<%BANNER%>

Characterization of the Relq Operon, and the Effects of (p)ppgpp on the Global Gene Regulation in Streptococcus Mutans

Permanent Link: http://ufdc.ufl.edu/UFE0042204/00001

Material Information

Title: Characterization of the Relq Operon, and the Effects of (p)ppgpp on the Global Gene Regulation in Streptococcus Mutans
Physical Description: 1 online resource (107 p.)
Language: english
Creator: Garrett, Steve
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: acka, mutans, ppgpp, ppnk, pta, rela, relq, rlue, streptococci, streptococcus
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Streptococcus mutans is the main causative agent of dental caries. The virulence of S. mutans stems from its ability to initiate biofilim formation, fermentation of carbohydrates to organic acids, and effective adaptive mechanisms to handle various stresses in the environment. The molecular alarmone (p)ppGpp is a key molecule involved in adaptation to stress. In S. mutans, (p)ppGpp synthesis is catalyzed by three gene products: RelA, RelP and RelQ. We show that relQ is co-transcribed in an operon along with an NAD kinase (ppnK), a pseudouridine synthase (rluE) and a phosphotransacetylase (pta). We also show the presence of an additional pta promoter that lies within the coding region of the relQ operon and is regulated by the products of relQ, ppnK, and pta. Individual deletion/replacement mutations were made in relQ, ppnK, rluE, pta and the acetate kinase gene ackA, along with polar mutants defective in both rluE and pta, and double mutants lacking rluE/pta and ackA/pta. The growth characteristics of all strains were compared with the wild-type strain in normal and stressed conditions. The relQ mutant displayed an acid-sensitive phenotype as evidenced by slow growth, compared with all other strains, at pH 5.5. The pta mutant showed the most profound growth defect when cultured in the presence of air, in medium containing the superoxide-generator paraquat, and in excess concentrations of acetate when grown in the presence of air. The pta mutant strain also displayed a compromised ability to form biofilms in BM medium with 10 mM sucrose or 20 mM glucose. Notably, deletion of rluE in strains lacking the pta gene reversed the slow-growth phenotype in air, with the rluE/pta double mutant growing at a rate similar to the wild-type strain. Growth rates of the pta deletion mutant when grown in 50mM acetate with and without air were also drastically different, as excess acetate has much less impact on the pta mutant when grown in anaerobic conditions. The drastic differences in the growth rates of the ackA and ackA/pta double mutant compared to the pta mutant suggest that the observed phenotypes might be a response to varying levels of acteyl-phopshate. Microarray analysis was performed to determine the effects on global gene expression by (p)ppGpp. The transcriptome of a (p)ppGpp0 triple mutant lacking all three (p)ppGpp synthetases was compared against wild type. One hundred thirty two genes were differentially regulated with a p-value < 0.005. The genes that were the most upregulated in the triple mutant encoded for the pyruvate dehydrogenase complex, which is responsible for the transformation of pyruvate into acetyl-CoA. We also showed that overexpression of relP causes slowed growth and that these changes in growth correlate with small differences in (p)ppGpp levels. The data presented in this study show evidence for linkage of (p)ppGpp, the relQ operon, and overall stress response that are key to the virulence traits exhibited by the caries pathogen S. mutans.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Steve Garrett.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Burne, Robert A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042204:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042204/00001

Material Information

Title: Characterization of the Relq Operon, and the Effects of (p)ppgpp on the Global Gene Regulation in Streptococcus Mutans
Physical Description: 1 online resource (107 p.)
Language: english
Creator: Garrett, Steve
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: acka, mutans, ppgpp, ppnk, pta, rela, relq, rlue, streptococci, streptococcus
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Streptococcus mutans is the main causative agent of dental caries. The virulence of S. mutans stems from its ability to initiate biofilim formation, fermentation of carbohydrates to organic acids, and effective adaptive mechanisms to handle various stresses in the environment. The molecular alarmone (p)ppGpp is a key molecule involved in adaptation to stress. In S. mutans, (p)ppGpp synthesis is catalyzed by three gene products: RelA, RelP and RelQ. We show that relQ is co-transcribed in an operon along with an NAD kinase (ppnK), a pseudouridine synthase (rluE) and a phosphotransacetylase (pta). We also show the presence of an additional pta promoter that lies within the coding region of the relQ operon and is regulated by the products of relQ, ppnK, and pta. Individual deletion/replacement mutations were made in relQ, ppnK, rluE, pta and the acetate kinase gene ackA, along with polar mutants defective in both rluE and pta, and double mutants lacking rluE/pta and ackA/pta. The growth characteristics of all strains were compared with the wild-type strain in normal and stressed conditions. The relQ mutant displayed an acid-sensitive phenotype as evidenced by slow growth, compared with all other strains, at pH 5.5. The pta mutant showed the most profound growth defect when cultured in the presence of air, in medium containing the superoxide-generator paraquat, and in excess concentrations of acetate when grown in the presence of air. The pta mutant strain also displayed a compromised ability to form biofilms in BM medium with 10 mM sucrose or 20 mM glucose. Notably, deletion of rluE in strains lacking the pta gene reversed the slow-growth phenotype in air, with the rluE/pta double mutant growing at a rate similar to the wild-type strain. Growth rates of the pta deletion mutant when grown in 50mM acetate with and without air were also drastically different, as excess acetate has much less impact on the pta mutant when grown in anaerobic conditions. The drastic differences in the growth rates of the ackA and ackA/pta double mutant compared to the pta mutant suggest that the observed phenotypes might be a response to varying levels of acteyl-phopshate. Microarray analysis was performed to determine the effects on global gene expression by (p)ppGpp. The transcriptome of a (p)ppGpp0 triple mutant lacking all three (p)ppGpp synthetases was compared against wild type. One hundred thirty two genes were differentially regulated with a p-value < 0.005. The genes that were the most upregulated in the triple mutant encoded for the pyruvate dehydrogenase complex, which is responsible for the transformation of pyruvate into acetyl-CoA. We also showed that overexpression of relP causes slowed growth and that these changes in growth correlate with small differences in (p)ppGpp levels. The data presented in this study show evidence for linkage of (p)ppGpp, the relQ operon, and overall stress response that are key to the virulence traits exhibited by the caries pathogen S. mutans.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Steve Garrett.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Burne, Robert A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042204:00001


This item has the following downloads:


Full Text





CHARACTERIZATION OF THE RELQ OPERON, AND THE EFFECTS OF (P)PPGPP
ON THE GLOBAL GENE REGULATION IN STREPTOCOCCUS MUTANS














By

STEVEN GARRETT


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2010

































2010 Steven Garrett



























To the two women in my life, Mom and Kati









ACKNOWLEDGMENTS

I would like to thank first and foremost Dr. Burne for his support and guidance

throughout this entire project. I would also like to thank my supervisory committee, Dr.

Brady and Dr. Gulig. Their input, suggestions, and encouragement to think freely

played a huge role in this thesis.

Without the help of Dr. Ahn, none of this work would have been possible. So

much of his time, hard work, and energy was put into not only this work, but also to

make sure I was learning along the way. I thank him tremendously for his invaluable

help. All the rest of the Burne Lab members have contributed in some way to this

research, so a big thank you to Chris, Kinda, Dr. Zeng, Dr. Liu, Dr. Korithoski, Matt, and

Nicole.

A big thank you has to go out to my family and friends, whose continued love and

support throughout this process encouraged me throughout the past two years.









TABLE OF CONTENTS

page

A C KN O W LED G M ENTS ............................ ............... ......................................... 4

L IS T O F T A B L E S ............................................................................................................ 7

LIS T O F F IG U R E S .................................................................. 8

A B S T R A C T ................................................................................................................... 1 0

CHAPTER

1 IN T R O D U C T IO N .................................................... .......... 12

Background on Streptococcus m utans ................................................................. 12
T he Stringent R epsonse .................................................................................. 16
PpnK an NAD kinase............................................ 20
RluE a pseudouridine synthase ........................ ..... ......... ......... 21
Pta a phosphotransacetylase................ ................. ......... 22
S u m m a ry ............. ......... .. .............. .. .................................................... 2 3
Specific Aim s ............... .................................... ....... ..... .. ......... 24

2 MATERIALS AND METHODS .................. ......................... 27

Bacterial Strains and Growth Conditions ........... .................... 27
Growth Rate and Biofilm Assays .......... .............. .. .............. 27
Construction of CAT Mutants and CAT Assays ................................................. 28
RNA M manipulations ................................................................ ........................... 28
ReIQ Operon Structure................. ............ 29
Microarray Experiments........................... ........ 29
Real-Time Quantitative RT-PCR ...... .................... ......... 29
(p)ppGpp Assays .................................................................. ... ......... 30

3 CHARACTERIZATION OF THE RELQ OPERON IN S. MUTANS UA159............. 33

Introduction ..................... ..................... 33
R e s u lts ................................... ........... .. ................. ........ ................. 3 3
Verifying the Organizational Structure of the relQ Operon by RT-PCR............ 33
Putative Internal pta Promoter in the relQ Operon ...................................... 34
Phenotypic Characterization of the Various relQ Operon Mutants ................... 35
Growth in BHI............................................................... 35
Growth in paraquat ............... .... ............................. 35
G row th in hydrogen peroxide ................................................. ... ....... 36
Growth at pH 5.5.................................... ............... 36
G row th in acetate .................................. ......................... ............ 37
B iofilm fo rm atio n .................................. .................................................... 38









Regulation of a Putative internal pta Promoter Within the RelQ Operon.......... 38
Discussion .............. .. ......... ..... ........................ 39
Summary .............. .. ......... ..... ........................ 47

4 THE ROLE OF (P)PPGPP IN THE GLOBAL GENE REGULATION OF S.
M UTANS ............... ....... .................... .... ................ ............... 65

Introduction ............................. ............... 65
Results ............... ...................................................... ............... 65
Growth Rates of Mutant Strains .......... ............ .................... ....... .. 65
Microarray Analysis of a ArelAPQ Mutant ............ ..................................... 66
Microarray Confirmation by Real-Time PCR ................. ............................ 66
Overexpression Using the Nisin Inducible Expression Vector pMSP3535....... 67
O verexpression of RelP...................... .......... ............................ 67
Growth Rates W ith RelP Overexpression......................... .................... 67
Levels of (p)ppGpp In RelP Overexpression ......... ............. ............... 68
Microarray Analysis of RelP Overexpression ............ ................................ 69
D is c u s s io n ............. ......... .. .............. .. .................................................. 6 9
S u m m a ry ............. ......... .. .............. .. .................................................... 7 3

5 SUMMARY AND FUTURE DIRECTIONS ........................ ................... 87

Summary and Concluding Remarks ..................... ..................... ....... .. 87
Future Directions ............. .... ................................ .. .... .... ........... 91

LIST OF REFERENCES ................................. .................... 96

B IO G RA PH ICA L SKETC H ...................... .. ............. .. ....................... ............... 107























6









LIST OF TABLES

Table page

2-1 Strains used in this study...................... ....... ................ .............. 31

2-2 Prim ers used in this study ................................................. .... .................. 32

4-1 Microarray data comparing triple mutant ArelAPQ to WT strain......................... 76

4-2 Real-time confirmation of microarray data .................................................. 81









LIST OF FIGURES


Figure page

1-1 Pathways of carbohydrate metabolism by S. mutans....................................... 25

1-2 O organizational structure of the relQ operon....................................................... 26

3-1 Positions of primer pairs used for RT-PCR to verify relQ operon structure ........ 49

3-2 RT-PCR confirming the proposed relQ operon structure................. ........ 50

3-3 Expression levels of the pta transcript via real-time PCR................................. 51

3-4 CAT activity of the 291 bp region directly upstream of the ATG start site of
p ta ....................... ...... .......... .................................................. ........ ............... 5 2

3-5 Promoter prediction using BPROM of the 291 bp region upstream of the ATG
start site of pta ............ .. ..... ......... ................................... 53

3-6 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with an oil overlay ....... .. ...................... .............. ..... 54

3-7 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI without an oil overlay ................................ ........ ...... 55

3-8 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with 25mM Paraquat and an oil overlay............................. 56

3-9 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with 0.001% and 0.002% H202 and an oil overlay.............. 57

3-10 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI pH 5.5 and an oil overlay. ............. .................................. 58

3-11 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with 0 mM excess acetate ........................................... 59

3-12 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with 50 mM excess acetate................ ....... ............. .. 60

3-13 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with 0 mM excess acetate with an oil overlay ................. 61

3-14 Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with 50 mM excess acetate with an oil overlay. ................ 62

3-15 Biofilm assay of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta,
and A pta in 20 m M glucose ......... ............... ............................ ............... 63









3-16 Biofilm assay of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta,
and Apta in 10 m M sucrose ...... .................. .. ................. .......... ............... 64

4-1 Growth of S. mutans UA159, UA159-pMSP3535, ArelAPQ, ArelAPQ-
pMSP3535, ArelAPQ-relP, ArelAPQ-relQ, ArelAPQ-relA in the defined
m edium FM C w ith an oil overlay............................ ........................... ...... 74

4-2 Growth of S. mutans UA159, UA159-pMSP3535, ArelAPQ, ArelAPQ-
pMSP3535, ArelAPQ-relP, ArelAPQ-relQ, ArelAPQ-relA in the defined media
FMC without an oil overlay ........... ........................... ............... 75

4-3 Nisin-induced expression of LacZ utilizing the pMSP3535 nisin-inducible
expression vector ......... .............. ........ ...................................... 82

4-4 Expression of relP with various concentrations of nisin utilizing the nisin-
inducible vector pMSP3535 ................................ ............... 83

4-5 Growth inhibition of ArelAPQ-pMSP3535/relP strain by varying
concentrations of nisin in FM C in 5% C0 2.................................. ..................... 84

4-6 Negative control showing the controls of nisin in the triple mutant ArelAPQ
with an empty pMSP3535 expression vector grown in FMC in 5% C02............. 85

4-7 Concentrations of (p)pppGpp via nisin-induced expression of relP .................... 86

5-1 Proposed model in non-limiting glucose and anaerobic conditions .................. 93

5-2 Proposed model in limiting glucose and anaerobic conditions .............. .......... 94

5-3 Proposed model in aerobic conditions......................... ..... ....... ..... 95









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

CHARACTERIZATION OF THE RELQ OPERON, AND THE EFFECTS OF (P)PPGPP
ON THE GLOBAL GENE REGULATION IN STREPTOCOCCUS MUTANS

By

Steven Garrett

August 2010

Chair: Robert A. Burne
Major: Medical Sciences

Streptococcus mutans is the main causative agent of dental caries. The virulence

of S. mutans stems from its ability to initiate biofilim formation, fermentation of

carbohydrates to organic acids, and effective adaptive mechanisms to handle various

stresses in the environment. The molecular alarmone (p)ppGpp is a key molecule

involved in adaptation to stress. In S. mutans, (p)ppGpp synthesis is catalyzed by three

gene products: RelA, RelP and RelQ. We show that relQ is co-transcribed in an operon

along with an NAD kinase (ppnK), a pseudouridine synthase (rluE) and a

phosphotransacetylase (pta). We also show the presence of an additional pta promoter

that lies within the coding region of the relQ operon and is regulated by the products of

relQ, ppnK, and pta. Individual deletion/replacement mutations were made in relQ,

ppnK, rluE, pta and the acetate kinase gene ackA, along with polar mutants defective in

both rluE and pta, and double mutants lacking rluE/pta and ackAlpta. The growth

characteristics of all strains were compared with the wild-type strain in normal and

stressed conditions. The relQ mutant displayed an acid-sensitive phenotype as

evidenced by slow growth, compared with all other strains, at pH 5.5. The pta mutant

showed the most profound growth defect when cultured in the presence of air, in









medium containing the superoxide-generator paraquat, and in excess concentrations of

acetate when grown in the presence of air. The pta mutant strain also displayed a

compromised ability to form biofilms in BM medium with 10 mM sucrose or 20 mM

glucose. Notably, deletion of rluE in strains lacking the pta gene reversed the slow-

growth phenotype in air, with the rluE/pta double mutant growing at a rate similar to the

wild-type strain. Growth rates of the pta deletion mutant when grown in 50mM acetate

with and without air were also drastically different, as excess acetate has much less

impact on the pta mutant when grown in anaerobic conditions. The drastic differences

in the growth rates of the ackA and ackA/pta double mutant compared to the pta mutant

suggest that the observed phenotypes might be a response to varying levels of acteyl-

phopshate. Microarray analysis was performed to determine the effects on global gene

expression by (p)ppGpp. The transcriptome of a (p)ppGppo triple mutant lacking all

three (p)ppGpp synthetases was compared against wild type. One hundred thirty two

genes were differentially regulated with a p-value < 0.005. The genes that were the

most upregulated in the triple mutant encoded for the pyruvate dehydrogenase

complex, which is responsible for the transformation of pyruvate into acetyl-CoA. We

also showed that overexpression of relP causes slowed growth and that these changes

in growth correlate with small differences in (p)ppGpp levels. The data presented in this

study show evidence for linkage of (p)ppGpp, the relQ operon, and overall stress

response that are key to the virulence traits exhibited by the caries pathogen S. mutans.









CHAPTER 1
INTRODUCTION

Background on Streptococcus mutans

Streptococcus mutans is a gram positive, facultative anaerobe that belongs to the

phylum Firmicutes. Members of the Streptococcus species can be categorized based

on their hemolytic properties (11). S. mutans can oxidize the iron in hemoglobin,

creating a green halo around colonies on blood agar. This oxidation of iron is known as

alpha hemolysis, which is the reason that S. mutans falls under the a-hemolytic group

(11). S. mutans is found primarily in the human oral cavity and is the main causative

agent of dental caries. The pathogenic potential of S. mutans is associated with its

ability to form biofilms on tooth enamel, to metabolize a variety of fermentable

carbohydrate sources to produce large amounts of organic acids, and to tolerate a

variety of environmental stresses. Environmental factors such as low pH, fluctuations in

nutrient availability, and aerobic to anaerobic transitions can have a profound effect on

the virulence of S. mutans (8, 22, 59).

The formation of oral biofilms, more commonly referred to as dental plaque, plays

an important role in the development of oral diseases. Biofilms are generally defined as

a community of microorganisms adhering to a surface (37, 53). Dental plaque can

consist of several hundred bacterial species including Streptococcus spp, Actinomyces

spp, Fusobacterium spp, Capnocytophaga spp, Porphyromonas spp, Neisseria spp,

Treponema spp, and Lactobacillus spp (21, 53). Plaque formation starts with the

formation of the conditioning film on a clean tooth surface. This conditioning film

consists of glycoproteins, mucins and other proteins and forms almost immediately (37,

64). This "acquired pellicle" allows adhesion of the primary colonizers, which consist









mainly of the streptococci and Actinomyces species. Subsequent attachment of the late

colonizers and cell-to-cell interactions with both the primary colonizers and one another

complete this simple model of plaque formation in the oral cavity (8, 21, 37). Numerous

studies have characterized and isolated various genes in S. mutans that lead to both

enhancement and defects in biofilm formation (19, 110, 118). These studies have

helped in gaining a better understanding of the environmental and genetic signals for

the initial attachment of these primary colonizers that play such a key role in the

development of disease.

One of the key early stages of biofilm formation by S. mutans is attachment to the

tooth surface. This key adhesion step can be mediated by either a sucrose-

independent or a sucrose-dependent mechanism (8, 111). Sucrose-independent

adhesion is driven primarily by the antigen 1/11 surface protein (66). Numerous studies

have shown the effects of mutant strains of S. mutans lacking antigen 1/11 and their

reduced ability to attach to saliva-coated hydroxyapitite (18, 58, 83). Sucrose-

dependent adhesion stems from the synthesis of glucans by glucosyltransfereases

(GTFs). The sucrase activity of GTFs catalyzes the splitting of a sucrose molecule into

fructose and glucose. The glucose molecule is then added to a growing polymer of

glucan. The primary types of glucans that can be formed from these GTFs are the

water-soluble linear polymer linked by a-1,6-glycosdic linkages and the water-insoluble,

highly branched polymer that contains mainly a-1,3-linkages (8). S. mutans possess

three GTFs encoded by gtfB, gtfC, and gtfD, and a number of studies have shown that

by inactivating one or more of the gtf genes, virulence is severely diminished (76, 104,

115).









S. mutans is extremely efficient in utilizing a variety of different carbohydrate

sources. The end products of carbohydrate metabolism by S. mutans are affected by a

number of factors, but can include lactate, format, acetate, and ethanol (Figure 1-1).

The formation of lactate by lactate dehydrogenase (LDH) is a major cause in the

reduction of pH when glucose is abundant (2, 30). This drop in pH can happen at an

alarmingly fast rate, as changes in pH from 7 to 4 have been seen in as little as 3

minutes (100). By reducing the pH of the surrounding environment, S. mutans can

change the ecological balance of the plaque flora and cause a relative increase in the

proportion of acidogenic and aciduric bacteria (8, 21). The effects of low pH caused by

production of these organic acids increase the rate of demineralization of the tooth

enamel, as sustained pH levels around 5.5 favor the demineralization of tooth enamel

and the formation of dental caries (8).

S. mutans must be able to survive the harsh conditions that the oral cavity

presents. Since S. mutans effectively acidifies its environment, it must be able to

withstand the low pH it is responsible for creating. The aciduricity of S. mutans is

mediated largely by an F1Fo-ATPase proton pump, which helps maintain an intracellular

pH approximately one unit higher than the external environment (40). The pH optima,

as well as the specific activity, of the ATPase are major contributors to the extent of acid

tolerance that S. mutans can exhibit (15). However, the ATPase is not the only

contributor to the acid-tolerance capabilities of S. mutans, as numerous other genes

and proteins have been identified in response to changes in pH. The changes in gene

transcription and protein translation that the cells utilize to adapt to acid stress, together

with the activity of the ATPase, constitute the acid tolerance response (ATR) of S.









mutans. The survival capability in low pH is greatly influenced by the time over which

the pH change occurs, as cultures of S. mutans were unable to survive with a pH drop

of 7.0 to 4.8 if the drop occurred in 10 minutes (40). However, these cells were able to

grow effectively if the drop occurred over a 24 hour time period. The acid tolerance

capabilities of this bacterium are also enhanced by the synthesis of water-insoluble

glucans and the formation of a biofilm (72). The speed of diffusion of hydronium ions is

proportional to the amount of glucan produced by S. mutans (42). As this pH drop is

occurring, the fatty acid profiles of the membrane also shift, decreasing permeability to

protons, while increasing the excretion of acidic end products (8). The ATR is extremely

important to the survival of S. mutans as it not only confers protection against low pH,

but also cross-protection from other environmental stresses, such as oxidative stress

and high osmality that it might encounter in the oral cavity (21).

Exposure to oxygen is a major source of environmental stress for S. mutans.

Microbes that colonize the mouth are subjected to varying oxygen levels (69). Growth

in these aerobic conditions presents cells with oxidative stress brought by the formation

of reactive oxygen species (ROS) such as superoxide ions and damaging radical

species. NADH oxidases convert oxygen and some of its metabolites to H20 or H202

and are responsible for the majority of the aerotolerance properties of S. mutans (43,

44). A significant change in carbohydrate metabolism is also a well known response to

oxygen (See Figure 1-1 for metabolic pathways). Pyruvate format lyase (PFL) is

responsible for the conversion of pyruvate and CoA into format and acetyl-CoA. In an

anaerobic glucose-rich environment, the major product of fermentation is lactate by

lactate dehydrogenase (LDH). In these anaerobic conditions, under glucose limitation









and in continuous culture, fermentation shifts away from lactate, and S. mutans

produces only format, acetate, and ethanol by a PFL dependent reaction (103). The

PFL enzyme is especially sensitive to oxygen and is inactivated in aerobic conditions

(103). In oxygen, pyruvate dehydrogenase (PDH) is activated, shifting the conversion

of pyruvate away from a PFL dependent reaction to a PDH-dependent reaction.

Aerobic conditions also increase expression of genes that encode for the incomplete

TCA cycle. This partial TCA cycle plays a key role in the oxidative stress response of S.

mutans, as it generates NADH, which is key in protecting the cell against oxidative

stress via NADH oxidases (2, 4, 6).

The Stringent Repsonse

The stringent response occurs in most bacteria and allows the cell to rapidly

respond to limited nutritional availability and environmental stress. These responses

are mediated by the RelA-catalyzed accumulation of the GDP- and GTP-derived

molecular alarmone (p)ppGpp. Accumulation of (p)ppGpp occurs after amino-acyl

tRNA pools fail to keep up with the demands of protein biosynthesis (45). This

accumulation signals nutritional stress, leading to adjustments of gene expression and

inhibition of stable rRNA and tRNA (88). Early studies on the stringent response were

based on experiments with E. coli. These early studies revealed two enzymes involved

in (p)ppGpp production, RelA and SpoT (48, 88). In E. coli, RelA is limited to only

synthetase activity, while SpoT has only limited synthetase activity and seems to be

specialized for hydrolase activity (45, 73). The RelA-catalyzed production of (p)ppGpp

involves a pyrophosphoryl group transfer of the P,y-phosphates from ATP to the ribose

3'-OH of either GDP or GTP to form either guanosine tetraphosphate (ppGpp) or

guanosine pentaphosphate (pppGpp), respectively (45, 88). In vitro experiments have









showed that the signal for this reaction is the presence of uncharged tRNA in the

acceptor site of a ribosome bound to an mRNA (41). In E. coli and other related

proteobacteria, hydrolysis of (p)ppGpp is carried out by SpoT in a Mn dependent

reaction, which removes the 3'-diphosphate to produce GTP or GDP and releases

pyrophosphate (45). SpoT-mediated synthesis of (p)ppGpp is thought to be driven

primarily by other sources of nutrient stress such as fatty acid, iron, carbon, and

phosphate starvation (12, 17, 114).

The inhibition of RNA synthesis is one of the classical features of the stringent

response, and this inhibition has been studied to a great extent in E. coli. The inhibition

of rRNA synthesis by (p)ppGpp occurs at the transcriptional level, and evidence

suggests a direct binding of (p)ppGpp to RNA-polymerase that can be enhanced by

DksA (10, 57, 84-87, 106). Inhibition or activation of other promoter elements, i.e.,

amino acid biosynthesis promoters by (p)ppGpp has also been observed, although the

mechanisms of action of this transcriptional control is still under debate (67, 102).

Although much work has been done on uncovering the mysteries of (p)ppGpp and

the stringent response in E. coli, still very little is known about the mechanisms of

control mediated by this alarmone in Streptococcus and other related Gram-positive

species. For example, studies on B. subtilis and other firmicutes have shown a

completely different mechanism of control by (p)ppGpp. For example, studies on B.

subtilis have show a completely different mechanism of transcriptional control by

(p)ppGpp, where the rRNA promoters are insensitive to (p)ppGpp and transcription is

independent of the cofactor DksA for RNA-(p)ppGpp interaction (55, 98). Furthermore,

a great number of bacteria do not even possess these separate and specialized relA









and spoT genes. On the contrary, many bacteria were thought to possess only a single

gene product that is responsible for the synthetase and hydrolase activity of (p)ppGpp

(73, 88). Some of the early RSH (Rel Spo homolog) gene products that were studied

were based on the RSH of Mycobacterium tuberculosis (RelMtb) and Streptococcus

equisimilis (Relseq). The crystal structure of Relseq recently revealed that the opposing

synthase and hydrolase activities are locked in two mutually exclusive active site

conformations, hydrolase-OFF/synthase-ON, and hydrolase-ON/synthase-OFF (45).

The switch between the two conformations of these bi functional RSH enzymes appears

to involve ligand-induced signal transmission between the two active sites (45, 88).

It has been known for some time that induction of (p)ppGpp quickly inhibits growth

and protein synthesis in exponentially growing cells (88). Increases in (p)ppGpp levels

correlate with a downregulation of genes involved in macromolecular biosynthesis and

an upregulation of genes for protein degradation and amino acid biosynthesis (60, 88).

Additionally, (p)ppGpp synthesis is also linked to a wide variety of physiologic functions

including competence, antibiotic production, antiobiotic sensitivity, thermotolerance,

adaptation to oxidative stress, and osmotic stress (116). In pathogenic bacteria

(p)ppGpp can also influences virulence, persistence, and host interaction (114).

Production of basal levels of this alarmone has also been suggested to be necessary for

optimal cell growth and allow the organisms to rapidly adapt to large swings in nutrient

pools (1, 60, 98). These numerous studies all illustrate the importance of the ability of

(p)ppGpp to modify global cellular metabolism almost instantaneously in response to

environmental changes, thereby promoting survival and optimizing growth (98)









Most bacteria were thought to metabolize (p)ppGpp either in a RelA/SpoT-

mediated system similar to E. coli or one that resembled systems such as Relseq system

with a single RSH gene product responsible for the synthesis and hydrolysis of

(p)ppGpp. However, with the recent discoveries of additional small synthetases in S.

mutans and B. subtilis (60, 77), it is now accepted that a variety of other species also

have similar sequences, along with a full-length RSH protein. This discovery in S.

mutans was made by observing the fact that a Are/A strain did not lead to a (p)ppGppo

phenotype, indicating the presence of other sources of (p)ppGpp production (60).

These other sources came from two additional synthetases, designated RelP and RelQ.

Only with a deletion of all three relAPQ genes did S. mutans exhibit a (p)ppGppo

phenotype (60).

Little is known about these two weak synthetases, as their discoveries have been

relatively recent (1, 60, 77). In S. mutans, the operon organizational structures of the

relP and relQ operon are intriguing. The relP gene is co-transcribed with re/R (a

response regulator) and relS (a histidine kinase of a two-component system) (60).

Initial findings suggest that RelP appears to be the major source of (p)ppGpp under

non-stressed conditions in S. mutans (60). The roles of the remainder of the genes

within this operon are still being investigated. Complementation studies in S. mutans

showed that RelQ produced significantly lower amounts of (p)ppGpp than RelP (60).

However, when RelP and RelQ were cloned into E. coli, RelQ produced detectable

amounts of (p)ppGpp, while RelP failed to produce any detectable amounts of (p)ppGpp

(60). The organizational structure of the relQ operon (Figure 1-2) in S. mutans is

thought provoking since the gene products in the operon appear at first glance to be









unrelated. Along with relQ, an NAD+ kinase (ppnK), a pseudouridine synthase (rluE),

and a phosphotransacetylase (pta) are encoded (Figure 1-2). Other related

streptococcal species, including S. pneumoniae, S. mitis, S. gordonii, and S. sanguinis

have similar organizational structures (7). Another interesting commonality that some of

these streptococcal species share is the addition of a mutY gene, which codes for an

adenine glycosylase that plays a key role in A/G mismatch repair due to oxidative

damage of DNA (113). In S. mutans, this mutY gene lies roughly 750 kb downstream of

relQ. However, mutY is found directly upstream of pta in other oral Streptococci

including S. mitis, S. gordonii, and S. sanguinis. The organizational differences in these

genes in the relQ operon exist, and further studies examining the differences between

operons from different species might reveal some new insights into additional regulation

by (p)ppGpp.

PpnK an NAD+ kinase

The pyridine nucleotide NADP+ is synthesized by the 2'-phosphorylation of NAD+

and is catalyzed by the gene product of ppnK (also sometimes referred to as nadK)

(38). NAD(P) has long been known to be important in energy metabolism. NADH is

used mainly in oxidative degradation, and NADPH is used in reductive biosynthesis

reactions (36). In recent years, the known roles of these pyridine nucleotides have

been further expanded to include a plethora of biochemical processes including DNA

repair and recombination, protein ADP ribosylation, and calcium-mediated signaling

(120). The synthesis of NAD can be through de novo or pyridine salvage pathways,

with quinolinic acid being the key metabolite in the de novo process (36). The synthesis

of NADP is dependent on only one route in all living organisms: the magnesium-

dependent phosphorylation of NAD catalyzed by a highly conserved NAD kinase (13).









Depending on the organism, the phosphoryl donor for catalysis can be ATP, other

nucleoside triphosphates, or even inorganic polyphosphate (49, 50, 54, 62). The

importance of NAD kinase for viability has been shown in a variety of organisms

including E. coli, B. subtillus, and S. enterica (36, 38). Given the importance of these

conserved NAD kinases, it is surprising that the genes encoding these enzymes are

nonessential in certain organisms such as Mycloplasma (46) and yeasts (38).

RluE a pseudouridine synthase

The isomerization of uridine to pseudouridine (Y) is the most abundant post-

transcriptional modification of RNA in all living organisms (82). Pseudouridines are

found in tRNA, rRNA, snRNA, snoRNA, and tmRNA. The mechanism behind this

isomerization involves cleavage of the N-glycosyl bond of uridine that links the base and

sugar, rotation of the uracil ring resulting in C-5 occupying the position that was

previously held by N-1, and the reformation of the glycosyl bond as a C-C bond. This

mechanism is catalyzed by a group of enzymes called pseudouridine synthases (33,

96). In S. mutans the gene product of rluE is thought to catalyze the formation of

pseudouridine in rRNA, specifically in the 23S rRNA of the large ribosomal subunit (7).

Although the presence of pseudouridine was discovered over 40 years ago, the

specific functional roles of this "fifth nucleotide" are still being investigated (25). Recent

studies have shown that particular pseudouridine residues are essential in various

organisms, and their functions are largely implied from their specific sites within the

RNA structure (33). Most evidence for the function of pseudouridine supports its role in

maintaining stable RNA tertiary structure (74, 107). Improved base stacking conferred

by pseudouridine on neighboring nucleosides due to its additional hydrogen bond donor









has been suggested to play a key role in the stabilization of RNA by conferring rigidity in

both its single and double stranded regions (24, 31, 82).

Pta a phosphotransacetylase

When grown in an anaerobic, non-limiting glucose environment, carbohydrate

metabolism of S. mutans proceeds via glycolysis with lactate dehydrogenase (LDH)

leading to a homolactic fermentation product. Depending on the levels and types of

carbohydrates that are available, as well as other factors such as varying oxygen

tension, fermentation can also yield acetate, format, and ethanol. The formation of

acetate involves two major gene products, Pta and AckA. Acetyl-CoA must first be

phosphorylated with inorganic phosphate to produce acetyl-phosphate by a Pta-

dependent reaction. The high energy acetyl~P has an extremely high AGO of hydrolysis

(-43.3 kJ/mol, compared to -30.5kJ/mol for ATP), and it phosphorylates ADP to ATP in

an AckA-dependent reaction. This reaction is also reversible, as Pta and AckA can also

catalyze the conversion of acetate into acetyl-CoA (92, 95). In fact, studies on

Lactococcus lactis have shown exogenous acetate to be incorporated into cellular lipids

by a Pta- and AckA-dependent reaction (28).

Acetyl-CoA is an essential molecule that is central to a variety of key metabolic

processes, including cell wall synthesis and fatty acid and amino acid metabolism. In

anaerobic conditions, the formation of acetyl-CoA from carbohydrate metabolism is

dependent on a PFL-catalyzed reaction:

pyruvate + CoA <--4 acetyl-CoA + format

In aerobic conditions, the formation of acetyl-CoA from carbohydrate metabolism is

dependent on a pyruvate dehydrogenase-catalyzed (PDH) reaction:

pyruvate + NAD+ + CoA <-- acetyl-CoA + NADH + H +CO2









The activity of pyruvate dehydrogenase is largely dependent on oxygen, as the

presence of oxygen increases the expression of pdh, while inactivating PFL (23). The

formation of acetyl-CoA can also be dependent on the reverse Pta/AckA pathway. In

the reverse pathway, acetate is converted to acetyl~P by an AckA-dependent reaction.

The acetyl~P is subsequently acted upon by Pta, which is ultimately converted to acetyl-

CoA.

Acetyl~P is thought to be a key regulatory molecule and can be formed by the

phosphorylation of acetyl-CoA by the enzyme Pta or by the phosphorylation of acetate

by AckA. There is increasing evidence elucidating its role as a global signal responsible

for regulating a wide variety of cellular processes (70, 71, 89, 112). The mechanism of

control is still not well understood, but one hypothesis for this global control is the direct

role of acetyl~P as a phosphate donor to various two-component response regulators.

Acetyl~P can donate its phosphate to a large number of response regulators in vitro, but

additional work is needed to fully elucidate its role in vivo (70, 71). Acetyl~P also plays

an important roll in energy metabolism, as the AckA-dependent hydrolysis of acetyl~P is

responsible for additional ATP synthesis by substrate level phosphorylation.

Summary

The ability of S. mutans to cope with various stress conditions is essential to its

survival. The human oral cavity provides a variety of challenges that the organism must

overcome, including a wide range of pH levels, aerobic/anaerobic transitions, and

varying nutrient availability. A key molecule in the stress response of S. mutans is the

production of (p)ppGpp. RelA, RelP, and RelQ are the three gene products that govern

the production of (p)ppGpp in S. mutans. RelA is responsible for the production of

(p)ppGpp in response to amino acid starvation, as well as (p)ppGpp hydrolysis. The









roles of RelP and RelQ in (p)ppGpp production have yet to be fully elucidated. This

study addressed the contribution of (p)ppGpp in the genetic and physiological

adaptations in S. mutans.

Specific Aims

* To characterize the relQ operon and determine its role in the physiology of S.
mutans.
* To determine the physiological and global genetic effects of low basal production of
(p)ppGpp during exponential growth of S. mutans.











Pyruvate
CoA+NAD. \f CoA


NADH + COt Formate
Acetyl-CoA

PTA NAI
CoA
Acetyl-phosphate
ADP


ATP
Acetate


NADH

SLactate





Acetylaldehyde
ALDH _
O AD I\


Ethanol


Figure 1-1. Pathways of carbohydrate metabolism by S. mutans. Under glucose-rich,
anaerobic conditions, lactate is the primary fermentation product. The
formation of lactate is catalyzed by LDH and is responsible for regenerating
the NAD+ needed for glycolysis. Under glucose-limiting, anaerobic
conditions, S. mutans produces heterofermentative products that include
ethanol, format and acetate, driven by the PFL-dependent formation of
acetyl-CoA. Under aerobic conditions, the formation of acetyl-CoA is driven
primary by PDH, as the activity of PFL is extremely sensitive to oxygen.














Figure 1-2. Organizational structure of the relQ operon. relQ (666 bp) encodes for a
small (p)ppGpp synthetase, ppnK (834bp) encodes for an NAD+ kinase, rluE
(891 bp) encodes for a pseudouridine synthase, and pta (996bp) encodes for
a phosphotransacetylase.









CHAPTER 2
MATERIALS AND METHODS

Bacterial Strains and Growth Conditions

Strains used in this study are listed in Table 2-1. S. mutans UA159-derived strains

were maintained in brain heart infusion (BHI, Difco Laboratories, Detoroit, MI) broth.

When required, erythromycin (300pg ml-1 for E. coli or 10 pg ml-1 for S. mutans) or

kanamycin (50 pg ml-1 for E. coli or 1 mg ml-1 for S. mutans) (Sigma-Aldrich, St. Louis,

MO) were utilized. S. mutans deletion mutants were created by utilizing standard DNA

manipulation techniques as previously described (2, 93). Briefly, two fragments flanking

the gene of interest were amplified by PCR, ligated to an antibiotic resistance marker,

and the resulting ligation mixtures were used to transform S. mutans. Primer

sequences used for fragment amplification are listed in Table 2-2.

Growth Rate and Biofilm Assays

To compare growth rates, overnight cultures grown in BHI were diluted 1:50 and

grown to mid-exponential phase (OD600 = 0.5) at 370C and 5% CO2. These mid-

exponential phase cultures were then inoculated in fresh medium at a 1:100 dilution.

The optical density of cells grown at 370C were measured at 600 nm (OD600) every

thirty minutes using a Bioscreen C lab system (Oy Growth Curves AB Ltd, Finland

(119). The Bioscreen C system was set to shake for 10 seconds every 30 minutes. For

anaerobic growth, sterile mineral oil was overlayed on top of the cultures. When

measuring growth in the defined medium FMC (105), 10 mM glucose was added as the

sole carbohydrate source. Stress conditions were introduced by adding paraquat,

0.001% or 0.002% H202, HCI to lower the medium to pH 5.5, or 50mM sodium acetate

(Sigma-Aldrich, St. Louis, MO). Biofilm assays were performed as previously described









(2). Briefly overnight cell cultures were diluted 1:100 in BM media supplemented with

either 20 mM glucose or 10 mM sucrose as the sole carbohydrate source. Cell cultures

were grown in a 96-well polystyrene plate (Costar 3595, Corning Inc., Corning, NY)

overnight at 370C in 5% CO2. Cells were then washed and stained with crystal violet.

After further washing, the dye was extracted from the cells using ethanol, and biofilm

formation was quantified by measuring absorbance at 575 nm.

Construction of CAT Mutants and CAT Assays

CAT mutants were created as described by Wen et al. (109). Briefly, to construct

a CAT reporter gene fusion, a 291-bp fragment directly upstream of the pta start site

was PCR amplified with the primers listed in Table 2-2. This 291 bp fragment was then

cloned in front of a promoterless chloramphenicol acetyltransferase (CAT) gene in

pJL105. The resulting integration vector was used to transform WT UA159, ArelQ,

AppnK, and the ArluE strains by double homologous crossover with the mtlA-phnA

locus serving as the integration site. CAT activity of the resulting mutant strains was

assayed for the resulting strains.

RNA Manipulations

RNA was prepared from S. mutans for use in RT-PCR, real-time RT-PCR, and

microarray experiments. A total culture volume of 10 mL of exponentially growing cells

was used. Total RNA was isolated using protocols described elsewhere (26). Briefly,

cells were harvested, washed with sodium phosphate buffer, pH 7.0 and resuspended

in TE buffer. Cells were then subjected to mechanical disruption in a Bead Beater

(Biospec Products, Inc., Bartlesville, OK), and total cellular RNA was extracted using

the RNeasy Mini Kit (Qiagen). RNA concentration was estimated

spectrophotometrically in triplicate.









RelQ Operon Structure

First-stand cDNA templates were generated from 1 pg of RNA from exponentially

growing WT cells, using the SuperScript First-Strand Synthesis System (Invitrogen,

Carlsbad, CA) according to the recommended procedure. PCR amplification of the

cDNA was performed using various primer pairs (Table 2-2), and fragment sizes were

verified by gel-electrophoresis to confirm operon structure.

Microarray Experiments

Microarray experiments comparing the gene expression profiles between WT and

ArelAPQ (60) strains were done as previously described (4, 78). Briefly, cDNAs using

random primers were created from 10 pg of RNA from 5 individual samples of both

exponentially growing WT and ArelAPQ strains. The purified cDNA from the WT and

ArelAPQ strains were then labeled with Cy3-dUTP, and the reference cDNAs were

labeled with Cy5-dUTP (Amersham Pharmacia Biotech). Four separate Cy3-labeled

samples from both the WT and ArelAPQ strain were hybridized to the microarray slides

were provided by The Institute for Genomic Reasearch (TIGR), along with the Cy5-

labeled reference cDNA, yielding a total of 8 slides. Hybridizations took place overnight

in a Maui hybridization chamber (BioMicro Systems, Salt Lake City, UT). Slides were

scanned, and the images were analyzed by TIGR Spotfinder software, and normalized

with LOWESS. Statistical analysis was carried out with BRB array tools with a cutoff P

value of 0.005.

Real-Time Quantitative RT-PCR

To validate microarray data and to measure expression levels of relP induced with

nisin, real-time quantitative RT-PCR was performed as described elsewhere (4).

Briefly, gene-specific primers (Table 2-2) were designed with Beacon Designer 4.0









software (Premier Biosoft International, Palo Alto, CA) to synthesize cDNA from 1 pg of

RNA extract. Standard curves were then prepared to measure copy numbers of the

resulting cDNA (117), and a Student t test was performed to verify the significance of

the real-time RT-PCR quantifications.

(p)ppGpp Assays

Measurements of levels of (p)ppGpp were done as previously described (60).

Briefly, overnight cultures were inoculated 1:50 in the defined medium FMC with 10 mM

glucose and 20% reduced phosphate levels with concentrations of nisin added at 10,

40, and 80 ng/mL to induce relP. Cells were grown at OD600 = 0.2. 32P was then added

to radiolabel the samples. Cells were harvested and nucleotides were extracted using

ice cold 13 M formic acid. Extracts were spotted onto PEI cellulose TLC plates (Selecto

Scientific) and separated by 1.5M KH2PO4 pH 3.5. Plates were then exposed to X-ray

film (Kodak) at -700C.









Table 2-1. Strains used in this study
Strain Phenotype or description Reference or source
UA159 Wild-type Lab stock
ArelQ ArelQ::Km (60)
AppnK AppnK::Km This study
ArluE ArluE::Km This study
ArluEf ArluE::-Km This study
ArluE/pta ArluE::Km, Apta::Em This study
Apta Apta::Km This study
AackA AackA::Km This study
AackA/pta AackA::Em, pta:: AKm This study
WT-pMSP3535 WT harboring empty pMSP3535 This study
ArelA::Em, ArelP::Spec,
ArelAPQ ArelQ::Km (60)
ArelAPQ- ArelAPQ harboring empty
pMSP3535 pMSP3535 This study
ArelAPQ harboring pMSP3535-
ArelAPQ-relA relA This study
ArelAPQ harboring pMSP3535-
ArelAPQ-relP relA This study
ArelAPQ harboring pMSP3535-
ArelAPQ-relQ relA This study
WT:Ppta-cat UA159 harboring Ppta-cat fusion This study
ArelQ:Ppta-cat ArelQ harboring Ppta-cat fusion This study
AppnK:Ppta-cat AppnK harboring Ppta-cat fusion This study
ArluE:Ppta-cat ArluE harboring Ppta-cat fusion This study










Table 2-2. Primers used in this study
Primer Sequence Application
ppnK-A GCTTGCTTTGCTCGCAATAA ppnK deletion, RT-PCR
ppnK-BamHI-B TTATCGGTAGGATCCATCTGTGTCA ppnK deletion
ppnK-BamHI-C CTTTTATCGGGATCCTCGATTCAT ppnK deletion
ppnK-D CATACCCCATTTCTCCTCCA ppnK deletion, RT-PCR
rluE-A GCAGATTCGCGATGACATTA rluE deletion
rluE-BamHI-B TTTTACTTTGGATCCAGCAATGAAT rluE deletion
rluE-BamHI-C GTTCCTTGAGATCCACCTTGATAG rluE deletion
rluE-D TGGTCCGATAGCATCAAACA rluE deletion
pta-A GACGAAGAAGCGCTTGAAAC pta deletion
pta-Sacl-B TTTTCTCTCGAGCTCCCAAATAAAG pta deletion
pta-Sacl-C GCGCAAACCGAGCTCAATACTAAAT pta deletion
pta-D CAAACTCTTCGCAAGCATCA pta deletion
SMu1244-sense136 TGGGCAGAGGCTATTATGTG Real-time RT PCR
SMu1244-antisense244 TCACGCTCAAATTATCAAGTGC Real-time RT PCR
SMu0957-sense344 TGGGAAATCTGACAACAACACG Real-time RT PCR
SMu0957-antisense433 AATCTTGCCGTCCTGCGTAG Real-time RT PCR
SMu1231-sense418 TCAGGAGGTGAACAACAAAGGG Real-time RT PCR
Smu1231-antisense502 CTCCTGTAGGTTCATCGCAGAG Real-time RT PCR
SMu0755-sense750 TCGTCCCAATCTCTCCCTAGCC Real-time RT PCR
SMu0755-antisense883 GGTAAGCAGTTGCTCCCGGAAC Real-time RT PCR
SMu0177-sense976 GTTGATGTGGTGAGTTCTGAGC Real-time RT PCR
SMu0177-antisensel 076 GTTGAGACAGGTGCTGACGAC Real-time RT PCR
SMu0187-sense270 GTTTGCTCGACTGCGTTCATTG Real-time RT PCR
SMu0187-antisense370 CCGTCCGTTTCTCTCTCTGTAC Real-time RT PCR
relP-sense AGACACGCCATTTGAGGATTGC Real-time RT PCR
relP-antisense GGTGCTCCAAACTAGCCCAAG Real-time RT PCR
3'-Bglll-ptaCAT GAATACCCATAGATCTATACCCCTA pta promoter amplification
5'-Sstl-pta_CAT TCTGGTAAAGAGCTCCATACAAGTT pta promoter amplification
reQ-sense TGGGCAACAATTGAACACTCTC RT-PCR
RT-pta-sense-348 ACTCGGTTTAGCAGATGGTATGG RT-PCR
RT-rluE-sense434 ATGCTCATGCTAGGCTGGATAAG RT-PCR
RT-rluE-anti-534 CTCTCCTTGATCAGGCAGTTGC RT-PCR









CHAPTER 3
CHARACTERIZATION OF THE RELQ OPERON IN S. MUTANS UA159

Introduction

The production of the molecular alarmone (p)ppGpp is crucial during various

stress conditions, such as nutrient starvation, and is mainly regulated by the enzyme

RelA, which has both synthetase and hydrolase activity (61). This alarmone signals the

cell to switch from a growth mode to a survival mode (1). RelA also plays a key role in

regulating genes that are responsible for the virulence properties of S. mutans, including

biofilm formation, stress tolerance, and sugar metabolism (60, 61). In S. mutans, there

are two additional small (p)ppGpp synthetases designated RelP and RelQ. RelP and

RelQ have been suggested to play an important role in producing basal levels of

(p)ppGpp that are somehow critical for optimal growth (60). Recent data on the specific

roles of RelP and RelQ have been interesting. Data in our lab have shown a link

between (p)ppGpp, RelP and competence (Seaton, Burne, unpublished), while another

recent study on Enterococcus faecalis has shown a strong correlation between

antibiotic resistance and RelQ (1). In S. mutans, the relQ operon has an interesting

organizational structure, and as detailed previously, includes ppnK, rluE, and pta. By

creating and examining the phenotypes of various deletion mutants, we tryed to further

our understanding of the possible relationships between these gene products, as well

as to explore other possible roles of (p)ppGpp in stress response.

Results

Verifying the Organizational Structure of the relQ Operon by RT-PCR

To verify that the genes relQ, ppnK, rluE, and pta are transcribed as a single

operon, RNA was extracted from wild-type S. mutans UA159 and RT-PCR reactions









using various primer pairs were run to determine the organizational structure of the

operon (Figure 3-1). The expected transcript fragment sizes of 967 bp, 2.2 Kbp, and

1.8 Kbp were verified, confirming the organizational structure of the relQ operon (Figure

3-2).

Putative Internal pta Promoter in the relQ Operon

Expression levels of pta in WT, ArluE, ArluEQ, and Apta were measured via real-

time PCR (Figure 3-3). Copy numbers of the pta transcript WT and ArluE strains were

similar in magnitude, as they were on the order of 3 x 105 copies. As expected, the

Apta strain displayed almost no expression of pta. However, the expression of pta in

the ArluEQ strain had expression levels on the order of approximately 3 x 103 copies

(Figure 3-3). This led us to hypothesize the possibility of pta being regulated by an

additional promoter, and the activity of this pta promoter could be the reason why pta

was still transcribed in a ArluEQ strain. To test this hypothesis, we fused the region 291

bp directly upstream of the ATG start site of pta to a promoterless chloramphenicol

acetyltransferase (cat) integration vector and transformed S. mutans UA159 with the

Ppta-cat fusion to determine if promoter activity was present in this 291 bp region. The

WT:Ppta-cat strain grown in BHI to mid-exponential phase showed significant activity of

approximately 250 units of CAT activity (Figure 3-4). Using the bacterial promoter

software, BPROM, and scanning the region upstream of pta, we found a possible

promoter site 30 bp upstream of the pta start site (Figure 3-5) (94). The results from

these experiments suggest that there is an internal promoter within the relQ operon that

regulates pta independently of the relQ promoter.









Phenotypic Characterization of the Various relQ Operon Mutants

Growth in BHI

WT, ArelQ, ArluE, ArluEQ, ArluE/pta and Apta strains were grown in BHI with a

mineral oil overlay for anaerobic growth, and their growth rates were determined using

the Bioscreen-C system. The results showed a slightly slowed growth phenotype in the

pta deletion mutant with a calculated doubling time of 56 11 minutes, compared to 48 +

1.3 minutes for WT. However, this growth defect was not seen in the ArluEQ mutant

and the growth defect was abolished in the double deletion mutant ArluE/pta as they

exhibited growth rates similar to that of WT (Figure 3-6).

For aerobic growth, the oil overlay was not added. With an increased oxygen

tension, the overall growth yield was lower for all strains than when grown with an oil

overlay (Figure 3-7). Cells grew to an OD600 of approximately 0.6. Cell lysis was also

seen in this aerobic condition, as a decrease in the optical density was quickly seen

after the cells reached their peak growth, as seen in previous experiments (3). The

growth defect of the pta deletion mutant was much more pronounced in these aerobic

conditions as doubling times in exponential phase were 90 14 minutes, compared to

53 1.7 for WT. As seen in our first growth rate experiment, a deletion in rluE with a

pta defect restored growth to WT levels as seen by the growth rates of the ArluEQ and

ArluE/pta strains.

Growth in paraquat

To impose superoxide stress on the cells, BHI supplemented with 25mM N,N'-

dimethyl-4,4'-bipyridinium dichloride (paraquat) was added to the media. To limit any

further oxidative stress from affecting the cells, an oil overlay was also added to the

media. Overall cell growth was much slower in these conditions, as WT strains did not









reach their final OD until approximately 15 hours, compared to approximately 7 hours in

plain BHI (Figure 3-8). The pta deletion mutant strains showed a severe growth defect,

only growing to a peak OD600 of approximately 0.25, with a doubling time of almost 396

69 minutes compared to a final OD of 0.6 in a WT strain with a doubling time of 95

9.7 minutes. Unlike previous growth conditions, a deletion of rluE with a disruption of

pta did not restore growth to WT levels as the doubling times of the ArluEQ and

ArluE/pta were both over 2 hours.

Growth in hydrogen peroxide

Hydrogen peroxide confers a different type of oxidative stress to cells than does

paraquat (4). Whereas paraquat induces superoxide stress by forming 02-anions, H202

generates reactive hydroxy-radical species. Growth was measured in BHI

supplemented with either 0.001% or 0.002% H202 with an added oil overlay to limit

additional oxidative stress. Growth levels in 0.001% H202 of all strains were similar to

those in plain BHI with an oil overlay (Figure 3-9). When the concentration of H202 was

doubled to 0.002%, there was no significant change in growth rates, with the only

difference being a slightly longer lag phase.

Growth at pH 5.5

Growth of all strains was measured in BHI acidified to pH 5.5 by 3.0 M HCI, with

an added oil overlay (Figure 3-10). A distinct type of growth was observed by the cells

when subjected to acid stress with a lag phase that was less pronounced and

proportionately shorter than when seen in normal growth conditions. In pH 5.5, the

ArelQ mutant exhibited a slowed growth phenotype when subjected to this acidic pH as

doubling times were 410 18.3 minutes compared to a doubling time of 334 14.7

minutes seen in the VVT strain.









Growth in acetate

As discussed previously, the gene products of pta and ackA play a key role in both

the formation of acetate, as well as the assimilation of exogenous acetate. To see if the

excess levels of acetate would alter the growth phenotype of S. mutans, all strains were

grown in plain BHI and BHI with the addition of 50 mM acetate. There was no

significant change in the pH of BHI due to excess acetate, as pH readings registered at

7.3 with both 0 and 50 mM acetate levels. Two additional mutants were introduced in

this specific experiment, the single deletion AackA, and the double deletion AackA/pta.

In varied concentrations of acetate, an additional variable was also included. By

including or excluding an oil overlay, the effect of oxygen on growth in excess acetate

was determined.

In an aerobic environment, without an added oil overlay, the growth data showed

an increased sensitivity to acetate by the AackA and AackA/pta mutants, while the Apta

mutant showed a much greater sensitivity to elevated levels of acetate, with almost no

growth observed in 50 mM acetate compared to a doubling rate of 77 1.9 minutes

seen in WT (Figure 3-10, Figure 3-11). Growth rates of the AackA and AackA/pta

mutants were also slowed, as the doubling rate was calculated to be 163 8.28 minutes

and 122 15.8 minutes respectively. A deletion of rluE in concurrence with an

elimination of pta once again showed a restoration of growth to WT levels. In an

anaerobic environment, the growth results were notably different. The ackA mutant

showed a significant growth defect in plain BHI, but elevated levels of acetate had little

effect on the mutants (Figure 3-12, Figure 3-13).









Biofilm formation

The ability to form biofilms is a key virulence factor for S. mutans (110). Biofilm

assays were carried out in BM media supplemented with either 20 mM glucose (Figure

3-14) or 10 mM sucrose (Figure 3-15) as detailed in the Materials and Methods section.

Pair-wise Student t-tests were used to determine a significant difference in biofilm

formation between the ArluEQ, ArluE/pta, and Apta mutants and the ArelQ, AppnK,

ArluE, and WT strains in both 20mM glucose and 10mM sucrose. A significant defect in

the ability to form biofilms was observed (p < 0.001) in the three pta mutants: ArluEO,

Arlue/pta, and Apta when compared to WT. These observations suggest that pta plays

an important role in biofilm formation and that a deletion of rluE with a defect of pta did

not restore the ability of the cells to form biofilms at levels comparable to the WT strains.

Regulation of a Putative internal pta Promoter Within the RelQ Operon

To investigate the possibility of regulation of the putative internal pta promoter by

the genes in the relQ operon, additional mutants were constructed to assay the internal

promoter activity in various mutant backgrounds. The Ppta-cat fusion was transformed

into ArelQ, AppnK, and ArluE mutant strains, and these strains were grown in plain BHI

in 5% CO2. CAT assays were performed on the WT:Ppta-cat, ArelQ:Ppta-cat,

AppnK:Ppta-cat, and ArluE:Ppta-cat strains. A deletion in relQ significantly enhanced

the activity of the internal pta promoter (p < 0.001), with CAT activity almost doubling in

the ArelQ:Ppta-cat strain compared to the WT: Ppta-cat strain. A deletion in rluE also

enhanced promoter activity, but only by approximately 40%. Whereas a deletion in relQ

and rluE served to enhance promoter activity of pta, a deletion in ppnK decreased

promoter activity of the internal promoter by roughly 30% (Figure 3-3). One-way

ANOVAs and pair-wise student t-tests were used to verify significant differences in pta









promoter activity in WT, ArelQ, AppnK and ArluE strains (p < 0.001). These results

suggest that the regulation of the internal promoter of pta is influenced by the gene

products of relQ, ppnK, and pta.

Discussion

The importance of the RelA-dependent synthesis and hydrolysis of (p)ppGpp in

regulating expression and physiology for growth and survival modes has been well

documented (51, 60, 61, 78, 116). Recently, additional small (p)ppGpp synthetases

have been identified in many gram-positive bacteria. S. mutans has two additional

synthetases designated RelP and RelQ, whose roles in (p)ppGpp have yet to be

elucidated. To investigate the possible roles of RelQ, the genes in the relQ operon

were investigated. The results of this study provided some clues that might give some

insight into the possible roles of RelQ and (p)ppGpp in various stress responses.

The importance of pta in the aerobic growth of S. mutans can be seen by the

growth data presented herein. Growth of S. mutans in the presence of air leads to the

formation of mixed acid fermentation products, with one of the major organic acids

produced being acetic acid. After glycolysis, PDH converts a molecule of pyruvate to

acetyl-CoA. The genes encoding for the S. mutans PDH complex are significantly

upregulated in the presence of air (4). With an increased level of acetyl-CoA by PDH,

Pta phosphorylates acetyl-CoA with inorganic phosphate into acetyl-phophate. This

high energy compound then donates its phosphate group to ADP to form ATP in an

AckA-dependent reaction. We found that the deletion mutant Apta had a significant

growth defect that was exacerbated by air. Interestingly, this growth defect observed in

a Apta mutant in aerobic and anaerobic conditions was abolished when a deletion in

rluE was also present (Figure 3-5, Figure 3-6). A restoration of growth was also seen in









cells grown in elevated levels of acetate in the presence of air. While the Apta strain

showed almost no growth in 50 mM acetate and aerobic conditions, a deletion in rluE in

parallel with the defect in pta restored growth to near WT levels. There were, however,

a few conditions where a deletion in rluE did not restore a pta defective mutant to a VVT

phenotype. Growth in the superoxide-generating agent paraquat was impaired in all

three mutant strains Apta, ArluEQ, and ArluE/pta. This shows that a deletion in rluE

does not unconditionally restore growth in pta defective strains. Similar results were

seen in biofilm formation, as any mutants with a defect in pta showed a decreased

ability to form biofilms.

The presence of oxygen in the environment presents a challenge for S. mutans.

Microarray data have shown that about 5% of the genome displayed altered expression

in response to aeration, with the genes involved in energy metabolism being the most

affected (4). The importance of energy metabolism can also be seen in increased

ATPase activity in aerated cells (2). Since the primary mechanism of dealing with

oxidative stress in S. mutans involves NADH oxidases and NADH peroxidases, the

increased energy demands by a cell exposed to oxygen may arise from the increased

demands involving the maintenance of a proper NAD+/NADH balance. This leads to a

simple possible explanation for the importance of pta and its involvement in production

of additional ATP by substrate level phosphorylation. In the acetate pathway, the Pta-

dependent formation of acetyl~P is essential for the formation of additional ATP by

AckA. The growth inhibition observed might simply be due to a decreased ATP pool.

However, if growth inhibition was due to decreased ATP availability, one would expect

to see similar growth rates of a mutant defective in ackA, the gene that is directly









responsible for production of ATP. The results seen in the growth data examining both

the AackA and AackA/pta mutants in aerobic growth suggest an alternative explanation

(Figure 3-10).

The Apta mutant also displayed sensitivity to increased levels of acetate. The

increased levels of added acetate in the aerobic conditions almost completely abolished

growth of the pta deletion mutant. A possibility for this observation could be the

importance of this gene in the metabolism of exogenous acetate. It has been shown in

vivo in the organism Lactococcus lactis, that the sole mechanism for the synthesis of

diacetyl under aerobic growth conditions is the utilization of external acetate (95). The

formation of diacetyl in prokaryotes comes from an irreversible condensation of acetyl-

CoA with hydroxyethylthiamine pyrophosphate. Lipoic acid is an essential co-factor for

PDH, and Speckman et al. demonstrated in vivo that the omission of lipoic acid from the

growth medium could block the PDH-catalyzed formation of acetyl-CoA from pyruvate

(95). The study subsequently showed that the cell still formed diacetyl from acetyl-CoA

from the radiolabled external source of acetate (95). Numerous other studies in a wide

range of bacteria also show the assimilation of acetate in the environment by the

reversible Pta/AckA pathway (20, 29, 47, 52, 92, 112).

The inability to deal with the weak acid effects of external acetate might also

hinder growth rates of S. mutans. Like other weak acids, acetate in its undisassociated

form easily permeates the cell membrane (14). Since S. mutans generally maintains a

pH gradient that is one unit higher than its environment, these weak acids then

disassociate into a proton and an anion. The increased [ H+] concentration acidifies the

cytoplasm while the anion increases the internal osmotic pressure (112). Since the data









here show sensitivity to increased levels of acetate only in pta defective strains, a

possible mechanism that S. mutans might have in dealing with these toxic effects of

acetate could be similar to the strategy employed by E. col, converting the toxic acetate

into the central metabolite acetyl-CoA. In E. coli, AMP-ACS catalyzes acetate

assimilation by first converting acetate and ATP into acetyladenelate (acetyl-AMP),

which in turn reacts with CoASH to form acetyl-CoA (99). S. mutans lack the AMP-ACS

system, but the reversible Pta/AckA pathway is also capable of assimilating exogenous

acetate. The biggest difference between the two acetate assimilating pathways is their

affinity for the substrates, with the AMP-ACS pathway having a Km of 200 pM for

acetate, compared with 7-10 mM in the reversible Pta/AckA pathway (112). The

differences in affinity of the two pathways could account for the fact that studies have

revealed that the AMP-ACS pathway deals primarily with low concentrations of external

acetate, less than 2.5 mM, while the reversible Pta/AckA pathway deals with high

concentrations of external acetate, e.g. greater than 25 mM (20, 47, 56). This is

consistent with the data shown in this study, as the levels of exogenous acetate were on

the order of 50 mM, which may cause a shift in acetate metabolism, favoring utilization

of the reversible Pta/AckA pathway.

The role of acetyl~P as a global signal is becoming widely accepted (16, 70, 71,

75, 89, 112) and might suggest another possible explanation for the growth behavior of

the Apta mutant. Numerous in vitro studies have shown that response regulators in

two-component signal transduction systems can be directly phosphorylated by acetyl~P

(16, 32, 34, 63, 65, 90, 91). In vivo studies in E. coli have also shown that acetyl-P

levels affect the expression of a variety of critical genetic elements that deal with a wide









range of processes including glutamine synthesis, flagella expression, and global

response to glucose starvation (34, 35, 81, 89, 108). In S. pneumoniae, a pyruvate

oxidase (SpxB) catalyzes the formation of acetyl-phosphate in response to oxygen:

pyruvate + phosphate + 02 acetyl-phosphate + C02 + H202

A S. pneumoniae mutant defective in spxB produced decreased concentrations of H202

and failed to grow aerobically (97). However, growth was restored when the medium

was supplemented with acetate, which would restore acetyl-phosphate levels by the

action of AckA. The addition of acetate also restored the adhesion properties of the

mutant. The results from this study suggest that the formation of acetyl~P and its

possible role as a global signal play a key role in response to various stress conditions

(97). Although S. mutans lacks a pyruvate oxidase, the importance of acetyl-phosphate

as a signal for stress in this model cannot be discounted.

An interesting observation can be seen regarding the growth of the Apta, AackA,

and AackA/pta mutants grown in the presence of air and in 50 mM acetate. While the

Apta strain showed almost no growth, the AackA and AackA/pta strains, although still

displaying slowed growth, showed significantly more growth than the Apta strain. This

suggests that the importance of detoxifying the weak acid effects of acetate is minimal,

as both the AackA and AackA/pta strains would be expected to display similar growth

rates to the Apta strain if the weak acid effect of acetate were the cause of slowed

growth. We have established that the reversible Pta/AckA pathway has the capability of

catalyzing the formation of acetyl-CoA from acetate and that this pathway is effective at

dealing with concentrations of acetate greater than 25 mM. If one assumes that the

majority of acetyl-CoA is being synthesized by the assimilation of external acetate by









the reversible Pta/AckA pathway in a similar manner to S. pneumoniae as previously

described (95), the data in this study support the idea of acetyl~P playing a key role as

a global signal in response to stress and the importance of regulating levels of this

signal. With acetate levels in excess at 50 mM, AckA may effectively catalyze the

phosphorylation of acetate to form acetyl~P. With a deletion in pta, the AckA-

dependent formation of acetyl~P from exogenous acetate would be unable to be

converted to acetyl-CoA, ultimately leading to increasingly elevated levels of acetyl~P.

The effects of acetyl~P on growth could be similar to the effects of (p)ppGpp, where

minute changes in concentrations might be essential for efficient growth, but an over-

accumulation might be detrimental. This hypothesis has not yet been shown or tested

but would provide an explanation for the growth observations seen in these mutants

when grown aerobically in excess acetate.

A deletion in ackA would prevent the accumulation of acetyl~P from acetate, but it

does not rule out the possibility of a Pta-dependent acetyl~P accumulation from

carbohydrate metabolism. However, with a deletion in both ackA and pta, acetyl~P

would now be unable to be produced from either acetyl-CoA or acetate. If in fact the

lack of growth by the Apta mutant observed in this study was due to the effect by an

overaccumulation of acetyl~P, the apparent growth restoration of a pta deletion by a

simultaneous election in ackA could now also be explained by the lack of acetyl~P

formation. The similar growth rates of both the AackA and AackA/pta mutants in

oxygen also suggest that the direction of the Pta/AckA pathway in high levels of acetate

favors the reverse reaction under aerobic conditions. If acetyl~P was formed by the

forward Pta catalyzed reaction from acetyl-CoA, one would expect the AackA mutant to









behave differently than the Apta/ackA mutant. The data show just the opposite, the

AackA and AackA/pta mutant strains having similar growth rates, possibly suggesting

that the AackA and the AackA/pta mutants have similar levels of acetyl~P. Although

these mutants display faster growth than Apta, they still exhibit a slowed growth rate

when compared to WT, which might again be explained if in fact the presence of

acetyl~P was crucial in acting as a global signal in response to growth in oxygen.

Data seen in the anaerobic growth conditions with various levels of acetate reveal

some additional interesting phenotypes of the Apta, AackA, and AackA/pta mutants.

The inhibition of anaerobic growth in a AackA mutant in plain BHI might suggest the

favored pathway of the Pta/AckA pathway in varying oxygen conditions. If the forward

reaction was favored, acetyl~P overaccumulation would be expected in the AackA

mutant. Also, elevated levels of acetate of the AackA mutant would have very little

effect due to the formation of acetyl~P in a forward Pta-catalyzed reaction from acetyl-

CoA. That is precisely what the data suggest. The data also support the idea of a

forward reaction being favored under anaerobic growth, by the growth rates of the Apta.

In oxygen, the Apta strain showed almost no growth. If an overaccumulation of

acetyl~P was the cause of this severe growth defect in aerobic growth but the forward

reaction is favored in anaerobic conditions, one should see drastically different results in

anaerobic growth conditions. The Apta mutant does in fact grow well in 50 mM acetate

in anaerobic conditions and also grows well with acetate levels up to 100 mM (data not

shown). It is likely therefore that the direction of the Pta/AckA pathway is influenced by

the presence or lack of oxygen.

The lack of growth of an S. pneumoniae spxB deletion mutant, when exposed to









an aerobic environment, could be restored by the AckA dependent production of

acetyl~P (97). However, no growth defects were seen in the spx mutant under

anaerobic conditions. This study suggests that the formation of acetyl~P is crucial for

growth in oxygen. In fact, studies in S. mutans have shown that ackA is upregulated

under aerobic conditions, which could increase the conversion of acetyl~P from acetate

(4). Under anaerobic conditions, ackA is downregulated, which could significantly

decrease levels of intracellular acetyl~P from the reverse AckA dependent conversion of

acetate. The formation of acetyl~P by the forward phosphotransacetylation of acetyl-

CoA by Pta would also be limited based on acetyl-CoA availability, as a high availability

of glucose and anaerobic growth conditions would mainly produce lactate from pyruvate

by LDH (4).

The importance of tight regulation of the Pta/AckA pathway is also highlighted by

the evidence that shows an additional pta promoter that lies within the operon that is

regulated by the other gene products in the same relQ operon. Increased CAT activity

in a ArelQ and ArluE mutant suggest that the gene products of relQ and rluE

downregulate the transcription of pta, while a decrease in CAT activity in a AppnK strain

suggests that PpnK enhances transcription of pta. This tight regulation of pta not only

highlights the importance of this phosphotransacetylase in S. mutans, but also serves to

illustrate the importance of the entire operon to the stress response of S. mutans.

The data is this study are informative when one examines the relationship

between rluE and pta. By comparing the Apta, ArluEO, and ArluE/pta mutants, an

interesting observation can be made. A deletion of rluE restored growth to mutants

defective in pta under certain growth conditions. Unfortunately, very little work has been









done in recent years on the relationship of pseudouridine and the stringent response.

Previous work that was conducted examined the common U to yp isomerization in the

anti-codon loop of tRNA (27). Since the binding of uncharged tRNA to the A site of the

ribosome is the key signal for a RelA-dependent mounting of the stringent response, a

number of studies have tried to show a link with pseudouridine and (p)ppGpp synthesis,

but the evidence that has been collected so far has failed to show any correlation

between the two (27, 79). Studies examining the relationship between pseudouridine

and carbohydrate metabolism are virtually non-existent. However, with bacterial

genomes now being readily available and the discovery of a common genetic operon

structure in many gram-positive bacterial species, in which a (p)ppGpp synthetase and

a pseudouridine synthase lie within the same operon, it is hard to dismiss completely a

relationship between pseudouridine and (p)ppGpp synthesis. At this point, however,

one can only speculate on potential mechanisms behind the links between pta, rluE,

and (p)ppGpp synthesis.

Summary

The role of (p)ppGpp in stress responses has been well documented, and it has

been linked to a wide range of stresses that include nutrient starvation, antibiotic

resistance, and acid tolerance (1, 60, 61, 88, 114). The recent discovery of novel

(p)ppGpp synthetases has led to interest in additional regulatory mechanisms of these

new rsh gene products. In S. mutans, RelQ is one of the two additional (p)ppGpp

synthetases. The early data shown in this study suggest that the relQ operon plays a

role in overall stress response. Acid tolerance, oxidative stress, biofilm formation, and

growth in excess acetate are all affected by various mutations in the operon. The data

also suggest the importance of the reversible Pta/AckA pathway in producing acetyl-









phosphate and acetyl-CoA, and the possibility of switching the forward and reverse

pathways based on an anaerobic or aerobic growth environment. The data also suggest

that an over accumulation of acetyl~P can cause a severe growth defect in S. mutans,

and that direction of the Pta/AckA pathway is influenced by an anaerobic or aerobic

growth environment.

The data in their entirety show the importance of the relQ operon and its

regulation. An additional regulatory mechanism in the form of a putative internal pta

promoter that is regulated by the other gene products within the same operon has been

shown, and this tight knit regulation of pta highlights how critical the acetate pathway is.

The most enigmatic data of this study deals with the interconnecting relationship

between rluE and pta. By what mechanisms does the presence or lack of

pseudouridine in the large ribosomal subunit affect acetate, acetyl~P, and acetyl-CoA

metabolism? How does a lack of pseudouridine in the ribosomes restore growth to a

mutant that has a defect in pta across a wide range of stress conditions? Previous

studies have attempted to examine the importance of pseudouridine present in tRNA for

regulating the production of (p)ppGpp, but these studies failed to show any correlation

between the two. Perhaps the presence of pseudouridine in rRNA plays a role in

regulating (p)ppGpp production. Or maybe the absence of pseudouridine causes the

acetate pathway to reverse somehow. Little is known currently about the significance of

these modified RNA bases, and much more work must be done before one can even

start to elucidate these complex questions.









Fragment 1t
950 bp


Fragment 3
1.8 Kbp


S Fragment 2
2.2 Kbp


Figure 3-1. Positions of primer pairs used for RT-PCR to verify relQ operon structure.
Expected fragment sizes are shown if genes within the operon are co-
transcribed.
































Figure 3-2. RT-PCR confirming the proposed relQ operon structure. Each RT-PCR
reaction was done in duplicate. The size of fragments 1, 2, and 3 correlate
with expected values of roughly 950 bp, 2.2 Kbp, and 1.8 Kbp. Smaller
additional fragments with unknown identity were observed. The positive
controls shown in lanes 4-6 were also done in duplicate and utilized the same
primer pairs to PCR amplify genomic S. mutans DNA.











Real-Time PCR Expression of pta
1.00E+06


1.00E+05


1.00E+04


1.00E+03


S1.00E+02


1.OOE+01


1.00E+00
WT Apta ArluE ArluEn

Figure 3-3. Expression levels of the pta transcript via real-time PCR. Cells were grown
to mid-exponential phase in BHI at 37C with 5% CO2. Results shown are the
mean and standard deviations (error bars) of three separate cultures assayed
in triplicate for each strain. One-way ANOVAs and pair-wise Student t-tests
were used to determine significant differences (p < 0.001) between the WT,
Apta, and ArluEQ strains, as well as the ArluE, Apta, and ArluEQ strains.











CAT Activity of Putative pta Promoter
600


500


400

S300


200 -


100


0
WT:Ppta-cat ArelQ:Ppta-cat AppnK:Ppta-cat ArluE:Ppta-cat


Figure 3-4. CAT activity of the 291 bp region directly upstream of the ATG start site of
pta. Cells were grown to mid-exponential phase in BHI at 37C with 5% CO2,
collected by centrifugation, and then measured for CAT activity. Results
shown are the mean and standard deviations (error bars) of 3 separate
cultures for each strain. One-way ANOVAs and pair-wise Student t-tests
were used and the CAT activity was determined to be significantly different
between all four strains (p < 0.001).









Promoter Pos: 992798 LDF- 5.20 Score
-10 box Pos 992813 CGTTATCAT 71
-35 box Pos: 992833 TTGACA 66

993061 TATAAAGTATTAGCTCGTTACGGTGATATCGCCTT 993027


993026 GGTTGATATTCAACTTCATACCGGCCGAACTCACC 992992


992991 AAATTCGCGTACACTTTGCTCATATTGGTTTTCCC 992957


992056 CTTTTAGGAGATGATTTATATGGAGGAGAAATGGG 992922


992921 GTATGGTTTAAAAAGACAAGCTCTTCACTGCCATT 992887


992886 TTTTGTCTTTTGTGGATCCTTTTTCCAAAGAACAT 992852

-35 box
992851 AAGCAGTACAATAGTTCCTTGACAGAAGACCTTGA 992817

-10 box
992816 TAGCGTTATCATAGATTTACAAAAACATTAGATGT 992782

pta start site
992781 AAATACCCCTAIIATG


Figure 3-5. Promoter prediction using BPROM of the 291 bp region upstream of the
ATG start site of pta.











BHI (oil overlay)
1
0.9 -
0.8

0.7
0.7 J 'IrelQ
0.6 --AppnK
1 0.5 -- ArluE

0.4 -,-ArluEM
0.3 -W-ArluE/pta
0.2 Apta
'WT
0.1


0 3 6 9 12 15
Time (hours)


Figure 3-6. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI with an oil overlay. Optical density at 600 nm was
determined every 30 minutes using a Bioscreen C. Each point represents the
mean of three separate cultures in triplicate and the standard deviations were
< 0.1 for the Apta strain and < 0.02 for the WT strain. Doubling times were
calculated to be 56 11 minutes for Apta and 48 1.3 minutes for WT and
the difference was found to be statistically insignificant using a pair wise
Student t-test.











BHI no oil overlay
0.7

0.6

0.5
S-$ArelQ
S0.4 ---AppnK
---ArluE
0.3 ----ArluEM

S0.2 -#-ArluE/pta
Apta
0.1 ----WT



0 3 6 9 12 15
Time (hours)


Figure 3-7. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI without an oil overlay. Optical density at 600 nm was
determined every 30 minutes using a Bioscreen C. Each point represents the
mean of three separate cultures in triplicate, and the standard deviations were
< 0.09 for the Apta strain and < 0.02 for the WT strain. Doubling times were
calculated to be 90 14 minutes for the Apta strain and 53 1.7 minutes for
the WT strain. A pair wise Student t-test was used to determine a significant
difference between the growth rates between the Apta and WT strains (p <
0.05).











BHI w/25mM paraquat (oil overlay)
0.7


0.6


0.5

-+ ArelQ
0.4
o 0.-AppnK


0.3 -)4-ArluEf
-WArluE/pta

0.2 3 61 Apta
0.WT


0.1


0
0 3 6 9 12 15 18 21 0 3 6 9 12 15


Time (hours)


Figure 3-8. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEO, ArluE/pta, and
Apta strains in BHI with 25mM Paraquat and an oil overlay. Optical density at
600 nm was determined every 30 minutes using a Bioscreen C. Each point
represents the mean of three separate cultures in triplicate and the standard
deviations were < 0.08 for all strains. Doubling times were calculated to be
396 69 minutes for Apta, 345 17 minutes for the ArluEQ, 314 + 75 minutes
hours for ArluE/pta, 114 1.3 minutes for AppnK, and 95 9.7 minutes for
WT.











BHI 0.001% H202 w/oil
1
0.9
0.8
0.7 -- ArelQ
0.6 ---AppnK
S0.5 -ArluE
o0.4 ---ArluEf
0.3 --ArluE/pta
0.2
0.1 Apta
0WT

0 3 6 9 12 15
Time (hours)




BHI 0.002% H202 w/oil
1
0.9
0.8 --
0.7 -ArelQ
o 0.6 ---AppnK
S0.5 --ArluE
0 0.4
0-ArluER
o 0.4 0- ArluEM
0.3
0.2 ---ArluE/pta
0.1 Apta
0 ..---WT
0 3 6 9 12 15
Time (hours)


Figure 3-9. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI with 0.001% and 0.002% H202and an oil overlay. Optical
density at 600 nm was determined every 30 minutes using a Bioscreen C.
Each point represents the mean of three separate cultures in triplicate and the
standard deviations were < 0.06 for all strains. Doubling times were
calculated to be 63 1.7 and 72 1.2 minutes for Apta and 56 1.3 and 62 +
3.8 minutes for the WT in 0.001% and 0.002% H202 respectively.











BHI pH 5.5 (oil overlay)
0.8

0.7

0.6

0.5 -ArelQ
- -=-E-AppnK
0
1 0.4 -*--ArluE

0.3 -0-ArluEf!
-_.-ArluE/pta
0.2 Apta

0.1 WT


0 12 0 12 0


Time (hours)


Figure 3-10. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI pH 5.5 and an oil overlay. Optical density at 600 nm was
determined every 30 minutes using a Bioscreen C. Each point represents the
mean of three separate cultures in triplicate and the standard deviations were
< 0.07 for all strains. Doubling times were calculated to be 410 18.3
minutes for ArelQ and 334 14.7 minutes for WT. A pair wise Student t-test
was used to determine a significant difference between the growth rates
between the ArelQ and WT strains (p < 0.05).











BHI OmM acetate no overlay
0.9

0.8

0.7

0.6 ----ArelQ
I --AppnK
S0.5 ---ArluE
T --)-ArluERf
0 0.4T
o 0.4 --ArluE/pta

0.3 Apta
T -AackA
T 1
0.2 AackA/pta
-WT
0.1

0
0 3 6 9 12 15
Time (hours)


Figure 3-11. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI with 0 mM excess acetate. Optical density at 600 nm was
determined every 30 minutes using a Bioscreen C. Each point represents the
mean of three separate cultures in triplicate and the standard deviations were
< 0.05 for all strains. Doubling times were calculated to be 118 4.4 minutes
for Apta, 80 1.9 minutes for AackA, 80 3.1 minutes for Apta/ackA, and 66
.78 minutes for WT. A pair wise Student t-test was used to determine a
significant difference between the growth rates between the Apta and WT
strains (p < 0.01).











BHI 50mM acetate no overlay
0.9

0.8


-+ArelQ
0.6
t0.- --AppnK
o 0.5 -*-ArluE

o 0.4 -
S/ ---ArluE/pta
0.3 Apta
T T T : ---ackA
0 .2 T -
0 AackA/pta
0.1 -WT

0
0 3 6 9 12 15
Time (hours)


Figure 3-12. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI with 50 mM excess acetate. Optical density at 600 nm
was determined every 30 minutes using a Bioscreen C. Each point
represents the mean of three separate cultures in triplicate and the standard
deviations were < 0.15 in all strains. Doubling times were calculated to be
163 8.38 minutes for AackA, 122 15.8 minutes for Apta/ackA, and 77
1.9 minutes for WT.











BHI 0 OmM acetate oil overlay
1
0.9
0.8
--ArelQ
0.7
0.... AppnK
0.6 --ArluE
1 0.5 T ----ArluEn

0.4 i 1 r -I -W-ArluE/pta
0.3 Apta
0.2 1J ----AackA
0.1 AackA/pta
0 -WT

0 3 6 9 12 15
Time (hours)


Figure 3-13. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI with 0 mM excess acetate with an oil overlay. Optical
density at 600 nm was determined every 30 minutes using a Bioscreen C.
Each point represents the mean of three separate cultures in triplicate and the
standard deviations were < 0.1 for all strains. Doubling times were calculated
to be 104 4.70 minutes for AackA, 78 5.6 minutes for Apta, 81 2.8
minutes for Apta/ackA, and 63 1.5 minutes for WT. A pair wise Student t-
test was used to determine a significant difference between the growth rates
between the AackA and VVT strains (p < 0.01).











BHI 50mM aceate oil overlay




0.8

T.- -ArelQ
0.6 ---AppnK
-T ArluE
o I --ArluE
0.4
0.4 --ArluE/pta

T- Apta
0.2 --+-AackA
-; AackA/pta
-WT

3 6 9 12 15

-0.2
Time (hours)


Figure 3-14. Growth of S. mutans UA159, ArelQ, AppnK, ArluE, ArluEQ, ArluE/pta, and
Apta strains in BHI with 50 mM excess acetate with an oil overlay. Optical
density at 600 nm was determined every 30 minutes using a Bioscreen C.
Each point represents the mean of three separate cultures in triplicate and the
standard deviations were < 0.1 for all strains. Doubling times were calculated
to be 147 44 minutes for AackA, 81 3.7 minutes for Apta, 88 2.5 minutes
for Apta/ackA, and 66 3.5 minutes for WT. A pair wise Student t-test was
used to determine a significant difference between the growth rates between
the AackA and WT strains (p < 0.01).











Biofilm Assay (20mM Glucose)
1.2


1


0.8

I.-'
0.6


0.4


0.2



WT ArelQ AppnK ArluE ArluEM ArluE/pta Apta


Figure 3-15. Biofilm assay of S. mutans UA159 ArelQ, AppnK, ArluE, ArluEO,
ArluE/pta, and Apta in 20 mM glucose. Strains were grown overnight in BM
semi-defined medium supplemented with 20 mM glucose in a 96-well
microtiter plate. To assay the strength and integrity of the biofilms, the plates
were washed twice with H20, stained with crystal violet, resuspended with an
8:2 ethanol:acetone mixture, diluted, and the resulting suspension's optical
density was at OD 575. Results shown are the mean and standard deviation
(error bars) of two separate cultures assayed in triplicate. Pair-wise Student
t-tests were used to determine a significant difference in biofilm formation
between the ArluEO, ArluE/pta, and Apta mutants and the ArelQ, AppnK,
ArluE, and WT strains (p < 0.001).











Biofilm Assay (10mM sucrose)


0.4 -


0.3


0.2 -


0.1


0 -


ArelQ AppnK


ArluE ArluEn ArluE/pta


Figure 3-16. Biofilm assay of S. mutans UA159 ArelQ, AppnK, ArluE, ArluEO,
ArluE/pta, and Apta in 10 mM sucrose. Strains were grown overnight in BM
semi-defined medium supplemented with 10 mM sucrose in a 96-well
microtiter plate. To assay the strength and integrity of the biofilms, the plates
were washed twice with H20, stained with crystal violet, resuspended with an
8:2 ethanol:acetone mixture, diluted and the resulting suspension's optical
density was at OD 575. Results shown are the mean and standard deviation
(error bars) of two separate cultures assayed in triplicates. Pair-wise Student
t-tests were used to determine a significant difference in biofilm formation
between the ArluEO, ArluE/pta, and Apta mutants and the ArelQ, AppnK,
ArluE, and WT strains (p < 0.001)


Apta









CHAPTER 4
THE ROLE OF (P)PPGPP IN THE GLOBAL GENE REGULATION OF S. MUTANS

Introduction

The ability for a bacterial cell to produce (p)ppGpp is crucial, and a lack of

(p)ppGpp leads to an a wide range of altered phenotypes including increased

susceptibility to stress, multiple amino acid requirements, and abnormal cell morphology

(68, 88). Increased levels of (p)ppGpp inhibit growth as seen in a number of previous

studies (10, 48, 57, 68, 88, 106, 114). Although the mechanisms of growth inhibition

have been studied in great detail in the bacterial paradigm, E. coli, in gram positive

bacteria, the mechanisms behind this inhibition are still not known (9, 10, 80, 88, 101).

S. mutans has three (p)ppGpp synthetases: RelA, RelQ, and RelP (60). RelA is

responsible for both the hydrolase and synthetase of (p)ppGpp and is the protein

responsible for rapid accumulation of (p)ppGpp during the stringent response (60, 61).

The roles of RelP and RelQ in (p)ppGpp are still unknown, but are currently being

investigated. In this study, global gene regulation of a triple ArelAPQ (p)ppGppo mutant

was examined by microarray analysis. The study also attempted to find the effects of

elevated levels of (p)ppGpp on the cell via an overexpression of relP in a triple deletion

relAPQ background.

Results

Growth Rates of Mutant Strains

Growth rates in complete FMC+glucose were compared for WT UA159, the

(p)ppGppo triple mutant (ArelAPQ), the triple mutant harboring the empty nisin-inducible

expression vector pMSP3535 (ArelAPQ-pMSP3535), and the triple mutant strains

complemented with either relA, relP, or relQ cloned under the control of the pMSP3535









inducible promoter (ArelAPQ-relA, ArelAPQ-relP, ArelAPQ-relQ). Growth data were

obtained with both an oil-overlay (Figure 4-1) and without (Figure 4-2). No differences

were observed with an oil overlay, as doubling times were all approximately 60 minutes.

However, when bacteria were grown in the presence of air, the ArelAPQ, ArelAPQ-

pMSP3535, and ArelAPQ-relQ strains exhibited a growth defect with doubling times of

approximately 130 minutes compared to a 70 minute doubling time seen in the WT

strain. In contrast, the ArelAPQ-relA and ArelAPQ-relP strains had growth rates similar

to the WT.

Microarray Analysis of a ArelAPQ Mutant

To analyze the effects of a complete lack of (p)ppGpp on global gene expression

of exponentially growing cells, microarray analysis comparing a (p)ppGpp triple mutant

(ArelAPQ ) to a WT strain was performed. The microarray data revealed that 132

genes were differentially regulated (p<0.005). In particular, 35 genes were upreglated

by a factor of at least 2, while 20 genes were downregulated by a factor of at least 2

(Table 4-1). The most abundant genes upregulated were involved in regulating cellular

processes, energy metabolism, and protein synthesis. The most abundant

downregulated genes were those involved in regulating cellular procecces and

metabolism of purines, pyrimidines, nucleosides, and nucleotides.

Microarray Confirmation by Real-Time PCR

Expression levels of Smu1244 (tpn, a transposase fragment), Smu0957 (a

hypothetical protein), Smu1231 (vex2, an ABC transporter), Smu0755 (a hypothetical

protein), Smu0177 (a hypothetical protein), Smu0187 (a hypothetical protein), and

Smu0840 (relP) in the ArelAPQ and WT strains were measured via real-time PCR to

verify the microarray data (Table 4-2). Gene expression via real-time PCR was









statistically different between the ArelAPQ and WT strains using a student two tailed t-

test with all p-values < 0.05. Smu0755, Smu0177, and Smu0187 were downregulated

in the ArelAPQ strain, while the rest were upregulated.

Overexpression Using the Nisin Inducible Expression Vector pMSP3535

To verify that we could induce expression of genes in S. mutans using the nisin-

inducible expression vector pMSP3535, a lacZ reporter was cloned into the pMSP3535

vector. Nisin concentrations used were 0 ng/mL, 5 ng/mL, 10 ng/mL, 20 ng/mL, 40

ng/mL, and 80 ng/mL. Activity of lacZ ranged from 15.1 (SD=0.62) Miller units with

Ong/mL of nisin to 207 (SD=29) Miller units with 80 ng/mL of nisin, which demonstrated

the effectiveness of the nisin-inducible promoter system (Figure 4-3).

Overexpression of RelP

A mutant that was able to accumulate elevated levels of (p)ppGpp was made by

cloning relP into the nisin-inducible pMSP3535 vector. The resulting pMSP3535/relP

fusion was used to transform the triple deletion relAPQ mutant. The triple mutant was

used to prevent (p)ppGpp hydrolysis by RelA. The ArelAPQ-pMSP3535/relP mutant

was grown in BHI supplemented with Ong/mL, 10ng/mL, 20ng/mL, and 40ng/mL of

nisin. After RNA extraction, real-time PCR was performed to measure expression levels

of relP. relP was induced with increasing concentrations of nisin, with copy number

levels starting at 3.44 x 105 (SD=5.2 x 104) with 0 ng/mL of nisin, to 4.58 x 106 (SD=1.2

x 106). However, the expression of relP without the induction by nisin, was still high,

and reasons behind this expression have not yet been investigated (Figure 4-4).

Growth Rates With RelP Overexpression

Growth rates of the re/P-inducible mutant ArelAPQ-pMSP3535/relP were

measured in FMC+glucose with 0 ng/mL, 10 ng/mL, 20 ng/mL, 40 ng/mL, and 80 ng/mL









of nisin (Figure 4-5). As a negative control, the ArelAPQ triple mutant was transformed

with an empty pMSP3535 vector, and growth of the ArelAPQ-pMSP3535 mutant was

measured in FMC+glucose in 0 ng/mL, 40 ng/mL, and 160 ng/mL of nisin (Figure 4-6).

No significant growth changes were observed even at nisin concentrations as high as

160ng/mL. The ArelAPQ-pMSP3535/relP strain showed decreased growth rates with

the induction of relP by nisin, increasing doubling times from 93 1.7 minutes with no

added nisin to 104 4.96 minutes with nisin concentrations of 80 ng/mL (Figure 4-5).

Levels of (p)ppGpp In RelP Overexpression

(p)ppGpp assays were performed to confirm that the decrease in growth rate

associated with overexpression of relP correlated with increased levels of (p)ppGpp.

The RelA-dependent production of (p)ppGpp by mupirocin in WT was used a positive

control, while a mupirocin-treated ArelAPQ-pMSP3535 mutant was used as the

negative control. Levels of (p)ppGpp were extremely high in the positive control, while

(p)ppGpp levels were undectable in the mupirocin-treated negative control. Our test

samples consisted of the ArelAPQ-pMSP3535/relP strain grown in Ong/mL, 10ng/mL,

40ng/mL, and 80ng/mL of nisin, induced and non-induced with mupirocin. Levels of

(p)ppGpp in our test samples were all low, but a small increase of (p)ppGpp was

observed. Using ImageJ for densitometry levels of (p)ppGpp on our TLC image proved

to be unsuccessful due to the extremely low amounts of (p)ppGpp present. However,

previous studies have shown that (p)ppGpp levels and GDP/GTP levels are inversely

related (48). Using the negative control as our baseline, GDP/GTP decreased to

92.9%, 80.4%, 72.2%, and 60% of baseline with the test samples being grown in

Ong/mL, 10ng/mL, 40ng/mL, and 80ng/mL of nisin respectively. These data suggest









that overexpression of relP does in fact increase levels of (p)ppGpp in S. mutans

(Figure 4-6).

Microarray Analysis of RelP Overexpression

To determine the effects of elevated levels of (p)ppGpp by RelP on global gene

expression in S. mutans, a microarray experiment was performed comparing the effects

of a RelP dependent accumulation of (p)ppGpp. The ArelAPQ-pMSP3535/relP

supplemented with 0 ng/mL of nisin was compared to the same strain supplemented

with 80 ng/mL of nisin to induce expression of relP. The microarray did not reveal any

relevant data, as it was unknown which differentially expressed genes were due to the

effects of nisin on the pMSP3535 nisin inducible vector. A second microarray was done

comparing the ArelAPQ-pMSP3535/relP and the ArelAPQ-pMSP3535 mutants. Both

strains were grown in BHI supplemented with 80ng/mL of nisin to standardize the

effects of nisin on gene expression. Unfortunately, conclusive data was not obtained as

re/P was the only gene differentially expressed.

Discussion

The molecular alarmone (p)ppGpp is synthesized by the three RSH proteins in S.

mutans: RelA, RelP, and RelQ. The recent discovery of additional synthetases raises

many questions regarding (p)ppGpp metabolism in gram-positive bacteria. Previous

studies on the RelP and RelQ enzymes in S. mutans highlight the complexity of

(p)ppGpp production. In this organism, RelP was shown to produce higher levels of

(p)ppGpp, but in E. coli, regarded as the bacterial paradigm, it was RelQ that produced

significant amounts of (p)ppGpp, while RelP failed to produce any detectable levels at

all (60). These findings suggest that the regulation of (p)ppGpp synthesis is reliant on a

wide variety of factors independent of transcriptional control. Regardless, it is widely









accepted that accumulation of (p)ppGpp plays a key role in mediating cellular response

to various stresses in the environment. To shed some light on possible stress

responses that are mediated by (p)ppGpp, this study examined the effects of (p)ppGpp

on the global gene regulation of S. mutans.

The ArelAPQ strain exhibited a slowed growth phenotype in response to oxygen

exposure. The (p)ppGppo ArelAPQ mutant showed restored growth when

complemented with either relA or relP, but not with relQ (Figure 4-2). Previous data in

our lab has showed the lack of (p)ppGpp production by RelQ in S. mutans (60), which

may explain the lack of growth restoration with the ArelAPQ-pMSP3535/relQ strain.

When grown with an oil overlay, all strains grew at similar rates (Figure 4-1). These

data suggest that (p)ppGpp production and proper responses to oxygen stress are key

for the survival of S. mutans. Microarray data in this study also support the importance

of (p)ppGpp and oxygen to the metabolic pathways of S. mutans. The microarray data

reveal a substantial response in the genes that encode pyruvate dehydrogenase to

(p)ppGpp. In a cell that fails to produce any (p)ppGpp, as seen in the ArelAPQ mutant

strain, the genes in the pdh operon are the most upregulated of the 132 genes identified

by the microarray data. Pyruvate dehydrogenase is a multienzyme complex which

catalyzes the overall reaction:

Pyruvate + NAD+ + CoA acetyl-CoA + NADH+ H+ + CO2

PDH is found in aerobic and facultative anaerobic bacteria, and its activity is increased

in response to oxygen (4, 23). In S. mutans this shifts fermentation away from the

lactate dehydrogenase dependent formation of lactate, and towards mixed acid

fermentation products, including acetate, format, and ethanol. PDH is subject to strict









regulation and feedback control, and can be inhibited by levels of acetyl-phosphate.

Acetyl~P, which was discussed in previous chapters, is a potent inhibitor of PDH, even

more so than acetyl-CoA (4, 23). The fact that the microarray data presented in this

study show that (p)ppGpp inhibits pdh (Table 4-1) supports the association between

(p)ppGpp, the Pta/AckA pathway, acetyl~P as a global signal, and oxidative stress in S.

mutans.

The roles of RelP and RelQ in (p)ppGpp production are still poorly understood.

Some studies have suggested the importance of these genes in various stress

responses, such as antibiotic tolerance (1). The data shown in this study also show a

possible link to stress tolerance and RelQ. When grown in pH 5.5, the ArelQ mutant

demonstrated a slowed growth rate. Previous data from our lab also showed that relQ is

upregulated in acidic medium (Lemos, Burne, unpublished). As the ArelQ mutant

showed no other defects in a number of various stress conditions, this was of interest,

but elucidating its role in acid stress was challenging. If in fact RelQ is activated in

response to low pH, perhaps that response is indirectly associated with anaerobic

growth. S. mutans is known to produce lactic acid as a primary product of anaerobic

fermentation. When unable to produce lactic acid, the extent to which S. mutans can

acidify its environment becomes greatly reduced, as the pKa of lactic acid is almost one

unit lower than that of acetic acid (3.86 vs 4.76 respectively). RelQ (with perhaps the

involvement of RelP) could possibly synthesize (p)ppGpp in response to decreased pH

as a result of homeostatic growth in non-stressed, anaerobically growing cells. The lack

of oxygen downregulates ackA, preventing the AckA dependent formation of acetyl~P

from acetate. However, acetyl~P can still be synthesized from the forward Pta









dependent conversion of acetyl-CoA. Previous microarray data showing the effects of

oxygen failed to reveal any effects on pta (4). However, during anaerobic conditions,

and low pH, if (p)ppGpp limits the production of acetyl-CoA via the genes that encode

for the enzymes that make up PDH, the formation of the Pta-dependent formation of

acetyl~P by carbohydrate metabolism would be reduced.

The levels of acetyl~P produced seem to be important and tightly regulated. Data

shown in previous chapters suggest that the accumulation of acetyl~P by the oxygen-

activated AckA dependent conversion of acetate and the anaerobic activated Pta

conversion of acetyl-CoA can inhibit cell growth. Perhaps (p)ppGpp production by RelQ

plays a key role in inhibiting production of acetyl~P. Since AckA is downregulated in

anaerobic conditions, the result of the conversion of the glyocolytic end product

pyruvate to acetyl-CoA by PDH, and then to acetyl~P by Pta might prove to be severely

detrimental to homeostatic growth since an accumulation of acetyl~P would be

predicted under these conditions to be caused by the inability to convert the

accumulated acetyl~P to acetate by AckA. Further suggesting the importance of

mechanisms to regulate acetyl~P are the data that show that RelQ inhibits the activity of

a promoter of pta. This may represent yet another level of control. Although this

provides an intriguing hypothesis, much work needs to be done to validate these

proposed mechanisms.

The rapid accumulation of (p)ppGpp is known to inhibit growth and protein

synthesis. Growth data shown here support this finding. A RelP-dependent induction of

(p)ppGpp slowed the growth rate of ArelAPQ strain. In previous work done by Lemos et

al (60)., they examined the effects of overexpression by RelP in a ArelA strain with the









same methodology and protocols utilized in this study. Their results showed a greater

effect of RelP overexpression on growth, as a total inhibition of cell growth was reported

at 50ng/mL of nisin (60). This contrasts with the findings presented in this study, as the

growth rate inhibition by overexpression of RelP was not as pronounced as the growth

rate inhibiiton of the ArelAPQ-pMSP3535/relP strain when grown in concentrations of

nisin as high as 80ng/mL. In fact, growth was still observable, as the relP inducible

strain showed no significant growth difference between cells grown in 80ng/mL and

160ng/mL of nisin. This suggests cooperativeity between RelP and RelQ in effectively

synthesizing (p)ppGpp.

Summary

The recent discovery of additional Rsh homologues in a wide range of gram-

positive bacterial species has renewed interest about (p)ppGpp metabolism, and its

roles and mechanims of action in a number of varying conditions. So far, these

additional synthetases have been linked to factors ranging from antiobiotic tolerance (1)

to competence (5). This study examined the effects of the absence and overproduction

of (p)ppGpp on the genetic regulation of S. mutans. Microarray analysis looking at the

effects of a complete lack of (p)ppGpp suggested a link between metabolism in oxygen

and (p)ppGpp. A proposed model highlighting the importance of acetyl~P, and its

possible role in conditions that present the cell with oxidative stress was presented.

The effect of RelP overexpression by nisin was shown to inhibit the growth of S. mutans

by elevating levels of (p)ppGpp.











FMC oil overlay
0.9
0.8
0.7
0.6 -
o 0.5 W --W T-pMSP3535
o 0.5
0.4 -ArelAPQ
0.4
0.3 -<--ArelAPQ-pMSP3535
0.2 -ArelAPQ-relP
0.1 AreAPQ-relQ
0 -ArelAPQ-relA
0 3 6 9 12 15


Time (hours)


Figure 4-1. Growth of S. mutans UA159, UA159-pMSP3535, ArelAPQ, ArelAPQ-
pMSP3535, ArelAPQ-relP, ArelAPQ-relQ, ArelAPQ-relA in the defined
medium FMC with an oil overlay. Optical density at 600 nm was determined
every 30 minutes using a Bioscreen C. Each point represents the mean of
three separate cultures in triplicate, and the standard deviations were < 0.1
for all strains. Doubling times for all strains were approximately 60 minutes.











FMC no oil overlay
0.7

0.6

0.5 --
1114 -WT
0.4 ---WT-pMSP3535
o -ArelAPQ
S0.3
S- -<-ArelAPQ-pMSP3535

0.2 ---AAQ-relAPQ-relP
ArelAPQ-relQ
0.10 --ArelAPQ-relA


0:)0 3:00 6:00 9:00 12:00 15:00 18:00 21:00 0:00
-0.1
Time (hours)


Figure 4-2. Growth of S. mutans UA159, UA159-pMSP3535, ArelAPQ, ArelAPQ-
pMSP3535, ArelAPQ-relP, ArelAPQ-relQ, ArelAPQ-relA in the defined media
FMC without an oil overlay. Optical density at 600 nm was determined every
30 minutes using a Bioscreen C. Each point represents the mean of three
separate cultures in triplicate and the standard deviations were < 0.1 for all
strains. Doubling times for the ArelAPQ, ArelAPQ-pMSP3535, and ArelAPQ-
pMSP3535-relQ were approximately 130 minutes, with the remaining strains
all had a doubling time of approximately 70 minutes.










Table 4-1. Microarray data comparing triple mutant ArelAPQ to WT strain
Ratio of geom Gene
means Are :WT Unique id Description
means ArelAPQ:WT Name
putative pyruvate dehydrogenase
9.26 SMU.1422 El component beta subunit) acoB
7.20 SMU.58 hypothetical protein
putative transposon protein
6.57 SMU.208c possible DNA segregation ATPase
putative pyruvate dehydrogenase,
TPP-dependent El component
6.51 SMU.1423 alpha-subunit acoA
putative dihydrolipoamide
5.77 SMU.1424 dehydrogenase adhD
5.39 SMU.575c putative membrane protein IrgA
3.93 SMU.420 putative ribosomal protein
3.90 SMU.212c hypothetical protein
putative PTS system, cellobiose-
3.74 SMU.1600 specific IIB component celB
3.45 SMU.202c hypothetical protein
2.95 SMU.46 hypothetical protein
putative conjugative transposon
2.94 SMU.198c protein tpn
2.91 SMU.1909c hypothetical protein
2.89 SMU.197c hypothetical protein
2.82 SMU.1160c hypothetical protein
2.81 SMU.200c hypothetical protein
putative type I restriction-
modification system, helicase
2.79 SMU.897 subunits hsdR
2.57 SMU.1367c conserved hypothetical protein
2.56 SMU.1504c hypothetical protein
putative PTS system, cellobiose-
2.55 SMU.1598 specific IIA component celC
2.50 SMU.685 hypothetical protein
2.48 SMU.2076c hypothetical protein
2.38 SMU.831 conserved hypothetical protein
2.37 SMU.11 conserved hypothetical protein
putative fructose-1-phosphate
2.37 SMU.113 kinase pfk
2.36 SMU.210c hypothetical protein
putative competence protein
2.33 SMU.1984 ComYC comYC
2.30 SMU.910 glucosyltransferase-S gtfD
putative glycerophosphoryl diester
2.26 SMU.724 phosphodiesterase glpQ
All values p < 0.005










Table 4-1. Continued
Ratio of geom Gene
means Are QWT Unique id Description
means ArelAPQ:WT Name
putative PTS system, fructose-
2.13 SMU.115 specific IIA component
2.08 SMU.1485c putative endonuclease
2.05 SMU.108 hypothetical protein
2.04 SMU.1761c conserved hypothetical protein
2.04 SMU.1209c hypothetical protein
2.02 SMU.365 glutamate synthase (large subunit) gItA
1.98 SMU.310 sorbitol operon activator srlM
DNA-directed RNA polymerase,
1.94 SMU.2001 alpha subunit rpoA
1.94 SMU.09 conserved hypothetical protein
1.93 SMU.1475c conserved hypothetical protein
1.90 SMU.948 conserved hypothetical protein
1.89 SMU.656 putative MutE
1.88 SMU.1816c putative maturase-related protein
putative ABC transporter, ATP-
1.84 SMU.1899 binding and permease protein
1.82 SMU.1818c hypothetical protein
putative DeoR-type transcriptional
1.78 SMU.491 regulator
1.78 SMU.2012 30S ribosomal protein S8 rpsH
1.77 SMU.1161c hypothetical protein
1.74 SMU.1763c conserved hypothetical protein
1.74 SMU.111lc conserved hypothetical protein
1.72 SMU.2161c conserved hypothetical protein
putative chromosome segregation
1.69 SMU.1513 ATPase SMC protein smc
putative mismatch repair protein
1.67 SMU.2089 HexB hexB
putative 1,4-alpha-glucan branching
1.65 SMU.1539 enzyme glgB
1.64 SMU.830 RgpFc protein rgpFc
putative 3-hydroxymyristoyl-(acyl
1.63 SMU.1737 carrier protein) dehydratase fabZ
conserved hypothetical protein
1.62 SMU.1080c possible transposon-related protein
1.57 SMU.15 putative cell division protein FtsH
1.56 SMU.554 conserved hypothetical protein
1.55 SMU.1018 hypothetical protein










Table 4-1. Continued
Ratio of geom Gene
means ArePQWT Unique id Description
means ArelAPQ:WT Name
1.54 SMU.1044c putative pseudouridylate synthase rluE
1.51 SMU.1591 catabolite control protein A, CcpA reg M
NADPH-dependent glutamate
1.50 SMU.366 synthase (small subunit) gltD
1.50 SMU.2011 50S ribosomal protein L6 (BL10) rplF
1.50 SMU.2008 50S ribosomal protein L30 rpmD
1.50 SMU.555 conserved hypothetical protein
0.710 SMU.181 putative mevalonate kinase mvaK
0.685 SMU.1871c conserved hypothetical protein
0.678 SMU.60 DNA alkylation repair enzyme alkD
0.672 SMU.395 X-prolyl dipeptidyl peptidase pepX
0.669 SMU.1628 conserved hypothetical protein
putative autoinducer-2 production
0.662 SMU.474 protein LuxS luxS
putative peptide methionine
0.643 SMU.1622 sulfoxide reductase msrA
0.632 SMU.771c hypothetical protein
0.632 SMU.1545c conserved hypothetical protein
putative anaerobic ribonucleoside-
0.631 SMU.2074 triphosphate reductase nrdD
putative transcriptional regulator
0.630 SMU.2040 repressor of the trehalose treR
0.623 SMU.318 putative hippurate hydrolase hipO
0.623 SMU.530c conserved hypothetical protein
0.623 SMU.1546 conserved hypothetical protein
0.620 SMU.1225 putative transcriptional regulator cpsY
putative ATPase, confers aluminum
0.620 SMU.919c resistance
putative glutamine
0.617 SMU.1054 amidotransferase guaA
putative
phosphoribosylpyrophosphate
0.612 SMU.1050 synthetase, PRPP synthetase prsA
0.610 SMU.268 adenylosuccinate synthetase purA
conserved hypothetical protein
0.608 SMU.1323 possible hydrolase
0.607 SMU.1578 putative biotin operon repressor birA
0.606 SMU.1387 putative oxidoreductase mocA
0.606 SMU.1254 conserved hypothetical protein
0.605 SMU.627 conserved hypothetical protein











Table 4-1. Continued
Ratio of geom Gene
means Are :WT Unique id Description
means ArelAPQ:WT Name
0.593 SMU.1876 conserved hypothetical protein
0.586 SMU.1298 50S ribosomal protein L31 rpmE
0.586 SMU.1076 putative membrane protein
0.580 SMU.1621c conserved hypothetical protein
0.576 SMU.167 hypothetical protein
0.576 SMU.1804c hypothetical protein
0.575 SMU.442 conserved hypothetical protein
0.571 SMU.1251 conserved hypothetical protein
0.570 SMU.174c conserved hypothetical protein
putative glucose-inhibited division
0.566 SMU.1931 protein gidB
0.564 SMU.1479 conserved hypothetical protein
putative bacteriocin peptide
0.560 SMU.299c precursor ip
0.557 SMU.1386 putative uridine kinase udk
conserved hypothetical protein
0.555 SMU.926 possible GTP-pyrophosphokinase relP
0.555 SMU.1950 putative pseudouridylate synthase rluE
putative Hit-like protein involved in
0.550 SMU.412c cell-cycle regulation
0.547 SMU.1579 hypothetical protein
0.539 SMU.145 conserved hypothetical protein
0.537 SMU.589 putative DNA-binding protein hlpA
0.518 SMU.429c hypothetical protein
0.514 SMU.2059c putative integral membrane protein
0.506 SMU.440 hypothetical protein
putative NAD(P)H-flavin
0.501 SMU.1602 oxidoreductase frp
putative integral membrane protein,
0.489 SMU.1807c possible permease
0.489 SMU.2043c conserved hypothetical protein dtd
0.481 SMU.441 putative transcriptional regulator
0.481 SMU.1592 putative dipeptidase PepQ pepQ
putative 40K cell wall protein
0.476 SMU.609 precursor bsp
0.474 SMU.1603 putative lactoylglutathione lyase gloA
0.474 SMU.911c hypothetical protein










Table 4-1. Continued
Ratio of geom Gene
means Are :WT Unique id Description
means ArelAPQ:WT Name
0.460 SMU.1211 conserved hypothetical protein
putative folyl-polyglutamate
0.459 SMU.839 synthetase folC
0.450 SMU.985 putative beta-glucosidase bglA
0.445 SMU.1004 glucosyltransferase-l gtfB
0.395 SMU.503c hypothetical protein
conserved hypothetical protein
0.395 SMU.1347c possible permease ylbB
0.377 SMU.984 hypothetical protein
putative MDR permease
0.368 SMU.133c transmembrane efflux protein
putative ABC transporter, ATP-
0.350 SMU.1348c binding protein psaA
0.224 SMU.1048 conserved hypothetical protein
0.108 SMU.1363c putative transposase tpn
0.00141 SMU.1046c putative GTP pyrophosphokinase relQ
putative stringent response protein,
0.000837 SMU.2044 ppGpp synthetase relA









Table 4-2. Real-time confirmation of microarray data.
Microarray Real-time
Gene ID Common Name ArelAPQ:WT ArelAPQ:WT
Smu1244 tpn 0.108 0.0841
Smu0957 0.224 0.173
Smu0755 2.38 1.49
Smu0177 2.89 1.97
Smu0187 6.57 2.92
Smu0840 relP 0.555 0.0000566
Smu1231 vex2 0.350 0.298
Real time data p <0.05











Nisin Induced pMSP3535-LacZ
250


200


S150


100


50


0
Ong/mL 5ng/mL 10ng/mL 20ng/mL 40ng/mL 80ng/mL

[nisin]


Figure 4-3. Nisin-induced expression of LacZ utilizing the pMSP3535 nisin-inducible
expression vector. Results shown are the mean and standard deviation (error
bars) of three separate cultures. One-way ANOVAs and pair-wise student t-
tests were used to determine a significant difference between all samples in
the expression of the lacZ reporter gene in the pMSP3535 expression vector
when induced with various concentrations of nisin (p < 0.001).











Overexpression of relP by nisin
7.00E+06

6.00E+06

5.00E+06

4.00E+06

> 3.00E+06 -

2.00E+06

1.00E+06 -

0.00E+00
0 ng/ml 10 ng/ml 40 ng/ml 80 ng/ml
Concentrations of Nisin (ng/ml)


Figure 4-4. Expression of relP with various concentrations of nisin utilizing the nisin-
inducible vector pMSP3535. Results shown are the mean and standard
deviation (error bars) of three separate cultures assayed in triplicate. One-
way ANOVAs and pair-wise student t-tests were used to determine a
significant difference between all samples in the expression of relP in the
pMSP3535 expression vector when induced with various concentrations of
nisin (p < 0.001).










Growth of ArelAPQ-pmSP3535/relP grown in various [nisin]
0.7

0.6

0.5

0.4 Ong/mL

o --10ng/mL
1 0.3
--20ng/mL
0.2 -- 40ng/mL
1 --80ng/mL
0.1

0
2 4 6 8 10
-0.1
Time (hours


Figure 4-5. Growth inhibition of ArelAPQ-pMSP3535/relP strain by varying
concentrations of nisin in FMC in 5% CO2. Optical density at 600 nm was
determined manually every hour. Each point represents the mean of three
separate cultures the and standard deviations were < 0.08 for all strains.
Doubling times were calculated to be 93 1.7 minutes with 0 ng/mL of nisin,
96 1.5 minutes with 10 ng/mL of nisin, 102 1.76 minutes with 20 ng/mL of
nisin, 109 9.22 minutes with 40 ng/mL of nisin and 104 4.96 minutes 80
ng/mL of nisin. A pair wise Student t-test was used to determine a significant
difference between the growth rates observed with 0 ng/mL of nisin and
concentrations of nisin greater than 20 ng/mL (p < 0.005)











Growth of ArelAPQ-pMSP3535 grown in

various [nisin]
0.7

0.6

0.5

o 0.4 -4 -ArelAPQ-pMSP3535

0 0.3 --ArelAPQ-pMSP3535 40
ng/mL
.2 --ArelAPQ-pMSP3535 160

0.1 ng/mL

0.1
0 2 4 6 8


Time (hours)


Figure 4-6. Negative control showing the controls of nisin in the triple mutant ArelAPQ
with an empty pMSP3535 expression vector grown in FMC in 5% CO2.
Optical density at 600 nm was determined manually every hour. Each point
represents the mean of three separate cultures and the standard deviations
were < 0.07 for all strains. No growth inhibition of ArelAPQ-pMSP3535 strain
by varying concentrations of nisin up to 160 ng/mL was shown, and doubling
times were determined to be approximately 90 minutes for all strains.





























Figure 4-7. Concentrations of (p)pppGpp via nisin-induced expression of relP. 1,2) WT
strain uninduced and induced with mupirocin as a positive control. 3,4) The
triple mutant ArelAPQ-pMSP3535 uninduced and induced with mupirocin as a
negative control. 5,7,9,11) The ArelAPQ-pMSP3535/relP strain induced with
0, 10, 40, and 80 ng/mL of nisin. 6,8,10,12) The ArelAPQ-pMSP3535/relP
strain induced with 0, 10, 40, and 80 ng/mL of nisin and the addition of
mupirocin.









CHAPTER 5
SUMMARY AND FUTURE DIRECTIONS

Summary and Concluding Remarks

The oral cavity exerts numerous environmental stresses on the caries-causing

bacterium S. mutans. Physical stress provided by the tongue, saliva flow, and food

stuffs, fluctuating nutrient availability, varying oxygen tension, and unstable pH are

some of the common stresses that S. mutans must be able to withstand on a constant

basis (4, 8, 21). This oral pathogen has developed effective mechanisms to overcome

challenges, which ultimately contribute to its virulence (8, 21, 59).

One of the key response to stress is the production of (p)ppGpp. The classical

RelA-dependent stringent response is triggered by amino acid starvation. However, the

presence of two additional (p)ppGpp synthetases suggests that this molecular alarmone

has a greater role than simply detecting nutrient availiabilty. The proposed model

based on the data presented suggests a strong link between oxygen, acid, the global

signaling molecule acetyl-phosphate, and (p)ppGpp synthesis.

In an anaerobic environment, actively growing, non-stressed S. mutans produces

significant amounts of acid through fermentation of carbohydrates (Figure 5-1). Under

these conditions, the principal fermentation path is the lactate dehydrogenase (LDH) -

dependent formation of lactate from pyruvate. The formation of lactate also acts to

regenerate NAD+ which is essential for substrate level phosphorylation through

glycolysis. The acidic environment created by S. mutans can easily reach a pH of 4.

Tooth enamel begins demineralizing at pH 5.5, and the acidogenic properties of S.

mutans ultimately give way to caries formation. When grown in aerobic environments,

S. mutans shifts its metabolic processes to a heterofermentive metabolism (Figure 5-3),









creating a less acidic environment (2, 30). The proposed model presented herein starts

with activation of RelQ by low pH that stems from rapidly growing cells in a nutrient rich

environment free from 02. Both previous data in our lab showing the expression of relQ

being upregulated in acidic conditions (Lemos, Burne, unpublished) and the impaired

growth of the ArelQ mutant grown in low pH, support the idea of relQ playing a

significant role in response to this acidic environment.

Oxygen presents numerous challenges to S. mutans, and as a result the bacteria

are less able to tolerate environmental stresses. The role of acetyl~P as a global signal

is becoming increasingly accepted as it has been shown to be regulate a multitude of

various physiological processes (65, 70, 71, 75, 89, 112). Here I suggest that acetyl~P

plays a key role as a global signal in response to oxidative stress conditions. The

Pta/AckA-dependent acetate pathway provides the only known mechanism for S.

mutans to produce acetyl~P. The formation of acetyl~P can be catalyzed by either Pta

in the forward reaction, or AckA in the reverse reaction. The related species S.

pneumoniae and S. sanguis have a second mechanism through the action of pyruvate

oxidase that produces acetyl~P. Spellerburg et al. found that a pyruvate oxidase-

deficient mutant grew at rates similar to WT, but failed to grow in oxygen (97). That

growth defect was restored by the AckA dependent formation of acetyl~P from excess

acetate added to the medium. Other previous work done on S. mutans shows that ackA

is upregulated in the presence of oxygen, with pta interestingly unaffected (4). It has

been established that this Pta/AckA pathway works efficiently in reverse in other

streptococcal species (28, 29, 92, 95). Biochemical studies examining equilibrium

constants for the Pta/AckA-dependent reaction have shown the reaction is likely, as Keq









values of approximately 1 were calculated (39). Looking at the growth of AackA, Apta,

and AackA/pta mutants grown aerobically and anaerobically in excess acetate, I

suggest that the lack of growth by the Apta mutant is due to overaccumulation of

acetyl~P by AckA and on the inability to convert the molecule into acetyl-CoA. The

AackA mutant displays the same growth phenotype as the double AackA/pta mutant in

aerobic conditions, which suggests that the level of acetyl~P in the AackA mutant is

similar to that of the double mutant AackA/pta which cannot synthesize acetyl~P.

Growth rates of these mutants in excess acetate in an anaerobic environment provide

additional clues to the regulation of the Pta/AckA pathway. If the forward reaction is

favored under anaerobic conditions, that would explain the growth defect seen in the

AackA mutant. By accumulating acetyl~P through the forward Pta dependent reaction,

a mutant with a defective ackA gene would not be able to convert the acetyl~P to

acetate. The limited effect on growth of increased acetate in an anerobic environment

also supports the idea of a forward Pta/AckA pathway favored in these conditions. In a

cell that utilizes this forward reaction, an abundance of acetate would have little effect

on acetyl~P levels, as carbohydrate metabolism, and the formation of acetyl-CoA

should be the sole determinant of acetyl~P formation. Based on this evidence, we

suggest that a possible pathway for the formation of acetyl~P is the oxygen-dependent

reverse AckA catalyzed formation of acetyl~P from acetate.

If acetyl~P as a global signal is important for growth in oxygen, but inhibits growth

when oxygen levels are too high, formation of acetyl~P must be tightly regulated. We

suggest multiple layers of regulation and control for acetyl~P production in S. mutans.

In this model, RelQ is activated by low pH produced by non-stressed anaerobically









growing cells. The RelQ mediated (perhaps with cooperative help from RelP)

production of (p)ppGpp would inhibit PDH. This is supported by microarray data

showing the inhibition of the pdh genes by (p)ppGpp. Consequently PDH dependent

synthesis of acetyl-CoA from pyruvate would be inhibited, which in turn would inhibit the

formation of acetyl~P from the forward Pta reaction suggested in the anaerobic

environment. An added layer of control is also suggested by CAT reporter experiments

that suggests that RelQ inhibits the promoter of pta. A third layer of control can be seen

by the downregulation of ackA under anaerobic growth conditions. These seemingly

redundant control mechanisms exhibited by S. mutans suggest and highlight the

importance of regulating production of acetyl~P.

The importance of both a forward and reverse Pta/AckA pathway might be seen

when examining the common mechanisms involved in aerobic and anaerobic growth

conditions. It is commonly known that NADH oxidases play crucial roles in oxygen

removal in S. mutans (43, 44). With increased activity of NADH oxidases under aerobic

conditions, the availability of NADH is restored by shunting carbohydrate metabolism

away from organic acid production and into the incomplete TCA cycle (4, 6). The

importance of NADH might serve to explain the relevance of the reverse Pta/AckA

pathway. Under aerobic conditions, elevated levels of acetate would push the

equilibrium in reverse favoring the formation of additional acetyl-CoA which would

subsequently feed into the TCA cycle for NADH regeneration. The importance of the

forward pathway could be highlighted under anaerobic conditions when carbohydrate

availability is low. Under anaerobic conditions, when glucose levels are high, the cells

are provided with an abundant level of ATP generated through gylcolysis, and the









activity of LDH recycles NAD+ back into the glycolytic pathway. However, in limiting

carbohydrate conditions, PFL would convert the majority of available pyruvate to acetyl-

CoA (Figure 5-2). Low carbohydrate availability would reduce levels of ATP via the

glycolytic pathway. The increased acetyl-CoA levels by PFL would push the Pta/AckA

pathways forward, and a need for ATP would provide a possible explanation for the

importance of this forward pathway, as the AckA dependent conversion of acetyl~P to

acetate is a key ATP generating step.

This proposed model provides some insight into the importance of tight regulatory

mechanisms in response to various environmental conditions. More work is needed to

validate this model and one can not ignore the strong links between aerobic/anaerobic

growth, the involvement of acetyl~P, and (p)ppGpp production. Some questions

remain, especially the relevance of the pseudouridine synthase, RluE. A deletion of

rluE restores aerobic growth in a pta defective mutant in plain BHI, and BHI

supplemented with excess acetate. Because little is known about this RNA

modification, it is almost impossible to draw any conclusions regarding a direct or

indirect relationship between pseudouridine, oxygen, (p)ppGpp, or acetyl~P. Another

mystery is the seemingly nonessential nature of PpnK, since these NAD kinases are

essential for most microorganisms.

Future Directions

Work done regarding acetyl~P, oxidative growth conditions, and (p)ppGpp could

lead to a better understanding of stress regulation in S. mutans.

* Assaying acetyl~P levels by 2D-TLC could confirm the major acetyl~P pathway by
either AckA or Pta, and identify conditions that trigger an enhanced level of acetyl~P
production.









* If the Apta mutant in 02 and the AackA mutant without 02 exhibit an
overaccumulation of acetyl~P, elucidating the role of acetyl~P as a global signal in
the overall genetic regulation of S. mutans would be important to establish.


* Identification of environmental or internal signals that enhance or inhibit expression
of relQ should lead to a better understanding of the role of RelA, RelP, and RelQ
mediated (p)ppGpp synthesis in S. mutans.


* Repeating previous experiments that showed the importance of external acetate to
acetyl-CoA formation, and ultimately to various key macromolecular biosynthetic
reactions (95), could shed some light to questions about cell wall synthesis, biofilm
formation, and cell lysis.


This study evaulated (p)ppGpp and the cellular metabolism of S. mutans.

Continued study of the relationships proposed here will unveil additional information

about the roles of these systems in regulating both stress responses and virulence.












NADH NAD+


I LDH >
e ----- s


Pyruvate


NAD' a;
PDH
NADH


Acetyl-CoA


N.~


pta
'I


I complete TCA


Acetyl-phosphate





ATP *


Acetate

Figure 5-1. Proposed model in non-limiting glucose and anaerobic conditions.
Activation of RelQ by low pH caused by high concentrations of lactic acid by
LDH. RelQ synthesized (p)ppGpp represses PDH further, and also represses
the promoter of pta. The presence of anaerobic conditions also serves to
repress ackA. This model suggests the importance of limiting acetyl~P
concentrations in non-stressed anaerobic conditions.


Lactate


A.ijn.-u n ai RCL a I- pH




RelQ










NADH NAD'


Pyruvate


NAD

NADH _"


Acetyl-CoA

.


Lactate


SReir
RelQ


Incomplete TCA


Acetyl-phosphate


Acetate




Figure 5-2. Proposed model in limiting glucose and anaerobic conditions. Limited ATP
production causes high activity by PFL, which pushes metabolism away from
lactate, and towards acetyl-CoA. High levels of acetyl-CoA push the reaction
mechanism forward to acetate to generate additional ATP by AckA.











NADH NAD'


Lactate


P r 0 ,
NAD'-
PDH FL
NADH Pr


Nea. auluain dm- t 1lier pH




ReIQ


Acetyl-CoA


Incomplete TCA


Acetyl-phosphate


ADP k


ATP


Acetate



Figure 5-3. Proposed model in aerobic conditions. The presence of 02 limits activity of
LDH, and shuts off transcription of PFL. AckA levels are increased in oxygen,
and levels of acetate in the media drive the reaction mechanism in reverse.
Acetyl~P as a global signal in response to oxygen. High levels of acetyl-CoA
is generated to restore NADH levels by shuttling acetyl-CoA into the
incomplete TCA cycle.


`jr









LIST OF REFERENCES


1. Abranches, J., A. R. Martinez, J. K. Kajfasz, V. Chavez, D. A. Garsin, and J.
A. Lemos. 2009. The molecular alarmone (p)ppGpp mediates stress responses,
vancomycin tolerance, and virulence in Enterococcus faecalis. J. Bacteriol.
191:2248-2256.

2. Ahn, S. J., S. J. Ahn, C. M. Browngardt, and R. A. Burne. 2009. Changes in
biochemical and phenotypic properties of Streptococcus mutans during growth
with aeration. Appl Environ Microb 75:2517-2527.

3. Ahn, S. J., and R. A. Burne. 2007. Effects of oxygen on biofilm formation and
the AtlA autolysin of Streptococcus mutans. J. Bacteriol. 189:6293-6302.

4. Ahn, S. J., Z. T. Wen, and R. A. Burne. 2007. Effects of oxygen on virulence
traits of Streptococcus mutans. J. Bacteriol. 189:8519-8527.

5. Ahn, S. J., Z. Z. T. Wen, and R. A. Burne. 2006. Multilevel control of
competence development and stress tolerance in Streptococcus mutans UA159.
Infect. Immun. 74:1631-1642.

6. Ajdic, D., W. M. McShan, R. E. McLaughlin, G. Savic, J. Chang, M. B.
Carson, C. Primeaux, R. Y. Tian, S. Kenton, H. G. Jia, S. P. Lin, Y. D. Qian, S.
L. Li, H. Zhu, F. Najar, H. S. Lai, J. White, B. A. Roe, and J. J. Ferretti. 2002.
Genome sequence of Streptococcus mutans UA159, a cariogenic dental
pathogen. Proc. Natl. Acad. Sci. U. S. A. 99:14434-14439.

7. Alamos, L. 2010, posting date. Oralgen Databases. [Online.]

8. Banas, J. A. 2004. Virulence properties of Streptococcus mutans. Front. Biosci.
9:1267-77.

9. Baracchini, E., and H. Bremer. 1988. Stringent and growth control of ribosomal-
RNA synthesis in Escherichia coli are both mediated by ppGpp. J. Biol. Chem.
263:2597-2602.

10. Barker, M. M., T. Gaal, C. A. Josaitis, and R. L. Gourse. 2001. Mechanism of
regulation of transcription initiation by ppGpp. Effects of ppGpp on transcription
initiation in vivo and in vitro. J. Mol. Biol. 305:673-688.

11. Baron, S. 1996. Medical microbiology, 4th ed. University of Texas Medical
Branch at Galveston, Galveston, Tex.

12. Battesti, A., and E. Bouveret. 2006. Acyl carrier protein/SpoT interaction, the
switch linking SpoT-dependent stress response to fatty acid metabolism. Mol.
Microbiol. 62:1048-1063.









13. Begley, T. P., C. Kinsland, R. A. Mehl, A. Osterman, and P. Dorrestein. 2001.
The biosynthesis of nicotinamide adenine dinucleotides in bacteria. Vitamins and
Hormones Advances in Research and Applications, Vol 61 61:103-119.

14. Belli, W. A., D. H. Buckley, and R. E. Marquis. 1995. Weak acid effects and
fluoride inhibition of glycolysis by Streptococcus mutans Gs-5. Can. J. Microbiol.
41:785-791.

15. Bender, G. R., S. V. W. Sutton, and R. E. Marquis. 1986. Acid tolerance,
proton permeabilities, and membrane ATPases of oral streptococci. Infect.
Immun. 53:331-338.

16. Boucher, P. E., F. D. Menozzi, and C. Locht. 1994. The modular architecture of
bacterial response regulators Insights into the activation mechanism of the
BvgA transactivator of Bordetella pertussis. J. Mol. Biol. 241:363-377.

17. Bougdour, A., and S. Gottesman. 2007. ppGpp regulation of RpoS degradation
via anti-adaptor protein IraP. Proc. Natl. Acad. Sci. U. S. A. 104:12896-901.

18. Bowen, W. H., K. Schilling, E. Giertsen, S. Pearson, S. F. Lee, A. Bleiweis,
and D. Beeman. 1991. Role of a cell surface-associated protein in adherence
and dental-caries. Infect. Immun. 59:4606-4609.

19. Brown, T. A., S. J. Ahn, R. N. Frank, Y. Y. M. Chen, J. A. Lemos, and R. A.
Burne. 2005. A hypothetical protein of Streptococcus mutans is critical for biofilm
formation. Infect. Immun. 73:3147-3151.

20. Brown, T. D. K., M. C. Jonesmortimer, and H. L. Kornberg. 1977. Enzymic
interconversion of acetate and acetyl coenzyme-A in Escherichia coli. J. Gen.
Microbiol. 102:327-336.

21. Burne, R. A. 1998. Oral streptococci ... products of their environment. J. Dent.
Res. 77:445-452.

22. Burne, R. A., Y. Y. M. Chen, D. L. Wexler, H. Kuramitsu, and W. H. Bowen.
1996. Cariogenicity of Streptococcus mutans strains with defects in fructan
metabolism assessed in a program fed specific pathogen- ree rat model. J. Dent.
Res. 75:1572-1577.

23. Carlsson, J., U. Kujala, and M. B. K. Edlund. 1985. Pyruvate-dehydrogenase
activity in Streptococcus mutans. Infect. Immun. 49:674-678.

24. Cate, J. H., M. M. Yusupov, G. Z. Yusupova, T. N. Earnest, and H. F. Noller.
1999. X-ray crystal structures of 70S ribosome functional complexes. Science
285:2095-2104.









25. Charette, M., and M. W. Gray. 2000. Pseudouridine in RNA: what, where, how,
and why. lubmb Life 49:341-351.

26. Chen, Y. Y. M., and R. A. Burne. 1996. Analysis of Streptococcus salivarius
urease expression using continuous chemostat culture. FEMS Microbiol. Lett.
135:223-229.

27. Chinali, G., J. Horowitz, and J. Ofengand. 1978. Replacement of
pseudouridine in transfer-RNA by 5-fluoridine does not affect ability to stimulate
synthesis of guanosine 5'-triphosphate 3'-diphosphate. Biochemistry (Mosc).
17:2755-2760.

28. Collins, E. B., and J. C. Bruhn. 1970. Roles of acetate and pyruvate in
metabolism of Streptococcus diacetilactis. J. Bacteriol. 103:541-&.

29. Collins, E. B., F. E. Nelson, and C. E. Parmelee. 1950. Acetate and oleate
requirements of the lactic group of streptococci. J. Bacteriol. 59:69-74.

30. Dashper, S. G., and E. C. Reynolds. 1996. Lactic acid excretion by
Streptococcus mutans. Microbiology-Uk 142:33-39.

31. Davis, D. R. 1995. Stabilization of RNA stacking by pseudouridine. J. Cell.
Biochem.:56-56.

32. Deretic, V., J. H. J. Leveau, C. D. Mohr, and N. S. Hibler. 1992. Invitro
phosphorylation of AlgR, a regulator of mucoidy in Pseudomonas aeruginosa, by
a histidine protein-kinase and effects of small phosphodonor molecules. Mol.
Microbiol. 6:2761-2767.

33. Durairaj, A., and P. A. Limbach. 2008. Mass spectrometry of the fifth
nucleoside: A review of the identification of pseudouridine in nucleic acids. Anal.
Chim. Acta 623:117-125.

34. Feng, J. L., M. R. Atkinson, W. Mccleary, J. B. Stock, B. L. Wanner, and A. J.
Ninfa. 1992. Role of phosphorylated metabolic intermediates in the regulation of
glutamine-synthetase synthesis in Escherichia coli. J. Bacteriol. 174:6061-6070.

35. Forst, S., J. Delgado, A. Rampersaud, and M. Inouye. 1990. In vivo
phosphorylation of OmpR, the rranscription activator of the OmpF and OmpC
genes in Escherichia coli. J. Bacteriol. 172:3473-3477.

36. Garavaglia, S., A. Galizzi, and M. Rizzi. 2003. Allosteric regulation of Bacillus
subtilis NAD kinase by quinolinic acid. J. Bacteriol. 185:4844-4850.









37. Gibbons, R. J., and J. Vanhoute. 1973. Formation of dental plaques. J.
Periodontol. 44:347-360.

38. Grose, J. H., L. Joss, S. F. Velick, and J. R. Roth. 2006. Evidence that
feedback inhibition of NAD kinase controls responses to oxidative stress. Proc.
Natl. Acad. Sci. U. S. A. 103:7601-7606.

39. Guynn, R. W., and R. L. Veech. 1973. Equilibrium constants of adenosine-
triphosphate hydrolysis and adenosine triphosphate-citrate lyase reactions. J.
Biol. Chem. 248:6966-6972.

40. Hamilton, I. R., and N. D. Buckley. 1991. Adaptation by Streptococcus mutans
to acid tolerance. Oral Microbiol. Immunol. 6:65-71.

41. Haseltin.Wa, and R. Block. 1973. Synthesis of guanosine tetraphosphate and
pentaphosphate requires presence of a codon-specific, uncharged transfer
ribonucleic-acid in acceptor site of ribosomes. Proc. Natl. Acad. Sci. U. S. A.
70:1564-1568.

42. Hata, S., and H. Mayanagi. 2003. Acid diffusion through extracellular
polysaccharides produced by various mutants of Streptococcus mutans. Arch.
Oral Biol. 48:431-438.

43. Higuchi, M., M. Shimada, Y. Yamamoto, T. Hayashi, T. Koga, and Y. Kamio.
1993. Identification of 2 distinct NADH oxidases corresponding to H202-forming
oxidase and H20-forming oxidase induced in Streptococcus mutans. J. Gen.
Microbiol. 139:2343-2351.

44. Higuchi, M., Y. Yamamoto, L. B. Poole, M. Shimada, Y. Sato, N. Takahashi,
and Y. Kamio. 1999. Functions of two types of NADH oxidases in energy
metabolism and oxidative stress of Streptococcus mutans. J. Bacteriol.
181:5940-5947.

45. Hogg, T., U. Mechold, H. Malke, M. Cashel, and R. Hilgenfeld. 2004.
Conformational antagonism between opposing active sites in a bifunctional
RelA/SpoT homolog modulates (p)ppGpp metabolism during the stringent
response. Cell 117:57-68.

46. Hutchison, C. A., S. N. Peterson, S. R. Gill, R. T. Cline, O. White, C. M.
Fraser, H. O. Smith, and J. C. Venter. 1999. Global transposon mutagenesis
and a minimal mycoplasma genome. Science 286:2165-2169.

47. Kakuda, H., K. Hosono, K. Shiroishi, and S. Ichihara. 1994. Identification and
characterization of the AckA (acetate kinase A)-Pta (phosphotransacetylase)
operon and complementation analysis of acetate utilization by an AckA-Pta









Deletion Mutant of Escherichia coli. J. Biochem. (Tokyo). 116:916-922.

48. Kari, C., I. Torok, and A. Travers. 1977. ppGpp cycle in Escherichia coli. Mol.
Gen. Genet. 150:249-255.

49. Kawai, S., S. Mori, T. Mukai, W. Hashimoto, and K. Murata. 2001. Molecular
characterization of Escherichia coli NAD kinase. Eur. J. Biochem. 268:4359-
4365.

50. Kawai, S., S. Mori, T. Mukai, S. Suzuki, T. Yamada, W. Hashimoto, and K.
Murata. 2000. Inorganic polyphosphate/ATP-NAD kinase of Micrococcus flavus
and Mycobacterium tuberculosis H37Rv. Biochem. Biophys. Res. Commun.
276:57-63.

51. Kazmierczak, K. M., K. J. Wayne, A. Rechtsteiner, and M. E. Winkler. 2009.
Roles of rel(Spn) in stringent response, global regulation and virulence of
serotype 2 Streptococcus pneumoniae D39. Mol. Microbiol. 72:590-611.

52. Kirkpatrick, C., L. M. Maurer, N. E. Oyelakin, Y. N. Yoncheva, R. Maurer, and
J. L. Slonczewski. 2001. Acetate and format stress: Opposite responses in the
proteome of Escherichia coli. J. Bacteriol. 183:6466-6477.

53. Kolenbrander, P. E. 2000. Oral microbial communities: Biofilms, interactions,
and genetic systems. Annu. Rev. Microbiol. 54:413-437.

54. Kornberg, A., N. N. Rao, and D. Ault-Riche. 1999. Inorganic polyphosphate: A
molecule of many functions. Annu. Rev. Biochem. 68:89-125.

55. Krasny, L., and R. L. Gourse. 2004. An alternative strategy for bacterial
ribosome synthesis: Bacillus subtilis rRNA transcription regulation. EMBO J.
23:4473-4483.

56. Kumari, S., R. Tishel, M. Eisenbach, and A. J. Wolfe. 1995. Cloning,
characterization, and functional expression of Acs, the gene which encodes
acetyl-coenzyme-A synthetase in Escherichia coli. J. Bacteriol. 177:2878-2886.

57. Lange, R., D. Fischer, and R. Henggearonis. 1995. Identification of
Transcriptional start sites and the role of ppGpp in the expression of RpoS, the
structural gene for the sigma(S) subunit of RNA-polymerase in Escherichia-Coli.
J. Bacteriol. 177:4676-4680.

58. Lee, S. F., A. Progulskefox, G. W. Erdos, D. A. Piacentini, G. Y. Ayakawa, P.
J. Crowley, and A. S. Bleiweis. 1989. Construction and characterization of
isogenic mutants of Streptococcus mutans deficient in major surface protein
antigen-P1 (1/li). Infect. Immun. 57:3306-3313.


100









59. Lemos, J. A., and R. A. Burne. 2008. A model of efficiency: stress tolerance by
Streptococcus mutans. Microbiology-Sgm 154:3247-3255.

60. Lemos, J. A., V. K. Lin, M. M. Nascimento, J. Abranches, and R. A. Burne.
2007. Three gene products govern (p)ppGpp production by Streptococcus
mutans. Mol. Microbiol. 65:1568-1581.

61. Lemos, J. A. C., T. A. Brown, and R. A. Burne. 2004. Effects of RelA on key
virulence properties of planktonic and biofilm populations of Streptococcus
mutans. Infect. Immun. 72:1431-1440.

62. Lerner, F., M. Niere, A. Ludwig, and M. Ziegler. 2001. Structural and functional
characterization of human NAD kinase. Biochem. Biophys. Res. Commun.
288:69-74.

63. Li, J., S. Kustu, and V. Stewart. 1994. In-Vitro Interaction of nitrate-responsive
regulatory protein NarL with DNA target sequences in the FdnG, NarG, NarK and
FrdA operon control regions of Escherichi coli K-12. J. Mol. Biol. 241:150-165.

64. Lie, T. 1977. Early dental plaque morphogenesis scanning electron-microscope
study using hydroxyapatite splint model and a low-sucrose diet. J. Periodontal
Res. 12:73-89.

65. Lukat, G. S., W. R. Mccleary, A. M. Stock, and J. B. Stock. 1992.
Phosphorylation of bacterial response regulator proteins by low-molecular-weight
phospho-donors. Proc. Natl. Acad. Sci. U. S. A. 89:718-722.

66. Ma, J. K. C., C. G. Kelly, G. Munro, R. A. Whiley, and T. Lehner. 1991.
Conservation of the gene encoding streptococcal antigen-I/ll in oral streptococci.
Infect. Immun. 59:2686-2694.

67. Magnusson, L. U., A. Farewell, and T. Nystrom. 2005. ppGpp: a global
regulator in Escherichia coli. Trends Microbiol. 13:236-242.

68. Magnusson, L. U., B. Gummesson, P. Joksimovic, A. Farewell, and T.
Nystrom. 2007. Identical, independent, and opposing roles of ppGpp and DksA
in Escherichia coli. J. Bacteriol. 189:5193-5202.

69. Marquis, R. E. 1995. Oxygen metabolism, oxidative stress and acid-base
physiology of dental plaque biofilms. J. Ind. Microbiol. 15:198-207.

70. Mccleary, W. R., and J. B. Stock. 1994. Acetyl phosphate and the activation of
2-component response regulators. J. Biol. Chem. 269:31567-31572.


101









71. Mccleary, W. R., J. B. Stock, and A. J. Ninfa. 1993. Is acetyl phosphate a
global signal in Escherichia coli. J. Bacteriol. 175:2793-2798.

72. McNeill, K., and I. R. Hamilton. 2003. Acid tolerance response of biofilm cells of
Streptococcus mutans. FEMS Microbiol. Lett. 221:25-30.

73. Mechold, U., H. Murphy, L. Brown, and M. Cashel. 2002. Intramolecular
regulation of the opposing (p)ppGpp catalytic activities of Rel(Seq), the Rel/Spo
enzyme from Streptococcus equisimilis. J. Bacteriol. 184:2878-2888.

74. Meroueh, M., P. J. Grohar, J. Qiu, J. SantaLucia, S. A. Scaringe, and C. S.
Chow. 2000. Unique structural and stabilizing roles for the individual
pseudouridine residues in the 1920 region of Escherichia coli 23S rRNA. Nucleic
Acids Res. 28:2075-2083.

75. Mizrahi, I., D. Biran, and E. Z. Ron. 2006. Requirement for the acetyl phosphate
pathway in Escherichia coli ATP-dependent proteolysis. Mol. Microbiol. 62:201-
211.

76. Munro, C., S. M. Michalek, and F. L. Macrina. 1991. Cariogenicity of
Streptococcus mutans V403 glucosyltransferase and fructosyltransferase
mutants constructed by allelic exchange. Infect. Immun. 59:2316-2323.

77. Nanamiya, H., K. Kasai, A. Nozawa, C. S. Yun, T. Narisawa, K. Murakami, Y.
Natori, F. Kawamura, and Y. Tozawa. 2008. Identification and functional
analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis. Mol. Microbiol.
67:291-304.

78. Nascimento, M. M., J. A. Lemos, J. Abranches, V. K. Lin, and R. A. Burne.
2008. Role of RelA of Streptococcus mutans in global control of gene expression.
J. Bacteriol. 190:28-36.

79. Negre, D., J. C. Cortay, P. Donini, and A. J. Cozzone. 1989. Relationship
between guanosine tetraphosphate and accuracy of translation in Salmonella
typhimurium. Biochemistry (Mosc). 28:1814-1819.

80. Nierlich, D. P. 1978. Regulation of bacterial-growth, RNA, and protein-synthesis.
Annu. Rev. Microbiol. 32:393-342.

81. Nystrom, T. 1994. The glucose-starvation stimulon of Escherichia coli induced
and repressed synthesis of enzymes of central metabolic pathways and role of
acetyl phosphate in gene-expression and starvation survival. Mol. Microbiol.
12:833-843.

82. Ofengand, J., M. Del Campo, and Y. Kaya. 2001. Mapping pseudouridines in
RNA molecules. Methods 25:365-373.


102









83. Ohta, H., H. Kato, N. Okahashi, I. Takahashi, S. Hamada, and T. Koga. 1989.
Characterization of a cell-surface protein antigen of hydrophilic Streptococcus
mutans Strain Gs-5. J. Gen. Microbiol. 135:981-988.

84. Oxford, A. E. 1958. The nutritional requirements of rumen strains of
Streptococcus bovis considered in relation to dextran synthesis from sucrose. J.
Gen. Microbiol. 19:617-623.

85. Paul, B. J., M. M. Barker, W. Ross, D. A. Schneider, C. Webb, J. W. Foster,
and R. L. Gourse. 2004. DksA: A critical component of the transcription initiation
machinery that potentiates the regulation of rRNA promoters by ppGpp and the
initiating NTP. Cell 118:311-322.

86. Paul, B. J., M. B. Berkmen, and R. L. Gourse. 2005. DksA potentiates direct
activation of amino acid promoters by ppGpp. Proc. Natl. Acad. Sci. U. S. A.
102:7823-7828.

87. Perederina, A., V. Svetlov, M. N. Vassylyeva, T. H. Tahirov, S. Yokoyama, I.
Artsimovitch, and D. G. Vassylyev. 2004. Regulation through the secondary
channel-structural framework for ppGpp-DksA synergism during transcription.
Cell 118:297-309.

88. Potrykus, K., and M. Cashel. 2008. (p)ppGpp: still magical? Annu. Rev.
Microbiol. 62:35-51.

89. Pruss, B. M., and A. J. Wolfe. 1994. Regulation of acetyl phosphate synthesis
and degradation, and the control of flagellar expression in Escherichia coli. Mol.
Microbiol. 12:973-984.

90. Roggiani, M., and D. Dubnau. 1993. ComA, a phosphorylated response
regulator protein of Bacillus subtilis, binds to the promoter region of SrfA. J.
Bacteriol. 175:3182-3187.

91. Schroder, I., C. D. Wolin, R. Cavicchioli, and R. P. Gunsalus. 1994.
Phosphorylation and dephosphorylation of the NarQ, NarX, and NarL proteins of
the nitrate-dependent 2-component regulatory system of Escherichia coli. J.
Bacteriol. 176:4985-4992.

92. Shockman, G. D. 1956. The Acetate requirement of Streptococcus faecalis. J
Bacteriol 72:101-104.

93. Shubeita, H. E., J. F. Sambrook, and A. M. McCormick. 1987. Molecular
cloning and analysis of functional cDNA and genomic clones encoding bovine
cellular retinoic acid-binding protein. Proc. Natl. Acad. Sci. U. S. A. 84:5645-9.

94. Softberry, posting date. Softberry BPROM. [Online.]


103









95. Speckman, R. A., and E. B. Collins. 1973. Incorporation of radioactive acetate
into diacetyl by Streptococcus diacetilactis. Appl. Microbiol. 26:744-746.

96. Spedaliere, C. J., J. M. Ginter, M. V. Johnston, and E. G. Mueller. 2004. The
pseudouridine synthases: Revisiting a mechanism that seemed settled. J. Am.
Chem. Soc. 126:12758-12759.

97. Spellerberg, B., D. R. Cundell, J. Sandros, B. J. Pearce, I. IdanpaanHeikkila,
C. Rosenow, and H. R. Masure. 1996. Pyruvate oxidase, as a determinant of
virulence in Streptococcus pneumoniae. Mol. Microbiol. 19:803-813.

98. Srivatsan, A., and J. D. Wang. 2008. Control of bacterial transcription,
translation and replication by (p)ppGpp. Curr. Opin. Microbiol. 11:100-105.

99. Starai, V. J., and J. C. Escalante-Semerena. 2004. Acetyl-coenzyme A
synthetase (AMP forming). Cell. Mol. Life Sci. 61:2020-2030.

100. Svensater, G., B. Sjogreen, and I. R. Hamilton. 2000. Multiple stress
responses in Streptococcus mutans and the induction of general and stress-
specific proteins. Microbiology-Uk 146:107-117.

101. Svitil, A. L., M. Cashel, and J. W. Zyskind. 1993. Guanosine tetraphosphate
inhibits protein-synthesis invivo a possible protective mechanism for starvation
stress in Escherichia coli. J. Biol. Chem. 268:2307-2311.

102. Szalewska-Palasz, A., G. Wqgrzyn, and A. Wegrzyn. 2007. Mechanisms of
physiological regulation of RNA synthesis in bacteria: new discoveries breaking
old schemes. Journal of Applied Genetics 48:281-294.

103. Takahashi, S., K. Abbe, and T. Yamada. 1982. Purification of pyruvate formate-
lyase from Streptococcus mutans and its regulatory properties. J. Bacteriol.
149:1034-1040.

104. Tanzer, J. M., M. L. Freedman, Fitzgera.Rj, and R. H. Larson. 1974.
Diminished virulence of glucan synthesis-defective mutants of Streptococcus
mutans. Infect. Immun. 10:197-203.

105. Terleckyj, B., N. P. Willett, and G. D. Shockman. 1975. Growth of several
cariogenic strains of oral streptococci in a chemically defined medium. Infect.
Immun. 11:649-655.

106. Toulokhonov, I. I., I. Shulgina, and V. J. Hernandez. 2001. Binding of the
transcription effector ppGpp to Escherichia coli RNA polymerase is allosteric,
modular, and occurs near the N terminus of the beta-subunit. J. Biol. Chem.
276:1220-1225.


104









107. Urbonavicius, J., J. M. B. Durand, and G. R. Bjork. 2002. Three modifications
in the D and T arms of tRNA influence translation in Escherichia coli and
expression of virulence genes in Shigella flexneri. J. Bacteriol. 184:5348-5357.

108. Wanner, B. L. 1993. Gene-regulation by phosphate in enteric bacteria. J. Cell.
Biochem. 51:47-54.

109. Wen, Z. T., and R. A. Burne. 2003. LuxS-mediated signaling regulates acid and
oxidative stress tolerance and biofilm formation in Streptococcus mutans. J.
Dent. Res. 82:B358-B358.

110. Wen, Z. Z. T., D. Yates, S. J. Ahn, and R. A. Burne. 2010. Biofilm formation
and virulence expression by Streptococcus mutans are altered when grown in
dual-species model. Bmc Microbiology 10:-.

111. Whittaker, C. J., C. M. Klier, and P. E. Kolenbrander. 1996. Mechanisms of
adhesion by oral bacteria. Annu. Rev. Microbiol. 50:513-552.

112. Wolfe, A. J. 2005. The acetate switch. Microbiol. Mol. Biol. Rev. 69:12-+.

113. Wright, P. M., J. A. Yu, J. Cillo, and A. L. Lu. 1999. The active site of the
Escherichia coli MutY DNA adenine glycosylase. J. Biol. Chem. 274:29011-
29018.

114. Wu, J., and J. P. Xie. 2009. Magic spot: (p) ppGpp. J. Cell. Physiol. 220:297-
302.

115. Yamashita, Y., W. H. Bowen, R. A. Burne, and H. K. Kuramitsu. 1993. Role of
the Streptococcus mutans gtf genes in caries induction in the specific pathogen
free rat model. Infect. Immun. 61:3811-3817.

116. Yan, X., C. Zhao, A. Budin-Verneuil, A. Hartke, A. Rince, M. S. Gilmore, Y.
Auffray, and V. Pichereau. 2009. The (p)ppGpp synthetase RelA contributes to
stress adaptation and virulence in Enterococcus faecalis V583. Microbiology-
Sgm 155:3226-3237.

117. Yin, J. L., N. A. Shackel, A. Zekry, P. H. McGuinness, C. Richards, K. V.
Putten, G. W. McCaughan, J. M. Eris, and G. A. Bishop. 2001. Real-time
reverse transcriptase-polymerase chain reaction (RT-PCR) for measurement of
cytokine and growth factor mRNA expression with fluorogenic probes or SYBR
Green I. Immunol. Cell Biol. 79:213-21.

118. Yoshida, A., and H. K. Kuramitsu. 2002. Multiple Streptococcus mutans genes
are involved in biofilm formation. Appl. Environ. Microbiol. 68:6283-6291.


105









119. Zeng, L., Z. Z. T. Wen, and R. A. Burne. 2006. A novel signal transduction
system and feedback loop regulate fructan hydrolase gene expression in
Streptococcus mutans. Mol. Microbiol. 62:187-200.

120. Ziegler, M. 2000. New functions of a long-known molecule Emerging roles of
NAD in cellular signaling. Eur. J. Biochem. 267:1550-1564.


106









BIOGRAPHICAL SKETCH

Steven Garrett was born in Daejeon, South Korea in 1981. He moved to the

United States in 1986 with his parents, Jong Suk and William Garrett. After graduating

from Rutherford High School as a National Merit Scholar and IB Diploma recipient in

1998, he briefly attended the University of Florida before pursuing a career in music.

After six years in the music industry, Garrett reenrolled at UF in 2006 in hopes of

attending dental school. In 2008 he was awarded a Bachelor of Science in microbiology

and cell science. As a graduate student at UF's College of Medicine, Garrett worked

under the supervision of Robert A. Burne for two years while completing his master's

thesis. Garrett has been able to present his work in a poster session at the 2010 ASM

General Meeting. After graduation, he will be awarded his Master of Science in medical

sciences, and further his education towards a DMD at the University of Florida. Garrett

recently got married to in July 2010 to Kathleen Rouisse.


107





PAGE 1

1 CHARACTERIZATION OF THE RELQ OPERON, AND THE EFFECTS OF (P)PPGPP ON THE GLOBAL GENE REGULATION IN STREPTOCOCCUS MUTANS By STEVEN GARRETT A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Steven Garrett

PAGE 3

3 To the two women in my life, Mom and Kati

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank first and foremost Dr. B urne for his support and guidance throughout this entire project. I would also like to thank my supervisory committee, Dr. Brady and Dr. Gulig. Their input, suggestions, and encouragement to think freely played a huge role in this thesis. Without the help of Dr. Ahn, none of this work would have been possible. So much of his time, hard work, and energy was put into not only this work, but also to make sure I was learning along the way. I thank him tremendously for his invaluable help. All the rest of the Burne Lab members have contributed in some way to this research, so a big thank you to Chris, Kinda, Dr. Zeng, Dr. Liu, Dr. Korithoski, Matt, and Nicole. A big thank you has to go out to my family and friends, whose continued love and support throughout thi s process encouraged me throughout the past two years.

PAGE 5

5 TABLE OF CONTENTS ACKNOWLEDGMENTS .................................................................................................. 4 page LIST OF TABLES ............................................................................................................ 7 LIST OF FIGURES .......................................................................................................... 8 ABSTRACT ................................................................................................................... 10 CHAPTER 1 INTRODUCTION .................................................................................................... 12 Background on Streptococcus mutans ................................................................... 12 The Stringent Repsonse ......................................................................................... 16 PpnK an NAD+ kinase........................................................................................... 20 RluE a pseudouridine synthase ........................................................................... 21 Pta a phosphotransacetylase ............................................................................... 22 Su mmary ................................................................................................................ 23 Specific Aims .......................................................................................................... 24 2 MATERIALS AND METHODS ................................................................................ 27 Bacterial Strains and Growth Conditions ................................................................ 27 Growth Rate and Biofilm Assays ............................................................................ 27 Construction of CAT Mutants and CAT Assays ...................................................... 28 RNA Manipulations ................................................................................................. 28 RelQ Operon Structure ..................................................................................... 29 Microarray Experiments .................................................................................... 29 Real Time Quantitative RT PCR ...................................................................... 29 (p)ppGpp Assays .................................................................................................... 30 3 CHARACTERIZATION OF THE RELQ OPERON IN S. MUTANS UA159 ............. 33 Introduction ............................................................................................................. 33 Results .................................................................................................................... 33 Verifying the Organizational Structure of the relQ Operon by RT PCR ............ 33 Putative Internal pta Promoter in the relQ Operon ........................................... 34 Phenotypic Characterization of the Various relQ Operon Mutants ................... 35 Growth in BHI ............................................................................................. 35 Growth in paraquat .................................................................................... 35 Growth in hydr ogen peroxide ..................................................................... 36 Growth at pH 5.5 ........................................................................................ 36 Growth in acetate ....................................................................................... 37 Biofilm formation ........................................................................................ 38

PAGE 6

6 Regulation of a Putative internal pta Promoter Within the RelQ Operon .......... 38 Discussion .............................................................................................................. 39 Summary ................................................................................................................ 47 4 THE ROLE OF (P)PPGPP IN THE GLOBAL GENE REGULATION OF S. MUTANS ................................................................................................................. 65 Introduction ............................................................................................................. 65 Results .................................................................................................................... 65 Growth Rates of Mutant Strains ....................................................................... 65 ........................................................ 66 Microarray Confirmation by Real Time PCR .................................................... 66 Overexpression Using the Nisin Inducible Expression Vector pMSP3535 ....... 67 Overexpression of RelP .................................................................................... 67 Growth Rates With RelP Overexpression......................................................... 67 Levels of (p)ppGpp In RelP Overexpression .................................................... 68 Microarray Analysis of RelP Overexpression ................................................... 69 Discussion .............................................................................................................. 69 Summary ................................................................................................................ 73 5 SUMMARY AND FUTURE DIRECTIONS .............................................................. 87 Summary and Concluding Remarks ....................................................................... 87 Future Directions .................................................................................................... 91 LIST OF REFERENCES ............................................................................................... 96 BIOGRAPHICAL SKETCH .......................................................................................... 107

PAGE 7

7 LIST OF TABLES Table page 2 1 Strains used in this study .................................................................................... 31 2 2 Primers used in this study .................................................................................. 32 4 1 ......................... 76 4 2 Real time confirmation of microarray data. ......................................................... 81

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Pathways of carbohydrate metabolism by S. mutans ......................................... 25 1 2 Organizational structure of the relQ operon ........................................................ 26 3 1 Positions of primer pairs used for RT PCR to verify relQ operon structure ........ 49 3 2 RT PCR confirming the proposed relQ operon structure .................................... 50 3 3 Expression levels of the pta transcript via real time PCR ................................... 51 3 4 CAT activity of the 291 bp region directly upstream of the ATG start site of pta ...................................................................................................................... 52 3 5 Promoter prediction using BPROM of the 291 bp region upstream of the ATG start site of pta ................................................................................................... 53 3 6 Growth of S. mutans ins in BHI with an oil overlay ................................................................ 54 3 7 Growth of S. mutans ........................................................... 55 3 8 Growth of S. mutans 5mM Paraquat and an oil overlay ............................... 56 3 9 Growth of S. m utans 2O2 and an oil overlay ................ 57 3 10 Growth of S. mutans .................................................... 58 3 11 Growth of S. mutans .................................................... 59 3 12 Growth of S. mutans .................................................. 60 3 13 Growth of S. mutans ...................... 61 3 14 G rowth of S. mutans ................... 62 3 15 Biofilm assay of S. mutans in 20 mM glucose. ............................................................................... 63

PAGE 9

9 3 16 Biofilm assay of S. mutans in 10 mM sucrose ................................................................................ 64 4 1 Growth of S. mutans UA159, UA159relA in the defined medium FMC with an oil overlay ......................................................................... 74 4 2 Growth of S. mutans UA159, UA159relA in the defined m edia FMC without an oil overlay ................................................................................. 75 4 3 Nisin induced expression of LacZ utilizing the pMSP3535 ni sin inducible expression vector ............................................................................................... 82 4 4 Expression of relP with various concentrations of nisin utilizing the nisin inducible vector pMSP3535 ................................................................................ 83 4 5 pMSP3535/relP strain by varying concentrations of nisin in FMC in 5% CO2 .......................................................... 84 4 6 with an empty pMSP3535 expression vector grown in FMC in 5% CO2 ............. 85 4 7 Concentrations of (p)pppGpp via nisininduced expression of relP .................... 86 5 1 Proposed model in nonlimiting glucose and anaerobic conditions .................... 93 5 2 Proposed model in limiting glucose and anaerobic conditions. .......................... 94 5 3 Proposed model in aerobic conditions ................................................................ 95

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CHARACTERIZATION OF THE RELQ OPERON, AND THE EFFECTS OF (P)PPGPP ON THE GLOBAL GENE REGULATION IN STREPTOCOCCUS MUTANS By Steven Garrett August 2010 Chair: Robert A. Burne Major: Medical Sciences Streptococcus mutans is the main causative agent of dent al caries. The virulence of S. mutans stem s from its ability to init iate biofilim formation, fermentation of carbohydrates to organic acids and effective adaptive mechanisms to handle various stresses in the environment. The molecular alarmone (p)ppGpp is a key molecule involved in adaptation to stress. In S. mutans, (p)ppGpp synthesis is catalyzed by three gene products: RelA, RelP and RelQ. We show that relQ is co transcribed in an operon along with an NAD kinase ( ppnK ), a pseudouridine synthase ( rlu E ) and a phosphotransacetylase ( pta ). We also show the presence of an additional pta pr omoter that lies within the coding region of the relQ ope ron and is regulated by the products of relQ, ppnK, and pta. Individual deletion/replacement mutations were made in relQ ppnK rluE pta and the acetate kinase gene ackA along with polar mutants defective in both rluE and pta, and double mutants lacking rluE / pta and ackA / pta The growth characteristics of all strains were compared with the wildtype strain in normal and stressed conditions. The relQ mutant displayed an acidsensitive phenotype as evidenced by slow growth, compared with all other strains, at pH 5.5. The pta mu tant showed the most profound growth defect when cultured in the presence of air in

PAGE 11

11 medium containing the superoxidegenerator paraquat, and in excess concentrations of acetate when grown in the presence of air. The pta mutant strain also displayed a com promised ability to form biofilms in BM medium with 10 mM sucrose or 20 mM glucose. Notably, deletion of rluE in strains lacking the pta gene reversed the slow growth phenotype in air, with the rluE/pta double mutant growing at a rate similar to the wild type strain. Growth rates of the pta deletion mutant when grown in 50mM acetate with and without air were also drastically different, as excess acetate has much less impact on the pta mutant when grown in anaerobic conditions The drastic differences in the growth rates of the ackA and ackA/pta double mutant compared to the pta mutant suggest that the observed phenotypes might be a response to varying levels of acteyl phopshate. Microarray analysis was performe d to determine the effects on global gene ex pression by (p)ppGpp. The transcriptome of a (p)ppGpp0 triple mutant lacking all three (p)ppGpp synthetases was compared a gainst wild type. One hundred thirty two genes were differentially regulated with a pvalue < 0.005. The genes that were the most upregulated in the triple mutant encoded for the pyruvate dehydrogenase complex, which is responsible for the transformation of pyr uvate into acetyl CoA. We also show ed that overexpression of relP causes slowed growth and that these changes in growth corr elate with small differences in (p)ppGpp levels The data present ed in this study show evidence for link age of (p)ppGpp, the relQ operon, and overall stress response that are key to the virulence traits exhibited by the caries pathogen S. mutans

PAGE 12

12 CHAPTER 1 INTRODUCTION Background on Strepto co ccus mutans Streptococcus mutans is a gram positive, facultative anaerobe that belongs to the phylum Firmicutes Members of the Streptococcus species can be categorized based on their hemolytic properties (11) S. mutans can oxidize the iron in hemoglobin, creating a green halo around colonies on blood agar This oxidation of iron is known as alpha hemolysis, which is the reason that S mutans falls hemolytic group (11) S mutans is found pr imarily in the human oral cavity and is the main causative agent of dental caries. The pathogenic potential of S. mutans is associated with its ability to form biofilms on tooth enamel, to metaboliz e a variety of fermentable carbohydrate sources to produce large amounts of o rganic acid s and to tolerate a variety of environmental stresses. Environmental factors such as low pH, fluctuations in nutrient availability, and aerobic to anaerobic transitions can have a profound effect on the virulence of S. mutans (8, 22, 59) The formation of oral biofilms, more commonly referred t o as dental plaque, plays an important role in the development of oral diseases. Biofilms are generally defined as a communit y of microorganisms adhering to a surface (37, 53) Dental plaque can consist of seve ral hundred bacterial species including Streptococcus spp, Actinomyces sp p, Fusobacterium spp, Capnocytophaga spp, Porphyromonas spp, Neisseria spp, Treponema spp, and Lactobacillus spp (21, 53) Plaque formation starts with the formation of the conditioning film on a clean tooth surface. This condit ioning film consists of glycoproteins, mucins and other proteins and forms almost immediately (37, 64) This acquired pellicle allows adhesion of the pr imary colonizers, which consist

PAGE 13

13 mainly of the streptococci and Actinomyces species. Subsequent attachment of the late colonizers and cell to cell interactions with both the primary colonizers and one another complete this simple model of plaque formation in the oral cavity (8, 21, 37) Numerous studies have characterized and isolated various genes in S. mutans that lead to both enhancement and defects in biofilm formation (19, 110, 118) These studies have helped in gaining a better understanding of the environmental and genetic signals for the initial attachment of these primary colonizers that play such a key role in the development of disease. One of the key early stages of biofilm formation by S. mutans is attachment to the tooth surface. This key adhesion step can be mediated by either a sucroseindependent or a sucrosedependent mechanism (8, 111) Sucrose independent adhesion is driven primarily by the antigen I/II surface protein (66) Numerous studies have shown the effects of mutant strains of S. mutans lack ing antigen I/II and their reduced ability to attach to salivacoated hydroxyapitite (18, 58, 83) Sucrose dependent adhesion stems from the synthesis of glucans by glucosyltransfereases (GTFs). The sucrase activity of GTFs catalyze s the splitting of a sucrose molecule into fructose and glucose. The glucose molecule is then added to a growing polymer of glucan. The primary types of glucans that can be formed from these GTF s are the water soluble linear poly mer linked by 1,6 glycosdic linkages and the water insoluble, highly branched polymer that contains mainly 1,3 linkages (8). S mutans possess three GTFs encoded by gtfB, gtfC, and gtfD and a number of studies have shown that by inactivating one or more of the gtf genes, virulence is severely diminished (76, 104, 115)

PAGE 14

14 S. mutans is extremely effic ient in utilizing a variety of different carbohydrate sources. The end products of carbohydrate metabolism by S. mutans are affected by a number of factors, but can include lactate, formate, acetate, and ethanol (Figure 1 1) The formation of lactate by lactate dehydrogenase (LDH) is a major cause in the reduction of pH when glucose is abundant (2, 30) This drop in pH can happen at an alarmingly fast rate, as changes in pH from 7 to 4 have been seen in as little as 3 minutes (100) By reducing the pH of the surrounding environment, S. mutans can change the ecological balance of the plaque flora and cause a relative increase in the proportion of acidogenic and aciduric bacteria (8, 21) The effects of low pH caused by production of these organic acids increase the rate of demineralization of the tooth enamel, as sustained pH levels around 5.5 favor the demineralization of tooth enamel and the formation of dental caries (8). S. mutans must be able to survive the harsh conditions that the oral cavity presents. Since S. mutans effectively acidifies its environment, it must be able to withstand the low pH it is responsible for creating The aciduricity of S. mutans is mediated largely by an F1F0ATPase proton pump, which helps maintain an intracellular pH approximately one unit higher than the external environment (40) The pH optima, as well as the specific activity of the ATPase are major contributors to the extent of acid tolerance that S. mutans can exhibit (15) However, the ATPase is not the only contributor to the acidto lerance capabilities of S. mutans as numerous other genes and proteins have been identified in response to changes in pH. The changes in gene transcription and protein translation that the cell s utlize to adapt to acid stress together with the activity of the ATPase, constitute the acid tolerance response (ATR) of S.

PAGE 15

15 mutans The survival capability in low pH is greatly influenced by the time over which the pH change occurs as cultures of S. mutans were unable to survive with a pH drop of 7.0 to 4.8 if the drop occurred in 10 minutes (40) However, these cells were able to grow effectively if the drop occurred over a 24 hour time period. The acid tolerance ca pabilities of this bacterium are also enhanced by the synthesis of water insoluble glucans and the formation of a biofilm (72) The speed of diffusion of hydronium ions is proportional t o the amount of glucan produced by S. mutans (42) As this pH drop is occurring, the fatty acid profiles of the membrane also shift decreasing permeability to protons, while increasing the excretion of acidic end products (8). The ATR is extremely important to the survival of S. mutans as it not only confers protection against low pH, but also cross protection from other environmental stresses such as oxidative stress and high osmality that it might encounter in the oral cavity (21) Exposure to oxygen is a major source of environmental stress for S. mutans. Microbes that colonize the mouth are subjected to varying oxygen levels (69) Growth in these aerobic conditions present s cells with oxidative stress brought by the formation of reactive oxygen species (ROS) such as superoxide ions and damaging radical species. NADH oxidases convert oxygen and some of its metabolites to H2O or H2O2 and are responsible for the majority of the aerotolerance properties of S. mutans (43, 44) A significant change in c arbohydrate metabolism is also a well known response to oxygen (See Figure 11 for metabolic pathways) Pyruvate formate lyase ( PFL) is responsible for the conversion of pyruvate and CoA into formate and acetyl CoA. In an anaerobic glucose rich envi ronment, the major product of fer mentation is lactate by lactate dehydrogenase (LDH). In these anaerobic conditions, under glucose limitation

PAGE 16

16 and in continuous culture, fermentation shifts away from lactate, and S. mutans produces only formate, acetate, and ethanol by a PFL dependent reaction (103) The PFL enzyme is espe cially sensitive to oxygen a nd is inactivated in aerobic conditions (103) In oxygen, pyruvate dehydrogenase ( PDH) is activated, shifting the c onversion of pyruvate away from a PFL dependent reaction to a PD H dependent reaction. Aerobic conditions also increase expression of genes that encode for the incomplete TCA cycle This partial TCA cycle plays a key role in the oxidative stress response of S. mutans, as it generate s NADH, which is key in protecting t he cell against oxidative stress via NADH oxidases (2, 4, 6) The Stringent Repsonse The stringent response occurs in mos t bacteria and allows the cell to rapidly respond to limited nutritional availability and environmental stress. These responses are mediated by the RelA catalyzed accumulation of the GDP and GTP derived molecular alarmone (p)ppGpp. A ccumulation of (p)ppGpp occurs after aminoacyl tRNA pools fail to keep up with the demands of protein biosynthesis (45) This accumulatio n signals nutritional stress, leading to adjustments of gene expression and inhibition of stable rRNA and tRNA (88) Early studies on the stringent response were based on experiments with E. coli. These early studies revealed two enzymes involved in (p)ppGpp production, RelA and SpoT (48, 88) In E. coli RelA is limited to only synthetase activity, while SpoT has only limited synthetase activity and seems to be specialized for hydrolase activit y (45, 73) The RelA catalyzed production of (p)ppGpp phosphates from ATP to the ribose 3 OH of either GDP or GTP to form e ither guanosine tetraphosphate (ppGpp) or guanosine pentaphosphate (pppGpp) respectively (45, 88) In vitro experiments have

PAGE 17

17 showed that the signal for this reaction is the presence of uncharged tRNA in the acceptor site of a ribosome bound to an mRNA (41) In E. coli and other related proteobacteria, hydrolysis of (p)ppGpp is carried out by SpoT in a Mn2+ dependent reaction, which removes the 3 diphosphate to pr oduce GTP or GDP and releases pyrophosphate (45) SpoT mediated synthesis of (p)ppGpp is thought to be driven primarily by other s ources of nutrient stress such as fatty acid, iron, carbon, and phosphate starvation (12, 17, 114) The inhibition of RNA synthesis is one of the classical features of the stringent response, and this inhibition has been studied to a great extent in E. coli The inhibition of r RNA synthesis by (p)ppGpp occurs at the transcriptional level and evidence suggests a direct binding of (p)ppGpp to RNA polymerase that can be enhanced by DksA (10, 57, 8487, 106) Inhibition or activation of other promoter elements i.e. am ino acid biosynthesis promoters by (p)ppGpp has also been observed, although the mechanisms of action of this transcriptional control is still under debate (67, 102) Although much work has been done on uncovering the myster ies of (p)ppGpp and the stringen t response in E. coli, still very little is known about the mechanisms of control mediated by this alarmone in Streptococcus and other related G ram positive species. For example, studies on B. subtilis and other firmicutes have shown a complet ely different mechanism of control by (p)ppGpp. For example, studies on B. subtilis have show a completely different mechanism of transcriptional control by (p)ppGpp, where the r RNA promoters are insensitive to (p)ppGpp and transcription is in dependent of the cofactor DksA for RNA (p)ppGpp interaction (55, 98) Further more, a great number of bacteria do not even possess these separate and specialized rel A

PAGE 18

18 and spoT genes. On the contrary many bacteria were thought to possess only a single gene product that is responsible for the synthetase and hydrolase activity of (p)ppGpp (73, 88) Some of th e early RSH (Rel Spo homolog) gene products that were studied were based on the RSH of Mycobacterium tuberculosis (RelMtb) and Streptococcus equisimilis (RelSeq). The crystal structure of RelSeq recently revealed that the opposing synthase and hydrolase activities are locked in two mutually excl usive active site conformations, hydrolaseOFF/synthase ON, and hydrolaseON/synthase OFF (45) The switch between the two conformations of these bi functional RSH enzymes appears to involve ligandinduced signal transmission between the two active sites (4 5, 88) It has been known for some time that induction of (p)ppGpp quickly inhibits growth and protein synthesis in exponentially growing cells (88) Increases in (p)ppGpp levels correlate with a downregulation of genes involved in macromolecular biosynthesis and an upr egulation of genes for protein degradation and amino acid biosynthesis (60, 88) Additionally, (p)ppGpp synthesi s is also linked to a wide variety of physi ologic functions including competence, antibiotic production, antiobiotic sensitivity, thermotolerance, adaptation to oxidative stress, and osmotic stress (116) In p athogenic bacteria (p)ppGpp can also influences virulence, persistence, and host interaction (114) Production of b asal levels of this alarmone has a lso been suggested to be necessary for optimal cell growth and allow the organisms to rapidly adapt to large swings in nutrient pools (1, 60, 98) These numerous studies all illustrate the importance of the ability of (p)ppGpp to modify global cellular metabolism almost instantaneously in response to environmental changes, thereby promoting survival and optimizing growth (98)

PAGE 19

19 M ost bacteria were thought to metabolize (p)ppGpp either in a RelA/SpoT mediated system similar to E. coli or one that resembled systems such as RelSeq system with a single RSH gene product responsible for the synthesis and hydrolysis of (p)ppGpp. However, with the recent discoveries of additional small synthetases in S. mutans and B. subtilis (60, 77) it is now accepted that a variety of other species also have similar sequences, along with a fulllength RSH protein. This discovery in S. mutans relA strain did not lead to a (p)ppGpp0 phenotype, indicating the presence of other sources of (p)ppGpp production (60) These other sources came from two additional synthetases, designated RelP and RelQ. Only with a deletion of all three relAPQ genes did S. mutans exhibit a (p)ppGpp0 phenoty pe (60) Little is known about these two weak synthetases as their discoveries have been relatively recent (1, 60, 77) In S. mutans, the operon organizational structures of the relP and relQ operon are intriguing. The relP gene is cotranscribed with relR (a response regulator) and relS (a histidine kinase of a twocomponent system ) (60) Initial findings suggest that RelP appears to be the major source of (p)ppGpp under nonstressed conditions in S. mutans (60) The roles of the remainder of the genes within this operon are still being investigated. Complementation studies in S. mutans show ed that RelQ produced significantl y lower amounts of (p)ppGpp than RelP (60) However, when RelP and RelQ were cloned into E. coli RelQ produced detectable amounts of (p)ppGpp, while RelP failed to produce any detectable amounts of (p)ppGpp (60) The organization al structure of the relQ operon (Figure 1 2) in S. mutans is thought provoking since the gene products in the operon appear at first glance to be

PAGE 20

20 unrelated. Along with relQ an NAD+ kinase ( ppnK ), a pseudouridine synthase ( rluE ), and a phosphotransacetylase ( pta ) are encoded (Figure 1 2 ) Other related streptococcal species, including S. pneumoniae, S. mitis, S. gordonii, and S. sanguinis have similar organizational structures (7). Another interesting c ommonality that some of thes e streptococcal species share is the addition of a mutY gene, which codes for an adenine glycosylase that plays a key role in A/G mismatch repair due to oxidative damage of DNA (113) In S. mutans this mutY gene lies roughly 750 kb downstream of relQ However, mutY is found directly upstream of pta in other oral S treptococci including S. mitis, S. gordonii, and S. sanguinis The organizational differ ences in these genes in the relQ operon exist and furt her studies examining the differences between operons from different species might reveal some new insig hts into additional regulation by (p)ppGpp. P pnK an NAD+ kinase The pyridine nucleotide NADP+ is synthesized by the 2 phosphorylation of NAD+ and is catalyzed by the gene product of ppnK (also sometimes referred to as nadK ) (38) NAD(P) has long been known to be important in energy metabolism. NADH is used mainly in oxidative degradat ion, and NADPH is used in reductive biosynthesis reactions (36) In recent years, the known roles of these pyridine nucleotides have been furt her expanded to include a plethora of biochemical processes including DNA repair and recombination, protein ADP ribosylation, and calcium mediated signaling (120) The synthesis of NAD can be through de novo or pyridine salvage pathways, with quinolinic acid being the key metabolite in the de novo process (36) The synthesis of NADP is dependent on only one ro ute in all living organisms: the magnesium dependent phosphorylation of NAD catalyzed by a highly conserved NAD kinase (13)

PAGE 21

21 Depending on the organism, the phosphoryl donor for catalysis can be ATP, other nucleoside triphosphates, or even inorganic polyphosphate (49, 50, 54, 62) The importance of NAD kinas e for viability has been shown i n a variety of organisms including E. coli, B. subtillus, and S. enterica (36, 38) Given the importance of these conserved NAD kinases, it is surprising that the genes encoding these enzymes are nonessential in certain organisms such as Myclo plasma (46) and yea sts (38) R luE a pseudouridine synthase transcriptional modification of RNA in all living organisms (82) Pse udouridines are found in tRNA, rRNA, snRNA, snoRNA, and tmRNA The mechanism behind this isomerization involves cleavage of the N glycosyl bond of uridine that links the base and sugar, rotation of the uracil ring resulting in C 5 occupying the position that was previously held by N 1, and the reformation of the glycosyl bond as a C C bond. This mechanism is catalyzed by a group of enzymes called pseudouridine synthases (33, 96) In S. mutans the gene product of rluE is thought to catalyze the formation of pseudouridine in rRNA specifically in the 23S rRNA of the large ribosomal subunit (7). Although the presence of pseudouridine was discovered over 40 years ago, the specific functional roles of this fifth nucleotide are still being investigated (25) Recent studies have shown that p articular pseudouridine residues are essential in various organisms, and their functions are largely implied from their specific sites within the RNA structure (33) Most evidence for the function of pseudouridine supports its role in m ain taining stable RNA tertiary structure (74, 107) Improved base stacking conferred by pseudouridine on neighboring nucleosides due to its additional hydrogen bond donor

PAGE 22

22 has been suggested to play a key role in the stabilization of RNA by conferring rigidity in both its single and double stranded regions (24, 31, 82) P ta a phosphotransacetylase When grown in an anaerobic, nonlimiting glucose environment carbohydrate metabolism of S. mutans proceeds via glycolysis with lactate dehydrogenase (LDH) l eading to a homolactic fermentation product Depending on the levels and types of carbohydrates that are available, as well as other factors such as varying oxygen tension, fermentation can also yield acetate, formate, and ethanol. The formation of aceta te involves two major gene products, Pta and AckA. Acetyl CoA must first be phosphorylated with inorganic phosphate to produce acetyl phosp hate by a Ptadependent reaction. The high energy acetyl~ P has an extremely ( 43.3 kJ/mol, c ompar ed to 30.5kJ/mol for ATP), and it phosphorylates ADP to ATP in an AckA dependent reaction. This reaction is also reversible, as Pta and AckA can also catalyze the conversion of acetate into acetyl CoA (92, 95) In fact, studies on Lactococcus lactis have shown exogenous acetate to be incorporated into cell ular lipids by a Ptaand AckA dependent reaction (28) Acetyl CoA is an essential molecule that is central to a variety of key metabolic processes, including cell wall synthesis and fatty acid and amino acid metabolism. In anaerobic conditions, the formation of acetyl CoA from carbohydrate metabolism is dependent on a PFLcatalyzed reaction: pyruvate + CoA acetyl CoA + formate In aerobic conditions, t he formation of acetyl CoA fro m carbohydrate metabolism is dependent on a pyruvate dehydrogenasecatalyzed (PDH) reaction: pyruvate + NAD+ + CoA acetyl CoA + NADH + H+ + CO2

PAGE 23

23 The activity of pyruvate dehydrogenase is largely dependent on oxygen, as the presence of oxy g en increases the expression of pdh while inactivating PFL (23) The formation of acetyl CoA can also be dependent on the reverse Pta/AckA pathway. In the reverse pathway, acetate is c onverted to acetyl~P by an AckA dependent reaction. The acetyl~P is subseq uently acted upon by Pta, which is ultimately converted to acetyl CoA. Acetyl~P is thought to be a key regul atory molecule and can be formed by the phosphorylation of acetyl CoA by the enzyme Pta or by the phosphorylation of acetate by AckA. There is i ncreasing evidence elucidating it s ro le as a global signal responsible for regulating a wide variety of cellular processes (70, 71, 89, 112) The mechanism of control is still not well understood, but one hypothesis for this global control is the direct role of acetyl~P as a phosphate donor to various twocomponent response regulators. Acetyl ~P can d onate its phosphate to a large number of response regulators in vitro but additional work is needed to fully elucidate its role in vivo (70, 71) Acetyl~P also plays an important roll i n energy met abolism, as the AckA dependent hydrolysis of acetyl~P is responsible for additional ATP synthesis by substrate level phosphorylati on. Summary The ability of S. mutans to cope with various stress conditions is essential to its survival. The human oral cavi ty provides a variety of challenges that the organism must overcome, including a wide range of pH levels, aerobic/anaerobic transitions and varying nutrient availability. A key molecule in the stress response of S. mutans is the production of (p)ppGpp. RelA, RelP, and RelQ are the three gene products that govern the production of (p)ppGpp in S. mutans RelA is responsible for the production of (p)ppGpp in response to amino acid starvation, as well as (p)ppGpp hydrolysis. The

PAGE 24

24 roles of RelP and RelQ in (p)ppGpp production have yet to be fully elucidated. This study addressed the contribution of (p)ppGpp in the genetic and physi ological adaptations in S. mutans Specific Aims To characterize the relQ operon and determine its role in the physiology of S. mutans. To determine the physiological and global genetic effects of low basal production of (p)ppGpp during exponential growth of S. mutans.

PAGE 25

25 Figure 11. Pathways of carbohydrate metabolism by S. mutans Under glucoserich, anaerobic conditions, lactate is the primary fermentation product. The formation of lactate is catalyzed by LDH and is responsible for regenerating the NAD+ needed for glycolysis. Under glucoselimiting, anaerobic conditions, S. mutans produces heterofermentative products that include ethanol, formate and acetate, driven by the PFLdependent formation of acetyl CoA. Under aerobic conditions, the formati on of acetyl CoA is driven primary by PDH, as the activity of PFL is extremely sensitive to oxygen.

PAGE 26

26 Figure 12. Organizational structure of the relQ operon. r elQ (666 bp) encodes for a small (p)ppGpp synthetase, ppnK (834bp) encodes for an NAD+ kinase, rluE (891 bp) encodes for a pseudouridine synthase, and pta (996bp) encodes for a phosphotransacetylase.

PAGE 27

27 CHAPTER 2 MATERIALS AND METHOD S Bacterial Strains and Growth Conditions Strai ns used in this study are listed in Table 2 1. S. mutans UA159 derived strains were maintained in brain heart infusion (BHI, Difco Laboratories, Detoroit, MI) bro th When required erythromycin ( ml1 for E. coli or 10 g ml1 for S. mutans ) or kanamycin (50 g ml1 for E. coli or 1 mg ml1 for S. mutans ) (Sigma Al drich, St. Louis, MO) were utilized. S. mutans deletion mutants were created by utilizing standard DNA manipulation techniques as previously described (2, 93) Briefly, two fragments flanking the gene of interest were amplified by PCR, ligated to an antibiotic resistance marker, and the resulting ligation mixtures were used to transform S. mutans. Primer sequ ences used for fragment amplifi cation are listed in Table 22. Growth Rate and Biofilm Assays To compare growth rates, overnight cultures grown in BHI were d iluted 1:50 and grown to midexponential phase (OD600 2. These mid exponential phase cultures were then inoculated in fresh medium at a 1: 100 dilution. The optical density of cells grown at 37C were measured at 600 nm (OD600) every thirty minutes using a Bioscreen C lab system (Oy Growth Curves AB Ltd, Finland (119) The Bioscreen C system was set to shake for 10 seconds every 30 minutes. For anaerobic growth, sterile mineral oil was overlay ed on top of the cultures When measuring growth in the defined medium FMC (105) 10 mM glucose was added as the sole carbohydrate source. Stress condit ions were introduced by adding paraquat, 0.001% or 0.002% H2O2, HCl to lower the medium to pH 5.5, or 50mM sodium acetate ( Sigma Aldrich, St. Louis, MO). Biofilm assays were performed as previously described

PAGE 28

28 (2). B riefly overnight cell cultures were diluted 1:100 in BM media supplemented wit h either 20 mM glucose or 10 mM sucrose as the sole carbohydrate source. Cell cultures were gro wn in a 96well polystyrene plat e (Costar 3595, Corning Inc., Corning, NY) overnight at 37C in 5% CO2. Cells were then washed and stained with crystal violet. After further washing, the dye was extracted from the cells using ethanol and biofilm formation was quantified by measuring absorbance at 575 nm. Construction of CAT Mutants and CAT Assays CAT mutants were created as described by Wen et al. (109) Brief ly, t o construct a CAT reporter gene fusion, a 291bp fragment directly upstream of the pta start site was PCR amplified with th e primers listed in Table 22. This 291bp fragment was then cloned in front of a promoterless chlor a mphenicol acetyltransferase (CAT) gene in pJL105. The resulting integration vector was used to transform WT UA159 lQ, by double homologous crossover with the mtlA phnA locus serving as the integration site. CAT activity of the resulting mutant strains was assayed for the resulting strains. RNA Manipulations RNA was prepared from S. mutans for use in RT PCR, realtime RT PCR, and microarray experiments A t otal culture volume of 10 mL of exponentially growing cells was used. Total RNA was isolated using protocols described elsewhere (26) Briefly, cells were harvested, washed with sodium phosphate buffer, pH 7.0 and resuspended in TE buffer. Cells were then subjected to mechanical disruption in a Bead Beater (Biospec Products, Inc., Bartlesville, OK) and total cellular RNA was extracted using the RNeasy Mini Kit (Qiagen). RNA concentration was estimated spectrophotometrically in triplicate.

PAGE 29

29 RelQ Operon S tructure F irst stand cDNA templates were generated fr from exponentially growing WT cells, using the Super Script First Strand Synthesis System (Invitrogen, Carlsbad, CA) according to the recommended procedure. PCR amplification of the cDNA was performed using various primer pairs (Table 22), a nd fragment sizes were verified by gel electrophoresis to confirm operon structure. Microarray Experiments Microarray experiments comparing the gene expression profiles between WT and (60) strains were done as previously described (4, 78) Briefly, cDNA s using random prim both rel APQ strains. The purified cDNA from the WT and with Cy3 dUTP, and the reference cDNAs were labeled with Cy5dUTP (Amersham Pharmac ia Biotech). Four separate Cy3labeled samples hybridized to the m icroarray slides were provided by The Institute for Genomic Reasearch (TIGR) along with the Cy5labeled reference cDNA, yielding a total of 8 slides Hybridizations took place overnight in a Maui hybridization chamber (BioMicro System s, Salt Lake City, UT). Slides were scanned, and the images were analyzed by TIGR Spotfinder software, and normalized with LOWESS. Statistical analysis was carried out with BRB array tools with a cutoff P value of 0.005. Real Time Q uantitative RT PCR To validate microarray data and to measure expression levels of relP induced with nisin, real time quantitative RT PCR was performed as described elsewhere (4). Briefly, g enespecific primers (Table 2 2) were designed with Beacon Designer 4.0

PAGE 30

30 software (Premier Biosoft International, Palo Alto, CA) to synthesize cDNA from RNA extract. Standard curves were then prepared to measure copy numbers of the resulting cDNA (117) and a S tudent t test was performed to verify the significance of the real time RT PCR quantifications (p)ppGpp Assays Measurement s of levels of (p)ppGpp were done as previously described (60) Briefly, overnight cult ures were inoculated 1:50 in the defined medium FMC with 10 mM glucose and 20% reduced phosphate levels w ith con centrati ons of nisin added at 10, 40, and 80 ng/mL t o induce relP Cells were grown at OD600 0 .2. 32P was then added to radiolabel the samples Cells were harvested and nucleotides were extracted using ice cold 13 M formic acid. Extracts were spotted onto PEI cellulose TLC plates (Selecto Scientific) and separated by 1.5M KH2PO4 pH 3.5 Plates were then exposed to X ray film (Kodak) at 70C.

PAGE 31

31 Table 21. Strains used in this study Strain Phenotype or description Reference or source UA159 Wild type Lab stock relQ ::Km (60) ppnK ::Km This study rluE ::Km This study rluE This study rluE ::Km, pta ::Em This study pta ::Km This study ackA ::Km This study ackA ::Em, pta :: Km This study WT pMSP3535 WT harboring empty pMSP3535 This study relA ::Em, relP ::Spec, relQ ::Km (60) pMSP3535 relAPQ harboring empty pMSP3535 This study relA relAPQ harboring pMSP3535 relA This study relP relAPQ harboring pMSP3535 relA This study relQ relAPQ harboring pMSP3535 relA This study WT:Ppta cat UA159 harboring Ppta cat fusion This study cat Ppta cat fusion This study cat Ppta cat fusion This study cat Ppta cat fusion This study

PAGE 32

32 Table 22. Primers used in this study Primer Sequence Application ppnK A GCTTGCTTTGCTCGCAATAA ppnK deletion, RT PCR ppnK BamHI B TTATCGGTAGGATCCATCTGTGTCA ppnK deletion ppnK BamHI C CTTTTATCGGGATCCTCGATTCAT ppnK deletion ppnK D CATACCCCATTTCTCCTCCA ppnK deletion, RT PCR rluE A GCAGATTCGCGATGACATTA rluE deletion rluE BamHI B TTTTACTTTGGATCCAGCAATGAAT rluE deletion rluE BamHI C GTTCCTTGAGATCCACCTTGATAG rluE deletion rluE D TGGTCCGATAGCATCAAACA rluE deletion pta A GACGAAGAAGCGCTTGAAAC pta deletion pta SacI B TTTTCTCTCGAGCTCCCAAATAAAG pta deletion pta SacI C GCGCAAACCGAGCTCAATACTAAAT pta deletion pta D CAAACTCTTCGCAAGCATCA pta deletion SMu1244sense136 TGGGCAGAGGCTATTATGTG Real time RT PCR SMu1244 antisense244 TCACGCTCAAATTATCAAGTGC Real time RT PCR SMu0957 sense344 TGGGAAATCTGACAACAACACG Real time RT PCR SMu0957 antisense433 AATCTTGCCGTCCTGCGTAG Real time RT PCR SMu1231 sense418 TCAGGAGGTGAACAACAAAGGG Real time RT PCR Smu1231 antisense502 CTCCTGTAGGTTCATCGCAGAG Real time RT PCR SMu0755 sense750 TCGTCCCAATCTCTCCCTAGCC Real time RT PCR SMu0755 antisense883 GGTAAGCAGTTGCTCCCGGAAC Real time RT PCR SMu0177 sense976 GTTGATGTGGTGAGTTCTGAGC Real time RT PCR SMu0177 antisense1076 GTTGAGACAGGTGCTGACGAC Real time RT PCR SMu0187 sense270 GTTTGCTCGACTGCGTTCATTG Real time RT PCR SMu0187 antisense370 CCGTCCGTTTCTCTCTCTGTAC Real time RT PCR relP sense AGACACGCCATTTGAGGATTGC Real time RT PCR relP antisense GGTGCTCCAAACTAGCCCAAG Real time RT PCR 3' BglII pta_CAT GAATACCCATAGATCTATACCCCTA pta promoter amplification 5' SstI pta_CAT TCTGGTAAAGAGCTCCATACAAGTT pta promoter amplification reQ sense TGGGCAACAATTGAACACTCTC RT PCR RT pta sense 348 ACTCGGTTTAGCAGATGGTATGG RT PCR RT rluE sense434 ATGCTCATGCTAGGCTGGATAAG RT PCR RT rluE anti 534 CTCTCCTTGATCAGGCAGTTGC RT PCR

PAGE 33

33 CHAPTER 3 CHARACTERIZATION OF THE RELQ OPERON IN S. MUTANS UA159 Introduction The production of the molecular alarmone (p)ppGpp is crucial during various stress conditions such as nutrient starvation, and is mainly regulated by the enzyme RelA which has both synthetase and hydrolase activity (61) This alarmone signals the cell to sw itch from a growth mode to a su rvival mode (1) RelA also plays a key role in regulating genes that are responsible for the virulence properties of S. mutans including biofilm formation, stress tolerance, and sugar metabolism (60, 61) In S. mutans there are two additional small (p)ppGpp synthetases designated RelP and RelQ. RelP and RelQ have been suggested to play an important role in producing basal levels of (p)ppGpp that are somehow critical for optimal growth (60) Recent data on the specific roles of RelP and RelQ have been interesting. Data in our lab have shown a link between (p)ppGpp, RelP and competence ( Seaton, Burne, unpublished) while another recent study on Enterococcus faecalis has shown a strong correlation between antibiotic resistance and RelQ (1). In S. mutans, the relQ operon has an interesting organizational structure, and as detailed previously, includes ppnK, rluE, and pta By creating and examining the phenotypes of various delet ion mutants, we try ed to further our understanding of the possible relationships between these gene products, as well as to explore other possible roles of (p)ppG pp in stress response. Results Verifying the Organizational Structure of the relQ Operon by RTPCR To verify that the genes relQ, ppnK, rluE, and pta are transcribed as a single operon, RNA was extracted from wild type S. mutans UA159 and RT PCR reactions

PAGE 34

34 using various primer pairs were run to determine the organizational s tructure of the operon (Figure 3 1) The expected transcript fragment sizes of 967 bp, 2.2 Kb p, and 1.8 Kbp were ver i fied confirming the organizational structure of the relQ operon (Figure 3 2 ) Putative Internal pta Promoter in the relQ Operon Expression levels of pta were measured via real time PCR (Figure 3 3 ) Copy numbers of the pta transcript WT and strains were similar in magnitude, as they were on the order of 3 x 105 copies As expected, the strain displayed almost no expression of pta However, the expression of pta in the strain had expression levels on the order of approximately 3 x 103 copies (Figure 3 3 ) This led us to hypothesize the possibility of pta being regulated by an additional promoter, and the activity of this pta promoter could be the reason why pta was still transcribed in a strain To test this hypothesis, we fused the region 291 b p directly upstream of the ATG start site of pta to a promoterless chloramphenicol acetyltransferase ( cat ) integration vector and transformed S. mutans UA159 with the Ppta cat fusion to determine if promoter activity was present in this 291 bp region. T he WT:Ppta cat strain grown in BHI to midexponential phase s howed significant activity of approximately 250 units of CAT activity (Figure 34 ) Using the bacterial promoter software, BPROM, and scanning the region upstream of pta we fo und a possible promot er site 30 bp upstream of the pta start site (Figure 3 5 ) (94) The results from these experiments suggest that there is an internal promoter within the relQ operon that regulates pta independently of the relQ promoter.

PAGE 35

35 Phenotypic Characterization of the Various relQ Operon Mutants Growth in BHI WT, with a mineral oil overlay for anaerobic growth, and their growth rates were determined using the BioscreenC system. The results showed a slightly slowed growth phenotype in the pta deletion mutant with a calculated doubling time of 56 11 minutes, compared to 48 1.3 minutes for WT However, this grow th defect was not seen in t mutant and the growth defect was abolished in the double deletion mutant as they exhibited growth rates similar to that of WT (Figure 3 6 ) For aerobic growth, the oil overlay was not added. With an increased oxygen tension, the overall growth yield was lower for all strains than when grow n with an oil overlay (Figure 37 ) Cells grew to an OD600 of approximately 0.6. Cell lysis was also seen in this aerobic condition as a decrease in the optical density was quickly seen after the cells reached their peak growth, as seen in previous experiments (3). The growth defect of the pta deletion mutant was much more pronounced in these aerobic conditions as doubling ti mes in exponential phase were 90 14 minutes, c ompared to 53 1.7 for WT A s seen in our first growth rate experiment a deletion in rluE with a pta defect restored grow th to WT levels as seen by the growth rates Growth in paraquat To impose superoxide stress on the cells, BHI supplemented with 25mM N N dimethyl 4,4 bipyridinium dichloride ( paraquat ) was added to the media. To limit any further oxidative stress from affecting the cells, an oil overl ay was also added to the media. Overall cell growth was much slower in these conditions, as WT strains did not

PAGE 36

36 reach their final OD until approximately 15 hours, compared to approxi mately 7 hours in plain BHI (Figure 3 8 ) The pta deletion mutant strains showed a severe growth defect, only growing to a peak OD600 of approximately 0.25, with a doubling time of almost 396 69 minutes compar ed to a final O D of 0.6 in a WT strain wit h a doubling time of 95 9.7 minutes Unlike previous growth conditions, a deletion of rluE with a disruption of pta d id not restore growth to WT levels and hours Growth in hydrogen peroxide Hydrogen peroxide confers a different type of oxidative stress to cells than does paraquat (4 ) Whereas paraquat induces superoxide stress by forming O2anions, H2O2 generates reactive hydroxy radical species. Growth was measured in BHI supplemented with either 0.001% or 0.002% H2O2 with an added oil overlay to limit additional oxidative stress. Growth le vels in 0.001% H2O2 of all strains were similar to those in plain BHI with an oil overlay (Figure 3 9 ) When the concentration of H2O2 was doubled to 0.002%, there was no significant change in growth rates with the only difference being a slightly longer lag phase. Growth at pH 5.5 Growth of all strains was measured in BHI acidified to pH 5.5 by 3.0 M HCl, with an added oil overlay (Figure 3 10) A distinct type of growth was observed by the cells when subject ed to acid stress with a lag phase that was less pronounced and proportionately shorter than when seen in normal growth conditions. In pH 5.5 the pH as doubling times were 410 18.3 minutes compared to a doubling time of 334 14.7 minutes seen in the WT strain.

PAGE 37

37 Growth in acetate As discussed previously, t he gene product s of pta and ackA play a key role in both the formation of acetate, as well as the assimilation of exogenous acetate. To see if the excess levels of acetate would alter the growth phenotype of S. mutans all strains were grown i n plain BHI and BHI with the addition of 50 mM acetate There was no significant change in the pH of BHI due to excess acetate, as pH reading s registered at 7.3 with both 0 and 50 mM acetate levels Two additional mutants were introduced in this specific experiment, In varied concentrations of acetate, an additional variable was also included. By including or excluding an oil overlay, the effect of oxyge n on growth in excess acetate was determined. In an aerobic environment, without an added oil overlay, the growth data showed an increased sensitivity to mutant showed a much greater sensitivity to elevated levels of acetate, with almost no growth observed in 50 mM acetate compared to a doubling rate of 77 1.9 minut es seen in WT (Figure 310, Figure 311) mutants were also slowed, as the doubling rate was calculated to be 163 8.28 minutes and 122 15.8 minutes respectively. A deletion of rluE in concurrence with an elmina tion of pta once again showed a res toration of growth to WT levels. In an anaerobic environm ent, the growth results were notably different. The ackA mutant showed a significan t growth defect in plain BHI but elevated levels of acetate had litt l e effect on the mutants (Figure 31 2, Figure 313 )

PAGE 38

38 Biofilm formation The ability to form biofilms is a key virulence factor for S. mutans (110) B iofilm assays were carried out in BM media supplemented with either 20 mM glucose (Figure 3 14) or 10 mM sucrose (Figure 3 15) as detailed in the Materials and M ethods section. Pair wise S tudent t tests we re used to determine a significant difference in biofilm in both 20mM glucose and 10mM sucrose. A significant defect in the abilit y to form biofilms was observed (p < 0.001) in the three pta mut ants: when compared to WT These observations suggest that pta plays an important role in biofilm formation and that a deletion of rluE with a defect of pta did not restore the ability of the cells to form biofilms at levels comparable to the WT strains. Reg ulation of a Putative internal pta Promoter Within the RelQ Operon To investigate the possibility of regulation of the putative internal pta promoter by the genes in the relQ operon, a dditional mutants were constructed to assay the internal promoter activity in various m utant backgrounds. The Ppta cat fusion was transformed and these strains were grown in plain BHI in 5% CO2. C AT assays w ere performed on the WT:Pptacat, cat strains. A deletion in relQ signific antly enhanced the activity of the internal pta promoter (p < 0.001) with CAT activity almost doubling in cat strain compared to the WT:Pptacat strain. A deletion in rluE also enhanced promoter activity, but only by approximately 40%. Whereas a deletion in relQ and rluE served to enhance promoter activity of pta a deletion in ppnK decreased promoter activity of the internal promoter by roughly 30% (Figure 3 3 ) One way ANOVAs and pair wise student t tests were used to verify significant differences in pta

PAGE 39

39 These results suggest that the regulation of the internal promoter of pta is influenced by the gene products of relQ ppnK and pta Discussion The importance of the RelA dependent synthesis and hydrolysis of (p)ppGpp in regulating expression and physiology for growth and survival modes has been well documented (51, 60, 61, 78, 116) Rec ently, additional small (p)ppGpp synthetases have been identified in many gram positive bacteria. S mutans has two additional synthetases designated RelP and RelQ, whose roles in (p)ppGpp have yet to be elucidated. To investigat e the possible roles of R elQ the genes in the relQ operon were investigated. The results of this study provided some clues that might give some insight into the possible roles of RelQ and (p)ppGpp in various stress responses. The importance of pta in the aerobic growth of S. mutans can be seen by the growth data presented herein. Growth of S. mutans in the presence of air leads to the formation of mixed acid fermentation products, with one of the major organic acids pr oduced being acetic acid. After glycolysis, PDH converts a molecule of pyruvate to acetyl CoA. T he genes encoding for the S. mutans PDH complex are significantly upregulated in the presence of air (4). With an incr eased level of acetyl CoA by PDH, Pta phosphorylates acetyl CoA with inorganic phosphate into acetyl phophate. This high energy compound then donates its phosphate group to ADP to form ATP in an AckA dependent reac growth defect that was exacerbated by air. Interestingly, this growth defect observed in aerobic and anaerobic conditions was abolished when a deletion in rluE was also present (Figure 35, Figure 36) A restoration of growth was also seen in

PAGE 40

40 showed almost no growth in 50 mM acetate and aerobic conditions a deletion in rluE in par allel with the defect in pta restored growth to near WT levels. There were however, a few conditions where a deletion in rluE did not restore a pta defective mutant to a WT phenotype. G rowth in the superoxidegenerating agent p araquat was impaired in al l three mutant strai show s that a deletion in rluE does not unconditionally restore growth in pta defective strains. Similar results were seen in biofilm formation, as any mutants with a defect in pta showed a decrease d ability to form biofilms. The presence of oxygen in the environment presents a challenge for S. mutans M icroarray data have shown that about 5% of the genome displayed altered expression in response to aeration with the genes involved in energy meta bolism being the most affected (4). The importance of energy metabolism can also be seen in increased ATPase activity in aerated cells (2). Since the primary mechanism of dealing with oxidative stress in S. mutans involves NADH oxidases and NADH peroxidases, t he increased energy demands by a cell exposed to oxygen may arise from the increased demands involving the maintenance of a proper NAD+/NADH balance. This leads to a simple possible explanation for the importance of pta and it s involvement in production of additional ATP by substrate level phosphorylation. In the acetate pathway, the Pt a dependent formation of acetyl~ P is essential for the formation of additional ATP by Ac kA. The growth inhibition observed might simply b e due to a decreased ATP pool. However, i f growth inhibition was due to decreased ATP availability, one would expect to see similar growth rates of a mutant defective in ackA the gene that is directly

PAGE 41

41 responsible for production of ATP The results seen in the growth data examining both the mutant s in aerobic growth suggest an alternative explanation (Figure 3 10) The also displayed sensitivity to increased levels of acetate. The increased levels of added acetate in the aerobic conditions almost completely abolished growth of th e pta deletion mutant. A possibility for this observation could be the importance of thi s gene in the metabolism of exogenous acetate. It has been shown in vivo in the organism L actococcus lactis that the sole mechanism for the synthesis of diacetyl und er aerobic growth conditions is the utilization of external acetate (95) The formation of diacetyl in prokaryotes comes from an irreversible condensation of acetyl CoA with hydroxyethylthiamine pyrophosphate. Lipoic acid is an essential cofactor for PDH, and Speckman et al. demonstrated in vivo that the omission of lipoic acid from the growth medium could block the PDHcatalyzed formation of acetyl CoA from py ruvate (95) The study subsequently showed that the cell still formed diacetyl from acetyl CoA from the radiolabled external source of acetate (95) Numer ous other studies in a wide range of bacteria also show the assimilation of acetate in the environment by the reversible Pta/AckA pathway (20, 29, 47, 52, 92, 112) The inability to deal with the weak acid effects of external acetate might also hinder growth rates of S. mutans Like other weak acids, acetate in its undi s associated form easily permeates the cell membrane (14) Since S. mutans generally maintains a pH gradient that is one unit higher than its environment these weak acids then disassociate into a proton and an anion. The increased [ H+] concentration acidifies the cytoplasm while the anion increases the internal osmotic pressure (112) Since the data

PAGE 42

42 here show sensitivity to increased levels of acetate only in pta defective strains, a possible mechanism that S. mutans might have in dealing with these toxic effects of acetate could be similar to the strategy employed by E. coli, converting the toxic acetate into the central metabolite acetyl CoA In E. coli, AMP ACS catalyzes acetate assimilation by first converting acetate and A TP into acetyladenelate (acetyl AMP), which in turn reacts with CoASH to form acetyl CoA (99) S. mutans lack the AMP ACS system, but the reversible Pta/AckA pathway is also capable of assimilating exogenous acetate. The biggest difference between the two acetate assimilating pathways is their affinity for the substrates, with the AMP ACS pathway having a Km of 200 acetate, com pared with 710 mM in the reversible Pta/AckA pathway (112) The differences in affinity of the two pathways could account for the fact that studies have revealed that the AMP ACS pathway deals primarily with low concentrations of external acetate less than 2.5 mM while the reversible Pta/AckA pathway deal s with high concentrations of external acetate, e.g. greater than 25 mM (20, 47, 56) This is consistent with the data shown in this study, as the levels of exogenous acetate were on the order of 50 mM, which may cause a shift in acetate meta bolism, favoring utilization of the revers ible Pta /A ckA pathway. The role of acetyl~P as a global signal is becoming widely accepted (16, 70, 71, 75, 89, 112) and might suggest another possible explanation for the growth behavior of t h in vitro studies have shown that response regulators in two component signal transduction systems can be directly phosphorylated by acetyl~P (16, 32, 34, 63, 65, 90, 91) In vivo studies in E. coli have also shown that acetyl~P levels affect the expression of a variety of critic al genetic elements that deal with a wide

PAGE 43

4 3 range of processes including glutamine synthesis, flagella expression, and global response to glucose starvation (34, 35, 81, 89, 108) In S. pneumoniae, a pyruvate oxidase (SpxB) catalyzes the formation of acetyl phosphate in response to oxygen: pyruvate + phosphate + O2 acetyl phosphate + CO2 + H2O2 A S. pneumoniae mutant defective in s pxB produced decreased concentrations of H2O2 and failed to grow aerobically (97) However, gr owth was restored when the medium was supplemented with acetate, which would restore acetyl phosphate levels by the action of AckA. The addition of acetate also restored the adhesion properties of the mutant. The results from this study suggest that the formation of acetyl~P and it s p ossible role as a global signal play a key role in response to various stress conditions (97) Although S. mutans lacks a pyruvate oxidase, the importance of acetyl phosphate as a signal for stress in this model cannot be discounted. An interesting observation can be seen A, rown in the presenc e of air and in 50 mM acetate. While the displa This suggests that the importance of detoxifying the weak acid effects of acetate is minimal, ra if the weak acid effect of acetate were the cause of slowed growth We have established that the reversible Pta/AckA pathway has the capability of catalyzing the formation of acetyl CoA from acetate and that this pathway is effectiv e at dealing with concentrations of acetate greater than 25 mM. If one assumes that the majority of acetyl CoA is being synthesized by the assimilation of external acetate by

PAGE 44

44 the reversible Pta/AckA pathway in a similar manner to S. pneumoniae as previous ly described (95) the data in this study support the idea of acetyl~P playing a key role as a global signal in response to stress and the importance of regulating levels of this signal With acetate levels in excess at 50 mM, AckA may effectively catalyze the phosphorylation of acetate to form acetyl~P. With a deletion in pta the AckA d ependent formation of acetyl~ P from exogenous acetate would be unable to be converted to acetyl CoA, ultimately leading to increasingly elevated level s of acetyl~P. The effects of acetyl~P on growth could be s imilar to the effects of (p)ppGpp, where minute changes in concentrations might be essential f or efficient growth, but an over ac cumulation might be detrimental. This hypothesis has not yet been shown or tested but would provide an explanation for the growth observations seen in these mutants when grown aerobically in excess acetate. A deletion in ackA would prevent the accumulation of acetyl~P from acetate, but it does not rule out the possibilit y of a Pta dependent acetyl~P accumulation from carbohydrate metabolism. However, with a deletion in both ackA and pta acetyl~P would now be unable to be produced from either acetyl CoA or acetate. If in fact the ed in t his study was due to the effect by an overaccumulation of acetyl~P, t he apparent growth restoration of a pta deletion by a simultaneous delection in ackA could now also be explained by the lack of acetyl~P formation. The similar growth rates of bot in oxygen also suggest that the direction of the Pta/AckA pathway in high levels of acetate favor s the reverse reaction under aerobic conditions If acetyl~P was formed by the forward Pta catalyzed reaction from acety l CoA, one mutant to

PAGE 45

45 behave different ly than the The data show just the opposite the possibly suggesting that the and the s hav e similar levels of acetyl~P Although these mutants display faster g exhibit a slowed growth rate when compared to WT, which might again be explained if in fact the presence of acetyl~P was crucial in acting as a global signal in response to growth in oxygen. Data seen in the anaerobi c growth conditions with various levels of acetate reveal The inhibition of anaerobic growth in a n p lain BHI might suggest the favored pathway of the Pta/AckA pathway in varying oxygen conditions. If the forward reaction was favored, acetyl~P over accumulation would be expect ed in mutant uld have very little effect due to the formati on of acetyl~P in a forward Ptacatalyzed reaction from acetyl CoA. That is precisely what the data suggest The data also support the idea of a forward reaction being favored under anaerobic growth, by the g rowth rates In oxygen, showed almost no growth. If an overaccumulation of acetyl~P was the cause of this sever e growth defect in aerobic growth but the forward reaction is favored in anaerobic conditions, one should see drastic ally different results in anaerobic growth conditions. The mutant does in fact g row well in 50 mM acetate in anaerobic conditions and also grow s well with acetate levels up to 100 mM (data not shown) It is likely therefore that t he direction of t he Pta/AckA pathway is influenced by the presence or lack of oxygen. The lack of growth of an S. pneumoniae spx B deletion mutant, when exposed to

PAGE 46

46 an aerobic environment could be restored by the AckA dependent production of acetyl~P (97) However, no growth defects were seen in the spx mutant under anaerobic conditions This study suggests that t he formation of acetyl~P is crucial for growth in oxygen. In fact, studies in S. mutans have shown that a ckA is upregulated under aerobic conditions which could increase the conversion of acetyl~P from acetate (4). Under ana erobic conditions, a ckA is downregulated, which could significantly decrease levels of intracellular acetyl~P from the reverse AckA dependent conversion of acetate The formation of acetyl~P by the forward phosphotransacetylation of acetyl CoA by Pta woul d also be limited based on acetyl CoA availability, as a high availability of glucose and anaerobic growth conditions would mainly produce lactate from pyruvate by LDH (4). The importance of tight regulation of the Pta/AckA pathway is also highl ighted by the evidence that show s an additional pta promoter that lies within the operon that is regulated by the other gene products in the same relQ operon. Increased CAT activity relQ and rluE downregulate the transcription of pta rain suggest s that PpnK enhances transcription of pta This tight regulation of pta not only highlights the importance of this phosphotransacetylase in S. mutans but also serves to illustrate the importance of the entire operon to the stress response of S. mutans. The data is this study are informative when one examines the relationship between rluE and pta. interesting observation can be made. A deletion of rluE restored growth to mutants defective in pta under certain growth conditions Unfortunately very little work has been

PAGE 47

47 done in recent years on the relationship of pseudouridine and the stringent response. Previous work that was conducted examined ization in the anti codon loop of tRNA (27) Since the binding of uncharged tRNA to the A site of the ribosome is the key signal for a RelA dependent mounting o f the stringent response, a number of studies have tried to show a link with pseudouridine and (p)ppGpp synthesis, but the evidence that has been collected so far has failed to show any correlation between the two (27, 79) Stu dies examining the relationship between pseudouridine and carbohydrate metabolism are vi rtually nonexistent However, with bacterial genomes now being readily available and the discovery of a common geneti c operon structure in many gram p ositive bacterial species, in which a (p)ppGpp synthetase and a pseudouridine synthase lie within the sa me operon, it is hard to dismiss completely a relationship between pseudouridine and (p)ppGpp synthesis. At this point however, one can only speculate on potential mechanisms behind the link s between pta, rluE and (p)ppGpp synthesis. Summary The role of ( p)ppGpp in stress responses has been well documented, and it has been linked to a wide range of stresses that include nutri ent starvation, antibiotic resistance, and acid tolerance (1, 60, 61, 88, 114) The recent discovery of novel (p)ppGpp s ynthetases has led to interest in additional regulatory mechanisms of these new rsh gene products. In S. mutans RelQ is one of the two additi onal (p)ppGpp synthetases. The early data shown in this study suggest that the relQ operon plays a role in overall stress response. Acid tolerance, oxidative stress, biofilm formation, and growth in excess acetate are all affected by various mutations in the operon. The data also suggest the importance of the reversible Pta/AckA pathway in producing acetyl -

PAGE 48

48 phosphate and acetyl CoA and the possibility of switching the forward and reverse pathways based on an anaerobic or aerobic growth environment. The data also suggest that an over accumulation of acetyl~P can cause a severe growth defect in S. mutans and that di rection of th e Pta/AckA pathway is influenced by a n anaerobic or aerobic growth environment. The data in their entirety show the importance of the relQ operon and its regulation. An additional regulatory mechanism in the form of a putative internal pta promoter that is r egulated by the other gene products within the same operon has been shown, and this tight knit regulation of pta highlight s how critical the acetate pathway is The most enigmatic data of this study deals with the interconnecting relationship between rluE and pta By what mechanisms does the presence or lack of pseudouridine in the large ribos omal subunit affect acetate, acetyl~P, and acetyl CoA metabolism? How does a lack of pseudouridine in the ribosomes restore growth to a mutant tha t has a defect in pta across a wide range of stress conditions? Previous studies have attempted to examine the importance of pseudouridine present in tRNA for regulating the production of (p)ppGpp, but these studies failed to show any correlation between the two. Perhaps the presence of pseudouridine in rRNA plays a role in r egulating (p)ppGpp production. Or maybe the absence of pseudouridine causes the acetate pathway to reverse somehow. Little is known currently about the significance of these modifie d RNA bases, and m uch more work must be done before one can even start to elucidate these complex questions.

PAGE 49

49 Figure 31. Positions of primer pairs used for RT PCR to verify relQ operon structure. Expe cted fragment sizes are shown if genes within the operon are co transcribed.

PAGE 50

50 Figure 32 RT PCR confirming the proposed relQ operon structure. Each RT PCR reaction was done in duplicate The size of fragments 1, 2, and 3 c orrelate with expected values of roug hly 950 bp, 2.2 Kbp, and 1.8 Kbp. Smal ler additional fragments with unknown identity were observed. T he positive controls shown in lanes 4 6 were also done in duplicate and utilized the same primer pairs to PCR amplify genomic S. mutans DNA.

PAGE 51

51 Figure 33 Expression levels of the pta transcript via real time PCR. Cells were grown to mid exponential phase in BHI at 37C with 5% CO2. Results shown are the mean and standard deviations (error bars) of three separate cultures assayed in triplicate for each strain. One way ANOVAs and pair wise S t udent t tests were used to determine significant differences (p < 0.001) between the WT, 1.00E+00 1.00E+01 1.00E+02 1.00E+03 1.00E+04 1.00E+05 1.00E+06 WT pta rluE rluE Copy numer (Log Scale) Real Time PCR Expression of pta

PAGE 52

52 Figure 34 CAT activity of the 291 bp region directly upstream of the ATG start site of pta Cells were grown to midexponential phase in BHI at 37C with 5% CO2, collected by centrifugation, and then measured for CAT activity. Results shown are the mean and standard deviations (error bars) of 3 separate cultures for each strain. One way ANOVAs and pair wise S tudent t tests were used and the CAT activity was determined to be significantly different between all four strains (p < 0.0 01). 0 100 200 300 400 500 600 WT:Ppta cat relQ:Ppta cat ppnK:Ppta cat rluE:Ppta cat CAT Activity CAT Activity of Putative pta Promoter

PAGE 53

53 Promoter Pos: 99279 8 LDF 5.20 Score 10 box Pos 99281 3 CGTTATCAT 71 35 box Pos: 99283 3 TTGACA 66 993061 TATAAAGTATTAGCTCGTTACGGTGATATCGCCTT 993027 993026 GGTTGATATTCAACTTCATACCGGCCGAACTCACC 9929 92 992991 AAATTCGCGTACACTTTGCTCATATTGGTTTTCCC 992957 992056 CTTTTAGGAGATGATTTATATGGAGGAGAAATGGG 9929 22 992921 GTATGGTTTAAAAAGACAAGCTCTTCACTGCCATT 992887 992886 TTTTGTCTTTTGTGGATCCTTTTTCCAAAGAACA T 992852 35 box 992851 AAGCAGTACAATAGTTCC TTGACA GAAGACCTTGA 992817 10 box 992816 TAG CGTTATCAT AGATTTACAAAAACATTAGATGT 992782 pta start site 992781 AAATACCCCTA || ATG Figure 35 Promoter prediction using BPROM of the 291 bp region upstream of the ATG start site of pta

PAGE 54

54 Figure 36 Growth of S. mutans w ith an oil overlay Optical density at 600 nm was determined ev ery 30 minutes using a Bioscreen C. Each point represents the mean of three separate cultures in triplicate and the standard deviations were Doubling times were calcula ted to be 56 11 minutes for a nd 48 1.3 minutes for WT and the difference was found to be statistically insignificant using a pair wise Student t test 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 3 6 9 12 15OD600Time (hours) BHI (oil overlay) relQ ppnK rluE rluE rluE/pta pta WT

PAGE 55

55 Figure 37 Growth of S. mutans rlay. Optical density at 600 nm was determined every 30 minutes using a Bioscreen C. Each point represents the mean of three separate cultures in triplicate and the standard deviations were Doubling times were cal culated to be 90 14 minutes minutes for the WT strain A pair wise Student t test was used to determine a significant (p < 0.05) 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0 3 6 9 12 15OD600Time (hours) BHI no oil overlay relQ ppnK rluE rluE rluE/pta pta WT

PAGE 56

56 Figure 38 Growth of S. mutans density at 600 nm was determined every 30 minutes using a Bioscreen C. Each point represents the mean of three separate cultures in triplicate and the standard deviations were < 0.08 for all strain s Doubling times were calc ulated to be 396 69 minutes 345 17 minutes 314 75 minutes 114 1.3 minutes f 95 9.7 minutes for WT. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.70 3 6 9 12 15 18 21 0 3 6 9 12 15OD600Time (hours) BHI w/25mM paraquat (oil overlay) relQ ppnK rluE rluE rluE/pta pta WT

PAGE 57

57 Figure 39 Growth of S. mutans H2O2 and an oil overlay. Optical density at 600 nm was determined every 30 minutes using a Bioscreen C. Each point represents the mean of three separate cultures in triplicate and the standard deviations were < 0.06 for all strains. Doublin g times were calculat ed t o be 63 1.7 and 72 1.2 and 56 1.3 and 62 3.8 minutes for the WT in 0.001% and 0.002% H2O2 respectively. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 3 6 9 12 15OD600Time (hours) BHI 0.001% H2O2 w/oil relQ ppnK rluE rluE rluE/pta pta WT 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 3 6 9 12 15OD600Time (hours)BHI 0.002% H2O2 w/oil relQ ppnK rluE rluE rluE/pta pta WT

PAGE 58

58 Figure 310. Growth of S. mutans pH 5.5 and an oi l overlay. Optical density at 600 nm was determined every 30 minutes using a Bioscreen C. Each point represents the mean of three separate cultures in triplicate and the standard devi ations were < 0.07 for all strains. Doubling times were calculated to be 410 18.3 minutes relQ and 334 14.7 minutes for WT A pair wise Student t test was used to determine a significant difference between the growth rates 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 12 0 12 0OD600Time (hours) BHI pH 5.5 (oil overlay) relQ ppnK rluE rluE rluE/pta pta WT

PAGE 59

59 Figure 3 11. Growth of S. mutans determined every 30 minutes using a Bioscreen C. E ach point represents the mean of three separate cultures in triplicate and the standard deviations were < 0.05 for all strains. Doubling times were calculated to be 118 4.4 minutes .78 minutes for WT. A pair wise Student t test was used to determine a signific strains (p < 0.01). 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 3 6 9 12 15OD600Time (hours) BHI 0mM acetate no overlay relQ ppnK rluE rluE rluE/pta pta ackA ackA/pta WT

PAGE 60

60 Figure 312. Growth of S. mutans and mM excess acetate Optical density at 600 nm was determined every 30 minutes using a Bioscreen C. Each point represents the mean of three separate cultures in triplicate and the standard deviations were < 0.15 in all strains Doubling times were calculated to be minutes 77 1.9 minutes for WT. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 3 6 9 12 15OD600Time (hours) BHI 50mM acetate no overlay relQ ppnK rluE rluE rluE/pta pta ackA ackA/pta WT

PAGE 61

61 Figure 313. Growth of S. mutans density at 600 nm was determined every 30 minutes using a Bioscreen C. E ach point represents the mean of three separate cultures in triplicate and the standard deviations were < 0.1 for all strains. Doubling times were calculated 81 2.8 minutes for WT. A pair wise Student t test w as used to determine a significant difference between the growth rates 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 3 6 9 12 15OD600Time (hours) BHI 0 0mM acetate oil overlay relQ ppnK rluE rluE rluE/pta pta ackA ackA/pta WT

PAGE 62

62 Figure 314. Growth of S. mutans th an oil overlay. Optical density at 600 nm was determined every 30 minutes using a Bioscreen C. E ach point represents the mean of three separate cultures in triplicate and the standard deviations were < 0.1 for all strains. Doubling times were calculated minu tes minutes for WT. A pair wise Student t test was used to determine a significant difference between the growth rates between ns (p < 0.01). 0.2 0 0.2 0.4 0.6 0.8 1 0 3 6 9 12 15OD600Time (hours) BHI 50mM aceate oil overlay relQ ppnK rluE rluE rluE/pta pta ackA ackA/pta WT

PAGE 63

63 Figure 315. Biofilm assay of S. mutans in 20 mM glucose. Strains were grown overnight in BM semi defined medium supplemented with 20 mM glucose in a 96well microtiter plate. To assay the strength and integrity of the biofilms, the plates were washed twice with H2O s tained with crystal violet, resuspended with an 8:2 ethanol:acetone mixture, diluted and the resulting suspensions optical densi ty was at OD 575. Results shown are the mean and standard deviation (error bars) of two separate cultures assayed in triplicate. P air wise S tudent t tests were used to determine a significant difference in biofilm formation (p < 0.00 1) 0 0.2 0.4 0.6 0.8 1 1.2 WT relQ ppnK rluE rluE rluE/pta pta OD575 Biofilm Assay (20mM Glucose)

PAGE 64

64 Figure 316. Biofilm assay of S. mutans in 10 mM sucrose. Strains were grown overnight in BM semi defined medium supplemented with 10 mM sucrose in a 96well microtiter plate. To assay the strength and integrity of the biofilms, the plates were washed twice with H2O, stained with crystal violet resuspended with an 8:2 ethanol:acetone mixture, diluted and the resul ting suspensions optical density was at OD 575. Results shown are the mean and standard deviation (error bars) of two separate cultures assayed in triplicates. Pair wise S tudent t tests were used to determine a significant difference in biofilm formation 001) 0 0.1 0.2 0.3 0.4 0.5 0.6 WT relQ ppnK rluE rluE rluE/pta pta OD575 Biofilm Assay (10mM sucrose)

PAGE 65

65 CHAPTER 4 THE ROLE OF (P)PPGPP IN THE GLOBAL GENE R EGULATION OF S. MUTANS Introduction The ability for a bacterial cell to produce (p)ppGpp is crucial, and a lack of (p)ppGpp leads to an a wide range of altered phenotypes including increased susceptibility to stress, multiple amino acid requirements, and abnormal cell morphology (68, 88) Increased levels of (p)ppGpp inhibit growth as seen in a number of previous studies (10, 48, 57, 68, 88, 106, 114) Although the mechanisms of growth inhibition have been studied in great detail in the bacterial paradigm E. coli in gram positive bacteria, the mechanism s behind this inhibition are still not known (9, 10, 80, 88, 101) S. mutans has three (p)ppGpp synthetases: RelA, RelQ, and RelP (60) RelA is responsible for both the hydrolase and synthetase of (p)ppGpp and is the protein responsible for rapid accumulation of (p)ppGpp during the stringent response (60, 61) The roles of RelP and RelQ in (p)ppGpp are still unknown, but are cu rrently being investigated. In this study, global gene regulation of a (p)ppGpp0 mutant was examined by micr oarray analysis. The study also attempt ed to find the effects of elevated levels of (p)ppGpp on the cell via an overexpression of relP in a triple deletion relAPQ backgrou n d Results Growth Rates of Mutant Strains G rowth rates in complete FMC+ glucose were compared for WT UA159, the (p)ppGpp0 tant harboring the empty nisini nducible expression vector pMSP3535 pMSP3535), and the triple mutant strains complemented with either relA, relP, or relQ cloned under the control of the pMSP3535

PAGE 66

66 relQ). Growth data were obtained with both an oil overlay (Figure 4 1) and wi thout (Figure 4 2) No differences were observed with an oil overlay as doubling times were all approximately 60 minutes However, when bacteria were grown relQ strains exhibited a growth defect with do ubling times of approximately 130 minutes compared to a 70 minute doubling time seen in the WT strain In contras relA relP strains had growth rates similar to the WT To analyze the effects of a c omplete lack of (p)ppGpp on global gene expression of exponentially growing cells, m icroarray analysis comparing a (p)ppGpp0 triple mutant ( ) to a WT strain was performed. The microarray data revealed that 132 genes were differentially regulated (p<0.005) In particular, 35 genes were upreglated by a factor of at least 2, while 20 genes were downregulated by a factor of at least 2 (Table 41 ) Th e most abundant gene s upregulated were involved in r egulating cellular processes, energy metabolis m, and protein synthesis. The most abundant downregulated genes were those involved in regulating cellular procecces a nd metabolism of purines, pyrimi dines, nucleosides, and nucleotides. Microarray Confirmation by Real Time PCR Expression levels of Smu1244 ( tpn a transposase fragment ) Smu0957 ( a h ypothetical protein) Smu1231 ( vex2 an ABC transporter) Smu0755 (a hypothetical protein) Smu0177 (a hypothetical protein) Smu0187 (a hypothetical protein) and Smu0840 ( relP ) were measured via real time PCR to verify the m icroarray data (Table 42 ) Gene expression via real time PCR was

PAGE 67

67 using a student two tailed t test with all p values < 0.05. Smu0755, Smu0177, and Smu0187 were downregulated in, while the rest were upregulated. Overexpression Using the Nisin Inducible Expression Vector pMSP3535 To verify t hat we could induce expression of genes in S. mutans using the nisin inducible expression vector pMSP3535, a lacZ reporter was cloned into the pMSP3535 vector Nisin concentrations used were 0 ng/mL, 5 ng/mL, 10 ng/mL, 20 ng/mL, 40 ng/mL, and 80 ng/mL. Activity of lacZ ranged from 15.1 (SD=0.62 ) Miller units with 0ng/m L of nisin to 207 (SD=29 ) Miller units with 80 ng/mL of nisin, which demonstrated the effectiveness of the nisin inducible promoter system (Figure 4 3 ) Overexpression of RelP A mutant that was able to accumulate elevated levels of (p)ppGpp was made by cloning relP into the nisin inducible pMSP3535 vector. The resulting pMSP 3535/ relP fusion was used to transform the triple deletion relAPQ mutant The triple mutant was used to prevent (p)ppGpp hydrolysis by RelA. pMSP3535/relP mutant was grown in BHI supplemented with 0ng/mL, 10ng/mL, 20ng/mL, and 40ng/mL of nisin. After RNA extraction, real time PCR was performed to measure expression levels of relP relP was induced with increasing concentrations of nisin, with copy number levels starting at 3.44 x 105 (SD=5.2 x 104) with 0 ng/mL of nisin, to 4.58 x 106 (SD=1.2 x 106) However, the expression of relP without the induction by nisin, was still high, and reasons behind this expression have not yet been investigated (Figure 44). Growth Rates With RelP Overexpression G rowth rates of the relP pMSP3535/relP were measured in FMC+glucose with 0 ng/mL, 10 ng/mL, 20 ng/mL, 40 ng/mL, and 80 ng/mL

PAGE 68

68 of nisin (Figure 4 5) with an empty pMSP pMSP3535 mutant was measured in FMC+glucose in 0 ng/mL, 40 ng/mL, and 160 ng/mL of nisin (Figure 4 6) No significant growth changes were observed even at nisin concentrations as high as 160ng/mL. T pMSP35 35/relP strain showed decreased growth rates with the induction of relP by nisin increasing doubling times from 93 1.7 minutes with no added nisin to 104 4.96 minutes with nisin concentrations of 80 ng/mL ( Figure 45 ) Levels of (p)ppGpp In RelP Overexpression (p )ppGpp assays were performed to confirm t hat the decrease in growth rate associated with overexpression of relP correlated wi th increased level s of (p)ppGpp. The RelA dependent production of (p)ppGpp by mupirocin in WT was used a positive control whi le a mupirocintreated pMSP3535 mutant was used as the negative control. Levels of (p)ppGpp were extremely high in the positive control, while (p)ppG pp levels were undectable in the mupir ocin treated negative control. Our test samplepMSP3535/relP strain grown in 0ng/mL, 10ng/mL, 40ng/mL, and 80ng/mL of nisin, induced and noninduced with mupirocin. Levels of (p)ppGpp in our test samples were all low, but a small increase of (p)ppGpp was observed. Using ImageJ for densitometry levels of (p)ppGpp on our TLC image proved to be unsuccessful due to the extremely low amounts of (p)ppGpp present. However, previous studies have shown that (p)ppGpp levels and GDP/GTP levels are inversely related (48) U sing the negative control as our baseline, GDP/GTP decreased to 92.9%, 80.4%, 72.2%, and 60% of baseline with the test samples being grown in 0ng/mL, 10ng/mL, 40ng/mL, and 80ng/ mL of nisin respectively. These data suggest

PAGE 69

69 that overexpression of relP does in fact increase levels of (p)ppGpp in S. mutans (Figure 4 6 ) Microarray Analysis of RelP Overexpression To determine the effects of elevated levels of (p) ppGpp by RelP on glob al gene expression in S. mutans a microarray experiment was performed comparing t he effects of a RelP dependent accumulation of (p)ppGpp. The pMSP3535/r elP supplemented with 0 ng/mL of nisin was compared to the same strain supplemented with 80 ng /mL of nisin to induce expression of relP The microarray did not reveal any relevant data, as it was unknown which differentially expressed genes were due to the effects of nisin on the pMSP3535 nisin inducible vector. A second microarray was done compa pMSP3535 mutants. Both strains were grown in BHI sup plemented with 80ng/mL of nisin to standardize the effects of nisin on gene expression. Unfortunately, conclusive data was not obtained as relP was the onl y gene differentially expressed. Discussion The molecular alarmone (p)ppGpp is synthesized by the three RSH proteins in S. mutans : RelA, RelP, and RelQ. The recent discovery of additional synthetases raises many questions regarding (p)ppGpp metabolism in gram positive bacteria. Previous studies on the RelP and RelQ enzymes in S. mutans highlight the complexity of (p)ppGpp production. In this or ganism, RelP was shown to produce higher levels of (p)ppGpp, but i n E. coli, regarded as the bacterial paradigm, it was RelQ that produced significant amounts of (p)ppGpp, while RelP failed to produce any detectable levels at all (60) These finding s suggest that the regulation of (p)ppGpp synthesis is reliant on a wide variety of factor s independent of transcriptional control. Regardless, it is widely

PAGE 70

70 accepted tha t accumulation of (p)ppGpp plays a key role in mediating cellular response to various stresses in the environment. To shed some light on possible stress responses that are mediated by (p)ppGpp, this study examined the effects of (p)ppGpp on the global gene regulation of S. mutans. The a slowed growth phenotype in response to oxygen exposure. The (p)ppGpp0 showed restored growth when complemented with either relA or relP but not with relQ (Figure 4 2) Previous data in our lab has showed the lack of (p)ppGpp production by RelQ in S. mutans (60) which may explain the lack of growth restoration with pMSP3535/relQ strain. When grown with an oil overlay, all strains gre w at similar rates (Figure 4 1). These data suggest that (p)ppGpp production and proper responses to oxygen stress are key for the survival of S. mutans Microarray data in this study also support the importance of (p)ppGpp and oxygen to the metabolic pathways of S. mutans The microarray data reveal a substantial response in the genes that encode pyruvate dehydrogenase to (p)ppGpp. In a cell that fails to produce any (p)ppGpp, strain, the genes in the pdh operon are the most upregulated of the 132 genes identified by the microarray data. Pyruvate dehydrogenase is a multienzyme complex which catalyze s the overall reaction: Pyruvate + NAD+ + CoA acetyl CoA + NADH+ H+ + CO2 PDH is found in aerobic and facultative anaerobic bacteria, and it s activity is increased in response to oxygen (4, 23) In S. mutans this shifts fermentation away from the lactate dehydrogenase dependent formation of lactate, and towards mixed acid fermentation products, including acetate, formate, and ethanol. PDH is subject to strict

PAGE 71

71 regu lation and feedback control, and can be inhibited by levels of acetyl phosphate. Acetyl~P, which was discus sed in previous chapters, is a potent inhibitor of PD H even more so than acetyl CoA (4, 23) The fact that the microarray data presented in this study show that (p)ppGpp inhibits pdh (Table 41) support s the association between (p)ppGpp, the Pta/AckA pathway, acetyl~P as a global signal, and oxidative stress in S. mutans The roles of RelP and RelQ in (p)ppGpp product ion are still poorly understood. Some studies have suggested the importance of these genes in various stress responses, such as antibiotic tolerance (1). The data shown in this study also show a possible link to stress tolerance and RelQ. demonstrated a slowed growth rate. Previous data from our lab also showed that relQ is upregulated in acidic medium (Lemos, Burne, unpublished). mutant showed no other defects in a number of vario us stre ss conditions, this was of interest, but elucidating its role in acid stress was challenging If in fact RelQ is activated in response to low pH, perhaps that response is indirectly associated with anaerobic growth. S. mutans is known to produce l actic acid as a primary product of anaerobic fermentation. When unable to produce lactic ac id, the extent to which S. mutans can acidify its env ironment becomes greatly reduced, as the pKa of lactic acid is almost one unit lower than that of acetic acid ( 3.86 vs 4.76 respectively) RelQ (with perhaps the involvement of RelP) could possibly synthesize (p)ppGpp in response to decreased pH as a result of homeostatic growth in nonstressed, anaerobically growing cells The lack of oxygen downregulates ackA preventing the AckA dependent formation of acetyl~P from acetate. However, acetyl~P can still be synthesized from the forward Pta

PAGE 72

72 dependent conversion of acetyl CoA Previous microarray data showing the effects of oxygen failed to reveal any effects on p ta (4). However during anaerobic conditions, and low pH if (p)ppGpp limits the production of acetyl CoA via the genes that encode for the enzymes that make up PDH, the formation of the Pta dependent formation of acetyl~P by carbohydrate metabolism would be reduced. The levels of acetyl~P produced seem to be important and tightly r egulated. Data shown in previous chapters suggest that the accumul ation of acetyl~P by the oxygenactivated AckA dependent conversion of acetate and the anaerobic activated Pta conversion of acetyl CoA can inhibit cell growth. Perh aps (p)ppGpp production by RelQ plays a key role in inhibiting production of acetyl~P. Since AckA is downregulated in anaerobic conditions, the result of the conversion of the glyocolytic end product pyruvate to acetyl CoA by PDH, and then to acetyl~P by Pta might prove to be severely detrime ntal to homeostatic growth since an acc umulation of acetyl~P would be predicted under these conditions to be caused by the inability to convert the accumulated acetyl~P to acetate by AckA. Further suggesting the importance of me chanisms to regulate acetyl ~P are the data that show that RelQ inhibits the activity of a promoter of pta This may represent yet another level of control. Although this provides an intriguing hypothesis, much work needs to be done to validate these proposed mechanisms. The rapid accumulation of ( p)ppGpp is known to inhibit growth and protein synthesis. Growth data shown here support this finding. A RelP dependent induction of (p)ppGpp slowed the growth rate of In previous work done by Lemos et al (60) strain with the

PAGE 73

73 same methodology and protocols utilized in this study. Their results sh owed a greater effect of RelP overexpression on growth, as a total inhibition of cell growth was reported at 50ng/mL of nisin (60) This cont rasts with the findings presented in this study, as the growth rate inhibition by overexpression of RelP was not as pronounced as the growth rate inhibiiton pMSP3535/relP strain when grown in concentrations of nisin as high as 80ng/mL. In f act, growth was still observable, as the relP inducible strain showed no significant growth difference between cells grown in 80ng/mL and 160ng/mL of nisin. This suggests cooperativeity between RelP and RelQ in ef fectively synthesizing (p)ppGpp. Summary T he recent discovery of additional Rsh homologues in a wide range of gram positive bacterial species has renewed interest about (p)ppGpp metabolism, and its roles and mechanims of action in a number of varying conditions. So far, these additional synthetas es have been linked to factors ranging from antiobiotic tolerance (1) to competence (5). This study examine d the effects of the absence and overproduction of (p)ppGpp on the genetic regulation of S. mutans Microarray analysis looking at the effects of a complete lack of (p)ppGpp suggest ed a link between metabolism in oxygen and (p)ppGpp. A proposed model highlighting the importance of acetyl~P, and its p ossible role in conditions that present the cell with oxidative stress was presented. The effect of RelP overexpression by nisin was shown to inhibit the growth of S. mutans by elevating levels of (p)ppGpp.

PAGE 74

74 Figure 41. Growth of S. mutans UA159, UA 159PQ relA in the defined medium FMC with an oil overlay Optical density at 600 nm was determined every 30 minutes using a Bioscreen C. E ach point represents the mean of three separate cultures in triplicate, and the standard deviations were < 0.1 for all strains. Doubling times for all strains were approximately 60 minutes. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 3 6 9 12 15OD600Time (hours) FMC oil overlay WT WT pMSP3535 relAPQ relAPQ pMSP3535 relAPQ relP relAPQ relQ relAPQ relA

PAGE 75

75 Figure 42. Growth of S. mutans UA159, UA159pMSP3535relA in the defined media FMC without an oil overlay. Optical density at 600 nm was determined every 30 minutes using a Bioscreen C. Each point represents the mean of three separate cultures in triplicate and the sta ndard deviations were < 0.1 for all strains. Doubling times for pMS P3535relQ were approximately 130 minutes, with the remaining strains all had a doubling time of approximately 70 minutes. 0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0:00 3:00 6:00 9:00 12:00 15:00 18:00 21:00 0:00OD600Time (hours) FMC no oil overlay WT WT pMSP3535 relAPQ relAPQ pMSP3535 relAPQ relP relAPQ relQ relAPQ relA

PAGE 76

76 Table 41. to WT strain Ratio of geom means Unique id Description Gene Name 9.26 SMU.1422 putative pyruvate dehydrogenase E1 component beta subunit) acoB 7.20 SMU.58 hypothetical protein 6.57 SMU.208c putative transposon protein possible DNA segregation ATPase 6.51 SMU.1423 putative pyruvate dehydrogenase, TPPdependent E1 component alpha subunit acoA 5.77 SMU.1424 putative dihydrolipoamide dehydrogenase adhD 5.39 SMU.575c putative membrane protein lrgA 3.93 SMU.420 putative ribosomal protein 3.90 SMU.212c hypothetical protein 3.74 SMU.1600 putative PTS system, cellobiosespecific IIB component celB 3.45 SMU.202c hypothetical protein 2.95 SMU.46 hypothetical protein 2.94 SMU.198c putative conjugative transposon protein tpn 2.91 SMU.1909c hypothetical protein 2.89 SMU.197c hypothetical protein 2.82 SMU.1160c hypothetical protein 2.81 SMU.200c hypothetical protein 2.79 SMU.897 putative type I restrictionmodification system, helicase subunits hsdR 2.57 SMU.1367c conserved hypothetical protein 2.56 SMU.1504c hypothetical protein 2.55 SMU.1598 putative PTS system, cellobiosespecific IIA component celC 2.50 SMU.685 hypothetical protein 2.48 SMU.2076c hypothetical protein 2.38 SMU.831 conserved hypothetical protein 2.37 SMU.11 conserved hypothetical protein 2.37 SMU.113 putative fructose1 phosphate kinase pfk 2.36 SMU.210c hypothetical protein 2.33 SMU.1984 putative competence protein ComYC comYC 2.30 SMU.910 glucosyltransferase S gtfD 2.26 SMU.724 putative glycerophosphoryl diester phosphodiesterase glpQ All values p < 0.005

PAGE 77

77 Table 41. Continued Ratio of geom means Unique id Description Gene Name 2.13 SMU.115 putative PTS system, fructosespecific IIA component 2.08 SMU.1485c putative endonuclease 2.05 SMU.108 hypothetical protein 2.04 SMU.1761c conserved hypothetical protein 2.04 SMU.1209c hypothetical protein 2.02 SMU.365 glutamate synthase (large subunit) gltA 1.98 SMU.310 sorbitol operon activator srlM 1 .94 SMU.2001 DNA directed RNA polymerase, alpha subunit rpoA 1.94 SMU.09 conserved hypothetical protein 1.93 SMU.1475c conserved hypothetical protein 1.90 SMU.948 conserved hypothetical protein 1.89 SMU.656 putative MutE 1.88 SMU.1816c putative maturase related protein 1.84 SMU.1899 putative ABC transporter, ATP binding and permease protein 1.82 SMU.1818c hypothetical protein 1.78 SMU.491 putative DeoR type transcriptional regulator 1.78 SMU.2012 30S ribosomal protein S8 rpsH 1.77 SMU.1161c hypothetical protein 1.74 SMU.1763c conserved hypothetical protein 1.74 SMU.1111c conserved hypothetical protein 1.72 SMU.2161c conserved hypothetical protein 1.69 SMU.1513 putative chromosome segregation ATPase SMC protein smc 1.67 SMU.2089 putative mismatch repair protein HexB hexB 1.65 SMU.1539 putative 1,4alpha glucan branching enzyme glgB 1.64 SMU.830 RgpFc protein rgpFc 1.63 SMU.1737 putative 3 hydroxymyristoyl (acyl carrier protein) dehydratase fabZ 1.62 SMU.1080c conserved hypothetical protein possible transposon related protein 1.57 SMU.15 putative cell division protein FtsH 1.56 SMU.554 conserved hypothetical protein 1.55 SMU.1018 hypothetical protein

PAGE 78

78 Table 41. Continued Ratio of geom means Unique id Description Gene Name 1.54 SMU.1044c putative pseudouridylate synthase rluE 1.51 SMU.1591 catabolite control protein A, CcpA regM 1.50 SMU.366 NADPH dependent glutamate synthase (small subunit) gltD 1.50 SMU.2011 50S ribosomal protein L6 (BL10) rplF 1.50 SMU.2008 50S ribosomal protein L30 rpmD 1.50 SMU.555 conserved hypothetical protein 0.710 SMU.181 putative mevalonate kinase mvaK 0.685 SMU.1871c conserved hypothetical protein 0.678 SMU.60 DNA alkylation repair enzyme alkD 0.672 SMU.395 X prolyl dipeptidyl peptidase pepX 0.669 SMU.1628 conserved hypothetical protein 0.662 SMU.474 putative autoinducer 2 production protein LuxS luxS 0.643 SMU.1622 putative peptide methionine sulfoxide reductase msrA 0.632 SMU.771c hypothetical protein 0.632 SMU.1545c conserved hypothetical protein 0.631 SMU.2074 putative anaerobic ribonucleosidetriphosphate reductase nrdD 0.630 SMU.2040 putative transcriptional regulator repressor of the trehalose treR 0.623 SMU.318 putative hippurate hydrolase hipO 0.623 SMU.530c conserved hypothetical protein 0.623 SMU.1546 conserved hypothetical protein 0.620 SMU.1225 putative transcriptional regulator cpsY 0.620 SMU.919c putative ATPase, confers aluminum resistance 0.617 SMU.1054 putative glutamine amidotransferase guaA 0.612 SMU.1050 putative phosphoribosylpyrophosphate synthetase, PRPP synthetase prsA 0.610 SMU.268 adenylosuccinate synthetase purA 0.608 SMU.1323 conserved hypothetical protein possible hydrolase 0.607 SMU.1578 putative biotin operon repressor birA 0.606 SMU.1387 putative oxidoreductase mocA 0.606 SMU.1254 conserved hypothetical protein 0.605 SMU.627 conserved hypothetical protein

PAGE 79

79 Table 41. Continued Ratio of geom means Unique id Description Gene Name 0.593 SMU.1876 conserved hypothetical protein 0.586 SMU.1298 50S ribosomal protein L31 rpmE 0.586 SMU.1076 putative membrane protein 0.580 SMU.1621c conserved hypothetical protein 0.576 SMU.167 hypothetical protein 0.576 SMU.1804c hypothetical protein 0.575 SMU.442 conserved hypothetical protein 0.571 SMU.1251 conserved hypothetical protein 0.570 SMU.174c conserved hypothetical protein 0.566 SMU.1931 putative glucoseinhibited division protein gidB 0.564 SMU.1479 conserved hypothetical protein 0.560 SMU.299c putative bacteriocin peptide precursor ip 0.557 SMU.1386 putative uridine kinase udk 0.555 SMU.926 conserved hypothetical protein possible GTP pyrophosphokinase relP 0.555 SMU.1950 putative pseudouridylate synthase rluE 0.550 SMU.412c putative Hit like protein involved in cell cycle regulation 0.547 SMU.1579 hypothetical protein 0.539 SMU.145 conserved hypothetical protein 0.537 SMU.589 putative DNA binding protein hlpA 0.518 SMU.429c hypothetical protein 0.514 SMU.2059c putative integral membrane protein 0.506 SMU.440 hypothetical protein 0.501 SMU.1602 putative NAD(P)H flavin oxidoreductase frp 0.489 SMU.1807c putative integral membrane protein, possible permease 0.489 SMU.2043c conserved hypothetical protein dtd 0 .481 SMU.441 putative transcriptional regulator 0.481 SMU.1592 putative dipeptidase PepQ pepQ 0.476 SMU.609 putative 40K cell wall protein precursor bsp 0.474 SMU.1603 putative lactoylglutathione lyase gloA 0.474 SMU.911c hypothetical protein

PAGE 80

80 Table 41. Continued Ratio of geom means Unique id Description Gene Name 0.460 SMU.1211 conserved hypothetical protein 0.459 SMU.839 putative folyl polyglutamate synthetase folC 0.450 SMU.985 putative beta glucosidase bglA 0.445 SMU.1004 glucosyltransferase I gtfB 0.395 SMU.503c hypothetical protein 0.395 SMU.1347c conserved hypothetical protein possible permease ylbB 0.377 SMU.984 hypothetical protein 0.368 SMU.133c putative MDR permease transmembrane efflux protein 0.350 SMU.1348c putative ABC transporter, ATP binding protein psaA 0.224 SMU.1048 conserved hypothetical protein 0.108 SMU.1363c putative transposase tpn 0.00141 SMU.1046c putative GTP pyrophosphokinase relQ 0.000837 SMU.2044 putative stringent response protein, ppGpp synthetase relA

PAGE 81

81 Table 42 Real time confirmation of microarray data. Gene ID Common Name Microarray Real time Smu1244 tpn 0.108 0.0841 Smu0957 0.224 0.173 Smu0755 2.38 1.49 Smu0177 2.89 1.97 Smu0187 6.57 2.92 Smu0840 relP 0.555 0.0000566 Smu1231 vex2 0.350 0.298 Real time data p <0.05

PAGE 82

82 Figure 43. Nisin induced expression of LacZ utilizing the pMSP3535 nisininducible expression vector. Results shown are the mean and standard deviation (error bars) of three separate cultures. Oneway ANOVAs and pair wise student t tests were used to determine a significant difference between all samples in the expression of the lacZ reporter gene in the pMSP3535 expression vector when induced with various concentrations of nisin (p < 0.001) 0 50 100 150 200 250 0ng/mL 5ng/mL 10ng/mL 20ng/mL 40ng/mL 80ng/mL Miller Units[nisin] Nisin Induced pMSP3535 LacZ

PAGE 83

83 Figure 44. E xpression of relP with various concentrations of nisin ut ilizing the nisin inducible vector pMSP3535. Results shown are the mean and standard deviation (error bars) of three separate cultures assayed in triplicate. Oneway ANOVAs and pair wise student t tests were used to determine a significant difference between all samples in the expression of relP in the pMSP3535 expression vector when i nduced with various concentrations of nisin (p < 0.001). 0.00E+00 1.00E+06 2.00E+06 3.00E+06 4.00E+06 5.00E+06 6.00E+06 7.00E+06 0 ng/ml 10 ng/ml 40 ng/ml 80 ng/ml Copy NumberConcentrations of Nisin (ng/ml) Overexpression of relP by nisin

PAGE 84

84 Figure 4pMSP3535/relP strain by varying concentrations of nisin in FMC in 5% CO2. Optical density at 600 nm was determined manually every hour. E ach point represents the mean of three separate cultures the and standard deviations were < 0. 0 8 for all strains. Doublin g times were calculated to be 93 1.7 minutes with 0 ng/mL of nisin, 96 1.5 mi nutes with 10 ng/mL of nisin, 102 1.76 minutes with 20 ng/mL of nisin, 109 9.2 2 minutes with 40 ng/mL of nisin and 104 4.96 minutes 80 ng/mL of nisin. A pair wise Student t test was used to determine a significant difference between the growth rates observed with 0 ng/mL of nisin and concentrations of nisin greater than 20 ng/mL (p < 0.005) 0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0 2 4 6 8 10OD600Time (hours pmSP3535/relP grown in various [nisin] 0ng/mL 10ng/mL 20ng/mL 40ng/mL 80ng/mL

PAGE 85

85 Figure 46. Negative control showing the with an empty pMSP3535 expression vector grown in FMC in 5% CO2. Optical density at 600 nm was determined manually every hour. E ach point repres ents the mean of three separate cultures and the standard deviations were < 0.07 for all strains. pMSP3535 strain by varying concentrations of nisin up to 160 ng/m L was shown, and doubling times were determined to be approx imately 9 0 minutes for all strains. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0 2 4 6 8OD600Time (hours) pMSP3535 grown in various [nisin] relAPQ pMSP3535 relAPQ pMSP3535 40 ng/mL relAPQ pMSP3535 160 ng/mL

PAGE 86

86 Figure 47. Concentrations of ( p)pppGpp via nisininduced expression of relP. 1,2) WT strain uninduced and induced with mupirocin as a positive control. 3,4) The pMSP3535 uninduced and induced with mupirocin as a negative control. 5,7,9,11) pMSP3535/relP strain induced with 0, 10, 40, and 80 ng/mL of nisin. 6,8,10,12) The pMSP3535/relP strain induced with 0, 10, 40, and 80 ng/mL of nisin and the addition of mupirocin

PAGE 87

87 CHAPTER 5 SUMMARY AND FUTURE DIRECTIONS Summary and Concluding Remarks The oral cavity exerts numerous envir onmental stresses on the caries causing bacterium S. mutans Physical stress provided by the tongue, saliva flow, and food stuffs, f lu ctuating nutrient availability, varying oxygen tension, and unstable pH are some of the common stresses that S. mutans must be able to withstand on a constant basis (4, 8, 21) This oral pathogen has developed effective mechanisms to overcome challenges which ultimately contribute to its virulence (8, 21, 59) One of the key response to stress is the production o f (p)ppGpp. The classical RelA dependent stringent response is triggered by a mino acid starvation. However, the presence of two additional (p)ppGpp synthetases suggest s that thi s molecular alarmone has a greater role than simply detecting nutrient availiabil ty. The proposed model based on the data presented s uggests a strong link between oxygen, acid, the global signaling molecule acetyl phosphate, and (p)ppGpp synthesis. In an anaerobic environment, actively growing, nonstressed S. mutans produces significant amounts of acid through fermentation of carbohy drates (Figure 5 1) Under these conditions, the princi pal fermentation path is the lactate dehydrogenase (LDH) dependent formation of lactate from pyruvate. The formation of lactate also acts to regenerate NAD+ which is essential for substrate level ph osphorylation through glycolysis. The acidic environment created by S. mutans ca n easily reach a pH of 4. Tooth enamel begins demineralizing at pH 5.5 and the acidogenic properties of S. mutans ultimately give way to caries formation. When grown i n aer obic environments, S. mutans shifts its metabolic processes to a heteroferment ive metabolism (Figure 5 3)

PAGE 88

88 creating a less acidic environment (2, 30) The proposed model p resented herein starts with activation of RelQ by low pH that stems from rapidly growing cells in a nutrient rich environment free from O2. Both previous data in our lab showing the expression of relQ being upr egulated in acidic condtions (Lemos, Burne, unpublished) and t he impaired growth of the support the idea of relQ playing a significant role in response to this acidic environment. Oxygen present s numerous challenges to S. mutans and as a result the bacteria are less able to tolerate environmental stresses. The role of acetyl~P as a global signal is becoming increasingly accepted as it has been shown to be regulate a multitude of various physiological processes (65, 70, 71, 75, 89, 112) Here I suggest that acetyl~P play s a key role as a global signal in response t o oxidative stress conditions. The Pta/AckA dependent acetate pathway provides the only known mechanism for S. mutans to produce acetyl~P. The formation of acetyl~P can be catalyzed by either Pta in the forward reaction, or AckA in the reverse reaction. The related species S. pneumoniae and S. sangui s have a second mechanism through the action of pyruvate oxidase that pr oduces acetyl~P. Spellerburg et al. found that a pyruvate oxidasedeficient mutant grew at rates similar to WT, but failed to grow in oxygen (97) That growth defect was restored by the AckA dependent formation of acetyl~P from exces s acetate added to the medium. Other previous work done on S. mutans show s that ackA is upregulated in the presence of oxygen, with pta interestingly unaffected (4). It has been established that this Pta/AckA pathway works efficiently in reverse in other streptococcal species (28, 29, 92, 95) Biochemical studies examining equilibrium constants for the Pta/AckA dependent reaction have shown the reaction is likely as Keq

PAGE 89

89 values of approximately 1 were calculated (39) Looking at the growth of aerobically and anaerobically in excess acetate, I suggest that the lack of growth by the is due to overaccumulation of acetyl~P by AckA and on the inability to conver t the molecule into acetyl CoA. The in aerobic conditions which suggests that the level of similar to that of the donot synthesize acetyl~P Growth rates of these mutants in excess acetate in an anaerobic environment provide additional clues to the regulation of the Pta/AckA pathway. If the forward reaction is favored under anaerobic conditions, that would explain the growth defect seen in the forward Pta dependent reaction, a mutant with a defective ackA gene would not be able to convert the acetyl~P to acetate. The limited effect on g rowth of increased acetate in an anerobic environment also supports the idea of a forward Pta/AckA pathway favored in these conditions. In a cell that utilizes this forward react ion, an abundance of acetate would have little effect on acetyl~P levels, as carbohydrate metabolism, and the for mation of acetyl CoA should be the sole determinant of acetyl~P formation. Based on this evidence, we suggest that a possible pathway for the formation of acetyl~P is the oxygen dependent reverse AckA catalyzed formation of acetyl~P from acetate. If acetyl~P as a global signal is important for growth in oxygen, but inhibits growth when oxygen levels are too high, formation of acety l~P must be tightly regulated. We suggest multiple layers of regulation and control for acetyl~P production in S. mutans. In this model, RelQ is activated by low pH produced by nonstressed anaerobically

PAGE 90

90 growing cells. The RelQ mediated ( perh aps with cooperative help from RelP) production of (p)ppGpp would inhibit PDH. This is suppor ted by microarray data showing the inhibition of the pdh genes by (p)ppGpp. Consequently PDH dependent synthesis of acetyl CoA from pyruvate would be inhibited which in turn would inhibit the formation of acetyl~P from the forward Pta reaction suggested in the anaerobic environment An added layer of control is also suggested by CAT reporter experiments that suggest s that RelQ inhibits the promoter of pta A third layer of control can be seen by the downregulation of ackA under anaerobic growth conditi ons. These seemingly redundant control mechanism s exhibited by S. mutans suggest and highlight the importance of regulating production of acetyl~P. The importance of both a forward and reverse Pta/Ac kA pa thway might be seen when examining the common mechanisms involved in aerobic and anaerobic growth conditions It is commonly known that NADH oxidases play crucial role s in oxygen removal in S. mutans (43 44) With increas ed activity of NADH oxidases under aerobic conditions, the availability of NADH is restored by shunting carbohydrate metabolism aw ay from organic acid production and into t he incomplete TCA cycle (4, 6) The importance of NADH might serve to explain the relevance of the re verse Pta/AckA pathw ay. Under aerobic conditions, elevated levels of acetate would push the equilibrium in reverse favoring the formation of additional acetyl CoA which would subsequently feed into the TCA cycle for NADH regeneration. The importance of the forward pathway c ould be highlighted under anaerobic conditions when carbohydrate availability is low. Under anaerobic conditions, when glucose levels are high, the cell s are provided with an abundant level of ATP generated through gylcolysis, and the

PAGE 91

91 activity of LDH recy cles NAD+ back into the glycolytic pathway. However in limiting carbohydrate conditions, PFL would convert the majority of available pyruvate to acetyl CoA (Figure 5 2) Low carbohydrate availability would reduce levels of ATP via the glycolytic pathway The increased acetyl CoA levels by PFL would push the Pta/AckA pathways forward, and a need for ATP would provide a possible explanation for the importance of this forward pathway, as the AckA dependent conversion of acetyl~P to acetate is a key ATP generating step. This proposed model provides some insight into the importance of tight regulatory mechanisms in response to various environmental conditions. More work is needed to validate this model and one can not ignore the strong links between aerobic/anaerobic growth, the involvement of acetyl~P, and (p)ppGpp production. Some questions remain, especially the relevance of the pseudouridine synthase, RluE. A deletion of rluE restore s aerobic growth in a pta defective mutant in plain BHI, and BHI supplemented with excess acetate. Because little is known about this RNA modification it is almost impossible to draw any conclusions regarding a direct or indirect relationship between pseudouridine, oxygen, (p)ppGpp, or acetyl~P. Another mystery is the seemingly nonessential nature of PpnK, since these NAD kinases are essential for most microorganisms Future Directions Work done regarding acetyl~P, oxidative growth conditions and (p)ppGpp could lead to a better understanding of stress regulation in S. mutans Assaying acetyl~P levels by 2D TLC could confirm the major acetyl~P pathway by either Ac kA or Pta, and identify conditions that trigger an enhanced level of acetyl~P production.

PAGE 92

92 in O2 without O2 exhibit an overaccumulation of a cetyl~P, elucidating the role of acetyl~P as a global signal in the overal l genetic regulation of S. mutans would be important to establish. Identification of environmental or internal signals that enhance or inhibit expression of rel Q should lead to a better understanding of the role of RelA, RelP, and RelQ mediated (p)ppGpp synthesis in S. mutans Repeating previous experiments that showed the importance of external acetate to acetyl CoA formation, and ultimately to various key macromolecular biosynthetic reactions (95) could shed some light to questions about cell wall synthesis, biofilm formation, and cell lysis. This study evaulated (p)ppGpp and the cellular metabolism of S. mutans Continued study of the relationships proposed here will unveil additional information about the roles of these systems in regulating both stress responses and virulence.

PAGE 93

93 Figure 51. Proposed model in nonlimiting glucose and anaerobic conditions. Activation of RelQ by low pH caused by high concentrations of lactic acid by LDH. RelQ synthesized (p)ppGpp represses PDH further, and also represses the promot er of pta The presence of anaerobic conditions also serves to repress ackA This model suggests the importance of limiting acetyl~P concentrations in nonstressed anaerobic conditions.

PAGE 94

94 Figure 52. Proposed model in limiting glucose and anaerobic conditions. Limited ATP production causes high activity by PFL, which pushes metabolism away from lactate, and towards acetyl CoA. High levels of acetyl CoA push the reaction mechanism forward to acetate to generate additional ATP by AckA.

PAGE 95

95 Figure 53. Proposed model in aerobic conditions. The presence of O2 limits activity of LDH, and shuts off transcription of PFL. AckA levels are increased in oxygen, and levels of acetate in the media drive the reaction mechanism in reverse. Acetyl~P as a global signal in response to oxygen. High levels of acetyl CoA is generated to restore NADH levels by shuttling acetyl CoA into the incomplete TCA cycle.

PAGE 96

96 LIST OF REFERENCES 1. Abranches, J., A. R. Martinez, J. K. Kajfasz, V. Chavez, D. A. Gars in, and J. A. Lemos. 2009. The molecular alarmone (p)ppGpp mediates stress responses, vancomycin tolerance, and v irulence in Enterococcus faecalis J. Bacteriol. 191: 22482256. 2. Ahn, S. J., S. J. Ahn, C. M. Browngardt, and R. A. Burne. 2009. Changes in biochemical and phenotypic properties of Streptococcus mutans during growth with a eration. Appl Environ Microb 75: 2517 2527. 3. Ahn, S. J., and R. A. Burne. 2007. Effects of oxygen on biofilm formation and the AtlA autolysin of Streptococcus mutans J. Ba cteriol. 189: 62936302. 4. Ahn, S. J., Z. T. Wen, and R. A. Burne. 2007. Effects of oxygen on virulence traits of Streptococcus mutans J. Bacteriol. 189: 85198527. 5. Ahn, S. J., Z. Z. T. Wen, and R. A. Burne. 2006. Multilevel control of competence development and stress tolerance in Streptococcus mutans UA159. Infect. Immun. 74: 1631 1642. 6. Ajdic, D., W. M. McShan, R. E. McLaughlin, G. Savic, J. Chang, M. B. Carson, C. Primeaux, R. Y. Tian, S. Kenton, H. G. Jia, S. P. Lin, Y. D. Qian, S. L. Li, H. Zhu, F. Najar, H. S. Lai, J. White, B. A. Roe, and J. J. Ferretti. 2002. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc. Natl. Acad. Sci. U. S. A. 99: 1443414439. 7. Alamos, L. 20 10, posting date. Oralgen Databases. [Online.] 8. Banas, J. A. 2004. Virulence properties of Streptococcus mutans Front. Biosci. 9: 1267 77. 9. Baracchini, E., and H. Bremer. 1988. Stringent and growth control of ribosomal RNA synthesis in Escherichia co l i are both m ediated by ppG pp. J. Biol. Chem. 263: 25972602. 10. Barker, M. M., T. Gaal, C. A. Josaitis, and R. L. Gourse. 2001. Mechanism of regulation of trans cription initiation by ppGpp. Effects of ppGpp on transcription initiation in vivo and in vit ro. J. Mol. Biol. 305: 673688. 11. Baron, S. 1996. Medical microbiology, 4th ed. University of Texas Medical Branch at Galveston, Galveston, Tex. 12. Battesti, A., and E. Bouveret. 2006. Acyl carrier protein/SpoT interaction, the switch linking SpoT dependent stress response to fatty acid metabolism. Mol. Microbiol. 62: 10481063.

PAGE 97

97 13. Begley, T. P., C. Kinsland, R. A. Mehl, A. Osterman, and P. Dorrestein. 2001. The biosynthesis of ni cotinamide adenine dinucleot ides in bacteria. Vitamins and H ormones Advances in Research and Applications, Vol 61 61: 103119. 14. Belli, W. A., D. H. Buckley, and R. E. Marquis. 1995. Weak acid effects and fluoride inhibition of g lycolysis by Streptococ cus m utans Gs 5. Can. J. Microbiol. 41: 785 791. 15. Bender, G. R., S. V. W. Sutton, and R. E. Marquis. 1986. Acid tolerance, proton permeabilities, and membrane ATPases of oral s treptococci. Infect. Immun. 53: 331338. 16. Boucher, P. E., F. D. Menozzi, a nd C. Locht. 1994. The modular architecture of bacterial response r egulators Insights int o the activation mechanism of the BvgA t ransactivator of Bordetella p ertussis. J. Mol. Biol. 241: 363 377. 17. Bougdour, A., and S. Gottesman. 2007. ppG pp regulation of RpoS degradation via anti adaptor protein IraP. Proc. Natl. Acad. Sci. U. S. A. 104: 12896 901. 18. Bowen, W. H., K. Schilling, E. Giertsen, S. Pearson, S. F. Lee, A. Bleiweis, and D. Beeman. 1991. Role of a cell surfaceassociated protein in adherence and dental caries. Infect. Immun. 59: 46064609. 19. Brown, T. A., S. J. Ahn, R. N. Frank, Y. Y. M. Chen, J. A. Lemos, and R. A. Burne. 2005. A hypothetical protein of Streptococcus mutans is critical for biofilm formation. Infect. Immun. 73: 31473151. 20. Brown, T. D. K., M. C. Jonesmortimer, and H. L. Kornberg. 1977. Enzymic i nterconversion of acetate and acetyl coenzymeA in Escherichia coli. J. Gen. Microbiol. 102: 327336. 21. Burne, R. A. 1998. Oral streptococci ... products of their environment. J Dent. Res. 77: 445 452. 22. Burne, R. A., Y. Y. M. Chen, D. L. Wexler, H. Kuramitsu, and W. H. Bowen. 1996. Cariogenicity of Streptococcus mutans strains with defects in fructan m etabolism assessed in a program fed specific pathogenree rat model. J. Dent. Res. 75: 1572 1577. 23. Carlsson, J., U. Kujala, and M. B. K. Edlund. 1985. Pyruvatedehydrogenase a ctivity in Streptococcus m utans Infect. Immun. 49: 674678. 24. Cate, J. H., M. M. Yusupov, G. Z. Yusupova, T. N. Earnest, and H. F. Noller. 1999. X ra y crystal structures of 70S ribosome functional complexes. Science 285: 20952104.

PAGE 98

98 25. Charette, M., and M. W. Gray. 2000. Pseudouridine in RNA: w hat, where, how, and why. Iubmb Life 49: 341 351. 26. Chen, Y. Y. M., and R. A. Burne. 1996. Analysis of Strept ococcus salivarius urease expression using continuous chemostat culture. FEMS Microbiol. Lett. 135: 223 229. 27. Chinali, G., J. Horowitz, and J. Ofengand. 1978. Replacement of p seu douridine in transfer RNA by 5 fluoridine does not affect ability to stimulate synthesis of guanosine 5' triphosphate 3' d iphosphate. Biochemistry (Mosc). 17: 27552760. 28. Collins, E. B., and J. C. Bruhn. 1970. Roles of acetate and pyruvate in m etabolism of Streptococcus diacetilactis J. Bacteriol. 103: 541&. 29. Collin s, E. B., F. E. Nelson, and C. E. Parmelee. 1950. Acetate and oleate requirements of the lactic group of s treptococci. J. Bacteriol. 59: 6974. 30. Dashper, S. G., and E. C. Reynolds. 1996. Lactic acid excretion by Streptococcus mutans Microbiology Uk 142: 3339. 31. Davis, D. R. 1995. Stabilization of RNA stacking by pseudouridine. J. Cell. Biochem. : 56 56. 32. Deretic, V., J. H. J. Leveau, C. D. Mohr, and N. S. Hibler. 1992. Invitro p hosphorylation of AlgR, a regulator of m ucoidy in Pseudomonas a eruginos a by a histidine proteinkinase and effects of small phosphodonor m olecules. Mol. Microbiol. 6: 27612767. 33. Durairaj, A., and P. A. Limbach. 2008. Mass spectrometry of the fifth nucleoside: A review of the identification of pseudouridine in nucleic aci ds. Anal. Chim. Acta 623: 117 125. 34. Feng, J. L., M. R. Atkinson, W. Mccleary, J. B. Stock, B. L. Wanner, and A. J. Ninfa. 1992. Role of phosphorylated metabolic intermediates in the r e gulation of glutaminesynthetase s ynthesis in Escherichia coli. J. Ba cteriol. 174: 60616070. 35. Forst, S., J. Delgado, A. Rampersaud, and M. Inouye. 1990. In vivo phosphorylation of OmpR, the rranscription activator of the OmpF and OmpC g enes in Escherich ia c oli. J. Bacteriol. 172: 3473 3477. 36. Garavaglia, S., A. Galizzi, and M. Rizzi. 2003. Allosteric regulation of Bacillus subtilis NAD kinase by quinolinic acid. J. Bacteriol. 185: 48444850.

PAGE 99

99 37. Gibbons, R. J., and J. Vanhoute. 1973. Formation of d ental p laques. J. Periodontol. 44: 347 360. 38. Grose, J. H., L. J oss, S. F. Velick, and J. R. Roth. 2006. Evidence that feedback inhibition of NAD kinase controls responses to oxidative stress. Proc. Natl. Acad. Sci. U. S. A. 103: 76017606. 39. Guynn, R. W., and R. L. Veech. 1973. Equilibrium constants of adenosinetri phosphate hydrolysis and adenosine triphosphatecitrate lyase r eactions. J. Biol. Chem. 248: 69666972. 40. Hamilton, I. R., and N. D. Buckley. 1991. Adaptation by Streptococcus m utans to acid t olerance. Oral Microbiol. Immunol. 6: 6571. 41. Haseltin.Wa, and R. Block. 1973. Synthesis of guanosine tetraphosphate and pentaphosphate requires presence of a codonspecific, uncharged transfer ribonucleic acid in acceptor site of r ibosomes. Proc. Natl. Acad. Sci. U. S. A. 70: 15641568. 42. Hata, S., and H. Mayan agi. 2003. Acid diffusion through extracellular polysaccharides produced by various mutants of Streptococcus mutans Arch. Oral Biol. 48: 431 438. 43. Higuchi, M., M. Shimada, Y. Yamamoto, T. Hayashi, T. Koga, and Y. Kamio. 1993. Identification of 2 distinct NADH oxidases c orresponding to H2O2forming o xidase and H2O forming oxidase i nduced in Streptococcus m utans J. Gen. Microbiol. 139: 23432351. 44. Higuchi, M., Y. Yamamoto, L. B. Poole, M. Shimada, Y. Sato, N. Takahashi, and Y. Kamio. 1999. Functions of two types of NADH oxidases in energy metabolism and oxidative stress of Streptococcus mutans J. Bacteriol. 181: 59405947. 45. Hogg, T., U. Mechold, H. Malke, M. Cashel, and R. Hilgenfeld. 2004. Conformational antagonism between opposing active sites in a bifunctional Re1A/SpoT homolog modulates (p)ppGpp metabolism during the stringent response. Cell 117: 57 68. 46. Hutchison, C. A., S. N. Peterson, S. R. Gill, R. T. Cline, O. White, C. M. Fraser, H. O. Smith, and J. C. V enter. 1999. Global transposon mutagenesis and a minimal mycoplasma genome. Science 286: 21652169. 47. Kakuda, H., K. Hosono, K. Shiroishi, and S. Ichihara. 1994. Identification and characterization of the AckA (acetate k inase A) Pta (p hosphotransacetylase) operon and complementation analysis of acetate utilization by an AckA Pta

PAGE 100

100 Deletion Mutant of Escherichia c oli. J. Biochem. (Tokyo). 116: 916 922. 48. Kari, C., I. Torok, and A. Travers. 1977. ppGpp c ycle in Escherichia c oli. Mol. Gen. Genet. 150: 249255. 49. Kawai, S., S. Mori, T. Mukai, W. Hashimoto, and K. Murata. 2001. Molecular characterization of E scherichia col i NAD kinase. Eur. J. Biochem. 268: 43594365. 50. Kawai, S., S. Mori, T. Mukai, S. Suzuki, T. Yamada, W. Has himoto, and K. Murata. 2000. Inorganic polyphosphate/ATP NAD kinase of Micrococcus flavus and Mycobacterium tuberculosis H37Rv. Biochem. Biophys. Res. Commun. 276: 57 63. 51. Kazmierczak, K. M., K. J. Wayne, A. Rechtsteiner, and M. E. Winkler. 2009. Roles of rel(Spn) in stringent response, global regulation and virulence of serotype 2 Streptococcus pneumoniae D39. Mol. Microbiol. 72: 590 611. 52. Kirkpatrick, C., L. M. Maurer, N. E. Oyelakin, Y. N. Yoncheva, R. Maurer, and J. L. Slonczewski. 2001. Acetate and formate stress: Opposite responses in the proteome of Escherichia coli. J. Bacteriol. 183: 64666477. 53. Kolenbrander, P. E. 2000. Oral microbial communities: Biofilms, interactions, and genetic systems. Annu. Rev. Microbiol. 54: 413 437. 54. Kornberg, A., N. N. Rao, and D. Ault Riche. 1999. Inorganic polyphosphate: A molecule of many functions. Annu. Rev. Biochem. 68: 89125. 55. Krasny, L., and R. L. Gourse. 2004. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcr iption regulation. EMBO J. 23: 44734483. 56. Kumari, S., R. Tishel, M. Eisenbach, and A. J. Wolfe. 1995. Cloning, characterization, and functional expression of Acs, the gene which encodes acetyl coenzymeA s ynthetase in Escherichia c oli. J. Bacteriol. 177: 28782886. 57. Lange, R., D. Fischer, and R. Henggearonis. 1995. Ide ntification of Transcriptional start sites and the role of ppGpp in the expression of RpoS, the structural gene for the sigma(S) subunit of RNA p olymerase in EscherichiaColi. J. Bact eriol. 177: 46764680. 58. Lee, S. F., A. Progulskefox, G. W. Erdos, D. A. Piacentini, G. Y. Ayakawa, P. J. Crowley, and A. S. Bleiweis. 1989. Construction and characterization of isogenic m utants of Streptococcus m utans deficient in major surface protein a ntigenP1 (I/Ii). Infect. Immun. 57: 33063313.

PAGE 101

101 59. Lemos, J. A., and R. A. Burne. 2008. A model of efficiency: stress tolerance by Streptococcus mutans Microbiology Sgm 154: 32473255. 60. Lemos, J. A., V. K. Lin, M. M. Nascimento, J. Abranches, and R. A. Burne. 2007. Three gene products govern (p)ppGpp production by Streptococcus mutans. Mol. Microbiol. 65: 15681581. 61. Lemos, J. A. C., T. A. Brown, and R. A. Burne. 2004. Effects of RelA on key virulence properties of planktonic and biofilm populations of Streptococcus mutans. I nfect. Immun. 72: 14311440. 62. Lerner, F., M. Niere, A. Ludwig, and M. Ziegler. 2001. Structural and functional characterization of human NAD kinase. Biochem. Biophys. Res. Commun. 288: 69 74. 63. Li, J., S. Kustu, and V. Stew art. 1994. InVitro Interaction of nitrateresponsive regulatory protein NarL with DNA target sequences in the FdnG, NarG, NarK and Frd A operon control r egions of Escherichi c oli K 12. J. Mol. Biol. 241: 150 165. 64. Lie, T. 1977. Early dental plaque m orphogenesis scanning electron microscope study using hydroxyapatite splint model and a low sucrose d iet. J. Periodontal Res. 12: 73 89. 65. Lukat, G. S., W. R. Mccleary, A. M. Stock, and J. B. Stock. 1992. Phosphorylation of bacterial response regulator p rot eins by low molecular weight phosphod onors. Proc. Natl. Acad. Sci. U. S. A. 89: 718722. 66. Ma, J. K. C., C. G. Kelly, G. Munro, R. A. Whiley, and T. Lehner. 1991. Conservation of the gene encoding streptococcal antigenI/II in oral s treptococci. In fect. Immun. 59: 2686 2694. 67. Magnusson, L. U., A. Farewell, and T. Nystrom. 2005. ppGpp: a global regulator in Escherichia coli. Trends Microbiol. 13: 236 242. 68. Magnusson, L. U., B. Gummesson, P. Joksimovic, A. Farewell, and T. Nystrom. 2007. Identic al, independent, and opposing roles of ppGpp and DksA in Escherichia coli J. Bacteriol. 189: 51935202. 69. Marquis, R. E. 1995. Oxygen metabolism, oxidative stress and acidbase physiology of dental plaque biofilms. J. Ind. Microbiol. 15: 198 207. 70. Mc cleary, W. R., and J. B. Stock. 1994. Acetyl phosphate and the activation of 2 component response r egulators. J. Biol. Chem. 269: 3156731572.

PAGE 102

102 71. Mccleary, W. R., J. B. Stock, and A. J. Ninfa. 1993. Is acetyl phosphate a global s ignal in Escherichia coli. J. Bacteriol. 175: 27932798. 72. McNeill, K., and I. R. Hamilton. 2003. Acid tolerance response of biofilm cells of Streptococcus mutans FEMS Microbiol. Lett. 221: 25 30. 73. Mechold, U., H. Murphy, L. Brown, and M. Cashel. 2002. Intramolecular regulation of the opposing (p)ppGpp catalytic activities of Rel(Seq), the Rel/Spo enzyme from Streptococcus equisimilis. J. Bacteriol. 184: 28782888. 74. Meroueh, M., P. J. Grohar, J. Qiu, J. SantaLucia, S. A. Scaringe, and C. S. Cho w. 2000. Unique structural and stabilizing roles for the individual pseudouridine residues in the 1920 region of Escherichia coli 23S rRNA. Nucleic Acids Res. 28: 20752083. 75. Mizrahi, I., D. Biran, and E. Z. Ron. 2006. Requirement for the acetyl phosphate pathway in Escherichia coli ATP dependent proteolysis. Mol. Microbiol. 62: 201 211. 76. Munro, C., S. M. Michalek, and F. L. Macrina. 1991. Cariogenicity of Streptococcus m utans V403 glucosyltransferase and fruct osyltransferase mutants constructed by allelic exchange. Infect. Immun. 59: 23162323. 77. Nanamiya, H., K. Kasai, A. Nozawa, C. S. Yun, T. Narisawa, K. Murakami, Y. Natori, F. Kawamura, and Y. Tozawa. 2008. Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis Mol. Microbiol. 67: 291 304. 78. Nascimento, M. M., J. A. Lemos, J. Abranches, V. K. Lin, and R. A. Burne. 2008. Role of RelA of Streptococcus mutans in global control of gene expression. J. Bacteriol. 190: 2836. 79. Negre, D., J. C. Cortay, P. Donini, and A. J. Cozzone. 1989. Relat ionship between guanosine tetraphosphate and accuracy of t ranslation in Salmonella t yphimurium. Biochemistry (Mosc). 28: 18141819. 80. Nierlich, D. P. 1978. Regulation of bacterial growth, RNA, and proteinsynthesis. Annu. Rev. Microbiol. 32: 393 342. 81. Nystrom, T. 1994. The glucosestarvation s timulon of Escherichia c oli induced and repressed synthesis of enzymes of central metabolic pathways and r ole of acetyl phosphate in geneexpression and starvation s urvival. Mol. Microbiol. 12: 833 843. 82. Ofengand, J., M. Del Campo, and Y. Kaya. 2001. Mapping pseudouridines in RNA molecules. Methods 25: 365 373.

PAGE 103

103 83. Ohta, H., H. Kato, N. Okahashi, I. Takahash i, S. Hamada, and T. Koga. 1989. Characterization of a cell surface protein antigen of hydrophilic Strept ococcus m utans Strain Gs 5. J. Gen. Microbiol. 135: 981 988. 84. Oxford, A. E. 1958. The nutritional requirements of rumen s trains of Streptococcus bov is considered in relation to dextran synthesis from s ucrose. J. Gen. Microbiol. 19: 617 623. 85. Paul, B. J., M. M. Barker, W. Ross, D. A. Schneider, C. Webb, J. W. Foster, and R. L. Gourse. 2004. DksA: A critical component of the transcription initiation machinery that potentiates the regulation of rRNA promoters by ppGpp and the initiating NTP. Cell 118: 311 322. 86. Paul, B. J., M. B. Berkmen, and R. L. Gourse. 2005. DksA potentiates direct activation of amino acid promoters by ppGpp. Proc. Natl. Acad. S ci. U. S. A. 102: 78237828. 87. Perederina, A., V. Svetlov, M. N. Vassylyeva, T. H. Tahirov, S. Yokoyama, I. Artsimovitch, and D. G. Vassylyev. 2004. Regulation through the secondary channel structural framework for ppGppDksA synergism during transcripti on. Cell 118: 297 309. 88. Potrykus, K., and M. Cashel. 2008. (p)ppGpp: still m agical? Annu. Rev. Microbiol. 62: 35 51. 89. Pruss, B. M., and A. J. Wolfe. 1994. Regulation of acetyl phosphate synthesis and degradation, and the control of flagellar e xpression in Escherichia coli. Mol. Microbiol. 12: 973 984. 90. Roggiani, M., and D. Dubnau. 1993. ComA, a p hosp horylated response regulator protein of Bacillus s ubtilis binds to the promoter region of SrfA J. Bacteriol. 175: 31823187. 91. Schroder, I., C. D. Wolin, R. Cavicchioli, and R. P. Gunsalus. 1994. Phosphorylation and dephosphorylation of the NarQ, NarX and NarL proteins of the nitratedependent 2component regulatory s ystem of Escherichia coli. J. Bacteriol. 176: 49854992. 92. Shockman, G. D. 1956. The Acetate r equirement of Streptococcus f aecalis J Bacteriol 72: 101 104. 93. Shubeita, H. E., J. F. Sambrook, and A. M. McCormick. 1987. Molecular cloning and analysis of functional cDNA and genomic clones encoding bovine cellular retinoic acidb inding protein. Proc. Natl. Acad. Sci. U. S. A. 84: 5645 9. 94. Softberry posting date. Softberry BPROM. [Online.]

PAGE 104

104 95. Speckman, R. A., and E. B. Collins. 1973. Incorporation of radioactive acetate into diacetyl by S treptococcus d iacetilactis Appl. Mic robiol. 26: 744 746. 96. Spedaliere, C. J., J. M. Ginter, M. V. Johnston, and E. G. Mueller. 2004. The pseudouridine synthases: Revisiting a mechanism that seemed settled. J. Am. Chem. Soc. 126: 12758 12759. 97. Spellerberg, B., D. R. Cundell, J. Sandros, B. J. Pearce, I. IdanpaanHeikkila, C. Rosenow, and H. R. Masure. 1996. Pyruvate oxidase, as a determinant of virulence in Streptococcus pneumoniae. Mol. Microbiol. 19: 803 813. 98. Srivatsan, A., and J. D. Wang. 2008. Control of bacterial transcription, tr anslation and replication by (p)ppGpp. Curr. Opin. Microbiol. 11: 100 105. 99. Starai, V. J., and J. C. EscalanteSemerena. 2004. Acetyl coenzyme A synthetase (AMP forming). Cell. Mol. Life Sci. 61: 20202030. 100. Svensater, G., B. Sjogreen, and I. R. Ham ilton. 2000. Multiple stress responses in Streptococcus mutans and the induction of general and stress specific proteins. Microbiology Uk 146: 107 117. 101. Svitil, A. L., M. Cashel, and J. W. Zyskind. 1993. Guanosine tetraphosphate inhibits proteinsynthesis invivo a possible protective mechanism for starvation stress in Escherichia c oli. J. Biol. Chem. 268: 23072311. 102. Szalewska Palasz, A., G. Wqgrzyn, and A. Wegrzyn. 2007. Mechanisms of physiological regulation of RNA synthesis in bacteria: new dis coveries breaking old schemes. Journal of Applied Genetics 48: 281 294. 103. Takahashi, S., K. Abbe, and T. Yamada. 1982. Purification of pyruvate formatel yase from Streptococcus m utans and its regulatory properties. J. Bacteriol. 149: 10341040. 104. Tanzer, J. M., M. L. Freedman, Fitzgera.Rj, and R. H. Larson. 1974. Diminished virulence of glucan synthesis d efect ive m utants of Streptococcus m utans. Infect. Immun. 10: 197 203. 105. Terleckyj, B., N. P. Willett, and G. D. Shockman. 1975. Growth of sever al cariogenic strains of oral streptococci in a chemically defined m edium. Infect. Immun. 11: 649655. 106. Toulokhonov, I. I., I. Shulgina, and V. J. Hernandez. 2001. Binding of the transcription effector ppGpp to Escherichia coli RNA polymerase is allosteric, modular, and occurs near the N terminus of the betasubunit. J. Biol. Chem. 276: 12201225.

PAGE 105

105 107. Urbonavicius, J., J. M. B. Durand, and G. R. Bjork. 2002. Three modifications in the D and T arms of tRNA influence translation i n Escherichia coli and expression of virulence genes in Shigella flexneri. J. Bacteriol. 184: 53485357. 108. Wanner, B. L. 1993. Gener eg ulation by phosphate in enteric bacteria. J. Cell. Biochem. 51: 47 54. 109. Wen, Z. T., and R. A. Burne. 2003. LuxS me diated signaling regulates acid and oxidative stress tolerance and biofilm formation in Streptococcus mutans J. Dent. Res. 82: B358 B358. 110. Wen, Z. Z. T., D. Yates, S. J. Ahn, and R. A. Burne. 2010. Biofilm formation and virulence expression by Strepto coccus mutans are altered when grown in dual species model. Bmc Microbiology 10: 111. Whittaker, C. J., C. M. Klier, and P. E. Kolenbrander. 1996. Mechanisms of adhesion by oral bacteria. Annu. Rev. Microbiol. 50: 513 552. 112. Wolfe, A. J. 2005. The ac etate switch. Microbiol. Mol. Biol. Rev. 69: 12+. 113. Wright, P. M., J. A. Yu, J. Cillo, and A. L. Lu. 1999. The active site of the Escherichia coli MutY DNA adenine glycosylase. J. Biol. Chem. 274: 29011 29018. 114. Wu, J., and J. P. Xie. 2009. Magic s p ot: (p) ppGpp. J. Cell. Physiol. 220: 297 302. 115. Yamashita, Y., W. H. Bowen, R. A. Burne, and H. K. Kuramitsu. 1993. Role of the Strept ococcus mutans gtf genes in caries induction in the specific pathogen free rat m odel. Infect. Immun. 61: 3811 3817. 116. Yan, X., C. Zhao, A. BudinVerneuil, A. Hartke, A. Rince, M. S. Gilmore, Y. Auffray, and V. Pichereau. 2009. The (p)ppGpp synthetase RelA contributes to stress adaptation and virulence in Enterococcus faecalis V583. Microbiology Sgm 155: 32263237. 117. Yin, J. L., N. A. Shackel, A. Zekry, P. H. McGuinness, C. Richards, K. V. Putten, G. W. McCaughan, J. M. Eris, and G. A. Bishop. 2001. Real time reverse transcriptasepolymerase chain reaction (RT PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I. Immunol. Cell Biol. 79: 21321. 118. Yoshida, A., and H. K. Kuramitsu. 2002. Multiple Streptococcus mutans genes are involved in biofilm formation. Appl. Environ. Microbiol. 68: 62836291.

PAGE 106

106 119. Zeng, L., Z. Z. T. Wen, and R. A. Burne. 2006. A novel signal transduction system and feedback loop regulate fructan hydrolase gene expression in Streptococcus mutans Mol. Microbiol. 62: 187 200. 120. Ziegler, M. 2000. New functions of a long known molecule Emerg ing roles of NAD in cellular signaling. Eur. J. Biochem. 267: 15501564.

PAGE 107

107 BIOGRAPHICAL SKETCH Steven Garrett was born in Daejeon, South Korea in 1981. He moved to the United States in 1986 with his parents Jong Suk and William Garrett. After graduating from Rutherford High School as a National Merit Scholar and IB Diploma recipient in 1998, he briefly attended the University of Florida before pursuing a career in music. After six years in the music industr y, Garrett reenrolled at UF in 2006 in hopes of attending dental school. In 2008 he was awarded a Bachelor of Science in microbiology and cell c cience. As a graduate student at UFs College of Medicine, Garrett worked under the supervision of Robert A. B urne for two years while completing his m asters thesis. Garrett has been able to present his work in a poster session at the 2010 ASM General Meeting. After graduation, he will be awarded his Master of Science in medical sciences, and further his educat ion towards a D MD at the University of Florida. Garrett recently got married to in July 2010 to Kathleen Rouisse