<%BANNER%>

Corticosterone Induced Morphological Changes of Hippocampal and Amygdaloid Cell Lines Are Dependent on 5-Ht7 Receptor Re...

Permanent Link: http://ufdc.ufl.edu/UFE0042195/00001

Material Information

Title: Corticosterone Induced Morphological Changes of Hippocampal and Amygdaloid Cell Lines Are Dependent on 5-Ht7 Receptor Related Signal Pathway
Physical Description: 1 online resource (62 p.)
Language: english
Creator: Zhang, Chong
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: agonist, amygdala, antagonist, hippocampus, serotonin, stress
Biomedical Engineering -- Dissertations, Academic -- UF
Genre: Biomedical Engineering thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Stress is an unavoidable life experience that can disturb emotional and cognitive processes, and neuroplasticity. This study observed two aspects of how stress hormone affects the hippocampus and amygdala. Firstly, we investigated whether administration of corticosterone to hippocampal and amygdaloid cell lines induced different changes in 5-HT sub-receptors. Secondly, we tested whether stress induced morphological changes in these two cell lines are involved in the 5-HT sub-receptors expression. We now show, using HT-22 and AR-5 cell lines, that 5-HT7 receptor mRNA is significantly up-regulated in HT-22 cells, but down-regulated in AR-5 cells by exposure to stress level of corticosterone (50 ?M) for 24h. Pretreatment of cells with 5-HT7 antagonist SB-269970 and agonist LP-44 reversed corticosterone induced cell lesion in a dose-dependent manner in HT-22 and AR-5 cells, respectively. Moreover, corticosterone induced different changes of dendritic length in HT-22 and AR-5 cells were also reversed by pretreatment with SB-269970 and LP-44. These results support the hypothesis that serotonin may differentially modulate neuronal morphology in hippocampus and amygdala depending on the expression levels of the 5-HT sub-receptors during stress hormone attacks.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Chong Zhang.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Ogle, William.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042195:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042195/00001

Material Information

Title: Corticosterone Induced Morphological Changes of Hippocampal and Amygdaloid Cell Lines Are Dependent on 5-Ht7 Receptor Related Signal Pathway
Physical Description: 1 online resource (62 p.)
Language: english
Creator: Zhang, Chong
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: agonist, amygdala, antagonist, hippocampus, serotonin, stress
Biomedical Engineering -- Dissertations, Academic -- UF
Genre: Biomedical Engineering thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Stress is an unavoidable life experience that can disturb emotional and cognitive processes, and neuroplasticity. This study observed two aspects of how stress hormone affects the hippocampus and amygdala. Firstly, we investigated whether administration of corticosterone to hippocampal and amygdaloid cell lines induced different changes in 5-HT sub-receptors. Secondly, we tested whether stress induced morphological changes in these two cell lines are involved in the 5-HT sub-receptors expression. We now show, using HT-22 and AR-5 cell lines, that 5-HT7 receptor mRNA is significantly up-regulated in HT-22 cells, but down-regulated in AR-5 cells by exposure to stress level of corticosterone (50 ?M) for 24h. Pretreatment of cells with 5-HT7 antagonist SB-269970 and agonist LP-44 reversed corticosterone induced cell lesion in a dose-dependent manner in HT-22 and AR-5 cells, respectively. Moreover, corticosterone induced different changes of dendritic length in HT-22 and AR-5 cells were also reversed by pretreatment with SB-269970 and LP-44. These results support the hypothesis that serotonin may differentially modulate neuronal morphology in hippocampus and amygdala depending on the expression levels of the 5-HT sub-receptors during stress hormone attacks.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Chong Zhang.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Ogle, William.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042195:00001


This item has the following downloads:


Full Text





CORTICOSTERONE INDUCED MORPHOLOGICAL CHANGES OF HIPPOCAMPAL
AND AMYGDALOID CELL LINES ARE DEPENDENT ON 5-HT7 RECEPTOR
RELATED SIGNAL PATHWAY


















By

CHONG ZHANG


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2010
































2010 Chong Zhang

































To my Mom and Dad









ACKNOWLEDGMENTS

This project was accomplished within the range of one year, and my advisor Dr.

William Ogle has been providing me with all support and guidance that could never be

replaced. Also I am deeply impressed by his profound academic knowledge and original

understanding of high quality research, which has been and will always be positively

impacting my further study and occupational life.

I sincerely thank Dr. Ying Xu for bring me into the field of exploiting great interest

while conducting steadfast research, as well as her brilliant ideas and problem solving

techniques. I would like to thank all my labmates in Gene Dynamics Lab, Shan, Phil,

Matt, Erin, Raj and Ling, for their kind assistance throughout the entire project.









TABLE OF CONTENTS

page

A C K N O W LE D G M E N T S .................................................................................. ......

LIST O F TA B LES ...................................................................................... 7

LIS T O F F IG U R E S .................................................................. 8

A B S T R A C T ...................................................................................... 9

CHAPTER

1 IN T R O D U C T IO N .................................... .................................................................... 1 1

2 MATERIALS AND METHODS ............................................................. ........ 13

2 .1 M a te ria ls ................................................... 1 3
2 .2 C e ll C u ltu re ...................................................... 13
2 .3 D rug T re a tm e nt .................................................................................. ...... ...... 14
2 .4 C e ll V ability .............................................................. ... ....................... ............... 14
2.5 mRNA Extraction and Real-time Reverse Transcriptase (RT)-PCR .............. 14
2.6 Image Collection and Data Analysis ....................................................... 15
2.7 Statistical A analysis ........................ ...................... .. ............................. 16

3 R E S U L T S .......... .............. ....... .......... ....... .............................................. 1 7

3.1 Corticosterone Impairs Hippocampal and Amygdaloid Primary Cultures in a
Dose- and Time- Dependent Manner..................................................... 17
3.2 The Influence of Corticosterone on 5-HT Receptors mRNA Expression in
Primary Hippocampal and Amygdaloid Cultures .......................................... 17
3.3 Protective Effects of SB-269970 and LP-44 on HT-22 Cells and AR-5 Cells
Respectively From the Lesion Induced by Corticosterone ........................... 17
3.4 SB-26970 and LP-44 Modulation of Cell Morphology Against Corticosterone
T oxicity ................. ......... ....................... ............................................ 18
3.5 SB-269970 and LP-44 Regulate Rho Family mRNA Changes Induced by
Corticosterone in HT-22 Cells and AR-5 Cells ........................... ...... ......... 18
3.6 The Effect of SB-269970 and LP-44 on Synaptic Markers mRNA Expression
in Corticosterone-Treated HT-22 and AR-5 Cells..................................... 19

4 DISCUSSION ............. ..... ...................... 30

5 LITERATURE REVIEW: THE ROLE OF 5-HT SYSTEM IN STRESS AND
DEPRESSION ................ ......... ........ ...... ............... 36

5 .1 Introductio n ....................................................... 36
5.2 The 5-HT System ...... ....................................................... ............... 37









5.3 5-HT1 Receptors .................................. ................... 40
5.3.1 5-HT1A Receptor .................................................................................. 40
5.3.2 5-HT1B Receptor .................................................................................. 41
5.4 5-HT2 Receptors .................................. ................... 42
5.4.1 5-HT2A Receptor ........................................................ 42
5.4.2 5-HT2c Receptor................................................ .................... 43
5.5 5-HT4 Receptors .................................. ................... 43
5.6 5-HT6 Receptors .................................. ................... 44
5.7 5-HT7 Receptors .................................... ............... ..... .................... 45
5.8 5-HT Receptor Agonist and Antagonist.............................. ............... 46
5.9 Signal Transduction in 5-HT Receptor System ................ ............. ............ 47
5.10 Future D irections.............................. ............... 48

LIST OF REFERENCES ................................. .................... 51

BIOGRAPHICAL SKETCH ...................... .................. .... .............................. 62



































6









LIST OF TABLES


Table page

3-1 Corticosterone induced 5-HT receptors mRNA expression in rat hippocampal
and amygdaloid neruons by real-time PCR................................... ............... 21

5-1 5-HT subreceptors agonist and antagonist......................... ............... 50









LIST OF FIGURES

Figures page

3-1 CORT impairs cell viability of primary cell cultures in a concentration- and
time- dependent manner .................................................. ............... 22

3-2 CORT impairment of HT-22 cultures cell viability and the effect of SB-269970.. 23

3-3 CORT impairment of AR-5 cultures cell viability and the effect of LP-44............ 23

3-4 HT-22 cell morphological changes. .............................. .............. 24

3-5 AR-5 cell morphological changes......................................... ............... 25

3-6 Effect of SB-269970 on Rho family small GTPase mRNA expression in HT-
22 cells ............... ..... .. .......... ........ .. ............. ........... 26

3-7 Effect of LP-44 on Rho family small GTPase mRNA expression in AR-5 cells... 27

3-8 Effect of SB-269970 on synaptic protein mRNA expression in HT-22 cells........ 28

3-9 Effect of LP-44 on synaptic protein mRNA expression in AR-5 cells ................ 29









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

CORTICOSTERONE INDUCED MORPHOLOGICAL CHANGES OF HIPPOCAMPAL
AND AMYGDALOID CELL LINES ARE DEPENDENT ON 5-HT7 RECEPTOR
RELATED SIGNAL PATHWAY

By

Chong Zhang

August 2010

Chair: William Ogle
Major: Biomedical Engineering

Stress is an unavoidable life experience that can disturb emotional and cognitive

processes, and neuroplasticity. This study observed two aspects of how stress hormone

affects the hippocampus and amygdala. Firstly, we investigated whether administration

of corticosterone to hippocampal and amygdaloid cell lines induced different changes in

5-HT sub-receptors. Secondly, we tested whether stress induced morphological

changes in these two cell lines are involved in the 5-HT sub-receptors expression. We

now show, using HT-22 and AR-5 cell lines, that 5-HT7 receptor mRNA is significantly

up-regulated in HT-22 cells, but down-regulated in AR-5 cells by exposure to stress

level of corticosterone (50 pM) for 24h. Pretreatment of cells with 5-HT7 antagonist SB-

269970 and agonist LP-44 reversed corticosterone induced cell lesion in a dose-

dependent manner in HT-22 and AR-5 cells, respectively. Moreover, corticosterone

induced different changes of dendritic length in HT-22 and AR-5 cells were also

reversed by pretreatment with SB-269970 and LP-44. These results support the

hypothesis that serotonin may differentially modulate neuronal morphology in









hippocampus and amygdala depending on the expression levels of the 5-HT sub-

receptors during stress hormone attacks.









CHAPTER 1
INTRODUCTION

Stress may be described as any environmental change, either internal or external,

that disturbs the maintenance on homeostasis (Leonard, 2005). The stress response is

to maintain homeostasis, which includes a series of physiological reactions such as

modulation of neuroplasticity (limbic system), endocrine activation (especially of the

hypothalamic-pituitary-adrenal axis, HPA axis), and cardiovascular changes (Sapolsky,

2003). The central feature of the limbic-HPA stress response is the synthesis and the

secretion of glucocorticoids from the adrenal cortex. The excessive stress hormone

often acts as a trigger to the onset of major depression and Alzheimer's disease (AD),

which is associated with a decreased sensitivity to HPA axis feedback inhibition by

cortisol in primates or corticosterone in rodents. In addition to the HPA axis, brain

neuronal systems, including the monoaminergic systems and in particular the serotonin

(5-HT) containing neuronal one, play critical roles in stress-related disorders (Lanfumey,

Mongeau, Cohen-Salmon, & Hamon, 2008; Y. Xu et al., 2006). Numerous data have

demonstrated the existence of reciprocal interactions between the central serotonin

system and HPA axis in stress related depression, in which dysfunction of both the 5-

HT and its sub-receptors and HPA axis have been evidenced (Kitamura, Araki, &

Gomita, 2002).

The hippocampus and the amygdala are essential components of the neural

circuitry mediating stress responses. The hippocampus is critical in its role controlling

the limbic-HPA axis, mood and memory through excitatory inputs. Changes within this

structure, synaptic loss and atrophy, is known to involve in prolonged elevated

glucocorticoid levels, major depression and cognitive impairment (Lupien et al., 1998).









The amygdala is responsible for the detection of an environmental stressor (or threat)

and controls the expression of the fear reaction, including behavioral, autonomic and

endocrine responses via projects to downstream areas, such as hypothalamus and

central gray, which in turn regulate the secretion of neurotransmitters, corticotropin-

releasing hormone (CRH) and glucocorticoids (Fanselow & Poulos, 2005) (Rodrigues et

al., 2009). However, recent studies show that enhanced hippocampal input would

suppress the HPA axis, while enhanced amygdaloid input could have the opposite

effect on HPA activity (Vyas, Mitra, Shankaranarayana Rao, & Chattarji, 2002). In

rodents, corticosterone reduces response to serotonin in the hippocampus, which could

contribute to the onset of symptoms of depression in predisposed individuals (Joels et

al., 2004). But the amygdala activation leads to an increase in arousal and vigilance in

response to the fear reaction after stress, which result in the release of

neurotransmitters (5-HT, noradrenaline and dopamine) and their sub-receptors change

(LeDoux, 2007; Leonard, 2005).

In view of the potentially contrasting impact of stress hormone on the

hippocampus and amygdala at the behavioral level and neuroendocrine mechanism, it

is important to study the molecular mechanism underlying how the stress hormone

affects the hippocampal and amygdaloid neurons function when they are exposed to the

stress hormone. Therefore, the present study was designed to investigate the

morphological changes of hippocampal and amygdaloid cell lines under corticosterone

exposure. We also tested if the mechanism was dependent on 5-HT sub-receptors and

related signal pathway.









CHAPTER 2
MATERIALS AND METHODS

2.1 Materials

HT-22 cells were a generous gift from Dr. David Schubert (The Salk Institute for

Biological Studies, La Jolla, CA, USA) (Y. Li, Maher, & Schubert, 1997). AR-5 cells were

kindly provided by Dr. Rosalie Uht (University of North Texas Health Science Center,

Fort Worth, TX, USA)(Lalmansingh & Uht, 2008). Culture plates were acquired from

Nunc (A/S, Roskilde, Denmark). DMEM/F12 media were bought from Hyclone (Logan,

UT). NeuroBasal medium, fetal Bovine Serum (FBS) and N2 nutrient supplement were

from Invitrogen (Carlsbad, CA). Corticosterone was purchased from Sigma Chemical

Co. (St. Louis, MO). MTT assay was obtained from Biotium, Inc. (Hayward, CA). 5-HT1A

receptor antagonist, NAN-190 (1-(2-methoxyphenyl)-4[-(2-phthalimido)butyl]piperazine),

5-HT7 receptor agonist, LP-44 ((4-[2-(Methylthio)phenyl]-N-(1,2,3,4-tetrahydro-1-

naphthalenyl)-1-piperazinehexanamide)) and antagonist SB-269970 ((2R)-1-[(3-

Hydroxyphenyl)sulfonyl]-2-(2-(4-methyl-1-piperidinyl)ethyl)pyrrolidine) were purchased

from Tocris (Avonmouth, UK). Other routine cell culture supplies and reagents were

from Sigma, Invitrogen or Fisher.

2.2 Cell Culture

HT-22 cells were maintained in Dulbecco's modified Eagle's medium (DMEM)

supplied with 10% FBS, and grown at 370C in 5% CO2, and differentiated in NeuroBasal

medium containing 1 x N2 supplement for 12h before treatment. AR-5 cells were

cultured in DMEM/F12 media as described previously (Lalmansingh & Uht, 2008) and

differentiated the same way as HT-22 were differentiated. Cells were plated at 105/ml









for MTT experiment and mRNA extraction, 5x104/ml for cell morphology tests. All

treatments were performed in the differentiation media.

2.3 Drug Treatment

Corticosterone, 5-HT7 receptor antagonist SB-269970 and agonist LP-44 were

dissolved in dimethyl sulfoxide (DMSO), NAN-190 in ethanol and respectively, the

vehicle concentrations did not exceed 0.1% of the total volume in the cell culture well.

SB-269970 and LP-44 were added 2h before corticosterone application (doses and

treatment schedules were presented in the results of each experiment), and cells were

pretreated with NAN-190 (1 pm) wherever LP-44 was used.

2.4 Cell Viability

Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium

bromide (MTT) assay based on the kit protocol. Briefly, 12 hr after differentiation on 96-

well plates, cells were treated with corticosterone and/or other protective reagents at

different concentrations and incubation time. Following the indicated treatments, 10pl of

MTT solution was added to each well and incubated for another 3 hr. The dark blue

formazan crystals formed in intact cells were dissolved with 200pl DMSO/well and

absorbance at was measured using Synergy Multi-mode Microplate Reader (BioTek,

USA).

2.5 mRNA Extraction and Real-time Reverse Transcriptase (RT)-PCR

Cultures were washed and total cellular RNA was isolated with TriZOL reagent

(TriZOLR Invitrogen) according to the manufacture's protocol. For RT-PCR, 600ng total

RNA was reverse transcribed using MJ Mini TM Gradient Thermal Cycler (Bio-Rad,

Hercules CA, USA) and PCR reaction was performed using iCycler Real-Time PCR

machine (Bio-Rad, Hercules CA, USA). After cDNA synthesis, a PCR mixture









containing 50% v/v per sample of SYBER Green (iQ SYBER Green Supermix reagent,

Bio-Rad) was tested with specific primers for 3-actin (5'-CGTGCGTGACATTAAAGAG-

3', 5'-GCCACAGGATTCCATACC-3'), RhoA (5'-TATTGAAGTGGACGGGAAGC-3', 5'-

ACTATCAGGGCTGTCGATGG-3'), Racl (5'-GGGAACAAGAGCAAGTCTGC-3', 5'-

CGATTCCCGTTCTCCTTCTA-3'), Cdc42 (5'-TTGTTGGTGATGGTGCTGTT-3', 5'-

TCTCAGGCACCCACTTTTCT-3'), Synaptophysin (5'-CCCCCTTTTCCCATATCCTA-3',

5'-AGGTCTGGTTCCCTTCCTGT-3'), Gap-43 (5'-CGTGCGTGACATTAAAGAG-3', 5'-

GGCATTTCCTTAGGTTTTGGT-3') and Synaptopodin (5'-

AGTCCTCACCAAACCCTCCT-3', 5'-TGGACCTCACTTCCTCTGCT-3'). PCR products

were amplified in the iCycler real-time PCR machine followed by melt curve analysis

and gel electrophoresis to verify specificity and purity of product. All the data were

normalized to the housekeeping gene, 3-actin.

2.6 Image Collection and Data Analysis

Images were collected in a blinded manner using a Zeiss LSM510 Pascal confocal

microscope (Carl Zeiss imaging systems, Germany). A stack of images was taken using

a 20xobjective and total lengths of neurite outgrowth were measured. Randomly

selected HT-22 or AR-5 cells from each group were excluded if precise tracing was

deemed to be questionable due to extensive overlapping with processes originating

from analysis or if their morphology was not intact and possessed membrane

varicosities. Fewer than 5% of the randomly selected neurons met one or more of these

exclusion criteria. Digitized images were assembled offline using Photoshop 7.0

software (Adobe Systems, Mountainview, CA) and used for analyses without further

manipulation (Jugloff, Jung, Purushotham, Logan, & Eubanks, 2005). Ten cells of each









group from at least two separate experiments were analyzed (Xie, Cahill, & Penzes,

2010).

2.7 Statistical Analysis

All data were presented as mean + standard error of the mean (SEM). One-way

analysis of variance (ANOVA) followed by a LSD test was used for statistical evaluation.

Statistical significance was set at p < 0.05.









CHAPTER 3
RESULTS

3.1 Corticosterone Impairs Hippocampal and Amygdaloid Primary Cultures in a
Dose- and Time- Dependent Manner

The ceoncentration- and time-course of corticosterone caused cytotoxicity were

test in hippocampal and amygdaloid primary cultures with MTT assay. Primary neurons

were seeded at a density of 106/ml in 0.1% (w/v) poly-L-lysine coated dishes.

Corticosterone treatment at higher than 1 pM for 24 hr caused significant cytotoxicity in

the above two types of primary cultures (p<0.01) (Fig. 1A, B, C and D).

3.2 The Influence of Corticosterone on 5-HT Receptors mRNA Expression in
Primary Hippocampal and Amygdaloid Cultures

Dysfunction of the 5-HT system is present in stress-related depression and

anxiety. The present study investigated the influence of stress levels of corticosterone

(10 [iM) on seven types of 5-HT receptors, which are closely involved in stress-related

mood disorders (Table 1). Results show that for hippocampus, 5-HT1A, 5-HT2A and 5-

HT4 and 5-HT7 receptor mRNAs were significantly increased after corticosterone

exposure for 24h (p<0.05 vs. vehicle-treated group without corticosterone, respectively).

For amygdala, 5-HT1A, 5-HT2B, 5-HT4, 5-HT6 receptor mRNA was shown to increase

following exposure to corticosterone, but 5-HT7 mRNA was shown to decrease

significantly (p<0.05 vs. vehicle-treated group).

3.3 Protective Effects of SB-269970 and LP-44 on HT-22 Cells and AR-5 Cells
Respectively From the Lesion Induced by Corticosterone

HT-22 cells were exposed to 6.25, 12.5, 25, 50, 100pM corticosterone, and cell

survival was quantified by MTT assay. Cell viability was markedly reduced after

exposure to 50pM corticosterone for 24 hr (p<0.01) (Fig. 2A). Pretreatment of HT-22

cells with 2.5, 5, 10pM SB-269970 could dose-dependently protect against the cell









lesion induced by 50pM corticosteronn. The effect was significant at 5 and 10 pM

(p<0.05 and p<0.01) (Fig. 2B). AR-5 cell survival was significantly at 50pM

corticosterone for 24 hr (p<0.01) and the effect was reversed dose-dependently by LP-

44 markedly at 0.1 and 0.2pM (p<0.01) (Fig. 3A and B).

3.4 SB-26970 and LP-44 Modulation of Cell Morphology Against Corticosterone
Toxicity

Corticosteone has been proved to cause not only cell toxicity but also cell

morphology. Firstly, differentiating HT-22 and AR-5 cells are morphologically different

from proliferating cells, as they have less cell densities and longer neurite outgrowth

(Fig. 4A and B, Fig. 5A and B). The results also showed significant reductions in total

length of cell neurite outgrowth of HT-22 cells and increment in AR-5 cells respectively

in corticosterone treated groups (Fig. 4C and E; Fig. 5C and E). These results were

reversed by SB-269970 on HT-22 cells and LP-44 on AR-5 cells (Fig. 4D and E; Fig 5D

and E).

3.5 SB-269970 and LP-44 Regulate Rho Family mRNA Changes Induced by
Corticosterone in HT-22 Cells and AR-5 Cells

The Rho family genes are known to have impact on cell morphology. To determine

if SB-269970 reverse effect of corticosterone-induced HT-22 cells morphological

changes were dependent on Rho family small GTPase, Cdc-42, RhoA and Rac-1

mRNA levels were measured in the presence or absence of 50pM corticosterone, and

also in the presence of 2.5, 5, 10pM SB-269970. Cdc-42 and RhoA mRNA levels were

increased about 1.5- and 3-fold respectively in HT-22 cells, following exposure to 50pM

corticosterone for 24 hr (p<0.01 and p<0.05 versus vehicle treated groups). These

increases in mRNA levels were prevented by treating the cells with SB-269970 2 hr

prior to corticosterone exposure, and the reversing effects were significant at 10pM for









Cdc42 mRNA and 5, 10pM for RhoA mRNA (Fig. 6A and B). Neither corticosterone nor

SB-269970 had impact on Rac-1 mRNA expression (Fig. 6C). Similarly, 50 pM

corticosterone exposure markedly increase AR-5 cells Cdc-42 mRNA levels by 1.5-fold

and RhoA mRNA levels by 1.4 Fold (p<0.05). And these effects were prevented by

pretreatment of AR-5 cells with 0.05, 0.1, 0.2pM LP-44 2 hr prior to corticosterone,

among which 0.2pM LP-44 had significant effect (p<0.05 and p<0.01) (Fig. 7A and B).

Rac-1 mRNA levels did not change either with corticosterone or LP-44 treatment (Fig.

7C). These results show that SB-269970 and LP-44 can prevent HT-22 cells and AR-5

cells morphological changes induced by corticosterone through Cdc-42 and RhoA, but

not Rac-1.

3.6 The Effect of SB-269970 and LP-44 on Synaptic Markers mRNA Expression in
Corticosterone-Treated HT-22 and AR-5 Cells

Synaptic markers such as Synaptopodin, Gap-43 and Synaptophysin are usually

mentioned in studies regarding neuroplasticity. In order to determine whether SB-

269970's protective effect against corticosterone on HT-22 cells toxicity and

morphological changes involves these markers, mRNA levels of the three genes were

detected using quantitative real-time PCR. Synaptopodin mRNA levels were increased

about-fold in HT-22 cells after treatment with 50pM corticosterone, and 10pM SB-

269970 significantly prevented this effect (p<0.05, p<0.05) (Fig. 8A). However, 50pM

corticosterone did not affect Gap-43 expression, while the use of SB-269970 still

increases it's mRNA levels significantly at 5 and 10pM (p<0.05, p<0.01) (Fig. 8B). On

the other hand, Synaptopodin and synaptophysin levels were decreased with 50pM

corticosterone treatment on AR-5 cells (p<0.05), and LP-44 raised synaptopodin levels

significantly at 0.2pM (p<0.05 compared with vehicle group) (Fig. 9A), while only having









an increasing trend on Synaptophysin (Fig. 9C). Similar to HT-22 cells, Gap-43

expression did not change in AR-5 cells with treatment of 50pM corticosterone and LP-

44 lifted its levels in an increasing trend (Fig. 9B).









Table 3-1. Corticosterone induced 5-HT receptors mRNA expression in rat hippocampal and amygdaloid neruons by real-
time PCR
Hippocampus Amygdala
Target Genbank Position Oligonucleotide sequence 5'-3' RT-PCR RT-PCR fold
fold P value P value
changechange
change
623-642 TGTTGCTCATGCTGGTTCTC
5-HT1A NM 012585 GA GTTTAGT 1.92 <0.05 2.50 <0.05
719-738 CCGACGAAGTTCCTAAGCTG

502-521 CTGGTGTGGGTCTTCTCCAT
5-HT1B NM 022225 55TGGGTGGT1.06 >0.05 1.55 <0.05
593-612 GTAGAGGACGTGGTCGTGT

504-523 GCGATCTGGATTTACCTGGA
5-HT2A NM 017254 GTGTTTA TG2.62 <0.05 0.85 >0.05
715-734 CCCCTCCTTAAAGACCTTCG
466-485 GGAGAAAAGGCTGCAGTACG
5-HT2B NM 017250 AAAAGGGGA1.14 >0.05 0.71 >0.05
601-620 ATAACCAGGCAGGACACAGG

780-799 GAGACCAAAGCAGCCAAGAC
5-HT4 NM 012853 AGGAAGGAG3.00 <0.05 2.82 <0.05
972-991 AGGAAGGCACGTCTGAAAGA

110-119 ATCAGTACC CTCCC CAAAC
5-HT6 NM 024365 1109 ATGT T1.25 >0.05 1.56 <0.05
296-315 GACTGGGTTGAGGACCAAGA

786-805 GGGCTCAGAATGTGAACGAT
5-HT7 NM 022938 786-85 GT 1.92 <0.05 0.49 <0.05
925-944 TGTGTTTGGCTGCACTCTTC












A 0.9 B 0.9
0.8 0.8

o, 0.6 0.6
A0.A 0.4

S0.3 0.3
01 11.2
0.1 0.1
0,1 0,
Control 2.5 5 10 20 40 Time (hr) 0 1 3 6 12 24 48
Corticosteroneroncentration (OiM) Cortaiostoeone cnntration (101iM)

C O.s D-


0.6
0.5

II 0.4
0.4 >.
S0.3 03
0.2 0.2
0.1 0A

Control 2.5 5 10 20 40 0
Time (hr) 0 1 3 6 12 24 4
Coticost oneo eration(M) entrao (lM)
Cor'ficerone onEnon 00HruMLb)


Figure 3-1. Corticosterone (CORT) impairs cell viability of primary hippocampal and
amygdaloid cell cultures in a concentration- and time- dependent manner,
measured by MTT assays. A) Primary hippocampal neurons were treated
with various concentrations of CORT for 24 hr. B) Primary hippocampal
neurons were treated with 10 M CORT for the indicated periods. C) Primary
amygdaloid neurons were treated with various concentrations of CORT for 24
hr. D) Primary amygdaloid neurons were treated with 10pM CORT for the
indicated periods. Results are expressed as mean SEM from at least three
independent experiments (*p<0.05; **p<0.01; ***p<0.001 versus controls).











A r B 0-"
0.6 0.6
0.54


03 0.3
0.2 02
01 0.1
0 o
Control 6.25 12.5 25 50 100 SB-269970 Conrol 0 2.5 5 10
eomcmntradon(f IM)
i(.lll s'ski, .1ir i III.Iii'll .111..i. 11 i Cortirosteriie(50 lM )


Figure 3-2. Corticosterone impairment of HT-22 cultures cell viability and the reverse
effect of SB-269970 against it, measured by MTT assay. A) HT-22 cells were
treated with indicated concentrations of CORT for 24 hr. B) SB-269970
protected HT-22 cells against CORT-induced decrease in cell viability dose-
dependently. Results are expressed as mean SEM from at least three
independent experiments (*, p<0.05; **, p<0.01; ***, p<0.001 as compared
with controls by one-way ANOVA. #, p<0.05; ##, p<0.01; ###, p<0.001 as
compared with corticosterone-treated group by one-way ANOVA).



0.6
0.5 Control 6.2 12. 2 0 100 0.0
S0








independent experiments (*, p<0.05; **, p<0.01; ***, p<0.001 as compared
0.3.3



0 10
Control 6.25 12.5 25 50 100one-way ANOVA. #, p<0.05; ##, p<0.01
Cortocosterone concetration on etreat) or tiost one(p-way AN


Figure 3-3. Corticosterone impairment of AR-5 cultures cell viability and the reverse
effect of LP-44 against it, measured by MTT assay. A) AR-5 cells were
treated with indicated concentrations of CORT for 24 hr. B) LP-44 protected
HT-22 cells against CORT-induced decrease in cell viability dose-
dependently. Results are expressed as mean SEM from at least three
independent experiments (*, p<0.05; **, p<0.01; ***, p<0.001 as compared
with controls by one-way ANOVA. #, p<0.05; ##, p<0.01; ###, p<0.001 as
compared with corticosterone-treated group by one-way ANOVA).









































"1 .1 1 .I 1 .
SB-269970 Control 0 2.5 5 10
concentration A) Corticosterone(OpM)

Figure 3-4. HT-22 cell morphological changes in proliferation, differentiation and
corticosterone/SB-269970 treated conditions. A) Proliferating HT-22 cells at 3
day of cultrue. B) Differenitating HT-22 cells at 3 day of culture. C) HT-22
cells treated with 50pM corticosterone for 24 hr. D) HT-22 cells treated with
5pM SB-269970 prior to 50pM corticosterone. E) Quantification of HT-22 cells
neurite outgrowth treated with corticosterone or SB-269970.












































E 1400
1200
, 1000


600
S400
200

LP-44 Control 0 0.05 0.1 0.2
concentration (nM)
Corticosterone(5OpM)


Figure 3-5. AR-5 cell morphological changes in proliferation, differentiation and
corticosterone/LP-44 treated conditions. A) Proliferating AR-5 cells at 3 day of
cultrue. B) Differenitating AR-5 cells at 3 day of culture. C) AR-5 cells treated
with 50pM corticosterone for 24 hr. D) AR-5 cells treated with 0.2pM LP-44
prior to 50pM corticosterone. E) Quantification of AR-5 cells neurite outgrowth
treated with corticosterone or LP-44.












A 1.8
1.6
S1.4
E 1.2

0.8

0.6
0.4
0.2

SB-269970 Control
' li, 1111 ,111illI.. I li l i


B 3.5


S25



1.5






0 2.5 5 10 SB-269970 Control
Coticosterone(5M) concentration (pM)
Corticosterone (OupM)


0 2.5 5 10

Corticosterone(50IM)


C 1.8
1.6
1.4
S1.2


I 0.8
0.6
0.4
0.02

SB-269970 Control 0 2.5 5 10
concentration (p1)M)
Corticostelone(50upM)


Figure 3-6. Effect of SB-269970 on Rho family small GTPase mRNA expression in
corticosterone treated HT-22 cells, measured with quantitative real-time PCR.
A) SB-269970 reverses corticosterone-induced Cdc-42 mRNA fold change in
a dose-dependent manner. B) SB-269970 reverses corticosterone-induced
RhoA mRNA fold change in a dose-dependent manner. C) Effects of
corticosterone and SB-269970 on Rac-1 mRNA expression.. Results are
expressed as mean SEM, n=6 (*, p<0.05; **, p<0.01 as compared with
controls by one-way ANOVA. #, p<0.05; ##, p<0.01 as compared with the
corticosterone-treated group by one-way ANOVA).












A 18 B 1.8
1.6 1.6
1.4 4 1









LP-44 Control 0 0.05 0.1 0.2 1244 Control 0 0.05 0.1 0.2
concentration (pM )C coincntrationitM) ------------------
1.2








12
0.8 0.8








0.6


040.4
0.2 0.2
0 0










LP- 44 Control 0 0.05 0.1 0.2 LP44 Conol 0 005 0
concentration (phM) c--a-ion









Corticosterone(50pM)
C 1.4
1.2


0.8

0.6

0.4

0.2


LP-44 Control 0 0.05 0.1 0.2

Corticosterone (501lM)


Figure 3-7. Effect of LP-44 on Rho family small GTPase mRNA expression in
corticosterone treated AR-5 cells, measured with quantitative real-time PCR.
A) LP-44 reverses corticosterone-induced Cdc-42 mRNA fold change in a
dose-dependent manner. B) LP-44 reverses corticosterone-induced RhoA
mRNA fold change in a dose-dependent manner. C) Effects of corticosterone
and LP-44 on Rac-1 mRNA expression. Results are expressed as mean
SEM, n=6 (*, p<0.05; **, p<0.01 as compared with controls by one-way
ANOVA. #, p<0.05; ##, p<0.01 as compared with corticosterone-treated
group by one-way ANOVA).












A 2.5
a
2




1-0
E 1

005


SB-269970 Control


0 2.5 5 10
Corticosterone(50pM)


B 4



2 2


a T
I.;



2
SB-26997# Control 0 2.5 5 10
con tceration O(fl )
Corlicstaerone(50pm)


Figure 3-8. Effect of SB-269970 on synaptic protein mRNA expression in corticosterone
treated HT-22 cells, measured with quantitative real-time PCR. A) SB-269970
reverses corticosterone-induced synaptopodin mRNA fold change in a dose-
dependent manner. B) Effects of corticosterone and SB-269970 on Gap-43
mRNA expression. Results are expressed as mean SEM, n=6 (*, p<0.05;
**, p<0.01 as compared with controls by one-way ANOVA. #, p<0.05; ##,
p<0.01 as compared with corticosterone-treated groupby one-way ANOVA).












A 1.2

1

0.8







-*i 0 -18 I* I
0.6

S0.4

S 0.2

I 0 --
LP-44 Control
..ll. l. ll .. I i ll 11111,




C 1.4

1.2


i 0.8


0.6

B 0.4

| 0.2

0
LP-44 Control
,' I II l i l Il.. h11 1 i


0 0.05 0.1 0.2

Corticosterone(50gM)


B .6
1.4

1.2

5 1
S0.8

S0.6

S0.


0
LP-44 Control
, ,-II* l d ii' ill iI


0 0.05 0.1 0.2

Corticosterone(SOpM)


Figure 3-9. Effect of LP-44 on synaptic protein mRNA expression in corticosterone
treated AR-5 cells, measured with quantitative real-time PCR. A) LP-44
reverses corticosterone-induced synaptopodin fold change in a dose-
dependent manner. B) Effects of corticosterone and LP-44 on Gap-43 mRNA
expression. C) Effects of corticosterone and LP-44 on synaptophysin mRNA
expression. Results are expressed as mean SEM, n=6 (*, p<0.05; **,
p<0.01 as compared with controls by one-way ANOVA. #, p<0.05; ##, p<0.01
as compared with corticosterone-treated group by one-way ANOVA).


0 0.05 0.1 0.2

Corticosterone (50jM)









CHAPTER 4
DISCUSSION

This study investigated two aspects of how stress hormone affects the hippocampus

and amygdala. Firstly, we tested whether administration of corticosterone to

hippocampal and amygdaloid cell lines induced different changes in 5-HT sub-

receptors. Secondly, we tested whether stress induced morphological changes in these

two cell lines are involved in the 5-HT sub-receptors expression. We now show, using

HT-22 and AR-5 cell lines, that 5-HT7 receptor mRNA is significantly up-regulated in HT-

22 cells, but down-regulated in AR5 cells by exposure to stress level of corticosterone

(50 pM) for 24h. Pretreatment of cells with 5-HT7 antagonist SB-269970 and agonist LP-

44 reversed corticosterone induced cell lesion in a dose-dependent manner in HT-22

and -AR5 cells, respectively. Moreover, corticosterone induced different changes of

dendritic complexity in HT-22 and AR-5 cells were also reversed by pretreatment with

SB-269970 and LP-44. This 5-HT7 sub-receptor mRNA expression difference was

confirmed by primary hippocampal and amygdaloid neuron cultures when they were

exposed to corticosterone.

In the present study, we focused our interest on two distinct brain regions, the

hippocampus and amygdala. The involvement of these brain regions in emotional,

motivational, and mnemonic processes may be related to stress related depression and

dementia (Butterweck, Bockers, Korte, Wittkowski, & Winterhoff, 2002). It is interesting

that Kelly et al. (Kelly, Wrynn, & Leonard, 1997)suggested that impaired hippocampal

function and/or dendritic atrophy may underlie memory deficits in stressed animals. In

contrast, the pyramidal and stellate neurons of amygdala showed increased dendritic

arborization (Vyas et al., 2002). This finding allows us to ask specific questions about









the impact of glucocorticoids on brain regions and the molecular basis on this pathway.

In the central nervous system, immortalized cell lines from various brain regions which

retain parental cell characteristics have been generated from neuron/glial precursors,

astrocytes and microglia (Lendahl & McKay, 1990). HT-22 cells are immortalized mouse

hippocampal neuronal precursor cells that were sub-cloned from their parent HT-4 cells

(Liu, Li, & Suo, 2009). The retroviral-mediated transfer of the SV 40 large T antigen into

rat embryonic amygdaloid cells has resulted in the production of an immortalized AR-5

cell line which is able to form stable monolayers in culture (Sheriff et al., 2001). Both

HT-22 and AR-5 cell lines are valuable models for better understanding the cellular and

molecular processes relevant to the hippocampus and amygdala, respectively.

Serotonin is an important neurotransmitter that exerts a wide influence over many

brain functions through activating or inhibiting families and subtypes of its receptors.

The interactions between HPA axis and the 5-HT system are of particular relevance

when being subjected to stress, in which dysfunctioning actually concerns both of these

two systems (Barden, 1999; Lesch et al., 1990). Among the 14 known 5-HT receptor

subtypes, 5-HT7 sub-receptor is one of the least well known. Recent attention has been

received mainly due to its pivotal role in the pathogenesis of depression and the

involvement in specific aspects of hippocampus-dependent contextual learning and

memory processing (C. Roberts, Thomas, Bate, & Kew, 2004). In situ hybridization

study reveals 5-HT7 sub-receptor expression in cortex, hippocampus, amygdala and

hypothalamus (M. Guscott, Bristow, Hadingham, Rosahl, Beer, Stanton, Bromidge,

Owens, Huscroft, Myers, Rupniak, Patel, Whiting, Hutson, Fone, Biello, Kulagowski et

al., 2005b). Animal study was shown that 5-HT7 sub-receptor mRNA was up-regulated









in the hippocampus, but not cortex in rats after exposure to chronic stress (Y. C. Li et

al., 2009). Recent evidences have shown a synergistic interaction between individually

ineffective doses of the selective antagonist SB-269970 and antidepressants in forced

swim test with an increase in 5-HT levels in the frontal cortex and hippocampus

(Bonaventure et al., 2007; Wesolowska, Nikiforuk, & Stachowicz, 2006). In this study, in

vitro HT-22 and AR-5 cell lines were tested to determine whether administration of

corticosterone to them is related to changes in 5-HT sub-receptors. We chose the

concentration of corticosterone in vitro (50 pM) that is equivalent to moderate to high

stress levels in vivo (Sapolsky, Brooke, & Stein-Behrens, 1995). Analyses by real-time

PCR in the present study revealed that 5-HT7 sub-receptor was up-regulated in HT-22

cells, but it was down-regulated in AR-5 cells. Subsequent cell viability test showed that

5-HT7 antagonist SB-269970 and agonist LP-44 reversed corticosterone induced cell

lesion in HT-22 and AR-5 cells, respectively. This is the first time to get such an

intriguing finding, which was also confirmed by hippocampal and amygdaloid neuron

cultures in our study. These results imply that elevated corticosterone level may change

some 5-HT receptor binding inculding 5-HT7 sub-receptor, which affects the neural

circuitry as an indirect mechanism (Raffa & Codd, 1996).

Dysfunction of neuronal plasticity is exhibited during chronic stress and in patients

with depression and likely occurs when the brain fails to induce the appropriate adaptive

response or remodeling phenomena (Reines et al., 2008). Hippocampus is one of the

most intensely studied structures in the stress-inhibitory circuit, other limbic inputs,

including amygdala have received less attention. Recent studies show that the

hippocampus experienced synaptic loss and atrophy while the amygdala had increased









plasticity and synaptogenesis when rats subjected to chronic stress (Vyas et al., 2002).

However, the sensitivities of hippocampal and amygdaloid neurons on stress hormone

and 5-HT7 sub-receptor have not been described. Neuronal soma size has been

correlated with increased neural activity (Gorski, Zeiler, Tamowski, & Jones, 2003) and

since dendritic trees act as the postsynaptic sites of excitatory input in the mammalian

brain, structural alterations in them must affect network function (Alfarez et al., 2009).

The present study, which quantified soma size and total dendritic length showed

decreased dendritic complexity of hippocampal and amygdaloid cells after

corticosterone exposure. Restoration of synaptic plasticity, reflected by increased

neuron complexities in the face of corticosterone cytotoxicity, were found in the

presence of SB-269970 and LP-44 in HT-22 and AR-5 cell lines, respectively. These

results confirmed our hypothesis that regulation of synaptic function after glucocorticoid

exposure was dependent on the amelioration of 5-HT neuronal function.

Molecular downstream mechanisms underlying such opposite effects of stress

hormone/5-HT sub-receptor on neurite outgrowth are still poorly understood. Studies

show that activation of the members of the Rho family of small GTPase (Rho, Rac-1

and Cdc-42) initiated pathway induces growth cone collapse and neurite retraction

(Kranenburg et al., 1999; Kvachnina et al., 2005). Marked changes in morphology,

motility and guidance of axons have been observed in response to activation of Rho

family GTPases both in vitro and in vivo (Ruchhoeft, Ohnuma, McNeill, Holt, & Harris,

1999; Zipkin, Kindt, & Kenyon, 1997). We chose to focus our current study on Rho,

Rac-1 and Cdc-42, which regulate cellular pathways involved in stress hormone and

presynaptic regulation in hippocampal neurons (Owe-Larsson et al., 2005). The present









findings suggest that there were significant increases in the levels of RhoA and Cdc-42

when the HT-22 and AR-5 cells were exposed to corticosterone. These effects were

prevented by SB-269970 in HT-22 cells and LP-44 in AR-5 cells, respectively. The

results are agreement with the previous studies (Owe-Larsson et al., 2005) and

demonstrate that the 5-HT7 sub-receptor effectively communicates with Rho family

when corticosterone exposure.

As plasticity-responsive elements, three synaptic markers including synaptophysin

(presynaptic vesicle protein), Gap 43 (synaptic membrane protein) and synaptopodin

(postsynaptic protein) are reported to be closely involved in neurotransmitter release

and neuronal sprouting during stress (M. Nishi, Whitaker-Azmitia, & Azmitia, 1996;

Reddy et al., 2005). However, they were shown to differentially respond to stress

hormone and antidepressant treatment in our study. The present findings suggested

that there were significant increase in Synaptopodin levels in HT-22 cells after

corticosterone exposure, and decreased Synaptopodin and Synaptophysin levels in AR-

5 cells, which were either reversed by SB-269970 and LP-44 respectively or having a

reversing trend.

The most distinctive finding of the present study is the investigation that

corticosterone-induced different expression of 5-HT7 receptor in HT-22 and AR-5 cell

lines which were generated from hippocampal and amygdaloid neurons. These data

were confirmed by primary neuron cultures. Moreover, the distinct cell viability and

morphological changes in HT-22 and AR-5 cells were also involved in activation and/or

inhibition of 5-HT7 receptor and the related genes expression in these cells after

corticosterone exposure. Our results support the hypothesis that serotonin may









differentially modulate neuronal morphology in hippocampus and amygdala depending

on the expression levels of the 5-HT sub-receptors during stress hormone attacks.









CHAPTER 5
LITERATURE REVIEW: THE ROLE OF 5-HT SYSTEM IN STRESS AND
DEPRESSION

5.1 Introduction

In the 1930s, it has been established that any environmental changes, whether

internal or external, that disturbs the maintenance on homeostasis can cause stress

response, including psychological, neuronal, endocrine and immune system reactivity

(Leonard, 2005). Chronic stress or long-term exposure to external stress hormone

glucocorticosteroids induces the hyperactivity of the HPA axis (Hypothalamic-Pituitary-

Adrenal axis), which produces an increase in plasma glucocorticoid level, and finally

impairs the negative feedback mechanism, causing psychological disorders such as

depression, anxiety and inhibition of learning and memory (Croes, Merz, & Netter, 1993;

Henry, 1992). In normal physiological conditions, HPA axis and serotonergic system

interact with each other to cross regulate body functions (Chaouloff, 1993). However, in

stress conditions, serotonergic system exerts its self-regulatory functions. Pathological

mechanisms of psychological disorders such as major depression that is caused by

chronic stress has been implicated to be closely related to dysregulation of HPA axis,

monoaminergic systems especially the 5-HT system (Barden, 1999; Porter, Gallagher,

Watson, & Young, 2004).

Serotonin (5-hydroxytryptamine, 5-HT) is an important neurotransmitter in the

central nervous system (CNS). Through activating or inhibiting families and subtypes of

its receptors, 5-HT has been demonstrated to have multiple physiological functions, and

dysregulation of serotonergic system can cause stress related diseases such as

Alzheimer's Diseases (AD), anxiety, depression and cognitive disorders (Goddard et al.,

2010; Ramanathan & Glatt, 2009). Animal models of chronic stress have revealed that,









the activation of HPA axis and elevated levels of adrenocortical hormone are the main

characteristics of stress (Konakchieva, Mitev, Almeida, & Patchev, 1998).

Limbic system is a set of brain structures including the hippocampus, amygdala,

anterior thalamic nuclei, and limbic cortex, which creates a closed loop by embracing

part of the two brain hemispheres and support a variety of functions including emotion,

behavior, long term memory, and olfaction. A great amount of serotonergic neurons can

be found in this system. Chronic stress leads to long-term hyperactivity of HPA axis and

elevated levels of glucocorticoids, causing impairment of brain regions in the limbic

system, in conjunction with down-regulation of HPA negative feedback control.

Abnormality of monoaminergic neurotransmitter secretion and continuous damage of

neurons finally leads to cognitive dysfunction including gradual loss of the ability of

learning and memory, which are the most important characteristics of affective disorders

(e.g. anxiety, depression, schizophrenia) and neurodegenerative diseases (e.g. AD,

Parkinson's Diseases) (Kaneda, 2009; Ribes, Colomina, Vicens, & Domingo, 2009; Uc

et al., 2009).

5.2 The 5-HT System

5-HT is an important neurotransmitter in the mature central nervous system. The

neurons of the raphe nuclei are the major source of 5-HT release in the brain, and it

projects upon many other regions of the brain, exerting its regulatory function of

physiology. 5-HT expression in the developing raphe nuclei neurons and the preferential

generation of the nerve fiber projecting terminals during the formation of neuronal

synapses, demonstrated that 5-HT plays a significant roles not only in the morphology

and neural activity of embryonic neurons, but also in neurogenesis and neuroplasticity

after maturation, including proliferation, translocation, differentiation and synapse built









(Benninghoff et al., 2010; Veenstra-VanderWeele, Anderson, & Cook, 2000). It's been

proved that 5-HT is related to the development of cerebral cortex in mammals. During

the early stages of sensory cortex development, temporary serotonergic fibers

projections have been detected, indicating that 5-HT might be helpful in conjugation and

integration of the developing cortex (Nayyar et al., 2009). Brain serotonin synthesis,

packaging, transportation, release, as well as its action at targeting ligands, reuptake

and degradation all affect the concentration of 5-HT and its function. Proteins and

related genes that are involved in regulating these physiological functions include

speed-limiting enzyme TPH-1 and TPH-2 (Illi et al., 2009), Vmat2 (Fukui et al., 2007;

Zucker, Weizman, & Rehavi, 2005), serotonin transporter (5-HTT), monoamine oxidase

A (MAO-A) and 5-HT pre and post synaptic receptors such as 5-HT1A, 5-HT2A, 5-HT2C,

5-HT3, 5-HT4, 5-HTs, 5-HT6, 5-HT7 (Lesch & Gutknecht, 2005; Paaver et al., 2007).

Firstly, 5-HT precursor L-tryptophan passes through the blood-brain barrier and

reaches the serotonergic neurons. Catalyzed by TPH, 5-HTP is generated from L-

tryptophan, and after decarboxylation catalyzed by 5-HTPDC it turns into 5-HT. 5-HT is

imported and stored at the vesicles from nerve terminals, and then released at

presynaptic membrane via Vmat2 and 5-HTT, binds to different subtypes of receptors

located on pre and post synaptic membranes and exerts its physiological function. 5-HT

level in synaptic space is regulated by SERT mediated reuptake, and 5-HT in cell

cytosol is metabolized to 5-HIAA by MAO-A (Holmes, 2008).

According to research regarding the molecular and functional properties of the 5-

HT receptors, each of them are now assigned to one of seven receptor families, 5-HT1-

7, comprising a total of 14 structurally and pharmacologically distinct mammalian 5-HT









receptor subtypes. With the exception of the 5-HT3 receptor, a ligand-gated ion channel,

all other serotonin receptors (5-HT1A-E, 5-HT2A-C, 5-HT4, 5-HTs, 5-HT6, 5-HT7) are G

protein-coupled receptors that activate an intracellular second messenger cascade to

produce an excitatory or inhibitory response. Activation of the specific G-protein can

affect enzymes (such as adenylate cyclase, phospholipase A and C, mitogen-activated

protein kinase and so on) and the function of cation channels especially K' and Ca2+

(Kushwaha & Albert, 2005). Recently, literatures has been reporting that in the intact

brain the function of many 5-HT receptors can now be unequivocally associated with

specific physiological responses, ranging from modulation of neuronal activity and

transmitter release to behavioral change, especially psychological disorders like

depression, anxiety, obsessive-compulsive disorder, panic disorder and migraine (add

references here). Among the receptor subtypes, 5-HT1A, 5-HT1B, 5-HT2A/2C, 5-HT4, 5-

HT6, 5-HT7 are considered related to chronic stress induced neural diseases, inhibition

of learning and memory, and cognitive disorders (King, Marsden, & Fone, 2008;

Meneses, 2007; Perez-Garcia, Gonzalez-Espinosa, & Meneses, 2006). Studies have

shown that chronic unpredictable mild stress (CUMS) remarkably reduced 5-HT

concentrations with over-expression of 5-HT1A receptor in the hippocampus, cortex and

hypothalamus, of 5-HT1B receptors in the hypothalamus and of 5-HT7 receptor in the

hippocampus and hypothalamus in rats (Y. C. Li et al., 2009). Also, it was found that

activation of presynaptic receptors enhanced stimulus-induced long-term depression

(Bailey et al., 2008), and antidepressant medications could attribute the ability to

change postsynaptic 5-HT1A receptors and cAMP production (Hines, Tabakoff, &









WHO/ISBRA Study on State and Trait Markers of Alcohol Use and Dependence

Investigators, 2005).

5.3 5-HT1 Receptors

The 5-HT1 subfamily consists of five G protein-coupled receptors (GPCRs) that

are coupled to Gi/Go and mediate inhibitory neurotransmission, including 5-HT1A, 5-

HT1B, 5-HT1D, 5-HT1E, and 5-HT1F. There is no 5-HT1c receptor, as it was reclassified as

the 5-HT2C receptor.

5.3.1 5-HT1A Receptor

5-HT1A is the first successfully cloned subtype of 5-HT receptors, and knowledge

of the pharmacology and function of the receptor have been quickly progressed. The 5-

HT1A receptor is widely distributed in the central nervous system, existing in the cerebral

cortex, hippocampus, septum, amygdala, and raphe nucelus in high densities, while low

amounts also exist in the basal ganglia and thalamus, mediating the release of 5-HT

(Cryan & Leonard, 2000).

Stimulation of 5-HT1A autoreceptors inhibits the activation of nucleus raphes

dorsalis neurons and blocks the release of serotonin in nerve terminals. The self-

regulatory function of 5-HT system is inhibited under chronic stress. Lanfumey and his

colleagues have found that exogenous corticosterone exposure or chronic mild stress

can desensitize the 5-HT1A autoreceptor and activate the postsynaptic 5-HT1A receptor,

which further elevates serotonin levels. Postsynaptic 5-HT1A receptor regulates the

release of 5-HT as well as other neurotransmitters such as acetyl choline, glutamate

and y-aminobutyric acid (Laaris, Le Poul, Laporte, Hamon, & Lanfumey, 1999;

Lanfumey et al., 1999; Le Poul, Laaris, Hamon, & Lanfumey, 1997). Activation of 5-HT1A

receptors has been demonstrated to impair cognition, learning, and memory by









inhibiting the release of glutamate and acetylcholine in various areas of the brain

(Bhagwagar, Rabiner, Sargent, Grasby, & Cowen, 2004).

Studies show that long-term chronic stress or high levels of exogenous

corticosterone can impair 5-HT1A feedback system, induce helplessness behavior in

animal models and psychological disorders in conjunction with deteriorated learning and

memory in human and rodents (Martin, 1991). Current research has discovered that in

chronic stress, 5-HT1A receptor expression varies in different brain regions (Y. C. Li et

al., 2009). In clinical reports, depression patients tend to have decreased postsynaptic

5-HT1A receptors and increased presynaptic inhibitive autoreceptors (Zhou et al., 2008).

In animal studies, post-synaptic 5-HT1A receptor antagonist manifests important

antidepressant roles.

5.3.2 5-HT1B Receptor

5-HT1B receptors are expressed throughout the rodent central nervous system.

These receptors are located in the axon terminals of both serotonergic and

nonserotonergic neurons in basal ganglia, striatum and the frontal cortex, where they

act as inhibitory autoreceptors or heteroreceptors. 5-HT1B receptors inhibit the release

of a range of neurotransmitters, including serotonin, GABA, acetylcholine, and

glutamate (Moret & Briley, 1997; Moret & Briley, 2000; Morikawa, Manzoni, Crabbe, &

Williams, 2000). Knockout mice lacking the 5-HT1B gene has shown an increase of

aggression and a higher preference for alcohol (Clark et al., 2002; Clark, Vincow,

Sexton, & Neumaier, 2004; Kaiyala, Vincow, Sexton, & Neumaier, 2003). Selective

serotonin reuptake inhibitors can reverse these outcomes (de Boer & Koolhaas, 2005).

In open-field test and elevated plus maze test, behavior of the rats in chronic stress

group is always accompanied by 5-HT1B overexpression (Lin & Parsons, 2002), in which









receptor agonist PC-94,253 can reverse the effect. However in forced swimming test

and shuttle box test, the same group of rats has low level expression of 5-HT1B

receptors (Bolanos-Jimenez et al., 1995; Lin & Parsons, 2002).

5.4 5-HT2 Receptors

The 5-HT2 receptors are a subfamily of 5-HT receptors that bind the endogenous

serotonin. The 5-HT2 subfamily consists of three GPCRs which are coupled to Gq/G11

and mediate excitatory neurotransmission. The 5-HT2 receptor family currently

accommodates three receptor subtypes, 5-HT2A, 5-HT2B and 5-HT2C receptors, which

are similar in terms of their molecular structure, pharmacology and signal transduction

pathways.

5.4.1 5-HT2A Receptor

5-HT2A is expressed widely throughout the central nervous system (CNS). It is

expressed near most of the areas rich of serotoninergic terminals, including neocortex

(mainly prefrontal, parietal, and somatosensory cortex) and the olfactory bulb. High

densities of this receptor on the apical dendrites of pyramidal cells in layer V of the

cortex may modulate cognitive processes (Miner, Backstrom, Sanders-Bush, & Sesack,

2003; T. Xu & Pandey, 2000). Studies have shown that 5-HT2A receptor is sensitive to

glucocoticoids. Chronic stress, isolated raising and long-term exposure to exogenous

corticosterone cause hyperactivities of HPA axis and desensitization of 5-HT2A receptor,

indicating that this receptor has important modulatory function in central nervous system

diseases (Lee, Redila, Hill, & Gorzalka, 2009). In patients with depression and AD,

which is usually accompanied by impaired learning and memory, 5-HT2A receptor

mRNA level in cortex is lower than normal condition (Lai et al., 2005; Lanctot,

Herrmann, & Rothenburg, 2008). More and more evidence have revealed that the loss









of 5-HT2A receptor function is not only critical in schizophrenia, but also depression and

anxiety (Dawson & Watson, 2009; Weisstaub et al., 2006).

5.4.2 5-HT2c Receptor

5-HT2C receptors are distributed in basal ganglia regions such as striatum,

substantial nigra pars reticulata (SNr), and subthalamic nucleus (Q. Li et al., 2003;

Lopez-Gimenez, Tecott, Palacios, Mengod, & Vilaro, 2002). 5-HT2C receptor angonitst

increases ACTH and corticosterone/cortisol levels in animal models and human

(Klaassen, Riedel, van Praag, Menheere, & Griez, 2002). 5-HT2C knockout mice do not

show depressive behavior in tale suspension test and forced swimming test. Moreover,

in tale suspension test, 5-HT2c-R gene knockout mice and those treated with 5-HT2C

antagonist SB242084 or RS102221 both exhibited increased antidepressive effects of

SSRI and increased the 5-HT level in cortex and hippocampus (Cremers et al., 2004;

Cremers et al., 2007). However, on the other hand, 5-HT2C receptor agonist WAY

163909, RO 600175 also have some antidpressive effects (Cryan & Lucki, 2000;

Rosenzweig-Lipson et al., 2007). Schmauss and his colleagues found that up-regulated

5-HT2C receptor expression in chronic stress can be reversed by SSRI, indicating that

psychological disorders caused by chronic stress is related to 5-HT2C receptor function

change (Schmauss, 2003).

5.5 5-HT4 Receptors

The 5-HT4 receptor was initially identified in cultured mouse colliculi neurones

and guinea pig brain by Bockaert and co-workers using a functional assay stimulation of

adenylate cyclase activity, which exerts domaminergic function and regulating

glutamatic and cholinergic neurotransmitter release (Matsumoto et al., 2001). The fact

that 5-HT4 receptor is mostly distributed in the limbic system implies it relation with









learning and memory, emotion and stress. Studies show that patients with

schizophrenia, attention-deficit hyperactivity disorder or neurodegenerative diseases

such as AD, have down-regulated levels of 5-HT4 receptor expression, as was shown

previously in rat models with learning and memory disabilities (Reynolds et al., 1995;

Wong, Reynolds, Bonhaus, Hsu, & Eglen, 1996). In numerous depression models such

as forced swimming test, olfactory bulb removal model and chronic bandaged-stress

model, 5-HT4 receptor agonist shows difference levels of antidepressant effect (G.

Lucas et al., 2007). 5-HT4 receptor knockout mice and antagonist treated mice show

anxiety, along with ameliorated abnormal behavior caused by chronic stress (Compan

et al., 2004; Conductier et al., 2006; Smriga & Torii, 2003). On the other hand, 5-HT4

receptor agonist increases neuronal activities in hippocampus and cortex, remodels

neuroplasticity such as densities of spines and length of dendrites (Restivo et al., 2008),

which is possibly the critical mechanism in improving cognition and treating CNS

diseases.

5.6 5-HT6 Receptors

5-HT6 receptor appears in CNS of rodents, mainly on corpus striatum, olfactory

bulb, limbic and forebrain regions including hippocampus and cortex. It is usually

involved in glutamatergic and cholinergic neuronal activity. It is a potential target for

drugs treating cognitive diseases, schizophrenia, anxiety and obesity. This receptor

binds to Gs protein, and couples to the stimulation of adenylate cyclase. 5-HT6 receptor

antagonist (such as SB-399885) improves learning and memory, ameliorate depression

and anxiety as well as the behavior disorder and microbiological changes caused by

chronic stress (Mitchell & Neumaier, 2005; Svenningsson et al., 2007; Wesolowska &

Nikiforuk, 2008; Wesolowska, 2008). On the other hand, receptor agonist (such as









WAY-208466, WAY-181187) can reduce 5-HT and dopamine release in cortex and

corpus striatum, inhibit glutamate release in hippocampus induced by potassium, and

finally lead to cognitive disorders (Burnham et al., 2010).

5.7 5-HT7 Receptors

The 5-HT7 receptor was first identified from brain cDNA libraries screened to

identify novel sequences showing homology to known 5-HT receptors. In situ

hybridization, immunohistochemistry and autoradiographical studies have demonstrated

the presence of 5-HT7 receptors throughout the CNS, mainly in the hypothalamus,

thalamus, hippocampus, amygdala and cortex, in both terminal fields and serotonergic

nuclei (J. J. Lucas & Hen, 1995).

Several studies have indicated a possible involvement of the 5-HT7 receptor in

mood, emotion, and other neuropsychiatric disorders. In recent studies, 5-HT7 receptor

mRNA level was showed upregulated in the hippocampus and hypothalamus, but not in

the cortex in rats after exposure to chronic unpredictable stress (Y. C. Li et al., 2009),

while strong evidence have been supporting the involvement of 5-HT7 receptor in

hippocampus- and cortex-dependent contextual learning and memory processing

(Eriksson, Golkar, Ekstrom, Svenningsson, & Ogren, 2008; Gasbarri, Cifariello, Pompili,

& Meneses, 2008; A. J. Roberts et al., 2004; Sarkisyan & Hedlund, 2009). Data

collected from the use of 5-HT7 receptor antagonists SB269970 or SB656104 have

showed that this receptor is involved in 5-HT mediated hypothermia and sleep patterns

which are normally seen altered in depressed patients (M. R. Guscott et al., 2003;

Hagan et al., 2000). In both of the forced swim test and tail suspension test,

pharmacological blockade of the 5-HT7 receptor or inactivation of the receptor gene

leads to an antidepressant-like behavioral profile (Bonaventure et al., 2007; M. Guscott,









Bristow, Hadingham, Rosahl, Beer, Stanton, Bromidge, Owens, Huscroft, Myers,

Rupniak, Patel, Whiting, Hutson, Fone, Biello, Kulagowski et al., 2005a; Hedlund,

Huitron-Resendiz, Henriksen, & Sutcliffe, 2005b; Wesolowska, Nikiforuk, Stachowicz, &

Tatarczynska, 2006). A drug originally believed to be selective for the 5-HT1A receptor,

8-OH-DPAT, was shown to act on the 5-HT7 receptor when inducing phase resetting

within the suprachiasmatic nucleus (SCN) of the hypothalamus (Ehlen, Grossman, &

Glass, 2001; Horikawa et al., 2000; Sprouse, Reynolds, Li, Braselton, & Schmidt, 2004).

Neuroimaging studies have shown that structural changes such as volumetric

reductions in the frontal cortex, amygdale, caudate and putamen, along with

concomitant increase in volume of the lateral ventricles are observed in depressed

patients (Sheline, 2003). Since disruptions to the sleep cycle is a form of chronic stress

which has been shown to suppress hippocampal neurogenesis (Hairston et al., 2005),

and decreases in REM sleep have been produced in mice using 5-HT7 receptor

antagonist (Hedlund, Huitron-Resendiz, Henriksen, & Sutcliffe, 2005a), the relationship

between 5-HT7 receptor and neurogenesis has been brought into discussion

(Kvachnina et al., 2005). The existing conflicting results about 5-HT7 receptor, such as

an increasing mRNA expression of this receptor as well as glucocorticoid levels in

restraint stress paradigm (Laplante, Diorio, & Meaney, 2002), and opposite effect in a

chemical adrenalectomy study (Yau, Noble, Widdowson, & Seckl, 1997), have revealed

our preliminary understanding of the complexity of this system and yet more in-depth

research into this area.

5.8 5-HT Receptor Agonist and Antagonist

Many of the effective or specific 5-HT receptor ligands have either been

discovered or synthesized, mediating 5-HT receptor subtypes and the whole 5-HT









system. 5-HT neurons show distinct function under receptor agonist or antagonist, many

of which have been widely utilized in preclinical and clinical studies, as listed in Table 5-

1.

5.9 Signal Transduction in 5-HT Receptor System

5-HT as a neurotransmitter exerts its function through relative subtypes of

receptors and diverse signaling pathways, which commonly involves second

messengers and other receptors. With the exception of the 5-HT3 receptor, a ligand-

gated ion channel, all other serotonin receptors are G protein-coupled receptors that

activate an intracellular second messenger cascade to produce an excitatory or

inhibitory response. G proteins, short for guanine nucleotide-binding proteins, are a

family of proteins involved in second messenger cascades. It carries information from

the cell surface to its target receptors, including adenylate cyclase (AC), phospholipase

C and ion channels. 5-HT increases the phosphorylation in DARPP-32, Thr34 (PKA)

and Ser137 (CK-1), and decreases the phosphorylation in Thr75 (Cdk5). DARPP-32 is

a dual functional protein, which works as an inhibitor of phosphatase (such as PP-1), as

well as an inhibitor of protein kinase (such as PKA); that is, DARPP-32 exerts its

bidirectional regulatory function in both phosphorylation and dephosphorylation, through

self-phosphorylation on different spots (A. Nishi, Snyder, & Greengard, 1997).

The 5-HT1 receptor subfamily is coupled to inhibitory pathways. Through the

biding to Gi protein it inhibits adenylyl cyclase and rapidly decreases cAMP level. They

are also coupled to stimulate phospholipase C and mitogen-activated protein kinase

(MAPK) growth signaling pathway (Noda, Higashida, Aoki, & Wada, 2004). 5-HT2

receptors increase the activity of casein kinase through activating Gq, PLC, followed by

PKA, and phosphorylating at Ser137. Studies show that Chronic stress impede the









cAMP-CREB signal transduction, inhibit CREB phosphorylation and decreases brain-

derived neurotrophic factor (BDNF) expression (Nair et al., 2007; Y. Xu et al., 2006). In

contrast, the 5-HT receptors that are positively coupled to adenylyl cyclase are a

heterogenous group, including the 5-HT4, 5-HT6, and 5-HT7 receptor subtypes. 5-HT4,

5-HT6, and 5-HT7 receptors mainly activates Gs and AC to boost cAMP dependent

protein kinase A, phosphorylation at Thr34 and CREB, and increases BDNF expression

and neurogenesis, which finally ameliorate the inhibition of learning and memory

caused by chronic stress.

In summary, chronic stress induces the hyperactivity of the HPA axis, elevates

the adrenal hormone levels in body, which further increases the glucocorticoid level and

impairs the 5-HT system function. High levels of glucocorticoids cause atrophy and

death in hippocampal neurons, which leads to inhibition in learning and memory in

patients with neuropsychological diseases. 5-HT plays a critical role in regulating CNS

diseases because of the large number of receptors locating in the limbic system. We

assume that relative agonists or antagonists of different 5-HT receptors exert it

protective or destructive function through various pathways. Research into the

relationship between different subtypes of 5-HT receptors and stress provides

theoretical backgrounds in drug development, clinical diagnosis and assessment of

clinical efficacy in the area of central nervous system disorders.

5.10 Future Directions

Current antidepressant drugs are mostly focusing on inhibiting the plasma

membrane transporters for serotonin and/or noradrenaline, such as SSRIs, SNRIs,

NRIs as well as MAOls. However, one of the major drawbacks of these medications is

that it takes at least several weeks for their antidepressant effects to become manifest.









Moreover, only about half of the depression patients show full remission to these

mechanisms and some of these medications put potential risks upon liver metabolism.

Thus studies focusing on other mechanisms such as CFR antagonist and 5-HT

receptors highly selective ligands provide new ideas for future antidepressant

development.









Table 5-1. 5-HT subreceptors agonist and antagonist
5-HT receptor Agonist
5-HT1A 8-OH-DAPT
5-HT1B Ergotamine
5-HT1D 5-(Nonyloxy)tryptamine
5-HT1E BRL-54443
5-HT1F LY-344
5-HT2A Ketanserin
5-HT2B a-Methyl-5-HT
5-HT2C a-Methyl-5-HT
5-HT3 2-methyl-5-HT
5-HT4 Cisapride
5-HT5A LSD
5-HT6 EMD-386088
5-HT7 5-CT/LP-44


Antagonist
WAY-100135
Risperidone
Yohimbine
Methiothepin
Methiothepin
APD-125
Yohimbine
Fluoxetine
Alosetron
GR-113
SB-699
SB-399885
SB-269970









LIST OF REFERENCES


Alfarez DN, De Simoni A, Velzing EH, Bracey E, Joels M, Edwards FA, Krugers HJ
(2009) Corticosterone reduces dendritic complexity in developing hippocampal
CA1 neurons. Hippocampus 19:828-836.

Bailey CP, Nicholls RE, Zhang X-l, Zhou Z-y, Muller W, Kandel ER, Stanton PK (2008)
Galpha(i2) inhibition of adenylate cyclase regulates presynaptic activity and
unmasks cGMP-dependent long-term depression at Schaffer collateral-CAl
hippocampal synapses. Learn Mem 15:261-270.

Barden N (1999) Regulation of corticosteroid receptor gene expression in depression
and antidepressant action. J Psychiatry Neurosci 24:25-39.

Benninghoff J, Gritti A, Rizzi M, Lamorte G, Schloesser RJ, Schmitt A, Robel S, Genius
J, Moessner R, Riederer P, Manji HK, Grunze H, Rujescu D, Moeller H-J, Lesch K-
P, Vescovi AL (2010) Serotonin depletion hampers survival and proliferation in
neurospheres derived from adult neural stem cells. Neuropsychopharmacology
35:893-903.

Bhagwagar Z, Rabiner EA, Sargent PA, Grasby PM, Cowen PJ (2004) Persistent
reduction in brain serotoninlA receptor binding in recovered depressed men
measured by positron emission tomography with [11C]WAY-100635. Mol
Psychiatry 9:386-392.

Bolanos-Jimenez F, Manhaes de Castro RM, Seguin L, Cloez-Tayarani I, Monneret V,
Drieu K, Fillion G (1995) Effects of stress on the functional properties of pre- and
postsynaptic 5-HT1B receptors in the rat brain. Eur J Pharmacol 294:531-540.

Bonaventure P, Kelly L, Aluisio L, Shelton J, Lord B, Galici R, Miller K, Atack J,
Lovenberg TW, Dugovic C (2007) Selective blockade of 5-hydroxytryptamine (5-
HT)7 receptors enhances 5-HT transmission, antidepressant-like behavior, and
rapid eye movement sleep suppression induced by citalopram in rodents. J
Pharmacol Exp Ther 321:690-698.

Burnham KE, Baxter MG, Bainton JR, Southam E, Dawson LA, Bannerman DM, Sharp
T (2010) Activation of 5-HT(6) receptors facilitates attentional set shifting.
Psychopharmacology (Berl) 208:13-21.

Butterweck V, Bockers T, Korte B, Wittkowski W, Winterhoff H (2002) Long-term effects
of St. John's wort and hypericin on monoamine levels in rat hypothalamus and
hippocampus. Brain Res 930:21-29.

Chaouloff F (1993) Physiopharmacological interactions between stress hormones and
central serotonergic systems. Brain Res Brain Res Rev 18:1-32.









Clark MS, Sexton TJ, McClain M, Root D, Kohen R, Neumaier JF (2002)
Overexpression of 5-HT1B receptor in dorsal raphe nucleus using Herpes Simplex
Virus gene transfer increases anxiety behavior after inescapable stress. J
Neurosci 22:4550-4562.

Clark MS, Vincow ES, Sexton TJ, Neumaier JF (2004) Increased expression of 5-HT1B
receptor in dorsal raphe nucleus decreases fear-potentiated startle in a stress
dependent manner. Brain Res 1007:86-97.

Company V, Zhou M, Grailhe R, Gazzara RA, Martin R, Gingrich J, Dumuis A, Brunner
D, Bockaert J, Hen R (2004) Attenuated response to stress and novelty and
hypersensitivity to seizures in 5-HT4 receptor knock-out mice. J Neurosci 24:412-
419.

Conductier G, Dusticier N, Lucas G, Cote F, Debonnel G, Daszuta A, Dumuis A,
Nieoullon A, Hen R, Bockaert J, Compan V (2006) Adaptive changes in serotonin
neurons of the raphe nuclei in 5-HT(4) receptor knock-out mouse. Eur J Neurosci
24:1053-1062.

Cremers TIFH, Giorgetti M, Bosker FJ, Hogg S, Arnt J, Mork A, Honig G, Bogeso K-P,
Westerink BHC, den Boer H, Wikstrom HV, Tecott LH (2004) Inactivation of 5-
HT(2C) receptors potentiates consequences of serotonin reuptake blockade.
Neuropsychopharmacology 29:1782-1789.

Cremers TIFH, Rea K, Bosker FJ, Wikstrom HV, Hogg S, Mork A, Westerink BHC
(2007) Augmentation of SSRI effects on serotonin by 5-HT2C antagonists:
mechanistic studies. Neuropsychopharmacology 32:1550-1557.

Croes S, Merz P, Netter P (1993) Cortisol reaction in success and failure condition in
endogenous depressed patients and controls. Psychoneuroendocrinology 18:23-
35.

Cryan JF, Leonard BE (2000) 5-HT1A and beyond: the role of serotonin and its
receptors in depression and the antidepressant response. Hum Psychopharmacol
15:113-135.

Cryan JF, Lucki I (2000) Antidepressant-like behavioral effects mediated by 5-
Hydroxytryptamine(2C) receptors. J Pharmacol Exp Ther 295:1120-1126.

Dawson LA, & Watson, J. M. (2009) ilazodone: A 5-HT1A receptor agonist/serotonin
transporter inhibitor for the treatment of affective disorders. CNS Neuroscience &
Therapeutics 15:107-117.

de Boer SF, Koolhaas JM (2005) 5-HT1A and 5-HT1B receptor agonists and
aggression: a pharmacological challenge of the serotonin deficiency hypothesis.
Eur J Pharmacol 526:125-139.










Ehlen JC, Grossman GH, Glass JD (2001) In vivo resetting of the hamster circadian
clock by 5-HT7 receptors in the suprachiasmatic nucleus. J Neurosci 21:5351-
5357.

Eriksson TM, Golkar A, Ekstrom JC, Svenningsson P, Ogren SO (2008) 5-HT7 receptor
stimulation by 8-OH-DPAT counteracts the impairing effect of 5-HT(1A) receptor
stimulation on contextual learning in mice. Eur J Pharmacol 596:107-110.

Fanselow MS, Poulos AM (2005) The neuroscience of mammalian associative learning.
Annu Rev Psychol 56:207-234.

Fukui M, Rodriguiz RM, Zhou J, Jiang SX, Phillips LE, Caron MG, Wetsel WC (2007)
Vmat2 heterozygous mutant mice display a depressive-like phenotype. J Neurosci
27:10520-10529.

Gasbarri A, Cifariello A, Pompili A, Meneses A (2008) Effect of 5-HT(7) antagonist SB-
269970 in the modulation of working and reference memory in the rat. Behav Brain
Res 195:164-170.

Goddard AW, Ball SG, Martinez J, Robinson MJ, Yang CR, Russell JM, Shekhar A
(2010) Current perspectives of the roles of the central norepinephrine system in
anxiety and depression. Depress Anxiety 27:339-350.

Gorski JA, Zeiler SR, Tamowski S, Jones KR (2003) Brain-derived neurotrophic factor is
required for the maintenance of cortical dendrites. J Neurosci 23:6856-6865.

Guscott M, Bristow LJ, Hadingham K, Rosahl TW, Beer MS, Stanton JA, Bromidge F,
Owens AP, Huscroft I, Myers J, Rupniak NM, Patel S, Whiting PJ, Hutson PH,
Fone KC, Biello SM, Kulagowski JJ, McAllister G (2005) Genetic knockout and
pharmacological blockade studies of the 5-HT7 receptor suggest therapeutic
potential in depression. Neuropharmacology 48:492-502.

Guscott MR, Egan E, Cook GP, Stanton JA, Beer MS, Rosahl TW, Hartmann S,
Kulagowski J, McAllister G, Fone KCF, Hutson PH (2003) The hypothermic effect
of 5-CT in mice is mediated through the 5-HT7 receptor. Neuropharmacology
44:1031-1037.

Hagan JJ, Price GW, Jeffrey P, Deeks NJ, Stean T, Piper D, Smith MI, Upton N,
Medhurst AD, Middlemiss DN, Riley GJ, Lovell PJ, Bromidge SM, Thomas DR
(2000) Characterization of SB-269970-A, a selective 5-HT(7) receptor antagonist.
Br J Pharmacol 130:539-548.

Hairston IS, Little MTM, Scanlon MD, Barakat MT, Palmer TD, Sapolsky RM, Heller HC
(2005) Sleep restriction suppresses neurogenesis induced by hippocampus-
dependent learning. J Neurophysiol 94:4224-4233.










Hedlund PB, Huitron-Resendiz S, Henriksen SJ, Sutcliffe JG (2005) 5-HT7 receptor
inhibition and inactivation induce antidepressantlike behavior and sleep pattern.
Biol Psychiatry 58:831-837.

Henry JP (1992) Biological basis of the stress response. Integr Physiol Behav Sci
27:66-83.

Hines LM, Tabakoff B (2005) Platelet adenylyl cyclase activity: a biological marker for
major depression and recent drug use. Biol Psychiatry 58:955-962.

Holmes A (2008) Genetic variation in cortico-amygdala serotonin function and risk for
stress-related disease. Neuroscience and Biobehavioral Reviews 32:1293-1314.

Horikawa K, Yokota S, Fuji K, Akiyama M, Moriya T, Okamura H, Shibata S (2000)
Nonphotic entrainment by 5-HT1A/7 receptor agonists accompanied by reduced
Perl and Per2 mRNA levels in the suprachiasmatic nuclei. J Neurosci 20:5867-
5873.

Illi A, Setala-Soikkeli, E., Viikki, M., Poutanen, O., Huhtala, H., Mononen, N. (2009) 5-
HTR1A, 5-HTR2A, 5-HTR6, TPH1 and TPH2 polymorphisms and major
depression. Neuroreport 20:1125-1128.

Joels M, Karst H, Alfarez D, Heine VM, Qin Y, van Riel E, Verkuyl M, Lucassen PJ,
Krugers HJ (2004) Effects of chronic stress on structure and cell function in rat
hippocampus and hypothalamus. Stress 7:221-231.

Jugloff DGM, Jung BP, Purushotham D, Logan R, Eubanks JH (2005) Increased
dendritic complexity and axonal length in cultured mouse cortical neurons
overexpressing methyl-CpG-binding protein MeCP2. Neurobiol Dis 19:18-27.

Kaiyala KJ, Vincow, E. S., Sexton, T. J., & Neumaier, J. F. (2009) 5-HT1B receptor
mRNA levels in dorsal raphe nucleus: Inverse association with anxiety behavior in
the elevated plus maze. Pharmacology, Biochemistry, and Behavior 75:769-776.

Kaneda Y (2009) Verbal working memory and functional outcome in patients with
unipolar major depressive disorder. World J Biol Psychiatry 10:591-594.

Kelly JP, Wrynn AS, Leonard BE (1997) The olfactory bulbectomized rat as a model of
depression: an update. Pharmacol Ther 74:299-316.

King MV, Marsden, C. A., & Fone, K. C. (2008) A role for the 5-HT(1A), 5-HT4 and 5-
HT6 receptors in learning and memory. Trends in Pharmacological Sciences
29:482-492.









Kitamura Y, Araki H, Gomita Y (2002) [Interaction of 5-HT and HPA axis in depression
and treatment-resistant depression]. Nippon Yakurigaku Zasshi 119:319-325.

Klaassen T, Riedel WJ, van Praag HM, Menheere PPCA, Griez E (2002)
Neuroendocrine response to meta-chlorophenylpiperazine and ipsapirone in
relation to anxiety and aggression. Psychiatry Res 113:29-40.

Konakchieva R, Mitev Y, Almeida OF, Patchev VK (1998) Chronic melatonin treatment
counteracts glucocorticoid-induced dysregulation of the hypothalamic-pituitary-
adrenal axis in the rat. Neuroendocrinology 67:171-180.

Kranenburg O, Poland M, van Horck FP, Drechsel D, Hall A, Moolenaar WH (1999)
Activation of RhoA by lysophosphatidic acid and Galpha12/13 subunits in neuronal
cells: induction of neurite retraction. Mol Biol Cell 10:1851-1857.

Kushwaha N, Albert PR (2005) Coupling of 5-HT1A autoreceptors to inhibition of
mitogen-activated protein kinase activation via G beta gamma subunit signaling.
Eur J Neurosci 21:721-732.

Kvachnina E, Liu, G. Q., Dityatev, A., Renner, U., Dumuis, A., Richter, D. W., (2005) 5-
HT7 receptor is coupled to G alpha subunits of heterotrimeric G12-protein to
regulate gene transcription and neuronal morphology. Journal of Neuroscience
25:7821-7830.

Laaris N, Le Poul E, Laporte AM, Hamon M, Lanfumey L (1999) Differential effects of
stress on presynaptic and postsynaptic 5-hydroxytryptamine-lA receptors in the
rat brain: an in vitro electrophysiological study. Neuroscience 91:947-958.

Lai MK, Tsang SW, Alder JT, Keene J, Hope T, Esiri MM, Francis PT, Chen CP (2005)
Loss of serotonin 5-HT2A receptors in the postmortem temporal cortex correlates
with rate of cognitive decline in Alzheimer's disease. Psychopharmacology (Berl)
179:673-677.

Lalmansingh AS, Uht RM (2008) Estradiol regulates corticotropin-releasing hormone
gene (crh) expression in a rapid and phasic manner that parallels estrogen
receptor-alpha and -beta recruitment to a 3',5'-cyclic adenosine 5'-monophosphate
regulatory region of the proximal crh promoter. Endocrinology 149:346-357.

Lanctot KL, Herrmann N, Rothenburg LS (2008) Commentary: Abeta(1-42) injection
causes memory impairment, lowered cortical and serum BDNF levels, and
decreased hippocampal 5-HT2A levels. Exp Neurol 212:251-254.

Lanfumey L, Mongeau R, Cohen-Salmon C, Hamon M (2008) Corticosteroid-serotonin
interactions in the neurobiological mechanisms of stress-related disorders.
Neurosci Biobehav Rev 32:1174-1184.









Lanfumey L, Pardon MC, Laaris N, Joubert C, Hanoun N, Hamon M, Cohen-Salmon C
(1999) 5-HT1A autoreceptor desensitization by chronic ultramild stress in mice.
Neuroreport 10:3369-3374.

Laplante P, Diorio J, Meaney MJ (2002) Serotonin regulates hippocampal glucocorticoid
receptor expression via a 5-HT7 receptor. Brain Res Dev Brain Res 139:199-203.

Le Poul E, Laaris N, Hamon M, Lanfumey L (1997) Fluoxetine-induced desensitization
of somatodendritic 5-HT1A autoreceptors is independent of glucocorticoid(s).
Synapse 27:303-312.

LeDoux J (2007) The amygdala. Curr Biol 17:868-874.

Lee TTY, Redila VA, Hill MN, Gorzalka BB (2009) 5-HT(2A) receptor mediated neuronal
activation within the paraventricular nucleus of the hypothalamus is desensitized
following prolonged glucocorticoid treatment. Eur J Pharmacol 602:54-57.

Lendahl U, McKay RD (1990) The use of cell lines in neurobiology. Trends Neurosci
13:132-137.

Leonard BE (2005) The HPA and immune axes in stress: The involvement of the
serotonergic system. The Journal of the Association of European Psychiatrists
20:302-306.

Lesch KP, Mayer, S., Disselkamp-Tietze, J., Hoh, A., Wiesmann, M., Osterheider, M.
(1990) 5-HT1A receptor responsivity in unipolar depression. evaluation of
ipsapirone-induced ACTH and cortisol secretion in patients and controls. Biological
Psychiatry 28:620-628.

Lesch KP, & Gutknecht, L. (2005) Pharmacogenetics of the serotonin transporter.
Progress in Neuro-Psychopharmacology & Biological Psychiatry 29:1062-1073.

Li Q, Wichems CH, Ma L, Van de Kar LD, Garcia F, Murphy DL (2003) Brain region-
specific alterations of 5-HT2A and 5-HT2C receptors in serotonin transporter
knockout mice. J Neurochem 84:1256-1265.

Li Y, Maher P, Schubert D (1997) A role for 12-lipoxygenase in nerve cell death caused
by glutathione depletion. Neuron 19:453-463.

Li Y-C, Wang F-M, Pan Y, Qiang L-Q, Cheng G, Zhang W-Y, Kong L-D (2009)
Antidepressant-like effects of curcumin on serotonergic receptor-coupled AC-
cAMP pathway in chronic unpredictable mild stress of rats. Prog
Neuropsychopharmacol Biol Psychiatry 33:435-449.









Lin D, & Parsons, L. H. (2002) Anxiogenic-like effect of serotonin(1 B) receptor
stimulation in the rat elevated plus-maze. Pharmacology, Biochemistry, and
Behavior 71:581-587.

Liu J, Li L, Suo WZ (2009) HT22 hippocampal neuronal cell line possesses functional
cholinergic properties. Life Sci 84:267-271.

Lopez-Gimenez JF, Tecott LH, Palacios JM, Mengod G, Vilaro MT (2002) Serotonin 5-
HT (2C) receptor knockout mice: autoradiographic analysis of multiple serotonin
receptors. J Neurosci Res 67:69-85.

Lucas G, Rymar, V. V., Du, J., Mnie-Filali, O., Bisgaard, C., Manta, S. (2007)
Serotonin(4) (5-HT(4)) receptor agonists are putative antidepressants with a rapid
onset of action. Neuron 55:712-725.

Lucas JJ, & Hen, R. (1995) New players in the 5-HT receptor field: Genes and
knockouts. Trends in Pharmacological Sciences 16:246-252.

Lupien SJ, de Leon M, de Santi S, Convit A, Tarshish C, Nair NP, Thakur M, McEwen
BS, Hauger RL, Meaney MJ (1998) Cortisol levels during human aging predict
hippocampal atrophy and memory deficits. Nat Neurosci 1:69-73.

Martin P (1991) 1-(2-pyrimidinyl)-piperazine may alter the effects of the 5-HT1A agonist
in the learned helplessness paradigm in rats. Psychopharmacology (Berl)
104:275-278.

Matsumoto M, Togashi H, Mori K, Ueno K, Ohashi S, Kojima T, Yoshioka M (2001)
Evidence for involvement of central 5-HT(4) receptors in cholinergic function
associated with cognitive processes: behavioral, electrophysiological, and
neurochemical studies. J Pharmacol Exp Ther 296:676-682.

Meneses AM (2007) Stimulation of 5-HT1A, 5-HT1 B, 5-HT2A/2C, 5-HT3 and 5-HT4
receptors or 5-HT uptake inhibition: Short- and long-term memory. Behavioural
Brain Research 184:81-90.

Miner LAH, Backstrom JR, Sanders-Bush E, Sesack SR (2003) Ultrastructural
localization of serotonin2A receptors in the middle layers of the rat prelimbic
prefrontal cortex. Neuroscience 116:107-117.

Mitchell ES, & Neumaier, J. F. (2005) 5-HT6 receptors: A novel target for cognitive
enhancement. Pharmacology & Therapeutics 108:320-333.

Moret C, & Briley, M. (2000) The possible role of 5-HT(1B/D) receptors in psychiatric
disorders and their potential as a target for therapy. European Journal of
Pharmacology 404:1-12.









Moret C, Briley M (1997) 5-HT autoreceptors in the regulation of 5-HT release from
guinea pig raphe nucleus and hypothalamus. Neuropharmacology 36:1713-1723.

Morikawa H, Manzoni OJ, Crabbe JC, Williams JT (2000) Regulation of central synaptic
transmission by 5-HT(1B) auto- and heteroreceptors. Mol Pharmacol 58:1271-
1278.

Nair A, Vadodaria KC, Banerjee SB, Benekareddy M, Dias BG, Duman RS, Vaidya VA
(2007) Stressor-specific regulation of distinct brain-derived neurotrophic factor
transcripts and cyclic AMP response element-binding protein expression in the
postnatal and adult rat hippocampus. Neuropsychopharmacology 32:1504-1519.

Nayyar T, Bubser M, Ferguson MC, Neely MD, Shawn Goodwin J, Montine TJ, Deutch
AY, Ansah TA (2009) Cortical serotonin and norepinephrine denervation in
parkinsonism: preferential loss of the beaded serotonin innervation. Eur J Neurosci
30:207-216.

Nishi A, Snyder GL, Greengard P (1997) Bidirectional regulation of DARPP-32
phosphorylation by dopamine. J Neurosci 17:8147-8155.

Nishi M, Whitaker-Azmitia PM, Azmitia EC (1996) Enhanced synaptophysin
immunoreactivity in rat hippocampal culture by 5-HT 1A agonist, S100b, and
corticosteroid receptor agonists. Synapse 23:1-9.

Noda M, Higashida H, Aoki S, Wada K (2004) Multiple signal transduction pathways
mediated by 5-HT receptors. Mol Neurobiol 29:31-39.

Owe-Larsson B, Chaves-Olarte E, Chauhan A, Kjaerulff O, Brask J, Thelestam M,
Brodin L, Low P (2005) Inhibition of hippocampal synaptic transmission by
impairment of Ral function. Neuroreport 16:1805-1808.

Paaver M, Nordquist N, Parik J, Harro M, Oreland L, Harro J (2007) Platelet MAO
activity and the 5-HTT gene promoter polymorphism are associated with
impulsivity and cognitive style in visual information processing.
Psychopharmacology (Berl) 194:545-554.

Perez-Garcia G, Gonzalez-Espinosa C, Meneses A (2006) An mRNA expression
analysis of stimulation and blockade of 5-HT7 receptors during memory
consolidation. Behav Brain Res 169:83-92.

Porter RJ, Gallagher P, Watson S, Young AH (2004) Corticosteroid-serotonin
interactions in depression: a review of the human evidence. Psychopharmacology
(Berl) 173:1-17.

Raffa RB, & Codd, E. E. (1996) Lack of binding of acetaminophen to 5-HT receptor or
uptake sites (or eleven other binding/uptake assays). Life Sciences 59:PL37-40.










Ramanathan S, Glatt SJ (2009) Serotonergic system genes in psychosis of Alzheimer
dementia: meta-analysis. Am J Geriatr Psychiatry 17:839-846.

Reddy PH, Mani G, Park BS, Jacques J, Murdoch G, Whetsell W, Kaye J, Manczak M
(2005) Differential loss of synaptic proteins in Alzheimer's disease: implications for
synaptic dysfunction. J Alzheimers Dis 7:103-117.

Reines A, Cereseto M, Ferrero A, Sifonios L, Podesta MF, Wikinski S (2008)
Maintenance treatment with fluoxetine is necessary to sustain normal levels of
synaptic markers in an experimental model of depression: correlation with
behavioral response. Neuropsychopharmacology 33:1896-1908.

Restivo L, Roman F, Dumuis A, Bockaert J, Marchetti E, Ammassari-Teule M (2008)
The promnesic effect of G-protein-coupled 5-HT4 receptors activation is mediated
by a potentiation of learning-induced spine growth in the mouse hippocampus.
Neuropsychopharmacology 33:2427-2434.

Reynolds GP, Mason SL, Meldrum A, De Keczer S, Parnes H, Eglen RM, Wong EH
(1995) 5-Hydroxytryptamine (5-HT)4 receptors in post mortem human brain tissue:
distribution, pharmacology and effects of neurodegenerative diseases. Br J
Pharmacol 114:993-998.

Ribes D, Colomina MT, Vicens P, Domingo JL (2009) Impaired Spatial Learning and
Unaltered Neurogenesis in a Transgenic Model of Alzheimer's Disease after Oral
Aluminum Exposure. Curr Alzheimer Res.

Roberts AJ, Krucker T, Levy CL, Slanina KA, Sutcliffe JG, Hedlund PB (2004) Mice
lacking 5-HT receptors show specific impairments in contextual learning. Eur J
Neurosci 19:1913-1922.

Roberts C, Thomas DR, Bate ST, Kew JNC (2004) GABAergic modulation of 5-HT7
receptor-mediated effects on 5-HT efflux in the guinea-pig dorsal raphe nucleus.
Neuropharmacology 46:935-941.

Rosenzweig-Lipson S, Sabb A, Stack G, Mitchell P, Lucki I, Malberg JE, Grauer S,
Brennan J, Cryan JF, Sukoff Rizzo SJ, Dunlop J, Barrett JE, Marquis KL (2007)
Antidepressant-like effects of the novel, selective, 5-HT2C receptor agonist WAY-
163909 in rodents. Psychopharmacology (Berl) 192:159-170.

Ruchhoeft ML, Ohnuma S, McNeill L, Holt CE, Harris WA (1999) The neuronal
architecture of Xenopus retinal ganglion cells is sculpted by rho-family GTPases in
vivo. J Neurosci 19:8454-8463.

Sapolsky R (2003) Taming stress. Sci Am 289:86-95.









Sapolsky R, Brooke S, Stein-Behrens B (1995) Methodologic issues in studying
glucocorticoid-induced damage to neurons. J Neurosci Methods 58:1-15.

Sarkisyan G, Hedlund PB (2009) The 5-HT7 receptor is involved in allocentric spatial
memory information processing. Behav Brain Res 202:26-31.

Schmauss C (2003) Serotonin 2C receptors: Suicide, serotonin, and runaway RNA
editing. The Neuroscientist : A Review Journal Bringing Neurobiology, Neurology
and Psychiatry 9:237-242.

Sheline YI (2003) Neuroimaging studies of mood disorder effects on the brain. Biol
Psychiatry 54:338-352.

Sheriff S, Dautzenberg FM, Mulchahey JJ, Pisarska M, Hauger RL, Chance WT,
Balasubramaniam A, Kasckow JW (2001) Interaction of neuropeptide Y and
corticotropin-releasing factor signaling pathways in AR-5 amygdalar cells.
Peptides 22:2083-2089.

Smriga M, Torii K (2003) L-Lysine acts like a partial serotonin receptor 4 antagonist and
inhibits serotonin-mediated intestinal pathologies and anxiety in rats. Proc Natl
Acad Sci U S A 100:15370-15375.

Sprouse J, Reynolds L, Li X, Braselton J, Schmidt A (2004) 8-OH-DPAT as a 5-HT7
agonist: phase shifts of the circadian biological clock through increases in cAMP
production. Neuropharmacology 46:52-62.

Svenningsson P, Tzavara ET, Qi H, Carruthers R, Witkin JM, Nomikos GG, Greengard
P (2007) Biochemical and behavioral evidence for antidepressant-like effects of 5-
HT6 receptor stimulation. J Neurosci 27:4201-4209.

Uc EY, McDermott MP, Marder KS, Anderson SW, Litvan I, Como PG, Auinger P, Chou
KL, Growdon JC (2009) Incidence of and risk factors for cognitive impairment in an
early Parkinson disease clinical trial cohort. Neurology 73:1469-1477.

Veenstra-VanderWeele J, Anderson GM, Cook EH (2000) Pharmacogenetics and the
serotonin system: initial studies and future directions. Eur J Pharmacol 410:165-
181.

Vyas A, Mitra R, Shankaranarayana Rao BS, Chattarji S (2002) Chronic stress induces
contrasting patterns of dendritic remodeling in hippocampal and amygdaloid
neurons. J Neurosci 22:6810-6818.

Weisstaub NV, Zhou M, Lira A, Lambe E, Gonzalez-Maeso J, Hornung J-P, Sibille E,
Underwood M, Itohara S, Dauer WT, Ansorge MS, Morelli E, Mann JJ, Toth M,
Aghajanian G, Sealfon SC, Hen R, Gingrich JA (2006) Cortical 5-HT2A receptor
signaling modulates anxiety-like behaviors in mice. Science 313:536-540.










Wesolowska A (2008) The anxiolytic-like effect of the selective 5-HT6 receptor
antagonist SB-399885: the impact of benzodiazepine receptors. Eur J Pharmacol
580:355-360.

Wesolowska A, Nikiforuk A (2008) The selective 5-HT(6) receptor antagonist SB-
399885 enhances anti-immobility action of antidepressants in rats. Eur J
Pharmacol 582:88-93.

Wesolowska A, Nikiforuk A, Stachowicz K (2006) Potential anxiolytic and
antidepressant effects of the selective 5-HT7 receptor antagonist SB 269970 after
intrahippocampal administration to rats. Eur J Pharmacol 553:185-190.

Wesolowska A, Nikiforuk A, Stachowicz K, Tatarczynska E (2006) Effect of the selective
5-HT7 receptor antagonist SB 269970 in animal models of anxiety and depression.
Neuropharmacology 51:578-586.

Wong EH, Reynolds GP, Bonhaus DW, Hsu S, Eglen RM (1996) Characterization of
[3H]GR 113808 binding to 5-HT4 receptors in brain tissues from patients with
neurodegenerative disorders. Behav Brain Res 73:249-252.

Xie Z, Cahill ME, Penzes P (2010) Kalirin loss results in cortical morphological
alterations. Mol Cell Neurosci 43:81-89.

Xu T, Pandey SC (2000) Cellular localization of serotonin(2A) (5HT(2A)) receptors in
the rat brain. Brain Res Bull 51:499-505.

Xu Y, Ku B, Tie L, Yao H, Jiang W, Ma X, Li X (2006) Curcumin reverses the effects of
chronic stress on behavior, the HPA axis, BDNF expression and phosphorylation
of CREB. Brain Res 1122:56-64.

Yau JL, Noble J, Widdowson J, Seckl JR (1997) Impact of adrenalectomy on 5-HT6 and
5-HT7 receptor gene expression in the rat hippocampus. Brain Res Mol Brain Res
45:182-186.

Zhou JS, Li, L., Cao, X., Zhang, X. H., Li, W. H., & Li, Z. X. (2008) Effect of 5-HT and
postsynaptic 5-HT1 A on the mood and recognition of the repeated restraint
stress in rats. Journal of Central South UniversityMedical Sciences 33:305-311.

Zipkin ID, Kindt RM, Kenyon CJ (1997) Role of a new Rho family member in cell
migration and axon guidance in C. elegans. Cell 90:883-894.

Zucker M, Weizman, A., & Rehavi, M. (2005) Repeated swim stress leads to down-
regulation of vesicular monoamine transporter 2 in rat brain nucleus accumbens
and striatum. European Neuropsychopharmacology 15:199-201.









BIOGRAPHICAL SKETCH

Chong Zhang was born in 1985 in a physicians family, in Ningbo, China. At an

early age, she was introduced to in the impact of current medical technology, with which

she gradually developed her interest in biomedical research later in her academic study.

She grew up in Ningbo and graduated from Xiaoshi High School in 2001and earned the

Bachelor of Engineering degree later in Biopharmaceutical Engineering from Zhejiang

University of Technology in 2004. After that she continued with her master's study in

University of Florida Biomedical Engineering department, with a specialization in the

field of neuropharmacology under the mentorship of Dr. William Ogle. She earned the

Degree of Master of Science from University of Florida in the summer of 2010. Chong

intends to pursue further study in neuropsychopharmacology and contributes

fundamentals for the current pharmaceutical industry.





PAGE 1

1 CORTICOSTERONE INDUCED MORPHOLOGICAL CHANGES OF HIPPOCAMPAL AND AMYGDALOID CELL LINES ARE DEPENDENT ON 5 HT7 RECEPTOR RELATED SIGNAL PATHWAY By CHONG ZHANG A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLO RIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Chong Zhang

PAGE 3

3 To my Mom and Dad

PAGE 4

4 ACKNOWLEDGMENTS This project was accomplished within the range of one year, and my adviso r Dr. William Ogle has been providing me with all support and guidance that could never be replaced. Also I am deeply impressed by his profound academic knowledge and original understanding of high quality research, which has been and will always be positi vely impacting my further study and occupational life. I sincerely thank Dr. Ying Xu for bring me into the field of exploiting great interest while conducting steadfast research, as well as her brilliant ideas and problem solving techniques. I would like to thank all my labmates in Gene Dynamics Lab, Shan, Phil, Matt, Erin, Raj and Ling, for their kind assistance throughout the entire project.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 INTRODUCT ION ................................ ................................ ................................ .... 11 2 MATERIALS AND METHODS ................................ ................................ ................ 13 2.1 Materials ................................ ................................ ................................ ........... 13 2.2 Cell Culture ................................ ................................ ................................ ....... 13 2.3 Drug Treatment ................................ ................................ ................................ 14 2.4 Cell Viability ................................ ................................ ................................ ...... 14 2.5 mRNA Extraction and Real time Reverse Transcriptase (RT) PCR ................. 14 2.6 Image Collection and Data Analysis ................................ ................................ 15 2.7 Statistical Analysis ................................ ................................ ............................ 16 3 RESULTS ................................ ................................ ................................ ............... 17 3.1 Corticosterone Impairs Hippocampal and Amygdaloid Primary Cultures in a Dose and Time Dependent Manner ................................ ............................. 17 3. 2 The Influence of Corticosterone on 5 HT Receptors mRNA Expression in Primary Hippocampal and Amygdaloid Cultures ................................ ............ 17 3.3 Protective Effects of SB 269970 and LP 44 on HT 22 Cells and AR 5 Cell s Respectively From the Lesion Induced by Corticosterone ............................. 17 3.4 SB 26970 and LP 44 Modulation of Cell Morphology Against Corticosterone Toxicity ................................ ................................ ................................ ........... 18 3.5 SB 269970 and LP 44 Regulate Rho Family mRNA Changes Induced by Corticosterone in HT 22 Cells and AR 5 Cells ................................ ............... 18 3.6 The Effect of SB 269970 and LP 44 on Synaptic Marker s mRNA Expression in Corticosterone Treated HT 22 and AR 5 Cells ................................ ........... 19 4 DISCUSSION ................................ ................................ ................................ ......... 30 5 LITERATURE REVIEW: THE ROLE OF 5 HT SYSTEM IN STRESS AND DEPRESSION ................................ ................................ ................................ ........ 36 5.1 Introduction ................................ ................................ ................................ ....... 36 5.2 The 5 HT System ................................ ................................ .............................. 37

PAGE 6

6 5.3 5 HT 1 Receptors ................................ ................................ ............................... 40 5.3.1 5 HT 1A Receptor ................................ ................................ .................... 40 5.3.2 5 HT 1B Receptor ................................ ................................ .................... 41 5.4 5 HT 2 Receptors ................................ ................................ ............................... 42 5.4.1 5 HT 2A Receptor ................................ ................................ .................... 42 5.4.2 5 HT 2C Receptor ................................ ................................ .................... 43 5.5 5 HT 4 Receptors ................................ ................................ ............................... 43 5.6 5 HT 6 Receptors ................................ ................................ ............................... 44 5.7 5 HT 7 Receptors ................................ ................................ ............................... 45 5.8 5 HT Receptor Agonist and Antagonist ................................ ............................. 46 5.9 Signal Transduction in 5 HT Receptor System ................................ ................. 47 5. 10 Future Directions ................................ ................................ ............................. 48 LIST OF REFERENCES ................................ ................................ ............................... 51 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 62

PAGE 7

7 LIST OF TABLES Table pa ge 3 1 Corticosterone induced 5 HT receptors mRNA expression in rat hippocampal and amygdaloid neruons by real time PCR ................................ ........................ 21 5 1 5 HT subreceptors agonist and antagonist ................................ ......................... 50

PAGE 8

8 LIST OF FIGURES Figure s page 3 1 CORT i mpairs cell viability of primary cell cultures in a conc entration and time dependent manner ................................ ................................ .................... 22 3 2 C ORT impairment of HT 22 cultures cell viability and the effect of SB 269970 .. 23 3 3 C ORT impairment of AR 5 cultures cell viability and the effect of LP 44 ............ 23 3 4 HT 22 cell morphological changes. ................................ ................................ .... 24 3 5 AR 5 ce ll morphological changes.. ................................ ................................ ..... 25 3 6 Effect of SB 269970 on Rho family small GTPase mRNA expression in HT 22 cells ................................ ................................ ................................ ............... 26 3 7 Effect of LP 44 on Rho family small GTPase mRNA expression in AR 5 cells ... 27 3 8 Effect of SB 269970 on synaptic protein mRNA expression in HT 22 cells ........ 28 3 9 Effect of LP 44 on synaptic protein mRNA expression in AR 5 cells. ................. 29

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Req uirements for the Degree of Master of Science CORTICOSTERONE INDUCED MORPHOLOGICAL CHANGES OF HIPPOCAMPAL AND AMYGDALOID CELL LINES ARE DEPENDENT ON 5 HT7 RECEPTOR RELATED SIGNAL PATHWAY By Chong Zhang August 2010 Chair: William Ogle Major: Biomedical E ngineering Stress is an unavoidable life experience that can disturb emotional and cognitive processes, and neuroplasticity. This study observed two aspects of how stress hormone affects the hippocampus and amygdala. Firstly, we investigated whether admin istration of corticosterone to hippocampal and amygdaloid cell lines induced different changes in 5 HT sub receptors. Secondly, we tested whether stress induced morphological changes in these two cell lines are involved in the 5 HT sub receptors expression We now show, using HT 22 and AR 5 cell lines, that 5 HT 7 receptor mRNA is sig nificantly up regulated in HT 22 cells, but down regulated in AR 5 cells by exposure to stress HT 7 antagonist SB 269970 and agonist LP 44 reversed corticosterone induced cell lesion in a dose dependent manner in HT 22 and AR 5 cells, respectively. Moreover, corticosterone induced different changes of dendritic length in HT 22 and AR 5 cells were also reversed by pretreatment with SB 269970 and LP 44. These results support the hypothesis t hat serotonin may differentially modulate neuronal morphology in

PAGE 10

10 hippocampus and amygdala depending on the expression levels of the 5 HT sub receptors during stress hormone attacks.

PAGE 11

11 CHAPTER 1 INTRODUCTION Stress may be described as any environmental cha nge, either internal or external, that disturbs the maintenance on homeostasis (Leonard, 2005) The stress response is to maintain homeostasis, which includes a series of physiological reactions such as modulation of neuroplasticity (limbic system), endocrine activation (especially of the hypothalamic pituitary adrenal axis, HPA axis), and cardiovascular changes (Sapolsky, 2003) The central feature of the limbic HPA stress resp onse is the synthesis and the secretion of glucocorticoids from the adrenal cortex. The excessive stress hormone which is associated with a decreased sensitivity to HPA axis feedback inhibition by cortisol in primates or corticosterone in rodents. In addition to the HPA axis, brain neuronal systems, including the monoaminergic systems and in particular the serotonin (5 HT) containing neuronal one, play critical roles in s tress related disorders (Lanfumey, Mongeau, Cohen Salmon, & Hamon, 2008; Y. Xu et al., 2006) Numerous data have demonstrated the existence of reciprocal interactions between the central serotonin sys tem and HPA axis in stress related depression, in which dysfunction of both the 5 HT and its sub receptors and HPA axis have been evidenced (Kitamura, Araki, & Gomita, 2002) The hippocampus and the amygdala are ess ential components of the neural circuitry mediating stress responses. The hippocampus is critical in its role controlling the limbic HPA axis, mood and memory through excitatory inputs. Changes within this structure, synaptic loss and atrophy, is known to involve in prolonged elevated glucocorticoid levels, major depression and cognitive impairment (Lupien et al., 1998)

PAGE 12

12 The amygdala is responsible for the detection of an environmental stressor (or threat) and control s the expression of the fear reaction, including behavioral, autonomic and endocrine responses via projects to downstream areas, such as hypothalamus and central gray, which in turn regulate the secretion of neurotransmitters, corticotropin releasing hormo ne (CRH) and glucocorticoids (Fanselow & Poulos, 2005) (Rodrigues et al., 2009). However, recent studies show that enhanced hippocampal input would suppress the HPA axis, while enhanced amygdaloid input could have the opposite effect on HPA activity (Vyas, Mitra, Shankaranarayana Rao, & Chattarji, 2002) In rodents, corticosterone reduces response to serotonin in the hippocampus, which could contribute to the onset of symptoms of d epression in predisposed individuals (Joels et al., 2004) But the amygdala activation leads to an increase in arousal and vigilance in response to the fear reaction after stress, which result in the release of neurotra nsmitters (5 HT, noradrenaline and dopamine) and their sub receptors change (LeDoux, 2007; Leonard, 2005) In view of the potentially contrasting impact of stress hormone on the hippocampus and a mygdala at the behavioral level and neuroendocrine mechanism, it is important to study the molecular mechanism underlying how the stress hormone affects the hippocampal and amygdaloid neurons function when they are exposed to the stress hormone. Therefore, the present study was designed to investigate the morphological changes of hippocampal and amygdaloid cell lines under corticosterone exposure. We also tested if the mechanism was dependent on 5 HT sub receptors and related signal pathway.

PAGE 13

13 CHAPTER 2 MATE RIALS AND METHODS 2.1 Materials HT 22 cells were a generous gift from Dr. David Schubert (The Salk Institute for Biological Studies, La Jolla, CA, USA) (Y. Li, Maher, & Schubert, 1997) AR 5 cells were kindly provided by D r. Rosalie Uht (University of North Texas Health Science Center, Fort Worth, TX, USA) (Lalmansingh & Uht, 2008) Culture plates were acquired from Nunc (A/S, Roskilde, Denmark). DMEM/F12 media were bought from Hy clone (Logan, UT). NeuroBasal medium, fetal Bovine Serum (FBS) and N2 nutrient supplement were from Invitrogen (Carlsbad, CA). Corticosterone was purchased from Sigma Chemical Co. (St. Louis, MO). MTT assay was obtained from Biotium, Inc. (Hayward, CA). 5 HT 1A receptor antagonist, NAN 190 (1 (2 methoxyphenyl) 4[ (2 phthalimido)butyl]piperazine), 5 HT 7 receptor agonist, LP 44 ((4 [2 (Methylthio)phenyl] N (1,2,3,4 tetrahydro 1 naphthalenyl) 1 piperazinehexanamide)) and antagonist SB 269970 ((2R) 1 [(3 Hydroxy phenyl)sulfonyl] 2 (2 (4 methyl 1 piperidinyl)ethyl)pyrrolidine) were purchased from Tocris (Avonmouth, UK). Other routine cell culture supplies and reagents were from Sigma, Invitrogen or Fisher. 2.2 Cell Culture HT supplied with 10% FBS, and grown at 37 in 5% CO 2 and differentiated in NeuroBasal medium containing 1 N2 supplement for 12h before treatment. AR 5 cells were cultured in DMEM/F12 media as described previously (Lalmansingh & Uht, 2008) and differentiated the same way as HT 22 were differentiated. Cells were plated at 10 5 /ml

PAGE 14

14 for MTT experiment and mRNA extraction, 510 4 /ml for cell morphology tests. All treatments were performed i n the differentiation media. 2.3 Drug Treatment Corticosterone, 5 HT 7 receptor antagonist SB 269970 and agonist LP 44 were dissolved in dimethyl sulfoxide (DMSO), NAN 190 in ethanol and respectively, the vehicle concentrations did not exceed 0.1% of the t otal volume in the cell culture well. SB 269970 and LP 44 were added 2h before corticosterone application (doses and treatment schedules were presented in the results of each experiment), and cells were pretreated with NAN 44 was used 2.4 Cell Viability Cell viability was assessed by 3 (4,5 dimethylthiazol 2 yl) 2,5 diphenyl tetrazolium bromide (MTT) assay based on the kit protocol. Briefly, 12 hr after differentiation on 96 well plates, cells were treated with corticosterone and/or other protective reagents at MTT solution was added to each well and incubated for another 3 hr. The dark blue formazan crystals formed in intact cells were dissolved with 200l DMSO/well and absorbance at was measured using Synergy Multi mode Microplate Reader (BioTek, USA). 2.5 mRNA Extraction and Real time Reverse Transcriptase (RT) PCR Cultures were washed and total cellular RNA was isolated with TriZOL reagent (T riZOL R PCR, 600ng total RNA was reverse transcribed using MJ Mini TM Gradient Thermal Cycler (Bio Rad, Hercules CA, USA) and PCR reaction was performed using iCycler Real Time PCR machine (Bio Rad, Hercules CA, USA). After cDNA synthesis, a PCR mixture

PAGE 15

15 containing 50% v/v per sample of SYBER Green (iQ SYBER Green Supermix reagent, Bio CGTGCGTGACATTAAAGAG GCCACAGGATTCCATACC TAT TGAAGTGGACGGGAAGC ACTATCAGGGCTGTCGATGG GGGAACAAGAGCAAGTCTGC CGATTCCCGTTCTCCTTCTA TTGTTGGTGATGGTGCTGTT TCTCAGGCACCCACTTTTCT CCCCCTTTTCCCATATCCTA AGGTCTGGTTCCCTTCCTGT 43 CGTGCGTGACATTAAAGAG GGCATTTCCTTAGGTTTTGGT AGTCCTCACCAAACCCTCCT TGGACCTCACTTCCTCTGCT were amplified in the iCycler real time PCR machine followed by melt curve analysis and gel electrophoresis to verify specificity and purity of product. All the data were actin. 2.6 Image Collection and Data Analysis Images were collected in a blinded manner using a Zeiss LSM510 Pascal confocal microscope (Carl Zeiss imaging systems, Germany). A stack of images was taken using a 20 objective and total lengths of neurite outgrowth were measured. Randomly selected HT 22 or AR 5 cells from each group were excluded if precise tracing was deemed to be questionable due to extensive overlapping with processes originating from analysis or if their morphology was not intact and possessed membrane varicosities. Fewer than 5% of the randomly selected neurons met one or more of these exclusion criteria. Digitized images were assembled off line using Photoshop 7.0 software (Adobe Systems, Mountainview, CA) and used for analyses without further manipulation (Jugloff, Jung, Purushotham, Logan, & Eubanks, 2005) Ten cells of each

PAGE 16

16 group from at least two separate experiments were analyzed (Xie, Cahill, & Penzes, 2010) 2.7 Statistical Analysis All data were presented as mean standard error of the mean (SEM). One way analysis of variance ( ANOVA) followed by a LSD test was used for statistical evaluation. Statistical significance was set at p < 0.05.

PAGE 17

17 CHAPTER 3 RESULTS 3.1 Corticosterone Impairs Hippocampal and Amygdaloid Primary Cultures in a Dose and Time Dependent Manner The ceoncentr ation and time course of corticosterone caused cytotoxicity were test in hippocampal and amygdaloid primary cultures with MTT assay. Primary neurons were seeded at a density of 10 6 /ml in 0.1% (w/v) poly L lysine coated dishes. Corticosterone treatment at higher than 10M for 24 hr caused significant cytotoxicity in the above two types of primary cultures (p<0.01) (Fig. 1A, B, C and D). 3.2 The Influence of Corticosterone on 5 HT Receptors mRNA Expression in Primary Hippocampal and Amygdaloid Cultures Dysfu nction of the 5 HT system is present in stress related depression and anxiety. The present study investigated the influence of stress levels of corticosterone (10 M) on seven types of 5 HT receptors, which are closely involved in stress related mood disor ders (Table 1). Results show that for hippocampus, 5 HT 1A 5 HT 2A and 5 HT 4 and 5 HT 7 receptor mRNAs were significantly increased after corticosterone exposure for 24h (p<0.05 vs. vehicle treated group without corticosterone, respectively). For amygdala, 5 HT 1A 5 HT 2B, 5 HT 4, 5 HT 6 receptor mRNA was shown to increase following exposure to corticosterone, but 5 HT 7 mRNA was shown to decrease significantly (p<0.05 vs. vehicle treated group). 3.3 Protective Effects of SB 269970 and LP 44 on HT 22 Cells and A R 5 Cells Respectively From the Lesion Induced by Corticosterone HT 22 cells were exposed to 6.25, 12.5, 25, 50, 100M corticosterone, and cell survival was quantified by MTT assay. Cell viability was markedly reduced after exposure to 50M corticosterone for 24 hr (p<0.01) (Fig. 2A). Pretreatment of HT 22 cells with 2.5, 5, 10M SB 269970 could dose dependently protect against the cell

PAGE 18

18 lesion induced by 50M corticosteronn. The effect was significant at 5 and 10 M (p<0.05 and p<0.01) (Fig. 2B). AR 5 cell survival was significantly at 50M corticosterone for 24 hr (p<0.01) and the effect was reversed dose dependently by LP 44 markedly at 0.1 and 0.2M (p<0.01) (Fig. 3A and B). 3.4 SB 26970 and LP 44 Modulation of Cell Morphology Against Corticosterone Toxi city Corticosteone has been proved to cause not only cell toxicity but also cell morphology. Firstly, differentiating HT 22 and AR 5 cells are morphologically different from proliferating cells, as they have less cell densities and longer neurite outgrowt h (Fig. 4A and B, Fig. 5A and B). The results also showed significant reductions in total length of cell neurite outgrowth of HT 22 cells and increment in AR 5 cells respectively in corticosterone treated groups (Fig. 4C and E; Fig. 5C and E). These result s were reversed by SB 269970 on HT 22 cells and LP 44 on AR 5 cells (Fig. 4D and E; Fig 5D and E). 3.5 SB 269970 and LP 44 Regulate Rho Family mRNA Changes Induced by Corticosterone in HT 22 Cells and AR 5 Cells The Rho family genes are known to have impac t on cell morphology. To determine if SB 269970 reverse effect of corticosterone induced HT 22 cells morphological changes were dependent on Rho family small GTPase, Cdc 42, RhoA and Rac 1 mRNA levels were measured in the presence or absence of 50M cortic osterone, and also in the presence of 2.5, 5, 10M SB 269970. Cdc 42 and RhoA mRNA levels were increased about 1.5 and 3 fold respectively in HT 22 cells, following exposure to 50M corticosterone for 24 hr (p<0.01 and p<0.05 versus vehicle treated groups ). These increases in mRNA levels were prevented by treating the cells with SB 269970 2 hr prior to corticosterone exposure, and the reversing effects were significant at 10M for

PAGE 19

19 Cdc42 mRNA and 5, 10M for RhoA mRNA (Fig. 6A and B). Neither corticosterone nor SB 269970 had impact on Rac 1 mRNA expression (Fig. 6C). Similarly, 50 M corticosterone exposure markedly increase AR 5 cells Cdc 42 mRNA levels by 1.5 fold and RhoA mRNA levels by 1.4 Fold (p<0.05). And these effects were prevented by pretreatment o f AR 5 cells with 0.05, 0.1, 0.2M LP 44 2 hr prior to corticosterone, among which 0.2M LP 44 had significant effect (p<0.05 and p<0.01) (Fig. 7A and B). Rac 1 mRNA levels did not change either with corticosterone or LP 44 treatment (Fig. 7C). These resul ts show that SB 269970 and LP 44 can prevent HT 22 cells and AR 5 cells morphological changes induced by corticosterone through Cdc 42 and RhoA, but not Rac 1. 3.6 The Effect of SB 269970 and LP 44 on Synaptic Markers mRNA Expression in Corticosterone Tre ated HT 22 and AR 5 Cells Synaptic markers such as Synaptopodin, Gap 43 and Synaptophysin are usually mentioned in studies regarding neuroplasticity. In order to determine whether SB 22 cells toxicity and morphological changes involves these markers, mRNA levels of the three genes were detected using quantitative real time PCR. Synaptopodin mRNA levels were increased about fold in HT 22 cells after treatment with 50M corticosterone, and 10M SB 269970 significantly prevented this effect (p<0.05, p<0.05) (Fig. 8A). However, 50M corticosterone did not affect Gap 43 expression, while the use of SB 269970 still the other hand, Synaptopodin and synaptophysin levels were decreased with 50M corticosterone treatment on AR 5 cells (p<0.05), and LP 44 raised synaptopodin levels significantly at 0.2M (p<0.05 compared with vehicle group) (Fig. 9A), while only having

PAGE 20

20 an increasi ng trend on Synaptophysin (Fig. 9C). Similar to HT 22 cells, Gap 43 expression did not change in AR 5 cells with treatment of 50M corticosterone and LP 44 lifted its levels in an increasing trend (Fig. 9B).

PAGE 21

21 Table 3 1 Corticosterone induced 5 HT recep tors mRNA expression in rat hippocampal and amygdaloid neruons by real time PCR Target Genbank Position Hippocampus Amygdala RT PCR fold change P value RT PCR fold change P value 5 HT1A NM_012585 623 642 719 738 TGTTGCT CATGCTGGTTCTC CCGACGAAGTTCCTAAGCTG 1.92 <0.05 2.50 <0.05 5 HT1B NM_022225 502 521 593 612 CTGGTGTGGGTCTTCTCCAT GTAGAGGACGTGGTCGTGT 1.06 >0.05 1.55 <0.05 5 HT2A NM_017254 504 523 715 734 GCGATCTGGATTTACCTGGA CCCCTCCTTAAAGACCTTCG 2.62 <0.05 0.85 >0.05 5 H T2B NM_017250 466 485 601 620 GGAGAAAAGGCTGCAGTACG ATAACCAGGCAGGACACAGG 1.14 >0.05 0.71 >0.05 5 HT4 NM_012853 780 799 972 991 GAGACCAAAGCAGCCAAGAC AGGAAGGCACGTCTGAAAGA 3.00 <0.05 2.82 <0.05 5 HT6 NM_024365 110 119 296 315 ATCAGTACCCTCCCCAAAC GACTGGGTTGAG GACCAAGA 1.25 >0.05 1.56 <0.05 5 HT7 NM_022938 786 805 925 944 GGGCTCAGAATGTGAACGAT TGTGTTTGGCTGCACTCTTC 1.92 <0.05 0.49 <0.05

PAGE 22

22 Figure 3 1 Corticosterone (CORT) impairs cell viability of primary hippocampal and amy gdaloid cell cultures in a concentration and time dependent manner, measured by MTT assays. A) Primary hippocampal neurons were treated with various concentrations of CORT for 24 hr. B) Primary hippocampal neurons were treated with 10M CORT for the indi cated periods. C) Primary amygdaloid neurons were treated with various concentrations of CORT for 24 hr. D) Primary amygdaloid neurons were treated with 10M CORT for the indicated periods. Results are expressed as mean SEM from at least three independen t experiments (*p<0.05; **p<0.01; ***p<0.001 versus controls).

PAGE 23

23 Figure 3 2 Corticosterone impairment of HT 22 cultures cell viability and the reverse effect of SB 269970 against it, measured by MTT assay. A) HT 22 cells were treated with indicated concentrations of CORT for 24 hr. B) SB 269970 protected HT 22 cells against CORT induced decrease in cell viability dose dependently. Results are expressed as mean SEM from at least three independent experiments (*, p<0.05; **, p<0.01; ***, p<0.001 as c ompared with controls by one way ANOVA. #, p<0.05; ##, p<0.01; ###, p<0.001 as compared with corticosterone treated group by one way ANOVA). Figure 3 3 Corticosterone impairment of AR 5 cultures cell viability and the reverse effect of LP 44 against it, measured by MTT assay. A) AR 5 cells were treated with indicated concentrations of CORT for 24 hr. B) LP 44 protected HT 22 cells against CORT induced decrease in cell viability dose dependently. Results are expressed as mean SEM from at least three independent experiments (*, p<0.05; **, p<0.01; ***, p<0.001 as compared with controls by one way ANOVA. #, p<0.05; ##, p<0.01; ###, p<0.001 as compared with corticosterone treated group by one way ANOVA).

PAGE 24

24 Figure 3 4 HT 22 cell morphological changes in proliferation, differentiation and corticosterone/SB 269970 treated conditions. A) Proliferating HT 22 cells at 3 day of cultrue. B) Differenitating HT 22 cells at 3 day of culture. C) HT 22 cells treated with 50M corticosterone for 24 hr. D) HT 22 cells treated with 5M SB 269970 prior to 50M corticosterone. E) Quantification of HT 22 cells neurite outgrowth treated with corticosterone or SB 269970.

PAGE 25

25 Figure 3 5 AR 5 cell morphological changes in proliferation, differentiation and corticosterone/LP 44 treated conditions. A) Proliferating AR 5 cells at 3 day of cultrue. B) Differenitating AR 5 cells at 3 day of culture. C) AR 5 cells treated with 50M corticosterone for 24 hr. D) AR 5 cells treated with 0.2M LP 44 prior to 50M cor ticosterone. E) Quantification of AR 5 cells neurite outgrowth treated with corticosterone or LP 44.

PAGE 26

26 Figure 3 6 Effect of SB 269970 on Rho family small GTPase mRNA expression in corticosterone treated HT 22 cells, measured with quantitative real t ime PCR. A) SB 269970 reverses corticosterone induced Cdc 42 mRNA fold change in a dose dependent manner. B) SB 269970 reverses corticosterone induced RhoA mRNA fold change in a dose dependent manner. C) Effects of corticosterone and SB 269970 on Rac 1 mRN A expression. Results are expressed as mean SEM, n=6 (*, p<0.05; **, p<0.01 as compared with controls by one way ANOVA. #, p<0.05; ##, p<0.01 as compared with the corticosterone treated group by one way ANOVA).

PAGE 27

27 Figure 3 7 Effect of LP 44 on Rh o family small GTPase mRNA expression in corticosterone treated AR 5 cells, measured with quantitative real time PCR. A) LP 44 reverses corticosterone induced Cdc 42 mRNA fold change in a dose dependent manner. B) LP 44 reverses corticosterone induced RhoA mRNA fold change in a dose dependent manner. C) Effects of corticosterone and LP 44 on Rac 1 mRNA expression. Results are expressed as mean SEM, n=6 (*, p<0.05; **, p<0.01 as compared with controls by one way ANOVA. #, p<0.05; ##, p<0.01 as compared wit h corticosterone treated group by one way ANOVA).

PAGE 28

28 Figure 3 8 Effect of SB 269970 on synaptic protein mRNA expression in corticosterone treated HT 22 cells, measured with quantitative real time PCR. A) SB 269970 reverses corticosterone induced synapt opodin mRNA fold change in a dose dependent manner. B) Effects of corticosterone and SB 269970 on Gap 43 mRNA expression. Results are expressed as mean SEM, n=6 (*, p<0.05; **, p<0.01 as compared with controls by one way ANOVA. #, p<0.05; ##, p<0.01 as compared with corticosterone treated groupby one way ANOVA).

PAGE 29

29 Figure 3 9 Effect of LP 44 on synaptic protein mRNA expression in corticosterone treated AR 5 cells, measured with quantitative real time PCR. A) LP 44 reverses corticosterone i nduced synaptopodin fold change in a dose dependent manner. B) Effects of corticosterone and LP 44 on Gap 43 mRNA expression. C) Effects of corticosterone and LP 44 on synaptophysin mRNA expression. Results are expressed as mean SEM, n=6 (*, p<0.05; **, p<0.01 as compared with controls by one way ANOVA. #, p<0.05; ##, p<0.01 as compared with corticosterone treated group by one way ANOVA).

PAGE 30

30 CHAPTER 4 DISCUSSION This study investigated two aspects of how stress hormone affects the hippocampus and amygdala Firstly, we tested whether administration of corticosterone to hippocampal and amygdaloid cell lines induced different changes in 5 HT sub receptors. Secondly, we tested whether stress induced morphological changes in these two cell lines are involved in the 5 HT sub receptors expression. We now show, using HT 22 and AR 5 cell lines, that 5 HT 7 receptor mRNA is significantly up regulated in HT 22 cells, but down regulated in AR5 cells by exposure to stress level of corticosterone ment of cells with 5 HT 7 antagonist SB 269970 and agonist LP 44 reversed corticosterone induced cell lesion in a dose dependent manner in HT 22 and AR5 cells, respectively. Moreover, corticosterone induced different changes of dendritic complexity in HT 2 2 and AR 5 cells were also reversed by pretreatment with SB 269970 and LP 44. This 5 HT 7 sub receptor mRNA expression difference was confirmed by primary hippocampal and amygdaloid neuron cultures when they were exposed to corticosterone. In the present st udy, we focused our interest on two distinct brain regions, the hippocampus and amygdala. The involvement of these brain regions in emotional, motivational, and mnemonic processes may be related to stress related depression and dementia (Butterweck, Bockers, Korte, Wittkowski, & Winterhoff, 2002) It is interesting that Kelly et al. (Kelly, Wrynn, & Leonard, 1997) suggested that impaired hippocampal function and/or dendritic atr ophy may underlie memory deficits in stressed animals. In contrast, the pyramidal and stellate neurons of amygdala showed increased dendritic arborization (Vyas et al., 2002) This finding allows us to ask specific questi ons about

PAGE 31

31 the impact of glucocorticoids on brain regions and the molecular basis on this pathway. In the central nervous system, immortalized cell lines from various brain regions which retain parental cell characteristics have been generated from neuron/g lial precursors, astrocytes and microglia (Lendahl & McKay, 1990) HT 22 cells are immortalized mouse hippocampal neuronal precursor cells that were sub cloned from their parent HT 4 cells (Liu, Li, & Suo, 2009) The retroviral mediated transfer of the SV 40 large T antigen into rat embryonic amygdaloid cells has resulted in the production of an immortalized AR 5 cell line which is able to form stable monolayers in culture (Sheriff et al., 2001) Both HT 22 and AR 5 cell lines are valuable models for better understanding the cellular and molecular processes relevant to the hippocampus and amygdala, respectively. Serotonin is an important neurotra nsmitter that exerts a wide influence over many brain functions through activating or inhibiting families and subtypes of its receptors. The interactions between HPA axis and the 5 HT system are of particular relevance when being subjected to stress, in wh ich dysfunctioning actually concerns both of these two systems (Barden, 1999; Lesch et al., 1990) Among the 14 known 5 HT receptor subtypes, 5 HT 7 sub receptor is one of the least well known Rece nt attention has been received mainly due to its pivotal role in the pathogenesis of depression and the involvement in specific aspects of hippocampus dependent contextual learning and memory processing (C. Roberts, Tho mas, Bate, & Kew, 2004) In situ hybridization study reveals 5 HT 7 sub receptor expression in cortex, hippocampus, amygdala and hypothalamus (M. Guscott, Bristow, Hadingham, Rosahl, Beer, Stanton, Bromidge, Owens, Husc roft, Myers, Rupniak, Patel, Whiting, Hutson, Fone, Biello, Kulagowski et al., 2005b) Animal study was shown that 5 HT 7 sub receptor mRNA was up regulated

PAGE 32

32 in the hippocampus, but not cortex in rats after exposure to chronic stress (Y. C. Li et al., 2009) Recent evidences have shown a synergistic interaction between individually ineffective doses of the selective antagonist SB 269970 and antidepressants in forced swim test with an increase in 5 HT levels in the frontal c ortex and hippocampus (Bonaventure et al., 2007; Wesolowska, Nikiforuk, & Stachowicz, 2006) In this study, in vitro HT 22 and AR 5 cell lines were tested to determine whether administratio n of corticosterone to them is related to changes in 5 HT sub receptors. We chose the concentration of corticosterone in vitro (50 M) that is equivalent to moderate to high stress levels in vivo (Sapolsky, Brooke, & Stein Behrens, 1995) Analyses by real time PCR in the present study revealed that 5 HT 7 sub receptor was up regulated in HT 22 cells, but it was down regulated in AR 5 cells. Subsequent cell viability test showed that 5 HT 7 antagonist SB 269970 and agoni st LP 44 reversed corticosterone induced cell lesion in HT 22 and AR 5 cells, respectively. This is the first time to get such an intriguing finding, which was also confirmed by hippocampal and amygdaloid neuron cultures in our study. These results imply t hat elevated corticosterone level may change some 5 HT receptor binding inculding 5 HT 7 sub receptor, which affects the neural circuitry as an indirect mechanism (Raffa & Codd, 1996) Dysfunction of neuronal plastici ty is exhibited during chronic stress and in patients with depression and likely occurs when the brain fails to induce the appropriate adaptive response or remodeling phenomena (Reines et al., 2008) Hippocampus is one of the most intensely studied structures in the stress inhibitory circuit, other limbic inputs, including amygdala have received less attention. Recent studies show that the hippocampus experienced synaptic loss and atrophy while the amygdala had increase d

PAGE 33

33 plasticity and synaptogenesis when rats subjected to chronic stress (Vyas et al., 2002) However, the sensitivities of hippocampal and amygdaloid neurons on stress hormone and 5 HT 7 sub receptor have not been described. Neuronal soma size has been correlated with increased neural activity (Gorski, Zeiler, Tamowski, & Jones, 2003) and since dendritic trees act as the postsynaptic sites of excitatory input in the mammalian brain, str uctural alterations in them must affect network function (Alfarez et al., 2009) The present study, which quantified soma size and total dendritic length showed decreased dendritic complexity of hippocampal and amyg daloid cells after corticosterone exposure. Restoration of synaptic plasticity, reflected by increased neuron complexities in the face of corticosterone cytotoxicity, were found in the presence of SB 269970 and LP 44 in HT 22 and AR 5 cell lines, respectiv ely. These results confirmed our hypothesis that regulation of synaptic function after glucocorticoid exposure was dependent on the amelioration of 5 HT neuronal function. Molecular downstream mechanisms underlying such opposite effects of stress hormone/5 HT sub receptor on neurite outgrowth are still poorly understood. Studies show that activation of the members of the Rho family of small GTPase (Rho, Rac 1 and Cdc 42) initiated pathway induces growth cone collapse and neurite retraction (Kranenburg et al., 1999; Kvachnina et al., 2005) Marked changes in morphology, motility and guidance of axons have been observed in response to activation of Rho family GTPases both in vitro and in vivo (Ruchhoeft, Ohnuma, McNeill, Holt, & Harris, 1999; Zipkin, Kindt, & Kenyon, 1997) We chose to focus our current study on Rho, Rac 1 and Cdc 42, which regulate cellular pathways involved in stres s hormone and presynaptic regulation in hippocampal neurons (Owe Larsson et al., 2005) The present

PAGE 34

34 findings suggest that there were significant increases in the levels of RhoA and Cdc 42 when the HT 22 and AR 5 c ells were exposed to corticosterone. These effects were prevented by SB 269970 in HT 22 cells and LP 44 in AR 5 cells, respectively. The results are agreement with the previous studies (Owe Larsson et al., 2005) a nd demonstrate that the 5 HT 7 sub receptor effectively communicates with Rho family when corticosterone exposure. As plasticity responsive elements, three synaptic markers including synaptophysin (presynaptic vesicle protein), Gap 43 (synaptic membrane pr otein) and synaptopodin (postsynaptic protein) are reported to be closely involved in neurotransmitter release and neuronal sprouting during stress (M. Nishi, Whitaker Azmitia, & Azmitia, 1996; Reddy et al., 2005) However, they were shown to differentially respond to stress hormone and antidepressant treatment in our study. The present findings suggested that there were significant increase in Synaptopodin levels in HT 22 cells after corticosterone exposure, and decreased Synaptopodin and Synaptophysin levels in AR 5 cells, which were either reversed by SB 269970 and LP 44 respectively or having a reversing trend. The most distinctive finding of the present study is the investigation that corticost erone induced different expression of 5 HT 7 receptor in HT 22 and AR 5 cell lines which were generated from hippocampal and amygdaloid neurons. These data were confirmed by primary neuron cultures. Moreover, the distinct cell viability and morphological ch anges in HT 22 and AR 5 cells were also involved in activation and/or inhibition of 5 HT 7 receptor and the related genes expression in these cells after corticosterone exposure. Our results support the hypothesis that serotonin may

PAGE 35

35 differentially modulate neuronal morphology in hippocampus and amygdala depending on the expression levels of the 5 HT sub receptors during stress hormone attacks.

PAGE 36

36 CHAPTER 5 LITERATURE REVIEW: THE ROLE OF 5 HT SYSTEM IN STRESS AND DEPRESSION 5.1 Introduction In the 1930s, it ha s been established that any environmental changes, whether internal or external, that disturbs the maintenance on homeostasis can cause stress response, including psychological, neuronal, endocrine and immune system reactivity (Leonard, 2005) Chronic stress or long term exposure to external stress hormone glucocorticosteroids induces the hyperactivity of the HPA axis (Hypothalamic Pituitary Adrenal axis), which produces an increase in plasma glucocorticoid level, and finally impairs the negative feedback mechanism, causing psychological disorders such as depression, anxiety and inhibition of learning and memory (Croes, Merz, & Netter, 1993; Henry, 1992) In nor mal physiological conditions, HPA axis and serotonergic system interact with each other to cross regulate body functions (Chaouloff, 1993) However, in stress conditions, serotonergic system exerts its self regulato ry functions. Pathological mechanisms of psychological disorders such as major depression that is caused by chronic stress has been implicated to be closely related to dysregulation of HPA axis, monoaminergic systems especially the 5 HT system (Barden, 1999; Porter, Gallagher, Watson, & Young, 2004) Serotonin (5 hydroxytryptamine, 5 HT) is an important neurotransmitter in the central nervous system (CNS). Through activating or inhibiting families and subtypes of its receptors, 5 HT has been demonstrated to have multiple physiological functions, and dysregulation of serotonergic system can cause stress related diseases such as (Goddard et al., 2010; Ramanathan & Glatt, 2009) Animal models of chronic stress have revealed that,

PAGE 37

37 the activation of HPA axis and elevated leve ls of adrenocortical hormone are the main chara c teristics of stress (Konakchieva, Mitev, Almeida, & Patchev, 1998) Limbic system is a set of brain structures including the hippocampus, amygdala, anterior thalamic nuclei, and limbic cortex, which creates a cl osed loop by embracing part of the two brain hemispheres and support a variety of functions including emotion, behavior, long term memory, and olfaction. A great amount of serotonergic neurons can be found in this system. Chronic stress leads to long term hyperactivity of HPA axis and elevated levels of glucocorticoids, causing impairment of brain regions in the limbic system, in conjunction with down regulation of HPA negative feedback control. Abnormality of monoaminergic neurotransmitter secretion and co ntinuous damage of neurons finally leads to cognitive dysfunction including gradual loss of the ability of learning and memory, which are the most important characteristics of affective disorders (e.g. anxiety, depression, schizophrenia) and neurodegenerat ive diseases (e.g. AD, (Kaneda, 2009; Ribes, Colomina, Vicens, & Domingo, 2009; Uc et al., 2009) 5.2 The 5 HT System 5 HT is an important neurotransmitter in the mature central nervous system. The neurons of the raphe nuclei are the major source of 5 HT release in the brain, and it projects upon many other regions of the brain, exerting its regulatory function of physiology. 5 HT expression in the developing r aphe nuclei neurons and the preferential generation of the nerve fiber projecting terminals during the formation of neuronal synapses, demonstrated that 5 HT plays a significant roles not only in the morphology and neural activity of embryonic neurons, but also in neurogenesis and neuroplasticity after maturation, including proliferation, translocation, differentiation and synapse built

PAGE 38

38 (Benninghoff et al., 2010; Veenstra VanderWeel e, Anderson, & Cook, 2000) proved that 5 HT is related to the development of cerebral cortex in mammals. During the early stages of sensory cortex development, temporary serotonergic fibers projections have been detected, indicating that 5 HT m ight be helpful in conjugation and integration of the developing cortex (Nayyar et al., 2009) Brain serotonin synthesis, packaging, transportation, release, as well as its action at targeting ligands, reuptake and deg radation all affect the concentration of 5 HT and its function. Proteins and related genes that are involved in regulating these physiological functions include speed limiting enzyme TPH 1 and TPH 2 (Illi et al., 2009) Vmat2 (Fukui et al., 2007; Zucker, Weizman, & Rehavi, 2005) serotonin transporter (5 HTT), monoamine oxidase A (MAO A) and 5 HT pre and post synaptic receptors such as 5 HT 1A 5 HT 2A 5 HT 2C 5 HT 3 5 HT 4 5 HT 5 5 HT 6 5 HT 7 (Lesch & Gutknecht, 2005; Paaver et al., 2007) Firstly, 5 HT precursor L tryptophan passes through the blood brain barrier and reaches the serotonergic neurons. Catalyz ed by TPH, 5 HTP is generated from L tryptophan, and after decarboxylation catalyzed by 5 HTPDC it turns into 5 HT. 5 HT is imported and stored at the vesicles from nerve terminals, and then released at presynaptic membrane via Vmat2 and 5 HTT, binds to di fferent subtypes of receptors located on pre and post synaptic membranes and exerts its physiological function. 5 HT level in synaptic space is regulated by SERT mediated reuptake, and 5 HT in cell cytosol is metabolized to 5 HIAA by MAO A (Holmes, 2008) According to research regarding the molecular and functional properties of the 5 HT receptors, each of them are now assigned to one of seven receptor families, 5 HT1 7, comprising a total of 14 structurally and pharmac ologically distinct mammalian 5 HT

PAGE 39

39 receptor subtypes. With the exception of the 5 HT 3 receptor, a ligand gated ion channel, all other serotonin receptors (5 HT 1A E 5 HT 2A C 5 HT 4 5 HT 5 5 HT 6 5 HT 7 ) are G protein coupled receptors that activate an intr acellular second messenger cascade to produce an excitatory or inhibitory response. Activation of the specific G protein can affect enzymes (such as adenylate cyclase, phospholipase A and C, mitogen activated protein kinase and so on) and the function of c ation channels especially K + and Ca 2+ (Kushwaha & Albert, 2005) Recently, literatures has been reporting that in the intact brain the function of many 5 HT receptors can now be unequivocally associated with specific physiological responses, ranging from modulation of neuronal activity and transmitter release to behavioral change, especially psychological disorders like depression, anxiety, obsessive compulsive disorder, panic disorder and migraine (add references her e). Among the receptor subtypes, 5 HT 1A 5 HT 1B 5 HT 2A/2C 5 HT 4 5 HT 6 5 HT 7 are considered related to chronic stress induced neural diseases, inhibition of learning and memory, and cognitive disorders (King, Marsden, & Fone, 2008; Meneses, 2007; Perez Garcia, Gonzalez Espinosa, & Meneses, 2006) Studies have shown that chronic unpredictable mild stress (CUMS) remarkably reduced 5 HT concentrations with over expression of 5 HT 1A receptor in the hippocampus, cortex and hypothalamus, of 5 HT 1B receptors in the hypothalamus and of 5 HT 7 receptor in the hippocampus and hypothalamus in rats (Y. C. Li et al., 2009) Also, it was found that acti vation of presynaptic receptors enhanced stimulus induced long term depression (Bailey et al., 2008) and antidepressant medications could attribute the ability to change postsynaptic 5 HT 1A receptors and cAMP produc tion (Hines, Tabakoff, &

PAGE 40

40 WHO/ISBRA Study on State and Trait Markers of Alcohol Use and Dependence Investigators, 2005) 5.3 5 HT 1 Receptors The 5 HT 1 subfamily consists of five G protein coupled receptors (GPCRs) tha t are coupled to Gi/Go and mediate inhibitory neurotransmission, including 5 HT 1A 5 HT 1B 5 HT 1D 5 HT 1E and 5 HT 1F There is no 5 HT 1C receptor, as it was reclassified as the 5 HT 2C receptor. 5.3.1 5 HT 1A Receptor 5 HT 1A is the first successfully clone d subtype of 5 HT receptors, and knowledge of the pharmacology and function of the receptor have been quickly progressed. The 5 HT 1A receptor is widely distributed in the central nervous system, existing in the cerebral cortex, hippocampus, septum, amygdal a, and raphe nucelus in high densities, while low amounts also exist in the basal ganglia and thalamus, mediating the release of 5 HT (Cryan & Leonard, 2000) Stimulation of 5 HT 1A autoreceptors inhibits the activatio n of nucleus raphes dorsalis neurons and blocks the release of serotonin in nerve terminals. The self regulatory function of 5 HT system is inhibited under chronic stress. Lanfumey and his colleagues have found that exogenous corticosterone exposure or chr onic mild stress can desensitize the 5 HT 1A autoreceptor and activate the postsynaptic 5 HT 1A receptor, which further elevates serotonin levels. Postsynaptic 5 HT 1A receptor regulates the release of 5 HT as well as other neurotransmitters such as acetyl ch oline, glutamate aminobutyric acid (Laaris, Le Poul, Laporte, Hamon, & Lanfumey, 1999; Lanfumey et al., 1999; Le Poul, Laaris, Hamon, & Lanfumey, 1997) Activation of 5 HT 1A receptors has been demonstrated to impair cognition, learning, and memory by

PAGE 41

41 inhibiting the release of glutamate and acetylcholine in various areas of the brain (Bhagwagar, Rabiner, Sargent, Grasby, & Cowen, 200 4) Studies show that long term chronic stress or high levels of exogenous corticosterone can impair 5 HT 1A feedback system, induce helplessness behavior in animal models and psychological disorders in conjunction with deteriorated learning and memory in human and rodents (Martin, 1991) Current research has discovered that in chronic stress, 5 HT 1A receptor expression varies in different brain regions (Y. C. Li et al., 2009) In clin ical reports, depression patients tend to have decreased postsynaptic 5 HT 1A receptors and increased presynaptic inhibitive autoreceptors (Zhou et al., 2008) In animal studies, post synaptic 5 HT1A receptor antagonist manifests important antidepressant roles. 5.3.2 5 HT 1B Receptor 5 HT 1B receptors are expressed throughout the rodent central nervous system. These receptors are located in the axon terminals of both serotonergic and nonserotonergic neurons in basal gangl ia, striatum and the frontal cortex, where they act as inhibitory autoreceptors or heteroreceptors. 5 HT 1B receptors inhibit the release of a range of neurotransmitters, including serotonin, GABA, acetylcholine, and glutamate (Moret & Briley, 1997; Moret & Briley, 2000; Morikawa, Manzoni, Crabbe, & Williams, 2000) Knockout mice lacking the 5 HT 1B gene has shown an increase of aggression and a higher preference for alcohol (Clark et al., 2002; Clark, Vincow, Sexton, & Neumaier, 2004; Kaiyala, Vincow, Sexton, & Neumaier, 2003) Selective serotonin reuptake inhibitors can reverse these outcomes (de Boer & Koolhaas, 2005) In open field test and elevated plus maze test, behavior of the rats in chronic stress group is always accompanied by 5 HT 1B overexpression (Lin & Parsons, 2002 ) in which

PAGE 42

42 receptor agonist PC 94,253 can reverse the effect. However in forced swimming test and shuttle box test, the same group of rats has low level expression of 5 HT 1B receptors (Bolano s Jimenez et al., 1995; Lin & Parsons, 2002) 5.4 5 HT 2 Receptors The 5 HT 2 receptors are a subfamily of 5 HT receptors that bind the endogenous serotonin. The 5 HT 2 subfamily consists of three GPCRs which are coupled to G q /G 11 and mediate excitatory neur otransmission. The 5 HT 2 receptor family currently accommodates three receptor subtypes, 5 HT 2A 5 HT 2B and 5 HT 2C receptors, which are similar in terms of their molecular structure, pharmacology and signal transduction pathways. 5.4.1 5 HT 2A Receptor 5 H T 2A is expressed widely throughout the central nervous system (CNS). It is expressed near most of the areas rich of serotoninergic terminals, including neocortex (mainly prefrontal, parietal, and somatosensory cortex) and the olfactory bulb. High densities of this receptor on the apical dendrites of pyramidal cells in layer V of the cortex may modulate cognitive processes (Miner, Backstrom, Sanders Bush, & Sesack, 2003; T. Xu & Pandey, 2000) Studies ha ve shown that 5 HT 2A receptor is sensitive to glucocoticoids. Chronic stress, isolated raising and long term exposure to exogenous corticosterone cause hyperactivities of HPA axis and desensitization of 5 HT 2A receptor, indicating that this receptor has im portant modulatory function in central nervous system diseases (Lee, Redila, Hill, & Gorzalka, 2009) In patients with depression and AD, which is usually accompanied by impaired learning and memory, 5 HT 2A receptor mRN A level in cortex is lower than normal condition (Lai et al., 2005; Lanctot, Herrmann, & Rothenburg, 2008) More and more evidence have revealed that the loss

PAGE 43

43 of 5 HT 2A receptor function is not on ly critical in schizophrenia, but also depression and anxiety (Dawson & Watson, 2009; Weisstaub et al., 2006) 5.4.2 5 HT 2C Receptor 5 HT 2C receptors are distributed in basal ganglia regions such as striatum, substantia nigra pars reticulata (SNr), and subthalamic nucleus (Q. Li et al., 2003; Lopez Gimenez, Tecott, Palacios, Mengod, & Vilaro, 2002) 5 HT 2C receptor angonitst increa ses ACTH and corticosterone/cortisol levels in animal models and human (Klaassen, Riedel, van Praag, Menheere, & Griez, 2002) 5 HT 2C knockout mice do not show depressive behavior in tale suspension test and forced s wimming test. Moreover, in tale suspension test, 5 HT 2C R gene knockout mice and those treated with 5 HT 2C antagonist SB242084 or RS102221 both exhibited increased antidepressive effects of SSRI and increased the 5 HT level in cortex and hippocampus (Cremers et al., 2004; Cremers et al., 2007) However, on the other hand, 5 HT 2C receptor agonist WAY 163909, RO 600175 also have some antidpressive effects (Cryan & Lucki, 2000; Rosenzweig Lipson et al., 2007) Schmauss and his colleagues found that up regulated 5 HT 2C receptor expression in chronic stress can be reversed by SSRI, indicating that psychological disorders caused by chronic stress is related to 5 HT 2C receptor function change (Schmauss, 2003) 5.5 5 HT 4 Receptors The 5 HT 4 receptor was initially identified in cultured mouse colliculi neurones and guinea pig brain by Bockaert and co workers using a functional assay stimulation of adenylate cyclase activity, which exerts domaminergic function and regulating glutamatic and cholinergic neurotransmitter release (Matsumoto et al., 2001) The fac t that 5 HT 4 receptor is mostly distributed in the limbic system implies it relation with

PAGE 44

44 learning and memory, emotion and stress. Studies show that patients with schizophrenia, attention deficit hyperactivity disorder or neurodegenerative diseases such as AD, have down regulated levels of 5 HT 4 receptor expression, as was shown previously in rat models with learning and memory disabilities (Reynolds et al., 1995; Wong, Reynolds, Bonhaus, Hsu, & E glen, 1996) In numerous depression models such as forced swimming test, olfactory bulb removal model and chronic bandaged stress model, 5 HT 4 receptor agonist shows difference levels of antidepressant effect (G. Lucas et al., 2007) 5 HT 4 receptor knockout mice and antagonist treated mice show anxiety, along with ameliorated abnormal behavior caused by chronic stress (Compan et al., 2004; Conductier et al., 2006; Smriga & Torii, 2003) On the other hand, 5 HT 4 receptor agonist increases neuronal activities in hippocampus and cortex, remodels neuroplasticity such as densities of spines and length of dendrites (Restivo et al., 2008) which is possibly the critical mechanism in improving cognition and treating CNS diseases. 5.6 5 HT 6 Receptors 5 HT 6 receptor appears in CNS of rodents, mainly on corpus striatum, olfactory bulb, limbic and forebrain regions including hippocampus and cortex. It is usually involved in glutamatergic and cholinergic neuronal activity. It is a potential target for drugs treating cognitive diseases, schizophrenia, anxiety and obesity. This receptor binds to G s protein, and couples to the stimulation of adenylate cyclase. 5 HT 6 receptor antagonist (such as SB 399885) improves learning and memory, ameliorate depression and anxiety as well as the behavior disorder and microbiological changes caused by chronic stress (Mitchell & Neumaier, 2005; Svenningsson et al., 2007; Wesolowska & Nikiforuk, 2008; Wesolowska, 2008) On the other hand, receptor agonist (such as

PAGE 45

45 WAY 20846 6, WAY 181187) can reduce 5 HT and dopamine release in cortex and corpus striatum, inhibit glutamate release in hippocampus induced by potassium, and finally lead to cognitive disorders (Burnham et al., 2010) 5.7 5 HT 7 Receptors The 5 HT 7 receptor was first identified from brain cDNA libraries screened to identify novel sequences showing homology to known 5 HT receptors. In situ hybridization, immunohistochemistry and autoradiographical studies have demonstrated the presence of 5 HT 7 receptors throughout the CNS, mainly in the hypothalamus, thalamus, hippocampus, amygdala and cortex, in both terminal fields and serotonergic nuclei (J. J. Lucas & Hen, 1995) Several studies have indicated a possible involvement of the 5 HT 7 receptor in mood, emotion, and other neuropsychiatric disorders. In recent studies, 5 HT 7 receptor mRNA level was showed upregulated in the hippocampus and hypothalamus, but not in the cortex in rats after exp osure to chronic unpredictable stress (Y. C. Li et al., 2009) while strong evidence have been supporting the involvement of 5 HT7 receptor in hippocampus and cortex dependent contextual learning and memory processing (Eriksson, Golkar, Ekstrom, Svenningsson, & Ogren, 2008; Gasbarri, Cifariello, Pompili, & Meneses, 2008; A. J. Roberts et al., 2004; Sarkisyan & Hedl und, 2009) Data collected from the use of 5 HT 7 receptor antagonists SB269970 or SB656104 have showed that this receptor is involved in 5 HT mediated hypothermia and sleep patterns which are normally seen altered in depressed patients (M. R. Guscott et al., 2003; Hagan et al., 2000) In both of the forced swim test and tail suspension test, pharmacological blockade of the 5 HT 7 receptor or inactivation of the receptor gene leads to an antidepre ssant like behavioral profile (Bonaventure et al., 2007; M. Guscott,

PAGE 46

46 Bristow, Hadingham, Rosahl, Beer, Stanton, Bromidge, Owens, Huscroft, Myers, Ru pniak, Patel, Whiting, Hutson, Fone, Biello, Kulagowski et al., 2005a; Hedlund, Huitron Resendiz, Henriksen, & Sutcliffe, 2005b; Wesolowska, Nikiforuk, Stachowicz, & Tatarczynska, 2006) A drug originally believed to be selective for the 5 HT 1A receptor, 8 OH DPAT, was shown to act on the 5 HT 7 receptor when inducing phase resetting within the suprachiasmatic nucleus (SCN) of the hypothalamus (Ehlen, Grossman, & Glass, 2001; H orikawa et al., 2000; Sprouse, Reynolds, Li, Braselton, & Schmidt, 2004) Neuroimaging studies have shown that structural changes such as volumetric reductions in the frontal cortex, amygdale, caudate and putamen, along with concomitant increase in volum e of the lateral ventricles are observed in depressed patients (Sheline, 2003) Since disruptions to the sleep cycle is a form of chronic stress which has been shown to suppress hippocampal neurogenesis (Hairston et al., 2005) and decreases in REM sleep have been produced in mice using 5 HT 7 receptor antagonist (Hedlund, Huitron Resendiz, Henriksen, & Sutcliffe, 2005a) the relationship between 5 HT 7 receptor and neurogenesis has been brought into discussion (Kvachnina et al., 2005) The existing conflicting results about 5 HT 7 receptor, such as an increasing mRNA expression of this receptor as well as glucocorticoid levels in restraint stress paradigm (Laplante, Diorio, & Meaney, 2002) and opposite effect in a chemical adrenalectomy study (Yau, Noble, Widdowson, & Seckl, 1997 ) have revealed our preliminary understanding of the complexity of this system and yet more in depth research into this area. 5.8 5 HT Receptor Agonist and Antagonist Many of the effective or specific 5 HT receptor ligands have either been discovered or synthesized, mediating 5 HT receptor subtypes and the whole 5 HT

PAGE 47

47 system. 5 HT neurons show distinct function under receptor agonist or antagonist, many of which have been widely utilized in preclinical and clinical studies, as listed in Table 5 1. 5.9 Sig nal Transduction in 5 HT Receptor System 5 HT as a neurotransmitter exerts its function through relative subtypes of receptors and diverse signaling pathways, which commonly involves second messengers and other receptors. With the exception of the 5 HT 3 re ceptor, a ligand gated ion channel, all other serotonin receptors are G protein coupled receptors that activate an intracellular second messenger cascade to produce an excitatory or inhibitory response. G proteins, short for guanine nucleotide binding prot eins, are a family of proteins involved in second messenger cascades. It carries information from the cell surface to its target receptors, including adenylate cyclase (AC), phospholipase C and ion channels. 5 HT increases the phosphorylation in DARPP 32, Thr34 (PKA) and Ser137 (CK 1), and decreases the phosphorylation in Thr75 (Cdk5). DARPP 32 is a dual functional protein, which works as an inhibitor of phosphatase (such as PP 1), as well as an inhibitor of protein kinase (such as PKA); that is, DARPP 32 e xerts its bidirectional regulatory function in both phosphorylation and dephosphorylation, through self phosphorylation on different spots (A. Nishi, Snyder, & Greengard, 1997) The 5 HT 1 receptor subfamily is coupled t o inhibitory pathways. Through the biding to G i protein it inhibits adenylyl cyclase and rapidly decreases cAMP level. They are also coupled to stimulate phospholipase C and mitogen activated protein kinase (MAPK) growth signaling pathway (Noda, Higashida, Aoki, & Wada, 2004) 5 HT 2 receptors increase the activity of casein kinase through activating G q PLC, followed by PKA, and phosphorylating at Ser137. Studies show that Chronic stress impede the

PAGE 48

48 cAMP CREB signal transd uction, inhibit CREB phosphorylation and decreases brain derived neurotrophic factor (BDNF) expression (Nair et al., 2007; Y. Xu et al., 2006) In contrast, the 5 HT receptors that are positively coupled to adenylyl cyclase are a heterogenous group, including the 5 HT 4 5 HT 6 and 5 HT 7 receptor subtypes. 5 HT 4 5 HT 6 and 5 HT 7 receptors mainly activates G s and AC to boost cAMP dependent protein kinase A, phosphorylation at Thr34 and CREB, and increases B DNF expression and neurogenesis, which finally ameliorate the inhibition of learning and memory caused by chronic stress. In summary, chronic stress induces the hyperactivity of the HPA axis, elevates the adrenal hormone levels in body, which further incre ases the glucocorticoid level and impairs the 5 HT system function. High levels of glucocorticoids cause atrophy and death in hippocampal neurons, which leads to inhibition in learning and memory in patients with neuropsychological diseases. 5 HT plays a c ritical role in regulating CNS diseases because of the large number of receptors locating in the limbic system. We assume that relative agonists or antagonists of different 5 HT receptors exert it protective or destructive function through various pathways Research into the relationship between different subtypes of 5 HT receptors and stress provides theoretical backgrounds in drug development, clinical diagnosis and assessment of clinical efficacy in the area of central nervous system disorders. 5.10 Fut ure Directions Current antidepressant drugs are mostly focusing on inhibiting the plasma membrane transporters for serotonin and/or noradrenaline, such as SSRIs, SNRIs, NRIs as well as MAOIs. However, one of the major drawbacks of these medications is tha t it takes at least several weeks for their antidepressant effects to become manifest.

PAGE 49

49 Moreover, only about half of the depression patients show full remission to these mechanisms and some of these medications put potential risks upon liver metabolism. Thu s studies focusing on other mechanisms such as CFR antagonist and 5 HT receptors highly selective ligands provide new ideas for future antidepressant development.

PAGE 50

50 Table 5 1. 5 HT subreceptors agonist and antagonist 5 HT receptor Agonist Antagonist 5 H T 1A 8 OH DAPT WAY 100135 5 HT 1B Ergotamine Risperidone 5 HT 1D 5 (Nonyloxy)tryptamine Yohimbine 5 HT 1E BRL 54443 Methiothepin 5 HT 1F LY 344 Methiothepin 5 HT 2A Ketanserin APD 125 5 HT 2B Methyl 5 HT Yohimbine 5 HT 2C Methyl 5 HT Fluoxetine 5 HT 3 2 methyl 5 HT Alosetron 5 HT 4 Cisapride GR 113 5 HT 5A LSD SB 699 5 HT 6 EMD 386088 SB 399885 5 HT 7 5 CT/LP 44 SB 269970

PAGE 51

51 LIST OF REFERENCES Alfarez DN, De Simoni A, Velzing EH, Bracey E, Joels M, Edwards FA, Krugers HJ (2009) Corticosterone reduces dendritic complexity in developing hippocampal CA1 neurons. Hippocampus 19:828 836. Bailey CP, Nicholls RE, Zhang X l, Zhou Z y, Muller W, Kandel ER, Stanton PK (2008) Galpha(i2) inhibition of adenylate cyclase regulates presynaptic activity and unmasks cGMP dependent long term depression at Schaffer collateral CA1 hippocampal synapses. Learn Me m 15:261 270. Barden N (1999) Regulation of corticosteroid receptor gene expression in depression and antidepressant action. J Psychiatry Neurosci 24:25 39. Benninghoff J, Gritti A, Rizzi M, Lamorte G, Schloesser RJ, Schmitt A, Robel S, Genius J, Moessne r R, Riederer P, Manji HK, Grunze H, Rujescu D, Moeller H J, Lesch K P, Vescovi AL (2010) Serotonin depletion hampers survival and proliferation in neurospheres derived from adult neural stem cells. Neuropsychopharmacology 35:893 903. Bhagwagar Z, Rabiner EA, Sargent PA, Grasby PM, Cowen PJ (2004) Persistent reduction in brain serotonin1A receptor binding in recovered depressed men measured by positron emission tomography with [11C]WAY 100635. Mol Psychiatry 9:386 392. Bolanos Jimenez F, Manhaes de Castro RM, Seguin L, Cloez Tayarani I, Monneret V, Drieu K, Fillion G (1995) Effects of stress on the functional properties of pre and postsynaptic 5 HT1B receptors in the rat brain. Eur J Pharmacol 294:531 540. Bonaventure P, Kelly L, Aluisio L, Shelton J, Lo rd B, Galici R, Miller K, Atack J, Lovenberg TW, Dugovic C (2007) Selective blockade of 5 hydroxytryptamine (5 HT)7 receptors enhances 5 HT transmission, antidepressant like behavior, and rapid eye movement sleep suppression induced by citalopram in rodent s. J Pharmacol Exp Ther 321:690 698. Burnham KE, Baxter MG, Bainton JR, Southam E, Dawson LA, Bannerman DM, Sharp T (2010) Activation of 5 HT(6) receptors facilitates attentional set shifting. Psychopharmacology (Berl) 208:13 21. Butterweck V, Bockers T, Korte B, Wittkowski W, Winterhoff H (2002) Long term effects of St. John's wort and hypericin on monoamine levels in rat hypothalamus and hippocampus. Brain Res 930:21 29. Chaouloff F (1993) Physiopharmacological interactions between stress hormones and central serotonergic systems. Brain Res Brain Res Rev 18:1 32.

PAGE 52

52 Clark MS, Sexton TJ, McClain M, Root D, Kohen R, Neumaier JF (2002) Overexpression of 5 HT1B receptor in dorsal raphe nucleus using Herpes Simplex Virus gene transfer increases anxiety behavio r after inescapable stress. J Neurosci 22:4550 4562. Clark MS, Vincow ES, Sexton TJ, Neumaier JF (2004) Increased expression of 5 HT1B receptor in dorsal raphe nucleus decreases fear potentiated startle in a stress dependent manner. Brain Res 1007:86 97. Compan V, Zhou M, Grailhe R, Gazzara RA, Martin R, Gingrich J, Dumuis A, Brunner D, Bockaert J, Hen R (2004) Attenuated response to stress and novelty and hypersensitivity to seizures in 5 HT4 receptor knock out mice. J Neurosci 24:412 419. Conductier G, Dusticier N, Lucas G, Cote F, Debonnel G, Daszuta A, Dumuis A, Nieoullon A, Hen R, Bockaert J, Compan V (2006) Adaptive changes in serotonin neurons of the raphe nuclei in 5 HT(4) receptor knock out mouse. Eur J Neurosci 24:1053 1062. Cremers TIFH, Giorg etti M, Bosker FJ, Hogg S, Arnt J, Mork A, Honig G, Bogeso K P, Westerink BHC, den Boer H, Wikstrom HV, Tecott LH (2004) Inactivation of 5 HT(2C) receptors potentiates consequences of serotonin reuptake blockade. Neuropsychopharmacology 29:1782 1789. Crem ers TIFH, Rea K, Bosker FJ, Wikstrom HV, Hogg S, Mork A, Westerink BHC (2007) Augmentation of SSRI effects on serotonin by 5 HT2C antagonists: mechanistic studies. Neuropsychopharmacology 32:1550 1557. Croes S, Merz P, Netter P (1993) Cortisol reaction in success and failure condition in endogenous depressed patients and controls. Psychoneuroendocrinology 18:23 35. Cryan JF, Leonard BE (2000) 5 HT1A and beyond: the role of serotonin and its receptors in depression and the antidepressant response. Hum Psyc hopharmacol 15:113 135. Cryan JF, Lucki I (2000) Antidepressant like behavioral effects mediated by 5 Hydroxytryptamine(2C) receptors. J Pharmacol Exp Ther 295:1120 1126. Dawson LA, & Watson, J. M. (2009) ilazodone: A 5 HT1A receptor agonist/serotonin tr ansporter inhibitor for the treatment of affective disorders. CNS Neuroscience & Therapeutics 15:107 117. de Boer SF, Koolhaas JM (2005) 5 HT1A and 5 HT1B receptor agonists and aggression: a pharmacological challenge of the serotonin deficiency hypothesis Eur J Pharmacol 526:125 139.

PAGE 53

53 Ehlen JC, Grossman GH, Glass JD (2001) In vivo resetting of the hamster circadian clock by 5 HT7 receptors in the suprachiasmatic nucleus. J Neurosci 21:5351 5357. Eriksson TM, Golkar A, Ekstrom JC, Svenningsson P, Ogren SO (2008) 5 HT7 receptor stimulation by 8 OH DPAT counteracts the impairing effect of 5 HT(1A) receptor stimulation on contextual learning in mice. Eur J Pharmacol 596:107 110. Fanselow MS, Poulos AM (2005) The neuroscience of mammalian associative learning Annu Rev Psychol 56:207 234. Fukui M, Rodriguiz RM, Zhou J, Jiang SX, Phillips LE, Caron MG, Wetsel WC (2007) Vmat2 heterozygous mutant mice display a depressive like phenotype. J Neurosci 27:10520 10529. Gasbarri A, Cifariello A, Pompili A, Meneses A (2008) Effect of 5 HT(7) antagonist SB 269970 in the modulation of working and reference memory in the rat. Behav Brain Res 195:164 170. Goddard AW, Ball SG, Martinez J, Robinson MJ, Yang CR, Russell JM, Shekhar A (2010) Current perspectives of the roles of the central norepinephrine system in anxiety and depression. Depress Anxiety 27:339 350. Gorski JA, Zeiler SR, Tamowski S, Jones KR (2003) Brain derived neurotrophic factor is required for the maintenance of cortical dendrites. J Neurosci 23:6856 6865. Guscott M, Bristow LJ, Hadingham K, Rosahl TW, Beer MS, Stanton JA, Bromidge F, Owens AP, Huscroft I, Myers J, Rupniak NM, Patel S, Whiting PJ, Hutson PH, Fone KC, Biello SM, Kulagowski JJ, McAllister G (2005) Genetic knockout and pharmacological blockad e studies of the 5 HT7 receptor suggest therapeutic potential in depression. Neuropharmacology 48:492 502. Guscott MR, Egan E, Cook GP, Stanton JA, Beer MS, Rosahl TW, Hartmann S, Kulagowski J, McAllister G, Fone KCF, Hutson PH (2003) The hypothermic effe ct of 5 CT in mice is mediated through the 5 HT7 receptor. Neuropharmacology 44:1031 1037. Hagan JJ, Price GW, Jeffrey P, Deeks NJ, Stean T, Piper D, Smith MI, Upton N, Medhurst AD, Middlemiss DN, Riley GJ, Lovell PJ, Bromidge SM, Thomas DR (2000) Charact erization of SB 269970 A, a selective 5 HT(7) receptor antagonist. Br J Pharmacol 130:539 548. Hairston IS, Little MTM, Scanlon MD, Barakat MT, Palmer TD, Sapolsky RM, Heller HC (2005) Sleep restriction suppresses neurogenesis induced by hippocampus depen dent learning. J Neurophysiol 94:4224 4233.

PAGE 54

54 Hedlund PB, Huitron Resendiz S, Henriksen SJ, Sutcliffe JG (2005) 5 HT7 receptor inhibition and inactivation induce antidepressantlike behavior and sleep pattern. Biol Psychiatry 58:831 837. Henry JP (1992) Bio logical basis of the stress response. Integr Physiol Behav Sci 27:66 83. Hines LM, Tabakoff B (2005) Platelet adenylyl cyclase activity: a biological marker for major depression and recent drug use. Biol Psychiatry 58:955 962. Holmes A (2008) Genetic var iation in cortico amygdala serotonin function and risk for stress related disease. Neuroscience and Biobehavioral Reviews 32:1293 1314. Horikawa K, Yokota S, Fuji K, Akiyama M, Moriya T, Okamura H, Shibata S (2000) Nonphotic entrainment by 5 HT1A/7 recept or agonists accompanied by reduced Per1 and Per2 mRNA levels in the suprachiasmatic nuclei. J Neurosci 20:5867 5873. Illi A, Setala Soikkeli, E., Viikki, M., Poutanen, O., Huhtala, H., Mononen, N. (2009) 5 HTR1A, 5 HTR2A, 5 HTR6, TPH1 and TPH2 polymorphis ms and major depression. Neuroreport 20:1125 1128. Joels M, Karst H, Alfarez D, Heine VM, Qin Y, van Riel E, Verkuyl M, Lucassen PJ, Krugers HJ (2004) Effects of chronic stress on structure and cell function in rat hippocampus and hypothalamus. Stress 7:2 21 231. Jugloff DGM, Jung BP, Purushotham D, Logan R, Eubanks JH (2005) Increased dendritic complexity and axonal length in cultured mouse cortical neurons overexpressing methyl CpG binding protein MeCP2. Neurobiol Dis 19:18 27. Kaiyala KJ, Vincow, E. S. Sexton, T. J., & Neumaier, J. F. (2009) 5 HT1B receptor mRNA levels in dorsal raphe nucleus: Inverse association with anxiety behavior in the elevated plus maze. Pharmacology, Biochemistry, and Behavior 75:769 776. Kaneda Y (2009) Verbal working memory and functional outcome in patients with unipolar major depressive disorder. World J Biol Psychiatry 10:591 594. Kelly JP, Wrynn AS, Leonard BE (1997) The olfactory bulbectomized rat as a model of depression: an update. Pharmacol Ther 74:299 316. King MV, Marsden, C. A., & Fone, K. C. (2008) A role for the 5 HT(1A), 5 HT4 and 5 HT6 receptors in learning and memory. Trends in Pharmacological Sciences 29:482 492.

PAGE 55

55 Kitamura Y, Araki H, Gomita Y (2002) [Interaction of 5 HT and HPA axis in depression and treatm ent resistant depression]. Nippon Yakurigaku Zasshi 119:319 325. Klaassen T, Riedel WJ, van Praag HM, Menheere PPCA, Griez E (2002) Neuroendocrine response to meta chlorophenylpiperazine and ipsapirone in relation to anxiety and aggression. Psychiatry Res 113:29 40. Konakchieva R, Mitev Y, Almeida OF, Patchev VK (1998) Chronic melatonin treatment counteracts glucocorticoid induced dysregulation of the hypothalamic pituitary adrenal axis in the rat. Neuroendocrinology 67:171 180. Kranenburg O, Poland M, v an Horck FP, Drechsel D, Hall A, Moolenaar WH (1999) Activation of RhoA by lysophosphatidic acid and Galpha12/13 subunits in neuronal cells: induction of neurite retraction. Mol Biol Cell 10:1851 1857. Kushwaha N, Albert PR (2005) Coupling of 5 HT1A autor eceptors to inhibition of mitogen activated protein kinase activation via G beta gamma subunit signaling. Eur J Neurosci 21:721 732. Kvachnina E, Liu, G. Q., Dityatev, A., Renner, U., Dumuis, A., Richter, D. W., (2005) 5 HT7 receptor is coupled to G alpha subunits of heterotrimeric G12 protein to regulate gene transcription and neuronal morphology. Journal of Neuroscience 25:7821 7830. Laaris N, Le Poul E, Laporte AM, Hamon M, Lanfumey L (1999) Differential effects of stress on presynaptic and postsynapti c 5 hydroxytryptamine 1A receptors in the rat brain: an in vitro electrophysiological study. Neuroscience 91:947 958. Lai MK, Tsang SW, Alder JT, Keene J, Hope T, Esiri MM, Francis PT, Chen CP (2005) Loss of serotonin 5 HT2A receptors in the postmortem te mporal cortex correlates with rate of cognitive decline in Alzheimer's disease. Psychopharmacology (Berl) 179:673 677. Lalmansingh AS, Uht RM (2008) Estradiol regulates corticotropin releasing hormone gene (crh) expression in a rapid and phasic manner tha t parallels estrogen receptor alpha and beta recruitment to a 3',5' cyclic adenosine 5' monophosphate regulatory region of the proximal crh promoter. Endocrinology 149:346 357. Lanctot KL, Herrmann N, Rothenburg LS (2008) Commentary: Abeta(1 42) injectio n causes memory impairment, lowered cortical and serum BDNF levels, and decreased hippocampal 5 HT2A levels. Exp Neurol 212:251 254. Lanfumey L, Mongeau R, Cohen Salmon C, Hamon M (2008) Corticosteroid serotonin interactions in the neurobiological mechani sms of stress related disorders. Neurosci Biobehav Rev 32:1174 1184.

PAGE 56

56 Lanfumey L, Pardon MC, Laaris N, Joubert C, Hanoun N, Hamon M, Cohen Salmon C (1999) 5 HT1A autoreceptor desensitization by chronic ultramild stress in mice. Neuroreport 10:3369 3374. L aplante P, Diorio J, Meaney MJ (2002) Serotonin regulates hippocampal glucocorticoid receptor expression via a 5 HT7 receptor. Brain Res Dev Brain Res 139:199 203. Le Poul E, Laaris N, Hamon M, Lanfumey L (1997) Fluoxetine induced desensitization of somat odendritic 5 HT1A autoreceptors is independent of glucocorticoid(s). Synapse 27:303 312. LeDoux J (2007) The amygdala. Curr Biol 17:868 874. Lee TTY, Redila VA, Hill MN, Gorzalka BB (2009) 5 HT(2A) receptor mediated neuronal activation within the paraven tricular nucleus of the hypothalamus is desensitized following prolonged glucocorticoid treatment. Eur J Pharmacol 602:54 57. Lendahl U, McKay RD (1990) The use of cell lines in neurobiology. Trends Neurosci 13:132 137. Leonard BE (2005) The HPA and immu ne axes in stress: The involvement of the serotonergic system. The Journal of the Association of European Psychiatrists 20:302 306. Lesch KP, Mayer, S., Disselkamp Tietze, J., Hoh, A., Wiesmann, M., Osterheider, M. (1990) 5 HT1A receptor responsivity in u nipolar depression. evaluation of ipsapirone induced ACTH and cortisol secretion in patients and controls. Biological Psychiatry 28:620 628. Lesch KP, & Gutknecht, L. (2005) Pharmacogenetics of the serotonin transporter. Progress in Neuro Psychopharmacolo gy & Biological Psychiatry 29:1062 1073. Li Q, Wichems CH, Ma L, Van de Kar LD, Garcia F, Murphy DL (2003) Brain region specific alterations of 5 HT2A and 5 HT2C receptors in serotonin transporter knockout mice. J Neurochem 84:1256 1265. Li Y, Maher P, S chubert D (1997) A role for 12 lipoxygenase in nerve cell death caused by glutathione depletion. Neuron 19:453 463. Li Y C, Wang F M, Pan Y, Qiang L Q, Cheng G, Zhang W Y, Kong L D (2009) Antidepressant like effects of curcumin on serotonergic receptor co upled AC cAMP pathway in chronic unpredictable mild stress of rats. Prog Neuropsychopharmacol Biol Psychiatry 33:435 449.

PAGE 57

57 Lin D, & Parsons, L. H. (2002) Anxiogenic like effect of serotonin(1B) receptor stimulation in the rat elevated plus maze. Pharmacolo gy, Biochemistry, and Behavior 71:581 587. Liu J, Li L, Suo WZ (2009) HT22 hippocampal neuronal cell line possesses functional cholinergic properties. Life Sci 84:267 271. Lopez Gimenez JF, Tecott LH, Palacios JM, Mengod G, Vilaro MT (2002) Serotonin 5 HT (2C) receptor knockout mice: autoradiographic analysis of multiple serotonin receptors. J Neurosci Res 67:69 85. Lucas G, Rymar, V. V., Du, J., Mnie Filali, O., Bisgaard, C., Manta, S. (2007) Serotonin(4) (5 HT(4)) receptor agonists are putative antide pressants with a rapid onset of action. Neuron 55:712 725. Lucas JJ, & Hen, R. (1995) New players in the 5 HT receptor field: Genes and knockouts. Trends in Pharmacological Sciences 16:246 252. Lupien SJ, de Leon M, de Santi S, Convit A, Tarshish C, Nair NP, Thakur M, McEwen BS, Hauger RL, Meaney MJ (1998) Cortisol levels during human aging predict hippocampal atrophy and memory deficits. Nat Neurosci 1:69 73. Martin P (1991) 1 (2 pyrimidinyl) piperazine may alter the effects of the 5 HT1A agonist in the learned helplessness paradigm in rats. Psychopharmacology (Berl) 104:275 278. Matsumoto M, Togashi H, Mori K, Ueno K, Ohashi S, Kojima T, Yoshioka M (2001) Evidence for involvement of central 5 HT(4) receptors in cholinergic function associated with cogn itive processes: behavioral, electrophysiological, and neurochemical studies. J Pharmacol Exp Ther 296:676 682. Meneses AM (2007) Stimulation of 5 HT1A, 5 HT1B, 5 HT2A/2C, 5 HT3 and 5 HT4 receptors or 5 HT uptake inhibition: Short and long term memory. B ehavioural Brain Research 184:81 90. Miner LAH, Backstrom JR, Sanders Bush E, Sesack SR (2003) Ultrastructural localization of serotonin2A receptors in the middle layers of the rat prelimbic prefrontal cortex. Neuroscience 116:107 117. Mitchell ES, & Neu maier, J. F. (2005) 5 HT6 receptors: A novel target for cognitive enhancement. Pharmacology & Therapeutics 108:320 333. Moret C, & Briley, M. (2000) The possible role of 5 HT(1B/D) receptors in psychiatric disorders and their potential as a target for the rapy. European Journal of Pharmacology 404:1 12.

PAGE 58

58 Moret C, Briley M (1997) 5 HT autoreceptors in the regulation of 5 HT release from guinea pig raphe nucleus and hypothalamus. Neuropharmacology 36:1713 1723. Morikawa H, Manzoni OJ, Crabbe JC, Williams JT (2000) Regulation of central synaptic transmission by 5 HT(1B) auto and heteroreceptors. Mol Pharmacol 58:1271 1278. Nair A, Vadodaria KC, Banerjee SB, Benekareddy M, Dias BG, Duman RS, Vaidya VA (2007) Stressor specific regulation of distinct brain deri ved neurotrophic factor transcripts and cyclic AMP response element binding protein expression in the postnatal and adult rat hippocampus. Neuropsychopharmacology 32:1504 1519. Nayyar T, Bubser M, Ferguson MC, Neely MD, Shawn Goodwin J, Montine TJ, Deutch AY, Ansah TA (2009) Cortical serotonin and norepinephrine denervation in parkinsonism: preferential loss of the beaded serotonin innervation. Eur J Neurosci 30:207 216. Nishi A, Snyder GL, Greengard P (1997) Bidirectional regulation of DARPP 32 phosphory lation by dopamine. J Neurosci 17:8147 8155. Nishi M, Whitaker Azmitia PM, Azmitia EC (1996) Enhanced synaptophysin immunoreactivity in rat hippocampal culture by 5 HT 1A agonist, S100b, and corticosteroid receptor agonists. Synapse 23:1 9. Noda M, Higas hida H, Aoki S, Wada K (2004) Multiple signal transduction pathways mediated by 5 HT receptors. Mol Neurobiol 29:31 39. Owe Larsson B, Chaves Olarte E, Chauhan A, Kjaerulff O, Brask J, Thelestam M, Brodin L, Low P (2005) Inhibition of hippocampal synaptic transmission by impairment of Ral function. Neuroreport 16:1805 1808. Paaver M, Nordquist N, Parik J, Harro M, Oreland L, Harro J (2007) Platelet MAO activity and the 5 HTT gene promoter polymorphism are associated with impulsivity and cognitive style in visual information processing. Psychopharmacology (Berl) 194:545 554. Perez Garcia G, Gonzalez Espinosa C, Meneses A (2006) An mRNA expression analysis of stimulation and blockade of 5 HT7 receptors during memory consolidation. Behav Brain Res 169:83 92. Porter RJ, Gallagher P, Watson S, Young AH (2004) Corticosteroid serotonin interactions in depression: a review of the human evidence. Psychopharmacology (Berl) 173:1 17. Raffa RB, & Codd, E. E. (1996) Lack of binding of acetaminophen to 5 HT receptor o r uptake sites (or eleven other binding/uptake assays). Life Sciences 59:PL37 40.

PAGE 59

59 Ramanathan S, Glatt SJ (2009) Serotonergic system genes in psychosis of Alzheimer dementia: meta analysis. Am J Geriatr Psychiatry 17:839 846. Reddy PH, Mani G, Park BS, Ja cques J, Murdoch G, Whetsell W, Kaye J, Manczak M (2005) Differential loss of synaptic proteins in Alzheimer's disease: implications for synaptic dysfunction. J Alzheimers Dis 7:103 117. Reines A, Cereseto M, Ferrero A, Sifonios L, Podesta MF, Wikinski S (2008) Maintenance treatment with fluoxetine is necessary to sustain normal levels of synaptic markers in an experimental model of depression: correlation with behavioral response. Neuropsychopharmacology 33:1896 1908. Restivo L, Roman F, Dumuis A, Bockae rt J, Marchetti E, Ammassari Teule M (2008) The promnesic effect of G protein coupled 5 HT4 receptors activation is mediated by a potentiation of learning induced spine growth in the mouse hippocampus. Neuropsychopharmacology 33:2427 2434. Reynolds GP, Ma son SL, Meldrum A, De Keczer S, Parnes H, Eglen RM, Wong EH (1995) 5 Hydroxytryptamine (5 HT)4 receptors in post mortem human brain tissue: distribution, pharmacology and effects of neurodegenerative diseases. Br J Pharmacol 114:993 998. Ribes D, Colomina MT, Vicens P, Domingo JL (2009) Impaired Spatial Learning and Unaltered Neurogenesis in a Transgenic Model of Alzheimer's Disease after Oral Aluminum Exposure. Curr Alzheimer Res. Roberts AJ, Krucker T, Levy CL, Slanina KA, Sutcliffe JG, Hedlund PB (2004 ) Mice lacking 5 HT receptors show specific impairments in contextual learning. Eur J Neurosci 19:1913 1922. Roberts C, Thomas DR, Bate ST, Kew JNC (2004) GABAergic modulation of 5 HT7 receptor mediated effects on 5 HT efflux in the guinea pig dorsal raph e nucleus. Neuropharmacology 46:935 941. Rosenzweig Lipson S, Sabb A, Stack G, Mitchell P, Lucki I, Malberg JE, Grauer S, Brennan J, Cryan JF, Sukoff Rizzo SJ, Dunlop J, Barrett JE, Marquis KL (2007) Antidepressant like effects of the novel, selective, 5 HT2C receptor agonist WAY 163909 in rodents. Psychopharmacology (Berl) 192:159 170. Ruchhoeft ML, Ohnuma S, McNeill L, Holt CE, Harris WA (1999) The neuronal architecture of Xenopus retinal ganglion cells is sculpted by rho family GTPases in vivo. J Neuro sci 19:8454 8463. Sapolsky R (2003) Taming stress. Sci Am 289:86 95.

PAGE 60

60 Sapolsky R, Brooke S, Stein Behrens B (1995) Methodologic issues in studying glucocorticoid induced damage to neurons. J Neurosci Methods 58:1 15. Sarkisyan G, Hedlund PB (2009) The 5 HT7 receptor is involved in allocentric spatial memory information processing. Behav Brain Res 202:26 31. Schmauss C (2003) Serotonin 2C receptors: Suicide, serotonin, and runaway RNA editing. The Neuroscientist : A Review Journal Bringing Neurobiology, N eurology and Psychiatry 9:237 242. Sheline YI (2003) Neuroimaging studies of mood disorder effects on the brain. Biol Psychiatry 54:338 352. Sheriff S, Dautzenberg FM, Mulchahey JJ, Pisarska M, Hauger RL, Chance WT, Balasubramaniam A, Kasckow JW (2001) I nteraction of neuropeptide Y and corticotropin releasing factor signaling pathways in AR 5 amygdalar cells. Peptides 22:2083 2089. Smriga M, Torii K (2003) L Lysine acts like a partial serotonin receptor 4 antagonist and inhibits serotonin mediated intest inal pathologies and anxiety in rats. Proc Natl Acad Sci U S A 100:15370 15375. Sprouse J, Reynolds L, Li X, Braselton J, Schmidt A (2004) 8 OH DPAT as a 5 HT7 agonist: phase shifts of the circadian biological clock through increases in cAMP production. N europharmacology 46:52 62. Svenningsson P, Tzavara ET, Qi H, Carruthers R, Witkin JM, Nomikos GG, Greengard P (2007) Biochemical and behavioral evidence for antidepressant like effects of 5 HT6 receptor stimulation. J Neurosci 27:4201 4209. Uc EY, McDerm ott MP, Marder KS, Anderson SW, Litvan I, Como PG, Auinger P, Chou KL, Growdon JC (2009) Incidence of and risk factors for cognitive impairment in an early Parkinson disease clinical trial cohort. Neurology 73:1469 1477. Veenstra VanderWeele J, Anderson G M, Cook EH (2000) Pharmacogenetics and the serotonin system: initial studies and future directions. Eur J Pharmacol 410:165 181. Vyas A, Mitra R, Shankaranarayana Rao BS, Chattarji S (2002) Chronic stress induces contrasting patterns of dendritic remodeli ng in hippocampal and amygdaloid neurons. J Neurosci 22:6810 6818. Weisstaub NV, Zhou M, Lira A, Lambe E, Gonzalez Maeso J, Hornung J P, Sibille E, Underwood M, Itohara S, Dauer WT, Ansorge MS, Morelli E, Mann JJ, Toth M, Aghajanian G, Sealfon SC, Hen R, Gingrich JA (2006) Cortical 5 HT2A receptor signaling modulates anxiety like behaviors in mice. Science 313:536 540.

PAGE 61

61 Wesolowska A (2008) The anxiolytic like effect of the selective 5 HT6 receptor antagonist SB 399885: the impact of benzodiazepine receptor s. Eur J Pharmacol 580:355 360. Wesolowska A, Nikiforuk A (2008) The selective 5 HT(6) receptor antagonist SB 399885 enhances anti immobility action of antidepressants in rats. Eur J Pharmacol 582:88 93. Wesolowska A, Nikiforuk A, Stachowicz K (2006) Pot ential anxiolytic and antidepressant effects of the selective 5 HT7 receptor antagonist SB 269970 after intrahippocampal administration to rats. Eur J Pharmacol 553:185 190. Wesolowska A, Nikiforuk A, Stachowicz K, Tatarczynska E (2006) Effect of the sele ctive 5 HT7 receptor antagonist SB 269970 in animal models of anxiety and depression. Neuropharmacology 51:578 586. Wong EH, Reynolds GP, Bonhaus DW, Hsu S, Eglen RM (1996) Characterization of [3H]GR 113808 binding to 5 HT4 receptors in brain tissues from patients with neurodegenerative disorders. Behav Brain Res 73:249 252. Xie Z, Cahill ME, Penzes P (2010) Kalirin loss results in cortical morphological alterations. Mol Cell Neurosci 43:81 89. Xu T, Pandey SC (2000) Cellular localization of serotonin(2A ) (5HT(2A)) receptors in the rat brain. Brain Res Bull 51:499 505. Xu Y, Ku B, Tie L, Yao H, Jiang W, Ma X, Li X (2006) Curcumin reverses the effects of chronic stress on behavior, the HPA axis, BDNF expression and phosphorylation of CREB. Brain Res 1122: 56 64. Yau JL, Noble J, Widdowson J, Seckl JR (1997) Impact of adrenalectomy on 5 HT6 and 5 HT7 receptor gene expression in the rat hippocampus. Brain Res Mol Brain Res 45:182 186. Zhou JS, Li, L., Cao, X., Zhang, X. H., Li, W. H., & Li, Z. X. (2008) Eff ect of 5 HT and postsynaptic 5 HT1 A on the mood and recogniztion of the repeated restraint stress in rats. Journal of Central South UniversityMedical Sciences 33:305 311. Zipkin ID, Kindt RM, Kenyon CJ (1997) Role of a new Rho family member in cell migra tion and axon guidance in C. elegans. Cell 90:883 894. Zucker M, Weizman, A., & Rehavi, M. (2005) Repeated swim stress leads to down regulation of vesicular monoamine transporter 2 in rat brain nucleus accumbens and striatum. European Neuropsychopharmacol ogy 15:199 201.

PAGE 62

62 BIOGRAPHICAL SKETCH Chong Zhang was born in 1985 in a physicians family, in Ningbo, China. At an early age, she was introduced to in the impact of current medical technology, with which she gradually developed her interest in biomedical research later in her academic study. She grew up in Ningbo and graduated from Xiaoshi High School in 2001and earned the Bachelor of Engineering degree later in Biopharmaceutical Engineering from Zhejiang University of Technology in 2004. After that she co University of Florida Biomedical Engineering department, with a specialization in the field of neuropharmacology under the mentorship of Dr. William Ogle. She earned the Degree of Master of Science from University of Flor ida in the summer of 2010. Chong intends to pursue further study in neuropsychopharmacology and contributes fundamentals for the current pharmaceutical industry.