<%BANNER%>

Genetic Differentiation Between the Recently Formed Allopolypoid Tragopogon Mirus and Its Diploid Parents

Permanent Link: http://ufdc.ufl.edu/UFE0042083/00001

Material Information

Title: Genetic Differentiation Between the Recently Formed Allopolypoid Tragopogon Mirus and Its Diploid Parents
Physical Description: 1 online resource (165 p.)
Language: english
Creator: Koh, Jin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: gene, homeolog, polyploidy, proteomics, tragopogon
Biology -- Dissertations, Academic -- UF
Genre: Botany thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Polyploidy (genome doubling) has played an important role in speciation and genome evolution in diverse organisms, particularly in plants. Although many polyploid species have formed repeatedly, the patterns and consequences of genome evolution and gene expression are largely unknown for natural polyploid populations of independent origin. Therefore, the goals of this study were to: 1) examine genomic changes and expression differences in natural and synthetic allopolyploid T. mirus relative to its diploid parents (T. dubius and T. porrifolius), as well as synthetic diploid F1 hybrids; 2) investigate in detail gene expression patterns of selected genes; and 3) compare the proteomic profiles among the diploid parents, natural and synthetic allopolyploids (S1), and a synthetic diploid F1 hybrid. Genomic and cDNA CAPS analyses indicated that plants representing multiple populations of this young natural allopolyploid have experienced frequent and preferential elimination of homeologous loci. Comparable analyses of synthetic F1 hybrids showed only additivity. These results suggest that loss of homeologs and changes in gene expression are not the immediate result of hybridization, but are processes that occur following polyploidization, occurring during the early ( < 40) generations of the young polyploid. Genomic and cDNA CAPS provide evidence that gene expression changes, while still rapid in evolutionary time, may also occur gradually over several generations in the recently and recurrently formed allotetraploid T. mirus. However, most studies on gene expression patterns do not distinguish between the relative contribution of each parental homeolog. Therefore, the relative expression patterns of homeologs were examined for ten genes, which showed additivity in the CAPS study using qRT-PCR. A careful examination of the expression patterns of homeologs showed quantitative differences in expression. In addition to these genomic and transcript expression patterns, proteomic profiles were also investigated, and the results indicated that the hybridization effect may be more pronounced in the proteome than polyploidization. Comparison of the proteome with the previous transcript study revealed that there is no good correlation between transcript and protein expression levels in T. mirus which has also been reported in Brassica, Arabidopsis, humans, and yeast, suggesting that post-transcriptional processes might control protein expression. Further studies of gene expression based on differentially expressed proteins are needed to explore the regulatory mechanisms that underlie physiological changes or phenotypic variation in the evolution of the allopolyploid Tragopogon system.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jin Koh.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Soltis, Douglas E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042083:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042083/00001

Material Information

Title: Genetic Differentiation Between the Recently Formed Allopolypoid Tragopogon Mirus and Its Diploid Parents
Physical Description: 1 online resource (165 p.)
Language: english
Creator: Koh, Jin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: gene, homeolog, polyploidy, proteomics, tragopogon
Biology -- Dissertations, Academic -- UF
Genre: Botany thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Polyploidy (genome doubling) has played an important role in speciation and genome evolution in diverse organisms, particularly in plants. Although many polyploid species have formed repeatedly, the patterns and consequences of genome evolution and gene expression are largely unknown for natural polyploid populations of independent origin. Therefore, the goals of this study were to: 1) examine genomic changes and expression differences in natural and synthetic allopolyploid T. mirus relative to its diploid parents (T. dubius and T. porrifolius), as well as synthetic diploid F1 hybrids; 2) investigate in detail gene expression patterns of selected genes; and 3) compare the proteomic profiles among the diploid parents, natural and synthetic allopolyploids (S1), and a synthetic diploid F1 hybrid. Genomic and cDNA CAPS analyses indicated that plants representing multiple populations of this young natural allopolyploid have experienced frequent and preferential elimination of homeologous loci. Comparable analyses of synthetic F1 hybrids showed only additivity. These results suggest that loss of homeologs and changes in gene expression are not the immediate result of hybridization, but are processes that occur following polyploidization, occurring during the early ( < 40) generations of the young polyploid. Genomic and cDNA CAPS provide evidence that gene expression changes, while still rapid in evolutionary time, may also occur gradually over several generations in the recently and recurrently formed allotetraploid T. mirus. However, most studies on gene expression patterns do not distinguish between the relative contribution of each parental homeolog. Therefore, the relative expression patterns of homeologs were examined for ten genes, which showed additivity in the CAPS study using qRT-PCR. A careful examination of the expression patterns of homeologs showed quantitative differences in expression. In addition to these genomic and transcript expression patterns, proteomic profiles were also investigated, and the results indicated that the hybridization effect may be more pronounced in the proteome than polyploidization. Comparison of the proteome with the previous transcript study revealed that there is no good correlation between transcript and protein expression levels in T. mirus which has also been reported in Brassica, Arabidopsis, humans, and yeast, suggesting that post-transcriptional processes might control protein expression. Further studies of gene expression based on differentially expressed proteins are needed to explore the regulatory mechanisms that underlie physiological changes or phenotypic variation in the evolution of the allopolyploid Tragopogon system.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jin Koh.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Soltis, Douglas E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042083:00001


This item has the following downloads:


Full Text

PAGE 1

1 GENETIC DIFFERENTIATION BETWEEN THE RECENTLY FORMED ALLOPOLYPOID T ragopogon mirus AND ITS DIPLOID PARENTS By JIN KOH A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF TH E REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Jin Koh

PAGE 3

3 To my parents

PAGE 4

4 ACKNOWLEDGMENTS I thank my advisors, Douglas Soltis and Pamela Soltis, for their guidance and consistent support throughout my P hD program. Their boundless enthusiasm for science, warm encouragement, and generosity of time led me to complete this work and further help me continue scientific research. I would also like to thank Sixue Chen and John Davis, members of my committee, for their guidance, good disposition and positive feedback. My gratitude for former and current Soltis lab members should be expressed here. In particular, I want to thank Mi Jeong Yoo, Jennifer Tate, Andrew Doust, Richard Buggs, Evgeny Mavrodiev, Matt Gitzendanner, Sangtae Kim, Matyas Buzgo, Andr Chanderbali for their discussion and help with experimental procedures and analytical methods. This work was supported by National Science Foundation (NSF) grants MCB 0346437 and DEB 0614421. In addition, I express my gratitude to the Chen lab members, Ning Zhu and Mengmeng Zhu who helped me analyze the proteome data. Also, I would like to thank Carolyn Diaz, Ran Zheng, Fahong Yu to the ICBR staff at the University of Florida, and Il Ho Kang who providing his databas e at Iowa State University. Finally, I highly thank my family, both immediate and extended, for their endless love and support. Particularly, I am thankful to my parents, who have always encouraged me to do what I want and their devotion and support made i t possible for me to do this work. I would like to express my thanks to my two kids, YooShin and YooMin. You two provide me with invaluable experience and delight. Also, I thank my parents in law, who have always encouraged me. I would like to thank my w ife, Mi Jeong, for her love, trust, encouragement, and support. She is my best friend as well as an excellent discussion partner. At the last part, I appreciate my maternal grandfather who show and suggest the biological field in my life.

PAGE 5

5 TABLE OF CONTENTS ACKNOWLEDGMENTS .................................................................................................. 4 page LIST OF TABLES ............................................................................................................ 7 LIST OF FIGURES .......................................................................................................... 8 ABSTRACT ..................................................................................................................... 9 CHAPTER 1 INTRODUCTION .................................................................................................... 11 2 HOMEOLOG LOSS AND EXPRESSION CHANGES IN NATURAL POPULATIONS OF THE RECENTLY AND REPEATEDLY FORMED ALLOTETRAPLOID Tragopogon mirus (ASTERACEAE) ....................................... 18 Introduction ............................................................................................................. 18 Materials and Methods ............................................................................................ 23 Plant Materials .................................................................................................. 23 cDNAAFLP Display and Identification of Polymorphic Fragments .................. 24 CAPS Analyses ................................................................................................ 26 R esults .................................................................................................................... 29 cDNAAFLP Polymorphism and Identification of Putatively Differentially Expressed Genes .......................................................................................... 29 Rapid L oss of Parental Homeologs .................................................................. 31 Diploid F1 Hybrids are Additive of Their Parental Genomes ............................. 33 Discussion .............................................................................................................. 34 cDNAAFLP V ariation in P opulations of T. mirus ............................................. 34 Rapid G enomic C hanges in T. mirus ................................................................ 35 Genomic C hanges versus D ifferential E xpression in T. mi rus : ......................... 39 Conclusions ............................................................................................................ 42 3 UNEQUAL EXPRESSION OF DUPLICATED GENES IN THE RECENTLY FORMED ALLO TETRAPLOID Tragopogon mirus (ASTERAC EAE) ...................... 71 Introduction ............................................................................................................. 71 Materials and Methods ............................................................................................ 75 Plant Materials .................................................................................................. 75 RNA Extraction, Purification and cDNA Synthesis .......................................... 75 Quantitative Real T ime RT PCR (qRT PCR) ................................................... 76 Results .................................................................................................................... 79 qRT PCR Resu lts corroborate Previous CAPS Analysis Results for T. mirus .. 79 Biased E xpression P attern s in Natural Populations of T. mirus ........................ 80 Stochastic E xpression Patterns in T. mirus ...................................................... 81

PAGE 6

6 Expression Patterns in F1 Hybrids and Synthetic T. mirus (S1 and S2) ............. 82 Discussion .............................................................................................................. 83 C is and Trans acting R egulation on N onadditive ly Expressed G enes ............ 84 Stochastic and Rapid Expression C hanges in T. mirus .................................... 86 Conclusions ............................................................................................................ 88 4 PROTEOMIC PROFILES IN THE RECENTLY FORMED ALLOPOLYPLOID, Tragopogon mirus (ASTERACEAE) AND ITS DIPLOID PARENTS .................... 108 Introduction ........................................................................................................... 108 Materials and Methods .......................................................................................... 111 Plant M aterials ................................................................................................ 111 Protein P reparation ........................................................................................ 112 Protein Digestion, iTRAQ Labeling, and Strong Cation Exchange Fractionation ............................................................................................... 112 Data Analysis ................................................................................................. 113 Results .................................................................................................................. 115 Tragpogon P rotein I dentification ..................................................................... 115 Proteome V ariation in Leaf Tissue of the Diploid Parents .............................. 116 Proteome V ariation in the N atural A llopolyploid T. mirus ............................... 117 Proteome Variation in Natural and Synthetic Allopolyploids and Diploid F1 Hybrids ........................................................................................................ 117 Differences between the Diploid F1 Hybrid and the Natural Allopol yploid T. mirus ........................................................................................................... 119 C haracterization of the Proteins Displaying Nonadditive Patterns .................. 120 C omparison of Proteome Data with Transc ript Data ...................................... 121 Discussion ............................................................................................................ 121 Technical Challenges of Proteomic Analysis of Allopolyploid T. mirus and its Parents ........................................................................................................ 122 Novel Insights into the Proteomes of Natural and Synthetic Allopolyploids and F1 Hybrids ............................................................................................ 124 Correlation between P rotein Expression and G e ne T ranscript D ata in T. mirus ........................................................................................................... 125 Conclusion s .......................................................................................................... 126 5 CONCLUSION ...................................................................................................... 143 LIST OF REFERENCES ............................................................................................. 148 BIOGRAPHICAL SKETCH .......................................................................................... 165

PAGE 7

7 LIST OF TABLES Table page 2 1 Summ ary of populations used in this study ............................................................. 44 2 2 Primer combination for selective amplification and used in cDNA AFLP analyses 45 2 3 Summary of cDNA AFLPs population study ........................................................... 46 2 4 Primer information used in genomic and cDNA CAPS analyses ............................. 47 2 5 Putative identities for a subset of polymorphic cDNA AFLP fragments ................... 51 2 6 Homeologous loci and restriction enzymes examined in T. mirus with genomic and cDNA anaylses ................................................................................................ 53 2 7 Presence of homeologous loci in seven populations of T. mirus on the basis of genomic CAPS analyses ........................................................................................ 56 2 8 Re tention of homeologous loci in seven populations of T. mirus on the basis of cDNA CAPS analyses ............................................................................................. 60 3 1 Summary of populations and individual numbers used in this study; numbers are Soltis and Soltis collection number ................................................................... 89 3 2 Synthetic Tragopogon mirus lines and its pursuing generation ............................... 90 3 3 Primer sequences used in thi s study. Tdu and Tpo indicate T. dubius and T. porrifolius homeolog specific primer ........................................................................ 91 3 4 Expression patterns in T. mirus inferred from quantitative Real time PCR. ............ 93 4 1 Plant materials used in this study and their plex number in iTRAQ ....................... 128 4 2 Variation between T. porrifolius individuals in leaf proteome ................................ 129 4 3 Variation between T. dubius individuals in leaf proteome ..................................... 130 4 4 Variation between T. porrifolius and T. dubius in leaf proteome ........................... 131 4 5 Variation between T. mirus individuals in leaf proteom e ....................................... 132 4 6 Analysis of leaf proteomes of F1 hybrid, synthetic T. mirus (S1), and natural T. mirus ..................................................................................................................... 133 4 7 Differentially expressed proteins in synthetic diploid F1 hybrid, polyploid (S1), and natural allopolyploid T. mirus ......................................................................... 134

PAGE 8

8 LI ST OF FIGURES Figure page 2 1 Genomic and cDNA CAPS analyses for a putative homolog of FRUCTOSEBISPHOSPHATE ALDOLASE ............................................................................... 62 2 2 Genomic and cDNA CAPS analyses illustrating homeolog loss in a putative homolog of THIOREDOXIN M TYPE 1 .................................................................. 63 2 3 Genomic CAPS analysis of ADENINEDNA GLYCOSYLAS E ................................ 64 2 4 Genomic and cDNA CAPS analyses illustrating homeolog loss in a putative homolog of MYOSIN HEAVY CHAIN CLASS XI .................................................... 65 2 5 Genomic and cDNA CAPS analyses of NUCLEAR RIBOSOMAL DNA .................. 66 2 6 Genomic and cDNA CAPS analyses illustrating homeolog loss as well as silencing in a putative homolog of GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE. .............................................................................................. 67 2 7 Genomic and cDNA CAPS analyses for 15 candidate genes from Tragopogon F1 hybrids and their porgenitors. ............................................................................. 68 3 1 Real T ime RT PCR a nalys e s of genes showing the biased expression due to the unequal contribution of a parental genome to T. mirus ..................................... 94 3 2 Real T ime RT PCR analys e s of genes showing biased expression with disagreement between genomic and transcriptomic expression levels ................... 96 3 3 Real T ime RT PCR analys e s of genes showing variable e xpression patterns ....... 99 3 4 Genomic CAPS analyses of FRUCTOSE BISPHOSPHATE ALDOLASE which exhibits additivity in synthetic S1 and S2 generations ........................................... 101 3 5 Real T ime RT PCR analys e s of all individuals from F1 hybrids (Hy) to synthetic generation (S1 and S2) ......................................................................................... 102 3 6 Real T ime RT PCR analyses of the four specific lines from F1 hybrids (Hy) to synthetic generation (S1 and S2) ........................................................................... 105 4 1 Classification of the identified proteins into molecular functions ........................... 138 4 2 Ven diagram showing differentially expressed proteins among F1 hy brid, synthetic (S1) and natural T. mirus ...................................................................... 139 4 3 Expression patterns of proteins that are commonly differentially expressed in T. mirus F1 hybrids, and synthetic generation (S1) ................................................... 140

PAGE 9

9 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC DIFFERENTIATION BETWEEN THE RECENTL Y FORMED ALLOPOLYPOID T ragopogon mirus AND ITS DIPLOID PARENTS By Jin Koh August 2010 Chair: Douglas E. Soltis Major: Botany Polyploidy (genome doubling) has played an important role in speciation and genome evolution in diverse organisms, particularly in plants. Although many polyploid species have formed repeatedly, the patterns and consequences of genome evolution and gene expression are largely unknown for natural polyploid populations of independent origin. Therefore, the goals of this study were to: 1) examine genomic changes and expression differences in natural and synthetic allopolyploid T. mirus relative to its diploid parents ( T. dubius and T. porrifolius ) as well as synthetic diploid F1 hybrids ; 2) investigate in detail gene expression patterns of selected genes ; and 3) compare the proteomic profiles among the diploid parents, natural and synthetic allopolyploids (S1), and a synthetic diploid F1 hybrid. Genomic and cDNA CAPS analyses indicated that plants representing multiple populations of thi s young natural allopolyploid have experienced frequent and preferential elimination of homeologous loci. Comparable analyses of synthetic F1 hybrids showed only additivity. These results suggest that loss of homeologs and changes in gene expression are not the immediate result of hybridization, but are processes that occur following polyploidization, occurring

PAGE 10

10 during the early (<40) generations of the young polyploid. G enomic and cDNA CAPS provide evidence that gene expression changes, while still rapid in evolutionary time, may also occur gradual ly over several generations in the recently and recurrently formed allotetraploid T. mirus However, most studies on gene expression patterns do not distinguish between the relative contribution of each parental homeolog. Therefore, the relative expression patterns of homeologs were examined for ten genes, which showed additivity in the CAPS study using qRTPCR. A careful examination of the expression patterns of homeologs showed quantitative differences in expressi on In addition to these genomic and transcript expression patterns, proteomic profiles were also investigated, and the result s indicated that the hybridization effect may be more pronounced in the proteome than polyploidization. Comparison of the proteome with the previous transcript study revealed that there is no good correlation between transcript and protein expression level s in T. mirus which has also been reported in Brassica Arabidopsis humans, and yeast, suggesting that post transcriptional proce sses might control protein expression. Further studies of gene expression based on differentially expressed proteins are needed to explore the regulatory mechanisms that underlie physiological changes or phenotypic variation in the evolution of the allopol yploid Tragopogon system.

PAGE 11

11 CHAPTER 1 INTRODUCTION Polyploidy is a major evolutionary force in plants with a long history of investigation (CLAUSEN et al. 1945; DARLINGTON 1937; LEWIS 1980a; LEWIS 1980b; MNTZING 1936; STEBBINS 1947; STEBB INS 1950; STEBBINS 1971) Recently, there has been an enormous surge of interest in the genetic, genomic, and epigenetic consequences of polyploid evolution (ADAMS et al 2003; AINOUCHE et al. 2004a; BAUMEL et al. 2001; BUGGS et al. 2010; BUGGS et al. 2009b; BUGGS et al. 2009c; CHAUDHARY et al. 2009; CHAUDHARY et al. 2008; COMAI et al. 2000; FELDMAN et al. 1997; FLAGEL and WENDEL 2009; FORTUNE et al. 2007; GAETA et al. 2007; HEGARTY et al. 2008; HEGARTY et al. 2006; HEGARTY and HISCOCK 2008; HEGARTY et al. 2005; HOVAV et al. 2008a; HOVAV et al. 2008b; HOVAV et al. 2008d; KASHKUSH et al. 2002; KASHKUSH et al. 2003; KOVARIK et al. 2005; LAWRENCE et al. 2004; LEE and CHEN 2001; LIU et al. 2001; LUKENS et al. 2004; LUKENS et al. 2006; MADLUNG et al. 2005; MARMAGNE et al. 2010; MATYEK et al. 2007; OZKAN et al. 2001; PIRES et al. 2004a; PUMPHREY et al. 2009; SALMON et al. 2005; SHAKED et al. 2001; SONG et al. 1995; SYMONDS et al. 2010; TATE et al. 2009a; TATE et al. 2006; TUSKAN et al. 2006; WANG et al. 2006b; WANG et al. 2004; ZHAO et al. 1998) Genomic data have provided unprecedented new insights into polyploidy. As just one example, genomic data have completely modified tr aditional views on the frequency of polyploidy in flowering plants (angiosperms). During the past 70 years, plant biologists have provided a series of estimates of the frequency of polyploidy in angiosperms. STEBBINS (1950), GOLDBLATT ( 1980), and others us ed base chromosome numbers to estimate the frequency of polyploidy in angiosperms. They suggested that at least 40% of all angiosperms were of polyploid origin. MASTERSON (1994) compared

PAGE 12

12 stomatal size in fossil and extant taxa and estimated that 70% of al l angiosperms have experienced one or more episodes of polyploidy OTTO and WHITTON (2000) examined the distribution of haploid chromosome numbers in various lineages (e.g. ferns, monocots, and mammals), and observed a large excess of even over odd haploi d numbers; this saw toothed pattern is difficult to explain by any mechanism other than frequent polyploidy. This signature arises because the haploid number is even following autotetraploidy, or allopolyploidy with the same number of chromosomes (monobasic allotetraploidy). Using this signature, OTTO and WHITTON (2000) developed a new method to estimate the frequency of polyploidy. They estimated that roughly 2 4% of all speciation events in angiosperms and approximately 7% in ferns involve polyploidy. They further stated that polyploidization may be the single most common mechanism of sympatric speciation in plants. Genomic studies have shown, howevever, that even the small genomes of Arabidopsis and rice, long thought to be classic examples of diploid plants, are the result of genome doubling (BOWERS et al. 2003; PATERSON et al. 2004) Analyses of other complete genom e sequences have revealed evidence of ancient polyploidization (genome or tandem duplication) events in Populus trichocarpa (TUSKAN et al. 2006) Vitis vinifera (JAILLON et al. 2007; VELASCO et al. 2007) Cucumis sativus (HUANG et al. 2009) Carica papaya (MING et al. 2008) Sorghum bicolor (PATERSON et al. 2009) Zea mays (WEI et al. 2007) and Glycine ma x (SCHMUTZ et al. 2010) Investigations of the rice ( Oryza sativa) genome similarly suggest ancient polyploidy in the early history of the grass family (Poaceae) (Paterson et al., 2004; Yu et al., 2005; (INTERNATIONAL RICE GENOME SEQUENCING PROJECT 2005)

PAGE 13

13 Furthermore, genomic data (including ESTs analyses) have provided evidence for ancient polyploidy for other angiosperms (KU et al. 2000) including the basal grade of angiosperm Nuphar advena, the magnoliids Persea americana, Liriodendron tulipifera, and Saruma henryi, the basal monocot Acorus americanus and the basal eudicot Eschscholzia californica (CUI et al. 2006) Therefore, it now appears that all angiosperms may have undergone at least one round of genome duplication at some point in their evolutionary history. Hence, the question being asked on a broad level is no longer the frequency of polyploidy across the angiosperms, but the number of polyploid events experienced by any given li neage (SOLTIS et al. 2009) Because of the extremely high frequency of polyploidy in plants it is a critical ev olutionary process to understand. Much of our current understanding of polyploidy is based on analyses of crops such as cotton (ADAMS et al. 2003; ADAMS et al. 2004; CHAUDHARY et al. 2009; CHAUDHARY et al. 2008; FLAG EL and WENDEL 2009; HOVAV et al. 2008a; HOVAV et al. 2008b; HOVAV et al. 2008d; LIU et al. 2001; TUSKAN et al. 2006; ZHAO et al. 1998) wheat (BAHRMAN and THIELLEMENT 1987; BOTTLEY and KOEBNER 2008; BOTTLEY et al. 2 006; FELDMAN et al. 1997; HE et al. 2003; ISLAM et al. 2003a; ISLAM et al. 2003b; KASHKUSH et al. 2002; KASHKUSH et al. 2003; LEVY and FELDMAN 2004; OZKAN et al. 2001; PUMPHREY et al. 2009; SHAKED et al. 2001) and Brassica (GAETA et al. 2007; LUKENS et al. 2004; LUKENS et al. 2006; MARMAGNE et al. 2010; OSBORN 2004; PIRES et al. 2004b; SONG et al. 1995) However, several naturally occurring species have unique attributes for the investigation of polyploids. One suc h natural system is the genus Tragopogon.

PAGE 14

14 Tragopogon (Asteraceae) comprises ca. 150 species distributed throughout Europe, temperate Asia and North Africa (BORISOVA 1964; BREMER 1994; MAVRODIEV et al. 2007) Most sp ecies are diploid (2n = 12), but some polyploid species or cytotypes have been reported (OWNBEY 1950) the most well known of which are the recently formed allotetraploids, T. mirus and T. miscellus. The formation of these two allotetraploids involves three diploid species ( T. dubius T. porrifolius, and T. pratensis ) that were introduced from Europe into the Palouse region of eastern Washington and adjacent Idaho, USA, in the early 1900s (OWNBEY 1950; SOLTIS et al. 2004) The introduction of these diploid species into the Palouse brought them into close contact; hybridization occurred and ultimately two new allotetraploids w ere formed (reviewed in SOLT IS et al 2004). However, these allotetralpoids have never formed in their native ranges because their progenitors are largely allopatric in the Old World (SOLTIS et al. 2004) Using morphology and cytology, OWNBEY (1950) demonstrate d that T. mirus and T. miscellus are allotetraploids (2n = 24) whose diploid parents are T. dubius and T. porrifolius and T. dubius and T. pratensis respectively. These three diploids did not co occur in the Palouse prior to 1928 (OWNBEY 1950) So, T. mirus and T. miscellus cannot be more than 80 years old (SOLTIS et al. 2004) Given that these plants appear to be biennials, the timeframe involved in the formation of these tetraploids, may be fewer than 4 0 generations (SOLTIS et al. 2004) The ancestries of both tetraploids were confirmed through flavonoid, isozymic and DNA studies (BREHM and OWNBEY 1965; COOK et al. 1998; KROSCHEWSKY et al. 1969; OWNBEY and MCCOLLUM 1953; OWNBEY and MCCOLLUM 1954; ROOSE and GOTTLIEB 1976; SOLTIS and SOLTIS 1989; SOLTIS et al. 1995; SOLTIS and SOLTIS 1991)

PAGE 15

15 Investigation of T mirus and T. miscellus should provide important insights into the early stages of polyploid evolution. As noted, the two allotetraploids formed very recently, within the past 80 years; only a few other polyploids are known to have formed within the past 200 years: Cardamine schulzii (URBANSKA et al. 1997) Spartina anglica (AINOUCHE et al. 2004a; BAUMEL et al. 2001; HUBBARD 1965; HUSKINS 1930; MARCHANT 1967; MARCHANT 1 968; RAYBOULD et al. 1991) Senecio cambrensis (ASHTON and ABBOTT 1992; ROSSER 1955) Senecio eboracensis (ABBOTT and LOWE 2004) Not only have T. mirus and T. miscellus formed recently, but in addition they have formed multiple times. Morphological and cytological (OWNBEY and MCCOLLUM 1953; OWNBEY and MCCOLLUM 1954) isozymic (ROOSE and GOTTLIEB 1976; SOLTIS et al. 1995) and particularly DNA evidence (COOK et al. 1998; SOLTIS and SOLTIS 1989; SOLTIS and SOLTIS 1991; SYMONDS et al. 2010) when considered along with geographical distribution, suggests that there may be as many as 21 lineages of separate origin of T. miscellus and 1 1 of T. mirus just in the Palouse (SOLTIS et al. 2004; SOLTIS and SOLTIS 2000) Thus, T. mirus and T. miscellu s provide a unique opportunity to investigate the consequences of recent and recurrent polyplody. Therefore, the goals of this study were to investigate the genetic/genomic changes, as well as changes in gene expression in a recently formed allopolyploid and its diploid parents. In addition, the proteomic changes were investigated to see how proteome of the natural allopolyploid species differ s from its diploid parents. In addition, artificial diploid F1 hybrid and synthetic generations will be examined to check assess whether hybridization or genome doubling plays the most important role in the early evolut ion of the transcriptome and proteome in Tragopogon polyploids. The major portion of the

PAGE 16

16 work was done with the recently formed North American allopolyploid T. mirus and its diploid parents ( T. dubius and T. porrifolius ). The goals of this study were to: ( 1) examine genomic changes and expression differences in T. mirus relative to its diploid parents as well as synthetic diploid F1 hybrids, (2) investigate in detail gene expression patterns of selected genes in synthetic T. mirus (generations S1 and S2) us ing quantitative real time PCR (qRT PCR), and (3) examine the proteomic profiles of the diploid parents, natural and synthetic allopolyploids, and a synthetic diploid F1 hybrid using isobaric tags for relative and absolute quantification liquid chromatography mass spectrometry/mass spectrometry (iTRAQ LC MS/MS ). These goals are addressed in the following f our chapters In C hapter 2, I examined genomic changes and differential expression in T. mirus relative to its diploid parents This work was done using t wo different experimental strategies. First, I initially employed cDNA amplified fragment length polymorphisms (cDNA AFLPs) to identify potentially differentially expressed genes and then I determined whether cDNAAFLP fragment polymorphisms resulted from genomic changes or expression differences using both genomic and cDNA cleaved amplified polymorphic sequence ( CAPS) analyses. In C hapter 3, I tried to assess the relative contribution of the two diploid progenitors to the transcriptome of both natural and synthetic allopolyploid T. mirus as well as synthetic diploid F1 hybrids between the two diploid parents using qRT PCR application with ten specific genes, which are selected from the first study (chapter 2).

PAGE 17

17 In C hapter 4, I analyzed the proteomic profi les of natural allopolyploid T. mirus and its diploid parents as well as synthetic diploid F1 hybrids and synthetic allopolyploids (S1) using iTRAQ LC MS/MS. Furthermore, the proteome identified here was compared with the results of qRTPCR ( C hapter 3), so the correlation between transcripts and proteomes was evaluated. Also, through the comparison of a F1 hybrid and synthetic polyploid (S1 generation) I inferred which process, hybridization or genome doubling, plays the most important role in the polyploid y evolution of Tragopogon. Chapter 5 provides general conclusions in which I summarize what has been done and what I learned about differentiation at the genomic, transcriptomic, and proteomic levels between natural and synthetic allopolyploid T. mirus and its diploid parents. In addition, I propose future directions that will help to infer evolutionary patterns of duplicated genes in polyploids.

PAGE 18

18 CHAPTER 2 HOMEOLOG LOSS AND EXPRESSION CHANGES IN NATURAL POPULATIONS OF THE RECENTLY AND REPEATEDLY FORMED ALLOTETRAPLOID T ragopogon mirus (ASTERACEAE) Introduction *Reprinted with permissi on from the BioMed Central. Original publication: Koh, J. P. S. Soltis, and D. E. Soltis. 2010. Homeolog loss and expression changes in natural populations of the recently and repeatedly formed allotetraploid Tragopogon mirus (Asteraceae) Polyploidy is a particularly important evolutionary mechanism in flowering plants (ADAMS 2007; KASHKUSH et al. 2002; SOLTIS and SOLTIS 1999; WENDEL and DOYLE 2005) During the past 70 years, many plant biologists have estimated the frequency of polyploidy in the angiosperms using analysis of base chromosome numbers (OTTO and WHITTON 2000; SOLTIS et al. 2003; STEBBINS 1950) as well as measurements of stomatal size in fossil and extant taxa (MASTERSON 1994) Based on these approaches, researchers estimated that from 40% to 70% of angiosperms have experienced polyploidy in their evolutionary history (GOLDBLATT 1980; MASTERSON 1994; OTTO and WHITTON 2000; STEBBINS 1950) Recent genomic studies indicate, however, that polyploidy is even more prevalent in angiosperm lineages than previously suspected. Sequencing of the entire nuclear genome of Arabidopsis thaliana indicated two or three rounds of genomewide duplication (ARABIDOPSIS GENOME INITIATIVE 2000; BLANC et al. 2003; BOWERS et al. 2003; SIMILLION et al. 2002; STERCK et al. 2007; VISION et al. 2000; ZHANG 2003; ZHANG et al. 2002) Complete genome sequences also indicate multiple ancient polyploidy events in Populus trichocarpa and Vitis vinifera (JAILLON et al. 2007; TUSKAN et al. 2006; VEL ASCO et al. 2007) Genomic data (including analyses of ESTs) indicate ancient polyploidy for other angiosperms (KU et al. 2000) including the basal angiosperm Nuphar advena, the magnoliids Persea americana, Liriodendron tulipifera,

PAGE 19

19 and Saruma henryi, the basal monocot Acorus americanus and the basal eudicot Esch scholzia californica (CUI et al. 2006) It now appears that all angiosperms may have undergone at least one round of genome duplication (reviewed in LYNCH and CONERY 2000; SCANNELL et al 2006). S everal outcomes for duplicated genes are possible at the genomic and transcriptional levels. First, both members of a duplicate gene pair may retain their original function. Second, one copy of a duplicate gene pair may retain the original function, but the other copy may become lost or silenced (ADAMS 2007; LYNCH and CONERY 2000; PRINCE and PICKETT 2002; SCANNELL et al. 2006; STERCK et al. 2007; TATE et al. 2006; ZHANG 2 003) Third, duplicate genes may partition the original gene function (subfunctionalization), with one copy active, for example, in one tissue and the other copy active in another tissue (ADAMS et al. 2003; FORCE et al. 1999; LYNCH and CONERY 2000; LYNCH and FORCE 2000; LYNCH et al. 2001; PRINCE and PICKETT 2002) Fourth, one copy may retain the original function, while the other develops a new function (neofunctionalization) (BENDEROTH et al. 2006; DES MARAIS and RAUSHER 2008; DREA et al. 2006; OHNO 1970; TESHIMA and INNAN 2008; TIROSH and BARKAI 2007; VAN DAMME et al. 2007) Recent studies have revealed varied consequences of genome evolution and gene expression following pol yploidy in diverse angiosperms, including Arabidopsis (COMAI et al. 2000; LAWRENCE et al. 2004; LEE and CHEN 2001; MADLUNG et al. 2005; WANG et al. 2006b; WANG et al. 2004) and crops such as cotton (ADAMS et al. 2003; LIU et al. 2001; ZHAO et al. 1998) wheat (FELDMAN et al. 1997; KASHKUSH et al. 2002; KASHKUSH et al. 2003; OZKAN et al. 2001; SHAKED et al. 2001) and Brassica (GAETA et

PAGE 20

20 al. 2007; LUKENS et al. 2004; LUKENS et al. 2006; SONG et al. 1995) Several investigations have shown that following polyploidy, rapid genomic rearrangement (PONTES et al. 2007; SHAKED et al. 2001; SONG et al. 1995) gene loss (KASHKUSH et al. 2002; LUKENS et al. 2006; SHAKED et al. 2001) or gene silencing via DNA methylation (COMAI et al. 2000; LEE and CHEN 2001; LUKENS et al. 2006; MADLUNG et al. 2005; SHAKED et al. 2001; WANG et al. 2004) may occur. However, few analyses have explored the genetic and genomic consequences of allopolyploidy in natural systems. Six natural allopolyploids are known to have formed within the past 150 years, thus affording the opportunity to examine the nearly immediate consequences of polyploidization in nature: Cardamine schulzii (URBANSKA et al. 1997) Senecio cambrensis (ABBOTT et al. 2007; ABBOTT and LOWE 2004; ASHTON and ABBOTT 1992; HEGARTY et al. 2006; HEGARTY and HISCOCK 2008; ROSSER 1955) S enecio eboracensis (ABBOTT and LOWE 2004) Spartina anglica (AINOUCHE et al. 2004b; HUBBARD et al. 1978; HUSKINS 1930; RAYBOULD et al. 2000; SALMON et al. 2005) and Tragopogon mirus and T. miscellus (KOVARIK et al. 2005; MATYEK et al. 2007; OWNBEY 1950; SOLTIS et al. 2004; SONG et al. 1995; TATE et al. 2006) Several studies of these recently formed allopolyploids show evidence of either genomic or expression level changes, relative to their diploid parents. For example, SALMON et al. (2005) showed that methylation patterns differ between the hexaploid parents ( Spartina maritima and S. alterniflora ), the independently formed hybrids ( Spartina townsendii and S. neyrautii ), and the allopolyploid S. anglica (formed from Spartina townsendii ) In Senecio, hybridization of diploid S. squalidus with tetraploid S. vulgaris forms a sterile triploid, S. baxteri and subsequent genome duplication produced the allohexaploid S. cambrensis Through

PAGE 21

21 microarray analysis of floral gene expression patterns in synthetic S. cambrensis lines, HEGARTY et al (2005, 2006) observed that the synthetic hybrid S. baxteri showed immediate transcriptional changes compared to the parental expression patterns, and that this transcriptional shock was subsequently calmed in allohexaploid S. cambrensis suggesting that hybridization and polyploidization have distinct effects on largescale gene expression in this sy stem. One of the best systems for the study of naturally occurring polyploids is provided by the genus Tragopogon (Asteraceae). Tragopogon comprises ca. 100 to 150 species distributed throughout Europe, temperate Asia, and North Africa (BORISOVA 1964; BREMER 1994; MAVRODIEV et al. 2007) Three diploid species ( T. dubius T. porrifolius, and T. pratensis ) were introduced from Europe into the Palouse region of eastern Washington and adjacent Idaho, USA, in the early 1900s (OWNBEY 1950; SOLTIS et al. 2004) The introduction of these three diploid species brought them into close contact, and as a result, two allotetraploid species ( T. mirus and T. miscellus ) formed (OWNBEY 1950) First collected in 1949 (OWNBEY 1950) these recently formed polyploids are less than 80 years old. Morphological, cytological, flavonoid, isozymic, and DNA evidence confirmed the ancestries of these two allotetraploids (BREHM and OWNBEY 1965; COOK et al. 1998; OWNBEY and MCCOLLUM 1953; OWNBEY and MCCOLLUM 1954; ROOSE and GOTTLIEB 1976; SOLTIS and SOLTIS 1989; SOLTIS and SOLTIS 1995) Multiple lines of evidence suggest that T. miscellus has formed recurrently, possibly as many as 21 times, including reciprocal formation, and T. mirus has formed repeatedly perhaps 11 times (but not reciprocally) (SOLTIS et al. 2004; SOLTIS et al. 1995; SOLTIS and SOLTIS 2000) Therefore, T. mirus and T. miscellus afford unique opportunities for the

PAGE 22

22 investigation of r ecent and recurrent polyploid evolution. In fact, nearly every population of these species may have formed independently (SYMONDS et al. 2010) TATE et al (2006, 2009a) and BUGGS et al. (2009) studied genom ic changes and expression differences of homeologs within natural populations of Tragopogon miscellus as well as in synthetic F1 hybrids and first generation polyploids formed from the diploid parents T. dubius and T. pratensis Most of the genes analyzed show additivity in T. miscellus at both the genomic (seven out of 23) and cDNA levels (12 out of 17). However, loss of one parental homeolog was observed at several loci (27 out of 46 homeologs), as were several examples of gene silencing (nine out of 34 homeologs). Both homeolog losses and silencing patterns vary among individuals in natural polyploid populations of independent origin (BUGGS et al. 2009b; TATE et al. 2006) Changes were also detected in rDNA content (KOVARIK et al. 2005) and expression (MATYEK et al. 2007) in populations of T. miscellus Although T. miscellus has fewer rDNA repeats of T. dubius than of T. pratensis (KOVARIK et al. 2005) apparently due to concerted evolution, most of the rDNA expression derives from the T. dubius repeats (MATYEK et al. 2007) The same pattern of rDNA e xpression has been observed in populations of T. mirus compared to its parents (KOVARIK et al. 2005; MATYEK et al. 2007) ; T. mirus has fewer repeats of T. dubius than of T. porrifolius (KOVARIK et al. 2005) but most of the rRNA is produced by the T. dubius copies (MATYEK et al. 2007) Although homeolog loss events and expression changes were observed in natural populations of T. mi scellus no such changes were observed in comparable analyses of F1 hybrids between the diploid parents, T. dubius and T. pratensis (BUGGS et al. 2009b; TATE et al. 2006) or in first generation synthetic lines (BUGGS et al. 2009b)

PAGE 23

23 In this study we extend our examination of gene loss and differential expression to the polyploid T. mirus In nature, T. mirus has formed repeatedly, but only when T. dubius is the paternal parent and T. porrifolius is the maternal parent (OWNBEY 1950; SOLT IS and SOLTIS 1989) However, T. mirus can be produced synthetically in both directions with about equal frequency (TATE et al. 2009b) Tragopogon mirus provides an opportunity to compare expression differences at the genomic and transcriptional levels with the results obtained for T. miscellus (BUGGS et al. 2009b; TATE et al. 2006) Our main objectives were to: 1) investigate the genomic changes and expression differences of parental homeologs in T. mirus relative to its diploid parents, 2) determine the identity of the genes that exhibit those changes, and 3) assess whether individuals within and among recurrently formed natural populations of T. mirus show similar patterns of genome evolution and gene expression. Materials and Methods Plant Materials For populations Pullman1 and 2, Palouse, and Ros alia, seeds were collected from natural populations and grown in the greenhouse at Washington State University (Pullman, WA, USA) and allowed to self fertilize. Seeds from these greenhouse grown plants were collected, germinated, and grown under controlled conditions in the greenhouse at the University of Florida (UF; Gainesville, FL, USA). Seeds from the Oakesdale, Tekoa, and Arizona populations were collected and then grown at UF without a round of selfing. Each population of T. mirus is inferred to be of separate origin (SYMONDS et al. 2010) and was analyzed, along with samples of the diploid progenitors from each location (Table 21; 70, 83, 84). However, only the paternal

PAGE 24

24 parent, T. dubius was investigat ed for populations from Oakesdale, Rosalia, Tekoa, and Arizona because T. porrifolius was not found at those sites. Diploid F1 hybrids used in this study were generated by J. Tate, who crossed T. dubius (261111, Pullman1; the paternal progenitor) and T. porrifolius (2613 24, Pullman 1; the maternal progenitor) using plants grown from seed in the greenhouse(TATE et al. 2009b) cDNAAFLP Display and Identification of Polymorphic Fragments Here, following TATE et al (2006), we initially employed cDNA amplified fragment length polymorphisms (cDNA AFLPs) to identify potentially differentially ex pressed genes (BACHEM et al. 1996) This approach has proven to be useful in systems without welldeveloped genetic resources (ADAMS et al. 2004; COMAI 2000; HE et al. 2003; KASHKUSH et al. 2002; LEE and CHEN 2001; TATE et al. 2006; WANG et al. 2005) However, the weakness of this approach is that fragment differences observed on a cDNAAFLP gel may result from true expression differences, sequence polymorphisms, or gene or homeolog loss (TATE et al. 2006; WANG et al. 2006b) Due to this limitation, we subsequently examined the expression patterns of genes isolated from cDNA AFLPs using genomic and cDNA CAPS analysis (KONIECZNY and AUSUBEL 1993; TATE et al. 2006) This approach can determine whether apparent expression differences observed at the transcriptional level result from genomic changes such as gene loss or from true differences in express ion. Putative homeolog losses were further tested via DNA sequencing. Leaf segments less than 30 cm in length were collected from young plants six weeks after germination. Due to heavy latex in the leaf tissue, we extracted total RNA from leaf tissue using the method of KIM et al. (2004) which combines a CTAB

PAGE 25

25 extraction protocol (DOYLE and DOYLE 1987) and subsequent use of the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). cDNA was synthesized from total RNA using SuperScript DoubleStranded cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA), and the cDNAAF LP technique was performed as previously described (LEE and CHEN 2001) except that we replaced isotopebased signal detection with silver staining (SAMBROOK and RUSSELL 2001) To investigate the utility of cDNA AFLPs in T. mirus we conducted an initial survey of the Pullman 1 population with 37 primer combinations. Following the success of this survey, expanded cDNA AFLP analyses were conducted on 510 individuals each from the Pullman 1, Pullman 2, and Palouse populations of T. mirus and from the diploid progenitors that occurred with the tetraploid po pulations. We employed the same methods, using the primer sets that were the most variable in our initial screen (21 for Pullman 1 and four each for Pullman2 and Palouse; Table 22). We analyzed 56 individuals: 20 of T. mirus 16 of T. dubius and 20 of T porrifolius from the Pullman1, Pullman 2, and Palouse populations, respectively (Table 21). The expressed bands on cDNAAFLP gels were scored as monomorphic (present in all individuals) or polymorphic (present in at least one individual/absent in at least one individual) (Table 2 3). From the expanded cDNA AFLP work, 125 variable fragments exhibiting novel, maternal/paternal, or other polymorphic patterns were identified from the Pullman1, Pullman 2, and Palouse populations. To determine the putative identity of these fragments, we excised and sequenced fragments over 250 bp in size, as described in LEE and CHEN (2001), WANG et al. (2005), and TATE et al. (2006). The polymorphic

PAGE 26

26 bands were cut from the polyacrylamide gels, and the fragments were reamplified using the same set of selective amplification primers and cloned using a Topo TA Cloning Kit (Invitrogen). Sequencing was performed with the CEQ DTCS Quick Start Kit (Beckman Coulter, Fullerton, CA, USA). To identify the sequences obtained above, we used BLAST searches against the NCBI database ( http://www.ncbi.nlm.nih.gov ) and the sequence identity was rechecked against the Compositae Genome Project database ( http://compgenomics.ucdavis.edu) Identified sequences have been deposited in the EMBL/GenBank database under accession nos (Table 24). CAPS Analyses To determine if cDNA AFLP fragment polymorphisms resulted from genomic changes or expression differences, we conducted both genomic and cDNA CAPS analyses. In CAPS analyses, amplified PCR products are digested with diagnostic restriction enzymes that distinguish the diploid parental sequences, and the fragments are separated by agarose gel electrophoresis For this study we included populations of T. dubius and T. mirus from Oakesdale, Tekoa, and Rosalia, Washington, and from Arizona, in addition to the Pullman 1, Pullman 2, and Palouse populations. Therefore, 100 individuals were examined for genomic CAPS analyses (Table 21): 40 of T. mirus 40 of T. dubius and 20 of T. porrifolius with 5 10 individuals per population. For cDNA CAPS analyses, we analyzed 40 individuals of T. mirus 36 of T. dubius and 20 of T. porrifolius with 5 10 individuals per population (Table 21). We also analyzed 6 F1 hybrid plants using both genomic and cDNA CAPS to determine whether genomic changes and expression differences appear in the first generation hybrids.

PAGE 27

27 For CAPS analyses, we used 30 primer sets: 23 primer sets were designed based on the sequences that were variable in the cDNA AFLP analysis of the Pullman1, Pullman 2, and Palouse populations, and 7 primer sets were from studies of T. miscellus (BUGGS et al. 2009b; TATE et al 2006) To design primer sets, we first BLASTed our fragments against Lactuca or Helianthus ESTs and then used the hit ESTs for primer design because the ESTs are likely longer than the isolated fragments, with a greater chance that the expressed sequence spans the introns in genomic DNA. With those primer sets, we amplified fragments from T. dubius and T. porrifolius and then confirmed their sequences. From those sequences, we redesigned the primer sets to be more specific for analysis of Tragopogon CAPS. All primers were designed using the web interface program, Primer3 (v. 0.4.0; http://frodo.wi.mit.edu/ ). Primer sequence information is given in Table 24. For each of the 30 gene regions, we aligned DNA seque nces from the diploid parents using Sequencher v. 4.1.4 (Gene Codes Corporation, Ann Arbor, MI, USA) and identified diagnostic restriction sites between the species. Genomic CAPS analyses: We isolated genomic DNA from 100 individuals of the allotetraploid and its two progenitors using a modified CTAB protocol (DOYLE and DOYLE 1987) buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.1 mM each primer, and 0.5 unit Taq polymerase (Promega, Madison, WI, USA). Thermal cycling conditions were as follows: 95C for 2 min, follow ed by 35 cycles of 95C for 30 sec, 5456C for 30 sec, 72C for 1 min 20 sec, and a final 7min extension at 72C. Products were separated on a 1.5% agarose gel, stained with ethidium bromide, and visualized using a UV transilluminator.

PAGE 28

28 Genomic digests we product, 2 units of restriction enzyme (New England Biolabs, Ipswich, MA, USA), and temperature for 9 hr. Digest ed products were separated on 24% agarose gels, stained with ethidium bromide or SyberGold (Invitrogen), and visualized using a transilluminator. To determine whether putative homeolog losses observed in genomic CAPS analyses were due to true homeolog loss or simply a loss of a restriction site (due to sequence polymorphism in one parental fragment in the polyploid) we sequenced the initial PCR product. A homeolog loss would yield only one parental diploid sequence, whereas loss of a restriction site in one parent would still yield both parental DNA sequences. cDNA CAPS analyses: We isolated total RNAs from 96 of the individuals analyzed for genomic CAPS (see above) using the method of KIM et al (2004) and the RNeasy Plant Mini Kit (Qiagen). The first st RNA using Superscript II reverse transcriptase (Invitrogen) with a poly T (T17) primer. Using the same primer sets as for 15 of the loci in the genomic CAPS analyses, RTPCR was carried out using 50 ng of template from the first volume with 20 ng template, 5X buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.1 mM each primer, and 0.5 unit Taq polymerase (Promega). The remaining 15 genes could not be amplified from these cDNAs; the reasons for this are unc lear, but perhaps these genes were not expressed in the leaf tissue sampled for cDNA CAPS. For amplification of fragments and digestion of RTPCR products, we employed basically the same approach as described for the genomic CAPS analyses. In addition, for NUCLEAR

PAGE 29

29 RIBOSOMAL DNA, the relative PCR band intensities of the two homeologs were measured using KODAK 1D Image Analysis Software (Kodak, Rochester, NY, USA). R esults cDNAAFLP Polymorphism and Identification of Putatively Differentially Expressed Genes We used cDNA AFLPs (PATHAN et al. 2007; REINEKE and LOBMANN 2005; TATE et al. 2006) as a first step toward identifying genes with putative differential expression in the allotetraploid T. mirus relative to its diploid parents ( T. dubius and T. porrifolius ) From our initial screen with 3 7 primer pairs 1,440 fragments were produced, and of these, 504 were monomorphic ( 35.0%), and 936 were polymorphic ( 65.0%) among the three species. N ovel cDNAAFLP bands in the pol yploid plants comprised 0 4 % ( 6 fragments) of all fragments fragments in the polyploids of maternal origin constituted 5.0% (72 fragments) of all fragments, while fragments having a paternal origin in the polyploids made up 3.5% (51 fragments) of all fragments. From this initial screening, we selected for further study 21 of the 37 primer sets, which produced an average of 50 different fragments per primer pair. From the remaining 16 primer sets, we obtained an average of 24 different fragments, but these were too short (below 250 bp) for further analysis. We then conducted an analysis on an expanded sample of the Pullman1 population and its progenitors (10 individuals of T. mirus 10 individuals of T. porrifolius and 6 individuals of T. dubius ) to obtain a larger set of potentially informative fragments. From the 21 primer pairs, 1 056 fragments were produced, and of these, 375 were monomorphic (35. 5 %), and 681 were polymorphic (64.5%) ( Table 23 ). Novel cDNAAFLP fragments in the polyploids comprised 0.6% (6 fragments) of all fragments.

PAGE 30

30 Shared fragments with a maternal or paternal origin in the polyploids represented 6.3% (67 fragments) or 4.6% (49 fragments) of the total fragments, respectively. For the Pullman2 and Palouse sites, we selected four prim er sets ( Eco RI AA/ Mse I CTT, Eco RI AG/ Mse I CTT, Eco RI AG/ Mse I CAT, Eco RI TG/ Mse I CTT) that showed high variation in populations from the Pullman1 site. At the Pullman 2 site 234 fragments were scored, and of these, 116 were monomorphic (49.6%), and 118 were polymorphic (50.4%) (Table 2 3 ) Novel cDNAAFLP bands in the polyploids accounted for 0.4 % ( 1 fragment ) of all fragments, and fragments of maternal or paternal origin in the polyploids made up 7.7% ( 18 fragments) and 8.1% ( 1 9 fragments) of all bands, r espectively At the Palouse site, 251 fragments were scored, and of these, 79 were monomorphic (31.5%) and 172 were polymorphic (68.5%) (Table 2 3 ) F ragments with a maternal or paternal origin in the polyploids made up 6.8% (1 7 fragments) and 5.2% (1 3 fragments) of all fragments respectively. No novel cDNAAFLP bands were detected in polyploid plants from Palouse. When we compared 20 individuals of T. mirus from the Pullman 1, Pullman 2, and P a louse populations, we observed very similar patterns in the P ullman 1 and Pullman2 populations. However, individuals of T. mirus from Palouse have more complex patterns than individuals of T. mirus from Pullman 1 and Pullman2. Individuals 26021 and 2602 3 from Palouse shared an AFLP pattern, whereas 2602 2 and 26024 showed a different pattern. T here are at least three genotypes among the five individuals of T. mirus from Palouse With 125 variable fragments (>350 bp) identified from cDNA AFLP analyses we then searched for fragment identity based on sequence sim ilarity using BLAST

PAGE 31

31 searches and identified 33 putative genes in T. mirus (Table 25). Further comparison with the Arabidopsis genome indicated that these genes are involv ed in various cellular processes such as carbohydrate metabolism, signal transduction, protein transport and degradation, and cell division (Table 2 5 ) However, we could not reliably identify the remainder of the fragments because of their short length (~150 bp). Rapid L oss of Parental Homeologs The genes enzymes, and sizes of digested genomic and cDNA amplifications for CAPS analysis of T. mirus and its parents are listed in Table 26 For the genomic CAPS analysis, 20 of 30 genes showed additivity, with both parental copies maintained in all allopolyploid individuals (Figure 21). Nine of 30 genes showed that at least one allotetraploid individual was missing one parental homeolog (Figure 22, Table 27). To determine whether these losses were due to true homeolog loss or simply loss of a restriction site (due to sequence polymorphism ) we sequenced the PCR fragments of all genes exhibiting putative losses. Sequencing revealed that all individuals exhibiting apparent loss events have only one parental homeolog, confirming that these inferred homeolog losses are not due to restriction sit e divergence and loss of a CAPS marker. Two genes exhibited homeolog losses of one parental copy or the other in at least one individual, whereas seven genes showed loss of only the T. dubius homeolog. For the putative homolog of THIOREDOXIN M TYPE 1 one Pullman 1 T. mirus plant (260110) showed loss of the T. porrifolius band, while one plant of Palouse T. mirus (26024) exhibited loss of the T. dubius band (Figure 22, Table 27). For the putative NUCLEIC ACID BINDING homolog, eight T. mirus plants from the Pullman 2 (26783 and 267811), Oakesdale (26734), and Arizona (17471, 17472, 17473, 17476,

PAGE 32

32 17479) populations showed loss of the T. porrifolius band, while one Palouse T. mirus individual (260225) lost the T. dubius band. In contrast, preferential loss of the T. dubius parental homeolog was observed in several individuals for seven genes (putatively identified as MYOSIN HEAVY CHAIN CLASS XI, LRR PROTEIN, PRENYLTRANSFERASE, NADP/FAD OXIDOREDUCTASE, TETRATRICOPEPTIDE REPEAT PROTEIN, RNA BINDING and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE). In addition, variation was observed among populations; losses of the T. dubius homeolog occurred at more loci in the Pullman1, Pullman 2, and Palouse populations than in the Oakesdale, Rosalia, Tekoa, and Ari zona populations. For example, individuals from the Palouse population showed loss of the T. dubius homeolog for four genes, while individuals from the Oakesdale population exhibited gene loss for only one gene (Table 27). Therefore, the Pullman1, Pullma n 2, and Palouse populations of T. mirus show higher levels of, and greater variation in, homeolog loss than do populations from Oakesdale, Rosalia, Tekoa, and Arizona. However, one putative gene ( A DENINEDNA GLYCOSYLASE) was polymorphic in both T. mirus a nd T. dubius (Figure 23). Most individuals of T. dubius have a single copy of this gene, but five T. dubius individuals have an extra copy that corresponds to the PCR amplicon produced in T. porrifolius Also, six T. dubius individuals only have the T. p orrifolius type (Figure 23). This polymorphism observed in T. dubius can affect interpretation of the expression patterns of T. mirus making it hard to distinguish loss from polymorphism. As a result of this polymorphism, this gene was not employed in our analyses of loss events.

PAGE 33

33 cDNA CAPS analysis was performed for 15 of 30 genes. The remaining 15 genes analyzed above for genomics CAPS could not be amplified. Eleven of the genes included in the cDNA analyses showed additivity, whereas four genes (putati ve homologs of THIOREDOXIN M TYPE 1 MYOSIN HEAVY CHAIN CLASS XI NUCLEAR RIBOSOMAL DNA and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE) showed expression differences in some polyploid individuals relative to the diploid parents. However, the apparent expres sion differences from the THIOREDOXIN M TYPE 1 and MYOSIN HEAVY CHAIN CLASS XI result from genomic losses (see above; Figures 23, 24). For the other two genes, true expression differences were detected. For the putative homolog of NUCLEAR RIBOSOMAL DNA cDNA CAPS showed absence of the T. dubius homeolog in one individual of T. mirus (26023) from Palouse, while genomic CAPS found additive patterns in all tetraploid individuals (Figure 25). Also, a putative homolog of GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE showed silencing in T. mirus in six individuals from Pullman 1 ( 26015, 260110, 260112, 260114, 260145, and 260147), three individuals from Pullman 2 ( 26781, 26782, and 267811 ), one individual from Palouse ( 26021 ), and one individual from Oake sdale (26735) (Figure 26, Table 28). In summary, 27 of 40 individuals sampled of T. mirus showed loss of at least one homeolog, and 12 individuals exhibited true loss of expression of one parental homeolog (Tables 27, 28). Diploid F1 Hybrids are Addi tive of Their Parental Genomes Genomic CAPS analyses for six synthetic F1 hybrids from two independent crosses between T. dubius and T. porrifolius were also performed for the same 30 genes surveyed in natural populations of T. mirus Significantly, all ge nomic CAPS

PAGE 34

34 analyses of F1 hybrids exhibited additivity of the parental homeologs. cDNA CAPS analysis for all 15 genes investigated in natural populations of T. mirus showed that both parental homeologs were expressed in all F1 hybrids examined (Figure 27) Discussion cDNAAFLP V ariation in P opulations of T. mirus As cDNAAFLPs reveal potentially differentially expressed genes, the results can provide useful initial information on the genetics of polyploids, especially those that lack developed genomic resources, such as Tragopogon. Thus, cDNAAFLPs provide numerous candidate genes relatively quickly and inexpensive ly. However, cDNAAFLP analysis must be followed by other approaches, such as CAPS analysis, because cDNAAFLP fragment differences may result from true expression differences, sequence polymorphism, or gene or homeolog loss (TATE et al. 2006; WANG et al. 2005) From cDNAAFLPs, we identified 33 putative genes that were not additive of the parental bands in T. mirus ; most of these (21 out of 33) exhibited maternal banding patterns (Table 25). However, subsequent analysis of 23 of these genes using genomic and cDNA CAPS analyses showed that only four of these genes exhibited an expression difference; two genes, THIOREDOXIN M TYPE 1 and MYOSIN HEAVY CHAIN CLASS XI showed homeolog losses, while NUCLEAR RIBOSOMAL DNA and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE exhibited true silencing (Figure 26, Table 28). However, most of the genes exhibiting apparent maternal, paternal, or novel banding patterns in cDNA AFLPs actually showed additive patterns in genomic and cDNA CAPS analyses, indicating that the cDNA AFLP fragment differences observed in T. mirus may be derived from sequence polymorphism and are not indicative of homeolog loss or silencing.

PAGE 35

35 Rapid G enomic C hanges in T. mirus Analyses of CAPS markers provide evidence of rapid, frequent, and preferential elimination of homeologous loci and changes in gene expression in allotetraploid individuals of T. mirus Most of the genes examined showed genomic CAPS patterns that are additive of the parental genes, but nine genes of the 30 examined showed homeolog loss, fewer than observed for T. miscellus in which 16 loci of the 23 examined showed homeolog loss (BUGGS et al. 2009b; TATE et al. 2009a; TATE et al. 2006) In T. mirus the T. dubius parental homeolog has been lost at more loci (12.1%; 7 out of 58 homeologs) than the T. porrifolius homeolog (6.9%; 4 out of 58 homeol ogs). Likewise, in T. miscellus T. dubius parental homeolog has been lost at more loci (32.6%; 15 out of 46 homeologs) than the T. pratensis homeolog (26.1%; 12 out of 46 homeologs) (BUGGS et al. 2009b; TATE et al. 2009a; TATE et al. 2006) However, the T. porrifolius homeolog has actually been lost from more individuals of T. mirus (25) than has the T. dubius homeolog (10), in contrast to data for T. miscellus (BUGGS et al. 2 009b; TATE et al. 2006) This difference between T. mirus and T. miscellus results from the extensive loss of the T. porrifolius homeolog for NADP/FAD OXIDOREDUCTASE. Furthermore, each homeolog absence in a polyploid should not necessary be viewed as a unique loss, as a single loss may subsequently be transmitted throughout a population. The preferential loss of T. dubius homeologs also agrees with the biased rDNA homogenization of T. dubius repeats to the other diploid parental type in both T. miscellus a nd T. mirus (KOVARIK et al. 2005) That is, the number of T. dubius rDNA units has typically been greatly reduced in the genomes of T. mirus and T. miscellus

PAGE 36

36 relative to the other diploid parent (either T. porrifoli us or T. pratensis ) due to apparent concerted evolution (KOVARIK et al. 2005; MATYEK et al. 2007) The single exception is the Palouse population of T. mirus in which individuals have a relatively high number of T. dubius rDNA repeats relative to T. porrifolius repeats within the plants from Palouse (KOVARIK et al. 2005) illustrating variation in rDNA repeat composition among populations of T. mirus of independent origin. In contrast, allopolyploids in Arabidopsis and Brassica apparently have not undergone loss or concerted evolution of rDNA units (BENNETT and SMITH 1991; O KANE et al. 1996) However, rapid concerted evolution of rDNA units in just a few generations (SKALICKA et al. 2003; SKALICKA et al. 2005) has occurred in some synthetic hybrids and allotetraploids, including synthetic hybrids between maize and Tripsacum (LIN et al. 1985) somatic hybrids of Medicago sativa (CLUSTER et al. 1996) synthetic Nicotiana allotetraploids (LIM et al. 2006; SKALICKA et al. 2003) and synthetic allotetraploid Arabidopsis suecica (PONTES et al. 2004) Despite being fewer in number, the rDNA units of T. dubi us origin dominate rDNA transcription in most populations of T. mirus (MATYEK et al. 2007) rDNA gene reduction by concerted evolution in allopolyploids can therefore be countered by high levels of expression cont rolled by epigenetic regulation. We obtained similar results for rDNA expression here in our cDNA CAPS study. Based on visual comparison of banding intensity, there is higher rDNA expression of T. dubius origin units than of T. porrifolius origin units in all plants from all populations examined, except for individuals from the Palouse population (Figure 25). Interestingly, for the Palouse population, cDNA and genomic CAPS indicate the silencing of the T. dubius rDNA unit in one plant

PAGE 37

37 of T. mirus Hence, t hese results further highlight the importance of populational surveys, by indicating some stochasticity for rDNA expression in the young polyploid T. mirus. Some synthetic and natural allopolyploids show remarkable genomic restructuring (e.g., Arabidopsis suecica (PONTES et al. 2007) Brassica napus (GAETA et al. 2007; PIRES et al. 2004b; SONG et al. 1995) Nicotiana lines (PIRES et al. 2004a; SKALICKA et al. 2003; SKALICKA et al. 2005) Primula (GUGGISBERG et al. 2008) and wheat (OZKAN et al. 2001) ). For example, synthetic Brassica napus allopolyploids exhibit many chromosomal translocations and transposition events during the S2 to S5 generations, based on RFLP analysis of synthetic lines (GAETA et al. 2007; SONG et al. 1995) Genome evolution in the natural polyploids Tragopogon mirus and T. miscellus appears most similar to the results obtained for these synthetic Brassica allopolyploids Homeolog loss appears frequent in both systems. Recent cytogenetic studies using FISH and GISH indicate that both T. mirus and T. miscellus show evidence of rapid genomic rearrangement, including translocations and inversions (LIM et al. 2008b) Genetic changes observed in synthetic Brassica napus as well as natural populations of Tragopogon mirus and T. miscullus may be related, in part, to chromosomal re arrangements in these polyploids (GAETA et al. 2007; LIM et al. 2008b; SONG et al. 1995) Plants of the synthetic and naturally occurring allopolyploid Arabidopsis suecica also e xhibit chromosomal rearrangement (PONTES et al. 2007) as well as many changes in gene expression (WANG et al. 2006b; WANG et al. 2004) Genes from one parent, A. thaliana, have often been silenced epigeneticall y by DNA methylation (WANG et al. 2004) T hrough microarray analysis, WANG et al. (2006b) showed that

PAGE 38

38 approximately 65% of nonadditively expressed genes in the synthetic allotetraploids were repressed, and more than 94% of them matched the genes that are highly expressed in one parent, A. thaliana Tragopogon allopolyploids have undergone many losses of homeologous loci, often eliminating copies of one parent, T. dubius but fewer instances of gene silencing. Additional studies of Tragopogon are needed to similarly examine gene expression on a genomic level scale. F1 hybrids and early synthetic allotetraploids (S1 to S3 generation) between Aegilops sharonensis and Triticum monococcum ssp aegilopoides showed both gene loss and silencing by DNA methylation (FELDMAN et al. 1997; KASHKUSH et al. 2002; LEVY and FELDMAN 2004; LIU et al. 1997; LIU et al. 1998; OZKAN et al. 2001) However, such immediate changes have not been detected in Tragopogon. Genomic and cDNA CAPS data for synthetic F1 hybrids between T. dubius and T. porrifolius showed additivity rather than gene loss or silencing (Figure 27). Similarly, no homeolog loss was observed in synthetic F1 hybrids between T. dubius and T. pratensis (TATE et al. 2006) or in newly produced (S0) or firstgeneration (S1) synthetic T. miscellus (BUGGS et al. 2009b) T herefore, in contrast to wheat, both T. mirus and T. miscellus exhibit genome evolution, not immediately following hybridization or allopolyploidization, but apparently shortly thereafter, given that the species are probably less than 80 years old (or 40 generations; these plants are biennials) (OWNBEY 1950; SOLTIS et al. 2004) Also, these results suggest that loss of homeologs and gene expression changes, while still rapid in evolutionary time, may be slightl y more gradual in Tragopogon, occurring over several generations, but further studies are required to assess the speed and magnitude with which genomic changes have occurred in Tragopogon.

PAGE 39

39 A major question centers on the mechanisms responsible for the loss of homeologs in these young allopolyploids. OWNBEY (1950) observed the formation of complex multivalents during meiosis in both T. mirus and T. miscellus shortly after their formation and in F1 hybrids between T. dubius and T. porrifolius and between T. dubius and T. pratensis. Furthermore, multivalents have also been observed in synthetic T. mirus and T. miscellus (LIM et al. 2008b; TATE et al. 2009b) In addition, rare patterns observed in analysis of allozyme va riation in Tragopogon are consistent with nonhomologous recombination (SOLTIS et al. 1995) Non homologous recombination could provide a mechanism of homeolog loss in T. mirus and T. miscellus as in Brassica (GAETA et al. 2007) Recent cytogenetic data provide additional insights into potential mechanisms for gene loss in Tragopogon. GISH studies have revealed that chromosomal rearrangements and other changes may be common in natural populations of T. mirus and T. miscellus (LIM et al. 2008b) Intergenomic translocations, inversions, as well as apparent monosomy and reciprocal trisomy occur in fertile individuals of both polyploids (LIM et al. 2008b) Such rearrangements provide a potential mechanism for the homeolog losses observed in both T. mirus and T. miscellus Genomic C hanges versus D ifferential E xpression in T. mi rus: For most of t he genes examined here, homeolog losses appear to be responsible for the cDNA AFLP fragment differences observed in individuals of T mi rus relative to its diploid progenitors. However, in two genes ( putatively NUCLEAR RIBOSOMAL DNA and GLYCERALDEHYDE3 PH OSPHATE DEHYDROGENAS E ) we found true expression differences in the allopolyploid relative to its parents NUCLEAR RIBOSOMAL DNA encodes ribosomal RNA, and GLYCERALDEHYDE3 PHOSPHATE

PAGE 40

40 DEHYDROGENASE encodes an enzyme that participates in multiple processes, including transcription activation, initiation of apoptosis, and ER to Golgi vesicle shuttling (TARZE et al. 2007) so both of these genes are crucial for cell function. T he pattern of NUCLEAR RIBOSOMAL DNA from genomic and cDNA CAPS analyses is consistent with MATY EK et al .s (2007) study: all individuals from the Palouse population showed additivity with genomic CAPS and in the Southern blot rDNA study of MATY EK et al (2007). However, in one individual from the Palouse population, the T. dubius NUCLEAR RIBOSOMAL DNA homeolog was completely silenced in both our cDNA CAPS analysis and in the rDNA transcript s tudy of MATY EK et al (2007). Most of the T. mirus individuals examined here, except those from Tekoa and Arizona, show no expression of the T. dubius homeolog for GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE (Figure 2 6 ) Genomic CAPS data indicate homeolog loss in two individuals, but additivity of parental homeologs in the remaining individuals. cDNA CAPS analyses therefore exhibit gene silencing in 13 individuals (Figure 26). Recent studies have shown that rapid epig enetic gene silencing follow ing allopolypoid formation can be reversed by chemical demethylation in allopolyploid Arabidopsis suecica (COMAI et al. 2000; LEE and CHEN 2001; MADLUNG et al. 2002; WANG et al. 2004) Therefore, silencing of t hese two genes might result from epigenetic phenomena such as DNA methylation or histone acetylation (CHEN 2007; PREUSS and PIKAARD 2007) In this study, gene silencing of T. dubius homeologs occurred in only two cases In addition, expression studies of T. miscellus (BUGGS et al. 2009b; TATE et al. 2006) showed that seven out of 17 genes exhibited silencing of the T. dubius homeolog, while

PAGE 41

41 for two other genes, the T. pratensis homeolog was silenced. These biased patterns in T. mirus and T. miscellus indicate that T. dubius homeologs might be more susceptible to silencing than the alternative parental homeologs. When we compare gene silencing with gene l oss with respect to the number of individuals examined, the previous studies of T. miscellus (BUGGS et al. 2009b; TATE et al. 2006) show that silencing events are slightly more frequent than homeolog loss, while in this study of T. mirus homeolog losses are slightly more frequent than silencing events. T hese expression patterns result from biased expression of only a few genes. For example, 14 out of 20 T. miscellus individuals have silencing events in LEUCINERICH REPEAT TRANSMEMBRANE PROTEIN KINASE and 11 out of 40 T. mirus individuals have silencing events in GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE. Therefore, comparing gene loss with silencing events in T. mirus and T. miscellus seems to be affected by specific genes, with a few of the genes examined here especially prone to silencing. However, when we consider the number of genes examined in this study of T. mirus and in the previous T. miscellus studies (BUGGS et al. 2009b; TATE et al. 2009a; TATE et al. 2006) homeolog losses in T. mirus ( 18.97%; 11 out of 58 homeologs) and in T. miscellus ( 58.7%; 27 out of 46 homeologs) are more frequent than silencing events (6.7 % ; two out of 30 homeologs in T. mirus ; 26.4% ; nine out of 34 homeologs in T. miscellus ). N evertheless, we investigated only a small portion of the genome, so further studies are required to assess whether the resul t s for the ~30 genes so far examined are representative of the entire genome.

PAGE 42

42 Genomic CAPS analy sis of a putative ADENINE DNA GLYCOSYL ASE gene showed polymorphism in the populations of the diploid parent T. dubius surveyed here (Figure 23). Although previous studies in Tragopogon diploids using allozymes and other markers indicated that genetic vari ation within populations is quite low (COOK et al. 1998; SOLTIS et al. 1995) T. dubius is the most genetically variable of the three diploids; allozyme variation within populations of T. porrifolius and T. pratensis was limited or absent. Therefore, polymorphism among T. dubius individuals for one of the genes analyzed here is not surprising. A recent survey of Tragopogon diploids and polyploids from the Palouse using microsatellite markers similarly revealed low levels of genetic variation within populations of T. dubius but none within either T. pratensis or T. porrifolius (SYMONDS et al. 2010) Conclusions Recently formed Tragopogon allotetraploids (<80 years; 40 generations for these biennial plants) exhibit various consequences of genome evolution and gene expression following polyploidy. In this study, using cDNAAFLPs, we found differential banding patterns, possibly attributable to gene silencing, novel express ion, and/or maternal/paternal effects between T. mirus and its diploid parents. Most of the banding patterns subsequently investigated with genomic and cDNA CAPS analyses revealed additivity. Most of the differences observed in T. mirus result from homeolog loss, rather than gene silencing; the latter was detected only infrequently (in two genes in some individuals). Genomic and cDNA CAPS analyses indicated that plants of T. mirus have experienced frequent and preferential elimination of the T. dubius homeolog, whereas comparable analyses of synthetic F1 hybrids between the parents (T. dubius T. porrifolius) of T. mirus showed only additivity. These same results were also obtained

PAGE 43

43 for the recent allotetraploid Tragopogon miscellus (BUGGS et al. 2009b; TATE et al. 2006) Both T. mirus and T. miscellus undergo biased loss of homeologs contributed by their shared diploid parent, T. dubius. Furthermore, both allotetraploids exhibit more homeolog losses than gene silencing in terms of the number of genes undergoing change. Taken together, our results suggest that in Tragopogon loss of homeologs and gene silencing are not immediate consequences of hybridization or polyploidization, but are processes that occur following pol yploidization, occurring over a relatively small number of generations. These results further support the idea of polyploidy as a dynamic evolutionary process (reviewed in Sambrook and Russell 2001), with abundant and rapid genomic changes occurring within a short time period following polyploidization. Further studies of homeolog loss, nonadditive expression patterns, and subfunctionalization of homeologs are needed to explore the roles of genetic and epigenetic phenomena in the evolution of allotetraploid Tragopogon species.

PAGE 44

44 Table 21. Summary of populations used in this study Species Collection Locality No. of individuals analyzed in cDNAAFLP No. of individuals analyzed in genomic CAPS No. of individuals analyzed in cDNACAPS T. dubius Population 2613 Pullman 1, WA 6 10 6 Population 2679 Pullman 2, WA 5 5 5 Population 2628 Palouse, WA 5 5 5 Population 2669 Oakesdale, WA 5 5 Population 2666 Rosalia, WA 5 5 Population 2691 Tekoa, WA 5 5 Population 1748 Coconino, AZ 5 5 T. mirus P opulation 2601 Pullman 1, WA 10 10 10 Population 2678 Pullman 2, WA 5 5 5 Population 2602 Palouse, WA 5 5 5 Population 2673 Oakesdale, WA 5 5 Population 2603 Rosalia, WA 5 5 Population 2690 Tekoa, WA 5 5 Population 1747 Coconino, AZ 5 5 T. porrifolius Population 2611 Pullman, WA 10 5 5 Population 2677 Pullman 2, WA 5 5 5 Population 2675 Palouse, WA 5 5 5

PAGE 45

45 Table 22. Primer combination for selective amplification and used in cDNA AFLP analyses Asterisk indicate s primers use d in expanded study EcoRI primer E AA E AC E AG E AT E TA E TC E TG MseI primer M CAA* M CAA* M CAA M CAA* M CAC* M CAC* M CAC* M CAC M CAC M CAC M CAC M CAG M CAG M CAC* M CAG* M CAG M CAG M CAT* M CAT* M CAG M CAT* M CAT* M CTA M CTA* M CTA* M CTC M CTC M CTC M CTG M CTG M CTT* M CTT* M CTT* M CTT* M CTT* M CTT* M CTT*

PAGE 46

46 Table 23. Summary of cDNA AFLPs population study Species Population No. of individuals No. of amplified bands Polymorphic fragment loci Within population variation (%) Maternal fragments Paternal fragments Novel fragments Pullman 1, WA T. dubius 2613 6 885 224 (25.3) 7.8 181* 46 (25.4)* 1.9* T. mirus 2601 10 964 339 (35.1) 8.1 67 49 6 197* 69 (35.0)* 2.2* 14* 11* 0* T. porrifolius 2611 10 1028 362 (35.2) 8.2 222* 78 (35.1)* 2.3* Total 26 1056 675 (63.9) 239* 152 (63.6)* Pullman 2, WA T. dubius 2679 5 169 25 (14.8) 1.8 T. mirus 2678 5 185 34 (18.4) 2.4 18 19 1 T. porrifolius 26 77 5 160 22 (13.8) 2.2 Total 15 234 118 (50.4) Palouse, WA T. dubius 2628 5 176 27 (15.3) 1.2 T. mirus 2602 5 220 52 (23.6) 3.5 17 13 0 T. porrifolius 2675 5 175 29 (16.6) 1.4 Total 15 251 172 (68.5) indicates 4 prim er sets as same as Pullman 2 and Palouse populations from completed 21 primer sets

PAGE 47

47 Table 24. Primer information used in genomic and cDNA CAPS analyses Putative Gene Genbank accession numbers Primer name Primer sequence (5 to 3) ADENINE DNA GLYCOSYLASE T .dubius DQ267228 ADGYF1 GGTGCATAAATCAGCACAACA T. porrifolius GU354166 ADGYR1 ACAAACCTACCCTCCCCATC FRUCTOSEBISPHOSPHATE T. dubius DQ267230 BFRUCT4 F1 GGAAGACCTTGATTGATCGG ALDOLASE T. porrifolius GU354167 BFRUCT4 R1 AAGGATGTTGTGGTGGAAGC SMALL GTP BINDING PROTEIN T. dubius DQ267232 GTPBF1 CCTCTCTCTACAATTCCGGC T. porrifolius GU354168 GTPBR1 TACGGCGACTGATGTCGTAA LEUCINE RICH REPEAT TRANSMEMBRANE T. dubius DQ267234 LTR2F1 GGGTTCTGTTACGAGCAAGG PROTEIN KINASE T. porrifolius GU354169 LTR2R1 TGA AGTATTCGGGATCCATAT PROTEIN PHOSPHATASE 2C FAMILY PROTEIN T. dubius DQ267222 PP2CF1 CTGGAAAACCAAATACCCGA T. porrifolius GU354170 PP2CR1 ATCTTCAGACCCCACCACAG TRANSDUCIN FAMILY PROTEIN T. dubius DQ267255 TDRCF2 AAAGCCGAGGGTAAATCAGC T. porrifolius GU 354171 TDRCR2 TCGAGGCCTTGAATGTTTTT THIOREDOXIN M TYPE 1 T. dubius DQ267221 THIOR F1 AATCAGAAGCATCCCGACTG T. porrifolius GU354172 THIOR R1 CACAATCTTTTTGTGAAATGCAA POLYUBIQUITIN T. dubius DQ267236 UBQ4 F1 TCGACTCTCCACCTGGTTCT T. porrifolius GU35417 3 UBQ4 R1 CAGACATCACCACCACGAAG

PAGE 48

48 Table 24. Continued PUTATIVE GENE Genbank accession numbers Primer name Primer sequence (5 to 3) GLYCERALDEHYDE 3 PHOSPHATE T. dubius GU354174 G3PDHF1 TTTGGAATTGTTGAGGGTCTC DEHYDROGENASE T. porrifolius GU354175 G3PDHR1 TCACCCACAAAGTCAGTGGA MYOSIN HEAVY CHAIN T. dubius GU354176 MHCF1 CGACACGGAATATAGCATCC T. porrifolius GU354177 MHCR1 GGATAAAGTGATGCTCATATGG GIBBERELLIN REPONSE T. dubius GU354178 RGAF1 CGTCCACGTCGTTGATTTCA MODULATOR T. porrifolius GU354179 RGAR 1 GATTCGATTCCTGTTCCACG NUCLEAR RIBOSOMAL DNA T. dubius AM493993 nrDNAF1 GCGCTACACTGATGTATTCAACG T. porrifolius AM493994 nrDNAR1 CGCAACTTGCGTTCAAAAACTCGA HEAT SHOCK PROTEIN 7 0 T. dubius GU354180 HSF1 CTAACGACAAGGGTAGACTATC HSR1 GGATCACATGCACATTAAGTGC PORPHYRIN OXIDOREDUCTASE T. dubius FJ708516 AG_194F TYTGYCGCAAACGCTGTC T. porrifolius GU354181 AG_597R TCWTCTTGAAAWGCTTGAACTCC NADP/FADOXIDOREDUCTASE T. dubius FJ708504 LacSing3F AGGCAAAGCACCTTCAAAGA T. porrifolius GU354182 LacSing3R CTTCCACTGCCAGCTTTTTC BIOTIN SYNTHASE T. dubius FJ708506 LacSing4F GGTCCGAGAACTGATTGGAA T. porrifolius GU354183 LacSing4R ATTGGGGGCAATATGAACAA

PAGE 49

49 Table 24. Continued PUTATIVE GENE Genbank accession numbers Primer name Primer sequence (5 to 3) TETRATRICOPEPTIDE REPEAT T. dubius GU354184 TPRF1 ATTCAGAGGAAGCCATCAAG PROTEIN T. porrifolius GU354185 TPRR1 GGCTTTTTCAATCCTGTTAATTC RNA BINDING T. dubius FJ708502 AB3156F TYACTCAYGTYTCAMGAGGATTTG T. porrifolius GU354186 AB4248R AGTAATAACCAGATGCTTCATCCC LRR PROTEIN T. dubius GU354187 LRRF1 GCACGAGGCCAGGAAGTAG T. porrifolius GU354188 LRRR1 ATCCACAATCGACTATGTTTG PRENYL TRANSFERASE T. dubius FJ708514 AK_1074F ARCCWGTMACTTGGCCTCC T. porrifoli us GU354189 AK_1461R ATKGCTCCMGAWGGAATTGG CRYPTOCHROME 1 T. dubius FJ770377 Cry1 F1 CTAAAACTCGTCCCACTAGAAG T. porrifolius GU354190 Cry1 R1 GGAATGGAAGAAGGACTCGG GLYCOSYLTRANSFERASE FAMILY 4 T. dubius GU354191 GlyTr F1 GTTTAAATATCCGAGCACCCC T. porrifol ius GU354192 GlyTr R1 ACGTGACTTGTTTGAGCTTC GLUCOSYL TRANSFERASE T. dubius GU354193 Glu F1 AAAAGGAAGAGTTACTTCATGG T. porrifolius GU354194 Glu R1 CCTCCAAACACCTCTTGATC EXPRESSION PROTEIN1 T. dubius GU354195 EPF1 AAAAGATTAGTTAGCTCTTGC T. porrifolius G U354196 EPR1 GCTTCAAGGTAACGCCGTTT HYPOTHETICAL PROTEIN T. dubius GU354197 APF1 TTGCAATTACGATTTACAC T. porrifolius GU354198 APR1 GGCATACAGTGTCTGAAACG

PAGE 50

50 Table 24. Continued PUTATIVE GENE Genbank accession numbers Primer name Primer sequence (5 to 3 ) CONSERVED HYPOTHETICAL T. dubius GU354205 PAF1 GGTAGTGCTGCATTTGCATG PROTEIN T. porrifolius GU354206 PAR1 TCTTGTTGCGAATGAGACCC UDPD APIOSEUDPD XYLOSE T. dubius GU354199 UDXF TCTGATCTTCCCAAGTCCAG SYNTHETASE T. porrifolius GU354200 UDXR AAAACAG CAGCACCTTACCC PEROXIDASE T. dubius GU354201 Pero F TAATGTTGGCAGTGATGGTG T. porrifolius GU354202 Pero R GGAACGTTATATTGTGGTCC FAR RED IMPAIRED RESPONSE T. dubius GU354203 FrirLaF TGGGTCAAAAGTAATCTGGATTC PROTEIN T. porrifolius GU354204 FRIRR AGCTTAGTCATGACGACATTG NUCLEIC ACID BINDING T. dubius FJ708510 LAC7FAD1_253F WTGGGAAGAAGGMGAAGG T. porrifolius GU354207 LAC7RAD_688R TTATCRAACTGWGTWGTATCAAATGCC

PAGE 51

51 Table 25. Putative identities for a subset of polymorphic cDNA AFLP fragments Cloned fragment ID cD NAAFLP pattern Putative Protein Nucleotide similarity to A. thaliana (%) / E value Tdu Tm Tpo TDF01 + + psbA 94/0.001 TDF03 + + Rubredoxin 78/4e13 TDF05 + + Glyceraldehyde3 phosphate dehydrogenase 82/2.3e21 TDF09 + + Ferredoxin 1 68/3.2e28 TDF10 + Expressed protein (EP1) 72/1.4e20 TDF101 + Putative outer membrane protein 57/2.5e23 TDF12 + + Leucinerich repeat transmembrane protein kinase 61/0.02 TDF13 + + Peroxidase 69/8.5e20 TDF14 + + Glycosyltransferase family 4 71/3.094 TDF15 + + Glucosyltransferase 94/1e119 TDF17.4 + + Polyubiquitin 79/1.5e33 TDF18 + + Fructokinase 1 74/7e61 TDF20 + + Gibberellin response modulator 71/6e17 TDF26 + + Chryptochrome 79/2e61 TDF29 + + Prenyl transferase 78/ 3e78 TDF33 + + Myosin heavy chain class XI E3 protein 79/2.8e9 TDF36.3 + + Thioredoxin M type 1 65/1.5e5 TDF37 + + UDPD apiose UDPD xylose synthetase 82/8.5e32

PAGE 52

52 Table 25. Continued Cloned fragment ID cDNAAFLP pattern Putative Protein Nuc leotide similarity to A. thaliana (%) / E value Tdu Tm Tpo TDF40 + + Serine/threonine protein kinase family protein 72/1.2e6 TDF42 + + Acetyl CoA carboxylase beta subunit 72/3.2e16 TDF46 + + Protein phosphate 2C family protein 84/9.7e8 TD F47 + Hypothetical protein 64/ 3.9e6 TDF48 + + MADSbox protein 83/2e33 TDF52 + + Far red impaired response proteinlike 73/1e10 TDF60 + + Nuclear ribosomal DNA 78/1e102 TDF62 + + Auxin conjugate hydrolase 63/1.1e31 TDF74 + + Transducin family protein 64/1.5e4 TDF80 + + Fructose bisphosphate aldolase 80/3e4 TDF83 + + Magnesium transporter protein 63/4e36 TDF87 + Conserved hypothetical protein 62/2.4e24 TDF90 + + Small GTP binding protein 77/2.4e37 TDF97 + Tetratricopeptide repeat protein 88/2e22 TDF98 + Heat shock protein 70 68/3.4e31 +, fragment present; Tdu, T. dubius ; Tm, T. mirus ; Tpo, T. porrifolius

PAGE 53

53 Table 26. Homeologous loci and restriction enzymes examined in T. mirus with genomic and cDNA anaylses Putative Gene Diagnostic restriction enzyme Genomic fragment sizes (bp) cDNA fragment sizes (bp) T. dubius T. porrifolius T. dubius T. porrifolius Fructose bi s phosphate aldolase 397 454 303 360 Small GTP binding protein BsmAI 200 318 20 0 318 115 115 Thioredoxin M type 1 DdeI 88 164 88 164 72 72 Transducin family protein 397 352 NIaIII 54 80 45 45 26 Gibberellin response modulator ApoI 383 225 383 225 155 155 nuclear ribosomal DNA BstNI 542 714 542 71 4 172 172 Expression protein 1 PleI 412 299 285 299 216 254 83 83 Conserved hypothetical protein HindII 583 302 395 232 142 281 142 28 142 28 Cryptochrome AciI 385 385 385 385 235 235 150 150 Glyceraldehyde 3 ph osphate DelI 378 606 278 504 dehydrogenase 220 220 Myosin heavy chain 520 430 520 430 Biotin synthase DdeI 334 336 334 336 240 282 240 282 Peroxidase BstNI 509 270 509 270 F ar red impaired response NdeI 295 360 365 326 protein 240 220 185 97 Glycosyl transferase family 4 Sau3AI 430 380 345 300 82

PAGE 54

54 Table 26. Continued Putative Gene Diagnostic restriction enzyme Genomic fragment sizes (bp) cDNA fragment sizes (bp) T. dubius T. porrifolius T. dubius T. porrifolius N ucleic acid binding MboII 720 500 284 RNA binding DraI 380 520 180 porphyrinoxidoreductase PleI 400 396 112 86 LRR protein AluI 296 136 224 108 124 Prenyltransferase NdeI 296 398 99 Tetratricopeptide repeat protein MboII 502 263 42 Adenine DNA glycosylase Aci I 289 220 69 Poly ubiquitin Sau3AI 624 621 312 Leucinerich repeat transmem MaeII 393 302 brane protein kinase 91 UDPD apiose UDPD xylose PIeI 415 512 synthetase 250 Protein phosphatase 2C family Nla III 186 277 protein 94 Heat shock protein 70 Sau3AI 560 280 Glucosyl transferase Sau3AI 480 420 34

PAGE 55

55 Table 26. Continued Putative Gene Diagnostic restriction enzyme Genomic fr agment sizes (bp) cDNA fragment sizes (bp) T. dubius T. porrifolius T. dubius T. porrifolius NADP/FAD oxidoreductase DdeI 164 350 48 Hypothetical protein AciI 365 581 215

PAGE 56

56 Table 27. Presence of homeologous loci in seven populations of T. mirus on the basis of genomic CAPS analyses. Genes showing additivity are not presented Population Individual number THIOREDOXIN M TYPE 1 NUCLEIC ACID BINDING MYOSIN HEAVY CHAIN CLASS XI LRR PROTEIN PRENYL TRANSFERASE Pullman 1 26015 2 6017 P 260110 D P 260112 260114 260133 260140 260145 260147 260148 Pullman 2 26781 26782 D 26783 D D 26788 267811 D P Palouse 26021 26022 D 26023 26024 P 260225 P P D

PAGE 57

57 Table 27. Continued Population Individual number THIOREDOXIN M TYPE 1 NUCLEIC ACID BINDING MYOSIN HEAVY CHAIN CLASS XI LRR PROTEIN PRENYL TRANSFERASE Oakesdale 2673 1 2673 2 2673 4 2673 5 2673 6 Rosalia 2603 13 2603 14 2603 33 2603 50 2603 51 Tekoa 2690 4 2690 5 2690 8 2690 10 2690 11 Arizona 17471 17472 17473 17476 17479

PAGE 58

58 Table 27. Continued Population Individual number NADP/FAD OXIDOREDUCTASE TETRATRICOPEPTID E REPEAT PROTEIN RNA BINDING GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE Pullman 1 26015 26017 260110 260112 P 260114 260133 260140 260145 260147 260148 Pullman 2 26781 26782 26783 26788 267811 Palouse 26021 26022 26023 26024 P 260225 P

PAGE 59

59 Table 27. Continued Population Individu al number NADP/FAD OXIDOREDUCTASE TETRATRICOPEPTIDE REPEAT PROTEIN RNA BINDING GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE Oakesdale 2673 1 D 2673 2 D 2673 4 D 2673 5 D 2673 6 D Rosalia 2603 13 2603 14 2603 33 D 2603 50 D 2603 51 D P Tekoa 2690 4 D 2690 5 D 2690 8 D 2690 10 D 2690 11 D Arizona 17471 D 17472 D 17473 D 17476 D 17479 D both parental copies detected in genome; D, only T. dubius copy detected; P, only T. porrifolius copy detected

PAGE 60

60 Table 28. Retention of homeologous loci in seven populations of T. mirus on the basis of cDNA CAPS analyses. Genes showing additivity are not presented Popu lation Individual number THIOREDOXIN M TYPE 1 MYOSIN HEAVY CHAIN CLASS XI NULEAR RIBOSOMAL DNA GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE Pullman 1 26015 P 26017 260110 D P 260112 P 260114 P 260133 260140 260145 P 260147 P 260148 Pullman 2 26781 P 26782 P 26783 26788 267811 P P Palouse 26021 P 26022 26023 P 26024 P P 260225 P

PAGE 61

6 1 Table 28. Continued Population Individual number THIOREDOXIN M TYPE 1 MYOSIN HEAVY CHAIN CLASS XI NULEAR RIBOSOMAL DNA GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE Oakesdale 2673 1 2673 2 2673 4 2673 5 P 2673 6 Rosalia 2603 13 2603 14 2603 33 2603 50 2603 51 P Tekoa 2690 4 2690 5 2690 8 2690 10 2690 11 Arizona 17471 17472 17473 17476 17479 both parental copies detected in genome; D, only T. dubius copy detected; P, only T. porrifolius copy detected indicates true silencing because genomic CAPS shows additivity

PAGE 62

62 Figure 21. Genomic and cDNA CAPS analyses for a putative homolog of FRUCTOSE BISPHOSPHATE ALDOLASE, an example of an additive pattern, from multiple individuals from several populations of independent origin of T. mirus and the parental diploids T. dubius and T. porrifolius Tdu= T. dubius Tm= T. mirus Tpo= T. porrifolius.

PAGE 63

63 Figure 22. Genomic and cDNA CAPS analyses illustrating homeolog loss in a putative homolog of THIOREDOXIN M TYPE 1 from multiple individuals from several populations of independent origin of T. mirus ; also shown are the parental diploids, T. dubius and T. porrifolius Tdu= T. dubius Tm= T. mirus Tpo= T. porrifolius. Arrows indicate homeolog loss.

PAGE 64

64 Figure 23. Genomic CAPS analysis of ADENINEDNA GLYCOSYLASE which exhibits a polymorphic pattern in the parental diploid T. dubius (see arrows). An additive pattern is consistently seen in the polyploid T. mirus. Tdu= T. dubius Tm= T. mirus Tpo= T. porrifolius

PAGE 65

65 Figure 24. Genomic and cDNA CAPS analyses illustrating homeolog loss in a putative homolog of MYOSIN HEAVY CHAIN CLASS XI from multiple individuals from several populations of independent origin of T. mirus ; also shown are the parental diploids, T. dubius and T. porrifolius Tdu= T. dubius Tm= T. mirus Tpo= T. porrifolius. Arrows indicate missing homeologs.

PAGE 66

66 Figure 25. Genomic and cDNA CAPS analyses of NUCLEAR RIBOSOMAL DNA, which exhibits silencing pattern in one plant of T. mirus from Tekoa (see red arrow). This plant is not expressing the homeolog of T. dubius Tdu= T. dubius Tm= T. mirus Tpo= T. porrifo lius.

PAGE 67

67 Figure 26. Genomic and cDNA CAPS analyses illustrating homeolog loss as well as silencing in a putative homolog of GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE from multiple individuals from several populations of independent origin of T. mirus ; also shown are the parental diploids, T. dubius and T. porrifolius Tdu= T. dubius Tm= T. mirus Tpo= T. porrifolius. White arrows indicate homeolog loss and red arrows show silencing.

PAGE 68

68 Figure 27. Genomic and cDNA CAPS analyses for 15 candidate genes from Tragopogon F1 hybrids and their porgenitors. Tdu= T. dubius (261111, Pullman, WA), Tpo= T. porrifolius (261324, Pullman, WA).

PAGE 69

69 Figure 27. Continued.

PAGE 70

70 Figure 27. Continued.

PAGE 71

71 CHAPTER 3 UNEQUAL EXPRESSION OF DUPLICATED GENES IN THE RECENTLY FORMED ALLO TETRA PLOID T ragopogon mirus (ASTERAC EAE) Introduction Polyploidy has been recognized as a particularly prominent phenomenon in flowering plants I t was historically estimated, based on chromosome numbers that perhaps 30% 80% of all angiosperms are polyploid (GOLDBLATT 1980; GRANT 1981; OTTO and WHITTON 2000; STEBBINS 1950) However, recent analyses of complete genom e sequences have revealed evidence of ancient polyploidization events in Arabidopsis thaliana (SIMILLION et al. 2002; THE ARABIDOPSIS GENOME INITIATIVE 2000) Populus trichocarpa (TUSKAN et al. 2006) Vitis vinifera (JAILLON et al. 2007; VEL ASCO et al. 2007) Cucumis sativus (HUANG et al. 2009) Carica papaya (MING et al. 2008) Oryza sativa (INTERNATIONAL RICE GENOME SEQUENCING PROJECT 2005) Sorghum bicolor (PATERSON et al. 2009) Zea mays (WEI et al. 2007) and Glycine max (SCHMUTZ et al. 2010) Furthermore, genomic and transcriptomic data have provided evidence for ancient polyploidy for other angiosperms (BLANC and WOLFE 2004; CUI et al. 2006; KU et al. 2000) Therefore, it now appears that all angiosperms may have undergone at least one round of genome duplication at some point in their evolutionary history (BOWERS et al. 2003; KIM et al. 20 04; LEEBENSMACK et al. 2006; PATERSON et al. 2004; SOLTIS et al. 2009; VISION et al. 2000) An obvious outcome of polyploidy is the duplication of all genes in the genome. These duplicated genes can subsequently provide the fuel for evolutionary novelty at the genomic and transcriptional levels via retention, pseudogenization, neofunctionalization, and subfunctionalization. Therefore, the process of diversification of duplicated genes following polyploidy has been a topic of great interest and has now

PAGE 72

72 been studied in several polyploid species, such as Arabidopsis suecica (WANG et al. 2006b) Gossypium hirsutum (FLAGEL and WENDEL 2009; HOVAV et al. 2008c) Brassica napus (MARMAGNE et al. 2010) and Triticum aestivum (BOTTLEY and KOEBNER 2008; BOTTLEY et al. 2006; PUMPHREY et al. 2009) Recent studies have revealed the varied genomic consequences of polyploidy which may lead to gene expression changes rapid genomic rearrangement, gene l oss, and epigenetic modification in Arabidopsis (COMAI et al. 2000; LAWRENCE et al. 2004; LEE and CHEN 2001; MADLUNG et al. 2005; WANG et al. 2006b; WANG et al. 2004) cotton (ADAMS et al. 2003; ADAMS et al. 2004; ADAMS and WENDEL 2004; CHAUDHARY et al. 2009; CHAUDHARY et al. 2008; FLAGEL and WENDEL 2009; HOVAV et al. 2008a; HOVAV et al. 2008b; HOVAV et al. 2008d; LIU et al. 2001; ZHAO et al. 1998) wheat (BAHRMAN and THIELLEMENT 1987; BOTTLEY and KOEBNER 2008; BOTTLEY et al. 2006; FELDMAN et al. 1997; HE et al. 2003; KASHKUSH et al. 2002; KASHKUSH et al. 2003; LEVY and FELDMAN 2004; SHAKED et al. 2001) Brassica (GAETA et al. 2007; LUKENS et al. 2004; LUKENS et al. 2006; MARMAGNE et al. 2010; PIRES et al. 2004b; SCHRANZ et al. 2002; SONG et al. 1995) Senecio (HEGARTY et al. 2008; HEGARTY et al. 2006; HEGART Y and HISCOCK 2008; HEGARTY et al. 2005) Spartina (AINOUCHE et al. 2004a; BAUMEL et al. 2001; FORTUNE et al. 2007; SALMON et al. 2005) and Tragopogon (BUGGS et al. 2010; BU GGS et al. 2009a; BUGGS et al. 2009c; KOH et al. 2010; TATE et al. 2009a; TATE et al. 2006) Therefore, genetic and expression changes caused by hybridization and polyploidization are thought to be important steps in evolution. However, much of what we have discovered about the genomic consequences of polyploidy have been based on crops, which are paleopolyploids and have long been under strong artificial selection.

PAGE 73

73 Therefore, natural and recently formed allopolyploid systems can provide more direct evaluation of the effect of hybridization and polyploidization, especially the early stages of polyploid evolution. Tragopogon mirus and T. miscellus (Asteraceae) are two such systems. These Tragopogon species have emerged as excellent evolutionary model s for st udying the fate of genes duplicated by polyploidy from genomic modifications Three diploid species ( T. dubius T. porrifolius and T. pratensis ) were introduced from Europe into the northwestern U.S.A. in the early 1900s (OWNBEY 1950; SOLTIS et al. 2004) and two allotetraploid species were subsequently formed: T. pratensis and T. dubius a re the parents of T. miscellus and T. dubius and T. porrifolius are the parents of T. mirus T hese recently formed allotetraploids are less than ~ 80 years old, based on the fact that T. dubius was not reported until 1926 (NOVAK et al. 1991; OWNB EY 1950) Molecular data indicate that T. miscellus has formed recurrently as many as 21 times among populations and T. mirus has formed repeatedly perhaps 11 times (SOLTIS et al. 2004; SOLTIS and SOLTIS 2000; SYMO NDS et al. 2010) Therefore, T. mirus and T. miscellus afford unique opportunities for the investigation of the fate and role of duplicated genes in recent polyploids. Previous studies on the fate of duplicated genes in the recently formed Tragopogon allo polyploids indicate that most plants of the natural allotetraploids as well as synthetic hybrids and polyploids show additive patterns for most parental loci(BUGGS et al. 2009a; KOH et al. 2010; TATE et al. 2009a; TA TE et al. 2006) However, homeolog loss occurs in frequently both polyploid species, and this is biased to the loss of the contribution of T. dubius homeologs. Furthermore, silencing of one homeolog (typically

PAGE 74

74 that contributed by T. dubius ), also occurs at some loci in at least some individuals (BUGGS et al. 2009a; KOH et al. 2010; TATE et al. 2006) The latter studies were based on compar ison of genomic and cDNA CAPS (cleaved amplified polymorphic sequences) analys es, demonstrate only presence or absence of parental homeolog expression, but do not distinguish the relative transcript amounts of parental homeologs on homeolog loss and silencing (KONIECZNY and AUSUBEL 1993) R ecently, next generation sequencing approaches have provided data f or hundreds, instead of tens of loci with very similar results, including a bias against T. dubius to those obtained using CAPS (BUGGS et al. 2010) Unequal expression of parental homeologs has been reported from other polyploid systems (HOVAV et al. 2008c; RAPP et al. 2009; RAUSCHER et al. 2002; RAUSCHER et al. 2004; WANG et al 2006a) However, we re not reporting it from previous work. The CAPS analysis can not detect quantitative differences in homeolog expression when both homeolog are expressed. W e therefore use qRTPCR to assess the relative contribution of the two diploi d progenitors ( T. dubius and T. porrifolius ) to the transcriptome of their natural allopolyploid derivative T. mirus at loci previously demonstrated to show experiments of both parental homeologs (KOH et al. 2010) We also examined possible differential expression in synthetic diploid F1 hybrids and synthetic T. mirus ( S1 and S2 generations). Through the latter analysis, we can determine whether such changes arise hybridization per se may be responsible for changes in expression (as in Senecio and Spartina (CHELAIFA et al. 2010; HE GARTY et al. 2006) ) or after polyploidization, during the subsequent evolution of the polyploid lineages.

PAGE 75

75 Materials and Methods Plant Materials All collection and locality information for plants used in this study are described in Table 3 1. The natural populations of the allotetraploid T. mirus used here were the same as those used in the recent work of KOH et al. ( 2010). F1 hybrids used in this study were generated by JA Tate, who crossed three T. dubius plants (2613 5, 2613 11, 2613 24 from Pullman 1) and five T. porrifolius plant s (2611 2, 2611 8, 2611 11 from Pullman 1 and 26072 and 260721 from Troy ) using plants grown from seed in the greenhouse (TATE et al. 2009b) Synthetic S1 and S2 generations were generated by JA Tate, AN Doust, and RA Buggs in the greenhouse (TATE et al. 2009b) (Table 3 2) T en F1 hybrid plants were generated from ten crosses with three T. dubius and five T. porrifolius lines, and six synthetic S1 individuals were produced by colchicine treatment of dipl oid F1 hybrids, and four synthetic S2 individuals were derived from the S1 lines noted (Table 3 2; (TATE et al. 2009b) All p lants were grown from seed under homogenous condition in the greenhouse, and leaf tissue was harvested directly into liquid nitrogen from at least four plants of each line from six week old plants. RNA Extraction, Pu rification and cDNA Synthesis Due to heavy latex in the leaf tissue, total RNA from young leaf tissue (~2 g) was extracted using the method of KIM et al. (2004) which combines a CTAB extraction protocol (DOYLE and DOYLE 1987) and subsequent use of the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). To ensure the purity of the RNA samples, all extracted total RNAs were tre ated with DNA free DNase I (Ambion, Austin, TX, USA) Purified RNA samples were quantified using Nanodrop ND 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and evaluated using Agilent 2100 Bioanalyzer (Agilent

PAGE 76

76 Technologies, Santa Clara, CA USA). cDNA was synthesized from 5 ug of purified RNA using the SuperScript III first strand cDNA synthesis system for RTPCR and r andom h examers according to the manufacturers instructions (Invitrogen, Carlsbad, CA, USA). Quantitative Real T ime RT PCR ( qRT PCR) T en genes were chosen from the 30 genes recently analyzed for gene expression changes and loss using CAPS analysis (KOH et al. 2010) These ten genes were chosen because they showed additive expression patterns in the CAPS analyses (KOH et al. 2010) Hence, these ten genes are good candidates for detailed study in that they show whether nonadditive expression patterns : SMALL GTP BINDING PROTEIN, TRANSDUCIN FAMILY PROTEIN POLYUBIQUITIN NUCLEAR RIBOSOMAL DNA THIOREDOXIN M TYPE1 FRUCTOSEBISPHOSPHATE ALDOLASE NUCLEAR ACID BINDING GIBBERELLIN RESPONSE MODULATOR, EXPRESSION PROTEIN1 and GLYCERALDEHYDE3 PHOSPHATE DEHYDRO GENASE. To investigate expression in these ten genes, 20 homeologspecific primer sets were designed using Primer3 (v. 0.4.0; http://frodo.wi.mit.edu/) based on regions (mostly 5 end or untranslated regions) that varied in sequence between T. dubius and T. porrifolius Specificity of primers was confirmed via PCR of T. mirus and its parents (Supplemental Figure 1) BLASTN searches against dbEST and nr (nonredundant set of GenBank, EMBL, and DDJB database sequences ) were conducted to confirm the total homeolog specificity of the nucleotide sequences chosen for the primers (Table 3 3 ) We also assessed whether any differential expression patterns of homeologs observed in T. mirus were actually due to differences in expression in the parental diploids themselves. That is, plants of T. mirus might exhibit stronger expression of the

PAGE 77

77 T. dubius homeolog for a particular gene simply because the gene is more strongly expressed in plants of T. dubius than in plants of T. porr ifolius not as a result of allopolyploidization. We therefore first assessed the transcript expression levels for each gene in three plants of each of the parental species. In addition, the genomic contribution of both homeologs to three plants of T. mirus was also assessed using the qRT PCR assay. This also required a genomic analysis of the diploid parents using qRT PCR (NOT DONE). Hence, plants of both diploid parents and T. mirus were examined from the Pullman1 site which was chosen because microsatel lite markers indicate that this is a site of polyploid formation with the parental genotypes at that location matching the contributions observed in plants of T. mirus at that some locale (SYMONDS et al. 2010) The qRTPCR assays for each target were performed in triplicate following the manufacturers instructions (Applied Biosystems, Foster City, CA, USA). The assays were done on cDNA samples in a dilution series (5 ng, 10 ng, 100 ng, and 500 ng) with negat ive and positive r eal time control s on an MyiQ ver 2.0 with iQ ver 5.0 (Bio Rad, Hercules, CA, USA) The endogenous control ACTIN II was amplified in parallel using the same cDNA pools and was used to normalize the quantity of a target gene ( Supplemental figure 2) From the pooled cDNA, a 100 ng of template was used in a 20ul PCR reaction with QuantiTect SYBR Green PCR Kit (Qiagen) The PCR thermal cycling parameters were 95C for 15 min, followed by 45 cycles of 95C for 45 sec, 5565C for 30 sec, and a final 5565C for 8 sec To monitor the mal function of qRTPCR, a melting curve analysis was performed using temperaturedependent dissociation ( Supplemental F igure 3).

PAGE 78

78 A total of 15, 624 reactions was performed in plants of the two parental diploids ( th ree individuals per species ), natural allopolyploids (40 individuals from seven populations), synthetic F1 hybrids ( ten individuals representing ten crosses), the generation S1 ( six individuals derived from six crosses) and the S2 generation ( four individu als, progeny from the four lines of the S1 plants) generation s. 720 reactions were conducted on six parental diploid plants (three of each parent) from the Pullman1 site to determine whether these parental plants exhibit similar expression levels for the genes investigated here. In addition, 720 reactions of genomic qRT PCR were carried out using three plants of T. mirus from the Pullman1 population to examine whether there is any difference between the two parental homeologs at the genom ic level, and fur ther track the origin of nonadditive expression at the transcript level. The remaining 1 4 184 reactions including 720 reactions of standard control were conducted to investigate transcript expression in natural T. mirus (40 individuals from seven populat ions), diploid F1 hybrids (ten individuals), synthetic S1 and S2 generations (six and four individuals, respectively); 348 reactions ( 2 .5 %) did not generate any amplicons (nonexpression) in 29 individuals for five genes due to either gene loss ( seven ind ividuals) or sil encing (22 individuals) which is congruent with the recent CAPS study of T. mirus (see below) Transcript levels of the target genes were measured relative to the endogenous control ACTIN II Relative expression of the target genes was cal culated using the comparative CT method as described in the ABI 7700 sequence detection system User Bulletin 2 (Applied Biosystems). The differences in Ctt t, between the target gene and endogenous control were calculated to normalize the differences in the

PAGE 79

79 cDNA concentrations for each reaction. Gene expression level was shown as a percentage of ACTIN II expression level using the equation 2 100%. A paired t test was performed to determine whether there are differences in levels of homeolog expression within population. A two sample t test was performed to assess whether the expression levels of the target genes differ between the diploid parental species Results We first took the empirically determined parental values using three individuals of each parent from the Pullman1 site. T here is essentially equal transcript production expression in the diploid parents for all genes examined here except GIBBERELLIN RESPONSE MODULATOR, which showed greater expression in T. dubius than in T. p orrifolius (Figures 3 1, 3 2, and 3 3; Table 3 4 ). qRT PCR R esults c orroborate P revious CAPS A nalysis R esults for T. mirus Support for the reliability of the qRTPCR results presented here was obtained via comparison of our results with the CAPS results of Koh et al (2010). As in Koh et al (2010), we similarly observed gene silencing at several loci (i.e., NUCLEAR RIBOSOMAL DNA and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE) and true homeolog loss at other loci (i.e., NUCLEIC ACID BINDING THIOREDOXIN M TYPE1 and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE). The results for each putative gene are discussed below and qRTPCR results compared with the CAPS data of Koh et al (2010). We further confirmed the silencing of NUCLEAR RIBOSOMAL DNA in one individual ( 26023) from the Palouse population of T. mirus ; in this individual, only the T. porrifolius homeolog was expressed, which is consistent with Koh et al (2010). Similar results for rDNA were also reported by Matyek et al (2007) We also corroborate

PAGE 80

80 here homeolog loss in a putative THIOREDOXIN M TYPE1 ; one individual (260110) from the Pullman1 population of T. mirus lost the T. porrifolius homeolog, and one individual (26024) from the Palouse population of T. mirus lost the T. dubius homeolog. Similar results were reported with CAPS (KOH et al. 2010) In addition, we verified homeolog loss in a putative NUCLEIC ACID BINDING gene; two individuals (26783 and 267811) from the Pullman 2 population of T. mirus lost the T. porrifolius homeolog and one individual (260225) from the Palouse population lost the T. dubius h omeolog. Moreover, homeolog loss as well as silencing were observed in a putative GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE gene; the T. dubius homeologs were not amplified in 13 individuals due to homeolog loss (26024 from the Palouse and 260351 from Ros alia) or true silencing (11 individuals from the Pullman1, Pullman 2, Palouse, and Oakesdale populations). These data are all consistent with the previous results of Koh et al. (2010). Here, we provide the first homeolog silencing in synthetic T. mirus S ilencing was observed in FRUCTOSEBISPHOSPHATE ALDOLASE in both S1 and S2 synthetic allopolyploid lines for all plants investigated; these synthetic lines showed additivity in genomic CAPS (Figure 3 4), but the T. porrifolius homeolog was not expressed in the qRT PCR. Biased E xpression P atterns in N atural P opulations of T. mirus In this study, biased gene expression of the parental homeologs was observed for all genes examined except a putative POLYUBIQUITIN from the Pullman2 population of T. mirus (Figures 3 1, 3 2, and 3 3; Table 3 4 ). Eight of the ten genes examined here in T. mirus displayed an expr e ssion bias towards one parent. SMALL GTP BINDING PROTEIN, NUCLEAR RIBOSOMAL DNA, THIOREDOXIN M TYPE1 and FRUCTOSE-

PAGE 81

81 BISPHOSPHATE ALDOLASE showed a higher expression of the T. dubius homeolog than of the T. porrifolius homeolog, whereas in TRANSDUCIN FAMILY PROTEIN, POLYUBIQUITIN, NUCLEIC ACID BINDING and GIBBERELLIN RESPONSE MODULATOR the T. porrifolius homeolog is more abundant than the T. dubius homeolog at the transcript levels measured using cDNA (Figure 3 1 and 32 ; Table 3 4 ). For POLYUBIQUITIN individuals from the Pullman2 population exhibited additivity of both parental homeologs ; in fact, the T. porrifolius homeolog was expressed slightly more t han T. dubius homeolog in five individuals of T. mirus from the Pullman 2 population, but this pattern was not statistically significant (pvalue=0.163; Figure 3 1). For a putative GIBBERELLIN RESPONSE MODULATOR, the expression level of this gene in the parental diploids is not equal; there are more T. dubius transcripts of GIBBERELLIN RESPONSE MODULATOR than T. porrifolius (Table 3 4 ). Stochastic E xpression P atterns in T. mirus EXPRESSION PROTEIN1 and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE showed stochastic expression patterns among plants of T. mirus (Figure 33 ). G ene expression levels vary with some individual expressing more of the T. dubius homeolog and others more of the T. porrifolius homeolog. For EXPRESSION PROTEIN1 the transcript expression pattern differs among the populations examined. The Palouse, Oakesdale, and Tekoa populations exhibited stochastic expression patterns, whereas the Pullman1, Pullman 2, Rosalia, and Arizona populations showed only paternally biased expression patterns in al l plants studied. GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE exhibited stochastic expression patterns in four populations of T. mirus but the Pullman2 and Arizona populations had paternally biased expression and the Tekoa population had maternally biased expression.

PAGE 82

82 Expression P atterns in F1 H ybrids and S ynthetic T. mirus ( S1 and S2) We tracked transcript changes in four specific lines from F1 hybrids through two synthetic generations S1 and S2 (Figure 3 6). Four genes out of ten (putative SMALL GTP BINDING PROTEIN, NUCLEAR RIBOSOMAL DNA, FRUCTOSEBISPHOSPHATE ALDOLASE, and THIOREDOXIN M TYPE1 ) showed the biased expression of the T. dubius homeolog, whereas three genes exhibited greater expression of the T. porrifolius homeolog (putative TRANSDUCIN FAMILY PROTEIN NUCLEIC ACID BINDING and POLY UBIQUITIN ). Furthermore, the T. porrifolius homeolog of FRUCTOSEBISPHOSPHATE ALDOLASE was silenced in all synthetic allopolyploid lines (six individuals of S1 and four individuals of S2). The remaining three genes showed stochastic expression patterns among individuals. GIBBERELLIN RESPONSE MODULATOR exhibited greater expression of the T. porrifolius homeolog in seven individuals of F1 hybrids, while three individuals showed greater expression of the T.dubius homeolog (Figure 5A). All individuals from both the S1 and S2 generations exhibited only greater expression of the T.dubius homeolog. For EXPRESSION PROTEIN1 all F1 hybirds exhibited greater expression of the T. porrifolius homeolog, while the S1 and S2 generations showed greater expression of the T. dubius homeolog (Figure 5B). For GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE, three out of ten F1 hybrids exhibited greater expression of the T. porrifolius homeolog, and the others showed higher expression of the T. dubi us homeolog. These expression patterns were also maintained in the both the S1 and S2 plants (Figure 5C). These three genes exhibit differential expression patterns among the four lines investigated from the F1 hybrid stage to the synthetic S2 generation. For the GIBBERELLIN RESPONSE MODULATOR, the expression levels of the T. dubius

PAGE 83

83 homeolog were highly elevated in the S1 generation with one line (842) showing a decrease in expression of the T. dubius homeolog in the S2 generation (Figure 6A). For EXPRESSED PROTEIN1 lines 732 and 7313 exhibited an increase of the T. dubius homeolog transcript from F1 hybrids to the S2 generation, while lines 773 and 842 showed higher transcript levels of the T. dubius homeolog in the S1 generation (Figure 6B). GLYCERAL DEHYDE3 PHOSPHATE DEHYDROGENASE showed a very complicated pattern of transcript changes from F1 hybrids to the S2 generation. Line 732 exhibited an increase in transcript level of the T. dubius homeolog from F1 hybrid to the S2 generation, while line 842 showed the highest expression level of the T. dubius homeolog in S1, followed by severe decrease in the S2 generation (Figure 6C). In the other two lines (7313, 773), transcript changes are very complicated; the expression level of one parental homeolog appeared to increase from F1 hybrid to the S1 generation, but then the other parental homeolog showed higher transcript levels in the S2 generation (Figure 6C). Discussion To examine homeolog evolution in the early stages of polyploidy w e analyzed the e xpression levels of ten genes using qRTPCR in the recently and recurrently formed allotetraploid T. mirus We examined seven natural populations of T. mirus all of which are of independent origin or formation (SYMONDS et al. 2010) ; all originated in just the past 80 years. Although previous studies provide evidence of rapid, frequent, and preferential elimination of homeologs, as well as gene silencing in both newly formed Tragopogon allopolyploids (BUGGS et al. 2009a; KOH et al. 2010; TATE et al. 2006) these studies could not provide quantitative assessments of gene expression between the parental homeologs due to the limitations of CAPS analyses Hence, those earlier

PAGE 84

84 studies basically reported the presence or absence of a homeolog (genomic DNA) or presence or absence of expression (cDNA). Therefore, through the detailed investigation of gene expression patterns using qRTPCR, we show that expression levels of homeologs can be changed from that observed in the parental diploids via hybridization and polyploidization. These changes in expression likely involve various mechanisms (not investigated here), including trans acting regulation, and epigenetic regulation. C is and Transacting R egulation on N onadditively E xpressed G enes Cis acting elements are DNA sequences that regulate directly the expression of genes often on the same chromosome via transcription factors, while trans acting elements codes for proteins or micr oRNAs that will be used in the regulation of another gene (CHEN 2007; LANDRY et al. 2007; WAYNE et al. 2004; YVERT et al. 2003) In general, it is believed that allopolyploids combine the same amount of a gene found in their diploid parents and at least initially express the relevantly equal amount of transcripts from each parental homeolog (CHEN 2007; SWANSONWAGNER et al. 2006) Therefore, it is hard to find trans acting regulation in an allopolyploid because h omeolog sequences are very similar. In an allopolyploid system, expression alterations through trans acting regulation should produce an expression difference of the two homoeologs compared to the midparental value or a 1:1 mixture of the parental mRNAs, or direct nonadditive gene expression (CHEN 2007; STUPAR and SPRINGER 2006) In this study, five genes showed asymmetric ( NUCLEAR RIBOSOMAL DNA, THIOREDOXINE M TYPE1 and NUCLEAR ACID BINDING ) or equal ( FRUCTOSEBISPHOSPHATE ALDOLASE and GIBBERELLIN RESPONSE MODULATOR) amount of both homeologs in the T. mirus genome, but these gene homeologs showed reverse

PAGE 85

85 expression patterns against their genomic contents. For example, if there are more genomic copies of the T. dubius homeolog in T. mirus the T. porrifolius homeolog expressed higher than the T. dubius homeolog at the transcript level. This pattern is also seen in hybrids and the synthetic allopolyploids (Figures 3 2 and 33 ) Allopolyploids generally exhibit high nucleotide similarity between homeologs (<5% in Arabidopsis suecica (LEE and CHEN 2001) and 1.05% in Gossypium hirsutum (SENCHINA et al. 2003) ), and this is the situation in Tragopogon mirus There is an average 3.6 % sequence divergence between the parental gene copies (homeologs) in T. mirus based on the analysis of 30 genes [457 out of 12,579 bp differ between two homeologs, and 361 of 457 derived from indels; if we exclude indels, the sequence divergence is 0.76%] (KOH et al. 2010) whether or not cis regulatory elements differ between the parental species of T. mirus via Should be be evaluated via sequencing of the upstream region of genes that show unequal expression patterns between homeologs. It seems likely that t his unbalanced expression in T. mirus occurs by trans acting regulation. In other polyploid systems, such as Arabidopsis suecica (WANG et al. 2006a; WANG et al. 2006b) trans acting regulation on the regulator of the other homeolog results in noticeable up/or down regulation of a specific homeolog. For example, gene expression in allotetraploid Arabidopsis suecia (2 n = 4X = 26), which is formed via the co mbination of the parental genomes of autotetraploid A. thaliana (2 n = 4X = 20) and allopolyploid A. arenosa (2 n = 4X = 32), exhibited nonadditivity of homeolog expression of the flowering time gene FLC ( FLOWERING LOCUS C) ; upregulation of A. thaliana FLC ( AtFLC ) affected the expression of A. arenosa FRI ( FRIGIDA ; AaFRI ) as a trans acting regulator, resulting in inhibition of early flowering in

PAGE 86

86 allotetraploid Arabidopsis suecia (WANG et al. 2006a) Furthermore, in th e study of heterotic F1 hybrids in maize, 9.8% of ESTs displayed significant differential expression among three distinct genotypes, and these expression differences were controlled by cis or trans acting regulation (SWANSONWAGNER et al. 2006) These studies show that t he dramatic changes in nonadditive gene regulation observed in the allotetraploids may be induced by interspecific hybridization as a trans acting regulation. P revious cytogenetic analysis of Tragopogon allopolyploids provide some evidence for genome downsizing in the newly formed allotetraploids (PIRES et al. 2004a) which would agree with the evidence for rapid homeolog loss demonstrated in both T. mirus and T. miscellus (BUGGS et al. 2009a; KOH et al. 2010; TATE et al. 2009a; TATE et al. 2006) Recent studies of chromosome evolution in Tragopogon allopolyploids using GISH and FISH provide evidence for intergenomic rearrangements and therefore, a mechanism for homeolog loss. For example, some plants of T. mirus exhibited intergenomic translocations as well as evidence for reciprocal monosomy/trisomy (LIM et al. 2008a) Genomic rearragement could also result in trans acting regulation, but not cis acting regulation, and could cause expression bias through changes in trans acting regulation, for example, the modulation of the activity of the basal transcriptional effects through interactions of the trans acting factors according t o origination from two distinct genomes (LANDRY et al. 2007) Stochastic and Rapid E xpression C hanges in T. mirus Two genes ( EXPRESSED PROTEIN1 and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE) displayed stochastic expression patterns among natural populations of T. mirus as well as in F1 hybrids and the synthetic pol yploids; the expression bias was observed toward the T. dubius homeolog in some cases and

PAGE 87

87 towards the T. porrifolius in other plants (Table 3 4 ). In addition, F1 hybrids and synthetic polyploid plants differ in their expression patterns in these genes. The four lines followed from F1 hybrids through both the S1 and then S2 generations exhibit different patterns of expression, for example, direct increase of expression level of one homeolog in the S1 or S2 generation relative to F1 hybrids. This might indica te that the effect of polyploidization can be immediate in some cases, as in lines 732 and 7313 or appear in later generations as in lines 773 and 842 (Figure 3 6B). A similar phenomenon was observed in line 732 for GLYCERALDEHYDE3 PHOSPHATE DEHYDROG ENASE; transcripts of this gene increased gradually from F1 hybrids to the synthetic generations (Figure 3 6C). However, for the other three lines the expression patterns are more complicated, perhaps due to genetic variation within one or both of the dipl oid parents, with T. dubius the most likely candidate based on other work. Recent studies of Tragopogon indicated that polymorphism is present in the populations of T. dubius (KOH et al. 2010) ; a recent survey of Tragopogon diploids and polyploids using microsatellite markers revealed low levels of genetic variation in T. dubius but none within either T. pratensis or T. porrifolius (SYMONDS et al. 2010) Homeolog silencing and other deviation from additive expression can occur rapidly after polyploidization as early the S1 and S2 generations; however, homeolog loss has not been detected in diploid hybrid and synthetic allopolyploid Tragopogon (BUGGS et al. 2009a; KOH et al. 2010; TATE et al. 2006) In contrast F1 hybrids and synthetic allotetraploids (S1 to S3 generation) between Aegilops sharonensis and Triticum monococcum ssp aegilopoides exhibited gene loss and silencing (FELDMAN et al. 1997; KASHKUSH et al. 2002; LEVY and FELDMAN 2004; LIU et al. 1997; LIU et al. 1998; OZKAN

PAGE 88

88 et al. 2001) Therefore, like wheat, the Tragopogon allopolyploid system might have experienced transcriptomic changes via epigenetic mechanisms immediately following hybridization or allopolyploidization. Conclusio ns We provide evidence that gene expression changes accumulate form the earliest polyploid generations The variation in homeolog expression observed here based on several natural populations as well as F1 hybrids and synthetic allopolyploids (S1 and S2 g enerations) could be the result of several factors, including cis and trans acting regulation, and epigenetic regulation. Future research can focus on the actual mechanism The nonadditive expression of homeologs in the allopolyploid T. mirus is in agreem ent with the results for other polyploid systems, including Triticum aestivum (MURAMATSU 1963) and Solanum tuberosum (FLIPSE et al. 1996) and Arabidopsis suecica (WANG et al. 2006a; WANG et al. 2006b) and Zea mays (SWANSONWAGNER et al. 2006) which exhibit trans acting regulation, and Arabidopsis suecica (CHEN and PIKAARD 1997; LAWRENCE et al. 2004) which displays epigenetic regulation. Moreover, stochastic expression related to rapid expression changes might result from genetic variation in the diploid parents, which is consistent with other studies of the Tragopogon system (BUGGS et al. 2009a; KOH et al. 2010; SYMONDS et al. 2010; TATE et al. 2009a; TATE et al. 2006) The combination of distinct genomes in an allopolyploid can lead to genomic shock (COMAI et al. 2000; MCCLINTOCK 1984) which may be ameliorated by alterations in homeolog expression. The Tragopogon system provides that the role of redundancy in the regulation of duplicate genes and genomes and its impact on biological mechanisms and phenotypic diversity.

PAGE 89

89 Table 31. Summary of populations and individual numbers used in this study; numbers are Soltis and Soltis collection number Population individual number of T. mirus individual number of T. dubius ind ividual number of T. porrifoilus Pullman 1, WA 2601 5 2613 1 2611 8 2601 7 2613 11 2611 11 2601 10 2613 24 2611 24 2601 12 2601 14 2601 33 2601 40 2601 45 2601 47 2601 48 Pullman 2, WA 2678 1 2678 2 2678 3 2678 8 2678 11 Palouse, WA 2602 1 2602 2 2602 3 2602 4 2602 25 Oakesdale, WA 2673 1 2673 2 2673 4 2673 5 2673 6 Rosalia, WA 2603 13 2603 14 2603 33 2 603 50 2603 51 Tekoa, WA 2690 4 2690 5 2690 8 2690 10 2690 11 Arizona 1747 1 1747 2 1747 3 1747 6 1747 9

PAGE 90

90 Table 32. Synthetic Tragopogon mirus lines and its pursuing generation Matern al lineage Paternal lineage F 1 Hybrid S 1 generation S 2 generation 2611 8 2613 5 Hy 54 2 S 1 54 2 2611 11 2613 24 Hy 73 2 S 1 73 2 S 2 73 2 2611 11 2613 24 Hy 73 5 S 1 73 5 2611 11 2613 24 Hy 73 8 2611 11 2613 24 Hy 73 12 S 1 73 12 S 2 73 12 2611 11 26 13 24 Hy 73 13 2607 2 2613 5 Hy 77 3 S 1 77 3 S 2 77 3 2613 11 2611 8 Hy 84 2 S 1 84 2 S 2 84 2 2611 2 2613 11 Hy 98 4 2607 21 2613 24 Hy 134 2

PAGE 91

91 Table 3 3 Primer sequences used in this study. Tdu and Tpo indicate T. dubius and T. porrifolius hom eolog specific primer, respectively. F=forward primer, R=reverse primer Gene name Primer Name Sequences (5' 3') FRUCTOSE Tdu Bruct F GTTTAATCGCTCCACCGTGT BISPHOSPHATE TduBruct R GTACTTGTTAAAGTGTATTAAACC ALDOLASE TpoBruct F TTCGAACTCCGCAACAATATC TpoBruct R TGGAATTCCATATTTTCTTTCCAA GIBBERELLIN Tdu GA20 F ATGAAGTTCCAGATGATGATGAT RESPONSE TduGA20 R CTCCATCTCTTTCCCTCCTA MODULATOR TpoGA20 F ATGAAGTTCCAGATGATGATATG TduGA20 R CTCCATCTCTTTCCCGCCTA NUCLEIC ACID Tr NAB F TCATGCAACCAACCAAGGTC B INDING TduNABR AAGCCGGCGATCTTGGCAG TpoNABR AAACCGGCGATCTTGGCTG EXPRESSION TduEP1 F AGTGGTGTGGATTTGAAGAATT PROTEIN1 Tpo EP1 F GTGGTGTGGATTTGAAGAATC Tr EP1 R AAACGGCGTTACCTTGAAGC TRANSDUCIN TduTDRC F TGGATAAAGATGATCATCAAAAGTC FAMILY PROTEIN T duTDRC R AAATAGTCATTGTGGTAACAACGAT Tpo TDRC F TGGATAAAGATGATCTTCAAAAATC TpoTDRC R AGCAATAACGACACCTTTTCATC GLYCERALDEHUDETduG3PDHDF CCGTTCGATTGGAAAAGGCT 3 PHOSPHATE TduG3PDHDR ACCCAAAATTCCCTTCATCTTT DEHYDROGENASE Tpo G3PDH DF CCGTTCGATTGGAAA AGGCC TpoG3PDHDR CCCAAAATCCCCTTCATCTTG NUCLEAR RIBOSOMAL DNA TdunrDNA F CGTCACGCATCGCGTCGC TponrDNA F CGTCACGCATCGCGTCGCT Tr nrDNAR CGAAGGTGACTCATGTTTGGGC THIOREDOXIN M TYPE1 Tr Thior F AATCAGAAGCATCCCGACTG TduThior R ATGGCATACAAGTTATTTACT Tpo Thior R TGGCATACAAGTTATTTATTTA POLYUBIQUITIN Tdupoly F GGAGGTTGAAAGTTCCGACACA Tdupoly R CCCTCCTTATCCTGGATCTTT Tpopoly F GGAGGTTGAAAGTTCCGATACT Tpo poly R CCCTCCTTATCCTGGATCTTG SMALL GTP TduSGTPBF GTGACAAGGTCATGGTTCTC

PAGE 92

92 Table 33. Co ntinued Gene name Primer Name Sequences (5' 3') BINDING PROTEIN TduSGTPBR ACCAATATTCAGCTACAAGC Tpo SGTPB F TCGCTCATAGAGTTCCAACG TpoSGTPBR ACCAATATTCAGCTACAAGG ACTINII Tr ACT F1 CATTGTGCTTAGTGGTGGGT Tr ACT R1 AGGATAGATCCTCCAATCCAG

PAGE 93

93 Table 34 Expression patterns in T. mirus inferred from quantitative Real time PCR. Tdu= T. dubius homeolog, Tpo= T. porrifolius homeolog Gene Expression data in diploid parents Genomic data in T. mirus Expression data in T. mirus Expression pattern in T. mirus SMALL GTP BINDING PROTEIN Tdu Tpo Tdu > Tpo Tdu > Tpo Dosage effect TRANSDUCIN FAMILY PROTEIN Tdu Tpo Tdu < Tpo Tdu < Tpo Dosage effect POLYUBIQUITIN Tdu Tpo Tdu < Tpo Tdu < Tpo Dosage effect Tdu < Tpo Tdu Tpo 1 NUCLEAR RIBOSOMAL DNA Tdu Tpo Tdu < Tpo Tdu > Tpo Tdu biased THIOREDOXIN M TYPE 1 Tdu Tpo Tdu < Tpo Tdu > Tpo 2 Tdu biased FRUCTOSE BISPHOSPHATE ALDOLASE Tdu Tpo Tdu Tpo Tdu > Tpo3 Tdu biased NUCLEIC ACID BINDING Tdu Tpo Tdu > Tpo Tdu < Tpo Tpo biased GIBBERELLIN REPONSE MODULATOR Tdu > Tpo Tdu Tpo Tdu < Tpo4 Tpo biased Tdu > Tpo 5 Dosage effect EXPRESSION PROTEIN1 Tdu Tpo Tdu Tpo Tdu > Tpo 6 Tdu biased Tdu < Tpo 7 Tpo biased Tdu > Tpo & Tdu < Tpo 8 Both direc tion GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE Tdu Tpo Tdu Tpo Tdu > Tpo9 Tdu biased Tdu < Tpo 10 Tpo biased Tdu > Tpo & Tdu < Tpo 11 Both direction 1Pullman 2; 2Tpo and Tdu copy lost in one individual of Pullman1 and Palouse, respectively; 3Tpo copy lost in all individuals of synthetic S1 and S2 generations; 4All natural populations and some hybrids; 5some hybrids, S1, and S2; 6Pullman 1, Pullman 2, Rosalia, Arizona, S1, and S2; 7Hybrids; 8Palouse, Oakesdale, and Tekoa; 9Pullman 2 and Arizona; Tdu copy lost in three individuals of Pullman2; 10Tekoa; 11Pulman 1, Palouse, Oakesdale, Rosalia, Hybrid, S1, and S2; Tdu copy lost in five individuals of Pullman1, one individual of Oakesdale, one individual of Rosalia.

PAGE 94

94 Figure 3 1. Real T ime RT PCR a nalys e s of genes showing the biased expression due to the unequal contribution of a parental genome to T. mirus. Expression levels were relative to the amount of internal control A CTINII and multiplied by 100. The vertical bars represent standard deviation. Different letters above bars indicate a significant difference according to paired t test (unpaired t test for parents) Numbers inside bars represent sample sizes. A: SMALL GTP BINDING PROTEIN, B: TRANSDUCIN FAMILY PROTEIN, C: POLY UBIQUITIN

PAGE 95

95 Figur e 31. Continued.

PAGE 96

96 Figure 32. Real T ime RT PCR analys e s of genes showing biased expression with disagreement between genomic and transcriptomic expression levels. Expression levels were relative to the amount of internal control A CTINII and multiplied by 100. The vertical bars represent standard deviation. Different letters above bars indicate a significant difference according to paired t test (unpaired t test for parents) Numbers inside bars represent sample sizes. A: NUCLEAR RIBOSOMAL DNA, B: THIOREDO XIN M TYPE 1 C: FRUCTOSEBISPHOSPHATE ALDOLASE, D: NUCLEIC ACID BINDING, E: GIBBERELLIN RESPONSE MODULATOR.

PAGE 97

97 Figure 32. Continued.

PAGE 98

98 Figure 32. Continued.

PAGE 99

99 Figure 33. Real T ime RT PCR analys e s of genes showing variable e xpression patterns Exp ression levels were relative to the amount of internal control A CTINII and multiplied by 100. The vertical bars represent standard deviation. Different letters above bars indicate a significant difference according to paired t test (unpaired t test for par ents) Numbers inside or below bars represent sample sizes. A: EXPRESSION PROTEIN 1. B: GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE.

PAGE 100

100 Figure 33. Continued.

PAGE 101

101 Figure 3 4. Genomic CAPS analyses of FRUCTOSEBISPHOSPHATE ALDOLASE which exhibits additivity in synthetic S1 and S2 generations. Tdu= T. dubius Tm= T. mirus Tpo= T. porrifolius FRUCTOSEBISPHOSPHATE ALDOLASE.

PAGE 102

102 Figure 3 5 Real T ime RT PCR analys e s of all individuals from F1 hybrids (Hy) to synthetic generation (S1 and S2). Expression levels were relative to the amount of internal control A CTINII and multiplied by 100. A: GIBBERELLIN REPONSE MODULATOR, B : EXPRESSED PROTEIN1 C: GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENEASE.

PAGE 103

103 Figure 35. Continued.

PAGE 104

104 Figure 35. Continued.

PAGE 105

105 Figure 36. Real T ime RT PCR analyses of the four specific lines from F1 hybrids (Hy) to synthetic generation (S1 and S2). Expression levels were relative to the amount of internal control ACTINII and multiplied by 100. A: GIBBERELLIN REPONSE MODULATOR, B : EXPRESSED PROTEIN1 C: GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENEASE.

PAGE 106

106 Figure 36. Continued.

PAGE 107

107 Figure 36. Continued.

PAGE 108

108 CHAPTER 4 PROTEOMIC PROFILES IN THE RECENTLY FORMED ALLOPOLYPLOID, T ragopogon mirus (ASTERACEAE) AND ITS DIPLOID PARENTS Introduction Polyploidy (genome doubli ng, or whole genome duplication) has played an important role in speciation and genome evolution in diverse organisms, including yeast (KELLIS et al. 2004) vertebrates (DEHAL and BOORE 2005; HUFTON et al. 2008) and plants (ADAMS and WENDEL 2005; CHEN 2007; CHEN and NI 2006; OSBORN et al. 2003; SOLTIS and SOLTIS 2000; WENDEL 2000) In plants, the historically estimated occu rrence of polyploidy ranged between 3080% angiosperms and up to 95% of ferns (Filicales) (GOLDBLATT 1980; GRANT 1981; MASTERSON 1994; OTTO and WHITTON 2000; STEBBINS 1950) However, based on recent genomic and transcriptomic studies (CUI et al. 2006; SOLTIS et al. 2009) all angiosperms may have experienced at least one round of polyploidy at some point in their evolutionary history ( Arabidopsis thaliana, (SIMILLION et al. 2002; THE ARABIDOPSIS GENOME INITIATIVE 2000) Populus trichocarpa (TUSKAN et al. 2006) Vitis vinifera (JAILLON et al. 2007; VELASCO et al. 2007) Cucumis sativus (HUANG et al. 2009) Carica papaya (MING et al. 2008) Oryza sativa (INTERNATIONAL RICE GENOME SEQUENCING PROJECT 2005) Sorghum bicolor (PATERSON et al. 2009) Zea mays (WEI et al. 2007) and Glycine max (SCHMUTZ et al. 2010) ) The most obvious genetic consequence of polyploidy is simultaneous duplication of all genes in the genome, which may provide increased evolutionary potential for any given polyploid. Al though one duplicated gene copy can be subsequently silenced or lost (nonfunctionalization), the divergence of duplicate genes can provide genetic redundancy for selection and mutation (retention) with the possible acquisition of new gene functions (neofunctionalization) and the partition such as timing or tissue -

PAGE 109

109 specificity of gene expression (subfunctionalization); both may be important sources of novelty and adaptability (FORCE et al. 2005; HE and ZHANG 2005; KIRSCHNER and GERHART 1998; LYNCH and CONERY 2000) Hence, the expression patterns of duplicated genes have been conducted in polyploids in Arabidopsis suecica (COMAI et al. 2000; LAWRENCE et al. 2004; LEE and CHEN 2001; MADLUNG et al. 2002; MADLUNG et al. 2005; WANG et al. 2006b; WANG et al. 2004) cotton (ADAMS et al. 2003; CHAUDHARY et al. 2009; FLAGEL and WENDEL 2009; HOVAV et al. 2008a; LIU et al. 2001; ZHAO et al. 1998) whe at (BOTTLEY and KOEBNER 2008; BOTTLEY et al. 2006; FELDMAN et al. 1997; HE et al. 2003; KASHKUSH et al. 2002; KASHKUSH et al. 2003; PUMPHREY et al. 2009; SHAKED et al. 2001) Brassica (GAETA et al. 2007; LUKENS et al. 2004; LUKENS et al. 2006; MARMAGNE et al. 2010; SONG et al. 1995) Spartina (AINOUCHE et al. 2004b; BAUMEL et al. 2001; FORTUNE et al. 2007; SALMON et al. 2005) Senecio (HEGARTY et al. 2008; HEGARTY et al. 2006; HEGARTY and HISCOCK 2008; HEGARTY et al. 2005) and Tragopogon (BUGGS et al. 2009b; KOH et al. 2010; KOH et al. in prep.; TATE et al. 2006) However, nearly all of these approaches have been carried out at the genomic or transcript omic level using cDNAAFLP display, CAPS (cleaved amplified polymorphic sequences), reverse transcriptase PCR, and microarray s, and few studies have examined levels and patterns of protein expression. Proteomics can complement genomic studies because proteins are the final products of genes and are more directly related to cellular metablism and phenotype. In fact, there is no linear relationship between RNA t ranscription and protein abundance due to post transcriptional regulation and post translational modifications (PTMs) (GYGI et al. 1999) Therefore, applying proteomic approaches to polyploid systems will

PAGE 110

110 enhance our understanding of the evolution and adaptation of polyploids T o date, only a few studies have implemented proteomic analysis in polyploids including studies of protein expression in Triticum aestivum (BAHRMAN and THIELLEMENT 1987; ISLAM et al. 2003a) and Brassica (ALBERTIN et al. 2006; ALBERTIN et al. 2005) These studies revealed additivity of the diploid parental proteomes in allopolyploids (BAHRMAN and THIELLEMENT 1987) and autopolyploids (ALBERTIN et al. 2005) and the other two suggest ed either an interaction among genomes or a nonadditive pattern in Triticum aestivum (ISLAM et al. 2003a) and synthetic B. napus (ALBERTIN et al. 2 006) However, all of these studies employed twodimensional electrophoresis (2DE), which may exhibit gel to gel variation and for which quantification is based on spot intensity which can be problematic In addition, Triticum aestivum and Brassica napus are crops as well as paleopolyploids, and might have been under strong artificial selection during their long evolutionary history. Therefore, a robust methodology and a natural and recent allopolyploid system will help to provide valuable new insight s i nto hybridization and polyploidization. Tragopogon mirus and T. miscellus are recent allopolyploids that have become evolutionary model s for polyploid research. T hese species were formed by hybridization of three diploid species ( T. mirus from T. dubius and T. porrifolius and T. miscellus from T. dubius and T. pratensis ) in the northwestern U.S.A. after the introduction of the progenitors from Europe in the early 1900s. The three diploids did not co occur in the Palouse prior to 1928, so T. mirus and T. mi scellus cannot be more than ~ 80 years old (NOVAK et al. 1991; OWNBEY 1950; SOLTIS et al. 2004) Through comparative analysis of genomic and transcriptional data and their diploid progenitors new perspectives have

PAGE 111

111 emerged on the genomic and genetic attributes of Tragopogon allopolyploids including regulation and evolution of homeologs in polyploids such as intergenomic translocation, rapid homeolog loss, and differential expression of homeologs (BUGGS et al. 2010; BUGGS et al. 2009b; BUGGS et al. 2009c; KOH et al. 2010; KOH et al. in prep.; LIM et al. 2008b; TATE et al. 2009a; TATE et al. 2006) T o understand evolutionary adaptation and natural selection of polyploids, we employed comparative proteomics (based on iTRAQ (isobaric tags for relative and absolute quantification) LC MS/MS technology) to investigate level s and patterns of protein expression in the natural allopolyploid T. mirus and its parents, T. dubius and T. porr ifolius We also examined artificial F1 diploid hybrids between the two parents and synthetic allotetraploid T. mirus generation S1. Proteomic studies will help us determine the contribution of hybridization and genome doubling to differences in protein ex pression in young polyploids. We sought to determine 1) differences in protein expression among the diploid parents, natural allopolyploids, diploid F1 hybrids and synthetic S1 generation, 2) the relative roles of hybridization and polyploidization in alt ering protein expression, and 3) whether the changes correlate with existing information obtained from transcriptional analysis (KOH et al. 2010; KOH et al. in prep.) Materials and Methods Plant M aterials For T. dubius and T. porrifolius seeds of the Pullman1 locale were collected fr om natural populations and grown in the greenhouse at Washington State University (Pullman, WA, USA) and allowed to self fertilize (Table 4 1) Seeds were collected, germinated, and grown under controlled conditions in the greenhouse at the University of Florida (UF; Gainesville, FL, USA). Diploid F1 hybrids and synthetic allopolyploids

PAGE 112

112 (S1) used in this study were generated by J. Tate (TATE et al. 2009b) who crossed T. dubius (261324; the paternal progenitor) with T. porrifolius (2611 1 and 261111 for the F1 hybrid and S1, respectively; the maternal progenitor). Synthetic polyploids (S1) were made by colchicine treatment of F1 hybrids. Seeds from the above materials wer e germinated at 20C in a petri dish containing 0.1% bleach, and plants were grown in a greenhouse. Leaf segments of 30 cm in length were collected directly into liquid ni trogen from young plants eight weeks after germination. Sixteen samples, including two lines of T. mirus two lines of each diploid parent, and two biological replicates each one line of F1 hybrids and one line of the synthetic allopolyploid (S1) were used in this study (Table 4 1). For each sample, ten individuals were combined to reduce variation among individuals ; thus, 160 plants w ere used for protein extraction. Protein P reparation Total proteins were isolated from two grams of leaf tissue from ten i ndividuals and purified as described in Hajduch et al. (2005), except proteins were washed in 80% cold acetone to remove impurities (THONGBOONKERD et al. 2002) Protein assay s were performed using an EZQ Protein Quantitation Kit (Invitrogen, Carlsbad, CA, USA) with the SoftMax Pro Software v5.3 (Molecular Devices, Downingtown, PA, USA) Protein Digestion, iTRAQ Labeling, and Strong Cation Exchange Fractionation Each replicate of 100 g protein was used for overnight acetone precipitation. After protein precipitation, the pellet from each replicate was dissolved in the dissolution buffer with 2% SDS in the iTRAQ Reagents 8plex kit ( AB Sciex, Inc. Foster City, CA, USA). Then the samples were reduced, alkylated, tryps in digested, and labeled according to the manufacturers instructions ( AB Sciex, Inc. ). Two independent maternal lines of T. porrifolius were labeled with iTRAQ tags 113 and 114, and two independent

PAGE 113

113 paternal lines of T. dubius were labeled with tags 115 and 116. Two independent allopolyploid lines of T. mirus were labeled with tags 117 and 118, and the diploid F1 hybrid and synthetic S1 generation were labeled with tags 119 and 121, respectively (Table 4 1). The combined peptide mixtures were lyophilized an d dissolved in strong cation exchange (SCX) solvent A (25% (v/v) acetonitrile, 10 mM ammonium formate, and 0.1% (v/v) formic acid, pH 2.8). The peptides were fractionated using an Agilent HPLC system 1100 with a polysulfoethyl A column (2.1 100 mm, 5 m, 300 ; PolyLC, Columbia, MD, USA). Peptides were eluted with a linear gradient of 0 20% solvent B (25% (v/v) acetonitrile and 500 mM ammonium formate, pH 6.8) over 50 min followed by ramping up to 100% solvent B in 5 min. The absorbance at 280 nm was moni tored, and 34 fractions were collected. The fractions were combined into 12 final fractions and lyophilized. A quadrupole timeof flight QSTAR MS/MS system (AB Sciex, Inc. ) was used for data acquisition as described previously (CHEN and HARMON 2006; ZHU et al. 2009) Peptides were passed through the HPLC column by a linear gradient from 3% Solvent B (96.9% acetonitrile (v/v), 0.1% (v/v) acetic acid) to 40% Solvent B for 2 h followed by ramping up to 90% Solvent B in 10 min. Peptides were sprayed into the orifice of the mass spectrometer, which was operated in an informationdependent data acquisition mode. (HAJDUCH et al. 2005) Data Analysis The MS/MS data were processed by a thorough search considering biological modification and amino acid substitution against the NCBI nonredundant fasta database (7,852,350 entries), a customized nonredundant Asteraceae fasta database ( http://compositdb.ucdavis.edu/ and http://comp bio.dfci.harvard.edu/ ; 10,250,488 entries), and a redundant Tragopogon diploid fasta database ( T. dubius T. porrifolius

PAGE 114

114 and T. pratensis ; 8,306,876 entries from 454 and Solexa seqeuncing) using the Fraglet and Taglet searches under the ParagonTM algorithm (SHILOV et al. 2007) of ProteinPilot v.3.0 software ( AB Sciex, Inc. ) After searching against these different databases, the results were combined per experimental group (biological replicate 1 and biological replicate 2). Plant species, fixed modification of methylmethane thiosulfatelabeled cysteine, fixed iTRAQ modification of amine groups in the N terminus and lysine, and variable iTRAQ modifications of tyrosine were considered. The raw peptide identification results from the Paragon algorithm were further processed by the ProGroupTM algorithm which assembles the results into the minimal set of detected proteins W e used t he ProteinPilot cutoff score with 1.3 which is a confidence level of 95%. The false discovery levels were estimated by performing the search against concatenated databases containing both forward and reverse sequences. For protein quantification, only MS/MS spectra that were unique to a particular protein and where the sum of the signal to noise ratio for all of the peak pairs was >9 were used for quantification (software default settings, AB Sciex, Inc. ). The accuracy of each protein ratio is gi ven by a calculated error factor from the ProGroup analysis in the software, and a p value is given to assess whether the protein is significantly differentially expressed. The error factor is calculated as 10^(95% confidence error) where this 95% confidence error is the weighted standard deviation of the weighted average of log ratios multiplied by Student's t factor. The p value is determined by calculating Student's t factor by dividing (weighted average of log ratios log bias) by the weighted standard deviation, allowing determination of the p value with n 1 degrees of freedom again where n is the number of peptides contributing to protein

PAGE 115

115 relative quantification (software default settings, AB Sciex, Inc. ). To be identified as being significantly dif ferentially expressed, a protein had to be quantified with at least three spectra (allowing generation of a p value), a p value <0.05, and a fold change >1.5 or <0.5 with at least six peptides in both experimental replicates Results Tragpogon P rotein I dentification To identify proteins in T. mirus relative to its diploid parents, we used an off line 2D LC MS/MS method with SCX chromatography as a first step to fractionate the leaf proteome of all Tragopogon samples (natural allopolyploid T. mirus and its diploid parents, synthetic diploid F1 hybrid, and S1 generation). A total of 32 fractions was collected and combined into 12 final fractions (supplemental File 2). This method has been used successfully to elucidate the proteomes from complex samples such as Arabidopsis thaliana (PANG et al. 2010) Brassica napus (ZHU et al. 2009) Saccharomyces cerevisiae (PENG et al. 2003) and human serum (ADKINS et al. 2003; NGELE et al. 2004) After reverse phase LC MS/MS of the SCX fractions, 470 unique proteins were identified from the first experim ent. Six additional proteins were identified from the second independent experiment. Thus, a total of 476 proteins from eight diploid and polyploid individuals was identified. Searching against three concatenated databases allowed calculation of the false discovery rates for these experiments, which are below 4% at the protein level in all the experiments. We included the Asteraceae database in our database search to enhance the success of protein identification due to the limitation of Tragopogon sequences in the public database. The identified proteins were functionally annotated according to their homology with other proteins based on proteinprotein basic local alignment search tool (BLAST) searches, protein family

PAGE 116

116 database information, and/or literature information. The proteins were classified with reference to the functional categories previously established (BEVAN et al. 1998) T he identified proteins cover a wide range of molecular functions, including photosy nthesis (17.8%), metabolism (16.1%), stress and defense (15.9%), respiration ( 12.4%), protein synthesis (8.6%), and signal transduction (6.4%) (Figure 4 1A). In addition, 68 proteins were differentially expressed among natural T. mirus the F1 hybrids, and the synthetic T. mirus generation S1. When they were classified into functional categories, 68 proteins exhibited a similar functional distribution as seen for all of the identified proteins (Figure 1B) : P hotosynthesis related proteins account for 24% of the differentially expressed proteins, followed by metabolism (17%), respiration (14%), and stress and defense (11%) (Figure 4 1B). Proteome V ariation in L eaf T issue of the D iploid P arents We first determined parental variation using two lines and four individuals of each diploid parent ( T. dubius and T. porrifolius ). For the expression levels within the parental species, there were 13 proteins that showed higher expression in either T. dubius or T. porrifolius (Tables 4 2, 4 3). Within the T. porrifolius p opulation, four proteins showed differential expression patterns (Oxygenevolving enhancer protein 2, Cytosolic glutamine synthetase GSbeta1, Predicted protein, and Vegetative storage protein) (Table 4 2). However, such differential expression is expected of 476 proteins). Furthermore the significance is not very high for two of the four proteins in T. porrifolius (0.023 p value 0.046). Within the T. dubius population, nine proteins exhibited differential expression (Phosphoglycer ate kinase precursor like, Calcium ion binding, Oxygenevolving enhancer protein 3 precursor like protein, ATPase beta subunit, hypothetical protein, Photosystem II chlorophyll apoprotein,

PAGE 117

117 Fructose bisphosphate aldolase 2, ATP synthase catalytic subunit A, ATP synthase CF1 beta subunit, and Photosystem II 44 kDa protein; 0.001 p value 8 ) (Table 4 3), proteins). Therefore, there may be minor variation in the proteome between the two T. dubius individuals used in this study. We also analyzed protein expression levels between the maternal ( T. porrifolius ) and paternal ( T. dubius ) progenitor s of the allo polyploid T. mirus Sixteen proteins w ere differentially expressed between the diploid parents (Table 4 4). The number of proteins identified here is much higher than that proteins) ; thus, leaf proteomes between the two diploid parents differ significantly. Proteome V ariation in the N atural A llopolyploid T. mirus Eight proteins showed differential expression between two individuals of T. mirus (Oxygenevolving enhancer protein 3 precursor like protein, ATP synthase CF1 beta subunit, photosystem II CP47 chlorophyll apoprotein, ATPase beta subunit, Hypothetical protein, Transketolase, photosystem II 44 kDa protein, and histone 2) (Table 4 5), which is slightly higher than the number expected as a result of random H alf of these proteins are due to variation in the proteome of the diploid parent T. dubius Thus, the variation observed in the proteome o f T. mirus might be attributed in part to variation in the parental proteomes (Tables 4 2, 4 3, 4 4, and 4 5). Proteome V ariation in N atural and Synthetic A llopolyploids and Diploid F1 Hybrids Differential expression was observed for 68 (14.3%) proteins between the F1 hybrid, synthetic, and natural allopolyploid T. mirus versus the diploid parents ( T. dubius

PAGE 118

118 and T. porrifolius ) The rest of the proteins (408, 85.7%) exhibited additivity, i.e., their expression levels are the same as those found in the parental diploid species (Figure 4 2, Table 4 6, 4 7). Among differentially expressed proteins in the natural allopolyploid T. mirus 44 proteins exhibited differential expression levels. Of these, 27 proteins were upregulated relative to the diploid parents, while 15 proteins showed downregulation. The remaining two proteins (Ribosomal protein L12 and Ribulose bisphosphate carboxylase large chain precursor) showed upregulation relative to T. dubius but downregulation relative to T. porrifolius (Table 4 6, 4 7). Furthermore, upregulated proteins are twice as frequent as downregulated proteins (27 vs. 15), and almost equal proportions of upor down regulated proteins were identified compared to each parental proteome (Table 4 6, 4 7). In the synthetic allo polyploid plant (S1), 50 (10.5%) proteins w ere differentially expressed relative to its diploid parents (261111 as maternal parent and 261324 as paternal parent; Table 4 1). The other 426 (89.5%) proteins showed additive patterns (Table 4 6, 4 7), which is similar to those observed in natural allopolyploid T. mirus A similar proportion of differential ly expressed proteins was upor downregulated in the synthetic polyploid (S1) as in the natural allopolyploid T. mirus (Table 6). However, there were twic e as many upregulated proteins as downregulated proteins. Among the upregulated proteins, 21 showed higher expression than T. dubius while 16 exhibited higher expression than T. porrifolius (Table 4 6). In addition, among the 15 downregulated proteins almost equal numbers were differentially expressed in the synthetic polyploid (S1) compared to each parental proteome.

PAGE 119

119 A slightly higher number of proteins is upregulated in the synthetic polyploid (S1) compared to natural allopolyploid T. mirus (Table 4 6, 4 7). To determine whether hybridization or polyploidization has the larger impact on polyploidy proteome evolution in polyploids we analyzed the proteomic profiles of the synthetic F1 hybrid. When protein expression levels in diploid F1 hybrids wer e compared with those in their diploid parents (26111 as maternal parent and 261324 as paternal parent; Table 4 1), we detected 32 (6.72%) proteins with differential expression, slightly fewer than those obtained from the natural allopolyploid T. mirus a nd synthetic allopolyploid (S1). In addition, 444 (93.3%) proteins in the F1 hybrid showed additivity. In contrast to the relatively equal number of proteins identified from comparison with parental proteomes in T. mirus and the synthetic allopolyploid (S1), there were more proteins identified when compared to T. dubius (22 proteins) than T. porrifolius (16 proteins) in the F1 hybrid plants. This became obvious when we considered upregulated proteins, i.e., 15 out of 20 upregulated proteins were found by comparison with T. dubius However, this bias was not observed in downregulated proteins (7 vs. 11 proteins relative to T. dubius and T. porrifolius respectively). Differences between the Diploid F1 Hybrid and the N atural Allopolyploid T. mirus A total of 68 proteins showed differential expression in F1 hybrid, synthetic T. mirus and natural T. mirus plants (Figure 4 2). Thirty two out of 68 proteins showed up or downregulation in the F1 hybrids relative to either one of the diploid parents; four prot eins out of the 32 showed changes only in the F1 hybrid plants, while 11 and 17 proteins have maintained the changes observed in F1 hybrids in the synthetic polyploid T. mirus (S1) and natural T. mirus plants, respectively. Important l y, 22 out of 68 protei ns showed expression changes in the first generation (S1) compared with the natural T.

PAGE 120

120 mirus plants. Nine out of the 22 proteins were differentially expressed only in synthetic pol yp l oid T. mirus (S1), while 13 out of 22 proteins have kept their expression level in the natural T. mirus plants. Interestingly, 14 out of 68 proteins showed novel differential expression changes in natural allopolyploid T. mirus plants compared to its diploid parental proteomes. C haracterization of the Proteins Displaying Nonadditive P atterns We examined detailed expression patterns of proteins differentially expressed in T. mirus F1 hybrids, and synthetic allopolyploid s (S1). A total of 30 proteins showed differential expression, among which 13 proteins exhibited the highest ex pression level in the S1, while nine and eight proteins were highly upregulated in F1 hybrids and natural T. mirus respectively (Figure 4 3) When compared with the parental proteomes, the proteins highly upregulated in S1 T. mirus were different from t he upregulated protein patterns observed in F1 hybrids and natural T. mirus (Figure 4 3A). The expression difference between S1 plants and F1 hybrids ranged from 5 to 36fold compared to the T. porrifolius proteome, while only 1 to 6 fold differences were observed in comparison to the T. dubius proteome. T his pattern was also observed in proteins showing the highest expression levels in F1 hybrids (Figure 4 3B). As noted, more proteins were highly upregulated in F1 hybrids compared to the T. dubius proteo me, and they exhibited less folddifference between F1 hybrids and S1 plants compared to the T. porrifolius proteome. However, this pattern was not observed in proteins highly upregulated in T. mirus (Figure 4 3C). In addition, in contrast to F1 hybrids, more proteins showed the highest upregulation in T. mirus compared to the T. porrifolius proteome (6 vs. 2 proteins in comparison between T. porrifolius and T. dubius proteomes, respectively).

PAGE 121

121 C omparison of Proteome D ata with Transcript D ata To determine whether transcript level changes correlate with protein accumulation, we compared the proteomic data presented here with the transcript data of KOH et al. (in prep.). Six out of ten genes investigated by KOH et al. (in prep.) ( FRUCTOSEBISPHOSPHATE ALDOLA SE ( FBP) GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE ( G3PDH), NUCLEIC ACID BINDING NUCLEAR RIBOSOMAL PROTEIN, POLYUBIQUITIN, and THIOREDOXIN M TYPE 1 ) were included in the proteomic analysis. Four of the six proteins showed additive patterns in naturally o ccurring polyploid T. mirus F1 hybrids, and S1 T. mirus In contrast, the T. dubius homeolog of FBP was upregulated in synthetic T. mirus (S1) 1.6 fold higher than in the diploid parent ( p value=0.034), and the T. porrifolius homeolog of G3PDH showed 0.6fold lower expression in the F1 hybrids than in the diploid parent ( p value=0.011). Discussion To date, most proteomic studies of polyploids have been conducted using 2DE (ALBERTIN et al. 2006; ALBERTIN et al. 2005; ISLAM et al. 2003a) This method has the advantage of visualizing protein expression patterns and potential PTMs. However, 2DE has many limitations, such as extensive sample handling, limited reproducibility, relatively lowthroughput, and difficulty i n analyzing low abundance proteins and very acidic or basic proteins, as well as very large or very small proteins (CHEN and HARMON 2006) An alternative to the 2DE approach is the use of a stable isotope for labeling peptides from protein digest, followed by peptide fractionation and LC MS/MS (CHEN and HARMON 2006; ROSS et al. 2004) iTRAQ is such a method, which is based on labeling all primary amines in peptides from different samples with isobaric tags. Each

PAGE 122

122 tag has a different reporter group, so the relative peak area of the reporter group can be used for protein quantification in each sample (CHEN and HARMON 2006) This technique allows relative and absolute quantificat ion of proteins from up to eight samples simult aneously. Here we applied iTRAQ based comparative proteomics to understand the early stage of polyploid evolution using natural allopolyploid T. mirus its diploid parents F1 hybrids and synthetic T. mirus T echnical Challenges of Proteomic Analysi s of Allopolyploid T. mirus and its Parents Comparative proteomic analysis revealed little variation within the T. porrifoilus population (0.8%; four out of 476), while the T. dubius population showed variation for n ine proteins (1.9%; nine out of 476). Although the level of proteomic variation was not high in either parent, T. dubius is more variable than T. porrifolius based on the samples included here i tion, previous studies using allozymes and molecular markers also suggested that genetic variation within populations is low in Tragopogon, but T. dubius is the most genetically variable species among the three diploid parents (COOK et al. 1998; KOH et al. 2010; SOLTIS et al. 1995; SYMONDS et al. 2010) The variable T. dubius proteome may affect the proteomic diversity of T. mirus Indeed, nine proteins were variable in the T. mirus due to variation in the parental proteomes, although both parents equally contributed to variation in T. mirus (two from T. dubius and two from T. porrifolius ). The other four could be derived from random variation among individuals. Comparison of the T. dubius and T. porrif olius proteomes revealed that 16 proteins were differentially expressed between them (3.4%; 0.01< p <0.05). Interestingly, there is 3.5% DNA sequence divergence between two species based on 30 gene

PAGE 123

123 regions (KOH et al. 2010; KOH et al. in prep.) It should be noted that no proteomic study yet has been conducted comparing different species using the iTRAQ method, although a recent comparative proteomic study based on 2DE showed nonadditive patterns (25 38%) in synthetic allopolyploid Brassica napus relative to its diploid progenitors ( B. r apa and B. oleracea) (ALBERTIN et al. 2006) However, the different techniques were used, mak ing it hard to compare our results with theirs. Our results show little variation between the proteomes of the two parental species, T. dubius and T. porrifolius (16 out of 476; 3.4%). Although this finding correlates well with genomic results, there is a possibility of underestimating the proteomic differences between the two species. In many studies like ours, whole tissue was used and protein differences between different cell types could be averaged out. In fact, when the proteomes from two different cells were compared in Brassica napus 217 differentially expressed proteins (217 out of 1458; 15%) were discovered (ZHU et al. 2009) which is more than six times as many as found in the Tragopogon system. In the future, proteomics using specific types of cells or organelles may reveal more proteome differences between the species. In addition, we might have underestimated the differentially expressed proteins due to the limitation of Tragopogon sequence databases. T he ProteinPilot v.3.0 software requires a nonredundant database because iTRAQ identifies proteins based on several peptide sequences using the basic unused ProtScore option, which is a measurement of all the peptides for a protein (AB Sciex Inc.). Therefore, it provides quantitative expression changes by isolating multiple tryptic peptides (OW et al. 2009; T et al. 2009) In this study, even though we used three different databases, the NCBI nonredundant database does not contain enough information for the

PAGE 124

124 Tragopogon system and Asteraceae and Tragopogon databases are not completely annotated or sequenced. Therefore, in contrast to ZHU et al. (2009), who used the Arabidopsis database because Brassica is closely related to Arabidopsis and also very similar in genomic content, our searching of databases represented only a small part of a whole proteome. Thus, the small number of differentially expressed proteins identified from iTRAQ might be due to insufficient information about Tragopogon gene sequences. A Tragopogon genome sequencing project would greatly enhance future proteomics work. Novel Insights into the Proteomes of Natural and Synthetic Allopolyploids and F1 Hybrid s Comparative proteomics of the diploid parents ( T. dubius and T. porrifolius ) and natural and synthetic T. mirus as well as F1 hybrids of T. dubius T. porrifolius revealed that 32 proteins changed their expression patterns after hybridization between the two parents, and an additional 22 proteins were differentially expressed immediately following the process of genomic doubling based on the study of S1 plants. In addition, our studies of natural populations of T. mirus revealed changes in protein expression profiles for an additional 14 proteins, indicating further change in the proteome over the past 40 generations. Overall, our data suggest that the hybridization effect is more i mportant in proteome evolution than is polyploidization itself. In particular, there are nearly identical numbers of proteins upor downregulated in F1 hybrids (17 vs. 14), while there are more proteins upregulated than downregulated in natural and syn thetic T. mirus (Table 4 6). This indicates that genome doubling might stimulate mechanisms controlling protein upregulation.

PAGE 125

125 Interestingly, the biased upregulated proteomic profiles were noted in the F1 hybrid and synthetic T. mirus compared to the T. dubius proteome, but were not observed in natural T. mirus (Table 4 6). This biased proteomic expression pattern is consistent with the previous results of BUGGS et al. (2010) based on gene expression. They examined gene expression patterns in T. miscellus using next generation sequencing approaches and showed that paternal T. dubius homeologs were more often differentially expressed than the T. pratensis homeologs (77% vs. 23%, respectively). It is uncertain that this genomic bias is also true for T. mirus but both T. miscellus and T. mirus exhibited similar patterns at genomic and transcript levels (BUGGS et al. 2009b; KOH et al. 2010; TATE et al. 2009a; TATE et al. 2006) Assuming that a genomic bias might be obse rved in T. mirus although this should be experimentally confirmed, T. dubius could continue its dominant effect on T. mirus from the gene transcription level to the proteomic level. However, this proteomic bias is effective only at the early stages of pol yploid evolution (i.e., hybridization and early synthetic generation, S1) because it is not observed in natural populations of T. mirus (no more than 40 generations old). Therefore, more work using later synthetic generations, such as from S2 to S5, is nec essary to determine whether the proteomic bias gradually fades away and how the process relates to polyploid evolution. Correlation between P rotein Expression and G ene T ranscript D ata in T. mirus Comparison of proteomic data with gene expression result s (KOH et al. in prep.) revealed six pairs of proteintranscript matches. All six of those genes showed biased expression patterns toward one of the parental species (KOH et al. in prep.) but four of then exhibited additive patterns in the proteomic profiles. Apparently, the upregulation of the T. dubius derived FBP is due to the absence of the T. porrifolius derived pr oteins

PAGE 126

126 due to silencing of the T. porrifolius homeolog in the S1 synthetic generation (KOH et al. in prep.) However, the T. porrifolius homeolog of G3PDH showed 0.6fold lower expressi on in the F1 hybrid than in the diploid parent s ( p =0.011). In addition, genes that were nonadditively expressed in other polyploid plant systems also showed additivity in Tragopogon (e.g., the small subunit of RUBISCO (HEGARTY et al. 2005; WANG et al. 2004) NADdependent malate dehydrogenase (HEGARTY et al. 2005; WANG et al. 2006b; WANG et al. 2004) and chlorophyll a/b binding protein (HEGARTY et al. 2005) ). Although protein abundance does not correlate well with transcript amounts (ALBERTIN et al. 2005; ANDERSON and SEILHAMER 1997; GYGI et al. 1999; HAYNES et al. 1998; KERSTEN et al. 2002; MARM AGNE et al. 2010) the divergence between the two parental genomes can have an impact on the proteomic differences in T. mirus In addition, parental homeologs can work differently in metabolic pathways, and it becomes important to understand the dynamics of proteins in polyploids. Thus, a higher proteome coverage is needed. To achieve this, sample fractionation, a better sequence database and implementation of other proteomics tools are essential. In summary, our results suggest that posttranscriptional processes may play an important role in controling protein levels. Further studies of gene expression based on differentially expressed proteome are needed to explore the regulatory mechanisms that underlie physiological changes or phenotypic variation in the evolution of allopolyploid Tragopogon. Conclusions This study represents the first proteomic analysis of hybridization and polyploidization in a naturally occurring plant species, recently and recurrently formed allopolyploid Tragopogon mirus (<80 year s old; 40 generations for a biennial). The only

PAGE 127

127 other proteomic investigations in polyploid plants have been conducted on wheat and Brassica based on analyses of 2DE (ALBERTIN et al. 2006; ALBERTIN et al. 2005; ISLAM et al. 2003a) Using iTRAQ based comparative proteomics, we identified 476 proteins, of which 68 were differentially expressed between T. mirus and its diploid parents. In addition, parental proteomic analysis indicated that only T. dubius is variable w ithin the Pullman 1 population, which is congruent with previous genetic studies (KOH et al. 2010; KOH et al. in prep.; SYMONDS et al. 2010) Comparative proteomics revealed that 39 proteins changed expression after hybridization, which merges two distinct genomes, and an additional 16 proteins were differentially expressed immediately following genomic doubling (in the synthetic S1 generation). Therefore, examination of proteomic profiles of T. mirus indicated that the impact of hybridization is more important in the proteome than is polyploidization per se. Comparison of the protein data with a previous study of gene transcription revealed that transcription and protein expression levels in T. mirus are not correlat ed. Our results suggest that post transcriptional processes might control protein expression (GYGI et al. 1999) Further studies of gene expression based on differentially expressed proteins are needed to explore the regulatory mechanisms that underlie physiological change s or phenotypic variation in the evolution of allopolyploid Tragopogon.

PAGE 128

128 Table 4 1. Plant materials used in this study and their plex number in iTRAQ Taxa Description Plant ID and collection No. Plex No. T. porrifolius Maternal parent (2 n ) 2611 1 113 T. porrifolius Maternal parent (2 n ) 2611 11 114 T. dubius Paternal parent (2 n ) 2613 5 115 T. dubius Paternal parent (2 n ) 2613 24 116 T. mirus Allotetraploid (4 n ) 2680 3 117 T. mirus Allotetraploid (4 n ) 2680 7 118 F 1 Hybrid Hybrid between 2613 24 ( 611 1 ( n ) 299 (2611 1 X 2613 24) 119 S 1 generation Chromosomal doubling of hybrid between 2613 24 ( 11 ( n ) 73 1 (2611 11 X 2613 24) 121

PAGE 129

129 Table 4 2. Variation between T. porrifolius individuals in leaf proteome Accession Pr otein ID species 2611 11/2611 1 Experiment 1 2611 11/2611 1 Experiment 2 Folding change p value Folding change p value gi|11134035 Oxygen evolving enhancer protein 2 Solanum tuberosum 0.619 0.009 0.459 0.019 gi|10946357 cytosolic glutamine syntheta se GSbeta1 Glycine max 2.992 0.014 3.132 0.014 gi|224112154 predicted protein Populus trichocarpa 0.316 0.037 0.432 0.023 gi|15387599 vegetative storage protein, VSP Cichorium intybus 0.029 0.046 0.129 0.036

PAGE 130

130 Table 43. Variation between T. dubius indi viduals in leaf proteome Accession Protein ID S pecies 2613 24/2613 5 Experiment 1 2613 24/2613 5 Experiment 2 Folding change p value Folding change p value gi|82621134 phosphoglycerate kinase precursor like Solanum tuberosum 0.614 0.027 0.054 0.007 gi|15234637 calcium ion binding Arabidopsis thaliana 7.727 0.000 3.981 0.004 gi|23308489 Oxygen evolving enhancer protein 3 precursor like protein Arabidopsis thaliana 7.627 0.000 4.998 0.004 gi|15234637 ATPase beta subunit Nicotiana sylvest ris 0.229 0.033 0.331 0.048 gi|18415911 ATP synthase subunit alpha, chloroplastic Arabidopsis thaliana 0.550 0.038 0.458 0.042 gi|255581400 Probable fructose bisphosphate aldolase 2 Ricinus communis 0.581 0.041 0.478 0.041 gi|15219366 ATP sy nthase catalytic subunit A Arabidopsis thaliana 0.360 0.017 0.050 0.000 gi|81176257 ATP synthase CF1 beta subunit Lactuca sativa 0.424 0.017 0.215 0.000 gi|94502487 photosystem II 44 kDa protein Helianthus annuus 6.368 0.021 4.858 0.028

PAGE 131

131 Table 44 Variation between T. porrifolius and T. dubius in leaf proteome Accession Protein ID species T. dubius / T. porrifolius Experiment 1 average T. dubius / T. porrifolius Experiment 2 average Folding change p value Folding change p value gi|584797 A TP synthase subunit beta Daucus carota 0.024 0.001 0.022 0.002 gi|68566313 Elongation factor TuA Nicotiana sylvestris 0.033 0.008 0.053 0.018 gi|75271099 Chlorophyll a/bbinding protein Oryza sativa subsp. Japonica 0.041 0.003 0.041 0.003 gi |4325041 FtsHlike protein Pftf precursor Nicotiana tabacum 0.048 0.006 0.045 0.003 gi|3328122 phosphoglycerate kinase precursor Solanum tuberosum 0.051 0.017 0.045 0.017 gi|255554879 ATP synthase gamma chain 2 Ricinus communis 0.063 0.019 0.06 3 0.022 gi|158513966 Ribulose bisphosphate carboxylase large chain precursor Crucihimalaya wallichii 0.103 0.001 0.120 0.001 gi|195622012 membrane associated 30 kDa protein Zea mays 0.118 0.034 0.122 0.031 gi|255557841 chlorophyll A/B binding protein, putative Ricinus communis 2.377 0.022 2.275 0.025 gi|77551383 ABC1 family protein Oryza sativa 4.325 0.001 5.285 0.001 gi|189418957 glycolate oxidase Mikania micrantha 6.081 0.008 7.393 0.008 gi|15234637 calcium ion binding Arabidopsis thaliana 6.546 0.000 8.828 0.000 gi|1172664 Photosystem I reaction center subunit III Flaveria trinervia 6.668 0.028 6.375 0.013 gi|15387599 vegetative storage protein, VSP Cichorium intybus 9.120 0.020 8.798 0.019 gi|75755655 photosystem II 44 kDa protein Acorus calamus 10.093 0.021 9.383 0.021 gi|2499497 Phosphoglycerate kinase, chloroplastic Nicotiana tabacum 13.677 0.003 12.731 0.003

PAGE 132

132 Table 4 5. Variation between T. mirus individuals in leaf proteom e Accession Protein ID Spe cies name 2680 7/2680 3 Exp.1 2680 7/2680 3 Exp.2 Folding change p value Folding change p value gi|23308489 Oxygen evolving enhancer protein 3 precursor like protein Arabidopsis thaliana 0.086 0.022 0.673 0.035 gi|81176257 ATP synthase CF1 beta subunit Lactuca sativa 0.453 0.019 0.515 0.027 gi|197132074 photosystem II CP47 chlorophyll apoprotein Geranium palmatum 18.880 0.031 9.290 0.023 gi|15234637 ATPase beta subunit Nicotiana sylvestris 2.421 0.045 0.098 0.038 gi|225424142 hypothetical protein Vitis vinifera 2.421 0.045 0.098 0.038 gi|30695271 transketolase Arabidopsis thaliana 3.802 0.038 3.981 0.014 gi|94502487 photosystem II 44 kDa protein Arabidopsis thaliana 4.446 0.031 9.550 0.011 gi|224065198 histone 2 Popu lus trichocarpa 5.012 0.035 2.249 0.024

PAGE 133

133 Table 4 6 Analysis of leaf proteomes of F1 hybrid, synthetic T. mirus (S1), and natural T. mirus Tdu= T. dubius Tpo= T. porrifolius F1 hybrids Synthetic (S1) T. mirus Pattern Number of proteins % Number of proteins % Number of proteins % Differential expression 32 6.7 50 10.5 44 9.2 Relative to Tdu 16 3.4 23 4.8 16 3.4 Relative to Tpo 10 2.1 23 4.8 18 3.8 Relative to both 6 1.3 4 0.8 10 2.1 Up regulated proteins 17 3.6 34 7.1 27 5.7 Relative to Tdu 12 2.5 18 3.8 10 2.1 Relative to Tpo 3 0.6 13 2.7 10 2.1 Relative to both 2 0.4 3 0.6 7 1.5 Down regulated proteins 14 2.9 15 3.2 15 3.2 Relative to Tdu 4 0.8 5 1.1 6 1.3 Relative to Tpo 7 1.5 10 2.1 8 1.7 Relative to both 3 0.6 1 0.2 Up and down regulated proteins 1 0.2 1 0.2 2 0.4 No differential expression 444 93.3 426 89.5 432 90.8 Total proteins identified 476 476 476 *proteins are upregulated relative to Tdu, but downregulated relative to Tpo.

PAGE 134

134 Table 4 7. Differentially expressed proteins in synthetic diploid F1 hybrid, polyploid (S1), and natural allopolyploid T. mirus. Tdu= T. dubius Tpo= T. porri folius Accession no. Protein ID Species F1 Hybrid Synthetic S1 natural T. mirus vs. Tdu vs. Tpo vs. Tdu vs. Tpo vs. Tdu vs. Tpo gi|80911 33kDa precursor protein of oxygen evolving complex Solanum tuberosum down down gi|548746 50S r ibosomal protein L12 Nicotiana sylvestris down down down gi|255564051 amino acid binding protein, putative Ricinus communis up up gi|3758827 amino acid selective channel protein Hordeum vulgare subsp. vulgare up up gi|81176257 ATP synth ase CF1 beta subunit Lactuca sativa down down down gi|461550 ATP synthase gamma chain 1, chloroplastic Arabidopsis thaliana up gi|6685244 ATP synthase subunit alpha Arabidopsis thaliana down down gi|118573691 ATP synthase subunit beta Lactuca sativa up up gi|124488474 benzoquinone reductase Gossypium hirsutum down gi|15234637 calcium ion binding Arabidopsis thaliana up up gi|297335585 catalytic/ coenzyme binding protein Arabidopsis lyrata subsp. lyrata up up u p gi|124245039 chloroplast HSP70 Cucumis sativus up up gi|45268437 chloroplast thylakoid bound ascorbate peroxidase Vigna unguiculata up up up gi|255580317 conserved hypothetical protein Ricinus communis up up up gi|10946357 cytosolic glutamine synthetase GSbeta1 Glycine max up up gi|73808794 cytosolic nucleoside diphosphate kinase Solanum chacoense up up gi|193161409 dehydrin 1 Cichorium intybus up up gi|7489327 drought induced protein SDi 6 Helianthus annuus d own down gi|51096228 Elongation factor 1 alpha Malus x domestica up up up up up gi|68566313 Elongation factor TuA Nicotiana sylvestris up up up up

PAGE 135

135 Table 4 7. Continued Accession no. Protein ID Species F1 Hybrid Synthetic S1 natural T. miru s vs. Tdu vs. Tpo vs. Tdu vs. Tpo vs. Tdu vs. Tpo gi|4325041 FtsH like protein Pftf precursor Nicotiana tabacum up up gi|51703306 glyceraldehyde 3 phosphate dehydrogenase Daucus carota down gi|38345525 histone 2 Populus trichocarpa up up gi|224065198 histone 2 Populus trichocarpa up gi|18411523 hydroxyproline rich glycoprotein family protein Arabidopsis thaliana down down down gi|225435052 hypothetical protein Vitis vinifera up up up gi|11994312 ic62 NAD(P ) related group II protein Arabidopsis thaliana up gi|259045656 LEA3 protein Sorghum bicolor down down down gi|18478480 maturation associated SRC1 like protein Carica papaya down gi|3676296 mitochondrial ATPase beta subunit Nicotian a sylvestris up gi|255542956 NAD dependent epimerase/dehydratase, putative Ricinus communis up up gi|16398 Nucleoside diphosphate kinase Arabidopsis thaliana up up gi|113596361 Os06g0669400 protein (Fragment) Oryza sativa subsp. Japo nica up gi|11134035 Oxygen evolving enhancer protein 2 Arabidopsis thaliana down down down down gi|31096349 oxygen evolving enhancer protein 3 precursor Pisum sativum up up gi|23308489 Oxygen evolving enhancer protein 3 precursor like protein Arabidopsis thaliana up gi|224069224 peroxiredoxin Populus trichocarpa down down down down gi|3328122 phosphoglycerate kinase precursor Solanum tuberosum down down gi|88656873 Photosystem I P700 chlorophyll a apoprotein Helianth us annuus up up up

PAGE 136

136 Table 4 7. Continued Accession no. Protein ID Species F1 Hybrid Synthetic S1 natural T. mirus vs. Tdu vs. Tpo vs. Tdu vs. Tpo vs. Tdu vs. Tpo gi|94502487 photosystem II 44 kDa protein Arabidopsis thaliana up up up gi|78675195 Photosystem II P680 chlorophyll A apoprotein Lactuca sativa up gi|255559812 Photosystem II stability/assembly fact or HCF136 Ricinus communis down down down gi|259783772 predicted protein Artemisia annua up gi|224130512 predicted protein Populus trichocarpa down down down gi|224121620 predicted protein Populus trichocarpa down down gi |224054740 predicted protein Populus trichocarpa up gi|255553917 Protein THYLAKOID FORMATION1, chloroplast precursor, putative Ricinus communis up gi|21553526 putative histone H2B Arabidopsis thaliana up up gi|75181188 Putative histone H2B.9 Arabidopsis thaliana up up gi|75294261 Putative RuBisCO subunit binding protein beta subunit, chloroplast Oryza sativa up down gi|16118827 putative sugar transporter Oryza sativa up gi|20020 Ribosomal protein L12 Nicot iana tabacum up down up down up down gi|158513966 Ribulose bisphosphate carboxylase large chain Crucihimalaya wallichii up up gi|988656961 Ribulose bisphosphate carboxylase large chain precursor Lactuca sativa up up up up up gi|37936916 ri bulose 1,5 bisphosphate carboxylase/oxygenase large subunit Tacazzea apiculata up gi|297320708 Rieske fes protein Arabidopsis lyrata subsp. lyrata down gi|4838147 seed maturation protein PM30 Glycine max down gi|68300918 thylakoi d bound ascorbate peroxidase 6 Solanum lycopersicum up up

PAGE 137

137 Table 4 7. Continued Accession no. Protein ID Species F1 Hybrid Synthetic S1 natural T. mirus vs. Tdu vs. Tpo vs. Tdu vs. Tpo vs. Tdu vs. Tpo gi|25562748 unknown protein Glyci ne max down down down down gi|257689925 unnamed protein product Glycine max up gi|257743421 unnamed protein product Medicago sativa up gi|15387599 vegetative storage protein Cichorium intybus up up up gi|30695271 transketo lase Arabidopsis thaliana up up up up gi|217072566 unknown Medicago truncatula up gi|255581400 fructose bisphosphate aldolase, putative Ricinus communis up gi|255551453 Photosystem I reaction center subunit II, chloroplast precursor, putative Ricinus communis up gi|94502490 photosystem I P700 chlorophyll a apoprotein Helianthus annuus down gi|7525033 Photosystem I P700 chlorophyll a apoprotein A2 Arabidopsis thaliana down down

PAGE 138

138 Figure 4 1. Classificatio n of the identified proteins into molecular functions. A. Classification of the 476 proteins. B. Classification of the 68 proteins differentially expressed in T. mirus F1 hybrid, or synthetic generation (S1).

PAGE 139

139 Figure 4 2 Ven diagram showing differenti ally expressed proteins among F1 hybrid, synthetic (S1) and natural T. mirus

PAGE 140

140 Figure 4 3 Expression patterns of proteins that are commonly differentially expressed in T. mirus F1 hybrids, and synthetic generation (S1). Compared parental proteome is indicated at the end of protein name. A: the highest expression level was observed in the S1 plants. B: the highest expression level was observed in F1 hybrid. C: the highest expression level was observed in T. mirus *actual value is 33.5.

PAGE 141

141 Figure 4 3 Continued.

PAGE 142

142 Figure 4 3 Continued.

PAGE 143

143 CHAPTER 5 CONCLUSION Although polyploidy has long been recognized as a major force in the evolution of plants, most of what we know about the genetic consequences of polyploidy comes from the study of crops and wel l established model systems (e.g., Arabidopsis Brassica cotton, and wheat). Furthermore, although many polyploid species have formed repeatedly, patterns of genome evolution and gene expression are largely unknown for natural polyploid populations of independent origin. Therefore, the goals of this study were to obtain a better understanding of polyploid evolution via the study of genomic changes, expression differences, and comparative proteomics in Tragopogon mirus relative to its diploid parents ( T. dubius and T. porrifolius ) as well as synthetic diploid F1 hybrids and synthetic T. mirus (generations S1 and S2). Tragopogon mirus (Asteraceae), was chsosen for study because it is an important evolutionary model system; it is an allopolyploid species that formed repeatedly within the last 80 years (<40 generations given that these plants are biennial) from the diploid parents T. dubius and T. porrifolius First, I examined the patterns of loss and expression in duplicate gene pairs (homeologs) in multiple i ndividuals (40) from seven natural populations of independent origin of T. mirus Application of the latest techniques in polyploidy evolution has been critical to improving our understanding of the evolutionary history in the Tragopogon system. U sing cDNAAFLPs, I found differential banding patterns that could be attributable to gene silencing, novel expression, and/or maternal/paternal effects between T. mirus and its diploid parents. These DNA regions were then studied in more detail. Subsequent cleaved amplified polymorphic sequence (CAPS) analyses of genomic DNA and cDNA revealed that 20 of the 30 genes identified through cDNA -

PAGE 144

144 AFLP analysis showed additivity, whereas nine of the 30 exhibited the loss of one parental homeolog in at least one individual. The remaining gene ( ADENINEDNA GLYCOSYLASE) showed ambiguous patterns in T. mirus because of polymorphism in the diploid parent T. dubius Most (63.6%) of the homeolog loss events were of the T. dubius parental copy. Two genes, NUCLEAR RIBOSOMAL DNA and G LYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE, showed differential expression of the parental homeologs, with the T. dubius copy silenced in some individuals of T. mirus Genomic and cDNA CAPS analyses indicated that plants of T. mirus have experienced frequent and preferential elimination, whereas comparable analyses of synthetic F1 hybrids between the diploid parents ( T. dubius T. porrifolius ) of T. mirus showed only additivity. Interestingly, similar results were reported for a second Tragopogon allopolyplo id that formed recently and repeatedly ( T. miscellus ) that also has T. dubius as one parent. Both T. mirus and T. miscellus undergo biased loss of homeologs contributed by their shared diploid parent, T. dubius Furthermore, both allotetraploids exhibit more homeolog losses than true gene silencing events. Taken together, these results suggest that in Tragopogon loss of homeologs and gene silencing are not immediate consequences of hybridization or polyploidization, but are processes that occur following polyploidization, occurring over a relatively small number of generations. These results further support the idea of polyploidy as a dynamic evolutionary process, with abundant and rapid genomic changes occurring within a short time period following polyploi dization.

PAGE 145

145 Second, I investigated whether additivity in expression patterns in T. mirus which was observed using CAPS analysis in the first study, are truly additive if studied in detail using more precise quantitative approaches. I evaluated the relative contribution of homeologs for ten genes in natural allopolyploid T. mirus its diploid parents ( T. dubius and T. porrifolius ), as well as synthetic F1 hybrids, and synthetic T. mirus (S1 and S2 generations) using qRTPCR. Since most published studies have not examined the relative contribution of each homeolog to the polyploid derivative, this work is of broad importance in.the study of allopolyploid evolution. I detected equal expression levels of each gene in the diploid parents ( T. dubius and T. porrifolius ) for all genes except a putative GIBBERELLIN RESPONSE MODULATOR which showed higher expression levels in T. dubius than in T. porrifolius Significantly, the genomic contribution of the parental genes to natural populations of T. mirus were shown to be variable. Paternally or maternally biased expression patterns were observed in all genes except EXPRESSION PROTEIN1 and GLYCERALDEHUDE3 PHOSPHATE DEHYDROGENASE. Three genes revealed an expression bias due to the unequal contribution of one parental homeolog to T. mirus while five genes showed a discrepancy between the genomic level and the transcript level in T. mirus EXPRESSION PROTEIN1 and GLYCERALDEHYDE3 PHOSPHATE DEHYDROGENASE exhibited stochastic expression patterns at the transcript level, while the genomic contribution of the parental homeologs is equal. For F1 hybrids and synthetic S1 and S2 T. mirus seven of ten genes displayed the same expression bias as observed for the natural allopolyploid T. mirus whereas three genes showed stochastic p atterns of expression. We also observed gene silencing in both the S1 and S2

PAGE 146

146 generations of all plants examined of T. mirus for FRUCTOSEBISPHOSPHATE ALDOLASE. These expression variations may be explained by dosage effects, trans acting regulation, and epi genetic regulation. Although evolution of allopolyploid which is the merger of two distinct genomes cannot be simple after hybridization and polyploidization, the genomic alterations through polyploidy can lead to the genomic disorders and expression diff erences. Recently formed allopolyploid T. mirus and T. miscellus provide that the plasticity in the regulation of duplicate genes and genomes may cause specific changes in phenotypes and biological mechanisms and speed up natural selection and environmental adaptation via managing their genomic shock or developmental changes. Third, I compared proteomes of natural allopolyploid T. mirus with those of its diploid parents ( T. dubius and T. porrifolius ). Few such studies have been conducted on polyploids and their parents (ALBERTIN et al. 2006; ALBERTIN et al. 2005; BAHRMAN and THIELLEMENT 1987; ISLAM et al. 2003a) Using iTRAQ based comparative proteomics, 6 8 differentially expressed proteins were identified between T. mirus and its diploid parents, while 4 0 8 proteins showed proteomic additivity. In addition, parental proteomic analyses indicated that only T. dubius is variable within the Pullman1 population, which is congruent with previous molecular studies, including CAPS analysis (chapter 2). Moreover, comparative proteomics revealed that 32 proteins changed their expression after hybridization (based on the study of F1 hybrids), and an additional 22 proteins were differentially expressed following genomic doubling (synthetic S1 generation). Therefore, examination of proteomic profiles of T. mirus indicated that hybridization has a larger impact on the proteome than polyploidization. Comparison of the proteomic

PAGE 147

147 results with the results of my study of transcript expression (Chapter 2) revealed that there is no good correlation between transcript and protein expression level in T. mirus This result is congruent with findings in other organisms such as Brassica Arabidopsis human, and yeast. These results suggest that post transcriptional processes might control protein expression. Further studies of gene expression based on differentially expressed proteins are needed to explore the regulatory mechanisms that underlie physiological changes or phenotypic variation in the evolution of allopolyploid Tragopogon system.

PAGE 148

148 LIST OF REFERENCES ABBOTT, R J. H E IRELAND and H J. ROGERS, 2007 Population decline despite high genetic diversity in the new allopolyploid species Senecio cambrensis (Asteraceae). Mol. Ecol. 16: 1023 1033. ABBOTT, R J. and A J LOWE, 2004 Origins, establishment and evolution of new polyploid species: Senecio cambrensis and S. eboracensis in the British Isles. Biol. J. Linn. Soc. Lond. 82: 467 474. ADAMS, K L 2007 Evolution of duplicate gene expression in polyploid and hybrid plants. J. Hered. 98: 136 141. ADAMS, K L R CRONN, R PERCIFIELD and J F WENDEL, 2003 Genes duplicated by polyploidy show unequal contributions to the transcriptome and organspecific reciprocal sile ncing. Proc. Natl. Acad. Sci. USA 100: 4649 4654. ADAMS, K L R PERCIFIELD and J F WENDEL, 2004 Organspecific silencing of duplicated genes in a newly synthesized cotton allotetraploid. Genetics 168: 2217 2226. ADAMS, K L and J F WENDEL, 2004 Ex ploring the genomic mysteries of polyploidy in cotton. Biol. J. Linn. Soc. Lond. 82: 573 581. ADAMS, K L and J F WENDEL, 2005 Polyploidy and genome evolution in plants. Curr. Opin. Plant Biol. 8: 135 141. ADKINS, J. N S M VARNUM, K J. AUBERRY, R J. MOORE, N H ANGELL et al. 2003 Toward a human blood serum proteome: analysis by multidimensional separation coupled with mass spectrometry. Mol. Cell. Proteomics 1: 947 955. AINOUCHE, M L A BAUMEL and A SALMON, 2004a Spartina anglica Schreb. a natural model system for analysing early evolutionary changes that affect allopolyploid genomes. Biol. J. Linn. Soc. Lond. 82: 475 484. AINOUCHE, M L A BAUMEL, A SALMON and G YANNIC, 2004b Hybridisation, polyploidy and speciation in Spartina Schreb. ( Poaceae). New Phytol. 161: 165 172. ALBERTIN, W T BALLIAU, P BRABANT, A M CHEVRE, F EBER et al. 2006 Numerous and rapid nonstochastic modifications of gene products in newly synthesized Brassica napus allotetraploids. Genetics 173: 1101 1113. ALBER TIN, W P BRABANT, O. CATRICE, F EBER, E JENCZEWSKI et al. 2005 Autopolyploidy in cabbage ( Brassica oleracea L.) does not alter significantly the proteomes of green tissues. Proteomics 5: 2131 2139.

PAGE 149

149 ANDERSON, L and J SEILHAMER, 1997 A comparison of selected mRNA and protein abundances in human liver. Electrophoresis 18: 533 537. ARABIDOPSIS GENOME INITIATIVE, 2000 Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796 815. ASHTON, P A and R J. ABBOTT, 1992 M ultiple origins and genetic diversity in the newly arisen allopolyploid species, Senecio cambrensis Rosser (Compositae). Heredity 68: 25 32. BACHEM, C W R S VAN DER HOEVEN, S M DE BRUIJN, D VREUGDENHIL, M. ZABEAU et al. 1996 Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development. Plant J. 9: 745 753. BAHRMAN, N and H THIELLEMENT, 1987 Parental genome expression in synthetic wheats ( Tritic um turgidum sp. x T.tauschii sp.) revealed by 2D electrophoresis of seedling proteins. Theor. Appl. Genet. 74: 246 251. BAUMEL, A M. L AINOUCHE and J E LEVASSEUR, 2001 Molecular investigations in populations of Spartina anglica C. E. Hubbard (Poaceae) invading coastal Brittany (France). Mol. Ecol. 10: 1689 1701. BENDEROTH, M S TEXTOR, A J. WINDSOR, T MITCHELLOLDS, J GERSHENZON et al. 2006 Positive selection driving diversification in plant secondary metabolism. Proc. Natl. Acad. Sci. USA 103: 9 118 9123. BENNETT, R I and A G SMITH, 1991 Use of a genomic clone for ribosomal RNA from Brassica oleracea in RFLP analysis of Brassica species. Plant Mol. Biol. 16: 685 688. BEVAN, M I BANCROFT, E BENT, K LOVE, H GOODMAN et al. 1998 Analysis of 1.9 Mb of contiguous sequence from chromosome 4 of Arabidopsis thaliana Nature 391: 485 488. BLANC, G K HOKAMP and K H WOLFE, 2003 A recent polyploidy superimposed on older largescale duplications in the Arabidopsis genome. Genome Res. 13: 137 144. BLANC, G and K H WOLFE, 2004 Functional divergence of duplicated genes formed by polyploidy during Arabidopsis evolution. Plant Cell 16: 1679 1691. BORISOVA, A G 1964 Tragopogon, pp. 115196 in Flora of USSR 29 edited by B K SHISHKIN. Academy of the USSR, Moscow and Leningrad.

PAGE 150

150 BOTTLEY, A and R M KOEBNER, 2008 Variation for homoeologous gene silencing in hexaploid wheat. Plant J. 56: 297 302. BOTTLEY, A G. M XIA and R M KOEBNER, 2006 Homoeologous gene silencing in hexaploid wheat. Plant J. 47: 897 906. BOWERS, J. E B A CHAPMAN, J RONG and A H PATERSON, 2003 Unravelling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature 422: 433 438. BREHM, B G and M OWNBEY, 1965 Variation in Chromatographic patterns in the Tragopogon dubius pratensis porrifolius complex (Compositae). Am. J. Bot. 52: 811 818. BREMER, K 1994 Asteraceae: Cladistics and classification. Timber Press, Portland. BUGGS, R J. S CHAMALA, W WU, L GAO, G D MAY et al. 2010 Characterization of duplicate gene evolution in the recent natural allopolyploid Tragopogon miscellus by next generation sequencing and Sequenom iPLEX MassARRAY genotyping. Mol. Ecol. 19 S1: 132 146. BUGGS, R J. A N DOUST, J A TATE, J KOH, K SOLT IS et al. 2009a Gene loss and silencing in Tragopogon miscellus (Asteraceae): comparison of natural and synthetic allotetraploids. Heredity 103: 73 81. BUGGS, R J. A A N DOUST, J A TATE, J KOH, K SOLTIS et al. 2009b Gene loss and silencing in Tr agopogon miscellus (Asteraceae): comparison of natural and synthetic allotetraploids. Heredity 103: 73 81. BUGGS, R J. A N ELLIOT, L ZHANG, J KOH, L F VICCINI et al. 2009c Tissue specific silencing of homeologs in natural populations of the recent allopolyploid Tragopogon mirus Heredity 103: 73 81. CHAUDHARY, B L FLAGEL, R M STUPAR, J A UDALL, N VERMA et al. 2009 Reciprocal silencing, transcriptional bias and functional divergence of homeologs in polyploid cotton (gossypium). Genetics 182: 503 517. CHAUDHARY, B R HOVAV, R RAPP, N VERMA, J A UDALL et al. 2008 Global analysis of gene expression in cotton fibers from wild and domesticated Gossypium barbadense. Evol. Dev. 10: 567 582. CHELAIFA, H A MONNIER and M AINOUCHE, 2010 Transcriptomic changes following recent natural hybridization and allopolyploidy in the salt marsh species Spartina x townsendii and Spartina anglica (Poaceae). New Phytol 186: 161 174.

PAGE 151

151 CHEN, S and A C HARMON, 2006 Advances in plant proteomics. Proteomics 6: 5504 5516. CHEN, Z J. 2007 Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. Annu. Rev. Plant. Biol. 58: 377 406. CHEN, Z J. and Z. F NI, 2006 Mechanisms of genomic rearrangements and gene expression changes in plant polyploids. Bioessays 28: 240 252. CHEN, Z J. and C S PIKAARD, 1997 Epigenetic silencing of RNA polymerase I transcription: a role for DNA methylation and histone modification in nucleolar dominance. Genes Dev. 11: 2124 2136. CLUSTER, P D O. CALDERINI, F PUPILLI, F CREA and F. E. A. DAMIANI, 1996 The fate of ribosomal genes in three interspecific somatic hybrids of Medicago sativa : three different outcomes including the rapid amplification of new spacer length variants. Theor. Appl. Genet. 93: 801 808. COMAI, L 2000 Genetic and epigenetic interactions in allopolyploid plants. Plant Mol. Biol. 43: 387 399. COMAI, L A P TYAGI, K WINTER, R HOLMESDAVIS, S H REYNOLDS et al. 2000 Phenotypic instability and rapid gene silenci ng in newly formed Arabidopsis allotetraploids. Plant Cell 12: 1551 1568. COOK, L M P S SOLTIS, S J. BRUNSFELD and D E SOLTIS, 1998 Multiple independent formations of Tragopogon tetraploids (Asteraceae): evidence from RAPD markers. Mol. Ecol. 7: 10. CUI, L P K WALL, J H LEEBENSMACK, B G LINDSAY, D E SOLTIS et al. 2006 Widespread genome duplications throughout the history of flowering plants. Genome Res. 16: 738 749. DES MARAIS, D L and M D RAUSHER, 2008 Escape from adaptive conflict after duplication in an anthocyanin pathway gene. Nature 454: 762 765. DOYLE, J. J. and J L DOYLE, 1987 A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11 15. DREA, S C N T LAO, K H WOLFE and T. A KAVANAGH, 2006 Gene duplication, exon gain and neofunctionalization of OEP16related genes in land plants. Plant J. 46: 723 735. FELDMAN, M B LIU, G. SEGAL, S ABBO, A A LEVY et al. 1997 Rapid elimination of low copy DNA sequences in polyploid wheat : a possible mechanism for differentiation of homoeologous chromosomes. Genetics 147: 1381 1387.

PAGE 152

152 FLAGEL, L E and J F WENDEL, 2009 Evolutionary rate variation, genomic dominance and duplicate gene expression evolution during allotetraploid cotton speciation. New Phytol. 186: 184 193. FLIPSE, E C J. A M KEETELS, E JACOBSEN and R G F VISSER, 1996 The dosage effect of the wildtype GBSS allele is linear for GBSS activity but not for amylose content: absence of amylose has a distinct influence on the physico chemical properties of starch. Theor. Appl. Genet. 92: 121 127. FORCE, A W A CRESKO, F B PICKETT, S R PROULX, C AMEMIYA et al. 2005 The origin of subfunctions and modular gene regulation. Genetics 170: 433 446. FORCE, A M. LYNCH, F B PICKETT, A AMORES, Y L YAN et al. 1999 Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151: 1531 1545. FORTUNE, P M K A SCHIERENBECK, A K AINOUCHE, J JACQUEMIN, J F WENDEL et al. 2007 Evolutionary dynamic s of Waxy and the origin of hexaploid Spartina species (Poaceae). Mol. Phylogenet. Evol. 43: 1040 1055. GAETA, R T J C PIRES, F INIGUEZLUY, E LEON and T. C OSBORN, 2007 Genomic changes in resynthesized Brassica napus and their effect on gene expression and phenotype. Plant Cell 19: 3403 3417. GOLDBLATT, P 1980 Polyploidy in angiosperms: Monocotyledons, pp. 219239 in Polyploidy biological relevance, edited by W H LEWIS. Plenum Press, New York. GRANT, V 1981 Plant speciation. University press, Columbia. GUGGISBERG, A C BAROUX, U GROSSNIKLAUS and E CONTI, 2008 Genomic origin and organization of the allopolyploid Primula egaliksensis investigated by in situ hybridization. Ann Bot (Lond) 101: 919 927. GYGI, S P Y ROCHON, B R FRANZA and R AEBERSOLD, 1999 Correlation between protein and mRNA abundance in yeast. Mol. Cell. Biol. 19: 1720 1730. HAJDUCH, M A GANAPATHY, J W STEIN and J J. THELEN, 2005 A systematic proteomic study of seed filling in soybean. Establishment of highresolut ion two dimensional reference maps, expression profiles, and an interactive proteome database. Plant Physiol. 137: 1397 1419. HAYNES, P A S P GYGI, D FIGEYS and R AEBERSOLD, 1998 Proteome analysis: biological assay or data archive? Electrophoresis 1 9: 1862 1871. HE, P B R FRIEBE, B S GILL and J M ZHOU, 2003 Allopolyploidy alters gene expression in the highly stable hexaploid wheat. Plant Mol. Biol. 52: 401 414.

PAGE 153

153 HE, X and J ZHANG, 2005 Rapid subfunctionalization accompanied by prolonged and substantial neofunctionalization in duplicate gene evolution. Genetics 169: 1157 1164. HEGARTY, M J. G. L BARKER, A C BRENNAN, K J. EDWARDS, R J. ABBOTT et al. 2008 Changes to gene expression associated with hybrid speciation in plants: further in sights from transcriptomic studies in Senecio. Phil. Trans. R. Soc. B. 363: 3055 3069. HEGARTY, M J. G. L BARKER, I. D WILSON, R J. ABBOTT, K J EDWARDS et al. 2006 Transcriptome shock after interspecific hybridization in senecio is ameliorated by g enome duplication. Curr. Biol. 16: 1652 1659. HEGARTY, M J. and S J. HISCOCK, 2008 Genomic clues to the evolutionary success of polyploid plants. Curr. Biol. 18: R435 444. HEGARTY, M J. J M JONES, I. D WILSON, G. L BARKER, J A COGHILL et al. 2005 Development of anonymous cDNA microarrays to study changes to the Senecio floral transcriptome during hybrid speciation. Mol. Ecol. 14: 2493 2510. HOVAV, R B CHAUDHARY, J A UDALL, L FLAGEL and J F WENDEL, 2008a Parallel domestication, convergent evolution and duplicated gene recruitment in allopolyploid cotton. Genetics 179: 1725 1733. HOVAV, R J A UDALL, B CHAUDHARY, E HOVAV, L FLAGEL et al. 2008b The evolution of spinnable cotton fiber entailed prolonged development and a novel metaboli sm. PLoS Genet. 4: e25. HOVAV, R J A UDALL, B CHAUDHARY, R RAPP, L FLAGEL et al. 2008c Partitioned expression of duplicated genes during development and evolution of a single cell in a polyploid plant. Proc. Natl. Acad. Sci. USA 105: 6191 6195. HOV AV, R J A UDALL, E HOVAV, R RAPP, L FLAGEL et al. 2008d A majority of cotton genes are expressed in singlecelled fiber. Planta 227: 319 329. HUANG, S R LI, Z ZHANG, L LI, X GU et al. 2009 The genome of the cucumber, Cucumis sativus L. Nat. Genet. 41: 1275 1281. HUBBARD, J C E 1965 Spartina marshes in southern England. VI. Pattern of invasion in Poole Harbour. J. Ecol. 53: 799 813. HUBBARD, J C E B H GRIMES and C J. MARCHANT, 1978 Some observations on the ecology and taxonomy of Sp artina neyrautii and Spartina alterniflora growing in France and Spain and comparison with Spartina townsendii and Spartina anglica Documents Phytosociologiques 2: 273 282.

PAGE 154

154 HUSKINS, C L 1930 The origin of Spartina X townsendii Genetica 12: 531 538. IN TERNATIONAL RICE GENOME SEQUENCING PROJECT, 2005 The mapbased sequence of the rice genome. Nature 436: 793 800. ISLAM, N H TSUJIMOTO and H HIRANO, 2003a Proteome analysis of diploid, tetraploid and hexaploid wheat: towards understanding genome interac tion in protein expression. Proteomics 3: 549 557. ISLAM, N H TSUJIMOTO and H HIRANO, 2003b Wheat proteomics: relationship between fine chromosome deletion and protein expression. Proteomics 3: 307 316. JAILLON, O J M AURY, B NOEL, A POLICRITI, C CLEPET et al. 2007 The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449: 463 467. KASHKUSH, K M FELDMAN and A A LEVY, 2002 Gene loss, silencing and activation in a newly synthesized wheat allotetraploid. Genetics 160: 1651 1659. KASHKUSH, K M FELDMAN and A A LEVY, 2003 Transcriptional activation of retrotransposons alters the expression of adjacent genes in wheat. Nat. Genet. 33: 102 106. KELLIS, M B W BIRREN and E S LANDER, 2004 Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617 624. KERSTEN, B L BURKLE, E J. KUHN, P GIAVALISCO, Z KONTHUR et al. 2002 Largescale plant proteomics. Plant Mol. Biol. 48: 133 141. KIM, S M YOO, V A ALBERT, J S FARRIS, P S SOLTIS et al. 2004 Phylogeny and diversification of B function MADSbox genes in angiosperms: evolutionary and functional implications of a 260million year old duplication. Am. J. Bot. 91: 2102 2118. KIRSCHNER, M and J GERHART, 1998 Evolvability. Proc Natl Acad Sci U S A 95: 8420 8427. KOH, J. P S SOLTIS and D E SOLTIS, 2010 Homeolog loss and expression changes in natural populations of the recently and repeatedly formed allotetraploid Tragopogon mirus ( Asteraceae). BMC Genomics 11: 97. KOH, J. M J. YOO, J M DAVIS, P S SOLTIS and D E SOLTIS, in prep. Unequal expression of duplicated genes in recently formed allopolyploid, Tragopogon mirus (Asteraceae).

PAGE 155

155 KONIECZNY, A and F. M AUSUBEL, 1993 A proc edure for mapping Arabidopsis mutations using co dominant ecotypespecific PCRbased markers. Plant J. 4: 403 410. KOVARIK, A J C PIRES, A R LEITCH, K Y LIM, A M SHERWOOD et al. 2005 Rapid concerted evolution of nuclear ribosomal DNA in two Tragopogon allopolyploids of recent and recurrent origin. Genetics 169: 931 944. KROSCHEWSKY, J. R T R MABRY, K R MARKHAM and R E ALSTON, 1969 Flavonoids from the genus Tragopogon (Compositae). Phytochemistry 8: 1495 1498. KU, H M T VISION, J LIU and S D TANKSLEY, 2000 Comparing sequenced segments of the tomato and Arabidopsis genomes: largescale duplication followed by selective gene loss creates a network of synteny. Proc. Natl. Acad. Sci. USA 97: 9121 9126. LANDRY, C R D L HARTL and J M RANZ, 2007 Genome clashes in hybrids: insights from gene expression. Heredity 99: 483 493. LAWRENCE, R J. K EARLEY, O. PONTES, M. SILVA, Z J. CHEN et al. 2004 A concerted DNA methylation/histone methylation switch regulates rRNA gene dosage control and nucleolar dominance. Mol. Cell 13: 599 609. LEE, H S and Z. J. CHEN, 2001 Proteincoding genes are epigenetically regulated in Arabidopsis polyploids. Proc. Natl. Acad. Sci. USA 98: 6753 6758. LEEBENSMACK, J. H P K WALL, J DUARTE, Z ZHENG, D OPPENHEIMER et al. 2006 A genomics approach to the study of ancient polyploidy and floral developmental genetics Elsevier, San Diego. LEVY, A and M FELDMAN, 2004 Genetic and epigenetic reprogramming of the wheat genome upon allopolyploidization. Biol J. Linn. Soc. Lond. 82: 607 613. LIM, K Y D E SOLTIS, P S SOLTIS, J TATE, R MATYEK et al. 2008a Rapid chromosome evolution in recently formed polyploids in Tragopogon (Asteraceae). PLoS ONE 3: e3353. LIM, K Y D E SOLTIS, P S SOLTIS, J TATE, R MATYASEK et al. 2008b Rapid chromosome evolution in recently formed polyploids in Tragopogon (Asteraceae). PLoS One 3: e3353. LIM, K Y K SOUCKOVASKALICKA, V SARASAN, J J. CLARKSON and C M W E. AL. 2006 A genetic appraisal of a new syn thetic Nicotiana tabacum (Solanaceae) and the Kostoff synthetic tobacco. Am. J. Bot. 93: 875 883.

PAGE 156

156 LIN, L S T D HO and J R HARLAN, 1985 Rapid amplification and fixation of new restriction sites in the ribosomal DNA repeats in the derivatives of a cross between maize and Tripsacum dactyloides Devel. Genetics 6: 101 112. LIU, B C L BRUBAKER, G. MERGEAI, C R C and J F WENDEL, 2001 Polyploid formation in cotton is not accompanied by rapid genomic changes. Genome 44: 321 330. LIU, B SEGAL G, VE GA JM, FELDMAN M and A S 1997 Isolation and characterization of chromosomespecific DNA sequences from a chromosome arm genomic library of common wheat. Plant J. 11: 959 965. LIU, B J M VEGA, G. SEGAL, S ABBO, H RODOVA et al. 1998 Rapid genomic c hanges in newly synthesized amphiploids of Triticum and Aegilops I. Changes in low copy noncoding DNA sequences. Genome 41: 272 277. LUKENS, L P QUIJADA, J UDALL, J C PIRES, S M E et al. 2004 Genome redundancy and plasticity within ancient and r ecent Brassica crop species. Biol. J. Linn. Soc. Lond. 82: 665 674. LUKENS, L N J C PIRES, E LEON, R VOGELZANG, L OSLACH et al. 2006 Patterns of sequence loss and cytosine methylation within a population of newly resynthesized Brassica napus allopolyploids. Plant Physiol. 140: 336 348. LYNCH, M and J S CONERY, 2000 The evolutionary fate and consequences of duplicate genes. Science 290: 1151 1155. LYNCH, M and A FORCE, 2000 The probability of duplicate gene preservation by subfunctionalization. Genetics 154: 459 473. LYNCH, M M. O HELY, B WALSH and A FORCE, 2001 The probability of preservation of a newly arisen gene duplicate. Genetics 159: 1789 1804. MADLUNG, A R W MASUELLI, B WATSON, S H REYNOLDS, J DAVISON et al. 2002 Remodelin g of DNA methylation and phenotypic and transcriptional changes in synthetic Arabidopsis allotetraploids. Plant Physiol. 129: 733 746. MADLUNG, A A P TYAGI, B WATSON, H JIANG, T KAGOCHI et al. 2005 Genomic changes in synthetic Arabidopsis polyploid s. Plant J. 41: 221 230. MARCHANT, C J. 1967 Evolution in Spartina (Gramineae). I. History and morphology of the genus in Britain. Bot. J. Linn. Soc. 60: 1 24. MARCHANT, C J. 1968 Evolution in Spartina (Gramineae). II. Chromosomes, basic relationships and the problems of S. x townsendii agg. Bot. J. Linn. Soc. 60: 381 409.

PAGE 157

157 MARMAGNE, A P BRABANT, H THIELLEMENT and K ALIX, 2010 Analysis of gene expression in resynthesized Brassica napus allotetraploids: transcriptional changes do not explain different ial protein regulation. New Phytol. 186: 216 227. MASTERSON, J. 1994 Stomatal size in fossil plants: evidence for polyploidy in majority of angiosperms. Science 264: 421 423. MATYEK, R J A TATE, Y K LIM, H SRUBAROVA, J KOH et al. 2007 Concerted evolution of rDNA in recently formed Tragopogon allotetraploids is typically associated with an inverse correlation between gene copy number and expression. Genetics 176: 2509 2519. MAVRODIEV, E P S SOLTIS, R M BALDINI, M. A GITZENDANNER and D E SOLTIS, 2007 Phylogeny of Tragopogon porrifolius L. (Asteraceae), a European native with intercontinental disjuncts. Int. J. Plant Sci. 168: 889 904. MCCLINTOCK, B 1984 The significance of responses of the genome to challenge. Science 226: 792 801. MING, R S HOU, Y FENG, Q. YU, A DIONNELAPORTE et al. 2008 The draft genome of the transgenic tropical fruit tree papaya (Carica papaya Linnaeus). Nature 452: 991 996. MURAMATSU, M 1963 Dosage Effect of the Spelta Gene Q of Hexaploid Wheat. Genetics 48: 469 482. NGELE, E M VOLLMER, P HORTH and C VAD, 2004 2D LC/MS techniques for the identification of proteins in highly complex mixtures. Expert. Rev. Proteomics 1: 37 46. NOVAK, S J D E SOLTIS and P S SOLTIS, 1991 Ownbey's Tragopogons: 40 year s later. Am. J. Bot. 78: 1586 1600. O KANE, S L B A SCHAAL and I A ALSHEHBAZ, 1996 The origins of Arabidopsis suecica as indicated by nuclear rDNA sequences. Syst. Bot. 21: 559 566. OHNO, S 1970 Evolution by Gene Duplication. Springer Verlag, Ber lin/Heidelberg, Germany/New York. OSBORN, T C 2004 The contribution of polyploidy to variation in Brassica species. Physiol. Plantarum 121: 531 536. OSBORN, T C J C PIRES, J A BIRCHLER, D L AUGER, Z J. CHEN et al. 2003 Understanding mechanism s of novel gene expression in polyploids. Trends Genet. 19: 141 147.

PAGE 158

158 OTTO, S P and J WHITTON, 2000 Polyploid incidence and evolution. Annu. Rev. Genet. 34: 401 437. OW, S Y M. SALIM, J NOIREL, C EVANS, I. REHMAN et al. 2009 iTRAQ underestimation in simple and complex mixtures: "the good, the bad and the ugly". J. Proteome Res. 8: 5347 5355. OWNBEY, M 1950 Natural hybridization and amphiploidy in the genus Tragopogon. Am. J. Bot. 37: 407 486. OWNBEY, M and G D MCCOLLUM, 1953 Cytoplasmic inher itance and reciprocal amphiploidy in Tragopogon. Am. J. Bot. 40: 788 796. OWNBEY, M and G D MCCOLLUM, 1954 The chromosomes of Tragopogon. Rodora 56: 7 21. OZKAN, H A A LEVY and M FELDMAN, 2001 Allopolyploidy induced rapid genome evolution in the w heat ( Aegilops Triticum ) group. Plant Cell 13: 1735 1747. PANG, Q S CHEN, S DAI, Y CHEN, Y WANG et al. 2010 Comparative proteomics of salt tolerance in Arabidopsis thaliana and Thellungiella halophila. J. Proteome Res. 9: 2584 2599. PATERSON, A H J. E BOWERS, R BRUGGMANN, I. DUBCHAK, J GRIMWOOD et al. 2009 The Sorghum bicolor genome and the diversification of grasses. Nature 457: 551 556. PATERSON, A H J E BOWERS and B A CHAPMAN, 2004 Ancient polyploidization predating divergence of the cereals, and its consequences for comparative genomics. Proc. Natl. Acad. Sci. USA 101: 9903 9908. PATHAN, A A K UMA DEVI, H VOGEL and A REINEKE, 2007 Analysis of differential gene expression in the generalist entomopathogenic fungus Beauveria bassi ana (Bals.) Vuillemin grown on different insect cuticular extracts and synthetic medium through cDNA AFLPs. Fungal Genet. Biol. 44: 1231 1241. PENG, J. J E ELIAS, C C THOREEN, L J. LICKLIDER and S P GYGI, 2003 Evaluation of multidimensional chromat ography coupled with tandem mass spectrometry (LC/LC MS/MS) for large scale protein analysis: the yeast proteome. J. Proteome Res. 2: 43 50. PIRES, J. C K Y LIM, A KOVARIK, R MATYASEK, A. BOYD et al. 2004a Molecular cytogenetic analysis of recently evolved Tragopogon allopolyploids reveal a kayotype that is additive of the diploid progenitors. Am. J. Bot. 91: 1022 1035.

PAGE 159

159 PIRES, J. C J W ZHAO, M E SCHRANZ, E J LEON, P A QUIJADA et al. 2004b Flowering time divergence and genomic rearrangement s in resynthesized Brassica polyploids (Brassicaceae). Biol. J. Linn. Soc. Lond. 82: 675 688. PONTES, O N NEVES, M SILVA, M. S LEWIS, A MADLUNG et al. 2004 Chromosomal locus rearrangements are a rapid response to formation of the allotetraploid Arab idopsis suecica genome. Proc. Natl. Acad. Sci. USA 101: 18240 18245. PONTES, O N NEVES, M SILVA, M. S LEWIS, A MADLUNG et al. 2007 Chromosomal locus rearrangements are a rapid response to formation of the allotetraploid Arabidopsis suecica genome. P roc. Natl. Acad. Sci. USA 101: 18240 18245. PREUSS, S and C S PIKAARD, 2007 rRNA gene silencing and nucleolar dominance: insights into a chromosomescale epigenetic on/off switch. Biochim. Biophys. Acta 1769: 383 392. PRINCE, V E and F. B PICKETT, 2002 Splitting pairs: the diverging fates of duplicated genes. Nat. Rev. Genet. 3: 827 837. PUMPHREY, M J BAI, D LAUDENCIACHINGCUANCO, O. ANDERSON and B S GILL, 2009 Nonadditive expression of homoeologous genes is established upon polyploidization i n hexaploid wheat. Genetics 181: 1147 1157. RAPP, R A J A UDALL and J F WENDEL, 2009 Genomic expression dominance in allopolyploids. BMC Biol. 7: 18. RAUSCHER, J. T J J. DOYLE and A H BROWN, 2002 Internal transcribed spacer repeat specific prim ers and the analysis of hybridization in the Glycine tomentella (Leguminosae) polyploid complex. Mol. Ecol. 11: 2691 2702. RAUSCHER, J. T J J. DOYLE and A H BROWN, 2004 Multiple origins and nrDNA internal transcribed spacer homeologue evolution in the Glycine tomentella (Leguminosae) allopolyploid complex. Genetics 166: 987 998. RAYBOULD, A F A J GRAY and D D HORNBY, 2000 Evolution and current status of the salt marshes grass, Spartina anglica in the Solent, pp. 299 302 in Solent science a rev iew, edited by M COLLINS and K ANSELL. Elsevier Science, Amsterdam. RAYBOULD, A F A J GRAY, M. J. LAWRENCE and D F MARSHALL, 1991 The evolution of Spartina anglica C. E. Hubbard (Gramineae): origin and genetic variability. Biol. J. Linn. Soc. Lond. 43: 111 126. REINEKE, A and S LOBMANN, 2005 Gene expression changes in Ephestia kuehniella caterpillars after parasitization by the endoparasitic wasp Venturia canescens analyzed through cDNA AFLPs. J. Insect Physiol. 51: 923 932.

PAGE 160

160 ROOSE, M L and L. D GOTTLIEB, 1976 Genetic and biochemical consequences of polyploiy in Tragopogon. Evolution 30: 818 830. ROSS, P L Y N HUANG, J N MARCHESE, B WILLIAMSON, K PARKER et al. 2004 Multiplexed protein quantitation in Saccharomyces cerevisiae using am ine reactive isobaric tagging reagents. Mol. Cell. Proteomics 3: 1154 1169. ROSSER, E M 1955 A new British species of Senecio. Watsonia 3: 228 232. SALMON, A M L AINOUCHE and J F WENDEL, 2005 Genetic and epigenetic consequences of recent hybridiza tion and polyploidy in Spartina (Poaceae). Mol. Ecol. 14: 1163 1175. SAMBROOK, J. and D W RUSSELL, 2001 Molecular cloning : a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. SCANNELL, D R K P BYRNE, J L GORDON, S WONG and K H WOLFE, 2006 Multiple rounds of speciation associated with reciprocal gene loss in polyploid yeasts. Nature 440: 341 345. SCHMUTZ, J. S B CANNON, J SCHLUETER, J MA, T MITROS et al. 2010 Genome sequence of the palaeopolyploid soybean. Natur e 463: 178 183. SCHRANZ, M E P QUIJADA, S B SUNG, L LUKENS, R AMASINO et al. 2002 Characterization and effects of the replicated flowering time gene FLC in Brassica rapa. Genetics 162: 1457 1468. SENCHINA, D S I ALVAREZ, R C C CRONN, B LIU, J RONG et al. 2003 Rate variation among nuclear genes and the age of polyploidy in Gossypium Mol. Biol. Evol. 20: 633 643. SHAKED, H K KASHKUSH, H OZKAN, M. FELDMAN and A A LEVY, 2001 Sequence elimination and cytosine methylation are rapid and r eproducible responses of the genome to wide hybridization and allopolyploidy in wheat. Plant Cell 13: 1749 1759. SHILOV, I V S L SEYMOUR, A A PATEL, A LOBODA, W H TANG et al. 2007 The Paragon Algorithm, a next generation search engine that uses sequence temperature values and feature probabilities to identify peptides from tandem mass spectra. Mol. Cell. Proteomics 6: 1638 1655. SIMILLION, C K VANDEPOELE, M. C VAN MONTAGU, M. ZABEAU and Y VAN DE PEER, 2002 The hidden duplication past of Arab idopsis thaliana Proc. Natl. Acad. Sci. USA 99: 13627 13632.

PAGE 161

161 SKALICKA, K K Y LIM, R MATYEK, B KOUKALOVA, A LEITCH et al. 2003 Rapid evolution of parental rDNA in a synthetic tobacco allotetraploid line. Am. J. Bot. 90: 988 996. SKALICKA, K K Y LIM, R MATYEK, M. MATZKE, A R LEITCH et al. 2005 Preferential elimination of repeated DNA sequences from the paternal, Nicotiana tomentosiformis genome donor of a synthetic, allotetraploid tobacco. New Phytol. 166: 291 303. SOLTIS, D E V A AL BERT, J LEEBENSMACK, C D BELL, A H PATERSON et al. 2009 Polyploidy and angiosperm diversification. Am. J. Bot. 96: 336 348. SOLTIS, D E and P S SOLTIS, 1989 Allopolyploid speciation in Tragopogon: Insights from chloroplast DNA. Am. J. Bot. 76: 1119 1124. SOLTIS, D E and P S SOLTIS, 1995 The dynamic nature of polyploid genomes. Proc. Natl. Acad. Sci. USA 92: 8089 8091. SOLTIS, D E and P S SOLTIS, 1999 Polyploidy: recurrent formation and genome evolution. Trends Ecol. Evol. 14: 348 352. SOLTIS, D E P S SOLTIS, J C PIRES, A KOVARIK, J A TATE et al. 2004 Recent and recurrent polyploidy in Tragopogon (Asteraceae): cytogentic, genomic and genetic comparisons. Biol. J. Linn. Soc. Lond. 82: 485 501 SOLTIS, D E P S SOLTIS and J A TATE, 2003 Advances in the study of polyploidy since plant speciation. New Phytol. 161: 173 191. SOLTIS, P S G M PLUNKETT, S J. NOVAK and D E SOLTIS, 1995 Genetic variation in Tragopogon species: additional origins of the allotetraploids T. mir us and T. miscellus (Compositae). Am. J. Bot. 82: 1329 1341. SOLTIS, P S and D E SOLTIS, 1991 Multiple origins of the allotetraploid Tragopogon mirus (Compositae): rDNA evidence. Syst. Bot. 16: 407 413. SOLTIS, P S and D E SOLTIS, 2000 The role of genetic and genomic attributes in the success of polyploids. Proc. Natl. Acad. Sci. USA 97: 7051 7057. SONG, K P LU, K TANG and T. C OSBORN, 1995 Rapid genome change in synthetic polyploids of Brassica and its implications for polyploid evolution. P roc. Natl. Acad. Sci. USA 92: 7719 7723. STEBBINS, G L 1950 Variation and evolution in plants Columbia University Press., New York.

PAGE 162

162 STERCK, L S ROMBAUTS, K VANDEPOELE, P ROUZE and Y VAN DE PEER, 2007 How many genes are there in plants (... and why are they there)? Curr. Opin. Plant. Biol. 10: 199 203. STUPAR, R M and N M SPRINGER, 2006 Cis transcriptional variation in maize inbred lines B73 and Mo17 leads to additive expression patterns in the F1 hybrid. Genetics 173: 2199 2210. SWANSONWAGNE R, R A Y JIA, R DECOOK, L A BORSUK, D NETTLETON et al. 2006 All possible modes of gene action are observed in a global comparison of gene expression in a maize F1 hybrid and its inbred parents. Proc. Natl. Acad. Sci. USA 103: 6805 6810. SYMONDS, V V P S SOLTIS and D E SOLTIS, 2010 Dynamics of polyploid formation in Tragopogon (Asteraceae): recurrent formation, gene flow, and population structure. Evolution: doi:10.1111/j.15585646.2010.00978.x. TARZE, A A DENIAUD, M LE BRAS, E MAILLIER, D MOLLE et al. 2007 GAPDH, a novel regulator of the proapoptotic mitochondrial membrane permeabilization. Oncogene 26: 2606 2620. TATE, J. A P JOSHI, K A SOLTIS, P S SOLTIS and D E SOLTIS, 2009a On the road to diploidization? Homoeolog loss i n independently formed populations of the allopolyploid Tragopogon miscellus (Asteraceae). BMC Plant Biol. 9: 80. TATE, J. A Z NI, A C SCHEEN, J KOH, C A GILBERT et al. 2006 Evolution and expression of homeologous loci in Tragopogon miscellus (Ast eraceae), a recent and reciprocally formed allopolyploid. Genetics 173: 1599 1611. TATE, J. A V V SYMONDS, A N DOUST, R J. A BUGGS, E MAVRODIEV et al. 2009b Synthetic polyploids of Tragopogon miscellus and T. mirus (Asteraceae): 60 years after Ow nbey's discovery. Am. J. Bot. 96: 979 988. TESHIMA, K M and H INNAN, 2008 Neofunctionalization of duplicated genes under the pressure of gene conversion. Genetics 178: 1385 1398. THE ARABIDOPSIS GENOME INITIATIVE, 2000 Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796 815. THONGBOONKERD, V K R MCLEISH, J M ARTHUR and J B KLEIN, 2002 Proteomic analysis of normal human urinary proteins isolated by acetone precipitation or ultracentrifugation. Kidney Int. 62: 1461 1469. TIROSH, I and N BARKAI, 2007 Comparative analysis indicates regulatory neofunctionalization of yeast duplicates. Genome Biol. 8: R50.

PAGE 163

163 T, V B V DESAI, R A EIGENHEER, T YIN, E V AMARGO et al. 2009 Detection of Differential ly Expressed Basal Cell Proteins by Mass Spectrometry. Mol. Cell. Proteomics 9: 351 361. TUSKAN, G A S DIFAZIO, S JANSSON, J BOHLMANN, I. GRIGORIEV et al. 2006 The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313: 1596 1604. URBANSKA, K M H HURKA, E LANDOLT, B NEUFFER and K MUMMENHOFF, 1997 Hybridization and evolution in Cardamine (Brassicaceae) at Urnerboden, Central Switzerland: biosystematic and molecular evidence. Plant Syst. Evol. 204: 233 256. VAN DAMME, E J. R CULERRIER, A BARRE, R ALVAREZ, P ROUGE et al. 2007 A novel family of lectins evolutionarily related to class V chitinases: an example of neofunctionalization in legumes. Plant Physiol. 144: 662 672. VELASCO, R A ZHARKIKH, M. TROGGIO, D A CARTW RIGHT, A CESTARO et al. 2007 A high quality draft consensus sequence of the genome of a heterozygous grapevine variety. PLoS One 2: e1326. VISION, T J D G BROWN and S D TANKSLEY, 2000 The origins of genomic duplications in Arabidopsis Science 290: 2114 2117. WANG, J. J J. LEE, L TIAN, H S LEE, M. CHEN et al. 2005 Methods for genomewide analysis of gene expression changes in polyploids. Methods Enzymol. 395: 570 596. WANG, J. L TIAN, H S LEE and Z J. CHEN, 2006a Nonadditive regulation of FRI and FLC loci mediates floweringtime variation in Arabidopsis allopolyploids. Genetics 173: 965 974. WANG, J. L TIAN, H S LEE, N E WEI, H JIANG et al. 2006b Genomewide nonadditive gene regulation in Arabidopsis allotetraploids. Genetics 172: 507 517. WANG, J. L TIAN, A MADLUNG, H S LEE, M. CHEN et al. 2004 Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids. Genetics 167: 1961 1973. WAYNE, M L Y J PAN, S V NUZHDIN and L. M MCINTYRE, 2004 Additivity and trans acting effects on gene expression in male Drosophila simulans Genetics 168: 1413 1420. WEI, F E COE, W NELSON, A K BHARTI, F ENGLER et al. 2007 Physical and genetic structure of the maize genome reflects its complex evolutionary history. PLoS Genet. 3: e123.

PAGE 164

164 WENDEL, J. and J DOYLE, 2005 Polyploidy and evolution in plants, pp. 97117 in Plant diversity and evolution: genotypic and pheontypic variation in higher plants edited by R J. HENRY. CABI, Oxfordshire. WENDEL, J. F 2000 Genome evol ution in polyploids. Plant Mol. Biol. 42: 225 249. YVERT, G R B BREM, J WHITTLE, J M AKEY, E FOSS et al. 2003 Trans acting regulatory variation in Saccharomyces cerevisiae and the role of transcription factors. Nat. Genet. 35: 57 64. ZHANG, J. 2003 Evolution by gene duplication: an update. Trends Ecol. Evol. 18: 292 298. ZHANG, L T J. VISION and B S GAUT, 2002 Patterns of nucleotide substitution among simultaneously duplicated gene pairs in Arabidopsis thaliana. Mol. Biol. Evol. 19: 1464 1473 ZHAO, X P Y SI, R E HANSON, C F CRANE, P H J. et al. 1998 Dispersed repetitive DNA has spread to new genomes since polyploid formation in cotton. Genome Res. 8: 479 492. ZHU, M S DAI, S MCCLUNG, X YAN and S CHEN, 2009 Functional differentiation of Brassica napus guard cells and mesophyll cells revealed by comparative proteomics. Mol. Cell. Proteomics 8: 752 766.

PAGE 165

165 BIOGRAPHICAL SKETCH Jin Koh received his b achelor of Science degree in b iology from the University of H allym, in Feburary 2000. His Bach e lor s thesis focused on the flora of Mt. Myoungsung and Mt. Sobak. He began his graduate career in Department of Biological Sciences at Seoul National University and received his Master of Science in Feburary 2003. His m aster s thesis focused on the p hylogenetic analysis of the genus Fallopia (Polygonaceae). He started his doctoral work with Doug and Pam Soltis at the University of Florida in Gainesville, where he studied polyploidy evolution with the Tragopogon system.