<%BANNER%>

Molecular and Clinical Investigations Using Animal and Human Systems to Improve Assisted Reproductive Technologies

Permanent Link: http://ufdc.ufl.edu/UFE0041891/00001

Material Information

Title: Molecular and Clinical Investigations Using Animal and Human Systems to Improve Assisted Reproductive Technologies
Physical Description: 1 online resource (149 p.)
Language: english
Creator: Kramer, Joseph
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: art, calyculin, cryopreservation, embryo, gnrh, ivf, pgd, synthetic
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: More than 30 years have passed since the birth of the first in vitro fertilization (IVF) baby. Since that time, advances in reproductive technologies have been remarkable. Yet with all that has been achieved so far, there is still much to be learned. To further our understanding, this dissertation investigated several aspects of IVF important to assisted reproductive medicine. The first area of investigation focused on the effects of gonadotropin-releasing hormone (GnRH) analogs on granulosa cells. Important components of stimulation protocols are the suppression of endogenous gonadotropins with GnRH analogs and the timely administration of exogenous gonadotropins to promote follicular development and final maturation of oocytes for use in IVF. Central to this process is the response of granulosa cells to gonadotropins by regulating the production of steroids and growth factors during folliculogenesis. In this study, GnRH agonist and antagonist protocols were shown to differentially affect the expression of microRNAs (miRNAs) in granulosa cells. This could have important consequences for the function of granulosa cells as these small non-coding RNAs have been shown to post-transcriptionally regulate the expression of numerous genes essential for folliculogenesis, which may affect stimulation response and reproductive success. The ensuing investigation focused on the effects of globulin proteins in solutions used for embryo cryopreservation. Successful cryopreservation is dependent upon the osmoregulation of water during freeze/thaw to avoid the formation of potentially detrimental ice crystals. Globulin-rich proteins, which have previously been shown to promote embryo development, have been suggested to alter the embryo microenvironment through interactions with water molecules and therefore were tested in cryopreservation solutions to improve post-thaw embryo survival. Results showed more blastocysts survived, as measured by re-expansion following freezing and thawing, in solutions supplemented with globulin-rich proteins compared to human serum albumin. These results indicate inclusion of globulins promotes blastocyst thaw-survival, which may prove beneficial for clinical cryopreservation of embryos. The final investigation studied the effects of a protein phosphatase inhibitor, calyculin-A, used to induce premature chromosome condensation (PCC) within single embryonic cells to identify a complete chromosome complement for genetic analysis. Traditional methods for analyzing chromosomal abnormalities in embryos utilize interphase fluorescence in situ hybridization (FISH), which is limited by the number of chromosomes that can be analyzed at one time. In an effort to improve these methods, this study exposed single blastomeres from bovine and murine embryos to calyculin-A to induced PCC. Results demonstrated blastomeres underwent rapid chromatin condensation; however, the quality of condensed chromosomes was inconsistent so that application of this technology was unreliable for genetic screening of embryos.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joseph Kramer.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Drury, Kenneth C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041891:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041891/00001

Material Information

Title: Molecular and Clinical Investigations Using Animal and Human Systems to Improve Assisted Reproductive Technologies
Physical Description: 1 online resource (149 p.)
Language: english
Creator: Kramer, Joseph
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: art, calyculin, cryopreservation, embryo, gnrh, ivf, pgd, synthetic
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: More than 30 years have passed since the birth of the first in vitro fertilization (IVF) baby. Since that time, advances in reproductive technologies have been remarkable. Yet with all that has been achieved so far, there is still much to be learned. To further our understanding, this dissertation investigated several aspects of IVF important to assisted reproductive medicine. The first area of investigation focused on the effects of gonadotropin-releasing hormone (GnRH) analogs on granulosa cells. Important components of stimulation protocols are the suppression of endogenous gonadotropins with GnRH analogs and the timely administration of exogenous gonadotropins to promote follicular development and final maturation of oocytes for use in IVF. Central to this process is the response of granulosa cells to gonadotropins by regulating the production of steroids and growth factors during folliculogenesis. In this study, GnRH agonist and antagonist protocols were shown to differentially affect the expression of microRNAs (miRNAs) in granulosa cells. This could have important consequences for the function of granulosa cells as these small non-coding RNAs have been shown to post-transcriptionally regulate the expression of numerous genes essential for folliculogenesis, which may affect stimulation response and reproductive success. The ensuing investigation focused on the effects of globulin proteins in solutions used for embryo cryopreservation. Successful cryopreservation is dependent upon the osmoregulation of water during freeze/thaw to avoid the formation of potentially detrimental ice crystals. Globulin-rich proteins, which have previously been shown to promote embryo development, have been suggested to alter the embryo microenvironment through interactions with water molecules and therefore were tested in cryopreservation solutions to improve post-thaw embryo survival. Results showed more blastocysts survived, as measured by re-expansion following freezing and thawing, in solutions supplemented with globulin-rich proteins compared to human serum albumin. These results indicate inclusion of globulins promotes blastocyst thaw-survival, which may prove beneficial for clinical cryopreservation of embryos. The final investigation studied the effects of a protein phosphatase inhibitor, calyculin-A, used to induce premature chromosome condensation (PCC) within single embryonic cells to identify a complete chromosome complement for genetic analysis. Traditional methods for analyzing chromosomal abnormalities in embryos utilize interphase fluorescence in situ hybridization (FISH), which is limited by the number of chromosomes that can be analyzed at one time. In an effort to improve these methods, this study exposed single blastomeres from bovine and murine embryos to calyculin-A to induced PCC. Results demonstrated blastomeres underwent rapid chromatin condensation; however, the quality of condensed chromosomes was inconsistent so that application of this technology was unreliable for genetic screening of embryos.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joseph Kramer.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Drury, Kenneth C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041891:00001


This item has the following downloads:


Full Text





MOLECULAR AND CLINICAL INVESTIGATIONS USING ANIMAL AND HUMAN
SYSTEMS TO IMPROVE ASSISTED REPRODUCTIVE TECHNOLOGIES















By

JOSEPH MICHAEL KRAMER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2010

































2010 Joseph Michael Kramer





















To my wife, Raeanna, who provided constant encouragement and support while I
continued my studies, and to my children, Nadia and Colt, who may have slowed my
writing, but through it have helped me become more tolerant and develop patience









ACKNOWLEDGMENTS

Foremost, I want to thank Dr. Kenneth Drury for his guidance throughout the

process of completing this project, including reading and editing this dissertation, for the

excellent scientific and intellectual training I received in his laboratory during this time,

and for being there anytime I needed advice.

I also want to thank Dr. Nasser Chegini for teaching me about the world of

miRNAs, for providing a research opportunity to complete my scientific studies and for

his suggestions and insights that helped towards the completion of this project.

I would also like to thank Dr. Peter Hansen, Dr. Stan Williams, Dr. Robert Zori and

Dr. Richard Scott for serving as members of my supervisory committee and for their

recommendations that helped towards the completion of this dissertation.

Additional thanks to all the faculty of the Animal Molecular and Cellular Biology

Graduate program for providing me with the fellowship to complete my graduate

studies.

Lastly, I would like to extend thanks to the following groups of people for assisting

with this research project: All the physicians, nurses, and laboratory staff of the in vitro

fertilization program at Shands hospital as well as all the members of Dr. Chegini's

laboratory.









TABLE OF CONTENTS

page

A C KNO W LEDG M ENTS ......... ............... ............................................. ...............

LIST O F TA BLES .......... ..... ..... ............................................................. ........ 8

LIS T O F F IG U R E S .................................................................. 9

LIST OF ABBREVIATIONS..................... .......... .............................. 10

A BST RA CT ............... ... ..... ......................................................... ...... 13

CHAPTER

1 INTRODUCTION .............. .......... .......... ......... 15

2 LITERATURE REVIEW ........ .... ...... .......... .. .... ......................... 19

Use of GnRH Analogs for Controlled Ovarian Hyperstimulation........................... 19
Ovarian Expression of miRNAs ... .. ........................... ............... 25
Protein Supplem entation of In Vitro System s................................. .................... 33
Cryopreservation of Blastocysts ................ .................. ............ ...... ......... 39
Preimplantation Genetic Diagnosis........... ... ......... ......... .. .............. 47
Premature Chromosome Condensation........................ ...... ............... 55

3 COMPARATIVE EFFECTS OF GnRH AGONIST AND ANTAGONIST ON
MiRNA AND GENE EXPRESSION PATTERN OF HUMAN GRANULOSA
C E L L S ............. ......... .. .. ......... .. .. ............................................... 6 1

Introduction .............. .. ................................. ........ .. ............ 61
Materials and Methods................................ ............... 63
Experim ents .............. ................................................ .......... 63
RNA Extraction, cDNA Synthesis and Real-Time PCR.............. ............ 64
S tatistica l A na lysis ........................................................................ ......... 6 5
R e su lts ............... ............................... .... .. ......... .. .. .... ............... 6 5
The Expression of miRNAs and Their Predicted Target Genes in Granulosa
C e lls ...... ...... ... ..... .. .............. ... ........ ..... .... .. ........... .. ..... .......... 6 5
GnRHa and GnRHant Protocols Instigate Differential Effects on hGC
m iR N A E x p re ssio n ................ ......... .... ....... ............... ...... .............. 6 6
Direct Effects of GnRH Analogs on miRNA and Gene Expression................... 67
D is c u s s io n ............. ......... .. .. ......... .. .. ......... .................................... 6 7

4 SUPPLEMENTATION OF FREEZE AND THAW SOLUTIONS WITH A
GLOBULIN-RICH PROTEIN SOURCE IMPROVES POST-THAW SURVIVAL
AND IMPLANTATION OF CONTROL-RATE CRYOPRESERVED
BLASTOCYSTS .............. ........... ............... ......... ................ ......... 76









In tro d u c tio n .............. ... .............. ........................................................... ............... 7 6
Materials and Methods.................. ................. ......... 78
Freezing and Thawing of Blastocysts...... ................. ..... .............. 78
Anim al Experim ental Design ......................................................................... 79
Experiment 1: Effects of SSS Supplementation of Freeze and Thaw
Solutions on Post-Thaw Murine Blastocyst Re-Expansion......................... 79
Experiment 2: Effects of post-thaw culture medium with SSS on re-
expansion of murine blastocyst frozen-thawed with different protein
supplem ents ...... ...... ....... .... ......... .................. ............. ............. ... 79
Experiment 3: Effects of protein supplementation in freeze-thaw and post-
thaw culture solutions on murine blastocyst re-expansion and total cell
num ber................ ........................ ............... ............... 80
H um an R retrospective A nalysis..................................................... ............... 80
S tatistica l A na lysis ........................................................................ ......... 82
R esu lts ................ ................................... .......... ..... ...................... 82
Experiment 1: Effects of Supplementing Freeze and/or Thaw Solutions with
SSS on Post-Thaw Murine Blastocyst Re-Expansion .............. ............ 82
Experiment 2: Effects of post-thaw culture medium with SSS on re-
expansion of murine blastocyst frozen-thawed with different protein
supplem ents ....................... .. ....... .. .. .... ..... ..... ........... 82
Experiment 3: Effects of protein supplementation of freeze-thaw and post-
thaw culture solutions on murine blastocyst re-expansion and total cell
n u m b e r .......................................................... .. .......................... ............... 8 3
Retrospective Analysis of Frozen-Thawed Human Blastocyst Re-Expansion
Using Thaw and Post-Thaw Solutions Supplemented with SSS ............... 83
D is c u s s io n ............. ......... .. .. ......... .. .. ......... .................................... 8 4

5 CALYCULIN-A IMPROVES CHROMOSOME CONDENSATION FOR
CYTOGENETIC ANALYSIS OF BLASTOMERES FROM BOVINE AND
MURINE EIGHT-CELL STAGE EMBRYOS................................. .................... 92

Intro d uctio n ......... ...... ............ ................................. ........................... 92
Materials and Methods............................ ...... .......... ............... 94
Production of Bovine Embryos ............................................... 94
Harvesting Bovine Blastomeres ...... ..................... ................. 95
Harvesting Murine Blastomeres ..... ............ .......... .................... 95
Induction of Premature Chromosome Condensation.................................. 95
Experiment 1: effects of calyculin-A duration on bovine blastomeres............ 96
Experiment 2: effects of calyculin-A concentration on bovine blastomeres...... 96
Experiment 3: effects of calyculin-A on murine blastomeres.......................... 96
Experiment 4: calyculin-A use for cytogenetic analysis of Day 3, eight-cell
stage bovine em bryos ............................................................ .... ........ 96
Fixation of Blastom eres ........................................................... ............ .......... 97
Analysis of Premature Chromosome Condensation ............. ............... 98
Fluorescence In Situ Hybridization Analysis............................ .................... 98
Statistical Analysis ....................................... 100
R e s u lts .............. ... .............. ................. ................................................. 1 0 0









Experiment 1: Effects of Calyculin-A Duration on Bovine Blastomeres ......... 100
Experiment 2: Effects of Calyculin-A Concentration on Bovine Blastomeres. 101
Experiment 3: Effects of Calyculin-A on Murine Blastomeres....................... 102
Experiment 4: Calyculin-A Use for Preimplantation Cytogenetic Analysis of
Day 3, Eight-Cell Stage Bovine Embryos.......... .. .... .............. 102
Discussion ............. ...... ..... .. .......... ........ ........... ........... 103

6 SUMMARY, CONCLUSIONS AND FINAL REMARKS.................. ............... 115

Effects of GnRH Analogs on Ovarian Expression of MiRNAs ..................... 116
Effects of Macromolecules on Embryo Cryopreservation............................. 118
Effects of Calyculin-A on Inducing Chromosome Condensation for Genetic
Analysis of Embryos......................................... 120
Final Remarks ....... ............................... ......... 122

LIST OF REFERENCES ......... ......... ......... ........... ............... 124

BIOGRAPHICAL SKETCH .............. ............... ........................ 149









LIST OF TABLES


Table page

3-1 Predicted m iRNA gene targets .............................................. .............. 72

4-1 Effects of protein supplement in freeze-thaw solutions on murine post-thaw
re-expansion.................................................................. ................. 88

4-2 Effects of post-thaw culture medium with SSS on re-expansion of murine
blastocyst frozen-thawed with different protein supplements. ............................ 88

4-3 Effects of protein supplementation of freeze-thaw and post-thaw culture
solutions on murine blastocyst re-expansion and total cell number................ 83

4-4 Retrospective analysis of frozen-thawed human blastocyst re-expansion
using thaw and post-thaw solutions supplemented with SSS............................. 89

5-1 Effects of calyculin-A duration on inducing PCC in bovine blastomeres .......... 109

5-2 Effects of calyculin-A concentration on inducing PCC in bovine blastomeres.. 101

5-3 Effects of calyculin-A duration on inducing PCC in murine blastomeres. ......... 109

5-4 Cytogenetic analysis of blastomeres from bovine embryos treated with
calyculin-A .............. ..... ............. ..... .............................. 113









LIST OF FIGURES


Figure page

2-1 Biogenesis and functionality of miRNAs. ............. ............................................ 60

3-1 Overall expression patterns of miRNA in hGC and IhGC. ................................ 73

3-2 Comparative analysis of the relative expression of miRNA and predicted
m R N A in hG C ................................................. ................................. .. 74

3-3 Comparative analysis of the relative expression of miRNA and mRNA targets
in IhGC. ............................................. 75

4-1 Thaw-survival of murine blastocysts following cryopreservation in solutions
supplemented with HSA or SSS......................................... .. ............... 90

4-2 Epifluorescence imaging of total cell number from a frozen-thawed murine
blastocyst fixed and stained with DAPI ............... ........... .. .......... ........ 91

5-1 Calyculin-A induces PCC in blastomeres from Day 3, eight-cell stage bovine
IVP em bryos ............. .. ......... .......... ..... ............ 110

5-2 Calyculin-A induces PCC in blastomeres from Day 2, eight-cell stage murine
embryos ............ ..... ........... ..... .............. ................... .......... 112

5-3 Cytogenetic analysis of bovine blastomeres treated with calyculin-A .............. 114









LIST OF ABBREVIATIONS

ART Assisted Reproductive Technology

ADO Allelic Dropout

AMCB Animal Molecular and Cellular Biology

AMH Anti-Mullarian Hormone

AREG Amphiregulin

BMP2 Bone Morphogenic Protein 2

BSA Bovine Serum Albumin

cDNA Complimentary DNA

CF Cystic Fibrosis

CGH Comparative Genome Hybridization

CL Corpus Luteum

CLIA 88 Clinical Laboratory Improvement Act of 1988

COC Cumulus Oocyte Complex

COH Controlled Ovarian Hyperstimulation

CT Critical Threshold

DAPI 4'6-Diamidino-2-Phenylindole Dihydrochloride Hydrate

DMSO Dimethyl Sulfoxide

DNA Deoxyribonucleic Acid

E2 Estradiol

EGF Epidermal Growth Factor

FBS Fetal Bovine Serum

FET Frozen Embryo Transfer

FF Follicular Fluid









FISH

FSH

GnRH

GnRHa

GnRHant

GNRH-R

hCG

hGC

HSA

ICM

ICSI

IGF-I

IhGC

IVF

IVP

KO

LH

LHRH

mRNA

miRNA

OHSS

P4

PBS


Fluorescence In Situ Hybridization

Follicle Stimulating Hormone

Gonadotropin-Releasing Hormone

GnRH agonist

GnRH antagonist

Gonadotropin-Releasing Hormone Receptor

Human Chorionic Gonadotropin

Human Granulosa Cells

Human Serum Albumin

Inner Cell Mass

Intracytoplasmic Sperm Injection

Insulin-Like Growth Factor-1

Immortalized Human Granulosa Cell Line

In Vitro Fertilization

In Vitro Produced

Knockout

Luteinizing Hormone

Luteinizing Hormone-Releasing Hormone

Messenger Ribonucleic Acid

MircroRNA

Ovarian Hyperstimulation Syndrome

Progesterone

Phosphate Buffered Saline









PCC

PCCs

PCR

PGD

PGS

PP

PAPPA

pre-miRNA

PVA

RISC

RNA

SEM

siRNA

SNP

SSS

T

TGF

UTR

VEGF

WGA


Premature Chromosome Condensation

Prematurely Condensed Chromosomes

Polymerase Chain Reaction

Preimplantation Genetic Diagnosis

Preimplantation Genetic Screening

Protein Phosphatase

Pregnancy Associated Plasma Protein A

Precursor-m iRNA

Polyvinylalcohol

RNA-Induced Silencing Complex

Ribonucleic Acid

Standard Error of Mean

Small-Interfering RNAs

Single Nucleotide Polymorphism

Synthetic Serum Substitute

Testosterone

Transforming Growth Factor

Untranslated Region

Vascular Endothelial Growth Factor

Whole Genome Amplification









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

MOLECULAR AND CLINICAL INVESTIGATIONS USING ANIMAL AND HUMAN
SYSTEMS TO IMPROVE ASSISTED REPRODUCTIVE TECHNOLOGIES


By

Joseph Michael Kramer

August 2010

Chair: Kenneth C. Drury
Major: Animal Molecular and Cellular Biology

More than 30 years have passed since the birth of the first in vitro fertilization (IVF)

baby. Since that time, advances in reproductive technologies have been remarkable.

Yet with all that has been achieved so far, there is still much to be learned. To further

our understanding, this dissertation investigated several aspects of IVF important to

assisted reproductive medicine.

The first area of investigation focused on the effects of gonadotropin-releasing

hormone (GnRH) analogs on granulosa cells. Important components of stimulation

protocols are the suppression of endogenous gonadotropins with GnRH analogs and

the timely administration of exogenous gonadotropins to promote follicular development

and final maturation of oocytes for use in IVF. Central to this process is the response of

granulosa cells to gonadotropins by regulating the production of steroids and growth

factors during folliculogenesis. In this study, GnRH agonist and antagonist protocols

were shown to differentially affect the expression of microRNAs (miRNAs) in granulosa

cells. This could have important consequences for the function of granulosa cells as

these small non-coding RNAs have been shown to post-transcriptionally regulate the









expression of numerous genes essential for folliculogenesis, which may affect

stimulation response and reproductive success.

The ensuing investigation focused on the effects of globulin proteins in solutions

used for embryo cryopreservation. Successful cryopreservation is dependent upon the

osmoregulation of water during freeze/thaw to avoid the formation of potentially

detrimental ice crystals. Globulin-rich proteins, which have previously been shown to

promote embryo development, have been suggested to alter the embryo

microenvironment through interactions with water molecules and therefore were tested

in cryopreservation solutions to improve post-thaw embryo survival. Results showed

more blastocysts survived, as measured by re-expansion following freezing and

thawing, in solutions supplemented with globulin-rich proteins compared to human

serum albumin. These results indicate inclusion of globulins promotes blastocyst thaw-

survival, which may prove beneficial for clinical cryopreservation of embryos.

The final investigation studied the effects of a protein phosphatase inhibitor,

calyculin-A, used to induce premature chromosome condensation (PCC) within single

embryonic cells to identify a complete chromosome complement for genetic analysis.

Traditional methods for analyzing chromosomal abnormalities in embryos utilize

interphase fluorescence in situ hybridization (FISH), which is limited by the number of

chromosomes that can be analyzed at one time. In an effort to improve these methods,

this study exposed single blastomeres from bovine and murine embryos to calyculin-A

to induced PCC. Results demonstrated blastomeres underwent rapid chromatin

condensation; however, the quality of condensed chromosomes was inconsistent so

that application of this technology was unreliable for genetic screening of embryos.









CHAPTER 1
INTRODUCTION

Long before the birth of the world's first in vitro fertilization (IVF) baby, scientific

experiments using animal and later human systems, were conducted to lay the

foundation for the field of assisted reproductive technology (ART). The early pioneers of

this field were not just clinicians, but included reproductive biologists and geneticists

whose scientific training was instrumental to overcoming the many problems of

achieving fertilization and embryo development in the laboratory. Science continues to

be a part of the field of ART today, but the approach is much slower because of the

presence of ever increasing regulation. Since the passing of the Clinical Laboratory

Improvement Act of 1988 (CLIA 88), directors of embryology laboratories within the

United States are required to hold doctorate degrees in related sciences or medicine;

however, there are few academic programs of study with emphasis in embryology to

educate and train persons for such positions. This dissertation is part of the

requirements of a newly developed doctorate program in the Animal Molecular and

Cellular Biology (AMCB) graduate program with emphasis in clinical embryology. The

multidisciplinary approach of this dissertation is somewhat unconventional, covering

various topics of ART, including ovarian stimulation, embryo cryopreservation and

preimplantation genetic diagnosis (PGD), but as a whole the approach provides the

basis of quality control and scientific methods essential for persons seeking careers in

clinical IVF.

One of the most important advances in IVF has been the development of ovarian

stimulation. From the beginning, the founders of clinical IVF, Patrick Steptoe and Robert

Edwards, believed ovarian stimulation of multiple follicles would increase the likelihood









of achieving a fertilized oocyte that develops to an embryo stage suitable for transfer to

the uterus. This approach was briefly abandoned in favor of natural IVF cycles, as none

of Steptoe and Edwards' patients became pregnant. Despite the success with the birth

of Louise Brown in 1978 with the use of a natural IVF cycle, a few groups began to

reexamine ovarian stimulation, namely Georgeanna and Howard Jones of the Norfolk

IVF program and John Leeton and Alan Trounson of the Melbourne program. Amid

controversy, the persistence of these groups paid off and was eventually proven to be

more effective than natural cycles. Today, ovarian stimulation is a hallmark of IVF and

has spawned the fertility pharmaceutical industry.

Among the current approaches to ovarian stimulation are the utilization of

gonadotropin-releasing hormone (GnRH) analogs, GnRH agonists and GnRH

antagonists, which control endogenous production of gonadotropins and prevent

premature surge of luteinizing hormone (LH). Despite overwhelming improvements in

controlled ovarian hyperstimulation (COH), the use of GnRH analogs is not without

controversy as patient response and outcomes differ between agonist and antagonist

protocols. Currently, an explanation for these differences is unknown. In an attempt to

help elucidate these differences, chapter 3 of this dissertation investigates the

expression of messenger ribonucleic acid (mRNA) and microRNA (miRNA) in granulosa

cells from IVF patients and cell lines treated with GnRH agonists and antagonists.

Comparisons of patterns of mRNA and miRNA expression are warranted as results may

provide insight into a potential molecular mechanism functioning within the ovary in

response to GnRH analog therapy which may have profound effects on future treatment

of patients along with the development of new drug therapies.









Another area of importance for IVF is cryopreservation of embryos. Improvements

in ovarian stimulation and laboratory culture conditions often result in the production of

multiple embryos of transferable quality. While in the past it was common practice for

patients to receive numerous embryos, current efforts to reduce the risk of multiple

pregnancy restrict the number of embryos that can be transferred. As such, following

the transfer of restricted numbers of embryos there are usually at least some remaining

in culture. Among the options for disposition of remaining embryos, cryopreservation for

future use offers perhaps the greatest benefit and is the least controversial choice for

the remaining embryos. Unfortunately, early attempts at cryopreservation often resulted

in poor thaw-survival rates of frozen embryos, in particular at the blastocyst stage. In

fact, many groups abandoned blastocyst cryopreservation, only to revisit the technique

after a few groups reported frozen embryo transfer (FET) pregnancy rates greater than

40% [1-4]. Attempts to duplicate this success have not been uniformly successful

possibly due to differences in freezing and thawing protocols. Included in one of the

more successful cryopreservation protocols are protein sources rich in a- and (3-

globulins [2]. While the function of these macromolecules is unknown, they have been

suggested, to alter the physiochemical environment surrounding the embryo through

interactions of hydrogen bonds with water molecules [5]. As osmoregulation of water

molecules is an essential component of embryo cryopreservation, chapter 4 of this

dissertation investigates the use of globulin-rich protein sources in freezing and thawing

protocols using a murine system in an attempt to improve post-thaw embryo survival.

The last area of IVF investigated in this dissertation is preimplantation genetic

diagnosis (PGD). This powerful tool allows testing of embryos for monogenic disorders









or chromosomal abnormalities prior to transfer to the uterus to thereby avoid potential

miscarriages or decisions to terminate affected pregnancies. Traditional approaches to

screening embryos for chromosomal abnormalities, such as structural rearrangements

or numerical abnormalities, utilized fluorescence in situ hybridization (FISH) on fixed

interphase nuclei from blastomeres removed from cleavage stage embryos. In recent

years, this procedure has been an area of heated debate as pregnancy and delivery

rates of healthy children have not improved, which in theory should have increased with

detection and transfer of normal embryos. A number of reasons for this discrepancy

have been proposed with most focus on the utilization of FISH to diagnose a single

interphase nucleus. This technique is not only limited by the number of chromosomes

that can be analyzed at one time, but also has notoriously high error rates ranging up to

50% [6-11]. These inefficiencies are unfortunate as the frequency of numerical

chromosome abnormalities in preimplantation embryos has been reported to range from

50-70% [6, 12-19]. Accordingly, there is a compelling need for a new technology to

replace interphase FISH. A number of promising technologies have been proposed, but

each has drawbacks that must be overcome before their implementation. Chapter 5 of

this dissertation discusses the investigation of premature chromosome condensation in

blastomeres from bovine embryos using the protein phosphatase (PP) inhibitor,

calyculin-A, in an attempt to produce condensed chromosomes suitable for full

chromosome analysis. [20]. Cytogenetic protocols for utilization of PP inhibitors in cell

lines are well established and with little modification may be able to replace interphase

FISH for preimplantation genetic screening of embryos.









CHAPTER 2
LITERATURE REVIEW

Use of GnRH Analogs for Controlled Ovarian Hyperstimulation

Gonadotropin-releasing hormone (GnRH) is the initiator reproductive hormone

responsible for maintaining the physiology and function of mammalian reproduction. As

such, a vast number of hormone dependent diseases, including prostate cancer, breast

cancer, endometriosis, uterine fibroids, polycystic ovarian syndrome, and precocious

puberty, as well as infertility are treated with synthetic GnRH analogs to regulate

reproductive hormone effects. This review will focus on the use of GnRH analogs for

preventing a premature surge of luteinizing hormone (LH) during controlled ovarian

hyperstimulation (COH) of infertile couples seeking in vitro fertilization.

Gonadotropin-releasing hormone, also referred to as luteinizing hormone-

releasing hormone (LHRH) or gonadorelin, is a decapeptide (pyroGlu-His-Trp-Ser-Tyr-

Gly-Leu-Arg-Pro-Gly-NH2)[21] synthesized in specialized neurons within the arcuate

nucleus of the medial basal hypothalamus (MBH) and preoptic anterior hypothalamus

[22]. Following synthesis, GnRH is transported down axons to the median eminence

where it is released into the hypophysial blood portal system. The release of GnRH

appears to be under the control of a GnRH "pulse generator" within the MBH. In

humans, the pulsatile release occurs every 60 to 100 minutes, but varies across the

normal female reproductive cycle [23]. Upon release, GnRH binds to a seven-

transmembrane G-protein-coupled receptor (GnRH-R) localized on the plasma

membrane of the gonadotroph cells within the anterior pituitary stimulating synthesis

and release of the gonadotropins, LH and follicle stimulating hormone (FSH)[24].









In mammals, several isoforms have been identified for GnRH and its receptors.

The type-I form of GnRH is responsible for regulating gonadotropins, while the type-11

form is a neuromodulator and stimulates sexual behavior [25]. Likewise, two isoforms of

GnRH receptors have been identified; however, the GnRH type-11 receptor has been

silenced in most mammals including humans [26]. The GnRH type-I receptor is

characterized as a typical G-protein coupled receptor with the exception of the absence

of a carboxy terminal tail which is believed to serve an important role in the functioning

of the receptor [25]. Both GnRH type-I and -II can bind and activate the functional GnRH

type-1 receptor [26].

Activation of the GnRH receptor stimulates the phospholipase C (PhL-C) enzyme

cascade, which promotes the rapid formation of inositol-triphosphate (IP3) and

diacylglycerol (DAG) [27]. The formation of IP3 subsequently mobilizes calcium which

activates protein kinase C [27]. This cascade culminates in the synthesis and release of

gonadotropins, LH and FSH, and is controlled by the frequency of GnRH release as well

as feedback by estrogen and androgens [28]. Generally, low frequency GnRH leads to

FSH release, and high-frequency GnRH stimulates LH release. In addition, the

frequency of GnRH release can have profound effects on availability of GnRH-Rs. While

pulsatile GnRH release patterns stimulate the up-regulation of GnRH receptors through

rapid dimerization, internalization, and recycling back to the cell surface, continuous

exposure to GnRH results in down-regulation of GnRH-Rs and suppression of

gonadotropins. This suppressive effect by down-regulation of GnRH-Rs is the basis for

the fundamental principal for controlling ovarian stimulation with GnRH agonists.









The use of GnRH agonists to control ovarian stimulation by suppressing pituitary

release of LH and FSH while stimulating follicular development with exogenous

gonadotropins was first demonstrated in 1984 [29]. Today, this procedure, although

slightly modified, is the primary protocol for preventing premature LH surge in patients

undergoing COH for IVF treatment. Unlike endogenous GnRH, which has a half life of 2

to 4 minutes [30], GnRH agonists are less susceptible to enzymatic breakdown and

have increased binding efficiency to GnRH-R. This increase in biologically potency is

made possible through substitutions of glycine at position six with D-amino acids such

as D-Leu or D-Ser found in Lupron and Buserelin, respectively [31]. In addition, the

replacement of the C-terminal glycinamide residue by an ethylamide group can lead to a

10-fold increase in GnRH-R affinity [31]. Together, these changes improve the

effectiveness of synthetic GnRH agonists up to 200-fold more than endogenous GnRH

making them highly efficient for desensitizing the gonadotroph cells and causing

suppression of pituitary gonadotropins.

GnRH antagonists offer an alternative, opposing mechanism, for preventing

premature LH surge during COH. Contrary to agonists, GnRH antagonists bind to the

GnRH-R without inducing gonadotropin synthesis by competitively inhibiting

endogenous GnRH from activating the GnRH receptor [25]. Competitive inhibition is

advantageous in that its effects are immediate and reversible. The properties of GnRH

antagonists arise mainly from modifications of the N-terminal region which are thought

to be necessary for GnRH actions, but modifications at the pyroglutamic region

(positions 1) or deletion and substitution of hydrophobic D-amino acids at position 2 and

3 have also been shown to be effective in generating antagonistic effects [31].









The protocols for GnRH agonist and antagonist are fairly standard for preventing

premature LH surge in patients undergoing ovarian stimulation for IVF. The major

differences between protocols are with the timing and duration of the GnRH analog

treatment. Generally, with the GnRH agonist "long protocol", patients receive a daily

dose of a GnRH agonist following menses up to the time of trigger with human chorionic

gonadotropin (hCG), which induces final oocyte maturation. Stimulation with FSH is

initiated when the patient is suppressed as evident by low LH, progesterone (P4),

estradiol (E2) (approximately 10 days after the first dose of GnRH agonist). Protocols

using GnRH antagonists differ in that the patients are not suppressed when they begin

stimulation with FSH. Instead, approximately 6 days after stimulation with FSH (or when

the leading follicle reaches 14 mm in diameter) patients receive a daily dose of GnRH

antagonists (or a large single dose) to inhibit premature LH surge up to the time the

oocytes are triggered for final maturation.

Since the introduction of GnRH antagonist protocols for COH [32], a number of

studies have compared patient response and outcome to the GnRH agonist long

protocol. Most studies have found patients treated with GnRH antagonist protocols were

associated with lower gonadotropin dose requirements [33-35], shorter durations of

stimulation [33-38], absence of flare-induced effects (hot flashes, headaches, sleep

deprivation) and decreased risk of ovarian hyperstimulation syndrome (OHSS)[34, 39-

42]. Studies were not in agreement in patient outcomes, however. While a number of

prospective randomized trials have found no differences in pregnancy rates in patients

receiving GnRH antagonists compared to agonists [33, 38, 43, 44], a few studies

reported a small advantage in favor of GnRH agonists, although not statistically









significant [34, 45, 46]. In an effort to clarify these discrepancies, at least four meta-

analyses have been undertaken but findings are equally conflicting. Two meta-analyses

by Al-lnany and Aboulghar [47] and Al-lnany [48] reported significantly higher

pregnancy rates after treatment with GnRH agonists. In contrast, Ludwig and coworkers

[41] and Daya [49] found no differences in pregnancy rates between protocols. Given

inconsistencies between studies and the potential for reduced outcomes, widespread

acceptance of GnRH antagonist protocols has been slow and met with resistance

despite the apparent benefits with patient response.

GnRH agonist and antagonist protocols have also been associated with

differences in concentrations of serum hormones and steroids as well as follicular

steroid concentrations. Several reports have found lower E2 [50-52], T [50], and P4 [50]

in follicular fluid from patients receiving GnRH antagonist compared to agonist

protocols. Ferrari and coworkers also found higher concentration of insulin-like growth

factor-1 (IGF-1) [52] and vascular endothelial growth factor (VEGF) [52, 53] in follicular

fluid obtained from patients receiving the GnRH antagonist protocol. In addition, they

found IGF-1 and VEGF to be inversely correlated with serum LH. Based on their

observations, they suggest the reduced LH release during late follicular maturation in

GnRH antagonist protocols may cause a decrease in steroidogenesis in thecal and

granulosa cells. While their suggestion could explain the reduced concentrations of E2,

T and P4, it does not explain the observed increases in IGF-1 and VEGF in GnRH

antagonists. Alternatively, many researchers have suggested the differences between

GnRH agonist and antagonist may arise because of direct ovarian affects as receptors









for GnRH have been localized in granulosa cells [54, 55]. However, the function of

these ovarian receptors remains unknown.

Direct ovarian action by GnRH analogs has been reported in a number of in vitro

animal and human studies. Hsueh and Erickson [56] were among the first to

demonstrate reduced estrogen production in cultured rat granulosa cells after treatment

with a GnRH agonist. In humans, the direct effects of GnRH analogs on steroidogenesis

of granulosa cells are controversial as no effect [57, 58], inhibitory [59] and stimulatory

[60] effects have been reported. Interestingly, Bussenot and coworkers [61] tested five

different GnRH agonists on steroidogenesis of human granulosa cells and found that

GnRH analogs were able to differentially modulate steroid production, despite all the

analogs having common pituitary effects. Based on their results, they suggested the

activation and function of GnRH-R differs in pituitary and ovarian cells. Recently,

another study investigated the effects of GnRH analogs on the expression of CYP19A1,

a key enzyme in the synthesis of E2 [62]. GnRH antagonists directly suppressed

CYP19A1 in cultured human granulosa cells while GnRH agonists promoted CYP19A1.

Together, these studies lend support to direct and differential actions of GnRH agonists

and antagonists on ovarian cells and suggest their actions may affect expression of

genes essential for ovarian function. A molecular explanation for differential regulation

of gene expression by GnRH analogs remains unknown. Such findings would be of

major concern as any direct ovarian effects of GnRH analogs might affect the quality of

gamete maturation and subsequent embryo development. Further research is

warranted.









Ovarian Expression of miRNAs

MicroRNAs (miRNAs) are members of a newly identified class of small non-

coding ribonucleic acid (RNA) molecules that function post-transcriptionally to regulate

gene expression. Since the identification of the first miRNA in Caenorhabditis elegans in

1993 [63], several hundred more miRNAs have been identified in various species. As of

June 1st, 2010, 579, 615, and 721 miRNAs have been recorded in murine, bovine, and

human databases, respectively (www.mirbase.org), and computational algorithms

predict the existence of several thousands more that may regulate the expression of up

to 30% of genes in humans [64, 65].

The biogenesis and functionality of miRNAs is a complex process (Figure 2-1).

The gene sequences encoding for miRNAs are found throughout the genome and

reside mainly in the intergenic regions and in a few cases in exon regions [66]. In

addition, promoters and regulatory units are included in many of the miRNA genes [67].

MicroRNA biogenesis initially results in the synthesis of primary miRNA molecules (pri-

miRNA) that can range up to a two kilobases long and can also contain sequences of

several different miRNAs as a result of clustering [68]. The pri-miRNAs are cleaved by

type III RNA endonuclease Drosha and its mammalian partner DiGeorge Syndrome

Critical Region 8 (DGCR8) into 70- to 90-nucleotide stem-loop precursor miRNA (pre-

miRNA) in the nucleus [69]. The pre-miRNAs are transported to the cytoplasm by the

nucleocytoplasmic shuttle exportin 5, where they undergo a second cleavage by

another RNA endonuclease, Dicer, generating a 19-24 base-pair-long double stranded

miRNA duplex [68, 70]. The double stranded miRNA duplex unwinds with usually, but

not always, one strand selected to function as a mature miRNA [71]. The mature miRNA

is then incorporated into the RNA-induced silencing complex (RISC), also known as









micro-ribonucleoprotein (miRISC) complexes, which contain a number of proteins, most

notably Argonaute proteins [72]. The Argonautes contain RNA binding domains, PAZ

and PIWI, that bind the single stranded 3' end of the mature miRNA and the 5' end of

the guide strand and orient the mature miRNA for interaction with the target messenger

RNA (mRNA) [72]. The interaction between a miRNA and its target usually occurs in the

3' untranslated region (3'UTR) of the mRNA [73]. The complementary region of the

miRNA is referred to as the "seed" region and contains 7-8 nucleotides. This small

"seed" sequence may be complimentary to hundreds of potential mRNA targets giving

rise to the diversity of gene regulation through only a few miRNA. In plants, the

complementary region has nearly perfect base pairing with the target RNA [74], while in

animals interaction with 2-8 nucleotides is sufficient to regulate gene expression [75]. In

general, miRNA binding to the complimentary target induces translational suppression

by blocking assembly of 80S ribosome [76], or through inhibition of translation after

initiation [77]. However, other reports have also suggested miRNAs can cause an

increase the in degradation of the mRNA target by endonucleolytic cleavage [77] similar

to small-interfering RNAs (siRNAs). This complexity in miRNA function may also be

target gene and tissue specific. As such, full understanding of miRNA functionality will

likely take many more years of research.

Currently, little is known about the role of miRNAs in reproductive tissues. To

date, a few reports have identified the expression of miRNAs in the pituitary [78], ovary

[79-81], testis [82], uterus [83, 84], several reproductive tissue cancers [85-87], and

recently the embryo [88, 89]. With regards to the ovary, several reports have identified

hundreds of miRNAs in fetal and adult mouse ovaries, including several novel miRNAs









preferentially expressed in the ovary [80]. Similar studies in the cow have also identified

more than 50 known and 24 novel miRNAs predominantly expressed in fetal ovarian

tissue [81]. Many of these miRNA are homologous to known miRNAs in other species,

supporting the notion that miRNAs are evolutionary conserved [90, 91]. In addition,

functional studies in other tissues have shown these miRNAs to play a central role in

various cellular activities, including developmental processes, cell growth,

differentiation, apoptosis, cell-cell communication, and inflammatory and immune

responses [92-96] and therefore are likely to be involved in similar processes and

pathways within the ovary.

The mammalian ovary is a dynamic tissue undergoing cyclic recruitment of

growing follicles, atresia, ovulation, and luteal formation and regression. These intricate

events involve highly coordinated endocrine and paracrine processes to modulate cell

growth, angiogenesis, steroidogenesis, and apoptosis. Coordination is most evident in

the development of oocytes and their supporting granulosa cells. Any disruption in this

paracrine communication between germ cells and their supporting somatic cells could

have profound effects on oocyte competence. As such, the processes of

folliculogenesis are tightly regulated by the expression of numerous genes. For

instance, more than 100 genes have been shown to be essential for normal

folliculogenesis in the mouse [97, 98]. Given that miRNAs have previously been

identified in the ovary, and that they function in the regulation of gene expression,

miRNAs may play a critical role in controlling the expression of genes essential for

maintaining ovarian function and avoiding disruption of folliculogenesis, ovulation and

CL formation and regression.









The biological importance of miRNAs has been well documented over the past

decade through a number of studies utilizing animal models and in vitro cell culture that

lack expression of the key miRNA processing protein, Dicer [99, 100]. Studies that

generated homozygous mutant Dicer knockout (KO) embryos found they exhibited

retarded growth and pregnancy declined as early as embryonic day 7.5 (E7.5) [99, 100].

Furthermore, yolk sacs from E11.5 Dicer KO were thin and contained disorganized

blood vessels suggesting developmental arrest was likely due to impaired angiogenesis

[100].

Several studies have since investigated the function of Dicer in growth and

development of oocytes and embryos [101, 102]. During normal folliculogenesis, germ

cells maintain steady transcription of dicer mRNA [103]; however, after fertilization, dicer

mRNA transcript decreases and remains low throughout the blastocyst stage [102, 104].

During this same time, the pool of maternal mRNAs in the mature oocyte decreases

throughout early cleavage, likely in part to Dicer function. Reports using conditional

oocyte specific KO of Dicer suggest folliculogenesis appears normal, as evidenced by

normal ovulation rates. However, oocytes are less likely to extrude polar bodies after

mating, and immunostaining indicated defects in spindle formation and chromatin

condensation [101, 102]. Furthermore, transplanting germinal vesicles from wild-type

mice into Dicer deficient oocytes resulted in similar spindle defects [101]. These results

suggest that meiotic defects arise from ooplasm of the oocyte and not the germinal

vesicle.

The expression of Dicer has also been selectively KO in mullarian duct

derivatives, including oviduct, uterus, cervix and ovary in mice [79, 105, 106]. In one









study [106], Dicer KO females demonstrated normal estrous cycles and successfully

mated as evidenced by fertilized oocytes and blastocysts obtained from day 1 and day 3

pregnancies; however, embryos morphologically contained more fragmentation and

degeneration compared to wild-type. Furthermore, Dicer KO females failed to produce

live offspring. Interestingly, P4 levels were comparable for day 1-3 of pregnancy, but

decreased thereafter. While the authors attribute the loss of pregnancy to poorly

developed oviduct and uteri, reduced luteal function could not be excluded.

In a similar report, ovaries from female mice containing a hypomorph KO of Dicer

(~75% loss of Dicer mRNAs) were transplanted into wild-type females and vice versa

[79]. In that study, dicer KO females receiving wild-type ovaries became pregnant, while

wild-type females receiving the Dicer KO ovaries failed to establish pregnancy despite

apparent normal ovulation, fertilization of oocytes, and cleavage of resulting embryos. In

contrast, serum progesterone concentrations were decreased in females with dicer KO

ovaries along with reduced expression of genes essential for CL formation, including LH

receptor, cytochrome p450 11al and prolactin receptor. Further assessment of Dicer

KO ovaries revealed decreased formation of blood vessels in the CL correlated with an

up-regulation of angiogenic factors, TIMP1 and platelet factor 4. Computational analysis

predicted that miRNAs, mir-17-5p and let-7b, may target these genes. Functional

studies that knocked down each miRNA in wild-type mice showed impaired CL

angiogenesis and decreased P4, similar to dicer KO females. Furthermore, the injection

of mir-17-5p and let-7b into the ovarian bursa of dicer KO females restored the

vasculature and increased P4; although pregnant females failed to deliver offspring

suggesting other miRNAs might be involved and necessary for continuing pregnancy.









While the previous studies suggest miRNAs may function in post-ovulatory

events leading to infertility, another study explored the role of dicer during

folliculogenesis. Using conditional KO mice lacking dicer in granulosa cells, histological

analysis found inactivation of dicer led to an increase in primordial follicle endowment,

accelerated early development of secondary and tertiary follicles, more degenerate

follicles, and more ovarian cysts in KO animals [105]. In addition, the CL in KO ovaries

had abnormal vascularization including the presence of more red blood cells. Analysis

of ovarian gene expression in dicer KO revealed several genes were significantly

reduced by day 4 and day 8, including genes involved in activin/inhibin (inhiba)

assembly, hormone synthesis (cyp 11al, cypl7a1 and cypl9a1), granulosa cell

development (Bcl2, Bax, Casp3, Ccnd2, Cdknlb) and oocyte specific genes (Zp2, Zp3,

Gdf9) as well as expression of mir-503. Functional analysis through transfection of pre-

mir-503 into primary cultured granulosa cells resulted in significant down-regulation of

both target and non-target genes involved in granulosa cell proliferation and

luteinization. These results suggest the Dicer-regulated signal pathway plays an

important role in follicular cell development through differential regulation of gene

expression.

Although the aforementioned studies clearly demonstrate the importance of the

miRNA processing protein Dicer in reproductive tissues, it remains unclear how miRNAs

are themselves regulated and how their function can regulate expression of genes

essential for maintaining ovarian physiology and preserving fertility. Recently, a few

reports have investigated the regulatory effects of hormones on the expression of

ovarian miRNAs [107, 108]. In one study, the effects of LH surge were investigated by









collecting murine granulosa cells from periovulatory follicles before and 4 hours after an

ovulatory dose of hCG (mimic LH) [107]. Microarray analysis showed differential

expression of 13 miRNAs, including mir-132 and mir-212, despite no changes in the

expression of Dicer. In addition, functional assessment of mir-132 and mir-212

demonstrated granulosa cells transfected with specific anti-mir probes and treated with

cAMP to simulate the second messenger system downstream of LH/hCG differentially

expressed several potential gene targets, including CTBP1, which was recently shown

to interact with steroidogenic factor-1 [109]. These results suggest hormonal stimulation

(LH/hCG) of ovarian tissue can regulate the expression of miRNAs, such as mir-132

and mir-212, which in turn may affect the expression of several genes important for

ovulatory events, including the final maturation of oocytes, luteal formation, and steroid

synthesis.

A similar study recently investigated the hormonal effects of FSH on ovarian

expression of miRNAs [108]. In situ hybridization of murine ovarian tissue revealed

select miRNAs (mir-142, let-7a, mir-125b, let-7b, let-7c, and miRr-21) were less

detectable in primordial follicles, but were readily detectable in granulosa cells from

primary, secondary and tertiary follicles suggesting expression may be under hormonal

regulation. Further experimentation using the murine ovarian cell line KK-1

demonstrated treatment with FSH reduced the expression of mir-143, let-7a and mir-

125b overtime. Based upon these results, the authors suggest FSH may regulate

folliculogenesis through a network of miRNAs.

Given that hormones drive follicular development and steroid production and that

the expression of miRNAs has recently been shown to be affected by FSH and LH/hCG,









and that defects in ovarian miRNA are associated with follicular and ovulatory

dysfunction, it would be expected that ovarian miRNAs play a role in ovarian

steroidogenesis. In support, a recent study using human granulosa cells transfected

with a miRNA library containing synthetic precursor miRNAs demonstrated differential

release of P4, T, and E2 [110]. Their results found transfection with 36 out of 80 tested

precursor miRNAs significantly inhibited P4 release, including mir-15a and mir-188,

while 10 miRNAs enhanced release of P4. Transfected miRNAs had similar effects with

T (57/80 miRNAs inhibited T release, while 1 activated T release) and E2 (51/80

miRNAs suppressed E2 release, while none activated E2 release). Functional studies

showed transfection with specific anti-mir probes successfully knocked down mir-15a

and mir-188 and significantly stimulated P4 release. This study suggests that among the

ovarian functions of miRNAs, they may regulate the processes of steroidogenesis.

Several studies have shown miRNAs to have an important role in ovarian

physiology. Furthermore, other studies have shown the expression of ovarian miRNAs

to be influenced by the same hormones responsible for regulating ovarian function. In

addition, disruption of the miRNA pathway has been found to result in ovarian

dysfunction, including abnormal follicular development, meiotic maturation, luteal

regression and formation, and abnormal steroid release. How these findings are related

to infertile disease remains unknown. However, the cumulative evidence suggests

miRNAs play a crucial part in regulating ovarian function. As such, fertility treatments

using different hormonal stimulation regimens may have differential effects on the

expression of ovarian miRNAs that may affect ovarian response differently. Therefore,

future studies are needed to determine if differences observed in patient response using









different stimulation regimes may be explained through altered regulation of ovarian

miRNAs.

Protein Supplementation of In Vitro Systems

Over the last few decades, advances in ART, including culture media, stimulation

procedures, and intracytoplasmic sperm injection (ICSI), have brought forth an age

where pregnancy rates of 60% can now be routinely achieved. While advances in each

of these areas has contributed to the overall improvement of ART, improvements in

culture media have perhaps had the greatest impact within the laboratory on sustaining

the viability of developing embryos. This review will focus on inclusion of

macromolecules in human embryo culture media with emphasis on the development

and utilization of Synthetic Serum Substitute (SSS).

In the early days of IVF, practitioners relied on culture media developed for

somatic cells (reviewed in detail by Summers and Biggers [111]). Accordingly, the

supplementation of embryo culture medium with macromolecules, such as serum, was

also borrowed from somatic cell culture. Serum or proteins from serum were initially

believed to provide some nutritional necessity for proper embryo development. Caro

and Trounson [112] however, were able to demonstrate IVF and pregnancy could be

achieved with embryos cultured in protein-free conditions. This result suggested serum

or other protein supplementation is not a requirement but rather acts to improve the

performance of embryos within a culture medium [113]. Additionally, early studies

comparing different sources of serum as well as different lots of the same source of

serum demonstrated inconsistencies within patients and batch to batch variation. It is

now well recognized that serum is a complex mixture containing a number of undefined

components that can vary from lot-to-lot resulting in unpredictable embryo development









and pregnancy. Despite this drawback, serum, including fetal calf, maternal, and fetal

cord, continued to be a major component of embryo culture media as it consistently

produces greater pregnancy rates than protein-free systems.

Slowly, with improvements in embryo culture conditions, a movement grew

towards the use of more defined culture components, including sources of protein, in an

effort to overcome the inconsistencies in embryo culture media performance and to

avoid the possibility of introducing serum contaminants. Produced from ethanol

precipitation of whole serum, serum albumin, initially from bovine (BSA) and later from

human (HSA), was a more defined protein component shown to produce equivalent

rates of fertilization, cleavage and pregnancy when compared to whole serum [114,

115]. At the time, commercial sources of HSA were limited to plasma volume expanders

licensed for intravenous infusion. Two such expanders were Plasmanate and

Plasmatein. Like other plasma volume expanders, these expanders are composed

predominantly of HSA, but they also contain a significant proportion of a- and 3-

globulins.

Two groups set out to evaluate the use of Plasmanate and Plasmatein as

embryo culture medium supplements. Plasmanate, composed of 88% normal human

albumin, 12% a- and 3-globulins, and not more than 1% y-globulins, was studied by the

Cornell IVF program [116]. Meanwhile Pool and Martin [5] studied Plasmatein, which

contained up to 5% more a- and 3-globulins than Plasmanate. Although not directly

compared, both Plasmanate and Plasmatein resulted in similar pregnancy rates. Both

groups attributed the success of these plasma extenders to the presence of the a- and

3-globulins, which might be mediating their effects by binding with available water









molecules and changing the microenvironment to one more conducive for embryonic

growth. Interestingly, despite successful fertilization and pregnancy when used as a

protein supplement, neither Plasmanate nor Plasmatein were developed for use as a

supplement for culture of embryos. In fact, characteristics such as the ionic strength, pH

and osmolarity, were optimized for vascular physiology and not embryonic development.

Weathersbee and coworkers [117] set out to overcome the drawbacks of these plasma

extenders by formulating a protein supplement containing high concentrations of a- and

3-globulins prepared in a solution more suitable for inclusion within embryo culture

media. Their efforts led to the development of Synthetic Serum Substitute (SSS; Irvine

Scientific, Santa Ana, CA, USA), composed of 6% total human protein containing 84%

HSA, 16% a- and 3-globulins and with less than 1% y-globulins in a saline solution with

a pH of 7.2-7.4 and an osmolarity of 275-285 mOsm/kg.

Since its initial development, SSS has undergone numerous animal and human

studies examining its ability to support embryonic development and pregnancy. When

tested with the culture of frozen-thawed mouse embryos, SSS supplementation was

comparable with Plasmatein and produced high rates of embryo development with

100% blastocyst formation [117]. Another study using mouse embryos compared

culture media performance when supplemented with either SSS or serum from patients

[118]. Interestingly, media supplemented with SSS produced more total blastocysts and

hatched blastocysts compared to media supplemented with serum from a proven fertile

donor (83.7% vs. 39.4% and 43.2% vs. 9.1%, respectively) suggesting SSS may be

clinically beneficial for IVF.









With regards to culture of human embryos, several studies have compared

media performance with SSS and other protein supplements [119-121]. One study

compared supplementation with SSS to Plasmanate and maternal serum for sperm

preparation and oocyte and embryo culture [119]. Results from that study revealed a

trend towards a higher pregnancy rate and a significant increase in implantation rates

with SSS compared to maternal serum or Plasmanate. Surprisingly, the rate of

fertilization was lower when SSS was used for sperm preparation and insemination

compared to Plasmanate. A different study compared supplemented culture media with

SSS or fetal cord serum [120]. In this study, there were no significant differences in

rates of fertilization, pregnancy, or implantation for embryos produced in media

supplemented with SSS or fetal cord serum. Yet another study compared SSS and HSA

in the early culture of human oocytes and embryos [121]. In that study, sperm, oocytes,

and fertilized embryos were processed and cultured until day 2 with SSS or HSA.

Fertilization rates were similar for both treatments and resulting embryos were scored

with similar high quality grades on day 2. Pregnancy rate and implantation rate were

reported only for the SSS group, but were comparable to the clinics previous experience

with HSA. Taken together, these studies demonstrate SSS to be comparable and in

some cases better than other protein supplements for the fertilization and development

of embryos while sustaining high pregnancy and implantation rates.

In addition to improving development of cleavage stage embryos, globulin-rich

supplements have also been tested for improving extended culture of blastocysts. The

importance of blastocyst development cannot be understated, especially in today's

laboratory where selection of the best one or two embryos from a cohort is necessary to









reduce the risks of multiple pregnancy. Schneider and Hayslip [122] cultured mouse

embryos to the blastocyst stage in medium supplemented with either SSS, HSA, or a

mixture of globulins and HSA. Their results indicated SSS or HSA+globulins to be

superior for the development of embryos to hatched blastocysts compared to HSA

alone. They also demonstrated that SSS could "rescue" hatching by transferring

embryos from HSA to a globulin-containing medium. Additionally, they showed that

hatching can be inhibited by removing embryos from globulin-containing medium. Other

groups have made similar observations which have led some to suggest that the

transition from morula to the early blastocyst stage is marked by a critical transition

phase influencing hatching [123]. Whether or not this holds true, it is clear that protein

supplementation during extended culture, and in particular globulin-rich supplements,

can promote blastocyst development and hatching.

The mechanism by which macromolecules, such as globulins, enhance in vitro

development of embryos is currently unknown. The original developers of SSS

suggested the growth promoting effects of globulins were predominantly physical rather

than chemical [5]. Central to their hypothesis is the number and orientation of hydroxyl

(-OH) groups in glycoprotein macromolecules, such as globulins, which may allow them

to interact through hydrogen bonds with water molecules to alter the microenvironment

[124]. Interestingly, naturally occurring glycoprotein macromolecules found within the

oviduct have also been proposed to modulate the microenvironment by affecting the

interaction of cations, sugars and other essential substrates with the developing embryo

[125]. Among the macromolecules identified in the reproductive tract include Mucus

glycoproteins [mucins [126-130]] and hyaluronan [131, 132].









Gardner and coworkers [133] have previously examined the effects of

supplementing embryo culture medium with hyaluronan. In their study, they compared

embryo development and implantation using culture medium supplemented with

macromolecules hyaluronan, BSA, polyvinylalcohol (PVA), or dextran. The highest rates

of implantation came from embryos exposed to hyaluronan. Murine [134], bovine [135]

and human [136] embryos are known to have receptors for hyaluronan so the functions

of this macromolecule in culture or in the oviduct are probably not limited to physical

interactions with the microenvironment.

Nonproteinaceous macromolecules, such as PVA and dextran, are known to

interact strongly with water and may provide support to a physical role of

macromolecules such as globulins during in vitro development. Bavister [137] previously

demonstrated PVA was able to replace BSA for the development of hamster and bovine

embryos. In addition, a protein supplement containing a mixture of dextran and HSA

[Dextran Serum Supplement (DSS);Irvine Scientific] was recently made commercially

available for inclusion of embryo culture medium. Preliminary reports from the

manufacturer demonstrated DSS performed equally to SSS in promoting blastocyst

development. The growth promoting effects of dextran are likely similar to globulins, as

both are included in intravenous volume expanders used for improving osmotic blood

pressure. As such, it is conceivable to think that these macromolecules interact with

minute amounts of water in the embryo microenvironment much like the way they help

to maintain water volume in the vasculature. In doing so, these macromolecules could

be altering the physical interactions of the preimplantation embryo with its

microenvironment which may enhance biological effects.









Alternatively, one could argue that there may be some unknown chemical

interaction responsible for the enhanced performance of embryo culture media when

supplemented with protein macromolecules. The processes of protein purification are

not absolute and consequently, trace amounts of embryotrophic peptides, such as

growth factors, could be present within the processed macromolecules and be

responsible for the improved embryonic potential.

Since their first introduction, macromolecules have played an integral role in the

improvement of embryo culture media. Numerous reports have shown enhanced

potential of embryos when cultured in the presence of macromolecules. Most notably

are globulins, which are now commercially available as supplements for embryo culture

media as SSS or Serum Protein Supplement (SPS; Sage In Vitro Fertilization, CT).

While the mechanism remains unknown, the enhanced embryonic potential derived

from the inclusion of these macromolecules has no doubt helped improve the overall

success rates of ART. With the advent of culture medium rich in hyaluronan

(EmbryoGlue,Vitrolife, Englewood, CO) and dextran, as well as the availability of

recombinant HSA, it will be interesting to see if greater understanding of the interaction

between macromolecules and embryos in culture media will explain enhanced viability.

Perhaps one day, protein-free culture media will be developed that support embryo

growth as effectively as or even better than current available media.

Cryopreservation of Blastocysts

The Successful cryopreservation of mammalian embryos was first demonstrated

in 1972, when Whittingham and coworkers [138] obtained live offspring following the

transfer of frozen-thawed mouse morula. A year later, these techniques were applied to

domestic animals, most notably cattle [139]. In humans, the first pregnancy was









reported by Trounson and Morh [140] in 1983, following transfer of a frozen-thawed

eight cell embryo. Shortly thereafter, Cohen and coworkers reported successful

cryopreservation of human blastocysts [141].

Today, the importance of blastocyst cryopreservation is greater than ever before

as improvements in extended embryo culture often result in the production of more

blastocysts than can be transferred to the patient. Consequently patients must make a

decision on the disposition of remaining embryos, such as cryopreservation for future

use, donation to an infertile couple, donation to research, or discard. Among the

choices, donating for research or discarding remaining embryos are controversial and

many patients and laboratory personnel have ethical concerns. Alternatively,

cryopreservation for future use and donation to an infertile couple, offer perhaps the

greatest benefit and are the least unethical solutions; however, both require the

laboratory to be proficient at freezing and thawing embryos. This review will focus on

current concepts of blastocysts cryopreservation.

The principals of cryopreservation have been well documented [142, 143], and

understanding their fundamentals is essential for gaining insight into the cellular and

molecular changes occurring in embryos during the freezing and thawing process.

During freezing, decreasing temperatures eventually cause extracellular water

molecules to transition from a liquid into a solid, generally in the form of ice crystals. The

osmolarity of the remaining solution surrounding the embryo then increases as the ratio

of free water to salts decreases. This increase in salt concentration in the extracellular

environment causes osmoregulatory mechanisms, including diffusion and active

transport, to drive water out of cells leading to dehydration. If this process is controlled









by a slow rate of freezing, then the formation of extracellular ice is harmless.

Conversely, if the temperature cools too quickly, then cellular water will transition into

intracellular ice crystals before the cell is dehydrated. The formation of intracellular ice,

in contrast, can damage cytoskeletal structures thereby affecting the integrity of cell

membranes. Fortunately, problems associated with intracellular ice formation can be

reduced with the aid of cryoprotectants. Theses chemical compounds increase the total

concentration of all solutes in the system, thereby reducing the amount of ice formed at

any given temperature. In addition, some cryoprotectants, such as glycerol, propandiol,

ethylene glycol and dimethyl sulfoxide (DMSO), increase cell membrane permeability

thereby allowing water to diffuse out of the cell more rapidly. As such, the inclusion of

cryoprotectants, along with controlling the rate of cooling, are important steps in all

freezing protocols.

During the thawing process, the transition from a frozen to an aqueous state

must occur faster than the rate at which the embryos were originally frozen. The reason

for this difference is that slow warming puts cells at a greater risk for ice crystal re-

formation or re-crystallization which can lead to membrane damage [142]. In contrast,

during rapid warming there is insufficient time for re-crystallization, and any ice crystals

melt away [142].

Upon thaw, permeating cryoprotectants need to be promptly removed to again

avoid toxic injury. Exposure to lower concentrations of cryoprotectants causes the

osmotic uptake of water at a faster rate than the diffusion of cryoprotectants out of the

cell [142]. This causes cells to swell above their initial volume. As cells are generally









more sensitive to swelling than shrinking, removal of cryoprotectants tends to be more

hazardous than their addition.

With an understanding of the general principles of freezing, embryologists have

been able to attain good success from cryopreservation of zygotes and early cleavage

stage embryos. The cryopreservation of blastocysts, however, has been more

challenging as early results were marred with poor rates of post-thaw survival. It was

almost 20 years between the first reported pregnancy from a frozen blastocyst [141] to

when Veeck and coworkers [2] reported high clinical pregnancy rates from frozen

blastocysts. In the interval, many groups had abandoned blastocyst cryopreservation.

Eventually though, with improved extended culture conditions, several groups began to

revisit blastocyst cryopreservation and reported pregnancy rates greater than 40%

following frozen embryo transfer (FET) [1-4]. Unfortunately, many other programs have

not been able to attain similar successes [144-149]. The differences in thaw survival of

early cleavage stage embryos and blastocysts suggest blastocysts have unique

properties which may require further optimization of freezing and thawing procedures.

Those groups that reported high rates of success may have, unbeknownst to them,

managed to highlight some differences that are necessary for attaining good post-thaw

survival.

There are at least two differences between blastocysts and cleavage stage

embryos that may factor into cryopreservation success rates. For one, the cells of the

trophoblast and inner cell mass (ICM) are much smaller compared to cells from an early

cleavage stage embryo. This size difference would mean the cell volumes from

blastocysts should contain less water, which would otherwise be thought to be an









advantage, as cells from blastocysts should be at reduced risk for intracellular ice

crystal formation. However, it is plausible that the permeability of cells from the

trophoblast and/or ICM differ compared to cells from early cleavage stage embryos

because of their reduced size or differentiation, which may affect the rate of exchange

of cryoprotectants and water. Another difference that may contribute to the lower thaw

survival of blastocysts is the presence of the blastocoele. This fluid filled cavity, if not

dehydrated, may lead to the formation of ice crystals within the cavity. While these

crystals would not be intracellular, the shear forces that they exert within the blastocyst

may damage extracellular structures and interconnections between cells, as observed

in the cryopreservation of multicellular organs and tissues [150-152]. Another possibility

is that the blastocoele cavity itself may affect the permeation of the cryoprotectants,

especially with cells of the ICM, and this may lead to highly damaging intracellular ice

crystal formation within those cells.

Overtime, a number of different approaches have attempted to further optimize

blastocyst cryopreservation protocols. The most notable studies include investigations

into changing the start temperature and cooling rate [153], artificially shrinking the

blastocoele cavity [154, 155], incorporating macromolecules into cryo solutions [156,

157], and more recently vitrification [3, 4, 158].

Gardner and coworkers [153] set out to determine the effects of start temperature

and cooling rate of slow freezing protocols on blastocyst viability. Using human

blastocysts donated for research, they tested freezing with a start temperature of -6C

and a cooling rate of 0.5C/minute compared to a more traditional control rate that starts

at 20C and cools to -6C for seeding and then continues cooling at 0.3C/minute. After









thawing, blastocysts frozen with the lower start temperature and slightly faster cooling

rate had a thaw survival rate of 75% compared to 15% for the more traditional protocol.

Based on these results, they applied the lower start temperature and faster cooling rate

clinically, and they were able to attain a 69% thaw-survival, 60% on-going pregnancy

rate and 30% implantation rate. The authors concluded that the shorter protocol

increased thaw-survival likely by reducing the duration that the blastocysts were

exposed to toxic cryoprotectants. Interestingly though, other groups using the traditional

longer protocol have reported high thaw-survival and pregnancy rates [2, 3] suggesting

other factors may also improve blastocyst cryopreservation.

Recently, several groups have investigated vitrification of blastocysts as a means

to improve thaw-survival. Vitrification differs from traditional slow control-rate freezing in

that blastocysts are directly plunged into liquid nitrogen causing a rapid decrease in

temperature producing a glass-like state without ice-crystal formation [159]. The theory

is that if done properly, vitrified embryos are not at risk for injury from ice crystals [160],

and therefore should have higher survival rates. Additional advantages of vitrification

technology are that expensive control-rate freezers are not needed, the duration of the

freezing and thawing procedures are much shorter, and that the same protocol can be

applied to all stages of embryonic development, including oocytes [161]. Currently,

several groups have reported high rates of survival and pregnancy following vitrification

suggesting the technology holds tremendous promise [3, 4]; however, differences in

vitrification protocols, including solutions and storage containers, have made the

technology difficult to reproduce by inexperienced groups. Complicating the matter is

that concentrations of cryoprotectants are much higher than in traditional freezing









protocols requiring laboratory personnel to work within time constraints to avoid toxicity.

Eventually, when the protocols become more uniform and laboratory personnel become

more experienced, this technology will replace traditional freezing methods. In the

meantime, as some of the freezing principals, such as the osmoregulation of water and

cryoprotectants, apply to both vitrification and traditional control-rate freezing, it will be

interesting to see if other factors that improve control-rate thaw-survival also help

improve survival following vitrification.

Several groups have investigated the effects of artificially shrinking the

blastocoele cavity prior to freezing, which might reduce the risk for ice crystal formation

and potential injury. Three different approaches to artificially shrink the blastocoele

cavity have all resulted in improved blastocyst thaw-survival, including puncture with a

needle [154, 155, 162], micropipetting [163], and laser [162], These reports, however,

were using vitrification technology, and their effects may be limited to that technique.

While no study has reported on artificially shrinking of blastocysts frozen by control-rate

methods, a study comparing the natural osmotic shrinkage of blastocysts in cryo

solutions using control-rate freezing reported a 73% thaw-survival rate from blastocysts

that underwent blastocoele collapse compared to a 33% thaw-survival from those that

did not collapse [164]. Together these studies suggest that the blastocoele cavity or

fluid within negatively effects thaw-survival, but also those blastocysts that are able to

undergo osmotic shrinkage are more likely to survive.

Macromolecules are routinely incorporated into freezing and thawing solutions.

Proteinaceous macromolecules, such as albumin [165], have been shown to improve

thaw-survival of blastocysts. Today, almost all embryo cryopreservation solutions









contain twice the amount of albumin than found in standard culture medium, as doubling

the concentration of albumin increases thaw-survival [165, 166]. Another

macromolecule, hyaluronan, which is known for its promoting effects on development

and implantation of fresh embryos [133, 167], has also been shown to increase

blastocyst thaw-survival. Several studies have demonstrated enhanced thaw-survival

and development of blastocysts for embryos cultured with hyaluronan [167, 168]. In

addition to embryo culture, Palasz and coworkers [157] found that replacement of

newborn calf serum with hyaluronan in freezing medium resulted in similar high rates of

thaw-survival of bovine blastocysts. While studies such as these demonstrate benefits

of macromolecules in cryopreservation, the mechanism by which these compounds

affect thaw-survival is unknown. Interestingly, non-proteinaceous macromolecules, such

as dextran and ficol, have also been shown to improve thaw-survival [156] suggesting

the mechanism may be physical rather than biological.

Although not directly tested on thaw-survival, protein supplements rich in globulin

macromolecules have been incorporated into many of the most successful

cryopreservation protocols, including slow control-rate [2] and vitrification [4] of

blastocysts. Pool and Martin [5] suggested that globulins mediate their effects by

interacting with water molecules thereby changing the microenvironment surrounding

the embryo. As such, it is conceivable that macromolecules alter the physiochemical

environment during freezing and thawing and by doing so improve the embryo's ability

to handle osmoregulatory stress. This action could reduce the risk for ice-crystal

formation during freezing and also facilitate rehydration and removal of cryoprotectants

during thawing. As reduced risk to ice crystal formation could improve thaw-survival,









future studies are needed to determine the effects of globulin-rich sources on thaw-

survival.

Preimplantation Genetic Diagnosis

Preimplantation genetic diagnosis (PGD) is a powerful tool used to test individual

embryos for genetic abnormalities. This technology is more favorable than prenatal

testing as embryos are screened prior to transfer to the uterus avoiding potential

miscarriages and termination of affected pregnancies. The first demonstration of

preimplantation genetic testing occurred in 1968 with the sexing of rabbit embryos [169].

Many years later, after the development of clinical IVF and polymerase chain reaction

(PCR), Handyside and coworkers [170] applied sex selection to human embryos from

couples at risk for transmitting an X-linked disorder. Two years later, the same group

applied the technique to test for cystic fibrosis (CF)[171]. Since then, preimplantation

embryos have been tested for hundreds of monogenic disorders, structural and

numerical chromosomal defects, mitochondrial diseases [172], and human leukocyte

antigen (HLA) matching [173]. This review will cover historical and current concepts of

PGD with emphasis on testing embryos for structural and chromosomal defects.

Preimplantation testing begins in the IVF laboratory with the biopsy. There are

three potential sources of genetic material for testing and each has its own set of

advantages and disadvantages. The earliest source of genetic material can be obtained

by biopsy of the preconception first and post-conception second polar bodies. As

meiotic products of oogenesis, the contents of the polar bodies can be used to indirectly

make inferences about the genetic composition of the oocyte [174]. The advantage of

this method is that the risk to the mature oocyte or the fertilized zygote is low because

genetic material is not removed from either source. The downside is that only the









maternal genetic contribution to the embryo can be analyzed. As such, this method of

biopsy is rarely used.

Another source for biopsy is blastomeres from day 3 cleavage stage embryos.

Embryos at this stage are generally composed of 6-8 blastomeres. In theory, each

blastomere should be representative of the genetic composition of the whole; although

in practice this is not always true do to the inherit mosaic nature of embryos (discussed

in more detail later) [175]. The procedures for removal of a single blastomere are

simple, and the potential risk of injury is small relative to the genetic benefit. As such,

removal of a single cell from a cleavage stage embryo is currently the preferred method

of biopsy by most programs.

The last potential source of genetic material comes from the trophoblast.

Removal of 5-10 cells from the outer layer of the blastocyst, if done properly, is

considered to pose little risk to the inner cell mass that will eventually become the

embryo proper. The main advantage is that genetic analysis of multiple cells reduces

the risk for misdiagnosis. The problems with the procedure are that the biopsy is

technically challenging, time constraints for genetic analysis usually require the biopsied

blastocysts to be cryopreserved, and there is concern that embryos that autocorrect by

allocating abnormal cells to the trophoblast may be misdiagnosed [176]. For most

laboratories, these risks currently outweigh the potential benefits. Perhaps in the future,

with the development of rapid genetic tests and/or better cryopreservation techniques,

this will become the preferred biopsy method.

For traditional testing of monogenic disorders, such as CF, Duchenne muscular

dystrophy and Huntington's disease, the biopsied samples are simply loaded into micro









tubes and shipped overnight to a PGD laboratory for analysis. The single most

technically challenging aspect for the PGD laboratory is making a genetic diagnosis

from as little as one copy of the genome. PCR has traditionally been used to amplify the

genes of interest to detectable levels. Initially, amplification inefficiencies limited the

practical use of PCR. One of the most common occurrences was failure of one of the

two target alleles to amplify (referred to as allelic dropout; ADO) which may lead to

misdiagnosis, especially in dominant disorders. Fortunately, numerous strategies have

since been developed to overcome ADO [177]. Today, PCR for monogenic disorders

has an accuracy of greater than 99% [178] making this technology invaluable in

avoiding the transfer of embryos with potentially life-altering genetic disorders.

Testing of preimplantation embryos for structural and numerical chromosomal

abnormalities is traditionally done with fluorescence in situ hybridization (FISH). Prior to

FISH, the biopsied cell must be fixed to a glass microscope slide. The fixation process

is challenging and has been an area of concern for many years [179]. Complicating the

procedure is that blastomeres are most frequently found in the interphase stage of the

cell cycle. As such, nuclear chromatin must be carefully fixed to allow hybridization

without overlapping or distortion of probe signals. Once fixed, the nuclear chromatin is

hybridized with chromosome specific DNA probes labeled with different colored

fluorochromes. Currently, only 5-6 colors are distinguishable at any given time, limiting

the number of chromosomes that can be analyzed with a single hybridization. This,

combined with the analysis of interphase nuclei, complicates preimplantation screening

of structural and numerical chromosomal defects.









Couples in which one of the partners carry a balanced translocation are at high

risk for the resulting embryos to have structural abnormalities; reportedly 72% for

Robertsonian translocations and 82% for reciprocal translocations [180]. Since the

majority of these structural abnormalities result in miscarriage, there is a strong need to

screen individual embryos prior to transfer to the uterus. Fortunately, FISH with as few

as three probes can be used to screen against structural abnormalities associated with

most reciprocal and Robertsonian translocations [181], regardless of whether the

biopsied cell is in interphase. The downside to interphase FISH for structural

abnormalities is that the method cannot distinguish between a normal and balanced

chromosome complement [182]. In addition, hybridization failure of a single probe may

result in misdiagnosis and the transfer of a potentially lethal embryo. The only way to

overcome such limitations with FISH would require analysis of condensed

chromosomes enabling detection of the breakpoints.

The frequency of numerical chromosome abnormalities in preimplantation

embryos has been reported by multiple studies to range from 50-70% [6, 12-19].

However, the frequency of aneuploidy determined by prenatal analysis is not nearly as

high. One possible explanation for this discrepancy is that the majority of

preimplantation embryos are aneuploid and developmentally arrest before reaching the

prenatal stage. Preimplantation genetic screening (PGS) is a procedure of PGD capable

of detecting chromosome copy numbers. Theoretically, the culling of embryos

containing numerical chromosomal abnormalities, such as monosomies or trisomies,

and the transfer of embryos identified as euploid should improve implantation rates and

decrease the frequency of miscarriage. As such, there is a tremendous need for PGS.









Unfortunately, traditional methods of PGS using interphase FISH have a number of

drawbacks making its use for improving IVF outcomes debatable.

Among the problems with interphase FISH are the limitations of the number of

chromosomes that can be screened. PGS protocols typically screen a maximum of 9 to

12 chromosomes, but require multiple rounds of hybridizations to do so. This is a

concern as previous reports have associated multiple rounds of FISH with increased

error rates [183]. To limit the risk of error, only the most common chromosomes affected

by aneuploidy (22, 16, 21 and 15) [184] as well as those in which trisomies are capable

of reaching live birth (13, 18, 21, X and Y) are typically screened with PGS. However,

this equates to fewer than half of all chromosomes being screened for potential

numerical abnormalities.

An additional problem with PGS is the reportedly high error rate estimated to

range from 4 to 50% [6-11]. Most often, the contributing factor affecting error rates is the

quality of the fixed chromatin. Problems associated with poorly fixed nuclei include:

damaged/lost chromatin, probe hybridization failures and misinterpretation of probe

signals [179]. Ultimately, these errors can result in the labeling of a normal embryo as

abnormal or labeling of an abnormal embryo as normal. While both outcomes are

unacceptable, the later could have profound effects if the embryo is trisomy for 13, 18,

or 21 and is transferred back to the uterus. As such, there is an urgent need for the

development of alternative approaches for determining numerical abnormalities in

preimplantation embryos.

Yet another problem with PGS is mosaicism. Mosaic embryos are those where

chromosome number differs between cells within the same embryo. For example, some









blastomeres could be diploid and others aneuploid. This phenomenon is believed to be

caused by mitotic errors in comparison to traditional aneuploidy that is thought to be

caused by meiotic errors [185]. The frequency of mosaicism is estimated to range from

~25-60% [14, 175, 186, 187], however, these estimates are likely confounded by the

error rate of interphase FISH. On the other hand, the error rate of FISH may be

overestimated because of mosaicism [188].

Several alternative approaches to traditional PGS have been proposed, including

comparative genome hybridization (CGH) [189], induced metaphase FISH [190, 191],

and more recently microarray [192]. The application of CGH for analysis of blastomeres

was first demonstrated by Wells and coworkers in 1999 [189]. This procedure works by

comparison of the test DNA with known reference DNA. Both test and reference DNA

samples are labeled with different color fluorochromes and then hybridized to a

previously fixed set of metaphase chromosomes on a microscope slide. Computerized

imaging systems examine fluorescent intensities of the test DNA and the reference DNA

to determine chromosome copy number. The main advantage of CGH over interphase

FISH is that the copy number of all chromosomes can be determined. In addition, CGH

provides coverage of the entire length of each chromosome, enabling the detection of

potential breakpoints in translocations. However, CGH cannot distinguish euploid from

ploidy errors, such as haploid, triploid or tetraploid. In addition, traditional CGH is labor

intensive and generally takes 3-5 days to yield results [193], requiring the embryos to be

frozen which may compromise the overall success. Another limitation is that CGH is not

sensitive enough to work with a single cell, requiring whole genome amplification

(WGA). Traditional WGA methods, including degenerate oligonucleotide primed PCR









(DOP-PCR) and primer extension preamplification (PEP), were often found to unevenly

amplify the genome complicating CGH analysis. Only, recently with a newly developed

and more efficient methods for WGA is there renewed interest in CGH [194, 195];

however, even with this improvement the overall length of the procedure remains too

long for clinical application of PGD.

Another alternative approach to PGS with interphase FISH is the application of

DNA microarray technologies. Recently, CGH-arrays and single nucleotide

polymorphism-arrays (SNP-arrays) have been proposed for full chromosome analysis of

preimplantation embryos. CGH-array is somewhat similar to traditional CGH, requiring

WGA and competitive hybridization of labeled test DNA and reference DNA to

thousands of chromosome specific probes spotted on the surface of a slide [196].

Hellani and coworkers [197] recently reported clinical use of CGH-array for PGS-

aneuploidy screening. In that study they were able to detect chromosomal abnormalities

in 60% of the embryos. Selection and transfer of euploid embryos in 5 out of 6 patients

resulted in pregnancy. Despite their success, the WGA was not robust and required the

removal of two blastomeres to attain a reproducible result with CGH-array. This is a

major concern as the removal of more than one blastomere has previously been

suggested to impact embryonic potential [198]. An additional concern is that no study

has validated the accuracy single cell CGH-array for aneuploidy testing calling into

question its clinical application.

SNP-array methodology is similar to CGH-array, but the test DNA following WGA

is hybridized to thousands of SNPs instead of chromosome specific probes. Recently,

Treff and coworkers [199] validated single cell 24 chromosome aneuploidy screening









using cell lines with known karyotypes demonstrating a 96% success rate of obtaining a

reliable result. In addition, they demonstrated the technique could be applied to single

blastomeres from cleavage stage embryos with high rates of concurrence. While that

study did not analyze any transferrable embryos, a similar report by the same group

used SNP-array to successfully DNA fingerprint and molecular karyotype blastomeres

from sibling embryos prior to transfer [200]. Based on the studies to date, SNP-array

has perhaps the most potential for not only improving assessment of chromosomal

abnormalities, but also for improving IVF laboratory performance through sibling embryo

investigations of laboratory culture components. The current downside to SNP-array is

that the chips are very expensive. Eventually though, as chips become more

competitively priced, the potential benefits will outweigh the costs and make SNP-array

a very attractive technology for improving ART.

As the previously mentioned technologies are currently limited for PGS, an older

but slightly modified approach to induced metaphase FISH may be beneficial. Previous

studies by Verlinsky and Evsikov [190, 201] demonstrated the fusion of a mouse zygote

with a blastomere from a cleavage stage human embryo could drive the chromatin in

the blastomere into mitosis making it possible to do 24 chromosome analysis. Similarly,

Willadsen and coworkers [191] demonstrated a bovine metaphase II oocyte could be

fused to a blastomere from cleavage stage human embryo to induce condensation of

chromosomes suitable for karyotyping in 74% of blastomeres. This conversion rate is

much greater than the 30% reported after overnight culture with cytoskeletal inhibitors,

such as colcemid [202]. However, the improved rate of obtaining metaphase-like

chromosomes is not high enough to warrant clinical application for PGS. One possible









way to potentially increase this rate may be with the incubation of potent protein

phosphatase (PP) inhibitors, such as calyculin-A or okadaic acid, which have been

shown to rapidly induce premature chromatin condensation (PCC) in cell lines suitable

for cytogenetic analysis [20]. Protocols for PP inhibitors are well established for cell

lines and should require little modification for application to blastomeres. If PP inhibitors

can be used to obtain high conversion rates of metaphase-like chromosomes suitable

for karyotyping, then this technology could replace interphase FISH for PGS or at least

until other approaches come to fruition.

Premature Chromosome Condensation

Visualization of chromosomes only occurs during the brief mitotic or meiotic

stage of the cell cycle. Through the intermiotic (or interphase) period, which can range

up to 40 hrs for cultured animal cells, chromosomes remain diffuse and

indistinguishable from the nucleus. This long period makes studying chromosomes

difficult as few cells at any given time will contain visible condensed chromatin.

Overtime, researchers have developed methods to trap or induce chromatin

condensation within cells opening the way for more detailed studies of chromosomal

rearrangements and aneuploidies. This review will focus on the use of premature

chromosome condensation (PCC) for assessment of chromosomal abnormalities.

Premature condensation of chromatin was first described in the 1960's by

several groups that fused cells at different stages of the cell cycle [203-205]. Based on

similar observations, Rao and Johnson [206] suggested that advanced entry of a non-

mitotic cell into mitosis (M-phase) might have been caused by fusion with a mitotic cell

containing some factors that induce chromatin condensation. These observations led

them to perform additional experiments in which mitotic cells blocked with colcemid









were fused with cells synchronized to G1, S, or G2 phase of the cell cycle [207]. Fusion

of M-phase and interphase cells resulted in rapid chromosome condensation within 30

minutes. This induction of condensed chromatin from an interphase cell was termed

premature chromosome condensation [207]. From their experiments with fused

synchronized cells, they were able to determine that cells from the G1, S, or G2 phase,

when induced into PCC, resulted in distinct patterns of condensed chromatin.

Prematurely condensed chromosomes (PCCs) from G1 cells consist of single

chromatids indicating the unreplicated state of the genome. Several studies have further

analyzed changes in the morphology of PCCs at different points in the G1 phase [208,

209]. These studies revealed a progressive decondensation of chromatin as cells

progressed toward the DNA synthetic period. The PCCs of a cell at the beginning of the

G- phase are relatively short and well condensed. In comparison, the PCCs from later in

G1 are much longer and more attenuated.

Induction of PCC in an S phase cell results in uneven condensation of chromatin.

As chromosomes replicate at different rates, the PCCs of an S phase cell can contain a

mixture of single chromatids, double chromatids, or finely "pulverized" chromatin,

depending on replication. Whereas single chromatids represent chromosomes still

within G1 that have not begun replication, double chromatids represent chromosomes

that have completed replication. PCC of chromosomes in the process of replication

appear as pulverized pieces of chromatin. These observations can be explained by the

molecular model for DNA synthesis that indicates bi-directional replication occurring at

multiple sites across the chromosome. As such, each piece of pulverized chromatin

represents a region that was undergoing replication.









PCCs from cells in G2 phase resemble mitotic chromosomes during prophase.

The G2 PCCs consists of two chromatids that are usually attached to each other, but are

slightly longer than prophase chromatids. The extended nature of G2 PCCs likely

represents the conformational state of chromatin at that point in the cell cycle.

Although chromosomes induced by PCC have some resemblance to M-phase

chromosomes, there are differences. The major difference between PCCs and M-phase

chromosomes is the degree of condensation. PCCs from G1 and G2 nuclei are not as

condensed as M-phase chromosomes. As such, G banding or C banding G1 and G2

PCCs are less intensely stained than metaphase chromosomes. In addition, some G2

PCCs appear to have extra bands, which only become visually separated in the

elongated G2 PCCs [210].

Over the last couple of decades, the mechanism responsible for chromosome

condensation has become clearer with the understanding of factors regulating the onset

of mitosis. Central to the initiation of both mitosis and meiosis is maturation-promoting

factor (MPF; also referred to as mitosis-promoting factor or M-Phase-promoting factor).

MPF is a heterodimeric protein composed of cyclin-dependent kinase p34cdc2 and

cyclins A and B [211]. Kinase p34cdc2 is present in growing cells throughout the cell

cycle, but is only activated when bound by cyclin B at G2/M-phase [212]. In addition, the

activation of kinase p34cdc2 requires phosphorylation of threonine 161. The kinase

activity is directed towards serine and threonine residues in histones [213]. Conversely,

in interphase, kinase p34cdc2 is phosphorylated on threonine and tyrosine residues

resulting in inhibition of kinase activity. At the G2/M transition, these residues are









dephosphorylated allowing kinase activity to appear, resulting in entry into M-phase

[211].

Insight into the mechanism regulating the onset of mitosis has been applied to

developing new methods for inducing PCC. Investigations of several chemical

compounds, including the protein phosphatase (PP) inhibitors okadaic acid, fostriecin,

and calyculin-A, have shown their ability to rapidly induce PCC [214, 215]. While the

exact mechanism is unknown, these chemical compounds are believed to facilitate PCC

through activation of kinase p34cdc2 and inhibition of histone PP [216]. Interestingly, the

inhibitory effects are not the same for all PP inhibitors. Whereas okadaic acid, fostriecin,

and calyculin-A are all strong inhibitors of PP type 2A (PP2A), okadaic acid and

fostriecin are weak inhibitors of PP type 1 (PP1). In contrast, calyculin-A is a strong

inhibitor of both PP1 and PP2 and therefore, has been suggested to be a more potent

inducer of PCC.

Chemical approaches with PP inhibitors offer several advantages over traditional

cytogenetic methods of colcemid block or PCC by cell fusion. Compared to cell fusion

methods which are difficult and laborious, chemical methods can be applied directly to

cultured cells and induce PCC within a few hours. In addition, PP inhibitors result in

much higher rates of PCCs (>20%) compared to traditional M-phase from colcemid

block treatments (usually 1-2%) [217]. A number of reports have successfully shown

these chemical compounds to rapidly induce PCC suitable for studying chromosomal

aberrations [214, 218-221].

One area in particular where PP inhibitors may prove beneficial is for inducing

condensed chromosomes suitable for preimplantation genetic screening for numerical









or structural chromosomal abnormalities. The traditional method for PGS uses

interphase FISH, which is limited to analysis of 5-6 chromosomes per hybridization and

a maximum of 9-12 total chromosomes, therefore making it impossible to perform 24

chromosome analysis. In addition, detailed analysis of chromosome breakpoints is not

possible with nuclear chromatin found in interphase cells prohibiting distinction of

normal and balanced translocations. In an effort to overcome these limitations of

interphase FISH, Evsikov and Verlinsky [201] treated blastomeres from human

cleavage stage embryos with okadaic acid; however, blastomere incubation in the

presence of okadaic acid resulted in only a 22% conversion rate of condensed

chromosomes. In most cases, okadaic treatment had no effect on the interphase

nucleus. These results were too low for use in PGS. More potent PP inhibitors, such as

calyculin-A, may prove to be more effective and therefore more research is needed to

determine the efficacy of calyculin-A for inducing PCC of blastomeres because this

treatment may become a suitable alternative to the current methods of PGS using

interphase FISH.








miRNA
Gene XWAWMAV
I,


Pri-miRNA


Nucleus


Pre-miRNA


Cytoplasm


-n mM=
N -11111111111


Ribosome


Target
mRNA


Translational repression


SRISC



mRNAcleavage
m RNA cleavage


Figure 2-1. Biogenesis and functionality of miRNAs.









CHAPTER 3
COMPARATIVE EFFECTS OF GNRH AGONIST AND ANTAGONIST ON MIRNA AND
GENE EXPRESSION PATTERN OF HUMAN GRANULOSA CELLS

Introduction

Gonadotropin-releasing hormone (GnRH) agonists (a) and antagonists (ant) are

used in controlled ovarian hyperstimulation (COH) to suppress premature luteinizing

hormone surge in patients undergoing in vitro fertilization (IVF). GnRHa acting through

GnRH receptor (GnRHR) induces a brief flare of gonadotropins from the pituitary while

prolonged administration of a high dose of GnRHa results in suppression of

gonadotropins through internalization of available GnRHRs [222]. In contrast, binding of

GnRHant to GnRHRs induces an immediate competitive inhibition of GnRHR resulting

in a rapid suppression of gonadotropins [223]. Although controversies exist with regard

to differences in IVF outcomes, GnRHant use provides some advantages over GnRHa

such as lower gonadotropin dose requirements, shorter duration of stimulation [37],

absence of flare-induced effects and decreased risk of ovarian hyperstimulation

syndrome (OHSS) [40, 41, 47, 224].

Several studies have demonstrated changes in follicular fluid (FF) concentrations

of steroids [51, 52] vascular endothelial growth factor (VEGF)[53] and insulin-like growth

factor-1 (IGF-I)[52] to account for differences between the action of GnRH analogs.

Although a molecular mechanism to explain the differences in the production of these

factors is unknown, GnRH analogs have been considered to directly act and

differentially regulate their expression through ovarian receptor mediated mechanisms.

As such, the expression of GnRH and GnRHRs have been documented in several

extrapituitary tissues, including the ovary [54], supporting GnRH local ovarian function.

Experiments using cultured granulosa cells have shown GnRH analogs to modulate









steroidogenesis [61] with GnRHant suppression of aromatase expression, the key

enzyme responsible for E2 biosynthesis [62]. Taken together, these observations imply

that GnRH analogs can directly act on ovarian cells; however, the extent to which these

analogs affect ovarian function remains to be elucidated.

MicroRNAs (miRNAs) are members of a family of small non-protein coding RNAs

that function as key regulators of gene expression. Several thousand miRNAs have

been identified and/or predicted and are estimated to target the expression of 30% of

genes in humans at post-transcriptional/translational levels [225, 226]. Functionally,

miRNAs play a central role in various cellular activities, including developmental

processes, cell growth, differentiation, apoptosis, cell-cell communication, and

inflammatory and immune responses [92-96]. Aberrant expression of specific miRNAs

has been associated with developmental abnormalities, disorders of inflammatory and

immune response, infection and tumorigenesis. Furthermore, conditional inactivation of

Dicer, a poll II enzyme necessary for miRNA processing, has been shown to impact

ovarian, oviductal and uterine development through altered expression of many miRNAs

causing female sterility [106, 227, 228]. Additional studies have also implicated the

importance of Dicer and regulatory function of miRNAs in overall gene expression

necessary for early embryonic development [99].

Recently, the expression profile of many miRNAs have been reported in the

pituitary [78], ovary [79, 80], testis [229], uterus [83], and embryo [230] suggesting

miRNAs may play a role in reproductive function. With regards to ovarian miRNAs, a

few reports have demonstrated granulosa cells differentially express miRNAs in

response to hormone treatment, including hCG/LH [107] and FSH [108]. In addition,









another report found the expression of miRNAs to differentially affect the release of

ovarian steroids P4, T, and E2 [110]. Studies like these imply hormonal stimulation may

regulate the expression of miRNAs which in turn may affect the expression of several

genes important for follicular development, including the final maturation of oocytes,

luteal formation, and steroid synthesis.

To further our understanding of hormonal regulation of miRNAs, the present

study assessed the expression of a select number of miRNAs in granulosa cells from

IVF patients receiving GnRHa and GnRHant protocols. In addition, using an

immortalized human granulosa cell line we examined the direct action of GnRHa and

GnRHant on the expression of these miRNAs and a number of their predicted target

genes. We hypothesize that GnRHa and GnRHant differentially regulate the expression

of ovarian miRNAs which may affect the expression of their predicted target genes to

influence ovarian function.

Materials and Methods

This study utilized human granulosa cells (hGC) from clinical IVF patients as well

as an immortalized human granulosa cell line (IhGC). The collection and use of hGC

was approved by the University of Florida institutional review board. All patients

involved in the study signed informed consent for collection and use of hGC to study

gene regulation.

Experiments

Six women, aged between 26 and 35, underwent COH with either a GnRHa

(standard 'long-leuprolide acetate' suppression; n=3) or GnRHant (ganirelix acetate

flexible protocol; n=3) protocol for IVF cycles with indications of male factor, tubal factor

or oocyte donation. All patients were pre-treated with combined birth control pills. None









of the patients were poor responders and all IVF patients and all anonymous oocyte

recipients from these cycles ended up with ongoing pregnancies. Hormonal profiles

were comparable in patients treated with GnRHa or GnRHant protocols. Follicles were

aspirated 35 hours after hCG administration for final oocyte maturation. After recovery

of oocytes in the IVF laboratory, the remaining FF from each patient was collected and

processed through repeated centrifugation at 400g and washing with phosphate

buffered saline (PBS) to isolate hGC. The cell pellets containing granulosa cells were

kept at -800C until utilization for RNA extraction.

Cell culture experiments were performed using a well characterized human

granulosa cell line previously immortalized with SV40 large T antigen and was reported

to express functional GnRHR [231]. These cells were kindly provided by Dr. Leung from

the University of British Columbia. Cells were cultured in DMEM:F12 (1:1, Invitrogen,

Carlsbad, CA), 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) antibiotic at 37C in a

humidified atmosphere of 5% CO2 in air. Culture medium was changed every 48 hours.

Once cells reached 70% confluence, they were washed once with medium and then

serum starved for 24 hours before initiating GnRH analog treatment. Cells were treated

with either 0.1 pM GnRH agonist (leuprolide acetate, Sigma-Aldrich Corp., St. Louis,

MO), 0.1 pM GnRH antagonist (cetrorelix acetate, Cetrotide; Serono, Geneva,

Switzerland), or vehicle control for 24 hours. Each treatment was performed in triplicate.

RNA Extraction, cDNA Synthesis and Real-Time PCR

Total RNA was isolated from granulosa cells using TRIzol reagent (Invitrogen) and

then quantified using a NanoDrop 1000 spectrophotometer (Thermo Scientific,

Wilmington, DE). All the reagents for cDNA synthesis and real-time PCR, including

primers and probes were purchased from Applied Biosystems (Foster City, CA).









Complimentary DNA was synthesized by reverse transcription from 2 pg of total RNA

using random primers for mRNA and specific stem-loop primers for miRNA (Table 3-1).

Real-time PCR was carried out as previously described [232] at 95C for 10 minutes,

95C for 15 seconds, and 60 oC for one minute for 40 cycles using an Applied

Biosystems 7300 Sequence Detection System. MicroRNA and mRNA expression

values were analyzed using the comparative CT (critical threshold) method following

transformation and normalization to RUB6 andl8S rRNA expression, respectively, with

threshold cycle set within the exponential phase of the PCR. Final results were reported

as relative expression by setting the expression values of miRNAs and mRNAs at 1 in

one of the samples and the expression value of other samples were calculated relative

to this control.

Statistical Analysis

All data were analyzed using software SPSS statistics 17.0 (SPSS Inc., Chicago, IL).

Means for hGC treatments were compared using two-tailed student t test. Means for

IhGC were analyzed using analysis of variance with post hoc Tukey's test for multiple

comparisons. Results for all comparisons are presented as means standard error of

the mean (SEM). In addition, correlations between each mRNA and miRNA were

analyzed using Pearson's correlations coefficient. Data were considered significantly

different if P < .05.

Results

The Expression of miRNAs and Their Predicted Target Genes in Granulosa Cells

The regulation by gonadotropins and local actions of aromatase (CYP19A1),

amphiregulin (AREG), GATA4, pregnancy associated plasma protein-A (PAPPA) and

transforming growth factor (TGF)-3 system, including TGF31, TGF3-RII, bone









morphogenetic protein 2 (BMP2) and Smads, have been associated with various

ovarian cellular activities, including oogenesis, granulosa and thecal cell growth and

differentiation and steroid biosynthesis. Using real-time PCR, we assessed the

expression of these genes and miRNAs that are predicted to target their expression,

including miR-16, miR-17, miR-23a, miR-23b, miR-26, miR-34a, miR-98, miR-133b,

miR-138, miR-145, miR-195, miR-424, miR-496, miR-497, and miR-512-3p (Table 3-1),

in hGC from patients undergoing COH with either GnRHa and GnRHant protocol. In

addition, the direct action of GnRHa and GnRHant on the expression of these genes

and miRNAs was determined in vitro using IhGC. Both hGC and IhGC expressed higher

levels of miR-16 as compared to the other miRNAs assayed and undetectable levels of

miR-512-3p and low levels of miR-138 (Figure 3-1). Similar analysis indicated higher

overall expression of PAPPA and TGF31 and lower overall expression of CYP19A1,

PAPPA2 and BMP2 in both cell types (data not shown). The level of expression of the

other genes varied with the exception of AREG, which was the highest expressed gene

in hGC and only moderately expressed in IhGC.

GnRHa and GnRHant Protocols Instigate Differential Effects on hGC miRNA
Expression

Comparative analysis revealed that hGC obtained from patients that underwent

COH with GnRHant express higher levels of miR-26a, miR-34a, miR-98, mir-133b, miR-

195, and miR-497 than in cells obtained from women treated with the GnRHa protocol

(P < .05) (Figure 3-2). In addition, there was a trend toward higher expression of miR-

17-5p, miR-23a, miR-23b, and miR-497 in hGC from patients treated with GnRHant

protocol compared to those treated with GnRHa protocol. No significant differences

were observed in relative expressions of mRNAs predicted as targets of these miRNAs









in hGC from both GnRHa and GnRHant treated cohorts, although AREG, BMP2,

SMAD3, TGF31, and TGF-3RII were expressed at lower levels in hGC obtained from

patients receiving GnRHant protocol. In addition, there were no significant inverse

correlations between the relative expressions of miRNA and predicted target genes. A

positive correlation was determined between the expression of miR-195 and miR-497,

and PAPPA in hGC (P < .05).

Direct Effects of GnRH Analogs on miRNA and Gene Expression

Using a well established immortalized human granulosa cell line (IhGC) we

assessed the direct action of GnRH analogs on the expression of miRNAs and

predicted target genes. Treatment of IhGC with GnRHant moderately increased the

relative level of expression of a number of miRNAs as compared with GnRHa and

untreated controls although the comparisons were not statistically significant (Figure 3-

3). Similar analysis of predicted target mRNAs indicated significantly lower expression

of AREG and CYP19A1 and higher expression of GATA4 in GnRHa treated cells as

compared with cells treated with GnRHant or vehicle control (P < .05). Meanwhile, the

expression patterns of BMP2, SMAD3, TGF31, TGF3-RII, PAPPA and PAPPA2 were

not significantly different between treatments or controls. No significant correlations

were determined from miRNA and predicted target genes in IhGC.

Discussion

In the present study, we selected and analyzed the expression and regulation of

a number of miRNAs and their predicted target genes by GnRHa and GnRHant in hGC

obtained from IVF patients as well as in IhGC. We found that both hGC and IhGC

express miR-16, miR-17, miR-23a, miR-23b, miR-26, miR-34a, miR-98, mir-133b, miR-

145, miR-195, miR-424, miR-496, and miR-497 at varying levels. These miRNAs are









predicted to target many genes, including CYP19A1, AREG, GATA4, PAPPAs, TGF31

and TGF3-RII, BMP-2 and Smads. Gonadotropins, through a receptor-mediated action,

regulate the expression of these and many other locally expressed genes. The products

of these genes modulate various ovarian cellular activities, including oogenesis,

granulosa and thecal cell growth and differentiation and steroidogenesis, and alteration

in their expression has been associated with disruption in follicular development

negatively impacting oocyte maturation and subsequent embryo development.

Accumulated evidence supports a central role for miRNAs in gene expression

stability by acting through mainly translational repression or mRNA degradation [90,

233, 234]. Among the 10 miRNAs analyzed, miR-16 was the most abundant, while miR-

512-3p and miR-138 were either not expressed or expressed at very low levels in both

hGC and IhGC, without any difference in their expression as a result of GnRH analog

treatments. In contrast, miR-26a, miR-34a, miR-98, miR-133b, miR-195, and miR-497

were expressed at significantly higher levels in hGC from patients receiving GnRHant

compared to GnRHa. These results suggest that granulosa cells express varying levels

of miRNAs, and GnRH analogs may differentially affect their expression, although in

IhGC these effects were limited and not significantly different from untreated controls.

Whereas it remains unclear whether the observed differences in miRNAs and mRNAs

expression in hGC is due to direct action of GnRH analogs, a recent in vitro study has

demonstrated that GnRH analogs have differential direct effects on AMH, aromatase,

SF-1 and LRH-1 expression in human primary granulosa cells in culture and in HGL5

granulosa cell line [62].









We also selected and confirmed the expression of CYP19A1, AREG, BMP2,

SMAD3, TGF31, TGF32R, GATA4, PAPPA and PAPPA2 which are among the

predicted targets of the tested miRNAs expressed in hGC and IhGC. Although, co-

expression of these miRNAs and their target genes imply a possible regulatory

interaction, we found no inverse correlations between their relative expressions;

however, there was a positive correlation between the expression of miR-195 and miR-

497, and PAPPA in hGC. Since miRNAs regulatory action on gene expression may

occur mainly at translational rather than transcriptional level, further studies are required

to confirm these observations. In addition, lack of correlations between the expression

of miRNAs and their target genes was not surprising since computational algorithms

rather than experimental validation was used for selecting these predicted target genes.

As such, the seed sequence of these miRNAs can potentially target many other genes

not tested in the current study.

Of the selected genes analyzed in this study, the expression of amphiregulin

(AREG) mRNA was differential affected in response to GnRH analog treatment in

cultured cells. AREG is a member of the epidermal-like growth factor (EGF-like) family,

which has been shown using both in vitro as well as animal systems to play a central

role in steroidogenesis, cumulus cell expansion and oocyte maturation, probably as

mediators of LH action in the ovulatory follicle [235-237]. EGF-like ligands have been

shown to accumulate in FF obtained from IVF patients, with concentrations of

amphiregulin up to 3,000 times greater than that in the serum [238]. The source of FF

AREG is most likely from granulosa cells in which AREG mRNA expression increases in

response to LH surge [236]. In the present study, we observed differential expression of









AREG in IhGC with GnRH analog treatment showing suppressed expression in GnRHa

treated cells. This finding suggests that GnRH can likely modulate AREG expression in

granulosa cells as well. Whether regulation of AREG expression by GnRH is mediated

through LH/hCG receptor cross-talk is unknown; however, GnRH has also been shown

to induce cyclooxygenase-2 expression in rat granulosa cells similar to LH [239] and

granulosa cell AREG mRNA expression increases in response to PGE2 [240] indicating

multiple mechanisms may regulate AREG. The molecular pathways of granulosa cell

expression of AREG are beyond the scope of the current study, however, our

observations warrant future investigations into possible role of GnRH and its analogs in

expression of AREG.

In the immortalized granulosa cell line used in this study, we could not replicate

some of the findings reported by Winkler and coworkers [62] using cultured human

granulosa-lutein cells and a HGL5 granulosa-lutein cell line. We observed a significant

suppression of CYP19A1 mRNA expression by GnRHa treatment while GnRHant

treatment did not show any significant effects. On the contrary, in HGL5 cell line,

Winkler and coworkers reported suppression of both basal and cAMP stimulated mRNA

expression of CYP19A1, the gonadal promoter of aromatase [62]. We used the same

GnRH antagonist, cetrorelix, at an intermediate dose of 0.1 pM rather than the doses of

1 nM or 1 pM. We consider this finding as another supporting evidence that the effects

of GnRH agonists and antagonists can differ in different cell lines, in different cell types

and in different culture conditions [241]. Furthermore, we noted that GnRHa increased

expression of GATA4 mRNA expression, a transcription factor interacting with the

promoter regions of many genes including AMH, steroidogenic factor (SF)-1, CYP19A1









and many other enzymes and factors involved in steroidogenesis and reproductive

system development and function [242, 243]. Hence, while GnRHa suppressed mRNA

expression of CYP19A1, it induced GATA-4 mRNA expression, which is a known

positive regulator of CYP19A1 expression. The observed diversity in GnRH analog

effects in different cell types have been thought to be related to treatment conditions

(dose and duration), different Ga subtypes or other G protein subunit components,

GnRHR expression level, ligand specificity, GnRHR splice variants, intrinsic cellular

properties and lastly cross-talk between different receptor systems [243, 244]. As such

our findings with different action of GnRHa and GnRHant on miRNAs and mRNAs

expression in granulosa cells may involve one or all the above pathways whose identity

requires detailed investigation [245].

The results of our study in human granulosa cells suggest that GnRH analogs

differentially regulate the expression of miRNAs and some of their target genes involved

with steroidogenesis and follicle development. Because miRNAs are estimated to

regulate the expression of over 30% of genes [246], any change in ovarian cellular

expression of a given miRNA could have a profound effect on the expression of many

genes, including specific genes whose products are known to influence granulosa cell

function. However, detailed investigation is required to identify the specific genes

targeted by these miRNAs allowing association of miRNAs biological function in human

granulosa cells. In addition, further studies using different GnRH antagonist

preparations is warranted in order to identify their specific and common miRNA and

genes targets and mechanism that regulate their expression.









Table 3-1. Predicted miRNA gene targets.


MiRNA


Mature sequence


hsa-miR-17

hsa-miR-23a
hsa-miR-23b
hsa-miR-26a
hsa-miR-34a


hsa-miR-98


hsa-miR-133b
hsa-miR-138

hsa-miR-145

hsa-miR-496
hsa-miR-512-3p
hsa-miR-16
hsa-miR-424
hsa-miR-195
hsa-miR-497
Notes: Prediction


caaagugcuuacagugcagguag

aucacauugccagggauuucc
aucacauugccagggauuacc
uucaaguaauccaggauaggcu

uggcagugucuuagcugguugu


ugagguaguaaguuguauuguu


uuugguccccuucaaccagcua

agcugguguugugaaucaggccg

guccaguuuucccaggaaucccu

ugaguauuacauggccaaucuc
aagugcugucauagcugagguc
uagcagcacguaaauauuggcg
cagcagcaauucauguuuugaa
uagcagcacagaaauauuggc
cagcagcacacugugguuugu


Predicted gene targets
TGFBR2, BMPR2, MMP2, ADAM9,
MMP24, IGF2BP1, EREG, SMAD6,
FGF4, BMP2, VEGFA
TGFBR2, FGF2, CASP7, TGFA, PGR,
PTGFR, SMAD5
PTEN, SMAD1, INHBB, IGF1, GATA4
BMP3, FGF23, AREG, CASP2, PDCD4,
SMAD4, INHBB,
IGF2BP1, TGFBR1, IGF1R, GDF6,
IGF2BP3, CASP3, IGF2BP2, FGF11,
GHR, INSR, IGF1, SMAD2, MMP11,
CYP19A1
FGF1, EGFR, MMP14, MMP15, INSR,
TGFBR1, IGF1R, TGFB1
CASP3, PAPPA, IGF2BP2, AMH
PTGFR, SMAD3, SMAD5, FGF5, ACTB,
TGFBR2, SMAD4, BMP3, ESR1, IGF1R,
INHBB, SP1, CASP10
PAPPA, MMP10, TGFBR2
SMAD2, FGF7, ESR1, PAPPA2
PAPPA, FGF7, FGFR1, SMAD3, SMAD5,
SMAD7, VEGFA, GHR, TGFbR3, IGF2R,
IGF1R, GATA4


of miRNA targets based on TargetScanHuman version 5.1. High-lighted


bases in mature sequence indicate seed region. Not all predicted targets shown for each
miRNA.











1000000
hGC

100000


10000

1000


100

10




.p A c -.
449~/ (6 ~ 4?4 ~.6 t~
44~


IhGC


10000


1000


100


10


Figure 3-1. Overall expression patterns of miRNA in (A) hGC and (B) IhGC. The y-axis
in each graph represents the average expression for each miRNA relative to
a calibrator. Mir-133b was chosen as the calibrator for hGC and IhGC
following normalization with RU6B.









U GnRH Agonist


b

j1


mi-25a mlr-23b TGFbR2






ii.
mir-145 Smad3 TFbRG


M GnRH Antagonist


h




i


AREAS


b




ji-i~


mir496 TGFhLb PAPPA


.L, 7sp TGFbR2


Figure 3-2. Comparative analysis of the relative expression of miRNA and predicted mRNA in hGC. Granulosa cells were
recovered from women undergoing COH with either GnRH agonist or GnRH antagonist protocols. The y-axis of
each graph represents the expression of miRNAs and predicted targets relative to a selected calibrator. The
calibrator for each miRNA and mRNA was chosen based on the sample with the highest ACT following
normalization to RU6B and 18S, respectively. Differing letters within miRNA or mRNA indicate significance (P <
.05).


TFbl1


GATMa


mir.1R


mirua


cvrlsal


2-
r-


lrG16 m1195 mlr424 mir-497 Smada GATA4 PAPPA













* GnRH Agonist


35


2





mr-23a mir23b TGFb2R












5T T
mlr-145 Smad3 TGFbZR


* GnRH Antagonist


4-


T b 2 5
2 -




mir-26a GATA4



b 4-








mir-34a AREG


Control


mir-98 CYPISA1


mir-133b


TGFbl


mir-496 TGFb2R PAPPA


mir-17-5p TGFb2R


a b

1111 19


mir-16 mir-195 mir-424 mir497 Smad3 GATA4 PAPPA


Figure 3-3. Comparative analysis of the relative expression of miRNA and mRNA targets in IhGC. Granulosa cell line was
treated with either 0.1 pM GnRH agonist, 0.1 pM GnRH antagonist, or vehicle control. The y-axis of each graph
represents the expression of miRNAs and predicted targets relative to a selected calibrator. The calibrator for
each miRNA and mRNA was chosen based on the sample with the highest ACT following normalization to
RU6B and 18S, respectively. Differing letters within miRNA or mRNA indicate significance (P < .05).


3
2 ^|









CHAPTER 4
SUPPLEMENTATION OF FREEZE AND THAW SOLUTIONS WITH A GLOBULIN-
RICH PROTEIN SOURCE IMPROVES POST-THAW SURVIVAL AND IMPLANTATION
OF CONTROL-RATE CRYOPRESERVED BLASTOCYSTS

Introduction

For more than two decades, the inclusion of globulin-rich protein sources in

culture medium has been suggested to benefit in-vitro development of embryos. Initial

studies investigating plasma volume extenders containing a mixture of serum albumin

and globulins intended for intravenous use, demonstrated high continuing pregnancy

rates if included in embryo culture medium [5, 116]. Furthermore, these studies

attributed the success largely to the high fractions of a- and (3-globulins. Results from

those early studies led to the development of commercial preparations of globulin-rich

protein supplements, such as Synthetic Serum Substitute (SSS; now manufactured

under name Serum Substitute Supplement, Irvine Scientific)[1 17] and Serum Protein

Substitute (SPS; SAGE In Vitro Fertilization). These serum substitutes are now

formulated to provide a more suitable pH range as well as appropriate osmolarity for

inclusion in embryo culture media. Numerous human and animal studies have

demonstrated that these commercially available protein supplements promote

blastocyst hatching [118, 122, 247] and implantation [119, 120, 248]. While a

mechanism for the interactions of globulins with embryos remains to be established,

Pool and Martin [5] suggested that the polyhydroxy nature of globulins may influence

their physiochemical interactions with water molecules within the culture environment.

These interactions may enhance developing embryo viability through physical

mechanisms involving altered water dynamics. As such, these interactions may also









benefit embryo cryopreservation, where osmoregulation of the embryo is essential for

post-thaw re-expansion and survival.

Modern trends seeking to limit the number of freshly transferred embryos along

with general improvements in culture conditions often result in embryos remaining

untransferred so as to place emphasis on successful blastocyst cryopreservation.

Previous attempts to improve blastocyst cryopreservation have focused on various

components, such as type of cryoprotectant [249, 250], altering start temperatures and

rate of slow-freezing [153], utilization of straws verse cryo-vials [251], inclusion of

various macromolecules [156] and more recently vitrification [3]. One of the earlier

reports demonstrating high pregnancy rates from frozen-thawed blastocysts was

accomplished with freeze and thaw solutions supplemented with a globulin-rich protein

source [2], suggesting globulins may promote post-thaw blastocyst survival.

Surprisingly, no studies have evaluated the effects of globulins on blastocyst

cryopreservation.

In the present study, supplementation of freeze and/or thaw solutions with SSS

compared to HSA alone was assessed for control-rate cryopreservation of murine

blastocysts in an effort to determine if globulin-rich protein sources offer advantages

during cryopreservation. We hypothesize that freeze and thaw solutions supplemented

with a globulin-rich protein, such as SSS, will improve thaw-survival, as measured by

blastocyst re-expansion and total cell number. In addition, we retrospectively examined

human blastocysts thawed and cultured in solutions supplemented with SSS compared

to HSA alone to determine if globulin-rich protein supplementation benefited clinical

frozen embryo transfer (FET) outcomes.









Materials and Methods

Freezing and Thawing of Blastocysts

Freeze and thaw procedures followed a modified version of Menezo's protocols

[143, 252] using kits of commercially available solutions (G-FreezeKit Blast and G-

ThawKit Blast; Vitrolife, Englewood, CO). Each freeze and thaw solution was

supplemented with protein in the form of HSA (10 mg/ml albumin; Vitrolife) or SSS (10

mg/ml albumin + 2 mg/ml globulins; Irvine Scientific,Santa Ana, CA) according to the

experimental design. Unless noted, all procedures were carried out at 37C. For

freezing, blastocysts were exposed for 5 minutes to a MOPS buffered incubation

medium containing no cryoprotectant or sucrose. They were then transferred into a

solution of 5% glycerol + 0.1 M sucrose for 10 minutes, and then to a solution of 10%

glycerol + 0.2 M sucrose for 7 minutes. Blastocysts were loaded into CBS high security

straws (Cryo Bio Systems, IMV corp, New York, NY), sealed and transferred into a

programmable rate controlled freezer (Cryologic, Victoria, AU). The freezing program

initially cooled from 180C to -7C at a rate of -2C/minute. Ice crystallization seeding

was performed manually by touching the straw with pre-cooled forceps. The

temperature was held for 15 minutes and then further cooled at a rate of -0.3C/minute

to -38C. Straws were then plunged directly into LN2 (-1960C) for storage. For thawing,

straws were removed from LN2, held in air at room temperature for 1 minute, and

immersed into a water bath for 30 seconds at 37C. Straws were wiped to remove

excess water and then cut to expel the contents into a petri dish containing 10%

glycerol + 0.2 M sucrose. Once located, the blastocysts were transferred into a solution

of 5% glycerol + 0.1 M sucrose for 5 minutes, then into a solution of 0.1 M sucrose for 5

minutes, and then held in MOPS buffered incubation medium for 5 minutes.









Animal Experimental Design

Frozen two-cell murine embryos (Embryotech, Haverhill, MA) were thawed and

cultured in Glv5 PLUS (Vitrolife) containing 5 mg/ml HSA for 72 hours. Only resulting

expanded blastocysts, containing a discernable inner cell mass and a well defined layer

of trophoblast cells were cryopreserved. Blastocysts remained in liquid nitrogen storage

for at least 24 hours but less than 1 week. Following thaw, blastocysts were cultured for

24 hours and then assessed for thaw-survival. Blastocysts exhibiting greater than 50%

blastocoele re-expansion were considered to survive.

Experiment 1: Effects of SSS Supplementation of Freeze and Thaw Solutions on
Post-Thaw Murine Blastocyst Re-Expansion

Murine blastocysts were randomly distributed to one of four treatments: frozen

and thawed in cryopreservation solutions supplemented with HSA (group I), frozen in

solutions supplemented with HSA and thawed in solutions supplemented with SSS

(group II), frozen in solutions supplemented with SSS and thawed in solutions

supplemented with HSA (group III), and frozen and thawed in solutions supplemented

with SSS (group IV). Following thaw, each treatment was cultured for 24 hours in G2v5

PLUS (Vitrolife) containing HSA (5 mg/ml).

Experiment 2: Effects of post-thaw culture medium with SSS on re-expansion of
murine blastocyst frozen-thawed with different protein supplements

Murine blastocysts were randomly distributed to one of four treatments as

described in experiment 1. Following thaw, each treatment was cultured for 24 hours in

G2v5 supplemented with SSS (5 mg/ml albumin + 1 mg/ml globulins).









Experiment 3: Effects of protein supplementation in freeze-thaw and post-thaw
culture solutions on murine blastocyst re-expansion and total cell number

Murine blastocysts were randomly distributed to freeze-thaw solutions

supplemented with HSA followed by 24 hours culture in G2v5 PLUS containing HSA (5

mg/ml) (group I) or freeze and thaw in solutions supplemented with SSS followed by 24

hours culture in G2v5 supplemented with SSS (5 mg/ml albumin + 1 mg/ml globulins)

(group II). Total cell numbers were calculated from all blastocysts that re-expanded

using a simple fixation and staining procedure. Briefly, individual blastocysts were

exposed for 2 minutes in hypotonic solution [1.0% sodium citrate (Sigma-Aldrich, St.

Louis, MO) + 3 mg/ml BSA (Sigma-Aldrich)], then transferred into a softening solution

[0.01 N HCI (Sigma-Aldrich) + 1% Tween 20 (Sigma-Aldrich)] for 10 seconds and

loaded onto a slide containing 10 pl softening solution. As soon as the softening solution

evaporated, one drop of fixative solution (methanol:acetic acid; 3:1) was added to fixate

nuclei to the slide. The central location on the slide containing the nuclei was encircled

with a carbide pen. Coverslips were mounted with 10 pl of vectashield mounting

medium with 4',6-diamidino-2-phenylindole (DAPI)(Vector Laboratories, Burlingame,

CA) applied to the slide area containing nuclei. The total number of nuclei

corresponding with each blastocyst were counted using a Nikon Eclipse E600 (Nikon,

Melville, NY) epifluorescent microscope equipped with a 60X dry objective.

Human Retrospective Analysis

A retrospective study was conducted that included 28 patient couples that

initiated FET cycles from January 2006 to March 2009 at Shands hospital at the

University of Florida, Gainesville, Florida. Only patients who had frozen blastocysts

thawed for the purpose of FET were included. No other exclusion criteria were used. All









women were pre-treated by combined oral contraceptive pills followed by down-

regulation with daily leuprolide acetate. Following hormonal suppression, confirmed by

estradiol concentrations <40 pg/ml and transvaginal ultrasound assessment of ovaries

and the endometrial stripe, patients were placed on transdermal estradiol with

increasing incremental doses to develop endometrium. Once the endometrial thickness

reached 7 mm, progesterone in oil was injected IM to synchronize endometrium for

embryo transfer. On day 5 of progesterone administration, blastocysts, originally frozen

on developmental day 5 or 6 with at least a grade of 3BB or better using Gardner's

scoring system [253], were thawed. One to two blastocysts were transferred to each

patient on day 6 of initiation of progesterone treatment regardless of the developmental

stage of the blastocyst. Pregnancy was first determined 9 days post transfer on the

basis of a serum hCG greater than 25 mlU/ml. Ongoing clinical pregnancy was

determined 4 weeks post transfer using transvaginal ultrasound to assess the presence

of fetal heartbeat.

We compared two groups of patients. Group I (n=19) included patients who had

frozen blastocysts thawed and cultured in solutions supplemented with HSA. Group II

(n=9) included patients who had frozen blastocysts thawed and cultured in solutions

supplemented with SSS. Thaw-survival was characterized as blastocysts exhibiting

fewer than 20% degenerative cells assessed at two hours post-thaw. Blastocyst

expansion was assessed at 24 hours post-thaw with only blastocysts exhibiting greater

than 50% blastocoele expansion considered to have re-expanded. The institutional

review board and ethics committee of the University of Florida approved this study.









Statistical Analysis

All data were analyzed using software SPSS statistics 17.0 (SPSS Inc., Chicago,

IL). Chi-Square testing was used to analyze blastocyst re-expansion for animal

experimental studies 1, 2, and 3, as well as the clinical retrospective study. Multiple

comparisons with Bonferroni adjustments were used to compare individual treatments in

animal experimental studies 1 and 2. Student's t-test was used to compare mean total

cell numbers for animal experiment 3. Fisher's exact test was used to analyze clinical

pregnancy and implantation rates for the retrospective study. Significance was deemed

P<.05.

Results

Experiment 1: Effects of Supplementing Freeze and/or Thaw Solutions with SSS
on Post-Thaw Murine Blastocyst Re-Expansion

Initially 306 murine blastocysts were frozen using freeze solutions supplemented

with either HSA (n=152) or SSS (n=154). Table 4-1 shows the distribution of 300

recovered murine blastocysts following thaw. Overall, there was no significant difference

in re-expansion from blastocysts frozen in HSA compared to SSS, whereas re-

expansion was greater if blastocysts were thawed in solutions supplemented with SSS

(85.3%) compared to HSA (64.0%) (P<.05). Individually, 89.5% of recovered blastocysts

re-expanded from group IV compared to 70.7% and 57.3% in groups I (P<.05) and III

(P<0.001), respectively.

Experiment 2: Effects of post-thaw culture medium with SSS on re-expansion of
marine blastocyst frozen-thawed with different protein supplements

In experiment 2, 158 of 160 frozen murine blastocysts were recovered following

thaw and were grouped similarly to experiment 1 (Table 4-2). Following 24 hours of









culture in post-thaw medium supplemented with SSS, blastocyst re-expansion was

excellent in all groups with no significant differences between treatments.

Experiment 3: Effects of protein supplementation of freeze-thaw and post-thaw
culture solutions on murine blastocyst re-expansion and total cell number

Experiment 3 included 111 murine blastocysts frozen, thawed and cultured for 24

hours using cryosolutions and post-thaw culture medium supplemented with HSA or

SSS (Figure 4-1 and Table 4-3). A greater percentage of blastocysts re-expanded if

frozen, thawed and cultured in solutions supplemented with SSS (85.5%) compared to

HSA alone (66.1%; P<.05). In addition, the mean total cell number of re-expanded

blastocysts, as determined by staining of fixed nuclei with DAPI (Figure 4-2), was

moderately greater for SSS group compared to HSA group (80.0 vs 70.5; P=.057).

Retrospective Analysis of Frozen-Thawed Human Blastocyst Re-Expansion Using
Thaw and Post-Thaw Solutions Supplemented with SSS

The retrospective analysis included 82 blastocysts originally frozen in freeze

solutions supplemented with HSA (Table 4-4). Cycles were grouped based on the thaw

protocol in use at the time. Between January 2006 and June 2008, 58 embryos were

thawed using thaw and post-thaw culture medium supplemented with HSA (group I).

Beginning in July 2008 through March 2009, 24 additional blastocysts were thawed, but

in these cases using thaw and post-thaw culture medium supplemented with SSS

(group II). Blastocysts thawed and cultured in solutions supplemented with SSS had

significantly greater survival at 2 hours post-thaw and greater blastocyst re-expansion at

24 hours than blastocysts thawed and cultured in HSA alone (83.3% and 66.7% vs

43.9% and 15.8%, respectively; P<.01). In addition, there was a higher clinical

pregnancy rate per thaw and higher implantation rate from frozen blastocysts thawed









and cultured in solutions containing SSS compared to HSA (55.6% and 53.8% vs 10.5%

and 13.3%; P<.05).

Discussion

The aim of this work was to improve current freezing and thawing protocols in

order to enhance post-thaw survival and implantation of blastocysts. The present study

was designed to test whether inclusion of the commercially available globulin-rich

protein supplement SSS in freeze, thaw and post-thaw solutions would increase thaw-

survival as compared to HSA. The results indicate that the type of protein supplement

provided impacted thaw-survival, as measured by post-thaw re-expansion and total cell

number. As several studies have demonstrated post-thaw re-expansion and total cell

number are predictors of implantation, the selection of protein type used in freeze, thaw

and post-thaw solutions could affect frozen embryo transfer outcomes.

Accumulated evidence supports a role for globular protein supplementation in

embryo culture medium. Results from the current study suggest globulin-rich protein

sources, such as SSS, may also promote thaw-survival of cryopreserved blastocysts.

The results show that blastocysts that were cryopreserved and thawed in freeze-thaw

solutions using SSS had significantly higher rates of re-expansion compared to HSA

alone. If we consider that cellular mechanisms involved during blastocyst expansion are

likely to also be involved in re-expansion of collapsed blastocysts following thaw, then

these results are consistent with previous studies demonstrating the positive effects of

globulin-rich protein supplements on blastocyst hatching [118, 122, 247]. Interestingly,

transitioning from SSS used during freeze to HSA used during thaw negatively affected

post-thaw re-expansion. Schneider and Hayslip [122] observed a similar phenomena

during extended embryo culture where compact embryos cultured with a mix of HSA









and globulin proteins resulted in poor production of hatched blastocysts when moved to

a sequential medium devoid of globulins, suggesting an active role for globulins in

stimulation of blastocyst hatching. In addition, the present study found that the culture of

thawed blastocysts overnight in SSS promotes excellent blastocyst hatching, regardless

of protein type in freeze-thaw solutions. These results imply supplementation of post-

thaw culture medium with a globulin-rich protein source, like SSS, may restore the

potential for blastocyst re-expansion even if previously frozen and/or thawed with HSA.

Total cell numbers were also analyzed to determine if re-expanded blastocysts

from SSS treatments were generally healthier compared to HSA alone. As total

blastocyst cell number has been correlated with implantation potential [254], our results

suggest that blastocysts cryopreserved and thawed in solutions containing SSS are

more robust than blastocysts cryopreserved and thawed in HSA. Although murine

blastocysts were not transferred to recipients, similar studies assessing protein

supplementation in routine embryo culture found globulins enhanced total cell numbers

[255] and implantation [119, 120, 248], further supporting the impression that

blastocysts cryopreserved, thawed and cultured in solutions containing SSS are more

likely to implant.

Based on the research results using murine embryos, our clinical ART laboratory

which previously solely used HSA, incorporated SSS into freeze-thaw protocols as well

as post-thaw culture of human blastocysts. Since this change, our program has shown a

remarkable improvement in thaw-survival. In addition, as our standard procedure is to

culture thawed embryos overnight, we have observed significant improvements in

blastocyst re-expansion prior to transfer. These changes have led to significant









increases in pregnancy per thaw and implantation rates. However, as these numbers

are small, additional studies are needed to determine whether these trends are clinically

significant.

Given the osmotic dynamics imposed on embryos undergoing exposure to high

concentrations of cryoprotectants, minor alterations in the physiochemical environment

may dramatically enhance an embryo's ability to restore osmotic function. Pool and

Martin [5] propose that the high number and orientation of hydroxyl groups (-OH) in

polyhydroxy compounds may interact through hydrogen bonding with water molecules

affecting physical properties such as water exchange dynamics. The finding presented

here that thawed blastocysts are more likely to re-expand if cultured with a protein

source containing globulins lends support to the idea that polyhydroxy compounds

improve osmotic function. Intriguingly, other polyhydroxy compounds, some of which

are currently used in IVF medium, may function better than globulins for

cryopreservation. Hyaluronan, which is naturally found in the reproductive tract [131]

and has been reported to stimulate in vitro embryo development and improve

implantation [133], was previously shown to produce equally high thaw-survival rates in

mouse and cow embryos when substituted for newborn calf serum in freezing solutions

[157]. While no study (to the author's knowledge) has evaluated the affects of

hyaluronan in freeze-thaw solutions of human blastocysts, a recent study comparing

blastocyst FET using hyaluronan-rich transfer medium, embryoglue (VitroLife),

demonstrated no improvement in implantation as observed with fresh blastocyst transfer

[256]. While it remains to be elucidated, Korosec [256] suggested that the freeze-thaw

process itself may affect receptor-mediated actions of hyaluronan thereby disrupting









signaling between the endometrium and the embryo. As this could have major

implications affecting implantation, further research is needed.

Alternative mechanisms for the thaw-survival promoting effects of globulins are

plausible and warrant further investigation. A previous in vitro culture study of murine

embryos cultured in medium supplemented with SSS showed reduced presence of

reactive oxygen species (ROS) accompanied by lower incidences of apoptosis when

compared to embryos cultured in medium supplemented solely with HSA [247]. Our

study was limited to observational data, including blastocyst re-expansion and total cell

number. We did not analyze post-thaw culture medium for ROS or re-expanded

blastocysts for apoptosis and therefore cannot exclude this as a potential mechanism

promoting thaw-survival. In addition, globulin proteins within SSS have also been

suggested to act as energy substrates or serve as carriers of growth promoting factors.

While this is plausible, it is more reasonable that the -OH groups within polyhydroxy

compounds, like SSS, influence osmotic tolerance of embryos. In support, a recently

made available supplement containing a mixture of HSA and dextran (DSS, Irvine

Scientific) is being promoted to be as effective as SSS for in vitro mouse embryo

development and more relevantly produce comparable thaw-survival to SSS when used

as the protein component in vitrification solutions for all stages of development. As

dextran is a nonproteinaceous polymer known to interact strongly with water, future

studies incorporating DSS may provide additional support for a mechanism in which

polyhydroxyl compounds interact in a physiochemical manner with the embryo and its

environment to enhance osmoregulation rather than function as growth promoting

factors.









The results of this study suggest that supplementation of freeze, thaw and post-

thaw solutions with a protein source containing high fractions of globulins, such as SSS,

may benefit thaw-survival. As this study was limited to slow-cool cryopreservation, it

would be interesting to see if similar results can be obtained through vitrification. Given

that most referenced vitrification solutions are formulated using SSS, it is likely that the

success of those solutions may at least in part be due to the presence of globins.


Table 4-1. Effects of protein supplement in freeze-thaw solutions on murine post-thaw
re-expansion.
Treatment Thawed-Recovered Re-Expanded (%)
Group I: HSA-->HSA 75 53 (70.7)ab
Group II: HSA-->SSS 74 60 (81.1)a"
Group III: SSS-->HSA 75 43 (57.3)b
Group IV: SSS-->SSS 76 68 (89.5)c
Results with different superscripts indicate significance. ab vs c P<0.05, b vs. ac
P<0.01, b vs. c P<0.001.


Table 4-2. Effects of post-thaw culture medium with SSS on re-expansion of murine
blastocyst frozen-thawed with different protein supplements.
Treatment Thawed-Recovered Re-Expanded
Group I: HSA-->HSA 38 36 (94.7)
Group II: HSA-->SSS 40 37 (92.5)
Group III: SSS-->HSA 41 37 (90.2)
Group IV: SSS-->SSS 39 37 (94.9)
No significance observed between treatments.


Table 4-3. Effects of protein supplementation of freeze-thaw and post-thaw culture
solutions on murine blastocyst re-expansion and total cell number.
Treatment Thawed Expanded (%) Mean Total Cell Count SEM
Group I: HSA 56 37 (66.1)a 70.50 4.03
Group II: SSS 55 47 (85.5)b 80.00 2.96
Treatments within columns with different superscripts are significantly different. a vs. b
P<0.05, c vs. c P = 0.057.









Table 4-4. Retrospective analysis of frozen-thawed human blastocyst re-expansion
using thaw and post-thaw solutions supplemented with SSS
Group I Group II Statistical
Significance


Number of Cycles
Number of Embryos Thawed
Average Number of Embryos Thawed
Number of Embryos Recovered (%)
Number of Embryos Survived (%)
Number of Embryos Expanded (%)
Number of Embryo Transfers (%)
Average Number of Embryos
Transferred
Number of Biochemical Pregnancy
Per Thaw (%)
Per Transfer (%)
Number of Clinical Pregnancy
Per Thaw (%)
Per Transfer (%)
Number of Implants
Per Embryo Transferred (%)


19
58
3.1
57/58 (98.3)
25/57 (43.9)
9/57 (15.8)
11/19 (57.9)
1.4

4
4/19 (21.1)
4/11 (36.4)
2
2/19 (10.5)
2/11 (18.2)
2
2/15 (13.3)


9
24
2.7
24/24 (100.0)
20/24 (83.3)
16/24 (66.7)
8/9 (88.9)
1.6

5
5/9 (55.6)
5/8 (62.5)
5
5/9 (55.6)
5/8 (62.5)
7
7/13 (53.8)


NS
NS
P<0.01
P<0.01
NS
NS


NS
NS

P<0.05
NS

P<0.05
















































Figure 4-1. Thaw-survival of murine blastocysts following cryopreservation in solutions
supplemented with (A) HSA or (B) SSS. Arrows indicate blastocysts that did
not meet re-expansion criteria for survival.








90





























Figure 4-2. Epifluorescence imaging of total cell number from a frozen-thawed murine
blastocyst fixed and stained with DAPI. The total number of nuclei
corresponding with each blastocyst were counted at 600X total magnification.









CHAPTER 5
CALYCULIN-A IMPROVES CHROMOSOME CONDENSATION FOR CYTOGENETIC
ANALYSIS OF BLASTOMERES FROM BOVINE AND MURINE EIGHT-CELL STAGE
EMBRYOS

Introduction

Cytogenetic analysis of preimplantation embryos has traditionally used

fluorescent in situ hybridization (FISH) to examine individual chromosome copy number,

chromosome rearrangements, or sex determination. Comprehensive and simultaneous

assessment of all chromosomes however, cannot be achieved with interphase FISH.

Metaphase FISH is an attractive alternative, but is biologically limited since the majority

of cells, including blastomeres, spend only a short duration in metaphase.

Consequently, this technique requires large numbers of cells to increase the likelihood

of obtaining sufficient metaphase spreads for analysis, making this inappropriate for

preimplantation embryos. An improved method for obtaining condensed chromosomes

therefore, would improve the efficiency of cytogenetic analysis of preimplantation

embryos.

Premature chromosome condensation (PCC) has been well documented and in

many respects mimics the chromatin changes seen during mitosis, enabling preparation

of chromosome spreads from interphase cells in G1, G2 and M phases of the cell cycle

[207, 209]. Interestingly, the final structure of prematurely condensed chromosomes is

influenced by the cell cycle stage, with three basic morphologies corresponding with G1,

S and G2/M cell cycle phases. Cells in G1 phase generally exhibit longer chromosomes

than traditional metaphase chromosomes, especially when in late G1 [209]. In contrast,

cells in G2/M appear as doublets, reflecting replicated chromosomes. Cells in S phase









are often described as "pulverized", as the chromatin appears smeared or fragmented

[209]. Therefore, PCC of S phase cells is not suitable for cytogenetic analysis.

Chromatin condensation of blastomeres has been achieved by fusing

blastomeres with metaphase stage oocytes, enabling analysis of chromosome

aberrations in interphase nuclei [190, 191]. However, the methods used for cell fusion

are technically difficult and laborious, and fusion results are often inconsistent.

Furthermore, rates of sufficient chromatin condensation remain low. Therefore, an

alternative approach is needed to overcome these inadequacies in order to evaluate the

early embryo prior to embryo transfer.

Chemical approaches have traditionally used colcemid to depolymerize

microtubules and prevent spindle formation, thereby trapping cells at metaphase [257].

This method, however, is often time consuming, as it requires the cell to enter mitosis.

Alternatively, protein phosphatase (PP) inhibitors, such as okadaic acid, fostriecin and

calyculin-A, have been used successfully to obtain condensed chromatin in

lymphocytes sufficient for karyotyping [214, 215]. Protein phosphatases play an

essential role in cell cycle regulation including mitosis [see review [258]]. Whereas

okadaic acid, fostriecin and calyculin-A are strong inhibitors of PP2A, okadaic acid and

fostriecin are weak inhibitors of PP1. In contrast, calyculin-A is a strong inhibitor of both

PP1 and PP2 and therefore, has been suggested to be a more potent inducer of PCC.

The aim of the present study was to demonstrate PCC in blastomeres using

calyculin-A as an improved method for obtaining condensed chromosomes for

cytogenetic analysis of embryos. We tested dose and duration to determine the optimal

conditions for using calyculin-A on eight-cell stage bovine and murine embryos, and









also examined whether chromosome spreads induced by calyculin-A could be used in

combination with whole chromosome painting for assessment of individual

chromosomes and blastomere ploidy.

Materials and Methods

Production of Bovine Embryos

Blastomeres were obtained from in vitro produced bovine embryos that were

produced according to a modified procedure of that previously described [259]. Briefly,

ovaries were collected from an abattoir and cumulus oocyte complexes (COCs) were

recovered by slashing 2-8 mm follicles with a scalpel blade. Cumulus oocyte complexes

with at least one layer of intact compact cumulus and evenly granular ooplasm were

matured in maturation medium incubated in 5% CO2 in humidified air at 390C. After

22 hours maturation (Day 0), COCs were washed in Hepes-Tyrodes Albumin Lactate

Pyruvate (TALP) medium and transferred in groups of 30 to wells with 425 pl of pre-

equilibrated Synthetic Oviduct Fluid-FERT [SOFF; [260]] overlaid with mineral oil.

Frozen-thawed Angus spermatozoa (Southeastern Semen Services, Wellborn, FL,

USA) were prepared by Percoll gradient centrifugation, and COCs were fertilized at a

concentration of 1 x 106 spermatozoa/ml. Following 18 hours incubation, putative

zygotes were stripped of cumulus by vortexing in hyaluronidase (0.3 mg/ml; Sigma, St.

Louis, MO, USA), washed in Hepes-TALP, transferred to pre-equilibrated 20 pl drops of

KSOM + amino acids (Specialty Media; Phillipsburg, NJ, USA) with BSA (EFAF;

3 mg/ml; Sigma) overlaid with mineral oil (Sigma), and cultured in a humidified

environment of 5% 02, 5% CO2, and 90% N2 at 390C.









Harvesting Bovine Blastomeres

Three days after fertilization (Day 3), developmental stage-appropriate eight-cell

embryos were selected and incubated in 0.5% pronase (Sigma) for 2 minutes to

dissolve the zona pellucida. Embryos were then transferred to calcium- and

magnesium-free phosphate buffered saline (Invitrogen, Gaithersburg, MD, USA) with

BSA (fraction V; 3 mg/ml; Sigma) and were pipetted to assist disaggregation into

individual blastomeres.

Harvesting Murine Blastomeres

Frozen two-cell mouse embryos (Day 1; Embryotech, Wilmington, MA, USA)

were thawed according to manufacturer's protocol and cultured overnight in G-1v3

PLUS medium (Vitrolife, Englewood, CO, USA) in a humidified environment of 5% CO2

at 37C. Approximately 16 hours post-thaw, zona pellucida were removed from embryos

with acidified Tyrode's solution (Irvine Scientific, Santa Ana, CA, USA). Embryos were

then transferred to calcium- and magnesium-free G-PGD biopsy medium

(Vitrolife) + human serum albumin (HSA; 5 mg/ml; Vitrolife) and pipetted to mechanically

facilitate disaggregation into individual blastomeres.

Induction of Premature Chromosome Condensation

Calyculin-A stock solution (5 pM, Sigma) was prepared in DMSO (Sigma) and

stored at -20C. On the day of blastomere harvest, working solutions of calyculin-A

were prepared by diluting the stock solution in KSOM medium for bovine blastomeres or

G-1v3 PLUS medium for murine blastomeres. Blastomeres that were intact after

disaggregation were randomly allotted to treatments in 500 pl wells (4-well plates, Nalge

Nunc International, Rochester, NY, USA) and incubated in a humidified environment of









5% C02. Blastomeres were observed every 30 minutes and evaluated for morphological

changes, such as cell lysis or blebbing of the plasma membrane.

Experiment 1: effects of calyculin-A duration on bovine blastomeres

The effects of calyculin-A duration on bovine blastomeres were examined by

incubating blastomeres in 50 nM calyculin-A for 0 (control), 60, 120, or 180 minutes at

39C. Calyculin-A concentration of 50 nM was chosen based upon PCC experiments by

Kanda et al. [261] using human fibroblast cell lines. Blastomeres from eight-cell stage,

Day 3 embryos were randomly distributed across the four treatments.

Experiment 2: effects of calyculin-A concentration on bovine blastomeres

The effect of calyculin-A concentration on bovine blastomeres was examined by

incubating blastomeres in 10, 50, or 100 nM calyculin-A or vehicle control (1% DMSO in

KSOM) for 120 minutes or in colcemid control (0.1 pg/ml) for 16 hours at 390C.

Blastomeres from eight-cell stage, Day 3 embryos were disaggregated and randomly

distributed among the treatments.

Experiment 3: effects of calyculin-A on marine blastomeres

The effects of calyculin-A duration on murine blastomeres were examined by

incubating blastomeres in 50 nM calyculin-A for 0 (control), 60, 90, or 120 minutes at

37C. Blastomeres from eight-cell stage, Day 2 embryos were randomly distributed

between the four treatments.

Experiment 4: calyculin-A use for cytogenetic analysis of Day 3, eight-cell stage
bovine embryos

The usefulness of calyculin-A for inducing chromosome condensation suitable for

cytogenetic analysis of bovine embryos was examined using FISH. Intact Day 3, eight-

cell stage bovine embryos were incubated individually in 50 pl drops of 50 nM calyculin-









A overlaid with mineral oil for 120 minutes at 39C, disaggregated with gentle pipeting,

and blastomeres were fixed individually on a slide, while maintaining embryo of origin

identity. Fluorescent in situ hybridization was used to determine ploidy and gender of

each embryo. Chromosome spreads obtained from adult male bovine fibroblasts treated

with either calyculin-A (50 nM, 30 minutes) or colcemid control (0.1 pg/ml for

30 minutes) were used as FISH controls.

An additional group of calyculin-A treated embryos were cultured to Day 7 to

determine if the effects of calyculin-A treatment were reversible in embryos. Embryos

were treated with calyculin-A (50 nM) for 0 (vehicle control), 30, 60, or 120 minutes at

39C. Embryos were then washed in KSOM and placed into culture drops as described

above. Treatments were evaluated for blastocyst development rates on Day 7.

Fixation of Blastomeres

Fixation of blastomeres was performed as previously described [262]. Briefly,

1 hour prior to fixation, room humidity was recorded using a digital hygrometer (Fisher

Scientific), and if necessary a ReliOn ultrasonic humidifier (Wal-mart, Bentonville, AR,

USA) was used to increase the level of humidity to 40%. Blastomeres were incubated in

hypotonic solution [1% (w/v) sodium citrate and BSA (2 mg/ml; fraction V); Sigma] for 1-

3 minutes, washed briefly in softening solution [0.01 N HCI (Sigma) + 0.1% Tween 20;

(Sigma)] and individually loaded with minimal volume (~1 pl) onto a clean glass slide.

Just prior to completely drying, one drop of fixative solution [3:1 methanol:acetic acid;

(Sigma)] was applied adjacent to the blastomere to induce chromosome spreading. If

necessary, additional drops of fixative were applied prior to evaporation to remove

residual cytoplasm. Throughout the fixation process, the specimen was monitored using

an inverted microscope (Nikon Instruments Inc., Melville, NY, USA; model TMS-F) at









100X. The chromatin was encircled with a diamond tip scribe to help mark the location

for analysis.

Analysis of Premature Chromosome Condensation

Data were collected on morphological appearance of the blastomeres, PCC rate,

and the degree and quality of chromosome condensation for each treatment. The level

of condensation and quality of chromosome spreads were determined by 4',6-

diamidino-2-phenylindole dihydrochloride hydrate (DAPI) staining. Slides containing

fixed chromatin were mounted under coverslips with Vectashield mounting medium

containing DAPI (Vector Laboratories, Burlingame, CA, USA) and visualized at 1000X

under oil using a Zeiss Axioplan 2 epifluorescence microscope equipped with an

Axiocam MRM digital camera and Axiovision 3.1 software (Carl Zeiss Microlmaging

Inc., Thornwood, NY, USA). Fixed blastomeres containing an interphase nucleus were

considered not having undergone PCC. Blastomeres that did not contain interphase

nuclei, but contained condensed chromatin were considered to have undergone PCC.

This group was further subdivided based on the quality of the chromosome

condensation. Condensed chromatin containing defined chromosomes blastomeress in

G1 or G2/M phase), in which individual chromosomes could be counted or used for

chromosome painting were considered suitable for cytogenetic analysis, whereas

chromatin that was loosely condensed, or chromatin which was pulverized blastomeress

in S phase) and individual chromosomes could not be well defined were deemed

unsuitable for cytogenetic analysis.

Fluorescence In Situ Hybridization Analysis

Chromosome spreads obtained from bovine blastomeres treated with calyculin-A

and deemed suitable for cytogenetic analysis were analyzed using FISH with a two-









color X-Y chromosome paint set following a modified version of the manufacturer's

protocol (Cambio, United Kingdom). Briefly, slides containing chromosome spreads

were washed in 2x SSC (Sigma) for 5 minutes at room temperature and then

dehydrated by washing through a series of 70, 85, and 100% ethanol solutions for

1 minute each. After air drying at room temperature, a 10 pl premix of biotin-labeled X

and Cy3-labeled Y was applied to the area of the slide containing the chromosomes,

coverslipped, and sealed with parafilm. The chromosomes and probes were co-

denatured at 750C for 2 minutes on a dry bath incubator (Fisher Scientific, Pittsburgh,

PA, USA), and then the slide was transferred to a prewarmed humidified chamber and

incubated in the dark at 370C overnight. Following hybridization, coverslips were

removed and slides were washed at 450C for 5 minutes each in Coplin jars (Fisher

Scientific) containing stringency wash solution [formamide:1X SSC (1:1); (Sigma)], 1X

SSC (Sigma), and detergent wash solution [4X SSC (Sigma) + manufacturer supplied

detergent DT (Cambio)]. Blocking protein and biotin detection agent (100 pl) were

applied to each slide, covered with parafilm, and incubated in a humidified box for

20 minutes at 370C. Slides were then washed for 10 minutes in detergent wash solution

at room temperature and allowed to air dry before applying 20 pl of mountant containing

DAPI (Cambio) and a coverslip. Chromosome spreads were visualized at 1000X under

oil using a Zeiss Axioplan2 epifluorescence microscope as described above.

Chromosome counting and ploidy assessment were determined by cytogenetic

criteria previously described by McCauley and coworkers [263]. Briefly, embryos in

which all blastomeres counted contained 2 sets of chromosomes (2N = 60

chromosomes) were scored as diploid. Likewise, embryos in which all blastomeres









counted contained one set of chromosomes (1 N = 30 chromosomes) were scored as

haploid, and embryos in which all blastomeres counted contained three or more sets of

chromosomes were scored as polyploid. Embryos containing a mixture of haploid,

diploid, or polyploid blastomeres were considered mixoploid.

Statistical Analysis

Data for PCC rate and degree and quality of condensation were analyzed by chi-

square. Multiple comparisons were made using PROC MULTTEST procedures of SAS

with Bonferroni P-value adjustments. Significance was deemed P < 0.05.

Results

Experiment 1: Effects of Calyculin-A Duration on Bovine Blastomeres

Blastomeres from 16 bovine IVP eight-cell stage embryos were evaluated for

calyculin-A duration during 4 repetitions of Experiment 1 (Table 5-1). No morphological

differences were observed between blastomeres prior to fixation for each treatment. In

addition, no blastomeres lysed during hypotonic treatment. Duration of calyculin-A

treatment affected the frequency of blastomeres undergoing PCC, as fewer blastomeres

treated for 0 and 60 minutes underwent PCC when compared to 120 and 180 minutes

(P < 0.005). Blastomeres not responding to calyculin-A treatment contained intact

interphase nuclei (Figure 5-1A). The frequency of blastomeres with defined

chromosomes varied by treatment, with 120 minutes giving the best results (57%). Non-

treated control blastomeres had 6% mitotic cells.

Despite >90% of blastomeres undergoing PCC after 120 minutes, not all

blastomeres were suitable for cytogenetic analysis. The effects of calyculin-A were

dependent upon cell cycle stage of the blastomeres. Chromatin of blastomeres was

sometimes incompletely condensed (Figure 5-1B), whereas blastomeres in S phase


100









appeared to be chaotically condensed (Figure 5-1D), or pulverized, in which distinct

chromosomes could not be differentiated (Figure 5-1E). Chromosomes deemed suitable

for analysis were either from blastomeres treated in G1 or G2/M phase of the cell cycle

(Figure 5-1C and 5-1F).

Experiment 2: Effects of Calyculin-A Concentration on Bovine Blastomeres

Individual blastomeres (n = 283) from 35 bovine IVP embryos at the eight-cell

stage were used during six repetitions of Experiment 2 to determine optimal

concentration (Table 5-2). No morphological differences were detected in blastomeres

between each treatment, and no blastomeres lysed during hypotonic treatment.

Preliminary experiments testing doses up to 750 nM calyculin-A (data not shown)

indicated that when concentrations exceeded 150 nM, blastomeres also underwent

cellular blebbing and subsequently ruptured when transferred to hypotonic solution.

Concentration of calyculin-A affected the frequency of blastomeres undergoing PCC,

resulting in nearly a 3-fold increase over colcemid-treated control blastomeres.

Blastomeres treated with 50 or 100 nM calyculin-A had a higher frequency of PCC

compared to blastomeres treated with 10 nM calyculin-A (P < 0.005). In addition,

blastomeres treated with 50 nM calyculin-A had a higher frequency of defined

chromosomes deemed suitable for cytogenetic analysis, as compared to blastomeres

treated with 10 nM calyculin-A (P < 0.005). Blastomeres that underwent PCC, but were

deemed unsuitable for cytogenetic analysis had chromatin that appeared chaotically

condensed (Figure 5-1D) or pulverized (Figure 5-1E). In comparison, vehicle treated

controls had only 3.5% mitotic cells after 2 hours, whereas colcemid treatment captured

32.7% in metaphase after 16 hours.


101









Experiment 3: Effects of Calyculin-A on Murine Blastomeres

Experiment 3 included 207 blastomeres recovered from 62 Day 2 murine

embryos during two repetitions to evaluate optimal dose (Table 5-3). No morphological

differences were observed between treatments; however, during the fixation process 17

blastomeres (29%) from the 120 minutes calyculin-A treatment lysed in hypotonic

solution and could not be used for analysis. Blastomeres remained intact in all other

treatments. Following fixation, blastomeres treated with calyculin-A for 90 and

120 minutes had higher frequencies of PCC (90 and 100%, respectively) than 0 or

60 minutes (P < 0.05). This was 13-fold greater than mitotic cells observed in the control

group. There were no differences in the degree of chromosome condensation between

calyculin-A treatments and averaged 24.7%. Blastomeres undergoing PCC appeared to

be similar to bovine blastomeres, exhibiting similar cell cycle effects, with no preference

between treatments (Figure 5-2).

Experiment 4: Calyculin-A Use for Preimplantation Cytogenetic Analysis of Day 3,
Eight-Cell Stage Bovine Embryos

Chromosome spreads from blastomeres of 11 bovine IVP embryos were

assessed by FISH, to determine the usefulness of calyculin-A treatment for cytogenetic

analysis and sex determination of embryos (Table 5-4). Seven blastomeres were lost

during fixation and those remaining were used for analysis. Overall, 100% of the

blastomeres analyzed underwent PCC, and 85% of blastomeres contained defined

chromosomes.

Normal, diploid blastomeres were observed in 93% of all blastomeres with

defined chromosomes. Four embryos (36%) were considered mixoploid, containing

combinations of diploid (Figure 5-3A and B), haploid (Figure 5-3C), and tetraploid


102









(Figure 5-3D) blastomeres, however, numbers of chromosomally abnormal blastomeres

were low in mixoploid embryos (14-22%). Overall, no sex chromosome specific

aneuploidies were observed among blastomeres and the ratio of female to male

embryos was 6-5 (Table 5-4; Fig. 5-3B and A, respectively).

Male fibroblast control slides were used to validate the FISH assay. Twenty

metaphase spreads from each FISH fibroblast control slide were analyzed with greater

than 80% detection of both X and Y chromosomes. There were no differences in

hybridization efficiencies between blastomeres and control fibroblasts.

Finally, intact bovine embryos treated with calyculin-A at the optimal dose

(50 nM) for 30, 60 or 120 minutes failed to resume development when returned to

culture in KSOM to Day 7, as compared to vehicle treated control embryos that

developed to the blastocyst stage (40%).

Discussion

In this study we tested calyculin-A, an inhibitor of serine/threonine phosphatases,

as an improved chemical approach for inducing premature chromosome condensation

suitable for cytogenetic analysis of preimplantation bovine and murine embryos. The

degree and quality of condensed chromosomes was affected by blastomere cell cycle

phase, as well as dose and duration of calyculin-A treatment. In addition, using a whole

chromosome paint set along with DAPI-counterstaining, we demonstrated that

condensed chromosomes from calyculin-A treated bovine blastomeres were suitable for

cytogenetic analysis by FISH.

Multiple studies of IVP embryos have reported chromosomal abnormalities

varying between 15 and 80% in domestic species [263-267] and in humans [15, 268-

271]; however, the incidence of live born mammals with chromosomal abnormalities


103









remains lower, suggesting that chromosomal abnormalities contribute to the high

incidence of embryonic and fetal losses following embryo transfer. This has led to

considerable interest in trying to study chromosomal abnormalities in IVP embryos. To

date, most cytogenetic studies of embryos have relied on interphase FISH and

therefore, have not provided insight into full karyotypes. Although alternative

approaches to trap or induce metaphase chromosomes for more detailed cytogenetic

studies of embryos have proven to be more informative than interphase FISH, the

techniques involved are laborious, inefficient and time consuming.

Our approach, using calyculin-A to achieve chromosome condensation in

blastomeres, was more efficient and required a shorter duration than colcemid, which is

traditionally used for cytogenetic studies. The potency of calyculin-A can be attributed to

its ability to induce chromosome condensation of cells in G1, S, and G2/M of the cell

cycle, whereas colcemid is limited to cells that have entered mitosis. This versatility

clearly makes calyculin-A advantageous for attaining condensed chromosomes in the

shortest duration.

Since the selection or induction of cells in G1 or G2/M prior to PCC is not possible

with blastomeres, this study evaluated all blastomeres regardless of cell cycle stage.

Retrospective analysis of chromosomes showed PCC in blastomeres treated in G1 and

G2/M were representative of those spreads deemed suitable for cytogenetic analysis.

Chromatin from blastomeres in S phase appeared either pulverized or presented

interspersed blocks of condensed and non-condensed chromatin, as described by El

Achkar and coworkers [272], and were not suitable for cytogenetic analysis.


104









The fourth cell cycle post-fertilization in the bovine embryo is the longest and is

associated with embryonic genome activation. It takes 38-49 h to complete cell

divisions in order to develop from the eight-cell stage to the 16-cell stage [273-275],

which allows ample time to complete embryo biopsies and blastomere treatments. We

demonstrate here that calyculin-A, under optimal conditions, can induce PCC in 100%

of bovine blastomeres treated at the eight-cell stage. However, between 15 and 47%

are unsuitable for analysis, probably due to cells being treated in the S phase of the cell

cycle. This suggests that 53-85% of blastomeres were in G1/G2/M phases of the cell

cycle.

Extended exposure of blastomeres to calyculin-A had an adverse effect on

chromosome condensation. Although calyculin-A treatment of bovine blastomeres for

3 hours had the greatest frequency of PCC, chromosomes were often over-condensed

and could not be utilized for further analysis. Interestingly, murine blastomeres showed

a similar adverse effect with prolonged exposure to calyculin-A; however, the cutoff time

for optimal condensation was shorter than for bovine. This over-condensed chromatin

morphology was also reported by Swain and coworkers [276], when murine oocytes

were cultured with calyculin-A for an extended period of time (7 hours) and no distinct

resolution of chromosomes was achieved. They attributed this effect to

hyperphosphorylation of histone H3 on Ser 10 and Ser 28, that may be detrimental to

proper chromatin remodeling required for the formation of chromosomes.

Calyculin-A also had adverse effects when blastomeres were exposed to doses

of 100 nM or more. Whereas blastomeres treated with 10 nM frequently had incomplete

chromatin condensation, resembling early prophase chromosomes, treatment with


105









100 nM calyculin-A resulted in over-condensed chromatin similar to blastomeres

exposed to durations longer than 2 hours. Taken together, we inferred that duration and

concentration of calyculin-A must be carefully monitored to achieve optimal

chromosome condensation and to avoid deleterious effects, such as over-condensation,

which will negatively affect cytogenetic analysis.

Employing optimal conditions in Experiment 4, we demonstrated that

blastomeres treated with calyculin-A can be used to screen for chromosome

abnormalities. Out of 11 embryos analyzed, 4 (36%) were mixoploid containing haploid

or polyploid blastomeres in combination with normal diploid blastomeres; however, only

a small percentage of cells within each of these embryos were chromosomally

abnormal. Mixoploidy can arise either from the fusion of blastomeres or the failure of

cell division following chromosome replication [277, 278]. Although live offspring may be

produced from mixoploid embryos if polyploid blastomeres are sequestered within the

extraembryonic tissues, Viuff and coworkers [279] suggest that embryos with a large

contribution of polyploid cells to the trophoblast lineage could contribute to the incidence

of large offspring syndrome. It is also important to note that given the limitations of

determining stage of cell cycle of bovine blastomeres, along with the resolution of

bovine chromosomes, we cannot ignore the possibility that some of the tetraploid cells

observed in embryos 7 and 11 could have been G2/M cells that underwent premature

centromere division (PCD)[218]. Notwithstanding, our results were similar to previous

studies of bovine IVP embryos that reported a range of mixoploidy from 12 to 72% [279,

280].


106









Interestingly, the only sex chromosomal abnormalities we observed were limited

to the mixoploid embryos. In addition, we did not observe any sex chromosome

aneuploidies, which was consistent with a detailed preimplantation genetic study of

human embryos that reported only 1.2% of analyzed embryos had aneuploidies

associated with sex chromosomes [184]. Although sex chromosome aneuploidies are

low, we chose this as our model, since we have good positive control male cell lines

and X-Y paint probes are commercially available. Future efforts can focus on specific

chromosomes of interest, but will require developing new chromosome paint probes.

Fixation of chromosomes from bovine blastomeres proved to be challenging.

Unlike human and murine blastomeres, bovine blastomeres from in vitro produced

embryos have a high lipid content, which can readily be seen upon addition of fixative

solution. The lipid droplets tend to associate with chromatin, making it challenging to

remove excess lipid without losing chromatin. Future studies therefore, will need to

develop fixation methods or improve culture conditions [281] that can overcome the

problems associated with this high lipid content in bovine IVP embryos. In addition,

future cytogenetic studies of bovine IVP embryos will need to address methods to

perform detailed karyotypes. A normal bovine cell contains 60 chromosomes, of which

all the autosomes are acrocentric making traditional staining methods, such a G-

banding, more difficult. Spectral karyotyping using whole chromosome paint probes

could overcome the shortcomings of G-banding, however chromosome painting probes

are commercially available only for chromosomes 1, 29, X, and Y.

Murine embryos were also evaluated in this study in an attempt to demonstrate

the versatility of calyculin-A for inducing PCC in embryos other than bovine. Although


107









murine embryos had been cryopreserved at the two-cell stage, they were all thawed

and cultured overnight, and all embryos developed to the eight-cell stage. Therefore, we

concluded that embryo cryopreservation did not alter results. Interestingly, murine

blastomeres were more sensitive to calyculin-A, so dose titrations tested differed from

the bovine experiments taking this into account. Although we did achieve high

frequencies of blastomeres undergoing PCC similar to bovine, the degree and quality of

condensation was often poor and insufficient for further cytogenetic analysis. Likewise,

using human blastomeres, Shkumatov and coworkers [282] found calyculin-A produced

low rates of well-spread metaphase chromosomes. We inferred that calyculin-A may

have species-specific activity.

An alternative possibility is that PCC induced by calyculin-A may be affected by

Ca2+-free medium. Interestingly, we obtained higher frequencies of chromosomes

suitable for cytogenetic analysis in Experiment 4, in which embryos were not

predisposed to Ca2+-free medium prior to calyculin-A treatment. We speculated that

these differences could be due to a disruption in intracellular calcium release. To

support this hypothesis, studies using cell lines of human fibroblasts and lymphocytes

demonstrated that inclusion of a calcium ionophore with calyculin-A improved PCC and

quality of chromosome spreads [261, 283].

Another unexpected finding was that treating whole embryos with calyculin-A

(Experiment 4) improved PCC over treating individual blastomeres (Experiments 1-3).

Methods for preimplantation genetic diagnosis (PGD) routinely involve the isolation of

individual blastomeres, whereas the biopsied embryos are returned to culture during the

analysis. Eriksson and coworkers [284] previously reported that the effects of calyculin-


108









A were reversible in BHK-21 fibroblasts. Therefore, as the next step for improving this

technique for possible use in PGD, we tested whether calyculin-A effects were

reversible when treating whole bovine embryos. Unfortunately, exposure of embryos to

calyculin-A for as little as 30 minutes was sufficient to induce irreversible cellular arrest,

and treated embryos failed to resume development. Although the highest frequency of

PCC is obtained with whole embryo incubation, it is not feasible for use in blastomere

biopsy schemes due to its irreversible toxicity in embryos at this dose.

In conclusion, we inferred that calyculin-A can rapidly induce PCC in blastomeres

for preimplantation cytogenetic studies of bovine and murine embryos, but the degree of

chromosome condensation may not always be suitable for detailed cytogenetic analysis

from a single blastomere, depending upon its cell cycle phase.


Table 5-1. Effects of calyculin-A duration on inducing PCC
No. of blastomeres
Duration No. of blastomeres undergoing PCC
(minutes) analyzed (%)
60 26 8(31)a
120 35 32 (91)b
180 34 33 (97)b
Non-treated 33 2 (6)c
Treatments within columns with different superscript letters


in bovine blastomeres


No. of blastomeres suitable
for cytogenetic analysis (%)
3(12)a
20 (57)b
17 (50)b
2 (6)a
differed (P < 0.01).


109














































Figure 5-1. Calyculin-A induces premature chromosome condensation (PCC) in
blastomeres from Day 3, eight-cell stage bovine IVP embryos (Day
0 = fertilization). The degree of chromatin condensation was determined by
DAPI counter-staining and epifluorescence microscopy at 1000x. (A)
Interphase nucleus, considered to not have undergone PCC. (B) Loosely
condensed bovine chromatin, as is seen in late G1 phase of the cell cycle. (C)
Defined bovine chromosomes, normal G1. (D) Chaotically condensed bovine
chromatin, indicative of a cell treated in S phase of the cell cycle. (E)
Pulverized bovine chromatin, indicative of a blastomere treated in S phase of
the cell cycle. (F) Defined bovine chromosomes, 60 chromosomes, normal
G2/M.


110








Table 5-2. Effects of calyculin-A concentration on inducing PCC in bovine blastomeres.
No. of No. of blastomeres No. blastomeres suitable
blastomeres undergoing PCC for cytogenetic analysis
Concentration (nM) analyzed (%) (%)
10 53 19 (35.8)a 12 (22.6)ab
50 59 56 (94.9)b 31 (52.5)c
100 59 58 (98.3)b 22 (37.3)bc
Control (DMSO) 57 2 (3.5)c 2 (3.5)a
Control (colcemid) 55 18(32.7)a 18(32.7)bc
Treatments within columns with different superscript letters differed (P < 0.005).


Table 5-3. Effects of calyculin-A duration on inducing PCC in murine blastomeres.
No. of blastomeres
No. of No. of blastomeres suitable for
Duration blastomeres undergoing PCC cytogenetic analysis
(minutes) Reps analyzed (%) (%)
60 1 35 15(42.9)a 7 (20.0)ab
90 2 59 53 (89.8)b 20 (33.9)b
120 1 41 41 (100.0)b 8 (19.5)ab


Control (non- 2 55 4 (7.3)c 4 (7.3)a
treated)
Treatments within columns with different superscript letters differed (P<0.05).


111



































Figure 5-2. Calyculin-A induces PCC in blastomeres from Day 2, eight-cell stage
murine embryos (Day 0 = fertilization). The degree of chromatin condensation
was determined by DAPI counter-staining and epifluorescence microscopy at
1000x. (A) Interphase nucleus, considered to not have undergone PCC. (B)
Defined murine chromosomes, abnormal 80 chromosomes, tetraploid, G1. (C)
Chaotically condensed murine chromatin, as seen in a blastomere in S
phase. (D) Defined murine chromosomes, 80 chromosomes, tetraploid, G2/M.


112








Table 5-4. Cytogenetic analysis of blastomeres from bovine embryos treated with calyculin-A
No. of
No. of analyzed
analyzed blastomeres
No. of No. of blastomeres suitable for
blastomeres blastomeres undergoing cytogenetic
Embryo per embryo analyzed PCC (%) analysis (%) Ploidy Gender
1 8 8 8 (100.0) 8(100.0) Diploid Male
Mixiploid (haploidx2,
2 12 10 10(100.0) 9 (90.0) iploid (2 Male
diploidx7)
3 8 8 8 (100.0) 6 (75.0) Diploid Female
4 8 8 8 (100.0) 7 (87.5) Diploid Female
5 7 5 5 (100.0) 5(100.0) Diploid Female
6 7 7 7 (100.0) 7(100.0) Diploid Male
7 7 6 6 (100.0) 5(83.3) Mixaploid (diploidx4, Female
7 7 6 6 (100.0) 5 (83.3) Femae
tetraploidxl)
8 9 8 8 (100.0) 7 (87.5) Diploid Male
9 10 10 10(100.0) 4 (40.0) Diploid Female
10 8 8 8(100.0) 7(87.5) Mixiploid (haploidxl, Male
10 8 8 8 (100.0) 7 (87.5) d Male
diploidx6)
11 8 7 7(100.0) 7(100.0) Mixiploid (diploidx6,Female
tetraploidxl)
6 Female (54.5%), 5
Total 92 85 85 (100.0) 72 (84.7) 7 Diploid (63.6%) Male (45.5%)
Male (45.5%)


113




































Figure 5-3. Cytogenetic analysis of bovine blastomeres treated with calyculin-A.
Blastomeres with defined chromosomes were hybridized with an X-Y
specific, whole chromosome paint probe set [biotin-labeled X (green) and
Cy3-labeled Y (red); Cambio] and counter-stained with DAPI. Images were
captured at 1000x using epifluorescence microscopy. (A) Diploid, 60,XY,
normal male. (B) Diploid, 60,XX, normal female. (C) Haploid, 30, OY,
abnormal male. (D) Tetraploid, 120, XXXX, abnormal female.


114









CHAPTER 6
SUMMARY, CONCLUSIONS AND FINAL REMARKS

The field of assisted reproduction has undergone many changes since the birth of

the first IVF baby more than 30 years ago. Compared to the early days of IVF, the

success and range of treatment options has seen tremendous improvement. Initially,

IVF was limited to treatment of female infertility, covering only 1/3 of all infertility cases.

For the laboratory's part, the early procedures were fairly simple and involved mixing of

sperm with oocytes within a petri dish and following fertilization selecting resulting

embryos for transfer back to the uterus. Today though, with the development of complex

procedures such as ICSI, assisted hatching, oocyte and embryo cryopreservation and

PGD, treatment options are no longer limited to female infertility. For instance, most

male factor infertility can now be routinely treated with ICSI. In addition, patients

diagnosed with cancer have a number of oncofertility options to help preserve their

fertility following treatment, including cryopreservation of oocytes, sperm and embryos.

Furthermore, patients who carry genetic abnormalities can undergo PGD to avoid the

transfer of affected embryos and in some cases even select embryos that match an

older sibling's immune components, providing a source of stem cells that can treat and

hopefully save a sibling's life. As these IVF procedures have increased in complexity, so

have government regulations enacted to ensure that laboratories and persons within the

laboratories performing such complex procedures are qualified.

This dissertation is part of the requirements of a newly developed doctorate

program with an emphasis in clinical embryology. Among the goals of this program are

to expose students to the fundamental principles of embryology, general laboratory

knowledge, quality control and quality assurance, and the development of clinical and


115









experimental research programs. As such, this dissertation incorporates many of these

aspects through investigations of the effects of GnRH analogs on ovarian expression of

miRNAs, effects of macromolecules during embryo cryopreservation, and the effects of

a specific protein phosphatase inhibitor, calyculin-A, on the induction of chromosome

condensation for the purpose of chromosomal analysis of in vitro produced embryos.

Effects of GnRH Analogs on Ovarian Expression of MiRNAs

Common practice for patients seeking IVF treatment is to undergo controlled

ovarian stimulation utilizing GnRH analogs in order to prevent a premature surge of LH.

Since the introduction of GnRH agonist and antagonist protocols, there have been

observed differences in follicular and serum steroid concentrations and pregnancy

outcomes between analog protocols that have led to the suggestion that GnRH agonists

and antagonists may directly and differentially affect ovarian function. While a molecular

mechanism remains unknown, hormone treatment, including hCG/LH [107] and FSH

[108] have recently been shown to differentially affect the expression of miRNAs in

granulosa cells. In addition, differential expression of miRNAs were shown in another

report to affect the release of ovarian steroids P4, T, and E2 [110].

Based partially on these studies, a hypothesis was formulated for the current study

stating that GnRH agonists and GnRH antagonists directly and differentially regulate the

expression of ovarian miRNAs which affects the expression of their predicted target

genes and influences ovarian function. To test this hypothesis, granulosa cells,

collected from patients undergoing stimulation with GnRH agonist and antagonist

protocols, as well as a granulosa cell line treated with GnRH agonist and antagonist,

were analyzed using realtime quantitative PCR to compare differences in expression of

select miRNAs and mRNAs.


116









Results from these experiments indicate greater expression of mir-26a, mir-34a,

mir-98, mir-133b, mir-195 and mir-497 in granulosa cells from patients treated with

GnRH antagonists compared to GnRH agonist, lending support to the hypothesis that

GnRH analogs differentially affect miRNA expression in ovarian tissue. However, the

expression patterns of the same miRNAs were not significantly different in the

granulosa cell line treated with GnRH agonist and antagonists, suggesting the observed

differences in miRNAs in granulosa cells from patients were not a direct affect of GnRH

analogs. An alternative explanation is that the granulosa cell line is not a representative

model of in vivo function. However, overall expression patterns of miRNAs in granulosa

cells from patients were similar to miRNA expression patterns in the granulosa cell line.

In addition, GnRH analogs differentially affected the expression of AREG, GATA4, and

CYP19A1 mRNA in the granulosa cell line demonstrating that these cells were capable

of directly responding to GnRH agonist and antagonist treatments. Based on these

results, the observed miRNA differences in granulosa cells from patients are most likely

explained by GnRH analogs indirectly affecting the expression of ovarian miRNAs,

possibly through modulation by endogenous hormones.

A limitation of this study is that a traditional non-treated control was not included

among the patients. The inclusion of a group that does not receive either GnRH analog

would have helped elucidate the indirect effects of GnRH agonist and antagonists on

ovarian expression of miRNAs. However, to not administer either GnRH analog is not

practical as the patient would be at an increased risk for premature LH surge. This could

lead to loss of oocytes and cancelation of the IVF cycle.


117









Another limitation was the sample size. With so few patients included in the study,

the differences in miRNA expression may not necessarily be clinically significant.

Perhaps, with a larger sample size and more detailed patient information, it may be

possible to determine the relevance of the differential expression of miRNAs.

Conclusions drawn from this study are that GnRH analog stimulation protocols

differentially regulate ovarian expression of miRNAs. Since miRNAs may regulate the

expression of 30% of all genes (246), any changes in ovarian expression of a given

miRNA could have profound effects on the expression of many other genes affecting

processes essential to ovarian function. This is a major concern that warrants further

investigations, as folliculogenesis and steroidogenesis may be affected by differential

ovarian miRNA expression in response to GnRH analog stimulation protocols and

ultimately affects patient response and reproductive success.

Effects of Macromolecules on Embryo Cryopreservation

This area of investigation focused on the utilization of a globulin-rich protein

source in cryopreservation protocols for improving thaw-survival of blastocysts.

Previous studies have shown that the inclusion of macromolecules, such as a- and (3-

globulins in embryo culture medium, promotes blastocyst hatching [118, 122, 247] and

implantation [119, 120, 248]. Several mechanisms have been proposed to explain the

promoting effects, including the alteration of the physiochemical environment

surrounding the embryo through interactions of macromolecules with water molecules

[5]. Since osmoregulation of water molecules is a vital component of embryo

cryopreservation, the current investigation tested the hypothesis that freeze and thaw

solutions supplemented with globulin-rich proteins would improve embryo thaw-survival.

To test this hypothesis, animal experimental studies compared thaw-survival rates of


118









murine blastocysts cryopreserved using freeze and/or thaw solutions supplemented with

HSA or the globulin-rich protein source, SSS.

Following the thaw of murine blastocysts, higher rates of re-expansion and

moderately higher total cell numbers were found in those frozen and thawed in solutions

containing SSS compared to HSA, supporting the hypothesis that globulin-rich protein

supplementation improves embryo thaw-survival. While the current study did not

investigate a potential mechanism, the findings are consistent with the proposed

mechanism by Pool and Martin that high numbers and orientation of hydroxyl groups (-

OH) in polyhydroxy compounds, such as a- and 3-globulins, interact with water

molecules affecting physical properties such as water exchange dynamics.

While the overall results are promising, there are several limitations with the

current study that need to be addressed. The true potential of the thawed blastocysts is

unknown, as murine blastocysts were not transferred to recipients. In defense, total cell

numbers, which have been positively correlated with implantation potential [254], were

higher for the SSS treatment, and therefore implantation potential would be expected to

be greater for blastocysts frozen and thawed in solutions containing SSS compared to

HSA. The present study utilized a commercially available protein source containing a

fixed mixture of 84% HSA, 16% a- and 3-globulins and less than 1% y-globulins. While

this mixture produced good overall thaw-survival rates, other concentrations of globulins

may be more beneficial. The experimental design used a murine system and the results

may not translate to human embryo cryopreservation. Murine embryos, however, are an

accepted system for quality control testing of clinical conditions. In addition, results from

the retrospective analysis of human clinical data, although limited by sample size, are


119









consistent with the results obtained from the murine experiments. The experiments

within the current study focused on control-rate cryopreservation, which is slowly being

phased out in favor of vitrification. Whether globulins would improve survival of vitrified

embryos remains unknown; however, many of the successful published vitrification

protocols incorporate globulin-rich proteins sources, such as SSS, suggesting the

observed results are probably applicable to vitrification technology.

The conclusion from this investigation is that supplementation of freeze and thaw

solutions with a protein source containing high fractions of globulins, such as SSS,

promotes thaw-survival. With increasing restrictions placed on the number of embryos

that can be transferred to the uterus, improvements in embryo cryopreservation, as

discussed in this study, will undoubtedly allow for better utilization of remaining

embryos.

Effects of Calyculin-A on the Induction of Chromosome Condensation for Genetic
Analysis of Embryos

Chromosomal abnormalities are estimated to occur in 50-70% of preimplantation

embryos [6, 12-19]. As these abnormalities are thought to be a major cause of

implantation failure, there is a tremendous need for technologies capable of screening

embryos prior to transfer to the uterus. Unfortunately, traditional cytogenetic approaches

for assessment of chromosomal abnormalities utilize FISH technology on interphase

nuclei, which limits the number of chromosomes that can be analyzed at one time and

more importantly is associated with high error rates [6-11]. In an attempt to overcome

the limitations of interphase FISH, the present study investigated the induction of PCC

in bovine and murine blastomeres using a specific protein phosphatase inhibitor,

calyculin-A, to obtain condensed chromosomes suitable for full cytogenetic analysis.


120









Results from this study demonstrate calyculin-A induced chromosome

condensation of bovine and to a lesser extent murine blastomeres; however, the quality

of condensation was dose, time, and cell cycle stage dependent. Overall, the most

effective conditions for inducing PCC in bovine blastomeres were 120 minute exposure

to 50 nM calyculin-A.

Though optimized conditions resulted in high rates of PCC in blastomeres, there

are several limitations that may hinder the application of this technology. 1) A large

fraction of blastomeres yielded condensed chromatin unsuitable for cytogenetic

analysis, presumably because blastomeres were in S phase. PCC of cells in S phase is

associated with chaotic chromatin which cannot be further studied. As the phase of the

cell cycle is difficult to ascertain prior to embryo biopsy, there is a risk that the selected

blastomere may be in S phase and therefore a diagnosis of the biopsied embryo will not

be able to be determined. 2) Calyculin-A may be limited to bovine blastomeres. In the

present study, calyculin-A was less effective for inducing PCC in murine blastomeres.

Additionally, another study reported fewer than 60% of human blastomeres underwent

PCC with calyculin-A, and of those only 17% were suitable for analysis [282]. Together

these results suggest induction of PCC in blastomeres with calyculin-A is species

limited, such as bovine. 3) High lipid content in bovine embryos complicates fixation and

impedes analysis. Lipid droplets, which can be readily seen upon addition of fixative

solution, tend to associate with chromatin making it difficult to remove excess lipid

without losing chromatin. This is a major concern as any lost chromatin can lead to

misdiagnosis.


121









Conclusions to be drawn from this study are that calyculin-A can rapidly induce

PCC in blastomeres, but the quality of chromosome condensation may not be suitable

for cytogenetic analysis. As such, the application of PCC is not an acceptable method

for chromosomal screening of embryos.

Final Remarks

For more than 30 years, the field of assisted reproduction has been pioneered by

clinicians and scientists whose achievements in clinical and basic research have led to

improvements in technical applications advancing reproductive medicine. Unfortunately,

many of these the early pioneers are preparing to retire, leaving a void of scientific

knowledge and clinical experience. As such, the field of assisted reproduction is at a

crossroads and will require a new generation of uniquely qualified personnel to continue

scientific and clinical efforts. Within the field of assisted reproduction, the area most

likely to be affected is the laboratory, as few academic programs exist to prepare future

leaders in embryology laboratory sciences. Unlike technical laboratory experience,

which can be gained with repetition, the acquisition of the fundamental principles

embryology requires careful study of scientific and academic literature. In addition,

general understanding of quality control and clinical and basic research are necessities,

as embryology is a clinical science requiring careful monitoring of clinical parameters,

as well as knowledge of scientific methodology to ensure clinical advances.

The investigations within this dissertation were designed to incorporate

knowledge of embryology with quality control, clinical research, and basic scientific

research to further our understanding of several areas of assisted reproduction,

including the effects of ovarian stimulation on granulosa cells, the effects of globulin

proteins on embryo cryopreservation, and the usefulness of chemical induction of


122









premature chromosome condensation for chromosomal screening of preimplantation

embryos. The majority of the results from these individual investigations are typical of

many studies, in that some outcomes, although significant, have little or no clinical

relevance; however, a few observations, such as the potential for improved post-thaw

survival with the utilization of globulin-rich proteins in cryopreservation solutions, may

have clinical application. In any case, these investigations together provide an

understanding of clinical and scientific methods that are fundamental for the knowledge

base of future embryologists who will be able to bring translational research from the

laboratory to the reproductive bedside.


123









LIST OF REFERENCES


1. Anderson AR, Weikert ML, Crain JL. Determining the most optimal stage for
embryo cryopreservation. Reprod Biomed Online 2004; 8: 207-211.

2. Veeck LL, Bodine R, Clarke RN, Berrios R, Libraro J, Moschini RM, Zaninovic N,
Rosenwaks Z. High pregnancy rates can be achieved after freezing and thawing
human blastocysts. Fertil Steril 2004; 82: 1418-1427.

3. Liebermann J, Tucker MJ. Comparison of vitrification and conventional
cryopreservation of day 5 and day 6 blastocysts during clinical application. Fertil
Steril 2006; 86: 20-26.

4. Kuwayama M, Vajta G, leda S, Kato O. Comparison of open and closed methods
for vitrification of human embryos and the elimination of potential contamination.
Reprod Biomed Online 2005; 11: 608-614.

5. Pool TB, Martin JE. High continuing pregnancy rates after in vitro fertilization-
embryo transfer using medium supplemented with a plasma protein fraction
containing alpha- and beta-globulins. Fertil Steril 1994; 61: 714-719.

6. Magli MC, Gianaroli L, Ferraretti AP, Lappi M, Ruberti A, Farfalli V. Embryo
morphology and development are dependent on the chromosomal complement.
Fertil Steril 2007; 87: 534-541.

7. Colls P, Escudero T, Cekleniak N, Sadowy S, Cohen J, Munne S. Increased
efficiency of preimplantation genetic diagnosis for infertility using "no result
rescue". Fertil Steril 2007; 88: 53-61.

8. Munne S, Sandalinas M, Escudero T, Marquez C, Cohen J. Chromosome
mosaicism in cleavage-stage human embryos: evidence of a maternal age effect.
Reprod Biomed Online 2002; 4: 223-232.

9. Coulam CB, Jeyendran RS, Fiddler M, Pergament E. Discordance among
blastomeres renders preimplantation genetic diagnosis for aneuploidy ineffective.
J Assist Reprod Genet 2007; 24: 37-41.

10. Li M, DeUgarte CM, Surrey M, Danzer H, DeCherney A, Hill DL. Fluorescence in
situ hybridization reanalysis of day-6 human blastocysts diagnosed with
aneuploidy on day 3. Fertil Steril 2005; 84: 1395-1400.

11. Baart EB, Van Opstal D, Los FJ, Fauser BC, Martini E. Fluorescence in situ
hybridization analysis of two blastomeres from day 3 frozen-thawed embryos
followed by analysis of the remaining embryo on day 5. Hum Reprod 2004; 19:
685-693.


124









12. Munne S, Alikani M, Tomkin G, Grifo J, Cohen J. Embryo morphology,
developmental rates, and maternal age are correlated with chromosome
abnormalities. Fertil Steril 1995; 64: 382-391.

13. Munne S, Chen S, Colls P, Garrisi J, Zheng X, Cekleniak N, Lenzi M, Hughes P,
Fischer J, Garrisi M, Tomkin G, Cohen J. Maternal age, morphology,
development and chromosome abnormalities in over 6000 cleavage-stage
embryos. Reprod Biomed Online 2007; 14: 628-634.

14. Delhanty JD, Harper JC, Ao A, Handyside AH, Winston RM. Multicolour FISH
detects frequent chromosomal mosaicism and chaotic division in normal
preimplantation embryos from fertile patients. Hum Genet 1997; 99: 755-760.

15. Marquez C, Sandalinas M, Bahce M, Alikani M, Munne S. Chromosome
abnormalities in 1255 cleavage-stage human embryos. Reprod Biomed Online
2000; 1: 17-26.

16. Kuliev A, Cieslak J, Ilkevitch Y, Verlinsky Y. Chromosomal abnormalities in a
series of 6,733 human oocytes in preimplantation diagnosis for age-related
aneuploidies. Reprod Biomed Online 2003; 6: 54-59.

17. Verlinsky Y, Cieslak J, Ivakhnenko V, Evsikov S, Wolf G, White M, Lifchez A,
Kaplan B, Moise J, Valle J, Ginsberg N, Strom C, Kuliev A. Chromosomal
abnormalities in the first and second polar body. Mol Cell Endocrinol 2001; 183
Suppl 1: S47-49.

18. Bielanska M, Tan SL, Ao A. Chromosomal mosaicism throughout human
preimplantation development in vitro: incidence, type, and relevance to embryo
outcome. Hum Reprod 2002; 17: 413-419.

19. Magli MC, Gianaroli L, Ferraretti AP. Chromosomal abnormalities in embryos.
Mol Cell Endocrinol 2001; 183 Suppl 1: S29-34.

20. Kowalska A, Srebniak M, Wawrzkiewicz A, Kaminski K. The influence of calyculin
A on lymphocytes in vitro. J Appl Genet 2003; 44: 413-418.

21. Schally AV, Arimura A, Baba Y, Nair RM, Matsuo H, Redding TW, Debeljuk L.
Isolation and properties of the FSH and LH-releasing hormone. Biochem Biophys
Res Commun 1971; 43: 393-399.

22. Silverman AJ. The gonadotropin-releasing hormone (GnRH) neuronal systems:
immunocytochemistry. In: Knobil E, Neill J (eds.), The physiology of reproduction.
New York: Raven; 1988: 1283-1304.


125









23. Rasmussen DD, Gambacciani M, Swartz W, Tueros VS, Yen SS. Pulsatile
gonadotropin-releasing hormone release from the human mediobasal
hypothalamus in vitro: opiate receptor-mediated suppression.
Neuroendocrinology 1989; 49: 150-156.

24. Halvorson LM, Chin WW. Gonadotropic hormones:biosynthesis, secretion,
receptors, and action. In: Yen SS, Jaffe RB, Barbieri R (eds.), Reproductive
endocrinology: physiological, pathophysiology, and clinical management, 4th ed.
Philadelphia: Saunders; 1999.

25. Millar RP. GnRHs and GnRH receptors. Anim Reprod Sci 2005; 88: 5-28.

26. Millar RP, Lu ZL, Pawson AJ, Flanagan CA, Morgan K, Maudsley SR.
Gonadotropin-releasing hormone receptors. Endocr Rev 2004; 25: 235-275.

27. Boime I, Garcia-Campayo V, Hsueh AJ. The glycoprotein hormones and their
receptors. In: Yen SS, Strauss JF, Barbieri RL (eds.), Yen and Jaffe's
reproductive endocrinology: physiology, pathophysiology, and clinical
management, 5th ed. Philadelphia: Saunders; 2004.

28. Ascoli M, Puett D. The gonadotropin hormones and their receptors. In: Strauss
JF, Barbieri RL (eds.), Yen and Jaffe's reproductive endocrinology: physiology,
pathophysiology, and clinical management, 6th ed. Philadelphia: Saunders;
2009.

29. Porter RN, Smith W, Craft IL, Abdulwahid NA, Jacobs HS. Induction of ovulation
for in-vitro fertilisation using buserelin and gonadotropins. Lancet 1984; 2: 1284-
1285.

30. Handelsman DJ, Swerdloff RS. Pharmacokinetics of gonadotropin-releasing
hormone and its analogs. Endocr Rev 1986; 7: 95-105.

31. Karten MJ, Rivier JE. Gonadotropin-releasing hormone analog design. Structure-
function studies toward the development of agonists and antagonists: rationale
and perspective. Endocr Rev 1986; 7: 44-66.

32. Reissmann T, Diedrich K, Comaru-Schally AM, Schally AV. Introduction of
LHRH-antagonists into the treatment of gynaecological disorders. Hum Reprod
1994; 9: 769.

33. Zikopoulos K, Kaponis A, Adonakis G, Sotiriadis A, Kalantaridou S, Georgiou I,
Paraskevaidis E. A prospective randomized study comparing gonadotropin-
releasing hormone agonists or gonadotropin-releasing hormone antagonists in
couples with unexplained infertility and/or mild oligozoospermia. Fertil Steril
2005; 83: 1354-1362.


126









34. Olivennes F, Belaisch-Allart J, Emperaire JC, Dechaud H, Alvarez S, Moreau L,
Nicollet B, Zorn JR, Bouchard P, Frydman R. Prospective, randomized,
controlled study of in vitro fertilization-embryo transfer with a single dose of a
luteinizing hormone-releasing hormone (LH-RH) antagonist (cetrorelix) or a depot
formula of an LH-RH agonist (triptorelin). Fertil Steril 2000; 73: 314-320.

35. Hohmann FP, Macklon NS, Fauser BC. A randomized comparison of two ovarian
stimulation protocols with gonadotropin-releasing hormone (GnRH) antagonist
cotreatment for in vitro fertilization commencing recombinant follicle-stimulating
hormone on cycle day 2 or 5 with the standard long GnRH agonist protocol. J
Clin Endocrinol Metab 2003; 88: 166-173.

36. Engel JB, Ludwig M, Felberbaum R, Albano C, Devroey P, Diedrich K. Use of
cetrorelix in combination with clomiphene citrate and gonadotrophins: a suitable
approach to 'friendly IVF'? Hum Reprod 2002; 17: 2022-2026.

37. Engel JB, Olivennes F, Fanchin R, Frydman N, Le Du A, Blanchet V, Frydman R.
Single dose application of cetrorelix in combination with clomiphene for friendly
IVF: results of a feasibility study. Reprod Biomed Online 2003; 6: 444-447.

38. Bahceci M, Ulug U, Ben-Shlomo I, Erden HF, Akman MA. Use of a GnRH
antagonist in controlled ovarian hyperstimulation for assisted conception in
women with polycystic ovary disease: a randomized, prospective, pilot study. J
Reprod Med 2005; 50: 84-90.

39. Ragni G, Vegetti W, Riccaboni A, Engl B, Brigante C, Crosignani PG.
Comparison of GnRH agonists and antagonists in assisted reproduction cycles of
patients at high risk of ovarian hyperstimulation syndrome. Hum Reprod 2005;
20: 2421-2425.

40. Ludwig M, Felberbaum RE, Devroey P, Albano C, Riethmuller-Winzen H, Schuler
A, Engel W, Diedrich K. Significant reduction of the incidence of ovarian
hyperstimulation syndrome (OHSS) by using the LHRH antagonist Cetrorelix
(Cetrotide) in controlled ovarian stimulation for assisted reproduction. Arch
Gynecol Obstet 2000; 264: 29-32.

41. Ludwig M, Katalinic A, Diedrich K. Use of GnRH antagonists in ovarian
stimulation for assisted reproductive technologies compared to the long protocol.
Meta-analysis. Arch Gynecol Obstet 2001; 265: 175-182.

42. Borm G, Mannaerts B. Treatment with the gonadotrophin-releasing hormone
antagonist ganirelix in women undergoing ovarian stimulation with recombinant
follicle stimulating hormone is effective, safe and convenient: results of a
controlled, randomized, multicentre trial. The European Orgalutran Study Group.
Hum Reprod 2000; 15: 1490-1498.


127









43. Barmat LI, Chantilis SJ, Hurst BS, Dickey RP. A randomized prospective trial
comparing gonadotropin-releasing hormone (GnRH) antagonist/recombinant
follicle-stimulating hormone (rFSH) versus GnRH-agonist/rFSH in women
pretreated with oral contraceptives before in vitro fertilization. Fertil Steril 2005;
83: 321-330.

44. Fluker M, Grifo J, Leader A, Levy M, Meldrum D, Muasher SJ, Rinehart J,
Rosenwaks Z, Scott RT, Jr., Schoolcraft W, Shapiro DB. Efficacy and safety of
ganirelix acetate versus leuprolide acetate in women undergoing controlled
ovarian hyperstimulation. Fertil Steril 2001; 75: 38-45.

45. Albano C, Felberbaum RE, Smitz J, Riethmuller-Winzen H, Engel J, Diedrich K,
Devroey P. Ovarian stimulation with HMG: results of a prospective randomized
phase III European study comparing the luteinizing hormone-releasing hormone
(LHRH)-antagonist cetrorelix and the LHRH-agonist buserelin. European
Cetrorelix Study Group. Hum Reprod 2000; 15: 526-531.

46. Roulier R, Chabert-Orsini V, Sitri MC, Barry B, Terriou P. Depot GnRH agonist
versus the single dose GnRH antagonist regimen (cetrorelix, 3 mg) in patients
undergoing assisted reproduction treatment. Reprod Biomed Online 2003; 7:
185-189.

47. Al-lnany H, Aboulghar M. GnRH antagonist in assisted reproduction: a Cochrane
review. Hum Reprod 2002; 17: 874-885.

48. Al-lnany HG, Abou-Setta AM, Aboulghar M. Gonadotrophin-releasing hormone
antagonists for assisted conception: a Cochrane review. Reprod Biomed Online
2007; 14: 640-649.

49. Daya S. GnRH-agonists versus antagonists in assisted reproduction-a
systematic review. In: 8th International Symposium on GnRH-analogues in
Cancer and Human Reproduction; 2005. A100.

50. Giampietro F, Sancilio S, Tiboni GM, Rana RA, Di Pietro R. Levels of apoptosis
in human granulosa cells seem to be comparable after therapy with a
gonadotropin-releasing hormone agonist or antagonist. Fertil Steril 2006; 85:
412-419.

51. Garcia-Velasco JA, Isaza V, Vidal C, Landazabal A, Remohi J, Simon C, Pellicer
A. Human ovarian steroid secretion in vivo: effects of GnRH agonist versus
antagonist (cetrorelix). Hum Reprod 2001; 16: 2533-2539.

52. Ferrari B, Pezzuto A, Barusi L, Coppola F. Gonadotropin-releasing hormone
antagonists increase follicular fluid insulin-like growth factor-I and vascular
endothelial growth factor during ovarian stimulation cycles. Gynecol Endocrinol
2006; 22: 289-296.


128









53. Ferrari B, Pezzuto A, Barusi L, Coppola F. Follicular fluid vascular endothelial
growth factor concentrations are increased during GnRH antagonist/FSH ovarian
stimulation cycles. Eur J Obstet Gynecol Reprod Biol 2006; 124: 70-76.

54. Minaretzis D, Jakubowski M, Mortola JF, Pavlou SN. Gonadotropin-releasing
hormone receptor gene expression in human ovary and granulosa-lutein cells. J
Clin Endocrinol Metab 1995; 80: 430-434.

55. Latouche J, Crumeyrolle-Arias M, Jordan D, Kopp N, Augendre-Ferrante B,
Cedard L, Haour F. GnRH receptors in human granulosa cells: anatomical
localization and characterization by autoradiographic study. Endocrinology 1998;
125: 1739-1741.

56. Hsueh AJ, Erickson GF. Extrapituitary action of gonadotropin-releasing hormone:
direct inhibition ovarian steroidogenesis. Science 1979; 204: 854-855.

57. Casper RF, Erickson GF, Rebar RW, Yen SS. The effect of luteinizing hormone-
releasing factor and its agonist on cultured human granulosa cells. Fertil Steril
1982; 37: 406-409.

58. Casper RF, Erickson GF, Yen SS. Studies on the effect of gonadotropin-
releasing hormone and its agonist on human luteal steroidogenesis in vitro. Fertil
Steril 1984; 42: 39-43.

59. Tureck RW, Mastroianni L, Jr., Blasco L, Strauss JF, 3rd. Inhibition of human
granulosa cell progesterone secretion by a gonadotropin-releasing hormone
agonist. J Clin Endocrinol Metab 1982; 54: 1078-1080.

60. Parinaud J, Beaur A, Bourreau E, Vieitez G, Pontonnier G. Effect of a luteinizing
hormone-releasing hormone agonist (Buserelin) on steroidogenesis of cultured
human preovulatory granulosa cells. Fertil Steril 1988; 50: 597-602.

61. Bussenot I, Azoulay-Barjonet C, Parinaud J. Modulation of the steroidogenesis of
cultured human granulosa-lutein cells by gonadotropin-releasing hormone
analogs. J Clin Endocrinol Metab 1993; 76: 1376-1379.

62. Winkler N, Bukulmez O, Hardy DB, Carr BR. Gonadotropin releasing hormone
antagonists suppress aromatase and anti-Mullerian hormone expression in
human granulosa cells. Fertil Steril 2009.

63. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4
encodes small RNAs with antisense complementarity to lin-14. Cell 1993; 75:
843-854.

64. Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB. Prediction of
mammalian microRNA targets. Cell 2003; 115: 787-798.


129









65. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA targets.
Cell 2005; 120: 15-20.

66. Saini HK, Griffiths-Jones S, Enright AJ. Genomic analysis of human microRNA
transcripts. Proc Natl Acad Sci U S A 2007; 104: 17719-17724.

67. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel
genes coding for small expressed RNAs. Science 2001; 294: 853-858.

68. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. MicroRNA genes are
transcribed by RNA polymerase II. EMBO J 2004; 23: 4051-4060.

69. Borchert GM, Lanier W, Davidson BL. RNA polymerase III transcribes human
microRNAs. Nat Struct Mol Biol 2006; 13: 1097-1101.

70. Cullen BR. Transcription and processing of human microRNA precursors. Mol
Cell 2004; 16: 861-865.

71. Okamura K, Phillips MD, Tyler DM, Duan H, Chou YT, Lai EC. The regulatory
activity of microRNA* species has substantial influence on microRNA and 3' UTR
evolution. Nat Struct Mol Biol 2008; 15: 354-363.

72. Pratt AJ, MacRae IJ. The RNA-induced silencing complex: a versatile gene-
silencing machine. J Biol Chem 2009; 284: 17897-17901.

73. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009;
136: 215-233.

74. Jones-Rhoades MW, Bartel DP, Bartel B. MicroRNAS and their regulatory roles
in plants. Annu Rev Plant Biol 2006; 57: 19-53.

75. Maziere P, Enright AJ. Prediction of microRNA targets. Drug Discov Today 2007;
12: 452-458.

76. Chendrimada TP, Finn KJ, Ji X, Baillat D, Gregory RI, Liebhaber SA, Pasquinelli
AE, Shiekhattar R. MicroRNA silencing through RISC recruitment of elF6. Nature
2007; 447: 823-828.

77. Jackson RJ, Standart N. How do microRNAs regulate gene expression? Sci
STKE 2007; 2007: rel.

78. Bak M, Silahtaroglu A, Moller M, Christensen M, Rath MF, Skryabin B,
Tommerup N, Kauppinen S. MicroRNA expression in the adult mouse central
nervous system. RNA 2008; 14: 432-444.


130









79. Otsuka M, Zheng M, Hayashi M, Lee JD, Yoshino O, Lin S, Han J. Impaired
microRNA processing causes corpus luteum insufficiency and infertility in mice. J
Clin Invest 2008; 118: 1944-1954.

80. Ro S, Song R, Park C, Zheng H, Sanders KM, Yan W. Cloning and expression
profiling of small RNAs expressed in the mouse ovary. RNA 2007; 13: 2366-
2380.

81. Tripurani SK, Xiao C, Salem M, Yao J. Cloning and analysis of fetal ovary
microRNAs in cattle. Anim Reprod Sci.

82. Ro S, Park C, Sanders KM, McCarrey JR, Yan W. Cloning and expression
profiling of testis-expressed microRNAs. Dev Biol 2007; 311: 592-602.

83. Pan Q, Luo X, Toloubeydokhti T, Chegini N. The expression profile of micro-RNA
in endometrium and endometriosis and the influence of ovarian steroids on their
expression. Mol Hum Reprod 2007; 13: 797-806.

84. Hu SJ, Ren G, Liu JL, Zhao ZA, Yu YS, Su RW, Ma XH, Ni H, Lei W, Yang ZM.
MicroRNA expression and regulation in mouse uterus during embryo
implantation. J Biol Chem 2008.

85. Adams BD, Furneaux H, White BA. The micro-ribonucleic acid (miRNA) miR-206
targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha
messenger RNA and protein expression in breast cancer cell lines. Mol
Endocrinol 2007; 21: 1132-1147.

86. lorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P, Taccioli C,
Volinia S, Liu CG, Alder H, Calin GA, Menard S, Croce CM. MicroRNA
signatures in human ovarian cancer. Cancer Res 2007; 67: 8699-8707.

87. Lui WO, Pourmand N, Patterson BK, Fire A. Patterns of known and novel small
RNAs in human cervical cancer. Cancer Res 2007; 67: 6031-6043.

88. Yang Y, Bai W, Zhang L, Yin G, Wang X, Wang J, Zhao H, Han Y, Yao YQ.
Determination of microRNAs in mouse preimplantation embryos by microarray.
Dev Dyn 2008; 237: 2315-2327.

89. McCallie B, Schoolcraft WB, Katz-Jaffe MG. Aberration of blastocyst microRNA
expression is associated with human infertility. Fertil Steril 2009.

90. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
2004; 116: 281-297.


131









91. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel
DP. The widespread impact of mammalian MicroRNAs on mRNA repression and
evolution. Science 2005; 310: 1817-1821.

92. Calin GA, Croce CM. MicroRNAs and chromosomal abnormalities in cancer
cells. Oncogene 2006; 25: 6202-6210.

93. Ambros V. The functions of animal microRNAs. Nature 2004; 431: 350-355.

94. Engels BM, Hutvagner G. Principles and effects of microRNA-mediated post-
transcriptional gene regulation. Oncogene 2006; 25: 6163-6169.

95. Jovanovic M, Hengartner MO. miRNAs and apoptosis: RNAs to die for.
Oncogene 2006; 25: 6176-6187.

96. Zeng Y. Principles of micro-RNA production and maturation. Oncogene 2006; 25:
6156-6162.

97. Matzuk MM, Lamb DJ. Genetic dissection of mammalian fertility pathways. Nat
Cell Biol 2002; 4 Suppl: s41-49.

98. Roy A, Matzuk MM. Deconstructing mammalian reproduction: using knockouts to
define fertility pathways. Reproduction 2006; 131: 207-219.

99. Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA,
Elledge SJ, Anderson KV, Hannon GJ. Dicer is essential for mouse development.
Nat Genet 2003; 35: 215-217.

100. Yang WJ, Yang DD, Na S, Sandusky GE, Zhang Q, Zhao G. Dicer is required for
embryonic angiogenesis during mouse development. J Biol Chem 2005; 280:
9330-9335.

101. Mattiske DM, Han L, Mann JR. Meiotic maturation failure induced by DICER1
deficiency is derived from primary oocyte ooplasm. Reproduction 2009; 137: 625-
632.

102. Murchison EP, Stein P, Xuan Z, Pan H, Zhang MQ, Schultz RM, Hannon GJ.
Critical roles for Dicer in the female germline. Genes Dev 2007; 21: 682-693.

103. Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi-Miyagawa S, Obata Y,
Chiba H, Kohara Y, Kono T, Nakano T, Surani MA, Sakaki Y, Sasaki H.
Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in
mouse oocytes. Nature 2008; 453: 539-543.


132









104. Cui XS, Shen XH, Kim NH. Dicer1 expression in preimplantation mouse
embryos: Involvement of Oct3/4 transcription at the blastocyst stage. Biochem
Biophys Res Commun 2007; 352: 231-236.

105. Lei L, Jin S, Gonzalez G, Behringer RR, Woodruff TK. The regulatory role of
Dicer in folliculogenesis in mice. Mol Cell Endocrinol; 315: 63-73.

106. Hong X, Luense LJ, McGinnis LK, Nothnick WB, Christenson LK. Diceri is
essential for female fertility and normal development of the female reproductive
system. Endocrinology 2008; 149: 6207-6212.

107. Fiedler SD, Carletti MZ, Hong X, Christenson LK. Hormonal regulation of
MicroRNA expression in periovulatory mouse mural granulosa cells. Biol Reprod
2008; 79: 1030-1037.

108. Yao N, Lu CL, Zhao JJ, Xia HF, Sun DG, Shi XQ, Wang C, Li D, Cui Y, Ma X. A
network of miRNAs expressed in the ovary are regulated by FSH. Front Biosci
2009; 14: 3239-3245.

109. Dammer EB, Sewer MB. Phosphorylation of CtBP1 by cAMP-dependent protein
kinase modulates induction of CYP17 by stimulating partnering of CtBP1 and 2. J
Biol Chem 2008; 283: 6925-6934.

110. Sirotkin AV, Ovcharenko D, Grossmann R, Laukova M, Mlyncek M. Identification
of microRNAs controlling human ovarian cell steroidogenesis via a genome-scale
screen. J Cell Physiol 2009; 219: 415-420.

111. Summers MC, Biggers JD. Chemically defined media and the culture of
mammalian preimplantation embryos: historical perspective and current issues.
Hum Reprod Update 2003; 9: 557-582.

112. Caro CM, Trounson A. Successful fertilization, embryo development, and
pregnancy in human in vitro fertilization (IVF) using a chemically defined culture
medium containing no protein. J In Vitro Fert Embryo Transf 1986; 3: 215-217.

113. Pool TB, Atiee SH, Martin JE. Oocyte and embryo culture. Basic concepts and
recent advances. In: May JV (ed.) Assisted reproduction: laboratory
considerations, vol. 9: Infertility and reproductive medicine clinics of north
america; 1998: 181-203.

114. Menezo Y, Testart J, Perrone D. Serum is not necessary in human in vitro
fertilization, early embryo culture, and transfer. Fertil Steril 1984; 42: 750-755.

115. Staessen C, Van den Abbeel E, Carle M, Khan I, Devroey P, Van Steirteghem
AC. Comparison between human serum and Albuminar-20 (TM) supplement for
in-vitro fertilization. Hum Reprod 1990; 5: 336-341.


133









116. Adler A, Reing AM, Bedford JM, Alikani M, Cohen J. Plasmanate as a medium
supplement for in vitro fertilization. J Assist Reprod Genet 1993; 10: 67-71.

117. Weathersbee PS, Pool TB, Ord T. Synthetic serum substitute (SSS): a globulin-
enriched protein supplement for human embryo culture. J Assist Reprod Genet
1995; 12: 354-360.

118. Tucker KE, Hurst BS, Guadagnoli S, Dymecki C, Mendelsberg B, Awoniyi CA,
Schlaff WD. Evaluation of synthetic serum substitute versus serum as protein
supplementation for mouse and human embryo culture. J Assist Reprod Genet
1996; 13: 32-37.

119. Desai NN, Sheean LA, Martin D, Gindlesperger V, Austin CM, Lisbonna H,
Peskin B, Goldfarb JM. Clinical experience with synthetic serum substitute as a
protein supplement in IVF culture media: a retrospective study. J Assist Reprod
Genet 1996; 13: 23-31.

120. Dugan KJ, Shalika S, Smith RD, Padilla SL. Comparison of synthetic serum
substitute and fetal cord serum as media supplements for in vitro fertilization: a
prospective, randomized study. Fertil Steril 1997; 67: 166-168.

121. Graham MC, Partridge AB, Lewis V, Phipps WR. A prospective comparison of
Synthetic Serum Substitute and human serum albumin in culture for in vitro
fertilization-embryo transfer. Fertil Steril 1995; 64: 1036-1038.

122. Schneider EG, Hayslip CC. Globulin-enriched protein supplements shorten the
pre-compaction mitotic interval and promote hatching of murine embryos. Am J
Reprod Immunol 1996; 36: 101-106.

123. Schiewe MC, Neev J, Hazeleger NL, Balmaceda JP, Berns MW, Tadir Y.
Developmental competence of mouse embryos following zona drilling using a
non-contact holmium:yttrium scandian gallium garnet (Ho:YSGG) laser system.
Hum Reprod 1995; 10: 1821-1824.

124. Franks F. Solute--water interactions: do polyhydroxy compounds after the
properties of water? Cryobiology 1983; 20: 335-345.

125. Hunter RH. Modulation of gamete and embryonic microenvironments by oviduct
glycoproteins. Mol Reprod Dev 1994; 39: 176-181.

126. Verhage HG, Fazleabas AT, Donnelly K. The in vitro synthesis and release of
proteins by the human oviduct. Endocrinology 1988; 122: 1639-1645.

127. DeSouza MM, Lagow E, Carson DD. Mucin functions and expression in
mammalian reproductive tract tissues. Biochem Biophys Res Commun 1998;
247: 1-6.


134









128. Lagow E, DeSouza MM, Carson DD. Mammalian reproductive tract mucins. Hum
Reprod Update 1999; 5: 280-292.

129. Gipson IK, Ho SB, Spurr-Michaud SJ, Tisdale AS, Zhan Q, Torlakovic E, Pudney
J, Anderson DJ, Toribara NW, Hill JA, 3rd. Mucin genes expressed by human
female reproductive tract epithelia. Biol Reprod 1997; 56: 999-1011.

130. Jansen RP. Ultrastructure and histochemistry of acid mucus glycoproteins in the
estrous mammal oviduct. Microsc Res Tech 1995; 32: 24-49.

131. Yaegashi N, Fujita N, Yajima A, Nakamura M. Menstrual cycle dependent
expression of CD44 in normal human endometrium. Hum Pathol 1995; 26: 862-
865.

132. Afify AM, Craig S, Paulino AF. Temporal variation in the distribution of hyaluronic
acid, CD44s, and CD44v6 in the human endometrium across the menstrual
cycle. Appl Immunohistochem Mol Morphol 2006; 14: 328-333.

133. Gardner DK, Rodriegez-Martinez H, Lane M. Fetal development after transfer is
increased by replacing protein with the glycosaminoglycan hyaluronan for mouse
embryo culture and transfer. Hum Reprod 1999; 14: 2575-2580.

134. Fenderson BA, Stamenkovic I, Aruffo A. Localization of hyaluronan in mouse
embryos during implantation, gastrulation and organogenesis. Differentiation
1993; 54: 85-98.

135. Furnus CC, Valcarcel A, Dulout FN, Errecalde AL. The hyaluronic acid receptor
(CD44) is expressed in bovine oocytes and early stage embryos. Theriogenology
2003; 60: 1633-1644.

136. Goshen R, Ariel I, Shuster S, Hochberg A, Vlodavsky I, de Groot N, Ben-Rafael
Z, Stern R. Hyaluronan, CD44 and its variant exons in human trophoblast
invasion and placental angiogenesis. Mol Hum Reprod 1996; 2: 685-691.

137. Bavister BD. Substitution of a synthetic polymer for protein in a mammalian
gamete culture system. J Exp Zool 1981; 217: 45-51.

138. Whittingham DG, Leibo SP, Mazur P. Survival of mouse embryos frozen to -196
degrees and -269 degrees C. Science 1972; 178: 411-414.

139. Wilmut I, Rowson LE. Experiments on the low-temperature preservation of cow
embryos. Vet Rec 1973; 92: 686-690.

140. Trounson A, Mohr L. Human pregnancy following cryopreservation, thawing and
transfer of an eight-cell embryo. Nature 1983; 305: 707-709.


135









141. Cohen J, Simons RF, Edwards RG, Fehilly CB, Fishel SB. Pregnancies following
the frozen storage of expanding human blastocysts. J In Vitro Fert Embryo
Transf 1985; 2: 59-64.

142. Pegg DE. Principals of cryopreservation. In: Day JG, Stacey GN (eds.),
Cryopreservation and freeze-drying protocols, 2nd ed: Humana Press; 2007: 39-
57.

143. Menezo YJ. Blastocyst freezing. Eur J Obstet Gynecol Reprod Biol 2004; 115
Suppl 1: S12-15.

144. Stehlik E, Stehlik J, Katayama KP, Kuwayama M, Jambor V, Brohammer R, Kato
O. Vitrification demonstrates significant improvement versus slow freezing of
human blastocysts. Reprod Biomed Online 2005; 11: 53-57.

145. Langley MT, Marek DE, Nackleyet AC. Frozen blastocyst transfer: a five year
evaluation of controlled rate cryopreservation technique. Fertil Steril 2003; 80:
S150-151.

146. Nakayama T, Goto Y, Kanzaki H, Takabatake K, Himeno T, Takakura K, Mori T,
Noda Y. Developmental potential of frozen-thawed human blastocysts. J Assist
Reprod Genet 1995; 12: 239-243.

147. Kaufman RA, Menezo Y, Hazout A, Nicollet B, DuMont M, Servy EJ. Cocultured
blastocyst cryopreservation: experience of more than 500 transfer cycles. Fertil
Steril 1995; 64: 1125-1129.

148. Menezo Y, Nicollet B, Herbaut N, Andre D. Freezing cocultured human
blastocysts. Fertil Steril 1992; 58: 977-980.

149. Troup SA, Matson PL, Critchlow JD, Morroll DR, Lieberman BA, Burslem RW.
Cryopreservation of human embryos at the pronucleate, early cleavage, or
expanded blastocyst stages. Eur J Obstet Gynecol Reprod Biol 1991; 38: 133-
139.

150. Pegg DE, Hunt CJ, Fong LP. Osmotic properties of the rabbit corneal
endothelium and their relevance to cryopreservation. Cell Biophys 1987; 10: 169-
189.

151. Taylor MJ, Pegg DE. The effect of ice formation on the function of smooth
muscle tissue stored at -21 or -60 degrees C. Cryobiology 1983; 20: 36-40.

152. Hunt CJ, Taylor MJ, Pegg DE. Freeze-substitution and isothermal freeze-fixation
studies to elucidate the pattern of ice formation in smooth muscle at 252 K (-21
degrees C). J Microsc 1982; 125: 177-186.


136









153. Gardner DK, Lane M, Stevens J, Schoolcraft WB. Changing the start
temperature and cooling rate in a slow-freezing protocol increases human
blastocyst viability. Fertil Steril 2003; 79: 407-410.

154. Son WY, Yoon SH, Yoon HJ, Lee SM, Lim JH. Pregnancy outcome following
transfer of human blastocysts vitrified on electron microscopy grids after induced
collapse of the blastocoele. Hum Reprod 2003; 18: 137-139.

155. Vanderzwalmen P, Bertin G, Debauche C, Standaert V, van Roosendaal E,
Vandervorst M, Bollen N, Zech H, Mukaida T, Takahashi K, Schoysman R. Births
after vitrification at morula and blastocyst stages: effect of artificial reduction of
the blastocoelic cavity before vitrification. Hum Reprod 2002; 17: 744-751.

156. Kuleshova LL, Shaw JM, Trounson AO. Studies on replacing most of the
penetrating cryoprotectant by polymers for embryo cryopreservation. Cryobiology
2001; 43: 21-31.

157. Palasz A, Alkemade S, Mapletoft RJ. The use of sodium hyaluronate in freezing
media for bovine and murine embryos. Cryobiology 1993; 30: 172-178.

158. Kuwayama M, Hamano S, Nagai T. Vitrification of bovine blastocysts obtained by
in vitro culture of oocytes matured and fertilized in vitro. J Reprod Fertil 1992; 96:
187-193.

159. Luyet B. The vitrification of organic colloids and protoplasm. Biodynamica 1937;
1: 1-14.

160. Rall WF, Fahy GM. Ice-free cryopreservation of mouse embryos at -196 degrees
C by vitrification. Nature 1985; 313: 573-575.

161. Liebermann J, Tucker MJ. Vitrifying and warming of human oocytes, embryos,
and blastocysts: vitrification procedures as an alternative to conventional
cryopreservation. Methods Mol Biol 2004; 254: 345-364.

162. Mukaida T, Oka C, Goto T, Takahashi K. Artificial shrinkage of blastocoeles
using either a micro-needle or a laser pulse prior to the cooling steps of
vitrification improves survival rate and pregnancy outcome of vitrified human
blastocysts. Hum Reprod 2006; 21: 3246-3252.

163. Hiraoka K, Kinutani M, Kinutani K. Blastocoele collapse by micropipetting prior to
vitrification gives excellent survival and pregnancy outcomes for human day 5
and 6 expanded blastocysts. Hum Reprod 2004; 19: 2884-2888.

164. Duke M, Basile N, Johnson A, Cooperman B, Barrit J. Hatched blastocysts that
collapse during slow freezing have a higher post-thaw survival rate. Fertil Steril
2004; 82: S150-151.


137









165. Wagley LM, Noble LS. High protein concentration is beneficial in mouse
blastocyst cryopreservation. Fertility and sterility 2008; 90: S245.

166. Shaw JM, Trounson AO. Effect of dimethyl sulfoxide and protein concentration
on the viability of two-cell mouse embryos frozen with a rapid freezing technique.
Cryobiology 1989; 26: 413-421.

167. Lane M, Maybach JM, Hooper K, Hasler JF, Gardner DK. Cryo-survival and
development of bovine blastocysts are enhanced by culture with recombinant
albumin and hyaluronan. Mol Reprod Dev 2003; 64: 70-78.

168. Block J, Bonilla L, Hansen PJ. Effect of addition of hyaluronan to embryo culture
medium on survival of bovine embryos in vitro following vitrification and
establishment of pregnancy after transfer to recipients. Theriogenology 2009; 71:
1063-1071.

169. Gardner RL, Edwards RG. Control of the sex ratio at full term in the rabbit by
transferring sexed blastocysts. Nature 1968; 218: 346-349.

170. Handyside AH, Kontogianni EH, Hardy K, Winston RM. Pregnancies from
biopsied human preimplantation embryos sexed by Y-specific DNA amplification.
Nature 1990; 344: 768-770.

171. Handyside AH, Lesko JG, Tarin JJ, Winston RM, Hughes MR. Birth of a normal
girl after in vitro fertilization and preimplantation diagnostic testing for cystic
fibrosis. N Engl J Med 1992; 327: 905-909.

172. Jacobs LJ, de Wert G, Geraedts JP, de Coo IF, Smeets HJ. The transmission of
OXPHOS disease and methods to prevent this. Hum Reprod Update 2006; 12:
119-136.

173. Rechitsky S, Kuliev A, Tur-Kaspa I, Morris R, Verlinsky Y. Preimplantation
genetic diagnosis with HLA matching. Reprod Biomed Online 2004; 9: 210-221.

174. Verlinsky Y, Ginsberg N, Lifchez A, Valle J, Moise J, Strom CM. Analysis of the
first polar body: preconception genetic diagnosis. Hum Reprod 1990; 5: 826-829.

175. Delhanty JD, Griffin DK, Handyside AH, Harper J, Atkinson GH, Pieters MH,
Winston RM. Detection of aneuploidy and chromosomal mosaicism in human
embryos during preimplantation sex determination by fluorescent in situ
hybridisation, (FISH). Hum Mol Genet 1993; 2: 1183-1185.

176. James RM, West JD. A chimaeric animal model for confined placental
mosaicism. Hum Genet 1994; 93: 603-604.


138









177. Spits C, Sermon K. PGD for monogenic disorders: aspects of molecular biology.
Prenat Diagn 2009; 29: 50-56.

178. Wilton L, Thornhill A, Traeger-Synodinos J, Sermon KD, Harper JC. The causes
of misdiagnosis and adverse outcomes in PGD. Hum Reprod 2009; 24: 1221-
1228.

179. Velilla E, Escudero T, Munne S. Blastomere fixation techniques and risk of
misdiagnosis for preimplantation genetic diagnosis of aneuploidy. Reprod
Biomed Online 2002; 4: 210-217.

180. Munne S. Analysis of chromosome segregation during preimplantation genetic
diagnosis in both male and female translocation heterozygotes. Cytogenet
Genome Res 2005; 111: 305-309.

181. Munne S. Preimplantation genetic diagnosis of structural abnormalities. Mol Cell
Endocrinol 2001; 183 Suppl 1: S55-58.

182. Verlinsky Y, Cieslak J, Evsikov S, Galat V, Kuliev A. Nuclear transfer for full
karyotyping and preimplantation diagnosis for translocations. Reprod Biomed
Online 2002; 5: 300-305.

183. Liu J, Tsai YL, Zheng XZ, Yazigi RA, Baramki TA, Compton G, Katz E. Feasibility
study of repeated fluorescent in-situ hybridization in the same human
blastomeres for preimplantation genetic diagnosis. Mol Hum Reprod 1998; 4:
972-977.

184. Munne S, Bahce M, Sandalinas M, Escudero T, Marquez C, Velilla E, Colls P,
Oter M, Alikani M, Cohen J. Differences in chromosome susceptibility to
aneuploidy and survival to first trimester. Reprod Biomed Online 2004; 8: 81-90.

185. Garcia-Cruz R, Roig I, Caldes MG. Maternal origin of the human aneuploidies.
Are homolog synapsis and recombination to blame? Notes (learned) from the
underbelly. Genome Dyn 2009; 5: 128-136.

186. Munne S, Magli C, Adler A, Wright G, de Boer K, Mortimer D, Tucker M, Cohen
J, Gianaroli L. Treatment-related chromosome abnormalities in human embryos.
Hum Reprod 1997; 12: 780-784.

187. Munne S, Weier HU, Grifo J, Cohen J. Chromosome mosaicism in human
embryos. Biol Reprod 1994; 51: 373-379.

188. Munne S, Howles CM, Wells D. The role of preimplantation genetic diagnosis in
diagnosing embryo aneuploidy. Curr Opin Obstet Gynecol 2009; 21: 442-449.


139









189. Wells D, Sherlock JK, Handyside AH, Delhanty JD. Detailed chromosomal and
molecular genetic analysis of single cells by whole genome amplification and
comparative genomic hybridisation. Nucleic Acids Res 1999; 27: 1214-1218.

190. Verlinsky Y, Evsikov S. A simplified and efficient method for obtaining metaphase
chromosomes from individual human blastomeres. Fertil Steril 1999; 72: 1127-
1133.

191. Willadsen S, Levron J, Munne S, Schimmel T, Marquez C, Scott R, Cohen J.
Rapid visualization of metaphase chromosomes in single human blastomeres
after fusion with in-vitro matured bovine eggs. Hum Reprod 1999; 14: 470-475.

192. Treff NR, Su J, Mavrianos J, Bergh PA, Miller KA, Scott Jr RT. Accurate 23
chromosome aneuploidy screening in human blastomeres using single
nucleotide polymorphism (SNP) microarrays. Fertility and sterility 2007; 88: S1-
S1.

193. Munne S, Wells D. Questions concerning the suitability of comparative genomic
hybridization for preimplantation genetic diagnosis. Fertility and sterility 2003; 80:
871-872.

194. Levy B, Nahum O, Hirschhorn K. P-931: Aneuploidy analysis of single cells by
high resolution comparative genomic hybridization after whole genome
amplification using a random fragmentation approach. Fertility and sterility 2006;
86: S479-S480.

195. Levy B, Treff NR, Nahum O, Su J, Tao X, Scott RT. The accuracy and
consistency of whole genome preimplantation genetic diagnosis (PGD): a
comparison of two independent methods microarray PGD (mPGD) and
comparative genomic hybridization (CGH). Fertility and sterility 2008; 90: S305-
S305.

196. Fiegler H, Geigl JB, Langer S, Rigler D, Porter K, Unger K, Carter NP, Speicher
MR. High resolution array-CGH analysis of single cells. Nucleic Acids Res 2007;
35: e15.

197. Hellani A, Abu-Amero K, Azouri J, EI-Akoum S. Successful pregnancies after
application of array-comparative genomic hybridization in PGS-aneuploidy
screening. Reprod Biomed Online 2008; 17: 841-847.

198. Cohen J, Wells D, Munne S. Removal of 2 cells from cleavage stage embryos is
likely to reduce the efficacy of chromosomal tests that are used to enhance
implantation rates. Fertil Steril 2007; 87: 496-503.


140









199. Treff NR, Su J, Tao X, Levy B, Scott RT, Jr. Accurate single cell 24 chromosome
aneuploidy screening using whole genome amplification and single nucleotide
polymorphism microarrays. Fertil Steril.

200. Treff NR, Su J, Tao X, Miller KA, Levy B, Scott RT, Jr. A novel single-cell DNA
fingerprinting method successfully distinguishes sibling human embryos. Fertil
Steril 2009.

201. Evsikov S, Verlinsky Y. Visualization of chromosomes in single human
blastomeres. J Assist Reprod Genet 1999; 16: 133-137.

202. Santalo J, Veiga A, Calafell JM, Calderon G, Vidal F, Barri PN, Gimenes C,
Egozcue J. Evaluation of cytogenetic analysis for clinical preimplantation
diagnosis. Fertil Steril 1995; 64: 44-50.

203. Sandberg AA, Sofuni T, Takagi N, Moore GE. Chronology and pattern of human
chromosome replication, IV. Autoradiographic studies of binucleate cells. Proc
Natl Acad Sci U S A 1966; 56: 105-110.

204. Yamanaka T, Okada Y. Cultivation of fused cells resulting from treatment of cells
with HVJ. I. Synchronization of the stages of DNA synthesis of nuclei involved in
fused multinucleated cells. Biken's J 1966; 9: 159-175.

205. Stubblefield E. DNA synthesis and chromosome morphology of Chinese hamster
cells cultured in media containing N-deacetyl-N-methylcolchicine (Colcemid).
Symp Int Soc Cell Biol 1964; 3: 223-248.

206. Rao PN, Johnson RT. Mammalian cell fusion: studies on the regulation of DNA
synthesis and mitosis. Nature 1970; 225: 159-164.

207. Johnson RT, Rao PN. Mammalian cell fusion: induction of premature
chromosome condensation in interphase nuclei. Nature 1970; 226: 717-722.

208. Schor SL, Johnson RT, Waldren CA. Changes in the organization of
chromosomes during the cell cycle: response to ultraviolet light. J Cell Sci 1975;
17: 539-565.

209. Rao PN, Wilson B, Puck TT. Premature chromosome condensation and cell
cycle analysis. J Cell Physiol 1977; 91: 131-141.

210. Unakul W, Johnson RT, Rao PN, Hsu TC. Giemsa banding in prematurely
condensed chromosomes obtained by cell fusion. Nat New Biol 1973; 242: 106-
107.

211. Nurse P. Universal control mechanism regulating onset of M-phase. Nature
1990; 344: 503-508.


141









212. Draetta G, Luca F, Westendorf J, Brizuela L, Ruderman J, Beach D. Cdc2
protein kinase is completed with both cyclin A and B: evidence for proteolytic
inactivation of MPF. Cell 1989; 56: 829-838.

213. Draetta G, Beach D. The mammalian cdc2 protein kinase: mechanisms of
regulation during the cell cycle. J Cell Sci Suppl 1989; 12: 21-27.

214. Gotoh E, Asakawa Y. Detection and evaluation of chromosomal aberrations
induced by high doses of gamma-irradiation using immunogold-silver painting of
prematurely condensed chromosomes. Int J Radiat Biol 1996; 70: 517-520.

215. Prasanna PG, Escalada ND, Blakely WF. Induction of premature chromosome
condensation by a phosphatase inhibitor and a protein kinase in unstimulated
human peripheral blood lymphocytes: a simple and rapid technique to study
chromosome aberrations using specific whole-chromosome DNA hybridization
probes for biological dosimetry. Mutat Res 2000; 466: 131-141.

216. Guo XW, Th'ng JP, Swank RA, Anderson HJ, Tudan C, Bradbury EM, Roberge
M. Chromosome condensation induced by fostriecin does not require p34cdc2
kinase activity and histone H1 hyperphosphorylation, but is associated with
enhanced histone H2A and H3 phosphorylation. EMBO J 1995; 14: 976-985.

217. Gotoh E, Durante M. Chromosome condensation outside of mitosis: mechanisms
and new tools. J Cell Physiol 2006; 209: 297-304.

218. Srebniak MI, Trapp GG, Wawrzkiewicz AK, Kazmierczak W, Wiczkowski AK. The
usefulness of calyculin a for cytogenetic prenatal diagnosis. J Histochem
Cytochem 2005; 53: 391-394.

219. Gotoh E. Visualizing the dynamics of chromosome structure formation coupled
with DNA replication. Chromosoma 2007; 116: 453-462.

220. Durante M, Furusawa Y, Gotoh E. A simple method for simultaneous interphase-
metaphase chromosome analysis in biodosimetry. Int J Radiat Biol 1998; 74:
457-462.

221. Bezrookove V, Smits R, Moeslein G, Fodde R, Tanke HJ, Raap AK, Darroudi F.
Premature chromosome condensation revisited: a novel chemical approach
permits efficient cytogenetic analysis of cancers. Genes Chromosomes Cancer
2003; 38: 177-186.

222. Barbieri RL. Clinical applications of GnRH and its analogues. Trends Endocrinol
Metab 1992; 3: 30-34.


142









223. Diedrich K, Diedrich C, Santos E, Zoll C, al-Hasani S, Reissmann T, Krebs D,
Klingmuller D. Suppression of the endogenous luteinizing hormone surge by the
gonadotrophin-releasing hormone antagonist Cetrorelix during ovarian
stimulation. Hum Reprod 1994; 9: 788-791.

224. Kolibianakis EM, Collins J, Tarlatzis BC, Devroey P, Diedrich K, Griesinger G.
Among patients treated for IVF with gonadotrophins and GnRH analogues, is the
probability of live birth dependent on the type of analogue used? A systematic
review and meta-analysis. Hum Reprod Update 2006; 12: 651-671.

225. Zhao JJ, Hua YJ, Sun DG, Meng XX, Xiao HS, Ma X. Genome-wide microRNA
profiling in human fetal nervous tissues by oligonucleotide microarray. Childs
Nerv Syst 2006; 22: 1419-1425.

226. Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer
2006; 6: 857-866.

227. Nagaraja AK, Andreu-Vieyra C, Franco HL, Ma L, Chen R, Han DY, Zhu H, Agno
JE, Gunaratne PH, DeMayo FJ, Matzuk MM. Deletion of Dicer in somatic cells of
the female reproductive tract causes sterility. Mol Endocrinol 2008; 22: 2336-
2352.

228. Gonzalez G, Behringer RR. Dicer is required for female reproductive tract
development and fertility in the mouse. Mol Reprod Dev 2009; 76: 678-688.

229. Ro S, Park C, Song R, Nguyen D, Jin J, Sanders KM, McCarrey JR, Yan W.
Cloning and expression profiling of testis-expressed piRNA-like RNAs. RNA
2007; 13: 1693-1702.

230. McCallie B, Schoolcraft WB, Katz-Jaffe MG. Aberration of blastocyst microRNA
expression is associated with human infertility. Fertil Steril; 93: 2374-2382.

231. Lie BL, Leung E, Leung PC, Auersperg N. Long-term growth and steroidogenic
potential of human granulosa-lutein cells immortalized with SV40 large T antigen.
Mol Cell Endocrinol 1996; 120: 169-176.

232. Ding L, Xu J, Luo X, Chegini N. Gonadotropin releasing hormone and
transforming growth factor beta activate mitogen-activated protein
kinase/extracellularly regulated kinase and differentially regulate fibronectin, type
I collagen, and plasminogen activator inhibitor-1 expression in leiomyoma and
myometrial smooth muscle cells. J Clin Endocrinol Metab 2004; 89: 5549-5557.

233. Ambros V, Chen X. The regulation of genes and genomes by small RNAs.
Development 2007; 134: 1635-1641.


143









234. Lee CT, Risom T, Strauss WM. MicroRNAs in mammalian development. Birth
Defects Res C Embryo Today 2006; 78: 129-139.

235. Park JY, Su YQ, Ariga M, Law E, Jin SL, Conti M. EGF-like growth factors as
mediators of LH action in the ovulatory follicle. Science 2004; 303: 682-684.

236. Freimann S, Ben-Ami I, Dantes A, Ron-El R, Amsterdam A. EGF-like factor
epiregulin and amphiregulin expression is regulated by gonadotropins/cAMP in
human ovarian follicular cells. Biochem Biophys Res Commun 2004; 324: 829-
834.

237. Shimada M, Hernandez-Gonzalez I, Gonzalez-Robayna I, Richards JS.
Paracrine and autocrine regulation of epidermal growth factor-like factors in
cumulus oocyte complexes and granulosa cells: key roles for prostaglandin
synthase 2 and progesterone receptor. Mol Endocrinol 2006; 20: 1352-1365.

238. Inoue Y, Miyamoto S, Fukami T, Shirota K, Yotsumoto F, Kawarabayashi T.
Amphiregulin is much more abundantly expressed than transforming growth
factor-alpha and epidermal growth factor in human follicular fluid obtained from
patients undergoing in vitro fertilization-embryo transfer. Fertil Steril 2009; 91:
1035-1041.

239. Wong WY, Richards JS. Induction of prostaglandin H synthase in rat
preovulatory follicles by gonadotropin-releasing hormone. Endocrinology 1992;
130: 3512-3521.

240. Ben-Ami I, Freimann S, Armon L, Dantes A, Strassburger D, Friedler S, Raziel A,
Seger R, Ron-El R, Amsterdam A. PGE2 up-regulates EGF-like growth factor
biosynthesis in human granulosa cells: new insights into the coordination
between PGE2 and LH in ovulation. Mol Hum Reprod 2006; 12: 593-599.

241. So WK, Cheng JC, Poon SL, Leung PC. Gonadotropin-releasing hormone and
ovarian cancer: a functional and mechanistic overview. FEBS J 2008; 275: 5496-
5511.

242. LaVoie HA. The role of GATA in mammalian reproduction. Exp Biol Med
(Maywood) 2003; 228: 1282-1290.

243. White CD, Stewart AJ, Lu ZL, Millar RP, Morgan K. Antiproliferative effects of
GnRH agonists: prospects and problems for cancer therapy. Neuroendocrinology
2008; 88: 67-79.

244. Cheung LW, Wong AS. Gonadotropin-releasing hormone: GnRH receptor
signaling in extrapituitary tissues. FEBS J 2008; 275: 5479-5495.


144









245. Millar RP, Pawson AJ, Morgan K, Rissman EF, Lu ZL. Diversity of actions of
GnRHs mediated by ligand-induced selective signaling. Front Neuroendocrinol
2008; 29: 17-35.

246. Yu J, Wang F, Yang GH, Wang FL, Ma YN, Du ZW, Zhang JW. Human
microRNA clusters: genomic organization and expression profile in leukemia cell
lines. Biochem Biophys Res Commun 2006; 349: 59-68.

247. Esfandiari N, Falcone T, Agarwal A, Attaran M, Nelson DR, Sharma RK. Protein
supplementation and the incidence of apoptosis and oxidative stress in mouse
embryos. Obstet Gynecol 2005; 105: 653-660.

248. Ben-Yosef D, Yovel I, Schwartz T, Azem F, Lessing JB, Amit A. Increasing
synthetic serum substitute (SSS) concentrations in P1 glucose/phosphate-free
medium improves implantation rate: a comparative study. J Assist Reprod Genet
2001; 18: 588-592.

249. Li R, Trounson A. Rapid freezing of the mouse blastocyst: effects of
cryoprotectants and of time and temperature of exposure to cryoprotectant
before direct plunging into liquid nitrogen. Reprod Fertil Dev 1991; 3: 175-183.

250. Emiliani S, Van den Bergh M, Vannin AS, Biramane J, Englert Y. Comparison of
ethylene glycol, 1,2-propanediol and glycerol for cryopreservation of slow-cooled
mouse zygotes, 4-cell embryos and blastocysts. Hum Reprod 2000; 15: 905-910.

251. Van Den Abbeel E, Van Steirteghem A. Zona pellucida damage to human
embryos after cryopreservation and the consequences for their blastomere
survival and in-vitro viability. Hum Reprod 2000; 15: 373-378.

252. Menezo YJ, Veiga A. Cryopreservation of blastocysts. In: In Vitro Fertilization
and Assisted Reproduction; 1997; Vancouver. 49-53.

253. Gardner DK, Schoolcraft WB. In vitro culture of human blastocysts. In: Jansen R,
Mortimer D (eds.), Towards reproductive certainty: fertility and genetics beyond
1999. Carnforth, UK: Parthenon Publishing; 1999: 378-388.

254. Lane M, Gardner DK. Differential regulation of mouse embryo development and
viability by amino acids. J Reprod Fertil 1997; 109: 153-164.

255. Tanikawa M, Harada T, Ito M, Yoshida S, Iwabe T, Terakawa N. Globulins in
protein supplements promote the development of preimplantation embryos. J
Assist Reprod Genet 1999; 16: 555-557.

256. Korosec S, Virant-Klun I, Tomazevic T, Zech NH, Meden-Vrtovec H. Single fresh
and frozen-thawed blastocyst transfer using hyaluronan-rich transfer medium.
Reprod Biomed Online 2007; 15: 701-707.


145









257. Borisy GG, Taylor EW. The mechanism of action of colchicine. Colchicine
binding to sea urchin eggs and the mitotic apparatus. J Cell Biol 1967; 34: 535-
548.

258. Lee TH. The role of protein phosphatase type-2A in the Xenopus cell cycle:
initiation of the G2/M transition. Semin Cancer Biol 1995; 6: 203-209.

259. Moore K, Kramer JM, Rodriguez-Sallaberry CJ, Yelich JV, Drost M. Insulin-like
growth factor (IGF) family genes are aberrantly expressed in bovine conceptuses
produced in vitro or by nuclear transfer. Theriogenology 2007; 68: 717-727.

260. Gandhi AP, Lane M, Gardner DK, Krisher RL. A single medium supports
development of bovine embryos throughout maturation, fertilization and culture.
Hum Reprod 2000; 15: 395-401.

261. Kanda R, Eguchi-Kasai K, Itsukaichi H, Mori M, Hayata I. Chemically induced
premature chromosome condensation in human fibroblast cell lines: fundamental
study for applications to the biodosimetry of local exposure. Somat Cell Mol
Genet 1999; 25: 317-325.

262. Dozortsev DI, McGinnis KT. An improved fixation technique for fluorescence in
situ hybridization for preimplantation genetic diagnosis. Fertil Steril 2001; 76:
186-188.

263. McCauley TC, Mazza MR, Didion BA, Mao J, Wu G, Coppola G, Coppola GF, Di
Berardino D, Day BN. Chromosomal abnormalities in Day-6, in vitro-produced pig
embryos. Theriogenology 2003; 60: 1569-1580.

264. Iwasaki S, Hamano S, Kuwayama M, Yamashita M, Ushijima H, Nagaoka S,
Nakahara T. Developmental changes in the incidence of chromosome anomalies
of bovine embryos fertilized in vitro. J Exp Zool 1992; 261: 79-85.

265. Rambags BP, Krijtenburg PJ, Drie HF, Lazzari G, Galli C, Pearson PL,
Colenbrander B, Stout TA. Numerical chromosomal abnormalities in equine
embryos produced in vivo and in vitro. Mol Reprod Dev 2005; 72: 77-87.

266. Viuff D, Greve T, Avery B, Hyttel P, Brockhoff PB, Thomsen PD. Chromosome
aberrations in in vitro-produced bovine embryos at days 2-5 post-insemination.
Biol Reprod 2000; 63: 1143-1148.

267. Yoshizawa M, Konno H, Zhu S, Kageyama S, Fukui E, Muramatsu S, Kim S,
Araki Y. Chromosomal diagnosis in each individual blastomere of 5- to 10-cell
bovine embryos derived from in vitro fertilization. Theriogenology 1999; 51: 1239-
1250.


146









268. Baart EB, van den Berg I, Martini E, Eussen HJ, Fauser BC, Van Opstal D. FISH
analysis of 15 chromosomes in human day 4 and 5 preimplantation embryos: the
added value of extended aneuploidy detection. Prenat Diagn 2007; 27: 55-63.

269. Munne S, Sultan KM, Weier HU, Grifo JA, Cohen J, Rosenwaks Z. Assessment
of numeric abnormalities of X, Y, 18, and 16 chromosomes in preimplantation
human embryos before transfer. Am J Obstet Gynecol 1995; 172: 1191-1199;
discussion 1199-1201.

270. Ruangvutilert P, Delhanty JD, Rodeck CH, Harper JC. Relative efficiency of FISH
on metaphase and interphase nuclei from non-mosaic trisomic or triploid
fibroblast cultures. Prenat Diagn 2000; 20: 159-162.

271. Ruangvutilert P, Delhanty JD, Serhal P, Simopoulou M, Rodeck CH, Harper JC.
FISH analysis on day 5 post-insemination of human arrested and blastocyst
stage embryos. Prenat Diagn 2000; 20: 552-560.

272. El Achkar E, Gerbault-Seureau M, Muleris M, Dutrillaux B, Debatisse M.
Premature condensation induces breaks at the interface of early and late
replicating chromosome bands bearing common fragile sites. Proc Natl Acad Sci
U S A 2005; 102: 18069-18074.

273. Yoshioka K, Suzuki C, Iwamura S. Effects of activin A and follistatin on
developmental kinetics of bovine embryos: cinematographic analysis in a
chemically defined medium. J Reprod Fertil 2000; 118: 119-125.

274. Holm P, Booth PJ, Callesen H. Kinetics of early in vitro development of bovine in
vivo- and in vitro-derived zygotes produced and/or cultured in chemically defined
or serum-containing media. Reproduction 2002; 123: 553-565.

275. Lequarre AS, Marchandise J, Moreau B, Massip A, Donnay I. Cell cycle duration
at the time of maternal zygotic transition for in vitro produced bovine embryos:
effect of oxygen tension and transcription inhibition. Biol Reprod 2003; 69: 1707-
1713.

276. Swain JE, Ding J, Brautigan DL, Villa-Moruzzi E, Smith GD. Proper chromatin
condensation and maintenance of histone H3 phosphorylation during mouse
oocyte meiosis requires protein phosphatase activity. Biol Reprod 2007; 76: 628-
638.

277. King WA, Linares T, Gustavsson I. Cytogenetics of preimplantation embryos
sired by bulls heterozygous for the 1/29 translocation. Hereditas 1981; 94: 219-
224.


147









278. King WA. Chromosome abnormalities and pregnancy failure in domestic
animals. In: McFeely RA (ed.) Advances in veterinary science and comparitive
medicine, vol. 34. San Diego: Academic Press; 1990: 229-250.

279. Viuff D, Rickords L, Offenberg H, Hyttel P, Avery B, Greve T, Olsaker I, Williams
JL, Callesen H, Thomsen PD. A high proportion of bovine blastocysts produced
in vitro are mixoploid. Biol Reprod 1999; 60: 1273-1278.

280. Kawarsky SJ, Basrur PK, Stubbings RB, Hansen PJ, King WA. Chromosomal
abnormalities in bovine embryos and their influence on development. Biol Reprod
1996; 54: 53-59.

281. De La Torre-Sanchez JF, Gardner DK, Preis K, Gibbons J, Seidel GE, Jr.
Metabolic regulation of in vitro-produced bovine embryos. II. Effects of phenazine
ethosulfate, sodium azide and 2,4-dinitrophenol during post-compaction
development on glucose metabolism and lipid accumulation. Reprod Fertil Dev
2006; 18: 597-607.

282. Shkumatov A, Kuznyetsov V, Cieslak J, Ilkevitch Y, Verlinsky Y. Obtaining
metaphase spreads from single blastomeres for PGD of chromosomal
rearrangements. Reprod Biomed Online 2007; 14: 498-503.

283. Kanda R, Eguchi-Kasai K, Hayata I. Phosphatase inhibitors and premature
chromosome condensation in human peripheral lymphocytes at different cell-
cycle phases. Somat Cell Mol Genet 1999; 25: 1-8.

284. Eriksson JE, Brautigan DL, Vallee R, Olmsted J, Fujiki H, Goldman RD.
Cytoskeletal integrity in interphase cells requires protein phosphatase activity.
Proc Natl Acad Sci U S A 1992; 89: 11093-11097.


148









BIOGRAPHICAL SKETCH

Joseph Michael Kramer was born in 1977 in Easy Patchogue, New York, to Doris

and John Kramer. He was raised with his older sister, Jennifer, and younger brother,

David, in Dunnellon, Florida. Joseph married Raeanna Fox on August 15, 1998. They

have two children, Nadia, born June 2004, and Colt, born February 2010.

Joseph graduated from Dunnellon high school in May, 1995, and then he enrolled

at the University of Florida, in Gainesville. Joseph received his bachelor's degree in

animal sciences in August 2000. The following year, he began a Master of Science

program in animal sciences at the University of Florida, Gainesville, under the direction

of Dr. Karen Moore, and he completed the program in April 2005. From August 2003 to

June 2006, Joseph began his career in the field of human reproductive medicine as an

embryologist and later as a cytogeneticist for Reproductive Medicine Associates of New

Jersey. Joseph returned to the University of Florida in August 2006 to begin a Doctor of

Philosophy in animal molecular and cellular biology, as part of a unique joint venture

between the Department of Animal Sciences and the human in vitro fertilization

laboratory at Shands hospital, Gainesville, under the direction of Dr. Kenneth Drury.

After graduation, Joseph will apply for certification as a High-Complexity Clinical

Laboratory Director through the American Board of Bioanalysis. In the future, Joseph

plans on directing a human clinical in vitro fertilization laboratory and pursuing his

research interests in ovarian tissue and oocyte vitrification and embryo metabolomics

and proteomics.


149





PAGE 1

1 MOLECULAR AND CLINICAL INVESTIGATIONS USING ANIMAL AND HUMAN SYSTEMS TO IMPROVE ASSISTED REPRODUCTIVE TECHNOLOGIES By JOSEPH MICHAEL KRAMER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Joseph Michael Kramer

PAGE 3

3 To my wife, Raeanna, who provided constant encouragement and support while I continued my studies, and to my children, Nadia and Colt, who may have slowed my writing, but through it have helped me become more tolerant and develop patience

PAGE 4

4 ACKNOWLEDGMENTS Foremost, I want to thank Dr. Kenneth Drury for his guidance throughout the process of completing this project, including reading and editing this dissertation, for the excellent scientific and intellectual training I received in his laboratory during this time, and for being there anytime I needed advice. I also want to thank Dr. Nasser Chegini for teaching me about the world of miRNAs, for providing a research opportunity to complete my scientific studies and for his suggestions and insights that helped towards the completion of this project. I would also like to thank Dr. Peter Hansen, Dr. Stan Williams, Dr. Robert Zori and Dr. Richard Scott for serving as members of my supervisory committee and for their recommendations that helped towards the completion of this dissertation. Additional thanks to all the faculty of the Animal Molecular and Cellular Biol ogy Graduate program for providing me with the fellowship to complete my graduate studies. Lastly, I would like to extend thanks to the following groups of people for assisting with this research project: All the physicians, nurses, and laboratory staff of the in vitro fertilization program at Shands hospital as well as all the members of Dr. Cheginis laboratory.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 LIST OF ABBREVIATIONS ........................................................................................... 10 ABSTRACT ................................................................................................................... 13 CHAPTER 1 INTRODUCTION .................................................................................................... 15 2 LITERATURE REVIEW .......................................................................................... 19 Use of GnRH Analogs for Controlled Ovarian Hyperstimulation ............................. 19 Ovarian Expression of miRNAs .............................................................................. 25 Protein Supplementation of In Vitro Systems .......................................................... 3 3 Cryopreservation of Blastocysts ............................................................................. 39 Preimplantation Genetic Diagnosis ......................................................................... 47 Premature Chromosome Condensation .................................................................. 55 3 COMPARATIVE EFFECTS OF GnRH AGONIST AND ANTAGONIST ON MiRNA AND GENE EXPRESSION PATTERN OF HUMAN GRANULOSA CELLS .................................................................................................................... 61 Introduction ............................................................................................................. 61 Materials and Methods ............................................................................................ 63 Experiments ..................................................................................................... 63 RNA Extraction, cDNA Synthesis and Real Time PCR .................................... 64 Statistical Analysis ............................................................................................ 65 Results .................................................................................................................... 65 The Expression of miRNAs and Their Predicted Target Genes in Granulosa Cells .............................................................................................................. 65 GnRHa and GnRHant Protocols Instigate Differential Effects on hGC miRNA Expr ession ........................................................................................ 66 Direct Effects of GnRH Analogs on miRNA and Gene Expression ................... 67 Discussion .............................................................................................................. 67 4 SUPPLEMENTATION OF F REEZE AND THAW SOLUTIONS WITH A GLOBULIN RICH PROTEIN SOURCE IMPROVES POST THAW SURVIVAL AND IMPLANTATION OF CONTROL RATE CRYOPRESERVED BLASTOCYSTS ...................................................................................................... 76

PAGE 6

6 Introduction ............................................................................................................. 76 Materials and Methods ............................................................................................ 78 Freezing and Thawing of Blastocysts ............................................................... 78 Animal Experimental Design ............................................................................ 79 Experiment 1: Effects of SSS Supplementation of Freeze and Thaw Solutions on Post Thaw Murine Blastocyst ReExpansion ............................ 79 Experiment 2: Effects of post thaw culture medium with SSS on reexpansion of murine blastocyst frozenthawed with different protein supplements .................................................................................................. 79 Experiment 3: Effects of protein supplementation in freezethaw and post thaw culture solutions on murine blastocyst reexpansion and total cell number .......................................................................................................... 80 Human Retrospective Analysis ......................................................................... 80 Statistical Analysis ............................................................................................ 82 Results .................................................................................................................... 82 Experiment 1: Effects of Supplementing Freeze and/or Thaw Solutions with SSS on Post Thaw Murine Blastocyst ReExpansion ................................... 82 Experiment 2: Effects of post thaw culture medium with SSS on reexpansion of murine blastocyst frozenthawed with different protein supplements .................................................................................................. 82 Experiment 3: Effects of protein supplementation of freezethaw and post thaw culture solutions on murine blastocyst reexpansion and total cell number .......................................................................................................... 83 Retrospective Analysis of FrozenThawed Human Blastocyst ReExpansion Using Thaw and Post Thaw Solutions Supplemented with SSS ................... 83 Discussion .............................................................................................................. 84 5 CALYCULINA IMPROVES CHROMOSOME CONDENSATION FOR CYTOGENETIC ANALYSIS OF BLASTOMERES FROM BOVINE AND MURINE EIGHT CELL STAGE EMBRYOS ............................................................ 92 Introduction ............................................................................................................. 92 Materials and Methods ............................................................................................ 94 Production of Bovine Embryos ......................................................................... 94 Harvesting Bovine Blastomeres ....................................................................... 95 Harvesting Murine Blastomeres ....................................................................... 95 Induction of Premature Chromosome Condensation ........................................ 95 Experiment 1: effects of calyculinA duration on bovine blastomeres ............... 96 Experiment 2: effects of calyculinA concentration on bovine blastomeres ...... 96 Experiment 3: effects of calyculinA on murine blastomeres ............................ 96 Experiment 4: calyculinA use for cytogenetic analysis of Day 3, eight cell stage bovine embryos ................................................................................... 96 Fixation of Blastomeres .................................................................................... 97 Analysis of Premature Chromosome Condensation ......................................... 98 Fluorescence In Situ Hybridization Analysis ..................................................... 98 Statistical Analysis .......................................................................................... 100 Results .................................................................................................................. 100

PAGE 7

7 Experiment 1: Effects of Calyculin A Duration on Bovine Blastomeres .......... 100 Experiment 2: Effects of CalyculinA Concentration on Bovine Blastomeres 101 Experiment 3: Effects of CalyculinA on Murine Blastomeres ......................... 102 Experiment 4: CalyculinA Use for Preimplantation Cytogenetic Analysis of Day 3, Eight Cell Stage Bovine Embryos .................................................... 102 Discussion ............................................................................................................ 103 6 SUMMARY, CONCLUSIONS AND FINAL REMARKS ......................................... 115 Effects of GnRH Analogs on Ovarian Expression of MiRNAs ........................ 116 Effects of Macromolecules on Embryo Cryopreservation ............................... 118 E ffects of Calyculin A on Inducing Chromosome Condensation for Genetic Analysis of Embryos .................................................................................... 120 Final Remarks ................................................................................................ 122 LIST OF REFERENCES ............................................................................................. 124 BIOGRAPHICAL SKETCH .......................................................................................... 149

PAGE 8

8 LIST OF TABLES Table page 3 1 Predicted miRNA gene targets. .......................................................................... 72 4 1 Effects of protein supplement in freezethaw solutions on murine post thaw re expansion. ...................................................................................................... 88 4 2 Effects of post thaw culture medium with SSS on reexpansion of murine blastocyst frozenthawed with different protein supple ments. ............................ 88 4 3 Effects of protein supplementation of freezethaw and post thaw culture solutions on murine blastocyst reexpansion and total cell number. ................... 83 4 4 Retrospective analysis of frozenthawed human blastocyst reexpansion using thaw and post thaw solutions supplemented with SSS ............................. 89 5 1 Effects of calyculin A duration on inducing PCC in bovine blastomeres ........... 109 5 2 Effects of calyculin A concentration on inducing PCC in bovine blastomeres. 101 5 3 Effects of calyculin A duration on inducing PCC in murine blastomeres. ......... 109 5 4 Cytogenetic analysis of blastomeres from bovine embryos treated with calyculin A ........................................................................................................ 113

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Biogenesis and functionality of miRNAs. ............................................................ 60 3 1 Overall expression patterns of miRNA in hGC and IhGC. .................................. 73 3 2 Comparative analysis of the relative expression of miRNA and predicted mRNA in hGC. .................................................................................................... 74 3 3 Comparati ve analysis of the relative expression of miRNA and mRNA targets in IhGC. .............................................................................................................. 75 4 1 Thaw survival of murine blastocysts following cryopreservation in solutions supplemented with HSA or SSS. ........................................................................ 90 4 2 Epifluorescence imaging of total cell number from a frozenthawed murine blastocyst fixed and stained with DAPI.. ............................................................. 91 5 1 Calyculin A induces PCC in blastomeres from Day 3, eight cell stage bovine IVP embryos ..................................................................................................... 110 5 2 Calyculin A induces PCC in blastomeres from Day 2, eight cell stage murine embryos ............................................................................................................ 112 5 3 Cytogenetic analysis of bovine blastomeres treated with calyculinA. .............. 114

PAGE 10

10 LIST OF ABBREVIATIONS ART Assisted Reproductive Technology ADO Allelic Dropout AMCB A nimal Molecular and Cellular Biology AMH Anti Mullarian Hormone AREG Amphiregulin BMP2 Bone Morphogenic Protein 2 BSA Bovine Serum Albumin cDNA Complimentary DNA CF Cystic Fibrosis CGH Comparative Genome Hybridization CL Corpus Luteum CLIA 88 Clinical Laboratory Improvement Act of 1988 COC Cumulus Oocyte Complex COH Controlled Ovarian Hyperstimulation CT Critical Threshold DAPI 4'6 Diamidino 2 Phenylindole Dihydrochloride Hydrate DMSO Dimethyl Sulfoxide DNA Deoxyribonucleic Acid E2 Estr a diol EGF Epidermal Growth Factor FBS Fetal Bovine Serum FET Frozen Embryo Transfer FF Follicular Fluid

PAGE 11

11 FISH Fluorescence In Situ Hybridization FSH Follicle Stimulating Hormone GnRH GonadotropinReleasing Hormone GnRHa GnRH agonist GnRHant GnRH antagonist GNRHR GonadotropinReleasing Hormone Receptor hCG Human Chorionic Gonadotropin hGC Human Granulosa Cells HSA Human Serum Albumin ICM Inner Cell Mass ICSI Intracytoplasmic Sperm Injection IGF I Insulin Like Growth Factor 1 IhGC Immortalized Human Granulosa Cell Line IVF In Vitro Fertilization IVP In Vitro Produced KO Knockout LH Luteinizing Hormone LHRH Luteinizing HormoneReleasing Hormone mRNA Messenger Ribonucleic Acid m iRNA M ircroRNA OHSS Ovarian Hyperstimulation Syndrome P4 Progesterone PBS Phosphate Buffered Saline

PAGE 12

12 PCC Premature Chromosome Condensation PCCs Prematurely Condensed Chromosomes PCR Polymerase Chain Reaction PGD Preimplantation Genetic Diagnosis PGS Preimplantation Genetic Screening PP Protein Phosphatase PAPP A Pregnancy Associated Plasma Protein A p re miRNA Precursor miRNA PVA Polyvinylalcohol RISC RNA Induced Silencing Complex RNA Ribonucleic Acid SEM Standard Error of Mean siRNA SmallInterfering RNAs SNP Single Nucleotide Polymorphism SSS Synthetic Serum Substitute T Testost erone TGF Transforming Growth Factor UTR Untranslated Region VEGF Vascular Endothelial Growth Factor WGA Whole Genome Amplification

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR AND CLINICAL INVESTIGATIONS USING ANIMAL AND HUMAN SYSTEMS TO IMPROVE ASSISTED REPRODUCTIVE TECHNOLOGIES By Joseph Michael Kramer August 2010 Chair: Kenneth C. Drury Major: Animal Molecular and Cellular Biology More than 30 years have passed since the birth of the first in vitro fertilization (IVF) baby. Since that time, advances in reproductive technologies have been remarkable. Yet with all that has been achieved so far, there is still much to be learned. To further our understanding, this dissertation investigated several aspects of IVF important to assisted reproductive medicine. The first area of investigation focused on the effects of gonadotropin releasing hormone (GnRH) analogs on granulosa cells. Important components of stimulation protocols are the suppression of endogenous gonadotropins with GnRH analogs and the timely administration of exogenous gonadotropins to promote follicular development and final maturation of oocytes for use in IVF. Central to this process is the response of granulosa cells to gonadotropins by regulating the production of steroids and growth factors during folliculogenesis. In this study, GnRH agonist and antagonist protocols we re shown to differentially affect the expression of microRNAs (miRNAs) in granulosa cells. This could have important consequences for the function of granulosa cells as these small noncoding RNAs have been shown to post transcriptionally regulate the

PAGE 14

14 expr ession of numerous genes essential for folliculogenesis, which may affect stimulation response and reproductive success. The ensuing investigation focused on the effects of globulin proteins in solutions used for embryo cryopreservation. Successful cryopreservation is dependent upon the osmoregulation of water during freeze/thaw to avoid the formation of potentially detrimental ice crystals. Globulinrich proteins, which have previously been shown to promote embryo development, have been suggested to alter the embryo microenvironment through interactions with water molecules and therefore were tested in cryopreservation solutions to improve post thaw embryo survival. Results showed more blastocysts survived, as measured by reexpansion following freezing and thawing, in solutions supplemented with globulinrich proteins compared to human serum albumin. These results indicate inclusion of globulins promotes blastocyst thaw survival, which may prove beneficial for clinical cryopreservation of embryos. The final investigation studied the effects of a protein phosphatase inhibitor, calyculin A, used to induce premature chromosome condensation (PCC) within single embryonic cells to identify a complete chromosome complement for genetic analysis. Traditional methods for analyzing chromosomal abnormalities in embryos utilize interphase fluorescence in situ hybridization (FISH), which is limited by the number of chromosomes that can be analyzed at one time. In an effort to improve these methods, this study exposed singl e blastomeres from bovine and murine embryos to calyculinA to induced PCC. Results demonstrated blastomeres underwent rapid chromatin condensation; however, the quality of condensed chromosomes was inconsistent so that application of this technology was unreliable for genetic screening of embryos.

PAGE 15

15 CHAPTER 1 INTRODUCTION Long before the birth of the worlds first in vitro fertilization (IVF) baby, sc ientific experiments using animal and later human systems, were conducted to lay the foundation for the field of assisted reproductive technology (ART). The early pioneers of this field were not just clinicians, but included reproductive biologists and geneticists whose scientific training was instrumental to overcoming the many problems of achieving fertilization and embryo development in the laboratory. Science continues to be a part of the field of ART today, but the approach is much slower because of th e presence of ever increasing regulation. Since the passing of the Clinical Laboratory Improvement Act of 1988 (CLIA 88) directors of embryology laboratories within the United States are required to hold doctorate degrees in related sciences or medicine; however, there are few academic programs of study with emphasis in embryology to educate and train persons for such positions. This dissertation is part of the requirements of a newly developed doctorate program in the Animal Molecular and Cellular Biology (AMCB) graduate program with emphasis in clinical embryology. The multidisciplinary approach of this dissertation is somewhat unconventional, covering various topics of ART, including ovarian stimulation, embryo cryopreservation and preimplantation geneti c diagnosis (PGD), but as a whole the approach provides the basis of quality control and scientific methods essential for persons seeking careers in clinical IVF. One of the most important advances in IVF has been the development of ovarian stimulation. From the beginning, the founders of clinical IVF, Patrick Steptoe and Robert Edwards, believed ovarian stimulation of multiple follicles would increase the likelihood

PAGE 16

16 of achieving a fertilized oocyte that develops to an embryo stage suitable for tr ansfer to the uterus. T his approach was briefly abandoned in favor of natural IVF cycles as none of Steptoe and Edwards patients became pregnant. Despite the success with the birth of Louise Brown in 1978 with the use of a natural IVF cycle, a few groups began to reexamine ovarian stimulation, namely Georgeanna and Howard Jones of the Norfolk IVF program and John Leeton and Alan Trounson of the Melbourne program. Amid controversy, the persistence of these groups paid off and was eventually proven to be more effe ctive than natural cycles. Today, ovarian stimulation is a hallmark of IVF and has spawned the fertility pharmaceutical industry. Among the current approaches to ovarian stimulation are the utilization of gonadotropinreleasing hormone (GnRH) analogs, GnRH agonists and GnRH antagonists, which control endogenous production of gonadotropins and prevent premature surge of lutei niz ing hormone (LH). Despite overwhelming improvements in controlled ovarian hyperstimulation (COH), the use of GnRH analogs is not without controversy as patient response and outcomes differ between agonist and antagonist protocols. Currently an explanation for t hese differences is unknown. In an attempt to help elucidate these differences, chapter 3 of this dissertation investigates the expression of messenger ribonucleic acid (mRNA) and microRNA (miRNA) in granulosa cells from IVF patients and cell lines treated with GnRH agonists and antagonists. Comparisons of patterns of mRNA and miRNA expression are warranted as results may provide insight into a potential molecular mechanism functioning within the ovary in response to GnRH analog therapy which may have profo und effects on future treatment of patients along with the development of new drug therapies.

PAGE 17

17 Another area of importance for IVF is cryopreservation of embryos. Improvements in ovarian stimulation and laboratory culture conditions often result in the production of multiple embryos of transferable quality. While in the past it was common practice for patients to receive numerous embryos, current efforts to reduce the risk of multiple pregnancy restrict the number of embryos that can be transferred. As such, following the transfer of restricted numbers of embryos there are usually at least some remaining in culture. Among the options for disposition of remaining embryos cryopreservation for future use offers perhaps the greatest benefit and is the least controversial choice for the remaining embryos. Unfortunately, early attempts at cryopreservation often resulted in poor thaw survival rates of frozen embryos, in particular at the blastocyst stage In fact, many groups abandoned blastocyst cryopreserv ation, only to revisit the technique after a few groups reported frozen embryo transfer (FET) pregnancy rates greater than 40% [1 4] A ttempts to duplicate this success have not been uniformly successful possibly due to differences in freezing and thawing protocols. Included in one of the globulins [2]. While the function of these macromolecules is unknown, they have been suggested, to alter the physiochemical environment surrounding the embryo through interactions of hydrogen bonds with water molecules [5] As osmoregulation of water molecules i s an essential component of embryo cryopreservation, chapter 4 of this dissertation investigates the use of globulinrich protein sources in freezing and thawing protocols using a murine system in an attempt to improve post thaw embryo survival. The last area of IVF investigated in this dissertation is preimplantation genetic diagnosis (PGD). This powerful tool allows testing of embryos for monogenic disorders

PAGE 18

18 or chromosomal abnormalities prior to transfer to the uterus t o thereby avoid potential miscarriages or decisions to terminate affected pregnancies. Traditional approaches to screening embryos for chromosomal abnormalities, such as s tructural rearrangements or numerical abnormalities, utilized fluorescence in situ hybridization (FISH) on fixed interphase nuclei from blastomeres removed from cleavage stage embryos. In recent years, this procedure has been an area of heated debate as pr egnancy and delivery rates of healthy children have not improved, which in theory should have increased with detection and transfer of normal embryos. A number of reasons for this discrepancy have been proposed with most focus on the utilization of FISH to diagnose a single interphase nucleus. This technique is not only limited by the number of chromosomes that can be analyzed at one time, but also has notoriously high error rates ranging up to 50% [6 11] These inefficiencies are unfortunate as the frequency of numerical chromosome abnormalities in preimplantation embryos has been reported to range from 5070% [6, 1219] Accordingly, there is a compelling need for a new technology to replace interphase FISH. A number of promising technologies have been pro posed, but each has drawbacks that must be overcome before their implementation. Chapter 5 of this dissertation discusses the investigation of premature chromosome condensation in blastomeres from bovine embryos using the protein phosphatase (PP) inhibitor calyculin A, in an attempt to produce condensed chromosomes suitable for full chromosome analysis. [20] Cytogenetic protocols for utilization of PP inhibitors in cell lines are well established and with little modification may be able to replace interphase FISH for preimplantation genetic screening of embryos.

PAGE 19

19 CHAPTER 2 LITERATURE REVIEW Use of GnRH Analogs for Controlled Ovarian Hyperstimulation Gonadotropinreleasing hormone (GnRH) is the initiator reproductive hormone responsible for maintaining the physiology and function of mammalian reproduction. As such, a vast number of hormone dependent diseases, including prostate cancer, breast cancer, endometriosis, uterine fibroids, polycystic ovarian syndrome, and precocious puberty, as well as infertility are treated with synthetic GnRH analogs to regulate reproductive hormone effects. This review will focus on the use of GnRH analogs for preventing a premature surge of luteinizing hormone (LH) during controlled ovarian hyperstimulation (COH) of infertile couples seeking in vitro fertilization. Gonadotropinreleasing hormone, also referred to as luteinizing hormonereleasing hormone (LHRH) or gonadorelin, is a decapeptide (pyroGluHis Trp Ser Tyr Gly LeuArg Pro Gly NH2) [21] synthesized in specialized neurons within the arcuate nucleus of the medial basal hypothalamus (MBH) and preoptic anterior hypothalamus [22] Following synthesis, GnRH is trans ported down axons to the median eminence where it is released into the hypophysial blood portal system. The release of GnRH appears to be under the control of a GnRH pulse generator within the MBH. In humans the pulsatile release occurs every 60 to 100 minutes, but varies across the normal female reproductive cycle [23] Upon release, GnRH binds to a seventransmembrane G proteincoupled receptor (GnRH R) localized on the plasma membrane of the gonadotroph cells within the anterior pituitary stimulating synthesis and release of the gonadotropins LH and follicle stimulating hormone (FSH) [24]

PAGE 20

20 In mammals, several isoforms have been identified for GnRH and its receptors. The typeI form of GnRH is responsible for regulating gonadotropins, while the typeII form is a neuromodulator and stimulates sexual behavior [25] Likewise, two isoforms of GnRH receptors have been identified; however, the GnRH typeII receptor has been silenced in most mammals including humans [26] The GnRH type I receptor is characteriz ed as a typical G protein coupled receptor with the exception of the absence of a carboxy terminal tail which is believed to serve an important role in the functioning of the receptor [25] Both GnRH type I and II can bind and activate the functional GnRH type I receptor [26] Activation of the GnRH receptor stimulates the phospholipase C (PhLC) enzyme cascade, which promotes the rapid formation of inositol triphosphate (IP3) and diacylglycerol (DAG) [27] The formation of IP3 subsequently mobilizes calcium which activates protein kinase C [27] This cascade culminates in the synthesis and release of gonadotropi ns LH and FSH and is controlled by the frequency of GnRH release as well as feedback by estrogen and androgens [28] Generally, low frequency GnRH leads to FSH release, and high frequency GnRH stimulates LH release. In addition, t he frequency of GnRH rel ease can have profound ef fects on availability of GnRH Rs While pulsatile GnRH release patterns stimulate the upregulation of GnRH receptors through rapid dimerization, internalization, and recycling back to the cell surface, continuous exposure to GnRH results in downregulation of GnRH R s and suppression of gonadotropins. This suppressive effect by downregulation of GnRH R s is the basis for the fundamental principal for controlling ovari an stimulation with GnRH agonists.

PAGE 21

21 The use of GnRH agonists to control ovarian stimulation by suppressing pituitary release of LH and FSH while stimulating follicular development with exogenous gonadotropins was first demonstrated in 1984 [29] Today, this procedure, although slightly modified, is the primary protocol for preventing premature LH surge in patients undergoing COH for IVF treatment. Unlike endogenous GnRH, which has a half life of 2 to 4 minutes [30] GnRH agonists are less susceptible to enzymatic breakdown and have increased binding efficiency to GnRH R. T his increase in biologically potency is made possible through substitutions of glycine at position six with D amino acids such as D Leu or D Ser found in Lupron and Buserelin, respectively [31] In addition, the replacement of the C terminal glycinamide residue by an ethylamide group can lead to a 10fold increase in GnRH R affinity [31] Together, these changes improve the effectiveness of synthetic GnRH agonists up to 200fold more than endogenous GnRH making them highly efficient for desensitizing the gonadotroph cells and causing suppression of pituitary gonadotropins. GnRH antagonists offer an alternative, opposing mechanism, for preventing premature LH surge during COH. Contrary to agonists GnRH antagonists bind to the GnRHR without inducing gonadotropin synthesis by competitively inhibiting endogenous GnRH from activating the GnRH receptor [25] Competitive inhibition is advantageous in that its effects are immediate and reversible. The p roperties of GnRH antagonists arise mainly from modifications of the N terminal region which are thought to be necessary for GnRH actions, but modifications at the pyroglutamic region (positions 1) or deletion and substitution of hydrophobic D amino acids at position 2 and 3 have also been shown to be effective in generating antagonistic effects [31]

PAGE 22

22 The protocols for GnRH agonist and antagonist are fairly standard for preventing premature LH surge in patients undergoing ovarian stimulation for IVF. The major differences between protocols are with the timing and duration of the GnRH analog treatment. Generally, with the GnRH agonist long protocol, patients receive a daily dose of a GnRH agonist following menses up to the time of trigger with human chorionic gonadotropin (hCG), which induces final oocyte maturation. Stimulation with FSH is initiated when the patient is suppressed as evident by low LH, progesterone (P4), estradiol (E2) (approximately 10 days after the first dose of GnRH agonist). Protocols using GnRH antagonists differ in that the patients are not suppressed when they begin stimulation with FSH. Instead, approximately 6 days after stimulation with FSH (or when the leading follicle reaches 14 mm in diameter) patients receive a daily dose o f GnRH antagonists (or a large single dose) to inhibit premature LH surge up to the time the oocytes are triggered for final maturation. Since the introduction of GnRH antagonist protocol s for COH [32] a number of studies have compared patient response and outcome to the GnRH agonist long protocol. Most studies have found patients treated with GnRH antagonist protocols were associated with lower gonadotropin dose requirements [33 35] shorter durations of stimulation [33 38] absence of flareinduced effects (hot flashes, headaches, sleep deprivation) and decreased risk of ovarian hyperstimulation syndrome (OHSS) [34, 3942] Studies were not in agreement in patient outcomes, however. While a number of prospective randomized trials have found no differences in pregnancy rates in patients receiving GnRH antagonists compared to agonists [33, 38, 43, 44] a few studies reported a small advantage in favor of GnRH agonists, although not statistically

PAGE 23

23 significant [34, 45, 46] In an effort to clarify these discrepancies, at least four metaanalyses have been undertaken but findings are equally conflicting. Two metaanalyses by Al Inany and Aboulghar [47] and Al Inany [48] reported significantly higher pregnancy rates after treatment with GnRH agonists. In contrast Ludwig and coworkers [41] and Daya [49] found no differences in pregnancy rates between protocols. Given inconsistencies between studies and the potential for reduced outcomes, widespread acceptance of GnRH antagonist protocols has been slow and met with resistance despite the apparent benefits with patient response. GnRH agonist and antagonist protocols have also been associated with differences in concentrations of serum hormones and steroids as well as follicular steroid concentrations. Several reports have found lower E2 [50 52] T [50] and P4 [50] in follicular fluid from patients receiving GnRH antagonist compared to agonist protocols. Ferrari and coworkers also found higher concentration of insulinlike growth factor 1 (IGF 1) [52] and vascular endothelial growth factor (VEGF) [52, 53] in follicular fluid obtained from patients receiving the GnRH antagonist protocol. In addition, they found IGF 1 and VEGF to be inversely correlated with serum LH. Based on their observations, they suggest the reduced LH release during late follicular maturation in GnRH antagonist protocols may cause a decrease in steroidogenesis in thecal and granulosa cells. While their suggestion could explain the reduced concentrations of E2, T and P4, it does not explain the obser ved increases in IGF 1 and VEGF in GnRH antagonists. Alternatively, many researchers have suggested the differences between GnRH agonist and antagonist may arise because of direct ovarian affects as receptors

PAGE 24

24 for GnRH have been localized in granulosa cells [54, 55] However, the function of these ovarian receptors remains unknown. Direct ovarian action by GnRH analogs has been reported in a number of in vitro animal and human studies. Hsueh and Erickson [56] were among the first to demonstrate reduced estr ogen production in cultured rat granulosa cells after treatment with a GnRH agonist. In humans, the direct effects of GnRH analogs on steroidogenesis of granulosa cells are controversial as no effect [57, 58] inhibitory [59] and stimulatory [60] effects have been reported. Interestingly, Bussenot and coworkers [61] tested five different GnRH agonists on steroidogenesis of human granulosa cells and found that GnRH analogs were able to differentially modulate steroid production, despite all the analogs having common pituitary effects. Based on their results, they suggested the activation and function of GnRH R differs in pituitary and ovarian cells. Recently, another study investigated the effects of GnRH analogs on the expression of CYP19A1, a key enzyme in the synthesis of E2 [62] GnRH antagonists directly suppressed CYP19A1 in cultured human granulosa cells while GnRH agonists promoted CYP19A1. Together, these studies lend support to direct and differential actions of GnRH agonists and antagonist s on ovarian cells and suggest their actions may affect expression of genes essential for ovarian function. A molecular explanation for differential regulation of gene expression by GnRH analogs remains unknown. Such findings would be of major concern as any direct ovarian effects of GnRH analogs might affect the quality of gamete maturation an d subsequent embryo development. Further research is warranted.

PAGE 25

25 Ovarian Expression of miRNAs MicroRNAs (miRNAs) are members of a newly identified class of small noncoding ribonucleic acid (RNA) molecules that function post transcriptionally to regulate gene expression. Since the identification of the first miRNA in Caenorhabditis elegans in 1993 [63] several hundred more miRNAs have been identified in various species. As of June 1st, 2010, 579, 615, and 721 miRNAs have been recorded in murine, bovine, and human databases, respectively ( www.mirbase.org ), and computational algorithms predict the existence of several thousands more t hat may regulate the expression of up to 30% of genes in humans [64, 65] The biogenesis and functionality of miRNAs is a co mplex process ( Figure 21 ). The gene sequences encoding for miRNAs are found throughout the genome and re side mainly in the intergenic regions and in a few cases in exon regions [66] In addition, promoters and regulatory units are included in many of the miRNA genes [67] MicroRNA biogenesis initially results in the synthesis of primary miRNA molecules (pri miRNA) that can range up to a two kilobases long and can also contain sequences of several different miRNAs as a result of clustering [68] The pr i miRNAs are cleaved by type III RNA endonuclease Drosha and its mammalian partner DiGeorge Syndrome Critical Region 8 (DGCR8) into 70 to 90 nucleotide stem loop precursor miRNA (premiRNA) in the nucleus [69] The premiRNAs are transported to the cytoplasm by the nucleocytoplasmic shuttle exportin 5, where they undergo a second cleavage by another RNA endonuclease, Dicer, generating a 1924 basepair long double stranded miRNA duplex [68, 70] The double stranded miRNA duplex unwinds with usually, but not always, one strand selected to function as a mature miRNA [71] The mature miRNA is then incorporated into the RNA induced silencing complex (RISC), also known as

PAGE 26

26 micro ribonucleoprotein (miRISC) complexes, which contain a number of proteins, most notably Argonaute proteins [72] The Argonautes contain RNA binding domains, PAZ and PIWI, that bind the single stranded 3 end of the mature miRNA and the 5 end of the guide strand and orient the mature miRNA for interaction with the target messenger RNA (mRNA) [72] The interaction between a miRNA and its target usually occurs in the 3 untranslated region (3UTR) of the mRNA [73] The comple mentary region of the miRNA is referred to as the seed region and contains 78 nucleotides. This small seed sequence may be complimentary to hundreds of potential mRNA targets giving rise to the diversity of gene regulation through only a few miRNA. In plants, the complementary region has nearly perfect base pairing with the target RNA [74] while in animals interaction with 2 8 nucleotides is sufficient to regulate gene expression [75] In general, miRNA binding to the complimentary target induces translational suppression by blocking assembly of 80S ribosome [76] or through inhibition of translation after initiation [7 7] However, other reports have also suggested miRNAs can cause an increase the in degradation of the mRNA target by endonucleolytic cleavage [77] similar to small interfering RNAs (siRNAs). This complexity in miRNA function may also be target gene and tis sue specific. As such, full understanding of miRNA functionality will likely take many more years of research. Currently, little is known about the role of miRNAs in reproductive tissues. To date, a few reports have identified the expression of miRNAs in the pituitary [78] ovary [79 81] testis [82] uterus [83, 84] several reproductive tissue cancers [85 87] and recently the embryo [88, 89] With regards to the ovary, several reports have identified hundreds of miRNAs in fetal and adult mouse ovaries, including several novel miRNAs

PAGE 27

27 preferentially expressed in the ovary [80] Similar studies in the cow have also identified more than 50 known and 24 novel miRNAs predominantly expressed in fetal ovarian tissue [81] Many of these miRNA are homologous to known miRNAs in other species, supporting the notion that miRNAs are evolutionary conserved [90, 91] In addition, functional studies in other tissues have shown these miRNAs to play a central role in various cellular activities, including developmental pr ocesses, cell growth, differentiation, apoptosis, cell cell communication, and inflammatory and immune responses [92 96] and therefore are likely to be involved in similar processes and pathways within the ovary. The mammalian ovary is a dynamic tissue undergoing cyclic recruitment of growing follicles, atresia, ovulation, and luteal formation and regression. These intricate events involve highly coordinated endocrine and paracrine processes to modulate cell growth, angiogenesis, steroi dogenesis, and apoptosis. C oordination is most evident in the development of oocytes and their supporting granulosa cells. Any disruption in this paracrine communication between germ cells and their supporting somatic cells could have profound effects on oocyte competence. As such, the processes of folliculogenesis are tightly regulated by the expression of numerous genes. For instance, more than 100 genes have been shown to be essential for normal folliculogenesis in the mouse [97, 98] Given that miRNAs have previously been identified in the ovary, and that they function in the regul ation of gene expression, miRNA s may play a critical role in controlling the expression of genes essential for maintaining ovarian function and avoiding disruption of folliculogenesis, ovulation and CL formation and regression.

PAGE 28

28 The biological importance of miRNAs has been well documented over the past decade through a number of studies utilizing animal models and in vitro cell culture that lack expression of the key miRNA processing protein Dicer [99, 100] Studies that generated homozygous mutant Dicer knockout (KO) embryos found they exhibited retarded growth and pregnancy declined as early as embryonic day 7.5 (E7.5) [99, 100] Furthermore, yolk sacs from E11.5 Dicer KO were thin and contained disorganized blood vessels suggesting developmental arrest was likely due to impaired angiogenesis [100] Several studies have since investigated the function of Dicer in growth and development of oocytes and embryos [101, 102] During normal fol liculo genesis, germ cells maintain steady transcription of dicer mRNA [103] ; however, after fertilization, dicer mRNA transcript decreases and remains low throughout the blastocyst stage [102, 104] During this same time, the pool of maternal mRNAs in the mature oocyte decreases throughout early cleavage, likely in part to Dicer function. Reports using conditional oocyte specific KO of Dicer suggest folliculogenesis appears normal, as evidenced by normal ovulation rates. However, oocytes are less likely to extrude polar bodies after mating, and immunostaining indicated defects in spindle formation and chromatin condensation [101, 102] Furthermore, transplanting germinal vesicles from wildtype mice into Dicer deficient oocytes resulted in similar spindle defects [101] These results suggest that meiotic de fects arise from ooplasm of the oocyte and not the germinal vesicle. The expression of Dicer has also been selectively KO in mullarian duct derivatives, including oviduct, uterus, cervix and ovary in mice [79, 105, 106] In one

PAGE 29

29 study [106] Dicer KO femal es demonstrated normal estrous cycles and successfully mated as evidenced by fertilized oocytes and blastocysts obtained from day 1 and day 3 pregnancies; however, embryos morphologically contained more fragmentation and degeneration compared to wildtype. Furthermore, Dicer KO females failed to produce live offspring. Interestingly, P4 levels were comparable for day 13 of pregnancy, but decreased thereafter. While the authors attribute the loss of pregnancy to poorly developed oviduct and uteri, reduced l uteal function could not be excluded. In a similar report, ovaries from female mice containing a hypomorph KO of Dicer (~75% loss of Dicer mRNAs) were transplanted into wildtype females and vice versa [79] In that study dicer KO females receiving wildt ype ovaries became pregnant, while wild type females receiving the Dicer KO ovaries failed to establish pregnancy despite apparent normal ovulation, fertilization of oocytes, and cleavage of resulting embryos. In contrast, serum progesterone concentrations were decreased in females with dicer KO ovaries along with reduced expression of genes essential for CL formation, including LH receptor, cytochrome p450 11a1 and prolactin receptor. Further assessment of Dicer KO ovaries revealed decreased formation of blood vessels in the CL correlated with an upregulation of angiogenic factors, TIMP1 and platelet factor 4. Computational analysis predicted that miRNAs, mir 175p and let 7b, may target these genes. Functional studies that knock ed down each miRNA in wildtype mice showed impaired CL angiogenesis and decrease d P4, similar to dicer KO females. Furthermore, the injection of mir 175p and let 7b into the ovarian bursa of dicer KO females restored the vasculature and increased P4; although pregnant females fail ed to deliver offspring suggesting other miRNAs might be involved and necessary for continuing pregnancy

PAGE 30

30 While the previous studies suggest miRNAs may function in post ovulatory events leading to infertility, another study explored the role of dicer during folliculogenesis. Using conditional KO mice lacking dicer in granulosa cells, histological analysis found inactivation of dicer led to an increase in primordial follicle endowment, accelerated early development of secondary and tertiary follicles, more degenerate follicles, and more ovarian cysts in KO animals [105] In addition, the CL in KO ovaries had abnormal vascularization including the presence of more red blood cells. Analysis of ovarian gene expression in dicer KO revealed several genes were significantly reduced by day 4 and day 8, including genes involved in activin/inhibin (inhiba) assembly, hormone synthesis (c yp 11a1, cyp17a1 and cyp19a1), granulosa cell development (Bcl2, Bax, Casp3, Ccnd2, Cdkn1b) and oocyte speci f ic genes (Zp2, Zp3, Gdf9) a s well as expression of mir 503. Functional analysis through transfection of premir 503 into primary cultured granulosa cells resulted in significant downregulation of both target and nontarget genes involved in granulosa cell proliferation and luteiniz ation. These results suggest the Dicer regulated signal pathway plays an important role in follicular cell development through differential regulation of gene expression. Although the aforementioned studies clearly demonstrate the importance of the m iRNA processing protein D icer in reproductive tissues, it remains unclear how miRNAs are themselves regulated and how their function can regulate expression of genes essential for maintaining ovarian physiology and preserving fertility. Recently, a few rep orts have investigated the regulatory effects of hormones on the expression of ovarian miRNAs [107, 108] In one study, the effects of LH surge were investigated by

PAGE 31

31 collecting murine granulosa cells from periovulatory follicles before and 4 h our s after an ovulatory dose of hCG (mimic LH) [107] Microarray analysis showed differential expression of 13 miRNA s, including mir 132 and mir 212, despite no changes in the expression of Dicer. In addition, functional assessment of mir 132 and mir 212 demonstrated g ranulosa cells transfected with specific anti mir probes and treated with cAMP to simulate the second messenger system downstream of LH/hCG differentially expressed several potential g ene targets, including CTBP1 which was recently shown to interact with steroidogenic factor 1 [109] These results suggest hormonal stimulation (LH/hCG) of ovarian tissue can regulate the expression of miRNAs, such as mir 132 and mir 212, which in turn may affect the expression of several genes important for ovulatory events, including the final maturation of oocytes, luteal formation, and steroid synthesis. A similar study recently investigated the hormonal effects of FSH on ovarian expression of miRNAs [108] In situ hybridization of murine ovarian tissue revealed select miRNAs (mir 142, let 7a, mir 125b, let 7b, let 7c, and mi R r 21) were less detectable in primordial follicles, but were readily detectable in granulosa cells from primary, secondary and tertiary follicles suggesting expression may be under hormonal regulation. Further experimentation using the murine ovarian cell line KK1 demonstrated treatment with FSH reduced the expression of mir 143, let 7a and mir 125b overtime. Based upon these results, the authors suggest FSH may regulate folliculogenesis through a network of miRNAs. Given that hormones drive follicular development and steroid production and that the expression of miRNAs has recently been shown to be affected by FSH and LH/hCG,

PAGE 32

32 and tha t defects in ovarian miRNA are associated with follicular and ovulatory dysfunction, it would be expected that ovarian miRNAs play a role in ovarian steroidogenesis. In support, a recent study using human granulosa cells transfected with a miRNA library co ntaining synthetic precursor miRNAs demonstrated differential release of P4, T, and E2 [110] Their results found transfection with 36 out of 80 tested precursor miRNAs significantly inhibited P4 release, including mir 15a and mir 188, while 10 miRNAs enha nced release of P4 Transfected miRNAs had similar effects with T (57/80 miRNAs inhibited T release, while 1 activated T release) and E2 (51/80 miRNAs suppressed E2 release, while none activated E2 release). Functional studies showed transfection with spec ific anti mir probes successfully knock ed down mir 15a and mir 188 and significantly stimulated P4 release. This study suggests that among the ovarian functions of miRNAs, they may regulate the processes of steroidogenesis. S everal studies have shown mi RNAs to have an important role in ovarian physiology. Furthermore, other studies have shown the expression of ovarian miRNAs to be influenced by the same hormones responsible for regulating ovarian function. In addition, disruption of the miRNA pathway has been found to result in ovarian dysfunction, including abnormal follicular development, meiotic maturation, luteal regression and formation, and abnormal steroid release. How these findings are related to infertile disease remains unknown. However, the cu mulative evidence suggests miRNAs play a crucial part in regulating ovarian function. As such, fertility treatments using different hormonal stimulation regimens may have differential effects on the expression of ovarian miRNAs that may affect ovarian response differently. Therefore, future studies are needed to determine if differences observed in patient response using

PAGE 33

33 different stimulation regimes may be explained through altered regulation of ovarian miRNAs. Protein Supplementation of In Vitro Syste ms Over the last few decades, advances in ART, including culture media, stimulation procedures, and intracytoplasmic sperm injection (ICSI), have brought forth an age where pregnancy rates of 60% can now be routinely achieved. While advances in each of these areas has contributed to the overall improvement of ART, improvements in culture media have perhaps had the greatest impact within the laboratory on sustaining the viability of developing embryos. This review will focus on inclusion of macromolecules i n human embryo culture media with emphasis on the development and utilization of Synthetic Serum Substitute (SSS). In the early days of IVF, practitioners relied on culture media developed for somatic cells (reviewed in detail by Summers and Biggers [111] ) Accordingly, the supplementation of embryo culture medium with macromolecules, such as serum, was also borrowed from somatic cell culture. Serum or proteins from serum were initially believed to provide some nutritional necessity for proper embryo development. Caro and Trounson [112] however, were able to demonstrate IVF and pregnancy could be achieved with embryos cultured in proteinfree conditions. This result suggested serum or other protein supplementation is not a requirement but rather acts to impr ove the performance of embryos within a culture medium [113] Additionally, early studies comparing different sources of serum as well as different lots of the same source of serum demonstrated inconsistencies within patients and batch to batch variation. It is now well recognized that serum is a complex mixture containing a number of undefined components that can vary from lot to lot resulting in unpredictable embryo development

PAGE 34

34 and pregnancy. Despite this drawback, serum, including fetal calf, maternal, and fetal cord, continued to be a major component of embryo culture media as it consistently produces greater pregnancy rates than proteinfree systems. Slowly, with improvements in embryo culture conditions, a movement grew towards the use of more defined culture components, including sources of protein, in an effort to overcome the inconsistencies in embryo culture media performance and to avoid the possibility of introducing serum contaminants. Produced from ethanol precipitation of whole serum, serum alb umin, initially from bovine (BSA) and later from human (HSA), was a more defined protein component shown to produce equivalent rates of fertilization, cleavage and pregnancy when compared to whole serum [114, 115] At the time, commercial sources of HSA were limited to plasma volume expanders licensed for intravenous infusion. Two such expanders were Plasmanate and Plasmatein. Like other plasma volume expanders, these expanders are composed predominantly of HSA, but they also contain a significant proportio globulins. Two groups set out to evaluate the use of Plasmanate and Plasmatein as embryo culture medium supplements. Plasmanate, composed of 88% normal human globulins, was studied by th e Cornell IVF program [116] Meanwhile Pool and Martin [5] studied Plasmatein, which globulins than Plasmanate. Although not directly compared, both Plasmanate and Plasmatein resulted in similar pregnancy rates. Both groups and globulins, which might be mediating their effects by binding with available water

PAGE 35

35 molecules and changing the microenvironment to one more conducive for embryonic growth. Inte restingly, despite successful fertilization and pregnancy when used as a protein supplement, neither Plasmanate nor Plasmatein were developed for use as a supplement for culture of embryos. In fact, characteristics such as the ionic strength, pH and osmolarity, were optimized for vascular physiology and not embryonic development. Weathersbee and coworkers [117] set out to overcome the drawbacks of these plasma and globulins prepared in a solution more suitable for inclusion within embryo culture media. Their efforts led to the development of Synthetic Serum Substitute (SSS; Irvine Scientific, Santa Ana, CA, USA), composed of 6% total human protein containing 84% globulins in a saline solution with a pH of 7.27.4 and an osmolarity of 275285 mOsm/kg. Since its initial development, SSS has undergone numerous animal and human studies examining its ability to support embryonic development and pregnancy. When tested with the culture of frozenthawed mouse embryos, SSS supplementation was comparable with Plasmatein and produced high rates of embryo development with 100% blastocyst formation [117] Another study using mouse embryos compared culture media performance when supplemented with either SSS or serum from patients [118] Interestingly, media supplemented with SSS produced more total blastocysts and hatched blastocysts compared to media supplemented with serum from a proven f ertile donor (83.7% vs. 39.4% and 43.2% vs. 9.1%, respectively) suggesting SSS may be clinically beneficial for IVF.

PAGE 36

36 With regards to culture of human embryos, several studies have compared media performance with SSS and other protein supplements [119 121] One study compared supplementation with SSS to Plasmanate and maternal serum for sperm preparation and oocyte and embryo culture [119] Results from that study revealed a trend towards a higher pregnancy rate and a significant increase in implantation rates with SSS compared to maternal serum or Plasmanate. Surprisingly, the rate of fertilization was lower when SSS was used for sperm preparation and insemination compared to Plasmanate. A different study compared supplemented culture media with SSS or feta l cord serum [120] In this study, there were no significant differences in rates of fertilization, pregnancy, or implantation for embryos produced in media supplemented with SSS or fetal cord serum. Yet another study compared SSS and HSA in the early cult ure of human oocytes and embryos [121] In that study, sperm, oocytes, and fertilized embryos were processed and cultured until day 2 with SSS or HSA. Fertilization rates were similar for both treatments and resulting embryos were scored with similar high quality grades on day 2. Pregnancy rate and implantation rate were reported only for the SSS group, but were comparable to the clinics previous experience with HSA. Taken together, these studies demonstrate SSS to be comparable and in some cases better tha n other protein supplements for the fertilization and development of embryos while sustaining high pregnancy and implantation rates. In addition to improving development of cleavage stage embryos, globulinrich supplements have also been tested for improvi ng extended culture of blastocysts. The importance of blastocyst development cannot be understated, especially in todays laboratory where selection of the best one or two embryos from a cohort is necessary to

PAGE 37

37 reduce the risks of multiple pregnancy. Schnei der and Hayslip [122] cultured mouse embryos to the blastocyst stage in medium supplemented with either SSS, HSA, or a mixture of globulins and HSA. Their results indicated SSS or HSA+globulins to be superior for the development of embryos to hatched blast ocysts compared to HSA alone. They also demonstrated that SSS could "rescue" hatching by transferring embryos from HSA to a globulincontaining medium. Additionally, they showed that hatching can be inhibited by removing embryos from globulincontaining me dium. Other groups have made similar observations which have led some to suggest that the transition from morula to the early blastocyst stage is marked by a critical transition phase influencing hatching [123] Whether or not this holds true, it is clear that protein supplementation during extended culture, and in particular globulinrich supplements, can promote blastocyst development and hatching. The mechanism by which macromolecules, such as globulins, enhance in vitro development of embryos is current ly unknown. The original developers of SSS suggested the growth promoting effects of globulins were predominantly physical rather than chemical [5] Central to their hypothesis is the number and orientation of hydroxyl ( OH) groups in glycoprotein macromol ecules, such as globulins, which may allow them to interact through hydrogen bonds with water molecules to alter the microenvironment [124] Interestingly, naturally occurring glycoprotein macromolecules found within the oviduct have also been proposed to modulate the microenvironment by affecting the interaction of cations, sugars and other essential substrates with the developing embryo [125] Among the macromolecules indentified in the reproductive tract include Mucus glycoproteins [mucins [126130] ] and hyaluronan [131, 132]

PAGE 38

38 Gardner and coworkers [133] have previously examined the effects of supplementing embryo culture medium with hyaluronan. In their study, they compared embryo development and implantation using culture medium supplemented with macro molecules hyaluronan, BSA, polyvinylalcohol (PVA), or dextran. The highest rates of implantation came from embryos exposed to hyaluronan. Murine [134] bovine [135] and human [136] embryos are known to have receptors for hyaluronan so the functions of this macromolecule in culture or in the oviduct are probably not limited to physical interactions with the microenvironment. N onproteinaceous macromolecules, such as PVA and dextran, are known to interact strongly with water and may provide support to a physi cal role of macromolecules such as globulins during in vitro development. Bavister [137] previously demonstrated PVA was able to replace BSA for the development of hamster and bovine embryos. In addition, a protein supplement containing a mixture of dextran and HSA [Dextran Serum Supplement (DSS);Irvine Scientific] was recently made commercially available for inclusion of embryo culture medium. Preliminary reports from the manufacturer demonstrated DSS performed equally to SSS in promoting blastocyst development. The growth promoting effects of dextran are likely similar to globulins, as both are included in intravenous volume expanders used for improving osmotic blood pressure. As such, it is conceivable to think that these macromolecules interact with minu te amounts of water in the embryo microenvironment much like the way they help to maintain water volume in the vasculature. In doing so, these macromolecules could be altering the physical interactions of the preimplantation embryo with its microenvironment which may enhance biological effects.

PAGE 39

39 Alternatively, one could argue that there may be some unknown chemical interaction responsible for the enhanced performance of embryo culture media when supplemented with protein macromolecules. The processes of prot ein purification are not absolute and consequently, trace amounts of embryotrophic peptides, such as growth factors, could be present within the processed macromolecules and be responsible for the improved embryonic potential. Since their first introduction, macromolecules have played an integral role in the improvement of embryo culture media. Numerous reports have shown enhanced potential of embryos when cultured in the presence of macromolecules. Most notably are globulins, w hich are now commercially available as supplements for embryo culture media as SSS or Serum Protein Supplement (SPS; Sage In Vitro Fertilization, CT). While the mechanism remains unknown, the enhanced embryonic potential derived from the inclusion of these macromolecules has no doubt helped improve the overall success rates of ART. With the advent of culture medium rich in hyaluronan (EmbryoGlue,Vitrolife, Englewood, CO) and dextran, as well as the availability of recombinant HSA, it will be interesting to see if greater understanding of the interaction between macromolecules and embryos in culture media will explain enhanced viability. Perhaps one day, proteinfree culture media will be developed that support embryo growth as effectively as or even better t han current available media. Cryopreservation of Blastocysts The Successful cryopreservation of mammalian embryos was first demonstrated in 1972, when Whittingham and coworkers [138] obtained live offspring following the transfer of frozenthawed mouse morula. A year later, these techniques were applied to domestic animals, most notably cattle [139] In humans, the first pregnancy was

PAGE 40

40 reported by Trounson and Morh [140] in 1983, following transfer of a frozenthawed eight cell embryo. Shortly thereafter, C ohen and coworkers reported successful cryopreservation of human blastocysts [141] Today, the importance of blastocyst cryopreservation is greater than ever before as improvements in extended embryo culture often result in the production of more blastocy sts than can be transferred to the patient. Consequently patients must make a decision on the disposition of remaining embryos, such as cryopreservation for future use, donation to an infertile couple, donation to research, or discard. Among the choices, d onating for research or discarding remaining embryos are controversial and many patients and laboratory personnel have ethical concerns. Alternatively, cryopreservation for future use and donation to an infertile couple, offer perhaps the greatest benefit and are the least unethical solutions; however, both require the laboratory to be proficient at freezing and thawing embryos. This review will focus on current concepts of blastocysts cryopreservation. The principals of cryopreservation have been well documented [142, 143] and understanding their fundamentals is essential for gaining insight into the cellular and molecular changes occurring in embryos during the freezing and thawing process. During freezing, decreasing temperatures eventually cause extracellular water molecules to transition from a liquid into a solid, generally in the form of ice crystals. The osmolarity of the remaining solution surrounding the embryo then increases as the ratio of free water to salts decreases. This increase in salt concentration in the extracellular environment causes osmoregulatory mechanisms, including diffusion and active transport, to drive water out of cells leading to dehydration. If this process is controlled

PAGE 41

41 by a slow rate of freezing, then the formation of ext racellular ice is harmless. Conversely, if the temperature cools too quickly, then cellular water will transition into intracellular ice crystals before the cell is dehydrated. The formation of intracellular ice, in contrast, can damage cytoskeletal struct ures thereby affecting the integrity of cell membranes. Fortunately, problems associated with intracellular ice formation can be reduced with the aid of cryoprotectants. Theses chemical compounds incr ease the total concentration of all solutes in the system, thereby reducing the amount of ice formed at any given temperature. In addition, some cryoprotectants, such as glycerol, propandiol, ethylene glycol and dimethyl sulfoxide (DMSO), increase cell membrane permeability thereby allowing water to diffuse out of the cell more rapidly. As such, the inclusion of cryoprotectants, along with controlling the rate of cooling, are important steps in all freezing protocols. During the thawing pr ocess, the transition from a frozen to an aqueous state must occur faster than the rate at which the embryos were originally frozen. The reason for this difference is that slow warming puts cells at a greater risk for ice crystal reformation or recrystal lization which can lead to membrane damage [142] In contrast, during rapid warming there is insufficient time for recrystallization, and any ice crystals melt away [142] Upon thaw, permeating cryoprotectants need to be promptly removed to again avoid t oxic injury. Exposure to lower concentrations of cryoprotectants causes the osmotic uptake of water at a faster rate than the diffusion of cryoprotectants out of the cell [142] This causes cells to swell above their initial volume. As cells are generally

PAGE 42

42 more sensitive to swelling than shrinking, removal of cryoprotectants tends to be more hazardous than their addition. With an understanding of the general principles of freezing, embryologists have been able to attain good success from cryopreservation of zygotes and early cleavage stage embryos. The cryopreservation of blastocysts, however, has been more challenging as early results were marred with poor rates of post thaw survival. It was almost 20 years between the first reported pregnancy from a froz en blastocyst [141] to when Veeck and coworkers [2] reported high clinical pregnancy rates from frozen blastocysts. In the interval many groups had abandoned blastocyst cryopreservation. Eventually though, with improved extended culture conditions, several groups began to revisit blastocyst cryopreservation and reported pregnancy rates greater than 40% following frozen embryo transfer (FET) [1 4] Unfortunately, many other programs have not been able to attain similar successes [144149] The differences i n thaw survival of early cleavage stage embryos and blastocysts suggest blastocysts have unique properties which may require further optimization of freezing and thawing procedures. Those groups that reported high rates of success may have, unbeknownst to them, managed to highlight some differences that are necessary for attaining good post thaw survival. There are at least two differences between blastocysts and cleavage stage embryos that may factor into cryopreservation success rates. For one, the cells of the trophoblast and inner cell mass (ICM) are much smaller compared to cells from an early cleavage stage embryo. This size difference would mean the cell volumes from blastocysts should contain less water, which would otherwise be thought to be an

PAGE 43

43 adv antage, as cells from blastocysts should be at reduced risk for intracellular ice crystal formation. However, it i s plausible that the permeability of cells from the trophoblast and/or ICM differ compared to cells from early cleavage stage embryos because of their reduced size or differentiation, which may affect the rate of exchange of cryoprotectants and water. Another difference that may contribute to the lower thaw survival of blastocysts is the presence of the blastocoele. This fluid filled cavity, if not dehydrated, may lead to the formation of ice crystals within the cavity. While these crystals would not be intracellular, the shear forces that they exert within the blastocyst may damage extracellular structures and interconnections between cells, as observed in the cryopreservation of multicellular organs and tissues [150 152] Another possibility is that the blastocoele cavity itself may affect the permeation of the cryoprotectants, especially with cells of the ICM, and this may lead to highly damagi ng intracellular ice crystal formation within those cells. Overtime, a number of different approaches have attempted to further optimize blastocyst cryopreservation protocols. The most notable studies include investigations into changing the start temperat ure and cooling rate [153] artificially shrinking the blastocoele cavity [154, 155] incorporating macromolecules into cryo solutions [156, 157] and more recently vitrification [3, 4, 158] Gardner and coworkers [153] set out to determine the effects of start temperature and cooling rate of slow freezing protocols on blastocyst viability. Using human blastocysts donated for research, they tested freezing with a start temperature of 6 and a cooling rate of 0.5 minute compared to a more traditional control rate that starts at 20 6 minute After

PAGE 44

44 thawing, blastocyst s frozen with the lower start temperature and slightly faster cooling rate had a thaw survival rate of 75% compared to 15% for the more traditional protocol. Based on these results, they applied the lower start temp erature and faster cooling rate clinically, and they were able to attain a 69% thaw survival, 60% ongoing pregnancy rate and 30% implantation rate. The authors conclud ed that the shorter protocol increased thaw survival likely by reducing the duration that the blastocysts wer e exposed to toxic cryoprotectants. Interestingly though, other groups using the traditional longer protocol have reported high thaw survival and pregnancy rates [2, 3] suggesting other factors may also improve blastocyst cryopreservation. Recently, several groups have investigated vitrification of blastocysts as a means to improve thaw survival. Vitrification differs from traditional slow control r ate freezing in that blastocysts are directly plunged into liquid nitrogen causing a rapid decrease in temperature producing a glass like state without icecrystal formation [159] The theory is that if done properly, vitrified embryos are not at risk for injury from ice crystals [160] and therefore should have higher survival rates. Additional advantages of vitrification technology are that expensive control rate freezers are not needed, the duration of the freezing and thawing procedures are much shorter and that the same protocol can be applied to all stages of embryonic development, including oocytes [161] Currently, several groups have reported high rates of survival and pregnancy following vitrification suggesting the technology holds tremendous promise [3, 4] ; however, differences in vitrification protocols, including solutions and storage containers, have made the technology difficult to reproduce by inexperienced groups. Complicating the matter is that concentrations of cryoprotectants are much hi gher than in traditional freezing

PAGE 45

45 protocols requiring laboratory personnel to work within time constraints to avoid toxicity. Eventually, when the protocols become more uniform and laboratory personnel become more experienced, this technology will replace traditional freezing methods. In the meantime, as some of the freezing principals such as the osmoregulation of water and cryoprotectants apply to both vitrification and traditional control rate freezing, it will be interesting to see if other factors th at improve control rate thaw survival also help improve survival f ollowing vitrification Several groups have investigated the effects of artificially shrinking the blastocoele cavity prior to freezing, which might reduce the risk for ice crystal format ion and potential injury. Three different approaches to artificially shrink the blastocoele cavity have all resulted in improved blastocyst thaw survival, including puncture with a needle [154, 155, 162] micropipetting [163] and laser [162] These report s, however, were using vitrification technology, and their effects may be limited to that technique. While no study has reported on artificially shrinking of blastocysts frozen by control rate methods, a study comparing the natural osmotic shrinkage of blastocysts in cryo solutions using control rate freezing reported a 73% thaw survival rate from blastocysts that underwent blastocoele collapse compared to a 33% thaw survival from those that did not collapse [164] Together these studies suggest that the bl astocoele cavity or fluid within negatively effects thaw survival, but also those blastocysts that are able to undergo osmotic shrinkage are more likely to survive. Macromolecules are routinely incorporated into freezing and thawing solutions. Proteinaceous macromolecules, such as albumin [165] have been shown to improve thaw survival of blastocysts. Today, almost all embryo cryopreservation solutions

PAGE 46

46 contain twice the amount of albumin than found in standard culture medium, as doubling the concentration o f albumin increases thaw survival [165, 166] Another macromolecule, hyaluronan, which is known for its promoting effects on development and implantation of fresh embryos [133, 167] has also been shown to increase blastocyst thaw survival. Several studies have demonstrated enhanced thaw survival and development of blastocysts for embryos cultured with hyaluronan [167, 168] In addition to embryo culture, Palasz and coworkers [157] f ound that replacement of newborn calf serum with hyaluronan in freezing medium resulted in similar high rates of thaw survival of bovine blastocysts. While studies such as these demonstrate benefits of macromolecules in cryopreservation, the mechanism by w hich these compounds affect thaw survival is unknown. Interestingly, nonproteinaceous macromolecules, such as dextran and ficol, have also been shown to improve thaw survival [156] suggesting the mechanism may be physical rather than biological. Although not directly tested on thaw survival, protein supplements rich in globulin macromolecules have been incorporated into many of the most successful cryopreservation protocols, including slow control rate [2] and vitrification [4] of blastocysts. Pool and Martin [5] suggested that globulins mediate their effects by interacting with water molecules thereby changing the microenvironment surrounding the embryo. As such, it i s conceivable that macromolecules alter the physiochemical environment during freezing and thawing and by doing so improve the embryos ability to handle osmoregulatory stress. This action could reduce the risk for icecrystal formation during freezing and also facilitate rehydration and removal of cryoprotectants during thawing. As reduced ri sk to ice crystal formation could improve thaw survival,

PAGE 47

47 future studies are needed to determine the effects of globulinrich sources on thaw survival. Preimplantation Genetic Diagnosis Preimplantation genetic diagnosis (PGD) is a powerful tool used to test individual embryos for genetic abnormalities. This technology is more favorable than prenatal testing as embryos are screened prior to transfer to the uterus avoiding potential miscarriages and termination of affected pregnancies. The first demonstrat ion of preimplantation genetic testing occurred in 1968 with the sexing of rabbit embryos [169] Many years later, after the development of clinical IVF and polymerase chain reaction (PCR), Handyside and coworkers [170] applied sex selection to human embry os from couples at risk for transmitting an X linked disorder. Two years later, the same group applied the technique to test for cystic fibrosis (CF) [171] Since then, preimplantation embryos have been tested for hundreds of monogenic disorders, structural and numerical chromosomal defects, mitochondrial diseases [172] and human leukocyte antigen (HLA) matching [173] This review will cover historical and current concepts of PGD with emphasis on testing embryos for structural and chromosomal defects. P reimplantation testing begins in the IVF laboratory with the biopsy. There are three potential sources of genetic material for testing and each has its own set of advantages and disadvantages. The earliest source of genetic material can be obtained by biopsy of the preconception first and post conception second polar bodies. As meiotic products of oogenesis, the contents of the polar bodies can be used to indirectly make inferences about the genetic composition of the oocyte [174] The advantage of this met hod is that the risk to the mature oocyte or the fertilized zygote is low because genetic material is not removed from either source. The downside is that only the

PAGE 48

48 maternal genetic contribution to the embryo can be analyzed. As such, this method of biopsy is rarely used. Another source for biopsy is blastomeres from day 3 cleavage stage embryos. Embryos at this stage are generally composed of 68 blastomeres. In theory, each blastomere should be representative of the genetic composition of the whole; although in practice this is not always true do to the inherit mosaic nature of embryos (discussed in more detail later) [175] The procedures for removal of a single blastomere are simple, and the potential risk of injury is small relative to the genetic benef it. As such, removal of a single cell from a cleavage stage embryo is currently the preferred method of biopsy by most programs. The last potential source of genetic material comes from the trophoblast. Removal of 510 cells from the outer layer of the bl astocyst, if done properly, is considered to pose little risk to the inner cell mass that will eventually become the embryo proper. The main advantage is that genetic analysis of multiple cells reduces the risk for misdiagnosis. The problems with the procedure are that the biopsy is technically challenging, time constraints for genetic analysis usually require the biopsied blastocysts to be cryopreserved, and there is concern that embryos that autocorrect by allocating abnormal cells to the trophoblast may be misdiagnosed [176] For most laboratories, these risks currently outweigh the potential benefits. Perhaps in the future, with the development of rapid genetic tests and/or better cryopreservation techniques, this will become the preferred biopsy method. For traditional testing of monogenic disorders, such as CF, Duchenne muscular dystrophy and Huntingtons disease, the biopsied samples are simply loaded into micro

PAGE 49

49 tubes and shipped overnight to a PGD laboratory for analysis. The single most technicall y challenging aspect for the PGD laboratory is making a genetic diagnosis from as little as one copy of the genome. PCR has traditionally been used to amplify the genes of interest to detectable levels. Initially, amplification inefficiencies limited the p ractical use of PCR. One of the most common occurrences was failure of one of the two target alleles to amplify (referred to as allelic dropout; ADO) which may lead to misdiagnosis, especially in dominant disorders. Fortunately, numerous strategies have si nce been developed to overcome ADO [177] Today, PCR for monogenic disorders has an accuracy of greater than 99% [178] making this technology invaluable in avoiding the transfer of embryos with potentially lifealtering genetic disorders. Testing of preim plantation embryos for structural and numerical chromosomal abnormalities is traditionally done with fluorescence in situ hybridization (FISH). Prior to FISH, the biopsied cell must be fixed to a glass microscope slide. The fixation process is challenging and has been an area of concern for many years [179] Complicating the procedure is that blastomeres are most frequently found in the interphase stage of the cell cycle. As such, nuclear chromatin must be carefully fixed to allow hybridization without over lapping or distortion of probe signals. Once fixed, the nuclear chromatin is hybridized with chromosome specific DNA probes labeled with different colored fluorochromes. Currently, only 56 colors are distinguishable at any given time, limiting the number of chromosomes that can be analyzed with a single hybridization. This, combined with the analysis of interphase nuclei, complicates preimplantation screening of structural and numerical chromosomal defects.

PAGE 50

50 Couples in which one of the partners carry a bal anced translocation are at high risk for the resulting embryos to have structural abnormalities; reportedly 72% for Robertsonian translocations and 82% for reciprocal translocations [180] Since the majority of these structural abnormalities result in misc arriage, there is a strong need to screen individual embryos prior to transfer to the uterus. Fortunately, FISH with as few as three probes can be used to screen against structural abnormalities associated with most reciprocal and Robertsonian translocations [181] regardless of whether the biopsied cell is in interphase. The downside to interphase FISH for structural abnormalities is that the method cannot distinguish between a normal and balanced chromosome complement [182] In addition, hybridization fai lure of a single probe may result in misdiagnosis and the transfer of a potentially lethal embryo. The only way to overcome such limitations with FISH would require analysis of condensed chromosomes enabling detection of the breakpoints. The frequency of numerical chromosome abnormalities in preimplantation embryos has been reported by multiple studies to range from 5070% [6, 12 19] However, the frequency of aneuploidy determined by prenatal analysis is not nearly as high. One possible explanation for this discrepancy is that the majority of preimplantation embryos are aneuploid and developmentally arrest before reaching the prenatal stage. Preimplantation genetic screening (PGS) is a procedure of PGD capable of detecting chromosome copy numbers. Theoretically, the culling of embryos containing numerical chromosomal abnormalities, such as monosomies or trisomies, and the transfer of embryos identified as euploid should improve implantation rates and decrease the frequency of miscarriage. As such, there is a tremendous need for PGS.

PAGE 51

51 Unfortunately, traditional methods of PGS using interphase FISH have a number of drawbacks making its use for improving IVF outcomes debatable. Among the problems with interphase FISH are the limitations of the number of chromosomes that can be screened. PGS protocols typically screen a maximum of 9 to 12 chromosomes, but require multiple rounds of hybridizations to do so. This is a concern as previous reports have associated multiple rounds of FISH with increased error rat es [183] To limit the risk of error, only the most common chromosomes affected by aneuploidy (22, 16, 21 and 15) [184] as well as those in which trisomies are capable of reaching live birth (13, 18, 21, X and Y) are typically screened with PGS. However, t his equates to fewer than half of all chromosomes being screened for potential numerical abnormalities. An additional problem with PGS is the reportedly high error rate estimated to range from 4 to 50% [6 11] Most often, the contributing factor affecting error rates is the quality of the fixed chromatin. Problems associated with poorly fixed nuclei include: damaged/lost chromatin, probe hybridization failures and misinterpretation of probe signals [179] Ultimately, these errors can result in the labeling of a normal embryo as abnormal or labeling of an abnormal embryo as normal. While both outcomes are unacceptable, the later could have profound effects if the embryo is trisomy for 13, 18, or 21 and is transferred back to the uterus. As such, there is an urgent need for the development of alternative approaches for determining numerical abnormalities in preimplantation embryos. Yet another problem with PGS is mosaicism. Mosaic embryos are those where chromosome number differs between cells within the same embryo. For example, some

PAGE 52

52 blastomeres could be diploid and others aneuploid. This phenomenon is believed to be caused by mitot ic errors in comparison to traditional aneuploidy that is thought to be caused by meiotic errors [185] The frequency of mosaicism is estimated to range from ~25 60% [14, 175, 186, 187] however, these estimates are likely confounded by the error rate of i nterphase FISH. On the other hand, the error rate of FISH may be overestimated because of mosaicism [188] Several alternative approaches to traditional PGS have been proposed, including comparative genome hybridization (CGH) [189] induced metaphase FISH [190, 191] and more recently microarray [192] The application of CGH for analysis of blastomeres was first demonstrated by Wells and coworkers in 1999 [189] This procedure works by comparison of the test DNA with known reference DNA. Both test and reference DNA samples are labeled with different color fluorochromes and then hybridized to a previously fixed set of metaphase chromosomes on a microscope slide. Computerized imaging systems examine fluorescent intensities of the test DNA and the reference DN A to determine chromosome copy number. The main advantage of CGH over interphase FISH is that the copy number of all chromosomes can be determined. In addition, CGH provides coverage of the entire length of each chromosome, enabling the detection of potent ial breakpoints in translocations. However, CGH cannot distinguish euploid from ploidy errors, such as haploid, triploid or tetraploid. In addition, traditional CGH is labor intensive and generally takes 35 days to yield results [193] requiring the embry os to be frozen which may compromise the overall success. Another limitation is that CGH is not sensitive enough to work with a single cell, requiring whole genome amplification (WGA). Traditional WGA methods, including degenerate oligonucleotide primed PC R

PAGE 53

53 (DOP PCR) and primer extension preamplification (PEP), were often found to unevenly amplify the genome complicating CGH analysis. Only, recently with a newly developed and more efficient methods for WGA is there renewed interest in CGH [194, 195] ; however, even with this improvement the overall length of the procedure remains too long for clinical application of PGD. Another alternative approach to PGS with interphase FISH is the application of DNA microarray technologies. Recently, CGH arrays and s ingle nucleotide polymorphism arrays (SNP arrays) have been proposed for full chromosome analysis of preimplantation embryos. CGH array is somewhat similar to traditional CGH, requiring WGA and competitive hybridization of labeled test DNA and reference DN A to thousands of chromosome specific probes spotted on the surface of a slide [196] Hellani and coworkers [197] recently reported clinical use of CGH array for PGS aneuploidy screening. In that study they were able to detect chromosomal abnormalities in 60% of the embryos. Selection and transfer of euploid embryos in 5 out of 6 patients resulted in pregnancy. Despite their success, the WGA was not robust and required the removal of two blastomeres to attain a reproducible result with CGH array. This is a major concern as the removal of more than one blastomere has previously been suggested to impact embryonic potential [198] An additional concern is that no study has validated the accuracy single cell CGH array for aneuploidy testing calling into question its clinical application. SNP array methodology is similar to CGH array, but the test DNA following WGA is hybridized to thousands of SNPs instead of chromosome specific probes. Recently, Treff and coworkers [199] validated single cell 24 chromosome aneuploidy screening

PAGE 54

54 using cell lines with known karyotypes demonstrating a 96% success rate of obtaining a reliable result. In addition, they demonstrated the technique could be applied to single blastomeres from cleavage stage embryos with high rates of concurrence. While that study did not analyze any transferrable embryos, a similar report by the same group used SNP array to successfully DNA fingerprint and molecular karyotype blastomeres from sibling embryos prior to transfer [200] Based on the studies to date, SNP array has perhaps the most potential for not only improving assessment of chromosomal abnormalities, but also for improving IVF laboratory performance through sibling embryo investigations of laboratory culture components. The current downside to SNP array is that the chips are very expensive. Eventually though, as chips become more competitively priced, the potential benefits will outweigh the costs and make SNP array a very attractive technology for improving ART. As the previously mentioned technologies are currently limited for PGS, an older but slightly modified approach to induced metaphase FISH may be beneficial. Previous studies by Verlinsky and Evsikov [190, 201] demonstrated the fusion of a mouse zygote with a blastomere from a cleavag e stage human embryo could drive the chromatin in the blastomere into mitosis making it possible to do 24 chromosome analysis. Similarly, Willadsen and coworkers [191] demonstrated a bovine metaphase II oocyte could be fused to a blastomere from cleavage s tage human embryo to induce condensation of chromosomes suitable for karyotyping in 74% of blastomeres. This conversion rate is much greater than the 30% reported after overnight culture with cytoskeletal inhibitors, such as colcemid [202] However, the im proved rate of obtaining metaphaselike chromosomes is not high enough to warrant clinical application for PGS. One possible

PAGE 55

55 way to potentially increase this rate may be with the incubation of potent protein phosphatase (PP) inhibitors, such as calyculinA or okadaic acid, which have been shown to rapidly induce premature chromatin condensation (PCC) in cell lines suitable for cytogenetic analysis [20] Protocols for PP inhibitors are well established for cell lines and should require little modification for application to blastomeres. If PP inhibitors can be used to obtain high conversion rates of metaphaselike chromosomes suitable for karyotyping, then this technology could replace interphase FISH for PGS or at least until other approaches come to fruition. Premature Chromosome Condensation Visualization of chromosomes only occurs during the brief mitotic or meiotic stage of the cell cycle. Through the intermiotic (or interphase) period, which can range up to 40 hrs for cultured animal cells, chromosomes remain diffuse and indistinguishable from the nucleus. This long period makes studying chromosomes difficult as few cells at any given time will contain visible condensed chromatin. Overtime, researchers have developed methods to trap or induce chromatin condensation within cells opening the way for more detailed studies of chromosomal rearrangements and aneuploidies. This review will focus on the use of premature chromosome condensation (PCC) for assessment of chromosomal abnormalities. Premature condensation of chromatin was first described in the 1960s by several groups that fused cells at different stages of the cell cycle [203 205] Based on similar observations, Rao and Johnson [206] suggested that advanced entry of a nonmitotic cell into mitosis (M phase) might have been caused by fusion with a mitotic cell containing some factors that induce chromatin condensation. These observations led them to perform additional experiments in which mitotic cells blocked with colcemid

PAGE 56

56 were fused with cells synchr onized to G1, S, or G2 phase of the cell cycle [207] Fusion of M phase and interphase cells resulted in rapid chromosome condensation within 30 minutes. This induction of condensed chromatin from an interphase cell was termed premature chromosome condensation [207] From their experiments with fused synchronized cells, they were able to determine that cells from the G1, S, or G2 phase, when induced into PCC, resulted in distinct patterns of condensed chromatin. Prematurely condensed chromosomes (PCCs) from G1 cells consist of single chromatids indicating the unreplicated state of the genome. Several studies have further analyzed changes in the morphology of PCCs at different points in the G1 phase [208, 209] These studies revealed a progressive decondensation of chromatin as cells progressed toward the DNA synthetic period. The PCCs of a cell at the beginning of the G1 phase are relatively short and well condensed. In comparison, the PCCs from later in G1 are much longer and more attenuated. Induction of PCC in an S phase cell results in uneven condensation of chromatin. As chromosomes replicate at different rates, the PCCs of an S phase cell can contain a mixture of single chromatids, double chromatids, or finely pulverized chromatin, depending on r eplication. Whereas single chromatids represent chromosomes still within G1 that have not begun replication, double chromatids represent chromosomes that have completed replication. PCC of chromosomes in the process of replication appear as pulverized piec es of chromatin. These observations can be explained by the molecular model for DNA synthesis that indicates bi directional replication occurring at multiple sites across the chromosome. As such, each piece of pulverized chromatin represents a region that was undergoing replication.

PAGE 57

57 PCCs from cells in G2 phase resemble mitotic chromosomes during prophase. The G2 PCCs consists of two chromatids that are usually attached to each other, but are slightly longer than prophase chromatids. The extended nature of G2 PCCs likely represents the conformational state of chromatin at that point in the cell cycle. Although chromosomes induced by PCC have some resemblance to M phase chromosomes, there are differences. The major difference between PCCs and M phase chromos omes is the degree of condensation. PCCs from G1 and G2 nuclei are not as condensed as M phase chromosomes. As such, G banding or C banding G1 and G2 PCCs are less intensely stained than metaphase chromosomes. In addition, some G2 PCCs appear to have extra bands, which only become visually separated in the elongated G2 PCCs [210] Over the last couple of decades, the mechanism responsible for chromosome condensation has become clearer with the understanding of factors regulating the onset of mitosis. Centra l to the initiation of both mitosis and meiosis is maturationpromoting factor (MPF; also referred to as mitosis promoting factor or M Phasepromoting factor ). MPF is a heterodimeric protein composed of cyclindependent kinase p34cdc2 and cyclins A and B [211] Kinase p34cdc2 is present in growing cells throughout the cell cycle, but is only activated when bound by cyclin B at G2/M phase [212] In addition, the activation of kinase p34cdc2 requires phosphorylation of threonine 161. The kinase activity is d irected towards serine and threonine residues in histones [213] Conversely, in interphase, kinase p34cdc2 is phosphorylated on threonine and tyrosine residues resulting in inhibition of kinase activity. At the G2/M transition, these residues are

PAGE 58

58 dephosphorylated allowing kinase activity to appear, resulting in entry into M phase [211] Insight into the mechanism regulating the onset of mitosis has been applied to developing new methods for inducing PCC. Investigations of several chemical compounds, includi ng the protein phosphatase (PP) inhibitors okadaic acid, fostriecin, and calyculinA, have shown their ability to rapidly induce PCC [214, 215] While the exact mechanism is unknown, these chemical compounds are believed to facilitate PCC through activation of kinase p34cdc2 and inhibition of histone PP [216] Interestingly, the inhibitory effects are not the same for all PP inhibitors. Whereas okadaic acid, fostriecin, and calyculinA are all strong inhibitors of PP type 2A (PP2A), okadaic acid and fostrie cin are weak inhibitors of PP type 1 (PP1). In contrast, calyculinA is a strong inhibitor of both PP1 and PP2 and therefore, has been suggested to be a more potent inducer of PCC. Chemical approaches with PP inhibitors offer several advantages over tradi tional cytogenetic methods of colcemid block or PCC by cell fusion. Compared to cell fusion methods which are difficult and laborious, chemical methods can be applied directly to cultured cells and induce PCC within a few hours. In addition, PP inhibitors result in much higher rates of PCCs (>20%) compared to traditional M phase from colcemid block treatments (usually 12%) [217] A number of reports have successfully shown these chemical compounds to rapidly induce PCC suitable for studying chromosomal aberrations [214, 218221] One area in particular where PP inhibitors may prove beneficial is for inducing condensed chromosomes suitable for preimplantation genetic screening for numerical

PAGE 59

59 or structural chromosomal abnormalities. The traditional method for PGS uses interphase FISH, which is limited to analysis of 56 chromosomes per hybridization and a maximum of 912 total chromosomes, therefore making it impossible to perform 24 chromosome analysis. In addition, detailed analysis of chromosome breakpoints is not possible with nuclear chromatin found in interphase cells prohibiting distinction of normal and balanced translocations. In an effort to overcome these limitations of interphase FISH, Evsikov and Verlinsky [201] treated blastomeres from human cleavage stage embryos with okadaic acid; however, blastomere incubation in the presence of okadaic acid resulted in only a 22% conversion rate of condensed chromosomes. In most cases, okadaic treatment had no effect on the interphase nucleus. These results were too low for use in PGS. More potent PP inhibitors, such as calyculin A, may prove to be more effective and therefore more research is needed to determine the efficacy of calyculinA for inducing PCC of blastomeres because this treatment may become a suitable alternative to the current methods of PGS using interphase FISH.

PAGE 60

60 Figure 2 1 Biogenesis and functionality of miRNAs.

PAGE 61

61 CHAPTER 3 COMPARATIVE EFFECTS OF GNRH AGONIST AND ANTAGONIST ON MIRNA AND GENE EXPRESSION PATT ERN OF HUMAN GRANULO SA CE LLS Introduction Gonadotropinreleasing hormone (GnRH) agonists (a) and antagonists (ant) are used in controlled ovarian hyperstimulation (COH) to suppress premature luteinizing hormone surge in patients undergoing in vitro fertilization (IVF). GnRHa acting through GnRH r eceptor (GnRHR) induces a brief flare of gonadotropins from the pituitary while prolonged administration of a high dose of GnRHa results in suppression of gonadotropins through internalization of available GnRHRs [222] In contrast, binding of GnRHant to G nRHRs induces an immediate competitive inhibition of GnRHR resulting in a rapid suppression of gonadotropins [223] Although controversies exist with regard to differences in IVF outcomes, GnRHant use provides some advantages over GnRHa such as lower gonadotropin dose requirements, shorter duration of stimulation [37] absence of flareinduced effects and decreased risk of ovarian hyperstimulation syndrome (OHSS) [40, 41, 47, 224] Several studies have demonstrated changes in follicular fluid (FF) concentra tions of steroids [51, 52] vascular endothelial growth factor (VEGF) [53] and insulinlike growth factor 1 (IGF I ) [52] to account for differences between the action of GnRH analogs. Although a molecular mechanism to explain the differences in the production of these factors is unknown, GnRH analogs have been considered to directly act and differentially regulate their expression through ovarian receptor mediated mechanisms. As such, the expression of GnRH and GnRHRs have been documented in several extrapitui tary tissues, including the ovary [54] supporting GnRH local ovarian function. Experiments using cultured granulosa cells have shown GnRH analogs to modulate

PAGE 62

62 steroidogenesis [61] with GnRHant suppression of aromatase expression, the key enzyme responsible for E2 biosynthesis [62] Taken together, these observations imply that GnRH analogs can directly act on ovarian cells; however, the extent to which these analogs affect ovarian function remains to be elucidated. MicroRNAs (miRNAs) are members of a famil y of small nonprotein coding RNAs that function as key regulators of gene expression. Several thousand miRNAs have been identified and/or predicted and are estimated to target the expression of 30% of genes in humans at post transcriptional/translational levels [225, 226] Functionally, miRNAs play a central role in various cellular activities, including developmental processes, cell growth, differentiation, apoptosis, cell cell communication, and inflammatory and immune responses [92 96] Aberrant express ion of specific miRNAs has been associated with developmental abnormalities, disorders of inflammatory and immune response, infection and tumorigenesis. Furthermore, conditional inactivation of Dicer, a poll II enzyme necessary for miRNA processing, has been shown to impact ovarian, oviductal and uterine development through altered expression of many miRNAs causing female sterility [106, 227, 228] Additional studies have also implicated the importance of Dicer and regulatory function of miRNAs in overall g ene expression necessary for early embryonic development [99] Recently, th e expression profile of many miRNAs have been reported in the pituitary [78] ovary [79, 80] testis [229] uterus [83] and embryo [230] suggesting miRNAs may play a role in reproductive function. With regards to ovarian miRNAs, a few reports have demonstrated granulosa cells differentially express miRNAs in response to hormone treatment, including hCG/LH [107] and FSH [108] In addition,

PAGE 63

63 another report found the expression of miRNA s to differentially affect the release of ovarian steroids P4, T, and E2 [110] Studies like these imply hormonal stimulation may regulate the expression of miRNAs which in turn may affect the expression of several genes important for follicular developmen t, including the final maturation of oocytes, luteal formation, and steroid synthesis. To further our understanding of hormonal regulation of miRNAs, the present study assessed the expression of a select number of miRNAs in granulosa cells from IVF patients receiving GnRHa and GnRHant protocols. In addition, using an immortalized human granulosa cell line we examined the direct action of GnRHa and GnRHant on the expression of these miRNAs and a number of their predicted target genes. We hypothesize t hat GnRHa and GnRHant differentially regulate the expression of ovarian miRNAs which may affect the expression of their predicted target genes to influence ovarian function. Materials and Methods This study utilized human granulosa cells (hGC) from clinica l IVF patients as well as an immortalized human granulosa cell line (IhGC). The collection and use of hGC was approved by the University of Florida institutional review board. All patients involved in the study signed informed consent for collection and us e of hGC to study gene regulation. Experiments Six women, aged between 26 and 35, underwent COH with either a GnRHa (standard long leuprolide acetate suppression; n=3) or GnRHant (ganirelix acetate flexible protocol; n=3) protocol for IVF cycles with i ndications of male factor, tubal factor or oocyte donation. All patients were pretreated with combined birth control pills. None

PAGE 64

64 of the patients were poor responders and all IVF patients and all anonymous oocyte recipients from these cycles ended up with ongoing pregnancies. Hormonal profiles were comparable in patients treated with GnRHa or GnRHant protocols. Follicles were aspirated 35 hours after hCG administration for final oocyte maturation. After recovery of oocytes in the IVF laboratory, the remaining FF from each patient was collected and processed through repeated centrifugation at 400g and washing with phosphate buffered saline (PBS) to isolate hGC. The cell pellets containing granulosa cells were kept at 80C until utilization for RNA extract ion. Cell culture experiments were performed using a well characterized human granulosa cell line previously immortalized with SV40 large T antigen and was reported to express functional GnRHR [231] These cells were kindly provided by Dr. Leung from the U niversity of British Columbia. Cells were cultured in DMEM:F12 (1:1, Invitrogen, Carlsbad, CA), 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) antibiotic at 37 humidified atmosphere of 5% CO2 in air. Culture medium was changed every 48 hour s. Once cells reached 70% confluence, they were washed once with medium and then serum starved for 24 hours before initiating GnRH analog treatment. Cells were treated with either 0.1 M GnRH agonist (leuprolide acetate, SigmaAldrich Corp., St. Louis, MO), 0.1 M GnRH antagonist (cetrorelix acetate, Cetrotide; Serono, Geneva, Switzerland), or vehicle control for 24 hours. Each treatment was performed in triplicate. RNA E xtraction, cDNA S ynthesis and R eal T ime PCR Total RNA was isolated from granulosa cells using T RIzol reagent (Invitrogen) and then quantified using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE). All the reagents for cDNA synthesis and real time PCR, including primers and probes were purchased from Applied Biosystems (Foster City, CA).

PAGE 65

65 Complimentary DNA was synthesized by reverse transcription from 2 g of total RNA using random primers for mRNA and specific stem loop primers for miRNA ( Table 31 ). Real time PCR was carried out as previously described [232] at 95C for 10 minutes, 95C for 15 seconds, and 60 C for one minute for 40 cycles using an Applied Biosystems 7300 Sequence Detection System. MicroRNA and mRNA expression values were analyzed using the comparative CT (critical threshold) method following transformation and normalization to RUB6 and18S rRNA expression, respectively, with threshold cycle set within the exponential phase of the PCR. Final results were reported as relative expression by setting the expres sion values of miRNAs and mRNAs at 1 in one of the samples and the expression value of other samples were calculated relative to this control. Statistical A nalysis All data were analyzed using software SPSS statistics 17.0 (SPSS Inc., Chicago, IL). Means f or hGC treatments were compared using twotailed student t test. Means for IhGC were analyzed using analysis of variance with post hoc Tukeys test for multiple comparisons. Results for all comparisons are presented as means standard error of the mean (S EM). In addition, correlations between each mRNA and miRNA were analyzed using Pearsons correlations coefficient. Data were considered significantly different if P < .05. Results The E xpression of miRNAs and T heir P redicted T arget G enes in G ranulosa C ell s The regulation by gonadotropins and local actions of aromatase (CYP19A1), amphiregulin (AREG), GATA4, pregnancy associated plasma proteinA (PAPPA) and transforming growth factor (TGF) RII, bone

PAGE 66

66 morphogenetic protein 2 (B MP2) and Smads, have been associated with various ovarian cellular activities, including oogenesis, granulosa and thecal cell growth and differentiation and steroid biosynthesis. Using real time PCR, we assessed the expression of these genes and miRNAs that are predicted to target their expression, including miR16, miR 17, miR 23a, miR 23b, miR 26, miR 34a, miR 98, miR 133b, miR138, miR 145, miR 195, miR 424, miR 496, miR 497, and miR 5123p ( Table 31 ), in hGC from patients under going COH with either GnRHa and GnRHant protocol. In addition, the direct action of GnRHa and GnRHant on the expression of these genes and miRNAs was determined in vitro using IhGC. B oth hGC and IhGC expressed higher levels of miR16 as compared to the other miRNAs assayed and undetectable levels of miR5123p and low levels of miR 138 ( Figure 31 ) Similar analysis indicated higher PAPPA2 and BMP2 in both cell types (data not shown) The level of expression of the other genes varied with the exception of AREG, which was the highest expressed gene in hGC and only moderately ex pressed in IhGC GnRHa and GnRHant P rotocols I nstigate D ifferential E ffects on hGC miRNA Expression Comparative analysis revealed that hGC obtained from patients that underwent COH with GnRHant express higher levels of miR 26a, miR 34a, miR 98, mir 133b, miR 195, and miR 497 than in cells obtained from women treated with the GnRHa protocol ( P < .05) ( Figure 32 ). In addition, there was a trend toward higher expression of miR 175p, miR 23a, miR 23b, and miR 497 in hGC from patients treated with GnRHant protocol compared to those treated with GnRHa protocol. No significant differences were observed in relative expressions of mRNAs predicted as targets of these miRNAs

PAGE 67

67 in hGC from both GnRHa and GnRHant treated cohorts, although AREG, BMP2, ed from patients rec eiving GnRHant protocol In addition, there were no significant inverse correlations between the relative expressions of miRNA and predicted target genes. A positive correlation was determined between the expression of miR 195 and miR 4 97, and PAPPA in hGC ( P < .05). Direct E ffects of GnRH A nalogs on miRNA and Gene Expression Using a well established immortalized human granulosa cell line (IhGC) we assessed the direct action of GnRH analogs on the expression of miRNAs and predicted target genes. Treatment of IhGC with GnRHant moderately increased the relative level of expression of a number of miRNAs as compared with GnRHa and untreated controls although the comparisons were not statistically significant ( Figure 3 3 ). Similar analysis of predicted target mRNAs indicated significantly lower expression of AREG and CYP19A1 and higher expression of GATA4 in GnRHa treated cells as compared with cells treated with GnRHant or vehicle control ( P < .05). Meanwhile, the exp RII, PAPPA and PAPPA2 were not significantly different between treatments or controls No significant correlations were determined from miRNA and predicted target genes in IhGC. Discussion In the present study, we selected and analyzed the expression and regulation of a number of miRNAs and their predicted target genes by GnRHa and GnRHant in hGC obtained from IVF patients as well as in IhGC. We found that both hGC and IhGC express miR 16, m iR17, miR 23a, miR 23b, miR 26, miR 34a, miR 98, mir 133b, miR 145, miR 195, miR 424, miR 496, and miR 497 at varying levels. These miRNAs are

PAGE 68

68 RII, BMP 2 and Smads. Gonadotropins, through a receptor mediated action, regulate the expression of these and many other locally expressed genes. The products of these genes modulate various ovarian cellular activities, including oogenesis, granulosa and thecal cell growth and dif ferentiation and steroidogenesis, and alteration in their expression has been associated with disruption in follicular development negatively impacting oocyte maturation and subsequent embryo development. Accumulated evidence supports a central role for m iRNAs in gene expression stability by acting through mainly translational repression or mRNA degradation [90, 233, 234] Among the 10 miRNAs analyzed, miR 16 was the most abundant while miR5123p and miR 138 were either not expressed or expressed at very low levels in both hGC and IhGC, without any difference in their expression as a result of GnRH analog treatments. In contrast, miR 26a, miR 34a, miR 98, miR 133b, miR 195, and miR 497 were expressed at significantly higher levels in hGC from patients rec eiving GnRHant compared to GnRHa. These results suggest that granulosa cells express varying levels of miRNAs, and GnRH analogs may differentially affect their expression, although in IhGC these effects were limited and not significantly different from unt reated controls. Whereas it remains unclear whether the observed differences in miRNAs and mRNAs expression in hGC is due to direct action of GnRH analogs, a recent in vitro study has demonstrated that GnRH analogs have differential direct effects on AMH, aromatase, SF 1 and LRH 1 expression in human primary granulosa cells in culture and in HGL5 granulosa cell line [62]

PAGE 69

69 We also selected and confirmed the expression of CYP19A1, AREG, BMP2, p redicted targets of the tested miRNAs expressed in hGC and IhGC. Although, coexpression of these miRNAs and their target genes imply a possible regulatory interaction, we found no inverse correlations between their relative expressions; however, there was a positive correlation between the expression of miR 195 and miR 497, and PAPPA in hGC. Since miRNAs regulatory action on gene expression may occur mainly at translational rather than transcriptional level, further studies are required to confirm these observations. In addition, lack of correlations between the expression of miRNAs and their target genes was not surprising since computational algorithms rather than experimental validation was used for selecting these predicted target genes. As such, the seed sequence of these miRNAs can potentially target many other genes not tested in the current study. Of the selected genes analyzed in this study, the expression of amphiregulin (AREG) mRNA was differential affected in response to GnRH analog treatment in cultured cells. AREG is a member of the epidermal like growth factor (EGF like) family, which has been shown using both in vitro as well as animal systems to play a central role in steroidogenesis, cumulus cell expansion and oocyte maturation, probably as mediators of LH action in the ovulatory follicle [235 237] EGF like ligands have been shown to accumulate in FF obtained from IVF patients, with concentrations of amphiregulin up to 3,000 times greater than that in the serum [238] The source of FF ARE G is most likely from granulosa cells in which AREG mRNA expression increases in response to LH surge [236] In the present study, we observed differential expression of

PAGE 70

70 AREG in IhGC with GnRH analog treatment showing suppressed expression in GnRHa treated cells. This finding suggests that GnRH can likely modulate AREG expression in granulosa cells as well. Whether regulation of AREG expression by GnRH is mediated through LH/hCG receptor cross talk is unknown; however, GnRH has also been shown to induce cyc looxygenase2 expression in rat granulosa cells similar to LH [239] and granulosa cell AREG mRNA expression increases in response to PGE2 [240] indicating multiple mechanism s may regulat e AREG. The molecular pathways of granulosa cell expression of AREG ar e beyond the scope of the current study, however, our observations warrant future investigations into possible role of GnRH and its analogs in expression of AREG. In the immortalized granulosa cell line used in this study we could not replicate some of th e findings reported by Winkler and coworkers [62] using cultured human granulosalutein cells and a HGL5 granulosalutein cell line. We observed a significant suppression of CYP19A1 mRNA expression by GnRHa treatment while GnRHant treatment did not show any significant effects. On the contrary, in HGL5 cell line, Winkler and coworkers reported suppression of both basal and cAMP stimulated mRNA expression of CYP19A1, the gonadal promoter of aromatase [62] We used the same GnRH antagonist, cetrorelix at an intermediate dose of 0.1 M rather than the doses of 1 nM or 1 M. We consider this finding as another supporting evidence that the effects of GnRH agonists and antagonists can differ in different cell lines, in different cell types and in different cultur e conditions [241] Furthermore, we noted that GnRHa increased expression of GATA4 mRNA expression, a transcription factor interacting with the promoter regions of many genes including AMH steroidogenic factor (SF) 1, CYP19A1

PAGE 71

71 and many other enzymes and factors involved in steroidogenesis and reproductive system development and function [242, 243] Hence, while GnRHa suppressed mRNA expression of CYP19A1, it induced GATA 4 mRNA expression, which is a known positive regulator of CYP19A1 expression. The obser ved diversity in GnRH analog effects in different cell types have been thought to be related to treatment conditions GnRHR expression level, ligand specificity, GnRHR splice variants, intrinsic cellular properties and lastly cross talk between different receptor systems [243, 244] As such our findings with different action of GnRHa and GnRHant on miRNAs and mRNAs expression in granulosa cells may involve one or all the above pathways whose identity requires detailed investigation [245] The results of our study in human granulosa cells suggest that GnRH analogs differentially regulate the expression of miRNAs and some of their target genes involved with steroidogenesis and follicle development. Because miRNAs are estimated to regulate the expression of over 30% of genes [246] any change in ovarian cellular expression of a given miRNA could have a profound effect on the expression of many genes, including specific genes whose products are known to influence granulosa cell function. However detailed investigation is required to identify the specific genes targeted by these miRNAs allowing association of miRNAs biological function in human granulosa cells. In addition, further s tudies using different GnRH antagonist preparations is warranted in order to identify their specific and common miRNA and genes targets and mechanism that regulate their expression.

PAGE 72

72 Table 31. Predicted mi RNA gene targets. MiRNA Mature sequence Predicted gene target s hsa m iR17 c aaagugcuuacagugcagguag TGFBR2, BMPR2, MMP2, ADAM9, MMP24, IGF2BP1, EREG, SMAD6, FGF4, BMP2, VEGFA hsa miR 23a a ucacauu gccagggauuucc TGFBR2, FGF2, CASP7, TGFA, PGR, PTGFR, SMAD5 hsa miR 23b a ucacauu gccagggauuacc hsa miR 26a u ucaagua auccaggauaggcu PTEN, SMAD1, INHBB, IGF1, GATA4 hsa miR34a u ggcagugucuuagcugguugu BMP3, FGF23, AREG, CASP2, PDCD4, SMAD4, INHBB, hsa miR98 u gagguaguaaguuguauuguu IGF2BP1, TGFBR1, IGF1R, GDF6, IGF2BP3, CASP3, IGF2BP2, FGF11, GHR, INSR, IGF1, SMAD2, MMP11, CYP19A1 hsa miR133 b u uugguccccuucaaccagcua FGF1, EGFR, MMP14, MMP15, INSR, TGFBR1, IGF1R, TGFB1 hsa miR 138 a gcuggug uugugaaucaggccg CASP3, PAPPA, IGF2BP2, AMH hsa miR145 g uccaguuuucccaggaaucccu PTGFR, SMAD3, SMAD5, FGF5, ACTB, TGFBR2, SMAD4, BMP3, ESR1, IGF1R, INHBB, SP1, CASP10 hsa miR 496 u gaguauu acauggccaaucuc PAPPA, MMP10, TGFBR2 hsa miR 512 3p a agugcug ucauagcugagguc SMAD2, FGF7, ESR1, PAPPA2 hsa miR 16 u agcagca cguaaauauuggcg PAPPA, FGF7, FGFR1, SMAD3, SMAD5, SMAD7, VEGFA, GHR, TGFbR3, IGF2R, IGF1R, GATA4 hsa miR 424 c agcagca auucauguuuugaa hsa miR 195 u agcagca cagaaauauuggc hsa miR 497 c agcagca cacugugguuugu Note s : Prediction of miRNA targets based on TargetScanHuman version 5.1. High lighted bases in mature sequence indicate seed region. Not all predicted targets shown for each miRNA.

PAGE 73

73 Figure 3 1 Overall expression patterns of miRNA in (A) hGC and (B) IhGC. The y axis in each graph represents the average expression for eac h miRNA relative to a calibrator. Mir133b w as chosen as the calibrator for hGC and IhGC following normalization with RU6B.

PAGE 74

74 Figure 3 2. Comparative analysis of the relative expression of miRNA and predicted mRNA in hGC. Granulosa cells were recovered from women undergoing COH with either GnRH agonist or GnRH antagonist protocols. The y axis of each graph represents the expression of miRNAs and predicted targets relative to a selected calibrator. The calibrator for each mi RNA and mRNA was chosen based on the sample with the highest CT following normalization to RU6B and 18S, respectively. Differing letters within miRNA or mRNA indicate significance (P < .05).

PAGE 75

75 Figure 3 3 Comparative analysis of the relative expression of miRNA and mRNA targets in IhGC. Granulosa cell line was treated with either 0.1 M GnRH agonist, 0.1 M GnRH antagonist, or vehicle control. The y axis of each graph represents the expression of miRNAs and predicted targets relative to a sel ected calibrator. The calibrator for each miRNA and mRNA was chosen based on the sample with the highest CT following normalization to RU6B and 18S, respectively. Differing letters within miRNA or mRNA indicate significance (P < .05).

PAGE 76

76 CHAPTER 4 SUPPLEMENTATION OF F REEZE AND THAW SOLUT IONS WITH A GLOBULIN RICH PROTEIN SOURCE IMPROVES POST THAW SURVIVAL AND IM PLANTATION OF CONTROL RATE CRYOPRESERVED B LASTOCYSTS Introduction For more than two decades, the inclusion of globuli n rich protein sources in culture medium has been suggested to benefit invitro development of embryos. Initial studies investigating plasma volume extenders containing a mixture of serum albumin and globulins intended for intravenous use, demonstrated hig h continuing pregnancy rates if included in embryo culture medium [5, 116] Furthermore, these stud ies globulins. Results from those early studies led to the development of commercial prepara tions of globulin rich protein supplements, such as Synthetic Serum Substitute (SSS; now manufactured under name Serum Substitute S upplement Irvine Scientific) [117] and Serum Pro tein Substitute (SPS; SAGE In Vitro Fertilization) These serum substitutes are now formulated to provide a more suitable pH range as well as appropriate osmolarity for inclusion in embryo culture media. N umerous human and animal studies have demonstrated that these commercially available protein supplements promote blastocyst hat ching [118, 122, 247] and implantation [119, 120, 248] While a mechanism for the interactions of globulins with embryos remains to be established, Pool and Martin [5] suggested that the polyhydroxy nature of globulins may influence the ir physiochemical in teractions with water molecules within the culture environment These interactions may enhance developing embryo viability through physical mechanisms involving altered water dynamics. As such, these interactions may also

PAGE 77

77 benefit embryo cryopreservation, w here osmoregulation of the embryo is essential for post thaw re expansion and survival. Modern trends seeking to limit the number of freshly transferred embryos along with general improvements in culture conditions often result in embryos remaining untrans ferred so as to place emphasis on successful blastocyst cryopreservation. Previous attempts to improve blastocyst cryopreservation have focused on various components, such as type of cryoprotectant [249, 250] altering start temperatures and rate of slow f reezing [153] utilization of straws verse cryovials [251] inclusion of various macromolecules [156] and more recently vitrification [3] One of the earlier reports demonstrating high pregnancy rates from frozenthawed blastocysts was accomplished with f reeze and thaw solutions supplemented with a globulinrich protein source [2] suggesting globulins may promote post thaw blastocyst survival. Surprisingly, no studies have evaluated the effects of globulins on blastocyst cryopreservation. In the present study, supplementation of freeze and/or thaw solutions with SSS compared to HSA alone was assessed for control rate cryopreservation of murine blastocysts in an effort to determine if globulin rich protein sources offer advantages during cryopreservation. We hypothesize that freeze and thaw solutions supplemented with a globulinrich protein, such as SSS, will improve thaw survival, as measured by blastocyst re expansion and total cell number. In addition, we retrospectively examined human blastocysts thaw ed and cultured in solutions supplemented with SSS compared to HSA alone to determine if globulinrich protein supplementation benefit ed clinical frozen embryo transfer (FET) outcomes.

PAGE 78

78 Materials and Methods Freezing and Thawing of Blastocysts Freeze and thaw procedures followed a modified version of Menezos protocols [143, 252] using kits of commercially available solutions (G FreezeKit Blast and G ThawKit Blast; Vitrolife, Englewood, CO ). E ach freeze and thaw solution was supplemented with pr otein in the form of HSA (10 mg/ml albumin; Vitrolife) or SSS (10 mg/ml albumin + 2 mg/ml globulins; Irvine Scientific,Santa Ana, CA) according to the experimental design. Unless noted, all procedures were carried out at 37C. For freezing, blastocysts wer e exposed for 5 minutes to a MOPS buffered incubation medium containing no cryoprotectant or sucrose. They were then transferred into a solution of 5% glycerol + 0.1 M sucrose for 10 minutes and then to a solution of 10% glycerol + 0.2 M sucrose for 7 min utes Blastocysts were loaded into CBS high security straws (Cryo Bio Systems, IMV corp, New York, NY), sealed and transferred into a programmable rate controlled freezer (Cryologic, Victoria, AU). The freezing program initially cooled from 18C to 7C at a rate of 2C/minute. I ce crystallization seeding was performed manually by touching the straw with precooled forceps. The temperature was held for 15 min utes and then further cooled at a rate of 0.3C/ minute to 38C. Straws were then plunged directl y into LN2 ( 196C) for storage. For thawing, straws were removed from LN2, held in air at room temperature for 1 minute and immersed into a water bath for 30 seconds at 37C. S traw s were wiped to remove excess water and then cut to expel the contents int o a petri dish containing 10% glycerol + 0.2 M sucrose. Once located, the blastocysts were transferred into a solution of 5% glycerol + 0.1 M sucrose for 5 minutes then into a solution of 0.1 M sucrose for 5 minutes and then held in MOPS buffered incubat ion medium for 5 minutes

PAGE 79

79 Animal Experimental Design Frozen twocell murine embryos (Embryotech, Haverhill, MA) were thawed and cultured in G1v5 PLUS (Vitrolife) containing 5 mg/ml HSA for 72 hours Only resulting expanded blastocysts, containing a discernable inner cell mass and a well defined layer of trophoblast cells were cryopreserved. Blastocysts remained in liquid nitrogen storage for at least 24 hours but less than 1 week. Following thaw, blastocysts were cultured for 24 h ours and then assessed for thaw survival. Blastocysts exhibiting greater than 50% blastocoele reexpansion were considered to survive. Experiment 1: Effects of SSS Supplementation of Freeze and Thaw Solutions on Post Thaw Murine Blastocyst R e Expansion Murine blastocysts were randomly distributed to one of four treatments: frozen and thawed in cryopreservation solutions supplemented with HSA (group I), frozen in solutions supplemented with HSA and thawed in solutions supplemented with SSS (gr oup II), frozen in solutions supplemented with SSS and thawed in solutions supplemented with HSA (group III), and frozen and thawed in solutions supplemented with SSS (group IV). Following thaw, each treatment was cultured for 24 h ours in G2v5 PLUS (Vitrolife) containing HSA (5 mg/ml). Experiment 2: Effects of post thaw culture medium with SSS on re expansion of murine blastocyst frozenthawed with different protein supplements Murine blastocysts were randomly distributed to one of four treatments as described in experiment 1. Following thaw, each treatment was cultured for 24 hours in G2v5 supplemented with SSS (5 mg/ml albumin + 1 mg/ml globulins).

PAGE 80

80 Experiment 3: Effects of protein supplementation in freeze thaw and post thaw culture so lutions on murine blastocyst re expansion and total cell number Murine blastocysts were randomly di stributed to freezethaw solutions supplemented with HSA followed by 24 hours culture in G2v5 PLUS containing HSA (5 mg/ml) (group I) or freeze and thaw in s olutions supplemented with SSS followed by 24 h ours culture in G2v5 supplemented with SSS (5 mg/ml albumin + 1 mg/ml globulins) (group II). Total cell numbers were calculated from all blastocysts that reexpanded using a simple fixation and staining procedure Briefly, individual blastocysts were exposed for 2 minutes in hypotonic solution [1.0% sodium citrate (SigmaAldrich, St. Louis, MO) + 3 mg/ml BSA (Sigma Aldrich)], then transferred in to a softening solution [ 0.01 N HCl (Sigma Aldrich) + 1% T ween 20 ( Sigma Aldrich)] for 10 sec onds and loaded onto a slide containing 10 l softening solution. As soon as the softening solution evaporated, one drop of fixative solution (methanol:acetic acid; 3:1) was added to fixate nuclei to the slide. The central locatio n on the slide containing the nuclei was encircled with a carbide pen. Coverslips were mounted with 10 l of vectashield mounting medium with 4',6 diamidino 2 phenylindole (DAPI)(Vector Laboratories, Burlingame, CA) applied to the slide area containing nuc lei. The total number of nuclei corresponding with each blastocyst were counted using a Nikon Eclipse E600 (Nikon, Melville, NY) epifluorescent microscope equipped with a 60X dry objective. Human Retrospective Analysis A retrospective study was conduc ted that included 28 patient couples that initiated FET cycles from January 2006 to March 2009 at Shands hospital at the University of Florida, Gainesville, Florida. Only patients who had frozen blastocysts thawed for the purpose of FET were included. No other exclusion criteria were used. All

PAGE 81

81 women were pretreated by combined oral contraceptive pills followed by downregulation with daily leuprolide acetate. Following hormonal suppression confirmed by estradiol concentrations <40 pg/ml and transvaginal ultrasound assessment of ovaries and the endometrial stripe, patients were placed on transdermal estradiol with increasing incremental doses to develop endometrium. Once the endometrial thickness reached 7 mm, progesterone in oil was injected IM to synchronize endometrium for embryo transfer. On day 5 of progesterone administration, blastocysts, originally frozen on developmental day 5 or 6 with at least a grade of 3BB or better using Gardners scoring system [253] were thawed. One to two blastocysts were t ransferred to each patient on day 6 of initiation of progesterone treatment regardless of the developmental stage of the blastocyst. P regnancy was first determined 9 days post transfer on the basis of a serum hCG greater than 25 mIU/ml Ongoing clinical pr egnancy was determined 4 weeks post transfer using transvaginal ultrasound to assess the presence of fetal heartbeat. We compared two groups of patients. Group I (n=19) included patients who had frozen blastocysts thawed and cultured in solutions supplemented with HSA. Group II (n=9) included patients who had frozen blastocysts thawed and cultured in solutions supplemented with SSS. Thaw survival was characterized as blastocysts exhibiting fewer than 20% degenerative cells assessed at two hou rs post thaw. Blastocyst expansion was assessed at 24 h ours post thaw with only blastocysts exhibiting greater than 50% blastocoele expansion considered to have re expanded The institutional review board and ethics committee of the University of Florida approved this s tudy.

PAGE 82

82 Statistical Analysis All data were analyzed using software SPSS statistics 17.0 (SPSS Inc., Chicago, IL). Chi Square testing was used to analyze blastocyst reexpansion for animal experimental studies 1, 2, and 3, as well as the clinical retrospectiv e study. Multiple comparisons with Bonferroni adjustments were used to compare individual treatments in animal experimental studies 1 and 2. Students t test was used to compare mean total cell numbers for animal experiment 3. Fishers exact test was used to analyze clinical pregnancy and implantation rates for the retrospective study. Significance was deemed P <.05. Results E xperiment 1: E ffects of Supplementing Freeze and/or Thaw Solutions with SSS on Post Thaw Murine Blastocyst Re Expansion Initially 30 6 murine blastocysts were frozen using freeze solutions supplemented with either HSA (n=152) or SSS (n=154). Table 41 shows the distribution of 300 recovered murine blastocysts following thaw. Overall, there was no significant dif ference in re expansion from blastocysts frozen in HSA compared to SSS, whereas reexpansion was greater if blastocysts were thawed in solutions supplemented with SSS (85.3%) compared to HSA (64.0%) ( P <.05). Individually, 89.5% of recovered blastocysts re expanded from group IV compared to 70.7% and 57.3% in groups I ( P <.05) and III ( P <0.001), respectively. Experiment 2: Effects of postthaw culture medium with SSS on re expansion of murine blastocyst frozenthawed with different protein supplements In e xperiment 2, 158 of 160 frozen murine blastocysts were recovered following thaw and were grouped similar ly to experiment 1 ( Table 42 ). Following 24 hours of

PAGE 83

83 culture in post thaw medium supplemented with SSS, blastocyst re expansion was excellent in all groups with no significant differences between treatments. E xperiment 3: E ffec ts of protein supplementation of freezethaw and post thaw culture solutions on murine blastocyst re expansion and total cell number E xperiment 3 included 111 murine blastocysts frozen, thawed and cultured for 24 hours using cryosolutions and post thaw culture medium supplemented with HSA or SSS ( Figure 41 and Table 43 ). A greater percentage of bl astocysts re expanded if frozen, thawed and cultured in solutions supplemented with SSS (85.5%) compared to HSA alone (66.1%; P <.05). In addition, the mean t otal cell number o f re expanded blastocysts, as determined by staining of fixed nuclei with DAPI ( Figure 42 ), was moderately greater for SSS group compared to HSA group (80.0 vs 70.5; P =.057). Retrospective Analysis of Frozen Thawed Human Blastocyst Re Expansion Using Thaw and Post Thaw Solutions Supplemented with SSS The retro spective analysis included 82 blastocysts originally frozen in freeze solutions supplemented with HSA ( Table 44 ). Cycles were grouped based on the thaw protocol in use at the time. Between January 2006 and June 2008, 58 embryos were thawed using thaw and post thaw culture medium supplemented with HSA (group I). Beginning in July 2008 through March 2009, 24 additional blastocysts were thawed, but in these cases using thaw and post thaw culture medium supplemented with SSS (group I I). Blastocysts thawed and cultured in solutions supplemented with SSS had significantly greater survival at 2 hours post thaw and greater blastocyst reexpansion at 24 h ours than blastocysts thawed and cultured in HSA alone (83.3% and 66.7% vs 43.9% and 1 5.8%, respectively; P <.01). In addition, there was a higher clinical pregnancy rate per thaw and higher implantation rate from frozen blastocysts thawed

PAGE 84

84 and cultured in solutions containing SSS compared to HSA (55.6% and 53.8% vs 10.5% and 13.3%; P <.05) Discussion The aim of this work was to improve current freezing and thawing protocols in order to enhance post thaw survival and i mplantation of blastocysts. T he present study was designed to test whether inclusion of the commercially available globulinrich protein supplement SSS in freeze, thaw and post thaw solutions would increase thaw survival as compared to HSA. The results indicate that the type of protein supplement provided impacted thaw survival, as measured by post thaw re expansion and total cell number As several studies have demonstrated post thaw reexpansion and total cell number are predictors of implantation, the selection of protein type used in freeze, thaw and post thaw solutions could affect frozen embryo transfer outcomes. Accumulated evidence supports a role for globular protein supplementation in embryo culture medium. R esults from the current study suggest globulinrich protein sources, such as SSS, may also promote thaw survival o f cryopreserved blastocysts. The results show that blastocysts that were cryopreserved and thawed in freezethaw solutions using SSS had significantly higher rates of reexpansion compared to HSA alone. If we consider that cellular mechanisms inv olved during blastocyst expansion are likely to also be involved in reexpansion of collapsed blastocysts following thaw, then these results are consistent with previous studies demonstrating the p o sitive e ffects of globulin rich protein supplements on blastocyst hatching [118, 122, 247] Interestingly, transitioning from SSS used during freeze to HSA used during thaw negatively affected post thaw re expansion. Schneider and Hayslip [122] observed a similar phenomena during extended embryo culture where compact embryos cultured with a mix of HSA

PAGE 85

85 and globulin proteins resulted in poor production of hatched blastocysts when moved to a sequential medium devoid of globulins, suggesting an active role for globulins in stimulation of blastocyst hatching. In addition, the present study found that the culture of thawed blastocysts overnight in SSS promotes excellent blastocyst hatching, regardless of protein type in freezethaw solutions. These results imply supplemen tation of post thaw culture medium with a globulinrich protein source, like SSS, may restore the potential for blastocyst reexpansion even if previously frozen and/or thawed with HSA. T otal cell numbers were also analyzed to determine if reexpanded blastocysts from SSS treatments were generally healthier compared to HSA alone. As total blastocyst cell number has been correlated with implantation potential [254] our results suggest that blastocysts cryopreserved and thawed in solutions containing SSS are more robust than blastocysts cryopreserved and thawed in HSA. Although murine blastocysts were not transferred to recipients, similar studies assessing protein supplementation in routine embryo culture found globulins enhanced total cell numbers [255] and implantation [119, 120, 248] further supporting the impression that blastocysts cryopreserved, thawed and cultured in solutions containing SSS are more likely to implant. Based on the research results using murine embryos, our clinical ART laboratory which previously solely used HSA, incorporated SSS into freezethaw protocols as well as post thaw culture of human blastocysts. Since this change, our program has shown a remarkable improvement in thaw survival. In addition as our standard procedure i s to culture thawed embryos overnight, we have observed significant improvements in blastocyst re expansion prior to transfer. These changes have led to significant

PAGE 86

86 increases in pregnancy per thaw and implantation rates. However, as these numbers are small additional studies are needed to determine whether these trends are clinically significant. Given the osmotic dynamics imposed on embryo s undergoing exposure to high concentrations of cryoprotectants, minor alterations in the physiochemical environmen t may dramatically enhance an embryos ability to restore osmotic function. Pool and Martin [5] propose that the high number and orientation of hydroxyl groups ( OH) in polyhydroxy compounds may interact through hydrogen bonding with water molecules affect ing physical properties such as water exchange dynamics. The finding presented here that thawed blastocysts are more likely to reexpand if cultured with a protein source containing globulins lends support to the idea that polyhydroxy compounds improve osm otic function. Intriguingly, other polyhydroxy compounds, some of which are currently used in IVF medium, may function better than globulins for cryopreservation. Hyaluronan, which is naturally found in the reproductive tract [131] and has been reported to stimulate in vitro embryo development and improve implantation [133] was previously shown to produce equally high thaw survival rates in mouse and cow embryos when substituted for newborn calf serum in freezing solutions [157] While no study (to the authors knowledge) has evaluated the affects of hyaluronan in freezethaw solutions of human blastocysts, a recent study comparing blastocyst FET using hyaluronanrich transfer medium, embryoglue (VitroLife) demonstrated no improvement in implantation as observed with fresh blastocyst transfer [256] While it remains to be elucidated, Korosec [256] suggested that the freezethaw process itself may affect receptor mediated actions of hyaluronan thereby disrupting

PAGE 87

87 signaling between the endometrium and the embryo. As this could have major implications affecting implantation, further research is needed. Alternative mechanisms for the thaw survival promoting effects of globulins are plausible and warrant further investigation. A previous in vitro culture stu dy of murine embryos cultured in medium supplemented with SSS showed reduced presence of reactive oxygen species (ROS) accompanied by lower incidences of apoptosis when compared to embryos cultured in medium supplemented solely with HSA [247] Our study was limited to observational data, including blastocyst reexpansion and total cell number. We did not analyze post thaw culture medium for ROS or re expanded blastocysts for apoptosis and therefore cannot exclude this as a potential mechanism promoting thaw survival. In addition, globulin proteins within SSS have also been suggested to act as energy substrates or serve as carriers of growth promoting factors. While this is plausible, it is more reasonable that the OH groups within polyhydroxy compounds, lik e SSS, influence osmotic tolerance of embryos. In support, a recently made available supplement containing a mixture of HSA and dextran (DSS, Irvine Scientific) is being promoted to be as effective as SSS for in vitro mouse embryo development and more rel e vantly produce comparable thaw survival to SSS when used as the protein component in vitrification solutions for all stages of development. As dextran is a nonproteinaceous polymer known to interact strongly with water, future studies incorporating DSS may provide additional support for a mechanism in which polyhydroxyl compounds interact in a physiochemical manner with the embryo and its environment to enhance osmoregulation rather than function as growth promoting factors.

PAGE 88

88 The results o f this study suggest that supplementation of freeze, thaw and post thaw solutions with a protein source containing high fractions of globulins, such as SSS, may benefit thaw survival. As this study was limited to slow cool cryopreservation, it would be interesting to see i f similar results can be obtained through vitrification. Given that most referenced vitrification solutions are formulated using SSS, it is likely that the success of those solutions may at least in part be due to the presence of globins. Table 4 1. Effe cts of protein supplement in freezethaw solutions on murine post thaw re expansion. Treatment Thawed Recovered Re Expanded (%) Group I: HSA ->HSA 75 53 (70.7) ab Group II: HSA ->SSS 74 60 (81.1) ac Group III: SSS ->HSA 75 43 (57.3) b Group IV: SSS ->SSS 76 68 (89.5) c Results with different superscripts indicate significance. ab vs c P<0.05, b vs. ac P<0.01, b vs. c P<0.001. Table 4 2. Effects of postthaw culture medium with SSS on reexpansion of murine blastocyst frozenthawed with different protein supplements. Treatment Thawed Recovered Re Expanded Group I: HSA ->HSA 38 36 (94.7) Group II: HSA ->SSS 40 37 (92.5) Group III: SSS ->HSA 41 37 (90.2) Group IV: SSS ->SSS 39 37 (94.9) No significance observed between treatments. Table 4 3. Effects of protein supplementation of freeze thaw and post thaw culture solutions on murine blastocyst reexpansion and total cell number. Treatment Thawed Expanded (%) Mean Total Cell Count SEM Group I: HSA 56 37 (66.1) a 70.5 c 4.03 Group II: SSS 55 47 (85.5) b 80.0 c 2.96 Treatments within columns with different superscripts are significantly different. a vs. b P<0.05, c vs. c P = 0.057.

PAGE 89

89 Table 4 4. Retrospective a nalysis of f rozent hawed h uman b lastocyst r e expansion u sin g thaw and post thaw solutions s upplemented with SSS Group I Group II Statistical Significance Number of Cycles 19 9 Number of Embryos Thawed 58 24 Average Number of Embryos Thawed 3.1 2.7 NS Number of Embryos Recovered (%) 57/58 (98.3) 24/24 (100.0) NS Number of Embryos Survived (%) 25/57 (43.9) 20/24 (83.3) P<0.01 Number of Embryos Expanded (%) 9/57 (15.8) 16/24 (66.7) P<0.01 Number of Embryo Transfers (%) 11/19 (57.9) 8/9 (88.9) NS Average Number of Embryos Transferred 1.4 1.6 NS Number of Biochemical Pregnancy Per Thaw (%) Per Transfer (%) 4 4/19 (21.1) 4/11 (36.4) 5 5/9 (55.6) 5/8 (62.5) NS NS Number of Clinical Pregnancy Per Thaw (%) Per Transfer (%) 2 2/19 (10.5) 2/11 (18.2) 5 5/9 (55.6) 5/8 (62.5) P< 0.05 NS Number of Implants Per Embryo Transferred (%) 2 2/15 (13.3) 7 7/13 (53.8) P<0.05

PAGE 90

90 Figure 41. Thaw survival of murine blastocysts following cryopreservation in solutions supplemented with (A) HSA or (B) SSS. Arrows indicate blastocysts that did not meet reexpansion criteria for survival.

PAGE 91

91 Figure 42. Epifluorescence imaging of total cell number from a frozenthawed murine blastocyst fixed and stained with DAPI. The total number of nuclei corres ponding with each blastocyst were counted at 600X total magnification.

PAGE 92

92 CHAPTER 5 CALYCULINA IMPROVES CHROMOSOM E CONDENSATION FOR CYTOGENETIC ANALYSIS OF BLASTOMERES FROM BOVINE AND MURINE EIGHT CELL STAGE EMBRYOS Introduction Cytogenetic analysis of preimplantation embryos has traditionally used fluorescent in situ hybridization (FISH) to examine individual chromosome copy number, chromosome rearrangements, or sex determination. Comprehensive and simultaneous assessment of all chromosomes however, cannot be achieved with interphase FISH. Metaphase FISH is an attractive alternative, but is biologically limited since the majority of cells, including blastomeres, spend only a short duration in metaphase. Consequently, this technique requires large numbers of cells to increase the likelihood of obtaining sufficient metaphase spreads for analysis, making this inappropriate for preimplantation embryos. An improved method for obtaining condensed chromosomes therefore, would improve the efficiency of cytogenetic analysis of preimplantation embryos. Premature chromosome condensation (PCC) has been well documented and in many respects mimics the chromatin changes seen during mitosis, enabling preparation of chromosome spreads from interphase cells in G1, G2 and M phases of the cell cycle [207, 209] Interestingly, the final structure of prematurely condensed chromosomes is influenced by the cell cycle stage, with three basic morphologies corresponding with G1, S and G2/M cell cycle phases. Cells in G1 phase generally exhibit longer chromosomes than traditional metaphase chromosomes, especially when in late G1 [209] In contrast, cells in G2/M appear as doublets, reflecting replicated chromosomes. Cells in S phase

PAGE 93

93 are often described as pulverized, as the chromatin appears smeared or fragmented [209] Therefore, PCC of S phase cells is not suitable for cytogenetic analysis. Chromatin condensation of blastomeres has been achieved by fusing blastomeres with metaphase stage oocytes, enabling analysis of chromosome aberrations in interphase nuclei [190, 191] However, the methods used for cell fusion are technically difficult and laborious, and fusion results are often inconsistent. Furthermore, rates of sufficient chromatin c ondensation remain low. Therefore, an alternative approach is needed to overcome these inadequacies in order to evaluate the early embryo prior to embryo transfer. Chemical approaches have traditionally used colcemid to depolymerize microtubules and prevent spindle formation, thereby trapping cells at metaphase [257] This method, however, is often time consuming, as it requires the cell to enter mitosis. Alternatively, protein phosphatase (PP) inhibitors, such as okadaic acid, fostriecin and calyculin A, h ave been used successfully to obtain condensed chromatin in lymphocytes sufficient for karyotyping [214, 215] Protein phosphatases play an essential role in cell cycle regulation including mitosis [ see review [258] ] Whereas okadaic acid, fostriecin and calyculin A are strong inhibitors of PP2A, okadaic acid and fostriecin are weak inhibitors of PP1. In contrast, calyculinA is a strong inhibitor of both PP1 and PP2 and therefore, has been suggested to be a more potent inducer of PCC. The aim of the present study was to demonstrate PCC in blastomeres using calyculin A as an improved method for obtaining condensed chromosomes for cytogenetic analysis of embryos. We tested dose and duration to determine the optimal conditions for using calyculinA on eight cell stage bovine and murine embryos, and

PAGE 94

94 also examined whether chromosome spreads induced by calyculinA could be used in combination with whole chromosome painting for assessment of individual chromosomes and blastomere ploidy. Materials and Methods Pro duction of Bovine Embryos Blastomeres were obtained from in vitro produced bovine embryos that were produced according to a modified procedure of that previously described [259] Briefly, ovaries were collected from an abattoir and cumulus oocyte complexes (COCs) were recovered by slashing 2 8 mm follicles with a scalpel blade. Cumulus oocyte complexes with at least one layer of intact compact cumulus and evenly granular ooplasm were matured in maturation medium incubated in 5% CO2 in humidified air at 39C After 22 h ours maturation (Day 0), COCs were washed in Hepes Tyrodes Albumin Lactate Pyruvate (TALP) medium and transferred in groups of 30 to wells with 425 l of pre equilibrated Synthetic Oviduct FluidFERT [ SOFF; [260] ] overlaid with mineral oil. Fro zen thawed Angus spermatozoa (Southeastern Semen Services, Wellborn, FL, USA) were prepared by Percoll gradient centrifugation, and COCs were fertilized at a concentration of 1 106 spermatozoa/m l Following 18 hours incubation, putative zygotes were stri pped of cumulus by vortexing in hyaluronidase (0.3 mg/m l ; Sigma, St. Louis, MO, USA), washed in Hepes TALP, transferred to preequilibrated 20 l drops of KSOM + amino acids (Specialty Media; Phillipsburg, NJ, USA) with BSA (EFAF; 3 mg/m l ; Sigma) overlaid with mineral oil (Sigma), and cultured in a humidified environment of 5% O2, 5% CO2, and 90% N2 at 39C.

PAGE 95

95 Harvesting Bovine Blastomeres Three days after fertilization (Day 3), developmental stage appropriate eight cell embryos were selected and incubated i n 0.5% pronase (Sigma) for 2 minutes to dissolve the zona pellucida. Embryos were then transferred to calcium and magnesium free phosphate buffered saline (Invitrogen, Gaithersburg, MD, USA) with BSA (fraction V; 3 mg/m l ; Sigma) and were pipetted to assis t disaggregation into individual blastomeres. Harvesting Murine Blastomeres Frozen twocell mouse embryos (Day 1; Embryotech, Wilmington, MA, USA) were thawed according to manufacturer's protocol and cultured overnight in G 1v3 PLUS medium (Vitrolife, Englewood, CO, USA) in a humidified environment of 5% CO2 at 37C. Approximately 16 hours post thaw, zona pellucida were removed from embryos with acidified Tyrode's solution (Irvine Scientific, Santa Ana, CA, USA). Embryos were then transferred to calcium and magnesium free G PGD biopsy medi um (Vitrolife) + human serum albumin (HSA; 5 mg/m l ; Vitrolife) and pipetted to mechanically facilitate disaggregation into individual blastomeres. Induction of P remature C hromosome C ondensation Calyculin A stock soluti on (5 stored at A were prepared by diluting the stock solution in KSOM medium for bovine blastomeres or G 1v3 PLUS medium for murine blastom eres. Blastomeres that were intact after disaggregation were randomly allotted to treatments in 500 l wells (4 well plates, Nalge Nunc International, Rochester, NY, USA) and incubated in a humidified environment of

PAGE 96

96 5% CO2. Blastomeres were observed every 30 minutes and evaluated for morphological changes, such as cell lysis or blebbing of the plasma membrane. Experiment 1: effects of calyculin A duration on bovine blastomeres The effects of calyculinA duration on bovine blastomeres were examined by incubating blastomeres in 50 nM calyculin A for 0 (control), 60, 120, or 180 minutes at 39C. Calyculin A concentration of 50 nM was chosen based upon PCC experiments by Kanda et al. [261] using human fibroblast cell lines. Blastomeres from eight cell stag e, Day 3 embryos were randomly distributed across the four treatments. Experiment 2: effects of calyculin A concentration on bovine blastomeres The effect of calyculinA concentration on bovine blastomeres was examined by incubating blastomeres in 10, 50, or 100 nM calyculin A or vehicle control (1% DMSO in KSOM) for 120 minutes or in colcemid control (0.1 l ) for 16 hours at 39C. Blastomeres from eight cell stage, Day 3 embryos were disaggregated and randomly distributed among the treatments. Experimen t 3: effects of calyculin A on murine blastomeres The effects of calyculinA duration on murine blastomeres were examined by incubating blastomeres in 50 nM calyculin A for 0 (control), 60, 90, or 120 minutes at 37C. Blastomeres from eight cell stage, Day 2 embryos were randomly distributed between the four treatments. Experiment 4: calyculin A use for cytogenetic analysis of Day 3, eight cell stage bovine embryos The usefulness of calyculinA for inducing chromosome condensation suitable for cytogenetic analysis of bovine embryos was examined using FISH Intact Day 3, eight cell stage bovine embryos were incubated individually in 50 l drops of 50 nM calyculin -

PAGE 97

97 A overlaid with mineral oil for 120 minutes at 39C, disaggregated with gentle pipeting, and blas tomeres were fixed individually on a slide, while maintaining embryo of origin identity. Fluorescent in situ hybridization was used to determine ploidy and gender of each embryo. Chromosome spreads obtained from adult male bovine fibroblasts treated with e ither calyculin A (50 nM, 30 minutes ) or colcemid control (0.1 l for 30 minutes ) were used as FISH controls. An additional group of calyculinA treated embryos were cultured to Day 7 to determine if the effects of calyculinA treatment were reversible in embryos. Embryos were treated with calyculinA (50 nM) for 0 (vehicle control), 30, 60, or 120 minutes at 39C. Embryos were then washed in KSOM and placed into culture drops as described above. Treatments were evaluated for blastocyst development rates on Day 7. Fixation of B lastomeres Fixation of blastomeres was performed as previously described [262] Briefly, 1 hour prior to fixation, room humidity was recorded using a digital hygrometer (Fisher Scientific), and if necessary a ReliOn ultrasonic humidifier (Wal mart, Bentonville, AR, USA) was used to increase the level of humidity to 40%. Blastomeres were incubated in hypotonic solution [1% (w/v) sodium citrate and BSA (2 mg/m l ; fraction V); Sigma] for 1 3 minutes washed briefly in softening solution [0.01 N HCl (Sigma) + 0.1% Tween 20; (Sigma)] and individually loaded with minimal volume ( ~ 1 l ) onto a clean glass slide. Just prior to completely drying, one drop of fixative solution [3:1 methanol:acetic acid; (Sigma)] was applied adjacent to the blast omere to induce chromosome spreading. If necessary, additional drops of fixative were applied prior to evaporation to remove residual cytoplasm. Throughout the fixation process, the specimen was monitored using an inverted microscope (Nikon Instruments Inc ., Melville, NY, USA; model TMS F) at

PAGE 98

98 100X The chromatin was encircled with a diamond tip scribe to help mark the location for analysis. Analysis of P remature C hromosome C ondensation Data were collected on morphological appearance of the blastomeres, PCC rate, and the degree and quality of chromosome condensation for each treatment. The level of condensation and quality of chromosome spreads were determined by 4 diamidino2 phenylindole dihydrochloride hydrate (DAPI) staining. Slides containing fixed chromatin were mounted under coverslips with Vectashield mounting medium containing DAPI (Vector Laboratories, Burlingame, CA, USA) and visualized at 1000X under oil using a Zeiss Axioplan 2 epifluorescence microscope equipped with an Axiocam MRM digital cam era and Axiovision 3.1 software (Carl Zeiss MicroImaging Inc., Thornwood, NY, USA). Fixed blastomeres containing an interphase nucleus were considered not having undergone PCC. Blastomeres that did not contain interphase nuclei, but contained condensed chr omatin were considered to have undergone PCC. This group was further subdivided based on the quality of the chromosome condensation. Condensed chromatin containing defined chromosomes (blastomeres in G1 or G2/M phase), in which individual chromosomes could be counted or used for chromosome painting were considered suitable for cytogenetic analysis, whereas chromatin that was loosely condensed, or chromatin which was pulverized (blastomeres in S phase) and individual chromosomes could not be well defined wer e deemed unsuitable for cytogenetic analysis. Fluorescence I n S itu H ybridization A nalysis Chromosome spreads obtained from bovine blastomeres treated with calyculinA and deemed suitable for cytogenetic analysis were analyzed using FISH with a two-

PAGE 99

99 color X Y chromosome paint set following a modified version of the manufacturer's protocol (Cambio, United Kingdom). Briefly, slides containing chromosome spreads were washed in 2 SSC (Sigma) for 5 minutes at room temperature and then dehydrated by washing through a series of 70, 85, and 100% ethanol solutions for 1 minute each. After air drying at room temperature, a 10 l premix of biotin labeled X and Cy3labeled Y was applied to the area of the slide containing the chromosomes, coverslipped, and sealed with parafilm. The chromosomes and probes were codenatured at 75C for 2 minutes on a d ry b ath i ncubator (Fisher Scientific, Pittsburgh, PA, USA), and then the slide was transferred to a prewarmed humidified chamber and incubated in the dark at 37C overnight. Following hybridization, coverslips were removed and slides were washed at 45C for 5 minutes each in Coplin jars (Fisher Scientific) containing stringency wash solution [formami de:1X SSC (1:1); (Sigma)], 1 X SSC (Sigma), and detergent wash solution [4X SSC (Sigma) + manufacturer supplied detergent DT (Cambio)]. Blocking protein and biotin detection agent (100 l ) were applied to each slide, covered with parafilm, and incubated in a humidified box for 20 minutes at 37C. Slides were then washed for 10 minut es in detergent wash solution at room temperature and allowed to air dry before applying 20 l of mountant containing DAPI (Cambio) and a coverslip. Chromosome spreads were visualized at 1000X under oil using a Zeiss Axioplan2 epifluorescence microscope as described above. Chromosome counting and ploidy assessment were determined by cytogenetic criteria previously described by McCauley and coworkers [263] Briefly, embryos in which all blastomeres counted contained 2 sets of chromosomes (2 N = 60 chromosomes ) were scored as diploid. Likewise, embryos in which all blastomeres

PAGE 100

100 counted contained one set of chromosomes (1N = 30 chromosomes) were scored as haploid, and embryos in which all blastomeres counted contained three or more sets of chromosomes were scored as polyploid. Embryos containing a mixture of haploid, diploid, or polyploid blastomeres were considered mixoploid. Statistical A nalysis Data for PCC rate and degree and quality of condensation were analyzed by chi square. Multiple comparisons were made using PROC MULTTEST procedures of SAS with Bonferroni P value adjustments. Significance was deemed P < 0.05. Results Experiment 1: E ffects of C alyculin A D uration on B ovine B lastomeres Blastomeres from 16 bovine IVP eight cell stage embryos were evaluated f or calyculin A duration during 4 repetitions of Experiment 1 ( Table 51 ) No morphological differences were observed between blastomeres prior to fixation for each treatment. In addition, no blastomeres lysed during hypotonic treatment. Duration of calyculinA treatment affected the frequency of blastomeres undergoing PCC, as fewer blastomeres treated for 0 and 60 minutes underwent PCC when compared to 120 and 180 minutes ( P < 0.005). Blastomeres not responding to calyculinA t reatment contained intact interphase nuclei ( Figure 51A ) The frequency of blastomeres with defined chromosomes varied by treatment, with 120 minutes giving the best results (57%). Nontreated control blastomeres had 6% mitotic c ells D espite >90% of blastomeres undergoing PCC after 120 minutes not all blastomeres were suitable for cytogenetic analysis. The effects of calyculinA were dependent upon cell cycle stage of the blastomeres. Chromatin of blastomeres was sometimes in completely condensed ( Figure 5 1B ) whereas blastomeres in S phase

PAGE 101

101 appeared to be chaotically condensed ( Figure 51 D ), or pulverized, in which distinct chromosomes could not be differentiated ( Figure 51E ). Chromosomes deemed suitable for analysis were either from blastomeres treated in G1 or G2/M phase of the cell cycle ( Figure 51C and 5 1F ). Experiment 2: E ffects of C alyculin A C oncentration on B ovine B lastomeres Individual blastomeres ( n = 283) from 35 bovine IVP embryos at the eight cell stage were used during six repetitions of Experiment 2 to determine optimal concentration ( Table 5 2 ). No morphological differences were detected in blastomeres between each treatment, and no blastomeres lysed during hypotonic treatment. Preliminary experiments testing doses up to 750 nM calyculin A (data not shown) indicated that when concentrations exceeded 150 nM, blastomeres also underwent cellular blebbing and subsequently ruptured when transferred to hypotonic solution. Concentration of calyculinA affected the frequency of blastomeres undergoing PCC, resulting in nearly a 3fold increase over colcemidtreated control blastomeres. Blastomeres treated with 50 or 100 nM calyculin A had a higher frequency of PCC compared to blastomeres treated with 10 nM calyculin A ( P < 0.005). In addition, blastomeres treated with 50 nM calyculin A had a higher frequency of defined chromosomes deemed suitable for cytogenetic analysis, as compared to blastomeres treated with 10 nM calyculinA ( P < 0.005). Blastomeres that underwent PCC, but were deemed unsuitable for cytogenetic analysis had chromatin that appeared chaotic ally condensed ( Figure 51D ) or pulverized ( Figure 51E ). In comparison, vehicle treated controls had only 3.5% mitotic cells after 2 h ours whereas colcemid treatment captured 32.7% in metaphase after 16 h ours

PAGE 102

102 Experiment 3: E ffects of C alyculin A on M urine B lastomeres Experiment 3 included 207 blastomeres recovered from 62 Day 2 murine embryos during two repetitions to evaluate optimal dose ( Table 53 ). No morphological dif ferences were observed between treatments; however, during the fixation process 17 blastomeres (29%) from the 120 minutes calyculin A treatment lysed in hypotonic solution and could not be used for analysis. Blastomeres remained intact in all other treatments. Following fixation, blastomeres treated with calyculinA for 90 and 120 minutes had higher frequencies of PCC (90 and 100%, respectively) than 0 or 60 minutes ( P < 0.05). This was 13fold greater than mitotic cells observed in the control group. There were no differences in the degree of chromosome condensation between calyculin A treatments and averaged 24.7%. Blastomeres undergoing PCC appeared to be similar to bovine blastomeres, exhibiting similar cell cycle effects, with no preference between treatments ( Figure 52 ). Experiment 4: C alyculin A U se for P reimplantation C ytogenetic A nalysis of Day 3, E ight C ell S tage B ovine E mbryos Chromosome spreads from blastomeres of 11 bovine IVP embryos were assessed by FISH, to determine the usefulness of calyculin A treatment for cytogenetic analysis and sex determination of embryos ( Table 54 ). Seven blastomeres were lost during fixation and those remaining were used for analysis. Overall, 100% of the blastom eres analyzed underwent PCC, and 85% of blastomeres contained defined chromosomes. Normal, diploid blastomeres were observed in 93% of all blastomeres with defined chromosomes. Four embryos (36%) were considered mixoploid, containing combinations of diploid ( Figure 53A and B ), haploid ( Figure 53C ), and tetraploid

PAGE 103

103 ( Figure 53D ) blastomeres, however, numbers of chromosomally abnormal blastomeres were low in mixoploid embryos (14 22%). Overall, no sex chromosome specific aneuploidies were observed among blastomeres and the ratio of female to male embryos was 6 5 ( Table 5 4 ; Fig. 5 3B and A respectively). Male fibroblast control slides were used to validate the FISH assay. Twenty metaphase spreads from each FISH fibroblast control slide were analyzed with greater than 80% detection of both X and Y chromosomes. There were no diff erences in hybridization efficiencies between blastomeres and control fibroblasts. Finally, intact bovine embryos treated with calyculinA at the optimal dose (50 nM) for 30, 60 or 120 minutes failed to resume development when returned to culture in KSOM t o Day 7, as compared to vehicle treated control embryos that developed to the blastocyst stage (40%). Discussion In this study we tested calyculinA, an inhibitor of serine/threonine phosphatases, as an improved chemical approach for inducing premature chromosome condensation suitable for cytogenetic analysis of preimplantation bovine and murine embryos. The degree and quality of condensed chromosomes was affected by blastomere cell cycle phase, as well as dose and duration of calyculinA treatment. In a ddition, using a whole chromosome paint set along with DAPI counterstaining, we demonstrated that condensed chromosomes from calyculinA treated bovine blastomeres were suitable for cytogenetic analysis by FISH. Multiple studies of IVP embryos have reporte d chromosomal abnormalities varying between 15 and 80% in domestic species [263 267] and in humans [15, 268271] ; however, the incidence of live born mammals with chromosomal abnormalities

PAGE 104

104 remains lower, suggesting that chromosomal abnormalities contribute to the high incidence of embryonic and fetal losses following embryo transfer. This has led to considerable interest in trying to study chromosomal abnormalities in IVP embryos. To date, most cytogenetic studies of embryos have relied on interphase FISH and therefore, have not provided insight into full karyotypes. Although alternative approaches to trap or induce metaphase chromosomes for more detailed cytogenetic studies of embryos have proven to be more informative than interphase FISH, the techniques i nvolved are laborious, inefficient and time consuming. Our approach, using calyculinA to achieve chromosome condensation in blastomeres, was more efficient and required a shorter duration than colcemid, which is traditionally used for cytogenetic studies. The potency of calyculinA can be attributed to its ability to induce chromosome condensation of cells in G1, S, and G2/M of the cell cycle, whereas colcemid is limited to cells that have entered mitosis. This versatility clearly makes calyculinA advantageous for attaining condensed chromosomes in the shortest duration. Since the selection or induction of cells in G1 or G2/M prior to PCC is not possible with blastomeres, this study evaluated all blastomeres regardless of cell cycle stage. Retrospective analysis of chromosomes showed PCC in blastomeres treated in G1 and G2/M were representative of those spreads deemed suitable for cytogenetic analysis. Chromatin from blastomeres in S phase appeared either pulverized or presented interspersed blocks of condensed and noncondensed chromatin, as described by El Achkar and coworkers [272] and were not suitable for cytogenetic analysis.

PAGE 105

105 The fourth cell cycle post fertilization in the bovine embryo is the longest and is associated with embryonic genome activation It takes 38 49 h to complete cell divisions in order to develop from the eight cell stage to the 16cell stage [273 275] which allows ample time to complete embryo biopsies and blastomere treatments. We demonstrate here that calyculinA, under optimal c onditions, can induce PCC in 100% of bovine blastomeres treated at the eight cell stage. However, between 15 and 47% are unsuitable for analysis, probably due to cells being treated in the S phase of the cell cycle. This suggests that 53 85% of blastomeres were in G1/G2/M phases of the cell cycle. Extended exposure of blastomeres to calyculinA had an adverse effect on chromosome condensation. Although calyculinA treatment of bovine blastomeres for 3 h ours had the greatest frequency of PCC, chromosomes wer e often over condensed and could not be utilized for further analysis. Interestingly, murine blastomeres showed a similar adverse effect with prolonged exposure to calyculinA; however, the cutoff time for optimal condensation was shorter than for bovine. This over condensed chromatin morphology was also reported by Swain and coworkers [276] when murine oocytes were cultured with calyculinA for an extended period of time (7 h ours ) and no distinct resolution of chromosomes was achieved. They attributed thi s effect to hyperphosphorylation of histone H3 on Ser 10 and Ser 28, that may be detrimental to proper chromatin remodeling required for the formation of chromosomes. Calyculin A also had adverse effects when blastomeres were exposed to doses of 100 nM or more. Whereas blastomeres treated with 10 nM frequently had incomplete chromatin condensation, resembling early prophase chromosomes, treatment with

PAGE 106

106 100 nM calyculin A resulted in over condensed chromatin similar to blastomeres exposed to durations longer than 2 h ours Taken together, we inferred that duration and concentration of calyculinA must be carefully monitored to achieve optimal chromosome condensation and to avoid deleterious effects, such as over condensation, which will negatively affect cytogenetic analysis. Employing optimal conditions in Experiment 4, we demonstrated that blastomeres treated with calyculinA can be used to screen for chromosome abnormalities. Out of 11 embryos analyzed, 4 (36%) were mixoploid containing haploid or polyploid blastomeres in combination with normal diploid blastomeres; however, only a small percentage of cells within each of these embryos were chromosomally abnormal. Mixoploidy can arise either from the fusion of blastomeres or the failure of cell division follow ing chromosome replication [277, 278] Although live offspring may be produced from mixoploid embryos if polyploid blastomeres are sequestered within the extraembryonic tissues, Viuff and coworkers [279] suggest that embryos with a large contribution of polyploid cells to the trophoblast lineage could contribute to the incidence of large offspring syndrome. It is also important to note that given the limitations of determining stage of cell cycle of bovine blastomeres, along with the resolution of bovine chromosomes, we cannot ignore the possibility that some of the tetraploid cells observed in embryos 7 and 11 could have been G2/M cells that underwent premature centromere division (PCD) [218] Notwithstanding, our results were similar to previous studies of bovine IVP embryos that reported a range of mixoploidy from 12 to 72% [279, 280]

PAGE 107

107 Interestingly, the only sex chromosomal abnormalities we observed were limited to the mixoploid embryos. In addition, we did not observe any sex chromosome aneuploidies, whi ch was consistent with a detailed preimplantation genetic study of human embryos that reported only 1.2% of analyzed embryos had aneuploidies associated with sex chromosomes [184] Although sex chromosome aneuploidies are low, we chose this as our model, s ince we have good positive control male cell lines and X Y paint probes are commercially available. Future efforts can focus on specific chromosomes of interest, but will require developing new chromosome paint probes. Fixation of chromosomes from bovine blastomeres proved to be challenging. Unlike human and murine blastomeres, bovine blastomeres from in vitro produced embryos have a high lipid content, which can readily be seen upon addition of fixative solution. The lipid droplets tend to associate with c hromatin, making it challenging to remove excess lipid without losing chromatin. Future studies therefore, will need to develop fixation methods or improve culture conditions [281] that can overcome the problems associated with this high lipid content in bovine IVP embryos. In addition, future cytogenetic studies of bovine IVP embryos will need to address methods to perform detailed karyotypes. A normal bovine cell contains 60 chromosomes, of which all the autosomes are acrocentric making traditional staini ng methods, such a G banding, more difficult. Spectral karyotyping using whole chromosome paint probes could overcome the shortcomings of G banding, however chromosome painting probes are commercially available only for chromosomes 1, 29, X, and Y. Murine embryos were also evaluated in this study in an attempt to demonstrate the versatility of calyculinA for inducing PCC in embryos other than bovine. Although

PAGE 108

108 murine embryos had been cryopreserved at the twocell stage, they were all thawed and cultured overnight, and all embryos developed to the eight cell stage. Therefore, we concluded that embryo cryopreservation did not alter results. Interestingly, murine blastomeres were more sensitive to calyculinA, so dose titrations tested differed from the bovine experiments taking this into account. Although we did achieve high frequencies of blastomeres undergoing PCC similar to bovine, the degree and quality of condensation was often poor and insufficient for further cytogenetic analysis. Likewise, using human blastomeres, Shkumatov and coworkers [282] found calyculinA produced low rates of well spread metaphase chromosomes. We inferred that calyculinA may have species specific activity. An alternative possibility is that PCC induced by calyculinA may b e affected by Ca2+free medium. Interestingly, we obtained higher frequencies of chromosomes suitable for cytogenetic analysis in Experiment 4, in which embryos were not predisposed to Ca2+free medium prior to calyculinA treatment. We speculated that the se differences could be due to a disruption in intracellular calcium release. To support this hypothesis, studies using cell lines of human fibroblasts and lymphocytes demonstrated that inclusion of a calcium ionophore with calyculinA improved PCC and qua lity of chromosome spreads [261, 283] Another unexpected finding was that treating whole embryos with calyculinA (Experiment 4) improved PCC over treating individual blastomeres (Experiments 1 3). Methods for preimplantation genetic diagnosis (PGD) routi nely involve the isolation of individual blastomeres, whereas the biopsied embryos are returned to culture during the analysis. Eriksson and coworkers [284] previously reported that the effects of calyculin-

PAGE 109

109 A were reversible in BHK 21 fibroblasts. Therefor e, as the next step for improving this technique for possible use in PGD, we tested whether calyculinA effects were reversible when treating whole bovine embryos. Unfortunately, exposure of embryos to calyculin A for as little as 30 minutes was sufficient to induce irreversible cellular arrest, and treated embryos failed to resume development. Although the highest frequency of PCC is obtained with whole embryo incubation, it is not feasible for use in blastomere biopsy schemes due to its irreversible toxic ity in embryos at this dose. In conclusion, we inferred that calyculinA can rapidly induce PCC in blastomeres for preimplantation cytogenetic studies of bovine and murine embryos, but the degree of chromosome condensation may not always be suitable for de tailed cytogenetic analysis from a single blastomere, depending upon its cell cycle phase. Table 51. Effects of calyculin A duration on inducing PCC in bovine blastomeres Duration (minutes) No. of blastomeres analyzed No. of blastomeres undergoing PCC (% ) No. of blastomeres suitable for cytogenetic analysis (%) 60 26 8 (31) a 3 (12) a 120 35 32 (91) b 20 (57) b 180 34 33 (97) b 17 (50) b Non treated 33 2 (6) c 2 (6) a Treatments within columns with different superscript letters differed ( P < 0.01).

PAGE 110

110 Figure 5 1 Calyculin A induces premature chromosome condensation (PCC) in blastomeres from Day 3, eight cell stage bovine IVP embryos (Day 0 = fertilization). The degree of chromatin condensation was determined by DAPI counter staining and epifluorescence microscopy at 1000. (A) Interphase nucleus, considered to not have undergone PCC. (B) Loosely condensed bovine chromatin, as is seen in late G1 phase of the cell cycle. (C) Defined bovine chromosomes, normal G1. (D) Chaotically condensed bovine chromatin, indicative of a cell treated in S phase of the cell cycle. (E) Pulverized bovine chromatin, indicative of a blastomere treated in S phase of the cell cycle. (F) Defined bovine chromosomes, 60 chromosomes, normal G2/M.

PAGE 111

111 Table 52. Effects of calyculin A concentration on inducing PCC in bovine blastomeres. Concentration (nM) No. of blastomeres analyzed No. of blastomeres undergoing PCC (%) No. blastomeres suitab le for cytogenetic analysis (%) 10 53 19 (35.8) a 12 (22.6) ab 50 59 56 (94.9) b 31 (52.5) c 100 59 58 (98.3) b 22 (37.3) bc Control (DMSO) 57 2 (3.5) c 2 (3.5) a Control (colcemid) 55 18 (32.7) a 18 (32.7) bc Treatments within columns with different superscript letters differed ( P < 0.005). Table 53. Effects of calyculin A duration on inducing PCC in murine blastomeres. Duration (minutes) Reps No. of blastomeres analyzed No. of blastomeres undergoing PCC (%) No. of blastomeres suitable for cytogenetic analysis (%) 60 1 35 15 (42.9) a 7 (20.0) ab 90 2 59 53 (89.8) b 20 (33.9) b 120 1 41 41 (100.0) b 8 (19.5) ab Control (non treated) 2 55 4 (7.3)c 4 (7.3)a Treatments within columns with different superscript letters differed ( P <0.05).

PAGE 112

112 Figure 5 2. Calyculin A induces PCC in blastomeres from Day 2, eight cell stage murine embryos (Day 0 = fertilization). The degree of chromatin condensation was determined by DAPI counter staining and epifluorescence microscopy at 1000. (A) Interphase nucleus, c onsidered to not have undergone PCC. (B) Defined murine chromosomes, abnormal 80 chromosomes, tetraploid, G1. (C) Chaotically condensed murine chromatin, as seen in a blastomere in S phase. (D) Defined murine chromosomes, 80 chromosomes, tetraploid, G2/M.

PAGE 113

113 Table 54. Cytogenetic analysis of blastomeres from bovine embryos treated with calyculinA Embryo No. of blastomeres per embryo No. of blastomeres analyzed No. of analyzed blastomeres undergoing PCC (%) No. of analyzed blastomeres sui table for cytogenetic analysis (%) Ploidy Gender 1 8 8 8 (100 .0 ) 8 (100.0) Diploid Male 2 12 10 10 ( 100.0) 9 ( 9 0 .0 ) Mixiploid (haploidx2, diploidx7) M ale 3 8 8 8 (100 .0 ) 6 ( 75 .0) Diploid Female 4 8 8 8 (100 .0 ) 7 ( 87.5 ) Diploid Female 5 7 5 5 (100 .0 ) 5 ( 100.0 ) Diploid Female 6 7 7 7 (100 .0 ) 7 ( 100.0 ) Diploid Male 7 7 6 6 (100 .0 ) 5 ( 83.3) Mixaploid (diploidx4, tetraploidx1) Female 8 9 8 8 (100.0) 7 (87.5) Diploid Male 9 10 10 10 (100.0) 4 (40.0) Diploid Female 10 8 8 8 (100.0) 7 (87.5) Mixiploid (haploidx1, diploidx6) Male 11 8 7 7 (100.0) 7 (100.0) Mixiploid (diploidx6, tetraploidx1) Female Total 92 85 85 (100.0) 72 (84.7) 7 Diploid (63.6%) 6 Female (54.5%), 5 Male (45.5%)

PAGE 114

114 Figure 53. Cytogenetic analysis of bovine blastomeres treated with calyculinA. Blastomeres with defined chromosomes were hybridized with an X Y specific, whole chromosome paint probe set [biotinlabeled X (green) and Cy3 labeled Y (red); Cambio] and counter stained with DAPI. Images were captured at 1000 using epifluorescence microscopy. (A) Diploid, 60,XY, normal male. (B) Diploid, 60,XX, normal female. (C) Haploid, 30, 0Y, abnormal male. (D) Tetraploid, 120, XXXX, abnormal female.

PAGE 115

115 CHAPTER 6 SUMMARY, CONCLUSIONS AND FINAL REMARKS The field of assisted reproduction has undergone many changes since the birth of the first IVF baby more than 30 years ago. Compared to the early days of IVF, the success and range of treatment options has seen tremendous improvement. Initially, IVF was limited to treatment of female infertility, covering only 1/3 of all infertility cases. For the laboratorys part, the early procedures were fairly simple and involved mixing of sperm with oocytes within a petri dish and following fertilization selecting resulting embryos for transfer back to the uterus. Today though, with the development of complex procedures such as ICSI, assisted hatching, oocyte and embryo cryopreservation and PGD, treatment options are no longer lim ited to female infertility. For instance, most male factor infertility can now be routinely treated with ICSI. In addition, patients diagnosed with cancer have a number of oncofertility options to help preserve their fertility following treatment, including cryopreservation of oocytes, sperm and embryos. Furthermore, patients who carry genetic abnormalities can undergo PGD to avoid the transfer of affected embryos and in some cases even select embryos that match an older siblings immune components, providi ng a source of stem cells that can treat and hopefully save a siblings life. As these IVF procedures have increased in complexity, so have government regulations enacted to ensure that laboratories and persons within the laboratories performing such compl ex procedures are qualified. This dissertation is part of the requirements of a newly developed doctorate program with an emphasis in clinical embryology. Among the goals of this program are to expose students to the fundamental principles of embryology, g eneral laboratory knowledge, quality control and quality assurance, and the development of clinical and

PAGE 116

116 experimental research programs. As such, this dissertation incorporates many of these aspects through investigations of the effects of GnRH analogs on ovarian expression of miRNAs, effects of macromolecules during embryo cryopreservation, and the effects of a specific protein phosphatase inhibitor, calyculinA, on the induction of chromosome condensation for the purpose of chromosomal analysis of in vitro produced embryos. Effects of GnRH Analogs on Ovarian Expression of MiRNAs Common practice for patients seeking IVF treatment is to undergo controlled ovarian stimulation utilizing GnRH analogs in order to prevent a premature surge of LH. Since the int roduction of GnRH agonist and antagonist protocols, there have been observed differences in follicular and serum steroid concentrations and pregnancy outcomes between analog protocols that have led to the suggestion that GnRH agonists and antagonists may d irectly and differentially affect ovarian function. While a molecular mechanism remains unknown, hormone treatment, including hCG/LH [107] and FSH [108] have recently been shown to d ifferentially affect the expression of miRNAs in granulosa cells. In addit ion, differential expression of miRNAs were shown in another report to affect the release of ovarian steroids P4, T, and E2 [110] Based partially on these studies, a hypothesis was formulated for the current study stating that GnRH a gonists and GnRH ant agonists directly and differentially regulate the expression of ovarian miRNAs which affect s the expression of their predicted target genes and influences ovarian function. To test this hypothesis, granulosa cells, collected from patients undergoing stimul ation with GnRH agonist and antagonist protocols, as well as a granulosa cell line treated with GnRH agonist and antagonist, were analyzed using realtime quantitative PCR to compare differences in expression of select miRNAs and mRNAs.

PAGE 117

117 Results from these experiments indicate greater expression of mir 26a, mir 34a, mir 98, mir 133b, mir 195 and mir 497 in granulosa cells from patients treated with GnRH antagonists compared to GnRH agonist, lending support to the hypothesis that GnRH analogs differentially affect miRNA expression in ovarian tissue. However, the expression patterns of the same miRNAs were not significantly different in the granulosa cell line treated with GnRH agonist and antagonists, suggesting the observed differences in miRNAs in granulosa cells from patients were not a direct affect of GnRH analogs. An alternative explanation is that the granulosa cell line is not a representative model of in vivo function. However, overall expression patterns of miRNAs in granulosa cells from patients were similar to miRNA expression patterns in the granulosa cell line. In addition, GnRH analogs differentially affected the expression of AREG, GATA4, and CYP19A1 mRNA in the granulosa cell line demonstrating that these cells were capable of directly responding to GnRH agonist and antagonist treatments. Based on these results, the observed miRNA differences in granulosa cells from patients are most likely explained by GnRH analogs indirectly affecting the expression of ovarian miRNAs, possibly through modulation by endogenous hormones. A limitation of this study is that a traditional nontreated control was not included among the patients. The inclusion of a group that does not receive either GnRH analog would have helped elucidate the indirect effects of GnRH agonist and antagonists on ovarian expression of miRNAs. However, to not administer either GnRH analog is not practical as the patient would be at an increased risk for premature LH surge. This could lead to loss of oocytes and cancelation of the IVF cycle.

PAGE 118

118 Another limitation was the sample size. With so few patients included in the study, the differences in miRNA expression may not necessarily be clinically significant. Perhaps, with a larger sample size and more detailed patient information, it may be possible to determine the relevance of the differential expression of miRNAs. Conclusions drawn from this study are that GnRH analog stimulation protocols differentially regulate ovarian expression of miRNAs. Since miRNAs may regulate the expression of 30% of all genes (246), any changes in ovarian expression of a given miRNA could have profound effects on the expression of many other genes affecting processes essential to ovarian function. This is a major concern that warrants further investigations, as fol liculogenesis and steroidogenesis may be affected by differential ovarian miRNA expression in response to GnRH analog stimulation protocols and ultimately affects patient response and reproductive success. Effects of Macromolecules on Embryo Cryopreservation This area of investigation focused on the utilization of a globulinrich protein source in cryopreservation protocols for improving thaw survival of blastocysts. globul ins in embryo culture medium, promote s blastocyst hatching [118, 122, 247] and implantation [119, 120, 248] Several mechanisms have been proposed to explain the promoting effects, including the alteration of the physiochemical environment surrounding the embryo through interactions of macromolecules with water molecules [5]. Since osmoregulation of water molecules is a vital component of embryo cryopreservation, t he current investigation tested the hypothesis that freeze and thaw solutions supplemented wit h globulin rich proteins would improve embryo thaw survival. To test this hypothesis, animal experimental studies compared thaw survival rates of

PAGE 119

119 murine blastocysts cryopreserved using freeze and/or thaw solutions supplemented with HSA or the globulinrich protein source, SSS. Following the thaw of murine blastocysts, higher rates of reexpansion and moderately higher total cell numbers were found in those frozen and thawed in solutions containing SSS compared to HSA, supporting the hypothesis th at globuli n rich protein supplementation improves embryo thaw survival. While the current study did not investigate a potential mechanism, the findings are consistent with the proposed mechanism by Pool and Martin that high number s and orientation of hydroxyl groups ( OH) in polyhydroxy compounds globulins, interact with water molecules affecting physical properties such as water exchange dynamics While the overall results are promising, there are several limitations with the current study that ne ed to be addressed. The true potential of the thawed blastocysts is unknown, as murine blastocysts were not transferred to recipients. In defense, total cell numbers, which have been positively correlated with implantation potential [254] were higher for the SSS treatment, and therefore implantation potential would be expected to be greater for blastocysts frozen and thawed in solutions containing SSS compared to HSA. The present study utilized a commercially available protein source containing a fixed mix globulins. While this mixture produced good overall thaw survival rates, other concentrations of globulins may be more beneficial. The experimental design used a murine system and the results may n ot translate to human embryo cryopreservation. Murine embryos, however, are an accepted system for quality control testing of clinical conditions. In addition, results from the retrospective analysis of human clinical data, although limited by sample size, are

PAGE 120

120 consistent with the results obtained from the murine experiments. The experiments within the current study focused on control rate cryopreservation, which is slowly being phased out in favor of vitrification. Whether globulins would improve survival of vitrified embryos remains unknown; however, many of the successful published vitrification protocols incorporate globulinrich proteins sources, such as SSS, suggesting the observed results are probably applicable to vitrification technology. The conclusion from this investigation is that supplementation of freeze and thaw solutions with a protein source containing high fractions of globulins, such as SSS, promotes thaw survival. With increasing restrictions placed on the number of embryos that can be transferred to the uterus, improvements in embryo cryopreservation, as discussed in this study, will undoubtedly allow for better utilization of remaining embryos. E ffects of Calyculin A on the Induction of Chromosome Condensation for Genetic Anal ysis of Embryos Chromosomal abnormalities are estimated to occur in 5070% of preimplantation embryos [6, 12 19] As these abnormalities are thought to be a majo r cause of implantation failure, there is a tremendous need for technologies capable of screening embryos prior to transfer to the uterus. Unfortunately, traditional cytogenetic approaches for assessment of chromosomal abnormalities utiliz e FISH technology on interphase nuclei which limit s the number of chromosomes that can be analyzed at one time and more importantly is associated with high error rates [6 11] In an attempt to overcome the limitations of interphase FISH, the present study investigated the induction of PCC in bovine and murine blastomeres using a specific protein phosphatase inhibitor, calyculin A to obtain condensed chromosomes suitable for full cytogenetic analysis.

PAGE 121

121 Results from this study demonstrate calyculinA induced chromosome condensation of bovine and to a less er extent murine blastomeres; however, the quality of condensation was dose, time, and cell cycle stage dependent. Overall, the most effective conditions for inducing PCC in bovine blastomeres were 120 minute exposure to 50 nM calyculinA. Though optimized conditions resulted in high rates of PCC in blastomeres, there are several limitations that may hinder the application of this technology. 1) A large fraction of blastomeres yielded condensed chromatin unsuitable for cytogenetic analysis, presumably because blastomeres were in S phase. PCC of cells in S phase is associated with chaotic chromatin which cannot be further studied. As the phase of the cell cycle is difficult to ascertain prior to embryo biopsy, there is a risk that the selected blastomere may be in S phase and therefore a diagnosis of the biopsied embryo will not be able to be determined. 2) CalyculinA may be limited to bovine blastomeres. In the present study, calyculinA was less effective for inducing PCC in murine blastomeres. Additionall y, another study reported fewer than 60% of human blastomeres underwent PCC with calyculin A, and of those only 17% were suitable for analysis [282] Together these results suggest induction of PCC in blastomeres with calyculinA is species limited, such as bovine. 3) High lipid content in bovine embryos complicates fixation and impedes analysis. Lipid droplets, which can be readily seen upon addition of fixative solution, tend to associate with chromatin making it difficult to remove excess lipid without l osing chromatin. This is a major concern as any lost chromatin can lead to misdiagnosis.

PAGE 122

122 Conclusions to be drawn from this study are that calyculinA can rapidly induce PCC in blastomeres, but the quality of chromosome condensation may not be suitable for cytogenetic analysis. As such, the application of PCC is not an acceptable method for chromosomal screening of embryos. Final Remarks For more than 30 years, the field of assisted reproduction has been pioneered by clinicians and scientists wh ose achievements in clinical and basic research have led to improvements in technical applications advancing reproductive medicine. Unfortunately, many of these the early pioneers are preparing to reti re, leaving a void of scientific knowledge and clinical experience. As such, the field of assisted reproduction is at a crossroads and will require a new generation of uniquely qualified personnel to continue scientific and clinical efforts. Within the field of assisted reproduction, the area most likely to be affected is the laboratory, as few academic programs exist to prepare future leaders in embryology laboratory sciences. Unlike technical laboratory experience, which can be gained with repetition, the acquisition of the fundamental principles embryology r equires careful study of scientific and academic literature. In addition, general understanding of quality control and clinical and basic research are necessities, as embryology is a clinical science requiring careful monitoring of clinical parameters, as well as knowledge of scientific methodology to ensure clinical advances. Th e investigations within this dissertation were designed to incorporate knowledge of embryology with quality control, clinical research, and basic scientific research to further our understanding of several areas of assisted reproduction, including the effects of ovarian stimulation on granulosa cells the effects of globulin proteins on embryo cryopreservation, and the usefulness of chemical induction of

PAGE 123

123 premature chromosome condens ation for chromosomal screening of preimplantation embryos. The majority of the results from these individual investigations are typical of many studies, in that some outcomes, although significant, have little or no clinical relevance; however, a few observations, such as the potential for improved post thaw survival with the utilization of globulinrich proteins in cryopreservation solutions, may have clinical application. In any case, these investigations together provide an understanding of clinical and scientific methods that are fundamental for the knowledge base of future embryologists who will be able to bring translational research from the laboratory to the reproductive bedside.

PAGE 124

124 LIST OF REFERENCES 1. Anderson AR, Weikert ML, Crain JL. Determining the most optimal stage for embryo cryopreservation. Reprod Biomed Online 2004; 8: 207211. 2. Veeck LL, Bodine R, Clarke RN, Berrios R, Libraro J, Moschini RM, Zaninovic N, Rosenwaks Z. High pregnancy rates can be achieved after freezing and thawing human blastocysts. Fertil Steril 2004; 82: 14181427. 3. Liebermann J, Tucker MJ. Comparison of vitrification and conventional cryopreservation of day 5 and day 6 blastocysts during clinical application. Fertil Steril 2006; 86: 2026. 4. Kuwayama M, Vajta G, Ieda S, Kato O. Comparison of open and closed methods for vitrification of human embryos and the elimination of potential contamination. Reprod Biomed Online 2005; 11: 608614. 5. Pool TB, Martin JE. High continuing pregnancy rates after in vitro fertilizationembryo transfer using medium supplemented with a plasma protein fraction containing alphaand betaglobulins. Fertil Steril 1994; 61: 714719. 6. Magli MC, Gianaroli L, Ferraretti AP, Lappi M, Ruberti A, Farfalli V. Embryo morphology and development are dependent on the chromosomal complement. Fertil Steril 2007; 87: 534541. 7. Colls P, Escudero T, Cekleniak N, Sadowy S, Cohen J, Munne S. Increased efficiency of preimplantation genetic diagnosis for infertility using "no result rescue". Fertil Steril 2007; 88: 5361. 8. Munne S, Sandalinas M, Escudero T, Marquez C, Cohen J. Chromosome mosaicism in cleavagestage human embryos: evidence of a maternal age effect. Reprod Biomed Online 2002; 4: 223232. 9. Coulam CB, Jeyendran RS, Fiddler M, Pergament E. Discordance among blastomeres renders preimplantation genetic diagnosis for aneuploidy ineffective. J Assist Reprod Genet 2007; 24: 3741. 10. Li M, DeUgarte CM, Surrey M, Danzer H, DeCherney A, Hill DL. Fl uorescence in situ hybridization reanalysis of day 6 human blastocysts diagnosed with aneuploidy on day 3. Fertil Steril 2005; 84: 13951400. 11. Baart EB, Van Opstal D, Los FJ, Fauser BC, Martini E. Fluorescence in situ hybridization analysis of two blas tomeres from day 3 frozenthawed embryos followed by analysis of the remaining embryo on day 5. Hum Reprod 2004; 19: 685693.

PAGE 125

125 12. Munne S, Alikani M, Tomkin G, Grifo J, Cohen J. Embryo morphology, developmental rates, and maternal age are correlated with chromosome abnormalities. Fertil Steril 1995; 64: 382391. 13. Munne S, Chen S, Colls P, Garrisi J, Zheng X, Cekleniak N, Lenzi M, Hughes P, Fischer J, Garrisi M, Tomkin G, Cohen J. Maternal age, morphology, development and chromosome abnormalities in over 6000 cleavagestage embryos. Reprod Biomed Online 2007; 14: 628634. 14. Delhanty JD, Harper JC, Ao A, Handyside AH, Winston RM. Multicolour FISH detects frequent chromosomal mosaicism and chaotic division in normal preimplantation embryos from fertile patients. Hum Genet 1997; 99: 755760. 15. Marquez C, Sandalinas M, Bahce M, Alikani M, Munne S. Chromosome abnormalities in 1255 cleavagestage human embryos. Reprod Biomed Online 2000; 1: 17 26. 16. Kuliev A, Cieslak J, Ilkevitch Y, Verlinsky Y. Chromo somal abnormalities in a series of 6,733 human oocytes in preimplantation diagnosis for agerelated aneuploidies. Reprod Biomed Online 2003; 6: 5459. 17. Verlinsky Y, Cieslak J, Ivakhnenko V, Evsikov S, Wolf G, White M, Lifchez A, Kaplan B, Moise J, Vall e J, Ginsberg N, Strom C, Kuliev A. Chromosomal abnormalities in the first and second polar body. Mol Cell Endocrinol 2001; 183 Suppl 1: S4749. 18. Bielanska M, Tan SL, Ao A. Chromosomal mosaicism throughout human preimplantation development in vitro: incidence, type, and relevance to embryo outcome. Hum Reprod 2002; 17: 413419. 19. Magli MC, Gianaroli L, Ferraretti AP. Chromosomal abnormalities in embryos. Mol Cell Endocrinol 2001; 183 Suppl 1: S2934. 20. Kowalska A, Srebniak M, Wawrzkiewicz A, Kaminski K. The influence of calyculin A on lymphocytes in vitro. J Appl Genet 2003; 44: 413418. 21. Schally AV, Arimura A, Baba Y, Nair RM, Matsuo H, Redding TW, Debeljuk L. Isolation and properties of the FSH and LH releasing hormone. Biochem Biophys R es Commun 1971; 43: 393399. 22. Silverman AJ. The gonadotropinreleasing hormone (GnRH) neuronal systems: immunocytochemistry. In: Knobil E, Neill J (eds.), The physiology of reproduction. New York: Raven; 1988: 12831304.

PAGE 126

126 23. Rasmussen DD, Gambacciani M, Swartz W, Tueros VS, Yen SS. Pulsatile gonadotropinreleasing hormone release from the human mediobasal hypothalamus in vitro: opiate receptor mediated suppression. Neuroendocrinology 1989; 49: 150156. 24. Halvorson LM, Chin WW. Gonadotropic hormones :biosynthesis, secretion, receptors, and action. In: Yen SS, Jaffe RB, Barbieri R (eds.), Reproductive endocrinology: physiological, pathophysiology, and clinical management, 4th ed. Philadelphia: Saunders; 1999. 25. Millar RP. GnRHs and GnRH receptors. A nim Reprod Sci 2005; 88: 528. 26. Millar RP, Lu ZL, Pawson AJ, Flanagan CA, Morgan K, Maudsley SR. Gonadotropinreleasing hormone receptors. Endocr Rev 2004; 25: 235275. 27. Boime I, Garcia Campayo V, Hsueh AJ. The glycoprotein hormones and their receptors. In: Yen SS, Strauss JF, Barbieri RL (eds.), Yen and Jaffe's reproductive endocrinology: physiology, pathophysiology, and clinical management, 5th ed. Philadelphia: Saunders; 2004. 28. Ascoli M, Puett D. The gonadotropin hormones and their receptors. In: Strauss JF, Barbieri RL (eds.), Yen and Jaffe's reproductive endocrinology: physiology, pathophysiology, and clinical management, 6th ed. Philadelphia: Saunders; 2009. 29. Porter RN, Smith W, Craft IL, Abdulwahid NA, Jacobs HS. Induction of ovul ation for in vitro fertilisation using buserelin and gonadotropins. Lancet 1984; 2: 12841285. 30. Handelsman DJ, Swerdloff RS. Pharmacokinetics of gonadotropinreleasing hormone and its analogs. Endocr Rev 1986; 7: 95105. 31. Karten MJ, Rivier JE. Gona dotropinreleasing hormone analog design. Structurefunction studies toward the development of agonists and antagonists: rationale and perspective. Endocr Rev 1986; 7: 4466. 32. Reissmann T, Diedrich K, Comaru Schally AM, Schally AV. Introduction of LHRHantagonists into the treatment of gynaecological disorders. Hum Reprod 1994; 9: 769. 33. Zikopoulos K, Kaponis A, Adonakis G, Sotiriadis A, Kalantaridou S, Georgiou I, Paraskevaidis E. A prospective randomized study comparing gonadotropinreleasing hormone agonists or gonadotropinreleasing hormone antagonists in couples with unexplained infertility and/or mild oligozoospermia. Fertil Steril 2005; 83: 13541362.

PAGE 127

127 34. Olivennes F, BelaischAllart J, Emperaire JC, Dechaud H, Alvarez S, Moreau L, Nicollet B, Zorn JR, Bouchard P, Frydman R. Prospective, randomized, controlled study of in vitro fertilizationembryo transfer with a single dose of a luteinizing hormonereleasing hormone (LH RH) antagonist (cetrorelix) or a depot formula of an LH RH agonist ( triptorelin). Fertil Steril 2000; 73: 314320. 35. Hohmann FP, Macklon NS, Fauser BC. A randomized comparison of two ovarian stimulation protocols with gonadotropinreleasing hormone (GnRH) antagonist cotreatment for in vitro fertilization commencing recombinant follicle stimulating hormone on cycle day 2 or 5 with the standard long GnRH agonist protocol. J Clin Endocrinol Metab 2003; 88: 166173. 36. Engel JB, Ludwig M, Felberbaum R, Albano C, Devroey P, Diedrich K. Use of cetrorelix in combination with clomiphene citrate and gonadotrophins: a suitable approach to 'friendly IVF'? Hum Reprod 2002; 17: 20222026. 37. Engel JB, Olivennes F, Fanchin R, Frydman N, Le Du A, Blanchet V, Frydman R. Single dose application of cetrorelix in combination with clomiphene for friendly IVF: results of a feasibility study. Reprod Biomed Online 2003; 6: 444447. 38. Bahceci M, Ulug U, Ben Shlomo I, Erden HF, Akman MA. Use of a GnRH antagonist in controlled ovarian hyperstimulation for assisted conception in women with polycystic ovary disease: a randomized, prospective, pilot study. J Reprod Med 2005; 50: 8490. 39. Ragni G, Vegetti W, Riccaboni A, Engl B, Brigante C, Crosignani PG. Comparison of GnRH agonists and antagonists in assisted reproduction cycles of patients a t high risk of ovarian hyperstimulation syndrome. Hum Reprod 2005; 20: 24212425. 40. Ludwig M, Felberbaum RE, Devroey P, Albano C, Riethmuller Winzen H, Schuler A, Engel W, Diedrich K. Significant reduction of the incidence of ovarian hyperstimulation sy ndrome (OHSS) by using the LHRH antagonist Cetrorelix (Cetrotide) in controlled ovarian stimulation for assisted reproduction. Arch Gynecol Obstet 2000; 264: 2932. 41. Ludwig M, Katalinic A, Diedrich K. Use of GnRH antagonists in ovarian stimulation for assisted reproductive technologies compared to the long protocol. Meta analysis. Arch Gynecol Obstet 2001; 265: 175182. 42. Borm G, Mannaerts B. Treatment with the gonadotrophinreleasing hormone antagonist ganirelix in women undergoing ovarian stimulati on with recombinant follicle stimulating hormone is effective, safe and convenient: results of a controlled, randomized, multicentre trial. The European Orgalutran Study Group. Hum Reprod 2000; 15: 14901498.

PAGE 128

128 43. Barmat LI, Chantilis SJ, Hurst BS, Dickey RP. A randomized prospective trial comparing gonadotropinreleasing hormone (GnRH) antagonist/recombinant follicle stimulating hormone (rFSH) versus GnRH agonist/rFSH in women pretreated with oral contraceptives before in vitro fertilization. Fertil Steril 2005; 83: 321330. 44. Fluker M, Grifo J, Leader A, Levy M, Meldrum D, Muasher SJ, Rinehart J, Rosenwaks Z, Scott RT, Jr., Schoolcraft W, Shapiro DB. Efficacy and safety of ganirelix acetate versus leuprolide acetate in women undergoing controlled ovarian hyperstimulation. Fertil Steril 2001; 75: 3845. 45. Albano C, Felberbaum RE, Smitz J, Riethmuller Winzen H, Engel J, Diedrich K, Devroey P. Ovarian stimulation with HMG: results of a prospective randomized phase III European study comparing the luteini zing hormonereleasing hormone (LHRH) antagonist cetrorelix and the LHRH agonist buserelin. European Cetrorelix Study Group. Hum Reprod 2000; 15: 526531. 46. Roulier R, Chabert Orsini V, Sitri MC, Barry B, Terriou P. Depot GnRH agonist versus the single dose GnRH antagonist regimen (cetrorelix, 3 mg) in patients undergoing assisted reproduction treatment. Reprod Biomed Online 2003; 7: 185189. 47. Al Inany H, Aboulghar M. GnRH antagonist in assisted reproduction: a Cochrane review. Hum Reprod 2002; 17: 874 885. 48. Al Inany HG, AbouSetta AM, Aboulghar M. Gonadotrophinreleasing hormone antagonists for assisted conception: a Cochrane review. Reprod Biomed Online 2007; 14: 640649. 49. Daya S. GnRH agonists versus antagonists in assisted reproduction a systematic review. In: 8th International Symposium on GnRH analogues in Cancer and Human Reproduction; 2005. A100. 50. Giampietro F, Sancilio S, Tiboni GM, Rana RA, Di Pietro R. Levels of apoptosis in human granulosa cells seem to be comparable after ther apy with a gonadotropinreleasing hormone agonist or antagonist. Fertil Steril 2006; 85: 412419. 51. Garcia Velasco JA, Isaza V, Vidal C, Landazabal A, Remohi J, Simon C, Pellicer A. Human ovarian steroid secretion in vivo: effects of GnRH agonist versus antagonist (cetrorelix). Hum Reprod 2001; 16: 25332539. 52. Ferrari B, Pezzuto A, Barusi L, Coppola F. Gonadotropinreleasing hormone antagonists increase follicular fluid insulinlike growth factor I and vascular endothelial growth factor during ovarian stimulation cycles. Gynecol Endocrinol 2006; 22: 289296.

PAGE 129

129 53. Ferrari B, Pezzuto A, Barusi L, Coppola F. Follicular fluid vascular endothelial growth factor concentrations are increased during GnRH antagonist/FSH ovarian stimulation cycles. Eur J Obstet Gynecol Reprod Biol 2006; 124: 7076. 54. Minaretzis D, Jakubowski M, Mortola JF, Pavlou SN. Gonadotropinreleasing hormone receptor gene expression in human ovary and granulosalutein cells. J Clin Endocrinol Metab 1995; 80: 430434. 55. Latouche J, Crumeyrolle Arias M, Jordan D, Kopp N, AugendreFerrante B, Cedard L, Haour F. GnRH receptors in human granulosa cells: anatomical localization and characterization by autoradiographic study. Endocrinology 1998; 125: 17391741. 56. Hsueh AJ, Erickson GF. Extrapituitary action of gonadotropinreleasing hormone: direct inhibition ovarian steroidogenesis. Science 1979; 204: 854855. 57. Casper RF, Erickson GF, Rebar RW, Yen SS. The effect of luteinizing hormonereleasing factor and its agonist on cultured hu man granulosa cells. Fertil Steril 1982; 37: 406409. 58. Casper RF, Erickson GF, Yen SS. Studies on the effect of gonadotropinreleasing hormone and its agonist on human luteal steroidogenesis in vitro. Fertil Steril 1984; 42: 3943. 59. Tureck RW, Mast roianni L, Jr., Blasco L, Strauss JF, 3rd. Inhibition of human granulosa cell progesterone secretion by a gonadotropinreleasing hormone agonist. J Clin Endocrinol Metab 1982; 54: 10781080. 60. Parinaud J, Beaur A, Bourreau E, Vieitez G, Pontonnier G. Ef fect of a luteinizing hormonereleasing hormone agonist (Buserelin) on steroidogenesis of cultured human preovulatory granulosa cells. Fertil Steril 1988; 50: 597602. 61. Bussenot I, Azoulay Barjonet C, Parinaud J. Modulation of the steroidogenesis of cu ltured human granulosalutein cells by gonadotropinreleasing hormone analogs. J Clin Endocrinol Metab 1993; 76: 13761379. 62. Winkler N, Bukulmez O, Hardy DB, Carr BR. Gonadotropin releasing hormone antagonists suppress aromatase and anti Mullerian hormone expression in human granulosa cells. Fertil Steril 2009. 63. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin4 encodes small RNAs with antisense complementarity to lin14. Cell 1993; 75: 843854. 64. Lewis BP, Shih IH, Jones Rhoades MW, Bartel DP, Burge CB. Prediction of mammalian microRNA targets. Cell 2003; 115: 787798.

PAGE 130

130 65. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2 005; 120: 1520. 66. Saini HK, Griffiths Jones S, Enright AJ. Genomic analysis of human microRNA transcripts. Proc Natl Acad Sci U S A 2007; 104: 1771917724. 67. Lagos Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science 2001; 294: 853858. 68. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. MicroRNA genes are transcribed by RNA polymerase II. EMBO J 2004; 23: 40514060. 69. Borchert GM, Lanier W, Davidson BL. RNA polymerase III trans cribes human microRNAs. Nat Struct Mol Biol 2006; 13: 10971101. 70. Cullen BR. Transcription and processing of human microRNA precursors. Mol Cell 2004; 16: 861865. 71. Okamura K, Phillips MD, Tyler DM, Duan H, Chou YT, Lai EC. The regulatory activity of microRNA* species has substantial influence on microRNA and 3' UTR evolution. Nat Struct Mol Biol 2008; 15: 354363. 72. Pratt AJ, MacRae IJ. The RNA induced silencing complex: a versatile genesilencing machine. J Biol Chem 2009; 284: 1789717901. 73. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: 215233. 74. Jones Rhoades MW, Bartel DP, Bartel B. MicroRNAS and their regulatory roles in plants. Annu Rev Plant Biol 2006; 57: 1953. 75. Maziere P, Enright AJ. Predi ction of microRNA targets. Drug Discov Today 2007; 12: 452458. 76. Chendrimada TP, Finn KJ, Ji X, Baillat D, Gregory RI, Liebhaber SA, Pasquinelli AE, Shiekhattar R. MicroRNA silencing through RISC recruitment of eIF6. Nature 2007; 447: 823828. 77. Jackson RJ, Standart N. How do microRNAs regulate gene expression? Sci STKE 2007; 2007: re1. 78. Bak M, Silahtaroglu A, Moller M, Christensen M, Rath MF, Skryabin B, Tommerup N, Kauppinen S. MicroRNA expression in the adult mouse central nervous system. R NA 2008; 14: 432444.

PAGE 131

131 79. Otsuka M, Zheng M, Hayashi M, Lee JD, Yoshino O, Lin S, Han J. Impaired microRNA processing causes corpus luteum insufficiency and infertility in mice. J Clin Invest 2008; 118: 19441954. 80. Ro S, Song R, Park C, Zheng H, Sanders KM, Yan W. Cloning and expression profiling of small RNAs expressed in the mouse ovary. RNA 2007; 13: 23662380. 81. Tripurani SK, Xiao C, Salem M, Yao J. Cloning and analysis of fetal ovary microRNAs in cattle. Anim Reprod Sci. 82. Ro S, Park C, Sanders KM, McCarrey JR, Yan W. Cloning and expression profiling of testis expressed microRNAs. Dev Biol 2007; 311: 592602. 83. Pan Q, Luo X, Toloubeydokhti T, Chegini N. The expression profile of microRNA in endometrium and endometriosis and the influence of ovarian steroids on their expression. Mol Hum Reprod 2007; 13: 797806. 84. Hu SJ, Ren G, Liu JL, Zhao ZA, Yu YS, Su RW, Ma XH, Ni H, Lei W, Yang ZM. MicroRNA expression and regulation in mouse uterus during embryo implantation. J Biol Chem 2008. 85. Adams BD, Furneaux H, White BA. The microribonucleic acid (miRNA) miR206 targets the human estrogen receptor alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol 2007; 21: 11321147. 86. Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P, Taccioli C, Volinia S, Liu CG, Alder H, Calin GA, Menard S, Croce CM. MicroRNA signatures in human ovarian cancer. Cancer Res 2007; 67: 86998707. 87. Lui WO, Pourmand N, Patterson BK, F ire A. Patterns of known and novel small RNAs in human cervical cancer. Cancer Res 2007; 67: 60316043. 88. Yang Y, Bai W, Zhang L, Yin G, Wang X, Wang J, Zhao H, Han Y, Yao YQ. Determination of microRNAs in mouse preimplantation embryos by microarray. De v Dyn 2008; 237: 23152327. 89. McCallie B, Schoolcraft WB, Katz Jaffe MG. Aberration of blastocyst microRNA expression is associated with human infertility. Fertil Steril 2009. 90. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116: 281297.

PAGE 132

132 91. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science 2005; 310: 18171821. 92. Calin GA, Croce CM. MicroRNAs and chromosomal abnormalities in cancer cells. Oncogene 2006; 25: 62026210. 93. Ambros V. The functions of animal microRNAs. Nature 2004; 431: 350355. 94. Engels BM, Hutvagner G. Principles and effects of microRNA mediated post transcriptional gene regulation. Oncogene 2006; 25: 61636169. 95. Jovanovic M, Hengartner MO. miRNAs and apoptosis: RNAs to die for. Oncogene 2006; 25: 61766187. 96. Zeng Y. Principles of microRNA production and maturation. Oncogene 2006; 25: 61566162. 97. Matzuk MM, Lamb DJ. Genetic dissection of mammalian fertility pathways. Nat Cell Biol 2002; 4 Suppl: s4149. 98. Roy A, Matzuk MM. Deconstructing mammalian reproduction: using knockouts to define fertility pathways. Reproduction 2006; 131: 207219. 99. Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA, Elledge SJ, Anderson KV, Hannon GJ. Dicer is essential for mouse development. Nat Genet 2003; 35: 215217. 100. Yang WJ, Yang DD, Na S, Sandusky GE, Zhang Q, Zhao G. Dicer is required for embryonic ang iogenesis during mouse development. J Biol Chem 2005; 280: 93309335. 101. Mattiske DM, Han L, Mann JR. Meiotic maturation failure induced by DICER1 deficiency is derived from primary oocyte ooplasm. Reproduction 2009; 137: 625632. 102. Murchison EP, St ein P, Xuan Z, Pan H, Zhang MQ, Schultz RM, Hannon GJ. Critical roles for Dicer in the female germline. Genes Dev 2007; 21: 682693. 103. Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi Miyagawa S, Obata Y, Chiba H, Kohara Y, Kono T, Nakano T, Surani MA, Sakaki Y, Sasaki H. Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in mouse oocytes. Nature 2008; 453: 539543.

PAGE 133

133 104. Cui XS, Shen XH, Kim NH. Dicer1 expression in preimplantation mouse embryos: Involvement of Oct3/4 transcription at the blastocyst stage. Biochem Biophys Res Commun 2007; 352: 231236. 105. Lei L, Jin S, Gonzalez G, Behringer RR, Woodruff TK. The regulatory role of Dicer in folliculogenesis in mice. Mol Cell Endocrinol; 315: 6373. 106. Hong X, Luense LJ, McGinnis LK, Nothnick WB, Christenson LK. Dicer1 is essential for female fertility and normal development of the female reproductive system. Endocrinology 2008; 149: 62076212. 107. Fiedler SD, Carletti MZ, Hong X, Christenson LK. Hormonal regulation of MicroRNA e xpression in periovulatory mouse mural granulosa cells. Biol Reprod 2008; 79: 10301037. 108. Yao N, Lu CL, Zhao JJ, Xia HF, Sun DG, Shi XQ, Wang C, Li D, Cui Y, Ma X. A network of miRNAs expressed in the ovary are regulated by FSH. Front Biosci 2009; 14: 32393245. 109. Dammer EB, Sewer MB. Phosphorylation of CtBP1 by cAMP dependent protein kinase modulates induction of CYP17 by stimulating partnering of CtBP1 and 2. J Biol Chem 2008; 283: 69256934. 110. Sirotkin AV, Ovcharenko D, Grossmann R, Laukova M, Mlyncek M. Identification of microRNAs controlling human ovarian cell steroidogenesis via a genomescale screen. J Cell Physiol 2009; 219: 415420. 111. Summers MC, Biggers JD. Chemically defined media and the culture of mammalian preimplantation embry os: historical perspective and current issues. Hum Reprod Update 2003; 9: 557582. 112. Caro CM, Trounson A. Successful fertilization, embryo development, and pregnancy in human in vitro fertilization (IVF) using a chemically defined culture medium contai ning no protein. J In Vitro Fert Embryo Transf 1986; 3: 215217. 113. Pool TB, Atiee SH, Martin JE. Oocyte and embryo culture. Basic concepts and recent advances. In: May JV (ed.) Assisted reproduction: laboratory considerations, vol. 9: Infertility and r eproductive medicine clinics of north america; 1998: 181203. 114. Menezo Y, Testart J, Perrone D. Serum is not necessary in human in vitro fertilization, early embryo culture, and transfer. Fertil Steril 1984; 42: 750755. 115. Staessen C, Van den Abbeel E, Carle M, Khan I, Devroey P, Van Steirteghem AC. Comparison between human serum and Albuminar 20 (TM) supplement for in vitro fertilization. Hum Reprod 1990; 5: 336 341.

PAGE 134

134 116. Adler A, Reing AM, Bedford JM, Alikani M, Cohen J. Plasmanate as a medium sup plement for in vitro fertilization. J Assist Reprod Genet 1993; 10: 6771. 117. Weathersbee PS, Pool TB, Ord T. Synthetic serum substitute (SSS): a globulinenriched protein supplement for human embryo culture. J Assist Reprod Genet 1995; 12: 354360. 118. Tucker KE, Hurst BS, Guadagnoli S, Dymecki C, Mendelsberg B, Awoniyi CA, Schlaff WD. Evaluation of synthetic serum substitute versus serum as protein supplementation for mouse and human embryo culture. J Assist Reprod Genet 1996; 13: 3237. 119. Desai NN, Sheean LA, Martin D, Gindlesperger V, Austin CM, Lisbonna H, Peskin B, Goldfarb JM. Clinical experience with synthetic serum substitute as a protein supplement in IVF culture media: a retrospective study. J Assist Reprod Genet 1996; 13: 23 31. 120. Du gan KJ, Shalika S, Smith RD, Padilla SL. Comparison of synthetic serum substitute and fetal cord serum as media supplements for in vitro fertilization: a prospective, randomized study. Fertil Steril 1997; 67: 166168. 121. Graham MC, Partridge AB, Lewis V Phipps WR. A prospective comparison of Synthetic Serum Substitute and human serum albumin in culture for in vitro fertilization embryo transfer. Fertil Steril 1995; 64: 10361038. 122. Schneider EG, Hayslip CC. Globulinenriched protein supplements shor ten the pre compaction mitotic interval and promote hatching of murine embryos. Am J Reprod Immunol 1996; 36: 101106. 123. Schiewe MC, Neev J, Hazeleger NL, Balmaceda JP, Berns MW, Tadir Y. Developmental competence of mouse embryos following zona drilling using a noncontact holmium:yttrium scandian gallium garnet (Ho:YSGG) laser system. Hum Reprod 1995; 10: 18211824. 124. Franks F. Solute--water interactions: do polyhydroxy compounds after the properties of water? Cryobiology 1983; 20: 335345. 125. H unter RH. Modulation of gamete and embryonic microenvironments by oviduct glycoproteins. Mol Reprod Dev 1994; 39: 176181. 126. Verhage HG, Fazleabas AT, Donnelly K. The in vitro synthesis and release of proteins by the human oviduct. Endocrinology 1988; 122: 16391645. 127. DeSouza MM, Lagow E, Carson DD. Mucin functions and expression in mammalian reproductive tract tissues. Biochem Biophys Res Commun 1998; 247: 16.

PAGE 135

135 128. Lagow E, DeSouza MM, Carson DD. Mammalian reproductive tract mucins. Hum Reprod Up date 1999; 5: 280292. 129. Gipson IK, Ho SB, Spurr Michaud SJ, Tisdale AS, Zhan Q, Torlakovic E, Pudney J, Anderson DJ, Toribara NW, Hill JA, 3rd. Mucin genes expressed by human female reproductive tract epithelia. Biol Reprod 1997; 56: 9991011. 130. Jansen RP. Ultrastructure and histochemistry of acid mucus glycoproteins in the estrous mammal oviduct. Microsc Res Tech 1995; 32: 2449. 131. Yaegashi N, Fujita N, Yajima A, Nakamura M. Menstrual cycle dependent expression of CD44 in normal human endometr ium. Hum Pathol 1995; 26: 862865. 132. Afify AM, Craig S, Paulino AF. Temporal variation in the distribution of hyaluronic acid, CD44s, and CD44v6 in the human endometrium across the menstrual cycle. Appl Immunohistochem Mol Morphol 2006; 14: 328333. 133. Gardner DK, Rodriegez Martinez H, Lane M. Fetal development after transfer is increased by replacing protein with the glycosaminoglycan hyaluronan for mouse embryo culture and transfer. Hum Reprod 1999; 14: 25752580. 134. Fenderson BA, Stamenkovic I Aruffo A. Localization of hyaluronan in mouse embryos during implantation, gastrulation and organogenesis. Differentiation 1993; 54: 8598. 135. Furnus CC, Valcarcel A, Dulout FN, Errecalde AL. The hyaluronic acid receptor (CD44) is expressed in bovine oocytes and early stage embryos. Theriogenology 2003; 60: 16331644. 136. Goshen R, Ariel I, Shuster S, Hochberg A, Vlodavsky I, de Groot N, BenRafael Z, Stern R. Hyaluronan, CD44 and its variant exons in human trophoblast invasion and placental angiogenesis. Mol Hum Reprod 1996; 2: 685 691. 137. Bavister BD. Substitution of a synthetic polymer for protein in a mammalian gamete culture system. J Exp Zool 1981; 217: 4551. 138. Whittingham DG, Leibo SP, Mazur P. Survival of mouse embryos frozen to 196 d egrees and 269 degrees C. Science 1972; 178: 411414. 139. Wilmut I, Rowson LE. Experiments on the low temperature preservation of cow embryos. Vet Rec 1973; 92: 686690. 140. Trounson A, Mohr L. Human pregnancy following cryopreservation, thawing and transfer of an eight cell embryo. Nature 1983; 305: 707709.

PAGE 136

136 141. Cohen J, Simons RF, Edwards RG, Fehilly CB, Fishel SB. Pregnancies following the frozen storage of expanding human blastocysts. J In Vitro Fert Embryo Transf 1985; 2: 5964. 142. Pegg DE. P rincipals of cryopreservation. In: Day JG, Stacey GN (eds.), Cryopreservation and freezedrying protocols, 2nd ed: Humana Press; 2007: 3957. 143. Menezo YJ. Blastocyst freezing. Eur J Obstet Gynecol Reprod Biol 2004; 115 Suppl 1: S1215. 144. Stehlik E, Stehlik J, Katayama KP, Kuwayama M, Jambor V, Brohammer R, Kato O. Vitrification demonstrates significant improvement versus slow freezing of human blastocysts. Reprod Biomed Online 2005; 11: 5357. 145. Langley MT, Marek DE, Nackleyet AC. Frozen blastoc yst transfer: a five year evaluation of controlled rate cryopreservation technique. Fertil Steril 2003; 80: S150151. 146. Nakayama T, Goto Y, Kanzaki H, Takabatake K, Himeno T, Takakura K, Mori T, Noda Y. Developmental potential of frozenthawed human bl astocysts. J Assist Reprod Genet 1995; 12: 239243. 147. Kaufman RA, Menezo Y, Hazout A, Nicollet B, DuMont M, Servy EJ. Cocultured blastocyst cryopreservation: experience of more than 500 transfer cycles. Fertil Steril 1995; 64: 11251129. 148. Menezo Y, Nicollet B, Herbaut N, Andre D. Freezing cocultured human blastocysts. Fertil Steril 1992; 58: 977980. 149. Troup SA, Matson PL, Critchlow JD, Morroll DR, Lieberman BA, Burslem RW. Cryopreservation of human embryos at the pronucleate, early cleavage, or expanded blastocyst stages. Eur J Obstet Gynecol Reprod Biol 1991; 38: 133139. 150. Pegg DE, Hunt CJ, Fong LP. Osmotic properties of the rabbit corneal endothelium and their relevance to cryopreservation. Cell Biophys 1987; 10: 169189. 151. Taylor M J, Pegg DE. The effect of ice formation on the function of smooth muscle tissue stored at 21 or 60 degrees C. Cryobiology 1983; 20: 3640. 152. Hunt CJ, Taylor MJ, Pegg DE. Freezesubstitution and isothermal freezefixation studies to elucidate the patt ern of ice formation in smooth muscle at 252 K ( 21 degrees C). J Microsc 1982; 125: 177186.

PAGE 137

137 153. Gardner DK, Lane M, Stevens J, Schoolcraft WB. Changing the start temperature and cooling rate in a slow freezing protocol increases human blastocyst viabil ity. Fertil Steril 2003; 79: 407410. 154. Son WY, Yoon SH, Yoon HJ, Lee SM, Lim JH. Pregnancy outcome following transfer of human blastocysts vitrified on electron microscopy grids after induced collapse of the blastocoele. Hum Reprod 2003; 18: 137139. 155. Vanderzwalmen P, Bertin G, Debauche C, Standaert V, van Roosendaal E, Vandervorst M, Bollen N, Zech H, Mukaida T, Takahashi K, Schoysman R. Births after vitrification at morula and blastocyst stages: effect of artificial reduction of the blastocoelic cavity before vitrification. Hum Reprod 2002; 17: 744751. 156. Kuleshova LL, Shaw JM, Trounson AO. Studies on replacing most of the penetrating cryoprotectant by polymers for embryo cryopreservation. Cryobiology 2001; 43: 2131. 157. Palasz A, Alkemade S, Mapletoft RJ. The use of sodium hyaluronate in freezing media for bovine and murine embryos. Cryobiology 1993; 30: 172178. 158. Kuwayama M, Hamano S, Nagai T. Vitrification of bovine blastocysts obtained by in vitro culture of oocytes matured and fer tilized in vitro. J Reprod Fertil 1992; 96: 187193. 159. Luyet B. The vitrification of organic colloids and protoplasm. Biodynamica 1937; 1: 1 14. 160. Rall WF, Fahy GM. Ice free cryopreservation of mouse embryos at 196 degrees C by vitrification. Natu re 1985; 313: 573575. 161. Liebermann J, Tucker MJ. Vitrifying and warming of human oocytes, embryos, and blastocysts: vitrification procedures as an alternative to conventional cryopreservation. Methods Mol Biol 2004; 254: 345364. 162. Mukaida T, Oka C, Goto T, Takahashi K. Artificial shrinkage of blastocoeles using either a microneedle or a laser pulse prior to the cooling steps of vitrification improves survival rate and pregnancy outcome of vitrified human blastocysts. Hum Reprod 2006; 21: 3246325 2. 163. Hiraoka K, Kinutani M, Kinutani K. Blastocoele collapse by micropipetting prior to vitrification gives excellent survival and pregnancy outcomes for human day 5 and 6 expanded blastocysts. Hum Reprod 2004; 19: 28842888. 164. Duke M, Basile N, Jo hnson A, Cooperman B, Barrit J. Hatched blastocysts that collapse during slow freezing have a higher post thaw survival rate. Fertil Steril 2004; 82: S150151.

PAGE 138

138 165. Wagley LM, Noble LS. High protein concentration is beneficial in mouse blastocyst cryopreservation. Fertility and sterility 2008; 90: S245. 166. Shaw JM, Trounson AO. Effect of dimethyl sulfoxide and protein concentration on the viability of twocell mouse embryos frozen with a rapid freezing technique. Cryobiology 1989; 26: 413421. 167. Lane M, Maybach JM, Hooper K, Hasler JF, Gardner DK. Cryosurvival and development of bovine blastocysts are enhanced by culture with recombinant albumin and hyaluronan. Mol Reprod Dev 2003; 64: 7078. 168. Block J, Bonilla L, Hansen PJ. Effect of addition of hyaluronan to embryo culture medium on survival of bovine embryos in vitro following vitrification and establishment of pregnancy after transfer to recipients. Theriogenology 2009; 71: 10631071. 169. Gardner RL, Edwards RG. Control of the sex ratio at f ull term in the rabbit by transferring sexed blastocysts. Nature 1968; 218: 346349. 170. Handyside AH, Kontogianni EH, Hardy K, Winston RM. Pregnancies from biopsied human preimplantation embryos sexed by Y specific DNA amplification. Nature 1990; 344: 768770. 171. Handyside AH, Lesko JG, Tarin JJ, Winston RM, Hughes MR. Birth of a normal girl after in vitro fertilization and preimplantation diagnostic testing for cystic fibrosis. N Engl J Med 1992; 327: 905909. 172. Jacobs LJ, de Wert G, Geraedts JP de Coo IF, Smeets HJ. The transmission of OXPHOS disease and methods to prevent this. Hum Reprod Update 2006; 12: 119136. 173. Rechitsky S, Kuliev A, Tur Kaspa I, Morris R, Verlinsky Y. Preimplantation genetic diagnosis with HLA matching. Reprod Biomed Online 2004; 9: 210221. 174. Verlinsky Y, Ginsberg N, Lifchez A, Valle J, Moise J, Strom CM. Analysis of the first polar body: preconception genetic diagnosis. Hum Reprod 1990; 5: 826829. 175. Delhanty JD, Griffin DK, Handyside AH, Harper J, Atkinson GH, Pieters MH, Winston RM. Detection of aneuploidy and chromosomal mosaicism in human embryos during preimplantation sex determination by fluorescent in situ hybridisation, (FISH). Hum Mol Genet 1993; 2: 11831185. 176. James RM, West JD. A chimaeric animal model for confined placental mosaicism. Hum Genet 1994; 93: 603604.

PAGE 139

139 177. Spits C, Sermon K. PGD for monogenic disorders: aspects of molecular biology. Prenat Diagn 2009; 29: 5056. 178. Wilton L, Thornhill A, Traeger Synodinos J, Sermon KD, Harper JC. The causes of misdiagnosis and adverse outcomes in PGD. Hum Reprod 2009; 24: 12211228. 179. Velilla E, Escudero T, Munne S. Blastomere fixation techniques and risk of misdiagnosis for preimplantation genetic diagnosis of aneuploidy. Reprod Biomed O nline 2002; 4: 210217. 180. Munne S. Analysis of chromosome segregation during preimplantation genetic diagnosis in both male and female translocation heterozygotes. Cytogenet Genome Res 2005; 111: 305 309. 181. Munne S. Preimplantation genetic diagnosi s of structural abnormalities. Mol Cell Endocrinol 2001; 183 Suppl 1: S5558. 182. Verlinsky Y, Cieslak J, Evsikov S, Galat V, Kuliev A. Nuclear transfer for full karyotyping and preimplantation diagnosis for translocations. Reprod Biomed Online 2002; 5: 300 305. 183. Liu J, Tsai YL, Zheng XZ, Yazigi RA, Baramki TA, Compton G, Katz E. Feasibility study of repeated fluorescent insitu hybridization in the same human blastomeres for preimplantation genetic diagnosis. Mol Hum Reprod 1998; 4: 972977. 184. M unne S, Bahce M, Sandalinas M, Escudero T, Marquez C, Velilla E, Colls P, Oter M, Alikani M, Cohen J. Differences in chromosome susceptibility to aneuploidy and survival to first trimester. Reprod Biomed Online 2004; 8: 8190. 185. Garcia Cruz R, Roig I, Caldes MG. Maternal origin of the human aneuploidies. Are homolog synapsis and recombination to blame? Notes (learned) from the underbelly. Genome Dyn 2009; 5: 128136. 186. Munne S, Magli C, Adler A, Wright G, de Boer K, Mortimer D, Tucker M, Cohen J, Gi anaroli L. Treatment related chromosome abnormalities in human embryos. Hum Reprod 1997; 12: 780784. 187. Munne S, Weier HU, Grifo J, Cohen J. Chromosome mosaicism in human embryos. Biol Reprod 1994; 51: 373379. 188. Munne S, Howles CM, Wells D. The role of preimplantation genetic diagnosis in diagnosing embryo aneuploidy. Curr Opin Obstet Gynecol 2009; 21: 442449.

PAGE 140

140 189. Wells D, Sherlock JK, Handyside AH, Delhanty JD. Detailed chromosomal and molecular genetic analysis of single cells by whole genome a mplification and comparative genomic hybridisation. Nucleic Acids Res 1999; 27: 12141218. 190. Verlinsky Y, Evsikov S. A simplified and efficient method for obtaining metaphase chromosomes from individual human blastomeres. Fertil Steril 1999; 72: 11271 133. 191. Willadsen S, Levron J, Munne S, Schimmel T, Marquez C, Scott R, Cohen J. Rapid visualization of metaphase chromosomes in single human blastomeres after fusion with invitro matured bovine eggs. Hum Reprod 1999; 14: 470475. 192. Treff NR, Su J, Mavrianos J, Bergh PA, Miller KA, Scott Jr RT. Accurate 23 chromosome aneuploidy screening in human blastomeres using single nucleotide polymorphism (SNP) microarrays. Fertility and sterility 2007; 88: S1S1. 193. Munn S, Wells D. Questions concerning t he suitability of comparative genomic hybridization for preimplantation genetic diagnosis. Fertility and sterility 2003; 80: 871872. 194. Levy B, Nahum O, Hirschhorn K. P 931: Aneuploidy analysis of single cells by high resolution comparative genomic hybridization after whole genome amplification using a random fragmentation approach. Fertility and sterility 2006; 86: S479S480. 195. Levy B, Treff NR, Nahum O, Su J, Tao X, Scott RT. The accuracy and consistency of whole genome preimplantation genetic diagnosis (PGD): a comparison of two independent methods microarray PGD (mPGD) and comparative genomic hybridization (CGH). Fertility and sterility 2008; 90: S305S305. 196. Fiegler H, Geigl JB, Langer S, Rigler D, Porter K, Unger K, Carter NP, Speicher MR High resolution array CGH analysis of single cells. Nucleic Acids Res 2007; 35: e15. 197. Hellani A, Abu Amero K, Azouri J, El Akoum S. Successful pregnancies after application of array comparative genomic hybridization in PGS aneuploidy screening. Repr od Biomed Online 2008; 17: 841847. 198. Cohen J, Wells D, Munne S. Removal of 2 cells from cleavage stage embryos is likely to reduce the efficacy of chromosomal tests that are used to enhance implantation rates. Fertil Steril 2007; 87: 496503.

PAGE 141

141 199. Treff NR, Su J, Tao X, Levy B, Scott RT, Jr. Accurate single cell 24 chromosome aneuploidy screening using whole genome amplification and single nucleotide polymorphism microarrays. Fertil Steril. 200. Treff NR, Su J, Tao X, Miller KA, Levy B, Scott RT, J r. A novel singlecell DNA fingerprinting method successfully distinguishes sibling human embryos. Fertil Steril 2009. 201. Evsikov S, Verlinsky Y. Visualization of chromosomes in single human blastomeres. J Assist Reprod Genet 1999; 16: 133137. 202. Sa ntalo J, Veiga A, Calafell JM, Calderon G, Vidal F, Barri PN, Gimenes C, Egozcue J. Evaluation of cytogenetic analysis for clinical preimplantation diagnosis. Fertil Steril 1995; 64: 4450. 203. Sandberg AA, Sofuni T, Takagi N, Moore GE. Chronology and pattern of human chromosome replication, IV. Autoradiographic studies of binucleate cells. Proc Natl Acad Sci U S A 1966; 56: 105110. 204. Yamanaka T, Okada Y. Cultivation of fused cells resulting from treatment of cells with HVJ. I. Synchronization of the stages of DNA synthesis of nuclei involved in fused multinucleated cells. Biken's J 1966; 9: 159175. 205. Stubblefield E. DNA synthesis and chromosome morphology of Chinese hamster cells cultured in media containing N deacetyl N methylcolchicine (Colcemid). Symp Int Soc Cell Biol 1964; 3: 223248. 206. Rao PN, Johnson RT. Mammalian cell fusion: studies on the regulation of DNA synthesis and mitosis. Nature 1970; 225: 159 164. 207. Johnson RT, Rao PN. Mammalian cell fusion: induction of premature chromosome condensation in interphase nuclei. Nature 1970; 226: 717722. 208. Schor SL, Johnson RT, Waldren CA. Changes in the organization of chromosomes during the cell cycle: response to ultraviolet light. J Cell Sci 1975; 17: 539565. 209. Rao PN, W ilson B, Puck TT. Premature chromosome condensation and cell cycle analysis. J Cell Physiol 1977; 91: 131141. 210. Unakul W, Johnson RT, Rao PN, Hsu TC. Giemsa banding in prematurely condensed chromosomes obtained by cell fusion. Nat New Biol 1973; 242: 106 107. 211. Nurse P. Universal control mechanism regulating onset of M phase. Nature 1990; 344: 503508.

PAGE 142

142 212. Draetta G, Luca F, Westendorf J, Brizuela L, Ruderman J, Beach D. Cdc2 protein kinase is complexed with both cyclin A and B: evidence for proteolytic inactivation of MPF. Cell 1989; 56: 829838. 213. Draetta G, Beach D. The mammalian cdc2 protein kinase: mechanisms of regulation during the cell cycle. J Cell Sci Suppl 1989; 12: 2127. 214. Gotoh E, Asakawa Y. Detection and evaluation of chromos omal aberrations induced by high doses of gammairradiation using immunogoldsilver painting of prematurely condensed chromosomes. Int J Radiat Biol 1996; 70: 517520. 215. Prasanna PG, Escalada ND, Blakely WF. Induction of premature chromosome condensati on by a phosphatase inhibitor and a protein kinase in unstimulated human peripheral blood lymphocytes: a simple and rapid technique to study chromosome aberrations using specific whole chromosome DNA hybridization probes for biological dosimetry. Mutat Res 2000; 466: 131141. 216. Guo XW, Th'ng JP, Swank RA, Anderson HJ, Tudan C, Bradbury EM, Roberge M. Chromosome condensation induced by fostriecin does not require p34cdc2 kinase activity and histone H1 hyperphosphorylation, but is associated with enhanced histone H2A and H3 phosphorylation. EMBO J 1995; 14: 976985. 217. Gotoh E, Durante M. Chromosome condensation outside of mitosis: mechanisms and new tools. J Cell Physiol 2006; 209: 297304. 218. Srebniak MI, Trapp GG, Wawrzkiewicz AK, Kazmierczak W, W iczkowski AK. The usefulness of calyculin a for cytogenetic prenatal diagnosis. J Histochem Cytochem 2005; 53: 391394. 219. Gotoh E. Visualizing the dynamics of chromosome structure formation coupled with DNA replication. Chromosoma 2007; 116: 453462. 220. Durante M, Furusawa Y, Gotoh E. A simple method for simultaneous interphasemetaphase chromosome analysis in biodosimetry. Int J Radiat Biol 1998; 74: 457462. 221. Bezrookove V, Smits R, Moeslein G, Fodde R, Tanke HJ, Raap AK, Darroudi F. Premature chromosome condensation revisited: a novel chemical approach permits efficient cytogenetic analysis of cancers. Genes Chromosomes Cancer 2003; 38: 177186. 222. Barbieri RL. Clinical applications of GnRH and its analogues. Trends Endocrinol Metab 1992; 3: 30 34.

PAGE 143

143 223. Diedrich K, Diedrich C, Santos E, Zoll C, alHasani S, Reissmann T, Krebs D, Klingmuller D. Suppression of the endogenous luteinizing hormone surge by the gonadotrophinreleasing hormone antagonist Cetrorelix during ovarian stimulation. Hum Reprod 1994; 9: 788791. 224. Kolibianakis EM, Collins J, Tarlatzis BC, Devroey P, Diedrich K, Griesinger G. Among patients treated for IVF with gonadotrophins and GnRH analogues, is the probability of live birth dependent on the type of analogue used? A systematic review and metaanalysis. Hum Reprod Update 2006; 12: 651671. 225. Zhao JJ, Hua YJ, Sun DG, Meng XX, Xiao HS, Ma X. Genomewide microRNA profiling in human fetal nervous tissues by oligonucleotide microarray. Childs Nerv Syst 2006; 22: 141914 25. 226. Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer 2006; 6: 857866. 227. Nagaraja AK, AndreuVieyra C, Franco HL, Ma L, Chen R, Han DY, Zhu H, Agno JE, Gunaratne PH, DeMayo FJ, Matzuk MM. Deletion of Dicer in somatic cells of the female reproductive tract causes sterility. Mol Endocrinol 2008; 22: 23362352. 228. Gonzalez G, Behringer RR. Dicer is required for female reproductive tract development and fertility in the mouse. Mol Reprod Dev 2009; 76: 678688. 229. Ro S, Pa rk C, Song R, Nguyen D, Jin J, Sanders KM, McCarrey JR, Yan W. Cloning and expression profiling of testis expressed piRNA like RNAs. RNA 2007; 13: 16931702. 230. McCallie B, Schoolcraft WB, Katz Jaffe MG. Aberration of blastocyst microRNA expression is associated with human infertility. Fertil Steril; 93: 23742382. 231. Lie BL, Leung E, Leung PC, Auersperg N. Long term growth and steroidogenic potential of human granulosalutein cells immortalized with SV40 large T antigen. Mol Cell Endocrinol 1996; 120 : 169 176. 232. Ding L, Xu J, Luo X, Chegini N. Gonadotropin releasing hormone and transforming growth factor beta activate mitogenactivated protein kinase/extracellularly regulated kinase and differentially regulate fibronectin, type I collagen, and plasminogen activator inhibitor 1 expression in leiomyoma and myometrial smooth muscle cells. J Clin Endocrinol Metab 2004; 89: 55495557. 233. Ambros V, Chen X. The regulation of genes and genomes by small RNAs. Development 2007; 134: 16351641.

PAGE 144

144 234. Lee CT, Risom T, Strauss WM. MicroRNAs in mammalian development. Birth Defects Res C Embryo Today 2006; 78: 129139. 235. Park JY, Su YQ, Ariga M, Law E, Jin SL, Conti M. EGF like growth factors as mediators of LH action in the ovulatory follicle. Science 2004; 303: 682 684. 236. Freimann S, BenAmi I, Dantes A, RonEl R, Amsterdam A. EGF like factor epiregulin and amphiregulin expression is regulated by gonadotropins/cAMP in human ovarian follicular cells. Biochem Biophys Res Commun 2004; 324: 829834. 237. Shimada M, Hernandez Gonzalez I, Gonzalez Robayna I, Richards JS. Paracrine and autocrine regulation of epidermal growth factor like factors in cumulus oocyte complexes and granulosa cells: key roles for prostaglandin synthase 2 and progesterone receptor. Mol Endocrinol 2006; 20: 13521365. 238. Inoue Y, Miyamoto S, Fukami T, Shirota K, Yotsumoto F, Kawarabayashi T. Amphiregulin is much more abundantly expressed than transforming growth factor alpha and epidermal growth factor in human follicular fluid obtained from patients undergoing in vitro fertilizationembryo transfer. Fertil Steril 2009; 91: 10351041. 239. Wong WY, Richards JS. Induction of prostaglandin H synthase in rat preovulatory follicles by gonadotropinreleasing hormone. Endocrinology 1992; 130: 35123521. 240. Ben Ami I, Freimann S, Armon L, Dantes A, Strassburger D, Friedler S, Raziel A, Seger R, RonEl R, Amsterdam A. PGE2 up regulates EGF like growth factor biosynthesis in human granulosa cells: new insights into the coordination between PGE2 and LH in ovulation. Mol Hum Reprod 2006; 12: 593599. 241. So WK, Cheng JC, Poon SL, Leung PC. Gonadotropinreleasing hormone and ovarian cancer: a functional and mechanistic overview. FEBS J 2008; 275: 54965511. 242. LaVoie HA. The role of GAT A in mammalian reproduction. Exp Biol Med (Maywood) 2003; 228: 12821290. 243. White CD, Stewart AJ, Lu ZL, Millar RP, Morgan K. Antiproliferative effects of GnRH agonists: prospects and problems for cancer therapy. Neuroendocrinology 2008; 88: 6779. 244. Cheung LW, Wong AS. Gonadotropinreleasing hormone: GnRH receptor signaling in extrapituitary tissues. FEBS J 2008; 275: 54795495.

PAGE 145

145 245. Millar RP, Pawson AJ, Morgan K, Rissman EF, Lu ZL. Diversity of actions of GnRHs mediated by ligandinduced selectiv e signaling. Front Neuroendocrinol 2008; 29: 1735. 246. Yu J, Wang F, Yang GH, Wang FL, Ma YN, Du ZW, Zhang JW. Human microRNA clusters: genomic organization and expression profile in leukemia cell lines. Biochem Biophys Res Commun 2006; 349: 5968. 247. Esfandiari N, Falcone T, Agarwal A, Attaran M, Nelson DR, Sharma RK. Protein supplementation and the incidence of apoptosis and oxidative stress in mouse embryos. Obstet Gynecol 2005; 105: 653660. 248. Ben Yosef D, Yovel I, Schwartz T, Azem F, Lessi ng JB, Amit A. Increasing synthetic serum substitute (SSS) concentrations in P1 glucose/phosphatefree medium improves implantation rate: a comparative study. J Assist Reprod Genet 2001; 18: 588592. 249. Li R, Trounson A. Rapid freezing of the mouse blas tocyst: effects of cryoprotectants and of time and temperature of exposure to cryoprotectant before direct plunging into liquid nitrogen. Reprod Fertil Dev 1991; 3: 175183. 250. Emiliani S, Van den Bergh M, Vannin AS, Biramane J, Englert Y. Comparison of ethylene glycol, 1,2propanediol and glycerol for cryopreservation of slow cooled mouse zygotes, 4cell embryos and blastocysts. Hum Reprod 2000; 15: 905910. 251. Van Den Abbeel E, Van Steirteghem A. Zona pellucida damage to human embryos after cryopres ervation and the consequences for their blastomere survival and invitro viability. Hum Reprod 2000; 15: 373378. 252. Menezo YJ, Veiga A. Cryopreservation of blastocysts. In: In Vitro Fertilization and Assisted Reproduction; 1997; Vancouver. 4953. 253. Gardner DK, Schoolcraft WB. In vitro culture of human blastocysts. In: Jansen R, Mortimer D (eds.), Towards reproductive certainty: fertility and genetics beyound 1999. Carnforth, UK: Parthenon Publishing; 1999: 378388. 254. Lane M, Gardner DK. Differential regulation of mouse embryo development and viability by amino acids. J Reprod Fertil 1997; 109: 153164. 255. Tanikawa M, Harada T, Ito M, Yoshida S, Iwabe T, Terakawa N. Globulins in protein supplements promote the development of preimplantation embryos. J Assist Reprod Genet 1999; 16: 555557. 256. Korosec S, Virant Klun I, Tomazevic T, Zech NH, MedenVrtovec H. Single fresh and frozenthawed blastocyst transfer using hyaluronanrich transfer medium. Reprod Biomed Online 2007; 15: 701707.

PAGE 146

146 257. Borisy GG, Taylor EW. The mechanism of action of colchicine. Colchicine binding to sea urchin eggs and the mitotic apparatus. J Cell Biol 1967; 34: 535548. 258. Lee TH. The role of protein phosphatase type2A in the Xenopus cell cycle: initiation of the G2/M transition. Semin Cancer Biol 1995; 6: 203209. 259. Moore K, Kramer JM, Rodriguez Sallaberry CJ, Yelich JV, Drost M. Insulinlike growth factor (IGF) family genes are aberrantly expressed in bovine conceptuses produced in vitro or by nuclear transfer. Theriogenology 2007; 68: 717727. 260. Gandhi AP, Lane M, Gardner DK, Krisher RL. A single medium supports development of bovine embryos throughout maturation, fertilization and culture. Hum Reprod 2000; 15: 395401. 261. Kanda R, Eguchi Kasai K, Itsu kaichi H, Mori M, Hayata I. Chemically induced premature chromosome condensation in human fibroblast cell lines: fundamental study for applications to the biodosimetry of local exposure. Somat Cell Mol Genet 1999; 25: 317325. 262. Dozortsev DI, McGinnis KT. An improved fixation technique for fluorescence in situ hybridization for preimplantation genetic diagnosis. Fertil Steril 2001; 76: 186188. 263. McCauley TC, Mazza MR, Didion BA, Mao J, Wu G, Coppola G, Coppola GF, Di Berardino D, Day BN. Chromosomal abnormalities in Day 6, in vitro produced pig embryos. Theriogenology 2003; 60: 15691580. 264. Iwasaki S, Hamano S, Kuwayama M, Yamashita M, Ushijima H, Nagaoka S, Nakahara T. Developmental changes in the incidence of chromosome anomalies of bovine embryos fertilized in vitro. J Exp Zool 1992; 261: 7985. 265. Rambags BP, Krijtenburg PJ, Drie HF, Lazzari G, Galli C, Pearson PL, Colenbrander B, Stout TA. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev 2005; 72: 7787. 266. Viuff D, Greve T, Avery B, Hyttel P, Brockhoff PB, Thomsen PD. Chromosome aberrations in in vitroproduced bovine embryos at days 25 post insemination. Biol Reprod 2000; 63: 11431148. 267. Yoshizawa M, Konno H, Zhu S, Kageyama S, Fukui E, Muramatsu S, Kim S, Araki Y. Chromosomal diagnosis in each individual blastomere of 5to 10 cell bovine embryos derived from in vitro fertilization. Theriogenology 1999; 51: 12391250.

PAGE 147

147 268. Baart EB, van den Berg I, Martini E, Eussen HJ, Fauser B C, Van Opstal D. FISH analysis of 15 chromosomes in human day 4 and 5 preimplantation embryos: the added value of extended aneuploidy detection. Prenat Diagn 2007; 27: 5563. 269. Munne S, Sultan KM, Weier HU, Grifo JA, Cohen J, Rosenwaks Z. Assessment of numeric abnormalities of X, Y, 18, and 16 chromosomes in preimplantation human embryos before transfer. Am J Obstet Gynecol 1995; 172: 11911199; discussion 11991201. 270. Ruangvutilert P, Delhanty JD, Rodeck CH, Harper JC. Relative efficiency of FISH o n metaphase and interphase nuclei from non mosaic trisomic or triploid fibroblast cultures. Prenat Diagn 2000; 20: 159162. 271. Ruangvutilert P, Delhanty JD, Serhal P, Simopoulou M, Rodeck CH, Harper JC. FISH analysis on day 5 post insemination of human arrested and blastocyst stage embryos. Prenat Diagn 2000; 20: 552560. 272. El Achkar E, Gerbault Seureau M, Muleris M, Dutrillaux B, Debatisse M. Premature condensation induces breaks at the interface of early and late replicating chromosome bands bearing common fragile sites. Proc Natl Acad Sci U S A 2005; 102: 1806918074. 273. Yoshioka K, Suzuki C, Iwamura S. Effects of activin A and follistatin on developmental kinetics of bovine embryos: cinematographic analysis in a chemically defined medium. J Reprod Fertil 2000; 118: 119125. 274. Holm P, Booth PJ, Callesen H. Kinetics of early in vitro development of bovine in vivo and in vitroderived zygotes produced and/or cultured in chemically defined or serum containing media. Reproduction 2002; 123: 553565. 275. Lequarre AS, Marchandise J, Moreau B, Massip A, Donnay I. Cell cycle duration at the time of maternal zygotic transition for in vitro produced bovine embryos: effect of oxygen tension and transcription inhibition. Biol Reprod 2003; 69: 17071713. 276. Swain JE, Ding J, Brautigan DL, Villa Moruzzi E, Smith GD. Proper chromatin condensation and maintenance of histone H3 phosphorylation during mouse oocyte meiosis requires protein phosphatase activity. Biol Reprod 2007; 76: 628638. 277. King WA, Linares T, Gustavsson I. Cytogenetics of preimplantation embryos sired by bulls heterozygous for the 1/29 translocation. Hereditas 1981; 94: 219224.

PAGE 148

148 278. King WA. Chromosome abnormalitites and pregnancy failure in domestic animals. In: McFeely RA (ed.) A dvances in veterinary science and comparitive medicine, vol. 34. San Diego: Academic Press; 1990: 229250. 279. Viuff D, Rickords L, Offenberg H, Hyttel P, Avery B, Greve T, Olsaker I, Williams JL, Callesen H, Thomsen PD. A high proportion of bovine blast ocysts produced in vitro are mixoploid. Biol Reprod 1999; 60: 12731278. 280. Kawarsky SJ, Basrur PK, Stubbings RB, Hansen PJ, King WA. Chromosomal abnormalities in bovine embryos and their influence on development. Biol Reprod 1996; 54: 5359. 281. De L a Torre Sanchez JF, Gardner DK, Preis K, Gibbons J, Seidel GE, Jr. Metabolic regulation of in vitroproduced bovine embryos. II. Effects of phenazine ethosulfate, sodium azide and 2,4dinitrophenol during post compaction development on glucose metabolism and lipid accumulation. Reprod Fertil Dev 2006; 18: 597607. 282. Shkumatov A, Kuznyetsov V, Cieslak J, Ilkevitch Y, Verlinsky Y. Obtaining metaphase spreads from single blastomeres for PGD of chromosomal rearrangements. Reprod Biomed Online 2007; 14: 498503. 283. Kanda R, Eguchi Kasai K, Hayata I. Phosphatase inhibitors and premature chromosome condensation in human peripheral lymphocytes at different cell cycle phases. Somat Cell Mol Genet 1999; 25: 18. 284. Eriksson JE, Brautigan DL, Vallee R, Olmste d J, Fujiki H, Goldman RD. Cytoskeletal integrity in interphase cells requires protein phosphatase activity. Proc Natl Acad Sci U S A 1992; 89: 1109311097.

PAGE 149

149 BIOGRAPHICAL SKETCH Joseph Michael Kramer was born in 1977 in Easy Patchogue, New York, to Doris and John Kramer. He was raised with his older sister, Jennifer, and younger brother, David, in Dunnellon, Florida. Joseph married Raeanna Fox on August 15, 1998. They have two chi ldren, Nadia, born June 2004, and Colt, born February 2010. Joseph graduated from Dunnellon high school in May, 1995, and then he enrolled at the University of Florida, in Gainesville. Joseph received his bachelors degree in animal sciences in August 2000. The following year, he began a Master of Science program in animal sciences at the University of Florida, Gainesville, under the direction of Dr. Karen Moore, and he completed the program in April 2005. From August 2003 to June 2006, Joseph began his career in the field of human reproductive medicine as an embryologist and later as a cytogeneticist for Reproductive Medicine Associates of New Jersey. Joseph returned to the University of Florida in August 2006 to begin a Doctor of Philosophy in animal molecular and cellular biology, as part of a unique joint venture between the Department of Animal Sciences and the human in vitro fertilization laboratory at Shands hospital, Gainesville, under the direction of Dr. Kenneth Drury. After graduation, Joseph will apply for certification as a HighComplexity Clinical Laboratory Director through the American Board of Bioanalysis. In the future, Joseph plans on directing a human clinical in vitro fertilization laboratory and pursuing his research interests in ovarian tissue and oocyte vitrification and embryo metabolomics and proteomics.