<%BANNER%>

Genetics of southern blight resistance in tomato (Solanum lycopersicum L.)

Permanent Link: http://ufdc.ufl.edu/UFE0042240/00001

Material Information

Title: Genetics of southern blight resistance in tomato (Solanum lycopersicum L.)
Physical Description: 1 online resource (114 p.)
Language: english
Creator: Bhakta, Mehul
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: blight, genetics, isolates, lycopersicum, markers, molecular, pimpinellifolium, resistance, rolfsii, sclerotium, solanum, southern, tomato
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Southern blight caused by Sclerotium rolfsii Sacc. is a soil-borne fungal disease of a wide range of plant species occurring throughout tropical and sub-tropical regions. This study aimed to evaluate the level of southern blight resistance provided by various genetic sources in tomato and also to determine if isolates of S. rolfsii differed in their virulence against tomato, so as to enable us to identify the most effective sources of resistance which could be used to identify molecular markers closely linked to loci conferring resistance to southern blight. In order to check the resistant sources and virulence level in different isolates, two different resistant sources (PI 126932 and 5913M) and a susceptible source (Fla. 7776) were inoculated with three different isolates of S. rolfsii. The plants were inoculated at an age of eight weeks by S. rolfsii grown on rye seeds. Disease severity was estimated by scoring individual plants on a visual scale of 0-4 with increasing severity, and overall survival was recorded. For identifying linked markers, a mapping population was generated from a cross between Fla. 7776 and PI 126932. The parental lines, F1 and F2 individuals, F3 families and BC1 individuals were assayed for southern blight resistance. The selective genotyping method was used to screen F2 population with 102 co-dominant molecular markers distributed throughout the genome. Significant markers were confirmed with additional F2 individuals as well as with F3 and BC1 generations. Results indicated that PI 126932 was resistant against all three isolates while 5913M against only two isolates (WM 609 and DF/LA-SR1). Also, differences in disease severity among isolates were observed in line 5913M and PI 126932. This indicated that southern blight resistance in tomato could depend on the interaction between the tomato genotype and southern blight strain. The percent of surviving individuals increased from 10% in the susceptible parent (Fla. 7776) to 90% in the resistant parent (PI 126932) suggesting incomplete penetrance. Two loci, L1 on chromosome 10 and L2 on chromosome 11, were associated with the resistance to southern blight. Results indicated overdominant and epistatic effects at both loci. The identification of favorable alleles in both parents explained recovery of transgressive segregants among progeny derived from the cross between Fla. 7776 and PI 126932. Apart from such epistatic genetic interactions, the locus L1 from PI 126932 provided sufficient resistance under greenhouse conditions as a dominant trait. Results from this study suggest that the L1 locus was an ideal source of southern blight resistance that could be introgressed into elite tomato lines through marker assisted backcrossing.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mehul Bhakta.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Edwards, Jeremy D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042240:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042240/00001

Material Information

Title: Genetics of southern blight resistance in tomato (Solanum lycopersicum L.)
Physical Description: 1 online resource (114 p.)
Language: english
Creator: Bhakta, Mehul
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: blight, genetics, isolates, lycopersicum, markers, molecular, pimpinellifolium, resistance, rolfsii, sclerotium, solanum, southern, tomato
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Southern blight caused by Sclerotium rolfsii Sacc. is a soil-borne fungal disease of a wide range of plant species occurring throughout tropical and sub-tropical regions. This study aimed to evaluate the level of southern blight resistance provided by various genetic sources in tomato and also to determine if isolates of S. rolfsii differed in their virulence against tomato, so as to enable us to identify the most effective sources of resistance which could be used to identify molecular markers closely linked to loci conferring resistance to southern blight. In order to check the resistant sources and virulence level in different isolates, two different resistant sources (PI 126932 and 5913M) and a susceptible source (Fla. 7776) were inoculated with three different isolates of S. rolfsii. The plants were inoculated at an age of eight weeks by S. rolfsii grown on rye seeds. Disease severity was estimated by scoring individual plants on a visual scale of 0-4 with increasing severity, and overall survival was recorded. For identifying linked markers, a mapping population was generated from a cross between Fla. 7776 and PI 126932. The parental lines, F1 and F2 individuals, F3 families and BC1 individuals were assayed for southern blight resistance. The selective genotyping method was used to screen F2 population with 102 co-dominant molecular markers distributed throughout the genome. Significant markers were confirmed with additional F2 individuals as well as with F3 and BC1 generations. Results indicated that PI 126932 was resistant against all three isolates while 5913M against only two isolates (WM 609 and DF/LA-SR1). Also, differences in disease severity among isolates were observed in line 5913M and PI 126932. This indicated that southern blight resistance in tomato could depend on the interaction between the tomato genotype and southern blight strain. The percent of surviving individuals increased from 10% in the susceptible parent (Fla. 7776) to 90% in the resistant parent (PI 126932) suggesting incomplete penetrance. Two loci, L1 on chromosome 10 and L2 on chromosome 11, were associated with the resistance to southern blight. Results indicated overdominant and epistatic effects at both loci. The identification of favorable alleles in both parents explained recovery of transgressive segregants among progeny derived from the cross between Fla. 7776 and PI 126932. Apart from such epistatic genetic interactions, the locus L1 from PI 126932 provided sufficient resistance under greenhouse conditions as a dominant trait. Results from this study suggest that the L1 locus was an ideal source of southern blight resistance that could be introgressed into elite tomato lines through marker assisted backcrossing.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mehul Bhakta.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Edwards, Jeremy D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042240:00001


This item has the following downloads:


Full Text





GENETICS OF SOUTHERN BLIGHT RESISTANCE IN TOMATO
(Solanum lycopersicum L.)



















By

MEHUL SAMIR BHAKTA


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2010

































2010 Mehul Samir Bhakta
































To my family, for supporting and never losing faith in me; and to all my friends along the
way for without all of you this would not have been possible.









ACKNOWLEDGMENTS

I express my deep appreciation to Dr. Jeremy Edwards, esteemed chair of my

advisory committee, for his persistent support, encouragement and scientific guidance

during my association with him. This work would not be possible without his help and

guidance. I would specially like to thank Dr. Xin Zhao and Dr. Gary Vallad the other

members of my advisory committee for their immense support and creative

suggestions.

I would also like to express a deep sense of gratitude and sincere thanks to Dr.

Jay Scott for introducing me to Dr. Jeremy Edwards and also for his kind help and

valuable suggestions, to Dr. Jeffrey A. Rollins for his assistance and suggestion for my

project in Gainesville. I am also very grateful to Dr. Samuel Hutton for his guidance and

support during this entire project and also for contributing valuable marker information

required for this project.

I pay special thanks to my lab members Timothy Davis, Ragy Ibrahem, Cathy

Provenzano, Jose Diaz for their support in lab, greenhouse and field work. I would also

like to thank my fellow graduate student Xie Chenzhao for her support with my

inoculation work.

I am deeply grateful to all my friends who filled my life with joy and happiness and

made my stay at GCREC a memorable event of my life. I thank my family for believing

in me and for their support in pursuing this degree.

Above all, I thank God for making me capable in achieving this goal.









TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ......... ............ .......... ....... ... .................... 4

LIS T O F TA B LE S ............. .. ..... ......................................................... ...... ........ 7

LIS T O F F IG U R E S .................................................................. 9

A B ST RA C T ............... .... ...... .......................................................... ...... 10

CHAPTER

1 INTR O D U CTIO N ............................................................................................. 12

2 SOURCES OF GENETIC RESISTANCE IN TOMATO TO SOUTHERN BLIGHT
UNDER FLORIDA CONDITION ................................................... 24

Introduction ............................ ............... 24
Materials and Methods........................................... ............... 26
Plant Materials............................... .............. ......... 26
Fungal Materials and Inoculum Preparation ............ ................................ 27
Screening Study ..................... ................................... 28
Isolate Study................ ...... .................... ............... .............................29
Screening for Resistance with the GCT-1 Isolate .................................. 29
Disease Assessment .............. ............................ 29
S tatistica l A na lys is ........................................................................ ......... 30
Results .......... ........................................................................................... 30
Inoculation Procedure ............. ........................... 30
Genotype Effects ........................................... 31
Isolate Effects .......................... .. ..... ............. .. ............. 31
Inheritance Patterns of Southern Blight Resistance ............... .... ............ 32
D discussion ............................................................................................ ............. 32

3 IDENTIFICATION OF MOLECULAR MARKERS LINKED TO SOUTHERN
BLIGHT RESISTANCE IN TOMATO .......... .......... ................. 43

Introduction ............................ ............... 43
Materials and Methods........................................... ............... 46
Plant M aterials............................... ..... ............... 46
Genomic DNA Extraction from Leaves ........... ........................ .... 47
Inoculation and Disease Evaluation ............... ...... ................. 47
Molecular Markers and F2 Genotyping ....................... ............. 48
Marker Analysis ......................... .......... ......... 50
Results ................ .................................................... 51
D is c u s s io n .............. ..... ............ ................. ............................................. 5 2









4 SUMMARY AND CONCLUSIONS............................................... 64

APPENDIX

A P E D IG R E E S ................................. .......... ................................... 69

B MOLECULAR MARKER TECHNICAL INFORMATION.............................. 72

C ADDITIONAL MOLECULAR MARKER INFORMATION............................. 85

D FIELD TRIAL EXPERIMENT ............... .................................. 95

E SOUTHERN BLIGHT RESISTANCE THROUGH GRAFTING ........................... 99

LIST OF REFERENCES ............... .................... ..................... 102

BIOGRAPHICAL SKETCH ............... ............ .... .......................... 114



































6









LIST OF TABLES


Table page

2-1 Determining inoculum load for differentiating southern blight resistant (PI
126932) and susceptible (Fla. 7776) tomato line.......... .......... ............ 39

2-2 Two-way analysis of variance based on the ranked data of southern blight
disease severity on tomato line PI 126932, Fla. 7776 and 5913M caused by
GCT-1, W M609 and DF/LA-SR1 isolates. ................... ............................... 39

2-3 Relative marginal effects with 95% confidence interval estimated based on
ranked data by two-way ANOVA type statistics for the severity of southern
blight on three different tomato line caused by three different S. rolfsii
isolates. ............................................. 39

2-4 Statistical analysis of variance based on disease severity scores in PI
126932, Fla. 7776 and 5913M caused by GCT-1 isolate............................ 40

2-5 Relative marginal effects with 95% confidence interval estimated based on
ranked data by ANOVA type statistics for the severity of southern blight on
three different tomato line caused by GCT-1 isolate of S. rolfsii......................... 40

2-6 Segregation for resistance to southern blight in parental, F1 and F2
populations .............. ............................ ....... ........ ...... .............. 40

3-1 Polymorphic markers for Fla. 7776 and PI 126932 .................. .................. 56

3-2 Detection of associated molecular markers in 354 F2 individuals for
chromosome 10 & 11 and for a subset of 135 F2 plants for chromosome 4,
10 and 11 through single marker interval analysis................ .... .......... 60

3-3 Parents and F2 plant survival percentage as per combination of alleles ........... 61

3-4 F3 plant survival percentage as per combination of alleles.............................. 62

3-5 BC1 plant survival percentage as per combination of alleles............. .............. 63

3-6 Detection of associated molecular markers in 64 BC1 individuals...................... 63

B-1 Technical information for markers polymorphic between Fla. 7776 and PI
126932. ............... ......... ...... ............... ......... ...... ........ 73

C-1 Marker classification based on polymorphism and dominance between PI
12 6 9 32 a nd F la 7 7 76 ....................................... ......................... 86

C-2 Chi-square test for marker segregation distortion.......................... ... ........... 94









D-1 Two-way analysis of variance test for determining variation in disease
severity scores in tomato lines PI 126932, 5913M, 5635M, Fla. 7776, Fla. 47
and Fi(Fla. 7776 x PI 126932) in field condition...................... ........... .......... 97

D-2 Bonferroni's t test for differentiating tomato lines based on disease severity
scores for G C T-1 isolate .......................................... ..................... .............. 98

E-1 Number of grafted and parental lines plants found to be resistant and
susceptible under greenhouse condition. .............................................. 101









LIST OF FIGURES


Figure page

2-1 Southern blight symptoms on plants of parental lines. A) wilting symptoms on
susceptible parent Fla. 7776, B) wilting symptoms on resistant parent
P1126932, C) stem lesion on Fla. 7776, D) stem lesion on PI 126932. .............. 41

2-2 Frequency distribution of southern blight disease severity for plants of tomato
line P1126392, Fla.7776, and F ....... ........ ........................ 42

A-1 Pedigree of Fla. 7776. ......... .. ..... ............................................... .......... ....... 70

A-2 Pedigree of 5913M ............ ..... ............. ............... .. ....... ...... ......... 71









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science


GENETICS OF SOUTHERN BLIGHT RESISTANCE IN TOMATO
(Solanum lycopersicum L.)

By

Mehul S. Bhakta

August 2010

Chair: Jeremy D. Edwards
Major: Horticultural Sciences


Southern blight caused by Sclerotium rolfsii Sacc. is a soil-borne fungal disease of

a wide range of plant species occurring throughout tropical and sub-tropical regions.

This study aimed to evaluate the level of southern blight resistance provided by various

genetic sources in tomato and also to determine if isolates of S. rolfsii differed in their

virulence against tomato, so as to enable us to identify the most effective sources of

resistance which could be used to identify molecular markers closely linked to loci

conferring resistance to southern blight. In order to check the resistant sources and

virulence level in different isolates, two different resistant sources (PI 126932 and

5913M) and a susceptible source (Fla. 7776) were inoculated with three different

isolates of S. rolfsii. The plants were inoculated at an age of eight weeks by S. rolfsii

grown on rye seeds. Disease severity was estimated by scoring individual plants on a

visual scale of 0-4 with increasing severity, and overall survival was recorded. For

identifying linked markers, a mapping population was generated from a cross between

Fla. 7776 and PI 126932. The parental lines, F1 and F2 individuals, F3 families and BC1

individuals were assayed for southern blight resistance. The selective genotyping

10









method was used to screen F2 population with 102 co-dominant molecular markers

distributed throughout the genome. Significant markers were confirmed with additional

F2 individuals as well as with F3 and BC1 generations. Results indicated that PI 126932

was resistant against all three isolates while 5913M against only two isolates (WM 609

and DF/LA-SR1). Also, differences in disease severity among isolates were observed in

line 5913M and PI 126932. This indicated that southern blight resistance in tomato

could depend on the interaction between the tomato genotype and southern blight

strain. The percent of surviving individuals increased from 10% in the susceptible parent

(Fla. 7776) to 90% in the resistant parent (PI 126932) suggesting incomplete

penetrance. Two loci, L1 on chromosome 10 and L2 on chromosome 11, were

associated with the resistance to southern blight. Results indicated overdominant and

epistatic effects at both loci. The identification of favorable alleles in both parents

explained recovery of transgressive segregants among progeny derived from the cross

between Fla. 7776 and PI 126932. Apart from such epistatic genetic interactions, the

locus L1 from PI 126932 provided sufficient resistance under greenhouse conditions as

a dominant trait. Results from this study suggest that the L1 locus was an ideal source

of southern blight resistance that could be introgressed into elite tomato lines through

marker assisted backcrossing.









CHAPTER 1
INTRODUCTION

Tomato (Solanum lycopersicum L.) is one of the most widely cultivated and

consumed vegetable crops in the world. World production of tomato in 2008 reached

129.64 million metric tons, out of which 12.57 million metric tons of tomatoes were

produced by the United States of America (FAOSTAT). Florida is the largest producer of

fresh market tomatoes in the United States, producing 474.36 thousand metric tons in

2008 and 557.82 thousand metric tons in 2009 (USDA). The tomato industry in Florida

is important to the state economy, contributing a value of more than $997 million, worth

$299 million in labor income (VanSickle and Hodges, 2008). However, there are many

challenges being faced by this industry, such as rising production costs, reduction in

farming area due to urbanization, increases in disease occurrence due to regulatory

phase out of chemicals, global climatic changes etc. Southern blight of tomato is one of

the soil-borne diseases which could become a major problem in near future due to the

phase out of the soil fumigant Methyl Bromide (an ozone depletor) (Gordon and Taylor,

1941).

Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii; Corticiaeae, Basidiomycota), a

soil-borne fungus, is responsible for significant economic losses on a wide range of

agronomic host plants. The most common hosts are the legumes, crucifers, and

cucurbits. On tomato, the disease is referred to as southern blight (synonyms: stem rot,

southern root rot, sclerotium blight) and is associated with warm, noncalcareous acid

soil (Sherf and MacNab, 1986). The fungus is common in tropical and sub-tropical parts

of the world and infects more than 500 species of plants in over 100 families and is a

problem in many southeast parts of the United States (Aycock, 1966). It appears that S.









rolfsii is mostly confined to areas where average winter temperatures are not cold

enough to kill mycelia and sclerotia in the soil. Trees are found to be more resistant to

this disease once they have passed their seedling stage (Freire et al., 2002; Naqvi,

2004).

The first documented report of southern blight was reported by Peter Henry Rolfs'

in association with tomato blight in Florida in 1892 (Garren, 1959). The organism was

later named as S. rolfsii and was placed in the phylum Fungi Imperfecti

(Deuteromycota) by Saccardo in 1911. Aycock, 1966 in his work cited many people who

worked with a perfect stage developed in cultures of S. rolfsii from 1930 to 1941. The

Basidiomycete teleomorph of S. rolfsii was first reported in 1931 (Curzi, 1931). Curzi

named it Corticium rolfsii (Sacc.) Curzi since there was no known basidiomycete

corresponding to the sexual stage of this fungus. In 1934 the perfect stage was first

reported in the United States (Barret, 1934), followed by Mundkur (1934) on onion in

India. Goto in 1935 obtained both typical and atypical isolates of S. rolfsii. Milthorpe in

1941 also observed differences in mycelia characters and in the production of sclerotia

among seven single basidiospore isolates. All agreed that the perfect stage of Corticium

sp;. Corticium centrifugum (Lev.) Bres. was most similar to the characteristics of the

new fungus, in color and thickness for basidium structure. As a result, the name

Corticium rolfsii (Sacc.) Curzi, proposed by Curzi was generally adopted. However, a

proposal that the fungus should be placed in the genus Pellicularia and named

Pellicularia rolfsii (Sacc.) West was proposed by West in 1947 giving the reason that it

conformed morphologically with characteristics of the subdivision of Corticium (West,

1961).









Extreme morphological and less marked physiological differences have been

known among several S. rolfsii strains. It has been shown that isolates from a given

geographical area may be relatively uniform, and verifiable mutants are less frequent.

Even so, single-basidiospore cultures from one of these isolates frequently show the

extreme variation of the species. In a study of the perfect stage of S. rolfsii, Lyle

obtained 306 monobasidiospore isolates from two original isolates which produced

hymenia in culture (Lyle, 1953). A marked difference was noticed by Lyle in the growth

type, amount of vegetative growth, sclerotial characters, mutual effects of sclerotial and

asclerotial isolates, aversion and hymenial formation. These differences lead Lyle to

conclude that the fungus can be homothallic. Goto (Aycock, 1966) reported earlier that

on pairing of larger numbers of monobasidiospores, several strains of varying

characteristics including parental strains were obtained indicating that the basidiospore

cultures were usually heterothallic. The uniformity of isolates from an area may be an

expression of dominance in the dikaryon, where as the great diversity reported in vitro

could be an expression of recombination and sorting out of nuclei in the sexual stage

(Lyle, 1953).

S. rolfsii isolates were reported to be showing distinction not only in their

morphology but also in their pathological behavior (Harlton et al., 1995; Sharma et al.,

2002; Shukla and Pandey, 2007; Shukla, 2008). Edson in 1923 used two isolates of S.

rolfsii in their study and reported that they differed pathogenically as well as

morphologically. Shukla and Pandey in 2008 tested 10 isolates and observed four

distinct pathogenicity reactions against Parthenium hysterophorus L. They noted that

depending upon the isolate, the disease incidence in a given individual ranged from 30









to 80 percent. Finding of Shukla and Pandey supported the finding of Flores-

Moctezume et al. (2006) who also reported four levels of pathogenicity in two of the

isolates they tested against different species like Ricinus communis, Sesamum indicum,

Tagetes erecta etc.

Sclerotium rolfsii is known to infect a diverse array of plants. Rolfs (West, 1961)

mentioned about 15 host plants that he observed which included weeds and garden

plants. Some of the hosts reported to be affected by this fungus in the U.S. includes

Arachis hypogaea, Beta vulgaris, Brassica oleracea, Capsicum annum, Cucurbita spp.

Citrusllus vulgaris, Daphne spp, Ficus carica, Gossyium hirsutum, Phaseolus vulgaris,

Solanum tuberosum, Solanum melongena, Solanum lycopersicum, Pensiemon spp,

Phlox sublata etc (Taurbenhaus, 1919). Webber, in 1931 published a list of 189 species

of plants susceptible to southern blight which included 8 monocot and 42 dicot families.

Many more hosts susceptible to this fungus have been reported later in the publications

from many parts of the tropic and sub-tropic regions around the world. The list included

host plants with high economic value along with ornamentals, forest species and weeds

(West, 1961). Recently reported hosts include Phaius flavus (BI.) Lindl. and

Paphioedilum venustum (Wall.) Pfitz.ex Stein. (Bag, 2003), Dioscorea alata (Jeeva, et

al., 2005), Swietenia macrophylla and Pterocarpus santalinus (Sankaran, et al., 2007),

Ascocentrum and Ascocenda orchids in Florida (Cating, et al., 2009), Convolvulus

cneorum (Polizzi, et al., 2010), Musa spp. (Thangavelu and Mustaffa, 2010).

In general, S. rolfsii is distributed in tropical and sub-tropical regions where high

temperature prevails during the rainy season. Based on the occurrence record from

publication, the geographical distribution of this fungus was estimated by West (1961).









He reported that S. rolfsii occurrence in the southern United States was found in Florida

to California. South and Central American countries where reports of the presence of S.

rolfsii have been obtained included Argentina, Brazil, Colombia, British Guiana,

Trinidad, West Indies, Dominican Republic, Bermuda, Barbados, Jamaica, St. Vincent,

Puerto Rico and Cuba. While publications from Italy, Germany and U.S.S.R reported

presence in Europe. From Africa, reports have been obtained from Egypt, Tunis, Gold

Coast, Sierra Leone, Gambia, Belgian Congo, Uganda, Southern Rhodesia, Nyasaland,

Madagascar, and Union of South Africa. A number of articles have been published from

countries like India, Iran, Japan, Malaya, China, Ceylon, Formosa in Asia reporting the

occurrence of S. rolfsii. Occurrence reporting articles have also been published from

Philippines, Java, Sumatra, Hawaii and Australia in the Pacific area (West, 1961).

The mycelium of S. rolfsii is able to grow in the temperature range of 8 to 40 OC.

However, the optimum range for growth is 30 to 35 OC. Vegetative hyphae are killed by

an exposure of 24 hrs to -2 OC. Sclerotial formation was greatest in the temperature

range of 30-35 OC (Milthorpe, 1941), whereas the optimal temperature for the

germination of sclerotia ranged from 24 to 36 OC. Highest germination rate is obtained

when the sclerotia are stored at relative humidity levels from 25% to 35% (Watkins,

1950; Punja, 1985). Povah (1927) showed that five years old sclerotia could be induced

to produce mycelia growth.

Sclerotia exhibit two forms of germination: hyphal and eruptive (Punja and Grogan,

1982; Punja, 1985). In hyphal germination, an individual strand grows out from the

sclerotium surface. However the growth is not extensive in absence of an external

nutrient source. In the case of eruptive germination, an aggregate of mycelium emerges









from the sclerotial rind. Eruptive germination is induced by drying the sclerotia (Smith,

1972; Punja and Grogan, 1982) or by exposing them to volatile compounds, mainly

alcohols and aldehydes (Punja, 1985).

Disease symptoms on the plant are generally accelerated by favorable

temperature. The period of incubation is approximately 2-4 days for tomato plants. An

early symptom of infection is manifested by a deep brown lesion on the stem at the soil

line. During infection mats of mycelium develop around the lesion on the stem base of

tomato seedlings. These mats are attached to the stem by the hyphae which are

appressed to the host epidermal cells. Death of the underlying parenchyma cells occurs

to a depth of two to four layers before they are penetrated by hyphae (Aycock, 1966).

Later the foliage droops, loses its green color and the plant never revives.

Oxalic acid is considered a pathogenicity factor in Sclerotium rolfsii. On direct

application of oxalic acid on stem or either leaf tissue, the resulting injury and wilting

symptoms observed were found to be similar to as caused by S. rolfsii (Malcolm, et al.,

2005). Bateman and Beer (1965) concluded that wilting is induced as a consequence of

acidifying the host tissue due to oxalic acid. Prominent activities of polygalacturonase

and cellulose were detected in infected tissue (Bateman and Beer, 1965; Bateman,

1972). A number of pathways have been proposed by which oxalic acid could aid

infection, such as acidification to facilitate cell wall degrading enzyme activity, through

tissue damage by pH, or by Ca" ions sequestration from the cell walls to form calcium

oxalate (Dutton and Evans, 1996; Malcolm, et al., 2005). Amadioha (1993) reported that

oxalic acid could work synergistically with polygalacturonase during the initiation of

infections. Polygalacturonase was found to be hydrolyzing calcium pectates only when









oxalate ions were present, which indicated that polygalacturonase and oxalic acid

produced by S. rolfsii acted together while disrupting the host cell walls during infection

(Bateman and Beer, 1955).

Earlier work showed that sclerotia can remain viable up to 5 years (Povah, 1927;

Nisikado et al., 1938). The extensive host range and prolific growth of S. rolfsii and its

ability to produce large number of sclerotia that may persist in soil for several years

increases the difficulty to control the resulting diseases.

Alteration of soil pH was one of the earliest strategies for controlling the diseases

caused by S. rolfsii. Higgins (1923) and Rosen (1929) both suggested applying lime to

increase the soil pH to around 8 for disease control. Later, Higgins (1934) found liming

to be impractical due to the cost of treating entire fields and difficulty of maintaining pH

around 8. Reducing the soil pH to around 2.4 was ineffective at controlling disease

(Aycock, 1966).

Host nutrition was reported to influence disease resistance in a number of

instances. Leach and Davey (1942) found that calcium nitrate effectively reduced

severity of Southern blight. It was postulated that N fertilizers may induce anatomical or

physiological resistance in the host (Mohr, 1955). Hudgins (1952) conducted an

experiment that varied the composition of N, P and K in peanut and also found that

higher levels of N decreased disease severity.

Mohr and Watkins (1959) reported that calcium nitrate depressed disease

expression. They also reported that the disease was more severe on sandy soil as

compared to the clay soil. On further analysis of the soil they found that the clay soil had

10 times more calcium, and noted that application of calcium nitrate to a susceptible









variety enable it to survive a week longer as compared to the plants fertilized with

ammonium sulfate and sodium nitrate. They concluded that nitrogen was probably not

the principal element associated with resistance to S. rolfsii; rather a resistant variety

may be more efficient in absorbing and utilizing calcium.

Grafting resistant rootstocks to susceptible scions may be another effective

strategy to control diseases caused by soil-borne pathogens. Several rootstocks like

'Big Power', 'Beaufort', and 'Maxifort' were resistant to southern blight and found to

reduce disease severity when utilized for tomato production (Rivard et al., 2009).

However, grafting increases the crop production time and also labor cost, which limit its

widespread adoption. Control of southern blight by the use of bio-control agents has

also been proposed. Bio-control agents like Trichoderma koningii protected tomato

seedlings against S. rolfsii. (Latunde-dada, 1993). Ganesan et al. (2007) reported that

the combined application of selected antagonistic Rhizobium isolates and the bio-

control agent Trichoderma harzianum conferred significant protection to Arachis

hypogaea L. against S. rolfsii and increased plant growth. It reduced the disease

incidence by 57% as compared to the control. Although considerable control has been

obtained by bio-control agents they have not been accepted widely because of the

limited performance vis-a-vis chemical fungicides and fumigants. In addition,

microorganisms used for biological control can have significant, measurable effects,

both direct and indirect, on non-target organisms. These effects include displacement of

non-targeted soil microorganisms, allergenicity to humans or animals and toxigenicity or

pathogenicity to undesired organisms (Brimner & Boland, 2004; Cook, et at, 1996).

Boyel (1952) and Garren (1959d) proposed that deep burial of organic matter to reduce









the occurrence of southern blight. However, Young (1954) stated that deep burial will

reduce crop yields for at least few years, since infertile soil is brought to the soil surface.

Because of the low effectiveness of these methods, the management of southern

blight has relied heavily on the application of chemicals and crop rotations (Leeper et

al., 1992). Although crop rotation has been suggested as a control for southern blight by

many, the extensive host range and survival period of sclerotia in soil has limited this

cultural practice.

Several fumigants have been found to be effective for the management of S.

rolfsii. Chloropicrin at a rate of 100 ppm was found to be highly effective than most of

the chemicals tried (Davey and Leach, 1941). Pentachloronitrobenzene (PCNB) was

also found to be an effective fungicide in curbing the southern blight. Csinos, et al.

(1983) found that PCNB reduced southern blight incidence by 50% in peanut. However,

in April 1993 PCNB was declared a hazardous air pollutant in the U.S. (Howard, 1991),

also the use of Chloropicrin was restricted by the US government in June 2003 (EPA,

2007), although such restriction was withdrawn latter. Another fumigant, Methyl bromide

(MeBr) gave adequate control of S. rolfsii, and this fumigant has been widely used

throughout the globe to treat soil in infested beds (Aycock, 1966; Jenkins and Averre,

1986; Brown et al., 1989). MeBr is an effective fungicide, herbicide, nematicide and

insecticide and has been used commercially in United States for soil fumigation

(Ragsdale and Wheeler, 1995).

MeBr has been used by Florida's tomato and pepper growers well over 40 years,

which has unfortunately limited the development of alternative multiple pest control

tactics for many of the soil-borne pests of these crops (Chellemi, 1998). However, the









provisions of the Montreal Protocol will eventually lead to a complete phase out of MeBr

use in crop production excluding the critical use exemption. If no alternatives are

available then the economics of producing certain horticultural crops in states like

Florida, North Carolina, California and other southern states will be greatly affected by

the ban imposed on the use of MeBr (USDA, 1993; Spreen, et al., 1995; CDFA, 1996).

Due to the recent MeBr phase-out, Southern blight as well as other soil-borne

pathogens which are currently a minor problem in Florida have a high potential of

becoming major production issues. This threat has created the need to develop

alternative strategies for controlling southern blight in tomato.

Even if a chemical replacement for MeBr is found, it is possible that it might not be

economically feasible, lack the same efficacy against soil-borne pathogens, or could

face a similar phase-out process in future. Thus, heritable resistance offers a

particularly desirable long term solution to the problem of controlling southern blight.

Early breeding efforts to develop resistant varieties confronted problems related to

genetic variation in the pathogen, environmental effects on pathogenicity and

expression of resistance in host (Mohr, 1955). Inheritance studies have shown that

resistance in many species is monofactorial as compared to other species where

resistance was shown to behave as a quantitative character with polygenic inheritance

(Mohr, 1955). Such complexity underlies the challenge faced by plant breeders to

develop resistant varieties that are horticulturally acceptable. For tomato, the first

challenge to developing southern blight resistant varieties is to understand the nature of

resistance along with its inheritance.









Numerous studies showed that tomato species S. lycopersicum carries little or no

resistance against southern blight, although some tests found some variation in the

degree of susceptibility (Fajardo and Mendoza, 1935; Mohr, 1955; Aycock, 1966). Mohr

et al. (1947) found resistance to southern blight in a single plant introduction line of S.

pimpinellifolium (PI 126932) obtained from Peru. In field screenings (Mohr, 1955), none

of these plants died from southern blight though they were grown in a heavily infested

area, while disease incidence was high among susceptible varieties.

Resistance in S. pimpinellifolium was proposed to be associated with the

development of a ring of heavily suberized phellem cells that form a protective barrier

around the stem when the plants were 6 to 9 weeks old (Mohr 1955). Southern blight

infection can greatly increases on these plants if the phellem ring is somehow damaged

(Jenkins and Averre, 1986). Such a lignified stem is not observed in S. lycopersicum. PI

126932 was not found to be resistant until they were about 6 weeks old. Mohr

suggested that the resistance could be associated with a barrier to fungal penetration

present in the outer stem tissue of mature plants but absent in young seedlings. Beside

PI 126932, six other advanced breeding lines (5635M, 5707M, 5719M, 5737M, 5876M

and 5913M) were identified to be resistant to southern blight in a breeding program

intended to develop heat-tolerant processing-type tomato cultivars. These advanced

breeding lines have been released as a source of southern blight resistance from Texas

A&M University (Leeper, et al., 1992)

Mohr (1955) reported that southern blight resistance in S. pimpinellifolium is

inherited as a dominant, monogenic trait, but suggested that further screening was

required to do an accurate analysis of the mode of inheritance. If resistance is inherited









as a single dominant gene, then the development of resistant varieties can be

accelerated through the identification of molecular markers linked to the gene, allowing

for marker assisted selection. Not only will the linked markers help in the rapid

development of resistant lines, but they also would be of great use in pyramiding

resistance alleles at multiple genes. The purpose of this study was to identify the locus

imparting resistance to southern blight in S. pimpinellifolium to develop resistant lines of

cultivated tomatoes. Specific objectives are 1) to develop reliable greenhouse methods

to assay for southern blight resistance in tomato, 2) to confirm sources of genetic

resistance in tomato, and 3) to map the genomic positions of the loci conferring

resistance.









CHAPTER 2
SOURCES OF GENETIC RESISTANCE IN TOMATO TO SOUTHERN BLIGHT
UNDER FLORIDA CONDITION

Introduction

Southern blight of tomato (Solanum lycopersicum L.) caused by Sclerotium rolfsii

Sacc. is a soil-borne disease that has the potential of becoming a major disease in

Florida following the phase-out of Methyl Bromide (MeBr). This disease can cause

major losses to tomato production in the southern United States. Georgia alone suffered

a loss of $10.4 million in peanut crops due to southern blight with an additional $19.2

million spent on its control in 2004 (University of Georgia, 2005).

Infection is promoted by dense planting, high soil moisture and frequent irrigation

(Aycock, 1966; Sconyers et al., 2005). In tomato this fungus can infect all portions of the

plant touching the soil, and sclerotia provide the primary inoculum for epidemics

(Ristaino et al., 1991; Liua et al., 2008). Symptoms on tomato initiate with the decay of

the cortex at the base of the stem several centimeters above and below the soil surface

(Aycock, 1966), followed by the growth of a white mat of mycelia on the stem. Later

sclerotia are produced, ranging from 1-2 mm in diameter, and tan to brown in color

depending upon the strain. Infection causes partial or complete girdling of the stem near

the soil line resulting in the damping-off of seedlings, while more mature plants develop

a progressive wilt that begins with the lower leaves and eventually leads to plant death.

Root infection can follow stem or crown invasion sometimes causing death of the tap

root. Sclerotia can be found on fibrous roots about 2-4 inches deep (Aycock,

1966).Fruits touching infected stem or soil can also get infected. The infection site

appears sunken at first and the epidermis may be ruptured by the time the lesion is 2

cm in diameter (Weber and Ramsay, 1926; Young, 1946; Aycock, 1966). Fruits can rot

24









in 3 to 4 days under ideal temperature and moisture (McColloch et al., 1968; Jones et

al., 1991).

Several methods have been proposed to control this disease, but none has proven

highly effective. The best possible control obtained was with the use of Methyl Bromide,

a soil fumigant. This chemical was ranked as one of the five most used pesticides in the

United States (UNEP, 1995). However, MeBr is photo-decomposed in the atmosphere

by photons to release elemental bromine, which is highly destructive for the

stratospheric ozone layer (Gordon and Taylor, 1941). Therefore, MeBr was designated

as a class I ozone depleter and its use was phased out in United States by 2005 except

for the critical use exemption under The Clean Air Act of 1990. Since no other chemical

or cultural methods are available to control this disease as effectively as fumigation with

MeBr, the best possible option is inherited host resistance.

Isolates of S. rolfsii have shown significant variations in their pathological behavior

(Harlton et al., 1995; Sharma et al., 2002; Shukla and Pandey, 2007). In a study

involving two isolates of S. rolfsii in 1923, Edson found that both differed not only

morphologically but also with respect to their virulence towards potato. Flores-

Moctezume et al. (2006) reported four levels of virulence reactions in two of the isolates

they tested against different plant species like Ricinus communis, Sesamum indicum,

Tagetes erecta etc. Their results were supported by Shukla and Pandey (2008) who

tested 10 isolates and also observed four distinct pathogenicity reactions against

Parthenium hysterophorus. They noted that depending upon the isolate, the disease

incidence in a given individual plant ranged from 30 to 80 percent.









Along with differences in virulence among isolates of S. rolfsii, variation has been

observed with respect to plant resistance and the mode of inheritance in different

species. Mohr (1955) reported that the resistance in S. pimpinellifolium was controlled

by a single, dominant gene. Whereas, in Capsicum annuum L. resistance was inherited

as a single recessive gene (Fery and Dukes, 2005). In alfalfa, resistance against S.

rolfsii was quantitative (Inami and Suzuki, 1981; Inami et al., 1986; Pratt and Rowe,

2002).

The only documented sources of resistance to southern blight in tomato are

selections from wild Peruvian accessions PI 126932 and PI 126432 of S.

pimpinellifolium Mill and 6 breeding lines (5635M, 5707M, 5719M, 5737M, 5876M and

5913M) released from Texas A&M University, each containing S. pimpinellifolium in

their pedigree (Leeper et al., 1992). S. pimpinellifolium has proved to be a fertile source

of resistant germplasm and hybridizes readily to S. lycopersicum (Muller, 1940).

Introducing resistance to southern blight into cultivated tomato cultivars would provide a

cost-effective and an environmentally safe method for managing this disease.

The objectives of this study were to assess the level of resistance provided by two

genetic sources of resistance in tomato, and determine the inheritance of resistance.

Results will help identify the most effective sources of resistance to incorporate into a

breeding program and for genetic mapping, and will also establish disease assays for

subsequent breeding and genetic studies.

Materials and Methods

Plant Materials

Fla. 7776 (Solanum lycopersicum), a southern blight susceptible cultivar was

obtained from the University of Florida, Gulf Coast Research and Education Center

26









(GCREC), Balm, FL. While the resistant wild Peruvian accession of S. pimpinellifolium

PI 126932 was obtained from the USDA, ARS, National Genetic Resources Program

(Geneva, New York). An advanced breeding line, i.e., 5913M, was obtained from Texas

A&M University. Seedlings of these lines were raised in 128- well styrofoam Speedling

trays (3.8 cm3 cell size) in the greenhouse filled with sterilized peat-lite mix (Speedling

Inc., Sun City, FL) in Fall 2008. The plants were fertilized with compound fertilizer 20-

20-20 (N P205 K20) at an interval of 5 days. After 4 weeks, seedlings were

transplanted into four inch diameter pots and maintained in the greenhouse for the

duration of the experiment. Controlled pollination was carried out to hybridize Fla. 7776

(recipient parent) and PI 126932 in a greenhouse to generate F1 progeny. F2 seeds

were produced and mass harvested by self-pollination of F1 plants in the greenhouse. A

BC1 population was obtained by backcrossing F1 with the recurrent parent Fla. 7776 in

the greenhouse.

Fungal Materials and Inoculum Preparation

Three different isolates of Sclerotium rolfsii were used in this study. A strain of S.

rolfsii (GCT-1) was isolated from an infected tomato plant at GCREC, Balm. Strain WM

609 was isolated from peanut in Georgia (Dr. Tim Brenneman, University of Georgia),

and a strain recovered from sweet potato (DF/LA-SR1) was obtained from Louisiana

(Louisiana State University).

Sclerotia from each isolates were submerged into 0.5 % sodium hypochlorite

(NaOCI) solution for 5 min to sterilize the outer rind (Linderman and Gilbert, 1972). A

single, surface sterilized sclerotium was transferred to a petri-dish containing potato

dextrose agar (PDA), incubated at 25 OC, to initiate cultures.









For inoculum preparation, approximately 200 g of rye seeds were washed with

water in a 1 L Erlenmeyer flask and then immersed in 300 ml of water. The flask mouth

was covered with 4 layers of cheese cloth followed by a layer of aluminum foil and was

left overnight so that the seeds could absorb the water. The flasks containing rye seeds

were autoclaved at 121 OC for 15 min; this process was repeated for two consecutive

days to ensure complete sterilization (Phatak and Bell, 1983). Sterilized rye seeds were

then inoculated with approximately ten 9 mm PDA plugs containing both mycelium and

mature brown sclerotia. The Erlenmeyer flask cultures were incubated at 25 C under

12 hr light and dark period for 3-4 weeks. The flasks were shaken thoroughly for the first

seven days and then periodically as needed until the inoculum was used.

Screening Study

In order to find the inoculum load required for disease assays, five different

inoculum treatments were tested using S. rolfsii strain GCT-1 in spring 2009. Eight-

week- old plants of PI 126932 and Fla. 7776 in 4 inch wide pots were used in this study.

Treatments consisted of 1) 1 g of inoculated rye seeds, 2) 1 g of inoculated rye seeds

treated with 0.5% methanol spray, 3) 2 g of inoculated rye seeds, 4) 2 g of inoculated

rye seeds treated with methanol and 5) 2 g non-inoculated rye seeds with methanol

spray. Methanol was used to induce eruptive germination (Punja, 1985) in sclerotia in

order to reduce the infection time. Each treatment was replicated 4 times with 6 plants

in each replication and arranged in a randomized complete block design. For each of

the treatments, the rye seeds were placed in contact with the host stem, on the soil

surface and covered with 1cm of soil. The soil was kept constantly moist by frequent

irrigation and the temperature was kept around 30 C. Plants were rated as dead or

alive at the end of 4th week after inoculation.

28









Isolate Study

The trial was conducted using 44 plants each of PI 126932, Florida 7776 and

5913M which were sown in 128-well Styrofoam Speedling trays (3.8 cm3 cell size)

containing peat-lite mix (Speedling Inc., Sun City, FL). The seedlings were grown to an

age of 4 weeks, transplanted into 4 inch wide pots, and placed in the greenhouse. At 8

weeks after sowing, the plants were inoculated with isolate GCT-1, WM 609 and DF/LA-

SR1 by dispersing 2 g of colonized rye seeds on the soil surface close to the stem base.

The temperature in the greenhouse was maintained in the range of 27 to 32 OC and with

soil moisture close to 50-70%. The trial was repeated once.

Screening for Resistance with the GCT-1 Isolate

Plants of PI 126932, Florida 7776, F1, F2 and BC1 were evaluated for response to

S. rolfsii in a greenhouse study arranged in randomized complete block design. Fifty

seeds of each parent line, F1, and BC1 as well as 96 seeds of F2 were sown in the

speedling trays in fall 2009. Eight-week-old plants were grown and inoculated with S.

rolfsii isolate GCT-1 as described earlier. Trial was also conducted to screen 4 week old

seedlings, using 48 PI 126932 and Fla. 7776 seedlings inoculated in a growth room

maintained at 28 OC with 80% relative humidity.

Disease Assessment

Seedlings grown in the greenhouse were examined every 2 days after inoculation

for symptoms of wilting and for stem lesions. Disease severity was estimated by scoring

individual plant on a visual scale of 0-4 for wilting with increasing severity: 0 = no wilting

symptoms with initiation of stem lesion 0.5 = initiation of wilting, 1 = 12.5% of total leaf

area showing wilting symptoms, 1.5 = 12.5 25% wilted leaf area, 2 = 25% 37.5%

wilted leaf area, 2.5 = 37.5%- 50% wilted leaf area, 3 = 50%-75% wilting, 3.5 = >75%

29









wilting with lodged plant, 4 = Dead plant. Plants were rated 21 days after inoculation.

Plants rated with a score of 2.5 or below were considered resistant plants as these

plants were able to recover from the infection. While the plants with a score greater than

2.5 were considered to be susceptible since they were unable to recover and eventually

died. A plant was considered to be an escape if no lesion or evidence of infection was

noted on its stem. Plants rated as escapes were excluded from the study.

Statistical Analysis

For statistical analysis, data obtained from the isolate study were pooled across

both trials. Disease severity based on genotypes and isolates were analyzed using a

two-way analysis of variance of ranked data using the PROC Mixed procedure in SAS

(version 9.2; SAS Institute Inc., Cary, North Carolina) to generate relative marginal

effects (RME), and 95% confidence intervals as described by Brunner et al. (2002);

Shah and Madden (2004); Vallad et al. (2006). Interactions between tomato genotype,

S. rolfsii isolate and trials were also tested. A one-way analysis of variance was used to

test for tomato genotype effect on disease severity scores caused by the isolate GCT-1.

RME and 95% confidence intervals were generated as mentioned earlier for testing

significant difference between disease score in tomato genotypes for GCT-1 isolate.

Chi-square test was used to test for single gene model.

Results

Inoculation Procedure

Only wilting scores were used to identify resistant plants as stem lesions were

found on both Fla. 7776 and PI 126932. The most effective treatment found to

distinguish the resistance and susceptible plants was 2 g of inoculated rye seed per

plant (Fig 2-1), in which more than 90 percent of susceptible plants died, while all of the

30









resistant plants were able to survive (Table 2-1). Inoculation of 4 week old PI 126932

and Fla. 7776 resulted in the death of all plants.

Genotype Effects

Although PI 126932 exhibited severe stem lesions after inoculation with S. rolfsii

isolate GCT-1, only mild to moderate wilting symptoms developed under the conditions

of this study. Twenty days after inoculation, the susceptible inbred Fla.7776 developed

severe stem lesion and wilting that led to plant collapse and death (Fig 2-1). No

significant difference was obtained between the two trials (P value = 0.39). Also no

interaction was found between tomato genotype x trial (P value = 0.74), isolate x trial (P

value = 0.81), isolate x genotype x trial (P value = 0.82). Significant difference was

obtained between all the three genotype tested (Table 2-2 and 2-3). PI 126932 and

Fla.7776 differed significantly in their mean disease severity score (Table 2-4 and 2-5)

following inoculation with S. rolfsii isolate GCT-1. However, the difference in mean

disease severity between 5913M and Fla.7776 against GCT-1 isolate was not

significant (Table 2-5). A statistical difference in disease severity between the two

resistance sources was also observed (Table 2-5).

Isolate Effects

Disease severity scores were found to be affected by the isolate used for the

inoculation. For the breeding line 5913M, a significant difference in the mean disease

severity ranking was observed between peanut isolate (WM 609) and the tomato isolate

(GCT-1) (Table 2-3). 5913M plants were killed by GCT-1, while they were able to

survive against WM 609. For PI 126932, a significant difference was also observed in

disease severity among various isolates (Table 2-3). For Fla. 7776, no significant isolate

effect was observed. Such a variable response for 5913M and PI 126932 indicates that

31









the isolates differ in aggressiveness against specific tomato line. Significant interaction

between tomato genotypes and isolates was also found (Table 2.3).

Inheritance Patterns of Southern Blight Resistance

Screening of the different generations of PI 126932 and Fla. 7776 with the GCT-1

isolate was carried out to understand the inheritance pattern (Fig 2-2). Out of the

inoculated 50 plants of parent lines seven of the PI 126932 plants died, and about six of

the Fla.7776 plants were able to survive although they showed severe stem lesions.

The F2 progeny segregated in an approximate ratio of 1:3 [resistant (R):

susceptible (S)] (Table 2-6, Fig 2-2). The segregation ratio in the F2 population failed to

fit the distribution expected for a single gene with dominant effect (X2 = 64) based on

Chi-square analysis; even when the expected segregation ratio was adjusted for the

level of penetrance observed in both parents and heterozygous F1 hybrids. Ratio also

failed to fit the distribution expected for single recessive gene (X2 = 8.7) when expected

ratio was adjusted for penetrance level. Few of the surviving F2 plants had a disease

rating below 1 which was lower than mean disease score for the resistant parent PI

126932.

Discussion

Using resistant varieties is an ideal approach for plant disease management.

Resistant sources against southern blight have been identified in many hosts in a

number of countries (Mohr, 1955; Sugha et al., 1991; Besler et al., 1997), but no stable

resistance has been achieved due to the occurrence of aggressive isolates of S. rolfsii

(Sharma and Jodha, 1984). We found that all three non-segregating populations i.e., the

resistant parent PI 126932, the susceptible parent Fla. 7776 and the F1 displayed a









range of susceptibility to S. rolfsii across individuals. This result was not unexpected

based on earlier works. Aycock (1966) suggested that it is a characteristic that all plants

even in a uniformly infested area do not become infected. Numerous published

references to the irregular distribution of southern blight in the field were cited by

Aycock (1966). Similar observations of irregularly distributed disease were also made

by Fery and Dukes (2005) in pepper. They noted such variable reaction in most of the

pepper cultigens evaluated in field trials which they conducted over multiple years. In

their opinion such variable reactions to S. rolfsii observed in their parental and F1

populations were not due to genetically heterogeneous plant material, but due to a

complex environmental interaction. In this study complex environment interaction may

have played an important role; however the possibility that the resistant plant

introduction line was not completely fixed for resistance cannot be completely ruled out,

and would require additional testing to verify.

5913M was found to be susceptible against GCT-1 but not against remaining

isolates which suggests that 5913M is not a reliable resistance source for multiple

isolates. Prior studies found that isolates from the same geographical location could be

host specific or exhibit a narrower host range (Cilliers et al., 2000). Punja and Sun

(1997) compared 128 isolates of S. rolfsii from 36 host species and 23 geographic

regions by means of random amplified polymorphic DNA (RAPD) polymerase chain

reaction and found that many isolates from the same host belonged to the same

mycelial compatibility group (MCG). The isolates used in the current study were found

to fall into three different MCG groups (Xie Chenzhao and Gary Vallad, personal

communication) and each was collected from different host species and different









geographical location (peanut-Georgia, tomato-Florida and sweet potato-Louisiana).

Different MCG groups suggest that there is genetic variation among the isolates (Cilliers

et al., 2000) and could probably explain the variation in the disease severity score

obtained in this study. S. rolfsii isolates from groundnut (peanut) fields in Texas were

studied by Nalim, et a/.,(1995) and based on DNA amplification pattern they found that

the isolates which belonged to the same MCG were clonal, which was supported by the

similarities in morphology and host specificity of the isolates they studied. This study

included only three MCGs with one isolate in each group. To get a better understanding

of difference in virulence among isolates, a thorough study needs to be carried out

involving multiple MCGs with multiple isolates in each MCG, testing for pathogenicity on

specific host plants.

Based upon the variability in response of 5913M to different isolates of S. rolfsii, it

is possible that the resistance conferred by this advanced breeding line isolate-specific.

Such a differential response to S. rolfsii isolates suggests that resistance breeding

needs to be based on the isolates present in the targeted geographical location. On the

contrary, P1126932 was found to be resistant against all three isolates tested. It is likely

that the level of resistance found in PI 126932 is enough to overcome the attack of

different isolates and this line could potentially be used as a source of resistance to

southern blight in different geographical locations with diverse isolates of S. rolfsii.

However, trials including more variable isolates are warranted to confirm this

assumption.

Another possibility is that the resistance to southern blight could be controlled by

multiple loci, with resistance to various isolates governed by different genes. This could









explain why 5913M was found to be resistance to only two isolates while PI 126932 was

resistant to all three isolates.

Out of all the F1 plants tested, 75% were able to survive indicating that the

resistance could be dominant however looking at the frequency distribution it seems

that some of the F1 plants were more resistant than PI 126932 while some of them were

behaving more like PI 126932. Such two peaks in frequency distribution could not be

completely explained by a single gene model. Also, frequency distribution of F2 was

found to be skewed towards left indicating that resistance is recessive, which is

opposite of that seen in F1 population. This variation suggests that the disease is not

conditioned by a single recessive or dominant gene and could in fact be governed by

more complex genetics which could not be fully explained by this study, since only a few

F3 families were tested and a backcross of the F1 to a donor parent was not tested in

this study. Other possibilities also exist that could be responsible for such results, for

example, compromised resistance in F1 plants due to excess inoculum load (appendix

D), less accurate disease rating scale, or unfit plants. In the F1 plants, more individuals

had a lower disease score as compared to the resistant parent PI 126932, which could

potentially be a heterotic effect of the interspecific cross.

However, variation in the aggressiveness of S. rolfsii isolates along with variation

in the inheritance pattern in crosses involving different resistant and susceptible sources

could explain the deviation of the current results from the monofactorial model proposed

by Mohr (1955). Earlier research showed that along with the variation in the

pathogenicity among the isolates, variation also existed with respect to the mode of

inheritance in different species. In Capsicum annuum L. the mode of resistance was









found to be inherited as a single recessive gene (Fery and Dukes, 2005). While it was

found to be quantitative in alfalfa (Inami and Suzuki, 1981; Inami et al., 1986; Pratt and

Rowe, 2002). Such kind of variable mode of inheritance has also been reported for

resistance to early blight of tomato caused by the fungus Alternaria solani Sorauer. The

inheritance of resistance to early bright was reported to be quantitative and recessive in

some lines (Barksdale and Stoner, 1977), but partially dominant, with epistasis in others

(Nash and Gardner, 1988a). Such variation in the parental lines and fungal isolates

could give rise to dissimilarity in the observed inheritance pattern.

The appearance of susceptible plants in PI 126932 and the F1 could be due to

incomplete penetrance. Incomplete penetrance can also perhaps explain the variation

observed in the F3 generation by Mohr (1955) and also in the inheritance study of

resistance to southern blight in pepper conducted by Fery and Dukes, 2005. The

incomplete penetrance effect in the resistance against tomato yellow leaf curl virus

derived from S. pimpinellifolium was reported by other authors in various studies

involving different accessions belonging to this species (Hassan, 1984; Perez de

Castro, 2007) indicating that the incomplete penetrance effect showed by the genes

derived from accession of S. pimpinellifolium is not rather surprising. Also complexity in

the genetics has also been reported for the resistances which have been derived from

different lines of S. pimpinellifolium species (Kasrawi and Mansour, 1994; Hassan, and

Abdel-Ati, 1999; Perez de Castro, 2007). Incomplete penetrance has also been reported

for Fusarium oxysporum f.sp. lycopersici in tomato (Retig et al., 1967; Alon et al., 1974)

and for tomato spotted wilt virus in tomato (Salvador Rosell6, 1998). It is quite possible

that the resistant plants in Fla. 7776 could be just escapes rather than due to









incomplete penetrance effect of the genes involved. Also, susceptible plants in PI

126932 and the F1 could be from excess inoculum load, due to variation in the

colonization of the rye seeds by the fungus. Based on this study it would be hard to

clearly justify whether such results are due to incomplete penetrance or merely due to

escapes. However, incomplete penetrance could be confirmed by conducting a progeny

test in F3 families and also by inoculating near isogenic lines carrying genes conferring

resistance.

An attempt to screen younger (4 week old) seedlings of both PI 126932 and Fla.

7776 resulted in death of all the plants, confirming the results of Mohr and Watkins

(1959) that resistance in PI 126932 is not effective until plants are six weeks or older.

This showed that resistance in PI 126932 is associated with physiological maturity of

the plants. It was also found that the resistance was affected by environmental

conditions (appendix D). Moreover, from this study it seems that the resistance could be

controlled by more than one gene indicating that the resistance could have multifactorial

inheritance. Such confounding factors together with the complex genetic nature of the

resistance could be a reason to the limited success achieved in breeding for southern

blight resistance using traditional breeding approaches. Thus, new strategies are

needed for the identification and effective transfer of genes for southern blight in tomato.

The use of molecular markers to assist with plant selection is an alternative

approach that could be adopted instead of conventional breeding while dealing with

complex traits such as southern blight. The chromosomal position of gene(s) or

quantitative trait loci controlling such complex traits can be determined by using

molecular markers. The use of molecular markers can also facilitate an understanding









of the interaction between genes controlling the same trait. Once molecular markers

linked to the gene(s) of interest are identified, they can be used to transfer the desired

gene(s) into commercial varieties in less time as compared to conventional breeding

(Sleper and Poehlman, 2006). The efficiency of developing superior tomato varieties

with resistance to southern blight could be increased through marker assisted breeding.









Table 2-1. Determining inoculum load for differentiating southern blight resistant (PI
126932) and susceptible (Fla. 7776) tomato line. Plants were inoculated at
an age of 8 weeks after sowing. Rye seeds colonized with GCT-1 isolate of
S. rolfsii were used to inoculate the plants.
Treatment PI 126932 Fla. 7776
Alive Dead Alive Dead
Control 24 0 24 0
1gY 23 1 8 16
1gY + metz 24 0 8 16
2gy 24 0 2 22
2gy+ met 18 6 0 24
x Control treatment included 2 g non-inoculated rye seeds + 0.5% methanol spray.
Y S. rolfsii (GCT-1) inoculated rye seeds.
z 0.5% Methanol spray.

Table 2-2. Two-way analysis of variance based on the ranked data of southern blight
disease severity on tomato line PI 126932, Fla. 7776 and 5913M caused by
GCT-1, WM609 and DF/LA-SR1 isolates. Data combined across two
independent experiments.
Effect dfx dfy F-value P- value
Tomato 1.95 171 53.26 < 0.001
Isolate 1.96 171 17.19 < 0.001
Tomato x Isolate 3.81 0o 5.68 < 0.001
x Numerator degrees of freedom.
Y Denominator degrees of freedom.

Table 2-3. Relative marginal effects with 95% confidence interval estimated based on
ranked data by two-way ANOVA type statistics for the severity of southern
blight on three different tomato line caused by three different S. rolfsii
isolates.
Tomato linex Isolate Medianz Mean Ranking RMEy
Fla. 7776 GCT-1 4.0 150 0.75 0.072
WM609 4.0 138 0.69 0.083
DF/LA-SR1 4.0 140 0.70 0.094

5913M GCT-1 3.5 127 0.64 0.090
WM609 1.0 39 0.19 0.086
DF/LA-SR1 2.0 84 0.41 0.095

PI 126932 GCT-1 2.0 80 0.40 0.060
WM609 1.5 53 0.26 0.062
DF/LA-SR1 2.0 84 0.42 0.084
x Data pooled for two independent experiments.
Y Relative Marginal Effect with 95% confidence interval.
z Score higher than 2.5 indicates susceptibility to specific S. rolfsii isolate.









Table 2-4. Statistical analysis of variance based on disease severity scores in PI
126932, Fla. 7776 and 5913M caused by GCT-1 isolate. Data combined
across two experiments.
Effect df F-Value P- Value
Tomato lines 2 20.19 < 0.01
Error 63

Table 2-5. Relative marginal effects with 95% confidence interval estimated based on
ranked data by ANOVA type statistics for the severity of southern blight on
three different tomato line caused by GCT-1 isolate of S. rolfsii.
Tomato line Isolate Medianz Mean Ranking RMEy
Fla. 7776 GCT-1 4.0 46 0.68 0.072
5913M 3.5 37 0.55 0.083
PI 126932 2.0 18 0.26 0.060
x Data pooled for two independent experiments.
Y Relative Marginal Effect with 95% confidence interval.
z Score higher than 2.5 indicates susceptibility to specific S. rolfsii isolate.

Table 2-6. Segregation for resistance to southern blight in parental, F1 and F2
populations.
Observed Expected Expected
Population RV S" R S ratio X2 P-value
P1126932 46 4 50 0
Fla. 7776 6 44 0 50
F1 38 12 50 0
F2 22 74 24 72 1:3x 0.22 0.63
60 36 1.6:1y 64 <0.01
36 60 1:1.6z 8.7 <0.01
v Number of resistant plant (wilting index < 2.5).
w Number of susceptible plant (wilting index > 2.5).
x Ratio for single recessive gene.
Y Single dominant gene ratio adjusted for incomplete penetrance.
z Single recessive gene ratio adjusted for incomplete penetrance.


























A B










C D
Figure 2-1. Southern blight symptoms on plants of parental lines. A) wilting symptoms
on susceptible parent Fla. 7776, B) wilting symptoms on resistant parent
P1126932, C) stem lesion on Fla. 7776, D) stem lesion on PI 126932.










PI 126932


CO

L-Z
5


00.5 1 1.5 22.5 33.54
Disease severity


15


aI10









60
zZ 5
u. -







50

j 40
60



C
50

So
U.-..20
10
0


00.5 1 1.5 22.5 3 3.5 4
Disease severity


I-.


0 0.5 1 1.5 2 2.5 3 3.5 4
Disease Severity

F2




I-


0 0.5 1 1.5 2 2.5 3 3.5 4
Disease Severity

Figure 2-2. Frequency distribution of southern blight disease severity for plants of
tomato line P1126392, Fla.7776, and F1. 0 = no wilting symptoms with
initiation of stem lesion, 0.5 = initiation of wilting, 1 = 12.5% of total leaf area
showing wilting symptoms, 1.5= 12.5 25% wilting, 2= 25% 37.5% wilting,
2.5 = 37.5%- 50% wilting, 3 = 50%-75% wilting, 3.5 = >75% wilting with
lodged plant, 4 = Dead plant. Rating >2.5 suggest susceptible plants.


,C,
h-z


FL. 7776









CHAPTER 3
IDENTIFICATION OF MOLECULAR MARKERS LINKED TO SOUTHERN BLIGHT
RESISTANCE IN TOMATO

Introduction

Southern blight of tomato (Solanum lycopersicum) is caused by Sclerotium rolfsii

Sacc. (Sherf and MacNab, 1986). Economic losses caused by this disease to the

tomato industry in Florida could increase in the near future due to the loss of Methyl

Bromide as a soil fumigant and a lack of satisfactory alternative control methods. Host

resistance is an economical, environmentally safe, and efficient means to control

disease. Mohr (1955) searched for southern blight resistance in a screen of several

varieties of Solanum lycopersicum as well as a number of lines from the wild relative

Solanum pimpinellifolium and Solanum peruvianum. Out of the 30 lines tested, Mohr

categorized a single line from Solanum pimpinellifolium accession as resistant against

southern blight. The line came from Pampa de Matacabilles, Peru, and was introduced

by the Plant Introduction Service of the U.S. Department of Agriculture as PI 126932.

In order to verify that PI 126932 is in fact a suitable genetic source for resistance

against southern blight in tomato, studies were carried out at the University of Florida,

IFAS, Gulf Coast Research and Education Center, Wimauma, FL. In this study the PI

126932 was inoculated with three different strains of S. rolfsii and results were

compared with a susceptible inbred line Fla. 7776. It was found that PI 126932 was

resistant against all three S. rolfsii strains tested. Based on the results it was confirmed

that PI 126932 was a good source for deriving genetic resistance against southern

blight in tomato, similar to previous studies (Mohr, 1955).

Along with PI 126932, other reported sources for southern blight resistance were

six breeding lines (5635M, 5707M, 5719M, 5737M, 5876M and 5913M) released from

43









Texas A&M University, containing S. pimpinellifolium in their pedigree (Leeper et al.,

1992). Breeding line 5913M was tested along with PI 126932 and Fla. 7776 against the

three isolates. 5913M was found to be susceptible to a field isolate obtained from

Florida (GCREC), but resistant against two isolates obtained from Georgia and

Louisiana. This suggested that the resistant breeding lines from Texas A&M may not be

a reliable source of resistance to S. rolfsii isolates from Florida.

Because the resistance source, PI 126932 is a wild species, the most effective

way of transferring resistance to cultivated tomato lines is through backcrossing. One

advantage of S. pimpinellifolium being the source is that the transfer of resistance from

S. pimpinellifolium to S. lycopersicum is rather straightforward through conventional

breeding since both species are closely related and hybridize easily (Rick, 1958).

Backcrossing has long been a valuable strategy in plant breeding for a number of crops.

Backcrossing is a type of recurrent hybridization in which the main aim is to substitute a

desirable allele(s) for the trait of interest in a desirable cultivar without losing or

changing the existing genetic background of the that cultivar except for the substitution

of desired allele(s).

Semagn et a/.(2004) pointed out that normally during backcross breeding it is

expected that the genome of recurrent parent will be recovered at a rate of 1-(1/2)t+, for

"t" generations of backcrossing. Thus with the completion of the fourth backcrossed

generation we expect to have recovered 96.87% of the recurrent parent's genome.

However, in actual practice, this theoretical percentage value is hardly achieved

especially when dealing with polygenic trait. One reason for recovering less than the

theoretical percentage is linkage drag, which refers to the reduction of fitness in a









recurrent parent due to introduction of deleterious genes along with the beneficial gene

during backcrossing (Semagn et al., 2006). Young et al. (1988) suggested that based

on linkage distance the unwanted DNA segment can be removed through additional

backcrossing, but to achieve significant progress, many generations are required.

Molecular markers offer a tool by which the amount of donor genome transferred

can be controlled during each backcross generation. Use of marker assisted breeding

techniques can speed up recovery of the recurrent parent's genome and thereby

improve efficiency of transferring gene(s) from the donor parent. Markers can aid in

minimizing the linkage drag associated with the target gene, and reduce the number of

generations required to recover a high percentage of the recurrent parent genotype.

Chahal and Gosal (2002) suggested that applying a molecular marker assisted

techniques to a backcross breeding program could reduce linkage drag by at least

tenfold in a fraction of the time required in traditional backcross breeding. This

technology can also help to gain better knowledge about the genetics of southern blight

resistance in tomato, which will help in transferring resistance into desired line.

Earlier study showed that the plants were not fully resistant till the age of six to

eight weeks and was greatly influenced by environmental conditions (Mohr, 1955).

Along with this, our study regarding the inheritance of southern blight resistance in

tomato showed that resistance was probably conferred by more than one gene

indicating multifactorial inheritance. Such influencing factors together with the complex

genetic of the resistance could greatly affect the selection in a traditional breeding

approach. Molecular markers and marker assisted selection technology is an alternative









system which could help to validate and effectively transfer genes conferring southern

blight resistance to tomato.

However in order to utilize the benefit obtained from marker assisted selection one

requires quality markers that are closely linked to the trait of interest. PI 126932 is a

convenient resistant source for identifying associated markers since many polymorphic

markers have already been reported by Hutton (2008) between PI 126932 and Fla.

7776.

The primary objective of this study was to identify PCR-based molecular markers

linked to loci conferring resistance to southern blight.

Materials and Methods

Plant Materials

Seeds for the resistant accession PI 126932 and a susceptible inbred line Fla.

7776 were grown and crosses were made between them in fall 2008 under greenhouse

conditions with Fla. 7776 serving as a recipient parent. Subsequently an F2 population

was generated by self pollination of F1 generation in spring 2009. In the spring of 2009

backcrossing was carried out to obtain the BC1 generation.

In order to study the response of PI 126932, Florida 7776, F1, F2 and BC1 to

southern blight, 50 seeds of PI 126932, Florida 7776, F1, and BC1 as well as 96 seeds

of F2 were sown in 128-wells styrofoam Speedling trays (3.8 cm3 cell size) containing

peat-lite mix (Speedling Inc., Sun City, FL) in fall 2009. The plants were fertilized with

compound fertilizer 20-20-20 (N-P205-K20) at an interval of 5 days. After four weeks,

seedlings were transplanted into four inch diameter pots and maintained in the

greenhouse for the duration of the experiment. A complete randomized block design

was selected for this study.









For the marker study in the F2 population, three groups containing two batches of

96 F2 seeds and 12 seeds of both the parents were sown in the speedling trays with an

interval of three weeks in June 2009. All three groups were transplanted and grown as

mentioned earlier. All the groups were inoculated at an age of 8 weeks. Progeny of F2

selections were evaluated in subsequent experiments.

Genomic DNA Extraction from Leaves

Genomic DNA was extracted buy using a protocol described by Fulton (1995) with

following modifications. About 3-4 new leaflets of about 1.5 cm size were collected in

1.2 mL library tubes (VWR, West Chester, Pennsylvania) and frozen at -80 C. The

frozen leaflets were homogenized using a Talboys high throughput homogenizer (Henry

Troemner LLC, Thorofare, New Jersey). DNA was extracted from the frozen leaf tissue

by incubating each sample with 166 pL of DNA extraction buffer (0.35 M sorbitol, 0.1 M

tris-base, 5 mM EDTA, pH 7.5,1.3mg sodium bisulfate ), 166 pL of nuclei lysis buffer

(0.2 M tris, 0.05 M EDTA, 2 M NaCI, 2% CTAB), and 66 pL of sarkosyl (5%w/v) at 65 C

followed by a chloroform : isoamyl alcohol (24:1,v:v) extraction and a final nucleic acid

precipitation with ice cold isopropanol. DNA was pelleted by centrifugation at 4000 rpm

for 15 min and rinsed with 70% ethanol. After air drying samples overnight, the DNA

was re-suspended in 100 pL nuclease free water and stored at -20 C. Each sample

yielded 300-600 ng/pL of DNA. The DNA was diluted down to 20 ng/pL for molecular

marker study.

Inoculation and Disease Evaluation

The Sclerotium rolfsii isolate GCT-1 used in this study was obtained from naturally

infected tomato fields at GCREC, Balm. The fungus was maintained on PDA plate at 25

C. For inoculum preparation 200 g of rye seeds were sterilized in 1000 ml Erlenmeyer

47









flask with 300 ml water and inoculated with approximately ten 9 mm PDA plugs

containing both mycelium and mature brown sclerotia. The rye seed cultures were

incubated at room temperature (25-30 C) for a period of 3-4 weeks.

The 8 weeks old plants were inoculated by spreading 2 g of colonized rye seeds

on the soil surface close to the base of the tomato plant. After 48 hr the inoculated pots

were examined to visually confirm the emergence of mycelial growth from the colonized

rye seeds. The pots not showing any sign of mycelial growth were re-inoculated.

Disease progress was recorded for individual plants every alternate day after

inoculation, using a visual scale of 0-4 with increasing severity: 0 = no wilting symptoms

with initiation of stem lesion 0.5 = initiation of wilting, 1 = 12.5% wilting of total leaf

area, 1.5 = 12.5 25% wilted leaf area, 2 = 25% 37.5% wilting, 2.5 = 37.5%- 50%

wilting, 3 = 50%-75% wilting, 3.5 = >75% wilting and stem collapse, 4 = Dead plant.

Plant with no clear sign of stem lesions was considered as an escape and was excluded

from the study.

Molecular Markers and F2 Genotyping

To detect polymorphisms between PI 126932 and FL. 7776 about 252 PCR based

DNA markers spanning the tomato genome were screened. Out of this, 115 markers

had been earlier reported to be polymorphic among PI 126932 and FL.7776 (Hutton,

2009). Markers were selected such that any two adjacent markers on a given

chromosome were not more than 20 cM apart. Most of the markers were obtained from

the Solanaceae Genomics Network (SGN) (http://www.sgn.cornell.edu) which included

CAPS, SCAR and SSR markers, or were obtained from various published sources

(Suliman, 2002; Yang, 2004; Dynze, 2007; Ji et al., 2007; Hutton, 2008).









Genomic DNA from parents, F1, F2, BC1 and F3 population were extracted prior to

inoculation. Plants were rated on 21st day after inoculation. Plants rated with a score of

2.5 or below where considered resistant plants as these plants were able to recover

from the infection. While the plants with score greater than 2.5 were considered to be

susceptible plants since they were never able to recover and eventually died. Selective

genotyping system was used to genotype F2 individuals found on the extreme ends of a

frequency distribution based on disease severity. About 23 extreme resistant and 22

susceptible F2 individuals were selected for selective genotyping. As a control, an

individual DNA sample from both the parents and the F1 were also included in the

screening study.

Amplification of CAPS and SCAR markers was performed in 10 pL reactions

containing 50-60 ng of DNA, 2 pL of 20% Dimethyl sulfoxide (DMSO), 1 pL of 25 mM of

dNTPs, 0.8 pL of 25 mM MgCI2, 1 pL of 10x PCR buffer, 0.8 pL of forward and reverse

primer (5 pM) and 0.08 pL of Taq polymerase (5 u/pL) (New England Biolab, Ipswich,

Massachusetts). Annealing temperatures for each marker was optimized using a

Mastercycler ep gradient (Eppendorf AG, Hamburg, Germany). The annealing

temperature was selected to yield a sufficient amount of PCR product at the desired

range. Separation of bands was either done on an agarose gel (2%, 3% or 4%) or on

4% MetaPhor agarose (Lonza Rockland, Inc., Rockland, Maine) depending upon band

size and percentage by which the DNA fragments differed. PCR products were run on

agarose or metaphor agarose gels in 1x TBE at 120 V for 90 min for visualization. Most

of the SSR and InDel markers were scored on denaturing polyacrylamide gel using LI-

COR 4300 DNA Analyzer system (LI-COR Biosciences, Lincoln, Nebraska).









Amplification of SSR and InDel markers was performed in 10 pL reactions containing 20

ng of DNA, 0.8 pL of 2.5 mM of dNTPs, 0.6 pL of 25 mM MgCI2, 0.04 pL of forward

primer (5 pM) with 5' M-13 tail, 0.4 pL reverse primer (5 pM), 0.18 pL fluorescent M-13

tail (10pM), 1 pL of 10x PCR buffer and 0.05 pL of Taq polymerase (5u/pL). For

detection on polyacrylamide gel, PCR was carried out in Mastercycler ep gradient with

the following program: Step 1) 2 min 95 OC, Step 2) 7 cycle of 45 sec 95 C to 68 OC

(with 2 OC drop per cycle), and 1 min 72 OC, Step 3) 28 cycle of 1 min 72 OC, 45 sec 95

C, 45 sec 50 C and 1 min at 72 OC, and Step 4) final extension of 5 min at 72 OC.

Amplified products were run on 6.5% polyacrylamide gel in 1x TBE buffer at 1400v for

120 min for visualization.

Marker Analysis

The chi-square (x2) method was used to test the goodness of fit for observed ratios

to theoretically expected ratios of marker scores in all populations. For the marker

analysis approach, selections were grouped as resistant or susceptible, and marker

data were scored on the basis of the probability of a resistant allele (2, 1, and 0) for co-

dominant markers. Detection of linked markers was carried out by using WinQTLCart

(Wang et al., 2010) through t-tests based on single marker analysis (Soller et al., 1976).

QTL analysis was performed with single marker analysis rather than using interval

mapping since the number of available markers was limited and large distances

between some markers did not allow for a reliable placement of potential QTLs. Markers

showing significant linkage were confirmed by genotyping additional F2 individuals.

Selected F2 progenies were also genotyped with significantly linked markers.









Results

A screen of 252 PCR based DNA markers including 115 markers that were

previously reported to be polymorphic between PI 126932 and Fla. 7776 (Hutton, 2009

were tested for polymorphism between two parents, including an F1 to test for co-

dominance (Table C-1). Out of the 252 markers 152 were polymorphic and 127 were

co-dominant. Tightly clustered markers were eliminated leaving 102 markers that were

used to genotype the F2 population (Table 3-1). The 102 markers spanned the tomato

genome with a maximum distance between markers of 30 cM, a mean distance of 12

cM, and a median distance of 10 cM.

From the extremes of the phenotype distribution, 23 resistant F2 individuals and

22 susceptible individuals were selected for genotyping. Based on single marker

regression analysis three loci were detected, one on chromosome 4, one on

chromosome 10, and another on chromosome 11 (Table 3-1). Markers at the three

detected loci were tested on an additional 45 resistant and 45 susceptible individuals

and the significant association was maintained for the markers at loci on chromosomes

10 and 11, but marker at the chromosome 4 loci was not significantly associated with

resistance (Table 3-2).

The significance of the association at the two remaining significant loci was

confirmed by genotyping and phenotyping of an additional 354 F2 plants (Table 3-2).

The markers SL10105i on chromosome 10 and T0408-1, 2 on chromosome 11

segregated as per the expected 1:2:1 ratio indicating no segregation distortion (Table C-

2). While the PI 126932 allele at the chromosome 10 locus (L1) was associated with

increased resistance, the PI 126932 allele at the locus on chromosome 11 (L2) was

associated with increased susceptibility to S. rolfsii (Table 3-3).

51









Evidence of both overdominant and epistatic effects at both loci was observed

among F2 segregants (Table 3-3). The apparent gene action at each locus was

dependent on the allele state at the other locus. When L1 was homozygous for the PI

126932 allele, the Fla. 7776 allele at L2 appears to be dominant for resistance, however

when L1 was heterozygous, a high level of resistance is only observed when L2 was

heterozygous (behaving overdominant). When L1 was homozygous for the Fla. 7776

allele, no allele state at L2 provides a high level of resistance. When the L2 allele was

homozygous for PI 126932 then all allele states at L1 were susceptible. When L2 was

heterozygous for the PI 126932 allele at L1 appears to have a dominant or slightly

overdominant resistance effect. Finally, when L2 was homozygous for the Fla. 7776

allele, the Fla. 7776 allele at L1 appeared to have a recessive resistance effect.

This unusual pattern of overdominant and epistatic effects was also observed in a

separate experiment using F3 family individuals (Table 3-4). When L1 was homozygous

for PI 126932 allele the highest number of resistant plants were observed when L2 was

homozygous for Fla. 7776 allele. As seen in F2, high level of resistance was observed in

F3 plants when both L1 and L2 were heterozygous (overdominant effect). When L1 was

homozygous for Fla. 7776 allele, no allelic combination on L2 showed good resistance

level. The overdominant and epistatic effects in the BC1 population were consistent with

those seen in the F2 and F3 populations (Table 3-5). High level of resistance was

observed in BC1 when both loci were heterozygous. The marker-trait associations were

confirmed in a BC1 population using single marker analysis (Table 3-6).

Discussion

This study identified molecular markers linked to two loci one chromosome 10 and

another on chromosome 11 controlling resistance to southern blight in tomato. The

52









pattern of phenotypic data observed in the F2 generation exhibited a non-continuous

distribution, indicating that resistance was inherited as a qualitative trait controlled by 1

to 2 genes rather than a quantitative trait controlled by multiple genes. It is possible that

there are additional genes influencing resistance, but were not detected in this study

because of gaps in genomic coverage of molecular markers or due to the lack of

statistical power to detect loci with weaker effects.

Based on the results of marker analysis for F2 and F3 plants, many of the resistant

plants were heterozygous at both the loci. Heterosis due to true- or pseudo-

overdominance could possibly explain why some of the F1 and F2 plants exhibited

greater resistance than the resistant parent itself. The over-dominance hypothesis

postulates the existence of loci at which the heterozygous state is superior to either

homozygote. Pseudo-overdominance, in contrast, refers to the situation of linked genes

with favorable dominant alleles linked in repulsion. However, clear differentiation could

not be made between true- or pseudo overdominance from the F2 and F3 generation.

Parvez (2006) pointed out that linkage was a major factor in preventing one from

differentiating overdominance from pseudo-overdominance. Budak et al. (2002) referred

that pseudo-overdominance is a condition that gives the false presumption of

overdominance, in which a pair of linked loci would behave as a single locus showing

overdominance effect eventually skewing the measure of true overdominance.

Regardless of the mechanisms involved, the genes at loci L1 and L2 identified in

this study provide a good source of resistance that could be introgressed into

commercial cultivars. Even though these loci do not confer complete resistance, it

should be considered that the disease pressure in the field is generally less than the









conditions in our disease assay. Thus the partial resistance conferred by the identified

genes may in practice be sufficient to efficiently protect tomato against S. rolfsii.

Although the locus L1 found on chromosome 10 did not confer complete resistance, its

dominant effect, as observed in the F2 dataset, makes it an interesting candidate for

breeding resistance into F1 hybrids, since introgression in only one parent is necessary.

Our study showed that southern blight resistance in tomato as conferred by genes

L1 and L2 is influenced by the overdominance effect and epistasis between the

detected loci. Both of these phenomena affect the development of resistant cultivars

through conventional breeding. Sofi et al. (2007) indicated that epistasis affects the

estimates of expected gain under selection during conventional breeding and also

reduces the efficiency in estimating additive and dominance component of genetic

variance. Recent improvement in methods for QTL-mapping with use of molecular

markers has provided an opportunity to detect and understand the effect of epistasis

between QTLs controlling complex trait (Carlborg and Haley, 2004). Such

methodologies can be used in better understanding the genetics of southern blight in

tomato which will eventually be helpful in generating resistant cultivars. Also, selection

of heterozygous plants to take advantage of the overdominance effect would be

possible using linked markers. However if the heterotic effect is due to pseudo

overdominance then the heterozygous effect is fixable and superior inbred to hybrid can

be obtained. This could also be facilitated by tightly linked markers which would enable

the detection of a recombination event converting repulsion into coupling phase linkage

that upon selfing could yield a fixable heterotic effect.









The conventional approach for breeding southern blight resistance in tomato by

phenotypic selection could be negatively affected by the complexity of this trait. Since

some of the resistant plants were found to be heterozygous at both the loci, selection

under conventional breeding could result into plants segregating for southern blight

resistance. However, some of these issues can be resolved by utilizing alternative

approach i.e. molecular breeding. Associated molecular markers can not only help in

the selection process but also facilitate a better genetic understanding of this disease in

tomato which would help in developing southern blight resistant tomato lines and could

improve the resistance level in other host species.





Table 3-1. Polymorphic markers for Fla.
Marker Approx. Position x
CosOH47 1.010
LEOH36 1.017
C2_At5gl8580 1.035
SSR95 1.043
SSR 316 1.053
SL20268i 1.061
SL10975i 1.070
LEVCOH11 1.085
C2_At3g04710 1.095
SSR42 1.107
SL10126i 1.137
TOM11 2.013
SL10682i 2.034
SSR96 2.043
SSR5 2.050
LEOH348 2.064
LEOH113 2.075
C2_At5g66090 2.083
LEOH174 2.096
TG525 3.014
LEOH124i 3.021
SL10480i 3.038
LEOH223 3.040
C2_At1g02140 3.054
FEY 3.064
Approximate position obtained from Dynze,


VV V


7776 and PI 126932. Significant P- value indicates association with QTL.
Forward primer Reverse primer P- valuey
ttgctgattttcttcccatttt gcagctggagtgagaggaac 0.164
tcacaaaaatggcgatgaga ccacctgtggatccttgact 0.278
tgccacattgcctctgtatgtacagaac atgtcaattcgggcttgagtaagtg 0.880
caatccaacaagcaatccct ccacataactaagcccacaactt 0.306
ccaccgcaacaaaccttatt gggtggtgagaaggatctga 0.628
cactccgttccttggcatac cccttccgttcttaaatacttg 0.928
gtgaacccggaactctgaac tcattgccacacagaagcag 0.894
caaccatgttagatgtgccagt taagagaggggaatggtgatgt 0.981
agggtgcagatcctgcaatacccag tccagcctcactttgtaaatcaacatc 0.416
ccatggcttcgttatcccta taaaggtgaaggaacgggtg 0.599
atgactgagcatctgcgttc gccgccacttattgtaggat 0.492
ttgtaatggtgatgctcttcc cagttactaccaaaaatagtcaaacac 0.224
gccgctcgtacaaggttattc tcgatttcccaaattgaagc 0.457
gggttatcaatgatgcaatgg cctttatgtcagccggtgtt 0.943
tggccggcttctagaaataa tgaaatcacccgtgaccttt 0.863
tgtttcccttcattcatgct ccaattggataaattggtggt 0.421
aaacagaggtgccgaagaaa gagctacaagcagcaaacca 0.602
atctctctgagggttcaagacagg tatatcagctccatacttctttgc 0.862
cgagtccgaggaagactgat tcaagacagacacggattgc 0.749
tatcagttcacctcccagca gccaatcatgtgaatggtgat 0.179
ccgtctccttctccctcttt ctggctggtgtcttctccat 0.348
tcgcatcaattgcaacacac aaacgcaaggtgatcagtcc 0.617
acaagagtcgggtgatggac gcgatggaaatagcatcaca 0.291
tccgttatgctaacaattccaac tgtgttcatttcccatcacaatctc 0.313
accacttcctctatcaaaca ataccaaataaccaaacaac 0.833


et al., 2007.









Table 3-1. Continued
Marker Approx. Position x Forward primer Reverse primer


C2_At5g60160
C2_At5g52820
C2_At1g61620
LEOH127
SSR296
SL10255i
C2_At3g17040
SSR603
SSR306
C2_Atlg71810
CT194
SL00030
SSR146
TG441
P11M6
Bs4
CT93
SL20210i
C2_At1gl4000
TOM49
CosOH73
SSR162
SL10328i
T1456
p55P11


3.068
3.070
3.087
3.098
4.010
4.025
4.032
4.045
4.053
4.072
4.079
4.087
4.107
5.008
5.015
5.022
5.030
5.046
5.060
5.068
5.082
5.090
6.000
6.010
6.020


Approximate position obtained from Dynze, et al., 2007.


acacaatgctaatcaacgttatgc
tgggatctaaatacccagacacc
atgcattctagaatgccttttgtc
caaggcatcaacctaattgga
ccggaacaagtcccttcata
tttgctgtatgtatatgctcttcc
tggggttggatggagtggaaag
gaagggacaattcacagagtttg
acatgagcccaatgaacctc
tcatgcagatccacatcctggaaac
tgggttttctgggtatggaa
agttggtggtggtagtgaag
tatggccatggctgaacc
tggtatggtaccacgacaaag
gaggtaggacttagaaaacata
ggagctgaatacggattgga
ttctgaggttggctgagaccttgt
gaggtatcaaagttatgctttcac
agcgttacatggctggatcgatg
aagaaactttttgaatgttgc
cttcccgacaagcacaaaaa
gctctctacaagtggaactttctc
accgtgaatctgaggttgct
tagcttctgccattgatttgagc
tcccaaaccccaacttaaaa


tcatccaccgcgcacatttc
acagaaagaacccaatttctgtgc
tccctggctttctgcagcatc
tgtaggcttgaaaaataagaggaga
tcagccaagttcatggtacatc
gcactctgataaaagacttgcag
agtagaggttacgaatttcctctgc
ccttcaacttcaccaccacc
aaccattccgcacgtacata
agtgacaaaatccttggccaatgc
gcatgatgggcagtctgtaa
ttctctccattcacagttcc
cgaacgccaccactatacct
ttttcaggtcgaggataccg
aatcaacaccactaaatgcaga
atcgttccgatgatttctgg
tctggtagacaatggaaccgcctt
tcgattagttgagctagttattcc
atacgtctttaacaattcaatcatgc
attacaatttagagagtcaagg
cgaatgctctgtaccatttcc
caacagccaggaacaaggat
cgtgccaatgtccaactaag
tgagagggaagtatctgtatgccc
ggacggtctgtgagtggaat


P- value
0.859
0.781
0.396
0.197
0.040*
0.929
0.718
0.515
0.222
0.465
0.233
0.308
0.190
0.443
0.303
0.537
0.506
0.625
0.503
0.878
0.979
0.721
0.097
0.252
0.252





Table 3-1. Continued
Marker Approx. Position x
P6-25F2R5 6.025
TG590f2R2 6.029
T0834-Fla,R2 6.032
C2_At1g44760 6.044
SP 6.068
LEOH112 6.078
SSR350 6.100
C2_At5g20180 7.006
C2_At1g19140 7.024
SSR276 7.033
TG217 7.043
TG174 7.052
TG216-1 7.062
C2_At1g56130 7.085
C2_At5g46630 8.002
LEOH147 8.020
C2_At2g26830 8.030
TG302 8.038
SSR38 8.053
TG294 8.083
C09H Ba0203J14.1 9.023
SSR70 9.031
LEOH144 9.058
LEOH170 9.074
SSR333 9.100
Approximate position obtained from Dynze,


Forward primer
ggtagtggaaatgatgctgctc
acagcaggaggtgatggaatac
ctgttaattgggaccccatcagaagcagg
ttcttcatctgctgctcatcttgc
agggttgaagttcatggtgg
gccaattgaactgaccatctg
ggaataacctctaactgcggg
tgctatgtacatctaatcccaagcac
aggcccttgtactcagtgcctctc
ctccggcaagagtgaacatt
cgttgcttcctgatcctacc
ttccaagatcttttagcgtctc
gctttcggtactgcatcctc
acatatagctgttgggaacaggg
tggcgcctttgatgaagatgc
agttcccgttggtgttcaag
tcaaatctagatggttctcacttctctg
ctctccgggtggctattaca
gtttctatagctgaaactcaacctg
gttctcattggagccatcgt
gcatgactgctctcagttggcttt
tttagggtgtctgtgggtcc
atggcctaggattgcatctg
ggattagaagagaaaaacaaaagca
gttcccgcttgagaaacaac
et al., 2007.


Reverse primer
gctctgcctattgtcccatatataacc
cgggtcgagcgatttgttta
ggaaggtgatgctgcaatccttcagataacc
agagggttttttctgacccaagac
gatgttccctgagatatgga
cccatgtatttggctgtagaa
cgatgccttcatttggactt
agctatcccccttttccaccaag
tcatggcggtttcagtccatcc
cgacggagtacttcgcatt
agctagtgatgatcctggcg
ctgttgcggatgtgatcatt
taaatgaagcctgggattgc
taggtttaaacttgcgaacatcc
agattttgagggtaaccaaagtcc
cccttgccagtggatgttag
aagtgcgtgcatcaataaatgactg
tcttgggactcctccttttct
gggttcatcaaatctaccatca
gattgggcacactcacttt
ggcagcttcatttgagtgtggaga
ggagtgcgcagaggatagag
ttgcatacacttggataaaagca
agccttctcaaattcctcctc
ccaatgctgggacagaagat


P- value
0.578
0.711
0.354
0.773
0.743
0.197
0.224
0.754
0.320
0.736
0.725
0.614
0.600
0.159
0.390
0.820
0.532
0.239
0.412
0.838
0.242
0.531
0.955
0.981
0.718









Table 3-1. Continued


x approximate position obtained from Dynze, et al., 2007


Marker
C2_At3g21610
C2_At5g60990
SL10105i
LEVCOH15
SL10419i
C2_At3g58470
T1682
TG403(dCAPS) R
SL10683i
TG497
SSR80
T0408-1,2
SSR76
C2_At4g10050
SL10737i
cLET-24-J2
Tg36
SL10027i
TG180
TG68
SL109531
TG360
C2_At5g42740
leoh301
CosOH1
LEOH 275
Pti B


Approx. Position
10.002
10.014
10.030
10.037
10.043
10.061
10.066
10.082
11.000
11.004
11.017
11.026
11.046
11.054
11.060
11.073
11.080
11.098
12.000
12.009
12.029
12.038
12.055
12.066
12.070
12.075
12.088


Forward primer
atgggattcaaaaaggatgcttagc
tgatacactgaagcagcagtatcg
ccaagcccttctgatttagtg
gcaaccaccaatgttcattaca
ccttgattggaaaaagcaagac
attgcttgtcccacactttatgc
cctccctcaccatccaataa
tttgccttggttcccttatgcagc
tggatattcgtatattcgagacagg
cgtctcgagaggaagtgagg
ggcaaatgtcaaaggattgg
tagacggtgctcatgtcgag
acgggtcgtctttgaaacaa
tcctgttgaaagttcaatctgtgt
ccactcctgggactcaaatc
caaccatcctagcaatgaaatct
tgttttaaactgaagatgtgtaaaatg
ctaccaggagcctgaagagc
tctcagtggactaaggggtca
tgcactaagcatctcgcatt
ctgtctctcgcttttctcctg
ccccagaacacctctccata
agcaccatttgagaaaaatatacctg
tgctgttttgtttggctcac
tgcatacacttggtcatgacttc
tcctctgaaaacaacttcacga
acccctQatataacaacacatc


Reverse primer
agcctaacaccagtagcatcatacattac
agccagaagacgagttgcatcac
ctttacataattggccgacaaac
aagctaaatctggcttgtggag
gccattcttttgggagataaac
tactgttcaaaccgtttgtcatactc
ctgctttaaccaccggattc
tacgtatttttgaaatatcctgttctttcag
attccgatccatccaatctg
tactggcacccatgctacaa
agggtcatgttcttgattgtca
gttctcggcacccattctaa
ccaccggattcttcttcgta
ctccactcatgtcacaaacca
tggacccacaggtaatgagg
gaggcattcactctcttcgatac
gaatgagcaagttaaacagtaagg
ccattagagccaagacgctc
gcatggaacaccatcatcaa
tttcatgtcaaggggattga
acggaacacaccctaagtgc
tttcccgattttgttcctga
atccaaggaatgaaacattccacac
tgttcatatctttgatggcatgt
ggctatagcatgcgttggtt
agtgtgagcctcaaattcca
caaQacaacaactacaaccatc


P- value
0.120
0.029*
0.024*
0.027*
0.040*
0.533
0.531
0.282
0.301
0.361
0.748
0.04*
0.815
0.416
0.256
0.152
0.145
0.456
0.216
0.304
0.184
0.264
0.370
0.312
0.909
0.588
0.904









Table 3-2. Detection of associated molecular markers in 354 F2 individuals for
chromosome 10 & 11 and for a subset of 135 F2 plants for chromosome 4,
10 and 11 through single marker interval analysis by fitting data to simple
linear regression model.
Chromosome Marker bO bl -21n(L0/L1)z F-value p-value
354 F2 plants
10 SL10105i 3.339 -0.177 5.376 5.385 0.021*
11 T0408-1,2 3.342 0.152 4.058 4.059 0.045*

135 F2 plants (subset of
354)
4 SSR296 2.528 -0.082 0.16 0.158 0.692
10 SL10105i 2.509 -0.442 5.102 5.122 0.025*
11 T0408-1,2 2.503 0.385 4.426 4.433 0.037*
z Likelihood ratio test statistic.









Table 3-3. Parents and F2 plant survival percentage as per combination of alleles on
chromosome 10 and 11. Plant numbers are in parenthesis.
SL10105iv T0408-1,2w Resistant Susceptible


PI 126932
SPx


Fla. 7776
SLy

F2 generation
SP




Hetz


Het
SL
v Marker on chromosome 10.
w Marker on chromosome 11.
x Homozygous for PI 126932 allele.
Y Heterozygous for both alleles.
z Homozygous for Fla. 7776 allele.


91.60(22)


8.4(2)


12.5(3)


87.5(21)


25.00(2)
63.64(7)
77.78(7)

23.53(4)
79.07(34)
37.50(6)

28.57(4)
23.08(3)
50.00(3)


75.00(6)
36.36(4)
22.22(2)

76.47(13)
20.93(9)
62.50(10)

71.43(10)
76.92(10)
50.00(3)









Table 3-4. F3 plant survival percentage as per combination of alleles on chromosome
10 and 11. Plant numbers are in parenthesis.
SL101 05iv T0408-1,2w Resistant Susceptible
SPx SP 28.57(2) 71.43(5)
Het 50.00(7) 50.00(7)
SL 88.89(8) 11.11(1)


Hety


Het
SL
v Marker on chromosome 10.
w Marker on chromosome 11.
x Homozygous for PI 126932 allele.
Y Heterozygous for both alleles.
z Homozygous for Fla. 7776 allele.


33.33(2)
63.64(7)
50.00(5)

13.33(2)
18.18(2)
40.00(2)


66.67(4)
36.36(4)
50.00(5)

86.67(13)
81.82(9)
60.00(3)









Table 3-5. BC1 plant survival percentage as per combination of alleles on chromosome
10 and 11. Plant numbers are in parenthesis.
SL10105iw T0408-1,2x Resistant Susceptible
Hety Het 83.3(15) 16.6(3)
SL 75(12) 25(4)

SLz Het 33.3(36) 66.66(12)
SL 58.3(7) 41.6(5)
w Marker on chromosome 10.
x Marker on chromosome 11.
Y Heterozygous for both alleles.
z Homozygous for Fla. 7776 allele.

Table 3-6. Detection of associated molecular markers in 64 BC1 individuals through
single marker interval analysis by fitting data to simple linear regression
model.
Chromosome Marker bO bl -21n(L0/L1)z F-value p-value
10 SL10105i 2.412 -0.605 5.054 5.094 0.028*
11 T0408-1,2 2.917 0.506 3.451 3.435 0.069
z Likelihood ratio test statistic









CHAPTER 4
SUMMARY AND CONCLUSIONS

Southern blight of tomato (Solanum lycopersicum L.) caused by Sclerotium rolfsii

Sacc. is a minor soil borne disease in Florida but the economic losses caused by this

fungus could increase after the regulatory phase out of Methyl Bromide which is the

preferred method of control. The best alternative control of this disease is the

deployment of genetically resistant cultivars which will not only be economical but also

beneficial for low-input and organic crop production systems. This study confirmed that

the previously identified (Mohr, 1955) S. pimpinellifolium accession (PI 126932) was an

effective source of resistance against a Florida isolate of S. rolfsii and determined the

genetic components of southern blight resistance from that source. This information will

be used to incorporate resistance into breeding lines through marker assisted selection.

Earlier work showed that isolates of S. rolfsii could differ in their virulence (Sharma

et al., 2002; Flores-Moctezume et al., 2006; Shukla and Pandey, 2008). So the first step

was to determine if there was any difference in the level of resistance among the

reported sources of resistance against several diverse isolates of S. rolfsii. This would

identify the most effective source of resistance for genetic mapping. Two resistant

sources (PI 126932 and breeding line 5913M), and a susceptible inbred line (Fla. 7776)

were individually inoculated with an isolate of S. rolfsii collected from tomato (GCT-1),

peanut (WM 609) and sweet potato (DF/LA SR1), obtained from Florida, Georgia and

Louisiana respectively.

Results showed that PI 126932 provided resistance against all three isolates of S.

rolfsii used in the study, while breeding line 5913M was only resistant against isolate

WM609 from peanut and DF/LA SR1 from sweet potato but not against GCT-1 from









tomato. Fla. 7776 was susceptible to all three isolates. Significant differences were

observed between different genotypes of tomato and between the three isolates of S.

rolfsii. Significant interaction between the tomato lines and the S. rolfsii strains was also

noted. This showed that the resistance in tomato could depend on the interaction

between the tomato genotype and southern blight strain.

For genetic studies of southern blight resistance, PI 126932 and Fla. 7776 were

selected as resistant and susceptible parents respectively. Crosses were made

between the parents and several generations were created. Both parents and F1 and F2

generations were artificially inoculated with southern blight strain GCT-1. Results

indicated that the genes contributing to resistance in PI 126932 could have incomplete

penetrance. However, such assumption needs to be confirmed by further tests as in the

field trial (appendix D) it seemed that high inoculum pressure and favorable climatic

condition for pathogen could be a possible cause for death of plants of resistant lines.

The distributions of individual phenotypes in the F1 and F2 generations suggested that

the inheritance of this trait in tomato involved multiple genes. Genetic mapping

experiments revealed two loci affecting resistance. Initially three loci were detected in a

selective genotyping study using the F2 segregating generation inoculated with the

GCT-1 isolate and genotyped with 102 co-dominant molecular markers. One locus was

excluded in a follow-up experiment with a larger population. The other two loci L1

(chromosome 10) and L2 (chromosome 11) were confirmed in a larger F2 population

without selective genotyping and F3 and BC1 populations. Locus L1 was found to be

contributing resistance while effect of L2 was opposite to that of L1. Paradoxically, the

highest numbers of resistant plants in F2, F3 and BC1 generation were found to be









heterozygous for both loci. One explanation involves both an overdominance and

epistasis effect. In the Fla. 7776 genetic background, locus L1 alone was found to

provide a good resistance level. Data indicated epistasis effect for locus L1, suggesting

that this gene might be interacting with some other genes along with L2. If the

resistance requires an interaction between genes then such a condition would greatly

affect the transfer of resistance genes through backcrossing. However, evidence from

BC1 generation suggested that a single gene (L1) from PI 126932 was sufficient in the

Fla. 7776 background for providing resistance and by use of the molecular backcross

method it could be transferred to cultivated lines to increase their resistance.

Heterozygous plants for locus L1 were also found to be resistant (dominant inheritance),

thus L1 can be used for breeding southern blight resistance into F1 hybrids because

introgression of this locus is only needed in one parent.

The mechanisms underlying the resistance conferred by this gene remain to be

resolved. S. rolfsii is a necrotrophic pathogen which seems to be relying on three prime

mechanisms for overcoming its host plants, i.e. the ability to kill host cells, decompose

plant tissue and counteract plant defense responses (Glazebrook, 2005). In order to kill

host cells, the fungus is able to produce certain phytotoxic metabolites, such as oxalic

acid (OA) and polygalacturonase (Bateman and Beer, 1965). OA induces Programmed

Cell Death (PCD) in the host plants (Errakhi et al., 2008). PCD is a part of plant life

cycle and helps in plant tissue development (Kim et al., 2008). Hypersensitive response

is a form of PCD which act as a defense mechanism during certain pathogens attack.

However, under attack from certain necrotrophic fungus like S. rolfsii, Sclerotinia

sclerotiorum PCD is beneficial to the pathogen as compared to the host (Kim et al.,









2008). While high concentration of OA causes PCD, at lower concentration OA induces

defense related gene expression resulting in resistance against the proliferation of S.

rolfsii in Arabidopsis thaliana (Lehner, 2008). It could be possible that the genes at the

detected loci might be somehow degrading the effect of OA, but this remains to be

determined. The second trait employed by this fungus in subduing its host is

decomposing host tissue through plant cell wall degrading enzymes like

polygalacturonase. OA increases the rate by which polygalacturonase hydrolyze

pectates in the middle lamella by reducing the pH of host tissue to a more favorable pH

range for enzyme action and by combining oxalate with the calcium ions in the calcium

pectates of the host cell wall (Bateman and Beer, 1965). It could be possible that the

genes are inhibiting the chelating of calcium ions in the calcium pectates in the middle

lamelle thereby inhibiting the effect of polygalacturonase and rendering resistance to the

host. Third principle on which this fungus relies to overcome host plant is its ability to

counteract the action of host defense mechanism. S. rolfsii is capable of doing this by

suppressing the oxidative burst, which is one of the initial plant defense mechanism

(Kim et al, 2008). The loci identified in this study might confer a better oxidative burst

response leading to efficient production of hydrogen peroxide (H202) which acts as

antimicrobial agent. Future studies should identify the gene(s) and unravel the

mechanisms for the higher resistance levels by the detected genes.

Another possible mechanism for resistance could be due to phellem cells that form

a protective barrier eventually preventing entry of fungus into the host stem (Mohr and

Watkins, 1959). In such case using tomato rootstock possessing continuous phellem

cells layer could help in controlling this disease. Grafting trials were conducted to test if









resistance could be achieved by using PI 126932 as a rootstock but due to unfavorable

condition no results were obtained (appendix E).

Further research is required to gain better understanding of southern blight

genetics in tomato. The influence of parameters like environmental effect, incomplete

penetrance, and fungus strain effect points to the need for large segregating

populations and progeny testing in F3 families to maximize the ability to detect

resistance loci and to understand their effects. It would also be helpful to evaluate

different crosses involving various sources of resistant and susceptible lines. Based on

the results of earlier work and the current study it is likely that resistance from PI

126932 will be effective against southern blight under field conditions. Current studies

were carried out in greenhouse conditions. Field trials were conducted but due to

unfavorable conditions no valid conclusions were derived (appendix D). So, the

resistance needs to be tested in field conditions and against various isolates of S. rolfsii.

Developing polymorphic markers in future for the chromosomal regions which were not

covered in this study could perhaps help in detecting additional genes with weak effects.

The phase-out of Methyl Bromide (MeBr) has forced researchers to come up with

new alternatives for controlling soil-borne diseases. Minor soil borne diseases like

southern blight which were effectively controlled by MeBr could now become major

problems to the Florida tomato industry. This study was directed towards finding genes

which could help in establishing southern blight resistant tomato lines. For the first time

we were able to map genes contributing to the resistance against southern blight in

tomato which are now being used to transfer resistance to elite commercial tomato

lines.









APPENDIX A
PEDIGREES












Suncoast


NC 140


I Suncoast

SFla. 7060


Fla. 7060


Fla. 721
F9


C-28


C-28

Fi-
1- 648

-6 -- Walter
-64833-D-D

-- 2133-D5-D1


Figure A-1. Pedigree of Fla. 7776.


Fla. 7776


- F58







--Fla. 7418














5913M-


- W1023 F71 STEP 1021


- W546 F71-
(F7)


STEP 54
-W507-1 S63- STEP 438 W273 S56 -


W80-4 S67- -W390M S59 Southland
- (F11) W451 S56- STEP 247
W416-1-1 F62-
W371M S56-STEP 54 Red cloud
L W371M S56--
Southland Fg

-W497 S62 STEP 401 W126 S56- Rutgers
(F7)
-W96-1 S65 W174 S59 -L Stokesdale

W162-4 S67- W247-1 S62- W451 S56- STEP 247


SW235-1 S59 -STEP 54
STEP 54 LW268M S56
-W268M S56- Southland

Southland STEP 54
W93-3 S65-
(F11) I W273 S56


S59


L Southland

W451 S56 STEP 247


Figure A-2. Pedigree of 5913M.









APPENDIX B
MOLECULAR MARKER TECHNICAL INFORMATION










Table B-1. Technical information for markers polymorphic between Fla. 7776 and PI 126932.


Marker
CosOH47
LEOH36
C2_At5g18580
SSR95
SSR316
SL20268i
SL10975i
LEVCOH11
C2_At3g04710
SSR42
SL10126i


Location
1.010
1.017
1.035
1.043
1.053
1.061
1.070
1.085
1.095
1.107
1.137


Marker
type
caps
caps
caps
ssr
ssr
indel
scar
caps
caps
ssr
indel


Restriction
Enzyme
Bst UI
Bcl /
Hpy CH41V
N/A
N/A
N/A
N/A
Mnl I
Hinc II
N/A
N/A


Annealing
Temp.
54
56
49
45
45
45
55
54
55
45
45


Amplicon size
226-150
1300-1128
929-1100
212-224
235-251
234-248
161-151
149-195
900-1100
188-192
213-219


Detection
2% agarose
1% agarose
2% agarose
6.5% acrylamide
6.5% acrylamide
6.5% acrylamide
6.5% acrylamide
4% agarose
2% agarose
6.5% acrylamide
6.5% acrvlamide


Reference
SGN
Yang, 2004
SGN
SGN
SGN
Deynze, 2007
Deynze, 2007
Yang, 2005
SGN
SGN
Devnze, 2007









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
TOM11 2.013 ssr N/A 45 183-187 6.5% acrylamide SGN
SL10682i 2.034 scar N/A 45 182-176 6.5% acrylamide Deynze, 2007
SSR96 2.043 ssr N/A 50 199-209-221 6.5% acrylamide SGN
SSR5 2.050 ssr N/A 50 196-193-181 6.5% acrylamide SGN
LEOH348 2.064 caps Hpy CH41V 52 100-184 2% agarose Yang, 2005
LEOH113 2.075 snp Nla III 52 154-211 4% agarose Yang, 2004
C2_At5g66090 2.083 caps Hpy CH4111 55 300-450 2% agarose SGN
LEOH174 2.096 indel N/A 52 221-146 4% agarose Yang, 2005









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
TG525 3.014 caps Tsp5091 53 214-230 2% agarose SGN
LEOH124i 3.021 indel N/A 52 110-208 6.5% acrylamide Yang, 2004
SL10480i 3.038 indel N/A 45 100-150 2% agarose Deynze, 2007
LEOH223 3.040 caps Mse I 52 177-212 4% agarose Yang, 2005
C2_At1g02140 3.054 caps Hha I 50 700-1000-1550 2% agarose SGN
FEY 3.064 caps Bst Ui 55 667-800 2% agarose SGN
C2_At5g60160 3.068 caps Hinf I 54 450-500 4% agarose SGN
C2_At5g52820 3.070 caps HypCH41V 55 750-850 2% agarose SGN
C2_At1g61620 3.087 caps Taq I 54 600-900 2% agarose SGN
LEOH127 3.098 caps Hinc II 52 177-244 2% agarose Yang, 2004









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
SSR296 4.010 ssr N/A 45 185-200 6.5% acrylamide SGN
SL10255i 4.025 indel N/A 45 160-150 6.5% acrylamide Deynze, 2007
C2_At3g17040 4.032 caps Dde I 55 200-250-550 2% agarose SGN
SSR603 4.045 ssr N/A 45 251-179 6.5% acrylamide SGN
SSR306 4.053 ssr N/A 45 255-270 6.5% acrylamide SGN
C2_At1g71810 4.072 caps Bst UI 57 450-800-1100 2% agarose SGN
CT194 4.079 ssr N/A 45 174-171 6.5% acrylamide SGN
SL00030 4.087 snp Ase I 51 233-163-70 4% Metaphor SolCAPX
SSR146 4.107 ssr N/A 45 234-238 6.5% acrylamide SGN
xhttp://solcap.msu.edu/tomato_snp_survey.shtml. [Accessed: January, 2010].









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
TG441 5.008 caps Taql 53 350-280 2% agarose SGN
P11M6 5.015 caps Taq I 50 300-330 4% agarose Hutton, 2008
Bs4 5.022 caps Dpn II 55 600-650 2% agarose SGN
CT93 5.030 caps Alu I 54 300-325 2% agarose Hutton, 2008
SL20210i 5.046 scar N/A 52 170-250 2% agarose Deynze, 2007
C2_Atlgl4000 5.060 caps Spe / 55 900-1000 2% agarose SGN
TOM49 5.068 ssr N/A 45 223-190 6.5% acrylamide Suliman,2002
CosOH73 5.082 caps Alu I 56 69-123 2% agarose tomatomap.net
SSR162 5.090 ssr N/A 50 260-264 6.5% acrylamide SGN









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
SL10328i 6.005 scar N/A 45 234-246 6.5% acrylamide Deynze, 2007
T1456 6.010 caps Rsa I 56 500-650 2% agarose Jieta/.2007
p55P11 6.020 caps Ddel 54 300-400 2% agarose SGN
TG590f2R2 6.029 caps HpyCH4III 55 250-350-525 2% agarose Hutton, 2008
P6-25F2R5 6.025 caps Taq I 55 200-400 2% agarose Hutton, 2008
T0834-Fla,R2 6.032 scar N/A 55 550-660 2% agarose Hutton, 2008
C2_At1g44760 6.044 caps Nsi I 55 400-700-900 2% agarose SGN
SP 6.068 caps Bst NI 56 350-370 4% agarose SGN
LEOH112 6.078 caps HpyCH4IV 52 240-300 4% agarose Yang, 2004
SSR350 6.100 ssr N/A 45 149-267-269 6.5% acrylamide SGN









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
C2_At5g20180 7.006 caps Taq I 55 700-800-1300 2% agarose SGN
C2_At1g19140 7.024 scar N/A 55 855-1100 2% agarose SGN
SSR276 7.033 ssr N/A 52 150-177 4% agarose SGN
TG217 7.043 caps HpyCH41V 55 450-500 4% agarose SGN
TG174 7.052 caps Hha I 55 500-1200 2% agarose SGN
TG216-1 7.062 caps Bsl / 55 300-350 2% agarose Hutton, 2008
C2_At1g56130 7.085 caps Rsal 55 400-300 2% agarose SGN









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
C2_At5g46630 8.000 CAPS Hpy CH4111 56 425-700 2% agarose SGN
LEOH147 8.020 caps Tsp45i 52 117-185 2% agarose Yang, 2004
C2_At2g26830 8.030 CAPS Hpy CH4111 50 550-950 2% agarose SGN
TG302 8.038 CAPS Alu I 55 450-700 2% agarose SGN
SSR38 8.053 SSR N/A 50 237-240 6.5% acrylamide SGN
TG294 8.083 CAPS Alu I 50 800-550 2% agarose SGN









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
C09HBa0203J14.1 9.023 caps Tsp 5091 53 300-380 3% agarose Hutton, 2008
SSR70 9.031 ssr N/A 50 115-105 6.5% acrylamide SGN
LEOH144 9.058 caps Fok I 52 152-225 2% agarose Yang, 2004
LEOH170 9.074 indel N/A 52 212-384 2% agarose Yang, 2005
SSR333 9.100 ssr N/A 50 199-201 6.5% acrylamide SGN









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
C2_At3g21610 10.000 caps Dpn I/ 55 500-750 2% agarose SGN
C2_At5g60990 10.014 caps Hinf I 55 900-1100 2% agarose SGN
SL10105i 10.030 scar N/A 45 203-235 6.5% acrylamide Dynze, 2007
LEVCOH15 10.037 scar N/A 52 178-188 6.5% acrylamide Yang, 2005
SL10419i 10.043 scar N/A 45 105-124 2% agarose Dynze, 2007
C2_At3g58470 10.061 caps Tsp 5091 50 320-280 2% agarose SGN
T1682 10.066 caps Hinf I 54 220-300 2% agarose Hutton, 2008
TG403(dCAPS)R 10.082 dcaps Hpy1881 55 215-235 4% agarose Huttony
Y Personal Communication.










Table B-1. Continued


Marker
SL10683i
TG497
SSR80
T0408-1,2
SSR76
C2_At4g10050
SL10737i
cLET-24-J2
TG36
SL10027i


Location
11.000
11.004
11.017
11.026
11.046
11.054
11.060
11.073
11.080
11.098


Marker
type
indel
caps
ssr
caps
ssr
caps
scar
caps
ssr
indel


Restriction
Enzyme
N/A
Taq I
N/A
Mnl I
N/A
BstN I
N/A
Hpy CH4111
N/A
N/A


Annealing
Temp.
45
52
45
55
45
56
45
55
45
45


Amplicon size
165-171
550-1200
164-167
350-520
150-160
139-170
163-176
394-450
162-172
171-180


Detection
6.5% acrylamide
2% agarose
4% agarose
2% agarose
2% agarose
2% agarose
6.5% acrylamide
4% agarose
6.5% acrylamide
6.5% acrylamide


Reference
Dynze, 2007
SGN
SGN
Hutton, 2008
SGN
SGN
Dynze, 2007
Hutton, 2008
SGN
Dynze, 2007









Table B-1. Continued
Marker Restriction Annealing
Marker Location type Enzyme Temp. Amplicon size Detection Reference
TG180 12.000 caps Dral 55 270-490 2% agarose SGN
TG68 12.009 caps EcoRV 52 200-300 2% agarose SGN
SL10953i 12.029 indel N/A 45 219-231 6.5% acrylamide Deynze, 2007
TG360 12.038 caps Apo I 55 500-650 2% agarose Hutton, 2008
C2_At5g42740 12.055 caps Dde I 55 700-600 2% agarose SGN
LEOH301 12.066 scar N/A 52 164-185 4% agarose Yang, 2005
CosOH1 12.070 caps Tsp RI 54 510-380 2% agarose SGN
LEOH 275 12.075 snp Msel 52 88-144 2% agarose Yang, 2005
PtiB 12.088 caps Mnl 56 500-600 2% agarose SGN









APPENDIX C
ADDITIONAL MOLECULAR MARKER INFORMATION










Table C-1. Marker classification based on polymorphism and dominance between PI
126932 and Fla. 7776.
Approx
Markers position Polymorphic Dominant Co-dominant
CosOH47 1.010 Yes No Yes
SSR 34 1.013 No
SL10075 1.015 No
LEOH36 1.017 Yes No Yes
TG58 1.017 No
TG236 1.019 No
C01HBa0003D15.1 1.029 Yes Yes No
SSR 266 1.033 No
SSR192 1.033 No
C2_At5g18580 1.035 Yes No Yes
SSR 105 1.040 No
TOM202 1.041 Yes No Yes
SSR95 1.043 Yes No Yes
SSR 316 1.053 Yes No Yes
SL20134i 1.060 Yes No Yes
SL20268i 1.061 Yes No Yes
SSR 134 1.064 Yes No Yes
SL10975i 1.070 Yes No Yes
SL20116 1.078 No
SL 10945 1.084 Yes No Yes
LEVCOH11 1.085 Yes No Yes
CT68 1.086 No
SSR9 1.093 No
C2_At3g04710 1.095 Yes No Yes
U237757 1.102 Yes Yes No
SSR42 1.107 Yes No Yes
t0664 1.111 No
C2_At1g02560 1.116 Yes Yes No
SSR37 1.118 No
TG255 1.125 No
SL10126i 1.137 Yes No Yes
SSR595 1.147 No
C2_At2g15890 1.150 No










Table C-1. Continued


Markers
LEOH342
SL10351
TOM11
CT205
SL10682i
SSR96
120k
SSR5
SL102791
LEOH348
Ovate
LEOH113
TG337
C2_At5g66090
TG537
TG91
LEOH174
LEOH319
TG151
TG154
TG 114
SL 10690i
TG130
SL20182i
TG525
LEOH124i
cbf
SL10480i
LEOH223
SL20195
t1388
SL 10736
SL20037


Approx
position
2.000
2.011
2.013
2.023
2.034
2.043
2.045
2.050
2.060
2.064
2.073
2.075
2.082
2.083
2.089
2.090
2.096
2.097
2.098
2.105
3.000
3.003
3.006
3.013
3.014
3.021
3.029
3.038
3.040
3.040
3.047
3.047
3.049


Polymorphic
Yes
No
Yes
No
Yes
Yes
No
Yes
Yes
Yes
No
Yes
No
Yes
No
No
Yes
Yes
No
No
No
Yes
No
Yes
Yes
Yes
No
Yes
Yes
Yes
Yes
Yes
Yes


Dominant
Yes

No

No
No

No
Yes
No

No

No



No
Yes




Yes

No
No
No

No
No
No
Yes
No
No


Co-dominant
No

Yes

Yes
Yes

Yes
No
Yes

Yes

Yes



Yes
No




No

Yes
Yes
Yes

Yes
Yes
Yes
No
Yes
Yes










Table C-1 Continued


Markers
SSR111
C2_Atlg02140
FEY
C2_At5g60160
C2_At5g52820
t1659
C2_At1g61620
TG134B5
U146899
LEOH127
HERO
SSR296
TG15-2
SSR43
SL10255i
C2_At3g17040
TG483
SSR603
SSR310
SSR306
C2_At1g71810
CT185
CT194
SL_00045
SL_00027
SL00030
C2_At1g27530
CT50
TG500
SSR214
SL10184
SL10888
SSR146


Approx
position
3.053
3.054
3.064
3.068
3.070
3.083
3.087
3.094
3.097
3.098
4.007
4.010
4.021
4.025
4.025
4.032
4.037
4.045
4.053
4.053
4.072
4.076
4.079
4.083
4.084
4.087
4.088
4.092
4.093
4.095
4.106
4.107
4.107


Polymorphic
No
Yes
Yes
Yes
Yes
No
Yes
No
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
No
Yes
No
Yes
Yes
Yes
Yes
No
No
Yes
Yes
No
Yes
No
Yes
Yes
Yes


Dominant


Co-dominant










Table C-1 Continued


Markers
TG163
t0998
TG441
SSR115
P11M6
Bs4
CT93
LEOH16.2
TG96
SL20210i
t0040
C2_Atlgl4000
LEOH192
TOM49
LEOH316
CosOH73
TG185
SSR162
SL10328i
T1456
ct216
SL10242i
p55P11
SL10187425
P6-25F2R5
TG590f2R2
T0834-Fla,R2
SSR128
C2_At1g44760
C2_At1g71950
TG356
LEOH243
TG435


Approx
position
4.107
5.000
5.008
5.014
5.015
5.022
5.030
5.033
5.038
5.046
5.056
5.060
5.060
5.068
5.069
5.082
5.087
5.090
6.000
6.010
6.012
6.018
6.020
6.024
6.025
6.029
6.032
6.041
6.044
6.046
6.050
6.053
6.058


Polymorphic
No
No
Yes
No
Yes
Yes
Yes
No
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
Yes
Yes
No
Yes
Yes
Yes
Yes
Yes
Yes
No
Yes
No
No
No
Yes


Dominant


Co-dominant


Yes

Yes
Yes
Yes



Yes


Yes


Yes
Yes
Yes


Yes
Yes
Yes
Yes
Yes
Yes










Table C-1 Continued


Markers
TG365
SP
LEOH146
SCBC792
CT206
LEOH112
TG314
SSR350
SL20017
C2_At5g20180
SSR286
C2_At2g26590
C2_At2g29490
C2_Atlg19140
LEOH104
SSR276
C2_At2g20860
TG217
LEOH221
LEOH40
TG174
TG291
TG216-1
SSR45
SL10039
C2_At1g56130
TG499
C2_At1g55870
TG424
C2_At5g56130
C2_At5g46630
LEOH 70
U221657


Approx
position
6.060
6.068
6.069
6.075
6.078
6.078
6.090
6.100
7.003
7.006
7.012
7.015
7.022
7.024
7.026
7.033
7.043
7.043
7.050
7.050
7.052
7.053
7.062
7.069
7.073
7.085
7.085
7.090
7.093
7.108
8.002
8.004
8.013


Polymorphic
No
Yes
No
Yes
Yes
Yes
No
Yes
Yes
Yes
No
Yes
Yes
Yes
No
Yes
Yes
Yes
No
No
Yes
No
Yes
Yes
No
Yes
No
No
No
No
Yes
No
Yes


Dominant


Co-dominant


Yes
No
No

No
Yes
No

Yes
No
No

No
No
No



No

No
No

No










Table C-1 Continued


Markers
TG 176
LEOH147
C2_At5g27390
SSR327
SL10044
C2_At2g26830
TG349
TG302
C2_At3g43540
SSR335
SSR38
CT265
C2_At4g11560
C2_At5g41350
C2_At1g63980
TG294
TG254
TG18
LEOH8.4
C2_At2g37025
SL10471
C09HBa0203J14.1
SSR70
LEOH31.4
SSR28
LEOH144
LEOH 117
LEOH170
TG348
TG421
C2_At3g23400
SSR333
SSR599


Approx
position
8.017
8.020
8.021
8.022
8.028
8.030
8.031
8.038
8.041
8.044
8.053
8.069
8.072
8.075
8.077
8.083
9.000
9.009
9.010
9.015
9.020
9.023
9.031
9.040
9.050
9.058
9.072
9.074
9.077
9.081
9.084
9.100
9.104


Polymorphic
No
Yes
Yes
No
No
Yes
No
Yes
Yes
No
Yes
No
No
No
No
Yes
No
No
No
Yes
No
Yes
Yes
No
No
Yes
No
Yes
No
No
No
Yes
No


Dominant


Co-dominant










Table C-1 Continued


Markers
C2_At3g21610
TG122
T0787
SSR34
C2_At5g60990
SL10105i
SSR318
LEVCOH15
SL10419i
TG285
SL10386i
C2_At3g58470
T1682
SSR74
SSR223
SL10807
TG403(dCAPS)R
SSR479
C2_At2g273011.069
SL10683i
TG497
SSR80
T0408-1,2
SL20244i
C2_At4g22260
TG384
SSR76
SL10737i
SL10615
C2_At4g 10050
TOM144
C2_At3g54470
cLET-24-J2


Approx
position
10.002
10.006
10.009
10.013
10.014
10.030
10.033
10.037
10.043
10.045
10.054
10.061
10.066
10.074
10.079
10.082
10.082
10.086
11.000
11.000
11.004
11.017
11.026
11.036
11.037
11.046
11.046
11.054
11.057
11.060
11.062
11.072
11.073


Polymorphic
Yes
No
Yes
No
Yes
Yes
Yes
Yes
Yes
Yes
No
Yes
Yes
No
No
No
Yes
No
No
Yes
Yes
Yes
Yes
No
No
No
Yes
Yes
No
Yes
Yes
Yes
Yes


Dominant
No

Yes

No
No
No
No
No
Yes

No
No




No



No
No
No
No




No
No


Co-dominant
Yes

No

Yes
Yes
Yes
Yes
Yes
No

Yes
Yes




Yes



Yes
Yes
Yes
Yes




Yes
Yes

Yes
Yes
Yes
Yes










Table C-1 Continued


Markers
TG46
TG36
TG393
SL10027i
TG180
SL10925i
TG68
SL10953i
CT100
TG360
CT99
TG565
TG111
C2_At5g42740
LEOH66
LEOH301
CosOH1
LEOH 275
SL10796i
LEOH197
PtiB


Approx
position
11.076
11.080
11.088
11.098
12.000
12.000
12.009
12.029
12.036
12.038
12.045
12.048
12.053
12.055
12.062
12.066
12.070
12.075
12.076
12.086
12.088


Polymorphic
No
Yes
No
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
No
Yes
No
Yes
Yes
Yes
Yes
Yes
Yes


Dominant


Co-dominant


Yes

Yes
Yes
Yes
Yes
Yes
No
Yes
No
Yes

Yes

Yes
Yes
Yes
No
No
Yes









Table C-2. Chi-square test for marker segregation distortion.
Observed Expected
Marker Chromosome Genotype plants plants p-value
SL10105i 10 SLx 101 99.75
Hy 198 199.5 0.98
SPz 100 99.75
T0408-1,2 11 SL 107 99.75
H 191 199.5 0.63
SP 101 99.75
x Homozygous for Fla. 7776 allele.
Y Heterozygous for both alleles.
z Homozygous for PI 126932 allele.









APPENDIX D
FIELD TRIAL EXPERIMENT

Resistance level of a particular plant genotype may vary between field and

greenhouse conditions. Ajit et al., (2003) showed that the transgenic wheat lines earlier

reported to be resistant against Fusarium graminearum under greenhouse conditions

were found to be susceptible during field trials. Variation in resistance between field and

greenhouse conditions could greatly affect the breeding of southern blight resistance

into commercial tomato lines grown in fields. So, it was necessary to confirm that the

level of southern blight resistance in various tomato genotypes under field conditions

was consistent with the results obtained in the greenhouse trials during this study.

In order to evaluate the response to southern blight disease in various resistant

and susceptible sources in field condition a study was carried out in September 2009.

Two different susceptible sources Fla. 7776 and Fla. 47 while three resistant sources PI

126932, 5913M and 5635M were selected for this study. F1 obtained from the cross

between PI 126932 and Fla. 7776 was also included. Sclerotium rolfsii isolate GCT-1

was used in this study since this isolate was endemic to the location (GCREC) where

this trial was conducted. A randomized complete block design was used with 4

replications, with 10 plants for each replication. All plant materials were raised in 128-

well speedling trays for 4 weeks before field transplanting. Inoculation was done in a

similar way as described in chapter 2 when plants were 8 weeks old; however, 3 g of

inoculum load was used instead of 2 g per plant. Disease score was rated on a visual

scale of 0 to 4. Data was collected on 10th and 20th day after inoculation (DAI).

A significant difference in the disease severity score was observed between the

tomato lines tested for both the dates (Table D-1). A significant difference was also









observed between the replications (Table D-1) at 10 DAI. Variation in-between the

replications could possibly explain why the mean disease severity score was lower for

Fla. 7776 as compared to PI 126932 at 10 DAI. Both the breeding lines 5913M and

5635M were found to be susceptible against GCT-1 isolate at 10 and 20 DAI. Based on

the results from the data collected on 10 DAI the lowest disease severity was seen in F1

plants (Table D-2). Also at 10 DAI the disease score for F1 was not found to be

significantly different from Fla.7776 but was different from PI 126932; however based on

the results from the data collected on 20 DAI, a significant difference was found

between F1 and Fla. 7776 but not between F1 and PI 126932 (Table D-2). Most of the

plants in all the tomato lines at 20 DAI were found to be susceptible. A possible cause

for such a high rate of death could be due to higher inoculum pressure which could

have overwhelmed the resistance. It is also likely that environmental were highly

favorable for the pathogen which enabled it to kill even the resistant lines. Unfortunately

due to limited time the study was not repeated and hence no definite conclusions were

derived from this study.









Table D-1.


Two-way analysis of variance test for determining variation in disease
severity scores in tomato lines PI 126932, 5913M, 5635M, Fla. 7776, Fla.
47 and Fi(Fla. 7776 x PI 126932) in field condition. GCT-1 isolate of S.
rolfsii was used to inoculate the plants.


Source of variance F value P- valuey

10 days after inoculation
Lines 11.22 <0.01*
Reps 3.15 0.03*

20 days after inoculation
Lines 5.02 <0.01*
Reps 2.49 0.06
Y P- value based on 0.05 significance level.









Table D-2.


Bonferroni's t test for differentiating tomato lines based
scores for GCT-1 isolate.


on disease severity


Bonferroni's
No. Line Mean grouping MSDY

10 DAI
1 5635M 2.9 Az
2 5913M 2.75 A
3 Fla.47 2.45 A B 0.75
4 PI 126932 2.31 A B
5 Fla. 7776 1.85 B C
6 F"w 1.45 C

20 DAI
3 Fla. 47 4 A
2 5913M 3.95 A
1 5635M 3.95 A B 0.38
5 Fla. 7776 3.87 A B
4 PI 126932 3.62 B C
6 F1 3.48 C
W"F derived from cross between PI 126932(e) and Fla. 7776(y).
x Critical 't' value = 2.96.
Y Minimum Significant Difference.
z Means with the same letters are not significantly different.









APPENDIX E
SOUTHERN BLIGHT RESISTANCE THROUGH GRAFTING

Many tomato soil-borne diseases like Fusarium oxysporum f. sp.lycopersici. and

P. lycopersici. etc have been found to be controlled by grafting susceptible varieties

onto resistant rootstocks (Lee, 2003; Lee and Oda, 2003; Rivard and Louws, 2008).

Hence, in order to test whether PI 126932 could provide resistance against southern

blight if used as a rootstock, a pilot study was carried out in greenhouse and later

studies were carried out in the field.

In order to obtained grafted plants for the greenhouse study, 14 plants of Fla.

7776(scion) were grafted to PI 126932(rootstock) and also 14 plants of PI

126932(scion) were grafted to Fla. 7776(rootstock). The 3-week-old plants were grafted

and allowed to grow for 5 more weeks before inoculation. However, at the end only 3

plants with Fla. 7776 as rootstock and 8 plants with PI 126932 as rootstock were

obtained. The study was still carried out by inoculating the grafted plants and 10 plants

of both parents as controls in greenhouse using a completely random design. For field

trials plant materials included PI 126932, Fla. 7776, PI 126932 grafted to PI 126932

below cotyledon, Fla. 7776 grafted to Fla. 7776 below cotyledon, PI 126932 grafted to

Fla. 7776 below cotyledon, and PI 126932 grafted to Fla. 7776 above cotyledon. A

randomized complete block design with four replications each including 10 plants per

treatment was used. GCT-1 isolate was used for this study. Field trials were conducted

in June 2009 and October 2009.

Due to extremely low number of grafted plants no statistical conclusions were

derived from the greenhouse study (Table E-1). During the first field trial most of the

plants died before inoculation due to accidental drift of herbicide from neighboring area.









Trial was repeated in October 2009 but due to sudden drop in temperature the

inoculation was not successful and no data were obtained. Further studies were not

conducted due to lack of time.


100









Table E-1. Number of grafted and parental lines plants found to be resistant and
susceptible under greenhouse condition.


Susceptible Resistant Total
F>Px 3 0 3
P>FY 5 3 8
PI 126932 1 9 10
Fla. 7776 10 0 10
x PI 126932 (scion) grafted to Fla. 7776(rootstock).
Y Fla. 7776 (scion) grafted to PI 126932(rootstock).


101









LIST OF REFERENCES


Ajith, A., T. Zhou, H.N. Trick, B.S. Gill, W.W. Bockus and S. Muthukrishnan, 2003.
Greenhouse and field testing of transgenic wheat plants stably expressing genes for
thaumatin-like protein, chitinase and glucanase against Fusarium graminearum. J.
Exp. Bot., 54: 1101-1111.

Allard, R.W., 1960. Principles of plant breeding. 2nd Edn., New York: Wiley.

Alon, H., J. Katan and N. Kedar, 1974. Factors affecting penetrance of resistance to
Fusarium oxysporum f. sp. lycopersici in tomatoes. Phytopathology, 64: 445-451.

Amadioha, A.C., 1993. A synergism between oxalic acid and polygalacturonases in the
depolymerization of potato tuber tissue. World J. Microbiol. Biotechnol., 9: 599-600.

Aycock, R., 1966. Stem rot and other diseases caused by Sclerotium rolfsii. N.C. Agric.
Exp. Stn. Tech. Bull., pp: 174.

Bag, T.K., 2003. Two new orchid hosts of Sclerotium rolfsii Sacc. from India. New
Disease Reports, 20: 8.

Barksdale, T.H. and A.K. Stoner, 1977. A study of the inheritance of tomato early blight.
Plant Dis. Rep., 61: 63-65.

Barrett, J.T., 1934. Observations on the basidial stage of Sclerotium rolfsii.
Phytopathology, 24: 1137-1138.

Bateman, D.F. and S.V. Beer, 1965. Simultaneous production and synergistic action of
oxalic acid and polygalacturonase during pathogenesis by Sclerotium rolfsii.
Phytopathology, 55: 204-211.

Bateman, D.F., 1972. The polygalacturonase complex produced by Sclerotium rolfsii.
Physiol. Plant Pathol., 2: 175-184.

Besler, B.A., A. Grichar and O.D. Smith, 1997. Reaction of selected peanut varieties
and breeding lines to southern stem rot. Peanut Sci., 24: 6-9.

Besri, M., 2003. Tomato grafting as an alternative to methyl bromide in Marocco.
Proceedings of the 2003 Annual International Research Conference on Methyl
Bromide Alternatives and Emissions Reductions, San Diego, CA, USA. Available
from: http://mbao.orq/2003/012%20besrimqraftinqmbao2003sd.pdf [Accessed June
2010].

Boland, G.J. and T. Brimner, 2004. Nontarget effects of biological control agents. New
Phytologist, 163: 455-457.


102









Boyle, L.W., 1952. Factors to be integrated in control of southern blight on peanuts.
Phytopathology, 42: 282.

Bret6, M. P., M. Asins and A. Carbonell, 1993. Genetic variability in Lycopersicon
species and their genetic relationships.Theor. Appl. Genet., 86: 113-120.

Brimner, T.A. and G.J. Boland, 2003. A review of the non-target effects of fungi used to
biologically control plant diseases. Agricult. Ecosys. Environ., 100: 3-16.

Brown, J.E., C. Stevens, M.C. Osborn and H.M. Bryce, 1989. Black plastic mulch and
spun bonded polyester row cover as method of southern blight control in bell pepper.
Plant Disease, 73: 930-932.

Brunner, E., S. Domhof, and F. Langer, 2002. Nonparametric analysis of longitudinal
data in factorial experiments. New York, John Wiley & Sons.

Budak, H., L. Cesurer, Y. Bolek, T. Dokuyuku and A. Akaya, 2002. Understanding of
heterosis. J. Sci. Eng., 5(2): 68-75.

Cai, G., L.R. Gale, R.W, Schneider, H.C. Kistler, R.M. Davis, K.S. Elias and E. Miyao,
2003. Origin of race 3 of Fusarium oxysporum f.sp. lycopersici at a single site in
California. Phytopathology, 93: 1014-1022.

California Department of Food and Agriculture (CDFA)., 1996. Methyl Bromide: An
Impact Assessment. Office of Pesticide Consultation and Analysis, Sacramento,
California.

Carlborg, O. and C.S. Haley, 2004. Epistasis: too often neglected in complex trait
studies. Nat. Rev. Genet., 5: 618-625.

Cating, R., A. Palmateer and R. McMillan, 2009. Occurance of Sclerotiumr rolfsii on
Ascocentrum and Ascocenda orchids in Florida. Phytopathology, 99(6): S19.

Chahal, G. and S. Gosal, 2002. Principles and procedures of plant breeding:
biotechnological and conventional approaches. Alpha Science Int'l Ltd.

Chellemi, D., 1998. Alternative to methyl bromide in Florida tomatoes and peppers. The
IPM Practitioner, 20(40): 1-6.

Cilliers, A.J., L. Herselman and Z.A. Pretorius, 2000. Genetic variability within and
among mycelial compatibility groups of Sclerotium rolfsii in South Africa.
Phytopathology, 90: 1026-1031.

Cook, R.J., W.L. Bruckart, J.R. Coulson, M.S. Goettel, R.A. Humber, R.D. Lumsden,
J.V. Maddox, M.L. McManus, L. Moore, S.F. Meyer, P.C. Quimby, J.P. Stack and


103









J.L. Vaughn, 1996. Safety of microorganisms intended for pest and disease plant
control: a framework for scientific evaluation. Biological Control, 7: 333-351.

Csinos, A. S., D.K. Bell, N.A. Minton and H.D. Wells, 1983. Evaluation of Trichoderma
spp., fungicides, and chemical combinations for control of southern stem rot on
peanuts. Peanut Science, 10: 75-79.

Curzi, M., 1931.Contributo alla conoscanza della biologia e della sistematica degli stipiti
della. Sclerotium rolfsii. R. Accad. Lincei Randic., 15: 241-245.

Davey, A. E. and L.D. Leach, 1941. Experiments with fungicides for use against
Scelerotium rolfsii in soils. Hilgerdia, 13: 523-547.

Deynze, A., K. Stoffel, R.R. Buell, A. Kozik, J. Liu, E. Knaap and D. Francis, 2007.
Diversity in conserved genes in tomato. BMC Genomics, 8: 465.

Dutton, M.V. and C.S. Evans, 1996. Oxalate production by fungi: its role in
pathogenicity and ecology in the soil environment. Can. J. Microbiol., 42: 881-895.

Duvick, N.D., 1996. Personal perspective plant breeding, an evolutionary concept. Crop
Sci., 36(3): 539-548.

Edson, H.A. and N. Shapovalov, 1923. Parasitism of Sclerotium rolfsii on Irish Potatoes.
Jour. Agr. Res., 23: 41-46.

Enivronmental Protection Agency. 2007. Available from:
www.epa.gov/opprd001/rup/rup6mols.htm. [Accessed January 2010].

Epps, W.M., J.C. Patterson and I.E. Freeman, 1951. Physiology and paratism of
Sclerotium rolfsii. Phytopathology, 41: 245-256.

Errakhi, R., P. Meimoun, A. Lehner, G. Vidal, J. Briand, F. Corbineau, J.P. Rona, F.
Bouteau, 2008. Anion channel activity is necessary to induce ethylene synthesis and
programmed cell death in response to oxalic acid. J. Exp. Bot., 59: 3121-3129.

Fajardo,T.G. and J.M. Mendoza, 1935. Studies on the Sclerotium rolfsii Sacc. attacking
tomato, peanuts, and other plants in the Philippines. Philippine J. of Agr., 6: 387-
424.

FAOSTAT-Agriculture, 2008. Available from:
http://faostat.fao.org/site/567/DesktopDefault.aspx?PagelD=567#ancor. [Accessed
March 2009].

Fery, R. and P. Dukes, 2005. Potential for utilization of pepper germplasm with a
variable reaction to Sclerotium rolfsii Sacc. to develop southern blight-resistant
pepper (Capsicum annuum L.) cultivars. Plant Genetic Resources, 3: 326-330.


104









Flores-Moctezuma, H.E., A. Montes-Belmont, R. Jimenez-Perez, R. Nava-Juarez, 2006.
Pathogenic diversity of Sclerotium rolfsii isolates from Mexico, and potential control
of southern blight through solarization and organic amendments, Crop Prot., 25:
195-201.

Freire, F.C.O., J.E. Cardoso, A. dos Santos, F.M.P. Viana, 2002. Diseases of cashew
nut plants (Anacardium occidentale L.) in Brazil. Crop Prot., 21: 489-494.

Fulton, T.M., J. Chunwongse and S.D. Tanksley, 1995. Microprep protocol for extraction
of DNA from tomato and other herbaceous plants. Plant Mol. Biol. Reptr., 13(3): 207-
209.

Ganesan, S., R. Ganesh Kuppusamy and R. Sekar, 2007. Integrated management of
stem rot disease (Sclerotium rolfsii) of groundnut (Arachis hypogaea L.) using
rhizobium and Tricoderma harzianum (ITCC-4572). Turk. J. Agric. For., 31: 103-108.

Garren, K.H., 1959. The stem rot of peanuts and its control. Virginia Agr. Exp. Sta. Bull.,
144.

Glazebrook, J., 2005. Contrasting mechanisms of defense against biotrophic and
necrotrophic pathogens. Annu. Rev. Phytopathol. 2005. 43:205-27.

Gordon, A. and A. Taylor, 1941. The Photolysis of Methyl Bromide. J. Am. Chem. Soc.,
63(12): 3435-3441.

Goto, K., 1935. Sclerotium rolfsii Sacc. in perfect stage III. Variation in cultures
originated from basidiospores. Jour. Soc. Trop. Agr. Formosa, 7: 331-345.

Hassan, A.A. and K.E.A. Abdel-Ati, 1999. Genetics of Tomato yellow leaf curl virus
tolerant derived from Lycopersicon pimpinellifolium and Lycopersicon pennellii.
Egypt. J. Hortic., 26: 323-338.

Hassan, A.A., H.M. Mazayd, S.E. Moustafa, S.H. Nassar, M.K. Nakhla and W.L. Sims,
1984. Genetics and heritability of tomato yellow leaf curl virus tolerance derived from
Lycopersicon pimpinellifolium. European Association for Research on Plant
Breeding. Tomato Working Group. Wageningen, Netherlands, pp: 81-87.

Higgins, B.B., 1923. The disease of pepper. Georgia Agr. Exp. Sta. Bull., 141: 48-75.

Higgins, B.B., 1927. Physiology and parasitism of Sclerotium rolfsii Sacc.
Phytopathology, 17: 417-448.

Higgins, B.B., 1934. Important disease of pepper in Georgia. Georgia Agr. Exp. Sta.
Bull., 186: 1-20.


105









Howard, P. H., 1991. Handbook of environmental fate and exposure data for organic
chemicals: Pesticides. CRC Press.

Hudgins, H.R., 1952. Relation of nitrogen concentration to the development of southern
blight of peanuts. M.S. Thesis, Texas Agr. and Mechanical Coll., U.S.A.

Hutton, S.F., 2008. Inheritance and mapping of resistance to bacterial spot race t4
(Xanthomonas perforans) in tomato, and its relationship to race t3 hypersensitivity,
and inheritance of race t3 hypersensitivity from PI 126932. Ph.D. Thesis, University
of Florida, U.S.A.

Inami, S. and S. Suzuki, 1981. Breeding alfalfa, Medicago sativa L., for southern blight
resistance. I. Varietal differences of the disease injury. J. Jpn. Soc. Grassland Sci.
26: 360-364.

Inami, S., M. Kanbe and F. Fujimoto, 1986. Breeding varieties of lucerne with resistance
to southern blight. III. Increase in resistance according to advance of selection
generation and heritability values. J. Jpn. Soc. Grassland Sci., 32: 218-224.

Jeeva, M.L., V. Hegde, T. Makeshkumar, R.R. Nair and S. Edison, 2005. Dioscorea
alata, a new host of Sclerotium rolfsii in India. New Disease Reports, 10: 49.

Jenkins, S.F. and C.W. Averre, 1986. Problems and progress in integrated control of
southern blight of vegetables. Plant disease, 70(7): 614-619.

Jha, G. and K. Thakur, 2009. The Venturia apple pathosystem: Pathogenicity
mechanisms and plant defense responses. J. Biomed. Biotechnol., 2009: 1-10.

Ji, Y., D.J. Schuster, and J.W. Scott, 2007. Ty-3, a begomovirus resistance locus near
the tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato.
Mol. Breeding, 20: 271-284.

Jones, J.B., J.P. Jones, R.E. Stall, and T.A. Zitter, 1991. Compendium of tomato
diseases. Amer. Phytopathol. Soc., St. Paul, Minnesota.

Kasrawi, M. A. and A. Mansour, 1994. Genetics of resistance to tomato yellow leaf curl
virus in tomato. J. Hortic. Sci., 69: 1095-1100.

Kim, K., J.Y. Min and M.B. Dickman, 2008. Oxalic Acid Is an Elicitor of Plant
Programmed Cell Death during Sclerotinia sclerotiorum Disease Development. Mol.
Plant-Microbe Interact., 21: 605-612.

Latunde-Dada, A.O., 1993. Biological control of southern blight disease of tomato
caused by Sclerotium rolfsii with simplified mycelial formulations of Trichoderman
koningii. Plant Pathology, 42: 522-529.


106









Leach, L.D. and A.E. Davey, 1942. Reducing southern Scelrotium rot of sugar beets
with nitrogenous fertilizers. J. Agr. Res., 64: 1-18.

Lee, J.M. and M. Oda, 2003. Grafting of herbaceous vegetables and ornamental crops.
Hort Rev., 28: 61-124.

Lee, J.M., 2003. Advances in vegetable grafting. Chronica Hort., 43: 13-19.

Leeper, P., S. Phatak, D. Bell, B. George, E. Cox, G. Oerther and B. Scully, 1992.
Southern blight resistant tomato breeding lines: 5635M, 5707M, 5719M, 5737M,
5876M, and 5913M. HortScience, 27(5): 475-478.

Lehner, A., P. Meimoun, R. Errakhi, K. Madiona, M. Barakate and F. Bouteau, 2008.
Toxic and signaling effects of oxalic acid. Plant Signaling & Behavior, 3: 746-748.

Linderman, G.R. and G.R. Gilbert, 1973. Behavior of sclerotia of Sclerotium rolfsii
produced in soil or in culture regarding germination stimulation by volatiles,
fungistasis, and sodium hypochlorite treatment. Phytopathology, 63: 500-503.

Liua, B., D. Glennb and K. Buckleyc, 2008. Trichoderma communities in soils from
organic, sustainable, and conventional farms, and their relation with Southern blight
of tomato. Soil Biol. Biochem., 40: 1124-1136.

Livingstone, D., J.L. Hampton, P.M. Phipps and E.A. Grabau, 2005. Enhancing
resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase
gene. Plant Physiol., 137: 1354-1362.

Lyle, J.A.,1953. A comparative study of Sclerotium rolfsii Sacc. and Sclerotium delphinii
Welch. Ph.D thesis (unpublished). University of Minnesota, U.S.A.

McColloch, L.P., H.T. Cook and W.R. Wright, 1968. Market disease of tomatoes,
peppers, and eggplants. Agr. Hdbk. no.28, U.S. Dept. Agr. Res. Serv., Washington,
D.C., U.S.A.

Milthorpe, F.L., 1941. Studies on Corticium rolfsii (Sacc.) Curzi (Sclerotium rolfsii Sacc.)
I. Cultural characters and perfect stage. II. Mechanism of parasitism. Proc. Linn.
Soc., 66: 65-75.

Mohr, H.C. and G.M. Watkins, 1959. The nature of resistance to southern blight in
tomato and the influence of nutrition on its expression. Proc. Amer. Soc. Hort. Sci.,
74: 484-493.

Mohr, H.C., 1955. Resistance in Lycopersicon pimpinellifolium Mill. to southern blight
caused by Sclerotium rolfsii Sacc. Ph.D. Thesis, M699, Texas A&M University,
U.S.A.


107









Mohr, H.C., V.A. Greulach and A.A. Dunlap, 1947. Recent studies of southern blight
and root know of tomatoes. Tex. Agr. Exp. Sta. Prog. Rept., 1092.

Muller, C.H., 1940. A revision of the genus Lycopersicon. U.S.Dept. Agr. Misc. Publ. No,
382, pp: 1-29.

Mundkur, B.B., 1934. Perfect stage of Sclerotium rolfsii Sacc. in culture. Indian Jour.
Agr. Sci., 4: 779-781.

Nalim, F.A., J.L. Starr, K.E. Woodard, S. Segner and N.P. Keller, 1995. Mycelial
compatibility groups in Texas peanut field populations of Sclerotium rolfsii.
Phytopathology, 85: 1507-1512.

Naqvi, S.A.M.H., 2004. Disease of fruits and vegetables: Diagnosis and Management.
Volumel. Kluwer Academic Publishers.

Nash, A.F. and R.G. Gardner, 1988a. Heritability of tomato early blight resistance
derived from Lycopersicon hirsutum PI 126445. J. Am. Soc. Hort. Sci., 113: 264-268.

Nisikado, Y., K. Hirata and T. Higuti, 1938. Studies on the temperature relations to the
longevity of pure culture of various fungi, pathogenic to plants. Ber. Ohara. Inst., fur.
Landwirtschaftliche. Forschungen, 8(2): 107-124.

Parvez, S., 2006. Recent advances in understanding genetic basis of heterosis in rice
(Oriza sativa L.). Revista Cientifica UDO Agricola, 6: 1-10.

Perez de Castro, A., M. J. Diez and F. Nuez, 2007. Inheritance of Tomato yellow leaf
curl virus resistance derived from Solanum pimpinellifolium UPV16991. Plant Dis.,
91: 879-885.

Phatak, S.C. and K.D. Bell, 1983. Screening for Sclerotium rolfsii resistance in the
tomato. In: Proc.4th Tomato Quality Wrkshp, Veg. Crops Res.Rpt., VEC-83-1, Dept.
Veg. Crops, Inst. Food and Agr. Sci., Univ. of Florida, Gainesville. pp: 107.

Pimental, D., and A. Wilson, 2004. World population, agriculture, and malnutrition.
World Watch Magazine, 17(5): 22-25.

Polizzi, G., D. Aiello, V. Guarnaccia, G. Parlavecchio and A. Vitale, 2010. First report of
southern blight on silverbush (Convolvulus cneorum) caused by Sclerotium rolfsii in
Italy. Plant Dis., 94: 131.

Povah, A., 1927. Notes on reviving old cultures. Mycologia, 19: 317-319.

Pratt, R. G. and D.E. Rowe, 2002. Enhanced resistance to Sclerotium rolfsii in
populations of alfalfa selected for resistance to Sclerotinia trifoliorum.
Phytopathology, 92: 204-209.


108









Punja, Z.K. and L.J. Sun, 1997. Genetic diversity among mycelial compatibility groups
of Sclerotium rolfsii and Sclerotium delphini. In: Programme and summaries of the
11th biennial conference of the Australian Plant Pathology Society. Perth, Australia,
29th September-2nd October 1997, pp: 110.

Punja, Z.K. and R.G. Grogan, 1982. Effects of inorganic salts, carbonate-bicarbonate
anions, ammonia, and the modifying influence of pH on sclerotial germination of
Sclerotium rolfsii. Phytopathology, 72: 635-639.

Punja, Z.K., 1985. The biology, ecology and control of Sclerotium rolfsii. Ann. Rev.
Phytopathol. 23: 97-127.

Punja, Z.K., S.F. Jenkins and R.G. Grogan, 1984. Effect of volatile compounds,
nutrients, and source of sclerotia on eruptive sclerotial germination of Sclerotium
rolfsii. Phytopathology, 74: 1290-1295.

Ragsdale, N. N. and W.B. Wheeler, 1995. Methyl bromide risks, benefits, and current
status in pest control. In: Review of Pesticide Toxicology, R. M. Roe and R. J. Kuhr
(Eds.). Raleigh, North Carolina: Toxic Communication Inc., pp: 21-44.

Retig, N., N. Kedar and J. Katan, 1967. Penetrance of gene I for Fusarium resistance in
the tomato. Euphytica, 16: 252-257.

Reyes-Valde's, M.H., 2000. A model for marker-based selection in gene introgression
breeding programs. Crop Sci., 40: 91-98.

Ribaut, J.M. and D. Hoisington, 1998. Marker-assisted selection: New tools and
strategies. Trends Plant Sci., 3: 236-239.

Rick, C.M., 1958. The role of natural hybrization in the derivation of cultivated tomatoes
in western South America. Econ. Bot., 12: 346-367.

Rick, C. M., 1988. Molecular markers as aids for germplasm management and use in
Lycopersicon. HortScience., 23 : 55-57.

Ristaino, J.B., K.B. Perry and R.D. Lumsden, 1991. Effect of solarization and
Gliocladium virens on sclerotia of Sclerotium rolfsii, soil microbiota, and incidence of
southern blight on tomato. Phytopathology, 81: 1117-1124.

Rivard, C.L. and F.J.Louws, 2008. Grafting to manage soil-borne disease in heirloom
tomato production. HortScience, 43(7): 2104-2111.

Rivard, C.L., F.J. Louws, S. O'Connell and M.M. Peet, 2009. Grafting tomato with inter-
specific rootstock provides effective management for southern blight and root-knot
nematodes. Phytopathology, 99(6): S109.


109









Rodriguez-Kabana, R., K.M. Beute and A.P. Backman, 1980. A method for estimating
numbers of viable sclerotia of Sclerotium rolfsii in soil. Phytopathology, 70(9): 917-
919.

Rosen, H.R., 1929. Studies on Sclerotium rolfsii with special reference to the metabolic
interchange between soil inhabitants. Arkansas. Agr. Exp. Sta. Annu. Rep., pp: 66.

Saccardo, P.A., 1911. Notes mycologicae. Ann. Mycel., 9: 252-261.

Salvador R., M.J. Diez and F. Nuez, 1998. Genetics of tomato spotted wilt virus
resistance coming from Lycopersicon peruvianum. Eur. J. of Plant Pathol., 104: 499-
509.

Sankaran, K., E.M. Florence and J. Sharma, 2007. Two new diseases of forest tree
seedlings caused by Sclerotium rolfsii in India. Eur. J. For. Pathol., 14(4-5): 318-320.

Sconyers, L.E., T.B. Brenneman, K.L. Stevenson and B.G. Mullinix, 2005. Effects of
plant spacing, inoculation date, and peanut cultivar on epidemics of peanut stem rot
and tomato spotted wilt. Plant Dis., 89(9): 969-974.

Semagn, K., A. Bjornstad and M. N. Ndjiondjop, 2006. Progress and prospects of
marker assisted backcrossing as a tool in crop breeding programs. Afri. J.
Biotechnol., 5 (25): 2588-2603.

Shah, D.A. and L.V. Madden, 2004. Nonparametric analysis of ordinal data in designed
factorial experiments. Phytopathology 94:33-43.

Sharma, B. K., U.P. Singh, K.P. Singh, 2002. Variability in Indian isolates of Sclerotium
rolfsii. Mycologia, 94(6): 1051-1058.

Sharma, D. and N.S. Jodha, 1984. Pulse production in Semi-arid region of India.
Proceedings of Pulses Production, Constraints and Opportunities. pp. 241-265.

Sherf, A.F. and A.A. MacNab, 1986. Vegetable diseases and there controls. John Wiley
& Sons.

Shukla, R. and A. K. Pandey. 2008. Pathogenic diversity of Sclerotium rolfsii isolates, a
potential biocontrol agent against Parthenium hysterophorus L. Afr. J. Environ. Sci.
Technol., 2: 124-126.

Shukla, R. and A.K. Pandey, 2007. Diversity in mycoherbicidal agent Sclerotium rolfsii
isolates from Central India. J.Mycol. PI. Pathol., 37(3): 514-518.

Sleper, D.A. and J.M. Poehlman, 2006. Breeding field crops. 5th Edn., Blackwell
Publishing.


110









Smith, A.M., 1972. Drying and wetting sclerotia promotes biological control of
Sclerotium rolfsii Sacc. Soil. Biol. Bio-chem., 4: 125-129.

Sofi, P.A., A.G. Rather and K. Warsi, 2007. Implications of epistasis in maize breeding.
Int. J. Plant Breed. Genet., 1: 1-11.

Soller, M., T. Brody and A. Genizi, 1976. On the power of experimental designs for the
detection of linkage between marker loci and quantitative loci in crosses between
inbred lines. Theor. Appl. Genet., 47: 35-39.

Soumpourou, E., M. Lakovidis, L. Chartrain, V. Lyall and C. Thomas, 2007. The
Solanum pimpinellifolium Cf-ECP1 and Cf-ECP4 genes for resistance to
Cladosporium fulvum are located in the Milky Way locus on the short arm of
chromosome 1. Theor. Appl. Genet., 115: 1127-1136.

Spreen, T. H., J.J. Van Sickle, A.E. Moseley, M.S. Deepak, and L. Mathers, 1995. Use
of methyl bromide and the economic impact of its proposed ban on the Florida fresh
market fruit and vegetable industry. Bull. Univ. Fla. Exp. Stn. No. 898.

Sugha, S.K., B.K. Sharma and P.D. Tyagi, 1991. A modified technique for screening
chickpea (Cicerarietinum) varieties against collar rot caused by Sclerotium rolfsii.
Indian J. Agric. Sci., 61(4): 289-290.

Suliman-Pollatschek, S., K. Kashkush, H. Shats, and U. Lavi, 2002. Generation and
mapping of AFLP, SSRs and SNPs in Lycopersicon esculentum. Cell. Mol. Biol.
Lett., 7: 583-597.

Tanksley, S. and S. McCouch, 1997. Seed banks and molecular maps: unlocking
genetic potential from the wild. Science, 277(5329): 1063-1066.

Tanksley, S.D., N.D. Young, A.H. Paterson and M.W. Bonierbale, 1989. RFLP mapping
in plant breeding: new tools for an old science. BioTechnology, 7: 257-264.

Taubenhaus, J.J., 1919.Recent studies on Sclerotium rolfsii Sacc. J. Agr. Res., 18(3):
127-138.

Thangavelu, R. and M.M. Mustaffa, 2010. First report of corm rots disease caused by
Sclerotium rolfsii in banana. Australasian Plant Disease Notes, 5(1): 30-33.

Tigchelaar, C.E., 1986. Tomato breeding. In: Breeding for Vegetable Crops, Bassett,
M.J. (Eds.)., AVI, Westport, Conn., pp: 135-171.

United Nations Environment Programme (UNEP), 1995. 1994 Report of the methyl
bromide technical options committee. Montreal Protocol on substances that deplete
the ozone Layer. United Nations Ozone Secretariat, Nairobi, Kenya.


111









United States Department of Agriculture (USDA), 2008. Available from:
www.nass.usda.gov/Statistics_by_Subject/index.asp [Accessed May 2009].

United States Department of Agriculture, 1993. The Biological and Economic
Assessment of Methyl Bromide. Available from:
http://pmep.cce.cornell.edu/profiles/fumigant/methyl_bromide/methbrom_rsk_0193.h
tml. [Accessed May 2009].

University of Georgia. 2005. Available from
http://pubs.caes.uga.edu/caespubs/pubcd/SB41-07/SB41-07. html#Pecan [Accessed
May 2009].

Vallad, G.E., Q.M. Qin, R. Grube, R.J. Hayes and K.V. Subbarao, 2006.
Characterization of race-specific interactions among isolates of Verticillium dahlia
pathogenic on lettuce. Phytopathology, 96: 1380-1387.

VanSickle, J.J. and A. Hodges, 2008. U.S. production trends and the impact of the
Florida fresh market tomato industry to the economy of Florida. Food and resource
economics department, Florida cooperative extension service, IFAS, University of
Florida. Published September 2008. Available from http: //edis.ifas.ufl.edu.
[Accessed March 2009].

Vos, P., R. Hogers and M. Bleeker, 1995. AFLP: A new technique for DNA
fingerprinting. Nucleic Acids Research, 23(21): 4407-4414.

Wang S., C.J. Basten and Z.B. Zeng, 2010. Windows QTL Cartographer 2.5.
Department of Statistics, North Carolina State University, Raleigh, NC. Available
from http://statgen.ncsu.edu/qtlcart/WQTLCart.htm [Accessed January 2010].

Watkins, G.M., 1950. Germination of sclerotia of Sclerotium rolfsii after storage at
various relative humidity levels. Phytopathology, 40: 31.

Weber,G.F. and G.B. Ramsay, 1926.Tomato disease in Florida. Florida Agr. Exp. Sta.
Bull., 185: 61-138.

West, E., 1961. Sclerotium rolfsii, history, taxonomy, host range and distribution.
Phytopathology, 51: 108-109.

Yang, W., S.A. Miller, J.W. Scott, J.B. Jones and D.M. Francis, 2005. Mining tomato
genome sequence databases for molecular markers application to bacterial
resistance and marker assisted selection. Acta Hort., 695: 241-250.

Yang, W., X. Bai, E, Kabelka, C. Eaton, S. Kamoun, E.D.F. Van der Knaap, 2004.
Discovery of single nucleotide polymorphisms in Lycopersicon esculentum by
computer aided analysis of expressed sequence tags. Molecular Breeding, 14: 21-
24.


112









Young, N.D. and S.D. Tanksley, 1989a. RFLP analysis of the size of chromosomal
segments retained around the tm-2 locus of tomato during backcross breeding.
Theor. Appl. Genet., 77: 353-359.

Young, N.D., D. Zamir, M.W. Ganal and S.D. Tanksley, 1988. Use of isogenic lines and
simultaneous probing to identify DNA markers tightly linked to the Tm-2a gene in
tomato. Genetics, 120: 579-585.

Young, P. A., 1946. Tomato disease in Texas. Texas Agr. Exp. Sta. Circ., pp: 113.

Young, P.A., 1954. Experimental control of southern blight on tomato. Plant Dis. Reptr.,
38: 858.


113









BIOGRAPHICAL SKETCH

Mehul Samir Bhakta was born in Navsari, India. Influenced by his grandfather and

brother he decided to pursue a B.S. degree in agricultural science. He graduated from

Navsari Agricultural University earlier known as Gujarat Agricultural University in the

year 2006. Being fascinated by the advancement in genetics and the changes it could

bring to agriculture he joined Dr. Jeremy Edwards's tomato genetics and plant breeding

program at University of Florida in the year 2008 as a master's student.


114





PAGE 1

1 GENETICS OF SOUTHERN BLIGHT RESISTANCE IN TOMATO ( Solanum lycopersicum L. ) By MEHUL SAMIR BHAKTA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Mehul Samir Bhakta

PAGE 3

3 To my family, for supporting and never losing faith in me; and to all my friends along the way for without all of you this would not have been possible.

PAGE 4

4 ACKNOWLEDGMENTS I express my deep appreciation to Dr. Jeremy Edwards, esteemed chair of my advisory committee, for his persistent support, encouragement and scientific guidance during my association with him. This work would not be possible without his help and guidance. I would specially like to thank Dr. Xin Zhao and Dr. Gary Vallad the other members of my advisory committee for their immense support and creative suggestions. I would also like to express a deep sense of gratitude and sincere thanks to Dr. Ja y Scott for introducing me to Dr. Jeremy Edwards and also for his kind help and valuable suggestions, to Dr. Jeffrey A. Rollins for his assistance and suggestion for my project in Gainesville. I am also very grateful to Dr. Samuel Hutton for his guidance and support during this entire project and also for contributing valuable marker information required for this project. I pay special thanks to my lab members Timothy Davis, Ragy Ibrahem, Cathy Provenzano, Jose Diaz for their support in lab, greenhouse and field work. I would also like to thank my fellow graduate student Xie Chenzhao for her support with my inoculation work. I am deeply grateful to all my friends who filled my life with joy and happiness and made my stay at GCREC a memorable event of my li fe. I thank my family for believing in me and for their support in pursuing this degree. Above all, I thank G od for making me capable in achieving this goal.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 7 LIST OF FIGURES .......................................................................................................... 9 ABSTRACT ................................................................................................................... 10 CHAPT ER 1 INTRODUCTION .................................................................................................... 12 2 SOURCES OF GENETIC RESISTANCE IN TOMATO TO SOUTHERN BLIGHT UNDER FLORIDA CONDITION ............................................................................. 24 Introduction ............................................................................................................. 24 Materials and Methods ............................................................................................ 26 Plant Materials .................................................................................................. 26 Fungal Materials and Inoculum Preparation ..................................................... 27 Screening Study ............................................................................................... 28 Isolate Study ..................................................................................................... 29 Screening for Resistance with the GCT1 Isolate ............................................. 29 Disease Assessment ........................................................................................ 29 Statistical Analysis ............................................................................................ 30 Results .................................................................................................................... 30 Inoculation Procedure ...................................................................................... 30 Genotype Effects .............................................................................................. 31 Isolate Effects ................................................................................................... 31 Inheritance Patterns of Southern Blight Resistance ......................................... 32 Dis cussion .............................................................................................................. 32 3 IDENTIFICATION OF MOLECULAR MARKERS LINKED TO SOUTHERN BLIGHT RESISTANCE IN TOMATO ...................................................................... 43 Introduction ............................................................................................................. 43 Materials and Methods ............................................................................................ 46 Plant Materials .................................................................................................. 46 Genomic DNA Extraction from Leave s ............................................................. 47 Inoculation and Disease Evaluation ................................................................. 47 Molecular Markers and F2 Genotyping ............................................................. 48 Marker Analysis ................................................................................................ 50 Results .................................................................................................................... 51 Discussion .............................................................................................................. 52

PAGE 6

6 4 SUMMARY AND CONCLUSIONS .......................................................................... 64 APPENDIX A PEDIGREES ........................................................................................................... 69 B MOLECULAR MARKER TECHNICAL INFORMATION .......................................... 72 C ADDITIONAL MOLECULAR MARKER INFORMATION ......................................... 85 D FIELD TRIAL EXPERIMENT .................................................................................. 95 E SOUTHERN BLIGHT RESIST ANCE THROUGH GRAFTING ............................... 99 LIST OF REFERENCES ............................................................................................. 102 BIOGRAPHICAL SKETCH .......................................................................................... 114

PAGE 7

7 LIST OF TABLES Table page 2 1 Determining inoculum load for differentiating southern blight resistant (PI 126932) and susceptible (Fla. 7776) tomato line.. .............................................. 39 2 2 Two way analysis of variance based on the ranked data of southern blight disease severity on tomato line PI 126932, Fla. 7776 and 5913M caused by GCT 1, WM609 and DF/LA SR1 isolates. .......................................................... 39 2 3 Relative marginal effects with 95% confidence interval estimated based on ranked data by twoway ANOVA type statistics for the severity of southern blight on three different tomato line caused by three different S. rolfsii isolates. .............................................................................................................. 39 2 4 Statistical analysis of variance based on disease severity scores in PI 126932, Fla. 7776 and 5913M caused by GCT1 isolate. ................................. 40 2 5 Relative marginal effects with 95% confidence interval estimated based on ranked data by ANOVA type statistics for the severity of southern blight on three different tomato line caused by GCT1 isolate of S. rolfsii. ........................ 40 2 6 Segregation for resistance to southern blight in parental, F1 and F2 populations ......................................................................................................... 40 3 1 Polymorphic mark ers for Fla. 7776 and PI 126932 ............................................. 56 3 2 Detection of associated molecular markers in 354 F2 individuals for chromosome 10 & 11 and for a subset of 135 F2 plants for chromosome 4, 10 and 11 through single marker interval analysis .............................................. 60 3 3 Parents and F2 plant survival percentage as per combination of alleles ............ 61 3 4 F3 plant survival percentage as per combination of all eles ................................. 62 3 5 BC1 plant survival percentage as per combination of alleles .............................. 63 3 6 Detection of associated molecular markers in 64 B C1 individuals. ..................... 63 B 1 Technical information for markers polymorphic between Fla. 7776 and PI 126932. .............................................................................................................. 73 C 1 Marker classificati on based on polymorphism and dominance between PI 126932 and Fla. 7776. ........................................................................................ 86 C 2 Chisquare test for marker segregation distortion. .............................................. 94

PAGE 8

8 D 1 Two way analysis of variance test for determining variation in disease severity scores in tomato lines PI 126932, 5913M, 5635M, Fla. 7776, Fla. 47 and F1 (Fla. 7776 x PI 126932) in field condition. ................................................ 97 D 2 Bonferronis t test for differentiating tomato lines based on disease severity scores for GCT 1 isolate. .................................................................................... 98 E 1 Number of grafted and parental lines plants found to be res istant and susceptible under greenhouse condition. ......................................................... 101

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Southern blight symptoms on plants of parental lines. A) wilt ing symptoms on susceptible parent Fla. 7776, B) wilting symptoms on resistant parent PI126932, C) stem lesion on Fla. 7776, D) stem lesion on PI 126932. .............. 41 2 2 Frequency distribution of sout hern blight disease severity for plants of tomato line PI126392, Fla.7776, and F1 ........................................................................ 42 A 1 Pedigree of Fla. 7776. ........................................................................................ 70 A 2 Pedigree of 5913M. ............................................................................................ 71

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science GENETICS OF SOUTHERN BLIGHT RESISTANCE IN TOMATO ( Solanum lycopersicum L. ) By Mehul S. Bhakta August 2010 Chair: Jeremy D. Edwards Major: Horticultural Science s Southern blight caused by Sclerotium rolfsii Sacc. is a soil borne fungal disease of a wide range of plant species occurring throughout tropical and subtropical regions. This study aimed to evaluate the level of southern blight resistance provided by various genetic sources in tomato and also to determine if isolates of S. rolfsii differed in their virulence against tomato, so as to enable us to identify the most effective sources of resistance which could be used to identify molecular markers closely linked to loci conferring resistance to southern blight. In order to check the resistant sources and virulence level in different isolat es, two different resistant sources (PI 126932 and 5913M) and a susceptible source (Fla. 7776) were inoculated with three different isolates of S. rolfsii. The plants were inoculated at an age of eight weeks by S rolfsii grown on rye seeds. Disease severi ty was estimated by scoring individual plants on a visual scale of 04 with increasing severity, and overall survival was recorded. For identifying linked markers, a mapping population was generated from a cross between Fla. 7776 and PI 126932. The parental lines, F1 and F2 individuals, F3 families and BC1 individuals were assayed f or southern blight resistance. The s elective genotyping

PAGE 11

11 method was used to screen F2 population with 102 co dominant molecular markers distributed throughout the genome. Signific ant markers were confirmed with additional F2 individual s as well as with F3 and BC1 generations. Result s indicated that PI 126932 was resistant against all three isolates while 5913M against only two isolates (WM 609 and DF/LA SR1) Also, difference s in d isease severity among isolates were observed in line 5913M and PI 126932. This indicated that southern blight resistance in tomato could depend on the interaction between the tomato genotype and southern blight strain. The percent of surviving individuals increased from 10% in the susceptible parent (Fla. 7776) to 90% in the resistant parent (PI 126932) suggesting incomplete penetrance. Two loci, L1 on chromosome 10 and L2 on chromosome 11, were associated with the resistance to southern blight. Results indicated overdominant and epistatic effects at both loci. The i dentification of favorable alleles in both parents explained recovery of transgressive segregants among progeny derived from the cross between Fla. 7776 and PI 126932. Apart from such epistatic g enetic interactions, the locus L1 from PI 126932 provided sufficient resistance under greenhouse conditions as a dominant trai t. Result s from this study suggest that the L1 locus was an ideal source of southern blight resistance that could be introgressed into elite tomato lines through marker assisted backcrossing.

PAGE 12

12 CHAPTER 1 INTRODUCTION Tomato ( Solanum lycopersicum L.) is one of the most widely cultivated and consumed vegetable crops in the world. World production of tomato in 2008 reached 129.64 milli on metric tons, out of which 12.57 million metric tons of tomatoes were produced by the United States of America (FAOSTAT). Florida is the largest producer of fresh market tomatoes in the United States, producing 474.36 thousand metric tons in 2008 and 557.82 thousand metric tons in 2009 (USDA). The tomato industry in Florida is important to the state economy, contributing a value of more than $997 mil lion, worth $299 million in labor income (VanSickle and Hodges, 2008). However, there are many challenges being faced by this industry, such as rising production costs, reduction in farming area due to urbanization, increases in disease occurrence due to regulatory phase out of chemicals, global climatic changes etc. Southern blight of tomato is one of the soil borne diseases which could become a major problem in near future due to the phase out of the soil fumigant Methyl Bromide (an ozone depletor) (Gordon and Taylor, 1941). Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii; Corticiaeae, Basidiomycota), a soilborne fungus, is responsible for significant economic losses on a wide range of agronomic host plants. The most common hosts are the legumes, crucifers, and cucurbits. On tomato, the disease is referred to as southern blight (synonyms: stem rot, southern root rot, sclerotium blight) and is associated with warm, noncalcareous acid soil (Sherf and MacNab, 1986). The fungus is common in tropical and subtropical parts of the world and infects more than 500 species of plants in over 100 families and is a p roblem in many southeast parts of the United States (Aycock, 1966). It appears that S.

PAGE 13

13 rolfsii is mostly confined to areas where average winter temperatures are not cold enough to kill mycelia and sclerotia in the soil. Trees are found to be more resistant to this disease once they have passed their seedling stage (Freire et al. 2002; Naqvi, 2004). The first documented report of southern blight was reported by Peter Henry Rolfs in association with tomato blight in Florida in 1892 (Garren, 1959). The organism was later named as S. rolfsii and was placed in the phylum Fungi Imperfecti (Deuteromycota) by Saccardo in 1911. Aycock, 1966 in his work cited m any people who worked with a perfect stage developed in cultures of S. rolfsii from 1930 to 1941. The Basid iomycete teleomorph of S. rolfsii was first reported in 1931 (Curzi, 1931). Curzi named it Corticium rolfsii (Sacc.) Curzi since there was no known basidiomycete corresponding to the sexual stage of this fungus. In 1934 the perfect stage was first reported in the United States (Barret, 1934), followed by Mundkur (1934) on onion in India. Goto in 1935 obtained both typical and atypical isolates of S. rolfsii. Milthorpe in 1941 also observed differences in mycelia characters and in the production of sclerotia among seven single basidiospore isolates. All agreed that the perfect stage of Corticium sp;. Corticium centrifugum (Lv.) Bres. was most similar to the characteristics of the new fungus, in color and thickness for basidium structure. As a result, the nam e Corticium rolfsii (Sacc.) Curzi, proposed by Curzi was generally adopted. However a proposal that the fungus should be placed in the genus Pellicularia and named Pellicularia rolfsii (Sacc.) West was proposed by West in 1947 giving the reason that it co nformed morphologically with characteristics of the subdivision of Corticium (West, 1961).

PAGE 14

14 Extreme morphological and less marked physiological differences have been known among several S. rolfsii strains. It has been shown that isolates from a given geogr aphical area may be relatively uniform, and verifiable mutants are less frequent. Even so, singlebasidiospore cultures from one of these isolates frequently show the extreme variation of the species. In a study of the perfect stage of S. rolfsii, Lyle obt ained 306 monobasidiospore isolates from two original isolates which produced hymenia in culture (Lyle, 1953). A marked difference was noticed by Lyle in the growth type, amount of vegetative growth, sclerotial characters, mutual effects of sclerotial and asclerotial isolates, aversion and hymenial formation. These differences lead Lyle to conclude that the f ungus can be homothallic. Goto (Aycock, 1966) reported earlier that on pairing of larger numbers of monobasidiospores, several strains of varying characteristics including parental strains were obtained indicating that the basidiospore cultures were usually heterothallic. The uniformity of isolates from an area may be an expression of dominance in the dikaryon, where as the great diversity reported in vitro could be an expression of recombination and sorting out of nuclei in the sexual stage (Lyle, 1953). S. rolfsii isolates were reported to be showing distinction not only in their morphology but also in their pathological behavior (Harlton et al. 1995; Sharma et al. 2002; Shukla and Pandey, 2007; Shukla, 2008). Edson in 1923 used two isolates of S. rolfsii in their study and reported that they differed pathogenically as well as morphologically. Shukla and Pandey in 2008 tested 10 isolates and observed f our distinct pathogenicity reactions against Pa rthenium hysterophorus L. They noted that depending upon the isolate, the disease incidence in a given individual ranged from 30

PAGE 15

15 to 80 percent Finding of Shukla and Pandey supported the finding of Flores Moct ezume et al. (2006) who also reported four levels of pathogenicity in two of the isolates they tested against different species like Ricinus communis, Sesamum indicum, Tagetes erecta etc Sclerotium rolfsii is known to infect a diverse array of plants. Rol fs (West, 1961) mentioned about 15 host plants that he observed which included weeds and garden plants. Some of the hosts reported to be affected by this fungus in the U.S. includes Arachis hypogaea, Beta vulgaris, Brassica oleracea, Capsicum annum, Cucurbita spp. Citrusllus vulgaris, Daphne spp, Ficus carica, Gossyium hirsutum, Phaseolus vulgaris, Solanum tuberosum, Solanum melongena, Solanum lycopersicum, Pensiemon spp, Phlox sublata etc (Taurbenhaus, 1919). Webber, in 1931 published a list of 189 species of plants susceptible to southern blight which included 8 monocot and 42 dicot families. Many more hosts susceptible to this fungus have been reported later in the publications from many parts of the tropic and subtropic regions around the world. The lis t included host plants with high economic value along with ornamentals, forest species and weeds (West, 1961). Recently reported hosts include Phaius flavus (Bl.) Lindl. and Paphioedilum venustum (Wall.) Pfitz.ex Stein. (Bag, 2003), Dioscorea alata (Jeeva, et al ., 2005), Swietenia macrophylla and Pterocarpus santalinus (Sankaran, et al ., 2007), Ascocentrum and Ascocenda orchids in Florida (Cating, et al ., 2009), Convolvulus cneorum (Polizzi, et al 2010), Musa spp. (Thangavelu and Mustaffa, 2010). In gener al, S. rolfsii is distributed in tropical and subtropical regions where high temperature prevails during the rainy season. Based on the occurrence record from publication, the geographical distribution of this fungus was estimated by West (1961).

PAGE 16

16 He repor ted that S. rolfsii occurrence i n the southern United States was found in Florida to California. South and Central American countries where reports of the presence of S. rolfsii have been obtained include d Argentina, Brazil, Colombia, British Guiana, Trini dad, West Indies, Dominican Republic, Bermuda, Barbados, Jamaica, St. Vincent, Puerto Rico and Cuba. While publications from Italy, Germany and U.S.S.R reported presence in Europe. From Africa, reports have been obtained from Egypt, Tunis, Gold Coast, Sier ra Leone, Gambia, Belgian Congo, Uganda, Southern Rhodesia, Nyasaland, Madagascar, and Union of South Africa. A number of articles have been published from countries like India, Iran, Japan, Malaya, China, Ceylon, Formosa in Asia reporting the occurrence of S. rolfsii. Occurrence reporting articles have also been published from Philippines, Java, Sumatra, Hawaii and Australia in the Pacific area (West, 1961). The mycelium of S. rolfsii is able to grow in the temperature range of 8 to 40 oC. However, the opt imum range for growth is 30 to 35 oC. Vegetative hyphae are killed by an exposure of 24 hrs to 2 oC Sclerotial formation was greatest in the temperature range of 3035 oC (Milthorpe, 1941), whereas the optimal temperature for the germination of sclerotia ranged from 24 to 36 oSclerotia exhibit two forms of germination: hyphal and eruptive (Punja and Grogan, 1982; Punja, 1985). In hyphal germination, an individual strand grows out from the sclerotium surface. However the growth is not extensive in absence of an external nutrient source. In the case of eruptive germination, an aggregate of mycelium emerges C. Highest germination rate is obtained when the sclerotia are stored at relative humidity levels from 25% to 35% (Watkins, 1950; Punja, 1985). Povah (1927) showed that five year s old sclerotia could be induced to produce mycelia gro wth.

PAGE 17

17 from the sclerotial rind. Eruptive germination is induced by drying the sclerotia ( Smith, 1972; Punja and Grogan, 1982) or by exposing them to volatile compounds, mainly a lcohols and aldehydes (Punja, 1985). Disease symptoms on the plant are generally accelerated by favorable temperature. The period of incubation is approximately 24 days for tomato plants. An early symptom of infection is manifested by a deep brown lesion on the stem at the soil line. During infection mats of mycelium develop around the lesion on the stem base of tomato seedlings. These mats are attached to the stem by the hyphae which are appressed to the host epidermal cells. Death of the underlying parenchyma cells occurs to a depth of two to four layers before they are penetrated by hyphae (Aycock, 1966). Later the foliage droops, loses its green color and the plant never revives. Oxalic acid is considered a pathogenicity factor in Sclerotium rolfsii. O n direct application of o xalic acid on stem or either leaf tissue, the resulting injury and wilting symptoms observed were found to be similar to as caused by S. rolfsii ( Malcolm, et al ., 2005) Bateman and Beer (1965) concluded that wilting is induced as a consequence of acidifying the host tissue due to oxalic ac id. Prominent activities of polygalacturonase and cellulose were detected in infected tissue (Bateman and Beer, 1965; Bateman, 1972). A number of pathways have been proposed by which oxalic acid c ould aid infection, such as acidification to facilitate cell wall degrading enzyme activity, through tissue damage by pH or by Ca++ ions sequestration from the cell walls to form calcium oxalate (Dutton and Evans, 1996; Malcolm, et al ., 2005). Amadioha (1993) reported that oxalic acid could work synergistically with polygalacturonase during the initiation of infections. Polygalacturonase was found to be hydrolyzing calcium pectates only when

PAGE 18

18 oxalate ions were present, which indicated that polygalacturonase and oxalic acid produced by S. rolfsii acted together while disrupting the host cell wall s during infection (Bateman and Beer, 1955). Earlier work showed that sclerotia can remain viable up to 5 years (Povah, 1927; Nisikado et al ., 1938). The extensive host range and prolific growth of S. rolfsii and its ability to produce large number of sclerotia that may persist in soil for several years increases the difficulty to control the resulting diseases. Alteration of soil pH was one of the earliest strategies for controlling the diseases caused by S. rolfsii. Higgins (1923) and Rosen (1929) both suggested applying lime to increase the soil pH to around 8 for disease control. Later, Higgins (1934) found liming to be impractical due to the cost of treating enti re fields and difficulty of maintaining pH around 8. Reducing the soil pH to around 2.4 was ineffective at controlling disease (Aycock, 1966). Host nutrition was reported to influence disease resistance in a number of instances. Leach and Davey (1942) found that calcium nitrate effectively reduced severity of Southern blight. It was postulated that N fertilizers may induce anatomical or physiological resistance in the host (Mohr, 1955). Hudgins (1952) conducted an experiment that varied the composition of N, P and K in peanut and also found that higher levels of N decreased disease severity. Mohr and Watkins (1959) reported that calcium nitrate depressed disease expression. They also reported that the disease was more severe on sandy soil as compared to the clay soil. On further analysis of the soil they found that the clay soil had 10 times more calcium, and noted that application of calcium nitrate to a susceptible

PAGE 19

19 variety enable it to survive a week longer as compared to the plants fertilized with ammoni um sulfate and sodium nitrate. They concluded that nitrogen was probably not the principal element associated with resistance to S. rolfsii; rather a resistant variety may be more efficient in absorbing and utilizing calcium. Grafting resistant rootstocks to susceptible scions may be another effective strategy to control diseases caused by soil borne pathogens. Several rootstocks like Big Power, Beaufort, and Maxifort were resistant to southern blight and found to reduce disease severity when utilize d for tomato pr oduction (Rivard et al ., 2009). However, grafting increases the crop production time and also labor cost, which limit its widespread adoption. Control of southern blight by the use of biocontrol agents has also been proposed. Biocontrol agents like Trichoderma koningii protected tomato seedlings against S. rolfsii. (Latundedada, 1993). Ganesan et al. (2007) reported that the combined application of selected antagonistic Rhizobium isolates and the biocontrol agent Trichoderma harzianum conferred significant protection to Arachis hypogaea L against S. rolfsii and increased plant growth. It reduced the disease incidence by 57% as compared to the control. Although considerable control has been obtained by biocontrol agents they have not been accepted widely because of the limited performance vis vis chemical fungicides and fumigants. In addition, microorganisms used for biological control can have significant, measurable effects, both direct and indirect, on nontarget organisms. These effects include displacement of nontarget ed soil microorganisms, allergenicity to humans or animals and toxigenicity or pathogenicity to undesired organisms ( Brimner & Boland, 2004; Cook, et at, 1 996). Boyel (1952) and Garren (1959d) proposed that deep burial of organic matter to reduce

PAGE 20

20 the occurrence of southern blight. However, Young (1954) stated that deep burial will reduce crop yields for at least few years, since infertile soil is brought to the soil surface. Because of the low effectiveness of these m ethods, the management of southern blight has relied heavily on the application of chemical s and crop rotations (Leeper et al. 1992). Although crop rotation has been suggested as a control for southern blight by many, the extensive host range and survival period of sclerotia in soil has limited this cultural practice. Several fumigants have been found to be effective for the management of S. rolfsii. Chloropicrin at a rate of 100 ppm was found to be highly effective than most of the chemicals tried (Davey and Leach, 1941). Pentachloronitrobenzene (PCNB) was also found to be an effective fungicide in curbing the southern blight. Csinos, et al (1983) found that PCNB reduced southern blight incidence by 50% in peanut. However, in April 1993 PCNB was declared a hazardous air pollutant in the U.S. (Howard, 1991), also the use of Chloropicrin was restricted by the US government in June 2003 (EPA, 2007), although such restriction was withdrawn latter. Another fumigant, Methyl bromide (MeBr) gave adequate control of S. rolfsii, and this fumigant has been widely used throughout the globe to treat soil in infested beds ( Aycock, 1966; Jenkins and Averre, 1986; Brown et al. 1989). MeBr is an effective fungicide, herbicide, nematicide and insecticide and has been used commercially in United States for soil fumigation (Ragsdale and Wheeler, 1995). MeBr has been used by Floridas tomato and pepper growers well over 40 years, which has unfortunately limited the development of alternative multiple pest control tactics for m any of the soil borne pests of these crops (Chellemi, 1998). However, the

PAGE 21

21 provisions of the Montreal Protocol will eventually lead to a complete phase out of MeBr use in crop production excluding the critical use exemption. If no alternatives are available then the economics of producing certain horticultural crops in states like Florida, North Carolina, California and other southern states will be greatly affected by the ban imposed on the use of MeBr ( USDA, 1993 ; Spreen, et al. 1995; CDFA, 1996). Due to the recent MeBr phase out, Southern blight as well as other soil borne pathogens which are currently a minor problem in Florida have a high potential of becoming major production issues. This threat has created the need to develop alternative strategies for controlling southern blight in tomato. Even if a chemical replacement for MeBr is found, it is possible that it might not be economically feasible, lack the same efficacy against soil borne pathogens, or could face a similar phase out process in future. Thus, heritable resistance offers a particularly desirable long term solution to the problem of controlling southern blight. Early breeding efforts to develop resistant varieties confronted problems related to genetic variation in the pathogen, environmental effects on pathogenicity and expression of resistance in host (Mohr, 1955). Inheritance studies have shown that resistance in many species is monofactorial as compared to other species where resistance was shown to behave as a quantitative character wi th polygenic inheritance (Mohr, 1955). Such complexity underlies the challenge faced by plant breeders to develop resistant varieties that are horticulturally acceptable. For tomato, the first challenge to developing southern blight resistant varieties is to understand the nature of resistance along with its inheritance.

PAGE 22

22 Numerous studies showed that tomato species S. lycopersicum carries little or no resistance against southern blight although some tests found some variation in the degree of susceptibilit y (Fajardo and Mendoza, 1935; M ohr, 1955; Aycock, 1966 ). Mohr et al. (1947) found resistance to southern blight in a single plant introduction line of S. pimpinellifolium (PI 126932) obtained from Peru. In field screenings (Mohr, 1955), none of these plant s died from southern blight though they were grown in a heavily infested area, while disease incidence was high among susceptible varieties. Resistance in S. pimpinellifolium was proposed to be associated with the development of a ring of heavily suberized phellem cells that form a protective barrier around the stem when the plants were 6 to 9 weeks old (Mohr 1955) Southern blight infection can greatly increases on these plants if the phellem ring is somehow damaged (Jenkins and Averre, 1986). Such a ligni fied stem is not observed in S. lycopersicum PI 126932 was not found to be resistant until they were about 6 weeks old. Mohr suggested that the resistance could be associated with a barrier to fungal penetration present in the outer stem tissue of mature plants but absent in young seedlings. Beside PI 126932, six other advanced breeding lines (5635M, 5707M, 5719M, 5737M, 5876M and 5913M) were identified to be resistant to southern blight in a breeding program intended t o develop heat tolerant processing ty pe tomato cultivars. These advanced breeding lines have been released as a source of southern blight resistance from Texas A&M University (Leeper, et al. 1992) Mohr (1955) reported that southern blight resistance in S. pimpinellifolium is inherited as a dominant, monogenic trait, but suggested that further screening was required to do an accurate analysis of the mode of inheritance. If resistance is inherited

PAGE 23

23 as a single dominant gene, then the development of resistant varieties can be accelerated through the identification of molecular markers linked to the gene, allowing for marker assisted selection. Not only will the linked markers help in the rapid development of resistant lines, but they also would be of great use in pyramiding resistance alleles at multiple genes. The purpose of this study was to identify the locus imparting resistance to southern blight in S. pimpinellifolium to develop resistant lines of cultivated tomatoes. Specific objectives are 1) to develop reliable greenhouse methods to assay for southern blight resistance in tomato, 2) to confirm sources of genetic resistance in tomato, and 3) to map the genomic positions of the loci conferring resistance.

PAGE 24

24 CHAPTER 2 SOURCES OF GENETIC RESISTANCE IN TOMATO TO SOUTHERN BLIGHT UNDER FLORIDA CONDITION Introduction Southern blight of tomato ( Solanum lycopersicum L.) caused by Sclerotium rolfsii Sacc. is a soil borne disease that has the potential of becoming a major disease in Florida following the phase out of Methyl Bromide (MeBr). This diseas e can cause major loss es to tomato production in the southern United States. Georgia alone suffered a loss of $ 10.4 million in peanut crops due to southern blight with an additional $ 19.2 million spent on its control in 2004 (University of Georgia, 2005). Infection is promoted by dense planting, high soil moisture and frequent irrigation (Aycock, 1966; Sconyers et al. 2005). In tomato this fungus can infect all portions of the plant touching the soil, and sclerotia provide the primary inoculum for epidemic s (Ristaino et al. 1991; Liua et al. 2008). Symptoms on tomato initiate with the decay of the cortex at the base of the stem several centimeters above and below the soil surface ( Aycock, 1966), followed by the growth of a white mat of mycelia on the stem Later sclerotia are produced ranging from 12 mm in diameter, and tan to brown in color depending upon the strain. Infection causes partial or complete girdling of the stem near the soil line resulting in the dampingoff of seedlings while more mature plants develop a progress ive wilt that begins with the lower leaves and eventually leads to plant death. Root infection can follow stem or crown invasion sometimes causing death of the tap root. Sclerotia can be found on fibrous roots about 24 inches deep ( Aycock, 1966).Fruits touching infected stem or soil can also get infected. The infection site appears sunken at first and the epidermis may be ruptured by the time the lesion is 2 cm in diameter (Weber and Ramsay, 1926; Young, 1946; Aycock, 1966). Fruits can rot

PAGE 25

25 in 3 to 4 days under ideal temperature and moisture ( McColloch et al. 1968; Jones et al. 1991). Several methods have been proposed to control this disease, but none has proven highly effective. The best possible control obtained was with the use of Methyl Bromide, a soil fumigant. This chemical was ranked as one of the five most used pesticides in the United States (UNEP, 1995). However, MeBr is photodecomposed in the atmosphere by photons to release elemental bromine, which is highly destructiv e for the stratospheric ozone layer (Gordon and Taylor, 1941). Therefore, MeBr was designated as a class I ozone depleter and its use was phased out in United States by 2005 except for the critical use exempti on under The Clean Air Act of 1990. Since no ot her chemical or cultural methods are available to control this disease as effectively as fumigation with MeBr the best possible option is inherited host resistance. Isolates of S. rolfsii have shown significant variations in their pathological behavior (H arlton et al. 1995; Sharma et al. 2002; Shukla and Pandey, 2007). In a study involving two isolates of S. rolfsii in 1923, Edson found that both differed not only morphologically but also with respect to their virulence towards potato. Flores Moctezume e t al. (2006) reported four levels of virulence reactions in two of the isolates they tested against different plant species like Ricinus communis, Sesamum indicum, Tagetes erecta etc. Their results w ere supported by Shukla and Pandey ( 2008) who tested 10 i solates and also observed four distinct pathogenicity reactions against Pa rthenium hysterophorus They noted that depending upon the isolate, the disease incidence in a given individual plant ranged from 30 to 80 percent

PAGE 26

26 Along with differences in virulen ce among isolates of S. rolfsii, variation has been observed with respect to plant resistance and the mode of inheritance in different species. Mohr (1955) reported that the resistance in S. pimpinellifolium was controlled by a single, dominant gene. Whereas, in Capsicum annuum L. resistance was inherited as a single recessive gene (Fery and Dukes, 2005). I n alfalfa, resistance against S. rolfsii was quantitative (Inami and Suzuki, 1981; Inami et al 1986; Pratt and Rowe, 2002). The only documented sources of resistance to southern blight in tomato are selections from wild Peruvian accessions PI 126932 and PI 126432 of S. pimpinellifolium Mill and 6 breeding lines (5635M, 5707M, 5719M, 5737M, 5876M and 5913M) released from Texas A&M University each containing S. pimpinellifolium in their pedigree (Leeper et al. 1992). S. pimpinellifolium has proved to be a fertile source of resistant germplasm and hybridizes readily to S. lycopersicum (Muller, 19 40) Introducing resistance to southern blight into cultivate d tomato cultivars would provide a cost effective a nd an environmentally safe method for managing this disease. The objectives of this study were to assess the level of resistance provided by two genetic sources of resistance in tomato, and determine the inheritance of resistance Results will help identify the most effective sources of resistance to incorporate into a breeding program and for genetic mapping, and will also establish disease assays for subsequent breeding and genetic studies. Materials and Methods Plant M aterial s Fla. 7776 ( Solanum lycopersicum ), a southern blight susceptible cultivar was obtained from the University of Florida, Gulf Coast Research and Education Center

PAGE 27

27 (GCREC), Balm FL. While the resistant wild Peruvian accession of S. pimpinellifolium PI 126932 was obtained from the USDA ARS, National Genetic Resources Program (Geneva, New York) A n advanced breeding line, i.e., 5913M was obtained from Texas A&M University. Seedlings of these lines were raised in 128well styro foam S p e edling trays (3.8 cm3 cell size ) in the greenhouse filled with sterilized peat lite mix (Speedling Inc. Sun City, FL) in Fall 2008. The plants were fertilized with compound fertilizer 202020 ( N P2O5 K2O) at an interval of 5 days After 4 weeks, s eedlings were transplanted into four inch diameter pots and maintained in the greenhouse for the duration of the experiment Controlled pollination was carried out to hybridize Fla. 7776 (recipient parent) and PI 126932 in a greenhouse to generate F1 progeny F2 seeds were produced and mass harvested by self pollination of F1 plants in the greenhouse. A BC1 population was obtained by backcrossing F1Fungal Material s and Inoculum Preparation with the recurrent parent Fla. 7776 in the greenhouse. Three different isolates of Sclerotium rolfsii were used in this study. A strain of S. rolfsii (GCT 1) was isolated from an infected tomato plant at GCREC, Balm. Strain WM 609 was isolate d from peanut in Georgia ( Dr. Tim Brenneman, University of Georgia), and a strain recovered from sweet potato (DF/LA SR1) was obtained from Louisiana (Louisiana State University ). Sclerotia from each isolates were submerged into 0.5 % sodium hypochlorite (NaOCl) solution for 5 min to sterilize the outer rind (Linderman and Gilbert, 1972). A single, surface sterilized sclerotium was transferred to a petri dish containing potato dextrose agar (PDA) incubated at 25 oC to initiate cultures

PAGE 28

28 For inoculum preparation, a pproximately 200 g of rye seeds were washed with water in a 1 L Erlenme yer flask and then immersed in 300 ml of water. The flask mouth was covered with 4 layer s of cheese cloth followed by a layer of aluminum foil and w as left overnight so that the seeds could absorb the water. The flasks containing rye seeds were autoclaved at 121 oC for 15 min; this process was repeated for two consecutive days to ensure complete sterilization (Phatak and Bell, 1983). Sterilized rye seeds were then inoculated with approximately ten 9 mm PDA plugs containing both mycelium and mature brown scl erotia. The Erlenmeyer flask cultures were incubated at 25 oScreening Study C under 12 hr light and dark period for 34 weeks. The flasks were shaken thoroughly for the first seven days and then periodically as needed until the inoculum was used. In order to find the inoculum load required for disease assays, five different inoculum treatments were tested using S. rolfsii strain GCT 1 in spring 2009. Eight week old plants of PI 126932 and Fla. 7776 in 4 inch wide pots were used in this study. T reatments consisted of 1) 1 g of inoculated rye seeds, 2) 1 g of inoculated rye seeds treated with 0.5% methanol spray, 3) 2 g of inoculated rye seeds, 4) 2 g of inoculated rye seeds treated with methanol and 5) 2 g noninoculated rye seeds with methanol spray. Meth anol was used to induce eruptive germination (Punja, 1985) in sclerotia in order to reduce the infection time. Each treatment was replicated 4 times with 6 plants in each replication and arranged in a randomized complete block design. For each of the treat ments, the rye seeds w ere placed in contact with the host stem, on the soil surface and covered with 1cm of soil. The soil was kept constantly moist by frequent irrigation and the temperature was kept around 30 oC. Plants were rated as dead or alive at the end of 4th week after inoculation.

PAGE 29

29 Isolate Study The trial w as conducted using 44 plants each of PI 126932, Florida 7776 and 5913M which were sown in 128well Styrofoam Speedling trays (3.8 cm3 cell size) containing peat lite mix (Speedling Inc. Sun C ity, FL). The seedlings were grown to an age of 4 weeks transplanted into 4 inch wide pots and placed in the greenhouse. At 8 weeks after sowing, the plants were inoculated with isolate GCT1, WM 609 and DF/LA SR1 by dispersing 2 g of colonized rye seeds on the soil surface close to the stem base. The temperature in the greenhouse was maintained in the range of 27 to 32 oScreening for Resistance with the GCT1 Isolate C and with soil moisture close to 5070%. The trial was repeated once. Plants of PI 126932, Florida 7776, F1, F2 and BC1 were evaluated for response to S. rolfsii in a greenhouse study arranged in randomized complete block design. Fifty seeds of each parent line, F1, and BC1 as well as 96 seeds of F2 were sown in the speedling trays in fall 2009. Eight week old plants were grown and inoculated with S. rolfsii isolate GCT1 as described earlier. Trial was also conducted to screen 4 week old seedlings, using 48 PI 126932 and Fla. 7776 seedlings inoculated in a growth room maintained at 28 oDisease Assessment C with 80% relative humidity. Seedlings grown in the greenhouse were examined every 2 day s after inoculation for symptoms of wilting and for stem lesions. Disease severity was estimated by scoring individual plant on a visual scale of 04 for wilting with increasing severity: 0 = no wilting symptoms with initiation of stem lesion 0.5 = initiation of wilting, 1 = 12.5% of total leaf area showing wilting symptoms, 1.5 = 12.5 25% wilted leaf area, 2 = 25% 37.5% wilted leaf area, 2.5 = 37.5% 50% wilted leaf area, 3 = 50% 75% wilting, 3. 5 = >75%

PAGE 30

30 wilting with lodged plant 4 = Dead plant Plants were rated 21 day s after inoculation. Plants rated with a score of 2.5 or below w ere considered resistant plants as these plants were able to recov er from the infection. While the plants with a score greater than 2.5 were considered to be susceptible since they were unable to recover and eventually died. A p lant was considered to be an escape if no lesion or evidence of infection was noted on its stem Plants rated as escapes were excluded from the study Statistical Analysis For statistical analysis, data obtained from the isolate study were p ooled across both trials. D isease severity based on genotypes and isolates were analyzed using a two way anal ysis of variance of ranked data using the PROC Mixed procedure in SAS (version 9 .2 ; SAS Institute Inc., Cary, N orth C arolina) to generate relative marginal effects (RME), and 95% confidence intervals as described by Brunner et al ( 2002); Shah and Madden ( 2004); Vallad et al (2006). Interaction s between tomato genotype, S. rolfsii isolate and trial s were also tested. A o neway analysis of variance was used to test for tomato genotype effect on disease severity scores caused by the isolate GCT 1. RME and 95% confidence intervals were generated as mentioned earlier for testing sig nificant difference between disease score in tomato genotypes for GCT 1 isolate. Chisquare test was us ed to test for single gene model Results Inoculation Procedure Only wilting s cores were used to identify resistant plants as stem lesions were found on both Fla. 7776 and PI 126932. The most effective treatment found to distinguish the resistance and susceptible plants was 2 g of inoculated rye seed per plant (Fig 21) in which mo re than 90 percent of susceptible plants died, while all of the

PAGE 31

31 resistant plants were able to survive (Table 21). Inoculation of 4 week old PI 126932 and Fla. 7776 resulted in the death of all plants. Genotype Effects Although PI 126932 exhibited severe s tem lesions after inoculation with S. rolfsii isolate GCT1 only mild to moderate wilting symptoms developed under the conditions of this study. Twenty days after inoculation, the susceptible inbred Fla.7776 developed severe stem lesion and wilting that l ed to plant collapse and death (Fig 21). No significant difference was obtained between the two trials ( P value = 0.39). Also no interaction was found between tomato genotype x trial ( P value = 0.74), isolate x trial ( P value = 0.81), isolate x genotype x trial ( P value = 0.82). Significant difference was obtained between all the three genotype tested (Table 2 2 and 23 ). PI 126932 and Fla.7776 differed significantly in their mean dis ease severity score (Table 24 and 25 ) following inoculation with S. rol fsii isolate GCT 1 However, the difference in mean disease severity between 5913M and Fla.7776 against GCT1 isolate was not significant (Table 25 ). A statistical difference in disease severity between the two resistance sources was also observed (Table 2 5 ). Isolate Effects Disease severity scores were found to be affected by the isolate used for the inoculation. For the breeding line 5913M a significant difference in the mean disease severity ranking was observed between peanut isolate (WM 609) and the tomato isolate (GCT 1) ( Table 23 ). 5913M plants were killed by GCT1, while they were able to survive against WM 609. For PI 126932, a significant difference was also observed in disease severity among various isolates (Table 23 ) For Fla. 7776, no significant isolate effect was observed. Such a variable response for 5913M and PI 126932 indicates that

PAGE 32

32 the isolates differ in aggressiveness against specific tomato line. Significant interaction between tomato genotypes and isolates was also found (Table 2. 3). Inheritance Patterns of Southern Blight Resistance Screening of the different generations of PI 126932 and Fla. 7776 with the GCT1 isolate was carried out to understand the inheritance pattern (Fig 22 ) Out of the inoculated 50 plants of parent lines seven of the PI 126932 plants died, and about six of the Fla.7776 plants were able to survive although they showed severe stem lesions. The F2 progeny segregated in an approximate ratio of 1:3 [resistant (R): susceptible (S)] (Tabl e 26, Fig 22 ) The se gregation ratio in the F2 population failed to fit the distribution expected for a single gene with dominant effect ( 2 = 64) based on Chisquare analysis ; even when the expected segregation ratio was adjusted for the level of penetrance observed in both parents and heterozygous F1 hybrids Ratio also failed to fit the distribution expected for single recessive gene ( 2 = 8.7) when expected ratio was adjusted for penetrance level. F ew of the surviving F2Discussion plants had a disease rating below 1 which was lower t han mean disease score for the resistant parent PI 126932. Using resistant varieties is an ideal approach for plant disease management R esistant sources against southern blight have been identified in many hosts in a number of countries (Mohr, 1955; Sugha et al. 1991; Besler et al. 1997) but no stable resistance has been achieved due to the occurrence of aggressive isolates of S. rolfsii (Sharma and Jodha, 1984). W e found that all three nonsegregating populations i.e., the resistant parent PI 1 2 6932, the susceptible parent Fla. 7776 and the F1 displayed a

PAGE 33

33 range of susceptibility to S. rolfsii across indi viduals. This result was not unexpected based on earlier works. Aycock (1966) suggested that it is a characteristic that all plants even in a uniformly infested area do not become infected. Numerous published references to the irregular distribution of southern blight in the field were cited by Aycock (1966) Similar observations of irregularly distributed disease were also made by Fery and Dukes ( 2005) i n pepper. They noted such variable reaction in most of the pepper cultigens evaluated in field trials which they conducted over multiple years. In their opinion such variable reactions to S. rolfsii observed in their parental and F15913M was found to be susceptible against GCT1 but not against remaining isolates which suggests that 5913M is not a reliable resistance source for multiple isolates. Prior studies found that isolates from the same geographical location could be host specific or exhibit a narrower host range ( Cilliers et al. 2000) Punja and Sun (1997) compared 128 isolates of S. rolfsii from 36 host spec ies and 23 geographic regions by means of random amplified polymorphic DNA (RAPD) polymerase chain reaction and found that many isolates from the same host belong ed to the same mycelial compatibility group (MCG). The isolates used in the current study were found to fall into three different MCG groups (Xie Chenzhao and Gary Vallad, personal communication) and each was collected from different host species and different populations were not due to genetically heterogeneous plant material, but due to a complex environmental interaction. In this study complex environment interaction may have pla yed an important role ; however the possibility that the resistant plant introduction line w as not completely fixed for resistance cannot be completely ruled out and would require additional test ing to verify

PAGE 34

34 geographical location (peanut Georgia, tomato Florida and sweet potatoLouisiana). Differ ent MCG groups suggest that there is genetic variation among the isolates ( Cilliers et al. 2000) and could probably explain the variation in the disease severity score obtained in this study S. rolfsii isolates from groundnut (peanut) fields in Texas wer e studied by Nalim, et al., ( 1995) and based on DNA amplification pattern they found that the isolates which belonged to the same MCG were clonal, which was supported by the similarities in morphology and host specificity of the isolates they studied. This study included only three MCG s with one isolate in each group. To get a better understanding of difference in virulence among isolates a thorough study needs to be carried out involving multiple MCGs with multiple isolates in each MCG testing for pathogenicity on specific host plants Based upon the variability in response of 5913M to different isolates of S. rolfsii, it is possible that the resistance conferred by this advanced breeding line isolate specific Such a differential response to S. rolfsii i solates suggests that resistance breeding needs to be based on the isolates present in the targeted geographical location. On the contrary, PI126932 was found to be resistant against all three isolates tested. It is likely that the level of resistance found in PI 126932 is enough to overcome the attack of different isolates and this line could potentially be used as a source of resistance to southern blight in different geographical locations with diverse isolates of S. rolfsii. However, trials including more variable isolates are warranted to confirm this assumption. Another possibility is that the resistance to southern blight could be controlled by multiple loci, with resistance to various isolates governed by different genes. This could

PAGE 35

35 explain why 5913M was found to be resistance to only two isolates while PI 126932 was resistant to all three isolates. Out of all the F1 plants tested, 75% were able to survive indicating that the resistance could be dominant however looking at the frequency distribution it seems that some of the F1 plants were more resistant than PI 126932 while some of them were behaving more like PI 126932. Such two peaks in frequency distribution could not be completely explained by a single gene model. Also, frequency distribution of F2 was found to be skewed towards left indicating that resistance is recessive, which is opposite of that seen in F1 population. This variation suggests that the disease is not conditioned by a single recessive or dominant gene and could in fact be governed by more complex genetics which could not be fully explained by this study, since only a few F3 families were tested and a backcross of the F1 to a donor parent was not tested in this study. Other possibil ities also exist that could be responsible f or su ch results for example, compromised resistance in F1 plants due to excess inoculum load (appendix D) less accurate disease rating scale, or unfit plants In the F1 However, variation in the aggressiveness of S. rolfsii isolates along with variation in the inheritance pattern in crosses involving different resistant and susceptible sour ces could explain the deviation of the current results from the monofactorial model proposed by Mohr (1955) Earlier research showed that along with the variation in the pathogenicity among the isolates, variation also existed with respect to the mode of i nheritance in different species. In Capsicum annuum L. the mode of resistance was plants, more individuals had a lower disease score as compared to the resistant parent PI 126932, which could potentially be a heterotic effect of the interspecific cross

PAGE 36

36 found to be inherited as a single recessive gene (Fery and Dukes, 2005). While it was found to be quantitative in alfalfa (Inami and Suzuki, 1981; Inami et al 1986; Pratt a nd Rowe, 2002). Such kind of variable mode of inheritance has also been reported for resistance to early blight of tomato caused by the fungus Alternaria solani Sorauer. The inheritance of resistance to e arly bright was reported to be quantitative and rece ssive in some lines (Barksdale and Stoner, 1977) but partially dominant, with epistasis in others ( Nash and Gardner, 1988a). Such variation in the parental lines and fungal isolates could give rise to dissimilarity in the observed inheritance pattern. The appearance of susceptible plants in PI 126932 and the F1 could be due to incomplete penetrance. Incomplete penetrance can also perhaps explain the variation observed in the F3 generation by Mohr (1955) and also in the inheritance study of resistance to southern blight in pepper conducted by Fery and Dukes, 2005. The incomplete penetrance effect in the resistance against tomato yellow leaf curl virus derived from S. pimpinellifolium was reported by other authors in various studies involving different acces sions belonging to this species (Hassan, 1984; Prez de Castro, 2007) indicating that the incomplete penetrance effect showed by the genes derived from accession of S. pimpinellifolium is not rather surprising. Also complex ity in the genetics has also been reported for the resistances which have been derived from different lines of S. pimpinellifolium species (Kasrawi and Mansour, 1994; Hassan, and Abdel Ati, 1999; Prez de Castro, 2007). Incomplete penetrance has also been reported for Fusarium oxysporum f .sp. lycopersici in tomato (Retig et al. 1967; Alon et al. 1974) and for tomato spotted wilt virus in tomato (Salvador Rosell, 1998). It is quite possible that the resistant plants in Fla. 7776 could be just escapes rather than due to

PAGE 37

37 incomplete penetrance effect of the genes involved. Also, susceptible plants in PI 126932 and the F1 could be from excess inoculum load, due to variation in the colonization of the rye seeds by the fungus. Based on this study it would be hard to clearly justify whether such results are due to incomplete penetrance or merely due to escapes. However, incomplete penetrance could be confirmed by conducting a progeny test in F3 An attempt t o screen younger (4 week old) seedlings of both PI 126932 and Fla. 7776 resulted in death of all the plants confirming the results of Mohr and Watkins (1959) that resistance in PI 126932 is not effective until plants are six weeks or older. This showed that resistance in PI 126932 is associated with physi ological maturity of the plants. I t was also found that the resistance was affected by environmental conditions (appendix D) Moreover from this study it seems that the resistance could be controlled by m ore than one gene indicating that the resistance could have multifactorial inheritance. Such confounding factors together with the complex genetic nature of the resistance could be a reason to the limited success achieved in breeding for southern blight re sistance using traditional breeding approaches. Thus, new strategies are needed for the identification and effective transfer of genes for southern blight in tomato. families and also by inoculating near isogenic lines carrying genes conferring resistance. The use of molecular marker s to assist with plant selection is an alternative approach that could be adopted instead of conventional breeding while dealing with complex traits such as southern blight. The c hromosomal position of gene(s) or quantitative trait loci controlling such complex traits can be determined by using molecular markers. The use of m olecular markers can also facilitate an understanding

PAGE 38

38 of the interaction between genes controlling the same trait. Once molecular markers linked to the gene(s) of interest are identified, they can be used to transfer the desired gene(s) into commercial varieties in less time as compared to conventional breeding ( Sleper and Poehlman, 2006) The efficiency of developing superior tomato varieties with resistance to southern blight could be increased through marker assisted breeding.

PAGE 39

39 Table 21. Dete rmining inoculum load for differentiating southern blight resistant (PI 126932) and susceptible (Fla. 7776) tomato line Plants were inoculated at an age of 8 weeks after sowing. Rye seeds colonized with GCT1 isolate of S. rolfsii were used to inoculate t he plants. Treatment PI 126932 Fla. 7776 Alive Dead Alive Dead C ontrol 24 x 0 24 0 1g y 23 1 8 16 1g y + met 24 z 0 8 16 2g 24 y 0 2 22 2g y 18 + met 6 0 24 x Control treatment included 2 g noninoculated rye seeds + 0.5% methanol spray y S. rolfsii (GCT 1) inoculated rye seeds. z 0.5% Methanol spray. Table 22 Two way analysis of variance based on the ranked data of southern blight disease severity on tomato line PI 126932, Fla. 7776 and 5913M caused by GCT 1, WM609 and DF/LA SR1 isolate s. Data combined across two independent experiments. Effect d f d f x F value y P value Tomato 1.95 171 53.26 < 0.001 Isolate 1.96 171 17.19 < 0.001 Tomato x Isolate 3.81 5.68 < 0.001 x Numerator degrees of freedom. y Denominator degrees of freedom. Table 23 Relative marginal effects with 95% confidence interval estimated based on ranked data by twoway ANOVA type statistics for the severity of southern blight on thr ee different tomato line caused by three different S. rolfsii isolates. Tomato line Isolate x Median Mean Ranking z RME y Fla. 7776 GCT 1 4 .0 150 0.75 0.072 WM609 4 .0 138 0.69 0.083 DF/LA SR1 4 .0 140 0.7 0 0.094 5913M GCT 1 3.5 127 0.64 0.09 0 WM609 1 .0 39 0.19 0.086 DF/LA SR1 2 .0 84 0.41 0.095 PI 126932 GCT 1 2 .0 80 0.4 0 0.06 0 WM609 1.5 53 0.26 0.062 DF/LA SR1 2 .0 84 0.42 0.084 x Data pooled for two independent experiments. y Relative Marginal Effect with 95% c onfidence interval z Score higher than 2.5 indicate s susceptibility to specific S rolfsii isolate

PAGE 40

40 Table 24 Statistical analysis of variance based on disease severity scores in PI 126932, Fla. 7776 and 5913M caused by GCT1 isolate. Data combined acr oss two experiments Effect df F Value P Value Tomato line s 2 20.19 < 0.01 Error 63 Table 25 Relative marginal effects with 95% confidence interval estimated based on ranked data by ANOVA type statistics for the severity of southern blight on thr ee different tomato line caused by GCT 1 isolate of S. rolfsii. Tomato line Isolate x Median Mean Ranking z RME y Fla. 7776 GCT 1 4 .0 46 0. 68 0.072 5913M 3.5 37 0. 55 0.083 PI 126932 2 .0 18 0. 26 0.0 60 x Data pooled for two independent experiments. y Relative Marginal Effect with 95% confidence interval z Score higher than 2.5 indicate s susceptibility to specific S rolfsii isolate Table 2 6 Segregation for resistance to southern blight in parental, F1 and F2 populations Observed Expecte d E xpected Population R S v R w S ratio P value 2 PI 126932 46 4 50 0 Fla 7776 6 44 0 50 F 38 1 12 50 0 F 22 2 74 24 72 1:3 0.22 x 0.63 60 36 1.6:1 64 y <0.01 36 60 1:1.6 8.7 z <0.01 v Number of resistant plant ( wilting index 2.5). w Number of susceptible plant ( wilting index > 2.5). x Ratio for single recessive gene. y S ingle dominant gene ratio adjusted for incomplete penetrance. z S ingle recessive gene ratio adjusted for incomplete penetrance.

PAGE 41

41 A B C D Fi gure 21 Southern blight symptoms on plants of parent al lines. A) wilting symptoms on susceptible parent Fla. 7776, B) wilting symptoms on resistant parent PI126932, C) stem lesion on Fla 7776, D) stem lesion on PI 126932.

PAGE 42

42 Figure 22 Frequency distribution of southern blight disease severity for plants of tomato line PI126392, Fla.7776, and F1 0 = no wilting symptoms with initiation of stem lesion, 0.5 = initiation of wilting, 1 = 12.5% of total leaf area showing wilting symptoms, 1.5= 12.5 25% wilting 2= 25% 37.5% wilting 2.5 = 37.5% 50% wilting 3 = 50% 75% wilting, 3.5 = >75% wilting with lodge d plan t 4 = Dead plant Rating >2.5 suggest susceptible plants.

PAGE 43

43 CHAPTER 3 I DENTIFICATION OF MOL ECULAR MARKERS LINKED TO SO UTHERN BLIGHT RESISTANCE IN TOMATO Introduction Southern blight of tomato ( Solanum lycopersicum) is caused by Sclerotium rolfsii Sacc. (Sherf and MacNab, 1986). Economic losses caused by this disease to the tomato industry in Florida could increase in the near future due to the loss of Methyl Bromide as a soil fumigant and a lack of satisfactory alternative control methods. Host resistance is an economical, environmentally safe, and efficient means to control disease. Mohr (1955) searched for southern bligh t resistan ce in a screen of several varieties of Solanum lycopersicum as well as a number of lines from the wild relative Solanum pimpinellifolium and Solanum peruvianum. Out of the 30 lines tested, Mohr categorized a single line from Solanum pimpinellifol ium accession as resistant against southern blight. The line came fr om Pampa de Matacabilles, Peru, and was introduced by the Plant Introduction Service of the U.S. Department of Agriculture as PI 126932. In order to verif y that PI 126932 is in fact a suit able genetic source for resistance against southern blight in tomato, studies were carried out at the University of Florida, IFAS, Gulf Coast Research and Education Center, Wimauma, FL In this study the PI 126932 was inoculated with three different strains of S. rolfsii and results were compared with a susceptible inbred line Fla. 7776. It was found that PI 126932 was resistant against all three S. rolfsii strains tested. Based on the result s it was confirmed that PI 126932 was a good source for deriving genetic resistance against southern blight in tomato, similar to previous studies (Mohr, 1955) Along with PI 126932, other reported sources for southern blight resistance were six breeding lines (5635M, 5707M, 5719M, 5737M, 5876M and 5913M) rel eased from

PAGE 44

44 T exas A&M University containing S. pimpinellifolium in their pedigree (Leeper et al. 1992). Breeding line 5913M was tested along with PI 126932 and Fla. 7776 against the three isolates. 5913M was found to be susceptible to a field isolate obtained from Fl orida (GCREC), but resistant against two isolates obtained from Georgia and Louisiana. This suggested that the resistant breeding lines from Texas A&M may not be a reliable source of resistance to S. rolfsii isolates from Florida. Because the resistance s ource PI 126932 is a wild species, the most effective way of transferring resistance to cultivated tomato lines is through backcrossing. One advantage of S. pimpinellifolium being the source is that the transfer of resistance from S. pimpinellifolium to S lycopersicum is rather straightforward through conventional breeding since both species are closely related and hybridize easily (Rick, 1958). Backcrossing has long been a valuable strategy in plant breeding for a number of crops. Backcrossing is a type of recurrent hybridization in which the main aim is to substitute a desirable allele(s) for the trait of interest in a desirable cultivar without losing or changing the existing genetic background of the that cultivar except for the substitution of desired allele(s). Semagn et al .(2004) pointed out that normally during backcross breeding it is expected that the genome of recurrent parent will be recovered at a rate of 1(1/2)t+1, for t generations of backcrossing. Thus with the completion of the fourth b ackcrossed generation we expect to have recovered 96.87% of the recurrent parent s genome. However, in actual practice, this theoretical percentage value is hardly achieved especially when dealing with polygenic trait. One reason for recovering less than t he theoretical percentage is linkage drag, which refers to the reduction of fitness in a

PAGE 45

45 recurrent parent due to introduction of deleterious genes along with the beneficial gene during backcrossing (Semagn et al. 2006) Young et al. (1988) suggested that based on linkage distance the unwanted DNA segment can be removed through additional backcrossing, but to achieve significant progress, many generations are required. Molecular markers offer a tool by which the amount of donor genome transferred can be controlled during each backcross generation. Use of marker assisted breeding techniques can speed up recovery of the recurrent parents genome and thereby improve efficiency of transferring gene(s) from the donor parent. Markers can aid in minimizing the link age drag associated with the target gene, and reduce the number of generations required to recover a high percentage of the recurrent parent genotype. Chahal and Gosal (2002) suggested that applying a molecular marker assisted techniques to a backcross breeding program could reduce linkage drag by at least tenfold in a fraction of the time required in traditional backcross breeding. This technology can also help to gain better knowledge about the genetics of southern blight resistance in tomato, which will help in transferring resistance into desired line. Earlier study showed t hat the plants were not fully resistant till the age of six to eight weeks and was greatly influenced by environmental condition s (Mohr 1955). Along with this, our study regarding the inheritance of southern blight resistance in tomato showed that resista nce was probably conferred by more than one gene indicating multifactorial inheritance. Such influencing factors together with the complex genetic of the resistance could greatly affect the selection in a traditional breeding approach. Molecular markers an d marker assisted selection technology is an alternative

PAGE 46

46 system which could help to validat e and effective ly transfer genes conferring southern blight resistance to tomato. However in order to utilize the benefit obtained from marker assisted selection one requires quality marker s that are closely linked to the trait of interest. PI 126932 is a convenient resistant source for identifying associated markers since many polymorphic markers have already been reported by Hutton (2008) between PI 126932 and Fla. 7776. The primary objective of this study was to identify PCRbased molecular markers linked to loci conferring resistance to southern blight Materials and Methods Plant Materials Seeds for the resistant accession PI 126932 and a susceptible inbred line Fla. 7776 were grown and crosses were made between them in fall 2008 under greenhouse conditions with Fla. 7776 serving as a recipient parent Subsequently an F2 population was generated by self pollination of F1 generation in spring 2009. In the spring o f 2009 backcrossing was carried out to obtain the BC1In order to study the response of PI 126932, Florida 7776, F generation. 1, F2 and BC1 to southern blight, 50 seeds of PI 126932, Florida 7776, F1, and BC1 as well as 96 seeds of F2 were sown in 128wells styrofoam Speedling trays (3.8 cm3 cell size) containing peat lite mix (Speedling Inc. Sun City, FL) in fall 2009. The plants were fertilized wit h compound fertilizer 202020 (N P2O5K2O) at an interval of 5 days After four weeks, seedlings were transplanted into four inch diameter pots and maintained in the greenhouse for the duration of the experiment. A complete randomized block design was selected for this study

PAGE 47

47 For the marker study in the F2 population, t hree groups containing two batches of 96 F2 seeds and 12 seeds of both the parents were sown in the speedling trays with an interval of three weeks in June 2009. All three groups were transplanted and grown as mentioned earlier. All the groups were inoculated at an age of 8 week s. Progeny of F2Genomic DNA Extraction from Leaves selections were evaluated in subsequent experiments. Genomic DNA was extracted buy using a protocol described by Fulton (1995) with following modifications. About 34 new leaflets of about 1.5 cm size were collected in 1.2 mL library tubes (VWR, West Chester, Pennsylvania) and frozen at 80 oC. The frozen leaflets were homogenized using a Talboys high throughput homogenizer (Henry Troemner LLC, Thorofare, New Jersey). DNA was extracted from the frozen leaf tissue by in cu bating each sample with 166 L of DNA extraction buffer (0.35 M sorbitol, 0.1 M tris base, 5 mM EDTA, pH 7.5,1.3mg sodium bisulfate ), 166 L of nuclei lysis buffer (0.2 M tris, 0.05 M ED TA, 2 M NaCl, 2% CTAB), and 66 L of sarkosyl (5%w/v) at 65 oC follow ed by a chloroform : isoamyl alcohol (24:1,v:v ) extraction and a final nucleic acid precipitation with ice cold isopropanol. DNA was pelleted by centrifugation at 4000 rpm for 15 min and rinsed with 70% ethanol. After air drying samples overnight the DNA was re suspended in 100 L nuclease free water and stored at 20 oInoculation and Disease Evaluation C. Each sample yielded 300 600 ng/L of DNA. Th e DNA was diluted down to 20 ng/ L for molecular marker study. The Sclerotium rolfsii isolate GCT 1 used in this study was obtained from naturally infected tomato fields at GCREC, Balm. The fungus was maintained on PDA plate at 25 oC. For inoculum preparation 200 g of rye seeds were sterilized in 1000 ml Erlenmeyer

PAGE 48

48 flask with 300 ml water and inoculated with approximately ten 9 mm PDA plugs containing both mycelium and mature brown sclerotia. The rye seed cultures were incubated at room temperature (2 5 30 oThe 8 weeks old plants were inoculated by spreading 2 g of colonized rye seeds on the soil surface close to the base of the tomato plant After 48 hr the inoculated pots were examined to visually confirm the emergence of mycelial growth from the colonized rye seeds. The pots not showing any sign of mycelial growth were reinoculated. D isease progress was recorded for individual plants every alternate day after inoculation, using a visual scale of 04 with incr easing severity: 0 = no wilting symptoms with initiation of stem lesion 0.5 = initiation of wilting, 1 = 12.5% wilting of t otal leaf area, 1.5 = 12.5 25% wilted leaf area, 2 = 25% 37.5% wilting, 2.5 = 37.5% 50% wilting, 3 = 50% 75% wilting, 3.5 = >75% wilting and stem collapse, 4 = Dead plant. Plant with no clear sign of stem lesions was considered as an escape and was ex cluded from the study. C ) for a period of 34 week s. Molecular Markers and F2To detect polymorphisms between PI 126932 and FL. 7776 about 252 PCR based DNA markers spanning the tomato genome were screened. Out of this, 115 markers had been earlier reported to be polymorphic among PI 126932 and FL.7776 (Hutton, 2009). Mark ers were selected such that any two adjacent markers on a given chromosome were not more than 20 cM apart. Most of the markers were obtained from the Solanaceae Genomics Network (SGN) (http://www.sgn.cornell .edu) which included CAPS, SCAR and SSR markers, or were obtained from various published sources (Suliman, 2002; Yang, 2004; Dynze, 2007; Ji et al. 2007; Hutton, 2008). Genotyping

PAGE 49

49 Genomic DNA from parents, F1, F2, BC1 and F3 population were extracted prior to inocul ation. Plants were rated on 21st day after inoculation. Plants rated with a score of 2.5 or below where considered resistant plants as these plants were able to recover from the infection. While the plants with score greater than 2.5 were considered to be susceptible plants since they were never able to recover and eventually died. Selective genotyping system was used to genotyp e F2 individuals found on the extreme ends of a frequency distribution based on disease severity About 23 extreme resistant and 22 susceptible F2 individual s were selected for selective genotyping. As a control, an individual DNA sample from both the parents and the F1 containing 5060 ng of DNA, 2 L of 20% Dimethyl sulfoxide (DMSO), 1 L of 25 mM of dNTPs, 0.8 L of 25 mM MgCl were also included in the screening study. 2, 1 L of 10x PCR buffer, 0.8 L of forward and reverse primer (5 M) and 0. 08 L of Taq polymerase (5 Massa chusetts). Annealing temperatures for each marker was optimized using a Mastercycler ep gradient (Eppendorf AG, Hamburg, Germany). The annealing temperature was selected to yield a sufficient amount of PCR product at the desired range. Separation of bands was either done on an agarose gel (2%, 3% or 4%) or on 4% MetaPhor agarose (Lonza Rockland, Inc., Rockland, Maine) depending upon band size and percentage by which the DNA fragments differed. PCR products were run on agarose or metaphor agarose gels in 1x TBE at 120 V for 90 min for visualization. Most of the SSR and InDel markers were scored on denaturing polyacrylamide gel using LI COR 4300 DNA Analyzer system (LI COR Biosciences, Lincoln, Nebraska).

PAGE 50

50 Amplification of SSR and InDel markers was performed i containing 20 ng of DNA, 0.8 L of 2.5 mM of dNTPs, 0.6 L of 25 mM MgCl2, 0.04 L of forward primer (5 M) with 5 M13 tail, 0.4 L reverse primer (5 M), 0.18 L fluorescent M 13 tail (10M), 1 L of 10x PCR buffer and 0.05 L of Taq polymerase (5u/ detection on polyacrylamide gel, PCR was carried out in Mastercycler ep gradient with the following program: Step 1) 2 min 95 oC, Step 2) 7 cycle of 45 sec 95 oC to 68 oC (with 2 oC drop per cycle), and 1 min 72 oC, Step 3) 28 cycle of 1 min 72 oC, 45 sec 95 oC, 45 sec 50 oC and 1 min at 72 oC, and Step 4) final extension of 5 min at 72 oMarker Analysis C. Amplified products were run on 6.5% polyacrylamide gel in 1x TBE buffer at 1400v for 120 min for visualization. The chi square ( 2) method was used to test the goodness of fit for observed ratios to theoretically expected ratios of marker scores in all populations. For the marker analysis approach, selections were grouped as resistant or susceptible, and marker data were scored on t he basis of the probability of a resistant allele (2, 1, and 0) for co dominant markers. Detection of linked markers was carried out by using WinQTLCart (Wang et al. 2010) through t tests based on single marker analysis (Soller et al. 1976). QTL analysis was performed with single marker analysis rather than using interval mapping since the number of available markers was limited and large distances between some markers did not allow for a reliable placement of potential QTLs. M arkers showing significant l inkage were confirmed by genotyping additional F2 individuals. Selected F2 progenies were also genotyped with significantly linked markers.

PAGE 51

51 Results A screen of 252 PCR based DNA markers includ ing 115 markers that were previously reported to be polymorphic between PI 126932 and Fla. 7776 (Hutton, 2009 were tested for polymorphism between two parents, including an F1 to test for co dominance ( Table C 1 ). Out of the 252 markers 1 52 were polymorphic and 1 27 were co dominant. Tightly clustered m arkers were elimi nated leaving 102 markers that were used to genotype the F2From the extremes of t he phenotype distribution, 23 resistant F population (Table 3 1). The 102 markers spanned the tomato genome with a maximum distance between markers of 30 cM, a mean distance of 12 cM and a median distance of 10 cM 2The s ignificance of the association at the two remaining significant loci was confirmed by genotyping and phenotyping of an additional 354 F individuals and 22 susceptible individuals were selected for genotyping. Based on single marker regression analysis three loci were detected, one on chromosome 4, one on chromosome 10, and another on chromosome 11 (Table 31) Markers at the three detected loci were tested on an additional 45 resistant and 45 susceptible individuals and the significant association was maintained for the markers at loci on ch romosomes 10 and 11, but marker at the chromosome 4 loci was not significantly associated with resistance (Table 32). 2 plants (Table 32 ). The markers SL10105i on chromosom e 10 and T04081 2 on chromosome 11 segregated as per the expected 1:2:1 ratio indicating no segregation distortion ( Table C 2 ). While t he PI 126932 allele at the chromosome 10 locus (L1) was associated with increased resistance, the PI 126932 allele at t he locus on chromosome 11 (L2) was associated with increased susceptibility to S. rolfsii (Table 33 ).

PAGE 52

52 E vidence of both overdominant and epistatic effects at both loci was observed among F2This unus ual pattern of overdominant and epistatic effects was also observed in a separate experiment using F segregants (Table 33 ). The apparent gene action at each locus wa s dependent on the allele stat e at the other locus. When L1 was homozygous for the PI 126932 allele, the Fla. 7776 allele at L2 appears to be dominant for resistance, however when L1 was heterozygous, a high level of resistance is only observed when L2 was heterozygous (behaving overdominant). When L1 was homozygous for the Fla. 7776 allele, no allele state at L2 provides a high level of resistance. When the L2 allele was homozygous for PI 126932 then all allele states at L1 were susceptible. When L2 was heterozygous for the PI 126932 allele at L1 appears to have a dominant or slightly overdominant resistance effect. Finally, when L2 was homozygous for the Fla. 7776 allele, the Fla. 7776 allele at L1 appear ed to have a recessive resistance effect. 3 family individuals (Table 34 ). When L1 was homozygous for PI 126932 allele the highest number of resistant plants were observed when L2 was homozygous for Fla. 7776 allele. As seen in F2, high level of resistance was observed in F3 plants when both L1 and L2 were heterozygous (overdominant effect). When L1 was homozygous for Fla. 7776 allele, no allelic combination on L2 showed good resistance level. The overdominant and epistatic effects in the BC1 population were consistent with those seen in the F2 and F3 p opulations (Table 35 ). High level of resistance was observed in BC1 when both loci were heterozygous. The marker trait associations were confirmed in a BC1Discussion population using single marker analysis (Table 36 ). Thi s study identified molecular markers linked to two loci one chromosome 10 and another on chromosome 11 controlling resistance to southern blight in tomato. The

PAGE 53

53 pattern of phenotypic data observed in the F2Based on the results of marker analysis for F generation exhibited a noncontinuous distribution, indicating that resistance was inherited as a qualitative trait controlled by 1 to 2 genes rather than a quantitative trait controlled by multiple genes It is possible that there are additional genes influencing resistance, but were not detected in this study because of gaps in genomic coverage of molecular markers or due to the lack of statistical power to detect loci with weaker effects. 2 and F3 plants, many of the resistant plants were heterozygous at both the loci. Heterosis due to trueor pseudooverdominance could possibly explain why some of the F1 and F2 plants exhibited greater resistance than the resistant parent itself. The over dominance hypothesis postulates the existence of loci at which the heterozygous state is superior to either homozygote. Pseudooverdominance, in contrast, refers to the situation of linked genes with favorable dominant alleles linked in repulsion. H owever, clear differentiation could not be made between trueor pseudo overdominance from the F2 and F3Regardless of the mechanisms involved, the genes at loci L1 and L2 identified in this study provide a good source of resistance that c ould be introgressed into commercial cultivars. Even though these loci do not confer complete resistance, it should be considered that the disease pressure in the field is generally less than the generation. Parvez (2006) pointed out that linkage was a major factor in preventing one from differentiating overdominance from pseudo overdominance. B udak et al. (2002) referred that p seudooverdominance is a condition that gives the false presumption of overdominance in which a pair of linked loci would behave as a single locus showing overdominance effect eventually skewing the measure of true overdominance.

PAGE 54

54 conditions in our disease assay Thus the partial resistance conferred by the identified genes may in practice be sufficient to efficiently protect tomato against S. rolfsii. Although the locus L1 found on chromosome 10 did not confer complete resistance, its dominant effect, as observed in the F2 dataset, makes it an interesting candidate for breeding resistance into F1Our study showed that southern blight resistance in tomato as conferred by genes L1 and L2 is influenced by the overdominance effect and epistasis between the detected loci. Both of these phenomena affect the development of resistant cultivars through conventional breeding. Sofi et al. (2007) indicated that epistasis affects the estimates of expected gain under selection during conventional breeding and also reduce s the efficiency in estimating additive and dominance component of genetic variance. Recent i mprovement in methods for QTLmapping with use of molecular markers has provided an opportunity to detect and understand the effect of epistasis between QTLs controlling complex trait (Carlborg and Haley, 2004). Such methodologies can be used in bett er understanding the genetics of southern blight in tomato which will eventually be helpful in generating resistant cultivars. Also, selection of heterozygous plants to take advantage of the overdominance effect would be possible using linked markers. However if the heterotic effect is due to pseudo overdominance then the heterozygous effect is fixable and superior inbred to hybrid can be obtained. This could also be facilitated by tightly linked markers which would enable the detection of a recombination event converting repulsion into coupling phase linkage that upon selfing could yield a fixable heterotic effect. hybrids, since introgression in only one parent is nece ssary.

PAGE 55

55 The conventional approach for breeding southern blight resistance in tomato by phenotypic selection c ould be negatively affected by the complex ity of this trait. Since some of the resistant plants were found to be heterozygous at both the loci, selection under conventional breeding could result into plants segregating for southern blight resistance However, some of these issues can be resolved by utilizing alternative approach i.e. molecular breeding. Associated molecular markers can not only help in the selection process but also facilitate a better genetic understanding of this disease in tomato which would help in developing southern blight resistant tomato lines and could improve the resistance level in other host species.

PAGE 56

56 Table 31. Polymorphic markers for Fla. 7776 and PI 126932. Significant P value indicates association with QTL. x approximate position obtained from Dynze, et al., 2007. Marker Approx. Position Forward primer x Reverse primer P value y CosOH47 1.010 ttgctgattttcttcccatttt gcagctggagtgagaggaac 0.164 LEOH36 1.017 tcacaaaaatggcgatgaga ccacc tgtggatccttgact 0.278 C2_At5g18580 1.035 tgccacattgcctctgtatgtacagaac atgtcaattcgggcttgagtaagtg 0.880 SSR95 1.043 caatccaacaagcaatccct ccacataactaagcccacaactt 0.306 SSR 316 1.053 ccaccgcaacaaaccttatt gggtggtgagaaggatctga 0.628 SL20268i 1.061 cactccgttc cttggcatac cccttccgttcttaaatacttg 0.928 SL10975i 1.070 gtgaacccggaactctgaac tcattgccacacagaagcag 0.894 LEVCOH11 1.085 caaccatgttagatgtgccagt taagagaggggaatggtgatgt 0.981 C2_At3g04710 1.095 agggtgcagatcctgcaatacccag tccagcctcactttgtaaatcaacatc 0.416 SSR 42 1.107 ccatggcttcgttatcccta taaaggtgaaggaacgggtg 0.599 SL10126i 1.137 atgactgagcatctgcgttc gccgccacttattgtaggat 0.492 TOM11 2.013 ttgtaatggtgatgctcttcc cagttactaccaaaaatagtcaaacac 0.224 SL10682i 2.034 gccgctcgtacaaggttattc tcgatttcccaaattgaagc 0.457 SSR96 2.043 gggttatcaatgatgcaatgg cctttatgtcagccggtgtt 0.943 SSR5 2.050 tggccggcttctagaaataa tgaaatcacccgtgaccttt 0.863 LEOH348 2.064 tgtttcccttcattcatgct ccaattggataaattggtggt 0.421 LEOH113 2.075 aaacagaggtgccgaagaaa gagctacaagcagcaaacca 0.602 C2_At5g 66090 2.083 atctctctgagggttcaagacagg tatatcagctccatacttctttgc 0.862 LEOH174 2.096 cgagtccgaggaagactgat tcaagacagacacggattgc 0.749 TG525 3.014 tatcagttcacctcccagca gccaatcatgtgaatggtgat 0.179 LEOH124i 3.021 ccgtctccttctccctcttt ctggctggtgtcttctccat 0.348 SL10480i 3.038 tcgcatcaattgcaacacac aaacgcaaggtgatcagtcc 0.617 LEOH223 3.040 acaagagtcgggtgatggac gcgatggaaatagcatcaca 0.291 C2_At1g02140 3.054 tccgttatgctaacaattccaac tgtgttcatttcccatcacaatctc 0.313 FEY 3.064 accgcttcctctatcaagca atgccgaataaccaagcaac 0.833

PAGE 57

57 Table 31. Continued x Marker approximate position obtained from Dynze, et al., 2007. Approx. Position Forward primer x Reverse pri mer P value C2_At5g60160 3.068 acacaatgctaatcaacgttatgc tcatccaccgcgcacatttc 0.859 C2_At5g52820 3.070 tgggatctaaatacccagacacc acagaaagaacccaatttctgtgc 0.781 C2_At1g61620 3.087 atgcattctagaatgccttttgtc tccctggctttctgcagcatc 0.396 LEOH127 3.098 caaggcat caacctaattgga tgtaggcttgaaaaataagaggaga 0.197 SSR296 4.010 ccggaacaagtcccttcata tcagccaagttcatggtacatc 0.040* SL10255i 4.025 tttgctgtatgtatatgctcttcc gcactctgataaaagacttgcag 0.929 C2_At3g17040 4.032 tggggttggatggagtggaaag agtagaggttacgaatttcctctgc 0.718 SSR603 4.045 gaagggacaattcacagagtttg ccttcaacttcaccaccacc 0.515 SSR306 4.053 acatgagcccaatgaacctc aaccattccgcacgtacata 0.222 C2_At1g71810 4.072 tcatgcagatccacatcctggaaac agtgacaaaatccttggccaatgc 0.465 CT194 4.079 tgggttttctgggtatggaa gcatgatgggcagtc tgtaa 0.233 SL00030 4.087 agttggtggtggtagtgaag ttctctccattcacagttcc 0.308 SSR146 4.107 tatggccatggctgaacc cgaacgccaccactatacct 0.190 TG441 5.008 tggtatggtaccacgacaaag ttttcaggtcgaggataccg 0.443 P11M6 5.015 gaggtaggacttagaaaacata aatcaacaccactaaatgcaga 0.303 Bs4 5.022 ggagctgaatacggattgga atcgttccgatgatttctgg 0.537 CT93 5.030 ttctgaggttggctgagaccttgt tctggtagacaatggaaccgcctt 0.506 SL20210i 5.046 gaggtatcaaagttatgctttcac tcgattagttgagctagttattcc 0.625 C2_At1g14000 5.060 agcgttacatggctggatcgatg atacgtc tttaacaattcaatcatgc 0.503 TOM49 5.068 aagaaactttttgaatgttgc attacaatttagagagtcaagg 0.878 CosOH73 5.082 cttcccgacaagcacaaaaa cgaatgctctgtaccatttcc 0.979 SSR162 5.090 gctctctacaagtggaactttctc caacagccaggaacaaggat 0.721 SL10328i 6.000 accgtgaatctgaggttgct cgtgccaatgtccaactaag 0.097 T1456 6.010 tagcttctgccattgatttgagc tgagagggaagtatctgtatgccc 0.252 p55P11 6.020 tcccaaaccccaacttaaaa ggacggtctgtgagtggaat 0.252

PAGE 58

58 Table 31. Continued x approximate position obtained from Dynze, et al., 2007. Marker Approx. P osition Forward primer x Reverse primer P value P6 25F2R5 6.025 ggtagtggaaatgatgctgctc gctctgcctattgtcccatatataacc 0.578 TG590f2R2 6.029 acagcaggaggtgatggaatac cgggtcgagcgatttgttta 0.711 T0834 Fla,R2 6.032 ctgttaattgggaccccatcagaagcagg ggaaggtgatgctgc aatccttcagataacc 0.354 C2_At1g44760 6.044 ttcttcatctgctgctcatcttgc agagggttttttctgacccaagac 0.773 SP 6.068 agggttgaagttcatggtgg gatgttccctgagatatgga 0.743 LEOH112 6.078 gccaattgaactgaccatctg cccatgtatttggctgtagaa 0.197 SSR350 6.100 ggaataacctctaactgcgg g cgatgccttcatttggactt 0.224 C2_At5g20180 7.006 tgctatgtacatctaatcccaagcac agctatcccccttttccaccaag 0.754 C2_At1g19140 7.024 aggcccttgtactcagtgcctctc tcatggcggtttcagtccatcc 0.32 0 SSR276 7.033 ctccggcaagagtgaacatt cgacggagtacttcgcatt 0.736 TG217 7.043 cg ttgcttcctgatcctacc agctagtgatgatcctggcg 0.725 TG174 7.052 ttccaagatcttttagcgtctc ctgttgcggatgtgatcatt 0.614 TG216 1 7.062 gctttcggtactgcatcctc taaatgaagcctgggattgc 0.600 C2_At1g56130 7.085 acatatagctgttgggaacaggg taggtttaaacttgcgaacatcc 0.159 C2_At5g46 630 8.002 tggcgcctttgatgaagatgc agattttgagggtaaccaaagtcc 0.39 0 LEOH147 8.020 agttcccgttggtgttcaag cccttgccagtggatgttag 0.82 0 C2_At2g26830 8.030 tcaaatctagatggttctcacttctctg aagtgcgtgcatcaataaatgactg 0.532 TG302 8.038 ctctccgggtggctattaca tcttgggactcctcc ttttct 0.239 SSR38 8.053 gtttctatagctgaaactcaacctg gggttcatcaaatctaccatca 0.412 TG294 8.083 gttctcattggagccatcgt gattgggcacactcacttt 0.838 C09HBa0203J14.1 9.023 gcatgactgctctcagttggcttt ggcagcttcatttgagtgtggaga 0.242 SSR70 9.031 tttagggtgtctgtgggtcc g gagtgcgcagaggatagag 0.531 LEOH144 9.058 atggcctaggattgcatctg ttgcatacacttggataaaagca 0.955 LEOH170 9.074 ggattagaagagaaaaacaaaagca agccttctcaaattcctcctc 0.981 SSR333 9.100 gttcccgcttgagaaacaac ccaatgctgggacagaagat 0.718

PAGE 59

59 Table 31. Continued x approximate position obtained from Dynze, et al., 2007. Marker Approx. Position Forward primer x Reverse primer P valu e C2_At3g21610 10.002 atgggattcaaaaaggatgcttagc agcctaacaccagtagcatcatacattac 0.120 C2_At5g60990 10.014 tgatacactgaagcagcagtatcg agccagaagacg agttgcatcac 0.029* SL10105i 10.030 ccaagcccttctgatttagtg ctttacataattggccgacaaac 0.024* LEVCOH15 10.037 gcaaccaccaatgttcattaca aagctaaatctggcttgtggag 0.027* SL10419i 10.043 ccttgattggaaaaagcaagac gccattcttttgggagataaac 0.040* C2_At3g58470 10.061 attgct tgtcccacactttatgc tactgttcaaaccgtttgtcatactc 0.533 T1682 10.066 cctccctcaccatccaataa ctgctttaaccaccggattc 0.531 TG403(dCAPS)R 10.082 tttgccttggttcccttatgcagc tacgtatttttgaaatatcctgttctttcag 0.282 SL10683i 11.000 tggatattcgtatattcgagacagg attccgatccatcca atctg 0.301 TG497 11.004 cgtctcgagaggaagtgagg tactggcacccatgctacaa 0.361 SSR80 11.017 ggcaaatgtcaaaggattgg agggtcatgttcttgattgtca 0.748 T0408 1,2 11.026 tagacggtgctcatgtcgag gttctcggcacccattctaa 0.04* SSR76 11.046 acgggtcgtctttgaaacaa ccaccggattcttctt cgta 0.815 C2_At4g10050 11.0 54 tcctgttgaaagttcaatctgtgt ctccactcatgtcacaaacca 0.416 SL10737i 11.0 60 ccactcctgggactcaaatc tggacccacaggtaatgagg 0.256 cLET 24 J2 11.073 caaccatcctagcaatgaaatct gaggcattcactctcttcgatac 0.152 Tg36 11.080 tgttttaaactgaagatgtg taaaatg gaatgagcaagttaaacagtaagg 0.145 SL10027i 11.098 ctaccaggagcctgaagagc ccattagagccaagacgctc 0.456 TG180 12.000 tctcagtggactaaggggtca gcatggaacaccatcatcaa 0.216 TG68 12.009 tgcactaagcatctcgcatt tttcatgtcaaggggattga 0.304 SL10953I 12.029 ctgtctctcgc ttttctcctg acggaacacaccctaagtgc 0.184 TG360 12.038 ccccagaacacctctccata tttcccgattttgttcctga 0.264 C2_At5g42740 12.055 agcaccatttgagaaaaatatacctg atccaaggaatgaaacattccacac 0.370 leoh301 12.066 tgctgttttgtttggctcac tgttcatatctttgatggcatgt 0.312 CosOH1 1 2.070 tgcatacacttggtcatgacttc ggctatagcatgcgttggtt 0.909 LEOH 275 12.075 tcctctgaaaacaacttcacga agtgtgagcctcaaattcca 0.588 PtiB 12.088 gcccctgatatggcagcacgtc caaggcagcaactgcagccatc 0.904

PAGE 60

60 Table 3 2 Detection of associated molecular markers in 354 F2 individuals for chromosome 10 & 11 and for a subset of 135 F2 Chromosome plants for chromosome 4, 10 and 11 through single marker interval analysis by fitting data to simple linear regression model. Marker b0 b1 2ln(L0/L1) F value z p value 354 F 2 plants 10 SL10105i 3.339 0.177 5.376 5.385 0.021* 11 T0408 1,2 3.342 0.152 4.058 4.059 0.045* 135 F 2 plants (subset of 354 ) 4 SSR296 2.528 0.082 0.16 0.158 0.692 10 SL10105i 2.509 0.442 5.102 5.122 0.025* 11 T0408 1,2 2.503 0.385 4.426 4.433 0.037* z Likelihood ratio test statistic.

PAGE 61

61 Table 33 Parents and F2 plant survival percentage as per combination of alleles on chromosome 10 and 11. Plant numbers are in parenthesis v Marker on chromosome 10. w Marker on chromosome 11. x Homozygous for PI 126932 allele. y Heterozygous for both alleles. z Homo zygous for Fla. 7776 allele. SL10 105i T0408 1,2 v Resistant w Susceptible PI 126932 SP SP x 9 1 6 0 (22) 8.4(2) Fla. 7776 SL SL y 12.5(3) 87.5(21) F2 generation SP SP 25.00 (2) 75.00 (6) Het 63.64 (7) 36.36 (4) SL 77.78 (7) 22.22 (2) Het SP z 23.53 (4) 76.47 (13) Het 79.07 (34) 20.93 (9) SL 37.50 (6) 62.50 (10) SL SP 28.57 (4) 71.43 (10) Het 23.08 (3) 76.92 (10) SL 50.00 (3) 50.00 (3)

PAGE 62

62 Table 34 F3 plant survival percentage as per combination of alleles on chromosome 10 and 11. Plant numbers are in parenthesis v Marker on chromosome 10. w Marker on chromosome 11. x Homozygous for PI 126932 allele. y Heterozygous for both alleles. z Homozygous for Fla. 7776 allele. SL10105i T0408 1,2 v Resistant w Susceptible SP SP x 28.57(2) 71.43( 5 ) Het 50.00(7) 50.00(7) SL 88.89(8) 11.11(1) Het SP y 33.33(2) 66.67(4) Het 63.64( 7 ) 36.36(4) SL 50.00(5) 50.00(5) SL SP z 13.33(2) 86.67(13) Het 18.18(2) 81.82(9) SL 40.00(2) 60.00(3)

PAGE 63

63 Table 35 BC1 plant survival percentage as per combination of alleles on chromosome 10 and 11. Plant numbers are in parenthesis. w Marker on chromosome 10. x Marker on chromosome 11. y Heterozygous for both alleles. z Homozygous for Fla. 7776 allele. Table 36 Detection of associated molecular markers in 64 BC1 Chromosome individuals through single marker interval analysis by fitting data to simple linear regression model Marker b0 b1 2ln(L0/L1) F value z p value 10 SL10105i 2.412 0.605 5.054 5.094 0.028 11 T0408 1,2 2. 917 0.506 3.451 3.435 0.069 z Likelihood ratio test statistic SL10105i T0408 1,2 w Resistant x Suscept ible Het Het y 83.3(15) 16.6(3) SL 75(12) 25(4) SL Het z 33.3 ( 36) 66.66(12) SL 58.3(7) 41.6(5)

PAGE 64

64 CHAPTER 4 SUMMARY AND CONCLUSI ON S Southern blight of tomato ( Solanum lycopersicum L.) caused by Sclerotium rolfsii Sacc. is a minor soil borne disease in Florida but the economic losses caused by this fungus could increase after the regulatory phase out of Methyl Bromide which is the preferred method of control. The best alternative control of this disease is the deployment of genetically resistant cultivars which will not only be economical but also beneficial for lowinput and organic crop production system s. This study confirmed that the previously identified (Mohr, 1955) S pimpinellifolium accession (PI 126932) was an effective source of resistance against a Florida isolate of S rolfsii and determined the genetic components of southern blight resistance from that source. This information will be used to incorporate resistance int o breeding lines through marker assisted selection. Earlier work showed that isolates of S. rolfsii could dif fer in their virulence (Sharma et al 2002; Flores Moctezume et al ., 2006; Shukla and Pandey, 2008) So the first step was to determine if there was any difference in the level of resistance among the reported sources of resistance against several diverse isolates of S. rolfsii. This would identify the most effective source of resistance for genetic mapping. Two resistant sources (PI 126932 and breeding line 5913M) and a susceptible inbred line (Fla. 7776) were individually inoculated with an isolate of S rolfsii collected from tomato (GCT 1), peanut (WM 609) and sweet potato (DF/LA SR1), obtained from Florida, Georgia and Louisiana respectively. Results showed that PI 126932 provided resistance against all three isolates of S. rolfsii used in the study, while breeding line 5913M was only resistant against isolate WM609 from peanut and DF/LA SR1 from sweet potato but not against GCT1 from

PAGE 65

65 tomato Fla. 7776 was susceptible to all three isolates. Significant differences were observed between different genotypes of tomato and between the three isolates of S. rolfsii. Significant interaction between the tomato lines and the S. rolfsii strains was also noted. This showed that the resistance in tomato could depend on the interaction between the tomato genotype and southern blight strain. For genetic studies of southern blight resistance PI 126932 and Fla. 7776 were selected as resistant and susceptible parents respectively. Crosses were made between the parents and several generations were created. Both parent s and F1 and F2 generations were artificially inoculated with southern blight strain GCT1. Results indicated that the genes contributing to resistance in PI 126932 could have incomplete penetrance. However such assumption needs to be confirmed by further tests as in the field trial (appendix D) it seemed that high inoculum pressure and favorable climatic condition for pathogen could be a possible cause for death of plants of resistant lines The distributions of individual phenotypes in the F1 and F2 generations suggested that the inheritance of this trait in tomato involved multiple genes. Genetic mapping experiments revealed two loci affecting resistance. Initially three loci were detected in a selective genotyping study using the F2 segregating generati on inoculated with the GCT 1 isolate and genotyped with 102 co dominant molecular markers. One locus was excluded in a follow up experiment with a larger population. The other two loci L1 (chromosome 10) and L2 (chromosome 11) were confirmed in a larger F2 population without selective genotyping and F3 and BC1 populations. Locus L1 was found to be contributing resistance while effect of L2 was opposite to that of L1. Paradoxically, the highest numbers of resistant plants in F2, F3 and BC1 generation were found to be

PAGE 66

66 heterozygous for both loci. One explanation involves both an overdominance and epistasis effect. In the Fla. 7776 genetic background, locus L1 alone was found to provide a good resistance level. Data indicated epistasis effect for locus L1, suggesting that this gene might be interacting with some other genes along with L2. If the resistance requires an interaction between genes then such a condition would greatly affect the transfer of resistance genes through backcrossing. However, evidence from BC1 generation suggested that a single gene (L1) from PI 126932 was sufficient in the Fla. 7776 background for providing resistance and by use of the molecular backcross method it could be transferred to cultivated lines to increase their resistance. Heter ozygous plants for locus L1 were also found to be resistant (dominant inheritance), thus L1 can be used for breeding southern blight resistance into F1The mechanisms underlying the resistance conferred by this gene remain to be resolved. S. rolfsii is a necrotrophic pathogen which seems to be relying on three prime mechanisms for overcoming its host plants, i.e. the ability to kill host cells, decompose plant tissue and counteract plant defense responses ( Glazebrook 2005) In order to kill host cells, the fungus is able to produce certain phytotoxic metabolites, such as oxalic acid (OA) and polygalacturonase (Bateman and Beer, 1965). OA induces Programmed Cell Death (PCD) in the hos t plants (Errakhi et al ., 2008). PCD is a part of plant life cycle and helps in plant tissue development (Kim et al 2008). Hypersensitive response is a form of PCD which act as a defense mechanism during certain pathogens attack. However, under attack from certain necrotrophic fungus like S. rolfsii, Sclerotinia sclerotiorum PCD is beneficial to the pathogen as compared to the host (Kim et al hybrids because introgression of this locus is only needed in one parent

PAGE 67

67 2008). While high concentration of OA causes PCD, at lower concentration OA induce s defense related gene express ion resulting in resistance against the proliferation of S. rolfsii in Arabidopsis thaliana (Lehner, 2008). It could be possible that the genes at the detected loci might be somehow degrading the effect of OA, but this remains to be determined. The second trait employed by this fungus in subduing its host is decompos ing host tissue through plant cell wall degrading enzymes like polygalacturonase. OA increases the rate by which polygalacturonase hydrolyze pectates in the middle lamella by reducing the pH of host tissue to a more favorable pH range for enzyme action and by combining oxalate with the calcium ions in the calcium pectates of the host cell wall (Bateman and Beer, 1965). It could be possible that the genes are inhibiting the chelating of calcium ions in the calcium pectates in the middle lamelle thereby inhibiting the effect of polygalacturonase and rendering resistance to the host. Third principle on which this fungus relies to overcome host plant is its ability to counteract the action of host def ense mechanism. S. rolfsii is capable of doing this by suppressing the oxidative burst, which is one of the initial plant defense mechanism (Kim et al, 2008) The loci identified in this study might confer a better oxidative burst response leading to effic ient production of hydrogen peroxide (H2O2Another possible mechanism for resistance could be due to phellem cells that form a protective barrier eventually preventing entry of fungus into the host stem (Mohr and Watkins, 1959). In such case using tomato rootstock possessing continuous phellem cells layer could help in controlling this diseas e Gra fting trials were conducted to test if ) which acts as antimicrobial agent. Future studies should identify the gene(s) and unravel the mechanisms for the higher resistance levels by the detected genes.

PAGE 68

68 resistance could be achiev ed by using PI 126932 as a root stock but due to unfavorable condition no results were obtained (appendix E). Further research is required to gain better understanding of southern blight genetics in tomato. The influence of parameters like environmental effect, incomplete penetrance, and fungus strain effect points to the need for large segregating populations and progeny testing in F3The phase out of Methyl B romide (M e Br) has forced researchers to come up with new alternatives for controlling so ilborne diseases. Minor soil borne disease s like southern blight which were effectively controlled by MeBr could now become major problem s to th e Florida tomato industry This study was directed towards finding genes which could help in establishing southern blight resistant tomato lines. For the first time we were able to map genes contributing to the resistance against southern blight in tomato which are now being used to transfer resistance to elite commercial tomato lines. families to maximize the ability to detect resistance loc i and to understand their effects. It would also be helpful to evaluate different crosses involving various sourc es of resistant and susceptible lines. Based on the results of earlier work and the current study it is likely that resistance from PI 126932 w ill be effective against southern blight under field conditions. C urrent studies were carried out in greenhouse conditions. Field trials were conducted but due to unfavorable condition s no valid conclusions w ere derived (appendix D) So, the resistance needs to be tested in field conditions and against various isolates of S rolfsii. Developing polymorphic markers in future for the chromosomal regions which were not covered in this study could perhaps help in detecting additional genes with weak effects.

PAGE 69

69 APPENDIX A PEDIGREES

PAGE 70

70 Suncoast F3 F3 NC 140 F5 Suncoast Fla. 7060 Fla. 7776 C 28 Fla. 7060 Fla. 7418 F F1 5 F 648 Fla. 7218 Walter 5 F9 648 C 28 2133D5 D1 Figure A 1. Pedigree of Fla. 7776.

PAGE 71

71 W1023 F71 STEP 1021 STEP 54 W5071 S63 STEP 438 W273 S56 5913M W80 4 S67 W390M S59 Southland (F11 W4161 1 F62 ) W451 S56 STEP 247 STEP 54 Red cloud W371M S56 Southland F5 W546 F71 W497 S62 STEP 401 W126 S56 Rutger s (F7) (F7 W961 S65 W174 S59 Stokesdale ) W1624 S67 W2471 S62 W451 S56 STEP 247 (F3 Red Top ) W2351 S59 STEP 54 STEP 54 W268M S56 W2 68M S56 Southland Southland STEP 54 W933 S65 (F11 ) W273 S56 W390 S59 Southland W451 S56 STEP 247 Fi gure A 2. Pedigree of 5913M

PAGE 72

72 APPENDIX B MOLECULAR MARKER TECHNICAL INFORMATIO N

PAGE 73

73 Table B 1. Technical information for markers polymorphic between F la. 7776 and PI 126932. Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference CosOH 47 1.010 caps Bst UI 54 226 150 2% agarose SGN LEOH36 1.017 caps Bcl I 56 1300 1128 1% agarose Yang, 2004 C2_At5g18580 1.035 caps Hpy CH41V 49 929 1100 2% agarose SGN SSR95 1.043 ssr N/A 45 212 224 6.5% acrylamide SGN SSR316 1.053 ssr N/A 45 235 251 6.5% acrylamide SGN SL20268i 1.061 indel N/A 45 234 248 6.5% acrylamide Deynze, 2007 SL10975i 1.070 scar N/A 55 161 151 6.5% acrylamide Deynze, 2007 LEVCOH11 1.085 caps Mnl l 54 149 195 4% agarose Yang, 2005 C2_At3g04710 1.095 caps Hinc II 55 900 1100 2% agarose SGN SSR42 1.107 ssr N/A 45 188 192 6.5% acrylamide SGN SL10126i 1.137 indel N/A 45 213 219 6.5% acrylamide Deynze, 2007

PAGE 74

74 Table B 1. Continued Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Ref erence TOM11 2.013 ssr N/A 45 183 187 6.5% acrylamide SGN SL10682i 2.034 scar N/A 45 182 176 6.5% acrylamide Deynze, 2007 SSR96 2.043 ssr N/A 50 199 209 221 6.5% acrylamide SGN SSR5 2.050 ssr N/A 50 196 193 181 6.5% acrylamide SGN LEOH348 2.064 caps H py CH41V 52 100 184 2% agarose Yang, 2005 LEOH113 2.075 snp Nla III 52 154 211 4% agarose Yang, 2004 C2_At5g66090 2.083 caps Hpy CH4III 55 300 450 2% agarose SGN LEOH174 2.096 indel N/A 52 221 146 4% agarose Yang, 2005

PAGE 75

75 Table B 1. Continued Marker L ocation Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference TG525 3.014 caps Tsp509I 53 214 230 2% agarose SGN LEOH124i 3.021 indel N/A 52 110 208 6.5% acrylamide Yang, 2004 SL10480i 3.038 indel N/A 45 100 150 2% aga rose Deynze, 2007 LEOH223 3.040 caps Mse I 52 177 212 4% agarose Yang, 2005 C2_At1g02140 3.054 caps Hha I 50 700 1000 1550 2% agarose SGN FEY 3.064 caps Bst Ui 55 667 800 2% agarose SGN C2_At5g60160 3.068 caps Hinf I 54 450 500 4% agarose SGN C2_At5 g52820 3.070 caps HypCH4IV 55 750 850 2% agarose SGN C2_At1g61620 3.087 caps Taq I 54 600 900 2% agarose SGN LEOH127 3.098 caps Hinc II 52 177 244 2% agarose Yang, 2004

PAGE 76

76 Table B 1. Continued X http://solcap.msu.edu/tomato_snp_survey.shtml [Accessed: January, 2010]. Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference SSR296 4.010 ssr N/A 45 185 200 6.5% acrylamide SGN SL10255i 4.025 indel N/A 45 160 150 6.5% acrylamide Deynze, 2007 C2_At3g17040 4.032 caps Dde I 55 200 250 550 2% agarose SGN SSR603 4.045 ssr N/A 45 251 17 9 6.5% acrylamide SGN SSR306 4.053 ssr N/A 45 255 270 6.5% acrylamide SGN C2_At1g71810 4.072 caps Bst UI 57 450 800 1100 2% agarose SGN CT194 4.079 ssr N/A 45 174 171 6.5% acrylamide SGN SL00030 4.087 snp Ase I 51 233 163 70 4% Metaphor SolCAP X SSR14 6 4.107 ssr N/A 45 234 238 6.5% acrylamide SGN

PAGE 77

77 Table B 1. Continued Marker Location Marker type Restriction Enzym e Annealing Temp. Amplicon size Detection Reference TG441 5.008 caps TaqI 53 350 280 2% agarose SGN P11M6 5.015 caps Taq I 50 300 330 4% agarose Hutton, 2008 Bs4 5.022 caps Dpn II 55 600 650 2% agarose SGN CT93 5.030 caps Alu I 54 300 325 2% ag arose Hutton, 2008 SL20210i 5.046 scar N/A 5 2 170 250 2% agarose Deynze, 2007 C2_At1g14000 5.060 caps Spe I 55 900 1000 2% agarose SGN TOM49 5.068 ssr N/A 45 223 190 6.5% acrylamide Suliman,2002 CosOH73 5.082 caps Alu I 56 69 123 2% agarose tomatomap.n et SSR162 5.090 ssr N/A 50 260 264 6.5% acrylamide SGN

PAGE 78

78 Table B 1. Continued Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference SL10328i 6.005 scar N/A 45 234 246 6.5% acrylamide Deynze, 2007 T1456 6.010 caps Rsa I 56 500 650 2% agarose Ji et al. 2007 p55P11 6.020 caps DdeI 54 300 400 2% agarose SGN TG590f2R2 6.029 caps HpyCH4III 55 250 350 525 2% agarose Hutton, 2008 P6 25F2R5 6.025 caps Taq I 55 200 400 2% agarose Hutton, 2008 T0834 Fla,R2 6.0 32 scar N/A 55 550 660 2% agarose Hutton, 2008 C2_At1g44760 6.044 caps Nsi I 55 400 700 900 2% agarose SGN SP 6.068 caps Bst NI 56 350 370 4% agarose SGN LEOH112 6.078 caps HpyCH4IV 52 240 300 4% agarose Yang, 2004 SSR350 6.100 ssr N/A 45 149 267 269 6.5% acrylamide SGN

PAGE 79

79 Table B 1. Continued Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference C2_At5g20180 7.006 caps Taq I 55 700 800 1300 2% agarose SGN C2_At1g19140 7.024 scar N/A 55 855 1100 2% agarose SGN SSR276 7.033 ssr N/A 52 150 177 4% agarose SGN TG217 7.043 caps HpyCH4IV 55 450 500 4% agarose SGN TG174 7.052 caps Hha I 55 500 1200 2% agarose SGN TG216 1 7.062 caps Bsl I 55 300 350 2% agarose Hutton, 2008 C2_At1g56130 7.085 caps RsaI 55 400 300 2% agarose SGN

PAGE 80

80 Table B 1. Continued Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference C2_At5g46630 8.000 CAPS Hpy CH4III 56 425 700 2% agarose SGN LEOH147 8.020 caps Tsp45i 52 117 185 2% agar ose Yang, 2004 C2_At2g26830 8.030 CAPS Hpy CH4III 50 550 950 2% agarose SGN TG302 8.038 CAPS Alu I 55 450 700 2% agarose SGN SSR38 8.053 SSR N/A 50 237 240 6.5% acrylamide SGN TG294 8.083 CAPS Alu I 50 800 550 2% agarose SGN

PAGE 81

81 Table B 1. Continued Mar ker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference C09HBa0203J14.1 9.023 caps Tsp 509I 53 300 380 3% agarose Hutton, 2008 SSR70 9.031 ssr N/A 50 115 105 6.5% acrylamide SGN LEOH144 9.058 caps Fok I 52 1 52 225 2% agarose Yang, 2004 LEOH170 9.074 indel N/A 52 212 384 2% agarose Yang, 2005 SSR333 9.100 ssr N/A 50 199 201 6.5% acrylamide SGN

PAGE 82

82 Table B 1. Continued y Marker Personal Communication. Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detecti on Reference C2_At3g21610 10.000 caps Dpn II 55 500 750 2% agarose SGN C2_At5g60990 10.014 caps Hinf I 55 900 1100 2% agarose SGN SL10105i 10.030 scar N/A 45 203 235 6.5% acrylamide Dynze, 2007 LEVCOH15 10.037 scar N/A 52 178 188 6.5% acrylamide Yang, 2005 SL10419i 10.043 scar N/A 45 105 124 2% agarose Dynze, 2007 C2_At3g58470 10.061 caps Tsp 5091 50 320 280 2% agarose SGN T1682 10.066 caps Hinf I 54 220 300 2% agarose Hutton, 2008 TG403(dCAPS)R 10.082 dcaps Hpy188I 55 215 235 4% agarose Hutton y

PAGE 83

83 Table B 1. Continued Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference SL10683i 11.000 indel N/A 45 165 171 6.5% acrylamide Dynze, 2007 TG497 11.004 caps Taq I 52 550 1 200 2% agarose SGN SSR80 11.017 ssr N/A 45 164 167 4% agarose SGN T0408 1,2 11.026 caps Mnl l 55 350 520 2% agarose Hutton, 2008 SSR76 11.046 ssr N/A 45 150 160 2% agarose SGN C2_At4g10050 11.054 caps BstN I 56 139 170 2% agarose SGN SL10737i 11.0 60 s car N/A 45 163 176 6.5% acrylamide Dynze, 2007 cLET 24 J2 11.073 caps Hpy CH4III 55 394 450 4% agarose Hutton, 2008 TG36 11.0 8 0 ssr N/A 45 162 172 6.5% acrylamide SGN SL10027i 11.098 indel N/A 45 171 180 6.5% acrylamide Dynze, 2007

PAGE 84

84 Table B 1. Continued Marker Location Marker type Restriction Enzyme Annealing Temp. Amplicon size Detection Reference TG180 12.000 caps Dral 55 270 490 2% agarose SGN TG68 12.009 caps EcoRV 52 200 300 2% agarose SGN SL10953i 12.029 indel N/A 45 219 231 6.5% acrylamide Deynze, 2007 TG360 12.038 caps Apo I 55 500 650 2% agarose Hutton, 2008 C2_At5g42740 12.055 caps Dde I 55 700 600 2% agarose SGN LEOH301 12.066 scar N/A 52 164 185 4% agarose Yang, 2005 CosOH1 12.070 caps Tsp RI 54 510 380 2% agarose SGN LEOH 275 12.0 75 snp MseI 52 88 144 2% agarose Yang, 2005 PtiB 12.088 caps Mnl 56 500 600 2% agarose SGN

PAGE 85

85 APPENDIX C ADDITIONAL MOLECULAR MARKER INFORMATION

PAGE 86

86 Table C 1 Marker classification based on polymorphism and dominance between PI 126932 and Fla. 7776. Marker s Approx position Polymorphic Dominant Co dominant CosOH47 1.010 Yes No Yes SSR 34 1.013 No SL 10075 1.015 No LEOH36 1.017 Yes No Yes TG 58 1.017 No TG 236 1.019 No C01HBa0003D15.1 1.029 Yes Yes No SSR 266 1.033 No SSR 192 1.033 N o C2_At5g18580 1.035 Yes No Yes SSR 105 1.040 No TOM202 1.041 Yes No Yes SSR 95 1.043 Yes No Yes SSR 316 1.053 Yes No Yes SL 20134 i 1.060 Yes No Yes SL 20268 i 1.061 Yes No Yes SSR 134 1.064 Yes No Yes SL 10975 i 1.070 Yes No Yes SL 20116 1.078 No SL 10945 1.084 Yes No Yes LEVCOH11 1.085 Yes No Yes CT68 1.086 No SSR 9 1.093 No C2_At3g04710 1.095 Yes No Yes U237757 1.102 Yes Yes No SSR 42 1.107 Yes No Yes t0664 1.111 No C2_At1g02560 1.116 Yes Yes No SSR 37 1.118 No TG 25 5 1.125 No SL 10126 i 1.137 Yes No Yes SSR 595 1.147 No C2_At2g15890 1.150 No

PAGE 87

87 Table C 1 Continued Marker s Approx position Polymorphic Dominant Co dominant LEOH 342 2.000 Yes Yes No SL 10351 2.011 No TOM11 2.013 Yes No Yes CT205 2.023 No SL 10682 i 2.034 Yes No Yes SSR 96 2.043 Yes No Yes 120k 2.045 No SSR 5 2.050 Yes No Yes SL 10279 I 2.060 Yes Yes No LEOH 348 2.064 Yes No Yes O vate 2.073 No LEOH 113 2.075 Yes No Yes TG 337 2.082 No C2_At5g66090 2.083 Yes No Yes TG 53 7 2.089 No TG 91 2.090 No LEOH 174 2.096 Yes No Yes LEOH 319 2.097 Yes Yes No TG 151 2.098 No TG 154 2.105 No TG 114 3.000 No SL 10690 i 3.003 Yes Yes No TG 130 3.006 No SL 20182 i 3.013 Yes No Yes TG 525 3.014 Yes No Yes LEOH 124 i 3.021 Yes No Yes cbf 3.029 No SL 10480 i 3.038 Yes No Yes LEOH 223 3.040 Yes No Yes SL 20195 3.040 Yes No Yes t1388 3.047 Yes Yes No SL 10736 3.047 Yes No Yes SL 20037 3.049 Yes No Yes

PAGE 88

88 Table C 1 Continued Marker s Approx position Polymorphic Domina nt Co dominant SSR 111 3.053 No C2_At1g02140 3.054 Yes No Yes FE Y 3.064 Yes No Yes C2_At5g60160 3.068 Yes No Yes C2_At5g52820 3.070 Yes No Yes t1659 3.083 No C2_At1g61620 3.087 Yes No Yes TG 134B5 3.094 No U146899 3.097 Yes Yes No LEOH 127 3.098 Yes No Yes HERO 4.007 Yes Yes No SSR 296 4.010 Yes No Yes TG 15 2 4.021 Yes Yes No SSR 43 4.025 Yes No Yes SL 10255i 4.025 Yes No Yes C2_At3g17040 4.032 Yes No Yes TG 483 4.037 No SSR 603 4.045 Yes No Yes SSR 310 4.053 No SSR 306 4.053 Yes No Yes C2_At1g71810 4.072 Yes No Yes CT 185 4.076 Yes No Yes CT 194 4.079 Yes No Yes SL _00045 4.083 No SL _00027 4.084 No SL 00030 4.087 Yes No Yes C2_At1g27530 4.088 Yes Yes No CT 50 4.092 No TG 500 4.093 Yes Yes No SSR 214 4.095 No SL 10184 4.106 Yes No Yes SL 10888 4.107 Yes No Yes SSR 146 4.107 Yes No Yes

PAGE 89

89 Table C 1 Continued Marker s Approx position Polymorphic Dominant Co dominant TG 163 4.107 No t0998 5.000 No TG 441 5.008 Yes No Yes SSR 115 5.014 No P11M6 5.01 5 Yes No Yes Bs4 5.022 Yes No Yes CT93 5.030 Yes No Yes LEOH 16.2 5.033 No TG96 5.038 No SL 20210i 5.046 Yes No Yes t0040 5.056 No C2_At1g14000 5.060 Yes No Yes LEOH 192 5.060 No TOM49 5.068 Yes No Yes LEOH 316 5.069 No CosOH73 5 .082 Yes No Yes TG 185 5.087 No SSR 162 5.090 Yes No Yes SL 10328i 6.000 Yes No Yes T1456 6.010 Yes No Yes ct216 6.012 No SL10242 i 6.018 Yes No Yes p55P11 6.020 Yes No Yes SL 10187425 6.024 Yes No Yes P6 25F2R5 6.025 Yes No Yes TG 590f2R2 6.02 9 Yes No Yes T0834 Fla,R2 6.032 Yes No Yes SSR 128 6.041 No C2_At1g44760 6.044 Yes No Yes C2_At1g71950 6.046 No TG 356 6.050 No LEOH 243 6.053 No TG 435 6.058 Yes Yes No

PAGE 90

90 Table C 1 Continued Marker s Approx position Polymorphic Domina nt Co dominant TG 365 6.060 No SP 6.068 Yes No Yes LEOH 146 6.069 No SCBC792 6.075 Yes Yes No CT 206 6.078 Yes No Yes LEOH 112 6.078 Yes No Yes TG 314 6.090 No SSR 350 6.100 Yes No Yes SL 20017 7.003 Yes Yes No C2_At5g20180 7.006 Yes No Yes SSR 286 7.012 No C2_At2g26590 7.015 Yes Yes No C2_At2g29490 7.022 Yes No Yes C2_At1g19140 7.024 Yes No Yes LEOH 104 7.026 No SSR 276 7.033 Yes No Yes C2_At2g20860 7.043 Yes No Yes TG 217 7.043 Yes No Yes LEOH 221 7.050 No LEOH 40 7.050 No TG 174 7.052 Yes No Yes TG 291 7.053 No TG 216 1 7.062 Yes No Yes SSR 45 7.069 Yes No Yes SL 10039 7.073 No C2_At1g56130 7.085 Yes No Yes TG 499 7.085 No C2_At1g55870 7.090 No TG 424 7.093 No C2_At5g56130 7.108 No C2_At5g466 30 8.002 Yes No Yes LEOH 70 8.004 No U221657 8.013 Yes Yes No

PAGE 91

91 Table C 1 Continued Marker s Approx position Polymorphic Dominant Co dominant TG 176 8.017 No LEOH 147 8.020 Yes No Yes C2_At5g27390 8.021 Yes No Yes SSR 327 8.022 No SL 1004 4 8.028 No C2_At2g26830 8.030 Yes No Yes TG 349 8.031 No TG 302 8.038 Yes No Yes C2_At3g43540 8.041 Yes No Yes SSR 335 8.044 No SSR 38 8.053 Yes No Yes CT 265 8.069 No C2_At4g11560 8.072 No C2_At5g41350 8.075 No C2_At1g63980 8. 077 No TG 294 8.083 Yes No Yes TG 254 9.000 No TG 18 9.009 No LEOH 8.4 9.010 No C2_At2g37025 9.015 Yes Yes No SL 10471 9.020 No C09HBa0203J14.1 9.023 Yes No Yes SSR 70 9.031 Yes No Yes LEOH 31.4 9.040 No SSR 28 9.050 No LEOH 1 44 9.058 Yes No Yes LEOH 117 9.072 No LEOH 170 9.074 Yes No Yes TG 348 9.077 No TG 421 9.081 No C2_At3g23400 9.084 No SSR 333 9.100 Yes No Yes SSR 599 9.104 No

PAGE 92

92 Table C 1 Continued Marker s Approx position Polymorphic Dominant Co d ominant C2_At3g21610 10.002 Yes No Yes TG 122 10.006 No T0787 10.009 Yes Yes No SSR 34 10.013 No C2_At5g60990 10.014 Yes No Yes SL 10105i 10.030 Yes No Yes SSR 318 10.033 Yes No Yes LEVCOH15 10.037 Yes No Yes SL 10419i 10.043 Yes No Yes TG 285 10.045 Yes Yes No SL 10386i 10.054 No C2_At3g58470 10.061 Yes No Yes T1682 10.066 Yes No Yes SSR 74 10.074 No SSR 223 10.079 No SL 10807 10.082 No TG 403(dCAPS)R 10.082 Yes No Yes SSR 479 10.086 No C2_At2g2 73011.069 11.000 No S L 10683i 11.000 Yes No Yes TG 497 11.004 Yes No Yes SSR 80 11.017 Yes No Yes T0408 1,2 11.026 Yes No Yes SL 20244i 11.036 No C2_At4g22260 11.037 No TG 384 11.046 No SSR 76 11.046 Yes No Yes SL 10737i 11.054 Yes No Yes SL 10615 11.057 No C2_At4g10050 11.060 Yes No Yes TOM144 11.062 Yes No Yes C2_At3g54470 11.072 Yes No Yes cLET 24 J2 11.073 Yes No Yes

PAGE 93

93 Table C 1 Continued Marker s Approx position Polymorphic Dominant Co dominant TG 46 11.076 No TG 36 11.080 Yes No Yes TG 393 11.0 88 No SL 10027i 11.098 Yes No Yes TG 180 12.000 Yes No Yes SL 10925 i 12.000 Yes No Yes TG68 12.009 Yes No Yes SL 10953 i 12.029 Yes No Yes CT100 12.036 Yes Yes No TG 360 12.038 Yes No Yes CT99 12.045 Yes Yes No TG565 12.048 Yes No Yes TG 111 12.053 No C2_At5g42740 12.055 Yes No Yes LEOH 66 12.062 No LEOH 301 12.066 Yes No Yes CosOH1 12.070 Yes No Yes LEOH 275 12.075 Yes No Yes SL 10796 i 12.076 Yes Yes No LEOH 197 12.086 Yes Yes No PtiB 12.088 Yes No Yes

PAGE 94

94 Table C 2 Chisquare test for marker segregation distortion x Homozygous for Fla. 7776 allele. y Heterozygous for both alleles z Marker Homozygous for PI 126932 allele. Chromosome Genotype Obs erved plants Expected plants p value SL10105i 10 SL 101 x 99.75 H 198 y 199.5 0.98 SP 100 z 99.75 T0408 1,2 11 SL 107 99.75 H 191 199.5 0.63 SP 101 99.75

PAGE 95

95 APPENDIX D FIELD TRIAL EXPERIMENT Resistance level of a particular plant genotype may vary between field and greenhouse condition s. Ajit et al ., (2003) showed that the trans genic wheat lines earlier reported to be resistant against Fusarium graminearum under greenhouse conditions were found to be susceptible during field trials. Variation in resistance between field and greenhouse condition s could greatly affect the breeding of southern blight resistance into commercial tomato lines grown in fields. So, it was necessary to confirm that the level of southern blight resistance in various tomato genotypes under field conditions was consistent with the results obtained in the greenhouse trials during this study. In order to evaluate the response to southern blight disease in various resistant and susceptible sources in field condition a study was carried out in September 2009. Two different susceptible sources Fla. 7776 and Fla. 47 while three resistant source s PI 126932, 5913M and 5635M were selected for this study. F1 obtained from the cross between PI 126932 and Fla. 7776 was also included. Sclerotium rolfsii isolate GCT 1 was used in this study since this isolate was endemic to the location (GCREC) where this trial was conducted. A r andomized complete block design was used with 4 replications, with 10 plants for each replication. All plant materials were raised in 12 8 well s p eedling tray s for 4 week s before field transplanting. Inoculation was done in a similar way as described in chapter 2 when plants were 8 week s old; however 3 g of inoculum load was used instead of 2 g per plant Disease score was rated on a visual scale of 0 to 4. Data was collected on 10th and 20thA s ignificant difference in the disease severity score was observed between the tomato lines tested f or both the dates (Table D 1). A s ignificant difference was also day after inoculation (DAI).

PAGE 96

96 observed between the replications (Table D 1) at 10 DAI. Variation inbetween the replications could possibly explain why the mean disease severity score was lower for Fla. 7776 as compared to PI 126932 at 10 DAI. Both the breeding lines 5913M and 5635M were found to be susceptible against GCT1 isolate at 10 and 20 DAI. Based on the results from the data collected on 10 DAI the lowest disease severity was seen in F1 plants (Table D 2). Also at 10 DAI the disease score for F1 was not found to be significantly different from Fla.7776 but was different from PI 126932; however based on the results from the data collected on 20 DAI, a significant difference was found between F1 and Fla. 7776 but not between F1 and PI 126932 (Table D 2). Most of the plants in all the tomato lines at 20 DAI were found to be susceptible. A possible cause for such a high rate of death could be due to higher inoculum pressure which could have overwhelmed the resistance. It is also likely that environmental were highly favorable for the pathogen which enabled it to kill even the resistant lines. Unfortunately due to limited time the study was not repeated and hence no definite conclusions were derived from this study.

PAGE 97

97 T able D 1. Two way analysis of variance test for determining variation in disease severity score s in tomato lines PI 126932, 5913M, 5635M, Fla. 7776, Fla. 47 and F1 Source of variance (Fla. 7776 x PI 126932) in field condition. GCT 1 isolate of S. rolfsii was used to inoculate the plants. F value P value y 10 days after inoculation Lines 11.22 <0.01* Reps 3.15 0.03* 20 days a fter inoculation Lines 5.02 <0.01* Reps 2.49 0.06 y P value based on 0.05 significance level

PAGE 98

98 Table D 2 Bonferronis t test for differentiating tomato lines based on disease severity score s for GCT 1 isolate. w F1 derived from cross between PI 126932( ) and Fla. 7776( ) x Critical t value = 2.96. y Minimum Significant Difference. z Means with the same letters are not significantly different. No. Line Mean Bonferroni's groupi ng x MSD y 10 DAI 1 5635M 2.9 A z 2 5913M 2.75 A 3 Fla.47 2.45 A B 0.75 4 PI 126932 2.31 A B 5 Fla. 7776 1.85 B C 6 F 1 1.45 w C 20 DAI 3 Fla. 47 4 A 2 5913M 3.95 A 1 5635M 3.95 A B 0.38 5 Fla. 7776 3.87 A B 4 PI 126932 3.62 B C 6 F 3.48 1 C

PAGE 99

99 APPENDIX E SOUTHERN BLIGHT RESISTANCE THROUGH GRAFTING Many tomato soil borne diseases like Fusarium oxysporu m f. sp.lycopersici. and P. lycopersici etc have been found to be controlled by grafting susceptible varieties onto resistant rootstock s (Lee, 2003; Lee and Oda, 2003; Rivard and Louws, 2008) Hence in order to test whether PI 126932 could provide resist ance against southern blight if used as a rootstock a pilot study was carried out in greenhouse and later studies were carried out in the field. In order to obtained grafted plants for the greenhouse study, 14 plants of Fla. 7776(scion) were grafted to PI 126932(rootstock) and also 14 plants of PI 126932(scion) were grafted to Fla. 7776(rootstock). The 3 week old plants were grafted and allowed to grow for 5 more weeks before inoculation. However at the end only 3 plants with Fla. 7776 as rootstock and 8 plants with PI 126932 as rootstock were obtained. The study was still carried out by inoculating the grafted plants and 10 plants of both parents as control s in greenhouse using a completely random design. For field trials plant materials included PI 126932, Fla. 7776, PI 126932 grafted to PI 126932 below cotyledon, Fla. 7776 grafted to Fla. 7776 below cotyledon, PI 126932 grafted to Fla. 7776 below cotyledon, and PI 126932 grafted to Fla. 7776 above cotyledon. A r andomized complete block design with four r eplication s each including 10 plants per treatment was used. GCT 1 isolate was used for this study. Field trials were conducted in June 2009 and October 2009. Due to extremely low number of grafted plants no statistical conclusions were derived from the gr eenhouse study (Table E 1). During the first field trial most of the plants died before inoculation due to accidental drift of herbicide from neighboring area.

PAGE 100

100 Trial was repeated in October 2009 but due to sudden drop in temperature the inoculation was not successful and no data were obtained. Further studies were not conducted due to lack of time.

PAGE 101

101 Table E 1. Number of grafted and parental lines plants found to be resistant and susceptible under greenhouse condition. Susceptible Resistant Total F>P 3 x 0 3 P>F 5 y 3 8 PI 126932 1 9 10 Fla. 7776 10 0 10 x PI 126932 (scion) grafted to Fla. 7776(rootstock). y Fla. 7776 (scion) grafted to PI 126932 (rootstock).

PAGE 102

102 LIST OF REFERENCES Ajith, A., T. Zhou, H.N. Trick, B. S. Gill, W.W. Bockus and S. Muthukrishnan, 2003. Greenhouse and field testing of transgenic wheat plants stably expressing genes for thaumatinlike protein, chitinase and glucanase against Fusarium graminearum J. Exp. Bot. 54: 11011111. Allard R W ., 1960. Principles of plant breeding. 2ndAlon, H., J. Katan and N. Kedar, 1974. Factors affecting penetrance of resistance to Fusarium oxysporum f. sp. lycopersici in tomatoes. Phytopathology, 64: 445451. Edn ., New York: Wiley. Amadioha, A.C. 1993. A synergism between oxalic acid and polygalactur onases in the depolymerization of potato tuber tissue. World J. Microbiol. Biotechnol. 9 : 599600. Aycock, R. 1966. Stem rot and other diseases caused by Sclerotium rolfsii. N.C. Agric. Exp. Stn. Tech. Bull. pp: 174. Bag, T.K. 2003. Two new orchid host s of Sclerotium rolfsii Sacc. from India. New Disease Reports, 20: 8. Barksdale, T.H. and A.K. Stoner, 1977. A study of the inheritance of tomato early blight. Plant Dis. Rep. 61: 63 65. Barrett, J.T., 1934. Observations on the basidial stage of Sclerotiu m rolfsii Phytopathology 24: 11371138. Bateman, D.F. and S.V. Beer, 1965. Simultaneous production and synergistic action of oxalic acid and polygalacturonase during pathogenesis by Sclerotium rolfsii. Phytopathology 55: 204211. Bateman, D.F. 1972. The polygalacturonase complex produced by Sclerotium rolfsii. Physiol. Plant Pathol. 2 : 175184. Besler, B.A., A. Grichar and O.D. Smith, 1997. Reaction of selected peanut varieties and breeding lines to southern stem rot. Peanut Sci. 24: 6 9. Besri, M., 2 003. Tomato grafting as an alternative to methyl bromide in Marocco. Proceedings of the 2003 Annual International Research Conference on Methyl Bromide Alternatives and Emissions Reductions, San Diego, CA, USA. Available from: http://mbao.org/2003/012%20besrimgraftingmbao2003sd.pdf Boland G.J. and T. Brimner 2004. N ontarget effect s of biological control agents. New Phytologist, 163: 455457. [Accessed June 2010].

PAGE 103

103 Boyle, L.W. 1952. Factors to be integrated in control of southern blight on peanuts. Phytopathology, 42: 282. Bret, M. P., M. Asins and A. Carbonell, 1993. Genetic variability in Lycopersicon species and their genetic relationships.Theor. Appl. Genet. 86: 113120. Brimner, T.A. and G.J. Boland, 2003. A review of the nontarget effects of fungi used to biologically control plant diseases. Agricult Ecosys. Environ., 100: 3 16. Brown J.E., C. Stevens, M.C. Osborn and H.M. Bryce, 1989. Black plastic mulch and spun bonded polyester row cover as method of southern blight control in bell pepper. Plan t Disease, 73: 930932. Brunner, E., S. Domhof, and F. Langer, 2002. Nonparametric analysis of l ongitudinal d ata in f actorial e xpe riments. New York, John Wiley & Sons. Budak, H., L. Cesurer Y. Bolek T. Dokuyuku and A. Akaya 2002. Understanding of heterosis. J. Sci. Eng., 5 (2) : 6875. Cai, G., L. R. Gale, R. W Schneider, H.C. Kistler, R.M. Davis, K. S. Elias and E. Miyao, 2003. Origin of race 3 of Fusarium oxysporum f.sp. lycopersici at a single site in California. Phytopathology 93: 10141022. California Department of Food and Agriculture (CDFA)., 1996. Methyl B romide: An Impact Assessment. Office of Pesticide Consultation and Analysis, Sacramento, C alifornia. Carlborg, O. and C.S. Haley, 2004. Ep istasis: too often neglected in complex trait studies. Nat Rev Genet ., 5 : 618 625. Cating, R., A. Palmateer and R. McMillan, 2009. Occurance of Sclerotiumr rolfsii on Ascocentrum and Ascocenda orchids in Florida. Phytopathology, 99(6): S19. Chahal, G. and S. Gosal, 2002. Principles and procedures of plant breeding: biotechnological and conventional approaches Alpha Science Int'l Ltd. Chellemi, D. 1998. Alternative to methyl bromide in Florida tomatoes and peppers. The IPM Practitioner, 20(40) : 1 6. Cilliers, A.J., L. Herselman and Z.A. Pretorius, 2000. Genetic v ariability within and among mycelial compatibility groups of Sclerotium rolfsii in South Africa. Phytopathology 90: 10261031. Cook, R.J., W.L. Bruckart, J.R. Coulson, M.S. Goettel, R.A. Humber, R.D. Lumsden, J.V. Maddox, M.L. McManus, L. Moore, S.F. Meye r, P.C. Quimby, J.P. Stack and

PAGE 104

104 J.L. Vaughn, 1996. Safety of microorganisms intended for pest and disease plant control : a framework for scientific evaluation. Biological Control 7 : 333351. Csinos A. S., D.K. Bell, N.A. Minton and H.D. Wells, 1983. Evalu ation of T richoderma spp., fungicides, and chemical combinations for control of southern stem rot on peanuts. Peanut Science, 10: 7579. Curzi, M., 1931.Contributo alla conoscanza della biologia e della sistematica degli stipiti della. Sclerotium rolfsii R. Accad. Lincei Randic. 15: 241 245. Davey, A. E. and L.D. Leach, 1941. Experiments with fungicides for use against Scelerotium rolfsii in soils. Hilgerdia 13: 523547. Deynze, A K. Stoffel, R. R Buell, A. Kozik, J. Liu, E. Knaap and D. Francis 2007. Diversity in conserved genes in tomato. BMC Genomics 8 : 465. Dutton, M.V. and C.S. Evans, 1996. Oxalate production by fungi : its role in pathogenicity and ecology in the soil environment. Can. J. Microbiol ., 42: 881895. Duvick, N.D. 1996. Personal pers pective plant breeding, an ev olutionary concept. Crop Sci., 36(3) : 539 548. Edson, H.A. and N. Shapovalov 1923. Parasitism of Sclerotium rolfsii on Irish Potatoes. Jour. Agr. Res. 23: 41 46. Enivronmental Protection Agency. 2007. Available from: www.epa.gov/opprd001/rup/rup6mols.htm [Accessed January 2010]. Epps, W.M., J.C. P atterson and I.E. Freeman, 1951. Physiology and paratism of Sclerotium rolfsii. Phytopathology 41: 245256. Errakhi, R. P. Meimoun, A. Lehner, G. Vidal, J. Briand, F. Corbineau, J.P Rona, F. Bouteau, 2008. Anion channel activity is necessary to induce ethylene synthesis and programmed cell death in response to oxalic acid. J. Exp. Bot. 59: 3121 3129. Fajardo,T.G. and J. M. Mendoza, 1935. Studies on the Sclerotium rolfsii Sacc. attacking tomato, peanuts, and other plants in the Philippines. Philippine J. of Agr. 6 : 387424. FAOSTAT Agriculture 2008. Available from: http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#ancor [Accessed March 2009]. Fery, R. and P. Dukes, 2005. Potential for utilization of pepper germplasm with a variable reaction to Sclerotium rolfsii Sacc. to develop southern blight resistant pepper ( Capsicum annuum L.) cultivars. Plant Genetic Resources 3: 326 330.

PAGE 105

105 Flores Moctezuma, H.E., A. Montes Belmont, R. Jimenez Perez, R. Nava Juarez, 2006. Pathogenic diversity of Sclerotium rolfsii isolates from Mexico, and potential control of southern blight through solarization and organic amendments, Crop Prot ., 25: 195201. Freire, F.C.O., J.E. Cardoso, A. dos Santos, F.M.P. Viana, 2002. Diseases of cashew nut plants ( Anacardium occidentale L.) in Brazil. Crop Prot., 21: 489 494. Fulton, T.M., J. Chunwongse and S.D. Tanksley, 1995. Microprep protocol for extraction of DNA from tomato and other herbaceous plants. Plant Mol. Biol. Reptr. 13(3) : 207209. Ganesan, S., R. Ganesh Kuppusamy and R. Sekar, 2007. Integrated management of stem rot disease ( Sclerotium rolfsii) of groundnut ( Arachis hypogaea L.) using rhizobium and Tricoderma harzianum (ITCC 4572). Turk. J. Agri c. For., 31: 103108. Garren, K.H., 1959. The stem rot of peanuts and its control. Virginia Agr. Exp. St a. Bull. 144. Glazebrook, J., 2005. C ontrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 2005. 43:205 27. Gordon, A. and A. Taylor, 1941. The Photolysis of Methyl Bromide. J. Am. Chem. Soc. 63(12) : 34353441. Goto, K. 1935. Sclerotium rolfsii Sacc. in perfect stage III. Variation in cultures originated from basidiospores. Jour Soc. Trop. Agr. Formosa 7 : 331345. Hassan, A.A. and K.E. A. Abdel Ati, 1999. Genetics of Tomato yellow leaf curl virus tolerant derived from Lycopersicon pimpinellifolium and Lycopersicon pennellii Egypt. J. Hortic. 26: 323 338. Hassan, A. A., H.M. Mazayd, S. E. Moustafa, S.H. Nassar, M.K. Nakhla and W.L. Sims, 1984. Genetics and heritability of tomato yellow leaf curl virus tolerance derived from Lycopersicon pimpinellifolium European Association for Research on Plant Breeding. Tomato Working Group. Wageningen, Netherlands, pp: 8187. Higgins, B.B. 1923. The disease of pepper. Georgia Agr. Exp. Sta. Bull. 141: 4875. Higgins, B.B. 1927. Physiology and parasitism of Sclerotium rolfsii Sacc. Phytopathology 17: 417448. Higgins, B.B. 1934. Important disease of pepper in Georgia. Georgia Agr. Exp. Sta. Bull. 186: 1 20.

PAGE 106

106 Howard, P. H. 1991. H andbook of environmental fate and exposure data for organic chemicals : Pesticides. CRC Press Hudgins, H.R. 1952. Relation of nitrogen concentration to the development of southern blight of peanuts. M.S. T hesis Texas Agr. and Mechanical Coll., U.S.A. Hutton, S.F., 2008. Inheritance and mapping of resistance to bacterial spot race t4 ( Xanthomonas perforans ) in tomato, and its relationship to race t3 hypersensitivity, and inheritance of race t3 hy persensitivity from PI 126932. Ph D Thesis University of Florida, U.S.A. Inami, S. and S. Suzuk i, 1981. Breeding alfalfa, Medicago sativa L., for southern blight resistance. I. Varietal differences of the disease injury. J. Jpn. Soc. Grassland Sci. 26: 360364. Inami, S., M. Kanbe and F. Fujimoto, 1986. Breeding varieties of lucerne with resistance to southern blight. III. Increase in resistance according t o advance of selection generation and heritability values. J. Jpn. Soc. Grassland Sci. 32: 218224. Jeeva, M.L., V. Hegde, T. Makeshkumar, R.R. Nair and S. Edison, 2005. Dioscorea alata, a new host of Sclerotium rolfsii in India. New D isease Reports 10: 49. Jenkins, S.F. and C.W. Averre, 1986. Problems and progress in integrated control of southern blight of vegetables. Plant disease 70(7) : 614619. Jha, G. and K. Thakur, 2009. The Venturia apple pathosystem : Pathogenicity mechanisms and plant defense responses. J. Biomed. Biotechnol. Ji, Y., D.J. Schuster, and J.W. Scott, 2007. Ty 3, a begomovirus resistance locus near the tomato yellow leaf curl virus resistance locus Ty 1 on chromo some 6 of tomato. Mol. Breeding, 20: 271284. 2009: 1 10. Jones, J.B., J.P. Jones, R.E. Stall, and T.A. Zitter, 1991. Compendium of tomato diseases. Amer. Phytopathol. Soc., St. Paul, Minnesota. Kasrawi, M. A. and A. Mansour, 1994. Genetics of resistance to t omato y ellow leaf curl virus in tomato. J. Hortic. Sci., 69: 10951100. Kim, K., J.Y. Min and M.B. Dickman 2008. Oxalic Acid Is an Elicitor of Plant Programmed Cell Death during Sclerotinia sclerotiorum Disease Development Mol. Plant Microbe Interact. LatundeDada, A.O. 1993. Biological control of southern blight disease of tomato caused by Sclerotium rolfsii with simplified mycelial formulations of Trichoderman koningii Plant Pathology 42: 522529. 21: 605612

PAGE 107

1 07 Leach, L. D. and A.E. Davey, 1942. Reducing southern Scelrotium rot of sugar beets with nitrogenous fertilizers. J. Agr. Res. 64: 1 18. Lee, J.M. and M. Oda, 2003. Grafting of herbaceous vegetables and ornamental crops. Hort Rev ., 28: 61124. Lee, J. M 2003. Advances in vegetable grafting. Chronica Hort ., 43: 1319. Leeper, P., S. Phatak D. Bell, B. George, E. Cox, G. Oerther and B. Scully, 1992. Southern blight resistant tomato breeding lines : 5635M, 5707M, 5719M, 5737M, 5876M, and 5913M. HortScience, 27(5) : 475478. Lehner, A., P. Meimoun, R. Err akhi, K. Madiona, M. Barakate and F. Bouteau, 2008. Toxic and signaling effects of oxalic acid. Plant Signaling & Behavior, 3: 746748. Linderman, G.R. and G.R. Gilbert, 1973. Behavior of sclerotia of Sclerotium rolfsii produced in soil or in culture regar ding germination stimulation by volatiles, fungistasis, and sodium hypochlorite treatment. Phytopathology 63: 500503. Liua, B. D Glennb and K. Buckleyc, 2008. Trichoderma communities in soils from organic, sustainable, and conventional farms, and their relation with Southern blight of tomato. Soil Biol. Biochem ., 40 : 1 124 1136. Livingstone, D., J.L. Hampton, P.M. Phipps and E.A. Grabau, 2005. Enhancing resistance to Sclerotinia minor in peanut by expressing a barley oxalat e oxidase gene. Plant Physiol. 137: 13541362. Lyle, J.A. 1953. A comparative study of Sclerotium rolfsii Sacc. and Sclerotium delphinii Welch. Ph.D thesis (unpublished). University of Minnesota, U.S.A. McColloch, L.P., H.T. Cook and W.R. Wright 1968. Market disease of tomatoes, peppers, and eggplants. Agr. Hdbk. no.28, U.S. Dept. Agr. Res. Serv., Washington, D.C. U.S.A. Milthorpe, F.L. 1941. Studies on Corticium rolfsii (Sacc.) Curzi (Sclerotium rolfsii Sacc.) I. Cultural characters and perfect stage. II. Mechanism of parasitism. Pr oc. Linn. Soc., 66: 65 75. Mohr, H.C. and G.M. Watkins, 1959. The nature of resistance to southern blight in tomato and the influence of nutrition on its expression. Proc. Amer. Soc. Hort. Sci., 74: 484493. Mohr, H.C. 1955. Resistance in Lycopersicon pi mpinellifolium Mill. to southern blight caused by Sclerotium rolfsii Sacc. Ph D Thesis M699, Texas A&M Univ ersity U.S.A.

PAGE 108

108 Mohr, H.C., V.A. Greulach and A.A. Dunlap, 1947. Recent studies of southern blight and root know of tomatoes. Tex. Agr. Exp. Sta. P rog. Rept. 1092. Muller, C.H. 1940. A revision of the genus Lycopersicon. U.S.Dept. Agr. Misc. Publ. No, 382, pp: 129. Mundkur, B.B. 1934. Perfect stage of Sclerotium rolfsii Sacc. in culture. Indian Jour. Agr. Sci. 4 : 779781. Nalim, F.A., J.L. Starr K.E. Woodard, S. Segner and N.P. Keller, 1995. Mycelial compatibility groups in Texas peanut field populations of Sclerotium rolfsii. Phytopathology 85: 15071512. Naqvi, S.A.M.H., 2004. Disease of fruits and vegetables: Diagnosis and Management. Volume 1. Kluwer Academic Publishers. Nash, A.F. and R.G. Gardner, 1988a. Heritability of tomato early blight resistance derived from Lycopersicon hirsutum PI 126445. J. Am. Soc. Hort. Sci., 113: 264268. Nisikado, Y., K. Hirata and T. Higuti, 1938. Studies on the temperature relations to the longevity of pure culture of various fungi, pathogenic to plants. Ber. Ohara. Inst., fur L andwirtschaftliche. Forschungen, 8(2) : 107124. Parvez, S., 2006. Recent advances in understanding genetic basis of heterosis in ric e ( Oriza sativa L.) Revista Cientfica UDO Agrcola 6 : 1 10. Prez de Castro, A., M. J. Dez and F. Nuez, 2007. Inheritance of Tomato yellow leaf curl virus resistance derived from Solanum pimpinellifolium UPV16991. Plant Dis. 91: 879885. Phatak, S.C. and K.D. Bell, 1983. Screening for Sclerotium rolfsii resistance in the tomato.In: Proc.4th Tomato Quality Wrkshp, Veg. Crops Res.Rpt., VEC 831, Dept. Veg. Crops, Inst. Food and Agr. Sci., Univ. of Florida, Gainesville. pp: 107. Pimental, D., and A. Wilso n, 2004. World population, agriculture, and malnutrition. World Watch Magazine, 17(5) : 2225. Polizzi, G., D. Aiello, V. Guarnaccia, G. Parlavecchio and A. Vitale, 2010. First report of southern blight on silverbush ( Convolvulus cneorum ) caused by Sclerotium rolfsii in Italy. Plant Dis ., 94: 131. Povah, A. 1927. Notes on reviving old cultures. Mycologia, 19: 317319. Pratt, R. G. and D.E. Rowe, 2002. Enhanced resistance to Sclerotium rolfsii in populations of alfalfa selected for resistance to Sclerotinia trifoliorum Phytopathology 92: 204209.

PAGE 109

109 Punja, Z.K. and L.J Sun, 1997. Genetic diversity among mycelial compatibility groups of Sclerotium rolfsii and Sclerotium delphini. In: Programme and summaries of the 11th biennial conference of the Australian Plant Pathology Society. Perth, Australia 29th September 2nd October 1997, p p : 110. Punja, Z.K. and R.G. Grogan, 1982. Effects of inorganic salts, carbonatebicarbonate anions, ammonia, and the modifying influence of pH on sclerotial germination of Sclerotiu m rolfsii. Phytopathology 72: 635639. Punja, Z.K., 1985. The biology, ecology and control of Sclerotium rolfsii. Ann. Rev. Phytopathol. 23: 97127. Punja, Z.K., S.F. Jenkins and R.G. Grogan, 1984. Effect of volatile compounds, nutrients, and source of sc lerotia on eruptive sclerotial germination of Sclerotium rolfsii. Phytopathology 74: 12901295. Ragsdale, N. N. and W.B. Wheel er, 1995. Methyl bromide r isks, benefits, and current status in pest control. I n : Review of Pesticide Toxicology, R. M. Roe and R J. K uhr (Eds.). Raleigh, N orth C arolina: Toxic Communication Inc., pp: 2144. Retig, N., N. Kedar and J. Katan, 1967. Penetrance of gene I for Fusarium resistance in the tomato. Euphytica 16: 252257. Reyes Valdes M H ., 2000. A model for marker based selection in gene introgression breeding programs. Crop Sci. 40: 9198. Ribaut J. M and D. Hoisington, 1998. Marker assisted selection: N ew tools and strategies. Trends Plant Sci., 3: 236239. Rick C.M. 1958. The role of natural hybrization in the der ivation of cultivated tomatoes in western South America. Econ. Bot. 12: 346367. Rick, C. M. 1988. Molecular markers as aids for germplasm management and use in Lycopersicon. HortScience. 23 : 5557. Ristaino, J.B., K.B. Perry and R.D. Lumsden, 1991. Ef fect of solarization and Gliocladium virens on sclerotia of Sclerotium rolfsii, soil microbiota, and incidence of southern blight on tomato. Phytopathology 81: 11171124. Rivard, C.L. and F.J.Louws, 2008. Grafting to manage soil borne disease in heirloom tomato production. HortScience, 43(7): 21042111. Rivard, C.L., F.J. Louws, S. O'Connell and M.M. Peet, 2009. Grafting tomato with inter specific rootstock provides effective management for southern blight and root knot nematodes. Phytopathology 99(6): S1 09.

PAGE 110

110 Rodriguez Kabana, R., K.M. Beute and A.P. Backman, 1980. A method for estimating numbers of viable sclerotia of Sclerotium rolfsii in soil. Phytopathology 70(9) : 917919. Rosen, H.R. 1929. Studies on Sclerotium rolfsii with special reference to the m etabolic interchange between soil inhabitants. Arkansas. Agr. Exp. Sta. Annu. Rep., pp: 66. Saccardo, P.A. 1911. Notes mycologicae. Ann. Mycel. 9 : 252261. Salvador R M. J Dez and F. N uez, 1998. Genetics of tomato spotted wilt virus resistance coming from Lycopersicon peruvianum Eur. J. of Plant Pathol. 104: 499509. Sankaran, K., E.M. Florence and J. Sharma, 2007. Two new diseases of forest tree seedlings caused by Sclerotium rolfsii in India. Eur J For Pathol ., 14(45) : 318 320. Sconyers, L.E., T.B. Brenneman, K.L. Stevenson and B.G. Mullinix, 2005. Effects of plant spacing, inoculation date, and peanut cultivar on epidemics of peanut stem rot and tomato spotted wilt. Plant Dis ., 89(9) : 969974. Semagn, K., A. Bjo rnstad and M. N. Ndjiondjop, 2006. P rogress and prospects of marker a ssisted backcrossing as a tool in crop breeding programs Afri J. Biotechnol ., 5 (25) : 25882603. Shah, D.A. and L.V. Madden, 2004. Nonparametric analysis of ordinal data in designed factorial experiments. Phytopathol ogy 94:3343. Sharma, B. K., U.P. Singh, K.P. Singh, 2002. Variability in Indian isolates of Sclerotium rolfsii. Mycologia 94(6) : 10511058. Sharma, D. and N.S. Jodha, 1984. Pulse production in Semi arid region of India. Proceedings of Pulses Production, Constraints and Opportunities. p p. 241265. Sherf, A.F. and A.A. MacNab, 1986. Vegetable diseases and there controls. John Wiley & Sons. Shukla, R. and A. K. Pandey. 2008. Pathogenic diversity of Sclerotium rolfs ii isolates, a potential biocontrol agent against Pa rthenium hysterophorus L. Afr. J. Environ. Sci. Technol. 2: 124126. Shukla, R. and A.K. Pandey, 2007. Diversity in mycoherbicidal agent Sclerotium rolfsii isolates from Centr al India. J.Mycol. Pl. Pathol., 37(3) : 514518. Sleper, D.A. and J.M. P oehlman, 2006. Breeding field crops. 5th Edn., Blackwell Publishing.

PAGE 111

111 Smith, A.M., 1972. Drying and wetting sclerotia promotes biological control of Sclerotium rolfsii Sacc. Soil. Biol. Bio chem ., 4 : 125129. Sofi, P.A., A.G. Rather and K. Warsi, 2007. Impl ications of epistasis in maize breeding. Int. J. Plant Breed. Genet., 1 : 1 11. Soller, M., T. Brody and A. Genizi, 1976. On the power of experimental designs for the detection of linkage between marker loci and quantitative loci in crosses between inbred l ines. Theor. Appl. Genet. 47: 3539. Soumpourou, E., M. L akovidis, L. Chartrain, V. Lyall and C. Thomas, 2007. The Solanum pimpinellifolium Cf ECP1 and Cf ECP4 genes for resistance to Cladosporium fulvum are located in the Milky Way locus on the short arm of chromosome 1. Theor. Appl. Genet. 115: 11271136. Spreen, T. H., J.J. Van Sickle A.E. Moseley, M.S. Deepak, and L. Mathers, 1995. Use of methyl bromide and the economic impact of its proposed ban on the Florida fresh market fruit and vegetable indust ry. Bull. Univ. Fla. Exp. Stn. No. 898. Sugha, S.K., B.K. Sharma and P.D. Tyagi, 1991. A modified technique for screening chickpea ( Cicer arietinum ) varieties against collar rot caused by Sclerotium rolfsii. Indian J. Agric. Sci. 61(4) : 289290. Suliman P ollatschek, S., K. Kashkush, H. Shats, and U. Lavi, 2002. Generation and mapping of AFLP, SSRs and SNPs in Lycopersicon esculentum Cell. Mol. Biol. Lett. 7 : 583 597. Tanksley, S. and S. McCouch, 1997. Seed banks and molecular maps : unlocking genetic potential from the wild. Science 277(5329) : 1063 1066. Tanksley, S.D., N.D. Young, A.H. Paterson and M.W. Bonierbale, 1989. RFLP mapping in plant breeding: new tools for an old science. BioTechnology 7 : 257264. Taubenhaus, J.J. 1919.Recent studies on Scler otium rolfsii Sacc. J. Agr. Res. 18(3) : 127138. Thangavelu, R. and M.M. Mustaffa, 2010. First report of corm rots disease caused by Sclerotium rolfsii in banana. Australasian Plant Disease Notes 5(1) : 3033. Tigchelaar, C. E. 1986. Tomato breeding. I n : Breeding for Vegetable Crops, Bassett, M.J. ( Ed s.)., AVI, Westport, Conn., pp: 135171. United Nations Environment Programme (UNEP), 1995. 1994 Report of the m ethyl b romide t echnical o ptions committee. Montreal Protocol on substances that deplete the o zone Layer. United Nations Ozone Secretariat, Nairobi, Kenya.

PAGE 112

112 United States Department of Agriculture (USDA) 2008. Available from: www.nass.usda.gov/Statistics_by_Subject/index.asp [Accessed May 2009]. United St ates Department of Agriculture,1993. The Biologic al and Economic Assessment of Methyl Bromide. Available from: http://pmep.cce.cornell .edu/profiles/fumigant/methyl_bromide/methbrom_rsk_0193.h tml [Accessed May 2009]. University of Georgia. 2005. Available from http://pubs.caes.uga.edu/caespubs/pubcd/SB410 7/SB4107.html#Pecan [Accessed May 2009]. Vallad, G.E., Q.M. Qin, R. Grube, R.J. Hayes and K.V. Subbarao, 2006. Characterization of racespecific interactions among isolates of Verticillium dahlia pathogenic on lettuce. Phytopathology, 96: 13801387. VanS ic kle, J.J. and A. Hodges, 2008. U.S. production trends and the impact of the Florida fresh market tomato industry to the economy of Florida. Food and resource economics department, Florida cooperative extension service, IFAS, University of Florida. Publis hed September 2008. Available from http : //edis.ifas.ufl.edu. [Accessed March 2009]. Vos, P., R. Hogers and M. Bleeker, 1995. AFLP : A new technique for DNA fingerprinting. Nucleic Acids Research, 23(21) : 4407 4414. Wa ng S., C.J. Basten and Z.B. Zeng, 2010. Windows QTL Cartographer 2.5. Department of Statistics, North Carolina State University, Raleigh, NC. Available from http://statgen.ncsu.edu/qtlcart/WQTLCart.htm [Accessed January 2010]. Watkins, G.M. 1950. Germination of sclerotia of Sclerotium rolfsii after storage at various relative humidity levels. Phytopathology, 40: 31. Weber,G.F. and G.B. Ramsay, 1926.Tomato di sease in Florida. Florida Agr. Exp. Sta. Bull. 185: 61138. West, E. 1961. Sclerotium rolfsii, history, taxonomy, host range and distribution. Phytopathology 51: 108109. Yang, W., S.A. Miller, J.W. Scott, J.B. Jones and D.M. Francis, 2005. Mining tomat o genome sequence databases for molecular markers application to bacterial resistance and marker assisted selection. Acta Hort. 695 : 241250. Yang, W., X. Bai, E, Kabelka C. Eaton, S. Kamoun, E.D.F. V an der Knaap, 2004. Discovery of single nucleotide pol ymorphisms in Lycopersicon esculentum by computer aided analysis of expressed se quence tags. Molecular Breeding, 14: 2124.

PAGE 113

113 Young, N D and S.D. Tanksley 1989a. RFLP analysis of the size of chromosomal segments retained around the tm 2 locus of tomato dur ing backcross breeding. Theor. Appl. Genet. 77 : 353 359. Young, N D ., D. Zamir M.W. Ganal and S.D. Tanksley 1988. Use of isogenic lines and simultaneous probing to identify DNA markers tightly linked to the Tm 2a gene in tomato. Genetics 120: 579585. Young, P. A. 1946. Tomato disease in Texas. Texas Agr. Exp. Sta. Circ. pp: 113. Young, P.A. 1954. Experimental control of southern blight on tomato. Plant Dis. Reptr. 38: 858.

PAGE 114

114 BIOGRAPHICAL SKETCH Mehul Samir Bhakta was born in Navsari, India. Influenced by his grandfather and brother he decided to pursue a B.S. degree in agricultural science. He graduated from Navsari Agricultural University earlier known as Gujarat Agricultural University in the year 2006. Being fascinated by the advancement in genetics and the changes it could bring to agriculture he joined Dr. Jeremy Edwardss tomato genetics and plant breeding program at University of Florida in the year 2008 as a m aster s student.