<%BANNER%>

Dietary Selenium and Prolonged Exercise Alter Gene Expression and Activity of Antioxidant Enzymes in Equine Skeletal Muscle

Permanent Link: http://ufdc.ufl.edu/UFE0042141/00001

Material Information

Title: Dietary Selenium and Prolonged Exercise Alter Gene Expression and Activity of Antioxidant Enzymes in Equine Skeletal Muscle
Physical Description: 1 online resource (71 p.)
Language: english
Creator: White, Sarah
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: damage, horse, muscle, oxidative, selenoenzyme, selenoprotein
Animal Sciences -- Dissertations, Academic -- UF
Genre: Animal Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Exercise is associated with increased production of reactive oxygen species (ROS), which may negatively affect health and athletic performance if antioxidant mechanisms are overwhelmed. Provision of antioxidants in the diet, such as selenium (Se), may provide a means to combat excessive ROS generated during strenuous exercise. To determine the effects of Se supplementation above current NRC requirements and an acute bout of exercise on measures of oxidative stress in blood and in skeletal muscle, 12 mature, untrained Thoroughbred horses were randomly assigned to either 0.1 (CON) or 0.3 mg Se/kg DM (SEL) for 36 d. Horses were individually fed 1.6% BW/d of coastal bermudagrass hay (0.02 mg Se/kg DM), 0.4% BW/d of whole oats (0.24 mg Se/kg DM), and a mineral/vitamin premix containing no Se. Sodium selenite was added to achieve either 0.1 or 0.3 mg Se/kg DM in the total diet. On d 35, horses underwent 120 min submaximal exercise in a free-stall exerciser (total distance 26 km; heart rate 135 ? 39 bpm). Biopsies of the middle gluteal muscle were obtained before and after 34 d of Se supplementation and on d 35-36 at 6 and 24 h post-exercise to determine gene expression and antioxidant enzyme activity. Gene expression was determined by quantitative real-time PCR using 18S as a reference gene. Blood samples were taken before and after 34 d of Se supplementation and on d 35-36 at 0, 6, and 24 h post-exercise to determine Se status and antioxidant enzyme activity. Serum Se increased in SEL in response to 34 d of supplementation, but remained unchanged in CON. Muscle expression of MT1B and MT3 both increased over 6-fold from pre- to 24 h post-exercise, indicating exercise was sufficient to elicit oxidative stress. TrxR activity increased following Se supplementation in SEL but not in CON, and was not affected by exercise in either group. However, muscle expression of TrxR1 increased 2.5-fold by 24 h post-exercise. Plasma GPx activity remained unchanged in all horses through 6 h post-exercise, but increased by 24 h post-exercise. RBC GPx activity decreased immediately following exercise in SEL and 6 h post-exercise in CON, and remained suppressed in both groups through 24 h post-exercise. Muscle GPx activity increased 6 h after exercise in SEL, followed by a return to baseline 24 h post-exercise, but expression of GPx1 and GPx3 in muscle did not change through 24 h post-exercise. Expression of SOD1 and SOD2 were unchanged through 6 h post-exercise, but expression of both genes increased in CON horses and SOD2 decreased in SEL horses from 6 to 24 h post-exercise. Level of dietary Se had no effect on expression of MT1B, MT3, TrxR1, GPx1, GPx3, SOD1, or SOD2, or on plasma, RBC, or muscle GPx activity. These results indicate that, overall, supplementation of 0.3 mg Se/kg DM for 36 d did not affect antioxidant gene expression or selenoenzyme activity in exercising horses. However, supplemented horses responded differently to exercise than control horses. Se supplementation of performance horses should be investigated further for potential benefits in mitigating exercise-induced ROS production.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sarah White.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Warren, Lori.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042141:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042141/00001

Material Information

Title: Dietary Selenium and Prolonged Exercise Alter Gene Expression and Activity of Antioxidant Enzymes in Equine Skeletal Muscle
Physical Description: 1 online resource (71 p.)
Language: english
Creator: White, Sarah
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: damage, horse, muscle, oxidative, selenoenzyme, selenoprotein
Animal Sciences -- Dissertations, Academic -- UF
Genre: Animal Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Exercise is associated with increased production of reactive oxygen species (ROS), which may negatively affect health and athletic performance if antioxidant mechanisms are overwhelmed. Provision of antioxidants in the diet, such as selenium (Se), may provide a means to combat excessive ROS generated during strenuous exercise. To determine the effects of Se supplementation above current NRC requirements and an acute bout of exercise on measures of oxidative stress in blood and in skeletal muscle, 12 mature, untrained Thoroughbred horses were randomly assigned to either 0.1 (CON) or 0.3 mg Se/kg DM (SEL) for 36 d. Horses were individually fed 1.6% BW/d of coastal bermudagrass hay (0.02 mg Se/kg DM), 0.4% BW/d of whole oats (0.24 mg Se/kg DM), and a mineral/vitamin premix containing no Se. Sodium selenite was added to achieve either 0.1 or 0.3 mg Se/kg DM in the total diet. On d 35, horses underwent 120 min submaximal exercise in a free-stall exerciser (total distance 26 km; heart rate 135 ? 39 bpm). Biopsies of the middle gluteal muscle were obtained before and after 34 d of Se supplementation and on d 35-36 at 6 and 24 h post-exercise to determine gene expression and antioxidant enzyme activity. Gene expression was determined by quantitative real-time PCR using 18S as a reference gene. Blood samples were taken before and after 34 d of Se supplementation and on d 35-36 at 0, 6, and 24 h post-exercise to determine Se status and antioxidant enzyme activity. Serum Se increased in SEL in response to 34 d of supplementation, but remained unchanged in CON. Muscle expression of MT1B and MT3 both increased over 6-fold from pre- to 24 h post-exercise, indicating exercise was sufficient to elicit oxidative stress. TrxR activity increased following Se supplementation in SEL but not in CON, and was not affected by exercise in either group. However, muscle expression of TrxR1 increased 2.5-fold by 24 h post-exercise. Plasma GPx activity remained unchanged in all horses through 6 h post-exercise, but increased by 24 h post-exercise. RBC GPx activity decreased immediately following exercise in SEL and 6 h post-exercise in CON, and remained suppressed in both groups through 24 h post-exercise. Muscle GPx activity increased 6 h after exercise in SEL, followed by a return to baseline 24 h post-exercise, but expression of GPx1 and GPx3 in muscle did not change through 24 h post-exercise. Expression of SOD1 and SOD2 were unchanged through 6 h post-exercise, but expression of both genes increased in CON horses and SOD2 decreased in SEL horses from 6 to 24 h post-exercise. Level of dietary Se had no effect on expression of MT1B, MT3, TrxR1, GPx1, GPx3, SOD1, or SOD2, or on plasma, RBC, or muscle GPx activity. These results indicate that, overall, supplementation of 0.3 mg Se/kg DM for 36 d did not affect antioxidant gene expression or selenoenzyme activity in exercising horses. However, supplemented horses responded differently to exercise than control horses. Se supplementation of performance horses should be investigated further for potential benefits in mitigating exercise-induced ROS production.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sarah White.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Warren, Lori.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042141:00001


This item has the following downloads:


Full Text

PAGE 1

1 DIETARY SELENIUM AND PROLONGED EXERCISE A LTER GENE EXPRESSION AND ACTIVITY OF ANTI OXIDANT ENZYMES IN E QUINE SKELETAL MUSCL E By SARAH WHITE A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Sarah White

PAGE 3

3 To Ms. Sandi White, my loving and caring Mother, whose support and faith were instrumental in my success thus far

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisor, Dr. Lori Warren for her guidance and encouragement. I would also like to thank my Mothe r, Ms. Sandi White, for helping to label endless numbers of microcentrifuge tubes. Lastly, this project would not have been possible without Jill Bobel, Jan Kivipelto, Jennifer Skelton, and the undergraduate volunteers who helped throughout the study, espe cially on exercise days.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 6 LIST OF FIGURES ................................ ................................ ................................ .......... 7 LIST OF ABBREVIATIONS ................................ ................................ ............................. 8 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 11 Oxidative Stress ................................ ................................ ................................ ...... 11 Exercise and Oxidative Stress ................................ ................................ ................ 13 Role of Selenium ................................ ................................ ................................ .... 19 Effects of Selenium Supplementation on Antioxidant Status ................................ .. 21 Selenium Supplementation and Exercise ................................ ............................... 25 2 INTRODUCTION ................................ ................................ ................................ .... 33 3 MATERIALS AND METHODS ................................ ................................ ................ 36 Horses ................................ ................................ ................................ .................... 36 Dietary Treatments ................................ ................................ ................................ 36 Exercise Test ................................ ................................ ................................ .......... 37 Sample Collection ................................ ................................ ................................ ... 38 Serum Se ................................ ................................ ................................ ................ 39 G ene Expression in Skeletal Muscle ................................ ................................ ....... 40 GPx and TrxR Activities ................................ ................................ .......................... 41 Statistical Analyses ................................ ................................ ................................ 42 4 RESULTS ................................ ................................ ................................ ............... 47 5 DISCUSSION ................................ ................................ ................................ ......... 57 APPENDIX: RNA ISOLATION USING STAT 60 AND RNEASY M ICRO KIT ............... 63 LIST OF REFERENCES ................................ ................................ ............................... 64 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 71

PAGE 6

6 LIST OF TABLES Table page 1 1 Functions of selenoproteins identified in humans ................................ ............... 29 3 1 Nutrient composition of basal diet feeds and sodium selenite supplement ......... 44 3 2 Sequence of equine specific PCR primers used for measurement 18S, MT1B, MT3, TrxR1, GPx1, GPx3, SOD1, and SOD2 mRNA content. ................ 45 4 1 Fold changes in gene expression observed in equine middle gluteal muscle from pre exercise to 6 h and 24 h post exercise across all treatments. .............. 49 4 2 GPx and TrxR activity in plasma, RBC lysate and skeletal muscle of horses before (d 0) and after 34 d of supplementation with either 0.1 mg Se/kg DM (CON) or 0.3 mg (SEL) Se/kg DM ................................ ................................ ...... 50

PAGE 7

7 LIST OF FIGURES Figure page 1 1 Metabolism of selenomethionine, selenite, and selenate. ................................ .. 30 1 2 Diagram of oxidant and antioxidant systems in the cell ................................ ..... 31 1 3 Schematic of the many functions of the thioredoxin reductase f amily in the body ................................ ................................ ................................ .................... 32 3 1 Diagram of the biopsy site from the middle gluteal muscle of the horse.. ........... 46 4 1 Serum Se concentration before and after 34 d of supp lementation with either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM to horses ................................ ................. 51 4 2 MT1B (A) and MT3 (B) expression in equine middle gluteal muscle before exercise and at 6 and 24 h post exercise in horses receiving either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise ............................... 52 4 3 TrxR1 (A), GPx1 (B), and GPx3 (C) expression in equine middle gluteal muscle before exercise and at 6 and 24 h post exercise in horses receiving either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise. .............. 53 4 4 SOD1 (A) and SOD2 (B) expression in equine middle gluteal muscle before exercise and at 6 and 24 post exercise in horses receiving e ither 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise. ................................ ......... 54 4 5 GPx activity in plasma (A), RBC lysate (B), and middle g luteal muscle (C) before exercise, and 0, 6 and 24 h post exercise in horses fed either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise ............................... 55 4 6 TrxR activity in the middle gluteal muscle before exercise, and at 6 and 24 h post exercise in horses fed either 0.1 (CON) or 0.3 (SEL) mg Se/k g DM for 34 d prior to exercise ................................ ................................ .......................... 56

PAGE 8

8 LIST OF ABBREVIATION S 18S Equine reference gene CK Creatine kinase GPx1 Glutathione peroxidase 1; active in cytoplasm GPx3 Glutathione peroxidase 3; active in plasma and other extracellular fluids MT1B Metallothionein 1B MT3 Metallothionein 3 RBC Red blood cell ROS Reactive oxygen species Se Selenium SeCys Selenocysteine SeMet Selenomethionine SOD1 Copper zinc superoxide dismutase; in cytoplasm SOD2 Manganese superoxide dismutase; in mitocho ndria SOD3 Extracellular superoxide dismutase; not found in horse genome TrxR Thioredoxin reductase

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science LEVEL OF DIETARY SELENIUM AND PROLONGED EXERCISE ALTER GENE EXPRESSION AND ACTIVITY OF ANTIOXIDANT ENZYMES IN EQUINE SKELETAL MUSCLE By Sarah White August 2010 Chair: Lori Warren Major: Animal Science s Exercise is associated with increased production of reactive oxygen species (ROS), which may negatively affect health and athletic performance if antioxidant mechanisms are overwhelmed. Provision of antioxidants in the diet, su ch as selenium (Se), may provide a means to combat excessive ROS generated during strenuous exercise. To determine the effects of Se supplementation above current NRC requirements and an acute bout of exercise on measures of oxidative stress in blood and i n skeletal muscle, 12 mature, untrained Thoroughbred horses were randomly assigned to either 0.1 (CON) or 0.3 mg Se/kg DM (SEL) for 36 d. Horses were individually fed 1.6% BW/d of coastal bermudagrass hay (0.02 mg Se/kg DM), 0.4% BW/d of whole oats (0.24 m g Se/kg DM), and a mineral/vitamin premix containing no Se. Sodium selenite was added to achieve either 0.1 or 0.3 mg Se/kg DM in the total diet. On d 35, horses underwent 120 min submaximal exercise in a free stall exerciser (total distance 26 km; heart r ate 135 39 bpm). Biopsies of the middle gluteal muscle were obtained before and after 34 d of Se supplementation and on d 35 36 at 6 and 24 h post exercise to determine gene expression and antioxidant enzyme activity. Gene

PAGE 10

10 expression was determined by q u antitative real time PCR using 18S as a reference gene. Blood samples were taken before and after 34 d of Se supplementation and on d 35 36 at 0, 6, and 24 h post exercise to determine Se status and antioxidant enzyme activity. Serum Se increased in SEL in response to 34 d of supplementation, but remained unchanged in CON. Muscle expression of MT1B and MT3 both increased over 6 fold from pre to 24 h post exercise, indicating exercise was sufficient to elicit oxidative stress. TrxR activity increased follow ing Se supplementation in SEL but not in CON, and was not affected by exercise in either group. However, muscle expression of TrxR1 increased 2.5 fold by 24 h post exercise. Plasma GPx activity remained unchanged in all horses through 6 h post exercise, bu t increased by 24 h post exercise. RBC GPx activity decreased immediately following exercise in SEL and 6 h post exercise in CON, and remained suppressed in both groups through 24 h post exercise. Muscle GPx activity increased 6 h after exercise in SEL fo llowed by a return to baseline 24 h post exercise, but expression of GPx1 and GPx3 in muscle did not change through 24 h post exercise. Expression of SOD1 and SOD2 were unchanged through 6 h post exercise, but expression of both genes increased in CON horses and SOD2 decreased in SEL horses from 6 to 24 h post exercise. Level of dietary Se had no effect on expression of MT1B, MT3, TrxR1, GPx1, GPx3, SOD1, or SOD2 o r on plasma, RBC, or muscle GPx activity. These results indicate that, overall, supplementation of 0.3 mg Se/kg DM for 36 d did not affect antioxidant gene expression or selenoenzyme activity in exercising horses. However, supplemented horses responded dif ferently to exercise than control horses. Se supplementation of performance horses should be investigated further for potential benefits in mitigating exercise induced ROS production.

PAGE 11

11 CHAPTER 1 LITERATURE REVIEW Wit h its temperate climate and abundance of flat terrain, Florida is a popular destination for many horse owners and trainers alike. Currently, Florida is home to over 500,000 horses, with over 60% involved in racing and competition (AHCF 2005). ine industry has an estimated $5.1 billion economic impact on the gross domestic product (AHCF 2005). The substantial presence of horses used in athletic population have creat ed a need for management strategies that optimize the health and performance of sport horses. Many performance horses undergo extreme physical exertion and must be cared for accordingly. One concern is muscle and tissue damage associated with exercise indu compete. Consumption of key antioxidant nutrients is necessary to replenish and result, ther e is interest in developing strategies to alleviate oxidative stress through dietary manipulation. It is possible that oxidative stress can be mitigated by dietary supplementation with nutritional antioxidants. Free radicals and reactive oxygen species are neutralized by a complex antioxidant system in the body, which is dependent on diet to replenish and sustain antioxidant capacity. Oxidative Stress A free radical is an atom, molecule, or ion with unpaired electrons. They include superoxide (O 2 ) hydrogen peroxide (H 2 O 2 ) the hydroxyl radical ( OH) and nitric oxide (NO) Those that contain oxygen in a more reactive state than molecular oxygen are

PAGE 12

12 known as reactive oxygen species (ROS). Free radicals are continuously produced from a multitude of co mmon events in the body, including aerobic metabolism and phagocytic bursts that destroy in tracellular pathogens (McDowell 2000). They are also responsible for some cell signaling pathways, known as redox signaling (Pacher et al. 2007). Under normal conditions free radical and ROS production with no deleterious consequences. However, an overproduction of ROS can lead to an imbalance in the prooxidant to antioxidant ratio, known as oxidative stress (Si es 1991). During oxidative stress conditions, free radicals and ROS can damage cellular components, such as DNA, proteins, and lipids. In humans, ROS have been implicated in cardiovascular disease, diabetes, c ancer, and aging (Young and Woodside 2001 ). In horses, excess ROS are associated with recurrent airway obstruction (commonly referred to as heaves), equine grass sickness (dysautonomia), equine motor neuron disease, equine degenerative myeloencephalopathy, and white muscle disease, to name a few (Kirsc hvink et al. 2008). Exertional myopathies (referred muscle; however, research has yet to demonstrate a clear cause and effect relationship. These diseases can be detrim ental to a performance horse, leading to lost training time or a severe decrease in performance which may cause a horse to lose a race or competition. Considering the average purse per race in the U.S. in 2009 was over $22,000 ( 2010 Online Factbook 2010), this can have a significant economic impact on the sport horse industry It would stand to reason that any activity that increases oxygen consumption would lead to an increase in ROS production. Yet, studies have shown that elevated

PAGE 13

13 levels of ADP, which ar e associated with rapid oxygen consumption, do not necessarily lead to increased mitochondrial oxidant produc tion (Leeuwenburgh and Heinecke 2001). Nonetheless the rate of superoxide production does greatly increase during contractile activity in skeletal muscle, leading to an increase in ROS. Low levels of ROS are necessary in skeletal muscle to maximize force but at high levels ROS decrease force produ ction and lead to fatigue (Reid 2001). Therefore, sufficient antioxidant mechanisms are important for c ounterbalancing free radical and ROS production during exercise in order to optimize performance. Exercise and Oxidative Stress Performance horses undergo strenuous exercise almost daily. For example, h orses in endurance training travel upwards of 160 km every week in preparation for a race. Horses in dressage training, which is a combination of strength and muscle endurance, tend to work 5 6 days per week for about an hour each day. Thoroughbred r acehorses in training generally work 6 days per week, trave lling from 100 150 km/wk (Evans 2002). H orses undergo ing intensive exercise training warrant s pecial consideration, just as extra care is given to human athletes in order to maximize their welfare and performance. Exercise causes an increase in ROS in skel etal muscle due, in part, to the ROS as int ermediates (Leeuwenburgh et al. 1999; Bejma and Ji 1999; Lawler and Powers 1998). Recent studies have also indicted xanthine oxidase (XO) as a notable contributor of free radicals during exercise under hypoxic conditions or exercise with decreased b lood flow (Gomez Cabrera et al. 2008; Ji 1999). In mice, artificial stimulation of the g astrocnemius muscle for 15 min caused a sig nificantly higher release

PAGE 14

14 of the superoxide anion by the contracting muscle com pared to the control, resting g astrocnemius muscle. Muscle superoxide dismutase (SOD) activity slowly increased following stimulation, peaking at 12 h after the con tractions end ed (McArdle et al. 2001). with an increase in oxidative stress. To examine the effect of exercise on oxidative stress in dogs, Hinchcliff et al. (2000) exercised 16 sled dogs for 58 km on each of 3 consecutive days. After exercise dogs had higher plasma isoprostanes, an indicator of lipid peroxidation, higher serum creatine kinase (CK) an indicator of muscle fiber damage, and lower plasma vitamin E, a potent antioxi dant. Levels of these markers did not change in non exercised control dogs over the same period. These results indicate a 58 km run for 3 consecutive days was sufficient to induce oxidative stress in trained sled dogs. White et al. (2001) conducted a study with similar objectives in which 30 healthy racehorses completed a 1000 200 m simulated race. Following exercise, plasma CK activity and plasma TBARS, a measure of oxidative damage, increased significantly. Collectively, t hese studies indicate that both prolonged and short duration intensive exercise increase ROS production and subsequently, oxidative stress in vivo. A novel method by which to measure oxidative stress is by evaluating the up or down regulation of gene expression in response to exercise. Mahoney et al. (2005) performed a microarray on muscle collected from the vastus lateralis of nontrained, healthy men following a high intensity 75 min cycling bout. Biopsies were taken 1 2 wk before, and 3 and 48 h after cycling. Cycling significantly in creased the expression of seven different metallothionein (MT) genes at 3 h post cycling. In agreement, previous studies indicate that oxidative stress agents increase MT protein concentrations in

PAGE 15

15 various tissues in mice (Bauman et al. 1991). Further, MTI III has been shown to react with hydroxyl radicals to protect against DNA damage and to scavenge superoxide radicals (You et al. 2002). Since Mahoney et al. (2005) were able to demonstrate that MT mRNA is up regulated during exhaustive aerobic exercise, most likely induced by an increase in free radicals, it may be meaningful to evaluate gene expression to determine levels of oxidative stress in tissue. This technology can also be used to evaluate effects of training on measures of oxi dative damage. Because muscle glycogen stores can be depleted during endurance exercise, the body switches from a state of glycogen utilization to fat oxidation to spare glucose for glycogenesis, especially during recovery. In response to endurance (aerobi c) training, mitochondrial density increases and the body increases its ability to mobilize, transport, and utilize lipids as energy sources. Since the mitochondrial electron transport chain and lipolysis both increase production of ROS (Leeuwenburgh and H einecke 2001; Wang et al. 2008), both of these adaptations have the potential to increase oxidative stress. In support of this theory, untrained Thoroughbred horses performed an incremental step exercise test on a treadmill in a study conducted by Eivers e t al. (2010 ). A biopsy was taken from the gluteus medius muscle before exercise, immediately following exercise, and 4 h post exercise. Expression of COX411 and COX412 genes both of which function in oxidative phosphorylation, were evaluated in response t o exercise. These researchers noted a significant decrease in COX412 mRNA 4 h post exercise paired with a simultaneous increase in COX411 mRNA, which is a common response under normal oxygen concentrations during exercise. However,

PAGE 16

16 following 10 mo of endur ance training, basal COX411 expression increased. Since mitochondrial COX4 concentration is directly relate d to mitochondrial density, an increase in COX411 expression may suggest a long term adaptation to training by increasing mitochondrial volume. While these researchers did not investigate any genes related to oxidative stress, such an increase in basal mitochondrial density could lead to an increased basal oxidative stress load. To evaluate the effect of training on mitochondrial oxidative stress, Tonk onogi et al. (2000) conducted a study in which 8 healthy, u ntrained humans underwent 6 wk of endurance training. Performance tests were conducted before and 2 d after the training period. Muscle biopsies were taken 48 h after each performance test from the quadriceps femoris muscle. Endurance training had no effect on glutathione peroxidase (GPx) or SOD activity in skeletal muscle, and actually decreased when expressed per mitochondrion. Further, ROS treatment caused a larger increase in state 4 (resting) r espiration after training indicating the mitochondrial membrane may be more susceptible to oxidative damage following 6 wk of endurance training. However, ROS may be an important factor in eliciting antioxidant defense adaptations and 6 wk may not be long enough for these changes to take place. Contrasting results were found in a study conducted by Gore et al. (1998) in which antioxidant enzymes were evaluated in rats following 10 wk of endurance training. Twenty seven hours after the final training sessio n, rats were killed and deep (DVL) and superficial (SVL) portions of the vastus lateralis muscle were removed. Mitochondrial MnSOD (SOD2) activity and SOD2 expression in both muscle groups were not different between trained and untrained rats following 10 wk of endurance

PAGE 17

17 training. However, training increased SOD2 protein content in DVL, but not in SVL. Conversely, cystolic CuZnSOD (SOD1) activity and SOD1 expression both increased in response to training in the DVL, but not in the SVL, yet SOD1 protein cont ent was not altered in DVL but increased in SVL. GPx activity followed a trend similar to SOD1 activity, increasing in DVL but not in SVL, but GPx expression did not change in either muscle group. These results indicate adaptations to training are multifac eted, affect isozymes differently, and may occur at pre or post transcriptional levels. They also highlight the fact that gene expression alone may not be sufficient to reach definitive conclusions regarding changes in antioxidant enzyme activity or abund ance in tissues. The previous studies utilized endurance training but it is also important to consider that other types of exercise training may affect antioxidant adaptations in the body differently. Endurance training generally consists of submaximal predominantly aerobic bouts of exercise interspersed with periods of rest during which the body can repair tissue damage. For this reason, antioxidant adaptations may take longer to respond to endurance training versus rapid, intense training in which larg er volumes of ROS may be produced in a very short time period. Hellsten et al. (1996) observed no change in GPx activity in the vastus lateralis muscle in humans after 6 wk of cycl e sprint training performed once per day, 3 d/wk. However, 24 h after one we ek of intensive cycle sprint training performed twice a day for 7 consecutive days, GPx activity increased but returned to baseline 48 h later. Although intense sprint training may immediately elicit increases in antioxidant status, if the training is not maintained, basal antioxidant status remains unchanged.

PAGE 18

18 A study conducted by de Moffarts et al. (2004) highlighted that different intensities of training also have the potential to effect antioxidant status differently. These researchers evaluated the effe ct of a strenuous exercise test on blood antioxidant markers in Standardbred horses before training (sedentary), after 4 wk of light exercise training, and after an additional 8 wk of interval training. The initial exercise test (before training) caused no change in GPx or SOD activity. Following 4 wk of light work, SOD activity increased in response to exercise testing, with a further increase in SOD activity after an additional 8 wk of interval training. GPx activity also increased after 4 wk of light exe rcise, but remained at that same level after the additional 8 wk of interval training. This study exemplifies the fact that different training intensities and techniques cause adaptations that allow horses to improve their antioxidant status at different r ates. Also, some antioxidant enzyme systems may reach their maximum efficiency in less time than others. While training can stimulate adaptations to protect tissues from the increased level of ROS produced during exercise, training alone may not be suffic ient to protect performance horses from high oxidative stress loads. This may be particularly evident during competitions that are more intense than the training itself (e.g., a horse running the Kentucky Derby does not actually run a mile and 1/16 th at fu ll speed while training for this prestigious race), or when environmental conditions are dissimilar between training and competition (e.g., U.S. Equestrian Team competing at the Olympic games in Beijing). In addition, stress associated with travel to the s ite of competition, adaptation to unfamiliar housing and altered routines during competition, and increased disease exposure from comingling of horses at competition sites also adds to the oxidative

PAGE 19

19 stress load experienced by performance horses. As a resul t, dietary provision of antioxidants is likely necessary to maintain sufficient antioxidant status in even the most fit, well trained performance horses. Role of Selenium Selenium is active in the body as a p art of many different selenoproteins ( McDowell 2003 ). Twenty five different selenoprotein genes have been identified in the human genome, but the functions of all of the proteins involved hav e yet to be identified (Table 1 1) (Gromadzinska et al. 2008). To be incorporated into selenoproteins, dietary S e sources must be inserted into cysteine where Se replaces the thiol ( SH) side chain thus forming the amino acid residue selenocysteine (SeCys). Inorganic forms of Se (i.e., selenite and selenate) must first be reduced to selenide before being incorporat ed into SeCys residues whereas organic forms of Se (i.e., SeCys and selenomethionine (SeMet)) are immediately available for p rotein synthesis (Suzuki et al. 2006; McDowell 2003). Selenite is the most common inorganic form of Se supplemented to horses, no rmally in the form of sodium selenite. Apparent absorption of selenite in mature horses was reported to be 51.1% (Pagan et al. 1999). Selenite is passively absorbed (Wolffram 1999) As stated above, selenite must first join with cysteine to form SeCys befo re it can be inco rporated into tissues. SeMet is the most common organic form of Se fed to horses, as it is the most prevalent in plan ts and yeast (Richardson et al. 2006). Apparent absorption of SeMet was shown to be 57.3% in horses, only slightly higher than selenite (Pagan et al. 1999 ). Once ingested, SeMet is actively transferred through the intestinal membrane and can replace methionine (Met) during protein synthesis (Schrauzer 2003). However, Se is not catalytically active in the SeMet form

PAGE 20

20 and must b e converted to SeCys, then reduced to selenide before it is me tabolically available (Figure 1 1) (Rayman 2000; Schrauzer 1998 ). The difference in metabolism between inorganic and organic Se sources likely explains studies that have found that dietary sodiu m selenite is more rapidly incorporated into GPx in serum, but not as prevalent in tissues. Conversely, SeMet is not as bioavailable in serum GPx, but is better incorporated into tissues for poss ible storage (Richardson et al. 2006; Mahan et al. 1999). O nce Se is incorporated into a selenoprotein, it can become biologically active in selenoproteins include the GPx and TrxR isozymes A main function of GPx is to detoxify hydrogen p eroxide to nontoxic elements (water and glutathione disulfide) (Figure 1 2) (Urso and Clarkson 2003). The antioxidant properties of the TrxR enzymes include the prevention of apoptosis in cells subjected to agents know n to produce ROS. It has also been sug gested that TrxR acts as the first line of defense against free radicals produced in response to UV light on human skin (Mustacich and Powis 2000) The many physiological functions of TrxR are presented in Figure 1 3 (Nordberg and Arner 2001). Selenium sup plementation acts through GPx and TrxR to protect cells from oxidative damage (Lewin et al. 2002). The current NRC (2007) Se requirement for horses is 0.1 mg Se/kg DM, which is lower than the requirement of 0.3 mg/kg DM recommended for other livestock. Th e Se requirement for horses is based on an early study by Stowe (1967) whereby dietary Se intake was plotted against serum Se concentrations in horses of varying physiological states. The estimated requirement of 0.1 mg Se/kg DM was confirmed in a study

PAGE 21

21 co nducted by Shellow et al. (1985) in which mature, sedentary horses received a basal diet containing 0.06 mg Se/kg DM plus sodium selenite at 0, 0.05, 0.1, or 0.2 mg Se/kg DM. Plasma Se reached a plateau of 0.14 g/mL by 8 wk of supplementation in horses su pplemented with either 0.1 or 0.2 mg Se/kg DM. Since serum Se concentration of 0.14 g/mL was reported to be sufficient to prevent problems linked to Se deficiency in horses, the authors concluded there would be no advantage to supplementing more than 0.1 mg Se/kg DM. More recently, Janicki et al. (2001) found foals from mares receiving 3 mg Se/d compared to 1 mg Se/d had greater influenza antibody concentrations, suggesting a higher level of dietary Se may be necessary in some horses to maximize immune fun ction. Further research is needed to determine the most advantageous rate of Se supplementation for different classes of horses. Effects of Selenium Supplementation on Antioxidant Status Because Se is an effective antioxidant, there is interest in supplem enting performance horses with Se to combat the damaging effects of oxidative stress and to aid in skeletal muscle repair following exercise. As with many supplements, Se can be injected I.M. or administered orally. Use of injectable products administered immediately popularity. However, in April 2009 21 polo ponies in South Florida suddenly died or had to be euthanized after receiving an injectable supplement containin g an acutely toxic level of Se. The error in the injectable product resulted from a miscalculation (a simple shifting of the decimal place) by the compounding pharmacy and highlights the narrow Se toxicity. This disaster was widely publicized, causing many in the equine industry to become more

PAGE 22

22 cautious of injectable Se. Such incidents have also increased interest in the safety and effectiveness of oral Se supplements. As previously mentioned, Se can be orally supplemented in two forms: organic or inorganic. There have been a handful of studies that have investigated the effects of Se dose on Se status and antioxidant capacity in horses. Calamari et al. (2009) fed mature, sedentary horses two different levels of dietary Se: control horses received a basal diet containing 0.085 mg Se/kg DM and supplemented horses received the basal diet plus sodium selenite to achieve 0.288 mg Se/kg DM in the total diet. These researchers noted that after 28 d of supplementation, horses receiving 0.288 mg Se/kg DM in the form of sodium selenite had higher whole blood Se and plasma Se concentrations than control horses. Further, whole blood GPx1 and plasma GPx3 activities were higher in supplemented horses compared with control horses at 28 d and remained elevated throu ghout 112 d of supplementation. In a concurrent study, Calamari et al. (2010) reported the effects of 0 .0 85 or 0.288 mg Se/kg DM on measures of plasma oxidative status, markers of inflammatory status, and enzyme activities in sedentary horses These researchers obser ved no effect of Se dose on plasma reactive oxygen metabolites (measured as mg H 2 O 2 /100 mL) plasma CK activity, or plasma aspartate aminotransferase (AST) activity after 112 d of supplementation. The results reported by these researchers indicate that eve n though Se is represented in circulating blood following supplementation, it may not necessarily actively protect skeletal muscle and other tissues from oxidative damage. However, it is worth noting that these horses were sedentary and not subjected to an y form of increased oxidative load Thus, although available Se appeared to be elevated in circulation, it may not have been necessary fo r

PAGE 23

23 which is below the NRC (2007) requirement of 0.1 mg/kg DM, which may also explain the increase in Se status in the supplemented horses. Although it is important to have Se in circulation, it may also be necessary to have stores in the body that are available in times of increased oxida tive stress. Richardson et al. (2006) fed 18 mo old horses either a control diet, containing 0.15 mg Se/kg DM, or a supplemented diet, containing the control diet plus 0.45 mg Se/kg DM ( i.e., 0.60 mg Se/kg DM in the total diet) in the form of sodium seleni te, for 56 d. These researchers found that plasma Se increased in supplemented animals after 28 d, with no changes observed in control horses. In contrast to Calamari et al. (2009), Richardson et al. (2006) did not observe a change in plasma GPx3 activity in response to a higher level of Se supplementation, but did observe an increase in red blood cell (RBC) GPx1 activity after 56 d of supplementation with 0.60 mg Se/kg DM. Muscle biopsies from the middle gluteal muscle were also evaluated by Richardson et al. (2006) but dietary Se level had no effect on muscle Se or muscle GPx1 activity One explanation for the difference in results between the two research groups may be the fact that since the horses in the second study were immature, they may have been s ubjected to higher levels of oxidative stress through normal growing processes than the mature horses in the first study. Also, younger horses tend to be more physically active than mature horses, which could result in greater oxidative challenge to tissue s Therefore, younger horses may deplete GPx stores more quickly than mature horses because of their increased oxidative stress load. Unfortunately, due to the somewhat invasive nature of muscle biopsy procedures, further studies are not available to permi t

PAGE 24

24 comparison of the effects of Se supplementation on GPx activity in skeletal muscle in horses. Several studies using rodent models have examined the effects of Se supplementation on muscle Se status and antioxidant markers. Whanger and Butler (1988) supp lemented rats with 0.2, 1.0, 2.0, or 4.0 mg Se/kg diet as sodium selenite for 9 wk. The supplementation was in addition to their basal diet, which contained 0.02 mg Se/kg diet. These researchers observed an increase in hind leg muscle Se with increasing su pplemental Se up to 1.0 mg Se/kg diet, after which muscle Se plateaued. Muscle GPx activity also increased with supplementation of 0.2 mg Se/kg diet and remained at that concentration, regardless of level of supplementation. Similarly, the Se concentration in RBC increased with increasing dietary Se, but RBC GPx activity reached a plateau at 0.2 mg Se/kg diet. In a study investigating similar parameters in chickens, chicks were fed a basal diet containing 0.017 mg Se/kg diet and 5.7 mg vitamin E/kg diet (Av anzo et al. 2001). They were then split into 4 dietary treatments receiving either 0 or 10 mg/kg added vitamin E as dl tocopherol acetate and either 0 or 0.15 mg/kg diet added Se as sodium selenite. Following 4 weeks of supplementation, chicks receiving only added Se had the highest GPx activity in the pectoralis muscle of all the groups. Chicks receiving no supplementation exhibited the highest muscle SOD1 and SOD2 activities and lowest GPx activity, possibly indicating SOD activity increases with Se and vitamin E deficiency, sparing the GPx system. In horses, Se requirements are currently based on plasma or serum Se concentrations, with some consideration of GPx activity in plasma or RBC. Research

PAGE 25

25 has concluded that supplementing Se increases circulating Se, up to a point. However, serum Se concentrations may not be the best indicator of status. While it has been reported that serum Se concentrations of 0.14 g/mL in horses are sufficient to protect from diseases caused by Se deficiency, the optimal suppl ementation rate to achieve antioxidant benefits during exercise has yet to be determined. Circulating Se is important, but there may be more sensitive indicators of Se status in regard to different classes of horses. Selenium Supplementation and Exercise Supplementation of Se has been shown to increase Se status in the body. This is only important, however, if the increase in Se is accompanied by an increase in its antioxidant activity. Since exercise has been shown to increase oxidative stress, it serves as a functional model to evaluate the effectiveness of Se supplementation to protect against oxidative damage. Unfortunately, equine exercise trials tend to be difficult and time consuming. Consequently, there have been few exercise trials in horses evalua ting antioxidant status due to exercise alone, and even fewer studies evaluating Se supplementation and exercise in horses. One such study was conducted by de Moffarts et al. (2005) in which trained Thoroughbred racehorses received an antioxidant suppleme nt that provided 7 mg Se and 7000 mg tocopherol acetate per day. Horses remained in their normal training and racing program throughout the study and were sampled for blood antioxidant markers and indicators of muscle soundness at 0, 6, and 12 wk. Plasma CK did not change during the 12 wk observation period in supplemented horses, indicating no increase in muscle damage. In non supplemented horses, plasma CK increased at 6 wk

PAGE 26

26 to a level higher than supplemented horses but returned to baseline by 12 wk. Pl asma Se increased in supplemented horses by 6 wk, remained elevated at 12 wk, and was higher at both time points than non supplemented horses. RBC SOD activity decreased in all horses by 12 wk but was not affected by treatment. RBC GPx activity decreased i n non supplemented horses by 6 wk and remained low at 12 wk while GPx activity in supplemented horses increased by 12 wk. This may indicate an inverse relationship between SOD activity and GPx activity depending on antioxidants provided in the diet. A simi lar inverse relationship between these two enzyme systems was reported by Avanzo et al. (2001) in chickens receiving no supplemental vitamin E or Se where muscle SOD activity increased when GPx activity decreased. Because the antioxidant supplement provide d to horses by de Moffarts et al. (2005) contained multiple antioxidant vitamins and minerals, it is difficult to determine if one nutrient was responsible for the effects on enzyme activities or if the combination of nutrients elicited the effects observe d. Further, exercise training improves antioxidant systems in the body (Ji 1999; Leeuwenburgh and Heinecke 2001), which may have had a positive effect on some enzyme activities. However, this study did utilize a negative control that should highlight any e ffects caused by training alone. Reddy et al. (1998) supplemented rats with one of four diets: vitamin E deficient ( E), Se deficient ( Se), vitamin E and Se deficient ( E Se), or vitamin E and Se supplemented (+E +Se). After 12 wk on these diets, half o f the rats from each group were subjected to a swimming exercise program to exhaustion. Following 12 wk of supplementation, lung GPx activity was highest in +E +Se, but was not affected by exercise. Lung SOD activity was lowest in +E +Se and increased afte r exercise but was

PAGE 27

27 still lower in the +E + Se rats compared to the other diets. This inverse relationship between SOD and GPx activity is similar to Avanzo et al. (2001) and de Moffarts et al. (2005). However, this study only compared Se deficient rats wit h Se sufficient rats, which is common among most studies previously conducted. It is expected that deficient animals would not perform as well as animals whose dietary requirements are met. However, these studies have demonstrated that Se supplementation i ncreases GPx activity during exercise and protects muscle tissue from oxidative damage. Research investigating the effects of Se only supplementation on exercise induced oxidative damage is virtually non existent. Most previous studies utilizing exercise as a model to increase oxidative stress have investigated dietary supplements containing multiple antioxidants. However, this makes it difficult to determine which antioxidant was responsible for the effect (if any) on measured variables. Research is need ed to determine if Se alone is a useful dietary antioxidant. Previous studies have also compared Se deficient animals with Se sufficient animals. This is useful for determining minimum Se requirements but rate of supplementation above requirements must als o be investigated for potential benefits in performance. Another feature of most previous research investigating exercise and antioxidants is the use of acute, exhaustive exercise. Since the body reacts differently to prolonged exercise, such as endurance, it too must be evaluated. The majority of studies examining antioxidant supplementation in response to endurance type exercise used trained subjects. Exercise training itself causes adaptations that protect against oxidative stress. Therefore, as with sup plementing multiple antioxidants, effects of Se status alone must be first be verified before compounding training effects. There is still an extensive

PAGE 28

28 amount of research needed in the area of Se supplementation and its effects on oxidative stress during e xercise.

PAGE 29

29 Table 1 1. Functions of selenoproteins identified in humans. (A dapted from Gromadzinska et al. 2008) Selenoprotein Function 15 kDa Involved in protein folding in the ER DI1, DI2, DI3 Thyroid hormone control GPx 1 Peroxide reduction in the cytoplasm GPx 2 Peroxide reduction, mainly in the gastrointestinal tract GPx 3 Peroxide reduction in plasma and other extracellular fluids GPx 4 Reduction of phospholipid hydroperoxides GPx 6 Peroxide reduction, found in embryos and in the olfactory epithelium SelH, SelI Unknown SelK Unknown, a membrane protein SelM Involved in protein folding in the ER SelN Unknown, mutations in gene associated with muscular diseases SelO Unknown SelP An antioxidant and Se transport protein SelR Reduces methionine R sulfoxides SelS A membrane protein, involved in the elimination of misfolded proteins from the ER SelT Unknown SelV Unknown, only found in the testes SelW Can reduce peroxides using glutathione as an electron donor SPS2 Catalyzes the formation of selenophosphate TrxR 1 Cytoplasmic thioredoxin reductase, involved in many biological pathways TrxR 2 Mitochondrial thioredoxin reductase, involved in many biological pathways TrxR 3 (TGR) Thioredoxin /glutathione reductase found mainly in testes

PAGE 30

30 Figure 1 1 Metabolism of selenomethionine, selenite, and selena te (Adapted from Schrauzer, 1998).

PAGE 31

31 Figure 1 2. Diagram of oxidant and antioxidant systems in the cell. Superoxide is produced intracellularly in the cytosol and in the mitochondria. Two superoxide molecules dismutate either spontaneously or by superoxide dismutases to hydrogen peroxide. Hydrogen peroxide can be metabolized to oxygen and water by a number of molecules, including g lutathione peroxidase, or it can be converted to the hydroxyl radical, which is highly reactive (Adapted from Nordberg and Arner, 2001 ).

PAGE 32

32 Figure 1 3. Schematic of the many functions of the thioredoxin reductase (TrxR) family in the body. Reduction of hydrogen peroxide and conversion of inactive to active glutathione peroxidase can be directly catalyzed by TrxR (Adapted from Nordberg and Arner, 2001).

PAGE 33

33 CHAPTER 2 INTRODUCTION Physical exercise, especially when strenuous or prolonged, cau ses an increase in the production of free radicals and reactive oxygen species (ROS) (Bejma and Ji 1999; Lawler and Powers 1998 ). Generation of ROS has some useful benefits including maximizing muscle force during exercise at low levels (Reid 2001). Howeve r, when the tissue damage (Leeuwenburgh et al. 1999; Gomez Cabrera et al. 2007; Ji 1999 ). In humans, excess ROS have been implicated in cardiovascular disease, aging, an d cancer (Marlin et al. 2002). In horses, excess ROS have been associated with equine al. 2008). Antioxidant mechanisms are reliant on several nutrients. While some of th ese nutrients, such as vitamins E and C quench free radicals directly, others including selenium (Se) and copper are components of enzymes that catalyze the reduction of ROS to less harmful intermediates (Urso and Clarkson 2003). Enzymes, such as catalase, superoxide dismutase, and glutathione peroxidase are thought to be the most efficient antioxidants (Valko et al. 2007). Thus, sufficient intake of antioxidant nutrients in the diet is important to bolster the antioxidant defenses of sport horses. Supplem entation with Se has been shown to be an effective means of increasing antioxidant status under various models of oxidative stress (e.g., lactation transition in ( Clark et al. 1996; Smith et al. 198 4 ; Zhang et al. 2010 ) Selenium is active in the body as a component of selenoproteins and selenoenzymes, which have selenocysteine incorporated into the

PAGE 34

34 active sites (Suzuki et al. 2006). Glutathione peroxidase in plasma (GPx3) and tissues (e.g., red bloo d cells and muscle; GPx1) are the most common selenoenzymes evaluated when determining Se status and antioxidant function in horses (Avellini et al. 1999; Calamari et al. 2009 2010; Richardson et al. 2006). However, other important selenoenzymes have been recognized for their antioxidant properties in other species, including thioredoxin reductase (TrxR) (Gromadzinska et al. 2008; Rederstorff et al. 2006). Among other role s, GPx and TrxR are responsible for detoxifying hydrogen peroxide (Urso and Clarkson 2003) and preventing apoptosis in cells subjected to ROS producing agents (Mustacich and Powis 2000), respectively. Research examining antioxidant supplementation in human athletes and performance horses has generally focused on a mixture of antioxidant nutrients ( Avellini et al. 1999; Rokitzki et al. 1994 ; de Moffarts et al. 2005). Long distance runners receiving supplementation of 400 IU vitamin E plus 200 mg vitamin C for 4.5 wk preceding a marathon had less muscle damage as evidenced by lower creatine kinase concentrations compared to runners that had received a placebo (Rokitzki et al. 1994). In horses, Avellini et al. (1999) observed no change in lymphocyte GPx activity due to acute exercise following 70 d of training plus supplementation of 20 g Se /kg BW and 40 mg vitamin E/kg BW. In contrast, de Moffarts et al. (2005) reported horses in training and receiving a daily antioxidant supplement containing 11,500 mg ascorbic acid, 7000 mg tocopherol acetate, and 7 mg Se for 12 wk exhibited an increase in RBC GPx activity when compared with horses receiving a placebo. Few studies have examined Se supplementation alone as a strategy for combating exercise induced oxidative stress.

PAGE 35

35 The current NRC (2007) requirement for horses is 0.1 mg Se/kg DM, which is lower than the 0.3 mg/kg suggested for other species of livestock. The Se requirement in horses is based on a small number of studies that showed no increase in serum Se or GPx activity when diets contained greater than 0.1 mg/kg. However, research in bro odmares and nursing foals suggests a higher level of Se may be needed to support immune function (Janicki et al. 2001). In addition, studies in other species have suggested that selenoenzyme activities in plasma and tissues may not be sensitive biomarkers of Se status, and that gene expression of selenoproteins may be more useful for determining Se requirements (Aitken et al. 2009; Sunde 2010). The objectives of this study were to determine if dietary Se supplementation above the current NRC (2007) require ment alters serum Se status, gene expression in skeletal muscle, and antioxidant enzyme activity in untrained horses at rest and in response to a prolonged bout of submaximal exercise. We hypothesized that horses receiving 0.3 mg Se/kg DM would not respond differently than horses receiving 0.1 mg Se/kg DM at rest, but the additional Se would confer improvements in response to exercise induced oxidative stress.

PAGE 36

36 CHAPTER 3 MATERIALS AND METHOD S Horses Twelve mature, untrained Thoroughbred horses (6 mares and 6 geldings) with a mean SE age of 11.1 1.1 yr and bodyweight ( BW ) of 564.6 11.0 kg were utilized in this study. Horses were housed in 6 m x 18 m paddocks at the Institute of Food and Agricultural Sciences (IFAS) Equine Sciences Center in Ocala, FL Paddocks were devoid of vegetation to facilitate control of Se intake. This study was reviewed and approved by the IFAS Animal Care and Use Committee at the University of Florida. Dietary Treatments After controlling for age and gender, h orses were ran domly assigned to one of two dietary treatments : 0.1 mg Se/kg DM (CON, n = 6) or 0.3 mg Se/kg DM (SEL, n = 6). To facilitate exercise testing and sample collection, horses were further divided into three groups of four horses each with equal dietary treatm ent representation in each group. Dietary treatments were initiated in one group of horses per day, over three consecutive days. As intended, this arrangement also staggered each data collection and exercise testing over 3 to 4 consecutive days. All horses were fed individually and received their respective dietary treatments for 36 d. The basal diet consisted of whole oats offered at 0.4% BW/d, C oastal bermudagrass hay fed at 1.6% BW/d, and a vitamin/mineral premix containing no Se (custom mixture, Lakelan d Nutrition Group, Lakeland, FL) fed at a rate of 0.009% BW/d. Sodium selenite was hand mixed into the oats daily in quantities to provide either 0.1 or 0.3 mg Se/kg DM in the total diet. Sodium selenite accounted for approximately 38% and 79% of the total daily Se intake for the 0.1 and 0.3 mg Se/kg DM treatments,

PAGE 37

37 respectively. At each feeding, a small quantity of molasses (about 30 mL) was mixed into the oats to help adhere the vitamin/mineral premix. Sodium selenite was mixed separately with a small amou nt of applesauce (30 g) and top dressed on the oat mixture to ensure the horses would consume the selenite. Diets were formulated to maintain BW and meet or exceed NRC (2007) requirements for horses in light work. Nutrient analysis was performed on all fe eds prior to the start of the study. Feeds were analyzed for Se by Olson Biochemistry Laboratories (South Dakota State University, Brookings, SD) using the fluorometric method (974.15) outlined by AOAC (2000) with an ultraviolet detector (Turner filter, fl u o rometer, model 112, Unipath, Mountain View, CA) All other nutrient analyses were performed by Dairy One, Ithaca, NY using standard analytical methods. The n utrient composition of all dietary ingredients is presented in Table 3 1. Exercise Test To acclim ate horses to the outdoor free stall exerciser used for exercise testing, horses underwent 10 min of walking and trotting on three separate occasions. Otherwise, horses remained sedentary prior to exercise testing. O n d 35 at 0800 h, horses were subjected to a 120 min bout of submaximal exercise on the free stall exerciser. H orses were fitted with onboard heart rate monitors equipped with telemetry signaling for remote monitoring (Polar Equine, Polar Electro Inc., Lake Success, NY). The exercise bout consis t ed of 7 replications of walk ing (1.51 m/sec ; for a total of 21 min ), jog ging (4.09 m/sec ; for a total of 41 min ), and extended trot ting or canter ing (4.83 m/sec ; for a total of 43 min ). Midway through the exercise bout, horses were removed from the exerciser, hand walked f or 15 min, offered water then returned to the free stall exerciser for the remaining 45 min of exercise The total distance travel ed was 25.8 km

PAGE 38

38 with a mean heart rate of 135 39 bpm at the fastest speed of 4.83 m/s Mean ambient t emperature during exercise testing was 20.0 1.7C with 93 8 1. 2 % relative humidity. Sample Collection Blood samples were obtained before (d 0) and after 34 d of Se supplementation, and on d 35 36 immediately after exercise ( 0 h) and at 6 and 24 hr pos t exercise for analysis of serum Se and plasma and red blood cell (RBC) lysate glutathione peroxidase activity. At each sampling interval approximately 15 mL of blood was collected from each horse by jugular venipuncture into evacuated tubes (Vacutainer, Becton Dickinson Co., Franklin Lakes, NJ) containing either no anticoagulant for harvesting of serum or in tubes containing sodium heparin for harvesting of RBC and plasma. Samples were immediately placed on ice and were processed within 2 h of collection by centrifugation at 2000 x g for 15 min at 4C. Serum and plasma were harvested and stored in polypropylene cryogenic vials in 0.05 2.0 mL aliquots at until analyse s were performed. After plasma was harvested, the buffy coat was discarded and 400 L of RBC were cold HPLC grade water in a separate microcentrifuge vial. RBC lysate was harvested after centrifugation at 10,000 x g for 15 min at 4C 80C. Biopsies were taken alternately from the right or left middle gluteal muscle using a 14 gauge x 9 cm SuperCore TM Biopsy needle (Angiotech, Vancouver, BC) before (d 0) and after 34 d of Se supplementation, and on d 35 36 at 6 and 24 hr post exercise. The middle gluteal muscle was located on the croup by tracing 8 10 cm from the tuber coxae at a 45 angle dorsocaudal from the tuber coxae ( Figure 3 1; Bechtel and Kline 1987). The area to be biopsied was surgically clipped, cleaned with 7.5% povidone iodine

PAGE 39

39 ( Betadine Surg ical Scrub, Purdue Products L.P., Stamford, CT) and rinsed with 70% ethanol Local anesthetic agents such as lidocaine, mepivacaine and prilocaine administered in clinically used concentrations have been shown to be myotoxic (Benoit and Belt 1972; Yagiela et al. 1982), as well as inhibit innate immunity, including modulation of superoxide anion production by neutrophils and macrophages (Azuma and Ohura 2004). Because of the potential for interference with skeletal muscle antioxidant enzyme activity and gene expression, horses in the current study were not administered a local anesthetic prior to biopsying. However horses were sedated with detomidine hydrochloride (Dormosedan Pfizer Animal Health, Exton, PA) prior to biopsying A 14 gauge needle was used t o create the initial puncture through the skin, followed by insertion of t he biopsy needle to a depth of 5 cm into the middle gluteal muscle at a 90 angle to the muscle to obtain tissue sample s At each sampling interval, approximately 75 mg of wet muscle tissue was placed in 1 mL of RNAlater RNA Stabilization Reagent (Qiagen, Valencia, CA) and stored at 80C until gene expression analysis was performed An additional 200 mg of muscle tissue was placed in aluminum foil (three separate aliquots of 65 75 mg each), flash frozen in liquid nitrogen, and stored at 80C until analysis of enzyme activity was performed Throughout the study, BW of horses was monitored weekly using a livestock scale accurate to 0.5 kg (MP800, Tru Test, Inc., Mineral Wells, TX). Feeding regimes were adjusted as necessary, based on changes in BW. Serum Se Serum was analyzed for Se concentration by Olson Biochemistry Laboratories (South Dakota State University, Brookings, SD) using the fluorometric method (974.15)

PAGE 40

40 outlined by AOAC (2000) with an ultraviolet detector (Turner filter, flu o rometer, model 112, Unipath, Mountain View, CA). Gene Expression in Skeletal Muscle Skeletal muscle was examined for expression of metallothionein 1B ( MT1B ), metallothionein 3 ( MT3 ), thioredoxin redu ctase 1 ( TrxR1 ), glutathione peroxidase 1 ( GPx1 ), glutathione peroxidase 3 ( GPx3 ), copper zinc superoxide dismutase ( SOD1 ), and manganese superoxide dismutase ( SOD2 ) RNA was isolated and purified from skeletal muscle that had been stored in RNAlater and quantitative real time PCR was performed to determine expression of selected genes using a modification of the methods described by Gonzalez et al. (2008) Briefly, 50 mg of tissue was homogenized in 1 mL of STAT 60 (Tel Test Inc., Friendswoods, TX) with a mechanical tissue disruptor for 60 sec. RNA was isolated from each sample using the RNeasy Micro Kit (Qiagen, Valencia, CA; Appendix A). Fifty nanograms of total RNA was treated with RQ1 RNase free DNase (Promega, Madison, WI) to remove any DNA contaminat ion. Samples were then reverse transcribed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA) at 37C for 120 min. cDNA from 12.5 ng of RNA was amplified with SYBR Green PCR Master Mix (Applied Biosystems, Foster C ity, CA) and the appropriate forward and reverse primers (Table 3 2) in an ABI 7300 Real Time PCR System (Applied Biosystems, Foster City, CA). Thermal cycling parameters included a denature s tep of 95C for 10 min and 5 0 cycles of 15 s ec at 95C and 1 min at 55 C. A final dissociation step included 95C for 15 s ec 60C for 30 s ec and 95C for 15 s ec Real time PCR efficiency for each primer set was determined using a standard curve of pooled cDNAs (Gonzalez 2007).

PAGE 41

41 Quantitative r eal time P CR produce d a cycle threshold (Ct) value for each sample Data for each gene were normalized using 18S as the reference gene t o account for total cDNA in each sample. The resulting was calculated by s ubtracting Ct 18S from Ct gene of interest permitting a more accurate value of gene expression in each sample In figures, g ene expression is represented as 50 number of cycles ran. Fold changes in gene expression are also reported, and are calculated using the formula, 2 whe re time of interest time 0 (pre exercise) for each horse (Livak and Schmittgen 2001). GPx and TrxR Activities Plasma and RBC lysate were examined for GPx activity and skeletal muscle was examined for both GPx and TrxR activities using commercially available kits (Cayman Chemical, Ann Arbor, MI) and the PowerWave XS microplate reader (BioTek Instruments, Winooski, VT) The enzymatically coupled GPx assay was based on the decrease in absorbance at 340 nm that accompanies the oxidation of NADPH to NADP + in response to the reduction of cumene hydroperoxide substrate by GPx. When GPx activity was rate limiting, the decrease in absorbance was proportional to GPx activity in the sample. The change in absorbance over time, the NADPH extinction coefficient of 0.00373 M 1 and the sample volume were used to calculate GPx activity for each sample. One unit (U) of GPx activity was defined as the amount of enzyme needed to oxidize 1 nmol of NADPH to NADP + per minute at 25C. The TrxR activity assay dithio bis (2 thio 2 nitrobenzoic acid (TNB) measured at 405 nm. Activity was determined in the presence and absence of a

PAGE 42

42 TrxR inhibitor to account for non thio redoxin reductase independent DTNB reduction. The difference in absorbance with and without the inhibitor was the DTNB reduction due to TrxR. The change in absorbance over time, the DTNB extinction coefficient of 6.35 mM 1 and the sample volume were used to calculate TrxR activity for each sample. One unit (U) of TrxR activity was defined as the NADPH dependent production of 2 mol of 2 nitro 5 thiobenzoate per minute at 22C. GPx activity was evaluated in undiluted p lasma and RBC lysate diluted 1:16 with assay buffer provided in the kit. Muscle tissue (approximately 75 mg that had been previously flash frozen and stored at 80 C in aluminum foil ) was prepared for GPx and TrxR analysis by first rinsing in tissue buffer (50 mM Tris HCl, 1 mM EDTA, 0.4 mM PMS F) and then homogenizing in 1 mL of the same buffer with a mechanical tissue disruptor. The homogenized tissue was centrifuged at 2000 x g for 15 min at 4C and enzyme activity in the undiluted supernatant was evaluated GPx and TrxR activities were determ ined using the same muscle tissue homogenate preparation on the same day. Samples of the same type (i.e., plasma, RBC and muscle) were analyzed for GPx and/or TrxR within the same day. Samples were analyzed in triplicate for GPx activity and in duplicate f or TrxR activity. Intraassay CV was 6.76%, 3.64%, 3.74%, and 7.69% for plasma GPx, RBC GPx, muscle GPx, and muscle TrxR activities, respectively. GPx and TrxR activities in plasma, RBC lysate and muscle homogenate were normalized per gram of total protein, which was determined using the Coomassie (Bradford) Protein Assay Kit (Thermo Scientific, Rockford, IL). Statistical Analyses O ne CON horse had to be removed from the study on d 28 ( after the initiation of supplementation but before the exercise test) due to unresolved forelimb lameness An

PAGE 43

43 alternate horse that had been maintained on a diet that contained a similar level of Se (0.1 mg Se/kg DM) was selected to replace the lame horse in the CON group The alternate horse was of similar weight and the sam e gender as the horse that was replaced. The pre supplementation (d 0) plasma, RBC lysate and muscle samples from the lame horse were retained in the dataset, and only d 34 and post exercise samples collected on d 35 36 were obtained from the replacement h orse. Differences in mRNA expression of each gene were analyzed using the GLIMMIX procedure of SAS (Version 9.2 SAS Institute Inc., Cary, NC) using individual horse as the experimental unit. Dietary Se treatment, exercise, and treatment x exercis e were evaluated as fixed effects, and horse within treatment was included as a random effect. Differences in serum Se and GPx and TrxR activit ies were analyzed using the PROC MIXED procedure of SAS with repeated measures The responses to Se supplementat ion alone (d 0 and d 34 samples obtained in resting animals) were analyzed separately from the responses to exercise (d 34 36). Dietary Se treatment, time (or exercise), and treatment x time (or treatment x exercise) were included in the model as fixed eff ects and horse within treatment served as a random effect. When evaluating effects of Se supplementation alone, d 0 values for serum Se and GPx and TrxR activities were initially included in the model as a covariate, but were later removed when found to be not significant. All data are expressed as mean SE. 0.05.

PAGE 44

44 Table 3 1 Nutrient composition of basal diet feeds and sodium selenite supplement a Nutrient Basal Diet Sodium Selenite Oats Bermudagrass Hay Vitamin/Mineral Premix DE b (Mcal/kg) 3.40 1.94 0 0 Crude fat (%) 5.8 1.8 0 0 Crude protein (%) 11.7 10.2 0 0 NDF b (%) 25.5 71.8 0 0 ADF b (%) 11.8 36.8 0 0 Ca (%) 0.07 0.34 12.0 28.0 P (%) 0.37 0.25 8.0 0 Zn (ppm) 27 27 9287 0 Cu (ppm) 5 7 2388 0 Se (ppm) 0.24 0.02 0 10,000 Vitamin A (IU/kg) 31 6,904 455,040 0 Vitamin E (IU/kg) 15 12 19,001 0 a Values presented on a 100% dry matter basis. b DE = digestible energy; NDF = neutral detergent fiber; ADF = acid detergent fiber

PAGE 45

45 Table 3 2. Sequence of equine specific PCR primers used for measurement 18S, MT1B, MT3, TrxR1, GPx1, GPx3, SOD1, and SOD2 mRNA content. Gene Forward Primer Reverse Primer Slope a 18S AAGGAATTGACGGAAGGGC TCAATCTGTCAATCCTGTCCG 3.19 MT1B TGAATCCTGCACCTGCG TTGTCCGATGCCCCTTTG 3.18 MT3 AGCCAATTCACCTCTTCCAG TTTGCATCCCTCGCACTT 3.36 TrxR1 TTTTGTCACTCCAACCCCTC TCGACATTCCATCCGTAGTTTC 3.20 GPx1 ATCAGGAGAACGCCAAGAAC TCACCTCGCACTTCTCAAAG 3.21 GPx3 GTCTGGTCATTCTGGGCTTC CCGTTCACATCCCCTTTCTC 3.24 SOD1 TGCTCACTTTAATCCTCTGTCG AATGCTTTCCCGAGAGTGAG 3.12 SOD2 ACGTGACTTTGGTTCCTTGG CGTCCCTGGTCCTTATTGAAAC 3.20 a Slope of standard curve of primer sequence used for real time PCR analysis.

PAGE 46

46 Figure 3 1. Diagram of the biopsy site from the middle gluteal muscle of the horse. The middle gluteal muscle was located by tracing 8 10 cm from the tuber coxae at a 45 angle dorsocaudal from the tuber coxae as described by Bechtel and Kline (1987).

PAGE 47

47 CHAPTER 4 RESULTS Serum Se concentration did not differ between SEL and CON horses prior to the start of supplementation (Figure 4 1). S erum Se increased (P=0.01) from d 0 to d 3 4 in SEL but remained unchanged in CON As a result, after 34 d of supplementation, serum Se was greater in SEL than CON (P=0.02) (Figure 4 1). Expression of MT1B and MT3 in skeletal muscle were affected by exercise (P=0.004 and P=0.006 respectively), but not Se treatment or the interaction of Se treatment x exercise (Figure 4 2). Across treatments, m uscle expression of MT1B (P=0.001) and MT3 (P=0.001) increased over 6 fold from pre to 24 h post exercise (Table 4 1 ; Figure 4 2 ). Similar to MT1B and MT 3 muscle expression of TrxR1 was affected by exercise (P=0.06 ), but not Se treatment or the interaction of Se treatment x exercise (Figure 4 3 A). At 6 h post exercise, m uscle expression of TrxR1 remained unchanged from pre exercise, but was increased (P= 0.02) 2. 8 fold at 24 h post exercise (Table 4 1 ; Figure 4 3 A ) In contrast GPx1 and GPx3 expression by skeletal muscle were unaffected by exercise and Se treatment (Figure 4 3 B and C ). However, expression of GPx1 decreased from pre exercise to 24 h post exercise in CON (P=0.05), while remaining unchanged in SEL (Figure 4 3 B). Although not affected by Se treatment or the interaction of Se treatment x exercise expression of SOD2 in skeletal muscle w as affected by exercise (P=0.0002 ) while expression of SOD1 was not (Figure 4 4). In CON horses, muscle expression of SOD1 (P=0.009) and SOD2 (P=0.003 ) increase d from 6 to 24 h post exercise (Figure 4

PAGE 48

48 4). In SEL horses, SOD1 expression by muscle was unchanged following exercise, however SOD2 expression had declined at 24 hr post exercise (P=0.02) (Figure 4 4). Supplementation with Se for 34 d had no effect on GPx activity in plasma, RBC lysate or muscle in horses at rest (Table 4 2). GPx activity in plasma, but not the other tissue s was affected by time (P=0.05) (Table 4 2). TrxR activity in muscle was also affected by time, where an overall increase (P=0.02) was observed from d 0 to d 34. Although the magnitude of increase in muscle TrxR activity was numerically greater for SEL horses, no treatment or time x treatment effects were observed in response to 34 d of Se supplementation (Table 4 2). In response to exercise, GPX activity increased in plasma (P=0.0005), decreased in RBC lysate (P=0.04), but was n ot altered in skeletal muscle (Figure 4 5). Supplementation with Se prior to the exercise bout had no effect on plasma or tissue GPx activity. However, a Se treatment x exercise interaction was observed for RBC lysate (P=0.05) and muscle (P=0.05) GPx activ ity (Figure 4 5). In SEL horses, RBC GPx activity was lower immediately after exercise (P=0.007) and at 24 h post exercise (P=0.01) compared to the level of activity observed before exercise (Figure 4 5 B). By comparison, in CON horses RBC GPx activity rem ained unchanged immediately after exercise, but decreased (P=0.04) at 6 h post exercise (Figure 4 5 B). Muscle GPx activity was unaffected by exercise in CON horses (Figure 4 5 C). In SEL horses, muscle GPx was elevated (P=0.02) over resting levels at 6 h post exercise, but by 24 h had returned to the level observed before exercise (Figure 4 5 C). Muscle TrxR activity was not affected by exercise nor Se level in the diet prior to exercise (Figure 4 6).

PAGE 49

49 Table 4 1. Fold changes in gene expression observed i n equine middle gluteal muscle from pre exercise to 6 h and 24 h post exercise across all treatments Gene 6 h 24 h MT1B 3.97 1.43 6.46 2.70 MT3 3.00 1.43 6.33 2.59 TrxR1 1.41 0.32 2.85 0.72 GPx1 1.17 0.44 1.06 0.53 GPx3 1.43 0.46 0.86 0.32 SOD1 1.10 0.25 1.62 0.34 SOD2 1.02 0.23 3.37 0.78

PAGE 50

50 Table 4 2. GPx and TrxR activity in plasma, RBC lysate and skeletal muscle of horses before (d 0) and after 34 d of supplementation with either 0.1 mg Se/kg DM (CON) or 0.3 (SEL) mg Se/kg DM P values Enzyme Trt d 0 d 34 Trt Time Trt*Time GPx (U /m g protein) Plasma CON 0.59 0.05 0.72 0.07 0.21 0.05 0.57 SEL 0.69 0.04 0.91 0.16 RBC CON 2.36 0.32 2.34 0.40 0.7 1 0.79 0.90 SEL 2.23 0.32 2.15 0.21 Muscle CON 50.92 20.9 17.36 4.01 0.28 0.08 0.54 SEL 27.82 14.5 11.01 3.4 TrxR (U/g protein) Muscle CON 2.16 0.53 3.51 1.53 0.30 0.02 0.41 SEL 4.02 0.94 x 7.02 2.53 y x,y Within a treatment time points lacking common letters differ ( P 0.05 ).

PAGE 51

51 Figure 4 1. Serum Se concentration before and after 34 d of supplementation with either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM to horses. x,y Within a treatment time points lacking common letters differ ( P<0.05 ). At same time point, CON differs from SEL (P<0.05). 0.00 0.03 0.06 0.09 0.12 0.15 0.18 d 0 d 34 Serum Se (mg/L) CON SEL x y

PAGE 52

52 A. MT1B B. MT3 Figure 4 2 MT1B (A) and MT3 (B) expression in equine middle gluteal muscle before exercise and at 6 and 24 h post exercise in horses receiving either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise. Overall effe ct of exercise (P=0.004, P=0.006), Se treatment (P=0.85, P=0.99 ), and treatment x ex ercise (P=0.73, P=0.67) for MT1B and MT3 expression, respecti vely. a,b,x,y Within each treatment time points lacking common letters differ ( P<0.05 ). 32 33 34 35 36 37 38 Pre Exercise 6 h 24 h 50 CON SEL Post Exercise a ab b x y y 32 33 34 35 36 37 38 Pre Exercise 6 h 24 h 50 CON SEL a ab b x xy y Post Exercise

PAGE 53

53 A TrxR1 B GPx1 C GPx3 Figure 4 3 TrxR1 (A ), GPx1 (B), and GPx3 (C) expression in equine middle gluteal muscle before exercise and at 6 and 24 h post exercise in horses receiving either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d pr ior to exercise Ov erall effect of exercise (P=0.006 P=0.06, P=0.09 ), Se treatment (P=0.56 P=0.89, P=0.73 ), and treatment x exercise (P=0.35 P=0.38, P=0.62 ) for TrxR1 GPx 1 and GPx3 expression respectively. a,b,x,y Within a treatment time points lacking common letters differ ( P<0.05 ). 30 32 34 36 38 Pre Exercise 6 h 24 h 50 CON SEL a a b x xy y Post Exercise 30 32 34 36 38 Pre Exercise 6 h 24 h 50 CON SEL Post Exercise a ab b 30 32 34 36 38 Pre Exercise 6 h 24 h 50 CON SEL Post Exercise

PAGE 54

54 A SOD1 B SOD2 Figure 4 4 SOD1 (A ) and SOD2 (B) expression in equine middle gluteal muscle before exercise and at 6 and 24 post exercise in horses receiving either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise. Ov erall effect of exercise (P=0.08 P=0.0009), Se treatment (P=0.95, P=0.94 ), and treatment x exercise (P=0.28, P=0.6 5) for SOD1 and SOD2 expression, respect ively. a,b,x,y Within a treatment time points lacking common letters differ ( P<0.05 ). 30 32 34 36 38 40 Pre Exercise 6 h 24 h 50 CON SEL ab b Post Exercise a 30 32 34 36 38 40 Pre Exercise 6 h 24 h 50 CON SEL x x y ab a b Post Exercise

PAGE 55

55 A. Plasma B. RBC Lysate C. Skeletal Muscle Figure 4 5. GPx activity in plasma (A), RBC lysate (B), and middle gluteal muscle (C) before exercise, and 0, 6 and 24 h post exercise in horses fed either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise. Overall effect of exercise (P=0.0005, P=0.04, P=0. 72 ), Se treatment (P=0.34 P=0.15 P=0. 65 ), and trea tment x e xercise (P=0.65, P=0.05 P=0. 05 ) for plasma, RBC lysate and muscle, respectively. a,b,x,y Within a treatment time points lacking common letters differ ( P 0.05 ). *At same time point, CON differs from SEL (P<0.05). 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Pre Exercise 0 h 6 h 24 h Plasma GPx Activity (U/mg protein) CON SEL x x x y a a ab b Post Exercise 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Pre Exercise 0 h 6 h 24 h RBC GPx Activity (U/mg protein) CON SEL a a b ab x y y xy Post Exercise 0 5 10 15 20 25 30 35 Pre Exercise 6 h 24 h Muscle GPx Activity (U/mg protein) CON SEL x y xy Post Exercise

PAGE 56

56 Figure 4 6. TrxR activity in th e middle gluteal muscle before exercise, and at 6 and 24 h post exercise in horses fed either 0.1 (CON) or 0.3 (SEL) mg Se/kg DM for 34 d prior to exercise. Overall effect of exercise (P=0.20), Se treatment (P=0.80), and treatment x exercise (P=0.58). 0 3 6 9 12 15 Pre Exercise 6 h 24 h Muscle TrxR Activity (U/min/g protein) CON SEL Post Exercise

PAGE 57

57 CHAP TER 5 DISCUSSION In the present study, short term Se supplementation at three times the current NRC (2007) recommendation was sufficient to increase serum Se status in mature, sedentary horses. This finding is consistent with previous studies in horses whe re plasma and RBC Se concentrations were observed to increase in as few as 28 d after beginning Se supplementation (Calamari et al. 2009; Richardson et al. 2006). Despite higher levels of circulating Se, GPx activity in plasma, RBC and skeletal muscle rem ained unchanged in resting horses in the current study. In contrast, Calamari et al. (2009) observed increases in plasma and whole blood GPx activity in sedentary horses supplemented with 0.3 mg Se/kg DM for 28 d. It is worth noting, however, that this inc rease was relative to horses receiving 0.085 mg Se/kg DM, which is below the Se r equirement of 0.1 mg/kg DM (NRC 2007). Richardson et al. (2006) found that supplementing weanling horses with either 0.15 or 0.6 mg Se/kg DM had no effect on GPx activity in p lasma or muscle, but the higher level of dietary Se did result in higher GPx activity in RBC after 56 d of supplementation. In growing rats and chickens, relatively short term (4 9 wk) supplementation with sodium selenite has been shown to result in an inc rease in muscle GPx activity compared with animals fed Se at or below requirements (Whanger and Butler 1988; Avanzo et al. 2001). Differing results may be due to differences in dietary Se level (in both supplemented and control animal rations), length of s upplementation, and physiological demand for increased antioxidant protection. The oxidative load generated in sedentary horses in the current study may not have been significant enough to upregulate GPx expression or activity. Interestingly, muscle TrxR a ctivity increased from d 0 to d 34 in horses supplemented with 0.3 mg

PAGE 58

58 Se/kg DM, whereas it remained unchanged in horses receiving 0.1 mg Se/kg DM. To equine skeletal mus cle in response to Se supplementation Because TrxR is involved in such a multitude of biological pathways, it may be able to detoxify a wider range of oxidants than other enzyme systems (Mustacich and Powis 2000). Not only does TrxR posses its own antioxidant properties (e.g., detoxifying lipid hydroperoxides), but it is also able to directly catalyze the conversion of inactive to active GPx (Nordberg and Arner 2001). Therefore, TrxR may be more active at rest when ample dietary Se i s provided. More research is needed to identify the significance of TrxR as an antioxidant in horses. A prolonged, submaximal exercise bout was used in the current study to increase oxidative load in otherwise sedentary horses. An increase in the use of the mitochondrial electron transport chain with aerobic exercise results in an increase of ROS production (Leeuwenburgh et al. 1999; Bejma and Ji 1999). Upregulation of MT1B and MT3 expression in skeletal muscle indicate the exercise protocol used in the c urrent study was sufficient to induce oxidative stress (Bauman et al. 1991; Mahoney et al. 2005). In agreement with Gore et al. (1998), varying responses to exercise were observed to occur at pre and post transcriptional levels Prolonged, submaximal exe rcise did not alter GPx 1 or GPx 3 expression or GPx activity in equine skeletal muscle, but did result in a transient decrease in RBC GPx activity and a progressive rise in plasma GPx activity following exercise. Although measured in different tissues, Hata o et al. (2006) also observed no change in GPx expression and GPx and TrxR activities in

PAGE 59

59 the lung in rats following an acute exercise bout on a treadmill. In contrast, a marked increase in GPx activity was observed in the soleus muscle of rats 24 h after w eight lifting to exhaustion, which remained elevated through 96 h post exercise (Uchiyama et al. 2006). Compared to the aerobic exercise performed by horses in the current study, the weight lifting exercise performed by rats was likely primarily anaerobic. Differences in substrate utilization between aerobic and anaerobic exercise can yield different oxidative loads (Bloomer et al. 2005), which could affect the GPx response following exercise. Oztasan et al. (2004) observed an increase in RBC GPx activity i n untrained rats immediately following treadmill exercise to exhaustion. This finding is in contrast to the decrease in RBC GPx activity observed in the current study; however, horses were not worked to exhaustion and were likely never in the anaerobic ran ge. Rather, untrained horses in the current study responded similarly to trained cyclists, where an early, transient decline in RBC GPx activity was observed after completing the 171 km mountain stage of a 5 d cycling competition (Aguilo et al. 2005). Hors es supplemented with 0.3 mg Se/kg DM entered the exercise bout with higher serum Se than horses supplemented with 0.1 mg Se/kg DM. Although the higher level of Se supplementation had no overall effect on selenoenzyme activity or mRNA in response to prolong ed exercise, SEL horses responded differently to exercise than CON horses. Exercise x dietary treatment interactions were observed for both muscle and RBC GPx activities. While prolonged exercise did not affect GPx activity in the muscle of CON horses, act ivity of this enzyme was elevated 6 h after exercise in SEL horses. An increase in enzyme activity following prolonged exercise may be beneficial in mitigating oxidative muscle damage, thereby aiding in recovery.

PAGE 60

60 In contrast to muscle GPx activity, a decr ease in RBC GPx was observed following exercise. In SEL horses, RBC GPx activity began to decline immediately observed until 6 h post exercise. Contrasting results were reporte d by de Moffarts et al. (2005) whereby horses supplemented with an antioxidant supplement containing vitamin C, vitamin E, and Se for 12 wk exhibited increased RBC GPx activity 18 24 h following a race or intense race training. In the current study, a decr ease in GPx activity in blood paired with an increase in muscle GPx activity in supplemented horses may indicate a lesser need for GPx in circulation because ROS were quenched at the site of production (muscle) However, it is interesting to note the rebo und of GPx activity in RBC and the rise of GPx in skeletal muscle both occurred 6 h after exercise in SEL supplemented horses. The significance of this finding is unknown, but highlights that prolonged exercise continues to alter the redox state significa ntly during recovery from exercise. Expression of SOD1 and SOD2 by middle gluteal muscle were also affected by prolonged exercise; however, the response appeared to differ between treatment groups. In CON horses, SOD1 and SOD2 mRNA were decreased slightly from pre to 6 h post exercise, but had returned to baseline by 24 h post exercise. In contrast, SOD1 expression was not affected by exercise in SEL horses, and SOD2 expression decreased from 6 to 24 h post exercise. In the g ast r ocnemius muscle of mice run on a treadmill for 150 min, e xercise did not affect SOD1 or SOD2 expression 6 h after exercise (Hitomi et al. 2008). But, these researchers did observe a n increase in extracellular SOD ( SOD3 ) mRNA expression in mice 6 h post exercise which remained

PAGE 61

61 elevated 24 h post exercise. I t is interesting that cystolic ( SOD1 ) and mitochondrial ( SOD2 ) expression of SOD did not change in response to exercise, while SOD 3 increased. This could attest to the fact that SOD3 is controlled at the transcriptional level, while SOD1 and SOD2 are controlled post transcriptionally (Hitomi et al. 2008) To date, SOD3 has not been annotated in the horse genome so we were not able to make a similar comparison. Although SOD activity in muscle was not measured in the current study, it is worth noting the relationship between GPx activity and (mitochondrial) SOD2 expression in SEL horses. Exercise caused an increase in muscle GPx activity 6 h after exercise, which was accompanied by a concurrent decrease in SOD2 expression 24 h after exercise. This inverse relationship is in agreement with de Moffarts et al. (2005), Avanzo et al. (2001), and Reddy et al. (1998). These three research laboratories observed a similar i nverse relationship between SOD activity and GPx activity in horses, chickens, and rats, respectively, based on dietary antioxidant status. This could indicate animals receiving higher levels of dietary Se utilize the GPx system in response to oxidative st ress in preference to the SOD system, whereas those that are Se deficient rely on the SOD system. In conclusion, supplementing mature horses with 0.3 mg Se/kg DM seemed to confer very few advantages over the NRC (2007) re commendation of 0.1 mg Se/kg DM when horses were evaluated in a resting state. However, when horses were challenged with prolonged, submaximal exercise, the level of dietary Se seemed to influence muscle mRNA expression and tissue activity of some antioxid ant enzymes. More specificially, changes in skeletal muscle SOD2 and TrxR1 expression and GPx activity

PAGE 62

62 in RBC and skeletal muscle seemed to be altered in response to exercise by a higher level of supplementation; however, expression of the selenium contain ing enzymes GPx1 and GPx3 were not. Further research is needed to determine how long effects on antioxidant expression and activity persist following exercise, as it may have bearing on recovery. In addition, research is needed to determine if Se supplementation confers additional benefits to trained horses.

PAGE 63

63 APPENDIX A RNA ISOLATION USING STAT 60 AND RNEASY M ICRO KIT Need 4 microcentrifuge tubes, 1 column, and 2 collection tubes per sample. 1. For each sample, label and add 1 mL STAT 60 to a 3 mL tube. 2. Place sample (~50 mg) in labele d 3 mL tube containing STAT 60. 3. Homogenize sample in 3 mL tube containing STAT 60 for 60 seconds. a. Clean homogenizer with 10% SDS, 70% ethanol, and water before and after use. 4. Transfer homogenate to 1.5 mL microcentrifuge tube. 5. Allow sample to stand at room temperature for 5 min. 6. seconds. a. Chloroform should not contain isoamyl alcohol or other additives. 7. Allow to stand at room temperature for 5 min. 8. Centrifuge at 12,000 x g for 15 min at room temperature 9. tube. a. Absolutely DO NOT disturb the lower red phenol phase. 10. Add 450 L of 70% ethanol to each tube and briefly vortex. 11. Place 700 L of sample into spin c olumn and centrifuge for 15 seconds at 10,000 x g. 12. Discard flow through and place remaining sample in spin column and centrifuge for 15 seconds at 10,000 x g. 13. Add 350 L of Buffer RW1 to spin column and centrifuge for 15 seconds at 10,000 x g. 14. Discard flow through, repeat step 13, and discard collection tube. 15. Place spin column into new 2 mL collection tube. 16. Add 500 L of Buffer RPE to spin column and centrifuge for 15 seconds at 10,000 x g. a. Do not forget to add ethanol to Buffer RPE before using. 17. Discar d flow through and add 500 L of 80% ethanol to spin column and centrifuge for 2 min at 10,000 x g. 18. Discard flow through and collection tube and place spin column into new 2 mL collection tube. 19. Centrifuge spin column with lid open in new collection tube fo r 5 min at full speed (16.1). 20. Discard collection tube and place spin column in 1.5 mL collection tube. 21. Add 17 L of RNA free water directly onto each spin column and centrifuge for 1 min at full speed (16.1). 22. Repeat step 21 and discard spin column. 23. Heat at 65C for 15 min to facilitate dissolution. 24. Centrifuge for 5 min at 12,000 x g and collect supernatant (30 L). 25. Store sample at 80C until further analysis.

PAGE 64

64 LIST OF REFERENCES 1. 2010 On line Factbook [online]. The Jockey Club. http://www.jockeyclub.com/factbook.asp [ 2 June 2010]. 2 Aguilo A, Tauler P, Fuentespina E, Tur JA, Cordova A, and Pons A. Antioxidant response to oxidative stress induced by exhaustive exercise. Physiol Behav 84: 1 7, 2005. 3. AHCF The Economic Impact of the Florida Horse Industry. American Horse Council Foundation, 2005. 4. Aitken SL, Karcher EL, Razamand P, Gandy JC, VandeHaar MJ, Capuco AV, and Sordillo LM. Evaluation of antioxidant and proinflammatory gene expression in bovine mammary tissue during the periparturient period. J Dairy Sci 92: 589 598, 2009. 5. AOAC. Official Methods of Analysis. 17th ed. Arlington, VA: Assoc Off Anal Chem, 2000. 6. Avanzo JL, Xavier de Mendonca Jr. C, Pugine SMP, and de Cerqueira Cesar M. Effect of vitamin E and selenium on resistance to oxidative stress in chicken superficial pectoralis muscle. Comp Biochem Physiol C Toxicol Pharmacol 129: 163 173, 2001. 7. Avellini L, Chiaradia E, and Gaiti A. Effect of exercise training, selenium and v itamin E on some free radical scavengers in horses ( Equus caballus ). Comp Biochem Physiol B Biochem Mol Biol 123: 147 154, 1999. 8. Azuma Y and Ohura K. Immunological modulation by lidocaine epinephrine and prilocaine felypressin on the functions related to natural immunity in neutrophils and macrophages. Endocr Metabol Disord 4: 29 36, 2004. 9. Bauman JW, Liu J, Liu YP, and Klaassen CD. Increase in metallothionein produced by chemicals that induce oxidative stress. Toxicol Appl Pharmacol 110: 347 354, 19 91. 10. Bechtel PJ and Kline KH. Muscle fiber changes in the middle gluteal of Quarter and Standardbred horses from birth through one year of age. In: Equine exercise physiology 2 edited by Gillespie JR and E RN. Davis, CA: ICEEP Publications, 1987, p. 2 65 270. 11. Bejma J and Ji L. Aging and acute exercise enhance free radical generation in rat skeletal muscle. J Appl Physiol 87: 465 470, 1999. 12. Benoit PW and Belt WD. Some effects of local anesthetics on skeletal muscle. Exp Neurol 34: 264 278, 1972

PAGE 65

65 13. Bloomer RJ, Goldfarb AH, Wideman L, McKenzie MJ, and Consitt LA. Effects of acute aerobic and anaerobic exercise on blood markers of oxidative stress. J Strength Cond Res 19: 276 285, 2005. 14. Burk RF. Selenium, and antioxidant nutrient. Nutr Clin Care 5: 75 79, 2002. 15. Calamari L, Abeni F, and Bertin G. Metabolic and hematologic profiles in mature horses supplemented with different selenium sources and doses. J Anim Sci 88: 650 659, 2010. 16. Calamari L, Ferrari A, and Bertin G. Effect of sele nium source and dose on selenium status of mature horses. J Anim Sci 87: 167 178, 2009. 17. Clark LC, Combs GF, Tumbull BW, Slate EH, Chalker DK, Chow J, Davis LS, Glover RA, Graham GF, Gross EG, Krongrad A, Lesher JL, Park K, Sanders BB, Smith CL, and Taylor JR. Effects of selenium supplementation for cancer prevention in patients with carcinoma of the skin. JAMA 276: 1957 1963, 1996. 18 de Moffarts B, Kirschvink N, Art T, Pincemail J, and Lekeux P. Effect of oral antioxidant supplementation on blood antioxidant status in trained thoroughbred horses. Vet J 169: 65 74, 2005. 19 de Moffarts B, Kirschvink N, Art T, Pincemail J, Michaux C, Cayeux K, Defraigne J O, and Lekeux P. Impact of training and e xercise intensity on blood antioxidant markers in healthy Standardbred horses. Equine Comp Ex Physiol 1: 211 220, 2004. 20 Eivers SS, McGivney BA, Fonseca RG, MacHugh DE, Menson K, Park SD, Rivero JL, Taylor CT, Katz LM, and Hill EW. Alterations in oxida tive gene expression in equine skeletal muscle following exercise and training. Physiol Genomics 40: 83 93, 2010. 21 Evans DL. Welfare of the Racehorse During Exercise Training and Racing. In: The Welfare of Horses edited by Waran N. Dordrecht, The Neth erlands: Springer, 2002, p. 181 201. 22 Gomez Cabrera M C, Domenech E, and Vina J. Moderate exercise is an antioxidant: upregulation of antioxidant genes by training. Free Radic Biol Med 44: 126 131, 2008. 23 Gonzalez JM, Carter JN, Johnson DD, Ouellet te SE, and Johnson SE. Effect of ractopamine hydrochloride and trenbolone acetate on longissimus muscle fiber area, diameter, and satellite cell numbers in cull beef cows. J Anim Sci 85: 1893 1901, 2007.

PAGE 66

66 24 Gonzalez JM, Dijkhuis RD, Johnson DD, Carter JN and Johnson SE. Differential response of cull cow muscles to the hypertrophic actions of ractopamine hydrogen chloride. J Anim Sci 86: 3568 3574, 2008. 25. Gore M, Fiebig R, Hollander J, Leeuwenburgh C, Ohno H, and Ji LL. Endurance training alters antio xidant enzyme gene expression in rat skeletal muscle. Can J Physiol Pharmacol 76: 1139 1145, 1998. 26 Gromadzinska J, Reszka E, Bruzelius K, Wasowicz W, and Akesson B. Selenium and cancer: biomarkers of selenium status and molecular action of selenium supplements. Eur J Nutr 47(Suppl 2): 29 50, 2008. 27 Hatao H, Oh ishi S, Itoh M, Leeuwenburg C, Ohno H, Ookawara T, Kishi K, Yagyu H, Nakamura H, and Matsuoka T. Effects of acute exercise on lung antioxidant enzymes in young and old rats. Mech Ageing Dev 127: 384 390, 2006. 28 Hellsten Y, Apple FS, and Sjodin B. Effect of sprint cycle training on activities of antioxidant enzymes in human skeletal muscle. J Appl Physiol 81: 1484 1487, 1996. 29 Hinchcliff KW, Reinhart GA, DiSilvestro R, Reynolds A, Blostein Fujii A, and Swenson RA. Oxidant stress in sled dogs subjected to repetitive endurance exercise. Amer J Vet Res 61: 512 517, 2000. 30 Hitomi Y, Watanabe S, Kizaki T, Sakurai T, Takemasa T, Haga S, Ookawara T, Suzuki K, and Ohno H. Acute exercise increases expression of extra cellular superoxide dismutase in skeletal muscle and the aorta. Redox Report 13: 213 216, 2008. 31 Janicki KM, Lawrence LM, Barnes T, and Stine CJ. The effect of dietary selenium source and level on selenium concentration, glutathione peroxidase activity, and influenza titers in broodmares and their foals. Proc. 17th Equine Nutr. Physiol Soc. Symp. Lexington, KY, 2001, p. 43 44. 32 Ji LL. Antioxidants and oxidative stress in exercise. P.S.E.B.M. 1999, p. 283 292. 33 Kirshvink N, de Moffarts B, and Lekeux P. The oxidant/antioxidant equilibrium in horses. Vet J 177: 178 191, 2008. 34 Lawler JM and Powers SK. Oxidative stress, antioxidant status, and the contracting diaphragm. Can J Appl Physiol 23: 23 55, 1998. 35 Leeuwenburgh C, Hansen PA, Holloszy JO, and Heinecke JW. Hydroxyl radical generation during exercise increases mitochondrial protein oxidation and levels of urinary dityrosine. Free Radic Biol Med 27: 186 192, 1999.

PAGE 67

67 36 Leeuwenburgh C and Heinecke JW. Oxidative stress and antioxidants in exercise. Curr Med Chem 8: 829 838, 2001. 37 Lewin MH, Arthur JR, Riemersma RA, Nicol F, Walker SW, Millar EM, Howie AF, and J BG. Selenium supplementaion acting through the induction of thioredoxin reductase and glutathione peroxidase protects the human endothelial cell line EAhy926 from damage by lipid hydroperoxides. Biochim Biophys Acta 1593: 85 92, 2002. 38 Livak KJ and Schmittgen TD. Analysis of relative gene expressoin data using real time quatitative PCR and the 2 method. Methods 25: 402 408, 2001. 39 Mahan DC, Cline R, and Richert B. Effects of dietary levels of selenium enriched yeast and sod ium selenite as selenium sources fed to growing finishing pigs on performance, tissue selenium, serum glutathione peroxidase activity, carcass characteristics, and loin quality. J Anim Sci 77: 2172 2179, 1999. 40 Mahoney DJ, Parise G, Melov S, Safdar A, and Tarnopolsky MA. Analysis of global mRNA expression in human skeletal muscle during recovery from endurance exercise. FASEB J 19: 1498 1500, 2005. 41 McArdle A, Pattwell D, Vasilaki A, Griffiths RD, and Jackson MJ. Contractile activity induced oxidati ve stress: cellular origin and adaptive responses. Amer J Physiol Cell Physiol 280: 621 627, 2001. 42 McDowell LR. In: Vitamins in Animal and Human Nutrition, 2nd ed Ames, IA: Iowa State University Press, 2000, p. 155 225. 43 McDowell LR. Selenium. In : Minerals in Animal and Human Nutrition Amsterdam: Elsevier Science B. V., 2003, p. 397 448. 44 Mustacich D and Powis G. Thioredoxin reductase. Biochem J 346: 1 8, 2000. 45 NRC. Nutrient Requirements of Horses, 6th Revised Edition National Research Council, 2007. 46 Nordberg J and Arner ESJ. Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic Biol Med 31: 1287 1312, 2001. 47 Oztasan N, Taysi S, Gumustekin K, Altinkaynak K, Aktas O, Timur H, Siktar E, Keles S, A kar S, Akcay F, Dane S, and Gul M. Endurance training attenuates exercise induced oxidative stress in erythrocytes in rat. Eur J Appl Physiol 91: 622 627, 2004. 48 Pacher P, Beckman JS, and Liaudet L. Nitric oxide and peroxynitrite in health and disease. Physiol Rev 8: 315 424, 2007.

PAGE 68

68 49 Pagan JD, Karnezos P, Kennedy MAP, Currier T, and Hoekstra KE. Effect of selenium source on selenium digestibility and retention in exercised thoroughbreds. Proc Equine Nutr Physiol Soc Symp Raleigh, NC, 1999, p. 135 140. 50 Rayman MP. The importance of selenium to human health. Lancet 356: 233 241, 2000. 51 Reddy KV, Kumar TC, Prasad M, and Reddanna P. Pulmonary lipid peroxidation and antioxidant defenses during exhaustive physical exercise: the role of vitami n E and selenium. Nutrition 14: 448 451, 1998. 52 Rederstorff M, Krol A, and Lescure A. Understanding the importance of selenium selenoproteins in muscle function. Cell Mol Life Sci 63: 52 59, 2006. 53 Reid MB. Redox modulation of skeletal muscle contr action: what we know and what we don't. J Appl Physiol 90: 724 731, 2001. 54 Richardson SM, Siciliano PD, Engle TE, Larson CK, and Ward TL. Effect of selenium supplementation and source on the selenium status of horses. J Anim Sci 84: 1742 1748, 2006. 5 5 Rokitzki L, Logemann E, Sagredos AN, Murphy M, Wetzel Roth W, and Keul J. Lipid peroxidation and antioxidative vitamins under extreme endurance stress. Acta Physiol Scand 151: 149 158, 1994. 56 Schrauzer GH. Selenomethionine and selenium yeast: approp riate forms of selenium for use in infant formulas and nutritional supplements. J Med Food 1: 201 206, 1998. 57 Schrauzer GN. The nutritional significance, metabolism, and toxicology of selenomethionine. Adv Food Nutr Res 47: 73 112, 2003. 58 Shellow J S, Jackson SG, Baker JP, and Cantor AH. The influence of dietary selenium levels on blood levels of selenium and glutathione peroxidase activity in the horse. J Anim Sci 61: 590 594, 1985. 59 Sies H. Role of reactive oxygen species in biological processes. Klin Wochenschr 69: 965 968, 1991. 60 Smith KL, Harrison JH, Hancock DD, Todhunter DA, and Conrad HR. Effect of vitamin E and selenium supplementation on incidence of clinical mastitis and duration of clinical symptoms. J Dairy Sci 67: 1293 1300, 1984. 61 Stowe HD. Serum selenium and related parameters of naturally and experimentally fed horses. J Nutr 9 3: 60 64, 1967.

PAGE 69

69 62 Sunde RA. mRNA transcripts as molecular biomarkers in medicine and nutrition. J Nutr Biochem 2010. 6 3 Suzuki KT, Somekawa L, Kurasaki K, and Suzuki N. Simultaneous tracing of 76 Se selenite and 77 Se selenomethionine by absolute label ing and speciation. Toxicol Appl Pharmacol 217: 43 50, 2006. 64 Tonkonogi M, Walsh B, Svensson M, and Sahlin K. Mitochondrial function and antioxidative defence in human muscle: effects of endurance training and oxidative stress. J Physiol 528: 379 388, 2000. 65 Uchiyama S, Tsukamoto H, Yoshimura S, and Tamaki T. Relationship between oxidative stress in muscle tissue and weight lifting induced muscle damage. Eur J Physiol 452: 109 116, 2006. 66 Urso ML and Clarkson PM. Oxidative stress, exercise, and antioxidant supplementation. Toxicology 189: 41 54, 2003. 67 Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, and Telser J. Free radicals and antioxidant in normal physiological functions and human disease. Int J Biochem Cell Biol 39: 44 84, 2007. 68 Wang L, Gill R, Pedersen TL, Higgins LJ, Newman JW, and Rutledge JC. Triglyceride rich lipoprotein lipolysis releases neutral and oxidized free fatty acids that induce endothelial cell inflammation. J Lipid Res 50: 204 213, 2009. 69 Whanger PD and Butler JA. Effects of various dietary levels of selenium as selenite or selenomethionine on tissue selenium levels and glutathione peroxidase activity in rats. J Nutr 118: 846 852, 1988. 70 White A, Estrada M, Walker K, Wisnia P, Filgueira G, Val des F, Araneda O, Behn C, and Martinez R. Role of exercise and ascorbate on plasma antioxidant capacity in thoroughbred racehorses. Comp Biochem Physiol A Mol Integr Physiol 128: 99 104, 2001. 71 Wolffram S. Absorption and metabolism of selenium: Differe nces between inorganic and organic sources. Proc 15th Alltech Annu Symp Biotechnol Feed Food Ind Lexington, KY. Nottingham Univ Press, Nottingham, UK, 1999, p. 547 566. 72 Yagiela JA, Benoit PW, and Fort NF. Mechanism of epinephrine enhancement of lidoc aine induced skeletal muscle necrosis. J Dent Res 61: 686 690, 1982. 73 You HJ, Oh D h, Choi CY, Lee DG, Hahm K S, Moon AR, and Jeong HG. Protective effect of metallothionein III on DNA damage in response to reactive oxygen species. Biochim Biophys Acta 1573: 33 38, 2002.

PAGE 70

70 74 Young IS and Woodside JV. Antioxidants in health and disease. J Clin Pathol 54: 176 186, 2001. 75 Zhang S, Rocourt C, and Cheng W. Selenoproteins and the aging brain. Mech Ageing Dev 131: 253 260, 2010.

PAGE 71

71 BIOGRAPHICAL SKETCH Sarah Haverty White was born in Orlando, Florida (FL) She grew up in Clermont, FL and graduated from West Orange High School in 2003. Immediately following graduation, she moved to Gainesville, FL to attend the University of Florida (UF). She graduated from UF summa c um laude in 2007, earning her Bachelor of S cience in animal science s equine i ndustry with a minor in m anagement and s ales in a gribusiness. She is currently pursuing her Master of S cience in animal s ci ences with a specialization in equine n utrition. While growing up, her mother housed rescue horses from the humane society, nursing them back to health until they could be adopted to new homes. This was the an taking riding lessons and never looked back. Sarah has been riding and training horses since she was 10, and is currently successfully progressing up the levels in dressage with her Arabian mare, a product of her own breeding program. Upon completion of her M.S. program, Sarah plans to continue her e ducation at UF, pursuing a Doctor of Philosophy in animal sciences with a focus on equine n utrition. She hopes to be able to use the information learned and experience gained through school to continue resear ching ways to improve the well being of performance horses. She also thoroughly enjoys teaching others, and looks forward to being able to share her knowledge with future generations.