<%BANNER%>

Regulation of Growth and Thermoprotection of the Bovine Preimplantation Embryo by Insulin-like Growth Factor-1

Permanent Link: http://ufdc.ufl.edu/UFE0042137/00001

Material Information

Title: Regulation of Growth and Thermoprotection of the Bovine Preimplantation Embryo by Insulin-like Growth Factor-1
Physical Description: 1 online resource (125 p.)
Language: english
Creator: Bonilla, Aline
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: bovine, development, embryo, igf1, ivf
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF GROWTH AND THERMOPROTECTION OF THE BOVINE PREIMPANTATION EMBRYOS BY INSULIN-LIKE GROWTH FACTOR-1 Aline Quadros Santos Bonilla August 2010 Chair: Peter J. Hansen Major: Animal Molecular and Cellular Biology The function of the embryo depends upon regulation by maternally derived growth factors. One of these, IGF1, can affect function of the preimplantation bovine embryo by increasing the proportion of embryos that become blastocysts, reducing effects of heat shock on development and apoptosis, and enhancing survival rates of embryos transferred into heat-stressed recipients. It was hypothesized that pro-developmental actions of IGF1 are exerted after day 4 of development (when the embryonic genome is activated), and that the ability of IGF1 to protect embryos from heat shock is developmentally regulated and involves stimulation of genes promoting survival to stress. In a series of experiments to determine the mechanism by which IGF1 increases competence to develop to the blastocyst stage, it was demonstrated that recombinant human IGF1 increased the proportion of oocytes becoming blastocysts when added from day 4-8 or day 0-8 but not from day 0-4 post-insemination. Furthermore, IGF1 promotes development to the blastocyst stage by regulating MAPK-dependent events because inhibition of MAPK signaling by the inhibitor PD 98059 reduced effects of IGF1. Moreover, actions of IGF1 involve increased expression of genes required for blastocoel formation as indicated by the observation that IGF1 increased expression of ATP1A1. As expected, treatment of embryos with IGF1 at day 5 post-insemination reduced the block in development to the blastocyst stage caused by exposure of embryos to heat shock. In contrast, there was no thermoprotective action of IGF1 at the two-cell stage. Failure of IGF1 to protect two-cell embryos does not seem to be due to insufficient signaling molecules because IGF1R mRNA and protein was detected in two-cell and day 5 embryos, and the expression of mRNA encoding for other molecules involved in the IGF1 signaling pathway, such as PI3K, MAPK, RAF1, was higher in two-cell embryos. Thus, it is likely that IGF1 fails to be thermoprotective in two-cell embryos because of the increased sensitivity of these embryos to heat shock. A final experiment evaluated gene expression in blastocysts treated with IGF1 using microarray technology to identify candidate genes responsible for the increased survival of IGF1-treated embryos transferred during heat stress. Culture with IGF1 caused altered expression of 102 genes (40 upregulated and 32 downregulated). Among these were genes involved in developmental processes, apoptosis and antioxidant defense. Taken together, these investigations indicate that IGF1 can regulate embryonic development and resistance to heat stress but that these actions occur at or after day 4 of development, at a time after embryonic genome activation. Furthermore, the pro-developmental effects of IGF1 involve actions mediated by the MAPK pathway and include alteration of genes controlling formation of the blastocoelic cavity. Genes regulated by IGF1 at the blastocyst stage, such as those involved in development, apoptosis and protection from oxidative stress could be involved in the increase in embryonic survival after transfer to heat stressed recipients caused by IGF1.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Aline Bonilla.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Hansen, Peter J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042137:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042137/00001

Material Information

Title: Regulation of Growth and Thermoprotection of the Bovine Preimplantation Embryo by Insulin-like Growth Factor-1
Physical Description: 1 online resource (125 p.)
Language: english
Creator: Bonilla, Aline
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: bovine, development, embryo, igf1, ivf
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF GROWTH AND THERMOPROTECTION OF THE BOVINE PREIMPANTATION EMBRYOS BY INSULIN-LIKE GROWTH FACTOR-1 Aline Quadros Santos Bonilla August 2010 Chair: Peter J. Hansen Major: Animal Molecular and Cellular Biology The function of the embryo depends upon regulation by maternally derived growth factors. One of these, IGF1, can affect function of the preimplantation bovine embryo by increasing the proportion of embryos that become blastocysts, reducing effects of heat shock on development and apoptosis, and enhancing survival rates of embryos transferred into heat-stressed recipients. It was hypothesized that pro-developmental actions of IGF1 are exerted after day 4 of development (when the embryonic genome is activated), and that the ability of IGF1 to protect embryos from heat shock is developmentally regulated and involves stimulation of genes promoting survival to stress. In a series of experiments to determine the mechanism by which IGF1 increases competence to develop to the blastocyst stage, it was demonstrated that recombinant human IGF1 increased the proportion of oocytes becoming blastocysts when added from day 4-8 or day 0-8 but not from day 0-4 post-insemination. Furthermore, IGF1 promotes development to the blastocyst stage by regulating MAPK-dependent events because inhibition of MAPK signaling by the inhibitor PD 98059 reduced effects of IGF1. Moreover, actions of IGF1 involve increased expression of genes required for blastocoel formation as indicated by the observation that IGF1 increased expression of ATP1A1. As expected, treatment of embryos with IGF1 at day 5 post-insemination reduced the block in development to the blastocyst stage caused by exposure of embryos to heat shock. In contrast, there was no thermoprotective action of IGF1 at the two-cell stage. Failure of IGF1 to protect two-cell embryos does not seem to be due to insufficient signaling molecules because IGF1R mRNA and protein was detected in two-cell and day 5 embryos, and the expression of mRNA encoding for other molecules involved in the IGF1 signaling pathway, such as PI3K, MAPK, RAF1, was higher in two-cell embryos. Thus, it is likely that IGF1 fails to be thermoprotective in two-cell embryos because of the increased sensitivity of these embryos to heat shock. A final experiment evaluated gene expression in blastocysts treated with IGF1 using microarray technology to identify candidate genes responsible for the increased survival of IGF1-treated embryos transferred during heat stress. Culture with IGF1 caused altered expression of 102 genes (40 upregulated and 32 downregulated). Among these were genes involved in developmental processes, apoptosis and antioxidant defense. Taken together, these investigations indicate that IGF1 can regulate embryonic development and resistance to heat stress but that these actions occur at or after day 4 of development, at a time after embryonic genome activation. Furthermore, the pro-developmental effects of IGF1 involve actions mediated by the MAPK pathway and include alteration of genes controlling formation of the blastocoelic cavity. Genes regulated by IGF1 at the blastocyst stage, such as those involved in development, apoptosis and protection from oxidative stress could be involved in the increase in embryonic survival after transfer to heat stressed recipients caused by IGF1.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Aline Bonilla.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Hansen, Peter J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042137:00001


This item has the following downloads:


Full Text





REGULATION OF GROWTH AND THERMOPROTECTION OF THE BOVINE
PREIMPLANTATION EMBRYO BY INSULIN-LIKE GROWTH FACTOR-1















By

ALINE QUADROS SANTOS BONILLA


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2010



























2010 Aline Quadros Santos Bonilla
































To my parents, my brothers, my nephews and my husband









ACKNOWLEDGMENTS

I would like to express my deep appreciation to Dr Peter J. Hansen for the

guidance, encouragement, dedication and financial support. Dr Hansen gave me the

opportunity to complete my PhD in the Animal Molecular and Cellular Biology graduate

program and I am very grateful for his enthusiasm and patience. I would also like to

thank my supervisory committee, Dr Alan Ealy, Dr. Kenneth C. Drury and Dr. James L.

Resnick, for their contributions and suggestions.

I would like to thank my lab mates, Justin Fear, Dr James Moss, Dr. Jeremy Block,

Dr. Katherine Hendricks, Dr. Luciano Bonilla, Dr. Lilian Oliveira, Dr. Maria Padua, Dr.

Ozawa Manabu, Dr Barbara Loureiro, Dr. Silvia Carambula and Sarah Fields. I am

thankful for their help, suggestions and friendship in the lab.

I also thank the personnel at Central Packing Co., Center Hill, FL, for providing the

ovaries used in my experiments, and to William Rembert, for his willingness and

dedication to collect ovaries for the experiment. I thank the students, faculty and staff of

the Department of Animal Sciences and the Animal Molecular and Cell Biology program

for their support and friendship.

A special thanks to my office mates Izabella Thompson, Leandro Greco, Luciano

Silva and Lilian Oliveira, for the good times, laughs and meaningful friendship. Thanks

to my friends in Brazil for their endless friendship and support.

I extend my sincere appreciation to my parents Heron and Marlove for their love

and moral and financial support, and also to my brothers Helder and Andre. They were

always there in the moments when I missed home and family. Finally I would like to

thank my husband Luciano Bonilla for his support, patience and encouragement in the

good and tough times that we had in our new adventure of living in the United States.









TABLE OF CONTENTS


page

ACKNOWLEDGMENTS ...... ................. .................... ........................4

LIST O F FIG URES ................................. .......................... ....... ............. 8

LIST OF ABBREVIATIONS .................. ................................... .............. 9

A B S T R A C T ............................................................................................ 1 1

CHAPTER

1 LITERATURE REVIEW .................. .............................. .. ... .. ............... 13

Introd auction ........... ............................ ...................................................... .............. 13
Key Events During Preimplantation Development in the Bovine.............................. 15
Embryonic Genome Activation ............ ...... ............... ............... 15
Epigenetic M modifications ...... .... ......._... .... ...... ...... ................. ............. 16
Polarization and Formation of the Blastocyst.................................................... 19
O ocyte S o urc e ............................................. ....................... 2 1
Conditions for Oocyte Maturation ................ ...... .... ...... ................ 22
F e rtiliz a tio n ..................... ... .... ........ ... .... ..................................... 2 3
Culture Conditions for the Embryo ................. ............ ......... .............. 23
Use of IGF1 to Improve Embryonic Development in Vitro ....................................25
Biology of IG F1 ......................... ..... ........... .... ........................25
Signaling by IG F1 ................... .... .... ........... .......................... 26
IGF1 in the Reproductive Tract ......................................................29
Actions of IGF1 on Embryonic Development and Survival ..............................30
IGF1 and Fertility During Heat Stress ....................... ......... ................ 31
Effect of Heat Stress on Fertility ................................................ ...... ................ 31
H eat Shock and IG F1 ..................... ..................................... ................ 33
H hypothesis and O objectives .......... .......... .................... ............. ... ..... 35

2 ACTIONS OF INSULIN-LIKE GROWTH FACTOR-1 TO INCREASE
DEVELOPMENT OF BOVINE EMBRYOS TO THE BLASTOCYST STAGE .........40

In tro d u c tio n .................................................................................... 4 0
M ateria ls a nd M methods ........................................................................... 4 1
M a te ria ls ......................................................... ............................ 4 1
In V itro Production of Em bryos ................... ............. ................. ....... ..42
Concentration-Dependent Actions of IGF1 to Increase Blastocyst
D eve lo p m e nt ................ ........ ......... ........ ....... ... ...... .......... ................4 3
Determination of the Stage of Development at Which IGF1 Acts to Increase
B lastocyst D evelopm ent ............................................................... .. ............ 44
Role of MAPK and P13K Signaling Pathway in IGF1 Actions..........................44









Action of IGF1 on Expression of Genes Controlling Compaction and
Blastocyst Form ation ........... .... ................... ... ....... .. ............... 45
Statistical Analysis ............... ............. ......................... ... ...... 46
Results ...... .............................................. 46
Concentration-Dependent Actions of IGF1 to Increase Blastocyst
D eve lo p m e nt ........... ......... ................. ... .............. ................. ................46
Determination of the Stage of Development at Which IGF1 Acts to Increase
Blastocyst Developm ent ................... ..... ....... ..... ........ ................... 47
Effect of Inhibition of MAPK and P13K Signaling on Actions of IGF1 to
P rom ote D evelopm ent .................................. .................... .................. .. ...... 47
Action of IGF1 on Expression of Genes Controlling Compaction and
Blastocyst Form ation ................ ......................... .......................... 48
D is c u s s io n ...................... .. ............. .. ................................................... 4 8

3 DEVELOPMENTAL CHANGES IN THERMOPROTECTIVE ACTIONS OF
INSULIN-LIKE GROWTH FACTOR-1 ON THE PREIMPLANTATION BOVINE
EM BRY O ................................................................. .. ................ 57

In tro d u c tio n .................................................................................... 5 7
M materials and M methods ............................................................. ... 58
Em bryo Culture Media and Additives ...... .......... ........................................ 58
In vitro Production of E m bryos ...................................................... ................. .. 59
Protective Effect of IGF1 on Heat Shocked Embryos at 410C .........................60
Protective Effect of IGF1 on Day 5 Embryos Exposed to Heat Shock at
4 2 0C ........... ................. .......... ........... .. .............. ... ................................ 6 1
Developmental Changes in Expression of Genes Involved in IGF1 Signaling..61
Immunofluorescent Analysis of Insulin-like Growth Factor 1 Receptor
(IGF1 R) ................................................. ................ 63
M icroarray Hybridization .... .. ......................... ........ ...... .... ......... 64
Microarray Data Analysis ...................... ................ .......... ........... ..... 66
q P C R ................. ..... .. .. ......... .. .. .............................................. 6 6
Statistical A analysis ............. .... ............. ........... .......................... 67
Results ............................................ ....... .. ........... ... ............... 68
Thermoprotective Actions of IGF1 on Two-cell and Day 5 Embryos ..............68
Gene Expression of Molecules Involved in IGF1 Signaling.............................. 69
Presence of IGF1 R in Two-cell and Day 5 Embryos .............................. 69
Effect of IGF1 on Gene Expression in Blastocysts................ ................ 69
Validation of M icroarray Data by qPCR ........................... ..... ...... .......... 71
D discussion ............... ....................................... ........................... 72

4 G EN ERA L D ISC U S S IO N ................................................ .............................. 94

LIST OF REFERENCES .......... .................................. ............ .............. 100

B IO G R A P H IC A L S K E T C H ................................................ .......................................... 12 5









LIST OF TABLES
Table page

1-1 Known actions of insulin like growth factor binding proteins ..............................29

2-1 Prim er sets for qPCR ......... .................................... ..... .. ................. 51

3-1 Primer sets for quantitative real-time RT-PCR (Exp. 1).......................................78

3-2 Primer sets for quantitative real-time RT-PCR (Exp.2).......................................78

3-3 Primer sets for quantitative real-time RT-PCR (microarray validation)................79

3-4 Genes upregulated by IGF1 treatment................................................ 80

3-5 Genes downregulated by IGF1 treatment ............. ........................... 84

3-6 Significant biological process gene ontology terms for differentially expressed
g e n es in b lastocysts ................ ........................................................ 8 7









LIST OF FIGURES


Figure page

1-1 IGF1 signaling transduction mediated by IGF1R ....... ... ......................... 28

1-2 Potential actions of IGF1 on embryonic development. ................................ ... 37

2-1 Concentration-dependent effects of IGF1 on the percent of oocytes that
cleaved and that became blastocysts at day 7 and day 8 post-insemination......52

2-2 Improvement in blastocyst development when IGF1 is added from day 4-8 of
culture but not when added from day 0-4.................... ............ ................ 53

2-3 Representative images of day 8 embryos when IGF1 was used in different
days of culture ................ .............. ... ........ ...... ........ ...... ........... 54

2-4 Effect of the MAPK inhibitor PD 98059 and the P13K inhibitor LY294002 on
actions of IGF1 to increase the percent of blastocysts at day 7 and day 8
post-insem nation ................ .................... ....................................... 55

2-5 Effects of IGF1 on expression of genes involved in compaction and
blastocoel form action ........... .......... ................. ...... ............... ........... 56

3-1 Representative results of analysis of RNA from KSOM (control) and IGF1
treated embryos used for microarray, determined by Agilent 2100
Bioanalyzer RNA 6000 Pico Labchip Kit. ................................. .................. ..... 88

3-2 Effect of IGF1 on the reduction in development caused by a heat shock of
41C at the two-cell stage and day 5 of development (embryos > 16 cells)........ 89

3-3 Effect of IGF1 on the reduction of development caused by exposure of day 5
embryos (2 16 cells) to a heat shock at 42 C. ..... ........ ..... ................. 90

3-4 Changes in expression of genes involved in IGF1 signaling at the two-cell
and day 5 (>16 cells) stage as determined by qPCR .............. ........ ...........91

3-5 Expression of IGF1R protein in two-cell and day 5 (2 16 cells) embryos ............92

3-6 Fold-change in gene expression using qPCR (y axis) and microarray
hybridization (x-axis) for a selected group of six differentially expressed
genes ...................................................... .................... .... .... .... .. 93

4-1 Developmental actions of IGF1 to promote blastocyst formation and protect
from heat shock.............. .................. ............ ...... ..... ............ 96









LIST OF ABBREVIATIONS

The following list describes abbreviations used in the dissertation. In addition, symbols
for genes and proteins were used according to procedures outlined in the Guide for
Authors to Biology of Reproduction
(http://www.biolreprod.org/site/misc/NomenBullets.xhtml). Gene symbols are used
without definition and were obtained from the EntrezGene website of the National
Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/gene).


ANOVA

BSA

bST

cDNA

COCs

CT

DAPI

AACT

DEPC

DNMT

DMSO

DNA

EGA

GH

IVP

ICM

IGF1

KSOM

KSOM-BE2

PBS


Analysis of variance

Bovine serum albumin

Recombinant bovine somatotropin

Complementary DNA

Cumulus-oocyte complexes

Cycle threshold

Diamidino-2-phenylindole

Delta delta CT

Diethylpyrocarbonate-treated

DNA methyltransferase

Dimethyl sulfoxide

Deoxyribonucleic acid

Embryonic genome activation

Growth hormone

In vitro production

Inner cell mass

Insulin-like growth factor 1

Potassium simplex optimized medium

KSOM-bovine embryo 2

Phosphate buffered saline









PVP Polyvinylpyrrolidone

qPCR Quantitative real-time RT-PCR

ROS Reactive oxygen species

RT-PCR Reverse transcription PCR

SAS Statistical Analysis System

SOF-BE1 Synthetic oviduct fluid -bovine embryo 1

TALP Tyrodes albumin lactate pyruvate

TBS Tris buffered saline

TBST TBS + Tween 20

TCM Tissue culture medium

TE Trophectoderm

TL Tyrodes lactate









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

REGULATION OF GROWTH AND THERMOPROTECTION OF THE BOVINE
PREIMPANTATION EMBRYOS BY INSULIN-LIKE GROWTH FACTOR-1

Aline Quadros Santos Bonilla

August 2010

Chair: Peter J. Hansen
Major: Animal Molecular and Cellular Biology

The function of the embryo depends upon regulation by maternally derived growth

factors. One of these, IGF1, can affect function of the preimplantation bovine embryo by

increasing the proportion of embryos that become blastocysts, reducing effects of heat

shock on development and apoptosis, and enhancing survival rates of embryos

transferred into heat-stressed recipients. It was hypothesized that pro-developmental

actions of IGF1 are exerted after day 4 of development (when the embryonic genome is

activated), and that the ability of IGF1 to protect embryos from heat shock is

developmentally regulated and involves stimulation of genes promoting survival to

stress.

In a series of experiments to determine the mechanism by which IGF1 increases

competence to develop to the blastocyst stage, it was demonstrated that recombinant

human IGF1 increased the proportion of oocytes becoming blastocysts when added

from day 4-8 or day 0-8 but not from day 0-4 post-insemination. Furthermore, IGF1

promotes development to the blastocyst stage by regulating MAPK-dependent events

because inhibition of MAPK signaling by the inhibitor PD 98059 reduced effects of IGF1.

Moreover, actions of IGF1 involve increased expression of genes required for blastocoel

formation as indicated by the observation that IGF1 increased expression of ATPIA1.









As expected, treatment of embryos with IGF1 at day 5 post-insemination reduced

the block in development to the blastocyst stage caused by exposure of embryos to

heat shock. In contrast, there was no thermoprotective action of IGF1 at the two-cell

stage. Failure of IGF1 to protect two-cell embryos does not seem to be due to

insufficient signaling molecules because IGFIR mRNA and protein was detected in two-

cell and day 5 embryos, and the expression of mRNA encoding for other molecules

involved in the IGF1 signaling pathway, such as P13K, MAPK, RAF1, was higher in two-

cell embryos. Thus, it is likely that IGF1 fails to be thermoprotective in two-cell embryos

because of the increased sensitivity of these embryos to heat shock.

A final experiment evaluated gene expression in blastocysts treated with IGF1

using microarray technology to identify candidate genes responsible for the increased

survival of IGF1-treated embryos transferred during heat stress. Culture with IGF1

caused altered expression of 102 genes (40 upregulated and 32 downregulated).

Among these were genes involved in developmental processes, apoptosis and

antioxidant defense.

Taken together, these investigations indicate that IGF1 can regulate embryonic

development and resistance to heat stress but that these actions occur at or after day 4

of development, at a time after embryonic genome activation. Furthermore, the pro-

developmental effects of IGF1 involve actions mediated by the MAPK pathway and

include alteration of genes controlling formation of the blastocoelic cavity. Genes

regulated by IGF1 at the blastocyst stage, such as those involved in development,

apoptosis and protection from oxidative stress could be involved in the increase in

embryonic survival after transfer to heat stressed recipients caused by IGF1.









CHAPTER 1
LITERATURE REVIEW

Introduction

Successful pregnancy is ensured when the zygote formed as a result of

fertilization encounters a suitable environment that will nourish it and allow it to develop

to term. One of the most critical periods of development occurs during the initial weeks

of pregnancy when the embryo is dependent of growth factors, hormones, and

cytokines derived from the oviduct and uterus [4-5]. Several factors can cause

pregnancy loss during this period including fertilization of a compromised oocyte,

chromosomal abnormalities, errors in embryonic development, infectious agents, and

other inadequacies in the uterine environment [4, 6-7].

Embryonic mortality is a particular problem for lactating dairy cows. Only 30-40%

of all inseminated cows become pregnant, and the pregnancy rate has declined in the

last 4 decades [7-8]. There are many reasons for reduced fertility in dairy cows including

altered follicular development [9-10], reduced steroid concentrations [11-12] and

increased susceptibility to heat stress [13-14].

One possible strategy for improving fertility in compromised populations of animals

is embryo transfer using in vitro production (IVP) of embryos. This technology was

originally developed with the view to improve genetic selection by increasing the

number of offspring from genetically-superior animals [15-16]. In cases where

pregnancy rates to artificial insemination are low, however, such as during heat stress,

transfer of IVP embryos can improve fertility in dairy cows [17-19].

Many advances in the techniques for in vitro maturation, fertilization and culture

have been achieved. Nonetheless, in vitro embryo technologies pose several problems,









including reduced embryo survival after transfer, decreased survival to cryopreservation

and increased neonatal calf loss [20-23]. Indeed, the embryo derived in vivo remains

the predominant type of embryo used in embryo transfer. According to data from the

International Embryo Transfer Society, only 34% of embryos transferred in 2008 were

produced in vitro [24].

One reason for the altered development of the in vitro produced embryo is the

difficulty in recreating in vitro the uterine environment with all the critical growth factors,

cytokines, hormones and other substances present in that environment that regulate

embryonic function. Accordingly, one approach to improve competence of the IVP

embryo is to modify culture conditions to more closely mimic the reproductive tract. A

molecule that holds promise for improving development of embryos in vitro is IGF1.

Circulating IGF1 is synthesized and secreted primarily by the liver [25] and, in the cow,

is also expressed in several reproductive tissues including ovary, oviduct, uterus and

embryo [26-30]. IGF1 can affect function of the preimplantation bovine embryo by

increasing the proportion of cultured embryos that become blastocysts [1, 3, 31-34],

reducing effects of heat shock on development and apoptosis [1-2], and enhancing

survival rates of embryos transferred into heat-stressed recipients [35].

Treatment of embryos cultured with IGF1 thus has the potential to increase

blastocyst yield and to increase subsequent pregnancy rate after transfer into heat-

stressed recipients. For IGF1 to be a practical treatment for enhancing embryonic

resistance to stress in vivo, it must be active at the earliest stages of development when

embryos are most susceptible to stress [36-37]. It is not known, however, how early in

development IGF1 can affect embryo physiology. Moreover, little is known about the









molecular basis of how IGF1 mitigates the effects of heat stress on embryo

development, increases embryonic survival following transfer during hot season and

increases bovine embryonic development.

The objectives of this dissertation were to 1) determine the mechanisms by which

IGF1 acts to increase the percent of oocytes becoming a blastocyst, 2) evaluate the

molecular basis for the developmental acquisition of thermoprotective actions of IGF1

on preimplantation embryos, and 3) identify candidate genes induced by IGF1 in

blastocysts that could mediate effects of IGF1 on embryonic survival during heat stress.

Key Events During Preimplantation Development in the Bovine

A series of key events takes place after fertilization to allow normal embryonic

development. In the cow, the first week of pregnancy sees the embryo initiate cleavage

divisions, activate its own genome and differentiate into trophectoderm (TE) and inner

cell mass (ICM). Errors in these events, whether caused by environment or genetic or

epigenetic factors, can lead to abnormal embryo development and pregnancy loss.

Embryonic Genome Activation

Embryonic genome activation (EGA) or the maternal-zygotic transition as it is

sometimes called, is the process by which embryonic transcription is activated [38]. In

the cow, EGA occurs between the 8-16 cell stage [39-40]. Until this time, maternal

mRNA and protein support embryonic development. In the period before EGA, the

embryo has a mRNA population similar to the one in the oocyte, whereas the 8-cell

embryo exhibits an mRNA profile more comparable with the one found in blastocysts

[41-42].

Activation of transcription is associated with increased translation of maternal

mRNA for RNA polymerase IIA [43]. Inhibition of this polymerase has no effect on









development up to the 16-cell stage but blocks embryo development beyond the 16-cell

stage [43], showing that transcription of embryonic genes is essential for normal

development only after the 16-cell stage.

There is evidence for a limited amount of transcription before the 8-16 cell stage

[42, 44]. Incubation of two-, four-, and eight-cell bovine embryos with [35S]UTP or

[3H]uridine resulted in incorporation of label into the RNA, indicating transcriptional

activity [43, 45]. Furthermore, two-cell embryos were capable of synthesizing HSPA1A

in response to heat shock and this effect of heat shock was blocked by addition of

transcriptional inhibitors such as a-amanitin and actinomycin D [46-47].

The duration of the period of maternal control has been attributed to the stability of

maternal mRNA [48]. Before EGA, there is a gradual degradation of maternal RNA and

protein [38, 49] and a decrease in protein synthesis [50]. Some possible mechanisms

for the degradation of maternal mRNA include binding of microRNAs to the

3'untranslated region of target RNA to repress their translation, regulatory RNAs that

can bind to the 3'untranslated region and target the mRNA for degradation [38], and

reduced availability of ribosome needed for translation [51].

Epigenetic Modifications

The newly formed embryo reprograms its new genome during early

embryogenesis and preimplantation development [52]. Such reprogramming involves

epigenetic modifications [53]. Inefficient reprogramming of DNA methylation may be in

part responsible for low birth rates and development abnormalities. Abnormal DNA

methylation has been found in bovine cloned embryos from the two-cell to the

blastocyst stage compared to in vitro produced embryos [54-55]. Furthermore, Li et al.

[56] found abnormal DNA methylation, histone acetylation and gene expression in









cloned calves that died during the perinatal period or at least 6 months after the prenatal

period compared to in vivo produced animals.

Bovine embryos undergo DNA demethylation during early cleavage stages with

demethylation reaching a nadir at the 8-cell stage (day 2-3 post-insemination) [57].

Demethylation is followed by de novo methylation beginning at the 8-cell to the 16-cell

stage (day 4 post-insemination) [57-59]. However, the pattern of demethylation differs

between paternally and maternally-derived DNA. Paternal DNA starts demethylation

before the first cell division and demethylation is complete around the two-cell stage.

Demethylation of maternal DNA does not begin until close to two-cell stage and is

completed around the 8-16 cell stages when de novo methylation is initiated [57-58].

Methylation takes place on the 5'-cytosine residues at CpG dinucleotides [60-62]

and is catalyzed by enzymes known as DNA methyltransferase (DNMT) [62-63]. The

DNMT family members, which include DNMT1, DNMT2 and DNMT3 [63-64], are

classified as de novo and maintenance methyltransferases [63]. DNMT1 is believed to

function primarily as a maintenance methyltransferase although it also is involved in de

novo methylation (methylation is re-established) [64]. There are three isotypes:

DNMT1s (the somatic form), DNMT1 o (oocyte-specific form) and DNMT1 p (sperm

specific form) [64-65]. DNMT2 has a weak methylation activity but may play a role in

centromere function [63-64]. DNMT3a and DNMT3b and DNMT3L have been identified

as de novo methyltransferases [63-64, 66-67].

In mouse, it was found that DNMT1 is expressed in oocytes and throughout

preimplantation, DNMT2 has low abundance throughout preimplantation development

and expression increases between 8-cell and morula/blastocyst stage, DNMT3a is high









in oocyte and early embryos and DNMT3b is low in oocytes and early embryos and

increases in morulae and blastocysts [68]. In the bovine embryo, DNMT1, DNMT2,

DNMT3a and DNMT3b are present from the 2-cell to the blastocyst stage [69].

DNA methylation plays an important role in genomic imprinting, both in silencing

certain genes as well as activating others [62]. Imprinted genes are those where there is

monoallelic expression that is parent-of-origin dependent [70]. The majority of paternally

expressed genes enhance fetal growth while maternally expressed genes suppress

fetal growth [62]. IGF2 and IGF2R are two examples of imprinted genes (paternally and

maternally expressed, respectively) [71]. Altered expression of IGF2 was related to

defects of organs in cloned calves experiencing neonatal death [72]. Imprinting is

established in the germline [73], in female mammals, imprinting autosomal genes are

established during folliculogenesis while in males, imprints are reset during fetal

development [74]. Histone modification is another important epigenetic process

whereby histones undergo acetylation, methylation, phosphorylation, ubiquitylation or

sumoylation [60].

Histone acetyltransferases are enzymes involved in histone acetylation, and

acetylated chromatin becomes more open and accessible for transcription [52, 75-76].

Acetylation can be removed by histone deacetylases leading to a more closed

chromatin and repression of transcription [60, 75]. Histome modifications undergo

dynamic changes during preimplantation development, for example, ICM and TE in the

blastocyst have different histone modification profiles [60]. Expression of these enzymes

was detected in all stages of bovine embryo development, indicating maternal and

embryonic expression [77].









Polarization and Formation of the Blastocyst

After the first cleavage, the blastomeres of the two-cell embryo are at a right angle

to each other. Thereafter, blastomeres divide asynchronously [51, 78]. The cells that

divide early contribute more to the ICM than the cells that divide later [78-79]. This first

division is thought to be involved in the establishment of the embryonic/abembryonic

axis, which is involved in blastocyst polarity (ICM and polar TE at embryonic pole, and

blastocoele and mural TE at the abembryonic pole) [79]. The polarization process is not

well known in the cow but there are two models to explain the process in the mouse: the

"inside-outside hypothesis" and the "cell polarity model"[79]. The first model proposes

that cell position and cell-to-cell contact in the late morula determines cell fate [79]. The

"cell polarity model" proposes that cell fate is established well before compaction, at the

8-cell stage in the mouse [80] and the differentiation pathway (ICM vs TE) depends

upon whether cells undergo symmetric or asymmetric cell divisions lead to cell polarity

along the radius of the early morula [79]. This process of polarization is an important

determinant of cell fate because cells in contact with the external environment become

TE while cells in the interior of the embryo are destined to form the ICM [78].

The first morphogenetic step of differentiation is the process of compaction, which

occurs on day 4 to 5 post-insemination at the 16 to 32-cell stage in the cow [78] and is

characterized by a change in appearance of the embryo so that individual cell borders

are not discernable. Compaction is caused by establishment of adherens junctions

between blastomeres [81-83]. In the absence of E-cadherin (a component of adherens

junctions), for example, there is a decrease in the proportion of embryos becoming a

blastocyst [84], and embryos fail to form trophectodermal epithelium [85]. The

development of junctions between blastomeres results in the formation of different









compartments within the embryo. Some blastomeres remain in contact with the external

environment whereas other cells are totally surrounded by other blastomeres.

Following compaction and establishment of cell polarity, the process of blastocyst

formation begins involving cavitation and differentiation of blastomeres to TE and ICM.

Cavitation is mediated by fluid transfer across the blastomeres and formation of a cavity

filled with fluid, the blastocoel, at day 6-8 post-insemination [81]. Cavitation requires two

cellular processes. First, water is moved into the interior extracellular space of the

embryo by the combined actions of ATPIA1 (which uses ATP to pump Na out of and

K into the cell) and aquaporins (which allow water movement directly across the cell) to

form the fluid-filled blastocoelic cavity [81, 83]. The inhibition of ATPIA1 with ouabain

caused a decrease in blastocyst diameter [86], and disruption in gene expression of

ATPIA inhibited blastocyst formation [87].

Secondly, the intercellular junctions between cells (including tight junctions,

adherens junctions and desmosome junctions) are required to maintain a impermeable

seal between the inside and outside of the embryo and prevent blastocoelic fluid from

diffusing out of the embryo [83, 88]. Tight junctions contribute to the maintenance of cell

membrane polarity and intercellular signaling, and are composed of occludin and

claudin proteins [83, 88].

Gap junctions allow communication between adjacent cells, and are composed of

connexins [88-89]. The role of gap junctions for embryo development is controversial,

since in some studies the use of inhibitors or knockout animals for connexin caused no

interference in early embryo development [90-91], whereas in other studies using

antibody inhibitors, embryo lethality was induced [83, 89]. Adherens junctions are









formed from E-cadherin and catenins and are involved in cell-to-cell adhesion, [88].

Desmosomes also play a role in cell-cell interaction, stabilizing the TE during blastocyst

formation and expansion [88, 92].

Challenges Associated with Production of In Vitro Produced Embryos

Advances in in-vitro maturation, fertilization and culture are still required to

optimize embryo competence for post-transfer development and eliminate inefficiencies

and problems that limit use of IVP embryos [93]. As compared to embryos produced in

vivo, IVP embryos have a reduced probability of developing to the blastocyst stage [94-

95], decreased pregnancy rates and increased number of fetuses and calves with

abnormalities [96-97], and lowered cryotolerance [17, 94, 98-100]. The reduced

competence of the IVP embryo is associated with altered ultrastructural and

physiological features such as decreased volume of mitochondria [101-102], higher

rates of chromosomal abnormalities [103-105], and altered gene expression [102, 106-

107]. There are several possible causes for reduced competence of IVP embryos that

are described below.

Oocyte Source

In cattle, approximately 90% of immature oocytes undergo maturation in vitro and

about 80% undergo fertilization, but only 20 to 40% reach the blastocyst stage [102].

Oocyte source is an important factor affecting in vitro embryo production. Many of the

oocytes used in IVP are obtained from abattoir ovaries, and oocytes are collected from

follicles of different sizes. Follicle diameter affects oocyte competence to develop to the

blastocyst stage [108-112]. For example, 66% of oocytes from follicles > 6 mm became

blastocysts after in vitro fertilization versus a value of 34% for oocytes from 2-6 mm

follicles [108].









Differences in animal age also influence oocyte quality. Zygotes derived from

prepuberal calf oocytes had ultrastructural abnormalities after maturation and cleaved

and developed at a lower rate compared to adult cattle oocytes [113]. In another study,

oocytes derived from cows had significantly higher blastocyst yield at day 8 than that

from heifers [114-115].

Conditions for Oocyte Maturation

Oocytes matured in vivo are more competent than those matured in vitro. Rizos et

al. [94] found a reduced rate of blastocyst development for oocytes matured in vitro as

compared to those matured in vivo (39 and 58%, respectively). Katz-Jaffe et al. [116]

reported that in vitro matured bovine oocytes had decreased amounts of mRNA for

genes involved in volume regulation, osmoreception and cell cycle progression such as

AQP3 and SEPT7, and increased expression of SIAH2, involved in stress-induced

apoptosis. Also, mRNA for three imprinted genes, IGF2R, PEG3 and SNRPN, were

present in higher amounts for oocytes matured in vitro [116]. Furthermore in vitro

maturation can affect gene expression in the resulting blastocyst. The addition of bovine

serum albumin in maturation medium increased expression of IGFIR, IGF2 and IGF2R

in day 9 bovine blastocysts and the use of fetal bovine serum in maturation medium

increased mRNA for HSPA 1A [117].

Improvement of maturation conditions to increase oocyte maturation and

blastocyst development can be achieved by addition of factors in maturation medium

such as linolenic acid [118], sodium nitroprusside [119], leptin [120], polyvinyl alcohol-40

and follicle-stimulating hormone [121-122].









Fertilization

Fertilization conditions can affect developmental potential of the subsequent

embryo. Using in vivo matured oocytes, Rizos et al.[94] reported that a greater

proportion of inseminated oocytes became blastocysts when oocytes were fertilized in

vivo (74%) than when oocytes were fertilized in vitro (58%).

Many aspects of in vitro fertilization have been studied to improve blastocyst

development. Aging of sperm before in vitro fertilization reduced cleavage rates [123].

The use of heparin [124] and adjustment of sperm concentration for in vitro fertilization

has improved fertilization and blastocyst yield [125]. Individual bulls require different

concentration of heparin and sperm for in vitro fertilization [125]. Moreover, the sire

used for fertilization can affect the proportion of embryos that develop to the blastocyst

stage [126].

Different methods for sperm purification for in vitro fertilization have been used.

Higher cleavage rates and embryo development were obtained when Percoll gradient

was used for sperm purification than when a fertilization medium was used alone or with

20% bovine albumin serum [124]. Fertilization time is another factor that can influence

blastocyst development. Recent data have shown that the proportion of cleaved

embryos that developed to the blastocyst stage was higher for embryos produced by

incubation of oocytes with sperm for 6 hr as compared to 9, 12 or 18 hr [127].

Culture Conditions for the Embryo

One important aspect of IVP affecting embryo competence is the period of embryo

culture after fertilization. One model to demonstrate this concept has been to compare

embryos produced and cultured in vitro with embryos produced by in vitro maturation

and fertilization and then placed in the ewe oviduct for development to the blastocyst









stage. Embryos cultured in vivo had higher development to the blastocyst stage and

higher survival rates to vitrification compared to embryos cultured in vitro [94, 98]. In

another study [128], there was no difference in rate of blastocyst development between

in vitro fertilized embryos cultured in vivo or in vitro but there were many transcripts that

differed between the two types of embryos. For day 7 blastocysts, there was higher

expression of IFNT, G6PD, BAX and SOXfor embryos cultured in vitro and more

expression of SOD2, IGF2, IGF1R and GJA1 for in vivo cultured embryos [128]. In

another study, bovine blastocysts produced in vitro had higher amounts of mRNA for

genes related to apoptosis (such as BAX and SOX) when compared to those produced

in vivo [99, 129]. Lazzari et al. [130] found increased mRNA abundance for HSPA 1A,

SOD1, SLC2A3, SLC2A4, and IGF1R in bovine blastocysts produced in vitro compared

with those produced either in the sheep oviduct or by superovulation.

More recently, a pairwise comparison identified 238 genes that were expressed

with a twofold or more difference between embryos produced in vivo by artificial

insemination and IVP or somatic cell nuclear transfer embryos [131]. Some of the genes

that were upregulated in IVP embryos as compared to embryos produced by artificial

insemination included HDAC3, DNMT1 and CDKN1C. Among the down-regulated

genes were ESR1 and OXTR.

Although many treatments can affect blastocyst yield, few studies have examined

embryonic survival after transfer. Addition of hyaluronan to culture increased blastocyst

yield and improved embryo survival following vitrification [132] Another molecule that

can affect competence of IVP embryos to survive transfer is CSF2. Addition of CSF2 to

embryo culture from day 5 to 7 after insemination increased pregnancy rate and calving









rate after transfer and decrease pregnancy loss [133]. The gaseous environment may

also affect embryo competence to establish pregnancy. To test this hypothesis, Merton

et al. [134] cultured IVP embryos in a conventional incubator or in an incubator with

carbon-activated air purification unit. While there was no difference in the proportion of

embryos developing to the blastocyst stage, pregnancy rate was 12.9% 14.6% higher

for fresh and frozen/thawed embryos, respectively, produced in the filtered air incubator

than in the standard incubator.

Taken together, results suggest that modification of embryo culture systems by

providing an environment that more closely matches the uterine environment is a likely

strategy to improve development and survival of IVP embryos. Important factors to

consider are media composition, presence of growth factors and cytokines, and the

gaseous environment inside the incubator.

Use of IGF1 to Improve Embryonic Development in Vitro

Biology of IGF1

The insulin-like growth factor family consists of three structurally related peptides:

IGF1, IGF2 and insulin; three cell surface receptors (IGF1 receptor, IGF2 mannose-6-

phosphate receptor and insulin receptor); and six IGF binding proteins (IGFBP-1

through 6; [135-136]). IGF1 consists of 70 amino acids and a molecular weight of 7.6

kDa [136]. The major secretagogue for IGF1 is growth hormone (GH) (or somatotropin)

from the somatotroph cells of the anterior pituitary. GH acts in an endocrine fashion at

the liver where it binds to its receptors and induces hepatic production of IGF1 [137-

139].

Even though GH is the main regulator of circulating IGF1, insulin is a metabolic

signal in the coupling of the GH/IGF1 axis. Insulin infusion in lactating cows increased









IGF1 plasma concentrations and mRNA expression for GHR and IGF1 in the liver [140].

The effect of insulin to increase hepatic IGF1 synthesis is mediated in part by the

increase in GHR protein in the liver [141].

Nutritional status of the dairy cow can influence circulating concentrations of IGF1

[142-143]. Early postpartum, there is a period of negative energy balance which is

associated with reduced expression of GHR-1A in the liver [144], reduced IGF1

synthesis [144-145] and increased concentrations of GH concentrations in plasma

[146].

Signaling by IGF1

Actions of IGF1 are mediated by the IGF1 receptor, which is a transmembrane

tyrosine kinase receptor that is activated with different potencies by at least three

different ligands: IGF1, IGF2 and insulin. IGF1R is composed of two extracellular a-

subunits and two transmembrane 3-subunits, which are linked together by disulfide

bonds to form an a3 IGF1 receptor [136, 147-148]. The a-subunits contain a cysteine-

rich binding domain. IGF1 binds to the a-subunits of the IGF1R to cause a

conformational change in the IGF1R 3-subunits resulting in the tyrosine phosphorylation

of the 3-subunits. In addition, the 3-subunits phosphorylation leads to the

phosphorylation of tyrosine residues on several docking proteins, IRS-1 and Shc-

homology protein [148]. The phosphorylation of IRS-1 triggers the activation of P13K

which increases the conversion of the PIP2 (a phospholipid component of cell

membranes) to PIP3. PIP3 binds to domains of at least two proteins, PKB/AKT and

PDK1. The PKB/AKT pathway has a role in regulation of apoptosis and cell survival,

and PDK1 activation of PKC and PKA to regulate the cell cycle and growth (Figure 1-1)

[3, 148-153].









Another signaling pathway activated by IGF1 includes the Ras/Raf/MAPK

pathway. Binding of IGF1 to IGF1R causes phosphorylation of the docking protein She

which causes formation of a complex between She and Grb2 (another adaptor protein).

Grb2 binds to guanine nucleotide exchange factor SOS and this complex promotes the

removal of GDP from Ras. Ras can then bind GTP, become activated and

phosphorylate and activate Rafl. Rafl activation, in turn, leads to a cascade of

phosphorylation events to activate the MAPKK pathway. This pathway is important in

cell differentiation, metabolism, mitogenic responses and cell cycle triggering (Figure 1-

1) [136, 147-148, 154-155].










IGF1


IGF1R


Ras-GTP shcO 1-- PIP2 ~
Ras-GTP IRS-1 PIPIP3


Rafl

I Grb2 / SOS P
MAPKKK
I PKBIAkt PDK1
MAPKK
SPKC
PKA
MAPK
y Anti-apoptotic factors
Bcl2 BclX NF-icB
Cell differentiation Cell cycle, growth
Cell proliferation Pro-apoptotic factors transcription
Cell migration FKH-P Caspase-9-P Bad-P

Figure 1-1. IGF1 signaling transduction mediated by IGF1R (modified from a drawing by
Jousan [156]. Following the bind of IGF1 to IGF1R the Ras/Raf/MAPK and
the PKB/AKT pathway are activated and can lead to increased activity of anti-
apoptotic factors and inhibition of pro-apoptotic factors, thereby decreasing
apoptosis, increasing cell differentiation, proliferation, cell cycle and growth.
MAPK pathway can also be activated through Grb2/SOS signaling by
activation of IRS-1.



IGF2R is a mannose 6-phosphate receptor that has high affinity for IGF2 and low

affinity for IGF1 and is not believed to have a major role in IGF signal transduction. It is

thought to regulate IGF2 by targeting it for clearance and degradation, and hence

inhibiting IGF2 actions [136, 157-158]. IGF1 and IGF2 actions are modified by IGFBP

which bind to IGF1 and IGF2 with high-affinity. At least 99% of the IGFs in circulation

are bound to the IGFBP, which increase IGF half-life and deliver the growth factors to

tissues. Different actions of IGFPB are summarized on Table 1-1.









Table 1-1. Known actions of insulin like growth factor binding proteins
Affinity to IGF Modulation of IGF action
IGFPB-1 1 and 2 inhibit and/or potentiate

IGFPB-2 2 more than 1 Inhibit

IGFPB-3 1 and 2 inhibit and/or potentiate
IGFPB-4 1 and 2 Inhibit

IGFPB-5 2 more than 1 Potentiate

IGFPB-6 2 more than 1 Inhibit
Modified from Rajaram et al. [159]


The IGFBP can either inhibit or potentiate IGF actions (Table 1-1) by sequestering

IGF from the IGF1R, or releasing IGFs to bind the IGF1R. The release of IGF from the

IGFBP can be induced by actions of endoproteases [160]. In addition, however, IGFBP

can bind to cell surfaces or cell matrices and thereby experience a decrease in affinity

for IGF1, and release the growth factor to act on cells [135, 157, 160]. Furthermore,

IGFBP may have bioactivity independent of IGF or without triggering IGF1R signaling

through interactions of specific domains in the IGFBP with specific domains ion the cell

surface [136, 157, 160-161].

IGF1 in the Reproductive Tract

While the primary source of circulating IGF1 is the liver, it is also expressed locally

in several reproductive tissues. In cattle, this includes the ovary [29], oviduct [28], uterus

[26, 29] and embryo from the two-cell to the blastocyst stage [27, 30, 162].

Transcripts for IGF1 were detected in cumulus oocyte complexes derived from

follicles that were 3 to 6 mm and 8 to 16 mm in diameter [163]. IGFIR mRNA was

detected in oocyte and granulosea cells of preantral and antral follicles [164-165]. IGF1

mRNA in the corpus luteum was highly expressed during the early luteal phase, with a









decrease from day 5 to 7 and then an increase from day 8 to 18 [166]. Amounts of IGF1

mRNA decreased after experimentally-induced luteolysis [167]. The role of IGF1 in the

corpus luteum is not clear but IGF1 stimulates luteal progesterone secretion [168].

Transcripts for IGF1 were localized in the mucosa and muscle layers of the

ampulla and isthmus in the bovine oviduct [28]. Highest expression of IGF1 mRNA in

the oviduct was on day 3 post-insemination for non-lactating beef heifers and on day 0-

1 for lactating dairy cows [28].

IGF1 mRNA expression in the uterus was higher at estrus and lowest during the

early and late luteal phases, and mainly localized in the sub-epithelial stroma underlying

the uterine luminal epithelium [169]. IGFBP1 and IGFBP3 mRNA have also been found

in the uterus of ewes and heifers with expression greater in pregnant than in cyclic

animals [170]. Amounts of IGFBP1 mRNA expression in the ewe uterus are upregulated

by progesterone and IFNT [170].

Expression of IGF1, IGF2 and IGFBP were studied in the uterus of postpartum

dairy cows at day 14 postpartum. IGF1 mRNA was localized in the sub-epithelial stroma

of inter-caruncular and caruncular endometrium while IGF2 and IGFIR mRNA were

localized in the deep endometrial stroma, the caruncular stroma and myometrium [171].

Expression of IGFBP3 was found in the luminal epithelium, IGFBP2, IGFBP4, IGFBP5

and IGFBP6 in the stroma and IGFBP4 and IGFBP5 in the myometrium [171].

Actions of IGF1 on Embryonic Development and Survival

IGF1 has an important effect on preimplantation embryonic development. In mice,

addition of IGF1 added to culture medium beginning at the two-cell stage increased the

proportion of embryos becoming a blastocyst and the number of cells in the ICM of the

blastocyst [172-173].









In other species too, there are data supporting a relationship between IGF1 and

embryo development and survival in vitro and in vivo. Addition of IGF1 to culture

medium increased the proportion of embryos becoming blastocysts in the bovine [31-

34], ovine [174], buffalo [175], pig [152], mouse [173] and human [176]. Additionally,

IGF1 is mitogenic and can increase total cell number of bovine blastocysts [177-180]

and decrease the number of apoptotic blastomeres [1, 3, 153, 178]. Matsui et al. [181]

used a monoclonal antibody specific for the a subunit of IGF1 receptor to block IGF1

actions on embryo development to the morula stage, showing that actions of IGF1 are

mediated by IGF1R.

Culture of bovine embryos with IGF1 increased steady-state amounts of mRNA for

IGFBP2, IGFBP5 and decreased mRNA for IGF1R in blastocysts [182]. In another

study, IGF1 altered amounts of several transcripts in blastocysts [183]. In particular,

IGF1 increased mRNA for IGFBP3 and DSC2 and tended to increase amount of

ATP1A1 and BAXmRNA. Also, there was a decrease in transcripts for HSPA1A and

IGF1R [183].

IGF1 and Fertility During Heat Stress

Effect of Heat Stress on Fertility

Heat stress is a major cause of poor reproductive function in lactating dairy cattle.

It has been shown that a 0.5 1C increase in uterine temperature on the day of

insemination reduce conception rates by 12.8% [184]. Heat stress decreases fertility by

several actions including a decrease in blood flow to the uterus [185], reduced duration

of estrus, impaired follicular development and oogenesis, and altered follicular steroid

production [14, 186-187].Oocytes that develop under elevated temperatures have

altered membrane composition, which was associated with decreased oocyte viability









and developmental competence [187-191]. Also in vitro studies showed that heat-

shocked oocytes had increased apoptosis and decreased cleavage rates [192].

Elevated temperatures (i.e., heat shock) such as experienced by heat stressed

females can also have deleterious effects on preimplantation embryos. Early embryonic

development was compromised in cows exposed to heat stress in the first seven days

of pregnancy [193-194]. In vitro exposure of embryos to elevated temperatures reduced

development to the blastocyst stage [1, 3, 195].

The magnitude of the effect of heat shock on development of preimplantation

bovine embryos is developmentally regulated. Heat stress reduced blastocyst yield in

superovulated cows when applied on day 1 of pregnancy but not at days 3, 5, or 7 of

pregnancy [194]. Heat stress also had a greater effect on embryonic mortality when

applied early in gestation in pigs [196]. In vitro, embryos were more affected by heat

shock when exposed early in development (two to four-cell stage) than when given later

in development (day 4-5 post-insemination) [36, 197-198]. Edwards et al. [36] showed

that heat shock at 41 C for 12 hr decreased blastocyst development for two-cell and

four-cell embryos (0% vs 26% and 10% vs 25% for heat shocked and control,

respectively), but did not affect morula (42% vs 37% heat shocked and control,

respectively).

There are many physiological effects of elevated temperature on the embryo that

could be responsible for disrupted development. Heat shock of the two-cell embryo

caused swelling of mitochondria and disruption of microfilaments and microtubules to

cause movement of organelles towards the center of the blastomere [199-200]. Heat

shock can increase intracellular levels of reactive oxygen species (ROS) [198], which is









correlated with DNA fragmentation [201], and with an increase in embryonic mortality

[202]. Exposure to elevated temperature can also induce apoptosis. This effect occurs

in maturing oocytes [187, 192] and embryos after the 8-16 cell stage [1, 3, 153, 203].

Overall protein synthesis in oocytes and embryos can also be reduced by heat shock,

although heat shock protein 70 increases during heat shock [10, 47], presumably to

block apoptosis and stabilize proteins denatured by heat shock [204].

Furthermore, Rivera et al. [205] have shown that two-cell embryos submitted to

heat shock were arrested and did not pass the eight-cell stage. One possible cause for

this embryonic arrest could be the increase in oxidative stress leading to higher levels of

p66shc mRNA. P66Shc is a stress adaptor protein associated with early embryonic

arrest [206-208] and it regulates mitochondrial metabolism by modulating the amount of

ROS released into the cytosol [209].

Heat Shock and IGF1

IGF1 can reduce effects of elevated temperature on the bovine preimplantation

embryo. Culture of embryos in the presence of IGF1 diminished the negative effects of

heat shock administered at day 5 post-insemination on the percent of oocytes becoming

blastocysts and number of apoptotic blastomeres [1, 3, 153]. The anti-apoptotic actions

of IGF1 are mediated through activation of the PI3K/AKT pathway because either a

P13K inhibitor or an AKT inhibitor blocked the anti-apoptotic actions of IGF1 in heat-

shocked embryos [3, 153]. In addition to protecting embryos from elevated temperature,

IGF1 can act as a survival factor to reduce effects of hydrogen peroxide on mouse

preimplantation embryos [210], induction of apoptosis by campothecin and actinomycin

D in mouse embryos [211] by menadione in bovine embryos [212] and by ultraviolet

radiation in rabbit embryos [213].









IGF1 can also improve competence of an embryo to establish and maintain

pregnancy following transfer to recipients provided the recipients are exposed to heat

stress. Lactating cows exposed to heat stress were more likely to become pregnant

following transfer of an in vitro produced embryo if the embryo was cultured in the

presence of IGF1 [33]. In another experiment, the effect of IGF1 on post-transfer

embryo survival in lactating cows was evaluated for warm and cool seasons [35, 133].

During the hot season, pregnancy rate was higher for cows receiving an embryo treated

with IGF1 (18% vs 33% for control and IGF1, respectively). During the cold season,

however, there was no difference in pregnancy rate between recipients receiving control

or IGF1 treated embryos (27.6% vs 23%, control and IGF1, respectively) [35]. Similar

results were seen in another experiment with lactating cows [133] except that the IGF1

effect was not significant.

The mechanism by which IGF1 improves embryo survival after heat shock and

after transfer into heat-stressed recipients is not known. The inhibition of apoptosis

caused by IGF1 is probably not responsible for increased survival of embryos to

elevated temperature because a similar protective effect was not caused by

administration of a caspase-3 inhibitor [3]. In fact, development is sometimes more likely

to be blocked by heat shock when caspase-3 activity is inhibited [3, 214]. Among the

actions of IGF1 that could improve survival after heat shock are mitogenesis, to

increase blastomere proliferation [178-180], and increased expression of SLC2A genes,

to increase uptake of energy substrates [215].

To determine possible factors responsible for increased survival of embryos

treated with IGF1 after transfer into heat-stressed recipients, Block et al. [183]









measured characteristics of blastocysts produced in the presence of IGF1. There was

no effect of IGF1 on blastocyst total cell number, the proportion of apoptotic

blastomeres or the ratio of TE: ICM. However, IGF1 increased transcript abundance for

ATPIA1 and DSC2 that are involved in blastocyst formation.

One possible approach to reduce the effects of heat stress on fertility is to

administer recombinant bovine somatotropin (bST). This hormone increases plasma

concentrations of IGF1 [216-218] and, in some studies, increases pregnancy rates

following timed artificial insemination [218-221]. There is little evidence that bST can

improve pregnancy rate in heat-stressed cows. However, in one study bST increased

plasma concentration of IGF1 in lactating cows exposed to heat stress but did not have

a significant effect on pregnancy rates (14.8% vs 17.2% for control and bST) [2]. Bell et

al. [222] found similar results in another study (22.4% pregnancy rate for control vs

24.8% pregnancy rate for bST). One possible reason for the ineffectiveness of bST is

that IGF1 induced by bST may not be thermoprotective in embryos at the earliest

stages of development, when thermosensitivity is highest. It is not known whether IGF1

has thermoprotective actions on bovine embryos at stages earlier than day 5 [1, 3].

Hypothesis and Objectives

This dissertation focuses on two of the main actions of IGF1 on development of

the preimplantation bovine embryo the increase in proportion of embryos that develop

to the blastocyst stage and the thermoprotective effects of IGF1 during culture and after

transfer into recipients.

Development from the one-cell stage to the blastocyst stage is accompanied by an

increase in cell number. The rate of increase in cell number, in turn, depends upon the

ratio between cell proliferation and apoptosis (Figure 1-2). In addition, the embryo must









overcome cell arrest, an event in which the embryo enters a senescence-like stage

where cells stop dividing [207]. Furthermore, development to the blastocyst stage

requires a sequential series of events beginning with degradation of maternal RNA,

embryonic genome activation, compaction, blastocoele formation and differentiation of

cells into the TE and ICM (Figure 1-2).









Potential actions of IGF-I on embryonic development

embryo arrest / apoptosis


I I

proliferation u


Increase cell number (1 cell proliferation, j apoptosis)


I mRNA


I 1-cell II 2-cell I 4-cell 1I 8-cell I 16-cell I


blastocst
I momla ll blastocvst I


I davyo I I dayv3 I I dav4 I I dav5 I I dav7 I

Figure 1-2. Potential actions of IGF1 on embryonic development. Development from the
1-cell stage to the blastocyst stage depends upon an increase in cell number
and the rate of increase in cell number depends upon the ratio between cell
proliferation and apoptosis. In addition, embryo development can be blocked
by embryo arrest. Furthermore, development to the blastocyst stage requires
a sequential series of events beginning with degradation of maternal RNA,
EGA, compaction, blastocoele formation and differentiation of cells into the
TE and ICM.


D LI I I









Given this scenario, one action of IGF1 that could result in an increase in the

proportion of embryos becoming blastocysts would be an increase in embryo cell

number. This action could involve stimulation of cell proliferation and/or a decrease in

the number of blastomeres undergoing apoptosis. In addition IGF1 could block cell

arrest, stimulate embryonic genome activation, or activate genes involved in compaction

or blastocyst formation. Experiments to determine whether IGF1 affects competence to

develop to the blastocyst stage before or after day 4 of development can help

distinguish between these possible mechanisms, because effects on maternal mRNA

degradation and embryonic genome activation would occur before day 4 while effects

on compaction and blastocyst formation would occur after day 4.

A second goal of this dissertation is to evaluate whether the ability of IGF1 to

protect embryos from heat shock [1, 3] is developmentally regulated, i.e., whether IGF1

can protect embryos from heat shock at early stages of development when the embryo

is most susceptible to elevated temperature [36, 198]. It is possible that the early

embryo may lack signaling molecules for IGF1 in sufficient quantity for IGF1 to affect

embryo function or that lack of activation of the embryonic genome may limit cellular

responses to IGF1 early in development. In addition, because the early embryo is so

susceptible to heat shock, the thermoprotective actions of IGF1 may not be sufficient to

overcome damage caused by heat shock. The question of developmental regulation of

IGF1 thermoprotection is an important one practically because it relates to the likelihood

of identifying treatments to improve fertility in heat-stressed cows. bST, which stimulates

secretion of IGF1 [216], increased fertility of lactating cows not exposed to heat stress

[219-220] but did not increase pregnancy rates of heat stressed cows [2, 222].









A third goal of the study was to identify genes whose expression is regulated by

IGF1 at day 7 of development to help understand the mechanism by which embryos

treated with IGF1 are better able to establish pregnancy in heat stressed cows than

control embryos. In particular, it is hypothesized that IGF1 causes differential

expression of genes related to survival from stress (HSPA1A, SOD2, GPX), embryonic

growth (IGF1, IGF1R, SLC2A, BMP15, PED) or apoptosis.









CHAPTER 2
ACTIONS OF INSULIN-LIKE GROWTH FACTOR-1 TO INCREASE DEVELOPMENT
OF BOVINE EMBRYOS TO THE BLASTOCYST STAGE

Introduction

Proper development of the embryo is dependent upon maternal signals. While

embryos can grow in simple defined media, the pattern of development can be

disrupted. In the cow, for example, in vitro produced embryos suffer from a variety of

morphological and molecular abnormalities and competence of the resultant embryo to

survive freezing or transfer into recipients is reduced compared to embryos produced in

vivo [223-224]. Lack of maternal signals controlling development is responsible for at

least some of the problems inherent in the embryo produced in vitro since potential for

development to the blastocyst stage, cryotolerance and gene expression can be made

more similar to that of embryos derived in vivo if in vitro produced embryos are returned

to the oviduct after fertilization [224].

Growth factors and cytokines that can affect embryonic development have been

identified in a variety of species. In the cow, these include vascular endothelial growth

factor [225], epidermal growth factor [226], colony stimulating factor 2 [133, 227],

leukemia inhibitory factor [228] and interleukin-1(3 [229]. The mechanisms by which

embryonic development is improved by these factors are not known. Effects on the

proportion of embryos that develop to the blastocyst stage could be caused by

stimulation of cell proliferation, inhibition of apoptosis and embryo arrest, or promotion

of key events such as maternal RNA degradation, embryonic genome activation,

compaction and blastocoel formation.

Here we evaluated how one growth factor capable of regulating embryonic

development, IGF1, increases the proportion of embryos that develop to the blastocyst









stage. IGF1 is mainly produced in the liver upon stimulation by growth hormone [137,

230] although some local synthesis in the ovary, uterus and embryo has been reported

[27, 29, 231]. Treatment with IGF1 can increase the proportion of embryos becoming

blastocysts in the bovine [31-32, 34] ovine [174], buffalo [175], pig [152], mouse [172]

and human [176]. In the cow, the model species examined for the present study, IGF1

also improves resistance of preimplantation embryos to heat shock [1, 3] and oxidative

stress [212], alters expression of several genes at the blastocyst stage [183] and

improves embryo survival after transfer into heat-stressed recipients [35, 133].

Specific objectives of the current study were to determine whether the pro-

developmental actions of IGF1 are exerted before or after day 4 of development (i.e., on

events occurring through the period of genomic activation versus events coincident with

compaction and blastocoele formation), whether MAPK or P13K signaling pathways

mediate effects of IGF1, and whether IGF1 alters expression of genes controlling

blastocoel formation.

Materials and Methods

Materials

Unless otherwise mentioned, reagents were purchased from Sigma or Fisher

Scientific (Pittsburgh, PA). HEPES-Tyrodes Lactate (TL) and IVF-TL, solutions were

purchased from Caisson (Sugar City, ID) and used to prepare HEPES-Tyrodes albumin

lactate pyruvate (HEPES-TALP), and IVF-TALP as previously described [232]. Oocyte

collection medium was tissue culture medium-199 (TCM-199) with Hanks salts without

phenol red (HyClone, Logan, Utah) supplemented with 2% (v/v) bovine steer serum

(Pel-Freez, Rogers, AR) containing 2 U/ml heparin, 100 U/ml penicillin-G, 0.1 mg/ml

streptomycin, and 1 mM glutamine. Oocyte maturation medium was TCM-199 (Gibco,









Grand Island, NY) with Earle's salts supplemented with 10% (v/v) bovine steer serum, 2

pg/ml estradiol 17-(3, 20 pg/ml bovine follicle stimulating hormone (Folltropin-V;

Bioniche, London, ON, Canada), 22 pg/ml sodium pyruvate, 50 pg/ml gentamicin

sulfate, and 1 mM glutamine. Percoll was from GE Healthcare (Uppsala, Sweden).

Frozen semen from various bulls was donated by Southeastern Semen Services

(Wellborn, FL). The embryo culture medium was Synthetic Oviduct Fluid-Bovine

Embryo 1(SOF-BE1). The formulation was as described by Fischer-Brown et al. [233]

except that bovine serum albumin was omitted, the concentration of sodium lactate was

5 mM and additional components were added as follows: polyvinyl alcohol (1 mg/ml),

alanyl-glutamine (1 mM), sodium citrate (0.5 mM) and myo-inositol (2.77 mM).

Recombinant human IGF1 was purchased from Sigma. A vial containing 50 pg of

lyophilized IGF1 was rehydrated with 200 pl of water, and this stock solution was then

stored at -200C in 5 pl aliquots until dilution to the requisite concentration with SOF-BE1

on the day of use.

Primers were designed using Primer3Plus (http://www.bioinformatics.nl/cgi-

bin/primer3plus/primer3plus.cgi) or were based on Sakurai et al. [234] (CDX2), and

were synthesized by Integrated DNA Technologies

(http://www.idtdna.com/Home/Home.aspx).

In Vitro Production of Embryos

Ovaries were obtained from Central Beef Packing Co. (Center Hill, FL), and

transported in 0.9% (w/v) NaCI solution at room temperature. Cumulus-oocyte

complexes (COCs) were obtained by slicing 2 to 8 mm follicles on the surface of

ovaries. Those COCs containing at least one layer of compact cumulus cells and even

granulation were washed in oocyte collection medium. COCs were matured for 20-22 hr









in groups of 10 in 50 pl drops of oocyte maturation medium overlaid with mineral oil at

38.5C in an atmosphere of 5% (v/v) C02 in humidified air. Matured COCs were then

washed in HEPES-TALP and transferred in groups of 200 to a 35 mm petri dish

containing 1700 pl of IVF-TALP supplemented with 80 pl PHE (0.5 mM penicillamine,

0.25 mM hypotaurine, and 25 pM epinephrine in 0.9% [w/v] NaCI), and fertilized with

120 pl Percoll-purified spermatozoa (~ 1x106 sperm cells). Sperm were prepared from a

pool of frozen-thawed semen from three different bulls; a different set of bulls was

generally used for each replicate). After 6 to 10 hr of fertilization in an atmosphere of 5%

CO2 in humidified air, putative zygotes were removed from fertilization wells, denuded of

cumulus cells by vortexing for 4 min in HEPES-TALP and hyaluronidase (10,000 U/ml in

600 pl HEPES-TALP medium) and washed in HEPES-TALP. Embryos were then

placed in groups of 30 in 50 pl drops of SOF-BE1 overlaid with mineral oil. Embryos

were cultured at 38.50C in an atmosphere of 5% CO2 in humidified air.

Concentration-Dependent Actions of IGF1 to Increase Blastocyst Development

Following fertilization, embryos were washed and cultured in 50 pl drops of SOF-

BE1 (control), or SOF-BE1 containing 10, 100, or 200 ng/ml IGF1. Concentrations were

chosen so that the second concentration was within the range of values for IGF1 in

blood of lactating cows [235-236]. The percentage of oocytes that cleaved was

observed at day 3 post-insemination and the percentage of embryos that became

blastocyst was observed at day 7 and day 8 post-insemination. The experiment was

replicated 4 times using 231 to 284 embryos per group.









Determination of the Stage of Development at Which IGF1 Acts to Increase
Blastocyst Development

This experiment tested whether IGF1 improves developmental competence by

acting from day 0-4 post-insemination (i.e., on events occurring through the period of

genomic activation at the 8-16 cell stage) or from day 4 to day 8 post-insemination (i.e.,

coincident with compaction and blastocoele formation). Following fertilization, putative

zygotes were washed and assigned to one of four treatments: control, IGF1 from day 0-

8 post-insemination, IGF1 from day 0-4 post-insemination or IGF1 from day 4-8 post-

insemination. Embryos were placed in groups of 30 in 50 pl drops of SOF-BE1 + 100

ng/ml IGF1 at day 0. For all treatments, embryos were washed at day 4 and transferred

to fresh medium containing SOF-BE1 + 100 ng/ml IGF1. The percent of oocytes that

cleaved was assessed at day 4 post-insemination and the percent that became

blastocysts was determined at day 7 and 8 post-insemination. The experiment was

replicated 5 times using 332 to 356 embryos per group.

Role of MAPK and PI3K Signaling Pathway in IGF1 Actions

Two experiments were performed to test whether the increase in blastocyst

development caused by IGF1 is mediated by the MAPK or P13K pathways using

PD98059 and LY294002 as inhibitors. Embryos were produced as described above and

cultured in SOF-BE1 from day 0-4 post-insemination. At day 4, embryos were placed in

groups of 30 in 50 pl drops of SOF-BE1 containing treatments. For the MAPK

experiment, treatments were SOF-BE1 containing 0.1% dimethyl sulfoxide (DMSO

vehicle), SOF-BE1 containing 0.1% DMSO and 100 ng/ml IGF1, SOF-BE1 containing

0.1% DMSO, 100 pM PD 98059 and SOF-BE1 containing 0.1% DMSO (vehicle), 100

ng/ml IGF1 and 100 pM PD 98059. For the P13K experiments, treatments were similar









except that PD 98059 was replaced with 100 pM LY294002. Embryo development was

assessed at day 7 and 8 post-insemination. The inhibitor experiment was replicated 5

times using 308 to 378 embryos per group, and the P13K inhibitor was replicated 7

times using 399 to 515 embryos per group.

Action of IGF1 on Expression of Genes Controlling Compaction and Blastocyst
Formation

Following fertilization, putative zygotes were washed and cultured in 50 pl drops of

SOF-BE1. At day 4, embryos were transferred to fresh medium of either SOF-BE1 or

SOF-BE1 containing 100 ng/ml IGF1. Morula and early blastocysts were selected at day

6 and frozen at -800C until RNA extraction. Total cellular RNA was extracted from

groups of 20 embryos using the Arcturus PicoPure RNA Isolation kit (MDS, Analytical

Technologies) following the manufacturer's instructions. After RNA extraction, all

samples were treated with DNase (DNAse I Kit RNase-free; New England Biolabs) and

then cDNA was generated using High Capacity cDNA Reverse Transcription Kit

(Applied Biosystems, Foster City-CA). Reverse-transcribed cDNA was subjected to real-

time PCR amplification using a 25 pl reaction consisting of 2.5 pl of cDNA sample, 12.5

pl of SYBR Green (Applied Biosystems), 2.5 pl (1 pM) of primers (Table 2-1) and

diethylpyrocarbonate-treated (DEPC) water. Quantitative real-time RT-PCR (qPCR) was

performed using an ABI 7300 sequence detection system (Applied Biosystems)

according to the manufacturer's instructions. The thermal cycles was performed as

follows: 50C for 2 min, 95C for 10 min followed by 40 cycles of 95C of 15 sec and

60C for 1 min. To obtain the fold difference, data were analyzed using the delta-delta

cycle threshold (AACT) method described previously [237]. cDNA concentration-









dependent amplification was validated by making standard curves for all genes using

serial 5-fold dilutions. This experiment was replicated 6 times.

Statistical Analysis

Data on the percent of oocytes that cleaved and became a blastocyst were

analyzed by least-squares analysis of variance (ANOVA) using the Proc GLM

procedure of the Statistical Analysis System (SAS for Windows, Version 9.2 Cary, NC).

Percent data were transformed by arcsin-transformation before analysis. The

mathematical model included main effects of replicate, treatment or treatments and all

interactions. Replicate was considered random and other main effects were considered

fixed. For the qPCR experiment, Cycle threshold (CT) and ACT were analyzed

statistically but data are presented as fold differences. All values reported are least-

squares means SEM. Probability values were based on analysis of arcsin-transformed

data while least-squares means were from analysis of untransformed data.

The following orthogonal contrasts were used to determine differences between

individual concentrations of IGF: 0 vs others, 100 vs 10 and 200 and 10 vs 200. For

other analyses, identification of means that differed significantly was determined using

the pdiff procedure of SAS.

Results

Concentration-Dependent Actions of IGF1 to Increase Blastocyst Development

Treatment with IGF1 did not affect the percent of oocytes that cleaved by day 3

post-insemination (Figure 2-1A) but increased the percent of embryos that became a

blastocyst at day 7 (p<0.05; Figure 2-1B) and 8 (p=0.05; Figure 2-1C). At day 7, there

was no statistical difference between 10, 100 and 200 ng/ml. At day 8, the percent of









oocytes that became a blastocyst was higher (P<0.05) for 100 ng/ml than for 10 or 200

ng/ml.

Determination of the Stage of Development at Which IGF1 Acts to Increase
Blastocyst Development

As expected, treatment did not affect cleavage (Figure 2-2A) and addition of IGF1

from day 0-8 post-insemination increased (p<0.05) the percent of oocytes that became

blastocysts at day 7 (Figure 2-2B) and 8 post-insemination (Figure 2-2C). A similar

increase in percent of oocytes developing to the blastocyst stage was observed when

embryos were cultured with IGF1 from day 4-8 (P<0.05 vs controls) but not when IGF1

was added from day 0-4 (Figure 2-2B and 2-2C). Representative image of day 8

blastocysts are shown in Figure 2-3.

Effect of Inhibition of MAPK and PI3K Signaling on Actions of IGF1 to Promote
Development

Results from the experiment with the MAPK inhibitor PD 98059 are shown in

Figure 2-4. Development at both day 7 and 8 was affected by inhibitor x IGF1

interactions (P<0.05). These interactions reflected the fact that IGF1 increased

development in the absence of the inhibitor but not in the PD 98059-treated group.

Results from the experiment with the P13K inhibitor LY-294,002 are shown in

Figure 2-4. The inhibitor reduced the percent of oocytes that were blastocysts at day 7

and 8 post-insemination (P<0.05) and IGF1 tended to increase blastocyst development

in the absence and presence of LY-294,002 at day 7 (P=0.09) and day 8 (P=0.08).

There were no inhibitor x IGF1 interactions because IGF1 increased development in the

presence and absence of the inhibitor.









Action of IGF1 on Expression of Genes Controlling Compaction and Blastocyst
Formation

There was no effect of IGF1 on expression of CDX2 or OCLN at day 6 post-

insemination. IGF1 decreased the steady state expression of CDH1 (P<0.05) and there

was a tendency (P=0.07) for ATPIA1 expression to be higher in IGF1 treated embryos

(Figure 2-5).

Discussion

Insulin-like growth factor is an important maternal determinant of embryonic

survival that can promote development to the blastocyst stage [31-32, 34], protect the

embryo from several stresses [1, 3, 212] and increase competence for development to

term, at least in heat-stressed females [35, 133]. As shown here, IGF1 exerts its pro-

developmental effects at concentrations that are within the range of those found in the

blood of lactating and non-lactating cows [235-236]. Since addition of IGF1 to culture

medium at day 4 post-insemination increased blastocyst development while IGF1 from

day 0-4 had no statistical difference from the control group on development, IGF1 exerts

actions on development at a time after embryonic genome activation [49, 58] and when

the embryo is undergoing compaction [238], DNA methylation [58], proliferation and

blastocoel formation [238]. Furthermore, the pro-developmental effects of IGF1 involve

actions mediated by the MAPK pathway and include alteration of genes controlling

formation of the blastocoelic cavity.

Activation of IGF1 receptors leads to signaling through at least two main

pathways, MAPK and P13K that engage transcriptional and non-transcriptional events

leading to a stimulation of cell proliferation and differentiation, inhibition of apoptosis and

cytokine signaling [239]. The MAPK pathway is one of the pathways for the proliferative









actions of IGF1 [240-241] and it is possible, therefore, that the main action of IGF1 that

increases blastocyst development is an increase in cell number. In this way, more

embryos could reach a critical cell number necessary for differentiation into the

blastocyst. Other molecules that stimulate proliferation also can increase the proportion

of embryos that develop to the blastocyst stage [225-226]. Another possible way to

control cell number, a reduction in apoptosis, does not seem to be major mechanism for

the pro-developmental effects of IGF1 because inhibition of the P13K pathway, which

mediates the effects of IGF1 on apoptosis [3], did not prevent the ability of IGF1 to

increase blastocyst development. There was, however, a reduction in the proportion of

embryos that became blastocysts caused by addition of LY294002, indicating the

importance of this signaling pathway for embryonic development.

There was evidence in the present study that IGF1 increases development to the

blastocyst stage, at least in part, by regulating expression of genes involved in

compaction and blastocoel formation. Compaction occurs on day 5 post-insemination at

the 32-cell [238, 242] and blastocoel formation occurs beginning at day 6-7 post-

insemination [243-244]. The process of compaction, which is necessary for subsequent

development of the blastocyst, involves formation of junctional complexes involving

CDH1 and OCLN [83]. There was no effect of IGF1 on steady state mRNA content of

OCLN at day 6 post-insemination, but IGF1 decreased expression of CDH1. The

decrease in CDH1 expression could represent a transient decrease in this adhesion

molecule in preparation for blastocoel formation. By the blastocyst stage, Block et al.

[183] found that IGF1 did not affect expression of CDH1. There was a tendency for

IGF1 to increase expression of ATPIA1 at day 6 post-insemination, a time before most









embryos in our culture system have a visible blastocoele. Block et al. [183] also

observed a tendency for IGF1 to increase ATPIA I transcript abundance in day 7

blastocysts. Na+/K+ ATPase activity is involved in active transport of ions across the TE

to form the fluid-filled blastocoelic cavity [81, 83]. It is not known whether effects of IGF1

on molecular events leading to blastocoel formation occur because of increased

proliferation mediated by the MAPK pathway or whether regulation of these genes is

independent of changes in the rate of cell proliferation.

There was no effect of IGF1 on the abundance of transcripts for the trophoblast

marker, CDX2, [245]. This result suggests that IGF1 is not involved in differentiation of

the TE and is consistent with the observation that IGF1 did not alter the TE:ICM ratio

[183].

It is also possible that IGF1 promotes development to the blastocyst stage by

regulating energy metabolism. There is an increase in oxygen consumption and glucose

uptake at compaction and a larger increase at the blastocyst stage [246]. One action of

IGF1 is increased transport of glucose [215]. In another study, however, IGF1 did not

affect expression of the glucose transporters SLC2A1, SLC2A3 or SLC2A8 in bovine

blastocysts [183].

In conclusion, IGF1 promotes development to the blastocyst stage by regulating

MAPK-dependent events at day 4 or later. Among the actions likely to be important for

the pro-developmental actions of IGF1 at this time are an increase in proliferation and

promotion of blastocoel formation through regulation of expression of ATPIA1.









Table 2-1. Primer sets for qPCR
Gene Accession Prime Sequence Length Tm
CDX2 XM_871005 Forward GCCACCATGTACGTGAGCTAC 140 57.90C
Reverse ACATGGTATCCGCCGTAGTC
CDH1 AY_508164 Forward TGACTGTGATGGGATCGTCAGCAA 198 59.90C
Reverse ACATTGTCCCGGGTGTCATCTTCT
ATPIA1 NM_001076798 Forward CCCTGAATGGGTCAAGTTCT 185 59.00C
Reverse AGGAGAAACACCCGGTTATG
OCLN NM_001082433 Forward TCAACTGGGCTGAACACTCCAACT 149 60.30C
Reverse AAGACCTGATTGCCCAGGATGTCA
Hist2h2aa2 U62674 Forward GTCGTGGCAAGCAAGGAG 182 56.60C
Reverse GATCTCGGCCGTTAGGTACTC













S80


" ^60
1o
o 40


0 20


S 0
o

30
' 30

E>
o 20
a)
c"j
t 10
0
0


40
S40
Mco
c, 130
E >
o-g 20

10
o
0


IGF1 Concentrations (ng/mL)

Figure 2-1. Concentration-dependent effects of IGF1 on the percent of oocytes that
cleaved (Panel A) and that became blastocysts at day 7 (Panel B) and day 8
(Panel C) post-insemination. Concentration of IGF1 did not affect cleavage
rate (p>0.05). IGF1 increased the percent of oocytes becoming a blastocyst
at day 7and day 8 compared to control (p<0.05 and p=0.05 respectively). At
day 7 there was no statistical difference between 10, 100 and 200 ng/ml, and
at day 8 the percent of oocytes that became a blastocyst was higher for 100
ng/ml (P<0.05) than for 10 or 200 ng/ml. Data are least-squares means
SEM of results from 4 replicates involving 231 to 284 oocytes per group.


A











B b


a








C b
b b
a T









0 10 100 200














80


-g
60
Co
c0
S40

0CO
o 20


Days of culture during which IGF1 was present


Figure 2-2. Improvement in blastocyst development when IGF1 is added from day 4-8 of
culture but not statistical different from controls when added from day 0-4.
Data are least-squares means SEM and represent the percent of oocytes
that cleaved (Panel A) and that became blastocysts at day 7 (Panel B) and
day 8 (Panel C) post-insemination. Embryos were either cultured without
IGF1, IGF1 from day 0-8 post-insemination, day 0-4 post-insemination or day
4-8 post-insemination. The main effect of treatment was significant for results
at day 7 (p<0.05) and 8 (p<0.01) and differences between individual means
(p<0.05) are indicated by different superscripts above each bar. Data are
least-squares means SEM of results from 5 replicates involving 332 to 356
oocytes per group.


A












B c bc
ab
a T

T








c bc
Sab C b
T
a
con









control 0 4 4 8 0 8


0


"- 30
o 10-



CO
0~0


o
3 CO
- O 20


OC-
0 (n 10
S.0

0


c o 40
0)CO
E c 30
0 n
CO
() >1 20
00
o E 10







































Figure 2-3. Representative images of day 8 embryos when IGF1 was used in different
days of culture. Panel A, control group without IGF1; Panel B, IGF1 was
added from day 0-4 of culture; Panel C IGF1 was added from day 4-8 of
culture and Panel D, IGF1 was added from day 0-8 of culture.









PD98059 LY-294,002
35 20 a
b
r b N-
>, 30 -,
-o 15 ac
S25-
cn a cn
a 20 -
- 10-
c 15 -a

c 10 c bc
a. a 5 b

0 i 1 0 -

0 [IGF1] 100 0 [IGF1] 100

50 35 -
o00 00 a
>% b >% 30 a
CU 40 -
i 25- a
-I-' -I-'
> 30- >
ac
O c O
ac 20 -
J0 20 cu 15 ,^
-aa
c c 10 -
2_ 10 -
S5 b

0- 0
0 [IGF1] 100 0 [IGF1] 100
Figure 2-4. Effect of the MAPK inhibitor PD 98059 and the P13K inhibitor LY294002 on
actions of IGF1 to increase the percent of blastocysts at day 7 and day 8
post-insemination. Black circles represent absence of inhibitor, and open
circles represent the presence of inhibitor. For MAPK inhibitor PD 98059,
development at both day 7 and 8 was affected by inhibitor x IGF1 interactions
(P<0.05). For the P13K inhibitor LY-294,002 experiment, the inhibitor reduced
the percent of oocytes that were blastocysts at day 7 and 8 post-insemination
(P<0.05) with or without IGF1 and IGF1 tended to increase blastocyst
development in the absence and presence of LY-294,002 at day 7 (P=0.09)
and day 8 (P=0.08).











P = 0.07
1.4
P < 0.05
1.2

0) 1.0 -


0
S0.6
LL
0.4

0.2

0.0
control IGF1 control IGF1 control IGF1 control IGF1

CDH1 OCLN ATP1A1 CDX2

Figure 2-5. Effects of IGF1 on expression of genes involved in compaction and
blastocoel formation. Control group is represented by the black bars and the
IGF1 treated group is represented by the white bars. IGF1 decreased the
steady state expression of CDH1 (p<0.05) and there as a tendency of IGF1 to
increase steady state expression of ATP1A on day 6 embryos (P=0.07).









CHAPTER 3
DEVELOPMENTAL CHANGES IN THERMOPROTECTIVE ACTIONS OF INSULIN-
LIKE GROWTH FACTOR-1 ON PREIMPLANTATION BOVINE EMBRYOS

Introduction

Adverse effects of elevated temperature (i.e., heat shock) on development of the

preimplantation embryo are one of the causes of reduced fertility during heat stress [14,

204]. Resistance of the preimplantation bovine embryo to heat shock can be modified

by genetic, developmental and microenvironmental inputs. For example Bos indicus

embryos are more resistant to heat shock than B. taurus embryos [247-250]. The

embryo also acquires resistance to elevated temperature during development. Thus,

exposure of cows to heat stress on day 1 after estrus reduced embryonic development

to the blastocyst stage but heat stress at days 3, 5 and 7 had no effect [194]. Similarly,

exposure to elevated temperature in vitro caused a greater reduction in development for

two-cell embryos than for 2 16 cell embryos at day 5 of development [36, 197, 204].

Among the microenvironmental inputs affecting embryonic resistance to heat stress is

the growth factor IGF1. Treatment of embryos with IGF1 reduces the magnitude of

effects of heat shock on development and apoptosis at day 5 of development [1, 3].

Moreover, treatment with IGF1 in vitro enhances survival rates of blastocysts

transferred into heat-stressed recipients [35].

Circulating IGF1 is synthesized and secreted primarily by the liver [251] although it

is also expressed in several reproductive tissues including, in the cow, ovary, oviduct,

uterus and embryo [26, 28-29]. Secretion by liver is increased by growth hormone [251].

Interestingly, however, injection of recombinant growth hormone into lactating cows

exposed to heat stress did not increase fertility even though circulating concentrations

of IGF1 were increased [2, 222]. One possible explanation is that, although IGF1 can









protect more advanced embryos from effects of heat stress [11-13], it cannot block

effects of heat stress on the oocyte or early embryo. Not only are early cleavage-stage

embryos maximally sensitive to elevated temperature [36, 197-198, 204], but lack of

activation of the embryonic genome [49] may limit cellular responses to IGF1.

The present study had two objectives. The first was to determine whether the

thermoprotective actions of IGF1 on the preimplantation bovine embryo were

developmentally regulated so that the two-cell embryo was refractory to IGF1. The

second was to determine the molecular basis for the improved competence of embryos

treated with IGF1 to establish pregnancy after transfer to heat-stressed recipients [35].

Since this beneficial effect of IGF1 has not been observed when embryos were

transferred to recipients not exposed to heat stress [35], it was hypothesized that IGF1

would enhance genes involved in cytoprotection and inhibit genes that would

exacerbate effects of heat shock on the embryo.

Materials and Methods

Embryo Culture Media and Additives

Unless otherwise mentioned, reagents were purchased from Sigma-Aldrich (St.

Louis, MO, USA) or Fisher Scientific (Pittsburgh, PA). HEPES-Tyrodes Lactate (TL) and

IVF-TL solutions were purchased from Caisson Laboratories (Sugar City, ID). These

media were used to prepare HEPES-Tyrodes Albumin Lactate Pyruvate (HEPES-

TALP), and IVF-TALP as previously described [232]. Oocyte collection medium was

TCM-199 with Hank's salts without phenol red (HyClone, Logan, Utah) supplemented

with 2% (v/v) bovine steer serum (Pel-Freez, Rogers, AR) containing 2 U/ml heparin,

100 U/ml penicillin-G, 0.1 mg/ml streptomycin, and 1 mM glutamine. Oocyte maturation

medium was TCM-199 (Gibco, Grand Island, NY) with Earle's salts supplemented with









10% (v/v) bovine steer serum, 2 pg/ml estradiol 17-(3, 20 pg/ml bovine follicle stimulating

hormone (Folltropin-V; Bioniche, Belleview, Ontario, Canada 22 pg/ml sodium

pyruvate, 50 pg/ml gentamicin sulfate, and 1 mM glutamine. Percoll was from GE

Healthcare (Uppsala, Sweden). Frozen semen from various bulls was donated by

Southeastern Semen Services (Wellborn, FL). The embryo culture medium was

Potassium Simplex Optimized Medium (KSOM) that contained 1 mg/ml bovine serum

albumin and was obtained from Caisson. On the day of use, KSOM was modified to

produce KSOM-BE2 (KSOM-bovine embryo 2) as described previously [252].

Recombinant human IGF1 was purchased from Sigma-Aldrich. A vial containing 50 pg

of lyophilized IGF1 was rehydrated with 200 ml of water. This stock solution was then

stored at -200C in 5 pl aliquots until use, when a single aliquot of IGF1 was diluted with

KSOM-BE2 to a final concentration of 100 ng/ml.

In vitro Production of Embryos

Embryo production was performed as previously described [1, 3] using in vitro

maturation of oocytes and in vitro fertilization. Immature COCs were collected from

ovaries obtained from Central Packing Co. (Center Hill, FL, USA). Harvested COCs

were washed in oocyte collection medium and allowed to mature for 20-22 hr in groups

of 10 in 50 pl drops of oocyte maturation medium overlaid with mineral oil and at 38.5C

in an atmosphere of 5% (v/v) CO2 in humidified air. Matured COCs were then washed in

HEPES-TALP and transferred to a 35 mm petri dish containing 1700 pl of IVF-TALP

supplemented with 80 pl PHE (0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 pM

epinephrine in 0.9% [w/v] NaCI), and fertilized with 120 pl Percoll-purified spermatozoa

(~ lx106 sperm cells). To eliminate bull effects, a pool of frozen-thawed semen from

three different bulls were used for each replicate; a separate pool was used for each









replicate. After 6 to 10 hr of fertilization, putative zygotes were removed from fertilization

wells, denuded of cumulus cells by vortexing in HEPES-TALP and hyaluronidase

(10,000 U/ml in 600 pl HEPES-TALP medium) for 4 min, washed in HEPES-TALP, and

placed in groups of 30 in 50 pl drops of KSOM-BE2 overlaid with mineral oil. For most of

the culture period, embryos were cultured at 38.5C in a humidified atmosphere of 5%

02 and 5% C02 (v/v) with the balance nitrogen. During the heat shock period, both

control and heat-shocked embryos were placed in an atmosphere of 5% (v/v) C02 in

humidified air. This atmosphere, which contains a higher oxygen content (21%) was

used during heat shock because high oxygen tension exacerbates the deleterious effect

of temperature on embryonic development to the blastocyst stage [253].

Protective Effect of IGF1 on Heat Shocked Embryos at 410C

Two-cell embryos were selected at 28-30 hr post-insemination. Embryos with > 16

cells were selected at day 5. Embryos were randomly transferred to a fresh drop of

KSOM-BE2 containing 100 ng/ml IGF1 (treated group) or KSOM-BE2 only (control

group) and then assigned randomly to temperature treatment. After 1 hr of

preincubation with or without IGF1, embryos received one of two thermal treatments in

an atmosphere of 5% C02 in air as follows: 38.5C for 24 hr or 41C for 15 hr and

38.5C for 9 hr. Embryos were then washed 3 times in KSOM-BE2 drops to remove

IGF1, placed in fresh drops of KSOM-BE2 and cultured in an atmosphere of 5% 02 until

day 8 post-insemination at 38.5C when development to the blastocyst stage was

assessed. The experiment with two-cell embryos was replicated 11 times using 169 to

174 embryos per group and the experiment for day 5 embryos was replicated 15 times

using 193 to 201 embryos per group.









Protective Effect of IGF1 on Day 5 Embryos Exposed to Heat Shock at 420C

Another experiment was performed where day 5 embryos were exposed to a more

severe heat shock of 42C. Day 5 embryos with at least 16 cells were selected and

randomly transferred to a fresh drop of KSOM-BE2 + 100 ng/ml IGF1 (treated group) or

KSOM-BE2 only (control group), and then assigned randomly to treatment. After 1 hr of

pre-incubation with or without IGF1, embryos received thermal treatments in 5% CO2 in

humidified air as follows: 38.5C for 24 hr or 42C for 15 hr and 38.5C for 9 hr.

Embryos were then washed 3 times in KSOM-BE2 drops to remove IGF1, placed in

fresh drops of KSOM-BE2 and cultured in 5% 02 at 38.50C until day 8 post-insemination

when development to the blastocyst stage was assessed. The experiment was repeated

4 times using 59-60 embryos per group.

Developmental Changes in Expression of Genes Involved in IGF1 Signaling

In one experiment, embryos were cultured in 50 pl drops of KSOM.-BE2 in 5% 02.

Two-cell embryos were selected at 28-30 hr post-insemination and embryos 2 16 cells

were selected from separate wells at day 5 post-insemination. Selected embryos were

washed in UltraspecTM RNase free water (Biotecx Houston, TX, USA) and stored at -

800C until RNA extraction. For each stage of development, total RNA was extracted

from five groups of 20 embryos each using Arcturus PicoPure RNA Isolation Kit (MDS,

Analytical Technologies, Sunnyvale, CA, USA) following the manufacturer's instruction.

RNA was frozen at -800C. Quantitative PCR was performed by Mogene, LLC (Saint

Louis, MO, USA). RNA was quantified using the Ribogreen RNA quantification Kit

(Invitrogen, Carlsbad, CA, USA) and then subjected to quantitative real-time RT- PCR

(qPCR) using the TaqMan RNA-to-CTTM 2-Step Kit (Applied Biosystems, Foster City,

CA, USA) in 25 pl reactions. In the first step, cDNA is generated and in the second the









cDNA is quantitated using the TaqMan Gene Expression Master Mix. The thermal

cycles for qPCR was 50C for 2 min, 95C for 10 min followed by 40 cycles of 95C of

15 sec and 600C for 1 min. The qPCR reactions were performed and fluorescence

quantified with the ABI 7900HT system (Applied Biosystems, Foster City, CA, USA).

The genes included IGF1R, RAF1, MAPK and GAPDH, with the last gene serving as an

endogenous control (housekeeping gene) (Table 3-1). Each qPCR was run in triplicate.

For a second experiment, genes of interest included IGF1R, P13K, HK2 and

Hist2h2aa2 a housekeeping gene. Embryos were produced as described above and 7

groups of 25 two-cell embryos and 7 groups of 25 day 5 embryos were selected. RNA

was extracted using Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA, USA)

following the manufacturer's instruction. RNA was frozen at -800C and sent to the

University of Missouri for qPCR. Primer sets for genes were designed by the public

domain primer design software Primer3 http://www.bioinformatics.nl/cgi-

bin/primer3plus/primer3plus.cgi). The primers were chosen based on the published

sequences of the bovine genome and the primers used had a product size of 150 to 300

bp in length (Table 3-2). cDNA was generated using High Capacity cDNA Reverse

Transcription Kit (Applied Biosystems, Foster City, CA, USA). Reverse-transcribed

cDNA was subject to real-time PCR amplification using 25 pl master mix reactions

consisting of 12.5 pl of SYBRGreen (Applied Biosystems, Foster City, CA, USA), 5 pl (1

pM) of the primers (2.5 pl forward and 2.5 pl reverse), 5 pl of diethylpyrocarbonate-

treated (DEPC) water and 2.5 pL of cDNA sample (1 ng/ pl). The PCR reactions were

performed and fluorescence quantified with the ABI 7300 Applied Biosystems system

(Applied Biosystems, Foster City, CA, USA). The thermal cycles for real-time PCR was









50C for 2 min and 95C for 10 min followed by 40 cycles of 95C of 15 sec and 60C

for 1 min. Each PCR was run in duplicate. For both experiments, responses were

quantified using the CT method, and the AACT method was used to determine fold

change.

Immunofluorescent Analysis of Insulin-like Growth Factor 1 Receptor (IGF1R)

This experiment was designed to evaluate the presence of IGF1R in two-cell and

day 5 embryos. Two-cell embryos were selected at 28-32 hr post-insemination and

embryos 2 16-cells were selected on day 5 post-insemination. Embryos were fixed in

4% (v/v) paraformaldehyde in 10 mM KPO4, pH 7.4 containing 0.9% (w/v) NaCI (PBS)

and 1 mg/ml polyvinylpyrrolidone (PVP) for 15 min at room temperature. After fixation,

embryos were washed in PBS-PVP and stored in PBS-PVP at 40C until

immunofluorescent analysis within 3 days of fixation.

Fixed embryos were permeabilized with 0.25% (v/v) Triton-X in PBS for 10 min at

room temperature and then washed three times in Tris buffered saline [TBS (10 mM

Tris, pH 7.2, 0.9% (w/v) NaCI)] containing 0.1% (v/v) of Tween-20 (TBST). Embryos

were blocked for 1 hr in PBS containing 20% (v/v) normal goat serum (Pel-Freez

Biologicals, Roger, AR, USA) at room temperature and then washed two times in TBST.

Afterwards, embryos were incubated overnight with the primary protein G-purified rabbit

polyclonal antibody to IGF1R (Abcam, Cambridge, MA, USA) at a concentration of 2.5

pg/ml in TBST-BSA [TBST containing 0.1% (w/v) bovine serum albumin]. The negative

control group was incubated with rabbit IgG (2 pg/ml, Sigma-Aldrich). After incubation,

embryos were washed in TBST 3 times for 5 min each and incubated for 1 hr in the dark

with 2 mg/ml anti-rabbit IgG F(ab')2 fragment labeled with Alexa Fluor 555 (Cell

Signaling, Danvers, MA, USA) diluted 1:1000 in TBST-BSA. Embryos were washed 3









times in TBST for 5 min each, and nuclear labeling was performed with 1 pg/ml of 4',6-

diamidino-2-phenylindole (DAPI) in TBST-BSA for 15 min. Embryos were rinsed in PBS-

PVP and placed in approximately 100 pl drops of PBS-PVP on a FluoroDish (World

Precision Instruments, Inc, Sarasota, FL, USA) for analysis. Embryos images were

extracted and examined with a laser confocal scanning microscope (Leica TCS SP5,

Bannockburn, IL, USA).

Seven consecutive section were merged and the merged image was subjected to

image analysis using ImageJ 1.43t software (National Institute of Health, Bethesda, MA,

USA). Pixel intensity of membrane-assocaited immunofluorescence was analyzed and a

threshold was chosen to designate the area of the picture to be analyzed (plasma

membrane) while excluding lower-intensity staining in the cytoplasm. Pixel intensity in

the selected areas was measured and a mean gray value calculated. A total of 5 two-

cell and 5 day 5 embryos were analyzed.

Microarray Hybridization

Embryos were cultured in KSOM-BE2 100 ng/ml IGF1 in a 5% 02 atmosphere.

At day 7,grade 1 blastocysts [254] were selected. A total of four pools of 30 control

blastocysts and four pools of 30 IGF1-treated blastocysts were produced. RNA was

extracted using RNeasy Micro kit (Qiagen Inc, Valencia, CA, USA). Samples were

frozen at -800C and sent to Mogene LLC (St. Louis, MO, USA), an Agilent Certified

Service Provider, for microarray analysis using the Agilent bovine gene expression

microarray 4x44k (AMIDID 023647, Agilent Technologies, Santa Clara CA, USA). The

array contains 43,803 bovine probes represented and the probes were developed by

clustering more than 450,000 mRNA and EST sequences of the bovine genome (btau

4.0).









Concentration of total RNA was determined using the Nanodrop 1000

spectrophotometer (Thermo Scientific, Waltham, MA, USA) and integrity determined by

Agilent 2100 Bioanalyzer RNA 6000 Pico LabChip kit (Agilent Technologies, Santa

Clara CA, USA). A representative analysis is shown in figure 3-1. The remainder of the

RNA was amplified using Agilent Quick-Amp.labeling Kit. Only those amplification

reactions yielding amplified RNA of consistent size range and quantity across samples

were utilized in subsequent microarray experiments. A total of 1.2 pg of the amplified

material was labeled using the ULS aRNA fluorescent Labeling Kit (Kreatech

Biotechnology, LG, Amsterdam). The hybridizations were setup so that, for two pairs of

samples, RNA from the control embryos were labeled with Cy3 and RNA from IGF1

treated embryos were labeled with Cy5, whereas for the other two pairs, RNA from

control embryos were labeled with Cy5 and RNA from the IGF1 group were labeled with

Cy3. Arrays were hybridized for 17 hr at 65C and 10 rpm. Arrays were washed

following procedures described in the Agilent Gene Expression manual and were

scanned at 5 pm on an Agilent C Scanner (Agilent Technologies, Santa Clara CA,

USA).

Hybridizations were prepared using 1.65 pg of sample (825 ng per dye

assignment) per array. Prior to hybridization, sample combinations (47.8 pl including

10x Blocking Agent) were fragmented with 2.2 pl of Agilent 25x Fragmentation Buffer

(Agilent Technologies, Santa Clara CA, USA) at 600C for 30 minutes. After

fragmentation, 5 pl of Kreablock was added to each tube followed by 55 pl of Agilent 2x

Hi-rpm Hybridization Buffer. This mixture was applied to an Agilent bovine gene









expression microarray 4x44k (AMIDID 015354, Agilent Technologies, Santa Clara CA,

USA).

M icroarray Data Analysis

The microarray image extraction and data pre-processing were performed using

Agilent's Feature Extraction software v 9.5 (Agilent Technologies, Santa Clara CA,

USA). The intensity of each spot was summarized as the median pixel intensity, and

then the generated values were transformed to log. The lowess method was used to

normalize intensity within each array. Microarray data were analyzed using the JMP

Genomics 4 for SAS 9.1.3 software (SAS Inst., Inc., Cary, NC). The quantile

normalization method was performed for the data global normalization and least-

squares analysis of variance conducted using the PROC ANOVA procedure of JMP

Genomics 4 for SAS 9.1.3 to identify differentially regulated genes. The model

included replicate and treatment. Replicate (array) was considered random and

treatment was considered fixed. Correction for false discovery rate was performed by

the Benjamini and Hochberg method [255] with a maximum false discovery rate of 0.01.

P values were adjusted to a false discovery rate of 0.01 and genes with a fold change of

at least 1.5 and a probability of P<0.05 were considered differentially expressed.

qPCR

Validation of the microarray data was conducted by performing qPCR on three

genes that were upregulated by IGF1 (NFATC3, PPIP5K2, TGFB2), three genes

downregulated by IGF1 (RAD23A, HIFOO, FADS6) and on GAPDH, which was used

as a housekeeping gene. Primer sets for genes were designed by the public domain

primer design software Primer3 (http://www.bioinformatics.nl/cgi-

bin/primer3plus/primer3plus.cgi) (Table 3-3). To confirm primer specificity, amplicon









size was determined by agarose gel electrophoresis and amplicons were sequenced at

the Genetic Analysis Core Laboratory of the Interdisciplinary Center for Biotechnology

Research, University of Florida.

cDNA was generated using High Capacity cDNA Reverse Transcription Kit

(Applied Biosystems, Foster City, CA) and cDNA concentration-dependent amplification

was validated by making standard curves for all genes using serial 5-fold dilutions using

CT1 cells (trophectoderm cells). Reverse-transcribed cDNA was subjected to qPCR

amplification using SyberGreen a 10 pl reaction consisting of 1 pl of cDNA sample (20

ng/ pl), 5 pl of SYBR Green (Applied Biosystems), 1 pl of 1 pM primers (forward and

reverse) and 2 pl of DEPC water. qPCR was performed using a Bio-Rad C100 thermal

cycler -CFX96-Real-Time system (Bio-Rad, Hercules, CA, USA). Due to differences in

primer annealing temperature, the thermal cycle for four of the genes tested (RAD23A,

PPIP5K2, NFA TC3, TGFB2) was performed as follows: 50C for 2 min and 95C for 10

min followed by 50 cycles of 95C of 15 sec and 60C for 1 min. The thermal cycle for

the other two genes (FADS6 and H1FOO) was 50C for 2 min and 95C for 10 min

followed by 50 cycles of 95C of 15 sec, 55C for 30 sec and 74C for 30 sec.

Statistical Analysis

Data on development and immunocytochemistry (pixel intensity) were analyzed

by least-squares analysis of variance (ANOVA) using the Proc GLM procedure of the

Statistical Analysis System (SAS for Windows, Version 9.2, Cary, NC). Data on the

percent of oocyte that cleaved and became blastocyst were transformed by arcsin

transformation before analysis. The mathematical model included main effects of

replicate, temperature, and IGF1 treatment and all interactions. Replicate was

considered random and other main effects were considered fixed. Probability values









were based on analysis of arcsin-transformed data while least-squares means are from

analysis of untransformed data. Pixel intensity data were analyzed with embryo as the

experimental unit and stage of development at the dependent variable.

For data from qPCR experiments, All CT responses from genes of interest were

normalized to the housekeeping GAPDH gene using the ACT method. The AACT for

each sample was calculated by subtracting the ACT of IGF1 from the control in the

same replicate. Fold change was determined by solving for 2-AACT relative to the

controls. Treatment effects were analyzed by the median scores procedure of SAS

(SAS for Windows, Version 9.0, Cary, NC, USA.

Results

Thermoprotective Actions of IGF1 on Two-cell and Day 5 Embryos

The first experiment to evaluate whether the thermoprotective effect of IGF1 on

bovine embryos was developmentally regulated used a heat shock of 41 C for 15 hr.

For two-cell embryos, heat shock reduced the percent of embryos that became

blastocysts at day 8 (P<0.005). IGF1 did not protect two-cell embryos from heat shock

as indicated by a lack of effect of IGF1 or the IGF1 x heat shock interaction (Figure 3-

2A). For day 5 embryos, which are known to be more resistant to heat shock than two-

cell embryos, culture at 41 C heat shock did not reduce the percent of embryos that

became a blastocyst and there was no effect of IGF1 or IGF1 x heat shock (Figure 3-

2B).

Given the resistance of day 5 embryos to a heat shock of 41 C, another

experiment was performed where day 5 embryos were exposed to a more severe heat

shock of 420C for 15 hr. The percent of embryos that became blastocysts was reduced

by heat shock (P<0.001) and increased by IGF1 (P=0.05) (Figure 3-3). Even though









there was no interaction, the increase in development caused by IGF1 was greater for

embryos at 42C than for embryos at 38.5C. Thus, IGF1 reduced the effects of 42C

on development.

Gene Expression of Molecules Involved in IGF1 Signaling

In the first experiment, expression of IGF1R, RAF1 and MAPK were higher in two-

cell embryos compared to day 5 embryos (P<0.001; Figure 3-4A). In the second

experiment (Figure 3-4B), there was again a trend for IGFIR mRNA to be higher at the

two-cell stage but the difference was not significant. Another gene, P13K, had higher

expression at the two-cell stage (P<0.001), while a third gene, HK2, was expressed

more highly for day 5 embryos (P<0.001).

Presence of IGF1R in Two-cell and Day 5 Embryos

Immunofluorescent labeling was performed to detect the presence of IGF1R in

two-cell and day 5 embryos. Immunoreactive IGF1R was localized to the plasma

membrane at both stages of development (Figure 3-5A). Intensity of staining was

quantified and there was no difference (P>0.05) in the amount of immunoreactive

IGF1R between the two stages of development (Figure 3-5B).

Effect of IGF1 on Gene Expression in Blastocysts

Using the criteria of a minimum 1.5-fold difference and P<0.05, a total of 102

genes were differentially expressed between IGF1 and control embryos. A total of 72

genes were annotated, with 40 genes upregulated by IGF1 (Table 3-4) and 32 genes

downregulated by IGF1 (Table 3-5).

The differentially expressed genes were used to query the DAVID bioinformatics

database (http://david.abcc.ncifcrf.gov) to identify biological process ontologies in which

genes are represented. When ontologies containing only one or two differentially









expressed genes or organ-specific ontologies were removed, there were a total of 10

ontology terms in which differentially expressed genes were represented (Table 3-6).

Six of these terms were related to developmental processes: embryonic development,

embryonic morphogenesis, anatomical structure morphogenesis, anatomical structure

development, cell development, and cellular component morphogenesis. The set of

developmental genes in the ontologies included 7 upregulated by IGF1 (in order of fold-

change; ODZ4, SLC40A1, ANXA2, NFATC3, TGFB, BMP7 and DYRK3) and 9

downregulated by IGF1 (CNTNAP, NRG2, DPYSL4, ALDH1A2, FBN2, TNFRSF11A,

NODAL, MMP13, and NEURL). In addition to the genes involved in developmental

processes identified by DAVID, other genes involved in development were differentially

regulated. Genes upregulated by IGF1 were CAB39 and SRPX2 while genes

downregulated by IGF1 were GFAP, PARD3B, NT5E, CBX1, KREMEN, IFITM3, and

ARHGEF10L.

Other biological process ontologies in DAVID containing more than two

differentially regulated genes were as follows: the transmembrane receptor protein

serine/threonine kinase signaling pathway, for which three genes were upregulated by

IGF1 (FNTA, BMP7, and TGFB2); the positive regulation of cell proliferation ontology,

with three upregulated genes (IL6ST, FNTA, and TGFB2) and three downregulated

genes (ALDH1A2, TNFRSF11A, and NODAL); cellular responses to cell signaling:

response to steroid hormone stimulus; and response to external stimulus. Included in

these last two ontologies were four upregulated genes (IL6ST, NFATC3, TGFB2, and

BMP7) and 5 downregulated genes (ALDH1A2, MMP15, MST1 MMP13, and NEURL).









Further analysis of the set of differentially-regulated genes was performed to test

the hypothesis that IGF1 increases genes involved in cytoprotection. To this end, the list

of differentially expressed genes was evaluated for the presence of heat shock protein

genes as well as genes involved in DNA repair, protection from reactive oxygen species

and apoptosis. No members of the heat shock protein family were differentially

regulated and only one DNA repair gene (RAD23A) was affected by IGF1. There were,

however, two genes involved in protection from oxidative stress that were upregulated

by IGF1 (COQ9 and GSTM2) and one such gene downregulated (MST1). A total of 5

anti-apoptotic genes were upregulated by IGF1 (IL6ST, EIF3A, NFATC3, DYRK3, and

ANP32B) and 5 pro-apoptotic genes were downregulated by IGF1 (DPYSL4, MST1,

TNFRSF11A, NODAL and ARHGEFIOL). In addition, IGF1 also upregulated two pro-

apoptotic genes (IER3P1, and RNASEL), and downregulated one anti-apoptotic gene

(NT5E).

There were a group of 5 antiviral genes that were differentially regulated including

three genes increased by IGF1 (MAN2A2, CPSF3, and RNASEL) and two genes

inhibited by IGF1 (MON1B and IFITM3).

The data base was also queried to determine whether genes reported to be

regulated by IGF1 in bovine blastocysts using PCR [183] were regulated by IGF1 in the

present study. However, none of the genes, which were A TP1A1, BAX, DSC2,

HSPA1A, IGFBP3, and IGF1R, were differentially regulated.

Validation of Microarray Data by qPCR

Results of microarray analysis were confirmed for four of six genes analyzed by

qPCR (Figure 3-6). In particular, NFATC3, PPIP5K2, and TGFB2, which were

upregulated by IGF1 as determined by microarray analysis, were also higher in the









IGF1 group by qPCR (P<0.05). Also, FADS6, which was downregulated by IGF1 in the

microarray analysis, was lower in the IGF1 group by qPCR (P<0.05). Another two genes

that were downregulated by IGF1 as determined by microarray analysis were not

downregulated as determined by qPCR. One gene (RAD23A) was upregulated as

determined by qPCR (P<0.05) while the other (H1FOO), was not different between

control and IGF1 although the magnitude of difference between IGF1 and control was in

the opposite direction than for the microarray results.

Discussion

In addition to increasing competence to develop to the blastocyst stage [31, 34],

IGF1 acts as a survival factor in the preimplantation embryo to protect against elevated

temperature [1, 3], oxidative stress [210, 212], tumor necrosis factor a [256],

campothecin and actinomycin D [211]. Results from the present study demonstrate that

thermoprotective actions of IGF1 are developmentally regulated because IGF1

diminished the effects of heat shock on development for day 5 embryos 2 16 cells but

had no thermoprotective effect for two-cell embryos exposed to heat shock. Moreover,

the failure of IGF1 to protect two-cell embryos is probably not because signaling

molecules required for IGF actions are depleted. Indeed, IGF1R mRNA was higher for

two-cell embryos than for day 5 embryos and the amount of immunoreactive IGF1R was

similar for two-cell and day 5 embryos. Similarly, mRNA for three key molecules in the

IGF1 signaling cascade, RAF1, MAPK, and P13K, [150] were higher for two-cell

embryos. Reduction in transcript abundance from the two-cell stage to morula stage is a

very common pattern in the bovine embryo [107, 257], probably because of degradation

of maternally-derived mRNA and because transcription is inhibited until the 8-16 cell

stage [49]. The one gene whose transcript abundance increased from the two-cell stage









to day 5 was HK2. A similar change in hexokinase mRNA from the two-cell to morula

stage was seen earlier using non quantitative RT-PCR [258]. This increase probably

reflects the increased utilization of glucose associated with compaction [259].

There are two other possible reasons why IGF1 failed to increase resistance of

two-cell embryos to heat shock. One possibility is that the block to transcription in the

two-cell embryo prevents changes in gene expression required for thermotolerance. A

second possibility is that the damage to the two-cell embryo caused by heat shock is

too great for IGF1 to counter. As shown in this study and others [36, 197-198], the two-

cell embryo is more susceptible to heat shock than day 5 embryos. In the present study,

for example, exposure to 41C decreased development of two-cell embryos while

having no effect on development of day 5 embryos. The reason for increased

susceptibility of the two-cell embryo to heat shock is not known but could involve

transcriptional silencing [49], increased production of free radicals in response to heat

shock [198], and decreased amounts of the intracellular antioxidant glutathione [260].

One of the characteristics of the bovine embryo produced in vitro in the presence

of IGF1 is increased potential for survival after transfer into recipients, but only when

those recipients are exposed to heat stress [35, 261]. Thus, IGF1 changes some aspect

of embryo function (gene expression, epigenetic regulation, etc.) that, through

interactions with heat-stress induced changes in maternal function, enhances embryo

survival. Microarray analysis was performed to identify genes or gene clusters that

might be involved in this effect of IGF1. In general, the pattern of gene expression was

largely similar between control and IGF1-treated blastocysts. Only a small number of

differentially-expressed genes were identified and the change in transcript abundance









caused by IGF1 was most typically between 1.5 and 2.0 fold. None of a set of 6 genes

whose expression was increased in IGF1-treated blastocysts [183] was identified as

being regulated by IGF1 in the present experiment. It is possible that the microarray

analysis underestimated the genes regulated by IGF1 or that only a few changes are

involved in the post-transfer consequences of treatment with IGF1.

Among the genes whose expression changed in response to IGF1 were several

involved in apoptosis and protection from reactive oxygen species. Regulation of these

genes could conceivably increase post-transfer survival in heat-stressed recipients by

protecting the embryo from effects of maternal hyperthermia. Of the 5 anti-apoptotic

genes upregulated by IGF1, three are involved in cell signaling. In particular, IL6ST is

part of the IL6 receptor complex that inhibits apoptosis through phosphorylation of STAT

[262], DYRK3 is a kinase that phosphorylates and activates the anti-apoptotic protein

SIRT1 [263], and NFATC3 is a transcription factor that increases production of BCL2

[264]. ANP32 is a substrate of caspase 3 that limits apoptosis [265], presumably by

competing with other substrates for the enzyme. EIF3A is a translation initiation factor

whose overexpression can inhibit apoptosis in cancer cells [266]. Five pro-apoptotic

genes were also downregulated by IGF1. DPYSL4 is one of the mediators of p53-

induced apoptosis [267], MST1 is a Sterile20-like kinase that promotes apoptosis

through several pathways [268], TNFRSF11A, also called RANK, is a ligand for the pro-

apoptotic TNF family member RANK [269], NODAL is a pro-apoptotic member of the

TGFB family [270], and ARHGEFIOL is a member of the RhoGEF family of guanine

nucleotide exchange factors (GEFs) that activate Rho GTPases which in turn can

activate apoptosis [271]. It is true that IGF1 also increased expression of two pro-









apoptotic genes (IER3P1, and RNASEL) and downregulated one anti-apoptotic gene

(NT5E). However, the anti-apoptotic effect of IGF1 on the preimplantation bovine

embryo has been demonstrated directly through studies evaluating induction of

apoptosis by heat shock [1, 3] and menadione [212].

Effects of heat shock on development involve reactive oxygen species; heat shock

increases production of reactive oxygen species and addition of certain antioxidants can

reduce the effects of heat shock [198, 202]. Thus, the increase in expression of two

genes involved in protection from reactive oxygen species could facilitate survival after

heat shock. One of the antioxidant genes was GSTM2, which utilizes glutathione to

reduce electrophilic molecules [272]. In addition, GSTM2 can serve as a prostaglandin

E synthase [273]. The other gene upregulated by IGF1 was COQ9, an endogenous

lipophilic antioxidant [274-275]. Treatment with IGF1 also decreased expression of

MST1. While this kinase is involved in blocking free radical generation caused by FOXO

regulation of superoxide dismutase and catalase [276], it is also pro-apoptotic [277-278]

so inhibition of its expression could contribute to embryo survival.

It is probably unlikely that the actions of IGF1 to improve embryonic survival during

heat stress are simply the result of increasing embryonic resistance to maternal heat

stress. Indeed, the embryo is substantially resistant to maternal hyperthermia by the

blastocyst stage [36, 194, 197-198] and embryo transfer can minimize the seasonal

variation in fertility in lactating dairy cows [14]. Moreover, treatment of embryos with

IGF1 increases pregnancy rate in heat-stressed embryo transfer recipients to a value

higher than that seen in embryo transfer recipients not exposed to heat stress [35]. One

interpretation of this observation is that increased survival after transfer is to do a









combination of changes in embryonic function caused by IGF1 treatment and the

maternal microenvironment established by heat stress. A large number of genes

involved in developmental processes were affected by IGF1 (9 upregulated genes and

16 downregulated genes) and some of these genes could be important for embryonic

survival in association with other changes in embryonic function caused by maternal

hyperthermia.

One process that IGF1 may be regulating is neurulation. The default fate of

embryonic ectoderm is neural tissue and this process is inhibited early in development

by BMP4 [279]. Several genes involved in neural function or differentiation were

inhibited by IGF1 including CNTNAP2, a member of the neurexin family of receptors

and cell adhesion molecules involved in synapse formation [280], GFAP, a glial

intermediate filament protein [281], DPYSL4, a member of a family of cytosolic

phosphoproteins involved in brain development [282], ALDHIA2, which catalyzes

formation of retinoic acid [283], which in turn promotes neural crest cell formation from

embryonic stem cells [284], KREMEN, a receptor for Dickkopf 1 that promotes

embryonic stem cell differentiation towards neuroectoderm [285], ARHGEFIOL, an

activator of Rho GTPases that participate in neural tube closure [286] and NRG2, a

member of the neuroregulin family of receptor ligands that are involved in development

of the nervous system [287].

In conclusion, thermoprotective actions of IGF1 are developmentally regulated

with the two-cell embryo being refractory to IGF1. Failure of IGF1 to protect two-cell

embryos is probably not because signaling molecules required for IGF1 actions are

depleted but rather either because the block to transcription in the two-cell embryo









prevents changes in gene expression required for thermotolerance or that the damage

to the two-cell embryo caused by heat shock is too great for IGF1 to counter. In any

case, refractoriness of the early preimplantation embryo to protective actions of IGF1

can be used to explain why a treatment like bovine somatotropin that regulates IGF1

secretion was not effective for increasing fertility of females exposed to heat stress [2,

222]. Results also indicate that the improved competence for post-transfer survival of

bovine embryos caused by treatment with IGF1 is associated with changes in

expression of genes involved in developmental processes, apoptosis, and protection

from reactive oxygen species.









Table 3-1. Primer sets for quantitative real-time RT-PCR (Exp.1)
Gene Accession Primer/ Sequence
Probe
IGFIR XM_606794.1 Forward AGTTATCTCCGGTCTCTGAGG
Reverse CTTATTGGCGTTGAGGTATGC
Probe /56-FAM/TTTTGCTTAGGCTGGGAGGTGCT/31ABIk_FQ/
RAF1 NM_001102505 Forward AAGCTATACAAGAACTGCCCC
Reverse GCTCGATGGAAGACAGGATC
Probe /56-FAM/TGGTAGCTGACTGCGTGAAGAAAGTG/31ABIk_FQ/
MAPK NM_175793 Forward ACCTCAAACCTTCCAACCTG
Reverse CCACGTACTCTGTCAAGAACC
Probe /56-FAM/ATCTGCAACACGGGCCAAGC/31ABIkFQ/
GAPHD NM_001034034 Forward ACCCAGAAGACTGTGGATGG
Reverse CAACAGACACGTTGGGAGTG
Probe /56-FAM/TCAACGGGAAGCTCACTGGCA/31ABlk_FQ/

Table 3-2. Primer sets for quantitative real-time RT-PCR (Exp.2)
Gene Accession Primer Sequence Length Tm
IGFIR XM_606794.3 Forward TAACCATGAGGCTGAGAAGCTTGG 120 bp 60C
Reverse TTCTCAGGCCTTGGCTCCCA
HK2 XM_865470.1 Forward GAG TTT GAT GCA GCT GTG GA 263 bp 56C
Reverse CTC TCG AGC CCT AAG TGG TG
P13K NM_174576.1 Forward GCAACAAGCTTCCACTCTCC 198 bp 55.5C
Reverse CAAGGAGGCGGTATCACAAT
HISTIH2AA XM_583411 Forward CTGCCAAAGAAAACCGAGAG 202 bp 55C
Reverse TCTGGATCGAGGCATCTCTT










Table 3-3. Primer sets for quantitative real-time RT-PCR (microarray validation)
Gene Accession Prime Sequence Length Tm
HIFOO DQ206443 Forward GCCGAGTGAGTCAAAGAAGG 324 bp 55.7C
Reverse GGTGACCGTGGATTTTGAAC
TGFB2 XM_001788732 Forward AAGCACGCTTTGCAGGTATT 166 bp 55.5C
Reverse TAGCAGGAGATGTGGGCTCT
RAD23A NM_001082614 Forward TCTGTCCAGGAGAGCCAAGT 91 bp 57.9C
Reverse TCTGGAACTGAGGCTGGTCT
NFATC3 XM_614673 Forward CCCACACACCTCATTCTGTG 125 bp 55.8C
Reverse AGAGGAAGGCTGACCTGTGA
PPIP5K2 XM_001250677 Forward ACTTGATGGCAAGGTGGAAC 100 bp 55.6C
Reverse AAGCAAGGCAGACTTTCCAA
FADS6 NM_001081722 Forward ACGTGGAACACCACCTCTTC 153 bp 57.2C
Reverse ACTCCTCGTAGCGTTGGAGA
GAPDH NM_001034034 Forward ACCCAGAAGACTGTGGATGG 177 bp 57.2C
Reverse CAACAGACACGTTGGGAGTG









Table 3-4. Genes upregulated by IGF1 treatment

Description

Bos taurus progesterone receptor membrane
component 2 (PGRMC2)

Predicted: Bos taurus odz, odd Oz/ten-m homolog 4
(ODZ4)

Predicted: Bos taurus similar to mannosidase, alpha,
class 2A, member 2, transcript variant 1 (MAN2A2)

Bos taurus exportin 4 (XP04)

Bos taurus profilin 2 (PFN2)

Predicted: Bos taurus similar to TATA binding protein
associated factor 4b (TAF4B)

Bos taurus solute carrier family 40 (iron-regulated
transporter), member 1 (SLC40A1)

Bos taurus cytochrome P450, family 4, subfamily F,
polypeptide 2 (CYP4F2)

Bos taurus cleavage and polyadenylation specific
factor 3, 73kDa (CPSF3)


Accession
Number
NM_001099060


XM_586751


XM_605840


NM_001098889

NM_001128197

XM_596212.4


NM_001077970


NM_001075322


NM_174284


Least Square Means
Intensity Intensity Fold
Control IGF1 change
11 28 2.6


P

0.04


22 2.5 0.01


12 2.3 0.01


20 2.1 0.04

28 2.1 0.01

22 2.1 0.01


39 2.0 0.02


1.9 0.02


12 1.9 0.05


Bos taurus annexin A2 (ANXA2)


Predicted: Bos taurus similar to interleukin 6 signal
transducer (gp130, oncostatin M receptor) (IL6ST)


NM_174716

XM_600430


782


1448


1.9 0.04


36 1.8 0.01









Table 3-4. Continued

Description

Bos taurus farnesyltransferase, CAAX box, alpha
(FNTA)

Bos taurus tudor and KH domain containing (TDRKH)

Bos taurus lysophosphatidic acid receptor 6 (LPAR6)

Bos taurus coenzyme Q9 homolog (S. cerevisiae)
(COQ9)

Predicted: Bos taurus similar to oxysterol-binding
protein-like protein 11, transcript variant 3 (OSBPL11)

Bos taurus transforming growth factor, beta 2 (TGFB2)

Predicted: Bos taurus eukaryotic translation initiation
factor 3, subunit A, transcript variant 4 (EIF3A)

Bos taurus similar to Homo sapiens nuclear factor of
activated T-cells, cytoplasmic, calcineurin-dependent 3
(NFA TC3)
Diphosphoinositol pentakisphosphate kinase 2
(PPIP5K2)
Bos taurus collagen, type IV, alpha 1 (COL4A1)

PREDICTED: Bos taurus IQ motif containing GTPase
activating protein 1 (IQGAP1)
Predicted: Bos taurus similar to mannosidase, alpha,
class 2B, member 2 (MAN2B2)


Accession
Number
BC112662


NM_001105375

NM_001101284

NM_001046302


XM_865427


NM_001113252

XM_879302


XM_614673


XM_001250677

NM_001166511

XM_001251162

XM_601803.4


Least Square Means
Intensity Intensity Fold
Control IGF1 change
43 77 1.8


51

6

23


23


29

121


29


46

338

33

7


P

0.05


0.05

0.04

0.00


1.7 0.01


49

202


0.01

0.01


49 1.7 0.01


76

557

54

11


0.00

0.01

0.00

0.04









Table 3-4. Continued


Description

Bos taurus cellular repressor of E1A-stimulated genes
1 (CREG1)

Bos taurus ribonuclease L (2',5'-oligoisoadenylate
synthetase-dependent) (RNASEL)

Bos taurus upstream binding factor (UBF)

Bos taurus immediate early response 3 interacting
protein 1 (IER3IP1)

Predicted: Bos taurus chloride channel 5
(nephrolithiasis 2, X-linked, Dent disease), transcript
variant 2 (CLCN5)

Bos taurus similar to Homo sapiens plasma glutamate
carboxypeptidase (PGCP)

Bos taurus similar to Homo sapiens bone
morphogenetic protein 7 osteogenicc protein 1) (BMP7)

Predicted: Bos taurus glutathione S-transferase M2,
transcript variant 1 (GSTM2)

Bos taurus calcium binding protein 39 (CAB39)

Bos taurus acidic (leucine-rich) nuclear phosphoprotein
32 family, member B (ANP32B)


Accession
Number
NM_001075942


NM_001098165


AY225853

NM_001113320


XM 864613



XM_613707


XM_612246


XM_868256.3


NM_001046087

NM_001035074


Least Square Means
Intensity Intensity Fold
Control IGF1 change
15 24 1.6


10


25

358


15



84


14


P

0.00


16 1.6 0.04


40 1.6 0.04


1.6 0.03


23 1.6 0.00


129


1.5 0.03


22 1.5 0.03


1.5 0.00


34 1.5 0.02


2393


3618


1.5 0.02









Table 3-4. Continued


Description

Bos taurus GABA(A) receptor-associated protein like 1
(GABARAPL1)

Bos taurus poly(A) binding protein interacting protein 2
(PAIP2)

Predicted: Bos taurus similar to erythrocyte adenosine
monophosphate deaminase (AMPD3)

Bos taurus inner membrane protein, mitochondrial
(mitofilin) (IMMT), nuclear gene encoding mitochondrial
protein

Bos taurus sushi-repeat-containing protein, X-linked 2
(SRPX2)

Bos taurus dual-specificity tyrosine-(Y)-phosphorylation
regulated kinase 3 (DYRK3)

Bos taurus similar to Homo sapiens synaptotagmin XIV
(SYT14)


Accession
Number
NM_001033616


NM_001034636


XM_001788101


NM_001046015



NM_001014926


NM_001100298


XM 607854


Least Square Means
Intensity Intensity
Control IGF1
486 733


1577


Fold
change
1.5


2375


P

0.02


1.5 0.05


8 1.5 0.02


144


1.5 0.04


32 1.5 0.04


1.5 0.02


1.5 0.03









Table 3-5. Genes downregulated by IGF1 treatment

Description

Bos taurus H1 histone family, member 0, oocyte-
specific (HIFOO)

Predicted: Bos taurus similar to contactin-associated
protein-like 2 precursor (Cell recognition molecule
Caspr2) (CNTNAP2)
Homo sapiens neuregulin 2 (NRG2), transcript
variant 4

Bos taurus glial fibrillary acidic protein (GFAP)

Bos taurus dihydropyrimidinase-like 4 (DPYSL4)

Predicted: Bos taurus similar to translocation-
associated membrane protein 2 (TRAM2)

MMP15 matrix metallopeptidase 15 (membrane-
inserted) (MMP15)

Par-3 partitioning defective 3 homolog b (C.elegans)
(Bos taurus) (PARD3B)

Bos taurus mucus-type core 2 beta-1,6-N-
acetylglucosaminyltransferase (GCNT3)

Inositol polyphosphate-5-phophatase, 40 KDa
(INPP5A)


Accession


NM_001035372


XM 594548


NM_013983


NM_174065

NM_001163783

XM 869521


XM_597651.4


XR_042691.1


NM_205809


XM 866984


Least Square Means
Intensity Intensity
Control IGF1


Fold
change
19 -2.5


P

0.00


-2.0 0.05


-1.9 0.03


7 -1.8 0.03


-1.8 0.03

-1.8 0.01


-1.7 0.05


15 -1.7 0.04


-1.7 0.04


7 -1.7 0.02









Table 3-5. Continued


Description

Predicted: Bos taurus hypothetical LOC511430,
transcript variant 2 (MUC13)

Predicted: Bos taurus similar to aldehyde
daiaiaiehydrogenase 1A2 (ALDH1A2)

Bos taurus 5' nucleotidaisisise, ecto (NT5E)

Predicted: Bos taurus similar to heterochromatin
protein 1 beta, transcript variant 1 (CBX1)

Bos taurus partial mRNA for 5-hydroxytryptamine 2C
receptor (5htr2c)

Bos taurus G-protein coupled receptor 173
(GPR173)

Bos taurus fatty acid desaturase domain family,
member 6 (FADS6)

Predicted: Bos taurus similar to fibrillin 2 (FBN2)

Bos taurus similar to Homo sapiens claudin 7
(CLDN7)

Bos taurus macrophage stimulating 1 (hepatocyte
growth factor-like) (MST1)

Bos taurus zona pellucida glycoprotein 4 (ZP4)


Accession

XM 865756


XM_615062


NM_174129

XM 001249481


AJ491865


NM_001015604


NM_001081722


XM_590917

NM_001040519


NM_001075677


NM_173975


Least Square Means
Intensity Intensity
Control IGF1
184 109


31

21


11


60


97


15

4517


19


124


Fold
change
-1.7


P

0.04


-1.7 0.01


-1.7 0.04


12 -1.7 0.03


-1.6 0.02


37 -1.6 0.02


-1.6 0.01


10 -1.6 0.03


2867


-1.6 0.01


12 -1.6 0.04


-1.6 0.02









Table 3-5. Continued


Description

Bos taurus similar to Homo sapiens NIMA (never in
mitosis gene a) related kinase 8 (NEK8)

Bos taurus tumor necrosis factor receptor
superfamily, member 1 a, NFKB activator
(TNFRSF11A)

Bos taurus similar to Homo sapiens nodal homolog
(mouse) (NODAL)
Predicted: Bos taurus similar to kringle-containing
transmembrane protein 1 (KREMEN1)
Predicted: Bos taurus similar to neuralized-like
protein 1 (h-neuralized 1) (h-neu) (RING finger
protein 67), transcript variant 1 (NEURL)

Salmo salar UV excision repair protein RAD23
homolog A (rd23a)

Bos taurus MON1 homolog B (yeast) (MONIB)
Bos taurus membrane-spanning 4-domains,
subfamily A, member 5 (MS4A5)

Bos taurus matrix metalloproteinase 13 (collagenase
3) (MMP13)
Bos taurus Rho guanine nucleotide exchange factor
(GEF) 10-like (ARHGEFIOL)
Bos taurus interferon induced transmembrane
protein 3 (1-8U) (IFITM3)


Accession

XM_610844


XM_609364



XM_609225

XM_602679

XM 587462



NM_001141812


NM_001037454
NM_001078146


NM_174389

NM_001046297


NM 181867


Least Square Means
Intensity Intensity
Control IGF1
17


15


Fold
change
11 -1.6


P

0.04


-1.6 0.01



-1.5 0.01


7 -1.5 0.04


59



405


39



269


-1.5 0.04



-1.5 0.02


-1.5
-1.5


217


146


0.02
0.01


-1.5 0.03

-1.5 0.03

-1.5 0.02









Table 3-6. Significant biological process gene ontology terms for differentially expressed genes in blastocvstsa


Gene ontology (GO)

GO:0009790: embryonic development

GO:0048598: embryonic morphogenesis

GO:0009653: anatomical structure
morphogenesis

GO:0008284: positive regulation of cell
proliferation

GO:0048545: response to steroid hormone
stimulus

GO:0048856: anatomical structure development



GO:0048468: cell development

GO:0007178: transmembrane receptor protein
serine/threonine kinase signaling pathway
GO:0009605: response to external stimulus

GO:0032989: cellular component
morphogenesis


Action of
IGF1
UP:
DOWN:
UP:
DOWN:
UP:


Gene

BMP7, TGFB2, ODZ4
ALDHIA2, NODAL, FBN2, MMP13, NRG2
BMP7, ODZ4
ALDHIA2, NODAL, FBN2, MMP13
BMP7, SLC4OA1, TGFB2, ANXA2, ODZ4


DOWN: ALDHIA2, NEURL, NODAL, FBN2, MMP13
UP: FNTA, IL6ST, TGFB2


DOWN:
UP:


ALDHIA2, TNFRSF11A, NODAL
BMP7, TGFB2


DOWN: ALDHIA2, MMP13
UP: ANXA2, TGFB2, DYRK3, BMP7, NFATC3, SLC4OA1,
ODZ4
DOWN: NEURL, NODAL, DPYSL4, MMP13, ALDHIA2,
TNFRSF11A, CNTNAP2, FBN2
UP: BMP7, TGFB2
DOWN: ALDHIA2, NEURL, NODAL, CNTNAP2
UP: FNTA, BMP7, TGFB2


UP:
DOWN:
UP:


IL6ST, BMP7, NFATC3, TGFB2
ALDHIA2, NEURL, MST1, MMP15
BMP7, TGFB2


DOWN: NEURL, NODAL
a The analysis was conducted using David software ( http://david.abcc.ncifcrf.gov/). The only ontologies shown are those
with more than two differentially expressed genes in an ontology and where the ontology was not an organ-specific term














KSOM
selected
RIN: 8.70
[FU]
40-


0 25 500 4000 [nt]
25 500 4000 [nt]


IGF-I
selected
RIN: 8.90
[FU]
100-

50 -
0
25 500 4000 [nt
25 500 4000 [nt]


Figure 3-1. Representative results of analysis of RNA from KSOM (control) and IGF1
treated embryos used for microarray, determined by Agilent 2100 Bioanalyzer
RNA 6000 Pico Labchip Kit.














U)
oo
U40

=
Y 30
00



M-
-0 0
(-D 20



h 0 10

^ 60

00
o ,50

E o 40
LO-
M 0 0


o
(M 20

- 10

o 0
-Q


B


38.5C


41C


Vehicle


38.5C


41C


IGF1


Figure 3-2. Effect of IGF1 on the reduction in development caused by a heat shock of
41C at the two-cell stage and day 5 of development (embryos > 16 cells).
Data in Panel A are from two-cell embryos and data in Panel B are from day 5
embryos at 41 C. In two-cell embryos, there was a decrease in the percent of
embryos becoming a blastocyst caused by heat shock (P<0.005) but no effect
of IGF1 or IGF1 x temperature. For day 5 embryos, there was no effect of
temperature, IGF1 or the interaction.














_T_


100

80

60

40

20

0


Figure 3-3. Effect of IGF1 on the reduction of development caused by exposure of day 5
embryos (2 16 cells) to a heat shock at 42C. There was a decrease in the
percent of embryos becoming blastocyst at day 8 caused by heat shock
(P<0.001) and an increase in percent blastocyst caused by IGF1 (P<0.05).


38.50C


38.5C 42C
IGF1


42C


Vehicle











16
14
12
c 10-


0 86
6-
-7 6


two-celll day 5
IGF1R


two-celll day 5 two-celll day 5


RAF


MAPK


two-celll day 5


IGF1R


two-celll day 5


P13K


two-celll day 5
two-celll day 5


HK2


Figure 3-4. Changes in expression of genes involved in IGF1 signaling at the two-cell
and day 5 (>16 cells) stage as determined by qPCR. In the first experiment
(panel A), steady state amounts of mRNA for IGFIR, RAF1 and MAPK were
higher for two-cell embryos (P<0.001). In the second experiment (panel B),
there was a nonsignificant tendency for expression of IGFIR to be higher at
the two-cell stage. Amounts of mRNA for P13K were higher for two-cell
embryos (P<0.001) while amounts of HK2 mRNA were higher for day 5
embryos (P<0.001).



























25 B


>, 20
:t-,

E15


O- 10


5


0
two-cell day 5

Figure 3-5. Expression of IGF1R protein in two-cell and day 5 (2 16 cells) embryos.
Panel A represents immunocytochemistry staining for two-cell embryos and
day 5 embryo. Red fluorescence denotes positive staining of IGF1R. As
shown by quantitative analysis in panel B, there was no difference in pixel
intensity between two-cell and day 5 embryos.











3.5 NFATC3 (P<0.05)
SPPIP5K2 (P<0.05)
0 3.0
c- 2.5 RAD23A (P<0.05)

S2.0 -
-C TGFB (P<0.05)
1.5 HIFOO(N.S.)

1.0

0.5 FADS6 (P<0.05)

0.0 .1
0.0 0.5 1.0 1.5 2.0 2.5 3.0
Fold change microarray
Figure 3-6. Fold-change in gene expression using qPCR (y axis) and microarray
hybridization (x-axis) for a selected group of six differentially expressed
genes. Fold change values are calculated as IGF1/control. N.S = non-
significant.









CHAPTER 4
GENERAL DISCUSSION

Insulin-like growth factor is an important maternal determinant of embryonic

survival that can promote development to the blastocyst stage [31-32, 34], protect the

embryo from several stresses [1, 3, 212] and increase competence for development to

term, at least in heat-stressed females [35, 133]. The overall goal of this dissertation

was to understand the molecular basis for the developmental acquisition of

thermoprotective actions of IGF1 on preimplantation embryos and the thermoprotective

effects of IGF1 during culture and after transfer into recipients. A schematic diagram

illustrating the conclusions of the dissertation is shown in Figure 4-1.

For both effects on development and on thermotolerance, the embryo appears

resistant to IGF1 until sometimes between the two-cell stage and day 4 after

fertilization. Thus, addition of IGF1 from day 0-4 had no effect on the proportion of

embryos becoming blastocysts while addition from day 4-8 increased the percent of

embryos becoming blastocysts in a manner involving MAPK-regulated events (Chapter

2). Similarly, IGF1 protected embryos from heat shock at day 5 but not at the two-cell

stage. Developmental changes in actions of IGF1 appear not to be due to a lack of IGF1

signaling molecules because IGF1R and mRNA for selected genes involved in IGF1

signaling were present at the two-cell stage (Chapter 2). It seems most likely that the

reason for unresponsiveness to IGF1 relates to the lack of transcriptional capacity for

the early embryo until embryonic genome activation at the 8-16 cell stage [39]. Indeed,

one effect of IGF1 was increased expression of ATPAIA (Chapter 2) and this action

may contribute to embryo competence to become a blastocyst.









The MAPK pathway is one of the signaling pathways for the proliferative actions of

IGF1 [240-241]. Inhibition of the MAPK pathway decreased the effect of IGF1 on

embryo development (Chapter 2), and it is possible, therefore, that the main action of

IGF1 for increasing blastocyst development is an increase in cell number. It is

controversial whether IGF1 increases cell number in the bovine embryo; some studies

did not show an increase in blastocyst cell number [183] while other studies did [177,

179]. Since the inhibition of MAPK pathway did not block overall embryo development,

future studies to evaluate different pathways by which IGF1 improves embryo

development, such as PDK1 or JAK-STAT [148, 288-289], could be important. In

addition, it would be of interest to determine whether IGF1 increases other genes

involved in embryo compaction and blastocyst formation such as zonula occludens, and

the aquaporins [81, 87]









IGF1R and signaling genes present
I I
N Increased competence
mRA EA for survival after transfer
SImR I o' J into heat-stressed cows

1-cell 2-cell 4-cell 8-cell 16-cell morula blastocyst
i i i Anti-apoptotic
day 0 day 3 day 4 day Antioxidant
_Changes in
no thermoprotection thermoprotection developmental
_genes
NI o effect of IGF1 on competence
to become a blastocyst MEK, ATP1A1

Promotes competence
to become a blastocyst

Figure 4-1. Developmental actions of IGF1 to promote blastocyst formation and protect
from heat shock. Note that effects of IGF1 to increase competence of an
embryo to become a blastocyst between day 4 and 8 post-insemination.
Similarly, IGF1 can protect embryos from heat shock at day 5 but not at the
two-cell stage. Actions of IGF1 to increase development involve MAPK-
dependent events and include increased expression of A TPA IA. Failure of
the embryo to respond to IGF1 before day 4 appears not to be due to a lack
of IGF1 signaling molecules because IGF1R and mRNA for selected genes
involved in IGF1 signaling were present at the two-cell stage. Note also that
the blastocyst produced in the presence of IGF1 has increased potential for
survival when transferred into heat stressed recipients [35]. This effect of
IGF1 is associated with changes in expression of genes involved in
development, apoptosis and protection from free radicals.









While lack of transcriptional regulation may be one reason why IGF1 cannot

protect two-cell embryos from heat shock, it is also possible that the increased

sensitivity of two-cell embryos to elevated temperatures due to higher production of

ROS [198] or other reasons makes the damage caused by heat shock too severe to be

reversed by IGF1. Some of the deleterious effects of ROS include DNA strand breaks,

mitochondrial damage [290], and embryonic arrest. Rivera et al. [205] have shown that

two-cell embryos submitted to heat shock were arrested and did not pass the eight-cell

stage. One possible cause for embryonic arrest could be an increase in oxidative stress

leading to higher levels of p66shc mRNA. P66Shc is a stress adaptor protein associated

with early embryonic arrest [206-208] and it regulates mitochondrial metabolism by

modulating the amount of ROS released into the cytosol [209]. Another possibility to

explain increased sensitivity of the two-cell embryo to heat shock is that maternal

mRNAs and proteins may be more sensitive to elevated temperatures. Embryonic

development during the early cleavage stages is supported by maternal mRNAs and

proteins synthesized and stored during oogenesis [39], and these stores are important

during the interval of fertilization and embryonic genome activation.

Heat stress reduces the duration of estrus, impairs follicular development and

oogenesis, decreases follicular steroid production [14, 186-187] and decreases IGF1

concentration in the blood and follicular fluid [291]. Addition of IGF1 to maturation

medium was shown to stimulate oocyte maturation, cumulus expansion and cleavage

rate after fertilization [292]. Furthermore, the use of bST has been shown to increases

plasma concentrations of IGF1 [216, 218], which could be used as an in vivo treatment

to prevent effects of heat stress. In vivo studies showed that bST treatment increased









IGF1 content in the follicular fluid, improved follicular development prior to ovulation

[293], and increased fertilization rate and embryonic development [294]. However, the

lack of thermoprotective effects of IGF1 on two-cell embryos would make treatment of

cows with bST at early stages of pregnancy ineffective for preventing effect of heat

stress on fertility. Future experiments could be conducted to evaluate whether oocytes

can be protected from heat shock by IGF1 and to determine whether this beneficial

effect would carry over into the period of embryonic development. Furthermore, it is not

known whether an increase of IGF1 in reproductive tract can increase fertility.

Moreira et al. [294] found that treatment of recipient cows with bST increased

pregnancy rates after transfer of embryos flushed from donor cows without bST.

Perhaps bST and IGF1 can also improve the uterine environment. Futures studies could

be done to evaluate effects of bST on gene expression in the uterus of cows under heat

stress.

In our study, microarray analysis showed that IGF1 changed expression of genes

involved in apoptosis and protection from reactive oxygen species in day 7 blastocysts,

which could conceivably increase post-transfer survival in heat-stressed recipients by

protecting the embryo from effects of maternal hyperthermia. Furthermore, a large

number of genes involved in developmental processes were affected by IGF1 and some

of these genes could be important for embryonic survival in association with other

changes in embryonic function caused by maternal hyperthermia. The fact that IGF1

increased potential for survival after transfer into recipients, but only when those

recipients are exposed to heat stress [35, 261], suggests that beneficial effects of IGF1









on embryo function only affect embryonic survival in conjunction with other changes in

embryo function caused by heat-stress induced changes in maternal function.

Taken together, these investigations indicate that IGF1 can regulate embryonic

development and resistance to heat stress but that these actions occur at or after day 4

of development, at a time after embryonic genome activation. Furthermore, the pro-

developmental effects of IGF1 involve actions mediated by the MAPK pathway and

include alteration of genes controlling formation of the blastocoelic cavity. Genes

regulated by IGF1 at the blastocyst stage, such as those involved in development,

apoptosis and protection from oxidative stress could be involved in the increase in

embryonic survival after transfer to heat-stressed recipients caused by IGF1.









LIST OF REFERENCES


1. Jousan FD, Hansen PJ. Insulin-like growth factor-I as a survival factor for the
bovine preimplantation embryo exposed to heat shock. Biol Reprod 2004;
71:1665-1670.

2. Jousan FD, de Castro e Paula LA, Block J, Hansen PJ. Fertility of lactating dairy
cows administered recombinant bovine somatotropin during heat stress. J Dairy
Sci 2007; 90:341-351.

3. Jousan FD, Hansen PJ. Insulin-like growth factor-I promotes resistance of bovine
preimplantation embryos to heat shock through actions independent of its anti-
apoptotic actions requiring P13K signaling. Mol Reprod Dev 2007; 74:189-196.

4. Diskin MG, Morris DG. Embryonic and early foetal losses in cattle and other
ruminants. Reprod Domest Anim 2008; 43 Suppl 2:260-267.

5. Berg DK, van Leeuwen J, Beaumont S, Berg M, Pfeffer PL. Embryo loss in cattle
between Days 7 and 16 of pregnancy. Theriogenology 2010; 73:250-260.

6. Santos JE, Thatcher WW, Chebel RC, Cerri RL, Galvao KN. The effect of
embryonic death rates in cattle on the efficacy of estrus synchronization
programs. Anim Reprod Sci 2004; 82-83:513-535.

7. Inskeep EK, Dailey RA. Embryonic death in cattle. Vet Clin North Am Food Anim
Pract 2005; 21:437-461.

8. Lucy MC. Reproductive loss in high-producing dairy cattle: where will it end? J
Dairy Sci 2001; 84:1277-1293.

9. Wolfenson D, Thatcher WW, Badinga L, Savio JD, Meidan R, Lew BJ, Braw-Tal
R, Berman A. Effect of heat stress on follicular development during the estrous
cycle in lactating dairy cattle. Biol Reprod 1995; 52:1106-1113.

10. Edwards JL, Hansen PJ. Elevated temperature increases heat shock protein 70
synthesis in bovine two-cell embryos and compromises function of maturing
oocytes. Biol Reprod 1996; 55:341-346.

11. Sartori R, Haughian JM, Shaver RD, Rosa GJ, Wiltbank MC. Comparison of
ovarian function and circulating steroids in estrous cycles of Holstein heifers and
lactating cows. J Dairy Sci 2004; 87:905-920.

12. Rizos D, Carter F, Besenfelder U, HavlicekV, Lonergan P. Contribution of the
female reproductive tract to low fertility in postpartum lactating dairy cows. J
Dairy Sci 2010; 93:1022-1029.


100









13. Sartori R, Sartor-Bergfelt R, Mertens SA, Guenther JN, Parrish JJ, Wiltbank MC.
Fertilization and early embryonic development in heifers and lactating cows in
summer and lactating and dry cows in winter. J Dairy Sci 2002; 85:2803-2812.

14. Hansen PJ. Exploitation of genetic and physiological determinants of embryonic
resistance to elevated temperature to improve embryonic survival in dairy cattle
during heat stress. Theriogenology 2007; 68 Suppl 1:S242-249.

15. Galli C, Duchi R, Crotti G, Turini P, Ponderato N, Colleoni S, Lagutina I, Lazzari
G. Bovine embryo technologies. Theriogenology 2003; 59:599-616.

16. Hansen PJ, Block J. Towards an embryocentric world: the current and potential
uses of embryo technologies in dairy production. Reprod Fertil Dev 2004; 16:1-
14.

17. AI-Katanani YM, Drost M, Monson RL, Rutledge JJ, Krininger CE, 3rd, Block J,
Thatcher WW, Hanse PJ. Pregnancy rates following timed embryo transfer with
fresh or vitrified in vitro produced embryos in lactating dairy cows under heat
stress conditions. Theriogenology 2002; 58:171-182.

18. Demetrio DG, Santos RM, Demetrio CG, Vasconcelos JL. Factors affecting
conception rates following artificial insemination or embryo transfer in lactating
Holstein cows. J Dairy Sci 2007; 90:5073-5082.

19. Dochi O, Takahashi K, Hirai T, Hayakawa H, Tanisawa M, Yamamoto Y, Koyama
H. The use of embryo transfer to produce pregnancies in repeat-breeding dairy
cattle. Theriogenology 2008; 69:124-128.

20. Drost M, Ambrose JD, Thatcher MJ, Cantrell CK, Wolfsdorf KE, Hasler JF,
Thatcher WW. Conception rates after artificial insemination or embryo transfer in
lactating dairy cows during summer in Florida. Theriogenology 1999; 52:1161 -
1167.

21. Numabe T, Oikawa T, Kikuchi T, Horiuchi T. Birth weight and birth rate of heavy
calves conceived by transfer of in vitro or in vivo produced bovine embryos. Anim
Reprod Sci 2000; 64:13-20.

22. Gomez E, Munoz M, Rodriguez A, Caamano JN, Facal N, Diez C. Vitrification of
bovine blastocysts produced in vitro inflicts selective damage to the inner cell
mass. Reprod Domest Anim 2009; 44:194-199.

23. Pontes JH, Nonato-Junior I, Sanches BV, Ereno-Junior JC, Uvo S, Barreiros TR,
Oliveira JA, Hasler JF, Seneda MM. Comparison of embryo yield and pregnancy
rate between in vivo and in vitro methods in the same Nelore (Bos indicus) donor
cows. Theriogenology 2009; 71:690-697.









24. Thibier M. Data Retrieval Committee statistics of Embryo Transfer Year 2008.
The worldwide statistics of embryo transfers in farm animals. In, vol. 27.
International Embryo Transfer News Letter; 2009: 13-19.

25. Scharf J, Ramadori G, Braulke T, Hartmann H. Synthesis of insulinlike growth
factor binding proteins and of the acid-labile subunit in primary cultures of rat
hepatocytes, of Kupffer cells, and in cocultures: regulation by insulin, insulinlike
growth factor, and growth hormone. Hepatology 1996; 23:818-827.

26. Geisert RD, Lee CY, Simmen FA, Zavy MT, Fliss AE, Bazer FW, Simmen RC.
Expression of messenger RNAs encoding insulin-like growth factor-I, -II, and
insulin-like growth factor binding protein-2 in bovine endometrium during the
estrous cycle and early pregnancy. Biol Reprod 1991; 45:975-983.

27. Lonergan P, Gutierrez-Adan A, Pintado B, Fair T, Ward F, Fuente JD, Boland M.
Relationship between time of first cleavage and the expression of IGF-I growth
factor, its receptor, and two housekeeping genes in bovine two-cell embryos and
blastocysts produced in vitro. Mol Reprod Dev 2000; 57:146-152.

28. Pushpakumara PG, Robinson RS, Demmers KJ, Mann GE, Sinclair KD, Webb R,
Wathes DC. Expression of the insulin-like growth factor (IGF) system in the
bovine oviduct at oestrus and during early pregnancy. Reproduction 2002;
123:859-868.

29. Rhoads ML, Meyer JP, Kolath SJ, Lamberson WR, Lucy MC. Growth hormone
receptor, insulin-like growth factor (IGF)-1, and IGF-binding protein-2 expression
in the reproductive tissues of early postpartum dairy cows. J Dairy Sci 2008;
91:1802-1813.

30. Pandey A, Gupta SC, Singh N, Rana JS, Gupta N. Efficiency of SCNT Buffalo
(Bubalus bubalis) Embryos in Different Culture Medium and Analysis of mRNA
Expression of Insulin-like Growth Factors During Embryogenesis. Reprod
Domest Anim 2009.

31. Moreira F, Paula-Lopes FF, Hansen PJ, Badinga L, Thatcher WW. Effects of
growth hormone and insulin-like growth factor-I on development of in vitro
derived bovine embryos. Theriogenology 2002; 57:895-907.

32. Sirisathien S, Hernandez-Fonseca HJ, Brackett BG. Influences of epidermal
growth factor and insulin-like growth factor-I on bovine blastocyst development in
vitro. Anim Reprod Sci 2003; 77:21-32.

33. Block J, Drost M, Monson RL, Rutledge JJ, Rivera RM, Paula-Lopes FF, Ocon
OM, Krininger CE, 3rd, Liu J, Hansen PJ. Use of insulin-like growth factor-I
during embryo culture and treatment of recipients with gonadotropin-releasing
hormone to increase pregnancy rates following the transfer of in vitro-produced
embryos to heat-stressed, lactating cows. J Anim Sci 2003; 81:1590-1602.


102









34. Lima PF, Oliveira MA, Santos MH, Reichenbach HD, Weppert M, Paula-Lopes
FF, Neto CC, Goncalves PB. Effect of retinoids and growth factor on in vitro
bovine embryos produced under chemically defined conditions. Anim Reprod Sci
2006; 95:184-192.

35. Block J, Hansen PJ. Interaction between season and culture with insulin-like
growth factor-1 on survival of in vitro produced embryos following transfer to
lactating dairy cows. Theriogenology 2007; 67:1518-1529.

36. Edwards JL, Hansen PJ. Differential responses of bovine oocytes and
preimplantation embryos to heat shock. Mol Reprod Dev 1997; 46:138-145.

37. AI-Katanani YM, Hansen PJ. Induced thermotolerance in bovine two-cell
embryos and the role of heat shock protein 70 in embryonic development. Mol
Reprod Dev 2002; 62:174-180.

38. Schier AF. The maternal-zygotic transition: death and birth of RNAs. Science
2007; 316:406-407.

39. Memili E, Dominko T, First NL. Onset of transcription in bovine oocytes and
preimplantation embryos. Mol Reprod Dev 1998; 51:36-41.

40. Baumann CG, Morris DG, Sreenan JM, Leese HJ. The quiet embryo hypothesis:
molecular characteristics favoring viability. Mol Reprod Dev 2007; 74:1345-1353.

41. Natale DR, Kidder GM, Westhusin ME, Watson AJ. Assessment by differential
display-RT-PCR of mRNA transcript transitions and a-amanitin sensitivity during
bovine preattachment development. Mol Reprod Dev 2000; 55:152-163.

42. Kues WA, Sudheer S, Herrmann D, Carnwath JW, HavlicekV, Besenfelder U,
Lehrach H, Adjaye J, Niemann H. Genome-wide expression profiling reveals
distinct clusters of transcriptional regulation during bovine preimplantation
development in vivo. Proc Natl Acad Sci U S A 2008; 105:19768-19773.

43. Memili E, First NL. Developmental changes in RNA polymerase II in bovine
oocytes, early embryos, and effect of alpha-amanitin on embryo development.
Mol Reprod Dev 1998; 51:381-389.

44. Hay-Schmidt A, Viuff D, Greve T, Hyttel P. Transcriptional activity in in vivo
developed early cleavage stage bovine embryos. Theriogenology 2001; 56:167-
176.

45. Memili E, First NL. Control of gene expression at the onset of bovine embryonic
development. Biol Reprod 1999; 61:1198-1207.

46. Chandolia RK, Peltier MR, Tian W, Hansen PJ. Transcriptional control of
development, protein synthesis, and heat-induced heat shock protein 70
synthesis in 2-cell bovine embryos. Biol Reprod 1999; 61:1644-1648.


103









47. Edwards JL, Ealy AD, Monterroso VH, Hansen PJ. Ontogeny of temperature-
regulated heat shock protein 70 synthesis in preimplantation bovine embryos.
Mol Reprod Dev 1997; 48:25-33.

48. Woodland H. The translational control phase of early development. Biosci Rep
1982; 2:471-491.

49. Memili E, First NL. Zygotic and embryonic gene expression in cow: a review of
timing and mechanisms of early gene expression as compared with other
species. Zygote 2000; 8:87-96.

50. Frei RE, Schultz GA, Church RB. Qualitative and quantitative changes in protein
synthesis occur at the 8-16-cell stage of embryogenesis in the cow. J Reprod
Fertil 1989; 86:637-641.

51. Barnes FL, Eyestone WH. Early cleavage and the maternal zygotic transition in
bovine embryos In, vol. 33. Theriogenology; 1990: 141-152.

52. Li E. Chromatin modification and epigenetic reprogramming in mammalian
development. Nat Rev Genet 2002; 3:662-673.

53. Santos F, Dean W. Epigenetic reprogramming during early development in
mammals. Reproduction 2004; 127:643-651.

54. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM. Aberrant
methylation of donor genome in cloned bovine embryos. Nat Genet 2001;
28:173-177.

55. Santos F, Zakhartchenko V, Stojkovic M, Peters A, Jenuwein T, Wolf E, Reik W,
Dean W. Epigenetic marking correlates with developmental potential in cloned
bovine preimplantation embryos. Curr Biol 2003; 13:1116-1121.

56. Lin L, Li Q, Zhang L, Zhao D, Dai Y, Li N. Aberrant epigenetic changes and gene
expression in cloned cattle dying around birth. BMC Dev Biol 2008; 8:14.

57. Fairburn HR, Young LE, Hendrich BD. Epigenetic reprogramming: how now,
cloned cow? Curr Biol 2002; 12:R68-70.

58. Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W.
Conservation of methylation reprogramming in mammalian development:
aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001;
98:13734-13738.

59. Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian
development. Science 2001; 293:1089-1093.

60. Shi L, Wu J. Epigenetic regulation in mammalian preimplantation embryo
development. Reprod Biol Endocrinol 2009; 7:59.









61. Shi W, Zakhartchenko V, Wolf E. Epigenetic reprogramming in mammalian
nuclear transfer. Differentiation 2003; 71:91-113.

62. Reik W, Dean W. DNA methylation and mammalian epigenetics. Electrophoresis
2001; 22:2838-2843.

63. Turek-Plewa J, Jagodzinski PP. The role of mammalian DNA methyltransferases
in the regulation of gene expression. Cell Mol Biol Lett 2005; 10:631-647.

64. Bestor TH. The DNA methyltransferases of mammals. Hum Mol Genet 2000;
9:2395-2402.

65. Ding F, Chaillet JR. In vivo stabilization of the Dnmtl (cytosine-5)-
methyltransferase protein. Proc Natl Acad Sci U S A 2002; 99:14861-14866.

66. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and
Dnmt3b are essential for de novo methylation and mammalian development. Cell
1999; 99:247-257.

67. Hata K, Okano M, Lei H, Li E. Dnmt3L cooperates with the Dnmt3 family of de
novo DNA methyltransferases to establish maternal imprints in mice.
Development 2002; 129:1983-1993.

68. Vassena R, Dee Schramm R, Latham KE. Species-dependent expression
patterns of DNA methyltransferase genes in mammalian oocytes and
preimplantation embryos. Mol Reprod Dev 2005; 72:430-436.

69. Golding MC, Westhusin ME. Analysis of DNA (cytosine 5) methyltransferase
mRNA sequence and expression in bovine preimplantation embryos, fetal and
adult tissues. Gene Expr Patterns 2003; 3:551-558.

70. Reik W, Walter J. Genomic imprinting: parental influence on the genome. Nat
Rev Genet 2001; 2:21-32.

71. Constancia M, Hemberger M, Hughes J, Dean W, Ferguson-Smith A, Fundele R,
Stewart F, Kelsey G, Fowden A, Sibley C, ReikW. Placental-specific IGF-II is a
major modulator of placental and fetal growth. Nature 2002; 417:945-948.

72. Li S, Li Y, Yu S, Du W, Zhang L, Dai Y, Liu Y, Li N. Expression of insulin-like
growth factors systems in cloned cattle dead within hours after birth. Mol Reprod
Dev 2007; 74:397-402.

73. Bartolomei MS. Genomic imprinting: employing and avoiding epigenetic
processes. Genes Dev 2009; 23:2124-2133.

74. Dupont C, Armant DR, Brenner CA. Epigenetics: definition, mechanisms and
clinical perspective. Semin Reprod Med 2009; 27:351-357.


105









75. Kanka J. Gene expression and chromatin structure in the pre-implantation
embryo. Theriogenology 2003; 59:3-19.

76. Morgan HD, Santos F, Green K, Dean W, Reik W. Epigenetic reprogramming in
mammals. Hum Mol Genet 2005; 14 Spec No 1:R47-58.

77. Nowak-lmialek M, Wrenzycki C, Herrmann D, Lucas-Hahn A, Lagutina I, Lemme
E, Lazzari G, Galli C, Niemann H. Messenger RNA expression patterns of
histone-associated genes in bovine preimplantation embryos derived from
different origins. Mol Reprod Dev 2008; 75:731-743.

78. Betteridge KJ. The anatomy and physiology of pre-attachment bovine embryos.
In: J.-E. F (ed.), vol. 29. Theriogelonogy: Annual Conference of the International
Embryo Transfer Society 1988: 155-187.

79. Yamanaka Y, Ralston A, Stephenson RO, Rossant J. Cell and molecular
regulation of the mouse blastocyst. Dev Dyn 2006; 235:2301-2314.

80. Johnson MH, Ziomek CA. The foundation of two distinct cell lineages within the
mouse morula. Cell 1981; 24:71-80.

81. Watson AJ, Natale DR, Barcroft LC. Molecular regulation of blastocyst formation.
Anim Reprod Sci 2004; 82-83:583-592.

82. Duranthon V, Watson AJ, Lonergan P. Preimplantation embryo programming:
transcription, epigenetics, and culture environment. Reproduction 2008; 135:141-
150.

83. Eckert JJ, Fleming TP. Tight junction biogenesis during early development.
Biochim Biophys Acta 2008; 1778:717-728.

84. Nganvongpanit K, Muller H, Rings F, Gilles M, Jennen D, Holker M, Tholen E,
Schellander K, Tesfaye D. Targeted suppression of E-cadherin gene expression
in bovine preimplantation embryo by RNA interference technology using double-
stranded RNA. Mol Reprod Dev 2006; 73:153-163.

85. Larue L, Ohsugi M, Hirchenhain J, Kemler R. E-cadherin null mutant embryos fail
to form a trophectoderm epithelium. Proc Natl Acad Sci U S A 1994; 91:8263-
8267.

86. Betts DH, MacPhee DJ, Kidder GM, Watson AJ. Ouabain sensitivity and
expression of Na/K-ATPase alpha- and beta-subunit isoform genes during bovine
early development. Mol Reprod Dev 1997; 46:114-126.

87. Watson AJ, Westhusin ME, De Sousa PA, Betts DH, Barcroft LC. Gene
expression regulating blastocyst formation. Theriogenology 1999; 51:117-133.


106









88. Fleming TP, Ghassemifar MR, Sheth B. Junctional complexes in the early
mammalian embryo. Semin Reprod Med 2000; 18:185-193.

89. Houghton FD. Role of gap junctions during early embryo development.
Reproduction 2005; 129:129-135.

90. Vance MM, Wiley LM. Gap junction intercellular communication mediates the
competitive cell proliferation disadvantage of irradiated mouse preimplantation
embryos in aggregation chimeras. Radiat Res 1999; 152:544-551.

91. Kidder GM, Winterhager E. Intercellular communication in preimplantation
development: the role of gap junctions. Front Biosci 2001; 6:D731-736.

92. Collins JE, Lorimer JE, Garrod DR, Pidsley SC, Buxton RS, Fleming TP.
Regulation of desmocollin transcription in mouse preimplantation embryos.
Development 1995; 121:743-753.

93. Hansen PJ. Realizing the promise of IVF in cattle--an overview. Theriogenology
2006; 65:119-125.

94. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P. Consequences of bovine
oocyte maturation, fertilization or early embryo development in vitro versus in
vivo: implications for blastocyst yield and blastocyst quality. Mol Reprod Dev
2002; 61:234-248.

95. Wetscher F, Havlicek V, Huber T, Gilles M, Tesfaye D, Griese J, Wimmers K,
Schellander K, Muller M, Brem G, Besenfelder U. Intrafallopian transfer of
gametes and early stage embryos for in vivo culture in cattle. Theriogenology
2005; 64:30-40.

96. Hasler JF, Bilby CR, Collier RJ, Denham SC, Lucy MC. Effect of recombinant
bovine somatotropin on superovulatory response and recipient pregnancy rates
in a commercial embryo transfer program. Theriogenology 2003; 59:1919-1928.

97. Farin PW, Piedrahita JA, Farin CE. Errors in development of fetuses and
placentas from in vitro-produced bovine embryos. Theriogenology 2006; 65:178-
191.

98. Enright BP, Lonergan P, Dinnyes A, Fair T, Ward FA, Yang X, Boland MP.
Culture of in vitro produced bovine zygotes in vitro vs in vivo: implications for
early embryo development and quality. Theriogenology 2000; 54:659-673.

99. Lonergan P, Rizos D, Kanka J, Nemcova L, Mbaye AM, Kingston M, Wade M,
Duffy P, Boland MP. Temporal sensitivity of bovine embryos to culture
environment after fertilization and the implications for blastocyst quality.
Reproduction 2003; 126:337-346.









100. HavlicekV, KuzmanyA, Cseh S, Brem G, Besenfelder U. The Effect of Long-
term In Vivo Culture in Bovine Oviduct and Uterus on the Development and Cryo-
tolerance of In Vitro Produced Bovine Embryos. Reprod Domest Anim 2009.

101. Crosier AE, Farin PW, Dykstra MJ, Alexander JE, Farin CE. Ultrastructural
morphometry of bovine blastocysts produced in vivo or in vitro. Biol Reprod 2001;
64:1375-1385.

102. Lonergan P, Fair T, Corcoran D, Evans AC. Effect of culture environment on
gene expression and developmental characteristics in IVF-derived embryos.
Theriogenology 2006; 65:137-152.

103. Viuff D, Hendriksen PJ, Vos PL, Dieleman SJ, Bibby BM, Greve T, Hyttel P,
Thomsen PD. Chromosomal abnormalities and developmental kinetics in in vivo-
developed cattle embryos at days 2 to 5 after ovulation. Biol Reprod 2001;
65:204-208.

104. Viuff D, Palsgaard A, Rickords L, Lawson LG, Greve T, Schmidt M, Avery B,
Hyttel P, Thomsen PD. Bovine embryos contain a higher proportion of polyploid
cells in the trophectoderm than in the embryonic disc. Mol Reprod Dev 2002;
62:483-488.

105. Lonergan P, Pedersen HG, Rizos D, Greve T, Thomsen PD, FairT, Evans A,
Boland MP. Effect of the post-fertilization culture environment on the incidence of
chromosome aberrations in bovine blastocysts. Biol Reprod 2004; 71:1096-1100.

106. Bertolini M, Beam SW, Shim H, Bertolini LR, MoyerAL, Famula TR, Anderson
GB. Growth, development, and gene expression by in vivo- and in vitro-produced
day 7 and 16 bovine embryos. Mol Reprod Dev 2002; 63:318-328.

107. McHughes CE, Springer GK, Spate LD, Li R, Woods R, Green MP, Korte SW,
Murphy CN, Green JA, Prather RS. Identification and quantification of
differentially represented transcripts in in vitro and in vivo derived preimplantation
bovine embryos. Mol Reprod Dev 2009; 76:48-60.

108. Lonergan P, Monaghan P, Rizos D, Boland MP, Gordon I. Effect of follicle size
on bovine oocyte quality and developmental competence following maturation,
fertilization, and culture in vitro. Mol Reprod Dev 1994; 37:48-53.

109. Fair T, Hyttel P, Greve T. Bovine oocyte diameter in relation to maturational
competence and transcriptional activity. Mol Reprod Dev 1995; 42:437-442.

110. Machatkova M, Krausova K, Jokesova E, Tomanek M. Developmental
competence of bovine oocytes: effects of follicle size and the phase of follicular
wave on in vitro embryo production. Theriogenology 2004; 61:329-335.


108









111. Nemcova L, Machatkova M, Hanzalova K, Horakova J, Kanka J. Gene
expression in bovine embryos derived from oocytes with different developmental
competence collected at the defined follicular developmental stage.
Theriogenology 2006; 65:1254-1264.

112. Anchamparuthy VM, Dhali A, Lott WM, Pearson RE, Gwazdauskas FC.
Vitrification of bovine oocytes: implications of follicular size and sire on the rates
of embryonic development. J Assist Reprod Genet 2009; 26:613-619.

113. Damiani P, Fissore RA, Cibelli JB, Long CR, Balise JJ, Robl JM, Duby RT.
Evaluation of developmental competence, nuclear and ooplasmic maturation of
calf oocytes. Mol Reprod Dev 1996; 45:521-534.

114. Palma GA, Tortonese DJ, Sinowatz F. Developmental capacity in vitro of
prepubertal oocytes. Anat Histol Embryol 2001; 30:295-300.

115. Rizos D, Burke L, Duffy P, Wade M, Mee JF, O'Farrell KJ, Macsiurtain M, Boland
MP, Lonergan P. Comparisons between nulliparous heifers and cows as oocyte
donors for embryo production in vitro. Theriogenology 2005; 63:939-949.

116. Katz-Jaffe MG, McCallie BR, Preis KA, Filipovits J, Gardner DK. Transcriptome
analysis of in vivo and in vitro matured bovine MII oocytes. Theriogenology 2009;
71:939-946.

117. Warzych E, Wrenzycki C, Peippo J, Lechniak D. Maturation medium
supplements affect transcript level of apoptosis and cell survival related genes in
bovine blastocysts produced in vitro. Mol Reprod Dev 2007; 74:280-289.

118. Marei WF, Wathes DC, Fouladi-Nashta AA. The effect of linolenic Acid on bovine
oocyte maturation and development. Biol Reprod 2009; 81:1064-1072.

119. Viana KS, Caldas-Bussiere MC, Matta SG, Faes MR, de Carvalho CS, Quirino
CR. Effect of sodium nitroprusside, a nitric oxide donor, on the in vitro maturation
of bovine oocytes. Anim Reprod Sci 2007; 102:217-227.

120. Paula-Lopes FF, Boelhauve M, Habermann FA, Sinowatz F, Wolf E. Leptin
promotes meiotic progression and developmental capacity of bovine oocytes via
cumulus cell-independent and -dependent mechanisms. Biol Reprod 2007;
76:532-541.

121. Ali A, Sirard MA. Effect of the absence or presence of various protein
supplements on further development of bovine oocytes during in vitro maturation.
Biol Reprod 2002; 66:901-905.

122. Ali A, Sirard MA. Protein kinases influence bovine oocyte competence during
short-term treatment with recombinant human follicle stimulating hormone.
Reproduction 2005; 130:303-310.


109









123. Hendricks KE, Martins L, Hansen PJ. Consequences for the bovine embryo of
being derived from a spermatozoon subjected to post-ejaculatory aging and heat
shock: development to the blastocyst stage and sex ratio. J Reprod Dev 2009;
55:69-74.

124. Mendes JO, Jr., Burns PD, De La Torre-Sanchez JF, Seidel GE, Jr. Effect of
heparin on cleavage rates and embryo production with four bovine sperm
preparation protocols. Theriogenology 2003; 60:331-340.

125. Lu KH, Seidel GE, Jr. Effects of heparin and sperm concentration on cleavage
and blastocyst development rates of bovine oocytes inseminated with flow
cytometrically-sorted sperm. Theriogenology 2004; 62:819-830.

126. Xu J, Guo Z, Su L, Nedambale TL, Zhang J, Schenk J, Moreno JF, Dinnyes A, Ji
W, Tian XC, Yang X, Du F. Developmental potential of vitrified holstein cattle
embryos fertilized in vitro with sex-sorted sperm. J Dairy Sci 2006; 89:2510-2518.

127. Kochhar HS, Kochhar KP, Basrur PK, King WA. Influence of the duration of
gamete interaction on cleavage, growth rate and sex distribution of in vitro
produced bovine embryos. Anim Reprod Sci 2003; 77:33-49.

128. Lonergan P, Rizos D, Gutierrez-Adan A, Moreira PM, Pintado B, de la Fuente J,
Boland MP. Temporal divergence in the pattern of messenger RNA expression in
bovine embryos cultured from the zygote to blastocyst stage in vitro or in vivo.
Biol Reprod 2003; 69:1424-1431.

129. Rizos D, Lonergan P, Boland MP, Arroyo-Garcia R, Pintado B, de la Fuente J,
Gutierrez-Adan A. Analysis of differential messenger RNA expression between
bovine blastocysts produced in different culture systems: implications for
blastocyst quality. Biol Reprod 2002; 66:589-595.

130. Lazzari G, Wrenzycki C, Herrmann D, Duchi R, Kruip T, Niemann H, Galli C.
Cellular and molecular deviations in bovine in vitro-produced embryos are related
to the large offspring syndrome. Biol Reprod 2002; 67:767-775.

131. Zhou W, Xiang T, Walker S, Farrar V, Hwang E, Findeisen B, Sadeghieh S,
Arenivas F, Abruzzese RV, Polejaeva I. Global gene expression analysis of
bovine blastocysts produced by multiple methods. Mol Reprod Dev 2008;
75:744-758.

132. Block J, Bonilla L, Hansen PJ. Effect of addition of hyaluronan to embryo culture
medium on survival of bovine embryos in vitro following vitrification and
establishment of pregnancy after transfer to recipients. Theriogenology 2009;
71:1063-1071.

133. Loureiro B, Bonilla L, Block J, Fear JM, Bonilla AQ, Hansen PJ. Colony-
stimulating factor 2 (CSF-2) improves development and posttransfer survival of
bovine embryos produced in vitro. Endocrinology 2009; 150:5046-5054.


110









134. Merton JS, Vermeulen ZL, Otter T, Mullaart E, de Ruigh L, Hasler JF. Carbon-
activated gas filtration during in vitro culture increased pregnancy rate following
transfer of in vitro-produced bovine embryos. Theriogenology 2007; 67:1233-
1238.

135. Butler AA, Le Roith D. Control of growth by the somatropic axis: growth hormone
and the insulin-like growth factors have related and independent roles. Annu Rev
Physiol 2001; 63:141-164.

136. DenleyA, Cosgrove LJ, Booker GW, Wallace JC, Forbes BE. Molecular
interactions of the IGF system. Cytokine Growth Factor Rev 2005; 16:421-439.

137. Le Roith D, Bondy C, Yakar S, Liu JL, Butler A. The somatomedin hypothesis:
2001. Endocr Rev 2001; 22:53-74.

138. Butler AA, Yakar S, LeRoith D. Insulin-like growth factor-l: compartmentalization
within the somatotropic axis? News Physiol Sci 2002; 17:82-85.

139. Yakar S, Leroith D, Brodt P. The role of the growth hormone/insulin-like growth
factor axis in tumor growth and progression: Lessons from animal models.
Cytokine Growth Factor Rev 2005; 16:407-420.

140. Butler ST, Marr AL, Pelton SH, Radcliff RP, Lucy MC, Butler WR. Insulin restores
GH responsiveness during lactation-induced negative energy balance in dairy
cattle: effects on expression of IGF-I and GH receptor 1A. J Endocrinol 2003;
176:205-217.

141. Rhoads RP, Kim JW, Leury BJ, Baumgard LH, Segoale N, Frank SJ, Bauman
DE, Boisclair YR. Insulin increases the abundance of the growth hormone
receptor in liver and adipose tissue of periparturient dairy cows. J Nutr 2004;
134:1020-1027.

142. Hess BW. Nutritional controls of beef cow reproduction. In: Lake SL (ed.), vol. 83.
Journal of Animal Science; 2005: E90-106.

143. Diskin MG, Mackey DR, Roche JF, Sreenan JM. Effects of nutrition and
metabolic status on circulating hormones and ovarian follicle development in
cattle. Anim Reprod Sci 2003; 78:345-370.

144. Lucy MC. Changes in the Somatotrophic Axix Associated with the Initiation of
Lactation. In: Jiang H (ed.), vol. 84. Journal of Daity Science; 2001: E-113-E-119.

145. Fenwick MA, Llewellyn S, Fitzpatrick R, Kenny DA, Murphy JJ, Patton J, Wathes
DC. Negative energy balance in dairy cows is associated with specific changes in
IGF-binding protein expression in the oviduct. Reproduction 2008; 135:63-75.









146. Kay JK, Phyn CV, Roche JR, Kolver ES. Extending lactation in pasture-based
dairy cows. II: Effect of genetic strain and diet on plasma hormone and
metabolite concentrations. J Dairy Sci 2009; 92:3704-3713.

147. Baserga R. The contradictions of the insulin-like growth factor 1 receptor.
Oncogene 2000; 19:5574-5581.

148. Vincent AM, Feldman EL. Control of cell survival by IGF signaling pathways.
Growth Horm IGF Res 2002; 12:193-197.

149. Bridgewater DJ, Ho J, Sauro V, Matsell DG. Insulin-like growth factors inhibit
podocyte apoptosis through the P13 kinase pathway. Kidney Int 2005; 67:1308-
1314.

150. Foulstone E, Prince S, Zaccheo O, Burns JL, Harper J, Jacobs C, Church D,
Hassan AB. Insulin-like growth factor ligands, receptors, and binding proteins in
cancer. J Pathol 2005; 205:145-153.

151. Riley JK, Carayannopoulos MO, Wyman AH, Chi M, Ratajczak CK, Moley KH.
The PI3K/Akt pathway is present and functional in the preimplantation mouse
embryo. Dev Biol 2005; 284:377-386.

152. Kim S, Lee GS, Lee SH, Kim HS, Jeong YW, Kim JH, Kang SK, Lee BC, Hwang
WS. Embryotropic effect of insulin-like growth factor (IGF)-I and its receptor on
development of porcine preimplantation embryos produced by in vitro fertilization
and somatic cell nuclear transfer. Mol Reprod Dev 2005; 72:88-97.

153. Jousan FD, Oliveira LJ, Hansen PJ. Short-Term culture of in vitro produced
bovine preimplantation embryos with insulin-like growth factor-I prevents heat
shock-induced apoptosis through activation of the Phosphatidylinositol 3-
Kinase/Akt pathway. Mol Reprod Dev 2008; 75:681-688.

154. Adams TE, Epa VC, Garrett TP, Ward CW. Structure and function of the type 1
insulin-like growth factor receptor. Cell Mol Life Sci 2000; 57:1050-1093.

155. Forbes K, Westwood M, Baker PN, Aplin JD. Insulin-like growth factor I and II
regulate the life cycle of trophoblast in the developing human placenta. Am J
Physiol Cell Physiol 2008; 294:C1313-1322.

156. Jousan FD. Insulin-like growth factor-I and apoptosis as determinants of
preimplantation bovine embryonic development. Gainesville: University of
Florida; 2006.

157. Firth SM, Baxter RC. Cellular actions of the insulin-like growth factor binding
proteins. Endocr Rev 2002; 23:824-854.

158. Scott CD, Firth SM. The role of the M6P/IGF-II receptor in cancer: tumor
suppression or garbage disposal? Horm Metab Res 2004; 36:261-271.


112









159. Rajaram S, Baylink DJ, Mohan S. Insulin-like growth factor-binding proteins in
serum and other biological fluids: regulation and functions. Endocr Rev 1997;
18:801-831.

160. Baxter RC. Insulin-like growth factor (IGF)-binding proteins: interactions with
IGFs and intrinsic bioactivities. Am J Physiol Endocrinol Metab 2000; 278:E967-
976.

161. Jones JI, Gockerman A, Busby WH, Jr., Wright G, Clemmons DR. Insulin-like
growth factor binding protein 1 stimulates cell migration and binds to the alpha 5
beta 1 integrin by means of its Arg-Gly-Asp sequence. Proc Natl Acad Sci U S A
1993; 90:10553-10557.

162. Schultz GA, Hogan A, Watson AJ, Smith RM, Heyner S. Insulin, insulin-like
growth factors and glucose transporters: temporal patterns of gene expression in
early murine and bovine embryos. Reprod Fertil Dev 1992; 4:361-371.

163. Nuttinck F, Charpigny G, Mermillod P, Loosfelt H, Meduri G, Freret S, Grimard B,
Heyman Y. Expression of components of the insulin-like growth factor system
and gonadotropin receptors in bovine cumulus-oocyte complexes during oocyte
maturation. Domest Anim Endocrinol 2004; 27:179-195.

164. Armstrong DG, Gutierrez CG, Baxter G, Glazyrin AL, Mann GE, Woad KJ, Hogg
CO, Webb R. Expression of mRNA encoding IGF-I, IGF-II and type 1 IGF
receptor in bovine ovarian follicles. J Endocrinol 2000; 165:101-113.

165. Armstrong DG, Baxter G, Hogg CO, Woad KJ. Insulin-like growth factor (IGF)
system in the oocyte and somatic cells of bovine preantral follicles. Reproduction
2002; 123:789-797.

166. Schams D, Berisha B, Kosmann M, AmselgruberWM. Expression and
localization of IGF family members in bovine antral follicles during final growth
and in luteal tissue during different stages of estrous cycle and pregnancy.
Domest Anim Endocrinol 2002; 22:51-72.

167. Berisha B, Meyer HH, Schams D. Effect of prostaglandin F2 alpha on local
luteotropic and angiogenic factors during induced functional luteolysis in the
bovine corpus luteum. Biol Reprod 2010; 82:940-947.

168. Sauerwein H, Miyamoto A, Gunther J, Meyer HH, Schams D. Binding and action
of insulin-like growth factors and insulin in bovine luteal tissue during the
oestrous cycle. J Reprod Fertil 1992; 96:103-115.

169. Robinson RS, Mann GE, Gadd TS, Lamming GE, Wathes DC. The expression of
the IGF system in the bovine uterus throughout the oestrous cycle and early
pregnancy. J Endocrinol 2000; 165:231-243.


113









170. Simmons RM, Erikson DW, Kim J, Burghardt RC, Bazer FW, Johnson GA,
Spencer TE. Insulin-like growth factor binding protein-1 in the ruminant uterus:
potential endometrial marker and regulator of concepts elongation.
Endocrinology 2009; 150:4295-4305.

171. Llewellyn S, Fitzpatrick R, Kenny DA, Patton J, Wathes DC. Endometrial
expression of the insulin-like growth factor system during uterine involution in the
postpartum dairy cow. Domest Anim Endocrinol 2008; 34:391-402.

172. Harvey MB, Kaye PL. Insulin-like growth factor-1 stimulates growth of mouse
preimplantation embryos in vitro. Mol Reprod Dev 1992; 31:195-199.

173. Glabowski W, Kurzawa R, Wiszniewska B, Baczkowski T, Marchlewicz M, Brelik
P. Growth factors effects on preimplantation development of mouse embryos
exposed to tumor necrosis factor a. Reprod Biol 2005; 5:83-99.

174. Kelly JM, Kleemann DO, Maxwell WM, Walker SK. Effects of insulin-like growth
factor-I, epidermal growth factor and cysteamine on the in vitro maturation and
development of oocytes collected from 6- to 8-week-old Merino lambs. Reprod
Fertil Dev 2008; 20:570-578.

175. Pawshe CH, Rao KB, Totey SM. Effect of insulin-like growth factor I and its
interaction with gonadotropins on in vitro maturation and embryonic
development, cell proliferation, and biosynthetic activity of cumulus-oocyte
complexes and granulosa cells in buffalo. Mol Reprod Dev 1998; 49:277-285.

176. Spanos S, Becker DL, Winston RM, Hardy K. Anti-apoptotic action of insulin-like
growth factor-I during human preimplantation embryo development. Biol Reprod
2000; 63:1413-1420.

177. Byrne AT, Southgate J, Brison DR, Leese HJ. Regulation of apoptosis in the
bovine blastocyst by insulin and the insulin-like growth factor (IGF) superfamily.
Mol Reprod Dev 2002; 62:489-495.

178. Makarevich AV, Markkula M. Apoptosis and cell proliferation potential of bovine
embryos stimulated with insulin-like growth factor I during in vitro maturation and
culture. Biol Reprod 2002; 66:386-392.

179. Sirisathien S, Brackett BG. TUNEL analyses of bovine blastocysts after culture
with EGF and IGF-I. Mol Reprod Dev 2003; 65:51-56.

180. Kim S, Lee SH, Kim JH, Jeong YW, Hashem MA, Koo OJ, Park SM, Lee EG,
Hossein MS, Kang SK, Lee BC, Hwang WS. Anti-apoptotic effect of insulin-like
growth factor (IGF)-I and its receptor in porcine preimplantation embryos derived
from in vitro fertilization and somatic cell nuclear transfer. Mol Reprod Dev 2006;
73:1523-1530.









181. Matsui M, Takahashi Y, Hishinuma M, Kanagawa H. Stimulation of the
development of bovine embryos by insulin and insulin-like growth factor-I (IGF-I)
is mediated through the IGF-I receptor. Theriogenology 1997; 48:605-616.

182. Prelle K, Stojkovic M, Boxhammer K, Motlik J, Ewald D, Arnold GJ, Wolf E.
Insulin-like growth factor I (IGF-I) and long R(3)IGF-I differently affect
development and messenger ribonucleic acid abundance for IGF-binding
proteins and type I IGF receptors in in vitro produced bovine embryos.
Endocrinology 2001; 142:1309-1316.

183. Block J, Wrenzycki C, Niemann H, Herrmann D, Hansen PJ. Effects of insulin-
like growth factor-1 on cellular and molecular characteristics of bovine
blastocysts produced in vitro. Mol Reprod Dev 2008; 75:895-903.

184. Gwazdauskas FC, Thatcher WW, Wilcox CJ. Physiological, environmental, and
hormonal factors at insemination which may affect conception. J Dairy Sci 1973;
56:873-877.

185. Roman-Ponce H, Thatcher WW, Caton D, Barron DH, Wilcox CJ. Thermal stress
effects on uterine blood flow in dairy cows. J Anim Sci 1978; 46:175-180.

186. De Rensis F, Scaramuzzi RJ. Heat stress and seasonal effects on reproduction
in the dairy cow--a review. Theriogenology 2003; 60:1139-1151.

187. Roth Z. Heat stress, the follicle, and its enclosed oocyte: mechanisms and
potential strategies to improve fertility in dairy cows. Reprod Domest Anim 2008;
43 Suppl 2:238-244.

188. Zeron Y, Ocheretny A, Kedar O, Borochov A, Sklan D, Arav A. Seasonal
changes in bovine fertility: relation to developmental competence of oocytes,
membrane properties and fatty acid composition of follicles. Reproduction 2001;
121:447-454.

189. Arav A, Zvi R. Do chilling injury and heat stress share the same mechanism of
injury in oocytes? Mol Cell Endocrinol 2008; 282:150-152.

190. AI-Katanani YM, Paula-Lopes FF, Hansen PJ. Effect of season and exposure to
heat stress on oocyte competence in Holstein cows. J Dairy Sci 2002; 85:390-
396.

191. AI-Katanani YM, Rivera RM, Hansen PJ. Seasonal variation in development of in
vitro produced bovine embryos. Vet Rec 2002; 150:486-487.

192. Roth Z, Hansen PJ. Involvement of apoptosis in disruption of developmental
competence of bovine oocytes by heat shock during maturation. In: Biol Reprod,
vol. 71; 2004: 1898-1906.


115









193. Putney DJ, Malayer JR, Gross TS, Thatcher WW, Hansen PJ, Drost M. Heat
stress-induced alterations in the synthesis and secretion of proteins and
prostaglandins by cultured bovine conceptuses and uterine endometrium. Biol
Reprod 1988; 39:717-728.

194. Ealy AD, Drost M, Hansen PJ. Developmental changes in embryonic resistance
to adverse effects of maternal heat stress in cows. J Dairy Sci 1993; 76:2899-
2905.

195. Rivera RM, Hansen PJ. Development of cultured bovine embryos after exposure
to high temperatures in the physiological range. Reproduction 2001; 121:107-
115.

196. Tompkins EC, Heidenreich CJ, Stob M. Effect of post-breeding thermal stress on
embyronic mortality in swine. In, vol. 26. J Anim Sci; 1967: 377-380.

197. Krininger CE, 3rd, Stephens SH, Hansen PJ. Developmental changes in
inhibitory effects of arsenic and heat shock on growth of pre-implantation bovine
embryos. Mol Reprod Dev 2002; 63:335-340.

198. Sakatani M, Kobayashi S, Takahashi M. Effects of heat shock on in vitro
development and intracellular oxidative state of bovine preimplantation embryos.
Mol Reprod Dev 2004; 67:77-82.

199. Rivera RM, Kelley KL, Erdos GW, Hansen PJ. Alterations in ultrastructural
morphology of two-cell bovine embryos produced in vitro and in vivo following a
physiologically relevant heat shock. Biol Reprod 2003; 69:2068-2077.

200. Rivera RM, Kelley KL, Erdos GW, Hansen PJ. Reorganization of microfilaments
and microtubules by thermal stress in two-cell bovine embryos. Biol Reprod
2004; 70:1852-1862.

201. Halliwell B, Aruoma 01. DNA damage by oxygen-derived species. Its mechanism
and measurement in mammalian systems. FEBS Lett 1991; 281:9-19.

202. Sakatani M, Yamanaka K, Kobayashi S, Takahashi M. Heat shock-derived
reactive oxygen species induce embryonic mortality in in vitro early stage bovine
embryos. J Reprod Dev 2008; 54:496-501.

203. Paula-Lopes FF, Hansen PJ. Heat shock-induced apoptosis in preimplantation
bovine embryos is a developmentally regulated phenomenon. Biol Reprod 2002;
66:1169-1177.

204. Hansen PJ. To be or not to be--determinants of embryonic survival following heat
shock. Theriogenology 2007; 68 Suppl 1:S40-48.


116









205. Rivera RM, Dahlgren GM, De Castro EPLA, Kennedy RT, Hansen PJ. Actions of
thermal stress in two-cell bovine embryos: oxygen metabolism, glutathione and
ATP content, and the time-course of development. Reproduction 2004; 128:33-
42.

206. Favetta LA, Madan P, Mastromonaco GF, St John EJ, King WA, Betts DH. The
oxidative stress adaptor p66Shc is required for permanent embryo arrest in vitro.
BMC Dev Biol 2007; 7:132.

207. Favetta LA, Robert C, St John EJ, Betts DH, King WA. p66shc, but not p53, is
involved in early arrest of in vitro-produced bovine embryos. Mol Hum Reprod
2004; 10:383-392.

208. Favetta LA, St John EJ, King WA, Betts DH. High levels of p66shc and
intracellular ROS in permanently arrested early embryos. Free Radic Biol Med
2007; 42:1201-1210.

209. Betts DH, Madan P. Permanent embryo arrest: molecular and cellular concepts.
Mol Hum Reprod 2008; 14:445-453.

210. Kurzawa R, Glabowski W, Baczkowski T, Brelik P. Evaluation of mouse
preimplantation embryos exposed to oxidative stress cultured with insulin-like
growth factor I and II, epidermal growth factor, insulin, transferring and selenium.
Reprod Biol 2002; 2:143-162.

211. Fabian D, II'kova G, Rehak P, Czikkova S, Baran V, Koppel J. Inhibitory effect of
IGF-I on induced apoptosis in mouse preimplantation embryos cultured in vitro.
Theriogenology 2004; 61:745-755.

212. Moss JI, Pontes E, Hansen PJ. Insulin-like growth factor-1 protects
preimplantation embryos from anti-developmental actions of menadione. Arch
Toxicol 2009; 83:1001-1007.

213. Herrler A, Krusche CA, Beier HM. Insulin and insulin-like growth factor-I promote
rabbit blastocyst development and prevent apoptosis. Biol Reprod 1998;
59:1302-1310.

214. Paula-Lopes FF, Hansen PJ. Apoptosis is an adaptive response in bovine
preimplantation embryos that facilitates survival after heat shock. Biochem
Biophys Res Commun 2002; 295:37-42.

215. Oropeza A, Wrenzycki C, Herrmann D, Hadeler KG, Niemann H. Improvement of
the developmental capacity of oocytes from prepubertal cattle by intraovarian
insulin-like growth factor-I application. Biol Reprod 2004; 70:1634-1643.

216. Bilby CR, Bader JF, Salfen BE, Youngquist RS, Murphy CN, Garverick HA,
Crooker BA, Lucy MC. Plasma GH, IGF-I, and conception rate in cattle treated
with low doses of recombinant bovine GH. Theriogenology 1999; 51:1285-1296.









217. Bilby TR, Sozzi A, Lopez MM, Silvestre FT, Ealy AD, Staples CR, Thatcher WW.
Pregnancy, bovine somatotropin, and dietary n-3 fatty acids in lactating dairy
cows: I. Ovarian, concepts, and growth hormone-insulin-like growth factor
system responses. J Dairy Sci 2006; 89:3360-3374.

218. Carrillo F, Hernandez-Ceron J, Orozco V, Hernandez JA, Gutierrez CG. A single
dose of bovine somatotropin 5 days before the end of progestin-based estrous
synchronization increases prolificacy in sheep. Anim Reprod Sci 2007; 102:31-
37.

219. Moreira F, Orlandi C, Risco CA, Mattos R, Lopes F, Thatcher WW. Effects of
presynchronization and bovine somatotropin on pregnancy rates to a timed
artificial insemination protocol in lactating dairy cows. J Dairy Sci 2001; 84:1646-
1659.

220. Santos JE, Juchem SO, Cerri RL, Galvao KN, Chebel RC, Thatcher WW, Dei
CS, Bilby CR. Effect of bST and reproductive management on reproductive
performance of Holstein dairy cows. J Dairy Sci 2004; 87:868-881.

221. Flores R, Looper ML, Rorie RW, Lamb MA, Reiter ST, Hallford DM, Kreider DL,
Rosenkrans CF, Jr. Influence of body condition and bovine somatotropin on
estrous behavior, reproductive performance, and concentrations of serum
somatotropin and plasma fatty acids in postpartum Brahman-influenced cows. J
Anim Sci 2007; 85:1318-1329.

222. Bell A, Rodriguez OA, de Castro EPLA, Padua MB, Hernandez-Ceron J,
Gutierrez CG, De Vries A, Hansen PJ. Pregnancy success of lactating Holstein
cows after a single administration of a sustained-release formulation of
recombinant bovine somatotropin. BMC Vet Res 2008; 4:22.

223. Rizos D, Clemente M, Bermejo-Alvarez P, de La Fuente J, Lonergan P,
Gutierrez-Adan A. Consequences of in vitro culture conditions on embryo
development and quality. Reprod Domest Anim 2008; 43 Suppl 4:44-50.

224. Rizos D, Ramirez MA, Pintado B, Lonergan P, Gutierrez-Adan A. Culture of
bovine embryos in intermediate host oviducts with emphasis on the isolated
mouse oviduct. Theriogenology 2010; 73:777-785.

225. Luo H, Kimura K, Aoki M, Hirako M. Vascular endothelial growth factor (VEGF)
promotes the early development of bovine embryo in the presence of cumulus
cells. J Vet Med Sci 2002; 64:967-971.

226. Sagirkaya H, Misirlioglu M, Kaya A, First NL, Parrish JJ, Memili E.
Developmental potential of bovine oocytes cultured in different maturation and
culture conditions. Anim Reprod Sci 2007; 101:225-240.


118









227. de Moraes AA, Hansen PJ. Granulocyte-macrophage colony-stimulating factor
promotes development of in vitro produced bovine embryos. Biol Reprod 1997;
57:1060-1065.

228. Neira JA, Tainturier D, Pena MA, Martal J. Effect of the association of IGF-I, IGF-
II, bFGF, TGF-P31, GM-CSF, and LIF on the development of bovine embryos
produced in vitro. Theriogenology 2010; 73:595-604.

229. Paula-Lopes FF, de Moraes AA, Edwards JL, Justice JE, Hansen PJ. Regulation
of preimplantation development of bovine embryos by interleukin-13. Biol Reprod
1998; 59:1406-1412.

230. Lucy MC, Verkerk GA, Whyte BE, Macdonald KA, Burton L, Cursons RT, Roche
JR, Holmes CW. Somatotropic axis components and nutrient partitioning in
genetically diverse dairy cows managed under different feed allowances in a
pasture system. J Dairy Sci 2009; 92:526-539.

231. Wang LM, Feng HL, Ma Y, Gang M, Li HJ, Yan Z, Zhou P, Wen JX, Bou S, Liu
DJ. Expression of IGF receptors and its ligands in bovine oocytes and
preimplantation embryos. Anim Reprod Sci 2009; 114:99-108.

232. Parrish JJ, Susko-Parrish JL, Leibfried-Rutledge ML, Critser ES, Eyestone WH,
First NL. Bovine in vitro fertilization with frozen-thawed semen. Theriogenology
1986; 25:591-600.

233. Fischer-Brown A, Monson R, Parrish J, Rutledge J. Cell allocation in bovine
embryos cultured in two media under two oxygen concentrations. Zygote 2002;
10:341-348.

234. Sakurai T, Sakamoto A, Muroi Y, Bai H, Nagaoka K, Tamura K, Takahashi T,
Hashizume K, Sakatani M, Takahashi M, Godkin JD, Imakawa K. Induction of
endogenous interferon tau gene transcription by CDX2 and high acetylation in
bovine nontrophoblast cells. Biol Reprod 2009; 80:1223-1231.

235. Wu M, Hall J, Akers RM, Jiang H. Effect of feeding level on serum insulin-like
growth factor I (IGF-I) response to growth hormone injection. J Endocrinol 2010.

236. Falkenberg U, Haertel J, Rotter K, Iwersen M, Arndt G, Heuwieser W.
Relationships between the concentration of insulin-like growth factor-1 in serum
in dairy cows in early lactation and reproductive performance and milk yield. J
Dairy Sci 2008; 91:3862-3868.

237. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
time quantitative PCR and the 2-"ct Method. Methods 2001; 25:402-408.

238. Van Soom A, Boerjan ML, Bols PE, Vanroose G, Lein A, Coryn M, de Kruif A.
Timing of compaction and inner cell allocation in bovine embryos produced in
vivo after superovulation. Biol Reprod 1997; 57:1041-1049.


119









239. Chitnis MM, Yuen JS, Protheroe AS, Pollak M, Macaulay VM. The type 1 insulin-
like growth factor receptor pathway. Clin Cancer Res 2008; 14:6364-6370.

240. Inoue A, Takeuchi S, Takahashi S. Insulin-like growth factor-I stimulated DNA
replication in mouse endometrial stromal cells. J Reprod Dev 2005; 51:305-313.

241. Radcliff K, Tang TB, Lim J, Zhang Z, Abedin M, Demer LL, Tintut Y. Insulin-like
growth factor-I regulates proliferation and osteoblastic differentiation of calcifying
vascular cells via extracellular signal-regulated protein kinase and
phosphatidylinositol 3-kinase pathways. Circ Res 2005; 96:398-400.

242. Van Soom A, Van Vlaenderen I, Mahmoudzadeh AR, Deluyker H, de Kruif A.
Compaction rate of in vitro fertilized bovine embryos related to the interval from
insemination to first cleavage. Theriogenology 1992; 38:905-919.

243. Holm P, Shukri NN, Vajta G, Booth P, Bendixen C, Callesen H. Developmental
kinetics of the first cell cycles of bovine in vitro produced embryos in relation to
their in vitro viability and sex. Theriogenology 1998; 50:1285-1299.

244. Alomar M, Tasiaux H, Remacle S, George F, Paul D, Donnay I. Kinetics of
fertilization and development, and sex ratio of bovine embryos produced using
the semen of different bulls. Anim Reprod Sci 2008; 107:48-61.

245. Kuijk EW, Du Puy L, Van Tol HT, Oei CH, Haagsman HP, Colenbrander B,
Roelen BA. Differences in early lineage segregation between mammals. Dev Dyn
2008; 237:918-927.

246. Thompson JG, Partridge RJ, Houghton FD, Cox CI, Leese HJ. Oxygen uptake
and carbohydrate metabolism by in vitro derived bovine embryos. J Reprod Fertil
1996; 106:299-306.

247. Block J, Chase CC, Jr., Hansen PJ. Inheritance of resistance of bovine
preimplantation embryos to heat shock: relative importance of the maternal
versus paternal contribution. Mol Reprod Dev 2002; 63:32-37.

248. Paula-Lopes FF, Chase CC, Jr., AI-Katanani YM, Krininger CE, 3rd, Rivera RM,
Tekin S, Majewski AC, Ocon OM, Olson TA, Hansen PJ. Genetic divergence in
cellular resistance to heat shock in cattle: differences between breeds developed
in temperate versus hot climates in responses of preimplantation embryos,
reproductive tract tissues and lymphocytes to increased culture temperatures.
Reproduction 2003; 125:285-294.

249. Hernandez-Ceron J, Chase CC, Jr., Hansen PJ. Differences in heat tolerance
between preimplantation embryos from Brahman, Romosinuano, and Angus
breeds. J Dairy Sci 2004; 87:53-58.


120









250. Eberhardt BG, Satrapa RA, Capinzaiki CR, Trinca LA, Barros CM. Influence of
the breed of bull (Bos taurus indicus vs. Bos taurus taurus) and the breed of cow
(Bos taurus indicus, Bos taurus taurus and crossbred) on the resistance of
bovine embryos to heat. Anim Reprod Sci 2009; 114:54-61.

251. Lucy MC. Functional differences in the growth hormone and insulin-like growth
factor axis in cattle and pigs: implications for post-partum nutrition and
reproduction. Reprod Domest Anim 2008; 43 Suppl 2:31-39.

252. Soto P, Natzke RP, Hansen PJ. Identification of possible mediators of embryonic
mortality caused by mastitis: actions of lipopolysaccharide, prostaglandin
F2alpha, and the nitric oxide generator, sodium nitroprusside dihydrate, on
oocyte maturation and embryonic development in cattle. Am J Reprod Immunol
2003; 50:263-272.

253. de Castro e Paula LA, Hansen PJ. Modification of actions of heat shock on
development and apoptosis of cultured preimplantation bovine embryos by
oxygen concentration and dithiothreitol. Mol Reprod Dev 2008; 75:1338-1350.

254. Robertson I, Nelson, R.E. Certification and identification of the embryo. Manual
of the International Embryo Transfer Society. In: Stringfellow D.A., and Seidel
S.M., ed lETS, Savoy, IL; 1998: 103-116.

255. Benjamini Y, Hochberg Y. Controlling the false discovery rate: apratical and
powerful approach to multiple testing. In, vol. 57. J Royal Statistical Society:
Series B; 1995: 289-300.

256. Byrne AT, Southgate J, Brison DR, Leese HJ. Effects of insulin-like growth
factors I and II on tumour-necrosis-factor-alpha-induced apoptosis in early
murine embryos. Reprod Fertil Dev 2002; 14:79-83.

257. Thelie A, Papillier P, Pennetier S, Perreau C, Traverso JM, Uzbekova S,
Mermillod P, Joly C, Humblot P, Dalbies-Tran R. Differential regulation of
abundance and deadenylation of maternal transcripts during bovine oocyte
maturation in vitro and in vivo. BMC Dev Biol 2007; 7:125.

258. Lequarre AS, Grisart B, Moreau B, Schuurbiers N, Massip A, Dessy F. Glucose
metabolism during bovine preimplantation development: analysis of gene
expression in single oocytes and embryos. Mol Reprod Dev 1997; 48:216-226.

259. Rieger D, Loskutoff NM, Betteridge KJ. Developmentally related changes in the
uptake and metabolism of glucose, glutamine and pyruvate by cattle embryos
produced in vitro. Reprod Fertil Dev 1992; 4:547-557.

260. Lim JM, Liou SS, Hansel W. Intracytoplasmic glutathione concentration and the
role of beta-mercaptoethanol in preimplantation development of bovine embryos.
Theriogenology 1996; 46:429-439.









261. Block J, Fischer-Brown AE, Rodina TM, Ealy AD, Hansen PJ. The effect of in
vitro treatment of bovine embryos with IGF-1 on subsequent development in
utero to Day 14 of gestation. Theriogenology 2007; 68:153-161.

262. Howlett M, Menheniott TR, Judd LM, Giraud AS. Cytokine signalling via gpl30 in
gastric cancer. Biochim Biophys Acta 2009; 1793:1623-1633.

263. Guo X, Williams JG, Schug TT, Li X. DYRK1A and DYRK3 promote cell survival
through phosphorylation and activation of SIRT1. J Biol Chem 2010; 285:13223-
13232.

264. Butterick TA, Igbavboa U, Eckert GP, Sun GY, Weisman GA, Muller WE, Wood
WG. Simvastatin stimulates production of the antiapoptotic protein Bcl-2 via
endothelin-1 and NFATc3 in SH-SY5Y cells. Mol Neurobiol 2010; 41:384-391.

265. Shen SM, Yu Y, Wu YL, Cheng JK, Wang LS, Chen GQ. Downregulation of
ANP32B, a novel substrate of caspase-3, enhances caspase-3 activation and
apoptosis induction in myeloid leukemic cells. Carcinogenesis 2010; 31:419-426.

266. Zhang L, Pan X, Hershey JW. Individual overexpression of five subunits of
human translation initiation factor elF3 promotes malignant transformation of
immortal fibroblast cells. J Biol Chem 2007; 282:5790-5800.

267. Kimura J, Kudoh T, Miki Y, Yoshida K. Identification of dihydropyrimidinase-
related protein 4 as a novel target of the p53 tumor suppressor in the apoptotic
response to DNA damage. Int J Cancer 2010.

268. Radu M, Chernoff J. The DeMSTification of mammalian Ste20 kinases. Curr Biol
2009; 19:R421-425.

269. Bharti AC, Aggarwal BB. Ranking the role of RANK ligand in apoptosis.
Apoptosis 2004; 9:677-690.

270. Wang H, Tsang BK. Nodal signalling and apoptosis. Reproduction 2007;
133:847-853.

271. Aznar S, Lacal JC. Rho signals to cell growth and apoptosis. Cancer Lett 2001;
165:1-10.

272. Hayes JD, Flanagan JU, Jowsey IR. Glutathione transferases. Annu Rev
Pharmacol Toxicol 2005; 45:51-88.

273. Beuckmann CT, Fujimori K, Urade Y, Hayaishi 0. Identification of mu-class
glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E synthases
in the human brain. Neurochem Res 2000; 25:733-738.


122









274. Martin SF, Buron I, Espinosa JC, Castilla J, Villalba JM, Torres JM. Coenzyme Q
and protein/lipid oxidation in a BSE-infected transgenic mouse model. Free Radic
Biol Med 2007; 42:1723-1729.

275. Kawasaki T. Antioxidant function of coenzyme Q. J Nutr Sci Vitaminol (Tokyo)
1992; Spec No:552-555.

276. Choi J, Oh S, Lee D, Oh HJ, Park JY, Lee SB, Lim DS. Mst1 -FoxO signaling
protects Naive T lymphocytes from cellular oxidative stress in mice. PLoS One
2009; 4:e8011.

277. Ling P, Lu TJ, Yuan CJ, Lai MD. Biosignaling of mammalian Ste20-related
kinases. Cell Signal 2008; 20:1237-1247.

278. Qiao M, Wang Y, Xu X, Lu J, Dong Y, Tao W, Stein J, Stein GS, Iglehart JD, Shi
Q, Pardee AB. Mst1 is an interacting protein that mediates PHLPPs' induced
apoptosis. Mol Cell 2010; 38:512-523.

279. Hemmati-Brivanlou A, Melton D. Vertebrate embryonic cells will become nerve
cells unless told otherwise. Cell 1997; 88:13-17.

280. Dean C, Dresbach T. Neuroligins and neurexins: linking cell adhesion, synapse
formation and cognitive function. Trends Neurosci 2006; 29:21-29.

281. Sawaishi Y. Review of Alexander disease: beyond the classical concept of
leukodystrophy. Brain Dev 2009; 31:493-498.

282. Charrier E, Reibel S, Rogemond V, Aguera M, Thomasset N, Honnorat J.
Collapsin response mediator proteins (CRMPs): involvement in nervous system
development and adult neurodegenerative disorders. Mol Neurobiol 2003; 28:51-
64.

283. McCaffery P, Drager UC. Retinoic acid synthesizing enzymes in the embryonic
and adult vertebrate. Adv Exp Med Biol 1995; 372:173-183.

284. Chiba S, Kurokawa MS, Yoshikawa H, Ikeda R, Takeno M, Tadokoro M, Sekino
H, Hashimoto T, Suzuki N. Noggin and basic FGF were implicated in forebrain
fate and caudal fate, respectively, of the neural tube-like structures emerging in
mouse ES cell culture. Exp Brain Res 2005; 163:86-99.

285. Kong XB, Zhang C. Dickkopf (Dkk) 1 promotes the differentiation of mouse
embryonic stem cells toward neuroectoderm. In Vitro Cell Dev Biol Anim 2009;
45:185-193.

286. Kinoshita N, Sasai N, Misaki K, Yonemura S. Apical accumulation of Rho in the
neural plate is important for neural plate cell shape change and neural tube
formation. Mol Biol Cell 2008; 19:2289-2299.


123









287. Falls DL. Neuregulins: functions, forms, and signaling strategies. Exp Cell Res
2003; 284:14-30.

288. Ihle JN. STATs: signal transducers and activators of transcription. Cell 1996;
84:331-334.

289. Zong CS, Chan J, Levy DE, Horvath C, Sadowski HB, Wang LH. Mechanism of
STAT3 activation by insulin-like growth factor I receptor. J Biol Chem 2000;
275:15099-15105.

290. Guerin P, El Mouatassim S, Menezo Y. Oxidative stress and protection against
reactive oxygen species in the pre-implantation embryo and its surroundings.
Hum Reprod Update 2001; 7:175-189.

291. Shehab-EI-Deen MA, Leroy JL, Fadel MS, Saleh SY, Maes D, Van Soom A.
Biochemical changes in the follicular fluid of the dominant follicle of high
producing dairy cows exposed to heat stress early post-partum. Anim Reprod Sci
2010; 117:189-200.

292. Lorenzo PL, Illera MJ, Illera JC, Illera M. Enhancement of cumulus expansion
and nuclear maturation during bovine oocyte maturation in vitro by the addition of
epidermal growth factor and insulin-like growth factor I. J Reprod Fertil 1994;
101:697-701.

293. Herrier A, Einspanier R, Schams D, Niemann H. Effect of recombinant bovine
somatotropin (rBST) on follicular IGF-I contents and the ovarian response
following superovulatory treatment in dairy cows: a preliminary study.
Theriogenology 1994; 41:601-611.

294. Moreira F, Badinga L, Burnley C, Thatcher WW. Bovine somatotropin increases
embryonic development in superovulated cows and improves post-transfer
pregnancy rates when given to lactating recipient cows. Theriogenology 2002;
57:1371-1387.









BIOGRAPHICAL SKETCH

Aline Quadros Santos Bonilla was born in Itabuna and raised in Ilheus, Bahia,

Brazil. In 2000 she received her degree in veterinary medicine from the Universidade

Federal de Vigosa, and in 2003, she finished her master's program at the same

University. Her M.S. thesis, concerning in nutrition and reproduction in Nelore bulls, was

completed under the direction of Dr Jose Domingos Guimaraes. Following graduation,

Dr Bonilla worked in veterinary service and embryo transfer in Barrado Gargas MT

and then Campo Grande MS, Brazil. In 2006, Dr. Bonilla and her husband Luciano

moved to Gainesville and she started her Doctor of Philosophy degree in the animal

molecular and cellular biology graduate program, in the laboratory of Dr Peter J.

Hansen. In the fall of 2010, Dr. Bonilla will start a post-doctoral program.


125





PAGE 1

1 REGULATION OF GROWTH AND THERMOPROTECTION OF THE BOVINE PREIMP L ANTATION EMBRYO BY I NSULIN LIKE GROWTH FACTOR 1 By ALINE QUADROS SANTOS BONILLA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PA RTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Aline Quadros Santos Bonilla

PAGE 3

3 To my parents, my brothers, my nephews and my husband

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my d eep appreciation to Dr Peter J. Hansen for the guidance, encouragement, dedication and financial support. Dr Hansen gave me the opportunity to complete my PhD in the Animal Molecular and Cellular Biology graduate program and I am very grateful for his enth usiasm and patience. I would also like to thank my supervisory committee Dr Alan Ealy, Dr. Kenneth C. Drury and Dr. James L. Resnick for their contributions and suggestions. I would like to thank my lab mates, Justin Fear, Dr James Moss, Dr. Jeremy Bloc k, Dr. Katherine Hendricks, Dr. Luciano Bonilla, Dr. Lilian Olive ira Dr. Maria Padua, Dr. Ozawa Manabu, Dr Barbara Loureiro, Dr. Silvia Carambula and Sarah Fields I am thankful for their help, suggestions and friendship in the lab. I also thank the perso n nel at Central Pa cking Co., Center Hill, FL, for providing the ovaries used in my experiments, and to William Rembert for his willingness and dedication to collect ovaries for the experiment. I thank the students, faculty and staff of the Department of A nimal Sciences and the Animal Molecular and Cell Biology program for their support and friendship. A special thanks to my office mates Izabella Th ompson Leandro Greco, Luciano Silva and Lilian Oliveira, for the good times, laughs and meaningful friendshi p. Thanks to my friends in Brazil for their endless friendship and support. I extend my sincere appreciation to my parents Heron and Marlove for their love and moral and financial support, and also to my brothers Helder and Andr. They were always there i n the moments when I miss ed home and family. Finally I would like to thank my husband Luciano Bonilla for his support, patience and encouragement in the good and tough times that we had in our new adventure of living in the United States

PAGE 5

5 TABLE OF CONTENT S page ACKNOWLEDGMENTS ................................ ................................ ................................ ...... 4 LIST OF FIGURES ................................ ................................ ................................ .............. 8 LIST OF ABBREVIATIONS ................................ ................................ ................................ 9 ABSTRACT ................................ ................................ ................................ ........................ 11 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .............................. 13 Introduction ................................ ................................ ................................ ................. 13 Key Events During Preimplantation Development in the Bovine .............................. 15 Embryonic Genome Activation ................................ ................................ ............ 15 E pigenetic Modifications ................................ ................................ ...................... 16 Polarization and Formation of the Blastocyst ................................ ...................... 19 Oocyte Source ................................ ................................ ................................ ...... 21 Conditions for Oocyte Maturation ................................ ................................ ........ 22 Fertilization ................................ ................................ ................................ ........... 23 Culture Conditions for the Embryo ................................ ................................ ...... 23 Use of IGF1 to Improve Embryonic Development in Vitro ................................ ........ 25 Biology of IGF1 ................................ ................................ ................................ .... 25 Signaling by IGF1 ................................ ................................ ................................ 26 IGF1 in the Reproductive Tract ................................ ................................ ........... 29 Actions of IGF1 on Embryonic Development and Survival ................................ 30 IGF1 and Fertility During Heat Stress ................................ ................................ ........ 31 Effect of Heat Stress on Fertility ................................ ................................ .......... 31 Heat Shock and IGF1 ................................ ................................ .......................... 33 Hypothesis and Objectives ................................ ................................ ......................... 35 2 ACTIONS OF INSULIN LIKE GROWTH FACTOR 1 TO INCREASE DEVELOPMENT OF BOVINE EMBRYOS TO THE BLASTOCYST STAGE ......... 40 Introduction ................................ ................................ ................................ ................. 40 Materials and Methods ................................ ................................ ............................... 41 Materials ................................ ................................ ................................ ............... 41 In Vitro Production of Embryos ................................ ................................ ............ 42 Concentration Dependent Actions of IGF1 to Increase Blastocyst Deve lopment ................................ ................................ ................................ ..... 43 Determination of the Stage of Development at Which IGF1 Acts to Increase Blastocyst Development ................................ ................................ ................... 44 Role of MAPK and P I3K Signaling Pathway in IGF1 Actions ............................. 44

PAGE 6

6 Action of IGF1 on Expression of Genes Controlling Compaction and Blastocyst Formation ................................ ................................ ........................ 45 Statistical Analysis ................................ ................................ ............................... 46 Results ................................ ................................ ................................ ........................ 46 Concentration Dependent Actions of IGF1 to Increase Blastocyst Development ................................ ................................ ................................ ..... 46 Determination of the Stage of Development at Which IGF1 Acts to Increase Blastocyst Development ................................ ................................ ................... 47 Effect of Inhibition of MAPK and PI3K Sign aling on Actions of IGF1 to Promote Development ................................ ................................ ...................... 47 Action of IGF1 on Expression of Genes Controlling Compaction and Blastocyst Formation ................................ ................................ ........................ 48 Discussion ................................ ................................ ................................ ................... 48 3 DEVELOPMENTAL CHANGES IN THERMOPROTECTIVE ACTIONS O F INSULIN LIKE GROWTH FACTOR 1 ON THE PREIMPLANTATION BOVINE EMBRYO ................................ ................................ ................................ .................... 57 Introduction ................................ ................................ ................................ ................. 57 Materials and Methods ................................ ................................ ............................... 58 Embryo Culture Media and Additives ................................ ................................ .. 58 In vitro Production of Embryos ................................ ................................ ............ 59 Protective Effect of IGF1 on Heat Shocked Embryos at 41C ........................... 60 Protective Effect of IGF1 on Day 5 Embryos Exposed to Heat Shock at 42C ................................ ................................ ................................ .................. 61 Developmental Changes in Expression of Genes Involved in IGF1 Signaling .. 61 Immunofluorescent Analysis of Insulin like Growth Factor 1 Receptor (IGF1R) ................................ ................................ ................................ ............. 63 Microarray Hybridization ................................ ................................ .................. 64 Microarray Data Analysis ................................ ................................ ..................... 66 qPCR ................................ ................................ ................................ .................... 66 Statistical Analysis ................................ ................................ ............................... 67 Results ................................ ................................ ................................ ........................ 68 Thermoprotective Actions of IGF1 on Two cell and Day 5 Embryos ................. 68 Gene Expression of Molecules Involved in IG F1 Signaling ................................ 69 Presence of IGF1R in Two cell and Day 5 Embryos ................................ .......... 69 Effect of IGF1 on Gene Expression in Blastocysts ................................ ............. 69 Validation of Microarray Data by qPCR ................................ .............................. 71 Discussion ................................ ................................ ................................ ................... 72 4 GENERAL DISCUSSION ................................ ................................ .......................... 94 LIST OF REFERENCES ................................ ................................ ................................ 100 BIOGRAPHICAL SKETCH ................................ ................................ .............................. 125

PAGE 7

7 LIST OF TABLES Table page 1 1 Known actions of insulin like growth factor binding proteins ................................ 29 2 1 Primer sets for qPCR ................................ ................................ ............................. 51 3 1 Primer sets for quantitative real time RT PCR (Exp.1) ................................ ......... 78 3 2 Primer sets for quantitative real time RT PCR (Exp.2) ................................ ......... 78 3 3 Primer sets for quantitative real time RT PCR (microarray validation) ................ 79 3 4 Genes upregulated by IGF1 treatment ................................ ................................ .. 80 3 5 Genes downregulated by IGF1 treatment ................................ ............................. 84 3 6 Significant biological process gene ontology terms for differentially expressed genes in blastocysts ................................ ................................ ............................... 87

PAGE 8

8 LIST OF FIGURES Figure page 1 1 IGF1 signaling transduction mediated by IGF1R ................................ .................. 28 1 2 Potential actions of IGF1 on embryonic development. ................................ ......... 37 2 1 Concentration dependent effects of IGF1 on the p ercent of oocytes that cleaved and that became blastocysts at day 7 and day 8 post insemination.. .... 52 2 2 Improvement in blastocyst development when IGF1 is added from day 4 8 of culture but not when added from day 0 4 ................................ ............................. 53 2 3 Representati ve images of day 8 embryos when IGF1 was used in different da ys of culture ................................ ................................ ................................ ........ 54 2 4 Effect of the MAPK inhibitor PD 98059 and the PI3K inhibitor LY294002 on actions of IGF1 to increase the perce nt of blastocysts at da y 7 and day 8 post insemination ................................ ................................ ................................ ... 55 2 5 Effects of IGF1 on expression of genes involved in comp action and blastocoel formation ................................ ................................ ............................... 56 3 1 Representative results of analysis of RNA from KSOM (control) and IGF1 treated embryos used for microarray, determined by Agilent 2100 Bioanalyzer RNA 6000 Pico Labchip Kit. ................................ .............................. 88 3 2 Effect of IGF1 on the reduction in development caused by a heat shock of 41C at the two cell stage and day 5 of d evelopment (embryos > 16 cells) ........ 89 3 3 Effect of IGF1 on the redu ction of development caused by exposure of day 5 heat shock at 42C ................................ ...................... 90 3 4 Changes in expression of genes involved in IGF1 signaling at the two cell and day 5 (>16 c ells ) stage as determined by qPCR ................................ ........... 91 3 5 Expression of IGF1R protein in two cell ............ 92 3 6 Fold chan ge in gene expression using qPCR (y axis) and microarray hybridization (x axis) for a selected group of six d ifferentially expressed genes ................................ ................................ ................................ ...................... 93 4 1 Developmental actions of IGF1 to promote blast ocyst formati on and protect from heat shock ................................ ................................ ................................ ..... 96

PAGE 9

9 LIST OF ABBREVIATION S The following list describes abbreviations used in the dissertation. In addition, symbols for genes and proteins were used according to procedures outl ined in the Guide for Authors to Biology of Reproduction ( http://www.biolreprod.org/site/misc/NomenBullets.xhtml ). Gene symbols are used without definition and were obtained from the Ent rezGene website of the National Center for Biotechnology Information ( http://www.ncbi.nlm.nih.gov/gene ). ANOVA A nalysis of variance BSA Bovine serum albumin bST Recombinant bovine somatotropin cDNA Complemen tary DNA COCs Cumulus oocyte complexes C T Cycle threshold DAPI Diamidino 2 phenylindole T Delta delta C T DEPC D iethylpyrocarbonate treated DNMT DNA methyltransferase DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid EGA Embryonic genome activation GH Gr owth hormone IVP In vitro production ICM Inner cell mass IGF1 Insulin like growth factor 1 KSOM Potassium simplex optimized medium KSOM BE2 KSOM bovine embryo 2 PBS Phosphate buffered saline

PAGE 10

10 PVP Polyvinylpyrrolidone qPCR Quantitative real time RT PCR ROS R eactive oxygen species RT PCR Reverse transcription PCR SAS Statistical A nalysis S ystem SOF BE1 Synthetic oviduct fluid bovine embryo 1 TALP Tyrodes albumin lactate pyruvate TBS Tris buffered saline TBST TBS + T ween 20 TCM Tissue culture medium TE Trophec toderm TL Tyrodes lactate

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF GROWTH AND THERMOPROTECTION OF THE BOVINE PREIMPANTATION EMBRYOS BY I NSULIN LIKE GROWTH FACTOR 1 Aline Quadros Santos Bonilla August 2010 Chair: Peter J. Hansen Major: Animal Molecular and Cellular Biology The function of the embryo depends upon regulation by maternally derived g rowth factors. One of these, IGF1 can affect function of the preimplantation bovine embryo by increasing the proportion of embryos that become blastocysts, reducing effects of heat shock on development and apoptosis and enhancing survival rates of embryos transferred into heat stressed recipients. It was hypothesized that pro developmental actions of IGF1 are exerted after day 4 of development (when the embryonic genome is activated), and that the ability of IGF1 to protect embryos from heat shock is developmentally regulated and involves stimulation of genes promoting survival to stress. In a series of experiments to determine the mechanism by which IGF1 increases competence to develop to the blastocyst stage, i t was demonstrated that recombinant human IGF1 increase d the proportion of oocytes becoming blastocysts when added from day 4 8 or day 0 8 but not from day 0 4 post insemination Furthermore, IGF1 promote s development t o the blastocyst stage by regulating MAPK dependent events because inhibition of MAPK signaling by the inhibitor PD 98059 reduced effects of IGF1. Moreover, actions of IGF1 involve increased expression of genes required for blastocoel formation as indicate d by the observation that IGF1 increased expression of ATP1A1

PAGE 12

12 As expected, treatment of embryos with IGF1 at day 5 post insemination reduced the block in development to the blastocyst stage caused by exposure of embryos to heat shock. In contrast, there was no thermoprotective action of IGF1 at the two cell stage. Failure of IGF1 to protect two cell embryos does not seem to be due to insufficient signaling molecules because IGF1R mRNA and protein was detected in two cell and day 5 embryos, and the express ion of mRNA encoding for other molecules involved in the IGF1 signaling pathway such as PI3K MAPK RA F1, was higher in two cell embryos Thus, it is likely that IGF1 fails to be thermoprotective in two cell embryos because of the increased sensitivity of these embryos to heat shock. A final experiment evaluated gene expression in blastocysts treated with IGF1 using microarray technology to identify candidate genes responsible for the increased survival of IGF1 treated embryos transferred during heat stres s. Culture with IGF1 caused altered expression of 102 genes (40 upregulated and 32 downregulated). Among these were genes involved in developmental processes, apopto s i s and antioxidant defense. Taken together, these investigations indicate that IGF1 can r egulate embryonic development and resistance to heat stress but that these actions occur at or after day 4 of development, at a time after embryonic genome activation Furthermore, the pro developmental effects of IGF1 involve actions mediated by the MAPK pathway and include alteration of genes controlling formation of the blastocoelic cavity. Genes regulated by IGF1 at the blastocyst stage, such as those involved in development, apoptosis and protection from oxidative stress could be involved in the increa se in embryonic survival after transfer to heat s tress ed recipients caused by IGF1

PAGE 13

13 CHAPTER 1 LITERATURE REVIEW Introduction Successful pregnancy is ensured when the zygote formed as a result of fertilization encounters a suitable environment that will no urish it and allow it to develop to term. One of the most critical periods of development occurs during the initial weeks of pregnancy when the embryo is dependent of growth factors, hormones, and cytokines derived from the oviduct and uterus [4 5] Several factors can cause pregnancy loss during this period including fertilization of a compromised oocyte, chromosomal abnormalities, errors in embryonic development, infectious agents and other inadequacies in the ute rine environment [4, 6 7] Embryonic mortality is a particular problem for lactating dairy cows. Only 30 40% of all inseminated cows become pregnant, and the pregnancy rate has declined in the last 4 decades [7 8] There are many reasons for reduced fertility in dairy cows including altered follicular development [9 10] reduced steroid concentrations [11 12] and increased susceptibility to heat stress [13 14] One possible strategy for improving fertility in compromised populations of animals is embryo transfer using in vitro production (IVP) of embryos. This technology was originally developed with the view to improve genetic selection by increasing the number of offspring from genetically superior animals [15 16] In cases where pregnancy rates to artificial inse mination are low, however, such as during heat stress, transfer of IVP embryos can improve fertility in dairy cows [17 19] Many advances in the techniques for in vitro maturation, fertilization and culture have be en achieved. Nonetheless, in vitro embryo technologies pose several problems,

PAGE 14

14 including reduced embryo survival after transfer, decreased survival to cryopreservation and increased neonatal calf loss [20 23] Indeed the embryo derived in vivo remains the predominant type of embryo used in embryo transfer. According to data from the Intern ational Embryo Transfer Society only 34% of embryos transferred in 2008 were produced in vitro [24] One reason for the altered development of the in vitro produced embryo is the difficulty in rec reating in vitro the uterine environment with all the critical growth factors, cytokines, hormones and other substances present in that environment that regulate embryonic function. Accordingly, one approach to improve competence of the IVP embryo is to mo dify culture conditions to more closely mimic the reproductive tract. A molecule that holds promise for imp roving development of embryos in vitro is IGF1 Circulating IGF1 is synthesized and secreted primarily by the liver [25] and, in the cow, is also expressed in several reprodu ctive tissues including ovary, oviduct, uterus and embryo [26 30] IGF1 can affect function of the preimplantation bovine embryo by increasing the proportion of cultured embryos that become blastocysts [1, 3, 31 34] reducing effects of heat shock on development and apoptosis [1 2] and enhancing survival rates of embryos transferred into heat stressed recipients [35] Treatment of embryos cultured with IGF1 thus has the potential to increase blastocyst yield and to increase subsequent pregnancy rate after transfer into heat stressed recipients. For IGF1 to be a practical treatment for enhancing embryonic resistance to stress in vivo, it must be active at the earliest stages of development when embryos are most susceptible to stress [36 37] It is not known, however, how early in development IGF1 can affect embryo physiology. Moreover, little is known about the

PAGE 15

15 molecular basis of how IGF1 mitigates the effects of heat stress on embryo development, increases embryonic s urvival following transfer during hot season and increases bovine embryonic development. The objectives of this dissertation were to 1) determine the mechanisms by which IGF1 acts to increase the percent of oocytes becoming a blastocyst, 2) evaluate the mo lecular basis for the developmental acquisition of thermoprotective actions of IGF1 on preimplantation embryos, and 3) identify candidate genes induced by IGF1 in blastocysts that could mediate effects of IGF1 on embryonic survival during heat stress Key Events During Preimplantation Development in the Bovine A series of key events takes place after fertilization to allow normal embryonic development. In the cow, the first week of pregnancy sees the embryo initiate cleavage divisions, activate its own geno me and differentiate into trophectoderm (TE) and inner cell mass (ICM). Errors in these events, whether caused by environment or genetic or epigenetic factors, can lead to abnormal embryo development and pregnancy loss. Embryonic Genome A ctivation Embryon ic genome activation (EGA) or the maternal zygotic transition as it is sometimes called, is the process by which embryonic transcription is activated [38] In the cow, EGA occurs between the 8 16 cell stage [39 40] Until this time, maternal mRNA and protein support embryonic development. In the period before EGA, the embryo has a mRNA population similar to the one in the oocyte, whereas the 8 cell embryo exhibits an mRNA profile more comparable with the one found in blastocysts [41 42] Activation of transcription is associated with i ncreased translation of maternal mRNA for RNA polymerase IIA [43] Inhibition of this po lymerase has no effect on

PAGE 16

16 development up to the 16 cell stage but blocks embryo development beyond the 16 cell stage [43] showing that transcription of embryonic genes is essential for normal development only after the 16 cell stage. There is evidence for a limited amount of transcription before the 8 16 cell stage [42, 44] Incubation of two four and eight cell bovine embryos with [ 35 S ] UTP or [ 3 H]uridine resulted in incorporation of label into the RNA, indicating transcriptional activity [43, 45] Furthermo re, two cell embryos were capable of synthesiz ing HSPA1A in response to heat shock and this effect of heat shock was blocked by addition of transcriptional inhibitors such as amanitin and actinomycin D [46 47] The duration of the period of maternal control has been attributed to the stability of maternal mRNA [48] Before EGA, there is a gradu al degradation of maternal RNA and protein [38, 49] and a decrease in protein synthesis [50] Some possible mechanisms for the degradation of maternal mRNA include binding of microRNAs to the n slated region of targe t RNA to repress their translation, regulatory RNAs that n slated region and target the mRNA for degradation [38] and reduced availability of ribosome needed for translation [51] Epigenetic M odifications The newly formed embryo reprograms its new genome during early embryogenesis and preimplantation dev elopment [52] Such reprogramming involves epigenetic modifications [53] Inefficient reprogramming of DNA methylation may be in part respons ible for low birth rates and development abnormalities. Abnormal DNA methylation has been found in bovine cloned embryos from the two cell to the blastocyst stage compared to in vitro produced embryos [54 55] Furth ermore, Li et al. [56] found abnormal DNA methylation, histone acetylation and gene expression in

PAGE 17

17 cloned calves that died during the perinatal period or at least 6 months after the prenatal period compared to in viv o produced animals. Bovine embryos undergo DNA demet hylation during early cleavage stage s with demethylation reaching a nadir at the 8 cell stage (day 2 3 p ost insemination ) [57] Demethylation is fo llowed by de novo methylation beginning at the 8 cell to the 16 cell stage (day 4 post insemination ) [57 59] However, the pattern of demethylation differs between paternally and maternally derived DNA. Paternal DNA starts demethylation before the first cell division and demethylation is complete around the two c ell stage. Demethylation of maternal DNA does not begin until close to two cell stage and is completed around the 8 16 cell stages when de novo methylation is initiated [57 58] cyt osine residues at CpG dinucleotides [60 62] and is catalyzed by enzymes known as DNA methyltransferase ( DNMT ) [62 63] The DNMT family members, which include DNMT1, DNMT2 and DNMT3 [63 64] are classified as de novo and maintenance methyltransferases [63] DNMT 1 is believed to function primarily as a maintenance methyltransferase although it also is involved i n de novo methylation (methylation is re established) [64] There are three isotypes: DNMT1s (the somatic form), DNMT1o (oocyte specific form) and DNMT1p (sperm specific form) [64 65] DNMT2 has a weak methylation activity but may play a role in centromere function [63 64] DNMT3a and DNMT3b and DNMT3L have been identified as de novo methyltransferases [63 64, 66 67] In mouse, it was found that DNMT1 is expressed in oocytes and throughout preimplantation, DNMT2 has low abundance throughout preimplantation development and expression increases between 8 cell and morula/ blastocyst stage, DNMT3a is high

PAGE 18

18 in oocyte and early embryos and DNMT3b is low in oocytes and early embryos and increases in morulae and blastocysts [68] In the bovine embryo, DNMT1 DNMT 2, DNMT3a and DNMT3b are pr esent from the 2 cell to the blastocyst stage [69] DNA methylation plays an important role in genomic imprinting, both in silencing certain genes as well as activating others [62] Imprinted genes are those where there is monoallelic expression that is paren t of origin dependent [70] The majority of paternally expressed genes enhance fetal growth while maternally expressed genes suppress fetal growth [62] IGF2 and IGF2R are two examples of imprinted genes (paternally and maternally expressed, respectively) [71] Alte red expression of IGF2 was related to defects of organs in cloned calves experiencing neonatal death [72] Imprinting is established in the germline [73] in female mammals, imprinting autosomal genes are established during folliculogenesis while in males, imprints are reset during fetal development [74] Histone modification is another important epigenetic process whereby histones undergo acetylation, methylation, phosphorylation, ubiquitylation or sumoylation [60] Histone a cetyltransferases are enzymes involved in histone acetylation and acetylated chromatin becomes more open and accessible for transcription [52, 75 76] Acetylation can be removed by histone deacetylases leading to a more closed chromatin and repression of transcription [60, 75] Histome modifications undergo dynamic changes during preimplantation development, for example, ICM and TE in the blastocyst have different histone mod ification profiles [60] Expression of these enzymes was detected in all stages of bovine embryo development, indicating maternal and embryonic expression [77]

PAGE 19

19 Polarization an d Formation of the B lastocyst After the first cleavage, the blastomeres of the two cell embryo are at a right angle to each other. Thereafter, blastomeres divide asynchronously [51, 78] The cells that divide early contribute more to the ICM than the cells that divide later [78 79] This first division is thought to be involved in the establishment of the embryonic/abembryonic axis, which is involved in blastocyst polarity (ICM and polar TE at embryonic pole, and blastocoele and mural TE at the abembryonic pole) [79] The polarization process is not w ell known in the cow but there are two models to explain the process in the mouse: the [79] The first model proposes that cell position and cell to cell contact in the late morula determines cell fate [79] The 8 cell st age in the mouse [80] and the differentiation pathway ( ICM vs TE ) depends upon whether cells undergo symmetric or asymmetric cell divisions lead to cell polarity along the radius of the early morula [79] This process of polarization is an important determinant of cell fate because cells in contact with the external environment become TE while cells in the interior of the embryo are destined to form the ICM [78] The first morphogeneti c step of differentiation is the process of compaction, which occurs on day 4 to 5 post insemination at the 16 to 32 cell stage in the cow [78] and is characterized by a change in appearance of the embryo so that individual cell borders are not discernable. Compaction is caused by establ ishment of adherens junctions between blastomeres [81 83] In the absence of E cadherin (a component of adherens junctions), for example, there is a decrease in the proportion of embryos becoming a blastocyst [84] and embryos fail to form trophectodermal epithelium [85] The development of junctions between blastomeres results in the formation of different

PAGE 20

20 compartments within the embryo. Some blastomeres remain in contact wit h the external environment whereas other cells are totally surrounded by other blastomeres. Following compaction and establishment of cell polarity, the process of blastocyst formation begins involving cavitation and differentiation of blastomeres to TE a nd ICM. Cavitation is mediated by fluid transfer across the blastomeres and formation of a cavity filled with fluid, the blastocoel, at day 6 8 post insemination [81] Cavitation requires two cellular processes. Fir st, water is moved into the interior extracellular space of the embryo by the combined actions of ATP1A1 (which uses ATP to pump Na + out of and K + into the cell) and aquaporins (which allow water movement directly across the cell) to form the fluid filled blastocoelic cavity [81, 83] The inhibition of ATP1A1 with ouabain caused a decrease in blastocyst diameter [86] and disruption in gene expression of ATP1A1 inhibited blast ocyst formation [87] Secondly, the intercellular junctions between cells (including tight junctions, adherens junctions and desmosome junctions) are required to maintain a impermeable seal between the inside and outside of the embryo and pre vent blastocoelic fluid from diffusing out of the embryo [83, 88] Tight junctions contribute to the maintenance of cell membrane polarity and intercellular signaling, and are composed of occludin and claudin protei ns [83, 88] Gap junctions allow communication between adjacent cells, and are composed of connexins [88 89] The role of gap junctions for embryo development is controversi al, since in some studies the use of inhibitors or knockout animals for connexin caused no interference in early embryo development [90 91] whereas in other studies using antibody inhibitors, embryo lethality was i nduced [83, 89] Adherens junctions are

PAGE 21

21 formed from E cadherin and catenins and are involved in cell to cell adhesion, [88] Desmosomes also play a role in cell cell interaction, stabilizing the TE during blastocyst formation and expansion [88, 92] Challenges Associated with Production of In Vitro Produced Embryos Advances in in vitro maturation, fertilization and culture are still required to optimize emb ryo competence for post transfer development and eliminate inefficiencies and problems that limit use of IVP embryos [93] As co mpared to embryos produced in vivo, IVP embryos have a reduced probability of developing to the blastocyst stage [94 95] decreased pregnancy rates and increased number of fetuses and calves with abnormalities [96 97] and lowered cryotolerance [17, 94, 98 100] The reduced competence of the IVP embryo is associated with altered ultrastructural and physiological features such as decreas ed volume of mitochondria [101 102] higher rates of chromosomal abnormalities [103 105] and altered gene expression [102, 106 107] There are several possible causes for reduced competence of IVP embryos that are described below. Oocyte Source In cattle, approximately 90% of immature oocytes undergo maturation in vitro and about 80% undergo fertilization, but only 20 to 40% reach th e blastocyst stage [102] Oocyte source is an important factor affecting in vitro embryo production. Many of the oocytes used i n IVP are obtained from abattoir ovaries, and oocytes are collected from follicles of different sizes. Follicle diameter affects oocyte competence to develop to the blastocyst stage [108 112] For example, 66% of oo cytes from follicles > 6 mm became blastocysts after in vitro fertilization versus a value of 34% for oocytes from 2 6 mm follicles [108]

PAGE 22

22 Differences in animal age also influence oocyte quality. Zygotes derived from prepuberal c alf oocytes had ultrastructural abnormalities after maturation and cleaved and developed at a lower rate compared to adult cattle oocytes [113] In another study, oocytes derived from c ows had significantly higher blastocyst yield at day 8 than that from heifers [114 115] Conditions for O ocyte M aturation Oocytes matured in vivo are more competent than those matured in vitro. Rizos et al. [94] found a reduced rate of blastocyst development for oocytes matured in vitro as compared to those matured in vivo (39 and 58% respectively). Katz Jaffe et al. [116] reported that in vitro matured bovine oocytes had decreased amounts of mRNA for genes involved in volume regulation, osmoreception and cell cycle progression such as AQP3 and S EPT7 and increased expression of S IAH2 involved in stress induced apoptosis. Also, mRNA for three imprinted genes, IGF2R, P EG3 and S NRPN were present in higher amounts for oocytes matured in vitro [116] Furthermore in vitro maturation can affect gene expression in the resulting blastocyst. The addition of bovine serum albumin in maturation medium increased expression of IGF1R, IGF2 and IGF2R in day 9 bovine blastocysts and the use of fetal bovine serum in maturation medium increased mRNA for H SPA1A [117] Improvement of maturation conditions to increase oocyte maturation and blastocyst development can be achieved by addition of factors in maturation medium such as linolenic aci d [118] sodium nitroprusside [119] leptin [120] polyvinyl alcohol 40 and follicle stimulating hormone [121 122]

PAGE 23

23 Fertilization Fertilization conditions can affect developmental potential of the subsequent embryo. Using i n vivo matured oocytes, Rizos et al. [94] reported that a greater proportion of inseminated oocytes became blastocysts whe n oocytes were fertilized in vivo (74%) than when oocytes were fertilized in vitro (58%). Many aspects of in vitro fertilization have been studied to improve blastocyst development. Aging of sperm before in vitro fertilization reduced cleavage rates [123] The use of hepari n [124] and adjustment of sperm concentration for in vitro fertilization has improved fertilization and blastocyst yield [125] Individual bulls require different concentration of heparin and sperm for in vitro fertilization [125] Moreover, the sire used for fertilization can affect the proportion of embryos that develop to the blastocyst stage [126] Different methods for sperm purification for in vitro fertilization have been used. Higher cleavage rates and embryo development were obtained when Percoll gradient was used for sperm purification than when a fertilization medium was used alone or with 20% bovine albumin serum [124] Fertilization time is another factor that can influence blast ocyst development. Recent data have shown that the proportion of cleaved embryos that developed to the blastocyst stage was higher for embryos produced by incubation of oocytes with sperm for 6 hr as compared to 9, 12 or 18 hr [127] Culture Conditions for the E mbryo One important aspect of IVP affecting embryo competence is the period of embryo culture after fertilization. One model to demonstrate this concept has been to compare embryos produced and cultured in vitro with embryos produced by in vitro maturation and fertilization and then placed in the ewe oviduct for development to the blastocyst

PAGE 24

24 stage. Embr yos cultured in vivo had higher development to the blastocyst stage and higher survival rates to vitrification compared to embryos cultured in vitro [94, 98] In another study [128] there was no difference in rate of blastocyst development between in vitro fertilized embryos cultured in vivo or in vitro but there were many transcripts that differed between the two types of embryos. For day 7 blastocysts, there was higher expr ession of IFNT, G6PD, B AX and SOX for embryos cultured in vitro and more expression of SOD2 IGF2 IGF1R and GJA1 for in vivo cultured embryos [128] In another study, bovine blastocysts produced in vitro had higher amounts of mRNA for genes related to apoptosis (such as BAX and SOX ) when compared to those produced in vivo [99, 129] Lazzari et al. [130] found increased mRNA abundance f or H SPA1A SOD1, SLC2A3, SLC2A4 and IGF1 R in bovine blastocysts produced in vitro compared with those produced either in the sheep oviduct or by superovulation. More recently, a pairwise comparison identified 238 genes that were expressed with a twofold or more difference between embryos produced in vivo by artificial insemination and IVP or somatic cell nuclear transfer embryos [131] Some of the genes that were upregulated in IVP embryos as compared to embryos produced by artificial insemination included HDAC3 D NMT 1 and C DKN 1 C Among the down regulated genes were ESR1 and O X TR Although many treatments can affect blastocyst yield, few studies have examined embryonic survival after transfer. Addition of hyaluronan to culture increas ed blastocyst yield and improved embryo survival following vitrification [132] Another molecule that can affect competence of IVP embryos to survive transfer is CSF2. Addition of CSF2 to embryo culture from day 5 to 7 after insemination increased pregnancy rate and calving

PAGE 25

25 rate after transfer and decrease pregnancy loss [133] The gaseous environment ma y also affect embryo competence to establish pregnancy. To test this hypothesis, Merton et al. [134] cultured IVP embryos in a conventional incubator or in an incubator with carbon activated air purification unit. While there was no difference in the proportion of embryos developing to the blastocyst st age, pregnancy rate was 12.9% 14.6% higher for fresh and frozen/thawed embryos, respectively, produced in the filtered air incubator than in the standard incubator. Taken together, results suggest that modification of embryo culture systems by providing an environment that more closely matches the uterine environment is a likely strategy to improve development and survival of IVP embryos. Important factors to consider are media composition, presence of growth factors and cytokines, and the gaseous enviro nment inside the incubator. Use of IGF1 to Improve Embryonic Development in Vitro Biology of IGF1 The insulin like growth factor family consists of three structurally related peptides: IGF1, IGF2 and insulin; three cell surface receptors (IGF1 receptor, IG F2 mannose 6 phosphate receptor and insulin receptor); and six IGF binding proteins (IGFBP 1 through 6; [135 136] ). IGF1 consists of 70 amino acids and a molecular weight of 7.6 kDa [136] The major secretagogue for IGF1 is growth hormone (GH) (or somatotropin) from the somatotroph cells of the anterior pituitary. GH acts in an endocrine fash ion at the liver where it binds to its receptors and induces hepatic production of IGF1 [137 139] Even though GH is the main regulator of circulating IGF1, insulin is a metabolic signal in the coupling of the GH/I GF1 axis. Insulin infusion in lactating cows increased

PAGE 26

26 IGF1 plasma concentrations and mRNA expression for GHR and IGF1 in the liver [140] The effect of insulin to increase hepatic IGF1 synthesis is mediated in part by the increase in GHR protein in the liver [141] Nutritional status of the dairy cow can influence circulating concentrations of IGF1 [142 143] Early postpartum, there is a period of negative energy balance which is associated with reduced expression of GHR 1A in the liver [144] reduced IGF1 synthesis [144 145] and increased concentrations of GH concentrations in plasma [146] Signaling by IGF1 Actions of IGF1 are mediated by the IGF1 receptor, which is a transmembrane tyrosine kinase receptor that is activated with different potencies by at least three subunits, which are linked together by disulfide [136 147 148] subunits contain a cysteine subunits of the IGF1R to cause a subunits resulting in the tyrosine phosphorylation subunits phosphorylation leads to the phosphorylation of tyrosine residues on several docking proteins, IRS 1 and Shc homology protein [148] The phosphorylation of IRS 1 triggers the activation of PI3K which increases the conversion of the PIP2 ( a phospholipid component of c ell membranes) to PIP3. PIP3 binds to domains of at least two proteins, PKB/AKT and PDK1. The PKB/AKT pathway has a role in regulation of apoptosis and cell survival, and PDK1 activation of PKC and PKA to regulate the cell cycle and growth ( Figure 1 1 ) [3, 148 153]

PAGE 27

27 Another signaling pathway activated by IGF1 includes the Ras/Raf/MAPK pathway. Binding of IGF1 to IGF1R causes phosphorylation of the docking protein Shc which causes format ion of a complex between Shc and Grb2 (another adaptor protein). Grb2 bind s to guanine nucleotide exchange factor SOS and this complex promotes the removal of GDP from Ras Ras can then bind GTP become activated and phosphorylate and activate Raf1. Raf1 activation, in turn, l eads to a cascade of phosphorylation eve nts to activate the MAPKK pathway. This pathway is important in cell differentiation, metabolism, mitogenic responses and cell cycle triggering ( Figure 1 1 ) [136, 147 148, 154 155]

PAGE 28

28 Figure 1 1. IGF1 signaling transduction mediated by IGF1R (modified from a drawing by Jousan [156] Following the bind of IGF1 to IGF1R the Ras/Raf/MAPK and t he PKB/AKT pathway are activated and can lead to increased activity of anti apoptotic factors and inhibition o f pro apoptotic factors, thereby decreasing apoptosis, increasing cell differentiation, proliferation, c e ll cycle and growth. MAPK pathway can als o be activated through Grb2/SOS signaling by activation of IRS 1. IGF2R is a mannose 6 phosphate receptor that has high affinity for IGF2 and low affinity for IGF1 and is not believed to have a major role in IGF signal transduction. It is thought to regul ate IGF2 by targeting it for clearance and degradation, and hence inhibiting IGF2 actions [136, 157 158] IGF1 and IGF2 actions are modified by IGFBP which bind to IGF1 and IGF2 with high affinity. At least 99% of t he IGFs in circulation are bound to the IGFBP, which increase IGF half life and deliver the growth factors to tissues. Different actions of IGFPB are summarized on Table 1 1

PAGE 29

29 Table 1 1. Known actions of insulin like growth f actor binding proteins Affinity to IGF Modulation of IGF action IGFPB 1 1 and 2 inhibit and/or potentiate IGFPB 2 2 more than 1 Inhibit IGFPB 3 1 and 2 inhibit and/or potentiate IGFPB 4 1 and 2 Inhibit IGFPB 5 2 more than 1 Potentiate IGFPB 6 2 mor e than 1 Inhibit Modified from Rajaram et al. [159] The IGFBP can either inhibit or potentiate IGF actions ( Table 1 1 ) by sequestering IGF from the IGF1R, or releasing IGFs to bind the IGF1R. The release of IGF from the IGFBP can be induced by actions of e ndoproteases [160] In addition, however, IGFBP can bind to cell surfaces or cell matrices and thereby experience a decrease in affinity for IGF1, and release the growth factor to act on cells [135, 157, 160] Furthermore, IGFBP may ha ve bioactivity independent of IGF or without triggering IGF1R signaling through interactions of specific domains in the IGFBP with specific domains ion the cell surface [136, 157, 160 161] IGF1 in the Reproductive Tract While the primary source of circulating IGF1 is the liver, it is also expressed locally in several reproductive tissues. In cattle, this includes the ovary [29] oviduct [28] uterus [26, 29] and embryo from the two cell to the blastocyst stage [27, 30, 162] Transcripts for IGF1 were detected in cumulus oocyte complexes derived from folli cles that were 3 to 6 mm and 8 to 16 mm in diameter [163] IGF1R mRNA was detected in oocyte and granulosea cells of preantral and antral follicles [164 165] IGF1 mRNA in th e corpus luteum was highly expressed during the early luteal phase, with a

PAGE 30

30 decrease from day 5 to 7 and then an increase from day 8 to 18 [166] Amounts of IGF1 mRNA decreased after experimentally induced luteolysis [167] The role of IGF1 in the corpus luteum is not clear but IGF1 stimulates luteal progesterone secretion [168] Transcripts for IGF1 were localized in the mucosa a nd muscle layers of the ampulla and isthmus in the bovine oviduct [28] Highest expression of IGF1 mRNA in the oviduct was on day 3 post insemination for non lactating beef heifers and on day 0 1 for lactating dairy cows [28] IGF1 mRNA expression in the uterus was higher at estrus and lowest during the early and late luteal phases, and mainly localized in the sub epithelial stroma underlying the uterine luminal epithelium [169] IGFBP1 and IGFBP3 mRNA have also been found in the uterus of ewes and heifers with expression greater in pregnant than in cyclic animals [170] Amounts of IGFBP1 mRNA ex pression in the ewe uterus are upregulated by progesterone and IFNT [170] Expression of IGF1, IGF2 and IGFBP were studied in the uterus of postpartum dairy cows at day 14 postpartum. IGF1 mRNA was localized in the sub epithelial stroma of inter caruncular and caruncular endometrium while IGF2 and IGF1R mRNA were localized in the deep endometrial stroma the caruncular stroma and myometrium [171] Expression of IGFBP3 was foun d in the luminal epithelium, IGFBP2 IGFBP4 IGFBP 5 and IGFBP 6 in the stroma and IGFBP4 and IGFBP 5 in the myometrium [171] Actions of IGF1 on E mbryonic D evelopment and S urvival IGF1 has an important effect on preim plantation embryonic development. In mice, addition of IGF1 added to culture medium beginning at the two cell stage increased the proportion of embryos becoming a blastocyst and the number of cells in the ICM of the blastocyst [172 173]

PAGE 31

31 In other species too, there are data supporting a relationship between IGF1 and embryo development and survival in vitro and in vivo. Addition of IGF1 to culture medium increased the proportion of embryos becoming blastocysts in the bovine [31 34] ovine [174] buffalo [175] pig [152] mouse [173] and human [176] Addit ionally, IGF1 is mitogenic and can increase total cell number of bovine blastocysts [177 180] and decrease the number of apoptotic blastomeres [1, 3, 153, 178] Matsui et al. [181] 1 actions on embryo development to the morula stage, showing that actions of IGF1 are mediated by IGF1R. Culture of bovine embryos with IGF1increased steady state amounts of mRNA for IGFBP 2, IGFBP5 and decreased mRNA for IGF1R in blastocysts [182] In another study, IGF1 altered amounts of several transcripts in blastocysts [183] In particular, IGF1 increased mRNA for IGFBP3 and DSC2 and tended to increase amount of ATP1A1 and B AX mRNA Also, there was a decrease in transcripts for H SPA1A and IGF1 R [183] IGF1 and Fertility During Heat Stress Effect of H eat S tress on F ertility Heat stress is a major cause of poor reproductive function in lactating dairy cattle. It has been shown that a 0.5 1C increase in uterine temperature on the day of insemination reduce conception rates by 1 2.8 % [184] Heat stress decreases fertility by several actions including a decrease in blood flow to the uterus [185] reduced duration of estrus, impaired follicular development and oogenesis, and altered follicular steroid production [14, 186 187] .Oocytes that develop under elevated temperatures have altered membrane composition, which was associated with decreased oocyte viability

PAGE 32

32 and developmental competence [187 191] Also in vitro studies showed that heat shocked oocytes had increased apoptosis and decreased cleavag e rates [192] Elevat ed temperatures (i.e., heat shock) such as experienced by heat stressed females can also have deleterious effects on preimplantation embryos. Early embryonic development was compromised in cows exposed to heat stress in the first seven days of pregnancy [193 194] In vitro exposure of embryos to elevated temperatures reduced development to the blastocyst stage [1, 3, 195] The magnitude of the effect of heat shock on developm ent of preimplantation bovine embryos is developmentally regulated. Heat stress reduced blastocyst yield in superovulated cows when applied on day 1 of pregnancy but not at days 3, 5, or 7 of pregnancy [194] Heat stress also had a greater effect on embryonic mortality when applied early in gestation in pigs [196] In vitro, embryos were more affected by heat shock when exposed early in development (two to four cell stage) than when given later in development (day 4 5 post insemination) [36, 197 198] Edwards et al. [36] showed that heat shock at 41 C for 12 hr decreased blastocyst development for two cell and four cell embryos (0% vs 26% and 10% vs 25% for heat shocked and control, respectively), but did not affect morula (42% vs 37% heat shocked and control, respectively). There are many physiological effects of elevated temperature on the embryo that could be responsible for disrupted development. Hea t shock of the two cell embryo caused swelling of mitochondria and disruption of microfilaments and microtubules to cause movement of organelles towards the center of the blastomere [199 200] Heat shock can increas e intracellular levels of reactive oxygen species (ROS) [198] which is

PAGE 33

33 correlated with DNA fragmentation [201] and with an increase in embryonic mortality [202] Exposure to elevated temperature can also induce apoptosis. This effect occurs in maturing oocytes [187, 192] and embryos after the 8 16 cell stage [1, 3, 153, 203] Overall protein synthesis in oocytes and embryos can also be reduced by heat shock, although heat shock protein 70 increases during heat shock [10, 47] presumably to block apoptosis and stabilize proteins denatured by heat shock [204] Furthermore, Rivera et al. [205] have shown that two cell embryos submitted to heat shock were arrested and did not pass the eight cell stage. O ne possible cause for this embryonic arrest could be the increase in oxidative stress leading to higher levels of p66shc mRNA P66Shc is a stress adaptor protein associated with early embryonic arrest [206 208] and it regulate s mitochondrial metabolism by modulating the amount of ROS released into the cytosol [209] H eat S hock and IGF1 IGF1 can reduce effects of elevated temperature on the bovine preimplantation embryo. Culture of embryos in the presence of IGF1 diminished the negative effects of heat shock administered at day 5 post insemination on the percent of oocytes becoming blastocysts and number of apoptotic blastomeres [1, 3, 153] The anti apoptotic actions of IGF1 are mediated through activation of the PI3K/AKT pathway because either a PI3K inhibitor or an AKT inhibitor blocked the anti apoptotic actions of IGF1 in heat shocked embryos [3, 153] In addition to protecting embryos from elevated temperature, IGF1 can act as a survival factor to reduce effects of hydrogen peroxide on mouse preimplantation embryos [210] induction of apoptosis by campoth ecin and actinomycin D in mouse embryos [211] by menadione in bovine embryos [212] and by ultraviolet radiation in rabbit embryos [213]

PAGE 34

34 IGF1 can also improve competence of an embryo to establish and maintain pregnancy following transfer to recipients provided the recipients are exposed to heat stress. Lactating cows exposed to heat stress were more likely to become pregnant following transfer of an in vitro produced embryo if the embryo was cultured in the presence of IGF1 [33] In another experiment, the effect of IGF1 on post transfer embryo survival in lactating cow s was evaluated for warm and cool seasons [35, 133] During the hot season, pregnancy rate was higher for cows receiving an embryo treated with IGF1 (18% vs 33% for control and IGF1, respectively). During the cold s eason, however, there was no difference in pregnancy rate between recipients receiving control or IGF1 treated embryos (27.6% vs 23%, control and IGF1, respectively) [35] Similar results were seen in another experiment with lactating cows [1 33] except that the IGF1 effect was not significant. The mechanism by which IGF1 improves embryo survival after heat shock and after transfer into heat stressed recipients is not known. The inhibition of apoptosis caused by IGF1 is probably not responsibl e for increased survival of embryos to elevated temperature because a similar protective effect was not caused by administration of a caspase 3 inhibitor [3] In fact, development is sometimes more likely to be blocked by heat shock when caspase 3 activity is inhibited [3, 214] Among the actions of IGF1 that could improve survival after heat shock are mitogenesis, to increase blastomere proliferation [178 180] and increased expression of SLC2A genes, to increa se uptake of energy substrates [215] To determine possible factors responsible for increased survival of embryos treated with IGF1 after transfer into heat stressed recipients, Block et al. [183]

PAGE 35

35 measured characteristics of blastocysts produced in the presence of IGF1. There was no effect of IGF1 on blastocyst total cell number, the proportion of apoptotic blastomeres or the ratio of TE: ICM. However, IGF1 increased transcrip t abundance for ATP1A1 and DSC2 that are involved in blastocyst formation. One possible approach to reduce the effects of heat stress on fertility is to administer recombinant bovine somatotropin (bST). This hormone increases plasma concentrations of IGF1 [216 218] and, in some studies, increases pregnancy rates following timed artificial insemination [218 221] There is little evidence that bST can improve pregnancy rate in h eat stressed cows. However, in one study bST increased plasma concentration of IGF1 in lactating cows exposed to heat stress but did not have a significant effect on pregnancy rates (14.8% vs 17.2% for control and bST) [2] Bell et al. [222] found similar results in another study (22.4% pregnancy rate for control vs 24.8% pregnancy rate for bST). One possible reason for the ineffectiveness of bST is that IGF1 induced by bST may not be thermoprotective in embryos at the ea rliest stages of development, when thermosensitivity is highest. It is not known whether IGF1 has thermoprotective actions on bovine embryos at stages earlier than day 5 [1, 3] Hypothesis and Objectives This disser tation focuses on two of the main actions of IGF1 on development of the preimplantation bovine embryo the increase in proportion of embryos that develop to the blastocyst stage and the thermoprotective effects of IGF1 during culture and after transfer in to recipients. Development from the one cell stage to the blastocyst stage is accompanied by an increase in cell number. The rate of increase in cell number, in turn, depends upon the ratio between cell proliferation and apoptosis ( Figure 1 2 ). In addition, the embryo must

PAGE 36

36 overcome cell arrest, an event in which the embryo enters a senescence like stage where cells stop dividing [207] Furthermore, development to the blastocyst stage requires a sequential series of events beginning with degradation of maternal RNA, embryonic genome activation, compaction, blastocoele formation and differentiation of cells into the TE and ICM ( Figure 1 2 ).

PAGE 37

37 Figure 1 2. Potential actions of IGF1 on emb ryonic development. Development from the 1 cell stage to the blastocyst stage depends upon an increase in cell number and the rate of increase in cell number depends upon the ratio between cell proliferation and apoptosis. In addition, embryo development c an be blocked by embryo arrest. Furthermore, development to the blastocyst stage requires a sequential series of events beginning with degradation of maternal RNA, EGA, compaction, blastocoele formation and differentiation of cells into the TE and ICM.

PAGE 38

38 Gi ven this scenario, one action of IGF1 that could result in an increase in the proportion of embryos becoming blastocysts would be an increase in embryo cell number. This action could involve stimulation of cell proliferation and/or a decrease in the number of blastomeres undergoing apoptosis. In addition IGF1 could block cell arrest, stimulate embryonic genome activation, or activate genes involved in compaction or blastocyst formation. Experiments to determine whether IGF1 affects competence to develop to the blastocyst stage before or after day 4 of development can help distinguish between these possible mechanisms, because effects on maternal mRNA degradation and embryonic genome activation would occur before day 4 while effects on compaction and blastocy st formation would occur after day 4. A second goal of this dissertation is to evaluate whether the ability of IGF1 to protect embryos from heat shock [1, 3] is developmentally regulated, i.e., whether IGF1 can prot ect embryos from heat shock at earl y stages of development when the embryo is most susceptible to elevated temperature [36, 198] It is possible that the early embryo may lack signaling molecules for IGF1 in suffici ent quantity for IGF1 to affect embryo function or that lack of activation of the embryonic genome may limit cellular responses to IGF1 early in development. In addition, because the early embryo is so susceptible to heat shock, the thermoprotective action s of IGF1 may not be sufficient to overcome damage caused by heat shock. The question of developmental regulation of IGF1 thermoprotection is an important one practically because it relates to the likelihood of identifying treatments to improve fertility i n heat stressed cows. bST, which stimulates secretion of IGF1 [216] increased fer tility of lactating cows not exposed to heat stress [219 220] but did not increase pregnancy rates of heat stressed cows [2, 222]

PAGE 39

39 A third goal of the study was to identify genes whose expression is regulated by IGF1 at day 7 of development to help understand the mechanism by which embryos treated with IGF1 are better able to establish pregnancy in heat stressed cows than control embryos. In particular, it is hypothesized tha t IGF 1 causes differential expression of genes related to survival from stress ( HSPA1A SOD2 GPX ), embryonic growth ( IGF1, IGF1R SLC2A BMP15 PED ) or apoptosis

PAGE 40

40 CHAPTER 2 ACTIONS OF INSULIN LIKE GROWTH FACTOR 1 TO INCREASE DEVELO PMENT OF BOVINE EMBRYO S TO THE BLASTOCYST STAGE Introduction Prope r development of the embryo is dependent upon maternal signals. While embryos can grow in simple defined media, the pattern of development can be disrupted. In the cow, for example, in vitro produced embryos suf fer from a variety of morphological and molecular abnormalities and competence of the resultant embryo to survive freezing or transfer into recipients is reduced compared to embryos produced in vivo [223 224] Lack of maternal signals controlling development is responsible for at least some of the problems inherent in the embryo produced in vitro since potential for development to the blastocyst stage, cryotolerance and gene expression can be made more similar to tha t of embryos derived in vivo if in vitro produced embryos are returned to the oviduct after fertilization [224] G rowth factors and cytokines that can a ffect embryonic development have been identified in a variety of species In the cow, these include vascular endothelial growth facto r [225] epidermal growth factor [226] colony stimulating factor 2 [133, 227] leukemia inhibitory factor [228] and interleukin [229] T he mechanisms by which embryo nic development is improved by these factors are not known. Effects on the proportion of embryos that develop to the blastocyst stage could be caused by stimulation of cell proliferation, inhibition of apoptosis a nd embryo arrest, or promotion of key events such as maternal RNA degradation, embryonic genome activation, compaction and blastocoel formation. Here we evaluated how one growth factor capable of regulating embryonic development, IGF1 increases the propor tion of embryos that develop to the blastocyst

PAGE 41

41 stage. IGF1 is mainly produced in the liver upon stimulation by growth hormone [137, 230] althoug h s ome local synthesis in the ovary, uterus and embryo has been reporte d [27, 29, 231] Treatment with IGF1 can increase the proportion of embryos becoming blastocysts in the bovine [31 32, 34] ovine [174] buffalo [175] pig [152] mouse [172] and human [176] In the cow, the model species examined for the present study, IGF1 also improves resistance of preimplantation embryos to heat shock [1, 3] and oxidative stress [212] alters expression of several genes at the blastocyst stage [183] and improves embryo survival after transfer into heat stressed recipient s [35, 133] Specific objectives of the current study were to determine whether the pro developmental actions of IGF1 are exerted before or after day 4 of development (i.e., on events occurring through the period of genomic activation versus events coincident with compaction and blastocoele formation), whether M APK or PI3K signaling pathways mediate effects of IGF1, and whether IGF1 alters expression of genes controlling blastocoel formation. Materials and Methods Ma terials Unless otherwise mentioned, reagents were purchased from Sigma or Fisher Scientific (Pittsburgh, PA). HEPES Tyrodes Lactate (TL) and IVF TL, solutions were purchased from Caisson (Sugar City, ID) and used to prepare HEPES Tyrodes albumin lactate py ruvate (HEPES TALP), and IVF TALP as previously described [232] Oocyte collection med ium was tissue culture medium 199 (TCM 199) with Hanks salts without phenol red (HyClone, Logan, Utah) supplemented with 2% (v/v) bovine steer serum (Pel Freez, Rogers, AR) containing 2 U/ml heparin, 100 U/ml penicillin G, 0.1 mg/ml streptomycin, and 1 mM glutamine. Oocyte maturation medium was TCM 199 (Gibco,

PAGE 42

42 Grand Island, NY) with Earle s salts supplemented with 10% (v/v) bovine steer serum, 2 g/ml estradiol 17 follicle stimulating hormone (Folltropin V; Bioniche, London, ON, Canada), 22 g/ml sodium pyruvate, 50 g/ml gentamicin sulfate, and 1 mM glutamine. Percoll wa s from GE Healthcare (Uppsala, Sweden). Frozen semen from various bulls was donated by Southeastern Semen Services (Wellborn, FL). The embryo culture medium was Synthetic Oviduct Fluid Bovine Embryo 1(SOF BE1). The formulation was as described by Fischer B rown et al. [233] except that bovine serum albumin was omitted, the concentration of sodium lactate was 5 mM and additional components were added as follows: polyvinyl alcohol ( 1 mg/ml ) alanyl glutamine (1 mM), sodium citrate (0.5 mM) and myo inositol (2.7 7 mM). Recombinant human IGF1 was purchased from Sigma. A vial containing 50 g of lyophilized IGF1 was rehydrated with 200 l of water, and this stock solution was then stored at 20C in 5 l aliquots until dilution to the requisite concentration with SO F BE1 on the day of use. Primers were designed using Primer3Plus ( http://www.bioinformatics.nl/cgi bin/primer3plus/primer3plus.cgi ) or were based on Sakurai et al. [234] ( CDX2 ) and were synthesized by I ntegrated D NA T echnologies ( http://www.idtdna.com/Home/Home.aspx ). In Vitro Production of Embryos Ovaries were obtained from Central Beef Packing Co. (Center Hill, FL), and transported in 0.9% (w/v) NaCl solution at room temperature Cumulus oocyte complexes (COCs) were obtained by slicing 2 to 8 mm follic les on the surface of ovaries. Those COCs containing at least one layer of compact cumulus cells and even granulation were washed in oocyte collection medium COCs were matured for 20 22 hr

PAGE 43

43 in groups of 10 in 50 l drops of o ocyte maturation medium overlaid with mineral oil at 38.5C in an atmosphere of 5% (v/v) CO 2 in humidified air. Matured COCs were then washed in HEPES TALP and transferred in groups of 200 to a 3 5 mm petri dish containing 1700 l of IVF TALP supplemented with 80 l PHE (0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 M epinephrine in 0.9% [w/v] NaCl), and fertilized with 120 l Percoll purified spermatozoa (~ 1x10 6 sperm cells) Sperm were prep ared from a pool of frozen thawed semen from three different bulls ; a different set of bulls was generally used for each replicate). After 6 to 10 hr of fertilization in an atmosphere of 5% CO 2 in humidified air, putative zygotes were removed from fertiliz ation wells, denuded of cumulus cells by vortexing for 4 min in HEPES TALP and hyaluronidase (10,000 U/ml in 600 l HEPES TALP medium) and washed in HEPES TALP. Embryos were then placed in groups of 30 in 50 l drops of SOF BE1 overlaid with mineral oil. E mbryos were cultured at 38.5C in an atmosphere of 5% CO 2 in humidified air. Concentration D ependent A ctions of IGF1 to I ncrease B lastocyst D evelopment Following fertilization, embryos were washed and cultured in 50 l drops of SOF BE1 ( control), or SOF B E1 containing 10, 100, or 200 ng/ml IGF1. Concentrations were chosen so that the second concentration was within the range of values for IGF1 in blood of lactating cows [235 236] The percentage of oocytes that clea ved was observed at day 3 post insemination and the percentage of embryos that became blastocyst was observed at day 7 and day 8 post insemination. The experiment was replicated 4 times using 231 to 284 embryos per group.

PAGE 44

44 Determination of the S ta ge of Dev elopment at Which IGF1 Acts to Increase Blastocyst D evelopment This experiment tested whether IGF1 improves developmental competence by acting from day 0 4 post insemination (i.e., on events occurring through the period of genomic activation at the 8 16 ce ll stage) or from day 4 to day 8 post insemination (i.e., coincident with compaction and blastocoele formation). Fo llowing fertilization, putative zygotes were washed and assigned to one of four treatments: control, IGF1 from day 0 8 post insemination IGF 1 from day 0 4 post insemination or IGF1 from day 4 8 post insemination Embryos were placed in groups of 30 in 50 l drops of SOF BE1 + 100 ng/ml IGF1 at d ay 0. F or all treatments, embryos were washed at day 4 and transferred to fresh medium containing SO F BE1 + 100 ng/ml IGF1. The percent of oocytes that cleaved was assessed at day 4 post insemination and the percent that became blastocysts was determined at day 7 and 8 post insemination The experiment was replicated 5 times using 332 to 356 embryos per group. Role of MAPK and PI3K S ignaling Pathway in IGF1 A ctions Two experiments were performed to test whether the increase in blastocyst development caused by IGF1 is mediated by the MAPK or PI3K pathways using PD98059 and LY294002 as inhibitors. Embryos were produced as described above and cultured in SOF BE1 from day 0 4 post insemination At day 4, embryos were placed in groups of 30 in 50 l drops of SOF BE1 containing treatments. For the MAPK experiment, treatments were SOF BE1 containing 0.1 % dimethy l sulfoxide (DMSO vehicle), SOF BE1 containing 0.1% DMSO and 100 ng/ml IGF1, SOF BE1 containing 0.1% DMSO, 100 M PD 98059 and SOF BE1 containing 0.1% DMSO (vehicle), 100 ng/ml IGF1 and 100 M PD 98059. For the PI3K experiments, treatments were similar

PAGE 45

45 exc ept that PD 98059 was replaced with 100 M LY294002. Embryo development was assesse d at day 7 and 8 post insemination The inhibitor experiment was replicated 5 times using 308 to 378 embryos per group, and the PI3K inhibitor was replicated 7 times using 3 99 to 515 embryos per grou p. Action of IGF1 on Expression of Genes Controlling Compaction and B lastocyst F ormation Following fertilization, putative zygotes were washed and cultured in 50 l drops of SOF BE1. At day 4, embryos were transferred to fresh med ium of either SOF BE1 or SOF BE1 containing 100 ng/ml IGF1. Morula and early blastocysts were selected at day 6 and frozen at 80C until RNA extraction. Total cellular RNA was extracted from groups of 20 embryos using the Arcturus PicoPure RNA Isolation k it (MDS, Analytical Technologies) following the s After RNA extraction, all samples were treated with DNase (DNAse I Kit RNase free; New England Biolabs) and then cDNA was generated using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City CA). Reverse transcribed cDNA was subject ed to real time PCR amplification using a 25 l reaction consisting of 2.5 l of cDNA sample, 12.5 l of SYBR Green (Applied Biosystems), 2.5 l (1 M) of primers ( Table 2 1 ) and diethylpyrocarbonate treated (DEPC) water. Quantitative r eal time RT PCR (qPCR) was performed using an ABI 7 3 00 sequence detection system (Applied Biosystems) as performed as follows: 50C for 2 min, 95C for 10 min followed by 40 cycles of 95C of 15 sec and 60C for 1 min. T o obtain the fold difference data were analyzed using the delta delta T ) method described previously [237] cDNA concentration

PAGE 46

46 dependent amplification was validated by making standard curves for all genes using serial 5 fold dilutions This experiment was replicated 6 times. Statistical Analysis Data on the percent of oocytes that cleaved and became a blastocyst were analyzed by least square s analysis of variance (ANOVA) using the Proc GLM procedure of the Statistical Analysis System (SAS for Windows, Version 9.2 Cary, NC). Percent data were transformed by arcsin tr ansformation before analysis. The mathematical model included main effects of replicate, treatment or treatments and all interactions. Replicate was considered random and other main effects were considered fixed. For the qP CR experiment, Cycle threshold ( C T ) T were analyzed statistically but data are presented as fold differences. All values reported are least square s means SEM. Probability values were based on analysis of arcsin transformed data while least square s means were from analysis of untransf ormed data. The following orthogonal contrasts were used to determine differences between individual concentrations of IGF: 0 vs others, 100 vs 10 and 200 and 10 vs 200. For other analyses, i dentification of means that differed significantly was determined using the pdiff procedure of SAS. Results Concentration D ependent Actions of IGF1 to Increase Blastocyst D evelopment Treatment with IGF1 did not affect the percent of oocytes that cleaved by day 3 post insemination ( Figure 2 1 A) but increased the percent of embryos that became a blastocyst at day 7 (p<0.05; Figure 2 1 B) and 8 (p= 0.05; Figure 2 1 C). At day 7 there was no statistical difference between 10, 100 and 200 n g/ml At day 8, the percent of

PAGE 47

47 oocytes that became a blastocyst was higher (P<0.05) for 100 ng/ml than for 10 or 200 ng/ml. Determination of the Stage of Development at Which IGF1 Acts to Increase B lastocyst D evelopment As expected, treatment did not affec t cleavage ( Figure 2 2 A) and addition of IGF1 from day 0 8 p ost insemination increased (p<0.05) the percent of oocytes that became blastocysts at day 7 ( Figure 2 2 B) and 8 p ost insemination ( Figure 2 2 C). A similar increase in percent of oocytes developing to the blastocyst stage was observed when embryos were cultured with IGF1 from day 4 8 (P<0.05 vs controls) but not when IGF1 was added from day 0 4 ( Figure 2 2 B and 2 2C). Representative image of day 8 blastocysts are shown in Figure 2 3 Effect of I nhibition of MAPK and PI3K S ignaling on A ctions of IGF1 to P romote D evelopment Results from the experiment with th e MAPK inhibitor PD 98059 are shown in Figure 2 4 Development at both day 7 and 8 was affected by inhibitor x IGF1 interactions (P< 0.05 ) These interactions reflected the fact that IGF1 increased development in the absence of the inhibitor but not in the PD 98059 treated group. Results from the experiment with the PI3K inhibitor LY 294 002 are shown in Figure 2 4 The i nhibitor reduced the percent of oocytes that were blastocysts at day 7 and 8 post insemination ( P <0.05) and IGF1 tended to increase blastocyst development in the absence and presence of LY 294 002 at day 7 (P =0.09) and day 8 (P =0.08). There were no inhibitor x IGF1 interactions because IGF1 increased development in the presen ce and abs ence of the inhibitor.

PAGE 48

48 Action of IGF1 on Expression of Genes Controlling Compaction and Blastocyst F ormation There was no effect of IGF1 on expression of CDX2 or OCLN at day 6 post insemination. IGF1 decreased the steady state expression of CDH1 (P <0.05 ) a nd there was a tendency (P=0.07) for ATP1A1 expression to be higher in IGF1 treated embryos ( Figure 2 5 ) Discussio n Insulin like growth factor is an important maternal determinant of embryonic survival that can promote develop ment to the blastocyst stage [31 32, 34] protect the embryo from several stresses [1, 3, 212] and increase competence for development to term, at least in heat stressed fema les [35, 133] As shown here, IGF1 exerts its pro developmental effects at concentrations that are within the range of those found in the blood of lactating and non lactating cows [235 236] Since addition of IGF1 to culture medium at day 4 post insemination increased blastocyst development while IGF1 from day 0 4 had no statistical difference from the control group on development, IGF1 exerts actions on development at a time after embryonic genome activation [49, 58] and when the embryo is undergoing compaction [238] DNA methylation [58] proliferation and blastocoel formation [238] Furthermore, the pro deve lopmental effects of IGF1 involve actions mediated by the MAPK pathway and include alteration of genes controlling formation of the blastocoelic cavity. Activation of IGF1 receptors leads to signaling through at least two main pathways, MAPK and PI3K that engage transcriptional and non transcriptional events leading to a stimulation of cell proliferation and differentiation, inhibition of apoptosis and cytokine signaling [239] The MAPK pathway is one of the pathways for the proliferative

PAGE 49

49 actions of IGF1 [240 241] and it is possible, therefore, that the main action of IG F1 that increases blastocyst development is an increase in cell number. In this way, more embryos could reach a critical cell number necessary for differentiation into the blastocyst. Other molecules that stimulate proliferation also can increase the propo rtion of embryos that develop to the blastocyst stage [225 226] Another possible way to control cell number, a reduction in apoptosis, does not seem to be major mechanism for the pro developmental effects of IGF1 b ecause inhibition of the PI3K pathway, which mediates the effects of IGF1 on apoptosis [3] did not prevent the ability of IGF1 to increase blastocyst development. There was, however, a reduction in the proportion of embryos that became blastocysts caused by addition of LY294002, indicating the importance of this signaling pathway for embryonic development. There was evidence in the present study that IGF1 increases development to the blastocyst stage, at least in part, by regulating expression of genes involved in compaction and blastocoel formation. Compaction occurs on day 5 post insemination at the 32 cell [238, 242] and blastocoel formation occurs beginning at day 6 7 post insemination [243 244] The proces s of compaction, which is necessary for subsequent development of the blastocyst, involves formation of junctional complexes involving CDH1 and OCLN [83] There was no effect of IGF1 on steady state mRNA content of OCLN at day 6 post insemination, but IGF1 decreased expression of CDH1 The decrease in CDH1 expression could represent a transient decrease in this adhesion molecule in preparation for blastocoel formation. By the blastocyst stage, Block et al. [183] found that IGF1 did not affect expression of CD H1 There was a tendency for IGF1 to increase expression of ATP1A1 at day 6 post insemination, a time before most

PAGE 50

50 embryos in our culture system have a visible blastocoele. Block et al. [183] also observed a tendency for IGF1 to increase ATP1A1 transcript abundance in day 7 blastocysts. Na+/K+ ATPase activity is involved in active transport of ions across the TE to form the fluid filled blastocoelic cavity [81, 83] It is not k nown whether effects of IGF1 on molecular events leading to blastocoel formation occur because of increased proliferation mediated by the MAPK pathway or whether regulation of these genes is independent of changes in the rate of cell proliferation. There was no effect of IGF1 on the abundance of transcripts for the trophoblast marker, CDX2 [245] This result suggests that IGF1 is not involved in differentiation of the TE and is consistent with the observation that IGF1 did not alter the TE:ICM ratio [183] It is also possible that IGF1 promotes development to the blastocyst stage by regulating energy metabolism. There is an increase in oxygen consumption and glucose uptake a t compaction and a larger increase at the blastocyst stage [246] One action of IGF1 is increased transport of glucose [215] In another study, however, IGF1 did not affect expression of the glucose tran sporters SLC2A1 SLC2A3 or SLC2A8 in bovine blastocysts [183] In conclusion, IGF1 promotes development to the blastocyst stage by regulating MAPK dependent events at day 4 or later. Among the actions likely to be important for the pro developmental actions of IGF1 at this time are an increase in proliferation and promotion of blastocoel formation through regulation of expression of ATP1A1

PAGE 51

51 Table 2 1. Primer sets for qPCR Gene A ccession Prime Sequence Length T m CDX2 XM_871005 Forward Reverse GCCACCATGTACGTGAGCTAC ACATGGTATCCGCCGTAGTC 140 57.9C CDH1 AY_508164 Forward Reverse TGACTGTGATGGGATCGTCAGCAA ACATTGTCCCGGGTGTCATCTTCT 198 59.9C ATP1A1 NM_001076798 Forward Reverse CCCTGAATGGGTCAAGTTCT AGGAGAAACACCCGGTTAT G 185 59.0C OCLN NM_001082433 Forward Reverse TCAACTGGGCTGAACACTCCAACT AAGACCTGATTGCCCAGGATGTCA 149 60.3C Hist2h2aa2 U62674 Forward Reverse GTCGTGGCAAGCAAGGAG GATCTCGGCCGTTAGGTACTC 182 56.6C

PAGE 52

52 Figure 2 1. Conc entration dependent effects of IGF1 on the percent of oocytes that cleaved (Panel A) and that became blastocysts at day 7 (Panel B) and day 8 (Panel C) post insemination. Concentration of IGF1 did not affect cleavage rate (p>0.05). IGF1 increased the perce nt of oocytes becoming a blastocyst at day 7and day 8 compared to control (p<0.05 and p=0.05 respectively). At day 7 there was no statistical difference between 10, 100 and 200 ng/ml, and at day 8 the percent of oocytes that became a blastocyst was higher for 100 ng/ml (P<0.05) than for 10 or 200 ng/ml. Data are least squares means SEM of results from 4 replicates involving 231 to 284 oocytes per group.

PAGE 53

53 Figure 2 2. Improvement in blastocyst development when IGF1 is added from day 4 8 of culture but not statistical different from controls when added from day 0 4. Data are least squares means SEM and represent the percent of oocytes that cleaved (Panel A) and that became blastocysts at day 7 (Panel B) and day 8 (Pane l C) post insemination. Embryos were either cultured without IGF1, IGF1 from day 0 8 post insemination, day 0 4 post insemination or day 4 8 post insemination. The main effect of treatment was significant for results at day 7 (p<0.05) and 8 (p<0.01) and di fferences between individual means (p<0.05) are indicated by different superscripts above each bar. Data are least squares means SEM of results from 5 replicates involving 332 to 356 oocytes per group.

PAGE 54

54 Figure 2 3 Representative images of day 8 embr yos when IGF1 was used in different days of culture. Panel A, control group without IGF1; Panel B, IGF1 was added from day 0 4 of culture; Panel C IGF1 was added from day 4 8 of culture and Panel D, IGF1 was added from day 0 8 of culture.

PAGE 55

55 Figure 2 4 Effect of the MAPK inhibitor PD 98059 and the PI3K inhibitor LY294002 on actions of IGF1 to increase the percent of blastocysts at day 7 and day 8 post insemination. Black circles represent absence of inhibitor, and ope n circles represent the presence of inhibitor. For MAPK inhibitor PD 98059 development at both day 7 and 8 was affected by inhibitor x IGF1 interactions (P<0.05). For the PI3K inhibitor LY 294 002 experiment, the inhibitor reduced the percent of oocytes t hat were blastocysts at day 7 and 8 post insemination ( P <0.05) with or without IGF1 and IGF1 tended to increase blastocyst development in the absence and presence of LY 294 002 at day 7 (P=0.09) and day 8 (P =0.08).

PAGE 56

56 Figure 2 5 Effects of IGF1 on expression of genes involved in compaction and blastocoel formation. Control group is represented by the black bars and the IGF1 treated group is represented by the white bars. IGF1 decreased the steady state expression of CD H1 (p<0.05) and there as a tendency of IGF1 to increase steady state expression of ATP1A1 on day 6 embryos (P=0.07).

PAGE 57

57 CHAPTER 3 DEVEL O PMENTAL CHANGES IN T HERMOPROTECTIVE ACTI ON S OF INSULIN LIKE GROWTH FACTOR 1 ON PREIMPLANTATION B OVINE EMBRYO S I ntroducti on Adverse effects of elevated temperature (i.e., heat shock) on development of the preimplantation embryo are one of the causes of reduced fertility during heat stress [14, 204] Resistance of the preimplantation b ovine embryo to heat shock can be modified by genetic, developmental and micro environmental inputs. For example Bos indicus embryos are more resistant to heat shock than B. taurus embryos [247 250] The embryo also acquires resistance to elevated temperature during development. Thus, exposure of cows to heat stress on day 1 after estrus reduced embryonic development to the blastocyst stage but heat stress at days 3, 5 and 7 had no effect [194] Similarly, exposure to elevated temperature in vitro caused a greater reduction in development for two cell embryos than f [36, 197, 204] Among the microenvironmental inputs affecting embryonic resistance to heat stress is the growth factor IGF1. Treatment of embryos with IGF1 reduces the ma gnitude of effects of heat shock on development and apoptosis at day 5 of development [1, 3] Moreover, treatment with IGF1 in vitro enhances survival rates of blastocysts transferred into heat stressed recipients [35] Circulating IGF1 is synthesized and secreted primarily by the liver [251] although it is also expressed in several reproductive tissues including, in the cow, ovary, oviduct, uterus and embryo [26, 28 29] Secretion by liver is incre ased by growth hormone [251] Interestingly, however, injection of recombinant growth hormone into lactating cows exposed to heat stress did not increase fer tility even though circulating concentrations of IGF1 were increased [2, 222] One possible explanation is that, although IGF1 can

PAGE 58

58 protect more advanced embryos from effects of heat stress [11 13], it cannot block e ffects of heat stress on the oocyte or early embryo. Not only are early cleavage stage embryos maximally sensitive to elevated temperature [36, 197 198, 204] but lack of activation of the embryonic genome [49] may limit cellular responses to IGF1. The present study had two objectives. The first was to determine whether the thermoprotective actions of IGF1 on the preimplantation bovine embryo were develop mentally regulated so that the two cell embryo was refractory to IGF1. The second was to determine the molecular b asis for the improved competence of embryos treated with IGF1 to establish pregnancy after transfer to heat stressed recipients [35] Since this beneficial effect of IGF1 has not been observed when embryos were transferred to recipients not exposed to heat stress [35] it was hypothesized that IGF1 would enhance genes involved in cytoprotection and inhibit genes that would exacerbate effects of heat shock on the embryo M aterials and Methods Embryo Culture Media and Additives Unless otherwise ment ioned, reagents were purchased from Sigma Aldrich (St. Louis, MO, USA) or Fisher Scientific (Pittsburgh, PA). HEPES Tyrodes Lactate (TL) and IVF TL solutions were purchased from Caisson Laboratories (Sugar City, ID). These media were used to prepare HEPES Tyrodes Albumin Lactate Pyruvate (HEPES TALP), and IVF TALP as previously described [23 2] Oocyte collection medium was TCM 199 with 2% (v/v) bovine steer serum (Pel Freez, Rogers, AR) containing 2 U/ml heparin, 100 U/ml penicillin G, 0.1 mg/ml streptomycin, and 1 mM g lutamine. Oocyte maturation medium was TCM 199 (Gibco, Grand Island,

PAGE 59

59 10% (v/v) bovine steer serum, 2 g/ml estradiol 17 hormone (Folltropin V; Bioniche, Belleview, Ontario, Canada 22 g/ml sodium pyruvate, 50 g/ml gentamicin sulfate, and 1 mM glutamine. Percoll was from GE Healthcare (Uppsala, Sweden). Frozen semen from various bulls was donated by Southeastern Semen Services (Wellborn, FL). The embryo culture medium was Potassium Simplex Optimized Medium (KSOM) that contained 1 mg/ml bovine serum albumin and was obtained from Caisson. On the day of use, KSOM was modified to produce KSOM BE2 (KSOM bovine embryo 2) as described previously [252] Recombinant human IGF1 was purchased from Sigma Aldrich. A vial containi ng 50 g of lyophilized IGF1 was rehydrated with 200 ml of water. This stock solution was then stored at 20C in 5 l aliquots until use, when a single aliquot of IGF1 was diluted with KSOM BE2 to a final concentration of 100 ng/ml In vitro Production o f Embryos Embryo production was performed as previously described [1, 3] using in vitro maturation of oocytes and in vitro fertilization. Immature COCs were collected from ovaries obtained from Central Packing Co. ( Center Hill, FL, USA). Harvested COCs were washed in oocyte collection medium and allowed to mature for 20 22 h r in groups of 10 in 50 l drops of oocyte maturation medium overlaid with mineral oil and at 38.5C in an atmosphere of 5% (v/v) CO 2 in humidifi ed air. Matured COCs were then washed in HEPES TALP and transferred to a 35 mm petri dish containing 1700 l of IVF TALP supplemented with 80 l PHE (0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 M epinephrine in 0.9% [w/v] NaCl), and fertilized with 120 l Percoll purified spermatozoa (~ 1x10 6 sperm cells). To eliminate bull effects, a pool of frozen thawed semen from three different bulls were used for each replicate; a separate pool was used for each

PAGE 60

60 replicate. After 6 to 10 h r of fertilization, put ative zygotes were removed from fertilization wells, denuded of cumulus cells by vortexing in HEPES TALP and hyaluronidase (10,000 U/ml in 600 l HEPES TALP medium) for 4 min, washed in HEPES TALP, and placed in groups of 30 in 50 l drops of KSOM BE2 over laid with mineral oil. For most of the culture period, embryos were cultured at 38.5C in a humidified atmosphere of 5% O 2 and 5% CO 2 (v/v) with the balance nitrogen. During the heat shock period, both control and heat shocked embryos were placed in an atm osphere of 5% (v/v) CO 2 in humidified air. This atmosphere, which contains a higher oxygen content (21%) was used during heat shock because high oxygen tension exacerbates the deleterious effect of temperature on embryonic development to the blastocyst sta ge [253] Protective E ffect of IGF1 on H eat S hocked E mbryos at 41C Two cell embryos were selected at 28 30 hr post insemination. Embryos with > 16 cells were selected at day 5. Embryo s were randomly transferred to a fresh drop of KSOM BE2 containing 100 ng/ml IGF1 (treated group) or KSOM BE2 only (control group) and then assigned randomly to temperature treatment. After 1 hr of preincubation with or without IGF1, embryos received one o f two thermal treatments in an atmosphere of 5% CO 2 in air as follows: 38.5C for 24 hr or 41C for 15 hr and 38.5C for 9 hr. Embryos were then washed 3 times in KSOM BE2 drops to remove IGF1, placed in fresh drops of KSOM BE2 and cultured in an atmospher e of 5% O 2 until day 8 post insemination at 38.5C when development to the blastocyst stage was assessed. The experiment with two cell embryos was replicated 11 times using 169 to 174 embryos per group and the experiment for day 5 embryos was replicated 15 times using 193 to 201 embryos per group

PAGE 61

61 Protective Effect of IGF1 on D ay 5 E mbryos E xposed to H eat S hock at 42C Another experiment was performed where day 5 embryos were exposed to a more severe heat shock of 42C. Day 5 embryos with at least 16 cells were selected and randomly transferred to a fresh drop of KSOM BE2 + 100 ng/ml IGF1 (treated group) or KSOM BE2 only (control group), and then assigned randomly to treatment. After 1 hr of pre incubation with or without IGF1, embryos received thermal treat ments in 5% CO 2 in humidified air as follows: 38.5C for 24 hr o r 42C for 15 hr and 38.5C for 9 hr. Embryos were then washed 3 times in KSOM BE2 drops to remove IGF1, placed in fresh drops of KSOM BE2 and cultured in 5% O 2 at 38.5C until day 8 post inse mination when development to the blastocyst stage was assessed. The experiment was repeated 4 times using 59 60 embryos per group. Developmental Changes in Expression of G enes Involved in IGF1 Signaling In one experiment, embryos were cultured in 50 l dro ps of KSOM. BE2 in 5% O 2 Two cell embryos were selected at 28 30 h r post were selected from separate wells at day 5 post insemination. Selected embryos were washed in UltraspecTM RNase free water (Biotecx Houston, TX, USA) and stored at 80C until RNA extraction. For each stage of de velopment, total RNA was extracted from five groups of 20 embryos each using Arcturus PicoPure RNA Isolation Kit (MDS, RNA was frozen at 80C. Quantitative PCR was perf ormed by Mogene, LLC (Saint Louis, MO, USA). RNA was quantified using the Ribogreen RNA quantification Kit (Invitrogen, Carlsbad, CA, USA) and then subjected to quantitative real time RT PCR (qPCR) using the TaqMan RNA to Step Kit (Applied Biosystems, Foster City, CA, USA) in 25 l reactions. In the first step, cDNA is generated and in the second the

PAGE 62

62 cDNA is quantitated using the TaqMan Gene Expression Master Mix. The thermal cycles for qPCR was 50C for 2 min, 95C for 10 min followed by 40 cycles of 95C of 15 sec and 60C for 1 min. The q PCR reactions were performed and fluorescence quantified with the ABI 7900HT system (Applied Biosystems, Foster City, CA, USA). The genes included IGF1R, RAF1, MAPK and GAPDH, with the last gene serving as an endogenous control (housekeeping gene) ( Table 3 1 ). Each q PCR was run in triplicate. For a second experiment, genes of interest included IGF1R, PI3K, HK2 and Hist2h2aa2 a housekeeping gene. Embryos were produced as described above and 7 groups of 25 two cell embryos and 7 groups of 25 day 5 embryos were selected. RNA was extracted using Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA, USA) en at 80C and sent to the University of Missouri for qPCR. Primer sets for genes were designed by the public domain primer design software Primer3 http://www.bioinformatics.nl/cgi bin/primer3plus/primer3plus.cgi). The primers were chosen based on the pub lished sequences of the bovine genome and the primers used had a product size of 150 to 300 bp in length ( Table 3 2 ). cDNA was generated using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Reverse transcribed cDNA was subject to real time PCR amplification using 25 l master mix reactions consisting of 12.5 l of SYBRGreen (Applied Biosystems, Foster City, CA, USA), 5 l (1 M) of the primers (2.5 l forward and 2.5 l reverse), 5 l o f diethylpyrocarbonate treated (DEPC) water and 2.5 L of cDNA sample (1 ng/ l). The PCR reactions were performed and fluorescence quantified with the ABI 7 3 00 Applied Biosystems system (Applied Biosystems, Foster City, CA, USA). The thermal cycles for re al time PCR was

PAGE 63

63 50C for 2 min and 95C for 10 min followed by 40 cycles of 95C of 15 sec and 60C for 1 min. Each PCR was run in duplicate. For both experiments, responses were quantified using the C T method, and the T method was used to determine fold change Immunofluorescent A nalysi s of Insulin like Growth Factor 1 Receptor (IGF1R) This experiment was designed to evaluate the presence of IGF1R in two cell and day 5 embryos. Two cell embryos were selected at 28 32 hr post insemination and cells were selected on day 5 post insemination. Embryos were fixed in 4% (v/v) paraformaldehyde in 10 mM KPO 4 pH 7.4 containing 0.9% (w/v ) NaCl (PBS) and 1 mg/ml polyvinylpyrrolidone (PVP) for 15 min at room temperat ure. A fter fixation, embryos were washed in PBS PVP and stored in PBS PVP at 4C until immunofluorescent analysis within 3 days of fixation. Fixed embryos were permeabilized with 0.25% (v/v) Triton X in PBS for 10 min at room temperature and then washed t hree times in Tris buffered saline [TBS (10 mM Tris, pH 7.2, 0.9% (w/v) NaCl)] containing 0.1% (v/v) of Tween 20 (TBST). Embryos were blocked for 1 hr in PBS containing 20% (v/v) normal goat serum (Pel Freez Biologicals, Roger, AR, USA) at room temperature and then washed two times in TBST. Afterwards, embryos were incubated overnight with the primary protein G purified rabbit polyclonal antibody to IGF1R (Abcam, Cambridge, MA, USA) at a concentration of 2 5 g/ml in TBST BSA [TB ST containing 0.1% (w/v) bo vine serum albumin]. The negative control group was incubated with rabbit IgG ( 2 g/ml, Sigma Aldrich). After incubation, embryos were washed in TBST 3 times for 5 min each and incubated for 1 hr in the dark with 2 mg/ml anti rabbit IgG F(ab') 2 fragment la beled with Alexa Fluor 555 (Cell Signaling, Danvers, MA, USA) diluted 1:1000 in TBST BSA. Embryos were washed 3

PAGE 64

64 diamidino 2 phenylindole (DAPI) in TBST BSA for 15 min. Em bryos were rinsed in PBS PVP and placed in approximately 100 l drops of PBS PVP on a FluoroDish (World Precision Instruments, Inc, Sarasota, FL, USA) for analysis. Embryos images were extracted and examined with a laser confocal scanning microscope (Leica TCS SP5, Bannockburn, IL, USA) Seven consecutive section were merged and the merged image was subjected to image analysis using ImageJ 1.43t software (National Institute of Health, Bethesda, MA, USA). Pixel intensity of membrane assocaited immunofluores cence was analyzed and a threshold was chosen to designate the area of the picture to be analyzed (plasma membrane) while excluding lower intensity staining in the cytoplasm. Pixel intensity in the selected areas was measured and a mean gray value calculat ed. A total of 5 two cell and 5 day 5 embryos were analyzed Microarray Hybridization Embryos were cultured in KSOM BE2 100 ng/ml IGF1 in a 5% O 2 atmosphere. At day 7, grade 1 blastocysts [254] were selected. A total of four pools of 30 control blastocysts and four pools of 30 IGF1 t reated blastocysts were produced. RNA was extracted using RNeasy Micro kit (Qiagen Inc, Valencia, CA, USA). Samples were frozen at 80C and sent to Mogene LLC (St. Louis, MO, USA), an Agilent Certified Service Provider, for microarray analysis using the A gilent bovine gene expression microarray 4x44k (AMIDID 023647, Agilent Technologies, Santa Clara CA, USA). The array contains 43,803 bovine probes represented and the probes were developed by clustering more than 450,000 mRNA and EST sequences of the bovin e genome (btau 4.0).

PAGE 65

65 Concentration of total RNA was determined using the Nanodrop 1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and integrity determined by Agilent 2100 Bioanalyzer RNA 6000 Pico LabChip kit (Agilent Technologies, Santa Clar a CA, USA). A representative analysis is shown in figure 3 1 T he remainder of the RNA was amplified using Agilent Quick Amp.labeling Kit. Only those amplification reactions yielding amplified RNA of consistent size range and q uantity across samples were utilized in subsequent microarray experiments. A total of 1.2 g of the amplified material was labeled using the ULS aRNA fluorescent Labeling Kit (Kreatech Biotechnology, LG, Amsterdam). The hybridizations were setup so that, f or two pairs of samples, RNA from the control embryos were labeled with Cy3 and RNA from IGF1 treated embryos were labeled with Cy5, whereas for the other two pairs, RNA from control embryos were labeled with Cy5 and RNA from the IGF1 group were labeled wi th Cy3. Arrays were hybridized for 17 hr at 65C and 10 rpm. Arrays were washed following procedures described in the Agilent Gene Expression manual and were scanned at 5 m on an Agilent C Scanner (Agilent Technologies, Santa Clara CA, USA). Hybridizatio ns were prepared using 1.65 g of sample (825 ng per dye assignment) per array. Prior to hybridization, sample combinations (47.8 l including 10x Blocking Agent) were fragmented with 2.2 l of Agilent 25x Fragmentation Buffer ( Agilent Technologies Santa Clara CA, USA ) at 60C for 30 minutes. After fragmentation, 5 l of Kreablock was added to each tube followed by 55 l of Agilent 2x Hi rpm Hybridization Buffer. This mixture was applied to an Agilent bovine gene

PAGE 66

66 expression microarray 4x44k (AMIDID 015354, Agilent Technologies, Santa Clara CA, USA). Microarray D ata A nalysis The microarray image extraction and data pre processing were performed using USA). The intensity of ea ch spot was summarized as the median pixel intensity, and then the generated values were transformed to log. The lowess method was used to normalize intensity within each array. Microarray data were analyzed using the JMP Genomics 4 for SAS 9.1.3 softwar e (SAS Inst., Inc., Cary, NC). The quantile normalization method was performed for the data global normalization and least squares analysis of variance conducted using the PROC ANOVA procedure of JMP Genomics 4 for SAS 9.1.3 to identify differentially re gulated genes. The model included replicate and treatment. Replicate (array) was considered random and treatment was considered fixed. Correction for false discovery rate was performed by the Benjamini and Hochberg method [255] with a maximum false discovery rate of 0.01. P values were adjusted to a false discovery rate of 0.01 and genes with a fold change of qPCR Validation of the microarray data was conducted by performing qPCR on three genes that were upregulated by IGF1 ( NFATC3, PPIP5K2, TGFB2 ), three genes do wnregulated by IGF1 ( RAD23A, H1FOO, FADS6 ) and on GAPDH which was used as a housekeeping gene. Primer sets for genes were designed by the public domain primer design software Primer3 (http://www.bioinformatics.nl/cgi bin/primer3plus/primer3plus.cgi) ( Table 3 3 ). To confirm primer specificity, amplicon

PAGE 67

67 size was determined by agarose gel electrophoresis and amplicons were sequenced at the Genetic Analysis Core Laboratory of the Interdisciplinary Center for Biotechnology Research University of Florida. cDNA was generated using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) and cDNA concentration dependent amplification was validated by making standard curves for all genes using serial 5 fold di lutions using CT1 cells (trophectoderm cells). Reverse transcribed cDNA was subjected to qPCR amplification using SyberGreen a 10 l reaction consisting of 1 l of cDNA sample (20 ng/ l), 5 l of SYBR Green (Applied Biosystems), 1 l of 1 M primers (forw ard and reverse) and 2 l of DEPC water. qPCR was performed using a Bio Rad C100 thermal cycler CFX96 Real Time system (Bio Rad, Hercules, CA, USA). Due to differences in primer annealing temperature, the thermal cycle for four of the genes tested ( RAD23A PPIP5K2, NFATC3, TGFB2 ) was performed as follows: 50C for 2 min and 95C for 10 min followed by 50 cycles of 95C of 15 sec and 60C for 1 min. The thermal cycle for the other two genes ( FADS6 and H1FOO ) was 50C for 2 min and 95C for 10 min followed b y 50 cycles of 95C of 15 sec, 55C for 30 sec and 74C for 30 sec Statistical A nalysis Data on development and immunocytochemistry (pixel intensity) were analyzed by least squares analysis of variance (ANOVA) using the Proc GLM procedure of the Statisti cal Analysis System (SAS for Windows, Version 9.2, Cary, NC). Data on the percent of oocyte that cleaved and became blastocyst were transformed by arcsin transformation before analysis. The mathematical model included main effects of replicate, temperature and IGF1 treatment and all interactions. Replicate was considered random and other main effects were considered fixed. Probability values

PAGE 68

68 were based on analysis of arcsin transformed data while least squares means are from analysis of untransformed data. Pixel intensity data w ere analyzed with embryo as the experimental unit and stage of development at the dependent variable. For data from qPCR experiments, All C T respo nses from genes of interest were T T for T of IGF1 from the control in the same replicate Fold change was determined by solving for 2 T relative to the controls. Treatment effects were analyzed by the median scores procedure of SAS (SAS for Windows, Version 9.0, Cary, NC, USA R esults Thermoprotective Actions of IGF1 on Two cell and D ay 5 E mbryos The first experiment to evaluate whether the thermoprotective effect of IGF1 on bovine embryos was developmentally regulated used a heat shock of 41C for 15 hr. For two cell embryos, heat shock reduced the percent of embryos that became blastocysts at day 8 (P<0.005). IGF1 did not protect two c ell embryos from heat shock as indicated by a lack of effect of IGF1 or the IGF1 x heat shock interaction ( Figure 3 2 A). For day 5 embryos, which are known to be more resistant to heat shock than two cell embryos, culture at 41 C heat shock did not reduce the percent of embryos that became a blastocyst and there was no effect of IGF1 or IGF1 x heat shock ( Figure 3 2 B). Given the resistance of day 5 embryos to a heat shock of 41C, another experiment was performed where day 5 embryos were exposed to a more severe heat shock of 42C for 15 hr. The percent of embryos that became blastocysts was reduced by heat shock (P<0.001) and increased by IGF1 (P=0.05) ( Figure 3 3 ). Even though

PAGE 69

69 there was no interaction, the increase in development caused by IGF1 was greater for embryos at 42C than for embryos at 38.5C. Thus, IGF1 reduced the effects of 42C on development. Gene E xpression of M olecules I nvolved in IGF1 S ignaling In the first experiment, expression of IGF1R, RAF1 and MAPK were higher in two cell embry os compared to day 5 embryos (P< 0.001; Figure 3 4 A). In the second experiment ( Figure 3 4 B), there was again a tren d for IGF1R mRNA to be higher at the two cell stage but the difference was not significant. Another gene, PI3K, had higher expr ession at the two cell stage (P< 0.001), while a third gene, HK2, was expressed mor e highly for day 5 embryos (P< 0.001). Presence of IGF1R in Two cell and Day 5 E mbryos Immunofluorescent labeling was performed to detect the presence of IGF1R in two cell and day 5 embryos. Immunoreactive IGF1R was localized to the plasma membrane at both stages of development ( Figure 3 5 A). Intensity of staining was quantified and there was no difference (P>0.05) in the amount of immunoreactive IGF1R between the two stages of development ( Figure 3 5 B ) Effect of IGF1 on Gene Expression in Blast ocysts Using the criteria of a minimum 1.5 fold diffe genes were differentially expressed between IGF1 and control embryos. A total of 72 genes were annotated, with 40 gene s upregulated by IGF1 ( Table 3 4 ) and 32 genes downregulated by IGF1 ( Table 3 5 ). The differentially expressed genes were used to query the DAVID bioinformatics database (http://david.abcc.ncifcrf.gov) to identify biological process ontologies in which genes are represented. When ontologies containing only one or two differentially

PAGE 70

70 expressed genes or organ specific ontologies were removed, there were a total of 10 ontology terms in which differentially expressed genes were represented ( Table 3 6 ). Six of these terms were related to developmental processes: embryonic development, embryonic morphogenesis, anatomical structure morphogenesis, anatomical structure development, cell development, and cellular component morpho genesis. The set of developmental genes in the ontologies included 7 upregulated by IGF1 (in order of fold change; ODZ4, SLC40A1, ANXA2, NFATC3, TGFB, BMP7 and DYRK3 ) and 9 downregulated by IGF1 ( CNTNAP, NRG2, DPYSL4, ALDH1A2, FBN2, TNFRSF11A, NODAL, MMP13 and NEURL ). In addition to the genes involved in developmental processes identified by DAVID, other genes involved in development were differentially regulated. Genes upregulated by IGF1 were CAB39 and SRPX2 while genes downregulated by IGF1 were GFAP, P ARD3B, NT5E, CBX1, KREMEN, IFITM3, and ARHGEF10L. Other biological process ontologies in DAVID containing more than two differentially regulated genes were as follows: the transmembrane receptor protein serine/threonine kinase signaling pathway, for which three genes were upregulated by IGF1 ( FNTA, BMP7, and TGFB2); the positive regulation of cell proliferation ontology, with three upregulated genes ( IL6ST, FNTA, and TGFB2 ) and three downregulated genes ( ALDH1A2, TNFRSF11A, and NODAL ); cellular responses t o cell signaling: response to steroid hormone stimulus; and response to external stimulus. Included in these last two ontologies were four upregulated genes ( IL6ST, NFATC3, TGFB2 and BMP7 ) and 5 downregulated genes ( ALDH1A2, MMP15, MST1 MMP13, and NEURL).

PAGE 71

71 Further analysis of the set of differentially regulated genes was performed to test the hypothesis that IGF1 increases genes involved in cytoprotection. To this end, the list of differentially expressed genes was evaluated for the presence of heat shock p rotein genes as well as genes involved in DNA repair, protection from reactive oxygen species and apoptosis. No members of the heat shock protein family were differentially regulated and only one DNA repair gene ( RAD23A ) was affected by IGF1. There were, h owever, two genes involved in protection from oxidative stress that were upregulated by IGF1 ( COQ9 and GSTM2) and one such gene downregulated (MST1). A total of 5 anti apoptotic genes were upregulated by IGF1 (IL6ST, EIF3A, NFATC3, DYRK3, and ANP32B) and 5 pro apoptotic genes were downregulated by IGF1 ( DPYSL4, MST1, TNFRSF11A NODAL and ARHGEF10L ). In addition IGF1 also upregulated two pro apoptotic genes ( IER3IP1, and RNASEL ) and downregulated one anti apoptotic gene ( NT5E ). There were a group of 5 ant iviral genes that were differentially regulated including three genes increased by IGF1 ( MAN2A2, CPSF3, and RNASEL ) and two genes inhibited by IGF1 ( MON1B and IFITM3 ). The data base was also queried to determine whether genes reported to be regulated by IG F1 in bovine blastocysts using PCR [183] were regulated by IGF1 in the present study. However, none of the genes, which were ATP1A1, BAX, DSC2, HSPA1A, IGFBP3, and IGF1R, were differentially regulated Validation of Microarray D ata by qPCR Results of microarray analysis were confirmed for four of six genes analyzed by qPCR ( Figure 3 6 ). In particular, NFATC3, PPIP5K2 and TGFB2, which were upregulated by IGF1 as determined by microarray a nalysis, were also higher in the

PAGE 72

72 IGF1 group by qPCR (P<0.05). Also, FADS6, which was downregulated by IGF1 in the microarray analysis, was lower in the IGF1 group by qPCR (P<0.05). Another two genes that were downregulated by IGF1 as determined by microarr ay analysis were not downregulated as determined by qPCR. One gene ( RAD23A) was upregulated as determined by qPCR (P<0.05) while the other ( H1FOO ), was not different between control and IGF1 although the magnitude of difference between IGF1 and control was in the opposite direction than for the microarray results Discussion In addition to increasing competence to develop to the blastocyst stage [31, 34] IGF1 acts as a survival factor in the preimplantation embryo to protect against elevated temperature [1, 3] oxidative stress [210, 212] [256] campothecin and actinomycin D [211] Results from the present study demonstrate that thermoprotective actions of IGF1 are developmentally regulated because IGF1 diminished the effects of heat shock on developmen had no thermoprotective effect for two cell embryos exposed to heat shock. Moreover, the failure of IGF1 to protect two cell embryos is probably not because signaling molecules required for IGF actions are depleted. Indee d, IGF1R mRNA was higher for two cell embryos than for day 5 embryos and the amount of immunoreactive IGF1R was similar for two cell and day 5 embryos. Similarly, mRNA for three key molecules in the IGF1 signaling cascade, RAF1, MAPK, and PI3K [150] were higher for two cell embryos. Reduction in transcript abundance from the two cell stage to morula stage is a very common pattern in the bovine embryo [107, 257] probably because of degradation of maternally derived mRNA and because transcription is inhibited until the 8 16 cell stage [49] The one gene whose transcript abundance increase d from the two cell stage

PAGE 73

73 to day 5 was HK2 A similar change in hexokinase mRNA from the two cell to morula stage was seen earlier using non quantitative RT PCR [258] This increase probably reflects the increased u tilization of glucose associated with compaction [259] There ar e two other possible reasons why IGF1 failed to increase resistance of two cell embryos to heat shock. One possibility is that the block to transcription in the two cell embryo prevents changes in gene expression required for thermotolerance. A second poss ibility is that the damage to the two cell embryo caused by heat shock is too great for IGF1 to counter. As shown in this study and others [36, 197 198] the two cell embryo is more susceptible to heat shock than da y 5 embryos. In the present study, cell embryos while having no effect on development of day 5 embryos. The reason for increased susceptibility of the two cell embryo to heat shock is not known but could involve transcriptional silencing [49] incre ased production of free radicals in response to heat shock [198] and decreased amounts of the intracellular antioxidant glutathione [260] One of the characteristics of the bovine embryo produced in vitro in the presence of IGF1 is increased potential for survival after transfer into recipients, but only when those recipients are exposed to heat stress [35, 261] Thus, IGF1 changes some aspect of embryo function (gene expression, epigenetic regulation, etc.) that, through interactions with heat stress induced change s in maternal function, enhances embryo survival. Microarray analysis was performed to identify genes or gene clusters that might be involved in this effect of IGF1. In general, the pattern of gene expression was largely similar between control and IGF1 tr eated blastocysts. Only a small number of differentially expressed genes were identified and the change in transcript abundance

PAGE 74

74 caused by IGF1 was most typically between 1.5 and 2.0 fold. None of a set of 6 genes whose expression was increased in IGF1 trea ted blastocysts [183] was identified as being regulated by IGF1 in the present experiment. It is possible that the microarray analysis underestimated the genes regulated by IGF1 or that only a few changes are involv ed in the post transfer consequences of treatment with IGF1. Among the genes whose expression changed in response to IGF1 were several involved in apoptosis and protection from reactive oxygen species. Regulation of these genes could conceivably increase post transfer survival in heat stressed recipients by protecting the embryo from effects of maternal hyperthermia. Of the 5 anti apoptotic genes upregulated by IGF1, three are involved in cell signaling. In particular, IL6ST is part of the IL6 receptor com plex that inhibits apoptosis through phosphorylation of STAT [262] DYRK3 is a kinase that phosphory lates and activates the anti apoptotic protein SIRT1 [263] and NFATC3 is a transcription factor that increases production of BCL2 [264] ANP32 is a substrate of caspase 3 that limits apoptosis [265] presumably by competing with other substrates for the enzyme. EIF3A is a translation initiation factor whose ove rexpression can inhibit apoptosis in cancer cells [266] Five pro apoptotic genes were also downregulated by IGF1. DPYSL4 is one of the mediators of p53 induced apoptosis [267] MST1 is a Sterile20 like kinase that promotes apoptosis through several pathways [268] TNFRSF11A, also called RANK, is a ligand for the pro apoptotic TNF family member RANK [269] NODAL is a pro apoptotic member of the TGFB family [270] and ARHGEF10L is a member of the RhoGEF family of guanine nucleotide exchange factors (GEFs) that activate Rho GTPases which in turn can activate apoptosis [271] It is true that IGF1 also increased expression of two pro

PAGE 75

75 apoptotic genes ( IER3 IP1, and RNASEL ) and downregulated one anti apoptotic gene ( NT5E ). However, the anti apoptotic effect of IGF1 on the preimplantation bovine embryo has been demonstrated directly through studies evaluating induction of apoptosis by heat shock [1, 3] and menadione [212] Effects of heat shock on development involve reactive oxygen species; heat shock increases production of reactive oxygen species and addition of certain antioxidants can reduce the effects of heat shock [198, 202] Thus, the increase in expression of two genes involved in protection from reactive oxygen species could facilitate survival afte r heat shock. One of the antioxidant genes was GSTM2 which utilizes glutathione to reduce electrophilic molecules [272] In addition, GSTM2 can serve as a prostaglandin E synthase [273] The other gene upregulated by IGF1 was COQ9, an endogenous lipophilic antioxidant [274 275] T reatment with IGF1 also decreased expression of MST1. Whi le this kinase is involved in blocking free radical generation caused by FOXO regulation of superoxide dismutase and catalase [276] it is also pro apoptotic [277 278] so inh ibition of its expression could contribute to embryo survival. It is probably unlikely that the actions of IGF1 to improve embryonic survival during heat stress are simply the result of increasing embryonic resistance to maternal heat stress. Indeed, the embryo is substantially resistant to maternal hyperthermia by the blastocyst stage [36, 194, 197 198] and embryo transfer can minimize the seasonal variation in fertility in lactating dairy cows [14] Moreover treatment of embryos with IGF1 increases pregnancy rate in heat stressed embryo transfer recipients to a value higher than that seen in embryo transfer recipients not exposed to heat stress [35] One interpretation of this observation is that increased survival after transfer is to do a

PAGE 76

76 combination of changes in embryonic function caused by IGF1 treatment and the maternal mi croenvironment established by heat stress. A large number of genes involved in developmental processes were affected by IGF1 (9 upregulated genes and 16 downregulated genes) and some of these genes could be important for embryonic survival in association w ith other changes in embryonic function caused by maternal hyperthermia. One process that IGF1 may be regulating is neurulation. The default fate of embryonic ectoderm is neural tissue and this process is inhibited early in development by BMP4 [279] Several genes involved in neural function or differentiation were inhibited by IGF1 including CNTNAP2 a member of the neurexin fam ily of receptors and cell adhesion molecules involved in synapse formation [280] GFAP a glial intermediate filament protein [281] DPYSL4 a member of a family of cytosolic phosphoproteins involved in brain development [282] ALDH1A2 which catalyzes formation of retinoic acid [283] which in turn promotes neural crest cell formation from embryonic stem cells [284] KREMEN, a receptor for Dickkopf 1 that promotes embry onic stem cell differentiation towards neuroectoderm [285] ARHGEF10L, an activator of Rho GTPases that participate in neural tube closure [286] and NRG2 a member of the neu roregulin family of receptor ligands that are involved in development of the nervous system [287] In conclusion, thermoprotective actions of IGF1 are developmentally regulated with the two cell embryo being refractory to IGF1. Failure of IGF1 to protect two cell embryos is probably not because signaling molecules required for IGF 1 actions are depleted but rather either because the block to transcription in the two cell embryo

PAGE 77

77 prevents changes in gene expression required for thermotoler ance or that the damage to the two cell embryo caused by heat shock is too great for IGF1 to counter. In any case, refractoriness of the early preimplantation embryo to protective actions of IGF1 can be used to explain why a treatment like bovine somatotro pin that regulates IGF1 secretion was not effective for increasing fertility of females exposed to heat stress [2, 222] Results also indicate that the improved competence for post transfer survival of bovine embryo s caused by treatment with IGF1 is associated with changes in expression of genes involved in developmental processes, apoptosis, and protection from reactive oxygen species

PAGE 78

78 Table 3 1. Primer sets for quantitative real time RT PCR (Exp.1) Gene Accessio n Primer/ Probe Sequence IGF1R XM_606794.1 Forward Reverse Probe AGTTATCTCCGGTCTCTGAGG CTTATTGGCGTTGAGGTATGC /56 FAM/TTTTGCTTAGGCTGGGAGGTGCT/3IABlk_FQ/ RAF1 NM_001102505 Forward Reverse Probe AAGCTATACAAGAACTGCCCC GCTCGATGGAAGACAGGATC /56 FAM/TGGTAGCTGAC TGCGTGAAGAAAGTG/3IABlk_FQ/ MAPK NM_175793 Forward Reverse Probe ACCTCAAACCTTCCAACCTG CCACGTACTCTGTCAAGAACC /56 FAM/ATCTGCAACACGGGCCAAGC/3IABlk_FQ/ GAPHD NM_001034034 Forward Reverse Probe ACCCAGAAGACTGTGGATGG CAACAGACACGTTGGGAGTG /56 FAM/TCAACGGGAAGCTCA CTGGCA/3IABlk_FQ/ Table 3 2. Primer sets for quantitative real time RT PCR (Exp.2) Gene Accession Primer Sequence Length Tm IGF1R XM_606794.3 Forward Reverse TAACCATGAGGCTGAGAAGCTTGG TTCTCAGGCCTTGGCTCCCA 120 bp 60C HK2 XM_865470.1 Forward Reverse GAG TTT GAT GCA GCT GTG GA CTC TCG AGC CCT AAG TGG TG 263 bp 56C PI3K NM_174576.1 Forward Reverse GCAACAAGCTTCCACTCTCC CAAGGAGGCGGTATCACAAT 198 bp 55.5C HIST1H2AA XM_583411 Forward Reverse CTGCCAAAGAAAACCGAGAG TCTGGATCGAGGCATCTCTT 202 bp 55C

PAGE 79

79 Table 3 3. Primer sets for quantitative real time RT PCR (microarray validation) Gene Accession Prime Sequence Length Tm H1FOO DQ206443 Forward Reverse GCCGAGTGAGTCAAAGAAGG GGTGACCGTGGATTTTGAAC 324 bp 55.7C TGFB2 XM_001788732 Forward Reverse AAGCACGCTTTGCAGGT ATT TAGCAGGAGATGTGGGCTCT 166 bp 55.5C RAD23A NM_001082614 Forward Reverse TCTGTCCAGGAGAGCCAAGT TCTGGAACTGAGGCTGGTCT 91 bp 57.9C NFATC3 XM_614673 Forward Reverse CCCACACACCTCATTCTGTG AGAGGAAGGCTGACCTGTGA 125 bp 55.8C PPIP5K2 XM_001250677 Forward Rever se ACTTGATGGCAAGGTGGAAC AAGCAAGGCAGACTTTCCAA 100 bp 55.6C FADS6 NM_001081722 Forward Reverse ACGTGGAACACCACCTCTTC ACTCCTCGTAGCGTTGGAGA 153 bp 57.2C GAPDH NM_001034034 Forward Reverse ACCCAGAAGACTGTGGATGG CAACAGACACGTTGGGAGTG 177 bp 57.2C

PAGE 80

80 Table 3 4. Genes upregulated by IGF1 treatment Least Square Means Description Accession Number Intensity Control Intensity IGF1 Fold change P Bos taurus progesterone receptor membrane component 2 ( PGRMC2 ) NM_001099060 11 28 2.6 0.04 Predicted: Bos taurus odz odd Oz/ten m homolog 4 ( ODZ4 ) XM_586751 9 22 2.5 0.01 Predicted: Bos taurus similar to mannosidase, alpha, class 2A, member 2, transcript variant 1 ( MAN2A2 ) XM_605840 5 12 2.3 0.01 Bos taurus exportin 4 ( XPO4 ) NM_001098889 9 20 2.1 0.04 Bos taurus profilin 2 ( PFN2 ) NM_001128197 13 28 2.1 0.01 Predicted: Bos taurus similar to TATA binding protein associated factor 4b ( TAF4B ) XM_596212.4 11 22 2.1 0.01 Bos taurus solute carrier family 40 (iron regulated transporter), member 1 ( SLC40A1 ) NM_0010779 70 19 39 2.0 0.02 Bos taurus cytochrome P450, family 4, subfamily F, polypeptide 2 ( CYP4F2 ) NM_001075322 8 15 1.9 0.02 Bos taurus cleavage and polyadenylation specific factor 3, 73kDa ( CPSF3 ) NM_174284 7 12 1.9 0.05 Bos taurus annexin A2 ( ANXA2 ) NM_1 74716 782 1448 1.9 0.04 Predicted: Bos taurus similar to interleukin 6 signal transducer (gp130, oncostatin M receptor) ( IL6ST ) XM_600430 20 36 1.8 0.01

PAGE 81

81 Table 3 4. Continued Least Square Means Description Accession Number Intensity Control Intensity IGF1 Fold change P Bos taurus farnesyltransferase, CAAX box, alpha ( FNTA ) BC112662 43 77 1.8 0.05 Bos taurus tudor and KH domain containing ( TDRKH ) NM_001105375 51 92 1.8 0.05 Bos taurus lysophosphatidic acid receptor 6 ( LPAR6 ) NM_001101284 6 10 1.7 0.04 Bos taurus coenzyme Q9 homolog (S. cerevisiae) ( COQ9 ) NM_001046302 23 39 1.7 0.00 Predicted: Bos taurus similar to oxysterol binding protein like protein 11, transcript variant 3 ( OSBPL11 ) XM_865427 23 39 1.7 0.01 Bos taurus transforming growth factor, beta 2 ( TGFB2 ) NM_001113252 29 49 1.7 0.01 Predicted: Bos taurus eukaryotic translation initiation factor 3, subunit A, transcript variant 4 ( EIF3A ) XM_879302 121 202 1.7 0.01 Bos taurus similar to Homo sapiens nuclear factor of activated T ce lls, cytoplasmic, calcineurin dependent 3 ( NFATC3 ) XM_614673 29 49 1.7 0.01 Diphosphoinositol pentakisphosphate kinase 2 ( PPIP5K2 ) XM_001250677 46 76 1.7 0.00 Bos taurus collagen, type IV, alpha 1 ( COL4A1 ) NM_001166511 338 557 1.6 0.01 PREDICTED: Bos t aurus IQ motif containing GTPase activating protein 1 ( IQGAP1 ) XM_001251162 33 54 1.6 0.00 Predicted: Bos taurus similar to mannosidase, alpha, class 2B, member 2 ( MAN2B2 ) XM_601803.4 7 11 1.6 0.04

PAGE 82

82 Table 3 4. Continued Least Square Means Description Accession Number Intensity Control Intensity IGF1 Fold change P Bos taurus cellular repressor of E1A stimulated genes 1 (CREG1) NM_001075942 15 24 1.6 0.00 Bos taurus ribonuclease L (2',5' oligoisoadenylate synthetase dependent) ( RNASEL ) NM_001098165 10 16 1.6 0.04 Bos taurus upstream binding factor ( UBF ) AY225853 25 40 1.6 0.04 Bos taurus immediate early response 3 interacting protein 1 ( IER3IP1 ) NM_001113320 358 571 1.6 0.03 Predicted: Bos taurus chloride channel 5 (nephrolithiasis 2, X linked, Dent disease), transcript variant 2 ( CLCN5 ) XM_864613 15 23 1.6 0.00 Bos taurus similar to Homo sapiens plasma glutamate carboxypeptidase ( PGCP ) XM_613707 84 129 1.5 0.03 Bos taurus similar to Homo sapiens bone morphogenetic protein 7 (osteogenic prote in 1) ( BMP7 ) XM_612246 14 22 1.5 0.03 Predicted: Bos taurus glutathione S transferase M2, transcript variant 1 ( GSTM2 ) XM_868256.3 10 15 1.5 0.00 Bos taurus calcium binding protein 39 ( CAB39 ) NM_001046087 22 34 1.5 0.02 Bos taurus acidic (leucine ric h) nuclear phosphoprotein 32 family, member B ( ANP32B ) NM_001035074 2393 3618 1.5 0.02

PAGE 83

83 Table 3 4. Continued Least Square Means Description Accession Number Intensity Control Intensity IGF1 Fold change P Bos taurus GABA(A) receptor associated protei n like 1 ( GABARAPL1 ) NM_001033616 486 733 1.5 0.02 Bos taurus poly(A) binding protein interacting protein 2 ( PAIP2 ) NM_001034636 1577 2375 1.5 0.05 Predicted: Bos taurus similar to erythrocyte adenosine monophosphate deaminase ( AMPD3 ) XM_001788101 5 8 1.5 0.02 Bos taurus inner membrane protein, mitochondrial (mitofilin) ( IMMT ), nuclear gene encoding mitochondrial protein NM_001046015 97 144 1.5 0.04 Bos taurus sushi repeat containing protein, X linked 2 ( SRPX2 ) NM_001014926 22 32 1.5 0.04 Bos taur us dual specificity tyrosine (Y) phosphorylation regulated kinase 3 ( DYRK3 ) NM_001100298 7 11 1.5 0.02 Bos taurus similar to Homo sapiens synaptotagmin XIV ( SYT14 ) XM_607854 6 9 1.5 0.03

PAGE 84

84 Table 3 5. Genes downregulated by IGF1 treatment Least Square Means Description Accession Intensity Control Intensity IGF1 Fold change P Bos taurus H1 histone family, member O, oocyte specific ( H1FOO ) NM_001035372 47 19 2.5 0.00 Predicted: Bos taurus similar to contactin associated protein like 2 precur sor (Cell recognition molecule Caspr2) ( CNTNAP2 ) XM_594548 18 9 2.0 0.05 Homo sapiens neuregulin 2 ( NRG2 ), transcript variant 4 NM_013983 44 23 1.9 0.03 Bos taurus glial fibrillary acidic protein ( GFAP ) NM_174065 12 7 1.8 0.03 Bos ta urus dihydropyrimidinase like 4 ( DPYSL4 ) NM_001163783 12 7 1.8 0.03 Predicted: Bos taurus similar to translocation associated membrane protein 2 ( TRAM2 ) XM_869521 30 17 1.8 0.01 MMP15 matrix metallopeptidase 15 (membrane inserted) ( MMP15 ) X M_597651.4 17 10 1.7 0.05 Par 3 partitioning defective 3 homolog b (C.elegans) (Bos taurus) ( PARD3B ) XR_042691.1 26 15 1.7 0.04 Bos taurus mucus type core 2 beta 1,6 N acetylglucosaminyltransferase ( GCNT3 ) NM_205809 12 7 1.7 0.04 Inositol polyphosphate 5 phophatase, 40 KDa ( INPP5A ) XM_866984 12 7 1.7 0.02

PAGE 85

85 Table 3 5. Continued Least Square Means Description Accession Intensity Control Intensity IGF1 Fold change P Predicted: Bos taurus hypothetical LOC511430, trans cript variant 2 ( MUC13 ) XM_865756 184 109 1.7 0.04 Predicted: Bos taurus similar to aldehyde daiaiaiehydrogenase 1A2 ( ALDH1A2 ) XM_615062 11 7 1.7 0.01 Bos taurus 5' nucleotidaisisise, ecto ( NT5E ) NM_174129 31 19 1.7 0.04 Predicted: Bos taurus similar to heterochromatin protein 1 beta, transcript variant 1 ( CBX1 ) XM_001249481 21 12 1.7 0.03 Bos taurus partial mRNA for 5 hydroxytryptamine 2C receptor ( 5htr2c ) AJ491865 11 7 1.6 0.02 Bos taurus G protein coupled recepto r 173 ( GPR173 ) NM_001015604 60 37 1.6 0.02 Bos taurus fatty acid desaturase domain family, member 6 ( FADS6 ) NM_001081722 97 61 1.6 0.01 Predicted: Bos taurus similar to fibrillin 2 ( FBN2 ) XM_590917 15 10 1.6 0.03 Bos taurus similar to Homo sapiens claudin 7 ( CLDN7 ) NM_001040519 4517 2867 1.6 0.01 Bos taurus macrophage stimulating 1 (hepatocyte growth factor like) ( MST1 ) NM_001075677 19 12 1.6 0.04 Bos taurus zona pellucida glycoprotein 4 ( ZP4 ) N M_173975 124 80 1.6 0.02

PAGE 86

8 6 Table 3 5. Continued Least Square Means Description Accession Intensity Control Intensity IGF1 Fold change P Bos taurus similar to Homo sapiens NIMA (never in mitosis gene a) related kinase 8 ( NEK8 ) XM_610844 17 11 1.6 0.04 Bos ta urus tumor necrosis factor receptor superfamily, member 11a, NFKB activator ( TNFRSF11A ) XM_609364 15 10 1.6 0.01 Bos taurus similar to Homo sapiens nodal homolog (mouse) ( NODAL ) XM_609225 8 5 1.5 0.01 Predicted: Bos taurus similar to kring le containing transmembrane protein 1 ( KREMEN1 ) XM_602679 11 7 1.5 0.04 Predicted: Bos taurus similar to neuralized like protein 1 (h neuralized 1) (h neu) (RING finger protein 67), transcript variant 1 ( NEURL ) XM_587462 59 39 1.5 0.04 Sal mo salar UV excision repair protein RAD23 homolog A ( rd23a ) NM_001141812 405 269 1.5 0.02 Bos taurus MON1 homolog B (yeast) ( MON1B ) NM_001037454 24 16 1.5 0.02 Bos taurus membrane spanning 4 domains, subfamily A, member 5 ( MS4A5 ) NM_001078146 15 10 1.5 0.01 Bos taurus matrix metalloproteinase 13 (collagenase 3) ( MMP13 ) NM_174389 11 8 1.5 0.03 Bos taurus Rho guanine nucleotide exchange factor (GEF) 10 like ( ARHGEF10L ) NM_001046297 9 6 1.5 0.03 Bos taurus interferon induced trans membrane protein 3 (1 8U) ( IFITM3 ) NM_181867 217 146 1.5 0.02

PAGE 87

87 Table 3 6. Significant biological process gene ontology terms for differentially expressed genes in blastocysts a Gene ontology (GO) Action of IGF1 Gene GO:0009790: embryonic development UP: BMP7, TGFB2, ODZ4 DOWN: ALDH1A2, NODAL, FBN2, MMP13, NRG2 GO:0048598: embryonic morphogenesis UP: BMP7, ODZ4 DOWN: ALDH1A2, NODAL, FBN2, MMP13 GO:0009653: anatomical structure morphogenesis UP: BMP7, SLC40A1, TGFB2, ANXA2, ODZ4 DOWN: ALDH1A2, NEURL, NODAL, FBN2, MMP13 GO:0008284: positive regulation of cell proliferation UP: FNTA, IL6ST, TGFB2 DOWN: ALDH1A2, TNFRSF11A, NODAL GO:0048545: response to steroid hormone stimulus UP: BMP7, TGFB2 DOWN: ALDH1A2, MMP13 GO:0048856: anatomical stru cture development UP: ANXA2, TGFB2, DYRK3, BMP7, NFATC3, SLC40A1, ODZ4 DOWN: NEURL, NODAL, DPYSL4, MMP13, ALDH1A2, TNFRSF11A, CNTNAP2, FBN2 GO:0048468: cell development UP: BMP7, TGFB2 DOWN: ALDH1A2, NEURL, NODAL, CNTNAP2 GO:0007178: transmembrane r eceptor protein serine/threonine kinase signaling pathway UP: FNTA, BMP7, TGFB2 GO:0009605: response to external stimulus UP: IL6ST, BMP7, NFATC3, TGFB2 DOWN: ALDH1A2, NEURL, MST1, MMP1 5 GO:0032989: cellular component morphogenesis UP: BMP7, TGFB2 DO WN: NEURL, NODAL a The analysis was conducted using David software ( http://david.abcc.ncifcrf.gov/ ). The only ontologies shown are those with more than two differentially expressed genes in an ontology and whe re the ontology was not an organ specific term

PAGE 88

88 Figure 3 1. Representative results of analysis of RNA from KSOM (control) and IGF1 treated embryos used for microarray determined by Agilent 2100 Bioanalyzer RNA 6000 Pico Labchip Kit.

PAGE 89

89 Figure 3 2 Effect of IGF1 on the reduction in development caused by a heat shock of 41C at the two cell stage and day 5 of development (embryos > 16 cells). Data in Panel A are from two cell embryos and data in Panel B are from day 5 embryos at 41C. In two cell embryos, there was a decrease in the percent of embryos becoming a blastocyst caused by heat shock (P<0.005) but no effect of IGF1 or IGF1 x temperature. For day 5 embryos, there was no effect of temperature, IGF1 or the int eraction.

PAGE 90

90 Figure 3 3 Effect of IGF1 on the reduction of development caused by exposure of day 5 embryos ( percent of embryos becoming blastocyst at day 8 caused by heat shock (P<0.001) and an increase in percent blastocyst caused by IGF1 (P<0.05).

PAGE 91

91 Figure 3 4 Changes in expression of genes involved in IGF1 signaling at the two cell and day 5 ( > 16 cells) stage as determined by qPCR In the first experiment (panel A), steady state amounts of mRNA for IGF1R RAF1 and MAPK were higher for two cell embryos (P <0.00 1). In the second experiment (panel B), there was a nonsignificant tendency for expression of IGF1R to be higher at the two cell stage. Amounts of mRNA for PI3K were higher for two cell embryos (P <0.001) while amounts of HK2 mRNA w ere higher for day 5 embr yos (P <0.001).

PAGE 92

92 Figure 3 5 Expression of IGF1R protein in two Panel A represents immunocytochemistry staining for two cell embryos and day 5 embryo Red fluorescence denotes p ositive staining of IGF1R. As shown by quantitative analysis in panel B, there was no difference in pixel intensity between two cell and day 5 embryos.

PAGE 93

93 Figure 3 6 Fold change in gene expression using qPCR (y axis) an d microarray hybridization (x axis) for a selected group of six differentially expressed genes. Fold change values are calculated as IGF1/control. N.S = non significant

PAGE 94

94 CHAPTER 4 GENERAL DISCUSSION Insulin like growth factor is an important maternal de terminant of embryonic survival that can promote development to the blastocyst stage [31 32, 34] protect the embryo from several stresses [1, 3, 212] and increase competence for development to term, at least in heat stressed females [35, 133] The overall goal of this dissertation was to understand the molecular basis for the developmental acquisition of thermoprotective actions of IGF 1 on preimplantation embryos and the thermoprotective effects of IGF1 during culture and after transfer into recipients. A schematic diagram illustrating the conclusions of the dissertation is shown in Figure 4 1 For both e ffects on development and on thermotolerance, the embryo appears resistant to IGF1 until sometimes between the two cell stage and day 4 after fertilization. Thus, addition of IGF1 from day 0 4 had no effect on the proportion of embryos becoming blastocysts while addition from day 4 8 increased the percent of embryos becoming blastocysts in a manner involving MAPK regulated events (Chapter 2). Similarly, IGF1 protected embryos from heat shock at day 5 but not at the two cell stage. Developmental changes in a ctions of IGF1 appear not to be due to a lack of IGF1 signaling molecules because IGF1R and mRNA for selected genes involved in IGF1 signaling were present at the two cell stage (Chapter 2). It seems most likely that the reason for unresponsiveness to IGF1 relates to the lack of transcriptional capacity for the early embryo until embryonic genome activation at the 8 16 cell stage [39] I ndeed, one effect of IGF1 was increased expression of ATPA1 A (Chapter 2) and this action may contribute to embryo competence to become a blastocyst

PAGE 95

95 The MAPK pathway is one of the signaling pathways for the proliferative actions of IGF1 [240 241] Inhibition of the MAPK pathway decreased the effect of IGF1 on embryo developmen t (Chapter 2), and it is possible, therefore, that the main action of IGF1 for increas ing blastocyst development is an increase in cell number It is controversial whether IGF1 increases cell number in the bovine embryo; some studies did not show an increa se in blastocyst cell number [183] while other studies did [177, 179] Since the inhibition of MAPK pathway did not block overall embryo development, future studies to evalua te different pathways by which IGF1 improves embryo development, such as PDK1 or JAK STAT [148, 288 289] could be important. In addition, it would be of interest to determine whether IGF1 increases other genes invo lved in embryo compaction and blastocyst formation such as zonula occludens, and the aquaporins [81, 87]

PAGE 96

96 Figure 4 1. Developmental actions of IGF1 to promote blastocyst formation and protect from heat shock. Not e that effects of IGF1 to increase competence of an embryo to become a blastocyst between day 4 and 8 post insemination Similarly, IGF1 can protect embryos from heat shock at day 5 but not at the two cell stage. Actions of IGF1 to increase development inv olve MAPK dependent events and include increased expression of ATPA1A Failure of the embryo to respond to IGF1 before day 4 appears not to be due to a lack of IGF1 signaling molecules because IGF1R and mRNA for selected genes involved in IGF1 signaling we re present at the two cell stage. Note also that the blastocyst produced in the presence of IGF1 has increased potential for survival when transferred into heat stressed recipients [35] This effect of IGF 1 is associated with changes in expression of genes involved in development, apoptosis and protection from free radicals.

PAGE 97

97 While lack of transcriptional regulation may be on e reason why IGF1 cannot protect two cell embryos from heat shock, it is also possible that the increased sensitivity of two cell embryos to elevated temperatures due to higher production of ROS [198] or other reasons makes the damage caused by heat shock too severe to be reversed by IGF1. Some of the deleterious effects of ROS include DNA strand breaks, mitochondrial damage [290] and embryonic arrest. Rivera et al. [205] have shown that two cell embryos submitted to heat shock were arrested and did not pass the eight cell stage. One possible cause for embryonic arrest could be an increase in oxidative stress leading to higher levels of p66s hc mRNA. P66Shc is a stress adaptor protein associated with early embryonic arrest [206 208] and it regulates mitochondrial metabolism by modulating the amount of ROS released into the cytosol [209] Another possibility to explain increased sensitivity of the two cell embryo to heat shock is that maternal mRNAs and proteins may be more sensitive to elevated temperatures. Embryonic development during the early cleavage stages is s upported by maternal mRNAs and proteins synthesized and stored during oogenesis [39] and these stores are important during the interval of fertilization and embryonic genome activation. Heat stress reduces the duration of estrus, impairs follicul ar development and oogenesis, decreases follicular steroid production [14, 186 187] and decreases IGF1 concentration in the blood and follicular fluid [291] Addition of IGF1 to maturation medium was shown to stimulate oocyte maturation, cumulus expansion and cleavage rate after fertilization [292] Furthermore, the use of bST has been shown to increases plasma concentrations of IGF1 [216, 218] which could be used as an in vivo treatment to prevent effects of heat stress. In vivo studies showed that bST treatment increased

PAGE 98

98 IGF1 content in the follicular fluid, improved follicular development prior to ovulation [293] and increased fertilization rate and embryonic development [294] However, the lack of thermoprotective effects of IGF1 on two cell embryos would make treatment of cows with bST at early stages of pregnancy ineffective for preventing effect of he at stress on fertility. Future experiments could be conducted to evaluate whether oocytes can be protected from heat shock by IGF1 and to determine whether this beneficial effect would carry over into the period of embryonic development. Furthermore, it is not known whether an increase of IGF1 in reproductive tract can increase fertility. Moreira et al. [294] found that treatment of recipient cow s with bST increased pregnancy rates after transfer of embryos flushed from donor cows without bST. Perhaps bST and IGF1 can also improve the uterine environment. Futures studies could be done to evaluate effects of bST on gene expression in the uterus of cows under heat stress. In our study, microarray analysis showed that IGF1 changed expression of genes involved in apoptosis and protection from reactive oxygen species in day 7 blastocysts, which could conceivably increase post transfer survival in heat stressed recipients by protecting the embryo from effects of maternal hyperthermia. Furthermore, a large number of genes involved in developmental processes were affected by IGF1 and some of these genes could be important for embryonic survival in associat ion with other changes in embryonic function caused by maternal hyperthermia. The fact that IGF1 increased potential for survival after transfer into recipients, but only when those recipients are exposed to heat stress [35, 261] suggests that beneficial effects of IGF1

PAGE 99

99 on embryo function only affect embryonic survival in conjunction with other changes in embryo function caused by heat stress induced changes in maternal function. Taken together, these investigation s indicate that IGF1 can regulate embryonic development and resistance to heat stress but that these actions occur at or after day 4 of development, at a time after embryonic genome activation. Furthermore, the pro developmental effects of IGF1 involve act ions mediated by the MAPK pathway and include alteration of genes controlling formation of the blastocoelic cavity. Genes regulated by IGF1 at the blastocyst stage, such as those involved in development, apoptosis and protection from oxidative stress could be involved in the increase in embryonic survival after transfer to heat stressed recipients caused by IGF1.

PAGE 100

100 LIST OF REFERENCES 1. Jousan FD, Hansen PJ. Insulin like growth factor I as a survival factor for the bovine preimplantation embryo exposed to heat shock. Biol Reprod 2004; 71:1665 1670. 2. Jousan FD, de Castro e Paula LA, Block J, Hansen PJ. Fertility of lactating dairy cows administered recombinant bovine somatotropin during heat stress. J Dairy Sci 2007; 90:341 351. 3. Jousa n FD, Hansen PJ. Insulin like growth factor I promotes resistance of bovine preimplantation embryos to heat shock through actions independent of its anti apoptotic actions requiring PI3K signaling. Mol Reprod Dev 2007; 74:189 196. 4. Diskin MG, Morris DG. Embryonic and early foetal losses in cattle and other ruminants. Reprod Domest Anim 2008; 43 Suppl 2:260 267. 5. Berg DK, van Leeuwen J, Beaumont S, Berg M, Pfeffer PL. Embryo loss in cattle between Days 7 and 16 of pregnancy. Theriogenology 2010; 73:250 2 60. 6. Santos JE, Thatcher WW, Chebel RC, Cerri RL, Galvao KN. The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Anim Reprod Sci 2004; 82 83:513 535. 7. Inskeep EK, Dailey RA. Embryonic death in cattle. Vet C lin North Am Food Anim Pract 2005; 21:437 461. 8. Lucy MC. Reproductive loss in high producing dairy cattle: where will it end? J Dairy Sci 2001; 84:1277 1293. 9. Wolfenson D, Thatcher WW, Badinga L, Savio JD, Meidan R, Lew BJ, Braw Tal R, Berman A. Effect of heat stress on follicular development during the estrous cycle in lactating dairy cattle. Biol Reprod 1995; 52:1106 1113. 10. Edwards JL, Hansen PJ. Elevated temperature increases heat shock protein 70 synthesis in bovine two cell embryos and compromis es function of maturing oocytes. Biol Reprod 1996; 55:341 346. 11. Sartori R, Haughian JM, Shaver RD, Rosa GJ, Wiltbank MC. Comparison of ovarian function and circulating steroids in estrous cycles of Holstein heifers and lactating cows. J Dairy Sci 2004; 87:905 920. 12. Rizos D, Carter F, Besenfelder U, Havlicek V, Lonergan P. Contribution of the female reproductive tract to low fertility in postpartum lactating dairy cows. J Dairy Sci 2010; 93:1022 1029.

PAGE 101

101 13. Sartori R, Sartor Bergfelt R, Mertens SA, Guent her JN, Parrish JJ, Wiltbank MC. Fertilization and early embryonic development in heifers and lactating cows in summer and lactating and dry cows in winter. J Dairy Sci 2002; 85:2803 2812. 14. Hansen PJ. Exploitation of genetic and physiological determinan ts of embryonic resistance to elevated temperature to improve embryonic survival in dairy cattle during heat stress. Theriogenology 2007; 68 Suppl 1:S242 249. 15. Galli C, Duchi R, Crotti G, Turini P, Ponderato N, Colleoni S, Lagutina I, Lazzari G. Bovine embryo technologies. Theriogenology 2003; 59:599 616. 16. Hansen PJ, Block J. Towards an embryocentric world: the current and potential uses of embryo technologies in dairy production. Reprod Fertil Dev 2004; 16:1 14. 17. Al Katanani YM, Drost M, Monson RL Rutledge JJ, Krininger CE, 3rd, Block J, Thatcher WW, Hanse PJ. Pregnancy rates following timed embryo transfer with fresh or vitrified in vitro produced embryos in lactating dairy cows under heat stress conditions. Theriogenology 2002; 58:171 182. 18. D emetrio DG, Santos RM, Demetrio CG, Vasconcelos JL. Factors affecting conception rates following artificial insemination or embryo transfer in lactating Holstein cows. J Dairy Sci 2007; 90:5073 5082. 19. Dochi O, Takahashi K, Hirai T, Hayakawa H, Tanisawa M, Yamamoto Y, Koyama H. The use of embryo transfer to produce pregnancies in repeat breeding dairy cattle. Theriogenology 2008; 69:124 128. 20. Drost M, Ambrose JD, Thatcher MJ, Cantrell CK, Wolfsdorf KE, Hasler JF, Thatcher WW. Conception rates after art ificial insemination or embryo transfer in lactating dairy cows during summer in Florida. Theriogenology 1999; 52:1161 1167. 21. Numabe T, Oikawa T, Kikuchi T, Horiuchi T. Birth weight and birth rate of heavy calves conceived by transfer of in vitro or in vivo produced bovine embryos. Anim Reprod Sci 2000; 64:13 20. 22. Gomez E, Munoz M, Rodriguez A, Caamano JN, Facal N, Diez C. Vitrification of bovine blastocysts produced in vitro inflicts selective damage to the inner cell mass. Reprod Domest Anim 2009; 4 4:194 199. 23. Pontes JH, Nonato Junior I, Sanches BV, Ereno Junior JC, Uvo S, Barreiros TR, Oliveira JA, Hasler JF, Seneda MM. Comparison of embryo yield and pregnancy rate between in vivo and in vitro methods in the same Nelore ( Bos indicus ) donor cows. Theriogenology 2009; 71:690 697.

PAGE 102

102 24. Thibier M. Data Retrieval Committee statistics of Embryo Transfer Year 2008. The worldwide statistics of embryo transfers in farm animals. In, vol. 27. International Embryo Transfer News Letter; 2009: 13 19. 25. Sch arf J, Ramadori G, Braulke T, Hartmann H. Synthesis of insulinlike growth factor binding proteins and of the acid labile subunit in primary cultures of rat hepatocytes, of Kupffer cells, and in cocultures: regulation by insulin, insulinlike growth factor, and growth hormone. Hepatology 1996; 23:818 827. 26. Geisert RD, Lee CY, Simmen FA, Zavy MT, Fliss AE, Bazer FW, Simmen RC. Expression of messenger RNAs encoding insulin like growth factor I, II, and insulin like growth factor binding protein 2 in bovine endometrium during the estrous cycle and early pregnancy. Biol Reprod 1991; 45:975 983. 27. Lonergan P, Gutierrez Adan A, Pintado B, Fair T, Ward F, Fuente JD, Boland M. Relationship between time of first cleavage and the expression of IGF I growth factor, its receptor, and two housekeeping genes in bovine two cell embryos and blastocysts produced in vitro. Mol Reprod Dev 2000; 57:146 152. 28. Pushpakumara PG, Robinson RS, Demmers KJ, Mann GE, Sinclair KD, Webb R, Wathes DC. Expression of the insulin like g rowth factor (IGF) system in the bovine oviduct at oestrus and during early pregnancy. Reproduction 2002; 123:859 868. 29. Rhoads ML, Meyer JP, Kolath SJ, Lamberson WR, Lucy MC. Growth hormone receptor, insulin like growth factor (IGF) 1, and IGF binding p rotein 2 expression in the reproductive tissues of early postpartum dairy cows. J Dairy Sci 2008; 91:1802 1813. 30. Pandey A, Gupta SC, Singh N, Rana JS, Gupta N. Efficiency of SCNT Buffalo (Bubalus bubalis) Embryos in Different Culture Medium and Analysis of mRNA Expression of Insulin like Growth Factors During Embryogenesis. Reprod Domest Anim 2009. 31. Moreira F, Paula Lopes FF, Hansen PJ, Badinga L, Thatcher WW. Effects of growth hormone and insulin like growth factor I on development of in vitro derive d bovine embryos. Theriogenology 2002; 57:895 907. 32. Sirisathien S, Hernandez Fonseca HJ, Brackett BG. Influences of epidermal growth factor and insulin like growth factor I on bovine blastocyst development in vitro. Anim Reprod Sci 2003; 77:21 32. 33. B lock J, Drost M, Monson RL, Rutledge JJ, Rivera RM, Paula Lopes FF, Ocon OM, Krininger CE, 3rd, Liu J, Hansen PJ. Use of insulin like growth factor I during embryo culture and treatment of recipients with gonadotropin releasing hormone to increase pregnanc y rates following the transfer of in vitro produced embryos to heat stressed, lactating cows. J Anim Sci 2003; 81:1590 1602.

PAGE 103

103 34. Lima PF, Oliveira MA, Santos MH, Reichenbach HD, Weppert M, Paula Lopes FF, Neto CC, Goncalves PB. Effect of retinoids and grow th factor on in vitro bovine embryos produced under chemically defined conditions. Anim Reprod Sci 2006; 95:184 192. 35. Block J, Hansen PJ. Interaction between season and culture with insulin like growth factor 1 on survival of in vitro produced embryos f ollowing transfer to lactating dairy cows. Theriogenology 2007; 67:1518 1529. 36. Edwards JL, Hansen PJ. Differential responses of bovine oocytes and preimplantation embryos to heat shock. Mol Reprod Dev 1997; 46:138 145. 37. Al Katanani YM, Hansen PJ. Ind uced thermotolerance in bovine two cell embryos and the role of heat shock protein 70 in embryonic development. Mol Reprod Dev 2002; 62:174 180. 38. Schier AF. The maternal zygotic transition: death and birth of RNAs. Science 2007; 316:406 407. 39. Memili E, Dominko T, First NL. Onset of transcription in bovine oocytes and preimplantation embryos. Mol Reprod Dev 1998; 51:36 41. 40. Baumann CG, Morris DG, Sreenan JM, Leese HJ. The quiet embryo hypothesis: molecular characteristics favoring viability. Mol Rep rod Dev 2007; 74:1345 1353. 41. Natale DR, Kidder GM, Westhusin ME, Watson AJ. Assessment by differential display RT PCR of mRNA transcri amanitin sensitivity during bovine preattachment development. Mol Reprod Dev 2000; 55:152 163. 42. Kues WA, Sudheer S, Herrmann D, Carnwath JW, Havlicek V, Besenfelder U, Lehrach H, Adjaye J, Niemann H. Genome wide expression profiling reveals distinct clusters of transcriptional regulation during bovine preimplantation development in vivo. Proc Natl Acad Sci U S A 2008; 105:19768 19773. 43. Memili E, First NL. Developmental changes in RNA polymerase II in bovine oocytes, early embryos, and effect of alpha amanitin on embryo development. Mol Reprod Dev 1998; 51:381 389. 44. Hay Schmidt A, Viuff D, Greve T, Hyttel P. Transcriptional activity in in vivo developed early cleavage stage bovine embryos. Theriogenology 2001; 56:167 176. 45. Mem ili E, First NL. Control of gene expression at the onset of bovine embryonic development. Biol Reprod 1999; 61:1198 1207. 46. Chandolia RK, Peltier MR, Tian W, Hansen PJ. Transcriptional control of development, protein synthesis, and heat induced heat shoc k protein 70 synthesis in 2 cell bovine embryos. Biol Reprod 1999; 61:1644 1648.

PAGE 104

104 47. Edwards JL, Ealy AD, Monterroso VH, Hansen PJ. Ontogeny of temperature regulated heat shock protein 70 synthesis in preimplantation bovine embryos. Mol Reprod Dev 1997; 48 :25 33. 48. Woodland H. The translational control phase of early development. Biosci Rep 1982; 2:471 491. 49. Memili E, First NL. Zygotic and embryonic gene expression in cow: a review of timing and mechanisms of early gene expression as compared with othe r species. Zygote 2000; 8:87 96. 50. Frei RE, Schultz GA, Church RB. Qualitative and quantitative changes in protein synthesis occur at the 8 16 cell stage of embryogenesis in the cow. J Reprod Fertil 1989; 86:637 641. 51. Barnes FL, Eyestone WH. Early cle avage and the maternal zygotic transition in bovine embryos In, vol. 33. Theriogenology; 1990: 141 152. 52. Li E. Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 2002; 3:662 673. 53. Santos F, Dean W. Epigenetic reprogramming during early development in mammals. Reproduction 2004; 127:643 651. 54. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001; 28:173 177. 55. Santos F, Zak hartchenko V, Stojkovic M, Peters A, Jenuwein T, Wolf E, Reik W, Dean W. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr Biol 2003; 13:1116 1121. 56. Lin L, Li Q, Zhang L, Zhao D, Dai Y, Li N. Aberr ant epigenetic changes and gene expression in cloned cattle dying around birth. BMC Dev Biol 2008; 8:14. 57. Fairburn HR, Young LE, Hendrich BD. Epigenetic reprogramming: how now, cloned cow? Curr Biol 2002; 12:R68 70. 58. Dean W, Santos F, Stojkovic M, Za khartchenko V, Walter J, Wolf E, Reik W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001; 98:13734 13738. 59. Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science 2001; 293:1089 1093. 60. Shi L, Wu J. Epigenetic regulation in mammalian preimplantation embryo development. Reprod Biol Endocrinol 2009; 7:59.

PAGE 105

105 61. Shi W, Zakhartchenko V, Wolf E. Epigenetic reprogramming in mammalian nuclear transfer. Differentiation 2003; 71:91 113. 62. Reik W, Dean W. DNA methylation and mammalian epigenetics. Electrophoresis 2001; 22:2838 2843. 63. Turek Plewa J, Jagodzinski PP. The role of mammalian DNA methyltransferases in the regulation of gene express ion. Cell Mol Biol Lett 2005; 10:631 647. 64. Bestor TH. The DNA methyltransferases of mammals. Hum Mol Genet 2000; 9:2395 2402. 65. Ding F, Chaillet JR. In vivo stabilization of the Dnmt1 (cytosine 5) methyltransferase protein. Proc Natl Acad Sci U S A 2 002; 99:14861 14866. 66. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999; 99:247 257. 67. Hata K, Okano M, Lei H, Li E. Dnmt3L cooperates with the Dnmt3 f amily of de novo DNA methyltransferases to establish maternal imprints in mice. Development 2002; 129:1983 1993. 68. Vassena R, Dee Schramm R, Latham KE. Species dependent expression patterns of DNA methyltransferase genes in mammalian oocytes and preimpla ntation embryos. Mol Reprod Dev 2005; 72:430 436. 69. Golding MC, Westhusin ME. Analysis of DNA (cytosine 5) methyltransferase mRNA sequence and expression in bovine preimplantation embryos, fetal and adult tissues. Gene Expr Patterns 2003; 3:551 558. 70. Reik W, Walter J. Genomic imprinting: parental influence on the genome. Nat Rev Genet 2001; 2:21 32. 71. Constancia M, Hemberger M, Hughes J, Dean W, Ferguson Smith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W. Placental specific IGF II is a major modulator of placental and fetal growth. Nature 2002; 417:945 948. 72. Li S, Li Y, Yu S, Du W, Zhang L, Dai Y, Liu Y, Li N. Expression of insulin like growth factors systems in cloned cattle dead within hours after birth. Mol Reprod Dev 2007; 74:3 97 402. 73. Bartolomei MS. Genomic imprinting: employing and avoiding epigenetic processes. Genes Dev 2009; 23:2124 2133. 74. Dupont C, Armant DR, Brenner CA. Epigenetics: definition, mechanisms and clinical perspective. Semin Reprod Med 2009; 27:351 357.

PAGE 106

106 75. Kanka J. Gene expression and chromatin structure in the pre implantation embryo. Theriogenology 2003; 59:3 19. 76. Morgan HD, Santos F, Green K, Dean W, Reik W. Epigenetic reprogramming in mammals. Hum Mol Genet 2005; 14 Spec No 1:R47 58. 77. Nowak Imi alek M, Wrenzycki C, Herrmann D, Lucas Hahn A, Lagutina I, Lemme E, Lazzari G, Galli C, Niemann H. Messenger RNA expression patterns of histone associated genes in bovine preimplantation embryos derived from different origins. Mol Reprod Dev 2008; 75:731 7 43. 78. Betteridge KJ. The anatomy and physiology of pre attachment bovine embryos. In: J. E. F (ed.), vol. 29. Theriogelonogy: Annual Conference of the International Embryo Transfer Society 1988: 155 187. 79. Yamanaka Y, Ralston A, Stephenson RO, Rossant J. Cell and molecular regulation of the mouse blastocyst. Dev Dyn 2006; 235:2301 2314. 80. Johnson MH, Ziomek CA. The foundation of two distinct cell lineages within the mouse morula. Cell 1981; 24:71 80. 81. Watson AJ, Natale DR, Barcroft LC. Molecular re gulation of blastocyst formation. Anim Reprod Sci 2004; 82 83:583 592. 82. Duranthon V, Watson AJ, Lonergan P. Preimplantation embryo programming: transcription, epigenetics, and culture environment. Reproduction 2008; 135:141 150. 83. Eckert JJ, Fleming T P. Tight junction biogenesis during early development. Biochim Biophys Acta 2008; 1778:717 728. 84. Nganvongpanit K, Muller H, Rings F, Gilles M, Jennen D, Holker M, Tholen E, Schellander K, Tesfaye D. Targeted suppression of E cadherin gene expression in bovine preimplantation embryo by RNA interference technology using double stranded RNA. Mol Reprod Dev 2006; 73:153 163. 85. Larue L, Ohsugi M, Hirchenhain J, Kemler R. E cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc Natl Acad Sci U S A 1994; 91:8263 8267. 86. Betts DH, MacPhee DJ, Kidder GM, Watson AJ. Ouabain sensitivity and expression of Na/K ATPase alpha and beta subunit isoform genes during bovine early development. Mol Reprod Dev 1997; 46:114 126. 87. Watson AJ, Westhusin ME, De Sousa PA, Betts DH, Barcroft LC. Gene expression regulating blastocyst formation. Theriogenology 1999; 51:117 133.

PAGE 107

107 88. Fleming TP, Ghassemifar MR, Sheth B. Junctional complexes in the early mammalian embryo. Semin Reprod Med 2000; 18:185 193. 89. H oughton FD. Role of gap junctions during early embryo development. Reproduction 2005; 129:129 135. 90. Vance MM, Wiley LM. Gap junction intercellular communication mediates the competitive cell proliferation disadvantage of irradiated mouse preimplantation embryos in aggregation chimeras. Radiat Res 1999; 152:544 551. 91. Kidder GM, Winterhager E. Intercellular communication in preimplantation development: the role of gap junctions. Front Biosci 2001; 6:D731 736. 92. Collins JE, Lorimer JE, Garrod DR, Pidsl ey SC, Buxton RS, Fleming TP. Regulation of desmocollin transcription in mouse preimplantation embryos. Development 1995; 121:743 753. 93. Hansen PJ. Realizing the promise of IVF in cattle -an overview. Theriogenology 2006; 65:119 125. 94. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P. Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality. Mol Reprod Dev 2002; 61:234 248. 95. Wetscher F, Havlice k V, Huber T, Gilles M, Tesfaye D, Griese J, Wimmers K, Schellander K, Muller M, Brem G, Besenfelder U. Intrafallopian transfer of gametes and early stage embryos for in vivo culture in cattle. Theriogenology 2005; 64:30 40. 96. Hasler JF, Bilby CR, Collie r RJ, Denham SC, Lucy MC. Effect of recombinant bovine somatotropin on superovulatory response and recipient pregnancy rates in a commercial embryo transfer program. Theriogenology 2003; 59:1919 1928. 97. Farin PW, Piedrahita JA, Farin CE. Errors in develo pment of fetuses and placentas from in vitro produced bovine embryos. Theriogenology 2006; 65:178 191. 98. Enright BP, Lonergan P, Dinnyes A, Fair T, Ward FA, Yang X, Boland MP. Culture of in vitro produced bovine zygotes in vitro vs in vivo: implications for early embryo development and quality. Theriogenology 2000; 54:659 673. 99. Lonergan P, Rizos D, Kanka J, Nemcova L, Mbaye AM, Kingston M, Wade M, Duffy P, Boland MP. Temporal sensitivity of bovine embryos to culture environment after fertilization and the implications for blastocyst quality. Reproduction 2003; 126:337 346.

PAGE 108

108 100. Havlicek V, Kuzmany A, Cseh S, Brem G, Besenfelder U. The Effect of Long term In Vivo Culture in Bovine Oviduct and Uterus on the Development and Cryo tolerance of In Vitro Produ ced Bovine Embryos. Reprod Domest Anim 2009. 101. Crosier AE, Farin PW, Dykstra MJ, Alexander JE, Farin CE. Ultrastructural morphometry of bovine blastocysts produced in vivo or in vitro. Biol Reprod 2001; 64:1375 1385. 102. Lonergan P, Fair T, Corcoran D, Evans AC. Effect of culture environment on gene expression and developmental characteristics in IVF derived embryos. Theriogenology 2006; 65:137 152. 103. Viuff D, Hendriksen PJ, Vos PL, Dieleman SJ, Bibby BM, Greve T, Hyttel P, Thomsen PD. Chromosomal ab normalities and developmental kinetics in in vivo developed cattle embryos at days 2 to 5 after ovulation. Biol Reprod 2001; 65:204 208. 104. Viuff D, Palsgaard A, Rickords L, Lawson LG, Greve T, Schmidt M, Avery B, Hyttel P, Thomsen PD. Bovine embryos con tain a higher proportion of polyploid cells in the trophectoderm than in the embryonic disc. Mol Reprod Dev 2002; 62:483 488. 105. Lonergan P, Pedersen HG, Rizos D, Greve T, Thomsen PD, Fair T, Evans A, Boland MP. Effect of the post fertilization culture e nvironment on the incidence of chromosome aberrations in bovine blastocysts. Biol Reprod 2004; 71:1096 1100. 106. Bertolini M, Beam SW, Shim H, Bertolini LR, Moyer AL, Famula TR, Anderson GB. Growth, development, and gene expression by in vivo and in vitr o produced day 7 and 16 bovine embryos. Mol Reprod Dev 2002; 63:318 328. 107. McHughes CE, Springer GK, Spate LD, Li R, Woods R, Green MP, Korte SW, Murphy CN, Green JA, Prather RS. Identification and quantification of differentially represented transcript s in in vitro and in vivo derived preimplantation bovine embryos. Mol Reprod Dev 2009; 76:48 60. 108. Lonergan P, Monaghan P, Rizos D, Boland MP, Gordon I. Effect of follicle size on bovine oocyte quality and developmental competence following maturation, fertilization, and culture in vitro. Mol Reprod Dev 1994; 37:48 53. 109. Fair T, Hyttel P, Greve T. Bovine oocyte diameter in relation to maturational competence and transcriptional activity. Mol Reprod Dev 1995; 42:437 442. 110. Machatkova M, Krausova K, Jokesova E, Tomanek M. Developmental competence of bovine oocytes: effects of follicle size and the phase of follicular wave on in vitro embryo production. Theriogenology 2004; 61:329 335.

PAGE 109

109 111. Nemcova L, Machatkova M, Hanzalova K, Horakova J, Kanka J. Ge ne expression in bovine embryos derived from oocytes with different developmental competence collected at the defined follicular developmental stage. Theriogenology 2006; 65:1254 1264. 112. Anchamparuthy VM, Dhali A, Lott WM, Pearson RE, Gwazdauskas FC. Vi trification of bovine oocytes: implications of follicular size and sire on the rates of embryonic development. J Assist Reprod Genet 2009; 26:613 619. 113. Damiani P, Fissore RA, Cibelli JB, Long CR, Balise JJ, Robl JM, Duby RT. Evaluation of developmental competence, nuclear and ooplasmic maturation of calf oocytes. Mol Reprod Dev 1996; 45:521 534. 114. Palma GA, Tortonese DJ, Sinowatz F. Developmental capacity in vitro of prepubertal oocytes. Anat Histol Embryol 2001; 30:295 300. 115. Rizos D, Burke L, Du ffy P, Wade M, Mee JF, O'Farrell KJ, Macsiurtain M, Boland MP, Lonergan P. Comparisons between nulliparous heifers and cows as oocyte donors for embryo production in vitro. Theriogenology 2005; 63:939 949. 116. Katz Jaffe MG, McCallie BR, Preis KA, Filipov its J, Gardner DK. Transcriptome analysis of in vivo and in vitro matured bovine MII oocytes. Theriogenology 2009; 71:939 946. 117. Warzych E, Wrenzycki C, Peippo J, Lechniak D. Maturation medium supplements affect transcript level of apoptosis and cell su rvival related genes in bovine blastocysts produced in vitro. Mol Reprod Dev 2007; 74:280 289. 118. Marei WF, Wathes DC, Fouladi Nashta AA. The effect of linolenic Acid on bovine oocyte maturation and development. Biol Reprod 2009; 81:1064 1072. 119. Viana KS, Caldas Bussiere MC, Matta SG, Faes MR, de Carvalho CS, Quirino CR. Effect of sodium nitroprusside, a nitric oxide donor, on the in vitro maturation of bovine oocytes. Anim Reprod Sci 2007; 102:217 227. 120. Paula Lopes FF, Boelhauve M, Habermann FA, S inowatz F, Wolf E. Leptin promotes meiotic progression and developmental capacity of bovine oocytes via cumulus cell independent and dependent mechanisms. Biol Reprod 2007; 76:532 541. 121. Ali A, Sirard MA. Effect of the absence or presence of various pr otein supplements on further development of bovine oocytes during in vitro maturation. Biol Reprod 2002; 66:901 905. 122. Ali A, Sirard MA. Protein kinases influence bovine oocyte competence during short term treatment with recombinant human follicle stimu lating hormone. Reproduction 2005; 130:303 310.

PAGE 110

110 123. Hendricks KE, Martins L, Hansen PJ. Consequences for the bovine embryo of being derived from a spermatozoon subjected to post ejaculatory aging and heat shock: development to the blastocyst stage and sex ratio. J Reprod Dev 2009; 55:69 74. 124. Mendes JO, Jr., Burns PD, De La Torre Sanchez JF, Seidel GE, Jr. Effect of heparin on cleavage rates and embryo production with four bovine sperm preparation protocols. Theriogenology 2003; 60:331 340. 125. Lu KH, Seidel GE, Jr. Effects of heparin and sperm concentration on cleavage and blastocyst development rates of bovine oocytes inseminated with flow cytometrically sorted sperm. Theriogenology 2004; 62:819 830. 126. Xu J, Guo Z, Su L, Nedambale TL, Zhang J, Sche nk J, Moreno JF, Dinnyes A, Ji W, Tian XC, Yang X, Du F. Developmental potential of vitrified holstein cattle embryos fertilized in vitro with sex sorted sperm. J Dairy Sci 2006; 89:2510 2518. 127. Kochhar HS, Kochhar KP, Basrur PK, King WA. Influence of t he duration of gamete interaction on cleavage, growth rate and sex distribution of in vitro produced bovine embryos. Anim Reprod Sci 2003; 77:33 49. 128. Lonergan P, Rizos D, Gutierrez Adan A, Moreira PM, Pintado B, de la Fuente J, Boland MP. Temporal dive rgence in the pattern of messenger RNA expression in bovine embryos cultured from the zygote to blastocyst stage in vitro or in vivo. Biol Reprod 2003; 69:1424 1431. 129. Rizos D, Lonergan P, Boland MP, Arroyo Garcia R, Pintado B, de la Fuente J, Gutierrez Adan A. Analysis of differential messenger RNA expression between bovine blastocysts produced in different culture systems: implications for blastocyst quality. Biol Reprod 2002; 66:589 595. 130. Lazzari G, Wrenzycki C, Herrmann D, Duchi R, Kruip T, Niema nn H, Galli C. Cellular and molecular deviations in bovine in vitro produced embryos are related to the large offspring syndrome. Biol Reprod 2002; 67:767 775. 131. Zhou W, Xiang T, Walker S, Farrar V, Hwang E, Findeisen B, Sadeghieh S, Arenivas F, Abruzze se RV, Polejaeva I. Global gene expression analysis of bovine blastocysts produced by multiple methods. Mol Reprod Dev 2008; 75:744 758. 132. Block J, Bonilla L, Hansen PJ. Effect of addition of hyaluronan to embryo culture medium on survival of bovine emb ryos in vitro following vitrification and establishment of pregnancy after transfer to recipients. Theriogenology 2009; 71:1063 1071. 133. Loureiro B, Bonilla L, Block J, Fear JM, Bonilla AQ, Hansen PJ. Colony stimulating factor 2 (CSF 2) improves developm ent and posttransfer survival of bovine embryos produced in vitro. Endocrinology 2009; 150:5046 5054.

PAGE 111

111 134. Merton JS, Vermeulen ZL, Otter T, Mullaart E, de Ruigh L, Hasler JF. Carbon activated gas filtration during in vitro culture increased pregnancy rate following transfer of in vitro produced bovine embryos. Theriogenology 2007; 67:1233 1238. 135. Butler AA, Le Roith D. Control of growth by the somatropic axis: growth hormone and the insulin like growth factors have related and independent roles. Annu Re v Physiol 2001; 63:141 164. 136. Denley A, Cosgrove LJ, Booker GW, Wallace JC, Forbes BE. Molecular interactions of the IGF system. Cytokine Growth Factor Rev 2005; 16:421 439. 137. Le Roith D, Bondy C, Yakar S, Liu JL, Butler A. The somatomedin hypothesis : 2001. Endocr Rev 2001; 22:53 74. 138. Butler AA, Yakar S, LeRoith D. Insulin like growth factor I: compartmentalization within the somatotropic axis? News Physiol Sci 2002; 17:82 85. 139. Yakar S, Leroith D, Brodt P. The role of the growth hormone/insuli n like growth factor axis in tumor growth and progression: Lessons from animal models. Cytokine Growth Factor Rev 2005; 16:407 420. 140. Butler ST, Marr AL, Pelton SH, Radcliff RP, Lucy MC, Butler WR. Insulin restores GH responsiveness during lactation ind uced negative energy balance in dairy cattle: effects on expression of IGF I and GH receptor 1A. J Endocrinol 2003; 176:205 217. 141. Rhoads RP, Kim JW, Leury BJ, Baumgard LH, Segoale N, Frank SJ, Bauman DE, Boisclair YR. Insulin increases the abundance of the growth hormone receptor in liver and adipose tissue of periparturient dairy cows. J Nutr 2004; 134:1020 1027. 142. Hess BW. Nutritional controls of beef cow reproduction. In: Lake SL (ed.), vol. 83. Journal of Animal Science; 2005: E90 106. 143. Diski n MG, Mackey DR, Roche JF, Sreenan JM. Effects of nutrition and metabolic status on circulating hormones and ovarian follicle development in cattle. Anim Reprod Sci 2003; 78:345 370. 144. Lucy MC. Changes in the Somatotrophic Axix Associated with the Initi ation of Lactation. In: Jiang H (ed.), vol. 84. Journal of Daity Science; 2001: E 113 E 119. 145. Fenwick MA, Llewellyn S, Fitzpatrick R, Kenny DA, Murphy JJ, Patton J, Wathes DC. Negative energy balance in dairy cows is associated with specific changes in IGF binding protein expression in the oviduct. Reproduction 2008; 135:63 75.

PAGE 112

112 146. Kay JK, Phyn CV, Roche JR, Kolver ES. Extending lactation in pasture based dairy cows. II: Effect of genetic strain and diet on plasma hormone and metabolite concentrations. J Dairy Sci 2009; 92:3704 3713. 147. Baserga R. The contradictions of the insulin like growth factor 1 receptor. Oncogene 2000; 19:5574 5581. 148. Vincent AM, Feldman EL. Control of cell survival by IGF signaling pathways. Growth Horm IGF Res 2002; 12:193 197. 149. Bridgewater DJ, Ho J, Sauro V, Matsell DG. Insulin like growth factors inhibit podocyte apoptosis through the PI3 kinase pathway. Kidney Int 2005; 67:1308 1314. 150. Foulstone E, Prince S, Zaccheo O, Burns JL, Harper J, Jacobs C, Church D, Hassa n AB. Insulin like growth factor ligands, receptors, and binding proteins in cancer. J Pathol 2005; 205:145 153. 151. Riley JK, Carayannopoulos MO, Wyman AH, Chi M, Ratajczak CK, Moley KH. The PI3K/Akt pathway is present and functional in the preimplantati on mouse embryo. Dev Biol 2005; 284:377 386. 152. Kim S, Lee GS, Lee SH, Kim HS, Jeong YW, Kim JH, Kang SK, Lee BC, Hwang WS. Embryotropic effect of insulin like growth factor (IGF) I and its receptor on development of porcine preimplantation embryos produ ced by in vitro fertilization and somatic cell nuclear transfer. Mol Reprod Dev 2005; 72:88 97. 153. Jousan FD, Oliveira LJ, Hansen PJ. Short Term culture of in vitro produced bovine preimplantation embryos with insulin like growth factor I prevents heat s hock induced apoptosis through activation of the Phosphatidylinositol 3 Kinase/Akt pathway. Mol Reprod Dev 2008; 75:681 688. 154. Adams TE, Epa VC, Garrett TP, Ward CW. Structure and function of the type 1 insulin like growth factor receptor. Cell Mol Life Sci 2000; 57:1050 1093. 155. Forbes K, Westwood M, Baker PN, Aplin JD. Insulin like growth factor I and II regulate the life cycle of trophoblast in the developing human placenta. Am J Physiol Cell Physiol 2008; 294:C1313 1322. 156. Jousan FD. Insulin lik e growth factor I and apoptosis as determinants of preimplantation bovine embryonic development. Gainesville: University of Florida; 2006. 157. Firth SM, Baxter RC. Cellular actions of the insulin like growth factor binding proteins. Endocr Rev 2002; 23:82 4 854. 158. Scott CD, Firth SM. The role of the M6P/IGF II receptor in cancer: tumor suppression or garbage disposal? Horm Metab Res 2004; 36:261 271.

PAGE 113

113 159. Rajaram S, Baylink DJ, Mohan S. Insulin like growth factor binding proteins in serum and other biolo gical fluids: regulation and functions. Endocr Rev 1997; 18:801 831. 160. Baxter RC. Insulin like growth factor (IGF) binding proteins: interactions with IGFs and intrinsic bioactivities. Am J Physiol Endocrinol Metab 2000; 278:E967 976. 161. Jones JI, Goc kerman A, Busby WH, Jr., Wright G, Clemmons DR. Insulin like growth factor binding protein 1 stimulates cell migration and binds to the alpha 5 beta 1 integrin by means of its Arg Gly Asp sequence. Proc Natl Acad Sci U S A 1993; 90:10553 10557. 162. Schult z GA, Hogan A, Watson AJ, Smith RM, Heyner S. Insulin, insulin like growth factors and glucose transporters: temporal patterns of gene expression in early murine and bovine embryos. Reprod Fertil Dev 1992; 4:361 371. 163. Nuttinck F, Charpigny G, Mermillod P, Loosfelt H, Meduri G, Freret S, Grimard B, Heyman Y. Expression of components of the insulin like growth factor system and gonadotropin receptors in bovine cumulus oocyte complexes during oocyte maturation. Domest Anim Endocrinol 2004; 27:179 195. 164. Armstrong DG, Gutierrez CG, Baxter G, Glazyrin AL, Mann GE, Woad KJ, Hogg CO, Webb R. Expression of mRNA encoding IGF I, IGF II and type 1 IGF receptor in bovine ovarian follicles. J Endocrinol 2000; 165:101 113. 165. Armstrong DG, Baxter G, Hogg CO, Woad KJ. Insulin like growth factor (IGF) system in the oocyte and somatic cells of bovine preantral follicles. Reproduction 2002; 123:789 797. 166. Schams D, Berisha B, Kosmann M, Amselgruber WM. Expression and localization of IGF family members in bovine ant ral follicles during final growth and in luteal tissue during different stages of estrous cycle and pregnancy. Domest Anim Endocrinol 2002; 22:51 72. 167. Berisha B, Meyer HH, Schams D. Effect of prostaglandin F2 alpha on local luteotropic and angiogenic f actors during induced functional luteolysis in the bovine corpus luteum. Biol Reprod 2010; 82:940 947. 168. Sauerwein H, Miyamoto A, Gunther J, Meyer HH, Schams D. Binding and action of insulin like growth factors and insulin in bovine luteal tissue during the oestrous cycle. J Reprod Fertil 1992; 96:103 115. 169. Robinson RS, Mann GE, Gadd TS, Lamming GE, Wathes DC. The expression of the IGF system in the bovine uterus throughout the oestrous cycle and early pregnancy. J Endocrinol 2000; 165:231 243.

PAGE 114

114 170. Simmons RM, Erikson DW, Kim J, Burghardt RC, Bazer FW, Johnson GA, Spencer TE. Insulin like growth factor binding protein 1 in the ruminant uterus: potential endometrial marker and regulator of conceptus elongation. Endocrinology 2009; 150:4295 4305. 171. Llewellyn S, Fitzpatrick R, Kenny DA, Patton J, Wathes DC. Endometrial expression of the insulin like growth factor system during uterine involution in the postpartum dairy cow. Domest Anim Endocrinol 2008; 34:391 402. 172. Harvey MB, Kaye PL. Insulin like growth factor 1 stimulates growth of mouse preimplantation embryos in vitro. Mol Reprod Dev 1992; 31:195 199. 173. Glabowski W, Kurzawa R, Wiszniewska B, Baczkowski T, Marchlewicz M, Brelik P. Growth factors effects on preimplantation development of mouse embryos 99. 174. Kelly JM, Kleemann DO, Maxwell WM, Walker SK. Effects of insulin like growth factor I, epidermal growth factor and cysteamine on the in vitro maturation and development of oocytes collected from 6 to 8 week old Merino lambs. Reprod Fertil Dev 2008; 20:570 578. 175. Pawshe CH, Rao KB, Totey SM. Effect of insulin like growth factor I and its interaction with gonadotropins on in vitro maturation and embryonic development, cell prolife ration, and biosynthetic activity of cumulus oocyte complexes and granulosa cells in buffalo. Mol Reprod Dev 1998; 49:277 285. 176. Spanos S, Becker DL, Winston RM, Hardy K. Anti apoptotic action of insulin like growth factor I during human preimplantation embryo development. Biol Reprod 2000; 63:1413 1420. 177. Byrne AT, Southgate J, Brison DR, Leese HJ. Regulation of apoptosis in the bovine blastocyst by insulin and the insulin like growth factor (IGF) superfamily. Mol Reprod Dev 2002; 62:489 495. 178. Ma karevich AV, Markkula M. Apoptosis and cell proliferation potential of bovine embryos stimulated with insulin like growth factor I during in vitro maturation and culture. Biol Reprod 2002; 66:386 392. 179. Sirisathien S, Brackett BG. TUNEL analyses of bovi ne blastocysts after culture with EGF and IGF I. Mol Reprod Dev 2003; 65:51 56. 180. Kim S, Lee SH, Kim JH, Jeong YW, Hashem MA, Koo OJ, Park SM, Lee EG, Hossein MS, Kang SK, Lee BC, Hwang WS. Anti apoptotic effect of insulin like growth factor (IGF) I and its receptor in porcine preimplantation embryos derived from in vitro fertilization and somatic cell nuclear transfer. Mol Reprod Dev 2006; 73:1523 1530.

PAGE 115

115 181. Matsui M, Takahashi Y, Hishinuma M, Kanagawa H. Stimulation of the development of bovine embryos by insulin and insulin like growth factor I (IGF I) is mediated through the IGF I receptor. Theriogenology 1997; 48:605 616. 182. Prelle K, Stojkovic M, Boxhammer K, Motlik J, Ewald D, Arnold GJ, Wolf E. Insulin like growth factor I (IGF I) and long R(3)I GF I differently affect development and messenger ribonucleic acid abundance for IGF binding proteins and type I IGF receptors in in vitro produced bovine embryos. Endocrinology 2001; 142:1309 1316. 183. Block J, Wrenzycki C, Niemann H, Herrmann D, Hansen PJ. Effects of insulin like growth factor 1 on cellular and molecular characteristics of bovine blastocysts produced in vitro. Mol Reprod Dev 2008; 75:895 903. 184. Gwazdauskas FC, Thatcher WW, Wilcox CJ. Physiological, environmental, and hormonal factors at insemination which may affect conception. J Dairy Sci 1973; 56:873 877. 185. Roman Ponce H, Thatcher WW, Caton D, Barron DH, Wilcox CJ. Thermal stress effects on uterine blood flow in dairy cows. J Anim Sci 1978; 46:175 180. 186. De Rensis F, Scaramuzzi RJ. Heat stress and seasonal effects on reproduction in the dairy cow -a review. Theriogenology 2003; 60:1139 1151. 187. Roth Z. Heat stress, the follicle, and its enclosed oocyte: mechanisms and potential strategies to improve fertility in dairy cows. Re prod Domest Anim 2008; 43 Suppl 2:238 244. 188. Zeron Y, Ocheretny A, Kedar O, Borochov A, Sklan D, Arav A. Seasonal changes in bovine fertility: relation to developmental competence of oocytes, membrane properties and fatty acid composition of follicles. Reproduction 2001; 121:447 454. 189. Arav A, Zvi R. Do chilling injury and heat stress share the same mechanism of injury in oocytes? Mol Cell Endocrinol 2008; 282:150 152. 190. Al Katanani YM, Paula Lopes FF, Hansen PJ. Effect of season and exposure to he at stress on oocyte competence in Holstein cows. J Dairy Sci 2002; 85:390 396. 191. Al Katanani YM, Rivera RM, Hansen PJ. Seasonal variation in development of in vitro produced bovine embryos. Vet Rec 2002; 150:486 487. 192. Roth Z, Hansen PJ. Involvement of apoptosis in disruption of developmental competence of bovine oocytes by heat shock during maturation. In: Biol Reprod, vol. 71; 2004: 1898 1906.

PAGE 116

116 193. Putney DJ, Malayer JR, Gross TS, Thatcher WW, Hansen PJ, Drost M. Heat stress induced alterations in t he synthesis and secretion of proteins and prostaglandins by cultured bovine conceptuses and uterine endometrium. Biol Reprod 1988; 39:717 728. 194. Ealy AD, Drost M, Hansen PJ. Developmental changes in embryonic resistance to adverse effects of maternal h eat stress in cows. J Dairy Sci 1993; 76:2899 2905. 195. Rivera RM, Hansen PJ. Development of cultured bovine embryos after exposure to high temperatures in the physiological range. Reproduction 2001; 121:107 115. 196. Tompkins EC, Heidenreich CJ, Stob M. Effect of post breeding thermal stress on embyronic mortality in swine. In, vol. 26. J Anim Sci; 1967: 377 380. 197. Krininger CE, 3rd, Stephens SH, Hansen PJ. Developmental changes in inhibitory effects of arsenic and heat shock on growth of pre implantat ion bovine embryos. Mol Reprod Dev 2002; 63:335 340. 198. Sakatani M, Kobayashi S, Takahashi M. Effects of heat shock on in vitro development and intracellular oxidative state of bovine preimplantation embryos. Mol Reprod Dev 2004; 67:77 82. 199. Rivera RM Kelley KL, Erdos GW, Hansen PJ. Alterations in ultrastructural morphology of two cell bovine embryos produced in vitro and in vivo following a physiologically relevant heat shock. Biol Reprod 2003; 69:2068 2077. 200. Rivera RM, Kelley KL, Erdos GW, Hanse n PJ. Reorganization of microfilaments and microtubules by thermal stress in two cell bovine embryos. Biol Reprod 2004; 70:1852 1862. 201. Halliwell B, Aruoma OI. DNA damage by oxygen derived species. Its mechanism and measurement in mammalian systems. FEB S Lett 1991; 281:9 19. 202. Sakatani M, Yamanaka K, Kobayashi S, Takahashi M. Heat shock derived reactive oxygen species induce embryonic mortality in in vitro early stage bovine embryos. J Reprod Dev 2008; 54:496 501. 203. Paula Lopes FF, Hansen PJ. Heat shock induced apoptosis in preimplantation bovine embryos is a developmentally regulated phenomenon. Biol Reprod 2002; 66:1169 1177. 204. Hansen PJ. To be or not to be -determinants of embryonic survival following heat shock. Theriogenology 2007; 68 Suppl 1:S40 48.

PAGE 117

117 205. Rivera RM, Dahlgren GM, De Castro EPLA, Kennedy RT, Hansen PJ. Actions of thermal stress in two cell bovine embryos: oxygen metabolism, glutathione and ATP content, and the time course of development. Reproduction 2004; 128:33 42. 206. Fave tta LA, Madan P, Mastromonaco GF, St John EJ, King WA, Betts DH. The oxidative stress adaptor p66Shc is required for permanent embryo arrest in vitro. BMC Dev Biol 2007; 7:132. 207. Favetta LA, Robert C, St John EJ, Betts DH, King WA. p66shc, but not p53, is involved in early arrest of in vitro produced bovine embryos. Mol Hum Reprod 2004; 10:383 392. 208. Favetta LA, St John EJ, King WA, Betts DH. High levels of p66shc and intracellular ROS in permanently arrested early embryos. Free Radic Biol Med 2007; 4 2:1201 1210. 209. Betts DH, Madan P. Permanent embryo arrest: molecular and cellular concepts. Mol Hum Reprod 2008; 14:445 453. 210. Kurzawa R, Glabowski W, Baczkowski T, Brelik P. Evaluation of mouse preimplantation embryos exposed to oxidative stress cul tured with insulin like growth factor I and II, epidermal growth factor, insulin, transferrin and selenium. Reprod Biol 2002; 2:143 162. 211. Fabian D, Il'kova G, Rehak P, Czikkova S, Baran V, Koppel J. Inhibitory effect of IGF I on induced apoptosis in mo use preimplantation embryos cultured in vitro. Theriogenology 2004; 61:745 755. 212. Moss JI, Pontes E, Hansen PJ. Insulin like growth factor 1 protects preimplantation embryos from anti developmental actions of menadione. Arch Toxicol 2009; 83:1001 1007. 213. Herrler A, Krusche CA, Beier HM. Insulin and insulin like growth factor I promote rabbit blastocyst development and prevent apoptosis. Biol Reprod 1998; 59:1302 1310. 214. Paula Lopes FF, Hansen PJ. Apoptosis is an adaptive response in bovine preimpla ntation embryos that facilitates survival after heat shock. Biochem Biophys Res Commun 2002; 295:37 42. 215. Oropeza A, Wrenzycki C, Herrmann D, Hadeler KG, Niemann H. Improvement of the developmental capacity of oocytes from prepubertal cattle by intraova rian insulin like growth factor I application. Biol Reprod 2004; 70:1634 1643. 216. Bilby CR, Bader JF, Salfen BE, Youngquist RS, Murphy CN, Garverick HA, Crooker BA, Lucy MC. Plasma GH, IGF I, and conception rate in cattle treated with low doses of recomb inant bovine GH. Theriogenology 1999; 51:1285 1296.

PAGE 118

118 217. Bilby TR, Sozzi A, Lopez MM, Silvestre FT, Ealy AD, Staples CR, Thatcher WW. Pregnancy, bovine somatotropin, and dietary n 3 fatty acids in lactating dairy cows: I. Ovarian, conceptus, and growth hor mone insulin like growth factor system responses. J Dairy Sci 2006; 89:3360 3374. 218. Carrillo F, Hernandez Ceron J, Orozco V, Hernandez JA, Gutierrez CG. A single dose of bovine somatotropin 5 days before the end of progestin based estrous synchronizatio n increases prolificacy in sheep. Anim Reprod Sci 2007; 102:31 37. 219. Moreira F, Orlandi C, Risco CA, Mattos R, Lopes F, Thatcher WW. Effects of presynchronization and bovine somatotropin on pregnancy rates to a timed artificial insemination protocol in lactating dairy cows. J Dairy Sci 2001; 84:1646 1659. 220. Santos JE, Juchem SO, Cerri RL, Galvao KN, Chebel RC, Thatcher WW, Dei CS, Bilby CR. Effect of bST and reproductive management on reproductive performance of Holstein dairy cows. J Dairy Sci 2004; 87:868 881. 221. Flores R, Looper ML, Rorie RW, Lamb MA, Reiter ST, Hallford DM, Kreider DL, Rosenkrans CF, Jr. Influence of body condition and bovine somatotropin on estrous behavior, reproductive performance, and concentrations of serum somatotropin and plasma fatty acids in postpartum Brahman influenced cows. J Anim Sci 2007; 85:1318 1329. 222. Bell A, Rodriguez OA, de Castro EPLA, Padua MB, Hernandez Ceron J, Gutierrez CG, De Vries A, Hansen PJ. Pregnancy success of lactating Holstein cows after a singl e administration of a sustained release formulation of recombinant bovine somatotropin. BMC Vet Res 2008; 4:22. 223. Rizos D, Clemente M, Bermejo Alvarez P, de La Fuente J, Lonergan P, Gutierrez Adan A. Consequences of in vitro culture conditions on embryo development and quality. Reprod Domest Anim 2008; 43 Suppl 4:44 50. 224. Rizos D, Ramirez MA, Pintado B, Lonergan P, Gutierrez Adan A. Culture of bovine embryos in intermediate host oviducts with emphasis on the isolated mouse oviduct. Theriogenology 2010 ; 73:777 785. 225. Luo H, Kimura K, Aoki M, Hirako M. Vascular endothelial growth factor (VEGF) promotes the early development of bovine embryo in the presence of cumulus cells. J Vet Med Sci 2002; 64:967 971. 226. Sagirkaya H, Misirlioglu M, Kaya A, First NL, Parrish JJ, Memili E. Developmental potential of bovine oocytes cultured in different maturation and culture conditions. Anim Reprod Sci 2007; 101:225 240.

PAGE 119

119 227. de Moraes AA, Hansen PJ. Granulocyte macrophage colony stimulating factor promotes develop ment of in vitro produced bovine embryos. Biol Reprod 1997; 57:1060 1065. 228. Neira JA, Tainturier D, Pena MA, Martal J. Effect of the association of IGF I, IGF II, bFGF, TGF CSF, and LIF on the development of bovine embryos produced in vitro. Ther iogenology 2010; 73:595 604. 229. Paula Lopes FF, de Moraes AA, Edwards JL, Justice JE, Hansen PJ. Regulation of preimplantation development of bovine embryos by interleukin 1998; 59:1406 1412. 230. Lucy MC, Verkerk GA, Whyte BE, Macdonald KA, Burton L, Cursons RT, Roche JR, Holmes CW. Somatotropic axis components and nutrient partitioning in genetically diverse dairy cows managed under different feed allowances in a pasture system. J Dairy Sci 2009; 92:526 539. 231. Wang LM, Feng HL, Ma Y, Cang M, Li HJ, Yan Z, Zhou P, Wen JX, Bou S, Liu DJ. Expression of IGF receptors and its ligands in bovine oocytes and preimplantation embryos. Anim Reprod Sci 2009; 114:99 108. 232. Parrish JJ, Susko Parrish JL, Leibfried Rutledge ML, Critser ES, Eyestone WH, First NL. Bovine in vitro fertilization with frozen thawed semen. Theriogenology 1986; 25:591 600. 233. Fischer Brown A, Monson R, Parrish J, Rutledge J. Cell allocation in bovine embryos cultured in two media under two oxygen concentrations. Zygote 2 002; 10:341 348. 234. Sakurai T, Sakamoto A, Muroi Y, Bai H, Nagaoka K, Tamura K, Takahashi T, Hashizume K, Sakatani M, Takahashi M, Godkin JD, Imakawa K. Induction of endogenous interferon tau gene transcription by CDX2 and high acetylation in bovine nont rophoblast cells. Biol Reprod 2009; 80:1223 1231. 235. Wu M, Hall J, Akers RM, Jiang H. Effect of feeding level on serum insulin like growth factor I (IGF I) response to growth hormone injection. J Endocrinol 2010. 236. Falkenberg U, Haertel J, Rotter K, I wersen M, Arndt G, Heuwieser W. Relationships between the concentration of insulin like growth factor 1 in serum in dairy cows in early lactation and reproductive performance and milk yield. J Dairy Sci 2008; 91:3862 3868. 237. Livak KJ, Schmittgen TD. Ana lysis of relative gene expression data using real time quantitative PCR and the 2 Method. Methods 2001; 25:402 408. 238. Van Soom A, Boerjan ML, Bols PE, Vanroose G, Lein A, Coryn M, de Kruif A. Timing of compaction and inner cell allocation in bovine embryos produced in vivo after superovulation. Biol Reprod 1997; 57:1041 1049.

PAGE 120

120 239. Chitnis MM, Yuen JS, Protheroe AS, Pollak M, Macaulay VM. The type 1 insulin like growth factor receptor pathway. Clin Cancer Res 2008; 14:6364 6370. 240. Inoue A, Takeuch i S, Takahashi S. Insulin like growth factor I stimulated DNA replication in mouse endometrial stromal cells. J Reprod Dev 2005; 51:305 313. 241. Radcliff K, Tang TB, Lim J, Zhang Z, Abedin M, Demer LL, Tintut Y. Insulin like growth factor I regulates prol iferation and osteoblastic differentiation of calcifying vascular cells via extracellular signal regulated protein kinase and phosphatidylinositol 3 kinase pathways. Circ Res 2005; 96:398 400. 242. Van Soom A, Van Vlaenderen I, Mahmoudzadeh AR, Deluyker H, de Kruif A. Compaction rate of in vitro fertilized bovine embryos related to the interval from insemination to first cleavage. Theriogenology 1992; 38:905 919. 243. Holm P, Shukri NN, Vajta G, Booth P, Bendixen C, Callesen H. Developmental kinetics of the first cell cycles of bovine in vitro produced embryos in relation to their in vitro viability and sex. Theriogenology 1998; 50:1285 1299. 244. Alomar M, Tasiaux H, Remacle S, George F, Paul D, Donnay I. Kinetics of fertilization and development, and sex r atio of bovine embryos produced using the semen of different bulls. Anim Reprod Sci 2008; 107:48 61. 245. Kuijk EW, Du Puy L, Van Tol HT, Oei CH, Haagsman HP, Colenbrander B, Roelen BA. Differences in early lineage segregation between mammals. Dev Dyn 2008; 237:918 927. 246. Thompson JG, Partridge RJ, Houghton FD, Cox CI, Leese HJ. Oxygen uptake and carbo hydrate metabolism by in vitro derived bovine embryos. J Reprod Fertil 1996; 106:299 306. 247. Block J, Chase CC, Jr., Hansen PJ. Inheritance of resistance of bovine preimplantation embryos to heat shock: relative importance of the maternal versus paternal contribution. Mol Reprod Dev 2002; 63:32 37. 248. Paula Lopes FF, Chase CC, Jr., Al Katanani YM, Krininger CE, 3rd, Rivera RM, Tekin S, Majewski AC, Ocon OM, Olson TA, Hansen PJ. Genetic divergence in cellular resistance to heat shock in cattle: differenc es between breeds developed in temperate versus hot climates in responses of preimplantation embryos, reproductive tract tissues and lymphocytes to increased culture temperatures. Reproduction 2003; 125:285 294. 249. Hernandez Ceron J, Chase CC, Jr., Hanse n PJ. Differences in heat tolerance between preimplantation embryos from Brahman, Romosinuano, and Angus breeds. J Dairy Sci 2004; 87:53 58.

PAGE 121

121 250. Eberhardt BG, Satrapa RA, Capinzaiki CR, Trinca LA, Barros CM. Influence of the breed of bull (Bos taurus ind icus vs. Bos taurus taurus) and the breed of cow (Bos taurus indicus, Bos taurus taurus and crossbred) on the resistance of bovine embryos to heat. Anim Reprod Sci 2009; 114:54 61. 251. Lucy MC. Functional differences in the growth hormone and insulin like growth factor axis in cattle and pigs: implications for post partum nutrition and reproduction. Reprod Domest Anim 2008; 43 Suppl 2:31 39. 252. Soto P, Natzke RP, Hansen PJ. Identification of possible mediators of embryonic mortality caused by mastitis: a ctions of lipopolysaccharide, prostaglandin F2alpha, and the nitric oxide generator, sodium nitroprusside dihydrate, on oocyte maturation and embryonic development in cattle. Am J Reprod Immunol 2003; 50:263 272. 253. de Castro e Paula LA, Hansen PJ. Modif ication of actions of heat shock on development and apoptosis of cultured preimplantation bovine embryos by oxygen concentration and dithiothreitol. Mol Reprod Dev 2008; 75:1338 1350. 254. Robertson I, Nelson, R.E. Certification and identification of the e mbryo. Manual of the International Embryo Transfer Society. In: Stringfellow D.A., and Seidel S.M., ed IETS, Savoy, IL; 1998: 103 116. 255. Benjamini Y, Hochberg Y. Controlling the false discovery rate: apratical and powerful approach to multiple testing. In, vol. 57. J Royal Statistical Society: Series B; 1995: 289 300. 256. Byrne AT, Southgate J, Brison DR, Leese HJ. Effects of insulin like growth factors I and II on tumour necrosis factor alpha induced apoptosis in early murine embryos. Reprod Fertil Dev 2002; 14:79 83. 257. Thelie A, Papillier P, Pennetier S, Perreau C, Traverso JM, Uzbekova S, Mermillod P, Joly C, Humblot P, Dalbies Tran R. Differential regulation of abundance and deadenylation of maternal transcripts during bovine oocyte maturation in vitro and in vivo. BMC Dev Biol 2007; 7:125. 258. Lequarre AS, Grisart B, Moreau B, Schuurbiers N, Massip A, Dessy F. Glucose metabolism during bovine preimplantation development: analysis of gene expression in single oocytes and embryos. Mol Reprod Dev 19 97; 48:216 226. 259. Rieger D, Loskutoff NM, Betteridge KJ. Developmentally related changes in the uptake and metabolism of glucose, glutamine and pyruvate by cattle embryos produced in vitro. Reprod Fertil Dev 1992; 4:547 557. 260. Lim JM, Liou SS, Hansel W. Intracytoplasmic glutathione concentration and the role of beta mercaptoethanol in preimplantation development of bovine embryos. Theriogenology 1996; 46:429 439.

PAGE 122

122 261. Block J, Fischer Brown AE, Rodina TM, Ealy AD, Hansen PJ. The effect of in vitro tre atment of bovine embryos with IGF 1 on subsequent development in utero to Day 14 of gestation. Theriogenology 2007; 68:153 161. 262. Howlett M, Menheniott TR, Judd LM, Giraud AS. Cytokine signalling via gp130 in gastric cancer. Biochim Biophys Acta 2009; 1 793:1623 1633. 263. Guo X, Williams JG, Schug TT, Li X. DYRK1A and DYRK3 promote cell survival through phosphorylation and activation of SIRT1. J Biol Chem 2010; 285:13223 13232. 264. Butterick TA, Igbavboa U, Eckert GP, Sun GY, Weisman GA, Muller WE, Wood WG. Simvastatin stimulates production of the antiapoptotic protein Bcl 2 via endothelin 1 and NFATc3 in SH SY5Y cells. Mol Neurobiol 2010; 41:384 391. 265. Shen SM, Yu Y, Wu YL, Cheng JK, Wang LS, Chen GQ. Downregulation of ANP32B, a novel substrate of ca spase 3, enhances caspase 3 activation and apoptosis induction in myeloid leukemic cells. Carcinogenesis 2010; 31:419 426. 266. Zhang L, Pan X, Hershey JW. Individual overexpression of five subunits of human translation initiation factor eIF3 promotes mali gnant transformation of immortal fibroblast cells. J Biol Chem 2007; 282:5790 5800. 267. Kimura J, Kudoh T, Miki Y, Yoshida K. Identification of dihydropyrimidinase related protein 4 as a novel target of the p53 tumor suppressor in the apoptotic response t o DNA damage. Int J Cancer 2010. 268. Radu M, Chernoff J. The DeMSTification of mammalian Ste20 kinases. Curr Biol 2009; 19:R421 425. 269. Bharti AC, Aggarwal BB. Ranking the role of RANK ligand in apoptosis. Apoptosis 2004; 9:677 690. 270. Wang H, Tsang B K. Nodal signalling and apoptosis. Reproduction 2007; 133:847 853. 271. Aznar S, Lacal JC. Rho signals to cell growth and apoptosis. Cancer Lett 2001; 165:1 10. 272. Hayes JD, Flanagan JU, Jowsey IR. Glutathione transferases. Annu Rev Pharmacol Toxicol 200 5; 45:51 88. 273. Beuckmann CT, Fujimori K, Urade Y, Hayaishi O. Identification of mu class glutathione transferases M2 2 and M3 3 as cytosolic prostaglandin E synthases in the human brain. Neurochem Res 2000; 25:733 738.

PAGE 123

123 274. Martin SF, Buron I, Espinosa JC, Castilla J, Villalba JM, Torres JM. Coenzyme Q and protein/lipid oxidation in a BSE infected transgenic mouse model. Free Radic Biol Med 2007; 42:1723 1729. 275. Kawasaki T. Antioxidant function of coenzyme Q. J Nutr Sci Vitaminol (Tokyo) 1992; Spec No :552 555. 276. Choi J, Oh S, Lee D, Oh HJ, Park JY, Lee SB, Lim DS. Mst1 FoxO signaling protects Naive T lymphocytes from cellular oxidative stress in mice. PLoS One 2009; 4:e8011. 277. Ling P, Lu TJ, Yuan CJ, Lai MD. Biosignaling of mammalian Ste20 relate d kinases. Cell Signal 2008; 20:1237 1247. 278. Qiao M, Wang Y, Xu X, Lu J, Dong Y, Tao W, Stein J, Stein GS, Iglehart JD, Shi Q, Pardee AB. Mst1 is an interacting protein that mediates PHLPPs' induced apoptosis. Mol Cell 2010; 38:512 523. 279. Hemmati Bri vanlou A, Melton D. Vertebrate embryonic cells will become nerve cells unless told otherwise. Cell 1997; 88:13 17. 280. Dean C, Dresbach T. Neuroligins and neurexins: linking cell adhesion, synapse formation and cognitive function. Trends Neurosci 2006; 29 :21 29. 281. Sawaishi Y. Review of Alexander disease: beyond the classical concept of leukodystrophy. Brain Dev 2009; 31:493 498. 282. Charrier E, Reibel S, Rogemond V, Aguera M, Thomasset N, Honnorat J. Collapsin response mediator proteins (CRMPs): involv ement in nervous system development and adult neurodegenerative disorders. Mol Neurobiol 2003; 28:51 64. 283. McCaffery P, Drager UC. Retinoic acid synthesizing enzymes in the embryonic and adult vertebrate. Adv Exp Med Biol 1995; 372:173 183. 284. Chiba S Kurokawa MS, Yoshikawa H, Ikeda R, Takeno M, Tadokoro M, Sekino H, Hashimoto T, Suzuki N. Noggin and basic FGF were implicated in forebrain fate and caudal fate, respectively, of the neural tube like structures emerging in mouse ES cell culture. Exp Brai n Res 2005; 163:86 99. 285. Kong XB, Zhang C. Dickkopf (Dkk) 1 promotes the differentiation of mouse embryonic stem cells toward neuroectoderm. In Vitro Cell Dev Biol Anim 2009; 45:185 193. 286. Kinoshita N, Sasai N, Misaki K, Yonemura S. Apical accumulati on of Rho in the neural plate is important for neural plate cell shape change and neural tube formation. Mol Biol Cell 2008; 19:2289 2299.

PAGE 124

124 287. Falls DL. Neuregulins: functions, forms, and signaling strategies. Exp Cell Res 2003; 284:14 30. 288. Ihle JN. S TATs: signal transducers and activators of transcription. Cell 1996; 84:331 334. 289. Zong CS, Chan J, Levy DE, Horvath C, Sadowski HB, Wang LH. Mechanism of STAT3 activation by insulin like growth factor I receptor. J Biol Chem 2000; 275:15099 15105. 290. Guerin P, El Mouatassim S, Menezo Y. Oxidative stress and protection against reactive oxygen species in the pre implantation embryo and its surroundings. Hum Reprod Update 2001; 7:175 189. 291. Shehab El Deen MA, Leroy JL, Fadel MS, Saleh SY, Maes D, Van Soom A. Biochemical changes in the follicular fluid of the dominant follicle of high producing dairy cows exposed to heat stress early post partum. Anim Reprod Sci 2010; 117:189 200. 292. Lorenzo PL, Illera MJ, Illera JC, Illera M. Enhancement of cumulus e xpansion and nuclear maturation during bovine oocyte maturation in vitro by the addition of epidermal growth factor and insulin like growth factor I. J Reprod Fertil 1994; 101:697 701. 293. Herrier A, Einspanier R, Schams D, Niemann H. Effect of recombinan t bovine somatotropin (rBST) on follicular IGF I contents and the ovarian response following superovulatory treatment in dairy cows: a preliminary study. Theriogenology 1994; 41:601 611. 294. Moreira F, Badinga L, Burnley C, Thatcher WW. Bovine somatotropi n increases embryonic development in superovulated cows and improves post transfer pregnancy rates when given to lactating recipient cows. Theriogenology 2002; 57:1371 1387.

PAGE 125

125 BIOGRAPHICAL SKETCH Aline Quadros Santos Bonilla was born in Itabuna and raise d in Ilhus Bahia, Brazil. In 2000 she received her degree in veterinary medicine from the Universidade Federal de Viosa and in 2003 she finished he r m U niversity. Her M.S. thesis, concerning in nutrition and reproduction in Nelore bulls, was completed under the direction of Dr Jos Domingos Guimares. Following graduation, Dr Bonilla worked in veterinary service and embryo transfer in Barrado Garas MT and then Campo Grande MS, Brazil. In 2006, Dr. Bonilla and her husband L uciano moved to Gainesville and she started her Doct or of Philosophy degree in the a nimal m olecular and c ellular b iology graduate program, in the laboratory of Dr Peter J. Hansen. In the fall of 2010 Dr. Bonilla wil l start a post doctoral program.