<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2012-08-31.

Permanent Link: http://ufdc.ufl.edu/UFE0042165/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2012-08-31.
Physical Description: Book
Language: english
Creator: Kwan, Jason
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Medicinal Chemistry -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Jason Kwan.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Luesch, Hendrik.
Electronic Access: INACCESSIBLE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042165:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042165/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2012-08-31.
Physical Description: Book
Language: english
Creator: Kwan, Jason
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Medicinal Chemistry -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Jason Kwan.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Luesch, Hendrik.
Electronic Access: INACCESSIBLE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042165:00001


This item has the following downloads:


Full Text

PAGE 1

1 DISCOVERY AND BIOLOGICAL EVALUATION OF SECONDARY METABOLITES FROM MARINE CYANOBACTERIA By JASON CHRISTOPHER KWAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Jason Christopher Kwan

PAGE 3

3 To my wife, my parents and my brother

PAGE 4

4 ACKNOWLEDGMENTS First and foremost I would like to thank my advisor, Dr. Hendrik Luesch. He has been an excellent and supportive mentor, whose unending enthusiasm has driven me to achieve more than I thought I was capable of. I have learnt so much from him and I feel he has prepared me well for a scientific career. Of course, I would like to t hank the other members of my committee, Dr. Raymond Booth, Dr. Arthur Edison and Dr. Kenneth Sloan, for all the help and support they have given me. I also wish to thank my wife, who has supported me in so many ways during my studies, and has put up with my sometimes strange working hours. Many individuals lent their expertise for specific aspects of the work described herein. One of the major figures has been Valerie Paul, of the Smithsonian Marine Station (SMS), in Fort Pierce, a long term collaborator with our group. Valerie was kind enough to accept me for a short internship at SMS during my first year, where I learned about the field work and specimen collecting she does. Although the majority of my work has been centered around discovering compounds with some sort of biomedical potential, it has been hugely rewarding to have been involved in studies to elucidate the ecological role of natural products. I was lucky enough to go on two field trips to the Florida Keys, in order to investigate the effe cts of cyanobacterial extracts and pure compounds on the settlement and metamorphosis of coral larvae, which Valerie organized. On our collection trips to Dry Tortugas, Valerie also provided invaluable help locating and identifying cyanobacteria for later extraction. I would also like to thank all the wonderful people at SMS, who made me feel most welcome, and also the people who joined me on field trips. In particular, Raphael Ritson-Williams, who helped me out a great deal in Valeries lab, Laura Bedin ger, my friendly neighbor in Fort Pierce who was kind enough to drive me to the lab on many occasions, and Theresa Meickle, who worked alongside me at SMS. I would also like to thank Karen Arthur and Cliff Ross, who were both postdocs at SMS while I

PAGE 5

5 was t here, for many useful discussions. Cliff was nice enough to let me stay at his house on the way to the Keys on a number of occasions, and for this I am extremely grateful. Another key person as far as this dissertation is concerned is Max Teplitski, who c ollaborated closely with me on all the experiments in bacterial quorum sensing. At the start of the project I had never worked with bacteria before and so I can honestly say that Max taught me everything I now know about the subject. I very much enjoyed working in his lab, and I would also like to thank the other members of his group Ali Alagely Clayton Cox Mengsheng Gao, Cory Krediet, and Jason Noel, who have all helped me out at one time or another. The NMR studies reported in this dissertation were supported extensively by Jim Rocca. Jim helped my experiments run smoothly, and through many stimulating discussions I have learned so much about NMR from him. On more than one occasion, he has come into work out of hours to help me with instrument problems, both at the McKnight Brain Institute and at the Department of Medicinal Chemistry. I was helped to crystallize two compounds by Khalil Abboud, who carried out the subsequent X-ray diffraction studies. Without his thoughtful advice, I would doubtless not have been successful in producing crystals. I must also acknowledge Chen Liu and his student, Erika Eksioglu. Erika spent some time carrying out experiments investigating the effect of one compound against human Tcells and dendritic cells. The se experiments were ultimately important to the acceptance of the paper and added an interesting dimension to the project. I must thank all the past and present members of the Luesch group Qiyin Chen, Yanxia Liu, Susan Matthew, Rana Montaser, Ranjala R atnayake, Lilibeth Salvador, Kanchan Taori, and Rui Wang, who have all provided companionship and many useful discussions. It has been a joy to work with these individuals, and we have undoubtedly shared a tough but rewarding journey.

PAGE 6

6 Finally, I wish to thank my family, for all their help and support both before and during my PhD studies. Without them I would not have been able to be here.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES .........................................................................................................................10 LIST OF FIGURES .......................................................................................................................12 LIST OF ABBREVIATIONS ........................................................................................................18 ABSTRACT ...................................................................................................................................28 CHAPTER 1 INTRODUCTION ..................................................................................................................30 Natural Products as a Source of Novel Bioactive Compounds ..............................................30 Marine Natural Products and Chemical Ecology of the Marine Environment .......................31 Cyanobacteria, Prolific Producers of Natural Products ..........................................................32 Bioactivities Examined in This Work Rationale .................................................................34 Cytotoxicity .....................................................................................................................34 P rotease Inhibition ...........................................................................................................34 Quorum Sensing Modulation ..........................................................................................35 Isolation and Structure Determination General Considerations ..........................................36 Cytotoxicity Guided and Nuclear Magnetic Resonance (NMR) -Guided Fractionation ................................................................................................................36 Approach for Structure Determination ............................................................................38 2 GRASSYPEPTOLIDES A C, CYTOTOXIC CYCLIC DEPSIPEPTIDES FROM LYNGBYA CONFERVOIDES .................................................................................................61 Introduction .............................................................................................................................61 Isolation and Structure Determination ....................................................................................62 Absolute Configuration of Grassypeptolides A ( 1) and C ( 3) ................................................65 XRay S tructures of Grassypeptolides A ( 1) and B ( 2) ..........................................................67 Molecular Modeling of Grassypeptolides A ( 1 ) and C ( 3) .....................................................69 Antiproliferative Activity .......................................................................................................70 Metal Binding of Grassypeptolides A ( 1) and C ( 3 ) ...............................................................71 Conclusions.............................................................................................................................73 Experimental ...........................................................................................................................74 General Experimental Procedures ...................................................................................74 Extraction and Isolation ...................................................................................................75 Acid Hydrolysis and Chiral Analysis of Grassypeptolide A ( 1) .....................................76 Ozonolysis, Acid Hydrolysis and Chiral Analysis of Grassypeptolide A ( 1) .................77 Advanced Marfeys Analysis of Grassypeptolide A ( 1) .................................................77 Ozonolysis and Acid Hydrolysis of Grassypeptolide C ( 3) ............................................79

PAGE 8

8 Advanced Marfeys Analysis of Grassypeptolide C ( 3) ..................................................81 X-Ray Crystallography ....................................................................................................82 Molecular Modeling of Grassypeptolide A ( 1 ) ...............................................................83 Molecular Modeling of Grassypeptolide C ( 3) ...............................................................85 Biological Activity ..........................................................................................................85 Cell Cycle Analysis .........................................................................................................86 Circular Dichroism Spectra .............................................................................................86 Detection of Metal Complexes by Mass Spectro metry ...................................................86 3 GRASSYSTATINS A C, POTENT CATHEPSIN E INHIBITORS FROM LYNGBYA CONFERVOIDES .................................................................................................................118 Introduction ...........................................................................................................................118 Isolation and Structure Determination ..................................................................................119 Biological Evaluation ...........................................................................................................123 Protease Inhibiti on .........................................................................................................123 Cell Permeability Studies ..............................................................................................124 Effect on Antigen Presentation ......................................................................................125 In Silico Docking to Cathepsins D and E .............................................................................126 Conclusion ............................................................................................................................127 Experimental .........................................................................................................................131 General Experimental Procedures .................................................................................131 Extraction and Isolation .................................................................................................132 Acid Hydrolysis and Chiral Amino Acid Analy sis .......................................................134 Base Hydrolysis to Determine Configuration of Hiva Units. ........................................136 Modified Marfeys Analysis to Determine Configuration of S tatine Units. .................137 Protease Inhibition Screen .............................................................................................137 Protease Inhibition Assays to Determine IC50 Values ...................................................138 Cellular Uptake of Grassystatin A ( 4 ) and Inhibition of Cellular Cathepsins ...............138 Molecular Docking ........................................................................................................139 4 CYANOBACTERIAL COMPOUNDS THAT INTERFERE WITH QUORUM SENSING .............................................................................................................................165 Introduction ...........................................................................................................................165 Malyngamides ...............................................................................................................167 Lyngbyoic Acid .............................................................................................................169 Isolation and Structure Determination ..................................................................................169 Quorum Sensing R eporter Studies and Mammalian Cell Toxicity of Malyngamide C and 8epi Malyngamide C ( 7) ...........................................................................................172 Initial Acylhomoserine lactone (AHL) Quorum Sensing Screening of Lyngbyoic Acid ....173 Investigation of 8epi Malyngamide C ( 7), Lyngbyoic Acid ( 8) and Related Compounds in pSB1075 ........................................................................................................................174 Investigation of Dependence on The LasR AHL-B inding Site. ...........................................174 Effects of 8 epi Malyngamide C ( 7), Lyngbyoic Acid ( 8) and Related Compounds in Wild Type P. aeruginosa and PAO-JP2. ..........................................................................175 Global Gene Expression Analysis of Lyngbyoic Acid ( 8)Treated P. aeruginosa. .............176

PAGE 9

9 Conclusion ............................................................................................................................180 Experimental .........................................................................................................................181 General Experimental Procedures .................................................................................181 Biological Material ........................................................................................................181 Extractio n and Isolation of 8epi Malyngamide C ( 7) and Lyngbic Acid ....................182 Extraction and Isolation of Lyngbyoic acid ( 8 ) .............................................................182 Cell Viabilit y Assay ......................................................................................................186 Bacterial Strains and Culture Conditions ......................................................................186 Quorum Sensing Reporter Assays .................................................................................187 In vitro Inhibition of LasB .............................................................................................187 Pigment and Elastase Production in Pseudomonas aeruginosa ....................................188 Transcriptome Analysis .................................................................................................190 Realtime Quantitative Polymerase Chain Reaction (RT qPCR) ..................................192 5 CONCLUSION .....................................................................................................................221 APPENDIX: NMR SPECTRA ....................................................................................................223 LIST OF REFERENCES .............................................................................................................290 BIOGRAPHICAL SKETCH .......................................................................................................305

PAGE 10

10 LIST OF TABLES Table page 2-1 NMR spectral data for grassypeptolide A ( 1) at 500 MHz (1H) and 100 MHz (13C) in CDCl3 .................................................................................................................................87 2-2 NMR spectral data for grassypeptolide B ( 2 ) in CDCl3 (600 MHz) ..................................89 2-3 NMR spectral data for grassypeptolide C ( 3) in CDCl3 at 600 MHz ................................92 2-4 NMR spectral data for grassypeptolide A ( 1) at 600 MHz (1H) and 100 MHz (13C) in DMSOd6 ...........................................................................................................................95 2-5 Distance constraints for molecular modeling of grassypeptolide A for 10 random structures and violations ....................................................................................................98 2-6 Angle constraints used in molecular modeling of grassypeptolide A ( 1 ) ........................100 2-7 Distance constraints used for molecular modeling of grassypeptolide C ( 3) ..................101 2-8 Angle constraints used in molecular modeling of grassypeptolide C ( 3) ........................102 2-9 Energies and constraint violations of grassypeptolide C ( 3) molecular models ..............103 2-10 IC50s for cytotoxicity exhibited by grassypeptolides A C ( 1 3) against two cancer cell lines ...........................................................................................................................105 3-1 NMR spectral data for grassystatins A ( 4 ) and B ( 5) at 500 MHz (1H) and 150 MHz (13C) in CDCl3 ..................................................................................................................141 3-2 NMR spectral data for grassystatin C ( 6) at 600 MHz in CDCl3 .....................................144 3-3 IC50s of grassystatins A C ( 4 6) against aspartic and metalloproteases identified in the primary screen.. ..........................................................................................................147 3-4 Conditions employed and results for protease screen and IC50 assays ............................148 3-5 NMR spectral data for grassystatin A ( 4 ) at 600 MHz in DMSOd6 ...............................151 4-1 NMR spectral data for 8 epi malyngamide C ( 7) in CDCl3 at 400 MHz (1H) or 600 MHz (2D NMR, 1H) and 100 MHz (13C) ........................................................................194 4-2 Strains and plasmids used in this study............................................................................196 4-3 NMR data for lyngbyoic acid ( 8) (500 MHz, CDCl3) .....................................................197 4-4 Validation of GeneChip experiment by RT-qPCR ..........................................................198

PAGE 11

11 4-5 Primers and probes used in this study ..............................................................................199 4-5 Primers and probes used in this study ..............................................................................199 4-6 Iron regulated genes that are affected by lyngbyoic acid ( 8 ) ..........................................200

PAGE 12

12 LIST OF FIGURES Figure page 1-1 Structures of some seminal natural product drugs in diverse therapeutic areas ................45 1-2 Structures of marine natural products shown to be harmful to human health or to cause fish kills. ...................................................................................................................46 1-3 Structure of maitotoxin, the largest non-polymeric natural product described. ................47 1-4 Structures of marine natural products/synthetic derivatives that are marketed as drugs. ..................................................................................................................................48 1-5 Proposed mechanism for adduct formation by ecteinascidin 743 .....................................49 1-6 Examples of polyketide natural products. ..........................................................................50 1-7 Structure of apratoxin A.....................................................................................................51 1-8 Structure of largazole. ........................................................................................................52 1-9 Structures of lyngbyastatins 4 10. .....................................................................................53 1-10 General isolation scheme for cyanobacterial extracts. .......................................................54 1-11 1H NMR spectra of some silica fractions, showing diagnostic signals..............................55 1-12 Scheme showing the process of structure determination. ..................................................57 1-13 HMBC, ROESY and TOCSY correlations that allowed the sequencing of units in grassypeptolide A...............................................................................................................58 1-14 Common MS fragmentations observed for peptides. ........................................................59 1-15 Scheme showing the principle behind Marfeys analysis by derivatization of amino acid units with FDLA. ......................................................................................................60 2-1 Structures of grassypeptolide A ( 1), B ( 2) and C ( 3 ). ......................................................106 2-2 21and 24membered macrocyclic marine metabolites closely related to 1 ..................107 2-3 MS/MS fragmentation data for grassypeptolides A C ( 1 3). .........................................108 2-4 Displacement ell ipsoids (50% probability) for the Xray crystal structure of grassypeptolide A ( 1 ). ......................................................................................................109 2-5 Displacement ellipsoids (50% probability) for the Xray crystal structure of grassypeptolide B ( 2). ......................................................................................................110

PAGE 13

13 2-6 Lowest energy conformational family most consistent with ROESY data .....................111 2-7 Molecular modeling of grassypeptolide C ( 3) .................................................................113 2-8 Cell cycle analysis of HT29 cells treated with grassypeptolides A ( 1) and C ( 3) for 24 h. Taxol served as a positive control for G2 arrest. ...................................................114 2-9 Structure of the bisCu(II) -ascidiacyclamide complex, with TAO domains shown in red. ...............................................................................................................................115 2-10 Circular dichroism spectra of grassypeptolide A ( 1 ) in the presence and absence of Cu2+ and Zn2+. ..................................................................................................................116 2-11 Detection of Cu2+ and Zn2+ adducts of grassypeptolides A ( 1) and C ( 3) by mass spectrometry .....................................................................................................................117 3-1 Structures of grassystatins A ( 4), B ( 5) and C ( 6 ). ...........................................................154 3-2 Structures of pepstatin A (including binding site nomenclature), tasiamide, and tasiamide B. ......................................................................................................................155 3-3 ESIMS fragmentation pattern of grassystatins A ( 4) and B ( 5). ......................................156 3-4 ESIMS fragmentation pattern for grassystatin C ( 6). ......................................................157 3-5 Protease screen treated with grassystatin A ( 4 ), 10 M. .................................................158 3-6 Progress curves of cathepsin E and TACE treated with grassystatin A ( 4). ....................159 3-7 Activities of grassystatin A ( 4) and pepstatin A against MCF7 cellular proteases as determined with a cathepsin D/E substrate ......................................................................160 3-8 Downregulation of antigen presentation of T cells and TH cells after treatment with grassystatin A ( 4) on activated PBMC and DC ...............................................................161 3-9 Effect of 4 on the T cell pro liferation and production of, intracellular IFN and IL -17 by TH cells induced by allogeneic activated DC in an MLR. ..........................................162 3-10 Docked structures of grassystatin A ( 4) and C ( 6) with cathepsins D and E.. .................163 3-11 Docked structure of pepstatin A with cathepsins D and E...............................................164 4-1 Acylhomoserin lactone (AHL) signaling molecules and the AHL pathways in P. aeruginosa........................................................................................................................202 4-2 Structures of 8 epi malyngamide C ( 7 ), lyngbyoic acid ( 8 ) and other compounds used for quorum sensing studies. .....................................................................................203

PAGE 14

14 4-3 Comparison of 1H NMR signal for H-8 in 8epi malyngamide C ( 7) and malyngamide C (400 MHz CDCl3)..................................................................................204 4-4 Conversion of 7 to malyn gamide C by Mitsunobu inversion ..........................................205 4-5 Structures of compounds related to lyngbyoic acid ( 8). .................................................206 4-6 Activity a gainst the quorum sensing reporter pSB1075 ..................................................207 4-7 Determination of AHL -inhibitory activity of compound 8 and probing of the mechanism of action by use of luxCDABE reporter constructs.. .....................................208 4-8 Treatment of the lacZ -based A. tumefaciens TraR reporter with 8 in the presence of 1 nM 3-oxo-C8HSL. ..........................................................................................................210 4-9 Treatment of constitutively active reporter pTIM2442 with lyngbyoic acid ( 8). ............211 4-10 Effect of lyngbyoic acid ( 8) and other compounds on wildtype P. aeruginosa and the lasIrhlI mutant PAO JP2 .........................................................................................212 4-11 Growth curves of P. aeruginosa PAO1 treated with EtOH and lyngbyoic acid ( 8) ........214 4-12 Lineweaver -Burke plot of LasB inhibition by lyngbyoic acid ( 8) ...................................215 4-14 Scheme showing the effect of lyngbyoic acid ( 8 ) on the transcript level of selected genes of P. aeruginosa PAO1. .........................................................................................218 4-15 DNA gels showing results of DNase reactions in preparation for GeneChip hybridization. ...................................................................................................................219 A-1 1H NMR spectrum of grassypeptolide A ( 1) in CDCl3 (500 MHz) .................................224 A-2 13C NMR spectrum of grassypeptolide A ( 1) in CDCl3 (100 MHz) ................................225 A-3 APT spectrum of grassypeptolide A ( 1) in CDCl3 (100 MHz) ........................................226 A-4 COSY spectrum of grassypeptolide A ( 1) in CDCl3 (500 MHz) .....................................227 A-5 HMQC spectrum of grassypeptolide A ( 1) in CDCl3 (500 MHz) ...................................228 A-6 HMBC spectrum of grassypeptolide A ( 1) in CDCl3 (500 MHz) ...................................229 A-7 ROESY spectrum of grassypeptolide A ( 1) in CDCl3 (500 MHz) ..................................230 A-8 1D TOCSY spectrum of grassypeptolide A ( 1 ) in CDCl3 (600 MHz), with selective excitation at 4.64 ppm ......................................................................................................231 A-9 1D TOCSY spectrum of grassypeptolide A ( 1 ) in CDCl3 (600 MHz), with selective excitation at 3.83 ppm ......................................................................................................232

PAGE 15

15 A-10 1H NMR spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz) ...........................233 A-11 13C NMR spectrum of grassypeptolide A ( 1) in DMSO d6 (100 MHz) ..........................234 A-12 COSY spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz) ...............................235 A-13 Edited HSQC spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz)....................236 A-14 HMBC spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz) ..............................237 A-15 ROESY spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz).............................238 A-16 TOCSY spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz).............................239 A-17 1H NMR spectrum of grassypeptolide B ( 2) in CDCl3 (600 MHz) .................................240 A-18 COSY spectrum of grassypeptolide B ( 2) in CDCl3 (600 MHz) .....................................241 A-19 Edited HSQC spectrum of grassypeptolide B ( 2) in CDCl3 (600 MHz) .........................242 A-20 HMBC spectrum of grassypeptolide B ( 2) i n CDCl3 (600 MHz) ....................................243 A-21 ROESY spectrum of grassypeptolide B ( 2) in CDCl3 (600 MHz) ..................................244 A-22 1H NMR spectrum of grassypeptolide C ( 3) in CDCl3 (600 MHz) .................................245 A-23 COSY spectrum of grassypeptolide C ( 3) in CDCl3 (600 MHz) .....................................246 A-24 Edited HSQC spectrum of grassypeptolide C ( 3) in CDCl3 (600 MHz) .........................247 A-25 HMBC spectrum of grassypeptolide C ( 3) in CDCl3 (600 MHz) ....................................248 A-26 ROESY spectrum of grassypeptolide C ( 3) in CDCl3 (600 MHz) ..................................249 A-27 1H NMR spectrum of grassystatin A ( 4) in CDCl3 (500 MHz) .......................................250 A-28 1H NMR spectrum of grassystatin A ( 4) in CDCl3 (500 MHz), diluted to give sharper signals. .............................................................................................................................251 A-29 1H NMR spectrum o f grassystatin A ( 4) in CDCl3 (400 MHz) after D2O exchange .......252 A-30 13C NMR spectrum of grassystatin A ( 4 ) in CDCl3 (150 MHz) ......................................253 A-31 APT spectrum of grassystatin A ( 4) in CDCl3 (150 MHz) ..............................................254 A-32 COSY spectrum of grassystatin A ( 4 ) in CDCl3 (500 MHz) ...........................................255 A-33 HMQC spectrum of grassystatin A ( 4) in CDCl3 (500 MHz) .........................................256 A-34 HMBC spectrum of grassystatin A ( 4) in CDCl3 (500 MHz) ..........................................257

PAGE 16

16 A-35 ROESY spectrum of grassystatin A ( 4) in CDCl3 (500 MHz) ........................................258 A-36 TOCSY spectrum of grassystatin A ( 4) in CDCl3 (500 MHz) ........................................259 A-37 1H NMR spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz)..................................260 A-38 COSY spectrum of grassystatin A ( 4 ) in DMSO d6 (600 MHz). ....................................261 A-39 Edited HSQC spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz). .........................262 A-40 HMB C spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz). ...................................263 A-41 ROESY spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz). ..................................264 A-42 1H NMR spectrum of grassystatin B ( 5) in CDCl3 (500 MHz). ......................................265 A-43 COSY spectrum of grassystatin B ( 5) in CDCl3 (50 MHz). ............................................266 A-43 HMQC spectrum of grassystatin B ( 5) in CDCl3 (500 MHz). .........................................267 A-44 HMBC spectrum of grassystatin B ( 5) in CDCl3 (500 MHz). .........................................268 A-45 ROESY spectrum of grassystatin B ( 5) in CDCl3 (500 MHz).........................................269 A-46 TOCSY spectrum of grassystatin B ( 5) in CDCl3 in (500 MHz). ...................................270 A-47 1H NMR spectrum of grassystatin C ( 6) in CDCl3 (600 MHz). ......................................271 A-48 COSY spectrum of grassystati n C ( 6) in CDCl3 (600 MHz). ..........................................272 A-50 Edited HSQC spectrum of grassystatin C ( 6) in CDCl3 (600 MHz). ...............................273 A-51 HMBC spectrum of grassystatin C ( 6) in CDCl3 (600 MHz). ........................................274 A-52 ROESY spectrum of grassystatin C ( 6) in CDCl3 (600 MHz).........................................275 A-53 TOCSY spectrum of grassystatin C ( 6) in CDCl3 (600 MHz).........................................276 A-54 1H NMR spectrum of 8epi malyngamide C ( 7 ) in CDCl3 (400 MHz). ..........................277 A-55 13C NMR spectrum of 8epi malyngamide C ( 7) in CDCl3 (100 MHz). .........................278 A-56 COSY spectrum of 8epi malyngamide C ( 7) in CDCl3 (600 MHz). ..............................279 A-57 Edited HSQC spectrum of 8epi malyngamide C ( 7) in CDCl3 (600 MHz). ..................280 A-58 HMBC spectrum of 8epi ma lyngamide C ( 7 ) in CDCl3 (600 MHz). ............................281 A-59 NOESY spectrum of 8 epi malyngamide C ( 7 ) in CDCl3 (600 MHz). ...........................282

PAGE 17

17 A-60 1H NMR spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz). .....................................283 A-61 13C NMR spectrum of lyngbyoic acid ( 8) in CDCl3 (100 MHz). ....................................284 A-62 APT spectrum of lyngbyoic acid ( 8) in CDCl3 (100 MHz). ............................................285 A-63 COSY spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz). .........................................286 A-64 HSQC spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz). .........................................287 A-65 HMBC spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz). ........................................288 A-66 TOCSY spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz). ......................................289

PAGE 18

18 LIST OF ABBREVIATION S ngstrom [ ]T D Specific optical rotation at 589 nm and temperature T in C Aba 2Aminobutyric acid Ac Acetyl ACE Angiotensin converting enzyme ADAM Protein with a disintegrin and a metalloprotease domain AHL Acylhomoserine lactone AiiA Autoinducer inactivation protein A Ala Alanine APC Antigen presenting cell APT Attached proton test Asn Asparagine Asp Aspartic acid ATM Ataxia telangiectasia -mutated gene product ATR Ataxia telangiectasia mutated Rad3-mutated kinase bp Base pairs BSA Bovine serum albumin br Broad c Concentration in g/100 mL C Degrees Celsius ca Carboxylic acid CAD Collisionally activated decomposition cal Calorie calcd Calculated

PAGE 19

19 CD Circular dichroism CDCl3 Deuterated chloroform CE Collision energy CHCl3 Chloroform CH2Cl2 Methylene chloride CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase 2 CO2 Carbon dioxide CoA CoEnzyme A COSY Correlation spectroscopy Cterminus Carbonyl terminus Cu2+ Copper(II) ion CuCl2 Copper(II) chloride CUR Curtain gas CuSO4 Copper sulfate CXP Collision cell exit potential Cya Cysteic acid Cys Cysteine 1D One -dimensional 2D Two -dimensional 3D Three-dimensional D Configurational descriptor (Fisher system) Chemical shift (in ppm) d Doublet dd Doublet of doublets

PAGE 20

20 ddd Doublet of doublet of doublets dddd Doublet of doublet of doublet of doublets dq Doublet of quartets dqd Doublet of quartet of doublets dqq Doublet of quartet of quartets dt Doublet of triplets DC Dendritric cell DEAD Diethyl azodicarboxylate DG Distance geometry DMEM Dulbeccos modified Eagle medium DMSO Dimethyl sulfoxide DMSOd6 Deuterated dimethyl sulfoxide DNA Deoxyribose nucleic acid DP Declustering potential Dtena 3,7-dihydroxy-2,5,8,8tetramethylnonanoic acid E Entgegen (descriptor in CahnIngold Prelog system) EDTA Ethylenediaminetetraacetic acid EP Entrance potential eq Equivalents ESIMS Electrospray ionization mass spectrometry EtOAc Ethyl acetate EtOH Ethanol FACS Fluorescenceactivated cell sorting FAM 5Carboxyfluorescein FDAA 1fluoro -2,4dinitro -5alaninamide

PAGE 21

21 FDLA 1fluoro -2,4dinitro -5leucinamide FL Florida fs Femtoseconds g Gram g Gravity G1 G1 phase G2/M G2 mitosis transition GHz Gigahertz Glu Glutamic acid Gln Glutamine Gly Glycine GS1 Gas 1 GS2 Gas 2 h Hours HCl Hydrochloric acid HeLa HeLa Cervical epithelial adenocarcinoma HETLOC Hetero half -filtered TOCSY for measurement of longrange coupling constants HCOOH Formic acid HDAC Histone deacetylase His Histidine Hiva 2Hydroxyisovaleric acid HMBC Heteronuclear multiple -bond correlation spectroscopy Hmpa 2-Hydroxy-3methylpentanoic acid HMQC Heteronuclear multiple -quantum correlation spectroscopy H2O Water

PAGE 22

22 H2O2 Hydrogen peroxide HP -20 High polymer resin HP-20 (Diaion) HPLC High performance liquid chromatography HRESI/APCIMS High resolution electrospray ionization/atmospheric pressure chemical ionization mass spectrometry (dual probe) HRESIMS High -resolution el ectrospray ionization mass spectrometry HSQC Heteronuclear single -quantum correlation spectroscopy HT29 HT29 Colorectal adenocarcinoma Hz Hertz IC50 Inhibitory concentration 50% IFN Interferon IL -4 Interleukin 4 Ii Invariant chain IL -17 Interleukin 17 Ile Isoleucine IMR -32 IMR -32 Neuroblastoma i PrOH Isopropanol IR Infrared IS Ionspray voltage nJ Coupling constant via n bonds K Kelvin K2CO3 Potassium carbonate Ki Dissociation constant (of an enzyme inhibitor) KM Michaelis constant L Configurational desc riptor (Fischer system)

PAGE 23

23 L Microliter max Absorbance ma ximum (UV) LB Luria Bertani LC MS Liquid chromatographymass spectrometry L. confervoides Lyngbya confervoides Leu Leucine L. majuscula Lyngbya majuscula Lys Lysine m Multiplet M Molar mA Milliamps mM Millimolar mm Millimeter g Microgram M Micromolar m Micrometer Maba 2Methyl -3-aminobutyric acid MCF7 MCF7 Breast adenocarcinoma Me Methyl MeCN Acetonitrile MeOH Methanol Met Methionine mg Milligram MHC Major histocompatibility complex MHz Megahertz

PAGE 24

24 min Minutes mL Milliliter MLR Mixed lymphocyte reaction MMP Matrix metalloprotease MoDC Monocytederived dendritic cell mol Mole MRM Multiple reaction monitoring MS Mass spectrometry MS/MS Tandem mass spectrometry MTT 3-(4,5dimethylthiazol-2yl) -2,5-dipheny l tetrazolium bromide m / z Mass/charge ratio N Normal NaHCO3 Sodium hydrogen carbonate NaOH Sodium hydroxide nBuOH n-Butanol NH4OAc Ammonium acetate NF B Nuclear factor kappa light chain enhancer of activated B cells NFQ Non -fluorescent quencher nM Nanomol ar nm Nanometer NMR Nuclear magnetic resonance NOESY Nuclear Overhauser effect spectroscopy NRPS Nonribosomal peptide synthetase ns Nanoseconds Nterminus Amino terminus

PAGE 25

25 OD600 Optical density at 600 nm PBMC Peripheral blood mononuclear cell PBS Phosphate-buffered saline PCR Polymerase chain reaction PDA Photodiode array PDB Protein Data Bank pH log[H+] Phe Phenylalanine PKS Polyketide synthase Pla Phenyllactic acid pM Picomolar PMA Phorbol 12myristate 13 acetate pNBA paraNitrobenzoic acid ppm Parts per million Pro Proline Pwr Power q Quartet qd Quartet of doublets qdd Quartet of doublet of doublets qqd Quartet of quartet of doublets QS Quorum sensing quin Quintet REM Restrained energy minimization RIN RNA integrity number RMD Restrained molecular dynamic s

PAGE 26

26 rmsd Root mean square deviation RNA Ribonucleic acid RNase Ribonuclease ROESY Rotating frame nuclear Overhauser effect spectroscopy RP Ribosomal peptide RR Ribonucleotide reductase rt Room temperature RT -qPCR Realtime quantitative polymerase chain reacti on s Seconds S Synthesis (cellcycle phase) SA Simulated annealing SAR Structure activity relationship Ser Serine SOD1 Cu/Zn superoxide dismutase 1 sp. Species (singular) spp. Species (plural) Sta Statine STAT3 Signal transducer and activator of transcription 3 Struc Structure t Triplet TACE Tumor necrosis factor -converting enzyme TBE Tris/Borate/EDTA buffer TEM Temperature TFA Trifluoroacetic acid TH T helper cell

PAGE 27

27 THF Tetrahydrofuran thn Thiazoline Thr Threonine tqq Triplet of quartet of quartets tR Retention time TOCSY Total correlation spectroscopy Tris Tris(hydroxymethyl)aminomethane TTc Tetanus toxin Cfragment Tyr Tyrosine U2OS Osteosarcoma UV Ultraviolet V Volt max Absorbance maximum (IR) v/v Volume per volume Val Valine w/v Weight per volume fo ld, fold concentrated, times Zn2+ Zinc(II) ion

PAGE 28

28 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DISCOVERY AND BIOLOG ICAL EVALUATION OF SECONDARY METABOLITES FROM MARINE CYANOBACTERIA By Jason Christopher Kwan August 2010 Chair: Hendrik Luesch Major: Pharmaceutical Sciences Medicinal Chemistry Natural products are an important source of bioactive compounds that often have complex and densely functionalized structures. A large portion of drugs in use today are either natural products or based on a natural product pharmacophore. In recent years natural products from marine sources have received increased attention, in part due to the vast biodiversity of the marine environment, a situation that plausibly increases the need for chemical defenses as a result of intense competition. Marine cyanobacteria, in particular, have been shown to produce a plethora of bioactive compounds. Samples of the marine cyanobacterium Lyngbya confervoides collected off Grassy Key, FL, were subjected to cytotoxicity-guided fractionation to afford three cyclic depsipeptides, grassypeptolides A ( 1), B (2) and C ( 3). These closely related comp ounds exhibited differential cytotoxicity to cancer cells, and therefore demonstrate a natural structureactivity relationship (SAR). The metal binding properties of 1 as well as the nature of mammalian cell growth inhibition by 1 and 3 was investigated. The structures of 1 3 were determined by NMR techniques (1D and 2D), MS, MS/MS, Xray crystallography (in the case of 1 and 2), and chemical degradation.

PAGE 29

29 The same extract of L. confervoides afforded three linear statinecontaining compounds, grassystatins A ( 4), B ( 5) and C ( 6). Based on its structure 4 was screened against a panel of diverse proteases, and found to potently inhibit cathepsins D and E. Follow-up studies revealed that 4 6 potently inhibited both enzymes, and that they all showed some sele ctivity for cathepsin E in contrast to the broad-spectrum aspartic protease inhibitor pepstatin A. Subsequently, it was found that 4 can inhibit antigen presentation by dendritic cells, a process thought to rely on cathepsin E. The structures of 4 6 were determined with NMR techniques, MS, MS/MS and chemical degradation. A sample of Lyngbya majuscula collected in Bush Key, FL, was found to produce a stereoisomer of malyngamide C, 8epi malyngamide C ( 7). The structure of 7, a fatty acid amide with a pendant cyclic moiety, was reminiscent of small signaling molecules used for quorum sensing, the N -acylhomoserine lactones. Compound 7 was tested against some quorumsensing reporter constructs and found to inhibit 3oxo -C12-HSL dependent signaling. The structure of 7 was determined by NMR techniques and MS, and by conversion to malyngamide C through a selective Mitsunobu inversion. A different sample of L. majuscula, collected in Fort Pierce, FL, yielded large amounts of a cyclopropanecontaining fatty acid, lyngbyoic acid ( 8). This compound was also tested for quorum sensing activity in reporter strains, and it was found to antagonize 3-oxo-C12HSL signaling. Intriguingly, this inhibition did not require the AHL-binding site. Subsequent global gene expression analysis revealed that transcript levels of AHL receptors and AHL synthesis genes are unaffected, even though downstream quorum-sensing genes are downregulated. The structure of 8 was determined by NMR techniques, MS, and specific rotation.

PAGE 30

30 CHAPTER 1 INTRODUCTION Natural Products as a Source of Novel Bioactive Compounds Natural products (NPs) are small molecules produced by living organisms, typically referred to as secondary metabolites. This nomenclature distinguishes NPs from small molecules t hat are produced during the course of primary metabolism, and are essential to life, such as enzyme co -factors, neurotransmitters, and molecules used for energy storage.1 Such primary metabolism is largely conserved across different species of organisms .2 By contrast, the presence of secondary metabolites has been recognized that are considered species specific.3 It has been an open question for some time as to why secondary metabolites are produced,4,5 but it is now fairly widely accepted that they confer some sort of survival advantage to the producing organism.3 Secondary biosynthetic pathways are metabolically expensive, and if they did not provide an advantage, would be lost through natural selection. It is easy to appreciate, for example, how toxic compounds could benefit the producing organism either to deter potential predators or to kill competitors. Natural products often have interesting carbon skeletons and are densely functionalized. Because they have evolved to interact with biological targets, they are considered privileged structures that have a high chance of being active against functionally unrelated targets.6,7 Indeed, natural products account for a large proportion of currently marketed drugs, and have provided inspiration for many pharmacophores used in synthetic drugs.8,9 A few examples of natural products used in diver se therapeutic areas are shown in Figure 1 -1. Two therapeutic areas where natural products have made a great impact are bacterial infection and cancer i.e., where compounds toxic to prokaryotic or eukaryotic cells are required. However, as can be seen

PAGE 31

31 in Figure 1 -1, there are NP drugs for many other indications, perhaps reflecting privileged activities that may not be related to their ecological functions. Marine Natural Products and Chemical Ecology of the Marine Environment The oceans cover over 75% of the Earths surface, and harbor the majority of its biodiversity. In many areas, there is intense competition for space, and exposed abiotic surfaces as well as those of sessile organisms are quickly colonized in the process called biofouling.10 There is also a high load of potentially pathogenic microbes in se awater, estimated to be in the region of 107 viruses, 106 bacteria and 103 fungi and 103 microalgae/mL.11 A recent metagenomic study has confirmed that the microbial genetic diversity in the sea is vast.1215 Marine organisms often form close interspecies relationships. Endosymbiosis is common in sponges, coral, inverte brates, etc.16 and mixed a ssemblages of cyanobacteria, algae and bacteria are common. Such relationships can sometimes make it difficult to identify the true producers of natural products in mixed communities. These compounds, especially those that are toxic to fish or other pote ntial grazers, are thought to act as chemical defenses for the producing organism/community. However, as chemical signal cues are prevalent in the aqueous marine environment,17 natural products could also be involved in interand intraspecies communication. Some marine secondary metabolites have been shown to have significant impacts on the environment and on human health. For example, dinoflagellates such as Karenia brevis that cause red tide blooms in Florida produce polyether metabolites (e.g., brevetoxin A, Figure 12) causing large scale fish kills and respiratory symptoms in humans.18 Other dinoflagellates of the genus Alexandrium produce neurotoxins (e.g., saxitoxin, Figure 12) that are the cause of paralytic shellfish poisoning when they contaminate filter feeding bivalves.19 Okadaic acid (see Figure 1 -2) is another polyether compound produced by dinoflagellates of the genera Prorocent rum and Dinophysis that causes diarrhetic shellfish poisoning.18 Cyanobacteria (vide

PAGE 32

32 infra), can also form harmful blooms. A cyanobacterial metabolite, lyngbyatoxin A20 (see Figure 1-2), found in Lyngbya majuscula collected in Hawaii, causes contact dermatitis in humans. The study of marine natu ral products is a relatively new discipline that has flourished due to recent advantages in technologies such as scuba diving and submersible vehicles, both manned and robotic. The widespread use of chemical defenses in the marine environment has encouraged the search for cytotoxic compounds that could be potential anti-cancer agents. In addition, marine natural products often possess intricate and complex structures that inspire synthetic chemistry efforts, such as the largest non polymeric natural molec ule reported, maitotoxin21 (see Figure 1 3). To date, there have been two marine natural products that have become marketed drugs, ecteinascidin -743 (Yondelis), and ziconotide (Prialt, see Figure 1-4). Ecteinascidin 743 is an alkaloid isolated from the marine tunicate Ecteinascidia turbinate ,22 that possesses a labile hydroxyl at the -position to a protected quaternary nitrogen, and is used to treat soft tissue sarcoma. Upon binding to the minor groove of the sequences 5 -PuGC or 5 PyGG,23 a network of hy drogen bonds allows dehydration to produce an imine that can be attacked by the N2 of guanine (see Figure 1 5).24,25 Ziconotide is a -conotoxin isolated from a marine conesnail ( Conus magus ) that uses a mixture of related peptides to paralyze its prey.26 It has been shown to block N-type voltagesensitive calcium channels, and it is injected intrathecally to treat chronic pain. Cyanobacteria, Prolific Producers of Natural Products Cyanobacteria, previously known as blue-green algae, are photosynthetic prokaryotes that are thought to be the first producers of molecular oxygen on Earth, and it is thought that chloroplasts originated as endosymbiotic cyanobacteria.27 They live in terre strial, aquatic and

PAGE 33

33 marine environments, and there are both unicellular and multicellular species.28 They are of interest to natur al products chemists as they are prolific producers of secondary metabolites. Over 300 nitrogen-containing secondary metabolites have been described from marine cyanobacteria alone.29 Cyanobacteria employ three types of secondary biosynthetic pathways nonribosomal peptide synthetase (NRPS), polyketide synthase (PKS), and ribosomal synthesis. Both NRPSs30 and PKSs31 are multimo dular proteins that is they have multiple active sites that carry out sequential synthesis steps. NRPSs are able to incorporate nonproteinogenic amino acids and are able to tailor units by chemical modifications, such as epimerization, heterocyclization and N methylation.32 PKSs condense successive acetate units (as acetyl CoA thioesters), and at each elongation step the oxidative state of the unit can be changed. It can remain a -ketoester, or be converted to a hydroxyester, a conjugated ester or a reduced ester.33 The macrolide antibiotics are well -known examples of PKS products, including oleandamycin,34 methymycin and neomethymycin35,36 (see Figure 1 6). Macrocyclization is common for both NRPS and PKS, and it is possible to combine NRPS and PKS modules. The potent cytotoxin apratoxin A37 (see Figure 1 -7) is likely an example of this, as the units in the western half of the molecule probably arise from NRPS modules, and the eastern 3,7-dihydroxy-2,5,8,8tetramethylnonanoic acid (Dtena) is probably acetate-derived.29 NRPSs incorporate many structural features not normally possible in ribosomal peptides and proteins. However, a ribosomal pathway has recently come to light that is able to produce cyclic peptides that many non -ribosom al features, such as heterocyclization (see also Chapter 2).38,39 The sequence of the precursor peptides are encoded directly in genes of the producing organism, flanked by recognition sequences for downstream enz ymes that perform

PAGE 34

34 macrocyclization, heterocyclization of Cys and Thr residues, and prenylation.32 Like NRPS derived peptides, D-amino acids are found, although for RPs they are believed to arise nonenzymatically.32 Another limitation of RPs is that non-proteinogenic amino acids cannot be incorporated. Bioactivities Examined in This Work Rationale Cytotoxicity Secondary metabolites are often used for defense of the producing organism or its symbiotic host. They therefore are a potential source for cytotoxic compounds that could have potential applications as anticancer drugs. It can be argued that natural products are not always perfect drug candidates, as they often have complex structures that are difficult to synthesize, and their physicalchemical properties may not be ideal. However, there are many examples of natural products with novel mechanisms of action, that can form the basis of further study. Historical examples of this include taxol40 and mitomycin C.41 Many cytotoxic compounds have already been isolated from cyanobacteria. Apratoxin A (Figure 1 -7) is cytotoxic at nanomolar concentrations, and it was recently demonstrated to inhibit STAT3 and the secretory pathway, a novel mechanism.42 Another example is largazole (Figure 18), which is selectively cytotoxic to transformed cells.43 This compound inhibits histone deacetylases (HDACs), and it is thought to effectively be a prodrug for the free thiol form, which binds to the Zn2+ at the HDAC active site. 44 Protease Inhibition Proteases are enzymes that degrade peptide bonds in peptides or proteins, with different degrees of specificity. Proteolytic cleavage is a common form of regulation in biological pathways, and therefore proteases are an important part of many diverse processes, such as blood

PAGE 35

35 pressure regulation (e.g., angiotensin converting enzyme), and regulation of blood-sugar (e.g., dipeptidyl peptidase IV).45 The modified peptides produced by NRPSs have the potential to bind to proteases in a substratelike manner. At the same time their modifications may ensure that they cannot be cleaved by the enzy me and are instead inhibitors. Natural protease inhibitors have been described, for example the broad spectrum aspartic protease inhibitor pepstatin A (see Chapter 3). Protease inhibitors have also been isolated from cyanobacteria, for example lyngbyasta tins 4 104648 (see Figure 1 9) are cyclic depsipeptides that potently inhibit elastase and to a lesser extent trypsin and chymotrypsin. They are part of a large group of related compounds that have differing inhibitory activities to different serine proteases. Quorum Sensing Modulation Quorum sensing (QS) is a mechanism by which bacteria coordinate gene expression according to their local population density, for example the expression of virulence factors only when enough cells are present to overwhelm host defenses.49 QS, therefore, is an important process in bacterial infections and targeting QS pathways may be a viabl e strategy to reduce virulence while exerting less selective pressure on bacteria to develop resistance.50 As well as conveying information to cells of the same species, QS signals can facilitate interspecies communication.51 QS is also thought to be important for the formation of biofilms in the process of biofouling in the marine encvironment,10 although not much work has been done in this area. Bacteria are known to interfere with competing organisms QS signals, for instance the gram positive Bacillus sp. 240B1 expresses an enzyme (AiiA), which degrades the acylhomoserine lactone QS signals of gram negative bacteria.52 Because the marine environment is extremely competitive and it contains a high load of potentially pathogenic

PAGE 36

36 microbes,11 it is reasonable to postulate that cyanobacteria may produce compounds that interfere with quorum sensing. Indeed, recently tumonoic acids E H from the cyanobacterium Blennothrix cantharidosum were found to reduce luminescence in wild type Vibrio harveyi a process that is regulated by quorum sensing.53 Also malyngolide, a fatty acid lactone from the cyanobacterium Lyngbya majuscula was shown to inhibit a series of quorum sensing reporter constructs and to reduce elastase production in Pseudomonas aeruginosa.54 Therefore, there may be many other cyanobacterial metabolites that interfere with quorum sensing. Isolation and Structure Determination General Considerations CytotoxicityGuided and Nuclear Magnetic Resonance (NMR) Guide d Fractionation A typical isolation scheme for cyanobacterial extracts is shown in Figure 1 -10. After collection and freezedrying the dry biological material is directly extracted by soaking first in non-polar solvent (e.g. EtOAc/MeOH 1:1), and then with a more polar solvent mixture (e.g. EtOH/H2O 1:1). Both extracts are subjected to solvent-solvent partitioning steps to remove highly lipophilic and hydrophilic material (with hexanes and H2O, respectively). Cyanobacterial metabolites are generally either highly modified peptides, or else fatty acid derivatives/polyketides that are generally insoluble in H2O. Secondary metabolites of interest are generally found in the nBuOH fractions, however it is good practice to test all fractions for cytotoxicity. Cytotoxicity testing of crude fractions is carried out with human cancer cell lines. Cells are seeded to a 96 -well plate at a density such that they will not become confluent in ~ < 72 h. Some wells should include medium only (no cells), so that at a l ater stage background absorbance can be measured. After 24 h solutions of the samples to be tested are added to respective wells as 1 L of stock solutions in DMSO or EtOH. Final concentrations of 100 and

PAGE 37

37 10 g/mL are appropriate for samples with unknown numbers of constituents. Negative control wells containing 1 L vehicle only should be included, as should wells containing known cytotoxins as positive controls. After a further 48 h of incubation, viability is quantified by MTT dye,55 using absorbance at 562 nm. During cytotoxicity-guided fractionation an n of 1 is sufficient for each fraction, as only qualitative data is requ ired at this stage. It should be noted, however, that multiple negative controls should be used so that the signal corresponding to 100% viability is accurately determined. It is good practice to visually inspect each well under the microscope prior to d eveloping the plate with MTT. This allows interesting effects on cell phenotype to be detected for example changes in cell morphology or detachment, and serves as a visual check of the subsequent results. The nBuOH fraction is typically subjected to on e or more column chromatography steps. Prior to bulk fractionation, aliquots (~20 mg) of the crude material can be run over pre-packed 1 g silica or C18 columns using trial gradient conditions. The mass distribution as well as activity distribution of the resulting fractions can be used to decide appropriate conditions for the bulk column. For instance, if the mass concentrated in one fraction only, this could indicate poor separation. Conversely, if all fractions are equally active this might suggest t hat the active constituents are streaking over multiple fractions. After the first bulk chromatography step, and for all subsequent purification steps, cytotoxicity should be assessed. In addition, after the first column, fractions may be sufficiently deconvoluted to allow their assessment by NMR. In this way, the presence of promising compounds that are not necessarily cytotoxic can be detected. Proton NMR spectra of mixtures can give some idea of the complexity of that mixture. Simple mixtures with small numbers of components have sharp signals and good signal to noise ratios. For such simple mixtures the

PAGE 38

38 approximate ratios of the components can be estimated by NMR. The presence of signals at particular chemical shifts can also be diagnostic. For instance, the upfield cyclopropane multiplets for lyngbyoic acid ( 8, see Chapter 4), could be seen in silica fractions containing this compound (see Figure 1-11a). Modified peptides are of particular interest in cyanobacterial extracts. The amide NH signals are apparent at H ~6 9 as either broad signals or doublets (see Figure 1 -11b), and aromatic signals from e.g. Phe and Pla at H ~7.2 7.4. A series of signals at H ~4 5, corresponding to the -protons of amino acids in peptides, along with signals ap proaching H 5.5 in the case of depsipeptide ester linkages (note that if the hydroxy acid has a free OH instead of an ester linkage, the -proton will have a more upfield chemical shift of H ~4.5). Sharp singlets due to N methyls may be apparent at H ~2.8 3.2, and further upfield, signals due to methyls connected to carbon atoms will probably be apparent, from units such as Val, Leu, Ile, etc. ( H ~0.8 1.1). Methyls from Thr and Ala are usually slightly further downfield ( H ~1.2 and 1.6, respectively). Approach for Structure Determination A typical cyanobacterial peptide metabolite is ~1 kDa, which corresponds to 50 60 carbons. The structure of such a compound can be determined with a set of 2D NMR experiments. A minimum of COSY, HSQC/HMQC, HMBC and ROESY/NOESY would be required. For specific problems, TOCSY may also be useful. The first step is to assess whether the compound is indeed pure, by looking at the relative integration of proton signals, which should fall into unit ratios of 1:1, 1:3 etc., for well separated signals. Signal doubling (or tripling, etc.), could be due to slowly-interconverting conformers of a pure compound, or it could indicate a mixture of closely related analogues. Impurities may be apparent in the mass spectrum of the sample, but this would not detect mixtures of compounds

PAGE 39

39 with the same molecular formula (for example epimers). In the case of conformers, the ratio of the different forms detected by NMR should change with temperature and/or concentration. However, if the ratio does not change this does not necessarily mean there are more than one compound. It could also be the case that the ratio is not dependent on temperature or concentration. The ratio between conformers could also change if the NMR spectrum is recor ded in a different solvent. It is worth noting that sometimes compounds exist as mixtures of epimers that cannot be separated, for example dolastatin 12.56 It is preferable to record spectra in non-protic solvents such as CDCl3 or DMSO d6, so that amide and other exchangeable protons are apparent. Sometimes, signals are sharper in a particular solvent, or at a particular temperature and concentration. Since correlations to sharper signals are more readily detected in 2D NMR experiments, it may be worth experimenting with different conditions. Chemical shifts are changed to varying extents in different solvents, and so it may be necessary to record spectra in more than one solvent to completely solve the structure, perhaps due to signal overlap. When determining a structure it is important to examine all available evidence, if not simultaneously then at least iteratively. Sometimes at first glance, evidence from different experiments can seem contradictory. For example, there could be a doublet in the proton spectrum that shows two coupling partners in the COSY spectrum. On closer inspection the doublet would be reassigned as a doublet of doublets where the second coupling is close to 0 Hz, perhaps because the dihedral angle between the two protons is close to 90 or it could be due to long range allylic/homoallylic coupling or W coupling in a rigid system. In such cases care must be taken not to use overly rigid logic, but to keep in mind the limitations of the experiments used and the potential reasons to explain apparent discrepancies. For example usually one

PAGE 40

40 would take the absence of a carbon correlation to a proton signal in the HSQC to mean that the proton is exchangeable. However, if the carbon or the proton signal is broad, then the correlation may be weak, and so it may be worth looking at lower slices of the HSQC spectrum. Before partial structures are constructed, an important first step is to make a list of carbon chemical shifts and the connected protons (see Figure 1 -12). This helps organize the process and prevents mistakes such as counting the same carbon more than once. One way of doing this is to systematically move through the carbon NMR starting at the downfield end. For each signal, the chemical shift is noted down, along with that of the attached proton(s), plus the coupling pattern and measured coupling constants (see Figure 1-12). As each carbon and attached protons are noted down, they are categorized into CH3, CH2 and CH groups, based on edited HSQC, the number of connected carbons and/or APT or DEPT spectra. Exchangeable protons should also be noted down. After this process is carried out, the list should include all (detectable) exchangeable protons and all protonated carbons. A preliminary count of quaternary carbonyls, unsaturated and aromatic carbons can be made from the HMBC spectrum. These should be listed under a separate heading. At this stage a preliminary molecular formula (based on NMR evidence) can be postulated, which can be compared t o the results of HRMS. Partial structures can then be constructed, based on COSY ( Figure 1 -12) and also with consideration of the chemical shift of signals, coupling patterns and coupling constants. The type of heteroatom and quaternary constituents can be assigned based on chemical shift. For peptides, -protons are generally in the H ~4 5 range, and the -proton of hydroxy acids in depsipeptides generally has H ~5.5. For peptides/depsipeptides it is useful to assign the immediately connected carbonyl and N methyl signals prior to attempting joining the units. Care should be taken during this process, because

PAGE 41

41 some protons could correlate to two different carbonyls (e.g. and amide protons, which can be within three bonds of two carbonyls). In these cases, positional assignments of carbonyls can hopefully be confirmed with correlations from -protons and N -methyl protons. The process of joining units is achieved by consideration of HMBC evidence, and then of through-space interactions observed in RO ESY or NOESY spectra. HMBC correlations are more definitive proof of connectivity, but sometimes not all crucial correlations are apparent. Also, carbonyls tend to have very similar C, and thus correlations can be ambiguous. In such cases, either the H MBC can be optimized to a different value of nJH-C, or the compound could be characterized in a different solvent, both in the hope that new HMBC correlations will be apparent. ROESY or NOESY correlations can help with sequencing, although it could be argued that non-adjacent units can also show correlations due to secondary structure. If an amide bond is trans there is usually a NOE/ROE correlation between the amide proton and the adjacent proton. In the case of cis amide bonds, there would usually be a correlation between the neighboring -protons. Figure 1 -13 shows the crucial HMBC and ROESY correlations that led to the assignment of the structure of grassypeptolide A ( 1, see Chapter 2). For this compound, additional connectivity information was obtained through homoallylic coupling over the thiazoline double bonds. These were apparent in the COSY and TOCSY spectra, and confirmed by 1D selective TOCSY experiments. The use of selective TOCSY also allows observation of the coupling pattern of signals that overlap with other spin systems. After a 2D structure for the compound can be proposed from NMR data, this should be checked against HRMS, and any mass defects carefully considered. Commonly, it is not possible to accurately estimate the length of long alkyl chains by NMR, for instance. For linear peptides, the sequence can be confirmed by MS/MS fragmentation (e.g. see Chapter 3). The

PAGE 42

42 types of backbone fragmentations that can be observed are shown in Figure 1 -14. Cyclic peptides can also be fr agmented, in theory allowing de novo sequencing.57 In practice, this can be a challenging task, and so it is preferable to have a group of related analogues with known or proposed structures in order to compare with analogues of lesscertain structu res (e.g. see Chapter 2). Generally, such analogues will give similar fragmentation series, and assignments can be made by considering which fragments have shifted masses. For analogues that contain halogens with multiple major isotopes, fragmentation of the different parent ions (e.g. for bromine-containing compounds, the [M + H]+ containing 81Br and 79Br),47 allows one to determine which fragments c arry the halogen. The methods described above can only allow the 2D structure of a compound to be determined. In peptides, each unit carries at least one stereogenic center (except glycine), and these must be determined. Typically, ~100 g of a peptide (~ 1kDa) is hydrolyzed with 6 N HCl (110 C, 18 24 h), then evaporated to dryness. The product is reconstituted in H2O and run over a prepacked 100 mg C18 cartridge (eluted with H2O), evaporated again, and then reconstituted with 100 L H2O. The resulting solution is normally sufficient for ~5 injections in a chiral HPLC system (e.g. Chirex [Phenomenex] or Chiralpak WH [Daicel] stationary phases), using MeCN/2mM CuSO4 isocratic solvent systems and UV detection at 254 nm (note: never use more than 15% MeCN, to avoid CuSO4 precipitation). Most amino acid enantiomers can be separated with Chirex, but some hydroxy acids, such as phenyllactic acid (Pla), cannot be detected with Chirex, and Chiralpak WH should be used. The stereoisomers of 2-Hydroxy-3methylp entanoic acid (Hmpa) are best separated by the Chiralpak MA (+) column (Daicel). Where peaks closely overlap, assignments may require the co-injection of the hydrolyzate and the relevant unit, to ascertain whether the peak of interest exactly co elutes wi th the standard.

PAGE 43

43 Chiral HPLC can also be carried out using MS detection. The main advantage of this is that detection limits are much lower, and perhaps ~20 injections or more can be made with 100 g of hydrolyzed peptide, depending on the individual unit. Another advantage is that one must only separate the enantiomers of units with the same mass, as overlapping peaks of different masses can be differentiated if multiple reaction monitoring (MRM) scans are used. However, a different type of column must be used as the CuSO4 modifier is incompatible with MS. We have successfully used the Chirobiotic TAG column (Supelco) to separate a variety of different units, including Pla. Separation of Hmpa, however, is suboptimal. Under favorable conditions a preli minary assignment may be made, but it should be confirmed using HPLCUV with the Chiralpak MA (+) column. -Amino acids cannot be detected by CuSO4based chiral HPLC -UV, and a better method to use is Marfeys analysis, preferably coupled to MS detection so that the reaction yield does not have to be high. Marfeys analysis can also be used as a secondary technique for -amino acids, in case data obtained by other methods is ambiguous. Hydroxy acids cannot be subjected to Marfeys analysis. The techniqu e involves the derivatization of hydrolyzate with a 1,2dinitrobenzene amino acid amide adduct (see Figure 1-15). We favor the leucinamide adduct (1 fluoro -2,4dinitro -5leucinamide, FDLA) as the derivatizing agent as it tends to give better separation th an the originally proposed alaninamide adduct FDAA. The derivatizing agent is easily prepared from 1,3-difluoro-4,6-dinitrobenzene and Lleucinamide.58 Addition of one extra chiral center to the analyte allows enantiomers to be separated by conventional reversed phase HPLC (i.e. enantiomers are converted to diastereomers). Adducts have distinctive UV spectra, with a strong absorption maximum at ~340 nm, which can be used to differentiate adducts from impurities by PDA detection. Typically a gradient solvent system is used with acid modifier to

PAGE 44

44 give sharp peaks. A nice advantage of Marfeys analysis is that one does not need authentic standards of all stereoisomers (see Figure 1 -15). For example, if only L-Ala can be obtained, it can be dervatized with both LFDLA and D-FDLA. Assuming that LAla -LFDLA and LAla -DFDLA can be separated by the HPLC conditions used, the latter will have the same retention time as DAla -LFDLA (as they are enantiomers). Therefore, if the hydrolyzate is derivatized with LFDLA only, we can assign the presence of either Lor DAla. This approach can be extended to -amino acids, with only one diastereomeric pair of the possible four isomers needed ( see Figure 1 15). Using MS detection for Marfeys analysis allows smaller amounts of compound to be used (~30 g has been successful in our experience), and is not affected by impurities or side products in the reaction mixture. Because adducts are free acids, MRM monitoring in negative ion mode is appropriate. The Kinetex column (Phenomenex) can be used to obtain exceptionally sharp peaks for Marfeys adducts (see Chapter 2).

PAGE 45

45 Figure 1 -1. Structures of some seminal natural product drugs in diverse therapeutic areas. For each the name is given, followed by the producer with common name in brackets, if applicable, and the therapeutic class or human indication.

PAGE 46

46 Figure 1 -2. Structures of marine natural products shown to be harmful to human health or to cause fish kills.

PAGE 47

47 Figure 1 -3. Structure of maitotoxin, the largest non-polymeric natural product described.

PAGE 48

48 Figure 1 -4. Structures of marine natural products/synthetic derivatives t hat are marketed as drugs.

PAGE 49

49 Figure 1 -5. Proposed mechanism for adduct formation by ecteinascidin 743 (see Figure 14) to the double stranded triplet 5 AGC -3 as an example. The leaving group is shown in red while DNA is shown in purple.

PAGE 50

50 Figure 1 -6. Examples of polyketide natural products.

PAGE 51

51 Figure 1 -7. Structure of apratoxin A.

PAGE 52

52 Figure 1 8. Structure of largazole.

PAGE 53

53 Figure 1 -9. Structures of lyngbyastatins 4 10.

PAGE 54

54 Figure 1 -10. General isolation scheme for cyanobacterial extracts.

PAGE 55

55 Figur e 1 -11. 1H NMR spectra of some silica fractions, showing diagnostic signals. a) Upfield cyclopropane signals in a fraction containing lyngbyoic acid ( 8), malyngolide ( 9) and lyngbic acid ( 10). The bottom panel shows the 1H NMR spectrum of a silica fracti on

PAGE 56

56 that yielded grassypeptolide A ( 1) as the major component, showing typical peptide features. b) Amide NH and aromatic signals. c) -protons. d) N methyl singlets. e) Side chain CH2 signals. f) Side chain methyl signals. The methylene envelope is also apparent, corresponding to the CH2 signals of longchain fatty impurities.

PAGE 57

57 Figure 1 -12. Scheme showing the process of structure determination.

PAGE 58

58 Figure 1 -13. HMBC, ROESY and TOCSY correlations that allowed the sequencing of units in grassypeptolide A ( 1, see Chapter 2). HMBC correlations are shown in red, ROESY correlations are shown in blue, and TOCSY correlations showing homoallylic coupling are purple. *An unusual 4-bond HMBC correlation (see Chapter 2).

PAGE 59

59 Figure 1 -14. Common MS fragmentations observed for peptides.

PAGE 60

60 Figure 1 -15. Scheme showing the principle behind Marfeys analysis by derivatization of amino acid units with FDLA. Only half of the possible stereoisomer standards are required, because they can be derivatized by either Lor D-FDLA, to produce species that are the enantiomers of the missing standards derivatized with LFDLA.

PAGE 61

61 CHAPTER 2 GRASSYPEPTOLIDES A C, CYTOTOXIC CYCLIC DEPSIPEPTIDES FROM LYNGBYA CONFERVOIDES* Introduction Here, we describe the cyt otoxicity guided isolatio n of three new cytotoxic depsipeptides, grassypeptolide s A C ( 1 3, see Figure 2 -1), from an extract of L. conferv oides collected in the Florida Keys. This cyanobacterium was of interest because it inhibited settlement of coral larvae ( Porites asteroides ) a nd reduced survival of coral recruits.59 Grassypeptolide A ( 1) contains some u nusual residues, such as the amino acid 2 methyl-3-aminobutyric acid (Maba, C1 5) and 2-aminobutyric acid (Aba, C20 23). Until now, the Aba unit had precedence only in sponge metabolites,6062 whereas the Maba un it was found in one other cyanobacterial compound, guineamide B.63 Additionally, compound 1 consists of an unusually high number of D-amino acid units. The tandem thiazoline rings flanking the DAba derived moiety are reminiscent of the lissoclinamide s and the patellamides (Figure 2 -2), which are cyclic peptides containing up to four cysteineand serine-derived cyclocondensation products and which tend to contain D-amino acids.39,6466 Lissoclinamide 7 ,64 closest related to 1 and the most cytotoxic of the series, has two thiazoline rings with the same arrangement and stereoconfiguration as 1, yet the macrocycle is only 21-membered in lissoclinamide 7 as opposed to 31membered in 1. Although both the lissoclinamides and the patellamides were originally isolated from the ascidian Lissoclinum patella the biosynthetic gene clusters were recently found in the obligate symbiotic cyanobacterium Prochloron didemni.39,65,66 Remarkably, these compounds are synthesized Reproduced in part with permission from Kwan, J. C.; Rocca, J. R.; Abboud, K. A.; Paul, V. J.; Luesch, H. Org. Lett. 2008, 10, 789. Copyright (2008) American Chemical Society. Reproduced in part with permission from J. Org. Chem. submitted for publication. Unpublished work copyright 2010 American Chemical Society.

PAGE 62

62 ribosomally (followed by post-translational modification) rather than by nonribosomal peptide synthetases (NRPS).39,65,66 Grassypeptolide A ( 1 ) is the firs t reported compound with tandem thiazoline rings in the depicted arrangement to be produced by an independently living cyanobacterium. Considering the number of nonribosomal peptide residues, it is probably made via an NRPS -like pathway. Grassypeptolides B and C ( 2 and 3, respectively, see Figure 2 1) are closely related in structure to 1. Although structural differences between the analogues are minimal, comparison of the in vitro cytotoxicity of the series revealed a structure activity relationship. Cha nge of ethyl substituent in 1 to a methyl in 2 only slightly reduced activity (3 4-fold), whereas inversion of the Phe unit flanking the bisthiazoline moiety results in 16 23-fold greater potency. We show that both 1 and 3 cause G 1 phase cell cycle arres t at lower concentrations, followed at higher concentrations by G 2/M phase arrest, and that these compounds bind Cu2+ and Zn2+. The three-dimensional structure of 2 was determined by MS, NMR and X-ray crystallography, and the structure of 3 was established by MS, NMR, and chemical degradation. The structure of 3 was explored by in silico molecular modeling, revealing subtle differences in overall conformation between 1 and 3. It is possible that conversion of 1 to 3 could be a novel form of activation fo r chemical defense. Isolation and Structure Determination Samples of L. confer voides were collected off Grassy Key. The nonpolar extract (EtOAc/MeOH 1:1) was fractionated over HP 20 resin followed by silica chromatography and reversed phase HPLC to afford 1. Compound 2 was obtained from the nonpolar extract (MeOH EtOAc, 1:1) of the Grassy Key material and also from additional samples of the same organism collected off Key Largo, FL, following silica chromatography and reversedphase

PAGE 63

63 HPLC. Compound 3 was found only in the Grassy Key collection, following a similar isolation scheme. NMR data combined with a [M + H]+ peak at m / z 1102.5438 in the HRESIMS of 1 suggested a molecular formula of C56H79N9O10S2 (calcd for C56H80N9O10S2, 1102.5464). The 1H NMR spect rum of 1 in CDCl3 was indicative of a peptide by displaying three secondary amide doublets (H 7.12, 7.40, 7.53), three putative N Me tertiary amide singlets (H 2.78, 3.11, 3.15), and several resonances characteristic for -protons of amino acids (H ~4 t o ~5). Considering the IR spectrum, which exhibited bands due to ester (1733 cm-1) and amide (1640 cm-1) carbonyl stretch vibrations, 1 appeared to be a depsipeptide. Analysis of the 1H NMR, 13C NMR, APT, COSY, HMQC, HMBC, and ROESY spectra recorded in CD Cl3 revealed the presence of two regular -amino acid units (threonine, C6 9; proline; C37 41), two N methylated amino acids ( Nmethylleucine, C10 16; N methylvaline, C42 47), one amino acid (Maba, C1 5), phenyllactic acid (Pla, C48 56), a N methylphen ylalanine-derived thiazoline carboxylic acid unit ( N Me -Phethn ca; C24 36), and a thiazoline carboxylic acid moiety derived from Aba (Aba-thnca; C17 23) (Table 2-1). The presence of the two thiazoline rings was deduced from the chemical shifts of vicinal ly coupled H-18 (H 5.32) and H2-19ab (H 3.58/3.27) as well as H-25 (H 5.30) and H2-26ab (H 3.70) combined with HMBC correlations of these spin systems to putative carbonyl-derived carbons from Aba [C -20 (C 178.5)] and N Me Phe [C -27 (C 177.2)], respe ctively. In addition, 1D selective TOCSY experiments revealed homoallylic coupling in both thiazoline rings between H18/H-21 and H-25/H-28. HMBC analysis (Table 2-1) readily established the connectivity of the units as shown for 1, which was further confirmed by interresidue ROESY correlations. Notably,

PAGE 64

64 there was an unusual four-bond correlation between H-2 and C49, which could have arisen because of a planar W conformation.67 HRESI/APCIMS a nd NMR data for 2 suggested a molecular formula of C55H77N9O10S2 ( m / z 1110.5115 for [M + Na]+, and 1088.5298 for [M + H]+, calcd 1110.5133 and 1088.5298, respectively ). Compared to 1, this is a difference of one methylene. The 1H NMR spectrum of 2 in CDC l3 is strikingly similar to 1, except for the presence of a relatively low field methyl doublet ( H 1.65, see Table 2-2), indicative of an alanine. Indeed, examination of the COSY, edited HSQC and HMBC spectra for 2 revealed the presence of the same units found in 1, except that Ala was present in the place of 2 -aminobutyric acid (Aba). Overall, both proton and carbon chemical shifts of 1 and 2 were comparable, suggesting that the sequence of units and also the relative configuration of both compounds are the same (see Table 2 -1 and 2-2). The sequence could be confirmed easily by examination of HMBC and ROESY correlations (Table 2 -2 ). Peaks at m / z 1124.5299 [M + Na]+ and 1102.5428 [M + H]+ (calcd 1124.5289 and 1102.5470, respectively) in the HRESI/APCIMS s pectrum of 3 suggested a molecular formula of C56H79N9O10S2, the same as that for 1. Examination of the 1H NMR, COSY, edited HSQC, HMBC and ROESY spectra for 3 revealed the presence of the same units present in 1, namely 2 methyl-3-aminobutyric acid (Maba ), Thr, N Me -Leu, N Me -Phederived thiazoline carboxylic acid ( N Me Phe -thnca), Pro, N Me Val and phenyllactic acid (Pla). The presence of a 2 aminobutyric acid -derived thiazoline carboxylic acid unit was proposed by default, as there were no HMBC correlations or ROESY correlations between the thiazoline ring and the amino-butyric acid portion. Importantly, although the proton and carbon chemical shifts were very similar to those of 1 and 2, those at position 28 were distinct ( H/ C was 3.83/69.0 and 5.48/59.2 for 1 and 3, respectively). Secondly, the methyl signal at position 36 also showed substantially different

PAGE 65

65 chemical shift s ( H/ C was 2.78/39.6 for 1 and 3.169/30.7 for 3). This suggested that 3 was the epimer of 1 at C -28. Examination of correla tion s in the HMBC and ROESY spectra easily allowed the construction of the sequences of Maba Thr N Me -Leu and Aba N Me -Phe-thnca Pro N Me Val Pla. A ROESY correlation was present between H -28 and H-38 ( N Me Phe and Pro -protons, respectively), suggesting that the intervening amide bond was cis in contrast to the corresponding bond in the crystal structures of 1 and 2. To confirm the complete sequence of 3, ESIMS/MS studies were carried out using 1 and 2 for compar ison (see Figure 2-3). Analysis of the fragmentation patterns of 1 and 2, as well as MS/MS/MS of the prominent ions 859.3 and 845.3 (see Figure 2-3) allowed the assignments shown. We found a dominant continuous series of mainly b ions, resulting from ring opening at the Pro N Me Val amide bond. This is consistent with previous studies of cyclic peptide fragmentation, where only b ions were observed,57 and it was noted that in some proline-containing molecules, ring opening predominantly occurs at this residue.68 None of the other possible b ion series were observed. However, the major series resulted from loss of Pla N Me -Val to give a pseudo c ion (859.3/845.3, see Figure 2-3), followed by loss of Thr Maba to give a b ion (641.2/627.2), Pro N Me -Phe (411.0/397.1) and finally Aba/Ala-thn (241.2/241.1). Compound 3 showed an identical fragmentation pattern to both 1 and 2, and therefore it shares the same sequence. Absolute Configuration of Grassypeptolides A (1) and C (3) Compound 1 was hydrolyzed with 6 N HCl (110 C, 18 h) and the hydrolyzate subjected to chiral HPLC, revealing the presence of DAba, N Me -D-Phe, L-Pro, N Me -LVal, L-Pla, and Dallo -Thr in the molecule, but the correct assignment for N Me Leu remained unclear. A sample of 1 was also subjected to ozonolysis prior to hydrolysis in an attempt to detect cysteic acid (Cya) and hence deduce the configuration of the thiazoline rings. However, peaks for both Land

PAGE 66

66 D-Cya were detected by chiral HPLC, preventing unambiguous configurational assignment. Marfeys analysis58 of the hydrolyzed ozonolysis product was carried out to ascertain the configuration of the Maba,69 N Me -Leu and Cya units, using 1fluoro -2,4-dinitrophenyl-5-Lleucinamide (L-FDLA) as the derivatizing agent. Re versed phase HPLC of 1 derivatized with LFDLA allowed the assignment of (2R ,3R )Maba. In addition, the presence of Dallo -Thr, N Me -DPhe,Compound 3 was hydrolyz ed with 6 N HCl (110 C, 18 h), and the hydrolyz ate was subjected to chiral HPLC MS to reveal the presence of Dallo -Thr, N Me -LVal L-Pro, N Me -DLeu and LPla. Compound 3 was treated with ozone at 78 C followed by oxidative workup and acid hydrolysis, then the product was analyzed by chiral HPLC MS to detect the presence of DAba. Under these conditions two peaks were observed c orresponding to N Me -LPhe and N Me -DPhe in the ratio 1.28:1, respectively. More stringent ozonolysis conditions were then used to treat both 1 and 3 (30 min, rt) in order to convert N Me Phe to N Me Asp. Analysis of the reaction L-Pro, and N Me -LVal was confirmed, and N Me -D-Leu could be unambiguously assigned. L-FDLA adducts for Lor D-C ya were quantified by LC MS and found to be present in the ratio of 1.64:1, indicating that either the thiazolines were of opposite configuration producing cysteic acids in different yields or that epimerization of one or both units had occurred. However, presumably at least one thiazoline had to have R configuration because of the excess LCya produced. Only the 2 R ,3 R and 2 R ,3 S standards were used. The elution times of the 2 S ,3 S and 2 S ,3 R isomers were deduced by derivatizing these standards with DLFDLA. Two peaks were observed corresponding to (2R ,3 R )and (2 S ,3 R )Maba in the approximate ratio of 2.5:1. This is consistent with chromat ograms of the standards, which were obtained from the corresponding N benzoylated O methyl esters. The latter also showed epimerization at the 2 position during hydrolysis. Marfeys adducts of N Me -DPhe and N Me -LLeu co eluted; however, the relative intensity of the corresponding peak was reduced and N Me -DGlu was generated when stringent oxonolysis conditions (25 C) were employed. Thus, a N Me-DPhe residue was present in 1

PAGE 67

67 product of 3 by chiral HPLC MS again showed the presence of both enantiomers of N Me Asp in the ratio of 1.22: 1 L to D. Two peaks in the ratio of 1:1.85 corresponding to N Me -LAsp and N Me -DAsp, respectively, were also apparent in the ozonolysis product of 1 under the same co nditions. Taken together, this suggests that the position of N Me Phe is somewhat prone to epimerization, as both peaks were detected in ozonolysis products of 1. The fact that the ratio of L to D is reversed for 3, along with NMR chemical shift eviden ce, suggests that the 28-position has Lconfiguration in 3. Additionally, 1 and 3 have very different specific rotations ([ ]20 D of +78 and +18 respectively), supporting a difference in configuration. The meager excess of N Me -LPhe and N Me -LAsp detected in these experiments is perhaps consistent with previous experience with the unnatural 31 S isomer of lissoclinamide 7, which showed conversion to lissoclinamide 7 (see Figure 2-2) in the presence of pyrimidine and CDCl3 at 60 C.64 The isolation of the 28S isomer of 1 in much reduced yield suggests that this compound is a minor sideproduct of the biosynthesis of 1, or else is an activated form (vide infra). Consistent with previous experience with 1, both Lcysteic acid and Dcysteic acid (Cya) were detected in the ozonolysis product of 3 Because the proton and carbon chemical shifts of the thiazoline moieties are both much the same as those of 1, the configuration of both are likely R in 3 as well as 1. X-Ray Structures of Grassypeptolides A (1) and B (2) Attempts were then made to crystallize grassypeptolide A ( 1). Eventually, a small yield of crystals was produced using a mixture of dichloromethane and methanol.* One methanol molecule was seen incorporated into the lattice. Upon dryi ng, the crystals would quickly degrade, presumably due to methanol loss. The resulting Xray structure (Figure 2 -4) confirmed the 2D arrangement and all of the previously assigned

PAGE 68

68 stereocenters. Additionally, both thiazolines could be assigned as R confirming that significant epimerization had occurred under the reaction conditions. The crystal structure shows hyd rogen bonds between the NH (at N1) of Maba to the Thr N (N2; 2.35 ) and the Pla ester O (O1; 2.52 ). Another hydrogen bond occurs between the Thr NH and the carbonyl of Aba-thn-ca (O6; 2.37 ). At the opposite site of the macrocycle, a tight turn at N -Me-Phe-thn-ca is stabilized by a hydrogen bond (2.04 ) between the Pro carbonyl (O8) and the NH of Aba-thnca (at N5), with the angle between the planes of the thiazoline rings at almost 90. Analogous turns occur in patellamide D at the oxazoline rings, w hile the thiazoles are planar.70 In lissoclinamide 7 (see Figure 2 2) a turn is centered around the other thiazoline (ring X), and there is a hydrogen bond between the NH of Phe and the N of the adjacent thiazoline, rather than across the turn. The angle between thiazoline planes is still close to 90, but one is twisted so that its plane is parallel to that of the macrocycle. The obtained yield of 2 was much less than for 1 (1.7 mg from both collections combined). However, by using H2O to produce a saturated solution, a small amount of crystals could be produced that were adequate for X ray diffraction studies (see Experimental Section). Th e resulting structure (Figure 2-5a ) is es sentially superimposable to that of 1, despite the fact that the crystals were formed under different conditions (Figure 2-5b). As expected, the relative configuration of all stereocenters was the same as that for 1. Because the Flack x parameter is near zero [0.16 (10)], and the specific rotations shown by 1 and 2 were of similar magnitude (+76 versus +109, respectively), the absolute configuration shown is correct.

PAGE 69

69 Molecular Modeling of Grassypeptolides A (1) and C (3) Several aspects of the NMR data fo r 1 suggested that the solution structure was similar to the X ray structure.* First, ROESY data suggested that all amide bonds were trans in solution, as they are in the solid state. Second, three calculated angles from 3JNHH valuesTo investigate the solution structure, 46 distance constraints were derived from ROESY spectra and three dihedral angle constraints from coupling constants* (NH H, see Tables 2 -5 and 2-6). Using a previously established molecular modeling protocol suitable for cyclodepsipeptides,37 10 randomly drawn structures of 1 were subjected to distance geometry,71 followed by simulated annealing and finally restrained molecular dynamics simulation for 1 ns. The modeled structures could be divided into two distinct conformational families. Six structures (Figure 2 6) that bore striking similarity to the X ray structure are in better agreement with the ROESY data, although there were not enough constraints in the PlaMaba-Thr region (due to signal overlap) to ensure convergence of all 10 random structures to the same conformation. were similar to those observed in the X-ray structure. Third, the planar W suggested by the fourbond HMBC between H -2 and C49 was present in the Xray structure. To further explore the potential conformational differences between 1, 2 and 3, we carried out molecular modeling of 3. Apart from the differences in chemical shifts already noted, the NMR spectra of 1 and 3 are similar which therefore su ggested a fairly similar conformation for both compounds. In particular, the two 3JNHH values that could be measured in 3 (indicative of angles)72 had almost the same values in 1. Therefore, the same ROESY distances and angle For conformational analysis in solution, NMR data for 1 in DMSO d6 was used, as the differing overlap of peaks allowed the unambiguous assignment of more correlations across units ( for full NMR data for 1 in DMSO d6, see Table 2 4) The four bond HMBC referred to was only observed in CDCl3. Using the modified Karplus equation, 3JNHH = 8.40 cos2 1.36 cos + 0.33; see: Vgeli, B.; Ying, J.; Grishaev, A.; Bax, A. J. Am. Chem. Soc. 2007, 129 9377 9385.

PAGE 70

70 constraints previously used for modeling of 173 were used. Most of the ROESY correlations observed for 1 were also seen for 3 (see Table 23, common correlations shown in bold), but four extra interresidue correlations were added for modeling purposes (see Table 27 and 2 -8). In addition, the N Me -Phe Pro amide bond was set to cis a s previously noted. As with modeling for 1, ten random structures were subjected to distance geometry followed by simulated annealing and then constrained molecular dynamics (see Experimental section ). This resulted in two conformational families, howeve r, one clearly had higher calculated energies and a larger number of constraint violations (3 structures, average 61.2 kcal/mol and 8 violat ions, see Table 29 and Figure 27a). The other family were all within 1 rmsd of the lowest energy conformation, and showed closely related backbone conformations (7 structures, average 35.1 kcal/mol and 2.3 constraint violations, see Table 2-9). Interestingly, this family contained two orientations of the N Me Phe side chain, with H 28 either pointing into the center of the macrocycle or away from it. The interconversion of these two forms would have resulted from a rotation of the C27 C28 bond (see Figure 2-7b ). The backbone conformation for the lower energy conformational family is also like that of the crystal structure of 1 (see Figure 2 -7 c). Antiproliferative Activity The antiproliferative activity of 1 3 was evaluated in two cell lines derived from human cervical carcinoma (HeLa) and colorectal adenocarcinoma (HT29, see Table 2 -10). Compounds 1 and 2 both ha d IC50s in the low micromolar range, and compound 2 was only slightly less potent than 1 (3 4 fold difference in IC50), indicating that the change from DAba -thnca in 1 to DAla -thnca in 2 did not have a drastic effect on antiproliferative effect. Surprisingly, 3 was 16 23 times more potent than 1, and 65-fold more potent than 2. Presumably this is due to differences in conformation and suggests that the region around the N Me Phe is crucial to

PAGE 71

71 cytotoxicity. Interestingly, the 31 S isomer of lissoclinamide 7 (Figure 2 -2) was also found to be more potent than the natural compound in some cell lines.64 To test if the antiproliferative effects were mediated by stage specific cell cycle arrest, we investigated the effect of both 1 and 3 on cell cycle in HT29 cells (see Figure 2 -8) using FACS-based DNA content analysis. Both compounds exhibited G1 arrest at lower concentrations, followed by G2/M arrest at higher concentrations, with 3 showing these effects at lower concentrations than 1 (see Figure 2 -8 ). An increase in apoptotic sub-G1 or sub-G2 populations is also seen. It is interesting that 3, the most active of the series, was recovered as the most minor component from the cyanobacterial extract. This could be an indication that 1 requires activation by epime rization, possibly as a strategy for self-resistance by the producing organism.41 Metal Binding of Grassypeptolides A (1) and C (3) Cyclic peptides that have tandem thiazole/oxazole or thiazoline/oxazoline rings, for example patellamides A and C (Figure 2 2) an d ascidiacyclamide (see Figure 2 -9 ), have been shown to bind to metals such as Cu2+ and Zn2+.7476 In the crystal structure of ascidiacyclamide,76 the molec ule is complexed with two Cu2+ ions bridged by a carbonate anion. Each Cu2+ is coordinated to one thiazole, one oxazoline, and the intervening deprotonated amide (see Figure 2-9), which has been termed a TAO domain, and is also thought to bind Cu2+ in the patellamides.77,78 Additionally, a non specific cytotoxic metal chelator (tachpyridine) has been shown to cause G2/M phase cell cycle arrest in HeLa cells.79 Since compounds 1 3 also promoted G2/M cell cycle arrest, and they contained a motif comprising of two thiazolines and an intervening amide (similar to TAO), we investigated the binding of 1 to Cu2+ and Zn2+. The circular dichroism spectrum of 1 revealed positive maxima at 2 18, 230 and 253 nm (see Figure 2 -10 ). Previously the CD spectra of patellamides A and C, lissoclinamides 9 and 10, and

PAGE 72

72 ulithiacyclamide had been investigated.75,80 The near UV CD maximum at 253 nm could be due to the aromatic N Me Phe and Pla residues, while the far UV maximum at 218 nm is similar to that observed in the random coil conformation of poly(Lys).81 The remaining maximum at 230 nm could be attributed to the tight turn at N Me -Phe-thnca observed in the solid state and solution structures of 1. The CD spectra of turns are fairly variable,82 but some examples exist with positive maxima near 230 nm. Upon addition of one equivalent of Cu2+, the shape of the CD spectrum of 1 changed (see Figure 2 10a and 2-10b), indicating that the binding of Cu2+ to 1 occurs, and that it is accompanied by a slight change in conformation. A second equivalent of Cu2+ did not cause a further change, indicating a 1:1 stoichiometry. Addition of one Zn2+ equivalent to 1 also brought about a slight change in the CD spectrum (see Figure 2 -10c and 210d). While copper caused both positive and negative changes in the CD spectrum of 1 (see Figure 2 10b), Zn2+ generated only positive changes (see Figure 2 10 d), perhaps indicating different conformations for the resulting complexes. These results are qualitatively reminiscent of the changes in CD spectrum seen when Cu2+ and Zn2+ are added to lissoclinamide 10, a 21membered cyclic peptide that con tains two thiazolines, an oxazoline and a proline.80 In this compound, Cu2+ causes both positive and negative changes in the CD spectrum with two isobesic points, whereas zinc causes only a negative change. Unfortunately, there were insufficient amounts of 3 to obtain a CD spectrum, however we were able to obtain evidence of both Cu2+ and Zn2+ adducts by MS for both 1 and 3 (see Figure 2 -11). Both compounds exhibited [M H + Cu]+ ions with the expected isotope distribution, as well as several zinc adducts ([M + Zn]2+, [M H + Zn]+ and [M + ZnCl ]+).

PAGE 73

73 Conclusions We have described two new cytotoxic cyclic depsipeptides, grassypeptolides B ( 2) and C ( 3). Compounds 1 3 show a natural SAR. While the substitution of DAba ( 1) to DAla ( 2 ) had only slightly reduced potency, inversion of N Me -DPhe ( 1) to N Me -LPhe ( 3) lowered IC50 by 16 23fold (see Table 2 10). Like the thiazole and oxazoline containing cyclic peptides patellamides A, C and ulithiacyclamide, compounds 1 and 3 can bind to metals. This activity may be a potential mechanism for cytotoxicity in mammalian cells, as many classes of enzymes are known to rely on metal cofactors. For example, ribonucleotide reductase (RR) requires iron for catalysis of the conversion of ribonucleotides to deoxyribonucleotides, the precursors needed for the synthesis of DNA during S phase of the cell cycle. Iron depletion by exogenous chelators therefore causes cell cycle arrest at the G1/S phase,83 through inhibition of RR and other mechanisms.84 However, metal chelators such as desferrioxamine85 and tachpyridine,79 have been shown to induce G2/M cell cycle arrest under some conditions. The latter was shown to mediate this effect through activation of CHK1 and CHK2, potentially through ataxia telangiectasiamutated and Rad3related kinase (ATR). Another potential target for metal chelators is Cu/Zn superoxide dismutase (SOD1),86,87 which protects cells from superoxide radicals produced during normal metabolism and especially at times of oxidative stress. Inhibition of SOD1 can lead to buildup of reac tive oxygen species (ROS), which can result in activation of both G1 and G2 checkpoint functions through the ataxia telangiectasia gene product (ATM).88 Our cell cycle data for 1 and 3, where a degree of both G 1 and G 2/M phase arrest is seen, is consistent with these compounds abilities to bind metals. Compound 1 has a low micromolar IC50 in a number of cancer cell lines, which is a potency similar to that of desferrioxamine89 and tachpyridine.79 Compound 3 was more potent, and this could be due to an

PAGE 74

74 increased affinity for metals. However, metal independent major pleiotropic mechanisms of action for these compounds may exist. Compound 3 may represent an activated form of 1, and this process may constitute a self resistance strategy by the producing organism. Experimental General Experimental Procedures Optical rotation was measured on a PerkinElmer 341polarimeter. UV was measured on a SpectraMax M5 (Molecular Devices) and IR data obtained on a Bruker Vector 22 instrument. 1H and 2D NMR spectra for 1 in CDCl3 were recorded on a Bruker Avance 500 MHz spectrometer. 1H and 2D NMR spectra for 1 in DMSO d6 1D TOCSY experiments for 1 in both CDCl3 and DMSO d6, and NMR spectra for 2 and 3 were carried out on a Bruker Avance II 600 MHz spectrometer using a 1 mm triple resonance high temperature superconducting cryogenic probe. All 100MHz 13C NMR data were recorded on a Varian Mercury 400 M Hz spectrometer. Spectra were referenced to residual solvent signals [ H/C 7.26/77.0 (CDCl3) and H/C 2.49/39.5 (DMSO d6)]. HMQC, HSQC and edited HSQC experiments were optimized for 145 Hz, and HMBC experiments were optimized for 10 Hz ( 1 in CDCl3) and 7 Hz ( 1 in DMSOd6, 2 and 3 in CDCl3). HRESI/APCIMS were recorded on a Bruker APEX II FTICR spectrometer in positive mode. LC MS data for 1 were obtained using an Agilent 1100 equipped with a ThermoFinnigan LCQ by ESI (negative mode). LC MS and low resolution MS data for 2 and 3 were obtained on an API 3200 (Applied Biosystems) equipped with a Shimadzu LC system. MTT assays were detected on a SpectraMax M5, and cell cycle analysis was quantified using FACScan (Beckton Dickinson Medical Systems). Circular dichroism spectra were acquired on an Aviv 400 spectrometer.

PAGE 75

75 Extraction and Isolation Samples of Lyngbya confervoides were collected off Grassy Key in the middle Florida Keys (24.381'N, 80.696'W) on May 26, 2004. Additional samples of the same spec ies were collected off Key Largo, Florida, on May 8, 2003. Voucher specimens are maintained at the Smithsonian Marine Station. The freeze -dried Grassy Key material was extracted with EtOAc MeOH (1:1) to afford the nonpolar extract (11.34 g) which was applied to a D iaion HP -20 polymeric resin and subsequently fractionated with H2O and increasing concentrations of acetone. The fraction eluting with 100% acetone (608 mg) was applied to a silica gel column, then eluted with increasing concentrations of isopropanol in CH2Cl2. The fraction eluting with 100% isopropanol was purified by semipreparative reversed phase HPLC (YMC Pack ODS AQ, 250 10 mm, 2.0 mL/min; UV detection at 220 and 254 nm) using a MeOHH2O linear gradient (60 100% over 30 min, then 100% MeOH for 20 min), to furnish compound 1, tR 34.2 min (11.2 mg). Silica gel fractions from both extracts eluting with i PrOH and MeOH were subjected to preparative HPLC [column, Luna 10u C18(2) 100A AXI, 100 21.2 mm, 10.0 mL/min, UV detection at 220 and 254 nm] using a MeOH H2O linear gradient (60 100% MeOH over 30 min, then 100% MeOH for 5 min). From each fraction, impure 2 eluted with tR 21.5 min and 1 eluted at tR 22.1 (14.5 mg) The collected peaks appeared the same by 1H NMR and so were combined before being subjected to another round of HPLC purification [column, YMC Pack ODS AQ, 250 10 mm, 2.0 mL/min; PDA detection, 190 500 nm] using a linear MeOH H2O gradient (60 97.5% MeOH over 28 min, then 97.5% MeOH for 20 min) to give 2 (1.7 mg) at tR 32.7 min. The 20:80 i PrOH/CH2Cl2 fraction from the silica column of the extract of the Grassy Key material was subjected to reversed phase HPLC [column, YMC Pack ODS AQ, 250 10 mm,

PAGE 76

76 2.0 mL/min; PDA detection, 190 500 nm], using a linear MeOH H2O gradient (60 100% MeOH over 30 min, then 100% MeOH for 20 min), to furnish 3 (0.6 mg) and 1 (1.9 mg) at tR 31.4 and 33.3 min respectively Grassypeptolide (1) Colorless amorphous solid; [ ]20 D +76 ( c 0.1, CH2Cl2); UV (CH2Cl2) max (log ) 230 (2.20), 260 (1.95), 330 (1.37); IR (film) max 3307 (br), 3054 (w), 2958, 2925, 2873, 2851, 1733, 1640 (s), 1532, 1456, 1266, 1085, 1023, 738, 702 cm1; 1H NMR, 13C NMR, COSY, HMBC and ROESY data see Table 1 (CDCl3), Table S1 (CDCl3) and Table S2 (DMSO d6) ; HRESIMS m/z [M + Na]+ 1124.5264 (calcd for C56H79N9O10S2Na, 1124.5284), [M + H]+ 1102.5438 (calcd for C56H80N9O10S2, 1102.5464), [M + H2]2+ 551.7756 (calcd for C56H81N9O10S2, 551.7771). Grassypeptolide B (2). Colorless amorphous solid; [ ]20 D +109; HRESI/APCIMS m / z [M + Na]+ 1110.5115 (calcd for C55H77N9O10S2Na, 1110.5133), [M + H]+ 1088.5298 (calcd for C55H78N9O10S2, 1088.5313); UV (CH2Cl2) max (log ) 224 (3.20), 250 (sh, 2.80), 280 (sh, 2.58); IR (film) max 3306 (br), 3027 (w), 2921, 2851, 2361 (w), 1731, 1641, 1531, 1453, 1266, 1225, 1160, 1122, 1085, 1026, 967, 913. Grassypeptolide C (3). Colorless amorphous solid; [ ]20 D +18; HRESI/APCIMS m / z [M + Na]+ 1124.5299 (calcd for C56H79N9O10S2Na, 1124.5289), [M + H]+ 1102.5428 (calcd for C56H80N9O10S2, 1102.5470); UV (CH2Cl2) ma x (log ) 224 (3.82), 260 (3.41); IR (film) max 3419 (br), 3056, 2961, 2920, 2851, 2306, 2125, 1750, 1640, 1515, 1456, 1265, 1030, 895. Acid Hydrolysis and Chiral Analysis of Grassypeptolide A (1) A sample of 1 (0.2 mg) was treated with 6 N HCl at 110 C for 18 h. The hydrolyzate was concentrated to dryness and analyzed by chiral HPLC [column, Chirex phase 3126 (D) (4.6 250 mm), Phenomenex; solvent, 2 mM CuSO4; flow rate, 0.8 mL/min; detection at 254 nm] for

PAGE 77

77 its amino acid content. DAllo -Thr, N Me -LVal LPro, and DAba eluted at tR 21.7, 26.1, 29.2 and 34.8 min, respectively. The retention times ( tR, min) of the authentic amino acids were as follows: LThr (13.4), D-Thr (15.6), Lallo -Thr (18.7), L-Aba (21.3), Dallo-Thr (21.7), N Me -LVal (26.1), LPr o (29.2), D-Aba (34.8), N Me -D-Val (43.0), and D-Pro (64.3). To detect phenyllactic acid (Pla), the hydrolyzate was analyzed using different chiral HPLC conditions [column, Chiralpak WH (4.6 250 mm), Daicel; solvent 2 mM CuSO4; flow rate, 2.5 mL/min; det ection at 254 nm]. NMe -D-Phe eluted with the other early-eluting peaks ( tR ~5.7 min), and LPla eluted at tR 15.6 min. There was no peak corresponding to N Me -LPhe. The retention times ( tR, min) of the authentic amino acids were as follows: N Me -DPhe ( 5.7), N Me -L-Phe (23.5), DPla (11.1), and L-Pla (15.6). All other amino acid standards eluted at tR < 9 min. Ozonolysis, Aci d Hydrolysis and Chiral Analysis of Grassypeptolide A (1) Ozone was bubbled through a sample of 1 (0.25 mg) dissolved in 3 ml CH2Cl2 at room temperature for 10 min. The solution was then dried down and treated with 6 N HCl at 110 C for 26 h. The resulting hydrolyzate was concentrated to dryness and analyzed by chiral HPLC [column, Chirex phase 3126 (D) (4.6 250 mm), Phenomenex; solvent, 2 mM CuSO4MeCN (97.5:2.5); flow rate, 0.8 mL/min; detection at 254 nm] for its amino acid content. DAllo -Thr, N Me -LVal/L-Pro, LCya, D-Aba, and DCya eluted at tR 15.9, 18.4.8, 22.0, 23.6 and 26.9 respectively. The retention times ( tR, min) of the authentic amino acids were as follows: LThr (10.9), D-Thr (12.3), Lallo-Thr (14.9), Dallo -Thr (15.9), LAba (16.5), L-Pro (18.5), NMe -LVal (18.8), LCya (22.0), D-Aba (23.6), DCya (26.9), N Me -D-Val (27.9), and D-Pro (38.2). Advanced Marfeys A nalysis of Grassypeptolide A (1) The N -benzoyl O methyl esters of (2 R ,3 R )and (2 R ,3S)-2methyl-3aminobutyric acid (Maba) were treated with 6 N HCl at 110 C for 22 h. The products of each reaction w ere dried and reconstituted to 50 mM solutions in water. The other amino acid standards were also made

PAGE 78

78 into 50 mM stock solutions in water. Then, 10 L 1 M NaHCO3 and 50 L 1 fluoro -2,4dinitrophenyl-5-Lleucinamide (L-FDLA, 1% w/v in acetone) were added to 25 L of these solutions. After heating at 35 C for 1 h, with frequent mixing, the reaction mixtures were acidified with 5 L 2 N HCl, concentrated to dryness and then reconstituted with 250 L MeCN H2O (1:1). FDLA derivatives of the hydrolyzate and hydrolyzed ozonolysis products were prepared in a similar way. Standards and hydrolyzates were subjected to reversed phase HPLC analysis [column, Alltima HP C18 HL (4.6 250 mm), 5 m, Alltech; flow rate, 1.0 mL/min; PDA detection from 200 nm] using a linear gradient of MeCN in 0.1% (v/v) aqueous TFA (30% MeCN over 50 min). LFDLA derivatives of the synthetic Maba standards gave two peaks each in an approximate ratio of 2.5:1, indicating partial epimerization at the 2 -position (this accounted for the minor peak each time). Retention times were as follows ( tR, min): (2 R ,3S)-Maba (24.3), (2S,3S)-Maba (24.6), (2R ,3R )-Maba (26.4), (2S,3R )-Maba (27.0). As with the standards, there were two Maba peaks in the LFDLA derivatized hydrolyzate, the major corresponding with (2R ,3R )and the minor with (2S,3R )Maba. Th erefore this unit was assigned 2 R ,3R All other previous assignments were confirmed by Marfeys analysis. Additionally, there was a peak corresponding to N Me -DLeu ( tR 36.6). There were no clear peaks above the noise at the retention times expected for Land D-Cya, so the LFDLA adduct mixture of the hydrolyzed ozonolysis products was subjected to LC-MS analysis [column, Zorbax Eclipse SDB -C18 (3.0 250 mm), 5 m, Agilent; flow rate 0.15 mL/min; UV and ESIMS detection, 338 nm and negative ion mode, respectively] using a step gradient of 0.2% HCOOH in MeCN (A) and 0.2% aqueous HCOOH (B) (5% A over 20 min, followed by 40 50% A for 20 min, then 50% A for 15 min). Both DCya and LCya were detected, eluting at tR 25.3 and 25.8 min, respectively, with peak volumes in the ratio of 1:1.64 (base peak had

PAGE 79

79 expected [M H] m/z 462.1 for both). Retention times ( tR, min, base peak m/z ) of authentic standards were as follows: D-Cya (25.3; 462.1) and L-Cya (25.8; 462.1). Ozonolysis and Acid Hydrolysis of Grassypeptolide C (3) A portion (50 g) of 3 was subjected to acid hydrolysis (6 N HCl, 110 C, 18 h) and then evaporated to dryness. The sample was reconstituted in 100 L H2O and subjected to chiral HPLC analysis [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 10 mM NH4OAc (40:60 pH 5.39); flow rate, 0.5 mL/min; detection by ESIMS in positive ion mode (MRM scan)]. Dallo -Thr, N Me -LVal, LPro and N Me -DLeu eluted at tR 12.6, 13.1, 14.8 and 112 min, respectively. The retention times ( tR, min ; MRM ion pair, parent product) of the authentic amino acids were as follows: LThr (8.0; 120 74), Lallo Thr (8.6), DThr (9.5), Dallo Thr (12.6), N Me -LVal (13.1; 132 86), N Me -DVal (40.4), LPro (14.8; 116 70), DPro (41.9), N Me -LLeu (16.2, 146 100), N Me -DLeu (112). Compounddependent MS parameters were as follows: Thr, DP 28, EP 9, CEP 5, CE 14, CXP 3.5; N Me Val, DP 37, EP 6, CEP 12, CE 16, CXP 3; Pro, DP 36, EP 10, CEP 8, CE 22, CXP 2.3; N Me Leu, DP 35, EP 6, CEP 10, CE 17, CXP 3. Source de pendent MS parameters were as follows: CUR 50, CAD medium, IS 5500, TEM 750, GS1 70, GS2 70. LPla was detected with different conditions [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH H2O (both with 10 mM NH4OAc, pH 5.43); flow rate, 0.5 mL/min; detection by ESIMS in negative ion mode (MRM scan)] at tR 10.6. The retention times ( tR, min; MRM ion pair, parent product) of the authentic amino acids were as follows: LPla (10.6, 165 147), DPla (11.5). The assignment of LPla was confirmed b y co injection with both authentic standards. Compounddependent MS parameters were as follows: DP 37, EP 3, CEP 9, CE 17, CXP 2.8. Source dependent MS parameters were as follows: CUR 50, CAD high, IS 4500, TEM 750, GS1 70, GS2 70.

PAGE 80

80 Another portion of 3 (50 g) in 3 mL CH2Cl2 was cooled to 78 C. Ozone was bubbled through the solution for 30 min, which was then allowed to reach room temperature and evaporated to dryness. The residue was treated with H2O2/HCOOH (15% w/v and 50% v/v in H2O, respecti vely, 70 C, 20 min), evaporated to dryness and reconstituted in 100 L H2O. Analysis by chiral HPLC [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 10 mM NH4OAc (40:60, pH 5.39); flow rate, 0.5 mL/min; detection by ESIMS in positive ion mode (MRM scan)], revealed the presence of DAba at tR 15.4, but both N Me -LPhe and N Me -DPhe were detected at tR 25.3 and 47.3 min, respectively, in the ratio 1.28:1. The retention times ( tR, min; MRM ion pair, parent product) of the authentic amino acids were as follows: LAba (9.1, 104 58), DAba (15.4), N Me -LPhe (25.3, 180 134), N Me -DPhe (47.3). Compounddependent MS parameters were as follo ws: Aba, DP 41, EP 2, CEP 8, CE 14, CXP 2.3; N Me Phe, DP 30, EP 10, CEP 13, CE 20, CXP 3. Source dependent M S parameters were as follows: CUR 50, CAD medium, IS 5500, TEM 750, GS1 70, GS2 70. Samples of both 1 and 3 (50 g each) were subjected to ozonolysis at room temperature for 30 min followed by oxidative workup, then subjected to chiral HPLC analysis [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 10 mM NH4OAc (30:70, pH 5.14); flow rate, 0.5 mL/min; detection by ESIMS in negative ion mode (MRM scan)]. For the ozonolysis product of 3, both N Me -LAsp and N Me -DAsp were detected at tR 6.6 and 10.6 min, respectively, in the ratio of 1.22:1. For the ozonolysis product of 1, the ratio was 1:1.85. The retention times ( tR, min; MRM ion pair, parent product) of the authentic amino acids were as follows: N Me -LAsp (6.6, 146 102), N Me -DAsp (10.6). Compounddependent MS parameters were as follows: DP 33, EP 4.5, CEP 14, CE 18, CXP 5. Source -dependent MS conditions were as follows: CUR 50, CAD high, IS 4500, TEM 750, GS1 70, GS2 70. The

PAGE 81

81 ozonolysis product of 3 was also examined under differ ent chiral HPLC conditions [column, Chirex phase 3126 (D) (4.6 250 mm), Phenomenex; solvent, 2 mM CuSO4 MeCN (97.5:2.5); flow rate, 0.8 mL/min; UV detection at 254 nm], to confirm the presence of Dallo Thr, N Me -LVal, LPro and DAba at tR 14.5, 16.3, 17.4 and 21.0, respectively. In addition, both Land DCya were detected at tR 19.8 and 23.7, respectively, consistent with previous results for 1.73 The retentio n times ( tR, min) of the authentic standards were as follows: LThr (10.3), DThr (11.6), Lallo Thr (13.9), Dallo Thr (14.5), LAba (15.0), DAba (21.0), N Me -LVal (16.3), N Me -DVal (22.2), L-Pro (17.4), D-Pro (33.6), LCya (19.8), D-Cya (23.7). Advanc ed Marfeys Analysis of Grassypeptolide C (3) The N -benzoyl O methyl esters of (2 R ,3R )and (2R ,3S)-2methyl-3aminobutyric acid (Maba) were treated with 6 N HCl at 110 C for 22 h. The products of each reaction were dried and diluted to 50 mM with wate r. Then, 10 L 1 M NaHCO3 and 50 L 1 fluoro -2,4-dinitrophenyl5-Lleucinamide (LFDLA, 1% w/v in acetone) were added to 25 L of the Maba stock solutions. The mixtures were heated to 35 C for 1 h with frequent mixing, then neutralized with 5 L 2 N HC l, concentrated to dryness and reconstituted with 250 L MeCN H2O (1:1). The FDLA derivative of the ozonolysis product of 3 was prepared in a similar way using ~45 g starting material. Derivatives were analyzed by reversed phase HPLC [column, Kinetex 2. 6 u C18 100A (4.6 100 mm), Phenomenex; flow rate, 0.5 mL/min; ESIMS detection in negative ion mode], using a MeOH H2O (both with 0.1% HCOOH) linear gradient (40 100% MeOH over 50 min). Under these conditions two peaks were detected in the LFDLA derivat ive of the ozonolyz ate of 3, corresponding to (2R ,3 R )and (2S,3R )Maba -LFDLA, respectively, in the ratio 1.51:1. This is consistent with the extent of epimerization at the 2 position observed after treatment of the standards with acid,73 and allowing the assignment of (2R ,3R )Maba. The retention times ( tR,

PAGE 82

82 min) of the authentic standards were as follows: (2R ,3S)Maba-LFDLA (25.6), (2R ,3R )Maba-DFDLA* (25.6), (2R ,3R )Maba-L-FDLA (27.1), (2 R ,3S)Maba -DFDLAX-Ray Crystallography (27.5). Needleshaped crystals of 1 were prepared by slow evaporation of a filtered solution in a mixture of CH2Cl2 and MeOH. The entire isolated yield of 2 was dissolved in a small amount of filtered CH2Cl2, then MeOH was added, followed by H2O until the saturation point was reached. The solution was left to slowly evaporate at rt for 10 days to yield needleshaped crystals Data were collected at 173 K on a Siemens SMART PLATFORM equipped with a CCD area detector and a graphite monochromator utilizing MoKradiation ( = 0.71073 ). Cell parameters were refined using up to 8192 reflections. A full sphere of data (1850 frames) was collected using the -scan method (0.3 frame width). The first 50 frames were remeasured at the end of data collection to moni tor instrument and crystal stability ( maximum correction on I was < 1 %). Absorption corrections by integration were applied based on measured indexed crystal faces. The structure of 1 was solved by the Direct Methods in SHELXTL6 and refined using fullmat rix least squares. The non-H atoms were treated anisotropically, whereas the hydrogen atoms were calculated in ideal positions and were resid ing on their respective carbon atoms. All acidic protons were obtained from a Difference Fourier map and refined freely. In addition to the molecule, the asymmetric unit contains a methanol molecule. The value of the Flack x parameter is -0.16(14). A very small value and a very small standard uncertainty mean that the current enantiomer is the correct one, consistent with the analysis of chemical degradation products. We Corresponding in tR to its enantiomer (2 S ,3 S )Maba-LFDLA Corresponding in tR to its enantiomer (2S,3 R )Maba-LFDLA

PAGE 83

83 believe that the deviation of our Flack x parameter from zero is due to the low diffraction of the small crystal used thus giving weak higher 2-theta reflections. A total of 740 parameters were refined in the final cycle of refinement using 4937 reflections with I > 2 (I) to yield R1 and wR2 of 7.43% and 15.81%, respectively. Refinement was done using F2. The structure of 3 was solved by the Direct Methods in SHELXTL6 and refined using full matrix least squares. The nonH atoms were treated anisotropically, whereas the hydrogen atoms were calculated in ideal positions and were residing on their respective carbon atoms. In addition to the molecule, there is a methanol and water molecule in the asymmetric unit. They are both disordered and were refined in two parts with their site occupation factors dependently refined. A total of 730 parameters were refined in the final cycle of refinement using 3804 reflections with I > 2 (I) to yield R1 and wR2 of 5.71% and 8.84%, respectively. Refinement was performed using F2. Molecular Modeling of Grassypeptolide A (1) The simulations were performed on a Dell PC with a 3.2 GHz Intel Pentium 4 processor, running Sybyl 7.3 under the Ubuntu Linux 7.04 operating system. The Tripos forcefield was used for all simulations. Random starting structures were generated by drawing 1 differently in ChemDraw Ultra 10.0, then they were converted to three dimensional mol2 files using Chem3D Pro 10.0. ROESY constraints were obtained by integration of correlations in MestReNova 5.0.32367, of spectra obtained using the following mixing times: 100, 200, 300 and 400 ms (in DMSOd6). The correlation between the geminal protons H2-22 was used as the calibration reference, as it was consist ently one of the largest signals across mixing times, indicating little TOCSY-type interference. Correlations were stratified into weak, medium and strong NOEs (3.5.0, 2.5.5, <2.5 respectively) for each spectrum. Interresidue correlations occurring in

PAGE 84

84 two or more of the spectra were used, resulting in 46 restraints. Pseudoatoms were used for methylenes where the protons could not be stereospecifically assigned, as well as for magnetically equivalent H -31/H-35. In these cases a correction of 1.0 per pseudoatom was added to the upper limit of the constraint. Pseudoatoms were also used in the case of methyls, although a correction was not added to constraints involving them. Additionally, torsional angle constraints could be obtained from the three a mide NH sign als, using a Karplus equation derived *The random structures were subjected to the following steps: 1. Restrained energy minimization (REM), 2. Distance geometry (DG), 3. REM, 4. Restrained molecular dynamics (RMD), and 5. REM. Chirality and distance constraints (force constant 2.0 kcal/mol2) were applied throughout the process. Charges were calculated in Sybyl using the GasteigerHuckel option, and a dielectric constant of 47.24 was used (DMSO at 20 C). The DG procedure consisted of bounds generation, bounds smoothening, and embedding of coordinates; this was followed by an optimization procedure, where the structure was minimized then subjected to simulated annealing (SA, 2000 K to 200 K over 100,000 fs, step time 0.3 fs) and then another round of minimization. RMD was run at 500 K for 1 ns, with a step size of 1 fs. Following simulation, the structures were overlaid in PyMol 0.99rc6. For these, a relatively weak force constant of 0.005 kcal/mol deg2 was used. The trans conformation of amide bonds could be ascertained by the relevant ROESY correlations. In the simulations these were locked into planar conformations using a strong force constant of 2.0 kcal/mol deg2. Using m odified Karplus equation 3JNHH = 8.40cos2 1.36cos + 0.33, see Vgeli, B.; Ying, J.; Grishaev, A.; Bax, A. J. Am. Chem. Soc. 2007, 129 9377.

PAGE 85

85 Molecular Modeling of Grassypeptolide C (3) Because of the general similarity of proton and carbon chemical shifts of 1 and 3, the same distance and angle constraints were used as in the previously reported modeling of 1,73 except that the amide bond between N Me Phe and Pro was set to cis due to a ROESY correlation between H 28 and H 38 in 3. Also, four additional distance constraints were added based on ROESY correlations unique to 3. The modeling procedure used was identical to that previously used for 1,73 with ten random structures of 3 being subjected to 1) minimization, 2) distance geometry, 3) minimization and 4) molecular dynamics in Sybyl 7.3. Constraints were applied at every step, and the distance geometry procedure consisted of bounds generation, bounds smoothening, and embedding of coordinates, followed by an optimization procedure where the structures were minimized and subjected to simulated annealing (SA, 2000 K to 200 K over 100,000 fs, step time 0.3 fs) and then another round of minimization. Dynamics were run at 500 K for 1 ns, with a step size of 1 fs. Following simulation, structures were overlaid in PyMol by pair fitting backbone carbons only. Biological Activity HT29 and HeLa cells were cultured in Dulbeccos modified Eagle medium (DMEM; Invitrogen) containing 10% fetal bovine serum (Hyclone) in a humidified atmosphere containing 5% CO2 at 37 C. Cells were seeded i nto 96 well plates at a density of 10 000 cells/well (HT29) or 3 000 cells/well (HeLa), in 100 L medium. After 24 h, compounds 1 3 were added to wells at varying concentrations (as 1 L stock solutions in DMSO). Taxol was used as a positive control for cytotoxicity, and DMSO alone was used as a negative control. After 48 h treatment the plates were developed with MTT dye according to the manufacturers protocol (Promega). Taxol exhibited IC50s of 2.2 and 1.7 nM for HT29 and HeLa cells, respectively.

PAGE 86

86 Ce ll Cycle Analysis HT29 cells were seeded in 6 cm dishes (650 000 cells/dish in 3 mL DMEM). After 24 h incubation, various concentrations of 1 and 3 were added to the dishes in 10 L DMSO. After a further 24 h, cells were washed with PBS and then detached with 600 L trypsin (Invitrogen). DMEM (2 mL) was added to each dish, and the cell suspensions were centrifuged at 650g for 10 min. The supernatant was discarded and the cells were resuspended in 500 L PBS and centrifuged again at 650g for 10 min. The supernatant was discarded and the cells were resuspended in 300 L PBS before 700 L ice cold EtOH was added. Cells were incubated at 20 C for 30 min, then centrifuged at 890g for 10 min. The EtOH/PBS was removed, then cells were resuspended in 500 L PBS containing 1 mM EDTA and 1 mg/mL RNa se A (Sigma). The cells were incubated at 37 C for 30 min, with shaking, and then 5 L propidium iodide (1 mg/mL, Invitrogen) was added to each tube. Fluorescence from propidium iodide DNA complexes were quantifi ed using FACScan (Becton Dickinson). Circular Dichroism Spectra Aliquots of 1 (200 g) were added to various amounts of CuCl2 in CH2Cl2 MeOH (1:100, total volume 400 L). Data were collected at 25 C in the range 200 350 nm. Detection of Metal Complexes by Mass Spectrometry Solutions of 1 (10 g/mL) were made containing various amounts of Cu2+ or Zn2+ in CH2Cl2 MeOH (1:100), and directly infused the ESIMS at a rate of 10 L/min. MS parameters were as follows: DP 113.5, EP 4.5, CEP 45, CUR 10, IS 5500, TEM 400, GS1 20, GS2 10.

PAGE 87

87 Table 2 -1. NMR s pectral data for grassypeptolide A ( 1) at 500 MHz (1H) and 100 MHz (13C) in CDCl3 C/H no. H ( J in Hz) C a 1 H 1 H COSY HMBC b ROESY Maba 1 172.5, s (A) 2 2.51, qd (6.9, 6.2) 45.5, d H 3, H 3 5 1, 3, 4, 5, 49 d H 3 H 3 4, H 3 5 3 4.18, dqd (6.8, 6.7, 6.2) 48.6, d H 2, H 3 4, NH (A) 1, 2, 4, 5, 6 H 2, H 3 4, H 3 5 4 1.16, d (6.7) 19.7, c q H 3 2, 3 H 2, H 3 5 1.10, d (6.9) 14.6, q H 2 1, 2, 3 H 2, H 3, H 49, H 52/56 NH 7.40, br d (6.8) H 3 H 7 Thr 6 169.8, s (B) 7 4.45, dd (7.8, 6.4) 59.2, d H 8, NH (B) 6, 8, 9, 10 H 8, H 3 9, H 3 16, H 41a, NH (A), NH (B) 8 4.02, dq (6.4, 6.2) 68.8, d H 7, H 3 9 H 7, H 3 9, H 43, NH (B) 9 1.23, d (6.2) 19.7, c q H 8 7, 8 H 7, H 8, H 3 16, H 22a, H 43, NH (B) OH 3.96, br NH 7.12, d (7.8) H 7 7, 8, 10 H 7, H 8, H 3 9, H 11, H 12b N Me Leu 10 170.3, s (C) 11 4.92, m 56.7, d H 12a, H 12b 13, 17 H 3 15, H 3 16, NH (B) 12a 1.85, m 36.9, t H 11, H 12b, H 13 10, 11, 13, 14, 15 H 12b, H 13, H 3 14, H 3 15, H 3 16 12b 1.7 2, ddd ( 14.2, 8.1, 6.2) H 11, H 12a, H 13 10, 11, 13, 14, 15 H 12a, H 3 14, H 3 15, H 3 16, NH (B) 13 1.55, m 25.1, d H 12a, H 12b, H 3 14, H 3 15 11, 14, 15 H 12a, H 3 14, H 3 15, H 3 16 14 0.95, d (6.6) 23.2, q H 13 12, 13, 15 H 12a, H 12b, H 13, H 3 16 1 5 0.90, d (6.5) 22.1, q H 13 12, 13, 14 H 11, H 12a, H 12b, H 13, H 3 16 16 3.15, s 32.3, q 11, 17 H 7, H 3 9, H 11, H 12a, H 12b, H 13, H 3 14, H 3 15, H 18, H 19a, H 21 Aba thn ca 17 170.4, s (D) 18 5.32, ddd (9.5, 9.1, 1.8) 77.8, d H 19a, H 19b, H 21 17, 19, 20 H 3 16, H 19b, H 22a, H 3 23 19a 3.58, dd ( 9.9, 9.1) 33.4, t H 18, H 19b 17, 18, 20 H 3 16, H 19b 19b 3.27, dd ( 9.9, 9.5) H 18, H 19a 17, 18, 20 H 18, H 19a, H 21 20 178.5, s 21 4.64, m 54.4, d H 18, H 22a, H 22b, NH (D) 20 H 3 16, H 19b, H 22a, H 22b, H 3 23, NH(D) 22a 2.18, m 25.2, t H 21, H 22b, H 3 23 23 H 3 9, H 18, H 21, H 22b, H 3 23 22b 1.97, m H 21, H 22a, H 3 23 20, 21, 23 H 21, H 22a, H 3 23, H 41b, H 43, NH(D) 23 0.96, t (7.2) 11.0, q H 22a, H 22b 21, 22 H 18, H 21, H 2 2a, H 22b, H 31/35, NH (D) NH 7.53, d (7.9) H 21 21, 22, 24 H 21, H 22b, H 3 23, H 25, H 29a, H 38, H 41b N Me Phe thn ca 24 171.0, s (E) 25 5.30, m (X of ABX) 79.3, d H 26a/b 24, 27 H 26a/b, NH (D) 26a/b 3.70, m (2H, AB of ABX) 37.7, t H 26b, H 25 24, 25, 27 H 25 27 177.2, s 28 3.83, dd (9, 3.5) 69.0, d H 29a, H 29b 27, 37 H 29b, H 31/35, H 3 36

PAGE 88

88 Table 2 -1. Continued 29a 3.57, dd ( 13.9, 9) 35.3, t H 28, H 29b 27, 28, 30, 31/35 H 29b, H 31/35, H 3 36, H 3 45, NH (D) 29b 3.44, dd ( 13.9, 3.5) H 28, H 29a 28, 30, 31/35 H 28, H 29a, H 31/35 30 138.2, s 31/35 7.35, m 129.8, d H 32/34 29, 33 H 3 23, H 28, H 29a, H 29b, H 3 36, H 44 32/34 7.34, m 128.7, d H 31/35, H 33 30 33 7.25, m 126.7, d H 32/34 36 2.78, s 39.6, q 28, 37 H 28, H 29a, H 31/35, H 38, H 39a/b Pro 37 173.0, s (F) 38 4.77, dd (7.4, 5.5) 57.0, d H 39a/b 37, 39, 40, 41, 42 H 3 36, H 39a/b, H 3 47, NH (D) 39a/b 2.04, m (2H) 27.5, t H 38, H 40a, H 40b 37, 38, 40, 41 H 3 36, H 38, H 40b, H 41a, H 41b 40a 2.12 m 24.8, t H 39a, H 39b, H 40b, H 41a, H 41b 38, 39, 41 H 40b, H 41a, H 41b 40b 1.86, m H 39a, H 39b, H 40a, H 41a, H 41b 38, 39, 41 H 39a/b, H 40a, H 41a, H 41b 41a 3.69, m 47.6, t H 40a, H 40b, H 41b 38, 39, 40 H 7, H 39a/b, H 40a, H 40b, H 41b, H 43, H 50a, H50b 41b 3.60, m H 40a, H 40b, H 41a 39, 40 H 22b, H 39a/b, H 40a, H 40b, H 41a, H 43 N Me Val 42 167.8, s (G) 43 4.93, d (10.9) 60.3, d H 44 42, 44, 45, 46, 47, 48 H 8, H 9, H 22b, H 41a, H 41b, H 44, H 3 45, H 3 46, H 3 47 44 2.42, dq q (10.9, 6.7, 6.4) 27.3, d H 43, H 3 45, H 3 46 42, 43, 45, 46 H 31/35, H 43, H 3 45, H 3 46, H 3 47 45 0.97, d (6.4) 19.5, q H 44 43, 44 H 29a, H 43, H 44 46 0.87, d (6.7) 18.2, q H 44 43, 44, 45 H 43, H 44, H 3 47, H 49 47 3.11, s 30.3, q 43, 48 H 7, H 38, H 43, H 44, H 3 46, H 53/55 Pla 48 171.1, s (H) 49 5.40, dd (9.9, 3.5) 72.0, d H 50a, H 50b 1, 50, 51 H 3 4, H 3 46, H 50a, H 50b, H 52/56 50a 3.12, dd ( 14.5, 9.9) 37.2, t H 49, H 50b 49, 51, 52/56 H 41a, H 49, H 50b, H 52/56 50b 3.00, dd ( 14. 5, 3.5) H 49, H 50a 48, 51, 52/56 H 41a, H 49, H 50a, H 52/56 51 135.6, s 52/56 7.21, m 129.2, d H 53/55 50, 54 H 3 4, H 49, H 50a, H 50b 53/55 7.30, m 128.6, d H 52/56, H 54 51 H 3 47 54 7.26, m 127.3, d H 53/55 aMultiplicity deduced from AP T and HMQC spectra. bProtons showing longrange correl ation with indicated carbon. cThese carbons have the same chemical shift. dAn unusual 4-bond HMBC correlation

PAGE 89

89 Table 2 -2. NMR spectral data for grassypeptolide B ( 2) in CDCl3 (600 MHz) C/H no. H ( J in Hz) C a 1 H 1 H COSY HMBC b ROESY Maba 1 172.7, s 2 2.55, qd (7.0, 6.8) 45.5, d H 3, H 3 5 1, 3, 4, 5 H 3, H 3 4, H 3 5 3 4.27, m 48.3, d H 2, H 3 4, NH 1, 2, 4, 6 H 2, H 3 4, H 3 5, H 31/35, H52/56 4 1.22, d (6.7) 19.5, q H 3 2, 3 H 2, H 3 5 1.15 d (7.0) 14.5, q 1, 2, 3 H 2, H 3, H 52/56 NH 7.31, m H 3 Thr 6 169.6, s 7 4.49, dd (7.9, 6.7) 58.8, d H 8, NH 6, 8, 9, 10 H 3 9, H 31/35, NH 8 4.03, m 68.5, d H 7, H 3 9 6 H 3 9 9 1.29, d (6.4) 19.7, q H 8 7, 8 H 7, H 8, H 3 16, H 3 22 OH 5 .02, br c NH 7.13, d (7.9) H 7 10 H 7 N Me Leu 10 170.3, s 11 5.02, br 56.1, d H 12a, H 12b 12a 1.89, m 36.4, t H 11, H 12b 10, 11, 13, 15 H 12b, H 3 14, H 3 16 12b 1.76, ddd ( 14.3, 7.9, 6.5) H 11, H 12a, H 13 10, 11, 13, 15 H 12a, H 3 14 H 3 15 13 1.59, m 24.8, d H 12b, H 3 14, H 3 15 12, 14 H 3 14, H 3 15, H 3 16 14 1.02, d (6.6) 23.0, q H 13 12, 13, 15 H 12a, H 12b, H 13, H 3 22 15 0.96, d (6.4) 21.9, q H 13 12, 13, 14 H 12b, H 13 16 3.22, s 31.6, q 11, 17 H 3 9, H 12a, H 13, H 18, H 25, H31/35, H 3 45 Ala thn ca 17 170.2, s 18 5.347, dd (10.4, 10.4) 77.6, d H 19a, H 19b 20 H 3 16, H 19a, H 19b 19a 3.71, dd ( 10.5, 10.4) 33.3, t H 18, H 19b 17, 18, 20 H 18, H 19b 19b 3.33, dd ( 10.5, 10.4) H 18, H 19a 17, 20 H 18, H 19a 20 178.9, s 21 4.90, dq (7.5, 7.1) 48.2, d H 3 22, NH 20, 22, 24 H 3 22, H 31/35, NH 22 1.65, d (7.1) 18.0, q H 21 20, 21 H 3 9, H 3 14, H 21, H 41a, H 41b, H 43, NH NH 7.73, d (7.5) H 21 21, 22, 24 H 21, H 3 22, H 25, H 2 26 N Me Phe thn ca 24 170.4, s 25 5.351, m 78.8, d H 2 26 24, 27 H 3 16, H 2 26, NH (Ala) 26 3.77, m (2H) 37.6, t H 25 24, 25, 27 H 25, H 31/35, H 52/56, NH (Ala) 27 177.5, s 28 3.91, dd (10.1, 3.2) 68.9, d H 29a, H 29b H 31/35, H 3 36 29a 3.65, dd ( 13.4, 10.1) 34.9, t H 28, H 29b 27, 28, 30, 31/35 H 31/35

PAGE 90

90 Table 2 -2. Continued 29b 3.48, dd ( 13.4, 3.2) H 28, H 29a 28, 30, 31/35 H 31/35, H 3 36 30 138.2, s 31/35 7.43, m 129.8, d H 32/34 29, 30, 33 H 3, H 7, H 3 16, H 21, H 2 26, H28, H 29a, H 29b, H336, H 38, H43, H 44, H345, H347, H 49 32/34 7.36, m 127.1, d H 31/35, H 33 33 7.43, m 128.6, d H 32/34 31/35 36 2.81, s 39.3, q 28, 37 H 28, H 29b, H 31/35, H 38 Pro 37 172.9, s 38 4.81, dd (8.4, 4.2) 57.0, d H 39a, H 39b 37, 39, 40, 41 H 31/35, H 3 36, H 39a, H 39b, H52/56 39a 2.11, m 27.4, t H 38, H 39b, H 40a, H 40b 37, 38, 41 H 38 39b 2.06, m H 38, H 39a, H 40a, H 40b 37, 40 H 38 40a 2.18, m 24.6, t H 39a, H 39bH 40b, H 41a, H 41b 38, 39, 41 H 40b 40b 1.93, m H 39a, H 39b, H 40a, H 41a, H 41b 38, 39, 41 H 40a 41a 3.76, m 47.4, t H 40a, H 40b, H 41b 39, 40 H 3 22, H 43 41b 3.67, m H 40a, H 40b, H 41a 39, 40 H 3 22, H 3 36, H 43 N Me Val 42 168.1, s 43 4.98, d (10.9) 60.0, d H 44 42, 44, 45, 46, 47, 48 H 3 22, H 31/35, H 41a, H 4 1b, H 44, H 3 45, H 3 46, H 50a 44 2.47, dqq (10.9, 6.6, 6.4) 27.1, d H 43, H 3 45, H 3 46 43, 45, 46 H 31/35, H 43, H 3 45, H 3 46, H 3 47 45 1.01, d (6.4) 19.2, q H 44 43, 44, 46 H 3 16, H 31/35, H 43, H 44 46 0.93, d (6.6) 17.9, q H 44 43, 44, 45 H 43, H 44, H 3 47 47 3.20, s 30.1, q 43, 48 H 31/35, H 3 46, H 49, H 54 Pla 48 171.0, s 49 5.40, dd (9.9, 3.0) 72.0, d H 50a, H 50b 1, 48, 50, 51 H 31/35, H 3 47, H 50a, H 50b, H 52/56 50a 3.17, dd ( 14.3, 9.9) 37.0, t H 49, H 50b 48, 49, 51, 52/56 H 43, H 49, H 50b, H 52/56 50b 3.06, dd ( 14.3, 2.7) H 49, H 50a 48, 51, 52/56 H 49, H 50a, H 52/56 51 135.7, s 52/56 7.27, m 129.1, d H 53/55 50, 54, 52/56 H 3, H 3 5, H 2 26, H 38, H 49, H 50a, H 50b 53/55 7.36, m 128.5, d H 52/56, H 54 51, 53/55

PAGE 91

91 Table 2 -2. Continued 54 7.32, m 126.8, d H 52/56 H 3 47 aMultiplicity derived from edited HSQC. bProtons showing long range correlation to indicated carbon. cOH signal assigned by default.

PAGE 92

92 Table 2 -3. NMR spectral data for g rassypeptolide C ( 3) in CD Cl3 at 600 MHz C/H no. H ( J in Hz) C a 1 H 1 H COSY b HMBC c ROESY b,d Maba 1 172.6, s 2 2.48, qd (6.9, 6.6) 45.7, d H 3, H 3 5 1, 3, 4, 5 H 3 H 3 4 H 3 5 3 4.22, m 48.7, d H 2, H 3 4, NH 1, 2, 4, 5, 6 H 2 H 3 4 H 3 5 4 1.18, d (6.9) 19.9, q H 3 2, 3 H 2 H 3 5 1.11, d (6.9) 14.6, q H 2 1, 2, 3 H 2 H 3 NH 7.65, br H 3 Thr 6 169.5, s 7 4.44, dd (6.9, 6.0) 59.2, d H 8, NH 6, 8, 9, 10 H 3 9 H 3 16 NH 8 3.99, m 69.2, d H 7, H 3 9 6 (w) H 3 9 NH 9 1.21, d (6.3) 19.6, q H 8 7, 8 H 7 H 8 H 3 16 OH NH 6.94, d (7.4) H 7 10 H 7 H 8 H 12b N Me Leu 10 170.6, s 11 4.70, br 57.6, d H 12a, H 12b H 3 15 H 3 16 12a 1.92, m 37.3, t H 11, H 12b, H 13 H 12b H 13 H 3 14 12b 1.66, ddd ( 14.3, 8.5, 5.8) H 11, H 12a, H 13 10, 11, 1 3, 14, 15 H 12a H 3 15 H 3 16 NH (Thr) 13 1.56, m 25.2, d H 12a (w), H 12b, H 3 14, H 3 15 H 12a H 3 14 H 3 16 14 0.955, m 23.2, q H 13 12, 13, 15 H 12a H 13 H 3 16 15 0.92, d (6.7) 22.1, q H 13 12, 13, 14 H 11 H 12b 16 3.171, s 33.1, q 11, 17 H 7 H 3 9 H 11 H 12b H 13 H 3 14 H 18 H 21 Aba thn ca 17 170.3, s 18 5.27, dd (9.9, 1.6) 78.3, d H 19a, H 19b 17, 20 H 3 16 H 19b 19a 3.60, dd ( 10.2, 1.6) 33.2, t H 18, H 19b 17 H 19b H 22b 19b 3.28, dd ( 10.2, 9.9) H 18, H 19a 17, 20 H 1 8 H 19a 20 177.8, s 21 4.55, m 54.6, d H 22a (w), H 22b, NH H 3 16 H 22a H 22b (w), H 3 23 H 25 e NH 22a 2.12, m 25.4, t H 21 (w), H 22b, H 3 23 H 21 H 22b H 3 23 22b 1.84, m H 21, H 22a, H 3 23 21 H 19a H 21 H 22a H 3 23 NH 23 0.94, m 11.0, q H 22a, H 22b 21 H 22a H 22b NH NH 7.12, d (7.6) H 21 21, 22, 24 H 21 H 22b H 3 23 H 25 H 28 N Me Phe thn ca 24 171.7, s 25 5.03, dd (10.2, 3.0) 78.1, d H 26a, H 26b 24, 27 H 21 e H 26a H 26b NH (Aba) 26a 3.67, dd ( 11.1, 3.0) 37 .4, t H 25, H 26b 24, 27 H 25

PAGE 93

93 Table 2 -3. Continued 26b 3.61, dd ( 11.1, 10.2) H 25, H 26a 24, 25 H 25 27 177.2, s 28 5.48, dd (9.1, 7.8) 59.2, d H 29a, H 29b 26, 27, 30, 36, 37 H 29a, H 31/35 H 3 36 H 38 NH (Aba) 29a 3.21, m 36.3, t H 28, H 29b 27, 28, 30, 31/35 H 28, H 31/35 29b 3.16, m H 28, H 29a 27, 28, 30, 31/35 H 31/35 30 135.6, s 31/35 7.23, m 128.8, d H 32/34 29, 30, 31/35 H 28 H 29a H 29b 32/34 7.33, m 129.0, d H 31/35, H 33 33 7.29, m 127.3, d H 32/34 36 3.1 69, s 30.7, q 37 H 28 H 38 H 39a H 39b H 40b Pro 37 173.2, s 38 4.80, dd (8.7, 5.0) 57.7, d H 39a, H 39b 37, 39, 40, 41 H 28 H 3 36 H 39a H 40a, H 40b, H41a (w) 39a 2.19, m 27.9, t H 38, H 39b, H 40a, H 40b H 3 36 H 38 H 39b, H 40b 39b 1.93, m H 38, H 39a, H 40a, H 40b 37, 38, 40, 41 H 3 36 H 39a, H 41a 40a 1.98, m 24.9, t H 39a, H 39b, H 40b, H 41a, H 41b H 38, H 40b H 41b 40b 1.84, m H 39a, H 39b, H 40a, H 41a, H 41b 39, 41 H 3 36, H 38, H 39a H 40a H 41a H41b 41a 3.97, m 48.1, t H 40a, H 40b, H 41b 39, 40 H 38 (w), H 39b H 40b H 43 41b 3.51, m H 40a, H 40b, H 41a 39, 40 H 40a H 40b H 43 N Me Val 42 168.5, s 43 4.95, d (11.1) 60.1, d H 44 42, 44, 45, 47, 48 H 41a H 41b H 44 H 3 45 H 3 46 H 3 47 44 2.30, m 27.3, d H 43, H 3 45, H 3 46 43, 46 H 43 H 3 45 H 3 46 H 3 47 45 0.960, m 19.2, q H 44 43, 44, 46 H 43 H 44 46 0.88, d (6.5) 18.3, q H 44 43, 44, 45 H 43 H 44 H 3 47 47 3.11, s 30.1, q 43, 48 H 43 H 44 H 3 46 H 49 Pla 48 171.2, s 49 5.33, dd (9.5, 3.2) 72.6, d H 50a, H 50b 50, 51 H 3 47 H 50b H 52/56 50a 3.06, dd ( 14.4, 9.5) 37.0, t H 49, H 50b 48, 49, 51, 52/56 H 52/56 50b 3.00, dd ( 14.4, 3.2) H 49, H 50a 48, 51, 52/56 H 49 H 52/56 51 135.8, s 52/56 7.20, m 129.2, d H 53/5 5 50, 53/55 H 49 H 50a H 50b 53/55 7.31, m 128.7, d H 52/55, H 54 51 54 7.29, m 127.3, d H 53/55

PAGE 94

94 aMultiplicity derived from edited HSQC spectrum. bCorrelations to NH protons in the same unit unless otherwise indicated. cProtons showing longrange correlation with indicated carbon. dCorrelations also observed in the ROESY spectrum of grassypeptolide A ( 1) in CDCl3 are shown in bold, and correlations that were used as extra constraints in molecular modeling are shown in red. eThis correlation was pr eviously observed in the ROESY spectrum of grassypeptolide A ( 1) in DMSO d6 but not the ROESY spectrum in CDCl3.

PAGE 95

95 Table 2 -4. NMR spectral data for g rassypeptolide A ( 1) at 600 MHz (1H) and 100 MHz (13C) in DMSO d6 C/H no. H ( J in Hz) C a 1 H 1 H COSY HMBC b ROESY Maba 1 171.6, s (A) 2 2.49, qd (6.0, 1.9) 43.9, d H 3, H 3 5 1, 3 H 3, H 3 4, H 3 5, NH (A) 3 3.95, dqd (8.6, 6.3, 1.9) 47.5, d H 2, H 3 4, NH (A) 1, 2 H 2, H 3 4, H 3 5, NH (A) 4 0.93, d (6.3) 19.16, c q H 2 2, 3 H 2, H 3, H 3 16, NH (A) 5 0.94, d (6.0) 14.1, q H 3 1, 2, 3 H 2, H 3, H 7, H 11, H 49, OH NH 7.46, d (8.6) H 3 3, 6 H 2, H 3, H 3 4, H 7, H 3 9, H 43, H 3 46 Thr 6 169.7, s (B) 7 4.17, dd (7.1, 7.1) 60.43, d H 8, NH (B) 6, 8, 9, 10 H 3 5, H 3 9, H 3 14, H 3 16, H 3 46, NH (A), NH (B), OH 8 3.96, dqd (7.1, 5.9, 5.2) 66.3, d H 7, H 3 9, OH 6 H 3 9, H 3 16, H 3 46, NH (B), OH 9 1.07, d (5.9) 19.20, c q H 8 7, 8 H 7, H 8, H 3 16, H 18, H 22a, NH (A), NH (B), OH OH 4.74, d (5.2) H 8 7, 8, 9 H 3 5, H 7, H 8, H 3 9, H 49, NH (B) NH 7.09, d (7.4) H 7 7, 11 H 7, H 8, H 3 9, H 11, H 12a/b, H 3 16, OH N Me Leu 10 170.4, s (C) 11 5.16, t (7.6) 54.4, d H 12a/b 10, 12, 13, 16, 17 H 3 5, H 12a/b, H 13, H 3 14, H 3 15, H 3 16, H 50a, NH (B) 12a/b 1.62, t (7.6) 36.2 t H 11, H 13 10, 11, 13, 14, 15 H 11, H 13, H 3 14, H 3 15, H 3 16, NH (B) 13 1.44, tqq (7.6, 7.0, 6.3) 24.4, d H 12a/b, H 3 14, H 3 15 11, 12, 14, 15 H 11, H 12a/b, H 3 14, H 3 15, H 3 16, H 18 14 0.88, d (7.0) 23.2, q H 13 12, 13, 15 H 7, H 11, H 12a/b, H 13, H 3 16, H 18 15 0.78, d (6.3) 22.0, q H 13 12, 13, 14 H 11, H 12a/b. H 13, H 3 16, H 18 16 3.01, s 30.4, q 11, 17 H 7, H 8, H 3 9, H 11, H 12a/b, H 13, H 3 14, H 3 15, H 18, H 21, NH (B) Aba thn ca 17 169.8, s (D) 18 5.53, ddd (9.6, 9.6, 1.2) 77. 2, d H 19a, H 19b, H 21 17, 20 H 3 9, H 13, H 3 14, H 3 15, H 3 16, H 19a, H 19b, H 21 19a 3.47, dd ( 9.8, 9.6) 32.9, t H 18, H 19b 17, 18 H 18, NH (D) 19b 3.29, dd ( 9.8, 9.6) H 18, H 19a 17, 20 H 18, NH (D) 20 176.9, s 21 4.43, m 53.3, d H 18, H 22a, H 22b, NH (D) H 3 16, H 18, H 22a, H 22b, H 3 23, H 25, NH (D) 22a 2.08, m 24.7, t H 21, H 22b, H 3 23 H 3 9, H 21, H 22b, H 3 23 22b 1.92, m H 21, H 22a, H 3 23 21, 23 H 21, H 22a, H 3 23, H 43, NH (D) 23 0.85, t (7.4) 10.7, q H 22a, H 22b 21, 22 H 21, H 22a, H 22b, NH (D) NH 7.59, d (7.9) H 21 21, 22, 24 H 19a, H 19b, H 21, H 22b, H 3 23, H 25 N Me Phe thn ca 24 170.1, s (E) 25 5.18, dd (10.6, 10.6) 78.8, d H 26a, H 26b 24, 26, 27 H 21, H 26a, H 26b, NH (D)

PAGE 96

96 Table 2 -4. Continued 26a 3.71 dd ( 10.9, 10.6) 36.7, t H 26b, H 25 24 H 25, H 26b 26b 3.45, dd ( 10.9, 10.6) H 26a, H 25 24, 27 H 25, H 26a 27 176.6, s 28 4.22, b 67.0, d H 29a, H 29b H 29b, H 31/35, H 3 36 29a 3.42, dd ( 12.8, 8.6) 34.7, t H 28, H 29b 30, 31/35 H 31/35 29b 3.30, dd ( 12.8, 2.0) H 28, H 29a 31/35 H 28, H 31/35 30 138.2, s 31/35 7.40, d (7.2) 129.9, d H 32/34 29, 31/35, 33 H 28, H 29a, H 29b, H 3 36, H 38, H 44, H 3 45 32/34 7.33, m 128.3, d H 31/35, H 33 30 33 7.25, m 126.3, d H 32/34 31/35 36 2.68, s 38.6, q 37 H 28, H 31/35, H 38, H 39a, H 39b, H 41a Pro 37 172.6, s (F) 38 4.69, dd (8.4, 4.6) 57.2, d H 39a, H 39b 39, 42 H 31/35, H 3 36, H 39a, H 39b, H 40a, H 3 47 39a 2.10, m 26.8, t H 38, H 40a, H 40b 40 H 3 36, H 38, H 39b, H 40 b 39b 1.83, m H 38, H 40a, H 40b H 3 36, H 38, H 39a, H 40a 40a 2.01, m 24.6, t H 39a, H 39b, H 40b, H 41a, H 41b 38, 39 H 38, H 39b, H 40b, H 41a 40b 1.74, m H 39a, H 39b, H 40a, H 41a, H 41b 38, 39, 41 H 39a, H 40a, H 41a 41a 3.39, ddd ( 9.6, 7 .6, 7.6) 46.7, t H 40a, H 40b, H 41b H 3 36, H 40a, H 40b, H 43 41b 3.33, m H 40a, H 40b, H 41a 38, 39, 40 H 43 N Me Val 42 166.0, s (G) 43 4.73, d (10.0) 60.45, d H 44 42, 44, 45, 47, 48 H 22b, H 41a, H 41b, H 44, H 3 45, H 3 46, H 3 47, H50b, NH (A) 44 2.33, dqq (10.0, 6.7, 6.4) 26.2, d H 43, H 3 45, H 3 46 42, 43, 45, 46 H 31/35, H 43, H 3 45, H 3 46, H 3 47 45 0.87, d (6.7) 19.8, q H 44 43, 44, 46 H 31/35, H 43, H 44 46 0.70, d (6.4) 17.8, q H 44 43, 44, 45 H 7, H 8, H 43, H 44, H 3 47, H 49, NH (A) 47 2.99, s 30.2, q 43, 48 H 38, H 43, H 44, H 3 46, H 49 Pla 48 170.5, s (H) 49 5.52, dd (10.2, 5.5) 71.0, d H 50a, H 50b 1, 50 H 3 5, H 43, H 3 46, H 3 47, H 50a, H 50b, OH 50a 3.12, dd ( 13.2, 5.5) 36.5, t H 49, H 50b 51, 52/56 H 11, H 3 15, H 40b, H 49 50b 3.02, dd ( 13.2, 10.2) H 49, H 50a 49, 51, 52/56 H 43, H 49 51 135.9, s 52/56 7.33, m 129.5, d H 53/55 50, 52/56, 54 53/55 7.30, m 128.2, d H 52/56, H 54 51 54 7.26, m 127.0, d H 53/55

PAGE 97

97 aMultiplicity deduced from APT and e dHSQC spectra. bProtons showing long-range correlation with indicated carbon. cInterchangeable.

PAGE 98

98 Table 2 -5. Distance constraints for molecular modeling of grassypeptolide A for 10 random structures and violations Atom 1 Atom 2 Lower () Upper () S tructures in violation a >1 (6 total, X ray like family) Structures in violation >1 (4 total, family dissimilar to Xray structure) H7A H1 3.5 5.0 H1 P9 3.5 5.0 H1 H43A 3.5 5.0 2, 3 H1 P46 3.5 5.0 2, H7A P14 3.5 5.0 (1, 6, 9, 10) b (2, 3, 4, 8) b H7A P16 3.5 5.0 4 H7A P46 3.5 5.0 2 H8A P16 3.5 5.0 H8A P46 3.5 5.0 8 H11A H2 2.5 3.5 H2 P12 3.5 6.0 H2 P16 3.5 5.0 H11A P16 3.5 5.0 H11A P50 3.5 6.0 P12 P16 3.5 6.0 H13A P16 3.5 5.0 P14 P16 3.5 5.0 P15 P16 3.5 5.0 2 H18A P9 3.5 5.0 3, 8 H18A H13A 3.5 5.0 7 H18A P15 3.5 5.0 7 2, 4 H18A P16 3.5 5.0 H21A H18A 3.5 5.0 H21A P16 3.5 5.0 2, 8 P9 P22 3.5 6.0 H25A H5 3.5 5.0 H25A H21A 3.5 5.0 H28A P36 3.5 5.0 P3135 P36 3.5 5.0 H38A P3135 3.5 5.0 H44A P3135 3.5 5.0 3, 4 P3135 P45 3.5 5.0 9 P36 P39 3.5 6.0 H38A P36 3.5 5.0 P36 P41 3.5 6.0 H43A P22 3.5 6.0 2, 3 H43A P41 2.5 4.5 H43A P47 3.5 5.0 H43A P50 3.5 6.0 H44A P47 3.5 5.0 P46 P47 3.5 5.0 H49A H43A 3.5 5.0 H49A P46 3.5 5.0 P15 P50 3 .5 6.0 3, 8

PAGE 99

99 Table 2 -5. Continued P40 P50 3.5 7.0 3 H11A P5 3.5 5.0 2, 3, 4, 8 a Nomenclature for the atoms is as in the X ray structure cif file. P indicates a pseudoatom at the indicated position. 3135 is a pseudoatom for the two aromatic protons H-31 and H-35. b Diastereotopic methyl groups of Leu were not assigned stereospecifically, yet one ROESY peak was used here, potentially causing the violation for the orientation of the side chain.

PAGE 100

100 Table 2 -6. Angle constraints used in molecular modeling of grassypeptolide A ( 1) Atom 1 Atom 2 Atom 3 Atom 4 Const Value ( ) Pwr H1 N1 C3 H3A 0.005 180 2 H2 N2 C7 H7A 0.005 180 2 H5 N5 C21 H21A 0.005 180 2 H1 N1 C6 O3 2 180 2 H2 N2 C10 O5 2 180 2 C16 N3 C17 O6 2 180 2 H5 N5 C24 O7 2 180 2 C36 N7 C3 7 O8 2 180 2 C41 N8 C42 O9 2 180 2 C47 N9 C48 O10 2 180 2

PAGE 101

101 Table 2 -7. Distance constraints used for molecular modeling of grassypeptolide C ( 3) Atom 1 Atom 2 Constant Lower () Upper () Pwr H7A H1 2 3.5 5 2 H1 P9 2 3.5 5 2 H1 H43A 2 3.5 5 2 H1 P46 2 3.5 5 2 H7A P14 2 3.5 5 2 H7A P16 2 3.5 5 2 H7A P46 2 3.5 5 2 H8A P16 2 3.5 5 2 H8A P46 2 3.5 5 2 H11A H2 2 2.5 3.5 2 H2 P12 2 3.5 6 2 H2 P16 2 3.5 5 2 H11A P16 2 3.5 5 2 H11A P50 2 3.5 6 2 P12 P16 2 3.5 6 2 H13A P16 2 3.5 5 2 P14 P16 2 3.5 5 2 P15 P16 2 3.5 5 2 H18A P9 2 3.5 5 2 H18A H13A 2 3.5 5 2 H18A P15 2 3.5 5 2 H18A P16 2 3.5 5 2 H21A H18A 2 3.5 5 2 H21A P16 2 3.5 5 2 P9 P22 2 3.5 6 2 H25A H5 2 3.5 5 2 H25A H21A 2 3.5 5 2 H28A P36 2 3.5 5 2 P3135 P36 2 3.5 5 2 H38A P3135 2 3.5 5 2 H44A P3135 2 3.5 5 2 P3135 P45 2 3.5 5 2 P36 P39 2 3.5 6 2 H38A P36 2 3.5 5 2 P36 P41 2 3.5 6 2 H43A P22 2 3.5 6 2 H43A P41 2 2.5 4.5 2 H43A P47 2 3.5 5 2 H43A P50 2 3.5 6 2 H44A P47 2 3.5 5 2 P46 P47 2 3.5 5 2 H49A H43A 2 3.5 5 2 H4 9A P46 2 3.5 5 2 P15 P50 2 3.5 6 2 P40 P50 2 3.5 7 2 H11A P5 2 3.5 5 2 P22 P19 2 3.5 7 2 H5 H28A 2 3.5 5 2 H28A H38A 2 3.5 5 2 H49A P47 2 2.5 3.5 2

PAGE 102

102 Table 2 -8. Angle constraints used in molecular modeling of grassypeptolide C ( 3) Atom 1 Atom 2 At om 3 Atom 4 Const Value ( ) Pwr H1 N1 C3 H3A 0.005 180 2 H2 N2 C7 H7A 0.005 180 2 H5 N5 C21 H21A 0.005 180 2 H1 N1 C6 O3 2 180 2 H2 N2 C10 O5 2 180 2 C16 N3 C17 O6 2 180 2 H5 N5 C24 O7 2 180 2 C36 N7 C37 O8 2 0 2 C41 N8 C42 O9 2 180 2 C47 N9 C48 O10 2 180 2

PAGE 103

103 Table 2 -9. Energies and constraint violations of grassypeptolide C ( 3) molecular models Struc 1 b Energy 60.12 kcal/mol Atom 1 Atom 2 Range () Violation a () H7A P14 3.5 5 1.715 H7A P16 3.5 5 1.053 H8A P46 3.5 5 2.453 H18A P15 3.5 5 1 .141 H21A P16 3.5 5 2.249 H43A P22 3.5 6 1.182 P15 P50 3.5 6 1.61 H11A P5 3.5 5 2.133 Struc 2 Energy 62.76 kcal/mol Atom 1 Atom 2 Range () Violation () H1 P46 3.5 5 1.14 H7A P14 3.5 5 2.537 H8A P46 3.5 5 1.817 H18A P9 3.5 5 1.768 H21A P1 6 3.5 5 2.363 P15 P50 3.5 6 1.091 H11A P5 3.5 5 2.286 Struc 3 Energy 38.46 kcal/mol Atom 1 Atom 2 Range () Violation () P14 P16 3.5 5 1.11 P15 P16 3.5 5 1.111 H18A P9 3.5 5 1.012 H18A H13A 3.5 5 1.139 H18A P15 3.5 5 1.257 H44A P3135 3.5 5 1.012 Struc 4 Energy 37.82 kcal/mol Atom 1 Atom 2 Range () Violation () H7A P14 3.5 5 2.157 H18A H13A 3.5 5 1.57 Struc 5 Energy 60.65 kcal/mol Atom 1 Atom 2 Range () Violation () H7A H1 3.5 5 1.116 H43A H1 3.5 5 1.062 H7A P14 3.5 5 2.558 H7A P16 3.5 5 1.14 H18A P15 3.5 5 1.17 H21A P16 3.5 5 1.125 P9 P22 3.5 6 1.415 H44A P3135 3.5 5 1.552 H11A P5 3.5 5 1.865 Struc 6 Energy 33.93 kcal/mol Atom 1 Atom 2 Range () Violation () H7A P14 3.5 5 2.575 Struc 7 Energy 37 .01 kcal/mol Atom 1 Atom 2 Range () Violation () P15 P16 3.5 5 1.126

PAGE 104

104 Table 2 -9. Continued H18A P9 3.5 5 1.001 H18A P15 3.5 5 1.098 H44A P3135 3.5 5 1.067 Struc 8 Energy 32.67 kcal/mol Atom 1 Atom 2 Range () Violation () H18A P9 3.5 5 1. 037 Struc 9 Energy 30.62 kcal/mol Atom 1 Atom 2 Range () Violation () H18A P9 3.5 5 1.319 Struc 10 Energy 35.22 kcal/mol Atom 1 Atom 2 Range () Violation () H7A P14 3.5 5 2.057 aOnly violations of > 1 to the upper bound of constraints are shown. bMembers of the higher energy conformational family are shown in red, while members of the lower energy conformational family are shown in blue.

PAGE 105

105 Table 2 -10. IC50s for cytotoxicity exhibited by grassypeptolides A C ( 1 3) against two cancer cell lines Cell Line Grassypeptolide A ( 1 ) Grassypeptolide B ( 2 ) Grassypeptolide C ( 3 ) HT29 1.22 M 4.97 M 76.7 nM HeLa 1.01 M 2.93 M 44.6 nM

PAGE 106

106 Figure 2 -1. Structure s of grassypeptolide A ( 1 ), B ( 2) and C ( 3).

PAGE 107

107 Figure 2 -2. 21and 24membered macrocyclic marine metabolites closely related to 1.

PAGE 108

108 Figure 2 -3. MS/MS fragmentation data for grassypeptolides A C ( 1 3).

PAGE 109

109 Figure 2 -4. Displacement ellipsoids (50% probability) for the Xray crystal structure of grassypeptolide A ( 1 ).

PAGE 110

110 Figure 2 -5. Displacement ellipsoids (50% probability) for the Xray crystal structure of grassypeptolide B ( 2).

PAGE 111

111 Figure 2-6. Lowest energy conformational family most consistent with ROESY data (X ray structure overlaid in green).

PAGE 112

112

PAGE 113

113 Figure 2 -7. Molecular mo deling of grassypeptolide C ( 3); a) lower energy conformational family of models of grassypeptolide C ( 3); b) select models showing two possible orientations of N Me -Phe side chain (lowestenergy examples of each); c) comparison of lowest energy conformati on of 3 (green) and the crystal structure of 1 (purple), showing N Me Phe -protons to illustrate configuration at this center and the amide bond that is trans and cis in 1 and 3, respectively.

PAGE 114

114 Figure 2 -8. Cell cycle analysis of HT29 cells treated with grassypeptolides A ( 1) and C ( 3 ) for 24 h. Taxol served as a positive control for G2 arrest.

PAGE 115

115 Figure 2 -9. Structure of the bisCu(II) -ascidiacyclamide complex, with TAO domains shown in red.

PAGE 116

116 Figure 2 -10. Circular dichroism spectra of grassypeptolide A ( 1) in the presence and absence of Cu2+ and Zn2+. a) CD spectra of 1 alone and after addition of one and two equivalents of Cu2+ to 1; b) differences induced in the CD spectrum of 1 by addition of Cu2+; c) CD spectra of 1 alone and after addition of one or two equivalents of Zn2+; d) differences induced in the CD spectrum of 1 by addition of Zn2+.

PAGE 117

117 Figure 2 -11. a) Cu2+ and Zn2+ adducts observed for 1; b) Cu2+ and Zn2+ adducts observed for 3; c) calculated isotope patterns for the observed metal adducts.

PAGE 118

118 CHAPTER 3 GRASSYSTATINS A C, POTENT CATHEPSIN E INHIBITORS FROM LYNGBYA CONFERVOIDES*Introduction Although all proteases share in common the ability to cleave peptide bonds, their various regulatory roles have made them interesting targets for dru g discovery. They are involved in such diverse processes as blood coagulation, the cell cycle, infection and neurodegenerative disorders, among others.90,91 However, because of the ubiquity of proteolytic signaling, potential therapeutic inhibitors must be selective in order to reduce the chance of off target effects. Non selective inhibition of metalloproteases is thought to be the reason for muskoskeletal side effects seen in early matrix metalloprotease (MMP) inhibitors that were evaluated for cancer treatment .92 It is with this in mind that we have been engaged in a systematic search for protease inhibitors amongst natural products produced by marine cyanobacteria. This ancient group of organisms is known to produce a vast array of secondary metabolites, often possessing potent cyt otoxicity.37,43 Such metabolites have presumably been optimized by millions of years of natural selection to be pot ent and specific to their intended target. In some cases, the ecological target may be pro tease enz ymes. Already, our group has identified several lyngbyastatins that potently inhibit the serine protease elastase.46,48 Cyanobacteria produce modified peptides through the non-ribosomal peptide synthase (NRPS) pathway or through combinations of the NRPS and polyketide synthase (PKS) pathways.93 Both of these pathways are highly modular, presumably allowing evolution of bioactive compounds through combinatorial alterations. The Reproduced in part with permission from Kwan, J. C.; Eksioglu, E. A.; Liu, C.; Paul, V. J.; Luesch, H. J. M ed. Chem. 2009, 52, 5732. Copyright (2009) American Chemical Society.

PAGE 119

119 modular architecture of these pathways has led several groups to pursue combinatorial biosynthesis of novel non-natural products.94 Herein, we describe the isolation, structure determination, and biological evaluation of three linear modified peptides, grassystatins A C ( 4 6, Figure 31). All three contain a statine unit [(3S,4S)-4amino -3-hydroxy-6methylheptanoic acid, Sta], which was first described in the broad-spectrum natural aspartic protease inhibitor pepstatin A (Figure 32).95,96 In the latter, statine arises from a mixed NRPS/PKS pathway that condenses leucine and malonate units.97 The closest structural relatives among cyanobacterial natural products are tasiamide98,99 and tasiamide B100,101 (Figure 3-2). Tasiamide does not contain a statine unit and there are also some differences in configuration of several amino acid residues (vide infra). To test aspartic and other protease inhibitory activity, we screened compound 4 against 59 diverse proteases, and found selective inhibition of the aspartic proteases cathepsins D and E. Notably, compound 4 6 discriminate between these two enzymes, while pepstatin A does not. We demonstrate the inhibition of cathepsins in a cellular system, and also the disruption of antigen presentation by dendritic cells (DCs), a process in which cathepsin E has been recently implicated.102,103 Isolation and Structure Determinatio n Samples of the cyanobacterium, identified as Lyngbya cf. confervoides were collected off Grassy Key as described previously as described in Chapter 2, and off Key Largo, Florida. The nonpolar extract (MeOH and reversed phase HPLC to furnish 4 and 5. Compound 6 was found only in the Key Largo collection. HRESI/APCIMS and NMR data for 4 suggested a molecular formula of C58H95N9O16 ( m / z 1196.6812 for [M + Na]+, 1174.6988 for [M + H]+, 598.8455 for [M + H + Na]2+, and 587.8544

PAGE 120

120 for [M + 2H]2+ ). Perusal of the 1H and 13C NMR spectra revealed that it was a depsipeptide (Table 31), w ith several exchangeable proton signals characteristic of amides ( H ~6 to ~8), protons ( H ~4 to ~5), and some deshielded signals in both the 1H and 13C NMR spectra indicative of methines adjacent to an ester linkage ( H/C 5.13/78.1 and 4.70/77.5). There were also several N methyl signals ( H 3.01 and 2.30) and one O methyl apparent ( H 3.72). In addition two conformers were present in the ratio 15:1.* Analysis of the 1H NMR, 13C NMR, APT, COSY, edited HSQC, HMBC, ROESY and TOCSY spectra in CDCl3 of 4 (Table 3-1 and Appendix ) revealed the presence of four regular ami no acid units (Ala, Thr, Asn and Leu). In addition, O Me -Pro, N Me -Phe, N ,N Me2Val and statine (Sta, C -25 C-32) were deduced. Given that there were two terminal groups ( O Me -Pro and N ,N Me2Val), it was clear from the degree of unsaturation that the compound was linear (all 16 double bond equivalents were accounted for). The hydroxyl protons for Sta and Thr The minor signals present in the CDCl3 NMR spectra are due to conformers and not impurities, as these were not observed in the spectra obtained in DMSO d6. units were evident and thus precluded branching of the chain through ester linkages at these positions. The fragments Sta Thr Ala N Me -Phe O Me Pr o and N ,N Me2Val Hiva Hiva Leu Asn were readily constructed with the help of HMBC and ROESY data. The continuous sequence of the two fragments was confirmed by ESIMS fragmentation (Figure 3-3). Without other evidence, however, it was still unclear wheth er the Sta and Asn units were joined through C-1 or C-4 of Asn (C-33 and C-36 in 4), as no correlations were observed through the NH2 group or from the NH or H-28 in the Sta unit. Collection of NMR data for 4 in DMSOd6 (see Table 3 -5) revealed an extra HMBC correlation The threonine hydroxyl wa s observed only in the NMR spectra collected in DMSO d6.

PAGE 121

121 from one of the NH2 amide protons to the -carbon of Asn, thus determining the chain proceeded through C-1. A portion of 4 was hydrolyz ed (6 N HCl, 110 C, 24 h) and analyzed by chiral HPLC-MS. This revealed the presence of L-Pro, N Me -D-Phe, LAla, L-Thr, LAsp,*To establish the configuration of the Sta, a portion of the acid hydrolyzate of 4 was derivatized with L-FDLA and subjected to modified Marfeys analysis.104 Peaks corresponding to both (3S,4S)and (3 R ,4S )Sta -L-FDLA were detected, probably due to epimerization at C-3 resulting from dehydrat ion/rehydration. An attempt to confirm the relative configuration of this unit in situ by J based analysis105 failed, probably because the small H -27H-28 coupling (2.7 Hz) precluded measurement of heteronuclear coupling constants by HETLOC106 L-Leu and N ,N Me2-LVal. In addition, peaks corresponding to both Land DHiva were detected, indicating two units of opposite configuration were present. To assign their order, another portion of 4 was subjected to base hydrolysis (0.5 N NaOH/MeOH 1:1, rt, 72 h) to selectively hydrolyze the ester bonds and liberate the two terminal units (Hiva -2 and N ,N Me2Val). Analysis of the base hydrolyzate indicated the presence of L-Hiva only, thus determining the configuration shown for 4 (Figure 31). The presence of LAsp in the hydrolyzate is consistent with the presence of LAsn in the intact molecule, the primary amide having undergone hydrolysis. across this bond. It was recently shown that the relative configuration of statine and statine-like units derived from other amino acids can be easily determined by examination of the coupling constants of the methylene signals.107 The downfield H2a signal (H -26a) shows a large coupling to H-27 and the upfield H-26 (H-26b) shows a small coupling to H-27 (8.7 and 5.4 Hz, respectively), thus indicating th at the configuration is 3S,4S. A modification of the pulse sequence in Re f. 106 was used, see Ref. 37

PAGE 122

122 HRESI/APCIMS of 5 suggested a molecular formula of C59H97N9O16 ( m / z 1226.6687 for [M + K]+, 1210.6936 for [M + Na]+, and 1188.7119 for [M + H + Na]2+), and the 1H NMR spectrum indicated a striking similarity to 5, including the same conformational ratio. Examination of the 1H NMR, COSY, HMQC, HMBC, ROESY and TOCSY spectra of 5 (Table 3-1 and Appendix) revealed the presence of the same units found in 4, except for 2 amino butyric acid (Aba) in place of Ala. The close similari ty of proton and carbon chemical shifts between 4 and 5 indicated that 5 had the same sequence and relative configuration as 4. Compounds 4 and 5 exhibited very similar optical rotation ([ ]20 D 4.4 and 5.0 respectively), indicating that they have the sa me absolute configuration. The sequence of 5 was confirmed by ESIMS fragmentation (Figure 33). The HRESI/APCIMS and NMR data for 6 suggested a molecular formula of C50H82N8O12. Analysis of the 1H NMR spectrum suggested that the compound was a peptide (a mide signals at H 6 -proton signals at H ~4 exists in the ratio of 2.45:1. Aromatic signals ( H 7.2.3), putative N methyl singlets ( H 3.090, 3.087, 3.05 and 2.77) and an O methyl singlet ( H 3.75) were also observed. Analysis of the 1H NMR, COSY, edited HSQC, HMBC, ROESY and TOCSY spectra of 6 recorded in CDCl3 revealed the presence of four regular a-amino acids (Pro, Gly, Ile, Leu), two N methylated amino acids ( N Me -Phe, N Me -Gln), one hydroxy acid (2 -hydroxy-3methylpentanoic acid, Hmpa), and Sta (C-25 -32, Table 32). The sequence N Me -Phe be determined by HMBC analysis. A ROESY correlation between H 5a and H -8 allowed the joining of O Me -Pro to N Me -Phe. ROESY data also confirmed the previously determined HMBC sequence (Table 3-2). It was unambiguously established that C5 of N Me Gln (C -37 in 6) was the primary amide carbon, by virtue of the HMBC correlation of H-28 to C-33 and

PAGE 123

123 correlations from H -34 and H3-38 to C-39. Additionally, there was a [M 128]+ peak at m /z 858.5322 in the HRESI/APCIMS which was consistent with loss of O Me Pro (calcd. for C44H72N7O10, 858.5341). By default, an OH group was proposed at C-46, and this was supported by the proton chemical shift at this position ( H 4.15), which suggests OH rather than an acyloxy group. The sequence was further confirmed by ESIMS fragmentation (Figure 34). A portion of 6 was hydrolyzed (6 N HCl, 110 C, 24 h) and analyzed by chiral HPLC-MS. Peaks corresponding to L-Pro, N Me -D-Phe, LIle, N Me -LGlu,*Biological Evaluation and LLeu were detected. The four stereoisomers of Hmpa eluted very closely together, but a putative assignment of (2R ,3S )Hmpa was made. This was later confirmed by analysis of the hydrolyzate by conventional chiral HPLC with a different column, under conditions where the four stereoisomers eluted further apart (see Experimental Section). A portion of the hydrolyzate was then derivatized with LFDLA as with 4, and once again, two peaks were detected corresponding to (3R ,4S)Sta -LFDLA and (3S,4S)Sta -LFDLA The further downfield of the CH2 protons at C-26 showed a large coupling constant to H-27 (9.3 Hz), indicating that the configuration of this unit is 3S,4S.107 Protease Inhibition The structures of compounds 4 6, in particular the presence of the statine unit and similarity to pepstatin A, led us to suspect that these compounds may be aspartic protease inhibitors. To test activity and to probe selectivity for certain aspartic and other proteases, we screened 4 against a panel of proteases to identify inhibitory activity at 10 M (Figure 35). It was found to be active against a subset of aspartic proteases cathepsin D, cathepsin E. The only other proteases with compromised activities were the metalloproteases ADAM9, ADAM10 The presence of N Me -LGlu is the hydrolyzate is consistent with the presence of N Me-LGln in the intact molecule, the primary amide having undergone hydrolysis.

PAGE 124

124 and TACE (Table 3-3). Subsequent validation of these hits revealed that the greatest activity was against cathepsin E (IC50 886 pM). Compounds 13 all showed selectivity for cathepsin E over cathepsin D compared to pepstatin A (Table 3-3). Of the metalloproteases, only TACE inhibition was validated in the second round of assays. IC50s against ADAM9 and 10 were in the high micromolar range or above 100 M. The IC50s of TACE inhibition were in the low micromolar range, and analysis of the progress curves revealed concentration and time -dependent inhibition (Figure 3-6 ). Cell Permeability Studies To assess whether grassystatin A is able to enter cells and inhibit target enzymes in a cellular context, MCF7 cells were treated for 1 h with various concentrations of 4. After this time, cells were lysed and the protease activity of the lysate was measured with a fluorogenic cathepsin D/E substrate (see Experimental Section, Figure 37a ). For comparison, cells were also treated with the same concentrations of pepstatin A (Figure 3-7A), and the in vitro inhibition of cellular enzymes were measured by adding compounds directly to cell lysate (Figures 3-7b). The apparent IC50s of 4 and pepstatin A in a cellular system are fairly similar (Figure 37a ). However, the apparent in vitro IC50 of 4 against MCF7 lysate is ~0.5 M, and that of pepstatin A is ~5 nM. This likely reflects these compounds differing specificity compound 4 is able to inhibit a smaller fraction of the enzymes that cleave the substrate compared to pepstatin A. Taken together, the results suggest that 4 is able to more efficiently enter cells than pepstatin A, which is known to have poor cell permeability.104 Effect on Antigen Present ation Cathepsin E is thought to have a functional role in the proteolysis of antigenic peptides, which are subsequently presented as antigens on the surface of antigen presenting cells (APCs)

PAGE 125

125 in the MHC-II pathway.104,108 110 Antigen presentation to T cells stimulates their proliferation and the release of certain inflammatory cytokines (vide infra).111 We therefore investigated the effect of compound 4 on human peripheral blood mononuclear cells (PBMCs). PBMCs are a mixture containing various APCs (dendritic cells, B cells and macrophages) and T cells. We examined the effect of 4 on T cells using flow cytometry to gate for CD3+ lymphocytes (T cells). 10 M 4 was able to significantly reduce T cell proliferation in response to exogenous antigen (Tetanus toxin C-fragment, TTc, Figure 3-8a ). In the same experiment, T cell viability was unaffected (data not shown). We then investigated the effect of 4 on the interaction between monocyte derived dendritic cells (DCs) and CD4+ T cells (T helper cells, TH), in a mixed lymphocyte reaction (MLR). The first set of experiments were autologous MLRs, where DCs and T cells came from the same human donor. DCs were chosen for this study as they are the most potent antigen presenting cells and have much higher cathepsin E expression than other APCs.112 The main target of antigen presentation are TH cells, which go on to orchestrate the ensuing immune response. We therefore decided to use an enriched population of these cells as the responders in our assay. Differentiated DCs were cultured in the presence of antigen (TTc), PMA and TH cells for 5 days. Compound 4 was able to reduce T cell proliferation in a dose dependent manner (Figure 3-8b ). TTc and PMA alone (i.e. in the absence of DCs) were unable to increase T cell proliferation, and thus this effect of 4 is dependent on DCs. In these experiments, 4 was also able to inhibit upregulation of IL17 (Figure 3-8c) and IFN(Figure 3-8d) in response to antigen presentation. To determine whether 4 had any effect on T cell recognition of foreign MHC II proteins, we carried out the same experiment with DCs and TH cells from different donors. We found that 4 had no effect on DC stimulated proliferation (Figure 3-9a ). This is likely because T cells were

PAGE 126

126 recognizing nonself MHC II proteins on the surface of DCs. At the same time, we still saw a significant downregulation of IL-17 and IFNproduction even though proliferation was not reduced (Figures 3-9b and 3-9c, respectively). In Silico Docking to Cathepsins D and E To gain some insight into the structural basis for the selectivity of the grassystatins for cathepsin E over D, compounds 4 and 6 were docked into these two enzymes (Figure 3-10). For both enzymes, compounds 4 and 6 were successfully docked using AutoDock Vina 1.0,113 with the ligand treated as fully flexible (see Experimental). Input structures of the ligands had all amide bonds trans except the proline amide, for which separate cis and trans structures were produced. Broadly speaking, many of the putative hydrogen bond interactions suggested by the crystal structure of pepstatin A bound to cathespin D (PDB code 1LYB)114 are also present in the model of compound 4 bound to this enzyme (Figure 3-10a). The reduced affinity of 4 versus pepstatin A may be due to the presence of a polar residue at P2. Cathepsin D has an established preference for hydrophobic residues in this position, although it is somewhat tolerant of polar residues here.115 In our docked conformation of 4, the Asn side chain is curled down in order to interact with Ser -80 in the flap, and to avoid the hydrophobic residues Met-307 and Met-309. The docked stru cture of grassystatin A ( 4) in cathepsin E (Figure 3-10b) shows this unit interacting with the polar residue Gln -303, which replaces Met-307 in cathepsin D. This could be one reason for an increased affinity for cathepsin E versus D. Another factor coul d be the numerous hydrogen bond interactions possible between the O Me -Pro unit of 4 with Gln -85 in cathepsin E (Figure 3-10B). It is probably not possible to form so many hydrogen bonds with the equivalent residue in cathepsin D His -77.

PAGE 127

127 Grassystatin C ( 6) was less potent than grassystatins A and B ( 4 and 5, respectively) against both cathepsin D and E. One potential reason for this is the absence of the terminal N ,N Me2-Val, which could act as either a hydrogen bond donor (protonated) or acceptor (un protonated). In cathepsin D, there are several polar residues within reach of this unit (Tyr-10, Gln -14, Thr125, Lys -130, Gln-258 and Gln260). The situation is similar with cathepsin E, where there are a number of polar residues in the same pocket (Tyr -20, Glu-24, Glu-27, Glu-121, Asp -125, Glu-256 and Tyr-257). In the docked structure of 4 shown in Figure 3-10B, the basic nitrogen of N ,N Me2Val is close to Gln -121. In the same run, another similar structure was produced, where the basic nitrogen was close to Tyr -20 (not shown). Thus, this unit may serve to anchor the inhibitor in the correct position within the binding cleft. Indeed, we observed that when docking into the same protein structure, more spurious structures*Conclusion were produced for grassystat in C ( 6) than for grassystatin A (4). In these situations, because 6 has fewer rotatable bonds than 4, it is unlikely that the search parameters would be insufficient for 6 and not 4. Consistent with our hypothesis, the marine cyanobacterium Lyngbya confervoides has yielded potent and selective protease inhibitors. Grassystatins A C ( 4 6) and the related compound tasiamide B100,101 (Figure 31 and 32) all contain a statine or statine like unit with th e same configuration (3S,4 S). This is also the same configuration as the statine units in pepstatin A. It has previously been shown that the configuration of C3 in the central statine is important to pepstatin As inhibitory activity against aspartic pr oteases.116 Like pepstatin A, 4 6 inhibited cathepsin D and E, although they were select ive for cathepsin E (~20 to ~30-fold), while pepstatin A did not discriminate between these proteases. For example, conformations where the N C direction was rever sed, where the ligand folded back on itself, or where a unit other than statine resided at the catalytic center.

PAGE 128

128 In pe pstatin A, the central statine unit is the pharmacophore of inhibition that binds to cathepsin D at the P1 P1 site.114 If the binding mode is the same for 4 6, then the units flanking the statine unit confer the differential act ivity for cathepsin D and E. Cathepsin D strongly favors hydrophobic amino acids in the P2 position, compared to polar units such as Asn in 4 and 5, or N Me -Gln in 6,117 which are more tolerated by cathepsin E.115 This could explain why these compounds are less potent inhibitors against cathepsin D compared to pepstatin A, which has valine at P2. Both cathepsins D and E allow polar (but not charged) units at position P2, and hydrophobic units such as leucine are also allowed.115,118 Th erefore, the change from Thr in 4 and 5 to Ile in 6 may not account for the its lower activity. The putative hydrogen bond between Asn NH and Ser -80OH may be particularly important to binding and this interaction is not possible in 6 because the nitrogen of Gln is methylated. Compound 6 does not possess terminal units N ,N Me2-LVal L-Hiva. The basic nitrogen of N ,N Me2-Val is probably able to interact with acidic residues in both cathepsins D and E. It has previously been shown that occupation of the S5 subsite of cathepsin E with Lys increases substrate turnover.115 Occupation of this site by positively charged residues may therefore be key to inhibitor binding. Three metalloproteases in the ADAM family were identified in the primary screen of compound 4 (ADAM9, ADAM10 and TACE). Only one of the hits (TACE), however, could be replicated in a doseresponse assay (Table 3-3). Inhibition of TACE by compounds 4 6 was concentration and time dependent (Figure 3-6b), with IC50s of 1.23, 2.23 and 28.6 M, respectively. A slow onset of inhibition indicates slow binding of the inhibitor, and is apparent by a noticeable curve in the progress curve of the reaction within a timescale where the uninhibited reaction is still linear.111 S tatine -based slow-binding inhibitors of aspartic proteases have been described.119 There are several examples of slow-binding inhibitors of zinc

PAGE 129

129 metalloproteases, for example the antihypertensive drugs captopril and enalapril are both slow binding inhibitors of angiotensin converting enzyme (ACE).120 There are also some slow -binding inhibitors of MMPs.121 The reason for slow-binding in these cases may be the expulsion of a tightly bound, catalytically active water molecule from the active site.122 With slow binding inhibitors, the onset of inhibition depends on the preincubation time of the test compound with the enzyme. In the large scale screen, t his time may have been longer than desirable, leading to an apparent lower IC50 for compound 4 against ADAM9 and ADAM10. Consistent with previously reported experiments using pepstatin A,104,108,109,123 we found that 4 was able to reduce antigen stimulated T cell proliferation in PBMCs (Figure 3-8a ) and antigen presentation by DCs to TH cells (Figure 3-8b). Concurrently, we found the 4 reduced production of IL17 and IFN by T cells (Figures 3-8c and 3-8d, respecti vely). IFNis a pro inflammatory molecule and the signature cytokine produced by TH1 cells that, among other effects, activates macrophages.111 These cells are strongly involved in cellular immunity against cancer and intracellular pathogens such as viruses, but are also involved in the etiology of transplant reject ion.124 IL -17 is another pro-inflammatory cytokine, produced by a recently described subset of T cells, TH17 cells.125 TH17 cells and IL-17 have been implicated in a number of autoimmune and allergic diseases such as rheumatoid arthritis and asthma.125 Because of their involvement in proinflammatory disorders and the association of such pathologies with the activation of T cells by antigen presentation we decided to investigate the contribution of 4 to the modulation or downregulation of proinflammatory cytokines. Exogenous antigens are internalized by APCs and proteolytically cleaved within endosomes, before they are presented on the cell surface bound to MHC class II proteins.111 The invariant chain (Ii) is a chaperone that prevents endogenous peptides from binding to MHC class

PAGE 130

130 II proteins while they are transported from the endoplasmic reticulum to endosomes.111 Ii undergoes several cleavage steps both before and after entering the endosome before antigens can bind MHC II for subsequent presentation. Cysteine proteases, such as cathepsin S, have a well established role in Ii cleavage.126 There have been conflicting reports, however, of whether an aspartic protease-dependent cleavage is also required for MHC II maturation. Mari et al.127 found that aspartic protease inhibitors reduced cleavage of MHC IIIi complexes in B lymphoblastoid cells. Similarly, Zhang et al.123 found that pepstatin A induced an accumulation of Ii containing cleavage intermediates both in a murine B cell line and live mice. Two other reports109,110 found that pepstatin A could inhibit presentation of antigens when cells (murine microglia and human DCs) were treated with intact antigens, but not when treated with precleaved epitotic peptides. Recently, Costantino et al.128 have presented results suggesting that the role of differ ent enzymes in Ii cleavage is highly variable and there is a large degree of redundancy. Our own results suggest that 4 is not able to inhibit MHC II Ii cleavage, as DCs treated with 10 M 4 in the allogeneic (but not autologous) MLR were still able to st imulate T cell proliferation. Furthermore, 4 was able to downregulate pro-inflammatory cytokines in both types of assays. This indicates that either presentation of TTc is inhibited in both cases, with inhibition of cytokine production being a consequence of this, or that 4 has a direct effect on cytokine expression. While further studies are needed it opens the possibility for this compound to be used in the study of antigen presentation and also of the role of cathepsin E in inducing proinflammatory r esponses. In conclusion, we believe that compound 4 could prove to be a valuable probe for the study of cathepsin E function. Previously, only one inhibitor selective for cathepsin E was known, a protein from the roundworm Ascaris lumbricoides .129 Because this inhibitor is not widely

PAGE 131

131 available, studies into the function of cathepsin E have had to rely on nonselective inhibitors such as pepstatin A or cathepsin D knockout animals/cells. To the best of our knowledge, grassystatins A C ( 4 6) are the only other natural protease inhibitors that are selective for cathepsin E over D. Experimental General Experimental Procedures Optical rotation was measur ed on a Perkin-Elmer 341 polarimeter. UV was measured on a SpectraMax M5 (Molecular Devices) and IR data obtained on a Bruker Vector 22 instrument. 1H and 2D NMR spectra in CDCl3 for 4 and 5 were recorded on a Bruker 500 MHz spectrometer. 13C and APT spectra for 4 were recorded on a Bruker 600 MHz Avance Spectrometer. 1H and 2D NMR spectra in CDCl3 for 6 were collected on a Bruker Avance II 600 MHz spectrometer using a 1mm triple resonance high temperature superconducting cryogenic probe.130 Spectra were referenced to residual solvent signals [ H/C 7.26/77.0 (CDCl3) and H/C 2.49/39.5 (DMSOd6]. HMQC and HSQC experiments were optimized for 145 Hz, and HMBC experiments were optimized for 7 Hz. HRESI/APCIMS data were recorded on an Agilent LC TOF mass spectrometer equipped with an APCI/ESI multimode ion source det ector in positive ion mode. LC MS data were obtained using an API 3200 (Applied Biosystems) equipped with a Shimadzu LC system. ESIMS fragmentation data were obtained on an API 3200 by direct injection with a syringe driver. Flow cytometry was carried out on a FACSCalibur flow cytometer using CellQuest software (BD Biosciences, Heidelberg, Germany). Figures of docked ligands were prepared using PyMol.

PAGE 132

132 Extraction and Isolation Samples of Lyngbya confervoides were collected off Grassy Key on May 26th 2004 an d fractionated as described in C hapter 2. The silica gel fraction eluting with 100% methanol was purified by preparative reversed -phase HPLC (Phenomenex Luna 10u C18 AXI, 100 21.2 mm, 10.0 mL/min; UV detection at 220 and 254 nm), using a MeOH 2O lin ear gradient (60 100% over 30 min, then 100% MeOH for 10 min), to give impure 4 and 5 at tR 24.3 and 24.9 min, respectively. These were purified using a different column (Phenomenex Ultracarb 5u ODS (30), 250 10.0 mm, 2.0 mL/min; UV detection at 220 and 254 nm) using the same linear gradient to furnish compound 4, tR 33.8 min (5.7 mg), and 5, tR 35.1 min (1.3 mg). Samples of the same species were collected off Key Largo on May 8th 2003. A voucher specimen is maintained at the Smithsonian Marine Station. The freeze-dried organism was extracted with EtOAc polar extract, which was directly fractionated by silica gel column and eluted with increasing concentrations of isopropanol in CH2Cl2. The fraction eluting with 100% isopropanol (665.8 mg) was subjected to preparative reversed -phase HPLC [column, Luna C18(2) 100A AXI, 10 mm (100 21.20 mm), Phenomenex; flow rate 10.0 mL/min; detection by UV at 220 and 254 nm] using a linear MeOH H2O gradient (60 100% MeOH over 30 min, then 100% MeOH for 5 min). In addition to previously isolated compounds, a minor peak eluted at tR 17.2 min, which was then deconvoluted using different conditions [column, ODS AQ (10 250 mm), YMC; flow rate, 2.0 mL/min; detection by UV at 220 and 254 nm] us ing the same linear MeOH H2O gradient, to furnish pure 6, tR 27.3 min (1.0 mg). Grassystatin A (4). Colorless amorphous solid; [ ]20 D 4.4 ( c 0.08, MeOH); UV (MeOH) max (log ) 206 (4.93), 258 (4.03), 324 (3.2); IR (film) max 3291 (br), 3068 (w), 3054 (w), 3019

PAGE 133

133 (w), 2955, 2937, 2925, 2914, 2851, 2360, 2342, 1733, 1646, 1540, 1457, 1374 (w), 1265, 1109 (w), 1023 (w), 896 (w), 739 cm-1; NMR data, 1H NMR, 13C NMR, APT, COSY, HMQC, HMBC, ROESY, TOCSY in CDCl3, see Table 3-1, 1H NMR, COSY, edited HSQC, HMBC, R OESY in DMSOd6, see Table 3 -5; HRESI/APCIMS m / z [M + Na]+ 1196.6812 (calcd for C58H95N9O16Na, 1196.6794), [M + H]+ 1174.6988 (calcd for C58H96N9O16 1174.6975), [M + H + Na]2+ 598.8455 (calcd for C58H96N9O16Na 598.8436), [M + 2H]2+ 587.8544 (calcd for C58H97N9O16 587.8527). Grassystatin B (5). Colorless amorphous solid; [ ]20 D 5.0 ( c 0.1, MeOH); UV (MeOH) max (log ) 202 (4.47), 266 (2.96), 320 (2.45); IR (film) max 3276 (br), 3079 (w), 3054 (w), 3017 (w), 2961, 2927, 2874, 2360, 2342, 1752, 1732, 1690, 1627, 1549, 1493 (w), 1463 (w), 1436 (w), 1389 (w), 1369 (w), 1267 (w), 1207 (w), 1179 (w), 1124 (w), 1023 (w) cm-1; NMR data, 1H NMR, COSY, HMQC, HMBC, ROESY, TOCSY in CDCl3, see Table 31; HRESI/APCIMS m / z [M + K]+ 1226.6687 (calcd for C59H97N9O16K 1226.6690), [M + Na]+ 1210.6936 (calcd for C59H97N9O16Na 1210.6951), [M + H]+ 1188.7119 (calcd for C59H98N9O16 1188.7131), [M + H + Na]2+ 605.8516 (calcd for C59H98N9O16Na 605.8515). Grassystatin C (6). Colorless amorphous solid; [ ]20 D .9 ( c 0.04, MeOH); UV (MeOH) max (log ) 203 (4.74), 260 (2.89), 320 (2.17); IR (film) max 3307 (br), 3078 (w), 3054 (w), 3016 (w), 2659, 2927, 2904, 2874, 2361, 2340, 1742, 1635, 1531, 1462, 1442, 1410, 1368, 1285 (w), 1199 (w), 1047 (w) cm-1; NMR data, 1H NMR, COSY, edited HSQC, HMBC, ROESY, TOCSY in CDCl3, see Table 32; HRESI/APCIMS m / z [M + Na]+ 1009.5941 (calcd for C50H82N8O12Na, 1009.5950), [M 128]+ 858.5322 (calcd for C44H72N7O10, 858.5341).

PAGE 134

134 Acid Hydrolysis and Chiral Amino Acid Analysis A sample of 4 (100 g) was t reated with 6 N HCl at 110 C for 24 h. The hydrolyzate was concentrated to dryness, reconstituted in 100 m L H2O and then analyzed by chiral HPLC [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 4OAc (40:60, pH 5.23): flow rate, 0.5 mL/min; detection by ESIMS in positive ion mode (MRM scan)]. LThr, LLeu, L-Pro, N ,N Me2-LVal and N Me -DPhe eluted at tR 7.2, 9.0, 14.4, 27.0 and 45.4 min, respectively. The retention times ( tR, min; MRM ion pair, parent product) of the authentic amin o acids were as follows: L-Thr (7.2; 120 Lallo Thr (7.5), DThr (8.6;), Dallo Thr (11.9), L-Pro (14.4; 116D-Pro (39.5), L-Leu (9.0; 132 DLeu (20.6), N Me -LPhe (25.0; 180N Me -D-Phe (45.4), N ,N Me2-L-Val (27.0; 146N ,N Me2-DVal (69.8). The assignment of LThr was confirmed by co -injection of the hydrolyzate with Lallo Thr and L-Thr. The MS parameters used were as follows: DP 31.0, EP 8.0, CE 17.3, CXP 3.1, CUR 35, CAD Medium, IS 4500, TEM 750, GS1 65, GS2 65. LAla wa s also detected in positive ion mode, at tR 8.0, but with slightly different MS conditions. The retention times ( tR, min; MRM ion pair, parent product) of the authentic standards were as follows: LAla (8.0; 90D-Ala (14.6). The MS parameters used were as follows: DP 21.0, EP 8.0, CE 15.0, CXP 5.0, CUR 50, CAD Medium, IS 4500, TEM 750, GS1 65, GS2 65. Asp was only detected weakly in positive ion mode and consequently negative ion mode was used with the same LC conditions. LAsp eluted at tR 6.1 min, indicating that the configuration of the Asn unit was L. The retention times ( tR, min; MRM ion pair, parent product) of the authentic standa rds were as follows: L-Asp (6.1; 132D-Asp (6.8). The MS param eters used were as follows: DP 30.0, EP 5.0, CE 18.5, CXP 13.0, CUR 30, CAD High, IS 4500, TEM 750, GS1 65, GS2 65.

PAGE 135

135 A sample of 6 was treated with 6 N HCl at 110 C for 24 h. The h ydrolyzate was concentrated to dryness, reconstituted in 100 m L H2O and then analyzed by chiral HPLC [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 4OAc (40:60, pH 5.33): flow rate, 0.5 mL/min; detection by ESIMS in positive ion mode (MRM scan)]. N Me -L-Glu, LIle, L-Leu, LPro and N Me -DPhe eluted at tR 6.0, 8.3, 8.6, 13.3 and 41.7 min, respectively. The retention times ( tR, min; MRM ion pair, parent product) of the authentic standards were as follows: N Me -L-Glu (6.0; 162 N Me -D-Glu (15.8), L-Ile (8.3; 132Lallo -Ile (8.5), Dallo -Ile (19.6), DIle (22.2), L-Leu (8.6; 132 DLeu (19.8), LPro (13.3; 116D-Pro (35.2), N Me -L-Phe (23.2; 180 N Me -D-Phe (41.7). To further separate the isobaric Ile and L eu units, different LC conditions were employed [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 4OAc (90:10, pH 5.65); flow rate, 0.5 mL/min; detection by MS (MRM scan)]. LIle and LLeu eluted at tR 12.3 and 13.1 min, respectively The retention times ( tR, min; MRM ion pair, parent product ) of the authentic amino acid standards were as follows: L-Ile (12.3; 132 Lallo -Ile (13.4), Dallo -Ile (57.5), D-Ile (70.5), L-Leu (13.1; 132 D-Leu (51.7). The MS parameters used w ere as follows: DP 31.0, EP 8.0, CE 17.3, CXP 3.1, CUR 35, CAD Medium, IS 4500, TEM 750, GS1 65, GS2 65. Hmpa in the hydrolyzate of 6 was detected in negative ion mode [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 4OAc (40:60, pH 5.35); flow rate, 0.5 mL/min; detection by ESIMS in negative ion mode (MRM scan)]. The MS parameters used were as follows: DP 750, GS1 65, GS2 65. (2R ,3S)-Hmpa from the hydrolyzate e luted at tR 6.4 min. The retention times ( tR, min; MRM ion pair, parent product ) of the authentic standards was as follows:

PAGE 136

136 (2 S,3R )-Hmpa (6.0; 131 S,3S)-Hmpa (6.2; 131 R ,3S)-Hmpa (6.4; 131 (2 R ,3R )-Hmpa (7.0; 131 hydrolyzate wa s examined under different HPLC conditions in order to confirm this assignment [column, Chiralpak MA (+) (4.6 50 mm), Daicel Chemical Industries, Ltd.; solvent, 2 mM CuSO4 CH3CN (85:15); flow rate, 1.0 mL/min; detection by UV absorption at 254 nm]. (2R ,3S)-Hmpa from the hydrolyzate eluted at tR 15.4 min. The retention times ( tR, min) of the authentic standards were as follows: (2R ,3S)-Hmpa (15.4), (2R ,3R )Hmpa (17.9), (2S,3R )-Hmpa (22.7), (2S,3S)-Hmpa (27.5). Under these conditions, all other units eluted at tR <6.5 min. Base Hydrolysis to Determine Configuration of Hiva Units. The acid hydrolyzate of 4 was analyzed by chiral HPLC [column, Chirobiotic TAG (4.6 250 mm), Supelco; solvent, MeOH 10 mM NH4OAc (60:40, pH 5.63); flow rate, 0.5 mL/min; detect ion by ESIMS in negative ion mode (MRM scan)]. Both LHiva and DHiva were detected at tR 6.0 and 6.4 min, respectively. The retention times ( tR, min; MRM ion pair, parent product) of the authentic standards were as follows: L-Hiva (6.0; 117 DHiva (6.4). A sample of 4 (100 mg) was suspended in 80 m L MeOH stand at room temperature for 72 h. The solution was neutralized by the addition of 20 m L 1 N HCl, and was then analyzed by chiral HPLC -MS as before. Only LHiva was detected at tR 6.0 min. The retention times ( tR, min; MRM ion pair, parent product) of the authentic standards were as follows: L-Hiva (6.0; 117 71), DHiva (6.4). The MS parameters used were as follows: DP 30.0, EP 3.0, CE 17.3, CXP 2.0, CUR 45, CAD Medium, IS 4500, TEM 650, GS1 50, GS2 25.

PAGE 137

137 Modified Marfeys Analysis to Determine Configuration of Statine Units. Samples of both 4 and 6 (35 g) were subjected to acid hydrolysis, derivatized with LFDLA as described previously, and analyzed by reversed-phase HPLC [column, Alltima HP C18 HL (4.6 250 mm), 5 m m, Alltech; flow rate, 0.5 mL/min; detection by ESIMS in negative ion mode (MRM scan, 468 408)], using a linear gradient of MeOH in H2O (both containing 0.1% HCOOH, 40 S ,4S)Sta -L-FDLA and (3 R ,4S)Sta -L-FDLA, were observed in both samples in a 1:1 ratio at tR 35.5 and 35.9 min, respectively. The retention times ( tR, min) of the authentic standards were as follows: (3S,4S)Sta -L-FDLA (35.5), (3R ,4 S)Sta -L-FDLA (35.9), (3S,4S)Sta -D-FDLA [corresponding to (3 R ,4R )Sta -L-FDLA, 45.7], (3R ,4S)Sta -D-FDLA [corresponding to (3S,4 R )Sta -L-FDLA, 46.4]. The MS parameters used were as follows: DP 60.0, EP 7.0, CE 28.0, CXP 7.4, CUR 40, CAD High, IS 4500, TEM 750, GS1 40, GS2 40. Protease Inhibition Screen Compound 4 was added into the reaction buffer containing enzyme by acoustic droplet ejectio n (Echo 550, Labcyte Inc., Sunnyvale, CA) such that the final concentration was 10 M. After incubation at room temperature for 10 15 min, the substrate was added, after which fluorescence at each relevant Ex/Em wavelength was measured every 5 min for 2 h The substrate alone in the reaction buffer served as background. The activity of 4 was evaluated by obtaining % enzyme activity relative to the slope of no inhibitor control. Each enzyme assay was performed in duplicate by Reaction Biology Corp. (Malvern, PA). For individual buffers, substrates and positive controls, see Table 3-4.

PAGE 138

138 Protease Inhibition Assays to Determine IC50 Values Assays for 4 and 5 were carried out in the same way as in the protease screen, using 3 -fold serial dilutions in DMSO, starting at 10 M and 100 M respectively, with 10 different concentrations of each. Compound 6 was insoluble in DMSO, and so a dilution series in EtOH was used. For 4 6, a 3 -fold dilution series starting at 100 M was used, with 10 different concentration s. Assays were carried out by Reaction Biology Corp. (Malvern, PA). % Enzyme activity, calculated as above, was used to determine IC50 values with non-linear regression in GraphPad Prism (GraphPad Software, Inc., La Jolla, CA). Cellular Uptake of Grassys tatin A (4) and Inhibition of Cellular Cathepsins The cellular uptake of grassystatin A ( 4 ) was measured as described previously in MCF7 cells.104 For these experiments, MCF7 cells were cultured in Dulbeccos Modified Eagle Medium (DMEM, Invitrogen) containing 10% fetal bovine serum (FBS, Hyclone), in an atmos phere containing 5% CO2 at 37 C. Briefly, MCF7 cells were seeded into 24 well plates. When cells reached 80 100% confluency, compound 4 or pepstatin A were added. After 1 h incubation the medium was removed and the cells were trypsinized for 10 min, be fore being collected by centrifugation and lysed with NP 40 lysis buffer (1% NP -40, 50 mM NaOAc, pH 4.0). The lysate (50 L) from each well was incubated at 37 C with 10 M Mca Gly Lys Pro Ile Leu -Phe-PheArg Leu -Lys(Dnp)-DArg NH2 (the same substrate us ed for cathepsin D and E in other assays) in 50 mM NaOAc (pH 4.0, total volume 100 L). The reaction was monitored by measuring the increase in fluorescence (ex = 320 nm, em = 405 nm). To measure the in vitro inhibition of cellular cathepsins by 4 and pepstatin A, kinetic assays were carried out in the same manner, using lysate prepared from untreated MCF7 cells. The test compounds were added to a mixture of the reaction buffer and the substrate (50 L).

PAGE 139

139 The reaction was initiated by the addition of 50 L cell lysate, and then monitored in the same way. Molecular Docking Compounds 4 and 6 were docked into cathepsin D using the crystal structure of pepstatin A in cathepsin D as a starting point (PDB code 1LYB).114 AutoDock Vina 1.0113 was used for all docking runs. This program is two orders of magnitude faster than AutoDock 4, and thus renders docking of flexible peptides with ~25 50 rotatable bonds possible on normal workstations in a reasonable timeframe. The program was able to reproduce the docked conformation of pepstati n A in cathepsin D, with an rmsd of 0.977 (Figure 3 -11). The default value of exhaustiveness (8) was sufficient to reproduce the bound conformation of pepstatin A, but since compounds 4 and 6 have more rotatable bonds, a higher value (25) was used for most of the docking studies. In structures of grassystatin A and C, all bonds were treated as rotatable, except ring and amide bonds, and the protein was treated as rigid. For grassystatin A, the terminal amine was protonated to reflect its likely state at physiological pH. Apart from the Pro amide bond, all amides in the ligand were set to trans configuration. For each compound, separate structures were made with the Pro amide bond either cis or trans Docking was carried out with an exhaustiveness value of 25, and a maximum output of 100 structures. It was observed that AutoDock was always able to propose docked structures with similar calculated affinities (~ 9 to 7 kcal/mol), and so the output structures were examined qualitatively. The primary criterion used in choosing the best docked structures was the position of the statine unit relative to the active site aspartates (Asp -33 and Asp-231), with reference to the bound conformation of pepstatin A. The rationale for this is found in the numerous crystal structures of pepstatin A131137 and analogues138142 bound to many different aspartic proteases.

PAGE 140

140 Docking to cathepsin E was carried out in the same manner, but with some differences. There is only one crystal structure of cathepsin E available (PDB code 1TZS),143 where the inhibitory prodomain is still resident in the active site. This structure pro bably corresponds to an early intermediate in the maturation of the enzyme. In addition to the prodomain in the active site, the N terminal is blocking the active site tunnel so that the enzyme is in the closed conformation. A structure more consistent with the mature enzyme had to be produced in order to carry out effective docking. For this purpose, homology modeling was carried out using the SWISSMODEL web server.144 Amongst the protein structures in the PDB, human cathepsin E has the highest sequence homology with porcine pepsinogen (PDB code 2PSG)145 and its mature form, pepsin (PDB code 4PEP).146 The activation inte rmediate structure for cathepsin E (1TZS) agrees very well with that for pepsinogen (2PSG, rmsd 0.784 ), therefore the structure of the corresponding mature enzyme (4PEP) is most likely a good template for homology modeling. Indeed, the structure obtaine d was in excellent agreement with 1LYB (rmsd 0.833 ). Docking of pepstatin A into the homology model was successful. The conformation obtained was close to that of pepstatin A bound to cathepsin D (rmsd 1.893 ). Grassystatin A was docked using the sam e protocol as above. For grassystatin C, a larger value of exhaustiveness was used (50).

PAGE 141

141 Table 3 -1. NMR spectral data for g rassystatins A ( 4) and B ( 5) at 500 MHz (1H) and 150 MHz (13C) in CDCl3 Grassystatin A ( 1 ) Grassystatin B ( 2 ) C/H no. H ( J in Hz) C, a mult. 1 H 1 H COSY HMBC b ROESY H ( J in Hz) C, a mult. O Me Pro 1 172.49, s 172.4, s 2 4.42, dd (7.1, 7.1) 59.2, d 3a, 3b 1, 3, 4 3a, 3b, 5a, 5b 4.42, dd (7.7, 6.8) 59.0, d 3a 2.18, m 28.9, t 2, 3b, 4a, 4b 1, 2, 4, 5 2, 3b, 4b 2.20, m 28.7, t 3b 1.84, m 2, 3a, 4a, 4b 1, 2, 4, 5 3a, 4a 1.82, m 4a 1.94, m 25.3, t 3a, 3b, 4b, 5a, 5b 1, 2, 3 3b, 4b, 5a, 5b 1.95, m 25.2, t 4b 1.80, m 3a, 3b, 4a, 5a, 5b 1, 2, 3, 5 3a, 4a, 5a, 5b 1.81, m 5a 3.46, m 47.0, t 4a, 4b, 5b 1, 2, 3, 4 2, 4a, 4b, 5b, 8 3.42, m 46.8, t 5b 3.29, m 4a, 4b, 5a 3, 4, 7 2, 4a, 4b, 5a, 8 3.29, m 6 3.72, s 52.2, q 3.72, s 52.0, q N Me Phe 7 168.1, s 167.9, s 8 5.66, dd (9.2, 6.5) 55.7, d 9a, 9b 7, 9, 10, 16, 17 2, 5a, 5b, 9a, 9b, 16 5.64, dd (8.7 6.8) 77.8, d 9a 3.23, dd ( 34.7, t 8, 9b 7, 8, 10, 11/15 8, 9b, 11/15 3.22, dd ( 6.8) 34.5, t 9b 2.97, dd ( 8, 9a 7, 8, 10, 11/15 8, 9a 2.91, dd ( 8.7) 10 136.7, s 136.7, s 11/15 7.20, m 129.5, d 9, 11/15 13 8, 9a, 9b, 16, 18, 19 7.21, m 129.4, d 12/14 7.22, m 128.2, d 10, 12/14 7.22, m 128.3, d 13 7.15, m 126.6, d 11/15, 7.16, m 126.5, d 16 3.01, s 30.4, q 8, 17 11/15, 18, 19 3.04, s 30.4, q Ala/Aba 17 172.46, s 171.7, s 18 4.72, dq ( 7.4, 7.2) 45.5, d 19, NH 17, 19, 21 11/15, 16, 19, NH 4.71, m 50.3, d 19a 0.86, d (7.2) 17.0, q 18 17, 18 1.39, m 24.5, t 19b 1.20, m 20 0.65, t (7.4) 9.4, q NH 7.41, d (7.4) 18 21 18, 22 7.26, m Thr 21 170.2, s Not obs. 22 4.31, dd (8.0, 7.3) 58.3, d 23, NH 21 24 4.35, dd (7.8, 3.1) 58.2, d 23 4.19, dq (7.3, 6.3) 67.5, d 22, 24 24 24 4.19, b 67.2, c d 24 1.12, d (6.3) 18.9, q 23 22, 23 1.14, d (6.2) 18.8, q OH NH 7.60, d (8.0) 22 25 7.55, m

PAGE 142

142 Table 3 -1. Continued Sta 25 172.2, s 172.1, s 26a 2.53, dd ( 40.5, t 26b, 27 25, 27, 28 2.54, dd ( 9.3) 40.5, t 26b 2.39, dd ( 26a, 27 25, 27 27, 28 2.39, dd ( 5.4) 27 4.02, dddd (8.7, 5.4, 5, 2.7) 70.3, d 26a, 26b, 28, OH 26b, 29a, 29b, 31 4.02, m Not obs. 28 3 .85 dddd (9.0, 6, 4.7, 2.7) 51.8, d 27, 29a, 29b, NH 26b, 29a, 29b, 31, 32 3.82, m Not obs. 29a 1.56, m 39.9, t 28, 29b, 30 28, 30, 31, 32 27, 28, 29b, 31, 32 1.55, m 39.7, c t 29b 1.36, ddd ( 28, 29a, 30 28, 30, 31, 32 27, 28, 29a, 3 1, 32 1.37, m 30 1.61, m 24.7, d 29a, 29b, 31, 32 28, 29, 31, 32 29b, 31, 32 1.55, m 26.7, d 31 0.87, m 23.1, q 30 29, 30, 32 0.88, m 22.8, q 32 0.84, m 22.0, q 30 29, 30, 31 0.86, m 21.9, q OH 4.63, br 27 NH 7.18, m 28 7.10, m Asn 3 3 173.2, d s 172.6, d s 34 4.82, ddd (8.0, 6.2, 4.5) 50.3, d 35a, 35b, NH 33, 35, 36, 37 35a, 35b 4.78, m 49.9, d 35a 2.79, dd ( 37.5, t 34, 35b 33, 34, 36 34 2.79, dd ( 4.3) 37.1, t 35b 2.73, dd ( 34, 35a 33, 34, 36 34 2.68, dd ( 6.0) 36 170.6, d s 170.5, d s NH 2 a 6.42, br 6.66, br NH 2 b 6.80, br 6.23, br NH 7.61, d (7.6) 34 38 7.53, m Leu 37 171.7, s 168.3, s 38 4.35, m 52.6, d 39a, 39b, NH 37, 39, 40, 43 39a, 39b, 41, 42 4.28, m 48.8, d 39a 1.69, m 40.2, t 38, 39b, 40 37, 38, 40, 41, 42 38, 41, 42, NH 1.69, m 39.9, t 39b 1.62, m 38, 39a, 40 37, 38, 40, 41, 42 38, 41, 42, NH 1.63, m 40 1.65, m 24.6, d 39a, 39b, 41, 42 38, 39, 41, 42 38, 41, 42, NH 1.64, m 24.3, d 41 0.90, d (5.3) 22.6, q 40 39, 40, 42 0.92, m 22.3, q 42 0.86 22.2, q 40 39, 40, 41 0.88, m 22.8, q NH 7.05, d (5.8) 38 39, 43 38, 39b, 44, 49 7.06, d (5.4) Hiva 1 43 169.9, s 170.1, s 44 5.13, d (3.3) 78.1, d 45 43, 45, 46, 47, 48 45, 46, 47, 51, NH (Leu) 5.12, d (3.2) 77.8, d

PAGE 143

143 Table 3 -1. Continued 45 2.40, qqd (6.9, 6.9, 3.3) 30.2, d 44, 46, 47 46, 47 44, 46, 47 2.42, qqd (6. 9, 6.9, 3.2) 29.9, c d 46 0.95, d (6.9) 19.2, e q 45 44, 45, 47 0.96, d (6.9) 18.98, q 47 0.92, d (6.9) 16.4, q 45 44, 45, 46 0.94, d (6.9) 16.2, q Hiva 2 48 169.5, s 169.4, s 49 4.70, d (5.9) 77.5, d 50 48, 50, 51, 52 44, 50, 51, 52, 54, 58/59, NH (Leu) 4.68, d (5.9) 77.5, d 50 2.20, qqd (6.8, 6.5, 5.9) 29.8, d 49, 51, 52 48, 49, 51, 52 49, 51, 52 2.20, qqd (6.8, 6.6, 5.9) 29.5, d 51 1.04, d (6.5) 17.7, q 50 48, 49, 52 1.06, d (6.8) 18.5, q 52 1.06, d (6.8) 18.8, q 50 48, 49, 51 1.05, d (6.6) 17.6, q N N Me 2 Val 53 172.46, s 172.3, s 54 2.82, d (10.7) 73.8, s 55 53, 55, 56, 57, 58/59 49, 55, 56, 57, 58/59 2.83, d (10.6) 73.6, d 55 1.98, m 27.5, d 54, 56, 57 53, 54, 56, 57 54, 56, 57, 58/59 1.96, m 27.3, d 56 0.88, m 19.5, q 5 5 54, 55, 57 0.99, d (6.6) 18.90, q 57 0.98, d (6.5) 19.2, e q 55 53, 54, 55, 56 0.88, m 19.3, q 58/59 2.30, s 41.1, q 58/59 49, 54 2.31, s 40.9, q aMultiplicity derived from APT and HMQC spectra. bProtons showing longrange correlation to indicated carbon. cThe chemical shift of these carbons was deduced by virtue of HMBC correlations, as their correlation(s) were not observed in the HMQC spectrum. dThere is insufficient information to distinguish between carbons 33 and 36. eThese carbons have the same chemical shift.

PAGE 144

144 Table 3 -2. NMR spectral data for grassystatin C ( 6) at 600 MHz in CDCl3 Conformer 1 a Conformer 2 a C/H No. H ( J in Hz) C b mult. H ( J in Hz) C b mult. 1 H 1 H COSY Key HMBC c Key ROESY O Me Pro 1 173.1, s 173.1, s 2 4.35, dd (7.9, 5.4) 58.8, d 4.35, dd (7.9, 5.4) 58.8, d 3a, 3b 1 3a 2.02, m 28.8, t 2.02, m 28.8, t 2, 3b, 4a, 4b 1 3b 1.82, m 1.82, m 2, 3a, 4a, 4b 1 6 4a 1.88, m 24.8, t 1.88, m 24.8, t 3a, 3b, 4b, 5a, 5b 4b 1.72, m 1.72, m 3a, 3b, 4a, 5a, 5b 5a 3.45, m 46.7, t 3.45, m 46.7, t 4a, 4b, 5b H 8 5b 3.05, m 3.05, m 4a, 4b, 5a 6 3.72, s 52.3, q 3.72, s 52.3, q 1 3b N Me Phe 7 168.6, s 168.6, s 8 5.45, dd (8.8, 6.4) 56.2, d 5.40, dd (8.8, 6.3) 56.4, d 9a, 9b 16, 17 H 5a, 16 9a 3.27, m 35.4, t 3.27, m 35.4, t 8, 9b 7 16 9b 2.83, m 2.83, m 8, 9a 7 16 10 136.7, s 136.7, s 11/15 7.21, m 129.3, d 7.21, m 129.3, d 12/14 12/14 7.25, m 128.5, d 7.25, m 128.5, d 11/15, 13 13 7.19, m 126.8, d 7.19, m 126.8, d 12/14 16 3.057, s 30.0, q 3.061, s 30.0, q 8, 17 8, 9a, 9b, 18a, 18b Gly 17 168.8, s 168.8, s 18a 4.11, dd ( 17.4, 4.7) 41.2, t 4.23, dd ( 17.1, 5.5) 41.1, t 18b, NH 17, 19 16 18b 3.94, dd ( 17.4, 3.7) 3.82, dd ( 17.1, 3 .8) 18a, NH 17, 19 16 NH 7.49, dd (4.7, 3.7) 7.70, dd (5.5, 3.8) 18a, 18b 19 20 Ile 19 171.8, s 171.8, s 20 4.50, dd (8.0, 5.7) 57.9, d 4.56, dd (9.2, 4.4) 57.8, d 21, NH 19, 25 NH (Gly) 21 2.01, m 36.6, d 2.13, m 36.5, d 20, 22, 2 3b 22 0.91, m 15.7, q 0.93, m 11.8, q 21 23a 1.48, m 24.3, t 1.46, m 24.3, t 23b, 24 23b 1.12, m 1.12, m 22, 23a, 24 24 0.88, m 11.7, q 0.88, m 11.7, q 23a, 23b NH 7.25, m 7.40, d (8.9) 20 25 26a, 26b Sta 25 172.6, s 17 3.0, s 26a 2.48, dd ( 13.9, 9.3) 38.7, t 2.56, dd ( 13.3, 9.6) 38.2, t 26b, 27 25 NH (Ile)

PAGE 145

145 Table 3 -2. Continued 26b 2.35, m 2.39, m 26a, 27 25 NH (Ile) 27 3.92, m 72.3, d 3.95, m 73.7, d 26a, 26b, 28, OH d 28 3.98, m 52.0, d 4.07, m 52.5, d 27, 29, NH 33 29 1.35, m (2H) 38.9, t 1.35, m (2H) 38.9, t 28, 30 30 1.45, m 24.7, d 1.45, m 24.7, d 29, 31, 32 38 31 0.88, m 23.7, q 0.84, m 23.3, q 30 32 0.83, m 21.2, q 0.83, m 21.2, q 30 OH 4.78, b 4.78, b 27 d NH 6.49, b 7.92, d (8.5) 28 33 34 N Me Gln 33 170.2, s 170.2, s 34 5.09, m 55.8, d 5.07, m 59.5, d 35a, 35b 33, 38, 39 38, 40, NH (Sta) 35a 2.36, m 23.7, t 2.60, m 25.9, t 34, 35b, 36a, 36b 38 35b 1.85, m 1.64, m 34, 35a, 36a, 36b 33, 37 38 36a 2.30, m 32.5, t 2.51, m 33.1, t 35a, 35b, 36b 37 36b 2.14, m 2.22, ddd ( 14.1, 8.5, 5.6) 35a, 35b, 36a 37 38 37 175.0, s 175.0, s 38 3.02, s 30.3, q 2.74, s 29.1, q 34, 39 30, 32, 34, 35a, 35b, 36b, 40, 41b, 43/44 NH 2 a 6.45, b 6.43, b NH 2 b NH 2 b 6.15, b 6.14, b NH 2 a Leu 39 173.5, s 172.3, s 40 4.85, m 47.9, d 4.87, m 46.9, d 41a, 41b, NH 39 (w), 45 (w) 34, 38 41a 1.67, m 40.8, t 1.78, m 41.0, t 40, 41b, 42 39 41b 1.32, m 1.53, m 40, 41a, 42 39 38 42 1.66, m 24.7, t 1.66, m 24.7, t 41a, 41b, 43, 44 43 0.97, m 21.2, q 0.94, m 21.9, q 42 38 44 0.93, m 23.4, q 0.97, m 23.2, q 42 38 NH 7.27, m 7.19, m 40 45 Hmpa 45 174.3, s 175.1, s 46 4.11, m 74.1, d 4.11, m 74.1, d 47 45 47 1 .83, m 38.5, d 1.83, m 38.5, d 46, 48, 49a, 49b 48 0.80, d (6.8) 12.8, q 0.76, d (6.8) 12.4, q 47 49a 1.45, m 26.2, t 1.45, m 26.2, t 47, 49b, 50 49b 1.31, m 1.31, m 47, 49a, 50

PAGE 146

146 Table 3 -2. Continued 50 0.92, m 11.8, q 0.92, m 11.8, q 49a 49b OH aConformers 1 and 2 were the most prominent, and they were evident in approximately a 2.45:1 ratio. bMultiplicity derived from APT and HMQC spectra. cProtons showing long-range correlation to indicated carbon. dCorrelation apparent for conformer 2 only.

PAGE 147

147 Table 3 -3. IC50s of g rassystatins A C ( 4 6) against aspartic and metalloproteases identified in the primary screen. For comparison, the positive control inhibitors pepstatin A and GM6001 are included. Protease Grassystatin A ( 1 ) Gr assystatin B ( 2 ) Grassystatin C ( 3 ) Pepstatin A a GM6001 a Cathepsin D 26.5 5.4 nM 7.27 0.9 nM 1.62 0.3 M 173 9.9 pM Cathepsin E 886 135 pM 354 192 pM 42.9 1.7 nM 181 8.49 pM ADAM9 46.1 21.7 M b 85.5 4.0 M b >100 M b 56.3 6.37 nM ADAM10 >100 M b 87.2 17.1 M b >100 M b 263 9.17 nM TACE 1.23 0.2 M b 2.23 0.2 M b 28.6 3.2 M b 13.1 1.8 nM aIC50s obtained for the positive controls in these experiments were close to their average IC50s obtained under the same conditions on other days (for pepstatin A, average IC50s were 173 pM and 181 pM for cathepsin D and E respectively, for GM6001, average IC50s were 50.3 nM, 263 nM and 13.1 nM for ADAM9, ADAM10 and TACE respectively). bThese IC50s were calculated from the later part of the progress curves, as time-dependent inhibition was evident (see text). Note: assays were carried out by Reaction Biology Corp. (Malvern, PA).

PAGE 148

148 Table 3 -4. Conditions employed and results for protease screen and IC50 a ssaysa Protease % Activity 10 M 4 Substrate Ex/Em Buffer a [Sub] ( M) Positive control Activated Protein C in 50% G ly 130 2.3 Boc DVLR ANSN H C4H9 355/460 B 50 Gabexate mesylate ACE1 84 6.4 MCA RPPGFSAFK(Dnp) 320/405 A 10 Captopril ADAM 9 3 1.8 MCA PLAQAV Dpa RSSSR NH3 320/405 I 10 GM6001 ADAM 10 0.4 0.9 MCA PLAQAV Dpa RSSSR NH3 320/405 I 10 GM6001 BACE 1 68 3.3 MCA SEVNLDAEFRK(Dnp) RR NH 2 320/405 J 10 Pepstatin A Calpain 1 80 1.1 Biom ol, N Succinyl Leu Tyr AMC 355/460 K 10 E 64 Caspase 1 90 3.4 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 2 69 0.9 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 3 63 8.3 Ac DEVD AMC 355/460 F 5 DEVD CHO Caspase 4 64 6.6 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 5 58 0.8 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 6 91 2.8 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 7 62 3.1 Ac DEVD AMC 355/460 F 5 DEVD CHO Caspase 8 82 5.8 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 9 78 4.2 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 10 102 0.3 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 11 60 3.0 Ac LEHD AMC 355/460 G 5 IETD CHO Caspase 14 96 5.9 Ac LEHD AMC 355/460 G 5 IETD CHO Cathepsin B 104 2.9 Z FR AMC (Biomol) 355/460 L 10 E 64 Activated Cathepsin C 110 0.2 Z FR AMC (Biomol) 355/460 L 10 E 64 Cathepsin D 4 0.9 Mca GKPILFFRLK(Dnp) D R NH 2 320/405 P 10 Pepstatin A Cathepsin E 0.8 0.3 Mca GKPILFFRLK(Dnp) D R NH 2 320/405 P 10 Pepstatin A Cathepsin H 80 0.1 R AMC 355/460 M 10 E 64 Activated Cathepsin K/O/O2/X 100 3.1 Z GPR AMC 355/460 C 10 E 64 Cathepsin S 83 1.9 Z FR AMC (Biomol) 355/460 M 10 E 64 Activated Cathepsin V 124 1.5 Z FR AMC (Biomol) 355/460 C 10 E 64 Activated Cathepsin X/Z 94 6.2 MCA RPPGFSAFK(Dnp) 320/405 D 10 E 64 Chymase 90 5.8 Suc AAPF AMC 355/460 B 10 Chymostatin Chymotrypsin 103 1.3 Suc AAPF AMC 355/460 B 10 Chymostatin DPP IV 71 0.3 H GP AMC 355/460 H 10 P32/98

PAGE 149

149 Table 3 -4. Continued DPP VIII 71 3.5 H GP AMC 355/460 H 10 P32/98 DPP IX 62 2.0 H GP AMC 355/460 H 10 P32/98 Elastase (Porcine Pancreatic) 66 7.7 AR AMC 355/460 B 10 Gabex ate mesylate Factor Xa 84 5.8 CH 3 SO 2 D CHA Gly Arg AMC AcOH 355/460 N 10 Gabexate mesylate Factor XIa 74 5.6 (Boc Glu(OBzl) Ala Arg) MCA 355/460 A 10 Gabexate mesylate Activated Kallikrein 4 62 0.1 VPR AMC 380/460 E 10 Gabexate mesylate Kallikrei n 5 83 2.0 Z VVR AMC 355/460 A 10 Gabexate mesylate Activated Kallikrein 8 101 4.0 VPR AMC 380/460 E 10 Gabexate mesylate MMP1 81 0.04 (5 FAM/QXLTM) FRET peptide [QXL520 g Abu PCha Abu Smc -H-ADab(5 FAM) -A-KNH2] 485/520 H 5 GM6001 MMP2 (5 FAM/ QXLTM) FRET peptide 485/520 H 5 GM6001 MMP3 86 1.6 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP7 89.7 0.8 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP8 ( Catal ytic domain) 70.5 2.7 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP9 ( Catalytic domain) 81 2.9 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP10 (Catalytic domain) 76 4.6 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP11 (Catalytic domain) (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP12 (Catalytic domain) 79 0.4 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP13 (Catalytic domain) 75 0.5 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 MMP14 (Catalytic domain) 77 2.1 (5 FAM/QXLTM) FRET peptide 485/520 H 5 GM6001 Papain (Cysteine Protease) 101 7.2 Z FR AMC 355/460 M 10 E 64 Activated Plasma Kallikrein 78 5.0 Z FR AMC 380/460 A 10 Gabexate mesylate Plasmin (Human) 86 1.1 H D CHA Ala Arg AMC.2AcOH 355/460 A 10 Gabexate mesylate Renin (Human) RE(EDANS)IHPFHLVIHTK(DABCYL)R 340/520 A 50 Pe pstatin A TACE 31 7.1 MCA PLAQAV Dpa RSSSR NH2 320/405 I 10 GM6001 Thrombin alpha 86 4.7 H D CHA Ala Arg AMC.2AcOH 355/460 O 10 Gabexate mesylate Trypsin (Bovine Pancreatic) 77 2.8 H D CHA Ala Arg AMC.2AcOH 355/460 A 10 Gabexate mesylate Trypta se beta 2 (Serin e Protease) 74 1.7 Z GPR AMC 355/460 A 10 Gabexate mesylate Tryptase gamma 1 (Human lung) 80 4.7 Z GPR AMC 355/460 A 10 Gabexate mesylate Urokinase 79 1.4 Bz b Ala Gly Arg AMC.AcOH 355/460 A 10 Gabexate mesylate aBuffers: A 25 mM Tris pH 8.0, 100 mM NaCl, 0.01% Brij35 B 100 mM Tris HCl, pH 8.0, 50 mM NaCl, 10 mM CaCl 2 0.025% CHAPS, 1.5 mM DTT

PAGE 150

150 C 25 mM Sodium Acetate pH 5.5, 0.1 M NaCl, 5 mM DTT D 25 mM Sodium Acetate pH 3.5, 5 mM DTT E 25 mM Tris pH 9, 150 mM NaCl F 50 mM HEPE S pH 7.4, 100 mM NaCl, 0.01% CHAPS, 0.1 mM EDTA, 10 mM DTT G 50 mM HEPES pH 7.4, 1 M Na Citrate, 100 mM NaCl, 0.01% CHAPS, 0.1 mM EDTA, 10 mM DTT H 50 mM HEPES (pH7.5), 10 mM CaCl 2 0.01% Brij 35, store at 4 C; add 0.1 mg/ml BSA in buffer before use. I 25 mM 2 0.005% Brij J 0.1 M Sodium Acetate, pH 4.0 K 75 mM Tris pH 7.0, 0.005% Brij35, 3 mM DTT, 0.5 mM CaCl 2 L 25 mM MES pH 6, 50 mM NaCl, 0.005% Brij35, 5 mM DTT M 75 mM Tris pH 7.0, 1 mM EDTA, 0.005% Brij35, 3 mM DTT N 25 mM Tris pH 8.0, 100 mM NaCl, 0.01% Brij35, 0.25 mg/ml BSA O 25 mM Tris pH 8.0, 100 mM NaCl, 0.01% Brij35, 2.5 mM CaCl 2 1 mg/ml BSA P 0.1 M Sodium Acetate, pH 3.5, 0.1 M NaCl aNote: this screen was carried out by Reaction Biology Corp. (Malvern, PA)

PAGE 151

151 Table 3 -5. NMR spectral data for grassystatin A ( 4) at 600 MHz in DMSOd6 C/H no. H ( J in Hz) C, a mult. 1 H 1 H COSY HMBC b ROESY O Me Pro 1 172.4, s 2 4.27, dd (7.8, 7.8) 58.8, d H 3a, H 3b 1, 3, 4 H 3a, H 3b, H 2 4 3a 2.22, m 28.3, t H 3b, H 2 4 4 H 2, H 3b, H 2 4, H 3 6 3b 1.72, m H 3a, H 2 4 H 2, H 3a, H 5b, H 3 6 4 1.77 (2 H) 24.7, t H 3a, H 3b, H 5a, H 5b 3 H 2, H 3a, H 5b 5a 3.34, m 46.4, t H 2 4, H 5b 3 H 8 5b 3.18, m H 2 4, H 5a H 3b, H 2 4, H 8, H 3 16 6 3.61, s 51.5, q 6 H 3a, H 3b N Me Phe 7 167.9, s 8 5.51, dd (9.7, 5.8) 55.1, d H 9a, H 9b 7, 9, 10, 16, 1 7 H 5a, H 5b, H 9a, H 9b, H 11/15, H 3 16 9a 2.99, dd ( 14.0, 5.8) 33.8, t H 8, H 9b 8, 10, 11/15 H 8, H 9b, H 11/15 9b 2.80, dd ( 14.0, 9.7) H 8, H 9a 7, 8, 10, 11/15 H 8, H 9a, H 11/15 10 137.8, s 11/15 7.20, m 129.4, d H 12/14 9, 10, 11/15, 12/14, 13 H 8, H 9a, H 9b, H 3 16, H 3 19 12/14 7.19, m 127.6, d H 11/15, H 13 10, 11/15, 12/14, 13 13 7.13, m 125.9, d H 12/14 16 2.89, s 29.5, q 8, 17 H 5b, H 8, H 11/15, H 18, H 3 19, H 38 Ala 17 172.1, s 18 4.54, dq (7.0, 6.9) 44.3, d H 3 19, NH 19 H 3 16, H 3 19, NH (Ala) 19 0.74, d (6.9) 16.1, q H 18 17, 18 H 11/15, H 3 16, H 18, NH (Ala) NH 7.94, d (7.0) H 18 21 H 18, H 3 19, H 22, H 23 Thr 21 169.7, s 22 4.15, dd (8.4, 4.6) 57.6, d H 23, NH 21, 23, 24, 25 H 3 24, OH (Thr), NH (Th r), NH (Ala) 23 3.85, qdd (6.3, 5.1, 4.6) 66.5, d H 22, H 3 24, OH 21 H 3 24, OH (Thr), NH (Thr), NH (Ala) 24 0.97, d (6.3) 19.2, q H 23 22, 23 H 22, H 23, OH (Thr), OH (Sta), NH (Thr) OH 4.63, d (5.1) H 23 22, 23, 24 H 22, H 23, H 3 24, NH (Thr) NH 7.61, d (8.4) H 22 25 H 22, H 23, H 3 24, H 2 26, H 27, OH (Thr), OH (Sta) Sta 25 171.3, s 26 2.18, m (2H) 39.7, t H 27 25, 27 H 27, OH (Sta), NH (Thr) 27 3.75, m 69.2, d H 2 26, OH H 2 26, OH (Sta), NH (Thr) 28 3.76, m 50.3, d H 29a, H 29b, NH H 29a, H 29b, H 30, H 3 31, H 3 32, NH (Sta) 29a 1.32, m 39.5, t H 28, H 29b, H 30 H 28, H 29b, OH (Sta), NH (Sta)

PAGE 152

152 Table 3 -5. Continued 29b 1.17, m H 28, H 29a, H 30 H 28, H 29a, H 3 31, H 3 32, OH (Sta) 30 1.50, m 23.7, d H 29a, H 29b, H 3 31, H 3 32 H 28, H 3 31, H 3 32, NH (Sta) 31 0.82, d (6.5) 23.0, q H 30 29 H 28, H 29b, H 30 32 0.78, d (6.1) 21.5, q H 30 29 H 28, H 29b, H 30 OH 4.82, d (4.8) H 27 H 3 24, H 2 26, H 27, H 29a, H 29b, NH (Sta), NH (Thr) NH 7.13, m H 28 H 26, H 28, H 29a, H 3 0, H 34, OH (Sta) Asn 33 171.6, c s 34 4.55, ddd (7.7, 7.5, 6.3) 49.5, d H 35a, H 35b, NH 33, 35, 36 H 35a, H 35b, NH (Sta), NH (Asn) 35a 2.58, dd ( 15.4, 7.5) 36.3, t H 34, H 35b 33, 34 H 34, H 35b, NH 2 a, NH (Asn) 35b 2.34, dd ( 15.4, 6.3) H 34 H 35a 33, 34, 36 H 34, H 35a, NH 2 a, NH (Asn) 36 170.5, c s NH 2 a 7.38, s H 35a, H 35b, NH 2 b NH 2 b 6.88, s 35 NH 8.29, d (7.7) H 34 37 H 34, H 35a, H 35b, H 38, H 39b Leu 37 172.0, s 38 4.37, m 50.1, d H 39a, H 39b, NH 37, 39 H 3 16, H 39a, H 39b, H 40, H 3 41, H 3 42, NH (Asn), NH (Leu) 39a 1.47, m 40.7, t H 38, H 39b, H 40 41, 42 H 38, H 39b, NH (Leu) 39b 1.35, m H 38, H 39a, H 40 42 H 38, H 39a, H 3 41, H 3 42, NH (Asn) 40 1.54, m 23.6, d H 39a, H 39b, H 3 41, H 3 42 H 38, H 3 41, H 3 42, H 49, NH (Leu) 41 0.82, d (6.5) 23.0, q H 40 39 H 38, H 39b, H 40 42 0.78, d (6.1) 21.0, q H 40 39 H 38, H 39b, H 40 NH 7.85, m H 38 43 H 38, H 39a, H 40, H 44, H 3 47, H 49 (w) e Hiva 1 43 168.3, s 44 4.88, d (4.4) 77.9, d H 45 43, 45, 46, 47 H 45, H 3 46, H 3 47, H 50, NH (Leu) 45 2.13, qqd (7.0, 6.9, 4.4) 29.9, d H 44, H 3 46, H 3 47 46, 47 H 44 46 0.88, d (6.9) 18.5, q H 45 44, 45, 47 H 44, H 49 47 0.86, d (7.0) 16.5, d q H 45 44, 45 H 44, H 49, NH (Leu) Hiva 2 48 168.8, s 49 5.04, d (3.9) 75.7, d H 50 48, 50, 51, 52, 53 H 40, H 3 46, H 3 47, H 50, H 3 51, H 54, NH (Leu, w) e 50 2.26, qqd (7.3, 6.8, 3.9) 29.3, d H 49, H 3 51, H 3 52 51, 52 H 44, H 49, H 3 51, H 3 52 51 0.99, d (6.8) 18.6, q H 50 49, 50, 52 H 49, H 50, H 54 52 0. 92, d (7.3) 16.5, d q H 50 49, 50, 51 H 50 N N Me 2 Val 53 170.6, s

PAGE 153

153 Table 3 -5. Continued 54 2.76, d (10.7) 73.2, d H 55 53, 55, 57, 58/59 H 49, H 3 51, H 55, H 3 56, H 3 57, H 3 58/59 55 1.91, dqq (10.7, 7.3, 6.6) 26.9, d H 54, H 3 56, H 3 57 54, 57 H 54, H 3 56, H 3 57 56 0.91, d (7.3) 18.9, q H 55 54, 55, 57 H 54, H 55 57 0.84, d (6.6) 19.2, q H 55 54, 55 H 54, H 55 58/59 2.23, s 40.6, q 54, 58/59 H 54 aMultiplicity derived from edited HSQC. bProtons showing longrange correlation to indicated carbon. cThere is insufficient information to distinguish between carbons 33 and 36. dThese carbons have the same chemical shift. ew denotes a weak correlation.

PAGE 154

154 Figure 3 -1. Structures of g rassystatins A ( 4), B ( 5 ) and C ( 6).

PAGE 155

155 Figure 3 -2. Str uctures of pepstatin A (including binding site nomenclature), tasiamide, and tasiamide B.

PAGE 156

156 Figure 3 -3. ESIMS fragmentation pattern of grassystatins A ( 4) and B ( 5).

PAGE 157

157 Figure 3 -4. ESIMS fragmentation pattern for grassystatin C ( 6).

PAGE 158

158 Figure 3 -5. Prot ease screen treated with grassystatin A ( 4), 10 M. Values represent % enzyme activity compared to solvent control, and additionally represented by a continuous color scale (0% red, 100% green). Standard deviations for these results are quoted in Table 3-4.

PAGE 159

159 Figure 3 -6. Progress curves of cathepsin E and TACE treated with grassystatin A ( 4). Inhibition of cathepsin E is not time dependent, and initial rate is affected by 4. Inhibition of TACE is time dependent, and so initial rate is not affected by 4 as the onset of inhibition is slow.

PAGE 160

160 Figure 3 -7. Activities of grassystatin A ( 4) and pepstatin A against MCF7 cellular proteases as determined with a cathepsin D/E substrate (see text). a ) MCF7 cells were treated with grassystatin A ( 4) or pepstatin A. C ells were lysed and the protease act ivity of the lysates assessed. b ) MCF7 cell lysate was directly treated with grassystatin A ( 4) or pepstatin A. *Denotes significance of P < 0.05 using a twotailed t test.

PAGE 161

161 Figure 3 -8. Downregulation of antigen presentation of T cells and TH cells after treatment with grassystatin A ( 4) on activated PBMC and DC. a) Downregulation of the activation of CD3+ T cells on whole PBMC after treatment with different concentrations of 4. b) Downregulation of TH activation (proliferation) by the addition of different concentrations of 4. c and d) Effect of 4 on the production of intracellular IFN and IL -17 by TH cells induced by autologous activated DC. Cont refers to T cells that did not have DCs added to them. *Denotes signi ficance of P < 0.05 using a twotailed t test. These experiments were carried out by Erika Eksioglu.

PAGE 162

162 Figure 3 -9. Effect of 4 on the a) T cell proliferation and production of b) intracellular IFN and c ) IL -17 by TH cells induced by allogeneic activated DC in an MLR. Cont refers to T cells that did not have DCs added to them. *Denotes significance of P < 0.05 using a two tailed t test. These experiments were carried out by Erika Eksioglu.

PAGE 163

163 Figure 3 -10. Docked structures of grassystatin A ( 4) and C ( 6) with cathepsins D and E. For each the protein is shown in green, and possible hydrogen bonds are shown as dotted yellow lines. a) Docked conformation of grassystatin A ( 4, yellow) with cathepsin D. b) Docked conformation of grassystatin A ( 1) with c athepsin E. c ) Docked conformation of grassystatin C ( 6, pink) with cathepsin D. d) Docked conformation of grassystatin C ( 6) with cathepsin E. For docked conformations of pepstatin A, see F igure 3 -11.

PAGE 164

164 Figure 3 -11. a ) Docked structure of pepstatin A (magenta) overlaid with the Xray structure of pepstatin A bound to cathepsin D (cyan). Cathepsin D is shown in green. b) Docked structure of pepstatin A (magenta) with homology model of cathepsin E.

PAGE 165

165 CHAPTER 4 CYANOBACTERIAL COMPOUNDS THAT INTERFERE WITH QUORUM SENSING* Introduction Quorum sensing (QS) is a mechanism by which bacteria regulate their behavior in response to increases in their population density. Within a diffusion-limited environment, the local concentration of small molecule cues i ncreases with bacterial population, acting to upregulate virulence genes in opportune situations (i.e., when the population of bacteria is large enough to overwhelm host defenses).147 QS pathways, therefore, are an attractive target for antimicrobial defense. In the marine environment, QS also contributes to the formation of biofilms by bacteria, the first step in the process of colonization of abiotic surfaces (biofouling).10 This process generally occurs before the recruitment of higher macroorganisms such as algae and invertebrate larvae, and biofilms can also form on the surfaces of living organisms. Thus, QS is likely crucial to the formation and maintenance of marine benthic communities. In gram negative bacteria, acylhomoserine lactones (AHLs, Figure 4-1a), of varying alkyl chain lengths and oxidation states at C-3, are used in quorum signaling.148 AHLs with short side chains diffuse freely in the medium and through cell membranes, and can bind intracellularly with receptor proteins (R proteins), which dimerize and typically act as transcriptional activators of target genes.149 One of these targets is generally the gene responsible for the synthesis of the signaling molecule itself. In this way QS is a positive feedback loop, and QS signaling molecules are sometimes ref erred to as autoinducers.49 Reproduced in part with permission from Kwan, J. C.; Teplitski, M.; Gunasekera, S.; Paul, V. J.; Luesch, H. J. Nat. Prod. 2010, 73, 463. C opyright (2010) American Chemical Society and American Society of Pharmacognosy. Reproduced in part with permission from ACS Chem. Biol. submitted for publication. Unpublished work copyright 2010 American Chemical Society.

PAGE 166

166 There is increasing evidence that various marine organisms can interfere with bacterial quorum sensing. Several halogenated furanones that inhibit AHL signaling have been isolated from the marine red alga Delisea pulchra.150 Recently, it has been shown that these compounds do not compete with AHLs but instead accelerate turnover of the LuxR protein.151 LuxR is the master regulator of three QS pathways in many luminescent Vibrio spp., and so furanones block all AHL signaling in these species.152 More recently, tumonoic acids E H from the cya nobacterium Blennothrix cantharidosmum were shown to reduce luminescence in wildtype Vibrio harveyi although the mechanism of action was not determined.53 In a screen of 284 extracts of marine organisms, 23% were found to exhibit quorum sensing antagonism in a LuxRbased reporter.153 Therefore, it would seem that QS modulation may be a fairly widespread phenomenon amongst lower organisms for pathogen defense or for maintenance of bacterial symbionts. Natural antibiotics have long provided benefit in the treatment of infectio ns (e.g., penicillins, macrolides and glycopeptides). Likewise, natural QS modulators may prove useful in the treatment and prevention of infection. Bacterial infections and the increase in antibiotic resistant pathogens are an ever escalating problem. Such infections complicate and prolong hospital stays and increase the cost to individuals and society.154 Antibiotics exert strong selective pressure on bacteria, and consequently, resistance is strongl y associated with increased antibiotic use.155,156 Agents that are not bactericidal, but instead modulate harmful bacterial behavior, could perhaps exert less selective pressure for resistance. It has been suggested that this may be a strategy used by marine organisms that lack cellular immune systems ,11 due to the fact that the ecologically relevant concentrations of natural antibiotics are sometimes in the sub lethal range.

PAGE 167

167 One prime target for QS -based therapy is the opportunistic pathogen Pseudomonas aeruginosa. This organism is a particular problem in cystic fibros is, where it can persistently establish itself in chronic lung infections .157 Persistence is largely due to the formation of antibiotic -resistant biofilms, a phenotype which is modulated by QS. P. aeruginosa can also cause serious eye infections in wearers of contact lenses, with extensive tissue damage mediated by the QS -controlled proteolytic enzymes, including the elastase LasB.157 P. aeruginosa has multiple QS pathways, mediated through two AHLs (3oxo -C12HSL and C4HSL)49 and a group of quinolone compounds (the Pseudomonas quinolone signaling pathway, PQS).158 The interplay of the two AHL pathways is shown in Figure 4-1b. One important feature of these is that the RhlR -RhlI system is subordinate to the LasRLasI system ,159 as expression of both RhlR and C4HSL synthesis (via RhlI) is regulated by LasR/3 oxo-C12HSL (Figure 4-1a). Therefore both 3-oxo-C12HSL and C4HSL are required for expression of RhlR target genes. The expression of LasR is not under the control of AHLmediated signaling ,160,161 and it therefore represents an upstream target for QS inhibition in P. aeruginosa. Interplay of AHL signaling with the quinolone pathway is complex. While on the one hand, quinolone signaling is thought to be dependent on LasRLasI ,158 this pathway has been shown to act independently under some circumstances.162 Malyngamides In the late 1970s and early 1980s, malyngamides A E, malyngamide C acetate, deoxymalyngamide C, and dideoxymalyngamide C163 167 were isolated from Lyngbya majuscula and described by Richard E. Moores laboratory, while Paul J. Scheuers group isolated the

PAGE 168

168 related s tylocheilamide168, *Malyngamides are small amides produced by marine cyanobacteria, of which there are 29 known examples (malyngamides A X,163167,169 182 C acetate, deoxy C, dideoxy C,163 F acetate171 and s tylocheilamide168). The acid side chain is most commonly (4E ,7S)-7methoxytetradec -4enoic acid (lyngbic acid), but it can be (4 E ,7S)-7-methoxy-9methylhexadec-4enoic acid (as in malyngamides D and E167) or (4 E ,7S)-7-methoxydodec-4enoic acid (as in malyngamides G,176 S,169 and U W173,174). In one notable example (malyngamide X177,178) the side ch ain is 7 R lyngbic acid. The other half of the molecule sometimes contains a vinyllic chlorine and either a five membered lactam or a six membered cyclic ketone, lactone, or aromatic ring. from the sea hare Stylocheilus longicauda. Subsequently, many more members of the series169 180 were reported, largely by William Gerwicks lab and mostly isolated from Lyngbya majuscula. Some malyngamides have been isolated from sea hares168,169,178,181 and a red alga,172 but in these cases the biosynthetic origin is thought to be dietary and epiphy tic cyanobacteria, respectively. Various malyngamides have been reported to have cytotoxic activit y, usually in the micromolar range. Ecologically, malyngamides A and B are known feeding deterrents,183 185 but it is worth noting that the biological activity of some members of the series are largely unexplored. Here we present a previously unknown epimer of malyngamide C, 8epi malyngamide C ( 7, Figure 4-2), and evaluation of its cytotoxicity and quorum sensing inhibitory activity. The structure of stylocheilamide was later revised by Gerwick (Todd, J. S.; Gerwick, W. H. Tetrahedron 1995, 36, 7837) and the absolute configuration was determined later (Kan, Y.; Fujita, T., Nagai, H.; Sakamoto, B.; Hokama, Y. J. Nat. Prod. 1998 61 15 2).

PAGE 169

169 Lyngbyoic Acid We describe the isolation and structure determination of a simple cyclopropane-containing fatty acid from a marine cyanobacterium, termed lyngbyoic acid ( 8, Figure 4-2). We found 8 to inhibit quorum sensing independent of the AHL binding site of LasR, and investigated its effects in wild type P. aeruginosa. We found that 8 had opposite effects on pyocyanin and LasB transcription and expression compared to the closely related compound dodecanoic acid ( 11 ), prompting us to term 8 a tagged fatty acid. We investigated the effects of 8 on the global transcriptome of P. ae ruginosa, finding it inhibited QS without affecting the expression of either lasRlasI or rhlRrhlI and that in some respects the compound mimics the phenotype seen in chronic lung infections of cystic fibrosis patients. From an ecological standpoint, compound 8 likely plays a role in the defense against pathogens or else acts to suppress competing bacterial species. Isolation and Structure Determination Samples of Lyngbya majuscula were collected off Bush Key, Florida, within the Dry Tortugas National Park in April 2007. The material was freeze-dried and extracted with EtOAc MeOH to afford a non-polar extract which was subsequently partitioned between hexanes and MeOH H2O (80:20). The MeOH H2O fraction was further partitioned between n BuOH and H2O. Th e n-BuOH soluble portion was subjected to silica gel chromatography and HPLC to give 7 and lyngbic acid ( 10, Figure 4 -2 ). HRESI/APCIMS data for 7 suggested a molecular formula of C24H38ClNO5 ( m / z 456.2518 and 458.2492 for [M + H]+). This molecular formula is identical to that of malyngamide C,163 but although the 1H and 13C NMR spectra for 7 are similar to those of a previously isolated sample of malyngamide C, there are differences (see Appendix ). Examination of the 1H NMR,

PAGE 170

170 13C NMR, COSY, edited HSQC and HMBC spectra of 7 (Table 4-1) allowed the construction of the same 2D structure as malyngamide C. Importantly, while the signal for H -8 in the 1H NMR spectrum for malyngamide C shows one large coupling (9.7 Hz), the corresponding signal in 7 shows only small couplings (Figure 4-3). It was therefore suspected that 7 is an epimer of malyngamide C, with an equatorial H -8 instead of the axial H-8 observed in malyngamide C. The carboxylic acid side chain of 7 is lyngbic acid (Figure 4 -2), which was also isolated from the same silica chromatography fraction. HRESI/APCIMS data suggested a molecular formula of C15H28O3 ( m / z 257.2121 for [M + H]+). 1H and 13C NMR data were identical to literature values177,186,187 for lyngbic acid ( 10 ). In addition, the specific rotation was close to values previously reported for the S isomer ( 12.6 versus 13.3,177 12.8187 and 13188), and therefore the configuration had to be 7S. Isolation of 7S-lyngbic acid supports a 7 S configuration for 7. NOESY correlations between H-3 of 7 and H1a and H -1b suggest a Z configuration for the C2 C3 double bond, as in malyngamide C. In order to test our hypothesis that 7 is the 8 epimer of malyngamide C, selective inversion of this center was carried out using the Mitsunobu reaction, with p-nitrobenzoic acid ( pNBA) as the nucleophile (see Figure 4 -4).189 Deprotection using K2CO3 190 gave the inverted product that had 1H and 13C NMR spec tra identical to malyngamide C The spectroscopic data also matched those previously reported for malyngamide C.163 Additionally, the product had a very similar specific rotation to that reported for malyngamide C ( 29.3 versus 27.4163), indicating that both compounds have the same absolute configuration. This result therefore established the absolute configuration of 7 to be 4 S,8R ,9S,7 S. Compound 8 was found in relatively large amounts, similar to the tumonoic acids.191 Natural quorum sensing inhibitors generally exhibit IC50s in the micromolar range (including

PAGE 171

171 tumonoic acids,53 halogenated furanones150 and manoalides153), and consequently they have to be present in high concentrations in the native organism. Interestingly, in addition to the main collection that produced 1 only, in another collection of Lyngbya sp. from Dry Tortugas, we coisolated 8 with two other QS inhibitors, malyngolide54 and lyngbic acid ( 9 and 10, respectively) in smaller amounts. With this in mind, and also with the consideration that 8 somewhat resembled some natural AHL disrupters, we screened it against a panel of AHL -responsive QS reporter strains (Table 4-3). These reporters are based on the AHL receptors from Vibrio fischeri (a common marine microorganism, and also a symbiont of marine invertebrates), Aeromonas hydrophila (a common aquatic organism, and a fish pathogen), and Pseudomonas aeruginosa (a ubiquitous bacterium, opportunistic pathogen of plants and animals). Samples of Lyngbya sp. were collected near Fort Pierce, Florida, in the Indian River Lagoon. Following freeze drying and extraction with EtOAc MeOH (1:1), the resulting extract was subjected to solvent partitio ning, silica gel chromatography and reversed phase HPLC to yield pure 8 (42.4 mg, 1.32% of extracte d lipophilic material, Figure 4 -2). Samples of Lyngbya cf. majuscula collected within the Dry Tortugas National Park, FL, were extracted and fractionated in a similar manner afforded 8, malyngolide ( 9) and lyngbic acid ( 10). NMR data combined with a [M H] peak of 211.1702 in the HRESI/APCIMS of 8 suggested a molecular formula of C13H24O2. Perusal of the 1H NMR spectrum revealed the presence of a carboxylic acid exchangeable proton (broad peak at H 10.18) and a cyclopropane ring (shielded signals at H 0.45 and 0.21). Analysis of 1H NMR, 13C NMR, COSY, HSQC and HMBC spectra allowed the construction of the 2D structure (Table 4-3). The relative configuration of the cyclopropane ring was assigned trans as the H 5 methylene protons are magnetically equivalent due to pseudo C2v symmetry .192 The similar compounds grenadamide,

PAGE 172

172 grenadadiene and majusculoic acid (Figure 4 -5 ), with trans cyclopropane rings, also have equivalent methylene protons for the same reason .192,193 In contrast, the cyclopropane ring in cepaciamide A was assigned cis as its methylene protons were non -equivalent.194 The absolute configuration could be determined as (4 R ,6R ) from the optical rotation, which was equal magnitude and opposite sign to that of the synthetic enantiomer.* This is the same absolute configuration reported for grenadamide.195 Although 1 is essentiall y the fatty acid side chain of grenadamide and possibly grenadadiene Quorum Sensing Reporter Studies and Mammalian Cell Toxicity of Malyngamide C and 8epi -Malyngamide C (7) it has not been previously reported as the free acid. The incidence of multiple related compounds suggests that they may all share biosynthetic functions and ecological functions, and that these are important to the survival of the cyanobacteria that produce them. Bioactivities for malyngamide C have not been previously reported and consequently malyngamide C was tested alongside 7 in all assays. Both 7 and malyngamide C were found to be cytotoxic to HT29 colorectal adenocarcinoma cells, with IC50s of 15.4 and 5.2 M, respectively. We were also interested in the potential for 7 and malyngamide C to act on bacterial quorum sensing (QS) pathways. These pathways allow bacteria to regulate their behavior according to their own population density.147 QS regulated behaviors include the expression of virulence factors and the onset of hardy biofilm phenotypes.147 One group of compounds that are used for QS signaling are the acyl homoserine lactones, which all contain a five membered lactone ring joined by an amide linkage to a fatty acid chain.148 We found The S S isomer of 7 was prepared as an intermediate in the synthesis of the enantiomer of grenadamide, with [ ]24 D +14.8 ( c 1.05, CHCl3), in: Al Dulayymi, J. R.; Baird, M. S.; Jones, K. Tetrahedron 2004, 60 341 345. As the absolute configuration of grenadadiene has not been determined, the cyclopropyl containing side chain could be the enantiomer of 8

PAGE 173

173 compounds 7 and malyngamide C were able to reduce 3 -oxo-C12-HSL signaling in a LasRbased quorum sensing reporter (Figure 4-6) at concentrations where these compounds did not inhibit bacterial cell growth. The potencies of 7 and malyngamide C are similar to that of tumonoic acid F,53 another cyanobacterial compound that previously has been reported to inhibit bioluminescence in Vibrio harveyi (IC50 62 M). Initial Acylhomoserine lactone (AHL) Quorum Sensing Screening of Lyngbyoic Acid In order to carry out an initial screen of QS modulation activities of 8, we used three repor ter plasmids transformed into E. coli (pSB401, pSB536 and pSB1075, see Table 42),196 and one Agrobacterium tumefaciens reporter that responds to 3-oxo-C8HSL. Each plasmid encodes different R proteins (that respond to different AHLs) and contains its cognate binding site within the QS regulate d promoter, cloned upstream of a promoterless light -producing luxCDABE cassette. In each, the R -protein is under the control of its native promoter.196 Reporter strains were treated with compound 8 both in the presence and absence of the cognate AHL signaling molecule (Figure 4 7a and 4 7b), in order to detect antagonism or agonism of AHL signaling, respectively. Compound 8 antagonized 3-oxo-C12HSL mediated light production through LasR (pSB1075) with an apparent IC50 of approximately 100 M, and to a much lesser extent in the other two repor ters (Figure 4 7a). Interestingly, 8 also reduced the baseline luminescence in all three reporters in the absence of cognate AHL (Figure 4 -7b), perhaps indicating either an inverse-agonist type activity or an effect of gene expression in the Rprotein, the luxCDABE cassette, or both. Compound 8 was not able to antagonize the production of blue pigment in the A. tumefaciens reporter in the presence of 3 -oxoC8 HSL (see Figure 4 8)

PAGE 174

174 Investigation of 8epi -Malyngamide C (7), Lyngbyoic Acid (8) and Related Com pounds in pSB1075 We compared the effect of 7 and 8 on pSB1075 to that of compounds of related structure, such as dodecanoic acid ( 11) and lyngbic acid ( 10, see Figure 4 2 and 47c). The most closely related dodecanoic acid ( 11) exerted a inhibitory effect of similar magnitude to 8, as did the previously identified quorum sensing inhibitor malyngolide ( 9).54 We previously observed that 8epi malyngamide C ( 7) weakly inhibited pSB1075 (vide supra).197 It can now be seen that compound 8 is more potent than 7. Interestingly, both 7 and its free side chain, lyngbic acid ( 10), have similar potency. Considering that the fatty acids 8 and 11 are inhibitors of pSB1075, it could be that the ring opened form of malyngolide is the active species. The methyl ester of dodecanoic acid ( 12 ) had only a small inhibitory effect, and butyric acid ( 13) was completely inactive, indicating a preference for free acids and longer alkyl chains, respectively. Investigation of Dependence on The LasR AHL Binding Site. To test whether the AHL binding site was required for inhibition, we us ed a reporter (pTIM5319) that lacks this domain, but in other respects is identical to pSB1075198 (Table 4 -3). Both compounds 8 and 11 reduced baseline luminescence in this reporter (Figure 4 -7d), indicating that neither the cognate AHL, nor the AHL binding domain of the AHL receptor is required. Additionally, we found that by varying the concentration of 3-oxo-C12HSL, that 8 is not competitive with this ligand in pSB1075 (see Figure 4 7e). However, in a reporter that lacks the transcriptional repressor rsaL (pTIM505 5211), which resides in the region be tween lasR and lasI in the PAO1 genome 3-oxo-C12HSL is clearly able to compete with 8. Taken together, these results suggest that the effects of 8 are exerted both through the AHL binding domain of LasR, and independently of it. The repressor rsaL is potentially implicated in the latter. To exclude a general effect on bacterial physiology or on the activity of the lux reporter cassette, we

PAGE 175

175 tested 8 on a reporter where the lux operon is under control of the constitutively active phage promoter (pTIM2442, Table 4-3 and Figure 4-9), and found no effect. Effects of 8 epi -Malyngamide C (7), Lyngbyoic Acid (8) and Related Compounds in WildType P. aeruginosa and PAO JP2. To assess whether 8 is able to inhibit a native quorum sensing system, we treated wil dtype P. aeruginosa cultures with 8 (1 mM) in a preliminary experiment measuring secreted pigments (assessed by UV absorption of culture supernatants at 360 nm), and LasB (assessed by degradation of elastin Congo red, see Figure 410a and 410b). It was observed that 8 was able to lower pigment production by the 6 h and 20 h timepoints, and that lower LasB levels were observed at 6 h only. Therefore the 6 h timepoint was used for subsequent experiments. To exclude an effect on the viability of PAO1, cul tures were grown in the presence and absence of 1 mM 8. No effect on growth, as assessed by OD600, was observed (Figure 411). Because fatty acids can inhibit proteases,199 we tested compound 8 for direct inhibition of purified LasB. Indeed, we found that 8 inhibited LasB with a Ki of 5.4 M (Figure 4 12). However, we did not detect 8 by LC MS in the filtered supernatants. T herefore, elastase activity in supernatants is a true reflection of expression and there is no direct inhibition of secreted enzyme by 8. Since 8 is quite lipophilic it may be sequestered within cells, membranes, or membrane vesicles, or else it is degraded by cellular enzymes. To assess potential differences between our reporter system and P. aeruginosa, we tested the complete set of compounds in PAO1 (see Figure 410c and 410d). Through extraction of pyocyanin from supernatants according to a published procedure,200 and measurement of LasB activity, it could be seen that compound 8 reduced both pyocyanin and LasB by the greatest extent. The most striking contrast with results in reporter assays came from the effects of dodecanoic acid ( 11) in PAO1. This compound greatly increased pyocyanin compared to

PAGE 176

176 contr ol, and LasB to a lesser extent (see Figure 4 10c). Intriguingly, this effect was not replicated in the lasIrhlI mutant PAO -JP2,201 indicating that it is dependent on either lasI or rhlI genes, or their downstream targets. Plausibly, dodecanoic acid could act as a substrate for oxidation pathways to produce the 3oxo acid, which if bound to an acyl carrier protein (ACP), is one of the substrates for lasI .202,203 This would suggest that the cyclopropane of 8 pr ecludes oxidation at the 3-position and does not allow it to be utilized by lasI We therefore describe 8 as tagged, as the cyclopropane may allow the compound to persist in both the producing cyanobacterium and target organisms, by avoiding metabolism through oxidation. Gene expression studies by RT qPCR revealed the effects on virulence factors due to compound treatments was largely duplicated in the transcript levels of lasB (PA3724) and phzG1 (PA4216), a member of the pyocyanin biosynthetic oper ons (see Figure 4 -10d).204 Glo bal Gene Expression Analysis of Lyngbyoic Acid (8)Treated P. aeruginosa. Some aspects of the reporter studies suggested that 8 may have effects on gene expression independent of AHL signaling. We investigated the effects of 8 on the transcriptome of PA O1 through microarray analysis, which revealed extensive gene expression changes (see Figure 49). Importantly, comparison of microarray data revealed a high overlap with two landmark transcriptome studies of LasR LasI and RhlR RhlI controlled genes (see Figure 4 -13).160,161 This included downregulation of pyocyanin synthesis, secreted enzymes ( lasA [PA1871], lasB [PA3724], chiC [PA2300] and aprA [PA1249]) and rhamnolipid production ( rhlA and B PA3479 and PA3480). Also, the pqsABCDE and phnAB operons (PA0996 PA1002), responsible for synthesis of QS quinolone signal molecules,158 was significantly decreased ( 3.4 to 11.9fold). These operons have previously been shown to be under the control of t he Las system,160,161 but treatment with 8 did not affect the expression level of lasR (PA1430), lasI

PAGE 177

177 (PA1432), rhlR (PA3477) or rhl (PA3476), although it did decrease levels of rsaL slightly (PA1431, 1.6 fold). Interestingly, expression of hydrogen cyanide production genes ( hcnA C PA2193 5) were unaffected, even though they were previously identified as QS -controlled,160,161 and they were downregulated by a previously iden tified QS inhibitor.205 In addition to effects on quorum sensing, lyngbyoic acid ( 8) reduced the expression of 44 genes previously identified as induced by ironstarvation (see Table 4 6).206 For example the expression of genes for the biosynthesis of pyoverdin207 ( pvdA D F I and J PA2386 2402, see Figure 4 14), a fluorescent siderophore, were reduced ( 1.6 to 4.5fold) along with the outer membrane pyoverdin receptor fvpA (PA2398, 2.2fold) and t he regulatory factor pvdS (PA2426, 4.7fold). Genes for the biosynthesis of pyochelin ( pchABCDG PA4228 4231, 2.6 to 3.5fold), another siderophore, were also reduced. Effects on both ironregulated and QS regulated genes potentially implicate an in volvement of the regulator vqsR .208,209 A vqsR mutant was shown to have decreased expression of genes related to quorum sensing, as well as pyoverdine and pyochelin. Importantly, the vqsR mutant exhibited reduced levels of rsaL and rhlR transcripts, as in P. aeruginosa treated with 8. Transcript levels of some other regulators that have previously been implicated in quorum sensing were also affected in a complex manner. rpoS (PA3622),210 rsmA (PA0905)211 and qscR (PA1898)212 were all decreased ( 4.3, 2.4 and 2.0fold, respectively), whereas rpoN (PA4462),213 mvfR (PA1003)214 and pmpR (PA0964)215 were all increased (+2.2, +1.8 and +2.8fold, respectively). The downstream QS effects of 8 could perhaps in part depend on alteration of the balance in positive and negative regulators, as well as posttranscriptional/posttranslational effects. It is possible that 8 similarly modulates transcriptional regulators in E. coli potentially accounting for the inhibitory effects seen in reporter systems that were independent of the lasR

PAGE 178

178 AHL -binding site (see Figures 4d and 4e). The effects in both systems could be due to regulators conserved between the two species, such as the GasS/A system, which is found in many Gram negative bacteria.216 Perhaps unsurprisingly, genes under the control of two fatty acid sensors, DesT (PA4890)217 and PsrA (PA3006)218 were affected, and also the level of psrA transcript was increased (+2.0 fold). Consistent with activation of the repressor DesT, the transcript levels of desaturases desB (PA4888) and desC (PA4889) were reduced ( 3.2 and 2.9 fold, respectively). The fatty acid metabolism genes under control of the activator PsrA were upregulated, except for lipA (see Figure 4 -9), which could be a result of a direct action on PsrA or of its increased expression. Lyngbyoic acid ( 8) appeared to have complex effects on oxidative and/or stress response regulators. Transcripts of relA (PA0934), spoT (PA5338), sspA (PA4428) and sspB (PA4427) were all upregulated (+1.7 to +2.4fold). However, RelA is thought to activate quorum sensing through enhanced expression of RpoS.219 In fact, we found a decrease in rpoS (PA3622, 4.3fold), perhaps suggesting an effect of 8 on RelA at the protein level or downstream of it. Also downregulated are the universal stress proteins uspK (PA3309, 3.9-fold), uspN (PA4352, 3.4fold), uspL (PA1789, 4-fold), uspM (PA4328, 1.8fold) and uspO (PA5027, 5fold). PA3309 was shown to be under control of the oxygen sensing regulator Anr220 (PA1544, no change in expression), while the other usp genes are dependent on SpoT.221 Three genes encoding arginine fermentation genes, ArcA C (PA5171 PA5173), were also downregulated ( 1.7 to 2.4fold). These genes were previously shown to be upregulated during anaerobic growth.220 Another oxidative stress regulator, soxR (PA2273), was downregulated ( 1.8fold), as was the majority of its known regulon,222 the mexGHID efflux pump (PA4205 8, 8.1 to 46.8fold) and the hypothetical protein PA2274 ( 24.9fold). This regulon has previously been

PAGE 179

179 identified as QS -controlled,160,161 and thus downregulation could be as a result of general QS inhibition as well as reduction of soxR Additionally, it has been shown that pyocyanin itself is able to activate SoxR,223 and thus some of the effect could be accounted for by reduced amounts of this metabolite. Overall, it would seem that 8 negatively regulates stress responses in PAO 1. The effect of 8 on biofilm genes was also complex. While some members of the psl operon ( pslAC [PA2231 2233] and pslN [PA2244]) were downregulated ( 1.7 to 3.4fold), the entire pelABCDEFG operon (PA3058 64) was upregulated (+2.0 to +7.2fold). The pel operon is required for the synthesis of a glucose rich matrix exopolysaccharide that is an important component of biofilms, and its expression has been shown to be dependent on lasI .224 Therefore, it would seem that in lyngbyoic acid ( 8) treated cells, expression of pel is uncoupled from general QS effects, which are inhibited. Recently, it has been shown that pel genes are repressed by the tyrosine phosphatase TpbA (PA3885).225 Lyngbyoic acid ( 8) paradoxically increased the expression of tpbA by 3.3 fold, perhaps suggesting a posttranscriptional or direct effect on the protein. Compound 8 also increased the expression of a type VI secretion virulence locus, HSI -I226 (PA0071 91, +1.7 to +5.7fold). This locus expresses a secreted protein, Hcp1, along with its secretion apparatus. Hcp1 has been detected in CF patients that harbor chronic P. aeruginosa infections, and the expression of HSI I is antagonistically regulated by RetS (repression) and LadS (activation). These two regulators also control exopolysaccharide production, and are implicated in the control of virulence factor expression in acute (RetS) and chronic (La dS) infections.226 Compound 8 al so reduced the expression of several genes involved in twitching and motility (see Figure 4 14). These included the flagella proteins flgC (PA1078, 2.0-fold) and flgE G (PA1080 82, 1.7 to 1.8fold). The majority of genes involved in the expression

PAGE 180

180 of type IVb pili227 were also strongly downregulated (PA4293 4306, 2.5 to 56fold). There were mixed effects on genes involved in expression of type IVa pili, with some upregulated and some downregulated (see Figure 414). However, it is possible that downregulation of pilV (PA4551, 2.8-fold) pilE (PA4556, 3.2-fold) and fimU (PA4550, 3.3fold) could lead to accumulation of PilA within the membrane fraction and reduced extracellular assembled fimbriae, similar to the mutants of these genes.228 Previously it has been shown that certain branched chain fatty acids can inhibit swarming,229 however these were also found to not have an effect on rhamnolipid production, and so likely do not share the quorum sensing inhibitory activity of 8. Conclusion After initial infection of cystic fibrosis patients, P. aeruginosa adapts to the CF lung environment, acquiring a phenotype characterized by reduced virulence factor production, overproduction of exopolysaccharide (mucoid phenotype), and reduced motility.230 This is accompanied very often by a loss of lasR .230 Compound 8 mimics many of these effects, including a general in hibition of quorum sensing and expression of the virulence determinant HSI I in wild type P. aeruginosa. It may therefore prove a valuable tool compound for modeling the process of adaption in CF, perhaps by replicating the response of P. aeruginosa to certain fatty acids present in CF sputum. We found 8 in multiple samples of Lyngbya cf. majuscula in Florida, sometimes produced along with lyngbic acid ( 10) and malyngolide ( 9), and QS modulation and downregulation of virulence factors such as elastase may be an ecological function of these compounds. Elastase inhibition in various biological contexts appears to be a common activity of cyanobacterial metabolites. While some previously identified lyngbyastatins inhibit mammalian elastase directly,4648,231 8 inhibits the elastase of P. aeruginosa both directly

PAGE 181

181 and through transcriptional regulation. The cyclopropane tag has functional significance as it prevents 8 from acting as a quorum sensing promoter like dodec anoic acid ( 11). Experimental General Experimental Procedures Optical rotation was measured on a Perkin-Elmer 341 polarimeter. UV was measured on a SpectraMax M5 (Molecular Devices), and IR data were obtained on a Bruker Vector 22 instrument. 1H and 13C NMR spectra in CDCl3 for 7, as well as 1H NMR spectra for 8S-( p nitrobenzoyl)malyngamide C, 9 and 10 were recorded on a Varian Mercury 400 MHz spectrometer. 13C NMR spectra for 9 and 10, as well as 2D NMR spectra for 7 were recorded on a Bruker 600 MHz A vance II spectrometer using a 1 mm tripleresonance high temperature superconducting cryogenic probe.130 1H, 13C and 2D NMR spectra for 8 were recorded in CDCl3 on a Bruker Avance 500 MHz spectrometer. Spectra were referenced to residual solvent signals [ H/C 7.26/77.0 (CDCl3)]. HSQC experiments were opti mized for 145 Hz and HMBC experiments were optimized for 7 Hz couplings, except for with the HMBC of 8, in which the exper iment was optimized to 8 Hz couplings. HRESI/APCIMS data were recorded on an Agilent LC TOF mass spectrometer equipped with an APCI/E SI multimode ion source detector in positive ion mode. MTT assays and purified LasB enzymatic assays were detected on a SpectraMax M5, and luminescence readings for quorum sensing assays were measured using a Perkin Elmer Victor3 LC MS data were obtaine d using a 3200 Q Trap LC/MS/MS system (Applied Biosystems). Realtime quantitative PCR experimen ts were carried out on an Applied Biosystems 7300 instrument. Biological Material Samples of L. majuscula were collected at a depth of 1 m on the West side of Bush Key, Florida (2437.582 N 82 52.099 W) on April 23rd 2007. Sheath width 41.2 0.61 m (mean

PAGE 182

182 SE), cell width 34.3 0.75 m, cell length 1.9 0.28 m. These dimensions fit the description of L. majuscula with short cells 2 4 m in length.232 Voucher specimens (DRTO0000019) are maintained at the Smithsonian Marine Station at Fort Pierce, Florida, and at South Florida Collections Management Center, Everglades National Park. Samples of Lyngbya sp. were collected in the Indian River Lagoon, near Fort Pierce (27.668 N, 80.095 W) on the 23rd June 2006. This was a recollection of the sample designated IRL1. A voucher sample is maintained at the Smithsonian Marine Station, Fort Pierce, FL. Samples of Lyngbya cf. majuscula were collected at Garden Key, within the Dry Tortugas National Park, FL on April 22, 2007. A voucher sample is maintained at the Smithsonian Marine Station, Fort Pierce, FL (DRTO0000003). Extraction and Isolation of 8epi -Malyngamide C (7) and Lyngbic Acid After freeze drying, L. majuscula from Bush Key, FL was extracted with EtOAc MeOH (1:1) to give 1.391 g nonpolar material. This was partitioned between hexanes and MeOH H2O (80:20). The MeOH H2O soluble portion (1.126 g) was further partitioned between nBuOH and H2O. The n-BuOH fraction (351.8 mg) was subjected to silica gel chromatography using a gradient system of increasing i PrOH in CH2Cl2. The fraction eluting with 6% i -PrOH (55.0 mg) was further purified by reversed phase HPLC [Synergi Hydro-RP (Phenomenex), 250 10 mm, 2.0 mL/min; UV detecti on at 220 and 240 nm] using a Me CN 0.1% HCOOH linear gradient (40 100% MeCN over 20 min, then 100% MeCN for 30 min), to furnish compound 7 (17.7 mg) at tR 22.3 min and lyngbic acid (8.0 mg) at tR 23.7 min. Extraction and Isolation of Lyngbyoic ac id (8) The freezedried material ( Lyngbya sp. from IRL) was extracted with EtOAc MeOH (1:1) to furnish a crude nonpolar extract, which was subsequently partitioned between H2O MeOH

PAGE 183

183 (80:20) and hexanes. The H2O MeOH fraction was further partitioned between nBuOH and H2O. The nBuOH extract (1.69 g) was subjected to silica gel chromatography, eluting fractions with increasing proportions of i PrOH in CH2Cl2. The fraction eluting with 6% i PrOH in CH2Cl2 was further purified by semi preparative reversed -phase HPLC (Phenomenex Ultracarb 5u ODS column, 250 10.00 mm, 2.0 mL/min; UV detection at 220 and 240 nm) using a MeOH H2O linear gradient (60 100% MeOH over 50 minutes and then 100% MeOH for 20 min) to furnish compound 8, tR 49.0 min (42.4 mg). The yield was 1.32% of lipophilic material (the n-BuOH and hexanes fractions, excluding the H2O fraction). The freezedried Garden Key material was extracted with EtOAc MeOH (1:1) and then subjected to solventsolvent partitioning as with the IRL material. The n-BuOH extract (669 mg) was subjected to silica gel chromatography, eluting fractions with increasing proportions of i PrOH in CH2Cl2. The fraction eluting with 10% i PrOH in CH2Cl2 showed evidence by 1H NMR of the presence of 8, 9 and 10, and so was furthe r purified by semi preparative reversed phase HPLC (Phenomenex Synergi Hydro column, 250 10.00 mm, 2.0 mL/min; UV detection at 220 and 240 nm) using an ACN 0.1% HCOOH linear gradient (40 100% ACN over 20 min then 100% ACN for 30 min) to furnish compound 10, tR 24.2 min (4.4 mg), 9, tR 25.5 min (0.3 mg) and 8, tR 26.5 (1.3 mg). Adjacent silica fractions also show the distinctive upfield cyclopropane ( H 0.45 and 0.21) signals of 8 and the oxygenated methylene doublets ( H 3.71 and 3.47) of malyngolide ( 9), and so the total yield of these compounds is expected to be greater. 8epi -Malyngamide C (7). Light brown oil; [ ]20 D 8.0 ( c 0.36, MeOH); UV (MeOH) max (log ) 213 (3.30), 231 (2.82), 270 (2.31); IR (film) max 3360 (br), 3070 (w), 2927, 2854, 2361 (w), 1716, 1654, 1542, 1520, 1495, 1457, 1267, 1090, 1071, 971, 914 cm-1; 1H NMR, 13C NMR, COSY, edited HSQC, HMBC, NOESY, see Table 4-1; HRESI/APCIMS m / z [M + H]+

PAGE 184

184 456.2518 and 458.2492 (ratio 3:1, calcd for C24H39 35ClNO5, 456.2517 and C24H39 37ClNO5, 458.2487). Lyngbic acid (10). Pale yellow oil; [ ]20 D 12.6 ( c 0.8, MeOH) [lit. 13.3,177 12.8187 and 13188]; UV (MeOH) max (log ) 203 (3.08), 230 (sh, 2.54), 261 (2.10); IR (film) max 2925, 2854, 2360, 2342, 1708, 1541 (w), 1456, 1361, 1270, 1193, 1096, 970, 722 (w), 669 (w) cm-1; 1H NMR (400 MHz, CDCl3) 5.54 5.43 (m, 2H), 3.32 (s, 3H), 3.15 (quin, J = 5.8 Hz, 1H), 2.45 2.38 (m, 2H), 2.37 2.30 (m, 2H), 2.21 2.16 (m, 2H), 1.48 1.38 (m, 2H), 1.33 1.19 (m, 11H), 0.88 (t, J = 6.9 Hz, 3H); 13C NMR (100 MHz, CDCl3) 178.7, 130.1, 127.8, 80.7, 56.5, 36.3, 33.9, 33.3, 31.8, 29.7, 29.3, 27.7, 25.3, 22.7, 14.1; HRESI/APCIMS m / z [M + H]+ 257.2121 (calcd for C15H29O3 257.2117). 8S -( p-Nitrobenzoyl)malyngamide C. A mixture of 5 mg 1, 7.7 mg p-NBA (4.2 eq) and 11.4 mg PPh3 (4.0 eq) was dissolved in dry THF. While the solution was stirred on an ice bath, 7.75 mg diethyl azodicarboxylate (DEAD) was added slowly (4.0 eq, as a 40% w/v solution in toluene). After addition of DEAD, the mixture was stirred at room temperature for 14 h, then heated to 40 C for 3 h. The reaction mixture was concentrated in vacuo, and the residue was applied to a 1 g prepacked C18 cartridge (All tech) and eluted with MeOH, then further purified by HPLC [Alltima HP C18, 250 4.6 mm (Alltech), 1.0 mL/min; PDA detection] using a MeOH H2O linear gradient (40 100% MeOH over 20 min, then 100% MeOH for 10 min) to give pure 2 (4.9 mg, 74% yield) at tR 22.8 min. Colorless amorphous solid; [ ]20 D 12.5 ( c 0.25, MeOH); UV (MeOH) max (log ) 204 (3.94), 257 (3.74); IR (film) max 3308 (br), 3079 (w), 2926, 2855, 1724, 1653, 1607, 1530, 1456, 1348, 1320, 1269, 1172, 1101, 1032 (w), 1015 (w), 971 (w), 929 (w), 872, 858, 784 (w), 755 (w), 721 cm-1; 1H NMR (400 MHz, CDCl3) 8.33 (d, J = 8.9 Hz, 2H), 8.27 (d, J = 8.8 Hz, 2H), 6.42 (d, J = 0.5 Hz, 1H), 6.05 (t, J = 5.1 Hz, 1H), 5.72

PAGE 185

185 (dd, J = 10.1, 5.8 Hz, 1H), 5.54 5.42 (m, 2H), 4.03 (ddd, J = 14.8, 6.0, 0.8 Hz, 1H), 3.88 (dd, J = 14.8, 4.7 Hz, 1H), 3.80 (br, 1H), 3.31 (s, 3H), 3.15 (quin, J = 5.7 Hz, 1H), 2.70 (dt, J = 17.9, 4.0 Hz, 1H), 2.43 (ddd, J = 18.4, 12.0, 6.4 Hz, 1H), 2.38 2.30 (m, 2H), 2.30 2.10 (m, 6H), 1.48 1.37 (m, 2H), 1.37 1.17 (m, 10H), 0.87 (t, J = 6.8 Hz, 3H); HRESI/APCIMS m / z [M + H]+ 605.2625 and 607.2609 (ratio 3:1, calcd for C31H42 35ClN2O8, 605.2630 and C31H42 37ClN2O8 607.2601). Malyngamide C. K2CO3 (15.9 mg) was suspended in 755 L MeOH and stirred. To this was added 2.45 mg 2 in 500 L Me OH. The mixture was stirred at room temperature for 1 h, dried under air, and partitioned between EtOAc and H2O. The EtOAc fraction was washed with water, concentrated to dryness and subjected to purification by HPLC [Alltima HP C18, 250 4.6 mm (Alltec h), 1.0 mL/min; PDA detection] using a MeOH H2O linear gradient (40 100% MeOH over 20 min, then 100% MeOH for 10 min) to give pure malyngamide C (1.4 mg, 76% yield) at tR 20.9 min. Colorless oil; [ ]20 D 29.3 ( c 0.14, MeOH) [lit. 27.4163]; UV (MeOH) max (log ) 202 (3.90), 232 (sh, 3.00), 264 (2.98) ; IR (film) max 3308 (br), 3054 (w), 2923, 2851, 2360 (w), 1717, 1654, 1526, 1456, 1372, 1264, 1085, 1028 (w), 969, 925 (w), 893 (w), 854 (w), 792 (w), 737, 703 cm-1; 1H NMR (400 MHz, CDCl3) 6.40 (s, 1H), 6.08 (br t, J = 4.5 Hz, 1H), 5.54 5.40 (m, 2H), 4.41 (dd, J = 9.5, 5.4 Hz, 1H), 4.06 (ddd, J = 14.6, 6.3, 0.6 Hz, 1H), 3.82 (dd, J = 14.6, 4.6 Hz, 1H), 3.62 (s, 1H), 3.33 (s, 3H), 3.16 (quin, J = 5.8 Hz, 1H), 2.59 (dt, J = 17.7, 4.1 Hz, 1H), 2.46 2.11 (m, 7H), 2.07 1.88 (m, 3H), 1.50 1.39 (m, 2H), 1.37 1.16 (m, 11H), 0.88 (t, J = 6.8 Hz, 3H); 13C NMR (150 MHz, CDCl3) 202.0, 172.6, 133.4, 130.6, 127.6, 122.3, 80.8, 66.2, 65.4, 61.8, 56.4, 40.5, 36.34, 36.28, 35.4, 33.3, 31.8, 29.7, 29.2, 28.4, 25.2, 24.8, 22.6, 14.0; HRESI/APCIMS m / z [M + H]+ 456.2520 and 458.2496 (ratio 3:1, calcd for C24H39 35ClNO5, 456.2517 and C24H39 37ClNO5, 458.2487).

PAGE 186

186 Lyngbyoic Aci d (8): Colorless oil; [ ]20 D 15.5 (c 0.1, CHCl3); UV (EtOH) max (log ) 202 (2.41), 230 (1.95), 260 (1.56); IR (film) max 3400-2400 (br), 3061, 2923, 2854, 1710, 1541, 1456, 1414, 1283, 1213, 1120, 1079, 1021, 936, 772, and 722 cm-1; 1H NMR, 13C NMR, APT, COSY, HSQC and HMBC data, see Table 4-2; HRESI/APCIMS m / z [M H] 211.1702 (calcd. for C13H23O2, 211.1698). Cell Viability Assay HT29 cells were cultur ed in Dulbeccos modified Eagle medium (DMEM; Invitrogen) containing 10% fetal bovine serum (Hyclone), in a humidified atmosphere containing 5% CO2 at 37 C. Cells were seeded into 96 -well plates at a density of 10,000 cells/well (100 L medium/well). Af ter 24 h, compound 7 and malyngamide C were added to wells at varying concentrations (as 1 L stock solutions in EtOH). Etoposide was used as a positive control for cytotoxicity, and EtOH alone was used as a negative control. After another 48 h, the plat e was developed with MTT dye according to the manufacturers protocol (G4000, Promega). Bacterial Strains and Culture Conditions Bacterial strains and plasmids used in this study are listed in Table 4 -2. Reporter strains were grown overnight in LuriaBert ani (LB) medium at 37 C with agitation as previously described .233,234 Briefly, overnight cultures were grown in the presence of the appropriate antibiotic (Table 4 -3). The following day, cultures were diluted 100 fold wi th fresh LB and antibiotic, incubated for 1 h, then diluted 100 fold again and incubated for a further 2 h. Cultures were diluted 10 fold with fresh LB and the appropriate antibiotic before being used in assays. Pseudomonas aeruginosa strain PAO1 was also grown using the same protocol, without added antibiotic.

PAGE 187

187 Quorum Sensing Reporter Assays Test compounds and/or cognate AHL where appropriate were added to black 96well plates, and the solvent was allowed to evaporate at room temperature. Cultures (100 L) of the appropriate reporter were added to each well, and the plates were incubated at 37 C in a humid environment for 6.5 h before their luminescence was recorded. For each assay, untreated wells (+/ AHL where appropriate) were used as control s. C4-HSL and 3-oxo-C6HSL are from Sigma Aldrich, 3-oxo-C12HSL is from Cayman Biochemicals. The final concentrations used were 10 M (C4-HSL), 10 M (3 -oxo-C6-HSL) and 1 nM (3-oxo-C12HSL), except for the 3 -oxo-C12HSL competition experiment (see Figure 4-7e). These concentrations corresponded to the experimentally determined IC50 of the AHLs against the relevant reporter strains under the same conditions as the assays. The A. tumefaciens lacZ based reporter was grown overnight in LB in the presence of gentamicin at 30 C with shaking. The culture was diluted 100fold then grown for a further 24 hours in 1% M9 salts/ 2% w/v sucrose/1 mM MgSO4, then diluted 100fold again with fresh M9 sucrose and grown a further 4 h. At the end of this time cultures we re mixed with 1:1 with M9 sucrose containing 1.12% agar and immediately 100 L of this mixture was added to each well of a 96 well plate containing compound 1 with and without 3-oxo-C8HSL. The final concentration of 3-oxo-C8HSL used was 1 nM, a concentration found to produce ~half maximal blue coloration by visual inspection. Plates were incubated in a humidified atmosphere at 30 C and then visually inspected for blue coloration. In vitro Inhibition of LasB The in vitro inhibition of LasB (E.C. 3.4.24.26, PE961, Elastin Products Company, Inc.) was assessed using BODIPY -FL casein (E6638, Invitrogen). Stock solutions (2 L) of

PAGE 188

188 lyngbyoic acid ( 8) were added to a mixture of 1 L LasB (10 g/ml), 20 L H2O and 77 L assay buffer (10 mM Tris -HCl, pH 7.8), and incubated at 37 C for 30 min. 100 L BODIPY FL was then added (10 g/mL), and the reaction was followed by fluorescence ( ex/ em 505/589 nm). EDTA (10 mM in H2O), a zinc chelating compound known to inhibit LasB, was used as a positive control. Simila r results were seen using ECR as the substrate. The Ki of lyngbyoic acid ( 8) was determined according to the protocol recommended by Copeland.235,236 First, the KM of the substrate BODIPYFL casein was determined by measuring the slope of reactions in the presence of different substrate concentrations. Reaction mixtures consisted of 189 L 10 mM Tris-HCl, pH 7.8, 1 L of 10 g/mL LasB, and 10 L substrate solution. Initial slope was plotted against substrate concentration and the substrate concentration that gave half maximal rate (the KM) was calculated by non -linear curve fitting in Graphpad to be 20 g/mL. The IC50 of lyngbyoic acid ( 8) at this substrate concentration was then determined under the same conditions to be 4.3 M. The Ki was then determined by running reactions in the presence of different substrate concentrations (10 5 2.5 1.25 0.625 0.3125 and 0.1563 KM) and different inhibitor concentrations (0, 1 M, 3.16 M and 10 M). Best fit wa s obtained by assuming a noncompetitive inhibition model in Graphpad, and the Ki was calculated to be 5.4 M. Pigment and Elastase Pro d uction in Pseudomonas aeruginosa Cultures (1 mL) of strain PAO1 were grown in 15 mm diameter glass tubes with shaking at 37 C for 6 h in the presence of 1 mM test compounds, added directly to the cultures as 10 L of 100 mM stocks. Negative controls consisted of PAO1 cultures with 10 L EtOH added, which positive controls were PAO-JP2 cultures with 10 L EtOH added. To obtain an estimate of the pigment production, cultures were spun down and the absorbance of the supernatant at 360 nm

PAGE 189

189 was measured, corresponding to one of the UV maxima reported for pyocyanin.237 The supernatants were then passed through a 0.2 m filter. Following the procedure of Mh et al.200 100 L of each supernatant was added to 900 L of a 5 mg/mL suspension of elastin Congo red (Elastin Products Company, Inc.). The mixtures were incubated in 15 mm glass tubes at 37 C with shaking for 18 h, at which point the reaction was stopped by addition of 100 L 0.12 M EDTA. Soluble reaction product was quantified by UV absorption of the supernatants at 495 nm after centrifugation. Pyocyanin was quantified according to the procedure of Mh et al.,200 with some differences. A portion (500 L) of the culture supernatants was extracted with 500 L CHCl3 in an Eppendorf tube. The CHCl3, which took on a visible blue color in cultures with high levels of pyocyanin, was transferred to a new tube and back-extracted with 150 L of 0.2 N HCl. Und er acidic conditions the UV spectrum of pyocyanin changes and takes on a visible red color in high-pyocyanin samples. A portion (100 L) of the aqueous layer was transferred to a 384-well plate, and the absorbance at 385 nm was measured. The UV maximum at 385 nm has a higher than the maximum at 520 nm237 used elsewhere,200 and thus is more suitable for smallscale cultures. LC MS of PAO1 Culture Supernatants. A portion (1 L) of the background absorbance controls from the ela stase activity assay were subjected to an LC separation step followed by MS detection (Phenomenex Luna 5u C8 column, 4.6 50 mm, 0.5 mL/min; detection by ESIMS, MRM scan in negative mode) using an isocratic solvent system (90:10 MeOH H2O, both with 0.1% HCOOH). Samples were compared to a standard solution of 1 at the expected concentration, and spiked control cultures. Authentic lyngbyoic acid ( 1 ) eluted at tR 6.3 min. The MS parameters were as follows: MRM ion pair 211 193, DP 66, EP 6.3, CEP 12, CE 25, CXP 3.4, CUR 30, CAD Medium, IS 4500, TEM 500, GS1 50, GS2 60.

PAGE 190

190 Transcriptome Analysis Cultures (1 mL) of PAO1 were grown either in the presence or absence of 1 mM 8 (added as 10 L of a 100 mM stock solution in EtOH), for 6 h at 37 C with shaking in 15 mm diameter glass tubes. Parallel cultures of each condition were grown alongside, and after ~5.5 h these were spun down and the UV absorbance of their supernatants was measured to confirm differential pyocyanin expression. RNA was stabilized in vivo by use of RNAprotect bacteria reagent (76506, Qiagen) according to the manufacturers instructions (Protocol 4 in the RNAprotect handbook). Briefly, 2 mL RNAprotect was added to each culture (treated with 8 and EtOH alone), then the tubes were vortexed for 5 s and allowed to stand at room temperature for 5 min. After this time the cultures were centrifuged for 10 min at 5000 g (each culture was split into two 1.5 mL aliquo ts to be centrifuged in 1.5 mL Eppendorf tubes), and the supernatant was decanted gently and discarded. The cells were stored at 70 C for later use. A solution of 15 mg/mL lysozyme (Sigma) in TE buffer was prepared immediately before use. To 425 L of this was added 75 L proteinase K solution (Roche). A portion of this mixture (100 L) was added to each Eppendorf containing bacteria cells which were resuspended by pipetting up and down repeatedly The tubes were vortexed for 10 s and then incubated at 25 C for 10 min with constant shaking. The RNeasy mini kit ( Qiagen) was used for subsequent RNA purification. Immediately before use, a stock of buffer RLT was made containing 10 L mercaptoethanol/mL A portion of this mixture (350 L) was added to each tube before vortexing. To each tube, EtOH ( 250 L ) was added and the conte nts mixed by gentle pipetting. The contents of one tube of each culture condition was added to different RNeasy spin columns, which were then centrifuged at 10,000g for 1 min. After discarding the flow -through, the contents of the remaining tube of each culture condition was added to the respective spin

PAGE 191

191 column, which was then centrifuged at 10,000g for 1 min. The optional on-column DNa se step was carried out followed by the rest of the manufacturers protocol to afford two separate 40 L elutions of RNA from each spin column. RNA samples were quantified by UV absorbance (Nanodrop 8000, Thermo), and DNA contamination was quantified by RT-qPCR of the samples using a primer/probe se t for rpsL (PA4268, see Table 4-5). To reduce DNA contamination, Turbo DNAfree (1907, Ambion) was used according to the manufacturers stringent treatmen t protocol. To 38.8 L RNA (containing 38.1 and 53.3 g RNA for 8 treated and EtOH treated, respectively), was added 7.76 L 10 DNa se buffer, 28.04 L H2O and 1 L Turbo DNase The reaction mixture was incubated at 37 C for 30 min before a further 1 L DNa se was added. After a further 30 min incubation, another 1 L DNa se was added and the mixture incubated another 30 min. After this time, 15.5 L inactivation reagent was added ( 0.2 volume) and the mixtures were incubated for 5 min at rt, mixing occasionally. After this time, the tubes were spun down at 10,000g for 1.5 min, and the supernatant was transferred to new tubes. It is worth noting that this procedure is able to reduce DNA contamination to Ct ~35, but it necessitates diluting the RNA, and the apparent amount of RNA as measured by UV is generally reduced by half. In order to carry out sample preparation for use with the Pseudomonas aeruginosa GeneC hip (900339, Aff ymetrix) exactly as specified by the manufacturer,238 RNA samples were concentrated by SpeedVac so that 10 g RNA could be added to the reverse-transcription reaction in a volume of < 12 L. Prior to carrying out the reverse-transcription reaction, RNA samples were analyzed by BioAnalyzer ( Agil ent) and found to have high RIN numbers (9.8 and 9.3 for 8 treated and EtOH treated, respectively). The reverse-transcription reaction and subsequent degradation of RNA with NaOH were carried out exactly as specified by

PAGE 192

192 Affymetrix.238 Resulting DNA was purified using the MinElute kit (Qiagen), according to the manufacturers protocol and using the supplied pH indicator. Fragm entation of DNA samples wit h DNa se I (89835, Pierce) was carried out only after trial titration reactions were performed in order to determine the correct dose of enzyme. For these trials, control genomic DNA was prepared from overnight cultures of PAO1 using a commercial kit (NA21 20, Sigma), according to the manufacturers instructions and using H2O for the final elution. The resulting DNA was then concentrated by SpeedVac and quantified by Nanodrop. Fragmentation reactions were carried out according to Affymetrixs protocol238 and each contained 4 g DNA. Nominal doses of 0, 0.001 U/ g, 0.005 U/ g, 0.01 U/ g, 0.05 U/ g, 0.1 U/ g and 0.15 U/ g were tested, and the results were assessed by DNA gel (see Figure 4 15). Briefly, 1.6 g DNA was loaded o nto each well of a TBE gel (EC62252, Invitrogen), which was then run at 200 V, 15 mA for 40 min in 1 TBE running buffer. To develop the gel, 2.5 L of SYBR Gold (S11494, Invitrogen) was added to 25 mL 1 TBE running buffer immediately before the gel was added and incuba ted in the dark for 10 min. DNa se I reactions were then carried out on the samples to be used in microarray experiments, followed by terminal labeling, as specified by Affymetrix.238 Analysis by gel electr ophoresis confirmed both reactions had been successful Equal amounts of DNA were used to hybridize each sample to GeneChips in duplicate. The microarray data was validated by realtime PCR using probes for lasB phzG1, retS fadA5 and lasR (vide infra). Comparison of realtime PCR and microarray data is shown in Table 4 -4. Realtime -Quantitative Polymerase Chain Reaction (RTqPCR) RNA for use in realtime PCR experiments was extracted and treated with DNase as for the GeneChip samples. Samples were reversetranscribed using Superscript II reverse transcriptase

PAGE 193

193 (18064014, Invitrogen) and random primers (48190011, Invitrogen). TaqMan primers/probes were custom designed by Applied Biosystems, using FAM as the fluorescent reporter and NFQ as the quencher. The sequences of primers and probes used is shown in Table 45, and in all experiments the housekeeping gene rpoD (PA0576) was used as the endogenous control, since this gene has been found to have very stable expression, suitable for its use as a control in R TqPCR experiments.239 Additionally, this gene was found to not be affected by lyngbyoic acid ( 8) in the microarray experiment. Real time PCR was performed by using 12.5 L of TaqMan 2 gene expression master mix (Applied Biosystems), 1.25 L of 20 TaqMan gene expression assay mix (see Table 4 4), 0.5 L of cDNA and 10.75 L of sterile water, in a total volume of 25 L per well reaction in a 96 well plate (Applied Biosystems). The thermocycler program consisted of 2 min at 50 C, 10 min at 95 C, and 40 cycl es of 95 C for 15 s and 60 C for 1 min. Each assay was carried out in triplicate.

PAGE 194

194 Table 4 -1. NMR spectral d ata for 8 epi -m alyngamide C ( 7) in CDCl3 at 400 MHz (1H) or 600 MHz (2D NMR, 1H) and 100 MHz (13C) C/H no. H ( J in Hz) C mult a 1 H 1 H COSY HMBC b NOESY 1a 3.96, ddd ( 14.7, 5.7, 0.6) 41.4, t H 1b, H 3, NH 2, 3, 4, 1 H 3, NH 1b 3.84, ddd ( 14.7, 5.5, 0.7) H 1a, H 3, NH 2, 3, 4, 1 H 3, NH 2 132.9, s 3 6.39, dd (0.6, 0.7) 123.3, d H 1a, H 1b 1, 2, 4 H 1a, H 1b, H 3 15 4 60.9, s 5 202.8, s 6a 2.52, ddd ( 17.3, 10.6, 6.1) 31.9, t H 6b, H 7a, H 7b 5, 7, 8 H 6b, H 7a, H 7b 6b 2.45, ddd ( 17.3, 5.3, 5.0) H 6a, H 7a, H 7b 4, 5, 7, 8 H 6a, H 7a, H 7b 7a 2.10, dddd ( 14.5, 6.1, 5.3, 3.8) 26.0, t H 6a, H 6b, H 7b, H 8 5, 6, 9 H 6 a, H 6b, H 7b, H 8 7b 1.98, dddd ( 14.5, 10.6, 5.0, 0.7) H 6a, H 6b, H 7a, H 8 5, 6, 9 H 6a, H 6b, H 7a, H 8 8 4.47, ddd (3.8, 2.5, 0.7) c 64.2, d H 7a, H 7b, H 9 4 H 7a, H 7b, H 9 9 3.58, d (2.5) 64.3, d H 8 2, 4, 7, 8 H 8 NH 6.16, dd (5.7, 5.5) H 1 a, H 1b 1, 1 H1a, H 1b,H 3 15 1 173.0, s 2 2.22, m (2H) 36.20, t H 3a H 3b 1 3 4 3a 2.29, m 28.3, t H 2 2 H 3b H 4 1 2 4 5 3b 2.20, m H 2 -2 H 3a 1 4 5 4 5.42, ddd 130.6, d H 3a H 5 3 5 6 5 5.50, ddd 127.7, d H 4 H 2 6 3 4 6 7 H 7 H 3 15 6 2.16, m (2H) 36.24, t H 5 H 7 4 5 7 8 7 3.15, quin 80.7, d H 2 -6 H 8a H 8b 5, 6, 8, 9 H-5 H 3 15 8a 1.40, m 33.3, t H 7 H 8b H 9a H 9b 7 9 10 8b 1.36, m H 7 H 8 a H 9a H 9b 6 7 9

PAGE 195

195 Table 4 -1. Continued 9a 1.31, m 25.3, t H 8a H 8b H 9b 11 9b 1.24, m H8a H 8b H 9a 10 1.24, m 29.7, t 11 1.24, m 29.3, t 12 1.23, m 31.8, t H 3 14 13a 1.26, m 22.6, t H 3 14 10 12 14 H 3 14 13b 1.24, m H 3 14 H 3 14 14 0.87, t 14.1, q H 13a H 13b 12 13 H 2 12 H 13a H 13b 15 3.30, s 56.4, q 7 H 3, H 5 H 7 NH aMultiplicity derived from edited HSQC spectra. bProtons showing longrange correlation to indicated car bon. cCoupling constants derived from signals of coupling partners.

PAGE 196

196 Table 4 -2. Strains and plasmids used in this study Strain Relevant Characteristics Receptor Cognate AHL Source Escherichia coli JM109 pSB401 pSB536 pSB10 75 pTIM505 pTIM5211 pTIM5319 luxR+ PluxIluxCDABE; Tetr p15A origin ahyR+ PahyIluxCDABE; Ampr ColE1 origin lasR+ PlasIluxCDABE; Ampr ColE1 origin PlasIluxCDABE; Ampr ColE1 origin lasR+, Kanr ColE1 origin lasR+ ( S13 S172), PlasIluxCDABE; Ampr ColE1 origin LuxR AhyR LasR LasR Truncated LasR, lacks AHLbinding domain 3oxo -C6HSL C4HSL 3oxo -C12HSL Winson et al. 1998196 Winson et al. 1998196 Winson et al. 1998196 Rajamani et al. 2008198 Alagely et al. 2010240 Rajamani et al. 2008198 Escherichia coli DH5 pTIM2442 P luxCDABE; Ampr ColE1 origin Contains nt770 893 of pWD4209, locus AF129072 cloned upstream of promoterless luxCDABE cassette. Constitutively luminescent construct Alagely et al. 2010240 Agrobacterium tumefaciens NT1 p DCI41E33 traR+ traG::lacZ ; Kanr TraR 3oxo -C8HSL Shaw et al. 1997241 Pseudomonas aeruginosa PAO1 Wild type P. aeruginosa LasR RhlR 3oxo -C12HSL C 4 HSL Holloway et al. 1979242 Pseudomonas aeruginosa PA OJP2 lasI rhlI LasR RhlR 3oxo -C12HSL C 4 HSL Pesci et al. 1997201

PAGE 197

197 Table 4-3. NMR data for lyngbyoic acid ( 8) (500 MHz, CDCl3) C/H No. C mult. 1 H ( J in Hz) COSY HMBC OH 10.18, br 1 180.7, s 2 34.5, t 2.42, t (7.48) H 3a, H 3b 1, 3, 4 3a 29.6, t 1.56, m H 2 2, H 4 1, 2, 4, 6 3b 1.52, m H 2 2, H 4 1, 2, 4, 5, 6 4 18.3, d 0.45, m H 2 5, H 3a, H 3b 5 2 7 2 5 12.0, t 0.21, m (2H) H 4, H 6 3, 4, 6, 7 6 19.2, d 0.45, m H 2 5, H 7a, H 7b 5 1 7 1 7a 34.3, t 1.21, m H 6, H 7b, H 2 8 4, 5, 6, 8 7b 1.13, m H 6, H 7a, H 2 8 4, 5, 6, 8 8 29.8, t 1.33, m H 7a, H 7b, H 2 9 6, 7 9 29.7 3 t 1.25, m H 2 8 7 10 29.5 3 t 1.25, m 12 11 32.1, t 1.25, m 12 12 22.2, t 1.27, m H 2 11, H 3 13 11, 13 13 14.0, q 0.88, t (6.99) H 2 1 11, 12 1Multiplicity is de rived from APT and HSQC spectra. 2It could not be distinguished which proton shows HMBC correlations to C-5 and C-7. 3Assignment of these carbon signals are interchangeable.

PAGE 198

198 Table 4 -4. Validation of GeneChip experiment by RT-qPCR Gene Fold change (RT q PCR) Fold change (GeneC hip) lasB (PA3724) 34.9 13.8 phzG1 (PA4216) 13.5 21.2 retS (PA4856) +2.2 +2.0 fadA5 (PA3013) +28.7 +18.2 lasR (PA1430) +1.05 +1.02

PAGE 199

199 Table 4 -5. Primers and probes used in this study Gene Forward Reverse Probe lasB (PA37 24) 5 GCCTATTCGCCGCTGAAC -3 5 AGTCCCGGTACAGTTTGAACAC -3 5 ACGCGCATTTCTTC-3 phzG1 (PA4216) 5 CCCGCCGGGCTACTG -3 5 GCTTCCAGCCTCCTTCGT -3 5 ACTCCAGGCACAGTTC -3 retS (PA4856) 5 ACGCCAGCGGCTGAT -3 5 TCGCTGGTGCGCTGTT -3 5 CCAGCAGCTCAACCTG-3 fadA5 ( PA3013) 5 GGCATGATGGGCCTGACT -3 5 CGCCTCACGGCTGATACC -3 5 TCTTGCCGAGCATTTC -3 lasR (PA1430) 5 TCCATCTACCAGACGCGAAAG -3 5 CGGCCGAGGCTTCCT -3 5 CAGCACGAGTTCTTCG -3 rpoD (PA0576) 5 GCGAGCGCATGGACATG-3 5 GGCTCTTTGGCGATCTTCAGT -3 5 ACCTTGCGGATCTTGT -3 rpsL (PA4268) 5 CTGCGTAAGGTATGCCGTGTA -3 5 CACCGATGTACGAGGAAACCT -3 5 CTGACCAACGGTTTCG-3

PAGE 200

200 Table 4 -6. Iron regulated genes that are affected by lyngbyoic acid ( 8) Gene a Gene name Fold Change Annotation PA0266 gabT 1.9 4 aminobutyrate aminotrans ferase PA0471 1.9 Probable transmembrane sensor PA0500 bioB 2.9 Biotin synthase PA0672 hemO 4.2 Heme oxygenase PA1003 mvfR 1.8 Transcriptional regulator PA1249 aprA 2.9 Alkaline metalloproteinase precursor PA2033 1.7 Hypothetical protein PA211 2 36.1 Conserved hypothetical protein PA2384 2.4 Hypothetical protein PA2385 pvdQ 2.4 3 oxo C 12 homoserine lactone acylase PA2386 pvdA 3.9 L ornithine N5 oxygenase PA2393 1.6 Probable dipetidase precursor PA2394 pvdN 2.5 PA2395 pvdO 3.8 P A2396 pvdF 2.5 Pyoverdine synthetase PA2397 pvdE 1.6 Pyoverdine biosynthesis protein PA2398 fpvA 2.2 Ferripyoverdine receptor PA2399 pvdD 2.9 Pyoverdine synthetase PA2400 pvdJ 4.5 PA2401 pvdJ 3.4 PA2402 3.3 Probable NRPS PA2403 2.2 Hypot hetical protein PA2410 1.7 Hypothetical protein PA2411 7.5 Probable thioesterase PA2413 pvdH 9.4 L 2,4 diaminobutyrate:2 ketoglutarate 4 aminotransferase PA2424 pvdL 2.3 PA2426 pvdS 4.7 Sigma factor PA2451 1.5 Hypothetical protein PA3165 h isC2 2.2 Histidinol phosphate aminotransferase PA3530 5.7 Conserved hypothetical protein PA3811 hscB 1.6 Heat shock protein B PA4175 prpL 2.7 PvdS regulated endoprotease (keratitis etc.) PA4219 1.7 Hypothetical protein PA4224 pchG 1.7 Pyochelin b iosynthetic protein PA4228 pchG 2.6 Pyochelin biosynthetic protein PA4229 pchC 3.1 Pyochelin biosynthetic protein

PAGE 201

201 Table 4 -6. Continued PA4230 pchB 3.5 Salicylate biosynthesis protein PA4231 pchA 2.6 Salicylate biosynthesis isochorismate synthase PA4357 ssb 3.4 Conserved hypothetical protein PA4359 5.0 Probable MFS transporter PA4468 sodM 4.1 Superoxide dismutase PA4469 6.3 Hypothetical protein PA4470 fumC1 4.4 Fumarate hydratase PA4471 2.0 Hypothetical protein PA4500 5.2 Probable b inding component of ABC transporter PA4570 3.9 Hypothetical protein PA4633 1.7 Probable chemotaxis inducer PA4708 phuT 2.3 Heme transport protein PA4709 2.4 Probable hemin degrading factor PA5313 1.7 Probable pyridoxal dependent aminotransfer ase PA5314 2.6 Hypothetical protein PA5531 tonB 1.8 ton B aGenes previously identified as upregulated under ironstarvation in a microarray study.243

PAGE 202

202 Figure 4 -1. a) Structures of three examples of acylhomoserine lactone signaling molecules used for quorum sensing in gram negative bacteria. b) Scheme showing the hierarchy of AHL pathways in P. aeruginosa.

PAGE 203

203 Figure 4 -2. Structures of 8 epi malyngamide C ( 7 ) lyngbyoic acid ( 8) and other compounds used for quorum sensing studies.

PAGE 204

204 Figure 4 -3. Comparison of 1H NMR signal for H -8 in a ) 8 epi malyngamide C ( 7) and b) malyngamide C (400 MHz CDCl3)

PAGE 205

205 Figure 4 -4. Conversion of 7 to malyngamide C by Mitsunobu inversion. i) PPh3, pNBA, DEAD, THF, rt for 14 h, then 40 C for 3 h; ii) K2CO3, rt for 1 h

PAGE 206

206 Figure 4 -5. Structures of compounds related to lyngbyoic acid ( 8). Note that the depicted absolute configuration of grenadadiene and majusculoic acid is arbitrary because the absolute configuration has not been determined.

PAGE 207

207 Fi gure 4 -6. Activity against the quorum sensing reporter pSB1075, which expresses LasR and responds to 3-oxo-C12HSL. (*) indicates reduction of luminescence with statistical significance of P < 0.05 ( t -test) compared to untreated controls.

PAGE 208

208 Figure 4 -7. Determination of AHL -inhibitory activity of compound 8 and probing of the mechanism of action by use of luxCDABE reporter constructs. All reporters are expressed in E. coli (see Table 1). In all graphs (*) indicates downregulation with statistical signif icance of P < 0.05 ( t test), compared to untreated controls. a) Effect of lyngbyoic acid ( 8) on luminescence of the reporter strains pSB401, pSB536 and pSB107 in the presence 3-oxo-C6HSL, C4-HSL and 3-oxo-C12HSL (see Figure 4 -1), respectively. Results are expressed as % activation compared to control wells treated with cognate AHL alone (100%). b) Effect of lyngbyoic acid ( 8) on background luminescence, in the absence of cognate AHL. Results are expressed as % activation compared to untreated control (100). c) Effect of lyngbyoic acid ( 8) and other

PAGE 209

209 compounds on luminescence in pSB1075. d) Effect of lyngbyoic acid ( 8 ) and dodecanoic acid ( 11 ) on a reporter that lacks a functional AHL -binding domain (pTIM5319).198 Results are expressed as % activation compared to untreated control (100). e) 3-oxo-C12HSL is able to compete with 8 (1 mM) in a reporter strain lacking rsaL (pTIM505 5211), but not in pSB1075.

PAGE 210

210 Figure 4 -8. Treatment of the lacZ based A. tumefaciens TraR reporter with 8 in the presence of 1 nM 3-oxo-C8HSL. Cont refers to wells treated wi th 3-oxo-C8-HSL alone, and Blank refers to untreated wells.

PAGE 211

211 Figure 4 -9. Treatment of constitutively active reporter pTIM2442 with lyngbyoic acid ( 8).

PAGE 212

212 Figure 4 -10. Effect of lyngbyoic acid ( 8) and other compounds on wildtype P. aeruginosa and the lasIrhlI mutant PAO -JP2. In all graphs (*) indicates downregulation with statistical significance of P < 0.05 ( t -test), compared to untreated controls. a)

PAGE 213

213 Lyngbyoic acid ( 8) is able to reduce pigment production by PAO1. b) Lyngbyoic acid ( 8) is able to reduce LasB production in PAO1. c) Effect of lyngbyoic acid ( 8) and other compounds (1 mM) on pyocyanin and LasB production in PAO1 and PAO-JP2. d) Effect of lyngbyoic acid (8) and other compounds on the gene expression of lasB and phzG1.

PAGE 214

214 Figure 4 -11. Growth curves of P. aeruginosa PAO1 treated with EtOH and lyngbyoic acid ( 8)

PAGE 215

215 Figure 4 -12. Lineweaver -Burke plot of LasB inhibition by lyngbyoic acid ( 8)

PAGE 216

216 Figure 4 -13. Comparison of lyngbyoic acid ( 8) induced changes in gene expression (a) with previous studies of quorumsensing controlled genes, Wagner et al.161 (b) and Schuster et al.160 (c and d). a) Cultures of PAO1 were treated with 1 mM 8 for 6 h at 37 C with shaking. b) PAOJP2 treated with exogenous 3-oxo-C12-HSL and C4HSL. c) PAO MW1 treated with 3 -oxo-C12HSL. d) PAO MW1 treated with 3 -oxo-C12-HSL and C4HSL.

PAGE 217

217

PAGE 218

218 Figure 4 -14. Scheme showing the effect of lyngbyoic acid ( 8) on the transcript level of selected genes of P. aeruginosa PAO1.

PAGE 219

219 Figure 4 -15. DNA gels showing results of DNase reactions in preparation for GeneChip hybridization. a) Trial DNase reactions using PAO1 genomic DNA as a control (4 g

PAGE 220

220 per reaction). 1. 25 bp ladder. 2. Unreacted PAO1 genomic DNA. 3. Blank reaction (no enzyme). 4. 0.001 U DNase/ g DNA. 5. 0.005 U DNase/ g DNA. 6. 0.01 U DNase/ g DNA. 7. 0.05 U DNase/ g DNA. 8. 0.1 U D Nase/ g DNA. 9. 0.15 U DNase/ g DNA. 10. NF B-luc, fragmented and labeled, incubated with neutravidin (0.2 g DNA). 11. NF B-luc, fragmented and labeled, not incubated with neutravidin. 12. 50 bp ladder. (Note: in this case 0.05 U DNase/ g DNA was chosen as the optimal dose and used for subsequent fragmentations). b) DNase reactions of reverse-transcribed total RNA samples. Each lane is loaded with 0.2 g DNA. 1. 25 bp ladder. 2. Unfragmented control DNA. 3. Fragmented and labeled control DNA. 4. Fragmente d and labeled control DNA, incubated with neutravidin. 5. Unfragmented DNA from lyngbyoic acid -treated PAO1 culture. 6. Fragmented and labeled DNA from lyngbyoic acid -treated PAO1 culture. 7. Fragmented and labeled DNA from lyngbyoic acid treated PAO1 cult ure, incubated with neutravidin. 8. Unfragmented DNA from EtOH -treated PAO1 culture. 9. Fragmented and labeled DNA from EtOHtreated PAO1 culture. 10. Fragmented and labeled DNA from EtOHtreated PAO1 culture, incubated with neutravidin.

PAGE 221

221 CHAPTER 5 CONCLUS ION Presented herein are examples of secondary metabolites from marine cyanobacteria that have diverse bioactivites. Cytotoxic compounds such as grassypeptolides A C ( 1 3, see Chapter 2) are often isolated from cyanobacteria,29 and presumably are a for m of chemical defense against predation. Protease inhibition was also found, as seen with the grassystatins A C ( 4 6, see Chapter 3) against the aspartic proteases cathepsins D and E (aspartic proteases), and with lyngbyoic acid ( 8) against P. aeruginosa elastase (a zinc metalloprotease). Previously, other protease inhibitors have been found to be produced by cyanobacteria, such as the lyngbyastatin series,4648 which potently inhibit mammalian elastase, and to a lesser extent chymotrypsin and trypsin (all serine proteases). It is uncertain whether protease inhibition plays a role in these compounds chemical ecology. One possibility is that they regulate an endogenous protease of the cyanobacterium, as with 1an titrypsin in humans.244 In the case of modified peptides or depsipeptides, protease inhibition may not be their ecological function, but could instead be a consequence of resemblance to protease substrates. There have been only a few reports of quorum sensing modulators from marine cyanobacteria.53,54 Howe ver, there is increasing evidence that quorum sensing modulation may be a widespread phenomenon in the marine environment. AHLproducing bacteria have been detected in the marine environment by a number of different studies.10 Also, in a recent screen of marine organism -derived extracts, 23% antagonized a LuxRbased reporter.153 QS is thought to play a role in biofouling,10 and so QS-modulation may a strategy to influence this process. The exact role of QS pathways and their modification by cyanobacteria in the marine environment remains to be determined.

PAGE 222

222 A common theme found in this work is that secondary metabolites tend to be found as groups of related analogues (see Chapter 2 and 3). Such groups are either the result of permissive substrate specificity in biosynthetic enzymes, or reflect the presence of genetic variations of these pathways within the collected sample. Secondary metabolites are a product of natural selection, and so it can be expected that selective pres sure continues to drive their evolution. From a medicinal chemistry perspective, these series of compounds provide extra SAR information once an activity has been identified, potentially saving time if further synthetic analogues are to be explored in the future. Both grassypeptolides A C ( 1 3, see Chapter 2) and grassystatins A C ( 4 6, see Chapter 3) are examples of natural SAR series. With the grassypeptolides, it was found that changing the configuration of one chiral center affected cytotoxic potency 16 23-fold (the analogue containing N Me -DPhe [ 1] was less potent than that containing N Me -LPhe [ 3]). For the grassystatins, it was suggested by molecular docking that the two Nterminal units N ,N Me2Val Hiva were important for binding to both cathepsins D and E. Indeed, grassystatin C ( 6), which does not possess these residues, has much lower potency against these two enzymes. Overall, this work supports the continued importance of natural products as a source of bioactive molecules. Marine cyano bacteria, in particular, continue to yield novel compounds. In addition, our approach, using both cytotoxicityand NMR-guided isolation, followed by structure -inspired in vitro assays, has been validated.

PAGE 223

223 APPENDIX: NMR SPECTRA

PAGE 224

224 Figure A -1. 1H NMR sp ectrum of g rassypeptolide A ( 1) in CDCl3 (500 MHz)

PAGE 225

225 Figure A -2. 13C NMR spectrum of g rassypeptolide A ( 1) in CDCl3 (100 MHz)

PAGE 226

226 Figure A -3. APT spectrum of g rassypeptolide A ( 1) in CDCl3 (1 00 MHz)

PAGE 227

227 Figu re A -4. COSY spectrum of grassypeptolide A ( 1) in CDCl3 (500 MHz)

PAGE 228

228 Figure A -5. HMQC spectrum of grassypeptolide A ( 1) in CDCl3 (500 MHz)

PAGE 229

229 Figure A -6. HMBC spectrum of g rassypeptolide A ( 1) in CDCl3 (500 MHz)

PAGE 230

230 Figure A -7. ROESY spectrum of g rassypeptolide A ( 1) in CDCl3 (500 MHz)

PAGE 231

231 Figure A -8. 1D TOCSY spectrum of g rassypeptolide A ( 1) in CDCl3 (600 MHz), with selective excitation at 4.64 ppm

PAGE 232

232 Figure A -9. 1D TOCSY s pectrum of g rassypeptolide A ( 1) in CDCl3 (600 MHz), with selective excitation at 3.83 ppm

PAGE 233

233 Figure A -10. 1H NMR spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz)

PAGE 234

234 Figure A -11. 13C NMR spectrum of grassypeptolide A ( 1) in DMSO d6 (1 00 MHz)

PAGE 235

235 Figure A -12. COSY spectrum of g ra ssypeptolide A ( 1) in DMSO d6 (600 MHz)

PAGE 236

236 Figure A -13. Edited HSQC spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz)

PAGE 237

237 Figure A -14. HMBC spectrum of g rassypeptolide A ( 1) in DMSO d6 (600 MHz)

PAGE 238

238 Figure A -15. ROESY spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz)

PAGE 239

239 Figure A -16. TOCSY spectrum of grassypeptolide A ( 1) in DMSO d6 (600 MHz)

PAGE 240

240 Figure A -17. 1H NMR spectrum of grassypeptolide B ( 2 ) in CDCl3 (600 MHz)

PAGE 241

241 Figure A -18. COSY spectrum of g rassypeptolide B ( 2) in CDCl3 (600 MHz)

PAGE 242

242 Figure A -19. Edited HSQC spectrum of grassypeptolide B ( 2) in CDCl3 (600 MHz)

PAGE 243

243 Figure A -20. HMBC spectrum of g rassypeptolide B ( 2) in CDCl3 (600 MHz)

PAGE 244

244 Figure A -21. ROESY spectrum of grassypeptolide B ( 2 ) in CDCl3 (600 MHz)

PAGE 245

245 Figure A -22. 1H NMR spectrum of grassypeptolide C ( 3) in CDCl3 (600 MHz)

PAGE 246

246 Figure A -23. COSY spectrum of g rassypepto lide C ( 3) in CDCl3 (600 MHz)

PAGE 247

247 Figure A -24. Edited HSQC spectrum of grassypeptolide C ( 3) in CDCl3 (600 MHz)

PAGE 248

248 Figure A -25. HMBC spectrum of g rassypeptolide C ( 3) in CDCl3 (600 MHz)

PAGE 249

249 Figure A -26. ROESY spectrum of grassypeptolide C ( 3) in CDCl3 (60 0 MHz)

PAGE 250

250 Figure A -27. 1H NMR spectrum of g rassystatin A ( 4) in CDCl3 (500 MHz)

PAGE 251

251 Figure A -28. 1H NMR spectrum of g rassystatin A ( 4) in CDCl3 (500 MHz), diluted to give sharper signals.

PAGE 252

252 Figure A -29. 1H NMR spectrum of g rassystatin A ( 4) in CDCl3 (400 MHz) after D2O exchange

PAGE 253

253 Figure A -30. 13C NMR spectrum of g rassystatin A ( 4) in CDCl3 (150 MHz)

PAGE 254

254 Figure A -31. APT spectrum of g rassystatin A ( 4) in CDCl3 (150 MHz)

PAGE 255

255 Figure A -32. COSY spectrum of g rassystatin A ( 4) in CDCl3 (500 MHz)

PAGE 256

256 Figure A -33. HMQC spectrum of grassystatin A ( 4) in CDCl3 (500 MHz)

PAGE 257

257 Figure A -34. HMBC spectrum of g rassystatin A ( 4) in CDCl3 (500 MHz)

PAGE 258

258 Figure A -35. ROESY s pectrum of g rassystatin A ( 4) in CDCl3 (500 MHz)

PAGE 259

259 Figure A -36. TOCSY spectrum of g rassystatin A ( 4) in CDCl3 (500 MHz)

PAGE 260

260 Figure A -37. 1H NMR spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz).

PAGE 261

261 Figure A -38. COSY spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz).

PAGE 262

262 Figure A -39. Edited HSQC spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz).

PAGE 263

263 Figure A -40. HMBC spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz).

PAGE 264

264 Figure A -41. ROESY spectrum of grassystatin A ( 4) in DMSO d6 (600 MHz).

PAGE 265

265 Figure A -42. 1H NMR spectrum of grassystatin B ( 5) in CDCl3 (500 MHz).

PAGE 266

266 Figure A -43. COSY spectrum of grassystatin B ( 5) in CDCl3 (50 MHz).

PAGE 267

267 Figure A -43. HMQC spectrum of grassystatin B ( 5) in CDCl3 (500 MHz).

PAGE 268

268 Figure A -44. HMBC spectrum of grassystatin B ( 5) in CDCl3 (500 MHz).

PAGE 269

269 Figure A -45. ROESY spectrum of grassystatin B ( 5) in CDCl3 (500 M Hz).

PAGE 270

270 Figure A -46. TOCSY spectrum of grassystatin B ( 5) in CDCl3 in (500 MHz).

PAGE 271

271 Figure A -47. 1H NMR spectrum of grassystatin C ( 6) in CDCl3 (600 MHz).

PAGE 272

272 Figure A -48. COSY spectrum of grassystatin C ( 6) in CDCl3 (600 MHz).

PAGE 273

273 Figure A -50. Edited HS QC spectrum of grassystatin C ( 6) in CDCl3 (600 MHz).

PAGE 274

274 Figure A -51. HMBC spectrum of grassystatin C ( 6) in CDCl3 (600 MHz).

PAGE 275

275 Figure A -52. ROESY spectrum of grassystatin C ( 6) in CDCl3 (600 MHz).

PAGE 276

276 Figure A -53. TOCSY spectrum of grassystatin C ( 6) i n CDCl3 (600 MHz).

PAGE 277

277 Figure A -54. 1H NMR spectrum of 8epi malyngamide C ( 7) in CDCl3 (400 MHz).

PAGE 278

278 Figure A -55. 13C NMR spectrum of 8epi malyngamide C ( 7) in CDCl3 (100 MHz).

PAGE 279

279 Figure A -56. COSY spectrum of 8epi malyngamide C ( 7) in CDCl3 (600 MHz).

PAGE 280

280 Figure A -57. Edited HSQC spectrum of 8epi malyngamide C ( 7) in CDCl3 (600 MHz).

PAGE 281

281 Figure A -58. HMBC spectrum of 8 epi malyngamide C ( 7) in CDCl3 (600 MHz).

PAGE 282

282 Figure A -59. NOESY spectrum of 8 epi malyngamide C ( 7) in CDCl3 (600 MHz).

PAGE 283

283 Figure A -60. 1H NMR spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz).

PAGE 284

284 Figure A -61. 13C NMR spectrum of lyngbyoic acid ( 8) in CDCl3 (100 MHz).

PAGE 285

285 Figure A -62. APT spectrum of lyngbyoic acid ( 8) in CDCl3 (100 MHz).

PAGE 286

286 Figure A -63. COSY spectrum of lyngbyoic a cid ( 8) in CDCl3 (500 MHz).

PAGE 287

287 Figure A -64. HSQC spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz).

PAGE 288

288 Figure A -65. HMBC spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz).

PAGE 289

289 Figure A -66. TOCSY spectrum of lyngbyoic acid ( 8) in CDCl3 (500 MHz).

PAGE 290

290 LIST OF REFERENCES (1) Tymoczko, J. L.; Stryer, L. ; Stryer, L. ; Berg, J. M. Biochemistry ; 6th ed. ; W. H. Freeman : New York 2007. (2) Peregrin -Alvarez, J. M.; Tsoka, S.; Ouzounis, C. A. Genome Res. 2003, 13 422-427. (3) Jenke-Kodama, H.; Mller, R.; Dittmann, E. Prog. Drug Res. 2008, 65, 120-140. (4) Williams, D. H.; Stone, M. J.; Hauck, P. R.; Rahman, S. K. J. Nat. Prod. 1989, 52, 11891208. (5) Haslam, E. Nat. Prod. Rep. 1986, 3, 217-249. (6) Kumar, K.; Waldmann, H. Angew. Chem. Int. Ed. 2009, 48, 3224-3242. (7) Nicolaou, K. C.; Pfefferkorn, J. A.; Roecker, A. J.; Cao, G.-Q.; Barluenda, S.; Mitchell, H. J. J. Am. Chem. Soc. 2000, 122, 9939-9953. (8) Cragg, G. M.; Grothaus, P. G.; Newman, D. J. Chem. Rev 2009, 109, 3012 -3043. (9) Newman, D. J.; Cragg, G. M. J. Nat. Prod. 2007, 70, 461-477. (10) Dobretsov, S.; Teplitski, M.; Paul, V. Biofouling 2009, 25, 413-427. (11) Engel, S.; Jensen, P. R.; Fenical, W. J. Chem. Ecol. 2002, 28, 1971-1985. (12) Rusch, D. B.; Halpern, A. L.; Sutton, G.; Heidelberg, K. B.; Williamson, S.; Yooseph, S.; Wu, D.; Eisen, J. A.; Hoffman, J. M.; Remington, K.; Beeson, K.; Tran, B.; Smith, H.; Baden -Tillson, H.; Stewart, C.; Thorpe, J.; Freeman, J.; Andrews-Pfannkock, C.; Venter, J. E.; Li, K.; Kravitz, S.; Heidelberg, J. F.; Utterback, T.; Rogers, Y.H.; Falcn, L. I.; Souza, V.; Bonilla-Rosso, G.; Eguiarte, L. E.; Karl, D. M.; Sathyendranath, S.; Platt, T.; Bermingham, E.; Gallardo, V.; Tamayo -Castillo, G.; Ferrari, M. R.; Strausberg, R. L.; Nealson, K.; Friedman, R.; Frazier, M.; Venter, J. C. PLoS Biol. 2007, 5, 398-431. (13) Yooseph, S.; Sutton, G.; Rusch, D. B.; Halpern, A. L.; Williamson, S. J.; Remington, K.; Eisen, J. A.; Heidelberg, K. B.; Manning, G.; Li, W.; Jaroszewski, L.; Cieplak, P.; Miller, C. S.; Li, H.; Mashiyama, S. T.; Joachimiak, M. P.; van Belle, C.; Chandonia, J.-M.; Soergel, D. A.; Zhai, Y.; Natarajan, K.; Lee, S.; Raphael, B. J.; Bafna, V.; Friedman, R.; Brenner, S. E.; Godzik, A.; Eisenberg, D.; Dixon, J. E.; Taylor, S. S.; Strausberg, R. L.; Frazie r, M.; Venter, J. C. PLoS Biol. 2007, 5, 432 -466. (14) Kannan, N.; Taylor, S. S.; Zhai, Y.; Venter, J. C.; Manning, G. PLoS Biol. 2007, 5, 467478.

PAGE 291

291 (15) Williamson, S. J.; Rusch, D. B.; Yooseph, S.; Halpern, A. L.; Heidelberg, K. B.; Glass, J. I.; Andrews -Pfannkoch, C.; Fadrosh, D.; Miller, C. S.; Sutton, G.; Frazier, M.; Venter, J. C. PLoS One 2008, 3, e1456. (16) Piel, J. Nat. Prod. Rep. 2009, 26, 338-362. (17) Hay, M. E. Annu. Rev. Mar. Sci. 2009, 1, 193-212. (18) Paul, V. J.; Arthur, K. E.; RitsonWilliams, R.; Ross, C.; Sharp, K. Biol. Bull. 2007, 213, 226-251. (19) Pohnert, G. Topics Curr. Med. Chem. 2004, 239, 179-219. (20) Cardellina, J. H.; Marner, F.-J.; Moore, R. E. Science 1979, 304, 193-195. (21) Nicolaou, K. C.; Aversa, R. J.; Jin, J.; Rivas, F. J. Am. Chem. Soc. 2010, 132, 68556861. (22) Rhinehart, K. L.; Holt, T. G.; Fregeau, N. L.; Kauffman, C. A.; Jensen, P. R.; Fenical, W. J. Org. Chem. 1990, 55, 4512-4515. (23) Zewail -Foote, M.; Hurley, L. H. J. Am. Chem. Soc. 2001, 123, 6485-6495. (24) Moore, B. M.; Seaman, F. C.; Wheelhouse, R. T.; Hurley, L. H. J. Am. Chem. Soc. 1998, 120, 2490-2491. (25) Marco, E.; David-Cordonnier, M.-H.; Bailly, C.; Cuevas, C.; Gago, F. J. Med. Chem. 2006, 49, 6925-6929. (26) Bingham, J.-P.; Mitsunaga, E.; Bergeron, Z. L. Chemico Biol. Interact. 2010, 183, 1-18. (27) Raven, J. A.; Allen, J. F. Genome Biol. 2003, 4, 209. (28) Littler, D. S. ; Littler, M. M. Caribbean Reef Plants ; OffShore Graphics : Washington, D. C. 2000. (29) Tan, L. K. Phytochem. 2007, 68, 954-979. (30) Challis, G. L.; Naismith, J. H. Curr. Opin. Struc. Biol. 2004, 14, 748-756. (31) Shen, B. Curr. Opin. Chem. Biol. 2003, 7, 285-295. (32) McIntosh, J. A.; Donia, M. S.; Schmidt, E. W. Nat. Prod. Rep. 2009, 26, 537-559. (33) Dewick, P. M. Medicinal Natural Products: A Biosynthetic Approach; 2nd ed.; John Wiley & Sons : Chichester 2002.

PAGE 292

292 (34) Quirs, L. M.; Aguirrezabalaga, I.; Olano, C.; Mndez, C.; Salas, J. A. Mol. Microbiol. 1998, 28, 1177-1185. (35) Zhao, L.; Beyer, N. J.; Borisova, S. A.; Liu, H.-W. B iochem. 2003, 42, 14794-14804. (36) Zhao, L.; Sherman, D. H.; Liu, H.-W. J. Am. Chem. Soc. 1998, 120, 9374 -9375. (37) Luesch, H.; Yoshida, W. Y.; Moore, R. E.; Paul, V. J.; Corbett, T. H. J. Am. Chem. Soc. 2001, 123, 5418-5423. (38) Donia, M. S.; Ravel, J.; Schmidt, E. W. Nat. Chem. Biol. 2008, 4, 341-343. (39) Schmidt, E. W.; Nelson, J. T.; Rasko, D. A.; Sudek, S.; Eisen, J. A.; Haygood, M. G.; Ravel, J. Proc. Natl. Acad. Sci. USA 2005, 102, 7315-7320. (40) Oberlies, N. H.; Kroll, D. J. J. Nat. Prod. 2004, 67 129-135. (41) Kwan, J. C.; Luesch, H. Chem. Eur. J. 2010, In press. (42) Liu, Y.; Law, B. K.; Luesch, H. Mol. Pharmacol. 2009, 76, 91-104. (43) Taori, K.; Paul, V. J.; Luesch, H. J. Am. Chem. Soc. 2008, 130, 1806-1807. (44) Ying, Y.; Taori, K.; Kim, H.; Hong, J.; Luesch, H. J. Am. Chem. Soc. 2008, 130, 84558459. (45) Rang, H. P. Pharmacology ; 6th ed. ; Churchill Livinstone : Edinburgh, 2003. (46) Taori, K.; Matthew, S.; Rocca, J. R.; Paul, V. J.; Luesch, H. J. Nat. Prod. 2007, 70, 1593-1600. (47) Kwan, J. C.; Taori, K.; Paul, V. J.; Luesch, H. Mar. Drugs 2009, 7, 528-538. (48) Matthew, S.; Ross, C.; Rocca, J. R.; Paul, V. J.; Luesch, H. J. Nat. Prod. 2007, 70, 124127. (49) Suga, H.; Smith, K. M. Curr. Opin. Chem. Biol. 2003, 7, 586-591. (50) Martin, C. A.; Hoven, A. D.; Cook, A. M. Eur. J. Clin. Microbiol. Infect. Dis. 2008, 27, 635-642. (51) Federle, M. J.; Bassler, B. L. J. Clin. Invest. 2003, 112, 1291-1299. (52) Dong, Y.-H.; Wang, L.-H.; Xu, J.-L.; Zhang, H.-B.; Zhang, X.F.; Zhang, L.H. Nature 2001, 411, 813-817. (53) Clark, B. R.; Engene, N.; Teasdale, M. E.; Rowley, D. C.; Matainaho, T.; Valeriote, F. A.; Gerwick, W. H. J. Nat. Prod. 2008, 71, 1530-1537.

PAGE 293

293 (54) Dobretsov, S.; Teplitski, M.; Alagely, A.; Gunasekera, S. P.; Paul, V. J. Env. Microbiol. Rep. 2010, DOI: 10.1111/j.1758-2229.2010.00169.x. (55) Carmichael, J.; DeGraff, W. G.; Gazdar, A. F.; Minna, J. D.; Mitchell, J. B. Cancer Res. 1987, 47, 936-942. (56) Williams, P. G.; Moore, R. E.; Paul, V. J. J. Nat. Prod. 2003, 66, 1356-1363. (57) Liu, W. -T.; Ng, J.; Meluzzi, D.; Bandeira, N.; Gutierrez, M.; Simmons, T. L.; Schultz, A. W.; Linnington, R. G.; Moore, B. S.; Gerwick, W. H.; Pevzner, P. A.; Dorrestein, P. C. Anal. Chem. 2009, 81, 4200-4209. (58) Marfey, P. Carlsberg Res. Commun. 1984, 49, 591-596. (59) Kuffner, I. B.; Walters, L. J.; Becerro, M. A.; J., P. V.; Ritson-Williams, R.; S., B. K. Mar. Ecol. Prog. Ser. 2006, 323, 107-117. (60) Fusetani, N.; Sugawara, T.; Matsunaga, S.; Hirota, H. J. Am. Chem. Soc. 1991, 113, 7811-7812. (61) Kobayashi, J.; Itagaki, F.; Shigemori, H.; Ishibashi, M.; Takahashi, K.; Ogura, M.; Nagasawa, S.; Nakamura, T.; Hirota, H.; Ohta, T.; Nozoe, S. J. Am. Chem. Soc. 1991, 113, 7812-7813. (62) Nakao, Y.; Fujita, M.; Warabi, K.; Matsunaga, S.; Fusetani, N. J. Am. Chem. Soc. 2000, 122, 10462-10463. (63) Tan, L. T.; Sitachitta, N.; Gerwick, W. H. J. Nat. Prod. 2003, 66, 764-771. (64) Wipf, P.; Fritch, P. C.; Geib, S. J.; Sefler, A. M. J. Am. Chem. Soc. 1998, 120, 41054112. (65) Long, P. F.; Dunlap, W. C.; Battershill, C. N.; Jaspars, M. ChemBioChem 2005, 6, 17601765. (66) Donia, M. S.; Hathaway, B. J.; Sudek, S.; Haygood, M. G.; Rosovitz, M. J.; Ravel, J.; Schmidt, E. W. Nat. Chem. Biol. 2006, 2, 729-735. (67) Claridge, T. D. W. High -Resolution NMR Techniques in Organic Chemistry ; Elsevier : San Diego, CA 1999. (68) Ngoka, L. C. M.; Gross, M. L. J. Am. Soc. Mass Spec. 1999, 10, 732-746. (69) Fujii, K.; Ikai, Y.; Mayumi, T.; Oka, H.; Suzuki, M.; Harada, K.I. Anal. Chem. 1997, 69, 3346-3352.

PAGE 294

294 (70) Schmitz, F. J.; Ksebati, M. B.; Chang, J. S.; Wang, J. L.; Hossain, M. B.; van der Helm, D.; Engel, M. H.; Serban, A.; Silfer, J. A. J. Org. Chem. 1989, 54, 3463-3472. (71) Kuntz, I. D.; Thomason, J. F.; Oshiro, C. M. Methods Enzymol. 1989, 177, 159-204. (72) Vgeli, B.; Ying, J.; Grishaev, A.; Bax, A. J. Am. Chem. Soc. 2007, 129, 9377-9385. (73) Kwan, J. C.; Rocca, J. R.; Abboud, K. A.; Paul, V. J.; Luesch, H. Org. Lett. 2008, 10, 789-792. (74) Bertram, A.; Pattenden, G. Nat. Prod. Rep. 2007, 24, 18-30. (75) Morris, L. A.; Jaspars M.; Kettenes -van den Bosch, J. J.; Versluis, K.; Heck, A. J. R.; Kelly, S. M.; Price, N. C. Tetrahedron 2001, 57, 3185-3197. (76) van den Brenk, A. L.; Byriel, K. A.; Fairlie, D. P.; Gahan, L. R.; Hanson, G. R.; Hawkins, C. J.; Jones, A.; Kennard, C. H. L.; Moubaraki, B.; Murray, K. S. Inorg. Chem. 1994, 33, 3549-3557. (77) Morris, L. A.; Milne, B. F.; Thompson, G. S.; Jaspars, M. J. Chem. Soc. Perkin Trans. 2 2002, 1072-1075. (78) Latifi, R.; Bagherzadeh, M.; Milne, B. F.; Jaspars, M.; de Visser, S. P. J. Inorg. Biochem. 2008, 102, 2171-2178. (79) Turner, J.; Koumenis, C.; Kute, T. E.; Planalp, R. P.; Brechbiel, M. W.; Beardsley, D.; Cody, B.; Brown, K. D.; Torti, F. M.; Torti, S. V. Blood 2005, 106, 3191-3199. (80) Morris, L. A.; Milne, B. F.; Jaspars, M .; Kettenes -van den Bosch, J. J.; Versluis, K.; Heck, A. J. R.; Kelly, S. M.; Price, N. C. Tetrahedron 2001, 57, 3199-3207. (81) Sreerama, N.; Woody, R. W. In Circular Dichroism: Principles and Applications ; nd ed.; Berova, N., Nakanishi, K., Woody, R. W., Eds.; Wiley -VCH: New York, 2000, p 601-620. (82) Perczel, A.; Hollsi, M. In Circular Dichroism and the Conformational Analysis of Biomolecules ; Fasman, G. D., Ed.; Plenum Press: New York, 1996, p 285 -380. (83) Le, N. T. V.; Richardson, D. R. Biochim. Biophys. Acta 2002, 1603, 31-46. (84) Yu, Y.; Kovacevic, Z.; Richardson, D. R. Cell Cycle 2007, 6, 1982-1994. (85) Renton, F. J.; Jeitner, T. M. Biochem. Pharmacol. 1996, 51, 1553-1561. (86) Huang, P.; Feng, L.; Oldham, E. A.; Keating, M. J.; Plunkett, W. Na ture 2000, 407, 390395.

PAGE 295

295 (87) Juarez, J. C.; Betancourt, O.; Pirie-Shephard, S. R.; Guan, X.; Price, M. L.; Shaw, D. E.; Mazar, A. P.; Doate, D. Clin. Cancer Res. 2006, 12, 4974-4982. (88) Shackelford, R. E.; Innes, C. L.; Sieber, S. O.; Heinloth, A. N.; Leadon, S. A.; Paules, R. S. J. Biol. Chem. 2001, 276, 21951-21959. (89) Rodriguez-Lucena, D.; Gaboriau, F.; Rivault, F.; Schalk, I. J.; Lescoat, G.; Mislin, G. L. A. Bioorg. Med. Chem. 2010, 18, 689-695. (90) Lpez-Otn, C.; Bond, J. S. J. Biol. Chem. 2008, 283, 30433-30437. (91) Turk, B. Nat. Rev. Drug Discov. 2006, 5, 785-799. (92) Coussens, L. M.; Fingleton, B.; Matrisian, L. M. Science 2002, 295, 2387 -2392. (93) Dittman, E.; Neilan, B. A.; Brner, T. Appl. Microbiol. Biotechnol. 2001, 57, 467-473. (94) Kittendorf, J. D.; Sherman, D. H. Bioorg. Med. Chem. 2009, 17, 2137-2146. (95) Morishima, H.; Takita, T.; Aoyagi, T.; Takeuchi, T.; Umezawa, H. J. Antibiot. 1970, 23, 263-265. (96) Umezawa, H.; Aoyagi, T.; Morishima, H.; Matsuzaki, M.; Hamada, M.; Takeuchi, T. J. Antibiot. 1970, 23, 259262. (97) Morishima, H.; Sawa, T.; Takita, T.; Aoyagi, T.; Takeuchi, M.; Umezawa, H. J. Antibiot. 1974, 27, 267-273. (98) Williams, P. G.; Yoshida, W. Y.; Moore, R. E.; Paul, V. J. J. Nat. Prod. 2002, 65, 13361339. (99) Ma Z. H.; Song, N.; Li, C.-X.; Zhang, W.; Wang, P.; Li, Y.X. J. Peptide Sci. 2008, 14, 1139-1147. (100) Williams, P. G.; Yoshida, W. Y.; Moore, R. E.; Paul, V. J. J. Nat. Prod. 2003, 66, 10061009. (101) Sun, T.; Zhang, W.; Zong, C.; Wang, P.; Li, Y. J. Peptide Sci. 2010, 16, 364-374. (102) Zaidi, N.; Hermann, C.; Hermann, T.; Kalbacher, H. Biochem. Biophys. Res. Commun. 2008, 377, 327-330. (103) Zaidi, N.; Kalbacher, H. Biochem. Biophys. Res. Commun. 2008, 367, 517-522. (104) Zaidi, N.; Burster, T.; Sommandas, V.; Herrmann, T.; Boehm, B. O.; Driessen, C.; Voelter, W.; Kalbacher, H. Biochem. Biophys. Res. Commun. 2007, 364, 243-249.

PAGE 296

296 (105) Matsumori, N.; Kaneno, D.; Murata, M.; Nakamura, H.; Tachibana, K. J. Org. Chem. 1999, 64, 866-876. (106) Uhrin, D.; Batta, G.; Hruby, V. J.; Barion, P. N.; Kvr, K. E. J. Magn. Reson. 1998, 130, 155-161. (107) Preciado, A.; Williams, P. G. J. Org. Chem. 2008, 73, 9228-9234. (108) Burster, T.; Reich, M.; Zaidi, N.; Voelter, W.; Boehm, B. O.; Kalbacher, H. Biochem. Biophys. Res. Commun. 2008, 377, 1299-1303. (109) Chain, B. M.; Free, P.; Medd, P.; Swetman, C.; Tabor, A. B.; Terrazzini, N. J. Immunol. 2005, 174, 1791-1800. (110) Nishioki, T.; Hashimoto, K.; Yamashita, K.; Liou, S.Y.; Kagamiishi, Y.; Maega wa, H.; Katsube, N.; Peters, C.; von Figura, K.; Saftig, P.; Katunuma, N.; Yasutomo, K.; Nakanishi, H. J. Biol. Chem. 2002, 277, 4816-4822. (111) Janeway, C. A.; Travers, P.; Walport, M.; Schlomchik, M. In Immunobiology, the Immune System in Health and Dis ease; 6th ed.; Garland Publishing: New York, 2005, p 169-202. (112) Zaidi, N.; Herrmann, T.; Baechle, D.; Schleicher, S.; Gogel, J.; Driessen, C.; Voelter, W.; Kalbacher, H. FEBS J. 2007, 274, 3138-3149. (113) Trott, O.; Olson, A. J. J. Comput. Chem. 2010, 31, 455-461. (114) Baldwin, E. T.; Bhat, T. N.; Gulnik, S.; Hosur, M. V.; Sowder, R. C.; Cachau, R. E.; Collins, J.; Silva, A. M.; Erickson, J. W. Proc. Natl. Acad. Sci. 1993, 90, 6796-6800. (115) Rao -Naik, C.; Guruprasad, K.; Batley, B.; Rapundalo, S.; Hill, J.; Blundell, T.; Kay, J.; Dunn, B. M. Proteins Struc. Func. Genet. 1995, 22 168-181. (116) Rich, D. H. J. Med. Chem. 1985, 28, 263-273. (117) Scarborough, P. E.; Dunn, B. M. Protein Eng. 1994, 7, 495-502. (118) Arnold, D.; Keilholz, W.; Schild, H.; Dumrese, T.; Stevanovic, S.; Rammensee, H.G. Eur. J. Biochem. 1997, 249, 171-179. (119) Marcinkeviciene, J.; Luo, Y.; Graciani, N. R.; Combs, A. P.; Copeland, R. A. J. Biol. Chem. 2001, 276, 23790-23794. (120) Bull, H. G.; Thornberry, N. A.; Cordes, M. H. J.; Patchett, A. A.; Cordes, E. H. J. Biol. Chem. 1985, 260, 2952-2962.

PAGE 297

297 (121) Bernardo, M. M.; Brown, S.; Li, Z.-H.; Fridman, R.; Mobashery, S. J. Biol. Chem. 2002, 277, 11201-11207. (122) Copeland, R. A. In Evaluation of Enzyme Inhibitors In Drug Discovery: A Guide for Medicinal Chemists and Pharmacologists ; Wiley & Sons: Hoboken, 2005, p 141-177. (123) Zhang, T.; Maekawa, Y.; Yasutomo, K.; Ishikawa, H.; Nashed, B. F.; Dainichi, T.; Hisaeda, H.; Sakai, T.; Kasai, M.; Mizuochi, T.; Asao, T.; Katunuma, N.; Himeno, K. Biochem. Biophys. Res. Commun. 2000, 276, 693-701. (124) Dunn, G. P.; Ikeda, H.; Bruce, A. T.; Koebel, C.; Uppaluri, R.; Bui, J.; Chan, R.; Diamond, M.; White, J. M.; Sheehan, K. C.; Schreiber, R. D. Immunol. Res. 2005, 32, 231-245. (125) Tesmer L. A.; Lundy, S. K.; Sarkar, S.; Fox, D. A. Immunol. Rev. 2008, 223, 87-113. (126) Riese, R. J.; Mitchell, R. N.; Villadangos, J. A.; Shi, G.-P.; Palmer, J. T.; Karp, E. R.; De Sanctis, G. T.; Ploegh, H. L.; Chapman, H. A. J. Clin. Invest. 1998, 101, 2351-2363. (127) Proc. Natl. Acad. Sci. USA 1994, 91, 21712175. (128) Costantino, C. M.; Hang, H. C.; Kent, S. C.; Hafler, D. A.; Ploegh, H. L. J. Immunol. 2008, 180, 2876-2885. (129) Keilov, H.; Tomek, V. Biochim. Biophys Acta 1972, 284, 461-464. (130) Brey, W. W.; Edison, A. S.; Nast, R. E.; Rocca, J. R.; Saha, S.; Withers, R. S. J. Magn. Reson. 2006, 179, 290-293. (131) Bernstein, N. K.; Cherney, M. M.; Yowell, C. A.; Dame, J. B.; James, M. N. G. J. Mol. Biol. 2003, 329, 505-524. (132) Borelli, C.; Ruge, E.; Schaller, M.; Monod, M.; Korting, H. C.; Huber, R.; Maskos, K. Proteins Struc. Func. Genet. 2007, 68, 738-748. (133) Fitzgerald, P. M. D.; McKeever, B. M.; VanMiddlesworth, J. F.; Springer, J. P.; Heimbach, J. C.; Leu, C.-T.; Herber, W. K.; Dixon, R. A. F.; Darke, P. L. J. Biol. Chem. 1990, 265, 14209-14219. (134) Fujimoto, Z.; Fujii, Y.; Kaneko, S.; Kobayashi, H.; Mizuno, H. J. Mol. Biol. 2004, 341, 1227-1235. (135) Fujinaga, M.; Chernaia, M. M.; Tarasova, N. I.; Mosimann, S. C.; James, M. N. G. Protein Sci. 1995, 4, 960-972. (136) Kamitori, S.; Ohtaki, A.; Ino, H.; Takeuchi, M. J. Mol. Biol. 2003, 326, 1501-1511.

PAGE 298

298 (137) Yang, J.; Quail, J. W. Acta Cryst. D 1999, D55 625-630. (138) Asojo, O. A.; Gulnik, S. V.; Afonina, E.; Yu, B.; Ellman, J. A.; Haque, T. S.; Silva, A. M. J. Mol. Biol. 2003, 327, 173-181. (139) Bone, R.; Vacca, J. P.; Anderson, P. S.; Holloway, M. K. J. Am. Chem. Soc. 1991, 113, 9382-9384. (140) Coates, L.; Erskine, P. T.; Wood, S. P.; Myles, D. A. A.; Cooper, J. B. Biochem. 2001, 40, 13149-13157. (141) Fraser, M. E.; Strynadka, N. C. J.; Bartlett, P. A.; Hanson, J. E.; James, M. N. G. Biochem. 1992, 31, 5201 -5214. (142) James, M. N. G.; Sielecki, A. R.; Hayakawa, K.; Gelb, M. H. Biochem. 1992, 31, 38723886. (143) Ostermann, N.; Gerhartz, B.; Worpenberg, S.; Trappe, J.; Eder, J. J. Mol. Biol. 2004, 342, 889-899. (144) Arnold, K.; Bordoli, L.; Kopp, J.; Schwede, T. Bioinformatics 2006, 22, 195-201. (145) Sielecki, A. R.; Fujinaga, M.; Read, R. J.; James, M. N. G. J. Mol. Biol. 1991, 219, 671692. (146) Sielecki, A. R.; Fedorov, A. A.; Boodhoo, A.; Andreeva, N. S.; James, M. N. G. J. Mol. Biol. 1990, 214, 143-170. (147) Pomianek, M. E.; Semmelhack, M. F. ACS Chem. Biol. 2007, 2, 293-295. (148) McDonald, D.; Rice, S. A.; Kjelleberg, S. Anal. Bioanal. Chem. 2007, 387, 445-453. (149) Nasser, W.; Reverchon, S. Anal. Bioanal. Chem. 2007, 387, 381-390. (150) Givskov, M.; de Nys, R.; Manefield, M.; Gram, L.; Maximilien, R.; Eberl, L.; Molin, S.; Steinberg, P. D.; Kjelleberg, S. J. Bacteriol. 1996 178, 6618-6622. (151) Koch, B.; Liljefors, T.; Persson, T.; Nielsen, J.; Kjelleberg, S.; Givskov, M. Microbiol. 2005, 151, 3589-3602. (152) Defoirdt, T.; Miyamoto, C. M.; Wood, T. K.; Meighen, E. A.; Sorgeloos, P.; Verstr aete, W.; Bossier, P. Environ. Microbiol. 2007, 9, 2486-2495. (153) Skindersoe, M. E.; Ettinger-Epstein, P.; Rasmussen, T. B.; Bjarnsholt, T.; de Nys, R.; Givskov, M. Mar. Biotechnol. 2008, 10, 56-63.

PAGE 299

299 (154) Interagency Task Force on Antimicrobial Resistance. A Public Heath Action Plan to Combat Antimicrobial Resistance, Part I: Domestic Issues. ONLINE. 2001. Available: http://www.cdc.gov/drugresistance/actionplan/aractionplan.pdf [June 11th 2009] (155) Int. J. Antimicrob. Agents 2003, 21, 297-307. (156) Heinemann, J. A.; Ankenbauer, R. G.; Ambile-Cuevas, C. F. Drug Discov. Today 2000, 5, 195-204. (157) Wilcox, M. D. P.; Zhu, H.; Conibear, T. C. R.; Hume, E. B. H.; Givskov, M.; Kjelleberg, S.; Rice, S. A. Microbiol. 2008, 154, 2184-2194. (158) Diggle, S. P.; Cornelis, P.; Williams, P.; Cmara, M. Int. J. Med. Microbiol. 2006, 296, 83-91. (159) Schuster, M.; Greenberg, E. P. Int. J. Med. Microbiol. 2006, 296, 73-81. (1 60) Schuster, M.; Lostroh, C. P.; Ogi, T.; Greenberg, E. P. J. Bacteriol. 2003, 185, 20662079. (161) Wagner, V. E.; Bushnell, D.; Passador, L.; Brooks, A. I.; Iglewski, B. H. J. Bacteriol. 2003, 185, 2080-2095. (162) Diggle, S. P.; Winzer, K.; Chhabra, S. R.; Worrall, K. E.; Cmara, M.; Williams, P. Mol. Microbiol. 2003, 50, 29-43. (163) Ainslie, R. D.; Barchi, J. J.; Kuniyoshi, M.; Moore, R. E.; Mynderse, J. S. J. Org. Chem. 1985, 50, 2859-2862. (164) Cardellina, J. H.; Dalietos, D.; Marner, F.-J.; Mynderse, J. S.; Moore, R. E. Phytochemistry 1978, 17, 2091-2095. (165) Cardellina, J. H.; Marner, F.-J.; Moore, R. E. J. Am. Chem. Soc. 1979, 101 240-242. (166) Moore, R. E. In Marine Natural Products: Chemical and Biological Perspectives ; Scheuer, P. J., Ed.; Academic Press: New York, 1981; IV, p 1-52. (167) Mynderse, J. S.; Moore, R. E. J. Org. Chem. 1978 43, 4359-4363. (168) Rose, A. F.; Scheuer, P. J.; Springer, J. P.; Clardy, J. J. Am. Chem. Soc. 1978, 100, 76657670. (169) Appleton, D. R.; Sewell, M. A.; Berridge, M. V.; Copp, B. R. J. Nat. Prod. 2002, 65, 630-631. (170) Gallimore, W. A.; Scheuer, P. J. J. Nat. Prod. 2000, 63, 1422-1424.

PAGE 300

300 (171) Gerwick, W. H.; Reyes, S.; Alvarado, B. Phytochemistry 1987, 26, 1701-1704. (172) Kan, Y.; Fujita, T.; Nagai, H.; Sakamoto, B.; Hokama, Y. J. Nat. Prod. 1998, 61, 152155. (173) Li, Y.; Feng, J.-P.; Wang, W.-H.; Chen, J.; Cao, X.-P. J. Org. Chem. 2007, 72, 23442350. (174) McPhail, K. L.; Gerwick, W. H. J. Nat. Prod. 2003, 66, 132-135. (175) Orjala, J.; Nagle, D.; Ge rwick, W. H. J. Nat. Prod. 1995, 58, 764-768. (176) Praud, A.; Valls, R.; Piovetti, L.; Banaigs, B. Tetrahedron Lett. 1993, 34, 5437-5440. (177) Suntornchashwej, S.; Suwanborirux, K.; Isobe, M. Tetrahedron 2007, 63, 3217-3226. (178) Suntornchashwej, S.; Suwanborirux, K.; Koga, K.; Isobe, M. Chem. Asian J. 2007, 2, 114-122. (179) Todd, J. S.; Gerwick, W. H. Tetrahedron Lett. 1995, 36, 7837-7840. (180) Wu, M.; Milligan, K. E.; Gerwick, W. H. Tetrahedron 1997, 53, 15983-15990. (181) Milligan, K. E.; Mrquez, B .; Williamson, R. T.; Davies -Coleman, M.; Gerwick, W. H. J. Nat. Prod. 2000, 63, 965-968. (182) Nogle, L. M.; Gerwick, W. H. J. Nat. Prod. 2003, 66, 217-220. (183) Paul, V. J.; Nelson, S. G.; Sanger, H. R. Mar. Ecol. Prog. Ser. 1990, 60, 23-34. (184) Thack er, R. W.; Nagle, D. G.; Paul, V. J. Mar. Ecol. Prog. Ser. 1997, 147 21-29. (185) Wylie, C. R.; Paul, V. J. Mar. Ecol. Prog. Ser. 1988, 45, 23-32. (186) Braddock, D. C.; Matsuno, A. Synlett 2004, 2521-2524. (187) Wright, A. D.; Coll, J. C. J. Nat. Prod. 1990, 53, 845-861. (188) Feng, J. -P.; Shi, Z.-F.; Li, Y.; Zhang, J.T.; Qi, X. -L.; Chen, J.; Cao, X.-P. J. Org. Chem. 2008, 73, 6873-6876. (189) Dodge, J. A.; Nissen, J. S.; Presnell, M. Org. Syn. 1996, 73, 110-113. (190) Haack, T.; Haack, K.; Diederich, W. E.; Blackman, B.; Roy, S.; Pusuluri, S.; Georg, G. I. J. Org. Chem. 2005, 70, 7592-7604. (191) Harrigan, G. G.; Luesch, H.; Yoshida, W. Y.; Moore, R. E.; Nagle, D. G.; Biggs, J.; Park, P. U.; Paul, V. J. J. Nat. Prod. 1999, 62, 464-467.

PAGE 301

301 (192) MacMillan, J B.; Molinski, T. F. J. Nat. Prod. 2005, 68, 604-606. (193) Sitachitta, N.; Gerwick, W. H. J. Nat. Prod. 1998, 61, 681-684. (194) Jiao, Y.; Yoshihara, T.; Ishikuri, S.; Uchino, H.; Ichihara, A. Tetrahedron Lett. 1996, 37, 1037-1042. (195) Al Dulayymi, J. R.; Baird, M. S.; Jones, K. Tetrahedron 2004, 60, 341-345. (196) Winson, M. K.; Swift, S.; Fish, L.; Throup, J. P.; Jorgensen, F.; Chhabra, S. R.; Bycroft, B. W.; Williams, P.; Stewart, G. S. FEMS Microbiol. Lett. 1998, 163, 185 -192. (197) Kwan, J. C.; Teplitski, M.; Gunasekera, S. P.; Paul, V. J.; Luesch, H. J. Nat. Prod. 2010, 73, 463-466. (198) Rajamani, S.; Bauer, W. D.; Robinson, J. B.; Farrow, J. M.; Pesci, E. C.; Teplitski, M.; Gao, M.; Sayre, R. T.; Phillips, D. A. Mol. PlantMicrobe Interact. 2008, 21, 1184-1192. (199) Rennert, B.; Melzig, M. F. Planta Med. 2002, 68, 767-769. (200) Mh, U.; Schuster, M.; Heim, R.; Singh, A.; Olson, E. R.; Greenberg, E. P. Antimicrob. Agents Chemother. 2006, 50, 3674-3677. (201) Pesci, E. C.; Pearson, J. P.; Seed, P. C.; Iglewski, B. H. J. Bacteriol. 1997, 179, 32173132. (202) Gould, T. A.; Schweizer, H. P.; Churchill, M. E. A. Mol. Microbiol. 2004, 53, 11351146. (203) Pappas, K. M.; Weingart, C. L.; Winans, S. C. Mol. Microbiol. 2004, 53, 755-769. (204) Mavrodi, D. V.; Bonsall, R. F.; Delaney, S. M.; Soule, M. J.; Phillips, G.; Thomashow, L. S. J. Bacteriol. 2001, 183, 6454-6465. (205) Hentzer, M.; Wu, H.; Andersen, J. B.; Riedel, K.; Rasmussen, T. B.; Bagge, N.; Kumar, N.; Schembri, M. A.; Song, Z.; Kristoffersen, P.; Manefield, M.; Costerton, J. W.; Molin, S.; Eberl, L.; Steinberg, P.; Kjelleberg, S.; Hiby, N.; Givskov, M. EMBO J. 2003, 22, 3803-3815. (206) Ochsner, U. A.; Wilderman, P. J.; Vasil, A. I.; Vasil, M. L. Mol. Microbiol. 2002, 45, 1277-1287. (207) Ravel, J.; Cornelis, P. Trends Microbiol. 2003, 11, 195-200. (208) Cornelis, P.; Aendekerk, S. Microbiol. 2004, 150, 752-756.

PAGE 302

302 (209) Juhas, M.; Wiehlmann, L.; Huber, B.; Jordan, D.; Lauber, J.; Salunkhe, P.; Limpert, A. S.; von Gtz, F.; Steinmetz, I.; Eberl, L.; Tmmler, B. Microbiol. 2004, 150 831-841. (210) Schuster, M.; Hawkins, A. C.; Harwood, C. S.; Greenberg, E. P. Mol. Microbiol. 2004, 51, 973-985. (211) Brencic, A.; Lory, S. Mol. Microbiol. 2009, 72, 612-632. (212) Lequette, Y.; Lee, J. H.; Ledgham, F. ; Lazdunski, A.; Greenberg, E. P. J. Bacteriol. 2006, 188, 3365-3370. (213) Heurlier, K.; Dnervaud, V.; Pessi, G.; Reimmann, C.; Hass, D. J. Bacteriol. 2003, 185, 2227-2235. (214) Dziel, E.; Gopalan, S.; Tampakaki, A. P.; Lpine, F.; Padfield, K. E.; Saucier, M.; Xiao, G.; Rahme, L. G. Mol. Microbiol. 2005, 55, 998-1014. (215) Liang, H.; Li, L.; Dong, Z.; Surette, M. G.; Duan, K. J. Bacteriol. 2008, 190, 6217-6227. (216) Heeb, S.; Haas, D. Mol. Plant Microbe Interact. 2001, 14, 1351-1363. (217) Zhu, K.; Choi, K.-H.; Schweizer, H. P.; Rock, C. O.; Zhang, Y.-M. Mol. Microbiol. 2006, 60, 260-273. (218) Kang, Y.; Nguyen, D. T.; Son, M. S.; Hoang, T. T. Microbiol. 2008, 154, 1584-1598. (219) van Delden, C.; Comte, R.; Bally, M. J. Bacteriol. 2001, 183, 5376-5384. (220) Schreiber, K.; Boes, N.; Eschbach, M.; Jaensch, L.; Wehland, J.; Bjarnsholt, T.; Givskov, M.; Hentzer, M.; Schobert, M. J. Bacteriol. 2006, 188, 659-668. (221) Boes, N.; Schreiber, K.; Schobert, M. J. Bacteriol. 2008, 190, 7189-7199. (222) Palma, M.; Zurita, J.; Ferreras, J. A.; Worgall, S.; Larone, D. H.; Shi, L.; Campagne, F.; Quadri, L. E. N. Infect. Immun. 2005, 73, 2958-2966. (223) Dietrich, L. E. P.; Price-Whelan, A.; Petersen, A.; Whiteley, M.; Newman, D. K. Mol. Microbiol. 2006, 61, 1308-1321. (224) Sakuragi, Y.; Kolter, R. J. Bacteriol. 2007, 189, 5383-5386. (225) Ueda, A.; Wood, T. K. PLoS Pathog. 2009, 5, e1000483. (226) Mougous, J. D.; Cuff, M. E.; Raunser, S.; Shen, A.; Zhou, M.; Gifford, C. A.; Goodman, A. L.; Joachimiak, G.; Ordoez, C. L.; Lory, S.; Walz, T.; Joachimiak, A.; Mekalanos, J. J. Science 2006, 312, 1526-1530.

PAGE 303

303 (227) de Bentzmann, S.; Aurouze, M.; Ball, G.; Filloux, A. J. Bacteriol. 2006, 188, 4851-4860. (228) Alm, R.; Mattick, J. S. Gene 1997, 192, 89-98. (229) Inoue, T.; Shingaki, R.; Fukui, K. FEMS Microbiol. Lett. 2008, 281, 81-86. (230) D'Argenio, D. A.; Wu, M.; Hoffman, L. R.; Kalasekara, H. D.; Dziel, E.; Smith, E. E.; Nguyen, H.; Ernst, R. K.; Freeman, T. J. L.; Spencer, D. H.; Brittnacher, M.; Hayden, H. S.; Selgrad e, S.; Klausen, M.; Goodlett, D. R.; Burns, J. L.; Ramsey, B. W.; Miller, S. I. Mol. Microbiol. 2007, 64, 512-533. (231) Gunasekera, S. P.; Miller, M. W.; Kwan, J. C.; Luesch, H.; Paul, V. J. J. Nat. Prod. 2010, 73, 459-462. (232) Littler, D. S.; Littler, M. M. In Caribbean Reef Plants ; Offshore Graphics: Washington, D. C., 2000, p 447-479. (233) Gao, M.; Teplitski, M.; Robinson, J. B.; Bauer, W. D. Mol. PlantMicrobe Interact. 2003, 16, 827-834. (234) Teplitski, M.; Robinson, J. B.; Bauer, W. D. Mol. Plant Microbe Interact. 2000, 13, 637648. (235) Copeland, R. A. In Evaluation of Enzyme Inhibitors In Drug Discovery: A Guide for Medicinal Chemists and Pharmacologists ; Wiley & Sons: Hoboken, 2005, p 48-81. (236) Copeland, R. A. In Evaluation of Enzyme Inhibitors In Drug Discovery: A Guide for Medicinal Chemists and Pharmacologists ; Wiley & Sons: Hoboken, 2005, p 111-140. (237) Watson, D.; MacDermot, J.; Wilson, R.; Cole, P. J.; Taylor, G. W. Eur. J. Biochem. 1986, 159, 309-313. (238) Affymetrix In GeneChip Ex pression Analysis Technical Manual 2009; [Online] http://media.affymetrix.com/support/downloads/manuals/expression_analysis_technical_ manual.pdf p 67-82. (239) Salvi, H.; Karadenizli, A.; Kolayli, F.; Gundes, S.; Ozbek, U.; Vahaboglu, H. J. Med. Microbiol. 2003, 52, 403-408. (240) Alagely, A.; Rajamani, S.; Teplitski, M. Methods Mol. Biol. 2010, In press. (241) Shaw, P. D.; Ping, G.; Daly, S. L.; Cha, C.; Cronan, J. E.; Rinehart, K. L.; Farrand, S. K. Proc. Natl. Acad. Sci. 1997, 94, 6036-6041. (242) Holloway, B. W.; Krishnapillai, V.; Morgan, A. F. Microbiol. Rev. 1979, 43 73-102. (243) Palma, M.; Worgall, S.; Quadri, L. E. N. Arch. Microbiol. 2003, 180, 374-379.

PAGE 304

304 (244) Law, R. H. P.; Zhang, Q.; McGowan, S.; Buckle, A. M.; Silverman, G. A.; Wong, W.; Rosado, C. J.; Langendorf, C. G.; Pike, R. N.; Bird, P. I.; Whisstock, J. C. Genome Biol. 2006, 7, 216.

PAGE 305

305 BIOGRAPHICAL SKETCH Jason Kwan was born in Brighton, United Kingdom, in 1981. He received his Master of Pharmacy degree, with first class honors, from the University of Bath in 2004. He became interested in natural products chemistry during his degree, when he took classes on the subject from D r. Ian Blagbrough and Dr. Mike Rowan. Also during his degree, he worked for a short time on a synthetic chemistry in the lab of Dr. Chris Upton, and later completed his final year masters project in synthetic chemistry with Dr. Steve Husbands. Following this, he completed his pre-registration training at Musgrove Park hospital in Taunton, U.K., and became a qualified pharmacist in 2005. He then joined the Department of Medicinal Chemistry at the University of Florida as a graduate student, and subsequently the lab of Dr. Hendrik Luesch, where he worked on the discovery of natural products from marine cyanobacteria and subsequent biological studies.