<%BANNER%>

Microbiological Survey for Methicillin-Resistant Staphylococcus Aureus in Veterinary Patients and Genotypic Characteriza...

Permanent Link: http://ufdc.ufl.edu/UFE0042243/00001

Material Information

Title: Microbiological Survey for Methicillin-Resistant Staphylococcus Aureus in Veterinary Patients and Genotypic Characterization of the Isolates
Physical Description: 1 online resource (76 p.)
Language: english
Creator: Maldonado, Katherine
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: cat, dog, horse, mrsa, usa300, veterinary
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: A convenience sampling was performed at 3 secondary and tertiary care veterinary facilities in Florida to determine the prevalence of methicillin-resistant Staphylococcus aureus (MRSA) nasal colonization in the canine, feline, and equine pet populations. Nasal swabs were collected and processed following standard microbiological techniques. Full antibiograms were performed to confirm antibiotic resistance and pulsed-field gel electrophoretic (PFGE) characterization was used to determine the strain. Each MRSA isolate was matched to 2 methicillin-sensitive S. aureus (MSSA) and PCR was performed to identify virulence factors. Positive isolates were submitted for sequencing and the sequences were aligned. The overall prevalence was low as only 6 isolates were determined to be MRSA of 966 patients sampled; 4 of these were the community-acquired USA300 strain based on PFGE. The recovered MRSA isolates demonstrated multi-drug resistance. The 5 genes tested were present in all 4 USA300 and in 1 MSSA. Another MSSA had 4 of 5 genes. The nontypeable MRSA and the remaining MSSA only had 2 genes present. Though of low prevalence, 4 of the MRSA isolates obtained were USA300 clones and carried similar virulence factors to the strains circulating in the human population. This finding is of particular concern given the potential threat this strain poses to people.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Katherine Maldonado.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Long, Maureen T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042243:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042243/00001

Material Information

Title: Microbiological Survey for Methicillin-Resistant Staphylococcus Aureus in Veterinary Patients and Genotypic Characterization of the Isolates
Physical Description: 1 online resource (76 p.)
Language: english
Creator: Maldonado, Katherine
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: cat, dog, horse, mrsa, usa300, veterinary
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: A convenience sampling was performed at 3 secondary and tertiary care veterinary facilities in Florida to determine the prevalence of methicillin-resistant Staphylococcus aureus (MRSA) nasal colonization in the canine, feline, and equine pet populations. Nasal swabs were collected and processed following standard microbiological techniques. Full antibiograms were performed to confirm antibiotic resistance and pulsed-field gel electrophoretic (PFGE) characterization was used to determine the strain. Each MRSA isolate was matched to 2 methicillin-sensitive S. aureus (MSSA) and PCR was performed to identify virulence factors. Positive isolates were submitted for sequencing and the sequences were aligned. The overall prevalence was low as only 6 isolates were determined to be MRSA of 966 patients sampled; 4 of these were the community-acquired USA300 strain based on PFGE. The recovered MRSA isolates demonstrated multi-drug resistance. The 5 genes tested were present in all 4 USA300 and in 1 MSSA. Another MSSA had 4 of 5 genes. The nontypeable MRSA and the remaining MSSA only had 2 genes present. Though of low prevalence, 4 of the MRSA isolates obtained were USA300 clones and carried similar virulence factors to the strains circulating in the human population. This finding is of particular concern given the potential threat this strain poses to people.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Katherine Maldonado.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Long, Maureen T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042243:00001


This item has the following downloads:


Full Text





MICROBIOLOGICAL SURVEY FOR METHICILLIN-RESISTANT
STAPHYLOCOCCUS AUREUS IN VETERINARY PATIENTS AND GENOTYPIC
CHARACTERIZATION OF THE ISOLATES


















By

KATHERINE LYNN MALDONADO


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2010



























2010 Katherine Lynn Maldonado




























To my parents who taught me to follow my dreams and imbued me with an eternal
curiosity and appreciation for life.









ACKNOWLEDGMENTS

This work would not have been possible without assistance, guidance, and

support from many. However, Dr. Maureen Long is due special thanks for her vision,

support, and mentoring. Without her, none of this would ever have happened and I

thank her for her constant belief in me. I also thank my other committee members, Dr.

Judith Johnson and Dr. Charles Courtney for their valuable insight and help in the

preparation of this manuscript and project. To my lab mate, Dr. Melissa Bourgeois

without whom I would never have completed this work, I am especially thankful and

forever indebted. Dr. Paul Gibbs has been a wonderful sounding board and friend and is

due special thanks. I appreciate the help of Crystal Schuman and the members of the

College of Veterinary Medicine's Microbiology Laboratory for their assistance in

teaching me techniques and offering technical assistance in bacterial culturing. Dr. Paul

Fiorella of the Florida Department of Health Bureau of Laboratories was instrumental in

typing the strains. Amber Menendez, Shannon Roff, Carmen-Susan Glotfelty, and An

Nguyen were all involved in various aspects of the project and their assistance is highly

appreciated. I also thank the members of the EDART lab in which the majority of this

work was carried out for their support and assistance. The staff members of the College

of Veterinary Medicine's Veterinary Medical Center, All Cats HealthCare Clinic, and

Equine Medical Center of Ocala were key in helping me obtain the samples used in this

work and deserve my sincerest thanks. Lastly, I thank my family and friends for their

constant support, love, and patience while undertaking this project I know it was not

always easy.









TABLE OF CONTENTS

page

ACKNOW LEDGMENTS ............................ .................................... 4

LIST OF TABLES ............... ............................... ................... ......... 7

LIST O F F IG U R E S .................................................... 8

LIST OF ABBREVIATIONS...................... .......... ................ ......... 9

ABSTRACT ............... .................................... ....... ..... ...... ......... 11

CHAPTER

1 LITERATURE REVIEW .................................................. 13

General Overview of Staphylococcus ............................. ........ 13
Pathogenicity of Staphylococcus aureus .............. ......... .............. ........ 14
Bacterial Virulence Factors..... ................ .................... 14
History of Antibiotic Resistance .................... ........... ... .... .. .... .. ......... 21
Hospital-Acquired Versus Community-Associated MRSA .......................... 23
Epidem biology of M R SA ............................................................. .... ................ 23
Molecular Epidemiology and Virulence of CA-MRSA ...................................... 27
M R S A in A nim a ls .................................................................................... 32

2 MICROBIOLOGICAL SURVEY AND NASAL COLONIZATION RATE
DETERMINATION OF METHICILLIN-RESISTANT STAPHYLOCOCCUS
AUREUS IN PATIENTS AT THREE SECONDARY/TERTIARY VETERINARY
CA R E FA C ILITIES IN FLO R IDA.................................................. 38

B ackg round .............................. .............. ...... 38
M methods ........................................ .............. .................... ......... 41
Animal Sampling ...... ...................... .......... ........ 41
Microbiological Testing .................................. ..... ............... 42
MIC Analysis of MRSA and MSSA Isolates............................... .............. 43
Pulsed Field Gel Electrophoresis ............ ......... .......... ........... 43
R e s u lts ......................4.. ...................... 4 4
M icrobiological R results ........................ ........ ........ .. .. ........................... 44
A ntib iotic R e sista nce ........................ ................. ............... .. ............. 4 5
Pulsed-Field Gel Electrophoresis ............ ... ...... .......... ............ 45
Discussion .............. .. ......... ..... ........................ 46

3 GENOTYPIC CHARACTERIZATION AND SEQUENCING OF THE MRSA
ISOLATES .............. .. ......... ..... ........................ 52

B ackg round .............................. .............. ...... 52









Materials and Methods........................................... ............... 54
S. aureus Isolates............................... ............... 54
Microbiological Techniques .. .. ............................... ............... 54
DNA Isolation and PCR ....................... ....................... .................... 55
Results ................ ...... ............ ............................... 57
D is c u s s io n .............. ..... ............ ................. ............................................. 5 8

4 CONCLUSIONS ................ ......... ........ ..... ......... 63

LIST OF REFERENCES ......................... ......... ......... 66

BIOGRAPHICAL SKETCH ................ ........ ................. 76








































6









LIST OF TABLES


Table page

1-1 CDC case definition for community-associated MRSA ........ ............ ...... ........... 37

2-1 Number of species swabbed, number of samples processed, and resulting
prevalence rates of MRSA in dog, cat, and horses patients of 3 secondary
and tertiary care facilities in North-Central Florida ..... ......... .... ............... 49

2-2 Overall antibiotic class resistance between MRSA isolates and the MSSA
control isolates obtained from dog, cat, and horse patients of 3 secondary and
tertiary care facilities in North-Central Florida........ ..... .. ... ... ............... 49

3-1 Date of collection for case (MRSA) and control (MSSA) isolates, the number of
days difference between the collection dates, and the species of origin............... 61

3-2 Primer sequences used for PCR analysis...... ................. ................. 61

3-3 Results of PCR analysis for all five genes in every MRSA case and its
corresponding tw o M SSA control isolates.................................... ..................... 62









LIST OF FIGURES


Figure page

2-1 Dendogram showing the relatedness of the 6 MRSA isolates obtained from dog,
cat, and horse patients of 3 secondary and tertiary care facilities in North-
Central Florida as compared to commonly circulating USA300 strains. Source
species is listed. Scale bar indicates genetic relatedness............... .......... 50

2-2 Antibiograms obtained from 6 MRSA isolates from dog, cat, and horse patients
of 3 secondary and tertiary care facilities in North-Central Florida............ ......... 51











ACME

ATCC

BA

bp

CA-MRSA

CC

CHIPS

CI

CNA

DEPC

DNA

HA-MRSA

J

MIC

MLST

MRSA

MRSI

MSSA

OR

PBP/PBP2a/PBP2'

PCR

PFGE

PFT

PMN


LIST OF ABBREVIATIONS

arginine catabolic mobile element

American type culture collection

blood agar

base pair

community-associated methicillin-resistant Staphylococcus aureus

clonal complex

chemotaxis inhibitory protein of staphylococci

confidence interval

colistin and nalidixic acid

diethylpyrocarbonate

deoxyribonucleic acid

hospital-acquired methicillin-resistant Staphylococcus aureus

junkyard region of the SCCmec

minimum inhibitory concentration

multilocus sequence typing

Methicillin-resistant Staphylococcus aureus

methicillin-resistant Staphylococcus intermedius

Methicillin-sensitive Staphylococcus aureus

odds ratio

penicillin binding protein

polymerase chain reaction

pulsed-field gel electrophoresis

pulsed-field type

polymorphonuclear cell









PSM phenol soluble modulin

PVL Panton-Valentine leukocidin

SCC staphylococcal chromosomal cassette

SE staphylococcal enterotoxin

SP sampling period

ST strain type

TSST toxic shock syndrome toxin









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

MICROBIOLOGICAL SURVEY FOR METHICILLIN-RESISTANT STAPHYLOCOCCUS
AUREUS IN VETERINARY PATIENTS AND GENOTYPIC CHARACTERIZATION OF
THE ISOLATES

By

Katherine Lynn Maldonado

August 2010

Chair: Maureen T. Long
Major: Veterinary Medical Sciences

A convenience sampling was performed at 3 secondary and tertiary care

veterinary facilities in Florida to determine the prevalence of methicillin-resistant

Staphylococcus aureus (MRSA) nasal colonization in the canine, feline, and equine pet

populations. Nasal swabs were collected and processed following standard

microbiological techniques. Full antibiograms were performed to confirm antibiotic

resistance and pulsed-field gel electrophoretic (PFGE) characterization was used to

determine the strain. Each MRSA isolate was matched to 2 methicillin-sensitive S.

aureus (MSSA) and PCR was performed to identify virulence factors. Positive isolates

were submitted for sequencing and the sequences were aligned. The overall prevalence

was low as only 6 isolates were determined to be MRSA of 966 patients sampled; 4 of

these were the community-acquired USA300 strain based on PFGE. The recovered

MRSA isolates demonstrated multi-drug resistance. The 5 genes tested were present in

all 4 USA300 and in 1 MSSA. Another MSSA had 4 of 5 genes. The nontypeable MRSA

and the remaining MSSA only had 2 genes present. Though of low prevalence, 4 of the

MRSA isolates obtained were USA300 clones and carried similar virulence factors to









the strains circulating in the human population. This finding is of particular concern

given the potential threat this strain poses to people.









CHAPTER 1
LITERATURE REVIEW

General Overview of Staphylococcus

Staphylococcus species are ubiquitous non-motile, non-spore-forming Gram

positive cocci bacteria that produce catalase which grow principally as facultative

anaerobes. Taxonomically, the Staphylococcus genus falls under the phylum

Firmicutes, class Bacilli, Bacillales order, and Staphylococcaceae family. Members of

this genus are characterized by being round, typically 1pm in diameter and can be

found as single cells, pairs, or tetrads though they are prone to clumping into bunches

(1, 2), giving rise to the cocci designation, a name derived from the Greek k6kkus which

means grain, seed, or berry (3). Phenotypically, the staphylococci are usually further

classified according to the presence of the active coagulase enzymes which induces

rabbit plasma to clot.

Staphylococci are found on the skin and on the mucous membranes of humans

and animals; many strains are host specific and may or may not cause disease in the

host. Commensal bacteria colonize the skin, filling an environmental niche and helping

to protect the host from colonization by pathogenic bacteria by competing for nutrients

and preventing the adherence of pathogenic bacteria (4, 5). They can also directly deter

pathogenic bacteria by excreting toxic metabolites which make the local environment

untenable to other bacteria (4). In humans, commensal staphylococci are generally

coagulase-negative species with S. epidermidis and S. hominis being the most

commonly identified.

Phenotypically, S. aureus itself is coagulase-positive and causes a double-zone

of hemolysis on blood agar. Though coagulase-positive species are more frequently









pathogenic than coagulase-negative species, S. aureus can also be a normal

commensal species of humans. A national study performed in 2000-2001 estimated the

weighted S. aureus colonization prevalence to be 32.4% (95% CI, 30-7%-34.1%) or

89.4 million people (95% CI, 84.8-94.1 million people) in the USA with the highest

prevalence seen in 6-11 year olds (6). A second prevalence study performed in 2003-

2004 found that the rate of S. aureus colonization had decreased to a weighted

prevalence of 28.6% (95% CI, 27.2%-30.0%), or 78.9 million people (95% CI, 75.0-82.9

million people) (7). Though these studies measured colonization at a single time point,

some of those identified as colonized may only have been transiently populated with the

organism. However, other studies have shown that colonization by S. aureus is a risk

factor for developing subsequent opportunistic infection (8).

Staphylococcus aureus has evidence of antibiotic resistance. While investigating

the rate of methicillin-resistant S. aureus (MRSA) nasal colonization in people in the

USA, the authors of the study determined that the prevalence in 2003-2004 was 1.5%

(95% Cl 1.2%-1.8%), up from 0.8% (95% Cl 0.5%-1.4%) in 2001-2002 (6, 7). As

researchers have demonstrated that persons nasally colonized by MRSA have an

increased risk of developing subsequent clinical conditions (8, 9) versus those colonized

by methicillin-sensitive S. aureus (MSSA) or not colonized at all (10), the risk to the

public cannot be discounted.

Pathogenicity of Staphylococcus aureus

Bacterial Virulence Factors

Several known and likely many still unknown features of S. aureus account for the

tendency of this commensal to become an opportunistic infection of humans, causing

as many as 50% of all nosocomial infections (11). Although sensitive to ultraviolet light









and drying, this bacterium can survive in organic debris and adapt. The bacteria's

pathogenicity is determined by various virulence factors, the expression of which varies

between various Staphyloccocci and can be chromosomally or plasmid encoded. The

mobility of many of these elements allows rapid adaptation to a variety of host

environments.

To avoid being ingested by the host's polymorphonuclear cells (PMN) during the

immune response, some S. aureus strains produce capsular polysaccharides. These

exopolysaccharides have been classified into 11 types though most pathogenic strains

are of capsular serotype 5 or 8 (12, 13). The predominant serotype seen in strains

demonstrating antibiotic resistance against the beta-lactamase class is serotype 5 (14).

The presence of the capsule reduces the uptake of the bacteria by PMNs in the

presence of opsonins (15).

Protein A is another cell wall and surface protein of S. aureus that binds the Fc

region of the heavy chain of IgG. This protein causes coating of the bacterium with

immumoglobulins in the incorrect orientation which interferes with opsonization

preventing ingestion by the PMNs (15). Protein A is immunogenic and forms the basis

of various rapid diagnostic tests in clinical laboratories testing for co-agglutination of

other bacteria, such as Streptococcus.

The peptidoglycans and techoic acids of the S. aureus cell wall serve a structural

role providing rigidity but also contribute to virulence by instigating a chemotactic

response by the host's PMNs and production of opsonic antibodies. However, about

60% of S. aureus strains secrete chemotaxis inhibitory protein of staphylococci (CHPS)

to inhibit PMNs chemotaxis and counter this innate defense system (15). Techoic acids









help promote adherence of gram-positive bacteria to mucosal surfaces. Additional

proteins that help the bacterium invade host-tissues such as adhesins, collagen-binding

proteins, fibronectin-binding protein, and clumping factor are covalently bound to the

peptidoglycan matrix of bacterium's cell wall, further increasing its virulence (1). These

surface proteins help promote cell invasion (2).

In addition to structural proteins, S. aureus secretes many enzymes to assist in

evasion of host immune responses or assume a niche in host cell tissue. Used also for

diagnostic purposes, catalase production counters the free radicals formed by the

myeloperoxidase system secreted by PMNs extracelluarly or when it is phagocytized.

This interaction creates local inflammation by inducing cytokines (16). Though clumping

factor is bound to the peptidoglycan of the cell wall as noted before, it enables the

bacteria to bind to fibrin and fibrinogen which then allows fibrinolysins to break down the

fibrin and enable spread to surrounding tissues. Hyaluronidase functions similarly to

fibrinolysins by hydrolyzing the matrix of nearby tissues and thereby allowing local

bacterial spread. Coagulase also interacts with fibrinogen following the interaction with

prothrombin, it activates the conversion of fibrinogen to fibrin which then coats the

bacteria and inhibits opsonization (1).

Another set of virulence factors seen in S. aureus is the hemolysins. Alpha-

hemolysin, encoded by h/a, has lethal effects on various cell types and can lyse

erythrocytes of various species as well as human PMN cells. The toxin creates pores in

the target cell, which disrupts the ion flow, causing osmotic swelling and rupture (17,

18). Diagnostically, this toxin creates the zone of hemolysis around colonies on sheep

blood agar. Unlike alpha-hemolysin, beta-hemolysin is not dermonecrotic nor fatal to









animals when injected intravenously but appears to confer some selective advantage

(18). Gamma-hemolysin and Panton-Valentine leukocidin (PVL) are two-component

toxins, meaning that each is made up of two unassociated protein components that then

assemble into one of six possible forms. Gamma-hemolysins are found in most strains

of S. aureus and their virulence has not been fully characterized (18). In contrast, the

LukPV operon is found only in some S. aureus strains, encoded on the prophage

OSA2usa. The operon encodes the two components, lukS-PV and lukF-PV of the

Panton-Valentine leukocidin (PVL) (19, 20), an exotoxin implicated in causing PMN cell

lysis via disruption of the osmotic gradient through pore-formation (1, 21). A large

percentage of S. aureus strains also create delta-hemolysin, a toxin proposed to act as

a surfactant, disrupting cell membranes allowing for cell lysis (18).

Generally associated with a particular strain of S. aureus which will be discussed

in detail later, genome analysis of USA300 has identified a genetic island which

contains a cluster of six genes known as the arc cluster. These genes allow for the

conversion of L-arginine to carbon dioxide, ammonia, and ATP via arginine deiminase

pathway (19). Two genes identified within the arginine catabolic mobile element (ACME)

may enhance virulence: arc and opp3. The arc gene encodes for an arginine deiminase

pathway which depletes L-arginine used in the production of nitric oxide, a molecule

used in both innate and adaptive immune responses against bacteria. The opp3 cluster

encodes for an oligopeptide permease system, a transporter important to nutrient

uptake, chemotaxis, quorum sensing, antimicrobial peptide resistance, and eukaryotic

cell adhesion, among others (20). The two clusters serve as surrogate markers for

ACME (19). The arginine deiminase pathway has been identified in the core genome of









S. aureus but it is not identical to the ACME found in USA300, where it is located

downstream of the SCCmec in the orfX site (19). It is believed that the presence of

redundant arginine catabolism pathways in this strain improve the strain's fitness since

arginine has been proven critical for survival in anaerobic conditions (22). ACME has

been shown to confer a bacterial advantage in a rabbit bacteremia model (23) though it

did not cause dermonecrosis or increased severity of necrotizing pneumonia in a rat

model (24).

More recently, bioactive peptides called phenol-soluble modulins (PSM) have

been proposed as a principal virulence factor in S. aureus. Though still being

investigated, S. aureus produces four shorter and two longer PSM-like peptides, alpha-

PSM and beta-PSM respectively. It is proposed that these peptides are

proinflammatory, thereby triggering an inflammatory response (25).

Certain strains of this species have also been shown to possess a variety of genes

that allow it to produce exotoxins, which may persist and damage the host even if the

bacteria are eliminated. The diseases associated with these exotoxins are primarily

those associated with food-borne illness. Typically, S. aureus grows when refrigeration

fails or processing requires growth-permissive temperatures as is the case in cheese-

making (26). During bacterial growth, the enterotoxins are elaborated. If the foodstuff in

which the bacteria are present is ingested, these enterotoxins can then cause

inflammation of the lining of the stomach and intestinal tract. The result of this

inflammation is gastroenteritis, generally manifesting itself with abdominal cramps,

nausea, vomiting, and diarrhea (27). Although there are dissimilarities between these









proteins, the majority of the SEs have some shared amino acid sequences, particularly

a cystine loop that is believed to play a role in causing emesis (26).

Foods that are commonly associated with staphylococcal foodborne illness include

meat and meat products; poultry and egg products; milk and dairy products; salads

such as egg, tuna, chicken, potato or macaroni; and several types of pastries, especially

ones with cream fillings (28).

At least 20 different staphylococcal enterotoxins (SEs) have been identified. They

are encoded on genes mostly located on mobile elements that allow the transfer of

enterotoxin production ability between strains. However, some isolates carrying the seb

enterotoxin have the SE gene integrated in the bacterium's chromosomal DNA while

others have a mobile plasmid containing the gene (26). Once produced, these SEs are

highly stable and resist heat and proteolytic degradation. The high heat processing used

in sterilization will inactivate most SEs if these are present in low numbers. However,

some of the SEs may retain function, depending on the foodstuff being treated and the

environmental pH. Staphylococcus aureus enterotoxins can also be superantigens such

as TSST which is associated with toxic shock syndrome (29).The superantigen capacity

of these SEs is due to their ability to cause fever and non-specific T-cell activation.

Rather than establishing an adaptive immune response, the enterotoxin T-cell

stimulation results in a massive cascade of cytokines and inflammatory mediators which

gives rise to the symptoms associated with foodborne illness. The clinical signs of

abdominal cramps, vomiting, and diarrhea are thought to be associated with the direct

effect of this cytokine release on the gastrointestinal epithelium. It may also stimulate

the vagus nerve which may subsequently stimulate the central emetic center









chemoreceptorr trigger zone) and result in vomiting (26, 30). The cystine loop that is

common to most of the SEs appears to play a role in stimulating the emetic center, as

the SEs that lack the cystine loop based on mutant analyses have absent or reduced

emetic capacity (26). Because enterotoxins activate T-cells and the subsequent

cytokine cascade, symptoms of staphylococcal foodborne illness normally appear within

30 minutes to eight hours, depending on the infective dose of bacterial SEs consumed

in the infected foodstuff. The disease, therefore, has an acute onset but symptoms are

typically self-limiting and resolve spontaneously within 24 to 48 hours (26). Colonized

food handlers, processors, and preparers could contaminate food and be the source of

an outbreak. The presence of S. aureus in animals may also lead to the elaboration

enterotoxins and start an outbreak in that fashion. Both populations can also have

enterotoxin producing MRSA which would further complicate the issue.

Non-enterotoxin superantigens have been identified in staphylococci, which, unlike

the enterotoxins, cause much greater systemic effects due to the body's more

widespread response. Categorized as a pyrogenic superantigen toxin, toxic shock

syndrome toxin-1 (TSST-1) shares three biologic characteristics with other superantigen

in its class: pyrogenicity, superantigenicity, and the ability to enhance the lethal effects

of minute amounts of endotoxin in rabbits up to 100,000 fold (1). The superantigen

capacity of TSST-1 involves the nonspecific activation of T-cells and subsequent

polyclonal T-cell proliferation and cytokine cascade. The resulting illness is a multiorgan

dysfunction syndrome involving fever, hypotension, and a rash accompanied by a

variety of other clinical symptoms dictated by the organ system involved, though









commonly gastrointestinal, renal, and hepatic signs are noted. Given the body's

overwhelming immunologic response, TSST-1 can lead to death from multiorgan failure.

History of Antibiotic Resistance

Medical advances in therapeutics have continuously sought to overcome the

bacteria's incursions. Prior to the development of antibiotics, little could be done against

this and other bacteria. But the addition of penicillin to the clinical formulary in 1940

revolutionized medical management of infectious bacterial diseases (31, 32). Penicillin

and members of the beta-lactam antibiotic class are bacteriocidal as they target the

bacterial enzymes involved in cell wall biosynthesis, known as the penicillin binding

proteins (PBP), thereby preventing cross-linking of the peptidoglycans in the bacterial

cell wall and inhibiting cell growth (1, 33). S. aureus soon adapted to the new

environmental pressure with some strains developing resistance to the beta-lactam

antibiotic within a year (34, 35). These resistant strains produced penicillinases (also

known as beta-lactamases) that attacked the penicillin's four-membered beta-lactam

ring structure by disrupting the amide bond of the ring and inactivating the antibiotic (33,

36). These plasmid-encoded penicillin-resistant strains soon became widespread and

comprise the first wave of antibiotic resistance in the hospital setting, necessitating a

new therapeutic option (36).

A new line of antibiotics, fortified against the beta-lactamases produced by the

bacterium were developed to target these newly resistant strains. Methicillin, a beta-

lactamase-resistant antibiotic was first used in 1959 and demonstrated efficacy in

inhibiting cell wall synthesis by bacteria despite the presence of beta-lactamases.

However reports of resistance to methicillin and members of its class surfaced by 1961,

denoting the start of the second wave of antibiotic resistance (36, 37). These resistant









strains expressed an altered penicillin-binding protein designated PBP2a (or in some

studies PBP2'), which is a transpeptidase that carries on cell wall synthesis despite the

presence of beta-lactam antibiotics. Resistance is conferred upon the bacteria by the

PBP2a protein's decreased affinity for binding the beta-lactam molecule (33, 38).

Though methicillin is no longer clinically used, S. aureus strains that exhibit resistance

to the beta-lactamase antibiotic class are known as methicillin-resistant S. aureus

(MRSA). To meet this classification, a MRSA strain must demonstrate a minimum

inhibitory concentration (MIC) of oxacillin (a laboratory standard for the beta-lactamase

class) 24pg/mL. Alternatively, a zone of inhibition <10mm around an oxacillin-

impregnated disk would be considered resistant when performing a disk diffusion test

(39).

Resistance to methicillin and the other beta-lactamases in S. aureus followed the

acquisition of the mecA gene. The original source of the resistance gene is presumed to

be a coagulase-negative staphylococci and studies have identified S. sciuri as the likely

donor: a DNA probe for the MRSA mecA hybridized strongly to unrelated S. sciuri

isolates. Interestingly, despite the presence of the gene, two-thirds of the S. sciuri

isolates showed marginal if any resistance to methicillin (40).

The mecA gene is embedded in a chromosomal island known as the

staphylococcal chromosomal cassette (SCCmec) that integrates into the S. aureus

chromosome at the orfX site (19). Several classes of SCCmec have been identified and

have been linked to the documented epidemic waves of resistance (36). Three major

classes have been defined: class A includes the entire mecA regulon (mecl-mecR1-

mecA) while classes B and C contain the regulon but the order is interrupted by









insertion sequences (41). The SCCmec's ability to move between isolates as well as

between species is due to the presence of recombinases encoded by the ccr gene

complexes present on the cassette. The size of the SCCmec cassette is believed to

impact its ability to transfer between isolates since the size depends on the number of

additional resistance genes encoded in the junkyard (J) regions (36, 41). The presence

of these additional resistance genes are used to classify the SCCmec subtype but also

mean that a sensitive strain can become multidrug resistant if it obtains the entire

cassette in a single horizontal gene transfer event (42). However, resistance to other

antibiotics is not necessarily dependent upon acquisition of the SCC. Spontaneous

mutations and positive selection have resulted in resistance to additional antibiotics and

antibiotic classes such as the fluoroquinolones and linezolid (42). Methicillin resistance

has also been demonstrated to occur via mecA-independent mechanisms, principally by

overproduction of other PBPs or hyperproduction of beta-lactamases (33, 38, 43).

It stands to reason, therefore, that the presence of antibiotic resistance limits the

clinician's ability to prescribe pharmacological agents that will curb the spread of the

bacteria. Combine this with the presence of other virulence factors identified in S.

aureus, and it is evident that the bacterium poses a threat to the wellbeing of people

and animals.

Hospital-Acquired Versus Community-Associated MRSA

Epidemiology of MRSA

Following the first reports of resistance in 1961 (37), MRSA has been a constant

hindrance and potential threat to the hospitalized patient. The bacterium has a

predilection for catheter sites, in-dwelling devices, and surgical incisions; hospital-









acquired MRSA (HA-MRSA) has historically been a nosocomial infection of concern, but

the risk has increased in recent years.

A study by Panlilio et al. found that nosocomial MRSA infections increased from

2.4% in 1975 to 29% in 1991. The number of beds in a facility impacted the rate of

infection, with larger institutions demonstrating a faster climb in the number of resistant

cases (44). In 2003, >60% of all isolates obtained from all adult patients in intensive

care units were MRSA, which translates into a 3.1% annual increase from 1992 to 2003

(45).

A retrospective survey of the National Hospital Discharge Survey looking at S.

aureus-related hospitalizations and deaths between 1999-2005 found that though

annual admissions increased ~8% during those years, the number of S. aureus related

hospitalizations increased 62% over the same time period, from 294,570 (95% CI

257,304-331,836) to 477,927 (95% CI 421,665-534,189). Strikingly, the estimated

number of MRSA-related hospitalizations more than doubled in the same time period,

from 127,036 (95% CI 112,356-141,716) to 278,203 (95% CI 252,788-303,619). The

resulting overall rate of S. aureus-related diagnoses per 1,000 hospitalizations

increased 50% from 9.17 to 13.79 while MRSA-related discharges per 1,000

hospitalizations more than doubled, from 3.95 to 8.02. In their study, the authors

estimated that S. aureus-related deaths averaged ~10,800 (range 7,440-13,676) per

year but that MRSA-related deaths averaged -5,500 per year (range 3,8909-7,372)

(46). In another study, the authors used the Active Bacterial Core surveillance system to

identify MRSA cases in a subset of the national population and extrapolated the findings

to the national scale. They estimated that 94,360 invasive MRSA infections occurred









nationwide resulting in 18,650 deaths in 2005 (47). The estimated number of MRSA-

related deaths was 3.3 times higher in the latter study as compared to the first.

However, the second study may have introduced bias into the sample by oversampling

minorities and the elderly as both were found to have increased incidence and mortality

(47).

In part, the increased rate of morbidity and mortality can be attributed to the

increased antibiotic pressure these strains encountered with the advancement of

therapeutics (43). These hospital-acquired strains developed a characteristic pattern of

multi-drug resistance, because methicillin-resistance imparts resistance against the

entire beta-lactam class, including the cephalosporins. Resistance to erythromycin,

levofloxacin, and constitutive clindamycin resistance is also commonly found in these

strains (48). Nosocomial transfer occurs among hospitalized patients, likely by means of

fomite transfer via colonized staff or equipment.

Over the past 20 years, newer strains have been noted with increasing frequency.

Initially labeled community-associated because patients diagnosed with these MRSA

strains lacked traditional risk factors (49), these strains were thought to be escaped

hospital strains that had circulated in the general population. Without antibiotic pressure,

these strains had retained their resistance against penicillins but tended not to be multi-

drug resistant. Community-associated MRSA patients tended to present to emergency

rooms with skin and soft tissue complaints (50), commonly complaining of a spider bite.

The characteristics that define these community-associated MRSA (CA-MRSA) and

separate them from the traditional HA-MRSA are listed in Table 1.1









The emergence of MRSA in a population not previously considered at risk was,

and continues to be, concerning. Though reports of isolations from indigenous

populations in Australia cropped up in the early 1990s (36), the CA-MRSA strains first

came to the forefront in the USA when the University of Chicago Children's Hospital

reported on the increased prevalence of MRSA in patients with no previous

predisposing risk factors. In their retrospective study, the authors looked at S. aureus

isolates obtained from hospitalized children in 1988-1990 and then compared these to

isolates from 1993-1995 and found that the number of hospitalizations from CA-MRSA

rose and that the prevalence increased from 10 per 100,000 admissions to 259 per

100,000 admissions (51). However, concern was heightened when the CDC reported

the death of four previously healthy children in the Midwest due to respiratory failure or

secondary to multi-organ dysfunction caused by MRSA infection; none of the children

had any risk factors for the development of traditional HA-MRSA (52).

Following the initial reports, CA-MRSA strains were reported in inmates (53),

military recruits (54, 55), athletes (56), minority populations (47), men who have sex

with men (57), and in poor urban adults (50). In a short amount of time, the frequency of

outbreaks involving CA-MRSA increased dramatically. CA-MRSAs have become so

prevalent, that though 59% of all skin and soft tissue infections presenting to 11

emergency departments nationwide were MRSA, 99% of these were community-

associated strains (50). Given this rate of spread, it was not long before reports of CA-

MRSA in the hospital setting followed, making the original definition for CA-MRSA

strains debatable; in some cases the traditional HA-MRSA strains have been displaced









by CA-MRSA as the predominant nosocomial infection (58), making the naming

nomenclature outdated (59, 60).

Molecular Epidemiology and Virulence of CA-MRSA

Genetic analysis of MRSA strains has been carried out utilizing a variety of

methods such as multilocus sequence typing (MLST), pulsed-field gel electrophoresis

(PFGE), and spa typing (61) to better understand this spread. MLST has been used to

study the evolution of the bacteria by performing sequence analysis on ~450bp internal

fragments of seven housekeeping genes. Identical sequences are considered to be

clones and are assigned to a sequence type (ST). If strains differ by less than three

single nucleotide polymorphisms, they are grouped into clonal complexes (CC) (36, 48).

PFGE of MRSA strains, alongside epidemiological research, was used to create a

national database of HA- and CA-MRSA strains due to the availability of technical

knowledge and experience with the technique in laboratories nationwide. In creating the

database, Smal macrorestriction fragment analysis was used to identify several pulsed-

field types (PFT). The HA-MRSA strains had PFTs USA100, 200, 500, 600, and 800.

USA700 strains were both HA- and CA-MRSA while CA-MRSA strains were either

USA300 or 400 (48). Additional PFT have been identified. The original CA-MRSA

circulating in the Midwest, named MW2, was designated a USA400 strain. This strain

has largely been displaced by the USA300 strain, the dominant CA-MRSA strain seen

today. Using MLST nomenclature, USA300 is categorized as sequence type 8, clonal

complex 8 (62).

Much of the recent scientific effort has been directed at USA300 strains, looking to

understand the bacteria's remarkable spread and apparent increased virulence. A

frequent cause of skin and soft tissue infections, a study by Johnson et al.









demonstrated ~4 fold increase in the incidence of primarily skin and soft tissue

infections over the course of five years attributed to USA300 (63). USA300 has also

been implicated as the cause of fulminant necrotizing pneumonias (21) and other

invasive conditions such as osteomyelitis, bacteremia, and septic arthritis (64).

Numerous studies have shown that the USA300 strain harbors a SCCmeclV. As noted

previously, these cassettes vary in size depending on the presence of additional

resistance genes and the meclV is the smallest cassette (21-25kb) and does not harbor

any additional virulence genes. In one study, CA-MRSA strains harboring the

SCCmeclV grew faster than HA-MRSA carrying different SCCmec allotypes (65). The

authors suggest that this may have allowed the CA-MRSA strains to outcompete other

bacteria in the absence of antibiotic pressure and that this may offset the fitness cost

that a larger SCCmec may impart on the HA-MRSA strains that carry them (65).

The rise of CA-MRSA infections, particularly those caused by the USA300 strain,

has also been epidemiologically correlated with the rise in the number of strains

containing PVL (48, 52, 56). However, conflicting results have been obtained evaluating

the impact of PVL on USA300's virulence. A study by Lina et al. implicated the presence

of PVL with S. aureus derived skin infections and community-acquired pneumonia,

noting that hospital-acquired staphylococcal pneumonias were rarely associated with a

necrotic process (21). Using a rabbit pneumonia, Diep et al. demonstrated that PVL-

producing USA300 strains caused greater mortality and significantly more necrosis and

disruption of the pulmonary architecture than a PVL negative strain. The researchers

also demonstrated that PVL is produced in toxic amounts in the lung (66). In a different

study, use of a rabbit bacteremia model demonstrated a modest but measurable effect









early in the disease process that could be attributed to the presence of PVL, which the

authors surmised permitted the bacteria to seed the kidney early in the course of the

disease (67). Another study determined that the presence of the PVL toxin in human S.

aureus clinical samples was positively associated with skin and soft-tissue infections as

well as bone and joint infections (OR, 2.5; 95% CI 1.2-5.2) (68).

This is in contrast to other studies which have investigated the contribution of PVL

to disease processes and not found it to be the determining virulence factor in USA300-

derived pneumonia (69) or in a mouse sepsis and abscess model study evaluating wild-

type USA300 and LukS/F-PV-knockout. The latter study found similar levels of survival

between mice inoculated with either strain as well as similar levels of PMN lysis upon

exposure to the wild-type versus the knockout. In an evaluation of the strains' ability to

cause abscesses and dermonecrosis, PVL negative strains produced a larger abscess

than the PVL positive strains, refuting the claim that PVL is the factor conferring

USA300 increased virulence (70).

A more recent study, however, validated both arguments by identifying PVL as a

strong cytotoxic factor for human and rabbit neutrophils but not mouse or simian,

demonstrating species-specific cytotoxicity. The group also found that no difference was

detected between PVL-expressing and pv/-knockout S. aureus, including USA300 in

their ability to induce neutrophil death when live bacteria where phagocytized. The

authors proposed that the effect of PVL is masked in this model by cellular processes

that delay the effect of PVL. Since production of PVL occurs mostly in the post-

exponential phase of bacterial growth, it is reasonable to suspect that PVL may not be

expressed in high concentration if the bacterium is immediately phagocytized (71). That









PVL's presence has been linked to USA300 strains causing skin and soft tissue

infections is not refuted though its exact impact on pathogenicity, if any, is still being

understood.

More recently, the ACME gene has been identified as a potential key determinant

in the USA300 strain's pathogenicity. The SCCmeclVa has been demonstrated to be

physically linked to the ACME (23, 72, 73), suggesting that antibiotic resistance and

pathogenicity are interconnected. The strain's virulence was attenuated when ACME

was eliminated but not when SCCmec was deleted in a rabbit bacteremia model (23).

As noted before, the presence of a redundant arginine deiminase operon in the

USA300 strain is believed to confer a fitness advantage upon the bacteria allowing for

improved survival in anaerobic conditions where arginine is the sole source of energy

(22). Investigation of the effect of ACME in Streptococcus pyogenes has found that

arginine deiminase inhibits proliferation of human mononuclear cells and improves the

bacteria's ability to invade and survive intracellularly (74, 75). Because of the presence

of the arginine deiminase pathway, the bacteria appear better equipped to survive in the

face of the acidic conditions that exist on human skin.

Another group of researchers contends that ACME does not enhance virulence.

Their study found that in a comparison of USA300-ACME wild-type and an ACME-

deletion mutant in a rat model, the presence of the gene was not associated with an

increase in mortality or lung pathology and no significant difference in expression of

other virulence factors with the exception of alpha-hemolysin (24). More research is

needed to further define the role of ACME in the pathogenesis of USA300.









Another potential source for the virulence noted in the CA-MRSA strains

suggested by some researchers are the PSM. Wang et al. first described these peptides

in S. aureus as they have previously been described S. epidermidis. The researchers

detected PSM production in vitro at a higher concentration in CA-MRSA strains as

compared to HA-MRSA strains. In testing alpha-PSM deletion mutants, the authors

described reduced mortality and decreased levels of tumor necrosis factor-alpha

peripherally in the affected mice as compared to mice infected with the wild-type.

Monocyte infiltration and lysis were significantly increased when exposed to a wild-type

CA-MRSA strain as compared to the deletion mutant while human neutrophils could be

stimulated to respond and produce cytokines when similarly exposed (25).

Another study demonstrated PSM-mediated PMN cell lysis (both human and

murine) when these were exposed to PSMalpha3 (the most potent peptide), though

lysis occurred at high peptide concentrations. Based on this, the researchers concluded

that the CA-MRSA strains would not be able to produce sufficiently high concentrations

of PSMa3 to create an appreciable amount of lysis. However, the researchers did find

that the PVL-mediated lysis of human neutrophils was enhanced in the presence of the

peptide (76). Correlating the findings of the previous study, Loffler et al. found that

PSMs are active against many different species' neutrophils at high concentrations and

that the cells are rapidly destroyed without a characteristic change in morphology (71).

The PSMs appear to be under the control of the global regulator agr though how this

might impact its virulence in CA-MRSA strains carrying the gene is not yet known (20).

It is evident that S. aureus has acquired a myriad of ways in which to prosper

despite environmental pressures it encounters from our attempts to treat clinical









conditions caused by the bacteria. As the human medical field continues to attempt to

curb the rising number of MRSA cases, potential spillover into the veterinary community

is an area of heightened concern. Specifically, questions regarding the potential for

reservoiring of MRSA in our pets and cross-transmission between humans and animals

are focal topics. Additionally, as the virulence factors of the human strains are defined,

efforts to characterize these virulence factors in the animal-derived strains should be

performed.

MRSA in Animals

Initial epidemiological studies into the presence of MRSA in pets have identified

fairly low rates of infection or colonization. This is most likely due to the fact that S.

aureus is a human-adapted strain so it would have to overcome species' specific

immune responses every time the bacterium jumped host species. Notwithstanding, S.

aureus does commonly cause pyodermas and other clinical diseases in animals.

The earliest report of veterinary MRSA isolation was in a mastitic dairy cow in

1972 (77). Since then, dogs, cats, horses, pigs, and poultry have been identified with

the bacterium (78-81). MRSA has been more recently found in companion animals, with

the first reports of a colonized dog arising in 1994 (82) and thereafter by the detection of

MRSA in cats in 1998 (78). A study carrying out molecular characterization of dog and

cat derived MRSA isolates concluded that these infections are rarely reported in pets.

The 16 isolates obtained and tested were PVL negative, ST22, and spa type t032, with

some strains carrying a type IV mec cassette, though subtyping was not successful

(83). More recently, MRSA was identified in 2 dogs that demonstrated clinical signs at

the time of sampling. Both isolates were obtained from the same veterinary clinic and

harbored a SCCmeclll and were ST239 (84).









The low prevalence in the general population can be seen by comparing the

results of MRSA isolations from a diagnostic laboratory and those obtained by

screening a healthy population. A report by Rich and Roberts notes that only 1 in 255

healthy dogs was colonized during the course of one year as compared to 114 MRSA

positive isolates received at the laboratory in the same time (85). A study sampling

private practice populations and clinical cases at a teaching hospital found that dogs in

the former were colonized 0.8% while MRSA was isolated in 7% of the latter cases (86).

Though higher than other reported values, Jones et al. found that 23.5% of all S. aureus

isolated from clinical samples submitted to their laboratory were MRSA (87).

These findings underscore the tendency in veterinary medicine to attempt

empirical antibiotic therapy and then rely on culture and sensitivity when the infection

does not resolve or respond. As in humans, the risk of developing clinical disease from

MRSA is significantly impacted by the number of antibiotic courses received, the

number of days the dog or cat is hospitalized, and having received surgical implants

(88). In a case-control study evaluating comparing MRSA and MSSA cases in dogs, the

receipt of antibiotics (OR 3.84, 95% CI 1.21-14.74, p=0.02), beta-lactams (OR 3.58,

95% CI 1.04-14.79, p=0.04), or fluoroquinolones (OR 4.61, 95% CI 1.08-27.37, p=0.02)

within 90 days of admission were significantly associated with the development of

MRSA in canine patients (89), corroborating the previous study's findings. Fortunately,

no significant difference was noted with regards to surgery or outcome.

Following an outbreak, sampling at a Canadian university's veterinary teaching

hospital large animal clinic was instituted. Subsequently, 4% of horses in 2000 and 8%

of horses in 2002 were found colonized with MRSA (90). In the study, 14% (n=17) of the









staff at the veterinary hospital were found to be colonized with MRSA, which, combined

with case histories and repeat sampling, lead the authors to conclude that 63% (n=17)

of the equine cases were nosocomial transmissions. A subset of these isolates were

typed and all demonstrated SCCmeclV but lacked PVL genes (90).

A surveillance program instituted at the Ontario Veterinary College following the

initial outbreaks found that 5.3% of all equine patients were either colonized at

admission or became colonized with MRSA during hospitalization over an almost 2 year

period. The colonization rate of horses by CA-MRSA was 2.7% (91).

In an Irish study, healthy horses were colonized 1.6% of the time (86).

Environmental swabbing by the Canadian group identified 9.6% of sites sampled were

MRSA positive. The most common locations that cultured MRSA were stalls housing

MRSA-positive horses (62%). In contrast, only 6.9% of stalls housing MRSA-negative

horses were culture positive for MRSA (92).

In a broad study surveying S. aureus isolates submitted by diagnostic laboratories

at seven veterinary teaching hospitals in the USA, 14% (n=9) of the isolates were found

to be MRSA, though none of the PFGE patterns matched each other; they were not

compared to existing human strains (80).

Recent attention has revolved around the high prevalence of colonization of MRSA

in pigs and pig farmers, which has been evaluated primarily in the Netherlands. An

initial study found that 23% (n=6) of pig farmers sampled were colonized, representing a

>760x higher risk of colonization by swine farmers as compared to the rest of the Dutch

population. The authors were also able to demonstrate transmission between species

and found that spa-type t108 was the most prevalent MRSA, though all the recovered









strains were nontypeable using PFGE (81). In a larger subsequent colonization study,

de Neeling et al. identified 39% (n=209) of the swine sampled were colonized with

MRSA at the time of slaughter and that all the samples belonged to ST398 (93). Three

SCCmec types were identified in the Dutch swine population sampled: type III (3%),

type IV (39%), and type IV (57%). All of the isolates demonstrated resistance to

tetracycline, which is a reflection on the high level of use of that antibiotic in pig

husbandry (93). To evaluate the potential for widespread colonization of pig farmers on

the North American continent, pigs and pig farmers in Ontario, Canada were swabbed

and 20% (n=5) and 24.9% (n=71), respectively, were found to be colonized with MRSA,

though the predominant strain was a HA-MRSA (94).

As the human-animal bond tightens and pets play increasingly integral roles in the

home, the potential for cross-colonization and infection has raised concerns in both the

human and veterinary medical fields. With this possible host-range expansion, the

epidemiology of the disease could be further complicated if reservoiring occurs in pets

as has been suggested by one group (95). An example of this complication was

described by van Duikjeren et al. when they reported a recurring outbreak in a nursing

home which was only resolved once the affected nurse was treated, in addition to her

affected infant and colonized dog (96). Weese et al. reported several case studies of

companion animal MRSA isolations that were identical to strains obtained from either

attending veterinary technician staff or the animal's owner (97). Cases such as this

underscore how detrimental it may be to both people and animals if MRSA gains a solid

foothold in non-human species and develops an additional host predilection.









Fortunately, to date, there does not appear to be reports of USA300 having been

detected.

It is the goal of this research to investigate the prevalence of MRSA in companion

animals and to assess Staphylococcus aureus for evidence of shared virulence factors

between the human and animal-derived strains. This is a needs study to further define

MRSA in animals.









Table 1-1. CDC case definition for community-associated MRSA
Diagnosis of MRSA within 48hrs of admission or as an outpatient
No previous history of MRSA infection or colonization
No history of hospitalization, admission to a long term care facility,
dialysis, or surgery in the past year

No indwelling catheter or medical device that passes through the
skin into the body









CHAPTER 2
MICROBIOLOGICAL SURVEY AND NASAL COLONIZATION RATE
DETERMINATION OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN
PATIENTS AT THREE SECONDARY/TERTIARY VETERINARY CARE FACILITIES IN
FLORIDA

Background

Originally detected in humans only two years after methicillin was introduced to

treat infections caused by penicillin-resistant staphylococci (37), methicillin-resistant

Staphylococcus aureus (MRSA) is today considered an emerging disease in humans

because of the increased numbers of isolations and clinical ramifications of reported

infections (46). Historically, these infections were associated with hospitalized patients

with in-dwelling catheters and devices, the elderly, and the immunocompromised and

were thereby termed hospital-acquired (HA)-MRSA. These HA-MRSA infections have

become much more frequent during the last two decades. Whereas in 1974 only 2% of

the S. aureus infections in US intensive care patients were classified as MRSA, by 1992

this number had risen to 35.9% and was 64.4% by 2003 (45, 98). Resistance to

penicillin in S. aureus is associated with beta-lactamases produced by resistant strains

that attack the antibiotic's beta-lactam ring. Methicillin and similar penicillins of this class

were fortified by the addition of an ortho-dimethoxyphenol group to the beta-lactam ring

to counter these resistant strains. The next wave of resistance against these fortified

antibiotics ensued (37), mediated via the mecA gene found on the staphylococcal

chromosomal cassette mec (SCCmec). These mobile elements transfer horizontally

between bacteria so sensitive strains become rapidly resistant. The traditional HA-

MRSA carry SCCmec types I, II, or III (22), with the rise in type II and III SCCmec

allotypes forming the basis for the third wave of resistance (36). Resistance to all

antibiotics in the beta-lactam family as well as cephalosporins is phenotypically









designated by the detection of resistance to oxacillin on an antibiogram. Additional

resistance to other antibiotic classes such as macrolides and fluoroquinolones is

frequently noted with these infections, leaving practitioners limited treatment options

(99). The fourth wave of antibiotic resistance involves the rise in vancomycin-

intermediate S. aureus (VISA) strains (36).

A second set of MRSA strains have come to the forefront in the past two decades

as community-associated strains (CA-MRSA) have been increasingly isolated from

people lacking traditional risk factors such as contact with hospital settings (58). Often,

these CA-MRSA show less antibiotic resistance than the hospital-acquired strains (48)

and typically have SCCmec type IV or V (22). The USA300 strain, which carries a

SCCmeclV cassette has been particularly concerning as it has developed increased

virulence and causes various primary disease syndromes predominant now in the US.

This trend towards the displacement of typical HA-MRSA by CA-MRSA strains,

particularly by USA300, is resulting in infections of new patient cohorts previously not at

risk for S. aureus infections. The syndromes themselves have higher morbidity and in

some cases mortality (46, 47, 58, 60). Understanding of the epidemiology of the

bacterium, its transmission, and reservoir patterns is still incomplete.

MRSA was first reported in the veterinary literature in a dairy cow in 1972 (77).

The first companion animal reported to have MRSA was a dog in 1994 (82) and

colonized cats were first reported in 1998 (78). There have been sporadic reports of

MRSA infection in horses in surgical wounds with more recent reports of nasal

colonization rates as high as 5.3% (91).









Whether or not animals serve as either the originating source of human infection

or disseminate acquired S. aureus (from humans) has not been fully determined. Work

performed in the Netherlands demonstrated contact with pigs or pig farming is a risk

factor for developing MRSA infection, and the frequency of colonization by pig farmers

was over 760 times higher than in the general Dutch population (81). In another study,

there was a significant correlation on Canadian farms with the presence of MRSA

positive pigs and MRSA positive nasal colonization in farm personnel. In these studies,

the strains found in personnel were of swine origin (94). Concomitant carriage between

cows and humans has also been demonstrated though the direction of transmission

could not be shown (100). A study investigating colonization rates in horses and

associated caretakers found similar subtypes circulating among the two populations

with evidence of human-to-horse and horse-to-human transmission (90). In 2004, a

case report described recurring MRSA colonization in a nursing home nurse which only

resolved once her child and dog were also treated to eliminate the same strain (96).

Given that human-animal-human transmission can occur, the potential for zoonotic

transmission of MRSA bears investigation. The use of molecular epidemiology to

perform comprehensive characterization of MRSA should be carried out to truly identify

if animals are an originating source of resistant S. aureus epidemics in humans. The

purpose of the study reported here was to determine the degree of nasal colonization in

companion animals at tertiary and secondary veterinary care facilities in Florida and to

perform basic genetic subtyping of any MRSA isolates.









Methods


Animal Sampling

Sampling was performed at several secondary and tertiary animal treatment

centers in north central Florida including the small (dog and cat) and large animal

(equine) hospitals of a veterinary teaching hospital (facility 1 and facility 2, respectively);

a primary and secondary care private care feline clinic (facility 3); and a primary,

secondary and tertiary care private care equine facility (facility 4) during the second

sampling period. Two sampling periods (SP) took place, the first during July-August

(SP1) and the second during the following March-April (SP2) to reflect seasonal

variation in Florida and seasonal reproductive differences in the horse. Detailed patient

signalment was obtained, recording the specie, age, gender, breed, and neuter status of

each animal sampled. Access to medical records at facilities 1 and 2 was used to

determine the animal's originating geographic location from the owner's address.

Admission date, hospital service visited, and length of stay were also obtained for these

animals and placed in a database. When possible, hospitalized patients were swabbed

within 24 hours of admission and again between 72 and 96 hours. Most of the cats

sampled were swabbed once at the time of their outpatient visit given the large majority

of these samples came from facility 3.

Samples were obtained by passing rayon-tipped culture swab against the mucosa

of a single nostril and then placed in Stuart's media (BD BBL CultureSwab, Sparks, MD)

and frozen at -20C if not processed immediately. A subset of the swabs was frozen

without any media during SP2 to determine storage options for future broader studies

that may be performed in animals under different management conditions.









Animal sampling protocols were evaluated and approved by the University of

Florida Institutional Animal Care and Use Committee. Additionally,owners of patients

seen at facilities 1-3 signed an informed consent prior to having their pet sampled.

Microbiological Testing

Briefly, samples were plated onto Columbia blood agar with 5% sheep blood (BA),

CNA, and (during SP2) mannitol salt plates. Dry swabs were plated to BA and then

inoculated into tryptic soy broth, which was incubated for enrichment and subsequently

plated to BA, CNA, and mannitol salt plates. All plates and broths were incubated at

370C with 5% CO2 overnight. The plates were evaluated for round, raised white to

yellow colonies with a zone of beta-hemolysis on the BA and CNA plates as well as

growth on the mannitol salt plate. Suspect colonies meeting these criteria were

reisolated onto BA after a Gram stain confirming gram positive status and a positive

catalase test was obtained. A coagulase tube test (BD BBL Coagulase Plasma, Rabbit,

Sparks, MD) was set up for these suspect colonies by inoculating a loop into rabbit

plasma and allowing it to incubate for a total of 24 hours with an initial read at 4 hours.

Isolates that coagulated were subjected to a latex agglutination test evaluating the

presence of penicillin binding protein 2a (PBP2a) (Remel BACTi STAPH, Lenexa, KS).

Any isolate that demonstrated latex agglutination was then inoculated into maltose,

trehalose, and lactose broths (Hardy Diagnostics Purple Broth with Maltose, Trehalose,

Lactose, Santa Maria, CA) and incubated overnight. Evidence of sugar fermentation by

the bacterium was based on a purple to yellow color change, though evidence of partial

fermentation was further evaluated. If all the criteria were met, the isolate was

inoculated into tryptic soy broth to a 0.5 McFarland turbidity standard and subsequently

plated onto Mueller Hinton agar with 4% NaCI and oxacillin (6ug/ml) (Hardy Diagnostic









MRSA screen plate, Santa Maria, CA) using the alternate swab procedure outlined by

the manufacturer. Any growth after 24 hours of incubation was considered a methicillin

resistant suspect strain. Following reisolation, the suspect strain was subjected to full

antibiogram performed by minimum inhibitory concentration (MIC) using a standard

microwell format.

MIC Analysis of MRSA and MSSA Isolates

Each of the six MRSA isolates was matched to two MSSA controls that had been

submitted for antibiograms and confirmed to be oxacillin sensitive. The MSSA controls

were matched to the MRSA isolates by species (canine, feline, or equine) and

represented the stored isolate that was obtained temporally closest to the case isolate

at that facility. Each strain's antibiogram was evaluated to determine the prevalence of

resistance to the penicillins, cephalosporins, fluoroquinolones, and macrolides. These

were then combined to determine overall prevalence of resistance to the classes in the

MRSA as compared to the MSSA group.

Pulsed Field Gel Electrophoresis

Once an isolate was identified as being methicillin resistant S. aureus based on

microbiological screening and MIC antibiogram (resistant to oxacillin at >2ug/ml),

isolates were submitted to the Florida Department of Health Bureau of Laboratories for

genotypic characterization using pulsed-field gel electrophoresis (PFGE) following the

protocol developed by McDougal, et al.(48). Briefly, a colony was inoculated into broth

and incubated while shaking. The turbidity was adjusted and the suspension was

centrifuged. The pellet was resuspended and a lysostaphin solution was added in

addition to agarose in buffer. The entire mixture was then dispensed into the wells of a









96 well plate and the plugs were allowed to solidify. The plugs were then placed in lysis

buffer and incubated prior to washing several times.

The plugs were cut to the desired size, equilibrated in restriction buffer, and then

subjected to Smal restriction enzyme prior to further incubation. The plugs were loaded

onto the comb tooth and placed in the casting platform to which the equilibrated

agarose was added. Pulsed-field gel electrophoresis (PFGE) was carried out and the

gel was stained and photographed. A dendogram of the isolates was derived using the

unweighted pair group method using arithmetic means and Dice coefficients to generate

percent similarities. A similarity coefficient of 80% was used to define the pulsed-field

type (PFT) clusters (48).

Results

Microbiological Results

A total of 966 patients were sampled from 3 domestic animal species: 263 patients

were sampled in SP1 (27%) while 703 patients were sampled in SP2 (73%). Of these,

132 patients were swabbed again during their hospitalization with 62 and 70 isolates

obtained during SP1 and SP2, respectively. No detectable differences were observed

on Staphylococcus spp. isolations based on sample storage as well as use of the dry

versus Stuart's media swabs (data not shown).

Dogs were most commonly sampled (n=536, 55%) followed by cats (n=257, 27%),

and horses (n=173, 18%). General population demographics showed that 50% of the

animals sampled were male and 80% were adult. The majority (n=585, 61%) of the

patients sampled came from facility 1, while 22% of the samples were submitted by

facility 3 (n=208). Additionally 17% (n=173) of the samples were from large animal

services with facility 2 contributing 7% (n=72) and facility 4 contributing 10% (n=101).









Facilities 1 and 2 yielded 68% (n=657) of the total submissions while 32% (n=309) of

the study population represented the two private secondary care facilities.

Six MRSA isolates were identified which represented 0.62% of the total animals

sampled for this study population during the entire sampling period. Three cats, 2 dogs,

and 1 horse grew a MRSA isolate. Based on these findings, MRSA colonization

prevalence rates were 0.37%, 1.17%, and 0.58% respectively for dogs, cats, and

horses. Only 1 patient was found to be colonized in 2006 (sampling prevalence 0.38%

or 1 in 263 patients) while the remaining 5 isolates were all obtained in 2007 (sampling

prevalence 0.71% or 5 in 703 patients). The results are summarized in Table 2.1.

Antibiotic Resistance

All MRSA and most of the control MSSA isolates demonstrated beta-lactamase

activity and were resistant to penicillin and ampicillin (Table 2.2). All 6 MRSA isolates

were resistant to the remainder of the antibiotics in the penicillin class, while none of the

MSSAs were multi-resistant to penicillins. One MRSA isolate was sensitive to

imipenem. In addition to penicillin and cephalosprins, all of the MRSA isolates were

resistant to macrolides (Table 2.2). Resistance against the fluoroquinolones class was

noted but was variable among the MRSA isolates while no MSSA demonstrated

resistance to this antibiotic class. No resistance was detected in any S. aureus against

vancomycin, rifampin, synercid, or linezolid (Figure 2.2).

Pulsed-Field Gel Electrophoresis

The isolates demonstrating growth on the MRSA Screen plate were subjected to

PFGE. Four of the MRSA isolates recovered (2 dog, 2 cats, 66%) were consistent with

USA300 strains (Figure 2.1). The pulsed-field type of 2 feline isolates and 1 of the

canine isolates aligned with the USA300-0014 strain (19). The other canine isolate









aligned with the circulating USA300-aJCI strain (48). The remaining two isolates did not

align with CA- or HA-MRSA reference strains.

Discussion

This study sought to evaluate the rate of nasal colonization of a veterinary patient

population presented for evaluation to secondary and tertiary care facilities in North-

Central Florida. The study did identify MRSA in pets and helps to underscore the

potential implications of MRSA colonized pets on human health. Low rates of

colonization were detected in the 3 species sampled, an overall 0.58% prevalence rate.

This deviates from a previous report by Weese et al. who identified 5.3% of the equine

patients at a Canadian veterinary college hospital as colonized or who became

colonized during hospitalization. Reasons for this discrepancy were not elucidated by

this study but may be related to differences in geographic distribution and impacting

environmental conditions, such as temperature and weather. The present study was not

performed alongside an increase in surveillance due to MRSA detection during routine

monitoring or due to a hospital outbreak, a condition which preceded the surveillance

program reported above (90). This study was cross-sectional in nature, with only 13.7%

of the patients being sampled a second time as opposed to the almost 2 years during

which surveillance occurred in the Canadian study, with weekly sampling of hospitalized

patients (91). An increase in MRSA isolations was noted between the two sampling

periods but cannot be validated due to the uneven distribution of sample collection.

The results of antibiogram analysis of suspect strains demonstrated that

resistance to the beta-lactam antibiotic class was widespread. All MRSA and most

MSSA isolates demonstrated beta-lactamase activity against penicillin and ampicillin.

Only the MRSA demonstrated resistance to all the antibiotics in the penicillin class with









the exception of case #3 which was sensitive to imipenem, an intravenous beta-lactam

antibiotic. Given the resistance detected against the fortified beta-lactamases in this

isolate, the clinical use of this antibiotic would have been questionable despite in vitro

results since the presence of a PBP2a would impart resistance to the entire class. All of

the MRSA isolates were also found to be resistant to the macrolides tested and to all

the cephalosporins. Resistance against members of the fluoroquinolone class was more

variable among the MRSA isolates. The results of the antibiogram analysis

demonstrated multi-drug resistant attributes of the MRSA isolates obtained. Fortunately,

no resistance was detected against vancomycin, rifampin, synercid, and linezolid.

However, as these are the last line of defense in many resistant human cases, use in

the pet population is to be undertaken with extreme caution so that further resistance in

animal-derived isolates does not impact the human population.

The isolation of USA300 from two dogs and two cats is significant given the

increasing concerns regarding this strain in people (58). The recovered strains

demonstrated typical patterns of resistance associated with USA300, indicating that the

strain has continued to propagate without great genomic diversification (19, 101) and by

means of clonal expansion (102) similar to what has been previously reported in people.

The multi-drug resistant pattern was seen in both USA300 and non-USA300 strains

which raises concern that other strain types may be acquiring multi-drug resistance. The

combination of PFGE and antibiograms were used to demonstrate similarity in the

isolates obtained in this study. Employing whole genome analysis of each MRSA would

determine if these animal-derived isolates are as closely associated to each other and









also to known human strains as they appear to be or if various single nucleotide

polymorphisms exist that could substantially impact the strains' virulence (102).

Of note, a USA300 positive dog was resampled a month later at the time of its

recheck admission and was found to no longer have MRSA but instead was colonized

with a methicillin-resistant S. intermedius (MRSI). The antibiogram profile for the MRSI

was similar to the MRSA's with additional full or partial resistance to various members of

the fluoroquinolone family, full resistance to clindamycin, tetracycline, and trimethoprim-

sulfa, and intermediate resistance to gentamicin, using the CLSI set points for S.

intermedius (data not shown). Since colonization in humans increases the risk of

developing a subsequent MRSA infection (9, 47), this finding raises the question as to

the duration of MRSA colonization in domestic pets and their ability to reservoir the

bacterium (95). Reports demonstrating repeated human infections that have been

traced back to the household pet (91, 96) point to the need for protocols and control

measures that help medical facilities address the issue of colonized pets. A goal in the

management of these animals would be to prevent the acquisition of multi-drug resistant

bacteria that could serve as sources of reinfection or may transmit virulence factors to

normal animal bacterial flora.

As the human MRSA epidemic continues to grow and pets play a more central

role in the lives of their owners, increasing reports pointing to transmission between

people and pets are likely. Additional studies investigating owners and pets for

colonization rates and assessing the genotypic similarities of resulting isolates are

necessary to elucidate the epidemiology of zoonotic transmission and thereby provide

important foundations for the management of this epidemic and prevention of further









spread in the pet population. Further evaluation of animal-derived MRSA isolate for the

presence of virulence factors associated with human disease is also warranted.


Table 2-1. Number of species swabbed, number of samples processed,
and resulting prevalence rates of MRSA in dog, cat, and
horses patients of 3 secondary and tertiary care facilities in
North-Central Florida
No. Sampled per Species (Samples Processed per
Species)
Dog Cat Horse Total
Sampling period 1 107 (126) 84(89) 72(110) 263 (325)
Sampling period 2 429 (459) 173 (180) 101 (134) 703 (773)
Total 536 (585) 257 (269) 173 (244) 966 (1098)
Total MRSA 2 3 1 6
Prevalence 0.37% 1.17% 0.58% 0.62%


Table 2-2. Overall antibiotic class resistance between MRSA
isolates and the MSSA control isolates obtained from
dog, cat, and horse patients of 3 secondary and tertiary
care facilities in North-Central Florida
Percent of Resistant Isolates (No.
isolates)
Antibiotic Class MRSA (n=6) MSSA (n=11)
Penicillin* 97.2% 28.8%
Cephalosporint 100% 1.6%
Fluoroquinolone* 74.4% 0%
Macrolide 100% 9.1%
Vancomycin 0% 0%

** Penicillins tested include: amoxicillin/clavulanic acid, ampicillin sulbactam, ampicillin, penicillin, oxacillin, imipenem
t Cephalosporins tested include:cefazolin, cefepime, cefotaxime, ceftriaxone, cephalothin, ceftiofur (equine only), cefpodoxime
(2007 only)
t Fluoroquinolones tested include: ciprofloxacin, enrofloxacin, gatifloxacin, levofloxacin, marbofloxacin, moxifloxacin, ofloxacin
Macrolides tested include: azithromycin, erythromycin











.1






'I
11'I


#1
#2

#3
#4


Figure 2-1. Dendogram showing the relatedness of the 6 MRSA isolates obtained from
dog, cat, and horse patients of 3 secondary and tertiary care facilities in
North-Central Florida as compared to commonly circulating USA300 strains.
Source species is listed. Scale bar indicates genetic relatedness.


CI
aa~3
III












6
S -_ -- ----__ -------- --_ -_ _---_

5

4 "
W 3
6 2
1

2 S S -i


1 -- 0 0 R M M C
0 E 2 C 0 0 0 0 0 C C C C C C C C C C V g a) E i C






O
2 EC C E 2 o E 4 .
S- o v v >- > > -0 l



UAntibiotic Tesd
x UU



E

Antibiotic Tested


resistant 0 sensitive 0 intermediate resistance

Figure 2-2. Antibiograms obtained from 6 MRSA isolates from dog, cat, and horse patients of 3 secondary and tertiary
care facilities in North-Central Florida.









CHAPTER 3
GENOTYPIC CHARACTERIZATION AND SEQUENCING OF THE MRSA ISOLATES

Background

Known for its propensity to cause disease in humans, methicillin-resistance S.

aureus (MRSA) is more recently being investigated for the role it may play in animal

disease. Not a usual commensal of animals, S. aureus has been identified as a

colonizer of healthy cats (78, 95), dogs (82, 95, 96), and horses (90, 95). In molecular

comparisons of some animal derived MRSA strains to human isolates, many animal

MRSAs are not typeable, raising the idea that these strains are circulating primarily in

the animal population (94, 103). Several studies have found these untypeable animal

strains in outbreaks or colonization surveys of humans, suggesting that characterization

of all strain has not yet occurred. Conversely, through molecular epidemiology, several

clinical infections and nosocomial outbreaks in animals have been caused by MRSA

strains primarily associated with human colonization and infection (97). Strains that

have been successfully isolated from animals and typed according to human derived

MRSA schemes, have been common hospital-acquired MRSA (HA-MRSA) strains such

as USA100 (94, 97) though strains carrying SCCmeclV have been obtained as well

(95).

During the past two decades there has been a sharp increase in both HA- and

community-associated MRSA (CA-MRSA) colonization as well as disease. Colonization

is an important risk factor for subsequent primary disease (9) and complications after

elective invasive procedures. Whether or not this bacterial evolution diverged from the

initial hospital acquired to community-associated genotypes is not known but generally it

is accepted that MRSA was initially confined to humans in hospital settings. This strain









was then disseminated into the community and colonized people readily. It continued to

circulate and eventually made its way back to the hospital setting. Much effort has been

spent in evaluating the genetic changes that MRSA has undergone in its transition from

being a hospital-based infection to one detected routinely in non-healthcare associated

people. Specifically, researchers have focused particular attention on understanding

what virulence factors, in addition to antibiotic resistance, have allowed the CA-MRSA

to successfully adapt to the community setting as well as in hospitals to which it has

returned. The focus of understanding the full ecology and evolution of the bacterium has

broadened to also investigate the role that animals have played in the process.

The first phase of this study determined the nasal colonization rate of dog, cat, and

horse patients at three facilities in North-Central Florida. These animals were swabbed

upon admission and the swabs were processed using standard microbiological

technique. MRSA cases were confirmed with full antibiogram and then subjected to

pulsed field gel electrophoresis (PFGE). A total of six isolates were obtained, four of

which were typed USA300 and two which were untypeable. In addition, several beta-

lactam resistant, but methicillin-sensitive, S. aureus were isolated allowing for molecular

characterization of virulence factors. It is important to determine the genotypic

background of these isolates to establish the genetic relatedness of S. aureus and its

pathogenicity determinants from a comparative species standpoint. This will allow

assessment of the role of animals and assessment of the value of these determinants

as tools to perform complete epidemiologic characterization of epidemics. Animal-

derived MRSA strains were evaluated for the presence of virulence factors including the

staphylococcus chromosomal cassette meclVa (meclVa), Panton-Valentine leukocidin









(PVL) gene lukPV, and the arginine catabolic mobile element (ACME)-encoded arcA

gene. Accessory gene regulator protein C (agr) was used as a marker protein for phenol

soluble modulins in addition to directly detecting phenol soluble modulin a3 (psm).

These are virulence factors currently under investigation for their role in the

pathogenesis of MRSA associated diseases in humans.

Materials and Methods

S. aureus Isolates

In a convenience sampling of 966 dogs, cats, and horses performed in North-

Central Florida, six isolations of MRSA were made, as discussed in Chapter 2. The

species and date of acquisition of MRSA case samples obtained from the colonization

prevalence study were determined. Each of the 6 MRSA isolates was matched to two

MSSA controls that had been submitted for antibiograms and confirmed to be oxacillin

sensitive. The MSSA controls were matched to the MRSA isolates by species (canine,

feline, or equine) and represented the stored isolate that was obtained temporally

closest to the case isolate. Control isolates ranged in collection dates from 22 days

before the MRSA in question to 21 days later as seen in Table 3.1. The average

difference among date of collection of all controls as compared to the date of collection

of the case isolates was -1.75 days.

Microbiological Techniques

The 6 MRSA case isolates and the 12 control MSSA isolates obtained while

performing the colonization prevalence study were recovered from stocks stored on

nutrient agar slants or in glycerol stock aliquots at -800C and recultured in brain-heart

infusion broth at 370F. A CNA plate was also plated and incubated for 24 hours at 37F

in addition to a new nutrient agar slant for storage. The MRSA-USA300 ATCC #BAA-









1556 (positive control) isolate and the MSSA ATCC #29213 (negative control) isolate

were also prepared in this fashion, having previously been rehydrated and stored at -

80C on nutrient agar slants. Turbidity of the broth was evaluated at 24 hours and

colony morphology and evidence of beta-hemolysis on the CNA plate was used to

confirm monoculture. Glycerol stocks were made from all samples and frozen at -80C

for future use.

DNA Isolation and PCR

Isolation of DNA from each isolate was performed utilizing the QIAGEN DNeasy

Blood & Tissue kit (Valencia, CA). Briefly, the bacteria were pelleted by centrifugation

and resuspended in a lysozyme solution. The mixture was incubated to promote cell

wall lysis prior to adding proteinase K and lysis buffer. The solution was again incubated

then centrifuged after which the supernatant was pipetted off into a clean

microcentrifuge tube for further use. This step was added to eliminate loss of product

due to large proteins clogging up the spin column in future steps. The manufacturer's

instructions were then followed as written. To this solution, ethanol (96-100%) was

added and the entire mixture was then applied to the QIAamp Mini spin column and

subjected to a two-step wash process. Lastly, DNA product was eluted with and the

resulting DNA concentrations were determined using a spectrophotometer (ND-1000,

Nanodrop Technologies, Wilmington, DE).

Polymerase chain reactions (PCR) for the five genes of interest were set up for

each isolate (Table 3.2). Each 50 uL reaction contained 50 ng of isolate template, 1 pL

of 0.5 pM forward and reverse primer of the corresponding primer pair, 25 pL of Sigma

Ready-Mix Taq. The reactions were run on a thermocycler (Perkin Elmer GeneAmp

DNA Systems 9600, Waltham, MA) using the following method: 3 minutes at 94C









followed by 40 cycles of 1 minute at 94C, 30 seconds at 550C, and 30 seconds at

72C, then a final elongation phase of 7 minutes at 72C before an indefinite hold at

4oC.

The reactions were loaded onto 1% agarose gels stained with ethidium bromide

and exposed to current. Each gel had a 100 bp DNA ladder, the USA300 MRSA

positive control, the MSSA negative control, and a water negative control loaded as

well. The gel was transilluminated using a UV viewer and bands corresponding in size

to the target band seen in the MRSA USA300 positive control were identified. PCR

purification was performed on these positive reactions following the QIAGEN QIAquick

PCR Purification Kit Protocol (Valencia, CA). Briefly, the sample was diluted 5:1 and

applied to a QIAquick spin column and centrifuged to allow binding. A buffered wash

was applied to the column before the final product was eluted off the spin column with

DEPC. The concentration of the final product was determined using the

spectrophotometer.

Purified products were loaded onto 1% agarose gels stained with ethidium

bromide using a 100 bp DNA ladder and exposed to current. The resulting gels were

again imaged on the transilluminator to verify product size. Sequencing was performed

by the Sanger sequencing method (Interdisciplinary Center for Biotechnology Research,

Gainesville, FL). The sequences were analyzed for similarity to known sequences

(BLAST, NCBI, Bethesda, MD) and sequence alignment was performed on the

sequence products obtained and compared to reference standards (ClustalW2,

European Bioinformatics Institute, Hinxton, UK) employing a blosum matrix (104).









Results

PCR analysis identified the presence of the 5 genes of interest in all 4 USA300

strains. One of the control MSSA strains, control #2A, also harbored all 5 genes of

interest. A second control strain, control #4A was weakly positive for 2 genes, meclVa

and lukPV in addition to being strongly positive for the presence of the agr and psm

genes. All MRSA and MSSA isolates were strongly positive for the agr and psm genes.

However these two genes were the only genes identified in the two non-typed MRSAs.

The results of the PCR analyses are summarized in Table 3.3.

Each sequence returned a match to the target area for S. aureus. Alignment of the

sequences to each other demonstrated close homology between the isolates (data not

shown).

The meclVa gene was identified in 6 isolates: 4 USA300 and 2 MSSA controls,

though 1 was weakly positive. When these were subjected to alignment against known

sequences, the isolates matched 6 sequences with 99-100% homology. The resulting

phylogram of the 6 sequences aligned to the USA300 control can be seen in Figure 3.1.

The lukPV gene was identified in 5 isolates: 4 USA300 and 1 MSSA control. When

these were subjected to alignment against known sequences, the isolates matched 109

sequences with 71-100% homology, though the majority of the matches were 99-100%

(data not shown).

The arcA gene was identified in 6 isolates: 4 USA300 and 2 MSSA controls,

though 1 was weakly so. When these were subjected to alignment against known

sequences, the isolates matched 38 sequences with 70-100% homology with the

majority of the matches in the mid 70s% range (data not shown).









The agr gene was identified in all 18 isolates, as all 6 MRSA and all 12 controls

were positive. When these sequences were subjected to alignment, the isolates

matched 100 sequences with 89-100% homology (data not shown).

Similarly, the psm gene was identified in all 18 isolates, as all 6 MRSA and all 12

controls were positive. When these sequences were subjected to alignment, the isolates

matched 19 or 20 sequences with 82-100% homology (data not shown).

Discussion

Virulence factors associated with USA300 invasive disease in people were

detected in the animal-derived USA300 strains. All 4 of the USA300 strains had

meclVa, PVL, and ACME as well as agr and PSM. That the two untypeable strains did

not have a meclVa gene suggests that they have a different SCC or that their methicillin

resistance is mediated by another fashion. It is not surprising that the SCCmeclVa gene

was identified in the 4 USA300 strains as this strain has been shown to carry a typelV

mec cassette. MSSA have also been found to have a USA300 PFT, so finding 2 strains

that harbored this cassette is not unusual. Control #2A was sensitive to all antibiotics

except penicillin and ampicillin suggesting the presence of beta-lactamases (data not

shown). An antibiogram of control #4A demonstrated resistance to penicillin and

ampicillin, but the strain was not oxacillin resistant. Control #4A also had evidence of

resistance against members of the macrolide family (data not shown).

The presence of PVL has been linked epidemiologically to skin and soft tissue

outbreaks caused by USA300 strains. The lukPV gene was identified in the 4 USA300

strains, supporting the apparent link between the 2 genes. A single MSSA, control #2A,

harbored this gene. The arcA gene is a marker gene for the presence of the ACME

gene cluster. The 4 USA300 strains appeared to harbor this gene cluster, in addition to









both control #2A and control #4A. Neither of the unteypeable MRSA strains had

evidence of either the PVL or ACME genes, further differentiating them from the

USA300 strains.

Not surprisingly, the agr and psm genes were identified in all the isolates tested.

PSMs have been described in all S. aureus so their presence in MSSA as well as

MRSA strains was expected. What role, if any, these genes play in the virulence of the

MRSA strains as compared to the MSSA strains has yet to be fully understood. The

primers for psm gene were generated by selecting for closest match since detection

was of interest given it is believed to incite an inflammatory response. Now that we have

shown that all the strains harbor this sequence, extending the target length and

sequencing the product will help to evaluate the true importance of this detection by

determining if any significant differences exist between the resistant and sensitive

strains. The identification of agr is similarly important since, again, all isolates proved to

harbor this gene which is used as a marker for psm. However, the ACME gene cluster

is believed to be under regulation by the agr gene as well so this may have additional

implication as to the virulence of the USA300 strains and warrants further investigation.

The MSSA control #2A deserves further consideration and brings to light

questions regarding bacterial fitness upon host-range expansion. Control #2A

demonstrated the presence of the virulence factors detected in the USA300 MRSA

strains but did not have oxacillin resistance on antibiogram. The bacterium was PBP2a

positive on latex agglutination test but did not grow readily on the MRSA screen plate as

discussed in Chapter 2. Based on the genetic analysis in addition to the previous

microbiological analysis, this strain may actually be a MRSA with heterogenous









expression of methicillin resistance. Further classifying this strain's PFT and subjecting

it to different growth parameters to evaluate for altered expression of methicillin

resistance would help resolve the classification.

This study sought to evaluate animal-derived MRSA isolates against MSSA

isolates for the presence of virulence factors noted in human strains. It also evaluated

the virulence factors obtained against banked sequences to evaluate the level of

relatedness and thereby confirm their presence. We have shown that animal-derived

MRSA strains harbor many of the same virulence factors as those found in people. We

have also described 2 MSSA strains which harbor all (control #2A) or most (control #4A)

of these factors and suggest that one strain (control #2A) was likely a MRSA with

heterogenous expression of methicillin resistance. Once the bacterium overcomes

fitness costs associated with the host-range expansion, we may detect MRSA more

frequently in animals but at present it appears that the bacteria colonizes animals at a

very low rate.









Table 3-1. Date of collection for case (MRSA) and control (MSSA) isolates, the number
of days difference between the collection dates, and the species of origin.
Isolate Date Control Date Acquired Variance in Species
Acquired Days
Case #1 4/3/07 Control #1A 3/30/07 -4
Feline
Control #1 B 3/12/07 -22

Case #2 8/1/06 Control #2A 7/13/06 -19 F
Feline
Control #2B 8/3/06 2

Case #3 4/3/07 Control #3A 4/5/07 2 C
Canine
Control #3B 3/19/07 -15

Case #4 3/13/07 Control #4A 3/13/07 0
Canine
Control #4B 3/13/07 0

Case #5 3/21/07 Control #5A 3/21/07 0
Control #5B 3/22/07 1

Case #6 3/2/07 Control #6A 3/15/07 13
Control #6B 3/23/07 21



Table 3-2. Primer sequences used for PCR analysis
Gene Target Forward Reverse
meclVa TTTGAATGCCCTCCATGAATA AGAAAAGATAGAAGTTCGAAAGA
AAAT
pvlt ATCATTAGGTAAAATGTCTGG GCATCAAATGTATTGGATAGCAA
ACATGATCCA AAGC
arcAl GAGCCAGAAGTACGCGAG CACGTAACTTGCTAGAACGAG
agr AGATGACATGCCTGGCCTAC ACGCGAATGATAGGGTCATC
psm GGGGGCCATTCACATGGAATT GCCATCGTTTTGTCCTGTA


Okuma K, Iwakawa K, Turnidge JD, Grubb WB, Bell JM, O'Brien FG, et al. Dissemination of New
Methicillin-Resistant Staphylococcus aureus Clones in the Community. J Clin Microbiol. 2002 November
1,2002;40(11):4289-94.
t Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter M-O, Gauduchon V, et al. Involvement of Panton-
Valentine Leukocidin-Producing Staphylococcus aureus in Primary Skin Infections and Pneumonia.
Clinical Infectious Diseases. 1999;29(5):1128-32.
1 Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davidson MG, et al. Complete Genome Sequence of
USA300, an Epidemic Clone of Community-Acquired Meticillin-Resistant Staphylococcus aureus. The
Lancet. 2006 March 4, 2006;367(9512):731-9.









Table 3-3. Results of PCR analysis for all five genes in every MRSA case and its
corresponding two MSSA control isolates
Gene
Isolate meclVa lukPV arcA agr psm
Case#1 + + + + +
Control #1A + +
Control #1B + +
Case #2 + + + + +
Control #2A + + + + +
Control #2B + +
Case #3 + + + + +
Control #3A + +
Control #3B + +
Case #4 + + + + +
Control #4A w+ w+ + +
Control #4B + +
Case #5 + +
Control #5A + +
Control #5B + +
Case #6 + +
Control #6A + +
Control #6B + +
USA300 control + + + + +
MSSA control + +









CHAPTER 4
CONCLUSIONS

The research presented herein sought to identify and characterize MRSA isolates

obtained from pets sampled at 3 veterinary hospitals in North-Central Florida. The dogs,

cats, and horses receiving veterinary care at these secondary and tertiary care facilities

have, by the very nature of their presence in the hospital, owners that are interested in

providing for their pet's needs and care. In light of this, it would be safe to suggest that

these dogs and cats likely participate as a member of the family in many, if not most

cases. Though horses may be viewed in such a light by recreational riders, Florida has

a large Thoroughbred industry which generally regards horses as a financial investment

and these animals make up a large proportion of the equine caseload at the facilities

sampled. However, horses are intensely managed so most are in direct contact with

people daily. The intense management on one hand and the close contact with owners

on the other provides a natural source of interaction that may allow for transmission of

bacteria between people and these animals.

In light of the prevalence of MRSA in the human population, isolation of this

bacterium in pets was anticipated. The overall prevalence of MRSA in our pet

population was low, suggesting that it is not very common, but similar to findings by

others in the veterinary literature (86) as well as in the human literature (6). There is

also some evidence to suggest that animals are able to clear the infection, both in this

work and in others (95), which supports the idea that the threat MRSA poses to

veterinary patients is less than in people. The MRSA strains that were isolated did

demonstrate multi-drug resistance, so early identification of these cases will help

improve clinical outcomes by directing therapeutic choices. Submitting culture and









sensitivity of infected wounds, recurring abscesses, effusions and the like from

symptomatic animals earlier in the course of disease would be clinically indicated in

general, but especially in cases where the owner has known risk factors. Empirical

antibiotic therapy is prevalent in the veterinary field and may work against clinicians in

the long run as it will help propagate antibiotic resistance. However, obtaining culture

status early on would allow the veterinary staff and owners to institute appropriate

measures, such as barrier controls to prevent spread, if the culture identifies MRSA as

the causative agent. Discouraging drastic measures such as euthanasia based on a

MRSA culture should be highlighted as outcome may not be negatively impacted by the

MRSA-positive status (89) and the risk to people can be mitigated through barrier

controls such as gloves and masks.

The identification of 4 USA300 strains was not anticipated. These strains harbored

known virulence factors seen in human-derived USA300 strains. It would be of value to

know the colonization status as well as the occupation of the owners of these cases to

help determine the original source of infection. Further studies investigating the

colonization of the general population and their pets would be of value to helping fully

determine the potential role that pets serve in reservoiring. The identification of grand

psm in all the MRSA and MSSA isolates tested requires further investigation to

determine the true relevance of these findings. Performing full isolate sequencing or

performing PCR with overlapping targets would help identify what lies to either side of

the sequence obtained and allow assessment of its role in disease processes. The two

MSSA isolates which had harbored 4 or 5 of the genes of interest also deserve further

evaluation. Having these two isolates typed with PFGE would determine if they are truly









USA300 MSSAs or if they have an altered SCCmeclVa. This would also help fully

establish the identity of control #2A as a MSSA or, as we suggest, as a MRSA.

Additionally, it would be interesting to evaluate these strains for virulence in a rabbit

model or against human PMN cells and determine if they produce the degree of disease

expected. Moving forward, typing of animal-derived MRSA strains should also be

pursued more actively to determine strain source and further characterize the circulating

strains. For diagnostic laboratories, the use of a bench-side latex agglutination test to

identify PBP2a could be implemented to assist in identifying cases that demonstrate

heterogenous resistance of methicillin.









LIST OF REFERENCES


1. Winn WC, Jr., Allen SD, Janda WM, Koneman EW, Procop GW,
Schreckenberger PC, et al. Koneman's Color Atlas and Textbook of Diagnostic
Microbiology. Sixth ed. Baltimore: Lippincott Williams & Wilkins; 2006.

2. Todar K. Todar's Online Textbook of Bacteriology. Madison; 2008.

3. cocci. Dictionarycom Unabridged: Random House; 2010.

4. Chiller K, Selkin BA, Murakawa GJ. Skin Microflora and Bacterial Infections of
the Skin. J Investig Dermatol Symp Proc. 2001 Dec;6(3):170-4.

5. Bibel D, Aly R, Bayles C, Strauss W, Shinefield H, Maibach H. Competitive
Adherence as a Mechanism of Bacterial Interference. Can J Microbiolo. 1983
Jun;29(6):700-3.

6. Kuehnert MJ, Kruszon-Moran D, Hill HA, McQuillan G, McAllister SK, Fosheim G,
et al. Prevalence of Staphylococcus aureus Nasal Colonization in the United States,
2001-2002. The Journal of Infectious Diseases. 2006;193(2):172-9.

7. Gorwitz RJ, Kruszon-Moran D, McAllister SK, McQuillan G, McDougal LK,
Fosheim GE, et al. Changes in the Prevalence of Nasal Colonization with
Staphylococcus aureus in the United States, 2001-2004. The Journal of Infectious
Diseases. 2008; 197(9): 1226-34.

8. von Eiff C, Becker K, Machka K, Stammer H, Peters G. Nasal Carriage as a
Source of Staphylococcus aureus Bacteremia. N Engl J Med. 2001 January 4,
2001;344(1):11-6.

9. Davis Kepler A, Stewart Justin J, Crouch Helen K, Florez Christopher E,
Hospenthal Duane R. Methicillin-Resistant Staphylococcus aureus (MRSA) Nares
Colonization at Hospital Admission and Its Effect on Subsequent MRSA Infection.
Clinical Infectious Diseases. 2004;39(6):776-82.

10. Stevens A, Hennessy T, Baggett H, Bruden D, Parks D, Klejka J. Methicillin-
Resistant Staphylococcus aureus carriage and risk factors for skin infections,
Southwestern Alaska, USA. Emerg Infect Dis. 2010 May;16(5):797-803.

11. Lowy FD. Staphylococcus aureus Infections. N Engl J Med. 1998 August 20,
1998;339(8):520-32.

12. Hochkeppel HK, Braun DG, Vischer W, Imm A, Sutter S, Staeubli U, et al.
Serotyping and Electron Microscopy Studies of Staphylococcus aureus clinical Isolates
with Monoclonal Antibodies to Capsular Polysaccharide Types 5 and 8. J Clin Microbiol.
1987 March 1, 1987;25(3):526-30.









13. Watts A, Ke D, Wang Q, Pillay A, Nicholson-Weller A, Lee JC. Staphylococcus
aureus Strains That Express Serotype 5 or Serotype 8 Capsular Polysaccharides Differ
in Virulence. Infect Immun. 2005 June 1, 2005;73(6):3502-11.

14. Fournier JM, Bouvet A, Boutonnier A, Audurier A, Goldstein F, Pierre J, et al.
Predominance of Capsular Polysaccharide Type 5 Among Oxacillin-Resistant
Staphylococcus aureus. J Clin Microbiol. 1987 October 1, 1987;25(10): 1932-3.

15. Foster TJ. Immune Evasion by Staphylococci. Nat Rev Micro. 2005;3(12):948-58.

16. Das D, Saha S, Bishayi B. Intracellular Survival of Staphylococcus aureus:
Correlating Production of Catalase and Superoxide Dismutase with Levels of
Inflammatory Cytokines. Inflammation Research. 2008;57(7):340-9.

17. Valeva A, Palmer M, Bhakdi S. Staphylococcal alpha-Toxin: Formation of the
Heptameric Pore Is Partially Cooperative and Proceeds through Multiple Intermediate
Stages. Biochemistry. 1997;36(43): 13298-304.

18. Dinges MM, Orwin PM, Schlievert PM. Exotoxins of Staphylococcus aureus. Clin
Microbiol Rev. 2000 January 1, 2000;13(1):16-34.

19. Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davidson MG, et al. Complete
Genome Sequence of USA300, an Epidemic Clone of Community-Acquired Meticillin-
Resistant Staphylococcus aureus. The Lancet. 2006 March 4, 2006;367(9512):731-9.

20. Diep BA, Otto M. The Role of Virulence Determinants in Community-Associated
MRSA Pathogenesis. Trends in Microbiology. 2008;16(8):361-9.

21. Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter M-O, Gauduchon V, et al.
Involvement of Panton-Valentine Leukocidin-Producing Staphylococcus aureus in
Primary Skin Infections and Pneumonia. Clinical Infectious Diseases. 1999;29(5):1128-
32.

22. Nygaard TK, DeLeo FR, Voyich JM. Community-Associated Methicillin-Resistant
Staphylococcus aureus Skin Infections: Advances Toward Identifying the Key Virulence
Factors. Current Opinion in Infectious Diseases. 2008;21(2):147-52.

23. Diep BA, Stone GG, Basuino L, Graber CJ, Miller A, des Etages S, et al. The
Arginine Catabolic Mobile Element and Staphylococcal Chromosomal Cassette mec
Linkage: Convergence of Virulence and Resistance in the USA300 Clone of Methicillin-
Resistant Staphylococcus aureus. The Journal of Infectious Diseases.
2008; 197(11): 1523-30.









24. Montgomery CP, Boyle-Vavra S, Daum RS. The Arginine Catabolic Mobile
Element Is Not Associated with Enhanced Virulence in Experimental Invasive Disease
Caused by the Community-Associated Methicillin-Resistant Staphylococcus aureus
USA300 Genetic Background. Infect Immun. 2009 July 1, 2009;77(7):2650-6.

25. Wang R, Braughton KR, Kretschmer D, Bach T-HL, Queck SY, Li M, et al.
Identification of Novel Cytolytic Peptides as Key Virulence Determinants for Community-
Associated MRSA. Nat Med. 2007;13(12):1510-4.

26. Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and Food Poisoning.
Genet Mol Res. 2003;2(1):63-76.

27. DBD. Staphylococcal Food Poisoning. [web page] 2006 [cited Dec. 9, 2009];
Available from:
http://www.cdc.gov/ncidod/dbmd/diseaseinfo/staphylococcus_food_g.htm

28. FDA. Bad Bug Book: Foodborne Pathogenic Microorganisms and Natural Toxins
Handbook: Staphylococcus aureus. 2009 [cited; May 4, 2009:[Available from:
http://www.fda.gov/Food/FoodSafety/Foodbornelllness/FoodbornelIllnessFoodbornePath
ogensNaturalToxins/BadBugBook/ucm070015.htm

29. Todar K. Todar's Online Textbook of Bacteriology. Madison; 2008.

30. Murphy K, Travers P, Walport M. Janeway's Immunobiology. Seventh ed. New
York: Garland Science; 2008.

31. Chain E, Florey HW, Gardner AD, Heatley NG, Jennings MA, Orr-Ewing J, et al.
The Classic: Penicillin as a Chemotherapeutic Agent. Clinical Orthopaedics and Related
Research. 2005 October Volume 439 23-6.

32. Rammelkamp CH, Keefer CS. Penicillin: Its Antibacterial Effect in Whole Blood
and Serum for the Hemolytic Streptococcus and Staphylococcus aureus. Journal of
Clinical Investigation. 1943;22(5):649-57.

33. Poole K. Resistance to 1-lactam Antibiotics. Cellular and Molecular Life
Sciences. 2004;61(17):2200-23.

34. Munch-Petersen E, Boundy C. Yearly Incidence of Penicillin-Resistant
Staphylococci in Man Since 1942. Bull World Health Organ. 1962;26(2):241-52.

35. Martyn G. Staphylococci in the Newborn. Br Med J. 1949;1(1607):710-2.

36. Chambers HF, DeLeo FR. Waves of Resistance: Staphylococcus aureus in the
Antibiotic Era. Nat Rev Micro. 2009;7(9):629-41.

37. Jevon MP. 'Celbenin'-Resistant Staphylococci. BMJ. 1961;1:124-5.









38. Brakstad O, Maeland J. Mechanisms of Methicillin Resistance in Staphylococci.
APMIS. 1997 Apr;105(4):264-76.

39. CDC. Staphylococcal Food Poisoning. 2006 [cited Dec. 9, 2009]; Available
from: http://www.cdc.gov/ncidod/dbmd/diseaseinfo/staphylococcus_food_g.htm

40. Couto I, de Lencastre H, Severina E, Kloos W, Webster J, Hubner R, et al.
Ubiquitous Presence of a mecA Homologue in Natural Isolates of Staphylococcus sciuri.
Microb Drug resist. 1996 Winter;2(4):377-91.

41. de Lencastre H, Oliveira D, Tomasz A. Antibiotic Resistant Staphylococcus
aureus: a Paradigm of Adaptive Power. Current Opinion in Microbiology.
2007; 10(5):428-35.

42. Pantosti A, Sanchini A, Monaco M. Mechanisms of Antibiotic Resistance in
Staphylococcus aureus. Future Microbiology. 2007;2(3):323-34.

43. Dancer S. The Problem with Cephalosporins. J Antimicrob Chemother.
2001;48(4):463-78.

44. Panlilio A, Culver D, Gaynes R, Banerjee S, Henderson T, Tolson J, et al.
Methicillin-resistant Staphylococcus aureus in U.S. hospitals, 1975-1991. Infect Control
Hosp Epidemiol. 1992;13(10):582-6.

45. Klevens RM, Edwards Jonathan R, Tenover Fred C, McDonald LC, Horan T,
Gaynes R. Changes in the Epidemiology of Methicillin-Resistant Staphylococcus aureus
in Intensive Care Units in US Hospitals, 1992-2003. Clinical Infectious Diseases.
2006;42(3):389-91.

46. Klein E, Smith DL, Laxminarayan R. Hospitalizations and Deaths Caused by
Methicillin-Resistant Staphylococcus aureus, United States, 1999-2005. Emerg Infect
Dis. 2007 December 2007; 13(12): 1840-6.

47. Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, Ray S, et al. Invasive
Methicillin-Resistant Staphylococcus aureus Infections in the United States. JAMA.
2007 October 17, 2007;298(15): 1763-71.

48. McDougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK, Tenover
FC. Pulsed-Field Gel Electrophoresis Typing of Oxacillin-Resistant Staphylococcus
aureus Isolates from the United States: Establishing a National Database. J Clin
Microbiol. 2003 November 1, 2003;41(11):5113-20.

49. Morrison MA, Hageman JC, Klevens RM. Case Definition for Community-
Associated Methicillin-Resistant Staphylococcus aureus. Journal of Hospital Infection.
2006;62(2):241.









50. Moran GJ, Krishnadasan A, Gorwitz RJ, Fosheim GE, McDougal LK, Carey RB,
et al. Methicillin-Resistant S. aureus Infections among Patients in the Emergency
Department. N Engl J Med. 2006 August 17, 2006;355(7):666-74.

51. Herold BC, Immergluck LC, Maranan MC, Lauderdale DS, Gaskin RE, Boyle-
Vavra S, et al. Community-Acquired Methicillin-Resistant Staphylococcus aureus in
Children With No Identified Predisposing Risk. JAMA. 1998 February 25,
1998;279(8):593-8.

52. CDC. Four Pediatric Deaths from Community-Acquired Methicillin-Resistant
Staphylococcus aureus -- Minnesota and North Dakota, 1997-1999. MMWR; 1999. p.
707-10.

53. CDC. Methicillin-Resistant Staphylococcus aureus Skin or Soft Tissue Infections
in a State Prison --- Mississippi, 2000. MMWR; 2001. p. 919-22.

54. Zinderman C, Conner B, Malakooti M, LaMar J, Armstrong A, Bohnker B.
Community-acquired methicillin-resistant Staphylococcus aureus among military
recruits. Emerg Infect Dis. 2004 May;10(5):941-4.

55. Ellis Michael W, Hospenthal Duane R, Dooley David P, Gray Paula J, Murray
Clinton K. Natural History of Community-Acquired Methicillin-Resistant Staphylococcus
aureus Colonization and Infection in Soldiers. Clinical Infectious Diseases.
2004;39(7):971-9.

56. Kazakova SV, Hageman JC, Matava M, Srinivasan A, Phelan L, Garfinkel B, et
al. A Clone of Methicillin-Resistant Staphylococcus aureus among Professional Football
Players. N Engl J Med. 2005 February 3, 2005;352(5):468-75.

57. Lee Nolan E, Taylor Melanie M, Bancroft E, Ruane Peter J, Morgan M, McCoy L,
et al. Risk Factors for Community-Associated Methicillin-Resistant Staphylococcus
aureus Skin Infections among HIV-Positive Men Who Have Sex with Men. Clinical
Infectious Diseases. 2005;40(10): 1529-34.

58. Maree CL, Daum RS, Boyle-Vavra S, Matayoshi K, Miller LG. Community-
Associated Methicillin-Resistant Staphylococcus aureus Isolates Causing Healthcare-
Associated Infections. Emerg Infect Dis. 2007 February 2007;13(2):236-42.

59. David MZ, Glikman D, Crawford SE, Peng J, King KJ, Hostetler MA, et al. What
Is Community-Associated Methicillin-Resistant Staphylococcus aureus? The Journal of
Infectious Diseases. 2008;197(9): 1235-43.

60. Klevens RM, Morrison MA, Fridkin SK, Reingold A, Petit S, Gershman K, et al.
Community-Associated Methicillin-Resistant Staphylococcus aureus and Healthcare
Risk Factors. Emerg Infect Dis. 2006 Dec 2006;12(12):[serial on the Internet].









61. Shopsin B, Gomez M, Montgomery SO, Smith DH, Waddington M, Dodge DE, et
al. Evaluation of Protein A Gene Polymorphic Region DNA Sequencing for Typing of
Staphylococcus aureus Strains. J Clin Microbiol. 1999 November 1, 1999;37(11):3556-
63.

62. Tenover FC, Goering RV. Methicillin-Resistant Staphylococcus aureus Strain
USA300: Origin and Epidemiology. J Antimicrob Chemother. 2009 September 1,
2009;64(3):441-6.

63. Johnson JK, Khoie T, Shurland S, Kreisel K, Stine OC, Roghmann M-C. Skin and
Soft Tissue Infections Caused by Methicillin-Resistant Staphylococcus aureus USA300
Clone. Emerg Infect Dis. 2007 August 2007; 13(8): 1195-200.

64. Jaggi P, Paule SM, Peterson LR, Tan TQ. Characteristics of Staphylococcus
aures Infections, Chicago Pediatric Hospital. Emerg Infect Dis. 2007 February
2007;13(2):311-4.

65. Okuma K, Iwakawa K, Turnidge JD, Grubb WB, Bell JM, O'Brien FG, et al.
Dissemination of New Methicillin-Resistant Staphylococcus aureus Clones in the
Community. J Clin Microbiol. 2002 November 1, 2002;40(11):4289-94.

66. Diep BA, Chan L, Tattevin P, Kajikawa O, Martin TR, Basuino L, et al.
Polymorphonuclear Leukocytes Mediate Staphylococcus aureus Panton-Valentine
Leukocidin-lnduced Lung Inflammation and Injury. Proceedings of the National
Academy of Sciences. 2010 March 23, 2010;107(12):5587-92.

67. Diep BA, Palazzolo-Ballance AM, Tattevin P, Basuino L, Braughton KR, Whitney
AR, et al. Contribution of Panton-Valentine Leukocidin in Community-Associated
Methicillin-Resistant Staphylococcus aureus Pathogenesis. PLoS ONE.
2008;3(9):e3198.

68. Verkaik Nelianne J, Dauwalder O, Antri K, Boubekri I, de Vogel Corne P, Badiou
C, et al. Immunogenicity of Toxins During Staphylococcus aureus Infection. Clinical
Infectious Diseases. 2010;50(1):61-8.

69. Bubeck Wardenburg J, Bae T, Otto M, DeLeo FR, Schneewind O. Poring Over
Pores: [alpha]-Hemolysin and Panton-Valentine Leukocidin in Staphylococcus aureus
Pneumonia. Nat Med. 2007 December 2007;13(12):1405-6.

70. Voyich JM, Otto M, Mathema B, Braughton KR, Whitney AR, Welty D, et al. Is
Panton-Valentine Leukocidin the Major Virulence Determinant in Community-Associated
Methicillin-Resistant Staphylococcus aureus Disease? The Journal of Infectious
Diseases. 2006;194(12):1761-70.









71. Loffler B, Hussain M, Grundmeier M, Bruck M, Holzinger D, Varga G, et al.
Staphylococcus aureus Panton-Valentine Leukocidin Is a Very Potent Cytotoxic Factor
for Human Neutrophils. PLoS Pathog. 2010;6(1):e1000715.

72. Bonnstetter KK, Wolter DJ, Tenover FC, McDougal LK, Goering RV. Rapid
Multiplex PCR Assay for Identification of USA300 Community-Associated Methicillin-
Resistant Staphylococcus aureus Isolates. J Clin Microbiol. 2007 January 1,
2007;45(1): 141-6.

73. Goering RV, McDougal LK, Fosheim GE, Bonnstetter KK, Wolter DJ, Tenover
FC. Epidemiologic Distribution of the Arginine Catabolic Mobile Element among
Selected Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus
Isolates. J Clin Microbiol. 2007 June 1, 2007;45(6):1981-4.

74. Degnan BA, Palmer JM, Robson T, Jones CED, Fischer M, Glanville M, et al.
Inhibition of Human Peripheral Blood Mononuclear Cell Proliferation by Streptococcus
pyogenes Cell Extract Is Associated with Arginine Deiminase Activity. Infect Immun.
1998 July 1, 1998;66(7):3050-8.

75. Degnan BA, Fontaine MC, Doebereiner AH, Lee JJ, Mastroeni P, Dougan G, et
al. Characterization of an Isogenic Mutant of Streptococcus pyogenes Manfredo
Lacking the Ability To Make Streptococcal Acid Glycoprotein. Infect Immun. 2000 May
1, 2000;68(5):2441-8.

76. Hongo I, Baba T, Oishi K, Morimoto Y, Ito T, Hiramatsu K. Phenol-Soluble
Modulin alpha3 Enhances the Human Neutrophil Lysis Mediated by Panton-Valentine
Leukocidin. The Journal of Infectious Diseases. 2009;200(5):715-23.

77. Devriese LA, Vandamme LR, Famere L. Methicillin (Cloxacillin)-Resistant
Staphylococcus aureus Strains Isolated from Bovine Mastitis Cases. Zbl Vet B.
1972;19:598-605.

78. Lilenbaum W, Nunes ELC, Azeredo MAI. Prevalence and Antimicrobial
Susceptibility of Staphylococci Isolated from the Skin Surface of Clinically Normal Cats.
Letters in Applied Microbiology. 1998;27(4):224-8.

79. Kania SA, Williamson NL, Frank LA, Wilkes RP, Jones RD, Bemis DA. Methicillin
Resistance of Staphylococci Isolated from the Skin of Dogs with Pyoderma. American
Journal of Veterinary Research. 2004;65(9): 1265-8.

80. Middleton JR, Fales WH, Luby CD, Oaks JL, Sanchez S, Kinyon JM, et al.
Surveillance of Staphylococcus aureus in Veterinary Teaching Hospitals. J Clin
Microbiol. 2005 June 1, 2005;43(6):2916-9.

81. Voss A, Loeffen F, Bakker J, Klaassen C, Wulf M. Methicillin-Resistant
Staphylococcus aureus in Pig Farming. Emerg Infect Dis. 2005;11:1965-6.









82. Cefai C, Ashurst S, Owens C. Human Carriage of Methicillin-Resistant
Staphylococcus aureus Linked with Pet Dog. The Lancet. 1994;344(8921):539-40.

83. Strommenger B, Kehrenberg C, Kettlitz C, Cuny C, Verspohl J, Witte W, et al.
Molecular Characterization of Methicillin-Resistant Staphylococcus aureus Strains from
Pet Animals and their Relationship to Human Isolates. J Antimicrob Chemother. 2006
March 1, 2006;57(3):461-5.

84. Malik S, Coombs GW, O'Brien FG, Peng H, Barton MD. Molecular Typing of
Methicillin-Resistant Staphylococci Isolated from Cats and Dogs. J Antimicrob
Chemother. 2006 August 1, 2006;58(2):428-31.

85. Rich M, Roberts L. MRSA in Companion Animals. Vet Rec. 2004;159:535-6.

86. Abbott Y, Leggett B, Rossney AS, Leonard FC, Markey BK. Isolation Rates of
Meticillin-Resistant Staphylococcus aureus in Dogs, Cats and Horses in Ireland. Vet
Rec. 2010;166:451-5.

87. Jones RD, Kania SA, Rohrbach BW, Frank LA, Bemis DA. Prevalence of
Oxacillin- and Multidrug-Resistant Staphylococci in Clinical Samples from Dogs: 1,772
Samples (2001-2005). Journal of the American Veterinary Medical Association.
2007;230(2):221-7.

88. Soares Magalhaes R, Loeffler A, Lindsay J, Rich M, Roberts L, Smith H, et al.
Risk Factors for Methicillin-Resistant Staphylococcus aureus (MRSA) Infection in Dogs
and Cats: a Case-Control Study. Vet Rec. 2010;41(5):55.

89. Faires MC, Tater KC, Weese JS. An Investigation of Methicillin-Resistant
Staphylococcus aureus Colonization in People and Pets in the Same Household with an
Infected Person or Infected Pet. JAVMA. 2009 September 1, 2009;235(5):540-3.

90. Weese JS, Archambault M, Willey BM, Dick H, Hearn P, Kreiswirth BN, et al.
Methicillin-Resistant Staphylococcus aureus in Horses and Horse Personnel, 2000-
2002. Emerg Infect Dis. 2005 March 2005;11(3):430-5.

91. Weese JS, Rousseau J, Willey BM, Archambault M, McGeer A, Low DE.
Methicillin-Resistant Staphylococcus aureus in Horses at a Veterinary Teaching
Hospital: Frequency, Characterization, and Association with Clinical Disease. Journal of
Veterinary Internal Medicine. 2006;20(1): 182-6.

92. Weese JS, DaCosta T, Button L, Goth K, Ethier M, Boehnke K. Isolation of
Methicillin-Resistant Staphylococcus aureus from the Environment in a Veterinary
Teaching Hospital. Journal of Veterinary Internal Medicine. 2004; 18(4):468-70.









93. de Neeling AJ, van den Broek MJM, Spalburg EC, van Santen-Verheuvel MG,
Dam-Deisz WDC, Boshuizen HC, et al. High Prevalence of Methicillin Resistant
Staphylococcus aureus in Pigs. Veterinary Microbiology. 2007;122(3-4):366-72.

94. Khanna T, Friendship R, Dewey C, Weese JS. Methicillin Resistant
Staphylococcus aureus Colonization in Pigs and Pig Farmers. Veterinary Microbiology.
2008; 128(3-4):298-303.

95. Baptiste KE, Williams K, Willams NJ, Wattret A, Clegg PD, Dawson S, et al.
Methicillin-Resistant Staphylococci in Companion Animals. Emerg Infect Dis. 2005 Dec
2005; 11(12): 1942-4.

96. van Duijkeren E, Wolfhagen MJHM, Box ATA, Heck MEOC, Wannet WJB, Fluit
AC. Human-to-Dog Transmission of Methicillin-Resistant Staphylococcus aureus.
Emerg Infect Dis. 2004 December 2004;10(12):2235-7.

97. Weese JS, Dick H, Willey BM, McGeer A, Kreiswirth BN, Innis B, et al.
Suspected Transmission of Methicillin-Resistant Staphylococcus aureus Between
Domestic Pets and Humans in Veterinary Clinics and In the Household. Veterinary
Microbiology. 2006; 115(1-3):148-55.

98. CDC. MRSA in Healthcare Settings. 2007 [cited Dec. 7, 2009]; Available from:
http://www.cdc.gov/ncidod/dhqp/ar_MRSAspotlight_2006.html

99. DHQP. Laboratory Detection of: Oxacillin/Methicillin-Resistant Staphylococcus
aureus. [web page] 2005 [cited April 6, 2007.]; Available from:
http://www.cdc.gov/ncidod/dhqp/ar_lab_mrsa.html

100. Juhasz-Kaszanyitzky E, Janosi S, Somogyi P, Dan A, van der Graaf-van Bloois
L, van Duijkeren E, et al. MRSA Transmission Between Cows and Humans. Emerg
Infect Dis. 2007 April 2007;13(4):630-2.

101. Tenover FC, McDougal LK, Goering RV, Killgore G, Projan SJ, Patel JB, et al.
Characterization of a Strain of Community-Associated Methicillin-Resistant
Staphylococcus aureus Widely Disseminated in the United States. J Clin Microbiol.
2006 January 1, 2006;44(1):108-18.

102. Kennedy AD, Otto M, Braughton KR, Whitney AR, Chen L, Mathema B, et al.
Epidemic Community-Associated Methicillin-Resistant Staphylococcus aureus: Recent
Clonal Expansion and Diversification. Proceedings of the National Academy of
Sciences. 2008 January 29, 2008;105(4):1327-32.

103. van Duijkeren E, Jansen MD, Flemming SC, de Neeling H, Wagenaar JA,
Schoormans AHW, et al. Methicillin-Resistant Staphylococcus aureus in Pigs with
Exudative Epidermitis. Emerg Infect Dis. 2007;13(9):1408-10.









104. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H,
et al. ClustalW and ClustalX version 2.0. Bioinformatics 2007;23(21):2947-8.









BIOGRAPHICAL SKETCH

Katherine Lynn Maldonado attended the University of Florida where she received

her Bachelor of Science in animal sciences with an emphasis in animal biology in 2002.

She was admitted to the early admission program at the College of Veterinary Medicine

and received her Doctor of Veterinary Medicine degree in 2006. Following a short time

in mixed animal practice, she returned to the University of Florida to pursue further

graduate studies. In December 2009 she received her Master in Public Health degree.

While finishing her graduate studies, Dr. Maldonado worked as a full-time veterinary

associate with Banfield, the Pet Hospital in small animal practice.





PAGE 1

MICROBIOLOGICAL SURVEY FOR METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN VETERINARY PATIENTS AND GENOTYPIC CHARACTERIZATION OF THE ISOLATES By KATHERINE LYNN MALDONADO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010 1

PAGE 2

2010 Katherine Lynn Maldonado 2

PAGE 3

To my parents who taught me to follo w my dreams and imbued me with an eternal curiosity and appreciation for life. 3

PAGE 4

ACKNOWLEDGMENTS This work would not have been possible without assistance, guidance, and support from many. However, Dr. Maureen Long is due special thanks for her vision, support, and mentoring. Wit hout her, none of this would ever have happened and I thank her for her constant belief in me. I al so thank my other co mmittee members, Dr. Judith Johnson and Dr. Charles Courtney for their valuable insight and help in the preparation of this manuscrip t and project. To my lab mate, Dr. Melissa Bourgeois without whom I would never have completed this work, I am especially thankful and forever indebted. Dr. Paul Gibbs has been a wonderful sounding board and friend and is due special thanks. I appreciate the help of Crystal Schuman and the members of the College of Veterinary Medicines Microbi ology Laboratory for their assistance in teaching me techniques and offering technical assistance in bacterial culturing. Dr. Paul Fiorella of the Florida Depar tment of Health Bureau of Labor atories was instrumental in typing the strains. Amber Menendez, Shannon Roff, Carmen-Susan Glotfelty, and An Nguyen were all involved in various aspects of the project and their assistance is highly appreciated. I also thank the members of the EDART lab in which the majority of this work was carried out for their support and assistance. The staff memb ers of the College of Veterinary Medicines Veterinary Medica l Center, All Cats HealthCare Clinic, and Equine Medical Center of Ocal a were key in helping me obtain the samples used in this work and deserve my sincerest thanks. Lastly, I thank my family and friends for their constant support, love, and patience while under taking this project I know it was not always easy. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4LIST OF TABLES ............................................................................................................ 7LIST OF FIGURES .......................................................................................................... 8LIST OF ABBREVIATIONS ............................................................................................. 9ABSTRACT ................................................................................................................... 11CHAPTER 1 LITERATURE REVIEW .......................................................................................... 13General Overview of Staphylococcus ..................................................................... 13Pathogenicity of Staphylococcus aureus ................................................................ 14Bacterial Virulence Factors ............................................................................... 14History of Antibiotic Resistance ........................................................................ 21Hospital-Acquired Versus Community-Associated MRSA ...................................... 23Epidemiology of MRSA ..................................................................................... 23Molecular Epidemiology and Virulence of CA-MRSA ....................................... 27MRSA in Animals .................................................................................................... 322 MICROBIOLOGICAL SURVEY AND NASAL COLONIZATION RATE DETERMINATION OF ME THICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN PATIENTS AT THREE SECONDARY/TERTIARY VETERINARY CARE FACILITIES IN FLOR IDA ............................................................................. 38Background ............................................................................................................. 38Methods .................................................................................................................. 41Animal Sampling .............................................................................................. 41Microbiological Testing ..................................................................................... 42MIC Analysis of MRSA and MSSA Isolates ...................................................... 43Pulsed Field Gel Electrophoresis ..................................................................... 43Results .................................................................................................................... 44Microbiological Results ..................................................................................... 44Antibiotic Resistance ........................................................................................ 45Pulsed-Field Gel Electrophoresis ..................................................................... 45Discussion .............................................................................................................. 463 GENOTYPIC CHARACTERIZATION AND SEQUENCING OF THE MRSA ISOLATES .............................................................................................................. 52Background ............................................................................................................. 52 5

PAGE 6

Materials and Methods ............................................................................................ 54S. aureus Isolates ............................................................................................. 54Microbiological Techniques .............................................................................. 54DNA Isolation and PCR .................................................................................... 55Results .................................................................................................................... 57Discussion .............................................................................................................. 584 CONCLUS IONS ..................................................................................................... 63LIST OF REFERENCES ............................................................................................... 66BIOGRAPHICAL SKETCH ............................................................................................ 76 6

PAGE 7

LIST OF TABLES Table page 1-1 CDC case definition for community-associated MRSA ........................................... 372-1 Number of species swabbed, number of samples processed, and resulting prevalence rates of MRSA in dog, ca t, and horses patients of 3 secondary and tertiary care facilities in North-Central Florida .................................................. 492-2 Overall antibiotic class resistanc e between MRSA isolates and the MSSA control isolates obtained from dog, cat, and horse patients of 3 secondary and tertiary care facilities in North-Central Florida ......................................................... 493-1 Date of collection for case (MRSA) and control (MSSA) isolates, the number of days difference between the collection dates, and the species of origin. ................ 613-2 Primer sequences used for PCR analysis ............................................................... 613-3 Results of PCR analysis for all five genes in every MRSA case and its corresponding two MSSA control isolates ............................................................... 62 7

PAGE 8

LIST OF FIGURES Figure page 2-1 Dendogram showing the re latedness of the 6 MRSA isolates obtained from dog, cat, and horse patients of 3 secondary and tertiary care facilities in NorthCentral Florida as compared to commonly circulating USA300 strains. Source species is listed. Scale bar indicates genetic relatedness. ...................................... 502-2 Antibiograms obtained from 6 MRSA isol ates from dog, cat, and horse patients of 3 secondary and tertiary care faci lities in North-Central Florida. ......................... 51 8

PAGE 9

LIST OF ABBREVIATIONS ACME arginine catabolic mobile element ATCC American type culture collection BA blood agar bp base pair CA-MRSA community-associated methicillin-resistant Staphylococcus aureus CC clonal complex CHIPS chemotaxis inhibitory protein of staphylococci CI confidence interval CNA colistin and nalidixic acid DEPC diethylpyrocarbonate DNA deoxyribonucleic acid HA-MRSA hospital-acquired methicillin-resistant Staphylococcus aureus J junkyard region of the SCCmec MIC minimum inhibitory concentration MLST multilocus sequence typing MRSA Methicillin-resistant Staphylococcus aureus MRSI methicillin-resistant Staphylococcus intermedius MSSA Methicillin-sensitive Staphylococcus aureus OR odds ratio PBP/PBP2a/PBP2 penicillin binding protein PCR polymerase chain reaction PFGE pulsed-field gel electrophoresis PFT pulsed-field type PMN polymorphonuclear cell 9

PAGE 10

PSM phenol solu ble modulin PVL Panton-Valent ine leukocidin SCC staphylococcal chromosomal cassette SE staphylococcal enterotoxin SP sampling period ST strain type TSST toxic shock syndrome toxin 10

PAGE 11

Abstract of Thesis Pres ented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Master of Science MICROBIOLOGICAL SURVEY FOR METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN VETERINARY PATIENTS AND GENOTYPIC CHARACTERIZATION OF THE ISOLATES By Katherine Lynn Maldonado August 2010 Chair: Maureen T. Long Major: Veterinary Medical Sciences A convenience sampling was performed at 3 secondary and tertiary care veterinary facilities in Flor ida to determine the prevalen ce of methicillin-resistant Staphylococcus aureus (MRSA) nasal colonization in the canine, feline, and equine pet populations. Nasal swabs were colle cted and processed following standard microbiological techniques. Full antibiogram s were performed to confirm antibiotic resistance and pulsed-field gel electrophoretic (PFGE) characterization was used to determine the strain. Each MRSA isolate was matched to 2 methicillin-sensitive S. aureus (MSSA) and PCR was performed to identify vi rulence factors. Positive isolates were submitted for sequencing and the sequences were aligne d. The overall prevalence was low as only 6 isolates were determined to be MRSA of 966 patients sampled; 4 of these were the community-acquired USA3 00 strain based on PFGE. The recovered MRSA isolates demonstrated mult i-drug resistance. The 5 genes tested were present in all 4 USA300 and in 1 MSSA. Another M SSA had 4 of 5 genes. The nontypeable MRSA and the remaining MSSA only had 2 genes present. Though of low prevalence, 4 of the MRSA isolates obtained were USA300 clones and carried similar virulence factors to 11

PAGE 12

12 the strains circulating in t he human population. This finding is of particular concern given the potential threat this st rain poses to people.

PAGE 13

CHAPTER 1 LITERATURE REVIEW General Overview of Staphylococcus Staphylococcus species are ubiquitous non-motile, non-spore-forming Gram positive cocci bacteria that produce catalase which grow principally as facultative anaerobes. Taxonomically, the Staphylococcus genus falls under the phylum Firmicutes, class Ba cilli, Bacillales order and Staphylococcaceae family. Members of this genus are characterized by being round, typically 1m in diameter and can be found as single cells, pairs, or tetrads t hough they are prone to clumping into bunches (1, 2), giving rise to the cocci desi gnation, a name deriv ed from the Greek kkkus which means grain, seed, or berry (3). Phenotypically, the staphy lococci are usually further classified according to the presence of the active coagulase enzymes which induces rabbit plasma to clot. Staphylococci are found on the skin and on the mucous membranes of humans and animals; many strains are host specific and may or may not cause disease in the host. Commensal bacteria colonize the skin, filling an environmental niche and helping to protect the host from colonization by pathogenic bacteria by competing for nutrients and preventing the adherence of pathogenic bacteria (4, 5). They can also directly deter pathogenic bacteria by excreting toxic metabo lites which make the local environment untenable to other bacteria (4). In humans, commensal staphylococci are generally coagulase-negative species with S. epidermidis and S. hominis being the most commonly identified. Phenotypically, S. aureus itself is coagulase-positive and causes a double-zone of hemolysis on blood agar. Though coagulasepositive species are more frequently 13

PAGE 14

pathogenic than coagulasenegative species, S. aureus can also be a normal commensal species of humans. A national study performed in 2000-2001 estimated the weighted S. aureus colonization prevalence to be 32.4% (95% CI, 30-7%-34.1%) or 89.4 million people (95% CI, 84.8-94.1 million people) in the USA with the highest prevalence seen in 6-11 year olds (6). A second prevalence study performed in 20032004 found that the rate of S. aureus colonization had decreased to a weighted prevalence of 28.6% (95% CI, 27.2%-30.0%), or 78.9 milli on people (95% CI, 75.0-82.9 million people) (7). Though these studies meas ured colonization at a single time point, some of those identified as colonized ma y only have been transiently populated with the organism. However, other studies hav e shown that colonization by S. aureus is a risk factor for developing subsequent oppor tunistic infection (8). Staphylococcus aureus has evidence of antibiotic resistance. While investigating the rate of methicillin-resistant S. aureus (MRSA) nasal colonization in people in the USA, the authors of the st udy determined that the prev alence in 2003-2004 was 1.5% (95% CI 1.2%-1.8%), up from 0.8% (95% CI 0.5%-1 .4%) in 2001-2002 (6, 7). As researchers have demonstrated that perso ns nasally colonized by MRSA have an increased risk of developing subsequent clinical conditions (8, 9) vers us those colonized by methicillin-sensitive S. aureus (MSSA) or not colonized at all (10), the risk to the public cannot be discounted. Pathogenicity of Staphylococcus aureus Bacterial Virulence Factors Several known and likely many still unknown features of S. aureus account for the tendency of this commensal to become an oppor tunistic infection of humans, causing as many as 50% of all nosocomial infections (11). Although sensitive to ultraviolet light 14

PAGE 15

and drying, this bacterium can survive in organic debris and adapt. The bacterias pathogenicity is determined by various virulence factors, the expression of which varies between various Staphyloccocci and can be chromosomally or plasmid encoded. The mobility of many of these elements allows rapid adaptation to a variety of host environments. To avoid being ingested by the hosts polymorphonuclear cells (PMN) during the immune response, some S. aureus strains produce capsular polysaccharides. These exopolysaccharides have been classified in to 11 types though most pathogenic strains are of capsular serotype 5 or 8 (12, 13) The predominant serotype seen in strains demonstrating antibiotic resist ance against the beta-lactamase class is serotype 5 (14). The presence of the capsule reduces the uptake of the bacteria by PMNs in the presence of opsonins (15). Protein A is another cell wall and surface protein of S. au reus that binds the Fc region of the heavy chain of IgG. This prot ein causes coating of the bacterium with immumoglobulins in the incorrect orientat ion which interferes with opsonization preventing ingestion by the PMNs (15). Protein A is immunogenic and forms the basis of various rapid diagnostic tests in clinical laboratories testing for co-agglutination of other bacteria, such as Streptococcus. The peptidoglycans and techoic acids of the S. aureus cell wall serve a structural role providing rigidity but also contribute to virulence by instigating a chemotactic response by the hosts PMNs and production of opsonic antibodies. However, about 60% of S. aureus strains secrete chemotaxis inhibito ry protein of staphylococci (CHPS) to inhibit PMNs chemotaxis and counter th is innate defense system (15). Techoic acids 15

PAGE 16

help promote adherence of gra m-positive bacteria to mu cosal surfaces. Additional proteins that help the bacterium invade hosttissues such as adhesins, collagen-binding proteins, fibronectin-binding protein, and clumping factor are covalently bound to the peptidoglycan matrix of bacteriums cell wall, further increasing its virulence (1). These surface proteins help prom ote cell invasion (2). In addition to structural proteins, S. aureus secretes many enzymes to assist in evasion of host immune responses or assume a niche in host cell tissue. Used also for diagnostic purposes, catalase production co unters the free radicals formed by the myeloperoxidase system secreted by PMNs extracelluarly or when it is phagocytized. This interaction creates local inflammati on by inducing cytokines (16). Though clumping factor is bound to the pepti doglycan of the cell wall as noted before, it enables the bacteria to bind to fibrin and fibrinogen which then allows fibrinolysins to break down the fibrin and enable spread to surrounding tiss ues. Hyaluronidase functions similarly to fibrinolysins by hydrolyzing the matrix of nearby tissues and thereby allowing local bacterial spread. Coagulase also interacts wit h fibrinogen following the interaction with prothrombin, it activates t he conversion of fibrinogen to fibrin which then coats the bacteria and inhibits opsonization (1). Another set of virulence factors seen in S. aureus is the hemolysins. Alphahemolysin, encoded by hla has lethal effects on various cell types and can lyse erythrocytes of various species as well as human PMN cells. The toxin creates pores in the target cell, which disrupts the ion flow causing osmotic swelling and rupture (17, 18). Diagnostically, this toxin creates the zone of hemolysis around colonies on sheep blood agar. Unlike alpha-hemolysin, beta-hemolysin is not dermonecrotic nor fatal to 16

PAGE 17

animals when injected intravenously but appears to confer some selective advantage (18). Gamma-hemolysin and Pa nton-Valentine leukocidin (PVL) are two-component toxins, meaning that each is made up of tw o unassociated protein components that then assemble into one of six possible forms. Ga mma-hemolysins are found in most strains of S. aureus and their virulence has not been fully c haracterized (18). In contrast, the Luk PV operon is found only in some S. aureus strains, encoded on the prophage SA2usa. The operon encodes the two components, lukS -PV and lukFPV of the Panton-Valentine leukocidin ( PVL) (19, 20), an exotoxin im plicated in causing PMN cell lysis via disruption of the osmotic gradi ent through pore-formation (1, 21). A large percentage of S. aureus strains also create delta-hemolysi n, a toxin proposed to act as a surfactant, disrupting cell membranes allowing for cell lysis (18). Generally associated with a particular strain of S. aureus which will be discussed in detail later, genome analysis of USA300 has identified a genetic island which contains a cluster of six genes known as the arc cluster. These genes allow for the conversion of L-arginine to carbon dioxide, ammonia, and ATP via arginine deiminase pathway (19). Two genes identif ied within the arginine catabo lic mobile element (ACME) may enhance virulence: arc and opp3 The arc gene encodes for an arginine deiminase pathway which depletes L-arginine used in the production of nitric oxide, a molecule used in both innate and adaptive immune responses against bacteria. The opp3 cluster encodes for an oligopeptide permease system a transporter important to nutrient uptake, chemotaxis, quorum s ensing, antimicrobial peptide resistance, and eukaryotic cell adhesion, among others (20) The two clusters serve as surrogate markers for ACME (19). The arginine deiminase pathway has been identified in the core genome of 17

PAGE 18

S. aureus but it is not identical to the ACME found in USA300, where it is located downstream of the SCC mec in the orfX site (19). It is believ ed that the presence of redundant arginine catabolism pathways in this strain improve the strains fitness since arginine has been proven critical for survival in anaerobic conditi ons (22). ACME has been shown to confer a bacterial advantage in a rabbit bacteremia model (23) though it did not cause dermonecrosis or increased seve rity of necrotizing pneumonia in a rat model (24). More recently, bioactive peptides ca lled phenol-soluble modulins (PSM) have been proposed as a principal virulence factor in S. aureus. Though still being investigated, S. aureus produces four shorter and two longer PSM-like peptides, alphaPSM and beta-PSM respectively. It is proposed that these peptides are proinflammatory, thereby triggering an inflammatory response (25). Certain strains of this species have also been shown to possess a variety of genes that allow it to produce ex otoxins, which may persist and damage the host even if the bacteria are eliminated. The diseases asso ciated with these exot oxins are primarily those associated with food-bor ne illness. Typically, S. aureus grows when refrigeration fails or processing requires growth-permissive temperatures as is the case in cheesemaking (26). During bacterial growth, the ente rotoxins are elaborated. If the foodstuff in which the bacteria are present is inges ted, these enterotoxins can then cause inflammation of the lining of the stomach and intestinal tract. The result of this inflammation is gastroenteritis, generally manifesting itself with abdominal cramps, nausea, vomiting, and diarrhea (27). Although there are dissimilariti es between these 18

PAGE 19

proteins, the majority of the SEs have some shared am ino acid sequences, particularly a cystine loop that is believed to play a role in causing emesis (26). Foods that are commonly associated with staphylococcal foodborne illness include meat and meat products; poul try and egg products; milk and dairy products; salads such as egg, tuna, chicken, potato or macar oni; and several types of pastries, especially ones with cream f illings (28). At least 20 different staphylococcal enter otoxins (SEs) have be en identified. They are encoded on genes mostly located on mobile elements that allow the transfer of enterotoxin production ability between strains. However, some isolates carrying the seb enterotoxin have the SE gene in tegrated in the bacteriums chromosomal DNA while others have a mobile plasmid containing the gene (26). Once produced, these SEs are highly stable and resist heat and proteolytic degradat ion. The high heat processing used in sterilization will inactivate most SEs if these are present in low numbers. However, some of the SEs may retain function, depending on the foodstuff being treated and the environmental pH. Staphylococcus aureus enterotoxins can also be superantigens such as TSST which is associated with toxic sh ock syndrome (29).The superantigen capacity of these SEs is due to their ability to cause fever and non-specific T-cell activation. Rather than establishing an adaptive imm une response, the enterotoxin T-cell stimulation results in a massive cascade of cytokines and inflammatory mediators which gives rise to the symptoms associated wit h foodborne illness. The clinical signs of abdominal cramps, vomiting, and diarrhea are thought to be associated with the direct effect of this cytokine release on the gastroi ntestinal epithelium. It may also stimulate the vagus nerve which may subsequently st imulate the centra l emetic center 19

PAGE 20

(chemoreceptor trigger zone) and result in vo miting (26, 30). The cy stine loop that is common to most of the SEs appear s to play a role in stimulating the emetic center, as the SEs that lack the cystine loop based on mutant analyses have absent or reduced emetic capacity (26). Because enterotoxins activate T-cells and the subsequent cytokine cascade, symptoms of staphylococcal foodborne illness normally appear within 30 minutes to eight hours, depending on the infective dose of bacterial SEs consumed in the infected foodstuff. The disease, therefore, has an acute onset but symptoms are typically self-limiting and resolve spontaneously within 24 to 48 hours (26). Colonized food handlers, processors, and preparers could contaminate food and be the source of an outbreak. The presence of S. aureus in animals may also lead to the elaboration enterotoxins and start an outbreak in that fashion. Bo th populations can also have enterotoxin producing MRSA which would further complicate the issue. Non-enterotoxin superantigens have been i dentified in staphyloc occi, which, unlike the enterotoxins, cause much greater systemic effects due to the bodys more widespread response. Categorized as a py rogenic superantigen toxin, toxic shock syndrome toxin-1 (TSST-1) shares three biolog ic characteristics with other superantigen in its class: pyrogenicity, superantigenicity, and the ability to enhance the lethal effects of minute amounts of endotoxin in rabbits up to 100,000 fold (1). The superantigen capacity of TSST-1 involves the nonspecif ic activation of T-cells and subsequent polyclonal T-cell proliferation and cytokine cascade. The resulting illness is a multiorgan dysfunction syndrome involv ing fever, hypotension, and a rash accompanied by a variety of other clinical symptoms dictated by the organ system involved, though 20

PAGE 21

commonly gastrointestinal, renal, and hepatic signs are noted. Given the bodys overwhelming immunologic response, TSST-1 can lead to death from multiorgan failure. History of Antibiotic R esistance Medical advances in therapeutics have continuously sought to overcome the bacterias incursions. Prior to the development of antibiotics, little could be done against this and other bacteria. But the addition of peni cillin to the clinical formulary in 1940 revolutionized medical management of infectious bacterial diseases (31, 32). Penicillin and members of the betalactam antibiotic class are bacteriocidal as they target the bacterial enzymes involved in cell wall bi osynthesis, known as the penicillin binding proteins (PBP), thereby prevent ing cross-linking of the peptidoglycans in the bacterial cell wall and inhibiting cell growth (1, 33). S. aureus soon adapted to the new environmental pressure with some strains developing resistance to the beta-lactam antibiotic within a year (34, 35). These resi stant strains produced penicillinases (also known as beta-lactamases) that attacked the penicillins four-membered beta-lactam ring structure by disrupting t he amide bond of the ring and inactivating the antibiotic (33, 36). These plasmid-encoded penicillin-resi stant strains soon became widespread and comprise the first wave of antibiotic resi stance in the hospital setting, necessitating a new therapeutic option (36). A new line of antibiotics, fortified agai nst the beta-lactamases produced by the bacterium were developed to target these newly resistant strains. Methicillin, a betalactamase-resistant antibiotic was firs t used in 1959 and demonstrated efficacy in inhibiting cell wall synthesis by bacteria despite the presence of beta-lactamases. However reports of resistance to methicillin and members of its class surfaced by 1961, denoting the start of th e second wave of antibiotic resistance (36, 37). These resistant 21

PAGE 22

strains expressed an altered penicillin-binding protein designated PBP2a (or in some studies PBP2 ), which is a transpeptidase that carri es on cell wall synthesis despite the presence of beta-lactam antibiotics. Resist ance is conferred upon the bacteria by the PBP2a proteins decreased affinity for bindi ng the beta-lactam molecule (33, 38). Though methicillin is no longer clinically used, S. aureus strains that exhibit resistance to the beta-lactamase antibiotic class are known as methicillin-resistant S. aureus (MRSA). To meet this classification, a MRSA strain must demonstrate a minimum inhibitory concentration (MIC) of oxacillin (a laboratory standard for the beta-lactamase class) 4g/mL. Alternatively, a zone of inhibition 10mm around an oxacillinimpregnated disk would be considered resist ant when performing a disk diffusion test (39). Resistance to methicillin and the other beta-lactamases in S. aureus followed the acquisition of the mecA gene. The original source of the resistance gene is presumed to be a coagulase-negative staphylococci and studies have identified S. sciuri as the likely donor: a DNA probe for the MRSA mecA hybridized strongly to unrelated S. sciuri isolates. Interestingly, despite the pr esence of the gene, two-thirds of the S. sciuri isolates showed marginal if any resistance to methicillin (40). The mecA gene is embedded in a chromosomal island known as the staphylococcal chromosomal cassette (SCC mec ) that integrates into the S. aureus chromosome at the orfX site (19). Several classes of SCC mec have been identified and have been linked to the documen ted epidemic waves of resistance (36). Three major classes have been defined: class A includes the entire mecA regulon ( mecI-mecR1mecA ) while classes B and C contain the regulon but the order is interrupted by 22

PAGE 23

insertion sequences (41). The SCC mec s ability to move between isolates as well as between species is due to the pres ence of recombinases encoded by the ccr gene complexes present on the casse tte. The size of the SCC mec cassette is believed to impact its ability to transfer between isolat es since the size depends on the number of additional resistance genes encoded in the j unkyard (J) regions (36, 41). The presence of these additional resistance genes are used to classify the SCC mec subtype but also mean that a sensitive strain can become multidrug resistant if it obtains the entire cassette in a single horizontal gene transfer event (42). However, resistance to other antibiotics is not necessarily dependent upon acquisition of the SCC. Spontaneous mutations and positive selection have resulted in resistance to additional antibiotics and antibiotic classes such as the fluoroquinolone s and linezolid (42). Methicillin resistance has also been demonstrated to occur via mecAindependent mechanisms, principally by overproduction of other PBPs or hyperproduc tion of beta-lactamases (33, 38, 43). It stands to reason, therefore, that the presence of antibiotic resistance limits the clinicians ability to prescribe pharmacol ogical agents that will curb the spread of the bacteria. Combine this with the presence of other virulence factors identified in S. aureus and it is evident that the bacterium poses a threat to the wellbeing of people and animals. Hospital-Acquired Versus Community-Associated MRSA Epidemiology of MRSA Following the first reports of resistanc e in 1961 (37), MRSA has been a constant hindrance and potential threat to the hospitalized patient. The bacterium has a predilection for catheter si tes, in-dwelling devices, and surgical incisions; hospital23

PAGE 24

acquired MRSA (HA-MRSA) has historically been a nosocomial infection of concern, but the risk has increased in recent years. A study by Panlilio et al found that nosocomial MRSA infections increased from 2.4% in 1975 to 29% in 1991. The number of beds in a facility impacted the rate of infection, with larger institut ions demonstrating a faster clim b in the number of resistant cases (44). In 2003, >60% of all isolates obtained from all adult patients in intensive care units were MRSA, which translates into a 3.1% annual increase from 1992 to 2003 (45). A retrospective survey of the National Hospital Discharge Survey looking at S. aureusrelated hospitalizations and deat hs between 1999-2005 found that though annual admissions increased ~8% duri ng those years, the number of S. aureus related hospitalizations increased 62% over the sa me time period, fr om 294,570 (95% CI 257,304-331,836) to 477,927 (95% CI 421,665-534,189). St rikingly, the estimated number of MRSA-related hospitalizations more than doubled in the same time period, from 127,036 (95% CI 112,356-141,716) to 278,203 (95% CI 252,788-303,619). The resulting overall rate of S. aureus -related diagnoses per 1,000 hospitalizations increased 50% from 9.17 to 13.79 while MRSA-related discharges per 1,000 hospitalizations more than doubled, from 3.95 to 8.02. In their study, the authors estimated that S. aureus -related deaths averaged ~ 10,800 (range 7,440-13,676) per year but that MRSA-related deaths average d ~5,500 per year (range 3,8909-7,372) (46). In another study, the authors used the Active Bacter ial Core surveillance system to identify MRSA cases in a subset of the national population and extrapolated the findings to the national scale. They estimated that 94,360 invasive MRSA infections occurred 24

PAGE 25

nationwide resulting in 18, 650 deaths in 2005 (47). The estimated number of MRSArelated deaths was 3.3 times higher in the latter study as compared to the first. However, the second study may have introduced bias into the sample by oversampling minorities and the elderly as both were found to have in creased incidence and mortality (47). In part, the increased rate of morbidit y and mortality can be attributed to the increased antibiotic pressure these stra ins encountered with the advancement of therapeutics (43). These hospital-acquired stra ins developed a characteristic pattern of multi-drug resistance, because methicillin-re sistance imparts resistance against the entire beta-lactam class, including the c ephalosporins. Resistance to erythromycin, levofloxacin, and constitutive clindamycin resistance is also commonly found in these strains (48). Nosocomial transfer occurs among hospita lized patients, likely by means of fomite transfer via coloni zed staff or equipment. Over the past 20 years, newer strain s have been noted with in creasing frequency. Initially labeled community-associated because patients diagnosed with these MRSA strains lacked traditional risk factors (49), these strains were thought to be escaped hospital strains that had circulated in the general population. Without antibiotic pressure, these strains had retained their resistance against penicillins but tended not to be multidrug resistant. Community-associated MRSA patients tended to present to emergency rooms with skin and soft tissue co mplaints (50), commonly complaining of a spider bite. The characteristics that define these community-associated MRSA (CA-MRSA) and separate them from the traditional HA-MRSA are listed in Table 1.1 25

PAGE 26

The emergence of MRSA in a population not previously considered at risk was, and continues to be, concer ning. Though reports of isolations from indigenous populations in Australia cropped up in the ear ly 1990s (36), the CA-MRSA strains first came to the forefront in the USA when the University of Chicago Childrens Hospital reported on the increased pr evalence of MRSA in patients with no previous predisposing risk factors. In their retrospective st udy, the authors looked at S. aureus isolates obtained from hospitalized childr en in 1988-1990 and then compared these to isolates from 1993-1995 and found that the number of hospi talizations from CA-MRSA rose and that the prevalence increased from 10 per 100,000 admissions to 259 per 100,000 admissions (51). However, conc ern was heightened when the CDC reported the death of four previously hea lthy children in the Midwest due to respiratory failure or secondary to multi-organ dysfunction caused by MRSA infection; none of the children had any risk factors for the developm ent of traditional HA-MRSA (52). Following the initial reports, CA-MRSA strains were reported in inmates (53), military recruits (54, 55), athletes (56), minority populati ons (47), men who have sex with men (57), and in poor urban adults (50). In a short amount of time, the frequency of outbreaks involving CA-MRSA increased dr amatically. CA-MRSAs have become so prevalent, that though 59% of all skin and so ft tissue infections presenting to 11 emergency departments nationwide were MRSA, 99% of these were communityassociated strains (50). Given th is rate of spread, it was not long before reports of CAMRSA in the hospital setting followed, ma king the original definition for CA-MRSA strains debatable; in some cases the tr aditional HA-MRSA strains have been displaced 26

PAGE 27

by CA-MRSA as the predominant nosocomia l infection (58), making the naming nomenclature outdated (59, 60). Molecular Epidemiology a nd Virulence of CA-MRSA Genetic analysis of MRSA strains has been carried out utilizing a variety of methods such as multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE), and spa typing (61) to better understand this spread. MLST has been used to study the evolution of the bacteria by performing sequence analysis on ~450bp internal fragments of seven housekeepin g genes. Identical sequences are considered to be clones and are assigned to a sequence type (ST) If strains differ by less than three single nucleotide polymorphisms, they are grouped into clonal complexes (CC) (36, 48). PFGE of MRSA strains, al ongside epidemiological resear ch, was used to create a national database of HAand CA-MRSA strains due to the availability of technical knowledge and experience wit h the technique in laboratorie s nationwide. In creating the database, Sma I macrorestriction fragment analysis wa s used to identify several pulsedfield types (PFT). The HA-MRSA strains had PFTs USA100, 200, 500, 600, and 800. USA700 strains were both HAand CA-MRSA while CA-MRSA strains were either USA300 or 400 (48). Additional PFT have been identified. The original CA-MRSA circulating in the Midwest, named MW2, was designated a USA400 strain. This strain has largely been displaced by the USA300 strain, the dom inant CA-MRSA strain seen today. Using MLST nomenclature, USA300 is categorized as sequence type 8, clonal complex 8 (62). Much of the recent scientific effort has been directed at USA300 strains, looking to understand the bacterias remarkable spread and apparent increased virulence. A frequent cause of skin and soft tissue infe ctions, a study by Johnson et al. 27

PAGE 28

demonstrated ~4 fold increase in the inci dence of primarily skin and soft tissue infections over the course of five years attributed to USA300 (63). USA300 has also been implicated as the cause of fulminant necrotizing pneumonias (21) and other invasive conditions such as osteomyelitis, bacteremia, and septic arthritis (64). Numerous studies have shown that the USA300 strain harbors a SCC mec IV. As noted previously, these cassettes vary in size depending on the presence of additional resistance genes and the mec IV is the smallest cassette (21-25kb) and does not harbor any additional virulence genes. In one study, CA-MRSA strains harboring the SCC mec IV grew faster than HA-MRSA carrying different SCC mec allotypes (65). The authors suggest that this may have allowed the CA-MRSA strains to outcompete other bacteria in the absence of antibiotic pressure and that this may offset the fitness cost that a larger SCCmec may impart on the HA-MRSA strain s that carry them (65). The rise of CA-MRSA infections, particularl y those caused by the USA300 strain, has also been epidemiologically correlated with the rise in the number of strains containing PVL (48, 52, 56). However, c onflicting results have been obtained evaluating the impact of PVL on USA300s vi rulence. A study by Lina et al. implicated the presence of PVL with S. aureus derived skin infections and co mmunity-acquired pneumonia, noting that hospital-acquired staphylococcal pneumonias were rarely associated with a necrotic process (21). Using a rabbit pneumoni a, Diep et al. demonstrated that PVLproducing USA300 strains caused greater mortality and significantly more necrosis and disruption of the pulmonary ar chitecture than a PVL negative strain. The researchers also demonstrated that PVL is produced in toxi c amounts in the lung (66). In a different study, use of a rabbit bacteremia model dem onstrated a modest but measurable effect 28

PAGE 29

early in the disease process that could be attributed to t he presence of PVL, which the authors surmised permitted the bac teria to seed the kidney early in the course of the disease (67). Another study determined that the presence of the PVL toxin in human S. aureus clinical samples was positively associ ated with skin and soft-tissue infections as well as bone and joint infections (O R, 2.5; 95% CI 1.2-5.2) (68). This is in contrast to other studies which have investigated the contribution of PVL to disease processes and not found it to be t he determining virulence factor in USA300derived pneumonia (69) or in a mouse sepsis and abscess model study evaluating wildtype USA300 and LukS/F-PV-knockout. The latter study found similar levels of survival between mice inoculated with eith er strain as well as similar levels of PMN lysis upon exposure to the wild-type versus the knockout. In an evaluation of the strains ability to cause abscesses and dermonecrosis, PVL negative strains produced a larger abscess than the PVL positive strains, refuting the claim that PV L is the factor conferring USA300 increased virulence (70). A more recent study, however, validated bo th arguments by identifying PVL as a strong cytotoxic factor fo r human and rabbit neutrophils but not mouse or simian, demonstrating species-specific cytotoxicity. The group also found that no difference was detected between PVL-expressing and pvl -knockout S. aureus including USA300 in their ability to induce neutrophil death when live bacteria where phagocytized. The authors proposed that the effect of PVL is ma sked in this model by cellular processes that delay the effect of PVL. Since produc tion of PVL occurs mostly in the postexponential phase of bacterial growth, it is reasonable to suspect that PVL may not be expressed in high concentration if the bacteri um is immediately phagocytized (71). That 29

PAGE 30

PVLs presence has been linked to USA300 strains causing skin and soft tissue infections is not refuted though its exact impact on pathogenicity, if any, is still being understood. More recently, the ACME gene has been identified as a potential key determinant in the USA300 strains pathogenicity. The SCC mec IVa has been demonstrated to be physically linked to the ACME (23, 72, 73), suggesting that antibiotic resistance and pathogenicity are interconnected. The strain s virulence was attenuated when ACME was eliminated but not when SCC mec was deleted in a rabbit ba cteremia model (23). As noted before, the presence of a redundant arginine de iminase operon in the USA300 strain is believed to confer a fi tness advantage upon the bacteria allowing for improved survival in anaerobic conditions where arginine is the sole source of energy (22). Investigation of t he effect of ACME in Streptococcus pyogenes has found that arginine deiminase inhibits proliferation of human mononuclear cells and improves the bacterias ability to invade and survive intracellularly (74, 75). Be cause of the presence of the arginine deiminase pathway, the bacte ria appear better equipped to survive in the face of the acidic conditions that exist on human skin. Another group of researchers contends that ACME does not enhance virulence. Their study found that in a comparison of USA300-ACME wild-type and an ACMEdeletion mutant in a rat model, the presenc e of the gene was not associated with an increase in mortality or lung pathology and no significant difference in expression of other virulence factors with the exception of alpha-hemolysin (24). More research is needed to further define the role of AC ME in the pathogenesis of USA300. 30

PAGE 31

Another potential source for the viru lence noted in the CA-MRSA strains suggested by some researchers are the PSM. Wang et al. first described these peptides in S. aureus as they have previously been described S. epidermidis The researchers detected PSM production in vitro at a higher concentration in CA-MRSA strains as compared to HA-MRSA strains. In testi ng alpha-PSM deletion mu tants, the authors described reduced mortality and decreased levels of tumor necrosis factor-alpha peripherally in the affected mice as com pared to mice infected with the wild-type. Monocyte infiltration and lysis were significantly increased when exposed to a wild-type CA-MRSA strain as compared to the deleti on mutant while human neutrophils could be stimulated to respond and produce cytoki nes when similarly exposed (25). Another study demonstrated PSM-mediat ed PMN cell lysis (both human and murine) when these were exposed to PSMalpha3 (the most potent peptide), though lysis occurred at high peptide concentrations. Based on this, the researchers concluded that the CA-MRSA strains would not be able to produce sufficiently high concentrations of PSM 3 to create an appreciable amount of lysis. However, the researchers did find that the PVL-mediated lysi s of human neutrophils was enhanced in the presence of the peptide (76). Correlating the findings of the previous study, Lffler et al. found that PSMs are active against many different specie s neutrophils at high concentrations and that the cells are rapidly destroyed without a characteristic change in morphology (71). The PSMs appear to be under the cont rol of the global regulator agr though how this might impact its virulence in CA-MRSA strains carrying the gene is not yet known (20). It is evident that S. aureus has acquired a myriad of ways in which to prosper despite environmental pressures it encounters from our attempts to treat clinical 31

PAGE 32

conditions caused by the bacteria. As the hu man medical field continues to attempt to curb the rising number of MRSA cases, potentia l spillover into the veterinary community is an area of heightened concern. Specific ally, questions regarding the potential for reservoiring of MRSA in our pets and cro ss-transmission between humans and animals are focal topics. Additionally, as the virul ence factors of the hum an strains are defined, efforts to characterize these virulence fact ors in the animal-derived strains should be performed. MRSA in Animals Initial epidemiological studi es into the presence of MRSA in pets have identified fairly low rates of infection or colonization. This is most likely due to the fact that S. aureus is a human-adapted strain so it would have to overcome species specific immune responses every time the bacterium jumped host species. Notwithstanding, S. aureus does commonly cause pyodermas and other clinical diseases in animals. The earliest report of veterinary MRSA isol ation was in a mastitic dairy cow in 1972 (77). Since then, dogs, cats, horses, pigs, and poultry have been identified with the bacterium (78-81). MRSA has been more re cently found in companion animals, with the first reports of a colonized dog arising in 1994 (82) and thereafter by the detection of MRSA in cats in 1998 (78). A study carrying out molecular characterization of dog and cat derived MRSA isolates concluded that these infections are rarely reported in pets. The 16 isolates obtained and test ed were PVL negative, ST22, and spa type t032, with some strains carrying a type IV mec cassette, though subtyping was not successful (83). More recently, MRSA was identified in 2 dogs that dem onstrated clinical signs at the time of sampling. Both isolates were obtained from the same veterinary clinic and harbored a SCC mec III and were ST239 (84). 32

PAGE 33

The low prevalence in the general popul ation can be seen by comparing the results of MRSA isolations from a di agnostic laboratory and those obtained by screening a healthy population. A report by Rich and Roberts notes that only 1 in 255 healthy dogs was colonized during the cour se of one year as compared to 114 MRSA positive isolates received at the laboratory in the same time (85). A study sampling private practice populations and clinical case s at a teaching hospita l found that dogs in the former were colonized 0.8% while MRSA was isolated in 7% of the latter cases (86). Though higher than other reported values, Jones et al. found t hat 23.5% of all S. aureus isolated from clinical samples submitted to their laborator y were MRSA (87). These findings underscore the tendency in veterinary medicine to attempt empirical antibiotic therapy and then rely on culture and sensitivity when the infection does not resolve or respond. As in humans, t he risk of developing clinical disease from MRSA is significantly impacted by the number of antibiotic courses received, the number of days the dog or cat is hospitaliz ed, and having received surgical implants (88). In a case-control study evaluating comparing MRSA and MSSA cases in dogs, the receipt of antibiotics (OR 3.84, 95% CI 1.21-14.74, p=0.02), bet a-lactams (OR 3.58, 95% CI 1.04-14.79, p=0.04), or fluoroquinolones (OR 4.61, 95% CI 1.08-27.37, p=0.02) within 90 days of admission were signific antly associated with the development of MRSA in canine patients (89), corroborating the previous st udys findings. Fortunately, no significant difference was noted wit h regards to surgery or outcome. Following an outbreak, sampling at a Canadian universitys veterinary teaching hospital large animal clinic was instituted. Subsequently, 4% of horses in 2000 and 8% of horses in 2002 were found colonized with MR SA (90). In the study, 14% (n=17) of the 33

PAGE 34

staff at the veterinary hospi tal were found to be colonize d with MRSA, which, combined with case histories and repeat sampling, lead the authors to conclude that 63% (n=17) of the equine cases were nosocomial transmissi ons. A subset of these isolates were typed and all demonstrated SCC mec IV but lacked PVL genes (90). A surveillance program inst ituted at the Ontario Veterinary College following the initial outbreaks found t hat 5.3% of all equine patient s were either colonized at admission or became colonized with MRSA during hospitalizati on over an almost 2 year period. The colonization rate of horses by CA-MRSA was 2.7% (91). In an Irish study, healthy horses were colonized 1.6% of the time (86). Environmental swabbing by t he Canadian group identified 9.6% of sites sampled were MRSA positive. The most common locations that cultured MRSA were stalls housing MRSA-positive horses (62%). In contrast, only 6.9% of stalls housing MRSA-negative horses were culture pos itive for MRSA (92). In a broad study surveying S. aureus isolates submitted by diagnostic laboratories at seven veterinary teaching hospitals in the USA, 14% (n=9) of the isolates were found to be MRSA, though none of the PFGE pattern s matched each other; they were not compared to existing hu man strains (80). Recent attention has revolved around the hi gh prevalence of colonization of MRSA in pigs and pig farmers, which has been eval uated primarily in t he Netherlands. An initial study found that 23% (n=6) of pig farmers sampled were colonized, representing a >760x higher risk of colonizati on by swine farmers as compar ed to the rest of the Dutch population. The authors were also able to demonstrate transmission between species and found that spa-type t108 was the most prevalent MRSA, though all the recovered 34

PAGE 35

strains were nontypeable using PFGE (81). In a larger subsequent colonization study, de Neeling et al. identified 39% (n=209) of the swine sampled were colonized with MRSA at the time of slaughter and that a ll the samples belonged to ST398 (93). Three SCC mec types were identified in the Dutch s wine population sampl ed: type III (3%), type IV (39%), and type IV (57%). All of the isolates demonstrated resistance to tetracycline, which is a reflection on the high level of use of that antibiotic in pig husbandry (93). To evaluate the potential for widespread colonization of pig farmers on the North American continent, pigs and pig farmers in Ontario, Canada were swabbed and 20% (n=5) and 24.9% (n=71), respectively, were found to be colonized with MRSA, though the predominant strain was a HA-MRSA (94). As the human-animal bond tightens and pets play increasingly integral roles in the home, the potential for cross-colonization and infection has raised concerns in both the human and veterinary medical fields. With this possible host-range expansion, the epidemiology of the disease could be further co mplicated if reservoiring occurs in pets as has been suggested by one group (95). An example of this complication was described by van Duikjeren et al. when they reported a recurring outbreak in a nursing home which was only resolved once the affect ed nurse was treated, in addition to her affected infant and colonized dog (96). Weese et al. reported several case studies of companion animal MRSA isolations that were identical to strains obtained from either attending veterinary technician staff or the an imals owner (97). Cases such as this underscore how detrimental it may be to bot h people and animals if MRSA gains a solid foothold in non-human species and develops an additional host predilection. 35

PAGE 36

Fortunately, to date, ther e does not appear to be reports of USA300 having been detected. It is the goal of this research to invest igate the prevalence of MRSA in companion animals and to assess Staphylococcus aureus for evidence of shared virulence factors between the human and animal-derived strains. Th is is a needs study to further define MRSA in animals. 36

PAGE 37

37 Table 1-1. CDC case definition for community-associated MRSA Diagnosis of MRSA within 48hrs of admission or as an outpatient No previous history of MR SA infection or colonization No history of hospitalization, admi ssion to a long term care facility, dialysis, or surgery in the past year No indwelling catheter or medi cal device that passes through the skin into the body

PAGE 38

CHAPTER 2 MICROBIOLOGICAL SURVEY AND NA SAL COLONIZATION RATE DETERMINATION OF ME THICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN PATIENTS AT THREE SECONDARY/TERTIAR Y VETERINARY CARE FACILITIES IN FLORIDA Background Originally detected in humans only two years after methicillin was introduced to treat infections caused by penicillin-resist ant staphylococci (37), methicillin-resistant Staphylococcus aureus (MRSA) is today considered an emerging disease in humans because of the increased numbers of isolations and clinical ramifications of reported infections (46). Historically, these infections were associated with hospitalized patients with in-dwelling catheters and devices, t he elderly, and the immunocompromised and were thereby termed hospital-acquired (H A)-MRSA. These HA-MRSA infections have become much more frequent during the last two decades. Whereas in 1974 only 2% of the S. aureus infections in US intensive care pati ents were classified as MRSA, by 1992 this number had risen to 35.9% and was 64.4% by 2003 (45, 98). Resistance to penicillin in S. aureus is associated with beta-lactamases produced by resistant strains that attack the antibiotic s beta-lactam ring. Meth icillin and similar penicillins of this class were fortified by the addition of an ortho-di methoxyphenol group to the beta-lactam ring to counter these resistant strains. The next wave of resistance against these fortified antibiotics ensued (37), mediated via the mecA gene found on the staphylococcal chromosomal cassette mec (SCC mec ). These mobile elements transfer horizontally between bacteria so sensitive strains become rapidly resistant. The traditional HAMRSA carry SCC mec types I, II, or III (22), with the rise in type II and III SCC mec allotypes forming the basis for the third wa ve of resistance (36). Resistance to all antibiotics in the beta-lactam family as well as cephalosporins is phenotypically 38

PAGE 39

designated by the detection of resistance to oxacillin on an antibiogram. Additional resistance to other antibiotic classes such as macrolides and fluoroquinolones is frequently noted with these infections, leavin g practitioners limited treatment options (99). The fourth wave of antibiotic resi stance involves the rise in vancomycinintermediate S. aureus (VISA) strains (36). A second set of MRSA strains have come to the forefront in the past two decades as community-associated strains (CA-MRSA) have been increasingly isolated from people lacking traditional risk factors such as contact with hospital settings (58). Often, these CA-MRSA show less antibiotic resistanc e than the hospital-acquired strains (48) and typically have SCC mec type IV or V (22). The US A300 strain, which carries a SCC mec IV cassette has been particularly concer ning as it has developed increased virulence and causes various primary disease syndromes predominant now in the US. This trend towards the displacement of typical HA-MRSA by CA-MRSA strains, particularly by USA300, is resulting in infectio ns of new patient cohorts previously not at risk for S. aureus infections. The syndromes themselv es have higher morbidity and in some cases mortality (46, 47, 58, 60). Understanding of the epidemiology of the bacterium, its transmission, and rese rvoir patterns is still incomplete. MRSA was first reported in the veterinary literature in a dairy cow in 1972 (77). The first companion animal reported to have MRSA was a dog in 1994 (82) and colonized cats were first reported in 1998 (78). There have been sporadic reports of MRSA infection in horses in surgical woun ds with more recent reports of nasal colonization rates as high as 5.3% (91). 39

PAGE 40

Whether or not animals serve as either the originating source of human infection or disseminate acquired S. aureus (from humans) has not been fully determined. Work performed in the Netherlands demonstrated contact with pigs or pig farming is a risk factor for developing MRSA infection, and t he frequency of colonization by pig farmers was over 760 times higher than in the general Dutch population (81). In another study, there was a significant correlation on C anadian farms with t he presence of MRSA positive pigs and MRSA positive nasal coloniza tion in farm personnel. In these studies, the strains found in personnel were of swine origin (94) Concomitant carriage between cows and humans has also been demonstrat ed though the direction of transmission could not be shown (100). A study investigating colonization rates in horses and associated caretakers found similar subty pes circulating among the two populations with evidence of human-to-hor se and horse-to-human transmi ssion (90). In 2004, a case report described recurring MRSA coloniza tion in a nursing home nurse which only resolved once her child and dog were also treat ed to eliminate the same strain (96). Given that human-anima l-human transmission can occur, the potential for zoonotic transmission of MRSA bears investigation. The use of molecular epidemiology to perform comprehensive characterization of MR SA should be carried out to truly identify if animals are an originat ing source of resistant S. aureus epidemics in humans. The purpose of the study reported here was to det ermine the degree of nasal colonization in companion animals at tertiary and secondary veterinary care facilities in Florida and to perform basic genetic subtyping of any MRSA isolates. 40

PAGE 41

Methods Animal Sampling Sampling was performed at several secondary and tertiary animal treatment centers in north central Florida includi ng the small (dog and cat) and large animal (equine) hospitals of a veterinary teaching hosp ital (facility 1 and facility 2, respectively); a primary and secondary care private care feline clinic (facilit y 3); and a primary, secondary and tertiary care private care equi ne facility (facility 4) during the second sampling period. Two sampling periods (SP) took place, the first during July-August (SP1) and the second during the following Ma rch-April (SP2) to reflect seasonal variation in Florida and seasonal reproductive differences in the horse. Detailed patient signalment was obtained, recording the spec ie, age, gender, breed, and neuter status of each animal sampled. Access to medical records at facilities 1 and 2 was used to determine the animals originating geographi c location from the owners address. Admission date, hospital service visited, and length of stay were also obtained for these animals and placed in a database. When possi ble, hospitalized patients were swabbed within 24 hours of admission and again betw een 72 and 96 hours. Most of the cats sampled were swabbed once at the time of thei r outpatient visit given the large majority of these samples came from facility 3. Samples were obtained by passing ray on-tipped culture swab against the mucosa of a single nostril and then placed in Stuart s media (BD BBL CultureSwab, Sparks, MD) and frozen at -20C if not pr ocessed immediately. A subs et of the swabs was frozen without any media during SP2 to determine st orage options for future broader studies that may be performed in animals under different management conditions. 41

PAGE 42

Animal sampling protocols were evaluat ed and approved by the University of Florida Institutional Animal Care and Use Committee. Additionally,owners of patients seen at facilities 1-3 signed an informed cons ent prior to having their pet sampled. Microbiological Testing Briefly, samples were plated onto Columbia blood agar with 5% sheep blood (BA), CNA, and (during SP2) mannitol salt plates. Dry swabs were plated to BA and then inoculated into tryptic soy broth, which was incubated for enrichment and subsequently plated to BA, CNA, and mannitol salt plates. All plates and broths were incubated at 37C with 5% CO2 overnight. The plates were eval uated for round, raised white to yellow colonies with a zone of beta-hemolysis on the BA and CNA plates as well as growth on the mannitol salt plate. Suspec t colonies meeting these criteria were reisolated onto BA after a Gram stain confirming gram posit ive status and a positive catalase test was obtained. A coagulase tu be test (BD BBL Coagulase Plasma, Rabbit, Sparks, MD) was set up for these suspect co lonies by inoculating a loop into rabbit plasma and allowing it to incubate for a to tal of 24 hours with an initial read at 4 hours. Isolates that coagulated were subjected to a latex agglutination test evaluating the presence of penicillin binding protein 2a (PBP2a) (Remel BACTi STAPH, Lenexa, KS). Any isolate that demonstrated latex aggluti nation was then inoculated into maltose, trehalose, and lactose broths (Hardy Diagnost ics Purple Broth with Maltose, Trehalose, Lactose, Santa Maria, CA) and incubated over night. Evidence of sugar fermentation by the bacterium was based on a purple to yell ow color change, though evidence of partial fermentation was further evaluated. If all the criteria were met, the isolate was inoculated into tryptic soy broth to a 0.5 McFarland turbidity standard and subsequently plated onto Mueller Hinton agar with 4% NaCl and oxacillin (6ug/ml) (Hardy Diagnostic 42

PAGE 43

MRSA screen plate, Santa Maria, CA) using the alternate swab procedure outlined by the manufacturer. Any growth after 24 hours of incubation was considered a methicillin resistant suspect strain. Following reisolation, the suspect strain was subjected to full antibiogram performed by minimum inhibi tory concentration (MIC) using a standard microwell format. MIC Analysis of MRSA and MSSA Isolates Each of the six MRSA isolates was matc hed to two MSSA controls that had been submitted for antibiograms and confirmed to be oxacillin sensitive. The MSSA controls were matched to the MRSA isolates by species (canine, feline, or equine) and represented the stored isolate that was obtained temporally closest to the case isolate at that facility. Each strains antibiogram was evaluated to determine the prevalence of resistance to the penicillins, cephalosporins, fluoroquinolones, and macrolides. These were then combined to determine overall prevalence of resistance to the classes in the MRSA as compared to the MSSA group. Pulsed Field Gel Electrophoresis Once an isolate was identified as being methicillin resistant S. aureus based on microbiological screening and MIC antibiogram (resistant to oxacillin at >2ug/ml), isolates were submitted to the Florida Depar tment of Health Bureau of Laboratories for genotypic characterization using pulsed-field gel electrophoresis (PFGE) following the protocol developed by McDougal, et al.(48). Briefly, a colony was inoculated into broth and incubated while shaking. The turbid ity was adjusted and the suspension was centrifuged. The pellet was resuspended an d a lysostaphin solution was added in addition to agarose in buffer. The entire mixt ure was then dispensed into the wells of a 43

PAGE 44

96 well plate and the plugs were allowed to so lidify. The plugs were then placed in lysis buffer and incubated prior to washing several times. The plugs were cut to the desired size, equi librated in restriction buffer, and then subjected to Sma I restriction enzyme prior to further incubation. The plugs were loaded onto the comb tooth and placed in the ca sting platform to which the equilibrated agarose was added. Pulsed-field gel electr ophoresis (PFGE) was carried out and the gel was stained and photographed. A dendogram of the isolat es was derived using the unweighted pair group method using arithmetic means and Dice coefficients to generate percent similarities. A similarity coefficient of 80% was used to define the pulsed-field type (PFT) clusters (48). Results Microbiological Results A total of 966 patients were sampled from 3 domestic animal species: 263 patients were sampled in SP1 (27%) while 703 patient s were sampled in SP 2 (73%). Of these, 132 patients were swabbed again during their hospitalization with 62 and 70 isolates obtained during SP1 and SP2, respectively. No detectable differences were observed on Staphylococcus spp. isolations based on sample storage as well as use of the dry versus Stuarts media sw abs (data not shown). Dogs were most commonly sampled (n=536 55%) followed by cats (n=257, 27%), and horses (n=173, 18%). General population demographics s howed that 50% of the animals sampled were male and 80% were adult. The majority (n=585, 61%) of the patients sampled came from facility 1, while 22% of the samples were submitted by facility 3 (n=208). Additionally 17% (n=173) of the samples were from large animal services with facility 2 contributing 7% (n=7 2) and facility 4 contributing 10% (n=101). 44

PAGE 45

Facilities 1 and 2 yielded 68% (n=657) of th e total submissions while 32% (n=309) of the study population repres ented the two private secondary care facilities. Six MRSA isolates were identified which represented 0.62% of the total animals sampled for this study population during the entire sampling period. Three cats, 2 dogs, and 1 horse grew a MRSA isolate. Based on these findings, MRSA colonization prevalence rates were 0.37%, 1.17%, and 0.58% respectively for dogs, cats, and horses. Only 1 patient was found to be colonized in 2006 (samplin g prevalence 0.38% or 1 in 263 patients) while the remaining 5 is olates were all obtained in 2007 (sampling prevalence 0.71% or 5 in 703 patients). The results are summarized in Table 2.1. Antibiotic Resistance All MRSA and most of the control MSSA isolates demonstrated beta-lactamase activity and were resistant to penicillin and am picillin (Table 2.2). All 6 MRSA isolates were resistant to the remainder of the antibiotics in the penic illin class, while none of the MSSAs were multi-resistant to penicilli ns. One MRSA isolate was sensitive to imipenem. In addition to penicillin and cephalo sprins, all of the MRSA isolates were resistant to macrolides (Table 2.2). Resistance against the fluoroquinolones class was noted but was variable among the MRSA is olates while no MSSA demonstrated resistance to this antibiotic class. No resistance was detected in any S. aureus against vancomycin, rifampin, synercid, or linezolid (Figure 2.2). Pulsed-Field Gel Electrophoresis The isolates demonstrating growth on the MRSA Screen plate were subjected to PFGE. Four of the MRSA isolates recovered (2 dog, 2 cats, 66%) were consistent with USA300 strains (Figure 2.1). The pulsed-fiel d type of 2 feline isolates and 1 of the canine isolates aligned with the USA300-0014 strain (19) The other canine isolate 45

PAGE 46

aligned with the circulating USA3 00-aJCI strain (48). The rema ining two isolates did not align with CAor HA-MRSA reference strains. Discussion This study sought to evaluate the rate of nasal colonization of a veterinary patient population presented for evaluati on to secondary and tertiary care facilities in NorthCentral Florida. The study did identify MRSA in pets and helps to underscore the potential implications of MRSA colonized pets on human health. Low rates of colonization were detected in the 3 specie s sampled, an overall 0.58% prevalence rate. This deviates from a previous report by Weese et al. who identifi ed 5.3% of the equine patients at a Canadian veterinary college hospital as colonized or who became colonized during hospitalization. Reasons fo r this discrepancy were not elucidated by this study but may be related to differenc es in geographic distribution and impacting environmental conditions, such as temperat ure and weather. The pr esent study was not performed alongside an increase in surveill ance due to MRSA detection during routine monitoring or due to a hospital outbreak, a condition which preceded the surveillance program reported above (90). This study was cross-sectional in nature, with only 13.7% of the patients being sampled a second time as opposed to the almost 2 years during which surveillance occurred in the Canadian study, with weekly sampling of hospitalized patients (91). An increase in MRSA isolat ions was noted between the two sampling periods but cannot be validated due to the unev en distribution of sample collection. The results of antibiogram analysis of suspect strains demonstrated that resistance to the beta-lactam antibioti c class was widespread. All MRSA and most MSSA isolates demonstrated bet a-lactamase activity against penicillin and ampicillin. Only the MRSA demonstrated resistance to all the antibiotics in the penicillin class with 46

PAGE 47

the exception of case #3 which was sensit ive to imipenem, an intravenous beta-lactam antibiotic. Given the resistance detected agains t the fortified beta-lactamases in this isolate, the clinical use of this antibiotic would have been questionable despite in vitro results since the presence of a PBP2a would im part resistance to the entire class. All of the MRSA isolates were also found to be resist ant to the macrolides tested and to all the cephalosporins. Resistance against mem bers of the fluoroquinol one class was more variable among the MRSA isolates. The results of the antibiogram analysis demonstrated multi-drug resistant attributes of the MRSA isol ates obtained. Fortunately, no resistance was detected against vancomyci n, rifampin, synercid, and linezolid. However, as these are the last line of def ense in many resistant human cases, use in the pet population is to be undertaken with extreme caution so that further resistance in animal-derived isolates does not impact the human population. The isolation of USA300 from two dogs and two cats is significant given the increasing concerns regardi ng this strain in people (58). The recovered strains demonstrated typical patterns of resistance a ssociated with USA300, indicating that the strain has continued to propagat e without great genomic diversification (19, 101) and by means of clonal expansion (102) similar to what has been previously reported in people. The multi-drug resistant pattern was s een in both USA300 and non-USA300 strains which raises concern that other strain ty pes may be acquiring multi-drug resistance. The combination of PFGE and antib iograms were used to demonstrate similarity in the isolates obtained in this study. Employing whole genome analysis of each MRSA would determine if these animal-derived isolates ar e as closely associated to each other and 47

PAGE 48

also to known human strains as they appear to be or if various single nucleotide polymorphisms exist that could substantiall y impact the strains virulence (102). Of note, a USA300 positive dog was resampl ed a month later at the time of its recheck admission and was found to no l onger have MRSA but instead was colonized with a methicillin-resistant S. intermedius (MRSI). The antibiogram profile for the MRSI was similar to the MRSAs with additional full or partial resistance to various members of the fluoroquinolone family, full resistance to c lindamycin, tetracycline, and trimethoprimsulfa, and intermediate resistance to gentam icin, using the CLSI set points for S. intermedius (data not shown). Since coloni zation in humans increases the risk of developing a subsequent MRSA infection (9, 47) this finding raises the question as to the duration of MRSA colonization in domes tic pets and their ability to reservoir the bacterium (95). Reports demonstrating repeated human infections that have been traced back to the household pet (91, 96) point to the need for protocols and control measures that help medical facilities address the issue of co lonized pets. A goal in the management of these animals would be to prevent the acquisition of multi-drug resistant bacteria that could serve as sources of rein fection or may transmit virulence factors to normal animal bacterial flora. As the human MRSA epidemic continues to grow and pets play a more central role in the lives of their owners, incr easing reports pointing to transmission between people and pets are likely. Additional studies investigating owners and pets for colonization rates and assessing the genotypic similarities of resulting isolates are necessary to elucidate the epidemiology of zoonotic transmission and thereby provide important foundations for the management of this epidemic and prevention of further 48

PAGE 49

spread in the pet population. Further evalua tion of animal-derived MRSA isolate for the presence of virulence factors associat ed with human disease is also warranted. Table 2-1. Number of species swabbed, number of samples processed, and resulting prevalence rates of MRSA in dog, cat, and horses patients of 3 secondary and tertiary care facilities in North-Central Florida No. Sampled per Species (Samples Processed per Species) Dog Cat Horse Total Sampling period 1 107 (126) 84 (89) 72 (110) 263 (325) Sampling period 2 429 (459) 173 (180) 101 (134) 703 (773) Total 536 (585) 257 (269) 173 (244) 966 (1098) Total MRSA 2 3 1 6 Prevalence 0.37% 1.17% 0.58% 0.62% Table 2-2. Overall antibiotic class resistance between MRSA isolates and the MSSA contro l isolates obtained from dog, cat, and horse patients of 3 secondary and tertiary care facilities in North-Central Florida Percent of Resistant Isolates (No. isolates) Antibiotic Class MRSA (n=6) MSSA (n=11) Penicillin* 97.2% 28.8% Cephalosporin 100% 1.6% Fluoroquinolone 74.4% 0% Macrolide 100% 9.1% Vancomycin 0% 0% ** Penicillins tested include: amoxicillin/clavulanic acid, am picillin sulbactam, ampicillin, penicillin, oxacillin, imipenem Cephalosporins tested include:cefazolin, cefepime, cefotaxime, ce ftriaxone, cephalothin, ceftiofur (equine only), cefpodoxime (2007 only) Fluoroquinolones tested include: ciprofloxacin, enrofloxacin, gatif loxacin, levofloxacin, marbof loxacin, moxifloxacin, ofloxa cin Macrolides tested include: azithromycin, erythromycin 49

PAGE 50

50 Figure 2-1. Dendogram showing the relatedness of the 6 MRSA isolates obtained from dog, cat, and horse patients of 3 secondary and tertiary care facilities in North-Central Florida as compared to commonly circulating USA300 strains. Source species is listed. Scale bar indicates genetic relatedness.

PAGE 51

Figure 2-2. Antibiograms obtained from 6 MRSA isolates from dog, cat, and horse patients of 3 sec ondary and tertiary care facilities in North-Central Florida. 0 1 2 3 4 5 6 Oxacillin Amoxicillin/Clavulanic Amp_Sulbactam Ampicillin Penicillin Imipenem Cefazolin Cefepime Cefotaxime Ceftriaxone Cephalothin Ceftiofur Cefpodoxime Ciprofloxacin Enrofloxacin Gatifloxacin Levofloxacin Marbofloxacin Moxifloxacin Ofloxacin Azithromycin Erythromycin Clindamycin Gentamicin Linezolid Rifampin Synercid Tetracycline Chloramphenicol TMS Vancomycin No. IsolatesAntibiotic Tested resistant sensitive intermediate resistance 51

PAGE 52

CHAPTER 3 GENOTYPIC CHARACTERIZATION AND SEQ UENCING OF THE MRSA ISOLATES Background Known for its propensity to cause dis ease in humans, methicillin-resistance S. aureus (MRSA) is more recently being investigat ed for the role it may play in animal disease. Not a usual commensal of animals, S. aureus has been identified as a colonizer of healthy cats (78, 95), dogs (82, 95, 96), and horses (90, 95). In molecular comparisons of some animal derived MRSA strains to human isolates, many animal MRSAs are not typeable, raising the idea that these strains are circulating primarily in the animal population (94, 103) Several studies have f ound these untypeable animal strains in outbreaks or colonization surve ys of humans, suggesting that characterization of all strain has not yet occurred. Conver sely, through molecular epidemiology, several clinical infections and nosocomial outbreaks in animals have been caused by MRSA strains primarily associated with human colonization and infe ction (97). Strains that have been successfully isolated from anima ls and typed according to human derived MRSA schemes, have been common hospital-ac quired MRSA (HA-MRSA) strains such as USA100 (94, 97) th ough strains carrying SCC mec IV have been obtained as well (95). During the past two decades there has been a sharp increase in both HAand community-associated MRSA (CA-MRSA) coloni zation as well as disease. Colonization is an important risk factor for subsequent primary disease (9) and complications after elective invasive procedures. Whether or not this bacterial evolution diverged from the initial hospital acquired to community-associated genotypes is not known but generally it is accepted that MRSA was in itially confined to humans in hospital settings. This strain 52

PAGE 53

was then disseminated into the community a nd colonized people readily. It continued to circulate and eventually made its way back to the hospital setting. Much effort has been spent in evaluating the genetic changes that MRSA has undergone in its transition from being a hospital-based infection to one detec ted routinely in non-healthcare associated people. Specifically, researchers have focu sed particular attention on understanding what virulence factors, in addition to ant ibiotic resistance, have allowed the CA-MRSA to successfully adapt to the community setting as well as in hospitals to which it has returned. The focus of understanding the full ecology and evolution of the bacterium has broadened to also investigate t he role that animals have pl ayed in the process. The first phase of this study determined the nasal colonization rate of dog, cat, and horse patients at three facilit ies in North-Central Florida. These animals were swabbed upon admission and the swabs were proc essed using standard microbiological technique. MRSA cases were confirmed with full antibiogram and then subjected to pulsed field gel electrophoresis (PFGE). A total of six isolates were obtained, four of which were typed USA300 and two which were untypeable. In addition, several betalactam resistant, but methicillin-sensitive, S. aureus were isolated allowing for molecular characterization of virulence factors. It is important to determine the genotypic background of these isolates to establish the genetic relatedness of S. aureus and its pathogenicity determinants from a comparative species standpoint. This will allow assessment of the role of animals and assess ment of the value of these determinants as tools to perform complete epidemiologi c characterization of epidemics. Animalderived MRSA strains were evaluated for the pr esence of virulence factors including the staphylococcus chromosomal cassette mec IVa ( mec IVa), Panton-Valent ine leukocidin 53

PAGE 54

(PVL) gene luk PV, and the arginine catabolic mobile element (ACME)-encoded arcA gene. Accessory gene regulator protein C (agr ) was used as a marker protein for phenol soluble modulins in addition to dire ctly detecting phenol soluble modulin 3 ( psm ). These are virulence factors currently under investigation for their role in the pathogenesis of MRSA associated diseases in humans. Materials and Methods S. aureus Isolates In a convenience sampling of 966 dogs, cats, and horses performed in NorthCentral Florida, six isolations of MRSA we re made, as discussed in Chapter 2. The species and date of acquisition of MRSA case samples obtained from the colonization prevalence study were determined. Each of the 6 MRSA isolates was matched to two MSSA controls that had been submitted for antibiograms and confirmed to be oxacillin sensitive. The MSSA controls were matched to the MRSA isolates by species (canine, feline, or equine) and repres ented the stored isolate t hat was obtained temporally closest to the case isolate. Control isolates ranged in collection dates from 22 days before the MRSA in question to 21 days la ter as seen in Table 3.1. The average difference among date of collection of all cont rols as compared to the date of collection of the case isolates was -1.75 days. Microbiological Techniques The 6 MRSA case isolates and the 12 control MSSA isolates obtained while performing the colonization prevalence study were recovered from stocks stored on nutrient agar slants or in glycerol stock aliq uots at -80C and recultured in brain-heart infusion broth at 37F. A CNA plate was also plated and incubated for 24 hours at 37F in addition to a new nutrient agar slant for storage. The MRSA-USA300 ATCC #BAA54

PAGE 55

1556 (positive control) isolate and the M SSA ATCC #29213 (negative control) isolate were also prepared in this fashion, having previously been rehydrated and stored at 80C on nutrient agar slants. Turbidity of the broth was evaluated at 24 hours and colony morphology and evidence of betahemolysis on the CNA plate was used to confirm monoculture. Glycerol stocks were made from all samples and frozen at -80C for future use. DNA Isolation and PCR Isolation of DNA from each isolate was performed utilizing the QIAGEN DNeasy Blood & Tissue kit (Valencia, CA). Briefly, th e bacteria were pelleted by centrifugation and resuspended in a lysozyme solution. The mixture was incubated to promote cell wall lysis prior to adding proteinase K and l ysis buffer. The solution was again incubated then centrifuged after which the super natant was pipetted off into a clean microcentrifuge tube for further use. This step was added to eliminate loss of product due to large proteins clogging up the spin column in future steps. The manufacturers instructions were then followed as writt en. To this solution, ethanol (96%) was added and the entire mixtur e was then applied to the QIAamp Mini spin column and subjected to a two-step wash process. Lastly, DNA product was eluted with and the resulting DNA concentrations were determined using a spectrophotometer (ND-1000, Nanodrop Technologies, W ilmington, DE). Polymerase chain reactions (PCR) for the five genes of interest were set up for each isolate (Table 3.2). Each 50 uL reaction contained 50 ng of isolate template, 1 L of 0.5 M forward and reverse primer of the corresponding primer pair, 25 L of Sigma Ready-Mix Taq. The reactions were run on a thermocycler (Perkin Elmer GeneAmp DNA Systems 9600, Waltham, MA) using the following method: 3 minutes at 94C 55

PAGE 56

followed by 40 cycles of 1 minute at 94C, 30 seconds at 55C, and 30 seconds at 72C, then a final elongation phase of 7 mi nutes at 72C before an indefinite hold at 4C. The reactions were loaded onto 1% agarose gels stained with ethidium bromide and exposed to current. Each gel had a 100 bp DNA ladder, the USA300 MRSA positive control, the MSSA neg ative control, and a water negative control loaded as well. The gel was transilluminated using a UV viewer and bands corresponding in size to the target band seen in the MRSA USA300 positive control were identified. PCR purification was performed on these positive reactions following the QIAGEN QIAquick PCR Purification Kit Protocol (Valencia, CA). Briefly, the sample was diluted 5:1 and applied to a QIAquick spin column and centrifuged to allow binding. A buffered wash was applied to the column before the final product was eluted off the spin column with DEPC. The concentration of the final product was determined using the spectrophotometer. Purified products were loaded onto 1% agarose gels stained with ethidium bromide using a 100 bp DNA ladder and expos ed to current. The resulting gels were again imaged on the transilluminator to verify product size. Sequencing was performed by the Sanger sequencing method (Interdisciplinary Center for Biotechnology Research, Gainesville, FL). The sequences were analyz ed for similarity to known sequences (BLAST, NCBI, Bethesda, MD) and sequence alignment was performed on the sequence products obtained and compared to reference standards (ClustalW2, European Bioinformatics Institut e, Hinxton, UK) employing a blosum matrix (104). 56

PAGE 57

Results PCR analysis identified the pr esence of the 5 genes of in terest in all 4 USA300 strains. One of the control MSSA strains, control #2A, also harbored all 5 genes of interest. A second control strain, cont rol #4A was weakly positive for 2 genes, mec IVa and luk PV in addition to being strongly posit ive for the presence of the agr and psm genes. All MRSA and MSSA isolates we re strongly positive for the agr and psm genes. However these two genes were the only genes identified in the two non-typed MRSAs. The results of the PCR analyses are summarized in Table 3.3. Each sequence returned a match to the target area for S. aureus Alignment of the sequences to each other demonstrated close homology between the isolates (data not shown). The mec IVa gene was identified in 6 isolates: 4 USA300 and 2 MSSA controls, though 1 was weakly positive. When these were subjected to alignment against known sequences, the isolates matched 6 sequences with 99-100% homology. The resulting phylogram of the 6 sequences aligned to the USA300 control can be seen in Figure 3.1. The luk PV gene was identified in 5 isolates : 4 USA300 and 1 MSSA control. When these were subjected to alignment against known sequences, the isolates matched 109 sequences with 71-100% homolog y, though the majority of the matches were 99-100% (data not shown). The arcA gene was identified in 6 isolates: 4 USA300 and 2 MSSA controls, though 1 was weakly so. When these were subjected to alignment against known sequences, the isolates matched 38 sequen ces with 70-100% homology with the majority of the matches in t he mid 70s% range (data not shown). 57

PAGE 58

The agr gene was identified in all 18 isolates, as all 6 MRSA and all 12 controls were positive. When these sequences were subjected to alignment, the isolates matched 100 sequences with 89-100% homology (data not shown). Similarly, the psm gene was identified in all 18 isolates, as all 6 MRSA and all 12 controls were positive. When these sequences were subjected to a lignment, the isolates matched 19 or 20 sequences with 82-100% homology (data not shown). Discussion Virulence factors associated with USA300 invasive disease in people were detected in the animal-deriv ed USA300 strains. All 4 of the USA300 strains had mec IVa, PVL, and ACME as well as agr and PSM. That the two unt ypeable strains did not have a mec IVa gene suggests that they have a diffe rent SCC or that their methicillin resistance is mediated by another fashion. It is not surprising that the SCC mec IVa gene was identified in the 4 USA300 strains as th is strain has been shown to carry a typeIV mec cassette. MSSA have also been found to have a USA300 PFT, so finding 2 strains that harbored this cassette is not unusual. Control #2A was sensitive to all antibiotics except penicillin and ampicil lin suggesting the presence of beta-lactamases (data not shown). An antibiogram of control #4A demonstrated resistance to penicillin and ampicillin, but the strain wa s not oxacillin resistant. Cont rol #4A also had evidence of resistance against members of the macr olide family (data not shown). The presence of PVL has been linked epi demiologically to skin and soft tissue outbreaks caused by USA300 strains. The luk PV gene was identified in the 4 USA300 strains, supporting the apparent link between the 2 genes. A single MSSA, control #2A, harbored this gene. The arcA gene is a marker gene for the presence of the ACME gene cluster. The 4 USA300 strains appeared to harbor this gene cluster, in addition to 58

PAGE 59

both control #2A and control #4A. Neither of the unteypeable MRSA strains had evidence of either the PVL or ACME genes, further diff erentiating them from the USA300 strains. Not surprisingly, the agr and psm genes were identified in a ll the isolates tested. PSMs have been described in all S. aureus so their presence in MSSA as well as MRSA strains was expected. What role, if any, these genes play in the virulence of the MRSA strains as compared to the MSSA strains has yet to be fully understood. The primers for psm gene were generated by selecting for closest match since detection was of interest given it is believed to incite an inflammatory response. Now that we have shown that all the strains harbor this sequence, extending the target length and sequencing the product will help to evaluate t he true importance of this detection by determining if any significant differences exist between the resistant and sensitive strains. The identification of agr is similarly important since, again, all isolates proved to harbor this gene which is used as a marker for psm However, the ACME gene cluster is believed to be under regulation by the agr gene as well so this may have additional implication as to the virulence of the USA3 00 strains and warrants fu rther investigation. The MSSA control #2A deserves further consideration and brings to light questions regarding bacterial fitness upon host-range expansio n. Control #2A demonstrated the presence of the virulenc e factors detected in the USA300 MRSA strains but did not have oxacillin resistanc e on antibiogram. The bacterium was PBP2a positive on latex agglutination test but did not grow readily on the MRSA screen plate as discussed in Chapter 2. Based on the genetic analysis in addition to the previous microbiological analysis, this strain may actually be a MRSA with heterogenous 59

PAGE 60

expression of methicillin resistanc e. Further classifying this strains PFT and subjecting it to different growth para meters to evaluate for alte red expression of methicillin resistance would help resolve the classification. This study sought to evaluate animalderived MRSA isolates against MSSA isolates for the presence of virulence factor s noted in human strains. It also evaluated the virulence factors obtained against bank ed sequences to evaluate the level of relatedness and thereby confirm their presence. We have shown that animal-derived MRSA strains harbor many of the same virul ence factors as those found in people. We have also described 2 MSSA strains which harbor all (control #2A) or most (control #4A) of these factors and suggest that one stra in (control #2A) was likely a MRSA with heterogenous expression of methicillin resi stance. Once the bacterium overcomes fitness costs associated with the host-r ange expansion, we may detect MRSA more frequently in animals but at present it appears that the bacteria colo nizes animals at a very low rate. 60

PAGE 61

Table 3-1. Date of collection for case (MRSA) and control (MSSA) isolates, the number of days difference between the collecti on dates, and the species of origin. Isolate Date Acquired Control Date Acquired Variance in Days Species Case #1 4/3/07 Control #1A Control #1B 3/30/07 3/12/07 -4 -22 Feline Case #2 8/1/06 Control #2A Control #2B 7/13/06 8/3/06 -19 2 Feline Case #3 4/3/07 Control #3A Control #3B 4/5/07 3/19/07 2 -15 Canine Case #4 3/13/07 Control #4A Control #4B 3/13/07 3/13/07 0 0 Canine Case #5 3/21/07 Control #5A Control #5B 3/21/07 3/22/07 0 1 Feline Case #6 3/2/07 Control #6A Control #6B 3/15/07 3/23/07 13 21 Equine Table 3-2. Primer sequences used for PCR analysis Gene Target Forward Reverse mec IVa TTTGAATGCCCTCCATGAATA AAAT AGAAAAGATAGAAGTTCGAAAGA pvl ATCATTAGGTAAAATGTCTGG ACATGATCCA GCATCAAATGTATTGGATAGCAA AAGC arcA GAGCCAGAAGTACGCGAG CACGTAACTTGCTAGAACGAG agr AGATGACATGCCTGGCCTAC ACGCGAATGATAGGGTCATC psm GGGGGCCATTCACATGGAATT GCCATCGTTTTGTCCTGTA Okuma K, Iwakawa K, Turnidge JD, Grubb WB, Bell JM, O'Brien FG, et al. Dissemination of New Methicillin-Resistant Staphylococcus aureus Clones in the Community. J Clin Microbiol. 2002 November 1, 2002;40(11):4289-94. Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter M-O, Gauduchon V, et al. Involvement of PantonValentine Leukocidin-Producing Staphylococcus aureus in Primary Skin Infections and Pneumonia. Clinical Infectious Diseases. 1999;29(5):1128-32. Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davi dson MG, et al. Complete Genome Sequence of USA300, an Epidemic Clone of Comm unity-Acquired Meticillin-Resistant Staphylococcus aureus The Lancet. 2006 March 4, 2006;367(9512):731-9. 61

PAGE 62

Table 3-3. Results of PCR analysis for a ll five genes in every MRSA case and its corresponding two MSSA control isolates Isolate Gene mec IVa luk PV arcA agr psm Case #1 + + + + + Control #1A + + Control #1B + + Case #2 + + + + + Control #2A + + + + + Control #2B + + Case #3 + + + + + Control #3A + + Control #3B + + Case #4 + + + + + Control #4A w+ w+ + + Control #4B + + Case #5 + + Control #5A + + Control #5B + + Case #6 + + Control #6A + + Control #6B + + USA300 control + + + + + MSSA control + + 62

PAGE 63

CHAPTER 4 CONCLUSIONS The research presented herein sought to identify and characterize MRSA isolates obtained from pets sampled at 3 veterinary hospitals in North-Central Florida. The dogs, cats, and horses receiving veterinary care at these secondary and tertiary care facilities have, by the very nature of t heir presence in the hospital, owners that are interested in providing for their pets needs and care. In light of this, it would be sa fe to suggest that these dogs and cats likely participate as a mem ber of the family in many, if not most cases. Though horses may be viewed in such a light by recreational riders, Florida has a large Thoroughbred industry which generally regar ds horses as a financial investment and these animals make up a large proportion of the equine caseload at the facilities sampled. However, horses are intensely ma naged so most are in direct contact with people daily. The intense management on one hand and the close contact with owners on the other provides a natural source of in teraction that may allow for transmission of bacteria between people and these animals. In light of the prevalence of MRSA in the human population, isolation of this bacterium in pets was anticipated. The overall prevalence of MRSA in our pet population was low, suggesting that it is not very common, but similar to findings by others in the veterinary literatur e (86) as well as in the hu man literature (6). There is also some evidence to suggest that animals ar e able to clear the infection, both in this work and in others (95), which supports t he idea that the threat MRSA poses to veterinary patients is less than in people. T he MRSA strains that were isolated did demonstrate multi-drug resistance, so early identification of th ese cases will help improve clinical outcomes by directing therapeutic choices. Submitting culture and 63

PAGE 64

sensitivity of infected wounds, recurring abscesses, effusions and the like from symptomatic animals earlier in the course of disease would be clin ically indicated in general, but especially in cases where the owner has known risk factors. Empirical antibiotic therapy is prevalent in the veteri nary field and may work against clinicians in the long run as it will help propagate antibiotic resistance. However, obtaining culture status early on would allow the veterinary staff and owners to institute appropriate measures, such as barrier controls to prev ent spread, if the cult ure identifies MRSA as the causative agent. Discouraging drastic measures such as euthanasia based on a MRSA culture should be highlighted as outco me may not be negatively impacted by the MRSA-positive status (89) and the risk to people can be mitigated through barrier controls such as gloves and masks. The identification of 4 U SA300 strains was not anticipated. These strains harbored known virulence factors seen in human-derived U SA300 strains. It w ould be of value to know the colonization status as well as the occupation of the owners of these cases to help determine the original source of infe ction. Further studies investigating the colonization of the general population and thei r pets would be of value to helping fully determine the potential role that pets serv e in reservoiring. The identification of agr and psm in all the MRSA and MSSA isolates test ed requires further investigation to determine the true relevance of these finding s. Performing full isolate sequencing or performing PCR with overlapping targets would hel p identify what lies to either side of the sequence obtained and allow assessment of its role in disease processes. The two MSSA isolates which had harbored 4 or 5 of t he genes of interest also deserve further evaluation. Having these two isolates typed with PFGE would determine if they are truly 64

PAGE 65

65 USA300 MSSAs or if they have an altered SCC mec IVa. This would also help fully establish the identity of control #2A as a MSSA or, as we suggest, as a MRSA. Additionally, it would be interesting to eval uate these strains for virulence in a rabbit model or against human PMN cells and determine if they produce the degree of disease expected. Moving forward, typing of ani mal-derived MRSA strains should also be pursued more actively to determine strain sour ce and further characterize the circulating strains. For diagnostic laborator ies, the use of a bench-side la tex agglutination test to identify PBP2a could be implemented to assist in identifying cases that demonstrate heterogenous resistance of methicillin.

PAGE 66

LIST OF REFERENCES 1. Winn WC, Jr., Allen SD, Janda WM, Koneman EW, Procop GW, Schreckenberger PC, et al. Koneman's Color Atlas and Textbook of Diagnostic Microbiology. Sixth ed. Ba ltimore: Lippincott Willi ams & Wilkins; 2006. 2. Todar K. Todar's Online Textbook of Bacteriology. Madison; 2008. 3. cocci. Dictionarycom Unabr idged: Random House; 2010. 4. Chiller K, Selkin BA, Murakawa GJ. Sk in Microflora and Bacterial Infections of the Skin. J Investig Dermatol Symp Proc. 2001 Dec;6(3):170-4. 5. Bibel D, Aly R, Bayles C, Strauss W, Shinefield H, Maibach H. Competitive Adherence as a Mechanism of Bacterial Interference. Can J Microbiolo. 1983 Jun;29(6):700-3. 6. Kuehnert MJ, Kruszon-Moran D, Hill HA, McQuillan G, McAllister SK, Fosheim G, et al. Prevalence of Staphylococcus aureus Nasal Colonization in the United States, 2001-2002. The Journal of Infect ious Diseases. 2006;193(2):172-9. 7. Gorwitz RJ, Kruszon-Moran D, Mc Allister SK, McQuillan G, McDougal LK, Fosheim GE, et al. Changes in the Pr evalence of Nasal Colonization with Staphylococcus aureus in the United States, 2001-2004. The Journal of Infectious Diseases. 2008;197(9):1226-34. 8. von Eiff C, Becker K, Machka K, St ammer H, Peters G. Nasal Carriage as a Source of Staphylococcus aureus Bacteremia. N Engl J Med. 2001 January 4, 2001;344(1):11-6. 9. Davis Kepler A, Stewart Justin J, Crouch Helen K, Florez Christopher E, Hospenthal Duane R. Methicillin-Resistant Staphylococcus aureus (MRSA) Nares Colonization at Hospital Admission and Its Effect on Subsequent MRSA Infection. Clinical Infectious Dis eases. 2004;39(6):776-82. 10. Stevens A, Hennessy T, Baggett H, Bruden D, Parks D, Klejka J. MethicillinResistant Staphylococcus aureus carriage and risk factors for skin infections, Southwestern Alaska, USA. Emerg Infect Dis. 2010 May;16(5):797-803. 11. Lowy FD. Staphylococcus aureus Infections. N Engl J Med. 1998 August 20, 1998;339(8):520-32. 12. Hochkeppel HK, Braun DG, Vischer W, Imm A, Sutter S, Staeubli U, et al. Serotyping and Electron Microscopy Studies of Staphylococcus aureus clinical Isolates with Monoclonal Antibodies to Capsular Poly saccharide Types 5 and 8. J Clin Microbiol. 1987 March 1, 1987;25(3):526-30. 66

PAGE 67

13. Watts A, Ke D, Wang Q, Pillay A, Nicholson-Weller A, Lee JC. Staphylococcus aureus Strains That Express Serotype 5 or Serotype 8 Capsular Polysaccharides Differ in Virulence. Infect Immun. 2005 June 1, 2005;73(6):3502-11. 14. Fournier JM, Bouvet A, Boutonnier A, Audurier A, Goldstein F, Pierre J, et al. Predominance of Capsular Polysaccharide Type 5 Among Oxacillin-Resistant Staphylococcus aureus J Clin Microbiol. 1987 October 1, 1987;25(10):1932-3. 15. Foster TJ. Immune Evasion by Staphylo cocci. Nat Rev Micro. 2005;3(12):948-58. 16. Das D, Saha S, Bishayi B. Intracellular Survival of Staphylococcus aureus : Correlating Production of Catalase and Superoxide Dismutase with Levels of Inflammatory Cytoki nes. Inflammation Rese arch. 2008;57(7):340-9. 17. Valeva A, Palmer M, Bhakdi S. Staphylococcal alph a-Toxin: Formation of the Heptameric Pore Is Partially Cooperative and Proceeds through Multiple Intermediate Stages. Biochemistry. 1997;36(43):13298-304. 18. Dinges MM, Orwin PM, Schlievert PM. Exotoxins of Staphylococcus aureus Clin Microbiol Rev. 2000 Januar y 1, 2000;13(1):16-34. 19. Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davidson MG, et al. Complete Genome Sequence of USA300, an Epidemic Clone of Community-Acquired MeticillinResistant Staphylococcus aureus The Lancet. 2006 March 4, 2006;367(9512):731-9. 20. Diep BA, Otto M. The Role of Viru lence Determinants in Community-Associated MRSA Pathogenesis. Trends in Microbiology. 2008;16(8):361-9. 21. Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter M-O, Gauduchon V, et al. Involvement of Panton-Val entine Leukocidin-Producing Staphylococcus aureus in Primary Skin Infections and Pneumonia. Clin ical Infectious Diseases. 1999;29(5):112832. 22. Nygaard TK, DeLeo FR, Voyich JM. Commu nity-Associated Methicillin-Resistant Staphylococcus aureus Skin Infections: Advances Toward Identifying the Key Virulence Factors. Current Opinion in Infe ctious Diseases. 2008;21(2):147-52. 23. Diep BA, Stone GG, Basuino L, Graber CJ Miller A, des Etages S, et al. The Arginine Catabolic Mobile Element and Staphylococcal Chromosomal Cassette mec Linkage: Convergence of Virulence and Resist ance in the USA300 Clone of MethicillinResistant Staphylococcus aureus The Journal of Infectious Diseases. 2008;197(11):1523-30. 67

PAGE 68

24. Montgomery CP, Boyle-Va vra S, Daum RS. The Arginine Catabolic Mobile Element Is Not Associated wit h Enhanced Virulence in Experimental Invasive Disease Caused by the Community-Associ ated Methicillin-Resistant Staphylococcus aureus USA300 Genetic Background. Infect Immun. 2009 July 1, 2009;77(7):2650-6. 25. Wang R, Braughton KR, Kretschmer D, Bach T-HL, Queck SY, Li M, et al. Identification of Novel Cytoly tic Peptides as Key Virul ence Determinants for CommunityAssociated MRSA. Nat Med. 2007;13(12):1510-4. 26. Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and Food Poisoning. Genet Mol Res. 2003;2(1):63-76. 27. DBD. Staphylococcal Food Poisoning. [web page] 2006 [cited Dec. 9, 2009]; Available from: http://www.cdc.gov/ncidod/dbmd/dis easeinfo/staphylococcus_food_g.htm 28. FDA. Bad Bug Book: Foodborne Pathogen ic Microorganisms and Natural Toxins Handbook: Staphylococcus aureus 2009 [cited; May 4, 2009:[Available from: http://www.fda.gov/Food/FoodSafety/F oodborneIllness/FoodborneIllnessFoodbornePath ogensNaturalToxins/BadBugBook/ucm070015.htm 29. Todar K. Todar's Online Textbook of Bacteriology. Madison; 2008. 30. Murphy K, Travers P, Walport M. Janeway's Immunobiology. Seventh ed. New York: Garland Science; 2008. 31. Chain E, Florey HW, Gardner AD, Heatley NG, Jennings MA, Orr-Ewing J, et al. The Classic: Penicillin as a Chemotherapeutic Agent. Clinical Orthopaedics and Related Research. 2005 October Volume 439 23-6. 32. Rammelkamp CH, Keefer CS. Penicillin: Its Antibacterial Effe ct in Whole Blood and Serum for the Hemolytic Streptococcus and Staphylococcus aureus Journal of Clinical Investigati on. 1943;22(5):649-57. 33. Poole K. Resistance to -lactam Antibiotics. Cell ular and Molecular Life Sciences. 2004;61(17):2200-23. 34. Munch-Petersen E, Boundy C. Yearly Incidence of Penicillin-Resistant Staphylococci in Man Since 1942. Bull World Health Organ. 1962;26(2):241-52. 35. Martyn G. Staphylococci in the Ne wborn. Br Med J. 1949;1(1607):710-2. 36. Chambers HF, DeLeo FR. Waves of Resistance: Staphylococcus aureus in the Antibiotic Era. Nat Rev Micro. 2009;7(9):629-41. 37. Jevon MP. Celbenin-Resistant Staphylococci. BMJ. 1961;1:124-5. 68

PAGE 69

38. Brakstad O, Maeland J. Mechanisms of Methicillin Resistance in Staphylococci. APMIS. 1997 Apr;105(4):264-76. 39. CDC. Staphylococcal Food Poisoning. 2006 [cited Dec. 9, 2009]; Available from: http://www.cdc.gov/ncidod/dbmd/d iseaseinfo/staphylococcus_food_g.htm 40. Couto I, de Lencastre H, Severina E, Kloos W, Webster J, Hubner R, et al. Ubiquitous Presence of a mecA Homologue in Natural Isolates of Staphylococcus sciuri Microb Drug resist. 1996 Winter;2(4):377-91. 41. de Lencastre H, Oliveira D, Tomasz A. Antibiotic Resistant Staphylococcus aureus : a Paradigm of Adaptive Power. Current Opinion in Microbiology. 2007;10(5):428-35. 42. Pantosti A, Sanchini A, Monaco M. Mechanisms of Antibiotic Resistance in Staphylococcus aureus Future Microbiology. 2007;2(3):323-34. 43. Dancer S. The Problem with C ephalosporins. J Antimicrob Chemother. 2001;48(4):463-78. 44. Panlilio A, Culver D, Gaynes R, Banerjee S, Henderson T, Tolson J, et al. Methicillin-resistant Staphylococcus aureus in U.S. hospitals, 1975-1991. Infect Control Hosp Epidemiol. 1992;13(10):582-6. 45. Klevens RM, Edwards Jonathan R, Tenov er Fred C, McDonald LC, Horan T, Gaynes R. Changes in the Epidem iology of Methicillin-Resistant Staphylococcus aureus in Intensive Care Units in US Hospitals, 1992-2003. Clinical Infectious Diseases. 2006;42(3):389-91. 46. Klein E, Smith DL, Laxminarayan R. Hospitalizations and Deaths Caused by Methicillin-Resistant Staphylococcus aureus United States, 1999-2005. Emerg Infect Dis. 2007 December 2007;13(12):1840-6. 47. Klevens RM, Morrison MA, N adle J, Petit S, Gershman K, Ray S, et al. Invasive Methicillin-Resistant Staphylococcus aureus Infections in the United States. JAMA. 2007 October 17, 2007;298(15):1763-71. 48. McDougal LK, Steward CD, Killgore GE Chaitram JM, McAllister SK, Tenover FC. Pulsed-Field Gel Electrophoresis Typing of Oxac illin-Resistant Staphylococcus aureus Isolates from the United States: Es tablishing a National Database. J Clin Microbiol. 2003 November 1, 2003;41(11):5113-20. 49. Morrison MA, Hageman JC, Klevens RM Case Definition for CommunityAssociated Methicillin-Resistant Staphylococcus aureus Journal of Hospital Infection. 2006;62(2):241. 69

PAGE 70

50. Moran GJ, Krishnadasan A, Gorwitz RJ Fosheim GE, McDoug al LK, Carey RB, et al. Methicillin-Resistant S. aureus Infections among Patients in the Emergency Department. N Engl J Med. 2006 August 17, 2006;355(7):666-74. 51. Herold BC, Immergluck LC, Mara nan MC, Lauderdale DS, Gaskin RE, BoyleVavra S, et al. Community-Ac quired Methicillin-Resistant Staphylococcus aureus in Children With No Identified Predisposing Risk. JAMA. 1998 February 25, 1998;279(8):593-8. 52. CDC. Four Pediatric D eaths from Community-Acqui red Methicillin-Resistant Staphylococcus aureus -Minnesota and North Dakota 1997-1999. MMWR; 1999. p. 707-10. 53. CDC. Methicillin-Resistant Staphylococcus aureus Skin or Soft Tissue Infections in a State Prison --Mississippi, 2000. MMWR; 2001. p. 919-22. 54. Zinderman C, Conner B, Malakooti M, LaMar J, Armstrong A, Bohnker B. Community-acquired methicillin-resistant Staphylococcus aureus among military recruits. Emerg Infect Dis. 2004 May;10(5):941-4. 55. Ellis Michael W, Hospenthal Duane R, Dooley David P, Gray Paula J, Murray Clinton K. Natural History of Community-Acquired Methicillin-Resistant Staphylococcus aureus Colonization and Infection in Soldiers. Clinical Infectious Diseases. 2004;39(7):971-9. 56. Kazakova SV, Hageman JC, Matava M, Sr inivasan A, Phelan L, Garfinkel B, et al. A Clone of Methicillin-Resistant Staphylococcus aureus among Professional Football Players. N Engl J Med. 2005 February 3, 2005;352(5):468-75. 57. Lee Nolan E, Taylor Melanie M, Bancro ft E, Ruane Peter J, Morgan M, McCoy L, et al. Risk Factors for Community-A ssociated Methicillin-Resistant Staphylococcus aureus Skin Infections among HIV-Positive Men Who Have Sex with Men. Clinical Infectious Diseases. 2005;40(10):1529-34. 58. Maree CL, Daum RS, Boyle-Vavra S, Matayoshi K, Miller LG. CommunityAssociated Methicillin-Resistant Staphylococcus aureus Isolates Causing HealthcareAssociated Infections. Emerg Infe ct Dis. 2007 February 2007;13(2):236-42. 59. David MZ, Glikman D, Crawford SE, P eng J, King KJ, Hostetler MA, et al. What Is Community-Associated Methicillin-Resistant Staphylococcus aureus ? The Journal of Infectious Diseases. 2008;197(9):1235-43. 60. Klevens RM, Morrison MA, Fridkin SK, Re ingold A, Petit S, Gershman K, et al. Community-Associated Methicillin-Resistant Staphylococcus aureus and Healthcare Risk Factors. Emerg Infect Dis. 2006 De c 2006;12(12):[serial on the Internet]. 70

PAGE 71

61. Shopsin B, Gomez M, Montgomery S O, Smith DH, Waddington M, Dodge DE, et al. Evaluation of Protein A Gene Polymorphic Region DNA Sequencing for Typing of Staphylococcus aureus Strains. J Clin Microbiol. 1999 November 1, 1999;37(11):355663. 62. Tenover FC, Goering RV. Methicillin-Resistant Staphylococcus aureus Strain USA300: Origin and Epidemiology. J An timicrob Chemother. 2009 September 1, 2009;64(3):441-6. 63. Johnson JK, Khoie T, Shurland S, Krei sel K, Stine OC, Roghmann M-C. Skin and Soft Tissue Infections Caused by Methicillin-Resistant Staphylococcus aureus USA300 Clone. Emerg Infect Dis. 2007 August 2007;13(8):1195-200. 64. Jaggi P, Paule SM, Peterson LR, Tan TQ. Characteristics of Staphylococcus aures Infections, Chicago Pediatric Hospital. Emerg Infect Dis. 2007 February 2007;13(2):311-4. 65. Okuma K, Iwakawa K, Turnidge JD, Grubb WB, Bell JM, O'Brien FG, et al. Dissemination of New Methicillin-Resistant Staphylococcus aureus Clones in the Community. J Clin Microbiol. 2002 November 1, 2002;40(11):4289-94. 66. Diep BA, Chan L, Tattevin P, Kajika wa O, Martin TR, Basuino L, et al. Polymorphonuclear Leukocytes Mediate Staphylococcus aureus Panton-Valentine Leukocidin-Induced Lung Inflammation and In jury. Proceedings of the National Academy of Sciences. 2010 Ma rch 23, 2010;107(12):5587-92. 67. Diep BA, Palazzolo-Ballance AM, Tatte vin P, Basuino L, Braughton KR, Whitney AR, et al. Contribution of Panton-Valentine Leukocid in in Community-Associated Methicillin-Resistant Staphylococcus aureus Pathogenesis. PLoS ONE. 2008;3(9):e3198. 68. Verkaik Nelianne J, Dauwal der O, Antri K, Boubekri I, de Vogel Corne P, Badiou C, et al. Immunogenicity of Toxins During Staphylococcus aureus Infection. Clinical Infectious Diseases. 2010;50(1):61-8. 69. Bubeck Wardenburg J, Bae T, Otto M, DeLeo FR, Schneewind O. Poring Over Pores: [alpha]-Hemolysin and Panton-Valentine Leukocidin in Staphylococcus aureus Pneumonia. Nat Med. 2007 De cember 2007;13(12):1405-6. 70. Voyich JM, Otto M, Ma thema B, Braughton KR, Whitney AR, Welty D, et al. Is Panton-Valentine Leuko cidin the Major Virulence Determinant in Community-Associated Methicillin-Resistant Staphylococcus aureus Disease? The Journal of Infectious Diseases. 2006;194(12):1761-70. 71

PAGE 72

71. Loffler B, Hussain M, Grundmeier M, Bruck M, Holzinger D, Varga G, et al. Staphylococcus aureus Panton-Valentine Leukocidin Is a Very Potent Cytotoxic Factor for Human Neutrophils. PLoS Pathog. 2010;6(1):e1000715. 72. Bonnstetter KK, Wolter DJ, Tenover FC, McDougal LK, Goering RV. Rapid Multiplex PCR Assay for I dentification of USA300 Community-Associated MethicillinResistant Staphylococcus aureus Isolates. J Clin Micr obiol. 2007 January 1, 2007;45(1):141-6. 73. Goering RV, McDougal LK, Fosheim GE Bonnstetter KK, Wolter DJ, Tenover FC. Epidemiologic Distribution of the Ar ginine Catabolic Mobile Element among Selected Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Isolates. J Clin Microbiol. 2007 June 1, 2007;45(6):1981-4. 74. Degnan BA, Palmer JM, Robson T, Jones CED, Fischer M, Glanville M, et al. Inhibition of Human Peripheral Blo od Mononuclear Cell Proliferation by Streptococcus pyogenes Cell Extract Is Associated with Argini ne Deiminase Activity. Infect Immun. 1998 July 1, 1998;66(7):3050-8. 75. Degnan BA, Fontaine MC, Doebereiner AH Lee JJ, Mastroeni P, Dougan G, et al. Characterization of an Isogenic Mutant of Streptococcus pyogenes Manfredo Lacking the Ability To Make Streptococcal Ac id Glycoprotein. Infect Immun. 2000 May 1, 2000;68(5):2441-8. 76. Hongo I, Baba T, Oishi K, Morimoto Y, Ito T, Hiramatsu K. Phenol-Soluble Modulin alpha3 Enhances the Human Neutr ophil Lysis Mediated by Panton-Valentine Leukocidin. The Journal of Infectious Diseases. 2009;200(5):715-23. 77. Devriese LA, Vandamme LR, Famere L. Methicillin (Cloxa cillin)-Resistant Staphylococcus aureus Strains Isolated from Bovine Mastitis Cases. Zbl Vet B. 1972;19:598-605. 78. Lilenbaum W, Nunes ELC, Azere do MAI. Prevalence and Antimicrobial Susceptibility of Staphylococci Isolated from t he Skin Surface of Clinically Normal Cats. Letters in Applied Microbiology. 1998;27(4):224-8. 79. Kania SA, Williamson NL, Frank LA, W ilkes RP, Jones RD, Bemis DA. Methicillin Resistance of Staphylococci Isolated from the Skin of Dogs with Pyoderma. American Journal of Veterinary Research. 2004;65(9):1265-8. 80. Middleton JR, Fales WH, Luby CD, Oaks JL, Sanchez S, Kinyon JM, et al. Surveillance of Staphylococcus aureus in Veterinary Teaching Hospitals. J Clin Microbiol. 2005 June 1, 2005;43(6):2916-9. 81. Voss A, Loeffen F, Bakker J, Klaass en C, Wulf M. Methicillin-Resistant Staphylococcus aureus in Pig Farming. Emerg Infect Dis. 2005;11:1965-6. 72

PAGE 73

82. Cefai C, Ashurst S, Owens C. Human Carriage of Methicillin-Resistant Staphylococcus aureus Linked with Pet Dog. T he Lancet. 1994;344(8921):539-40. 83. Strommenger B, Kehrenberg C, Kettlitz C, Cuny C, Verspohl J, Witte W, et al. Molecular Characterization of Methicillin-Resistant Staphylococcus aureus Strains from Pet Animals and their Relationship to Hum an Isolates. J Antimicrob Chemother. 2006 March 1, 2006;57(3):461-5. 84. Malik S, Coombs GW, O'Brien FG, Peng H, Barton MD. Molecular Typing of Methicillin-Resistant Staphylococci Isolated from Cats and Dogs. J Antimicrob Chemother. 2006 August 1, 2006;58(2):428-31. 85. Rich M, Roberts L. MRSA in Companion Animals. Vet Rec. 2004;159:535-6. 86. Abbott Y, Leggett B, Rossney AS, Leonard FC, Markey BK. Isolation Rates of Meticillin-Resistant Staphylococcus aureus in Dogs, Cats and Horses in Ireland. Vet Rec. 2010;166:451-5. 87. Jones RD, Kania SA, Rohrbach BW, Frank LA, Bemis DA. Prevalence of Oxacillinand Multidrug-Resistant Staphyloco cci in Clinical Samples from Dogs: 1,772 Samples (2001-2005). Journal of the Amer ican Veterinary Medical Association. 2007;230(2):221-7. 88. Soares Magalhes R, Loeffl er A, Lindsay J, Rich M, R oberts L, Smith H, et al. Risk Factors for Methicillin-Resistant Staphylococcus aureus (MRSA) Infection in Dogs and Cats: a Case-Control Study Vet Rec. 2010;41(5):55. 89. Faires MC, Tater KC, Weese JS. An Investigation of Methicillin-Resistant Staphylococcus aureus Colonization in People and Pets in the Same Household with an Infected Person or Infected Pet. JAVMA. 2009 September 1, 2009;235(5):540-3. 90. Weese JS, Archambault M, Willey BM, Di ck H, Hearn P, Krei swirth BN, et al. Methicillin-Resistant Staphylococcus aureus in Horses and Horse Personnel, 20002002. Emerg Infect Dis. 2005 March 2005;11(3):430-5. 91. Weese JS, Rousseau J, Willey BM Archambault M, McGeer A, Low DE. Methicillin-Resistant Staphylococcus aureus in Horses at a Veterinary Teaching Hospital: Frequency, Characterization, and Asso ciation with Clinical Disease. Journal of Veterinary Internal Medicine. 2006;20(1):182-6. 92. Weese JS, DaCosta T, Button L, Goth K, Ethier M, Boehnke K. Isolation of Methicillin-Resistant Staphylococcus aureus from the Environment in a Veterinary Teaching Hospital. Journal of Veteri nary Internal Medicine. 2004;18(4):468-70. 73

PAGE 74

93. de Neeling AJ, van den Broek MJM, Spalburg EC, van Santen-Verheuvel MG, Dam-Deisz WDC, Boshuizen HC, et al. Hi gh Prevalence of Methicillin Resistant Staphylococcus aureus in Pigs. Veterinary Microbiology. 2007;122(3-4):366-72. 94. Khanna T, Friendship R, Dewey C, Weese JS. Methicillin Resistant Staphylococcus aureus Colonization in Pigs and Pig Farmers. Veterinary Microbiology. 2008;128(3-4):298-303. 95. Baptiste KE, Williams K, Willams NJ, Wattret A, Clegg PD, Dawson S, et al. Methicillin-Resistant Staphylococci in Co mpanion Animals. Emer g Infect Dis. 2005 Dec 2005;11(12):1942-4. 96. van Duijkeren E, Wolfhagen MJHM, Bo x ATA, Heck MEOC, Wannet WJB, Fluit AC. Human-to-Dog Transmission of Methicillin-Resistant Staphylococcus aureus Emerg Infect Dis. 2004 De cember 2004;10(12):2235-7. 97. Weese JS, Dick H, Willey BM, McGeer A, Kreiswirth BN, Innis B, et al. Suspected Transmission of Methicillin-Resistant Staphylococcus aureus Between Domestic Pets and Humans in Veterinary Clinics and In the Household. Veterinary Microbiology. 2006;115(1-3):148-55. 98. CDC. MRSA in Healthcare Settings. 2007 [cited Dec. 7, 2009]; Available from: http://www.cdc.gov/ncidod/dhqp/ar _MRSA_spotlight_2006.html 99. DHQP. Laboratory De tection of: Oxacillin/M ethicillin-Resistant Staphylococcus aureus [web page] 2005 [cited April 6, 2007.]; Available from: http://www.cdc.gov/ncidod/dhqp/ar_lab_mrsa.html 100. Juhasz-Kaszanyitzky E, Janosi S, Somogy i P, Dan A, van der Graaf-van Bloois L, van Duijkeren E, et al. MRSA Transmission Between Cows and Humans. Emerg Infect Dis. 2007 Apri l 2007;13(4):630-2. 101. Tenover FC, McDougal LK, Goering RV, Killgore G, Projan SJ, Patel JB, et al. Characterization of a Strain of Comm unity-Associated Methicillin-Resistant Staphylococcus aureus Widely Disseminated in the Un ited States. J Clin Microbiol. 2006 January 1, 2006;44(1):108-18. 102. Kennedy AD, Otto M, Braughton KR, Whit ney AR, Chen L, Mathema B, et al. Epidemic Community-Associated Methicillin-Resistant Staphylococcus aureus: Recent Clonal Expansion and Diversification. Pr oceedings of the National Academy of Sciences. 2008 January 29, 2008;105(4):1327-32. 103. van Duijkeren E, Jansen MD, Flemming SC, de Neeling H, Wagenaar JA, Schoormans AHW, et al. Methicillin-Resistant Staphylococcus aureus in Pigs with Exudative Epidermitis. Emerg Infect Dis. 2007;13(9):1408-10. 74

PAGE 75

104. Larkin MA, Blackshields G, Brown NP Chenna R, McGettigan PA, McWilliam H, et al. ClustalW and ClustalX version 2.0. Bioinformati cs 2007;23(21):2947-8. 75

PAGE 76

76 BIOGRAPHICAL SKETCH Katherine Lynn Maldonado attended the University of Florida where she received her Bachelor of Science in animal sciences with an emphasis in animal biology in 2002. She was admitted to the early admission prog ram at the College of Veterinary Medicine and received her Doctor of Veterinary Medi cine degree in 2006. Following a short time in mixed animal practice, she returned to t he University of Florida to pursue further graduate studies. In December 2009 she receiv ed her Master in Public Health degree. While finishing her graduate studies, Dr. Ma ldonado worked as a full-time veterinary associate with Banfield, the Pet Hosp ital in small animal practice.