<%BANNER%>

Differential Ethylene Sensitivity during Abscission and Degreening in Citrus

Permanent Link: http://ufdc.ufl.edu/UFE0042069/00001

Material Information

Title: Differential Ethylene Sensitivity during Abscission and Degreening in Citrus
Physical Description: 1 online resource (158 p.)
Language: english
Creator: John-Karuppiah, Karthik-Joseph
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: 1mcp, abscission, citrus, degreening, diurnal, ethylene
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Ethylene is a gaseous plant hormone that regulates many processes in plant growth and development. Knowledge of ethylene biosynthesis, perception and signal transduction has helped to better understand plants response to ethylene. Response to ethylene was affected by several factors such as cultivar, plant organ and stage of development. In this research, differential response to exogenous ethylene in citrus during abscission and degreening were explored. Expression of genes involved in ethylene biosynthesis and signaling pathways were analyzed to determine if transcriptional changes were correlated with differential ethylene response. Partial or full-length nucleotide sequences were obtained for Valencia , Fallglo and Lee x Orlando homologs of biosynthetic genes CsACS1, CsACS2 and CsACO, receptor genes CsERS1, CsETR1, CsETR2 and CsETR3, and signaling genes CsCTR1, CsEIN2, CsEIL1 and CsEIL2. When applying abscission agents to tree fruit to facilitate harvest, it is desirable to loosen fruit and not leaves or other organs, but mechanisms controlling leaf and fruit drop are not fully understood. Differential abscission response in leaf and fruit tissues was observed when Valencia orange was treated with ethephon abscission agent (ethylene releasing agent) alone or in combination with 1-methylcyclopropene (1-MCP; ethylene perception inhibitor). When 1-MCP was combined with ethephon application, leaf abscission was greatly reduced whereas fruit loosening was little affected. Diurnal fluctuation in ethylene biosynthetic and signaling gene expression levels were studied in Valencia . Expression of genes fluctuated diurnally in at least one of the tissues tested (leaf blade, leaf abscission zone, fruit peel and fruit abscission zone). Changes in natural fluctuations were correlated with changes in sensitivity of mature fruit and leaves to abscission agent ethephon. Abscission agent was most effective when applied at 2 pm when expression levels of biosynthetic genes were actively increasing. Apart from differential abscission response, two citrus types Fallglo and Lee x Orlando exhibit differential degreening response. When harvested fruit were exposed to ethylene, rate of color change was greater in Fallglo than in Lee x Orlando . Differential degreening was correlated with differences in peel maturity between the two types and seedling triple response assay indicated no differences in ethylene perception.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Karthik-Joseph John-Karuppiah.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Burns, Jacqueline K.
Local: Co-adviser: Grosser, Jude W.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042069:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042069/00001

Material Information

Title: Differential Ethylene Sensitivity during Abscission and Degreening in Citrus
Physical Description: 1 online resource (158 p.)
Language: english
Creator: John-Karuppiah, Karthik-Joseph
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: 1mcp, abscission, citrus, degreening, diurnal, ethylene
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Ethylene is a gaseous plant hormone that regulates many processes in plant growth and development. Knowledge of ethylene biosynthesis, perception and signal transduction has helped to better understand plants response to ethylene. Response to ethylene was affected by several factors such as cultivar, plant organ and stage of development. In this research, differential response to exogenous ethylene in citrus during abscission and degreening were explored. Expression of genes involved in ethylene biosynthesis and signaling pathways were analyzed to determine if transcriptional changes were correlated with differential ethylene response. Partial or full-length nucleotide sequences were obtained for Valencia , Fallglo and Lee x Orlando homologs of biosynthetic genes CsACS1, CsACS2 and CsACO, receptor genes CsERS1, CsETR1, CsETR2 and CsETR3, and signaling genes CsCTR1, CsEIN2, CsEIL1 and CsEIL2. When applying abscission agents to tree fruit to facilitate harvest, it is desirable to loosen fruit and not leaves or other organs, but mechanisms controlling leaf and fruit drop are not fully understood. Differential abscission response in leaf and fruit tissues was observed when Valencia orange was treated with ethephon abscission agent (ethylene releasing agent) alone or in combination with 1-methylcyclopropene (1-MCP; ethylene perception inhibitor). When 1-MCP was combined with ethephon application, leaf abscission was greatly reduced whereas fruit loosening was little affected. Diurnal fluctuation in ethylene biosynthetic and signaling gene expression levels were studied in Valencia . Expression of genes fluctuated diurnally in at least one of the tissues tested (leaf blade, leaf abscission zone, fruit peel and fruit abscission zone). Changes in natural fluctuations were correlated with changes in sensitivity of mature fruit and leaves to abscission agent ethephon. Abscission agent was most effective when applied at 2 pm when expression levels of biosynthetic genes were actively increasing. Apart from differential abscission response, two citrus types Fallglo and Lee x Orlando exhibit differential degreening response. When harvested fruit were exposed to ethylene, rate of color change was greater in Fallglo than in Lee x Orlando . Differential degreening was correlated with differences in peel maturity between the two types and seedling triple response assay indicated no differences in ethylene perception.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Karthik-Joseph John-Karuppiah.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Burns, Jacqueline K.
Local: Co-adviser: Grosser, Jude W.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042069:00001


This item has the following downloads:


Full Text

PAGE 1

1 DIFFERENTIAL ETHYLENE SENSITIVITY DURING ABSCISSION AND DEGREENING IN CITRUS By KARTHIK JOSEPH JOHN KARUPPIAH A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Karthik Joseph John Karuppiah

PAGE 3

3 To my parents Dr. J. John Karuppiah and Mrs. J. Geetha

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my sincere thanks and gratitude to Dr. Jacqueline K. Burns, my committee chair, for giving me the opportunity to work on my degree and for her valuable advice, guidance support and encouragement throughout my Ph.D. program. I would like to extend my thanks and gratitude to my committee members, Dr. Jude Grosser, Dr. Greg McCollum, Dr. Fred Gmitter, Dr. Gloria Moore and Dr. David Clark for their guidance throughout my program. I would like to thank my colleagues Dr. Igor Kostenyuk, Dr. Luis Pozo, Dr. Anish Malladi, Dr. Hui Ling (Sunny) Liao, Dr. Fernando Alferez and Kate Dekkers for their valuable help in conducting my experiments in field and in laboratory I would like to thank my parents, my sister and her family who have supported me in my endeavors. I would like to thank my friends S.K. Ashok Kumar, Hui Ling (Sunny) Liao, Eduardo Chica, Lisseth Proao, Juan Carlos Melgar, Patricia Soria, Anish Malladi, Juan Manuel Cevallos, Raquel Rosales and Raquel Herrera for their friendship and motivation to successfully complete my PhD p rogram.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .................... 4 LIST OF TABLES ................................ ................................ ................................ ................................ 8 LIST OF FIGURES ................................ ................................ ................................ .............................. 9 ABSTRACT ................................ ................................ ................................ ................................ ........ 11 CHAPTER 1 INTRODUCTION A ND LITERATURE REVIEW ................................ ................................ 13 Abscission and Ethylene ................................ ................................ ................................ ............. 14 Diurnal Regulation of Ethylene Biosynthesis and Abscission ................................ ................. 17 Degreening and Ethylene ................................ ................................ ................................ ............ 19 Ethylene Sensitivity ................................ ................................ ................................ .................... 21 Ethylene Perception and Signaling ................................ ................................ ..................... 21 Discovery of ethylene receptors ................................ ................................ .................. 21 Structure of receptors ................................ ................................ ................................ ... 22 Function of receptors and ethylene binding ................................ ............................... 23 Spatial and temporal expression of receptors ................................ ............................. 28 Response to exogenous ethylene ................................ ................................ ................. 30 Downstream signaling elements ................................ ................................ .................. 32 Ethylene Biosynthesis ................................ ................................ ................................ ......... 36 Transcript ional regulation of ACS ................................ ................................ .............. 36 Dimerization of ACS ................................ ................................ ................................ ... 37 ACS protein turnover ................................ ................................ ................................ ... 37 Regulation of ACO ................................ ................................ ................................ ...... 38 Conjugation of ACC ................................ ................................ ................................ .... 39 Research Overview ................................ ................................ ................................ ..................... 39 2 ISOLATION AND CHARAC TERIZATION OF CITRUS ETHYLENE RECEPTOR AND SIGNALING GENES ................................ ................................ ................................ ....... 41 Introduction ................................ ................................ ................................ ................................ 41 Materials and Methods ................................ ................................ ................................ ................ 43 RNA Extraction ................................ ................................ ................................ ................... 43 Cloning of Ethylene Receptors and Signaling Genes ................................ ........................ 44 Results ................................ ................................ ................................ ................................ .......... 46 Discussion ................................ ................................ ................................ ................................ .... 47

PAGE 6

6 3 EXPRESSION OF ETHYLE NE BIOSYNTHETIC AND SIGNALING GENES DURING DIFFERENTIAL ABSCISSION RESPONSE OF CITRUS LEAVES AND MATURE FRUIT ................................ ................................ ................................ ....................... 57 Introduction ................................ ................................ ................................ ................................ 57 Materials and Method s ................................ ................................ ................................ ................ 60 Plant Materials and Treatment ................................ ................................ ............................ 60 RNA Extraction ................................ ................................ ................................ ................... 61 Gene Expression ................................ ................................ ................................ .................. 62 Ethylene Sensitivity in Leaf Abscission Zones ................................ ................................ 62 Results ................................ ................................ ................................ ................................ .......... 63 Differential Effect of 1 MCP on Leaf and Fruit Abscission ................................ ............. 63 Expression of Ethylene Biosynthetic Genes ................................ ................................ ...... 64 Expression of Ethylene Receptor and Signaling Genes ................................ .................... 64 Ethylene Sensitivity in Leaf Abscission Zones ................................ ................................ 65 Discussion ................................ ................................ ................................ ................................ .... 66 4 DIURNAL FLUCTUATION OF ETHYLENE BIOSYNTH ETIC AND SIGNALING GENE EXPRESSION LEVE CIA LEAF ABSCISSION ................................ ................................ ................................ .................. 77 Introduction ................................ ................................ ................................ ................................ 77 Materials and Methods ................................ ................................ ................................ ................ 80 Diurnal Fl uctuation in Leaf Blades, Leaf Abscission Zones, Fruit Peel and Fruit Abscission Zones ................................ ................................ ................................ ............. 80 Light and Dark Studies in the Growth Room ................................ ................................ .... 80 Diurnal Effects on Abscission Agent Efficacy in the Field ................................ .............. 81 Diurnal Effects on Abscission Agent Efficacy at Constant Temperature ........................ 82 RNA Extraction and Gene Expression ................................ ................................ ............... 82 Results ................................ ................................ ................................ ................................ .......... 83 Diurnal Fluctuation of Ethylene Biosynthetic Genes ................................ ........................ 83 Diurnal Fluctuation of Ethylene Receptor and Signaling Genes ................................ ...... 84 Receptors ................................ ................................ ................................ ...................... 84 Downstream signaling elements ................................ ................................ .................. 85 Diurnal Fluctuation of Cel a1 and PG ................................ ................................ ............... 86 Constant Light or Dark Studies in the Growth Room ................................ ....................... 87 Diurnal Effects on Abscission Agent Efficacy in the Field ................................ .............. 87 Diurnal Effects on Abscission Agent Efficacy at Constant Temperature ........................ 87 Discussion ................................ ................................ ................................ ................................ .... 88 5 DEGREENING BEHAVIOR CORRELATED WITH DIFF ERENTIAL EXPRESSION OF ETHYLENE SIGNALING AND BIOSYN THETIC GENES ................................ ................................ ..... 109 Introduction ................................ ................................ ................................ ............................... 109 Materials and methods ................................ ................................ ................................ .............. 111 Plant Material and Seedling Triple Response ................................ ................................ .. 111

PAGE 7

7 Ethylene Treatment ................................ ................................ ................................ ............ 113 RNA Extraction and Analysis of Gene Expression ................................ ......................... 113 Chlorophyll Extraction and Analysis ................................ ................................ ............... 114 ACC and MACC Extraction and Analysis ................................ ................................ ....... 114 Measurement of Ethylene Production ................................ ................................ .............. 115 Results ................................ ................................ ................................ ................................ ........ 116 Seedling Triple Response and Sequence Comparison ................................ .................... 116 Peel Color ................................ ................................ ................................ ........................... 116 Expression of Ethylene Biosynthetic Genes, ACC and MACC Contents, and Ethylene Production ................................ ................................ ................................ ....... 117 Expression of Ethylene Receptor and Signaling Genes ................................ .................. 119 Chlorophyllase Gene Expression and Total Chlorophyll Content ................................ 120 Discussion ................................ ................................ ................................ ................................ .. 121 APPENDIX A SUPPLEMENTAL DATA FO R CHAPTER THREE ................................ ........................... 134 B SUPPLEMENTAL DATA FO R CHAPTER FOUR ................................ .............................. 138 C SUPPLEMENTAL DATA FO R CHAPTER FIVE ................................ ................................ 139 LIST OF REFERENCES ................................ ................................ ................................ ................. 142 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ........... 158

PAGE 8

8 LIST OF TABLES Table page 2 1 Sequences of prim ................................ ........................ 52 3 1 Prim er sequences designed using Primer Express software and concentrations used to assess ethylene biosynthetic and perception gene expression ................................ ......... 71 4 1 room at constant temperature ................................ ................................ ................................ 93 5 1 harvest stages ................................ ................................ ................................ ........................ 126 5 2 Basa l levels of gene expression of ACS1 ACS2 and ACO and ethylene production ..... 127 C 1 Basal levels of gene expression of ERS1 ETR1 ETR2 and ETR3 ................................ ... 139

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Schematic representation of strategy ............................. 53 2 2 Comparative schematic representation of Citrus sinensis, Arabidopsis thaliana and tomato ethylen e receptors ................................ ................................ ................................ ...... 54 2 3 ...... 55 2 4 Amino acid sequence and sequence comparison with the highest similarity Arabidopsis sequence for ethylene signaling elements ................................ ....................... 56 3 1 Percentage of leaf drop and fruit detachment force ................................ ............................. 72 3 2 Gene expression of CsACS1 and CsACO ................................ ................................ ............. 73 3 3 Gene expression of CsERS1 ................................ ................................ ................................ .. 74 3 4 Gene expression of CsETR2 ................................ ................................ ................................ .. 75 3 5 Percentage of abscission of leaf blade and petiole when treated with ethylene for 88 h or 24 h followed by transfer to ethylene free air ................................ ............................... 76 4 1 Fluctuations in gene expression of CsACS1 ................................ ................................ ......... 94 4 2 Fluctuations in gene expression of CsACS2 ................................ ................................ ......... 95 4 3 Fluctuations in gene expression of CsACO ................................ ................................ .......... 96 4 4 Fluctuations in gene expression of CsETR3 ................................ ................................ ......... 97 4 5 Fluctuations in gene expression of CsERS1 ................................ ................................ ......... 98 4 6 Fluctuations in gene expression of CsETR1 ................................ ................................ ......... 99 4 7 Fluctuations in gene expression of CsETR2 ................................ ................................ ....... 100 4 8 Fluctuations in gene expression of CsCTR1 ................................ ................................ ....... 101 4 9 Fluctuations in gene expression of CsEIL1 ................................ ................................ ........ 102 4 10 Fluctuations in gene expression of CsEIL2 ................................ ................................ ........ 103 4 11 Fluctuations in gene expression of CsCel a1 and CsPG ................................ ................... 104 4 12 Fluctuations in gene expression of CsACS2 CsACO CsETR2 and CsETR3 under constant light or constant dark condition ................................ ................................ ............ 105

PAGE 10

10 4 13 Fluctuations in gene expression of CsCTR1 CsEIL1 and CsEIL2 under constant light or constant dark condition ................................ ................................ ................................ ... 106 4 14 Percentage of leaf drop and fruit detachment force when ethephon was sprayed at 8 am, 2 pm 8 pm or 2 am ................................ ................................ ................................ ....... 107 4 15 Leaf drop aft er ethephon application at 4 times of the day. ................................ .............. 108 5 1 ................................ ................... 127 5 2 treated ........................ 128 5 3 Changes in peel color during 24 h of ethylene treatment followed by 7 d of ethylene free storage; and during 8 d of storage in ethylene free air. ................................ .............. 129 5 4 Expression of ACS1 and ACO treated ........................ 130 5 5 ACC and MACC contents in trea ................................ ......... 131 5 6 Expression of ETR1 ETR2 and ETR3 treated ........................ 132 5 7 Expression of CHL and total chlorophyll content ethylene ................................ ................................ ................................ ................................ 133 A 1 Gene expression of CsACS2 and CsACO in fruit peel, fruit abscission zone, leaf blade and leaf abscission zone ................................ ................................ ............................. 134 A 2 Gene expression of CsETR1 and CsETR3 in fruit peel, fruit abscission zone, leaf blade and leaf abscission zone ................................ ................................ ............................. 135 A 3 Gene expression of CsCTR1 and CsEIN2 in fruit peel, fruit abscission zone, leaf blade and leaf abscission zone ................................ ................................ ............................. 136 A 4 Gene expression of CsEIL1 and CsEIL2 in fruit peel, fruit abscission zone, leaf blade and leaf abscission zone ................................ ................................ ................................ ....... 137 B 1 Fluctuations in gene expression of CsEIN2 in leaf blade, leaf abscission zone, fruit peel and fruit abscission zone ................................ ................................ .............................. 138 C 1 Expression of ACS2 ERS1 and CTR1 treated ........................ 140 C 2 Expression of EIN2 EIL1 and EIL2 treated thylene ........................ 141

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DIFFERENTIAL ETHYLENE SENSITIVITY DURING ABSCISSION, AND DEGREENING IN CITRUS By Karthik Joseph John Karuppiah December 2010 Chair: Jacqueline K. Burns Cochair: Jude W. Grosser Major: Horticultural Science Ethylene is a gaseous plant hormone that regulates many processes in plant growth and development. Knowledge of ethylene biosynthesis, perception and signal transduction has helped to better understand plants response to ethyl ene. Response to ethylene was affected by several factors such as cultivar, plant organ and stage of development. In this research, differential response to exogenous ethylene in citrus during abscission and degreening were explored. Expression of genes in volved in ethylene biosynthesis and signaling pathways were analyzed to determine if transcriptional changes were correlated with differential ethylene response. Partial or full homologs of biosynthetic genes CsACS1 CsACS2 and CsACO receptor genes CsERS1 CsETR1 CsETR2 and CsETR3 and signaling genes CsCTR1 CsEIN2 CsEIL1 and CsEIL2 When applying abscission agents to tree fruit to facilitate harvest, it is desirable to loosen fruit and not leaves or other organs, but mechanisms controlling leaf and fruit drop are not fully understood. Differential abscission response in leaf and fruit tissues was observed when ent (ethylene releasing agent) alone or in combination with 1 methylcyclopropene (1 MCP; ethylene perception inhibitor). When 1

PAGE 12

12 MCP was combined with ethephon application, leaf abscission was greatly reduced whereas fruit loosening was little affected. Di urnal fluctuation in ethylene biosynthe tic and signaling gene expression levels were (leaf blade, leaf abscission zone, fruit peel and fruit abscission zone). Changes in natural fluctuations were correlated with changes in sensitivit y of mature fruit and leaves to abscission agent ethephon. Abscission agent was most effective when applied at 2 pm when expression level s of biosynthe tic genes were actively increasin g exhibit differential degreening response. When harvested fruit were exposed to ethylene, rate of correlated with differences in peel maturity between the two types and seedling triple response assay indicated no differences in ethylene perception.

PAGE 13

13 CHAPTER 1 INTRODUCTION AND LIT ERATURE REVIEW Citrus production in the United States was 12 million tons in 845,100 acres during 2008 2009 (NASS, 2009). Florida is the largest citrus producing state in U.S. accounting for 71% of total U.S. citrus production followed by California (26%), and Tex as and Arizona accounting for the remaining 3%. Florida produced 8.47 million tons during 2008 2009 of which about 90% (7.6 million tons) goes to the processing industry while the remaining 10% (0.87 million tons) was marketed as fresh citrus (NASS, 2009). A major concern for the Florida citrus industry with respect to global marketing and competition is the high cost of production. The cost of harvesting (picking and roadsiding) alone for sweet oranges during the 2007 08 season was $1.86 per 40.8 kg (90 lb ) box (Muraro, 2008). Mechanization of citrus harvesting is one way to reduce harvesting cost, although it cannot be used for fresh citrus due to external fruit damage. In fruit crop situations where abscission agents are used, the goal is to selectively a nd uniformly loosen target fruit and increase efficiency of harvest. In practice, achieving this goal has been problematic due to our lack of knowledge about factors controlling abscission. With regard to fresh citrus fruit, Florida produced 868,000 tons in 2008 2009 (NASS, 2009). Although fresh fruit is a small percentage of Florida citrus production, it is a high value crop. During 2008 2009, the average on tree price for fresh citrus produced in Florida ranged from $6.10 to $13.25 per 40.8 kg box depend ing on the variety, accounting for a total value of production of $156 million (FASS, 2009). In early season fresh fruit, internal quality attains marketable standards even though the peel remains green. At this time there is an absence of cool nights that has been associated with poor color development (Grierson et al., 1986). When this destruction, unmask peel pigments, and enhance marketability. However, certain va rieties

PAGE 14

14 require longer ethylene exposure to completely degreen. But prolonged exposure to ethylene enhances peel senescence resulting in reduced storage life and increased vulnerability to pathogens. Degreening has been shown to hasten the development of stem end rot and anthracnose in early season fruit (McCornack, 1972; Brown, 1975; Brown, 1978). Increased peel senescence also led to enhanced rate of respiration and weight loss which eventually reduc ed the storage life of citrus fruit (Vines et al., 1965; Zamorani et al., 1973). Hence it is important to attain full coloration using concentration and duration of ethylene treatment as low as possible. Understanding the mechanisms involved during degreen ing will help to achieve full color development with minimum damage to the peel. Abscission and degreening are processes regulated by the plant hormone ethylene (Grierson and Newhall, 1960; Burg, 1968 ). Whether applied as a liquid formulation or a gas, et hylene has been shown to hasten both processes; however, the horticultural challenge is to understand factors affecting the plant response so that each process can be controlled and variation in response can be reduced. Abscission and Ethylene Abscission i s a process of separation of plant organs like leaves, flowers and fruit. Abscission occurs in abscission zones characterized by 10 20 layers of cells that differ in shape and size from the surrounding cells (Scott et al., 1948). Abscission zone cells are characterized by dense protoplasm, smaller intercellular spaces, large deposits of starch and highly branched plasmodesmata (Sexton and Roberts, 1982). Detachment of plant parts takes place as a result of dissolution of cell walls in abscission zone by the activity of hydrolase enzymes cellulase and polygalacturonase. Horton and Osborne (1967) reported an increase in cellulase activity during abscission of bean explants. In citrus, significant increase in cellulase and polygalacturonase activities were obse rved prior to abscission of leaf explants and intact mature fruit (Ratner et al.,

PAGE 15

15 1969; Greenberg et al., 1975). Two forms of cellulase were detected in abscission zones. The residual cellulase has a pI of 4.5 while the soluble form has a pI of 9.5; only t he soluble form was found to be involved in the abscission process (Reid et al., 1974). Girardin (1864) first observed the induction of leaf abscission in plants during accidental exposure to an illuminating gas. Neljubow (1901) identified ethylene as the active component of the illuminating gas and the role of ethylene on leaf abscission in plants was later confirmed by Doubt (1917). Subsequently, several studies indicated that the plant hormone ethylene plays a major role in regulating the abscission pro cess (Burg, 1968; Jackson and Osborne, 1970; Bleecker and Patterson, 1997). Apart from ethylene, other plant hormones like auxin, abscisic acid and cytokinin were also shown to regulate the abscission process. In contrast to the function applied by its nam e, studies have shown that abscisic acid does not have a direct effect on abscission. Abscisic acid promoted ethylene production that consequently induced abscission (Sagee et al., 1980). Unlike ethylene, auxin plays an inhibitory role in abscission. Auxin was reported to inhibit the increase in cellulase and polygalacturonase activity (Greenberg et al., 1975; Goren and Huberman, 1976). Balance between ethylene and auxin levels is thought to play an important role in regulating abscission (Sexton and Robert s, 1982; Brown 1997; Patterson, 2001; Taylor and Whitelaw, 2001). Abscission zones of young and immature tissues have high auxin levels and low ethylene levels. As senescence and maturity proceeds, auxin level decreases and ethylene level increases resulti ng in the detachment of plant part s Similar to auxin, cytokinin inhibits abscission of plant parts. Application of cytokinin reduced abscission of leaves in Poinsettia (King et al., 2001) and phlox flowers (Sankhla et al., 2003). Hence, interplay between ethylene and other plant hormones play critical role in regulating the abscission process. Although auxin and cytokinin inhibit abscission, they are widely used as thinning agents

PAGE 16

16 (Iwahori and Oohata, 1976; Yuan and Greene, 2000). It was reported that auxi n and cytokinin enhance ethylene production leading to fruitlet abscission (Iwahori and Oohata, 1976), but later studies reported no correlation with auxin or cytokinin application and ethylene biosynthesis (Dennis, 2002). Hence mechanism(s) underpinning t his differential response are not fully understood. Application of exogenous ethylene hastens abscission by inducing gene expression level s of cellulase and polygalacturonase in peach fruit (Bonghi et al., 1992) and tomato leaves, fruit and flowers (Kala itzis et al., 1995; del Campillo and Bennett, 1996). In citrus, enzyme activities of cellulase and polygalacturonase increased during ethylene induced abscission of mature citrus fruit (Greenberg et al. 1975; Huberman and Goren, 1979). Burns et al. (1998) showed increase in cellulase gene expression and enzyme activity during ethylene induced abscission in citrus. Ethylene not only induces the levels of cellulase but also enhances its secretion into the cell wall (Abeles and Leather, 1971). The regulatory r ole of ethylene in abscission was demonstrated in transgenic plants. Tomato transgenes over expressing the ethylene biosynthe tic gene 1 aminocyclopropane 1 carboxylic acid (ACC) synthase resulted in premature flower abscission, while a delay in abscission was noted in Nr plants (mutant of ethylene receptor LeETR3 ) and in LeETR1 antisense plants (Lanahan et al., 1994; Whitelaw et al., 2002). Ethephon (2 chloroethylphosphonic acid) is an ethylene releasing compound that can be used to induce abscission. Ethep hon is an effective abscission agent in citrus, plums, cherries and olives (Bukovac et al., 1969; Martin et al., 1981; Burns, 2002). However, excessive leaf abscission occurs at concentrations required for effective fruit loosening in citrus (Burns, 2002). Pozo et al. (2004) used 1 methylcyclopropane (1 MCP), an ethylene perception inhibitor, to control ethephon induced leaf drop with minimal effect on ethephon induced fruit loosening.

PAGE 17

17 Application of guanfacine, an agonist of G protein adrenorec eptors, also reduced ethephon induced leaf drop but not fruit loosening (Yuan et al., 2005). These results suggest that different abscission control mechanisms may exist in leaf and mature fruit of citrus. Moreover, ethylene sensitivity changed in fruit du ring development (Pozo and Burns, 2009). When abscission agents were applied at the same concentration throughout fruit growth and development, the response differed. Up to 100 days after bloom (DAB) fruitlets were highly sensitive to abscission agents. Fr om 100 to 225 DAB fruitlets were insensitive to abscission agents and the sensitivity increased after 225 DAB. Given the established role of ethylene and the above results, we hypothesized that examining how ethylene biosynthe tic and signaling gene express ion responded to abscission compound treatments could help explain ethylene based mechanisms involved in differential abscission responses. Diurnal Regulation of Ethylene Biosynthesis and Abscission Diurnal fluctuations are oscillations or repetitive variations that occur over a period of ~24 h. Such variations are controlled by external cues such as daily changes in light and temperature. Those biological oscillations that fluctuate over a repeating time period but are not regulated by external cues are termed circadian rhythms. Circadian rhythms and diurnal fluctuations were well documented in daily leaf movements of Mimosa pudica (de Mairan, 1729), and in leaf movement, elongation rate of abaxial an d adaxial cells of the petiole, elongation of hypocotyl and inflorescence stem in Arabidopsis (Engelmann and Johnsson, 1998; Jouve et al., 1998; Dowson Day and Millar, 1999; McClung, 2001). Since many physiological processes are regulated by light and plan t hormones, the effect of light on hormone synthesis and action play important roles in regulating such processes. For example, diurnal regulation has been reported for auxin production and signaling (Covington and Harmer, 2007; Liao and Burns, unpublished data) and diurnal regulation of hormone levels were reported for ethylene, cytokinin, abscisic

PAGE 18

18 acid and gibberellic acid (Lipe and Morgan, 1973; Cowling and Harberd, 1999; Novkov et al., 2005). In ethylene, diurnal fluctuation of ethylene evolution was observed in young fruit of cotton (Lipe and Morgan, 1973), leaves of Vicia faba (El Beltagy and Hall, 1974) and leaves of tomato (El Beltagy et al., 1976). In general, ethylene evolution increased during the light period reaching the peak towards the end of the light period and gradually declined during the dark period (Lipe and Morgan, 1973, Jasoni et al., 2002). However, in leaves of Vicia faba two peaks of ethylene production were noticed, one during the start of the light cycle and other at the end of the light cycle (El Beltagy and Hall, 1974). These fluctuations were correlated with daily changes in light and temperature (Lipe and Morgan, 1973). Although daily fluctuations in stomatal opening could act as a major diffusion pathway for ethylene and be misinterpreted as diurnal synthesis, fluctuation in the internal ethylene concentration in leaves of Vicia faba did not correlate with stomatal opening (El Beltagy and Hall, 1974). Studies with constant light or dark growth conditions revealed that ethylen e biosynthesis pathway is regulated by the circadian clock and diurnal conditions. In detached cotton cotyledons synthesis of the ethylene biosynthetic precursor ACC was regulated by the circadian clock, while the conversion of ACC to ethylene was regulate d by light (Rikin et al., 1984). Later, Jasoni et al. (2002) showed that synthesis of ACC in intact seedlings was regulated by light and synthesis of ethylene from ACC was controlled by circadian clock. This apparent discrepancy could be due to choice of p lant material or differences in intact and detached organs; nevertheless, diurnal fluctuations were evident.

PAGE 19

19 Information on diurnal fluctuation or circadian regulation of ethylene biosynthe tic and signaling gene transcription is not available. However, re cent information is available on diurnal response to abscission agents and efficacy. Efficacy of abscission agents in citrus fruit and leaves was highest when applied during mid day and was least when applied at night, even when temperatures were held cons tant over a 72 h light/dark cycle (Pozo et al., 2007; Malladi and Burns, 2008). We hypothesized that diurnal fluctuation in ethylene signaling and biosynthe tic gene expression could play a role in ethylene sensitivity and response to abscission agents dur i ng different times of the day. Knowledge of such fluctuations may lead to better abscission compound application timing in agricultural systems to better manage the abscission response. Degreening and Ethylene Degreening in citrus is a postharvest treatmen t during which fruit are exposed to ethylene gas to degrade peel chlorophyll. Under cool nights (<12.5 C) fruit are subjected to mild stress that triggers endogenous ethylene production (Grierson et al., 1986), resulting in chlorophyll degradation and unm asking and/or synthesis of other natural pigments. Early season fruit in Florida are not subjected to cool nights and remain green or partially green in color, even though internal quality has reached acceptable maturity standards (Brix and % acid) for ma rketing. To Chlorophyllase is the first enzyme in chlorophyll degradation which converts chlorophyll a and b to chlorophyllide a and b, respectively. Increased chl orophyllase activity during degreening has been reported in several studies (Shimokawa et al., 1978; Purvis and Barmore, 1981; Amir Shapira et al., 1987; Trebitsh et al., 1993). Application of 1 MCP (an ethylene perception inhibitor) was shown to inhibit o r delay chlorophyll loss during degreening (Goldschmidt et al., 1993; Porat et al., 1999; McCollum and Maul, 2007), suggesting ethylene

PAGE 20

20 orange fruit were treated with 8 0 L L 1 ethylene, chlorophyllase activity increased 5 and 12 fold after 24 h and 72 h of ethylene treatment, respectively (Trebitsh et al., 1993). Synthesis of chlorophyllase protein was observed after 24 h of ethylene treatment, whereas no chlorophyllas e protein was detected for up to 7 d in fruit not exposed to ethylene. Taken together, these results indicate that exogenous ethylene plays an important role in triggering chlorophyllase gene expression and protein synthesis. The response of citrus fruit to ethylene varies between cultivars. Although ethylene induced increase in chlorophyllase activity varied among different citrus species; 18 fold in Citrus unshiu (Shimokawa et al., 1978), 3 fold in calamondin (Purvis and Barmore, 1981), 4 fold in Citrus reticulata (Amir Shapira et al., 1987) and 5 fold in Citrus sinensis cv. Valencia (Trebitsh et al., 1993), differential induction of chlorophyllase between citrus species could not be compared because of the varied concentrations and durations of ethylene treatment. However, differential ethylene induced degradation of chlorophyll content in seven cultivars under the same degreening conditions (Kitagawa et al., 1978) suggested that chlorophyllase enzyme synthesis and activity respond to ethylene differentia responds rapidly to ethylene treatment and is sensitive to low levels. Petracek and Montalvo free storage following a 24 h ethy 15 ethylene treatment (McCollum, personal communication). Poor or variable response to ethylene degreening can result in incomplete color development or accelerated senescence due to overtreatment with ethylene, resulting in increased decay and loss of storage life (McCornack, 1972; Brown, 1975). Examining the basis of differential response with reg ard to ethylene

PAGE 21

21 signaling and biosynthesis pathways between two citrus fruit cultivars or the two citrus types described above with disparate response to degreening could assist with design of degreening strategies that control variation in response. Ethylene Sensitivity Ethylene sensitivity is described as the response of plants to endogenous and/or exogenous ethylene. Ethylene perception and biosynthesis govern ethylene sensitivity and can be ascertained through changes in perception and biosynthe tic gene expressions, ethylene precursors, ethylene production, and downstream biological response(s). Ethylene Perception and Signaling Ethylene perception and signaling has been shown to play major roles in downstream ethylene responses. Changes in percepti on were shown to influence changes in ethylene response during development. Further, the type of receptor involved in perception leads to differential ethylene response. Domains present in the receptor proteins vary in each receptor and differential ethyle ne sensitivity was associated with different receptor mutants. Hence, each receptor play important role in ethylene perception although functional compensation for the loss of one receptor by another receptor has been reported. These roles are described be low. Discovery of ethylene r eceptors Ethylene perception begins with the receptors located in the endoplasmic reticulum (ER) (Nehring and Ecker, 2004). The N termini of the receptors are bound to the ER membrane while the C termini are located on the cytoplasmic side. Ethylene perception rece ptors were elucidated using the triple response of Arabidopsis seedlings when exposed to ethylene. Ethylene treated seedlings show exaggerated apical hook curvature, radial swelling of the hypocotyl and inhibition of hypocotyls and root elongation, and thi lack the triple response in the presence of ethylene are insensitive to ethylene and were exploited

PAGE 22

22 to study downstream elements of the ethylene signaling pathway, ethylene responses and their regulation. Ble ecker et al. (1988) isolated the first ethylene receptor ETR in Arabidopsis using an ethylene dose response approach and measured hypocotyl length of the etr mutant and the wild type. Treatment with 1 L L 1 ethylene inhibited hypocotyl elongation by 70% i n the wild type, whereas the etr mutant was not affected. Ethylene insensitivity was also observed in primary root growth of the etr mutant. In this same work, chlorophyll loss in leaves of 6 week old etr mutants was impaired when treated with ethylene, wh ereas loss in the wild type was promoted. Screening for ethylene insensitive plants using the triple response led to the isolation of four additional ethylene receptors in Arabidopsis: ETR2 (Sakai et al., 1998), ERS1 (Hua et al., 1995), ERS2 (Hua et al., 1 998) and EIN4 (Roman et al., 1995; Hua et al., 1998). Structure of r eceptors The five Arabidopsis receptor genes, ERS1 (1842 bp), ERS2 (1938 bp), ETR1 (2217 bp), ETR2 (2322 bp) and EIN4 (2301 bp) encode proteins of 613, 645, 738, 773 and 766 amino acids, r espectively, with calculated molecular weights of 68, 72, 83, 86 and 86 kDa, respectively. The N termini of the receptor proteins contain transmembrane domains, with ETR1 and ERS1 having 3 transmembrane domains and ETR2, ERS2 and EIN4 have 4 transmembrane domains (Nehring and Ecker, 2004). The C termini contain histidine kinase and receiver domains and share similarity with the bacterial 2 component signal transduction system (Chang et al., 1993). ERS1 and ETR1 receptors have conserved protein motifs (H h istidine, N asparagine, G glycine, F phenylalanine and G glycine) of the histidine kinase domain and are classified as sub family I receptors, whereas sub family II receptors (ETR2, ERS2 and EIN4) have one or more of the protein motifs missing (Sch aller and Kieber, 2002). ETR1, ETR2 and EIN4 have receiver domain with conserved aspartate residue. Among the five receptors, amino acid sequence s of sub family I receptors (ETR1 and ERS1) have high similarity (79%) than with other receptors,

PAGE 23

23 attributed in part to the similarities in functional domains present in these two receptors. The sub family II receptors shared about 70 75% similarity while they had only 60 65% similarity with sub family I receptors. Six ethylene receptors were identified in tomato (Lashbrook et al., 1998; Tieman and Klee, 1999). LeETR1 and LeETR2 had ~90% similarity with AtETR1, while LeETR3 was less similar to AtETR1. These three tomato receptors contain all conserved histidine kinase domain motifs and three transmembrane domains, similar to sub family I receptors in Arabidopsis. LeETR3 lacks the receiver domain and has only 83% similarity with LeETR1. Similar to sub family II receptors in Arabidopsis, LeETR4, 5 and 6 contain 4 transmembrane domains but have less similarity with Le ETR1 (42, 40 and 56% similarity, respectively). While LeETR5 lacks all the conserved motifs in the kinase domain, LeETR4 and LeETR6 contain only the H and N motif. Similarities and differences among the receptors between species suggest that each receptor has differential function or response. Later, ethylene receptors were cloned in several plants like citrus (Katz et al., 2004), apple (Dal Cin et al., 2005), muskmelon (Sato Nara et al., 1999), strawberry (Trainotti et al., 2005), rose (Mller et al., 2000 ), chrysanthemum (Narumi et al., 2005) and carnation (Tanase et al., 2008) and expression was correlated with different ethylene responses. Function of r eceptors and e thylene b inding Ethylene receptors act as negative regulators in the ethylene signaling pathway (Hua and Meyerowitz, 1998; Ciardi et al., 2000; Tieman et al., 2000). In the absence of ethylene, the receptors actively suppress ethylene signaling. When ethylene is bound to the receptor(s), suppression is relieved and the signaling pathway is activated ultimately resulting in activation or suppression of genes that govern ethylene responses. When there are more receptors present, more ethylene is needed to illicit a downstrea m response; hence the tissue is less sensitive to

PAGE 24

24 ethylene and vice versa (Klee, 2002). Thus, there is an inverse relationship between receptor number and ethylene sensitivity. Loss of function mutation of a single receptor does not exhibit complete ethyl ene insensitivity (Hua and Meyerowitz, 1998). Double mutants etr1;etr2 and etr2;ein4 did not exhibit severe mutant phenotype, whereas double mutant etr1;ein4 triple mutant etr1;etr2;ein4 and quadruple mutant etr1;etr2;ein4;ers2 were severely abnormal. Thi s study and others in tomato (Tieman et al., 2000) indicated that receptors are redundant in function; when a single receptor is mutated, its function may be compensated for by other receptors. Antisense lines of NR ( LeETR3 ) were not altered in phenotype w hen compared with wild type tomato plants. However, expression of the NR gene was reduced significantly but simultaneously an increase in LeETR4 gene expression was measured, suggesting functional compensation by LeETR4 Also, transgenes with NR overexpres sing lines and LeETR4 antisense lines were crossed to study if an increase in levels of one ETR can compensate for the decrease in the level of another. NR overexpressing lines exhibited decreased ethylene sensitivity and ETR4 antisense plants exhibited an increase in ethylene sensitivity. Plants containing both transgenes had increased levels of NR gene expression and reduced levels of ETR4 gene expression, but the phenotype was similar to that of wild type tomato plants. Hence, lack of a single receptor m ay be functionally compensated by the other receptors, resulting in little or no change in ethylene sensitivity. Even though receptors are redundant in function and ethylene responses by different receptor mutant plants are similar, the degree of ethylene sensitivity varies depending on the type of receptor that is mutated. This is due in part to similarities and differences within structural components of the receptors that lead to downstream transduction of signal. The role of histidine

PAGE 25

25 kinase domain in e thylene signaling was studied using double mutant ers1;etr1 (Wang et al., 2003). The double mutant had severe constitutive triple response in seedlings and mature plants exhibited miniature rosette size phenotype, delayed flowering and male and female ster ility. Transgene constructs for each receptor were placed behind the ETR1 promoter and transferred into the ers1;etr1 double mutant. Constructs of ERS1 or ETR1 restored normal growth in the double mutant whereas ERS2, ETR2 or EIN4 had little or no effect o n the phenotype of the double mutant. This suggests that sub family I receptors that contain the conserved histidine kinase domain have a unique role in ethylene signaling. A histidine kinase inactivated ETR1 construct was then introduced into the double m utant, and interestingly it restored the mutant phenotype. Hence, subfamily I receptors may play an important role in ethylene signaling but it is not the histidine kinase function per se that is necessary for receptor function. The kinetics of ethylene re lated growth inhibition and subsequent recovery of growth after removal from ethylene was studied in ethylene receptor mutants in Arabidopsis (Binder et al., 2004). When wild type Arabidopsis was treated with 10 L L 1 ethylene, the inhibition of growth sh owed two distinct phases. The first phase was characterized by a rapid deceleration of growth rate, which began after 15 min of ethylene exposure and continued for 15 min. The growth rate was stable for 20 min thereafter, and then a second phase with slowe r rate of growth inhibition began and lasted for about 20 min. Null mutations in any of the ethylene receptors did not have a significant effect on both these rates of ethylene induced growth inhibition. But after removal from ethylene, the recovery of gro wth rate was significantly delayed in the null mutants of ETR1 ETR2 and EIN4 when compared with wild type or ERS1 and ERS2 mutant seedlings. Thus, ERS1 and ERS2 may not play a prominent role in the recovery of growth after ethylene removal. The absence of the receiver domain in these 2 receptors may play a part in the absence of this

PAGE 26

26 response. Studies such as these demonstrate that different types of receptors ma y influence downstream responses or sensitivity to ethylene. Binding of ethylene to the receptors is a crucial step in relieving the suppression of the signaling pathway by the receptors. To determine the ethylene binding activity of Arabidopsis ETR1, the ETR1 protein was expressed in yeast (Schaller and Bleecker, 1995). Truncated proteins of ETR1 were introduced into yeast to determine which region of the protein was involved in ethylene binding. When only the C terminal domain containing the histidine kin ase and response regulator domain were introduced, no ethylene binding was observed indicating that this portion is not required for ethylene binding. When the N terminal region containing the three transmembrane domains alone was introduced, the amount of ethylene binding per unit of protein expressed was similar to that of yeast containing the full length ETR1 protein. Studies on the mechanism of ethylene action revealed that metal binding was required for ethylene action (Burg and Burg, 1965). Later, cop per was found to be required for ethylene binding to the receptors (Rodrguez et al., 1999). Cysteine residues present in the transmembrane domains of the receptors may be involved in the coordination of copper to the receptors and ethylene binding. Point mutation at Cys 65 ( etr1 1 mutant) located in the second transmembrane domain resulted in complete inhibition of ethylene binding to the ETR1 protein. But when Cys 99 located in the third transmembrane domain was mutated, ethylene binding was not affected. T he etr1 1 mutant is a null mutant exhibiting complete ethylene insensitive phenotype. Hence, copper coordination at the Cys 65 is necessary for ethylene binding in this mutant and subsequent relieving suppression of signaling pathway by the receptors.

PAGE 27

27 lley et al. (2005) studied the ethylene binding ability of the different receptors in Arabidopsis and tomato. They calculated the receptor occupancy based on the percentage of total receptors bound by ethylene. The receptor occupancy was similar for all th e Arabidopsis receptors with values ranging from 41% to 59%, indicating that all receptors have similar binding affinity to ethylene. In tomato, the receptor occupancy for LeETR1 3 varied from 27% to 41% with LeETR3 having the highest occupancy and LeETR2 having the lowest value. The values for LeETR4 and LeETR5 were higher than 100% but this may be a quantification error due to very low expression levels of these proteins. Overall, the affinity for ethylene binding to the receptors was similar in Arabidops is and tomato, indicating that differences in signaling output may not be due to preferential binding of ethylene to any particular receptor. They also studied the relationship between the receptor gene expression and ethylene binding activity in wild type and various mutants in Arabidopsis. In ctr1 mutant, the total gene expression of the receptors was 1.8 fold higher than the wild type plants and correspondingly there was a 1.5 fold increase in ethylene binding. In etr1 1 null mutant, there was a 2 fold d ecrease in total gene expression and the ethylene binding was also reduced by 2 fold. In triple mutants etr1;etr2;ein4 and etr2;ers2;ein4 the total receptor gene expression and ethylene binding were similar to that of the wild type. In these systems, ther e was a direct correlation between receptor gene expression and the amount of ethylene bound to the receptors. Although both triple mutants exhibit similar ethylene binding ability to the wild type, they exhibit severe mutant phenotype indicating that each receptor type plays an important role in downstream ethylene signaling and action. Sensitivity to ethylene could not be correlated with total ethylene bound to the receptors.

PAGE 28

28 In summary, ethylene receptors are negative regulators in signaling pathway and are redundant in function. Though functional compensation can occur, the function of receptors can be linked to the type and structure of receptors. The degree of ethylene response was governed by the type of receptor, with sub family I receptors playing a major role in perception. Spatial and temporal expression of r eceptors Hua et al. (1998) studied spatial gene expression patterns of different ethylene receptors in Arabidopsis. Though all receptor transcripts were ubiquitously expressed in most tissues, the levels of receptor gene expression in different tissues were unique. In tomato six ethylene receptors were identified (LeETR1 6). During development and in response to external stimuli, each gene was differentially expressed in fruit (Lashbrook et al. 1998; Tieman and Klee, 1999). Throughout development, LeETR1 and LeETR2 expression level s remain unchanged, but expression of the other genes was differentially regulated during development. The levels of NR ( LeETR3 ) increased 10 20 fold during ripening. Reproductive tissues like flowers and fruit show high gene expression of LeETR4 LeETR5 and LeETR6 when compared with vegetative tissues. Differential expression of receptors suggests that each receptor type may have unique temporal and spatial functions that lead to differences in ethylene sensitivity. As development proceeds, ethylene sensitivity may also change based on the presence and abundance of a particular type of receptor. Sato Nara et al. (1999) demonstrated that expression of CmERS1 and CmETR1 was lower in flesh of melon fruit than on its epidermis. Similar to tomato, fruit ripening in muskmelon starts from inside and proceeds outward. Hence, lower receptor transcript levels inside the fruit suggest that this tissue is more sensitive to ethylen e and ripening is hastened at that location. The level of gene expression correlated with ethylene sensitivity of the tissue. They also compared expression of CmERS1 and CmETR1 between 2 cultivars of muskmelon. The cultivars FuyuA and Natsu4 have different fruit development characteristics and FuyuA sets

PAGE 29

29 larger fruit than Natsu4. CmETR1 gene expression started to increase 1 d after pollination in both cultivars, but there was a constant increase in gene expression from 7 to 35 d and from 7 to 21 d after pol lination in the cultivars FuyuA and Natsu4, respectively. Also, a correlation between an increase in CmERS1 gene expression and increase in fruit size was observed. This differential expression of the ethylene receptors in the 2 cultivars could lead to the differential ethylene sensitivity which may be related to the regulation of cell expansion. But since ethylene receptors are negative regulators, the correlation between increased gene expression and increased fruit size cannot be explained. So, Takahashi et al. (2002) made anti bodies for CmERS1 protein and studied the protein levels in these 2 cultivars. In both the cultivars, there was high accumulation of CmERS1 protein immediately after pollination. During the process of fruit development, the protein levels decreased in both cultivars but at varying rate. Like changes in gene expression, in Natsu4 the protein levels disappeared earlier than in FuyuA. The CmERS1 protein may play an important role in cell division and expansion and account for, at least in part, to smaller fruit size in Natsu4. In strawberry, FaETR1 gene expression was low in flowers and it increased continuously in fruit during ripening (Trainotti et al., 2005). The expression of FaERS1 was very high in flowers but like FaETR1 the gene expression increased during ripening. Like citrus, strawberry is a non climacteric fruit and no plant hormone has been shown to play a unique role in the development of non climacteric fruit. This study showed a correlation between strawberry fruit develo pment and changes in gene expression of ethylene receptors. In citrus, existence of autocatalytic system II like ethylene biosynthesis was reported in detached young fruitlet which was accompanied by increase in expression of ethylene biosynthe tic and rece ptor genes (Katz et

PAGE 30

30 al., 2004). Hence ethylene might play important roles in non climacteric fruit during fruit development. Spatial and temporal expression of ethylene receptors indicates that different receptors have unique roles during plant development and responses to various external stimuli. It is evident that ethylene plays an important role during development of climacteric fruit, but studies in citrus and strawberry suggest that ethylene also plays an important role during development of non clima cteric fruit. Response to e xogenous e thylene The effect of ethylene treatment on ethylene receptor gene expression was studied in Arabidopsis (Hua et al., 1998; Binder et al., 2004). When seedlings were treated with ethylene, only the expression of recepto rs ERS1 ERS2 and ETR2 were ethylene responsive. Further, the responsiveness of each receptor to ethylene treatment varied; ERS1 ERS2 and ETR2 expression level s increased by 3.8 6.6 and 14.3 fold, respectively, while no induction was observed in ETR1 a nd EIN4 expression. Similarly, transcript accumulation was ethylene responsive in other crops. In flavedo of immature fruitlets, gene expression of ERS1 and not ETR1 was induced by ethylene (Katz et al., 2004). But in mature fruit flavedo both the receptor transcript levels were not affected by ethylene. In tomato leaf blades expression of NR ETR4 and ETR5 genes were induced by exogenous ethylene application (Ciardi et al., 2000). Differences in ERS1 gene expression were studied in ethylene sensitive and ethylene insensitive cultivars of chrysanthemum (Narumi et al., 2005). These two cultivars were classified as ethylene sensitive or insensitive based on the phenotype observed when exposed to ethylene When cut flowers were left to senesce, DgERS1 gene expression increased with time in the ethylene sensitive

PAGE 31

31 cultivar but decreased in the ethylene insensitive cultivar. Thus, ethylene responsiveness of tissues could be correlated with changes in receptor gene expression level s. In many studies, exogenous ethylene application increased gene expression of one or more of the receptors, which is accompanied by an increase in ethylene response. Although a correlation exists between receptor transcription to e thylene application and biological activity in some cases, a direct link to biological activity can only be made if receptor protein was transcribed and properly inserted into the ER membrane. Since ethylene receptors are negative regulators of the ethylen e signaling pathway (Hua and Meyerowitz, 1998; Ciardi et al., 2000), insertion or degradation of functional receptors is one mechanism to alter ethylene sensitivity. In the majority of reports, it is unclear whether this actually occurred. Moreover, in som e cases where ethylene induced increased receptor expression, an increase in ethylene sensitivity was reported, not a reduction that would be expected. Such an outcome suggests the level of functional receptor proteins may be controlled at the post transcr iptional level, resulting in gene expression levels that may not correspond to the protein levels. During maturation, tomato fruit become more sensitive to ethylene, despite the fact that there was an increase in gene expression of NR ( LeETR3 ), LeETR4 and LeETR6 (Wilkinson, et al., 1995; Kevany et al., 2007). When mature tomato fruit were treated with 10 L L 1 of ethylene for 15 h, the expression of NR LeETR4 and LeETR6 increased by 9 10 and 7 fold, respectively (Kevany et al., 2007). Interestingly, NR ETR4 and ETR6 receptor protein levels were higher in immature fruit and significantly reduced in mature fruit during ripening, suggesting that mature fruit were more sensitive to ethylene. Also, treatment with ethylene itself caused rapid degradation of these proteins. Hence, ethylene itself degrades the receptor proteins and since the receptor number decreases, the fruit will likely become more sensitive to ethylene. This study shows that gene

PAGE 32

32 expression of receptors cannot be used to define the ethylene sensitivity, but that receptor protein levels are more strongly correlated. Downstream s ignaling e lements Kieber et al. (1993) isolated a ctr1 mutant in Arabidopsis that displayed constitutive triple response even in the absence of ethylene. Ethylene regu lated genes like chitinase were constitutively expressed in ctr1 mutants. Epistasis analysis positioned CTR1 downstream of ethylene receptors, and together with the receptors, acts as negative regulators in ethylene signaling pathway. CTR1 has been shown t o physically interact with the ethylene receptors; hence CTR1 was localized to the endoplasmic reticulum membrane, even though it lacks a trans membrane domain (Clark et al., 1998; Gao et al., 2003; Qu et al., 2007). The binding capacity of CTR1 to sub fam ily I receptors (ETR1 and ERS1) was higher than to sub family II receptors (ETR2), supporting the greater role of sub family I receptors in ethylene signaling (Cancel and Larsen, 2002; Wang et al., 2003). Further, mutations in the N terminal domain of CTR1 leading to disruption of binding with ETR1 resulted in mutant phenotype indicating that this physical interaction is required for the activation of CTR1 (Huang et al., 2003). CTR1 contains a serine/threonine kinase domain (Kieber et al., 1993). In vitro p hosphorylation assays identified autophosphorylation activity of the wild type Arabidopsis CTR1 (Huang et al., 2003). The ctr1 1 mutant (D694E mutation in the kinase domain) displayed strong constitutive triple response phenotype in Arabidopsis. Correspond ingly, no kinase activity was detected in ctr1 1 mutant indicating that the severe mutant phenotype was a consequence of the loss of kinase activity of CTR1. These results along with the binding of CTR1 to receptors suggest that the receptors activate kina se activity of CTR1 in the absence of ethylene thus leading to suppression of ethylene signaling pathway. However, mechanism(s) underlying this interaction has not been identified. Thus, impairment of the ser/thr domain and/or interaction of

PAGE 33

33 CTR1 with diff erent receptors could result in differential kinase activity and downstream ethylene signaling. Phosphatidic acid (PA), a signaling molecule with biological activity (Testerink and Munnik, 2005), is produced by phopholipase D or phospholipase C/diacylglycerol kinase mediated signaling pathways. Phosphatidic acid was demonstrated to bind directly to the kinase domain of CTR1 in vitro, inhibit its kinase activity, and inhibit the interaction of CTR1 with ethylene receptors (Testerink et al., 2007 ). Since CTR1 is a negative regulator in the ethylene signaling pathway, inhibition of kinase activity of CTR1 by PA binding turns on the downstream ethylene signaling pathway without interaction of ethylene with its receptors. PA and its interaction with CTR1 may lead to an increase in ethylene response in the absence of ethylene. It et al., 1996); however, it is unclear how the ethylene signaling pathway was initially activated in the absence of ethylene. Since PA is continuously present at low levels in the ER, it is possible that PA interaction with CTR1 was initially triggered by stress, leading to the activation of ethylene signaling pathway. CTR1 gene ex pression in Arabidopsis seedlings was not responsive to treatment with 10 or 100 L L 1 ethylene or 50 M ACC (Kieber et al., 1993; Gao et al., 2003). However, treatment with ethylene (100 L L 1 ) or ACC (50 M) resulted in an increase in CTR1 protein leve ls by 4 or 3 fold, respectively. In tomato, constitutive LeCTR1 gene expression increased with fruit ripening (Leclercq et al., 2002). LeCTR1 expression increased by 4 6 and 2 fold following ethylene treatment in mature green fruits, leaves and roots, respectively, but the effect on LeCTR1 protein level was not determined. Like in Arabidopsis, LeCTR1 may be regulated at a post transcriptional level, but this work has yet to be done.

PAGE 34

34 Downstream of CTR in the ethylene signaling pathway of Arabidopsis is E IN2; a positive regulator in ethylene signaling pathway (Alonso et al., 1999). EIN2 has a N terminal domain similar to Nramp metal transporter proteins. In addition, 12 transmembrane domains were predicted based on the protein sequence, although no metal t ransport activity or membrane association has been observed so far. When the suppression of signaling is relieved by ethylene binding to the receptors, EIN2 is activated followed by the activation of EIN3 in the nucleus. EIN3 belongs to a multigene family designated as EIN3 like (EIL) proteins. EIN3 and EILs are transcription factors that activate other ethylene responsive transcription factors. Loss of function mutation of EIN2 results in complete ethylene insensitivity (Chen and Bleecker, 1995) and consti tutive expression of EIN2 has shown to activate ethylene responses in Arabidopsis (Alonso et al., 1999). In tomato, reduced expression of LeEIN2 resulted in delayed fruit ripening (Klee, 2004). However, the gene expression did not change during fruit development and treatment with ethylene did not induce LeEIN2 expression, suggesting that EIN2 is regulated at post transcriptional level. EIN3 is a positive regulator in ethylene signaling pathway. Mutations in EIN3 severely affect ethylene responses in Arabidopsis and tomato by reducing ethylene sensitivity (Chao et al., 1997; Tieman et al., 2001). Mutation of a single LeEIL gene did not alter ethyle ne sensitivity in tomato plants (Tieman et al., 2001). When multiple LeEIL genes were mutated, the transgenic plants exhibited a severe ethylene insensitive phenotype. These results suggest that LeEILs are positive regulators of ethylene signaling and are redundant in function. Though EIN3 plays an important role in ethylene signaling, little work was done to show the expression of EIN3 as affected by ethylene treatment. During tomato fruit ripening, constitutive LeEIL gene expression remained unchanged and treatment of leaves with exogenous ethylene did not induce changes in

PAGE 35

35 gene expression (Tieman et al., 2001). In tobacco, even though different cells within the ovary (vascular bundle, placental epidermis and ovules) responded differently to ethylene, ther e was no change in the expression of EIL genes in these tissues following ethylene treatment (Rieu et al., 2003). Similar to CTR1 and EIN2, EIN3 does not appear to be transcriptionally regulated (increased gene expression) by ethylene; however, regulation at a post transcriptional level (increased protein level) may be important. Though the mechanism is not clear, post transcriptional regulation of EIN3 was described by Guo and Ecker (2003). Treatment of Arabidopsis with ethylene for 1 h significantly incr eased the EIN3 protein level. When seedlings were removed from ethylene and placed in an ethylene free environment, the EIN3 protein level decreased to undetectable levels after 30 min following removal of ethylene. This rapid degradation of EIN3 protein w as through an ubiquitin/proteasome pathway mediated by two F box proteins, EBF1 (EIN3 binding F box protein 1) and EBF2. In the presence of ethylene, the degradation pathway is inactive and EIN3 proteins accumulate, which increases the sensitivity (respons e) to ethylene. When ethylene is absent, the degradation pathway is active and ethylene sensitivity decreases due to degradation of EIN3 proteins. Later, Binder et al. (2007) showed through kinetic analysis of ethylene induced growth inhibition and recover y that EBF1 plays an important role in early stages of signaling whereas EBF2 plays a more prominent role in the later stages of ethylene signaling. When wild type Arabidopsis seedlings were treated with 10 L L 1 ethylene, inhibition of growth could be d ivided into two phases; the first phase is a rapid deceleration of growth rate, followed by a second phase with slower rate of growth inhibition. The kinetics of the first phase was not affected by mutations of ebf1 or ebf2 But the onset of the second pha se was faster in the ebf1 mutant than in wild type Arabidopsis; and the ebf2 mutant

PAGE 36

36 displayed similar kinetics to that of wild type Arabidopsis. During the recovery of growth following ethylene removal, the kinetics in ebf1 mutant was similar to wild type seedlings whereas ebf2 mutant required ~75 min longer time to restore its growth rate similar to that of wild type seedlings. Hence, the ubiquitin/proteosome pathway could also regulate sensitivity to ethylene. Ethylene Biosynthesis Methionine is converted to ethylene through three key reactions. Methionine is converted to S adenosylmethionine (SAM) by SAM synthetase. SAM is converted to 1 aminocyclopropane 1 carboxylic acid (ACC) by ACC synthase (ACS) which is then oxidized to ethylene by ACC oxidase (ACO) The conversion of SAM to ACC by ACS is considered the rate limiting step in ethylene biosynthesis (Adams and Yang, 1979), but regulation at the level of ACO has also been reported (Alexander and Grierson, 2002). SAM is also the precursor for polyamine bi osynthesis and is involved in several trans methylation reactions (Pech et al., 2004). Regulation of ethylene biosynthesis at the level of SAM has not been well defined. Expression of SAM did not coincide with changes in ethylene biosynthesis in carnation (Yang and Hoffman, 1984). Ethylene biosynthesis is highly regulated and an increase in ethylene production has been observed during various plant developmental stages and with biotic and abiotic stress. Both positive and negative feedback regulation of eth ylene biosynthesis have been reported (Riov and Yang, 1982; Rottmann et al., 1991; Nakatsuka et al., 1998) as described below. Transcriptional r egulation of ACS ACS is encoded by a multi gene family and different isoforms are differentially regulated in se veral plant species like Arabidopsis, tomato, rice, carnation, potato, zucchini, tobacco, plum and peas (Johnson and Ecker, 1998; Peck and Kende, 1998; El Sharkawy et al., 2008; Ge et al., 2008). The ACS isoforms in Arabidopsis exhibit differential spatial and temporal expression

PAGE 37

37 patterns and in response to various stress conditions (Yamagami et al., 2003; Tsuchisaka and Theologis, 2004; Peng et al., 2005). Barry et al. (2000) reported that LeACS1A LeACS2 LeACS4 and LeACS6 were differentially expressed du ring tomato fruit ripening whereas LeACS1B LeACS3 LeACS5 and LeACS7 were not detected in fruit. Further, two systems of ethylene production exist during tomato fruit development and ripening. System 1 ethylene is produced in very low quantities in green immature fruit and system 2 ethylene is autocatalytic and occurs duri ng fruit ripening. LeACS1A and LeACS6 are involved in system 1 ethylene while LeACS2 and LeACS4 are involved in system 2 ethylene production (Barry et al., 2000). These data suggest that each ACS isoform may play a unique role in regulating ethylene produc tion and response. Dimerization of ACS Dimerization of ACS was first reported in LeACS expressed in E. coli (Li and Mattoo, 1994). Crystalline structure analysis showed that the amino acid residues at the active site of apple ACS are Tyr85, Thr121, Asn202, Asp230, Tyr233, Ser270, Lys273, Arg281 and Arg407 (Capitani et al., 1999). These essential residues are required to form the homo dimer interface. The intermolecular complementation of ACS isoforms in E. coli revealed the formation of hetero dimers in Ara bidopsis (Tsuchisaka and Theologis, 2004). Though 45 different homo and hetero dimers are possible within members of the ACS gene family, only 25 are functional. Dimerization can depend on the relative abundance of isoforms. Thus dimerization can influen ce ethylene biosynthesis and differential ethylene responses. ACS p rotein t urnover Post transcriptional regulation of ACS was reported in cultured cells of parsley (Chappel et al., 1984) and tomato (Felix et al., 1991). In these studies, induction of ACS a ctivity occurred in the presence of a RNA transcription inhibitor, suggesting that a post transcriptional mechanism

PAGE 38

38 mediated ACS activity. Post transcriptional regulation was examined in ethylene overproducer ( eto ) mutants (Woeste et al., 1999). Though the mutants had ACS transcript levels similar to that of wild type, they exhibited higher ACS activity suggesting post transcriptional regulation. Like many proteins, ACS is also degraded through ubiquitin 26S proteasome mechanisms (Wang et al., 2004). ACS tu rnover is regulated by protein phosphorylation and two different types of phosphorylation (mitogen activating protein kinase; MAPK and calcium dependent protein kinase; CDPK) have been observed in the different ACS isoforms. In tomato, LeACS2 was phosphory lated at Ser460 while LeACS4 did not phosphorylate (Tatsuki and Mori, 2001). These two isoforms exhibit differences in the C terminal region that influence post translational protein stability. Based on phosphorylation, ACS can be classified into three typ es (Yoshida et al., 2005). Type 1 ACS proteins (Arabidopsis ACS1, 2 and 6; tomato ACS1A, 1B, 2 and 6) are phosphorylated by MAPK and CDPK, type II ACS are phosphorylated by CDPK while type III ACS lacks the phosphorylation sites. Differences in the type of phosphorylation of ACS isoforms together with differences in post translational modification could regulate protein turnover. Kende and Boller (1981) reported that the stability (half life) of wound induced ACS activity of green tomato fruit was 40 min wh ile that of ripening fruit was 2 h. This difference could be due to the involvement of different ACS isoforms during the wound response and ripening. Hence, temporal and spatial regulation of ACS turnover could result in differential ACS activity. Regulati on of ACO Like ACS, ACO is encoded by a multi gene family and differential expression of ACO has been observed (Barry et al., 1996; Nakatsuka et al., 1998). Though the conversion of SAM to ACC by ACS is considered the rate limiting step in ethylene biosynt hesis, regulation of ethylene production and action at the ACO step has also been reported (Alexander and Grierson, 2002). Tissue specific expression of ACO isoforms and differential expression during various stages of

PAGE 39

39 development and response to external stimuli suggests unique roles for various ACO isoforms. In tomato, LeACO1 is a key gene involved in fruit ripening (Blume and Grierson, 1997) and wound induced ethylene production in leaves (Smith et al., 1986; Blume and Grierson, 1997), while LeACO1 2 an d 3 are expressed during senescence of leaves, fruit and flowers (Barry et al., 1996). Temporal and spatial expression of LeACO genes were observed during flower development (Barry et al., 1996; Llop Tous et al., 2000). Differential expression could lead t o differential ethylene production and responses. Conjugation of ACC ACC can be conjugated to malonyl ACC (MACC) by the enzyme N malonyltransferase (Amrhein et al., 1981; Hoffman et al., 1982). Conjugati on to MACC is irreversible as it i s sequestered in th e vacuole and unavailable for conversion to ethylene (Bouzayen et al., 1989). ACC conjugation has been observed in many plants like grapefruit flavedo (Liu et al., 1985a), tomato fruit (Liu et al., 1985b; Martin and Saftner, 1995), apple fruit (Mansour et a., 1986), wheat leaves (Hoffman et al., 1982) and peanut seed (Hoffman et al., 1983). In immature apple fruit, about 45% and 5% of ACC synthesized in peel and flesh, respectively, was conjugated to MACC (Mansour et al., 1986). This rate of conjugation can be the contributing factor for low levels of ethylene production in pre climacteric fruit. Further, differences in the rate of conjugation between tissues could lead to differential ethylene responses among tissues. Research Overview From the vast literat ure available on ethylene signaling and biosynthesis it is evident that ethylene response (sensitivity) could be regulated at many steps in ethylene signaling and biosynthesis pathways. In this work, the hypothesis that differential ethylene sensitivity in citrus was a result of differential transcript accumulation of ethylene signaling and biosynthesis pathway genes was tested. Although ACS and ACO are encoded by a multi gene family, three

PAGE 40

40 biosynthetic genes ACS1 ACS2 and ACO1 are known to play major role s in ethylene biosynthesis in citrus (Mullins et al., 1999; Mullins et al., 2000; McCollum and Maul 2003; Katz et al., 2004; Yuan et al., 2005; Distefano et al., 2009) and these genes were used for this study. However, little information is available about the role of ethylene perception and signaling in citrus due in part to lack of sequence information of the elements involved in ethylene signaling. No known citrus ethylene perception or biosynthesis mutants exist. At the beginning of this work, sequ ence information was available for the biosynthe tic genes ( ACS1 ACS2 and ACO ) and two ethylene receptors ( ERS1 and ETR1 ) in citrus. In this project, nucleotide sequence information for other ethylene receptor and downstream signaling genes in citrus were isolated and characterized. Expression level s of these genes and in some cases ACC and MACC content and ethylene production were used to understand the basis of differential ethylene sensitivity between and within abscising citrus organs, and the role of d iurnal gene fluctuation in sensitivity. Finally, gene expression was used to determine the basis of differential degreening behavior

PAGE 41

41 CHAPTER 2 ISOLATION AND C HARACTERIZATION OF CITRUS E THYLENE RECEPTOR AND S IGNALING G ENES Introduction Ethylene signaling begins with the perception of ethylene by receptors located in the endoplasmic reticulum (Nehring and Ecker, 2004). Ethylene perception receptors were elucidated using the triple response of irradiated Arabidopsis seedlings exposed to ethylene. Bleecker et al. (1988) isolated the first ethylene receptor ETR (ethylene response) in Arabidopsis. Screening for ethylene insensitive plants using the triple response led to the isolation of four more ethylene receptors in Arabidopsis: ETR2 (Sakai et al., 1998), ERS1 (ethylene response sensor 1; Hua et al., 1995), ERS2 (ethylene response sensor 2; Hua et al., 1998) and EIN4 (ethylene insensitive 4; Roman et al., 1995; Hua et al., 1998). The N termini of the receptor proteins contain transmembrane domains, with ETR1 and ERS1 having 3 transmembrane domains and ETR2, ERS2 and EIN4 hav ing 4 transmembrane domains (Nehring and Ecker, 2004). The C termini of receptor proteins share similarity with the 2 component signal transduction system that contains histidine kinase and receiver domains (Chang et al., 1993). ERS1 and ETR1 receptors have conserved protein motifs within the histidine kinase domain and are classified as sub f amily I receptors, whereas sub family II receptors (ETR2, ERS2 and EIN4) have one or more protein motifs missing. ERS1 and ERS2 do not have the receiver domains. Downstream of the receptors in the signaling pathway is CTR1 (constitutive triple response 1; Kieber et al., 1993). CTR1 interacts with the receptors and together they act as negative regulators in the ethylene signaling pathway. Downstream of CTR is EIN2 (ethylene insensitive 2) a positive regulator in the ethylene signaling pathway (Alonso et a l., 1999). Downstream of EIN2 is EIN3 (ethylene insensitive 3) which is located in the nucleus (Chao et

PAGE 42

42 al., 1997). EIN3 belongs to a multigene family designated as EIN3 like (EIL) proteins. EIN3 and EILs are transcription factors that activate other trans cription factors of the ethylene responsive genes. Differences in the structure of receptors have been reported and these differences correlated with receptor function ( Schaller and Kieber, 2002 ). For example, sub family I receptors in Arabidopsis possess histidine kinase domain with conserved protein motifs ( H histidine, N asparagine, G1 glycine, F phenylalanine and G2 glycine) and these receptors were shown to play more important roles in signaling and downstream responses than sub family II rec eptors (Wang et al., 2003; Binder et al., 2004). The six ethylene receptors in tomato were differentially expressed in various tissues implying different receptors are involved in different ethylene responses (Lashbrook et al., 1998). CTR1 was reported to physically interact with the receptors and this binding is critical in regulating downstream responses (Clark et al., 1998; Cancel and Larsen, 2002). The binding capacity of CTR1 to sub family I receptors was higher than sub family II receptors, suggesting that differences in receptor structure influences CTR1 binding and subsequently downstream signaling. The C termini of CTR1 contains a ser/thr kinase domain and this phosphorylation activity together with its interaction with receptors is critical for CTR 1 function (Huang et al., 2003). CTR1 has also been reported to bind with other signaling elements like phosphatidic acid (PA) which result in changes in downstream ethylene signaling (Testerink and Munnik, 2005). Changes in CTR1 structure not only affects its binding to ethylene receptors but also with other signaling elements like PA, leading to changes in downstream ethylene responses.

PAGE 43

43 Changes in transcript accumulation of ethylene receptor and signaling genes were associated with various ethylene respo nses. In tomato fruit, each of the six receptors ( LeETR1 6 ) was differentially expressed during development and in response to external stimuli ( Lashbrook et al., 1998; Tieman and Klee, 1999) During fruit ripening the transcript accumulation of the NR ( Le ETR3 ) gene increased about 10 20 fold. Changes in expression of CmERS1 and CmETR1 were associated with ripening of muskmelon fruit ( Sato Nara et al., 1999 ). Changes in expression of ethylene receptor genes were associated with fruit development not only in climacteric fruit but also in non climacteric fruit like citrus and strawberry. In strawberry, expression of FaETR1 and FaERS1 increased continuously during fruit ripening (Trainotti et al., 2005) Katz et al. (2004) reported ethylene induced increase s in receptor gene expression in citrus fruitlets and changes in receptor gene expression level s ( CsERS1 and CsETR1 ) were correlated with degreening and pigment synthesis in clementine mandarins (Distefano et al., 2009). Obtaining sequence information in citru s for other genes involved in ethylene signaling pathway would provide detail understanding of the role of ethylene signaling during differential ethylene responses. In this study two additional ethylene receptors ( CsETR2 and CsETR3 ) and downstream signali ng genes CsCTR1 CsEIN2 CsEIL1 and CsEIL2 were sequenced in citrus. The goal was to compare structure of domains and encoded protein motifs that could provide information on the differential activities of these perception and signaling elements. Materials and Methods RNA Extraction from Citrus sinensis (Bower citrus hybrid [ C. reticulata Bl anco x ( C. reticulata Blanco x C. paradisi [purported C. reticulata Blanco x C. sinensis 15 150; [ Citrus

PAGE 44

44 reticulata cv. Clementine x ( C. reticulata cv. Dancy x C. paradisi cv. Duncan)] x [ C. reticulata cv. Dancy x C. paradisi cv. Duncan]), fruit flavedo tissues were collected along the equatorial region of mature fruit using a potato peeler. Tissues were frozen in liquid nitrogen immediately after excision and stored at 80 C until needed for extraction. RNA was e xtracted from 0.5 g of leaf blade or flavedo. The tissue was ground into fine powder and suspended in 1 mL TRI Reagent (Molecular Research Center, Cincinnati, OH) Chloroform (200 L) was added and the mixture vortexed thoroughly. The samples were incubate d on ice for 15 min and centrifuged at 20,000 g for 15 min at 4 C. RNA was extracted from the supernatant using RNeasy mini kit (Qiagen, Valencia, CA). First strand cDNA was synthesized from 1 g of RNA using SuperScript III Reverse Transcriptase (Invitro gen, Carlsbad, CA). Cloning of Ethylene Receptors and Signaling Genes The full length nucleotide sequence of CsERS1 (1905 bp; accession no. AF092088) and a partial sequence of CsETR1 (1065 bp; accession no. AJ276294) were obtained from the NCBI database. A partial sequence of CsETR2 was available in a citrus mature fruit and leaf EST database (921 bp; Burns, unpublished research) and partial sequence of CsETR3 (630 bp) was obtained from the publically available citrus HarvEST database (http://harvest.ucr.ed u/). Full (Invitrogen, Carlsbad, CA). To obtain full length nucleotide sequence of CsETR1 a fragment of 1; Table 2 1). For CsETR2 fragments of 522 bp length sequence of CsETR2 ively, were amplified for CsETR3 length sequence.

PAGE 45

45 Partial sequences of CsCTR1 (405 bp), CsEIN2 (847 bp) and CsEIL2 (260 bp) were CsCTR1 and CsEIN2 yielded 96 bp and 34 bp fragments, respectively, resulting in partial sequences. Partial sequence of CsEIL1 was obtained from the citrus mature fruit and leaf EST database and 615 bp fragment. Further amplification yielded a 507 bp fragment to obtain the full length sequence. most Amplified fragments were ligated into pGEM T Easy vector and transformed into JM109 competent cells using pGEM T Easy vector system (Promega, Madison, WI) as described in the purified using PureYield plasmid miniprep system (Promega, Madison, WI). Ligated fragments in the purified plasm ids were sequenced in the DNA sequencing facility at the Interdisciplinary Center for Biotechnology Research (University of Florida, Gainesville, FL). The cloned sequences from citrus were compared with ethylene signaling genes from Arabidopsis. The sequen ces of ERS1 ERS2 ETR1 ETR2 EIN4 CTR1 EIN2 and EIN3 for Arabidopsis (accession nos. AT2G40940, AT1G04310, AT1G66340, AT3G23150, AT3G04580, AT5G03730, AT5G03280 and AT3G20770, respectively) and sequences of ETR1 6 for tomato (accession nos. AF043084, A F043085, U38666, AF118843, AF118844 and AY079426, respectively) were obtained from NCBI. Comparison of sequences between citrus, Arabidopsis and tomato, and comparison of ethylene receptors within citrus were done using the software DS

PAGE 46

46 Gene 2.5 (Accelrys I nc., San Diego, CA). This software was also used to calculate the molecular weight, pI and von Heijne transmembrane prediction for the citrus ethylene receptors. Results Full length sequences of CsETR1 CsETR2 and CsETR3 (accession nos. GQ339592, GQ339593 sweet orange. The predicted protein sequence from the longest cDNA open reading frame for CsERS1, CsETR1, CsETR2 and CsETR3 contained 634, 740, 764 and 763 amino acids with calcula ted molecular weights of 71, 83, 85 and 86 kDa, respectively. Although CsERS1, CsETR1 and CsETR3 had a predicted pI of 6.5, CsETR2 had a higher pI of 8.0. The predicted amino acid sequence of CsERS1 was more similar to CsETR1 (81% similarity) than to those of CsETR2 and CsETR3 (58% and 54% similarity, respectively). CsETR2 and CsETR3 were more similar to each other (80%) than with CsETR1 (~60%). Sequence comparison with Arabidopsis receptors indicated CsERS1 and CsETR1 were highly similar to sub family I re ceptors AtERS1 (86% similarity) and AtETR1 (92% similarity), respectively, while CsETR2 and CsETR3 were more similar to sub family II receptors AtERS2 (70% similarity) and AtEIN4 (80% similarity), respectively. Based on von Heijne transmembrane prediction (von Heijne, 1992), CsERS1 and CsETR1 contained 3 transmembrane domains in their N termini, whereas CsETR2 and CsETR3 had 4 such domains (Fig. 2 2 and 2 3). CsERS1 and CsETR1 had histidine kinase domains containing five conserved motifs (H Histidine, N Asp aragine, G1 Glycine, F Phenylalanine and G2 Glycine). CsETR2 lacked all 5 conserved motifs in the histidine kinase domain. Only the H motif was present in the histidine kinase domain of CsETR3. When motifs were present, the contained amino acids were 85 10 0% identical between receptors with 0 2 amino acid substitutions. CsETR1, CsETR2 and CsETR3 contained the receiver domain with the conserved aspartate residue. The receiver domain was absent in the C terminus of CsERS1. A structural

PAGE 47

47 comparison between the predicted amino acid sequence of the cloned citrus ethylene receptor genes and Arabidopsis and tomato heterologs is presented (Fig. 2 2). Due to difficulties in PCR amplification, only partial sequences of CsCTR1 CsEIN2 and CsEIL2 were obtained (Fig. 2 4). Partial sequence of CsCTR1 contained 501 bp. Predicted amino acid sequence of the partial CsCTR1 (166 aa) corresponded to 657 to 821 aa of the AtCTR1 sequence with 85% similarity. The partial CsCTR1 sequence had high similarity w ith members of serine/threonine kinases of the class mitogen activated protein kinase kinase kinase (MAPKKK) from plants. The encoded amino acid sequence contained conserved residues of HRDLKSPN and TPEWMAPE identical to that of Arabidopsis, suggesting ser ine/threonine specificity. Partial sequence of CsEIN2 contained 881 bp. The predicted amino acid sequence of CsEIN2 (292 aa) shared homology with 416 to 696 aa of the AtEIN2 sequence with 55% similarity. Based on von Heijne transmembrane prediction partial amino acid sequence of CsEIN2 contained one transmembrane domain, although no specific membrane location of EIN2 has been identified in other plants. The full length sequence of CsEIL1 (accession no. GU981740) and a partial sequence of CsEIL2 contained 18 45 bp (614 aa) and 260 bp (86 aa), respectively. Predicted amino acid sequence CsEIL1 had 75% similarity with AtEIN3, while the partial sequence of CsEIL2 shared 63% similarity with 313 to 392 aa of the AtEIN3 sequence. When sequences of all genes cloned identical. Discussion A number of conclusions can be drawn on the possible role of signaling elements on ethylene sens itivity based on structure. CsERS1 is similar to AtERS1 and LeETR3 having three transmembrane domains, all conserved motifs ( H histidine, N asparagine, G glycine, F

PAGE 48

4 8 phenylalanine and G glycine) in the histidine kinase domain and lacking the recei ver domain (Fig. 2 2; Hua et al., 1998; Klee and Tieman, 2002). CsETR1 is similar to AtETR1, LeETR1 and LeETR2 having three transmembrane domains, conserved histidine kinase domain and a receiver domain. CsETR2 and CsETR3 have four transmembrane domains an d the receiver domain. CsETR2 lacks all the conserved motifs in the histidine kinase domain while CsETR3 contains only the H motif. Similar to CsETR2 all of the motifs in the histidine kinase domain are absent in AtERS2 and LeETR5, but unlike in CsETR2 the receiver domain is absent in AtERS2. CsETR3 is similar to AtEIN4 with four transmembrane domains, only the H motif in the histidine kinase domain and a receiver domain. Ethylene receptors are classified into two groups based on the conserved motifs prese nt in the histidine kinase domain. Sub family I receptors contain all the conserved motifs in the histidine kinase domain, while sub family II receptors lack one or more of the conserved motifs. Based on this criteria, CsERS1 and CsETR1 can be classified a s sub family I receptors and CsETR2 and CsETR3 can be classified as sub family II receptors. Sequence comparison indicated that CsERS1 and CsETR1 had higher similarity with sub family I receptors in Arabidopsis and CsETR2 and CsETR3 had higher similarity w ith sub family II receptors. Differences in the structure of citrus receptors could imply their importance in ethylene signaling. CsERS1 and CsETR1 might be more important for ethylene perception in citrus than CsETR2 and CsETR3 since sub family I recepto rs in Arabidopsis had been shown to play a more important role in ethylene perception than sub family II receptors. The response to ethylene in Arabidopsis varied depending on the type of receptors mutated (Hua and Meyerowitz, 1998). Although receptors are redundant in function (Hua and Meyerowitz, 1998; Tieman et al., 2000 ), mutations in sub family I receptors in Arabidopsis ( ERS1 and ETR1 ) displayed more severe

PAGE 49

49 mutant phenotype s in seedlings than did mutations in sub family II receptors ( ETR2 ERS2 and EIN4 ), implying the conserved histidine kinase domain may be important for signal transduction. Since CsERS1 and CsETR1 contain all the conserved protein motifs in the histidine kinase domain, phosphorylation might not be affected in these citrus receptors However, CsETR2 lacks all the motifs and CsETR3 lacks the N, G1, F and G2 motifs. Based on the Arabidopsis model, phosphorylation of these citrus receptors might be affected resulting in poorer downstream ethylene action. All four citrus receptors contai n the conserved cysteine residue in the second transmembrane domain necessary for ethylene binding. In Arabidopsis, a point mutation at Cys 65 ( etr1 1 mutant) resulted in complete lack of ethylene binding indicating that this cysteine residue located in the second transmembrane domain coordinates ethylene binding to the receptors ( Rodrguez et al., 1999). Hence, ethylene binding may not be affected in the four citrus receptors. Spatial and temporal differences in the abundance of transcripts of different rec eptors in Arabidopsis (Hua et al., 1998) and tomato (Lashbrook et al., 1998; Tieman and Klee, 1999) suggest that each receptor type may have unique functions in specific tissues and during development and thus lead to differences in ethylene sensitivity. D uring tomato fruit ripening, levels of LeETR3 expression increased by 10 to 20 fold and mutations in LeETR3 affected fruit ripening. CsERS1 is structurally similar to LeETR3 and might play an important role in ethylene perception during citrus fruit devel opment. The role of CsETR2 in transferring ethylene signals could be more important in fruit than in leaves, since expression of LeETR5 (closely related to CsETR2 with respect to structure and sequence similarity) was highly expressed in fruit but not in v egetative tissues. Increased expression of these genes during fruit development indicates that they are responsive to endogenous ethylene production. Beyond this fact, a direct link to

PAGE 50

50 downstream ethylene effects cannot be made. Knowledge on the number of active receptors incorporated into the membrane as a result of ethylene treatment will help to understand their role in ethylene sensitivity. The predicted amino acid sequence of CsCTR1 strongly suggests a possibility for phosphorylation through serine/th reonine protein kinase activity since the conserved residues required for kinase activity were identical to those present in CTR1 of Arabidopsis and tomato. Autophosphorylation of CTR1 in Arabidopsis was shown to play an important role in ethylene signalin g as a ctr1 1 mutant (mutation at the kinase domain) resulted in a strong constitutive triple response phenotype (Huang et al., 2003). The conserved amino acid residues of HRDLKSPN and TPEWMAPE in CsCTR1 are specific for serine/threonine protein kinases (H anks et al., 1988; Hanks and Quinn, 1991). These conserved domains are also present in AtCTR1 (Kieber et al., 1993), LeCTR1 and LeCTR2 (Leclercq et al., 2002). Sequence similarity with Arabidopsis and tomato CTRs suggests that CsCTR1 may also have a simila r function acting as negative regulator in the ethylene signaling pathway; however, full sequence was not obtained to make a more precise comparison. Partial sequence of CsEIN2 contains a transmembrane domain that has sequence similarity with the 12 th tran smembrane domain in AtEIN2 (Alonso et al., 1999). In Arabidopsis, EIN2 contains 12 transmembrane domains in the N terminal of the protein, although studies to identify cellular localization of EIN2 protein have been unsuccessful. Sequences of CsEIL1 and Cs EIL2 have high sequence similarity with EIN3 and EIN3 like ( EIL ) genes in other plants. The predicted AtEIN3 amino acid sequence did not have significant similarity with any known proteins (Chao et al., 1997). AtEIN3 was localized to the nucleus, and the presence of acidic, proline rich and glutamine rich regions indi cate the EIN3 group could act as transcription factors (Mitchell and Tjian, 1989). High sequence similarity of

PAGE 51

51 CsEIL1 to AtEIN3 and the presence of acidic or glutamic acid rich (1 50 aa), proline rich (227 238 aa) and glutamine rich (523 533 aa) regions su ggest CsEIN3 has a similar role. Although partial sequence of CsEIL2 aligns in between the conserved regions of CsEIL1, high sequence similarity suggests it could act as a transcription factor in the ethylene signaling pathway. Overall, structural comparis ons indicate that ethylene binding to the citrus receptors occurs, since the cysteine residue involved in binding is present in the second transmembrane domain. However, differences in the presence or absence of structural domains, especially the histidine kinase domain might impart differences in ethylene perception by different citrus receptors. Based on the Arabidopsis model, CsERS1 and CsETR1 belonging to the sub family I type of receptors might play a greater role in ethylene perception and signal tran sduction in citrus than CsETR2 and CsETR3. The relative abundance of receptors in different tissues could result in differential sensitivity or response to ethylene. In studies detailed in the following chapters, citrus receptor and signaling genes were us ed to determine their role in ethylene sensitivity during abscission and degreening.

PAGE 52

52 Table 2 Primer Sequence A1 5' GGCCGAGTCAAGTGCAATATTC 3' A2 5' TGCAGCATGTGACAGAGCAAC 3' B1 5' TCTCTAGTTCCTGATTGCT 3' B2 5' ATAACAAGCTGAGACTAGCTCG 3' B3 5' TTTCGCCCAAGATCCCAGG 3' B4 5' TCTCCCCTTCACTTTGAGAAGC 3' B5 5' ATGGTTGGGAGCCTGTTGAATTGC 3' B6 5' AATGGAAGTCAGGATAGGAATGAT 3' C1 5' CATATTCATCTGCCTTACTAGG 3' C2 5' TCTTGTCCTCACTACCACTCTC 3' C3 5' CTCATTTGGCATCCAAACCGCAC 3' C4 5' TGGTGTGCTTATCAAGCGACTTCC 3' C5 5' AGGGTCTTGCACGAAGGATGAC 3' C6 5' GAGGTTTCAGTTCGCACCAAC 3' D1 5' CAGCTTTGGTGTGATCTTGTGG 3' D2 5' TCTCAGGTCATTTCTGCTGTTGGG 3' E1 5' TGATGGTCCGGCTTCATTGAG 3' E2 5' TGCCGCACGACGCCAATTAG 3' F1 5' TTATGCAGCACTGTGATCCACCGC 3' F2 5' GGCCAAATGGGAATGAGGAG 3' F3 5' ATAGCTGCCTTCCAGCGTCTAC 3' F4 5' GGCTGATGAGCCACATATGACG 3'

PAGE 53

53 Figure 2 1. Schematic representation of from database which was used for the RACE protocol. The arrowheads indicate the relative position of the primers used to amplify the fragments represented by solid bars. The sequences of the primers are listed in Table 1.

PAGE 54

54 Figure 2 2. Comparative schematic representation of Citrus sinensis (Cs) Arabidopsis thaliana (At) and tomato (Le; Lycopersicon esculentum ) ethylene receptors. The number of amino acid (aa ) residues and molecular weight (in kDa) of the predicted full length protein sequences are indicated in parenthesis. The presence of transmembrane domains, GAF domain, conserved H (histidine) and NGFG (asparagine, glycine, phenylalanine and glycine, respe ctively) motifs within the histidine kinase domain and the conserved D (aspartate) residue in the receiver domain are indicated in dark grey.

PAGE 55

55 Figure 2 The four trans membrane domains (I, II, III and IV) and the histidine kinase domain (H Histidine, N Asparagine, G1 Glycine, F Phenylalanine and G2 Glycine motifs) are indicated in boxes. The conserved apartate (D) residues in the receiver domain are indicated by arrows. conserved substitutions.

PAGE 56

56 A B C D Figure 2 4. Amino acid sequence (left panel) and sequence comparison with the highest similarity Arabidopsis sequence (right panel) for ethylene signaling elements. Partial or full length amino acid sequence of (A) CsCTR1, (B) CsEIN2, (C) CsEIL1 and (D) CsEIL2 were compared with Arabidopsis. Amino acid residues specific for serine/threonine protein ki nases for CTR1 (A) and predicted transmembrane domain for EIN2 (B) are indicated in boxes.

PAGE 57

57 CHAPTER 3 EXPRESSION OF E THYLENE B IOSYNTHE TIC AND S IGNALING G ENES DURING D IFFERENTIAL A BSCISSION R ESPONSE OF C ITRUS L EAVES AND M ATURE F RUIT Introduction A bscission is a coordinated process of separation of organs such as leaves, flowers and fruit from the parent plant. Abscission occurs in abscission zones due to the dissolution of cell walls by the activity of the hydrolase enzymes cellulase and polygalact uronase, resulting in organ detachment. Since the initial work of Horton and Osborne (1967) associating cellulase activity with abscission of bean explants, cell wall hydrolase activity has been associated with abscission in other plants, including citrus (Ratner et al., 1969; Greenberg et al., 1975). Ethylene is a plant hormone that plays a major role in regulating the abscission process (Burg, 1968; Jackson and Osborne, 1970; Bleecker and Patterson, 1997). Application of exogenous ethylene hastens absciss ion by inducing gene expression of cellulase and polygalacturonase in peach fruit (Bonghi et al., 1992) and tomato leaves, fruit and flowers (Kalaitzis et al., 1995; del Campillo and Bennett, 1996). In citrus, the activities and gene expression level s of c ellulase and polygalacturonase increased during ethylene induced abscission of mature citrus fruit (Greenberg et al., 1975; Huberman and Goren, 1979; Burns et al., 1998). The regulatory role of ethylene in abscission was demonstrated in transgenic plants. Tomato transgenes over expressing the ethylene biosynthe tic gene 1 aminocyclopropane 1 carboxylic acid (ACC) synthase resulted in premature flower abscission, while a delay in abscission was noted in Nr plants (mutant of ethylene receptor LeETR3 ) and in an tisense plants with the ethylene receptor LeETR1 (Lanahan et al., 1994; Whitelaw et al., 2002). The response or sensitivity to ethylene can be controlled at steps involving ethylene biosynthesis and ethylene perception. Ethylene biosynthesis begins with the conversion of S adenosylmethionine (SAM) to ACC by ACC synthase (ACS). ACC is oxidized to ethy lene by

PAGE 58

58 ACC oxidase (ACO). The conversion of SAM to ACC by ACS is considered the rate limiting step in ethylene biosynthesis, but regulation at the ACO step has also been reported (Alexander and Grierson, 2002). The structure of ACS is similar to the subgr oup phosphate (PLP) dependent aminotransferases and PLP is an essential co factor for ACS activity (Mehta et al., 1993). ACS is encoded by a multi gene family and different isoforms are differentially regulated (Oetiker et al., 199 7; Peck and Kende, 1998; Barry et al., 2000). ACO is also encoded by a multi gene family and differential expression of ACO has been observed (Barry et al., 1996; Nakatsuka et al., 1997, 1998). Ethylene perception begins with ethylene binding at the recept ors located in the endoplasmic reticulum (Nehring and Ecker, 2004). Many ethylene perception receptors were elucidated using the triple response of Arabidopsis seedlings when exposed to ethylene. Bleecker et al. (1988) isolated the first ethylene receptor ETR (ethylene response) in Arabidopsis Screening for ethylene insensitive plants using the triple response led to the isolation of four additional ethylene receptors in Arabidopsis : ETR2 (Sakai et al., 1998), ERS1 (ethylene response sensor 1; Hua et al., 1995), ERS2 (ethylene response sensor 2; Hua et al., 1998) and EIN4 (ethylene insensitive 4; Roman et al., 1995; Hua et al., 1998). The N termini of the receptor proteins contain transmembrane domains, with ETR1 and ERS1 having 3 transmembrane domains and ETR2, ERS2 and EIN4 having 4 transmembrane domains (Nehring and Ecker, 2004). The C termini contain histidine kinase and receiver domains and share similarity with the bacterial 2 component signal transduction system (Chang et al., 1993). ERS1 and ETR1 rec eptors have conserved protein motifs in the histidine kinase domain and are classified as sub family I receptors, whereas sub family II receptors (ETR2, ERS2 and EIN4) have one or more protein motifs missing. ERS1 and ERS2 do not have the receiver domains. Downstream of the

PAGE 59

59 receptors in the signaling pathway is CTR1 (constitutive triple response 1; Kieber et al., 1993). CTR1 interacts with the receptors and together they act as negative regulators in ethylene signaling. Downstream of CTR1 is EIN2 (ethylene insensitive 2), which is a positive regulator in ethylene signaling pathway (Alonso et al., 1999). Downstream of EIN2 is EIN3 (ethylene insensitive 3) that is located in the nucleus. EIN3 belongs to a multigene family designated as EIN3 like (EIL) proteins EIN3 and EILs are transcription factors that ultimately activate ethylene responsive genes. Several studies have examined how ethylene treatment impacted expression of these perception and signaling genes in an attempt to identify which may have importan t roles in downstream biological responses. In general, subfamily I receptors are thought to play a more dominant role in ethylene signaling (Cancel and Larsen, 2002). Ethephon (2 chloroethylphosphonic acid) is an ethylene releasing compound used to accele rate abscission. Ethephon is an effective abscission agent in citrus, plums, cherries and olives (Bukovac et al., 1969; Martin et al., 1981; Burns, 2002). However, excessive leaf abscission occurs at concentrations required for effective fruit loosening in citrus (Burns, 2002) and olives (Burns et al., 2008). Pozo et al. (2004) used 1 methylcyclopropane (1 MCP), an ethylene perception inhibitor that irreversibly binds to ethylene receptors, to reduce ethephon induced leaf drop with minimal effect on ethepho n induced fruit loosening. Application of guanfacine, an agonist of G protein 2A adrenoreceptors, also reduced ethephon induced leaf drop but not fruit loosening (Yuan et al., 2005). These data suggest that different abscission control mechanisms may exist in leaf and mature fruit of citrus. Further, ethylene independent abscission has been observed in several plants. Studies with ethylene insensitive mutants revealed that ethylene independent abscission occurs in Arabidopsis (Patterson and Bleecke r,

PAGE 60

60 2004). Moreover, lack of ethylene involvement was observed during flower abscission in tulips and orchids (Sexton et al., 2000; Van Doorn, 2002). For effective use of mechanical harvesting in citrus, it is necessary to use abscission agents that prefere ntially increase fruit loosening but have very little effect on leaf abscission. Thus, understanding mechanisms of abscission in leaf and mature fruit are important in selecting an effective abscission compound. The objective of this study was to test if d ifferential expression of ethylene biosynthe tic and signaling genes were correlated with differential abscission of leaves and mature fruit. In this study, genes involved in ethylene signaling and biosynthetic pathways were cloned from and their expression level s were analyzed during abscission in leaf and fruit tissues. We demonstrate that 1) most ethylene biosynthetic and perception gene expression level s explored in this study were responsive to ethephon application in one or more tissues exam ined, 2) failure of 1 MCP to suppress fruit loosening was not correlated with ACS or ACO expression in fruit abscission zones, and 3) differential timing of subtending organ drop at two spatially distinct leaf abscission zones was not correlated with ethyl ene sensitivity. Materials and Methods Plant Materials and Treatment Citrus sinensis from an experimental grove located at the Citrus Research and Education Center, Lake Alfred, FL Trees were sprayed until run off with 450 L L 1 ethephon or 5 mM of 1 MCP or a combination of both using a motorized back pack sprayer on 28 Apr. 2006 as described (Pozo et al., 2004). Control trees were sprayed with water and two trees were used for each treatment. The experiment was repeated on 30 Ap r. 2008. Data from the two seasons had similar trends and hence the average from both seasons is shown for leaf drop, fruit detachment force (FDF) and

PAGE 61

61 gene expression level s. Leaf abscission and FDF were measured immediately after treatment and after 6 h, 1, 2, 4 and 7 d of application. Ten branches (each with about 100 leaves) per treatment were tagged to follow leaf abscission. Leaf count was taken on these branches and percentage of leaf drop was calculated. FDF was measured on 5 fruit/replication with 4 replicates using a Force One digital force gauge (Wagner Instruments, Greenwich, CT, USA). Reports indicate that abscission may be initiated in organ abscission zones and/or their subtending organs (Beyer, 1975; Alferez et al., 2005), so leaf blade, lamin ar abscission zones, fruit peel and fruit abscission zones were used for this study. Samples of leaf blade, laminar abscission zone (LAZ), fruit peel and fruit abscission zone (FAZ) tissues were collected in 3 replicates during the first season (4 replicat es during the second season) immediately after treatment and 6 h, 1, 2, 4 and 7 d after application. Leaf blade and LAZ were collected from 10 leaves/replicate at each sampling time. Mid section of the leaf blade was used and LAZ were excised using a razor blade as described (Yuan et al., 2005). Fruit peel and FAZ were collected from 4 fruit/replicate. Fruit flavedo (the colored portion of the peel) was removed from the equatorial area of each fruit using a potato peeler. FAZ were removed from fruit using a 1 cm cork borer. The pedicel, calyx and albedo surrounding the abscission zone were trimmed away using a razor blade, leaving approximately the 4 mm thick FAZ intact. Tissues were frozen in liquid nitrogen immediately after sampling and stored at 80 C u ntil needed. RNA Extraction RNA was extracted from 0.5 g of flavedo, 0.5 g of leaf blade, 4 FAZ (approximately 0.3 g) and 10 LAZ (approximately 0.2 g). The frozen tissue was ground into fine powder and suspended in 1 mL of cold TRI Reagent (Molecular Resea rch Center, Cincinnati, OH) Chloroform (200 L) was added and the mixture vortexed thoroughly. Samples were incubated on ice for 15 min and centrifuged at 20,000 g n for 15 min at 4 C. RNA was extracted from the

PAGE 62

62 supernatant using RNeasy mini kit (Qiagen, Valencia, CA). First strand cDNA was synthesized from 1 g of RNA using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA). Gene Expression Primers for real time PCR were designed using Primer Express 3.0 software (Applied Biosystems, Foster City, CA). Primer sequences and primer concentrations used are listed in Table 3 1. Gene expression was analyzed using Real Time PCR (model 7500 Fast Real Time PCR System, Applied Biosystems, Foster City, CA) using 2x SYBR Green PCR Master Mix sold by the instrument manufacturer. One L of cDNA was used in a 20 L reaction. Glyceraldehyde 3 phosphate dehydrogenase ( CsGAPDH ) was used as a constitutively expressed gene to compensate for differences in concentration of template that may have occurred in each r eplicate. Relative gene expression was calculated using the comparative C T method (Livak and Schmittgen, 2001). For each sample, the C T (threshold cycle) value for the gene of interest was subtracted from the C T value of CsGAPDH T T was calculated T of one T 0 control replicate with the value closest to the mean T 0 T of all individual replications at each time point. Relative gene expression was calculated by the formula 2 Ethylene Sensitivity in Leaf Abscission Zones Citrus leaves have two abscission zones. One abscission zone is located between the leaf blade and the petiole (LAZ) and the second is located between the petiole and the stem (petiolar abscission zone). When abscission agents are applied, leaf blades first abscise due to abscission processes at the LAZ and later followed by abscission of the petioles due to abscission processes at the petiolar abscission zone. To study differences in ethylene sensitivity of LAZ and petiolar abscission zone s during ethylene induced abscission, two 7 year old potted Citrus sinensis cv. L L 1

PAGE 63

63 of ethylene for 88 h. The trees were grown in 12h/12h light and dark cycles (light: 6 am to 6 pm; dark: 6 pm to 6 am) and watered daily. The temperature and humidity of the chamber were monitored every 15 min using a HOBO automatic data logger (Onset Computer Corporation, Bourne, MA). Leaf blade and petiole drop were counted twice a day at 10 am and 6 pm on 20 branches (at least 30 leaves/branch). In another experiment, two 7 placed in a chamber with 5 L L 1 of ethylene for 24 h and then transferred to ethylene free air. T he plants were held under the same light, temperature and humidity conditions as above. Leaf blade and petiole drop were counted on 6 tagged branches (at least 30 leaves/branch) every 12 h for 84 h. Laminar and petiolar detachment force were measured on 30 leaves every 12 h using an Imada DS2 11 force gauge (Imada Inc., Northbrook, IL). Results Differential Effect of 1 MCP on Leaf and Fruit Abscission Ethephon induced leaf abscission 2 d after application was 12% and increased rapidly to 73% after 4 d of ap plication (Fig. 3 1A). When 1 MCP was applied in combination with ethephon, leaf abscission was delayed and reduced to 6% after 4 d of application and increased to only 22% after 7 d. Visual examination for an additional 2 weeks indicated no further increa se in leaf abscission in this treatment combination. Fruit loosening was evident 4 d after ethephon application (Fig. 3 1B) and FDF was reduced to 6.4 kg force compared to 10.5 kg force in control fruit. When 1 MCP was combined with ethephon, the rate of f ruit loosening was reduced slightly, and FDF fell to 7.8 kg force on day 4 after application. However, FDF was similar in both treatments after 7 d of application. 1 MCP treatment alone did not cause leaf abscission or fruit loosening.

PAGE 64

64 Expression of Ethyl ene Biosynthe tic Genes Expression of CsACS1 in peel was ethylene responsive (Fig. 3 2A). Peak expression occurred 6 h after application and then fell to control levels soon thereafter. A slight but measurable increase in gene expression occurred in FAZ 6 h after ethephon application, but rose 22 fold 24 h after application and then decreased (Fig. 3 2B). CsACS1 gene expression in peel was suppressed if 1 MCP was combined with ethephon and applied to the canopy; however, expression in FAZ was only delayed. C sACS1 expression in leaf blade and LAZ tissue was ethephon responsive; with peak expression measured 4 d after application (Fig. 3 2C and 3 2D, respectively). Gene expression was suppressed in leaf tissues when 1 MCP was applied in combination with ethepho n. Timing of increased CsACS1 gene expression in leaf tissues coincided with increased leaf drop, while in fruit tissues increased gene expression preceded fruit loosening. Increased expression in FAZ in response to 1 MCP alone suggests that basal ethylene production may be inhibitory to CsACS1 expression. CsACS2 expression was not affected by ethephon in any of the 4 tissues studied (Fig. A 1). CsACO expression in FAZ reached a maximum (6.8 fold) 6 h after application of ethephon and remained high until da y 4, after which expression decreased (Fig. 3 2E). Treatments with 1 MCP alone or in combination with ethephon delayed the rise in CsACO expression. Like CsACS1 expression, basal ethylene production may inhibit CsACO expression in FAZ. In LAZ, ethephon tre atment increased CsACO expression, reaching a maximum of 5.7 fold 1 d after application and then falling to control levels after day 4 (Fig. 3 2F). Ethephon had very little effect on CsACO expression in leaf blade and fruit peel (Fig. A 1). Expression of E thylene Receptor and Signaling Genes CsERS1 was ethylene responsive in all four tissues examined (Fig. 3 3). In fruit peel (Fig. 3 3A) and FAZ (Fig. 3 3B), expression increased to a maximum 6 h after application and

PAGE 65

65 gradually declined to control levels 4 a nd 2 d after application, respectively. CsERS1 expression increased gradually in leaf blade (Fig. 3 3C) and LAZ (Fig. 3 3D) to a maximum of 2.1 and 2.6 fold after 2 and 1 d of application, respectively. CsETR1 expression was induced by ethephon in fruit p eel (Fig. A 2). The maximum increase in expression (2.2 fold) occurred after 1 d of application and decreased to control levels on day 4. In LAZ, CsETR1 expression increased in all three treatments after 6 h of application and reduced to control levels on day 1. Similar to CsERS1 expression of CsETR2 was ethylene responsive in all four tissues (Fig. 3 4). Ethephon induced expression in fruit peel and FAZ (Fig. 3 4A and 3 4B) was higher than control after 6 h, 1 and 2 d after treatment and then dropped to control levels. In leaf blade and LAZ (Fig. 3 4C and 3 4D), ethephon induced maximum increase in CsETR2 expression after 1 d of application and levels in leaf blade remained higher than the control until the end of the experiment, while in LAZ t he expression reduced to control levels after 4 d of application. Expression of CsETR3 was not affected by ethephon (Fig. A 2). Ethephon induced increases of receptor gene expression were counteracted by 1 MCP when applied in combination with ethephon. Exp ression of CsERS1 and CsETR2 were generally lower than control when 1 MCP was applied alone or in combination with ethephon while expression level s of CsETR1 and CsETR3 were similar to the control. The expression level s of CsCTR1 CsEIN2 CsEIL1 and CsEIL2 were variable but not significantly altered by ethephon and/or 1 MCP treatment in any of the tissues (Fig. A 3 and A 4). Ethylene Sensitivity in Leaf Abscission Zones When potted trees were treated with continuous ethylene exposure, abscission of leaf bl ades was measured 24 h after exposure, while abscission of petioles began after 40 h (Fig. 3 5A). Abscission of leaf blades increased rapidly to 95% after 40 h of continuous ethylene exposure, and after 64 h all leaf blades abscised. Abscission of bladeles s petioles steadily

PAGE 66

66 increased to 93% in 72 h and reached 100% in 88 h. When potted trees were treated with ethylene for 24 h and then transferred to ethylene free air, leaf blade abscission began 12 h after ethylene removal, whereas petioles started to abs cise 36 h after ethylene removal (Fig. 3 5B). After 60 h of transfer from ethylene, 57% and 13% abscission of leaf blades and petioles was measured, respectively. Leaf blade and petiole detachment forces indicated that reduction in detachment force due to ethylene treatment was similar at both abscission zones (Fig. 3 5C). The detachment force in both abscission zones reduced from 1 kg force to 0.6 kg force in 12 h and reached a minimum of 0.1 kg force in 24 h. Discussion Citrus leaves and fruit abscised w hen treated with ethephon, but foliage appeared to respond more readily by dropping over 80% of the total leaves after 7 d. Apart from this differential intensity of response to ethephon, differential response to 1 MCP also was observed. Ethephon induced l eaf drop was suppressed by application of 1 MCP in combination with ethephon, while it had little effect on fruit loosening. Similar results were observed with application of 1 MCP (Pozo et al., 2004) or guanfacine, an agonist of G protein 2A adre noreceptors (Yuan et al., 2005) Since 1 MCP is a gas, penetration of 1 MCP into bulky fruit tissues may have been restricted but less so in leaf tissues. Absorption of 1 MCP was reported to vary between different plant tissues (Nanthachai et al., 2007). T hese differences were due to various cellular components such as oils, polysaccharides and lignin that alter 1 MCP absorption. 1 MCP was absorbed faster and in greater amounts in high lipid avocado fruit than apple of lower lipid content (Dauny et al., 200 3). Choi and Huber (2009) reported that 1 MCP absorption ranged from 34% to 94% in fruit and vegetable tissues depending on the type of polysaccharide, with xyloglucan exhibiting the lowest absorption (34%) followed by cellulose (38%), starch (49%) and est erified pectin (94%). Among the aliphatic components of lipid derived polymers,

PAGE 67

67 citrus leaves contain a higher percentage of fatty alcohols and fatty acids than citrus fruit peel hydroxy acids, dicarboxylic acids and polar acids than leaves (Espelie et al., 1980). Pectin content was slightly higher in citrus fruit flavedo (270 mg g 1 dry weight) than in leaf blade (220 mg g 1 dry weight; Liao and Burns, unpublished data). In whole fruit, pectin is expected to be much higher than in leaves due to the highly pectinaceous albedo. Nonetheless, our gene expression data indicated that 1 MCP penetrated flavedo and fruit abscission zone tissues sufficiently because ethephon induced receptor gene expression was suppressed. Thus differences in oil, polysaccharide, lignin and pectin content cannot solely account for differential response observed in fruit and leaves. Alternatively, regeneration of new receptor sites could play a role in the differential abscission response. When ethylene and 1 MCP are co applied to tissues, 1 MCP preferentially binds to the receptors, but there is no 1 MCP binding preference between receptor types (Hall et al., 2000). Since 1 MCP was applied as a gas to citrus canopies in an open environment, it w ould be available only for a short duration, while release of ethylene into plant tissues from liquid ethephon solution could take place after several hours of application (Domir and Foy, 1978; Perry and Gianfagna, 1987). Though more than 50% of ethephon w as dissociated to ethylene within 24 h of application, ethylene release continued to occur for 96 h in leaves of tobacco (Domir and Foy, 1978) and peach (Perry and Gianfagna, 1987). Several studies indicated that new receptors were synthesized after 1 MCP was bound to available receptors (Binder et al., 2004; Blankenship and Dole, 2003). In avocado, two applications of 1 MCP at 10 d intervals were required to prevent fruit softening (Pesis et al., 2002) and 1 MCP was effective in increasing vase life of hib iscus flowers only by continuous exposure for 15 h (Reid et al., 2002). Application of 1 MCP delayed ripening of avocado and tomato by 2 weeks and 5 10 d,

PAGE 68

68 respectively (Feng et al., 2000; Wills and Ku, 2002). If new receptors were synthesized and incorpora ted into the endoplasmic reticulum, rate of new receptor regeneration must have varied between tissues. The amount or rate of receptor regeneration in mature citrus fruit could be much lower than in leaves, creating a situation of lower new and functioning receptor numbers in fruit. Since low receptor number is associated with greater ethylene sensitivity (Hua and Meyerowitz, 1998; Klee, 2004; Tieman et al., 2000), residual ethylene released from decaying ethephon could be sufficient to allow fruit loosenin g to continue. Although several studies indicated that ethylene plays a major role in accelerating abscission, ethylene is likely not required to initiate the abscission process. Studies in tulip (Sexton et al., 2000), orchids (van Doorn, 2002) and Arabidopsis (Patterson and Bleecker, 2004) revealed that ethylene was not necessary for abscission to occur. Patterson and Bleecker (2004) developed five Arabidopsis mutants that were ethylene responsive but abscission of floral organs was not affected by exogenous ethylene. Recently, existence of alternate signaling pathway for ethylene was hypothesized (Xu et al., 2008). Two FEI proteins (leucine rich repeat receptor like kinases) were identified to act in a novel ethylene signaling pathway during cell wa ll development in Arabidopsis These proteins were shown to interact directly with ACS proteins, suggesting a potential by pass mechanism leading to ethylene perception independent ethylene responses. Application of 1 MCP did not prevent ethephon induced a bscission of mature fruit (Fig. 2B). Although it is possible that an ethylene perception independent pathway leading to responses such as abscission exists in mature citrus fruit, one would have to assume that all receptors were bound by 1 MCP. There was n o attempt in this study to quantify receptor number or binding of 1 MCP to the receptors and the presence or operation of a functional ethylene

PAGE 69

69 signaling independent pathway that participates in citrus abscission cannot be confirmed or discounted. Changes in transcript accumulation of ethylene biosynthe tic and signaling genes were associated with ethylene responses in citrus (Katz et al., 2004), Arabidopsis (Binder et al., 2004), tomato (Wilkinson et al., 1995; Barry et al., 2000), plum (Fernndez Otero et al., 2007), carnation (Tanase et al., 2008), Alstroemeria (Wagstaff et al., 2005), apple (Dal Cin et al., 2005) and peach (Rasori et al., 2002). CsACS1 CsACO CsERS1 and CsETR2 expression in fruit peel, leaf blade and LAZ increased when ethephon was appli ed and was suppressed when 1 MCP was combined with ethephon application. In contrast, expression differed in FAZ. Although CsERS1 and CsETR2 expression was suppressed when 1 MCP was combined with ethephon, expression of the biosynthe tic genes CsACS1 and Cs ACO was only delayed. Moreover, basal ethylene production suppressed gene expression, as application of 1 MCP alone relieved this suppression. Alternatively, saturation of ethylene receptors by 1 MCP may trigger ethylene biosynthe tic gene expression in a f eedback regulatory mechanism (McCollum and Maul, 2007). Since 1 MCP alone increased expression of biosynthe tic genes but did not cause fruit loosening, reduction in FDF was poorly correlated with CsACS1 and CsACO gene expression. Increase in expression of CsERS1 and CsETR2 genes is contradictory to the role of ethylene receptors as negative regulators in the signaling pathway. Though these genes are ethylene responsive, gene expression may not correlate with the actual number of active receptor proteins as reported in tomato (Kevany et al., 2007). Expression of CsCTR1 CsEIN2 CsEIL1 and CsEIL2 remained unchanged due to ethephon treatment. Post transcriptional regulation may play a role in citrus as postulated in tomato and Arabidopsis (Kieber et al., 1993; Leclercq et al., 2002; Gao et al., 2003). Though the mechanism is not clear in CTR1 and EIN2, post transcriptional regulation of

PAGE 70

70 EIN3 and EIN3 like (EIL) protein was described by Guo and Ecker (2003). Degradation of EIN3 protein occurs through an ubiquitin /proteasome pathway mediated by two F box proteins, EBF1 (EIN3 binding F box protein 1) and EBF2. This pathway is inactive in the presence of ethylene resulting in increased accumulation of EIN3 protein. Analyzing the protein expression of CTR1, EIN2 and E ILs could help to explain differential abscission responses in citrus. Taken together, leaves and fruit respond differentially to ethephon and/or 1 MCP. Although differences were seen in timing and intensity of gene expression level s, the most significant differences were measured in ethylene biosynthe tic gene expression in FAZ and LAZ. During the course of this study, it was shown that the timing of ethephon induced abscission associated with the two abscission zones located in leaves were different. Soon after ethephon application in citrus, the leaf blade abscised first, followed days later by the subtending petiole. However, differences in timing of abscission of the blade and petiole could not be attributed to differences in ethylene sensitivity. Althou gh abscission occurred earlier in the LAZ than the petiolar abscission zone when treated with ethylene, the reduction in detachment force at both locations was similar. Since force is directly proportional to mass (force = mass acceleration) and the aver age weights of leaf blade and petiole are 579 mg and 36 mg, respectively, much more downward force was exerted by the leaf blade than by the petiole. The total force exerted by the leaf blade may not be transferred to the petiolar abscission zone due to th e presence of the weakened LAZ. This might have caused earlier abscission of the leaf blade at the LAZ than at the petiolar abscission zone. Further work on quantifying the number of receptors in leaf and fruit tissues and the regeneration capacity of rece ptors would more fully elucidate the basis of this differential abscission response.

PAGE 71

71 Table 3 1. Primer sequences designed using Primer Express software and concentrations used to assess ethylene biosynthe tic and perception gene expression for real time PCR The genes are 1 amino cyclopropane 1 carboxylate synthase 1 ( CsACS1 ) and 2 ( CsACS2 ), 1 amino cyclopropane 1 carboxylate oxidase ( CsACO ), ethylene response sensor 1 ( CsERS1 ), ethylene response 1 ( CsETR1 ), 2 ( CsETR2 ) and 3 ( C sETR3 ), constitutive triple response 1 ( CsCTR1 ), ethylene insensitive 2 ( CsEIN2 ), ethylene insensitive 3 like 1 ( CsEIL1 ) and 2 ( CsEIL2 ), and glyceraldehyde 3 phosphate dehydrogenase ( CsGAPDH ). Gene Forward Primer Reverse Primer Final concentration of each primer (M) CsACS1 TTCGAATCCACTAGGCACAACTT CAACGCTCGTGAACTTAGGAGA 0.5 CsACS2 GATGGCGTTATGGCAAGTGA GAGCAATTTCCATCGTCCGA 0.4 CsACO AAGATGGCCAGTGGATTGATG TCACCGAGGTTGACAACAATG 0.4 CsERS1 TTGTGGACTGACTCACTTCATAAGC ATGACACAAAAGCACAAGCC 0.4 CsETR1 TCGTCAGCAGAATCCTGTTGG GGCCTTAATCTTGCTACTGGACA 0.8 CsETR2 AACTTCGCCCATCCATTGC TCACCGTCAGCTAATAAAACTTGC 0.4 CsETR3 GGCACAATAGCAAAGAAATTAAGGAG CGTGCAAGACCCTGATAGTTAGG 0.3 CsCTR1 GTGGATGGCACCGGAAGTT GAATTTCTCCAAGGTTTTTGCAG 0.4 CsEIN2 GAAAAGGATGATGATGAAGCAGATT GAAGCCGGACCATCAGACAT 0.2 CsEIL1 ACAGAGCAAGAGTAAGGAATGTGTTG TCTTGTGCCCGAGACATCTTC 0.4 CsEIL2 GGGCTGAAGATGAGCCAAACT CATAAGGTGGTTGTTGATTCGGTA 0.5 CsGAPDH GGAAGGTCAAGATCGGAATCAA CGTCCCTCTGCAAGATGACTCT 0.2

PAGE 72

72 Figure 3 1. Percentage of leaf drop (A) and fruit detachment force, FDF in kg force (B) in after treatment with 450 L L 1 MCP of the mean. Where bars are not visible, markers are larger than SE.

PAGE 73

73 Figure 3 2. Ge ne expression of CsACS1 in fruit peel (A), fruit abscission zone (B), leaf blade (C) and leaf abscission zone (D) and expression of CsACO in fruit abscission zone (E) and leaf abscission zone (F) Data represent relative change i n gene expression normalized with respect to T 0 control ( ). Trees were treated with 450 L L 1 Vertical bars through markers represent SE of the mean. Where bars are not visible, markers are large r than SE.

PAGE 74

74 Figure 3 3. Gene expression of CsERS1 in fruit peel (A), fruit abscission zone (B), leaf blade (C) and leaf abscission zone (D) Data represent relative change in gene expression normalized with respect to T 0 control ( ). Trees were treated with 450 L L 1 Vertical bars through markers represent SE of the mean. Where bars are not visible, markers are larger than SE.

PAGE 75

75 Figure 3 4. Gene expression of C sETR2 in fruit peel (A), fruit abscission zone (B), leaf blade (C) and leaf abscission zone (D) Data represent relative change in gene expression normalized with respect to T 0 control ( ). Trees were treated with 450 L L 1 Vertical bars through markers represent SE of the mean. Where bars are not visible, markers are larger than SE.

PAGE 76

76 Figure 3 sweet orange when treated with 5 L L 1 of ethylene for 88 h (A) or 24 h followed by transfer to ethylene free air (B). Detachment force (C) of leaf blade and petiole was measured on organs from potted trees treated as in (B). Time of watering is indicated by and white and black bars indicate light and dark conditions, respectively. Vertical bars through markers represent SE of the mean. Where bars are not visible, markers are larger than SE.

PAGE 77

77 CHAPTER 4 DIURNAL F LUCTUATION OF E THYLENE B IOSYNTHETIC AND S IGNALING G ENE E XPRESSION L EVELS: E O RANGE F RUIT AND L EAF A BSCISSION Introduction Diurnal fluctuations are oscillations or repetitive variations that occur over a period of ~24 h. Such variations are controlled by external cues such as daily changes in light and temperature. Stomatal movement is a typical example of diurnal fluctuation that is affected by light and temperature (Yemm and Willis, 1954). Diurnal fluctuations cease when external cues are removed or held constant. Another type of oscillation is circadian rhythm. Circadian rhythms are endogenously generated and self sustaining over a period of approximately 24 h, and persist under constant environmental conditions such as constant light and dark, or constant temperature. When temperature varies, amplitude of fluctuations is affected, but the presence and period of oscillations do not change. Mimosa leaf movement is a classic example of a circadian rhythm, as movement occurs in constant dark (McClung, 2006). Arabidopsis exhibits numerous circadian rhythms, including the elongation rate of abaxial and adaxial cells of the petiole (Engelmann and Johnsson, 1998; Dowson Day and Millar, 1999) and even transcription. Since many physiological processes are regulated by light and plant hormones, the effect of light on hormone synthesis and action play important roles in regulating such pr ocesses. Diurnal regulation has been reported for auxin production and signaling (Covington and Harmer, 2007; Liao and Burns, unpublished data) and diurnal regulation of hormone levels was reported for ethylene, cytokinin, abscisic acid, gibberellic acid, and in particular, ethylene (Lipe and Morgan, 1973; Cowling and Harberd, 1999; Novkov et al., 2005). Ethylene is a gaseous plant hormone that regulates a number of plant growth and developmental processes such as growth and differentiation of roots and s hoots, formation of adventitious roots, flower opening, fruit

PAGE 78

78 ripening, abscission of leaves and fruit, and senescence (Abeles et al., 1992). Steps involved in ethylene perception and biosynthesis are well documented (Adams and Yang, 1979; Nehring and Eck er, 2004). Diurnal fluctuation of ethylene evolution in plants was initially observed in young fruit of cotton (Lipe and Morgan, 1973), in leaves of Vicia faba (El Beltagy and Hall, 1974) and in leaves of tomato (El Beltagy et al., 1976). Since light might be required for ethylene biosynthesis (Yang, 1968) and low production of ethylene was observed under dark conditions, Lipe and Morgan (1973) speculated that these fluctuations were the result of daily changes in light and temperature. The degree of stomat al opening may be a major diffusion pathway for ethylene, though diurnal fluctuation in the internal ethylene concentration in leaves of Vicia faba did not correlate with the stomatal opening (El Beltagy and Hall, 1974). Studies with constant light or dark growth conditions revealed that ethylene biosynthesis was regulated by the circadian clock and diurnal conditions. Rikin et al. (1984) reported that conversion of the ethylene biosynthesis precursor ACC to ethylene in detached cotton cotyledons was regula ted by light and an earlier step in ethylene biosynthesis was regulated by circadian rhythms. In contrast, Jasoni et al. (2002) showed that synthesis of ACC was directly affected by light and was not regulated by the circadian clock, whereas synthesis of e thylene from ACC was controlled by the circadian clock. This apparent discrepancy could be due to choice of plant material or differences in intact and detached organs; nevertheless, diurnal fluctuations were evident. Abscission is a physiological response regulated by ethylene in citrus (Greenberg et al., 1975; Huberman et al., 1983; Goren, 1993) and fluctuations in ethylene synthesis could play a role in regulating the abscission process. Gene expression levels and enzyme activities of cell wall hydrolase s like cellulase and polygacturonase were induced in abscission zones during

PAGE 79

79 abscission (Burns et al., 1998). Treatment with ethylene triggered the accumulation of cellulase transcripts followed by an increase in cellulase activity in fruit abscission zone s (FAZ) of et al., 2008). Changes in enzyme activities in the ethylene biosynthesis pathway occur during abscission. Increase in ACS and ACO enzyme activities and subsequent increase in ethylene production were observed in abscising tissues. During abscission of grapevine fruitlets, an increase in ACC content and ACO activity occurred, resulting in increased ethylene production (Hilt and Bessis, 2003). Ethylene ind uced abscission of cotton leaves was associated with an increase in ACS and ACO activities (Mishra et al., 2008). Gene expression levels of CsACS1 and CsACO but not CsACS2 were induced by ethephon (an ethylene releasing abscission agent) in citrus FAZ (Yua n et al., 2005). Hence abscission is closely correlated with changes in the gene expression and enzyme activities in ethylene biosynthesis pathway. Research on daily changes in fruit detachment force (FDF) in citrus mature fruit suggests that abscission ma y be diurnally regulated (Pozo et al. 2007). Changes in FDF, fruit drop, and leaf drop were greater when abscission agents were applied in mid day when compared to morning or evening hours (Pozo et al., 2007; Malladi and Burns, 2008), suggesting diurnal co ntrol. Little information is available, however, on diurnal fluctuation of ethylene biosynthetic and signaling gene transcription that may underpin daily abscission changes and alter efficacy of abscission agents. In this report, diurnal fluctuation of tra nscript accumulation of genes involved in ethylene biosynthesis and signaling pathways was analyzed in leaf blades, LAZ, fruit peel and FAZ. Knowledge of such fluctuations may lead to better abscission compound application timing in agricultural systems to improve management of the response. We hypothesized that diurnal

PAGE 80

80 fluctuation in ethylene signaling and biosynthetic gene expression could play a role in ethylene sensitivity and response to abscission agents during different times of the day. Materials an d Methods Diurnal Fluctuation in Leaf Blades, Leaf Abscission Zones, Fruit Peel and Fruit Abscission Zones Citrus sinensis from an experimental grove located at the Citrus Research a nd Education Center, Lake Alfred, FL. There were four replications and one tree was used for each replication. Samples of leaf blade, LAZ, fruit peel and FAZ were collected from random canopy locations every 4 h for 2 d. Solar radiation data was obtained f rom Florida Automated Weather Network (FAWN; http://fawn.ifas.ufl.edu/). Solar radiation was measurable from dawn at 5:45 am until the end of dusk at 7:15 pm. Leaf blade and LAZ were collected from 10 leaves/replicate at each sampling time. Mid section of the leaf blade was used and LAZ were excised using a razor blade as described (Yuan et al., 2005). Fruit peel and FAZ were collected from four fruit/replicate. Fruit flavedo was removed from the equatorial area of each fruit using a potato peeler. FAZ were removed from fruit using a 1 cm diameter cork borer. The pedicel, calyx and albedo surrounding the abscission zone were trimmed away using a razor blade, leaving approximately the 4 mm thick FAZ intact. Tissues were frozen in liquid nitrogen immediately a fter sampling and stored at 80 C until needed. Light and Dark Studies in the Growth Room Fluctuation of gene expression in leaf blade was studied in 7 trees placed in growth room at 25/19 C temperature with 12h/12h light and d ark cycles (light: 6 am to 6 pm; dark: 6 pm to 6 am). Light intensity in the growth room was 230 260 mol m 2 s 1

PAGE 81

81 After 1 week of entrainment of potted trees under these conditions, the start of light cycle at 6 am was considered as T 0 and sampling was do ne every 4 h for 2 d starting at 9 am. There were four replicates and samples were collected randomly from two potted trees per replication. To determine the effect of light on fluctuations in gene expression, 7 year old potted ned in the growth room for 1 week under conditions mentioned above, except that temperature was maintained at a constant 24 C. After the entrainment period, trees were transferred to constant light or dark conditions at 6 pm (T 0 ) and kept at 24 C for the duration of the experiment. There were four replicates and samples were collected randomly from two potted trees per replication. Leaf blade samples were collected as described above from each replicate every 4 h for 2 d starting from 10 pm after transfer to constant light or dark conditions. Two samples were collected 2 and 8 h prior to transfer to constant light or dark. Diurnal Effects on Abscission Agent Efficacy in the Field above. Trees were sprayed until run off with 450 L L 1 of ethephon at 8 am, 2 pm, 8 pm or 2 am using a motorized backpack sprayer. Control trees were sprayed with water an d four trees were used for each treatment. Leaf drop and fruit detachment force were measured every 24 h after application for up to 4 d. Ten branches (each with about 100 leaves; approximately 1 year old) per treatment were tagged randomly from four trees and each branch was used as a replicate to follow leaf drop. Leaf count was taken on these branches and percentage of leaf drop was calculated. FDF was measured on five fruit/replication with 4 replicates using Force One digital force gauge (Wagner Instru ments, Greenwich, CT). Analysis of variance (ANOVA) was performed using Statistical Analysis System (version 9.1; SAS Institute Inc., Cary, NC) and

PAGE 82

82 Diurnal Effects on Abscission Agent Efficacy at Co nstant Temperature year old) were kept in a growth room at constant temperature (25 C) with 12h/12h light and dark cycles (light: 6 am to 6 pm and dark: 6 pm to 6 am). Trees were entrained under growth room conditions for 1 week and subsequently sprayed until run off with 450 L L 1 of ethephon at 8 am, 2 pm, 8 pm and 2 am. Control trees were sprayed with water and one potted tree was used for each treatment. Four branches (each with about 50 leaves; approximately 1 year old) per treatment were randomly selected and each branch was used as a replicate to follow leaf drop. Leaf count was taken every 24 h after application for up to 4 d and percentage of leaf drop was calculated. Statistical analysis was performed as described above RNA Extraction and Gene Expression RNA was extracted from 0.5 g of flavedo, 0.5 g of leaf blade, 4 FAZ (approximately 0.3 g) and 10 LAZ (approximately 0.2 g). The tissue was ground into fine powder and suspended in 1 mL TRI Reagent (Molecular Research Ce nter, Cincinnati, OH). Chloroform (200 L) was added and the mixture vortexed thoroughly. The samples were incubated on ice for 15 min and centrifuged at 20,000 g for 15 min at 4 C. RNA was extracted from the aqueous fraction using RNeasy mini kit (Qiagen Valencia, CA). First strand cDNA was synthesized from 1 g of RNA Primers for real time PCR (Table 3 1; ATGGAACATCGGCAACAGAAGT GTAACTGAGCTTCACATCCTCCAA PG GGAAGATTGCCGCCTAACC TCCGCCCACTAGATCAACATG Cel a1 ) were designed by using the software Primer Express 3.0 (Applied Biosystems, Foster City, CA). Gene expression was analyzed using Real Time PCR (model 7500 Fast Real Time PCR System, Applied Biosystems, Foster City, CA) using 2x SYBR Green PCR Master Mix sold by the manufacturer of the instrument. One microliter of cDNA was used in a 20 L reaction. Glyceraldehyde 3 ph osphate dehydrogenase

PAGE 83

83 ( CsGAPDH ) was used as a constitutively expressed gene to normalize differences in concentration of template that may have occurred in each replicate. Relative gene expression was calculated using comparative C T (threshold cycle) metho d (Livak and Schmittgen, 2001). For each sample, the C T value for the gene of interest was subtracted from the C T value of CsGAPDH T 0 control replicate from the treatments at each time point. The relative gene expression was calculated by the formula 2 Standard error of the mean was calculated from the four biological replicates. Results Diurnal Fluctuation of Ethylene Biosynthetic Genes In the field, diurn al fluctuations with a period of approximately 24 h were measured in all ethylene biosynthetic gene expression examined and in most tissues. Diurnal fluctuation of CsACS1 expression was evident in leaf blade (Fig. 4 1). In leaf blade, phase of peak express ion occurred 12 to 16 h after the start of dawn or light period (6 pm to 10 pm) and the phase of minimum expression occurred 11 to 15 h after dusk or dark period (6 am to 10 am), although this was somewhat variable. During the second 24 h of measurement, L AZ had two peaks of expression. In FAZ, a small but noticeable phase occurred in the first 24 h and a stronger phase was measured in the second phase. No CsACS1 expression was detected in fruit peel. CsACS2 expression fluctuated in all the 4 tissues examin ed (Fig. 4 2). The 3 to 4 fold change in amplitude was similar in all four tissues, but the phase and periods were not consistent within the 48 h measurement time and between tissues. In leaf blade, one peak was noticed during the first phase while two pe aks were noticed during the second. Fluctuation of CsACO was evident in leaf blade but phase and period inconsistencies were noted (Fig. 4 3). Although marked changes in CsACO expression were noticed in fruit peel no rhythmic pattern of fluctuation was obs erved.

PAGE 84

84 CsACO expression was low and diurnal patterns were not discernable in LAZ and FAZ. In general, when fluctuations occurred, the three biosynthetic genes increased in expression during the day and reached maximum at the end of the day and declined dur ing the night, reaching a minimum value in the morning. Similar to field samples, CsACS2 and CsACO fluctuated diurnally with a period of approximately 24 h in leaf blades collected from potted trees grown in the growth room (Fig. 4 2 and 4 3). However, the phase of peak and minimum expression was delayed. For both genes, the phase of maximum expression was measured 3 h after the start of the dark cycle and the phase of minimum expression was measured 3 to 7 h after the start of the light cycle. No expressio n was detected for CsACS1 in leaf blades from growth room studies. Diurnal Fluctuation of Ethylene Receptor and Signaling Genes Receptors Diurnal fluctuation in all tissues examined was more consistent in CsETR3 than in CsERS1 CsETR1 and CsETR2 Fluctuat ion in CsETR3 had higher amplitude than other receptor genes. All four tissues studied fluctuated with a period of 24 h and the phase of peak gene expression occurred 12 h after start of dawn (6 pm; Fig. 4 4). Fluctuations in CsERS1 occurred in LAZ and FAZ with a period of 24 28 h with expressions generally lower during the day and higher during the night (Fig. 4 5). Although gene expression in leaf blade was lower at day and higher at night during the first 24 h measurement period, changes were inconsistent during the second phase. No change in CsERS1 expression was observed in fruit peel over the 48 h measurement period. Diurnal fluctuations were evident in leaf blade, LAZ and FAZ but not in fruit peel for CsETR1 expression (Fig. 4 6). The phase and period were inconsistent in leaf blade during the 48 h period. However, in LAZ and FAZ the phase and period were consistent, with phase of peak expression occurring 3 to 7 h after dusk (10 pm to 2 am). In leaf blade and fruit

PAGE 85

85 peel, CsETR2 expression was higher during night and lower during day, but phase and period were not consistent (Fig. 4 7). In LAZ and FAZ, fluctuation occurred with 24 h period but amplitude varied between the two oscillations. Similar to field observations in leaf bl ade, diurnal fluctuation was noticed in expression of CsETR2 and CsETR3 but not in CsERS1 in leaf blade from potted trees grown in the growth room. Although CsETR1 fluctuated in leaf blades collected from field grown trees, no fluctuation was observed in leaf blades from trees grown in the growth room. The amplitude and phase of CsETR3 fluctuation were similar in field and growth room studies, while the phase of CsETR2 expression was delayed by 7 h in leaf blades collected from the growth room as compared to those collected from field grown trees. In general, the expression levels of CsERS1 CsETR1 and CsETR2 were lower during middle of the light period and reached a maximum level during the middle of the dark period. But CsETR3 expression was minimum at th e start of the light period and gradually increased during the day after which expression started to decline during the night. So CsETR3 not only fluctuated the most among the receptors, but also had a unique pattern compared to the other receptors. Downst ream signaling elements Fluctuation of CsCTR1 (Fig. 4 8) expression was more prominent in leaf (blade and LAZ) than in fruit tissues (peel and FAZ). In leaf blade and LAZ, fluctuation occurred with an approximate period of 24 h and an amplitude of 3 to 5 fold change. The phase of peak expression occurred 12 h after start of dawn (6 pm) and decreased gradually during the night. In peel, changes in CsCTR1 expression were small, nevertheless, the changes followed a similar trend as in leaf tissues. Fluctuatio ns in FAZ expression were low and the phase broad during the first period and were more prominent in the second period, with phase occurring 12 h after start

PAGE 86

86 of dawn (6 pm). Fluctuation of CsEIL1 expression was more evident in LAZ than in other tissues (Fi g. 4 9). The amplitude of fluctuation was 2 fold change with expression increasing during the day and decreasing during the night. CsEIL1 expression was low and variable in leaf blade. Expression appeared to fluctuate diurnally in fruit peel and FAZ with small changes in expression. Fluctuation of CsEIL2 was observed in all four tissues examined with an approximate period of 24 h (Fig. 4 10). The phase of peak expression occurred 3 or 7 h after dusk (10 pm or 2 am). None of the tissues examined exhibited d iurnal fluctuation of CsEIN2 expression (Fig. B 1). In leaf blades collected from trees grown in the growth room, diurnal fluctuation was observed in CsCTR1 CsEIL1 and CsEIL2 but not in CsEIN2 (Fig. 4 8, 4 9, 4 10 and B 1). Although CsEIL1 did not fluctua te in leaf blades collected from field grown trees, fluctuations were observed in those collected from potted trees in the growth room. All three genes fluctuated with amplitude of 2 to 3 fold change with phase of peak expression occurring 1 h before or 3 h after the start of the dark cycle. Overall, expression of CsCTR1 CsEIL1 and CsEIL2 fluctuated diurnally with expression increasing during the day and reaching a maximum at the end of the light period. Diurnal Fluctuation of Cel a1 and PG The expressio n levels for CsPG and CsCel a1 were studied only in the abscission zones (Fig. 4 11). Expression of CsCel a1 fluctuated diurnally, with the amplitude greater in the second period. Although CsPG expression in FAZ fluctuated during the first period, expressi on was erratic during the second period. Diurnal fluctuation was noted in LAZ, but period and amplitude were low and variable.

PAGE 87

87 Constant Light or Dark Studies in the Growth Room To study the influence of light on diurnal fluctuation, gene expression was stu died in leaf blades of plants grown under constant light or constant dark conditions. Gene expression was monitored for CsACS2 CsACO CsETR2 CsETR3 CsCTR1 CsEIL1 and CsEIL2 that showed distinct diurnal patterns in 12 h day/night cycles reported above. Loss of period, amplitude or phase was noted in all gene expression levels examined in constant light or dark conditions (Fig 4 12 and 4 13). Expression of CsACS2 did not fluct uate in either constant light or constant dark conditions. In constant light, CsACO expression fluctuated without consistent period and phase, but in constant dark, expression was dampened. Similar patterns were measured for CsETR2 CsETR3 (Fig 4 12), CsCT R1 CsEIL1 and CsEIL2 (Fig 4 13) expression. Diurnal Effects on Abscission Agent Efficacy in the Field Efficacy of ethephon application at different times of the day was studied. After 4 d of ethephon application, percentage of leaf drop was maximum (86%) when applied at 2 pm and was least (32%) when applied at 2 am (Fig. 4 14A and 4 15). When application was done at 8 am or 8 pm, leaf drop was at intermediate levels with 43% or 59%, respectively, after 4 d of application. FDF was also least when applicatio n was done at 2 pm followed by 8 pm and maximum at 8 am and 2 am (Fig 4 14B). After 4 d of application, FDF was reduced to 41%, 50%, 77% or 78% of control when ethephon was applied at 2 pm, 8 pm, 8 am or 2 am, respectively. Hence, maximum efficacy was achi eved when ethephon was applied at 2 pm. Diurnal Effects on Abscission Agent Efficacy at Constant Temperature To test if the differences in abscission efficiency were due to differences in temperature at the time of application, ethephon was applied on potted trees grown in the growth room maintained at constant temperature (25 C). Similar to field application, p ercentage of leaf drop was maximum when application was done at 2 pm and was minimum at 2 am (Table 4 1).

PAGE 88

88 Hence, differences in efficacy of the abscission agent were not attributed to the differences in temperature alone at the time of application. However the amount of leaf abscission was much lower in growth room studies and could have been due to differences in age of trees, lower temperature and lower light intensity in the growth room. Discussion Diurnal fluctuation of gene expression was observed in most of the genes analyzed in at least one of the tissues tested. All three biosynthetic genes studied increased in expression during the day and decreased during the night, although their patterns were variable within and between tissues. Increased expres sion of ethylene biosynthetic genes corresponded with increase in ethylene production measured in citrus leaves (Malladi and Burns, unpublished work). Similar correlation between biosynthetic gene expression and ethylene production was reported in Arabidop sis (Thain et al., 2004). Similar to ethylene, fluctuations in transcripts involved in auxin biosynthesis and signaling have been reported and these fluctuations could regulate fluctuation of auxin content (Jouve et al., 1999; Covington and Harmer, 2007). The circadian clock regulated fluctuations in auxin biosynthetic and signaling gene expression. Unlike auxin, expression of citrus ethylene biosynthetic and signaling genes were highly regulated by light as revealed by constant light or dark studies. Light and clock regulated elements were identified in the promoter regions of several genes (Folta and Kaufman, 1999; Harmer et al., 2000; Hudson and Quail, 2003; Chatterjee et al., 2006; Liao and Burns, 2010). Presence of one or more of these elements in prom oter regions of ethylene biosynthetic and signaling genes could regulate fluctuations of these gene expression levels. Apart from light and circadian regulated elements, fluctuation in ethylene biosynthesis could have a direct effect on the changes in exp ression of the ethylene receptor genes. Exogenous ethylene treatment induced receptor gene expression as early as 6 h after ethylene

PAGE 89

89 application (Chapter 3, Ciardi et al., 2000; Binder et al., 2004). The diurnal rise and fall measured in ethylene biosynthe tic gene expression preceded that of four ethylene receptors, suggesting that fluctuations in ethylene biosynthesis could have a direct effect on the fluctuations of ethylene receptor gene expression levels by changing internal ethylene concentrations. The rise and fall in gene expression suggests that the diurnal pattern is regulated by transcription rate and transcript degradation. Posttranscriptional degradation of mRNAs occurs through gene silencing mediated by micro RNA (Bartel 2004). In Arabidopsis mi cro RNAs were identified to target several mRNAs, and one micro RNA, miR407a targeted ACO (Sunkar and Zhu, 2004). Such a mechanism could exist in citrus that results in a diurnal pattern of ethylene biosynthetic and signaling gene expression. To test if fl uctuations were diurnal or regulated by the circadian clock, gene expression levels were studied in potted trees grown under continuous light or dark conditions. Though CsACO fluctuated under constant light conditions, the resulting erratic phase and perio d, and declining amplitude suggested that fluctuation would have disappeared over an extended period of time. Lack of fluctuation and rapid decline in expression under constant dark indicate that CsACS2 and CsACO expression were tightly regulated by light. This is in contrast to the observations in cotton where fluctuations were regulated by both diurnal and circadian clocks (Rikin et al., 1984; Jasoni et al., 2002). The primary regulating mechanism of diurnal changes in gene expression appears to be specie s specific. CsACS1 expression was undetectable in leaf blade tissues sampled for growth room studies, perhaps due to lower light intensity compared with field conditions. Thus, CsACS1 expression was excluded for growth room studies under constant light or dark conditions.

PAGE 90

90 Similar to biosynthetic genes, changes in expression of ethylene receptors and signaling genes were highly regulated by light. Constant light or dark studies were not done for CsERS1 CsETR1 and CsEIN2 as their gene expression levels did n ot fluctuate in leaf blade samples collected from growth chamber studies conducted at 12h/12h light and dark cycles. Light played a major role in changes of CsETR2 CsCTR1 CsEIL1 and CsEIL2 expression since no fluctuation was noted under constant light or dark conditions. CsETR3 fluctuated under constant dark conditions, but amplitude decreased over time indicating that light is required for the expression of CsETR3 In conclusion, the period and phase of all genes analyzed under constant light or dark con ditions were disrupted, indicating that their transcription was not governed directly by the circadian clock. Rather, light played a major role in the oscillation of transcription. Light and temperature effects on diurnal fluctuations could not be separate d since temperature was also held constant during continuous light or dark treatments. The function of ethylene fluctuation on ethylene regulated processes has not been conclusively determined. The importance of fluctuation in auxin biosynthesis and signa ling was demonstrated by microarray analysis. More than 50% of auxin responsive genes fluctuated rhythmically (Covington and Harmer, 2007). Studies were attempted to correlate ethylene fluctuation with hypocotyl elongation and changes in leaf angle (Dowson Day and Millar, 1999; Thain et al., 2004). Maximum ethylene production preceded peak hypocotyl elongation and increase in leaf angle by 4 6 h. This delay could be due to difference in the time to respond after ethylene perception. Abscission is another ph ysiological process that is tightly regulated by ethylene. Ethylene enhances dissolution of cell walls in abscission zones by stimulating the activities of cellulase and polygalacturonase, subsequently leading to detachment of plant parts ( Greenberg et al. 1975; Huberman and Goren, 1979 ). Pozo et al. (2007) reported natural

PAGE 91

91 fluctuations in citrus FDF during the day, with FDF reaching a maximum at 8 am and minimum at 2 to 5 pm. This fluctuation could be a consequence of the natural fluctuation in ethylene bi osynthesis. Since ethylene receptor proteins are rapidly degraded in the presence of ethylene (Kevany et al., 2007), increase in ethylene biosynthesis could result in receptor protein degradation leading to increased ethylene sensitivity. This subsequently could lead to an increase in cellulase gene expression whose peak occurred at 10 pm. Peak cellulase gene expression did not coincide with minimal FDF, indicating a delay in gene expression and protein synthesis and subsequent enzyme activity followed by c ell wall degradation. Since expression of ethylene biosynthetic and signaling genes changed during different times of the day, sensitivity to the ethylene releasing abscission agent ethephon could vary depending on the time of application. Differential re sponse to exogenous auxin application due to differences in timing of application has been reported in Arabidopsis (Covington and Harmer, 2007). Induction of hypocotyl elongation was greatest when exogenous auxin was applied during the night, however natur al elongation reached a peak during the day. In contrast, maximum response to abscission agents occurred when it was applied at times when natural FDF was lowest in citrus (Pozo et al., 2007). At 2 pm, ethylene biosynthetic gene expression was increasing, likely leading to synthesis of active protein. Increased ethylene could lead to the degradation of ethylene receptor proteins and increased ethylene sensitivity. Similar correlation between time of application and gene expression was reported for phospholi pase gene CsPLD 1 in citrus, where efficacy of abscission agent was higher when it was applied at the time of maximum gene expression (Malladi and Burns, 2008).

PAGE 92

92 Ethephon has been reported to be more effective at higher temperatures (Bukovac et al., 1969) and the increased effect of ethephon could be a direct effect of higher temperature during mid day. Studies conducted in the growth rooms maintained at constant temperature revealed that temperature alone does not play a role in increased efficacy during m id day application. Although air temperature in growth room was maintained constant, changes in leaf temperature could have occurred since light intensity was directly proportional to changes in leaf temperature (Ansari and Loomis, 1959; Cook et al., 1964; Pallas et al., 1967). If leaf temperature was increasing from the start of the light cycle, it could have enhanced the effect of ethephon, thus resulting in increased response during mid day. Similarly, after the end of the light period the leaf temperatu re could have decreased, thus resulting in lower efficacy of ethephon when applied during the dark period. Overall, expression of several genes involved in ethylene biosynthesis and signaling pathways fluctuated diurnally in many of the tissues examined in this work. Actively increasing ethylene biosynthesis during mid day could lead to enhanced ethephon sensitivity and maximum efficacy of abscission agents could be achieved by application during mid day.

PAGE 93

93 Table 4 room at constant temperature (25 C). Ethephon (450 L L 1 ) was applied at 8 am, 2 pm, 8 pm and 2 am. Values within each column followed by different letters are Treatment Days after treatment 0 1 2 3 4 Control 0.00 0.00 a 0.00 b 0.00 b 0.00 b Ethephon 8am 0.00 0.00 a 1.72 ab 8.29 ab 11.73 ab Ethephon 2pm 0.00 0.58 a 4.38 a 15.79 a 21.19 a Ethephon 8pm 0.00 0.00 a 0.00 b 2.43 ab 2.43 b Ethephon 2am 0.00 0.00 a 0.00 b 0.00 b 0.00 b

PAGE 94

94 Figure 4 1. Fluctuations in gene expression of CsACS1 the field. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 95

95 Figur e 4 2. Fluctuations in gene expression of CsACS2 grown in the field and the growth room. Time 0 represents the start of the fir st light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approxi mate start, stop and duration of light and dark conditions, respectively.

PAGE 96

96 Figure 4 3. Fluctuations in gene expression of CsACO ge grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not v isible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 97

97 Figure 4 4. Fluctuations in gene expression of CsETR3 grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 98

98 Figure 4 5. Fluctuations in gene expression of CsERS1 grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white a nd black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 99

99 Figure 4 6. Fluctuations in gene expression of CsETR1 grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent S E of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 100

100 Figure 4 7. Fluctuations in gene expression of CsETR2 in leaf b grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene ex pression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions respectively.

PAGE 101

101 Figure 4 8. Fluctuations in gene expression of CsCTR1 orange grown in the field and the growth room. Time 0 represe nts the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black b ars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 102

102 Figure 4 9. Fluctuations in gene expression of CsEIL1 grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the m ean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 103

103 Figure 4 10. Fluctuations in gene expression of CsEIL2 leaf abscission zone orange grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respect ively.

PAGE 104

104 Figure 4 11. Fluctuations in gene expression of CsCel a1 and CsPG field. Time 0 represents the start of the first light cycle. Data repr esents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and dura tion of light and dark conditions, respectively.

PAGE 105

105 Figure 4 12. Fluctuations in gene expression of CsACS2 CsACO CsETR2 CsETR3 room under constant light or cons tant dark condition. Time 0 represents the start of constant light or dark period. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbol s are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 106

106 Figure 4 13. Fluctuations in gene expression of CsCTR1 CsEIL1 CsEIL2 constant light or constant dark condition. Time 0 represents the start of constant light or dark period. Data represents relative change in gene expression with respec t to first sampling. Vertical bars through symbols represent SE of the mean. Where bars are not visible, symbols are larger than SE The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 107

107 Figure 4 14. Percentage of leaf drop (A) and fruit detachment force (percent of control; B) in L L 1 SE of the mean. Where bars are not visible, symbols are larger than SE

PAGE 108

108 8 am Spray 2 pm Spray 8 pm Spray 2 am Spray Figure 4 L L 1 ethephon application at 4 times of the day.

PAGE 109

109 CHAPTER 5 DEGREENING B IS C ORRELATED WITH D IFFERENTIAL E XPRESSION OF E THYLENE S IGNALING AND B IOSYNTHE TIC G ENES Introduction Degreening in citrus is a postharvest treatment during which fruit are exposed to ethylene response of harvested fruit to ethylene application. Under cool nights (<12.5 C) ethylene production is triggered (Grierson et al., 1986), resulting in chlorophyll degradation and unmasking and/or synthesis of other natural pigments. Early season fruit in Florida are not subjected to c ool nights and they remain green or partially green in color, while the internal quality defined as the ratio of soluble solids (Brix) to % acid, has reached acceptable maturity standards for marketing. To enhance marketability, application of exogenous e thylene is required to degreen the fruit. The response of citrus fruit to ethylene varies between cultivars. Though differences in response between most fruit are minor, some citrus types show extreme responses. Kitagawa et al. (1978) reported differences in degreening effectiveness in seven citrus cultivars. When treated with 1 L L 1 ethylene for 15 h, Satsuma mandarin had the highest chlorophyll loss followed by treatment, fruit continued to change color even after 1 d of ethylene free conditions, but color Petracek and change continued in ethylene free storage. For the first 6 h of ethylene treatment, fruit were

PAGE 110

110 similar in color to control fruit but after 8 d in e thylene free storage, treated fruit were completely degreened. Chlorophyllase is the first enzyme in chlorophyll degradation which converts chlorophyll a and b to chlorophyllide a and b, respectively. Increased chlorophyllase activity during degreening of citrus fruit was reported in several studies (Shimokawa et al., 1978; Purvis and Barmore, 1981; Amir Shapira et al., 1987; Trebitsh et al., 1993). Application of 1 MCP (an ethylene perception inhibitor) was shown to inhibit or delay chlorophyll loss during degreening (Goldschmidt et al., 1993; Porat et al., 1999; McCollum and Maul, 2007), suggesting ethylene 80 L L 1 ethylene, chlorophyllase activity increased 5 and 12 fold after 24 h and 72 h of ethylene treatment, respectively (Trebitsh et al., 1993). Synthesis of chlorophyllase protein was observed after 24 h of ethylene treatment, whereas no chlorophyllase protein was detected for up to 7 d in fruit not expo sed to ethylene, indicating that exogenous ethylene plays an important role in triggering chlorophyllase gene expression and protein synthesis. Although increased chlorophyllase activity varied among different citrus species; 18 fold in Citrus unshiu (Shim okawa et al., 1978), 3 fold in calamondin (Purvis and Barmore, 1981), 4 fold in Citrus reticulata (Amir Shapira et al., 1987) and 5 fold in Citrus sinensis cv. Valencia (Trebitsh et al., 1993), differential induction of chlorophyllase between citrus specie s could not be compared because of the varied concentrations and durations of ethylene treatment used in reported studies. However, differential ethylene induced degradation of chlorophyll content in seven cultivars under the same degreening conditions (Ki tagawa et al., 1978) suggested that chlorophyllase enzyme synthesis and/or activity respond to ethylene differentially in different cultivars.

PAGE 111

111 Little is known about the basis of differential ethylene sensitivity between citrus species or cultivars during d egreening. Differences in ethylene sensitivity were observed between young L L 1 ) application induced expression of ACS1 (1 amino cyclopropane 1 carboxylate synth ase 1), ACO1 (1 amino cyclopropane 1 carboxylate oxidase 1) and ERS1 (ethylene response sensor 1) genes in detached young fruitlets but not in detached mature fruit, indicating a decrease in ethylene sensitivity during fruit maturation. Differential ethyle ne sensitivity between cultivars was observed in chrysanthemum flowers (Narumi et al., 2005) and muskmelon fruit (Sato Nara et al., 1999). We hypothesized that differential expression of ethylene biosynthe tic or perception genes is correlated with differen ces in rate and amount of degreening between citrus species or cultivars. In this study, two citrus types with disparate degreening behavior were selected. tangerine d oes not respond or responds poorly. We show differences in peel maturity between biosynthe tic and perception genes. Materials and M ethods Plant Material and Seedling Triple Response 15 150; [ Citrus reticulata cv. Clementine x ( C. reticulata cv. Dancy x C. paradisi cv. Duncan)] x [ C. reticulata cv. Dancy x C. paradisi cv. Duncan]) fruit (Bower citrus hybrid [ C. reticulata Blanco x ( C. reticulata Blanco x C. paradisi [purported C. reticulata Blanco x C. sinensis ]) fruit were harvested from groves at the Citrus Research and Education Center (Lake Alfred, FL). For citrus seedling triple response assays,

PAGE 112

112 for 15 min and rin sed with sterile distilled water. Seeds were germinated on Murashige and Skoog medium (Murashige and Skoog, 1962) with 0.8% agar in polycarbonate boxes (Magenta vessel, Sigma Aldrich, St. Louis, MO). The seeds in boxes were transferred to chambers maintain ed at a concentration of 10 L L 1 of ethylene at 271 C under dark conditions. Control seeds were germinated in ethylene free air held under the same conditions. Root and shoot lengths were measured on seedlings 18 d after sowing. Fruit were harvested on three dates (early [Oct. 3, 2007], mid [Oct. 24, 2007] and late two dates (early [Oct. 3, 2007] and mid season [Oct. 24, 2007], designated Harvest I and II, abscised and no fruit remained o n the tree, dates were selected based on marketable Brix/% citr ic acid juice ratio and color break (the appearance of orange color on the peel), the optimal being that of Harvest II (Table 5 1). The shape (224 pieces) were harvested at random canopy locations from 6 and 5 trees, respective ly, at each harvest stage and transported to the Citrus Research and Education Center, Lake Alfred, FL. Juice ratio and peel color were measured in 24 randomly selected fruit separated into 6 fruit/replication. The remaining fruit were randomly assigned to 4 replications of 25 fruit each for control and ethylene treatments. Total soluble solids (Brix) were measured using a Hand Held Refractometer (Fisher Scientific, Pittsburgh, PA) and titratable acidity (% citric acid) was measured by titrating juice samp les with NaOH using phenolphthalein as indicator (Boland,

PAGE 113

113 1990). Peel color at equidistant locations along the fruit equator, was measured in CIELAB color space (L*, a* and b*) using Chroma Meter CR 400 (Konica Minolta Sensing, Inc., Japan) and expressed a s a*/b* ratio. Measurements were averaged for each replicate fruit. Ethylene Treatment Fruit were treated with 50.5 L L 1 ethylene for 24 h at 270.04 C. After 24 h, ethylene treated fruit were transferred to ethylene free storage at 270.06 C for 1 week. Control fruit were stored in ethylene free air at 270.04 C for the duration of the study. Peel color measurements as described above were taken immediately after harvest and ethylene treatment, and every 24 h after ethylene treatment for 7 d on 10 fruit/replication. No decay developed during this storage period. Flavedo from the fruit equator region was collected from 1 fruit/replication using a potato peeler and tissue frozen immediately in liquid nitrogen and stored at 80 C until needed. RNA Extraction and Analysis of Gene Expression RNA was extracted from 0.5 g of flavedo for each replicate. The tissue was ground int o fine powder and suspended in 1 mL TRI Reagent (Molecular Research Center, Cincinnati, OH) Chloroform (200 L) was added and the mixture vortexed thoroughly. Samples were incubated on ice for 15 min and centrifuged at 20,000 g for 15 min at 4 C. RNA was extracted from the supernatant (RNeasy mini kit, Qiagen, Valencia, CA) and quantified by spectrometry (NanoDrop ND 1000 Spectrophotometer, Wilmington, DE). First strand cDNA was synthesized from 1 g of RNA using SuperScript III Reverse Transcriptase (Inv itrogen, Carlsbad, CA). Primers for gene expression analysis (Table 3 ATCCTCACCACCTCCTCCAAA GTTGCTGAGAGAAGTGCCATGA designed using the software Primer Express 3.0 (Applied Biosystems, Foster Ci ty, CA). Gene expression was analyzed using Real Time PCR (model 7500 Fast Real Time PCR System,

PAGE 114

114 Applied Biosystems, Foster City, CA) with the 2x SYBR Green PCR Master Mix. One L cDNA was used in a 20 L reaction. The constitutively expressed glyceraldehy de 3 phosphate dehydrogenase (GAPDH) was used to compensate for any template concentration differences that may have occurred between replicates. Relative gene expression was calculated using the comparative C T method. For each sample, the C T (threshold cycle) value for the gene of interest was subtracted from the C T T T T of the one T 0 control replicate with the value closest to the mean T 0 T of all individual rep lications at each time point. The relative gene expression was calculated by the formula 2 Chlorophyll Extraction and Analysis Chlorophyll extraction was performed following the method of Mackinney (1941). Flavedo tissue (0.25 g) was ground into fin e powder using liquid nitrogen. Chlorophyll was extracted by grinding the powdered tissue with 10 mL of 80% (v/v) acetone. Absorbance was measured at 663 nm and 645 nm using a SmartSpec 3000 spectrophotometer (Bio Rad, Hercules, CA). Total chlorophyll cont ent was calculated using the absorbance values. ACC and MACC Extraction and Analysis For ACC (1 amino cyclopropane 1 carboxylic acid) extraction, 1 g peel tissue from each replicate was ground to a fine powder in liquid nitrogen. Ethanol (7.5 mL of 80%, v/ v) was added to the powdered tissue and was incubated at 65 C for 15 min. The homogenate was centrifuged at 6,000 g for 20 min and the supernatant collected. The residue was re extracted with 7.5 mL of 80% ethanol at 65 C for 15 min. The supernatants wer e combined and dried under vacuum. The dried pellet was dissolved in equal volumes of water and chloroform (900 L each). After centrifugation, 850 L of aqueous phase was collected. MACC (malonyl ACC)

PAGE 115

115 extraction was performed in a similar method, but the dried pellet was dissolved in 300 L each of water and chloroform and 250 L of the aqueous phase was collected after centrifugation. Hydrolysis of MACC to ACC was achieved by adding 400 L of 6 N HCl at 100 C for 1 h. After hydrolysis, 250 L NaOH (13.25 N) was added. Estimation of ACC and MACC contents was accomplished using the method of Lizada and Yang (1979). In brief, the extracts were taken in 12 x 75 mm test tubes, 100 L of HgCl 2 (10 mM) was added, and tubes were sealed with a rubber stopper. Abou t 100 L of cold mixture of 5% NaOCl (v/v; 50 L) and saturated NaOH (2:1, v/v; 50 L) was injected into the tubes. Tubes were vortexed and kept in ice for 2.5 min. One mL of headspace gas was withdrawn for ethylene measurement. The actual amount of ACC wa s calculated from a standard curve constructed with known concentrations of ACC. ACC Aldrich, St. Louis, MO. Measurement of Ethylene Production Rate of ethylene production was measured in a closed system. Fruit were co llected the following season at three developmental stages (Sep. 25, 2008, Oct. 28, 2008 and Dec. 16, 2008) with juice quality and peel color similar to the previous season (Table 5 1). Fruit (25 pieces) of similar size and shape were harvested at random f measured, and then fruit were sealed in a 750 mL Rubbermaid container for 3 4 h at room temperature. Ethylene production was measured by injecting 1 mL of headspace gas from each container separately into a HP 5890 series II gas chromatograph (Hewlett Packard Company, Atlanta, GA) equipped with an activated alumina column and a flame ionization detector. Rate of ethylene pro duction was calculated using the formula:

PAGE 116

116 L C 2 H 4 kg 1 h 1 = [L L 1 C 2 H 4 void volume (mL)]/[sample weight (kg) sealed time (h) 1000] Results Seedling Triple Response and Sequence Comparison To determine if ethylene perception was impaired, the seedlings germinated in ethylene had short thick roots and shoots, and apical hooks were exaggerated, whereas seedlings germinated in ethylene free air had long and thin roots and shoots (Fig. 5 erminated in the presence of ethylene (data not shown). To determine if differences in ethylene receptor most primers from th e Citrus sinensis heterologs. Alignment of full length sequences of ERS1 ETR1 ETR2 and ETR3 indicated that the receptors were identical in both citrus types and to C. sinensis Peel Color The a /b ratio of peel became more positive (changed from green t o orange) as maturity advanced, however, the a /b 2A, 5 2B and 5 2C). When fruit of both citrus types were compared at /b 2A and 5 2B). Harvest I fruit treated with ethylene for 24 h resulted in 0.32 and 0.08 unit a /b ratio espectively. The rate of color change after 24 h

PAGE 117

117 harvests, with little maturity effect (Fig. 5 2D and 5 2E). Although color continued to change it were removed from ethylene treatment and placed in ethylene free storage, the rate of change declined in fruit from Harvests I and II and was no different than control fruit h after transfer to ethylene free air storage, and declined or remained similar in Harvest II and III fruit (Fig. 5 2D, 5 2E, and 5 was similar to control fruit 4 to 5 d after transfer to ethylene free air storage. remained mostly green (Fig. 5 were completely degreened, but at this stage harvested fruit had already begun orange pigment synthesis. Control d storage period and the a*/b* ratios remained below 0.45, whereas orange pigment synthesis was negative in nearly all cases (Fig. 5 3B). While small changes in peel color occurred in control ratio of control fruit from Harvest II in both cultivars increased slightly and at the same rate. even though pigment synthesis was evident at harvest. In summary, rate of color change was similar as Expression of Ethylene Biosynthe tic Genes, ACC and MACC Contents, and Ethylene Production Basal ACS1 2). Ethylene induced higher expression of ACS1

PAGE 118

118 atment in all harvest dates (Fig. 5 4A, 5 4B and 5 4C). Ethylene was less effective in inducing ACS1 gene expression as maturity advanced. After 24 h of ethylene treatment, ACS1 expression increased 510 and 250 re spectively, and 230 40 and 9 h after transfer to ethylene free storage. However, ethylene ind uced ACS1 ACS2 2) but did not show a clear differential t rend with ethylene treatment (Fig. C 1). However, all fruit in Harvests II and III responded similarly or nearly so to harvest and subsequent storage, whether or not they were treated with ethylene. Basal ACO expression declined with maturity in both citru s types. Ethylene induced expression of ACO after 24 h of treatment (Fig. 5 4D, 5 4E and 5 ACO compared with Harvest I fruit. Expression declined 24 h after removal of Harvest I and II fruit ACO expression remained high. After 3 d of transfer to ethylene free storage, expression declined to control levels. Expression of biosynthetic genes in control fruit generally declin ed after harvest. Small but variable maturity related changes in flavedo basal ACC and MACC content of (Fig. 5 5). Overall, ACC content was higher but treatment induced a 5 fold increase was observed in

PAGE 119

119 fold higher 24 h after ethylene treatment and continued to increase 24 h after transfer to ethylene le 5D). MACC content was higher in ethylene treated fruit than control fruit at this time, but contents declined and were similar to controls after 3 d of transfer to ethylene free storage. Although fluctuations occurred, ethylene tr eatment did not affect the fruit, but later slowly increased to s tarting levels or remained low. The basal rate of ethylene production (Table 5 2) was measured at 3 different stages of fruit development with internal juice quality similar to the 3 harvests during the previous season. Basal ethylene production was about 4.5 Expression of Ethylene Recep tor and Signaling Genes ETR1 expression was ethylene 6A, 5 6B and 5 6C). ETR2 expression in Harvest I ethylene treate after transfer to ethylene free storage (Fig. 5 6D). Ethylene had little effect on ETR2 expression ETR2 expression increased in fruit of and 4.6 fold, respectively, whether they were or were not treated with 24 h ethylene treatment, but the rise in expression was less when ethylene was applied (Fig. 5 6E). At Harvest III, ethylene had little effect on ETR2 expression (Fig. 5 6F). After harvest, ETR3 were treated with ethylene (Fig. 5 6G, 5 6H and 5 6I). However, the decline in expression was

PAGE 120

120 no effect on basal levels of receptor gene expression level 1). Ethylene had little effect on ERS1, CTR1 EIN2, EIL1 or EIL2 gene expression level C 1 and C 2). While ERS1 expression was slightly up regulated, expression level s of CTR1 EIN2 EIL1 and EIL2 were slightly down regulated. Chlorophyllase Gene Expression and Total Chlorophyll Content 7A and 5 and 63 fold increase of CHL and 9 fold increase, re spectively. After removal from ethylene CHL expression dropped precipitously and returned to control levels after 3 d of transfer to ethylene mg g 1 fresh weight to 0.4 0 mg g 1 fresh weight 24 h after ethylene treatment and then was reduced to 0.11 mg g 1 fresh weight 1 d after transfer to ethylene free storage (Fig. 5 7D). In 1 fresh weight to 0.27 mg g 1 fresh weight after 24 h ethylene treatment and did not change thereafter. Total chlorophyll content in control fruit was slightly reduced during the 8 d storage period. At 1 f resh weight to 0.08 mg g content reduced from 0.39 mg g 1 fresh weight to 0.27 mg g 1 fresh weight (Fig. 5 7E). After 8 d, the chlorophyll content was similar to the levels immediately after ethylene removal in both ethylene treated f ruit at the end of storage. At Harvest III, ethylene induced CHL expression by

PAGE 121

121 6 fold (Fig. 5 7C and 5 7F). After 24 h, total chlorophyll content reduced from 0.26 mg g 1 fresh weight to 0.14 mg g 1 fresh weight in ethylene treated fruit and to 0.20 mg g 1 fresh weight in control fruit. At the end of storage, total chlorophyll content was 0.12 mg g 1 fresh weight and 0.17 mg g 1 fresh weight in ethylene treated and control fruit, respectiv ely. Discussion and after treatment with exogenous ethylene, especiall y when fruit of similar juice quality (maturity) were compared. After ethylene treatment and 7 d of ethylene Differential rate of color to differences in peel maturity. In citrus, peel color and juice quality are poorly correlated (Grierson and Newhall, 1960). No specific criteria exist to define peel maturity in citrus and g inducing chlorophyll loss and promoting coloration in citrus as fruit maturity progressed (Young and Jahn, 1972; Grierson et al., 1986; Rodrigo and Zacarias, 2007). Rodrigo and Zacarias (2007) reported that the effect of ethylene on carotenoid accumulation and expression of carotenoid biosynthe tic and chlorophyllase genes was more pronounced in fruit harvested later during the ripening stage than fruit harvested during earlier ripening stage. Similarly, during 24 h ethyle ne treatment, the effect of ethylene on chlorophyllase gene expression and total chlorophyll

PAGE 122

122 ement of peel maturity between Harvests I and II, however, Harvest III fruit had lower chlorophyllase gene expression and total eened at harvest and had low chlorophyll content. Since rate of fruit, explaining in part, their differential ethylene response. However, when fruit with similar cating an impaired sensitivity to ethylene. This impaired sensitivity to ethylene, however, was not due to constitutive impairment of the ethylene signal perception and transduction pathway, since the triple response assay indicated that both citrus types responded markedly and similarly to ethylene treatment. Moreover, sequence comparisons of full length perception and signaling genes indicated no major structural changes in motifs identified as important to perception and signaling. Thus, it is likely tha t differential response to ethylene between the two citrus types is not due to impairment in perception and signaling but rather to downstream responses. The basis of this downstream differential response between the two citrus types is not known, but can be measured in expression of ethylene biosynthe tic genes and their products, and altered as maturation progresses. Ethylene induced expression of ACS1 and ACO was higher in induced expression of ACS1 and ACO ethylene biosynthe tic genes were maturation dependent and decreased as fruit maturity progressed. Similarly, Katz et

PAGE 123

123 al. (2004) demonstrated developmental and maturation dep endent alteration in ethylene sensitivity as measured by ethylene production and expression of CsACS1 and CsACO1 In strawberries, ethylene induced greater expression of FaACO1 in more mature fruit than in less mature fruit, indicating an increase in ethyl ene response as maturity progressed (Trainotti et al., 2005). In citrus leaves and tomato fruit, both positive and negative feedback regulation of ethylene biosynthesis occur (Riov and Yang, 1982; Nakatsuka et al., 1998; Barry et al., 2000). In mature citr us fruit peel, an increase in expression of ethylene biosynthe tic genes was observed when treated with an ethylene releasing abscission agent (Yuan et al., 2005). The increase in gene expression corresponded with an increase in the abscission response. Si milar to biosynthetic genes, changes in ethylene receptor gene expression level s were also ethylene responsive. However, it is unclear whether translation and incorporation of active receptor proteins into the membrane of endoplasmic reticulum occurs. Such activities would be required to alter sensitivity to ethylene by these means. Differences in receptor gene expression levels correlating receptor response to ethylene treatmen t with downstream action. Other studies have also reported these observations. Ethylene induced increase in expression of receptor genes was observed in Arabidopsis (Binder et al., 2004), tomato (Ciardi et al., 2000), kiwifruit (Yin et al., 2008) and strawberries (Trainotti et al., 2005). Differences in receptor gene expression during natural color change were noticed in Clementine cultivars with differential degreen ing behavior (Distefano et al., 2009). Also, Narumi et al. (2005) showed differential ethylene induced receptor gene expression levels in ethylene sensitive and insensitive cultivars of chrysanthemum.

PAGE 124

124 Differences in endogenous ethylene production were c orrelated with differential endogenous ethylene production. Difference s in basal ethylene production and biosynthesis were correlated with ethylene sensitivity during flower senescence in carnation (Onozaki et al., 2001; Tanase et al., 2008). Cultivars with low ethylene biosynthesis and associated gene expression levels had longer vase life and were less sensitive to exogenous ethylene or ACC application. Harvest I and appears to correlate with higher ethylene sensitivity during degreening. However, ethylene sensitivity. Post transcriptional chang es in ACO could lead to differential ethylene transcriptional regulation of ACO has been reported in tomato (Hamilton et al., 1998) and persimmon fruit (Nakano et al., 2002). In Harvest I fruit, thou ACO gene ACO Differences in conjugation of ACC to MACC could also lead to differential ethylene biosynthesis and response. Conjugation of ACC to MACC is a regulatory step in ethylene biosynthesis (Amrhein et al., 1981; Hoffman et al., 1982 ) and as a consequence less ACC would be available for ethylene conversion and resulting action(s). In general, MACC content was

PAGE 125

125 to MACC. Moreover, ethylene tr eatment had a maturation dependent effect on MACC content. Thus, malonylation of ACC may contribute to regulation of ACC content and consequently ethylene sensitivity in both citrus types. Ethylene production during the course of the experiment was not att empted; so a direct comparison between ACC or MACC contents and ethylene production could not be made. Taken together, iff erences in ethylene biosynthe tic pathway gene expression (likely resulting in changes in active proteins) and conjugation of ACC indicate impaired not impaired at ethylene perception and signaling, but rather downstream factors or elements are affected.

PAGE 126

126 Table 5 on the indicated dates. The indicates that sampling was not done. Values within each parameter followed by different letters are Parameter Citrus type First year Second year Harvest I (10/3/2007) Harvest II (10/24/2007) Harvest III (12/14/2007) Harvest I (9/25/2008) Harvest II (10/28/2008) Harvest III (12/16/2008) Juice quality (Brix/% acid) Fallglo 5.80 d 9.79 c 6.07 d 9.62 c Lee x Orlando 9.03 c 12.44 b 15.39 a 9.56 c 12.73 b 14.92 a Peel color (a*/b*) Fallglo 0.48 d 0.32 c 0.39 c 0.21 b Lee x Orlando 0.61 e 0.58 e 0.02 a 0.63 e 0.57 e 0.04 a

PAGE 127

127 Table 5 2. Basal levels of gene expression of ACS1 ACS2 and ACO and ethylene production (nL kg 1 h 1 Harvest I for each corresponding gene. The indicates that sampling was not done. nd; no ethylene was detectable. Values within each row followed by different letters are signific Harvest I Harvest II Harvest III Fallglo Lee x Orlando Fallglo Lee x Orlando Fallglo Lee x Orlando ACS1 0.98 b 0.80 b 0.16 c 2.18 a 0.55 bc ACS2 0.98 b 1.56 a 0.16 d 0.40 c 0.14 d ACO 1.02 b 1.47 a 0.58 c 0.73 bc 0.56 c Ethylene production 36.03 a 7.98 b nd 3.81 bc 0.46 c Figure 5 ethylene free air or 10 L L 1 of ethylene for 18 d at 27 C.

PAGE 128

128 Figure 5 2. Peel color measured as a*/b* ratio (A, B and C) and rate of color change (D, E and and ethylene d with 5 L L 1 ethylene for 24 h (indicated by shaded region) followed by storage in ethylene free air for 7 d. Control fruit were stored in ethylene free air for 8 d. The vertical bars above and below markers represent the SE of the mean. Bars are not vi sible when markers are larger than SE.

PAGE 129

129 Figure 5 3. Changes in peel color A) during 24 h of ethylene treatment followed by 7 d of ethylene free storage; and B) during 8 d of storage in ethylene free air.

PAGE 130

130 Figure 5 4. Expression of ACS1 (A, B and C) a nd ACO respect to T 0 control. The ethylene treatm ent period is indicated by the shaded region. The vertical bars above and below markers represent the SE of the mean. Bars are not visible when markers are larger than SE.

PAGE 131

131 Figure 5 treated The vertical bars above and below markers represent the SE of the mean. Bars are not visible when markers are larger than SE.

PAGE 132

132 Figure 5 6. Expression of ETR1 (A, B and C), ETR2 (D, E and F) and ETR3 (G, H and I) in tr in gene expression with respect to T0 control. The ethylene treatment period is indicated by the shaded region. The vertical bars above and below markers represent the SE of the mean. Bars are not v isible when markers are larger than SE.

PAGE 133

133 Figure 5 7. Expression of CHL (A, B and C) and total chlorophyll content (D, E and F) in in gene expression with respe ct to T 0 control. The ethylene treatment period is indicated by the shaded region. The vertical bars above and below markers represent the SE of the mean. Bars are not visible when markers are larger than SE.

PAGE 134

134 APPENDIX A S UPPLEMENTAL D ATA FOR C HAPTER T HREE Figure A 1. Gene expression of CsACS2 in fruit peel (A), fruit abscission zone (B), leaf blade (C) and leaf abscission zone (D) and expression of CsACO in fruit peel (E) and leaf blade (F) Data represent relative change in gene expression normalized with respect to T 0 control ( ). Trees were treated with 450 L L 1 through markers represent SE of the mean. Where bars are not visible, markers are larg er than SE.

PAGE 135

135 Figure A 2. Gene expression of CsETR1 in fruit peel (A), fruit abscission zone (B), leaf blade (C) and leaf abscission zone (D) and expression of CsETR3 in fruit peel (E), fruit abscission zone (F), leaf blade (G) and leaf abscission zone (H) orange Data represent relative change in gene expression normalized with respect to T 0 control ( ). Trees were treated with 450 L L 1 ethep or ethephon + 1 Where bars are not visible, markers are larger than SE.

PAGE 136

136 Figure A 3. Gene expression of CsCTR1 in fruit peel (A), fruit abscission zone (B), leaf b lade (C) and leaf abscission zone (D) and expression of CsEIN2 in fruit peel (E), fruit abscission zone (F), leaf blade (G) and leaf abscission zone (H) orange Data represent relative change in gene expression normalized with respect t o T 0 control ( ). Trees were treated with 450 L L 1 or ethephon + 1 Where bars are not visible, markers are larger than SE.

PAGE 137

137 Figure A 4. Gene expression of CsEIL1 in fruit peel (A), fruit abscission zone (B), leaf blade (C) and leaf abscission zone (D) and expression of CsEIL2 in fruit peel (E), fruit abscission zone (F), leaf blade (G) and leaf abscission zone (H) orange Data represen t relative change in gene expression normalized with respect to T 0 control ( ). Trees were treated with 450 L L 1 or ethephon + 1 Where bars are not visible markers are larger than SE.

PAGE 138

138 APPENDIX B S UPPLEMENTAL D ATA FOR C HAPTER F OUR Figure B 1. Fluctuations in gene expression of CsEIN2 grown in the field and the growth room. Time 0 represents the start of the first light cycle. Data represents relative change in gene expression with respect to first sampling. Vertical bars through symbols represent se of the mean. Where bars are not visible, symbols are larger than se. The white and black bars indicate the approximate start, stop and duration of light and dark conditions, respectively.

PAGE 139

139 APPENDIX C S UPPLEMENTAL D ATA FOR C HAPTER F IVE Table C 1. Basal levels of gene expression of ERS1 ETR1 ETR2 and ETR3 Each value for gene The indicates that sampling was not done. Values within each row followed by same Harvest I Harvest II Harvest III Fallglo Lee x Orlando Fallglo Lee x Orlando Fallglo Lee x Orlando ERS1 0.97 a 0.88 a 0.95 a 0.90 a 0.85 a ETR1 0.99 a 0.91 a 0.90 a 0.98 a 0.93 a ETR2 0.98 a 1.11 a 1.02 a 0.93 a 0.95 a ETR3 0.97 a 0.98 a 1.00 a 0.98 a 0.94 a

PAGE 140

140 Figure C 1. Expression of ACS2 (A, B and C), ERS1 (D, E and F) and CTR1 (G, H and I) in in gene expression with respect to T 0 control. The ethylene treatment period is indicated by the shaded region. The vertical bars above and below markers represent the SE of the mean. Bars are not visible when markers are larger than SE.

PAGE 141

141 Figure C 2. Expression of EIN2 (A, B and C), EIL1 (D, E and F) a nd EIL2 (G, H and I) in in gene expression with respect to T 0 control. The ethylene treat ment period is indicated by the shaded region. The vertical bars above and below markers represent the SE of the mean. Bars are not visible when markers are larger than SE.

PAGE 142

142 LIST OF REFERENCES Abeles, F.B., Leather, G.R., 1971. Abscission: control of c ellulase secretion by ethylene. Planta 97, 87 91. Abeles, F.B., Morgan, P.W., Saltveit, M.E., 1992. Ethylene in plant biology. 2nd edition. Academic Press, Inc., California. Adams, D.O., Yang., S.F., 1979. Ethylene biosynthesis: identification of 1 aminocy clopropane 1 carboxylic acid as an intermediate in the conversion of methionine to ethylene. Proc. Natl. Acad. Sci. 76, 170 174. Alexander, L., Grierson, D., 2002. Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening. J. Expt. Bot. 53, 2039 2055. Alferez, F., Singh, S., Umbach, A.L., Hockema, B., Burns, J.K., 2005. Citrus abscission and Arabidopsis plant decline in response to 5 chloro 3 methyl 4 nitro 1H pyrazole are mediated by lipid signaling. Plant, Cell Env. 28, 1436 1449. Alonso, J.M., Hirayama, T., Roman, G., Nourizadeh, S., Ecker, J.R., 1999. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Sci. 284, 2148 2152. Amir Shapira, D., Goldschmidt, E.E., Altman, A., 1987. Chlorophyll catabolism i n senescing plant tissues: In vivo breakdown intermediates suggest different degradative pathways for Citrus fruit and parsley leaves. Proc. Natl. Acd. Sci. 84, 1901 1905. Amrhein, N., Scheebeck, D., Skorupka, H., Tophof, S., 1981. Identification of a majo r metabolite of the ethylene precursor 1 aminocyclopropane 1 carboxylic acid in higher plants. Naturwissenschaften 68, 619 620. Ansari, A.Q., Loomis, W.E., 1959. Leaf temperature. Amer. J. Bot. 46, 713 717. Barry, C.S., Blume, B., Bouzayen, M., Cooper, W., Hamilton, A.J., Grierson, D., 1996. Differential expression of the 1 aminocyclopropane 1 carboxylate oxidase gene family of tomato. Plant J. 9, 525 535. Barry, C.S., Llop Tous, M.I., Grierson, D., 2000. The regulation of 1 aminocyclopropane 1 carboxylic a cid synthase gene expression during the transition from system 1 to system 2 ethylene synthesis in tomato. Plant Physiol. 123, 979 986. Beyer, E., 1975. Abscission: the initial effect of ethylene is in the leaf blade. Plant Physiol. 55, 322 327. Binder, B. A.B., 2004. Arabidopsis seedling growth response and recovery to ethylene. A kinetic analysis. Plant Physiol. 136, 2913 2920.

PAGE 143

143 Binder, B.M., Walker, J.M., Gagne, J.M., Emborg, T.J., Hemmann, G., Bleecker, A.B., Vierstra, R.D., 2007. The Arabidopsis EIN3 binding F box proteins EBF1 and EBF2 have distinct but overlapping roles in ethylene signaling. Plant Cell 19, 509 523. Blankenship, S., Dole, J.M., 2003. 1 Methylcyclopropene: A review. Postharvest Biol. Technol. 28, 1 25. Bleecker, A.B., Estelle, M.A., Somerville, C., Kende, H., 1988. Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana. Sci. 241, 1086 1089. Bleecker, A.B., Patterson, S.E., 1997. L ast exit: Senescence, abscission and meristem arrest in Arabidopsis. Plant Cell 9, 1169 1179. Blume, B., Grierson, D., 1997. Expression of ACC oxidase promoter GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli. Plant J. 12, 731 746. Boland, F. E. 1990. Fruits and fruits products. In: Helrich, K. (Ed.) Official methods of analysis of AOAC international, 15th ed. Association of Official Agricultural Chemists, Arlington, VA, Vol. II, pp. 918. Bonghi, C., Rascio, N., Ramina, A., Casadoro, G., 1992. Cellulase and polygalacturonase involvement in the abscission of leaf and fruit explants of peach. Plant Mol. Biol. 20, 839 848. Bouzayen, M., Latch, A., Pech, J.C., Marigo, G., 1989. Carrier mediated uptake of 1 (malonylamino) cyclopropane 1 carboxylic acid in vacuoles isolated from Catharanthus roseus cells. Plant Physiol. 91, 1317 1322. Brown, G.E., 1975. Factors affecting postharvest development of Colletotrichum gloeosporioides in citrus fruit. Phytopathol. 65, 404 409. Brown, G.E., 1978. Hypersensitive response of orange colored Robinson tangerines to Colletotrichum gloeosporioides after ethylene treatment. Phytopathol. 68, 700 706. Brown, K.M., 1997. Ethylene and abscission. Physiol. Plant. 100, 567 576. Bu kovac, M.J., Zucconi, F., Larsen, R.P., Kesner, C.D., 1969. Chemical promotion of fruit abscission in cherries and plums with special reference to 2 chloroethylphosphonic acid. J. Amer. Soc. Hort. Sci. 94, 226 230. Burg, S.P., 1968. Ethylene, plant senesce nce and abscission. Plant Physiol. 43, 1503 1511. Burg, S.P., Burg, E.A., 1965. Ethylene action and the ripening of fruits: Ethylene influences the growth and development of plants and is the hormone which initiates fruit ripening. Sci. 148, 1190 1196.

PAGE 144

144 Bur ns, J.K., 2002. Using molecular biology tools to identify abscission materials in citrus. HortSci. 37, 15 20. Burns, J.K., Ferguson, L., Glozer, K., Krueger, W.H., Rosecrance, R.C., 2008. Screening fruit loosening agents for black ripe processed table oliv es. HortSci. 43, 1449 1453. Burns, J.K., Lewandowski, D.J., Nairn, C.J., Brown, G.E., 1998. Endo 1,4 glucanase gene expression and cell wall hydrolase activities during abscission in Valencia orange. Physiol. Plant. 102, 217 225. Cancel, J.D., Larsen, P. B., 2002. Loss of function mutations in the ethylene receptor ETR1 cause enhanced sensitivity and exaggerated response to ethylene in Arabidopsis. Plant Physiol. 129, 1557 1567. Capitani, G., Hohenester, E., Feng, L., Storici, P., Kirsch, J.F., Jansonius, J.N., 1999. Structure of 1 aminocyclopropane 1 carboxylate synthase, a key enzyme in the biosynthesis of the plant hormone ethylene. J. Mol. Biol. 294, 745 756. Chang, C., Kwok, S.F., Bleecker, A.B., Meyerowitz, E.M., 1993. Arabidopsis ethylene response ge ne ETR1: Similarity of product of two component regulators. Sci. 262, 539 544. Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., Ecker, J.R., 1997. Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE INSENSITIVE 3 and related proteins. Cell 89, 1133 1144. Chappel, J., Hahlbrock, K., Boller, T., 1984. Rapid induction of ethylene biosynthesis in cultured parsley cells by fungal elicitor and its relationship to the induction of phenylalanine ammonia lyase Plant 161, 475 480. Chen, Q.G., Bleecker, A.B., 1995. Analysis of ethylene signal transduction kinetics associated with seedling growth response and chitinase induction in wild type and mutant Arabidopsis. Plant Physiol. 108, 597 607. Choi, S.T., Huber, D.J., 2009. Differential sorption of 1 methylcyclopropene to fruit and vegetable tissues, storage and cell wall polysaccharides, oil, and lignins. Postharvest Biol. Technol. 52, 62 70. Ciardi, J.A., Tieman, D.M., Lund, S.T., Jones, J.B., Stall, R.E., Klee, H.J., 2000. Response to Xanthomonas campestris pv. Vesicatoria in tomato involves regulation of ethylene receptor gene expression. Plant Physiol. 123, 81 92. Clark, K.L., Larsen, P.B., Wang, X., Chang, C., 1998. Association of the Arabidopsis CTR1 Raf lik e kinase with the ETR1 and ERS ethylene receptors. Proc. Natl. Acad. Sci. 95, 5401 5406. Cook, G.D., Dixon, J.R., Leopold, A.C., 1964. Transpiration: its effect on plant leaf temperature. Sci. 144, 546 547.

PAGE 145

145 Covington, M.F., Harmer, S.L., 2007. The circadia n clock regulates auxin signaling and responses in Arabidopsis PLoS Biol. 5, 1773 1784. Cowling, R.J., Harberd, N.P., 1999. Gibberellins control Arabidopsis hypocotyl growth via regulation of cellular elongation. J. Expt. Bot. 50, 1351 1357. Dal Cin, V., Danesin, M., Boschetti, A., Dorigoni, A., Ramina, A., 2005. Ethylene biosynthesis and perception in apple fruitlet abscission (Malus domestica L. Borck). J. Expt. Bot. 56, 2995 3005. Dauny, P.T., Joyce, D.C., Gamby, C., 1 Methylcyclopropene influx and effl 105. de Mairan, J., 1729. Obersvation botanique. Hist. Acad. Roy. Sci. 35 36. del Campillo, E., Bennett, A.B., 1996. Pedicel breakstrength and cellulase gene expression during t omato flower abscission. Plant Physiol. 111, 813 820. Dennis, F.G., 2002. Mechanisms of action of apple thinning chemicals. HortSci. 37, 471 474. Distefano, G., Casas, G.L., Caruso, M., Todaro, A., Rapisarda, P., Malfa, S.L., Gentile, A., Tribulato, E., 2009. Physiological and molecular analysis of the maturation process in fruits of clementine mandarin and one of its late ripening mutants. J. Agric. Food Chem. 57, 7974 7982. Domir, S.C., Foy, C.L., 1978. A study of ethylene and CO2 evolution from ethepho n in tobacco. Pesticide Biochem. Physiol. 9, 1 8. Doubt, S.L., 1917. The response of plants to illuminating gas. Botan. Gaz. 63, 209 224. Dowson Day, M.J., Millar, A.J., 1999. Circadian dysfunction causes aberrant hypocotyl elongation patterns in Arabidopsis. Plant J. 17, 63 71. El Beltagy, A.S., Hall, M.A., 1974. Effect of water stress upon endogenous ethylene levels in Vicia faba. New Phytol. 73, 47 60. El Beltagy, A.S., Kapuya, J.A., Madkour, M.A., Hall, M.A., 1976. A possible endogenous rhythm in internal ethylene levels in the leaves of Lycopersicon esculentum Mill. Plant Sci. Lett. 6, 175 180. El Sharkawy, I., Kim, W.S., Jayasankar, S., Svircev, A.M., Brown, D.C.W., 2008. Differential regulation of the ACC synthase gene family in plum. J. Expt Bot. 59, 2009 2027. Engelmann, W., Johnsson, A., 1998. Rhythms in organ movement. In: Lumsden, P.J., Millar, A.J. (Eds.), Biological Rhythms and Photoperiodism in Plants. Oxford: BIOS Scientific Publishers, pp. 35 50.

PAGE 146

146 Espelie, K.E., Davis, R.W., Kolattuk udy, P.E., 1980. Composition, ultrastructure and function of the cutin and suberin containing layers in the leaf, fruit peel, juice sac and inner seed coat of grapefruit (Citrus paradisi Macfed.). Planta 149, 498 511. Felix, G., Gorsskopf, D.G., Regenass, M., Basse, C., Boller, T., 1991. Elicitor induced ethylene biosynthesis in tomato cells. Characterization and use as a bioassay for elicitor action. Plant Physiol. 97, 19 25. Fernndez Otero, C.I., de la Torre, F., Iglesias, R., Rodrguez Gacio, M.C., Mat illa, A.J., 2007. Stage and tissue expression of genes involved in the biosynthesis and signalling of ethylene in reproductive organs of damson plum (Prunus domestica L. subsp. insititia). Plant Physiol. Biochem. 45, 199 208. Florida Agricultural Statisti cs Service, 2009. Florida Citrus Statistics: 2008 2009. < http://www.nass.usda.gov/Statistics_by_State/Florida/Publications/Citrus/fcs/2008 09/fcs0809all.pdf>. Gao, Z., Chen, Y F., Randlett, M.D., Zhao, X C., Findell, J.L., Kieber, J.J., Schaller, G.E., 20 03. Localization of the Raf like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in ethylene receptor signaling complexes. J. Biol. Chem. 278, 34725 34732. Ge, L., Liu, J.Z., Wong, W.S., Hsiao, W.L.W., Chong, K., Xu, Z.K., Yan g, S.F., Kung, S.D., Li, N., 2008. Identification of a novel multiple environmental factor responsive 1 aminocyclopropane 1 carboxylate synthase gene, NT ACS2, from tobacco. Plant, Cell Environ. 23, 1169 1182. Girardin, J.P.L., 1864. Einfluss des Leuchtgas es auf die promenaden und strassen Bume. Jahresber Agri. 7, 199 200. Goldschmidt, E.E., Galily, D., 1995. Role of endogenous ethylene in the spontaneous degreening 313. Goldsch midt, E.E., Huberman, M., Goren, R., 1993. Probing the role of endogenous ethylene in the degreening of citrus fruit with ethylene antagonists. Plant Growth Regulation 12, 325 329. Goren, R., 1993. Anatomical, physiological, and hormonal aspects of absciss ion in citrus. Hortic. Rev. 15, 145 181. Goren, R., Huberman, M., 1976. Effects of ethylene and 2,4 D on the activity of cellulase isoenzymes in abscission zones of the developing orange fruit. Physiol. Plant. 37, 123 130. Greenberg, J., Goren, R., Riov, J ., 1975. The role of cellulase and polygalacturonase in abscission of young and mature Shamouti orange fruits. Physiol. Plant. 34, 1 7.

PAGE 147

147 Grierson, W., Cohen, E., Kitagawa, H., 1986. Degreening. In: Wardowski, W.F., Nagy, S., Grierson, W. (Eds.), Fresh Citru s Fruits. Van Nostrand Reinhold Company Inc., New York, pp. 253 274. Grierson, W., Newhall, W.F., 1960. Degreening of Florida citrus fruits. Fla. Agr. Exp. Stn. Bull. 620. Guo, H., Ecker, J.R. 2003. Plant responses to ethylene gas are mediated by SCFEBF1/ EBF2 dependent proteolysis of EIN3 transcription factor. Cell 115 667 677. Guzman, P., Ecker, J.R., 1990. Exploiting the triple response of Arabidopsis to identify ethylene related mutants. Plant Cell 2, 513 523. Hall, A.E., Findell, J.L., Schaller, G.E., Sisler, E.C., Bleecker, A.B., 2000. Ethylene perception by the ERS1 protein in Arabidopsis. Plant Physiol. 123, 1449 1457. Hamilton, A.J., Brown, S., Yuanhai, H., Ishizuka, M., Lowe, A., Solis, A.A., Grierson, D., 1998. A transgene with repeated DNA cause s high frequency, post transcriptional suppression of ACC oxidase gene expression in tomato. Plant J. 15, 737 746. Hanks, S.K., Quinn, A.M., 1991. Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Meth. Enzymol. 200, 38 62. Hanks, S.K., Quinn, A.M., Hunter, T., 1988. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Sci. 241, 42 52. Hilt, C., Bessis, R., 2003. Abscissi on of grapevine fruitlets in relation to ethylene biosynthesis. Vitis 42, 1 3. Hoffman, N.E., Fu, J., Yang, S.F., 1983. Identification and metabolism of 1 (malonylamino)cyclopropane 1 carboxylic acid in germinating peanut seeds. Plant Physiol. 71, 197 199. Hoffman, N.E., Yang., S.F., McKeon, T., 1982. Identification of 1 (malonylamino) cyclopropane 1 carboxylic acid as a major conjugate of 1 aminocyclopropane 1 carboxylic acid, an ethylene precursor in higher plants. Biochem. Biophys. Res. Commun. 104, 765 770. Horton, R.F., Osborne, D.J., 1967. Senescence, abscission and cellulase activity in Phaseolus vulgaris. Nature 214, 1086 1088. Hua, J., Meyerowitz, E.M., 1998. Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thalia na. Cell 94, 261 271. Hua, J., Chang, C., Meyerowitz, E.M., 1995. Ethylene insensitivity conferred by Arabidopsis ERS gene. Sci. 269, 1712 1714.

PAGE 148

148 Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, A.B., Ecker, J.R., Meyerowitz, E.M., 1998. EIN4 and E RS2 are members of the putative ethylene receptor gene family in Arabidopsis. Plant Cell 10, 1321 1332. Huang, Y., Li, H., Hutchison, C.E., Laskey, J., Kieber, J.J., 2003. Biochemical and functional analysis of CTR1, a protein kinase that negatively regulates ethylene signaling in Arabidopsis. Plant J. 33, 221 233. Huberman, M., Goren, R., 1979. Exo and endo cellular cellulase and polygalacturonase in abscission zones of developing orange fruits. Physiol. Plant. 45, 189 196. Huberman, M., Goren, R., Zamski, E., 1983. Anatomical aspects of hormonal regulation of abscission in citrus. The shoot peduncle abscission zone in the non abscising stage. Physiol. Plant. 59, 445 454. Iwahori, S., and Oohata, J.T., 1976. Chemical thinning of Satsuma mandarin ( Cit rus unshiu Marc.) fruit by 1 naphthaleneacetic acid: role of ethylene and cellulase. Sci. Hort. 4, 167 174. Jackson, M.B., Osborne, D.J., 1970. Ethylene, the natural regulator of leaf abscission. Nature 225, 1019 1022. Jasoni, R.L., Cothren, J.T., Morgan, P.W., Sohan, D.E., 2002. Circadian ethylene production in cotton. Plant Growth Regulation 36, 127 133. Johnson, P.R., Ecker, J.R., 1998. The ethylene gas signal transduction pathway: A molecular perspective. Annu. Rev. Genet. 32, 227 254. Jouve, L., Greppi n, H., Agosti, R.D., 1998. Arabidopsis thaliana floral stem elongation: Evidence for an endogenous circadian rhythm. Plant Physiol. Biochem. 36, 469 472. Kalaitzis, P., Koehler, S.M., Tucker, M.L., 1995. Cloning of a tomato polygalacturonase expressed in a bscission. Plant Mol. Biol. 28, 647 656. Kazokas, W.C., Burns, J.K., 1998. Cellulase activity and gene expression in citrus fruit abscission zones during and after ethylene treatment. J. Amer. Soc. Hort. Sci. 123, 781 786. Katz, E., Lagunes, P.M., Riov, J. Weiss, D., Goldschmidt, E.E., 2004. Molecular and physiological evidence suggests the existence of a system II like pathway of ethylene production in non climacteric Citrus fruit. Planta 219, 243 252. Kende, H., Boller, T., 1981. Wound ethylene and 1 ami nocyclopropane 1 carboxylate synthase in ripening tomato fruit. Planta 151, 476 481. Kevany, B.M., Tieman, D.M., Taylor, M.G., Cin, V.D., Klee, H.J., 2007. Ethylene receptor degradation controls the timing of ripening in tomato fruit. Plant J. 51, 458 467.

PAGE 149

149 Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A., Ecker, J.R., 1993. CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72, 427 441. King, A., Yi, M., Ferrante, A. Reid, M., 2001. Thiadiazuron reduces leaf senescence and abscission in flowering potted plants. HortSci. 36, 599. Kitagawa, H., Kawada, K., Tarutani, T., 1978. Effectiveness of ethylene degreening of certain citrus cultivars. J. Amer. Soc. Hort. Sci. 103 113 115. Klee, H.J., 2002. Control of ethylene mediated processes in tomato at the level of receptors. J. Expt. Bot. 53, 2057 2063. Klee, H.J., 2004. Ethylene signal transduction. Moving beyond Arabidopsis. Plant Physiol. 135, 660 667. Klee, H., Tieman, D., 2002. The tomato ethylene receptor gene family: Form and function. Physiol. Plant. 115, 336 341. Lanahan, M.B., Yen, H C., Giovannoni, J.J., Klee, H.J., 1994. The Never Ripe mutation blocks ethylene perception in tomato. Plant Cell 6, 521 530. Lashbroo k, C., Tieman, D., Klee, H.J., 1998. Differential regulation of the tomato ETR gene family throughout plant development. Plant J 15:243 252. Leclercq, J., Adams Phillips, L.C., Zegzouti, H., Jones, B., Latch, A., Giovannoni, J.J., Pech, J C., Bouzayen, M. 2002. LeCTR1, a tomato CTR1 like gene, demonstrates ethylene signaling ability in Arabidopsis and novel expression patterns in tomato. Plant Physiol. 130, 1132 1142. Li, N., Mattoo, A.K., 1994. Deletion of the carboxy terminal region of 1 aminocyclopropa ne 1 carboxylic acid synthase, a key protein in the biosynthesis of ethylene, results in catalytically hyperactive, monomeric enzyme. J. Biol. Chem. 269, 6908 6917. Liao, H L., Burns, J.K., 2010. Light controls phospholipase A 2 and gene expression in Citrus sinensis J. Expt. Bot. 61, 2469 2478. Lipe, J.A., Morgan, P.W., 1973. Ethylene, a regulator of young fruit abscission. Plant Physiol. 51, 949 953. Liu, Y., Hoffman, N.E., Yang, S.F., 1985a. Promotion by ethylene of the capability to convert 1 amin ocyclopropane 1 carboxylic acid to ethylene in preclimacteric tomato and cantaloupe fruit. Plant Physiol. 77, 407 411. Liu, Y., Hoffman, N.E., Yang, S.F., 1985b. Ethylene promoted malonylation of 1 aminocyclopropane 1 carboxylic acid participates in autoin hibition of ethylene synthesis in grapefruit flavedo discs. Planta 164, 565 568.

PAGE 150

150 Lizada, M.C.C., Yang, F.Y., 1979. A simple and sensitive assay for 1 aminocyclopropane 1 carboxylic acid. Anal. Biochem. 100, 140 145. Llop Tous, I., Barry, C.S., Grierson, D. 2000. Regulation of ethylene biosynthesis in response to pollination in tomato flowers. Plant Physiol. 123, 971 978. Machckov, I., Chauvaux, N., Dewitte, W., van Onckelen, H., 1997. Diurnal fluctuations in ethylene formation in Chenopodium rubrum. Plan t Physiol. 113, 981 985. Mackinney, G., 1941. Absorption of light by chlorophyll solutions. J. Biol. Chem. 140, 315 322. Malladi, A., Burns, J.K., 2008. CsPLD 1 and CsPLD 1 are differentially induced during leaf and fruit abscission and diurnally regulated in Citrus sinensis J. Expt. Bot. 59, 3729 3739. Mansour, R., Latch, A., Vaillant, V., Pech, J.C., Reid, M.S., 1986. Metabolism of 1 aminocyclopropane 1 carboxylic acid in ripening apple fruits. Physiol. Plant. 66, 495 502. Martin, G.C., Lavee, S., Sibbett, G.S., 1981. Chemical loosening agents to assist mechanical harvest of olive. J. Amer. Soc. Hort. Sci. 106, 325 330. Martin, M.N., Saftner, R.A., 1995. Purification and characterization of 1 aminocyclopropane 1 carboxylic acid N malonyltransferase from tomato fruit. Plant Physiol. 108, 1241 1249. McClung, C.R., 2001. Circadian rhythms in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 139 162. McClung, C.R., 2006. Plant circadian rhythms. Plant Cell 18, 792 803. McCollum, G., Maul, P., 2003. Differential effects of ethylene and 1 MCP on degreening and ethylene biosynthesis in grapefruit. HortSci. 38, 833 834. McCollum, G., Maul, P., 2007. 1 Methylcyclopropene inhib its degreening but stimulates respiration and ethylene biosynthesis in grapefruit. HortSci. 42, 120 124. McCornack, A.A., 1972. Effect of ethylene degreening on decay of Florida citrus fruit. Proc. Fla. State Hort. Soc. 84, 270 272. Mehta, P.K., Hale, T.I. Christen, P., 1993. Aminotransferases: Demonstration of homology and division into evolutionary subgroups. Eur. J. Biochem. 214, 549 561. Mishra, A., Khare, S., Trivedi, P.K., Nath, P., 2008. Ethylene induced cotton leaf abscission is associated with hig her gene expression of cellulase (GhCell) and increased activities of ethylene biosynthesis enzymes in abscission zone. Plant Physiol. Biochem. 46, 54 63. Mller, R., Stummann, B.M., Serek, M., 2000. Characterization of an ethylene receptor family with dif ferential expression in rose ( Rosa hybrid ) flowers. Plant Cell Rep. 19, 1232 1239.

PAGE 151

151 Mullins, E.D., McCollum, T.G., McDonald, R.E., 1999. Ethylene: A regulator of stress induced ACC synthase activity in nonclimacteric fruit. Physiol. Plant. 107, 1 7. Mullins E.D., McCollum, T.G., McDonald, R.E., 2000. Consequences on ethylene metabolism of inactivating the ethylene receptor sites in diseased non climacteric fruit. Postharvest Biol. Technol. 19, 155 164. Muraro, R.P., 2008. Estimated average picking, roadsidi ng and hauling charges for Florida citrus, 2007 08 season. Institute of Food and Agricultural Sciences, University of Florida. < http://www.crec.ifas.uf l.edu/extension/economics/pdf/Estimated_Average_Picking_2007 08.pdf >. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant. 15, 473 479. Nakano, R., Inoue, S., Kubo, Y., Inaba, A., 2002 Water stress induced ethylene in the calyx grown in a heated plastic house. Postharvest Biol. Technol. 25, 293 300. Nakatsuka, A., Murachi, S., Okunishi, H., Shiomi, S ., Nakano, R., Kubo, Y., Inaba, A., 1998. Differential expression and internal feedback regulation of 1 aminocyclopropane 1 carboxylate synthase, 1 aminocyclopropane 1 carboxylate oxidase, and ethylene receptor genes in tomato fruit during development and ripening. Plant Physiol. 118, 1295 1305. Nanthachai, N., Ratanachinakorn, B., Kosittrakun, M and Beaudry, R.M., 2007. Absorption of 1 MCP by fresh produce. Postharvest Biol. Technol. 43, 291 297. Narumi, T., Kanno, Y., Suzuki, M., Kishimoto, S., Ohmiya, A. Satoh, S., 2005. Cloning of a cDNA encoding an ethylene receptor (DG ERS1) from chrysanthemum and comparison of its mRNA level in ethylene sensitive and insensitive cultivars. Postharvest Biol. Technol. 36, 21 30. National Agricultural Statistics Servic e, 2009. Citrus Fruits 2009 Summary, U.S. Dept. Agr., September 2009. < http://usda.mannlib.cornell.edu/usda/current/CitrFrui/CitrFrui 09 24 2009.pdf >. Nehring, R.B., Ecker, J.R., 2004. Ethylene responses in seedling growth and development, p. 350 368. In: Davies, P.J. (Ed.), Plant Hormones: Biosynthesis, signal transduction, Action, Kluwer Academic Publishers, Norwell, MA. Pisum sativum und einiger anderen pflanzen. Bot. Cetrabl. Beihefte 10, 128 139. Novkov, M., Motyka, V., Dobrev, P., Malbeck, J., Gaudinov, A., Vankov, R., 2005. Diurnal variation of cytokinin, auxin and abscisic acid levels in tobacco leaves. J. Expt. Bot. 56, 2877 2883.

PAGE 152

152 Ethylene as a signal mediating the wound response of tomato plants. Sci. 274, 1914 1917. A.B. 2005., Ethylene binding activity, gene expression levels, and receptor system output for ethylene receptor family members from Arabidopsis and tomato. The Plant J. 41, 651 659. Oetiker, J.H., Olson, D.C., Shiu, O.Y., Yang, S.F., 1997. Differential induction of seven 1 aminocylcopropane 1 carboxylate synthase genes by elicitor in suspension cultures of tomato (Lycopersicon esculentum). Plant Mol. Biol. 34, 2 75 286. Onozaki, T., Ikeda, H., Yamaguchi, T., 2001. Genetic improvement of vase life of carnation flowers by crossing and selection. Sci. Hort. 87, 107 120. Pallas, J.E., Michel, B.E., Harris, D.G., 1967. Photosynthesis, transpiration, leaf temperature, a nd stomatal activity of cotton plants under varying water potentials. Plant Physiol. 42, 76 88. Patterson, S.E., 2001. Cutting loose, abscission and dehiscence in Arabidopsis Plant Physiol. 126, 494 500. Patterson, S.E., Bleecker, A.B., 2004. Ethylene dep endent and independent processes associated with floral organ abscission in Arabidopsis. Plant Physiol. 134, 194 203. Pech, J C., Latch, A., Bouzayen, M., 2004. Ethylene biosynthesis, p. 115 136. In: Davies, P.J. (Ed.), Plant Hormones: Biosynthesis, sign al transduction, Action, Kluwer Academic Publishers, Norwell, MA. Peck, S.C., Kende, H., 1998. Differential expression of genes encoding 1 aminocyclopropane 1 carboxylate (ACC) synthase in etiolated pea seedlings: Effects of indole 3 acetic acid, wounding, and ethylene. Plant Mol. Biol. 38, 977 982. Peng, H.P., Lin, T.Y., Wang, N.N., Shih, M.C., 2005. Differential expression of genes encoding 1 aminocyclopropane 1 carboxylate synthase in Arabidopsis during hypoxia. Plant Mol. Biol. 58, 15 25. Perry, S.C., G ianfagna, T.J., 1987. Effect of silaid and Ethrel on peach leaf and fruit abscission in relation to the kinetics of ethylene release. Acta Hort. 201, 157 163. Pesis, E., Ackerman, M., Ben Aire, R., Feygenberg, O., Feng, X., Apelbaum, A., Goren, R., Prusky, D., 2002. Ethylene involvement in chilling injury symptoms of avocado during cold storage. Postharvest Biol. Technol. 24, 171 181. Sci. 122, 547 552.

PAGE 153

153 Porat, R., Weiss, B., Cohen, L., Daus, A., Goren, R., Droby, S., 1999. Effects of ethylene and 1 Technol. 15, 155 163. Pozo, L., and Burns, J.K., 2009. Organ loss and yield impa response to fruit abscission agents. HortSci. 44, 83 88. Pozo, L., Malladi, A., John Karuppiah, K J., Lluch, Y., Alferez, A., Burns, J.K., 2007. Daily o time of day, temperature, relative humidity, fruit weight, and juice percentage. Proc. Fla. State Hort. Soc. 120, 41 44. Pozo, L., Yuan, R., Kostenyuk, I., Alfrez, F., Zhong, G.Y., Burns, J.K. 2004. Differential effects of 1 methylcyclopropene on citrus leaf and mature fruit abscission. J. Amer. Soc. Hort. Sci. 129, 473 478. Purvis, A.C., Bramore, C.R., 1981. Involvement of ethylene in chlorophyll degradation in peel of citrus fruits. Plant Physiol. 68, 854 856. Qu, X., Hall, B.P., Gao, Z., Schaller, G.E ., 2007. A strong constitutive ethylene response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1. BMC Plant Biol. 7, 3. Rasori, A., Ruperti, B., Bonghi, C., Tonutti, P., Ramina, A., 2002. Characte rization of two putative ethylene receptor genes expressed during peach fruit development and abscission. J. Expt. Bot. 53, 2333 2339. Ratner, A., Goren, R., Monselise, S.P., 1969. Activity of pectin esterase and cellulase in the abscission zone of citrus leaf explants. Plant Physiol. 44, 1717 1723. Reid, M.S., Wollenweber, B., Serek, M., 2002. Carbon balance and ethylene in the postharvest life of flowering hibiscus. Postharvest Biol. Technol. 25, 227 233. Reid, P.D., Strong, H.G., Lew, F., Lewis, L.N., 19 74. Cellulase and abscission in the red kidney bean (Phaseolus vulgaris). Plant Physiol. 53, 732 737. Rieu, I., Mariani, C., Weterings, K., 2003. Expression analysis of five tobacco EIN3 family members in relation to tissue specific ethylene reponses. J. E xpt. Bot. 54, 2239 2244. Rikin, A., Chalutz, E., Anderson, J.D., 1984. Rhythmicity in ethylene production in cotton seedlings. Plant Physiol. 75, 493 495. Riov, J., Yang, S.F., 1982. Effects of exogenous ethylene on ethylene production in citrus leaf tissu e. Plant Physiol. 70, 136 141. Rodrigo, M.J., Zacarias, L., 2007. Effect of postharvest ethylene treatment on carotenoid accumulation and the expression of carotenoid biosynthetic genes in the flavedo of orange (Citrus sinensis L. Osbeck) fruit. Postharvest Biol. Technol. 43, 14 22.

PAGE 154

154 Rodrguez, F.I., Esch, J.J., Hall, A.E., Binder, B.M., Schaller, G.E., Bleecker, A.B., 1999. A copper cofactor for the ethylene receptor ETR1 from Arabidopsis. Sci. 283, 996 998. Roman, G., Lubarsky, B., Kieber, J.J., Rothenberg, M., Ecker, J.R., 1995. Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: Five novel mutant loci integrated into a stress response pathway. Genetics 139, 1393 1409. Rottmann, W.H., Peter, G.F., Oeller, P.W., Keller, J.A., Shen, N.F., Nagy, B.P., Taylor, L.P., Campbell, A.D., Theologis, A., 1991. 1 Aminocyclopropane 1 carboxylate synthase in tomato is encoded by a multigene family whose transcription is induced during fruit and floral senescence. J. Mol. Biol. 222, 937 961. Sagee, O., Goren, R., Riov, J., 1980. Abscission of citrus leaf explants. Interrelationship of abscisic acid, ethylene and hydrolytic enzymes. Plant Physiol. 66, 750 753. Sakai, H., Hua, J., Chen, Q.G., Chang, C., Medrana, L.J., Bleecker, A.B., Meyerowitz E.M., 1998. ETR2 is an ETR1 like gene involved in ethylene signaling in Arabidopsis. Proc. Natl. Acad. Sci. 95, 5812 5817. Sankhla, N., Mackay, W.A., Davis, T.D., 2003. Reduction of flower abscission and leaf senescence in cut phlox inflorescences by thi diazuron. Acta Hort. 628, 837 841. Sato Nara, K., Yuhashi, K I., Higashi, K., Hosoya, K., Kubota, M., Ezura, H., 1999. Stage and tissue specific expression of ethylene receptor homolog genes during fruit development in muskmelon. Plant Physiol. 119, 321 3 29. Schaller, G.E., Bleecker, A.B., 1995. Ethylene binding sites generated in yeast expressing the Arabidopsis ETR1 gene. Sci. 270, 1809 1811. Schaller, G.E., Kieber, J.J., (September 30, 2002). Ethylene. In C.R. Somerville, E.M. Meyerowitz, eds, The Arabi dopsis Book. American Society of Plant Biologists, Rockville, MD, doi: 10.1199/tab.0009, www.aspb.org/publications/arabidopsis/ Scott, F.M., Schroeder, M.R., Turrell, F.M., 1948. Development, cell shape, suberization of internal surface and abscission in t he leaf of the Valencia orange, Citrus sinensis. Bot. Gaz. 109, 381 411. Sexton, R., Laird, G., van Doorn, W.G., 2000. Lack of ethylene involvement in tulip tepal abscission. Physiol. Plant. 108, 321 329. Sexton, R., Roberts, J.A., 1982. Cell biology of abscission. Ann. Rev. Plant Physiol. 33, 133 162. Shimokawa, K., Shimada, S., Yaeo, K., 1978. Ethylene enhanced chlorophyllase activity during degreening of Citrus unshiu Marc. Sci. Hortic. 8, 129 135. Smith, C.J.S., Slater, A., Grierson, D., 1986. Rapid a ppearance of an mRNA correlated with ethylene synthesis encoding a protein of molecular weight 35000. Plant 168, 94 100.

PAGE 155

155 Takahashi, H., Kobayashi, T., Sato Nara, K., Tomita, K., Ezura, H., 2002. Detection of ethylene receptor protein Cm ERS1 during fruit d evelopment in melon (Cucumis melo L.). J. Expt. Bot. 53, 415 422. Tanase, K., Onozaki, T., Satoh, S., Shibata, M., Ichimura, K., 2008. Differential expression levels of ethylene biosynthetic pathway genes during senescence of long lived carnation cultivars Postharvest Biol. Technol. 47, 210 217. Tatsuki, M., Mori, H., 2001. Phosphorylation of tomato 1 aminocyclopropane 1 carboxylic acid synthase, LE ACS2, at the C terminal region. J. Biol. Chem. 276, 28051 28057. Taylor, E.J., Whitelaw, J.A., 2001. Signals in abscission. New Phytologist 151, 323 339. Testerink, C., Larsen, P.B., van der Does, D., van Himbergen, J.A.J., Munnik, T., 2007. Phosphatidic acid binds to and inhibits the activity of Arabidopsis CTR1. J. Expt. Bot. 58, 3905 3914. Testerink, C., Munn ik, T., 2005. Phosphatidic acid: a multifunctional stress signaling lipid in plants. Trends Plant Sci. 10, 368 375. Tieman, D.M., Klee, H.J., 1999. Differential expression of two novel members of the tomato ethylene receptor family. Plant Physiol. 120, 165 172. Tieman, D.M., Ciardi, J.A., Taylor, M.G., Klee, H.J., 2001. Members of the tomato LeEIL (EIN3 like) gene family are functionally redundant and regulate ethylene responses throughout plant development. Plant J. 26, 47 58. Tieman, D.M., Taylor, M.G., C iardi, J.A., Klee, H.J., 2000. The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. Proc. Natl. Acad. Sci. 97, 5663 5668. Trainotti, L., Pavanello, A., Casad oro, G., 2005. Different ethylene receptors show an increased expression during the ripening of strawberries: does such an increment imply a role for ethylene in the ripening of these non climacteric fruits? J. Expt. Bot. 56, 2037 2046. Trebitsh, T., Golds chmidt, E.E., Riov, J., 1993. Ethylene induces de novo synthesis of chlorophyllase, a chlorophyll degrading enzyme, in Citrus fruit peel. Proc. Natl. Acad. Sci. 90, 9441 9445. Tsuchisaka, A., Theologis, A., 2004. Unique and overlapping expression patterns among the Arabidopsis 1 amino cyclopropane 1 carboxylate synthase gene family members. Plant Physiol. 136, 2982 3000. van Doorn, W.G., 2002. Effect of ethylene on flower abscission: a survey. Annals Bot. 89, 689 693. Vines, H.M., Edwards, G.J., Grierson, W ., 1965. Citrus fruit respiration. Proc. Fla. State Hort. Soc. 78, 198 102.

PAGE 156

156 von Heijne, G., 1992. Membrane protein structure prediction. Hydrophobicity analysis and the positive inside rule. J. Mol. Biol. 225, 487 494. Wagstaff, C., Chanasut, U., Harren, F.J.M., Laarhoven, L J., Thomas, B., Rogers, H.J., Stead, A.D., 2005. Ethylene and flower longevity in Alstroemeria: relationship between tepal senescence, abscission and ethylene biosynthesis. J. Expt. Bot. 56, 1007 1016. Wang, K.L C., Yoshida, H., Lurin, C., Ecker, J.R., 2004. Regulation of ethylene gas biosynthesis by the Arabidopsis ETO1 protein. Nature 428, 945 950. the transmitter domain of the ETR1 ethyle ne receptor from Arabidopsis is not required for signal transmission. Proc. Natl. Acad. Sci. 100, 352 357. Whitelaw, C.A., Lyssenko, N.N., Chen, L., Zhou, D., Mattoo, A.K., Tucker, M.L., 2002. Delayed abscission and shorter internodes correlated with a red uction in the ethylene receptor LeETR1 transcript in transgenic tomato. Plant Physiol. 128, 978 987. Wilkinson, J.Q., Lanahan, M.B., Yen, H C., Giovannoni, J.J., Klee, H.J., 1995. An ethylene inducible component of signal transduction encoded by never ripe Sci. 270, 1807 1809. Wills, R.B.H., Ku, V.V.V., 2002, Use of 1 MCP to extend the time to ripen of green tomatoes and postharvest life of ripe tomatoes. Postharvest Biol. Technol. 26, 85 90. Woeste, K., Vogel, J.P., Kieber, J.J., 1999. Factors regulating ethylene biosynthesis in etiolated Arabidopsis thaliana seedlings. Physiol. Plant. 105, 478 484. Xu, S L., Rahman, A., Baskin, T.I., Kieber, J.J., 2008. Two leucine rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synt hase in Arabidopsis. Plant Cell 20, 3065 3079. Yamagami, T., Tsuchisaka, A., Yamada, K., Haddon, W.F., Harden, L.A., Theologis, A., 2003. Biochemical diversity among the 1 amino cyclopropane 1 carboxylate synthase isozymes encoded by the Arabidopsis gene f amily. J. Biol. Chem. 278, 49102 19112. Yang, S.F., 1968. Biosynthesis of ethylene, p. 1217 1228. In: Wightman, F., Setterfield, G. (Eds.), Biochemistry and physiology of plant growth substances, Runge Press, Ottawa. Yang, S.F., Hoffman, N.E., 1984. Ethyle ne biosynthesis and its regulation in higher plants. Annu. Rev. Plant Physiol. 35, 155 189. Yemm, E.W., Willis, A.J., 1954. Stomatal movement and changes of carbohydrate in leaves of Chrysamthemum maximum New Phytologist 53, 373 396. Yin, X R., Chen, K S. Allan, A.C., Wu, R M., Zhang, B., Lallu, N., Ferguson, I.B., 2008. Ethylene induced modulation of genes associated with the ethylene signaling pathway in ripening kiwifruit. J. Expt. Bot. 59, 2097 2108.

PAGE 157

157 Yoshida, H., Nagata, M., Saito, K., Wang, K.L., Eck er, J.R., 2005. Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1 aminocyclopropane 1 carboxylate synthases. BMC Plant Biol. 5, 14. Young, R., Jahn, O., 1972. Ethylene induced carotenoid accumulation in citrus fruit rinds. J. A mer. Soc. Hort. Sci. 97, 258 261. Yuan, R., Greene, D.W., 2000. McIntosh apple fruit thinning by benzyladenine in relation to seed number and endogenous cytokinin levels in fruit and leaves. Sci. Hort. 86, 127 134. Yuan, R., Wu, Z., Kostenyuk, I.A., Burns, J.K., 2005. G protein adrenoreceptor agonists differentially alter citrus leaf and fruit abscission by affecting expression of ACC synthase and ACC oxidase. J. Expt. Bot. 56, 1867 1875. Zamorani, A., Russo, C., Monaco, M., 1973. Effect of degr eening on physical characteristics and juice composition of Feminello lemons. Proc. Int. Soc. Citric. 3, 303 307.

PAGE 158

158 BIOGRAPHICAL SKETCH Karthik Joseph John Karuppiah was born on 1979, in India. In 2001, he obtained his Bachelor of Science degree in Horticulture from the Tamil Nadu Agricultural University in f Florida and completed his degree in 2004. I n August 2010, he successfully defended his dissertation and was awarded the Ph.D. in Horticulture at the University of Florida in December 2010