<%BANNER%>

Strategies for Enhancing Leaf Spot (Cercospora arachidicola and Cercosporidium personatum) Tolerance in Peanut (Arachis ...

Permanent Link: http://ufdc.ufl.edu/UFE0042245/00001

Material Information

Title: Strategies for Enhancing Leaf Spot (Cercospora arachidicola and Cercosporidium personatum) Tolerance in Peanut (Arachis hypogaea L.)
Physical Description: 1 online resource (140 p.)
Language: english
Creator: Burns, Scott
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: agrobacterium, arachis, cercospora, cercosporidium, hypogaea, leafspot, organogenesis, peanut, tolerance, transformation
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Cercospora arachidicola S. Hori and Cercosporidium personatum (Berk and M. A. Curtis) Deighton are fungal pathogens that cause leaf spot, the most significant disease in peanut. Early leaf spot (C. arachidicola) and late leaf spot (C. personatum) are found in all peanut-growing regions worldwide. In Florida, if fungicides are not used, pod yields can be reduced by as much as 50% by these leaf spot diseases. The present research focused on developing novel strategies for improving leaf spot tolerance in peanut. The first objective of this study was to confirm and characterize the source of suspected leaf spot tolerance in Florida-07. It was hypothesized that Florida-07 displayed classically defined tolerance. With regard to visual rating, lesion/leaf percentage, and lesion density, the rate of disease progression was the same in sprayed and non-sprayed York sprayed AP-3, and sprayed Florida-07. Similar disease progression was observed for non-sprayed AP-3 and non-sprayed Florida-07, but at a faster rate than the aforementioned cultivar*treatments. Lesion growth occurred at the same rate. Based on these data, it was concluded that Florida-07 and AP-3 possessed the same degree of susceptibility to late leaf spot disease. The impact of leaf spot on pod yield of Florida-07 was similar to its impact on pod yield of AP-3 in two out of three tests, but in the third test, leaf spot impacted pod yield of Florida-07 (1084 kg ha-1) less than it did AP-3 (1991 kg ha-1) (P > t =0.0524). On average, however, yield loss to leaf spot (sprayed minus non-sprayed) of AP-3 (1564 kg ha-1) was not different than that of Florida-07 (1177 kg ha-1). On average, Florida-07 does not appear to possess significant tolerance to leaf spot. The second objective of this research was to optimize a peanut direct shoot organogenesis tissue culture system that had been optimized for an Indian cultivar, JL-24 (Sharma and Anjaiah, 2000) for U.S. cultivars. A difference in shoot induction was found for the cotyledon explants examined (P > t = < 0.0001). Explant A had more shoot induction with a visual rating of 1.8, than explant B that had a rating of 1.6 (P > t = < 0.0001). Cultivars responded to the culture conditions differently (cultivar * BA interaction). Georgia Green on 10 microM BA produced the most shoot buds (24.56%) and had the highest visual rating (2.1), followed by VC-2 on 10 microM BA (22.1%, 1.8), Valencia-A on 640 microM BA (21.4%, 1.8), Georgia Brown on 80 microM BA (9.0%, 1.7), and Florida-07 on 40 microM BA (7.1%, 1.8). Georgia Green, VC-2, and Valencia-A appear to be the best suited for future Agrobacterium-mediated transformation experiments based on their shoot bud production. The third objective of this research was to identify an Agrobacterium strain that was highly virulent for selected cultivars. Transient expression studies were conducted using a CaMV35S-uidA construct. It was hypothesized that a highly virulent Agrobacterium strain could be identified by testing for uidA expression in cotyledon explants. It was concluded that Agrobacterium strain ABI was virulent and should be used for future stable transformation experiments.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Scott Burns.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Tillman, Barry L.
Local: Co-adviser: Gallo, Maria.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042245:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042245/00001

Material Information

Title: Strategies for Enhancing Leaf Spot (Cercospora arachidicola and Cercosporidium personatum) Tolerance in Peanut (Arachis hypogaea L.)
Physical Description: 1 online resource (140 p.)
Language: english
Creator: Burns, Scott
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: agrobacterium, arachis, cercospora, cercosporidium, hypogaea, leafspot, organogenesis, peanut, tolerance, transformation
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Cercospora arachidicola S. Hori and Cercosporidium personatum (Berk and M. A. Curtis) Deighton are fungal pathogens that cause leaf spot, the most significant disease in peanut. Early leaf spot (C. arachidicola) and late leaf spot (C. personatum) are found in all peanut-growing regions worldwide. In Florida, if fungicides are not used, pod yields can be reduced by as much as 50% by these leaf spot diseases. The present research focused on developing novel strategies for improving leaf spot tolerance in peanut. The first objective of this study was to confirm and characterize the source of suspected leaf spot tolerance in Florida-07. It was hypothesized that Florida-07 displayed classically defined tolerance. With regard to visual rating, lesion/leaf percentage, and lesion density, the rate of disease progression was the same in sprayed and non-sprayed York sprayed AP-3, and sprayed Florida-07. Similar disease progression was observed for non-sprayed AP-3 and non-sprayed Florida-07, but at a faster rate than the aforementioned cultivar*treatments. Lesion growth occurred at the same rate. Based on these data, it was concluded that Florida-07 and AP-3 possessed the same degree of susceptibility to late leaf spot disease. The impact of leaf spot on pod yield of Florida-07 was similar to its impact on pod yield of AP-3 in two out of three tests, but in the third test, leaf spot impacted pod yield of Florida-07 (1084 kg ha-1) less than it did AP-3 (1991 kg ha-1) (P > t =0.0524). On average, however, yield loss to leaf spot (sprayed minus non-sprayed) of AP-3 (1564 kg ha-1) was not different than that of Florida-07 (1177 kg ha-1). On average, Florida-07 does not appear to possess significant tolerance to leaf spot. The second objective of this research was to optimize a peanut direct shoot organogenesis tissue culture system that had been optimized for an Indian cultivar, JL-24 (Sharma and Anjaiah, 2000) for U.S. cultivars. A difference in shoot induction was found for the cotyledon explants examined (P > t = < 0.0001). Explant A had more shoot induction with a visual rating of 1.8, than explant B that had a rating of 1.6 (P > t = < 0.0001). Cultivars responded to the culture conditions differently (cultivar * BA interaction). Georgia Green on 10 microM BA produced the most shoot buds (24.56%) and had the highest visual rating (2.1), followed by VC-2 on 10 microM BA (22.1%, 1.8), Valencia-A on 640 microM BA (21.4%, 1.8), Georgia Brown on 80 microM BA (9.0%, 1.7), and Florida-07 on 40 microM BA (7.1%, 1.8). Georgia Green, VC-2, and Valencia-A appear to be the best suited for future Agrobacterium-mediated transformation experiments based on their shoot bud production. The third objective of this research was to identify an Agrobacterium strain that was highly virulent for selected cultivars. Transient expression studies were conducted using a CaMV35S-uidA construct. It was hypothesized that a highly virulent Agrobacterium strain could be identified by testing for uidA expression in cotyledon explants. It was concluded that Agrobacterium strain ABI was virulent and should be used for future stable transformation experiments.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Scott Burns.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Tillman, Barry L.
Local: Co-adviser: Gallo, Maria.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042245:00001


This item has the following downloads:


Full Text





STRATEGIES FOR ENHANCING LEAF SPOT (Cercospora arachidicola AND
Cercosporidium personatum) TOLERANCE IN PEANUT (Arachis hypogaea L.)


















By

SCOTT P. BURNS


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2010



























2010 Scott P. Burns
































To my family and friends, who have no idea what I've been studying, but have
enthusiastically supported me nonetheless









ACKNOWLEDGMENTS

I would like to thank Dr. Barry Tillman and Dr. Maria Gallo for giving me the

opportunity to study at the University of Florida. I could not have asked for a more

knowledgeable, supportive, or friendly pair of advisors. I would like to thank the rest of

my committee, Dr. David Clark, Dr. John Erikson, and Dr. Amanda Gevens, for their

assistance and input throughout my research. I am especially thankful to Dr. Victoria

James-Hurr, whose understanding of genetics and molecular biology seemed endless,

her assistance always exceeded expectation. I would also like to extend thanks to Dr.

Mukesh Jain, Dr. Yolanda Lopez, Mr. Justin McKinney, and Mr. Mark Gomillion for all

their technical support throughout the course of my research project. I would like to

thank all the members of the Gallo and Teplitski Laboratories, who, along with a vast

scientific knowledge, brought a lot of humor and normalcy to everyday life as a graduate

student. And lastly, but far from least, I would like to thank my parents and sister, whose

lifelong support and encouragement have carried me to where I am today.









TABLE OF CONTENTS

page

A C KN O W LED G M E NTS .......... .......... .......... ......... .......................... ............... 4

L IS T O F T A B LE S ................................................................................................... 8

LIS T O F F IG U R E S .................................................................. 9

LIST OF ABBREVIATIONS..................... .......... .............................. 10

A B S T R A C T ................................................................................................................... 1 2

CHAPTER

1 LITERATURE REVIEW .................... ............................ 15

Peanut as a Crop ....................... ....................... 15
Peanut Morphology and Taxonomy............ .......... ......................... ............... 16
Peanut Genetic Diversity ................ .................. ......... 18
Peanut D iseases.............................. ............... 20
Peanut Leaf Spots ............ ...... ....... ................. 21
Identification and Classification .................. ...... .. ... .. ......... 21
Symptoms and Signs ....................... ................................ 22
Disease Cycle ........... .......... .......... ...................... 23
Management Strategies ..................... ........ ...................... 24
Breeding for Leaf Spot Resistance ................. ............... ....................... 28
Peanut Transformation ................ ................... ......... 30
Peanut Tissue Culture ..................... ................... ............... 32
Em bryogenesis..................... ....................... ............... 33
O rg a no g e ne sis ............ ... ....... ................. ............... .......... 3 5
Peanut Transformation Advancements ......... .......... ...................... ............... 36
Leaf Senescence, a Nuclear Controlled Form of Programmed Cell Death.......... 38
Cytokinins and Isopentyl Transferase ............................. .......... ...... 41
Pathogen Induced Leaf Senescence........................................................... 43

2 EVALUATING PEANUT CV. FLORIDA-07 FOR LATE LEAF SPOT
TOLERANCE............................................ ........ 45

A b s tra c t ........... .. ......... .. ............. .. ..................................................... 4 5
Introduction ............................. ............... 46
Materials and Methods............................. ............ ............... 49
Experim ental D esign ...................... ....... ......... .. .. ........................... 49
D disease A ssessm ent ... .. ................................................................. 50
Area Under the Disease Progress Curve (AUDPC) ................................. 51
H harvest and P od Y ie ld ...... ........ ..................... ............................... 5 1
Environm mental C onditions................................... ................ ............... 52









Statistical Analysis......................................................... 52
Disease Response Classification ...... ................. .............. 52
Results and Discussion.......................................... ............... 53
Citra 2008 ................ ......... .................. 53
Marianna 2008 .......................... .......... ......... 55
Marianna 2009 .......................... .......... ......... 58
A ll Y ears*Locations .......... ......... ......... .......... .............. .............. 60
Environm ental Conditions.............................................. .................... 61
C o n c lu s io n s .............. ..... ............ ................. ........................................... 6 2

3 A DIRECT SHOOT ORAGANOGENESIS SYSTEM FOR U.S. PEANUT
C U LT IV A R S ........................... ............ ............... 77

Abstract ............... ...... .... ........................... ............... 77
Introduction ........................... ............... 78
Materials and Methods............................. ............ ............... 79
Cultivar Selection .................... .................... ......... 79
Explant Preparation .......................................... 80
Experimental Design ............................... ..... ...................... 81
Evaluation of Cotyledon Explant Source ...... ................. ..... .............. 81
Evaluation of Shoot induction and Direct Shoot Organogenesis ................... 82
Regeneration of M ature Plants................................................. 82
S tatistica l A na lysis ........................................................................ ......... 8 3
Results and Discussion.............................. ......... 83
Explant R response ........................ ........ ......... .. .............................. 83
Genotype Response......................................... ............... 85
C ultivar C om prison ........................ ........ .......... .. ............................ 88
Regeneration of M ature Plants.......................................... .................... 89
Conclusions .............. .. ......... ..... ......................... 90

4 TRANSIENT EXPRESSION OF UIDA (P-GLUCURONIDASE) IN PEANUT
COTYLEDON EXPLANTS ................................ ..... ............... 99

Abstract ............ .... ... ..... .......................... ............... 99
In tro d u ctio n ............................................................................................ 1 0 0
Materials and Methods.................................. 102
Agrobacterium Strain and Gene Construct......................... ........... 102
Explant Preparation and Inoculation............................ ..... .............. .. 102
Transient Expression in Cotyledon Explants and Histochemical GUS-assay. 103
Results and Discussion................... ............................. 103
C conclusions ...... .. .. ........ .... ................................................. 105

APPENDIX

A TRANSFORMATION OF PEANUT WITH SAG12-IPT FOR A 'STAY GREEN'
P H E N O T Y P E ........................................................................ ..... ............... 1 0 8



6









In tro d u ctio n .............. ... ..............1 08................. .........
Materials and Methods.................................. 109
Agrobacterium Strain and Gene Constructs ............................................... 109
Explant Preparation and Inoculation...................................... ...... ......... 109
Regeneration of Mature Plants................ ......... ..... .......... .. ............... 110
G enom ic D NA A analysis ....................................... ... .......................... 111
3-glucuronidase (GUS) Assay.............. ....... ............ ............ 112
Results and Discussion....................................... 112
Conclusions ....... ....... ................................................... 113

B PEANUT TRANSFORMATION STUDIES ............................................. 117

LIST OF REFERENCES ......... ........................................... .. ............... 120

BIOGRAPHICAL SKETCH ................... ........ ................. 140









LIST OF TABLES


Table page

2-1 Cultivar Descriptions............................ ......... 65

2-2 Standard Commercial Fungicide Spray Treatment................... ............ 67

2-3 F lorida 1-10 Leaf S pot R ating .................................................. .... .. ............... 68

2-4 Citra 2008, FL Yield under late leaf spot pressure, lost to late leaf spot, and
percent lost to late leaf spot......................................... ............... 74

2-5 Marianna, FL 2008 Yield under late leaf spot pressure, lost to late leaf
spot, and percent lost to late leaf spot........................................ ... ............ 74

2-6 Marianna, FL 2009 Yield under late leaf spot pressure, lost to late leaf spot,
and percent lost to late leaf spot.................................................. .... .. ............... 75

2-7 All Years*Locations Yield under late leaf spot pressure, lost to late leaf
spot, and percent lost to late leaf spot................ ......................... 75

2-8 Environmental Conditions in Citra, FL 2008 and Marianna, FL 2008 and 2009. 76

3-1 Effect of N6-benzyladenine concentrations ranging from 10-80 pM on the
peanut cultivar response trend ............ .... ............................. ............. 94

3-2 Effect of N6-benzyladenine concentrations ranging from 10-320 pM for
Georgia Browne and 10-640 pM for Valencia-A on the peanut cultivar
response trend.... ................................................. 94

3-3 Comparison of top-performing cultivar* N6-benzyladenine concentration ........ 98

4-1 Transient expression of CaMV 35S-uidA in peanut cotyledon explants ........... 106

A-1 Assay results of transformation attempts of peanut using Agrobacterium
stra in L B A 4 4 0 4 ............... ........................................................ 1 1 5

A-2 Assay results of attempted transformation of peanut using Agrobacterium
strain ABI harboring SAG12-IPT. ............... ....... ........................ ............... 116

B-1 Agrobacterium-mediated peanut transformation studies. ............................. 118

B-2 Peanut Transformation via Particle Bombardment. .................... .............. 119









LIST OF FIGURES


Figure page

1-1 Petunia Leaf Spot (Cercospora petunia) Infection. (A) wild type Petunia, and
(B) SAG 12-IPT transgenic Petunia .......... ... ............................. ............... 44

2-1 Florida peanut growing regions and experimental locations............................... 64

2-2 Late-season, lateral-branch leaflet lesion coverage under high late leaf spot
pressure on York, AP-3, and Florida-07. ......... ..... ........................ ... 66

2-3 Peanut compound leaf and leaflets. ..................... ..................... 69

2-4 Citra, FL 2008 Disease Progression.................. .... ... ................. 70

2-5 Marianna, FL 2008 Disease Progression ........................... ............... 71

2-6 Marianna, FL 2009 Disease Progression ........................... ............... 72

2-7 All Years*Locations Disease Progression .................................. ................ 73

3-1 Peanut seed morphology and cotyledon explants preparation........................ 92

3-2 Direct Shoot Organogenesis (DSO) Rating ................. ............... ........ ....... 92

3-3 Explant response and regeneration of mature peanut plants ........................... 93

3-4 Shoot organogenesis response from two types of peanut cotyledon explants
(A) Explant derived from cotyledon with embryo axis previously attached, (B)
Explant derived from cotyledon without embryo axis previously attached.......... 95

3-5 Effect of N6-benzyladenine concentration ranging form 10 80 pM on direct
shoot organogenesis rating of peanut cotyledon explants, and shoot
induction percentage ....................... ....... ... ......... ... .............. .............. 96

3-6 Effect of N6-benzyladenine concentration ranging from 10 320 pM for
peanut cultivars Georgia Browne and 10-640 pM for Valencia-A on direct
shoot organogenesis, and shoot induction percentage ................... ............... 97

4-1 Transient uidA expression in de-embryonated, quartered cotyledon explants
of peanut cv. Georgia Green ...................................... ......... 107

A-1 Expression cassettes used for transformation of de-embryonated, quartered
cotyledon explants of peanut........ ... ....... ................... ............... 114











2,4-D

AFLP

AUDPC

BA

DAP

DSO

ELS

Explant A


Explant B

FAWN

GUS

ha

IPT

LLS

MS

MT

NS

PCD

PI

%RH

RAPD

RFLP

RIM


LIST OF ABBREVIATIONS

2,4-dichlorophenoxyacetic acid

Amplified Fragment Length Polymorphism

Area Under the Disease Progress Curve

N6-Benzyladenine

Days After Planting

Direct Shoot Organogenesis

Early Leaf Spot (caused by Cercospora arachidicola)

Explant derived from peanut cotyledon with previously attached
embryo-axis

Explant derived from embryo-axis-free peanut cotyledon

Florida Automated Weather Network

3-Glucuronidase

hectare

Isopentyl Transferase

Late Leaf Spot (caused by Cercosporidium personatum)

Murashige and Skoog

Metric Ton

Non-Sprayed

Programmed Cell Death

Plan Introduction

Percent Relative Humidity

Random Amplification of Polymorphic DNA

Restriction Fragment Length Polymophism

Root Induction Medium









S Sprayed

SAG12 Senescence Associated Gene 12

SAGs Senescence Associated Genes

SEM Shoot Elongation Medium

SI% Shoot Induction Percentage

SIM Shoot Induction Medium

SIM10 Shoot Induction Medium supplemented with 10 pM N6-
Benzyladenine

SIM160 Shoot Induction Medium supplemented with 160 pM N6-
Benzyladenine

SIM20 Shoot Induction Medium supplemented with 20 pM N6-
Benzyladenine

SIM320 Shoot Induction Medium supplemented with 320 pM N6-
Benzyladenine

SIM40 Shoot Induction Medium supplemented with 40 pM N6-
Benzyladenine

SIM640 Shoot Induction Medium supplemented with 640 pM N6-
Benzyladenine

SIM80 Shoot Induction Medium supplemented with 80 pM N6-
Benzyladenine

SSR Simple Sequence Repeat

TSWV Tomato Spotted Wilt Virus









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

STRATEGIES FOR ENHANCING LEAF SPOT (Cercospora arachidicola AND
Cerscosporidium personatum) TOLERANCE IN PEANUT (Arachis hypogaea L.)

By

Scott P. Burns

August 2010

Chair: Barry Tillman
Cochair: Maria Gallo
Major: Agronomy

Cercospora arachidicola S. Hori and Cercosporidium personatum (Berk and M. A.

Curtis) Deighton are fungal pathogens that cause leaf spot, the most significant disease

in peanut. Early leaf spot (C. arachidicola) and late leaf spot (C. personatum) are found

in all peanut-growing regions worldwide. In Florida, if fungicides are not used, pod yields

can be reduced by as much as 50% by these leaf spot diseases. The present research

focused on developing novel strategies for improving leaf spot tolerance in peanut.

The first objective of this study was to confirm and characterize the source of

suspected leaf spot tolerance in Florida-07. It was hypothesized that Florida-07

displayed classically defined tolerance. With regard to visual rating, lesion/leaf

percentage, and lesion density, the rate of disease progression was the same in

sprayed and non-sprayed York sprayed AP-3, and sprayed Florida-07. Similar disease

progression was observed for non-sprayed AP-3 and non-sprayed Florida-07, but at a

faster rate than the aforementioned cultivar*treatments. Lesion growth occurred at the

same rate. Based on these data, it was concluded that Florida-07 and AP-3 possessed

the same degree of susceptibility to late leaf spot disease. The impact of leaf spot on









pod yield of Florida-07 was similar to its impact on pod yield of AP-3 in two out of three

tests, but in the third test, leaf spot impacted pod yield of Florida-07 (1084 kg ha-1) less

than it did AP-3 (1991 kg ha-1) (P > t =0.0524). On average, however, yield loss to leaf

spot (sprayed minus non-sprayed) of AP-3 (1564 kg ha-1) was not different than that of

Florida-07 (1177 kg ha-1). On average, Florida-07 does not appear to possess

significant tolerance to leaf spot.

The second objective of this research was to optimize a peanut direct shoot

organogenesis tissue culture system that had been optimized for an Indian cultivar, JL-

24 (Sharma and Anjaiah, 2000) for U.S. cultivars. A difference in shoot induction was

found for the cotyledon explants examined (P > t = <0.0001). Explant A had more shoot

induction with a visual rating of 1.8, than explant B that had a rating of 1.6 (P > t =

<0.0001). Cultivars responded to the culture conditions differently (cultivar BA

interaction). Georgia Green on 10 pM BA produced the most shoot buds (24.56%) and

had the highest visual rating (2.1), followed by VC-2 on 10 pM BA (22.1%, 1.8),

Valencia-A on 640 pM BA (21.4%, 1.8), Georgia Brown on 80 pM BA (9.0%, 1.7), and

Florida-07 on 40 pM BA (7.1%, 1.8). Georgia Green, VC-2, and Valencia-A appear to be

the best suited for future Agrobacterium-mediated transformation experiments based on

their shoot bud production.

The third objective of this research was to identify an Agrobacterium strain that

was highly virulent for selected cultivars. Transient expression studies were conducted

using a CaMV35S-uidA construct. It was hypothesized that a highly virulent









Agrobacterium strain could be identified by testing for uidA expression in cotyledon

explants. It was concluded that Agrobacterium strain ABI was virulent and should be

used for future stable transformation experiments.









CHAPTER 1
LITERATURE REVIEW

Peanut as a Crop

The cultivated peanut, Arachis hypogaea L., is a self-pollinating, indeterminate,

annual herbaceous legume crop of global importance. Peanut's center of genetic

diversity is believed to be in South America, specifically southern Brazil and northern

Paraguay (Pattee and Young, 1982). During the sixteenth and seventeenth centuries,

early Spanish and Portuguese explorers found indigenous people of Central and South

America cultivating peanut. Subsequently, these explorers introduced peanut first to

Europe and eventually to both African coasts, Asia, the Pacific Islands, and finally to

North America. Currently, peanut is grown on six continents and in over 100 countries

(Nwokolo, 1996).

The vast majority of the world grows peanut as a low input, small scale

subsistence oilseed crop. Presently, it is the fifth most important oilseed crop in the

world. Peanut oil is versatile and has been widely used as a bio-fuel, in cooking, and as

a food constituent. However, in the U.S., peanut is used primarily as a food product for

direct consumption, e.g. peanut butter, dry roasted nuts, and flour. Nutritionally, peanut

is high in protein, as well as mono- and poly-unsaturated fats (e.g. linoleic and oleic

acids). In many developing countries, peanut serves as a crucial dietary component for

the indigenous people.

In 2007, an estimated 22,365,760 hectares (ha) of peanuts were harvested

worldwide. China led the world in peanut production and value (13,079,363 metric tons

(MT), Int. $6,112,785,000, respectively), followed by India (9,182,500 MT, Int.

$4,205,879,000), Nigeria (estimated 3,835,600 MT, estimated Int. $1,778,082,000), and









the U.S. (1,696,728 MT, Int. $778,851,000) (FAO 2010). Although the U.S. does not

lead the world in peanut production, it has ranked first in yield per land unit for over 15

years (Chenault et al. 2008). In 2009, 443,536 ha of peanuts were planted in the U.S.

Georgia had the largest tract of land dedicated to peanut production (186,155 ha),

followed by Alabama (68,797 ha), Texas (64,750 ha), Florida (48,562 ha), and North

Carolina (30,351 ha). In 2009, the farm-gate level value of peanut production was

$835,172,000, while the peanut industry, as a whole, generated approximately $4 billion

for the U.S. economy. Georgia had the largest farm-gate level input toward value

($390,400,000), followed by Texas ($129,658,000), Alabama ($104,606,000), Florida

($69,552,000), and North Carolina ($66,911,000) (USDA NASS 2010). U.S. peanut

production plays a major role in the overall economic prosperity of many rural

production areas across the peanut growing regions.

Peanut Morphology and Taxonomy

The peanut plant can be upright or prostrate in growth. At emergence, plants

develop a main stem with many auxiliary lateral branches extending from the main

stem. Leaves are alternate and compound, consisting of three to four leaflets.

Botanically, peanut is unique among most other cultivated crops due to its geocarpic

growth habit. Geocarpy is the production of aerial flowers but subterranean fruits.

Peanut flowers are papilionaceous in appearance and contain both male and female

reproductive parts (perfect flower). Natural cross-pollination of peanut is rare and

breeding efforts require hand pollination. Post-pollination, flowers produce an elongated

ovarian structure known as a gynophore or peg. The aerial peg grows vertically and

penetrates the soil where the mature fruit (pod) develops.









Arachis hypogaea consists of two subspecies, hypogaea and fastigiata. The ssp.

hypogaea does not flower on the main stem and, in general terms, matures later, has a

high water requirement, an alternate branching pattern, and produces large seed. The

ssp. fastigiata produces flowers on the main stem, has sequential branching, and,

relative to the other subspecies, matures earlier, with a lower water requirement, and

produces smaller seed. Subspecies can be further classified into six botanical varieties

based on their morphology and growth habits (Krapovickas and Gregory 1994).

Botanical varieties 'hypogaea' and 'hirsuta' belong to ssp. hypogaea while varieties

'fastigiata', peruvianaa', 'aequatoriana' and vulgariss' belong to ssp. fastigiata.

The four U.S. peanut market types fall within the botanical varieties vulgaris,

fastigata, and hypogaea. Botanical variety vulgaris contains cultivars belonging to the

Spanish market type, fastigata includes the Valencia market type cultivars, and

hypogaea consists of Runner and Virginia market types. Market type forms a rough

classification system which is primarily based on relative pod and seed size

characteristics (small, medium, and large), and to a lesser extent on growth habit,

growing region, and center of genetic origin (Pattee and Young 1982; Knauft et al.

1987).

Cultivars classified as Spanish market types typically have small, two seeded

pods containing small seeds. The genetic origin of Spanish market types is the Guarani

region of northeast Argentina, Paraguay, and southern Brazil. In the U.S., Spanish

market types are generally grown in the southwestern portion of the peanut producing

region (Texas, and Oklahoma), and their seeds are used primarily in candy and for oil.









Valencia market types typically have medium two- and three-seeded pods

containing medium sized seed and originated in Paraguay and central Brazil. This

market type is grown primarily in the southeastern producing region (Georgia, Alabama,

and Florida). Valencia peanuts, especially the three-seeded type, are whole roasted and

boiled as snack foods.

The center of origin for Runner and Virginia market type peanuts is unclear. The

precursor to these market types originated in South America, but may have arisen, as

we know them today, while being grown in Africa. Runner and Virginia type peanuts

tend to have larger pods and seeds compared to Spanish and Valencia peanuts.

However, Virginia type peanuts have larger pods and seeds compared to Runner type

pods and seeds. Runner type peanuts are most widely grown in the southeastern

growing region of the U.S. and are used for oil and peanut butter production. Virginia

types are primarily grown in the northeastern peanut producing region (Virginia, and

North Carolina) for use as whole roasted, "ball park" nuts.

Peanut Genetic Diversity

Within the genus Arachis, A. hypogaea is the only species that has been

domesticated and grown worldwide. Despite extensive morphological and physiological

variation, many studies have concluded that A. hypogaea has low genetic diversity.

These studies have used pedigree analysis (Knauft and Gorbet 1989), protein profiles

(Singh et al. 1991b, 1994), isozymes (Grieshammer and Wynne 1990; Lacks and

Stalker 1993; Lu and Pickersgill 1993; Stalker et al. 1994), restriction fragment length

polymorphism (RFLP) (Galgaro et al. 1998; Garcia et al. 1995; Halward et al. 1991,

1993; Kochert et al. 1991, 1996; Paik-Ro et al. 1992), and random amplification of

polymorphic DNA (RAPD) (Halward et al. 1992; Lanham et al. 1992; Garcia et al. 1995;









Galgaro et al. 1998; Subramanian et al. 2000; Raina et al. 2001) but have found low

levels of polymorphism. Additional studies have identified more polymorphism using

amplified fragment length polymorphism (AFLP) (He and Prakash 1997, 2001;

Herselman 2003) and simple sequence repeat (SSR) (Hopkins et al. 1999; Raina et al.

2001; Tang et al. 2007) techniques. However, the genetic diversity that exists in

domesticated peanut remains narrow when compared to other important crops.

Because most Arachis species are diploid, with the exception of Arachis monticola

Krapov. and Rigonc., they do not readily cross with tetraploid A. hypogaea. The limited

genetic diversity found in cultivated peanut is most likely due to a relatively recent,

single hybridization event between wild, diploid Arachis species (Halward et al. 1991).

This narrow genetic base in peanut has been further compounded by the self-pollinating

nature of peanut and breeding programs using very few elite breeding lines (Herselman

2003).

As mentioned above, peanut is a tetraploid, specifically an allotetraploid (2n = 4x =

40), containing two distinct A and B genomes. Genome A has a set of chromosomes

that is significantly smaller when compared to the chromosomes of the B genome

(Husted 1936). Of the approximately 70 known Arachis species, only a few possess the

B genome, which limits the number of candidate parent Arachis species (Smartt et al.

1978; Gregory et al. 1980). Morphology, chromosome pairing, cross compatibility, and

molecular markers have been used to identify likely progenitors of cultivated peanut.

Several studies point to Arachis cardenasii Krapov. and W.C.Greg., Arachis villosa

Benth., Arachis correntina (Burkart) Krapov. and W.C. Greg., or Arachis duranensis

Krapov. and W.C. Greg as being likely A genome donors (Seetheram et al. 1973;









Gregory and Gregory, 1976; Smartt et al. 1978; Singh and Moss 1982; Kirti et al. 1983;

Murty and Jahnavi 1986; Singh, 1988; Kochert et al. 1991, 1996; Singh et al. 1996;

Raina and Mukai 1999) and Arachis batizocoi Krapov. and W.C. Greg or Arachis

ipaensis Krapov. and W.C. Greg as being B genome donors (Smartt et al. 1978; Singh

and Moss 1984; Singh, 1988; Klosova et al. 1983; Kochert et al. 1991, 1996; Fernandez

and Krapovickas 1994). Studies conducted by Kochert et al. (1996), Seijo et al. (2004,

2007) and Favero et al. (2006) propose that A. duranensis and A. ipaensis are the likely

progenitors of peanut. Currently, this theory is the most commonly accepted one. As

technologies improve and whole genome sequencing becomes more efficient and

affordable, additional polymorphisms (e.g. single nucleotide polymorphisms) should be

identified, and that along with a better understanding of epigenetic effects should help

explain the morphological and physiological diversity observed in cultivated peanut.

Peanut Diseases

Peanut is susceptible to a variety of biotic stressors. In the U.S., several foliar and

soilborne diseases/pests exist that lower yields, as well as profits for growers.

Domestically, the most prevalent pathogens/pests of peanut include tomato spotted wilt

virus (TSWV; Tospovirus vectored by thrips), root-knot nematode (Meloidogyne

arenaria (Neal) Chitwood race 1), Sclerotium rolfsii Sacc., the casual agent of white

mold, Cylindrocladium parasiticum Crous, Wingfield and Alfenas, the casual agent of

Cylindrocladium Black Rot, Sclerotinia minor Jagger, that results in Sclerotinia blight,

Puccinia arachidis Speg., that causes rust, and Cercospora arachidicola S. Hori and

Cercospiridium personatum (Berk and M. A.Curtis) Deighton, that are the casual agents









of early and late leaf spot. In addition to yield, seed vigor and grade, disease/pest

resistance is a primary breeding objective for peanut breeding programs throughout the

U.S.

Peanut Leaf Spots

Early leaf spot (ELS) (teleomorph Mycosphaerella arachidi Deighton) and late leaf

spot (LLS) (teleomorph Mycosphaerella berkeleyi Jenk.] diseases are the most

widespread foliar diseases of peanut. Both C. arachidicola and C. personatum can be

found wherever peanut is grown, making them the most significant of all peanut

pathogens (Zhang et al. 2001). If fungicides are not used, pod yields can be reduced by

50% or more in diseased plants (Knauft et al. 1986, Pixley et al. 1990ab, Shokes et al.

1983, Damicone et al. 1994, Smith and Littrell 1980, Zhang et al. 2001).

Identification and Classification

During the early production years of peanut, leaf spots were regarded as a

common and natural feature of the peanut plant (Backman et al. 1977). The first

documented description of an organism causing peanut leaf spot was by Berkley

(1875). Berkley identified a single fungal species and proposed the name Cladosporium

personatum as being the source of leaf spot disease. Studies following the work of

Berkley led to a highly variable nomenclature and classification system for leaf spot

disease. Comparison of specimens and earlier reports by Woodruff (1933) led to the

determination that the casual agent of leaf spot disease was actually due to two distinct

fungal organisms. The two pathogens were identified and then named, Cercospora

arachidicola Hori and Cercospora personata (Berk. and Curt.) Ellis and Everhart.









The sexual stages for each pathogen were later identified by Jenkins (1938) and named

Mycosphaerella arachidicola (ELS) and Mycoshaerella berkeleyii (LLS).

Cercospora personata was later re-classified by Deighton (1967) as belonging to the

genus, Cercosporidium. Deighton re-named the pathogen to Cercosporidium

personatum (LLS).

Symptoms and Signs

ELS and LLS diseases are characterized by necrotic flecks that enlarge to necrotic

lesions that reduce light interception and photosynthesis (Boote et al. 1983). Lesions

caused by either disease can occur on pegs, stems, or petioles, but are most commonly

found on leaves (Hemingway, 1954; Gibbons, 1966). Lesion appearance on leaves

infected by C. arachidicola and C. personatum can differ slightly. ELS disease produces

tan to reddish-brown to black foliar lesions that are typically, but not always, surrounded

by a distinct yellow halo (frog-eye). Because the yellow halo is not always indicative of

ELS, conclusive identification can only be made by microscopically examining

conidiophores/conidia. In ELS, conidiophores form on the upper leaf surface within the

lesion covered area and conidia are often sparsely present or not present at all. LLS

disease, on the other hand, produces brown to black lesions with no halo ever being

present. However, similar to ELS, conclusive identification can only be made by

microscopic examination of conidiophores/conidia. The formation of C. personatum

conidiophores/conidia is far more prolific than C. arachidicola. Conidiophores of C.

personatum tend to be densely packed into lesions with numerous conidia being

present.

Regardless of lesion appearance, lesions caused by the presence of either C.

arachidicola or C. personatum have the same effect of reducing photosynthetic activity









in leaf tissue, as mentioned above. The reduction of photosynthetic leaf area is the

primary factor associated with loss of yield in peanut. Pre-mature defoliation (due to

early onset of senescence mechanisms), another symptom associated with both leaf

spot pathogens, of course, further compounds the reduction of active photosynthetic

area.

Disease Cycle

C. arachidicola and C. personatum are very similar in respect to their life cycles.

Both produce conidia and mycelia that are capable of overwintering in crop residue.

They are necrophilic, thriving on the dead cells and tissues of the host. Conidial-spores

and mycelia overwintering in crop residue provide the inoculum source for the following

season's initial infection.

Infection begins when conidial-spores germinate and form germ tubes that

penetrate open stomata or lateral faces of epidermal cells. Following penetration, germ

tubes form into networks of mycelia. These mycelia produce cellulolytic and pectolyic

enzymes, i.e., dothistromin (Stoessl, 1984) and/or cercosporin, which diffuse and

degrade host cell wall and middle lamellae constitutients. Intercelluar hyphae of C.

arachidicola have been shown to kill host cells in advance of hyphal penetration (Alabi

and Naqvi, 1977; Stoessl et al. 1990; Daub et al. 2000). Conversely, C. personatum

does not kill prior to penetration, but instead develops into haustoria. As mycelia spread

into host tissues and enzymatic degradation occurs, cells collapse and produce necrotic

lesions (Abdou et al. 1974; Jenkins, 1938). In addition to their degradative properties,

enzymes produced by these pathogenic fungi have also been shown to promote

ethylene production, enhancing the rate of leaf abscission (Bourgeois et al. 1991).









Sporulation of these organisms is characterized by the formation of long, thin

multicellular conidia on short, darkly pigmented conidiophores (Agrios, 2005). Conidia

and conidiophores for both organisms are very similar in appearance. Conidia are easily

detached and can be dispersed by wind, water, or any other mechanical movement. C.

arachidicola and C. personatum favor warm temperatures and are most destructive

during the summer months in warmer climates, such as those found in the

southeastern peanut growing states (e.g., Alabama, Florida, Georgia, Mississippi, and

South Carolina) (Culbreath et al. 2009). Development and dispersal of conidia of both

pathogens are most prevalent in temperatures ranging from 16C 30C and relative

humidity exceeding 90%. High temperatures and leaf wetness, either due to humidity or

rainfall, are necessary for the rapid growth and widespread dispersal of leaf spot

disease (Jensen and Boyle, 1965; Alderman and Beute, 1986; Shew, 1988; Jacobi et al.

1995a, b).

Management Strategies

Current management strategies for controlling leaf spot epidemics rely heavily on

foliar fungicide application, crop rotation, tillage, planting date, and cultivar selection

(Wright et al. 2009; Cantonwine et al. 2006, 2007a; Zhang et al. 2001).

Foliar fungicide application. Numerous reports are available describing the

successful control of leaf spot diseases using fungicides. Without the use of fungicides,

commercial peanut cultivation would not be practical. Disease control for the 2010

growing season has been estimated to be approximately $216/ha, with a large portion

of that amount going toward fungicides for leaf spot control (Smith and Smith, 2009).

Annually, purchasing and applying fungicides is one of the most expensive investments

for a grower. As previously mentioned, without fungicides, peanut yields may be









reduced by more than 50%, which is unacceptable if one is trying to make a profit.

Foliar fungicide products commonly used on peanuts include sulfur, tebuconazole,

propiconazole, chlorothalonil, trifloxystrobin, pyraclostrobin, and azoxystrobin. Less

commonly used fungicides include copper, maneb, mancozeb, thiophanate, boscalid,

iprodione, fluazinam, prothioconazole, and phoshite (Mossier and Aerts, 2007). Current

recommendations call for fungicides to be applied every 10 14 days beginning 30 35

days after planting (DAP) (Wright et al. 2009). As a result, typically seven or more

applications are made during a growing season. Additionally, it is recommended that

multiple fungicides with different modes of activity be used throughout the growing

season, to avoid the development of fungicide-specific, resistant strains. With the use of

fungicides, leaf spot control may approach 100%, but on average, growers can expect

60 70% protection from recommended fungicide applications (Culbreath et al. 2009).

Crop rotation. Rotation has long been recognized as one of the most effective

means of controlling disease in any crop. Crop rotation provides a time period for

degradation of crop debris, which in turn deprives any surviving inoculum of host

tissues. After foliar fungicide applications, crop rotation is the next most important

management practice for reducing leaf spot pressure (Culbreath et al. 2009).

Unfortunately, in the southeastern U.S., low value crops are generally the only

alternative for rotating with high cash value crops like peanut (Wright et al. 2009). Due

to the discrepancy in crop-value, many growers have opted to continually grow peanuts

in the same fields. Current extension recommendations suggest rotation with non-

leguminous crops such as cotton, corn, sorghum, or bahiagrass. Rotating these crops

with peanut will reduce disease pressure and thereby result in higher yields (Culbreath









et al. 2009; Wright et al. 2009). In fact, peanut yields were 19% higher after two years of

corn and 41% higher after two years of bahiagrass (Wright et al. 2009). Mossler and

Aerts (2007) reported that a rotation interval of three to four years will further reduce

disease pressure and increase yields.

Tillage. Because C. arachidicola and C. personatum are necrophilic and survive

from season to season on crop debris, tillage will create a soil layer (physical barrier)

preventing fungal inoculum from coming into contact with new growth. Conventional

tillage of peanut involves turning the soil in an entire field. Recently, the increased cost

of fuel has led to the investigation of conservation tillage methods. A particularly

effective conservation method is strip tillage, which differs from conventional tillage in

that the entire field is not turned. Rather, a narrow strip of planting area (8 12" wide) is

sub-soiled (inversion of top soil) (Wright et al. 2009). Although the exact mechanism is

unclear, leaf spot appearance is delayed and late-season pressure is less severe in

strip-tilled peanut fields (Cantonwine et al. 2007b; Culbreath et al. 2009). Because of

the reduced time investment, cost, and incidence of disease, strip tillage has been

regionally adopted in the southeastern states by some peanut producers.

Planting date. Peanuts planted in early- to mid-April generally have less leaf spot

pressure than those planted later in mid-May to early-June. Peanuts planted during the

earlier months have less exposure time to hot, humid conditions which are most

conducive for pathogen development. Fungicide applications in early planted fields

(mid-April) can be delayed to 60 DAP (Mossier and Aerts, 2007). However, this

advantage is overcome in early planted peanuts because they are more susceptible to

outbreaks of white mold and TSWV (Culbreath et al. 2009). Although first identified in









the early 1980s in the southeastern U.S. growing region, during the mid-1990s, TSWV

severity became more prevalent. To avoid significant TSWV damage, planting dates

were shifted later in the season and this increased leaf spot pressure. Current

recommendations call for the use of environmental modeling systems to determine

planting dates. Ideally, planting will occur late enough in a season to avoid TSWV

damage, but early enough to avoid the most conducive leaf spot environment.

Cultivar selection. In a typical growing season in the southeastern U.S. peanut

growing region, it can be expected that leaf spot will be the most severe disease

encountered. Breeding programs have invested a great deal of effort in developing leaf

spot resistant cultivars. Breeding for leaf spot resistance has led to the release of

several cultivars with negligible lesion coverage, reduced defoliation, and high yield

potential. Some cultivars possess enough resistance to reduce fungicide spray regimes.

Resistant cultivars provide financial protection to growers because less investment is

required for chemical fungicides/applications and final yield potential is protected.

Several peanut cultivars have been released that are classified as "resistant" to

ELS and/or LLS diseasess. These cultivars include Georgia-01R (Branch, 2002),

Tifrunner (Holbrook et al. 2007), Georgia-02C (Branch, 2003), Georganic (Holbrook et

al. 2008), Georgia-07W (Branch et al. 2008), Southern Runner (Gorbet et al. 1987),

York, DP-1 (Gorbet and Tillman, 2008), C99-R (Gorbet, 2002a), Hull (Gorbet, 2007b),

and Florida MDR-98 (Gorbet, 2002b). Although classified as resistant, the degree of

protection in many of these cultivars is incomplete and still allows for significant damage

under severe disease pressure. Additionally, several of these cultivars are associated

with characteristics that have hindered their wide-spread acceptance among growers,









such as poor germination, late maturity, and large seed size. For example, when

multiplied by commercial seed producers, York, DP-1, C-99R, Hull, and MDR-98 often

exhibit poor field emergence. Poor field emergence results in unacceptable field stands

that in turn affect final yield (Morton, 2007). Additionally, the development of leaf spot

resistant, Runner-type cultivars have typically been limited to cultivars with late maturity

(maturity reached 14 21 days after other Runner-types), and these cultivars tend to

have larger seed size which presents problems to shelling facilities and has further

contributed to the limited acceptance of such cultivars. The unfavorable characteristics

associated with many leaf spot resistant cultivars may be due to a common parent in

their lineage, plant introduction (PI) 203396, which is the primary source for superior

leaf spot resistance. PI 203396 is one of only a few peanuts that consistently results in

progeny with high leaf spot resistance, consequently the genetic diversity available for

leaf spot resistance is narrow.

Breeding for Leaf Spot Resistance

Peanut breeding in the U.S. began in Florida during the 1920s (Tillman and

Stalker, 2009). Since that time, breeding efforts have led to drastic improvements in

peanut performance. The University of Florida has led breeding efforts over the past 30

years to develop leaf spot resistant cultivars. Breeding methods in peanut are similar to

that of other self-pollinating crops. Pedigree selection, single seed descent, and mass

selection are all common strategies for improvement. In terms of breeding for leaf spot

resistance, the major hurdle encountered is the lack of genetic diversity available, as

previously mentioned. Southern Runner was the first cultivar to be released with

resistance to leaf spot. Cultivars with a genetic background similar to Southern Runner

have been recently released: York, DP-1, C99-R, Hull, and Florida MDR-98. Along with









leaf spot protection, these genetically similar cultivars also inherited many agronomically

unfavorable characteristics that were described above.

In an effort to increase genetic diversity and incorporate favorable traits,

alternative breeding methods and new genetic technologies (e.g., hybrid introgression,

embryo rescue, and genetic transformation) have been used in peanut breeding

programs. Wild Arachis germplasm has been collected with nearly complete resistance

to both leaf spot pathogens. However, the production of fertile A. hypogaea x Arachis

sp. progeny are complicated by differences in ploidy levels of the parents. However,

A.villosa, A. correntina, A. diogoi Hoehne, A. stenosperma, A. cardenasii Krapov. and

W.C. Greg., A. duranensis, and A. batizocoi have all been successfully crossed with A.

hypogaea (Singh, 1986; Stalker and Simpson 1995).

Simpson and Starr (2001) released the first commercial peanut cultivar, COAN,

which possessed an identifiable gene derived from a wild Arachis species that provided

resistance to root-knot nematode. Although not bred for the purposes of leaf spot

resistance, the development of COAN proved that hybrid introgression was a viable

method for improving genetic diversity and bringing biotic resistance factors into

cultivated peanut. Recently, germplasm lines have been released with very high levels

of leaf spot resistance derived from A. cardenasii (Stalker et al. 2002). PI 261942 was

crossed with A. cardenasii to produce triploid hybrids. First generation hybrids were

collected and colchicine-treated to restore fertility. Fertile plants were self-pollinated,

and offspring were field screened for disease resistance. Germplasm possessing leaf

spot resistance was further screened for ploidy level. Lines that were tetraploid were









selected as breeding stock (Stalker et al. 2002). Isleib et al. (2006) used these stocks to

develop a germplasm line resistant to ELS, N96076L.

Peanut Transformation

Recently, interest has increased in transgenic approaches to complement

traditional breeding for improved agronomic performance in peanuts. Transgenic cotton

(Gossypium hirsutum L.), soybean (Glycine max L.), and corn (Zea mays L.) have been

widely accepted and very successful in streamlining cultivation practices and improving

yields.

Numerous studies have focused on transforming peanuts using particle

bombardment as well as Agrobacterium-mediated transformation systems (see Table B-

1 for details of these studies). Presently, the most successful attempts at producing

transgenic peanuts have used particle bombardment to introduce constructs into peanut

somatic embryos. Although an effective means for generating transgenics,

bombardment protocols have several disadvantages: complex rearrangements and

integration patterns, gene silencing, high cost, difficulty of use/accessibility, and limited

end product utility (Altpeter et al. 2005). Among these disadvantages, perhaps the most

unfavorable issue associated with bombardment protocols, is the length of time required

to generate mature plants. Most biolistic protocols require 8-16 months to produce

mature, transgenic lines capable of producing seed. These lengthy tissue culture

requirements allow for an increased likelihood of somaclonal variation. In addition, these

lengthy protocols often require extensive subsequent sub-culturing, which is highly labor

intensive and increases the chances for putative transgenics to be lost to contamination.

As an alternative to lengthy bombardment methods, protocols using faster, direct

organogenesis and Agrobacterium have been investigated. Transformation by









Agrobacterium is believed to be superior to bombardment because integration patterns

tend to be "cleaner", meaning whole gene constructs integrate into the host genome

usually with low copy number (Sharma et al. 2005). Additionally, and perhaps most

favorable, tissue culture requirements tend to be far less intensive in terms of sub-

culturing and time to plant maturity. This reduction in time and handling lessens the

likelihood for contamination and somaclonal variation. Thus, once established, protocols

are far less labor intensive and more economically sound.

Despite the many advantages of Agrobacterium-mediated transformation over

particle bombardment, it is far from an ideal system and requires intensive optimization

because highly efficient Agrobacterium protocols are dependent upon multiple factors:

bacterial strain, specialized plasmid vectors, host genotype, explant age/type, and co-

cultivation conditions (Sharma et al. 2005). Due to the biological nature of

Agrobacterium-mediated transformation (host-"pathogen" compatibility), much effort is

required to determine the best infection conditions. Unlike particle bombardment

protocols, that use DNA-coated gold particles to physically deliver foreign DNA to the

nucleus of target tissue, Agrobacterium relies on a biological virulence mechanism for

nuclear transgene delivery. As in nature, the interaction of host tissue susceptibility and

Agrobacterium virulence are highly variable.

Few genetically engineered peanut lines exist today, and none are commercially

available. The limited availability of transgenic peanuts is primarily due to: 1) no single

peanut transformation protocol for fast and routine production of transgenic, 2) no

approved transgenic lines, and 3) grower hesitancy to plant "GM peanut" for fear of non-

acceptance by consumers. Recently, grower/consumer attitudes have shifted since









observing the success of other genetically engineered crops, e.g., cotton, corn, and

soybean. Because of this shift in attitude, a renewed interest in peanut transformation

has led to the development of research lines with improved agronomic performance.

Peanut Tissue Culture

Genetic transformation has great potential for introducing novel, beneficial genes

into peanut that would not be available using conventional breeding methods. While

conventional breeding will always play a highly significant role in the improvement of

peanut, transformation technologies may provide a means of streamlining those

improvement processes.

Although many studies have reported the successful production of transgenic

peanuts, none have described very efficient production in the numbers of independent

lines generated. Many of the transgenic peanut lines developed have been for "proof of

concept" purposes and have used easily identifiable traits that serve no agronomic

function, i.e., production of 3-glucuronidase (GUS) or fluorescent reporter proteins. A

common factor that impedes the efficient production of multiple independent lines is the

restraints associated with the tissue culture process. Somaclonal variation due to long

tissue culture requirements, explant availability, cultivar specificity, and poor

regeneration into mature plants are common factors attributed to the limited success of

developing highly efficient transformation protocols (Livingstone and Birch 1999;

Anuradha et al. 2008).

Regardless of transformation method or target crop, a requirement for all tissue

culture systems is the highly prolific, in vitro production of actively dividing cells. The

transfer and stable integration of transgenes is dependent upon the rapid regeneration

of competent cells. Highly efficient transformation protocols, in which numerous stable,









independent lines are produced, are often those with the highest incidence of

regeneration. Currently, the major impediment of the routine production of transgenic

peanut is the lack of prolific tissue culture systems.

Most seed and seedling tissues of peanut can be used to establish regeneration-

competent tissue culture systems (Ozias-Akins and Gill, 2001). Explant source material

has varied widely in previous peanut tissue culture studies. Several explant types have

been used to develop both embryogenic and organogenic tissue culture protocols with

moderate success. These studies have repeatedly shown that regardless of explant

type or developmental system, the pathway to differentiation is primarily dependent

upon genotype selection and growth regulator concentration in culture medium. Peanut

cultivars tend to be regionally adapted and this has led to a large number of genotypes

being tested across many regeneration protocols. Likewise, numerous growth

regulators at various concentrations have been tested in tissue culture protocols.

Presently, cytokinin-class hormones, i.e. N6-benzyladenine (BA), kinetin, and

thidiazuron, and auxin-class hormones, i.e. 2,4-dichlorophenoxyacetic acid (2,4-D), and

picloram, have been the most widely tested and successful for eliciting a regeneration

response.

Embryogenesis

To date, the most efficient method for producing transgenic peanut is particle

bombardment of somatic embryos. Somatic embryogenesis is the development of

embryogenic cells lines from tissues not typically involved with embryo production.

Embryos are unique from other adventitious tissues because they are bipolar, having

both a shoot and root pole.









Ozias-Akins et al. (1989) and Hazra et al. (1989) were among the first to report the

successful generation of somatic embryos in peanut. These studies used immature

cotyledons as explants, which were placed on medium supplemented with synthetic

auxin hormones. Later studies also used immature explants to develop somatic

embryos. The major disadvantage of using immature tissues as explants is the limited

availability of this starting material. To obtain immature explants, material must be

collected from flowering plants three to four weeks following soil penetration by the peg.

In the southeastern U.S., field production of peanut begins in mid- to late-April and

continues through early-October, with the most prevalent flowering occurring 60 80

DAP (Wright et al. 2009; personal communication Y. Lopez, 2010). The process of

monitoring flowering and peg formation is an extremely tedious and labor intensive

activity. Furthermore, flower induction is highly dependent on environmental conditions

and can deviate from the general 60 80 day range. Along with the same problems

observed in field-grown peanuts, growing peanuts in a controlled greenhouse

environment is complicated by the fact that these plants tend to produce fewer flowers.

Because of the unpredictable time and rate of immature embryo development, the

availability of explants is extremely limited.

To circumvent the issues associated with using immature explants, investigations

focused on developing protocols that used mature explants. Mature explants (generally

from seeds) can remain viable when stored at low temperature and humidity, making

the production of somatic embryogenesis on a year-round basis more convenient.

McKently (1991) was the first to report a successful embryogenesis protocol using

mature explants cultured on Murashige and Skoog (MS) medium supplemented with









picloram. Despite the convenience of using mature explant source material, many

studies showed improved somatic embryogenesis efficiencies using immature tissue as

explants (Ozias-Akins et al. 1993; Singsit et al. 1997; Wang et al. 1998; Chenault et al.

2002, 2003b, 2005; Yang et al. 1998, 2003; Deng et al. 2001; Chenault and Payton

2003; Athmaram et al. 2006).

In addition to explant availability, somatic embryogenesis in peanut is

disadvantageous due to the low conversion rate of embryos into mature plants (Joshi et

al. 2008). Ozias-Akins et al. (1992) and Chengalrayan et al. (1995, 1997) have made

attempts to increase the frequency of recovering mature plants from somatic embryos of

peanut. Despite previous efforts, the time required for the production and conversion of

somatic embryos has led to the investigation of other tissue culture systems for use in

transformation protocols.

Organogenesis

An alternative to lengthy somatic embryo production is direct production of organ-

specific tissues from explants, a process known as organogenesis.

Illingworth (1968) was the first to report successful in vitro organogenesis of

peanut from de-embryonated cotyledon sections cultured on hormone-free basal

medium. This study, as well as many of the other early peanut organogenesis studies,

was intended to develop protocols for basic research purposes, such as germplasm

storage, rapid propagation, disease eradication, and embryo rescue (Martin, 1970;

Kartha, 1981; Mroginski, 1981; Bajaj, 1982; Narasimhulu, 1983; Pittman, 1983; Atreya,

1984; Bhatia, 1985). These studies tested several media formulations, various growth

hormones and concentrations, and explants. Although the efforts of these investigations

resulted in the development of organogenesis protocols, no single protocol was highly









efficient in regenerating adventitious tissues. As the reality of routine gene

transformation became more evident, efforts to improve the organogenic response in

peanut intensified.

Successful organogenesis protocols have been developed using leaf material and

immature seed material. These protocols, much like embryogenesis protocols using

similar starting material, are not always favorable due to low explant availability. Mature

seed have been investigated as an explant source. Hypocotyls, epicotyls, and

cotyledonary nodes from freshly germinated seed have been investigated as explants

for organongenesis. To simplify protocols, direct organogenesis from non-germinated,

mature, whole seed, embryo axes, and cotyledons has been tested.

Sharma and Anajaiah (2000) developed an efficient protocol which used de-

embryonated cotyledon halves as explants. This study optimized an organogenesis

system using cv. JL-24. Freshly cut cotyledon-halves placed on MS medium

supplemented with 20 pM BA and 10 pM 2,4-D were efficient at producing adventitious

shoot buds (> 90%). Recently, Tiwari et al. (2008) expanded upon this protocol to

include other Spanish market type cultivars widely grown in India: TMV-2, TAG-24, and

Dh-3-30. In addition to numerous adventitious buds forming and rapid regeneration to

mature plants, Sharma and Anajaiah (2000) and Tiwari et al. (2008) reported high

transformation efficiencies using this tissue culture method.

Peanut Transformation Advancements

Peanut, like other crops, encounters many biotic and abiotic stressors throughout

a growing season. Although much of the early peanut transformation work was for

"proof of concept" purposes, several investigators have developed transgenic lines for

improved agronomic performance.









As previously discussed, TSWV is a major pathogen in most peanut growing

regions throughout the U.S. Innate resistance has been observed in peanut, but is

incomplete and allows for significant yield loss. In an effort to supplement natural

resistance, Brar et al. (1994), Yang et al. (1998), Magbanau et al. (2000), and Chenault

et al. (2003) bombarded somatic embryos with a nucleocapsid coat protein from TSWV.

Li (1997) used Agrobacterium transformation to integrate a similar gene into peanut. To

and progeny of transgenic plants displayed a day delay in symptom development. Using

a similar approach, Higgins et al. (2004) developed transgenic lines expressing peanut

stripe nucleocapsid coat protein. These lines displayed resistance to peanut stripe virus,

a virus common to peanut crops in Asian and Australian growing regions.

Toxin derived from Bacillus thuringiensis (Bt-toxin) has been widely used in many

crops to confer resistance to insect pests. Bt-expressing peanut was developed using

both Agrobacterium and biolistic transformation. Singsit et al. (1997), using

bombardment, developed transgenic peanut lines expressing CrylAc providing

protection to lesser cornstalk borer. Tiwari et al. (2008) successfully integated a

synthetic CrylEC gene into peanut using Agrobactrium transformation. Complete

resistance to tobacco cut worm, an insect pest common to Indian production regions,

was reported for several independent lines. Ingestion of CrylEC-expressing plants by

tobacco cut worms in in vitro bio-assays led to 100% fatality.

As mentioned earlier, fungal pathogens are the most prevalent peanut pests.

Rohini and Rao (2001) were the first to use Agrobacterium to generate peanut plants

with improved fungal resistance. Using a non-tissue culture-based transformation

system, Rohini and Rao (2001) developed plants expressing tobacco chitinase. This









study reported transgenic lines displaying tolerance to ELS disease in small-plot field

trials. Chenault et al. (2002) used biolistics to engineer peanut lines expressing genes

encoding chitinase and glucanse. Livingstone et al. (2005) engineered peanut lines to

produce oxalate oxidase, an enzyme which degrades oxalic acid, a compound required

for Sclerotinia blight infection. Detached leaflet assays showed transgene expression

limited lesion size resulting from direct application of oxalic acid. Lesion size was

significantly reduced in transgenic plants compared to wild type controls (65% 89%

reduction at high oxalic acid concentrations). A second assay examined lesion size after

inoculation of leaflets with S. minor mycelia. Lesion size was reduced by 75% 97% in

transformed plants, providing evidence that oxalate oxidase can confer enhanced

resistance to Sclerotinia blight in peanut. Most recently, Anurahda et al. (2008)

generated peanut plants expressing a mustard defensin protein. In vitro bio-assays of

leaf material indicated improved resistance to multiple fungal pathogens.

Leaf Senescence, a Nuclear Controlled Form of Programmed Cell Death

Plants defend themselves against pathogens by activating a complex, multi-

component defense response. Induced defenses of plants against pathogens are

regulated by networks of interconnecting signaling pathways involving cytosolic Ca2+

and H+ ions, reactive oxygen intermediates, salicylic acid, jasmonic acid, nitric oxide,

and ethylene as the primary components (Agrios, 2005). Increased activity of these

pathways during pathogen infection is believed to be controlled by gene-for-gene

interaction between the host and pathogen. Interactions between these defense

pathways are complex and not completely understood. However, hypersensitivity is

associated with nearly all defense mechanisms. Hypersensitivity is the rapid cell death

at the site of attempted pathogen ingress.









In recent years, programmed cell death (PCD) has become the focus of several

studies because of its potential to explain many fundamental processes common to a

species. PCD is the controlled self-destruction of cells triggered by external or internal

factors (Lim et al. 2007). PCD was once viewed as an unorganized process in which

cellular components were randomly degraded and were relocated to newly developing

tissues. More recent studies focusing on leaf senescence, a nuclear controlled form of

PCD, show that the process is very much orchestrated and coordinated by a complex

biochemical network (Gan and Amasino, 1997; Brault and Maldiney, 1999). Leaf

senescence is a phase of a plant's life cycle that signifies the final stage of leaf

development and is controlled by an extremely regulated system. Changes occur in cell

structure, metabolism, and gene expression. Senescence is characterized by reduced

photosynthetic capabilities, chlorosis and subsequent necrosis. A primary purpose of

this process is to relocate nutrients from old, non-functional leaves to developing

portions of the plant such as young leaves, growing seeds, or storage tissues (Gan and

Amasino, 1997; Jordi et al. 2000). Leaf senescence is influenced by many internal and

environmental signals (Lim et al. 2007). Internal factors include age and productivity of

tissues, flower and seed development, and phytohormone levels (Gan and Amasino,

1997). Environmental factors controlling leaf senescence can be biotic or abiotic in

nature. Examples of these factors include temperature extremes, drought, ozone,

nutrient deficiency, pathogen infection, wounding and shading (Lim et al 2007).

Although the exact mechanisms that regulate leaf senescence are not yet well defined,

several researchers have identified a class of control genes known as senescence

associated genes (SAGs). SAGs have been identified in a number of plant species.









First identified in Arabidopsis (Arabidopsis thaliana (L.)) Heynh. (Lohman et al. 1994),

SAGs have also been found in asparagus (Asparagus officinalis L.) (King et al. 1995),

barley (Hordeum vulgare L.) (Becker and Apel, 1993), rapeseed (Brassica napus L.)

(Buchanan-Wollaston and Ainsworth, 1997), maize (Zea mays L.) (Smart et al. 1995),

radish (Raphanus sativus L.) (Azumi and Watanabe, 1991), rice (Orzya sativa L.) (Lee

et al. 2001), and tomato (Solanum lycopersicum L.) (Drake et al. 1996). Many SAGs

code for similar gene products across species lines. Products often associated with

senescence genes are degradative enzymes such as proteases, lipases, nucleases,

chlorophyllases, and other nutrient recycling proteins such as glutamine synthase

(Gepstein et al. 2003; Ori et al. 1999)

Watanabe and Imaseki (1982) were the first to observe a correlation between leaf

senescence and a change in gene expression; their study indicated significant reduction

of leaf mRNAs during the progression of senescence. Subsequent work with

Arabidopsis showed that expression of photosynthetic genes are markedly down

regulated during the progression of leaf senescence, whereas mRNA levels increase for

other genes (later to be classified as SAGs) (Jiang et al. 1993; Humbeck et al. 1996).

Microarray analyses of Arabidopsis by van der Graaff et al. (2006) investigated SAGs

on a genome-wide scale. Results from this work indicated the up-regulation and down-

regulation of several hundred genes throughout the phases of senescence.

Approximately 800 SAGs of varying classes have been identified for which transcription

is initiated at various stages of leaf senescence (Gepstein et al. 2003). The large

number of SAGs expressed during leaf senescence is indicative of its tight genetic

control.









In a study focusing upon mRNA accumulating during natural senescence of

Arabidopisis leaves, Lohman et al. (1994) observed a gene that was up-regulated

throughout all phases of the process. This gene is now designated as senescence

associated gene 12 (SAG12), and the five phases of leaf senescence are described as

follows: stage one is the first visible sign of senescence, while stage five is total

chlorosis. Analysis of SAG12 expression showed that it was senescence-specific, up-

regulated only slightly at stage one, and then progressed rapidly to high levels that were

maintained until senescence was complete. Subsequent studies showed that SAG12

expression was not limited to leaf tissue alone, but was also expressed in other

senescing tissues such as stems, sepals, petals, and carpels (Gan and Amasino, 1997).

Gan and Amasino (1995) linked the SAG12 promoter to a reporter gene, uidA

which codes for 3-glucuronidase, to form a SAG12-uidA construct. Introduction of this

chimeric gene into tobacco did not alter the rate of senescence, but showed increased

uidA expression as leaf senescence progressed. Once effectiveness of the SAG12

promoter was confirmed, efforts then shifted toward developing an expression system

that used cytokinins to delay leaf senescence.

Cytokinins and Isopentyl Transferase

Cytokinins are a class of plant hormones that are active in controlling several

critical processes associated with the normal life cycle of a plant. Cytokinins are

essential for cell division, chloroplast development, bud differentiation, shoot initiation

and growth, and leaf senescence (Brault and Maldiney, 1999). Although these critical

roles are widely acknowledged for cytokinins, the pathways controlling them have yet to

be completely discerned.









Most of the research has focused upon the controlled expression of cytokinin

biosynthetic genes (Akiyshi et al. 1984; Barry et al. 1984). These studies indicate that

the gene coding for adenosine phosphate isopentyl transferase (IPT) is a key regulator

of cytokinin biosynthesis in Agrobacterium tumefaciens (Hirose et al. 2008). This gene

(tmr) is located on the Ti plasmid of pathogenic A. tumefaciens and is activated during

plant infection to initiate cytokinin production and gall formation (Sakakibara et al. 2005).

IPT catalyzes condensation of dimethylallylpyrophosphate and 5'-AMP to

isopentenyladenosine (iPA) 5'-phosphate (Hirose et al. 2008). This reaction is generally

considered the rate limiting step for cytokinin biosynthesis (Sakakibara, 2006).

One of the earliest attempts to exploit IPT activity involved linking tmrto a heat-

shock inducible promoter, HS6871 (Smart et al. 1991). Transgenic tobacco expressing

this construct initiated IPT production under heat stress were shorter with larger side

shoots, and remained green longer than wild-type controls. After several cycles of heat

shock, however, plant growth and morphology became abnormal due to extremely high

levels of IPT accumulating in the transgenic plants. Subsequent research tested a

multitude of promoters in combination with tmr, with results generally similar to those

reported by Smart (1991).

Gan and Amasino (1995) were the first to report transgenic tobacco plants with

increased IPT levels that did not exhibit developmental abnormalities. The tmr gene

(referred to as IPT in this particular study) was linked to the senescence-specific SAG12

promoter. The SAG12-IPTchimeric gene resulted in an autoregulatory system that was

only activated during initiation of leaf senescence. Because IPT expression was only

activated during senescence, cytokinin levels were maintained at levels similar to wild-









type controls, thus facilitating normal development. In addition, plants transformed with

SAG12-IPT had delayed leaf senescence and prolonged photosynthetic activity when

compared to wild-type control plants. Subsequent research has focused on using the

autoregulatory system developed by Gan and Amasino (1995) to improve agronomic

and horticultural performance in a variety of plant species. Reports indicate successful

use of SAG12-IPTin lettuce (Lactuca sativa L.) (McCabe et al. 2001), petunia (Petunia

x hybrida) (Chang et al. 2003), tomato (Solanum lycopersicum L.) (Swartzberg et al.

2006), alfalfa (Medicago sativa L.) (Calderini et al. 2007), wheat (Triticum aestivum L.)

(Sykorova et al. 2008), and cassava (Manihot esculenta Crantz) (Zhang et al. 2010).

Pathogen Induced Leaf Senescence

As previously discussed, leaf senescence is the final stage of leaf development

when photosynthetic rates are reduced and nutrients are recycled to newly developing

portions of the plant. However, this process can be induced prematurely by a number of

factors, including pathogen infection, which can lead to reduced productivity and yields

(Gan and Amasino, 1995). Premature senescence in response to pathogen infection

may have evolved as a mechanism of defense (Greenberg and Yao, 2004). This

hypersensitive response would be advantageous in limiting pathogen growth and

spread. Although beneficial to the infected plant, early leaf abscission can have

negative effects in an agricultural setting. With fewer photosynthetic structures, fewer

sugars are available for developing organs, and overall yield and productivity will be

reduced. Assuming leaf senescence is induced by a lesion-producing pathogen such as

Cercospora spp., reduced photosynthetic capabilities can be further compounded by the

presence of lesions on the remaining, non-senesced leaves. As previously discussed,

successful efforts have been made to engineer several species of plants with the









SAG12-IPTchimeric gene to delay the onset of leaf senescence. Engineering plants to

retain leaves, even under pathogen attack, could potentially negate some of the

undesirable effects associated with pathogen infection. Preliminary data (M. Jones and

D. Clark, University of Florida) indicated that transgenic petunia expressing SAG12-IPT

had a delayed leaf senescence response (Jandrew, 2002). Transformants also

appeared to develop fewer chlorotic lesions and gained tolerance to petunia leaf spot

disease caused by Cercospora petunia (Jandrew 2002) (Figure 1-1). Similar results

were reported by Swartzberg et al. (2008), in which tomato plants transformed with

SAG12-IPTdisplayed suppressed symptoms (i.e. delayed leaf senescence and reduced

lesion size) of the disease caused by Botrytis cinerea (De Bary) Whetzel.


Figure 1-1. Petunia Leaf Spot (Cercospora petunia) Infection. (A) wild type Petunia,
and (B) SAG12-/PTtransgenic Petunia (Jandrew 2002).









CHAPTER 2
EVALUATING PEANUT CV. FLORIDA-07 FOR LATE LEAF SPOT TOLERANCE

Abstract

Florida-07, a peanut cultivar recently released by the University of Florida, displays

classic symptoms of leaf spot susceptibility, having numerous lesions and heavy

defoliation. However, it still produces good yields. Therefore, one hypothesis is that

Florida-07 possesses tolerance to leaf spot. To test this hypothesis, Florida-07 was

compared to a known leaf spot susceptible cultivar, AP-3, and a known resistant

cultivar, York. Experiments were conducted in Citra, FL in 2008 and Marianna, FL in

2008 and 2009. For all years and locations, late leaf spot (Cercosporidium personatum

(Berk and M. A. Curtis) Deighton) appeared to be the predominant pathogen. The

experimental design was a randomized complete block with a split-plot treatment

arrangement and three replications. Cultivars were assigned to sub-plots and fungicide

treatment (full-season vs. no spray) was assigned to main plots. Data collected included

area under the disease progress curve (AUDPC) for visual leaf spot rating (Florida 1-10

scale), lesion/leaf percentage, lesion density, and lesion growth rate. Following harvest,

pod yield, yield loss to leaf spot, and percent yield loss to leaf spot were calculated. In

regard to visual rating, lesion/leaf percentage, and lesion density, the rate of disease

progression (AUDPC) was the same in sprayed and non-sprayed York, sprayed AP-3,

and sprayed Florida-07. Disease progression was similar in non-sprayed AP-3 and non-

sprayed Florida-07, but at a relatively faster rate compared to the aforementioned

cultivar*treatment combinations. Regardless of cultivar*treatment combination, lesion

growth occurred at the same rate. Based on these data, it was concluded that Florida-

07 and AP-3 possessed the same degree of susceptibility to late leaf spot disease.









Because of its higher yield potential, Florida-07 appeared to overcome the impact of leaf

spot disease in two out of three tests, but in the third test, leaf spot impacted pod yield

of Florida-07 and AP-3 equally. In the two tests in which Florida-07's higher yield

potential became evident, environmental conditions were favorable for the onset and

increased severity of leaf spot disease. Therefore, it was determined that in some

environments, and primarily due to its yield potential, Florida-07 may provide a degree

of "protection" against late leaf spot disease that AP-3 does not possess. However, on

average, Florida-07 does not appear to possess significant tolerance to leaf spot.

Introduction

Early leaf spot [Cercospora arachidicola S. Hori (teleomorph Mycosphaerella

arachidi Deighton)] (ELS) and late leaf spot [Cercosporidium personatum (Berk and M.

A.Curtis) Deighton (teleomorph Mycosphaerella berkeleyi Jenk)] (LLS) diseases are the

most widespread foliar diseases of peanut. Both ELS and LLS diseases can be found

wherever peanut is grown, making them among the most significant peanut diseases

(Zhang et al. 2001). ELS and LLS diseases are characterized by necrotic flecks that

enlarge to necrotic lesions that reduce light interception and photosynthesis (Boote et a.

1983). The reduction in photosynthetic leaf area is the primary factor associated with

loss of yield in peanut. If fungicides are not used, pod yields can be reduced by as much

as 50% in diseased plants (Zhang et al. 2001). Early defoliation is also associated with

both types of leaf spot infection.

Currently, management strategies for controlling leaf spot epidemics rely heavily

on crop rotation or on reducing the rate of disease spread via resistant cultivars and

regular applications of foliar fungicide (Zhang et al. 2001). Although leaf spot resistant

cultivars are commercially available, the degree of protection in these cultivars is









incomplete and still allows for a significant amount of damage. Previous studies have

shown that partial resistance is due to the interaction of multiple components that

additively produce varying degrees of resistance. Cultivars exist with partial resistance,

but there has been no complete or single-gene resistance to C. arachidicola or C.

personatum reported in cultivated peanut. Components of resistance that have been

identified include, infection frequency (dependent on density of inoculum), incubation

period (time from inoculation to appearance of symptoms), latent period (time from

inoculation to first sporulating lesion), lesion size, necrotic leaf area, spore production,

and defoliation time (Dwivedi et al. 2002; Cantonwine et al. 2008). Components of

resistance have been reported for early and/or late leaf spot for several cultivars tested

under field and greenhouse conditions (Chiteka et al. 1988a; Cook 1981; Foster et al.

1980; Green and Wynne 1986; Melouk and Banks, 1984; Ricker et al. 1985;

Subrahmanyam et al. 1982; Walls et al. 1985; Watson et al. 1998). Among the identified

resistance components, no one component has emerged as the primary mechanism for

resistance in leaf spot resistant cultivars (Cantonwine et al. 2008).

Florida-07 (released by the University of Florida in 2006) (Gorbet and Tillman,

2009) is a medium-late maturing (~140 day) Runner market-type peanut. Release of

Flordia-07 was made on the basis of its excellent pod yield potential, competitive kernel

grade, high-oleic fatty acid chemistry, and resistance to tomato spotted wilt topovirus

(TSWV) and white mold (Gorbet and Tillman, 2009). In addition to the aforementioned

characteristics, in non-sprayed preliminary field trials, under high leaf spot pressure,

Florida-07 consistently produced higher yields than other test varieties. However,

Florida-07 still displayed classic symptoms of leaf spot disease, i.e. high lesion









coverage and pre-mature defoliation. Florida-07 seemed to possess the ability to

sustain the effects of leaf spot disease without dying or suffering serious injury or crop

loss. Therefore, it was hypothesized that Florida-07 possessed tolerance to leaf spot

disease. The purpose of this study was to confirm/characterize Florida-07 as a leaf spot

tolerant cultivar and to identify a mechanism of tolerance. Currently, there are no

reported formal field evaluations testing Florida-07's tolerance to ELS and LLS

diseases.

AP-3 (University of Florida, 2003) is a medium-late maturing (~140 days) Runner

market-type peanut. AP-3 was released because of its excellent resistance to tomato

spotted wilt topovirus (TSWV) and Sclerotium rolfsii (white mold). The cross that

produced AP-3 was made primarily to produce material to select for resistance to white

mold and Cylindrocladium black rot (CBR caused by Cylindrocladium parasiticum)

(Gorbet 2007). Despite AP-3's resistance to other fungal pathogens of peanut, AP-3 is

very susceptible to early and late leaf spot diseases. Without fungicide treatment, AP-3

has high lesion coverage and premature defoliation, which results in reduced yields.

York (University of Florida, 2006) is a late maturing (~150 days) runner market-

type peanut. York has excellent disease resistance to TSWV, white mold, and leaf spot

diseases. Under intense leaf spot pressure, lesion coverage on York is minimal and is

often isolated to the uppermost portion of the canopy. Defoliation in leaf spot infected

York is also minimal. Because of the observed resistance to leaf spot in York, fungicide

application recommendations allow for a reduced regime when York is grown in a good

crop rotation.









In this study, Florida-07 was compared to AP-3, a known leaf spot disease

susceptible cultivar, and York, a known leaf spot disease resistant cultivar, in sprayed

and non-sprayed field plots across multiple locations and years. Foliar leaf spot disease

progression rates and yield were examined to classify Florida-07 as susceptible,

tolerant, or resistant.

Materials and Methods

Experimental Design

Peanut cultivars for this study included AP-3 (Gorbet, 2007a), Florida-07, and York

(released by the University of Florida in 2006) (Table 2-1). The three genotypes were

planted on 20 May 2008 at the Plant Science Research & Education Unit located in

Citra, FL. Soil type in Citra, FL is Tavares sandy loam. The Citra, FL test site was

previously planted with bahiagrass for the three years prior. A duplicate test was planted

on 3 June 2008 and 20 May 2009 at the North Florida Research and Education Center

located in Marianna, FL. Soil type in Marianna, FL is Chipola sandy loam. The

Marianna, FL test site was previously planted with a cotton and corn rotation. Test site

locations can be seen in Figure 2-1. With the exception of fungicide applications,

cultural and management practices followed the standard UF/IFAS Extension

recommendations for irrigated peanut.

The experimental design was a randomized complete block with a split-plot

treatment arrangement; fungicide treatment was assigned to the main plot and cultivar

was assigned to the sub-plot. Plot dimensions were two rows, 4.5 m in length, with row

centers set at 91 cm apart. Seed were sown at a rate of six seeds per 31 cm (90-100

seeds per row) using conventional tillage practices. Border rows of C99-R and Florida-

07 were located on each side of the plots to maintain disease inoculum and to prevent









spray-drift from affecting adjacent plots in 2008 and 2009, respectively. Plots were

replicated three times at each test site and two spray regimes were used as treatments

(NS = no fungicide treatment, S = standard commercial fungicide treatment). Plots

receiving the standard commercial treatment were sprayed with chlorothalonil,

tebuconazole, pyraclostrobin, and azoxystrobin bi-weekly beginning 30 DAP (Table 2-

2).

In Citra, fungicides were applied using a C02 backpack sprayer and hand-held

boom with five nozzles, spaced 51 cm apart. Boom width (swath) allowed for complete

coverage of peanut plants for the entire two-row plot. The sprayer was calibrated to

deliver 327 L ha-1. In Marianna, fungicides were applied using a Hi-Boy, 12-row sprayer

with flat fan nozzles. Boom width allowed for coverage of the entire treated range of test

plots. The sprayer was calibrated to deliver 206 L ha1.

Disease Assessment

Disease assessment began at the first sign of leaf spot symptoms and continued

weekly until harvest. Identification of the pathogen causing disease was determined in

the field using a 60X-100X, handheld microscope. In this study, late leaf spot was the

predominant pathogen. Disease assessment for AP-3 and Florida-07 lasted a period of

four weeks and six weeks for York. For all years and locations, leaf spot symptoms first

appeared in early-September.

Qualitative, visual evaluations were made in the field using the Florida 1-10 leaf

spot scale as described by Chiteka et al. (1988b) (Table 2-3). Use of the Florida 1-10

rating scale allowed for the assessment of whole plot response to leaf spot pressure

(lesion coverage and defoliation amount).









Lesion percentage, lesion density, and average lesion size were quantified using

APS Assess 2.0 image analysis software (American Phytopathological Society). Forty

compound leaves (approximately 160 leaflets) were randomly collected from each plot

weekly, scanned, and imported into APS Assess 2.0 as JPEG images (Figure 2-3).

Default settings were applied to determine total leaf and lesion area, lesion percentage

and lesion frequency for each plot. Using the total leaf and lesion area and lesion

frequency data, lesion density (lesions cm-2) and average lesion area (mm2) were

calculated.

Area Under the Disease Progress Curve (AUDPC)

Area under the disease progress curve (AUDPC) was calculated as the total area

under the graph of disease severity (Florida 1-10 rating, lesion/leaf percentage, lesion

density, and lesion growth rate) against time (weekly evaluation from early-September

through harvest), from the first scoring to the last:


AUDPC = Li_2+ Li) (ti t1 )]
i (2-1)

where, tj = days after planting (time) and Li = severity rating

Harvest and Pod Yield

Harvest dates were determined by maturity group and leaf spot severity. Plots with

severe leaf spot pressure (high lesion coverage and high defoliation) were harvested

early (plots receiving a rating 2 8 on the Florida 1-10 scale) to avoid substantial yield

loss. Digging was accomplished with a two-row digger/inverter. Pod yields were

determined by threshing all plants in a plot with a stationary thresher and weighing the

pods after the seeds had dried to 9-10% moisture content. In addition to pod yields,









yield loss to LLS disease (S NS), and percent yield loss to LLS disease ((S-NS) / S)

were determined for each plot.

Environmental Conditions

Environmental conditions for each year and location were determined from various

weather components (maximum (max.) temperature, minimum (min.) temperature,

percent relative humidity (%RH)) obtained from the Florida Automated Weather Network

(FAWN). Both test locations had FAWN stations on site. For temperatures (max/min)

and %RH, daily averages were collected beginning 70 DAP and continued until harvest

for each test site. Daily leaf spot hours were calculated for each year and location. A

leaf spot hour was defined as one hour with relative humidity greater than or equal to

90% and temperatures between 16C and 300C. Beginning 70 DAP and continuing

through harvest dates, hourly average temperature and %RH data were collected. Leaf

spot hours accounted for the amount of time in a given day which provided conditions

that were most conducive to the rapid development and increased severity of leaf spot

diseases.

Statistical Analysis

Analysis of variance was carried out on the means for each AUDPC and pod yield

per plot using the Mixed Model procedure (PROC Mixed) in SAS software (SAS

Institute, 2000). Fungicide treatment and cultivar were considered fixed effects whereas

year and replication and their interactions were considered random effects. Statistical

significance was determined at P<0.05 according to Tukey's HSD mean separation test.

Disease Response Classification

Classification of cultivar disease response was based on descriptions reported in

Agrios (2005) for resistance, tolerance, and susceptibility:









Resistance the ability of an organism to exclude or overcome, completely or in some
degree, the effect of a pathogen or other damaging factor.

Tolerance the ability of a plant to sustain the effects of a disease without dying or
suffering serious injury or crop loss.

Susceptibility the inability of a plant to resist the effect of a pathogen or other
damaging factor; non-immune.

Results and Discussion

Citra 2008

Disease progression. In Citra 2008, foliar lesions were first noted during the first

week of September. Unless otherwise noted, cultivar*treatment was significant for each

measure of disease progression.

In terms of whole plot response (Florida 1-10 rating) and lesion percentage,

Florida-07 and AP-3 were equally susceptible to LLS. AUDPC for the Florida 1-10 rating

indicated that disease progression was most rapid in NS AP-3 (5.2 0.3 rating*time),

followed by NS Florida-07, S Florida-07 (4.5 0.3 rating*time and 4.4 0.3 rating*time),

then S AP-3, NS York (3.9 0.3 rating*time), and finally S York (2.0 0.3 rating*time)

(Figure 2-4A). Likewise, in respect to lesion percentage, Florida-07 and AP-3 were

equally susceptible to LLS. Cultivar was the only significant main effect for necrotic

lesion percentage. In this test, AUDPC means for percent lesion coverage increased at

the same rate for AP-3 and Florida-07 (14 1.1 %*time and 16.4 1.1%*time,

respectively), but more rapidly than for York (3 1.1 %*time) (Figure 2-4B).

In terms of lesion density, LLS progression was most rapid in NS Florida-07 (4.8 +

0.2 lesions cm-l*time), followed by S Florida-07, NS AP-3, and S AP-3 (3.9 0.2 lesions

cm-2*time, 3.6 0.2 lesions cm-2*time, and 3.4 0.2 lesions cm-2*time, respectively).

Disease progression was slowest on NS York and then S York (1.8 0.2 lesions cm









2*time and 0.6 0.2 lesions cm-l*time, respectively) (Figure 2-4C). These results

suggest that LLS lesions may develop more rapidly on Florida-07 than AP-3, meaning,

in terms of foliar lesion density, Florida-07 may be more susceptible to LLS.

Rate of lesion growth was not affected by treatment, cultivar, or cultivar*treatment

interaction. Lesion size increased at the same rate on all cultivars and treatments

(Figure 2-4D).

Yield Response. Treatment, cultivar, and cultivar*treatment effects were

significant (p>F = <0.0001, p>F = <0.0001, and p>F = 0.0007, respectively). In Citra

2008, yield response for cultivar*treatments occurred as expected under high LLS

pressure. Characteristic of a leaf spot resistant cultivar, York produced the same yields

under LLS pressure in the S and NS treatments (2429 kg ha-1 and 2320 kg ha1,

respectively) (p>t = 0.6527). AP-3, a known susceptible under LLS pressure, yielded

much higher in the S treatment than the NS treatment (4452 kg ha- and 2461 kg ha1,

respectively) (p>t = <0.0001). Likewise, S Florida-07 yielded higher than NS Florida-07

under LLS pressure (4806 kg ha-1 and 3722 kg ha-1, respectively) (p>t = 0.0009).

Despite AP-3 and Florida-07's similarity in yield response to treatments, if yields of NS

AP-3 and NS Florida-07 are compared, then NS Florida-07 yielded more than NS AP-3

(P > t =0.0003). Similarly, AP-3's yield loss to LLS (S NS) was more than that lost by

Florida-07(1991 kg ha-1 and 1084 kg ha-1, respectively) (P > t =0.0524). However, when

the yields lost to LLS are normalized to percentage values ((S NS) / S), AP-3 and

Florida-07 lost the same percent value of their yield (44.8% and 22.3%, respectively) (P

> t =0.1698) (Table 2-4). However, if one compares cultivar alone, regardless of

treatment, Florida-07 yielded higher than AP-3 (p








yield in the absence of leaf spot disease may be the reason Florida-07 appeared to

display tolerance to the disease in preliminary studies.

To summarize the Citra 2008 test, disease progression in whole plot evaluations

and percent lesion coverage suggest that Florida-07 and AP-3 are equally susceptible o

LLS. However, higher lesion frequencies developing over time indicate that Florida-07 is

more susceptible to LLS. Comparison of Florida-07 and AP-3 yields show that Florida-

07 has the potential to produce higher yields even under high LLS pressure. Florida-

07's ability to produce high yields even under pathogen attack (i.e. high lesion density)

suggests that it possesses a degree of tolerance to LLS. However, upon normalizing

yield data, it becomes clear that Florida-07 did not display tolerance to LLS, but instead

had a higher yield potential. Although Florida-07 did not display tolerance as defined by

Agrios (2005) in this test, its higher yield potential did provide a degree of protection to

final yield.

No other fungal diseases were observed in Citra 2008. However, insect pest

pressure was high late in the season. An unknown species of leafhopper caused a fairly

large reduction in canopy density. Reduction in canopy density might have contributed

to reduced photosynthetic rates, which could have potentially impacted final yields.

However, because damage occurred late in the season (occurring just prior to harvest

of Florida-07 and AP-3 plots), it was determined that this reduced canopy density likely

did not affect yields.

Marianna 2008

Disease progression. In Marianna 2008, foliar lesions were first noted during the

second week of September. Cultivar*treatment interaction was significant main effect for

each measure of disease progression unless otherwise noted.









AUDPC for the Florida 1-10 scale and lesion density indicated that LLS disease

progression was more rapid in Florida-07 than for AP-3. AUDPC for Florida 1-10 ratings

was most rapid on NS Florida-07, followed by NS AP-3, and then NS York (5.4 0.3

rating*time, 4.4 0.3 rating*time, and 2.7 0.3 rating *time, respectively). S Florida-07

and S AP-3's disease progression were the same (1.8 0.3 rating*time and 0.3 1.7

rating*time, respectively), followed by disease progression in S York (1.0 0.3

rating*time) (Figure 2-5A). Likewise, the rate at which lesion density increased

throughout the season was most rapid for NS Florida-07, followed by NS AP-3, and

then NS York (4.0 0.2 lesions cm-l*time, 3.3 0.2 lesions cm-l*time, and 2.1 0.2

lesions cml*time, respectively). Disease progression as a measure of lesion density

was equal in S Florida-07, S York, and S AP-3 (0.8 0.2 lesions cm-2*time, 0.7 0.2

lesions cm-2*time, 0.6 0.2 lesions cm-2*time, respectively), but occurred at a slower

rate than observed in the previously mentioned cultivar*treatments (Figure 2-5C).

Percent necrotic lesion indicates that disease progression was equal in NS

Florida-07 and NS AP-3, followed by NS York (15.2 0.7 %*time, 14.2 0.7 %*time,

and 5.6 0.7 %*time, respectively). S Florida-07, S AP-3, and S York were equal in rate

of disease progression (2.8 0.7 %*time, 2.3 0.7 %*time, and 1.9 0.7 %*time), but

rates were slower than those observed in the aforementioned cultivar*treatments

(Figure 2-5B). Under high LLS pressure, Florida-07 and AP-3 were equally susceptible.

Rate of lesion growth was not affected by treatment, cultivar, or cultivar*treatment

interaction. Lesion size increased at the same rate on all cultivars and treatments

(Figure 2-5D).









Yield response. In Marianna 2008, treatment and cultivar*treatment interaction

affected pod yield (p > F = <0.0001 and p > F = 0.0106, respectively). S cultivars

yielded more than their NS counterparts. NS AP-3 and NS Florida-07 produced equal

yields (2790 kg ha-1 and 2786 kg ha-1, respectively) (p > t = 0.9841). AP-3 and Florida-

07's yield lost to LLS were also equal (1811 and 1648, respectively) (p > t = 0.5397), as

well as percent yield lost to LLS (39.4% and 37.2%, respectively) (p > t = 0.7109) (Table

2-5). Based on AP-3 and Florida-07 having equal yield under LLS pressure, yield lost to

LLS, and yield percentage lost to LLS, it was determined, in terms of yield response,

that Florida-07 did not display tolerance to LLS in Marianna 2008, and was equally

susceptible to LLS as AP-3.

To summarize the Marianna 2008 test, yields under LLS pressure, yield lost to

LLS, and percent yield lost to LLS suggest that Florida-07 and AP-3 are equally

susceptible to LLS. The higher yield potential observed in Citra 2008 test was not

observed in the Marianna 2008 test. Compared to Citra 2008, in Marianna 2008,

Florida-07 was more susceptible to LLS than AP-3, having more rapid disease

progression with respect to the Florida 1-10 rating and lesion density. The more rapid

disease progression in Florida-07 may explain why a higher yield potential was not

observed in this test.

In addition to LLS, the only other fungal disease observed was a small amount of

rust in the 2008 Marianna test site. Signs of rust were not observed until three days

prior to harvest and were found on only non-treated plots. Because of the extremely late

onset and very small amount of rust found, it was determined that its presence was









negligible and had no impact on the result of the test. LLS disease was the greatest

yield reducing factor in this study.

Marianna 2009

Disease progression. In Marianna 2009, foliar lesions were first noted during the

second week of September. Cultivar*treatment interaction affected each measure of

disease progression unless otherwise noted.

Disease progression, in terms of Florida 1-10 rating, was most rapid in NS Florida-

07 and NS AP-3 (3.5 0.2 rating*time and 3.4 0.2 rating*time, respectively). Disease

progression rate was the same for NS York, S Florida-07, S AP-3, and S York (2.3 0.2

rating*time, 2.1 0.2 rating*time, 2.0 0.2 rating*time, and 2.0 0.2 rating*time,

respectively), but at a slower rate than the previously mentioned cultivar*treatments

(Figure 2-6A). Under high LLS pressure, in terms of the Florida 1-10 rating, Florida-07

and AP-3 were equally susceptible.

The rate of disease percent lesion coverage increased most rapidly in NS Florida-

07 (25.2 2.7 %*time), followed by NS AP-3 (17.6 2.7 %*time). Disease progression

was equal in NS York, S AP-3, S Florida-07, and S York (4.6 2.7 %*time, 3.0 2.7

%*time, 1.7 2.7 %*time, and 1.3 2.7 %*time, respectively), but was at a slower rate

than the aforementioned cultivar*treatments (Figure 2-6B). Based on the results of this

test, in terms of percent lesion coverage, under high LLS disease pressure, Florida-07

was more susceptible to LLS than AP-3. Disease progression, in terms of lesion

density, was most rapid in NS Florida-07(5.6 0.3 lesions cm-2*time), followed by NS

AP-3 (3.9 0.3 lesions cm-2*time). Disease progression was slower in NS York, S AP-3,

S Florida-07 (1.8 0.3 lesions cm-2*time, 1.1 0.3 lesions cm-2*time, and 0.8 0.3

lesions cm-2*time), followed by S York (0.6 0.3 lesions cm-2*time) (Figure 2-6C).









Based on results for percent lesion coverage and lesion density, under high disease

pressure, Florida-07 was more susceptible than AP-3.

Rate of lesion growth was not affected by treatment, cultivar, or cultivar*treatment

interaction. Lesion size increased at the same rate on all cultivars and treatments

(Figure 2-6D).

Yield response. In Marianna 2009, pod yield varied by treatment and cultivar

were significant main effects (P > F = 0.0166 and P > F = 0.0146, respectively). The

difference in yield for S plots and NS plots was significant (3833 kg ha-1 and 3098 kg ha-

1, respectively) (P > t = 0.0166). Florida-07 yielded (4122 kg ha-1) higher than AP-3

(3082 kg ha-1) (P > t = 0.0078), as well as York (3193 kg ha-1) (P > t = 0.0142). AP-3

and York's yields were equal (P > t = 0.7311) (Table 2-6). As in the Citra 2008 test, in

this test, Florida-07 produced higher pod yields than AP-3 (averaged over S and NS

treatment, which indicates that Florida-07 possesses a higher genetic yield potential

rather than tolerance to LLS).

To summarize the Marianna 2009 test, disease progression rate as measured by

lesion percentage and lesion density showed that Florida-07 was more susceptible to

LLS than AP-3. Despite foliar symptoms developing more rapidly in Florida-07 than AP-

3, Florida-07's yields were higher than yields in AP-3. Florida-07 under higher disease

pressure than AP-3 and possessing the ability to produce higher yields suggests that

Florida-07 may have a degree of tolerance to LLS. However, this discrepancy Florida-

07 and AP-3 yields is probably better explained by differences in genetic yield potential

as was observed in the Citra 2008 test.









All Years*Locations

Disease progression. Foliar lesions appeared in early September for all tests.

Cultivar*treatment interaction was significant for each measure of disease progression

unless otherwise noted.

On average, means for AUDPC for the Florida 1-10 rating, lesion percentage, and

lesion density indicate that Florida-07 and AP-3 are equally susceptible to LLS disease.

In terms of the Florida 1-10 rating, disease progression was most rapid in NS Florida-07

and NS AP-3 (5.7 rating*time and 5.7 rating*time, respectively). Disease progression

was slower and equal on S AP-3, S Florida-07, NS York, and S York (3.6 rating*time,

3.2 rating*time, 3.0 rating*time, 2.0 rating*time, respectively) (Figure 2-7A). Disease

progression, as measured by lesion percentage, was most rapid for NS Florida-07 and

NS AP-3 (24.6%*time and 20.3%*time, respectively). Disease progression was slower

and equal on NS York, S Florida-07, S AP-3, and S York (9.5%*time, 7.4%*time,

7.3%*time, and 6.4%*time, respectively) (Figure 2-7B). Increase in lesion density

throughout the season was most rapid in NS Florida-07 and NS AP-3 (6.0 lesions cm

l*time and 4.6 lesions cm-'*time, respectively). Disease progression occurred at a

slower, but similar rate in NS York, S Florida-07, S AP-3, and S York (3.1 lesions cm

2*time, 2.4 lesions cm-2*time, 2.3 lesions cm-2*time, 2.1 lesions cm-2*time, respectively)

(Figure 2-7C).

As in all individual tests, lesion growth rate was equal in all treatments and

cultivars. No main effects were significant (Figure 2-7D).

Yield response. On average, in terms of yield, cultivar*treatment interaction was

the only significant main effect (P > t = 0.0001). Yields under LLS pressure for S

Florida-07 and S AP-3 were equal (4734 kg ha-1 and 4092 kg ha-1, respectively) (p>t =









0.2688). Likewise, yields under LLS pressure for NS Florida-07 and NS AP-3 were

equal (3556 kg ha-1 and 2527 kg ha-1, respectively) (P > t = 0.0803). Yield lost to LLS

were equal for Florida-07 and AP-3 (1177 kg ha- and 1564 kg ha-1, respectively) (p>t =

0.1563), as well as percent yield lost in Florida-07 and AP-3 (23.5 and 34.9,

respectively) (P > t = 0.0894). S York and NS York's yields under LLS pressure were

the same (2976 kg ha-1 and 2663 kg ha-1, respectively) (P > t = 0.2729), as is expected

by a resistant cultivar (Table 2-7). York's yield lost to LLS and percent yield lost to LLS

was less than those for Florida-07 and AP-3.

On average, Florida-07 displayed no tolerance to LLS. Disease progression was

equal in Florida-07 and AP-3. The yield under LLS pressure for NS AP-3 and NS

Florida-07 was the same. Likewise, the yield lost to LLS and the difference of percent

yield loss between AP-3 and Florida-07 was the same (P > t = 0.1563 and P > t =

0.0894, respectively). However, these values approach statistical significance and it is

possible that with additional testing, responses of Florida-07 and AP-3 would separate.

Environmental Conditions

In an effort to explain the highly variable yield response under high LLS pressure

and to determine disease pressure, environmental data were collected using the Florida

Automated Weather Network (FAWN). Environmental conditions required for rapid

development and increased severity of LLS are warm temperatures and long periods of

high humidity or leaf wetness. Differences in test site environment were determined by

observing average daily leaf spot hours, percent relative humidity, and min/ max

temperatures.

On average, Marianna 2009 had more daily leaf spot hours (12.1 hrs day-)

compared to Marianna 2008 or Citra 2008 (9.2 hrs day-land 10.2 hrs day1,









respectively). However, when analyzing individual components which comprise leaf spot

hours, it appeared that Citra 2008 (80.7%, 20.9C/32.1C) and Marianna 2009 (83.5%,

20.4C/31.8C) had higher and warmer daily high/low temperatures when compared to

Marianna 2008 (77.2%, 19.4C/88.1 F) (Table 2-8). Overall, Citra 2008 and Marianna

2009 provided an environment more conducive to the rapid development and increased

severity of LLS disease.

Conclusions

Limited research has been conducted to identify and characterize tolerance as a

mechanism for overcoming LLS disease (Pixley et al 1990). Previous research has

primarily focused on identifying sources of resistance to leaf spot disease in peanut.

Although resistant cultivars are available, many of these are derived from a similar

genetic lineage and have several undesirable characteristics associated with their

resistance, i.e. late maturity, large seeded, and poor germination (Morton, 2007).

Tolerance provides an alternative to the limited genetic resistance available in cultivated

peanut.

Based on the rate at which foliar disease symptoms progressed over time, it was

concluded, that under high LLS pressure, AP-3 and Florida-07 showed the same

degree of susceptibility. However, in specific tests and measurements of foliar disease

progression, Florida-07 did appear to be more susceptible to LLS than AP-3. In all tests,

the rate of lesion growth was equal for all treatments and cultivars tested. This result is

likely due to the limited rate at which hyphae of C. personatum can grow and penetrate

new tissue.

Yield response suggests that Florida-07 has a higher genetic yield potential than

either York or AP-3. In this study, York yields were low due to poor germination which









led to poor plant stands. However, research has shown that when germination in York is

high, yields were competitive with Florida-07. On average, Florida-07 did not display

tolerance to LLS. However, in two of the three tests, pod yield of Florida-07 was greater

than that of AP-3. The higher pod yield of Florida-07 is what led to it being mistakenly

classified as a possible leaf spot tolerant cultivar. In this study, because of its higher

yield potential, Florida-07 appeared to overcome the impact of leaf spot disease in two

out of three tests, but in the third test, leaf spot impacted pod yield of Florida-07 and AP-

3 equally.

However, Citra 2008 and Marianna 2009, the two tests in which Florida-07's

higher yield potential became evident, had weather conditions were more conducive for

the rapid development and increased severity of LLS. In an environment where rapid

growth and development of leaf spot likely occurred, Florida-07 proved to be more

resilient to LLS. Although Florida-07 does not fit the definition of tolerance described by

Agrios (2005), it does provide a degree of protection for a grower by producing higher

yields than other cultivars.

Based on this evidence, it was concluded that Florida-07 did not display tolerance

to LLS disease. Therefore, no tolerance mechanisms were identified. However,

compared to other LLS susceptible cultivars, Florida-07 possesses a high yield potential

which can act as an "insurance policy" to growers.













Citra, FL

1. Jackson
2. Santa Rosa
3. Levy
4. Escambia
5. Marion
6. Okaloosa
7. Alachua
8. Calhoun
9. Holmes


Figure 2-1. Florida is divided into three peanut growing regions. Counties highlighted in
yellow are ranked (1 9) by the acreage planted in peanut. Experimental
locations, Marianna and Citra, are indicated on the map (modified from
Mossier and Aerts, 2007).









Table 2-1. F
Cultivar
York








AP-3







Florida-07


Peanut cultivar descriptions.


-University of Florida, 2006
-89 x OL24-3-1-2-2-b2-B x C99-R
-Runner-type
-Late maturing (-150 days)
-High-oleic chemistry, resistance to TSWV & white mold
-If not sprayed to prevent LS = defoliation and lesion coverage minimal, lesions confined to upper
canopy (moderate resistance) reduced fungicide regime

-University of Florida, 2003
-OKFH15 x NC3033
-Runner-type
-Medium-late maturing (-140 days)
-High-oleic chemistry, resistance to TSWV and white mold
- If not sprayed to prevent LS = high lesion coverage, premature defoliation, reduced yields

-University of Florida, 2006
-89 x OL14-11-1-1-1 -b2-B x C99-R
-Runner-type
-Medium-late maturing (-140 day)
-High-oleic chemistry, resistance to TSWV & white mold
- If not sprayed to prevent LS = high lesion coverage, premature defoliation, yields higher than other
susceptible cultivars












(A) (B) (C)




Figure 2-2. Typical late-season, lateral-branch leaflet lesion coverage under high late
leaf spot pressure on (A) York, (B) AP-3, and (C) Florida-07 peanut cultivars
in Citra, Florida 2008 and Marianna, Florida 2008 and 2009.








Table 2-2. Standard commercial fungicide spray treatments applied in Citra, Florida
2008 and Marianna, Florida 2008 and 2009. Treatments began approximately
30 days after planting and continued bi-weekly.
Commercial Name (rate ml ha-1)

Treatment Citra 2008 Marianna 2008 & 2009

1 Bravo Weatherstik1 (1753) Bravo Weatherstik1 (877)

2 Bravo Weatherstik1 (1753) Bravo Weatherstik1 (877)

3 Headline2 (296) Bravo Weatherstik1 (877)
Tebustar4 (213)

4 Abound3 (532) Bravo Weatherstik1 (877)
Tebustar4 (213)

5 Bravo Weatherstik1 (877) Abound3 (532)
Folicur4 (213)

6 Bravo Weatherstik1 (877) Headline2 (296)
Folicur4 (213)

7 Bravo Weatherstik1 (1753) Bravo Weatherstik1 (877)

8 Bravo Weatherstik1 (1753)--
Footer denotes active ingredient: 1Chlorothalonil, Pyralostrobin, Azoxystrobin, 4Tebuconazole









Table 2-3. Florida 1-10 leaf spot rating based on Chiteka et al. (1988)
Rating Description

1 No disease

2 Very few lesions (none on upper canopy)

3 Few lesions (very few on upper canopy)

4 Some lesions with more on upper canopy than rank for 3 and slight defoliation noticeable

5 Lesions noticeable even on upper canopy with noticeable defoliation

6 Lesions numerous on upper canopy with significant defoliation (50%+)

7 Lesions numerous on upper canopy with much defoliation (75%+)

8 Upper canopy covered with lesions with high defoliation (90%+)

9 Very few leaves remaining and those covered with lesions (some plants completely defoliated)

10 Plants dead








Leaf Spot Lesion
/_


-Compound Leaf


Leaflet


Figure 2-3. Example of peanut leaf collection for evaluation of late leaf spot disease.
Beginning at the first sign of leaf spot, compound leaves (40 compound
leaves/plot = 160 leaflets) were collected weekly and scanned into APS
Assess 2.0 (American Phytopathological Society) for image analysis. Tests
were conducted in 2008 and 2009 in Citra, Florida and Marianna, Florida.


1 ,F













6 18
I g SFloridO7 NSForka-07 a Forid07
SAP-3 NSAP-3 16 3
5 SYNSYok a, Y 1k a
a, a,b
4 b b 12-
E
C_ 210



22 < 6-
4- b

1 2-


slower Rate of Disease Progression faster slower Rate of Disease Progression faster

C. D.

ggg S Forida07 NS Florida-07 MH S FloridOa-07 NS Florido-07
SAP-3 NSAP-3I a SAP-3 NSAP-3
5 r SYork = NSYork I a4 SYork NSYok
E b
.4 E










slowerRate of Disease Prgression fst sloweRate of Disease Progression faster


Figure 2-4. Progression of late leaf spot disease of peanut based on AUDPC in Citra, Florida 2008 for (A) Florida 1-10
Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth (no significant main effects). Means
with the same letter are not different at the P : 0.05 level.
with the same letter are not different at the P 0.05 level.












A. B.1
N SFSlorid07 M NSFFidn 7 a
ISAP-3 m NSAP3 m SFlorid7 m NSFof7
5 Z SYork NSYo rk 14 SAP-3 NSAP-3
b 1 SYuk NSYAr
12

E 10 -
CO



D 2 d,e
4

2-


slower Rate of Disease Progression sste slower Rate of Disease Progressin faster

C. D.


3 SYork NSYoC. a77 SYork I NSYodt
4- 14
E b












slower Rate of Disease Progression faster slower Rate of Disease Progression faster,


Figure 2-5. Progression of late leaf spot disease of peanut based on AUDPC in Marianna, Florida 2008 for (A) Florida 1-
tOE















10 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth (no significant main effects).
Means with the same letter are not different at the P I 0.05 level.
3 E
o _
-0


o EEA





slower Rate of Disease Progressicm faster slower Rate of Disease Progression rastera


Figure 2-5. Progression of late leaf spot disease of peanut based on AUDPC in Marianna, Florida 2008 for (A) Florida 1-
10 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth (no significant main effects).
Means with the same letter are not different at the P 5 0.05 level.














A. B.
4 30
S Frid7 NS Fid07 a M NS- I-7
SSAP-3 M NSAP N SAP-3 NSF 07
SSYork NSYoa 2- SAP3 NSA3
253- E S ^H N 2 SYNSYWa


I b 20 b
E b E b
b b b --
2 15







slower Rate of Disease Progression faster slower Rate ofDisease Progression faster

C. D.
6 50
S Fborida07 m NS Florid&o7 aS Florlds07 m NS Fkxoid07
o //











5 SYok NSY 0 EZ SYak NSYaxt
'4-


















slower Rate of Disease Progression faster, slower Rate of Disease Progression faster
6 5


















Figure 2-6. Progression of late leaf spot disease of peanut based on AUDPC in Marianna, Florida 2009 for (A) Florida 1-
10 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth (no significant main effects).
Means with the same letter are not different at the P 0.05 level.
0/ A

Cn2-

'C c,d 1



slower Rate of Disease Progression fktr, slower Rate of Disease Progressia faster.

Figure 2-6. Progression of late leaf spot disease of peanut based on AUDPC in Marianna, Florida 2009 for (A) Florida 1-
10 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth (no significant main effects).
Means with the same letter are not different at the P 0.05 level.











A. B.
6 35
-- i SFkwiS07 NSFkida-07 a 3Fbrid07 W NS Forid 07
AP3 NSA3 SAP3 NSAP3
5 ZZ3 NSYsvert 30 S York =3 uNSYork

S25
4 b
bE a
bO b 20
3 b
1 15

2 10



sloWr Rate of Disease Progression fasterslowerRatef sease Progression faster

C. D.
10 5
|g SFbridW07 gm NSFboridW07 = SFbriC07 m NS Fkorid-r07
AP-3 NSAP3 SAP-3 NSAP3




Ei-
s Z77 SYvak -q users 77 sveik E--- NS Yo


8 4









sower Rate of Disease Progressionster slower Rate of Disease Progression faster


Figure 2-7. Progression of late leaf spot disease of peanut based on AUDPC in Citra, Florida 2008 and Marianna, Florida
2008 and 2009 for (A) Florida 1-10 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth
(no significant main effects). Means with the same letter are not different at the P 0.05 level.
(no significant main effects). Means with the same letter are not different at the P <5 0.05 level.









Table 2-4. Peanut pod yield and pod loss to late leaf spot disease in Citra, Florida in
2008.
Yield Under LLS Pressure Yield Lost to LLS
Cultivar Spray (kg ha-1) (kg ha-1) % Yield Lost to LLS
S 4806 + 207 a
Florida-07 4806207 1084 207 b 22.3 9.8 a
NS 3722 207 c
S 4452 + 207 b
AP-3 S 2 1991 207 a 44.8 9.8 a
NS 2461 207 d
S 2429 + 207 d
York S 109 207 c 0.9 9.8 b
NS 2320 207 d
*Each column is a mean SE
**Means within columns followed by the same letter are not different at the P < 0.05

Table 2-5. Peanut pod yield and pod loss to late leaf spot disease in Marianna, Florida
in 2008.
Yield Under LLS Pressure Yield Lost to LLS
Cultivar Spray (kg ha-1) (kg ha-1) % Yield Lost to LLS
S 4434 + 168.29 a
Florida-07 4 16829 1648 168 a 37.2 4.0 a,b
NS 2786 168.29 c
S 4601 + 168.29 a
AP-3 4 68291811 168 a 39.4 4.0 a
NS 2790 168.29 c
S 3823 + 168.29 b
York 6829 878 168 b 22.9 4.0 b
NS 2946 168.29 c
*Each column is a mean SE
**Means within columns followed by the same letter are not different at the P < 0.05









Table 2-6. Peanut pod yield and pod loss to late leaf spot disease in Marianna, Florida
in 2009.
Yield Under LLS Pressure
Cultivar Spray
(kg ha-1)
S 3833 183 a
NS 3098 183 b
Florida-07 4122 223 a
AP-3 3082 223 b
York 3193 223 b
*Only treatment and cultivar were significant main effects.
**Each column is a mean SE
**Means within columns followed by the same letter are not different at the P < 0.05

Table 2-7. Peanut pod yield and pod loss to late leaf spot disease in Citra, Florida in
2008 and Marianna, Florida in 2008 and 2009.
Yield Under LLS Pressure Yield Lost to LLS
Cultivar Spray (kg ha-1) (kg ha-1) % Yield Lost to LLS
S 4734 + 430 a
Florida-07 4734 1177 430 a 23.5 8.9 a
NS 3556 430 b
S 4092 + 430 a,b
AP-3 40 4301564 430 a 34.9 8.9 a
NS 2527 430 c
S 2976 + 430 b,c
York S314 430 b 6.3 8.9 b
NS 2663 430 c
*Each column is a mean SE
**Means within columns followed by the same letter are not different at the P < 0.05









Table 2--8.
Location


Environmental
Year


conditions that impact leaf spot disease of peanut.
%RH Min. Temp. (C) Max. Temp. (C)


Leaf Spot Hrs1 (hrs/day)


Citra 2008 80.7 1.3 b 20.9 0.7 a 32.1 0.6 a 10.2 0.5 b

Marianna 2008 77.2 1.3 c 19.4 0.7 b 31.2 0.6 b 9.2 0.5 b

Marianna 2009 83.5 1.3 a 20.4 0.7 a, b 31.8 0.6 a, b 12.1 0.5 a


*Mean SE.
**Means within individual columns followed by the same letter are not different at the P < 0.05.
1Leaf Spot Hrs = 1 hour with percent relative humidity greater than or equal to 90% and temperatures between 16C and
300C.









CHAPTER 3
A DIRECT SHOOT ORAGANOGENESIS SYSTEM FOR U.S. PEANUT CULTIVARS

Abstract

One of the most successful methods for producing transgenic peanut is particle

bombardment of somatic embryos. A major disadvantage of this approach is the time

required to produce mature plants (eight to 12 months). An alternative to lengthy

bombardment and regeneration protocols is Agrobacterium-mediated transformation

employing direct shoot organogenesis. This strategy allows for mature, transgenic

plants to be obtained quickly (three to four months). Peanut cultivars, Florida-07

(Runner), Georgia Green (Runner), Georgia Brown (Spanish), Valencia-A (Valencia),

and VC-2 (Virginia), were selected to represent all four market types. Two types of

cotyledon explants were examined, those that previously had an attached embryo-axis

upon cotyledon separation (explant A) and those that were embryo-axis-free upon

separation (explant B). Explants were placed on shoot induction medium (MS salts, B5

vitamins, 3% sucrose, 0.8% agar, 10 pM 2,4-D, pH 5.8) with N6-benzyladenine (BA)

concentrations ranging from 10 pM 80 pM for Florida-07, Georgia Green, and VC2, 10

pM 320 pM for Georgia Brown, and 10 pM 640 pM for Valencia-A. Following a four-

week culture period, explants were visually rated based on a scale of 1 to 4, where 1

indicated slight greening, but no growth; 2 indicated greening, with callus-like growth,

but no adventitious bud formation; 3 indicated greening and adventitious bud formation;

and 4 indicated greening, adventitious bud formation, as well as small leaflet expansion.

A difference in shoot induction was observed for the cotyledon explants examined (P > t

= <0.0001). Explant A had greater shoot induction with a visual rating of 1.8 0.1, while

explant B had a rating of 1.6 0.1 (P > t = <0.0001). Additionally, cultivars responded









to the culture conditions differently (cultivar BA interaction). Georgia Green on 10 pM

BA produced the most shoot buds (24.6%) and the highest visual rating (2.1), followed

by VC2 on 10 pM BA (22.1%, 1.8), Valencia-A on 640 pM BA (21.4%, 1.8), Georgia

Brown on 80 pM BA (9.0%, 1.7), and Florida-07 on 40 pM BA (7.1%, 1.8). Of the tested

varieties, Georgia Green, Valencia-A and VC2 were best suited for future transformation

experiments based on their shoot bud production.

Introduction

Peanut production and its associated industries are important to the overall

economic prosperity of many rural areas in the southeastern U.S. The peanut industry

generates approximately $4 billion annually for the U.S. economy. Throughout the

growing season, peanut growers are faced with many biotic and abiotic threats that can

lower yields and ultimately profit. Presently, conventional breeding is the primary means

to overcome these threatening factors. Through use of conventional breeding

techniques, both cultivated and wild Arachis species have been used to develop

agronomically superior cultivars. However, conventional breeding is a slow and difficult

endeavor due to reproductive barriers, failure of interspecific crosses, and transfer of

undesirable traits. Recently, there has been an increased interest in using genetic

transformation to circumvent some of the problems associated with traditional breeding.

Although several studies report the successful transformation of peanut, no single

protocol has proven to be highly efficient in the number of transgenic lines recovered.

Furthermore, many of the studies used lengthy somatic embryogenesis protocols

requiring eight to 12 months to generate mature plants. This inefficient use of time and

poor in vitro conversion into whole, mature, seed-bearing plants, has led to the









investigation of alternative organogenesis protocols that can be successfully used in

Agrobacterium transformation studies.

Sharma and Anjaiah (2000) reported an efficient method (> 90%) for the

production of adventitious shoot buds using mature seed explants on MS medium

(Murashige and Skoog, 1962) supplemented with 20 pM N6-benzyladenine (BA) and 10

pM 2,4-dichlorophenoxyacetic acid (2,4-D). Combinations of BA (2.5, 5.0, 7.5, 10.0,

15.0, 20.0, 25.0 pM) and 2,4-D (1.0, 2.5, 5.0, 7.5, 10.0, 15.0, 20.0 pM) were tested with

six Indian cultivars belonging to the Spanish (JL-24, J-11, ICGS-11) and Virginia

(Robut-3-11, ICGS-76, ICGS-44) market types. These six peanut varieties produced

shoot buds with high frequencies (80.0 97.7%) and followed a similar pattern of

growth and development on each medium formulation. Shoot proliferation appeared to

be most dependent upon BA concentration. Of the six test cultivars, Sharma and

Anjaiah (2000) reported that JL-24 performed the best. JL-24 is a cultivar widely grown

in India, but is not readily available in the U.S. The goal of this research was to optimize

direct shoot organogenesis culture conditions for use with readily available, regionally,

and economically important U.S. cultivars (Georgia Green, Florida-07, Georgia Browne,

VC-2, and Valencia-A). It was hypothesized that the direct shoot organogenesis

protocol described by Sharma and Anajaiah (2000) could be optimized for U.S. peanut

cultivars representing each market type.

Materials and Methods

Cultivar Selection

Peanut cultivars representing the four market types were evaluated for their

potential for in vitro direct shoot organogenesis from cotyledon explants. Florida-07

(Gorbet and Tillman, 2009) and Georgia Green (Branch, 1996), Runner market types,









were selected because the former was a recent release by the University of Florida with

many agronomically favorable traits, including high oleic chemistry, and the latter was,

until recently, the most widely grown cultivar in the U.S. Georgia Browne (Branch,

1994), a Spanish market type, was selected based on its availability, and because it is

one of a very few Spanish types grown in the southeastern U.S. Valencia-A (His et al.

1972), a Valencia market type, was selected because of its successful use in previous

transformation studies (Cheng et al. 1996, 1997; Egnin et al. 1998; Eapen and George

1994; Li et al. 1997). VC-2 (AgraTech Seed, Golden Peanut Company, LLC), a Virginia

market type, was selected because it is widely cultivated in the Virginia-Carolina U.S.

peanut growing region.

Explant Preparation

The direct shoot organogenesis protocol used followed that described by Sharma

and Anajaiah (2000) with modifications described below. For all experiments, prior to

use, mature seeds were surface-sterilized by soaking in 70% ethanol for 1 min.,

followed by a wash for 10 min in 0.1% (w/v) mercuric chloride solution. Following this

wash, seeds were rinsed five times in sterile-distilled water and then allowed to soak in

sterile-distilled water for four hrs before further use. With forceps and under aseptic

conditions, seed coats were carefully removed. Cotyledons were separated into two

halves. The cotyledon half containing the embryo axis was designated as "cotyledon A",

while the cotyledon without the embryo axis was designated as "cotyledon B". Using a

scalpel and forceps, the embryo axis was removed from cotyledon A and discarded.

Both cotyledons were then cut into vertical halves to obtain quartered-cotyledon

explants (Figure 3-1). The proximal, freshly cut edge of each explant was then

embedded into shoot induction medium (SIM; MS salts [Sigma, St. Louis, MO, USA], B5









vitamins, 3% (w/v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar

(Becton, Dickinson and Co., Franklin Lakes, NJ, USA), 10 pM 2,4-

dichlorophenoxyacetic acid (2,4-D) (Sigma, St. Louis, MO, USA), and either 10, 20, 40,

80, 160, 320, or 640 pM N6-benzyladenine (BA) [Sigma, St. Louis, MO, USA], pH 5.8)

at a slight downward angle. Since Sharma and Anjaiah (2000) reported that increased

2,4-D concentrations showed no significant increase in shoot bud formation, 2,4-D

concentrations remained at 10 pM for all media formulations. Four cotyledon explants

(one whole seed) were placed onto 25 mm Petri dishes containing approximately 50 ml

SIM medium.

Experimental Design

Each experiment consisted of 40 cotyledon explants (10 seeds). Cultures were

sealed and allowed to incubate at 26 1 C under continuous light of 100 pEs-1 m-2

irradiance for four weeks. Following the four-week shoot induction period, explants were

evaluated for direct shoot organogenesis (DSO) on a scale of 1 4 for adventitious bud

formation (Figure 3-2). Shoot induction percentage (SI %) was determined for each BA

level*cultivar interaction. SI% represented cultures that were capable of moving into the

shoot elongation phase (percentage of explants receiving a rating of > 2).

Evaluation of Cotyledon Explant Source

Explants from each cultivar were prepared as described above. Cotyledons A and

B were cut in half vertically to obtain quartered-cotyledon explants and placed on culture

plates containing SIM medium. SI% and DSO rating were determined following a four

week culture period.









Evaluation of Shoot induction and Direct Shoot Organogenesis

The five previously mentioned cultivars were prepared as described above.

Explants were evaluated for DSO rating and SI% on SIM medium supplemented with

BA at 10 pM (SIM10), 20 pM (SIM20), 40 pM (SIM40), and 80 pM (SIM80). Explant

response was evaluated following a four-week culture period. For cultivars that

responded with a strong linear trend within the 10-80 pM BA range, BA concentrations

were increased until a quadratic (normal) distribution was observed. The assumption

was that shoot induction response should fit a normal distribution, with optimal response

being at the peak of the quadratic curve. Consequently, BA levels for Georgia Green

were tested at 160 pM (SIM160) and 320 pM (SIM320), while BA levels for Valencia-A

were tested at 160 pM, 320 pM, and 640 pM (SIM640). Following a four-week culture

period, explants were evaluated by DSO rating and SI%.

Regeneration of Mature Plants

Explants bearing shoot buds were transferred to shoot elongation medium (SEM;

MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v) sucrose [Fisher Scientific,

Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ,

USA), and 2 pM BA [Sigma, St. Louis, MO, USA], pH 5.8). Elongated shoots were sub-

cultured twice, every four weeks to fresh SEM (or when shoot length was approximately

2-3 cm in length). Elongated shoots were then placed onto root induction medium (RIM;

MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v) sucrose [Fisher Scientific,

Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ,

USA), and 5 pM 1-Naphthaleneacetic acid (NAA) [Sigma, St. Louis, MO, USA], pH 5.8).

Cultures undergoing selection and rooting were maintained at 260C ( 1 C) under

continuous light of 100 pEs-1 m-2 irradiance. Once roots were established, plants were









transferred to pots containing a 2:1 Fafard #2 : sand mixture [Fafard, Agawam, MA,

USA]. Plants were hardened under growth chamber conditions maintained at 26 1C

under a 14 h light to10 h dark regime with the light set to 100 pEs-1 m-2 irradiance.

Plants reaching maturity were moved to the greenhouse and fertilized and irrigated as

needed (Figure 3-3).

Statistical Analysis

SI% was determined for each BA level*cultivar by using the frequency procedure

(PROC Freq) in SAS software (SAS Institute, 2000). Analysis of variance was carried

out on the means for each experimental component (explant type, DSO rating, and

SI%) using the Mixed Model procedure (PROC Mixed) in SAS software (SAS Institute,

2000). Statistical significance was determined at P < 0.05 according to Tukey's HSD

mean separation test.

Results and Discussion

Explant Response

In general, across all cultivars and BA concentrations, explants producing

adventitious shoot buds responded as described by Sharma and Anjaiah (2000), but at

a lower frequency. Sharma and Anjaiah (2000) reported shoot induction frequencies as

high as 95%; the current studies highest incidence of shoot induction was 25%.

However, the appearance of those explants developing shoot buds was similar to that

described in Sharma and Anjaiah (2000). On SIM, explants turned green and underwent

considerable enlargement within the first week of culture initiation. During weeks two

and three, multiple shoot buds formed at the proximal cut end of the explants (Figure 3-

3A).









In the present study, shoot bud induction was tightly confined to the proximal

portion of each explant. Shoot buds developing on the proximal end of the explants

were small and too numerous to count (Figure 3-3B). Tiwari et al. (2009) reported a

similar response and counted up to 100 buds per explant. Other studies have provided

data to explain the highly prolific nature of the proximal region of cotyledon explants.

Sujatha et al. (2008), using a direct shoot organogenesis protocol, tested three

cotyledon segment types proximall, middle, and distal) of Pongamia pinnata, a tree

legume. This study concluded that the proximal cotyledon section, followed by the

middle and distal sections, were most responsive in terms of producing shoot buds.

These results suggest that there is a gradient of cells within cotyledon tissue that is

likely to dedifferentiate, with those cells nearest the proximal region being more likely to

become meristematic. Further supporting this observation of cotyledon gradient

competence, using serial sections of peanut cotyledons, Victor et al. (1999) saw an

increase in meristematic conversion in the epidermal and sub-epidermal cell layers as

the sections approached the hypocotyledonary notch region when exposed to

thidiazuron and BA.

In Sharma and Anjaiah (2000), whole cotyledon explants were compared to

vertically cut, cotyledon halves. Both explants produced shoots at high frequencies, but

the number of shoots per responding explant was much higher when the cotyledons

were vertically split into halves. The corresponding half of each split cotyledon

responded similarly relative to induction frequency and the number of shoots per

explant. However, in the present study there was a significant difference in SI% and

DSO rating of the two split cotyledon explant sources. A difference in shoot induction









was observed for each type of cotyledon explant examined regardless of cultivar.

Explant A had a higher DSO rating (1.8) and higher SI% (12.8%) than explant B (1.6,

and 6.7%, respectively) (P > t = >0.0001) (Figure 3-4). It has been demonstrated across

several species that cotyledons have a high capacity for an organogenic growth

response (Dunstan and Thorpe, 1986), but, as previously mentioned, this morphogenic

potentiality is not uniform across different cotyledonary tissues. Previous work, using

Dalbergia sissoo, a tree legume (Singh et al. 2002), almond (Prunus dulcis Mill.)

(Ainsley et al. 2001), and cherry (Prunus) (Hokanson and Pooler, 2000), demonstrated

that the region of the cotyledon in closest contact with the embryo displayed the highest

organogenic capacity. It was observed in the present study, upon embryo axis removal

from cotyledon A, that a small amount of embryo axis tissue usually remained at the

proximal portion of the cotyledon. Explant A's closer association with the embryo axis,

fits the description of Hokanson and Pooler (2000) and provides a plausible explanation

for the difference in SI% and DSO rating between the explants.

Genotype Response

Based on the findings by Sharma and Anjaiah (2000) that medium supplemented

with 20 pM BA led to the highest incidence of adventitious bud formation in peanut, the

present study tested BA concentrations ranging 10 640 pM to determine the best level

for shoot induction response of the five selected cultivars. Cultivars responded to all the

BA levels tested producing adventitious shoot buds, but cultivars responded differently

to culture treatments (Table 3-1; Figure 3-5).

Florida-07. For BA concentrations ranging from 10 80 pM, Florida-07's DSO

response was quadratic (normal) (p > t = 0.0051) (Table 3-1). The highest observed

DSO rating for Florida-07 was on SIM40 (1.8), which was higher than DSO ratings on









SIM10 (1.5), SIM20 (1.5), and SIM80 (1.5) (Figure 3-5A). The highest observed Sl% for

Florida-07 was also on SIM40 (7.1%), but was not different than the SI% on SIM10

(0.9%), SIM20 (2.8%), or SIM80 (0.0%) (Figure 3-5B).

Georgia Green. Georgia Green had neither a linear nor quadratic DSO trend (p>t

= 0.6191, and p>t = 0.8416, respectively), but it had a strong cubic DSO (P > t =

0.0001) (Table 3-1). No biologically relevant cause could be deduced for this trend

which was repeatable. SIM40 and SIM10 produced the highest DSO ratings for Georgia

Green (2.2, and 2.1, respectively). SIM80 and SIM20 produced similar DSO ratings

(1.9, and 1.8, respectively), that were lower than the ratings on SIM40 or SIM10 (Figure

3-5A). No differences were observed in SI% (Figure 3-5B).

Georgia Browne. Georgia Browne responded with a strong linear DSO trend for

BA concentrations of 10 80 pM (P > t = <0.0001) (Table 3-1). The highest DSO ratings

were on SIM80 (1.7) and SIM40 (1.6). The DSO rating on SIM80 was higher than

ratings on SIM20 (1.5, p>t = 0.0021) or SIM10 (1.5). However, its DSO response on

SIM40, was the same as on SIM20 (1.5) and SIM10 (1.5) (Figure 3-5A). The highest

SI% was on SIM10 (9.1%), followed by the SI% on SIM80 (9.0) and SIM20 (3.8) (Figure

3-5B).

To normalize the linear DSO response trend between 10 80 pM, the BA

concentration range was increased with levels of 160 pM and 320 pM. Within the 10 -

320 pM BA range, Georgia Browne had a strong, quadratic DSO trend (P > t = <0.0001)

(Table 3-2). Its DSO rating on SIM160 (1.5) was higher than on SIM320 (1.3) (Figure 3-

6A). Likewise, the SI% for Georgia Browne was much higher on SIM160 (6.9%) than









SIM320 (0.6%) but neither was higher than those produced on SIM10 and SIM80

(Figure 3-6B).

Valencia-A. Valencia-A responded with a strong linear trend within the 10-80 pM

BA range (P > t = <0.0001) (Table 3-1). When the BA concentration was extended up to

640 pM a linear trend was still observed (P > t = <0.0001), as well as a weaker

quadratic trend (P > t = 0.0021) (Table 3-2). This quadratic trend indicates diminishing

returns. Valencia-A had the same DSO rating on SIM80 (1.7), SIM40 (1.7), and SIM20

(1.7), all of which were higher than DSO rating on SIM10 (1.4) (Figure 3-5A). Although

the highest SI% was produced on SIM80 (8.1%), this was not different than the SI% on

SIM10 (4.6%), SIM20 (5.3%), or SIM40 (4.3%) (Figure 3-5B).

Attempts to normalize the linear DSO response trend were made by increasing BA

concentrations to 160 pM, 320 pM, and 640 pM. Within this 10-640 pM, Valencia-A still

responded with a strong linear trend (P > t = <0.0001) (Table 3-2). BA concentrations

were not extended beyond 640 pM, because the saturation point was met and medium

components precipitated out of solution. No differences were observed in DSO rating

between 160 640 pM BA (Figure 3-6A). However, Valencia-A's SI% was higher on

SIM640 (21.4%) than on SIM160 and SIM320 (Figure 3-6B).

VC-2. DSO ratings were similar for VC-2 on all BA concentration tested (Figure 3-

4A). Its highest SI% was on SIM10 (22.1%), followed by SIM20 (19.0%), SIM80

(13.9%), and SIM40 (13.4%). Although a decreasing trend was observed for SI%, there

was no significant difference among the treatments (Figure 3-4B).

Sharma and Anjaiah (2000) and Tiwari and Tuli (2008) failed to report the

statistical difference in SI% between hormone concentrations, but, in general, reported









higher SI% than the present study. Sharma and Anjaiah (2000) and Tiwari and Tuli

(2008) also failed to describe the difference in shoot bud appearance (quality). In the

present study, regardless of BA concentration, SI% (percentage of explants developing

shoot buds) generally appeared to be similar within cultivars. However, DSO rating

(measure of quality of shoot buds produced by explants) varied within cultivars. In the

present study, the quality of shoot buds at each concentration appeared to be

dependent upon BA level (Tables 3-3 and 3-4, Figures 3-5 and 3-6). Similarities in SI%

across BA concentrations may suggest that the threshold for growth response may be

met at low BA levels. However, based on differences in DSO ratings of the tested BA

levels, it is believed that BA concentration plays a significant role in the quality of growth

response.

Cultivar Comparison

A comparison of the top-performing cultivar*BA level from this study suggest a

genotypic influence on growth response (Table 3-3). When comparing tissue culture

responses among cultivars, Georgia Green on SIM10 had the highest SI% (24.6%) and

the highest DSO rating (2.1), followed by VC-2 on SIM10 (22.1%, 1.8), Valencia-A on

SIM640 (21.4%, 1.8), Georgia Browne on SIM80 (9.0%, 1.7), and Florida-07 on SIM40

(7.0%, 1.8) (Table 3-3). Statistically, Georgia Green, Valencia-A, and VC-2 had an

equal SI% response, but were higher than Florida-07 and Georgia Browne, which were

equal. Georgia Green had the highest DSO rating which was higher than Florida-07,

Georgia Browne, Valencia-A, and VC-2, which were all equal (Table 3-3).

Previous studies have only tested Spanish and Virginia market type cultivars. In

these studies, Spanish market types, specifically the cultivar JL-24, have performed

best in terms of shoot induction response. In the present study, the selected Spanish









market type, Georgia Browne, was one of the poorest performing cultivars. However, it

should be pointed out that Georgia Browne is closely related to Georgia Green, a

Runner market type, and is not a traditional Spanish market type. Future work should

use multiple cultivars from each market type to identify if response is similar at the

market type level. However, because of the discrepancy in response by Georgia

Browne and Georgia Green, the author feels that shoot induction response is likely

genotype dependent.

Earlier studies on peanut organogenesis have also reported a strong genotypic

influence on shoot induction (Mroginski et al. 1981, Seitz et al. 1987, McKently et al.

1990, Chengalrayan et al. 2004, Banerjee et al. 2007, Matand et al. 2007). In contrast,

Li et al. (1994), Sharma and Anjaiah (2000), and Tiwari et al. (2008, 2009) reported that

all tested genotypes responded equally in organogenic response. Tiwari et al. (2009)

suggests that this discrepancy in findings may be due to the extent of diversity among

the selected genotypes from different studies.

Regeneration of Mature Plants

In the present study, data were collected only for shoot induction response, as

prolific shoot bud induction is the most critical component for Agrobacterium

transformation protocols. Although no data were collected post-shoot induction, shoot

elongation and rooting portions on the protocol were carried out (Figures 3-3C and 3-

3D). Preliminary results indicated that mature plants could be generated for all the

tested cultivars at all BA concentrations examined using the described protocol (Figure

3-3E). It appeared that BA in shoot induction medium did not adversely affect shoot

elongation and rooting of plantlets, although further testing is required to make a

definitive conclusion. Despite phenotypically normal plants being generated in this









study, previous studies have shown that the use of cytokinin growth regulators at high

concentrations (0.5-10 mg L1) can lead to residual toxicity which will inhibit or delay the

efficiency of shoot elongation and/or root formation (Harris and Hart, 1964; Gray et

al. 1991; Preece and Imel, 1991, Chandra et al. 2003). Because of this inhibitory effect,

cytokinins are usually removed from culture media during later stages of the tissue

culture process. Frequently, more than one subculture to a cytokinin-free medium may

be required until the level of cytokinin within the tissues has been sufficiently reduced.

The need for multiple rounds of subculturing on hormone-free medium suggests that

residual cytokinin can persist in adventitious tissue. Based on these previous findings, it

was determined that using the lowest BA concentration capable of inducing the desired

shoot induction response would be the best option for generating mature peanut plants

in future studies. Therefore, Georgia Green and VC-2 on SIM10, Florida-07 on SIM40,

Georgia Browne on SIM80, and Valencia-A on SIM640 should be the preferred

cultivar*BA concentration combinations used for producing transgenic lines in the future.

Conclusions

A difference in shoot induction was observed for each type of cotyledon explant

examined. Because adventitious shoot bud formation was confined to the proximal

region of explants and explant A had a higher SI% and DSO rating, it was concluded

that the cotyledon nearest the embryo axis is most likely to de-differentiate and become

meristematic. Because shoot induction was higher and of better visual quality for

explant A, it was determined that it should be the only explant type used in direct shoot

organogenesis for future Agrobacterium-mediated transformation studies.

All tested BA levels and cultivars produced adventitious shoot buds, indicating that

this protocol is adaptable to a wide array of market types and cultivars. However, there









was a genotype effect because the cultivars responded differently in culture. Georgia

Green on SIM10 had the highest SI% and DSO rating followed by VC-2 on SIM10,

Valencia-A on SIM640, Georgia Brown on SIM80, and Florida-07 on SIM40.

Furthermore, similarities in SI% across BA concentrations indicate that the threshold for

explant growth response can be met at low BA levels. However, differences in DSO

ratings indicate that BA level does play a significant role in the overall quality of the

growth response. Cultivars Georgia Green, Valencia-A and VC-2 appear to be the best

suited for future transformation experiments based on their shoot bud production.
























Figure 3-1. Peanut seed morphology and cotyledon explants preparation. Arrows
indicate the proximal end with high regeneration potential. Explants prepared
in the following order: (1) Seed coat removed; (2) Cotyledons separated; (3)
Embryo axis removed and cotyledon vertically cut, forming explants A; (4)
Remaining cotyledon vertically cut, forming explants B. (Photo modified from
Armstrong, 2008).










Figure 3-2. Direct shoot organogenesis (DSO) rating of peanut explants. (1) Slight
greening of explants, with no growth; (2) Greening of explants, with callus-like
growth, and no adventitious bud formation; (3) Greening of explants, with
adventitious bud formation; (4) Greening of explants, with adventitious bud
formation, and small leaflet expansion.









































Figure 3-3. Explant response and regeneration of mature peanut plants. (A)
Adventitious shoot buds from cotyledon explants after 3 weeks of culture on
shoot induction medium. Arrow indicates the proximal cut end with high
regeneration potential. (B) Shoot bud formation on proximal cut end of
cotyledon explants after 4 weeks of culture on hoot induction medium (2.5X
magnification). (C) Shoot development after 4 weeks on shoot elongation
medium. (D) Root development after 4 weeks on root induction medium. (E)
Mature plant in soil 16 weeks after initial shoot bud formation.









Table 3-1. Effect of N6-benzyladenine concentrations ranging from 10-80 pM on the
peanut cultivar response trend
Trend*
Cultivar Linear Quadratic Cubic

Florida-07 0.0985 0.0051 0.0005

Georgia Browne <0.0001 0.5536 0.7933

Georgia Green 0.6191 0.8416 <0.0001

Valencia-A <0.0001 0.0029 0.1533

VC-2 0.199 0.2278 0.9089
*Trends determined using orthogonal polynomials in the Estimate statement of the
Mixed Procedure of SAS software. Cultivar response trend considered significant at P <
0.05.

Table 3-2. Effect of N6-benzyladenine concentrations ranging from 10-320 pM for
Georgia Browne and 10-640 pM for Valencia-A on the peanut cultivar
response trend
Trend*
Cultivar Linear quadratic Cubic

Georgia Browne 0.0625 <0.0001 0.0668

Valencia-A <0.0001 0.0021 0.4706
Trends determined using orthogonal polynomials in the Estimate statement of the
Mixed Procedure of SAS software. Cultivar response trend considered significant at P <
0.05.















0 2
-"l I---------| --1




. ie I_ -I 3
* I I I

EI C
c C


0 r-3



A
*[

o-


Figure 3-4. Shoot organogenesis response from two types of peanut cotyledon explants

(A) Explant derived from cotyledon with embryo axis previously attached, (B)

Explant derived from cotyledon without embryo axis previously attached.












(A) 2 -

c 2.2 -

O 2.0


C 1.I

O

0
0 1
0
.0
u IA





(B rS-----------i^,|






S c0 -
.0 1



"5
10















Figure 3-5. Effect of N6-benzyladenine concentration ranging form 10 80 pM on (A)
direct shoot organogenesis rating of peanut cotyledon explants, and (B) shoot
induction %. Each value is a mean SE.












(A) 2. AConcentrati s
e wum C3 80 PM MouM



o 1J1- ----
os I

1.0
8 1.6
0
C
0
C










BAenzt cntrati om
IA
0


1;
a
1.0

(8) 3 I0---------
AFigure 3-6. Effect of N-benzyladenine concentration ranging from 0 320 M for












peanut cultivars Georgia Browne and 0-640 M for Valencia-A on (A) direct

shoot organogenesis, and (B) shoot induction %. Each value is a mean SE.
15
C

0




0 ILL ii, iii







Figure 3-6. Effect of N6-benzyladenine concentration ranging from 10 320 pM for
peanut cultivars Georgia Browne and 10-640 pM for Valencia-A on (A) direct
shoot organogenesis, and (B) shoot induction %. Each value is a mean SE.









Table 3-3. Comparison of top-performing cultivar* N6-benzyladenine concentration combinations in peanut tissue culture
of quartered, de-embryonated cotyledon explants.
Cultivar Market Type N6-benzyladenine (pM) DSO Rating SI%


Florida-07 Runner 40 1.8 0.1 b 7.1 6.1 b

Georgia Green Runner 10 2.1 0.1 a 24.6 5.4 a

Georgia Bowne Spanish 80 1.7 0.1 b 9.00 3.1 b

Valencia-A Valencia 640 1.8 0.1 b 21.4 3.3 a

VC-2 Virginia 10 1.8 0.1 b 22.1 6.1 a
*Mean DSO rating SE and SI% SE for cultivar*treatment following 4 week culture period.
**Means within cultivars followed by the same letter are not different at the P < 0.05.









CHAPTER 4
TRANSIENT EXPRESSION OF UIDA (B-GLUCURONIDASE) IN PEANUT
COTYLEDON EXPLANTS

Abstract

Peanut is susceptible to a variety of abiotic and biotic stressors. In the U.S., foliar

and soilborne diseases/pests are the most prevalent of these stressors and annually

lower yields and profits for growers. Outside of pesticides, the primary means to

overcoming these stressors is conventional breeding. Conventional breeding for

disease resistance has been a slow endeavor due to the lack of genetic diversity

available in cultivated peanut. Recently, interest has increased in using transgenic

approaches to complement traditional breeding for improved agronomic performance in

peanut. Sharma and Anajaiah (2000) reported the development of a highly efficient

peanut transformation protocol via Agrobacterium-mediated transgene delivery.

However, this protocol was optimized for JL-24, an Indian peanut cultivar not readily

available in the U.S. In the present study, the protocol described by Sharma and

Bhatnagar-Mathur (2006) was tested using two readily available U.S. cultivars (Georgia

Green and VC-2) and four Agrobacterium strains (ABI, C58C1, GV3101, and LBA4404)

harboring the CaMV 35S-uidA gene construct. It was hypothesized that the protocol

described by Sharma and Bhatnagar-Mathur (2006) could be used to successfully

transform these selected cultivars. The purpose of this study was to identify

Agrobacterium strains that would successfully infect the selected cultivars. Following

inoculation and co-cultivation of explants, a histochemical 3-glucuronidae (GUS) assay

analysis was performed to test for transient expression of the uidA gene. The only

explants testing positive for uidA expression were those infected with Agrobacterium









strain ABI. It was concluded that Agrobacterium strain ABI must be used for future

transformation experiments.

Introduction

Throughout a growing season, peanut is exposed to many biotic and abiotic

stressors that can lower yields and profits for growers. In the U.S., foliar and soilborne

diseases/pests are the most prevalent of these stressors. Domestically, the most

prevalent biotic stressors of peanut include tomato spotted wilt virus (TSWV; Tospovirus

vectored by thrips), root-knot nematode (Meloidogyne arenaria (Neal) Chitwood race 1),

White Mold (Sclerotium rolfsii Sacc.), Cylindrocladium black rot (Cylindrocladium

parasiticum Crous, Wingfield and Alfenas), Sclerotinia blight (Sclerotinia minor Jagger),

Rust (Puccinia arachidis Speg.), early leaf spot (Cercospora arachidicola S. Hori), and

late leaf spot (Cercospiridium personatum (Berk and M. A.Curtis) Deighton). Outside of

pesticides the primary means to overcoming these diseases is conventional breeding.

Conventional breeding for disease resistance has been a slow endeavor due to the lack

of genetic diversity available in cultivated peanut. Recently, interest has increased in

using transgenic approaches to complement traditional breeding for improved

agronomic performance and disease resistance in peanut. Routine peanut

transformation would allow breeders to have access to otherwise unavailable genetic

resources.

Peanut has been successfully transformed using both particle bombardment and

Agrobacterium-mediated transformation (see Chapter 1 for review). Recently, as an

alternative to lengthy bombardment methods, protocols using faster, direct

organogenesis and Agrobacterium have been investigated. Transformation by

Agrobacterium is believed to be superior to bombardment because integration patterns


100









tend to be "cleaner", meaning whole gene constructs integrate into the host genome

with low copy number. Additionally, and perhaps most favorable, tissue culture

requirements tend to be far less intensive in terms of sub-culturing and time to plant

maturity. This reduction in time and handling lessens the likelihood for contamination

and somaclonal variation, and therefore, loss of putative transgenics. Once established,

protocols are far less labor intensive and more economically sound.

Sharma and Anjaiah (2000) reported the development of a direct shoot

organogenesis and transformation protocol via Agrobacterium-mediated transgene

delivery. However, this protocol was optimized using cv. JL-24, an Indian cultivar not

readily available in the U.S. Likewise, many of the earlier studies reporting the

successful transformation of peanut via Agrobacterium used cultivars not readily

available or economically important in the U.S (Venkatachalam 1998, 2000; Rohini et al.

2000, 2001; Khandelwal et al 2003, 2004; Anurahda et al. 2006, 2008; Bhatnagar-

Mathur t al. 2007; Tiwari 2008, 2009). Very few readily available domestic peanut

cultivars have been transformed (Franklin et al. 1993; Eapen and George, 1993;

McKently et al. 1995; Cheng 1996, 1997; Li et al. 1997; Egnin et al. 1998; Dodo et al.

2007; Yin et al. 2007). Within these studies that have reported successful peanut

transformation, the number of cultivars used has been relatively narrow; the Indian

cultivar most commonly transformed via Agrobacterium has been JL-24 followed by

TMV-2, while in the U.S. it has been Valencia-A.

Sharma and Anjaiah (2000) report a protocol which results in a high production of

transgenics. It was hypothesized that the protocol described by Sharma and Bhatnagar-

Mathur (2006) could be expanded to successfully transform U.S. cultivars. The purpose


101









of this study was to identify Agrobacterium strains virulent to the candidate cultivars,

Georgia Green and VC-2.

Materials and Methods

Agrobacterium Strain and Gene Construct

Peanut transformation experiments were conducted using a modified protocol

described by Sharma and Bhatnagar-Mathur (2006). For transformation and transient

expression experiments, Agrobacterium strains ABI, C58C1, GV3101, and LBA4404

harboring CaMV 35S-uidA expression cassette were tested (CaMV 35S-uidA,

constitutively expressed promoter from Cauliflower Mosaic virus linked to uidA, a

reporter gene derived from E. coli which encodes for (3-glucuronidase (GUS). A single

colony of an Agrobacterium strain was incubated in 20 ml of yeast extract peptone

medium (YEP; 10 g L-1 Yeast Extract [Fisher Scientific, Waltham, Massachusetts,

USA], 10 g L-1 Bacto Peptone [Sigma, St. Louis, MO, USA], 5 g L-1 NaCI [Fisher

Scientific, Waltham, Massachusetts, USA]) and grown overnight on a shaker at 200 rpm

at 280C to an OD600 of 0.5-0.8. An overnight culture (10 ml) was pelleted by

centrifugation at 600 g for 10 min. Pelleted cells were resuspended in 30 ml of 0.5X MS

medium (Murashige and Skoog 1962). The suspension was then incubated at 4C for 1

hr prior to explant inoculation.

Explant Preparation and Inoculation

Mature dry seeds of Georgia Green and VC-2 were surface-sterilized in a 0.1%

(w/v) mercuric chloride solution for 10 min, rinsed five times with sterile water, and

soaked in sterile distilled water overnight. Using sterile technique, seed coats were

removed, cotyledons were separated, and embryo axes were removed. Cotyledons

were sliced vertically to obtain quartered cotyledon explants. Explants were briefly


102









immersed (1-2 sec) into an Agrobacterium suspension culture at room temperature for

inoculation. Explants were then blotted on sterile filter to remove excess suspension

solution. The proximal, freshly cut edge of each explant was embedded into shoot

induction medium (SIM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v)

sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar [Becton, Dickinson and

Co., Franklin Lakes, NJ, USA], 10 pM 2,4-dichlorophenoxyacetic acid (2,4-D) [Sigma,

St. Louis, MO, USA], and 10 pM N6-benzyladenine (BA) [Sigma, St. Louis, MO, USA],

pH 5.8) at a slight downward angle. Explant/bacterial co-cultivation lasted a period of

three days. Co-cultivation conditions were set to 26C ( 1C) under continuous light of

100 pEs-1 m-2 irradiance.

Transient Expression in Cotyledon Explants and Histochemical GUS-assay

Explants of Georgia Green and VC-2 were inoculated with Agrobacterium strains

ABI, LBA4404, GV3101, and C58C1 harboring the CaMV 35S-uidA construct. Explants

were placed onto SIM medium as previously described. Following co-cultivation,

explants were assayed for transient GUS expression. Explants were removed from SIM

medium and rinsed in 70% EtOH for 5 min, followed by a 5 min rinse in sterile water.

Explant pieces were placed into a solution containing 5 mM potassium ferricyanide, 5

mM potassium ferrocyanide, 0.3% Triton X-100, and 1 mg/ml 5-bromo-4-chloro-3-

indolyl glucuronide (X-gluc) and vacuum infiltrated for 5 min. Explant pieces were then

placed at 37C overnight under constant agitation. Explants were visually examined for

"blue" GUS sectors indicating uidA expression.

Results and Discussion

Transient expression of uidA was used in the first peanut transformation

experiments to identify strain virulence. Lacorte et al. (1991) used several


103









Agrobacterium strains to induce uidA-expressing tumor masses on peanut seed and

seedling explants. Lacorte et al. (1991) reported strain A281 to be the most virulent

strain tested. In a similar study, Franklin et al. (1992) reported uidA expression in callus

tissue following infection with Agrobacterium strains EHA101 and LBA4404. Georgia

Green and VC-2 explants inoculated with Agrobacterium strains C58C1, GV3101, and

LBA4404 harboring the CaMV 35S-uidA plasmid showed no signs of transient uidA

expression following GUS-histochemical analysis. Prior to the current study, no reports

have been made which indicate that strains GV3101 or C58C1 have been used in

peanut transformation studies. However, LBA4404 has been successfully used in

several studies testing transient and stable in peanut (Venkatachalam et al. 1998, 2000;

Rohini et al. 2000, 2001; Yin et al. 2007). Explants of VC-2 and Georgia Green

inoculated with ABI showed transient expression, with several "blue" sectors observed

on the cut surface of the explants. Eighty explants per cultivar were inoculated with ABI,

41% of the Georgia Green explants and 43% of VC-2 explants were positive for uidA

expression (Table 4-1, Figure 4-1). Prior to this study, no peanut transformation studies

have been reported using strain ABI. ABI was identified as being the most virulent strain

of those tested. The development of blue sectors on explants is a clear indication of

nuclear delivery of the CaMV 35S-uidA expression cassette. C58C1, GV3101, and

LBA4404 lacked the necessary host-"pathogen" virulence required for transformation.

However, using a similar protocol, Yin et al. (2007) produced stable transgenics using

LBA4404. The discrepancy of this study with the current study can only be explained by

differences in cultivar; Yin et al. (2007) used Baisha 1016 peanut. Because

Agrobacterium strain ABI was the only strain to produce GUS positive, blue-sectors


104









upon assaying, it was determined that ABI was the only viable strain for use in future

transformation experiments using Georgia Green and VC-2.

To further determine the optimal Agrobacterium/cultivar combination, attempts were

made to quantify uidA expression through use of a 4-methylumbelliferyl 3-D-glucuronide

(MUG) assaying and quantitative real-time PCR (qRT-PCR). Because of the high lipid

content of peanut seed, protein extracts from explants were of extremely low quality.

These low quality extracts did not allow for the detectable hydrolytic conversion of MUG

into glucuronic acid and 7-hydroxyl-4-methylcoumarin (MU). qPCR analysis, using uidA

specific primers, was also unsuccessful despite positive GUS assay staining observed

in control explants. No detectable traces of uidA expression were observed. The

discrepancy between the GUS assay and the qRT-PCR results can be explained by the

accumulation of stable, GUS protein being translated from a non-detectable amount of

uidA mRNA transcripts within a cell.

Conclusions

Results from the transient expression study indicate the nuclear delivery of CaMV

35S-uidA gene construct. Because transient uidA expression was only observed in

explants inoculated with Agrobacterium strain ABI and not C58C1, GV3101, and

LBA4404, it was concluded that strain ABI was the best option for use in future stable

transformation experiments when using Georgia Green and VC-2 explants. Based on

the findings of this study, attempts were made to produce mature, transgenic peanut

lines expressing for CaMV 35S-uidA, DR5-uidA, and SAG12-IPT. Results to these

experiments can be found in Appendix A.


105









Table 4-1. Transient expression of CaMV 35S-uidA in peanut cotyledon explants
Agrobacterium-strain Cultivar SIM1 # GUS + # GUS -

Georgia Green 80 33 47
ABI
VC-2 80 34 46

Georgia Green 80 0 80
C58C1
VC-2 80 0 80

Georgia Green 80 0 80
GV3101
VC-2 80 0 80

Georgia Green 80 0 80
LBA4404
VC-2 80 0 80

Number in column represents the total number of explants which were inoculated and
onto SIM for 3 day co-cultivation.


106























Figure 4-1. Arrows indicate transient uidA expression on the proximal end of de-embryonated, quartered cotyledon
explants of peanut cv. Georgia Green. Explants were inoculated with Agrobacterium strain ABI harboring the
CaMV 35S-uidA expression cassette.









APPENDIX A
TRANSFORMATION OF PEANUT WITH SAG12-IPT FOR A 'STAY GREEN'
PHENOTYE

Introduction

Several studies have developed transgenic plants expressing for the SAG12-IPT

chimeric gene to delay the onset of leaf senescence ('Stay Green'). Engineering plants

to retain leaves, even under pathogen attack, could potentially negate some of the

undesirable effects associated with pathogen infection. Preliminary data (M. Jones and

D. Clark, University of Florida) indicated that transgenic petunia expressing SAG12-IPT

had a delayed leaf senescence response (Jandrew, 2002). Transformants also

appeared to develop fewer chlorotic spots and gained tolerance to petunia leaf spot

disease caused by Cercospora petunia (Jandrew 2002) (refer to Chapter 1, Figure 1-1).

Similar results were reported by Swartzberg et al. (2008), in which tomato plants

transformed with SAG12-IPTdisplayed suppressed symptoms of the disease caused by

Botrytis cinerea. It is hypothesized that the same tolerance response can be

incorporated into peanut lines expressing for SAG12-IPT.

Transient expression of uidA reported in Chapter 4 suggest that Agrobacterium

strain ABI possesses the virulence required to produced mature, stable transgenic

peanut lines. Likewise, several previous studies report the successful transformation of

peanut using Agrobacterium strain LBA4404. Yin et al. (2007), using LBA4404, Georgia

Green explants, and a similar direct shoot organogenesis protocol developed multiple

independent transgenic plants. Based on these findings, it was hypothesized that

Georgia Green, VC-2, and Valencia-A could be successfully transformed. The current

study attempted to integrate the CaMV 35S-uidA, DR5-uidA, and SAG12-IPT

expression cassettes in independent peanut lines.


108









Materials and Methods

Agrobacterium Strain and Gene Constructs

Peanut transformation experiments were conducted using a modified protocol

described by Sharma and Bhatnagar-Mathur (2006). Agrobacterium strains LBA4404

and ABI harboring the CaMV 35S-uidA (previously described in Chapter4), DR5-uidA

(DR5-uidA, an auxin-inducible promoter linked to P3-glucuronidase gene), or SAG12-IPT

(Sag12-IPT, senescence-specific promoter linked to isopentyl transferase gene)

expression cassette were used in experiments for stable transformation (Figure A-1). A

single colony of Agrobacterium was incubated in 20 ml of yeast extract peptone medium

(YEP; 10 g L-1 Yeast Extract [Fisher Scientific, Waltham, Massachusetts, USA], 10 g L1

Bacto Peptone [Sigma, St. Louis, MO, USA], 5 g L-1 NaCI [Fisher Scientific, Waltham,

Massachusetts, USA]) and grown overnight on a shaker at 200 rpm at 28C to an

OD600 of 0.5-0.8. An overnight culture (10 ml) was pelleted by centrifugation at 600 g

for 10 min. Pelleted cells were resuspended in 30 ml of 0.5X MS medium. The

suspension was then placed at 4C for 1 hr prior to explant inoculation.

Explant Preparation and Inoculation

Mature dry seeds of Georgia Green, VC-2, and Valencia-A were surface-sterilized

in a 0.1% (w/v) mercuric chloride solution for 10 min, rinsed five times with sterile water,

and soaked in sterile distilled water overnight. Using sterile technique, seed coats were

removed, cotyledons were separated, and embryo axes were removed. Cotyledons

were sliced vertically to obtain quartered cotyledon explants. Explants were briefly

immersed (1-2 sec) into an Agrobacterium suspension culture at room temperature for

inoculation. Explants were then blotted on sterile filter to remove excess suspension

solution. The proximal, freshly cut edge of each explant was embedded into shoot


109









induction medium (SIM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v)

sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar [Becton, Dickinson and

Co., Franklin Lakes, NJ, USA], 10 pM 2,4-dichlorophenoxyacetic acid (2,4-D) [Sigma,

St. Louis, MO, USA], and either 10 pM or 640 pM N6-benzyladenine (BA) [Sigma, St.

Louis, MO, USA], pH 5.8) at a slight downward angle. Georgia Green and VC-2

explants were placed onto shot induction medium (SIM) supplemented with 10 pM BA,

while Valencia-A was placed on to SIM supplemented with 640 pM BA.

Explant/bacterial co-cultivation lasted a period of three days. Co-cultivation conditions

were set to 26C ( 1C) under continuous light of 100 pEs-1 m-2 irradiance. Following

co-cultivation, explants were sub-cultured to fresh SIM medium supplemented with 50

mg L-1 timentin and 50 mg L1 kanamycin. Explants remained on this SIM medium for 3-

4 weeks.

Regeneration of Mature Plants

Explants bearing shoot buds were transferred to shoot elongation medium (SEM;

MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v) sucrose [Fisher Scientific,

Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ,

USA), and 2 pM BA [Sigma, St. Louis, MO, USA], pH 5.8) containing 50 mg L-1 timentin

and 50 mg L1 kanamycin for selection. Following three weeks under selection, surviving

shoots were sub-cultured twice, every 4 weeks to SEM supplemented with 100 mg L1

kanamycin. Elongated shoots (approximately 2-3 cm in length) were then placed onto

root induction medium (RIM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3%

(w/v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar (Becton,

Dickinson and Co., Franklin Lakes, NJ, USA), and 5 pM 1-Naphthaleneacetic acid

(NAA) [Sigma, St. Louis, MO, USA], pH 5.8). Cultures undergoing selection and rooting


110









were maintained at 26C ( 1C) under continuous light of 100 pEs-1 m-2 irradiance.

Once roots were established, plants were transferred to pots containing a 2:1 Fafard #2

: sand mixture [Fafard, Agawam, MA, USA]. Plants were hardened undergrowth

chamber conditions. Plants reaching maturity were moved into greenhouse conditions

and fertilized and irrigated as needed. Plants that reached maturity underwent genomic

PCR screening and when appropriate, GUS-assay analysis.

Genomic DNA Analysis

Using the CTAB extraction method, genomic DNA was isolated from putative

transgenic lines that survived tissue culture selection to maturity. From To plants, freshly

expanding compound leaves were collected and immediately frozen in liquid nitrogen.

Small quantities of tissue (< 300 mg) were homogenized in microcentrifuge tubes using

a pellet pestle. Precipitated DNA was air-dried and resuspended in sterile distilled

water.

PCR amplification was carried out using gene specific primers. Putative Sag12-

IPTtransgenic plants were screened with primers that flanked the Sag12 promoter and

the IPT gene, producing a 1000 bp product (Forward: 5'-

GATTTGATTAAGCTTTTAACTTGC-3', Reverse: 5'-GCCCGCCGTTGGCCTCATGAT-

3'). Putative CaMV 35S-uidA plants were screened with primers which annealed to the

uidA gene only, producing an 819 bp product (Forward: 5'-

CCCCAACCCGTGAAATCAAA-3', Reverse: 5'- GTTCGCCCTTCACTGCCACT-3').

Thermal cycler conditions were set as such: 95C for 1min (denaturation), 60C for 30 s

(annealing), C for 1 min (extension), for 30 cycles, and held at 4C until recovery. The

amplified products were assayed by electrophoresis in 1% agarose gels in 1X TAE.


111









GUS Assay

Explants were removed from SIM medium and rinsed in70% EtOH for 5 min,

followed by a 5 min rinse in sterile water. Explant pieces were placed into a solution

containing 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 0.3% Triton X-

100, and 1 mg ml-1 5-bromo-4-chloro-3- indolyl glucuronide (X-gluc) and vacuum

infiltrated for 5 min. Explant pieces were then placed at 37C overnight under constant

agitation. Explants were visually examined for "blue" GUS sectors indicating uidA

expression.

Results and Discussion

In this experiment, explants of VC-2 and Georgia Green were inoculated using

Agrobacterium strain LBA4404. In total, 400 individual explants of VC-2, and 320

explants of Georgia Green were inoculated with Agrobacterium strain LBA4404

harboring various gene constructs (SAG12-IPT, 35S-uidA, DR5-uidA). Under selection,

approximately 1% of the Georgia Green explants and 4% of the VC-2 explants survived

selection and yielded mature plants, none of which were transgenic (Table A-1).

Likewise, attempts to transform Georgia Green, VC-2, and Valencia-A via

Agrobacterium strain ABI harboring the SAG12-IPT plasmid were also unsuccessful

(Table A-2). Under selection, 3% of Georgia Green and 3% of VC-2 explants inoculated

resulted in mature plants. None of the Valencia-A explants inoculated resulted in the

development of mature plants.

Sharma et al. (2000) reported shoot bud induction efficiencies to be nearly 96%

and transformation efficiencies of those explants to be 55% when using cultivar JL-24

and Agrobacterium strain C58. Because JL-24 and strain C58 were not readily

available, cultivars Georgia Green, VC-2 and Valencia-A were used in these initial


112









transformation experiments. Shoot bud induction efficiencies in VC-2, Georgia Green,

and Valencia-A (22%, 25%, and 21%, respectively) were much lower than those

reported by Sharma et al. (2000). Transformation efficiencies in the present experiment

were not as high as those reported by Sharma et al. (2000) because of the dramatic

difference in shoot induction frequencies. Another possible explanation is poor

cultivar/Agrobacterium strain interaction.

Conclusions

Although no transgenic peanut lines were developed in this study, the author of

this paper is optimistic that use of this protocol with the selected cultivars will lead to the

generation of multiple independent transgenic lines. Consistent transient expression of

CaMV 35S-uidA has been observed in explants, meaning that expression cassettes are

being delivered to the nucleus of cells of explants (refer to Chapter 4). Transgene

integration is a rare event and occurs at very low frequencies, even within crops with

established transformation systems. Given this fact, and the fact that past studies report

peanut being recalcitrant to transformation, it is not surprising that transgenic lines were

not generated in the present study. However, as tissue culture conditions are further

improved and other highly virulent Agrobacterium strains are identified, the routine

transformation of Georgia Green, VC-2, and Valencia-A peanut should become a

reality.

Further work will be required to improve shoot bud induction frequencies, which

will likely improve overall efficiencies to produce mature transgenic plants. The use of

other Agrobacterium strains should be explored which may be more virulent than those

tested. Although JL-24 is not readily available domestically, efforts should be made with

this cultivar to duplicate Sharma and Anajaiah's (2000) result.


113









pCAMBIA2300

(A)


RB olyA NPTII CaMV35S pro CaMV35S pro UidA polyA LB
py Reporter



pCAMBIA2300

(B)


35S NPTIp CaMV35S pro DR5pro UidA NOS LB
RB polyA Reporter polyA



EcoRV Ncol Sac pSG5299(+)
(C)


RB SAG12 pro IPT NOS NPTII LB
(2.2 kb) (0.7 kb) polyA

Figure A-1. Expression cassettes used for transformation of de-embryonated, quartered cotyledon explants of peanut, (A)
CaMV 35S-uidA, (B) DR5-uidA, and (C) SAG12-IPT.


114









Table A-1. Assay results of transformation attempts of peanut using Agrobacterium strain LBA4404
Selection

Construct Cultivar SIM1 SEM12 SEM23 RIM4 Ipt/uidA PCR GUS assay

CaMV 35S-UidA VC-2 80 12 4 3-

SA G12-IPT VC-2 80 19 3 0 n/a n/a

DR5-uidA VC-2 80 20 7 6

SAG12-IPT VC-2 80 33 8 0 n/a n/a

SA G12-IPT VC-2 80 16 10 6 n/a

CaMV 35S-uidA Georgia Green 80 6 1 1

DR5-uidA Georgia Green 80 13 6 0 n/a

SAG12-IPT Georgia Green 80 9 5 0 n/a n/a

SAG12-IPT Georgia Green 80 12 5 1 n/a

1Number in column represents the total number of explants which were inoculated and cultured on SIM. 2Number in
column represents the total number of explants which developed adventitious shoot buds and were moved to SEM
(SEM1). 3Number in column represents the total number of individual shoots were sub-cultured to fresh SEM (SEM2).
Number in column represents the total number of shoots that developed roots on RIM.


115









Table A-2. Assay results of attempted transformation of peanut using Agrobacterium strain ABI harboring SAG12-IPT
Selection

Cultivar SIMA SEM1B SEM2c RIMD IPT PCR

Georgia Green 80 16 9 2

VC-2 80 11 5 2

Valencia-A 80 12 3 0 n/a

ANumber in column represents the total number of explants which were inoculated and cultured on SIM. BNumber in
column represents the total number of explants which developed adventitious shoot buds and were moved to SEM
,SEM1). cNumber in column represents the total number of individual shoots were sub-cultured to fresh SEM (SEM2).
Number in column represents the total number of shoots that developed roots on RIM.


116









APPENDIX B
PEANUT TRANSFORMATION STUDIES


117














Table B-1. List of published Agrobacterium-mediated peanut transformation studies.

Cultivar Explant Trait Promoter Strain Reference


Tatu, Tatui,
Tatu branco,
Tupa, Penapolis


Epicotyls


Okrun
New Mexico 'A'
Florigiant, NC-7, Florunner, F435AT
New Mexico 'A'


New Mexico 'A'


New Mexico 'A', Florunner,
Georgia Runner,
Sunrunner, Southrunner
VRI-2, TMV-7
TMV-2
JL-24


TMV-2

TMV-2
JL-24
JL-24


Georgia Green
Baisha 1016


JL-24
JL-24


Hypocotyls
leaf sections
embryo axes
leaf sections

leaf sections


Epicotyls
Cotyledon
embryo axis attached to one cotyledon
de-embryonated cotyledon


embryo axis attached to one cotyledon

Plumule of embryo axes
embryo axis attached to one cotyledon
de-embryonated cotelydon


Hypocotyls
de-embryonated cotelydon

embryo axes
de-embrvonated cotelvdon


p-Glucuronidase


p-Glucuronidase
p-Glucuronidase
p-Glucuronidase
p-Glucuronidase
Nucleocapsid gene
from TSWV
p-Glucuronidase


p-Glucuronidase
p-Glucuronidase
p-Glucuronidase
p-Glucuronidase
Peanut clump
virus coat protein
Tobacco chitinase
Rinderpest virus
hemagglutinin
p-Glucuronidase
DREB1A

Ara h2
FAD2
mustard defensin
(BjD)
synthetic Crv1 EC


ATC1


CaMV 35S
CaMV 35S
MAS
CaMV 35S


T37, A281,
Bo542, A136
EHA101,
LBA4404
ASE1
EHA105
EHA105
EHA105


CaMV 35S EHA105


CaMV 35S
CaMV 35S
CaMV 35S
CaMV 35S


EHA101
LBA4404
LBA4404
C58


CaMV 35S LBA4404


CaMV 35S
none
CaMV 35S,
rd29A
CaMV 35S
CaMV 35S


EHA105
GV2260
C58

EHA105
LBA4404


CaMV 35S EHA105
CaMV 35S EHA101


Lacorte et al. 1991


Franklin et al. 1993
Eapen and George 1994
McKently et al. 1995
Cheng et al. 1996, 1997

Li et al. 1997




Egnin et al. 1998
Venkatachalam et al. 1998, 2000
Rohini and Rao 2000
Sharma and Anjaiah 2000


Rohini and Rao 2001

Khandelwal et al. 2003, 2004
Anuradha et al. 2006
Bhatnagar-Mathur et al. 2007

Dodo et al. 2007
Yin et al. 2007

Anuradha et al. 2008
Tiwari et al. 2008


118











Table B-2. List of published peanut transformation studies using particle bombardment.


Cultivar


Toalson, Florunner

Florunner, Florigiant





MARC-1, Forunner, Toalson
Florunner, Georgia Runner,
MARC-1

Florunner, Georgia Runner,
MARC-1
Gajah, NC-7


VC-1, AT120


Luhua 9, YueYou 116
Okrun


Okrun
Georgia Runner

Gajah, NC-7
Georgia Green, MARC-1


NC-7, Wilson, Perry
JL-24
Georaia Green


Explant
leaflets from
mature embryos
somatic embryos
shoot meristems of
embryo axes





somatic embryos

somatic embryos


somatic embryos
somatic embryos


somatic embryos


somatic embryos
somatic embryos


somatic embryos
embryonic axes

somatic embryos
somatic embryos


somatic embryos
somatic embryos
somatic embrvos


Trait Promoter Reference


p-Glucuronidase
p-Glucuronidase

p-Glucuronidase
Phosphinothricin
resistance (bar)
Nucleocapsid gene
from TSWV
crylA c

p-Glucuronidase

Nucleocapsid gene
from TSWV
p-Glucuronidase
Luciferase (luc)
Nucleocapsid protein
gene from TSWV
p-Glucuronidase
p-Glucuronidase
Rice chitinase
Alfalfa glucanase
Nucleocapsid gene
from TSWV
Mercury resistance (merA)
Peanut stripe virus
coat protein
Green fluorescent protein
Mercury resistance (merB)
Barley oxalate oxidase
BTVP2
Bcl-xL


CaMV 35S Clemente et al. 1992ab
CaMV 35S Ozias-Akins et al. 1993

CaMV 35S Brar et al. 1994





CaMV 35S Singsit et al. 1997


(vsp B,
CaMV 35S


Wang et al. 1998


CaMV 35S Yang et al. 1998, 2004
CaMV 35S Livingstone and Birch 1999


CaMV 35S Magbanua et al. 2000


CaMV 35S Deng et al. 2001
CaMV 35S Chenault et al. 2002, 2003, 2005


CaMV 35S Chenault and Payton 2003
AtACT2 Yang et al. 2003

CaMV 35S Higgins et al. 2004
CaMV 35S Joshi et al. 2005


CaMV 35S
CaMV 35S
CaMV 35S


Livingstone et al. 2005
Athmaram et al. 2006
Chu et al. 2007


119


"









LIST OF REFERENCES


Abdou Y., Gregory W., Cooper W. 1974. Sources and Nature of Resistance to
Cercospora Arachidicola Hori and Cercosporidium Personatum (Beck & Curtis)
Deighton in Arachis Species. Peanut Science 1:6-11.

Agrios G. 2005. Plant Pathology. 5 ed. Elsevier Academic Press, Burlington, MA.

Ainsley P.J., Hammerschlag F.A., Bertozzi T., Collins G.G., Sedgley M. 2001.
Regeneration of almond from immature seed cotyledons. Plant Cell Tissue and
Organ Culture 67:221-226.

Akiyoshi D., Klee H., Amasino R., Nester E., Gordon M. 1984. T-DNA of Agrobacterium
tumefaciens encodes an enzyme of cytokinin biosynthesis. Proceedings of the
National Academy of Sciences 81:5994-5998.

Alabi C., Naqui S. 1977. Effect of infection by Cercospora arachidicola on the food
contents of groundnut leaf. Transactions of the British Mycological Society
68:295-296.

Alderman S., Beute M. 1986. Influence of temperature and moisture on germination
and germ tube elongation of Cercospora arachidicola. Influence of temperature
and moisture on germination and germ tube elongation of Cercospora
arachidicola. 76:715-719.

Altpeter F., Baisakh N., Beachy R., Bock R., Capell T., Christou P., Daniell H., Datta K.,
Datta S., Dix P.J., Fauquet C., Huang N., Kohli A., Mooibroek H., Nicholson L.,
Nguyen T.T., Nugent G., Raemakers K., Romano A., Somers D.A., Stoger E.,
Taylor N., Visser R. 2005. Particle bombardment and the genetic enhancement
of crops: myths and realities. Molecular Breeding 15:305-327.

Anuradha T.S., Divya K., Jami S.K., Kirti P.B. 2008. Transgenic tobacco and peanut
plants expressing a mustard defensin show resistance to fungal pathogens.
Plant Cell Reports 27:1777-1786.


Anuradha T.S., Jami S.K., Datla R.S. and Kirti P.B. 2006. Genetic transformation of
peanut (Arachis hypogaea L.) using cotyledonary node as explant and a
promoterless gus::nptll fusion gene based vector; Journal of Biosciences 31:
235-246.

Armstrong W. 2008. The Peanut: A Subterranean Legume.
http://waynesword.palomar.edu/index.htm (15 October 2008).


120









Athmaram T.N., Bali G., Devaiah K.M. 2006. Integration and expression of Bluetongue
VP2 gene in somatic embryos of peanut through particle bombardment method.
Vaccine 24:2994-3000.

Atreya C.D., Rao J.P., Subrahmanyam N.C. 1984. In vitro regeneration of peanut
(Arachis hypogaea L.) plantlets from embryo axes and cotyledon segments.
Plant Science Letters 34:379-383.

Azumi Y., Watanabe A. 1991. Evidence for a senescence-associated gene induced by
darkness. Plant Physiology 95:577-583.

Backman P.A., Rodriguez-Kabana R., Hammond J.M., Clark E.M., Lyle J.A., Ivey H.W.,
II, Starling J.G. 1977. Peanut leafspot research in Alabama 1970-1976. Bulletin
Auburn University Agricultural Experiment Station: 38.

Bajaj Y.P.S., Kumar P., Singh M.M., Labana K.S. 1982. Interspecific hybridization in
the genus Arachis through embryo culture. Euphytica 31:365-370.

Banerjee P., Maity S., Maiti S.S., Banerjee N. 2007. Influence of genotype on in vitro
multiplication potential of Arachis hypogaea L. Acta Botanica Croatica 66:15-23.

Barry G.F., Rogers S.G., Fraley R.T., Brand L. 1984. Identification of a cloned cytokinin
biosynthetic gene. Proceedings of the National Academy of Sciences of the
United States of America-Biological Sciences 81:4776-4780.

Becker W., Apel K. 1993. Differences in gene expression between natural and
artificially induced leaf senescence. Planta 189:74-79.

Berkeley M. (1875). Notices of North American Fungi 3:97-112.

Bhatia C.R., Murty G.S.S., Mathews V.H. 1985. Regeneration of plants from de-
embryonated peanut cotyledons cultured without nutrients and agar. Zeitschrift
Fur Pflanzenzuchtung-Journal of Plant Breeding 94:149-155.

Bhatnagar-Mathur P., Devi M.J., Reddy D.S., Lavanya M., Vadez V., Serraj R.,
Yamaguchi-Shinozaki K., Sharma K.K. 2007. Stress-inducible expression of At
DREB1A in transgenic peanut (Arachis hypogaea L.) increases transpiration
efficiency under water-limiting conditions. Plant Cell Reports 26:2071-2082.

Boote K., Jones J., Mishoe J., Berger R. 1983. Coupling pest to crop growth stimulators
to predict yield reductions. Phytopathology 73:1581-1587.

Bourgeois G., Boote K., Berger R. 1991. Growth, Development, Yield, and Seed
Quality of Florunner Peanut Affected by Late Leaf Spot. Peanut Science 18:137-
143.


121









Branch, W.D. 1994. Registration of 'Georgia Browne' peanut. Crop Science 34:1125-
1126.

Branch W. 1996. Registration of 'Georgia Green' peanut. Crop Science 36:806.

Branch W. 2002. Registration of 'Georgia-01R' Peanut. Crop Science 42:1750-1751.

Branch W. 2003. Registration of 'Georgia-02C' Peanut. Crop Science 43:1883-1884.

Branch W., Brenneman T. 2008. Registration of 'Georgia-07W' Peanut. Journal of Plant
Registrations 2:88-91.

Brar G.S., Cohen B.A., Vick C.L., Johnson G.W. 1994. Recovery of transgenic peanut
(arachis-hypogaea I) plants from elite cultivars utilizing ACCELL technology.
Journal of Cellular Biochemistry: 99-99.

Brault M., Maldiney R. 1999. Mechanisms of cytokinin action. Plant Physiology and
Biochemistry 37:403-412.

Buchanan-Wollaston V., Ainsworth C. 1997. Leaf senescence in Brassica napus:
Cloning of senescence related genes by subtractive hybridisation. Plant
Molecular Biology 33:821-834.

Calderini O., Bovone T., Scotti C., Pupilli F., Piano E., Arcioni S. 2007. Delay of leaf
senescence in Medicago sativa transformed with the ipt gene controlled by the
senescence-specific promoter SAG12. Plant Cell Reports 26:611-615.

Cantonwine E., Culbreath A., Holbrook C., Gorbet D. 2008. Disease Progress of Early
Leaf Spot and Components of Resistance to Cercospora arachidicola and
Cercosporidium personatum in Runner-Type Peanut Cultivars. Peanut Science
35:1-10.

Cantonwine E.G., Culbreath A.K., Stevenson K.L. 2007a. Effects of cover crop residue
and preplant herbicide on early leaf spot of peanut. Plant Disease 91:822-827.

Cantonwine E.G., Culbreath A.K., Stevenson K.L. 2007b. Characterization of early leaf
spot suppression by strip tillage in peanut. Phytopathology 97:187-194.

Cantonwine E.G., Culbreath A.K., Stevenson K.L., Kemerait R.C., Brenneman T.B.,
Smith N.B., Mullinix B.G. 2006. Integrated disease management of leaf spot and
spotted wilt of peanut. Plant Disease 90:493-500.

Chandra A., Pental D. 2003. Regeneration and genetic transformation of grain
legumes: An overview. Current Science 84:381-387.


122









Chang H.S., Jones M.L., Banowetz G.M., Clark D.G. 2003. Overproduction of
cytokinins in petunia flowers transformed with P-SAG12-IPT delays corolla
senescence and decreases sensitivity to ethylene. Plant Physiology 132:2174-
2183.

Chenault K., Ozias-Akins P., Gallo M., Srivastava P. 2008. Peanut. A Compendium of
Transgenic Crop Plants: Oilseed Crops.

Chenault K.D., Melouk H.A. 2003. Disease incidence, yield, and grade comparisons of
transgenic and non-transgenic peanut plants in field tests for Sclerotinia minor
resistance. Phytopathology 93:S16.

Chenault K.D., Payton M.E. 2003. Genetic transformation of a runner-type peanut with
the nucleocapsid gene of tomato spotted wilt virus. Peanut Science 30:112-115.

Chenault K.D., Payton M.E., Melouk H.A. 2003. Greenhouse testing of transgenic
peanut for resistance to Sclerotinia minor. Peanut Science 30:116-120.

Chenault K.D., Melouk H.A., Payton M.E. 2005. Field reaction to Sclerotinia blight
among transgenic peanut lines containing antifungal genes. Crop Science
45:511-515.

Chenault K.D., Burns J.A., Melouk H.A., Payton M.E. 2002. Hydrolase activity in
transgenic peanut. Peanut Science 29:89-95.

Cheng M., Jarrett R., Li Z., Demski J. 1997. Expression and inheritance of foreign
genes in transgenic peanut plants generated by Agrobacterium-mediated
transformation. Plant Cell Reports 16:541-544.

Cheng M., Jarret R.L., Li Z.J., Xing A.Q., Demski J.W. 1996. Production of fertile
transgenic peanut (Arachis hypogaea L) plants using Agrobacterium
tumefaciens. Plant Cell Reports 15:653-657.

Chengalrayan K., Gallo-Meagher M. 2004. Evaluation of runner and Virginia market
types for tissue culture responses. Peanut Science 31:74-78.

Chengalrayan K., Mhaske V.B., Hazra S. 1995. In vitro regulation of morphogenesis in
peanut (Arachis hypogaea L.). Plant Science 110:259-268.

Chengalrayan K., Mhaske V.B., Hazra S. 1997. High-frequency conversion of abnormal
peanut somatic embryos. Plant Cell Reports 16:783-786.

Chiteka Z., Gorbet D., Knauft D., Shokes F., Kucharek T. 1988a. Components of
resistance to late leafspot in peanut II. Correlations among components and
their significance in breeding for resistance. Peanut Science 15:76-81.


123









Chiteka Z., Gorbet D., Shokes F., Kucharek T., Knauft D. 1988b. Components of
Resistance to Late Leafspot in Peanut I. Levels and Variability Implications for
Selection. Peanut Science 15:25-30.

Chu Y., Deng X.Y., Faustinelli P., Ozias-Akins P. 2008. Bcl-xL transformed peanut
(Arachis hypogaea L.) exhibits paraquat tolerance. Plant Cell Reports 1:85-92.

Clemente T.E., Schnall J.A., Beute M.K., Weissinger A.K. 1992a. Analysis of peanut
(Arachis hypogaea L.) leaflets from mature zygotic embryos as a target tissue
for biolistic gene transfer. Phytopathology 82:1074.

Clemente T.E., Robertson D., Isleib T.G., Beute M.K., Weissinger A.K. 1992b.
Evaluation of peanut (Arachis hypogaea L.) leaflets from mature zygotic
embryos as recipient tissue for biolistic gene transfer. Transgenic Research
1:275-284.

Cook M. 1981. Susceptibility of peanut leaves to Cercosporidium personatum.
Phytopathology 71:787-791.

Culbreath A., Beasley J., Kemerait R., Prostko E., Brenneman T., Smith N., Tubbs S.,
Paz J., Olatinwo R., Tillman B., Gevens A., Weeks R., Hagan A. 2009. Peanut
Update, Peanut RX.

Damicone J.P., Jackson K.E. 1994. Response of peanut cultivars differing in
susceptibility to Sclerotinia blight to fungicide treatments. Phytopathology
84:1078.

Daub M., Ehrenshaft M. 2000. The photoactivated Cercospora toxin cercosporin:
contributions to plant disease and fundamental biology. Annual Review of
Phytopathology 38:461-490.

Deighton F.C. 1967. New names in Mycosphaerella (M. arachidis and M. pruni-persici)
and validation of M. rosicola. Transactions of the British Mycological Society
50:328-&.

Deng X.Y., Wei Z.M., An H.L. 2001. Transgenic peanut plants obtained by particle
bombardment via somatic embryogenesis regeneration system. Cell Research
11:156-160.

Dodo H., Konan K., Chen F., Egnin M., Viquez 0. 2007. Alleviating peanut allergy
using genetic engineering: the silencing of the immunodominant allergen Ara h 2
leads to its significant reduction and a decrease in peanut allergenicity. Plant
Biotechnology Journal 5.


124









Drake R., John I., Farrell A., Cooper W., Schuch W., Grierson D. 1996. Isolation and
analysis of cDNAs encoding tomato cysteine proteases expressed during leaf
senescence. Plant Molecular Biology 30:755-767.

Dunstan D., Thorpe A. 1986. Regeneration in forest trees, in: E. Vasil (Ed.), Cell culture
and somatic cell genetics of plants, Academic Press, Orlando, FL. pp. 223-243.

Dwivedi S., Pande S., Rao J., Nigam S. 2002. Components of resistance to late leaf
spot and rust among interspecific derivatives and their significance in a foliar
disease resistance breeding in groundnut (Arachis hypogaea L.). Euphytica
125:81-88.

Eapen S., George L. 1994. Agrobacterium-tumefaciens-mediated gene-transfer in
peanut (Arachis hypogaea L.). Plant Cell Reports 13:582-586.

Egnin M., Mora A., Prakash C.S. 1998. Factors enhancing Agrobacterium tumefaciens-
mediated gene transfer in peanut (Arachis hypogaea L.). In Vitro Cellular &
Developmental Biology Plant 34:310-318.

FAO Statisics. 2010. Countries by Commodity: Groundnuts. http://faostat.fao.org.

Favero A.P., Simpson C.E., Vails J.F.M., Vello N.A. 2006. Study of the evolution of
cultivated peanut through crossability studies among Arachis ipaensis, A.
duranensis, and A. hypogaea. Crop Science 46:1546-1552.

Fernandez A., Krapovickas A. 1994. Chromosomes and evolution in Arachis
(Leguminosae). Bonplandia 8:187-220.

Foster D., Beute M., Wynne J. 1980. Spore production and latent period as
mechanisms of resistance to Cercospora arachidicola in four peanut genotypes.
Peanut Science 7:88-89.

Franklin C.I., Shorrosh K.M., Trieu A.N., Cassidy B.G., Nelson R.S. 1993. Stable
transformation of peanut callus via Agrobacterium-mediated DNA transfer.
Transgenic Research 2:321-324.

Galgaro L., Lopes C.R., Gimenes M., Vails J.F.M., Kochert G. 1998. Genetic variation
between several species of sections Extranervosae, Caulorrhizae, Heteranthae,
and Triseminatae (genus Arachis) estimated by DNA polymorphism. Genome
41:445-454.

Gan S., Amasino R. 1995. Inhibition of Leaf Senescence by Autoregulated Production
of Cytokinin. Science 270:1986-1988.

Gan S.S., Amasino R.M. 1997. Making sense of senescence Molecular genetic
regulation and manipulation of leaf senescence. Plant Physiology 113:313-319.


125









Garcia G.M., Stalker H.T., Kochert G. 1995. Introgression analysis of an interspecific
hybrid population in peanuts (Arachis hypogaea L.) using RFLP and RAPD
markers. Genome 38:166-176.

Gepstein S., Sabehi G., Carp M.J., Hajouj T., Nesher M.F.O., Yariv I., Dor C., Bassani
M. 2003. Large-scale identification of leaf senescence-associated genes. Plant
Journal 36:629-642.

Gibbons R. 1966. Mycosphaerella leafspots of groundnuts. FAO Plant Protection
Bulletin:15-30.

Gorbet D. 2007a. Registration of 'AP-3' Peanut. Journal of Plant Registrations 1:126-
127.

Gorbet D. 2007b. Registration of 'Hull' Peanut. Journal of Plant Registrations 1:125-
126.

Gorbet D., Shokes F. 2002a. Registration of 'C-99R' peanut. Crop Science 42:2207.

Gorbet D., Shokes F. 2002b. Registration of 'Florida MDR 98' Peanut. Crop Science
42:2207-2208.

Gorbet D., Tillman B. 2008. Registration of 'DP-1' Peanut. Journal of Plant
Registrations 2:200-204.

Gorbet D., Norden A., Shokes F., Knauft D. 1987a. Registration of 'Southern Runner'
peanut. Crop Science 27:817.

Gorbet D.W., Tillman B.L. 2009. Registration of'Florida-07' Peanut. Journal of Plant
Registrations 3:14-18.

Gorbet D.W., Norden A.J., Shokes F.M., Knauft D.A. 1987b. Registration of Southern
Runner peanut. Crop Science 27:817-817.

Graaff E.v.d., Schwacke R., Schneider A., Desimone M., Flugge U.I., Kunze R. 2006.
Transcription analysis of Arabidopsis membrane transporters and hormone
pathways during developmental and induced leaf senescence. Plant Physiology
141:776-792.

Gray D., Benton C. 1991. In vitro micropropagation and plant establishment of
muscadine grape cultivars (Vitis rotundifolia). Plant Cell, Tissue and Organ
Culture 27:7-14.

Green C., Wynne J. 1986. Field and greenhouse evaluation of the components of
partial resistance to early leafspot in peanut. Euphytica 35:561-573.


126









Green J., Gallo M. 2001. Suitability of b-glucuronidase and the green fluorescent
protein as reporters for transformation of peanut merstimatic tissue. Soil and
Crop Science Society of Florida 60:98-104.

Greenberg J., Yao N. 2004. The role and regulation of programmed cell death in plant-
pathogen interactions. Cellular Microbiology 6:201-211.

Gregory W., Gregory M. 1976. Groundnut, in: N. Simmonds (Ed.), Evolution of crop
plants, Longman Group Ltd., London, UK. pp. 151-154.

Gregory W., Krapovickas A., Gregory M. 1980. Structure, variation, evolution and
classification in Arachis, in: R. Summerfield and A. Bunting (Eds.), Advances in
Legume Science. pp. 469-481.

Grieshammer U., Wynne J.C. 1990. Mendelian and non-mendelian inheritance of
three isozymes in peanut Arachis hypogaea L. Peanut Science 17:101-105.

Halward T., Stalker H.T., Kochert G. 1993. Development of an RFLP linkage map in
diploid peanut species. Theoretical and Applied Genetics 87:379-384.

Halward T., Stalker T., Larue E., Kochert G. 1992. Use of single-primer DNA
amplifications in genetic-studies of peanut (Arachis hypogaea L.). Plant
Molecular Biology 18:315-325.

Halward T.M., Stalker H.T., Larue E.A., Kochert G. 1991. Genetic-variation detectable
with molecular markers among unadapted germplasm resources of cultivated
peanut and related wild-species. Genome 34:1013-1020.

Harris G., Hart E. 1964. Regeneration from leaf squares of Peperomia sandersii A, DC:
a relationship between rooting and budding. Annals of Botany 28:509-526.

Hazra S., Sathaye S.S., Mascarenhas A.F. 1989. Direct somatic embryogenesis in
peanut (Arachis hypogeal L.). Bio-Technology 7:949-951.

He G.H., Prakash C.S. 1997. Identification of polymorphic DNA markers in cultivated
peanut (Arachis hypogaea L.). Euphytica 97:143-149.

He G.H., Prakash C. 2001. Evaluation of genetic relationships among botanical
varieties of cultivated peanut (Arachis hypogaea L.) using AFLP markers.
Genetic Resources and Crop Evolution 48:347-352.

Hemingway J. 1954. Cercospora leafspot of groundnuts inTanganyika 19:263-267.

Herselman L. 2003. Genetic variation among Southern African cultivated peanut
(Arachis hypogaea L.) genotypes as revealed by AFLP analysis. Euphytica
133:319-327.


127









Higgins C.M., Hall R.M., Mitter N., Cruickshank A., Dietzgen R.G. 2004. Peanut stripe
potyvirus resistance in peanut (Arachis hypogaea L.) plants carrying viral coat
protein gene sequences. Transgenic Research 13:59-67.

Hirose N., Takei K., Kuroha T., Kamada-Nobusada T., Hayashi H., Sakakibara H.
2008. Regulation of cytokinin biosynthesis, compartmentalization and
translocation. Journal of Experimental Botany 59:75-83.

Hokanson K.E., Pooler M.R. 2000. Regeneration of ornamental cherry (Prunus) taxa
from mature stored seed. Hortscience 35:745-748.

Holbrook C., Culbreath A. 2007. Registration of 'Tifrunner' Peanut. Journal of Plant
Registrations 1:124.

Holbrook C., Culbreath A. 2008. Registration of 'Georganic' Peanut. Journal of Plant
Registrations 2:17.

Hopkins M.S., Casa A.M., Wang T., Mitchell S.E., Dean R.E., Kochert G.D., Kresovich
S. 1999. Discovery and characterization of polymorphic simple sequence
repeats (SSRs) in peanut. Crop Science 39:1243-1247.

Hsi, D.C.H., and R.E. Finkner. 1972. Registration of New Mexico Valencia A peanut.
Crop Science 12:256.

Humbeck K., Quast S., Krupinska K. 1996. Functional and molecular changes in the
photosynthetic apparatus during senescence of flag leaves from field-grown
barley plants. Plant Cell and Environment 19:337-344.

Husted L. 1936. Cytological studies of the peanut Arachis. 2. Chromosome number,
morphology and behavior, and their application to the problem of the origin of
the cultivated forms. Cytologia 7:396-423.

Illingworth J.E. 1968. Peanut plants from single de-embryonated cotyledons.
Hortscience 3:238, 276.

Isleib, T.G., Mozingo, R.W., Copeland, S.C., Graber, J.B., Shew, B.B., Smith, D.L.,
Melouk, H.A., Stalker, H.T. 2006. Registration of N96076L Peanut Germplasm
Line. Crop Science 46: 2329-2330.

Jacobi J.C., Backman P.A. 1995. AU-peanuts advisory .2. Modification of the rule-
based leaf-spot advisory system for a partially resistant peanut cultivar. Plant
Disease 79:672-676.

Jacobi J.C., Backman P.A., Davis D.P., Brannen P.M. 1995. AP-peanuts advisory .1.
Development of a rule-based system for scheduling peanut leaf-spot fungicide
applications. Plant Disease 79:666-671.


128









Jandrew J. 2002. Nutritional and Fungal Stress Responses of Transgenic Petunias with
Delayed Leaf Senescence, Horticulture, University of Florida, Gainesville, FL.

Jenkins W. 1938. Two fungi causing leafspot of peanuts. Journal of Agricultural
Research 56:317-332.

Jensen R.E., Boyle L.W. 1965. The effect of temperature, relative humidity and
precipitation on peanut leaf spot. Plant Dis Rep 49:975-978.

Jiang C., Rodermel S., Shibles R. 1993. Photosynthesis, rubisco activity and amount,
and their regulation by transcription in senescing soybean leaves. Plant
Physiology 101:105-112.

Jordi W., Schapendonk A., Davelaar E., Stoopen G.M., Pot C.S., De Visser R., Van
Rhijn J.A., Gan S., Amasino R.M. 2000. Increased cytokinin levels in transgenic
P-SAG12-IPT tobacco plants have large direct and indirect effects on leaf
senescence, photosynthesis and N partitioning. Plant Cell and Environment
23:279-289.

Joshi M., Sujatha K., Hazra S. 2008. Effect of TDZ and 2, 4-D on peanut somatic
embryogenesis and in vitro bud development. Plant Cell Tissue and Organ
Culture 94:85-90.

Joshi M., Niu C., Fleming G., Hazra S., Chu Y., Nairn C.J., Yang H.Y., Ozias-Akins P.
2005. Use of green fluorescent protein as a non-destructive marker for peanut
genetic transformation. In Vitro Cellular & Developmental Biology Plant 41:437-
445..

Kartha K.K., Pahl K., Keung N., Mroginski L. 1981. Plant regeneration from meristems
of grain legumes: soybean, cowpea, peanut, chickpea, and bean. Canadian
Journal of Botany 59:1671-1679.

Khandelwal A., Renukaradhya G.J., Rajasekhar M., Sita G.L., Shaila M.S. 2004.
Systemic and oral immunogenicity of hemagglutinin protein of rinderpest virus
expressed by transgenic peanut plants in a mouse model. Virology 323:284-291.

Khandelwal A., Vally K., Geetha N., Venkatachalam P., Shaila M., Lakshmi Sita G.
2003. Engineering hemagglutinin (H) protein of rinderpest virus into peanut
(Arachis hypogaea L.) as a possible source of vaccine. Plant Science 165:77-84.

King P.S., Rodriguez-Kabana R., Robertson D.G., Weaver C.F. 1995. Long-term study
on the value of new crops for the management of root-knot and southern blight
in 'Florunner' peanut. Journal of Nematology 27:505.


129









Kirti P., Bharati M., Murty U., Rao N. 1983. Chromosome morphology in three diploid
species of Arachis and its bearing on the genomes of groundnut (Arachis
hypogaea L.). Cytologia 48:139-151.

Klosova E., Turkova V., Smartt J., Pitterova K., Svachulova J. 1983. Immunochemical
characterization of seed proteins of some species of the genus Arachis. Biologia
Plantarum 25:201-208.

Knauft D.A., Gorbet D.W. 1989. Genetic diversity among peanut cultivars. Crop
Science 29:1417-1422.

Knauft D.A., Norden A.J., Gorbet D.W. 1986. The effect of three digging dates on oil
quality yield and grade of five peanut genotypes grown without leafspot control.
Peanut Science 13:82-86.

Knauft D.A., Norden A.J., Gorbet D.W., Martin F.G. 1987. Stability of market quality
factors in peanut (Arachis hypogaea L.). Soil and Crop Science Society of
Florida Proceedings 46:72-74.

Kochert G., Halward T., Branch W.D., Simpson C.E. 1991. RFLP variability in peanut
(Arachis hypogaea L.) cultivars and wild-species. Theoretical and Applied
Genetics 81:565-570.

Kochert G., Stalker H.T., Gimenes M., Galgaro L., Lopes C.R., Moore K. 1996. RFLP
and cytogenetic evidence on the origin and evolution of allotetraploid
domesticated peanut, Arachis hypogaea (Leguminosae). American Journal of
Botany 83:1282-1291.

Krapovickas A., Gregory W.C. 1994. Taxonomy of the genus Arachis (Leguminosae).
Bonplandia 8:1-186.

Lacks G.D., Stalker H.T. 1993. Isozyme analyses of Arachis species and interspecific
hybrids. Peanut Science 20:76-81.

Lacorte C., Mansur E., Timmerman B., Cordeiro A.R. 1991. Gene-transfer into peanut
(Arachis hypogaea L.) by Agrobacterium-tumefaciens. Plant Cell Reports
10:354-357.

Lanham P.G., Fennell S., Moss J.P., Powell W. 1992. Detection of polymorphic loci in
Arachis germplasm using random amplified polymorphic DNAs. Genome
35:885-889.

Lee R.-H., Huang L.-T., Chen Shu-Chen G. 2001. Leaf senescence in rice plants. Plant
Biology (Rockville) 2001:60.


130









Li Y., Hagen G., Guilfoyle T. 1992. Altered Morphology in Transgenic Tobacco Plants
That Overproduce Cytokinins in Specific Tissues and Organs. Developmental
Biology 153:386-395.

Li Z.J., Jarret R.L., Demski J.W. 1997. Engineered resistance to tomato spotted wilt
virus in transgenic peanut expressing the viral nucleocapsid gene. Transgenic
Research 6:297-305.

Li Z.J., Jarret R.L., Pittman R.N., Demski J.W. 1994. Shoot organogenesis from
cultured seed explants of peanut (Arachis hypogaea L.) using thidiazuron. In
Vitro Cellular & Developmental Biology-Plant 30P: 187-191.

Lim P.O., Kim H.J., Nam H.G. 2007. Leaf senescence. Annual Review of Plant Biology
58:115-136.

Livingstone D.M., Birch R.G. 1999. Efficient transformation and regeneration of diverse
cultivars of peanut (Arachis hypogaea L.) by particle bombardment into
embryogenic callus produced from mature seeds. Molecular Breeding 5:43-51.

Livingstone D.M., Hampton J.L., Phipps P.M., Grabau E.A. 2005. Enhancing resistance
to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene.
Plant Physiology 137:1354-1362.

Lohman K.N., Gan S.S., John M.C., Amasino R.M. 1994. Molecular analysis of natural
leaf senescence in Arabidopsis thaliana. Physiologia Plantarum 92:322-328.

Lu J., Pickersgill B. 1993. Isozyme variation and species relationships in peanut and its
wild relatives (Arachis L. Leguminosae). Theoretical and Applied Genetics
85:550-560.

Luo M., P D., Bausher M., Holbrook C., Lee R., Lynch, RE, Guo, BZ. 2005.
Identification of Transcripts Involved in Resistance Responses to Leaf Spot
Disease Caused by Cercosporidium personatum in Peanut (Arachis hypogaea).
Phytopathology 95:381-387.

Magbanua Z., Wilde H., Roberts J., Chowdhury K., Abad J., Moyer J., Wetzstein H.,
Parrott W. 2000. Field resistance to tomato spotted wilt virus in transgenic
peanut (Arachis hypogaea L.) expressing an antisense nucleocapsid gene
sequence. Molecular Breeding 6:227-236.

Martin J. 1970. Culture in vitro d'ovules d'arachide. Oleagineux 25:155-156.

Matand K., Prakash C.S. 2007. Evaluation of peanut genotypes for in vitro plant
regeneration using thidiazuron. Journal of Biotechnology 130:202-207.


131









McCabe M.S., Garratt L.C., Schepers F., Jordi W., Stoopen G.M., Davelaar E., van
Rhijn J.H.A., Power J.B., Davey M.R. 2001. Effects of P-SAG12-IPT gene
expression on development and senescence in transgenic lettuce. Plant
Physiology 127:505-516.

McKently A.H. 1991. Direct somatic embryogenesis from axes of mature peanut
embryos. In Vitro Cellular and Developmental Biology Plant 27P:197-200.

McKently A.H., Moore G.A., Gardner F.P. 1990. In vitro plant-regeneration of peanut
from seed explants. Crop Science 30:192-196.

McKently A.H., Moore G.A., Doostdar H., Niedz R.P. 1995. Agrobacterium-mediated
transformation of peanut (Arachis hypogaea L.) embryo axes and the
development of transgenic plants. Plant Cell Reports 14:699-703.

Melouk H., Banks D. 1986 Assessment of resistance to Cercospora arachidicola in
peanut genotypes in field plots. Plant Disease 68:395-397.

Morton B. 2007. Poor field emergence of late-maturing peanut cultivars (Arachis
hypogaea L.) derived from PI-203396, Dissertation, Agronomy, University of
Florida, Gainesville, FL.

Mossier M., Aerts M. 2007. Florida Crop/Pest Management Profiles: Peanuts, IFAS
Extension EDIS.

Mroginski L.A. 1981. Regeneration of peanut (Arachis hypogaea L.) plantlets by in vitro
culture of immature leaves. Environmental and Experimental Botany 21:437-
437.

Murashige Y., Skoog F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiologia Plantarum 15:473-497.

Murty U.R., Jahnavi M.R. 1986. The A genome of Arachis hypogaea L. Cytologia
51:241-250.

Narasimhulu S.B., Reddy G.M. 1983. Plantlet regeneration from different callus-
cultures of Arachis hypogaea L. Plant Science Letters 31:157-163.

Nwokolo E. 1996. Peanut (Arachis hyogaea L.), in: J. Smartt and E. Nwokolo (Eds.),
Food and Feed from Legumes and Oilseeds, Chapman & Hall, London, UK. pp.
48-58.

Ori N., Juarez M.T., Jackson D., Yamaguchi J., Banowetz G.M., Hake S. 1999. Leaf
senescence is delayed in tobacco plants expressing the maize homeobox gene
knotted under the control of a senescence-activated promoter. Plant Cell
11:1073-1080.


132









Ozias-Akins P., Gill R. 2001. Progress in the development of tissue culture and
transformation methods applicable to the production of transgenic peanut.
Peanut Science 28:123-131.

Ozias-Akins P., Yang H., Gill R., Fan H., Lynch R. 2002. Reduction of aflatoxin
contamination in peanut: A genetic engineering approach. ACS Symposium
Series 829:151-160.

Ozias-Akins P. 1989. Plant-regeneration from immature embryos of peanut. Plant Cell
Reports 8:217-218.

Ozias-Akins P., Anderson W.F., Holbrook C.C. 1992. Somatic embryogenesis in
Arachis hypogaea L. genotype comparison. Plant Science 83:103-111.

Ozias-Akins P., Schnall J.A., Anderson W.F., Singsit C., Clemente T.E., Adang M.J.,
Weissinger A.K. 1993. Regeneration of transgenic peanut plants from stably
transformed embryogenic callus. Plant Science 93:185-194.

Paik-ro O.G., Smith R.L., Knauft D.A. 1992. Restriction-fragment-length-polymorphism
evaluation of 6 peanut species within the Arachis section. Theoretical and
Applied Genetics 84:201-208.

Pattee H.E., Young C.T., American Peanut Research and Education Society. 1982.
Peanut science and technology American Peanut Research and Education
Society, Yoakum, Tex.

Pittman R.N., Banks D.J., Kirby J.S., Mitchell E.D., Richardson P.E. 1983. In vitro
culture of immature peanut (Arachis spp.) leaves: morphogenesis and plantlet
regeneration. Peanut Science 10:21-25.

Pixley K.V., Boote K.J., Shokes F.M., Gorbet D.W. 1990a. Disease progression and
leaf-area dynamics of 4 peanut genotypes differing in resistance to late leafspot.
Crop Science 30:789-796.

Pixley K.V., Boote K.J., Shokes F.M., Gorbet D.W. 1990b. Growth and partitioning
characteristics of 4 peanut genotypes differing in resistance to late leafspot.
Crop Science 30:796-804.

Preece J., Imel M. 1991. Plant regeneration from leaf explants of Rhododendron P.J.M.
hybrids. Scientia Horticulturae 48:159-170.

Raina S., Mukai Y. 1999. Genomic in situ hyridization in Arachis (Fabaceae) identifies
the diploid wild progenitors of cultivated (A. hypogaea) and related wild (A.
monticola) peanut species. Plant Systemics & Evolution 214:251-262.


133









Raina S.N., Rani V., Kojima T., Ogihara Y., Singh K.P., Devarumath R.M. 2001. RAPD
and ISSR fingerprints as useful genetic markers for analysis of genetic diversity,
varietal identification, and phylogenetic relationships in peanut (Arachis
hypogaea) cultivars and wild species. Genome 44:763-772.

Ricker M., Beute M., Campbell C. 1985. Components of resistance in peanut to
Cercospora arachidicola. Plant Disease 69:1059-1064.

Rohini V., Rao K. 2000. Transformation of peanut (Arachis hypogaea L.): a non-tissue
culture based approach for generating transgenic plants. Plant Science 150:41-
49.

Rohini V.K., Rao K.S. 2001. Transformation of peanut (Arachis hypogaea L.) with
tobacco chitinase gene: variable response of transformants to leaf spot disease.
Plant Science 160:889-898.

Sakakibara H. 2005. Cytokinin biosynthesis and regulation. Plant Hormones 72:271-
287.

Sakakibara H. 2006. Cytokinins: Activity, biosynthesis, and translocation. Annual
Review of Plant Biology 57:431-449.


SAS Institute Inc. 2000. Version 8, Cary, NC: SAS Institute Inc.

Seetharam A., Nayar K., Sreekantaradhya R., Achar D. 1973. Cytological studies on
the interspecific hybrid of Arachis hypogaea x Arachis duranensis. Cytologia
38:277-280.

Seijo G., Lavia G.I., Fernandez A., Krapovickas A., Ducasse D.A., Bertioli D.J.,
Moscone E.A. 2007. Genomic relationships between the cultivated peanut
(Arachis hypogaea, Leguminosae) and its close relatives revealed by double
GISH. American Journal of Botany 94:1963-1971.

Seijo J.G., Lavia G.I., Fernandez A., Krapovickas A., Ducasse D., Moscone E.A. 2004.
Physical mapping of the 5S and 18S-25S rRNA genes by fish as evidence that
Arachis duranensis and A. ipaensis are the wild diploid progenitors of A.
hypogaea (Leguminosae). American Journal of Botany 91:1294-1303.

Seitz M.H., Stalker H.T., Green C.C. 1987. Genetic-variation for regenerative response
in immature leaflet cultures of the cultivated peanut, Arachis hypogaea. Plant
Breeding 98:104-110.

Sharma K., Bhatnagar-Mathur P. 2006. Peanut (Arachis hypogaea L.), in: K. Wang
(Ed.), Methods in Molecular Biology. pp. 347-358.


134









Sharma K.K., Bhatnagar-Mathur P., Thorpe T.A. 2005. Genetic transformation
technology: status and problems. In Vitro Cellular & Developmental Biology -
Plant 41:102-112.

Sharma K.K., Anjaiah V. 2000. An efficient method for the production of transgenic
plants of peanut (Arachis hypogaea L.) through Agrobacterium tumefaciens-
mediated genetic transformation. Plant Science 159:7-19.

Shew B.B., Beute M.K., Wynne J.C. 1988. Effects of temperature and relative-humidity
on expression of resistance to cercosporidium personatum in peanut.
Phytopathology 78:493-498.

Shokes F., Gorbet D., Jackson L. 1983. Control of early and late leaf spot on two
peanut cultivars. Peanut Science 10:17-21.

Simpson C.E., Starr J.L. 2001. Registration of'COAN' peanut. Crop Science 41:918-
918.

Singh A., Moss J. 1982. Utilization of wild relatives in genetic improvement of Arachis
hypogaea L. Chromosome complements of species in section Arachis.
Theoretical and Applied Genetics 61:305-314.

Singh A., Moss J. 1984. Utilization of wild relatives in genetic improvement of Arachis
hypogaea L. 2.Chromosome complements of species in the section Arachis.
Theoretical and Applied Genetics 68:355-364.

Singh A., Smartt J. 1998. The genome donors of the groundnut/peanut (Arachis
hypogaea L.) revisited. Genetic Resources and Crop Evolution 45:113-118.

Singh A.K. 1986. Utilization of wild relatives in the genetic-improvement of Arachis
hypogaea L .7. Autotetraploid production and prospects in interspecific breeding.
Theoretical and Applied Genetics 72:164-169.

Singh A.K. 1988. Putative genome donors of arachis-hypogaea (fabaceae), evidence
from crosses with synthetic amphidiploids. Plant Systematics and Evolution
160:143-151.

Singh A.K., Stalker H.T., Moss J.P. 1991a. Cytogenetics and use of alien genetic
variation in groundnut improvement. Chromosome engineering in plants:
genetics, breeding, evolution. Part B.:65-77.

Singh A.K., Gurtu S., Jambunathan R. 1994. Phylogenetic-relationships in the genus
Arachis based on seed protein profiles. Euphytica 74:219-225.


135









Singh A.K., Sivaramakrishnan S., Mengesha M.H., Ramaiah C.D. 1991b. Phylogenetic
relations in section Arachis based on seed protein profile. Theoretical and
Applied Genetics 82:593-597.

Singh A.K., Chand S., Pattnaik S., Chand P.K. 2002. Adventitious shoot organogenesis
and plant regeneration from cotyledons of Dalbergia sissoo Roxb., a timber
yielding tree legume. Plant Cell Tissue and Organ Culture 68:203-209.

Singh K.P., Raina S.N., Singh A.K. 1996. Variation in chromosomal DNA associated
with the evolution of Arachis species. Genome 39:890-897.

Singsit C., Adang M.J., Lynch R.E., Anderson W.F., Wang A.M., Cardineau G.,
OziasAkins P. 1997. Expression of a Bacillus thuringiensis crylA(c) gene in
transgenic peanut plants and its efficacy against lesser cornstalk borer.
Transgenic Research 6:169-176.

Smart C., Scofield S., Bevan M., Dyer T. 1991. Delayed Leaf Senescence in Tobacco
Plants Transformed with tmr, a Gene for Cytokinin Production in Agrobacterium.
The Plant Cell 3:647-656.

Smart C., Hosken S., Thomas H., Greaves J., Blair B., Schuch W. 1995. The timing of
maize leaf senescence and characterization of senescence-related cDNAs.
Physiologia Plantarum 93:637-682.

Smartt J., Gregory W., Gregory M. 1978. The genomes of Arachis hypogaea.
Cytogenetic studies of putative genome donors. Euphytica 27:665-675.

Smith, N.B., Smith, A.R. 2009. Peanut: Estimated Costs and Returns. Extension Ag
and Applied Economics, University of Georgia College of Agriculture and
Environmental Science, www.ces.uga.edu.

Smith D.H., Littrell R.H. 1980. Management of peanut foliar diseases with fungicides.
Plant Disease 64:356-361.

Stalker H.T., Dhesi J.S., Kochert G. 1995. Genetic diversity within the species Arachis
duranensis Krapov & W.C. Gregory, a possible progenitor of cultivated peanut.
Genome 38:1201-1212.

Stalker, H.T., Simpson, C.E. 1995. Genetic resources in Arachis, In H. E. Pattee and H.
T. Stalker (eds.), Advances in Peanut Science: 14-53. Amer. Peanut Res. Educ.
Soc., Stillwater, OK.

Stalker H.T., Phillips T.D., Murphy J.P., Jones T.M. 1994. Variation of isozyme patterns
among Arachis species. Theoretical and Applied Genetics 87:746-755.


136









Stalker H.T., Beute M.K., Shew B.B., Isleib T.G. 2002. Registration of five leaf spot-
resistant peanut germplasm lines. Crop Science 42:314-316.

Stoessl A. 1984. Dothistromin as a metabolite of Cercospora arachidicola.
Mycopathologia 86:165-168.

Stoessl A., Abramowski Z., Lester H.H., Rock G.L., Towers G.H.N. 1990. Further toxic
properties of the fungal metabolite dothistromin. Mycopathologia 112:179-186.

Subrahmanyam P., McDonald D., Gibbons R., Nigam S., Nevill D. 1982. Resistance to
rust and late leaf spot diseases in some genotypes of Arachis hypogaea. Peanut
Science 9:6-10.

Subramanian V., Gurtu S., Rao R.C.N., Nigam S.N. 2000. Identification of DNA
polymorphism in cultivated groundnut using random amplified polymorphic DNA
(RAPD) assay. Genome 43:656-660.

Sujatha K., Panda B.M., Hazra S. 2008. De novo organogenesis and plant
regeneration in Pongamia pinnata, oil producing tree legume. Trees-Structure
and Function 22:711-716.

Swartzberg D., Dai N., Gan S., Amasino R., Granot D. 2006. Effects of cytokinin
production under two SAG promoters on senescence and development of
tomato plants. Plant Biology 8:579-586.

Swartzberg D., Kirshner B., Rav-David D., Elad Y., Granot D. 2008. Botrytis cinerea
induces senescence and is inhibited by autoregulated expression of the IPT
gene. European Journal of Plant Pathology 120:289-297.

Sykorova B., Kuresova G., Daskalova S., Trckova M., Hoyerova K., Raimanova I.,
Motyka V., Travnickova A., Elliott M.C., Kaminek M. 2008. Senescence-induced
ectopic expression of the A-tumefaciens ipt gene in wheat delays leaf
senescence, increases cytokinin content, nitrate influx, and nitrate reductase
activity, but does not affect grain yield. Journal of Experimental Botany 59:377-
387.

Tang R., Gao G., He L., Han Z., Shan S., Zhong R., Zhou C., Jiang J., Li Y., Zhuang
W. 2007. Genetic diversity in cultivated groundnut based on SSR markers.
Journal of Genetics and Genomics 34:449-459.

Tillman B., Stalker H. 2009. Peanuts, in: J. Vollman and I. Rajcan (Eds.), Oil Crops,
Handbook of Plant Breeding. pp. 287-315.

Tiwari S., Tuli R. 2009. Multiple shoot regeneration in seed-derived immature leaflet
explants of peanut (Arachis hypogaea L.). Scientia Horticulturae 121:223-227..


137









Tiwari S., Mishra D.K., Singh A., Singh P.K., Tuli R. 2008. Expression of a synthetic
cryl EC gene for resistance against Spodoptera litura in transgenic peanut
(Arachis hypogaea L.). Plant Cell Reports 27:1017-1025.


Tiwari, S., Tuli, R. 2008. Factors promoting efficient in vitro regeneration from de-
embryonated cotyledon explants of Arachis hypogaea L. Plant Cell Tissue Organ
Culture 92:15-24.

USDA, NASS 2010. Crop Acreage and Values: Peanut. http://www.nass.usda.gov.

Venkatachalam P., Geetha N., Jayabalan N., Saravanababu, Sita L. 1998.
Agrobacterium-mediated genetic transformation of groundnut (Arachis hypogaea
L.): An assessment of factors affecting regeneration of transgenic plants. Journal
of Plant Research 111:565-572.

Venkatachalam V., Geetha N., Khandelwal A., Shaila M., Lakshmi Sita G. 2000.
Agrobacterium-mediated genetic transformation and regeneration of transgenic
plants from cotyledon explants of groundnut (Arachis hypogaea L.) via somatic
embryogensis. Current Science 78:1130-1136.

Victor J.M.R., Murch S.J., KrishnaRaj S., Saxena P.K. 1999. Somatic embryogenesis
and organogenesis in peanut: The role of thidiazuron and N-6-
benzylaminopurine in the induction of plant morphogenesis. Plant Growth
Regulation 28:9-15.

Walls S., Wynne J., Beute M. 1985. Resistance to late leafspot of peanut of progenies
selected for resistance to early leafspot. Peanut Science 12:22-27.

Wang A.M., Fan H.L., Singsit C., Ozias-Akins P. 1998. Transformation of peanut with a
soybean vspB promoter-uidA chimeric gene. I. Optimization of a transformation
system and analysis of GUS expression in primary transgenic tissues and
plants. Physiologia Plantarum 102:38-48.

Watanabe A., Imaseki H. 1982. Changes in translatable messenger-rna in senescing
wheat leaves. Plant and Cell Physiology 23:489-497.

Watson G.R., Kucharek T.A., Shokes F.M. 1998. Components of resistance in peanut
to late peanut leaf spot. Proceedings Soil and Crop Science Society of Florida
57:87-91.

Woodroff N. 1933. Two leafspots of the peanut (Arachis hypogeae L.). Phytopathology
23:627-640.


138









Wright D., Tillman B., Jowers E., Marois J., Ferrell J., Katsvairo T., Whitty E. 2009.
Management and Cultural Practices for Peanuts, IFAS Extenson EDIS,
University of Florida, Gainesville, FL.

Wu L., Damicone J., Duthie J., Melouk H. 1999. Effects of temperature and wetness
durtion on infection of peanut cultivars by Cercospora arachidicola.
Phytopathology 89:653-659.

Yang H., Singsit C., Wang A., Gonsalves D., Ozias-Akins P. 1998. Transgenic peanut
plants containing a nucleocapsid protein gene of tomato spotted wilt virus show
divergent levels of gene expression. Plant Cell Reports 17:693-699.

Yang H.Y., Nairn J., Ozias-Akins P. 2003. Transformation of peanut using a modified
bacterial mercuric ion reductase gene driven by an actin promoter from
Arabidopsis thaliana. Journal of Plant Physiology 160:945-952.

Yin D.M., Deng S.Z., Zhan K.H., Cui D.Q. 2007. High-oleic peanut oils produced by
HpRNA-mediated gene silencing of oleate desaturase. Plant Molecular Biology
Reporter 25:154-163.


Zhang, P., Wang, W., Zhang, G., Kaminek, G.M., Dobrev, P., Xu, J.,Gruissem, W. 2010.
Senescence-Inducible Expression of Isopentenyl Transferase Extends Leaf Life,
Increases Drought Stress Resistance and Alters Cytokinin Metabolism in
Cassava. Journal of Integrative Plant Biology, online.

Zhang S., Reddy M.S., Kokalis-Burelle N., Wells L.W., Nightengale S.P., Kloepper J.W.
2001. Lack of induced systemic resistance in peanut to late leaf spot disease by
plant growth-promoting rhizobacteria and chemical elicitors. Plant Disease
85:879-884.


139









BIOGRAPHICAL SKETCH

Scott Burns was born in 1983 in Marietta, Georgia to Mike and Neva Burns. Scott

attended elementary, middle, and high school in his hometown, Canton, Georgia. Scott

graduated from Cherokee High School in 2002. Upon completing high school, Scott

enrolled at the University of Georgia. He graduated from UGA in 2006 with a Bachelor

of Science degree in applied biotechnology. While working as an undergraduate

research assistant at UGA, Scott developed an interest in using genetic approaches to

improve agricultural performance in agronomic crops. Upon completion of his

undergraduate degree, Scott took an internship position managing a production

greenhouse for the Walt Disney Company in Orlando, Florida. After completing his

internship, Scott enrolled in at the University of Florida in 2007, serving as a graduate

assistant in the Agronomy Department. Scott will earn a Master of Science in agronomy

from UF in 2010. His master's degree research focused on using genetic strategies to

develop novel sources of tolerance to peanut leaf spot disease.


140





PAGE 1

1 STRATEGIES FOR ENHANCING LEAF SPOT ( C ercospora arachidicola AND C ercosporidium personatum ) TOLERANCE IN PEANUT ( A rachis hypogaea L.) By SCOTT P. BURNS A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Scott P. Burns

PAGE 3

3 To my family and friends, who have no idea what I ve been study ing but have enthusiastically support ed me nonethel ess

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank Dr. Barry Tillman and Dr. Maria Gallo for giving me the opportunity to study at the University of Florida. I could not have as ked for a more knowledgeable, supportive or friendly pair of advisors I would lik e to thank the rest of my committee, Dr. David Clark, Dr. John Erikson, and Dr. Amanda Gevens, for their assistance and input throughout my research. I am especially thankful to Dr. Victoria James Hurr, who se understanding of genetics and molecular biology seemed endless her assistance always exceeded expectation. I would also like to extend thanks to Dr. Mukesh Jain, Dr. Yolanda Lopez Mr. Justin McKinney, and Mr. Mark Gomillion for all their technical support throughout the course of my research project. I would like to thank all the members of the Gallo and Teplitski Laboratories, who, along with a vast scientific knowledge, brought a lot of humor and normalcy to everyday life as a graduate student. And lastly, but far from least, I would like to thank m y parents and sister, whose lifelo ng support and encouragement have carried me to where I am today.

PAGE 5

5 TABLE OF CONTENTS ACKNOWLEDGMENTS .................................................................................................. 4 page LIST OF TABL ES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 LIST OF ABBREVIATIONS ........................................................................................... 10 ABSTRACT ................................................................................................................... 12 CHAPTER 1 LITERATURE REVIEW .......................................................................................... 15 Peanut as a Crop .................................................................................................... 15 Peanut Morphology and Taxonomy ........................................................................ 16 Peanut Genetic Diversity ........................................................................................ 18 Peanut Diseases ..................................................................................................... 20 Peanut Leaf Spots .................................................................................................. 21 Identification and Classification ........................................................................ 21 Symptoms and Signs ....................................................................................... 22 Disease Cycle .................................................................................................. 23 Management Strategies ................................................................................... 24 Breeding for Leaf Spot Resistance ......................................................................... 28 Peanut Transformation ........................................................................................... 30 Peanut Tissue Culture ............................................................................................ 32 Embryogenesis ................................................................................................. 33 Organogenesis ................................................................................................. 35 Peanut Transformation Advancements ................................................................... 36 Leaf Senescence, a Nuclear Controlled F orm of Programmed Cell Death ............. 38 Cytokinins and Isopentyl Transferase .............................................................. 41 Pathogen Induced Leaf Senescence ................................................................ 43 2 EVALUATING PEANUT CV. FLORIDA 07 FOR LATE LEAF SPOT TOLERANCE .......................................................................................................... 45 Abstract ................................................................................................................... 45 Intro duction ............................................................................................................. 46 Materials and Methods ............................................................................................ 49 Experimental Design ........................................................................................ 49 Disea se Assessment ........................................................................................ 50 Area Under the Disease Progress Curve (AUDPC) ......................................... 51 Harvest and Pod Yield ...................................................................................... 51 Environmental Conditions ................................................................................. 52

PAGE 6

6 Statistical Analysis ............................................................................................ 52 Disease Response Classification ..................................................................... 52 Results and Discussion ........................................................................................... 53 Citra 2008 ......................................................................................................... 53 Marianna 2008 ................................................................................................. 55 Marianna 2009 ................................................................................................. 58 All Years*Locations .......................................................................................... 60 Environmental Conditions ................................................................................. 61 Conclusions ............................................................................................................ 62 3 A DIRECT SHOOT ORAGANOGENESIS SYSTEM FOR U.S. PEANUT CULTIVARS ............................................................................................................ 77 Abstract ................................................................................................................... 77 Introduction ............................................................................................................. 78 Materials and Methods ............................................................................................ 79 Cultivar Selection ............................................................................................. 79 Explant Preparation .......................................................................................... 80 Experimental Design ........................................................................................ 81 Evalu ation of Cotyledon Explant Source .......................................................... 81 Evaluation of Shoot induction and Direct Shoot Organogenesis ...................... 82 Regeneration of Mature Plan ts ......................................................................... 82 Statistical Analysis ............................................................................................ 83 Results and Discussion ........................................................................................... 83 Explant Response ............................................................................................ 83 Genotype Response ......................................................................................... 85 Cultivar Comparison ......................................................................................... 88 Regeneration of Mature Plants ......................................................................... 89 Conclusions ............................................................................................................ 90 4 TRANSIENT EXPRESSION OF UIDA GLUCURONIDASE) IN PEANUT COTYLEDON EXPLANTS ...................................................................................... 99 Abstract ................................................................................................................... 99 Introduction ........................................................................................................... 100 Materials and Methods .......................................................................................... 102 Agrobacterium Strain and Gene Construct ..................................................... 102 Explant Preparation and Inoculation ............................................................... 102 Transient Expression in Cotyledon Explants and Histochemical GUS assay 103 Results and Discussion ......................................................................................... 103 Conclusions .......................................................................................................... 105 APPENDIX A TRANSFORMATION OF PEANUT WITH SAG12 IPT FOR A STAY GREEN PHENOTY P E ........................................................................................................ 108

PAGE 7

7 Introduction ........................................................................................................... 108 Materials and Methods .......................................................................................... 109 Agrobacterium Strain and Gene Constructs ................................................... 109 Explant Preparation and In oculation ............................................................... 109 Regeneration of Mature Plants ....................................................................... 110 Genomic DNA Analysis .................................................................................. 111 glucuronidase ( GUS ) Assay ........................................................................ 112 Results and Discussion ......................................................................................... 112 Conclusions .......................................................................................................... 113 B PEANUT TRANSFORMATION STUDIES ............................................................ 117 LIST OF REFERENCES ............................................................................................. 120 BIOGRAPHICAL SKETCH .......................................................................................... 140

PAGE 8

8 LIST OF TABLES Table page 2 1 Cultivar Descriptions. .......................................................................................... 65 2 2 Stand ard Commercial F ungicide Spray Treatment ............................................. 67 2 3 Florida 110 Leaf Spot R ating ............................................................................. 68 2 4 Citra 2008, FL Yield u nder l a te leaf s pot pressure, l ost to late leaf s pot and percent lost to late leaf s pot ................................................................................ 74 2 5 Marianna, FL 2008 Yield under late leaf spot pressure, lost to late leaf spot, and percent lost to late leaf spot ................................................................ 74 2 6 Marianna, FL 2009 Yield under late leaf spot pressure, lost to late leaf spot, and percent lost to late leaf spot ......................................................................... 75 2 7 Al l Years*Locations Yield under late leaf spot pressure, lost to late leaf spot, and percent lost to late leaf spot ................................................................ 75 2 8 Environmental C onditions in Citra, FL 2008 and Marianna, FL 2008 and 2009 76 3 1 Effect of N6 benzyladenine concentrations ranging from 10peanut cultivar response trend ........................................................................... 94 3 2 Effect of N6 benzyladenine concentrations ranging from 10Georgia Browne and 10A on the peanut cultivar response trend .................................................................................................... 94 3 3 Comparison of topperforming cul tivar* N6 benzyladenine concentration. ......... 98 4 1 Transient expression of CaMV 35S uidA in peanut cotyledon explants ........... 106 A 1 Assa y results of transformation attempts of peanut using Agrobacterium strain LBA4404 ................................................................................................. 115 A 2 Assay results of attempted transformation of peanut using Agrobacterium strain ABI harboring SAG12 I PT ....................................................................... 116 B 1 Agrobacterium mediated peanut transformation studies. ................................. 1 18 B 2 Peanut T ransformation via Particle B ombardment. .......................................... 119

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Petunia Leaf Spot ( Cercospora petunia) Infection. (A) wild type Petunia, and (B) SAG12 IPT transgenic Petunia. .................................................................... 44 2 1 Florida peanut growing regions and experimental locations ............................... 64 2 2 L ate season, lateral branch leaflet lesion coverage un der high late leaf spot pressure on York, AP 3, and Florida 07. ............................................................ 66 2 3 Peanut compound leaf and leaflets ................................................................... 69 2 4 Citra, FL 2 008 Disease Progression ............................................................... 70 2 5 Marianna, FL 2008 Disease Progression ........................................................ 71 2 6 Marianna, FL 2009 Disease Progression ........................................................ 72 2 7 All Years*Locations Disease Progression ....................................................... 73 3 1 Peanut seed morphology and cotyledon explants preparation ........................... 92 3 2 Direct Shoot Organogenesis (DSO) R ating ........................................................ 92 3 3 Explant response and regeneration of mature peanut plants ............................. 93 3 4 Shoot organogenesis response from two types of peanut cotyledon explants (A) Explant derived from cotyledon with embryo axis previously attached, (B) Explant derived from cotyledon without embryo axis previousl y attached. ......... 95 3 5 Effect of N6 benzyladenine concentration ranging form 10 direct shoot organogenesis rating of peanut cotyledon explants, and shoot induction percentage .......................................................................................... 96 3 6 Effect of N6 benzyladenine concentration ranging from 10 peanut cultivars Georgia Browne and 10 A on direct shoot organogenesis, and shoot induction percntage ........................................ 97 4 1 T ransient uidA expression in deembryonated, quartered cotyledon explants of peanut cv. Georgia Green ............................................................................ 107 A 1 Expres sion cassettes used for transformation of deembryonated, quartered co tyledon explants of peanut ............................................................................ 114

PAGE 10

10 LIST OF ABBREVIATION S 2,4 D 2,4 dichlorophenoxyacetic acid AFLP Amplified Fragment Length Polymorphism AUDPC Area Under the Disease Progress Curve BA N6 B enzyladenine DAP Days After Planting DSO Direct Shoot Organogenesis ELS Early Leaf Spot (caused by Cercospora arachidicola) Explant A Explant derived from peanut cotyledon with previously attached embryoaxis Explant B Explant derived from embryoaxis free peanut cotyledon FAWN Florida Automated Weather Network GUS Glucuronidase ha hectare IPT Isopentyl Transferase LLS Late Leaf Spot (caused by Cercosporidium personatum ) MS Murashige and Skoog MT Metric Ton NS Non Sprayed PCD Programmed Cell Death PI Plan Introduction %RH Percent Relative Humidity RAPD Random Amplification of Polymorphic DNA RFLP Restriction Fragment Length Polymophism RIM Root Induction Medium

PAGE 11

11 S Sprayed SAG12 Senescence Associated Gene 12 SAGs Senescence Associated Genes SEM Shoot Elongation Medium SI% Shoot Induction Percentage SIM Shoot Ind uction Medium SIM10 Benzyladenine SIM160 Benzyladenine SIM20 Benzyladenine SIM320 Shoot Induction Medium supplemented w Benzyladenine SIM40 Benzyladenine SIM640 Benzyladenine SIM80 Benzyladenine SSR Simple Seque nce Repeat TSWV Tomato Spotted Wilt Virus

PAGE 12

12 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science STRATEGIES FOR ENHANCING LEAF SP OT ( Cercospora arachidicola AND Cerscosporidium personatum ) TOLERANCE IN PEANUT ( Arachis hypogaea L.) By Scott P. Burns August 2010 Chair: Barry Tillman Cochair: Maria Gallo Major: Agronomy Cercospora arachidicola S. Hori and Cercosporidium personatum ( Berk and M. A. Curtis) Deighton are fungal pathogens that cause leaf spot, the most significant disease in peanut. Early leaf spot ( C. arachidicola) and late leaf spot ( C. personatum ) are found in all peanut growing regions worldwide. In Florida, if fungic ides are not used, pod yields can be reduced by as much as 50% by these leaf spot diseases. The present research focused on developing novel strategies for improving leaf spot tolerance in peanut. The first objective of this study was to confirm and characterize the source of suspected leaf spot tolerance in Florida07. It was hypothesized that Florida07 displayed classically defined tolerance. With regard to visual rating, lesion/leaf percentage, and lesion density, t he rate of disease progression was th e same in sprayed and nonsprayed York sprayed AP 3 and sprayed Florida07. Similar d isease progression was observed for non sprayed AP 3 and nonsprayed Florida07, but at a faster rate than the aforementioned cultivar*treatments. L esion growth occurred at the same rate. Based on these data, it was concluded that Florida07 and AP 3 possessed the same degree of susceptibility to late leaf spot disease. The impact of leaf spot on

PAGE 13

13 pod yield of Florida07 was similar to its impact on pod yield of AP 3 in two out of three tests, but in the third test, leaf spot impacted pod y ield of Florida 07 (1084 kg ha1) les s than it did AP 3 (1991 kg ha1) (P > t =0.0524). On average, however, yield loss to leaf spot (sprayed minus non sprayed) of AP 3 (1564 kg ha1) was not different than that of Florida 07 (1177 kg ha1). O n average, Florida07 does not appear to possess significant tolerance to leaf spot. The second objective of this research was to optimize a peanut direct shoot organogenesis tissue culture system that had been optimized for an Indian cultivar, JL24 (Sharma and Anjaiah, 2000) for U.S. cultivars. A difference in shoot induction was found for the cotyledon explants examined (P > t = <0.0001). Explant A had more shoot induction with a visual rating of 1. 8, than explant B that had a rating of 1.6 (P > t = <0.0001). C ultivars responded to the culture conditions differently (cultivar BA interaction). Geo rgia Green on 10 M BA produced the most shoot buds (24.56%) and had the highest visual rating (2.1), f ollowed by VC 2 on 10 M BA (22.1%, 1.8), ValenciaA on 640 M BA (21.4%, 1.8), Georgia Brown on 80 M BA (9.0%, 1.7), and Florida 07 on 40 M BA (7.1%, 1.8). Georgia Green, VC 2, and ValenciaA appear to be the best suited for future Agrobacterium mediated transformation experiments based on their shoot bud production. The third objective of this research was to identify an Agrobacterium strain that was highly virulent for selected cultivars. Transient expression studies were conducted using a CaMV35S u id A construct. It was hypothesized that a highly virulent

PAGE 14

14 Agrobacterium strain could be identified by testing for u idA expression in cotyledon explants. I t was concluded that Agrobacterium strain ABI was virulent and should be used for future stable transformation experiments.

PAGE 15

15 CHAPTER 1 LITERATURE REVIEW Peanut as a Crop The cultivated peanut, Arachis hypogaea L., is a self pollinating, indeterminate, annual herbaceous legume crop of global importance. Peanuts center of genetic diversity is believed to be in South America, specifically southern Brazil and northern Paraguay (Pattee and Young, 1982). During the sixteenth and seventeenth centuries, early Spanish and Portuguese explorers found indigenous people of Central and South America cultivating peanut. S ubsequently, these explorers introduced peanut first to Europe and eventually to both African coasts, Asia, the Pacific Islands, and finally to North Ameri ca. Currently, peanut is grown on six continents and in over 100 countries (Nwokolo, 1996). The vast majority of the world grows peanut as a low input, small scale subsistence oilseed crop. Presently, it is the fifth most important oilseed crop in the world. Peanut oil is versatile and has been widely used as a biofuel, in cooking, and as a food constit uent. However, in the U.S., peanut is used primar ily as a food product for direct consumption, e.g. peanut butter dry roasted nuts, and flour. Nutritionally, peanut is high in protein, as well as mono and poly unsaturated fats (e.g. linoleic and oleic ac ids). In many developing countries, peanut serves as a crucial dietary component for the indigenous people. In 2007, an estimated 22,365,760 hectares ( h a ) of peanuts were harvested worldwide. China led the world in peanut production and value (13,079,363 metric tons ( MT ) Int. $6,112,785,000, respectively), followed by India (9,182,500 MT, Int. $4,205,879,000), Nigeria (estimated 3,835,600 MT, estimated Int. $1,778,082,000), and

PAGE 16

16 the U.S. (1,696,728 MT, Int. $778,851,000) (FAO 2010). Although the U.S. does not lead the w orld in peanut production, it has ranked first in yield per land unit for over 15 years (Chenault et al. 2008). In 2009, 443,536 ha of peanuts were planted in the U.S Georgia had the largest tract of land dedicated to peanut production (186,155 ha ), followed by Alabama (68,797 ha), Texas (64,750 ha), Florida (48,562 ha), and North Carolina (30,351 h a). In 2009, the farm gate level value of peanut production was $835,172,000, while the peanut industry, as a whole, generated approximately $4 billion for the U.S. economy. Georgia had the largest farm gate level input toward value ($390,400,000), followed by Texas ($129,658,000), Alabama ($104,606,000), Florida ($69,552,000), and North Carolina ($66,911,000) (USDA NASS 2010). U.S. peanut producti on plays a major role in the overall economic prosperity of many rural production areas across the peanut growing regions. Peanut Morphology and Taxonomy The peanut plant can be upright or prostrate in growth. At emergence, plants develop a main stem with many auxiliary lateral branches extending from the main stem. Leaves are alternate and compound, consisting of three to four leaflets. Botanically, peanut is unique among most other cultivated crops due to its geocarpic growth habit. Geocarpy is the produc tion of aerial flowers but subterranean fruits. Peanut flowers are papilionaceous in appearance and contain both male and female reproductive parts (perfect flower). Natural cross pollination of peanut is rare and breeding efforts require hand pollination. Post pollination, flowers produce an elongated ovarian structure known as a gynophore or peg. The aerial peg grows vertically and penetrates the soil where the mature fruit (pod) develops.

PAGE 17

17 Arachis hypogaea consists of two subspecies, hypogaea and fastigi ata The ssp hypogaea does not flower on the main stem and, in general terms, matures later, has a high water requirement, an alternate branching pattern, and produces large seed. The ssp fastigiata produces flowers on the main stem, has sequential branc hing, and, relative to the other subspecies, matures earlier, with a lower water requirement, and produces smaller seed. Subspecies can be further classified into six botanical varieties based on their morphology and growth habits (Krapovickas and Gregory 1994). Botanical varieties hypogaea and hirsuta belong to ssp hypogaea while varieties fastigiata peruviana aequatoriana and vulgaris belong to ssp. fastigiata T he four U.S. peanut market types fall within the botanical varieties vulgaris fastigata and hypogaea Botanical variety vulgaris contains cultivars belonging to the Spanish market type, fastigata includes the Valencia market type cultivars, and hypogaea consists of Runner and Virginia market types. Market type forms a rough classi fication system which is primarily based on relative pod and seed size characteristics (small, medium, and large), and to a lesser extent on growth habit, growing region, and center of genetic origin (Pattee and Young 1982; Knauft et al. 1987). Cultivars classified as Spanish market types typically have small, two seeded pods containing small seeds. The genetic origin of Spanish market types is the Guarani region of northeast Argentina, Paraguay, and southern Brazil. In the U.S., Spanish market types are g enerally grown in the southwestern portion of the peanut producing region (Texas, and Oklahoma), and their seeds are used primarily in candy and for oil.

PAGE 18

18 Valencia market type s typically have medium twoand threeseeded pods containing medium sized seed and originated in Paraguay and central Brazil. T his market type is grown primarily in the southeastern producing region (Georgia, Alabama, and Florida). Valenci a peanuts, especially the threeseeded type, are whole roasted and boiled as snack foods. The center of origin for Runner and Virginia market type peanuts is unclear. The precursor to these market types originated in South America, but may have arisen, as we know them today, while being grown in Africa. Runner and Virginia type peanuts tend to have l arger pods and seeds compared to Spanish and Valencia peanuts. However, Virginia type peanuts have larger pods and seeds compared to Runner type pods and seeds. Runner type peanuts are most widely grown in the southeastern growing region of the U.S. and ar e used for oil and peanut butter production. Virginia types are primarily grown in the northeastern peanut producing region (Virginia, and North Carolina) for use as whole roasted, ball park nuts. Peanut Genetic Diversity W ithin the genus Arachis A. h ypogaea is the only species that has been domesticated and grown worldwide. Despite extensive morphological and physiological variation, many studies have concluded that A. hypogaea has low genetic diversity. These studies have used pedigree analysis (Knau ft and Gorbet 1989), protein profiles (Singh et al. 1991b 1994), i soz ymes (Grieshammer and Wynne 1990; Lacks and Stalker 1993; Lu and Pickersgill 1993; Stalker et al. 1994), restriction fragment length polymorphism (RFLP) (Galgaro et al. 1998; Garcia et al. 1995; Halward et al. 1991, 1993; Kochert et al. 1991, 1996; Paik Ro et al. 1992), and random amplification of polymorphic DNA (RAPD) ( Halward et al. 1992; Lanham et al. 1992; Garcia et al. 1995;

PAGE 19

19 Galgaro et al. 1998; Subramanian et al. 2000 ; Raina et al. 2001) but have found low levels of polymorphism Additional studies have identified more polymorphism using amplified fragment length polymorphism (AFLP) (He and Prakash 1997, 2001; Herselman 2003) and simple sequence repeat (SSR) (Hopkins et al. 1999; Raina et al. 2001; Tang et al. 2007) techniques. However, the genetic diversity that exists in domesticated peanut remains narrow when compared to other important crops. Because most Arachis species are diploid, with the exception of A rachis monticola Krapov. and Rigonc. they do not readily cross with tetraploid A. hypogaea. The l imited genetic diversity found in cultivated peanut is most likely due to a relatively recent, single hybridization event between wild, diploid Arachis species (Halward et al. 1991). This narrow genetic base in peanut has been further compounded by the self pollinating nature of peanut and breeding programs using very few elite breeding lines (Herselman 2003). As mentioned above, peanut is a tetraploid, specifically an allotetrapl oid (2n = 4x = 40) containing two distinct A and B genomes. Genome A has a set of chromosomes that is significantly smaller when compared to the chromosomes of the B genome (Husted 1936). Of the approximately 70 known Arachis species, only a few possess t he B genome, which limits the number of candidate parent Arachis species (Smartt et al. 1978; Gregory et al. 1980). Morphology, chromosome pairing, cross compatibility, and molecular markers have been used to identify likely progenitors of cultivated peanut. Several studies point to Arachis cardenasii Krapov. and W.C.Greg. Arachis villosa Benth. Arachis correntina (Burkart) Krapov. and W.C. Greg. or A rachis duranensis Krapov. and W.C. Greg as being likely A genome donors ( Seetheram et al. 1973;

PAGE 20

20 Gregory a nd Gregory, 1976; Smartt et al. 1978; Singh and Moss 1982; Kirti et al. 1983; Murty and Jahnavi 1986; Singh 1988; Kochert et al. 1991, 1996; Singh et al. 1996; Raina and Mukai 1999) and Arachis batizocoi Krapov. and W.C. Greg or Arachis ipa ensis Krapov. a nd W.C. Greg as being B genome donors (Smartt et al. 1978; Singh and Moss 1984; Singh, 1988; Klosova et al. 1983; Kochert et al. 1991, 1996; Fernandez and Krapovickas 1994). Studies conducted by Kochert et al. (1996), Seijo et al. (2004, 2007) and Favero e t al. (2006) propose that A. duranensis and A. ipaensis are the likely progenitors of peanut. Currently, this theory is the most commonly accepted one As technologies improve and whole genome sequencing becomes more efficient and affordable, additional polymorphisms ( e.g. single nucleotide polym orphisms ) should be identified, and that along with a better understanding of epigenetic effects should help explain the morphological and physiological diversity observed in cultivated peanut. Peanut Diseases Peanut is susceptible to a variety of biotic stressors. In the U.S., several foliar and soilborne diseases/pests exist that lower yields as well as profits for growers. Domestically, the most prevalent pathogens/pests of peanut include tomato spotted wilt v irus (TSWV; Tospovirus vectored by thrips), root knot nematode ( Meloidogyne arenaria (Neal ) Chitwood race 1), Sclerotium rolfsii Sacc. the casual agent of white mold, Cylindrocladium parasiticum Crous, Wingfield and Alfenas the casual agent of Cylindro cladium Black Rot, Sclerotinia minor Jagger that results in Sclerotinia blight, Puccinia arachidis Speg. that causes rust, and Cercospora arachidicola S. Hori and Cercospiridium personatum (Berk and M. A.Curtis) Deighton, that are the casual agents

PAGE 21

21 of early and late leaf spot In addition to yield, seed vigor and grade, disease/pest resistance is a primary breeding objective for peanut breeding programs throughout the U.S. Peanut Leaf Spots Early leaf spot (ELS) (teleomorph Mycosphaerella arachidi Deight on) and late leaf spot (LLS) (teleomorph Mycosphaerella berkeleyi Jenk.] diseases are the most widespread foliar diseases of peanut. Both C. arachidicola and C. personatum can be found wherever peanut is grown, making them the most significant of all peanut pathogens (Zhang et al. 2001). If fungicides are not used, pod yields can be reduced by 50% or more in diseased plants (Knauft et al. 1986, Pixley et al. 1990ab, Shokes et al. 1983, Damicone et al. 1994, Smith and Littrell 1980, Zhang et al. 2001). Identification and Classification During the early production years of peanut, leaf spots were regarded as a common and natural feature of the peanut plant (Backman et al. 1977). The first documented description of an organism causing peanut leaf spot was by B erkley (1875). Berkley identified a single fungal species and proposed the name Cladosporium personatum as being the source of leaf spot disease. Studies following the work of Berkley led to a highly variable nomenclature and classification system for leaf spot disease. Comparison of specimens and earlier reports by Woodruff (1933) led to the determination that the casual agent of leaf spot disease was actually due to two distinct fungal organisms. The two pathogens were identified and then named, Cercospor a arachidicola Hori and Cercospora personata (Berk. and Curt.) Ellis and Everhart.

PAGE 22

22 The sexual stages for each pathogen were later identified by Jenkins (1938) and named Mycosphaerella arachidicola (ELS) and Mycoshaerella berkeleyii (LLS). Cercospora personata was later reclassified by Deighton (1967) as belonging to the genus, Cercosporidium Deighton renamed the pathogen to Cercosporidium personatum (LLS). Symptoms and Signs ELS and LLS diseases are characterized by necrotic flecks that enlarge to n ecrotic lesions that reduce light interception and photosynthesis (Boote et al. 1983). Lesions caused by either disease can occur on pegs, stems, or petioles, but are most commonly found on leaves (Hemingway 1954; Gibbons 1966). L esion appearance on leav es in fected by C. arachidicola and C. personatum can differ slightly. ELS disease produces tan to reddishbrown to black foliar lesions that are typically, but not always, surrounded by a distinct yellow halo (frog eye). Because the yellow halo is not alwa ys indicative of ELS, conclusive identification can only be made by microscopically examining conidiophores/conidia. In ELS conidiophores form on the upper leaf surface within the lesion covered area and conidia are often sparsely present or not present at all. LLS disease, on the other hand, produces brown to black lesions with no halo ever being present. However, similar to ELS, conclusive identification can only be made by microscopic examination of conidiophores/conidia. The formation of C. personatum conidiophores/conidia is far more prolific than C. arachidicola. Conidiophores of C. person a tum tend to be densely packed into lesions with numerous conidia being present. Regardless of lesion appearance, lesions caused by the presence of either C. arachi dicola or C. personatum have the same effect of reducing photosynthetic activity

PAGE 23

23 in leaf tissue, as mentioned above. The reduction of photosynthetic leaf area is the primary factor associated with loss of yield in peanut. Premature defoliation (due to ear ly onset of senescence mechanisms), another symptom associated with both leaf spot pathogens, of course, further compounds the reduction of active photosynthetic area. Disease Cycle C. arachidicola and C. personatum are very similar in respect to their lif e cycles. Both produce conidia and mycelia that are capable of overwintering in crop residue. They are necrophilic thriving on the dead cells and tissues of the host. Conidial spores and mycelia overwintering in crop residue provide the inoculum source for the following seasons initial infection. I nfection begins when conidial spores germinate and form germ tubes that penetrate open stomata or lateral faces of epidermal cells. Following penetration, germ tubes form into networks of mycelia. These m ycelia produce cellulolytic and pectolyic enzymes, i.e., dothistromin (Stoessl 1984) and/or cercosporin, which diffuse and degrade host cell wall and middle lamellae constitutients. Intercelluar hyphae of C. arachidicola have been shown to kill host cells in advance of hyphal penetration ( Alabi and Naqvi, 1977; Stoessl et al 1990; Daub et al. 2000). Conversely, C. personatum does not kill prior to penetration, but instead develops into haustoria. As mycelia spread into host tissues and enzymatic degradation occ urs, cells collapse and produce necrotic lesions (Abdou et al. 1974; Jenkins, 193 8 ). In addition to their degradative properties, enzymes produced by these pathogenic fungi have also been shown to promote ethylene production, enhancing the rate of leaf abs cission (Bourgeois et al. 1991).

PAGE 24

24 Sporulation of these organisms is characterized by the formation of long, thin multicellular conidia on short, darkly pigmented conidiophores (Agrios 2005). Conidia and conidiophores for both organisms are very similar in appearance. Conidia are easily detached and can be dispersed by wind, water, or any other mechanical movement. C. arachidicola and C. personatum favor warm temperatures and are most destructive during the summer months in warmer climates, such as those fo und in the southeastern peanut growing states (e.g., Alabama, Florida, Georgia, Mississippi, and South Carolina) (Culbreath et al. 2009). Development and dispersal of conidia of both pathogens are most prevalent in temperatures ranging from 16C 30C and relative humidity exceeding 90%. High temperatures and leaf wetness, either due to humidity or rainfall, are necessary for the rapid growth and widespread dispersal of leaf spot d isease ( Jensen and Boyle, 1965; Alderman and Beute, 1986; Shew, 1988; Jacobi et al. 1995a b ). Management Strategies Current management strategies for controlling leaf spot epidemics rely heavily on foliar fungicide application, crop rotation, tillage, planting date, and cultivar selection (Wri ght et al. 2009; Cantonwine et al. 2006, 2007a; Zhang et al. 2001). Foliar f ungicide a pplication. Numerous reports are available describing the successful control of leaf spot diseases using fungicides. Without the use of fungicides, commercial peanut cultivation would not be practical. Dise ase control for the 2010 growing season has been estimated to be approximately $216/ha, with a large portion of that amount going toward fungicides for leaf spot control (Smith and Smith, 2009) Annually, purchasing and applying fungicides is one of the most expensive investments for a grower. As previously mentioned, without fungicides, peanut yields may be

PAGE 25

25 reduced by more than 50%, which is un acceptable if one is trying to make a profit. Foliar fungicide products commonly used on peanuts include sulfur, t ebuconazole, propiconazole, chlorothalonil, trifloxystrobin, pyraclostrobin, and azoxystrobin. Less commonly used fungicides include copper, maneb, mancozeb, thiophanate, boscalid, iprodione, fluazinam, prothioconazole, and phoshite (Mossler and Aerts, 200 7). Current recommendations call for fungicides to be applied every 10 14 days beginning 30 35 days after planting ( DAP ) (Wright et al. 2009). As a result, typically seven or more applications are made during a growing season. Additionally, it is recom mended that multiple fungicides with different modes of activity be used throughout the growing sea son, to avoid the development of fungicidespecific, resistant strains. With the use of fungicides, leaf spot control may approach 100%, but on average, grow ers can expect 60 70% protection from recommended fungicide applications (Culbreath et al. 2009). Crop r otation Rotation has long been recognized as one of the most effective means of controlling disease in any crop. Crop rotation provides a time period for degradation of crop debris, which in turn deprives any surviving inoculum of host tissues. After foliar fungicide applications, crop rotation is the next most important management practice for reducing leaf spot pressure (Culbreath et al. 2009). Unfor tunately, in the southeastern U.S., low value crops are generally the only alternative for rotating with high cash value crops like peanut (Wright et al. 2009). Due to the discrepancy in cropvalue, many growers have opted to continually grow peanuts in th e same fields. Current extension recommendations suggest rotation with nonleguminous crops such as cotton, corn, sorghum, or bahiagrass. Rotating these crops with peanut will reduce disease pressure and thereby result in higher yields (Culbreath

PAGE 26

26 et al. 20 09; Wright et al. 2009). In fact, peanut yields were 19% higher after two years of corn and 41% higher after two years of bahiagrass (Wright et al. 2009). Mossler and Aerts (2007) report ed that a rotation interval of three to four years will further reduce disease pressure and increase yields. Tillage Because C. arachidicola and C. personatum are necrophilic and survive from season to season on crop debris, t illage will create a so il layer (physical barrier) preventing fungal inoculum from coming into cont act with new growth. Conventional tillage of peanut involves turning the soil in an entire field. Recently, the increased cost of fuel has led to the investigation of conservation tillage methods. A particularly effective conservation method is strip tillage, which differs from conventional tillage in that the entire field is not turned. Rather, a narrow strip of planting area (8 12 wide) is sub soiled (inversion of top soil) (Wright et al. 2009). Although the exact mechanism is unclear, leaf spot appear ance is delayed and lateseason pressure is less severe in strip tilled peanut fields ( Cantonwine et al. 2007b; Culbreath et al. 2009). Because of the reduced time investment, cost, and incidence of disease, strip tillage has been regionally adopted in the southeastern states by some peanut producers. Planting d ate Peanuts planted in early to mid April generally have less leaf spot pressure than those planted later in midMay to early June. Peanuts planted during the earlier months have less exposure time to hot, humid conditions which are most conducive for pathogen development. Fungicide applications in early planted fields (mid April) can be delayed to 60 DAP (Mossler and Aerts, 2007). However, this advantage is overcome in early planted peanuts because they are more susceptible to outbreaks of white mold and TSWV (Culbreath et al. 2009). Although first identified in

PAGE 27

27 the early 1980s in the southeastern U.S. growing region, during the mid1990s, TSWV severity became more prevalent. To avoid significant TS WV damage, planting dates were shifted later in the season and this increased leaf spot pressure. Current recommendations call for the use of environmental modeling systems to determine planting dates. Ideally, planting will occur late enough in a season to avoid TSWV damage, but early enough to avoid the most conducive leaf spot environment. Cultivar s election In a typical growing season in the southeastern U.S. peanut growing region, it can be expected that leaf spot will be the most severe disease enco untered. Breeding programs have invested a great deal of effort in developing leaf spot resistant cultivars. Breeding for leaf spot resistance has led to the release of several cultivars with negligible lesion coverage, reduced defoliation, and high yield potential. Some cultivars possess enough resistance to reduce fungicide spray regimes. Resistant cultivars provide financial protection to growers because less investment is required for chemical fungicides/applications and final yield potential is protec ted. Several peanut cultivars have been released that are classified as resistant to ELS and/or LLS disease(s) These cultivars i nclude Georgia01R (Branch, 2002), Tifrunner (Holbrook et al. 2007), Georgia02C (Branch, 2003), Georganic (Holbrook et al. 2 008), Georgia07W (Branch et al. 2008), Southern Runner (Gorbet et al. 1987), York, DP 1 (Gorbet and Tillman, 2008), C99R (Gorbet, 2002a), Hull (Gorbet, 2007b ), and Florida MDR 98 (Gorbet, 2002b). Although classified as resistant, the degree of protection in many of these cultivars is incomplete and still allows for significant damage under severe disease pressure. Additionally, several of these cultivars are associated with characteristics that have hindered their widespread acceptance among growers,

PAGE 28

28 su ch as poor germination, late maturity, and large seed size. For example, when multiplied by commercial seed producers, York, DP 1, C 99R, Hull, and MDR 98 often exhibit poor field emergence. Poor field emergence results i n unacceptable field stands that i n turn affect final yield (Morton, 2007). Additionally, the development of leaf spot resistant, Runner type cultivars have typically been limited to cultivars with late maturity (maturity reached 14 21 days after other R unner types), and these cultivars tend to have larger seed size which presents problems to shelling facilities and has further contributed to the limited acceptance of such cultivars. The unfavorable characteristics associated with many leaf spot resistant cultivars may be due to a common parent in their lineage, plant introduction (PI) 203396, which is the primary source for superior leaf spot resistance. PI 203396 is one of only a few peanuts that consistently results in progeny with high leaf spot resistance, consequently the genetic div ersity available for leaf spot resistance is narrow. Breeding for Leaf Spot Resistance Peanut breeding in the U.S. began in Florida during the 1920s (Tillman and Stalker, 2009). Since that time, breeding efforts have led to drastic improvements in peanut performance. The University of Florida has led breeding efforts over the past 30 years to develop leaf spot resistant cultivars. Breeding methods in peanut are similar to that of other self pollinating crops. Pedigree selection, single seed descent, and mas s selection are all common strategies for improvement. In terms of breeding for leaf spot resistance, the major hurdle encountered is the lack of genetic diversity available, as previously mentioned. Southern Runner was the first cultivar to be released wi th resistance to leaf spot. C ultivars with a genetic background similar to Southern Runner have been recently released: York, DP 1, C99 R, Hull, and Florida MDR98. Along with

PAGE 29

29 leaf spot protection, these genetically similar cultivars also inherited many ag ronomically unfavorable characteristics that were described above. In an effort to increase genetic diversity and incorporate favorable traits alternative breeding methods and new genetic technologies (e.g., hybrid introgression, embryo rescue, and genet ic transformation) have been used in pean ut breeding programs. Wild Arachis germplasm has been collected with nearly complete resistance to both leaf spot pathogens. However, the production of fertile A. hypogaea x Arachis sp progeny are complicated by differences in ploidy levels of the parents. However, A.villosa, A. correntina, A. diogo i Hoehne A. stenosperma, A. carden a sii Krapov. and W.C. Greg., A. duranensi s, and A. batizocoi have all been successfully crossed with A. hypogaea (Singh 1986; Stalk er and Simpson 1995). Simpson and Starr (2001) released the first commercial peanut cultivar, COAN, which possessed an identifiable gene derived from a wild Arachis species that provided resistance to root knot nematode. Although not bred for the purposes of leaf spot resistance, the development of COAN proved that hybrid introgression was a viable method for improving genetic diversity and bringing biotic resistance factors into cultivated peanut. Recently, germplasm lines have been released with very hig h levels of leaf spot resistance derived from A. carden a sii (Stalker et al. 2002). PI 261942 was crossed with A. carden a sii to produce triploid hybrids. First generation hybrids were collected and colchicinetreated to restore fertility. Fertile plants wer e self pollinated, and offspring were field screened for disease resistance. Germplasm possessing leaf spot resistance was further screened for ploidy level. Lines that were tetraploid were

PAGE 30

30 selected as breeding stock (Stalker et al. 2002) Isleib et al. (2006) used these stocks to develop a germplasm line resistant to ELS, N96076L. Peanut Transformation Recently, interest has increased in transgenic approaches to complement traditional breeding for improved agronomic performance in peanuts. Transgenic cotton ( Gossypium hirsutum L.), soybean ( Glycine max L. ), and corn ( Zea mays L.) have been widely accepted and very successful in streamlining cultivation practices and improving yields. Numerous studies have focused on transforming peanuts using particle bombardment as well as Agrobacterium mediated tr ansformation systems ( see Table B 1 for details of these studies) Presently, the most successful attempts at producing transgenic peanuts have used particle bombardment to introduce constructs into peanut somatic embryos. Although an effective means for generating transgenic s, bombardment protocols have several disadvantages: complex rearrangements and integration patterns, gene silencing, high cost, difficulty of use/accessibility, and limited end product utility (Altpeter et al. 2005). Among these disadvantages, perhaps the most unfavorable issue associated with bombardment protocols, is the length of time required to generate mature plants. Most biolistic protocols require 816 months to produce mature, transgenic lines capable of producing seed. These lengthy tissue culture requirements allow for an increased likelihood of somaclonal variation. In addition, these lengthy protocols often require extensive subsequent subculturing, which is highly labor intensive and increases the chances for putative transgenics to be lost to contamination. As an alternative to lengthy bombardment methods, protocols using faster, direct organogenesis and Agrobacterium have been investigated. Transformation by

PAGE 31

31 Agrobacterium is bel ieved to be superior to bombardment because integration patterns tend to be cleaner, meaning whole gene constructs integrate into the host genome usually with low copy number (Sharma et al. 2005). Additionally, and perhaps most favorable, tissue culture requirements tend to be far less intensive in terms of subculturing and time to plant maturity. This reduction in time and handling lessens the likelihood for contamination and somaclonal variation. Thus, once established, protocols are far less labor int ensive and more economically sound. Despite the many advantages of Agrobacterium mediated transformation over particle bombardment, it is far from an ideal system and requires intensive optimization because highly efficient Agrobacterium protocols are dependent upon multiple factors: bacterial strain, specialized plasmid vectors, host genotype, explant age/type, and cocultivation conditions (Sharma et al. 2005). Due to the biological nature of Agrobacterium mediated transformation (host pathogen compat ibility), much effort is required to determine the best infection conditions. Unlike particle b ombardment protocols, that use DNA coated gold part icles to physically deliver foreign DNA to the nucleus of target tissue, Agrobacterium relies on a biological virulence mechanism for nuclear transgene delivery. As in nature, the interaction of host tissue susceptibility and Agrobacterium virulence are highly variable. Few genetically engineered peanut lines exist today, and none are commercially available. The l imited availability of transgenic peanut s is primarily due to: 1) no single peanut transformation protocol for fast and routine production of transgenic, 2) no approved transgenic lines, and 3) g rower hesit ancy to plant GM peanut for fear of nonacceptance by consumer s. Recently, grower/consumer attitudes have shifted since

PAGE 32

32 observing the success of other genetically engineered crops, e.g., cotton, corn, and soybean. Because of this shift in attitude, a renewed interest in peanut transformation has led to the development of research lines with improved agronomic performance. Peanut Tissue Culture Genetic transformation has great potential for introducing novel, beneficial genes into peanut that would not be available using conventional breeding methods. Wh ile conventional breeding will always play a highly significant role in the improvement of peanut, transformation technologies may provide a means of streamlining those improvement processes. Although many studies have reported the successful production of transgenic peanuts, none have described very efficient production in the numbers of independent lines generated. Many of the transgenic peanut lines developed have been for proof of concept purposes and have used easily identifiable traits that serve no agronomic glucuronidase (GUS) or fluorescent reporter proteins. A common factor that impedes the efficient production of multiple independent lines is the restraints associated with the tissue culture process. Somaclonal variation due to long tissue culture requirements, explant availability, cultivar specificity, and poor regeneration into mature plants are common factors attributed to the limited success of developing highly efficient transformation protocols (Livingstone and Birch 1999; Anuradha et al. 2008). Regardless of transformation method or target crop, a requirement for all tissue culture systems is the highly prolific, in vitro production of actively dividing cells. The transfer and stable integration of transgenes is dependent upon the rapid regeneration of competent cells. Highly efficient transformation protocols, in which numerous stable,

PAGE 33

33 independent lines are produced, are often those with the highest incidence of regeneration. Currently, the major impediment of the ro utine production of transgenic peanut is the lack of prolific tissue culture systems. Most seed and seedling tissues of peanut can be used to establish regenerationcompetent tissue culture systems (Ozias Akins and Gill, 2001). Explant source material has varied widely in previous peanut tissue culture studies. Several explant types have been used to develop both embryogenic and organogenic tissue culture protocols with moderate success. These studies have repeatedly shown that regardless of explant type or developmental system, the pathway to differentiation is primarily dependent upon genotype selection and growt h regulator concentration in culture medium. Peanut cultivars tend to be regionally adapted and this has led to a large number of genotypes being tested across many regeneration protocols Likewise, numerous growth regulators at various concentrations have been tested in tissue culture protocols. Presently, c ytokinin class hormones, i.e. N 6 benzyladenine (BA), k ineti n and thidiazuron, and auxincl ass hormones, i.e. 2,4d ichlorop henoxyacetic acid (2,4D), and p icloram, have been the most widely tested and successful for eliciting a regeneration response. Embryogenesis To date, the most efficient method for producing transgenic peanut is particle bom bardment of somatic embryos. Somatic embryogenesis is the development of embryogenic cells lines from tissues not typically involved with embryo production. Embryos are unique from other adventitious tissues because they are bipolar, having both a shoot an d root pole.

PAGE 34

34 Ozias Akins et al. (1989) and Hazra et al. (1989) were among the first to report the successful generation of somatic embryos in peanut. These studies used immature cotyledons as explants, which were placed on medium supplemented with syntheti c auxin hormones. Later studies also used immature explants to develop somatic embryos. The major disadvantage of using immature tissues as explants is the limited availability of this starting material. To obtain immature explants, material must be collec ted from flowering plants three to four weeks following soil penetration by the peg. In the southeastern U.S., field production of peanut begins in midto late April and continues through early October, with the most prevalent flowering occurring 60 80 DAP (Wright et al. 2009; personal communication Y. Lopez, 2010). The process of monitoring flowering and peg formation is an extremely tedious and labor intensive activity. Furthermore, flower induction is highly dependent on environmental conditions and c an deviate from the general 60 80 day range. Along with the same problems observed in fieldgrown peanuts, growing peanuts in a controlled greenhouse environment is complicated by the fact that these plants tend to produce fewer flowers. Because of the u npredictable time and rate of immature embryo development, the availability of explant s is extremely limited. To circumvent the issues associated with using immature explants, investigations focused on developing protocols that used mature explants. Matur e explants (generally from seeds) can remain viable when stored at low temperature and humidity, making the production of somatic embryogenesis on a year round basis more convenient. McKently (1991) was the first to report a successful embryogenesis protoc ol using mature explants cul t ured on Murashige and Skoog (MS) medium supplemented with

PAGE 35

35 p icloram. Despite the convenience of using mature explant source material, many studies showed improved somatic embryogenesis efficiencies using immature tissue as explants (Ozias Akins et al. 1993; Sing sit et al. 1997; Wang et al. 1998; Chenault et al. 2002, 2003 b 2005; Yang et al. 1998, 2003; Deng et al. 2001; Chenault and Payton 2003; Athmaram et al. 2006). In addition to explant availability somatic embryogenesis i n peanut is disadvantageous due to the low conversion rate of embryos into mature plants (Joshi et al. 2008). Ozias Akins et al. (1992) and Chengalrayan et al. (1995, 1997) have made attempts to increase the frequency of recovering mature plants from soma tic embryos of peanut. Despite previous efforts, the time required for the production and conversion of somatic embryos has led to the investigation of other tissue culture systems for use in transformation protocols. Organogenesis An alternative to length y somatic embryo production is direct production of organspecific tissues from explants, a process known as organogenesis. Illingworth (1968) was the first to report successful in vitro organogenesis of peanut from deembryonated cotyledon sections cultured on hormonefree basal medium. This study, as well as many of the other early peanut organogenesis studies, was intended to develop protocols for basic research purposes, such as germplasm storage, rapid propagation, disease eradication, and embryo resc ue (Martin 1970; Kartha 1981; Mroginski 1981; Bajaj 1982; Narasimhulu, 1983; Pittman 1983; Atreya, 1984; Bhatia 1985). These studies tested several media formulations, various growth hormones and concentrations, and explants. Although the efforts of these investigations resulted in the development of organogenesis protocols, no single protocol was highly

PAGE 36

36 efficient in regenerating adventitious tissues. As the reality of routine gene transformation became more evident, efforts to improve the organogenic response in peanut intensified. Successful organogenesis protocols have been developed using leaf material and immature seed material. These protocols, much like embryogenesis protocols using similar starting material, are not always favorable due to low explant availability. Mature seed have been investigated as an explant source. Hypocotyls, epicotyls, and cotyledonary nodes from freshly germinated seed have been investigated as explants for organongenesis. To simplify protocols, direct organogenesis fro m non germinated, mature, whole seed, embryo axes, and cotyledons has been tested. Sharma and Anajaiah (2000) developed an efficient protocol which used deembryonated cotyledon halves as explants. This study optimized an organogenesis system using cv. JL 24. F reshly cut cotyledon halves placed on MS medium supplemented with 20 M BA and 10 M 2,4D were efficient at producing adventitious shoot buds (> 90%). Recently, Tiwari et al. (2008) expanded upon this protocol to include other Spanish market type cultivars widely grown in India: TMV 2, TAG 24, and Dh 3 30. In addition to numerous adventitious buds forming and rapid regeneration to mature plants, Sharma and Anajaiah (2000) and Tiwari et al. (2008) reported high transformation efficiencies using this t issue culture method. Peanut Transformation Advancements Peanut, like other crops, encounters many biotic and abiotic stress ors throughout a growing season. Although much of the early peanut transformation work was for proof of concept purposes, several investigators have developed transgenic lines for improved agronomic performance.

PAGE 37

37 As previously discussed, TSWV is a major pathogen in most peanut growing regions throughout the U.S. Innate resistance has been observed in peanut, but is incomplete and allows for significant yield loss. In an effort to supplement natural resistance, Brar et al. (1994), Yang et al. (1998), Magbanau et al. (2000), and Chenault et al. (2003) bombarded somatic embryos with a nucleocapsid coat protein from TSWV. Li (1997) used Ag robacterium transformation to integrat e a similar gene into peanut. T0 and progeny of transgenic plants displayed a day delay in symptom development. Using a similar approach, Higgins et al. (2004) developed transgenic lines expressing peanut stripe nucleocapsid coat protein. These lines displayed resistance to peanut stripe virus, a virus common to peanut crops in Asian and Australian growing regions. Toxin derived from B acillus t huringiensis ( Bt toxin ) has been widely used in many crops to confer resist ance to insect pests. Bt expressing peanut was developed using both Agrobacterium and biolistic transformation. Singsit et al. (1997), using bombardment, developed transgenic peanut lines expressing Cry1Ac providing protection to lesser cornstalk borer. Ti wari et al. (2008) successfully integated a synthetic C ry1EC gene into peanut using Agrobactrium transformation. Complete resistance to tobacco cut worm, an insect pest common to Indian production regions, was reported for several i ndependent lines. Ingest ion of C ry1EC expressing plants by tobacco cut worms in in vitro bio assays led to 100% fatality. As mentioned earlier, f ungal pathogens are the most prevalent peanut pests. Rohini and Rao (2001) were the first to use Agrobacterium to generate peanut plant s with improved fungal resistance. Using a non tissue culturebased transformation system, Rohini and Rao (2001) developed plants expressing tobacco chitinase. This

PAGE 38

38 study reported transgenic lines displaying tolerance to ELS disease in smallplot field tri als. Chenault et al. (2002) used biolistics to engineer peanut lines expressing genes encoding chitinase and glucanse. Livingstone et al. (2005) engineered peanut lines to produce oxalate oxidase, an enzyme which degrades oxalic acid, a compound required f or Sclerotinia blight infection. Detached leaflet assays showed transgene expression limited lesion size resulting from direct application of oxalic acid. Lesion size was significantly reduced in transg enic plants compared to wild type controls (65% 89% reduction at high oxalic acid concentrations). A second assay examined lesion size after inoculation of leaflets with S. minor mycelia. Lesion size was reduced by 75% 97% in transformed plants, providing evidence that oxalate oxidase can confer enhanced resistance to Sclerotinia blight in peanut. Most recently, Anurahda et al. (2008) generated peanut plants expressing a mustard defensin protein. In vitro bio assays of leaf material indicated improved resistance to multiple fungal pathogens. Leaf Senescence a Nuclear Controlled Form of Programmed Cell Death Plants defend themselves against pathogens by activating a complex, multi component defense response. Induced defenses of plants against pathogens are regulated by networks of interconnecting signaling pathways involving cytosolic Ca2+ and H+ ions, reactive oxygen intermediates salicylic acid, jasmonic acid, nitric oxide, and ethylene as the primary components (Agrios, 2005) Increased activity of these pathways during pathogen infection is believed to be controlled by genefor gene interaction between the host and pathogen. Interactions between these defense pathways are complex and not completely understood. However, hypersensitivity is associated with nearly all defense mechanisms. Hypersensitivity is the rapid cell death at the site of attempted pathogen ingress.

PAGE 39

39 In recent years, programmed cell death (PCD) has become the focus of several studies because of its potential to explain many fundamental processes common to a species. PCD is the controlled self destruction of cells triggered by external or internal factors (Lim et al. 2007). PCD was once viewed as an unorganized process in which cellular components were randomly degraded and were relocated to newly developing tissues. More recent studies focusing on leaf senescence, a nuclear controlled form of PCD, show that the process is very much orchestrated and coordinated by a complex biochemical network (Gan and Amasino 1997; Brault and Maldiney 1999). Leaf senescence is a phase of a plants life c ycle that signifies the final stage of leaf development and is controlled by an extremely regulated system. Changes occur in cell structure, metabolism, and gene expression. Senescence is characterized by reduced photosynthetic capabilities, chlorosis and subsequent necrosis. A primary purpose of this process is to relocate nutrients from old, nonfunctional leaves to developing portions of the plant such as young leaves, growing seeds, or storage tissues (Gan and Amasino, 1997; Jordi et al 2000). Leaf sen escence is influenced by many internal and environmental signals (Lim et al 2007). Internal factors include age and productivity of tissues, flower and seed development, and phytohormone levels (Gan and Amasino, 1997). Environmental factors controlling leaf senescence can be biotic or abiotic in nature. Examples of these factors include temperature extremes, drought, ozone, nutrient deficiency, pathogen infection, wounding and shading (Lim et al 2007). Although the exact mechanisms that regulate leaf senescence are not yet well defined, several researchers have identified a class of control genes known as senescence associated genes (SAGs). SAGs have been identified in a number of plant species.

PAGE 40

40 First identified in Arabidopsis ( Arabidopsis thaliana (L.) ) H eynh. (Lohman et al 1994), SAGs have also been found in asparagus ( Asparagus officinalis L.) (King et al 1995), barley ( Hordeum vulgare L. ) (Becker and Apel 1993), rapeseed ( Brassica napus L.) (BuchananWollaston and Ainsworth, 1997), maize ( Zea mays L. ) (Smart et al 1995), radish ( Raphanus sativus L.) (Azumi and Watanabe, 1991), rice ( Orzya sativa L.) (Lee et al 2001), and tomato ( Solanum lycopersicum L. ) (Drake et al 1996). Many SAGs code for similar gene products across species lines. Products often associated with senescence genes are degradative enzymes such as proteases, lipases, nucleases, chlorophyllases, and other nutrient recycling proteins such as glutamine synthase (Gepstein et al 2003; Ori et al 1999) Watanabe and Imaseki (1982) were the first to observe a correlation between leaf senescence and a change in gene expression; their study indicated significant reduction of leaf mRNAs during the progression of senescence. Subsequent work with Arabidopsis showed that expression of photosynthet ic genes are markedly down regulated during the progression of leaf senescence, whereas mRNA levels increase for other genes (later to be classified as SAGs) (Jiang et al 1993; Humbeck et al 1996). Microarray analyses of Arabidopsis by van der Graaff et al (2006) investigated SAGs on a genomewide scale. Results from this work indicated the upregulation and downregulation of several hundred genes throughout the phases of senescence. Approximately 800 SAGs of varying classes have been identified for whi ch transcription is initiated at various stages of leaf senescence (Gepstein et al 2003). The large number of SAGs expressed during leaf senescence is indicative of its tight genetic control.

PAGE 41

41 In a study focusing upon mRNA accumulating during natural senescence of Arabidopisis leaves, Lohman et al. (1994) observed a gene that was upregulated throughout all phases of the process. This gene is now designated as senescence associated gene 12 ( SAG 12), and the five phases of leaf senescence are des cribed as fo llows: s tage one is the first visible sign of senescence, while stage five is total chlorosis. Analysis of SAG 12 expression showed that it was senescencespecific, up regulated only slightly at stage one, and then progressed rapidly to high levels that wer e maintained until senescence was complete. Subsequent studies showed that SAG 12 expression was not limited to leaf tissue alone, but was also expressed in other senescing tissues such as stems, sepals, petals, and carpels (Gan and Amasino, 1997). Ga n and Amasino (1995) linked the SAG 12 promoter to a reporter gene, uid A which codes for glucuronidase, to form a SAG 12uid A construct. Introduction of this chimeric gene into tobacco did not alter the rate of senescence, but showed increased uid A expression as leaf senescence progressed. Once effectiveness of the SAG12 promoter was confirme d, efforts then shifted toward developing an expression system that used cytokinins to delay leaf senescence. Cytokinins and Isopentyl Transferase Cytokinins are a class of plant hormones that are active in controlling several critical processes associated with the normal life cycle of a plant. Cytokinins are essential for cell division, chloroplast development, bud differentiation, shoot initiation and growth, and leaf senescence (Brault and Maldiney 1999). Although these critical roles are widely acknowl edged for cytokinins, the pathways controlling them have yet to be completely discerned.

PAGE 42

42 Most of the research has focused upon the controlled expression of cytokinin biosynthetic genes (Akiyshi et al. 1984; Barry et al. 1984). These studies indicate that the gene coding for adenosine phosphate isopentyl transferase ( IPT ) is a key regulator of cytokinin biosynthesis in Agrobacterium tumefaciens (Hirose et al 2008). This gene ( tmr) is located on the Ti plasmid of pathogenic A. tumefaciens and is activated during plant infection to initiate cytokinin production and gall formation (Sakakibara et al. 2005). IPT catalyzes condensation of dimethylallylpyrophosphate and 5 AMP to isopentenyladenosine (iPA) 5 phosphate (Hirose et al 2008). This reaction is generally considered the rate limiting step for cytokinin biosynthesis (Sakakibara, 2006). One of the earliest attempts to exploit IPT activity involved linking tmr to a heat shock inducible promoter, HS6871 (Smart et al. 1991). Transgenic tobacco expressing this construct initiated IPT production under heat stress were shorter with larger side shoots, and remained green longer than wildtype controls. After several cycles of heat shock, however, plant growth and morphology became abnormal due to extremely high levels of IPT accumulating in the transgenic plants. Subsequent research tested a multitude of promoters in combination with tmr with results generally similar to those reported by Smart (1991). Gan and Amasino (1995) were the first to report transgenic tobacco plants with increased IPT levels that did not exhibit developmental abnormalities. The tmr gene (referred to as IPT in this particular study) was linked to the senescencespec ific SAG 12 promoter. The SAG 12 IPT chimeric gene resulted in an autor egulatory system that was only activated during initi ation of leaf senescence. Because IPT expression was only activated during senescence, cytokinin levels were maintained at levels similar to wild-

PAGE 43

43 type controls, thus facilitating normal development. In a ddit ion, plants transformed with SAG 12 IPT had delayed leaf senescence and prolonged photosynthetic activity when compared to wildtype control plants. Subsequent research has focused on using the autoregulatory system developed by Gan and Amasino (1995) t o improve agronomic and horticultural performance in a variety of plant species. Reports indicate successful use of SAG 12 IPT in lettuce ( Lactuca sativa L. ) (McCabe et al. 2001), p etunia ( Petunia x hybrida) (Chang et al. 2003), tomato ( Solanum lycopersicum L.) (Swartzberg et al. 2006), alfalfa ( Medicago sativa L.) (Calderini et al. 2007), wheat ( Triticum aestivum L.) (Sykorova et al. 2008) and cassava ( Manihot esculenta Crantz) (Zhang et al. 2010) Pathogen Induced Leaf Senescence As previously discussed, leaf senescence is the final stage of le af development when photosynthetic rates are reduced and nutrients are recycled to newly developing portions of the plant. However, this process can be induced prematurely by a number of factors, including pathogen infection, which can lead to reduced productivity and yields (Gan and Amasino, 1995). Premature senescence in response to pathogen infection may have evolved as a mechanism of defense (Greenberg and Yao, 2004). This hypersensitive response would be advantageous in limiting pathogen growth and spread. Although beneficial to the infected plant, early leaf abscission can have negative effects in an agricultural setting. With fewer photosynthetic structures, fewer sugars are available for developing organs, and overall yield and productivity will be reduced. Assuming leaf senescence is induced by a lesionproducing pathogen such as Cercospora sp p ., reduced photosynthetic capabilities can be further compounded by the presence of lesions on the remaining, nonsene sced leaves. As previously discussed, successful efforts have been made to engineer several species of plants with the

PAGE 44

44 SAG 12 IPT chimeric gene to delay the onset of leaf senescence. Engineering plants to retain leaves, even under pathogen attack, could pot entially negate some of the undesirable effects associated with pathogen infection. Preliminary data (M. Jones and D. Clark, University of Florida) indicated that t ransgenic petunia expressing SAG 12 IPT had a delayed leaf senescence response (Jandrew, 200 2). Transformants also appeared to develop fewer chlorotic lesions and gained tolerance to petunia leaf spot disease caused by Cercospora petunia (Jandrew 2002) (Figure 11 ). Similar results were reported by Swartzberg et al. (2008), in which tomato plants transformed with SAG 12 IPT displayed suppressed symptoms (i.e. delayed leaf senescence and reduced lesion size) of the disease caused by Botrytis cinerea (De Bary) Whetzel Figure 11. Petunia Leaf Spot ( Cercospora petunia) Infection. (A) wild type P etunia and (B) SAG12 IPT transgenic Petunia (Jandrew 2002).

PAGE 45

45 CHAPTER 2 EVALUATING PEANUT CV FLORIDA 07 FOR LATE LEAF SPO T TOLERANCE Abstract Florida 07, a peanut cultivar recently released by the University of Florida, displays classic symptoms of l eaf spot susceptibility, having numerous lesions and heavy defoliation. However, it still produces good yields. Therefore, one hypothesis is that Florida 07 possesses tolerance to leaf spot. To test this hypothesis, Florida07 was compared to a known leaf spot susceptible cultivar, AP 3, and a known resistant cultivar York. Experiments were conducted in Citra, FL in 2008 and Marianna, FL in 2008 and 2009. For all years and locations, late leaf spot ( Cercosporidium personatum (Berk and M. A. Curtis) Deighton) appeared to be the predominant pathogen. The experimental design was a randomized complete block with a split plot treatment arrangement and three replications. C ultivars were assigned to subplots and fungicide treatment (full season vs. no spray) was assigned to main plots. Data collected included area under the disease progress curve (AUDPC) for visual leaf spot rating (Florida 110 scale), lesion/leaf percentage, lesion density, and lesion growth rate. Following harvest, pod yield, yield loss to leaf spot, and percent yield loss to leaf spot were calculated. In regard to visual rating, lesion/leaf percentage, and lesion density, the rate of disease progression (AUDPC) was the same in sprayed and nonsprayed York, sprayed AP 3, and sprayed Florida07. Disease progression was similar in nonsprayed AP 3 and nonsp rayed Florida07, but at a relatively faster rate compared to the aforementioned cultivar*t reatment combinations Regardless of cultivar*treatment combination lesion growth occurred at the same rate. Based on these data, it was concluded that Florida 07 and AP 3 possessed the same degree of susceptibility to late leaf spot disease.

PAGE 46

46 Because of its higher yield potential, Florida07 appeared to overcome t he impact of leaf spot disease in two out o f three tests, but in the third test, leaf spot impacted pod yi eld of Florida 07 and AP 3 equally. In the two test s in which Florida07 s higher yield potential became evident, environmental conditions were favorable for the onset and increased severity of leaf spot disease. Therefore, it was determined that in some environments, and primarily due to its yield potential, Florida 07 may provide a degree of protection against late leaf spot disease that AP 3 does not possess. However, on average, Florida0 7 does not appear to possess significant tolerance to leaf spot. Introduction Early leaf spot [ Cercospora arachidicola S. Hori (teleomorph Mycosphaerella arachidi Deighton)] (ELS) and late leaf spot [ Cercosporidium personatum (Berk and M. A.Curtis) Deight on (teleomorph Mycosphaerella berkeleyi Jenk)] (LLS) diseases are the most widespread foliar diseases of peanut. Both ELS and LLS diseases can be found wherever peanut is grown, making them among the most significant peanut diseases (Zhang et al. 2001). EL S and LLS diseases are characterized by necrotic flecks that enlarge to necrotic lesions that reduce light interception and photosynthesis (Boote et a. 1983). The reduction in photosynthetic leaf area is the primary factor associated with loss of yield in peanut. If fungicides are not used, pod yields can be reduced by as much as 50% in diseased plants (Zhang et al. 2001). Early defoliation is also associated with both types of leaf spot infection. Currently, management strategies for controlling leaf spot epidemics rely heavily on crop rotation or on reducing the rate of disease spread via resistant cultivars and regular applications of foliar fungicide (Zhang et al. 2001). Although leaf spot resistant cultivars are commercially available, the degree of protection in these cultivars is

PAGE 47

47 incomplete and still allows for a significant amount of damage. Previous studies have shown that partial resistance is due to the interaction of multiple components that additively produce varying degrees of resistance. Cul tivars exist with partial resistance, but there has been no complete or singlegene resistance to C. arachidicola or C. personatum reported in cultivated peanut. Components of resistance that have been identified include, infection frequency (dependent on density of inoculum), incubation period (time from inoculation to appearance of symptoms), latent period (time from inoculation to first sporulating lesion), lesion size, necrotic leaf area, spore production, and defoliation time ( Dwivedi et al. 2002; Cant onwine et al. 2008). Components of resistance have been reported for early and/or late leaf spot for several cultivars tested under field and greenhouse conditions (Chiteka et al. 1988a; Cook 1981; Foster et al. 1980; Green and Wynne 1986; Melouk and Banks 1984; R i cker et al. 1985; Subrahmanyam et al. 1982; Walls et al. 1985; Watson et al. 1998). Among the identified resistance components, no one component has emerged as the primary mechanism for resistance in leaf spot resistant cultivars (Cantonwine et al. 2008). Florida 07 (released by the University of Florida in 2006) (Gorbet and Tillman, 2009) is a m edium late maturing (~140 day) R unner market type peanut. Release of Flordia 07 was made on the basis of its excellent pod yield potential, competitive kernel grade, higholeic fatty aci d chemistry, and resistance to t omato spotted wilt topovirus (TSWV) and white mold (Gorbet and Tillman, 2009). In addition to the aforementioned characteristics, in non sprayed preliminary field trials, under high leaf spot pressure, Florida 07 consistently produced higher yields than other test varieties. However, Florida 07 still displayed classic symptoms of leaf spot disease, i.e. high lesion

PAGE 48

48 coverage and premature defoliation. Florida07 seemed to possess the ability t o sustain the effects of leaf spot disease without dying or suffering serious injury or crop loss Therefore, it was hypothesized that Florida07 possessed tolerance to leaf spot disease. The purpose of this study was to confirm/characterize Florida07 as a leaf spot tole rant cultivar and to identify a mechanism of tolerance. Currently, there are no reported formal field evaluations testing Florida07s tolerance to ELS and LLS diseases. AP3 (University of Florida, 2003) is a medium late maturing (~140 days) R unner market type peanut. AP 3 was released because of its excellent resistance to t omato spotted wilt topovirus (TSWV) and Sclerotium rolfsii (white mold). The cross that produced AP 3 was made primarily to produce material to select for resistance to white mold and Cylindrocladium black rot (CBR caused by Cylindrocladium parasiticum ) (Gorbet 2007). Despite AP 3s resistance to other fungal pathogens of peanut, AP 3 is very susceptible to early and late leaf spot diseases. Without fungicide treatment, AP 3 has high lesion coverage and premature defoliation, which results in reduced yields. York (University of Florida, 2006) is a late maturing (~150 days) runner market type peanut. York has excellent disease resistance to TSWV, white mold, and leaf spot diseases. Under intense leaf spot pressure, lesion coverage on York is minimal and is often isolated to the uppermost portion of the canopy. Defoliation in leaf spot infected York is also minimal. Because of the observed resistance to leaf spot in York, fungicide application recommendations allow for a reduced regime when York is grown in a good crop rotation.

PAGE 49

49 In this study, Florida07 was compared to AP 3, a known leaf spot disease susceptible cultivar, and York, a known leaf spot disease resista nt cultivar, in sprayed and nonsprayed field plots across multiple locations and years. Foliar leaf spot disease progression rates and yield were examined to classify Florida07 as susceptible, tolerant, or resistant. Materials and Methods Experimental Design Peanut cultivars for this study included AP 3 ( Gorbet, 2007a ), Florida 07, and York (released by the University of Florida in 2006) (Table 21 ). The three genotypes were planted on 20 May 2008 at the Plant Science Research & Education Unit located i n Citra, FL. Soil type in Citra, FL is Tavares sandy loam. The Citra, FL test site was previously planted with bahiagrass for the three year s prior. A duplicate test was planted on 3 June 2008 and 20 May 2009 at the North Florida Research and Education Center located in Marianna, FL. Soil type in Marianna, FL is Chipola sandy loam. The Marianna, FL test site was previously planted with a cotton and corn rotation. Test site loc ations can be seen in Figure 21 With the exception of fungicide applications, cultural and management practices followed the standard UF/IFAS Extension recommendations for irrigated peanut. The experimental design was a randomized complete block with a split plot treatment arrangement; fungicide treatment was assigned to the main pl ot and cultivar was assigned to the subplot. Plot dimensions were two rows, 4.5 m in length, with row centers set at 91 cm apart. Seed were sown at a rate of six seeds per 31 cm (90100 seeds per row) using conventional tillage practices. Border rows of C 99R and Florida07 were located on each side of the plots to maintain disease inoculum and to prevent

PAGE 50

50 spray drift from affecting adjacent plots in 2008 and 2009, respectively. Plots were replicated three times at each test site and two spray regimes were used as treatments (NS = no fungicide treatment, S = standard commercial fungicide treatment). Plots receiving the standard commercial treatment were sprayed with chlorothalonil, tebuconazole, pyraclostrobin, and azoxystrobin bi weekly beginning 30 DAP (Ta ble 22). In Citra, fun gicides were applied using a CO2 backpack sprayer and handheld boom with five nozzles, spaced 51 cm apart. Boom width (swath) allowed for complete coverage of peanut plants for the entire tworow plot. The sprayer was calibrated to deliver 327 L ha1. In Marianna, fungicides were applied using a Hi Boy, 12row sprayer with flat fan nozzles. Boom width allowed for coverage of the entire treated range of test plots. The sprayer was calibrated to deliver 206 L ha1. Disease Assessment Disease assessment began at the first sign of leaf spot symptoms and continued weekly until harvest. Identification of the pathogen causing disease was determined in the field using a 60X 100X, handheld microscope. In this study, late leaf spot was the pre dominant pathogen. Disease assessment for AP 3 and Florida 07 lasted a period of four weeks and six weeks for York. For all years and locations, leaf spot symptoms first appeared in early September. Qualitative, visual evaluations were made in the field using the Florida 1 10 leaf spot scale as described by Chiteka et al. (1988b ) (Table 23). Use of the Florida 110 rating scale allowed for the assessment of whole plot response to leaf spot pressure (lesion coverage and defoliation amount).

PAGE 51

51 Lesion percent age, lesion density, and average lesion size were quantified using APS Assess 2.0 image analysis software (American Phytopathological Society) Forty compound leaves (approximately 160 leaflets) were randomly collected from each plot weekly, scanned, and i mported into APS Assess 2.0 as JPEG images (Figure 23). Default settings were applied to determine total leaf and lesion area, lesion percentage and lesion frequency for each plot. Using the total leaf and lesion area and lesion frequency data, lesion density (lesions cm2) and average lesion area (mm2) were calculated. Area Under the Disease Progress Curve ( AUDPC) A rea under the disease progress curve (AUDPC) was calculated as the total area under the graph of disease severity (Florida 110 rating, lesion/leaf percentage, lesion density, and lesion growth rate) against time (weekly evaluation from early September through harvest) from the first scoring to the last: (2 1) where, ti = day s after planting (time) and Li = severity rating Harvest and Pod Yi eld Harvest dates were determined by maturity group and leaf spot severity. Plots with severe leaf spot pressure (high lesion coverage and high defoliation) were harvested early (plots receiving a rating 10 scale) to avoid substantial yield loss. Digging was accomplished with a tworow digger/inverter. Pod yields were determined by threshing all plants in a plot with a stationary thresher and weighing the pods after the seeds had dried to 910% moisture content. In addition to pod yields,

PAGE 52

52 yield loss to LLS disease (S NS ), and percent yield loss to LLS disease ((S NS) / S ) were determined for each plot. Environmental Conditions Environmental conditions for each year and location were determined from various weather components ( maximum (max ) temperature, minimum (min ) temperature, percent relative humidity (%RH)) obtained from the Florida Automated Weather Network (FAWN). Both test locations had FAWN stations on site. For temperatures (max/min) and %RH, daily av erages were collected beginning 70 DAP and continued until harvest for each test site. D aily leaf spot hours were calculated for each year and location. A leaf spot hour was defined as one hour with relative humidity greater than or equal to 90% and temperatures between 16C and 30C. Beginning 70 DAP and continuing through harvest dates, hourly average temperature and %RH data were collected. Leaf spot hours accounted for the amount of time in a given day which provided conditions that were most conducive to the rapid developme nt and increased severity of leaf spot diseases. Statistical Analysis Analysis of variance was carried out on the means for e ach AUDPC and pod yield per plot using the Mixed Model procedure (PROC Mixed) in SAS software (SAS Institute, 2000). Fungicide trea tment and cultivar were considered fixed effects whereas year and replication and their interactions were considered random effects. Statistical significance w as determined at P Disease Response Classifi cation Classification of cultivar disease response was based on descriptions reported in Agrios (2005) for resistance, tolerance, and susceptibility:

PAGE 53

53 Resistance the ability of an organism to exclude or overcome, completely or in some degree, the effect of a pathogen or other damaging factor. Tolerance the ability of a plant to sustain the effects of a disease without dying or suffering serious injury or crop loss. Susceptibility the inability of a plant to resist the effect of a pathogen or other dam aging factor; nonimmune. Results and Discussion Citra 2008 Disease progression. In Citra 2008, foliar lesions were first noted during the first week of September. Unless otherwise noted, cultivar*treatment was significant for each measure of disease prog ression. In terms of whole plot response (Florida 110 rating) and lesion percentage, Florida 07 and AP 3 were equally susceptible to LLS. AUDPC for the Florida 110 rating indicate d that d isease progression was most rapid in NS AP 3 (5.2 0.3 rating*time), followed by NS Florida07, S Florida07 (4.5 0.3 rating*time and 4.4 0.3 rating*time), then S AP 3, NS York (3.9 0.3 rating*time), and finally S York (2.0 0.3 rating*time) (Figure 2 4A). Likewise, in respect to lesion percentage, Florida07 and AP3 were equally susceptible to LLS. Cultivar was the only significant main effect for necrotic lesion percentage. In this test, AUDPC means for percent lesion coverage increased at the same rate for AP3 and Florida07 (14 1.1 %*time and 16.4 1.1%*ti me, respectively), but more rapidly than for York (3 1.1 %*time) (Figure 24B). In terms of lesion density, LLS progression was most rapid in NS Florida07 (4.8 0.2 lesions cm1*time), followed by S Florida07, NS AP 3, and S AP 3 (3.9 0.2 lesions cm2*time, 3.6 0.2 lesions cm2*time, and 3.4 0.2 lesions cm2*time, respectively). Disease progression was slowest on NS York and then S York (1.8 0.2 lesions cm-

PAGE 54

54 2*time and 0.6 0.2 lesions cm1*time, respectively) (Figure 2 4C). These results sugges t that LLS lesions may develop more rapidly on Florida07 than AP 3, meaning, in terms of foliar lesion density, Florida07 may be more susceptible to LLS. Rate of lesion growth was not affected by treatment, c ultivar, or cultivar*treatment interaction. Le sion size increased at the same rate on all cultivars and treatments (Figure 2 4D). Yield Response. T reatment, cultivar, and cultivar*treatment effects were significant (p>F = <0.0001, p>F = <0.0001, and p>F = 0.0007, respectively). In Citra 2008, yield r esponse for cultivar*treatments occurred as expected under high LLS pressure. Characteristic of a leaf spot resistant cultivar, York produced the same yields under LLS pressure in the S and NS treatment s (2429 kg ha1 and 2320 kg ha1, respectively) (p>t = 0.6527) AP 3, a known susceptible under LLS pressure, yielded much higher in the S treatment than the NS treatment ( 4452 kg ha1 and 2461 kg ha1, respectively) (p>t = <0.0001) Likewise S Florida 07 yielded higher than NS Florida07 under LLS pressure (4806 kg ha1 and 3722 kg ha1, respectively) (p>t = 0.0009). Despite AP 3 and Florida07s similarity in yield response to treatments, if yields of NS AP3 and NS Florida07 are compared, then NS Florida 07 yielded more than NS AP 3 ( P > t =0.0003). Similarly, AP 3s yield loss to LLS (S NS) was more than that lost by Florida 07( 1991 kg ha1 and 1084 kg ha1, respectively) ( P > t =0.0524). However, when the yields lost to LLS are normalized to percentage values ((S NS) / S), AP 3 and Florida 07 lost th e same percent value of their yield (44.8% and 22.3%, respectively) ( P > t =0.1698) (Table 24) However, if one compares cultivar alone, regardless of treatment, Florida07 yielded higher than AP 3 (p
PAGE 55

55 yield in the absence of leaf spot disease may be the reason Florida 07 appeared to display tolerance to the disease in preliminary studies. To summarize the Citra 2008 test, disease progression in whole plot evaluations and percent lesion coverage suggest that Florida07 and AP 3 are equally susceptible o LLS. However, higher lesion frequencies developing over time indicate that Florida07 is more susceptible to LLS. Comparison of Florida07 and AP 3 yields show that Florida07 has the potential to produce higher yields even under high LLS pressure. Florida07s ability to produce high yields even under pathogen attack (i.e. high lesion density) suggests that it possesses a degree of tolerance to LLS. However, upon normalizing yield data, it becomes clear that Florida07 did not display t olerance to LLS, but instead had a higher yield potential. Although Florida07 did not display tolerance as defined by Agrios (2005) in this test, its higher yield potential did provide a degree of protection to final yield. No other fung al diseases were observed in Citra 2008. However, insect pest pressure was high late in the season. An unknown species of leafhopper caused a fairly large reduction in canopy density. Reduction in canopy density might have contributed to reduced photosynth etic rates, which could have potentially impact ed final yield s. However, because damage occurred late in the season (occurring just prior to harvest of Florida 07 and AP 3 plots), it was determined that this reduced canopy density likely did not affect yield s. Mari anna 2008 Disease p rogression. In Marianna 2008, foliar lesions were first noted during the second week of September. Cultivar*treatment interaction was significant main effect for each measure of disease progression unless otherwise noted.

PAGE 56

56 AUDP C for the Florida 110 scale and lesion density indicated that LLS disease progression was more rapid in Florida07 than for AP 3. AUDPC for Florida 110 ratings was most rapid on NS Florida 07, followed by NS AP 3, and then NS York (5.4 0.3 rating*time, 4.4 0.3 rating*time, and 2.7 0.3 rating *time, respectively). S Florida07 and S AP 3s disease progression were the same (1.8 0.3 rating*time and 0.3 1.7 rating*time, respectively), followed by disease progression in S York (1.0 0.3 rating*tim e) (Figure 2 5A). Likewise, the rate at which lesion density increased throughout the season was most rapid for NS Florida 07, followed by NS AP 3, and then NS York (4.0 0.2 lesions cm1*time, 3.3 0.2 lesions cm1*time, and 2.1 0.2 lesions cm1*time, respectively). Disease progression as a measure of lesion density was equal in S Florida07, S York, and S AP 3 (0.8 0.2 lesions cm2*time, 0.7 0.2 lesions cm2*time, 0.6 0.2 lesions cm2*time, respectively), but occurred at a slower rate than obser ved in the previously mentioned cultivar*treatments (Figure 25C). Percent necrotic lesion indicates that disease progression was equal in NS Florida 07 and NS AP 3, followed by NS York (15.2 0.7 %*time, 14.2 0.7 %*time, and 5.6 0.7 %*time, respectiv ely). S Florida 07, S AP 3, and S York were equal in rate of disease progression (2.8 0.7 %*time, 2.3 0.7 %*time, and 1.9 0.7 %*time), but rates were slower than those observed in the aforementioned cultivar*treatments (Figure 2 5B). Under high LLS pressure, Florida07 and AP 3 were equally susceptible. Rate of lesion growth was not affected by treatment, cultivar, or cultivar*treatment interaction. Lesion size increased at the same rate on all cultivars and treatments (Figure 2 5D).

PAGE 57

57 Yield r esponse. In Marianna 2008, treatment and cultivar*treatment interaction affected pod yield (p > F = <0.0001 and p > F = 0.0106, respectively). S cultivars yielded more than their NS counterparts. NS AP3 and NS Florida07 produced equal yields (2790 kg ha1 and 27 86 kg ha1, respectively) (p > t = 0.9841). AP3 and Florida07s y ield lost to LLS were also equal (1811 and 1648, respectively) (p > t = 0.5397), as well as percent yield lost to LLS (39.4% and 37.2%, respectively) ( p > t = 0.7109) (Table 2 5) Based on AP3 and Florida07 having equal yield under LLS pressure, yield lost to LLS, and yield percentage lost to LLS, it was determined, in terms of yield response, that Florida07 did not display tolerance to LLS in Marianna 2008, and was equally susceptible to LLS as AP3 To summarize the Marianna 2008 test, yields under LLS pressure, yield lost to LLS, and percent yield lost to LLS suggest that Florida07 and AP 3 are equally susceptible to LLS. The higher yield potential observed in Citra 2008 test was not observed in the Marianna 2008 test. Compared to Citra 2008, in Marianna 2008, Florida 07 was more susceptible to LLS than AP 3, having more rapid disease progression with respect to the Florida 1 10 rating and lesion density. The m ore rapid disease progres sion in Florida 07 may explain why a higher yield potential was not observed in this test. In addition to LLS, the only other fungal disease observed was a small amount of rust in the 2008 Marianna test site. Signs of rust were not observed until thr ee days prior to harvest and were found on only nontreated plots. Because of the extremely late onset and very small amount of rust found, it was determined that its presence was

PAGE 58

58 negligible and had no impact on the result of the test. LLS disease was the great est yield reducing factor in this study. Marianna 2009 Disease progression. In Marianna 2009, foliar lesions were first noted during the second week of September. Cultivar*treatment interaction affected each measure of disease progression unless otherwise noted. Disease progression, in terms of Florida 110 rating, was most rapid in NS Florida07 and NS AP 3 (3.5 0.2 rating*time and 3.4 0.2 rating*time, respectively). Disease progression rate was the same for NS York, S Florida 07, S AP3, and S York ( 2.3 0.2 rating*time, 2.1 0.2 rating*time, 2.0 0.2 rating*time, and 2.0 0.2 rating*time, respectively), but at a slower rate than the previously mentioned cultivar*treatments (Figure 2 6A). Under high LLS pressure, in terms of the Florida 110 rating, Florida 07 and AP 3 were equally susceptible. The rate of disease percent lesion coverage increased most rapidly in NS Florida 07 (25.2 2.7 %*time), followed by NS AP3 (17.6 2.7 %*time). Disease progression was equal in NS York, S AP 3, S Florida07, and S York (4.6 2.7 %*time, 3.0 2.7 %*time, 1.7 2.7 %*time, and 1.3 2.7 %*tim e, respectively), but was at a slower rate than the aforementioned cultivar*treatments (Figure 26B). Based on the results of this test, in terms of percent lesion cov erage, under high LLS disease pressure, Florida07 was more susceptible to LLS than AP 3 Disease progression, in terms of lesion density, was most rapid in NS Florida07(5.6 0.3 lesions cm2*time), followed by NS AP3 (3.9 0.3 lesions cm2*time). Dise ase progression was slower in NS York, S AP 3, S Florida 07 (1.8 0.3 lesions cm2*time, 1.1 0.3 lesions cm2*time, and 0.8 0.3 lesions cm2*time), followed by S York (0.6 0.3 lesions cm2*time) (Figure 2 6C).

PAGE 59

59 Based on results for percent lesion cov erage and lesion density under high disease pressure, Florida07 was more susceptible than AP 3. Rate of lesion growth was not affected by treatment, cultivar, or cultivar*treatment interaction. Lesion size increased at the same rate on all cultivars and treatments (Figure 2 6D). Yield response. In Marianna 2009, pod yield varied by treatment and cultivar were s ignificant main effects (P > F = 0.0166 and P > F = 0.0146, respectively). The difference in yield for S plots and NS plots was significant (3833 kg ha1 and 3098 kg ha1, respectively) ( P > t = 0.0166). Florida07 yielded (4122 kg ha1) higher than AP 3 (3082 kg ha1) (P > t = 0.0078), as well as York (3193 kg ha1) (P > t = 0.0142). AP 3 and Yorks yields were equal (P > t = 0.7311) (Table 26) A s in the Citra 2008 test, in this test, Florida07 produced higher pod yields than AP 3 (averaged over S and NS treatment, which indicates that Florida 07 possesses a higher genetic yield potential rather than tolerance to LLS) To summarize the Marianna 2009 test, disease progression rate as measured by lesion percentage and lesion density showed that Florida07 was more susceptible to LLS than AP 3. Despite foliar symptoms developing more rapidly in Florida07 than AP 3, Florida07s yields were higher th an yields in AP 3. Florida07 under higher disease pressure than AP 3 and possessing the ability to produce higher yields suggests that Florida 07 may have a degree of tolerance to LLS. However, this discrepancy Florida07 and AP 3 yields is probably better explained by differences in genetic yield potential as was observed in the Citra 2008 test.

PAGE 60

60 All Years*Locations Disease progression. Foliar lesions appeared in early September for all tests. Cultivar*treatment interaction was significant for each measure of disease progression unless otherwise noted. On average, means for AUDPC for the Florida 1 10 rating, lesion percentage, and lesion density indicate that Florida07 and AP 3 are equally susceptible to LLS disease. I n terms of the Florida 1 10 rating, disease progression was most rapid in NS Florida07 and NS AP 3 (5.7 rating*time and 5.7 rating*time, respectively). Disease progression was slower and equal on S AP 3, S Florida07, NS York, and S York (3.6 rating*time, 3.2 rating*time, 3.0 rating*time 2.0 rating*time, respectively) (Figure 27A). Disease progression, as measured by lesion percentage, was most rapid for NS Florida 07 and NS AP3 (24.6%*time and 20.3%*time, respectively). Disease progression was slower and equal on NS York, S Florida07 S AP3, and S York (9.5%*time, 7.4%*time, 7.3%*time, and 6.4%*time, respectively) (Figure 27B). Increase in lesion density throughout the season was most rapid in NS Florida07 and NS AP 3 (6.0 lesions cm1*time and 4.6 lesions cm1*time, respectively). Disease progression occurred at a slower, but similar rate in NS York, S Florida07, S AP 3, and S York (3.1 lesions cm2*time, 2.4 lesions cm2*time, 2.3 lesions cm2*time, 2.1 lesions cm2*time, respectively) (Figure 2 7C). As in all individual tests, lesion growth rate was equal in all treatments and cultivars. No main effects were significant (Figure 27D). Yield response. On average, in terms of yield, cultivar*treatment interaction was the only significant main effect (P > t = 0.0001). Yields under LLS pressure for S Florida 07 and S AP 3 were equal (4734 kg ha1 and 4092 kg ha1, respectively) (p>t =

PAGE 61

61 0.2688). Likewise, yields under LLS pressure for NS Florida07 and NS AP 3 were equal (3556 kg ha1 and 2527 kg ha1, respectively) (P > t = 0.0803). Yield lost to LLS were equal for Florida07 and AP 3 (1177 kg ha1 and 1564 kg ha1, respectively) (p>t = 0.1563), as well as percent yield lost in Florida07 and AP 3 (23.5 and 34.9, respectively) (P > t = 0.0894). S York and NS Yorks yields under LLS pr essure were the same (2976 kg ha1 and 2663 kg ha1, respectively) (P > t = 0.2729), as is expected by a resistant cultivar (Table 27). Yorks yield lost to LLS and percent yield lost to LLS was less than those for Florida 07 and AP 3. On average, Flor ida 07 displayed no tolerance to LLS. Disease progression was equal in Florida07 and AP 3. The yield under LLS pressure for NS AP 3 and NS Florida 07 was the same. Likewise, the yield lost to LLS and the difference of percent yield loss between AP 3 and F lorida 07 was the same (P > t = 0.1563 and P > t = 0.0894, respectively). However, these values approach statistical significance and it is possible that with additional testing, response s of Flo rida 07 and AP 3 would separate. Environmental Conditions In an effort to explain the highly variable yield response under high LLS pressure and to determine disease pressure environmental data were collected using the Florida Automated Weather Network (FAWN). Environmental conditions required for rapid development and increased severity of LLS are warm temperatures and long periods of high humidity or leaf wetness. Differences in test site environment were determined by observing average daily leaf spot hours, percent relative humidity, and min/ max temperatures. On average, Marianna 2009 had more daily leaf spot hours (12.1 hrs day1) compared to Marianna 2008 or Citra 2008 (9.2 hrs day1and 10.2 hrs day1,

PAGE 62

62 respectively) However, when analyzing individual components which comprise leaf spot hours, i t appeared that Citra 2008 (80.7%, 20.9C/32.1C) and Marianna 2009 (83.5%, 20.4C/31.8C ) had higher and warmer daily high/low temperatures when compared to Marianna 2008 (77.2%, 19.4C/88.1F) (Table 28) Overall, Citra 2008 and Marianna 2009 provided an environment more conducive to the rapid development and increased severity of LLS disease. Conclusions Limited research has been conducted to identify and characterize tolerance as a mechanism for overcoming LLS disease (Pixley et al 1990) P revious research has pri marily focused on identifying sources of resistance to leaf spot disease in peanut. Although resistant cultivars are available, many of these are derived from a similar genetic lineage and have several undesirable characteristics associated with thei r resi stance, i.e. late maturity large seeded, and poor germination (Morton, 2007) Tolerance provides an alternative to the limited genetic resistance available in cultivated peanut. Based on the rate at which foliar disease symptoms progressed over time, it was concluded, that under high LLS pressure, AP 3 and Florida07 showed the same degree of susceptibility. However, in specific tests and measurements of foliar disease progression, Florida07 did appear to be more susceptible to LLS than AP 3. In all test s, the rate of lesion growth was equal for all treatments and cultivars tested. This result is likely due to the limited rate at which hyphae of C. personatum can grow and penetrate new tissue. Yield response suggests that Florida07 has a higher genetic yield potential than either York or AP 3. In this study, York yields w ere low due to poor germination which

PAGE 63

63 led to poor plant stand s. However, research has shown that when germination in York is high, yields were competitive with Florida 07. On average, Fl orida07 did not display tolerance to LLS. However, in two of the three tests, pod yield of Florida07 was greater than that of AP 3. The higher pod yield of Florida 07 is what led to it being mistakenly classified as a possible leaf spot tolerant cultivar In this study b ecause of its higher yield potential, Florida07 appeared to overcome t he impact of leaf spot disease in two out of three tests, but in the third test, leaf spot impacted pod yi eld of Florida07 and AP 3 equally. However, Citra 2008 and Marianna 2009, the two tests in which Florida07s higher yield potential became evident, had weather conditions were more conducive for the rapid development and increased severity of LLS. In an environment where rapid growth and development of leaf spot likely occurred, Florida07 proved to be more resilient to LLS. Although Florida07 does not fit the definition of tolerance described by Agrios (2005) it does provide a degree of protection for a grower by producing higher yields than other cultivars. Ba sed on this evidence, it was concluded that Florida07 did not display tolerance to LLS disease. Therefore, no tolerance mechanisms were identified. However, compared to other LLS susceptible cultivars, Florida07 possesses a high yield potential which can act as an insurance policy to growers.

PAGE 64

64 Figure 21. Florida is divided into three peanut growing regions. Counties highlighted in yellow are ranked (1 9) by the acreage planted in peanut. Experimental locations Marianna an d Citra, are indicated on the map (modified from Mossler and Aerts, 2007)

PAGE 65

65 Table 21. Peanut cultivar descriptions. Cultivar York University of Florida, 2006 89 x OL24 3 1 2 2 b2 B x C99 R Runner type Late maturing (~150 days) High oleic chemistry, resi stance to TSWV & white mold If not sprayed to prevent LS = defoliation and lesion cov e rage minimal, lesions co n fined to upper canopy (mo d erate resistance) reduced fungicide regime AP 3 University of Florida, 2003 OKFH15 x NC3033 Runne r type Medium late maturing (~140 days) High oleic chemistry, resistance to TSWV and white mold If not sprayed to prevent LS = high lesion coverage, premature defoliation, reduced yields Florida 07 University of Florida, 2006 89 x OL14 11 1 1 1 b2 B x C99 R Runner type Medium late maturing (~140 day) High oleic chemistry, resistance to TSWV & white mold If not sprayed to prevent LS = high lesion coverage, premature defoliation, yields higher than other susceptibl e cultivars

PAGE 66

66 Figure 22 Typical late season, lateral branch l eaflet lesion coverage under high late leaf spot pressure on (A) York, (B) AP 3, and (C) Florida 07 peanut cultivars in Citra, Florida 2008 and Marianna, Florida 2008 and 2009.

PAGE 67

67 Table 22 Standard commercial fungicide spray t reatment s applied in Citra Florida 2008 and Marianna, Florida 2008 and 2009 Treatments began approximately 30 days after planting and continued bi weekly. Treatment Commercial Name (rate ml ha 1) Citra 2008 Marianna 2008 & 2009 1 Bravo Weatherstik 1 (1753) Bravo Weatherstik 1 (877) 2 Bravo Weatherstik 1 (1753) Bravo Weatherstik 1 (877) 3 Headline 2 (296) Bravo Weatherstik 1 (877) Tebustar 4 (213) 4 Abound 3 (532) Bravo Weatherstik 1 (877) Tebustar 4 (213) 5 Bravo Weatherstik 1 (877) Abound 3 (532) Folicur 4 (213) 6 Bravo Weatherstik 1 (877) Headline 2 (296) Folicur 4 (213) 7 Bravo Weatherstik 1 (1753) Bravo Weatherstik 1 (877) 8 Bravo Weatherstik 1 (1753) --Footer denotes active ingredient: 1Chlorothalonil, 2Pyralostrobin, 3Azoxystrobin, 4Tebuconazole

PAGE 68

68 Table 23 Florida 1 10 leaf s pot r ating based on Chiteka et al ( 1988) Rating Description 1 No di sease 2 Very few lesions (none on upper canopy) 3 Few lesions (very few on upper canopy) 4 Some lesions with more on upper canopy than rank for 3 and slight defoliation noticeable 5 Lesions noticeable even on upper canopy with notic eable defoliation 6 Lesions numerous on upper canopy with significant defoliation (50%+) 7 Lesions numerous on upper canopy with much defoliation (75%+) 8 Upper canopy covered with lesions with high defoliation (90%+) 9 Very few lea ves remaining and those covered with lesions (some plants completely defoliated) 10 Plants dead

PAGE 69

69 Figure 23 Example of peanut leaf collection for evaluation of late leaf spot disease. Beginning at the first sign of leaf spot, compo und leaves (40 compound leaves/plot = 160 leaflets) were collected weekly and scanned into APS Assess 2.0 (American Phytopathological Society) for image analysis Tests were conducted in 2008 and 2009 in Citra, Florida and Marianna, Florida.

PAGE 70

70 Figure 24 Progr ession of late leaf spot disease of peanut based on AUDPC in Citra, Florida 2008 fo r (A) Florida 1 10 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) l esion g rowth (no significant main effects) Means with the same letter are not different at the P l.

PAGE 71

71 Figure 25 Progression of late leaf spot disease of peanut based on AUDPC in Marianna, Florida 2008 for (A) Florida 110 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth (no significant main effects). Means with the same letter are not different at the P .

PAGE 72

72 Figure 26 Progression of late leaf spot disease of peanut based on AUDPC in Marianna, Florida 2009 for (A) Florida 110 Rating, (B) lesion/leaf percentage, (C) lesion density, and ( D) lesion growth (no significant main effects). Means with the same letter are not different at the P

PAGE 73

73 Figure 27 Progression of late leaf spot disease of peanut based on AUDPC in Citra, Florida 2008 and Marianna, Florida 2008 and 2009 for (A) Florida 1 10 Rating, (B) lesion/leaf percentage, (C) lesion density, and (D) lesion growth (no significant main effects). Means with the same letter are not different at the P

PAGE 74

74 Table 24 Peanut pod yield and pod loss to late leaf spot disease in Citra, Florida in 2008. Cultivar Spray Yield Under LLS Pressure Yield Lost to LLS % Yield Lost to LLS (kg ha 1 ) (kg ha 1 ) Florida 07 S 4806 207 a 1084 207 b 22.3 9.8 a NS 3722 207 c AP3 S 4 452 207 b 1991 207 a 44.8 9.8 a NS 2461 207 d York S 2429 207 d 109 207 c 0.9 9.8 b NS 2320 207 d *Each column is a mean SE **Means within columns followed by the same letter are not different at the P Table 25 Peanut pod yield and pod loss to late leaf spot disease in Marianna, Florida in 2008. Cultivar Spray Yield Under LLS Pressure Yield Lost to LLS % Yield Lost to LLS (kg ha 1) (kg ha 1) Florida 07 S 4434 168. 29 a 1648 168 a 37.2 4.0 a,b NS 2786 168.29 c AP3 S 4601 168.29 a 1811 168 a 39.4 4.0 a NS 2790 168.29 c York S 3823 168.29 b 878 168 b 22.9 4.0 b NS 2946 168.29 c *Each colu mn is a mean SE **Means within columns followed by the same letter are not different at the P

PAGE 75

75 Table 26 Peanut pod yield and pod loss to late leaf spot disease in Marianna, Florida in 2009. Cultivar Spray Yield Under LLS Pressure (kg ha 1) S 3833 183 a NS 3098 183 b Florida 07 4122 223 a AP3 3082 223 b York 3193 223 b *Only treatment and cultivar were significant main effects. Each column is a mean SE **Means within columns followed by the same letter ar e not different at the P Table 27 Peanut pod yield and pod loss to late leaf spot disease in Citra, Florida in 2008 and Marianna, Florida in 2008 and 2009. Cultivar Spray Yield Under LLS Pressure Yield Lost to LLS % Yield Lost to LLS (kg ha 1 ) (kg ha 1 ) Florida 07 S 4734 430 a 1177 430 a 23.5 8.9 a NS 3556 430 b AP3 S 4092 430 a,b 1564 430 a 34.9 8.9 a NS 2527 430 c York S 2976 430 b,c 314 430 b 6.3 8.9 b NS 2663 430 c *Each column is a mean SE **Means within columns followed by the same l etter are not different at the P

PAGE 76

76 Table 2--8 Environmental c onditions that impact leaf spot disease of peanut. Location Year % RH Min. Temp. (C) Max. Temp. (C) Leaf Spot Hrs 1 (hrs/day) Citra 2008 80.7 1.3 b 20.9 0.7 a 32.1 0.6 a 10.2 0.5 b Marianna 2008 77.2 1.3 c 19.4 0.7 b 31.2 0.6 b 9.2 0 .5 b Marianna 2009 83.5 1.3 a 20.4 0.7 a b 31.8 0.6 a, b 12.1 0.5 a *Mean SE. **Means within individual columns fol lowed by the same letter are not different at the P 1Leaf Spot Hrs = 1 hour with percent relative humidity greater than or equal to 90% and temperatures between 16C and 30C

PAGE 77

77 CHAPTER 3 A DIRECT SHOOT ORAGANO GENESIS SYSTEM FOR U.S. PEANUT CULT IVAR S Abstract One of t he most successful method s for producing transgenic peanut is particle bombardment of somatic embryos. A major disadvantage of this approach is the time requ ired to produce mature plants (eight to 12 months). An alternative to lengthy b ombardment and regeneration protocols is Agrobacterium mediated transformation employing direct shoot organogenesis. This strategy allows for mature, transgenic plants to be obtained quickly (three to four months). Peanut cultivars Florida 07 (Runner), Ge orgia Green (Runner), Georgia Brown (Spanish), ValenciaA (Valencia), and VC 2 (Virginia), were selected to represent all four market types. Two types of cotyledon explants were examined, those that previously had an attached embryoaxis upon cotyledon separation (explant A) and those that were embryoaxis free upon separation (explant B). Explants were placed on shoot induction medium (MS salts, B5 vitamins, 3% sucrose, 0.8% agar, 10 M 2,4D, pH 5.8) with N6 benzyladenine (BA) concentrations ranging from 10 M 80 M for Florida07, Georgia Green, and VC2, 10 M 320 M for Georgia Brown, and 10 M 640 M for ValenciaA Following a four week culture period, explants were visually rated based on a scale of 1 to 4, where 1 indicated slight greening, but no growth; 2 indicated greening, with callus like growth, but no adventitious bud formation; 3 indicated greening and adv entitious bud formation; and 4 indicated greening, adventitious bud formation, as well as small leaflet expansion. A difference in sh oot induction was observed for the cotyledon explants examined (P > t = <0.0001). Explant A had greater shoot induction with a visual rating of 1.8 0.1 while explant B had a rating of 1.6 0.1 (P > t = <0.0001). Additionally, cultivars responded

PAGE 78

78 to th e culture conditions differently (cultivar BA interaction). Georgia Green on 10 M BA pro duced the most shoot buds (24. 6%) and the highest visual rating (2.1), followed by VC2 on 10 M BA (22.1%, 1.8), ValenciaA on 640 M BA (21.4%, 1.8), Georgia Brown on 80 M BA (9.0%, 1.7), and Florida07 on 40 M BA (7.1%, 1.8). Of the tested varieties, Georgia Green, ValenciaA and VC2 were best suited for future transformation experiments based on their shoot bud production. Introduction Peanut production and its associated industries are important to the overall economic prosperity of many rural areas in the southeastern U.S. The peanut industry generates approximately $4 billion annually for the U.S. economy. Throughout the growing season, peanut growers are faced with many biotic and abiotic threats that can lower yields and ultimately profit. Presently, conventional breeding is the primary means to overcome these threatening factors. Through use of conventional breeding techniques, both cultivated and wild Arachi s species have been used to develop agronomically superior cultivars. However, conventional breeding is a slow and difficult endeavor due to reproductive barriers, failure of interspecific crosses, and transfer of undesirable traits. Recently, there has be en an increased interest in using genetic transformation to circumvent some of the problems associated with traditional breeding. Although several studies report the successful transformation of peanut, no single protocol has proven to be highly efficient in the number of transgenic lines recovered. Furthermore, many of the studies used lengthy somatic embryogenesis protocols requiring eight to 12 months to generate mature plants. This inefficient use of time and poor in vitro conversion into whole, mature, seedbearing plants, has led to the

PAGE 79

79 investigation of alternative organogenesis protocols that can be successfully used in Agrobacterium transformation studies. Sharma and Anjaiah (2000) reported an efficient method (> 90%) for the production of advent itious shoot buds using mature seed explants on MS medium (Murashige and Skoog, 1962) supplemented with 20 M N 6 benzyladenine ( BA) and 10 M 2,4 d ichlorophenoxyacetic acid ( 2,4 D ) Combinations of BA (2.5, 5.0, 7.5, 10.0, 15.0, 20.0, 25.0 M) and 2,4D (1 .0, 2.5, 5.0, 7.5, 10.0, 15.0, 20.0 M) were tested with six Indian cultivars belonging to the Spanish (JL24, J 11, ICGS 11) and Virginia (Robut 3 11, ICGS 76, ICGS 44) market types. These six peanut varieties produced shoot buds with high frequencies (80.0 97.7%) and followed a similar pattern of growth and development on each medium formulation. Shoot proliferation appeared to be most dependent upon BA concentration. Of the s ix test cultivars, Sharma and Anjaiah (2000) reported that JL24 performed the best. JL 24 is a cultivar widely grown in India, but is not readily available in the U.S. The goal of this research was to opti mize direct shoot organogenesis culture conditions for use with readily available, regionally, and economically important U.S. c ultivars (Georgia Green, Florida07, Georgia Browne, VC 2, and ValenciaA ). It was hypothesized that the direct shoot organogenesis protocol described by Sharma and Anajaiah (2000) could be optimized for U.S. peanut cultivars representing each market type. Materials and Methods Cultivar Selection Peanut cultivars representing the four market types were evaluated for their potential for in vitro direct shoot organogenesis from cotyledon explants. Florida07 (Gorbet and Tillman, 2009) and Georgia Green (Bra nch, 1996) Runner market types,

PAGE 80

80 were selected because the former was a recent release by the University of Florida with many agronomically favorable traits, including high oleic chemistry, and the latter was, until recently, the most widely grown cultivar in the U.S. Georgia Browne (Branch, 1994) a Spanish market type, was selected based on its availability, and because it is one of a very few Spanish types grown in the southeastern U.S. ValenciaA (His et al. 1972) a Valencia market type, was selected because of its successful use in previous transformation studies (Cheng et al. 1996, 1997; Egnin et al. 1998; Eapen and George 1994; Li et al. 1997). VC 2 (AgraTech Seed, Golden Peanut Company, LLC) a Virginia market type, was selected because it is widely cultivated in the Virginia Carolina U.S. peanut growing region. Explant Preparation The direct shoot organogenesis protocol used followed that described by Sharma and Anajaiah (2000) with modifications described below. For all experiments, prior to use, mature seeds were surfacesterilized by soaking in 70% ethanol for 1 min., followed by a wash for 10 min in 0.1% (w/v) mercuric chloride solution. Following this wash, seeds were rinsed five times in steriledistilled water and then allowed to soak in ster ile distilled water for four hrs before further use. With forceps and under aseptic conditions, seed coats were carefully removed. Cotyledons were separated into two halves. The cotyledon half containing the embryo axis was designated as cotyledon A, whi le the cotyledon without the embryo axis was designated as cotyledon B. Using a scalpel and forceps, the embryo axis was removed from cotyledon A and discarded. Both cotyledons were then cut into vertical halves to obtain quartered cotyledon explants (Fi gure 31). The proximal, freshly cut edge of each explant was then embedded into shoot induction medium (SIM; MS salts [Sigma, St. Louis, MO, USA], B5

PAGE 81

81 vitamins, 3% (w/v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ, USA), 10 M 2,4dichlorophenoxyacetic acid (2,4D) (Sigma, St. Louis, MO, USA), and either 10, 20, 40, 80, 160, 320, or 640 M N6benzyladenine (BA) [Sigma, St. Louis, MO, USA], pH 5.8) at a slight downward angle. Since Sharma and Anjaiah (2000) reported that increased 2,4 D concentrations showed no significant increase in shoot bud formation, 2,4D concentrations remained at 10 M for all media formulations. Four cotyledon explants (one whole seed) were placed onto 25 mm Petri dishes containing approximately 50 ml SIM medium. Experimental Design Each experiment consisted of 40 cotyledon explants (10 seeds). Cultures were sealed and allowed to incubate at 26 1C und 1 m2 irradiance for four weeks. Following the four week shoot induction period, explants were evaluated for direct shoot organogenesis (DSO) on a scale of 1 4 for adventitious bud formation (Figure 32). Shoot induction p ercentage (SI %) was determined for each BA level*cultivar interaction. SI% represented cultures that were capable of moving into the shoot elongation phase ( percentage of explants receiving a rating of > 2). Evaluation of Cotyledon Explant Source Explant s from each cultivar were prepared as described above. Cotyledons A and B were cut in half vertically to obtain quarteredcotyledon explants and placed on culture plates containing SIM medium. SI% and DSO rating were determined following a four week cultur e period.

PAGE 82

82 Evaluation of Shoot induction and Direct Shoot Organogenesis The five previously mentioned cultivars were prepared as described above. Explants were evaluated for DSO rating and SI% on SIM medium supplemented with BA at 10 M (SIM10), 20 M (SIM20), 40 M (SIM40), and 80 M (SIM80). Explant response was evaluated following a four week culture period. For cultivars that responded with a strong linear trend within the 1080 M BA range, BA concentrations were increased until a quadratic (normal) dis tribution was observed. The assumption was that shoot induction response should fit a normal distribution, with optimal response being at the peak of the quadratic curve. Consequently, BA levels for Georgia Green were tested at 160 M (SIM160) and 320 M ( SIM320), while BA levels for ValenciaA were tested at 160 M, 320 M, and 640 M (SIM640). Following a four week culture period, explants were evaluated by DSO rating and SI%. Regeneration of Mature Plants Explants bearing shoot buds were transferred to s hoot elongation medium (SEM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ, USA), and 2 M BA [Sigma, St. Louis, MO, USA], pH 5.8) Elongated shoots were subcultured twice, every four weeks to fresh SEM (or when shoot length was approximately 2 3 cm in length) Elongated shoots were then placed onto root induction medium (RIM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v ) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ, USA), and 5 M 1Naphthaleneacetic acid (NAA) [Sigma, St. Louis, MO, USA], pH 5.8). Cultures undergoing selection and rooting were maintained at 26C ( 1C) und er 1 m2 irradiance. Once roots were established, plants were

PAGE 83

83 transferred to pots containing a 2:1 Fafard #2 : sand mixture [Fafard, Aga wam, MA, USA] Plants were hardened under growth chamber conditions maintained at 26 1C u nd er a 14 h light to10 h dark regime with the 1 m2 irradiance. Plants reaching maturity were moved to the greenhouse and fertilized and irrigated as needed (Figure 3 3) Statistical Analysis SI% was determined for each BA level*cultiv ar by using the frequency procedure (PROC Freq) in SAS software (SAS Institute, 2000). Analysis of variance was carried out on the means for each experimental component (explant type, DSO rating, and SI%) using the Mixed Model procedure (PROC Mixed) in SAS software (SAS Institute, 2000). Statistical signific ance was determined at P mean separation test. Results and Discussion Explant Response In general, across all cultivars and BA concentrations, explants producing adventitious shoot buds responded as described by Sharma and A njaiah (2000), but at a lower frequency. Sharma and Anjaiah (2000) reported shoot induction frequencies as high as 95%; the current studies highest incidence of shoot induction was 25%. However, the appearance of those explants developing shoot buds was si milar to that described in Sharma and Anjaiah (2000). On SIM, explants turned green and underwent considerable enlargement within the first week of culture initiation. During weeks two and three, multiple shoot buds formed at the proximal cut end of the ex plants (Figure 33A).

PAGE 84

84 In the present study, shoot bud induction was tightly confined to the proximal portion of each explant Shoot buds developing on the proximal end of the explants were small and too numerous to count (Figure 33B). Tiwari et al. (2009) reported a similar response and counted up to 100 buds per explant. Other studies have provided data to explain the highly prolific nature of the proximal region of cotyledon explants. Sujatha et al. (2008), using a direct shoot organogenesis protocol, t ested three cotyledon segment types (proximal, middle, and distal) of Pongamia pinnata, a tree legume. This study concluded that the proximal cotyledon section, followed by the middle and distal sections were most responsive in terms of producing shoot buds. These results suggest that there is a gradi ent of cells within cotyledon tissue that is likely to dedifferentiate, with those cells nearest the proximal region being more lik ely to become meristematic. F urther support ing this observation of cotyledon g radient competence, using serial sections of peanut cotyledons, Victor et al. (1999) saw an increase in meristematic conversion in the epidermal and subepidermal cell layers as the sections approached the hypocotyledonary notch region when exposed to thid iazuron and BA. In Sharma and Anjaiah (2000), whole cotyledon explants were compared to vertically cut, cotyledon halves. Both explants produced shoots at high frequencies, but the number of shoots per responding explant was much higher when the cotyledons were vertically split into halves. The corresponding half of each split cotyledon responded similarly relative to induction frequency and the number of shoots per explant. However, in the present study there was a significant difference in SI% and DSO rat ing of the two split cotyledon explant sources. A difference in shoot induction

PAGE 85

85 was observed for each type of cotyledon explant examined regardless of cultivar. Explant A had a higher DSO rating (1.8) and higher SI% (12.8%) than explant B (1.6, and 6.7%, r espectively) (P > t = >0.0001) (Figure 34). It has been demonstrated across several species that cotyledons have a high capacity for an organogenic growth response (Dunstan and Thorpe, 1986), but, as previously mentioned, this morphogenic potentiality is not uniform across different cotyledonary tissues. Previous work, using Dalbergia sissoo a tree legume (Singh et al. 2002), almond ( Prunus dulcis Mill.) (Ainsley et al. 2001), and cherry ( Prunus ) (Hokanson and Pooler, 2000), demonstrated that the region o f the cotyledon in closest contact with the embryo displayed the highest organogenic capacity. It was observed in the present study, upon embryo axis removal from cotyledon A, that a small amount of embryo axis tissue usually remained at the proximal port i on of the cotyledon. Explant As closer association with the embryo axis, fits the description of Hokanson and Pooler ( 2000) and provides a plausible explanation for the difference in SI% and DSO rating between the explants Genotype Response Based on the findings by Sharma and Anjaiah (2000) that medium supplemented with 20 M BA led to the highest incidence of adventitious bud formation in peanut, the present study tested BA concentrations ranging 10 640 M to determine the best level for shoot inductio n response of the five selected cultivars. Cultivars responded to all the BA levels tested producing adventitious shoot buds, but cultivars responded differently to culture treatments (Table 31; Figure 35). Florida 07. For BA concentrations ranging from 10 80 M, Florida 07s DSO response was quadratic (normal) (p > t = 0.0051) (Table 31) The highest observed DSO rating for Florida07 was on SIM40 (1.8), which was higher than DSO ratings on

PAGE 86

86 SIM10 (1.5), SIM20 (1.5), and SIM80 (1.5) (Figure 3 5A ) Th e highest observed SI% for Florida 07 was also on SIM40 (7.1%), but was not different than the SI% on SIM10 (0.9%), SIM20 (2.8%), or SIM80 (0.0%) (Figure 3 5 B) Georgia Green Georgia Green had neither a linear n or quadratic DSO trend (p>t = 0.6191, and p>t = 0.8416, respectively) but it had a strong cubic DSO (P > t = 0.0001) (Table 31) N o biologically relevant cause could be deduced for this trend which was repeatable. SIM40 and SIM10 produced the highest DSO ratings for Georgia Green ( 2.2, and 2.1 r espectively ). SIM80 and SIM20 produced similar DSO ratings (1.9, and 1.8, respectively), that were lower than the ratings on SIM40 or SIM10 (Figure 3 5 A) No differences were observed in SI% (Figure 3 5 B) Georgia Browne Georgia Browne responded with a strong linear DSO trend for BA concentrations of 10 80 M (P > t = <0.0001) (Table 31) The highest DSO ratings were on SIM80 (1.7) and SIM40 (1.6). The DSO rating on SIM80 was higher than ratin gs on SIM20 (1.5, p>t = 0.0021) or SIM10 (1.5). However, its DSO response on SIM40, was the same as on SIM20 (1.5) and SIM10 (1.5) (Figure 3 5 A) The highest SI% was on SIM10 (9.1%), followed by the SI% on SIM80 (9.0) and SIM20 (3.8) (Figure 3 5 B) To normalize the linear DSO response trend between 10 the BA conc entration range was increased with levels of 160 M and 320 M. Within the 10 320 M BA range, Georgia Browne had a strong, quadratic DSO trend (P > t = <0.0001) (Table 32) Its DSO rating on SIM160 (1.5) was higher than on SIM320 (1.3) (Figure 3 6 A) Likewise, the SI% for Georgia Browne was much higher on SIM160 (6.9%) than

PAGE 87

87 SIM320 (0.6%) but neither was higher than those produced on SIM10 and SIM80 (Figure 3 6 B) ValenciaA ValenciaA responded with a strong linear trend within the 10 80 M BA r ange (P > t = <0.0001) (Table 31) When the BA concentration was extended up to 640 M a linear trend was still observed (P > t = <0.0001), as wel l as a weaker quadratic trend (P > t = 0.0021) (Table 32) This quadratic trend indicates dimini shing returns. ValenciaA had the same DSO rating on SIM80 (1.7), SIM40 (1.7), an d SIM20 (1.7), all of which were higher than DSO rating on SIM10 (1.4) (Figure 3 5A) Although the highest SI% was produced on SIM80 (8.1%), this was not different than the SI % on SIM10 (4.6%), SIM20 (5.3%), or SIM40 (4.3%) (Figure 3 5B) Attempts to normalize the linear DSO response trend were made by increasing BA concentrations to 160 M, 320 M, and 640 M. Within this 10640 M, ValenciaA still responded with a strong l inear trend (P > t = <0.0001) (Table 32) BA concentrations were not extended beyond 640 M because the saturation point was met and medium components precipitated out of solution. No differences were observed in DSO rating between 160 640 M BA (Figur e 36A) However, ValenciaA s SI% was higher on SIM640 (21.4%) than on SIM160 and SIM320 (Figure 3 6B) VC 2 DSO rating s were similar for VC 2 on all BA concentration tested (Figure 34A). Its highest SI% was on SIM10 (22.1%), followed by SIM20 (19.0%), SIM80 (13.9%), and SIM40 (13.4%). Although a decreasing trend was observed for SI%, there was no significant difference among the treatments (Figure 34B). Sharma and Anjaiah (2000) and Tiwari and Tuli (2008) failed to report the statistical difference in SI% between hormone concentrations, but, in general, reported

PAGE 88

88 higher SI% than the present study. Sharma and Anjaiah (2000) and Tiwari and Tuli (2008) also failed to describe the difference in shoot bud appearance (quality). In the present study, r egardles s of BA concentration, SI% (percentage of explants developing shoot buds) generally appeared to be similar within cultivars. However, DSO rating (measure of quality of shoot buds produced by explants) varied within cultivars. In the present study the qual ity of shoot buds at each concentration appeared to be dependent upon BA level (Tables 33 and 34, Figures 35 and 36). Similarities in SI% across BA concentrations may suggest that the threshold for growth response may be met at low BA levels. However, based on differences in DSO ratings of the tested BA levels, it is believed that BA concentration plays a significant role in the quality of growth response. Cultivar Comparison A c omparison of the top performing cultivar*BA level from this study suggest a genotypic influence on growth response (Table 33 ). When comparing tissue culture responses among cultivars, Georgia Green on SIM10 had the highest SI% (24.6%) and the highest DSO rating (2.1), followed by VC 2 on SIM10 (22.1%, 1.8), Valencia A on SIM640 (21.4%, 1.8), Georgia Browne on SIM80 (9.0%, 1.7), and Florida07 on SIM40 (7.0%, 1.8) (Table 33) Statistically, Georgia Green, Valencia A and VC 2 had an equal SI% response, but were higher than Florida07 and Georgia Browne, which were equal. Georgia Green had the highest DSO rating which was higher than Florida07, Georgia Browne, ValenciaA and VC 2, w hich were all equal (Table 33 ). Previous studies have only tested Spanish and Virginia market type cultivars. In these studies, Spanish market types, specifically the cultivar JL 24, have performed best in terms of shoot induction response. In the present study, the selected Spanish

PAGE 89

89 market type, Georgia Browne, was one of the poorest performing cultivars. However, it should be pointed out that Georgi a Browne is closely related to Georgia Green, a Runner market type, and is not a traditional Spanish market type. Future work should use multiple cultivars from each market type to identify if response is similar at the market type level. However, because of the discrepancy in response by Georgia Browne and Georgia Green, the author feels that shoot induction response is likely genotype dependent. Earlier studies on peanut organogenesis have also reported a strong genotypic influence on shoot induction ( Mroginski et al. 1981, Seitz et al. 1987, McKently et al. 1990, Chengalrayan et al. 2004, Banerjee et al. 2007, Matand et al. 2007). In contrast, Li et al. (1994), Sharma and Anjaiah (2000), and Tiwari et al. (2008, 2009) report ed that all tested genotypes responded equally in organogenic response. Tiwari et al. (2009) suggests that this discrepancy in findings may be due to the extent of diversity among the selected genotypes from different studies. Regeneration of Mature Plants In the present study, data were collected only for shoot induction response, as prolific shoot bud induction is the most critical component for Agrobacterium transformation protocols. Although no data were collected post shoot induction, shoot elongation and rooting portions on the protoc ol were carried out (Figures 33 C and 33 D). Preliminary results indicated that m ature plants could be generated for all the tested cultivar s at all BA concentrations examined using the described protocol (Figure 3 3 E). It appeared that BA in shoot induction medium did not adversely affect shoot elongation and rooting of plantlets, although further testing is required to make a definitive conclusion. Despite phenotypically normal plants being generated in this

PAGE 90

90 study previous studies have shown that the use of cytokinin growth regulators at high concentrations (0.510 mg L1) can lead to residual toxicity which will inhibit or delay the efficiency of shoot elongation and/or root f ormation (Harris and Hart, 1964; Gray et al.1991; Preece and Imel, 1991, Chandra et al. 2003). Because of this inhibitory effect, cytokinins are usually removed from culture media during later stages of the tissue culture process Frequently, m ore than one subculture to a cytokinin free medium may be required until the level of cytokinin within the tissues has been sufficiently reduced. The need for multiple rounds of subculturing on hormonefree medium suggests that residual cytokinin can persist in adventitious tissue. Based on these previous findings, it was determined that using the lowest BA concentration capable of inducing the desired shoot induction response would be the best option for generating mature peanut plants in future studies. Therefore, Georgia Green and VC 2 on SIM10, Florida07 on SIM40, Georgia Browne on SI M80, and ValenciaA on SIM640 should be the preferred cultivar*BA concentration combinations used for producing transgenic lines in the future. Conclusions A difference in shoot induction was observed for each type of cotyledon explant examined. Because ad ventitious shoot bud formation was confined to the proximal region of explants and explant A had a higher SI% and DSO rating, it was concluded that the cotyledon nearest the embryo axis is most likely to dedifferentiate and become meristematic. Because shoot induction was higher and of better visual quality for explant A, it was determined that it should be the only explant type used in direct shoot organogenesis for future Agrobacterium mediated transformation studies. All tested BA levels and cultivars produced adventitious shoot buds, indicating that this protocol is adaptable to a wide array of market types and cultivars. However, there

PAGE 91

91 was a genotype effect because the c ultivars responded differently in culture. Georgia Green on SIM10 had the highest SI% and DSO rating followed by VC 2 on SIM10, ValenciaA on SIM640, Georgia Brown on SIM80, and Florida07 on SIM40. Furthermore, similarities in SI% across BA concentrations indicate that the threshold for explant growth response can be met at low BA levels. However, differences in DSO ratings indicate that BA level does play a significant role in the overall quality of the growth response. Cultivars Georgia Green, ValenciaA and VC 2 appear to be the best suited for future transformation experiments based on their shoot bud production.

PAGE 92

92 Figure 31. Peanut seed morphology and cotyledon explants preparation. Arrows indicate the proximal end with high regeneration potential. Explants prepared in the following order: (1) Seed coat removed; (2) Cotyledons s eparated; (3) Embryo axis removed and cotyledon vertically cut, forming explants A; (4) Remaining cotyledon vertically cut, forming explants B. (Photo modified from Armstrong, 2008). Figure 32. Direct shoot organogenesis (DSO) rating of peanut explant s. (1) Slight greening of explants, with no growth; (2) Greening of explants, with callus like growth, and no adventitious bud formation; (3) Greening of explants, with adventitious bud formation; (4) Greening of explants, with adventitious bud formation, and small leaflet expansion.

PAGE 93

93 Figure 33. Explant response and regeneration of mature peanut plants. (A) Adventitious shoot buds from cotyledon explants after 3 weeks of culture on shoot induction medium Arrow indicates the proximal cut end with high regeneration potential. (B) Shoot bud formation on proximal cut end of cotyledon explants after 4 weeks of culture on hoot induction medium (2.5X magnification). (C) Shoot development after 4 weeks on shoot elongation medium (D) Root development after 4 w eeks on root induction medium (E) Mature plant in soil 16 weeks after initial shoot bud formation.

PAGE 94

94 Table 31. Effect of N 6 benzyladenine concentrations ranging from 10the peanut cultivar response trend Trend Cultivar L inear Q uadratic C ubic Florida 07 0.0985 0.0051 0.0005 Georgia Browne <0.0001 0.5536 0.7933 Georgia Green 0.6191 0.8416 <0.0001 Valencia A <0.0001 0.0029 0.1533 VC 2 0.199 0.2278 0.9089 Trends determined using orthogonal polynomials in the Estimate statement of the Mixed Procedure of SAS software Cultivar response trend considered significant at P 0.05 Table 32 Effect of N6 benzyladenine concentrations ranging from 10Georgia Browne and 10A on the peanut cultivar response trend Trend Cultivar Linear quadratic Cubic Georgia Browne 0.0625 < 0.0001 0.0668 Valencia A <0.0001 0.0021 0.4706 Trends determined using orthogonal polynomials in the Estimate statement of the Mixed Procedure of SAS software. Cultivar response trend considered significant at P 0.05.

PAGE 95

95 Figure 34. Sho ot organogenesis response from two types of peanut cotyledon explants (A) Explant derived from cotyledon with embryo axis previously attached, (B) Explant derived from cotyledon without embryo axis previously attached.

PAGE 96

96 Figure 35 Effect of N 6 benzyladenine concentration ranging form 10 direct shoot organogenesis rating of peanut cotyledon explants and (B) shoot induction %. Each value is a mean SE.

PAGE 97

97 Figure 36 Effect of N 6 benzyladenine concentration ranging from 10 320 for peanut cultivars Georgia Browne and 10 640 for ValenciaA on (A) direct shoot organogenesis, and (B) shoot induction %. Each value is a mean SE.

PAGE 98

98 Table 33 Comparison of top performing cultivar* N 6 benzyladenine concentration combinations in peanut tissue culture of quartered, deembry onated cotyledon explants. Cultivar Market Type N 6 benzyladenine (M) DSO Rating SI% Florida 07 Runner 40 1.8 0.1 b 7.1 6.1 b Georgia Green Runner 10 2.1 0.1 a 24.6 5.4 a Georgia Bowne Spanish 80 1.7 0.1 b 9.00 3.1 b Valencia A Valencia 640 1.8 0.1 b 21.4 3.3 a VC 2 Virginia 10 1.8 0.1 b 22.1 6.1 a *Mean DSO rating SE and SI% SE for cultivar*treatment following 4 week culture period. **Means within cultivar s followed by the same letter are not different at the P

PAGE 99

99 CHAPTER 4 TRANSIENT EXPRESSION OF UIDA GLUCURONIDASE ) IN PEANUT COTYLEDON EXPLANTS Abstract Peanut is susceptible to a variety of abiotic and biotic stressors. In the U.S., foliar and soilborne diseases/pests are the most prevalent of these stressors and annually lower yields and profits for growers. Outside of pesticides, t he primary means to overcoming these stressors is conventional breeding. Conventional breeding for disease resistanc e has been a slow endeavor due to the lack of genetic diversity available in cultivated peanut. Recently, interest has increased in using transgenic approaches to complement traditional breeding for improved agronomic perf ormance in peanut. Sharma and Anaj aiah (2000) report ed the development of a highly efficient peanut transformation protocol via Agrobacterium mediated trans gene delivery. However, this protocol was optimized for JL24, an Indian peanut cultivar not readily available in the U.S. In the present study, the protocol described by Sharma and Bhatnagar Mathur (2006) was tested using two readily available U.S. cultivars (Georgia Green and VC 2) and four Agrobacterium strains (ABI, C58C1, GV3101, and LBA4404) harbor ing the CaMV 35S uid A gene constr uct. It was hypothesized that the protocol described by Sharma and Bhatnagar Mathur (2006) could be used to successfully transform these selected cultivars. The purpose of this study was to identify Agrobacterium strains that ould successfully infect the s elected cultivars. Following inoculation and cocultivation of ex plants, glucuronidae (GUS) assay analysis w as performed to test for transient expression of the u id A gene. The only explants testing positive for u idA expression were those infected with Agrobacterium

PAGE 100

100 strain ABI. It was concluded that Agrobacteri um strain ABI must be used for future transformation experiments. Introduction Throughout a growing season, peanut is exposed to many biotic and abiotic stressors that can lower yields and profits for growers. In the U.S., foliar and soilborne diseases/pes ts are the most prevalent of these stressors Domestically, the most prevalent biot ic stressors of peanut include tomato spotted wilt v irus (TSWV; Tospovirus vectored by thrips), root knot nematode ( Meloidogyne arenaria (Neal) Chitwood race 1), White Mold ( Sclerotium rolfsii Sacc.), Cylindrocladium black r ot ( Cylindrocladium parasiticum Crous, Wingfield and Alfenas), Sclerotinia b light ( Sclerotinia minor Jagger), Rust ( Puccinia arachidis Speg.), early leaf s pot ( Cercospora arachidicola S. Hori), and late le af s pot ( Cercospiridium personatum (Berk and M. A.Curtis) Deighton). Outside of pesticides the primary means to overcoming these diseases is conventional breeding. Conventional breeding for disease resistance has been a slow endeavor due to the lack of gen etic diversity available in cultivated peanut. Recently, interest has increased in using transgenic approaches to complement traditional breeding for improved agronomic performance and disease resistance in peanut. Routine peanut transformation would allow breeders to have access to otherwise unavailable genetic resources. Peanut has been successfully transformed using both particle bombardment and Agrobacterium mediated transformation ( see Chapter 1 for review ). Recently, as an alternative to lengthy bomb ardment methods, protocols using faster, direct organogenesis and Agrobacterium have been investigated. Transformation by Agrobacterium is believed to be superior to bombardment because integration patterns

PAGE 101

101 tend to be cleaner, meaning whole gene construc ts integrate into the host genome with low copy number. Additionally, and perhaps most favorable, tissue culture requirements tend to be far less intensive in terms of subculturing and time to plant maturity. This reduction in time and handling lessens the likelihood for contamination and somaclonal variation, and therefore, loss of putative transgenics. Once established, protocols are far less labor intensive and more economically sound. Sharma and Anjaiah (2000) reported the development of a direct shoot organogenesis and transformation protocol via Agrobacterium mediated transgene delivery. However, this protocol was optimized using cv. JL24, an Indian cultivar not readily available in the U.S. Likewise, many of the earlier studies reporting the successful transformation of peanut via Agrobacterium used cultivars not readily available or economically important in the U.S (Venkatachalam 1998, 2000; Rohini et al. 2000, 2001; Khandelwal et al 2003, 2004; Anurahda et al. 2006, 2008; Bhatnagar Mathur t al. 2 007; Tiwari 2008, 2009). Very few readily available domestic peanut cultivars have been transformed (Franklin et al. 1993; Eapen and George, 1993; McKently et al. 1995; Cheng 1996, 1997; Li et al. 1997; Egnin et al. 1998; Dodo et al. 2007; Yin et al. 2007) Within these studies that have reported successful peanut transformation, the number of cultivars used has been relatively narrow; the Indian cultivar most commonly transformed via Agrobacterium has been JL 24 followed by TMV 2, while in the U.S. it has been Valencia A Sharma and Anjaiah (2000) report a protocol which results in a high production of transgenic s. It was hypothesized that the protocol described by Sharma and Bhatnagar Mathur (2006) could be expanded to successfully transform U.S. cultivar s. The purpose

PAGE 102

102 of this study was to identify Agrobacterium strains virulent to the candidate cultivars, Georgia Green and VC 2. Materials and Methods Agrobacterium Strain and Gene Construct Peanut transformation experiments were conducted using a modified protocol described by Sharma and Bhatnagar Mathur (2006). For transformation and transient expression experiments, Agrobacterium strains ABI, C58C1, GV3101, and LBA4404 harboring CaMV 35S u id A expression cassette were tested ( CaMV 35S u idA constitu tively expressed promoter from Cauliflower M osaic virus linked to u idA a reporter gene derived from E. coli which encodes glucuronidase (GUS ). A single colony of an Agrobacterium strain was incubated in 20 ml of yeast extract peptone medium (YEP; 10 g L1 Yeast Extract [Fisher Scientific, Waltham, Massachusetts, USA], 10 g L 1 Bacto Peptone [Sigma, St. Louis, MO, USA], 5 g L1 NaCl [Fisher Scientific, Waltham, Massachusetts, USA]) and grown overnight on a shaker at 200 rpm at 28C to an OD600 of 0.50.8. An overnight culture (10 ml) was pelleted by centrifugation at 600 g for 10 min. Pelleted cells were resuspended in 30 ml of 0.5X MS medium (Murashige and Skoog 1962). The suspension was then incubated at 4C for 1 hr prior to explant inoculation. Explant Pr eparation and Inoculation Mature dry seeds of Georgia Green and VC 2 were surfacesterilized in a 0.1% (w/v) mercuric chloride solution for 10 min, rinsed five times with sterile water, and soaked in sterile distilled water overnight. Using sterile techniq ue, seed coats were removed, cotyledons were separated, and embryo axes were removed. Cotyledons were sliced vertically to obtain quartered cotyledon explants. Explants were briefly

PAGE 103

103 immersed (1 2 sec) into an Agrobacterium suspension culture at room temper ature for inoculation. Explants were then blotted on sterile filter to remove excess suspension solution. The proximal, freshly cut edge of each explant was embedded into shoot induction medium (SIM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w /v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar [Becton, Dickinson and Co., Franklin Lakes, NJ, USA], 10 M 2,4dichlorophenoxyacetic acid (2,4D) [Sigma, St. Lo uis, MO, USA], and 10 M N 6 benzyladenine (BA) [Sigma, St. Louis, MO, USA], pH 5.8) at a slight downward angle. Explant/bacterial cocultivation lasted a period of three days. Cocultivation conditions were set to 26C ( 1C) under c ontinuous light of 1 m2 irradiance. Transient Expression in Cotyledon Explants and Histoc hemical GUS assay Explants of Georgia Green and VC 2 were inoculated with Agrobacterium strains ABI, LBA4404, GV3101, and C58C1 harboring the CaMV 35S u id A construct. Explants were placed onto SIM medium as previously described. Following cocultivation, e xplants were assayed for transient GUS expression. Explants were removed from SIM medium and rinsed in 70% EtOH for 5 min, followed by a 5 min rinse in sterile water. Explant pieces were placed into a solution containing 5 mM potassium ferricyanide, 5 mM p otassium ferrocyanide, 0.3% Triton X 100, and 1 mg/ml 5bromo 4 chloro3 indolyl glucuronide (X gluc) and vacuum infiltrated for 5 min. Explant pieces were then placed at 37C overnight under constant agitation. Explants were visually examined for blue GUS sectors indicating u idA expression. Results and Discussion Transient expression of u idA was used in the first peanut transformation experiments to identify strain virulence. Lacorte et al. (1991) used several

PAGE 104

104 Agrobacterium st rains to induce uidA expres sing tumor masses on peanut seed and seedling explants. Lacorte et al. (1991) reported strain A281 to be the most virulent strain tested. In a similar study, F ranklin et al. (1992) reported u idA expression in callus tissue following infection with Agrobact erium strains EHA101 and LBA4404. Georgia Green and VC 2 explants inoculated with Agrobacterium strains C58C1, GV3101, and LB A4404 harboring the CaMV 35S u idA plasmi d showed no signs of transient u idA expression following GUS histochemical analysis. Prior to the current study, no reports have been made which indicate that strains GV3101 or C58C1 have been used in peanut transformation studies. However, LBA4404 has been successfully used in several studies testing transient and stable in peanut (Venkatachala m et al. 1998, 2000; Rohini et al. 2000, 2001; Yin et al. 2007). Explants of VC 2 and Georgia Green inoculated with ABI showed transient expression, with several blue sectors observed on the cut surface of the explants. Eighty explants per cultivar were inoculated with ABI, 41% of the Georgia Green explants and 43% of VC 2 explants were positive for u idA expression (Table 41 Figure 41). Prior to this study, no peanut transformation studies have been reported using strain ABI. ABI was identified as being the most virulent strain of those tested. The development of blue sectors on explants is a clear indication of nuclear delivery of the CaMV 35S u idA expression cassette. C58C1, GV3101, and LBA4404 lacked the necessary host pathogen virulence required f or transformation. However, using a similar protocol, Yin et al. (2007) produced stable transgenics using LBA4404. The discrepancy of this study with the current study can only be explained by d ifferences in cultivar; Yin et al. (2007) used Baisha 1016 pea nut. Because Agrobacterium strain ABI was the only strain to produce GUS positive, bluesectors

PAGE 105

105 upon assaying, it was determined that ABI was the only viable strain for use in future transformation experiments using Georgia Green and VC 2. To further determine the optimal Agrobacterium /cultivar combination, attempts were made to quantify uidA expression through use of a 4D glucuronide (MUG) assaying and quantitative real time PCR (qRT PCR). Because of the high lipid content of peanut seed, protein extracts from explants were of extremely low quality. These low quality extracts did not allow for the detectable hydrolytic conversion of MUG into glucuronic acid and 7hydroxyl 4 methylcoumarin (MU). qPCR analysis, using u idA specific prime rs, was also unsuccessful despite positive GUS assay staining observed in control explants. No detectable traces of u idA expression were observed. The discrepancy between the GUS assay and the qRT PCR results can be explained by the accumulation of stable, GUS protein being translated from a nondetectable amount of u idA mRNA transcripts within a cell. Conclusions Results from the transient expression study indicate the nuclear delivery of C aMV 35S u idA gen e construct. Because transient u idA expression was only observed in explants inoculated with Agrobacterium strain ABI and not C58C1, GV3101, and LBA4404, it was concluded that strain ABI was the best option for use in future stable transformation experiments when using Georgia Green and VC 2 explants. Based on the findings of this study, attempts were made to produce mature, transgenic peanut lines expressing for CaMV 35S uidA, DR5 u idA and SAG12 IPT Results to these experiments can be found in Appendix A.

PAGE 106

106 Table 41. Transient e xpression of CaMV 35S u id A in peanut cotyledon explants Agro bacterium strain Cultivar SIM 1 # GUS + # GUS ABI Georgia Green 80 33 47 VC 2 80 34 46 C58C1 Georgia Green 80 0 80 VC 2 80 0 80 GV3101 Georgia Green 80 0 80 VC 2 80 0 80 LBA4404 Georgia Green 80 0 80 VC 2 80 0 80 1Number in column represents the total number of explants which were inoculated and onto SIM for 3 day cocultivation.

PAGE 107

107 Figure 41. Arrows indicate transient u idA expression on the proximal end of dee mbryonated, quartered cotyledon ex p lants of peanut cv. Georgia Green. Explants were inoculated with Agrobac t erium strain ABI harboring the CaMV 35S u idA expression cassette.

PAGE 108

108 APPENDIX A TRANSFORMAT ION OF PEANUT WITH SAG12 IPT FOR A STAY GREEN PHENOTYE I ntroduction Several studies have developed transgenic plants expressing for the SAG 12 IPT chimeric gene to delay the onset of leaf senescence (Stay Green). Engineering plants to retain leaves, even under pathogen attack, could potentially negate some of the undesirable effects associated with pathogen infection. Preliminary data (M. Jones and D. Clark, University of Florida) indicated that transgenic petunia expressing SAG 12 IPT had a delayed leaf senescence response (Jandrew, 2002). Transformants also a ppeared to develop fewer chlorotic spots and gained tolerance to petunia leaf spot disease caused by Cercospora petunia (Jandrew 2002) ( refer to Chapter 1, Figure 11 ). Similar results were reported by Swartzberg et al. (2008), in which tomato plants trans formed with SAG 12IPT displayed suppressed symptoms of the disease caused by Botrytis cinerea. It is hypothesized that the same tolerance response can be incorporated into peanut li nes expressing for SAG 12 IPT Transient expression of u idA reported in Cha pter 4 suggest that Agrobacterium strain ABI possesses the virulence required to produced mature, stable transgenic peanut lines. Likewise, several previous studies report the successful transformation of peanut using Agrobacterium strain LBA4404. Yin et al. (2007), using LBA4404, Georgia Green explants, and a similar direct shoot organogenesis protocol developed multiple independent transgenic plants. Based on these findings, it was hypothesized that Georgia Green, VC 2, and Valencia A could be successfull y transformed. The current study attempted to integrate the CaMV 35S uidA, DR5 u idA and SAG 12IPT expression cassettes in independent peanut lines.

PAGE 109

109 Materials and Methods Agrobacterium Strain and Gene Constructs Peanut transformation experiments were conducted using a modified protocol described by Sharma and Bhatnagar Mathur (2006). Agrobacterium strains LBA4404 and ABI harboring the CaMV 35S u idA (previously described in Chapter4), DR5 u idA ( DR5 u idA an auxi n glucuronidase gene), or SAG 12IPT ( Sag12IPT senescence specific promoter linked to isopentyl transferase gene) expression cassette were used in experiments for stable transformation (Figure A 1) A single colony of Agrobacterium was incubated in 20 ml of yeast extract peptone medium (YEP; 10 g L1 Yeast Extract [Fisher Scientific, Waltha m, Massachusetts, USA], 10 g L1 Bacto Peptone [Sig ma, St. Louis, MO, USA], 5 g L1 NaCl [Fisher Scientific, Waltham, Massachusetts, USA]) and grown overnight on a shaker at 200 rpm at 28C to an OD600 of 0.50.8. An overnight culture (10 ml) was pelleted by centrifugation at 600 g for 10 min. Pelleted cells were resuspended in 30 ml of 0.5X MS medium. The suspension was then placed at 4C f or 1 hr prior to explant inoculation. Explant Preparation and Inoculation Mature dry seeds of Georgia Green, VC 2, and ValenciaA were surfacesterilized in a 0.1% (w/v) mercuric chloride solution for 10 min, rinsed five times with sterile water, and soake d in sterile distilled water overnight. Using sterile technique, seed coats were removed, cotyledons were separated, and embryo axes were removed. Cotyledons were sliced vertically to obtain quartered cotyledon explants. Explants were briefly immersed (1 2 sec) into an Agrobacterium suspension culture at room temperature for inoculation. Explants were then blotted on sterile filter to remove excess suspension solution. The proximal, freshly cut edge of each explant was embedded into shoot

PAGE 110

110 induction medium ( SIM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar [Becton, Dickinson and Co., Franklin Lakes, NJ, USA], 10 M 2,4dichlorophenoxyacetic acid (2,4D) [Sigma, St. Louis, MO, USA], and either 10 M or 640 M N 6 benzyladenine (BA) [Sigma, St. Louis, MO, USA], pH 5.8) at a slight downward angle. Georgia Green and VC 2 explants were placed onto shot induction medium ( SIM ) supplemented with 10 M BA, while ValenciaA was plac ed on to SIM supplemented with 640 M BA. Explant/bacterial cocultivation lasted a period of three days. Cocultivation conditions 1 m 2 irradiance. Following co cultivation, explants were subcultured to fresh SIM medium supplem ented wi th 50 mg L1 timentin and 50 mg L1 kanamycin. Explants remained on this SIM medium for 34 weeks. Regeneration of Mature Plants Explants bearing shoot buds were transferred to shoot elongation medium (SEM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins 3% (w/v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ, USA), and 2 M BA [Sigma, St. Louis, MO, USA], pH 5.8) containing 50 mg L1 timentin and 50 mg L1 kanamycin for selection. Following three weeks under selection, surviving shoots were subcultured twice, every 4 weeks to SEM supplemented with 100 mg L1 kanamycin. Elongated shoots (approximately 23 cm in length) were then placed onto root induction medium (RIM; MS salts [Sigma, St. Louis, MO, USA], B5 vitamins, 3% (w/v) sucrose [Fisher Scientific, Hampton, NH, USA], 0.8% (w/v) agar (Becton, Dickinson and Co., Franklin Lakes, NJ, USA), and 5 M 1Naphthaleneacetic acid (NAA) [Sigma, St. Louis, MO, USA], pH 5.8). Cultures undergoing selec tion and rooting

PAGE 111

111 1 m 2 irradiance. Once roots were established, plants were transferred to pots containing a 2:1 Fafard #2 : sand mixture [Fafard, Aga w am, MA, USA]. Plants were hardened undergrowth chamber conditions. Plants reaching maturity were moved into greenhouse conditions and fertilized and irrigated as needed. Plants that reached maturity underwent genomic PCR screening and when appropriate, GUS assay analysis. Genomic DNA Analysis U sing the CTAB extraction method, genomic DNA was isolated from putative transgenic lines that survived tissue cultur e selection to maturity. From T0 plants, freshly expanding compound leaves were collected and immediately frozen in liquid nitrogen. Small q uantities of tissue (< 300 mg) were homogenized in microcentrifuge tubes using a pellet pestle. Precipitated DNA was air dried and resuspended in sterile distilled water. PCR amplification was carried out using gene specific primers. Putative Sag12IPT tr ansgenic plants were screened with primers that flanked the Sag12 promoter and the IPT gene, producing a 1000 bp product (Forward: 5 GATTTGATTAAGCTTTTAACTTGC 3, Reverse: 5 GCCCGCCGTTGGCCTCATGAT 3). Putative CaMV 35S u idA plants were screened with prime rs which annealed to the u idA gene only, producing an 819 bp product (Forward: 5 CCCCAACCCGTGAAATCAAA 3, Reverse: 5 GTTCGCCCTTCACTGCCACT 3). Thermal cycler conditions were set as such: 95C for 1min (denaturation), 60C for 30 s (annealing), C for 1 min (extension), for 30 cycles, and held at 4C until recovery. The amplified products were assayed by electrophoresis in 1% agarose gels in 1X TAE.

PAGE 112

112 GUS Assay Explants were removed from SIM medium and rinsed in70% EtOH for 5 min, followed by a 5 min rins e in sterile water. Explant pieces were placed into a solution containing 5 mM potassium ferricyanide, 5 mM potassium ferrocyani de, 0.3% Triton X 100, and 1 mg ml1 5 bromo 4 chloro3 indolyl glucuronide (X gluc) and vacuum infiltrated for 5 min. Explant pieces were then placed at 37C overnight under constant agitation. Explants were visually examined for blue GUS sectors indicating u idA expression. Results and Discussion In this experiment, explants of VC 2 and Georgia Green were inoculated using Agrob acterium strain LBA4404. In total, 400 individual explants of VC 2, and 320 explants of Georgia Green were inoculated with Agrobacterium strain LBA4404 harbor ing various gene constructs ( SAG 12IPT, 35S uidA, DR5 u idA ). Under selection, approximately 1% of the Georgia Green explants and 4% of the VC 2 explants survived selection and yielded mature plants, none of which were transgenic (Table A 1 ) Likewise, attempts to transform Georgia Green, VC 2, and ValenciaA via Agrobacterium strain ABI harboring the S AG 12 IPT plasmid were also unsuccessful (Table A 2 ) Under selection, 3% of Georgia Green and 3% of VC 2 explants inoculated resulted in mature plants. None of the ValenciaA explants inoculated resulted in the development of mature plants. Sharma et al. (2000) reported shoot bud induction efficiencies to be nearly 96% and transformation efficiencies of those explants to be 55% when using cultivar JL24 and Agrobacterium strain C58. Because JL24 and strain C58 were not readily available, cultivars Georgia Green, VC 2 and ValenciaA were used in these initial

PAGE 113

113 transformation experiments. Shoot bud induction efficiencies in VC 2, Georgia Green, and Valencia A (22%, 25%, and 21%, respectively) were much lower than those reported by Sharma et al. (2000). T ransf ormation efficiencies in the present experiment were not as high as those reported by Sharma et al. (2000) because of the dramatic difference in shoot induction frequencies. Another possible explanation is poor cultivar/ Agrobacterium strain interaction. Co nclusions Although no transgenic peanut lines were developed in this study, the author of this paper is optimistic that use of this protocol with the selected cultivars will lead to the generation of multiple independent transgenic lines. Consistent transi ent expression of CaMV 35S u idA has been observed in explants, meaning that expression cassettes are being delivered to the nucleus of cells of explants (refer to Chapter 4). Trans gene integration is a rare event and occurs at very low frequencies, even wi thin crops with established transformation systems. Given this fact, and the fact that past studies report peanut being recalcitrant to transformation, it is not surprising that transgenic lines were not generated in the present study. However, as tissue c ulture conditions are further improved and other highly virulent Agrobacterium strain s are identified, the routine transformation of Georgia Green, VC 2, and ValenciaA peanut should become a reality. Further work will be required to improve shoot bud induction frequencies, which will likely improve overall efficiencies to produce mature transgenic plants. The use of other Agrobacterium strains should be explored whi ch may be more virulent than those tested. Although JL24 is not readily available domestically, efforts should be made with this cultivar to duplicate Sharma and Anajaiahs (2000) result.

PAGE 114

114 Figure A 1. Expression cassettes used for t ransformation of de embryonated, quartered cotyledon explants of peanut (A) CaMV 35S u idA (B) DR5 u idA and ( C) SAG12 IPT

PAGE 115

115 Table A 1. Assay results of transformation attempts of peanut using Agrobacterium strain LBA4404 Selection Construct Cultivar SIM 1 SEM1 2 SEM2 3 RIM 4 Ipt/uidA PCR GUS assay CaMV 35S UidA VC 2 80 12 4 3 SAG12 IPT VC 2 80 19 3 0 n/a n/a DR5 u idA VC 2 80 20 7 6 SAG12 IPT VC 2 80 33 8 0 n/a n/a SAG12 IPT VC 2 80 16 10 6 n/a CaMV 35S u idA Georgia Green 80 6 1 1 DR5 u idA Georgia Green 80 13 6 0 n/a SAG12 IPT Georgia Green 80 9 5 0 n/a n/a SAG12 IPT Georgia Green 80 12 5 1 n/a 1Number in column represents the total number of explants w h ich were inoculated and cultured on SIM. 2Number in column represents the total number o f explants which developed adventitious shoot buds and were moved to SEM (SEM1). 3Number in column represents the total number of individual shoots were subcultured to fresh SEM (SEM2). 4Number in column represents the total number of shoots that develope d roots on RIM.

PAGE 116

116 Table A 2. Assay results of attempted transformation of peanut using Agrobacterium strain ABI harboring SAG12 IPT Selection Cultivar SIM A SEM1 B SEM2 C RIM D IPT PCR Georgia Green 80 16 9 2 VC 2 80 11 5 2 Valencia A 80 12 3 0 n/a ANumber in column represents the total number of explants w h ich were inoculated and cultured on SIM. BNumber in column represents the total number of explants which developed adventitious shoot buds and were moved to SEM (SEM1). CNumber in column represents the total number of individual shoots were sub cultured to fresh SEM (SEM2). DNumber in column represents the total number of shoots that developed roots on RIM.

PAGE 117

117 APPENDIX B PEANUT TRANSFORMATIO N STUDIES

PAGE 118

118 Table B 1. List of published Agrobacterium mediated peanut t ransformation studies. Cultivar Explant Trait Promoter Strain Reference Tatu, Tatui, Tatu branco, Tupa, Penapolis Epicotyls Glucuronidase ATC1 T37, A281, Bo542, A136 Lacorte et al. 1991 Okrun Hypocotyls Glucuronidase CaMV 35S EHA101, LBA4404 ASE1 Franklin et al. 1993 New Mexico 'A' leaf sections Glucuronidase CaMV 35S EHA105 Eapen and George 1994 Florigiant, NC 7, F lorunner, F435AT embryo axes Glucuronidase MAS EHA105 McKently et al. 1995 New Mexico 'A' leaf sections Glucuronidase CaMV 35S EHA105 Cheng et al. 1996, 1997 New Mexico 'A' leaf sections Nucleocapsid gene from TSWV CaMV 35S EHA105 Li et al. 1997 Glucuronidase New Mexico 'A', Florunner, Georgia Runner, Sunrunner, Southrunner Epicotyls Glucuronidase CaMV 35S EHA101 Egnin et al. 1998 VRI 2, TMV 7 C otyledon Glucuronidase CaMV 35S LBA4404 Venkatachalam et al. 1998, 2000 TMV 2 embryo a xis attached to one cotyledon Glucuronidase CaMV 35S LBA4404 Rohini and Rao 2000 JL 24 de embryonated cot y le don Glucuronidase CaMV 35S C58 Sharma and Anjaiah 2000 Peanut clump virus coat protein TMV 2 embryo axis attached to one cotyledon Tobacco chitinase CaMV 35S LBA4404 Rohini and Rao 2001 TMV 2 Plumule of embryo axes Rinderpest virus hemagglutinin CaMV 35S EHA105 Khandelwal et al. 2003, 2004 JL 24 embryo axis attached to one cotyledon Glucuronidase none GV2260 Anuradha et al. 2006 JL 24 de embryonated cotelydon DREB1A CaMV 35S C58 Bhatnagar Mathur et al. 2007 rd29A Georgia Green Hypocotyls Ara h2 CaMV 35S EHA105 Dodo et al. 2007 Baisha 1016 de embryonated cotelydon FAD2 CaMV 35S LBA4404 Yin et al. 2007 JL 24 embryo axes mustard defensin (BjD) CaMV 35S EHA105 Anuradha et al. 2008 JL 24 de embryonated cotelydon synthetic Cry1 EC CaMV 35S EHA101 Tiwari et al. 2008

PAGE 119

119 Table B 2. List of published peanut t ransformation studies using particle bombardment Cultivar Explant Trait Promoter Reference leaflets from mature embryos Glucuronidase CaMV 35S Clemente et al. 1992 ab Toalson, Florunner somatic embryos Glucuronidase CaMV 35S Ozias Akins et al. 1993 Florunner, Florigiant shoot meristems of embryo axes -Glucuro nidase CaMV 35S Brar et al. 1994 Phosphinothricin resistance (bar) Nucleocapsid gene from TSWV MARC 1, Forunner, Toalson somatic embryos cryIA c CaMV 35S Singsit et al. 1997 Florunner, Georgia Runner, MARC 1 somatic embryos Glucuro nidase (vsp B Wang et al. 1998 CaMV 35S Florunner, Georgia Runner, MARC 1 somatic embryos Nucleocapsid gene from TSWV CaMV 35S Yang et al. 1998, 2004 Gajah, NC 7 somatic embryos Glucuronidase CaMV 35S Livingstone and Birch 1999 Lucifer ase ( luc ) VC 1, AT120 somatic embryos Nucleocapsid protein gene from TSWV CaMV 35S Magbanua et al. 2000 Glucuronidase Luhua 9, YueYou 116 somatic embryos Glucuronidase CaMV 35S Deng et al. 2001 Okrun somatic embryos Rice chitinase CaMV 35S Chenault et al. 2002, 2003, 2005 Alfalfa glucanase Okrun somatic embryos Nucleocapsid gene from TSWV CaMV 35S Chenault and Payton 2003 Georgia Runner embryonic axes Mercury resistance ( merA ) AtACT2 Yang et al. 2003 Gajah, NC 7 somatic em bryos Peanut stripe virus coat protein CaMV 35S Higgins et al. 2004 Georgia Green, MARC 1 somatic embryos Green fluorescent protein CaMV 35S Joshi et al. 2005 Mercury resistance ( merB ) NC 7, Wilson, Perry somatic embryos Barley oxalate oxidase CaMV 35S Livingstone et al. 2005 JL 24 somatic embryos BTVP2 CaMV 35S Athmaram et al. 2006 Georgia Green somatic embryos Bcl xL CaMV 35S Chu et al. 2007

PAGE 120

120 LIST OF REFERENCES Abdou Y. Gregory W. Cooper W. 1974. Sources and Nature of Resistance to Cercos pora Arachidicola Hori and Cercosporidium Personatum (Beck & Curtis) Deighton in Arachis Species. Peanut Science 1:611. Agrios G. 2005. Plant Pathology. 5 ed. Elsevier Academic Press, Burlington, MA. Ainsley P.J., Hammerschlag F.A., Bertozzi T., Colli ns G.G., Sedgley M. 2001. Regeneration of almond from immature seed cotyledons. Plant Cell Tissue and Organ Culture 67:221226. Akiyoshi D. Kl ee H. Am asi no R. Neste r E., Gordon M. 1984. T DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin bi osynthesis. Proceedings of the National Academy of Sciences 81:59945998. Alabi C. Na qui S. 1977. Effect of infection by Cercospora arachidicola on the food contents of ground nut leaf. Transactions of the British Mycological Society 68:295296. Ald erman S., Beute M. 1986. Influence of temperature and moisture on germination and germ tube elongation of Cercospora arachidicola. Influence of temperature and moisture on germination and germ tube elongation of Cercospora arachidicola 76:715 719. Altpeter F. Baisakh N., Beachy R., Bock R., Capell T., Christou P., Daniell H., Datta K., Datta S., Dix P.J., Fauquet C., Huang N., Kohli A., Mooibroek H., Nicholson L., Nguyen T.T., Nugent G., Raemakers K., Romano A., Somers D.A., Stoger E., Taylor N., Visser R. 20 05. Particle bombardment and the genetic enhancement of crops: myths and realities. Molecular Breeding 15:305327. Anuradha T.S., D ivya K., Jami S.K., Kirti P.B. 2008. Transgenic tobacco and peanut plants expressing a mustard defensin show resistance to f ungal pathogens. Plant Cell Reports 27:17771786. Anuradha T.S., Jami S .K., Datla R.S. and Kirti P.B. 2006. Genetic transformation of peanut ( Arachis hypogaea L.) using cotyledonary node as explant and a promoterless gus::npt II fusion gene based vector; Journal of Biosciences 31: 235 246. Armstrong W. 2008. The Peanut: A Subterranean Legume http://waynesword.palomar.edu/index.htm (15 October 2008).

PAGE 121

121 Athmar am T.N., Bali G., Devaiah K.M. 2006. Integration and expression of Bluetongue VP2 gene in somatic embryos of peanut through particle bombardment method. Vaccine 24:29943000. Atreya C.D., Rao J.P., Subrahmanyam N.C. 1984. In vitro regeneration of peanut ( Arachis hypogaea L.) plantlets from embryo axes and cotyledon segments. Plant Science Letters 34:379383. Azumi Y., Watanabe A. 1991. Evidence for a senescenceassociated gene induced by darkness. Plant Physiology 95:577583. Backman P.A., Rodriguez Kabana R., Hammond J.M., Clark E.M., Lyle J.A. Ive y H.W., II, Starling J.G. 1977. Peanut leafspot research in Alabama 19701976. Bulletin Auburn University Agricultural Experiment Station: 38. Bajaj Y.P.S., Kum ar P., Singh M.M., Labana K.S. 1982. Interspecific hybridization in the genus Arachis through em bryo culture. Euphytica 31:365370. Banerjee P., Mai ty S., Maiti S.S., Banerjee N. 2007. Influence of genotype on in vitro multiplication potential of Arachis hypogaea L. Acta Botanica Croatica 66:1523. Barry G.F., Rogers S.G., Fraley R.T., Brand L. 1984. Identification of a cloned cytokinin biosynthetic gene. Proceedings of the National Academy of Sciences of the United States of AmericaBiological Sciences 81:47764780. Becker W. Ap el K. 1993. Differences in gene expression between natural and artifi cially induced leaf senescence. Planta 189:7479. Berkeley M. (1875). Notices of North American Fungi 3:97112. Bhatia C. R., Murty G.S.S., Mathews V.H. 1985. Regeneration of plants from deembryonated peanut cotyledons cultured without nutrients and agar Zeitschrift Fur Pflanzenzuchtung Journal of Plant Breeding 94:149155. Bhatnagar Mathur P., Devi M.J., Reddy D.S., Lavanya M., Vadez V., Serraj R., Yamag uchi Shinozaki K., Sharma K.K. 2007. Stress inducible expression of At DREB1A in transgenic peanut ( Arachis hypogaea L.) increases transpiration efficiency under water limiting conditions. Plant Cell Reports 26:20712082. Boote K., Jones J., Mishoe J., Berger R. 1983. Coupling pest to crop growth stimulators to predict yield reductions. Phytopathology 73:15811587. Bou rgeois G., Boote K., Berger R. 1991. Growth, Development, Yield, and Seed Quality of Florunner Peanut Affected by Late Leaf Spot. Peanut Science 18:137143.

PAGE 122

122 Branch, W.D. 1994. Registration of Georgia Browne peanut. Crop Science 34:1125 1 126. Branch W. 1996. Registration of Georgia Green peanut. Crop Science 36:806. Branch W. 2002. Registration of Georgia01R Peanut Crop Science 42:1750 1751. Branch W. 2003. Registration of Georgia02C Peanut Crop Science 43:1883 1884. Branch W. Brenneman T. 2008. Registration of Georgia 07W Peanut Journal of Plant Registrations 2:8891. Brar G.S., Cohen B.A., Vick C.L., Johnson G.W. 1994. Recovery of transgenic peanut (arachis hypogaea l) plants from elite cultivars utilizing ACCELL technol ogy. Journal of Cellular Biochemistry: 9999. Brault M., Maldiney R. 1999. Mechanisms of cytokinin action. Plant Physiology and Biochemistry 37:403412. BuchananWollaston V., Ainsworth C. 1997. Leaf senescence in Brassica napus : Cloning of senescence related genes by subtractive hybridisation. Plant Molecular Biology 33:821834. Calderini O., Bovone T., Scotti C., Pu pilli F., Piano E., Arcioni S. 2007. Delay of leaf senescence in Medicago sativa transformed with the ipt gene controlled by the senescencespecific promoter SAG12. Plant Cell Reports 26:611615. Cantonwine E., Culbre ath A., Holbrook C., Gorbet D. 2008. Disease Progress of Early Leaf Spot and Components of Resistance to Cercospora arachidicola and Cercosporidium personatum in Runner Type Peanut Cultivars. Peanut Science 35:110. Cantonwine E.G., Culbreath A.K., Stevenson K.L. 2007a. Effects of cover crop residue and preplant herbicide on early leaf spot of peanut. Plant Disease 91:822827. Cantonwine E.G., Cu lbreath A.K., Stevenson K.L. 200 7b. Characterization of early leaf spot suppression by strip tillage in peanut. Phytopathology 97:187194. Cantonwine E.G., Culbreath A.K., Stevenson K.L., Kemerait R.C., Brenneman T .B., Smith N.B., Mullinix B.G. 2006. Integrated disease management of lea f spot and spotted wilt of peanut. Plant Disease 90:493500. Chandra A., Pental D. 2003. Regeneration and genetic transformation of grain legumes: An overview. Current Science 84:381387.

PAGE 123

123 Chang H.S., Jones M.L., Banowet z G.M., Clark D.G. 2003 Overproduc tion of cytokinins in petunia flowers transformed with P SAG12 IPT delays corolla senescence and decreases sensitivity to ethylene. Plant Physiology 132:21742183. Chenault K., Ozias Aki ns P., Gallo M., Srivastava P. 2 008. Peanut. A Compendium of Transgen ic Crop Plants: Oilseed Crops. Chenault K.D., Melouk H.A. 2003. Disease incidence, yield, and grade comparisons of transgenic and nontransgenic peanut plants in field tests for Sclerotinia minor resistance. Phytopathology 93:S16. Chenault K.D., Payton M .E. 2003. Genetic transformation of a runner type peanut with the nucleocapsid gene of tomato spotted wilt virus. Peanut Science 30:112115. Chenault K.D., Payton M.E. Melouk H.A. 2003. Greenhouse testing of transgenic peanut for resistance to Sclerotini a minor Peanut Science 30:116120. Chenault K.D., Melouk H.A., Payton M.E. 2005. Field reaction to Sclerotinia blight among transgenic peanut lines containing antifungal genes. Crop Science 45:511515. Chenault K.D., Burns J.A., Melouk H.A., Payton M.E. 2002. Hydrolase activity in transgenic peanut. Peanut Science 29:8995. Cheng M. Jarrett R., Li Z., Demski J. 1997. Expression and inheritance of foreign genes in transgenic peanut plants generated by Agrobacterium mediated transformation. Plant Cell Reports 16:541544. Cheng M., Jarret R.L., Li Z.J., Xing A.Q., Demski J.W. 1996. Production of fertile transgenic peanut ( Arachis hypogaea L) plants using Agrobacterium tumefaciens Plant Cell Reports 15:653657. Che ngalrayan K., GalloMeagher M. 2004. Eva luation of runner and Virginia market types for tissue culture responses. Peanut Science 31:7478. Chengalr ayan K., Mhaske V.B., Hazra S. 1995. In vitro regulation of morphogenesis in peanut ( Arachis hypogaea L.). Plant Science 110:259268. Chengalr ayan K., Mhaske V.B., Hazra S. 1997. High frequency conversion of abnormal peanut somatic embryos. Plant Cell Reports 16:783786. Chiteka Z., Gorbet D., Knauft D., Shokes F., Kucharek T. 1988a. Components of resistance to late leafspot in peanut II. Correlati ons among components and their significance in breeding for resistance. Peanut Science 15:7681.

PAGE 124

124 Chiteka Z., Gorbet D., Shokes F., Kucharek T., Knauft D. 1988b. Components of Resistance to Late Leafspot in Peanut I. Levels and Variability Implications f or Selection. Peanut Science 15:2530. Chu Y Deng X Y Faustinelli P Ozias Akins P 2008 Bcl xL transformed peanut ( Arachis hypogaea L.) exhibits paraquat tolerance. P lant Cell Reports 1:85 92. Clemente T.E., Schnall J.A ., Beute M.K., Weissinger A.K. 1992a. Analysis of peanut ( Arachis hypogaea L.) leaflets from mature zygotic embryos as a target tissue for biolistic gene transfer. Phytopathology 82:1074. Clemente T.E. Robertson D., Isleib T.G ., Beute M.K., Weissinger A.K. 1992b. Evaluation of peanut ( Arachis hypogaea L.) leaflets from mature zygotic embryos as recipient tissue for biolistic gene transfer. Transgenic Research 1:275284. Cook M. 1981. Susceptibility of peanut leaves to Cercosporidium personatum Phytopathology 71:787 791. Culbreath A., Beasley J., Kemerait R., Prostko E., Brenneman T., Smith N., Tubbs S., Paz J., Olatinwo R., Tillman B., Gevens A., Weeks R., Hagan A. 2009. Peanut Update, Peanut RX. Da micone J.P., Jackson K.E. 1994. Response of peanut cultivars differing in susceptibility to Sclerotinia blight to fungicide treatments. Phytopathology 84:1078. Daub M., Ehrenshaft M. 2000. The photoactivated Cercospora toxin cercosporin: contributions to plant disease and fundamental biology. Annual Review of Phytopathology 38:461 490. Deighton F.C. 1967. New names in Mycosphaerella ( M. arachidis and M pruni persici ) and validation of M. rosicola Transactions of the British Mycological Society 50:328&. Deng X.Y., Wei Z.M., An H.L. 2001. Transgenic peanut plants obtained by particle bombardment via somatic embryogenesis regeneration system. Cell Research 11:156160. Dodo H., Konan K., Chen F., Egnin M., Viquez O. 2007. Alleviating peanut allergy using genetic engineering: the silencing of the immunodominant allergen Ara h 2 leads to its significant reduction and a decrease in peanut allergenicity. Plant Biotechnology Journal 5.

PAGE 125

125 Drake R., John I., Farrell A., Coo per W., Schuch W., Grierson D. 1996. Isol ation and analysis of cDNAs encoding tomato cysteine proteases expressed during leaf senescence. Plant Molecular Biology 30:755767. Dunstan D., Thorpe A. 1986. Regeneration in forest trees, in: E. Vasil (Ed.), Cell culture and somatic cell genetics of pl ants, Academic Press, Orlando, FL. pp. 223243. Dwivedi S., Pande S., Rao J., Nigam S. 2002. Components of resistance to late leaf spot and rust among interspecific derivatives and their significance in a foliar disease resistance breeding in groundnut ( A rachis hypogaea L.). Euphytica 125:8188. Eapen S., George L. 1994. Agrobacterium tumefaciens mediated genetransfer in peanut ( Arachis hypogaea L.). Plant Cell Reports 13:582586. Egnin M., Mo ra A., Prakash C.S. 1998. Factors enhancing Agrobacterium tum efaciens mediated gene transfer in peanut ( Arachis hypogaea L.). In Vitro Cellular & Developmental Biology Plant 34:310318. FAO Statisics. 2010. Countries by Commodity: Groundnuts. http://faosta t.fao.org Favero A.P., Simpson C.E., Valls J.F.M., Vello N.A. 2006. Study of the evolution of cultivated peanut through crossability studies among Arachis ipaensis A. duranensis and A. hypogaea. Crop Science 46:15461552. Fernandez A., Krapovickas A. 1994. Chromosomes and evolution in Arachis (Leguminosae). Bonplandia 8:187220. Foster D., Beute M., Wynne J. 1980. Spore production and latent period as mechanisms of resistance to Cercospora arachidicola in four peanut genotypes. Peanut Science 7:8889 Franklin C.I., Shorrosh K.M., Trieu A .N., Cassidy B.G., Nelson R.S. 1993. Stable transformation of peanut callus via Agrobacterium mediated DNA transfer. Transgenic Research 2:321324. Galgaro L., Lopes C.R., Gimenes M., Valls J.F.M., Kochert G. 1998. Genetic variation between several species of sections Extranervosae, Caulorrhizae, Heteranthae, and Triseminatae (genus Arachis ) estimated by DNA polymorphism. Genome 41:445454. Gan S., Amasino R. 1995. Inhibition of Leaf Senescence by Autoregulated Prod uction of Cytokinin. Science 270:19861988. Gan S.S., Amasino R.M. 1997. Making sense of senescence Molecular genetic regulation and manipulation of leaf senescence. Plant Physiology 113:313319.

PAGE 126

126 Garcia G.M., Stalker H.T., Kochert G. 1995. Introgression analysis of an interspecific hybrid population in peanuts ( Arachis hypogaea L.) using RFLP and RAPD markers. Genome 38:166176. Gepstein S., Sabehi G., Carp M.J., Hajouj T., Nesher M.F.O. Yariv I., Dor C., Bassani M. 2003. Large scale identification of leaf senescenceassociated genes. Plant Journal 36:629642. Gibbons R. 1966. Mycosphaerella leafspots of groundnuts FAO Plant Protection Bulletin: 1530 Gorbet D. 2007 a Registration of AP3 Peanut Jour nal of Plant Registrations 1:126127. Gorbet D 2007 b Registration of Hull Peanut Journal of Plant Registrations 1:125126. Gorbet D., Shokes F. 2002a. Registration of C 99R peanut. Crop Science 42:2207. Gorbet D. Sh okes F. 2002b. Registration of Florida MDR 98 Peanut Crop Science 42:22072208. Gorbet D. Ti llman B. 2008. Registration of DP 1 Peanut Journal of Plant Registrations 2:200204. Gorbet D., N orden A., Shokes F., Knauft D. 1987a. Registration of Southern Runner peanut. Crop Science 27:817. Gorbet D.W., Tillman B.L. 2009. R egistration of 'Florida 07' Peanut. Journal of Plant Registrations 3:1418. Gorbet D.W., Norden A.J., Shokes F.M., Knauft D.A. 1987b. Registration of Southern Runner peanut. Crop Science 27:817817. Graaff E.v.d., Schwacke R., Schneider A., Desi mone M., Flugge U.I., Kunze R. 2006. Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence. Plant Physiology 141:776792. Gray D., Benton C. 1991. In vitro micropropagation and plant establishment of muscadine grape cultivars ( Vitis rotundifolia). Plant Cell, Tissue and Organ Culture 27:714. Green C., Wynne J. 1986. Field and greenhouse evaluation of the components of partial resistance to early leafspot in peanut. Euphytica 35:561 573.

PAGE 127

127 Green J., Gallo M. 2001. Suitability of b glucuronidase and the green fluorescent protein as reporters for transformation of peanut merstimatic tissue. Soil and Crop Science Society of Florida 60:98104. Greenberg J., Yao N. 2004. The role and regulation of programmed cell death in plant pathogen interactions. Cellular Microbiology 6:201211. Gregory W., Gregory M. 1976. Groundnut, in: N. Simmonds (Ed.), Evolution of crop plants, Longman Group Ltd., London, UK. pp. 151154. Gregory W., Krapovickas A., Gr egory M. 1980. Structure, variation, evolution and classification in Arachis in: R. Summerfield and A. Bunting (Eds.), Advances in Legume Science. pp. 469 481. Grieshammer U. Wynne J.C. 1990. Mendelian and nonmendelian inheritance of three isozymes in peanut Arachis hypogaea L. Peanut Science 17:101105. Halwar d T., Stalker H.T., Kochert G. 1993. Development of an RFLP linkage map in diploid peanut species. Theoretical and Applied Genetics 87:379384. Halward T., St alker T., Larue E., Kochert G. 1992. Use of single primer DNA amplifications in genetic studies of peanut ( Arachis hypogaea L.). Plant Molecular Biology 18:315325. Halward T.M., Stalker H.T., Larue E .A., Kochert G. 1991. Genetic variation detectable with molecular markers among unadapted g ermplasm resources of cultivated peanut and related wildspecies. Genome 34:10131020. Harris G., Hart E. 1964. Regeneration from leaf squares of Peperomia sandersii A, DC: a relationship between rooting and budding. Annals of Botany 28:509526. Hazra S. Sathaye S.S., Mascarenhas A.F. 1989. Direct somatic embryogenesis in peanut ( Arachis hypogeal L.). Bio Technology 7:949951. He G.H., Prakash C.S. 1997. Identification of polymorphic DNA markers in cultivated peanut ( Arachis hypogaea L.). Euphytica 97:143149. He G.H., Prakash C. 2001. Evaluation of genetic relationships among botanical varieties of cultivated peanut ( Arachis hypogaea L.) using AFLP markers. Genetic Resources and Crop Evolution 48:347352. Hemingway J. 1954. Cercospora leafspot of groundnuts inTanganyika 19:263267. Herselman L. 2003. Genetic variation among Southern African cultivated peanut ( Arachis hypogaea L.) genotypes as revealed by AFLP analysis. Euphytica 133:319327.

PAGE 128

128 Higgins C.M., Hall R.M., Mitter N., Cruickshank A., Dietzge n R.G. 2004. Peanut stripe potyvirus resistance in peanut ( Arachis hypogaea L.) plants carrying viral coat protein gene sequences. Transgenic Research 13:5967. Hirose N., Takei K., Kuroha T., KamadaNobusada T., Hayashi H., Sakakibara H. 2008. Regulation of cytokinin biosynthesis, compartmentalization and translocation. Journal of Experimental Botany 59:7583. Hokanson K.E., Pooler M.R. 2000. Regeneration of ornamental cherry ( Prunus ) taxa from mature stored seed. Hortscience 35:745748. Holbrook C., Culbreath A. 2007. Registration of Tifrunner Peanut Journal of Plant Registrations 1:124. Holbrook C. Culbreath A. 2008. Registration of Georganic Peanut Journal of Plant Registrations 2:17. Hopkins M.S., Casa A.M., Wang T., Mitchell S.E., Dean R.E. Kochert G.D., Kresovich S. 1999. Discovery and characterization of polymorphic simple sequence repeats (SSRs) in peanut. Crop Science 39:12431247. Hsi, D.C.H., and R.E. Finkner. 1972. Registration of New Mexico Valencia A peanut. Crop Science 12:256. H umb eck K., Quast S., Krupinska K. 1996. Functional and molecular changes in the photosynthetic apparatus during senescence of flag leaves from fieldgrown barley plants. Plant Cell and Environment 19:337344. Husted L. 1936. Cytological studies of the pea nut Arachis 2. Chromosome number, morphology and behavior, and their application to the problem of the origin of the cultivated forms. Cytologia 7:396423. Illingworth J.E. 1968. Peanut plants from single deembryonated cotyledons. Hortscience 3:238, 27 6. Isleib, T.G., Mozingo, R.W., Copeland, S.C., Graber, J.B., Shew, B.B., Smith, D.L ., Melouk, H.A., Stalker, H.T. 2006. Registration of N96076L Peanut Germplasm Line. Crop Science 46: 23292330. Jacobi J.C., Backman P.A. 1995. AU peanuts advisory .2. Modification of the rulebased leaf spot advisory system for a partially resistant peanut cultivar. Plant Disease 79:672676. Jacobi J.C., Backman P .A., Davis D.P., Brannen P.M. 1995. AP peanuts advisory .1. Development of a rulebased system for scheduling peanut leaf spot fungicide applications. Plant Disease 79:666671.

PAGE 129

129 Jandrew J. 2002. Nutritional and Fungal Stress Responses of Transgenic Petunias with Delayed Leaf Senescence, Horticulture, University of Florida, Gainesville, FL. Jenkins W. 1938. Two f ungi causing leafspot of peanuts. Journal of Agricultural Research 56:317332. Jensen R.E., Boyle L.W. 1965. The effect of temperature, relative humidity and precipitation on peanut leaf spot. Plant Dis Rep 49:975978. Jia ng C., Rodermel S., Shibles R. 1993. Photosynthesis, rubisco activity and amount, and their regulation by transcription in senescing soybean leaves. Plant Physiology 101:105112. Jordi W., Schapendonk A., Davelaar E., Stoopen G.M., Pot C.S., De Visser R., Van Rh ijn J.A., Gan S., Amasino R.M. 2000. Increased cytokinin levels in transgenic P SAG12 IPT tobacco plants have large direct and indirect effects on leaf senescence, photosynthesis and N partitioning. Plant Cell and Environment 23:279289. Joshi M., Sujatha K., Hazra S. 2008. Effec t of TDZ and 2, 4 D on peanut somatic embryogenesis and in vitro bud development. Plant Cell Tissue and Organ Culture 94:8590. Joshi M., Niu C., Fleming G., Hazra S., Chu Y., Nairn C .J., Yang H.Y., Ozias Akins P. 2005. Use of green fluorescent protein as a nondestructive marker for peanut genetic transformation. In Vitro Cellular & Developmental Biology Plant 41:437445.. Kartha K.K., P ahl K., Keung N., Mroginski L. 1981. Plant regeneration from meristems of grain legumes: soybean, cowpea, peanut, chi ckpea, and bean. Canadian Journal of Botany 59:16711679. Khandelwal A., Renukaradhya G.J., Rajasek har M., Sita G.L., Shaila M.S. 2004. Systemic and oral immunogenicity of hemagglutinin protein of rinderpest virus expressed by transgenic peanut plants in a mouse model. Virology 323:284291. Khandelwal A., Vally K., Geetha N., Venkatachalam P., Shaila M., Lakshmi Sita G. 2003. Engineering hemagglutinin (H) protein of rinderpest virus into peanut ( Arachis hypogaea L.) as a possible source of vaccine. Plant Science 165:7784. King P.S., Rodriguez Kabana R ., Robertson D.G., Weaver C.F. 1995. Long term study on the value of new crops for the management of root knot and southern blight in 'Florunner' peanut. Journal of Nematology 27:505.

PAGE 130

130 Kirti P. Bharati M., Murty U., Rao N. 1983. Chromosome morphology in three diploid species of Arachis and its bearing on the genomes of groundnut ( Arachis hypogaea L.). Cytologia 48:139151. Klosova E., Turkova V., Smartt J ., Pitterov K., Svachulov J. 1983. Immunochemical characterization of seed proteins of some species of the genus Arachis Biologia Plantarum 25:201208. Knauft D.A., Gorbet D.W. 1989 Genetic diversity among peanut cultivars. Crop Science 29:14171422. Knauft D.A., Norden A.J., Gorbet D.W. 1986. The effe ct of three digging dates on oil quality yield and grade of five peanut genotypes grown without leafspot control. Peanut Science 13:8286. Knauft D.A., Norden A.J., Gorbet D.W., Martin F.G. 1987. Stability of market quality factors in peanut ( Arachis hypo gaea L.). Soil and Crop Science Society of Florida Proceedings 46:7274. Kochert G., Halward T., Branch W.D., Simpson C.E. 1991. RFLP variability in peanut ( Arachis hypogaea L.) cultivars and wildspecies. Theoretical and Applied Genetics 81:565570. Koc hert G., Stalker H.T., Gimenes M., Ga lgaro L., Lopes C.R., Moore K. 1996. RFLP and cytogenetic evidence on the origin and evolution of allotetraploid domesticated peanut, Arachis hypogaea (Leguminosae). American Journal of Botany 83:12821291. Krapovickas A., Gregory W.C. 1994. Taxonomy of the genus Arachis (Leguminosae). Bonplandia 8:1186. Lacks G.D., Stalker H.T. 1993. Isozyme analyses of Arachis species and interspecific hybrids. Peanut Science 20:7681. Lacorte C., Mansur E ., Timmerman B., Cordeiro A.R. 1991. Gene transfer into peanut ( Arachis hypogaea L.) by Agrobacterium tumefaciens. Plant Cell Reports 10:354357. Lanham P.G., Fe nnell S., Moss J.P., Powell W. 1992. Detection of polymorphic loci in Arachis germplasm using random amplified polymorphic DNAs. Genome 35:885889. Lee R. H., Huang L. T., Chen Shu Chen G. 2001. Leaf senescence in rice plants. Plant Biology (Rockville) 2001:60.

PAGE 131

131 Li Y., Hagen G., Guilfoyle T. 1992. Altered Morphology in Transgenic Tobacco Plants That Overproduce Cytokinins in Specific Tissues and Organs. Developmental Biology 153:386395. Li Z.J., Jarret R.L., Demski J.W. 1997. Engineered resistance to tomato spotted wilt virus in transgenic peanut expressing the viral nucleocapsid gene. Transgenic Research 6:297305. Li Z .J., Jarret R .L., Pittman R.N., Demski J.W. 1994. Shoot organogenesis from cultured seed explants of peanut ( Arachis hypogaea L.) using thidiazuron. In Vitro Cellular & Developmental Biology Plant 30P:187191. Lim P.O., Kim H.J., Nam H.G. 2007. Leaf senes cence. Annual Review of Plant Biology 58:115136. Livingstone D.M., Birch R.G. 1999. Efficient transformation and regeneration of diverse cultivars of peanut ( Arachis hypogaea L.) by particle bombardment into embryogenic callus produced from mature seeds. Molecular Breeding 5:4351. Livingstone D.M., Hampton J.L., Phipps P.M., Grabau E.A. 2005. Enhancing resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Plant Physiology 137:13541362. Lohman K.N., Gan S.S., John M.C., Amasino R.M. 1994. Molecular analysis of natural leaf senescence in Arabidopsis thaliana. Physiologia Plantarum 92:322328. Lu J., Pickersgill B. 1993. Isozyme variation and species relationships in peanut and its wild relatives ( Arachis L. Leguminosae). Theoretical and Applied Genetics 85:550560. Luo M., P D., Bausher M., Holbrook C., Lee R., Lynch, RE, Guo, BZ. 2005. Identification of Transcripts Involved in Resistance Responses to Leaf Spot Disease Caused by Cercosporidium personatum in Peanut ( Ara chis hypogaea). Phytopathology 95:381 387. Magbanua Z., Wilde H., Roberts J., Chowdhury K., Abad J., Moyer J., We tzstein H., Parrott W. 2000. Field resistance to tomato spotted wilt virus in transgenic peanut ( Arachis hypogaea L.) expressing an antisense nucleocapsid gene sequence. Molecular Breeding 6:227236. Martin J. 1970. Culture in vitro dovules darachide. Oleagineux 25:155156. Matand K., Prakash C.S. 2007. Evaluation of peanut genotypes for in vitro plant regeneration using thidiazuron. Journal of Biotechnology 130:202207.

PAGE 132

132 McCabe M.S., Garratt L.C., Schepers F., Jordi W., Stoopen G.M., Davelaar E., van Rhijn J.H.A., Power J.B., Davey M.R. 2001. Effects of P SAG12 IPT gene expression on development and senescence in transgenic lettuce. Plant Ph ysiology 127:505516. McKently A.H. 1991. Direct somatic embryogenesis from axes of mature peanut embryos. In Vitro Cellular and Developmental Biology Plant 27P:197 200. McKently A.H., Moore G.A., Gardner F.P. 1990. In vitro plant regeneration of peanut from seed explants. Crop Science 30:192196. McKently A.H., Moore G.A., Doostdar H., Niedz R.P. 1995. Agrobacterium mediated transformation of peanut ( Arachis hypogaea L.) embryo axes and the development of transgenic plants. Plant Cell Reports 14:699703 Melouk H., Banks D. 1986 Assessment of resistance to Cercospora arachidicola in peanut genotypes in field plots. Plant Disease 68:395 397. Morton B. 2007. Poor field emergence of latematuring peanut cultivars ( Arachis hypogaea L.) derived from PI 203396, Dissertation, Agronomy, University of Florida, Gainesville, FL. Mossler M. A erts M. 2007. Florida Crop/Pest Management Profiles: Peanuts IFAS Extension EDIS. Mroginski L.A. 1981. Regeneration of peanut ( Arachis hypogaea L.) plantlets by in vitro cu lture of immature leaves. Environmental and Experimental Botany 21:437437. Murashige Y., Skoog F. 1 962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiologia Plantarum 15:473 497. Murty U.R., Jahnavi M.R. 1986. The A genome of Arachis hypogaea L. Cytologia 51:241250. Narasimhulu S.B., Reddy G.M. 1983. Plantlet regeneration from different callus cultures of Arachis hypogaea L. Plant Science Letters 31:157163. Nwokolo E. 1996. Peanut ( Arachis hyogaea L.), in: J. Smar tt and E. Nwokolo (Eds.), Food and Feed from Legumes and Oilseeds, Chapman & Hall, London, UK. pp. 4858. Ori N., Juarez M.T., Jackson D., Yamagu chi J., Banowetz G.M., Hake S. 1999. Leaf senescence is delayed in tobacco plants expressing the maize homeobox gene knotted1 under the control of a senescenceactivated promoter. Plant Cell 11:10731080.

PAGE 133

133 O zias Akins P., Gill R. 2001. Progress in the development of tissue culture and transformation methods applicable to the production of transgenic peanut. Peanut Science 28:123131. Ozias Akins P., Yang H., Gill R., Fan H., Lynch R. 2002. Reduction of aflatoxin contamination in peanut: A genetic engineering approach. ACS Symposium Series 829:151160. Ozias Akins P. 1989. Plant regeneration from immature embryos of peanut. Plant Cell Reports 8:217218. Ozias Akins P. Anderson W.F., Holbrook C.C. 1992. Somatic embryogenesis in Arachis hypogaea L. genotype comparison. Plant Science 83:103111. Ozias Akins P., Schnall J.A., Anderson W.F., Singsit C., Clemente T.E ., Adang M.J., Weissinger A.K. 1993. Regeneration of transgenic peanut plants from stably transformed embryogenic callus. Plant Science 93:185194. Paik ro O.G., Smith R.L., Knauft D.A. 1992. Restriction fragment lengthpolymorphism evaluation of 6 peanut species within the Arachis section. Theoretical and Applied Genetics 84:201208. Pattee H.E., Young C.T., American Peanut R esearch and Education Society. 1982. Peanut science and technology American Peanut Research and Education Society, Yoakum, Tex. P ittman R.N., Banks D.J., Kirby J.S., Mitchell E.D., Richardson P.E. 1983. In vitro culture of immature peanut ( Arachis spp.) leaves: morphogenesis and plantlet regeneration. Peanut Science 10:2125. Pixley K.V., Boote K.J., Shokes F.M., Gorbet D.W. 1990a. Disease progression and leaf area dynamics of 4 peanut genotypes differing in resistance to late leafspot. Crop Science 30:789796. Pixley K.V., Boote K.J., Shokes F.M., Gorbet D.W. 1990b. Growth and partitioning characteristics of 4 peanut genotypes dif fering in resistance to late leafspot. Crop Science 30:796804. Preece J., Imel M. 19 91. Plant regeneration from leaf explants of Rhododendron P.J.M. hybrids. Scientia Horticulturae 48:159170. Raina S., Mukai Y. 1999. Genomic in situ hyridization in Ara chis (Fabaceae) identifies the diploid wild progenitors of cultivated ( A. hypogaea) and related wild ( A. monticola) peanut species. Plant Systemics & Evolution 214:251262.

PAGE 134

134 Raina S.N., Rani V., Kojima T., Ogihara Y ., Singh K.P., Devarumath R.M. 2001. RAPD and ISSR fingerprints as useful genetic markers for analysis of genetic diversity, varietal identification, and phylogenetic relationships in peanut ( Arachis hypogaea) cultivars and wild species. Genome 44:763772. Ricker M., Beute M., Campbell C. 1985. Components of resistance in peanut to Cercospora arachidicola. Plant Disease 69:10591064. Rohini V., Rao K. 2000. Transformation of peanut ( Arachis hypogaea L.): a nontissue culture based approach for generating transgenic plants. Plant Science 150:4149. Rohini V.K., Rao K.S. 2001. Transformation of peanut ( Arachis hypogaea L.) with tobacco chitinase gene: variable response of transformants to leaf spot disease. Plant Science 160:889 898. Sakakibara H. 2005. Cytokinin biosynthesis and regulation. Plant Hormones 72:271287. Sakakibara H. 2006. Cytokinins: Activity, biosynthesis, and translocation. Annual Review of Plant Biology 57:431449. SAS Institute Inc. 2000. Version 8, Cary, NC: SAS Institute Inc Seetharam A., Nayar K. Sreekantaradhya R., Ac har D. 1973. Cytological studies on the interspecific hybrid of Arachis hypogaea x Arachis duranensis Cytologia 38:277280. Seijo G., Lavia G.I., Fernandez A., Krapovickas A., Ducasse D.A ., Bertioli D.J., Moscone E.A. 2007. Genomic relationships between the cultivated peanut ( Arachis hypogaea, Leguminosae) and its close relatives revealed by double GISH. American Journal of Botany 94:19631971. Seijo J.G., Lavia G.I., Fernandez A., Krapovickas A., Ducasse D., Moscone E.A. 2004. Physical mapping of the 5S and 18S 25S rRNA genes by fish as evidence that Arachis duranensis and A ipaensis are the wild diploid progenitors of A hypogaea (Leguminosae). American Journal of Botany 91:12941303. Seitz M.H., Stalker H.T., Green C.C. 1987. Genetic variation for regenerative response in immature leaflet cultures of the cultivated peanut, Arachis hypogaea. Plant Breeding 98:104110. Sharma K., Bhatnagar Mathur P. 2006. Peanut ( Arachis hypogaea L.), in: K. Wang (Ed.), Methods in Molecular Biology. pp. 347358.

PAGE 135

135 Shar ma K.K., Bh atnagar Mathur P., Thorpe T.A. 2005. Genetic transformation technology: status and problems. In Vitro Cellular & Developmental Biology Plant 41:102112. Sharma K.K., Anjaiah V. 2000. An efficient method for the production of transgenic plants of peanut ( Arachis hypogaea L.) through Agrobacterium tumefaciens mediated genetic transformation. Plant Science 159:719. She w B.B., Beute M.K., Wynne J.C. 1988. Effects of temperature and relativehumidity on expression of resistance to cercosporidium p ersonatum in peanut. Phytopathology 78:493 498. Shokes F. Go rbet D. Ja ckson L. 1983. Control of early and late leaf spot on two peanut cultivars Peanut Science 10:1721. Simpson C.E., Starr J.L. 2001. Registration of 'COAN' peanut. Crop Science 41:918918. Singh A., Moss J. 1982. Utilization of wild relatives in genetic improvement of Arachis hypogaea L. Chromosome complements of species in section Arachis Theoretical and Applied Genetics 61:305314. Singh A., Moss J. 1984. Utilization of wild relat ives in genetic improvement of Arachis hypogaea L. 2.Chromosome complements of species in the section Arachis Theoretical and Applied Genetics 68:355364. Singh A., Smartt J. 1998. The genome donors of the groundnut/peanut ( Arachis hypogaea L.) revisited. Genetic Resources and Crop Evolution 45:113118. Singh A.K. 1 986. U tilization of wild relatives in the genetic improvement of Arachis hypogaea L .7. Autotetraploid production and prospects in interspecific breeding. Theoretical and Applied Genetics 72:164169. Singh A.K. 1988. Putative genome donors of arachis hypogaea (fabaceae), evidence from crosses with synthetic amphidiploids. Plant Systematics and Evolution 160:143151. Singh A.K., Stalker H.T., Moss J.P. 1991a. Cytogenetics and use of alien genetic variation in groundnut improvement. Chromosome engineering in plants: genetics, breeding, evolution. Part B.:6577. Singh A.K., Gurtu S., Jambunathan R. 1994. Phylogenetic relationships in the genus Arachis based on seed protein profiles. Euphytica 74 :219 225.

PAGE 136

136 Singh A.K., Sivaramakrishnan S., Mengesha M.H., Ram aiah C.D. 1991b. Phylogenetic relations in section Arachis based on seed protein profile. Theoretical and Applied Genetics 82:593597. Singh A.K., Cha nd S., Pattnaik S., Chand P.K. 2002. Advent itious shoot organogenesis and plant regeneration from cotyledons of Dalbergia sissoo Roxb., a timber yielding tree legume. Plant Cell Tissue and Organ Culture 68:203209. Sing h K.P., Raina S.N., Singh A.K. 1996. Variation in chromosomal DNA associated wi th the evolution of Arachis species. Genome 39:890897. Singsit C., Adang M.J., Lynch R.E., Anderson W.F., Wang A.M ., Cardineau G., OziasAkins P. 1997. Expression of a Bacillus thuringiensis cryIA(c) gene in transgenic peanut plants and its efficacy against lesser cornstalk borer. Transgenic Research 6:169176. Smart C., Scofield S., Bevan M., Dyer T. 1991. Delayed Leaf Senescence in Tobacco Plants Transformed with tmr, a Gene for Cytokinin Production in Agrobacterium The Plant Cell 3:647 656. Smart C. Ho sken S. Th oma s H. Grea ves J. Blair B. Sch uch W. 1 995. The timing of maize leaf senescence and characterization of senescencerelated cDNAs. Physiologia Plantarum 93:637682. Sma rtt J., Gregory W., Gregory M. 1978. The genomes of Arachis hypogaea. C ytogenetic studies of putative genome donors. Euphytica 27:665675. Smith, N.B., Smith, A.R. 2009. Peanut: Estimated Costs and Retur ns. Extension Ag and Applied Economics, University of Georgia College of Agriculture and Environmental Science, www.ces.uga.edu Smith D.H., Littrell R.H. 1980. Management of peanut foliar diseases with fungicides. Plant Disease 64:356361. Stalke r H.T., Dhesi J.S., Kochert G. 1995. Genetic diversity within the species Arachis duranensis Krapov & W.C. Gregory, a possible progenitor of cultivated peanut. Genome 38:12011212. Stalker, H.T., Simpson, C.E. 1995. Genetic resources in Arachis In H. E. Pattee and H. T. Stalker (eds.), Advances in Peanut Science: 1453. Amer. Peanut Res. Educ. Soc., Stillwater, OK. Stalker H.T., Phillips T. D., Murphy J.P., Jones T.M. 1994. Variation of isozyme patterns among Arachis species. Theoretical and Applied Genetics 87:746755.

PAGE 137

137 Stalker H.T., Beut e M.K., Shew B.B., Isleib T.G. 2002. Registration of f ive leaf spot resistant peanut germplasm lines. Crop Science 42:314316. Stoessl A. 1984. Dothistromin as a metabolite of Cercospora arachidicola. Mycopathologia 86:165168. Stoessl A., Abramowski Z., Lester H.H., Rock G.L., Towers G.H.N. 1990. Further t oxic properties of the fungal metabolite dothistromin. Mycopathologia 112:179186. Subrahmanyam P., McDonald D., G ibbons R., Nigam S., Nevill D. 1982. Resistance to rust and late leaf spot diseases in some genotypes of Arachis hypogaea. Peanut Science 9:610. Subramanian V., Gurtu S., Rao R.C.N., Ni gam S.N. 2000. Identification of DNA polymorphism in cultivated groundnut using random amplified polymorphic DNA (RAPD) assay. Genome 43:656660. Su jatha K., Panda B.M., Hazra S. 2008. De novo organogenesis an d plant regeneration in Pongamia pinnata, oil producing tree legume. Trees Structure and Function 22:711716. Swartzberg D., Dai N., Gan S., Amasino R., Granot D. 2006. Effects of cytokinin production under two SAG promoters on senescence and development of tomato plants. Plant Biology 8:579586 Swartzberg D., Kirshner B., Rav David D., Elad Y., Granot D. 2008. Botrytis cinerea induces senescence and is inhibited by autoregulated expression of the IPT gene. European Journal of Plant Pathology 120:289297 Sykorova B., Kuresova G., Daskalova S., Trckova M., Hoyerova K., Raimanova I., Motyka V., Travnickov a A., Elliott M.C., Kaminek M. 2008. Senescenceinduced ectopic expression of the A tumefaciens ipt gene in wheat delays leaf senescence, increases cytok inin content, nitrate influx, and nitrate reductase activity, but does not affect grain yield. Journal of Experimental Botany 59:377387. Tang R., Gao G., He L., Han Z., Shan S., Zhong R., Zhou C., Jiang J., Li Y., Zhuang W. 2007. Genetic diversity in cul tivated groundnut based on SSR markers. Journal of Genetics and Genomics 34:449459. Tillman B., Stalker H. 2009. Peanuts, in: J. Vollman and I. Rajcan (Eds.), Oil Crops, Handbook of Plant Breeding. pp. 287315. Tiwari S., Tuli R. 2009. Multiple shoot regeneration in seedderived immature leaflet explants of peanut ( Arachis hypogaea L.). Scientia Horticulturae 121:223227..

PAGE 138

138 Tiwari S., Mishra D.K., Singh A., Singh P.K., Tuli R. 2008. Expression of a synthetic cry1EC gene for resistance against Spodoptera litura in transgenic peanut ( Arachis hypogaea L.). Plant Cell Reports 27:10171025. Tiwari S Tuli, R 2008. Factors promoting efficient in vitro regeneration from deembryonated cotyledon explants of Arachis hypogaea L. Plant Cell Tissue Organ Cult ure 92:15 24 USDA, NASS 2010. Crop Acreage and Values: Peanut. http://www.nass.usda.gov Venkatachalam P., Geetha N., Jayab alan N., Saravanababu, Sita L. 1998. Agrobacterium mediated genetic transformation of groundnut ( Arachis hypogaea L.): An assessment of factors affecting regeneration of transgenic plants. Journal of Plant Research 111:565572. Venkatachalam V., Geetha N., Khandelwal A., Shaila M., Lakshmi Sita G. 2000. Agrobacterium mediated genetic transformation and regeneration of transgenic plants from cotyledon explants of groundnut ( Arachis hypogaea L.) via somatic embryogensis. Current Science 78:11301136. Victor J.M.R., Murch S.J., KrishnaRaj S., Saxena P.K. 1999. Somatic embryogenesis and organogenesis i n peanut: The role of thidiazuron and N 6 benzylaminopurine in the induction of plant morphogenesis. Plant Growth Regulation 28:915. Walls S., Wynne J., Beute M. 1985. Resistance to late leafspot of peanut of progenies selected for resistance to early leafspot. Peanut Science 12:2227. Wang A.M., Fan H. L., Singsit C., Ozias Akins P. 1998. Transformation of peanut with a soybean vspB promoter uidA chimeric gene. I. Optimization of a transformation system and analysis of GUS expression in primary transgeni c tissues and plants. Physiologia Plantarum 102:3848. Watanabe A., Imaseki H. 1982. Changes in translatable messenger rna in senescing wheat leaves. Plant and Cell Physiology 23:489497. Watson G. R., Kucharek T.A., Shokes F.M. 1998. Components of resist ance in peanut to late peanut leaf spot. Proceedings Soil and Crop Science Society of Florida 57:8791. Woodroff N. 1933. Two leafspots of the peanut ( Arachis hypogeae L.) Phytopathology 23:627640.

PAGE 139

139 Wright D., Tillman B., Jowers E., Marois J., Ferrel l J. Katsvairo T., Whitty E. 2009. Management and Cultural Practices for Peanuts, IFAS Extenson EDIS, University of Florida, Gainesville, FL. Wu L., Dam icone J., Duthie J., Melouk H. 1999. E f fects of temperature and wetness durtion on infection of peanut cultivars by Cercospora arachidicola. Phytopathology 89:653 659. Yang H., Singsit C., Wang A., Gonsalves D., Ozias Akins P. 1998. Transgenic peanut plants containing a nucleocapsid protein gene of tomato spotted wilt virus show divergent levels of gene expression. Plant Cell Reports 17:693699. Yang H.Y., Nairn J., Ozias Akins P. 2003. Transformation of peanut using a modified bacterial mercuric ion reductase gene driven by an actin promoter from Arabidopsis thaliana Journal of Plant Physiology 160:945952. Yin D.M., Deng S.Z ., Zhan K.H., Cui D.Q. 2007. High oleic peanut oils produced by HpRNA mediated gene silencing of oleate desaturase. Plant Molecular Biology Reporter 25:154163. Zhang, P ., Wang, W ., Zhang, G., Kaminek, G M ., Dobrev, P ., Xu, J ., Gru issem, W 2010. SenescenceInducible Expression of Isopentenyl Transferase Extends Leaf Life, Increases Drought Stress Resistance and Alters Cytokinin Metabolism in Cassava Journal of Integrative Plant Biology, online. Zhang S., Reddy M.S., Kokalis Burell e N., Wells L.W., Nigh tengale S.P., Kloepper J.W. 2001. Lack of induced systemic resistance in peanut to late leaf spot disease by plant growthpromoting rhizobacteria and chemical elicitors. Plant Disease 85:879884.

PAGE 140

140 BIOGRAPHICAL SKETCH Scott Burns was born in 1983 in Marietta Georgia to Mike and Neva Burns. Scott attended elementary, middle, and high school in his hometown, Canton, Georgia. Scott graduated from Cherokee High School in 2002. Upon completing high school Scott enrolled at the University of Georgia. H e graduated from UGA in 2006 with a Bachelor of Science degree in applied biotechnology. While working as an undergraduate research assistant at UGA Scott developed an interest in using genetic approaches to improve agricultural performance i n agronomic crops. Upon completion of his undergraduate degree, Scott took an internship position managing a production greenhouse for the Walt Disney Company in Orlando, Florida. After completing his internship, Scott enrolled in at the University of Flor ida in 2007, serving as a graduate assistant in the Agronomy Department. Scott will earn a Master of Science in a gronomy from UF in 2010. His m asters degree research focused on using genetic strategies to develop novel sources of tolerance to peanut leaf spot disease.