<%BANNER%>

An Investigation Into the Role of USF in Beta-Globin Regulation

Permanent Link: http://ufdc.ufl.edu/UFE0042050/00001

Material Information

Title: An Investigation Into the Role of USF in Beta-Globin Regulation
Physical Description: 1 online resource (119 p.)
Language: english
Creator: Liang, Shermi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: beta, biology, cell, culture, eklf, erythroid, erythroleukemia, erythropoiesis, gene, globin, hematopoiesis, hemoglobin, human, k562, mel, molecular, mouse, murine, mus, musculus, regulation, usf
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The human beta-globin gene locus contains five genes organized linearly in the order of their tissue and stage-specific expression (5'-epsilon-Ggamma-Agamma-delta-beta-3'). A region of DNA known as the beta-globin locus control region (LCR) resides upstream of the genes, and is required for the high-level expression of these beta-type globin genes in erythroid cells throughout development. The LCR is composed of five 200 to 400 bp DNase I hypersensitive sites (HS1 to HS5) which individually exhibit strong enhancer activity. Many transcription factors are known to bind at the LCR as well as the adult beta-globin gene promoter, including the ubiquitously expressed transcription factor Upstream Stimulatory Factor (USF), which binds tightly to E-box elements and aids in the assembly of transcriptional complexes. Previous studies showed that transfection of dominant-negative USF (A-USF) into murine erythroleukemia (MEL) cells diminished the adult beta-maj-globin expression, while overexpression of USF1 increased beta-maj-globin expression. I herein demonstrate that erythroid cell-specific expression of A-USF in transgenic mice reduces expression of all beta-type globin genes, as well as the association of RNA polymerase II with HS2 and the beta-globin gene promoter. Expression of several key erythroid cell-specific transcription factors was also reduced. Furthermore, A-USF-expressing transgenic mice exhibited defective erythropoiesis. USF has also been implicated in chromatin remodeling, and the phenotype of mice carrying a point mutation of the protein Brahma-Related Gene 1 (BRG1) is similar to that observed in A-USF mice. BRG1 is a subunit of the SWI/SNF chromatin remodeling complex, and is recruited to the locus to promote erythropoiesis through interaction with the erythroid-specific transcription factor Erythroid Kruppel-Like Factor (EKLF). We found that USF and BRG1 reside in a complex, although the exact properties of the interaction remain uncharacterized. In summary, these data demonstrate that USF regulates globin expression indirectly by enhancing erythroid transcription factor expression, and directly by mediating the recruitment of transcriptional complexes to the globin gene locus. The ubiquitously expressed USF may have erythroid-specific effects when associated with erythroid-specific factors, enabling the optimal utilization of resources to promote erythropoiesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shermi Liang.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042050:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042050/00001

Material Information

Title: An Investigation Into the Role of USF in Beta-Globin Regulation
Physical Description: 1 online resource (119 p.)
Language: english
Creator: Liang, Shermi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: beta, biology, cell, culture, eklf, erythroid, erythroleukemia, erythropoiesis, gene, globin, hematopoiesis, hemoglobin, human, k562, mel, molecular, mouse, murine, mus, musculus, regulation, usf
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The human beta-globin gene locus contains five genes organized linearly in the order of their tissue and stage-specific expression (5'-epsilon-Ggamma-Agamma-delta-beta-3'). A region of DNA known as the beta-globin locus control region (LCR) resides upstream of the genes, and is required for the high-level expression of these beta-type globin genes in erythroid cells throughout development. The LCR is composed of five 200 to 400 bp DNase I hypersensitive sites (HS1 to HS5) which individually exhibit strong enhancer activity. Many transcription factors are known to bind at the LCR as well as the adult beta-globin gene promoter, including the ubiquitously expressed transcription factor Upstream Stimulatory Factor (USF), which binds tightly to E-box elements and aids in the assembly of transcriptional complexes. Previous studies showed that transfection of dominant-negative USF (A-USF) into murine erythroleukemia (MEL) cells diminished the adult beta-maj-globin expression, while overexpression of USF1 increased beta-maj-globin expression. I herein demonstrate that erythroid cell-specific expression of A-USF in transgenic mice reduces expression of all beta-type globin genes, as well as the association of RNA polymerase II with HS2 and the beta-globin gene promoter. Expression of several key erythroid cell-specific transcription factors was also reduced. Furthermore, A-USF-expressing transgenic mice exhibited defective erythropoiesis. USF has also been implicated in chromatin remodeling, and the phenotype of mice carrying a point mutation of the protein Brahma-Related Gene 1 (BRG1) is similar to that observed in A-USF mice. BRG1 is a subunit of the SWI/SNF chromatin remodeling complex, and is recruited to the locus to promote erythropoiesis through interaction with the erythroid-specific transcription factor Erythroid Kruppel-Like Factor (EKLF). We found that USF and BRG1 reside in a complex, although the exact properties of the interaction remain uncharacterized. In summary, these data demonstrate that USF regulates globin expression indirectly by enhancing erythroid transcription factor expression, and directly by mediating the recruitment of transcriptional complexes to the globin gene locus. The ubiquitously expressed USF may have erythroid-specific effects when associated with erythroid-specific factors, enabling the optimal utilization of resources to promote erythropoiesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shermi Liang.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042050:00001


This item has the following downloads:


Full Text

PAGE 1

1 AN INVESTIGATION INTO THE ROLE OF USF IN BETA GLOBIN REGULATION By SHERMI YEN LIANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE O F DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Shermi Yen Liang

PAGE 3

3 This work is dedicated to my grandfather Dr. I Teh Wang, who passed away during my second year of graduate studies. As a child, I once promised him that I would become a doctor I hope he would be proud of me, even if

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I would like to thank my mentor, Dr. Jrg Bungert, for giving me the opportunity to perform my doctoral studies in his laboratory. I owe him a great deal for all his help and guidance through these past few years His dedication and endless optimism has been an inspiration for me T hank s go out to my committee members Drs. Thomas P. Yan g, Brian Harfe, and Jianrong Lu for giving time ou t of their busy schedules to serve on my committee and to assist in overseeing my graduate studies Not only have they provided insightful feedback to the thought processes behind the design and implementation of my experiments, but they also took an inter est in my future career plans and have done much to help me on my way. I am grateful to the many past and current members of the Bungert lab that have helped train me during my years there. S pecial thanks go out to Dr. Boris Thurish Dr. Zhuo Zhou, Dr. Val erie Crusselle Davis, Dr. Babak Moghimi, Michael Rosenberg, Joeva Barrow and I Ju Lin I know that in the future, wherever I may go, I will miss Zhuo and Joeva very much. ability to perform comedic antics in the lab but focusing on experiments when necessary Neal Benson and Steve McClellan of the UF ICBR Flow Cytometry core helped me greatly by accommodating my flow cytometry experiments into their busy schedules. Dr. Dan Tuttle of the UF Animal Care Services provided his expert ise and assistance in generating transient transgenic mice. D r. Cortney Bouldin formerly of the Harfe lab, helped me take pictures of mouse embryos I am and will remain eternally grateful to all my friends at the University of Florida that I leaned on fo r support and for whom I supported in return : Amanda W Ada, Nicole

PAGE 5

5 P Aleixo, Arne and Ben S I honestly h I would like to express an apology for not includ ing some name s as it was not my intention to deliberately n eglect anyone I am honored to have been able to make beautiful music despite my meager violin skills with all the members involved in the IDP Chamber Ensemble over the years and am especially grateful to Ellen for starting it. I owe a great deal to my aun t and uncle Jau and Richard Yoh as well as my cousin Eric, for helping me get settled in when I first moved to Gainesville I am glad to have been in this city to witness the transformation of my Uncle entire business from an auto shop to a suc cessful restaurant, and I hope it will grow and continue to flourish for years to come. I wish them the best of luck in their endeavors I would like to thank my wonderful fianc Justin Bickford for everything. No words could ever be enough to express how grateful I am to him for all he has done and all he continue s to do. During these past few years, he has stayed by my side and supported me and witnessed all my ups and downs. He has seen me at my worst and at my best, and helped me through every step of t he way. I look forward to starting our new life together. Finally, I t hank m y parents Dr. Alan Yuh Lin and Yen Liang Quite literally, none of this would ever have been possible without them I would like to th ank them f or being the best role models in my life They set the bar high, and I hope that like they have done, I will always manage to rise up to and overcome any challenge that comes my way.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTERS 1 INTRODUCTION ................................ ................................ ................................ .... 15 Hematopoiesis and Erythropoiesis ................................ ................................ ......... 15 Hemoglobin and Disease ................................ ................................ ........................ 16 Overview of Hemoglobinopathies ................................ ................................ ..... 18 Treatments ................................ ................................ ................................ ....... 19 globin Gene Locus ................................ ................................ ....................... 20 Chromatin Structure and Function ................................ ................................ .......... 21 Histone Modifications ................................ ................................ ....................... 21 Chromatin Remodeling ................................ ................................ ..................... 23 Chromosome Territories and Nuclear Compartmentalization ........................... 24 typ e Globin Gene Regulation ................................ ..................... 25 General Transcription Factors ................................ ................................ .......... 26 Cis acting Regulatory Elements ................................ ................................ ....... 28 globin locus control region (LCR) ................................ .................... 29 Promoter regions ................................ ................................ ....................... 33 Proximal enhancer elements ................................ ................................ ...... 33 Gene competition ................................ ................................ ....................... 34 Trans acting Regulatory Elements ................................ ................................ ... 35 Upstream stimulatory factor (USF) ................................ ............................. 35 GATA 1 and GATA 2 ................................ ................................ ................. 38 NF E2 ................................ ................................ ................................ ........ 39 TAL1/SCL ................................ ................................ ................................ .. 39 Erythroid Krppel like factor (EKLF) ................................ .......................... 40 Co Regulators ................................ ................................ ................................ .. 41 SWI/SNF ................................ ................................ ................................ .... 42 CBP ................................ ................................ ................................ ........... 43 Summary ................................ ................................ ................................ ................ 44

PAGE 7

7 2 MATERIALS AND METHODS ................................ ................................ ................ 48 Cell Culture ................................ ................................ ................................ ............. 48 Cell Cycle Synchronization and Mitotic Arrest ................................ ........................ 48 A USF Transgene Construction ................................ ................................ .............. 49 Generation of Transgenic Mice ................................ ................................ ............... 49 Phenylhydrazine Treatment ................................ ................................ .................... 50 RNA Isolation and Analysis ................................ ................................ ..................... 50 Chromatin Immunoprecipitation (ChIP) and MicroChIP Analyses ........................... 51 Chromatin Conformation Capture (3C) and ChIP 3C (ChIP loop) .......................... 53 Fluorescence Activated Cell Sorting (FACS) ................................ .......................... 54 Nuclear Extraction and Co Immunoprecipitation (Co IP) ................................ ........ 54 Protein Isolation and Immunoblotting ................................ ................................ ...... 55 3 THE CONSEQUENCE OF EXPRESSING DOMINANT NEGATIVE USF IN MICE ................................ ................................ ................................ ....................... 58 Introduction ................................ ................................ ................................ ............. 58 Results ................................ ................................ ................................ .................... 59 Discussion ................................ ................................ ................................ .............. 64 4 THE ASSOCIATION OF USF AND BRG1 ................................ .............................. 76 Introduction ................................ ................................ ................................ ............. 76 Results ................................ ................................ ................................ .................... 77 Discussion ................................ ................................ ................................ .............. 80 5 EXAMINING THE CONFORMATION OF THE BETA GLOBIN LOCUS AT DIFFERENT CELL CYCLE STAGES ................................ ................................ ..... 85 Introduction ................................ ................................ ................................ ............. 85 Results ................................ ................................ ................................ .................... 87 Discussion ................................ ................................ ................................ .............. 90 6 DISCUSSION AND FUTURE DIRECTIONS ................................ .......................... 96 globin Gene Expression by USF .................... 96 Recruitment of Transcription Complexes to the LCR ................................ .............. 97 USF, BRG1, and Transcription Factories ................................ ................................ 99 Therapeutic Strategies ................................ ................................ ............................ 99 Summary ................................ ................................ ................................ .............. 100 LIST OF REFERENCES ................................ ................................ ............................. 103 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 119

PAGE 8

8 LIST OF TABLES Table page 2 1 Partial list of names and sequences of primer pairs u sed for qRT PCR ............. 56 2 2 Partial list of names and sequences of primer pairs used for ChIP .................... 56 2 3 List of names and sequences of primer pairs used for ChIP 3C, Hind III digest ................................ ................................ ................................ .................. 56

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Schematic representation of the structural organization of the human (top) a globin gene loci ................................ .............................. 45 1 2 Summary of proteins and co regulators interacting with LCR element HS2 globin gene promoter ................................ ......................... 46 1 3 Sequence alignment of human (H), mouse (M), and rabbit (R) downstream globin gene ................................ ......................... 47 2 1 DNA construct pITRp543f2AUSF4 used to generat e transgenic mice expressing dominant negative USF (A USF) ................................ ..................... 57 3 1 Analysis of mice expressing A USF ................................ ................................ .... 67 3 2 Analysis of transgenic mous e embryos at different stages of development ....... 68 3 3 Effects of A USF expression on the expression of erythroid genes in embryonic yolk sac cells ................................ ................................ ..................... 69 3 4 Effects of A USF expression on the expression of erythroid cell specific transcription factors in 10.5 dpc embryonic yolk sac cells ................................ .. 70 3 4 Generation and analysis of 11.5 dpc tr ansient transgenic mouse embryos expressing A USF ................................ ................................ .............................. 71 3 5 ChIP analysis of RNA Pol II and USF1 association with LCR element HS2 and the GAPDH gene in the yolk sac of wild type and A USF transgeni c embryos ................................ ................................ ................................ .............. 72 3 6 Interaction of USF with regulatory elements of genes encoding hematopoietic specific transcription factors in MEL cells ................................ .... 73 3 7 Interaction of USF with regulatory elements of genes encoding hematopoietic specific transcription factors in fetal liver cells ............................. 74 3 8 Transgenic A USF embryos reveal a reduction in the number of CD71 + and Ter 119 + erythroid cells ................................ ................................ ...................... 75 4 1 Comparison of hypomorphic BRG1 ENU1/ 12.5 dpc mutant embryos with A USF 11.5 dpc transgenic male embryos ................................ ............................. 82 4 2 globin locus in uninduced and induced (1.5% DMSO, 72 h) MEL cells ................................ ...... 82

PAGE 10

10 4 3 globin locus in uninduced and induced (1.5% DMSO; 24, 48, or 72 h) MEL cells ................................ ............................ 83 4 4 Immunoblot analysis of Co IP on nuclear extract from uninduced and induced (2% DMSO, 24 h) MEL cells ................................ ................................ ............... 83 4 5 Analysis of ChIP 3C ligation products from induced (1.5% DMSO, 72 h) MEL cells ................................ ................................ ................................ .................... 84 4 6 Model of USF2/CBP/BRG1 globin LC R ................................ ................................ ................................ .......... 84 5 1 Representative flow cytometry analysis of untreated (unsynchronized) and drug treated (synchronized, mitotic arrest) K562 cells stained with propidium iodide ................................ ................................ ................................ .................. 93 5 2 Analysis of ChIP from synchronized (harvested at time 0) or mitotically arrested K562 cells ................................ ................................ ............................. 93 5 3 qPCR analysis of ChIP on various phosphorylation states of RNA Pol II in synchronized and mitotically arrested K562 cells ................................ ............... 94 5 4 Analysis of ChIP from synchronized K562 cells harvested at the indicated time points (0, 45 min, 2 h) ................................ ................................ ................. 94 5 5 3C Analysis of synchronized K562 cells ................................ ............................. 95 6 1 YAC) and changes in expression patte rn when expressed in transgenic mice .......... 101 6 2 Model depicting USF and BRG1 globin gene expression ................................ ................................ ................................ ........ 102

PAGE 11

11 LIST OF ABBREVIATION S ChIP Small 3C Chromatin Conformation Capture ACH Active Chromatin Hub A USF Dominant negative USF bHLH LZ basic Helix Loop Helix Leucine Zipper BRG1 Brahma Related Gene 1 CBP CREBBP; CREB Binding Protein ChIP Chromatin Im munoprecipitation Co IP Co Immunoprecipitation CTD Carboxy Terminal Domain of RNA Polymerase II DMSO Dimethylsulfoxide Dpc Days post coitum EKLF Erythroid Krppel Like Factor FACS Fluorescence Activated Cell Sorting HAT Histone A cetyltransferase HDAC Hist one Deacetylase HLH Helix Loop Helix HS Hypersensitive Site HSC Hematopoietic Stem Cell IgG I mmunoglobulin G K562 cells Human Erythroleukemia cells LCR Locus Control Region LZ Leucine Zipper MARE M af R ecognition E lement

PAGE 12

12 MEL cells Murine Erythroleukemia cel ls p300 E1A binding protein p300; EP300 PIC Transcription Pre Initiation Complex q PCR Quantitative (Real Time) Polymerase Chain Reaction qRT PCR Quantitative (Real Time) Reverse Transcription Polymerase Chain Reaction RBC Red Blood Cell (Erythrocyte) RNA Pol II RNA Polymerase II RT PCR Reverse Transcription Polymerase Chain Reaction TG Transgenic TSS Transcription Start Site USF Upstream Stimulatory Factor WT Wild Type YAC Yeast Artificial Chromosome YS Yolk Sac YAC Human globin Gene Locus Yeast Artifi cial Chromosome

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy AN INVESTIGATION INTO THE ROLE OF USF IN BETA GLOBIN GENE REGULATION By Shermi Yen Liang July 2010 Chair: Jrg Bungert Major: Medical Sciences -Genetics globin gene locus contains five genes organized linearly in the order of their tissue and stage specific expression G A A region of DNA known as t he globin locus control region (LCR) resides upstream of the genes and is requ ired for the high level expression of the se type globin genes in erythroid cells throughout development. The LCR is composed of five 200 to 400 bp DNase I hypersensitive sites (HS1 to HS5) which individually exhibit strong enhancer activity. Many transcr iption factors are known to bind at t he LCR as well as the adult g lobin gene promoter including t he ubiquitously expressed transcription factor Upstream Stimulatory Factor (USF) which binds tightly to E box elements and aids in the assembly of transcri ption al complexes Previous studies show ed that transfection of dominant negative USF (A USF) into murine erythroleukemia (MEL) cells diminished the adult maj globin expression while maj globin expression. I herein demon strate that erythro id cell specific expression of A USF in transgenic mice reduces expression of all type globin genes, as well as the association of RNA p ol ymerase II with HS2 and the globin gene promoter Expression of s everal key erythroid cell spec ific transcription

PAGE 14

14 factors was also reduced Furthermore, A USF expressing transgenic mice exhibit ed defect ive erythropoiesis USF has also been implicated in chromatin remodeling, and the phenotype of mice carrying a point mutation of the protein Brahma R elated Gene 1 (BRG1 ) is similar to that observed in A USF mice. BRG1 is a subunit of the SWI/SNF chrom atin remodeling complex, and is recruited to the locus to promote erythropoiesis through interaction with the erythroid specific transcription factor Eryt hroid Krppel Like Factor (EKLF ) We found that USF and BRG1 reside in a complex, although the exact properties of the interaction remain uncharacterized In summary, the se data demonstrate that USF regulates globin expression indirectly by enhancing eryth roid transcription factor expression, and directly by mediating the recruitment of transcriptional complexes to the globin gene locus. The ubiquitous ly expressed USF may have erythroid specific effects when associated with erythroid specific factors, enabl ing the optimal utilization of resources to promote erythropoiesis.

PAGE 15

15 CHAPTER 1 INTRODUCTION Hematopoiesis and Erythropoiesis The process of hematopoiesis begins fro m hematopoietic stem cells (HSC ), which give rise to all blood cell types of both myeloid a nd lymphoid lineages (1) Cell types in the myeloid lineage include granulocytes and erythrocytes (or red blood cells, RBC) Cell types in the lymphoid lineage include l ymphocytes a type of non phagocytic white blood cell involved in the vertebrate immune system Lymphocytes can be found in blood, lymph, and lymphatic tissues while granulocytes and erythrocy tes are restricted to blood In a typical circulatory system, granulocytes are larger in size but less abundant than erythrocytes They are also able to move about under their own power by am o eboid movement, unlike erythrocytes, which rely on the pumping o f the heart and blood flow for mobility (2) Because mature blood cells have undergone terminal differentiation, they have a finite life span and are generally incapable of mitosis Thus, the body must rely on the constant self renewal and pluripotency of HSCs in order to generate new mature blood cells Environmental influences and v arious growth factors such as erythropoietin, thrombopoietin, and interleukin, signal the differentiating cells to assume the desired lineage (1) HSCs first differentiate into either a multipotent lymphoid progenitor or a multipotent myeloid progenitor Lymphoid progenitors then give rise to T cell and B cell progenitors, which are involved in the immune response against foreign substances (3) M yeloid progenitors give rise to myeloblasts and erythroblasts. Myeloblasts are the precursors to granulocytes while erythroblasts eventually undergo erythropoiesis to become erythrocytes (4)

PAGE 16

16 Under stimulation by specific growth factors, m yeloid progenitor s differentiate into erythroid burst forming unit s (BFU E) a nd then erythroid colony forming unit s (CFU E). CFU E s then differentiate into a series of various erythroblasts, finally undergo ing enucleation to yield reticulocytes and eventually mature erythrocytes (4) Erythrocytes contain n o nucleus or organelles, and have a flat biconcave d isk shape which helps maximize their surface area to facilitate gas exc hange (3) These mature red blood cells are responsible for the delivery of oxygen from the lungs to tissues throughout the body and also for carry ing carbon dioxide from th ose tissues back to the lungs In human adults, p roduction of erythrocytes from HSCs in the bone marrow is carefully controlled by a negative feedback system t hat senses the amount of oxygen reach ing tissues from the blood (5 ) Under hypoxic conditions in which tissues do not receive enough oxygen, the kidneys convert a membrane protein into the excreted hormone erythropoietin which stimulates the bone marrow to produce more erythrocytes (3) When the tissues then receive more oxygen, the kidneys cease production of erythropoietin. Hemoglobin Struc ture and Disease I n order to carry out their function of transporting oxygen and carbon dioxide throughout the body, erythrocytes utilize the hemoglobin molecule The protein portion of hemoglobin is a tetramer comprised of a homo dimer of two hetero dimers of globin chains (6) In humans, embryonic hemoglobin 2 2 ), 2 2 ), and the majority of adult hemoglobin (HbA) con 2 2 ) (7,8) Embryonic and f etal hemoglobin bind oxygen with higher affinity than the adult form, facilitating exchange from the mother s bloodstream to the developing embryo (9) Embedded in

PAGE 17

17 each globin chain is a non covalently bound ring shaped heme group containing a central iro n (Fe) atom, which is the site of reversible oxygen binding (10) Mutations in the genes that encod e the globin chains can cause defective and/or imbalanced globin chain synthesis, resulting in serious hemogl obinopathies, or blood diseases. However, many of these mutations can have protective effects agai nst malaria, and thus these mutations are more prevalent in people of African, Indian, and Mediterranean descent areas where there are a lso high incidences of malaria (11) Malaria is caused by parasitic protists of the genus Plasmodium and humans can be infected by four different species: P. falciparum (the most common cause of severe malaria) P. vivax P. ovale and P malariae (12) Infection by Plasmodium is facilitated by the mosquito, which injects the protists into human blood fro m its saliva The parasites take up residence in the liver, and release more into the bloodstream where they then invade circulating erythrocytes and reticulocytes (12) The protists consume and metabolize hemoglobin, enlarg ing unt il they fill the cell completely, which subsequently lyses the infected erythroid cells (12) A set population does not lyse the cells, however, and instead produce s gametocytes, which can be taken up by mosquitoes and consequently injected to other human hosts, re start ing the infection process. H eterozygous individuals who carry one copy of a normal globin allele and one copy of a diseased globin allele often show increased resistance to the consequences of malaria due to the more rapid turnover of sickle cell eryt hrocytes or other diseased erythrocytes Thus, heterozygous individuals have higher r elative fitness than individuals who are homozygous for either the normal globin allele or a disease d globin allele (13,14)

PAGE 18

18 Over view of Hemoglobinopathies S ickle cell disease and thalassemia s are both hemoglobinopathies that arise as a result of genet ic defects but differ in their classification and effect S ickle cell disease is caused by an aberrant globin chain structure while thalassemias are caused by an abnormally low quantity of globin chains T he two disease phenotypes are not mutually exclusive as a single indi vidual may be affected by both. globin chain structural variants have been identified, and s ickle cell disease is specifically caused by the aberrant globin chain HbS (15) In HbS, a single base pair mutation in the globin gene causes a glutamic acid at amino acid position 6 to be mutated to a valine (1,16) Under low oxygen conditions, t his causes the globin chains to form insoluble fibers, and e rythrocytes containing these aberrant cha ins assume an abnormal rigid sickled shape characteristic of the disease. Sickle cell erythrocytes can obstruct capillaries and restrict proper blood flow causing extreme pain and possible internal o rgan damage (3) Thalassemia is the most common monogenic disease worldwide. Approximately 300,000 to 500,000 infants a year are b orn with this disease, and it is estimated that 7% (17) Thalassemias are classified first based on which globin chain is affected ( / ) and second based on the severity of the disease. thalassemias are caused by any number of mutations that either reduce or completely eliminate the expression of the ad globin gene. There are over 200 known mutations thalassemia patients that cause this disease (18) The mildest form thalassemia minor, a mild microcytic a nemia that is typically asymptomatic and is characterized by reduced levels of globin gene expression most often caused by mutations in transcription regulatory elements (19) The most severe

PAGE 19

19 thalassemia major, which is associated with a severe microcytic hyperchromic anemia, and is characterized by the complete absence of chain synthesis. In bet thalassemia intermedia which is characterized by a moderate to severe anemia (20) thalassemia, the reduced globin chains can lead to imbalanced chain synthesis, causing aggregation and overproduction glob in chains. Erythrocyte precursors containing these aggregates are broken down in either the bone marrow or peripheral blood, which is what l eads to the anemic phenotype (11) Treatments For many sickle cell patients, the administration of h ydroxyurea can alleviate symptoms. Hydroxyurea increases the amount of fetal hemoglobin in the blood, although the precise mechanism by which it acts is not completely known (16) Currently, no cure for severe forms of thalassemias exi st s and the limited treatments available for patients i nclude complications. Most conventional treatments are based primarily on blood transfusions Unfortunately, with receiving frequent blood transfusions, iron chelation therapy also becomes necessary i n order to prevent iron overload damage to internal organs (21,22) Since this process is tedious and painful, most patients cho o se not to endure it In a 2000 study by Modell et al., it was found that 50% of thal a ssemia patients in the U.K. die before the age of 35, mostly as a result of noncompliance (23) Iron overload can also suppress the p roduction of erythropoietin, which may (24) Alternatively, bone marrow transplants offer a more curative approach, but this requires finding a suitable donor and is depend e

PAGE 20

20 globin Gene Locus type globin genes, which encode for the s of the hemoglobin mo lecule, occurs exclusively in erythroid cells In humans, globin gene locus is located on chromosome 11 while it is l ocated on chromosome 7 in mice. T globin gene locus and its developmental regulation is conserved between the two species (Figure 1 1) T he type globin genes are arranged linearly in the order of their developmental and ti ssue specific expression, with the embryonic genes located at the 5 globin gene locus, and the adult genes located at the 3 end (1,25) Both the human and murine type globin genes are also under th e control of a powerful regulatory element known as the locus control region (LCR), which resides 6 to 2 2 kb upstream of the embryonic gene s in both species (25,26) globin is expressed during the firs t 6 weeks of gestation in primitive erythroid cells originating from the embryonic yolk sack During development, expression switches to erythroid cells generated during fetal liver hematopoiesis, where globin, G A In a final switch completed shortly globin genes are globin are expressed in erythroid cells that mature during bone marrow hematopoiesis Alt hough it also globin is expresse d at 5% globin expression levels due to a mutation in its promoter region (26) Unlike its human counterpart, the murine globin locus contains h1 which are co expressed in the embryonic yolk sac; maj min which are expressed in the fetal liver and adult bone marrow. In mice, the switch from embryonic to fetal/adult expression occurs at 12 days post coitum (dpc).

PAGE 21

21 Chromatin Structure and Function In order to fit the entire genome into a single cell nucleus, eukaryotic DNA is packaged into nucleosomes and subsequent hierarchical organizational structures. Each nucleosome core particle is co mprised of a histone oct a mer containing two copies each of histones H2A, H2B, H3, and H4, with 145 147 DNA base pairs wound around each octomer (27,28) This arrangement of nucleosomes is commonly referred to as nucleosomes, establishing a higher level of organization coiled into a helical 30 nm fiber (29,30) Additional compaction occurs and leads to higher order chromatin structure, but the exact architecture beyond the 30 nm fiber is unknown. Histone Modifications In addition to the globular carboxy terminal domains that make up the core nucleosome, histones also have flexible amino terminal tail s that protrude outward from the nucleosome (27) These N terminal tails are known to undergo post translational modifications, which can affect the accessibility of the chr omatin and underlying DNA (31) These modifications include, but are not limited to, acetylation, methylation, phosphorylation, glycosylation ubiquitination, sumoylation, ADP ribosylati on, and carbonylation (32,33) The different combinations of these modifications at multiple and (34,35) The functional outcome of these histone modifications, in terms of chromatin structure and gene expression, depends on the modification and the amino acid residue(s) modified. Methylation of histones is carried out by transferring a methyl group from the donor S adenosyl L methionine (SAM) to either the NH 2 group of lysine (K) or the or

PAGE 22

22 NH 2 of arginine (R) residues (36) Histone 3 (H3) K4, K9, K27, K36, and K79, and histone 4 (H4) K20 can be mono di or tri methylated by the addition of o ne, two, or three methyl groups, respectively. A rginine residues are either mono methylated, or symmetrically or asymmetrically di methylated (36) The transcriptional impact of histone methylation depends on the residue modified and the methylation status Methylation of H3K9 and K27, as well as H4K20 residu es has generally been found to be associated with heterochromatin and gene silencing, while methylation of H3K4, R17, R26, K36, and K79 has generally been found to be associated with euchromatin and active genes (37 ,38) Histone methylation w as once considered irreversible but in 2004 it was demonstrated by Shi et al. that LSD1 /KDM1 is capable of demethylating mono and di methylated lysines, specifically H3K4 and H3K9 (39) Since then, several additional lysine demethylases have been identified, including Jumonji histone demethylases (JHDM), a family of demethylases which contain the Jumonji C (JmjC) domain (38,40) Histone acetylat ion occurs at lysine residues and is c arried out by a group of enzymes known as histone acetyl transferases (HATs) During acetylation, the acetyl moiety from the donor a cetyl C oenzyme A (acetyl CoA) is transferred to the NH 2 group o f lysine. H istone dea cetylases (HDACs) catalyze the reverse reaction where CoA serves as an acceptor of the acetyl moiety instead (41) Histone 3 can be acetylated at H3K9, K14, K18, and K23, while histone 4 can be acetylated at H4K5, K8, K12, and K16 These acetylated histone tails can serve as signal s for trans acting factors containing bromodomains, which recognize acetylated lysine residues (42)

PAGE 23

23 Chromatin Remodeling Chromatin remo deling complexes are essential for regulating the binding of transcription factors as well as gene expression Some complexes alter the chromatin structure to increase DNA accessibility for transcription, while others help generate chromatin structures tha t promote long term gene silencing. Adenosine triphosphate ( ATP ) depend e nt remodeling complexes use the energy from ATP hydrolysis to disrupt interactions between DNA and histones, which can cause changes in the structure and positioning of nucleosomes (43) At least five families of c hromatin remodelers are known in eukaryotes: SWI/SNF, ISWI, NURD/Mi 2/CHD, INO80, and SWR1 (43 45) SWI/SNF is a 2 MDa multisubunit complex that is highly conserved in eukaryotes, and will be discussed later in thi s chapter in more detail The SWI/SNF family of chromatin remodelers contain a bromodomain that targets these enzymes to histones with acetylated lysine residues on their N terminal tails (46) They primarily act a t gene promoters to promote transcription factor binding and transcriptional activation but have also been implicated to have repressive activity (47) ISWI complexes appear to slide nucleosome s and play a role in the ordering and spacing of nucleosomes following DNA replication (48,49) They recognize histone tails as well a s the linker DNA between nucleosomes, and act primarily to repress transcription (50,51) Similarly, the NURD complex es ha ve been found to act as repressor s while INO80 complexes appear to evict nucleosomes from b reak sites to help facilitate the repair of double strand ed DNA break s (52,53) SWR 1 acts by replacing core histones with histone variants, such as exchanging H2A for histone variant H2A.Z (54,55) Th is hi stone variant has been implicated in both transcription activation an d repression, and in some circumstances, is required for the recruitment of RNA Pol II and TBP (56,57) In mamma ls, H2A.Z is

PAGE 24

24 essential, as H2A.Z / null mice are embryonic lethal (58) All of these complexes play a role in mediating gene regulation by altering the chromatin structure, which thereby affects the binding of factor s Chromosome Ter ritories and Nuclear Compartmentalization The genome is arranged into discrete chromosome specific territories, and chromatin can also be divided into two subcategories: heterochromatin and euchromatin (59,60) In general, h eterochromatin is associated with silenced genes and condense d chromatin, while euchromatin is associated with active genes and a more open chromatin structure (59) Chromatin is highly dynamic, as the selective expression of genes residing in various chromatin structures is nec essary to ensure proper gene regulation during development. Genes needed to be silent may remain condensed, while inducible or constitutively active genes must remain accessible. Chromatin itself can pose a barrier to transcription, as nucleosomes may hind er the association of the transcriptional machinery with the underlying DNA. In addition to the physical packaging of DNA into nucleosomes and higher order structures, t he eukaryotic cell nucleus itself is highly compartmentalized, both structurally and fu nctionally (61) Studies have found that both centromeric and telomeric se quences, which are primarily heterochromatic, anchor chromatin to the nuclear periphery, an area of the cell that is typically associated with repression (62,63) During replication and mitosis, chromatin undergoes dramatic rearrangement in organization and structure In addition to temporal regulation by the timing of the cell cycle, replication and transcription ar e also spatially regulated, and occur in separate and di stinct areas of the nucleus known as factorie s (64) Presumably, a chromati n region that is engaged in active transcription would first need to dissociate from its

PAGE 25

25 transcription factory and be relocated to a re plication fac tory for replication, and after replication it would relocate back to transcription factories (65) Transcription is not ubiquitous throughout the n ucleus, but instead occurs in transcription factories which are regions enriched with the active elongating form of RNA polymerase II (66 68) Many a ctive and highly expressed genes are transcribed in these trans cription factories and m ultiple genes undergoing transcription can also occupy the same factory or space (69) It is not known what nucleates transcription factories, and some data suggests that genes poised for t ranscription are repositioned to transcription factories rather than directly undergoing the de novo assembly of a factory (69) T globin gene itself has been shown to associate with transcription factories in erythroid cells (61) D globin gene migrates away from the nuclear periphery and peri centromeric heterochromatin (61) globin locus control region ( LCR ) not only reduces the expression of the type globin genes by 25 to 100 fold, but also affects the nuclear positioning of the locus during development (61,70) C type G lobin Gene Regulation Transcription initiation is a multi step process It begins with n ucleosome remodeling, then binding of transcription factors and co activators to enhancers and promoters, which finally lead s to the recruitment of basal transcription machinery to the core promoter (71) These events must all take place before transcription type globin genes can occur. In addition to general transcription factors, v arious cis and trans regulatory elements both erythroid specific and ubiquitous, are known to function in order to activate or enhance the expression of the type globi n genes These regulatory elements are described below.

PAGE 26

26 General Transcription Factors The process of generating RNA from DNA is termed transcription, and is accomplished by RNA p olymerases At least five different RNA p olymerases are known to exist in euka ryotes, although two RNA p olymerase IV and V are unique to plants. RNA p olymerase I generates RNA sequences that are later processed into 1 8s and 28s rRNAs while RNA p olymerase II (RNA Pol II) generates mRNAs and a variety of functional small RNAs (e.g. U1 to U5 RNA involved in splicing) and RNA p olymerase III generates cellular 5s rRNA and tRNAs (72 74) Because RNA Pol II generates mRNAs, which contain the information needed to produce the proteins necessary fo r the cell to function, it is the RNA p olymerase most extensively studied A wide range of transcription factors are required for RNA Pol II to bind to its promoters and initiate transcription. The transcriptional machinery required for transcriptio n by RN A Pol II include but are not limited to, the transcription factors TFII A, TFII B, TFII D TFII E, TFII F, and TFII H (71) Binding of TFII D to the promoter is thought to be the first step in activating transcription. TFII D is a multi component transcription factor that contains a DNA binding subunit known as the TATA binding protein ( TBP ) a s well as approximately 13 TBP associated factors (TAFs) This subunit recognizes a region of DNA located upstream of certain genes known as the TATA box, which contains the core sequence 5 TATAAA 3 In humans, the TATA box generally resides 25 30 nucleo tides upstream of the transcription start site (TSS). Following the binding o f TFII D TFII A binds next and serves to stabilize the interaction between TFII D and the TATA box (75,76) TFIIB associates with TFII D at the promoter and directly recruits RNA Pol II to the TSS TFII F is required for the stable

PAGE 27

27 association of RNA Pol II with the pre initiation complex (PIC) (77) After formation of the TFII D/TFII B/RNA Pol II/TFII F complex, TFII E and TFII H are re cruited (78) TFII E not only serves to both help recru it TFII H to the PIC but also to stim ulate TFII H activity TFII H has three crucial functions during the process of transcription initiation as an ATP depend e nt ATPase, an ATP dependent helicase, and a RNA Pol II carboxy terminal domain (CTD) kinase (78) Not all genes contain a TATA box, however, and these employ the use of an initiator element (INR), downstream promoter element (DPE) or downstream core element (DCE) in transcription initiation (71) The INR is a pyrimidine rich region that surrounds the TSS, and is capable of directing accurate transcription initiation either alone or with TATA and other core elements (78) Interaction of TAFs with the INR, DPE, and DCE allow TFII D to recognize TA TA less promoters which TBP binds to with less affinity than the TATA sequence The INR, DPE, and DCE can also act in TATA containing genes by enhancing the strength of the promoter (71) Additionally, many eukaryotic gene promoters contain a TFII B recognition element (BRE), which resides upstream and downstream of the TATA box and is bound b y TFII B. Binding of TFII B to t he BRE is thought to help orient the directionality of the tran scription PIC (79) After formation of the transcript ion PIC, TFII H phosphorylates the CTD of RNA Pol II. Th e RNA Pol II CTD contains the tandem heptapeptide repeat Tyr Ser Pro Thr Ser Pro Ser ( YSPTSPS ), which is repeated 52 times in humans (78,80) Both the serine 5 (Ser 5) and the serine 2 (Ser 2) residues of this heptapeptide repeat can be phosphorylated, which regulate different s teps in the transcription cycle: initiatio n and elongation, respectively. Through its helicase activity TFII H melts the DNA. Both of

PAGE 28

28 these events performed by TFII H lead to transcription initiation and the binding of DRB Sensitivity Inducing Factor ( DSIF ) to RNA Pol II (81) DSIF then recruits Negative Elongation Factor (NELF) which momentaril y arrests transcription (82) During this end capping enzymes are recruited through interactions with the Ser 5 phosphorylated CTD and DSIF (83) end capping has taken place on the nascent mRNA P TEFb bin ds to RNA Pol II and phosphorylates both Ser 2 of the RNA Pol II CTD as well as DSIF. Phosphorylation of DSIF neutralizes the inhibitory behavior of NELF, which leads to transcription elongation and the eventual transcription coupled recruitment of 3 end processing factor s (78,83) Cis acting Regulatory Elements C is acting DNA regulatory elements contain binding sites which recruit transcription factors and/or members of the PIC, and thereby regulate transcription. These regulatory elements include promoters, enhancers, and locus control regions, which are classified based on their varying functions and location s relative to the gene which they act upon Promoters are proximal regulators, typically located upstream and adjacent to the genes they regulate, while enhancers and locus control regions (LCRs) are distal regulators. Enhancers can function with heterologous promoters in a position and orientation independent manner, while LCRs are able to activate gene expression in a tissue specific, copy number dependent, and position independent manner (84) The type globin genes are subject to regulation by the globin LCR, which resides upstream of the genes. LCRs were also first identified in the globin locus, and are thought to have chromatin opening act ivity. This was observed i n globin locus, where the locus remain ed in a relative open conformation despite its location of integration, indicating resistance to

PAGE 29

29 position effects (85) A p osition effect is described as the effect on expression of a gene depending on the in the genome. The genes surrounding a location of integration can affect its conformation and may consequently reduce or enhance its expression levels Additionally, in thalassemia patients carrying the Hispanic deletion, in which an approximately 35 kb region of the LCR is deleted but the rest of the globin locus remains intact the entire locus resides in a closed chromatin conformation (86) In addition to the LCR, t he main regulat ory elements that mediate tissue specific regulation of the adult globin gene are located proximal to the gene, including the 5 promoter, downstream promoter elements, an intronic enhancer, and a 3 enhancer (87,88) All of t hese elements likely work together in order to media te the tissue and the developmental stage specific expression of the type globin genes The globin l ocus c ontrol r egion (LCR) globin LCR is a n important cis acting regulatory domain that is crucial for high level expression of the type globin g enes during all stages of erythroid development (89) I t is comprised of several erythroid specific DNase I h ypersensitive s ites (HS ) each separated from an other by 2 4 kb of flanking DNA These HSs contain several putative and confirmed binding s ites for various regulators and co regulators. Thus, t he LCR can serve as the primary recruitment site for protein complexes that mediate both chromosome remodeling and type globin genes (90) In humans, the LCR contains five HSs (HS1 to HS5) which have varying functions but work together to activate the type globin genes. Each HS contains a core region of 200 400 bp. HS5 is present in multiple cell lineages and behaves as an insulator, while HS1 to 4 are only present in erythroid cells (91 93) HS3 is required for chromatin

PAGE 30

30 opening, while HS2 behaves as a classical enhancer and also has the most powerful enhancing activity (94,95) HS2 contains binding sites for regulators and co regulators that also bind to the adult globin promoter (Figure 1 2). Some transcription factors known to be involved in LCR mediated activation of globin gene transcription include the hematopoietic specific proteins GATA 1, EKLF, NF E2, and TAL1 as well as the ubiquitously expressed t ranscription factor USF. These t rans acting factors involved in the transcription pre initiation complex formation colocalize to the LCR and are thought to be subsequently transferred to the appropriate gene for transcription initiation (26) Se veral mechanisms for this interaction have been postulated, such as tracking and looping model s The tracking model of LCR function A tracking model of LCR function was proposed based on the observation that LCR HS2 initiates the formation of long non cod ing transcripts (96) Most of this non coding transcription proceeds uni directionally toward the globin genes. According to the tracking model, the LCR recruits transcription complexes that track along the DNA until they reach the globin gene promoters. The model explains the chromatin opening function of the LCR because elongating transcription complexes in eukaryotic cells h arbor chromatin modifying activities that either remodel nucleosomes or modify histone tails (97) It also explains the enhancer function, because the mechanism of tracking would deliver the polymerase to the genes. Several recent findings support an RNA Pol II tracking based mechanism for globin activa tion. Insulators placed between the LCR and the globin genes diminish globin genes (98,99) Furthermore, it has recently not only been

PAGE 31

31 demonstrated that an insulator placed between the LCR and t globin gene represses expression of the downstream gene but also, and perhaps more importantly, that RNA Pol II transcription complexes accumulate at the insulator (99) The role of intergenic transcription in modulation of chromatin structure is so mewhat controversial. Inhibiting transcription elongation by DRB (5,6 dichloro 1 D ribofuranosylbenzamidazole) in erythroid cells has no effect on chromatin modifications downstream of the LCR, suggesting that transcription elongation is not required for chromatin opening (100) DRB mediated inhibition also fails to prevent conformational changes that bring LCR and globin genes in close proximity (101) It should be noted however that recent studies demonstrated that long non coding transcription is relativel y insensitive to DRB (102) The fact that deletion of the murine endogenous LCR does not affect DNase I sensitivity or increase in histone acetylation in the remainder of the globin gene locus also argues against the hypothesis that LCR initiated intergenic transcription is required to open chromatin structure (87) Furthermore a recent study has shown that intergenic transcrip tion does not correlate with open chromatin domains in the globin gene locus, and inhibition of dicer causes an increase in the abundance of intergenic transcripts (103) This suggests that intergenic transcription could, in fact, have a negative role in mediating silencing of globin locus domains that are inactive at specific developmental stages. The looping m odel of LCR f unction The looping model prop oses that LCR HSs interact with the globin genes to activate transcription (104,105) This interaction may be mediated by transcription factors and co factors that interact with the HSs and the globin gene promoters. In this view the looping model is a contact model, suggesting

PAGE 32

32 direct contacts betw een the regulatory elements and the genes. However, it is also possible that there are no direct interactions between the LCR and the genes but that these elements instead are brought together in close physical proximity to allow transfer of activities fro m the LCR to the genes or to allow modifications of promoter bound activities by those recruited to the LCR. The recently applied chromatin conformation capture ( 3C ) technology, which assays proximities between genes and regulatory elements, does demonstra te that the LCR and actively transcribed globin genes are in close proximity in the context of an ACH, or active chromatin hub (106) However, how close these elements come together is not known. A more open and perhaps dynamic globin globin genes rapidly switch their interactions with the LCR and al so with previously proposed competition models (104,107) While t he transcription tracking mechanism may explain gene activation it is not known how looping can lead to the enhanced expression of the globin genes LCR mediated gene activation either results in enhanced recruitment of transcription complexes to the globin genes and/or in the conversion of transcription initiation complexes to elongation active complexes (26,1 08) This could be achieved by providing activities that are first recruited to the LCR and subsequently transferred to globin genes. For example, transcription complexes could first be recruited to the LCR and looping would mediate the transfer to the gl obin gene promoters. The ACH would provide a high local concentration of transcription factors that could efficiently capture transcription complexes which would then be recruited to and positioned at the basal promoters of the globin genes to engage in pr oductive transcription. Alternatively, or

PAGE 33

33 additionally, elongation incompetent transcription complexes may be recruited to the genes while the LCR provides activities necessary for activation, for example kinases that phosphorylate Ser 2 at the RNA Pol II CTD or co regulator complexes that modify chromatin structure at the globin gene promoters either to enable recruitment of transcription complexes and/or to allow elongation. Promoter r egions The human adult globin promoter consists of basal promoter el e ments and regulatory sequences (88) T he basal promoter contains a TATA like sequence ( CATAAA ) and an initiator, both of which interact with co mponents of the TFII D complex (109,110) The upstream promoter region contains important elements for tissue and stage specific regulation including multiple binding s ites for GATA 1 and EKLF (or Sp1). Both EKLF and Sp1 are thought to interact with the promoter at the 90 CACCC motif (111,112) T he promoter region also includes two E box motifs that are conserved between humans and mice (Figure 1 3) One E box overlaps with the initiator while the other one resides d ownstream from the transcription start site at +60. The downstream E box is required for high level in vitro transcription globin gene (113) It is believed that the upstream E box is bound by the general transcription factor TFII I and ubiquitous transcription factor USF1 while the downstream E box is bound by a USF1/USF2 het erodimer. There is also a partial Ap1/MARE like (maf recognition element ) binding site at +24 which has been shown to bind NF E2 with low affinity (113) Proximal e nhancer e lements globin locus, b ot h the globin gene and the globin The globin

PAGE 34

34 bp downstream of the polyadenylation site of the A globin gene and is less than 750 bp in length (114) The role of th is 3 during development and in the expression type gene s is widely disputed. It has been implicated as a stage specific silencer as well as reported to have no function at all (115) However, in a study where the region was deleted in transge nic mice carrying a yeast artificial chromosome containing the entire human globin gene locus YAC) no effect on the high level, stage specific or position independent expression of any of the human globin genes was observed (116) T may have a functionally redundant r ole in conjunction with other cis regulators in the locus. The globin about 2.2 kb downstream of the promoter region, 500 to 850 bp downstream of the polyadenylation site (117) This enhancer contains four binding sites for GATA 1 and confers high level expression ( 118) Whereas deletion of the A YAC transgenic mice had no effect d globin gene expression (119) The adult globin is known to regulate transcription in both a tissue and developmental stage specific manner (120 123) When the the human globin gene was end of the human A globin gene in transgenic mice, the A similar to that of the adult gene (124) Gene c ompetition It has been suggested globin genes compete for interaction with the LCR, and that only one gene is transcribed at a time (104,105) T his theory postulates that only one active gene can come into contact with the LCR at any given time (125) Gene competition in the globin gene locus was first observed when transgenic mice

PAGE 35

35 were generated using various constructs containing the LCR linked to spec ific globin genes (126,127) W hen the LCR was linked directly to only the globin was expressed in the embryo, and to a lesser degree, in the adult mouse. When the LCR was linked directly to only th globin was expressed at globin genes were linked to the LCR, normal developmental expression was restored. This indicates that there may be a preferential in globin gene globin gene during the adult stage of expression. Additionally, t he relative position of the genes with respect to the LCR is also important f or c orrect developmental expression. If the gene order relative to the LCR is i nvert ed in transgenic mice an aberrant expression pattern is observed, in which globin is expressed in embryonic cells, and globin gene expression remains silent throughout development (128,129) Trans acting Regulatory Elements globin gene expression. These proteins function as DNA binding transcription factors, as co regulator s modulating chromatin structure and/or recruiting transcription complexes, and as architectural proteins that change the conformation and perhaps nuclear localization of the globin locus during differentiation and development. These factors include the ub iquitously expressed transcription factor USF, and the hematopoietic specific proteins GATA 1 & GATA 2 NF E2 (p45) TAL1 and EKLF. Upstream s timulatory f actor (USF) USF is a ubiquitously expressed transcription factor that binds to DNA E box motifs and h as been associated with the transcription of many cellular and viral genes

PAGE 36

36 (130) It belongs to a family of transcription factors characterized by their basic helix loop helix leucine zipper (bHLH LZ) DNA binding d omains (131) T here are currently two known members of this family: USF1 (44 kDa) and USF2 (43 kDa). These two USF proteins bear close simila rities to one another except at the N terminus, and they also share a small but extremely conserved nuclear localization domain termed the USF specific region (USR), located just upstream of the basic region (132) The predominant form of USF is a USF1/USF2 heterodimer, although homodimers are known to exist in various degrees across cell types (133) The bHLH LZ DNA binding domain is not uniq ue to the USF family, and is also present in the Myc family of regulatory proteins. Like c Myc, the USF proteins have similarly been implicated in controlling cell growth and proliferation, and they play a role in G 1 /S and G 2 /M cell cycle progression by re gulating the expression of cyclin and Cdk genes (134 136) USF1 has been found to be an active regulator of cyclin B1 and cdc2 gene expression, which are involved in the G 2 /M transition (134,135) The CDK4 gene, which is involved in the G 1 /S transition, is activated by USF2 (136) In mouse studies USF1 and USF2 knockout mice display distinct phenotypes, further illustrating the regu latory differences between the two USF proteins. USF1 / null mice are viable and fertile but display elevated amounts of USF2, a possible compensatory rea ction to the lack of USF1. USF2 / null mice, however, have reduced levels of USF1 and display a gro wth defect. Double knockouts of USF1 and USF2 are embryonic lethal (137) Though the USF proteins are ubiquitously expressed, they appear to primarily regulate genes that are expressed in a differentiation and tissue specific manner (130)

PAGE 37

37 Most genes activated by USF are expressed at high levels in differentiated cells, including globin gene (130,138) USF binds with high affinity to DNA fragments containing a central CANNTG consensus E box motif and is known to be involved in the transcriptional regulation of genes containing t his E box (139,140) Additionally, a genome wide mapping study of USF interaction sites in hepatocytes revealed that it preferentially binds DNA in close proximity to transcription start sites, and that this intera ction correlates with increased levels of H3 acetylation (141) This suggests that USF may be involved in the recruitment of transcription complex es globin g ene r egulation Previous studies have shown that USF interacts with conserved E box elements located in Hypersensitive Site II (HS2) of the globin downstream promoter region (Figure 1 3) (138,142 144) USF interacts with co activators and histone modifiers in erythroid cells, suggesting that it functions through chromatin remodeling and RNA Pol II recruitment (145,146) The gen eral transcription factor TFII I has also been shown to interact with USF at INR and E box elements in order to coordinate gene activation or repression, and can recruit USF to these sites (147,148) TFII I and USF have been found to co globin INR, although they appear to have antagonistic effects on globin gene expression, where TFII I is a repressor and USF is an activator (113,138) USF has also been shown to interact with the HAT CBP /p300, as well as with large co regulator complexes such as the histone methyltransferases P RMT 1 and SET1 (146,149) This suggests that USF, at least in part, regula tes chromatin accessibility which may facilitate the assembly of transcription complexes at the LCR and at the adult

PAGE 38

38 globin gene promoter. Additionally, U SF also is known to function at chromatin ment, and may serve to help maintain an environment of active chromatin (149,150) GATA 1 and GATA 2 The GATA transcription factors are a family of six small zinc finger proteins that bind to DNA regions containing a 5 (A/T)GATA(A/G) 3 otif GATA factors are known to interact with various co regulators including FOG 1 (friend of GATA 1), CBP ( a co activator with HAT activity ) and mediator ( a large co activator complex associated with RNA Pol II ) (151) During development, GATA factors play a prominent role in differentiation, proliferation, an d organ morphogenesis. GA TA 1, 2, and 3 are important regulators of hematopoietic stem cells and their derivatives while GATA 4, 5, and 6 are expressed in various mesoderm and endoderm derived tissues. GATA 1 has been shown to both increase histone ac etylation in the LCR and in globin gene promoters, as well as to participate in the recruitment of RNA Pol II to the LCR and to the promoters (152) Additionally, GATA 1 represses c Kit signaling at multiple levels to coordinate decreased cell proliferation (153) However, GATA 1 does not indiscriminately bind to all GATA sites in accessible chromatin, and interaction with specific sites is facilitated by the zinc finger pro tein FOG 1 (151) Both GATA 1 and FOG 1 are essential for erythroid and megakaryocyte develop ment. FOG 1 interacts with the amino (N) finger of GATA 1 and cooperates to promote differentiation by mediating the proximity between the LCR and the adult globin gene (154) GATA 1 has also been implicated in t ranscription repression and associates with the NURD co repressor complex (155)

PAGE 39

39 As GATA 1 levels increase upon cell maturation, GATA 2 expression is silenced; thus, erythroid differentiation is accompanied by an e xchange of GATA factor s It is believed that GATA 2 promotes the survival and expansion of hematopoietic cells and acts to block differentiation. GATA 2 is expressed in hematopoietic progenitors, including early erythroid cells, mast cells, and megakaryocy tes, and also in non hematopoietic embryonic stem cells. NF E2 NF E2 also known as Nuclear Factor Erythroid 2, is a heterodimer comprised of a small ubiquitously expressed subunit (p18) and a large hematopoietic subunit (p45). Both subunits of NF E2 both contain leucine zipper and DNA binding domains and interact with MAREs (151) Mice deficient for p45 do not exhibit a significant erythroid phenotype or reduction in globin gene expression. S tudies have shown that a globin locus associated NF E2 sites by the NF E2 related protein NRF2 (156) The same group demonstrated that NF E2 is not required for conformational changes that reduce the globin gene promoter. NF E2 has been shown to interact with othe r proteins, including components of the TFII D complex and protein complexes with chromatin modifying activities (151,157) It appears that in erythroid progenitor cells MARE sites in the LCR are occupied by Bach1 an N F E2 related protein that functions as a repressor (158) Heme induced differentiation leads to the dissociation of Bach1 and the subsequent association of the activator NF E2. TAL1/SCL TAL1 stands for T cell acute lymphocytic leukemia protein 1, and is also known as SCL TAL1 is a hematopoietic specific helix loop helix protein that heterodimerizes with

PAGE 40

40 ubiquitously expressed E12/E47 proteins and interacts with E box sequences (151) It has also been shown to interact with TFII H, a member of the basal transcription complex (159) TAL1 has an essential role during early stages of erythroid specification, but the function of TAL1 in more differentiated and adult erythroid cells is far less understood. TAL1 and its heterodimeric partner interact with a variety of proteins and can recruit both co activators and/or co repressors to target regulatory elements. It also forms a complex with NL1/Ldb1 and GATA 1, which i nteracts with a modular cis element composed of GATA and E box sequences, although it is not clear whether individual sites are able to recruit the entire complex in vivo (151) TAL1 has been shown to interact in vitro with an E box located in the LCR element HS2 (143) More recently, it has been shown that TAL1 can be crosslinked to the LCR as well as to the globin gene promoter and that NL1/Ldb1 is required for conformational changes that bring the LCR and the adult globin gene into close proximity (160) Erythroid K rppel l ike f actor (EKLF) EKLF, also kn own as Krppel Like Factor 1 ( KLF1 ) is an erythroid specific zinc finger transcription factor that binds to DNA sequences containing a CACCC motif (112) It belongs to a family of transcription factors called the Krppel like factors, which Drosophila transcription factor Krppel In humans, EKLF is expressed in bone marrow and erythropoietic cells, but not in myeloid or lymphoid cell lines. E KLF globin promoter in both mice an d humans (112) In humans, EKLF regulates the adult globin promoter specifically through the 90 CACCC sequ ence. EKLF is also required globin gene promoter (161)

PAGE 41

41 EKLF / knockout mice die at ~14.5 dpc due to severe anemia resulting from ineffective erythropoiesis (162) The fetal livers of these embryos are pale, and they fail to express maj h1 expression Additionally, these EKLF deficient mice reveal a reduction in the formatio n of LCR elements HS2 and HS3. globin gene expression, it is present in primitive erythroid cells and surprisingly was found to bind globin gene in these cells ( 163) Although it is expressed at all stages, earlier works suggested that EKLF is not required for yolk sac erythropoiesis, erythroid commitment, or expression of other potential target genes (164) Its stage spe cific and globin gene specific requirement suggests that EKLF may facilitate completion of the fetal to adult switch. EKLF expression incr eases during development, and it is speculated that increased expression leads to greater association with co factor s that would then be recruited to the globin gene in adult erythroid cells. The zinc finger DNA binding domain of EKLF has also been shown to interact with th e BRG1 subunit of the SWI/SNF complex, indicating that it also plays a role in recruiting chroma tin remodeling enzyme s to the globin locus (165,166) Co Regulators In addition to cis and trans regulatory elements, several co regulators also globin locus such as the SWI/ SNF family of chromatin remodeling complexes, and CREB binding protein ( CBP ) SWI/SNF plays a role in re positioning nucleosomes to allow access for transcriptional machinery to the underlying DNA and has been shown to be involved in erythropoiesis. CBP is a co

PAGE 42

42 activator that is known to bind at enhancer regions. The se two are described in more detail below. SWI/SNF SWI/SNF is a chromatin remodeling complex that uses energy derived from ATP hydrolysis to disrupt the chromatin a rchitecture of target promoter s (167) The SWI/SNF complex was first identified in yeast through screening for genes that regulated mating type switching (SWI) and sucrose non fermenting phenotypes (SNF). In general, genes targeted by the SWI/S NF complex are often regulated by highly inducible promoters, respond to growth conditions, or are important for cellular development and differentiation (167) The SWI/SNF complex is also known to play a role in D NA repair. Since its discovery, SWI/SNF homologues have also been found in other species, including Drosophila mice and human s Mammalian SWI/SNF consists of 8 15 subunits of various BRG1 associated factors (BAFs), and contain s either Brahma (BRM) or Bra hma Related Gene 1 (BRG1 ; also known as SMARCA4 which stands for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 ) as the central catalytic ATPase subunit (166) Al though BRM and BRG1 are similar in sequence and have comparable in vitro activity, knockout studies have revealed distinct differences. BRM / null mice are viable and express increased levels of BRG1, indicating a possible compensatory response (168) Conversely BRG / null mice fail to develop beyond the peri implantation stage of early embryogenesis (169) In o rder to circumvent this issue for the purposes of studying the role of BRG1 in development, mutagenesis studies have produced mice carrying a partial loss of function mutation of BRG1 (BRG1 ENU 1 ). In these mice, BRG1 has been implicated in globin regulation and erythropoiesis (170)

PAGE 43

43 Additionally, BRG1 contains a unique N terminal domain not present in BRM, with which it can bind to zinc finger proteins such as EKLF, GATA 1, and Sp1 (166,171) During cellular differentiation, BRM protein concentrations increase, while BRG1 protein levels remain relatively constant in all cells. The unique properties of each catalytic ATPase subunit may allow them to direct di fferent cellular processes through chromatin remodeling by making use of various specific protein protein interactions CBP CBP stands for CREB (cAMP response element binding protein) binding protein As evidenced by its name, the CBP protein is associated with and co activates the transcription factor CREB (172) CREB binds t o certain DNA sequences called cA MP response elements (CRE) in order to increase or de crease the transcription of genes. CBP contains a bromodomain, a protein domain that recognizes acetylated lysine residues, such as those in modified histone N terminal tails (173) These domains are often found in co activators involved in signal dependent, but not basal, transcription. CBP is associa ted with t he E1A binding protein p300 (EP300 or p300 ) and the two share high homology. B oth proteins play critical roles in embryonic development and growth ; k nockout studies on CBP and p300 in mice have shown that both are required for proper development as loss of either is embryonic lethal (174,175) Both of these proteins have histone acetyltransferase activity and are capable of acetylat ing all the core histones in a nucleosome (176,177) Recently, genome wide studies have established that many, if not most, enhancers are bound by CBP /p300 and H3K4me1 and that these enhancers are often located very distal from known transcription start sites (178 180)

PAGE 44

44 In studies involving transient transfection of murine non hematopoietic cells, it was found that overexpression of CBP stimulated GATA 1 expression. Co IP studies on MEL nuclear extract found an a ssociation between the two endog enous proteins, which could be pinpointed to the zinc finger region of GATA 1 and to the E1A binding region of CBP (181) Additionally, CBP is known to acetylate both GATA 1 and EKLF which may assist their role in globin gene (182,183) Summary globin gene locus is one of the most extensively studied eukaryotic loci due to several unique aspects of its regulation, as well as for its role in sick le cell disease thalassemia. type globin gene expression during development and throughout life is essential to survival, and gaining a better globin gene is regulated is the first step toward finding better treatments for patients suffering from these hemoglobinopathies. Identifying key players in its regulation during development would greatly contribute to this understanding It had previously been shown that the ubiquitously expr essed transcription factor USF as well as the BRG1 subunit of the SWI/SNF complex both have a role in globin gene. The goal of the work presented here is to further characterize that knowledge. Although ubiquitously expressed transcr iption factors have been implicated in erythropoiesis, it is likely that they act in an erythroid specific manner by association with erythroid specific factors ; t his would allow the optimal utilization of available resources in the context of an erythroid system in order to promote erythropoiesis.

PAGE 45

45 Figure 1 1. Schematic representation of the structural organization of the human (top) and mouse (bottom) globin gene loci (138) Tissue and stage specific expression is indicated below the genes.

PAGE 46

46 Figure 1 2. Summary of proteins and co regulators interacting with LCR element HS2 globin gene promoter (184) Shown on top is the overall globin gene locus depicting the LCR and the diagram be low illustrates the overall organization of regulatory elements globin gene regulation. Transcription factor binding globin promoter (on the right) are bound by transcription factors (circles) that either activate (shown below the binding sites) or repress (shown above the binding sites) transcription through the recruitment of co regulators (triangles). The binding sequences, interacting proteins, and co regulators are listed in the table. DNA binding motifs as well as interacting proteins and their known co regulators are color matched. No co regulators have been described for Bach1 and Bp1 (indicated by question marks).

PAGE 47

47 Figure 1 3. Sequence alignment of human (H), mouse (M), and ra bbi t (R) downstream globin gene (113) Shaded rectangles indicate regions containing consensus E boxes motifs (CANNTG) where USF may bind.

PAGE 48

48 CHAPTER 2 MATERIALS AND METHOD S Cell Culture Human erythroleu kemia (K562) cells were grown in RPMI 1640 containing L glutamine and supplemented with 10% fetal bovine serum (FBS) and 1 % penicillin streptomycin (P/S). Cells were grown in 5% CO 2 at 37C and maintained at a density of around 1.5 10 5 to 2.5 10 5 cells /mL. Murine erythroleukemia (MEL) cells were grown in Dulbecco s modified Eagle s medium (DMEM) containing L g lutamine, 4.5 g/L g lucose and s odium pyruvate, and supplemented with 10% FBS and 1% P/S Cells were grown in 5% CO 2 at 37C and maintained at a d ensity between 1 10 5 and 2 10 6 cells/m L. Generally, i nduction of erythroid differentiation of MEL cells was achieved by incubating cells in medium containing 1.5% dimethylsulfoxide (DMSO) for 72 h. In certain situations induction was achieved by incub ation with 2% DMSO for 24 h, and this deviation will be noted in the appropriate figure legends. Cell C ycle Synchronization and Mitotic Arrest Cell synchronization of K562 cells at the border of G 1 (gap 1) and S phase (synthesis) was performed as describe d previously in Vieira, et al. (90) In order to arrest cells in M phase (mitosis) cells were incubated in 60 ng /mL Nocodazole (Sigma) for an additional 10 12 h after incubation in fresh medium for 5 h following synchronization Verification of synchronization and arrested cells was achieved by propidium iodide staining followed by flow cytometry as described by Vieira, et al. (90) Cells were taken for flow cytometry, chromatin immunoprecipitation ( ChIP ) and

PAGE 49

49 chromosome conformation capture ( 3C ) analys e s at specific time points after release from synchronization or block A USF Transgene Construction The pITRp543f2AUSF4 plasmid used to generate transgenic mice was created previously by Dr. Valerie Crusselle Davis (138) In pITRp543f2AUSF4, the dominant negative Upstream Stimulatory Factor ( A USF ) gene was placed under the control of enhancer in order to confer erythroid specific expression (Figure 2 1). Additionally, the human globin locus control region ( LCR ) elements HS3, HS3/HS2 linker, and HS2 were included for high level expression. Finally, the transgene was flanked by two chicken HS4 sequences which have been shown to have insulator activity, thu s protecting the transgene from position effects attributable to its location of integration (185) Generation and Identification of Transgenic Mice The pITRp543f2AUSF4 p lasmid DNA was first linearized by digestion with Asc I, and then resuspended in injection buffer (5 mM Tris HCl [pH 7.4], 0.1 mM EDTA) at a concentration of 2 ng/ L. The linearized plasmid DNA was injected into fertilized murine oocytes as described by Bungert et al. and implanted into the uterus of pseudopregnant surrogate female s (186) For the analysis of transient transgenic mice, the implanted embryos were isolated at 11.5 dpc rather than allowing the pseu dopregnant females to give birth. DNA was prepared from offspring using t ail clips from adult mice or the head of embryos by overnight digestion in DNA lysis buffer containing proteinase K and was purified by a series of one phenol, one phenol chloroform i soamyl alcohol (25:24:1) and one chloroform isoamyl alcohol (49:1) extraction The presence of the A USF expression construct in transgenic mice was determined by PCR Primers used for

PAGE 50

50 amplification of the A USF transgene TGACGAAGAAGAACTCGAGGA ACGACCTCTAATCCGTGGTG Phenylhydrazine Treatment To induce hemolytic anemia in adult mice, a total of three intraperitoneal injections o f phenylhydrazine hydrochloride (Sigma) were administered at an estimated am ount of g of bodyweight. Mice were weighed, and the appropriate amount of phenylhydrazine was dissolved in a 0.9% saline solution so that the total volume of each injection was approximately 0.1 mL. The first injection was administered in the morning with an additional injection 8 hours later, while the third injection was administered in the morning of the following day (0, 8, and 24 h). Spleens were isolated from anemic animals 6 days after the first injection and subjected to RNA or ChIP analys e s RNA I solation and A nalysis RNA was isolated using the guanidinium thiocyanate method as described previously and reverse transcribed using the iScript cDNA synthesis kit (Bio Rad) (186,187) RNA was subjected to an alysis by quantitative real time reverse transcription PCR (qRT PCR) using the MyiQ (Bio Rad) system, and reactions were carried out using the iQ SYBR green super mix (Bio Rad). qRT PCR conditions were the following: 95C for 5 min, followed by 40 cycles o f 94C for 30 s, 59C for 30 s, and 72C for 1 min (readings were taken after every cycle). A melting curve was performed from 60 to 95C (readings every 0.5C). Standard curves were generated using 10 fold serial dilutions of wild type complementary DNA ( cDNA) from the appropriate source. Final quantification analysis was performed using the relative standard curve method. RNA subjected to analysis by reverse transcription PCR (RT PCR) was electrophoresed on either agarose

PAGE 51

51 gel s and visualized with ethidium bromide or on 5% Tris borate EDTA (TBE) polyacrylamide gels stained with SYBR Green I (Invitrogen) and scanned with a Storm scanner Gene expression analysis was performed as described previously, with results reported as expression relative to wild ty pe levels after the normalization of the transcript data to those of a control gene, GAPDH (138,146) Primers for amplifying maj actin, and murine GAPDH have been described previously (138) RNA from wild type and transgenic mice was isolated from embryonic yolk sac, fetal liver, or the spleen of phenylhydrazine treated anemic mice as described in Bungert et al. (186) Primers for the murine maj globin gene and the murine LCR element HS2 used to amplify cDNA in qRT PCR analyses were as desc ribed in Crusselle Davis et al. (138) Additional primers used to amplify cDNA can be found in Table 2 1. Primers for mouse GATA 1 and EKLF analysis were described by Tanabe et h1 were descr ibed by Basu et al., and primers for mouse Band3 were described by Nilson et al. (188 190) Chromatin Immunoprecipitation (ChIP) and Micro ChIP Analys e s Conventional chromatin immunoprecipitation (ChIP) assays were performed as described previously (113,138) Fetal liver cells were homogenized in phosphate buffered saline ( PBS ) containing protease inhibitors and passed through a 70 m cell strainer. The following antibodies w ere used for ChIP in this study: USF1 and USF2 (H 86 and N 18, respectiv ely; Santa Cruz Biotechnology), RNA Pol II (CTD45H8; Upstate Biotechnology) serine 5 phosphorylated RNA Pol II ( H14; Covance) serine 2 phosphorylated RNA Pol II ( YSPTSPS phospho S2; Abcam ) CBP ( A 22; Santa Cruz Biotechnology), TFII B ( C 18; Santa Cruz Biotechnology) and rabbit polyclonal BRG1

PAGE 52

52 (H 88; Sant a Cruz Biotechnology ). F or ChIP assays using IgM antibodies, Dynabeads rat anti mouse IgM ( I nvitrogen) was used instead of Protein A Sepharose beads with normal mouse IgM as a negative control Dynabeads were prepared as per the MicroChIP (ChIP) was used according to a previous protocol with minor modifications (191,1 92) Antibody bead complexes were prepared using Dynabeads Protein A beads (Invitrogen) Embryonic yolk sacs were cross linked with 1% formaldehyde in 500 L PBS and quenched with 125 mM glycine Prior to sonication, yolk sacs were homogenized using a gla ss tissue grinder (Radnoti) and washed with PBS Based on trial and error, s onication conditions were optimized to yield fragments of ~500 bp, and sonication products were diluted 10 fold in ChIP RIPA buffer (10 mM Tris HCl [pH 7.4] 140 mM NaCl 1 mM EDT A, 0.5 mM EGTA, 1% Triton X 100, 0.1% SDS, 0.1% Na des oxycholate) containing 1mM PMSF and additional protease inhibitors (Roche) Sonicated chromatin was incubated with various antibody bead complexes, and after a series of washes, DNA was purified using a QIAprep Spin Miniprep kit (Qiagen) Quantitative ( real time ) PCR (q PCR) conditions were the following: 95C for 5 min, followed by 40 cycles of 94C for 30 s, 59C for 20 s, and 72C for 30 s A melting curve was performed from 60 to 95C (reading every 0.5C) Negative control exp eriments were performed using immunog lobulin G (IgG) antibodies and primers amplifying a region between LCR elements HS2 and HS3 that does not interact with USF and RNA Pol II (90,146, an d data not shown) Standard curves were generated

PAGE 53

53 using 10 fold serial dilutions of the input DNA Final quantification analysis was performed using the relative standard curve method ChIP primers used for q PCR analyses can be found in Table 2 2. Additi onal primers used for amplifying specific regions of the human and murine globin locus have been described previously (90,138) Primers for the mouse EKLF gene promoter were described by Vakoc et al (154) Chromatin Conformation Capture (3C) and ChIP 3C (ChIP loop) 3C was performed on K562 cells as described by Dekker, et al. with minor modifications (193,194) T he restriction enzyme Hind III was used for the initial digestion, and 3C primers for the globin gene locus were described by Chan, et al. (195) Additionally, ChIP 3C (a.k.a. ChIP loop) studies were performed on MEL cells as described by Song, et al., with minor modifications (160) This procedure combines ChIP and 3C, and allows for the identification of chromatin interactions that are bound or facilita ted by specific proteins (196) Cells were lysed in 3C lysi s buffer (10 mM Tris HCl [pH 8.0], 10 mM NaCl, 0.2% NP 40) containing protease inhibitors and homogenized in a glass tissue grinder ( Radnoti ). The initial digestion was performed with either Hind III or Bgl II, and antibodies used to pull down protein DNA complexes are the same as described in ChIP, with the addition of di methylated H3K4 (Upstate). Analysis of 3C or ChIP 3C ligation products were analyzed by conventional PCR and elect rophoresis on 1.2% agarose gels or on 5% TBE gels (Bio Rad) Conventional PCR conditions for 3C and ChIP 3C were the following: 95C for 5 min, followed by 34 cycles of 95C for 1 min, 60C for 45 s, 72C for 2 min, with an additional 95C for 1 min, 65C for 45 sec, and 72C for 8 min afterward. ChIP 3C primers for amplifying Hind

PAGE 54

54 III digests globin locus were provided by Dr. Ann Dean and can be found in Table 2 3 (160) Fluorescence Activated Cell Sorting (FACS) Cells obtained from the yolk sac s of transgenic and wild type m urine male e mbryos at 10.5 days post coitum ( dpc ) as determined by Y chromosome specific PCR, were subjected to fluorescence activated cell sorting (FACS) analysis using antibodies against fluorescein isothiocyanate CD71 (BD Biosciences) and phycoeryrthrin Cy7 Ter 11 9 (eBioscience ). Cells were homogenized in PBS containing 2% FBS using a glass tissue grinder (Radnoti), passed through a 70 m cell strainer, and incubated on ice with antibodies for 30 min. After a series of washes to remove unbound antibodies, cells wer e subjected to FACS using a BD LSRII system. Ter 119 + yolk sac cells collected for RNA extraction were homogenized with collagenase in PBS containing 20% FBS. Y chromosome primers used for identifying male embryos were described by Kunieda et al. (197) CD71 + cells represent early erythroid progenitor cells, while Ter 119 + cells represent more mature erythroid cells (198) Nuclear Extraction and Co Immunoprecipitation (Co IP) Nuclear extraction and co i mmunoprecipitation (Co IP) was performed on MEL c ells as de scribed by Leach, et al. (144) Protein concentration from both uninduced and induced MEL nuclear extracts was determined by Bradford assay, and RIPA buffer (50 mM Tris HCl [pH 7.4], 100 mM NaCl, 10 mM ED TA, 0.25% Na Desoxycholate, 1% NP 40 0.1% SDS) was added to lysates to yield a final protein concentration of 1 mg / mL Precipitation was carried out by incubating diluted extracts with 2.5 g of antibody for 2.5 h The a ntibodies used in Co IP are the sam e as those used in the ChIP assays with the exception of BRG1. For Co IP studies, mouse monoclonal antibody against

PAGE 55

55 BRG1 was used, which was provided by Dr. David Reisman (UF) Complexes were then captured by adding Protein A Sepharose beads (GE Healthcar e) and incubating for an additional 2 h. Samples were washed 3 times with RIPA buffer and eluted with Laemmli buffer (Bio Rad) at 95C for 10 min. Eluted samples were loaded onto 7.5% T ris HCl Ready Gels (Bio Rad) a nd analyzed by immunob lot. Protein Isolat ion and Immunob lotting Protein extract for immuno blot analys i s was obtained by resuspending cells in RIPA buffer (50 mM Tris HCl [pH 7.4], 100 mM NaCl, 10 mM EDTA, 0.25% Na Desoxycholate, 1% NP 40, 0.1% SDS) containing protease inhibitor s (Roche) and incub ation on a rotating wheel at 4C for 30 minutes. Following incubation, lysates were centrifuged and the pellet was discarded. The protein concentration was determined using the Bradford assay. A total of 20 g was incubated with Laemmli buffer (Bio Rad) at 95C for 10 min before being loaded onto 7.5% or 10% Tris HCl Ready Gel s (Bio Rad). After transfer to a nitrocellulose membrane (Bio Rad) proteins were detected using Immobilon Western Detection Reagents ( Millipore ) according to the ol Primary antibodies used are the same as those used in the ChIP assays. Secondary antibodies used include g oat anti rabbit (IgG HRP, sc 2004) and goat anti mouse (IgG HRP, sc 2005) both obtained from Santa Cruz Biotechnology.

PAGE 56

56 Table 2 1. Partial list o f n ames and sequences of primer pairs used for qRT PCR Primers Sequence Mouse US CCTGGGGGAAGATTGGTG DS GCCGTGGCTTACATCAAAGT Mouse min US TGAGCTCCACTGTGACAAGC DS TACTTGTGAGCCAGGGCAGT M ouse HoxB4 US TGGATGCGCAAAGTTCA CG DS GGTCTTTTTTCCACTTCATGCG Mouse USF1 US GATGAGAAACGGAGGGCTCAACATA DS TTAGTTGCTGTCATTCTTGATGACG Mouse NF E2 (p45) US TCAGCAGAACAGGAACAGGT DS GCTTTGACACTGGTATAGCT Mouse TAL1 US TAGCCTTAGCCAGCCGCTCG DS G CGGAGGATCTCATTCTTGC Table 2 2 Partial list of n ames and sequences of primer pairs used for ChIP Primers Sequence A globin gene CCATGATGCAGAGCTTTCAA TTTGCTCATCAAAACCCACA Human Necdin promoter GTGTTATGTGCGTGCAAACC CTCTTCCCGGGTTTCTTCTC Mouse GATA 1 promoter US AGCCTCTGCTTGAAATGCTC 3 DS CCTTTGGCTTCTGTGGAGTC 3 Mouse TAL 1 promoter US CAGATCCGTTAGAGGGTTCG 3 DS CTGGGAATTACCTCGTGTGC M ouse NF E2 (p45) promoter US GCAGACACAGTGAGCACTCC DS GAGGGTCCTTAGGTGGGAGA Mouse Necdin promoter US TTTACATAAGCCTAGTGGTACCCTCC DS ATCGCTGTCCTGCATCTCACAGTCG Table 2 3 List of n ames and sequences of primer pairs used for ChIP 3C, Hind III digest Primers Sequence Mouse HS2 GTTAATGAAATGCTATTTGGAATGG 3 CTAAAGAAACGCCAGACTGATTTAC 3 h1 AAGGGTGAGAGTTTAGCCTTCTCTA 3 maj TACTCCCTCTGAATAATGTTTGTCC M ouse TTAAATTCATCTGGAAAGGCAAATA

PAGE 57

57 Figure 2 1. DNA construct pITRp543f2AUSF4 used to generate transgenic mice ex pressing dominant negative USF (A USF). The A USF coding region is DNA construct is flanked on either site by insulator elements derived from the globin gene locus (cHS4).

PAGE 58

58 CHAPTER 3 THE CONSEQUENCE OF EXPRESSING DOMINA NT NEGATIVE USF IN MICE Introduction Previous research demonstrated that expression of dominant negative Upstream Stimulatory Factor (A maj globin gene expression, as well as a reduc tion in the recruitment of RNA p ol ymerase II (RNA Pol II) to HS2 maj globin gene promoter (138) Additi onally, over expression of USF1 led to an increase in maj globin gene expression Overall, these data suggest globin gene. The purpose of the following study was to examine the in vivo role of USF in erythropoie sis by generating transgenic mouse lines that express A USF. A USF contains the USF heterodimerization domain but lacks the USF specific region (USR), which is required for transcriptional activation. Additionally, the basic DNA binding region has been mut ated to contain an acidic extension (132,199) Thus, any USF heterodimers that contain A USF will be unable to bind or activate DNA. A USF has been shown to successfully inhibit normal activity of both USF1 and USF 2 (199 201) The A USF construct used to generate A USF transgenic mice was designed to confer high level, erythroid specific expression of A USF (Figure 2 1) The intention was to express A USF exclusively or pref erentially in erythroid cells to i nterfere with the function of both USF1 and USF2 without affecting the vital functions of these proteins in other tissues and organs.

PAGE 59

59 Results Three transgenic founders were generated with this construct (founders I, II, an d III), although two of these founders did not transmit the transgene to their progeny (founders I and III). Reverse transcription PCR ( RT PCR ) and immuno blot analyses showed that A USF was expres sed in all transgenic lines, but not in the liver of founder mouse I ( Figure 3 1, panel B ). Additionally, RT PCR analys i s of A USF in the spleen of three F 1 females from founder II revealed that the expression of A USF varied between littermates (Fig ure 3 1, panel A). To analyze the effect of expressing A maj globin gene expression, transgenic (founder I and three F 1 females from founder II) and four control wild type (WT) littermates were treated with phenylhydrazine hydrochloride which induces hemolytic anemi a Under anemic conditions, the mouse spleen becomes a major site of erythrocyte production, which increases the amount of nucleated red blood cells in the organ. It was maj globin gene expression was reduced by 50% in the non transmitting tran sgenic mouse (founder I) compared to expression in a wild type control mouse ( Figure 3 1, panel C ). The expression of A USF in the spleen of phenylhydrazine treated F 1 animals from the transmitting line varied (Fig ure 3 1, panel B ), and it resulted in a tw o maj globin gene expression in three transgenic littermates ( Figure 3 1, panel C ) compared to that of three wild type littermates. Five transgenic female mice but none of the wild type mice died as a result of the phenylhydrazine treatment, indicating a possible defect in erythropoiesis. Consistent with this observation is the fact that 4 week old transgenic female mice weighed 2 to 3 g less than wild type littermates (23 1 and 26 1 g, respectively).

PAGE 60

60 Next, the recruitment of R maj globin gene in mice expressing A USF was analyzed and compared to wild type littermates, which do not express A USF (Fig ure 3 1, panel D ). It was found that t he expression of A USF in erythroid cells led to a reduction in USF2 and RNA maj globin promoter. The actin gene was not af fected in A USF expressing mice (data not shown). Because the founder of line II was male, but failed to yield transgenic male offspring it was hypothesized that the A USF transgene had integrated into the X chromosome, and that the expression of A USF in all erythroid cells was not compatible with survival. Females from line II showed a somewhat variegated phenotype, likely because of di fferences in the silencing of the transgene on the X chromosome due to X chromosome inactivation. Since adult transgenic males were unable to be examined, male transgenic embryos were examined at different developmental stages instead In two different 1 4. 5 days post coitum ( dpc ) litters which were obtained by mating a transgenic female (line II) with a wild type male, several re absorbed and pale embryos were detected Genotyping with primers specific for both the A USF transgenic construct and for the Y chromosome revealed that the re absorbed embryos were transgenic males Em bryos at earlier stages 10.5 11.5, and 12.5 dpc were examined next At 10.5 and 11.5 dpc, all embryos appeared to be alive and normally developed; however, several of the embryos we re pale, and these were identified by PCR as tran sgenic males (Figure 3 2). At 12.5 dpc the male transgenic embryos ceased to develop further, demonstrating that the male transgenic embryos did not survive beyond 11.5 dpc.

PAGE 61

61 T he exp ression of globin genes i n 10.5 and 11.5 dpc embryos was examined next, and i t was found that t he expression of A USF caused a reduction in the expression of all globin genes compared to that of wild type littermat es (Figure 3 3 ). In 10.5 dpc yolk sac samples, the expression of th e embryonic h 1 genes as well as that of the Hba 1 min globin genes was reduced 5 to 10 fold, and in 11.5 dpc fetal liver samples there was a 5 to 10 maj globin gene. T he effect of A USF on the ex pression of other erythroid cell specific genes was also examined including those that encode for transcription factors that regulate erythropoiesis, such as GATA 1, Erythroid Krppel Like Factor ( EKLF ) TAL1 NF E2 (p45), and HoxB4 (Fig ure 3 4 ). HoxB4, a homeobox transcription factor expressed in primitive hematopoietic stem cells, has previously been shown to be regulated by USF in K562 cells (202) We found that the expression of HoxB4 and GATA 1 is reduced by o nly about twofold in the yolk sac of transgenic males. In contrast, the expression of transcription factors EKLF, TAL1 a nd NF E2 (p45) was reduced by 5 to 10 fold suggesting that USF is required for the expression of these genes during primitive erythrop oiesis (Fig ure 3 4 ) The expression of another well characterized erythroid cell specific gene, Band3, also was reduced by more than 5 fold in the transgenic yolk sac samples. Band3 is a major glycoprotein of the erythrocyte membrane and plays a key role in the uptake of carbon dioxide by red blood cells by mediating the exchange of chloride and bicarbonate across the phospholipid bilayer (203) U SF1 transcription was una f fected by the expression of A USF (Figure s 3 3 and 3 4 ) To exclude the possibility that the phenotype observed in the male transgenic embryos was due to the integration of the transgene and subsequent disruption of a

PAGE 62

62 specific cellular function, t ransient transgenic embryos were generated and analyzed at 11.5 dpc In total, 4 transient transgenic embryos were generated, although only two of them expressed A USF in the yolk sac, as determined by RT PCR (Figure 3 4). Both embryos appeared pale and revealed re ductions in the expression of Hba 1 globin genes as well as that of EKLF and Band3 (Fig ure 3 4 ). The expression of USF1 was not affected in these mice. The se data demonstrate that the expression of A USF in erythroid cells of transgenic mice leads to consistent defects in erythropoi esis in multiple independent transgenic embryos. Therefore, the erythroid phenotype observed in the transmitting line (line II) is unlikely to be due to the disruption of gene expression patterns at the site of transgene integration. To verify that the exp ression of A USF affects the binding of USF in transgenic embryos, we examined the binding of USF1 to LCR element HS2 in yolk sac samples taken from 10.5 dpc transgenic embryos (line II) and wild type litter mates using the ChIP assay, which allows the de tection of protein chromatin interactions with a small number of cells. The binding of USF1 to the LCR was reduced in transgenic embryos compared to that of wild type littermates (Fig ure 3 5 panel A ). The interaction of RNA Pol II with LCR element HS2 als o was reduced in 10.5 dpc yolk sac samples from transgenic mice compared to that of littermates (Fig ure 3 5 panel B ), whereas there was no change in the association of RNA Pol II with the GAPDH gene between wild type and transgenic embryos (Fig ure 3 5 pa nel B ). Because EKLF, TAL1 and NF E2 (p45) failed to be expressed at high levels in the hematopoietic tissue of transgenic mice, we examined the possibility that USF directly regulates these genes. We performed ChIP to examine the interaction of USF with the

PAGE 63

63 gene loci encoding these transcription factors during the differentiation of MEL cells. One of the multiple DNA regulatory elements in the EKLF gene locus contains an E box, which previously has been shown to interact with TAL1 (204,205) Both subunits of USF associated with the E box containing regulatory region of the EKLF gene in MEL cells ( Fig ure 3 6) We also observed interactions of USF with the TAL1 gene locus, which also contains an E box motif in a regu latory element. Interestingly, the interaction of USF with the TAL1 gene decreased during dimethylsulfoxide (DMSO) induced MEL cell differentiation. USF binding also was detectable at the GATA 1 gene locus ( Fig ure 3 6 ). There are no previous data concernin g E box elements regulating the GATA 1 gene. We failed to detect significant interactions of USF1 with the NF E2 (p45) gene; however, the recovery of USF2 precipitated p45 gene fragments was higher than that of the IgG control. The data suggest that the TA L1 and EKLF genes are direct targets of both USF1 and USF2 in differentiating erythroid cells. There was no significant binding of USF to the control Necdin gene, which is not expressed in erythroid cells ( Fig ure 3 6 ). We confirmed the interactions of USF2 with the erythroid cell specific gene loci in primary erythroid cells taken from 16.5 dpc mouse fetal liver samples ( Fig ure 3 7 ). The ChIP results demonstrated that USF2 interacts with the EKLF, GATA 1, and TAL1 gene loci but not with the Necdin gene locu s. We observed a reproducible interaction of USF2 with the NF E2 (p45) gene locus in fetal liver cells. We next examined the possibility that the expression of A USF in erythroid cells impairs their differentiation potential. We began these studies by exam ining 10.5 dpc yolk sac cells from transgenic embryos and wild type littermates for the expression of the transferrin receptor CD71, which is expressed at high levels in developing erythroid

PAGE 64

64 cells and serves as a marker for erythroid progenitors (198) The CD71 mediated sorting of yolk sac cells revealed that the number of CD71 + cells was about threefold lowe r in the transgenic embryos than that of the wild type embryos (Fig ure 3 8 ) Furthermore, we observed a decrease in the number of cells that express high levels of Ter 119 (Fig ure 3 8 ), which is a marker for more differentiated erythroid cells (206) The number of benzidine positive cells also was reduced by three to fourfold in the yolk sac cells from transgenic embryos compared to those taken from wild type littermates (data not shown). Taken together, these resul ts demonstrate that USF is an important contributor to erythroid cell differentiation and mediates the high level expression of erythroid transcription factors and the expression of the globin genes. To examine whether USF not only regulates the differenti ati on of erythroid cells but also functions within the context of differentiating cells, we analyzed the expression h1 globin gene in Ter 119 sorted cells obtained from transgenic or wild type embryos ( Fig ure 3 8 h1 globin gen e was reduced in Ter 119 + cells isolated from two transgenic embryos compared to that of their wild type littermates. Discussion It currently is unknown how ubiquitously expressed and tissue specific transcription factors coordinate the activat ion of highl y expressed genes during differentiation. Perhaps tissue specific factors mediate the accessibility of regulatory sites, whereas ubiquitously expressed proteins perform basic functions involved in the local remodeling of nucleosomes and the recruitment of transcription complexes. USF was one of the first transcription factors shown to activate transcription mediated by RNA Pol II, and it plays a role in the high level expression of many genes

PAGE 65

65 in differentiated cells (130,139) Accumulating evidence points to the possibility that highly expressed genes are transcribed in specialized nuclear domains enriched for splicing factors and RNA Pol II, often referred to as transcription factories or transcription domains (207 209) It is possible that the LCR nucleates such a transcription domain in erythroid cells (184) USF is a likely candidate protein that could mediate the association of genes or regulatory elements with transcription domains in the nucleus. USF mediates the high level expression of genes during cellular differentiation, and the global analysis of the interaction of USF with chromatin revealed that USF mostl y binds to regions close to transcription start sites (141) The data presented here suggest that USF regulates many genes involved in erythropoiesis, including genes encoding key erythroid transcription factors. I nactivating USF thus causes a defect in the differentiation of erythroid cells. This is supported by our observation that the expression of A USF in transgenic mice causes reductions in the number of CD71 + and Ter 119 + cells in the yolk sac (Fig ure 3 8 ). I n addition to regulating erythropoiesis, several lines of evidence suggest that USF also directly globin gene locus. First, globin gene promoter in vitro and in the context of intact erythroid cells (113,138,142,143) Electrophoretic mobility shift assays (EMSA) using protein extracts from erythroid cells demonstrated that a single comp lex is formed on the E globin downstream promoter region (113) This complex is super shifted with USF antibodies which suggests that no other helix loop helix (HLH) protein present in the protein extract is capable of interacting with this site in vitro. The expression of a

PAGE 66

66 dominant negative mutant of USF in MEL cells or transgenic mice reduces the recruitment of USF and RNA globin gene locus (138,210) Furthermore, it has also been demonstrated that A USF reduces the recruitment of RNA Pol II to immobilized LCR templates in vitro (211) Finally, a reduction in globin gene expression in T er 119 + cells isolated from A USF expressing transgenic embryos was observed (Fig ure 3 8 ). All of these data are consistent with the hypothesis that USF plays a direct role in the regulation of erythroid specific genes, including the globin genes. However, USF does not appear to act globally on transcription, as no changes in the expression of housekeeping genes in the A USF transgenic mice were observed. The reduction of embryonic globin gene expression in A USF expressing transgenic mice could be due to r educed interactions of USF and transcription complexes with the LCR, which may impair its activity. A reduction in the expression levels of EKLF, TAL1 and NF E2 (p45) was observed, whereas the expression of GATA 1 and HoxB4 was only mildly reduced. It is likely that th e reduced expression of these key erythroid transcription factors also contributes to the decreased globin gene expression observed in the yolk sac of A USF transgenic mice. USF appears to interact with E box containing regulatory elements in the EKLF, GATA 1, and TAL1 gene loci. USF may function within the context of erythroid specific transcription domains in the nucleus, and that genes expressed during erythropoiesis associate with these domains, which is consistent with data from Osborne e t al. (69)

PAGE 67

67 Figure 3 1. Anal ysis of mice expressing A USF. A) SYBR green stain of the RT PCR analysis of A USF expression in transgenic (founders I and III and line II F 1 littermates 1 to 3 [II/1 to II/3]) and w ild type (WT) mice. RNA was isolated from the spleens of phenylhydrazine treated mice, reverse transcribed, subjected to PCR analysis with primers specific to the A USF coding region and electrophoresed in 5% TBE gels. B) Immuno blot analysis of A USF expr ession in transgenic or wild type mice. Protein was isolated from the spleen or liver of phenylhydrazine treated mice and subjected to i mmuno blot analysis using an antibody against U SF1, which also detects A USF. C) qRT maj globin gene exp ression in spleens of A USF transgenic line II F 1 littermates, A USF founder mouse I, and wild type mice. Data from the three line II F 1 littermates were combined and are designated II/1/2/3. GAPDH was used as a loading control, and results from samples we re normali zed to those of the wild type. D) q PCR ChIP analysis of RNA Pol II maj globin gene promoter control mice (WT) and transgenic mice (A USF). Spleens taken from two phenylhydrazine treated F 1 females (derived from line II) or wild type mice were homogenized and subjected to ChIP analysis using antibodies against IgG, RNA Pol II, or USF2. Error bars reflect standard deviations from two independent experiments. These data were generated by Babak Moghimi.

PAGE 68

68 Figure 3 2. Analysis of transgenic mouse embryos at different stages of development. Male embryos were isolated at the indicated time points of development from A USF transgenic females (F 1 females from line II) mated with wild type (WT) males. Embryos were placed in a culture dish with PBS either in the p resence or absence of the yolk sac (YS) and photographed using a Leica MZ16F4 instrument and the Qcapture program. Embryos were genotyped for sex and determined to be wild type or transgenic (A USF).

PAGE 69

69 Figure 3 3. Effects of A USF expression on the expre ssion of erythroid genes in embryonic yolk sac cells RNA was extracted from 10.5 or 11.5 dpc embryos, reverse transcribed, and subjected to qR T PCR performed in triplicate. q RT PCR analysis h 1 min 1, USF1 (left; 10.5 maj globin (right; 11.5 dpc) gene expression in A USF transgenic (TG II/1 to II/4) and wild type (WT 1 to 4) mouse embryos. Two sets of four embryos, each containing two TG and two WT animals, were examined. GAPDH was used as an internal control, and sample data were normalized to those for a respective WT littermate. Data are represented as means standard errors of the means of at least three PCRs on each s ample.

PAGE 70

70 Figure 3 4. Effects of A USF expression on the expression of erythroid cell specific transcription factors in 10.5 dpc embryonic yolk sac cells qRT PCR analysis of EKLF, GATA 1, Tal 1, p45, Band3, HoxB4, and USF1 gene expression in the yolk sac of the transgenic (TG II/1 and II/2) and wild type (WT 1 and 2) 10.5 dpc embryos examined in Figure 3 3 Data are presented as described for Figure 3 3

PAGE 71

71 Figure 3 4 Generation and analysis of 11.5 dpc transient transgenic mouse embryos expressing A USF. Fertilized oocytes were injected with the A USF expression construct and implanted into the uterus of a pseudopregnant foster mother. Embryos (11.5 dpc) were isolated and subjected to DNA (embryo) and RNA (yolk sac) extraction. A) cDNA from the embryos was analyzed by RT PC R using primers specific for the A USF transgene to verify A USF expression. All four embryos, two transgenic (TG IV and TG V) and two wild type (WT 7 and WT 8) embryos, we re taken from the same litter. B) RNA was subjected to qRT PCR performed in triplica te for the analysis of h 1 min 1, EKLF, Band3, and USF1 gene expression. Data were analyzed and are represented as described in the legend of Fig ure 3 3

PAGE 72

72 Figure 3 5. ChIP analysis of RNA Pol II and USF1 association with LCR element HS2 and the GAPDH gene in the y olk sac of wild type and A USF transgenic embryos. Embryos (10.5 dpc) were taken from an A USF transgenic female mated to a wild type male. Yolk sacs were isolated an d subjected to ChIP analysis. A) ChIP was performed with antibodies against negative con trol IgG and USF1. DNA was analyzed by qPCR using primers specific for LCR element HS2 as well as for the con trol GAPDH gene, as indicated. B) ChIP was performed with antibodies against the negative control IgG and RNA Pol II. The DNA was analyzed by qPCR using primers specific for LCR element HS2 as well as for the control GAPDH gene, as indicated. Data were normalized to those of IgG and are represented as means standard errors of the means of three independent ChIP experiments with qPCRs performed in triplicate.

PAGE 73

73 Figure 3 6. Interaction of USF with regulatory elements of genes encoding hematopoietic specific transcription factors in MEL cells ChIP analysis of the interaction of USF1 and USF2 with regulatory elements of the EKLF, GATA 1, TAL1 and NF E2 (p45) genes as well as with the Necdin promoter serving as a negative control. The diagrams at the top indicate the position of E boxes with respect to the transcription start site of each individual gene, with arrows indicating the location of prime rs used to amplify each region. ChIP was performed on uninduced or induced MEL cells. Cells were induced to differentiate for 3 days in the presence of 1.5% DMSO. Uninduced and induced cells were incubated with 1% formaldehyde. After being quenched with 12 5 mM glycine, the cells were lysed and chromatin was fragmented by sonication prior to precipitation with antibodies specific for IgG, USF1, or USF2. The isolated DNA was analyzed by qPCR with primers specific for the EKLF, GATA 1, TAL1 NF E2 (p45), and N ecdin gene promoters, as indicated. Results are represented as means standard errors of the means of three independent experiments, with each PCR performed in duplicate.

PAGE 74

74 Figure 3 7. Interaction of USF with regulatory elements of genes encoding hematopo ietic specific transcription factors in fetal liver cells ChIP was performed on 16.5 dpc liver cells, examining the interaction of USF2 with the same regions examined in Figure 3 6 Results are represented as means standard errors of the means of two in dependent experiments with PCRs performed in duplicate.

PAGE 75

75 Figure 3 8 Transgenic A USF embryos reveal a reduction in the number of CD71 + and T er 119 + erythroid cells. Yolk sac cells from 10.5 dpc male embryos were isolated and subjected to flow cytomet ry using antibodies against CD71 or Ter 119. Hatched areas indicate unstained yolk sac cells analyzed separately. Solid lines represent the analysis of cells from A USF expressing transgenic embryos, while shaded gray areas represent cells from wild type e mbryos. A) FACS analysis using antibodies against CD71. B) Number of CD71 positive cells in the 10.5 dpc yolk sac of wild type (WT) and A U SF expressing (A USF) embryos. C) FACS analysis using an tibodies against Ter 119. h 1 gene expression in Ter 119 + embryonic yolk sac cells. Yolk sac cells from 10.5 dpc embryos were sorted using Ter 119 antibodies, and a subset of Ter 119 + cells was collected and subjected to RNA extraction and analysis Data were analyzed as describ ed in the legend to Figure 3 3 and are represented as the means standard errors of the means of two qRT PCRs performed in duplicate. Data from panels A, B, and C were generated by Babak Moghimi.

PAGE 76

76 CHAPTER 4 THE ASSOCIATION OF USF AND BRG1 Introduction Be cause BRG1 / (Brahma Related Gene 1) knockout mice do not survive to birth, a hypomorph ic mutation of BRG1 (BRG1 ENU 1 ) was generated and identified in a mutant mouse screen in which mice were subjected to N ethyl N nitrosourea (ENU) induced mutagenesis. In the BRG1 mutant mice, a single amino acid in a highly conserved region of the catalytic a denosine triphosphatase ( ATPase ) domain was mutated from a negatively charged glutamic acid to a non polar glycine (E1083G) (1 70) The partial loss of function BRG1 ENU1 is stable and able to assemble into SWI/SNF related complexes, but has diminished nucleosome remodeling capabilities ; it is unable to establish DNase I hypersens itive sites M ice carrying a single copy of the hyp omorphic allele (BRG1 ENU 1/ ) develop normally until mid gestation but begin to exhibit defects in the erythroid lineage at ~11.5 dpc. U ltimately, all mutant embryos die by ~14.5 days post coitum ( dpc ) Although B RG 1 is still globin locu s in these mice chromatin remodeling, transcription and epigenetic marks such as histone acetylation and DNA methylation are all affected (170) Like the dominant negative Upstream Stimulatory Factor ( A USF ) tran sgenic male embryos these BRG1 ENU1/ embryos are smaller than their wild type littermates and exhibit signs of anemia (Figure 4 1). Additionally, it was recently demonstrated that BRG1 functions to help establish specific chromatin loops in the globin l ocus in G1E ER4 cells (212) G1E ER4 cells are GATA 1 null erythroid progenitor cells that express a conditional GATA 1 under control of estrogen receptor ligand binding domain T he pattern of BRG1 occupancy at

PAGE 77

77 bot h HS2 and the maj promoter observed upon activation of maj in G1E ER4 cells is similar to what has been previously observed with USF in studies using erythroid differentiation of murine embyronic stem (ES) cells (138) Thus, b oth USF and BRG1 were ob served to bind to HS2 and the maj promoter prior to the binding of RNA p ol ymerase II (RNA Pol II) Due to the similarities in the embryonic phenotypes of both the BRG1 ENU1/ mice as well as the transgenic male A USF mice, it was h ypothesized that USF and BRG1 may be associated in a common protein complex and function together to prepare the locus for the recruitment of RNA Pol II Additionally, the role of USF in loop formation between the globin locus control region ( LCR ) and the maj globin gene was examined as well. Results Chromatin immunoprecipitation ( ChIP ) was performed on uninduced and induced (1.5% dimethylsulfoxide [ DMSO ] 72 h) murine erythroleukemia ( MEL ) cells in order to compare the results to the BRG1 b inding patter n that was originally observed in G1E ER4 cells by Kim, et al. (212) G 1 E ER4 and MEL cells are both representative of erythroid progenitor cells and it was anticipated that the MEL ChIP would produce a similar result Surprisingly, binding of BRG1 to H maj globin in MEL cells appeared to decrease after the 72 h inductio n when compared to BRG1 binding levels in uninduced cells ( Figure 4 2 ). Based on this result, it was suspected that BRG1 is recruited to the locus early on during induction, but th at it may not be required for the continued association of RNA Pol II to the locus. In addition, it was found that RNA Pol II appears to be recruited to the LCR prior to TATA binding protein ( TBP ) binding, maj globin promoter before induction (Figure 4 2). After induction, TBP levels increase at both HS2 and at maj globin

PAGE 78

78 promoter. The presence of RNA Pol II at HS2 prior to induction would suggest that binding of RNA Pol II to the LCR is independent of TBP and that other factors, such as BRG1 and CBP may be involved in its recruitment globin gene locus throughout the duration of the normal 3 day induction period, ChIP was performed on MEL cells incubated with 1.5% DMSO for 24 h, 48 h, and 72 h. As expected, levels of maj globin gene promoter gradually decreased over each day of the induction, with the highest levels of BRG1 binding occurring 24 h after the addition of DMSO (Figure 4 3) Although t his is in agreement with the previous observation of a decrease in BRG1 binding at 72 h after the addition of DMSO this ChIP has only been pe r formed once and needs to be repeated for confirmation In order to deter mine whether USF and BRG1 are part of a common protein complex, Co IP was performed on nuclear extrac t from uninduced 1 day induced (2% DMSO, 24 h), and 3 day induced (1.5% DMSO, 72 h) MEL cells In the induced MEL cells incubated with 2% DMSO for 24 h a band of the expected size of BRG1 (20 5 kDa) was detected in both the input lane as well as the USF2 pulldown lane (Figure 4 4) The se data show that BRG1 interacts with USF2, although the specific nature of this interaction remain s uncharacterized. No int eraction between BRG1 and USF1 was detected, however. Interestingly, in the induced MEL cells incubated with 1.5% DMSO for 72 h, no interaction between either USF1 or USF2 with BRG1 was detected (data not shown). Based on these results i t is believed that USF2 recruits BRG1 to the globin gene locus early on during induction This is consistent with data generated by Dr. Zhuo Zhou, in which USF2 is more efficiently recruited to HS2 in undifferentiated MEL cells

PAGE 79

79 compared to USF1 (211) While it could be argued that the lack of detection of BRG1 observed in the USF1 pull down lane could be due to poor antibody quality, it is unlikely, as the same antibody has been shown to successfully pull down USF1/ USF2 complexes in other co IP studies (211) Although it is known that the LCR comes into close proximity with the globin genes after DMSO mediated erythroid induction of MEL cells, it is not known exactly what protein or protein co mplexes facilitate this interaction In 2007, Song et al. demonstrated by using chromatin immunoprecipitation chromosome conformation capture ( ChIP 3C ) that NLI/Ldb1 is required for loop formation and also that it is a part of the protein scaffold which br maj globin gene (160) However, NLI/Ldb1 itself is not a DNA binding protein, and this interaction would require a multi protein complex to facilitate the interaction betwe en NLI/Ldb1 and the two distal regions of DNA Because there are binding sites for USF in both the LCR as well as at globin gene promoter and USF binding at both loci increases upon DMSO mediated erythroid induction in MEL cells, it was hypoth esized that USF could be a member of this multi maj globin gene (211) In in loop formation, ChIP 3C was performed on u ninduced and induced MEL cells, using a modified protocol based on the ChIP 3C technique described in Song, et al. (160) Unfortunately, multiple attempts at the ChIP 3C pro cedure using antibodies against both USF1 and USF2 yielded no liga tion products between HS2 and h1 or maj globin gene (data not shown). However, a ligation product between HS2 and the maj globin gene was detected when using an antibody against di methylated H3K4 (Figure 4 5) This band was later subjected to gel extraction

PAGE 80

80 and sequenced for verification, and although the band from this ligation product was positively identified as the correct product, further attempts to reproduce this result did not succeed. Discussion The results presented here demonstrate a novel role for the ubiquitou sly expressed USF in chromatin remodeling through interaction with the BRG1 subunit of SWI/SNF. USF has previously been implicated in chromatin remodeling when it was shown that USF interact s with a chromatin boundary globin gene locus and recruits the co regulators p300 and P300/CBP associated factor ( PCAF ) which both harbor histone acetyltransferase ( HAT ) activity (145) The chromatin modifying enzyme s recruited by USF could establish an op en and accessible chromatin region, which would counteract the spread of heterochromatin. USF could also globin gene promoter. Other data has shown that the association of p300 with LCR maj globin promoter, bo th of which associate with USF is reduced in cells expressing A USF (90,113) Additionally, USF2, but not USF1, has been shown to interact with CBP in undifferentiated cells (211) It is believed that USF2 interacts with CBP and BRG1 to establish an open chromatin configuration (Figure 4 6 ). Once this open chromatin is establis hed, however, BRG1 dissociates from the complex but USF2 and CBP remain bound possibly for the purposes of recruiting RNA Pol II to the locus. This would be in agreement with the ChIP data, which indicate that RNA Pol II is present at HS2 prior to induct ion. As MEL cells are representative of an erythroid induction, which leads to terminal erythroid differentiation.

PAGE 81

81 Although it could not be conclusively determined wh ether or not USF plays a role in loop formation between the LCR and the globin genes the data presented here do not exclude t he possibility. Future investigation using the ChIP 3C assay will require more experimentation and controls. Using antibody agains t Ldb1 in the ChIP 3C assay could serve as a positive control, as it has previously been shown to be a part of the loop complex (160) Additional controls include performing the 3C assay in a non erythroid cell lin e, no restriction enzyme digestion, no ligation, and no antibody. In cell cycle studies using K562 cells, USF was also observed to bind to the LCR and globin genes prior to binding of RNA Pol II (90) The next chapter describes further studies on the conformation of the globin locus, with an emphasis on changes that occur in binding of USF or RNA Pol II to the locus duri ng different stage s of the cell cycle.

PAGE 82

82 0 0.0004 0.0008 0.0012 0.0016 IgG BRG1 TBP IgG BRG1 TBP HS2 maj Fraction of Input Figure 4 1 Comparison of hypomorphic BRG1 ENU1 / 12.5 dpc mutant embryos with A USF 11.5 dpc transgenic male embryos (170) Note that the transgenic embryos are pale, w hich is indicative of anemia, and are smaller in size than their wild type littermates. Figure 4 2 Interaction of BRG1, TBP, and RNA Pol II globin locus in uninduced and induced ( 1.5 % DMSO, 72 h) MEL cells Crosslinked cells were sonica ted, and the cell extract s were subjected to immuno precipitation wi th antibodies specific for IgG, rabbit polyclonal BRG1, TBP, and RNA Pol II The isolated DNA was analyzed by qPC R with primers specific for HS2 and the maj globin gene promoter. Results a re normalized to IgG levels and represented as means standard errors of the means of at least three independent experiments, with each PCR performed in duplicate. 0 0.01 0.02 0.03 0.04 0.05 Pol II Pol II HS2 maj Uninduced Induced BRG1 ENU1 / A USF

PAGE 83

83 Figure 4 3 globin locus in uninduced and induc ed (1.5% DMSO ; 24, 48, or 72 h) MEL cells ChIP was performed on uninduced or induced MEL cells. Crosslinked cells were sonicated, and the cell extract s were subjected to immuno precipitation with antibodies spe cific for IgG and rabbit polyclonal BRG1 The isolated DNA was analyzed by qPC maj globin gene promoter. Results are represented as means standard deviation of a single ChIP experiment with qPCR performed in duplicate Figure 4 4 Immunoblot analysis of Co IP on nuclear extract from uninduced and induced (2% DMSO, 24 h) MEL cells Protein complexes were i solated from nuclear extract usin g antibodies against rabbit IgG, mouse monoclonal BRG1, USF1, and USF2, while the membrane was probed using mouse polyclonal antibody against BRG1. 0 0.0005 0.001 0.0015 0.002 0.0025 IgG BRG1 IgG BRG1 HS2 maj Fraction of Input 0 0.01 0.02 0.03 0.04 0.05 Pol II Pol II HS2 maj Day 1 Day 2 Day 3

PAGE 84

84 Figure 4 5. Analysis of ChIP 3C ligation products from induced (1.5% DMSO, 72 h) globin gene locus ; red or b lack bars below indicate Hind III digestion fragments with in which the primers bind (160) B) Agarose gel analysis of ligation products using primers for the regions indicated at the top. HS2 served as an anchor primer to either the maj globin gene HS1. Protein DNA complexes were pulled down with the antibodies listed bel ow, and eluted DNA was subjected to PCR. The band observed in HS2 maj using antibody against di methylated H3K4 was excised and sequenced for verification. NTC indicates no template control. Figure 4 6 Model of USF2/CBP/BRG1 mediated recruitment of RNA P ol II to the globin LCR USF2 and CBP are recruited to the LCR prior to induction and recruit the chromatin modifying enzyme BRG1. After remodeling has occurred and nucleosomes have been shifted or slid to create a more open chromatin structure, BRG1 is no longer needed and dissociates from the LCR. USF2 and CBP remain bound, and may serve to recruit RNA Pol II. The open chromatin also allows for other transcription factors, such as GATA 1 and type globin gene expression.

PAGE 85

85 CHAPT ER 5 EXAMINING THE CONFORMATION OF THE BETA GLOBIN LOCUS AT DIFF ERENT CELL CYCLE STAGES Introduction All organisms consist of cells that multiply through cell division An adult human has approximately 1 10 1 4 cells, all of which o riginated from a single fertilized egg cell (59) A n enor mous number of cells in the human body are also continuously dividing to replac e dying cells B efore a cell can divide it must grow in size, duplicate its chromosomes and separate those chromosomes for exact distribution between two daughter cells (3) These different processes are coordinated in the cell cycle. During the first phase ( G 1 first gap ) of the cell cycle, the cell grows and becomes larger. Once it has reached a certain size the cell enters S phase (synthesis) in which it duplicates its genome and a copy of each chromosome is formed. During the next phase (G 2 seco nd gap ) the cell ensures that DNA replication is completed and prepares for cell division. The chromosomes are separated during M phase (mitosis) and the cell divides, yielding two daughter cells that each carry a copy of the original genome (3) The t ranscriptional activity of genes may be affected by replica tion and other chang es that alter the DNA structure during these different stages of the cell cycle (213) I n general, the replication of many tissue specific genes occurs late in most tissues during S phase but early in the tissue of expression (214) globin gene locus replicates early in erythroid cells, but late in nearly all other cell types (84) globin gene locus, this early replication timing is correlated with an open chromatin structure but not gene transcription (215) In eukaryotic cells ent ering mitosis, transcription is silenced and most transcription factors, as well as RNA p olymerase II ( RNA Pol II ) are displaced (216) However, other studies

PAGE 86

86 have shown that transcription factors TFII D and TFII B can remain associated with active gene promoters during mitosis (217) These mitotic promoter complexes ma y maintain the transcriptional competence of genes or facilitate the rapid reactivation of transcription upon exit from mitosis. In a previous study by Dr. Karen Vieira the interaction of transcription complexes globin locus was analyzed using chromatin immunoprecipitation ( ChIP ) in synchronized human erythroleukemia ( K562 ) cells (90) The analysis of protein/DNA interactions at the globin locus during S phase in synchronized cells revealed a dynamic pattern of dissociation and re association for both transcription fa ctors and RNA P ol II Synchronized samples were analyzed directly after double thymidine block (time 0), as well as cells harvested at 15 min, 45 min, 2 h, and 6 h after release from the block. At time 0, RNA Pol II is observed to associate with HS2 as wel l as with globin promoters. After 15 min N F E2 (p45) is also observed to colocalize to HS2 globin promoter until after 45 min After 2 h RNA Pol II dissociates from both HS2 as well as the globin promoter Interestingly, globin promoter at this time. By performing semi quantitative PCR using primers specific for the human globin locus it was globin locus is completed by 2 h in K562 cell s (90) After 6 h, USF2 is observed to dissociate from the locus, which is accompanied by the reappearance of RNA Pol globin promoter. In the study presented here the synchronization o f K562 cells by double thymidine block was repeated in order to verify the previous ly observed results Additionally, K562 c ells released from block were subsequently i ncubated in the presence of nocodazole ;

PAGE 87

87 this reversibly arrests cells in M phase by chemically interfering with the polymerization of microtubule s, which prevent s the mitotic spindles from forming (218,219) The i n teraction of transcription complexes with specific regions of globin locus in these mitotically arrested K562 cells was examined by ChIP and PCR Finally, synchronized K652 cells were also harvested for chromatin conformation capture (3C) globin locus at specific time points after the release from double thymidine block in order to examine the conformation of the locus at those times. Results Both untreated and drug treated K562 cells were subjected to flow cytometry analysis in order to verify synchronization and arrest (F igure 5 1 ). Cells harvested for analysis directly after the double thymidine block were considered time 0, and are blocked at the boundary of G 1 /S phase These cells are F igure s 5 1 and 5 2 ol II binds to both HS2 and the globin gene promoter in synchronized cells harvested at time 0 (Figure 5 2). Originally, it was anticipated that the extensive condensation of chromatin during mitosis would disrupt the globin locus conformation re quired f or transcription of the genes. However, results from PCRs performed on ChIP samples from mitotically arrested globin gen e promoter region during M phase (Figure 5 2 ) While RNA Pol II appe ars to globin gene promoter region in these cells it is not known whether transcription is taking place, or if RNA Pol II is merely associated but remaining idle until completion of mitosis Since g lobin it is possible that the continuous association of RNA Pol II may assist in the transition to active

PAGE 88

88 transcription immediately upon exit from M phase Interestingly, CBP is also seen to bind to HS2 during M phase, and may serve to re recruit RNA Pol II to HS2 (Figure 5 2) Interestingly, during M phase, lower levels of RNA Pol II are observed to associate globin promoter (Figure 5 2) which was confirmed by qPCR (data not shown). Additional PCRs using primers designed to ampli fy the 3 end of the A globin were performed in order to determine whether RNA Pol II was also present in this region Levels of RNA Pol II binding appear to be reduced compared to that of the 5 end, suggesting that any RNA Pol II bound to the A globin gene promoter during the M phase arrest are stalled and not engaged in transcription elongation (Figure 5 2 ). The tive RT PCR (data not shown). In order to determine if RNA Pol II globin gene ChIP was performed on both synchronized (time 0) and mitotically arrested K562 cells using antibodies for total RNA Pol II as well as antibodies that discriminate between the transcribing and non tran scribi ng forms of RNA Pol II. Phosphory l a tion of serine 5 (Ser 5) of the carboxy terminal domain ( CTD ) of RNA Pol II is indicative of transcriptional initiation, while serine 2 (Ser 2) phosphorylation of the CTD is indicative of transcriptional elongation In comparison to total RNA Pol II levels both Ser 2 and Ser 5 globin promoter are low (Figure 5 3). This would indicate that in both synchronized and mitotically arrested cells, any RNA Pol II binding to HS2 and the globin promoter are unphosphorylated and therefore inactive However, th is ChIP

PAGE 89

89 has only been performed once and needs to be repeated before any conclusions can be made regarding the data. In order to ascertain the chromatin conformation at specific times during S phase, 3C was performed on synchronized K562 cells The 3C assa y allows for the study of h igher order chromatin structures ; specifically, where two or more pieces of chromatin are brought together in close spatial proximity (194) It is thought that these associations between different chromatin domain s may mediate transcriptional regulation and other globin gene locus, 3C has been used extensively in mammalian cells to study of long range chromatin interactions between the LCR and the globin genes downs tream (220) In this study, K562 cells were first synchro nized by double t hymidine block, harvested at specific times after block ( 0, 45 m in 2 h) and then analyzed by both ChIP and 3C. The ChIP was performed in order to verify what was resulting timing of dissociation of R NA Pol II and USF2 are not the same. Nevertheless, the trend is still similar, as RNA Pol II is seen to globin gene promoter at 45 min after release from block, and observed to re appear at 2 h (Figure 5 4). The same samples h arvested at 0, 45 min, and 2 h after release were also subjected to 3C analysis followed by subsequent PCR analyses using primers that would detect a ligation product between LCR element HS2 and either HS3, the A 5 ). A band the expected size ( ~ 226 bp) was observed in the lane using primers amplifying a ligation product between HS2 and the A globin gene for all time points. While this could indicate a possible interaction between HS2 and the A globin gene during these t imes and therefore suggest that the

PAGE 90

90 loop formation remains intact during the dissociation of RNA Pol II various larger and nonspecific bands also apparent on the gel (Figure 5 5) The ~226 bp band which matches the expected size of a ligation product be tween HS2 and the the A globin gene, was excised and subjected to gel extraction for verification by sequencing, but unfortunately a clear verifiable sequence was unable to be obtained A PCR using the same primers on genomic DNA extracted directly from K 562 cells yielded no product, indicating that the observed band is not a by product of genomic amplification using these primers (data not shown). Discussion I t could be argued that the binding of RNA Pol II observed in the m itotically arrested K562 cells is attributable to the small population of cells escaping arrest, and the non globin However, this gene would not in theory, undergo active transcription in arrested cells. In order to test this hypothesis, heterogeneous nuclear RNA ( hnRNA ) levels of the gene could be measure d in b oth unsynchronized and arrested cells. The short lived hnRNA, al so know n as precursor mRNA or pre mRNA is an incompletely processed single strand of mRNA sy nthesized from a DNA template (221) Thus, aside from containing uracil in place of thymine, the hnRNA sequence is identical to the original genomic DNA because it still contains introns but also contain s A tail While mRNA dictates steady state transcription levels, the rapid processing and turnover of hnRNA makes this transient RNA form ideal for determining active transcription levels, since eukaryotic hnRNA exists only brie fly before it is ful ly processed into mature mRNA. It has previously been shown that both chicken and mouse globin hnRNA have half lives of around 3 5 minutes (222,223) In comparison, it is estimated that the

PAGE 91

91 stru ctural half globin mRNA are approximately 27 29 hours, while the functional half lives are approximately 7 9 hours, based on studies using cultured human adult and neonatal reticulocytes (224) If the level of reduction in the rapidly processed globin hn RNA between the unsynchronized and the mitotically arrested K562 cells is proportionally comparable to the reduction in the total number of cells in G 1 phase then it could be assumed that the RNA Pol II binding is attribut able to arrested cells. This would indicate that the mitotically arrested K562 globin gene promoter even in M phase, but are not actively transcribing. In addition to these possib le future hnRNA studies, more ChIP on the Ser 2 and Ser 5 phosphorylated forms of RNA Pol II need to be performed on the synchronized and mitotically arrested cells. Additionally, ChIP using antibodies against Ser 2 and Ser 5 RNA Pol II needs to be perform ed on unsynchronized K562 cells to serve as a comparison. The 3C assay presented here is only preliminary and although it is reproducible, the amplified ligation product between HS2 and A globin was unable to be sequenced for verification. Based on this as well as the additional bands observed on the gel, it is likely the primer may not be entirely specific for the intended region of amplification. Adjustments to the annealing temperature in the 3C PCR protocol may need to be made to reduce background levels. Melting curve analysis on the PCR amplified DNA may also help determine whether the primers for amplifying a ligation product between HS2 and the A globin gene have sufficient specif icity. Additionally, different primers for globin gene locus were designed, but no 3C ligation products were detected in PCR analyses using these new primers (data not shown).

PAGE 92

92 Immediately, it is imperative that viable 3C primers for the human globin locus be obtained before any more studies of the chromatin conformation in these synchronized K562 cells can be done. I n the future, additional important 3C controls must also be implemented, including but not limited to performing 3C on non crosslinked cells as well as non erythroid cells, a no restriction enzyme control, and a no ligation control. Furthermore, the HS3 HS2 ligation fragment was originally intended to serve as a positive control in the 3C assay due to the fact that thes e two regions reside in close proximity within the LCR. However, no ligation between HS3 and HS2 was detected by PCR. It is possible that a fragment may become apparent with additional cycles in the PCR. Nevertheless, if the PCR band observed in the ligati on product between HS2 and globin gene promoter i s not a mere artifact it poses an interesting scenario This would suggest that LCR remains in contact with the globin genes downstream even when RNA Pol II is dissociated and that the association of other factors, such as USF2, may mediate the continued association between the LCR and the genes. These factors may serve to re recruit RNA Pol II upon completion of replication. It is unknown how replication factors affect the conformation of the locus, and unfortunately in the context of the nonspecific bands and lack of sequence verification no definitive conclusions can be made regarding these 3C data In addition to the controls mentioned above, m ore time points after release from block should be an alyzed as well such as 0, 15 min, 45 min, 2 h, 4 h, and 6 h after release from block.

PAGE 93

93 Figure 5 1 Representative f low cytometry analysis of untreated (unsynchronized) and drug treated (synchronized mitotic arrest) K562 cells stained with propidium i odide. Cells treated with double thymidine block and harvested at time 0 are labeled as synchronized while mitotic arrest indicates cells incubated with nocodozole after release from block. Figure 5 2 Analysis of ChIP from synchronized (harvested at t ime 0) or m itotically arrested K562 cells. ChIP was performed with the indicated antibodies and samples were analyzed by PCR using primers for LCR element HS2 (top), globin promoter region (middle), or the 3 globin (bottom). PCR product s were electrophoresed on a 5% TBE gel and stained with SybrGreen for analysis. Unsynchronized Synchronized Mitotic Arrest

PAGE 94

94 Figure 5 3 qPCR analysis of ChIP on various phosphorylation states of RNA Pol II in synchronized and mitotically arrested K562 cells. Data are normalized to IgM (Ser 5) or IgM (Ser 2), and error bars reflect means standard error of a single ChIP experiment with qPCR performed in duplicate. Figure 5 4. Analysis of ChIP from synchronized K562 cells harvested at the indicated time points (0, 45 min, 2 h). ChIP was performed with the indicated antibodies, and samples were analyzed by PCR using primers for LCR element HS2. PCR products wer e electrophorese d on a 5% TBE gel and stained with SybrGreen for analysis. 0 0.4 0.8 1.2 1.6 2 IgM Ser 5 IgG Ser 2 IgM Ser 5 IgG Ser 2 HS2 A globin Fold of Input Relative to IgM or IgG Synchronized Mitotic arrest

PAGE 95

95 Figure 5 5 3C Analysis of synchronized K562 cells A) Sche globin locus with black triangles indicating approximate location of primer s used B) PCR analyses for cells harvested at 0, 45 min, and 2 h after double thymidine block, as indicated. The HS2 primer was used as an anchor to examine l igation products between the LCR and other regions in the locus including HS3, A PCR products were electrophoresed on a 5% TBE gel and stained with SybrGreen for analysis.

PAGE 96

96 CHAPTER 6 DISCUSSION AND FUTUR E DIRECTIONS Regulation of Mouse and Human globin Gene Expression by USF It currently is unknown how ubiquitously expressed and tissue specific transcription factors coordinate the activation of highly expressed genes during differentiation. T issue specific factors may mediate t he accessibility of regulatory sites, while ubiquitously expressed proteins perform basic functions involved in the local remodeling of nucleosomes and the recruitment of transcription complexes. The data presented here demonstrate that Upstream Stimulator y Factor ( USF ) is required for high maj globin gene. Based on the homology of the E boxes in the globin promoter region (Figure 1 3), it is likely that USF also regulates the adult human globin gene. Additionally it was shown p reviously that mutations of the +60 E box in the adult globin promoter reduced transcription to a level comparable to that observed after mutation of the initiator sequence (113) I t is hypothesized that in adult erythroid cells globin promoter and recruits coactivator complexes which modify the chromatin structure to increase accessibility for the transcrip tional machinery In order to study the role of USF in adult human globin expres sion, transgenic mice expressing both dominant negative USF ( A USF ) YAC) have been generated This was done by crossing transgenic females from the A USF mouse line with transgenic males carrying YAC YAC mice contain the globin gene locus, including the locus control region ( LCR ) as well as areas upstream and d ownstream of the locus (Figure 6 1 ) (225,226) S YAC mice have shown that in these mice, expr type genes is also

PAGE 97

97 limited to erythroid cells and that the developmental regulation remains similar to that of globin locus (226) Figure 6 1 illustrates differences in gene and tissue expression when analyzed in the context of transgenic mice (227) Any c hang es in recruitment of RNA p olymerase II (RNA Pol II) globin gene in these A USF/ YAC mice can be examined by ChIP and subsequent real time PCR. Unsurprisingly, no adult male mice carrying both A USF and YAC have been generated as of yet This is likely due to the fact that erythropoiesis in these mice is disturbed. Because the production of adult A USF/ YAC ma les is not anticipated to be possible, embryonic A USF/ YAC males should be analyzed in addition to adult A USF/ YAC females. Recruitment of Transcription Complexes to the LCR Previous studies have shown that Erythroid Krppel Like Factor ( EKLF ) is requi red globin gene promoter (165,228,229) Interestingly, a recent report from Sengupta et al. revealed a requirement for EKLF in the recruitment of TAF9, which interacts with a globin gene, suggesting that EKLF is directly involved globin gene promoter (230) NF E2 ( p45) globin gene promoter, but it is dispensable for its initial recruitment to the LCR (231) Since both proteins appear to be regulated by USF, the data presented here suggest that USF globin gene expression indirectly by enhancing the expression of erythroid specific transcription factors and directly by cooperating with these factors in the recruitment of transcription comple xes to the globin gene locus.

PAGE 98

98 While the transcription tracking mechanism may explain gene activation, it is not known how looping can lead to the enhanced expression of the globin genes. LCR mediated gene activation either results in enhanced recruitment o f transcription complexes to the globin genes and/or in the conversion of transcription initiation complexes to elongation active complexes (26,108) This could be achieved by providing activities that are first re cruited to the LCR and subsequently transferred to globin genes. For example, transcription complexes could first be recruited to the LCR and looping would mediate the transfer to the globin gene promoters. The active chromatin hub ( ACH ) would provide a hi gh local concentration of transcription factors that could efficiently capture transcription complexes which would then be recruited to and positioned at the basal promoters of the globin genes to engage in productive transcription. Alternatively, or addit ionally, elongation incompetent transcription complexes may be recruited to the genes while the LCR provides activities necessary for activation, for example, kinases that phosphorylate serine 2 (Ser 2) at the RNA Pol II carboxy terminal domain ( CTD ) or co regulator complexes that modify chromatin structure at the globin gene promoters either to enable recruitment of transcription complexes and/or to allow elongation Additionally, the data presented here also suggest that in MEL cells, RNA Pol II is recrui ted to the LCR prior to recruitment of TBP (TATA binding protein) although TBP is observed to be present at the maj promoter before induction (Figure 4 4) A TBP independent mechanism of recruitment of RNA Pol II to the HS2 may exist which would involve other factors. CBP (CREB binding protein) is one likely candidate; i t is known to bind to enhancers, and was obs erved to bind to HS2 in mitotically arrested K562 cells

PAGE 99

99 (Figure 5 2 ) Studies regarding the TBP independent recruitment of RNA Pol II to the LCR can be performed on linearized LCR constructs immobilized on streptavidin coated magnetic beads as described p reviously (90,144,211) Nuclear extract from uninduced and induced MEL cells would be immunodepleted using antibodies against TBP and/or CBP, and t he immobilized LCR streptavidin bead constructs would then be incub ated in this n uclear extract. This would allow the observation of any changes in the recruitment of RNA Pol II to the LCR in the absence of TBP or CBP, or both. USF, BRG1, and Transcription Factories USF was one of the first transcription factors shown to activate transcription mediated by RNA Pol II, and it plays a role in the high level expression of many genes in differentiated cells (130,139) Accumulating evidence points to the possibility that highly expressed genes are transcribed in specialized nuclear domains enriched for splicing factors and RNA Pol II, often referred to as transcription factories or transcription domains (207 209) It is possible that the LCR nucle ates such a transcription domain in erythroid cells (184) USF and Brahma Related Gene 1 ( BRG1 ) are possible candidate protein s that could mediate the association of genes or regulat ory elements wit h transcription factories in the nucleus. In future studies, immunofluorescence and florescent in situ hybridization (FISH) can be used on yolk sac cells isolated from A USF transgenic embryos in order to determine if recruitment of the globin locus to transcription factories is hindered by expression of A USF. Therapeutic Strategies globin genes a re competitively regulated by the LCR and activation of the type globin genes requires the LCR to come in close proximity to the genes (104,127) During the differentiation of erythroid cells, it appears that ce rtain factors and protein

PAGE 100

100 complexes, including RNA Pol II, first associate with the LCR before they interact with the globin gene promoters (90,212,232) The LCR could serve as the primary site of recruitment for a ctivities involved in globin gene regulation and t hese activities could be transferred to the globin genes by looping mechanisms (26,105,144) If mechanisms are known that mediate the stage specific association of the globin genes with the LCR, strategies could be developed to change these association patterns. This could lead to novel therapies for the treatment of sickle cell anemia or other hemoglobinopathies, e.g., by favoring interactions of the LCR with thera globin genes over those with globin genes. Summary In summary, these data show that USF is required for high level globin gene expression and that it enhances the expression of erythropoietic transcription factors. Additionally, USF globin gene locus. USF also appears to form a complex with the BRG1 subunit of the SWI/SNF chromatin remodeling complex. It is hoped that this i ncreased understanding globin ge ne expression and erythropoiesis will lead to better therapeutic strategies for individuals suffering from hemoglobinopathies.

PAGE 101

101 Figure 6 1. globin gene locus YAC ( YAC) and changes in expression patt ern when expressed in transgenic mice (26) In YAC mice, t globin genes are co expressed in the embryonic yolk sac while the globin gene is expressed at high levels in fetal liver and circulat ing erythroid cells from bone marrow. Embryonic yolk sac Globin gene expression during development Expression of the globin genes in transgenic mice Fetal liver Adult bone marrow Embryonic yolk sac Fetal liver and adult bone marrow

PAGE 102

102 Figure 6 2 Model depicting USF and BRG1 globin gene expression (210) The expression of USF increases during the differentiation of erythroid ce lls. Both USF and EKLF interact physically with the BRG1 subunit of SWI/SNF, and may serve to modify the chromatin structure to a transcriptionally permissive state. USF also regulates the recruitment of globin gene locus b y interacting with E boxes globin gene promoter. Through the LCR, USF regulates the expression of the embryonic genes. USF further regulates the expression of the globin genes indirectly by enhancing the expres sion of erythroid cell specific transcription factors with which it cooperates in mediating the recruitment of transcription complexes to the globin gene locus.

PAGE 103

103 LIST OF REFERENCES 1. Stamatoyannopoulos, G., and Nienhuis, A. (1994) The Molecular Basis of Blood Diseases 2nd ed., W. B. Saunders, Philadelphia, PA 2. Norberg, B., Bandmann, U., and Rydgren, L. (1977) J Mechanochem Cell Motil 4 37 53 3. Campbell, N. A., Reece, J. B., and Mitchell, L. G. (1999) Biology 5th ed., Benjamin/Cum mings, an imprint of Addison Wesley Longman, Inc., Menlo Park, CA 4. Tsiftsoglou, A. S., Vizirianakis, I. S., and Strouboulis, J. (2009) IUBMB Life 61 800 830 5. Fried, W. (2009) Exp Hematol 37 1007 1015 6. Perutz, M. F. (1960) Brookhaven Symp Biol 13 1 65 183 7. Huehns, E. R., Flynn, F. V., Butler, E. A., and Beaven, G. H. (1961) Nature 189 496 497 8. Huisman, T. H., and Prins, H. K. (1955) J Lab Clin Med 46 255 262 9. Allen, D. W., Wyman, J., Jr., and Smith, C. A. (1953) J Biol Chem 203 81 87 10. Per utz, M. F. (1978) Sci Am 239 92 125 11. Weatherall, D. J. (1997) BMJ 314 1675 1678 12. Trampuz, A., Jereb, M., Muzlovic, I., and Prabhu, R. M. (2003) Crit Care 7 315 323 13. Williams, T. N., Maitland, K., Bennett, S., Ganczakowski, M., Peto, T. E., Newb old, C. I., Bowden, D. K., Weatherall, D. J., and Clegg, J. B. (1996) Nature 383 522 525 14. Aidoo, M., Terlouw, D. J., Kolczak, M. S., McElroy, P. D., ter Kuile, F. O., Kariuki, S., Nahlen, B. L., Lal, A. A., and Udhayakumar, V. (2002) Lancet 359 1311 1 312 15. Murayama, M. (1967) Clin Chem 13 578 588

PAGE 104

104 16. Voet, D., Voet, J. G., and Pratt, C. W. (2002) Fundamentals of Biochemistry Upgrade ed., John Wiley & Sons, Inc., Hoboken, NJ 17. Galanello, R., and Cao, A. (1998) Ann N Y Acad Sci 850 325 333 18. Wea therall, D. J. (2004) Nat Rev Genet 5 625 631 19. Urbinati, F., Madigan, C., and Malik, P. (2006) Expert Rev Mol Med 8 1 26 20. Nathan, D. G., and Gunn, R. B. (1966) Am J Med 41 815 830 21. Hershko, C., Graham, G., Bates, G. W., and Rachmilewitz, E. A. (1978) Br J Haematol 40 255 263 22. Porter, J. B., Abeysinghe, R. D., Marshall, L., Hider, R. C., and Singh, S. (1996) Blood 88 705 713 23. Modell, B., Khan, M., and Darlison, M. (2000) Lancet 355 2051 2052 24. Spivak, J. L., Gascon, P., and Ludwig, H. (2009) Oncologist 14 Suppl 1 43 56 25. Bulger, M., and Groudine, M. (1999) Genes Dev 13 2465 2477 26. Levings, P. P., and Bungert, J. (2002) Eur J Biochem 269 1589 1599 27. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (1 997) Nature 389 251 260 28. Bishop, T. C. (2008) Biophys J 95 1007 1017 29. Bednar, J., Horowitz, R. A., Grigoryev, S. A., Carruthers, L. M., Hansen, J. C., Koster, A. J., and Woodcock, C. L. (1998) Proc Natl Acad Sci U S A 95 14173 14178 30. Thoma, F., Koller, T., and Klug, A. (1979) J Cell Biol 83 403 427 31. Luger, K., and Richmond, T. J. (1998) Curr Opin Genet Dev 8 140 146 32. Lennartsson, A., and Ekwall, K. (2009) Biochim Biophys Acta 1790 863 868

PAGE 105

105 33. Munshi, A., Shafi, G., Aliya, N., and Jyothy A. (2009) J Genet Genomics 36 75 88 34. Strahl, B. D., and Allis, C. D. (2000) Nature 403 41 45 35. Jenuwein, T., and Allis, C. D. (2001) Science 293 1074 1080 36. Pal, S., and Sif, S. (2007) J Cell Physiol 213 306 315 37. Tian, X., and Fang, J. (200 7) Acta Biochim Biophys Sin (Shanghai) 39 81 88 38. Shi, Y. (2007) Nat Rev Genet 8 829 833 39. Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J. R., Cole, P. A., and Casero, R. A. (2004) Cell 119 941 953 40. Anand, R., and Marmorstein, R. (2007) J Biol Chem 282 35425 35429 41. Kuo, M. H., and Allis, C. D. (1998) Bioessays 20 615 626 42. Dhalluin, C., Carlson, J. E., Zeng, L., He, C., Aggarwal, A. K., and Zhou, M. M. (1999) Nature 399 491 496 43. Vignali, M., Hassan, A. H., Neely, K. E., and Wo rkman, J. L. (2000) Mol Cell Biol 20 1899 1910 44. Gangaraju, V. K., and Bartholomew, B. (2007) Mutat Res 618 3 17 45. Ho, L., and Crabtree, G. R. (2010) Nature 463 474 484 46. Hassan, A. H., Prochasson, P., Neely, K. E., Galasinski, S. C., Chandy, M., Carrozza, M. J., and Workman, J. L. (2002) Cell 111 369 379 47. Martens, J. A., and Winston, F. (2003) Curr Opin Genet Dev 13 136 142 48. Deuring, R., Fanti, L., Armstrong, J. A., Sarte, M., Papoulas, O., Prestel, M., Daubresse, G., Verardo, M., Moseley, S. L., Berloco, M., Tsukiyama, T., Wu, C., Pimpinelli, S., and Tamkun, J. W. (2000) Mol Cell 5 355 365 49. Corona, D. F., and Tamkun, J. W. (2004) Biochim Biophys Acta 1677 113 119

PAGE 106

106 50. Goldmark, J. P., Fazzio, T. G., Estep, P. W., Church, G. M., and Tsu kiyama, T. (2000) Cell 103 423 433 51. Grune, T., Brzeski, J., Eberharter, A., Clapier, C. R., Corona, D. F., Becker, P. B., and Muller, C. W. (2003) Mol Cell 12 449 460 52. Shen, X., Mizuguchi, G., Hamiche, A., and Wu, C. (2000) Nature 406 541 544 53. Xue, Y., Wong, J., Moreno, G. T., Young, M. K., Cote, J., and Wang, W. (1998) Mol Cell 2 851 861 54. Kobor, M. S., Venkatasubrahmanyam, S., Meneghini, M. D., Gin, J. W., Jennings, J. L., Link, A. J., Madhani, H. D., and Rine, J. (2004) PLoS Biol 2 E131 5 5. Ruhl, D. D., Jin, J., Cai, Y., Swanson, S., Florens, L., Washburn, M. P., Conaway, R. C., Conaway, J. W., and Chrivia, J. C. (2006) Biochemistry 45 5671 5677 56. Adam, M., Robert, F., Larochelle, M., and Gaudreau, L. (2001) Mol Cell Biol 21 6270 6279 57. Redon, C., Pilch, D., Rogakou, E., Sedelnikova, O., Newrock, K., and Bonner, W. (2002) Curr Opin Genet Dev 12 162 169 58. Faast, R., Thonglairoam, V., Schulz, T. C., Beall, J., Wells, J. R., Taylor, H., Matthaei, K., Rathjen, P. D., Tremethick, D. J., and Lyons, I. (2001) Curr Biol 11 1183 1187 59. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002) Molecular Biology of the Cell 4th ed., Garland Science, New York, NY 60. Schardin, M., Cremer, T., Hager, H. D., and Lang, M. (1985) Hum Genet 71 281 287 61. Ragoczy, T., Bender, M. A., Telling, A., Byron, R., and Groudine, M. (2006) Genes Dev 20 1447 1457 62. Boyle, S., Gilchrist, S., Bridger, J. M., Mahy, N. L., Ellis, J. A., and Bickmore, W. A. (2001) Hum Mol Genet 10 21 1 219 63. Croft, J. A., Bridger, J. M., Boyle, S., Perry, P., Teague, P., and Bickmore, W. A. (1999) J Cell Biol 145 1119 1131

PAGE 107

107 64. Hughes, T. A., Pombo, A., McManus, J., Hozak, P., Jackson, D. A., and Cook, P. R. (1995) J Cell Sci Suppl 19 59 65 65. Wei, X., Samarabandu, J., Devdhar, R. S., Siegel, A. J., Acharya, R., and Berezney, R. (1998) Science 281 1502 1506 66. Grande, M. A., van der Kraan, I., de Jong, L., and van Driel, R. (1997) J Cell Sci 110 ( Pt 15) 1781 1791 67. Iborra, F. J., Pombo, A., Ja ckson, D. A., and Cook, P. R. (1996) J Cell Sci 109 ( Pt 6) 1427 1436 68. Hieda, M., Winstanley, H., Maini, P., Iborra, F. J., and Cook, P. R. (2005) Chromosome Res 13 135 144 69. Osborne, C. S., Chakalova, L., Brown, K. E., Carter, D., Horton, A., Debra nd, E., Goyenechea, B., Mitchell, J. A., Lopes, S., Reik, W., and Fraser, P. (2004) Nat Genet 36 1065 1071 70. Bender, M. A., Bulger, M., Close, J., and Groudine, M. (2000) Mol Cell 5 387 393 71. Smale, S. T., and Kadonaga, J. T. (2003) Annu Rev Biochem 72 449 479 72. Willis, I. M. (1993) Eur J Biochem 212 1 11 73. Grummt, I. (1999) Prog Nucleic Acid Res Mol Biol 62 109 154 74. Sims, R. J., 3rd, Mandal, S. S., and Reinberg, D. (2004) Curr Opin Cell Biol 16 263 271 75. Buratowski, S., Hahn, S., Guarent e, L., and Sharp, P. A. (1989) Cell 56 549 561 76. Hoiby, T., Zhou, H., Mitsiou, D. J., and Stunnenberg, H. G. (2007) Biochim Biophys Acta 1769 429 436 77. Robert, F., Douziech, M., Forget, D., Egly, J. M., Greenblatt, J., Burton, Z. F., and Coulombe, B. (1998) Mol Cell 2 341 351 78. Thomas, M. C., and Chiang, C. M. (2006) Crit Rev Biochem Mol Biol 41 105 178

PAGE 108

108 79. Littlefield, O., Korkhin, Y., and Sigler, P. B. (1999) Proc Natl Acad Sci U S A 96 13668 13673 80. Hampsey, M., and Reinberg, D. (2003) Cell 113 429 432 81. Wada, T., Takagi, T., Yamaguchi, Y., Ferdous, A., Imai, T., Hirose, S., Sugimoto, S., Yano, K., Hartzog, G. A., Winston, F., Buratowski, S., and Handa, H. (1998) Genes Dev 12 343 356 82. Yamaguchi, Y., Takagi, T., Wada, T., Yano, K., Furu ya, A., Sugimoto, S., Hasegawa, J., and Handa, H. (1999) Cell 97 41 51 83. Orphanides, G., and Reinberg, D. (2002) Cell 108 439 451 84. Li, Q., Peterson, K. R., Fang, X., and Stamatoyannopoulos, G. (2002) Blood 100 3077 3086 85. Grosveld, F., van Assend elft, G. B., Greaves, D. R., and Kollias, G. (1987) Cell 51 975 985 86. Forrester, W. C., Epner, E., Driscoll, M. C., Enver, T., Brice, M., Papayannopoulou, T., and Groudine, M. (1990) Genes Dev 4 1637 1649 87. Epner, E., Reik, A., Cimbora, D., Telling, A., Bender, M. A., Fiering, S., Enver, T., Martin, D. I., Kennedy, M., Keller, G., and Groudine, M. (1998) Mol Cell 2 447 455 88. Stamatoyannopoulos, G. (2005) Exp Hematol 33 259 271 89. Higgs, D. R. (1998) Cell 95 299 302 90. Vieira, K. F., Levings, P. P., Hill, M. A., Crusselle, V. J., Kang, S. H., Engel, J. D., and Bungert, J. (2004) J Biol Chem 279 50350 50357 91. Li, Q., Zhang, M., Duan, Z., and Stamatoyannopoulos, G. (1999) Genomics 61 183 193 92. Li, Q., and Stamatoyannopoulos, G. (1994) Blood 8 4 1399 1401 93. Li, Q., Zhang, M., Han, H., Rohde, A., and Stamatoyannopoulos, G. (2002) Nucleic Acids Res 30 2484 2491

PAGE 109

109 94. Ellis, J., Tan Un, K. C., Harper, A., Michalovich, D., Yannoutsos, N., Philipsen, S., and Grosveld, F. (1996) EMBO J 15 562 568 9 5. Tuan, D. Y., Solomon, W. B., London, I. M., and Lee, D. P. (1989) Proc Natl Acad Sci U S A 86 2554 2558 96. Tuan, D., Kong, S., and Hu, K. (1992) Proc Natl Acad Sci U S A 89 11219 11223 97. Orphanides, G., and Reinberg, D. (2000) Nature 407 471 475 9 8. Tanimoto, K., Sugiura, A., Omori, A., Felsenfeld, G., Engel, J. D., and Fukamizu, A. (2003) Mol Cell Biol 23 8946 8952 99. Zhu, X., Ling, J., Zhang, L., Pi, W., Wu, M., and Tuan, D. (2007) Nucleic Acids Res 35 5532 5544 100. Johnson, K. D., Grass, J. A., Park, C., Im, H., Choi, K., and Bresnick, E. H. (2003) Mol Cell Biol 23 6484 6493 101. Palstra, R. J., Simonis, M., Klous, P., Brasset, E., Eijkelkamp, B., and de Laat, W. (2008) PLoS One 3 e1661 102. Hosey, A. M., Chaturvedi, C. P., and Brand, M. (2 010) Epigenetics 5 103. Haussecker, D., and Proudfoot, N. J. (2005) Mol Cell Biol 25 9724 9733 104. Choi, O. R., and Engel, J. D. (1988) Cell 55 17 26 105. Engel, J. D., and Tanimoto, K. (2000) Cell 100 499 502 106. Palstra, R. J., Tolhuis, B., Splinter E., Nijmeijer, R., Grosveld, F., and de Laat, W. (2003) Nat Genet 35 190 194 107. Wijgerde, M., Grosveld, F., and Fraser, P. (1995) Nature 377 209 213 108. Sawado, T., Halow, J., Bender, M. A., and Groudine, M. (2003) Genes Dev 17 1009 1018 109. Lewis B. A., and Orkin, S. H. (1995) J Biol Chem 270 28139 28144

PAGE 110

110 110. Lewis, B. A., Kim, T. K., and Orkin, S. H. (2000) Proc Natl Acad Sci U S A 97 7172 7177 111. Hartzog, G. A., and Myers, R. M. (1993) Mol Cell Biol 13 44 56 112. Miller, I. J., and Bieker, J. J. (1993) Mol Cell Biol 13 2776 2786 113. Leach, K. M., Vieira, K. F., Kang, S. H., Aslanian, A., Teichmann, M., Roeder, R. G., and Bungert, J. (2003) Nucleic Acids Res 31 1292 1301 114. Bodine, D. M., and Ley, T. J. (1987) EMBO J 6 2997 3004 115. S toeckert, C. J., Jr., and Cheng, H. (1996) Am J Hematol 51 220 228 116. Liu, Q., Tanimoto, K., Bungert, J., and Engel, J. D. (1998) Proc Natl Acad Sci U S A 95 9944 9949 117. Donovan Peluso, M., Acuto, S., O'Neill, D., Hom, A., Maggio, A., and Bank, A. ( 1991) Blood 77 855 860 118. Wall, L., deBoer, E., and Grosveld, F. (1988) Genes Dev 2 1089 1100 119. Liu, Q., Bungert, J., and Engel, J. D. (1997) Proc Natl Acad Sci U S A 94 169 174 120. Behringer, R. R., Hammer, R. E., Brinster, R. L., Palmiter, R. D. and Townes, T. M. (1987) Proc Natl Acad Sci U S A 84 7056 7060 121. Kollias, G., Hurst, J., deBoer, E., and Grosveld, F. (1987) Nucleic Acids Res 15 5739 5747 122. Trudel, M., and Costantini, F. (1987) Genes Dev 1 954 961 123. Antoniou, M., deBoer, E. Habets, G., and Grosveld, F. (1988) EMBO J 7 377 384 124. Kollias, G., Wrighton, N., Hurst, J., and Grosveld, F. (1986) Cell 46 89 94 125. Patrinos, G. P., de Krom, M., de Boer, E., Langeveld, A., Imam, A. M., Strouboulis, J., de Laat, W., and Grosveld F. G. (2004) Genes Dev 18 1495 1509

PAGE 111

111 126. Behringer, R. R., Ryan, T. M., Palmiter, R. D., Brinster, R. L., and Townes, T. M. (1990) Genes Dev 4 380 389 127. Enver, T., Raich, N., Ebens, A. J., Papayannopoulou, T., Costantini, F., and Stamatoyannopoulos, G. (1990) Nature 344 309 313 128. Peterson, K. R., and Stamatoyannopoulos, G. (1993) Mol Cell Biol 13 4836 4843 129. Tanimoto, K., Liu, Q., Bungert, J., and Engel, J. D. (1999) Nature 398 344 348 130. Corre, S., and Galibert, M. D. (2005) Pigment Cell Res 18 337 348 131. Sirito, M., Walker, S., Lin, Q., Kozlowski, M. T., Klein, W. H., and Sawadogo, M. (1992) Gene Expr 2 231 240 132. Luo, X., and Sawadogo, M. (1996) Mol Cell Biol 16 1367 1375 133. Sirito, M., Lin, Q., Maity, T., and Sawadogo, M. (1994 ) Nucleic Acids Res 22 427 433 134. Cogswell, J. P., Godlevski, M. M., Bonham, M., Bisi, J., and Babiss, L. (1995) Mol Cell Biol 15 2782 2790 135. North, S., Espanel, X., Bantignies, F., Viollet, B., Vallet, V., Jalinot, P., Brun, G., and Gillet, G. (199 9) Oncogene 18 1945 1955 136. Pawar, S. A., Szentirmay, M. N., Hermeking, H., and Sawadogo, M. (2004) Oncogene 23 6125 6135 137. Sirito, M., Lin, Q., Deng, J. M., Behringer, R. R., and Sawadogo, M. (1998) Proc Natl Acad Sci U S A 95 3758 3763 138. Cruss elle Davis, V. J., Vieira, K. F., Zhou, Z., Anantharaman, A., and Bungert, J. (2006) Mol Cell Biol 26 6832 6843 139. Sawadogo, M., and Roeder, R. G. (1985) Cell 43 165 175 140. Gregor, P. D., Sawadogo, M., and Roeder, R. G. (1990) Genes Dev 4 1730 1740

PAGE 112

112 141. Rada Iglesias, A., Ameur, A., Kapranov, P., Enroth, S., Komorowski, J., Gingeras, T. R., and Wadelius, C. (2008) Genome Res 18 380 392 142. Bresnick, E. H., and Felsenfeld, G. (1993) J Biol Chem 268 18824 18834 143. Elnitski, L., Miller, W., and Har dison, R. (1997) J Biol Chem 272 369 378 144. Leach, K. M., Nightingale, K., Igarashi, K., Levings, P. P., Engel, J. D., Becker, P. B., and Bungert, J. (2001) Mol Cell Biol 21 2629 2640 145. West, A. G., Huang, S., Gaszner, M., Litt, M. D., and Felsenfeld, G. (2004) Mol Cell 16 453 463 146. Crusselle Davis, V. J., Zhou, Z., Anantharaman, A., Moghimi, B., Dodev, T., Huang, S., and Bungert, J. (2007) FEBS J 274 6065 6073 147. Roy, A. L., Meisterernst, M., Pognonec, P., and Roeder, R. G. (1991) Nature 354 245 248 148. Roy, A. L., Du, H., Gregor, P. D., Novina, C. D., Martinez, E., and Roeder, R. G. (1997) EMBO J 16 7091 7104 149. Huang, S., Li, X., Yusufzai, T. M., Qiu, Y., and Felsenfeld G. (2007) Mol Cell Biol 27 7991 8002 150. Gallagher, P. G., Nilson, D. G., Steiner, L. A., Maksimova, Y. D., Lin, J. Y., and Bodine, D. M. (2009) Blood 113 1547 1554 151. Kim, S. I., and Bresnick, E. H. (2007) Oncogene 26 6777 6794 152. Johnson, K. D. Grass, J. A., Boyer, M. E., Kiekhaefer, C. M., Blobel, G. A., Weiss, M. J., and Bresnick, E. H. (2002) Proc Natl Acad Sci U S A 99 11760 11765 153. Munugalavadla, V., Dore, L. C., Tan, B. L., Hong, L., Vishnu, M., Weiss, M. J., and Kapur, R. (2005) Mol Cell Biol 25 6747 6759 154. Vakoc, C. R., Letting, D. L., Gheldof, N., Sawado, T., Bender, M. A., Groudine, M., Weiss, M. J., Dekker, J., and Blobel, G. A. (2005) Mol Cell 17 453 462

PAGE 113

113 155. Rodriguez, P., Bonte, E., Krijgsveld, J., Kolodziej, K. E., Guyot, B., Heck, A. J., Vyas, P., de Boer, E., Grosveld, F., and Strouboulis, J. (2005) EMBO J 24 2354 2366 156. Kooren, J., Palstra, R. J., Klous, P., Splinter, E., von Lindern, M., Grosveld, F., and de Laat, W. (2007) J Biol Chem 282 16544 16552 157. Demers, C., Chaturvedi, C. P., Ranish, J. A., Juban, G., Lai, P., Morle, F., Aebersold, R., Dilworth, F. J., Groudine, M., and Brand, M. (2007) Mol Cell 27 573 584 158. Ogawa, K., Sun, J., Taketani, S., Nakajima, O., Nishitani, C., Sassa, S., Hayashi, N., Yamamo to, M., Shibahara, S., Fujita, H., and Igarashi, K. (2001) EMBO J 20 2835 2843 159. Zhao, X. F., and Aplan, P. D. (1999) J Biol Chem 274 1388 1393 160. Song, S. H., Hou, C., and Dean, A. (2007) Mol Cell 28 810 822 161. Drissen, R., Palstra, R. J., Gille mans, N., Splinter, E., Grosveld, F., Philipsen, S., and de Laat, W. (2004) Genes Dev 18 2485 2490 162. Nuez, B., Michalovich, D., Bygrave, A., Ploemacher, R., and Grosveld, F. (1995) Nature 375 316 318 163. Zhou, D., Pawlik, K. M., Ren, J., Sun, C. W., and Townes, T. M. (2006) J Biol Chem 281 16052 16057 164. Perkins, A. C., Sharpe, A. H., and Orkin, S. H. (1995) Nature 375 318 322 165. Armstrong, J. A., Bieker, J. J., and Emerson, B. M. (1998) Cell 95 93 104 166. Kadam, S., McAlpine, G. S., Phelan, M L., Kingston, R. E., Jones, K. A., and Emerson, B. M. (2000) Genes Dev 14 2441 2451 167. Muchardt, C., and Yaniv, M. (1999) Semin Cell Dev Biol 10 189 195 168. Reyes, J. C., Barra, J., Muchardt, C., Camus, A., Babinet, C., and Yaniv, M. (1998) EMBO J 1 7 6979 6991

PAGE 114

114 169. Bultman, S., Gebuhr, T., Yee, D., La Mantia, C., Nicholson, J., Gilliam, A., Randazzo, F., Metzger, D., Chambon, P., Crabtree, G., and Magnuson, T. (2000) Mol Cell 6 1287 1295 170. Bultman, S. J., Gebuhr, T. C., and Magnuson, T. (2005) G enes Dev 19 2849 2861 171. Kadam, S., and Emerson, B. M. (2003) Mol Cell 11 377 389 172. Arany, Z., Newsome, D., Oldread, E., Livingston, D. M., and Eckner, R. (1995) Nature 374 81 84 173. Nordheim, A. (1994) Nature 370 177 178 174. Yao, T. P., Oh, S. P., Fuchs, M., Zhou, N. D., Ch'ng, L. E., Newsome, D., Bronson, R. T., Li, E., Livingston, D. M., and Eckner, R. (1998) Cell 93 361 372 175. Tanaka, Y., Naruse, I., Hongo, T., Xu, M., Nakahata, T., Maekawa, T., and Ishii, S. (2000) Mech Dev 95 133 145 17 6. Bannister, A. J., and Kouzarides, T. (1996) Nature 384 641 643 177. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996) Cell 87 953 959 178. Heintzman, N. D., Stuart, R. K., Hon, G., Fu, Y., Ching, C. W., Hawkins, R. D., Barrera, L. O., Van Calcar, S., Qu, C., Ching, K. A., Wang, W., Weng, Z., Green, R. D., Crawford, G. E., and Ren, B. (2007) Nat Genet 39 311 318 179. Xi, H., Shulha, H. P., Lin, J. M., Vales, T. R., Fu, Y., Bodine, D. M., McKay, R. D., Chenoweth, J. G ., Tesar, P. J., Furey, T. S., Ren, B., Weng, Z., and Crawford, G. E. (2007) PLoS Genet 3 e136 180. Visel, A., Blow, M. J., Li, Z., Zhang, T., Akiyama, J. A., Holt, A., Plajzer Frick, I., Shoukry, M., Wright, C., Chen, F., Afzal, V., Ren, B., Rubin, E. M. and Pennacchio, L. A. (2009) Nature 457 854 858 181. Blobel, G. A., Nakajima, T., Eckner, R., Montminy, M., and Orkin, S. H. (1998) Proc Natl Acad Sci U S A 95 2061 2066 182. Boyes, J., Byfield, P., Nakatani, Y., and Ogryzko, V. (1998) Nature 396 594 598

PAGE 115

115 183. Zhang, W., and Bieker, J. J. (1998) Proc Natl Acad Sci U S A 95 9855 9860 184. Liang, S., Moghimi, B., Yang, T. P., Strouboulis, J., and Bungert, J. (2008) J Cell Biochem 105 9 16 185. Emery, D. W., Yannaki, E., Tubb, J., and Stamatoyannopoulos, G. (2000) Proc Natl Acad Sci U S A 97 9150 9155 186. Bungert, J., Dave, U., Lim, K. C., Lieuw, K. H., Shavit, J. A., Liu, Q., and Engel, J. D. (1995) Genes Dev 9 3083 3096 187. Chomczynski, P., and Sacchi, N. (1987) Anal Biochem 162 156 159 188. Basu, P., Morris, P. E., Haar, J. L., Wani, M. A., Lingrel, J. B., Gaensler, K. M., and Lloyd, J. A. (2005) Blood 106 2566 2571 189. Tanabe, O., Shen, Y., Liu, Q., Campbell, A. D., Kuroha, T., Yamamoto, M., and Engel, J. D. (2007) Genes Dev 21 2832 2844 190. N ilson, D. G., Sabatino, D. E., Bodine, D. M., and Gallagher, P. G. (2006) Exp Hematol 34 705 712 191. Dahl, J. A., and Collas, P. (2009) Methods Mol Biol 567 59 74 192. Dahl, J. A., and Collas, P. (2007) Stem Cells 25 1037 1046 193. Miele, A., Gheldof, N., Tabuchi, T. M., Dostie, J., and Dekker, J. (2006) Curr Protoc Mol Biol Chapter 21 Unit 21 11 194. Dekker, J., Rippe, K., Dekker, M., and Kleckner, N. (2002) Science 295 1306 1311 195. Chan, P. K., Wai, A., Philipsen, S., and Tan Un, K. C. (2008) PLoS One 3 e2134 196. Fullwood, M. J., and Ruan, Y. (2009) J Cell Biochem 107 30 39 197. Kunieda, T., Xian, M., Kobayashi, E., Imamichi, T., Moriwaki, K., and Toyoda, Y. (1992) Biol Reprod 46 692 697 198. Loken, M. R., Shah, V. O., Dattilio, K. L., and Civi n, C. I. (1987) Blood 69 255 263

PAGE 116

116 199. Qyang, Y., Luo, X., Lu, T., Ismail, P. M., Krylov, D., Vinson, C., and Sawadogo, M. (1999) Mol Cell Biol 19 1508 1517 200. Rishi, V., and Vinson, C. (2003) Methods Enzymol 370 454 466 201. Szentirmay, M. N., Yang, H X., Pawar, S. A., Vinson, C., and Sawadogo, M. (2003) J Biol Chem 278 37231 37240 202. Giannola, D. M., Shlomchik, W. D., Jegathesan, M., Liebowitz, D., Abrams, C. S., Kadesch, T., Dancis, A., and Emerson, S. G. (2000) J Exp Med 192 1479 1490 203. Tann er, M. J. (1993) Semin Hematol 30 34 57 204. Anderson, K. P., Crable, S. C., and Lingrel, J. B. (2000) Blood 95 1652 1655 205. Anderson, K. P., Crable, S. C., and Lingrel, J. B. (1998) J Biol Chem 273 14347 14354 206. Kina, T., Ikuta, K., Takayama, E., Wada, K., Majumdar, A. S., Weissman, I. L., and Katsura, Y. (2000) Br J Haematol 109 280 287 207. Iborra, F. J., Pombo, A., McManus, J., Jackson, D. A., and Cook, P. R. (1996) Exp Cell Res 229 167 173 208. Chakalova, L., Debrand, E., Mitchell, J. A., Osb orne, C. S., and Fraser, P. (2005) Nat Rev Genet 6 669 677 209. Sutherland, H., and Bickmore, W. A. (2009) Nat Rev Genet 10 457 466 210. Liang, S. Y., Moghimi, B., Crusselle Davis, V. J., Lin, I. J., Rosenberg, M. H., Li, X., Strouboulis, J., Huang, S., and Bungert, J. (2009) Mol Cell Biol 29 5900 5910 211. Zhou, Z., Li, X., Deng, C., Ney, P. A., Huang, S., and Bungert, J. (2010) J Biol Chem 285 15894 15905 212. Kim, S. I., Bultman, S. J., Kiefer, C. M., Dean, A., and Bresnick, E. H. (2009) Proc Natl Ac ad Sci U S A 106 2259 2264 213. Gilbert, D. M. (2002) Curr Opin Cell Biol 14 377 383

PAGE 117

117 214. Simon, I., and Cedar, H. (1996) DNA Replication in Eukaryotic Cells. in DNA Replication in Eukaryotic Cells (DePamphilis, M. L. ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. pp 387 408 215. Cimbora, D. M., Schubeler, D., Reik, A., Hamilton, J., Francastel, C., Epner, E. M., and Groudine, M. (2000) Mol Cell Biol 20 5581 5591 216. Parsons, G. G., and Spencer, C. A. (1997) Mol Cell Biol 17 5791 58 02 217. Christova, R., and Oelgeschlger, T. (2002) Nat Cell Biol 4 79 82 218. De Brabander, M. J., Van de Veire, R. M., Aerts, F. E., Borgers, M., and Janssen, P. A. (1976) Cancer Res 36 905 916 219. Lee, J. C., Field, D. J., and Lee, L. L. (1980) Bioch emistry 19 6209 6215 220. Palstra, R. J. (2009) Brief Funct Genomic Proteomic 8 297 309 221. Lewin, B. (1975) Cell 4 11 20 222. Bastos, R. N., and Aviv, H. (1977) Cell 11 641 650 223. Crawford, R. J., and Wells, J. R. (1978) Biochemistry 17 1591 1596 224. Ross, J., and Sullivan, T. D. (1985) Blood 66 1149 1154 225. Gaensler, K. M., Burmeister, M., Brownstein, B. H., Taillon Miller, P., and Myers, R. M. (1991) Genomics 10 976 984 226. Gaensler, K. M., Kitamura, M., and Kan, Y. W. (1993) Proc Natl Acad Sci U S A 90 11381 11385 227. Strouboulis, J., Dillon, N., and Grosveld, F. (1992) Genes Dev 6 1857 1864 228. Gillemans, N., Tewari, R., Lindeboom, F., Rottier, R., de Wit, T., Wijgerde, M., Grosveld, F., and Philipsen, S. (1998) Genes Dev 12 2863 2873 229. Lee, C. H., Murphy, M. R., Lee, J. S., and Chung, J. H. (1999) Proc Natl Acad Sci U S A 96 12311 12315 230. Sengupta, T., Cohet, N., Morle, F., and Bieker, J. J. (2009) Proc Natl Acad Sci U S A 106 4213 4218

PAGE 118

118 231. Johnson, K. D., Christensen, H. M., Zhao, B., and Bresnick, E. H. (2001) Mol Cell 8 465 471 232. Levings, P. P., Zhou, Z., Vieira, K. F., Crusselle Davis, V. J., and Bungert, J. (2006) FEBS J 273 746 755

PAGE 119

119 BIOGRAPHICAL SKETCH Shermi Yen Liang was born in Raleigh, N orth C arolina to Dr. A lan Yuh L in and Yen Liang, and spent the majority of her childhood in Albuquerque, N ew M exico There, she attended La Cueva High School and participated in school activities such as National Honors Society, Orchestra, and Creative Writing Club. In 2000, sh e graduated as one of the top 50 students in her class and went on to perform undergraduate studies at the University of Washington (UW) with the intention of majoring in b iology. While there, she joined the first year of students to take part in a new exc hange student program that formed as a collaborative effort between the UW and Sichuan University (SU) Within her first quarter at the UW, her participation in this program thrust her immediately into the realm of scientific research. As a result, she com pleted several undergraduate research projects in both botany and genome sciences, and spent her junior year improving her Chinese by studying abroad in Chengdu, China. There, she and along with other members in the UW SU exchange performed a botanical fie ld study of the local plant biodiversity in a minority region of Sichuan province under the guidance of Dr. Richard Olmstead (UW) and Dr. Jiemei Xu (SU). After returning to the United States, Shermi joined the lab of Dr. Benjamin D. Hall (UW) and worked wi th students from the SU side of the exchange, performing genetic research on the phylogeny of various Rhododendron species After graduating from UW in 2004 with a degree in c ell & m olecular b iology, Shermi went on to perform doctoral studies at the Univer sity of Florida (UF) under the guidance of Dr. Jrg Bunger t (UF), joining his lab in May 2006. She hopes to one day work in the field of forensic science.