetic factors critical to satellite cell development and postnatal function, Seale et al. (2000) performed repr esentational difference analysis (RDA) to enrich for transcripts unique to satellite cell s. The genetic screen identified Pax7 as an abundant transcript in the adult muscle prec ursor population. Pax7 is a paired box transcription factor orthologous to Pax3, a regulatory factor expressed prior to the MRFs 11

PAGE 12

and required for initiation of My f5 transcription (Maro to et al., 1997). Mice null for Pax7 typically die prior to w eaning with both neural and muscle defects (Mansouri et al., 1996; Seale et al., 2000). Electron microscopy revealed that the Pax7-/skeletal muscle is severely compromised in satellite cell num bers. However, a portion of the genetic null mice survive to adult with no apparent r eduction in muscle fiber numbers or crosssectional area (Oustanina et al., 2004). Inje ction of cardiotoxin, a myonecrotic agent, into Pax7-/hindlimb muscles caused a se vere reduction in neofiber formation and muscle regeneration. Serial culture of putat ive satellite cells isolated from Pax7-/revealed a decline in the number s of muscle progenitor cells and their ability to form fibers when compared to heteroz ygous controls. Thus, it was concluded that Pax7 is not required for specification of the lineage but is necessary for self-renewal of satellite cells. An elegant confirmation and extension of these findings was performed using conditional ablation of the transcription factor. Genetic ablation of Pax7-/in young mice (P60-90) did not disrupt growth regeneration or satellite cell self-renewal (Lepper et al., 2009). By contrast, conditional removal of Pa x7 in utero or during the early juvenile period (
PAGE 13

generate a pool of progenitors. Early work in both rodent and human models indicated that not all satellite cells were functionally eq uivalent, suggestive of distinct stem and progenitor subgroups. Mixed populations of satellite cells with different cell cycle kinetics were reported in rats (Schultz, 1996) Also, primary cultures of human satellite cells display different prolifer ation and differentiation capabilit ies (Baroffio et al., 1995). In the search for protein fingerprints unique to quiescent muscle progenitors, Beauchamp (2000) noted a degree of heterogeneity within the satellite cell pool based upon Myf5 expression. Myofibers with attac hed satellite cells isolated from Myf5-nLacZ mice revealed that two subpopulations exis t based upon differential expression of the transgene. All satellite cells expressed CD34 and M-cadherin but a minor myogenic population did not exhibit -galactosidase activity, the assay product for nLacZ. Kuang et al (2007) extended these observations to the Pax7-expressing satellite cells with 90% of the population exhibiting expression of Myf5 and 10% expressing Pax7-only. Moreover, Pax7-only muscle cells divide asy mmetrically, a hallmark of stem cell selfrenewal, to yield a daughter cell expressing both Pax7 and Myf5. Transplantation of Pax7-only cells into the tibialis anterior of Pax7-/mice re vealed that the cell could both restore muscle growth and re-populate the nic he. By contrast, Pax7+/Myf5+ expressing satellite cells were unable to reconstitute the sublaminar pool and exhibited only limited amounts of muscle repair. These efforts prov ide a framework for definition of satellite cell stem and progenitors based upon differential Myf5 expression. Although Pax7 is regarded as the definitive marker of adult muscle satellite cells, it is not exclusive. A portion of satellite cells exhibit Pax3 expression and others are defined by Pax3 and Pax7 co-expression (Otto et al., 2006; Relaix et al., 2005). Pax3 13

PAGE 14

and Pax7 exhibit overlapping, as well as unique, expression patterns during embryogenesis in rodents and chicks (Boryc ki et al., 19 99; Goulding and Paquette, 1994; Williams and Ordahl, 1994). Moreover, t he two control distin ct elements within embryonic and adult myogenesis. Pax3 initiates transcription of Myf5 to establish the early myogenic lineage duri ng embryogenesis, an event that precedes MyoD expression (Tajbakhsh et al., 1997). Mice ho mozygous null for both Pax3 and Myf5 lack body muscles and MyoD expression. Sequential activation of Myf5 and MyoD does not occur in all satellite cells indicating at l east two distinct subpopulations exist (Cooper et al., 1999). Following cardiotoxin-induced injury in mice satellite cells expr ess Myf5, MyoD or a combination of the two MRFs. Unlike Cornelison and Wold (1997), Myf5 was not detected in quiescent satellite cells; the protein was evident only upon activation. The ability of Myf5 to denote quiescent satellite cells was explored further using heterozygous Myf5-nLacZ mice, which contai n nuclear LacZ knocked into the one allele of Myf5 (Beauchamp et al., 2000). -galactosidase expressing M-cadherin immunopositive satellite cells were evident in non-injured adult muscles supporting the hypothesis that Myf5 is a marker of quiesc ent muscle progenitors in vivo. Satellite cells isolated from heterozygous Myf5-nLacZ mice and expanded in vitro successfully engraft into diseased muscle (mdxnu/nu) with a sma ll number assuming the satellite position (Heslop et al., 2001). Microenvironmental Control of Satellite Cell Biology Numerous growth factors, morphogens and hormones exert effects on both muscle fibers and satellite cells. Several member s of the fibroblast gr owth factor (FGF) superfamily serve as potent mitogens while suppressing myofiber formation 14

PAGE 15

(Buckingham, 2003). Platelet-der iv ed growth factor (PDGF) exer ts effects similar to the FGFs and may be one of the first blood-borne growth factors delivered to sites of myotrauma (Christov et al., 2007). Insulin-likegrowth factor I (IGF-I) has little effect on satellite cell proliferation but strongly supports myoblast fusion into mature fibers (Clemmons, 2009). Although these growth factor s are important to satellite cell actions and muscle function, they are often deliv ered systemically and are not regarded as niche factors for the purpos es of this discussion. Notch, Wnt and Self-Renewal The niche localized signals that direct self-renewal and progenitor development remain poorly understood. Asymmetric cell divisi on leading to fate decisions occurs in many organisms and tissues and commonly employs a Notch signal. Notch, a transmembrane receptor, binds De lta and Jagged ligands leading to -secretase cleavage of the intracellula r domain (ICD) (Fortini, 2009). ICD proteolytic maturation allows for nuclear translocation and modi fication of gene transcription. The Notch pathway is intact in mouse satellite cell: myofiber explant cultures and receptor activation causes increased proliferat ion (Conboy and Rando, 2002). Immunostaining for the Notch inhibitor, Numb, demonstrated a portion of the dividing satellite cells exhibited asymmetric distribut ion of the protein. Importa ntly, the daughter cell with intense Numb localization failed to contain detectable Pax3 indicating a more committed progenitor cell. No differential Numb loca lization was observed in Pax7-expressing satellite cells. Pax7+/Myf5satellite cells expressed abundant amounts of Notch-3 by comparison to Pax7+/Myf5+ progenitors, which express greater amounts of Delta-1 transcripts (Kuang et al., 2007). In vivo BrdU pulse labeling experiments followed by myofiber explant culture dem onstrated that asymmetric di vision of attached satellite 15

PAGE 16

cells inv olved co-segregation of template DNA and Numb to the putative muscle stem cell (Shinin et al., 2006). The importance of Notch inhibition vi a Numb as a determinant of progenitor commitment was challenged by experiment s with targeted mis-ex pression in mouse embryos. Ectopic expression of Numb in Pa x3 and Pax7 somitic cells prior to progenitor fate commitment revealed that Numb in creased the numbers of Pax3+/Pax7+ stem cells, contrary to expectations (Jory et al., 2009). While it is safe to state that Notch signals affect myogenic decisions, it remain s unclear if the various satellite cell subpopulations respond to the fate determinant analogously. The Drosophila Wingless gene and the vert ebrate homolog, Int-1, are commonly referred to as Wnts. In mammals, this large fa mily of secreted proteins binds to frizzled (Fz) receptors to elicit canonical responses through nuclear -catenin accumulation as well as non-canonical effects that include activation of Rac and Rho GTPases (Sethi and Vidal-Puig). Early work using chick somite explant cultures detailed the ability of Wnt1, produced by the neural tube, to activate Myf5 in the dorsal aspects of somite committing cells to the myogenic lineage (Muns terberg and Lassar, 1995; Stern, 1995). A similar fate decision occurs through su rface ectoderm-derived Wnt7a induction of MyoD in the dermamyotome compartment of the somite (Tajbakhsh et al., 1998). These early fate decisions were extrapolated to regenerating muscle and satellite cells. Wnt5a, 5b and 7a are transcribed by primary mouse myof iber explant cultur es and treatment of CD45+/Sca1+ hematopoeitic progenitors with a cockt ail of the Wnts is sufficient to instill the myogenic gene network (Polesskaya et al ., 2003). The authors conclude that niche 16

PAGE 17

production of the Wnts during muscle regeneration serves to recruit non-myogenic cells into the lineage and im prove regenerative capabilities. Direct involvement of Wnts on satellite cell biology was reported by Steelman et al (2006) who found that Wnt4 acts a mitogen for mouse satellite cells en masse. By contrast, Otto et al. (2008), using single fiber explant cu ltures, found that Wnt4 inhibits proliferation of the associated satellite cells while Wnt1, 3 and 5a increased satellite cell proliferation (Otto et al., 2008). The ability of the Wnts to alter satellite cell myogenesis appears to be agedependent. Satellite cells from old mice tend to lose their myogenicity at the expense of a fibroblast-like lineage (Brack et al., 2007). In contrast to embryonic myoblasts, Wnt signaling causes transdifferentiation of aged sate llite cells. The identity of the circulating Wnt or niche-localized Wnts responsible for the fate modification remain unknown. Interestingly, the fate alteri ng Wnt activity is absent from the serum of young mice. Hepatocyte Growth Fator and Activation It was noted that satellite cells attached to intact, viable muscle fibers exited quiescence sooner if the culture cont ained damaged or dead fibers (Bischoff, 1986). Crude preparations of cr ushed muscle extract (CME) contained a mitogen that shortened the time to G1/S phase in satellit e cells cultured in vitro and increased the numbers of proliferative satellit e cells following injection in vivo. The unknown activator and mitogen elicited similar activity on rat sa tellite cells as hepato cyte growth factor (HGF) (Allen et al., 1995). HGF reduced th e time delay between G0 and G1/S in cultures of satellite cells isolated from mature rats, analogous to CME. Due to the functional similarities and satellite cellexpressi on of c-Met, the HGF re ceptor, Allen et al. (1995) postulated that HGF was the activator of CME. Validation of HGF as the satellite 17

PAGE 18

cell activation factor w as provided by Tatsum i et al (1998) whereby it was demonstrated that HGF was present in CM E and that immunodepletion of HGF from CME prevented satellite cell activation. HGF is synthesized and released by the satellite cell to create an autocrine loop that facilitates proliferation (Sheehan et al., 2000) and prevents precocious differentiation (Gal-Levi et al., 1998). Due to its inhibitory e ffects on fiber formation, the therapeutic potential of HGF may be limited. Injection of the growth factor into regenerating skeletal muscle caused an increase in the numbers of proliferating satellite cells but also suppressed neofiber formation (Miller et al., 2000). The inhibitory actions of HGF toward myoblast fusion and differentiation are mediated, in part, through c-Met initiated intracellular signals that culminate in up-regulation of T wist, a basic helix-loophelix transcriptional repressor (Leshem et al ., 2000). Translational inhibition of Twist mRNA with a putative antisense RNA molecu le partially restores biochemical and morphological parameters of myogenesis to chick satellite cells treated with HGF. The importance of HGF to satellit e cell function dur ing myotrauma and regeneration often overshadows t he influence of the regulatory protein as a mediator of muscle hypertrophy. Resistance exercise, st retch and the normal process of muscle growth are dependent upon the activation of satellite cells. Rat satellite cells that received a 2-hr mechanical stretch stimul us re-entered the cell cycle sooner than nonstretched cells and the improved activation ki netics were prevented by immunosorption of the autocrine HGF (Tatsumi et al., 2002; Tatsumi et al., 2001). Young men that performed an acute bout of ecce ntric exercise to achieve contraction-induced muscle 18

PAGE 19

damage released more active HGF from the muscle tissue (O'Reilly et al., 2008). In turn, the active HGF stimulated sa tellite cell activation and proliferation. The release of HGF from the muscle fiber and receptor docking on the adjacent satellite cell rapidly alters cell cycle dynamic s. Expeditious releas e of HGF from the extracellular matrix reserv oir necessitates both a shear detection mechanism and a proteolytic system for processing and activation of the growth factor. Anderson (2000) proposed that nitric oxid e (NO), an abundant, diffusible molecule found in muscle, participated in the initial si gnal for HGF-initiated activation of satellite cells. Treatment of dystrophic mice (mdx) wit h L-NAME, a chemical inhibitor of the NOS enzyme response for NO production, result ed in a substantial delay in muscle regeneration that was a ttributed to a block in HGF re lease from the fiber ECM and a subsequent blunting of satellite cell activa tion (Anderson, 2000). These results were extended by demonstration that stretch-induced HGF release from satellite cells is prevented by inhibition of NO production thereby, delaying in vitro activation. Although release of HGF is instrumental to receptor mediated actions on the satellite cell, these experiments did not address the proteolytic processing of HG F or its shedding from the ECM. HGF is synthesized as a large prec ursor protein that requires proteolytic processing into and chains that assemble into the functional heterodimeric HGF (Naka et al., 1992). Tatsumi and Allen (2004) dem onstrated that HGF is tethered to the myofiber ECM in both an active and inactive configuration. Pro-HG F is rapidly cleaved to its active form upon incubation with crushed muscle extract indicating that a matrixassociated protease system is present for production of mature HGF. Importantly, 19

PAGE 20

treatment of intact muscle with nitroprusside, a NO donor, resulted in the release of mature HGF heteromeric complexes from the matrix (Tatsumi and Allen, 2004). HGF release likely is mediated through NO activation of matrix metalloproteinases (MMPs), a family of endopeptidas es that degrade multiple EC M components. Treatment of satellite cells with TIMP, an inhibitor of MMPs, prevented HGF release from the ECM during cyclic stretch and blunted activation (Y amada et al., 2008). These results provide the basis for a working model of satellite cell activation in health and disease that includes near instantaneous synthesis and releas e of NO from the myofiber leading to MMP-mediated release of HGF, the growth factor required for exit from G0. Growth Differentiation Factor 8 One of the best examples of unrestricted skeletal muscle size is the Belgian Blue breed of cattle. These animals are not ed for their massive amounts of muscle deposition to the extent that they are often referred to as double-muscled. However, the animals do not possess duplicate muscles but simply contain twice as many muscle fibers per muscle (Ashmore et al., 1974; Swat land, 1974; Swatland and Kieffer, 1974). Due to the extreme amounts of muscle, problems with d ystocia and unconventional carcass parameters, this breed has had limited acceptance as a big cattle breed in the United States. In 1997, a new member of the transforming growth factor beta (TGF) superfamily, referred to as growth and different iation factor 8 (GDF8) or myostatin, was described (McPherron et al., 1997). The gene is highly expressed in skeletal muscle during embyrogenesis through adulthood. Mice genetically null for GD F8 exhibited 2-3 times the amount of muscle found in wildty pe animals. The phenotypic resemblance of the GDF-/mice to double muscled cattle provided a causative explanation for the 20

PAGE 21

excess muscle hypertrophy. Sequence analysis of GD F8 in Belgian Blue cattle demonstrated an 11-bp deletion in the codi ng sequence for the bioactive carboxyterminus leaving the protein inactive (Mc Pherron and Lee, 1997). Pietmontese, another double-muscled breed, contain a point mutation in GDF8 that leads to production of a biologically inactive protein. From these results it was concluded that GDF8 is a negative regulator of muscle size. GDF8 is synthesized as a propeptide that requires cleavage of the amino-terminal domain for bioactivity (Thies et al., 2001) The prodomain acts to inhibit GDF8 and injection or ectopic expression of the peptide enhances muscle size and attenuates the severity of muscle disease and cachexia (B ogdanovich et al., 2002; Whittemore et al., 2003; Zimmers et al., 2002). Although GDF8 circulates systemically, its major actions are regarded as autocrine and paracrine. GDF8 exerts its effects through the activin receptor IIb (ActRIIb) and includes phos phorylation and activation of Smad2 and Smad3 (Rebbapragada et al., 2003; Walsh and Celest e, 2005). Mice expressing a dominant negative form of ActRIIb in skeletal muscle display a 4-fold increase in muscle mass by comparison to the 2-fold increase observe d in GDF8-/animals (Lee and McPherron, 2001). The increased severity suggests that additi onal ActRIIb ligands participate in the regulation of muscle fiber size. GDF11, a st ructurally similar subfamily member to GDF8, does not modulate muscle size in the embryonic or neonatal mouse (McPherron et al., 2009; McPherron et al., 1999). Mice homozygous null for GDF8 and GDF11 in muscle are phenotypically no different than GDF8-/with regard to fiber numbers and size (McPherron et al., 2009). Thus, the i dentity of additional ActRIIb ligands remains unknown. 21

PAGE 22

Bone Morphogenetic Protein 6 The majority of bone morphogenetic protein (BMP) effects on myogenesis ar e noted during embryogenesis (Buckingham et al., 2003). BMP2 and BMP4, secreted by the neural tube and notochord, se rve to limit the size of t he developing somitic myotome in chick embryos (Reshef et al., 1998). Inhibi tion of BMP activity by Noggin allows for expansion of the embryonic myoblast pool. However, neither BMP2 nor BMP4 is activated during muscle regeneration arguing that they play an insign ificant role during postnatal muscle growth and repair (Zhao and Hoffman, 2004). BMP6, originally named Vgr-1, is expresse d by adult skeletal muscle (Lyons et al., 1989). Although BMP6-/mice display no phenotypic abnormalities in muscle size or ambulatory function, the growth factor may act as a paracri ne mediator of satellite cell activity (Solloway et al., 1998). BMP6 stimul ates iNOS expression, a known mediator of satellite cell activation, in macrophages (Kw on et al., 2009). Moreover, treatment of C2C12 satellite cells wit h BMP6 suppresses MyoD expression and muscle fiber formation (Ouyang et al., 2006). It remains unclear if inhibition of myogenesis is a direct effect or a consequence of initiation of the osteogenic gene program and subsequent myoblast transdifferentiation (Ebisawa et al ., 1999). An intriguing possibility is that BMP6 secreted by the muscle fiber serves as niche-localized factor that promotes satellite cell activation through NO production and suppresses precocious differentiation. BMP6 regulatory effects are mediated through phosphoryl ation and activation of Smad1, Smad5 and Smad8, collectively referred to as Smad1/5/8, shortly after docking with an oligomerized BMP receptor (Valdima rsdottir et al., 2002). Unlike BMP2 and 4, 22

PAGE 23

BMP6 exhibits high affinity bi nding with the type II receptor, activin receptor 2A or ALK2, prior to receptor oligomerization wit h BMPRI (Vukicevic and Grgurevic, 2009). The unique nature of BMP6 further ext ends to co-receptor interacti ons. The receptor guidance molecule (RGM) family contai ns four members that serve as specific co-receptors for the BMPs (Corradini et al., 2009) RGMa, RGMb/DRAGON and RGMc/hemojuvelin (HJV) are expressed in mammals with RGMd found only in fish. RGMs are GPI-linked proteins with an extracellular ligand binding interface and no apparent cytosolic signaling motif. The thr ee RGMs are expressed in several mouse tissues and are particularly abundant in skeletal muscle (Kanomata et al., 2009). RGMa is constitutively expressed during myogenes is and genetic ablation in mice causes neural tube defects with no apparent effect on skeletal muscle (Kanomata et al., 2009; Niederkofler et al., 2004). RGMb is up-regul ated during C2C12 myoblast differentiation with ectopic expression inhibitory to BMP2 induced myoblast transdifferentiation (Kanomata et al., 2009). RGMb-/ mice are neonatal lethal with possible neural mapping defects (Mueller et al., 2006). RGMc increases dramatically prior to C2 myoblast fusion (Kuninger et al., 2006). However, forced expr ession of the putativ e signaling modulator neither promotes nor deter s myofiber formation. RGMc -/mice are viable with no discernible muscle defects but suffer juven ile hemochromatosis (A ndriopoulos et al., 2009; Huang et al., 2005; Niederkofler et al ., 2005). In a like mann er, BMP6-/animals accumulate extreme amounts of iron in t he liver, pancreas and heart, a hallmark of juvenile hemochromatosis (Meynard et al., 2009). Infusion of soluble RGMc into mice effectively binds and inactivates BMP6 and i nduces iron accumulation in the serum and liver (Andriopoulos et al., 2009). Soluble RGMb bound BMP6 in vitro but failed to 23

PAGE 24

interact with the growth factor in vivo. T hus, RGMc is a specific binding partner for BMP6, a critical mediator of iron homeostasis. Since BMP6 is widely expressed in embr yonic and adult tissue, including musc le, in many species, it is supposed that BMP6 is also expressed in bovine muscle. Thus BMP6 may have regulatory effects via SMAD pat hway in bovine satellite cells, such as regulating proliferatio n, differentiation. Activated BSC can be divided into three groups based on Pax7 and Myf5 expression. Since the proportion of these groups is closely related to BSC lineage progression, BMP6 may also change the ratio of them. Moreover, BSC could be converted to osteogeni c cells under the effect of BMP6 as the mouse myogenic cell, C2C12. 24

PAGE 25

CHA PTER 2 MATERIALS AND METHODS Bovine Satellite Cell Isolation The semimembranosus muscle ( 455g) was harvested intact from Holstein bull calves (3-7 days of age) following euthanasia Visible connective tissue was removed, and the muscle was finely minced with a commercial meat grinder. The tissue was incubated with 0.8 mg/ml Type XI V protease (Sigma, St Louis, MO) in Earles Balanced Salt Solution (EBSS; Sigma, St Louis, MO) for 1 hour at 37 C with gentle mixing at 10 minute intervals. The tissue slurry was centrifuged at 1500 X g for 10 minutes and the protease decanted. An equal volume of ster ile phosphate buffered saline (PBS, pH 7.4) was added to the tissue and the slurry was vi gorously shaken for 5 minutes to liberate the fiber-associated satellite cells. Cells we re collected by centrifugation at 500 X g for 10 minutes and retention of the supernatant. The process was repeated for a total of 4 times. Cell pellets were collected by centrifugation at 1500 X g for 10 minute, resuspended in growth medium (low gl ucose Dulbeccos modified Eagle medium supplemented with 10% (v/v) horse serum (HS), 1% (v/v) 5000 Units/ml penicillinstreptomycin, 200 mM L-glutam ine and 0.1% (v/v) 10mg/ml gentimicin). Cells were further purified by sequ ential filtration through 70 m and 40 m cell strainers (BD Falcon, Durham, NC). The resulting bovine satellite cells (BSC) were stored frozen in growth medium containing 10% (v/v) dimeth yl sulfoxide in liquid nitrogen until use. Cell Culture All cell culture reagents were purchased from Invitrogen (Carlsbad, CA) unless otherwise noted. C2C12 mouse satellite ce lls and 23A2 embryonic myoblasts were cultured on 0.1% (w/v) gelatin coated tiss ue culture plasticware in high-glucose 25

PAGE 26

Dulbeccos modified Eagles medium (DMEM) containing 10% (v/v) fetal bovine serum (FBS), 1% (v/v) penicillin/strept omycin, L-glutamine, and 0.1% (v/v) gentamicin or basal Eagle medium (BME) containing 15% (v/v) FBS, 1% v/v penicilli n/streptomycin, Lglutamine, and 0.1% (v/v) gentamicin, respec tively. BSC were seeded at a density of 1.6X104/cm2 on tissue cultureware coated with entactin-collagen IV-laminin cell attachment matrix (ECL) in high glucose DM EM containing 10% (v/v) horse serum (HS), 1% (v/v) penicillin/streptomycin, 1% (v/v ) L-glutamine, and 0.1% (v/v) gentamicin reagent solution. Differentiation was induced by culture for 3 days in low glucose DMEM supplemented with 2% (v/v) HS, 1% (v/v) penicillin/streptomycin, and 0.1% (v/v) gentamycin. Where indicated, recombinant human BMP6 (R&D S ystems, Minneapolis, MN) was supplemented at 50 ng/ml in growth or differentiation medium. Proliferation was measured by 5-ethynyl-2-deoxyuridine (EdU), a nucleoside analog to thymidine, incorporation into DNA during the final 30 mi nutes or 2 hours of ex perimental treatment. Immunocytochemistry Myoblast cells were fixed with 4% (v/v ) formaldehyde in PBS for 10 minutes at room temperature. Myofiber cultures were fixed with Alc ohol-Formalin-Acetic Acid (AFA, 85% alcohol: 16% formaldehyde: 5% glacial ac etic acid, v/v) for 15 minutes at room temperature. Fixed cells were washed thoroughly with PBS and non-specific binding sites were blocked with the blocking buffer (PBS containing 5% (v/v) HS and 0.1% (v/v) Triton X-100 (Fisher Scientific NJ)) for 30 minutes at room temperature. Subsequently, cells were incubated with primary antibodie s under the following conditions: mouse antiPax7 hybridoma supernatant (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA), 1:10 in 0.1X Blocking Buffer, 4 C overnight; ra bbit anti-Myf5 (C-20; Santa Cruz Biotechnology, S anta Cruz CA), 1:100 in 0. 1X Blocking Buffer, 4 C 26

PAGE 27

overnight; mouse anti-myosin heavy chai n (MyHC) hybridoma supernatant (MF20; Developmental Studies Hybridoma Bank, Univer sity of Iowa, Iowa City, IA), 1:20 in Blocking Buffer, room temperature, 1 hour Primary antibodies wer e removed by washing with PBS (3 X 5 min). Immune co mplexes were detected with the appropriate anti-mouse AlexaFluor 488 and anti-rabbit Alex aFluor 527 (Invitrogen, Carlsbad, CA) diluted 1:200 in Blocking Buffer. Hoechst 33342 (5 g/ml in PBS) was used to identify nuclei. After a final PBS wash, fluorescent-labeled complexes were visualized using an Eclipse TE 2000-U microscope (Nikon, Le wisville, TX) equipped with an X-Cite 120 epifluorescence illumination system (EXF O, Mississauga, Ontario, Canada). Photomicrographs were captured using a Ph otometrics Cool Snap EF digital camera (Nikon, Lewisville, TX). Alkaline Phosphatase Histology Semiconfluent myoblasts and BSC were cu ltured with 50 ng/ml BMP6 for 48 hours following fixation with 4% (v/v) formaldehyde for 10 minutes. Afte r washing with PBS, the fixed cultures were incubated at 37 C fo r 18 hours with nitroblue tetrazolium and 5bromo-4-chloro-3'-indolyphos phate p-toluidine (NBT-BCIP). Colorimetric alkaline phosphatase activity was visualized under bright field and phase microscopy. Representative images were captured with a DXM 1200F digital camera. Western Blots BSC, C2C12 and 23A2 myoblasts were treated with 10 g/ml protamine sulfate (EMD Chemicals, Gibbstown, NJ) in serum free medium for 10 minutes at 37 C to remove surface associated growth factors. The cells were further incubated for one hour in serum free medium to reduce intracellula r signaling events. BMP6 (50 ng/ml) was added to the medium and cells were lysed in 4X Lammeli buffer (250 mM Tris, pH 6.8, 27

PAGE 28

8% (w/v)S DS, 40% (v/v) glycerol, and 0.4% (v/v) -mercaptoethanol ) at the indicated times. Lysates were sonicated and heated for 5 minutes at 95 C. Total cellular protein from an equivalent number of cells was sepa rated electrophoretically through 10% (v/v) polyacrylamide gels and transferred to nitrocellulose membrane. The membranes were incubated with 5% w/v nonfat dr y milk in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, and 0.1% (v/v) Tween 20) for 30 mi nutes at room temperature to block non-specific antigen binding sites. Primar y antibodies diluted in blocking solution were incubated with blots under the following conditions: rabbit anti-phospho-Smad1 (Ser463/465)/Smad5 (Ser463/465)/Smad8 (Ser426/428) (Cell Signaling Technolog y, Danvers, MA), 1:1000, 4 C overnight; rabbit anti-SMAD 1/5/8/9 (Abcam Cambridge, MA), 1:1000, 4 C overnight; mouse anti-alpha tubulin (Abcam, Cambridge, MA), 1:5000, room temperature for 1 hour. After incubation, the blots were wash ed with TBST 3 times for 5 minutes each, then incubated with peroxidaselabeled anti-mouse or anti -rabbit antibody (Invitrogen, Carlsbad, CA) in blocking solution for 1 hour at room temperatur e. After washing with TBST, immune complexes were visualized wit h chemiluminescence and exposure to xray films (X-OMAT LS Scientific Imaging Films, Kodak, Rochester, NY). Luciferase Reporter Assay Cells were transiently transfected by DNA -calcium phosphate pr ecipitate formation (C2C12, 23A2) or liposome-mediated DNA delivery (BSC; Lipofectamine 2000, Invitrogen, Carlsbad, CA). Plasmid DNA included BRE-Luc, a mulitmerized BMP response element driving luciferase expr ession, and pRL-tk, a plasmid coding for Renilla luciferase under control of a minimal thymide kinase promoter. The cells were cultured in the presence of transfection r eagents for 5 hours. After 18 hours in growth medium, the cells were treated with 50 ng/ml BMP6 for 48 hours. Cells were lysed and 28

PAGE 29

luciferase activities were measured usi ng a Dual-Lucifer ase Reporter Assay System (Promega, Madison, WI). BMP6 RT-PCR Total RNA (1 g) isolated from the semimembranosus of a young bull calf was digested with RNase-free DNase (Ambion, Aust in, TX) for 30 minutes at 37 C prior to reverse transcription with 60 M random hexamers (Promega, Madison, WI), 1 mM dNTP (Promega, Madison, WI), 40 units RNase inhibitor (New England Biolabs, Ipswich, MA), and M-MLV reverse transcr iptase (200 units, New England Biolabs, Ipswich, MA). The resulting cDNA was amplified with bovine BMP6 forward (5 TTGCCCCCAAGGGCTACGCT 3) and reverse (5 AGCACCGAGATGGCGTTCAGT 3) primers and AmpliTaq DNA polymerase (Appli ed Biosystems, Foster City, CA) under the following conditions; 95 C 2 minutes, 40 cycles of 95 C 30 seconds, 65 C 30 seconds, and 72 C 40 seconds and a final ex tension step of 72 C 10 minutes. The BMP6 amplicon was visualized following electrophoresis through ethidium bromide impregnated agarose gels, extrac ted and sequenced on both strands. Statistics All data presented in this study represent s at least three independent experiments with a minimum of two to three replicates per treatment group. A ll numerical data was analyzed with the PROC ANOVA procedure of the Statistical Anal ysis System (SAS, SAS inst. Inc., Cary, NC) where treatment, r epeat, and their interaction were the fixed effects. Data was presented as Means st andard error of the me an (SEM). Treatments were considered significantly different when P 0.05. 29

PAGE 30

CHA PTER 3 RESULTS BMP6 is Expressed in Bovine Skeletal Muscle BMP6 is widely expressed throughout m ouse embryonic and adult tissues including skeletal muscle (Lyons, 1989). In an analogous manner, BMP6 is expressed in the newborn calf. Total RNA was isolat ed from the semimembraneous muscle of a young Holstein bull calf ( 7 days) and analyzed by RT-PCR us ing gene specific primers (Figure 3-1). The resulting DNA amplificatio n of 175 bp was sequenced on both strands. NCBI database search using the BLASTN engine revealed 100% homology to bovine BMP6 The gene is conserved with 45 orthologs present in genomes ranging from lizards (Anolis carolinensis ) to dolphins ( Tursiops truncates), fruitflies ( Drosophila melanogaster ) and humans (Figure 3-2). The extens ive conservation of BMP6 suggests that it may participate in an integral developmental, metabo lic or regulatory function. BMP6 Affects Distinct Aspect s of Satellite Cell Myogenesis Members of the TGFsuperfamily, which includes BMP6, are noted inhibitors of satellite cell and myoblast proliferation and di fferentiation. The effects of BMP6 on bovine satellite cell (BSC) proliferation and myofiber formation were examined. BSCs were isolated, seeded on gelatin-coated tissuew are and cultured in growth medium for 48 hours. Subsequently, the medium was replaced with low-serum medium supplemented with 50 ng/ml BMP6 or vehicle for 48 hours. Embryonic mouse myoblasts (23A2) and mouse satellite cells (C2C12 ) were treated in an analogous manner. All cells were pulsed with the thymidine analog, Ed U, prior to fixation. The numbers of cells that incorporated EdU were measured and expre ssed as a percent of total cells (Figure 30

PAGE 31

3-3). A modest decline (~5%) in cell proliferation was appar ent for all myogenic cells types treated with BMP6. The limited response suggests that mu scle-derived BMP6 does not serve as a primary mediator of satellite cell quiesc enc e and proliferative activity. Although no robust change in total cell numbers were observed, BMP6 may affect satellite cell lineage progression. Satellite cells are a heterogeneous population comprised of both muscle stem and progenitor cells. Muscle stem cells, defined by Pax7 expression, give rise to myoblast progenitors that expre ss both Pax7 and Myf5 (Buckingham, 2007). The effects of BMP6 on the two subpopulations we re examined following 48 hrs of treatment (Figure 3-4). In brief, BSC were cultured in growth permi ssive medium supplemented with 50 ng/ml BMP6 for 48 hours followed by fixation and immunodetection of Pax7 and Myf5. The numbers of Pax7-only, Pax7+/Myf5+ and Myf5-only cells were measured and expressed as a percentage of total cells. BMP6 did not affect the percent of Pax7-only muscle stem cells. However, a reduction in the percent of Pax7+/Myf5+ progenitors and an increase in the numbers of Myf5-only my oblasts were evident. The population shift from progenitor to committed myoblast indica tes that BMP6 prom otes satellite cell myogenesis independent of an effect on global proliferation rate. The ability of BMP6 to accelerate the tr ansition from progenitor to myoblast also may hasten myofiber formation. BSC cultures were placed in differentiation permissive medium supplemented with 50 ng/ml BM P6. 23A2 and C2C12 myogenic cells were treated in a similar manner. After 48 or 72 hours, the cells were fixed and immunostained for myosin heavy chain (My HC). Total nuclei were visualized with Hoechst 33245. As shown in Figure 3-5A, BSC readily form large myosin-expressing, 31

PAGE 32

multinucleated fibers in vitro Many of these structures contain over 100 nuclei. A substantial reduction in the myofi ber s was noted following BMP6 treatment. Enumeration of myofiber nuclei re vealed an approximate 50% reduction in differentiation in response to growth fact or treatment (Figure 3-6). These results demonstrate that BMP6 exerts strikingly di fferent effects on satellite cell myogenesis by promoting myoblast pool expansion and suppre ssion of myofiber formation. A similar 50% reduction in myofiber formation was obs erved for 23A2 myoblasts treated with BMP6 (Figure 3-5B). By cont rast, a dramatic inhibitory effect was noted for C2C12 satellite cells treated with BMP6 (Figure 3-5C ). Less than 1% of the total nuclei were contained within MyHC immunopositive cells. Repression of BSC Myogenesis is Independent of Transdifferentiation C2C12 myoblasts are notably responsive to BMP2, 4 and 6 whereby they undergo transdifferentiation to an osteogenic phenoty pe (Yamamoto, 1997, Li, 2005, Ebisawa, 1999). The ability of BMP6 to block BSC di fferentiation by initiation of the osteogenic gene program was examined. In brief, BSC, 23A2 and C2C12 myogenic cells were treated for 48 hours with BMP6 fo llowed by fixation and histological staining for alkaline phosphatase activity. As expected, C2C12 myoblasts readily adopted the osteogenic phenotype as indicated by strong AP activi ty. By contrast, neither 23A2 nor BSC expressed the bone enzyme in response to the growth factor (Figure 3-7). The inability of the cell s to convert to the osteogenic lineage is not due to a defective SMAD1/5/8 signaling pathway. Subc onfluent cultures were serum-deprived for one hour followed by treatment with BMP6. Ce lls were lysed and evaluated by Western blot for total and phosphorylated SMAD content. BSC activate the SMAD signaling axis within 5 minutes of BMP6 treatment and exhi bit maximal, sustained activity within 30 32

PAGE 33

minutes (Figure 3-8A). Both 23A2 and C2C12 myoblasts demonstrate abundant amounts of phosphory lated SMAD1/ 5/8 (Figure 3-8B, C). The ability of the myogenic cells to acti vate SMADs and elic it a transcriptional response was examined using a BMP-response element reporter gene (BRE-Luc). The myogenic cells were transiently transfected with BRE-Luc and pRLtk-Luc, a transfection efficiency monitor, prior to treatment with BMP6. After 48 hours, the cells were lysed and luciferase activities measured. All three myogenic cells directed transcription from the BMP-response reporter gene, although at differing levels (Figure 3-9). By comparison to 23A2 and C2C12 myoblasts, BSC direct higher levels of basal BRE-Luc transcription. These results demonstrate that the SMADs are phosphorylated in response to BMP6, and translocate to the nuc leus to initiate transcriptional change. 33

PAGE 34

603bp 234bp 194bp BMP6GAPDH Figure 3-1. Bovine muscle tissue expresse s BMP6. RT-PCR was performed on bovine semimembranosus total RNA using prim ers specific for bovine BMP6 and GAPDH transcripts. Both transcripts were expressed. Representative photo is shown. 34

PAGE 35

Figure 3-2. BMP6 phylogenetic tree (Source: http://uswest.ensembl.org/Bos_t aurus/Gene/Compara_Tree?db=core;g=ENS BTAG00000019234;r=23: 48406821-48416543;t=ENSBTAT00000025614. Last accessed May, 2010) 35

PAGE 36

0% 5% 10% 15% 20% 25% 30% 35% 40% 45% 23A2C2C12BSCPercent of cells labeled with EdU control BMP6* ** Figure 3-3. BMP6 inhibits EdU incorporati on. BSC (pre-cultured for 24 hours), 23A2 and C2C12 myoblasts were treated with 50 ng/ml BMP6 for 48 hours and pulsed with EdU for the last 30 minutes (23A 2 and C2C12) or 2 hours (BSC). Cells were fixed and immunostained quantify the percent of cells that incorporated EdU. All experiments were repeated 3 times. Error bars indicate SEM. Asterisks indicates significant diffe rence, p<0.05 (*) or p<0.0001 (**). 36

PAGE 37

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% Pax7+/Myf5+Pax7+/Myf5-Pax7-/Myf5+Percent of total cells control BMP6** ** Figure 3-4. BMP6 changes BSC subpopulation proportions. BSC were cultured with 50 ng/ml BMP6 for 48 hours. Cells were fixed and immunostained for Pax7 and Myf5. Hoescht dye was used to identif y nuclei. The proportion of different BSC subpopulations in response to tr eatment was quantified. All experiments were repeated 3 times. Error bars indica te standard error of the mean (SEM). Asterisks indicates significant diffe rence, p<0.05 (*) or p<0.0001 (**). 37

PAGE 38

BMP6 control Hoechst MyHC A Figure 3-5. BMP6 inhibits my ofiber formation. BSC (pre-cultured for 3 days), 23A2, and C2C12 were cultured with 50 ng/ml BMP6 or vehicle-only for 48 or 72 hours. Cells were fixed and immunostained for myosin heavy chain (MyHC). Total nuclei were identified wit h Hoechst 33245. A) BSC myofiber formati on was inhibited by BMP6. B) 23A2 myofiber formation was repressed by BMP6. C) C2C12 myofiber formation was restrained by BMP6. 38

PAGE 39

39 MyHC Hoechst control BMP6 MyHC Hoechst control BMP6 B C Figure 3-5. Continued.

PAGE 40

0% 10% 20% 30% 40% 50% 60% 70% 80% BSC23A2C2C12fusion index control BMP6** ** Figure 3-6. BMP6 inhibits differentiation of BSC and myoblasts. BSC (pre-cultured for 3 days), 23A2 and C2C12 were cultured with 50 ng/ml BMP6 or vehicle-only for 48 hours (BSC) or 72 hours (23A2 and C2C12). Cells were fixed and immunostained for myosin heavy chain (MyHC). Total nuclei were identified with Hoechst staining. Fusion index was calculated as numbers of nuclei in MyHC positive fibers (containing at least 3 nuclei) divided by number of total nuclei. BMP6 suppressed differentiation and fusion in all three types of cells. All experiments were repeated 3 times. Error bars indicate SEM. Asterisks indicate significant differenc e, p<0.05 (*) or p<0.0001 (**). 40

PAGE 41

BMP6 Bright Field Phase control A Figure 3-7. BMP6 induces alkaline phosphat ase (ALP) activity in C2C12 myoblasts but not 23A2 myoblasts and BSC. BSC, C2C12 and 23A2 myoblasts were treated with 50 ng/ml BMP6 fo r 48 hours. Cells were fixed and ALP activity was measured by colorimetrical r eaction with NBT/BCIP. Representative photomicrographs at 100X are shown. A) BMP6 induced ALP activity in C2C12 myoblasts. B) BMP6 did not induc ed ALP activity in 23A2 myoblasts. C) BMP6 did not induced ALP activity in BSC. 41

PAGE 42

BMP6 Bright Field Phase control BMP6 Bright Field Phase control B C Figure 3-7. Continued. 42

PAGE 43

0 time53060 p-SMAD 1/5/8 SMAD 1/5/8/9 tubulin min A Figure 3-8. BMP6 activates SMAD1/5/8 in BSC, 23A2 and C2C12 myoblasts. A) BSC were treated with 50 ng/ml BMP6 fo r 0, 5 minutes, 30 minutes and 1 hour after serum-starvation. Total protein isolates were harvested and analyzed by Western blot for SMAD1/5/8/9, phosphorylate SMAD1/ 5/8 or tubulin protein expression. B) 23A2 myoblasts were treated with 50 ng/ml BMP6 for 0 and 30 minutes after serum-starvation. Tota l protein isolates were harvested and analyzed by Western blot for SMAD1/5/ 8/9, active SMAD1/5/8 or tubulin protein expression. C) C2C12 myoblasts were treated with 50 ng/ml BMP6 for 0 and 30 minutes after serum-starvati on. Total protein isolates were harvested and analyzed by Western blot fo r SMAD1/5/8/9, active SMAD1/5/8 or tubulin protein expression. 43

PAGE 44

time 030 p-SMAD 1/5/8 SMAD 1/5/8/9 tubulin min time 030 p-SMAD 1/5/8 SMAD 1/5/8/9 tubulin min B C Figure 3-8. Continued. 44

PAGE 45

0 200 400 600 800 1000 1200 1400 1600 BSC23A2C2C12Relative Bru-Luc Activity control BMP6** ** Figure 3-9. BMP6 stimulates transcription of BRE-Luc. BSC (pre-cultured for 3 days), 23A2 and C2C12 myoblasts were transfected with BRE-Luc reporter and pRL-tk. Cells were treated with 50 ng/ml BMP6 for 48 hours. Cell lysis were harvested and analyzed using a Dual-Luc iferase Reporter Assay System. Reporter luciferase activity was normaliz ed to the amount of Renilla luciferase activity. All experiments were repeat ed 3 times. Error bars indicate SEM. Asterisks indicate significant diffe rence, p<0.05 (*) or p<0.0001 (**). 45

PAGE 46

CHA PTER 4 DISCUSSION Bone morphogenetic protein (BMP6) belongs to transforming growth factor beta (TGF-) super family which contains many important growth factors involved in myogenesis regulation. Previous researches display wide expression of BMP6 in embryonic and adult tissue, including skeletal muscle. It is documented that BMP6 can convert a myogenic cell line, C2C12, to ost eogenic cells (Fujii et al., 1999). And also, BMP6 can stimulates iNOS expression, a known mediator of satellite cell activation, in macrophages (Kwon et al., 2009). Thus, BMP6 is indicated a potential role as a nichelocalized regulatory factor of satellite cells. To characterize the regulatory effects of BMP6 in satellite cells, especially in bovine satellite cell. Three types of cells were used in this study: two commonly used mouse satellite cell models, C2 C12 and 23A2 cell lines, and an bovine in vitro satellite cell model, BSC. First of all, the endogenous BMP6 expression in immatu re bovine muscle tissue was demonstrated by the RT-PCR. The expression of BMP6 indicates potential regulation effects of BMP6 in bovine muscle. To determine the effe cts, Three different types of muscle cells were used: BSC, 23A2 myoblast, and C2C12 myoblast. It was noticed that BMP6 inhibi ted proliferation of all three cell types; however, the decline in proliferation was not large enough to conclude that BMP6 plays the main role in mediating satellite cell quiescence and pr oliferative activity. Although no notable change in total cell numbers were observe d, BMP6 affects satellite cell lineage progression. As Figure 4-1 shows, quie scent satellite cells are a heterogeneous population comprised of both muscle stem and progenitor cells. Once they are 46

PAGE 47

activated, Pax7-only muscle st em cells can not only selfrenew but also give rise to committed myo-progenitors whic h ex press both Pax7 and Myf5. Pax7+/Myf5+ myoprogenitors can become Myf5-only myoblasts during myogenesis. In BSC cultures, cells were already activated and there were th ree main subpopulations: Pax7-only muscle stem cells, Pax7+/Myf5+ muscle progenitors, and Myf5-onl y myoblasts. BMP6 did not significantly affect the percent of cells that were muscle stem cells. However, the percent of Pax7+/Myf5+ progenitors decreased and the perc ent of Myf5-only myoblasts increased. The population shift from progenito r to myoblast indicates that BMP6 promotes satellite cells myogenesis independent of an effect on global pr oliferation rate. Nevertheless, BMP6 does not accelerate myofiber formation. In contrast, a substantial reduction in the myofibers wa s noted following BMP6 treatment on BSC. A similar reduction in myofiber formation wa s observed in 23A2 treated with BMP6, also a dramatic inhibitory effect was noted in BMP6 treated C2C12. These results demonstrate that BMP6 exerts strikingly different effects on satellite cell myogenesis by promoting myoblast pool expansion and suppression of myofiber formation. It is documented that BMP6 can induce many different cells in vivo (Gitelman, 1994) or in vitro (Gruber, 2003; Ouyang, 2006; Estes, 2006) to endochondral bone pathway in previous studies. C2C12 myoblas ts in particular are notably responsive to BMP2, 4 and 6 whereby they undergo trans-di fferentiation to an osteogenic phenotype (Yamamoto, 1997, Li, 2005, Ebis awa, 199). Strong ALP activity was observed in C2C12 treated with BMP6 in the study as expected, which indicated the osteogenic transdifferentiation. Interesti ngly, neither 23A2 nor BSC expressed the bone enzyme in response to the growth factor. This s hows that the repression of BSC myogenesis 47

PAGE 48

differentiation was not because of osteogenic tr ans-differentiation. Also the inability of the cells to be converted to the osteogenic lineage is not due to a defective SMAD1/5/8 signaling. In all three cell types, BMP6 activated SMAD1/5/8, and trigger a transcriptional level response in nuclei. Thus, the intracellular pathway of BMP6 in BSC is intact. BMP6 regulates BSC through SMAD pathway and in two distinct aspects: the proliferation and the myogenic differentiation are inhibited by BMP6, which are negative regulatory effect of myogenesis; relatively more muscle progenitors were converted into myoblasts under the effect of BMP6, which is positive regulat ory effect of myogenesis. But BMP6 fails to convert myogenic differentiation to osteogenic differentiation in BSC. The different responses to BMP6 between BSC and other cells does not simply relate to species difference. BSC, 23A2, and C2C12 are all in vitro satellite cell model. BSC are primary cells, so they can better mimic the in vivo situation. 23A2 myoblasts were induced from a mouse embryonic cell line C3H10T1/2 (Konieczny and Emerson, 1984) and C2C12 myoblasts were isolated fr om dystrophic mouse muscle (Yaffe and Saxel, 1977).They are both mouse cells. Regarding to differentiation, the response modes to BMP6 of 23A2 and BSC are more alike than C2C12. Although the differences of their intracellular pathways are not yet cl ear, it seems that 23A2 may be a better mice mouse model to use in comparative studies with BSC, especially st udies relating to BMP6. BSC is an important in vitro satellite cell model in muscle studies. Because of the bigger muscle size and larger satellite cell amount of bovine than other commonly used animals, it is more efficient to obtain sate llite cells from bovine, which is benefit for 48

PAGE 49

repeating s tudies in one animal or certain muscle if necessary. Some breeds have natural mutation of genes, such as Belgiu m Blue and Piedmontese cattle, which have GDF8 mutation and are known as double musc ling (Kambadur, 1997). So satellite cells from those breeds are good to be used in studies of those genes and their interaction of other genes. Also, cattle are an important kind of meat-producing animal. An understanding of muscle biology in bovine can help improve production efficiency in the cattle industry. Muscle contains abundant storage iron. Iron overload can cause hemochromatosis, while iron deficiency can c onvert the red Fast Oxidative-Glycolytic (FOG) muscle fibers into white Fast Glycoly tic (FG) fibers, which will decline the meat tenderness (Gordeuk et al., 1987; Klont et al., 1998; Ohira and Gill, 1983). Since BMP6 is a critical mediator of iron homeostasis (Andriopoulos et al., 2009), it is indicated that the expression of BMP6 is related to meat quality. If the mechanism behind can be found out, it may promote meat producing by optimiz ing breeding or feeding. This work revealed some regulatory e ffects of BMP6 in BSC, 23A2 and C2C12, but still left some unknown and unexplored. The BMP inhibitor, Noggin, or small interfering RNA ( siRNA ) can be applied to block BMP6 effects and observe the responses of the cells. To find out the di fferent response mechanism of BSC and 23A2 from C2C12, some factors in the signali ng pathway, such as RGMs, need to be considered in the future work. Also the in vivo responses of satellite cells to BMP6 should be studied later. 49

PAGE 50

quiescent satellite cell muscle stem cell muscle progenitor committed myoblast Pax7-only Pax7+Myf5+ BMP6 BMP6 Myf5-only Figure 4-1. Illustration of satellite cell subpopulations and myogenesis. (Modified from Winata and Geraces figure in http://www.bio.purdue.edu/people/faculty/k onieczny/lab/MyoDresearch.htm) 50

PAGE 51

LIST OF REFERENCES Allen, R. E., L. L. Rankin, E. A. Greene, L. K. Bo xhorn, S. E. Johns on, R. G. Taylor, and P. R. Pierce. 1991. Desmin is present in proliferating rat muscle satellite cells but not in bovin e muscle satellite cells. J Cell Physiol 149: 525-535. Allen, R. E., S. M. Sheehan, R. G. Ta ylor, T. L. Kendall, and G. M. Rice. 1995. Hepatocyte growth factor activates quie scent skeletal muscle satellite cells in vitro. J Cell Physiol 165: 307-312. Anderson, J. E. 2000. A role for nitric ox ide in muscle repair: Nitric oxide-mediated activation of muscle satellite cell s. Mol Biol Cell 11: 1859-1874. Andriopoulos, B., Jr., E. Corradini, Y. Xia, S. A. Faa sse, S. Chen, L. Grgurevic, M. D. Knutson, A. Pietrangelo, S. Vukicevic, H. Y. Lin, and J. L. Babitt. 2009. Bmp6 is a key endogenous regulator of hepcidin expression and iron metabolism. Nat Genet 41: 482-487. Ashmore, C. R., W. Parker, H. Stokes, and L. Doerr. 1974. Comparative aspects of muscle fiber types in fetuses of the no rmal and "Double-muscled" Cattle. Growth 38: 501-506. Baroffio, A., M. L. Bochat on-Piallat, G. Gabbiani, and C. R. Bader. 1995. Heterogeneity in the progeny of single human muscle satell ite cells. Differentiation 59: 259-268. Baroffio, A., M. Hamann, L. Bernheim, M. L. Bochaton-Pial lat, G. Gabbiani, and C. R. Bader. 1996. Identification of self-renewing myoblasts in the progeny of single human muscle satellite cells. Differentiation 60: 47-57. Beauchamp, J. R., L. Heslop, D. S. Yu, S. Tajbakhsh, R. G. Kelly, A. Wernig, M. E. Buckingham, T. A. Partri dge, and P. S. Zammit. 2000. Expression of cd34 and myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J Cell Biol 151: 1221-1234. Bintliff S., a. W. B. E. 1960. Radioautogr aphic study of skeletal muscle regeneration. American Journal of Anatomy 106: 223-345. Bischoff, R. 1986. A satellite cell mitogen fr om crushed adult muscle. Dev Biol 115: 140147. Blanco-Bose, W. E., C. C. Yao, R. H. Kram er, and H. M. Blau. 2001. Purification of mouse primary myoblasts based on alpha 7 integrin expression. Exp Cell Res 265: 212-220. Bogdanovich, S., T. O. Kr ag, E. R. Barton, L. D. Morris, L. A. Whittemore, R. S. Ahima, and T. S. Khurana. 2002. Functional im provement of dystrophic muscle by myostatin blockade. Nature 420: 418-421. 51

PAGE 52

Borycki, A. G., J. Li, F. Jin, C. P. Emerson, and J. A. Ep stein. 1999. Pax3 func tions in cell survival and in pax7 regulat ion. Development 126: 1665-1674. Brack, A. S., M. J. Conboy, S. Roy, M. Lee, C. J. Kuo, C. Kelle r, and T. A. Rando. 2007. Increased wnt signaling during aging alters muscle stem cell fate and increases fibrosis. Science 317: 807-810. Buckingham, M. 2003. How the community effect orchestrat es muscle differentiation. Bioessays 25: 13-16. Buckingham, M. 2007. Skelet al muscle progenitor cells and the role of pax genes. C R Biol 330: 530-533. Buckingham, M., L. Bajard T. Chang, P. Daubas, J. Hadchouel, S. Meilhac, D. Montarras, D. Rocancourt, and F. Relaix. 2003. The formation of skeletal muscle: From somite to limb. J Anat 202: 59-68. Cardasis, C. A., and G. W. Co oper. 1975. An analysis of nuc lear numbers in individual muscle fibers during differentiation and growth: A satellite cell-muscle fiber growth unit. J Exp Zool 191: 347-358. Cashman, N. R., J. Covault, R. L. Wo llman, and J. R. Sanes. 1987. Neural cell adhesion molecule in normal, denerva ted, and myopathic human muscle. Ann Neurol 21: 481-489. Chanoine, C., B. Della Gaspera, and F. Charbonnier. 2004. Myogenic regulatory factors: Redundant or specific functions ? Lessons from xenopus. Dev Dyn 231: 662-670. Christov, C., F. Chretien, R. Abou-Khalil, G. Bassez, G. Vallet, F. J. Authier, Y. Bassaglia, V. Shinin, S. Tajbakhsh, B. Chazaud, and R. K. Gherardi. 2007. Muscle satellite cells and endothelial cells: Close neighbors and privileged partners. Mol Biol Cell 18: 1397-1409. Clemmons, D. R. 2009. Role of igf-i in skeletal muscle mass maintenance. Trends Endocrinol Metab 20: 349-356. Conboy, I. M., and T. A. Rando. 2002. The regulation of notch signaling controls satellite cell activation and cell fate determination in postnatal myogenesis. Dev Cell 3: 397-409. Cooper, R. N., S. Tajbakhsh, V. Mouly, G. Cossu, M. Bu ckingham, and G. S. ButlerBrowne. 1999. In vivo satellite cell ac tivation via myf5 and myod in regenerating mouse skeletal muscle. J Cell Sci 112 ( Pt 17): 2895-2901. Cornelison, D. D., M. S. Filla, H. M. Stanley, A. C. Rapraeger, and B. B. Olwin. 2001. Syndecan-3 and syndecan-4 specifically mark skeletal muscle satellite cells and are implicated in satellite cell maintenance and muscle regeneration. Dev Biol 52

PAGE 53

239: 79-94. Cornelison, D. D., S. A. Wilcox-Adelman, P. F. Goetinck, H. Rauv ala, A. C. Rapraeger, and B. B. Olwin. 2004. Essential and separable roles for syndecan-3 and syndecan-4 in skeletal muscle developm ent and regeneration. Genes Dev 18: 2231-2236. Corradini, E., J. L. Babitt, and H. Y. Lin. 2009. The rgm/dragon family of bmp coreceptors. Cytokine Growth Factor Rev 20: 389-398. Day, K., G. Shefer, J. B. Richardson, G. Enikolopov, and Z. Yablonka-Reuveni. 2007. Nestin-gfp reporter expression defines the quiescent state of skeletal muscle satellite cells. Dev Biol 304: 246-259. Ebisawa, T., K. Tada, I. Kitaji ma, K. Tojo, T. K. Sampath, M. Kawabata, K. Miyazono, and T. Imamura. 1999. Characteriza tion of bone morphogenetic protein-6 signaling pathways in osteoblast different iation. J Cell Sci 112 ( Pt 20): 35193527. Edom-Vovard, F., V. Mouly, J. P. Bar bet, and G. S. Butler-Browne. 1999. The four populations of myoblasts involved in human limb muscle formation are present from the onset of primar y myotube formation. J Cell Sci 112 ( Pt 2): 191-199. Estes, B. T., A. W. Wu, and F. Guilak. 2006. Potent induction of chondrocytic differentiation of human adipose-derived ad ult stem cells by bone morphogenetic protein 6. Arthritis Rheum 54: 1222-1232. Flintoff-Dye, N. L., J. Welser J. Rooney, P. Scowen, S. Ta mowski, W. Hatton, and D. J. Burkin. 2005. Role for the alpha7beta1 in tegrin in vascular development and integrity. Dev Dyn 234: 11-21. Fortini, M. E. 2009. Notch signaling: T he core pathway and its posttranslational regulation. Dev Cell 16: 633-647. Foster, R. F., J. M. Thomps on, and S. J. Kaufman. 1987. A laminin substrate promotes myogenesis in rat skeletal muscle cultures: Analysis of replication and development using antidesmin and anti-br durd monoclonal antibodies. Dev Biol 122: 11-20. Fukada, S., S. Higuchi, M. Segawa, K. Koda, Y. Yamamoto, K. Tsujikawa, Y. Kohama, A. Uezumi, M. Imamura, Y. MiyagoeSuzuki, S. Takeda, and H. Yamamoto. 2004. Purification and cell-surface marker characterization of quiescent satellite cells from murine skeletal muscle by a novel monoclonal antibody. Exp Cell Res 296: 245-255. Gal-Levi, R., Y. Leshem, S. Aoki, T. Na kamura, and O. Halevy. 1998. Hepatocyte growth factor plays a dual role in regulating skeletal muscle satellite cell proliferation and differ entiation. Biochim Biophys Acta 1402: 39-51. 53

PAGE 54

Gardiner, N. J., P. Fernyhough, D. R. Tomlinson, U. Mayer, H. von der Mark, and C. H. Streuli. 2005. Alpha7 integrin mediates neur ite outgrowth of distinct populations of adult sensory neurons. Mol Cell Neurosci 28: 229-240. Gitelman, S. E., M. S. K obrin, J. Q. Ye, A. R. Lopez, A. Lee, and R. Derynck. 1994. Recombinant vgr-1/bmp-6-e xpressing tumors induce fibrosis and endochondral bone formation in vivo. J Cell Biol 126: 1595-1609. Gordeuk, V. R., B. R. Bac on, and G. M. Brittenham. 1987. Iron overload: Causes and consequences. Annu Rev Nutr 7: 485-508. Goulding, M., and A. Paquette. 1994. Pax genes and neural tube defects in the mouse. Ciba Found Symp 181: 103-113; discussion 113-107. Gruber, R., W. Graninger, K. Bobacz, G. Wa tzek, and L. Erlacher 2003. Bmp-6-induced osteogenic differentiation of mesenchyma l cell lines is not modulated by sex steroids and resveratrol. Cytokine 23: 133-137. Hasty, P., A. Bradley, J. H. Morris, D. G. Edmondson, J. M. Venuti, E. N. Olson, and W. H. Klein. 1993. Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature 364: 501-506. Heslop, L., J. R. Beauchamp, S. Tajbakhsh, M. E. Bucki ngham, T. A. Partridge, and P. S. Zammit. 2001. Transplanted primary neonat al myoblasts can give rise to functional satellite cells as identified usi ng the myf5nlaczl+ mouse. Gene Ther 8: 778-783. Huang, F. W., J. L. Pinkus, G. S. Pinkus, M. D. Fleming, and N. C. Andrews. 2005. A mouse model of juvenile hemochromat osis. J Clin Invest 115: 2187-2191. Irintchev, A., M. Langer, M. Zweyer, R. T heisen, and A. Wernig. 1997. Functional improvement of damaged adult mouse muscle by implantation of primary myoblasts. J Physiol 500 ( Pt 3): 775-785. Jory, A., I. Le Roux, B. Gayraud-Morel, P. Rocheteau, M. Cohen-Tannoudji, A. Cumano, and S. Tajbakhsh. 2009. Numb promotes an increase in skeletal muscle progenitor cells in the embryoni c somite. Stem Cells 27: 2769-2780. Kallestad, K. M., and L. K. McLoon. Defining the het erogeneity of skeletal musclederived side and main population cells is olated immediately ex vivo. J Cell Physiol 222: 676-684. Kambadur, R., M. Sharma, T. P. Smith, and J. J. Bass. 1997. Mutations in myostatin (gdf8) in double-muscled belgian blue and piedmontese cattle. Genome Res 7: 910-916. 54

PAGE 55

Kanomata, K., S. Kokabu, J. Noji ma, T. Fukuda, and T. Katagiri. 2009. Dragon, a gpianchored membrane protein, inhibits bm p signaling in c2c12 myoblasts. Genes Cells 14: 695-702. Kaufman, S. J., and R. F. Foster. 1988. Replicating myoblasts express a musclespecific phenotype. Proc Natl Acad Sci U S A 85: 9606-9610. Klont, R. E., L. Brocks, G. Eikelenboom. 1998. Muscle fiber type and meat quality. Meat Science 49: S219-S229. Konieczny, S. F., and C. P. Emerson, Jr. 1984. 5-azacyt idine induction of stable mesodermal stem cell lineages from 10t1/2 cells: Evidence for regulatory genes controlling determination. Cell 38: 791-800. Kuang, S., K. Kuroda, F. Le Grand, and M. A. Rudnicki. 2007. Asymmetric self-renewal and commitment of satellite stem ce lls in muscle. Cell 129: 999-1010. Kuninger, D., R. Kuns-Hashimoto, R. Ku zmickas, and P. Rotwein. 2006. Complex biosynthesis of the mu scle-enriched iron regulator rgmc. J Cell Sci 119: 32733283. Kwon, S. J., G. T. Lee, J. H. Lee, W. J. Kim, and I. Y. Kim. 2009. Bone morphogenetic protein-6 induces the ex pression of inducible nitric oxide synthase in macrophages. Immunology 128: e758-765. Lee, S. J., and A. C. McPhe rron. 2001. Regulation of my ostatin activity and muscle growth. Proc Natl Acad Sci U S A 98: 9306-9311. Lepper, C., S. J. Conway, and C. M. Fan. 2009. Adult satellite cells and embryonic muscle progenitors have distinct genetic requirements. Nature 460: 627-631. Leshem, Y., D. B. Spicer, R. Gal-Levi, and O. Halevy. 2000. Hepatocyte growth factor (hgf) inhibits skeletal muscle cell different iation: A role for the bhlh protein twist and the cdk inhibitor p27. J Cell Physiol 184: 101-109. Li, G., Y. Cui, L. McIlmurray, W. E. All en, and H. Wang. 2005. Rhbmp-2, rhvegf(165), rhptn and thrombin-related peptide, tp508 induce chemotaxis of human osteoblasts and microvascular endothelial cells. J Orthop Res 23: 680-685. Li, S., T. Zhao, H. Xin, L. H. Ye, X. Zhang, H. Tanaka, A. Nakamura, and K. Kohama. 2004. Nicotinic acetylcholine receptor alpha7 subunit mediates migration of vascular smooth muscle cells toward nicotine. J Pharmacol Sci 94: 334-338. Lyons, K., J. L. Graycar, A. Lee, S. Hashmi P. B. Lindquist, E. Y. Chen, B. L. Hogan, and R. Derynck. 1989. Vgr-1, a mammalian gene related to xenopus vg-1, is a member of the transforming growth fact or beta gene superfamily. Proc Natl Acad 55

PAGE 56

Sci U S A 86: 4554-4558. Mansouri, A., A. Stoykova, M. Torres, and P. Gruss. 1996. Dysgenesis of cephalic neural crest derivatives in pax7-/mutant mice. Development 122: 831-838. Maroto, M., R. Reshef, A. E. Munsterberg, S Koester, M. Goulding, and A. B. Lassar. 1997. Ectopic pax-3 activates myod and myf-5 expression in embryonic mesoderm and neural tissue. Cell 89: 139-148. Mauro, A. 1961. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 9: 493495. Mayer, U., G. Saher, R. Fassler A. Bornemann, F. Echterme yer, H. von der Mark, N. Miosge, E. Poschl, and K. von der Ma rk. 1997. Absence of integrin alpha 7 causes a novel form of muscular dystrophy. Nat Genet 17: 318-323. McPherron, A. C., T. V. Huynh, and S. J. Lee. 2009. Redundancy of myostatin and growth/differentiation factor 11 function. BMC Dev Biol 9: 24. McPherron, A. C., A. M. Lawler, and S. J. Lee. 1997. Regulation of skeletal muscle mass in mice by a new tgf-beta super family member. Nature 387: 83-90. McPherron, A. C., A. M. La wler, and S. J. Lee. 1999. Regu lation of anterior/posterior patterning of the axial skeleton by growth /differentiation factor 11. Nat Genet 22: 260-264. McPherron, A. C., and S. J. Lee. 1997. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci U S A 94: 12457-12461. Meynard, D., L. Kautz, V. Darnaud, F. Canonne-Hergaux, H. Coppin, and M. P. Roth. 2009. Lack of the bone morphogenetic pr otein bmp6 induces massive iron overload. Nat Genet 41: 478-481. Miller, K. J., D. Thaloor, S. Matteson, and G. K. Pavlath. 2000. Hepatocyte growth factor affects satellite cell activation and differ entiation in regenerating skeletal muscle. Am J Physiol Cell Physiol 278: C174-181. Montarras, D., J. Morg an, C. Collins, F. Relaix, S. Zaffr an, A. Cumano, T. Partridge, and M. Buckingham. 2005. Direct isolation of satellite cells for skeletal muscle regeneration. Sci ence 309: 2064-2067. Moss, F. P., and C. P. Leblond. 1970. Nature of dividing nuclei in skeletal muscle of growing rats. J Cell Biol 44: 459-462. Mueller, B. K., T. Yamashita, G. Schaffar, and R. Mueller. 2006. The role of repulsive guidance molecules in the embryonic and adult vertebrate central nervous system. Philos Trans R Soc Lond B Biol Sci 361: 1513-1529. 56

PAGE 57

Munsterberg, A. E., and A. B. Lassar. 1995. Combinatorial signals from the neural tube, floor plate and notochord induce myogenic bhlh gene expression in the somite. Development 121: 651-660. Naka, D., T. Ishii, Y. Yoshiyama, K. Miya zawa, H. Hara, T. Hishida, and N. Kidamura. 1992. Activation of hepatocyte growth factor by proteolytic conversion of a single chain form to a heterodimer. J Biol Chem 267: 20114-20119. Niederkofler, V., R. Salie, and S. Arber. 2005. Hemojuvelin is essential for dietary iron sensing, an d its mutation leads to severe iron overload. J Clin Invest 115: 21802186. Niederkofler, V., R. Salie, M. Sigrist, and S. Arber. 2004. Repulsive guidance molecule (rgm) gene function is required for neural tube closure but not retinal topography in the mouse visual system. J Neurosci 24: 808-818. O'Reilly, C., B. McKay, S. Phillips, M. Tarnopolsky, and G. Parise. 2008. Hepatocyte growth factor (hgf) and the satellite cell response following muscle lengthening contractions in humans. Muscle Nerve 38: 1434-1442. Ohira, Y., and S. L. Gill. 1983. Effects of dietar y iron deficiency on muscle fiber characteristics and whole-body distributi on of hemoglobin in mice. J Nutr 113: 1811-1818. Otto, A., C. Schmidt, G. Luke, S. Allen, P. Valasek, F. Muntoni, D. Lawrence-Watt, and K. Patel. 2008. Canonical wnt signalling in duces satellite-cell proliferation during adult skeletal muscle regeneratio n. J Cell Sci 121: 2939-2950. Otto, A., C. Schmidt, and K. Patel. 2006. Pax3 and pax7 expression and regulation in the avian embryo. Anat Em bryol (Berl) 211: 293-310. Oustanina, S., G. Hause, and T. Braun. 2004. Pax7 dire cts postnatal renewal and propagation of myogenic satell ite cells but not their sp ecification. EMBO J 23: 3430-3439. Ouyang, X., M. Fujimoto, R. Nakagawa, S. Serada, T. Tanak a, S. Nomura, I. Kawase, T. Kishimoto, and T. Naka. 2006. Socs-2 interferes with myotube formation and potentiates osteoblast differentiation through upregulation of junb in c2c12 cells. J Cell Physiol 207: 428-436. Polesskaya, A., P. Seale, and M. A. Rudnicki. 2003. Wnt signaling induces the myogenic specification of resident cd45+ adult stem cells during muscle regeneration. Cell 113: 841-852. Rebbapragada, A., H. B enchabane, J. L. Wrana, A. J. Celeste, and L. Attisano. 2003. Myostatin signals through a transforming growth factor beta-like signaling 57

PAGE 58

pathway to block adipogenesis. Mol Cell Biol 23: 7230-7242. Relaix, F., D. Rocanc ourt, A. Mansouri, and M. Bu ckingham. 2005. A pax3/pax7dependent population of skeleta l muscle progenitor cells. Nature 435: 948-953. Reshef, R., M. Maroto, and A. B. Lassar. 1998. Regulation of dorsal somitic cell fates: Bmps and noggin control the timing and pattern of myogenic regulator expression. Genes Dev 12: 290-303. Rudnicki, M. A., P. N. Schnegelsberg, R. H. Stead, T. Braun, H. H. Arnold, and R. Jaenisch. 1993. Myod or myf-5 is required for the form ation of skeletal muscle. Cell 75: 1351-1359. Schmalbruch, H., and U. Hellhammer. 1976. The number of satellite cells in normal human muscle. Anat Rec 185: 279-287. Schober, S., D. Mielenz, F. Echtermeyer, S. Hapke, E. Poschl, H. von der Mark, H. Moch, and K. von der Mark. 2000. The ro le of extracellular and cytoplasmic splice domains of alpha7-integrin in ce ll adhesion and migration on laminins. Exp Cell Res 255: 303-313. Schultz, E. 1996. Satellite ce ll proliferative compartments in growing skeletal muscles. Dev Biol 175: 84-94. Seale, P., L. A. Sabourin, A. Girgis-Gabar do, A. Mansouri, P. Gruss, and M. A. Rudnicki. 2000. Pax7 is required for the specification of myogenic satellite cells. Cell 102: 777-786. Sethi, J. K., and A. Vidal-Puig. Wnt signalling and the control of cellular metabolism. Biochem J 427: 1-17. Sheehan, S. M., R. Tatsumi, C. J. Temm -Grove, and R. E. Allen. 2000. Hgf is an autocrine growth factor for skeletal muscl e satellite cells in vitro. Muscle Nerve 23: 239-245. Sherwood, R. I., J. L. Christensen, I. M. Conboy, M. J. Conboy, T. A. Rando, I. L. Weissman, and A. J. Wagers. 2004. Isolation of adult mouse myogenic progenitors: Functional heterogeneity of cells within and engrafting skeletal muscle. Cell 119: 543-554. Shinin, V., B. Gayraud-Morel, D. Gomes, and S. Tajbakhsh. 2006. Asymmetric division and cosegregation of template DNA strands in adult muscle satellite cells. Nat Cell Biol 8: 677-687. Smith, C. K., 2nd, M. J. Janney, and R. E. Allen. 1994. Temporal expression of myogenic regulatory genes during activation, proliferation, and differentiation of rat skeletal muscle satellite cells. J Cell Physiol 159: 379-385. 58

PAGE 59

Solloway, M. J ., A. T. Dudl ey, E. K. Bikoff, K. M. Lyons B. L. Hogan, and E. J. Robertson. 1998. Mice lacking bmp6 function. Dev Genet 22: 321-339. Song, W. K., W. Wang, R. F. Foster, D. A. Bielser, and S. J. Kaufman. 1992. H36-alpha 7 is a novel integrin alpha chain that is developmentally regulated during skeletal myogenesis. J Cell Biol 117: 643-657. Stern, C. D. 1995. Common molecular pathways for patterning of the body axis, limbs, central nervous system, and face during embryonic development. Cleft Palate Craniofac J 32: 525-527. Stockdale, F. E., and H. Ho ltzer. 1961. DNA synthesis and myogenesis. Exp Cell Res 24: 508-520. Swatland, H. J. 1974. Feta l and neonatal development of spindle capsules and intrafusal myofibers in the porcine sartorius. J Anim Sci 39: 42-46. Swatland, H. J., and N. M. Kieffer. 1974. Fetal development of the double muscled condition in cattle. J Anim Sci 38: 752-757. Tajbakhsh, S., U. Borello, E. Vivarelli, R. Kelly, J. Papkoff, D. Duprez, M. Buckingham, and G. Cossu. 1998. Differential activation of myf5 and myod by different wnts in explants of mouse paraxial mesoderm and the later activation of myogenesis in the absence of myf5. De velopment 125: 4155-4162. Tajbakhsh, S., D. Rocancourt, G. Cossu, and M. Buckingham. 1997. Redefining the genetic hierarchies controlling skelet al myogenesis: Pax-3 and myf-5 act upstream of myod. Cell 89: 127-138. Tatsumi, R., and R. E. Allen. 2004. Active hepatocyte growth factor is present in skeletal muscle extracellular matrix Muscle Nerve 30: 654-658. Tatsumi, R., J. E. Anderson, C. J. Nevoret, O. Halevy, and R. E. Allen. 1998. Hgf/sf is present in normal adult skeletal muscle and is capable of activating satellite cells. Dev Biol 194: 114-128. Tatsumi, R., A. Hattori, Y. Ikeuchi, J. E. Anderson, and R. E. All en. 2002. Release of hepatocyte growth factor fr om mechanically stretched sk eletal muscle satellite cells and role of ph and nitric ox ide. Mol Biol Cell 13: 2909-2918. Tatsumi, R., S. M. Sheehan, H. Iwasaki, A. Hattori, and R. E. Allen. 2001. Mechanical stretch induces activation of skeletal muscle satellite cells in vitro. Exp Cell Res 267: 107-114. Thies, R. S., T. Chen, M. V. Davies, K. N. Tomkinson, A. A. Pearson, Q. A. Shakey, and N. M. Wolfman. 2001. Gdf-8 propeptide binds to gdf-8 and antagonizes biological activity by inhibiting gdf-8 receptor binding. Growth Factors 18: 251-259. 59

PAGE 60

Valdimarsdottir, G., M. J. Goumans, A. Rosendahl, M. Brugman, S. Itoh, F. Lebrin, P. Sideras, an d P. ten Dijke. 2002. Stim ulation of id1 expression by bone morphogenetic protein is sufficient and necessary for bone morphogenetic protein-induced activation of endothe lial cells. Circulation 106: 2263-2270. van der Ven, P. F., G. Schaart, P. H. Jap, R. C. Sengers, A. M. Stadhouders, and F. C. Ramaekers. 1992. Differentia tion of human skeletal muscle cells in culture: Maturation as indicated by titin and des min striation. Cell Tissue Res 270: 189198. Walsh, F. S., and A. J. Cele ste. 2005. Myostatin: A modulat or of skeletal-muscle stem cells. Biochem Soc Trans 33: 1513-1517. Welser, J. V., N. Lange, C. A. Singer, M. Elorza, P. Scowen, K. D. Keef, W. T. Gerthoffer, and D. J. Burkin. 2007a. Lo ss of the alpha7 in tegrin promotes extracellular signal-regulated kinase acti vation and altered vascular remodeling. Circ Res 101: 672-681. Welser, J. V., N. D. Lange, N. Flintoff-Dye, H. R. Burkin, and D. J. Burkin. 2007b. Placental defects in alpha7 integr in null mice. Placenta 28: 1219-1228. Whittemore, L. A., K. Song, X. Li, J. Aghajanian, M. Davies, S. Girgenrath, J. J. Hill, M. Jalenak, P. Kelley, A. Knight, R. Maylor, D. O'Hara, A. Pears on, A. Quazi, S. Ryerson, X. Y. Tan, K. N. Tomkinson, G. M. Veldman, A. Widom J. F. Wright, S. Wudyka, L. Zhao, and N. M. Wolfman. 2003. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem Biophys Res Commun 300: 965-971. Williams, B. A., and C. P. Ordahl. 1994. Pax-3 expressi on in segmental mesoderm marks early stages in myogenic cell specification. Developm ent 120: 785-796. Yaffe, D., and O. Saxel. 1977. Serial pa ssaging and differentiation of myogenic cells isolated from dystrophic mous e muscle. Nature 270: 725-727. Yamada, M., Y. Sankoda, R. Tatsumi, W. Mizunoya, Y. Ikeuchi, K. Sunagawa, and R. E. Allen. 2008. Matrix meta lloproteinase-2 mediates stretch-induced activation of skeletal muscle satellite cells in a ni tric oxide-dependent manner. Int J Biochem Cell Biol 40: 2183-2191. Yamamoto, N., S. Akiyama, T. Katagiri, M. Namiki, T. Kurokawa, and T. Suda. 1997. Smad1 and smad5 act downstream of intrac ellular signalings of bmp-2 that inhibits myogenic differentiation and induc es osteoblast differentiation in c2c12 myoblasts. Biochem Biophys Res Commun 238: 574-580. 60

PAGE 61

61 Yao, C. C., B. L. Ziober, R. M. Squillac e, and R. H. Kramer 1996. Alpha7 integrin mediates cell adhesion and mi gration on specific laminin isoforms. J Biol Chem 271: 25598-25603. Zimmers, T. A., M. V. Davies, L. G. Koni aris, P. Haynes, A. F. Esquela, K. N. Tomkinson, A. C. McPherron, N. M. Wo lfman, and S. J. Lee. 2002. Induction of cachexia in mice by systemically administered myostatin. Science 296: 14861488. Ziober, B. L., M. P. Vu, N. Waleh, J. Craw ford, C. S. Lin, and R. H. Kramer. 1993. Alternative extracellular and cytoplasmic dom ains of the integrin alpha 7 subunit are differentially expre ssed during development. J Biol Chem 268: 26773-26783.

PAGE 62

BIOGRAPHICAL SKETCH Wenli Sun was born in Shangha i, China, to Y ongxian Sun and Caizhen Pan. She grew up as the only child of this family and completed all of her educations until university in this large city. In July 2006, Wenli Sun graduated with a bachelors degree in veterinary medicine from Shanghai Jiao Tong University. She then moved to the United States and began study at the University of Florida under the advisement of Dr. Sally Johnson in 2007. Wenli Sun currently re sides in Gainesville, Florida with Tony the fish and Shadow the cat. Upon receiving the masters degree, Wenli Sun will go back to her hometown and stay with her families. She hopes to find a position in related area there, continue exploring t he sea of knowledge, and ultimately find her interest. 62