<%BANNER%>

Factors Affecting Trophoblast Differentiation, Development, and Function in Cattle

Permanent Link: http://ufdc.ufl.edu/UFE0042004/00001

Material Information

Title: Factors Affecting Trophoblast Differentiation, Development, and Function in Cattle
Physical Description: 1 online resource (165 p.)
Language: english
Creator: Pennington, Kathleen
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: binucleate, development, differentiation, placenta, trophoblast
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In dairy cows, approximately 60% of all pregnancies fail to reach term and generate healthy offspring. A substantial portion of these losses occur during the first three months of gestation. Critical reproductive events must occur during this time period, and insufficiencies in any of these likely contribute to pregnancy failure. Inadequate or retarded placental formation and development are mechanistic causes for some, if not a substantial portion of pregnancy losses in cattle. The initial events of placental attachment and adhesion with the endometrial epithelium begin by day 20 of gestation in cattle, and the placenta is fully formed between days 40 to 50. One of the first developmental events in the bovine placenta is the formation of binucleated trophoblast cells, referred to as binucleate cells (BNCs). BNCs are the trophoblast cells that attach to the uterine epithelium to form a feto-materal syncytium and produce several hormones important for pregnancy, fetal development and mammary gland development in the mother. Mechanisms controlling BNC formation are not well described. This dissertation research was completed to test the hypothesis that mechanisms controlling trophoblast differentiation, development and function in cattle are similar to mechanisms utilized to generate invasive trophoblast lineages identified in humans and mice. Three primary objectives completed in this dissertation research include: 1) development of a method for obtaining enriched populations of BNCs from mid-gestation bovine placentae 2) identification of factors controlling BNC formation in cattle 3) evaluation of how bone morphogenetic proteins (BMPs) effect trophoblast development and function. For the first objective, BNCs were isolated from mid-gestation bovine placentae based on their DNA content using fluorescence activated cell sorting (FACS). Sorting for hyperploidic cells yielded enriched BNC and CSH1 (chorionic somatomammotropin-1)-positive samples versus pre-sorted controls. Transcripts for BNC-specific markers were greater in abundance in BNC-enriched fractions than in MNC samples. FACS-sorted BNCs remained viable after 3.5 days in culture, and greater numbers of BNCs were evident when incubated on Matrigel-coated than non-coated plates. However, regardless of culture matrix, BNCs contained lower amounts of BNC-specific transcripts and were nearly devoid of CDX2 mRNA after 3.5 d in culture. The second objective was to examine the expression profile of selected factors associated with formation and activation of BNC-like placental cells identified in primates and rodents and to determine if overexpression of one of these factors (HAND1; heart and neural crest derivatives expressed-1) induced BNC formation in culture. Nearly all of the transcripts of interest (HAND1, MASH2, ID1, ID2, IMFA, Stra13, GCM1 and E12/E47) were present in bovine cotyledons obtained from mid-gestation placentae. One of these, HAND1, was characterized by mRNA and protein concentrations being greater in BNC versus MNC. However, HAND1 overexpression did not induce BNC differentiation in a mononucleated trophoblast cell line. The third objective was to elucidate the function of BMP2 and 4 in bovine trophoblast cells. BMPs play an important role in several reproductive processes and are implicated in controlling placental development in humans and mice. Transcripts for both BMPs were present in day 17 bovine conceptuses, the CT1 bovine trophoblast cell line and endometrium. The BMP antagonist, Noggin, also was detected in day 17 conceptuses but not in CT1 cells or endometrium. All receptors necessary for BMP2 and 4 signaling were found in all tissues examined. Supplementing CT1 with recombinant human BMP2 and 4 did not affect IFNT and CSH1 expression and did not induce BNC formation. Therefore, potential functions for these morphogenic factors in bovine trophoblast cells remain unclear. In conclusion, FACS is an effective method for isolating enriched populations of BNCs; however culturing BNCs leads to rapid loss of key BNC and trophectoderm specific markers in culture. HAND1 was found in greater abundance in BNCs versus MNCs. However, overexpression of HAND1 did not induce BNC formation in an ovine trophoblast cell line suggesting that HAND1 is not the only causative factor required for BNC formation in ruminants. The signaling pathway controlling BNC differentiation is still unknown. BMP2 and BMP4 mRNA are abundant in day 17 conceptuses; however their actions for regulating trophoblast function is unknown.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kathleen Pennington.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Ealy, Alan.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042004:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042004/00001

Material Information

Title: Factors Affecting Trophoblast Differentiation, Development, and Function in Cattle
Physical Description: 1 online resource (165 p.)
Language: english
Creator: Pennington, Kathleen
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: binucleate, development, differentiation, placenta, trophoblast
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In dairy cows, approximately 60% of all pregnancies fail to reach term and generate healthy offspring. A substantial portion of these losses occur during the first three months of gestation. Critical reproductive events must occur during this time period, and insufficiencies in any of these likely contribute to pregnancy failure. Inadequate or retarded placental formation and development are mechanistic causes for some, if not a substantial portion of pregnancy losses in cattle. The initial events of placental attachment and adhesion with the endometrial epithelium begin by day 20 of gestation in cattle, and the placenta is fully formed between days 40 to 50. One of the first developmental events in the bovine placenta is the formation of binucleated trophoblast cells, referred to as binucleate cells (BNCs). BNCs are the trophoblast cells that attach to the uterine epithelium to form a feto-materal syncytium and produce several hormones important for pregnancy, fetal development and mammary gland development in the mother. Mechanisms controlling BNC formation are not well described. This dissertation research was completed to test the hypothesis that mechanisms controlling trophoblast differentiation, development and function in cattle are similar to mechanisms utilized to generate invasive trophoblast lineages identified in humans and mice. Three primary objectives completed in this dissertation research include: 1) development of a method for obtaining enriched populations of BNCs from mid-gestation bovine placentae 2) identification of factors controlling BNC formation in cattle 3) evaluation of how bone morphogenetic proteins (BMPs) effect trophoblast development and function. For the first objective, BNCs were isolated from mid-gestation bovine placentae based on their DNA content using fluorescence activated cell sorting (FACS). Sorting for hyperploidic cells yielded enriched BNC and CSH1 (chorionic somatomammotropin-1)-positive samples versus pre-sorted controls. Transcripts for BNC-specific markers were greater in abundance in BNC-enriched fractions than in MNC samples. FACS-sorted BNCs remained viable after 3.5 days in culture, and greater numbers of BNCs were evident when incubated on Matrigel-coated than non-coated plates. However, regardless of culture matrix, BNCs contained lower amounts of BNC-specific transcripts and were nearly devoid of CDX2 mRNA after 3.5 d in culture. The second objective was to examine the expression profile of selected factors associated with formation and activation of BNC-like placental cells identified in primates and rodents and to determine if overexpression of one of these factors (HAND1; heart and neural crest derivatives expressed-1) induced BNC formation in culture. Nearly all of the transcripts of interest (HAND1, MASH2, ID1, ID2, IMFA, Stra13, GCM1 and E12/E47) were present in bovine cotyledons obtained from mid-gestation placentae. One of these, HAND1, was characterized by mRNA and protein concentrations being greater in BNC versus MNC. However, HAND1 overexpression did not induce BNC differentiation in a mononucleated trophoblast cell line. The third objective was to elucidate the function of BMP2 and 4 in bovine trophoblast cells. BMPs play an important role in several reproductive processes and are implicated in controlling placental development in humans and mice. Transcripts for both BMPs were present in day 17 bovine conceptuses, the CT1 bovine trophoblast cell line and endometrium. The BMP antagonist, Noggin, also was detected in day 17 conceptuses but not in CT1 cells or endometrium. All receptors necessary for BMP2 and 4 signaling were found in all tissues examined. Supplementing CT1 with recombinant human BMP2 and 4 did not affect IFNT and CSH1 expression and did not induce BNC formation. Therefore, potential functions for these morphogenic factors in bovine trophoblast cells remain unclear. In conclusion, FACS is an effective method for isolating enriched populations of BNCs; however culturing BNCs leads to rapid loss of key BNC and trophectoderm specific markers in culture. HAND1 was found in greater abundance in BNCs versus MNCs. However, overexpression of HAND1 did not induce BNC formation in an ovine trophoblast cell line suggesting that HAND1 is not the only causative factor required for BNC formation in ruminants. The signaling pathway controlling BNC differentiation is still unknown. BMP2 and BMP4 mRNA are abundant in day 17 conceptuses; however their actions for regulating trophoblast function is unknown.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kathleen Pennington.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Ealy, Alan.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042004:00001


This item has the following downloads:


Full Text

PAGE 1

1 FACTORS A FFECTING TROPHOBLAST DIFFERENTIATION, DEVELOPMENT AND FUNCTION IN CATTLE By KATHLEEN A. PENNINGTON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIR EMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Kathleen A. Pennington

PAGE 3

3 To Mom, Dad, Chris, and Annie

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my parents, Maynard and Mary Frances. You have always encour aged me to pursue my dreams and without your unwavering faith, love and support I would not be the person I am today. Thank you for providing a safe and happy home for Chris and I; it is the foundation of our lives without which we would not be where we are today. Thank you for instilling in me the desire to reach for the stars and providing every opportunity for me to succeed. To my Aunt, Ann Elizabeth, you have been a second mother to Chris and me; there are not enough words to express how grateful I am to you. Thank you for all your prayers, love and support throughout my life, espec ially during these last months. H aving you in my corner has only pushed me to be a better person. I am forever indebted to you for your monthly fun money, your apartmen t hunter skills, and your willingness to help however you can. To my brother Christopher, all my life I have looked up to you. Thank you for providing a wonderful example to me and for always being there to encourage me. It has been wonderful watching y ou grown into the wonderful man you are today. I would also like to thank you for brin g ing Janelle into all our lives. To Janelle, I couldnt be happier to call you sister; you are a wonderful women and friend. I know you will both have many years of happy memories together, I am grateful to both of you for making me part of them. To my advisor, Dr. Alan Ealy, thank you for helping me to become the scientist I am today. I am indebted to you for your guidance and support that has been an essential part of my learning. You have always had an open door policy which I am grateful for. Thank you for your understanding and patience throughout my graduate

PAGE 5

5 career, it has been a long process and steep learning curve and without you I am not sure where I would be To my committee members, Dr. Peter Hansen, Dr Sally Johnson, and Dr. Charles Wood, thank you for your guidance, support and advice throughout my graduate career. Your recommendations and words of wisdom have pushed me to be a better student, scientist and person. Thank you t o all the staff that has helped me find my way, especially Idania, who encouraged and pushed me to become the best scientist I could. Joyce, you have been my go to person when I needed something. Joann, thank you for keeping me on track and making sure everything was always turned in on time. William, thank you for always making sure I had the samples I needed. Finally, I am grateful to Neal and Steve at the flow cytometery laboratory, for your invaluable assistance and support. To all of my lab mates past and present you all have made my experiences at Florida educational and memorable. From the hood and lab bench to Thanksgiving dinners and football games, we have shared wonderful moments together. Thank you all for your help, support, encouragement and friendship throughout the years. To Teresa, it is hard to believe we started at Florida five years ago. I appreciate the friendship you have given and continue to give me throughout these past years. To Flavia, I have treasu red our time together as lab mates and friends, thank you for your encouragement, faith and support these past years even from across the country. To Susan and Paula, you both have taught me so much about myself and life, I will miss you both. To Yang, y our knowledge, assistance and friendship is something I will

PAGE 6

6 treasure for the rest of my life. To Kun and Manabu, thank you for all the inv aluable discussions and debates; they have made me a better researcher. To all the friends I have made throughout my five years in Florida; Erin, Regina, Jake, Isabella, John, Amber, and Lillian, you have all helped me in so many different ways. To Adriane, I miss you every day. To Ashley thank you for all the editing and advice throughout the years. Katherine, you were an awesome office mate, thank you for putting up with my messes and melt downs. Jessica, you have been the person to pull me out and make me have fu n when I needed it, thank you. To all the Brazilians, thank you all for including me and making me feel welcome; you all have taught me so much. To Margo and Katie, thank you for pushing me to reach my goals and helping m e keep my stress level in check; the workouts have been worth it. To Meredith, Marsha, Jen, and Brooke, I cannot believe it has been nin e years since we were just starting our undergrad studies at Delaware. You have all been so special to me and I value your friendship so much. Meredith and Marsha, you were the best roommates I could ask for. Y ou put up with my messes and supported me through so many tough times, I hope you know how much you both mean to me. To Jen and Brooke, w e went through so much together; thank you for including me in all your wonderful moments. To my lifelong friends, Elise and Dawn, I know I can always pick up the phone and you will be there. I can remember when we met and all the moments we shared like they happened yesterday. Thank you for always being there especially these past five years when I just needed was to talk it out with someone, you both were there willing to listen, give advice and then tell me to get over it when I needed it.

PAGE 7

7 To my second family, the McCarthys you all have welcomed me with open arms and made me one of you. I cannot express how much I treasure all of you. To April and Paul, t hank you for everything, your support and wisdom has been more then I could have ever asked. To Mr. and Mrs. McCarthy, you have made me feel like one of your own, thank you. To Brenda, you have been my older and much wiser confidant, thank you for all th e advice and guidance throughout the years. Y ou have never failed in keeping me on track when I didnt think I could go any further and gave me a kick in the butt when I needed it. Finally, to everyone mentioned here and anyone I forgot, saying thank you doesnt seem enough. Without all of you I dont know where I would be in my career and life. It takes a village to shape a person and that is what you all have been to me. I am forever grateful to you all.

PAGE 8

8 TABLE OF CONTENTS page ACKNOWLEDGMENTS .............................................................................................................. 4 LIST OF TABLES ....................................................................................................................... 11 LIST OF FIGURES ..................................................................................................................... 12 ABSTRACT ................................................................................................................................. 14 CHAPTER 1 INTRODUCTION................................................................................................................. 17 2 LITERATURE REVIEW ...................................................................................................... 21 The Placenta ........................................................................................................................ 21 Placental Formation..................................................................................................... 22 Placental Classification ............................................................................................... 24 Evolution of the Placenta ............................................................................................ 26 The Ruminant Placenta ...................................................................................................... 29 Conceptus Elongation and Gastrulation .................................................................. 29 Placental Attachment .................................................................................................. 30 Placental Defects ......................................................................................................... 32 Placental Cell Types ........................................................................................................... 34 Mononucleate Cells ..................................................................................................... 34 Trophoblast Cell Lines ................................................................................................ 35 Binucleate Cells ........................................................................................................... 36 BNC Isolation and Culture .......................................................................................... 41 Trophoblast Cell Differentiation ........................................................................................ 42 Trophectoderm Differ entiation ................................................................................... 42 Trophoblast Lineage Segregation in Mice ............................................................... 44 Trophoblast Lineage Segregation in Primates ........................................................ 44 Transcriptional Regulation of Trophoblast Differentiation ..................................... 45 Endogenous Retroviruses .......................................................................................... 49 B one Morphogenetic Proteins ................................................................................... 52 Summary of Previous Literature ....................................................................................... 54 3 THE ENRICHMENT AND CULTURE OF BINUCLEATED TROPHOBLAST FROM M ID GESTATION BOVINE PLACENTA USING FLUORESCENCEACTIVATED CELL SORTING .......................................................................................... 57 Introduction .......................................................................................................................... 57 Materials and Methods ....................................................................................................... 58 Tissue Collection.......................................................................................................... 58 FACS ............................................................................................................................. 59

PAGE 9

9 Immunostaining ............................................................................................................ 60 BNC Cell Culture .......................................................................................................... 61 Quantitative (q) RT PCR ............................................................................................. 61 Statistical Analysis ....................................................................................................... 63 Results .................................................................................................................................. 63 BNC Enrichment Using FACS ................................................................................... 63 BNC Culture .................................................................................................................. 65 Discussion ............................................................................................................................ 66 4 EXPRESSION OF SEVER AL PUTATIVE TROPHOBLAST DIFFEREN TIATION FACTORS IN BOVINE MONONUCLEATE AND BINUCLEATE CELLS .................. 76 Introduction .......................................................................................................................... 76 Methods ................................................................................................................................ 77 Tissue Collection.......................................................................................................... 7 7 End Point RT PCR ....................................................................................................... 78 Quantitative (q), Real Time RT PCR ........................................................................ 79 Cell Culture ................................................................................................................... 79 Hand1 Over Expression ............................................................................................. 80 Western Blotting ........................................................................................................... 80 Immunocytochemistry ................................................................................................. 81 Statistical Analysis ....................................................................................................... 82 Results .................................................................................................................................. 82 Expression Pattern of Potential BNC Differentiation Regulator s ......................... 82 The Role of HAND1 in BNC Differentiation ............................................................. 83 Discussion ............................................................................................................................ 84 5 EXPRESSION AND FUNCT ION OF BMP2 AND BMP4 IN THE PERI ATTACHMENT BOVINE CONCEPTUS.......................................................................... 93 Introduction .......................................................................................................................... 93 Materials and Methods ....................................................................................................... 95 Animal Use and Tissue Collection ............................................................................ 95 Bovine Trophectoderm Cell (CT1) Culture .............................................................. 95 SuperArray .................................................................................................................... 96 End Point RT PCR ....................................................................................................... 96 Quantitative (q) RT PCR ............................................................................................. 97 Proliferation Assay ....................................................................................................... 97 Alkaline Phosphatase Staining .................................................................................. 98 Smad 1, 5, 8 Western Blotting ................................................................................... 98 Statistical Analysis ....................................................................................................... 99 Results .................................................................................................................................. 99 Expression of BMP Ligands and Receptors in Bovine Conceptu s and Endometrium ............................................................................................................. 99 Biological Activities of BMP2 and BMP4 in Bovine Trophectoderm .................. 101 Discussion .......................................................................................................................... 102

PAGE 10

10 6 OVERALL DISCUSSION ................................................................................................. 112 APPENDIX A METHODS FOR FLUORESCENCE ACTIVATED CELL SORTING (FACS) OF MID GESTATION bOVINE PLACENTA ........................................................................ 117 Materials ............................................................................................................................. 117 Tissue Collection ............................................................................................................... 117 FACS Sample Preparation .............................................................................................. 118 FACS ................................................................................................................................... 119 Sorting Efficiency Analysis .............................................................................................. 120 Media Formulas ................................................................................................................. 120 Collection Medium ..................................................................................................... 120 Sort Medium ............................................................................................................... 120 B STIMULATION OF IF NT BY FIBROBLAST GROWTH FACT ORS IN THE BOVINE TROPHECTODERM CELL LINE, CT1 ......................................................... 121 Introduction ........................................................................................................................ 121 Materials and Methods ..................................................................................................... 122 Bovine Trophectoderm Cell (CT1) Culture ............................................................ 122 IFNT mRNA Abundance ........................................................................................... 122 IFNT Antiviral Protein Assay .................................................................................... 124 Statistical Analysis ..................................................................................................... 124 Results ................................................................................................................................ 125 FGF 1, 2, 7, and 10 Incr ease IFNT mRNA Abundance in CT1 Cells ................ 125 FGF 1, 2, 9, and 10 Increase IFNT Protein Abundance in CT1 Cells ............... 125 Discussion .......................................................................................................................... 125 LIST OF REFERENCES ......................................................................................................... 130 BIOGRAPHICAL SKETCH ..................................................................................................... 165

PAGE 11

11 LIST OF TABLES Table page 3 1 Trophectoderm marker primers used for qRT PCR. ................................................ 71 4 1 Primers used for end point and quantitative RT PCR .............................................. 88 5 1 Primers used for end point RT PCR ......................................................................... 105 5 2 Primer and Probe sets used for real time qRT PCR .............................................. 105

PAGE 12

12 LIST OF FIGURES Figure page 3 1 Representative FACS plots of a bovine placenta homogenate .............................. 72 3 2 Enrichment of BNCs after FACS. ................................................................................ 73 3 3 Percentage MNC and BNC populations after FACS and gene expression profiles for each. ............................................................................................................. 74 3 4 Outcomes of culturing BNC enri ched populat ions for 3.5 days. ............................. 75 3 5 Gene expression profiles f or BNCs after 3.5 day culture. ....................................... 75 4 1 Expression pattern of selected trophob last cell differentia tion in the ruminant placenta. .......................................................................................................................... 89 4 2 Gene expression profile of selected potential B NC differentiation regulators. ..... 90 4 3 Western blot analysis of GCM1 and HAND1 protein expression i n MNC (M) and BNC (B) samples. ................................................................................................... 90 4 4 Overexp ression of HAND1 in oTr cells ....................................................................... 91 4 5 HAND1 activity as me asured by luciferase activity. ................................................. 92 5 1 SuperA rray Gene Expression Analysis. ................................................................... 106 5 2 End point PCR of BMP ligands in Day 17 bovine conceptus, bovine trophec toderm and bovine endometrium .................................................................. 107 5 3 End point PCR of BMP receptors in Day 17 bovine conceptus, bovine trophec toderm and bovine endometrium .................................................................. 107 5 4 Effect of BMP2 or BMP4 supplementation on CT1 cell IFNT mRNA expression. ....................................................................................................................108 5 5 Effect of 48 h of BMP2 or BMP4 suppleme ntation on numbers of CT1 cells .... 109 5 6 Effect of BMP2 and BMP4 treatment on alkaline phosphatase activity. ............. 110 5 7 Phosphorylation of Smad 1/5/8 following BMP2 or BMP4 supplementation. ..... 111 6 1 Summary of findings on factors effecting trophoblast cell development, differentiation and function. ......................................................................................... 116

PAGE 13

13 B 1 Several FGFs increase IFNT mRNA abundance in a dose dependent manner ......................................................................................................................... 128 B 2 Several FGFs increase IFNT protein sec retion in CT1 cells. ................................ 129

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy FACTORS A FFECTING BOVINE TROPHOBLAST DEVELOPMENT, DIFFERENTIATION AND FUNCTION By Kathleen A. Pennington December 2010 Chair: Alan D. Ealy Major: Animal Molecular and Cellular Biology In dairy cows, approximately 60% of all pregnancies fail to reach term and generate healthy offspring. A substantial portion of these losses occur during the first three months of gestation. Critical reproductive events must occur during this time period, and insufficiencies in any of these likely contribute to pregnan cy failure. Inadequate or retarded placental formation and development are mechanistic cause s for some, if not a substantial portion of pregnancy losses in cattle. The initial events of placental attachment and adhesion with the endometrial epithelium begin by day 20 of gestation in cattle and the placenta is fully formed between days 40 to 50. One of the first developmental events in the bovine placenta is the formation of binucleated trophoblast cells, referred to as binucleate cells (BNCs). BNCs ar e the trophoblast cell s that attach to the uterine epithelium to form a fe to materal syncytium and produce several hormones important for pregnancy, fetal development and mammary gland development in the mother. Mechanisms control ling BNC formation are not well described. This dissertation research was completed to test the hypothesis that mechanisms controlling trophoblast differentiation, devel opment and

PAGE 15

15 function in cattle are similar to mechanisms utilized to generate invasive trophoblast lineages ident ified in humans and mice. Three primary objectives completed in this dissertation research include: 1 ) development of a method for obtaining enriched populations of BNCs from mid gestation bovine placentae 2 ) identification of factors controlling BNC formatio n in cattle 3 ) evaluation of how bone morphogenetic proteins (BMPs) effect trophoblast development and function. For the first objective, BNCs were isolated from midgestation bovine placentae based on their DNA content using fluorescence activated cell sorti ng (FACS). Sorting for hyperploidic cells yielded enriched BNC and CSH1 ( chorionic somatomammotropin 1) positive samples versus pre sorted controls Transcripts for BNC specific markers were greater in abundance in BNC enriched fractions than in MNC sampl es. FACS sorted BNCs remained viable after 3.5 days in culture, and greater numbers of BNCs were evident when incubated on Matrigel coated than noncoated plates. However, regardless of culture matrix, BNCs contained lower amounts of BNC specific transcr ipts and were nearly devoid of CDX2 mRNA after 3.5 d in culture. The second objective was to examine the expression profile of selected factors associated with formation and activation of BNC like placental cells identified in primates and rodents and to determine if over expression of one of these factors (HAND1; heart and neural crest derivatives expressed1) induced BNC formation in culture. Nearly all of the transcripts of interest ( HAND1, MASH2, ID1, ID2, IMFA, Stra13, GCM1 and E12/E47) were present in bovine cotyledons obtained from mid-

PAGE 16

16 gestation placentae. One of these, HAND1 was characterized by mRNA and protein concentrations being greater in BNC versus MN C. However, HAND1 over expression did not induce BNC differentiation in a mononucleated troph oblast cell line. The third objective was to elucidate the function of BMP2 and 4 in bovine trophoblast cells. BMPs play an important role in several reproductive processes and are implicated in controlling placental development in humans and mice. Trans cripts for both BMPs were present in day 17 bovine conceptuses, the CT1 bovine trophoblast cell line and endometrium. The BMP antagonist, Noggin, also was detected in day 17 conceptuses but not in CT1 cells or endometrium. All receptors necessary for BMP 2 and 4 signaling were found in all tissues examined. Supplementing CT1 with recombinant human BMP2 and 4 did not affect IFNT and CSH1 expression and did not induce BNC formation. Therefore, potential functions for these morphogenic factors in bovine trophoblast cells remain unclear. In conclusion, FACS is an effective method for isolating enriched populations of BNCs; however culturing BNCs leads to rapid loss of key BNC and trophectoderm specific markers in culture. HAND1 was found in greater abundance in BNCs versus MNCs However, over expression of HAND1 did not induce BNC formation in an ovine trophoblast cell line suggesting that HAND1 is not the only causative factor required for BNC formation in ruminants. The signaling pathway controlling BN C differentiation is still unknown. BMP2 and BMP4 mRNA are abundant in day 17 conceptuses; however their actions for regulating trophoblast function is unknown.

PAGE 17

17 CHAPTER 1 INTRODUCTION Over the past six decades reproductive efficiency in dairy cattle has decreased steadily This decrease is negatively correlat ed with increased milk production [1, 2] Approximately 60% of all pregnancies fail to reach term in dairy cattle [3]. Between 4050% of pregnancies fail to reach term du e to complications du ring the first three months of gestation [3, 4]. The events leading to pregnancy failure can be evaluated based on the timing of specific developmental events throughout early and mid gestation. Studying the mechanisms controlling specific events during this period of pregnancy loss can enhance our understanding of what may be leading to pregnancy failure. Some of the events this laborat ory has focused on inc lude embryo and conceptus development, maternal recognition of pregnancy and placental development [3, 5] Substantial pregnancy loss occurs during the first 7 days of pregnancy. During this period, the fertilized egg must undergo several cellular divisi ons By days 4 5 of gestation, embryos enter the uterus and begin translating from their own genome, an event termed embryonic genome activation [5, 6] On day 6, the troph oblast lineage is specified and forms an outer layer of cells referred to as the trophectoderm and the blastocyst begins to be formed. Lack of cellular divisions and blastocyst formation can result from cellular miscues, including improper genome activati on that includes the expression of lethal genes and deficient expression of housekeeping genes and chromosome abnormalities [7] These problems can be exacerbated by environmental and phys iological stressors. One example is the partitioning of energy towards milk synthesis and lactation rather than reproduction causing reduced embryo quality [3, 8].

PAGE 18

18 From 20 to 40% of pregnancies that survive into the beginning of the second week of gestation fail before day 24 of gestation [3, 4, 9] Several crucial developmental events occur at this time. By day 1315 of gestation the embryo begins the processes of concep tus elongation, transitioning from a spherical embryo, to a tubular and soon thereafter a filamentous conceptus [10]. During this time the hormone interferon tau (IFNT) is secreted from the mononucleate trophoblast cells (MNCs) [11] IFNT prevents the puls atile secretion of prostaglandin F2 to extend luteal function beyond the length of a normal estr o us cycle. The production of IFNT radically increases as the conceptus elongates [12, 13] By day 16 of pregnancy, enough IFNT must be produced by the trophectoderm of the embryo or luteolysis will occur and the pregnancy will be lost [14] Data indicate that the inability of the embryo to elongate and produce enough IFNT to prevent luteoly sis results in pregnancy loss [15, 16] Pregnancy failures occurring after day 24 of gestation but before day 42 (transition from embryonic to fetal development) are classified as late embryonic losses [4] These events account for 5 20% of all pregnancy losses [3, 4, 17] Many of these losses likely result from insufficiencies in placental formation and function. The placental attachment processes begins at approximately day 20 in cattle and is nearly completed by day 42 [13, 18] BNC formation and migration into the uterine lining is a hallmark feature of early placental formation in ruminants. BNCs are apparent on day 16 of gestation [19]. The mechanisms controlling BNC formation and function are still unknown in dairy cattle. This topic is of central interest in this dissertation given that some studies have found that reductions in BNC numbers may contribute to pregnancy failures in cattle [20, 21]

PAGE 19

19 Pregnancy losses following the sixth week of gestation are usually referred to as fetal lo sses. The se losses are less prevalent tha n early and late embryonic losses representing between 2 5% of total pregnancy failures. The cause of fetal losses is often undetermined but can result from a pathological condition [3]. R eproducti ve failures are directly related to economic loss in the dairy industry [3, 4, 8] It is estimated that each pregnancy failure in lactating cows costs a dairy farm $555. This value is based on repeat breeding and losses associated with lifetime milk production potential [22] The cost of pregnancy failure is greater in fetal and late embryonic associated losses tha n early embryonic losses, due to the increased number of days open and costs associated with the loss of a calf. Also high producing dairy cows are estimated to have more costly pregnancy losses tha n lower producing dairy cows An extended period of time between the subsequent lactations is more costly for high producing cows tha n low producing cows [22 24] Based on these findings, it is clear that insufficiencies in trophoblast development, placental formation a nd/or placental function during early and midgestation can significantly impact pregnancy success in cattle. Understanding the processes controlling trophoblast development, differentiation and function are, therefore, imperative for identifying new ways to limit pregnancy failures in cattle. This dissertation research was completed to test the hypothesis that mechanisms controlling trophoblast differentiation, development and function in cattle is similar to mechanisms utilized to generate invasive trop hoblast lineages identified in humans and mice. Three overall objectives were examined in this dissertation research.

PAGE 20

20 1 ) To develop a method to isolate enriched populations of BNCs from midgestation bovine placenta and study the function of these cells in culture. 2 ) To identify expression differences of suspected trophoblast differentiation factors in MNCs and BNCs and determine if over expression of differentially expressed genes in a trophoblast cell line can induce BNC formation. 3 ) To evaluate the express ion profile and function of bone morphogenetic proteins (BMPs) and their receptors during trophoblast development and differentiation.

PAGE 21

21 CHAPTER 2 LITERATURE REVIEW The Placenta The mammalian placenta is a transient endocrine organ that is essential for f etal survival in eutherians [25]. The term placenta was derived from the Latin term for flat cake, an u nleavened loaf of bread found throughout ancient Rome, and undoubtedly refle cts the gross morphology of the human placenta [10] The placenta is essential for fetal growth. It provides gas, nutrient and metabolic waste exchange between the mother and fetus [26 29] It also produces several growth factors, cytokines, and hormones which help regulate the maternal environment and maintain pregnancy [30, 31] The first s tudies of placental function and morphology date back to ancient Egyptian times The first scientific studies of the placenta were completed by the Greek philosopher s, Hippocrates and Aristotle, who hypothes ized that the embryo is nourished by maternal blood [32] In the fifteenth century, Leonardo da Vinci made several illustrations and observations about the p lacenta and fetal circulation that were based mainly on ruminant placentae, the placental model he had access to [33]. The se observations, while anatomically inc orrect for the human, did show that the fetal circulatio n is not continuous with the mother and that the placenta attaches to the uterus [32] Lat er, advancing histological technology permitted scientists to complete more substantial investigations about the placenta. In the 1700s b rot hers William and John Hunter published books about the structure of the uterus and placenta in humans [32, 34] William Hunter described the structure of the maternal spiral artery using wax

PAGE 22

22 colored injections [35] John Hunter was the first to describe the anatomical relationship between the fetal and maternal circulation in humans [34, 35] Another well known philosopher of the eighteenth century who made significant contributions to the understanding of placental function was Era smus Darwin. In his published work, Zoonomia, he described the role the placenta plays in deliver ing oxygen to the fetus [34, 36] In the nineteenth century Enrst Heinrich Weber obtained the first microscopic images of the human placenta and was able to describe an epithelial lining separating the maternal supply from fetal blood vess el s [35] In 1889, Ambrosius Hubrecht first coined the term trophoblast for cells that differentiate into placenta [35] The term trophoblast is still used today to describe placental cells. Placental Formation Great diversity exists in placentation amongst eutherian, or placental, mammals but many of the events that control placental formation are similar among most mammals [37]. All eutherian mammals have a chorioallantoic placenta [38, 39] After fertilization, the embry o goes through a series of cellular divisions, leading to a mass of tightly compacted cells. This stage of embryo development is termed the morula stage [10] Very early in development usually before any differentiation event occurs the translational events controlling development switch from maternal RNAs to the embryonic genome in an event called t he Maternal Zygotic Transition (MZT) [6, 40] The timing of this event depends on the species ; occurring at the late two cell stage in mouse between the four to eight cell stage in human, and at the 8 to 16cel l stage in ruminants [41]

PAGE 23

23 The mammalian embryo undergoes its first lineage differentiation event as cells on the outer layer of the embryo differentiate to trophoblast cells [42] The inner cells, often referred t o as inner cell mass (ICM), remain totipotent and eventually develop into various other extraembryonic layers and embryonic germ layers [43] The trophectoderm is made up of trophoblast cells that for m the outer layer of the blastocyst and later the placenta [44, 45] Another hallmark of blastocyst formation is the presence of a fluid filled cavity termed the blastocoele cavity. Trophectoderm cells facilitate the formation of this cavity by pumping sodium into the blastocoele. This increase in ionic concentration in the embryo causes water to diffuse into the embryo forming the blastocoele cavity [45, 46] Following cavity formation, two extraembryonic layers, the primitive endoderm and mesoderm begin to form. T he primitive endoderm differe ntiates from the ICM and grows to form the yolk sac [43, 47] In cattle, the primitive endoderm begins to differentiate by day 8 and is completely formed by day 10 [48] The yolk sac forms in the blastocoele cavity space [10] T he next layer of cells to differentiate is the mesoderm, which forms between the endoderm and trophectoderm. This layer emerges at day 14 in cattle [49, 50] The trophectoderm and the mesoderm eventually will fus e to form the outer and inner layers of the chorion, respectively [43, 47] The embryo continues to grow and expand as the now formed chorion folds and surrounds the embryonic disc These folds eventually meet and f use together to form the amnion and its fluid filled amniotic cavity that surround s the embryo/fetus. Simultaneous with chorion folding the embryonic disc begins to di fferentiate and eventually form the fetus.

PAGE 24

24 At the same time as the amnion is developing another extraembryonic membrane begins to form from the fetal hindgut. The posterior region of the hindgut extends and forms a sac like evagination forming the allantois The allantois begins to form at day 20 in cattle [50]. This extra embryonic membrane forms a fluid filled sac that collects liquid fetal waste. The allantois also carries blood vessels that will vascularize the chorion and amnion [10] The last event to occur is the fusion of the allantois and chorion to become the chorioallantoic placenta [10] Placental Classification There is a great diversity in placentation types, and several classificatio n systems exist to account for the various differences in placental types identified. Several schemes for discriminating placentae are used. Some of these include the type of maternal fetal interdigitation nutrition, gross morphology and the number of histological tissue layers separating the maternal and fetal blood supply [25, 51 54] These classifications have been useful for understanding the evolution of placental diversity among mammals [51, 55 ] which will be discussed in greater detail later in this section. T wo widely used parameters for classifying placentae are based on gross morphology and histological examination [25, 31] T he gross morphological classification of placentae is based on the distribution of chorionic villi Chorionic villi develop small finger like projections that extend away from the chorio n and intercalate with the uterine endometrium [31]. Four primary deviations in the distribution pattern of chorionic villi exist. In diffuse placenta e, ch o rionic villi are distributed evenly over the placental surface [25, 31] Species with this type of placentation include swine [56] and equi ds [57] Some other mammals, including cats and dogs, possess a zonary placenta, which is characterized with a ring or band of invasive chorionic villi in the center of the

PAGE 25

25 chorion [58, 59] The discoid placenta contains a disc of concentrated chorionic villi that form the attachment to the ut erine endometrium. The discoid placenta is found in rodents and humans [31, 60] Ruminant species have a cotyledonary placenta This placenta is similar to the discoid placenta in regards to having disc like structures, but nu merous chorionic villi structures, termed cotyledons, spread across the chorion and interact with distinct maternal structures, termed caruncles to form placentomes. The placentome is the area of placental attachment. This placenta type is found i n ruminant species, including the bovine and ovine [61]. The placental classification system based on h istological examination of the number of tissue layers separating the maternal and fetal blood supply was first described in the early 1900s by Grosser [25, 39] In this classification, the most non invasive type of placenta is term ed epitheliochorial, where six layers of tissue separate the fetal and maternal blood supply (fetal endothelium of the blood vessel, the mesoderm, trophoblast, maternal epithelium, stroma, and endothelium of the maternal blood vessel). These placentae are found in swine and equids [62, 63] Ruminant species have a synepitheliochorial morphology where fusion between fetal placental cells and maternal uterine epithelium cells create areas of fusion that form syncytial plaques, or syncytium to various extents depending on the species [61 63] The third type of placenta in this classifi cation is the endotheliochorial placenta. In this placentation, the maternal epithelium and stroma is eroded away and the chorionic epithelium contact s the maternal endothelium Species with this type of placentation include the feline and canine [25, 62, 63] T he most invasive type of placen ta is called, hemochorial, and is classified as having n o maternal tissue layers separating the

PAGE 26

26 maternal blood supply and the fetal chorionic epithelium. Thi s is often referr ed to as the placenta bathed being in the maternal blood supply. Humans and rodents are both classified as having a hemochorial placenta; however there are differences in the number of fetal tissue layers separating the fetal and maternal blood supply. I n rodents, there are three trophoblast cell layers (hemotrichorial) two syncytial layers and a mononucleate cell layer In humans, there are two trophoblast cell layers (hemo di chorial) one syncytial layer and one mononucleate cell layer in the first tri mester and by term there is one complete syncytial trophoblast layer (hemomonochorial) separating the fetal and maternal blood supply and a discontinuous layer of mononucleate trophoblast cells [62 67] In the rodent the fetal and maternal interdigitation area is termed the labyrinthine and in humans it is termed villous [68] Evolution of the Placenta It is interesting to consider the evolutionary advantages and disadvantages afforded eutherian mammals versus other animals (methatherian s, monotremes, and nonmammals [ both viviparous and oviparous ] ). One advantage of viviparity over oviparity (egg laying) is the ability to protect the embryo/fetus as it develops. However, protecting the developing embryo can reduce the fitness and survi vability of the mother, and this limitation likely maintained oviparity throughout the evolution of animals [69, 70] T he viviparity driven conflict hypothesis argues that viviparity allows for genomic conflicts fo llowing fertilization. C onflict s over resources aris e between the mother and embryo, siblin gs in the womb, and maternal and paternal genomes. These conflicts have resulted in the diversification in mammalian placentation [70 72] Methatherian (marsupial) mammals evolved a primitive yolk sac placenta containing a poorly developed maternal fetal interface [37, 73] While eutherian mammals developed a

PAGE 27

27 chorioallantoic placenta that allows these mammals to deliver well developed young by having a high degree of fetal maternal exchange [69, 70, 74] Overall the evolution to a chorioallantoic placenta has allowed eutherian mammals to produce well developed young wi th less reproductive wastage tha n seen in egg laying species [69, 70, 74, 75] Understanding the necessity of various placental types throughout mammalian evolution has been the focus of m uch discussion over the past 100+ years and has been rekindled recently by our ability to re examine evolutionary relationships at the molecular level [76, 77] The multiple divergences seen in m ammalian placentati on are due in part to the continental break up [78 80] This continental breakup led to four clades of eutherian mammals : Afrotheria, Xenarthra, Euarchontoglires, and Laurasiatheria [51, 53, 55, 76, 78] The Australia continental break resulted in a large clustering of marsupials that are often included as an out grouping in phylogenetic trees describing the evolution of eutherian mammals [37, 39, 51] Original studies of placental evolution were based on fossil records and indicate that eutherian mammal divergence occurred following the Cretaceous/Tertiary (K/T) boundary ( i.e. the end of dinosaurs ) [79, 81] M ore recent placental evolution analysis based on molecular phylogenetics indicates that eutherian mammals split from the metatherian taxa, or marsupial species, before the K/T boundary [78, 81] W hile there is a disagreement between the fossil record and molecular phylogenetics on when eutherian mammals originated, both records show consistency in the order that the placental clades diverged [81, 82] The superclades Afrotheria and Xenarthra are the closest to the original divergence of eutherian mammals Interestingly, present day species within these

PAGE 28

28 groupings contain endotheliochorial or hemochorial placentae, suggesting that one of these placental types likely existed in the original mammals that gave rise to all eutherian mammals [83]. The Afrotheria clade (those arising from anc ient Africa) is thought to be the predecessor for the other major clades [53, 77] The second major clade to diverge likely was Xenarthra (now South America ) [84] followed by the Euarchontoglires (now Europe and Asia) [51, 83 ] This superclade includes two sister groups; the Glires ( rabbits and rodents ) and the E uarchonta ( primates and tree shrews) [39, 51] Lastly the Laurasiatheria superclade diverge from the Euarchontoglires [85]. This fourth clade includes several orders of placental mammals, including perissodyctyls, carnivores, cetaceans, and cetartiodactyla [39]. Examples of epitheliochorial and synepitheliochorial placentae are ev ident in the Euarchontoglires clade in the lemur and within the expansive cetartidactyla grouping within the Laurasiatheria clade that includes pigs, cattle and whales [51, 53] The epitheliochorial placenta is a derived adaption in the Euarchontoglires and Laurasiatheria super clades however the placenta type that this evolved from is unclear [39, 53, 77, 86] A s ubstantial divergence in placental morphology exists withi n certartiodactyls. Species with a diffuse epitheliochorial placenta, such equine and porcine, are the more primitive species and the emergence of a cotyledonary placenta with epitheliochorial or synepitheliochorial characteristics evolved from these species [51, 70] T he evolution of the coteldonary placenta correlates fairly well with the emergence of rumination and the formation of a rumen stomach Perhaps a reason for this close correlation is that when ferm entation occurs glucose availability is lim ited [51] Limited glucose a vailability can

PAGE 29

29 negatively impact the mother causing fatal metabolic diseases. Therefore the mother needs to tightly regulate glucose exchange with the fetus however glucose is also essential for fetal development [70] Th is could explain why placentae in ruminant s evolved a more efficient nutrient exchange system than what is found in species with diffuse placenta e T he nutrient exchange surface in the cotyledonary placenta is comparable to the endotheliochorial and hemochorial placenta However, th e diffuse equine placent a has a lower placental efficiency when compared to the bovine based on placental surface area and fetal weight gain over time [51, 70] In conclusion, there are differences between the pl acentation found in humans, rodents and ruminants however, the epitheliochorial and hemochorial placentae are evolutionary linked and the nutrient exchange rate in these two distinct placentae is similar. The Ruminant Placenta As reviewed above ruminant species have developed a specialized synepitheliochorial placenta also referred to as a cotyledon ary placenta. The processes leading to the development and function of the ruminant placenta will be examined here. Conceptus Elongation and Gastrulation T he pro cess of conceptus elongation refers to the time period when the ruminant embryo changes from a spherical blastocyst to an ovoid then a tubular conceptus during a transition phase before the rapid elongation of the conceptus that leads to a filamentou s structure. This rapid change in structure coincides with rapid trophoblast remodeling and proliferation [43, 48] The timing of these events is species dependent based on the reproductive cycle. For instance, in cattle the embryo begins to transition from spherical to ovoid by day 12 and to tubular by day 14 where the average length is

PAGE 30

30 5 6 mm. By day 16 the bovine conceptus is filamentous and ranges between 1030cm in length [7, 48, 50] This elongation process also occurs in non r uminant ungulates but some distinctions exist. For example, conceptus elongation in swine occurs because of changes in trophectoderm morphology caused by cytoskeleton reorganization instead of an active proliferation of cells [18, 8789] Also, equids do not undergo an elongation process. Instead the equid conceptus migrates freely between both uterine horns until days 1617 following ovulation when the increase in conceptus diameter prevents this movement throu gh the narrow uterine lumen and it becomes fixed in position [57] During this same period of elongation, the ICM underg oes gastrulation and neurulation As discussed previously, primitive endoderm, also referred to as the hypoblast emerges early during embryonic development and usually is evident by day 8 of gestation in cattle [50] Over the next few days the outer cells of the ICM become polarized and begin to differentiate into embryonic ectoderm. The hypoblast has formed a complete lining inside of the trophectoderm by day 12 in cattle. At this time Raubers layer is lost and the epiblast is exposed [48, 50] The process of gastrulation involves the migration of cells from the epiblast to form the primitive streak, endoderm and mesoderm. The precursor cells of the primitive streak are present in day 14 bovine embryos and accumulate at the caudal end of the epiblast. Also the primitive mesoderm forms between days 1416 [50, 90] By day 21 in bovine the primitive streak and definitive endoderm and mesoderm are formed [50] Placental Attachment There are several stages of implantation during placental development First, the blastocyst must hatch from the zona pellucida and orient itself to the uterine epithelium.

PAGE 31

31 Usuall y the ICM will be positioned on the side opposite of the implantation site [91, 92] In ruminants, this site is central to the uterine cavity [91] T he embryo under goes elongation at thi s time [9 2] Following conceptus orientation is the apposition phase when the first cell to cell contact is made between the trophoblast and uterine cells [91]. This event occurs at approximately da y 19 in cattle at the uterine glands located throughout the intercaruncular spaces on the endometrium [93 95] Here trophoblast finger like papillae extend into the openings of the uterine glands anchoring the peri attachment conceptus and take up uterine histotroph [91, 93, 94, 96] Concurrently, the endometrial caruncles develop deep folds that the chorionic villi will interdigitate with to form the placentome [97] Following apposition, the conceptus begins to firmly adhere to the uterine endometrium. At this time the trophectoderm and endometrial epithelium interdigitate in both the caruncular and intercarcucl ular area. The interdigitation of the fetal villi, or cotyledon, with the caruncle forms the placentome [94, 95, 98] The initial attachm ent or apposition of the trophoblast cells to the uterine epithelium is controlled by the loss of anti adhesive components on the apical surface of the uterine epithelium, such as Mucin 1 (MUC1) [18, 99] Loss of M UC1 is attributed to the down regulation of progesterone receptors on the uterine epithelium by progesterone [18, 100] Removal of MUC1 reveals attachment and adhesion molecules. Following this removal, attachment is controlled by low affinity carbohydrate binding molecules, including galectins and selectins [101103] Finally, firm adhesion of the trophoblast to the uterine endometrium is mediated by various integrin heter odimers. These heterodimers interact with extracellular matrix proteins, and

PAGE 32

32 integrin binding molecules such as osteopontin and fibronectin found on the surface of the endometrium [104108] Placental Defects One way to elucidate the essential mechanisms controlling placental development in ruminants is to study improper signaling events that cause abnormal placentation. In this regard, pregnancies produced from somatic cell nuclear transfer (SCNT) are beneficial due to the major placental defects, including placentomegaly, hydrallantois, and poor placental vascularization found in these pregnancies. These defects are due at least in part to abnormal placentome formation and BNC number resulting in a high percen tage of embryonic loss and a greater incidence of large offspring syndrome in SCNT pregnancies [21, 109] Only 5% of SCNT pregnancies proceed to term in livestock species [1 10115] In cattle 6080% of SCNT pregnancies fail between day 30 90 of gestation and a majority of these losses occur between days 3040 of pregnancy. This period of pregnancy coincides with cotyledon formation in cattle [109, 112] Histological examination of SCNT placentae during this time period of loss shows smaller, fewer and less vascularized cotyledons when compared to in vitro produced (IVP) embryos or artificial insemination (AI) placentas [21, 116, 117] A placentomegaly phenomenon exists in bovine and ovine SCNT pregnancies that make it past day 90 of gestation. This phenomenon is characterized by a reduced number of placentomes, but a greater placentomal wei ght and overall size compared to AI as well as IVP placentae [111, 118, 119] Along with gross morphological placental differences, the expression pattern of various f actors is also different between SCNT an d con trol (IVP and AI) placentae.

PAGE 33

33 These factors include angiogenic factors, such as hypoxiainducible factor 1 (HIF 1), angiopoieten 1 (ANGPT1), placenta growth factor (PIGF), as well as the vascular endothelial growth factor A (VEGFa) system [116, 120] Researchers have also examined SCNT placentas for differences in the insulin like growth factor axis. Insulin like growth factor binding proteins (IGFBP) 2 and 3 were increased in SCNT placental tissues in cattle an d Insulinlike growth factor 2 (IGF 2) mRNA was reduced in ovine placentae [118, 121] Glucose transporters, GLUT1, GLUT3, and GLUT8 are also reduced in SCNT ovine placentae coinciding with reduced fetal glucose pla sma levels by day 135 of gestation [118] Major histocompatibility complex I (MHC I), which is involved in the immunologic rejection of the conceptus, is also reduced in bovine SCNT placentae [122] Differences in these factors and others may indicate a cause for the SCNT placental abnormalities and also provided insight into potential mechanisms affecting proper placentation. Another change in SCNT placentas is differences in BNC numbers. Several reports indicate a reduced number of BNCs in SCNT placentas when compared to IVP and AI placentas [21, 117, 123] Several BNC specific factors, including chorionic somatmammotropin hormone 1 (CSH1 ) pregnancy associated glycoprotein (PAG) 1 and 9, and prolactin related protein (PRP) are reduced in SCNT placentas [124, 125] One report indicates an increase in BNC numbers in SCNT pregnancies [121] Although there are differing reports of how BNC number s change in SCNT pregnancies, it is clear that differences in the number of these cells exist. All of the observations made about SCNT pregnancies and placentas highlight essential time periods for proper placental development in ruminant species.

PAGE 34

34 Placental Cell Types The ruminant placenta contains two morphologically and functionally distinct trophoblast cells, the MNC and BNC [19] Both of these cell types play essent ial roles during pregnancy. This section will describ e the functional importance of these cell types, review known signaling pathways controlling their function, and discuss how the formation of these cells may be controlled. Mononucleate Cells The trophoblast MNCs comprise approximately 80 percent of th e trophectoderm throughout gestation in ruminants They contain features typifying cubodial to columnar epithelial cells located on a basal lamina [126, 127] The apical surface membrane of these cells for ms microvilli that interdigitate with microvilli on the endometrium forming the fetal maternal contact zone. These contact zones are where maternal fetal nutrient exchange occurs [10, 19] Early in pregnancy, the MNCs also produ ce IFNT responsible for signaling maternal recognition of pregnancy in ruminant species [19, 128, 129] F or a pregnancy to succeed, the embryo must si gnal its presence to the mother and prevent corpus luteum (CL) regression, a process referred to as maternal recognition of pregnancy [19] Ruminant species have evolved a unique signaling mechanism early in pregnancy to prevent CL regression or luteolysis. In a non pregnant animal, the CL regresses due to pusatile secretions of p rostaglandin F (PGF) produced by the uterine endometrium [130135] Pulsatile secretions of PGF are controlled by oxytocin and oxytocin receptor binding on the uterine endometr ium. In a pregnant animal, IFNT must be secreted in high enough amounts to prevent oxytocin binding ; thus abolishing PGF pulsatile secretions and luteolysis [14, 16, 136] S everal

PAGE 35

35 factors influence the production of IFNT and many of these factors are found in the uterine histotroph [15, 137139] Trophoblast Cell L ines Ruminant trophoblast cell lines that resemble MNCs have been established for cattle and other ruminant species (e.g. ovine and caprine) [101, 140, 141] In cattle, several trophoblast cell lines have been established from in vivo in vitro somatic cell nuclear transfer, and parthenogenetic activation of blastocysts [140, 142144] These cell lines secre te IFNT, but are not known to differentiate into BNCs nor do they produce BNC specific markers, such as CSH1 [140, 144] The in vitro blastocyst derived cell line, CT 1, has been used to elucidate the role of several growth factors on IFNT expression [145147] Another bovine in vitro blastocyst derived trophoblast cell line is the BT 1 cell line, developed in Japan [148] These cells express IFNT and can differentiate into what is considered a nave BNC that secrete CSH1 protein but do not produce BNC specific PAGs [148150] Sheep t roph oblast cell lines have also been established One of central importance to thi s dissertation research is the ovine trophoblast cell line, oTr. It was developed from day 15 elongating sheep conceptus [20] The oTr cell line has been used to elucidate mechanisms controlling trophoblast cell differentiation, migration and attachment [20, 101, 151, 152] In an other study, primary sheep trophoblast cell cultures were produced from the cotyledons of sheep at 120135 day gestation. These cells were passaged and maintained for 12 to 16 weeks during which time BNC differentiation occurred unlike the oTr cell line w hich does not form BNCs in culture [153]

PAGE 36

36 There is one report of a caprine trophoblast cell line produced from trophoblast cells isolated from placentae o f goats at 100 days of gestation [141] These cells stain positive for IFNT and CSH1. In this cell line BNCs also form at a high frequency [141] Overall the establishment of trophoblast cell lines from various ruminant species has aided researchers in studying the underlying signaling mechanisms controlling trophoblast development and function. Binucleate Cells Ruminant BNCs, als o termed trophoblast giant cells, differentiate fro m trophoblast MNCs and have two functions. First, they are the cells that fuse with the maternal epithelium to form the fetomaternal syncytium [61, 154, 155] Se cond they are the ma jor endocrine trophoblast cells producing steroid hormones, such as estrogen and progesterone, as well as other hormones including chorionic somatomammotropin 1 (CSH1; also known as placental lactogen) and pregnancy associated glycoprot eins (PAGs ) [156158] These cells are found in both the cotyeldonary and intercotyledonary regions of the ruminant placenta [61, 159] Placental B NCs are found in all ruminant species exami ned, including bovine, ovine, ce rvine, caprine, water buffalo, alpaca, antelope, and giraffe [61, 159166] BNCs are also present in the mouse deer, which represents the m ost primitive ruminant group existing [167169] Mouse deer have a placenta that is unique amongst species in the Ruminant suborder because they contain BNCs but do not contain definitive cotyledons [167, 168] BNCs first appear just before implantation and comprise 15 to 20 percent of all trophoblast cells throughout most of gestation. Their numbers decline approximately a week before parturition [159, 170172] The decrease of BNCs in the last week of

PAGE 37

37 gestation is controlled by the concentration of fetal cortisol [172, 173] Ablation of the prepartum fetal cortisol rise prevented the norma l decrease of BNCs while increasing cortisol levels in immature fetuses decreased BNC numbers [173] In cattle, this decrease in BNCs prior to parturition is associated with placental separation [174] Beginning at day 16 in cattle, BNCs form from MNCs through either fusion and or acytokinetic mitosis events [175, 176] M ost BNCs contain two nuclei, and all cells are hyperploidic and contain up to 32 DNA copies [155, 165, 175] Using electron microscopy it was discovered that BNCs have multiple small mitochondria, rough endoplasmi c reticulum cisternae and an extensive golgi body which produces secretory granules [177, 178] These cytoplasmic secretory granules store synthesized hormones that are delivered to the maternal environment through exocytosis [61, 179] The migratory nature of BNCs is evident from the time they first appear in the trophoblast. O n average, o ne in seven BNCs can be observed migrat ing towards the apical surface of the trop hoblast epithelium at any one time throughout gestation [159] BNCs are unique migratory cells because they form a tight junction with neighboring MNCs that allow the trophectoderm to keep the fetal physiological milieu isolated from the mother while allowing the BNCs to deliver hormones to the maternal environment [126, 180] Following their migration to the uterine epithelium, BNCs fuse with the uterine epithelium. This fusion forms feto maternal hybrid, or trinucleate, cells which form the placental attachment in ruminant species [61, 181, 182] The degree of syncytia formed depends on the ruminant species, with ovine and caprine formin g a greater syncytia than seen in bovine and cervine [61, 159] In ovine and caprine the feto maternal hybrid cells fuse together to form the fetomaternal syncytia containing

PAGE 38

38 numerous nuclei (n=3 20) [161, 171, 183] In the bovine and cervine this syncytium is formed at the time of placental implantation, however as gestation progresses the syncytium is overgrown by unicellular uterine epithelium cells [184] One of the major functions of BNCs is to produce and deliver steroid and protein hormones to the maternal environment [61] BNCs are the primary placental cell producers of steroid hormones [185] A majority of the placental progesterone in ovine and bovine is produced in BNCs through the conversion of pregnenolone [186188] Th ey also are t o be the major placental source of p rostaglandins and have the ability to convert prostaglandin F to prostaglandin E2 [189] Oestrogens are also produced by BNCs [185, 190] Key steroid synthesis enzymes, aromatase and P450 side chain cleavage, are also present in BNCs [191, 192] One protein hormone expressed by BNCs is placental lactogen (PL) or chorionic somatmammotropin hormone 1 (CSH1) [191, 193, 194] It is a member of the growth hormone (GH) and prolactin (PRL) family of hormones but is more closely related to PRL [195, 196] Six isoelectric isoforms of PL have been identified in bovine with a molecular weight of 3133 kilo Daltons (kDa) [193] All bovine CSH1 is glycosylated however ovine and caprine CSH1 is not glycosylated resulting in a lower molecular mass of 23 kDa [197] CSH1 binds and activates the GH/PRL/PL family receptors [193, 198 200] Various in vivo functions have been postulated for CSH1 in both mother and fetus. CSH1 may have a luteotrophic effect in bovine by increasing the size of the corpus luteum and progesterone concentrations [201] Another proposed role of CSH1 is nutrient intake and partitioning to regulate nutrient supply to the fetus [197, 202, 203]

PAGE 39

39 In conjunction with nutrient intake and partitioning, CSH1 is suggested to regulate fetal growth and development. Research has correlate elevated CSH1 plasma concentrations and inc reased fetal birth weight [196, 204207] Lastly, CSH1 impacts mammary development and lactation. Administration of CSH1 can increase milk yield by acting as a PRL like compound in cattle [208211] Another member of the GH/PRL gene family produced by BNCs is the group of prolactin related proteins (PRP) or prolactin like proteins (PLP) [196, 212] Nine PRP genes are expressed in bovine placenta but only PRP I is present at the protein level in bovine [196, 213, 214] Expression ha s been reported as early as day 17 20 in the conceptus and has been localized to BNCs [215217] PRP 1 expression coincides with implantation events in the bovine and therefore this protein may have a potential role in this process. [217] These proteins are also hypothesized to play a ro le in regulating ovarian and mammary gland function [30]. BNCs produce several aspartic protease family protei ns termed pregnancy associa ted glycoprotein proteins (PAGs) [1 58] These proteins have been characterized in bovine, caprine and ovine ruminant species [218221] There are two classes of PAGs: ancient and modern [218, 222, 223] Bo th classes of PAGs are present in the cotyledon fr om implantation to term, although there are different spatial and temporal expression patterns exist for the modern and ancient PAGs [224, 225] At least some, and likely all of the ancient PAGs are active proteolytic enzymes These include PAG 2 and 10 and localize to the MNC outer surface [218, 223, 224] On the other hand, the modern PAGs are unlikely to be active proteases based on their

PAGE 40

40 structure and poor binding to pepstatin [226228] The modern PAGs include PAG 1, 6, 7, and 9 are found in BNCs [218, 222, 224] The function of PAG s during pregnancy is unknown, but PAG measurements in plasma are a useful way to diagnose pregnancy in cattle and other ruminants [229232] Based on radioimmuno assay (RIA), a positive pregnancy diagnosis c an be made with PAGs beginning between days 28 30 of pregnancy [233] During early and mid gestation PAG con centrations increase grad ually until day 240 at which time the y increase exponentially [231, 233] The concentrations remain elevated until parturition [231] PAGs remain detectable in bovine for approximately 14 weeks indicating a long half life for the se proteins in cattle [231] L ow concent rations of PAGs (<2.5 ng/ml) in pregnant animals are also predictive of impending fetal losses [234, 235] Decreased levels of BNC specific, PAG1, also are seen in high milk production in dairy cattle [8, 236] Lastly, low levels of PAG1 also are found in placentae from SCNT animals containing fewer BNCs [21, 120] O ther BNC expressed factors are not as well characterized. For exam ple, lectins such as Dolichos biflorus (DBA) are used as a BNC indicator. The function of the carbohydrate moieties it binds with is not known, but it is known that BNCs contain various proteins that are heavily glycosylated (e.g. PAGs) [237240] The glycosylation pattern found on BNC secretory granules is conserved across ruminant species and is characterized by containing tri/tetraantennary complex N glycans and bisecting terminal N acetylgalactosamine [241] Another marker used to identify BNCs is the SBU 3 monoclonal antibody This antibody recognizes a carbohydrate antigen on BNCs [242, 243]

PAGE 41

41 Other factors localized to BNCs have been implicated in regulating BNC migration and fusion. One of these is heparanase (HPA), an extracellular remodeling enzyme that degrades heparin sulfate proteoglycan [244, 245] HPA plays a similar role in human placental implantation [246, 247] Another enzyme, termed fertilin is a disintegrin and metalloprotease (ADAM) while a nother protein, termed CD9 is a transmembrane 4 superfamily glycoprotein are present in a subpopulation of BNCs [248251] gration, adhesion and fusion of various cell types, and CD9 specifically has a demonstrated role in human trophoblast invasion [249, 252254] The localization of fertilin ro les in trophoblast cell migration and adhesion also implicates them in ruminant trophoblast migration and adhesion. Integrins also likely participate in regulating BNC migration, adhesion and invasion [255257] V arious integrins are expressed on placental cells in ovine and bovine [104, 106108, 258, 259] Specifically integrin 6 1 localize in BNCs [259] BNC Isolation and Culture Previous efforts to isolat e and culture BNCs from mid gestation placentae have provided insight into various facets of B NC biology including hormone production [189191] Several tissue dissociation methods have been utilized to liberate B NCs from the placenta, including mechanical disruption and enzymatic digestion with trypsin, co llagenase, or dispase [187, 191, 260262] BNCs harvested using collagenase have an increased percentage of viable cells over mechanical disruption and trypsin digestion [26 0] Following digestion, BNCs have been typically separated from the whole placenta homogenate using density gradients [186, 187, 191, 260264] T he purity of BNC samples harvested using these methods ranges from 15% to 80% The variable

PAGE 42

42 purities and unrepeatability of this BNC isolation method are potentially caused by the narrow range of concentration s (1031.06 g/ml) used with these density gradients [191, 260, 261, 263] Following isolation many of these studies evaluated BNC viability and hormone production in in vitro culture systems. BNCs are viable in culture for over 30 days wh en grown on a collagen substratum [260] T his substrata may be the optimal matrix to culture BNCs on based on cell viability and attachment when compared to plastic [260, 261] The ability of BNCs to produce hormones was also evaluated in culture ; BNC produced se veral steroid hormones including estrogen and progesterone [187, 190, 264] However the expression of steroid enzymes and CSH1 is decreased following three and seven days of culture [191] These exper iments indicate that while BNC s appear viable throughout culture, they have altered expression of key BNC specific factors. Trophoblast Cell Differentiation The signaling events that lead to placental cell differentiation have been best defined in rodents and primates. We hypothesize th at the transcriptional regulators of trophoblast development and differentiation are conserved among most mammals and therefore the signaling mechanisms controlling ruminant trophoblast cell differentiation likely are similar with th ose at work in mouse and human trophoblast lineages. The focus of this section is to evaluate the known mechanisms controlling trophoblast cell differentiation in humans, mice and cattle. Trophectoderm Differentiation The specification of trophobl ast cells from non committed precursor cells cells during early blastocyst formation involves several transcriptional regulators. Two key

PAGE 43

43 changes in gene expression required for trophoblast cell formation in mice are the loss of octamer 4 ( OCT 4 ; also known as POU class 5 home box 1 [POU5F1]) expression and the gain of caudal type home box transcription factor 2 ( CDX 2 ) expression [46] OCT 4 maintains the undifferentiated state of the ICM and is downregulated in the trophectoderm CDX 2 regulat es trophectoderm differentiation and is not expressed in the inner cell mass [265268] In the mouse, OCT4 and CDX 2 are first expres sed at the morula stage when OCT 4 begins to be restricted to the cell s that become the ICM while CDX 2 is found more concentrated in the outer cells [269] Other factors have also emerged in the mouse model of trophoblast cell differentiation, such as TEAD4 (TEA domain family member 4). TEAD4 is necessary for trophoblast development prior to implantation and may drive the expression of C DX 2 [266, 269, 270] The T box gene Eomesodermin (Eomes) i s required for trophoblast and mesoderm development and its expression is stimulated by C DX 2 [269, 271] The pattern of expression of these trophoblast specifying factors is differe nt in cattle. Most notably, OCT 4 expression continues in the trophoblast for several days after its formation, and its detection ceases 12 days before conceptus elongation [268, 272, 273] CDX 2 is expressed exclusively in the trophectoderm of bovine blastocysts and is implicated in controlling trophectoderm differentiation [42] Eomes expression has not been found in bovine blastocysts [274] E xpression of TEAD4 remains to be established. These observations indicate that there is a conserved mechanism for involvement of CDX2 in trophectoderm differentiat ion but other lineage segregation factors differ between mammals.

PAGE 44

44 Trophoblast Lineage Segregation in Mice There are three distinct trophoblast cell layers in the mouse, the labyrinthine, the spongiotrophoblast, and the trophoblast giant cells. The inner most trophoblast layer to the fetus is the labyrinthine whi ch is comprised of two layers of syncytium termed the syncytiotrophoblast. The labyrinthine is highly folded giving it a large surface area essential for maternal fetal nutrient and gas exchange. The next layer is the spongiotrophoblast layer. This la yer whose function is not really known develops from the ectoplacental c one The trophoblast giant cells are the outer most cell type of the mouse placenta. T hese cells mediate trophoblast cell invasion and implantation [31, 275, 276] Trophoblast Lineage Segregation in Primates There are two main trophoblast cell layers in primates; the chorionic floating villi and the villous cytotrophoblast. The chorionic floating villi is the inner most layer and shares analogous function with the labyrinthine layer in mouse. Like the mouse, this layer is where syncytiotrophoblast cells are found. The villous cytotrophoblast are precursors of invasive extravillous cytotrophoblast cells that invade into the maternal spiral art ery [31, 275, 277] Several cell types in rodents and primates share similarities. The trophoblast giant cell in rodents and the extravillous cytotrophoblast cell in primates are homologous based on their hyerploi dic and invasive nature [278] Another placental cell that is also hyperploi dic and semi invasive is the BNC found in ruminants. BNCs and e xtravillous cytotrophoblast cells are known to have 416 DNA copies while the trophoblast giant cells have approximately 100 copies [31, 175, 279] Many of the same genes that are involved in trophoblast differenti ation in rodents are conserved in primates and it is

PAGE 45

45 hypothesized that these same genes may be involved in ruminant trophoblast differentiation [31, 275, 278] The following sections are aimed at reviewing the know n mechanisms controlling trophoblast differentiation and identify conserved pathways that may play a role in ruminant trophoblast differentiation. Transcriptional Regulation of Trophoblast Differentiation In both rodents and primates, several members of t he basic Helix LoopHelix (bHLH) family of transcriptional regulators play essential roles in trophoblast lineage segregation [276, 280] The bHLHs form homo and/or hetero dim ers with one another or may associate with E proteins (e.g. E 12/47), depending on the factor. Following dimerization, they bind DNA at specific E box sites and regulate transcription [281] The E box (CANNTG) is found in enhancer and promoter regions of numerous genes [281, 282] The basic region of these proteins is t he portion that binds the E box. S pecifically a glutamate residue in the basic region of each dimer subunit makes contact with the cytosine and adenine bases in the E box. Portions of the loop region and second helix also contact DNA and form van der Waals interactions that help to stabilize the binding of this complex to DNA. [282284] There are several classes of bHLH proteins [285] The class I bHLHs are often referred to as E proteins Most of these fa ctors are ubiquitously expressed and form dimers with one another or with bHLHs from other classes [286] Examples of E proteins include Daughterless, HEB, E12, and E47 [282] The proteins E12 and E47 arise from alternative s plicing of the E2A gene [287] The class II bHLHs are expressed in select tissues. Many of these factors can dimerize with one another but their preference usually is to dimerize with E proteins Members of this s econd class include the MyoD family of proteins, achaete scute

PAGE 46

46 complex homolog 2 (ASCL2) and heart and neural crest derivatives expressed 1 (HAND1) [282, 286] ASCL2 is often referred to as MASH2 or HASH2 ( mammalia n or human achaete scute complex like protein 2, respectively ) HAND1 is known by several different names, including Hxt, eHAND, and Thing1 [288] ASCL2 and HAND1 are antagonists of one another and compete for E pr otein dimerization specifically E12 and E47 [275, 289, 290] Another class of HLH proteins is the ID class ( inhibitors of DNA binding ; ID1, ID2, ID3 and ID4). These proteins lack the basic DNA binding region and act as dominant negative regulators of E proteins and bHLHs b y forming inactive dimers that cannot bind DNA [282, 291, 292] Several bHLHs appear important for placental development in mice and humans. Of specia l note is the role that HAND1 may play in regulating trophoblast giant cell formation in mice [275, 276, 293] HAND1 transcripts are present in placental tissue as early as embryonic day 7.5 [294] and a n embryonic lethal phenotype is observed in HAND1 null mice at this time Th ese mice lack trophoblast giant cells [295, 296] Use of mouse and rat trophoblast stem ce ll lines has also provided insight into the role of HAND1 in trophoblast lineage segregation. Trophoblast stem (TS) cell lines have the ability to differentiate into one of four rodent trophoblast cell types, trophoblast giant cells, spongiotrophoblast, syncytiot rophoblast, and glycogen trophoblast [31, 297] Culturing mouse TS cells with FGF4 maintains a non differentiated, proliferative population of cells, but its removal results in trophoblast differentiation into trophoblast giant cells and syncytiotrophoblast cells [267, 298 300] HAND1 over e xpression is sufficient to override the FGF4 signal and induce trophoblast giant cell formation [301] Trophoblast stem cells generated from HAND1 null mutant mice have a reduced rate of

PAGE 47

47 trophoblast giant cell dif ferentiation when FGF 4 is removed. Also those trophoblast giant cells that did differentiate exhibited a decreased invasion rate when compared to trophoblast giant cells produced from normal trophoblast stem cells [302] In the rat trophoblast cell line, Rcho 1, over expression of HAND1 induces trophoblast giant cell formation [294, 303] In rodent species, regulation of HAND1 expression plays a key role in trophoblast lineage specification. Several factors positively and negatively regulate HAND1 in trophoblast differentiation. One such factor is Sox15 (Sry related HMG box 15). Sox15 is found predominately in trophoblast giant cells, and its over expression in Rcho 1 cells increased HAND1 expression and induced trophoblast giant cell formation [304] The expression of Hand1 is tightly regulated by intracellular molecular mechanisms. HICp40 (human inhibitor of myogenic factor [I mfa] dom ain containing protein) binds and sequesters HAND1 to the nucleolus [305308] HAND1 is activated when Plk4 (Polo like kinase 4) phosph o rylates HAND1 and releases it from HICp40 and the nucleolus [305308] R elease into the nucleoplasm allows HAND1 to bind DNA Following release, cells are observed exiting the cell cycle and undergoing trophoblast giant cell differentiation [305, 306] The r egulation of HAND1 activity is a highly coordinated process in rodent placentae, and several HAND1 antagonists play key ro les in regulating this factor and placenta development in mice. The HAND1 antagonist, ASCL2, also has a role in trophoblast cell differentiation. ASCL2 null mutants are embryonic lethal between 9.5 and 10.5 due to placental defects. In these mutants th e spongiotrophoblast layer of the placenta is absent and a greater number of trophoblast giant cells are present [309]

PAGE 48

48 ASCL2 also promotes spongiotrophoblast differentiation and proliferation in vitro [310] Trophoblast giant cell precursor cells are found in the spongiotrophoblast layer and their growth is promoted by ASCL2 [275, 311] Over expression of ASCL2 also inhibits trophoblast giant cell formation Additionally, expression is downregulated as trophoblast giant cell differentiation occurs [290, 294, 301, 312] Other bHLH factors also have a role in trophoblast cell differentiation in mice. I mfa ( inhibitor of myogenic factor ) blocks nuclear importation and DNA binding of several bHLHs [313] and I mfa null mice have a placental defect that is embryonic lethal on day 10.5 of gestation marked by reduced numbers of trophoblast giant cells [312] This factor inhibits ASCL2, thus promoting trophoblast giant cell differentiation in culture [299, 312] The bHLH factor, Stra13 (stimulated by retinoic acid 13) also regulates mouse and human trophoblast differentiation [314316] O verexpression in mouse TS cells induce s trophoblast giant cell formation similar to that observed for HAND1 [301] The dominant negative bHLH facto rs, specifically ID1 and ID 2 also play crucial roles in trophoblast differentiation [275, 317] These factors are down regulated during normal trophoblast differentiation in rodents [294] Also ID 1 over expression in Rcho 1 cells inhibits trophoblast giant cell differentiation [294] Many of the same bHLH factors likely also have a role in human trophoblast development HAND1 is present in various human cytotrophoblastic cell li nes, including Jar, Jeg 3 and BeWo [318320] The HAND1 antagonist, ASCL2, is localized to human cytotrophoblast progenitor cells [314] Stra13 regulat es human trophoblast differentiation and localizes to the human trophoblast epithelium [314, 315, 320] Also, I D 2 expression is increased in preeclampsia patients. ID 2 over expression in human

PAGE 49

49 cytotrophoblast cell s reduces cell invasion [321] These factors are down regulated during normal human trophoblast differentiation [294, 321] In cattle the expression of HAND1 and ASCL2 has been examined in normal and SCNT pregnancies HAND1 is present in the elongating bovine conceptus and in situ hybridization indicates that HAND1 localizes to BNCs [272, 294] HAND1 mRNA is also decreased i n SCNT placentae wit h decreased BNC numbers [21] ASCL2 may be involved negatively in BNC differentiation. It is present in day 8 blastoc y sts, day 17 conceptus, and day 40 and 60 cotyledonary tissue and was most abundant in the day 17 filamento us conceptus [322] Expression of A S C L2 expression is increased in SCNT placentae samples that contain decreased BNC numbers [21] To summarize these findings, several bHLH factors are required for normal trophoblast differentiation in rodents, and apparently these same factors play active roles in controlling placental development in humans. The little information available in ruminants suggests that some of these same factors may control BNC formation and function, although controlled studies have not been completed to support such conjecture. Endogenous Retroviruses Endogenous retroviruses have been implicated in trophoblast formation due to their presence in human and animal placenta tissues [74, 323329] In multiple species endogenous retroviruses play a role in placental cell fusion. In humans and mice, the formation of the syncytiotrophoblast cell layer occurs through trophoblast cell fusion. In mice, syncytiotrophoblast formation is regulated by the endogen ous retrovirus syncytin 1 [330, 331] Syncytin 1 is a member of the HERV W retroviral family It is an envelope protein [330, 332, 333] that binds to a sodium dependent ne utral amino acid transporter

PAGE 50

50 [334337] The over expression o f sy ncytin1 induces cell fusion and syncytium formation [338] Expression of synctin1 is controlled by the tr anscription factor GCM1 ( glia l cells missing homolog 1) [276, 330, 339] There are two binding sites for GCM1 located in the upstream 5 flanking region of the synctin 1 gene that control its expression [339] Over expression of GCM1 induces cell fusion in several trophoblast cell lines and this cell fusion event is linked to increased expression of synctin 1 [301, 340] GCM1 is loca lized to syncytiotrophoblast cells in rodents [341343] Mutant GCM1 mice are embryonic lethal by day 10 of gestation due to the absence of the placental labyrinth which is formed by syncytiotrophoblast cells [344] The role of syncytin1 and GCM1 is similar in human syncytiotrophoblast formation [330, 345] GCM1 induces syncytin1 expression and trophoblast cell fusion in the human trophoblast cell line, BeWo [340] These factors localize to the syncytiotrophoblast of human placenta [338, 342] The expression of GCM1 is decreased during preeclampsia in direct proportion to a decrease in syncytin 1 also seen during this placental disorder [332, 346] The decrease in GCM1 expression is due to degradation stimulated by preeclampsia associated hypoxia [345, 347] The degradation of GCM1 is caused by the suppression of the phosphatidylinositol 3kinase Akt signaling that activates GSK 3 synthase kinase 3 beta) [345] Activated GSK 3 box protein, FBW2 (F box and WD repeat domain containing 2). FBW2 protein marks GCM1 for ubiquitination and degradation [345, 348] This informat ion indicates that improper GCM1 levels can affect

PAGE 51

51 the expression the endogenous retrovirus syncytin 1 and trophoblast development resulting in placental insufficiencies. Endogenous retroviruses also play a role in placental differentiation and development in sheep [20, 176] In particular, a distinct retroviral envelope p rotein called endogenous Jaagsiekte sheep retroviruses (enJSRVs) appears vital for this activity. Several enJSRVs are abundant in the uterine epi thelial lining and the trophoblast cells of sheep throughout gestation [176, 349351] Uterine expression of enJSRVs is progesterone dependent [349] In the trophectoderm enJSRVs expression is te mporal and coincides with conceptus elongation and BNC formation [351] The cellular receptor for enJSRVs, hyaluronoglucosaminidase 2 (HYAL2), is detectable beginning at day 16 of gestation and is found exclusively in BNCs and syncytial plaques in the placentomes [351] Inhibition of enJSRVs in the uterus with morpholinos at day 8 of pregnancy in sheep hampered conceptus elongation and prevented BNC differentiation [20] T wo hypotheses for BNC formation in sheep exist. The first hypothesi s is that BNCs develop through endoreduplication followed by enJSRV mediated fusion between BNCs and uterine epithelium to create trinucleated or multinucleated synchtial cells The second hypothesis is that the enJSRVs induce both BNC and syncytial formation through fusion with HAND1 likely inducing endoreduplication events either immediately before or after this event [5, 333] While the importance of endogenous retroviruses has been established in sheep, t he sam e mechanisms have not been identified in other ruminant species. Cattle, for example, do not contain enJSRVs in their reproductive

PAGE 52

52 tract. Therefore, the role of endogenous retroviruses is not known in bovine trophoblast differentiation. Bone Morphogene tic Proteins A large family of paracrine factors that play a major role in trophoblast cell differentiation are the bone morphogenetic proteins (BMPs) [267] These factors are part of the super family of transforming growth factor factors that control various aspects of cell, tissue and organ development and differentiation in numerous species [352, 353] The BMPs are best known for regulating bone formation [354356] cardiovascular function [357] and various aspects of reproduction [358] BMPs signal through specific type I and type II s erine/threonine kinase receptor complexes. BMP ligand binds the type II receptor, this binding recruits the type I receptor. The type I receptor is then phosphorylated at specific serine and threonine sites by the type II receptor [359] Several intracellular signaling molecules are activated by this phosphorylation event ; most notably the Smads. In this pathway, the receptor regulated (R) Smad receptor proteins, specifically Smad 1, 5 and 8, are activated by phosphorylating two C terminal serine residues [352, 353] A ctivation allows R Smads to bind coSmad, or Sm ad4 and form a Smad complex. This complex then t ranslocates into the nucleus, binds DNA and activates target gene transcription [360] BMPs can also signal through t he mitogen activated protein kinase (MAPK) pathway [361] Multiple levels of negativ e regu lation for BMP signaling exist in cells. Several antagonists exist for BMPs, and one of central interest in reproduction is Noggin. Noggin binds BMP ligands and blocks the ligand BMP receptor binding site. Noggin is

PAGE 53

53 up regulated b y BMP 2, 4 and 6. U p r egulation of N oggin is part of a negative f eedback loop that prevents overstimulation [358, 362] Another avenue of regulating BMP activity is the inhibition of Smad signaling. Smad signaling is inhibited in part by the inhibitory (I) Smads 6 and 7. These Smads act as antagonists to the R Smads competing for association with the activated Type I receptor [353] I Smads also inhibit signaling by causing receptor degradation. Smad7 recruits ubiquitin ligases, Smurf1 and Smurf2, to form a complex at the activated receptor and induces degradation through proteasomal and lysosomal pathways [352, 353] Smurfs can also interact with R Smads and signal for their degradation via similar pathways [353] Overall the BMP signaling pathway is tightly regulated to prevent over activation which can lead to various pathologies, including cancer [363] The BMPs that are of particular interest when considering the paracrine regulation of placental development, differentiation and function are BMP 2 and 4. These factors are closely related TGF s that utilize similar receptors [362, 364] BMP2 and BMP4 also use the type I serine/theronine kinase receptor s, BMPR1A (ALK3) and BMPR1B (ALK 6) and type II serine/theronine kina se receptor, BMPR II [365, 366] BMP2 also use s the type II receptor, ACVR1 (ALK 2) [367] BMP4 is the more studied of these factors in regards to extra embryonic membrane development and trophoblast formation. In mice, BMP4 is involved in vascular development between the embryo and placenta [368, 369] It is also essential for mesoderm formation as indicated by the lack of this tissue layer in a majority of BMP4 knockout mice. Mesoderm formation occurs by day 6.5 in mouse. BMP4 knock out mice are embryonic lethal, however emb ryonic arrest occurs between a r ange of

PAGE 54

54 developmental days (day 6.5 and 9.5). Embryos that survive past day 6.5 develop mesoderm but arrest during other stages of gastrulation [364] Hypothetically, those embryos that arrest later in gestation likely were rescued by BMP2. BMP2 expression overlaps t hat of BMP4 [364] The hyp othesis that BMP2 a nd BMP4 expression overlaps is also supported by data showing the BMP 2 and 4 type II serine/theronine kinas e receptor, BMPR II, knockout mouse is embryonic lethal at day 6.5 due to lack of mesoderm formation [370] BMPs have also been implicated in controlling human trophoblast differentiation. Supplementation of BMP4 to human embryonic stem cells induces trophoblast formation in culture [371, 372] This differentiation event is also caused by BMP2 [371] BMP4 induces this differentiation event by increasing CDX2 expression through SMAD activation [373] In conclusion, BMPs mediate placental formation in mice and humans. However, l ittle is known about the expression and ro le of BMPs in bovine trophoblast development and function. Summary of Previous Literature For thousands of years we have known that the placenta is vital for fetal development and survival. Eutherian mammals possess a great diversity of chorioallantoic placentae. Mu ltiple placental classification systems have been developed and have helped to describe the evolu tion of the various placental types The ruminant has evolved a specialized synepitheliochorial placenta. Based on the predescribed phylogentic assessment of placental formation, this is a placental type derived from a common ancestor of the ungulates w ith an invasive type of placenta There are two placental cell types that comprise the ruminant placenta: MNCs and

PAGE 55

55 BNCs. The MNCs produce the maternal recognition of pregnancy hormone IFNT and function in placental nutrient and gas exchange. The BNCs fu nction in placental attachment and the formation of the fetal maternal syncytium. They also produce and secrete several hormones, including progesterone and CSH1, into the maternal environment. Studies of BNC function are difficult due to the lack of an i n vitro model system. The factors regulating trophoblast differentiation are not well understood in ruminants. Trophoblast differentiation has been studied extensively in the mouse and human. The trophoblast giant cell s in mouse and the extra villous cyt otrophoblast cell s in humans are analogous to BNCs in ruminants. In mice, bHLH transcription factors play essential roles in the formation of the trophoblast giant cell, most notably HAND1 and ASCL2 These factors also are linked to placental defects ass ociated with reduced BNC numbers in SCNT pregnancies. Another family of factors that cause trophoblast cell differentiation in mouse and humans is the BMPs, specifically 2 and 4. The role of these factors in ruminant trophoblast development is not known. The following chapters were aimed at testing the hypothesis that mechanisms controlling trophoblast differentiation, devel opment and function in cattle are similar to mechanisms utilized to generate invasive trophoblast lineages identi fied in humans an d mice. The first objective was to develop a method to isolate enriched populations of BNCs from mid gestation bovine placenta and study the function of these cells in culture. Floursence activated cell sorting (FACS) was used to isolate enriched populati ons of MNCs and BNCs. These cells were then evaluated for differences in gene expression and BNCs were studied in culture. The second objective was to

PAGE 56

56 identify expression differences of suspected trophoblast differentiation factors in MNCs and BNCs and d etermine if over expression of differentially expressed genes in a trophoblast cell line can induce BNC formation. The third objective was to eval uate the expression profile and function of bone morphogenetic proteins (BMPs) and their receptors during trop hoblast development and differentiation. The expression of BMP 2, 4, and receptors was found in day 17 bovine conceptus and endometrium and the function of BMP 2 and 4 on bovine trophectoderm was tested in the bovine trophectoderm cell line CT 1. Overall these objectives evaluated several potential mechanism controlling trophoblast development, differentiation and function.

PAGE 57

57 CHAPTER 3 THE ENRICHMENT AND C ULTURE OF BINUCLEATE D TROPHOBLAST FROM MID GESTATION BOVINE PLA CENTA USING FLUORESC ENCE ACTIVATED CEL L SORTING Introduction Placentae from cattle, sheep, deer and other members of the Ruminantia suborder are unique among mammals. Most ruminants have a cotyledonary placenta comprised of multiple maternal and fetal tissue contacts, termed placentomes, inst ead of the single, large area of contact seen in mammals with discoid placentae [154, 374] Ruminant placentomes are comprised of fetal cotyledons and maternal caruncles that become highly interdigitated as gesta tion progresses. Ruminant placentae are also classified as having a synepitheliochorial contact between fetal and maternal tissues. Placental cells invade into the uterine epithelium and form syncytial plaques that persist to varying degrees throughout gestation depending on the species [154, 374] The placental cell responsible for this invasion is the binucleate cell (BNC). This cell contains two di stinct nuclei. It also is called trophoblast giant cell becaus e of its large size when compare d to mononucleated trophoblast cells (MNCs) [70, 375] In cattle, BNCs are apparent by day 16 of gestation. By day 25 of gestation approximately 15 to 20% of the trophectoderm is comprised of BNCs. BNCs are present throughout gestation and begin reducing in number during the last few days preceding parturition [172, 374] BNCs serve as the primary endocrine cell in ruminant placentae. They produce a variety of hormones, notably estrogens such as estrone and estriol sulfate, progesterone, chorionic somatomammotropin 1 (CSH1; also known as placental lactogen) and various prolactin related proteins [156, 157, 196] BNCs also secrete

PAGE 58

58 numerous pregnancy associated glycoproteins (PAGs) These proteins comprise a large group of active and inactive aspartic proteases that are detected in maternal blood throughout gestation in cattle and other ruminants [227] Detec ting PAGs in serum or plasma is one method used to predict pregnancy status in various ruminants [229, 376] Nearly all of our current knowledge about BNCs has been achieved by observi ng them in situ BNCs are terminally differentiated and therefore do not proliferate after their collection. It has proven challenging to induce ruminant trophectoderm to differentiate into BNCs in vitro To date only one bovine cell line, termed the BT1 cell, is able to form BNCs, and these cells likely represent a nave, immature form of BNCs [240, 261] Others have harvested BNCs from bovine and ovine placentae to complete short term in vitro studies by using density gradient centrifugation to purify BNCs [1 87, 191, 260, 263] Work presented in this report describes the us e of fluorescence activated cell sorting (FACS) to isolate BNCs after enzymatic digestion of midgestation bovine cotyledons. The hyperploidic nature of BNCs [175] was used in combination with a membranepermeable fluorescent DNA dye to permit highspeed sortin g of BNCs from diploid cells [377] The overall aims of this work were to examine the efficiency of BNC enrichment with FACS and exa mine the limits of using these cells after their collection. Materials and Methods Tissue Collection Pregnant bovine uteri were collected from a nearby abattoir ( Central Beef Industries L.L.C.; Center Hill, F L ) and transported to the laboratory on ice. Reproductive tracts were dissected, fetuses were excised and crown rump length was used to estimate the stage of gestation ( mean = 135.3 2.67 days of gestation; range =

PAGE 59

59 118 to 159 days). For each placenta (n=20), c otyledons (n= 5 6 /placenta) were separat ed from caruncles and dissected away from intercotyledonary tissues. Tissue was diced into 56 mm sections and incubated in DMEM with high glucose (4.5 g/l D glucose) ( Invitrogen Corp. Carlsbad, CA ) containing 25 units/ml Dispase (BD Biosciences, Bedford, MA ), 0.625 mg/ml Pancreatin (Invitrogen Corp.), 10% [v/v] f etal b ovine serum (FBS ; Invitrogen Corp. ) and 10 mM HEPES ( Invitrogen Corp. ) at 37C for 1 h under constant rotation. Following digestion homogenates were filtered through a 200 m mesh and ce ntrifuged (300 x g; 10 minutes at room temperature). In preliminary studies, cells were resuspended in 3 M Propidium iodide in buffer (100 mM Tris, pH 7.4, 150 mM NaCl, 1 mM MgCl2, 0.1% [v/v] Nonidet P 40) and incubated at room temperature for 15 minutes Following incubation cells were centrifuged (300 x g; 10 minutes at room temperature), resuspended in buffer, plated on glass slides, and viewed by epifluorescence microscopy. For FACS studies, cells were resuspended in Dulbeccos phosphatebuffered saline (DPBS; Invitrogen Corp. ) containing 5% FBS and 10 M Vybrant Dye Cycle Green (Invitrogen) and incubated at 37C for 30 minutes in the dark. Samples were transported at 37C to the University of Florida Interdisciplinary Center for Biotechnology Res earch Flow Cytometry laboratory (UF ICBR; Gainesville, FL). FACS Homogenates were sorted using a BD FACSAria cell sorting system (BD Biosciences) and FACS Diva software version 6.2.1 (BD Biosciences) A 100 mW laser emitting 488 nM light was used for ex citation Thresholds were set at 20,000 on forward light scatter and 5000 on green fluorescence (530 +/ 15 nM) to eliminate excessive cell debris. A gate was set on a forward light scatter and green fluorescence plot to further

PAGE 60

60 assist in debris removal. A green fluorescence histogram was plotted. The photomultiplier voltage was adjusted to maintain the diploid peak to 50 on a linear scale of 0 to 255. Once the diploid peak was established cells were collected. MNC enriched samples were collected by harvesting cells that fluoresced at the diploid peak. BNC enriched samples were harvested in the fluorescence range 2to 4 times greater than that of the diploid peak. Cell aggregates were avoided by eliminating sample with fluorescence more than 4 time s that of the diploid peak. Approximately two million BNCs and six million MNCs were usually collected in a three hour time period. All cells were collected into a collect ion medium ( DMEM with high glucose containing 10% FBS and 10 mM HEPES ) Following FACS, cells were centrifuged (300 x g; 10 minutes at room temp) to remove FACS sheath fluid and resuspended in collection medium Immunostaining Tissue homogenates collected before sorting ( nonsorted samples) and post sorted samples were fixed in 4% [w/ v] paraformald e hyde (Polysciences Inc, Warrington, PA, USA) for 15 m in at room temperature. Cells were permeabilized and blocked in 0 .5% [v/v] Triton X 100 (ThermoFisher Scientific Inc., Fairlawn, NJ) and 1% [w/v/] bovine serum albumin ( BSA ; Thermo Fishe r Scientific) for 20 min at room temperature. Cells were incubated in rabbit antiserum generated against ovine CSH1 (generously provided by Dr. Russ ell Anthony ; Colorado State University; 1:1000 Dilution) After washing, cells were incubated in Alexa Flu or 5 94 goat anti rabbit IgG (Invitrogen Corp. ) for one hour, washed again and, mounted onto glass slides using ProLong Gold antifade reagent (Invitrogen Corp.) and viewed under phasecontrast and epifluorescence microscop y to determine the proportion of cells that were BNCs (cells containing two nuclei in one plasma membrane) and that were CSH1 positive

PAGE 61

61 respectively. Four individual slides were examined for each placental preparation, and four independent fields were counted per slide (approximately 125200 cells/field). BNC Cell Culture FACS enriched BNCs were centrifuged (300 x g; 10 min, room temp erature ) and reconstituted in DMEM with high glucose containing 10% fetal bovine serum and other supplements ( 100 M non essential amino acids, 2 mM glutamin e, 2mM sodium pyruvate, 55 mercaptoethanol, 100 U/ml penicillin G, 100 g/ml streptomycin sulfate, and 250 ng/ml amphoterin B; each from Invitrogen Corp.). Approximately 50,000 cells were seeded on to LabTek II 8 well chamber slides (0. 7cm2/well) (Th ermo Fisher Scientific). Wells either were treated with Matrigel Basement Membrane Matrix (BD Biosciences, San Jose, CA) or no coating was added (plastic only) in 400 l medium. Matrigel coating was completed using a 1:3 dilution of Matrigel in DMEM fo llowing manufacturer instructions. Two replicate Matrigel coated and non coated wells were inc luded in each study (n=4 placentae). After 3.5 days at 38.5C in 5% CO2 in air, medium was removed and cells were fixed in 4% [v/v] paraformaldehyde for 15 minutes. Cells were immunostained for CSH1 reactivity as described previously and stained with 8 .1 M Hoechst 33342 (Invitrogen Corp.). Cells were viewed under phase contrast and epifluorescence microscop y to determine total cell number and number of BNCs a nd CSH1 positive cells (5 fields/well; ~50 cells/well). Percentages of CSH1positive cells and BNCs in FASC preparations before culture served as a control in the analysis. Quantitative (q) RT PCR In some studies, total cellular (tc) RNA was extracted from cells immediately after FACS. TRIzol (Invitrogen Corp.) was added to MNC and BNC enriched populations

PAGE 62

62 after centrifugation to remove residual medium and tcRNA was e xtracted using the PureLink Total RNA Purification System (Invitrogen Corp. ). In the culture studies (n=4 placentae), tcRNA was extracted using the PicoPure RNA Isolation Kit (MDS Analytical Technologies, Sunnyvale, CA). qRT PCR was completed in both sample sets as described previously [147] to determine the relative abundance of CDX2 CSH1 PAG1 CYP19 and 18S mRNA Samples w ere incubated with RNasefree DN ase (New Eng land Biolabs, Ipswic h, MA) before reverse transcription using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems Inc. Foster City, CA). Primers (200 nM) specific for CDX2 CSH1 PAG1 Cyp19 and 18S (internal control) (Table 1) were used in combination with a SYBR Green Detector System (Applied Biosystems Inc.) and a 7300 Real Time PCR System (Applied Biosystems Inc.) to quantify target gene abundance. Following an initial activation/denaturation step (50C for 2 min; 95C for 10 min), 40 cycles of a twostep amplification procedure (60C for 1 min; 95C for 15 s) were completed. A dissociation curve analysis (60 95C) was used to verify the amplification of a single product. Primer efficiencies were tested on RNA collected from cotyledonary samples by using the relative standard curve approach [146] Each sample was completed in triplicate reactions. A fo u rth reac tion lacking reverse transcriptase was included to control for genomic DNA contamination. Nonprocessed, whole cotyledonary tissue was used as a control. In most studies, the comparative threshold cycle (CT) method was used to quantify mRNA abundance [146] Briefly, the average T value for each sample was calculated (gene of interest CT CT for 18S ) and used to calculate the fold changes in relative

PAGE 63

63 abundance of each transcript. For one study (BNC culture study), the abundance of 18S RNA differed over time relative to that of total RNA concentrations. Since the same amount of starting tcRNA was used for this study, raw CT values were inverted by solving the equation, 40CT, to examine differences in mRNA abundance. The value 40 represents the total number of PCR cycles completed. Statistical Analysis All analyses were completed by analysis of variance using the General Linear M odel s Procedure of the Statistical Analysis System (SAS Institute, Cary, NC). When analyzing qRT PCR data, the T values or raw CT values were used for analyses [146, 147] Either T values were transformed to fold differences or raw CT values were inverted (40CT) for illustration on graphs. Results are presented as arithmetic means SEM. Results BNC Enrichment Using FACS A series of pilot studies were completed to identify an optimal strategy for dissociatin g cotyledonary tissue. Two enzymatic approaches, t rypsin and Dispase/Pancreatin, were examined along with a mechanical disruption technique described previously [191, 260] After each dissociation procedure, placental cells were stained with propidium i o dide (Invitrogen Corp.) to identify BNCs and determine cell viability, respectively. Overall viability of placental cells was markedly greater after cotyledons were digested enzymatically (>95% propidium iodide exclusion rates) than in placental cells obtained by mechan ical disruption (~10% propidium iodide exclusion rate). Although digestion with 500 g/ml trypsin proved effective at maintaining cell viability, it yielded substantially more cell clumps when compared to cotyledons

PAGE 64

64 dissociated with Dispase/Pancreatin (da ta not shown). Based on these observations, Dispase/Pancreatin was used in the remaining studies. Placental homogenates were sorted via FACS to determine the relative purity of BNCs in the hyperploidic cell population. A consistent diploid peak was observed in placental homogenates. A broad range in hyperploidic cells was evident in most samples, although defined hyperploidic peak(s) could not be detected in most samples (f ig. 3 1A & B). To determine whether these hyperploidic cells were indeed BNCs FACS was completed on placental homogenates (n=5 samples) and cells fluorescing with 2 to 4 times the intensity of those within the diploid peak were collected and analyzed. Under phasecontrast microscopy, substantially more (P=0.0001) BNCs presided i n the hyperploidic sample than were evident before sorting began (f ig. 32). Immunofluorescence was completed to verify that the binucleated cells identified in these sorted samples also produced CSH1, a BNC specific product. A greater (P=0.0002) proport ion of CSH1positive cells existed in the FACS sorted preparation than in the cotyledonary samples before sorting (f ig. 3 2). The purity of these BNC enriched populations ranged from 6570% (fig. 32). Attempts to improve BNC purity via FACS beyond what was achieved were not successful. Selecting cells greater than 4times the intensity of those found in the diploid peak yielded fewer BNCs. In fact, most of these cells represented clumps of MNCs. Utilizing more narrow ranges of green fluorescence inten sity (e.g. 2 3, 3 4 times that of the diploid peak) yielded similar BNC purities when compared with that of selecting cells that were 2 to 4 times the intensity of cells found at the diploid peak (data not shown). It also was difficult to collect ample B NC numbers when using

PAGE 65

65 smaller gates. Broadening the sorting gate to 2 to 4 times the intensity of the diploid peak usually permitted collection of two million cells over three hours, although this sometimes varied substantially. Occasionally it took substantially less time to sort these cells (e.g. two million in one and one half hours) and on other occasions cell sorted proceeded so slowly that sorting had to be terminated before ample cells were sorted. In most instances (85% of the time), however, FA CS proceeded with repeatable timing and outcomes. To determine if MNC enriched samples also could be collected with FACS, placental homogenates (n=5) were subjected to FACS and cells with fluorescence intensities at the diploid peak and at 2to 4 tim es greater than the peak were separated and analyzed (f ig. 33). Cells with DNA content similar to that of the diploid peak (presumptive MNCs) contained fewer (P<0.01) BNCs than the presorted preparations whereas the hyperploidic cells (BNC enriched samples) contained substantially more (P<0. 01) BNCs (f ig 33A). Differences in the relative abundance of selected transcripts also were evident in the MNC and BNC enriched samples. Relative abundances of CSH1 and PAG1 two BNC specific transcripts [224, 378] were greater (P<0.05) in BNC enriched samples than in the MNC samples (f ig. 3 3B). Concentrations of CDX2 mRNA, a transcription factor involved with trophectoderm lineage specification and placental gene express ion [42] were decreased (P=0.03) in BNCs versus MNCs. BNC Culture FACS sorted BNCs were incubated on selective substrata to determine if they would maintain their morphology and gene expression profile following cu lture. BNCs could be visualized after 3.5 days in culture when grown on either Matrigel or no coating (f ig. 3 4A). Matrigel coating was better able to maintain BNC numbers during

PAGE 66

66 culture Total numbers of cells, number of BNCs, and number of CSH1posit ive cells in each field were greater (P<0.01) after 3.5 days on M atrigel than on plastic only (f ig. 4B). The percentage of total bound cells that were BNCs were greater (P<0.01) on the Matrigel coated than noncoated wells (75.72.5% vs. 58.73.9%, respectively). Also, a greater (P<0.01) proportion of the BNCs on Matrigel coated wells stained positive for CSH1 than those on noncoated wells (91.92.2% vs. 51.07.3%, respectively). Although the BNCs remained reactive to CSH1 antisera after 3.5 days in cul ture, marked changes in BNC specific gene expression were observed after culture. Lower (P<0.05) mRNA abundances were evident for CDX2 CSH1 PAG1 and CYP19 after 3.5 day of culture than before culture (f ig. 35). CDX2 mRNA levels were barely detectable after culture. The presence of Matrigel did not affect gene expression profiles compared with non coated wells. Abundance of 18S RNA also was decreased (P<0.002) after culture, and because of this, CT values were not normalized to this factor. Discussi on Work described here shows that FACS can be used for selecting BNCs from bovine cotyledonary homogenates. Yields of 12 million BNCs could be isolated within 3 h at 70 85% purity when using Vybrant Dye Cycle Green nuclear stain as the indicator. Several placental dissociation methods were tested in preliminary work, and using a Dispase/Pancreatin dissociation approach described for dissociating ovine endometrium [379] proved most effective at dissociating placental tissue into single cells without negatively affecting viability. Different gating strategies also were examined to improve the purity of BNC preparations. Reducing the size of the range in dye intensity

PAGE 67

67 for gating cel ls did not improve the proportions of BNCs isolated and the speed at which BNCs could be collected was notably reduced. Devising strategies to further improve the purity of BNCs through FACS could n ot be conceived by using the fluorescent DNA dye. The most prominent cell contaminant in BNC enriched samples was non digested clusters of diploid cells. These clusters likely represented MNCs or maternal endometrial cells. It is nearly impossible to completely separate maternal caruncles and fetal cotyledons in mid gestation bovine placentae because of the extensive interdigitation of fetal and maternal tissues. Further gains in selecting BNCs over other cells in placental homogenates likely will require the use something other than DNA staining as the FACS indicator. Of particular interest would be to identify a cell surface marker that can be used to discriminate BNCs from other cells. Such markers have not been identified to the best of our knowledge. FACS also could be used to purify diploidic cells. In general, these gated samples consistently contained only 5 8% BNCs. These diploid cells were termed MNCs ( i.e. diploid trophoblast ) in the results, although these samples likely also contained some endometrial cells. Current studies were not aimed at purifying placental MNCs away from endometrial cells and other diploid cells. T he proportion of maternal cells in diploid samples was not determined but RNA extracted from these samples contained ample amounts of CDX2 mRNA, a trophectoderm marker [380, 381] indicating that a fair portion, and likely a majority, of the diploid cells collected were placental MNCs. Good quality tcRNA also could be extracted from FACS sorted MNCs and BNCs. One trophectoderm gen e ( CDX2 ) and two BNC specific genes ( CSH1 and PAG1 ) were

PAGE 68

68 examined to further describe the efficiency of cell sorting. Not surprising, CSH1 and PAG1 mRNA were abundant in BNC enriched samples. Placental lactogen, the protein product of CSH1, is produced p redominately by BNCs in ruminants [194, 196] PAG1, or PSPB (pregnancy specific protein B), is produced in BNCs and represents one of the predominant, if not the most abundant PAGs in the maternal bloodstream throughout most of pregnancy in cattle [224, 227, 229, 376] CDX2 encodes a transcription factor that regulates placental gene expression and trophectoderm lineage specification [380, 381] Its expression was different between the MNC and BNC samples, with a reduction in CDX2 mRNA concentrations existed in the BNC samples. It also was possible to culture BNCs isolated by FACS. Previous reports of BNC culture exists [191, 260, 261] Coating plastic plat es with collagen proved useful in maximizing BNC attachment in two studies [191, 261] However, another report found that BNCs can be cultured for extended periods of time without a collagen substratum [260] Our general observations were that most BNCs attached within 48 h in culture in Matrigel coated plates whereas from 60 to 72 h was required for BNCs to attach to well with no matrix (data not shown). Collagenonly matrixes were not tested here. After 3.5 days in culture, BNCs appear ed normal morphologically regardless of whether they were cultured on Matrigel or plastic only. However, markedly more BNCs were attached to Matrigel coated wells than cultures lacking this matrix. Moreover, more of the BNCs attached to Matrigel containe d measurable amounts of immunoreactive CSH1 protein over those BNCs found on plastic (see Fig. 4). Based on these observations, Matrigel was a more suitable matrix for BNC culture than using no matrix The pr imary component of Matrigel is laminin, a centr al component of basement membranes [382]

PAGE 69

69 It also contains trace amounts of several growth factors, including transforming growth factor like growth factor 1. Further research is needed to determine if these or potentially other molecules promotes BNC attachment and survival in vitro. Marked changes in gene expression profiles were noted after the 3.5 day culture. Reductions in abundance for each transcript investigated were evident. A previous report observed decreases in the expression of CYP19 the gene encoding aromatase, followi ng BNC culture [191] Other genes encoding steroidogenic enzymes also were modified in that report. For example, CYP17 mRNA abundance increased with progressive culture whereas 3BHSD expression increased during the first 3 days of culture and decreased thereafter. The prese nt work also observed marked decreases in CSH1 and PAG1 mRNA concentrations and nearly the complete absence of CDX2 mRNA after 3.5 days in culture. Reductions in CSH1 mRNA concentrations also were evident in another BNC culture study [191] Based on these observations, BNCs appeared to be losing their ability to express genes normally associated with their activity in vivo In summary, this work describes a new method for selecting BNCs from bovine placental homogenates. BNC purities ranged from 70 to 85% when using FACS. These sorted cells maintain their viability for several days after collection. Sufficient RNA could be extracted from these cells. Also, the BNC enriched samples could be cultured for several days. Providing Matrigel improved the speed and efficiency of BNC attachment and may have delayed the rate at which these cells lost their ability to produce CSH1. However, neither culture method proved successful at preventing

PAGE 70

70 BNCs from losing their ability to express several BNC specific genes. The nearly comp lete loss in CDX2 expression suggests that these cells are losing key trophectoderm specifying molecules These observations indicate that BNC cultures likely do not adequately represent trophectoderm and certainly do not appear to represent BNCs after a short time in culture.

PAGE 71

71 Table 3 1. Trophectoderm marker primers used for qRT PCR. Gene of Interest GeneID# Primer Sequence (5' 3') CDX2 618679 Forward Reverse GCCACCATGTACGTGAGCTA GACTACGGCGGATACCATGT CSH2 281097 Forward Reverse CATCCTGGGATTTCTCTCCA AAAACCAACCTGGCAACTG PAG1 281964 Forward Reverse TGTACACATGGACCGCATCT ACAACTACCCAGTGCCAGG CYP19A1 281740 Forward Reverse TCTCGAAAGCTGTTCGACCT GACTTGGGCTATGTGGACGT 18S a 493779 Forward Reverse GCCTGAGAAACGGCTACCAC CACCAGACTTGCCCTCCAAT a [23]

PAGE 72

72 Figure 31 Representative FACS plots of a bovine placenta homogenate. Placenta homogenates were incubated in Vybrant DyeCycle Green dye and subjected to FACS. Panel A) Scatter plot of cell densities (forward scatter; Y axis) and DNA intensity (x axis) for one sa mple. The boxed region contains cells with >20,000 forward scatter eliminating small debris particles from the collection sample. B) Distribution of DNA Fluorescence activity (x Axis) in placental homogenates. The quadrants used to sort for MNC and BNC enriched populations are indicated.

PAGE 73

73 Figure 32. Enrichment of BNCs after FACS. Panels A & B) The incidence of CSH1positive cell staining before (A) and after (B) FACS. CSH1reactive cells are indicated in red and DNA staining is represented in gr een (Vybrant dye staining). Panel C) The proportion of CSH1positive and BNCs in samples before and after FACS for cells with DNA contents 2 4 times greater than that of the diploid peak identified in samples (n=5 placentae). The a sterisk indicates dif ferences in percentages of BNC (P=0.0001) and CSH1positive cells (P=0.0002) before and after FACS.

PAGE 74

74 Figure 33. Percentage MNC and BNC populations after FACS and gene expression profiles for each. FACS was completed on bovine placental homogenates (n=5 8 placentae) and MNC and BNC fractions were collected. Panel A) The percentage of BNC s and MNCs represented in each sorted group. The presence of 2nuclei was used to distinguish BNCs from MNCs. Different subscripts represent differences between cel l populations (P<0.05) Panel B) Expression profiles for candidate genes in MNC and BNC enriched samples. qRT PCR was completed to determine the relative abundances of CDX2 CSH1 and PAG1 mRNA Abundance of 18s RNA was used to normalize values. The a sterisks represent differences (P<0.05) in mRNA abundance between MNC and BNC samples.

PAGE 75

75 Figure 34 Outcomes of culturing BNC enriched populations for 3.5 days. FACS sorted BNCs were cultured in wells coated in Matrigel or no matrix. After 3.5 da ys at 38.5C in 5% CO2 in air, attached cells were examined for the presence of CSH1 via immunostaining Hoechst staining of DNA also was completed (n=4 placental homogenates). A) Representative bright field image of cultured cells (400 fold magnification). B) Number of attached cells after 3.5 days in culture. Asterisks indicates differences between plastic and Matrigel coated surfaces (P<0.05). Figure 35 Gene expression profiles for BNCs after 3.5 day culture. TcRNA was extracted from BNCs on ei ther Matrigel or no coating after 3.5 days in culture (n=4 replicate studies ). TcRNA extracted from samples before culture also were included in the analysis. qRT PCR was completed. 18S mRNA concentrations differed between samples collected before and after culture, so raw CT values were analyzed and are graphs after inversion (40CT). The same tcRNA concentration was used in qRT PCR for each sample. Different subscripts represent differences between cell populations (P<0.005)

PAGE 76

76 CHAPTER 4 EXPRESSION OF SEVERAL PUTATIVE TROPHOBLAST DIFFER EN TIATION FACTORS IN BOVINE MO NONUCLEATE AND BINUC LEATE CELLS Introduction Ruminant trophoblast binucleate cells (B NCs) share several common features with trophoblast giant cells in rodents and extravillous cytotroph oblast cells in humans [61, 280] One class of transcriptional regulators that play a predominant role in the formation of trophoblast giant cells and extravillous cytotrophoblast cells are selected basic helix loop helix (bHLH) factors [31, 275, 320] Numerous bHLH factors regulate trophoblast dif ferentiation in the mouse and appear to function in similar ways in the human placenta. The role of HAND1 in trophoblast giant cell formation has been studied extensively. In the mouse, HAND1 knockouts are placental lethal due to a lack of trophoblast gi ant cell formation [295, 296] HAND1 induces trophoblast giant cell formation in mouse and rat trophoblast stem cells [294, 301] In the human, HAND1 impacts tro phoblast cell differentiation [318, 320] In cattle, HAND1 localizes to BNCs [272] A large portion of b ovine somatic cell nuclear transfer (SCNT) pregnancies fail to reach term, and a reduction of HAND1 mRNA expression and decreased BNC numbers is evident in these placentae [21] The natural antagonist of HAND1, ASCL2, negatively impacts trophoblast giant cell formation [275, 294, 309] ASCL2 and HAND1 compete for the same E protein binding partners and E box binding sites Over expression of ASCL2 in rodent trophoblast stem cells inhibits the formation of trophoblast giant cells [301] In bovine SCNT pregnancies with reduced BNC numbers, ASCL2 expression is increased [21, 120]

PAGE 77

77 Other bHLHs of interest include inhibitor of MyoD family form a (I mfa ) and stimulated by retinoic acid 13 (Stra13). Both factors induce trophoblast giant cell formation when over expressed in rodent trophoblast cell lines [301, 312, 316] The dominant negative regulators, ID1 and ID2, also play a role in placental differentiation [320] ID2 specifically is reduced in human placental disease preeclampsia indicating for this factor in trophoblast differentiation and migration [321] BNCs also share similarities with syncytiotrophoblast cells Both of these cell types fuse to form syncytium. The HLH factor, glial cell missing homologue 1 (GCM1), plays a role in placental cell fusion in human and mouse [301, 340, 383] GCM1 induces syncytiotrophoblast formation by regulat ing the endogenous retrovirus, syncy tin 1 [276] This factor is also down regulated in women with preeclampsia [346] Over expression of GCM1 in trophoblast stem cells induces cell fusion and in creases syncytin 1 expression [340] Since BNCs are potentially analogous to trophoblast giant cells and extravillous cytotrophoblast cells, we hypothesize that many of the same differentiation factors regulating their formation also may control BNC formation. The objectives of this study were to characterize the expression of these factors in MNC and BNC isolated samples and determine if over expression of differentially expressed factors induce bovin e BNC formation in vitro Methods Tissue Collection Tissue and placenta homogenates were collected as described in the previous chapter. Fetuses crown rump length estimated the stage of gestation to be mean = 135.8 3.6 days; range = 118159 days Fo r each placenta (n=12 in all), c otyledons

PAGE 78

78 (n= 5 6 /placenta) were separated from caruncles and dissected away from intercotyledonary tissues. Whole cotyledonary tissue was collected and snap frozen in liquid nitrogen for future use. End Point RTPCR The P ureLink Micro to Midi Total RNA Purification System with Trizol (Invitrogen Corp.) was used to extract tcRNA from whole cotyledonary tissue (n=4 animals) following manufactures guidelines tcRNA (10 250 ng) w as incubated in RNase free DN ase (New England B iolabs, Ipswich, MA) for 30 minutes at 37C and heat inactivated for 10 min at 75C prior to reverse transcription (RT). The SuperScript III First Strand Sythesis System Kit (Invitrogen Corp.) and random hexemers were used for RT of tcRNA. Non reverse transcribed Dnasetreated RNA was used as a negative control. Gene specific primer sets were used to amplify products for possible BNC differentiation factors (see Table 4 actin (ACTB) was included as a positive control. PCR amplifi cation was performed using ThermalAce DNA Polymerase (Invitrogen Corp.). A total of 35 cycles of denaturation (95C for 15 sec ), annealing (5559C for 1 min, depending on primer set) and DNA synthesis (72C for 1 min) were completed and were followed by a DNA polishing stage (72C for 10 min). PCR products were electrophoresed ( 1% (w/v) agarose gel contain in g ethidium bromide (100ng/ml) and v isualized on an ultraviolet light box. PCR products with a single amplicon at the appropriate size were PCR purif ied using the PureLink Quick Gel Extraction and PCR Purification Combo Kit (Invitrogen Corp.) and submitted for DNA sequenc ing using gene specific primer sets at the University of Florida DNA Core Facility.

PAGE 79

79 Quantitative (q), Real T ime RT PCR tcRNA was e xtracted from FACS sorted MNC and BNC samples (n=8 preparations ) and incubated with RNasefree Dnase (New England Biolabs) as described above. T he High Capacity cDNA Archive Kit (Applied Biosystems Inc.) w as used for RT Following RT, Primers (200 nM) specific for HAND1, GCM1, Stra13, ID1, ID2 and 18S (internal control) (Table 41) were used in combination with a SYBR Green Detector System (Applied Biosystems Inc.) and a 7300 Real Time PCR System (Applied Biosystems Inc.) to quantify target gene abundan ce. Following an initial activation/denaturation step (50C for 2 min; 95C for 10 min), 40 cycles of a twostep amplification procedure (60C for 1 min; 95C for 15 s) were completed. A dissociation curve analysis (60 95C) was used to verify the amplif ication of a single product. Primer efficiencies ranged from 90 to 107% when tested on RNA collected from cotyledonary samples by using the relative standard curve approach [146] Each sample was completed in triplicate reactions. A forth reaction lacking reverse transcriptase was included to control for genomic DNA contamination. Non processed, whole cotyledonary tissue was used as a control. Cell Culture The ovine trophectoderm cell line (oTr) was generously provided by Dr. Thomas Spencer (Texas A&M University, College Station, TX) and cultured as previously described [104, 151] Briefly, cells were cultured in Dulbecco modified Eagle medium with F 12 salts (DMEMF12; Invitrogen Corp.) with supplements (10% FBS, 700 nM insulin, 0.1 mM nonessential amino acids, 100 U penicillin, 100 g streptomycin, and 0.25 g/ml amphotericin B; Invitrogen Corp.). Cultures were maintained at 5% CO2 in air at 37 C.

PAGE 80

80 Hand1 Over E xpression The oTr cells were seeded into 12well plates. At 50% confluency, cells were transfected using Lipofectamine 2000 (Invitrogen Corp.) following the manufacturers instructi ons. Expression plasmids for HAND1 (pCMV Express 1; ThermoFisher Scientific) and Gal (pCMV Sport; negative control; Invitrogen Corp.) were cotransfected with GFP (pCMV PCS2) reporter plasmid. Transfection efficiency averaged 10% (see Fig 44G). Cell s were examined at 3 and 6 days post transfection for changes in cell morphology Western blotting and immunoh istochemistry were also preformed for HAND1 and CSH1. The activity of over expressed HAND1 was assessed using a dual luc iferase reporter assay Hand1 plasmid was co tra nsfected with the E box promoter plasmid, 4Rtk luc ( generously pro vided by Dr. Sally Johnson) and a Renilla report control (pRL TK) plasmid. Cells were cultured for 36 h following transfection and then submitted to the Dual Lucife rase Reporter Assay System (Promega, Madison, WI) following manufactures guidelines. Western Blotting Samples were washed twice in cold PBS and incubated in RIPA buffer (Thermo Scientific) containing Halt protease inhibitor and Halt phosphatase inhibitor cocktails (Thermo Scientific) and incubated on ice for 15 minutes with constant agitation. Samples were sonicated and centrifuged (14,000 g for 15 minutes) and supernatants were harvested and stored at 20C. Protein concentrations were determined using the BCA Protein Assay (Pierce/Thermo Scientific, Rockford, IL). Samples (20 g) were boiled on ice for 5 minutes with 10% n on reducing lane marker solution (Thermo Scientific) containing

PAGE 81

81 m ercaptoethanol (Fisher Scientific, Pittsburgh, PA) then placed on ice. Samples were loaded into 12.5% poly a crylamide gels and electrophoresed Proteins were transferre d onto ImmobilonP PDVF membrane ( Millipore, Jaffery, NH ) using a Hoefer SemiPhor Semi dry transfer unit (Amersham Biosciences/ GE Healthcare, Pi scataway, NJ ) at 1 mAMP/cm2 of membrane and constant voltage (500 V) for 1 h. Membranes were then dried and then blocked in 5% [w/v] nonfat dry milk (NFDM) for 1 h at room temperature. Samples were incubated in a 1:2500 dilution of r abbit anti HAND1 (Ab cam Inc., Cambridge, MA) or 1:5000 dilution of m ouse anti GCM1 (Abcam Inc.) in 3% [w/v] bovine serum albumi n (BSA; Fisher Scientific) over night at 4C. Membranes were washed in TBST and incubated in a 1:5000 dilution of either anti r abbit or anti m ouse co njugated HRP secondary antibody (Cell Signaling) depending on primary antibody, in 5% NFDM for 1 h at r oom temperature. Blots were developed using the Amersham ECL Plus Western Blotting Detection Reagents (GE Healthcare). Following developing, membranes were placed in stripping buffer (100 Mercaptoethanol, 2% [w/v] SDS, 62.5 mM Tris HCl pH 6.7) for 30 min at 50C and reused for rabbit anti alpha tubulin detection (loading control; 1:5000 Cell Signaling, Danvers, MA ). Immunocytochemistry Transfected oTr cells were fixed in 4% [w/v] paraformald e hyde (Polysciences Inc, Warrington, PA) for 15 m in at room temperature following 3 a nd 6 days of culture. Cells were permeabilized and blocked in 0.5% [v/v] Triton X 100 (ThermoFisher Scientific) and 1% [w/v/] BSA ( Thermo Fisher Scientific) for 20 min at room temperature. Cells were incubated in primary antibody, either a r abbit anti C SH1 (generously provided by Dr. Russ ell Anthony ; Colorado State U niversity; 1:1000 Dilution) or r abbit anti HAND1 (1:500 dilution) overnight at 4 C C ells were then washed in PBS and then incubated in

PAGE 82

82 Alexa Fluor 5 94 goat anti rabbit IgG (Invitrogen Corp ) with 8.1 M Hoechst 33342 (Invitrogen Corp.) nuclear counterstain. In some studies, F actin filaments were stained using Texas Red X phalloidin (Invitrogen Corp.) according to manufacturers guidelines with Hoechst 33342 nuclear counter stain. Statis tical Analysis All analyses were completed by analysis of variance using the General Linear M odel Procedure of the Statistical Analysis System (SAS Institute, Cary, NC). When analyzing qRT PCR data, the T values were used for analyses [146, 147] T values were transformed to fold differences for illustration on graphs. Results are presented as arithmetic means SEM. Results Expression Pattern of Potential BNC Differentiation Regulators The first experiment ex amined the expression of several transcription factors in bovine trophoblast cells that are li n ked with placental development and differentiation in humans and mice. When using end point RT PCR, transcripts for HAND1, GCM1, ASCL2, I mfa Stra13, ID1 and I D2 were detected in midgestation bovine placentae (figure 4 1). The relative abundance of some of these factors was examined by using qRT PCR. Specifically, differential expression between MNC and BNC populations were examined after FACS. Expression of GCM1 Stra13, ID1 and ID2 was not different between MNC and BNC populations (figure 42). However, HAND1 mRNA abundance was greater (P=0.02) in BNC than in MNC preparations (figure 42). The protein expression pattern was also analyzed for HAND1 and GCM1. GCM1 protein was not differentially expressed between MNC and BNC samples (Fig 43). Conversely, HAND1 protein was more abundant in BNC samples versus MNC samples.

PAGE 83

83 To date fully functional BNCs do not differentiate in ruminant trophectoderm cell l ines, including the bovine trophectoderm cell line, CT1, and the ov ine trophectoderm cell line, oTr There for the abundance of these factors was measured to missing factors that may regulate BNC differenitation Stra13, ID1, and ID2 transcripts were pre sent. A limited amount of HAND1 mRNA was found in either cell line and GCM1 transcripts were not identified in either cell line (n=5; data not shown). The Role of HAND1 in BNC Differentiation HAND1 mRNA and protein was more abundant in BNCs than MNCs, and HAND1 expression was limited in trophoblast cell lines that do not differentiate into BNCs. Hence, a study was completed to determine if HAND1 express ion induces BNC formation in oTr cells. The transfection efficiency of both control and HAND1 samples w as 6 11% as measured by GFP expression from co transfected plasmid (Fig 4 4 a & b). The functional capacity of the HAND1 expression system was validated with a lucife rase reporter assay with MyoD as a positive control. The experiment showed that over expr ession of HAND1 induced (P <0.05) luciferase activ ity over the negative control (F ig 45). The next experiment focused on examining the morphological effects of HAND1 over expression in oTr cells. HAND1 did not cause oTr cells to differentiate into BNCs when observed by using phase contrast and epiflourescence microsc opy of F actin filaments (Fig 4 4 c & d). Over expressed HAND1 protein was localized to the nucleus as expected [305] Also, HAND1 expressing oTr cells did not produce CSH1 as determined by Immunocytochemistry (data not shown).

PAGE 84

84 Discussion The first portion of this work describes the expression profile of several suspected BNC differentiation factor s. The factors under investigation are involved with differentiation of human and mouse trophoblast cells but their actions on bovine trophoblast cells has not been described. Transcripts for all factors were detected in the bovine placenta. Interestin gly, the only factor that exhibited differential gene expression between MNCs and BNCs was HAND1. Expression of HAND1 was limited in CT1 and oTr cell lines. CT1 and oTr cells do not differentiate into functional BNCs implicating these factors as potential regulators of BNC differentiation [20, 142, 151] Due to the limited expression of HAND1 in the cell lines and the mRNA abundance results HAND1 protein expression was analyzed in MNC and BNC samples. HAND1 pro tein expression was increased in BNCs. This result confirmed the qRT PCR results and implicates HAND1 as a potential BNC differentiation regulator. Insufficiencies in HAND1 expression are associated with pregnancy failures in cattle. A substantial portio n of SCNT pregnancies are lost during placental formation, or shortly thereafter, and HAND1 mRNA abundance is less in these placentae than IVP and AI placentas [384] Based on present findings, this decrease likely reflects either that fewer BNCs exist in these pregnancies or that the BNCs present do not produce sufficient amount s of HAND1. Due to the differential expression of HAND1 in MNC and BNCs and the evidence from SCNT pregnancies, the function of HAND1 in t rophoblast differentiation was examined. Over expression of HAND1 did not alter oTr cell appearance nor induce CSH1 expression [194] It did appear that HAND1 was being over expressed in these

PAGE 85

85 cells and was present in the nucleus instead of being sequ estered in the nucleolus. This localization is important based on previous reports showing that the nucleolar release of HAND1 promotes its activation and trophoblast giant cell differentiation whereas nulceolar compartmentalization prevents HAND1 activat ion [305, 306] The function of over expressed HAND1 was confirmed using an E box lucife rase reporter assay. E boxes are the DNA site for all bHLHs [282] Although HAND1 did not induce the same response as the positive co ntrol, MyoD, it did significantly activate the E box promoter over that of the control. This shows that the over expressed HAND1 is functioning. Several reasons could explain why HAND1 over expression in oTr cells did not induce BNC differentiation. Fir st, the transfection efficiency was low in these experiments. However, i f HAND1 was the essential factor control ling BNC differentiation the expected result would be that those cells with over expressed HAND1 would show changes in morphology and/or produc e CSH1 An alternative reason for the in sufficiency of HAND1 to cause a morphological change is a problem with the cell line. BNCs begin to appear in vivo several days later then when these cell lines were made. Perhaps these cells are not set up for t his differentiation event and are missing several key factors, in addition to HAND1. Also, ID1 and ID2, inhibitors of bHLH factors are expressed at significant levels in the oTr cell line. Perh aps these factors prevent HAND1 from functioning at the appropriate level. Another factor that may be playing a role and that was not examined is ASCL2, the competitive inhibitor of HAND1 [275] A high abundance of this factor may prevent differentiation events. In future endeavors it would be interesting to examine ASCL2 expression in the cell line. Other factors that

PAGE 86

86 also impact HAND1 activity include the proteins HICp40 (human I mfa domain cont aining protein) and Plk4 (Polo like kinase 4). HICp40 sequesters HAND1 to the nucleolus while Plk4 phosphorylates HAND1 releasing it from the nucleolus and activating the protein [305, 306] These factors should also be examined to ensure their proper expression in oT r cells. The expression of several other factors was compared between M NC and BNC samples. The expression of Stra13, ID1 and ID2 was similar in these samples indicates that they may not play an essential role in BNC differentiation. These factors were also examined in the CT1 and oTr trophectoderm cell lines. Stra13, ID1 and ID2 expression was present in both cell lines. Although ASCL2 expression was found in whole placenta samples an d is different in SCNT placentae versus controls, we were unable to accurately examine differences in this transcript abundance between MNCs a nd BNCs due to difficulties with identifying primers with acceptable primer efficiencies. GCM1 is a trophoblastic fusigenic factor in several species. In mouse, GCM1 null mice lack syncytiotrophoblast and are embryonic lethal [344] Decreased GCM1 expression is associated with the human placental disease, preeclampsia [346] It also is expressed in the equine binucleate chorionic girdle [385] In the cow, however, we were not able to detect differences in the expression profile for GCM1 between MNCs and BNCs. There was a noted absence of GCM1 from the trophoblast cell lines, suggesting this factor may be needed for trophoblast differentiation or function in ruminants. An interesting finding with GCM1 expression was that it seemed to be in lower abundance when compared to HAND1. In fact, 50 times more starting RNA was needed for the GCM1 mRNA abundance assay than for HAND1. Al so the protein

PAGE 87

87 analysis indicated weak GCM1 signals. Perhaps GCM1 is more of a transient factor that is difficult to detect. Also GCM1 may not play a role in BNC differentiation but may have a potential role in signaling BNC fusion to the uterine epithel ium. In conclusion, several potential trophoblast differentiation factors are present in the placenta. HAND1 was differentially expressed in MNCs and BNCs. HAND1 did not induce BNC development in the oTr cell line. Several reasons have been proposed f or why over expression of HAND1 did not cause the expect result. Further experiments are needed to test these hypotheses.

PAGE 88

88 Table 4 1. Primers used for endpoint and quantitative RT PCR Gene of Interest Primer Sequence (5 3) Annealing Temp(C) HAND1 Forward Reverse ACATCGCCTACCTGATGGAC GCGCCCTTTAATCCTCTTCT 57 GCM1 Forward Reverse AGCAGCTGGATAGACGGAAA TCGTCGGAGCTGTAGATGTG 57 ASCL 2 Forward Reverse ACCCAAGGCTAGTGTGCAAG TAAGCCTTCATACCGCCAGT 57 ID1 Forward Reverse TCTGGGATCTGGAGTTGGAG CTGGAAGGACCAGAGAG CAC 59 ID2 Forward Reverse CCATTTCACAAGGAGGAGGA TCCCCATGGTGGGAATAGTA 55 I mfa Forward Reverse CACTAGTGGCGAATGGCTCT TGGACACAGCAGTCTTCCTG 57 Stra13 Forward Reverse CTGACCCACAACGTTCTCCT CTTCCCAGTGACCAAATGCT 57 E12/E47 Forward Reverse ATAGTGACGGTGCCCACTTC AGGGTGCCCAGAGTAGTAGGAAT 57 ACTBa Forward Reverse CTGTCCCTGTATGCCTCTGG AGGAAGGAAGGCTGGAAGAG 55 18Sa Forward Reverse GCCTGAGAAACGGCTACCAC CACCAGACTTGCCCTCCAAT 59 a[147]

PAGE 89

89 Figure 41. Expression pattern of selected trophoblast cell differentiation in the ruminant placenta. End point RT PCR was performed on whole bovine cotyledonary tissue harvested at midgestation (n=4). All factors of interest were present in cotyledonary tissue and products were verified by sequence analysis.

PAGE 90

90 Figure 42. Gene expression profile of selected potential BNC differentiation regulators. qRT PCR was performed on MNC and BNC sorted populations to determine differences in gene expression (n=58 replicates). HAND1 mRNA abundance was greater in BNC versus MNC samples (p<0.05) as indicated by the asterisk. Figure 43. Western blot analysis of GCM1 and HAND1 protein expression in MNC (M) and BNC (B) samples. GCM1 prot ein expression was not different between samples. HAND1 protein expression was higher in BNC samples versus MNC samples. All samples had the same amount of protein loaded as measured by BCA protein concentration assay (n=6 samples).

PAGE 91

91 Figure 44. Over ex pression of HAND1 in oTr cells. Figures A, C, E represent Gal transfected control samples and B, D, and F represent HAND1 transfected samples. A&B) Representative figures of samples cotransfected with GFP to measure transfection efficiency. C&D) Samples stained for F actin to determine if there were changes i n cell morphology or cell fusion events. E&F) Localization of over expressed HAND1 to the cell nucleus. G) Graphical representation of transfection efficiency. H) Western blot analysis of HAND1 expression in control ( ) and HAND1 transfected (+) sample s.

PAGE 92

92 Figure 45. HAND1 activity as measured by luciferase activity. Gal (negative control), HAND1, and MyoD (positive control) were cotransfected with the E box promoter (4Rtk Luc) and luciferase activity was measured following 36 h of culture. Positive control, MyoD, indicates that the reporter assay is functional. Different subscripts represent differences between groups (P<0.05)

PAGE 93

93 CHAPTER 5 EXPRESSION AND FUNCT ION OF BMP2 AND BMP4 IN THE PERI ATTACHMENT BOVINE CONCEPTUS Introduction The transforming growth factor (TGF ) superfamily is a multifunctional group of paracrine factors [352, 386] that regulate various cell differentiation, and migration events throughout development [363] Improper regulation of these factors causes multiple disorders, including cancer and autoimmune diseases [352, 363] TGF super family members include TGF s, activins, nodal, growth and differentiation factors (GDFs), and bone morphogenic proteins (BMPs ) [352, 353, 363, 386] The BMPs mediate various physiological and developmental processes including bone formation [354356] cardiovascular, nervous and urogenital function [357] and reproduction [358] BMP4 and 8b play a critical role in primordial germ cell formation [387390] Other BMPs, specifically 6 and 15, are localized to the oocyte and are essential during folliculogenesis for contro lling follicle turnover selection and dominance [358, 391394] In the mouse placenta, BMP4, 7 and 8a are expressed and play a role in trophoblast proliferation and differentiation [358, 395, 396] Two BMPs of special interest in regards to trophoblast development and function are BMP2 and BMP4, two closely rela ted TGF s [362, 364] BMP4 is the best studied of these factors. It is especially important for regulating placental vascular development in mice [368, 369] It also serves a major function in mesoderm formation. BMP4 knockout mice arrest between day 6.5 and 9.5 with majority of embryonic death occurring at day 6.5. Those embryos that arrest at day 6.5 lack mesoderm [ 364, 368] Those BMP4 knockouts that do not die until embryonic day 9.5 form mesoderm and are believed to be partially rescued by BMP2 [364] This

PAGE 94

94 hyp othesis is supported by theBMP2 and BMP4 type II receptor knockout, BMPR II. This null mouse is embryonic lethal at day 6.5 due to lack of mesoderm formation [370] Signaling for all TGF super family members occurs through ligand binding to a heterodimeric receptor complex of specific type I and II serine/threonine kinase receptors. The type II receptor phos phorylates the type I receptor initiating the signaling cascade [352, 386] BMP 2 and 4 interact primarily with the type II serine/theronine kinas e receptor, BMPR II. They also use the type I serine/theronine kinase receptors, BMPR1A (A LK3) and BMPR1B (ALK 6) [365, 366] BMP2 also reacts with the type I receptor, ACVR1 (ALK 2) [367] BMP binding and activation of their receptors impacts several signal transduction pathways including the Smads and the mitogen activated protein kinas e (MAPK) pathway [360, 361] BMP2 and 4 interaction with their receptors regulate Smad1, 5, and 8 activity [352, 353] Upon complexing with Smad4, the Smads are translocated into the nucleus, bind DNA at specific sites (Smad binding elements) and regulate transcription of targeted genes [353, 397, 398] S everal levels of negative regulation exist in the BMP signaling pathway and one of special interest is Noggin, which is secreted from cells and serves as a competitive inhibitor of BMP2 and 4 for their receptors [352, 353] BMP4 can also induce human trophoblast differentiation when added to embryonic stem cells [371, 372] BMP2 can also induce trophectoderm differentiati on in human embryonic stem cells, although greater doses of BMP2 are needed to mimic the effects of BMP4 [371] Little is known about the expression and role of BMPs in the bovine uterus and pre at tachment conceptus. The goal s of this work w ere to examine the expression pattern of the BMP2 /4 ligand, receptor and inhibitor profile in the bovine

PAGE 95

95 uterus and pre attachment conceptus and explore the functions of these paracrine factors during early pregnancy. Materials and Methods Animal Use and Tissue C ollection All animal use was completed with the approval of the Institutional Animal Care and Use Committee at the University of Florida. Healthy, non lactating Holstein cows (n=12) were housed at the University of Florida Dairy Unit (Hague, Fl, USA) and fed a maintenance diet. Tissues were harvested at day 17 of gestation following slaughter in superovulated cows [147] Pregnant and non pregnant endometrial samples were collected from nonsuperovulated cows subjected to estrus synchronization as described previously [146] Four biopsies were taken from the endometrium ipsilateral to the functional corpus luteum; with biopsy location ranging from the horn tip to the uterine body Biopsies were pooled in one tube, snapfrozen and store d at 80C. Total cellular RNA was extracted from d 17 conceptuses using the RNAqueous Midi RNA Isolation Kit (Applied Biosystems/Ambion, Austin, TX). Other tissues and CT1 tcRNA were extracted using the PureLink Microto Midi Total RNA Purification Syst em with Trizol (Invitrogen Corp.). RNA concentration and integrity were evaluated using a NanoDrop 2000 Spectrophotometer (Thermo Scientific). Bovine Trophectoderm Cell (CT1) C ulture Cells were cultured as previously described [142, 146, 147] in DMEM with high glucose containing 10% fetal bovine serum and other supplements on Matrigel Basement Membrane Matrix (BD Biosciences, Bedford, MA) at 38.5C in 5% CO2 in air. CT1 cells were seeded onto 12well plates and allowed to attach for 48 h. U pon reaching ~50% confluence, cells were placed in fresh DMEM lacking FBS but

PAGE 96

96 containing other supplements plus a serum substitute (insulin/transferring/selenium; ITS; Invitrogen Corp.). 24 h after serum free culture, cells were placed in treatments conta ining 0, 0.1, 1, 10, and 100 ng/ml of either recombinant human ( rh ) BMP2 (R&D Systems, Minneapolis, MN) or rhBMP4 (R&D Systems) ( n=2 wells/BMP treatment/replicate experiment). BMP2 and BMP4 were reconstituted in sterile 4 mM HCl according t o manufacturers guidelines. The same amount of carrier was placed into all cultures. SuperArray Total cellular RNA from d 17 conceptuses (n=3), pregnant endometrium (n=4) and nonpregnant endometrium (n=4) were analyzed using t he Oligo GEArray System (SABiosciences/Qi agen, Frederick, MD) and the TrueLabelingAMP 2.0 kit (SABiosciences/Qiagen) according to manufacturer s guidelines. Custom nylon membrane arrays were supplied with 60mer oligonucleotide probes for specific genes (see Fig. 5 1). End P oint RTPCR All sa mples were processed as described in Chapter 4 Gene specific primer sets were used to amplify products for BMP2, BMP4, Noggin, BMPRII, ACVR1, BMPR1A, and BMPR1B (see Table 5 actin (ACTB) was included as a positive PCR control (Table 5 1). PCR amplification was performed using ThermalAce DNA Polymerase (Invitrogen Corp.). 35 cycles of denaturation (95C for 1 min), annealing (5559C for 1 min, depending on primer set) and DNA synthesis (74 C for 1 min) followed by a DNA polishing stage (72 C for 10 min) were completed. PCR products were analyzed, cloned and sequenced as described previously.

PAGE 97

97 Quantitative (q) RT PCR After 24 h, 4 d or 8 d, tcRNA was extracted using the PureLink Microto Midi Total RNA Purification System with Tr izol following manufacturer s guidelines (n=4 replicate experiments). TcRNA was stored at 80C until further use. For the 4 d and 8 d studies, medium with BMP2 or BMP4 supplements (0, 1, 10 or 100 ng/ml) were changed every three days. DN ase treatment and RT was per formed as previously described. The abundance of IFNT CSH1and 18S RNA (internal RNA loading control) in BMP2 and BMP4 treated CT1 samples were then determined by TaqMan based qRT PCR. Primers and probes specific for IFNT and CSH1 were synthesi zed (Applied Bio systems Inc.; Table 5 2) and labeled with a fluorescent 5 6FAM reported dye and 3 TAMRA quencher. The IFNT probe was designed to recognize all know bovine IFNT isoforms [146, 147] After an initial activation/denaturation step (50C for 2 min; 95C for 10 min), 40 cycles of a twostep amplification procedure (60C for 1 min; 95C for 15 s) was completed with TaqMan reagent (Applied Biosystems Inc.) and a 7300 Real Time PCR System to quantify mRNA abundance. 18S abundance was quantified using the 18S RNA Control Reagent Kit (Applied Biosystems Inc.) containing a 5 VIC labeled probe with a 3 6 carboxy tetramethylrhodamine quencher. Each RNA sample was analyzed in triplicate (50 ng tcRNA). A negative control was also run which lacked reverse transcriptase for each sample to verify they were free from genomic DNA contamination. The t method was used to contrast abundance of IFNT and CSH1 transcripts relative to the 18S RNA Proliferation A ssay C T1 cells were seeded into 24 well M atrigel coated plates and allowed to attach for 48 h. Cells were then placed in serum free medium for 24 h. After serum starvation,

PAGE 98

98 fresh serum free medium containing 0, 0.1, 1, 10, an d 100 ng/ml of rhBMP2 or rhBMP4 wa s added to cultures (4 wells/treatment) After 48 h the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (Promega Corp., Madison, WI) was used to determi ne relative cell numbers Alkaline Phosphatase S taining CT1 cells were seeded into plates and cultured for 2 days to allow cell attachment. Med ium was then changed into serum free medium as before and, 24 h later medium was changed into serum free medium containing 0, 10, 100 ng/ml of rh BMP2 or rh BMP4 (n=2 wells/treatment). Cells were then cultured for 4 or 8 d. Medium and BMP supplements were changed every 3 days. On 4 d or 8 d, cells were fixed in 4% [w/v] paraformaldehyde (Polysciences In c, Warrington, PA, USA) for 15 m in at room temperature. Staining solution (500 l 1M MgCl2, 310l 5 M NaCl, 1ml 1 M Tris (pH 9.0), 8 ml dH2O, 66 l NBT [Nitro Blue Tetrazolium Chloride] and 33 l BCIP [5=Bromo 4Chloro3 Indolyphosphate p Toluidine Salt] ) was placed on cells and incubated at room temperature in the dark overnight. Cells were then viewed under phase contrast microscop y for positive alkaline phosphatase activity as indicated by purple staining. Smad 1 5, 8 Western B lotting CT1 cells were seeded o nto 6 well Matrigel coated plates and allowed to attach for 48 h. Medium was then changed into serum free medium as described above for 24 h. Cells were then placed in 100 ng/ml of rh BMP2 or rh BMP4, for 0, 5, 15, 60, or 120 min. Following treatment cells were placed in NP 40 buffer ( 20 mM Tris HCl pH 8, 137 mM NaCl, 2 mM EDTA, 1% [w/v] NP40) for 20 min on ice. Samples were then stored at 20C until further use. Samples were sonicated and then centrifuged (10,000 g for 10 min at 4C).

PAGE 99

99 Western blotting w as per f ormed as described previously (C hapter 4). Membranes were blocked in 5% NFDM a t room temperature for 1 h and then incubated in rabbit anti p hoshorylated Smad1 (Ser 463/465) / Smad5 (Ser 463/465) / Smad8 (Ser 426/428) antibody ( 1:5000; Cell Signaling, Danvers, MA) over night at 4C. Mem branes were then washed and incubated in secondary antibody. Membranes were then developed as describe in the previous chapter. Following developing membranes were placed in stripping buffer blocked in 5% NFDM for 1 h at room temperature, and then incubated with rabbit anti SMAD1/5/8 ( 1:5000; Santa Cruz B iotechnology inc., Santa Cruz, CA) in 3% BSA over night at 4C. Following incubation, membranes were washed and then incubated in secondary antibody, washed in TBST, and developed as above. Statistical A nalysis All analyses were completed by analysi s of variance using the General Linear M odel s Procedure of the Statistical Analysis System (SAS Institute, Cary, NC). When analyzing qRT PCR data, the T values were used for analyses [146, 147] T values were transformed to fold differences for illustration on graphs. Results are presented as arithmetic means SEM. Results Expression of BMP Ligands and Receptors in Bovine Conceptus and E ndometrium Customized SuperArrays were generated to evaluate the expression of several factors including FGFs, IGFs, VEGFs, N otc h signaling molecules and BMPs in endometrium and conceptuses These factors are involved in a variety of cell differentiation and signaling events throughout development. We isolated RNA from d ay 17 conceptuses, pregnant and non pregnant endometri al whi ch was used to

PAGE 100

100 generate a template for biotinalated cDNAs that were used to probe this customized SuperArray (f ig 51). Transcripts for BMP2 and BMP4 were present in all samples tested (n=4 arrays/tissue). The relative expression of these transcripts appeared greater than many other growth and differentiation factors expressed by conceptuses and endometrium. Specifically, substantially more BMP2 and 4 mRNA was detected than FGF2 and 10 mRNA two factors known to be expressed by conceptuses and endometriu m during early pregnancy [146, 147] Other transcripts notably IGF2, VEGFa and VEGFb, also were detected. End point RT PCR was completed to confirm the observations made w hen using the Sup erArray (f ig 52). Bot h BMP2 and BMP4 mRNA were detected in bovine endom etrium and day 17 conceptuses (f ig. 5 2). BMP2 and 4 mRNA also were detected in CT1 cells (f ig 52). The presence of BMP2/4 signaling components was also examined by endpoint RT PCR. Each of the major receptor subtypes utilized by BMP2 and BMP4 binding w ere found in endometrium, d 17 conceptuses and CT1 cells (fig. 53). T he type II receptor, BMPR II, was found in all tissues; a lthough the abundance of this transc ript appeared to vary between conceptus samples. The type I receptor BMPR1A was found in all tissues examined. BMPR1B was found in d 17 conceptus and endometrium but there was limited expression of this transcript in CT1 cells. ACVR1 was also found to be expressed in all tissues examined. T he expression profile of Noggin was examined in these tissues. Noggin exp ression was confirmed in the d 17 conceptus; but w as not identified in the endometrium. CT1 cells had limited transcript expression of N oggin (fig 5 2).

PAGE 101

101 Biological A ctivities o f BMP2 and BMP4 in Bovine T rophectoderm Several studies were completed to examine the biological potential for BMP2 and 4 in bovine trophoblast. The CT1 cell line was used for all studies. The initial study investigated whether BMP2/4 affected IFNT expres sion in CT1 cells. BMP2 and BMP4 supplementation had no effect on IFNT mRNA abundance after 24, 96, and 192 h (fig. 5 4). I n a separate set of experiments, the ability of BMP2/4 to regulate CSH1 expression was determined Mid gestation placenta RNA was used as a positive control. Following 96 and 192 h of BMP2 and BMP4 treatment no change in the production of CSH1 mRNA was detected ( data is not shown) The ability of BMP2 and BMP4 to control trophoblast proliferation was examined in CT1 cells after 4 8 h exposure to BMP2 or 4. BMP2 did not affect CT1 cell numbers after 48 h (fig. 5 5A) but BMP4 decreased (P<0.05) CT1 proliferation when provided at 1, 10, and 100 ng/ml (fig C 5B). To ensure bone formation and mineralization was not induced in BMP treated CT1 cells, alkaline phosphatase activity was measured [399] As seen in figure 5 6, alkaline phosphatase staining was evident in all treatments and no increases in staining intensities were observed between the nontreated controls and treat ed groups. The ability of BMP2/4 to activate Smad 1/5/8 signaling was examin ed in CT1 cells Phosphorylated Smad was detected in nontreated controls and BMP2 supplementation did not increase the presence of pSmad1/5/8 (fig 57). BMP4 supplementation appears to have increased the activati on of Smad1/5/8 signaling in the 60 minute sample as compared to the control, 5, and 15 minute supplementation samples Given that only a single analysis was completed, further verification is needed to confirm that BMP4 increased Smad activation ( fig 5 7 ).

PAGE 102

102 Discussion The BMP s are utilized to control various reproductive processes across species [358] b ut little is known a bout how these factors impact the events of early pregnancy in cattle. These studies were completed to discover some of these functions Transcripts for BMP2 and BMP4 were readily detectable in both elongated conceptuses and endometrium collected from pregnant cattle, and upon further study it became evident that all the receptor subtypes needed to elicit a BMP2/4 response were present in conceptuses and endom etrium. Noggin regulates BMP expression in various systems and is also u p reg ulated by BMP2 and BMP4 to prevent overs timulation by BMP2 and/or BMP4 [362] T he BMP2 and 4 antagonist, Noggin, was found in day 17 conceptus but had limited expression in CT1 cells and endometrium Perhaps the lack of Noggin expression allows BMP2 and BMP4 present in these cells to activate their signal ing pathway, while in other tissues where Noggin is present there is more control of this signaling system. A main focus of this laboratory is to better understand how IFNT expression is controlled during early pregnancy, and a study was completed to det ermine if B MP2/4 affects IFNT expression. In humans BMP4 induced trophoblast cell differentiation from embryonic stem cells however the cell line used in these studies is an already differentiated trophectoderm cell line [371] A major function of BMP4 i n mice is development of the mesoderm [368] However this function could not be test ed in the CT1 cell line. A potentially better model system may be an in vitro produced bovine embryo. BMP4 supplementation decreases CT1 cell number however this result needs to be further investigated to identify if this is a result of decreased cell proli feration or cell

PAGE 103

103 death. BMP4 supplementation may be inducing cell differentiation which would decrease cell number, h owever other experiments conducted here did not observe any signs of differentiation N o biological effect was seen because the signalin g system is already activated by endogenous BMP 2 and 4 as indicated by the endogenous activation of Smad 1/5/8. In order to determine if the endogenous expression of BM P2 and BMP4 is the cause of continuous Smad activation, studies are needed to inhibit BMP2 an d BMP4 activity Also to determine the function of the endogenously stimulated Smads, inhibitors can be used to block activation and then examine IFNT expression, proliferation and differentiation events in these cells. It is quite possible that th e primary site of BMP2/4 action is on the uterus BMPR1B knockout mouse lack uterine glands [358] Previous studies in ewes show that endometrial glands are essential for conceptus development and pregnancy [15] The uterine glands secrete a wide range of factors into the uterine lumen that nourish t he conceptus. T he BMP 2 and 4 ligands produced by both the endometrium and day 17 conceptus may function to promote endometrial gland formation by signaling through this essential receptor. While the examination of alkaline phosphatase staining did not indicate any mineralization it is also used as a marker for pluripotency in stem cells [400] The presence of alk aline phosphatase throughout control and treated samples may indicate that CT1 cells, which are deriv ed from an in vitro produced bovine blastocyst [142] may maintain a small amount of pluripotency. However since a bovine embryonic stem cell line has not been established, it is unknown whether alkaline phosphatase will be a good marker for pluirpotency in these cells.

PAGE 104

104 Overall, BMP2 and 4 and their receptors are present in the bovine endometrium and day 17 conceptus. However, the role the BMP2 and BMP4 play in the pre attachment bovine conceptus has yet to be identified Determining the potential role of BMP2 and BMP4 negative regulation has on this system may lead to a better understanding of what function these factors have in trophoblast function.

PAGE 105

105 Table 5 1. Primers used for end point RT PCR Gene of Interest Primer Sequence (5 3) Annealing Temp(C) BMP2 Forward Reverse CTTAGACGGTCTGCGGTCTC CGAAGCTCTCCCACCTACTG 59 BMP4 Forward Reverse TGAGCCTTTCCAGCAAGTTT TACGATGAAAGCCCTGATCC 55 Noggin Forward Reverse GAACACCCGGACCCTATCTT ATGGGGTACTGGATGGGAAT 57 BMPRII Forward R everse AGACTGTTGGGACCAGGATG GTCTGGCCCACTGAATTGTT 57 ACVR1 Forward Reverse AAATGGGATCGCTGTACGAC CTGTGAGTCTGGCAGATGGA 57 BMPR1A Forward Reverse CAGGTTCCTGGACTCAGCTC CACACCACCTCACGCATATC 59 BMPR1B Forward Reverse AGGTCGCTATGGGGAAGTTT CTCCCAAAGGATGAGTCCAA 5 5 ACTBa Forward Reverse CTGTCCCTGTATGCCTCTGG AGGAAGGAAGGCTGGAAGAG 55 a[147] Table 5 2 Primer and Probe sets used for real time qRT PCR Gene of Interest Primer/ Probe Sequence (5 3) a IFNT b Forward Reverse Probe TGCAGGACAGAAAAGACTTTGGT CCTGATCCTTCTGGAGCTGG TTCCTCAGGAGATGGTGGTAGGGCA CSH1 Forward Reverse Probe GTGGATTTGTGACCTTGTTCGA CCTGGCACAAGAGTAGATTTGACA TCCTGCCTGCTCCTGCTGCTGGTA aEach probe was synthesized with a 6 FAM reporter dye and TAMRA quencher b[147]

PAGE 106

106 Figure 51 SuperArray Gene Expression Analysis. Panels A and B are day 17 non pregnant endometrium, panels C and D are day 17 pregnant endometrium and panels E and F are day 17 co nceptus samples. The grid provided is a list of genes represented and their position on the SuperArray. Genes in bold on the grid are those that appear in all samples. Blank FGF1 FGF2 FGF3 FGF4 FGF5 FGF6 FGF7 FGF8 FGF9 FGF10 FGF11 FGF12 Fgf13 Fgf14 Fgf16 FGF18 FG F20 FGF21 FGF22 FGF23 Blank HGF Blank IGF1 IGF2 Blank VEGFa VEGFb VEGFc BMP2 BMP4 BMP6 Blank GDF5 GDF8 GDF10 GDF11 TGFb1 TGFb2 DII1 DII3 DII4 JAG1 JAG2 Blank Blank Blank Blank Blank PUC18 Blank Blank AS1R2 AS1R1 AS1 Blank Blank Blank Blank Blank Blan k Blank Blank GAPD B2M PPIA PPIA ACTB ACTB DAS2C DAS2C

PAGE 107

107 Figure 52 End point PCR of BMP ligands in Day 17 bovine conceptus, bovine trophectoderm and bovi ne endometrium. Three samples of day 17 Conceptus and CT1 cells and one sample of endometrium were run per replicate (n=2 replicates). Figure 5 3 End point PCR of BMP receptors in Day 17 bovine conceptus, bovine trophectoderm and bovine endometrium. Three samples of day 17 Conceptus and CT1 cells and one sample of endometrium were run per replicate (n=2 replicates).

PAGE 108

108 Figure 54 Effect of BMP2 or BMP4 supplementation on CT1 cell IFNT mRNA expression. Panels A, C and E are cells supplemented with varying doses of BMP2. Panels B, D and f are cells supplemented with varying doses of BMP4. Panels A and B are following 24 h of supplementation, panels C and D are after 96 h of supplementation and panels E and F are following 192 h of supplementation. No changes in IFNT mRNA expression was seen (n=5 replicates/treatment/time period)

PAGE 109

109 Figure 55. Effect of 48 h of BMP2 or BMP4 supplementation on numbers of CT1 cell s. CT1 cells we re supplemented with 0, 0.1, 1, 10 and 100 ng/ml of BMP2 or BMP4 for 48 h (n=4 replicates/ BMP). Cells were the submitted to the Titer 96 Aqueous One Solution Cell Proliferation Assay BMP2 treatment did not affect the proliferation rate of CT1 cells. B MP4 supplementation caused a decrease in CT1 cell proliferation at 1, 10 and 100 ng/ml (p<0.05).

PAGE 110

110 Figure 56. Effect of BMP2 and BMP4 treat ment on alkaline phosphatase activity A, C, E, G, and I are cells after 96 h of treatment and B, D, F, H and J are following 192 h of supplementation. A and B are control. C and D are cells treated with 10 ng/ml of BMP2. E and F are supplemented with 100 ng/ml BMP2. G and H are treated with 10 ng/ml of BMP4. I and J are treated with 100 ng/ml of BMP4. Darker areas of staining indicate positive alkaline phosphatase expression. Two wells per treatment and 2 replicates were preformed.

PAGE 111

111 Figure 57. Phosphorylation of Smad 1/5/8 following BMP2 or BMP4 supplementation. CT1 cells were supplemented with 100 ng/ml of BMP2 or BMP4 for 0, 5, 15, 60, and 120 minutes and then submitted to western blot analysis for p Smad1/5/8 and total Smad1/5/8 used as loading control. BMP2 supplementation did not cause an increase in the p Smad1/5/8 present howev er endogenous BMP are activating Smad1/5/8. BMP4 treatment did cause an increase in p Smad1/5/8 activation as seen at 60 min over endogenous activation. Total Smad1/5/8 was not different between samples.

PAGE 112

112 CHAPTER 6 OVERALL DISCUSSION Work presented her e was directed at studying the basic mechanisms controlling trophoblast differentiation and function in the bovine placenta. Specifically, studies focused on developing new methods to study the formation of BNCs, examining the expression and function of s everal trophoblast differentiation factors in bovine placenta and elucidating the expression pattern and role of BMPs during early conceptus development. The first project described a new method to examine BNC formation. Like others before us, we were u nable to create BNCs in vitro and resorted instead to examining BNCs once they were formed in vivo The FACS method utilized the hyperploidic nature of BNCs for cell enrichment. Using FACS to isolate enriched populations yielded 7080% BNCs consistently. These cells could be used for mRNA and protein expression analysis as well as culture experiments. While the method used to enrich BNCs is useful being able to obtain even greater purity of BNCs may be possible. One way to improve the enrichment of B NCs with FACS would be to incorporate a BNC specific cell surface marker along with the nuclear content stain. Using the combination of nuclear content and cell surface marker during FACS would potentially increase the yield The identification of a BNC specific cell surface marker would also allow the employment of other sorting techniques such as Magnetic activated cell sorting (MACS). Potential cell surface markers to examine include several integrins, such as integrin subunits 6 and 1. Integrins play an essential role in placental migration and implantation in rodents and humans, and several integrins have been localized by immunohistochemistry to the bovine placenta

PAGE 113

113 [255, 259, 401] Increasing the purity of the BNCs obtained would increase chances of deciphering changes between MNCs and BNCs. Also increased purity would allow the use of high throughput techniques such as global gene and protein analysis with a better efficiency. It became evident from t his work that BNCs cannot be maintained effectively in culture. BNCs maintain their morphology after three and a half days in culture but lose their BNC specific features. This is consistent with observations made by others [191] Studying BNCs in vitro is not a good model for elucidating mechanisms controlling trophoblast differentiation and function. One way to study BNCs in vitro would be to develop a system where BNC differentiation occurs. In order to develop this system, the mechanisms controlling BNC formation need to be understood. In order to gain further understanding of how BNC development may be induced several putative differentiation factors were examined and found in midgestation bovine placentae (HAND1, MASH2, ID1, ID 2, Imfa Stra13, G CM1, and E12/E47). Only HAND1 mRNA expression was greater in BNC than MNC populations (fig 6 1). This difference was also observed at the protein level. This increase in HAND1 mRNA and protein expressi on in BNCs versus MNCs identifies HAND1 as a potential factor involved in BNC differentiation and function. HAND1 and GCM1 mRNA was absent in oTr and CT1 cell lines, while all other factors were present in amounts comparable to those found in BNC and MNC populations. T o determine if HAND1 plays a role in B NC differentiation, it was over expressed in the oTr cell line. Over expression did not cause a change in morphology; however expressed H AND1 protein was localized correctly to the nucleus.

PAGE 114

114 E xperiments indicate that HAND1 may play a role in BNC dif ferent iation, but it cannot by itself induce BNC formation from trophectoderm cells Rather, it is likely that other yet unidentified factors are over or under expressed in the oTR cell line It also may be necessary to use a different cell line or primary cell culture system The cell line used, oTr is thought to be a trophectoderm cell line produced from an elongated sheep conceptus It does produce IFNT, but in very low levels. Also the morphology of the oTR cell line is more like that of an endoderm or f ibroblast cell line rather tha n what is typically observed in a pure trophoblast cell line A potential cell line to develop is a mid gestation bovine mononucleate trophoblast cell l ine. Such a cell line would enable the testing of potential differentiati on facto rs in ce lls that are known to form BNCs. Other avenues to pursue in regards to mechanisms controlling trophoblast differentiation include examining factors produced by both the conceptus and endometrium. W ork examined the expression pattern and potential role of BMP2 and BMP4 in placental development and function. While BMP2/4 and their receptors were found in day 17 conceptus, endometrium and CT1 cells the function of these factors remains unknown (fig 6 1). Localization of the expression of BMP2 and BMP4 in the endometrium and conceptus could provide greater insight into their function. Not studied was the role of BMP4 in mesoderm formation in cattle. One model to test this hypothesis is an extended in vitro embryo culture system. Experi ments could examine the effects of BMP2 and 4 supplementation on mesoderm formation in the embryo by measuring the abundance of mesoderm marker, brachyury in control and supplemented embryos. Immunohistochemistry could also be used to examine the formati on of this layer in supplemented embryos.

PAGE 115

115 O f interest is the role that the BMP inhibitor, Noggin, plays in trophoblast developm ent. Noggin expression was present in the day 17 conceptu s and endometrium but not in CT1 cells, potentially indicating a role for Noggin and the negative regulation of BMP signaling in trophectoderm differentiation and function. To test this hypothesis further experiments are necessary to ass ess the function of Noggin in the trophectoderm cell line. The continued study of bas ic trophoblast development, differentiation and function is necessary in order to develop methods to reduce pregnancy losses in cattle that occur due to the improper regulation of these events. Studies here identified HAND1 as a candidate for regulating B NC differentiation because it was differentially expressed between enriched populations of MNCs and BNCs Although HAND1 alone did not induce BNC differentiation future studies could focus on the combination of this factor with other potential dif ferenti ation regulators. E valuated here was the expression of potential trophoblast regulators, BMP2 and BMP4. While both factors found are expressed by the conceptus and endometrium, their function is yet to be determined. Continued studies to identify the role that endogenous BMP2 and BMP4 have on trophoblast function could focus on inhibiting BMP2 and BMP4 signals and studying the effects. In conclusion, continued research on the basic biology controlling normal placental formation and attachment may illumi nate the role of proper placentation pregnanc y loss

PAGE 116

116 Figure 61 Summary of findings on factors effecting trophoblast cell development, differentiation and function. Several factors were examined for their potential role in BNC differentiation. The t rophectoderm marker CDX2 was greater in MNCs versus BNCs. HAND1 was greater in BNCs versus MNCs indicating it may play a role in BNC differentiation. Other factors examines were not different between these cell types. BMP2 and BMP4 were found in the day 17 conceptus and endometrium while the BMP antagonist Noggin was found only in the day 17 conceptus. The role these factors play in conceptus and endometrium development needs to be further examined.

PAGE 117

117 APPENDIX A METHODS FOR FLUORESC ENCE ACTIVATED CELL SORTING (FACS) OF MID GESTATION BOVINE PLA CENTA Materials Dispase BD Biosciences DMEM with high glucose (4.5 g/l D glucose) Invitrogen Corp. Dulbeccos phosphatebuffered saline (DPBS) Invitrogen Corp. Fetal Bovine serum (FBS) Invitrogen Corp. HEPES Sigma Pancreatin Invitrogen Corp. ProLong Gold antifade reagent Invitrogen Corp. Vybrant Dye Cycle Green Invitrogen Corp. 16% ultra pure Paraformaldehyde Polysciences Inc. Tissue Collection 1 Obtain pr egnant bovine uteri from the abattoir (Central Beef Industries L.L.C.; Center Hill, FL) and transport to the laboratory on ice. 2 Place uteri in appropriately sized basin and clean an incision area on the uterine horn ipsilateral to the corpus luteum with su rgical scrub to remove any outside bacterial contamination. 3 Cut an incision through the uterine body and through the placental tissue all the way down to the fetus. 4 Remove several (5 6) placentomes, place in a clean petri dish, cover and take the tissue ba ck to the laboratory. 5 Remove any unnecessary fetal membranes from the placentome.

PAGE 118

118 6 Dissect away the cotyledonary tissue from the caruncular tissue; this can usually be achieved by carefully pulling the two tissues layers apart. 7 Wash the cotyledonary tissue twice in DPBS to wash away excess blood. 8 Cut tissue into smaller pieces (56 mm) and incubate in collection medium containing 25 units/ml Dispase and 0.625 mg/ml Pancreatin in a 50 ml conical tube at 37C for 1 h under constant rotation (use the hybridizat ion oven). 9 While the tissue is digesting, go back and measure the crownrump length of the fetus to estimate gestational age as well as record the fetal sex. 10. Discard the left over tissue and fetus in the UF Meats lab awful room FACS Sample Preparation 11. Fol lowing tissue digestion, using a forceps take the large pieces of tissue and transfer into a new 50 ml conical tube. 12. Take the tissue homogenate and filter through a 200m mesh. 13. Wash the large tissue pieces with collection medium and then transfer the large tissue pieces back to the original conical tube. 14. Repeat steps 12 and 13 twice. 15. Centrifuge the filtered tissue homogenate at 300 x g for 10 minutes at room temperature. 16. Resuspend cells in sort medium with 10M Vybrant Dye Cycle Green and incubate at 37 C for 30 minutes in the dark under constant rotation (use the hybridization oven). 17. Transport samples at 37C to the University of Florida Interdisciplinary Center for Biotechnology Research Flow Cytometry laboratory (UF ICBR; Gainesville, Fl).

PAGE 119

119 Contact info: Neal Benson ( nbenson@ufl.edu); recommend setting up flow appointments at least 2 weeks in advance. FACS 18. Use the BD FACSAria cell sorting system (BD Biosciences) and FACS Diva software version 6.2.1 (BD Biosciences). 19. Before placing the placenta cell homogenate on the sorter dilute the sample at least in half with sort medium (you may need to dilute the sampl e further depending on the thickness of the sample). The sample needs to dilute enough to smoothly run the machine but if the sample is to dilute sorting will take a longer period of time. 20. Prepare collection tubes (215ml conical tubes with 3 mls collecti on medium) and label for MNC and BNC fractions. 21. Place diluted sample on the cell sorter and illuminate the cells with a 100mW laser emitting 488nM light. 22. Set thresholds at 20,000 of the forward light scatter and 5000 on green fluorescence (530 +/ 15nM) to eliminate excessive cell debris. 23. Plot the green fluorescence on a histogram and adjust the diploid peak to 50 on the linear scale of 0 to 255 using the photomultiplier voltage. 24. Once the diploid peak is established collect cells a MNCs: cells that fall at th e diploid peak b BNCs: cells that have a fluorescence range of 2to 4 times greater than the diploid peak 25. Approximately two million BNCs and six million MNCs can be collected in a three hour period.

PAGE 120

120 26. Following FACS, centrifuge cells at 300 x g for 10 minutes at room temperature to remove FACs sheath fluid. 27. Resuspend cells in collection media. Sorting Efficiency Analysis 28. Bring cells back to the laboratory. 29. Take a small aliquot of sorted cells and fix in 4% [w/v] paraformaldehyde for 15 minutes at room temperature Make 4% para formaldehyde by mixing 1 vial 16% ultra pure Para formaldehyde (10ml) with 30 ml PBS 30. Wash cells with DPBS twice 31. Mount cell onto glass slides using ProLong G old antifade reagent 32. View cells under phasecontrast and epifluorescence micros copy (nuclei will appear green) to determine the purity of sorted samples 33. Stored the remainder of the sorted sample appropriately for further use Media Formulas Collection M edi um DMEM with high glucose (4.5 g/l D glucose) 10% [v/v] fetal bovine serum (FBS ) 10mM HEPES Sort M edi um Dulbeccos phosphatebuffered saline (DPBS) 5% FBS

PAGE 121

121 APPENDIX B STIMULATION OF IF NT BY FIBROBLAST GRO WTH FACTORS IN THE BOVINE TROPHECTODERM CELL L INE, CT1 Introduction For pregnancy to succeed the maternal unit must recognize the conceptus and maintain a uterine environment compatible for embryo survival. In ruminants the maternal recog nition of pregnancy hormone is i nterferon tau (IFNT), a protein produced by the trophectoderm prior to placental attachment to the uterine lining. IFNT prevents maternal rejection of the conceptus by blocking oxytocin receptor expression, thereby preventing pulsatile secretions of prostaglandin F2 alpha and luteloysis. It also induces several uterine proteins implicated in various pregnancy regul atory functions [14, 402, 403] M ultiple intracellular and extracellular factors control IFNT gene expression. Intracellular factors include transcription factors Oct4 and Ets2 and signaling molecules MAPK and PKC [14] Extra cellular factors include CSF2 [145] insulin growth f actor I and II [404] and fibroblast growth factor 2 (FGF2). FGF2 increases IFNT gene and protein abunda nce in bovine trophectoderm [146] FGF 2 localizes to luminar and glandular epithelium in the endometrium and is secreted into the ut erine lumen [146, 405] To date 23 FGFs have been identified along with 4 functional receptors with several isoforms [406] FGF receptor 2 b (FGFR2 b ) appears to have a function in the maternal uterine environment and has been localized to the epithelial lining of the endometrium in several species. Ligands for FGFR2b include FGF1, 7, and 10 [407] FGFR2b localizes to the ovine uterine epithelium and mesoderm layer of the conc eptus implicating FGF 1, 7, and 10 as potential players in maintaining pregnancy [408] Our

PAGE 122

122 laboratory ident ified FGFR2b as the FGFR2 receptor subtype present in bovine conceptus and the trophectoderm cell line CT1 [147] FGF1 protein localizes to the trophectoderm and endometrial epithelium during mid pregnancy in cows [375] In the ewe, FGF10 is expressed by the stromal endometri um and the developing embryonic mesoderm, a tissue layer juxtaposed to trophectoderm during conceptus elongation [408] Current evidence indicates that FGF7 does not secrete it into the uterine lumen in ruminants [408] However, FGF7 acts exclusively through FGFR2b [409] thereby implicating this rec eptor subtype in transducing the effects of this and potentially other FGFs on trophectoderm. We hypothesize that FGFs 1, 7 and 10 increase IFNT expression. The goal of this work is to evaluate FGF1, 2, 7 and 10s ability to increase IFNT mR NA and protein levels Materials and Methods Bovine Trophectoderm Cell (CT1) C ulture Cells were cultured as previously described [142, 146, 147] in DMEM with high glucose containing 10% fetal bovine serum and other supplements (100 uM non essential amino acids, 2 mM glutamine, 2 mM sodium pyruvate, 55 mercaptoethanol, 100 U/ml penicillin G, 100 g/ml streptomycin sulfate, and 250 ng/ml amphoterin B; each from Invitrogen Corp.) on Matrigel Basement Membrane Matrix (BD Biosciences, Bedford, MA) at 38.5C in 5% CO2 in air. IFNT mRNA A bundance CT1 c ells were seeded onto 12well plates and allowed to attach for 48 h. Upon reaching ~50% confluence, cells were placed in fresh DMEM lacking FBS but containing other supplements plus a serum substitute (insulin/transferring/selenium;

PAGE 123

123 ITS; Invitrogen Corp.) Following 24 h of serum free culture, cells were placed in treatments containing 0, 0.05, 0.5, 5, and 500 ng/ml of either rbFGF1 (R&D Systems; Minneapolis, MN), rbFGF2 (R&D Systems), rhFGF7 (R&D Systems) or rhFGF10 (Invitrogen Corp.) All treatments cont ained 50g/ml carrier protein (BSA). Following 24 h of culture with treatment, tcRNA was extracted using the PureLink Microto Midi Total RNA Purification System with Trizol following manufactures guidelines (n=4 replicate experiments). TcRNA was stored a t 80C until further use. All samples were incubated with RNasefree Dnase (New England Biolabs) as described above before RT with the High Capa city cDNA Archive Kit (Applied Biosystems Inc.). The abundance of IFNT and 18S RNA (internal RNA loading con trol) in FGF1, FGF2, FGF7 and FGF10 treated CT1 samples were then determined by TaqMan based qRT PCR. Primers and probes specific for IFNT [147] were synthes ized ( Applied Biosystems Inc. ) and labeled with a fluorescent 5 6FAM reported dye and 3 TAMRA quencher. The IFNT probe was designed to recognize all know bovine and ovine IFNT isoforms [146, 147] After an init ial activation/denaturation step (50C for 2 min; 95C for 10 min), 40 cycles of a twostep amplification procedure (60C for 1 min; 95C for 15 s) was completed with TaqMan reagent (Applied Biosystems Inc.) and a 7300 Real Time PCR System to quantify mRNA abundance. 18S abundance was quantified using the 18S RNA Control Reagent Kit (Applied Biosystems Inc.) containing a 5 VIC labeled probe with a 3 6 carboxy tetramethylrhodamine quencher. Each RNA sample was analyzed in triplicate (50 ng tcRNA). A negative control lacking reverse transcriptase was run for each sample to verify they were free from genomic DNA

PAGE 124

124 contamination. The t method was used to determine the abundance of IFNT transcripts relative to the 18S RNA. IFNT Antiviral Protein A ssay For a second study, CT1 cells were seeded onto 24 well plates coated in Matrigel and allowed to plate for 48 hours. Cells were allowed to reach 50% confluency and then placed in fresh medium lacking FBS as described above. After 24 h of serum free culture, ce lls were placed in treatments of 0, 0.5, 5, 50, or 500 ng/ml of rbF GF1, rbFGF2, rhFGF9 (R&D Systems ) or rhFGF10 for 48 h. All treatments contained 50 g/ml carrier protein (BSA). Medium samples were collected and frozen for future analysis. In order to control for cell number CT1 cells were submitted to the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (Promega Corp., Madison, WI) following medium collection. Absorbance was measured at 490 nm. In order to determine the amount of biologically active IFNT, the collected medium samples were submitted to a cytopathic antiviral assay [146, 147, 410, 411] Data values are expressed as ng/ ml of biologically active IFNT found in conditioned media based on t he standard rbIFNT (8.03x108 IU/ml). All values were corrected for cell number variability based on values obtained from the cell proliferation assay. Statistical A nalysis Statistical analysis preformed using least squares analysis of variance (LS ANOVA) using the general ized linear model (GLM) of the Statistical Analysis System (SAS Institute Inc., Cary, NC). When analyzing qRT PCR data, the T values were used for analyses [146, 147] T values were transformed to fold differences for illustration on graphs. Results are presented as arithmetic means SEM.

PAGE 125

125 Results FGF 1, 2, 7, and 10 Increase IFNT mRNA Abundance in CT1 C ells Treatment of CT 1 cells treated with 50 and 500 ng/ml of FGF1 (fig. B 1) increased (P<0. 05) amounts of IFNT mRNA as compared to non treated controls in a dose dependent manner FGF2 increased (P<0.05) IFNT abundance at 5, 50, and 500 ng in a dose dependant manner. FGF7 increased (P<0.05) IFNT mRNA abundance (fig. B 1) in CT 1 cells at concen trations of 50 and 5 00 ng/ml FGF 10 (fig. B 1) increased (P<0.05) IFNT mRN A abundance at 500 ng/ml FGF 1, 2, 9, and 10 Increase IFNT Protein Abundance in CT1 C ells Treatment of Ct 1 cell s with 50 ng/ml of FGF1 (fig B 2) increased IFNT protein expressi on (P<.05). T reatment with of 500 ng/ml FGF1 increas ed IFNT concentration but there was no significant difference between controls and 50 ng/ml. FGF2 (fig B 2) treatment increase d (P<0.05) the amount of biologically active IFNT protein at 50 and 500 ng/m l doses Treatment of 500 ng/ml of FGF9 (fig B 2) significantly increased (P<0.05) IFNT protein. FGF 10 (fi g B 2) increased IFNT protein at 500 ng/ml (P<.05) and treatment at 50 ng/ml increased protein levels numerically but not significantly from controls Discussion Early embryonic loss in dairy cattle accounts for a large portion of economic loss in the dair y industry [8] For an embryo to be sustained early in pregnancy enough IFNT must be produced [14] Few regulatory factors effecting IFNT regulation in ruminants have been determined. The present study describes the discovery of two factors, FGF 1 and 10, believed to be important in IFNT gene regulation both in the uterus and trophectoderm.

PAGE 126

126 Previous work in the laboratory identified FGF 1, 7 and 10 mRNA expression in tissues [147] FGF 1 expression occurs in conceptus, trophectoderm, and endometrium while FGF 10 expression occurred in conceptus and endometrium. FGF 7 expression occurred only in the endometrium, however was still o f interest because it only can act through FGFR2b the receptor subtype the study was aimed at examinin g All FGFs increased IFNT mRNA abundance; however FGF 1 increased these levels at a lower treat ment dose than other FGFs. FGF 1 the sa me trends show for FGF 2 as seen in this and previously published work [146] T hese two factors together could have more of an implication in increasin g IFNT expression. FGF 7 showed that the FGFR2b subtype was present and functional in the Ct 1 bovine trophectoderm cell line because it increased IFNT mRNA abundance and can only work through that receptor. However we did not follow FGF 7 at the protein level because it localizes to the tunic muscularis of endometrial blood vessels in sheep and it is believed that it cannot mak e it into the uterine lumen and therefore act as a paracrine factor on the endometrium [408] FGF1, 2, 9, and 10 treatment increased IFNT protein produced by the trophectoderm However, efforts to locate transcripts for FGF9 in day 17 b ovine conceptus or bovine endometrium were not effective. Thus from this work only FGF1 and 10 can be implicated in regulating IFNT production along with previously published results implicating FGF2 in this role as well [146] FGF 1 increased IFNT protein production at an early dose than FGF 10, a trend seen in the mRNA data as well. FGF 1 may increase IFNT production at an earlier dose because of the type of rec ombinant protein used. The FGF 1 protein was a bovine recombinant while FGF 10

PAGE 127

127 was human. While bovine an d human FGF 10 share approximately 85% amino acid identity This lower similarity may account for the need for a higher FGF dose. Also FGF 1 does work through m ultiple receptors and may work through multiple ones to increase IFNT production while FGF 10 will not. Results implicate FGF 1 and 10 in potential IFNT regulation, but expression of FGF 7 shows it may not come into contac t with the trophectoderm thus preventing any effect it may ha ve on IFNT production. M ultiple FGFs may work in concert with each other to regulate IFNT and t r eatment with multiple FGFs may have an additive effect on IFNT production

PAGE 128

128 Figure B 1 Several FGFs increase IFNT mRNA abundance in a dose dependent manner. Cells were incubated in medium lacking serum and containing 0, 0.05, 0.5, 5, 50, and 500 ng/ml of rhFGF1, rbFGF2 rhFGF7 or rhFGF10. All cultures contained carrier protein (50g/ml BSA). RNA w as extracted 24 h post treatment quantitative RT PCR was used to determine IFNT mRNA abundance relative to an internal control (18s RNA). Changes in IFNT mRNA were analyzed (n=4) with Least Squares Analysis of Variance using the General Linear Models Proc edure of Statistical Analysis Software. Different superscripts within each panel represent differences (P<0.05).

PAGE 129

129 Figure B 2. Several FGFs increase IFNT protein secretion in CT1 cells. Cells were exposed to FGFs as described previously Cell culture supernatant was collected 48 hours after start of incubation and antiviral assays were completed to quantify IFNT concentrations in conditioned medium. Cell density was measured using the CellTiter 96aqueous One Solution Cell Proliferation Assay Changes in IFNT protein concentration were analyzed (n=5) with LS ANOVA. Different superscripts within each panel represent differences (P<0.05).

PAGE 130

130 LIST OF REFERENCES [1] Butler WR, Smith RD. Interrelationships between energy balance and post partum reproductive function in dairy cattle. J Dairy Sci 1989;72(3):76783. [2] Hansen LB. Consequences of selection for milk yield from a geneticist's viewpoint J Dairy Sci 2000;83(5):114550. [3] Santos JE, Thatcher WW, Chebel RC, Cerri RL, Galvao KN The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs Anim Reprod Sci 2004;(82 83):51335. [4] Inskeep EK, Dailey RA. Embryonic death in cattle. Veterinary Clinics of North America Food Animal Practice 2005;21(2):437. [5] Spencer TE, Johnson GA, Bazer FW, Burghardt RC, Palmarini M. Pregnancy recognition and conceptus implantation in domestic ruminants: Roles of progesterone, interferons and endogenous retroviruses Reproduction Fertility and Development 2007; 19(1):6578. [6] Brevini TAL, Cillo F, Antonini S, Tosetti V, Gandolfi F. Temporal and spatial control of gene expression in early embryos of farm animals Reproduction Fertility and Development 2007;19(1):3542. [7] Roberts RM, Embryonic loss and conceptus interferon production. Strauss III JF and Lyttle CR, eds. Uterine and Embryonic Factors in Early Pregnancy New York: Plenum Press, 1991. [8] Lucy MC. ADSA Foundation Scholar Award Reproductive loss in high producing dairy cattle: Where will it end? Journal of Dairy Science 2001;84(6):127793. [9] Thatcher WW, Staples CR, Danet Desnoyers G, Oldick B, Schmitt E P. Embryo Health and Mortality in Sheep and Cattle. Journal of Animal Science 1994;72(Suppl. 3):1630. [10] Schlafer DH, Fisher PJ, Davies CJ. The bovine placenta before and after birth: placental development and function in health and disease. Animal Reproduction Science 2000;60:14560. [11] Roberts RM, Xie SC, Mathialagan N. Maternal recognition of pregnancy Biology of Reproduction 1996;54(2):294302. [12] Kubisch HM, Larson MA, Roberts RM. Relationship between age of blastocyst formation and interferon tau secretion by in vitro derived bovine embryos Molecular Reproduction and Development 1998;49(3):25460.

PAGE 131

131 [13] Ealy AD, Yang QE. Contr ol of InterferonTau Expression During Early Pregnancy in Ruminants American Journal of Reproductive Immunology 2009;61(2):95106. [14] Demmers KJ, Derecka K, Flint A. Trophoblast interferon and pregnancy Reproduction 2001;121(1):41 9. [15] Gray CA, Bu rghardt RC, Johnson GA, Bazer FW, Spencer TE. Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation Reproduction 2002;124(2):289300. [16] Mann GE, Lamming GE. Relationship bet ween maternal endocrine environment, early embryo development and inhibition of the luteolytic mechanism in cows Reproduction 2001;121(1):17580. [17] Silke V, Diskin MG, Kenny DA, Boland MP, Dillon P, Mee JF, Sreenan JM. Extent, pattern and factors associated with late embryonic loss in dairy cows Animal Reproduction Science 2002;71(12):1 12. [18] Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G. Comparative aspects of implantation Reproduction 2009;138(2):195209. [19] Igwebuike UM. Trophoblast cells of ruminant placentas -A minireview. Animal Reproduction Science 2006;93(34):18598. [20] Dunlap KA, Palmarini M, Varela M, Burghardt RC, Hayashi K, Farmer JL, Spencer TE. Endogenous retroviruses regulate periimplantation placental growth and diff erentiation. Proceedings of the National Academy of Sciences of the United States of America 2006;103(39):143905. [21] Arnold DR, Bordignon V, Lefebvre R, Murphy BD, Smith LC. Somatic cell nuclear transfer alters peri implantation trophoblast differentiation in bovine embryos Reproduction 2006;132(2):27990. [22] De Vries A. Economic value of pregnancy in dairy cattle J Dairy Sci 2006;89(10):387685. [23] Meadows C, RajalaSchultz PJ, Frazer GS. A spreadsheet based model demonstrating the nonuniform economic effects of varying reproductive performance in Ohio dairy herds J Dairy Sci 2005;88(3):124454. [24] Groenendaal H, Galligan DT, Mulder HA. An economic spreadsheet model to determine optimal breeding and replacement decisions for dairy cattle. J Dairy Sci 2004;87(7):214657.

PAGE 132

132 [25] Seller MJ. Some aspects of placental function Postgraduate Medical Journal 1965;41(481):680&. [26] Desforges M, Sibley CP. Placental nutrient supply and fetal growth Int J Dev Biol;54(23):37790. [27] Battaglia FC Meschia G. Fetal and placental metabolisms their interrelationship and impact upon maternal metabolism Proceedings of the Nutrition Society 1981;40(1):99113. [28] Wilkening RB, Meschia G, Battaglia FC. The relationship of placental oxygen uptake and transfer to uterine bloodflow. Pediatric Research 1981;15(4):490. [29] Carter AM. Evolution of Factors Affecting Placental Oxygen Transfer Placenta 2009;30:S19S25. [30] Gootwine E. Placental hormones and fetal placental development Animal Reproduct ion Science 2004;823:55166. [31] Cross JC, Baczyk D, Dobric N, Hemberger M, Hughes M, Simmons DG, Yamamoto H, Kingdom JCP. Genes, Development and Evlolution of the Placenta Placenta 2003;24:12330. [32] Jaffe R, Jauniaux E, Hustin J. Maternal circulat ion in the first trimester human placenta-myth or reality? Am J Obstet Gynecol 1997;176(3):695 705. [33] Cataldi L, Fanos V. [Leonardo da Vinci and his studies on the human fetus and the placenta] Acta Biomed Ateneo Parmense 2000;71 Suppl 1:4056. [34 ] Pijnenborg R, Vercruysse L. Erasmus Darwin's enlightened views on placental function Placenta 2007;28(8 9):7758. [35] Pijnenborg R, Vercruysse L. Shifting concepts of the fetal maternal interface: a historical perspective. Placenta 2008;29 (Suppl A) :S20 5. [36] Dunn PM. Dr Erasmus Darwin (17311802) of Lichfield and placental respiration Arch Dis Child Fetal Neonatal Ed 2003;88(4):F3468. [37] Selwood L, Johnson MH. Trophoblast and hypoblast in the monotreme, marsupial and eutherian mammal: evolu tion and origins Bioessays 2006;28(2):12845. [38] Wildman DE. Sources for comparative studies of placentation. II. Genomic resources Placenta 2008;29(2):1447.

PAGE 133

133 [39] Carter AM, Enders AC. Comparative aspects of trophoblast development and placentation. Reprod Biol Endocrinol 2004;2:46. [40] Schier AF. The maternal zygotic transition: Death and birth of RNAs Science 2007;316(5823):4067. [41] Telford NA, Watson AJ, Schultz GA. Transition from maternal to embryonic control in early mammalian developme nt: a comparison of several species Mol Reprod Dev 1990;26(1):90100. [42] Kuijk EW, Du Puy L, Van Tol HT, Oei CH, Haagsman HP, Colenbrander B, Roelen BA. Differences in early lineage segregation between mammals Dev Dyn 2008;237(4):91827. [43] Blomber g L, Hashizume K, Viebahn C. Blastocyst elongation, trophoblastic differentiation, and embryonic pattern formation. Reproduction 2008;135(2):18195. [44] Gopichandran N, Leese HJ. Metabolic characterization of the bovine blastocyst, inner cell mass, trop hectoderm and blastocoel fluid. Reproduction 2003;126(3):299308. [45] Watson AJ, Barcroft LC. Regulation of blastocyst formation Front Biosci 2001;6:D70830. [46] Watson AJ, Natale DR, Barcroft LC. Molecular regulation of blastocyst formation Anim Re prod Sci 2004;8283:58392. [47] Bolouri H. Embryonic pattern formation without morphogens Bioessays 2008;30(5):4127. [48] Betteridge KJ, Flechon JE. The anatomy and physiology of preattachemtn bovine embryos Theriogenology 1988;29(1):15587. [49] V ejlsted M, Du YT, Vajta G, Maddox Hyttel P. Post hatching development of the porcine and bovine embryodefining criteria for expected development in vivo and in vitro Theriogenology 2006;65(1):15365. [50] Maddox Hyttel P, Alexopoulos NI, Vajta G, Lewis I, Rogers P, Cann L, Callesen H, Tveden Nyborg P, Trounson A. Immunohistochemical and ultrastructural characterization of the initial post hatching development of bovine embryos Reproduction 2003;125(4):60723. [51] Vogel P. The Current Moecular Phylogeny of Eutherian Mammals Challenges Previous Interpretations of Placental Evolution. Placenta 2005;26:5916.

PAGE 134

134 [52] Leiser R, Kaufmann P. Placental structure in a comparative aspect Experimental and Clinical Endocrinology 1994;102(3):12234. [53] Wildman DE, Chen C, Erez O, Grossman LI, Goodman M, Romero R. Evolution of the mammalian placenta revealed by phylogenetic analysis Proc Natl Acad Sci U S A 2006;103(9):32038. [54] Mossman HW. Comparative morphogenesis of the fetal membranes and accessory uter ine structures Contributions to Embryology 1937;26(158):1337. [55] Carter AM. Evolution of the placenta and fetal membranes seen in the light of molecular phylogenetics Placenta 2001;22(10):8007. [56] Vallet JL, Freking BA. Differences in placental structure during gestation associated with large and small pig fetuses J Anim Sci 2007;85(12):326775. [57] Allen WR, Wilsher S. A Review of Implantation and Early Placentation in the Mare Placenta 2009;30(12):100515. [58] Leiser R, Koob B. Developm ent and characteristics of placentation in a carnivore, the domestic cat J Exp Zool 1993;266(6):64256. [59] Miglino MA, Ambrosio CE, dos Santos Martins D, Wenceslau CV, Pfarrer C, Leiser R. The carnivore pregnancy: the development of the embryo and fetal membranes Theriogenology 2006;66(6 7):1699702. [60] Carr MC. Biology of human trophoblast Calif Med 1967;107(4):33843. [61] Wooding FBP. The synepitheliochorial placenta of ruminants binucleate cell fusions and hormone production. Placenta 1992;13(2):10113. [62] Enders AC, Carter AM. Comparative placentation: Some interesting modifications for histotrophic nutrition A review Placenta 2006;27:S11S6. [63] Wooding FBP, Flint APF, Lamming GE. Placentation Marshall's physiology of reproduction Volume 3: pregnancy and lactation. Part one: ovulation and early pregnancy. Fourth edition. 1994:233 460. [64] Benirschke K, Kaufmann P, Baergen RN. Pathology of the human placenta. 5th ed. New York: Springer, 2006. [65] Mess AM, Carter AM. Evolution of the Interhaemal Barrier in the Placenta of Rodents Placenta 2009;30(10):9148. [66] Cross JC. Placental function in development and disease. Reproduction, Fertility and Development 2006;18:716.

PAGE 135

135 [67] Boyd JD, Hamilton WJ. The Human Placenta. Cambridge: Heffer, 1970. [68] Rawn SM, Cross JC. The Evolution, Regulation, and Function of PlacentaSpecific Genes Annual Review of Cell and Developmental Biology 2008;24:15981. [69] Carter AM. What Fossils Can Tell Us About the Evolution of Viviparity and Placentation. Placenta 2008;29(11):9301. [70] Klisch K, Mess A. Evolutionary differentiation of Cetartiodactyl placentae in the light of the viviparity driven conflict hypothesis Placenta 2007;28(4):35360. [71] Zeh DW, Zeh JA. Reproductive mode and speciation: the viviparity driven conflict hypothesis Bioessays 2000;22(10):93846. [72] Zeh JA, Zeh DW. Viviparity driven conflict: more to speciation than meets the fly Ann N Y Acad Sci 2008;1133:12648. [73] Graves JA. Mammalian genome evolution: n ew clues from comparisons of eutherians, marsupials and monotremes Comp Biochem Physiol A Comp Physiol 1991;99(12):5 11. [74] Harris JR. The evolution of placental mammals FEBS Lett 1991;295(13):3 4. [75] Thompson MB, Stewart JR, Speake BK, Hosie MJ, Murphy CR. Evolution of viviparity: what can Australian lizards tell us? Comp Biochem Physiol B Biochem Mol Biol 2002;131(4):63143. [76] Carter AM, Mess A. Evolution of the Placenta in Eutherian Mammals Placenta 2007;28(4):25962. [77] Mess A, Carte r AM. Evolutionary transformations of fetal membrane characters in Eutheria with special reference to Afrotheria. J Exp Zool B Mol Dev Evol 2006;306(2):14063. [78] Easteal S. Molecular evidence far the early divergence of placental mammals Bioessays 1999;21(12):10528. [79] Hedges SB, Parker PH, Sibley CG, Kumar S. Continental breakup and the ordinal diversification of birds and mammals Nature 1996;381(6579):2269. [80] Kumar S, Hedges SB. A molecular timescale for vertebrate evolution. Nature 1998;392(6679):91720.

PAGE 136

136 [81] David Archibald J. Timing and biogeography of the eutherian radiation: fossils and molecules compared. Mol Phylogenet Evol 2003;28(2):3509. [82] Foote M, Hunter JP, Janis CM, Sepkoski JJ, Jr. Evolutionary and preservational constra ints on origins of biologic groups: divergence times of eutherian mammals Science 1999;283(5406):13104. [83] Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the ea rly placental mammal radiation using Bayesian phylogenetics Science 2001;294(5550):234851. [84] Mess A, Carter AM. Evolution of the placenta during the early radiation of placental mammals Comparative Biochemistry and Physiology aMolecular & Integrat ive Physiology 2007;148:76979. [85] Murphy WJ, Eizirik E, Johnson WE, Zhang YP, Ryder OA, O'Brien SJ. Molecular phylogenetics and the origins of placental mammals Nature 2001;409(6820):6148. [86] Carter AM, Mess A. The common ancestor of living place ntal mammals had an endotheliochorial placenta. Placenta 2006;27(9 10):A19A. [87] Albertini DF, Overstrom EW, Ebert KM. Changes in the organization of the actin cytoskeleton during preimplantation development of the pig embryo Biol Reprod 1987;37(2):44151. [88] Geisert RD, Brookbank JW, Roberts RM, Bazer FW. Establishment of pregnancy in the pig: II. Cellular remodeling of the porcine blastocyst during elongation on day 12 of pregnancy Biol Reprod 1982;27(4):94155. [89] Mattson BA, Overstrom EW, Alb ertini DF. Transitions in trophectoderm cellular shape and cytoskeletal organization in the elongating pig blastocyst Biol Reprod 1990;42(1):195205. [90] Guillomot M, Turbe A, Hue I, Renard JP. Staging of ovine embryos and expression of the T box genes Brachyury and Eomesodermin around gastrulation Reproduction 2004;127(4):491501. [91] Chavatte Palmer P, Guillomot M. Comparative implantation and placentation. Gynecol Obstet Invest 2007;64(3):16674. [92] Spencer TE, Johnson GA, Bazer FW, Burghardt R C. Implantation mechanisms: insights from the sheep. Reproduction 2004;128(6):65768.

PAGE 137

137 [93] Guillomot M, Flechon JE, Wintenberger Torres S. Conceptus attachment in the ewe: an ultrastructural study Placenta 1981;2(2):16982. [94] Guillomot M, Guay P. Ul trastructural features of the cell surfaces of uterine and trophoblastic epithelia during embryo attachment in the cow Anat Rec 1982;204(4):31522. [95] Guillomot M. Cellular interactions during implantation in domestic ruminants J Reprod Fertil Suppl 1995;49:3951. [96] Wooding FB, Staples LD, Peacock MA. Structure of trophoblast papillae on the sheep conceptus at implantation J Anat 1982;134(Pt 3):50716. [97] Wimsatt WA. New histological observations on the placenta of the sheep. Am J Anat 1950;87( 3):391457. [98] Guillomot M, Reinaud P, La Bonnardiere C, Charpigny G. Characterization of conceptus produced goat interferon tau and analysis of its temporal and cellular distribution during early pregnancy J Reprod Fertil 1998;112(1):14956. [99] Bur ghardt RC, Burghardt JR, Taylor JD, 2nd, Reeder AT, Nguen BT, Spencer TE, Bayless KJ, Johnson GA. Enhanced focal adhesion assembly reflects increased mechanosensation and mechanotransduction at maternal conceptus interface and uterine wall during ovine pregnancy Reproduction 2009;137(3):56782. [100] Brayman M, Thathiah A, Carson DD. MUC1: a multifunctional cell surface component of reproductive tissue epithelia. Reprod Biol Endocrinol 2004;2:4. [101] Farmer JL, Burghardt RC, Jousan FD, Hansen PJ, Bazer FW, Spencer TE. Galectin 15 (LGALS15) functions in trophectoderm migration and attachment Faseb Journal 2008;22(2):54860. [102] Lewis SK, Farmer JL, Burghardt RC, Newton GR, Johnson GA, Adelson DL, Bazer FW, Spencer TE. Galectin 15 (LGALS15): a gene uni quely expressed in the uteri of sheep and goats that functions in trophoblast attachment Biol Reprod 2007;77(6):102736. [103] Muniz JJ, Joyce MM, Taylor JD, 2nd, Burghardt JR, Burghardt RC, Johnson GA. Glycosylation dependent cell adhesion molecule 1li ke protein and L selectin expression in sheep interplacentomal and placentomal endometrium Reproduction 2006;131(4):75161. [104] Johnson GA, Bazer FW, Jaeger LA, Ka H, Garlow JE, Pfarrer C, Spencer TE, Burghardt RC. Muc 1, integrin, and osteopontin expr ession during the implantation cascade in sheep. Biology of Reproduction 2001;65(3):8208.

PAGE 138

138 [105] Johnson GA, Burghardt RC, Bazer FW, Spencer TE. Osteopontin: roles in implantation and placentation. Biol Reprod 2003;69(5):145871. [106] Burghardt RC, Johnson GA, Jaeger LA, Ka H, Garlow JE, Spencer TE, Bazer FW. Integrins and extracellular matrix proteins at the maternal fetal interface in domestic animals Cells Tissues Organs 2002;172(3):20217. [107] MacIntyre DM, Lim HC, Ryan K, Kimmins S, Small JA, Ma cLaren LA. Implantation associated changes in bovine uterine expression of integrins and extracellular matrix Biol Reprod 2002;66(5):14306. [108] Bridger PS, Haupt S, Leiser R, Johnson GA, Burghardt RC, Tinneberg HR, Pfarrer C. Integrin activation in bovine placentomes and in caruncular epithelial cells isolated from pregnant cows Biol Reprod 2008;79(2):27482. [109] Hill JR, Burghardt RC, Jones K, Long CR, Looney CR, Shin T, Spencer TE, Thompson JA, Winger QA, Westhusin ME. Evidence for placental abnormality as the major cause of mortality in first trimester somatic cell cloned bovine fetuses Biol Reprod 2000;63(6):178794. [110] Heyman Y, Chavatte Palmer P, LeBourhis D, Camous S, Vignon X, Renard JP. Frequency and occurrence of lategestation losses from cattle cloned embryos Biol Reprod 2002;66(1):613. [111] Loi P, Clinton M, Vackova I, Fulka J, Jr., Feil R, Palmieri C, Della Salda L, Ptak G. Placental abnormalities associated with post natal mortality in sheep somatic cell clones Theriogenology 2006;65(6):111021. [112] Palmieri C, Loi P, Ptak G, Della Salda L. Review paper: a review of the pathology of abnormal placentae of somatic cell nuclear transfer clone pregnancies in cattle, sheep, and mice. Vet Pathol 2008;45(6):86580. [113] Palmieri C, Loi P, Reynolds LP, Ptak G, Della Salda L. Placental abnormalities in ovine somatic cell clones at term: a light and electron microscopic investigation Placenta 2007;28(5 6):57784. [114] Hill JR, Edwards JF, Sawyer N, Blackwell C, Cibelli JB. Placen tal anomalies in a viable cloned calf Cloning 2001;3(2):83 8. [115] Constant F, Guillomot M, Heyman Y, Vignon X, Laigre P, Servely JL, Renard JP, Chavatte Palmer P. Large offspring or large placenta syndrome? Morphometric analysis of late gestation bovin e placentomes from somatic nuclear transfer pregnancies complicated by hydrallantois Biology of Reproduction 2006;75(1):12230.

PAGE 139

139 [116] HoffertGoeres KA, Batchelder CA, Bertolini M, Moyer AL, Famula TR, Anderson GB. Angiogenesis in day 30 bovine pregnanci es derived from nuclear transfer Cloning Stem Cells 2007;9(4):595607. [117] Hashizume K, Ishiwata H, Kizaki K, Yamada O, Takahashi T, Imai K, Patel OV, Akagi S, Shimizu M, Takahashi S, Katsuma S, Shiojima S, Hirasawa A, Tsujimoto G, Todoroki J, Izaike Y Implantation and placental development in somatic cell clone recipient cows Cloning and Stem Cells 2002;4(3):197209. [118] Fletcher CJ, Roberts CT, Hartwich KM, Walker SK, McMillen IC. Somatic cell nuclear transfer in the sheep induces placental defec ts that likely precede fetal demise. Reproduction 2007;133(1):24355. [119] KohanGhadr HR, Lefebvre RC, Fecteau G, Smith LC, Murphy BD, Junior JS, Girard C, Helie P. Ultrasonographic and histological characterization of the placenta of somatic nuclear tr ansfer derived pregnancies in dairy cattle. Theriogenology 2008;69:21830. [120] Arnold DR, Fortier AL, Lefebvre R, Miglino MA, Pfarrer C, Smith LC. Placental insufficiencies in cloned animals a workshop report Placenta 2008;29 (Suppl A):S10810. [121] Ravelich SR, Breier BH, Reddy S, Keelan JA, Wells DN, Peterson AJ, Lee RS. Insulin like growth factor I and binding proteins 1, 2, and 3 in bovine nuclear transfer pregnancies Biol Reprod 2004;70(2):4308. [122] Hill JR, Schlafer DH, Fisher PJ, Davies CJ. Abnormal expression of trophoblast major histocompatibility complex class I antigens in cloned bovine pregnancies is associated with a pronounced endometrial lymphocytic response Biol Reprod 2002;67(1):5563. [123] Miles JR, Farin CE, Rodriguez KF, A lexander JE, Farin PW. Effects of embryo culture on angiogenesis and morphometry of bovine placentas during early gestation Biology of Reproduction 2005;73(4):66371. [124] Patel OV, Yamada O, Kizaki K, Takahashi T, Imai K, Takahashi S, Izaike Y, Schuler LA, Takezawa T, Hashizume K. Expression of trophoblast cell specific pregnancy related genes in somatic cell cloned bovine pregnancies Biol Reprod 2004;70(4):111420. [125] Ravelich SR, Shelling AN, Ramachandran A, Reddy S, Keelan JA, Wells DN, Peterson AJ, Lee RS, Breier BH. Altered placental lactogen and leptin expression in placentomes from bovine nuclear transfer pregnancies Biol Reprod 2004;71(6):18629.

PAGE 140

140 [126] Wooding FBP, Morgan G, Brandon MR, Camous S. Membrane dynamics during migration of placental cells through trophectodermal tight junctions in sheep and goats Cell and Tissue Research 1994;276(2):38797. [127] Boshier DP, Holloway H. Sheep trophoblast and placental function ultrastructural study Journal of Anatomy 1977;124(NOV):28798. [ 128] Roberts RM, Cross JC, Leaman DW. Interferons as hormones of pregnancy Endocrine Reviews 1992;13(3):43252. [129] Spencer TE, Burghardt RC, Johnson GA, Bazer FW. Conceptus signals for establishment and maintenance of pregnancy Animal Reproduction Sc ience 2004;823:53750. [130] Spencer TE, Ott TL, Bazer FW. tau Interferon: pregnancy recognition signal in ruminants Proc Soc Exp Biol Med 1996;213(3):21529. [131] Thatcher WW, Meyer MD, Danet Desnoyers G. Maternal recognition of pregnancy J Reprod F ertil Suppl 1995;49:1528. [132] Bazer FW, Spencer TE, Ott TL. Interferon tau: A novel pregnancy recognition signal American Journal of Reproductive Immunology 1997;37(6):41220. [133] Martal J, Chene N, Camous S, Huynh L, Lantier F, Hermier P, Lharidon R, Charpigny G, Charlier M, Chaouat G. Recent developments and potentialities for reducing embryo mortality in ruminants: The role of IFN tau and other cytokines in early pregnancy Reproduction Fertility and Development 1997;9(3):35580. [134] Lamming G E, Wathes DC, Flint AP, Payne JH, Stevenson KR, Vallet JL. Local action of trophoblast interferons in suppression of the development of oxytocin and oestradiol receptors in ovine endometrium J Reprod Fertil 1995;105(1):16575. [135] Flint AP. Interferon, the oxytocin receptor and the maternal recognition of pregnancy in ruminants and nonruminants: a comparative approach Reprod Fertil Dev 1995;7(3):3138. [136] Thatcher WW, Binelli M, Burke J, Staples CR, Ambrose JD, Coelho S. Antiluteolytic signals bet ween the conceptus and endometrium Theriogenology 1997;47(1):13140. [137] Gray CA, Taylor KM, Ramsey WS, Hill JR, Bazer FW, Bartol FF, Spencer TE. Endometrial glands are required for preimplantation conceptus elongation and survival Biology of Reproduc tion 2001;64(6):160813.

PAGE 141

141 [138] Gray CA, Bartol FF, Tarleton BJ, Wiley AA, Johnson GA, Bazer FW, Spencer TE. Developmental biology of uterine glands Biology of Reproduction 2001;65(5):131123. [139] Spencer TE, Bazer FW. Uterine and placental factors re gulating growth in domestic animals Journal of Animal Science 2004;82(E. Suppl.):E4E13. [140] Talbot NC, Powell AM, Camp M, Ealy AD. Establishment of a bovine blastocyst derived cell line collection for the comparative analysis of embryos created in viv o and by in vitro fertilization, somatic cell nuclear transfer, or parthenogenetic activation In Vitro Cell Dev Biol Anim 2007;43(2):5971. [141] Miyazaki H, Imai M, Hirayama T, Saburi S, Tanaka M, Maruyama M, Matsuo C, Meguro H, Nishibashi K, Inoue F, D jiane J, Gertler A, Tachi S, Imakawa K, Tachi C. Establishment of feeder independent cloned caprine trophoblast cell line which expresses placental lactogen and interferon tau Placenta 2002;23(8 9):61330. [142] Talbot NC, Caperna TJ, Edwards JL, Garrett W, Wells KD, Ealy AD. Bovine blastocyst derived trophectoderm and endoderm cell cultures: Interferon tau and transferrin expression as respective in vitro markers Biology of Reproduction 2000;62(2):23547. [143] Talbot NC, Caperna TJ, Powell AM, Garrett WM, Ealy AD. Isolation and characterization of a bovine trophectoderm cell line derived from a parthenogenetic blastocyst Molecular Reproduction and Development 2004;69(2):16473. [144] Talbot NC, Powell AM, Ocon OM, Caperna TJ, Camp M, Garrett WM, Ealy AD. Comparison of the interferon tau expression from primary trophectoderm outgrowths derived from IVP, NT, and parthenogenote bovine blastocysts Mol Reprod Dev 2008;75(2):299308. [145] Michael DD, Wagner SK, Ocon OM, Talbot NC, Rooke JA, Ealy AD. Gran ulocyte macrophage colony stimulating factor increases interferon tau protein secretion in bovine trophectoderm cells American Journal of Reproductive Immunology 2006;56(1):637. [146] Michael DD, Alvarez IM, Ocon OM, Powell AM, Talbot NC, Johnson SE, Ealy AD. Fibroblast growth factor 2 is expressed by the bovine uterus and stimulates interferon tau production in bovine trophectoderm Endocrinology 2006;147(7):35719. [147] Cooke FNT, Pennington KA, Yang Q, Ealy AD. Several fibroblast growth factors are expressed during preattachment bovine conceptus development and

PAGE 142

142 regulate interferon tau expression from trophectoderm Reproduction 2009;137(2):25969. [148] Shimada A, Nakano H, Takahashi T, Imai K, Hashizume K. Isolation and characterization of a bovin e blastocyst derived trophoblastic cell line, BT 1: Development of a culture system in the absence of feeder cell Placenta 2001;22(7):65262. [149] Nakano H, Shimada A, Imai K, Takezawa T, Takahashi T, Hashizume K. Bovine trophoblastic cell differentiati on on collagen substrata: formation of binucleate cells expressing placental lactogen. Cell and Tissue Research 2002;307(2):22535. [150] Ushizawa K, Takahashi T, Kaneyama K, Tokunaga T, Tsunoda Y, Hashizume K. Gene expression profiles of bovine trophoblastic cell line (BT 1) analyzed by a custom cDNA microarray Journal of Reproduction and Development 2005;51(2):21120. [151] Hayashi K, Burghardt RC, Bazer FW, Spencer TE. WNTs in the ovine uterus: potential regulation of periimplantation ovine conceptus development Endocrinology 2007;148(7):3496506. [152] Kim J, Song G, Gao H, Farmer JL, Satterfield MC, Burghardt RC, Wu G, Johnson GA, Spencer TE, Bazer FW. Insulin like growth factor II activates phosphatidylinositol 3kinase protooncogenic protein kinase 1 and mitogenactivated protein kinase cell Signaling pathways, and stimulates migration of ovine trophectoderm cells Endocrinology 2008;149(6):308594. [153] Steven DH, Mallon KA, Nathanielsz PW. Sheep trophoblast in monolayer cell culture Placenta 1980;1(3):20921. [154] Wooding FB. The role of the binucleate cell in ruminant placental structure. J.Reprod.Fertil.Suppl 1982;31:319. [155] Klisch K, Pfarrer C, Schuler G, Hoffmann B, Leiser R. Tripolar acytokinetic mitosis and formation of fetomater nal syncytia in the bovine placentome: different modes of the generation of multinuclear cells Anat Embryol 1999;200:22937. [156] Schuler G, Greven H, Kowalewski MP, Doring B, Ozalp GR, Hoffmann B. Placental steroids in cattle: hormones, placental growt h factors or by products of trophoblast giant cell differentiation? Exp Clin Endocrinol Diabetes 2008;116(7):42936. [157] Patel OV, Yamada O, Kizaki K, Todoroki K, Takahashi T, Imai K, Schuler LA, Hashizume K. Temporospatial expression of placental lactogen and prolactin -

PAGE 143

143 related protein1 genes in the bovine placenta and uterus during pregnancy Molecular Reproduction and Development 2004;69(2):14652. [158] Xie SC, Low BG, Nagel RJ, Kramer KK, Anthony RV, Zoli AP, Beckers JF, Roberts RM. Identification of the major pregnancy specific antigens of cattle and sheep as inactive members of the aspartic proteinase family Proceedings of the National Academy of Sciences of the United States of America 1991;88(22):10247 51. [159] Wooding FBP. Frequency and loca lization of binucleate cells in the placnetomes of ruminants Placenta 1983;4:52739. [160] Wooding FBP, Morgan G, Adam CL. Structure and function in the ruminant synepitheliochorial placenta: Central role of the trophoblast binucleate cell in deer Micro scopy Research and Technique 1997;38(12):8899. [161] Wango EO, Wooding FBP, Heap RB. The role of trophoblastic binucleate cells in implantation in the goat a morphological study Journal of Anatomy 1990;171:24157. [162] Hradecky P. Placental morphol ogy in african antelopes and giraffes Theriogenology 1983;20(6):72534. [163] Hradecky P, Mossman HW, Stott GG. Comparative histology of antelope placentomes Theriogenology 1988;29(3):693714. [164] Olivera LV, Zago DA, Jones CJ, Bevilacqua E. Developm ental changes at the maternoembryonic interface in early pregnancy of the alpaca, Lamos pacos Anat Embryol (Berl) 2003;207(45):31731. [165] Klisch K, Bevilacqua E, Olivera LV. Mitotic polyploidization in trophoblast giant cells of the alpaca Cells Tissues Organs 2005;181(2):1038. [166] Carvalho AF, Klisch K, Miglino MA, Pereira FTV, Bevilacqua E. Binucleate trophoblast giant cells in the water buffalo (Bubalus bubalis) placenta. Journal of Morphology 2006;267(1):506. [167] Kimura J, Sasaki M, Endo H, Fukuta K. Anatomical and histological characterization of the female reproductive organs of mouse deer (Tragulidae) Placenta 2004;25(8 9):70511. [168] Wooding FB, Kimura J, Fukuta K, Forhead AJ. A light and electron microscopical study of the Tragul id (mouse deer) placenta. Placenta 2007;28(10):103948.

PAGE 144

144 [169] Hassanin A, Douzery EJ. Molecular and morphological phylogenies of ruminantia and the alternative position of the moschidae. Syst Biol 2003;52(2):20628. [170] Boshier DP. A histological and histochemical examination of implantation and early placentome formation in sheep Journal of Reproduction and Fertility 1969;19(1):51&. [171] Wango EO, Wooding FBP, Heap RB. The role of trophoblast binucleate cells in implantation in the goat a quantit ative study Placenta 1990;11(5):38194. [172] Wooding FB, Flint AP, Heap RB, Morgan G, Buttle HL, Young IR. Control of binucleate cell migration in the placenta of sheep and goats J Reprod Fertil 1986;76(2):499512. [173] Ward JW, Wooding FBP, Fowden A L. The effects of cortisol on the binucleate cell population in the ovine placenta during late gestation. Placenta 2002;23(6):4518. [174] Gross TS, Williams WF, RussekCohen E. Cellular changes in the peripartum bovine fetal placenta related to placental separation Placenta 1991;12(1):2735. [175] Klisch K, Hecht W, Pfarrer C, Schuler G, Hoffmann B, Leiser R. DNA content and ploidy level of bovine placentomal trophoblast giant cells Placenta 1999;20(5 6):4518. [176] Spencer TE, Dunlap KA, Palmarini M A. Endogenous betaretroviruses of sheep: Biological roles in uterine function and placental morphogenesis Biology of Reproduction 2005:767. [177] Wooding FB. Electron microscopic localization of binucleate cells in the sheep placenta using phosphotungst ic acid Biol Reprod 1980;22(2):35765. [178] Wooding FBP, Morgan G, Monaghan S, Hamon M, Heap RB. Functional specialization in the ruminant placenta: Evidence for two populations of fetal binucleate cells of different selective synthetic capacity Placen ta 1996;17(1):7586. [179] Wooding FB. Role of binucleate cells in fetomaternal cell fusion at implantation in the sheep Am J Anat 1984;170(2):23350. [180] Morgan G, Wooding FB. Cell migration in the ruminant placenta: a freeze fracture study J Ultra struct Res 1983;83(2):148 60. [181] Wooding FBP. The role of the binucleate cell in ruminant placental structure. Journal of Reproduction and Fertility 1982:31.

PAGE 145

145 [182] Hashizume K, Ushizawa K, Patel OV, Kizaki K, Imai K, Yamada O, Nakano H, Takahashi T. G ene expression and maintenance of pregnancy in bovine: Roles of trophoblastic binucleate cell specific molecules Reproduction Fertility and Development 2007;19(1):7990. [183] Wooding FBP, Flint APF, Heap RB, Morgan G, Buttle HL, Young IR. Control of bin ucleate cell migration in the placenta of sheep and goats Journal of Reproduction and Fertility 1986;76(2):499512. [184] Wathes D, Wooding FB. An electron microscopic study of implantation in the cow Am. J. Anatomy 1980;159(3):285306. [185] Gross TS Williams WF. In vitro steroid synthesis by the placenta of cows in late gestation and at parturition J Reprod Fertil 1988;83(2):56573. [186] Wango EO, Heap RB, Wooding FB. Progesterone and 5 beta pregnanediol production by isolated fetal placental bi nucleate cells from sheep and goats J Endocrinol 1991;129(2):2839. [187] Reimers TJ, Ullmann MB, Hansel W. Progesterone and prostanoid production by bovien binucleate trophoblastic cells Biology of Reproduction 1985;33(5):122736. [188] Ullmann MB, Reimers TJ. Progesterone production by binucleate trophoblastic cells of cows J Reprod Fertil Suppl 1989;37:1739. [189] Gross TS, Williams WF. Bovine placental prostaglandin synthesis: principal cell synthesis as modulated by the binucleate cell Biol Reprod 1988;38(5):102734. [190] Matamoros RA, Caamano L, Lamb SV, Reimers TJ. Estrogen production by bovine binucleate and mononucleate trophoblastic cells in vitro. Biol Reprod 1994;51(3):48692. [191] Vanselow J, Furbass R, Tiemann U. Cultured bovine t rophoblast cells differentially express genes encoding key steroid synthesis enzymes Placenta 2008;29(6):5318. [192] Kandiel MM, Watanabe G, Sosa GA, Abou El Roos ME, Abdel Ghaffar AE, Li JY, Manabe N, El Azab Ael S, Taya K. Profiles of circulating ster oid hormones, gonadotropins, immunoreactive inhibin and prolactin during pregnancy in goats and immunolocalization of inhibin subunits, steroidogenic enzymes and prolactin in the corpus luteum and placenta J Reprod Dev;56(2):24350. [193] Alvarez Oxiley AV, de Sousa NM, Beckers JF. Native and recombinant bovine placental lactogens Reprod Biol 2008;8(2):85106.

PAGE 146

146 [194] Duello TM, Byatt JC, Bemel RD. Immunohistochemical localization of placental lactogen in binucleate cells of bovine placentomes. Endocrinol ogy 1986;119(3):3515. [195] Schuler LA, Shimomura K, Kessler MA, Zieler CG, Bremel RD. Bovine placental lactogen molecular cloning and protein structure Biochemistry 1988;27(22):84438. [196] Anthony RV, Pratt SL, Liang R, Holland MD. Placental Fetal Hormonal Interactions: Impact on Fetal Growth Journal of Animal Science 1995;73:186171. [197] Byatt JC, Warren WC, Eppard PJ, Staten NR, Krivi GG, Collier RJ. Ruminant placental lactogens: structure and biology J Anim Sci 1992;70(9):291123. [198] By att JC, Welply JK, Leimgruber RM, Collier RJ. Characterization of glycosylated bovine placental lactogen and the effect of enzymatic deglycosylation on receptor binding and biological activity Endocrinology 1990;127(3):10419. [199] Galosy SS, Gertler A, Elberg G, Laird DM. Distinct placental lactogen and prolactin (lactogen) receptors in bovine endometrium Mol Cell Endocrinol 1991;78(3):22936. [200] Freemark M, Comer M. Purification of a distinct placental lactogen receptor, a new member of the growt h hormone/prolactin receptor family J Clin Invest 1989;83(3):8839. [201] Lucy MC, Byatt JC, Curran TL, Curran DF, Collier RJ. Placental lactogen and somatotropin: hormone binding to the corpus luteum and effects on the growth and functions of the ovary in heifers Biol Reprod 1994;50(5):113644. [202] Rasby RJ, Wettemann RP, Geisert RD, Rice LE, Wallace CR. Nutrition, body condition and reproduction in beef cows: fetal and placental development, and estrogens and progesterone in plasma J Anim Sci 1990; 68(12):426776. [203] Handwerger S. Clinical counterpoint: the physiology of placental lactogen in human pregnancy Endocr Rev 1991;12(4):32936. [204] Freemark M, Comer M, Mularoni T, D'Ercole AJ, Grandis A, Kodack L. Nutritional regulation of the placental lactogen receptor in fetal liver: implications for fetal metabolism and growth. Endocrinology 1989;125(3):150412. [205] Freemark M, Handwerger S. The role of placental lactogen in the regulation of fetal metabolism and growth. J Pediatr Gastroenter ol Nutr 1989;8(3):2813.

PAGE 147

147 [206] Leibovich H, Gertler A, Bazer FW, Gootwine E. Active immunization of ewes against ovine placental lactogen increases birth weight of lambs and milk production with no adverse effect on conception rate Anim Reprod Sci 2000;64(1 2):3347. [207] Byatt JC, Staten NR, Schmuke JJ, Buonomo FC, Galosy SS, Curran DF, Krivi GG, Collier RJ. Stimulation of body weight gain of the mature female rat by bovine GH and bovine placental lactogen J Endocrinol 1991;130(1):119. [208] Byatt J C, Eppard PJ, Munyakazi L, Sorbet RH, Veenhuizen JJ, Curran DF, Collier RJ. Stimulation of milk yield and feed intake by bovine placental lactogen in the dairy cow J Dairy Sci 1992;75(5):121623. [209] Byatt JC, Eppard PJ, Veenhuizen JJ, Curran TL, Curra n DF, McGrath MF, Collier RJ. Stimulation of mammogenesis and lactogenesis by recombinant bovine placental lactogen in steroidprimed dairy heifers J Endocrinol 1994;140(1):3343. [210] Byatt JC, Sorbet RH, Eppard PJ, Curran TL, Curran DF, Collier RJ. Th e effect of recombinant bovine placental lactogen on induced lactation in dairy heifers J Dairy Sci 1997;80(3):496503. [211] Schams D, Russe I, Schallenberger E, Prokopp S, Chan JS. The role of steroid hormones, prolactin and placental lactogen on mamma ry gland development in ewes and heifers J Endocrinol 1984;102(1):12130. [212] Milosavljevic M, Duello TM, Schuler LA. In situ localization of two prolactin related messenger ribonucleic acids to binucleate cells of bovine placentomes Endocrinology 198 9;125(2):8839. [213] Ushizawa K, Kaneyama K, Takahashi T, Tokunaga T, Tsunoda Y, Hashizume K. Cloning and expression of a new member of prolactin related protein in bovine placenta: bovine prolactin related proteinVII. Biochemical and Biophysical Resear ch Communications 2005;326(2):43541. [214] Ushizawa K, Takahashi T, Hosoe M, Kaneyama K, Hashizume K. Cloning and expression of two new prolactinrelated proteins, prolactinrelated protein VIII and IX, in bovine placenta. Reprod Biol Endocrinol 2005;3: 68. [215] Zieler CG, Kessler MA, Schuler LA. Characterization of a novel prolactin related protein from bovine fetal placenta. Endocrinology 1990;126(5):237782. [216] Kessler MA, Duello TM, Schuler LA. Expression of prolactin related hormones in the ear ly bovine conceptus, and potential for paracrine effect on the endometrium Endocrinology 1991;129(4):188595.

PAGE 148

148 [217] Yamada O, Todoroki J, Kizaki K, Takahashi T, Imai K, Patel OV, Schuler LA, Hashizume K. Expression of prolactin related protein I at the f etornaternal interface during the implantation period in cows Reproduction 2002;124(3):42737. [218] Green JA, Xie SC, Quan X, Bao BN, Gan XS, Mathialagan N, Beckers JF, Roberts RM. Pregnancy associated bovine and ovine glycoproteins exhibit spatially an d temporally distinct expression patterns during pregnancy Biology of Reproduction 2000;62(6):162431. [219] Garbayo JM, Green JA, Manikkam M, Beckers JF, Kiesling DO, Ealy AD, Roberts RM. Caprine pregnancy associated glycoproteins (PAG): their cloning, expression, and evolutionary relationship to other PAG Mol Reprod Dev 2000;57(4):31122. [220] Xie S, Green J, Roberts RM. Expression of multiple genes for pregnancy associated glycoproteins in the sheep placenta. Adv Exp Med Biol 1998;436:195200. [221] Klisch K, De Sousa NM, Beckers JF, Leiser R, Pich A. Pregnancy associated glycoprotein1, 6, 7, and 17 are major products of bovine binucleate trophoblast giant cells at midpregnancy Molecular Reproduction and Development 2005;71(4):45360. [222] Hughe s AL, Green JA, Garbayo JM, Roberts RM. Adaptive diversification within a large family of recently duplicated, placentally expressed genes Proc Natl Acad Sci U S A 2000;97(7):331923. [223] Hughes AL, Green JA, Piontkivska H, Roberts RM. Aspartic protein ase phylogeny and the origin of pregnancy associated glycoproteins Mol Biol Evol 2003;20(11):19405. [224] Wooding FBP, Roberts RM, Green JA. Light and electron microscope immunocytochemical studies of the distribution of pregnancy associated glycoprotei ns (PAGs) throughout pregnancy in the cow: Possible functional implications Placenta 2005;26(10):80727. [225] Garbayo JM, Serrano B, Lopez Gatius F. Identification of novel pregnancy associated glycoproteins (PAG) expressed by the peri implantation conc eptus of domestic ruminants Animal Reproduction Science 2008;103:12034. [226] Xie S, Green J, Bao B, Beckers JF, Valdez KE, Hakami L, Roberts RM. Multiple pregnancy associated glycoproteins are secreted by day 100 ovine placental tissue Biol Reprod 1997;57(6):138493.

PAGE 149

149 [227] Xie S, Green J, Bixby JB, Szafranska B, DeMartini JC, Hecht S, Roberts RM. The diversity and evolutionary relationships of the pregnancy associated glycoproteins, an aspartic proteinase subfamily consisting of many trophoblast expr essed genes Proc.Natl.Acad.Sci.U.S.A 1997;94(24):1280916. [228] Guruprasad K, Blundell TL, Xie S, Green J, Szafranska B, Nagel RJ, McDowell K, Baker CB, Roberts RM. Comparative modelling and analysis of amino acid substitutions suggests that the family of pregnancy associated glycoproteins includes both active and inactive aspartic proteinases Protein Eng 1996;9(10):84956. [229] Green JA, Parks TE, Avalle MP, Telugu BP, McLain AL, Peterson AJ, McMillan W, Mathialagan N, Hook RR, Xie S, Roberts RM. The establishment of an ELISA for the detection of pregnancy associated glycoproteins (PAGs) in the serum of pregnant cows and heifers Theriogenology 2005;63(5):1481503. [230] Sousa NM, Ayad A, Beckers JF, Gajewski Z. Pregnancy associated glycoproteins (PA G) as pregnancy markers in the ruminants J Physiol Pharmacol 2006;57 (Suppl 8):15371. [231] Sousa NM, Beckers JF, Gajewski Z. Current trends in follow up of trophoblastic function in ruminant species J Physiol Pharmacol 2008;59 (Suppl 9):65 74. [232] El Amiri B, Melo de Sousa N, Mecif K, Desbuleux H, Banga Mboko H, Beckers JF. Double radial immunodiffusion as a tool to identify pregnancy associated glycoproteins in ruminant and nonruminant placentae. Theriogenology 2003;59(56):1291301. [233] Zoli AP Guilbault LA, Delahaut P, Ortiz WB, Beckers JF. Radioimmunoassay of a bovine pregnancy associated glycoprotein in serum: its application for pregnancy diagnosis Biol Reprod 1992;46(1):8392. [234] Lopez Gatius F, Hunter RH, Garbayo JM, Santolaria P, Ya niz J, Serrano B, Ayad A, de Sousa NM, Beckers JF. Plasma concentrations of pregnancy associated glycoprotein1 (PAG 1) in high producing dairy cows suffering early fetal loss during the warm season Theriogenology 2007;67(8):132430. [235] Thompson IM, C erri RLA, Kim IH, Green JA, Santos JEP, Thatcher WW. Effects of resynchronization programs on pregnancy per artificial insemination, progesterone, and pregnancy associated glycoproteins in plasma of lactating dairy cows Journal of Dairy Science In press;doi:10.3168/jds.20092941:113. [236] Lopez Gatius F, Garbayo JM, Santolaria P, Yaniz J, Ayad A, de Sousa NM, Beckers JF. Milk production correlates negatively with plasma levels of pregnancy associated glycoprotein (PAG) during the early fetal period in h igh

PAGE 150

150 producing dairy cows with live fetuses Domest Anim Endocrinol 2007;32(1):2942. [237] Munson L, Kao JJ, Schlafer DH. Characterization of glycoconjugates in the bovine endometrium and chorion by lectin histochemistry J Reprod Fertil 1989;87(2):50917. [238] Lehmann M, Russe I, Sinowatz F. [Detection of lectin binding sites in the trophoblast of cattle during early pregnancy] Anat Histol Embryol 1992;21(3):26370. [239] Jones CJ, Koob B, Stoddart RW, Hoffmann B, Leiser R. Lectinhistochemical analys is of glycans in ovine and bovine near term placental binucleate cells Cell Tissue Res 1994;278(3):60110. [240] Nakano H, Shimada A, Imai K, Takahashi T, Hashizume K. Association of Dolichos biflorus lectin binding with full differentiation of bovine tr ophoblast cells Reproduction 2002;124(4):58192. [241] Klisch K, Wooding FB, Jones CJ. The glycosylation pattern of secretory granules in binucleate trophoblast cells is highly conserved in ruminants Placenta 2010;31(1):117. [242] Lee CS, GogolinEwen s K, White TR, Brandon MR. Studies on the distribution of binucleate cells in the placenta of the sheep with a monoclonal antibody SBU 3 J Anat 1985;140 ( Pt 4):56576. [243] Lee CS, Ralph MM, GogolinEwens KJ, Brandon MR. Monoclonal antibody (SBU 1 and SBU 3) identification of cells dissociated from the sheep placentomal trophoblast J Histochem Cytochem 1990;38(5):64952. [244] Kizaki K, Yamada O, Nakano H, Takahashi T, Yamauchi N, Imai K, Hashizume K. Cloning and localization of heparanase in bovine p lacenta Placenta 2003;24(4):42430. [245] Kizaki K, Nakano H, Takahashi T, Imai K, Hashizume K. Expression of heparanase mRNA in bovine placenta during gestation Reproduction 2001;121(4):57380. [246] Dempsey LA, Brunn GJ, Platt JL. Heparanase, a poten tial regulator of cell matrix interactions Trends Biochem Sci 2000;25(8):34951. [247] Dempsey LA, Plummer TB, Coombes SL, Platt JL. Heparanase expression in invasive trophoblasts and acute vascular damage. Glycobiology 2000;10(5):467 75.

PAGE 151

151 [248] Edwards DR, Handsley MM, Pennington CJ. The ADAM metalloproteinases Mol Aspects Med 2008;29(5):25889. [249] Primakoff P, Myles DG. The ADAM gene family: surface proteins with adhesion and protease activity Trends Genet 2000;16(2):837. [250] Xiang WY, MacLaren LA. Expression of fertilin and CD9 in bovine trophoblast and endometrium during implantation. Biology of Reproduction 2002;66(6):17906. [251] Maecker HT, Todd SC, Levy S. The tetraspanin superfamily: molecular facilitators FASEB J 1997;11(6):42842. [252] Liu WM, Cao YJ, Yang YJ, Li J, Hu Z, Duan EK. Tetraspanin CD9 regulates invasion during mouse embryo implantation Journal of Molecular Endocrinology 2006;36(1):12130. [253] Hirano T, Higuchi T, Katsuragawa H, Inoue T, Kataoka N, Park KR, Ueda M, Maeda M, Fujiwara H, Fujii S. CD9 is involved in invasion of human trophoblast like choriocarcinoma cell line, BeWo cells Mol Hum Reprod 1999;5(2):16874. [254] Hirano T, Higuchi T, Ueda M, Inoue T, Kataoka N, Maeda M, Fujiwara H, Fujii S. CD9 is expres sed in extravillous trophoblasts in association with integrin alpha(3) and integrin alpha(5) Molecular Human Reproduction 1999;5(2):1627. [255] Lessey BA, Castelbaum AJ. Integrins and implantation in the human Rev Endocr Metab Disord 2002;3(2):10717. [256] Aplin JD, Jones CJP, Harris LK. Adhesion Molecules in Human Trophoblast A Review. I. Villous Trophoblast Placenta 2009;30(4):2938. [257] Harris LK, Jones CJP, Aplin JD. Adhesion Molecules in Human Trophoblast A Review. II. Extravillous Troph oblast Placenta 2009;30(4):299304. [258] MacLaren LA, Wildeman AG. Fibronectin receptors in preimplantation development: cloning, expression, and localization of the alpha 5 and beta 1 integrin subunits in bovine trophoblast Biol Reprod 1995;53(1):15365. [259] Pfarrer C, Hirsch P, Guillomot M, Leiser R. Interaction of integrin receptors with extracellular matrix is involved in trophoblast giant cell migration in bovine placentomes Placenta 2003;24(6):58897. [260] Landim LP, Miglino MA, Pfarrer C, Ambrosio CE, Garcia JM. Culture of mature trophoblastic giant cells from bovine placentomes Animal Reproduction Science 2007;98(34):35764.

PAGE 152

152 [261] Nakano H, Takahashi T, Imai K, Hashizume K. Expression of placental lactogen and cytokeratin in bovine plac ental binucleate cells in culture. Cell Tissue Res. 2001;303:26370. [262] Wango EO, Heap RB, Wooding FBP. Regulation of steroid sythesis and metabolism in isolated binucleate cells of the placneta in sheep and goats Journal of Reproduction and Fertility 1992;94(1):203 11. [263] Bainbridge DRJ, Sargent IL, Ellis SA. Increased expression of major histocompatibility complex (MHC) class I transplantation antigens in bovine trophoblast cells before fusion with maternal cells Reproduction 2001;122(6):90713. [264] Morgan G, Whyte A, Wooding FB. Characterization of the synthetic capacities of isolated placental binucleate cells from sheep and goats Anat Rec 1990;226(1):2736. [265] Tolkunova E, Cavaleri F, Eckardt S, Reinbold R, Chiustenson LK, Scholer HR, Tomilin A. The caudal related protein Cdx2 promotes trophoblast differentiation of mouse embryonic stem cells Stem Cells 2006;24(1):13944. [266] Jedrusik A, Parfitt DE, Guo G, Skamagki M, Grabarek JB, Johnson MH, Robson P, Zernicka Goetz M. Role of Cdx2 and cell polarity in cell allocation and specification of trophectoderm and inner cell mass in the mouse embryo. Genes & Development 2008;22(19):2692706. [267] Roberts RM, Ezashi T, Das P. Trophoblast gene expression: transcription factors in the specif ication of early trophoblast Reprod Biol Endocrinol 2004;2:47. [268] Vejlsted M, Avery B, Schmidt M, Greve T, Alexopoulos N, Maddox Hyttel P. Ultrastructural and immunohistochemical characterization of the bovine epiblast Biology of Reproduction 2005;72 (3):67886. [269] Rielland M, Hue I, Renard JP, Alice J. Trophoblast stem cell derivation, cross species comparison and use of nuclear transfer: New tools to study trophoblast growth and differentiation Developmental Biology 2008;322(1):110. [270] Nish ioka N, Yamamoto S, Kiyonari H, Sato H, Sawada A, Ota M, Nakao K, Sasaki H. Tead4 is required for specification of trophectoderm in preimplantation mouse embryos Mech Dev 2008;125(3 4):27083. [271] Russ AP, Wattler S, Colledge WH, Aparicio SA, Carlton MB, Pearce JJ, Barton SC, Surani MA, Ryan K, Nehls MC, Wilson V, Evans MJ. Eomesodermin is required for mouse trophoblast development and mesoderm formation Nature 2000;404(6773):95 9.

PAGE 153

153 [272] Degrelle SA, Campion E, Cabau C, Piumi F, Reinaud P, Richard C, Renard JP, Hue I. Molecular evidence for a critical period in mural trophoblast development in bovine blastocysts Developmental Biology 2005;288(2):44860. [273] van Eijk MJ, van Rooijen MA, Modina S, Scesi L, Folkers G, van Tol HT, Bevers MM, Fisher SR Lewin HA, Rakacolli D, Galli C, de Vaureix C, Trounson AO, Mummery CL, Gandolfi F. Molecular cloning, genetic mapping, and developmental expression of bovine POU5F1. Biol Reprod 1999;60(5):1093103. [274] Hall VJ, Ruddock NT, French AJ. Expression profi ling of genes crucial for placental and preimplantation development in bovine in vivo, in vitro, and nuclear transfer blastocysts Mol Reprod Dev 2005;72(1):1624. [275] Cross JC. Genetic insights into trophoblast differentiation and placental morphogenes is Seminars in Cell & Developmental Biology 2000;11(2):10513. [276] Cross JC. How to make a placenta: mechanisms of trophoblast cell differentiation in mice -a review Placenta 2005;26 (Suppl A):S39. [277] Loregger T, Pollheimer J, Knofler M. Regulatory transcription factors controlling function and differentiation of human trophoblast A review Placenta 2003;24:S104S10. [278] Hu D, Cross JC. Development and function of trophoblast giant cells in the rodent placenta Int J Dev Biol;54(23):34154. [279] Goncalves CR, Antonini S, Vianna Morgante AM, MachadoSantelli GM, Bevilacqua E. Developmental changes in the ploidy of mouse implanting trophoblast cells in vitro Histochemistry and Cell Biology 2003;119(3):189 98. [280] Cross JC. Genes Regulati ng Embryonic and Fetal Survival Theriogenology 2001;55:193207. [281] Ephrussi A, Church GM, Tonegawa S, Gilbert W. B lineage--specific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science 1985;227(4683):13440. [282] Massar i ME, Murre C. Helix loophelix proteins: Regulators of transcription in eucaryotic organisms Molecular and Cellular Biology 2000;20(2):42940. [283] Ellenberger T, Fass D, Arnaud M, Harrison SC. Crystal structure of transcription factor E47: E box recognition by a basic region helix loophelix dimer Genes Dev 1994;8(8):970 80. [284] Atchley WR, Fitch WM. A natural classification of the basic helix loophelix class of transcription factors Proc Natl Acad Sci U S A 1997;94(10):51726.

PAGE 154

154 [285] Murre C, Bain G, van Dijk MA, Engel I, Furnari BA, Massari ME, Matthews JR, Quong MW, Rivera RR, Stuiver MH. Structure and function of helix loophelix proteins Biochim Biophys Acta 1994;1218(2):12935. [286] Murre C, McCaw PS, Vaessin H, Caudy M, Jan LY, Jan YN, Cabrera CV, Buskin JN, Hauschka SD, Lassar AB, et al. Interactions between heterologous helix loophelix proteins generate complexes that bind specifically to a common DNA sequence Cell 1989;58(3):53744. [287] Aronheim A, Shiran R, Rosen A, Walker MD. The E2A gene product contains two separable and functionally distinct transcription activation domains Proc Natl Acad Sci U S A 1993;90(17):80637. [288] Thattaliyath BD, Livi CB, Steinhelper ME, Toney GM, Firulli AB. HAND1 and HAND2 are expressed in the adult rodent heart and are modulated during cardiac hypertrophy Biochemical and Biophysical Research Communications 2002;297(4):8705. [289] Firulli AB. A HANDful of questions: the molecular biology of the heart and neural crest derivatives (HAND) subcl ass of basic helix loophelix transcription factors Gene 2003;312:27 40. [290] Scott IC, Anson Cartwright L, Riley P, Reda D, Cross JC. The HAND1 basic helix loophelix transcription factor regulates trophoblast differentiation via multiple mechanisms M olecular and Cellular Biology 2000;20(2):53041. [291] Kewley RJ, Whitelaw ML, ChapmanSmith A. The mammalian basic helix loophelix/PAS family of transcriptional regulators International Journal of Biochemistry & Cell Biology 2004;36(2):189204. [292] Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H. The protein Id: a negative regulator of helix loophelix DNA binding proteins Cell 1990;61(1):49 59. [293] Maltepe E, Bakardjiev AI, Fisher SJ. The placenta: transcriptional, epigenetic, and physiological integration during development J Clin Invest;120(4):101625. [294] Cross JC, Flannery ML, Blanar MA, Steingrimsson E, Jenkins NA, Copeland NG, Rutter WJ, Werb Z. HXT encodes a basic helix loophelix transcription factor that regulates trophoblast cell development Development 1995;121(8):251323. [295] Riley P, Anson Cartwright L, Cross JC. The Hand1 bHLH transcription factor is essential for placentation and cardiac morphogenesis Nature Genetics 1998;18(3):2715.

PAGE 155

155 [296] Firulli AB, McFadden DG, Lin Q, Srivastava D, Olson EN. Heart and extraembryonic mesodermal defects in mouse embryos lacking the bHLH transcription factor Hand1. Nature Genetics 1998;18(3):26670. [297] Rossant J, Cross JC. Placental development: lessons from mouse mutants Nat Rev Genet 2001;2(7):53848. [298] Feldman B, Poueymirou W, Papaioannou VE, DeChiara TM, Goldfarb M. Requirement of FGF 4 for postimplantation mouse development Science 1995;267(5195):2469. [299] Simmons DG, Cross JC. Determinants of trophoblast lineage and cell subtype specification in the mouse placenta Developmental Biology 2005;284(1):1224. [300] Tanaka S, Kunath T, Hadjantonakis AK, Nagy A, Rossant J. Promotion of trophoblast stem cell proliferation by FGF4. Science 1998;282(5396):20725. [301] Hughes M, Dobric N, Scott IC, Su L, Starovic M, St Pierre B, Egan SE, Kingdom JCP, Cross JC. The Hand1, Stra13 and Gcm1 transcription factors override FGF signaling to promote terminal differentiation of trophoblast stem cells Developmental Biology 2004;271(1):2637. [302] Hemberger M, Hughes M, Cross JC. Trophoblast stem cells differentiate in vitro into invasive trophoblast giant cells Dev Biol 2004;271(2):36271. [303] Sahgal N, Canham LN, Konno T, Wolfe MW, Soares MJ. Modulation of trophoblast stem cell and giant cell phenotypes: analyses using the Rcho1 cell model Differentiation 2005;73(910):45262. [304] Yamada K, Kanda H, Tanaka S, Takamatsu N, Shiba T, Ito M. Sox15 enhances trophoblast giant cell differentiation induced by Hand1 in mouse placenta Differentiation 2006;74(5):21221. [305] Martindill DMJ, Risebro CA, Smart N, Franco Viseras MDM, Rosario CO, Swallow CJ, Dennis JW, Riley PR. Nucleolar release of Hand1 acts as a molecular switch to determine cell fate Nature Cell Biology 2007; 9:113141. [306] Tanenbaum ME, Medema RH. Cell fate in the hand of Plk4. Nature Cell Biology 2007;9:112730. [307] Thebault S, Basbous J, Gay B, Devaux C, Mesnard JM. Sequence requirement for the nucleolar localization of human I mfa domaincontaining p rotein (HIC p40) Eur J Cell Biol 2000;79(11):8348. [308] Thebault S, Gachon F, Lemasson I, Devaux C, Mesnard JM. Molecular cloning of a novel human I mfa domain containing protein that differently regulates human

PAGE 156

156 T cell leukemia virus type I and HIV 1 e xpression J Biol Chem 2000;275(7):484857. [309] Guillemot F, Nagy A, Auerbach A, Rossant J, Joyner AL. Essential role of MASH 2 in extraembryonic development Nature 1994;371(6495):3336. [310] Tanaka M, Gertsenstein M, Rossant J, Nagy A. Mash2 acts ce ll autonomously in mouse spongiotrophoblast development Dev Biol 1997;190(1):5565. [311] El Hashash AH, Warburton D, Kimber SJ. Genes and signals regulating murine trophoblast cell development Mech Dev;127(12):1 20. [312] Kraut N, Snider L, Chen CMA, Tapscott SJ, Groudine M. Requirement of the mouse I mfa gene for placental development and skeletal patterning Embo Journal 1998;17(21):627688. [313] Chen CM, Kraut N, Groudine M, Weintraub H. I mf, a novel myogenic repressor, interacts with members of the MyoD family Cell 1996;86(5):73141. [314] Janatpour MJ, Utset MF, Cross JC, Rossant J, Dong JY, Israel MA, Fisher SJ. A repertoire of differentially expressed transcription factors that offers insight into mechanisms of human cytotrophoblast differe ntiation Developmental Genetics 1999;25(2):14657. [315] Boudjelal M, Taneja R, Matsubara S, Bouillet P, Dolle P, Chambon P. Overexpression of Stra13, a novel retinoic acidinducible gene of the basic helix loophelix family, inhibits mesodermal and prom otes neuronal differentiation of P19 cells Genes Dev 1997;11(16):205265. [316] St Pierre B, Flock G, Zacksenhaus E, Egan SE. Stra13 homodimers repress transcription through class B E box elements Journal of Biological Chemistry 2002;277(48):4654451. [317] Cross JC, Werb Z, Fisher SJ. Implantation and the placenta key pieces of the development puzzle Science 1994;266(5190):150818. [318] Knofler M, Meinhardt G, Bauer S, Loregger T, Vasicek R, Bloor DJ, Kimber SJ, Husslein P. Human Hand1 basic helix loophelix (bHLH) protein: extraembryonic expression pattern, interaction partners and identification of its transcriptional repressor domains Biochemical Journal 2002;361:64151. [319] Knofler M, Meinhardt G, Vasicek R, Husslein P, Egarter C. Molecular cloning of the human Hand1 gene/cDNA and its tissue restricted expression in cytotrophoblastic cells and heart Gene 1998;224(1 2):7786.

PAGE 157

157 [320] Meinhardt G, Husslein P, Knofler M. Tissuespecific and ubiquitous basic helix loophelix transcription factor s in human placental trophoblasts Placenta 2005;26(7):52739. [321] Janatpour MJ, McMaster MT, Genbacev O, Zhou Y, Dong JY, Cross JC, Israel MA, Fisher SJ. Id 2 regulates critical aspects of human cytotrophoblast differentiation, invasion and migration. Development 2000;127(3):54958. [322] Arnold DR, Lefebvre R, Smith LC. Characterization of the placenta specific bovine mammalian achaete scutelike homologue 2 (Mash2) gene. Placenta 2006;27(1112):112431. [323] Kalter SS, Helmke RJ, Heberling RL, Pani gel M, Fowler AK, Strickland JE, Hellman A. Brief communication: C type particles in normal human placentas J Natl Cancer Inst 1973;50(4):10814. [324] Kalter SS, Helmke RJ, Panigel M, Heberling RL, Felsburg PJ, Axelrod LR. Observations of apparent C typ e particles in baboon (Papio cynocephalus) placentas Science 1973;179(80):13323. [325] Vernon ML, McMahon JM, Hackett JJ. Additional evidence of typeC particles in human placentas J Natl Cancer Inst 1974;52(3):9879. [326] Smith CA, Moore HD. Expres sion of C type viral particles at implantation in the marmoset monkey Hum Reprod 1988;3(3):3958. [327] Panem S. C type virus expression in the placenta. Curr Top Pathol 1979;66:17589. [328] Ueno H, Imamura M, Kikuchi K. Frequency and antigenicity of t ype C retrovirus like particles in human placentas Virchows Arch A Pathol Anat Histopathol 1983;400(1):3141. [329] Feldman D, Valentine T, Niemann WH, Hoar RM, Cukierski M, Hendrickx A. C type virus particles in placentas of rhesus monkeys after maternal treatment with recombinant leukocyte A interferon. J Exp Pathol 1989;4(4):1938. [330] Huppertz B, Bartz C, Kokozidou M. Trophoblast fusion: fusogenic proteins, syncytins and ADAMs, and other prerequisites for syncytial fusion. Micron 2006;37(6):50917. [331] Dupressoir A, Vernochet C, Bawa O, Harper F, Pierron G, Opolon P, Heidmann T. Syncytin A knockout mice demonstrate the critical role in placentation of a fusogenic, endogenous retrovirus derived, envelope gene. Proc Natl Acad Sci U S A 2009;106(29) :1212732.

PAGE 158

158 [332] Knerr I, Huppertz B, Weigel C, Dotsch J, Wich C, Schild RL, Beckmann MW, Rascher W. Endogenous retroviral syncytin: compilation of experimental research on syncytin and its possible role in normal and disturbed human placentogenesis Mol Hum Reprod 2004;10(8):5818. [333] Black SG, Arnaud F, Palmarini M, Spencer TE. Endogenous Retroviruses in Trophoblast Differentiation and Placental Development Am J Reprod Immunol. [334] Sommerfelt MA, Williams BP, McKnight A, Goodfellow PN, Weiss RA. Localization of the receptor gene for type D simian retroviruses on human chromosome 19. J Virol 1990;64(12):621420. [335] Rasko JE, Battini JL, Gottschalk RJ, Mazo I, Miller AD. The RD114/simian type D retrovirus receptor is a neutral amino acid transporter Proc Natl Acad Sci U S A 1999;96(5):212934. [336] Kudo Y, Boyd CA. Human placental amino acid transporter genes: expression and function Reproduction 2002;124(5):593600. [33 7] Kudo Y, Boyd CA. Changes in expression and function of syncytin and its receptor, amino acid transport system B(0) (ASCT2), in human placental choriocarcinoma BeWo cells during syncytialization Placenta 2002;23(7):53641. [338] Mi S, Lee X, Li X, Vel dman GM, Finnerty H, Racie L, LaVallie E, Tang XY, Edouard P, Howes S, Keith JC, Jr., McCoy JM. Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis Nature 2000;403(6771):7859. [339] Yu C, Shen K, Lin M, Chen P, Li n C, Chang GD, Chen H. GCMa regulates the syncytin mediated trophoblastic fusion. J Biol Chem 2002;277(51):500628. [340] Baczyk D, Drewlo S, Proctor L, Dunk C, Lye S, Kingdom J. Glial cell missing 1 transcription factor is required for the differentiation of the human trophoblast Cell Death Differ 2009;16(5):71927. [341] Basyuk E, Cross JC, Corbin J, Nakayama H, Hunter P, Nait Oumesmar B, Lazzarini RA. Murine Gcm1 gene is expressed in a subset of placental trophoblast cells Dev Dyn 1999;214(4):30311. [342] Baczyk D, Satkunaratnam A, Nait Oumesmar B, Huppertz B, Cross JC, Kingdom JC. Complex patterns of GCM1 mRNA and protein in villous and extravillous trophoblast cells of the human placenta. Placenta 2004;25(6):5539. [343] Nait Oumesmar B, Copperma n AB, Lazzarini RA. Placental expression and chromosomal localization of the human Gcm 1 gene Journal of Histochemistry & Cytochemistry 2000;48(7):91522.

PAGE 159

159 [344] Anson Cartwright L, Dawson K, Holmyard D, Fisher SJ, Lazzarini RA, Cross JC. The glial cells missing 1 protein is essential for branching morphogenesis in the chorioallantoic placenta Nat Genet 2000;25(3):311 4. [345] Chiang MH, Liang FY, Chen CP, Chang CW, Cheong ML, Wang LJ, Liang CY, Lin FY, Chou CC, Chen H. Mechanism of hypoxiainduced GCM1 degradation: implications for the pathogenesis of preeclampsia. J Biol Chem 2009;284(26):174119. [346] Chen CP, Chen CY, Yang YC, Su TH, Chen H. Decreased placental GCM1 (glial cells missing) gene expression in preeclampsia Placenta 2004;25(5):41321. [347] Wich C, Kausler S, Dotsch J, Rascher W, Knerr I. Syncytin 1 and glial cells missing a: hypoxiainduced deregulated gene expression along with disordered cell fusion in primary term human trophoblasts Gynecol Obstet Invest 2009;68(1):918. [348] Ch iang MH, Chen LF, Chen HW. Ubiquitin Conjugating Enzyme UBE2D2 Is Responsible for FBXW2 (F Box and WD Repeat Domain Containing 2) Mediated Human GCM1 (Glial Cell Missing Homolog 1) Ubiquitination and Degradation. Biology of Reproduction 2008;79(5):91420. [349] Palmarini M, Gray CA, Carpenter K, Fan H, Bazer FW, Spencer TE. Expression of endogenous betaretroviruses in the ovine uterus: effects of neonatal age, estrous cycle, pregnancy, and progesterone. J Virol 2001;75(23):1131927. [350] Palmarini M, Hal lwirth C, York D, Murgia C, de Oliveira T, Spencer T, Fan H. Molecular cloning and functional analysis of three type D endogenous retroviruses of sheep reveal a different cell tropism from that of the highly related exogenous jaagsiekte sheep retrovirus J Virol 2000;74(17):806576. [351] Dunlap KA, Palmarini M, Adelson DL, Spencer TE. Sheep endogenous betaretroviruses (enJSRVs) and the hyaluronidase 2 (HYAL2) receptor in the ovine uterus and conceptus Biol Reprod 2005;73(2):2719. [352] Itoh S, ten Dij ke P. Negative regulation of TGF beta receptor/Smad signal transduction Current Opinion in Cell Biology 2007;19(2):17684. [353] ten Dijke P, Korchynskyi E, Valdimarsdottir G, Goumans MJ. Controlling cell fate by bone morphogenetic protein receptors Mol ecular and Cellular Endocrinology 2003;211(12):10513. [354] Urist MR. Bone: formation by autoinduction. Science 1965;150(698):8939.

PAGE 160

160 [355] Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM, Wang EA. Novel regulators of bone formation: molecular clones and activities Science 1988;242(4885):152834. [356] Reddi AH. Bone morphogenetic proteins: from basic science to clinical applications J Bone Joint Surg Am 2001;83A (Suppl 1 Pt 1):S1 6. [357] Goumans MJ, Mummery C. Function al analysis of the TGFbeta receptor/Smad pathway through gene ablation in mice. Int J Dev Biol 2000;44(3):25365. [358] Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic protein system in mammalian reproduction Endocrine Reviews 2004;25(1):72101. [359] Knight PG, Glister C. Local roles of TGF beta superfamily members in the control of ovarian follicle development Animal Reproduction Science 2003;78(3 4):16583. [360] Massague J, Seoane J, Wotton D. Smad transcription factors Genes & Development 2005;19(23):2783810. [361] Nohe A, Keating E, Knaus P, Petersen NO. Signal transduction of bone morphogenetic protein receptors Cell Signal 2004;16(3):2919. [362] Gazzerro E, Canalis E. Bone morphogenetic proteins and their antagonists Rev Endocr Metab Disord 2006;7(12):51 65. [363] Massague J, Blain SW, Lo RS. TGFbeta signaling in growth control, cancer, and heritable disorders Cell 2000;103(2):295309. [364] Winnier G, Blessing M, Labosky PA, Hogan BLM. Bone morphogenetic protein 4 is required for mesoberm formation and patterning in the mouse. Genes & Development 1995;9(17):210516. [365] Koenig BB, Cook JS, Wolsing DH, Ting J, Tiesman JP, Correa PE, Olson CA, Pecquet AL, Ventura FS, Grant RA, Chen GX, Wrana JL, Massague J, Rose nbaum JS. Characterization and cloning of a receptor for BMP 2 and BMP 4 from NIH 3T3 cells Molecular and Cellular Biology 1994;14(9):596174. [366] ten Dijke P, Yamashita H, Sampath TK, Reddi AH, Estevez M, Riddle DL, Ichijo H, Heldin CH, Miyazono K. Id entification of type I receptors for osteogenic protein 1 and bone morphogenetic protein 4 J Biol Chem 1994;269(25):169858. [367] Lee KB, Khivansara V, Santos MM, Lamba P, Yuen T, Sealfon SC, Bernard DJ. Bone morphogenetic protein 2 and activin A synergistically stimulate follicle -

PAGE 161

161 stimulating hormone beta subunit transcription. Journal of Molecular Endocrinology 2007;38(12):31530. [368] Fujiwara T, Dunn NR, Hogan BL. Bone morphogenetic protein 4 in the extraembryonic mesoderm is required for allantois development and the localization and survival of primordial germ cells in the mouse Proc Natl Acad Sci U S A 2001;98(24):1373944. [369] Murohashi M, Nakamura T, Tanaka S, Ichise T, Yoshida N, Yamamoto T, Shibuya M, Schlessinger J, Gotoh N. An FGF4FRS2 alpha Cdx2 axis in trophoblast stem cells induces Bmp4 to regulate proper growth of early mouse embryos Stem Cells 2010;28(1):11321. [370] Mishina Y, Suzuki A, Gilbert DJ, Copeland NG, Jenkins NA, Ueno N, Behringer RR. Genomic organization and chromosom al location of the mouse type I BMP 2/4 receptor Biochem Biophys Res Commun 1995;206(1):3107. [371] Xu RH, Chen X, Li DS, Li R, Addicks GC, Glennon C, Zwaka TP, Thomson JA. BMP4 initiates human embryonic stem cell differentiation to trophoblast Nature Biotechnology 2002;20(12):12614. [372] Schulz LC, Ezashi T, Das P, Westfall SD, Livingston KA, Roberts RM. Human embryonic stem cells as models for trophoblast differentiation. Placenta 2008;29:S10S6. [373] Hayashi Y, Furue MK, Tanaka S, Hirose M, Waki saka N, Danno H, Ohnuma K, Oeda S, Aihara Y, Shiota K, Ogura A, Ishiura S, Asashima M. BMP4 induction of trophoblast from mouse embryonic stem cells in defined culture conditions on laminin. In Vitro Cell Dev Biol Anim;46(5):41630. [374] Wooding FB. Curr ent topic: the synepitheliochorial placenta of ruminants: binucleate cell fusions and hormone production Placenta 1992;13(2):10113. [375] Pfarrer C, Weise S, Berisha B, Schams D, Leiser R, Hoffmann B, Schuler G. Fibroblast growth factor (FGF) 1, FGF2, F GF7 and FGF receptors are uniformly expressed in trophoblast giant cells during restricted trophoblast invasion in cows Placenta 2006;27(6 7):75870. [376] Sasser RG, Ruder CA, Ivani KA, Butler JE, Hamilton WC. Detection of pregnancy by radioimmunoassay of a novel pregnancy specific protein in serum of cows and a profile of serum concentrations during gestation. Biol Reprod 1986;35(4):93642. [377] Ibrahim SF, van den Engh G. High speed cell sorting: fundamentals and recent advances Current Opinion in Biotechnology 2003;14(1):512.

PAGE 162

162 [378] Wooding FBP, Morgan G, Forsyth IA, Butcher G, Hutchings A, Billingsley SA, Gluckman PD. Light and electron microscopic studies of cellular localization of oPL with monoclonal and polyclonal antibodies Journal of Histo chemistry & Cytochemistry 1992;40(7):10019. [379] Johnson GA, Burghardt RC, Newton GR, Bazer FW, Spencer TE. Development and characterization of immortalized ovine endometrial cell lines Biology of Reproduction 1999;61(5):132430. [380] Deb K, Sivaguru M, Yong HY, Roberts RM. Cdx2 gene expression and trophectoderm lineage specification in mouse embryos Science 2006;311(5763):9926. [381] Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, Rossant J. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst Development 2005;132(9):2093102. [382] Miner JH. Laminins and their roles in mammals Microsc Res Tech 2008;71(5):34956. [383] Pan ZS, Sikandar S, Witherspoon M, Dizon D, Nguyen T, Benirschke K, Wiley C, Vrana P, Lipkin SM. Impaired placental trophoblast lineage differentiation in Alkbh1( / ) mice Developmental Dynamics 2008;237:31627. [384] Arnold DR, Bordignon V, Lefebvre R, Murphy BD, Smith LC. Somatic cell nuclear tr ansfer alters peri implantation trophoblast differentiation in bovine embryos Reproduction 2006;132(2):27990. [385] de Mestre AM, Miller D, Roberson MS, Liford J, Chizmar LC, McLaughlin KE, Antczak DF. Glial cells missing homologue 1 is induced in differentiating equine chorionic girdle trophoblast cells Biol Reprod 2009;80(2):22734. [386] Massague J, Gomis RR. The logic of TGF beta signaling. Febs Letters 2006;580(12):2811 20. [387] McLaren A. Signaling for germ cells Genes Dev 1999;13(4):3736. [388] Ying Y, Liu XM, Marble A, Lawson KA, Zhao GQ. Requirement of Bmp8b for the generation of primordial germ cells in the mouse. Mol Endocrinol 2000;14(7):105363. [389] Ying Y, Qi X, Zhao GQ. Induction of primordial germ cells from murine epiblasts by synergistic action of BMP4 and BMP8B signaling pathways Proc Natl Acad Sci U S A 2001;98(14):785862.

PAGE 163

163 [390] Lawson KA, Dunn NR, Roelen BA, Zeinstra LM, Davis AM, Wright CV, Korving JP, Hogan BL. Bmp4 is required for the generation of primordial germ cell s in the mouse embryo. Genes Dev 1999;13(4):42436. [391] Eppig JJ. Oocyte control of ovarian follicular development and function in mammals Reproduction 2001;122(6):82938. [392] Matzuk MM. Revelations of ovarian follicle biology from gene knockout mic e Mol Cell Endocrinol 2000;163(12):61 6. [393] Erickson GF, Shimasaki S. The role of the oocyte in folliculogenesis Trends Endocrinol Metab 2000;11(5):1938. [394] Otsuka F, Moore RK, Shimasaki S. Biological function and cellular mechanism of bone mo rphogenetic protein6 in the ovary J Biol Chem 2001;276(35):3288995. [395] Ozkaynak E, Jin DF, Jelic M, Vukicevic S, Oppermann H. Osteogenic protein1 mRNA in the uterine endometrium Biochem Biophys Res Commun 1997;234(1):2426. [396] Zhao GQ, Hogan BL. Evidence that mouse Bmp8a (Op2) and Bmp8b are duplicated genes that play a role in spermatogenesis and placental development Mech Dev 1996;57(2):15968. [397] Derynck R, Zhang Y, Feng XH. Smads: transcriptional activators of TGF beta responses Cell 1998;95(6):73740. [398] Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE. Human Smad3 and Smad4 are sequencespecific transcription activators Mol Cell 1998;1(4):611 7. [399] Balcerzak M, Hamade E, Zhang L, Pikula S, Azzar G, Radisson J, Bandorowicz Pikula J, Buchet R. The roles of annexins and alkaline phosphatase in mineralization process Acta Biochim Pol 2003;50(4):101938. [400] Saito S, Liu B, Yokoyama K. Animal embryonic stem (ES) cells: self renewal, pluripotency, transgenesis and nuclear transfer Hum Cell 2004;17(3):10715. [401] Sapin V, Blanchon L, Serre AF, Lemery D, Dastugue B, Ward SJ. Use of transgenic mice model for understanding the placentation: towards clinical applications in human obstetrical pathologies? T ransgenic Res 2001;10(5):37798. [402] Martal JL, Chene NM, Huynh LP, L'Haridon RM, Reinaud PB, Guillomot MW, Charlier MA, Charpigny SY. IFN tau: A novel subtype I IFN1. Structural characteristics, non ubiquitous expression, structure function relationshi ps, a

PAGE 164

164 pregnancy hormonal embryonic signal and cross species therapeutic potentialities Biochimie 1998;80(89):75577. [403] Roberts RM, Ezashi T, Rosenfeld CS, Ealy AD, Kubisch HM. Evolution of the interferon tau genes and their promoters, and maternal t rophoblast interactions in control of their expression. Reproduction 2002:23951. [404] Ko Y, Lee CY, Ott TL, Davis MA, Simmen RCM, Bazer FW, Simmen FA. Insulin like growth factors in sheep uterine fluids concentrations and relationship to ovine trophob last protein1 production during early pregnancy Biology of Reproduction 1991;45(1):13542. [405] Ocon Grove OM, Cooke FNT, Alvarez IM, Johnson SE, Ott TL, Ealy AD. Ovine endometrial expression of fibroblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy Domestic Animal Endocrinology 2008;34:13545. [406] Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors Cytokine & Growth Factor Reviews 2005;16(2):13949. [407] Xu X, Weinstein M, Li C, Naski M, Cohen RI, Ornitz DM, Leder P, Deng C. Fibroblast growth factor receptor 2 (FGFR2) mediated reciprocal regulation loop between FGF8 and FGF10 is essential for limb induction. Development 1998;125(4):75365. [408] Chen C, Spencer TE, Bazer FW. Fibroblast growth factor 10: A stromal mediator of epithelial function in the ovine uterus Biology of Reproduction 2000;63(3):95966. [409] Ka H, Spencer TE, Johnson GA, Bazer FW. Keratinocyte growth factor: Expression by endometrial epit helia of the porcine uterus Biology of Reproduction 2000;62(6):17728. [410] Roberts RM, Imakawa K, Niwano Y, Kazemi M, Malathy PV, Hansen TR, Glass AA, Kronenberg LH. Interferonproduction by the perimplantation sheep embryo Journal of Interferon Research 1989;9(2):17587. [411] Rodina TM, Cooke FNT, Hansen PJ, Ealy AD. Oxygen tension and medium type actions on blastocyst development and interferon tau secretion in cattle Animal Reproduction Science 2009;111(24):17388.

PAGE 165

165 BIOGRAPHICAL SKETCH Kathl een Pennington grew up in Levittown Pennsylvania just north of Philadelphia. She attended Queen of the Universe Elementary School through eighth grade and then moved to Neshaminy High School where she graduated in 2001. Following high school, Kathleen attended the University of Delaware where she majored in a nimal science with a Pre Veterinary concentration. Kathleen graduated from the Universi ty of Delaware with a Bachelor of Science in the spring of 2005. While attending the University of Delaware, K athleen took the opportunity to pursue undergraduate research which helped her to make the decision to pursue her doctorate. Kathleen began her PhD program in a nimal m olecular and cellular b iology in the Animal Sciences Department at the University of Florida in the fall of 2005 under the direction of Dr. Alan Ealy. Kathleens research focus has been on maternal fetal interactions during the first trimester of pregnancy in cattle, with particular interest on the signaling mechanisms controlling trophoblas t cell development and function. Following her PhD Kathleen plans to pursue a postdoctoral position in the human biomedical field and focus on placental development and associated diseases.