<%BANNER%>

Developmental Acquisition of Apoptosis in the Preimplantation Bovine Embryo

Permanent Link: http://ufdc.ufl.edu/UFE0041865/00001

Material Information

Title: Developmental Acquisition of Apoptosis in the Preimplantation Bovine Embryo Returning to the Balance of Live and Death
Physical Description: 1 online resource (125 p.)
Language: english
Creator: Fear, Justin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: apoptosis, bad, bax, bcl2, preimplantation
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The developmental acquisition of apoptosis occurs in a stage dependent manner in the bovine preimplantation embryo. Two-cell embryos lack the capacity for apoptosis, and the embryo remains refractory to apoptotic stimuli until the 8- to 16-cell stage. The apoptotic machinery is present in the 2-cell embryo but the mitochondria are resistant to depolarization following apoptotic stimuli. This suggests that there is a developmental regulation of apoptosis at the level of the mitochondria. Propagation of an apoptotic signal requires mitochondrial outer membrane depolarization, which is dependent upon the complex balance of anti- versus pro- apoptotic proteins. It was hypothesized that 2-cell embryos have higher amounts of anti-apoptotic proteins and lower amounts of pro-apoptotic proteins, thereby shifting the balance towards life and preventing the capacity for apoptosis. After embryonic genome activation, at the 8- to 16-cell stage, there is a decrease in anti-apoptotic proteins and an increase in pro-apoptotic proteins causing the embryo to adjust the balance of life and death and acquire the capacity for apoptosis in ?16-cell embryos. Accordingly, a series of experiments were conducted to test variations in expression of anti- and pro-apoptotic genes early during stages of preimplantation development. Expression of anti-apoptotic genes BCL2 and HSPA1A were higher in oocytes, 2-cell embryos, and 2-cell embryos treated with a transcription inhibitor compared to ?16-cell embryos. In contrast, expression of pro-apoptotic gene BAD was higher in ?16-cell embryos when compared to oocytes, 2-cell embryos, and 2-cell embryos treated transcription inhibitor. Steady-state mRNA for BCL2L1, BAX, DFFA, and HIST1H2A was not affected by stage of development. Protein concentrations also varied between the 2-cell embryo and the ?16-cell embryo. The 2-cell embryo had higher immunoreactive amounts of the anti-apoptotic protein BCL2 compared to the ?16-cell embryo. In contrast, the ?16-cell embryo had higher immunoreactive amounts of BAX when compared to the 2-cell embryo. Immunoreactive amounts of BCL2L1, HSPA1A and BAD were not significantly affected by stage of development. These results suggests that the loss of capacity for apoptosis in the 2-cell embryo is due at least in part, to higher amounts the anti-apoptotic protein BCL2. Developmental acquisition of apoptosis is dependent upon a decrease in expression of BCL2 along with an increase in expression of the pro-apoptotic protein BAX and possibly increased availability of BAD after embryonic genome activation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Justin Fear.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Hansen, Peter J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041865:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041865/00001

Material Information

Title: Developmental Acquisition of Apoptosis in the Preimplantation Bovine Embryo Returning to the Balance of Live and Death
Physical Description: 1 online resource (125 p.)
Language: english
Creator: Fear, Justin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: apoptosis, bad, bax, bcl2, preimplantation
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The developmental acquisition of apoptosis occurs in a stage dependent manner in the bovine preimplantation embryo. Two-cell embryos lack the capacity for apoptosis, and the embryo remains refractory to apoptotic stimuli until the 8- to 16-cell stage. The apoptotic machinery is present in the 2-cell embryo but the mitochondria are resistant to depolarization following apoptotic stimuli. This suggests that there is a developmental regulation of apoptosis at the level of the mitochondria. Propagation of an apoptotic signal requires mitochondrial outer membrane depolarization, which is dependent upon the complex balance of anti- versus pro- apoptotic proteins. It was hypothesized that 2-cell embryos have higher amounts of anti-apoptotic proteins and lower amounts of pro-apoptotic proteins, thereby shifting the balance towards life and preventing the capacity for apoptosis. After embryonic genome activation, at the 8- to 16-cell stage, there is a decrease in anti-apoptotic proteins and an increase in pro-apoptotic proteins causing the embryo to adjust the balance of life and death and acquire the capacity for apoptosis in ?16-cell embryos. Accordingly, a series of experiments were conducted to test variations in expression of anti- and pro-apoptotic genes early during stages of preimplantation development. Expression of anti-apoptotic genes BCL2 and HSPA1A were higher in oocytes, 2-cell embryos, and 2-cell embryos treated with a transcription inhibitor compared to ?16-cell embryos. In contrast, expression of pro-apoptotic gene BAD was higher in ?16-cell embryos when compared to oocytes, 2-cell embryos, and 2-cell embryos treated transcription inhibitor. Steady-state mRNA for BCL2L1, BAX, DFFA, and HIST1H2A was not affected by stage of development. Protein concentrations also varied between the 2-cell embryo and the ?16-cell embryo. The 2-cell embryo had higher immunoreactive amounts of the anti-apoptotic protein BCL2 compared to the ?16-cell embryo. In contrast, the ?16-cell embryo had higher immunoreactive amounts of BAX when compared to the 2-cell embryo. Immunoreactive amounts of BCL2L1, HSPA1A and BAD were not significantly affected by stage of development. These results suggests that the loss of capacity for apoptosis in the 2-cell embryo is due at least in part, to higher amounts the anti-apoptotic protein BCL2. Developmental acquisition of apoptosis is dependent upon a decrease in expression of BCL2 along with an increase in expression of the pro-apoptotic protein BAX and possibly increased availability of BAD after embryonic genome activation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Justin Fear.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Hansen, Peter J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041865:00001


This item has the following downloads:


Full Text





DEVELOPMENTAL ACQUISITION OF APOPTOSIS IN THE PREIMPLANTATION
BOVINE EMBRYO: RETURNING TO THE BALANCE OF LIFE AND DEATH




















By

JUSTIN M. FEAR


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2010

































2010 Justin M. Fear




























To Laura M. Neumann, for all of her love, help, and understanding and to my parents;
Karen M. and Jerry J. Fear for their love, support, and the many opportunities they have
given me









ACKNOWLEDGMENTS

This thesis would not have been possible without the guidance, encouragement,

and dedication of Dr. Peter J. Hansen, chair of my supervisory committee. Dr. Hansen

accepted me into the Animal Molecular and Cellular Biology program, and it was with

his support that this project was made possible; for this is am truly grateful. I would also

like to thank my supervisory committee: Dr. Sally Johnson and Dr. Lei Zhou for their

contributions and suggestions.

I would like to thank all my lab mates, Dr. Jeremy Block, Aline Bonilla, Luciano

Bonilla, Dr. Silvia Carambula, Sarah Fields, Dr. Katherine Hendricks, Barbara Loureiro,

Dr. James Moss, Dr. Lilian Oliveira, Dr. Manabu Ozawa, and Dr. Maria Padua. It is with

their help and guidance I have been able to carry out this project.

I would like to thank the personnel at Central Packing Co., Center Hill, FL, for

providing the ovaries used in this thesis, and to William Rembert for his dedication and

willingness collect ovaries throughout these projects, on Earth and in space. I am also

thankful to the extended faculty, staff, and students of the Department of Animal

Sciences and the Animal Molecular and Cell Biology program for their support.

I would like to give special thanks to John Wayne Kennedy (Zero Gravity Inc.), Dr.

Neil Talbot (USDA), and Louis Stodieck (BioServe Space Technologies) for allowing me

to participate in the joint project with the USDA to study bovine embryo development in

space. I would like to thank the staff of the Kennedy Space Center Space Life Science

Lab for providing the facilities and assistance on that project. I also thank the crew of

the space shuttle Endeavour along with all those who participated on mission STS-126.

Special thanks to Luciano Bonilla who was my partner on this project, I could not have

done this alone.









I would like to express my deepest gratitude to my parents, Jerry J. and Karen M.

Fear along with my brother Joseph M. Fear for their support and helping me to be the

person I am today.

Finally, I thank the love of my life, Laura M. Neumann for her care, love,

understanding and devotion over these years. Truly without her I would be lost on this

great journey of life.









TABLE OF CONTENTS

page

A C KNOW LEDG M ENTS ......... ............... ............................................. ............... 4

LIST O F TA B LES .......... ..... ..... .................. ............................................. ...... .. 8

LIS T O F F IG U R E S .................................................................. 9

LIST OF ABBREVIATIONS ........................................ 10

A BST RA C T ............... ... ..... ......................................................... ...... 15

CHAPTER

1 LITERATURE REVIEW .................. .................. ......... 17

Overview of the Role of Apoptosis During Preimplantation Development ............. 17
Pathw ays of A poptosis ........................ .................... .. .. ............................. 19
The Extrinsic Pathway ................................. ..... ............... 19
The Intrinsic Pathway ............. ... ... .... ...... ...................... 20
Molecular Events Controlling Apoptosis in the Intrinsic Pathway.......................... 21
Pore Formation and Permeabilization ......... ............. .... ................... 24
Cytochrome C Release ............. .................................. ............... 26
O the r A po ptoge n ic Facto rs...................................................... ... .. ............... 2 7
The Apoptosom e ............. .... ............................ .. .. ....... ........ 29
T he C aspase C cascade ........ .......... .... ...................... ............................ ..31
The Role of Ceramide as a Signaling Molecule Triggering Apoptosis ............. 34
BCL2 Family Proteins ..................... ................................. 36
Structure.................................. ......... ............... 36
Membrane Permeabilization and Pore Formation ..................................... 38
Protein Interactions and Signal Transduction .......................................... 39
Regulation of BCL2 Fam ily M em bers ........... ...................... ..... ............. 41
Apoptosis in the Preimplantation Embryo ................ ....... .. ................... 45
Occurrence of Apoptosis in the Oocyte and the Preimplantation Embryo........ 45
Apoptosis as a Protective Mechanism.............. .... .. .. ........... ....... 47
Developmental Regulation of Apoptosis in Preimplantation Embryos ............. 48
Possible Causes for Developmental Regulation ......................................... 50
T h e s is ............. ......... .. .. ......... .. .. ............................................. 5 2

2 DEVELOPMENTAL ACQUISITION OF APOPTOSIS IN THE BOVINE
PREIM PLANTATION EM BRYO .......................................................... ............... 57

Introduction .................................... ................................. ......... 57
Materials and Methods................................................... 59
M materials ........................... .................... .......... 59
In V itro Production of Em bryos...................................................................... 60









BEND Cell Culture................................ ............... 61
RNA Extraction ............................................ 61
Quantitative Real-Time RT-PCR (qPCR) .............. ...... ................. 62
Immunocytochemistry ..................... .............................. 64
Image Analysis ......................... ........... ........ 65
W western B letting ......... ............... ............ .......... ......................... 66
Experim mental Design .............. ........ ................ ............... .............. 67
S tatistica l A na lysis ........................................................................ ......... 6 8
Results .............. .......... .................................... 69
Quantitative Real-Time RT-PCR ........................ ............... 69
Immunocytochemistry and W western Blotting .......... ............ .................... 70
D discussion ........... ......... ............................... 71

APPENDIX: COWS IN SPACE: A PRELIMINARY INVESTIGATION TO
DETERMINE EFFECTS OF SPACE FLIGHT ON BOVINE
PREIMPLANTATION EMBRYO DEVELOPMENT ............................................. 86

In tro d u c tio n ................................................................................. 8 6
Materials and Methods.................................................. 89
M materials ..... ............................................... ..... .. ................ 89
In V itro Production of Em bryos...................................................................... 89
Fluid Processing Apparatus.................... ............................... 90
Group Activation Pack Preparation and Handoff ................ .................. 91
Launch, Fixation, and Recovery ............................................. 91
TUNEL and Hoescht 33342 Labeling ...................... .. ..... ............ 91
E xpe rim e nta l D e sig n .......................................... .......................... ........... 92
S tatistica l A na lysis ........................................................................ ......... 9 3
R results ............................................................................... ............ 93
D discussion ............... ............................................................................... 94

LIST OF REFERENCES ................................................................ 103

BIOGRAPHICAL SKETCH .......................................... 125









LIST OF TABLES

Table page

2-1 Primer sets used for qRT-PCR................................ ............... 79

A-1 Developmental distribution of embryos recovered from FLIGHT and
G R O U N D .................. .................................. ................. 1 0 0

A-2 Comparison of embryonic development coincident with orbital flight ............... 101









LIST OF FIGURES


Figure page

1-1 Schematic of the extrinsic or receptor-mediated apoptotic pathway................. 54

1-2 Schematic of the intrinsic or mitochondrial apoptotic pathway ........................... 55

1-3 Schematic drawing of the BCL2 family proteins .............. .... ................ 56

2-1 Quantitative real-time RT-PCR for anti-apoptotic genes.................................. 80

2-2 Immunoreactive amounts of BCL2 ...... .... .............. ............... 81

2-3 Immunoreactive amounts of BAX ................................................. 83

2-4 Immunoreactive amounts of BCL2L1, HSPA1A, and BAD........................ 85

A-1 Schematic drawing the the fluid processing apparatus (FPA) .......................... 96

A -2 Plunger apparatus ....................... .. ................ ................................ 97

A-3 Group activation pack (GAP) ....... ..... ....... ................... ..... .......... 98

A -4 Flight incubator .............................................. ................. .............. 99

A-5 Representative images of TUNEL analysis ................................... ................ 102











Abbreviation

AZA

ANT

ADP

ATP

AIF

ART

APAF1

BIR

BCL2

BBC3

BAK1

BAD

BAX

BCL2L1

BCL211

BOK

BID

BEND cell

CCCP

CARD

CAPK

cDNA

COCs


LIST OF ABBREVIATIONS

Term (Alias)

5-Aza-2'-Deoxycytidine

Adenine-Nuclotide Translocator

Adenosine Diphosphate

Adenosine Triphosphate

Apoptosis Inducing Factor 1

Apoptosis Regulating and Targeting Sequence

Apoptotic Peptidase Activating Factor 1

Baculoviral IAP Repeat

B-cell CLL/Lymphoma 2

BCL2 Binding Component 3 (PUMA)

BCL2-Antagonist/Killer 1 (BAK)

BCL2-Associated Agonist of Cell Death

BCL2-Associated X Protein

BCL2-Like 1 (BCL-xL)

BCL2-Like 11 (BIM)

BCL2-Related Ovarian Killer

BH3 Interacting Domain Death Agonist

Bovine Endometrial Cell Line

Carbonyl Cyanide 3-Chlorophenyl Hydrazone

Caspse-Recruitment Domain

Ceramide-Activated Protein Kinase

Complementry DNA

Cumulus-Oocyte Complexes









Ct

DD

DED

DISC

Diablo

DEPC

DFF

DFFA

DFFB

DNA

DNAJB1

DRP1

EGA

FASLG

FADD

FIS1

FPA

GLM

GAP

HSPA1A

HPM

HIST1H2A

hpi

HTRA2

IVF


Cycle Threshold

Death Domain

Death Effector Domains

Death Inducing Signaling Complex

Diablo Homolog (SMAC/DIABLO)

Diethyl Pyrocarbonate

DNA Fragmentation Factor

DNA Fragmentation Factor A (DFF45, ICAD)

DNA Fragmentation Factor B (DFF40, CAD)

Deoxyribonucleic Acid

DNAJ Homolog 1

Dynamin Related Protein 1

Embryonic Genome Activation

Fas Ligand (FASL)

Fas-Associated Protein with Death Domain

Fission 1

Fluid Processing Apparatus

General Linear Model

Group Activation Pack

Heat-Shock Protein 70 kDa 1A (HSP70.1)

High-Polarized Mitochondria

Histone Cluser 1, H2a (H2A.1)

Hours Post-Insemination

HtrA Serine Peptidase 2 (OMI)

In Vitro Fertilization









IAP

ICM

KSR1

KSOM-BE2

MII

MOM

MOMP

MFN1

MAPK

MAPK8

MAPK9

MAP3K1

MCL1

NLS

NB-ARC

OPA1

PBS-PVP

PHE

PTP

PBS

PMAIP1

PARP1

PCR

KSOM

PCD


Inhibitors of Apoptosis

Inncer Cell Mass

Kinase Supressor of RAS (KSR)

KSOM-Bovine Embryo 2

Metaphase 2

Mitochondrial Outer Membrane

Mitochondrial Outer Membrane Permeabilization

Mitofusin 1

Mitogen-Activated Protein Kinase

Mitogen-Activated Protein Kinase 8 (JNK)

Mitogen-Activated Protein Kinase 9 (SAPK)

Mitogen-Activated Protein Kinase Kinase Kinase 1 (MEKK1)

Myeloid Cell Leukemia Sequence 1

Nuclear Localization Signal

Nucleotide Binding and Oligomerization

Optic atrophy 1 Homolog

PBS + Polyvinylpyrrolidone

Penicillamine Hypotaurin Epinephrine

Permeability Transition Pore

Phophate Buffered Saline

Phorbol-12-Myristate-13-Acetate-lnduced protein 1 (NOXA)

Poly (ADP-ribose) Polymerase 1

Polymerase Chain Reaction

Potassium Simplex Optomized Medium

Programmed Cell Death









qPCR

ROS

RT-PCR

RNA

RNAi

SDS

SMPD

SMPD1

SMPD2

SAS

TBS-T

TBS-TM

TUNEL


TCM-199

TIMM8A

TSA

TBS

TE

tBID

TNFSF10

TNF

TALP

TL

YWHAQ


Quantitative Real-Time RT-PCR

Reactive Oxygen Species

Reverse Transcription PCR

Ribonucleic Acid

RNA Interference

Sodium Dodecyl Sulfate

Sphingomyelin Phosphodiesterase (SMase)

Sphingomyelin Phosphodiesterase 1 (aSMase)

Sphingomyelin Phosphodiesterase 2 (nSMase)

Statistical Analysis System

TBS + Tween

TBS + Tween + Non-Fat Dry Milk

Terminal Deoxynucleotidyl Transferase Deoxyuridine Triphosphate
Nick End Labeling

Tissue Culture Medium 199

Translocase of Inner Mitochondrial Membrane 8 Homolog A

Trichostatin-A

Tris Buffered Saline

Trophectoderm

Truncated BID

Tumor Necrosis Factor (Ligand) Superfamily, Member 10 (TRAIL)

Tumor Necrosis Factor-a (TNF-a)

Tyrodes Albumin Lactate Pyruvate

Tyrodes Lactate

Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase
Activation Proteins (14-3-3)









AKT1 v-akt Murine Thymoma Viral Oncogene Homolog 1 (AKT/PKB)

VDAC Voltage-Dependent Anion Channel

VDAC1 Voltage-Dependent Anion Channel 1

VDAC2 Voltage-Dependent Anion Channel 2

XIAP X-Linked Inhibitor of Apoptosis

a-PFPs a-Pore Forming Proteins









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

DEVELOPMENTAL ACQUISITION OF APOPTOSIS IN THE PREIMPLANTATION
BOVINE EMBRYO: RETURNING TO THE BALANCE OF LIFE AND DEATH
By

Justin M. Fear

August 2010

Chair: Peter J. Hansen
Major: Animal Molecular and Cellular Biology

The developmental acquisition of apoptosis occurs in a stage dependent manner

in the bovine preimplantation embryo. Two-cell embryos lack the capacity for

apoptosis, and the embryo remains refractory to apoptotic stimuli until the 8- to 16-cell

stage. The apoptotic machinery is present in the 2-cell embryo but the mitochondria are

resistant to depolarization following apoptotic stimuli. This suggests that there is a

developmental regulation of apoptosis at the level of the mitochondria.

Propagation of an apoptotic signal requires mitochondrial outer membrane

depolarization, which is dependent upon the complex balance of anti- versus pro-

apoptotic proteins. It was hypothesized that 2-cell embryos have higher amounts of

anti-apoptotic proteins and lower amounts of pro-apoptotic proteins, thereby shifting the

balance towards life and preventing the capacity for apoptosis. After embryonic

genome activation, at the 8- to 16-cell stage, there is a decrease in anti-apoptotic

proteins and an increase in pro-apoptotic proteins causing the embryo to adjust the

balance of life and death and acquire the capacity for apoptosis in 216-cell embryos.

Accordingly, a series of experiments were conducted to test variations in expression of

anti- and pro-apoptotic genes early during stages of preimplantation development.









Expression of anti-apoptotic genes BCL2 and HSPA1A were higher in oocytes, 2-

cell embryos, and 2-cell embryos treated with a transcription inhibitor compared to 216-

cell embryos. In contrast, expression of pro-apoptotic gene BAD was higher in 216-cell

embryos when compared to oocytes, 2-cell embryos, and 2-cell embryos treated

transcription inhibitor. Steady-state mRNA for BCL2LI, BAX, DFFA, and HIST1H2A

was not affected by stage of development.

Protein concentrations also varied between the 2-cell embryo and the 216-cell

embryo. The 2-cell embryo had higher immunoreactive amounts of the anti-apoptotic

protein BCL2 compared to the 216-cell embryo. In contrast, the >16-cell embryo had

higher immunoreactive amounts of BAX when compared to the 2-cell embryo.

Immunoreactive amounts of BCL2L1, HSPA1A and BAD were not significantly affected

by stage of development.

These results suggests that the loss of capacity for apoptosis in the 2-cell embryo

is due at least in part, to higher amounts the anti-apoptotic protein BCL2.

Developmental acquisition of apoptosis is dependent upon a decrease in expression of

BCL2 along with an increase in expression of the pro-apoptotic protein BAX and

possibly increased availability of BAD after embryonic genome activation.









CHAPTER 1
LITERATURE REVIEW

The term apoptosis is proposed for a hitherto little recognized mechanism
of controlled cell deletion, which appears to play a complementary but
opposite role to mitosis in the regulation of animal cell populations.

Kerr et al. 1972

Overview of the Role of Apoptosis During Preimplantation Development

The developmental success of a preimplantation embryo is dependent on its ability

to adapt to the surrounding environment and protect itself against intrinsically or

extrinsically-induced cellular damage. Upon damage to DNA or organelles, somatic

cells respond by arresting the cell cycle and activating repair mechanisms (Friedberg,

2003). If damage is repaired, the cell cycle resumes; otherwise the cell undergoes

programmed cell death (PCD), also termed apoptosis (Friedberg, 2003). Apoptosis is a

cascade of events leading to cytoplasmic, nuclear, and DNA fragmentation. The cell

fragments into membrane-bound apoptotic bodies which are either dispersed or

phagocytized by neighboring cells (Kerr et al., 1972; Wyllie et al., 1980). Apoptosis is

heavily regulated to prevent unwanted cell death. Regulation ranges from genetic

controls (Wyllie, 1995) to complex protein interactions (Hanada et al., 1995; Yang et al.,

1995; Wang et al., 1996; Zha et al., 1996; Garland and Rudin, 1998).

Apoptosis plays a variety of roles in the preimplantation embryo including removal

of cells with chromosomal defects (aneuploidy) (Hardy, 1999; Liu et al., 2002) or those

with inappropriate developmental potential such as cells of the inner cell mass (ICM)

that fail to lose the potential to form trophectoderm (TE) (Handyside and Hunter, 1986;

Pierce et al., 1989; Parchment, 1993; Hardy, 1997). Apoptosis is also involved in

elimination of damaged cells in the preimplantation embryo as has been shown









experimentally for embryos exposed to reactive oxygen species (ROS) (Yang et al.,

1998), menadione (Moss et al., 2009), ultraviolet radiation (Herrler et al., 1998), heat-

shock (Paula-Lopes and Hansen, 2002a), and arsenic (Krininger et al., 2002). Indeed,

clearance of damaged cells in a compromised blastocyst by apoptosis can enhance the

probability that an embryo can survive stress (Paula-Lopes and Hansen, 2002; Jousan

and Hansen, 2007).

One characteristic of apoptosis responses during the preimplantation period is that

the capacity for apoptosis is developmentally acquired. In the bovine preimplantation

embryo, it is between the 8- to 16-cell stage, that signals such as heat-shock (Paula-

Lopes and Hansen, 2002; Brad et al., 2007), ceramide (de Castro e Paula and Hansen,

2008), arsenic (Krininger et al., 2002), or tumor necrosis factor-a (TNF) (Soto et al.,

2003a) first are capable of inducing apoptosis. Earlier in development, apoptosis is not

possible.

Apoptosis responses may be inhibited early in development to prevent accidental

triggering of apoptosis by signals generated during fertilization and preimplantation

development. Fertilization causes a complex set of intracellular [Ca2+] oscillations which

allow the oocyte to complete the second meiotic division (Whitaker, 2006). These

oscillations may have the potential to induce an apoptotic response given that increases

in intracellular [Ca2+] have been associated with apoptosis (Kaiser and Edelman, 1977;

McConkey et al., 1989). In the bovine, calcium activated cysteine proteinase, p-calpain,

is activated in oocytes, morulae and blastocysts. Inhibition of p-calpain reduced

apoptotic indices (Sergeev and Norman, 2003) showing it is involved in apoptosis in the

early preimplantation embryo.









It may also be that, when cell number is low, removal of cells by apoptosis in

response to stress is harmful rather than beneficial. For example, the elimination of 10

damaged cells from a 150-cell blastocyst may be an effective strategy for facilitating

continued development but removal of 1 damaged cell from a 2-cell embryo may

accentuate reduction in developmental potential caused by stress. Although a bisected

2-cell embryo can develop into a blastocyst (Loskutoff et al., 1993), insults to the

embryo are likely to affect both blastomeres and loss of one cell to apoptosis may make

further development problematic.

Pathways of Apoptosis

There are two well-known pathways of apoptosis the extrinsic or receptor

mediated-pathway and the intrinsic or mitochondrial pathway. Both of these pathways

result in the activation of caspases and DNases that cause cytoplasmic, nuclear, and

DNA fragmentation and lead to the classic morphological signs of apoptosis, membrane

blebbing and formation of apoptotic bodies. The major difference between the two

pathways is the involvement of a receptor-mediated signal versus an internally-

generated, mitochondrial signal.

The Extrinsic Pathway

The extrinsic pathway, illustrated in Figure 1-1, utilizes specialized membrane-

bound 'death receptors' that are members of the tumor necrosis factor superfamily

(Ashkenazi and Dixit, 1998). These receptors share a homologous domain (about 80

amino acids) in their cytoplasmic region called the death domain (DD) (Nagata, 1999).

Binding of a variety of extra-cellular signaling molecules such as Fas ligand (FASLG)

(Nagata, 1997), TNF-related apoptosis inducing ligand (TNFSF10, previously TRAIL)

(MacFarlane, 2003), and TNF (Ding and Yin, 2004), activates these receptors. An









adapter molecule, Fas-associated protein with death domain (FADD), is recruited by the

receptor and interacts with the DD. FADD then interacts with procaspase-8. Two death

effector domains (DED) on the N-terminal region of procaspase-8 combine to form the

death-inducing signaling complex (DISC). Procaspase-8 contains a weak proteinase

activity that is activated upon DISC formation, allowing self-cleavage to produce active

caspase-8 (Nagata, 1997). Caspase-8 preferentially cleaves procaspase-3 and -7 into

caspase-3 and -7 which in turn activate other caspases and cleave a variety of cellular

proteins.

There are two cell types with regards to the extrinsic pathway based on whether

the cell has sufficient quantities of caspase-8, -3, and -7 for induction of apoptosis. For

cells with insufficient quantities, the intrinsic pathway (see below) is activated through

cleavage of BH3 interactive domain death agonist (BID) into truncated BID (tBID) by

casapse-8, allowing for the apoptosis signal to be amplified (Scaffidi et al., 1998).

Caspase-3 and -7 then cleave DNA fragmentation factor A (DFFA), also known as the

inhibitor of caspase-activated DNase. Cleavage of DFFA leads to its release from the

DNA fragmentation factor B (DFFB) or caspase-activated DNase. As a result, DFFB

becomes an active DNase and cleaves internucleosomal regions of chromosomal DNA

(Nagata, 1999).

The Intrinsic Pathway

The intrinsic pathway, illustrated in Figure 1-2, is the stress induced pathway of

apoptosis. This pathway does not utilize membrane-bound receptors like the extrinsic

pathway but instead depends upon activation for a stress-induced signal such as the

activation of sphingomyelin phosphodiesterase (SMPD) by heat-shock causing the

hydrolysis of sphingomyelin to ceramide. Ceramide, in turn activates BH3-only









members of the BCL2 family through mitogen-activated protein kinase (MAPK9;

previously SAPK) or mitogen-activated protein kinase 8 (MAPK8; previously JNK).

BH3-only proteins inhibit anti-apoptotic actions of B-cell CLL/lymphoma 2 (BCL2) and

BCL2-like 1 (BCL2L1, previously BCL-xL) by binding to the anti-apoptotic BCL2 and

BCL2L1 causing release of the pro-apoptotic proteins BCL2-associated X protein (BAX)

and BCL2-antagonist/killer 1 (BAK1). In addition to the inhibition of BCL2 and BCL2L1,

some BH3-only proteins bind to BAX and BAK1 causing a conformational change

allowing targeting to the mitochondrial outer membrane and formation of multimers.

BAX and BAK1 then form pores in the mitochondrial outer membrane leading to

mitochondrial depolarization. Consequently, cytochrome c is released into the cytosol.

Cytochrome c binds to apoptosis inducing factor 1 (APAF1) and causes a

conformational change allowing it to form a 7 member unit called the apoptosome. The

apoptosome recruits multiple units of the zymogen procaspase-9. Once procaspase-9

concentrations are high enough, there is a conformational change in procaspase-9

exposing the enzymatically active site of caspase-9. Caspase-9 in turn cleaves and

activates the executioner or group II caspases (-3, -6, and -7). The caspase cascade

terminates with cleavage of DFFA leading to its disassociation from DFFB activating the

DNase. DFFB then cuts DNA into the internucleosomal fragments which are the

hallmark of apoptosis (Wyllie et al., 1980).

Molecular Events Controlling Apoptosis in the Intrinsic Pathway

Mitochondria are membrane-enclosed organelles found in the majority of

eukaryotic cells. It was incorporated during eukaryotic evolution from symbiotic

bacteria. The mitochondrion has retained its own genome that encodes 37 genes but it

also requires nuclear encoded genes. The major function of the mitochondria is the









production of adenosine tri-phosphate (ATP). As part of the process of energy

production, the outer mitochondrial membrane becomes highly polarized with respect to

H+. Polarization is also key to the participation of mitochondria in signal transduction in

several cellular pathways including apoptosis.

Mitochondria have the ability to form complex and dynamic networks. These

networks allow for mitochondrial communication, cellular signal transduction and signal

amplification. Perhaps the clearest example of this is the signal transduction event at

fertilization. During oocyte maturation there is a formation of a ring of high-polarized

mitochondria (HPM) in the subplasmalemmal region. This ring of HPM is required for

sperm penetration and cortical granule exocytosis (van Blerkom and Davis, 2007). The

authors suggested that the HPM establish a continuous circumferential circuit, capable

to reacting to and propagating a signal across the subplasmalemmal cytoplasm.

Apoptosis leads to fragmentation of the mitochondrial network communication both

upstream and downstream of apoptotic stimuli (Gao et al., 2001; Arnoult et al., 2005a;

Youle and Karbowski, 2005). In the initial stages of apoptosis, however, the

mitochondrial network is important for propagation of the apoptotic signal because early

fragmentation of the mitochondrial network prevents cell death (Perfettini et al., 2005).

The key event in induction of apoptosis by the intrinsic pathway is permeabilization

of the mitochondrial outer membrane (MOM) (termed mitochondrial outer membrane

permeabilization or MOMP). Sensitivity of the mitochondrion to outer-membrane

permeabilization may be affected by mitochondrial shape which is derived from

equilibrium of fusion and fission events affecting membrane integrity and structural

proteins. The mitochondria can undergo fusion with other mitochondria, or fission









leading to the production of two daughter organelles. Both mitochondrial fusion and

fission depend upon GTPases; mitofusin 1 (MFN1), optic atrophy 1 (OPA1) and

dynamin related protein 1 (DRP1) (Smirnova et al., 2001; Santel et al., 2003; Cipolat et

al., 2004). While early fragmentation of the mitochondrial network may prevent

apoptotic signaling from propagation, there is evidence showing the induction of

network fragmentation downstream of BAX/BAK1 signaling events (Arnoult et al.,

2005a). BAX has been shown to co-localize with DRP1 at mitochondrial fission sites

suggesting its involvement (Karbowski et al., 2002). BAX and BAK1 also induce

sumoylation of DRP1 during apoptosis, prior to pore formation, which leads to the

stabilization and prevents lysosomal degradation of DRP1 (Wasiak et al., 2007). Finally

as a result of MOMP there is a release of the mitochondrial factor, translocase of inner

mitochondrial membrane 8 homolog A (TIMM8a), which leads to further activation of

DRP1 (Arnoult et al., 2005b). Even thought mitochondrial network breakdown is part of

apoptosis, its inhibition does not prevent BAX/BAK1-dependent apoptosis (Parone et

al., 2006).

Mitochondrial outer-membrane depolarization leads to the release of many

mitochondrial factors including cytochrome c, endonuclease g and Diablo homolog

(DIABLO; previously SMAC/DIABLO). These factors are involved in further signal

transduction by the creation of the apoptosome and initiation of the caspase signaling

cascade. Indeed, MOMP and cytochrome c release is the "point of no return" in the

apoptotic signal transduction system so that once activated the cell is committed to

destruction. It is the irreversibility of events contingent on MOMP that has lead to

development of tight regulatory control mechanisms for MOMP.









Pore Formation and Permeabilization

At the level of the mitochondria, the first step in signal propagation is pore

formation and permeabilization of the MOM. Currently there are several competing

models to explain this mechanism. The first model suggests that there is an opening of

the permeability transition pore (PTP). The PTP spans both the outer and inner

mitochondrial membranes with a voltage-dependent anion channel (VDAC) on the outer

membrane and the adenine-nucleotide translocator (ANT) channel or a similar channel

on the inner-membrane (Green and Kroemer, 2004). In addition, there is possible

involvement of several other proteins including cyclophilin D and hexokinase-ll

(Kumarswamy and Chandna, 2009). In this model, VDAC is semipermeable to allow

passage of molecules up to 5 kDa, while the ANT is nearly impermeable. Differential

permeability is essential for the generation of the electrochemcial proton gradient used

for oxidative phosphorylation (Bernardi, 1999). In response to an apoptotic stimulus,

mitochondrial calcium concentrations increase, which leads to the opening of the PTP

allowing calcium, water, and other low molecular weight molecules (~1.5 kDa) to pass

through the inner-membrane (Green and Kroemer, 2004). With the influx of water,

there is a swelling of the mitochondrial matrix which is sufficient enough to lead to

rupture of the outer membrane and release of cytochrome c.

There are two major issues with this model. First, mitochondrial function and

structure are preserved after cytochrome c release suggesting that there is not a rupture

of the outer membrane (Ashen and Goff, 2000). Also, cells lacking BAX and BAK1 fail

to undergo MOMP in response to a wide range of apoptotic stimuli including

staurosporine, ultraviolet radiation, growth factor deprivation, and tBID-induced









cytochrome c release (Wei et al., 2001). Thus, the two major pro-apoptotic members of

the BCL2 family, BAX and BAK1, are necessary for initiation of pore formation.

BAX is primarily localized to the cytosol and translocates to the mitochondrial

membrane when activated by the binding of certain BH3-only domain proteins like BID

and BCL2-like 11 (BCL2L11, previously BIM) (Lovell et al., 2008). BAK1 is localized to

the mitochondrial outer membrane associated with VDAC2, myeloid cell leukemia

sequence 1 (MCL1) and BCL2L1 (Cheng et al., 2003; Willis et al., 2005; Li et al., 2008).

Like BAX, BAK1 is also activated by binding of BH3-only proteins (e.g. BID).

BAX and BAK1 belong to a class of amphipathic proteins called a-pore-forming

proteins (a-PFPs) that contain several a-helices that can bind to the water-lipid interface

of the mitochondrial lipid bi-layer. BAX and BAK1 then form multimer units in the

mitochondrial membrane resulting in the interfacial area increasing and stretching the

hydrocarbon core of the bi-layer. This strain on the membrane increases with protein

concentration, when the concentration is such that it exceeds a threshold, a stable pore

is formed with a defined size (Lee et al., 2008). The a5-helix of BAX forms a type of

pore referred to as toroidal or lipidic pore which is made of both protein and lipids (Qian

et al., 2008). When the pore is formed, it relieves some of the interfacial strain and

becomes stable.

One interesting player that appears to be involved in both models of mitochondrial

outer membrane permeabilization are VDACs. There are three isoforms of VDACs and

each have different functions with regards to pore formation (reviewed Blachly-Dyson

and Forte, 2001). VDAC2 has been shown to be inhibitory of BAK1 (Cheng et al.,

2003), while VDAC1 appears to be a contributing factor to pore formation in ROS









stimulated apoptosis, through its binding with active BAX or BAK1. The VDACs may

function to group small amounts of cardiolipin and related lipids present in the MOM into

microdomains. When active BAX and BAK1 associate with VDAC1, these lipid domains

may aid in the lipidic pore formation and permeabilization.

Cytochrome C Release

Regardless of how MOMP occurs, cytochrome c release is "the point of no return".

Cytochrome c is a molecule that has been shown to be involved in electron

transportation between the mitochondrial inner and outer membranes (Bernardi and

Azzone, 1981). Beyond its role in respiration, cytochrome c is a major signaling factor

in the apoptotic cascade (Liu et al., 1996). Release of cytochrome c occurs within

minutes following an apoptotic stimulus (Goldstein et al., 2000) leading to the

propagation of the apoptotic signal.

Cytochrome c resides in the mitochondrial inter-membrane space. Approximately

10-15% of cytochrome c is available in the mitochondrial inter-membrane space while

the rest is compartmentalized within pockets formed by the cristae or inner-membrane

folds (Bernardi and Azzone, 1981). One implication of the localization of cytochrome c

is that apoptosis requires not only formation of pores in the MOM but also remodeling of

the cristae (Scorrano et al., 2002) to allow complete cytochrome c releases as it occurs

in programmed cell death (Goldstein et al., 2000). Like in mitochondrial network

plasticity, OPA1 is involved in cristae remodeling. OPA1 is the major factor involved in

maintenance and formation of the cristae folds (Olichon et al., 2003). Depletion of

OPA1 using RNA interference (RNAi) results in restructuring the cristae allowing

complete release of cytochrome c (Olichon et al., 2003; Griparic et al., 2004; Zhang et

al., 2007). With an apoptotic stimulus, OPA1 is also depleted by its release from the









mitochondria at the same rate as cytochrome c (Arnoult et al., 2005; Yamaguchi et al.,

2008). In addition to OPA1, active BAX and BAK1 have been shown to be involved with

cristae restructuring during apoptosis. Yamaguchi et al. (2008) evaluated the role of

BH3-only proteins BID, BCL2L11, and BCL2-associated agonist of cell death (BAD)

along with the multi-domain proteins BAX and BAK1, in cristae remodeling and

cytochrome c release. Active forms of BID and BCL2L11 showed a loss of OPA1

complexes and a complete release of cytochrome c. BAD had no effect on loss of

OPA1 or cytochrome c release. Using different BAX and BAK1 knockdown or knockout

models, they concluded that BID-induced cristae remodeling was dependent on either

BAX or BAK1. BAX/BAK1-dependent events on the mitochondrial inner-membrane

(cristae remodeling) and on the mitochondrial outer membrane (pore formation) could

experimentally separated (Yamaguchi et al., 2008).

Other Apoptogenic Factors

Besides cytochrome c, there are other apoptogenic factors that are released at the

time of mitochondrial permeabilization including DIABLO, HTRA serine peptidase 2

(HTRA2; previously OMI), endonuclease g, and apoptosis-inducing factor 1 (AIF1).

DIABLO is a nuclear encoded protein that is imported into the mitochondria and

co-localizes with cytochrome c (Du et al., 2000). Like cytochrome c DIABLO's complete

release from mitochondria requires cristae remodeling (Yamaguchi et al., 2008). When

released into the cytosol, DIABLO binds to inhibitors of apoptosis (lAPs) such as X-

linked IAP (XIAP) and survivin (Du et al., 2000; Verhagen et al., 2000; Srinivasula et al.,

2001). lAPs contain three baculoviral IAP repeat (BIR) domains. These domains

function together to bind both procaspases and activated caspases and thereby inhibit









their enzymatic activity (Srinivasula et al., 2001). DIABLO binds to the BIR2 and BIR3

domains and blocks the action of lAPs enhancing caspase activity.

HTRA2 is an evolutionarily conserved nuclear encoded protein with serine

proteinase activity (Hu et al., 1998) it is found in the endoplasmic reticulum, nucleus,

and mitochondria. HTRA2 is released from the mitochondria upon apoptotic stimuli

(anti-FAS antibodies, ultraviolet irradiation, or tBID) (Verhagen et al., 2002; van Loo et

al., 2002). The N-terminus of HTRA2 is almost identical to DIABLO and has been

shown to have similar binding and inhibitory properties towards lAPs (Suzuki et al.,

2001). In addition to the inhibition of lAPs, the serine proteinase also has a pro-

apoptotic function. Over-expression of HTRA2 outside of the mitochondria leads to a

caspase-independent cell death (Suzuki et al., 2001; Verhagen et al., 2002).

Endonuclease g is a nuclear encoded protein that is imported into the

mitochondria and is involved in mitochondrial DNA processing and generation of RNA

primers required for DNA synthesis (C6te and Ruiz-Carrillo, 1993). Endonuclease g is

also released from the mitochondria upon apoptotic stimuli such as ultraviolet radiation

or treatment with tBID coincident with release of cytochrome c (Li et al., 2001). Release

of endonuclease g is independent of release of mitochondrial heat-shock protein 70

(HSPA1A), which is localized to the inner-membrane matrix, suggesting that there are

substantial amounts of endonuclease g in the inter-membrane space and not in the

inner-membrane matrix where DNA processing occurs (Li et al., 2001). Like HTRA2,

the release of endonuclease g can be blocked by the over-expression of BCL2 (Li et al.,

2001; van Loo et al., 2001). Once in the cytosol, endonuclease g translocates to the

nucleus where it cleaves chromatin DNA into fragments (Li et al., 2001; van Loo et al.,









2001). This activity is similar to DFFB except that endonuclease g has been shown to

act as a caspase-independent DNase (van Loo et al., 2001). Endonuclease g also has

RNase activity that has been suggested may play a role as an apoptotic RNase

(Kalinowska et al., 2005).

Apoptosis-inducing factor 1 is a flavoprotein with homology to a bacterial

oxidoreductase; it is encoded in the nucleus and imported into the mitochondria where it

is anchored to the inner-membrane by an amino-terminal transmembrane segment

(Otera et al., 2005) and plays a role in oxidative phosphorylation and redox control

(Modjtahedi et al., 2006). During MOMP, the transmembrane portion of AIF1 is cleaved

by calpain I, a class of cysteine proteinases, and is released into the cytosol (Otera et

al., 2005; Polster et al., 2005). Once in the cytosol, AIF1 translocates to the nucleus

and causes large-scale (~50 kb) DNA fragmentation and chromatin condensation (Susin

et al., 1999). Like for endonuclease g, this apoptogenic function is caspase-

independent (Susin et al., 1999). AIF1 has been shown to play a central role in several

caspase-independent apoptotic signaling mechanisms such as response to DNA

damage (Yu et al., 2002) and by interacting poly(ADP-ribose) polymerase 1 (PARP1).

PARP1 is a nuclear enzyme involved in DNA repair by transferring ADP-ribose to an

acceptor protein such as histone (Hong et al., 2004). AIF1 also stimulates the DNase

activity of endonuclease g (Joza et al., 2009).

The Apoptosome

As mentioned previously, the point of no return for cell death is the release of

cytochrome c and its translation into an irreversible death signaling cascade. Several

signaling modules are required to translate and propagate this signal. The first is

apoptotic peptidase activating factor 1 (APAF1), a monomeric cytosolic protein (Zou et









al., 1997), that senses mitochondrial depolarization by binding to cytochrome c leading

to its oligomerization and formation of a wheel-shaped signaling platform with seven

spokes, the apoptosome (Acehan et al., 2002). Given the importance of regulating this

signal, the formation of the apoptosome is a multi-step process requiring either 2'-deoxy

ATP (dATP) or ATP (Riedl et al., 2005), for simplicity will refer to them as (d)ATP.

To understand the regulation of the apoptosome, it is necessary to first understand

the structure and function of APAF1. APAF1 is a multi-domain protein consisting of a

N-terminal caspase-recruitment domain (CARD), two C-terminal domains consisting of

a string of WD40 repeats, and three central domains called a nucleotide-binding and

oligomerization (NB-ARC) region that contain an ATPase domain (Hanson and

Whiteheart, 2005). In the monomeric form, both the CARD and NB-ARC domains are in

a locked conformational state with the WD40 domain folded over (Bao and Shi, 2007;

Riedl and Salvesen, 2007). Associated with the NB-ARC region is a (d)ATP that is

hydrolyzed to (d)ADP with binding of cytochrome c to the WD40 domain. This leads to

a conformational change removing the WD40 domains from inhibiting the CARD and

NB-ARC domains (Li et al., 1997; Riedl et al., 2005).

The CARD and NB-ARC domains are still in an inhibitory conformation and require

the exchange of (d)ADP for (d)ATP to become activated (Kim et al., 2005; Riedl et al.,

2005; Yu et al., 2005). Therefore, the ADP to ATP exchange represent another level of

control in apoptosome formation. With the exchange of ADP for ATP, the CARD and

NB-ARC domains undergo a conformational change that removes their inhibition. The

active NB-ARC domain can then oligomerize to form the 7 member holoenzyme that is









arranged in a wheel shape with the WD40 domains extending out like spokes and the

CARD domain sitting in on top of the NB-ARC domain in the center.

After apoptosome formation, the final step is for this cytosolic receptor to bind and

activate procaspase-9. The CARD domain of procaspase-9 binds to the CARD domain

of the apoptosome. Caspase-9 is an initiator caspase and functions upstream in the

intrinsic pathway. Caspase-9 is present as a monomeric zymogen (procaspase-9) in

the cytosol. Like other initiator caspases, caspase-9 is sensitive to apoptotic stimuli but

is not easily activated so that the caspase cascade is not accidentally triggered. The

monomeric form of caspase-9 has very little enzymatic activity (Renatus et al., 2001),

but activity increases upon dimerization suggesting that caspase-9 is activated by a

conformational change caused by dimerization instead of a cleavage cleavage event

like the group II caspases (Riedl and Salvesen, 2007). Procaspase-8 also has a similar

activation mechanism and both require being physically brought together onto an

activation platform (Boatright et al., 2003). This model, called the induced proximity

model, suggests that the role of the apoptosome is to bring multiple units of

procaspase-9 together not to cause a cleavage event, but to induce dimer formation

leading to a conformational change activating caspase-9 (Muzio et al., 1998; Boatright

et al., 2003).

The Caspase Cascade

Caspases are cysteine proteinases that cleave peptide bonds on the carboxyl side

of aspartic acid residues (Cohen, 1997). Caspases are synthesized as zymogens or

procaspases with little to no enzymatic activity. Procaspases are structurally organized

into three regions; a prodomain, a large subunit, and a small subunit. Caspases

involved in apoptosis (-2, -3, -6, -7, -8, -9, -10, -12) can be split into two groups based









on the size of their prodomains; initiator caspases with long prodomains (-2, -8, -9, -10)

and executioner caspases with short prodomains (-3, -6, -7, -12). As previously alluded

to, it is hypothesized that the long prodomains on initiator caspases can be activated by

a dimerization event that causes a conformational change allowing for exposure of an

enzymatic active site, while the short prodomain of executioner caspases requires a

cleavage event for activation (Muzio et al., 1998; Boatright et al., 2003).

In the intrinsic apoptotic pathway, caspase-9 is activated by its recruitment to the

apoptosome and dimerization as previously discussed. The executioner caspases -3

and -7 exist at physiological concentrations as dimers with no detectable activity. Active

caspase-9 acts enzymatically on caspase-7 and caspase-3 to cleave the Asp-X bond

between the prodomain and the large subunit and then cleave the Asp-X bond between

the large and small subunits to allow the formation of a tetramer with two large and two

small subunits (Muzio et al., 1998; Slee et al., 1999; Boatright et al., 2003). Activated

caspase-3 has a variety of cellular targets including BCL2 family proteins, a variety of

lAPs, various cytoskeletal proteins (e.g. gelsolin, fodrin, actin, kereatin), other caspases

(-2 and -6), and even a feedback amplification loop that further processes caspase-9

(Srinivasula et al., 1998; Slee et al., 1999).

Activation of caspase-2 and -6 is through a similar mechanism as caspase-3

activation, with cleavage of the prodomain and large and small subunits. Caspase-2

and -6 then activate caspase-8 and -10. The caspase cascade continues to

disassemble the cell with cleavage of various proteins and finally terminates with the

activation of DNA fragmentation factor.









DNA fragmentation factor (DFF) is a heterodimer consisting of DFFA and DFFB.

DFFA and DFFB each contain their own nuclear localization signal (NLS) on the C-

terminus. As a result, DFF is localized to the nucleus in non-apoptotic cells (Liu et al.,

1998; Lechardeur et al., 2000). In addition to the normal 45 kDa form of DFFA, there is

a splice variant that is 35 kDa (DFFA-short) that missing the C-terminal NLS and is

therefore localized to the cytosol (Sakahira et al., 1999; Samejima and Earnshaw,

2000).

DFFB contains an endonuclease active site that is inhibited by its dimerization with

DFFA (Enari et al., 1998; Sakahira et al., 1998). DFFA binds to DFFB during

translation, allowing for the proper folding of DFFB into an enzymatically capable protein

(Enari et al., 1998; Liu et al., 1998) with the possible involvement of HSPA1A and DNAJ

homolog 1 (DNAJB1, previously HSP40) (Sakahira and Nagata, 2002). With activation

of the caspase cascade, DFFA is cleaved at two specific sites by caspase-2, -3, or -7

(Liu et al., 1997; Widlak et al., 2003; Woo et al., 2004; Dahal et al., 2007). Cleavage of

DFFA causes it to disassociate from DFFB, activating DFFB's endonuclease site

(reviewed Widlak and Garrard, 2005).

After removal of DFFA, DFFB forms a homo-oligomer that increases its

endonuclease activity (Liu et al., 1999; Woo et al., 2004), however this large unit can

still be inhibited by binding of either DFFA or DFFA-short (Widlak et al., 2003). Multiple

layers of activation and inhibition suggest that there are multiple fail-safes in non-

apoptotic cells to prevent the accidental activation of DFFB (Widlak and Garrard, 2005).

DFFB cleaves DNA leaving double strand breaks with 5'-phosphate and 3'-

hydroxyl groups exposed (Liu et al., 1999; Widlak and Garrard, 2005). Cleavage occurs









in two stages. The first stage is the cleavage of the chromatin loop domains in 250 kb

intervals (Oberhammer et al., 1993) possibly due to DFFB interacting with other nuclear

proteins such as histone H1 (Liu et al., 1999) and topoisomerase Ila (Durrieu et al.).

The second stage is the preferential cleavage of DNA into internucleosomal fragments

(Wyllie et al., 1980).

The Role of Ceramide as a Signaling Molecule Triggering Apoptosis

The early signaling mechanism for stressed-induced MOMP is not well

understood. One possible pathway is through sphingomyelin signaling which involves

hydrolysis of the phospholipid sphingomyelin (N-acylsphingosine-1-phosphocholine)

into the sphingolipid ceramide. Ceramide is a second messenger in the stress-induced

pathway caused by heat-shock, ultra-violet radiation, and ROS (Basu and Kolesnick,

1998; Chung et al., 2003; Moulin et al., 2007; de Castro e Paula and Hansen, 2008).

Sphingomyelin is a ceramide linked to a phosphocholine with a phosphodiester bond

(Kolesnick, 1991). Hydrolysis is performed by a sphingomyelin-specific phospholipase

C termed sphingomyelin phosphodiesterase (SMPD; previously SMase). There are two

specific forms of SMPD, an acidic form that functions at a pH around 5 (SMPD1) and

neutral form that functions at a pH around 7.4 (SMPD2), both yield ceramide and

phosphocholine (Kolesnick, 1991). Ceramide can have a variety of chain lengths

ranging from a short-chain C(2)-ceramide to a very long-chain C(24)-ceramide. Chain

lengths may affect how ceramide is involved in cellular responses (Kroesen et al., 2003;

Senkal et al., 2007).

There are two potential ways ceramide may interact with mitochondrial signaling,

one of which involves BCL2 family proteins. The first signaling mechanism is through

the stimulation or inactivation of various kinase leading to the phosphorylation or









dephosphorylation of various members of the BCL2 family. Kinase pathways implicated

in ceramide signaling include MAPK9/MAPK8 and kinase suppressor of RAS/ceramide-

activated protein kinase (KSR1/CAPK) (Basu and Kolesnick, 1998; Basu et al., 1998).

For example, the phosphroylation of the BH3-only pro-apoptotic protein BAD by v-akt

murine thymoma viral oncogene homolog 1 (AKT1; previously AKT/PKB) on serine 112

and 136 prevents BAD from heterodimerizing with BCL2 or BCL2L1. Instead BAD is

targeted for binding with members of the tyrosine 3-monooxygenase/tryptophan 5-

monooxygenase activation proteins (YWHAQ; previously 14-3-3) that sequester and

inactivate BAD (Zha et al., 1996). Stimulation of ceramide leads to activation of various

kinase that cause prolonged deactivation of AKT1, resulting in the dephosphorylation of

BAD on serine 112 and 136 allowing BAD to form heterodimers with BCL2 and BCL2L1

(Basu et al., 1998). Heat-shock induced ceramide signaling, has been shown to

stimulate MAPK9/MAPK8, triggering apoptosis in human monoblastic leukemia cells

and bovine aorta endothelial cells (Verheij et al., 1996). The addition of C(2)-ceramide

to cells has also been shown activate MAPK9 in a concentration dependent manner and

induce apoptosis (Verheij et al., 1996).

Besides ceramide's signaling interactions with BCL2 family proteins, ceramide

may also affect mitochondrial biophysics either in cooperation or separately from

involvement of the BCL2 family pathway. Ceramides has been shown modify

membrane curvature in liposomes leading to their fragmentation (Holopainen et al.,

2000) a similar action may occur in the mitochondria (Siskind et al., 2010). Addition of

C(2)-ceramide altered the shape of the mitochondria, this was associated with a

transient increase of DRP1 and fission 1 (FIS1), which are involved with mitochondrial









fission (Parra et al., 2008). In addition to of ceramide affecting mitochondrial membrane

structure, ceramide has been shown to induce MOMP through the formation of

ceramide channels in the absence of pro-apoptotic BCL2 family members BAX and

BAK1 or synergistically in cooperation with them (Ganesan et al., 2010). BCL2 and

BCL2L1 have also been shown to prevent the formation of ceramide channels probably

by the inhibition of ceramide accumulation, and BCL2L1 has been shown to

disassemble ceramide channels with an unknown mechanism (Siskind et al., 2008;

Ganesan and Colombini, 2010).

BCL2 Family Proteins

BCL2 was first identified as a proto-oncogene in human follicular lymphoma

(Tsujimoto et al., 1984; Bakhshi et al., 1985; Cleary and Sklar, 1985). Whereas most

oncogenes promote proliferation, BCL2 promoted cellular survival (Vaux et al., 1988;

NuQez et al., 1990). Since the initial discovery of BCL2, other proteins in the family

have been identified (BCL2L1, BCL2L2, BCL2L3, BCL2L10, BCL2L11, BCL2L12,

BCL2L15, BAX, BAK1, BAD, BID, BMF, BOK, PMAIP1, BBC2). BCL2 family proteins

are evolutionarily conserved, and a BCL2 homolog is encoded by a number of viruses,

including the majority of gamma herpes viruses and African swine fever virus (Hardwick,

1998; Huang et al., 2002).

Structure

BCL2 family proteins exist as a globular structure consisting of 5-7 amphipathic a-

helices surrounding two central hydrophobic helices (Muchmore et al., 1996; Petros et

al., 2001). Similar structures have been characterized in the membrane-translocation

domains of pore-forming bacterial toxins (Parker and Pattus, 1993; Petros et al., 2004).

The C-terminal domain of the some of the BCL2 proteins (e.g. BCL2, BCL2L1, BAX,









BAK1) contain a single membrane spanning region consisting of hydrophobic amino

acids that allows insertion into the membrane of the mitochondria, endoplasmic

reticulum, and the nuclear envelope (Adams and Cory, 1998; O'Connor et al., 1998;

Wang et al., 1998).

BCL2 family proteins also contain up to 4 BCL2 homology (BH) domains. These

domains are important for protein-protein interactions, signal transduction, and

regulation of cytosolic solubility (Figure 1-3). Anti-apoptotic family members (e.g. BCL2,

BCL2L1, BCL2L2, and MCL1) contain all 4 BH domains (Yin et al., 1994; Chittenden et

al., 1995; Hunter et al., 1996; Huang et al., 1998). It is the BH4 domain that allows the

anti-apoptotic proteins to heterodimerize with other members of the BCL2 family.

Multi-domain pro-apoptotic family members contain either 3 BH domains (BH 1, 2,

3), e.g. BAX, BAK1, BCL2L1-short, and BCL2-related ovarian killer (BOK) (Yin et al.,

1994; Chittenden et al., 1995). The BH3-only pro-apoptotic family members contain

only 1 BH domain (BH3) (e.g. BID, BAD, BCL2L11, BIK, BMF, BLK, BCL-GS, PMAIP1,

and BBC2) (Wang et al., 1996; Kelekar et al., 1997; Adams and Cory, 1998; Hsu et al.,

1998; O'Connor et al., 1998; Oda, 2000; Wu and Deng, 2002).

The BH1, BH2, and BH3 domains form hydrophobic pockets which allow proteins

existing in the cytoplasm, for example BAX and BCL2L1, to be soluble (Muchmore et

al., 1996). The hydrophobic C-terminal transmembrane domain region inserts into the

hydrophobic pocket created by the BH1 and BH2 domains (Nechushtan et al., 1999;

Suzuki et al., 2000; Petros et al., 2004). Interactions of BH3-only proteins with multi-

domain proteins are a result of the BH3 domain of the BH3-only protein acting as a









"donor," and the multi-domain protein's hydrophobic pocket (BH 1, 2, 3) acting as an

"acceptor" (Eskes et al., 2000; Wei et al., 2000; Letai et al., 2002; Cartron et al., 2004).

Membrane Permeabilization and Pore Formation

The outer mitochondrial membrane is permeabilized by active BAX or BAK1. The

N-terminus of BAX contains a localization sequence, termed apoptosis regulating and

targeting sequence (ART), which allows the specific targeting of BAX to the MOM

(Goping et al., 1998). The C-terminal contains the transmembrane domain which is

inserted into the MOM (Eskes et al., 2000; Marani et al., 2002; Lucken-Ardjomande and

Martinou, 2005; Youle and Strasser, 2008). Activation occurs with binding of certain

BH3-only proteins (e.g. BID and BCL2L11) in response to apoptotic stimuli that in turn

leads to several structural changes. The hydrophobic C-terminal is removed from the

hydrophobic pocket, and the N-terminus undergoes a conformational change. Also,

some BH3-only proteins recruit BAX to the MOM. For example, tBID is rapidly targeted

to the MOM following an apoptotic signal (Lovell et al., 2008) even though it lacks a

transmembrane domain (Wang et al., 1996). Once associated with the membrane, tBID

recruits BAX, inducing a conformational change allowing hairpin formed by the a5-a6

helices of BAX to be inserted into the outer-membrane (Veresov and Davidovskii,

2009). Thereafter, BAX forms oligomers via interactions of BH3-hydrophobic pockets to

form pores that allow components of the mitochondrial inter-membrane space proteins

such as DIABLO, cytochrome c, AIF1, and endonuclease G to be released and trigger

apoptosis (Antonsson et al., 2000; Eskes et al., 2000; Wei et al., 2000). This process

can be prevented by the addition of BCL2L1, which can bind tBID and to a lesser extent

with BAX (Billen et al., 2008). The BH3 protein, BAD, in turn, can neutralize BCL2L1 to

allow BAX activation and pore formation (Lovell et al., 2008).









In contrast to BAX, BAK1 is constitutively inserted into the MOM where, in the

absence of apoptotic signals, it is inhibited by binding with VDAC2, MCL1, and BCL2L1

(Cheng et al., 2003; Willis et al., 2005; Li et al., 2008). Like BAX, BAK1 activation is

dependent on BH3-only proteins such as tBID, where binding causes a conformational

change that exposes the BH3 domain of BAK1 allowing it to associate with the

hydrophobic pocket of another BAK1 protein and form oligomers (Wei et al., 2000;

Dewson et al., 2008). BAX and BAK1 are amphipathic proteins that contain several a-

helices that can bind to the water-lipid interface of the mitochondrial lipid bi-layer. BAX

and BAK1 form multimer units in the mitochondrial membrane resulting in stretching the

hydrocarbon core of the bi-layer in a concentration-dependent manner that leads

eventually to the formation of a stable pore that is made up of both proteins and lipids

(Lee et al., 2008; Qian et al., 2008).

Protein Interactions and Signal Transduction

Many death stimuli are propagated by BH3-only proteins by signal transduction to

the multi-domain BCL2 family members. Two different models for signal transduction

have been proposed. The "direct activation" model suggests that certain BH3-only

proteins (e.g. BID, BCL211, and BBC3) bind directly to the hydrophobic pocket of BAX

or BAK1 activating them. The truncated form of BID, tBID, helps recruit BAX to the

MOM (Lovell et al., 2008) and participates in the oligomerization and pore-formation

with BAX (Eskes et al., 2000; Tan et al., 2001; Marani et al., 2002; Cartron et al., 2004).

BAK1, on the other hand, resides in complexes in the mitochondrial outer-membrane

and endoplasmic reticulum (Wei et al., 2000). Binding of BH3-only proteins causes a

conformational change that allows for BAK1 oligomerization (Wei et al., 2000; Cheng et

al., 2003; Willis et al., 2005; Dewson et al., 2008).









In addition to activation of pro-apoptotic BCL2 family members (BAX and BAK1)

by "activator" BH-3only protein, the "direct activation" model also proposes a second

group of BH3-only proteins that function in an "inhibitory" capacity. These "inhibitory"

BH3-only proteins (BAD and BIK) bind the anti-apoptotic proteins (BCL2 and BCL2L1)

preventing them from binding to the "activator" BH3-only proteins (tBID, BCL2L11, and

BBC3). As a result, the "activator" BH3-only proteins are available to bind and activate

BAX and BAK1 (Letai et al., 2002).

As is apparent from the previous paragraph, the role of the anti-apoptotic family

members in the "direct activation" model of apoptosis is to bind and neutralize the pro-

apoptotic "activator" BH3-only proteins preventing their action on BAX/BAK1. In the

second model, termed "indirect activation," the BH3-only proteins activate BAX/BAK1 by

removing the direct inhibition of the anti-apoptotic proteins on BAX and BAK1 (Adams

and Cory, 1998). In this model, BAX and BAK1 are constitutively bound to BCL2 and

BCL2L1, thereby they are prevented from acting on the MOM. Upon signal

transduction, the BH3-only proteins bind to BCL2 and BCL2L1 via the the BH3 domain

interacting with the hydrophobic pocket of BCL2 and BCL2L1 freeing BAX and BAK1

(Kelekar et al., 1997; Sattler et al., 1997). Free BAX and BAK1 then can form multimers

within the MOM causing MOMP without the need for further activation.

Current evidence suggests that signal transduction involves a combination of

events described in both models. The activation of BAX and BAK1 by "activator" BH3-

only proteins has been demonstrated often (Wang et al., 1996; Desagher et al., 1999;

Eskes et al., 2000; Wei et al., 2000; Letai et al., 2002; Cheng et al., 2003; Cartron et al.,

2004; Lovell et al., 2008; Kim et al., 2009). There is also evidence showing inhibitory









function of anti-apoptotic proteins directly on the BAX and BAK1. Interestingly, BCL2,

which is expressed only in the mitochondrial outer-membrane, binds to and inhibits BAX

localized in the cytosol (Zha and Reed, 1997; Wang et al., 1998). BCL2L1, which is

membrane bound and cytosolic, also binds and inhibits BAX (Billen et al., 2008).

Finally, BCL2L1/MCL1, but not BCL2/BCL2L2, sequester and inhibit BAK1 until BH3-

only activation (Willis et al., 2005).

Regulation of BCL2 Family Members

Tight regulatory controls of BCL2 family proteins are necessary in order to

preserve the balance of life and death. Like the apoptotic cascade itself, there are

multiple layers of regulation. The first layer is at the level of gene expression. While

some of the BCL2 family proteins are expressed ubiquitously, certain members,

especially the pro-apoptotic BH3-only members, are transcriptionally upregulated upon

an apoptotic stimulus. One example is the p53-dependent upregulation of the BH3-only

pro-apoptotic proteins phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1;

previously NOXA) and BCL2 binding component 3 (BBC3; previously PUMA) upon DNA

damage (Oda, 2000; Nakano and Vousden, 2001). Another example is the

upregulation of expression of the BH3-only pro-apoptotic gene BCL2L11-EL by serum

or growth factor starvation (Chalmers et al., 2003; Biswas et al., 2007). Interestingly,

upregulation of BCL2L11-EL expression could be blocked by addition of the serine

proteinase thrombin (Chalmers et al., 2003).

Survival factors, like apoptotic signals, can also effect gene expression of BCL2

family members. For example, insulin-like growth factor-1 (IGF1) causes reduced

expression of the pro-apoptotic gene BCL2L11 (De Bruyne et al., 2010), while the









addition of granulocyte-macrophage stimulating factor (CSF2) leads to increased

expression of the anti-apoptotic gene MCL1 (Chao et al., 1998).

Besides inducible changes in gene expression by various factors, there is also

temporal and cell/tissue specific variation in gene expression of BCL2 family members.

An example is the reciprocal expression of BCL2 and BCL2L1 in various lymphocyte

populations (Chao and Korsmeyer, 1998). BCL2 is highly expressed in pro-B-cells and

mature B-cells, but there is low expression in pre-B-cells. In contrast, BCL2L1 has low

expression in pro-B-cells and high expression in pre-B-cells (Chao and Korsmeyer,

1998). Finally, BOK, BCL2L1O and BCL2L11 are only expressed in the reproductive

tissues (Hsu et al., 1997; Song et al., 1999).

Alternative splicing is another form of regulation for BCL2 family members.

Leading to multiple isoforms in the majority of the BCL2 family members. Some

variants have no apparent effect on the resulting protein such as the anti-apoptotic

protein BCL2L1 (Ko et al., 2003), or the pro-apoptotic protein BAD (Hamner et al., 2001;

Seo et al., 2004). For other splice variants, certain isoforms have greater potency.

BCL2 has a long and short isoform (BCL2-L and BCL2-S) of which the long form is

more potent (Hockenbery et al., 1993). The pro-apoptotic protein BCL2L11 has three

isoforms, BCL2L11 -S, BCL2L11-L and BCL2L11 -EL. The shortest of these, BCL2L11-

S, is the most potent (O'Connor et al., 1998).

Alternative splicing can also affects the functional properties of the protein. BAX

has two isoforms, BAXa and BAX3, which share BH1-3 domains but differ in their C-

terminal. BAX3's unique C-terminal targets it for immediate proteasomal degradation.

With apoptotic stimuli, BAX3, is upregulated by inhibition of its ubiquitination. Moreover,









changes in the C-terminal make BAX3 constitutively-active so that it can be inserted into

the MOM without need for further activation (Fu et al., 2009). Splice variants can even

result in ordinarily anti-apoptotic proteins acting as pro-apoptotic proteins as is seen

with BCL2L1 (Boise et al., 1993) and MCL1 (Bingle et al., 2000). Similarly, some

isoforms of the pro-apoptotic BID can act as an anti-apoptotic protein (Renshaw et al.,

2004).

Some splice variants only occur in specific cell types or tissues. BCL2L14 is a

pro-apoptotic protein that has two isoforms, BCL2L14-L and BCL2L14-S. BCL2L14-L is

widely expressed while BCL2L14-S is only expressed in the testis (Guo et al., 2001).

Another example is the fourth isoform of BCL2L11 called BCL2L11 -y which is mostly

expressed in the small intestine and colon (Liu et al., 2002). The final and perhaps

most complex example is a splice variant of BAK1 called N-BAK1, which has cell-

specific expression and function. BAK1 is expressed ubiquitously except in central and

peripheral neurons, which is the only location where N-BAK1 is expressed. N-BAK1

includes a novel 20-base pair exon that changes BAK1 from a pro-apoptotic multi-

domain (BH 1, 2, 3) protein to a BH3-only protein. As a BH3-only protein, N-BAK1

functions in neurons as an anti-apoptotic protein, but if N-BAK1 is experimentally

expressed in a non-neuronal cell type it functions as a pro-apoptotic BH3-only protein

(Sun et al., 2001).

The final layer of regulation of BCL2 family members involves post-translational

modifications. Post-translational modifications activate BCL2 by phosphorylating the

serine residual Ser70 (Haldar et al., 1997; Ito et al., 1997; Maundrell et al., 1997). In

addition to activation events, post-translation modifications can also lead to the









inactivation of anti-apoptotic proteins. BCL2 and BCL2L1 inhibit pro-apoptotic proteins

by inserting their BH4 domain into the pro-apoptotic proteins' hydrophobic pocket

created by the BH2 and BH3 domains. In response to apoptotic stimuli BCL2 and

BCL2L1 are phosphorylated on serine residuals in the loop region between their BH4

and BH3 domains (Figure 1-3) (Fang et al., 1998; Poruchynsky et al., 1998) possibly by

activated MAPK8 (Chang et al., 1997). This phosphorylation event prevents the binding

of BCL2 and BCL2L1 to their pro-apoptotic targets (Yamamoto et al., 1999). Other

post-translational modifications convert BCL2 and BCL2L1 from anti-apoptotic to pro-

apoptotic proteins. Caspase-3 can cleave BCL2 and BCL2L1 in the loop region

resulting in the production of C-terminal truncations (tBCL2 and tBCL2L1) that are

missing their BH4 domain changing the function protein to pro-apoptotic (Chang et al.,

1997).

Post-translation regulation is also used on pro-apoptotic proteins to maintain them

in an inactive state until apoptotic stimuli. MAPK8 and phosphatidylinositol 3-kinase can

phosphorylate BAX at Ser184, leading to its insertion into the mitochondrial membrane

(Kolliputi and Waxman, 2009). BAK1 is also regulated by mitogen-activated protein

kinase kinase kinase 1 (MAP3K1; previously MEKK1) and MAPK8 (Ihrlund et al., 2006).

MAP3K1 is involved in the conformational change caused by binding to proteins like

tBID and may also prevent deconvolution of BAK1 by cross linking several residues.

After unfolding and activating BAK1, it has been proposed that MAPK8 induces the

formation of BAK1 complexes of 80-170 kDa (Ihrlund et al., 2006).

The pro-apoptotic BH3-only proteins are another group of BCL2 family members

regulated by post-translational modifications. This group of proteins uses









phosphorylation, dephosphorylation, and cleavage events for regulation, resulting in

changes in cellular localization and binding potential. BAD is phosphorylated at Ser112

by cAMP-dependent kinase (Zha et al., 1996; Harada et al., 1999) and Serl36 by AKT1

(Datta et al., 1997). The phosphorylation of these two serine causes BAD to be

sequestered in the cytosol by YWHAQ proteins, preventing its interaction with anti-

apoptotic proteins (Zha et al., 1996; Datta et al., 1997). Dephosphorylation occurs in

response to an apoptotic stimulus leading to its release from YWHAQ and allowing BAD

to contribute to cell death (Zha et al., 1996).

BID is activated by caspase-8 dependent cleavage (Li et al., 1998). This cleavage

event occurs in different parts of the loop region leading to the formation of a truncated

form of BID (tBID) (Li et al., 1998). This truncation event leads to the exposure of a

hydrophobic pocket that was blocked by the al and a2 helices allowing tBID to

translocate to the MOM (Lovell et al., 2008).

Apoptosis in the Preimplantation Embryo

Occurrence of Apoptosis in the Oocyte and the Preimplantation Embryo

Spontaneous apoptosis is used throughout life as a means to deplete ovarian

pools of oocytes (Morita and Tilly, 1999; Perez et al., 1999; Tilly, 2001), signal cell death

in ovulated and cultured oocytes (van Blerkom and Davis, 1998; Perez et al., 1999), and

as a mechanism responsible for stress-induced infertility. For example, dairy cattle

show a decrease in fertility rates during summer as a result of heat-stress (Badinga et

al., 1985; Cavestany et al., 1985; al-Katanani et al., 1999) that may be a due to heat-

shock induced apoptosis in the oocyte (Roth and Hansen, 2004). In addition to the

oocyte, spontaneous apoptosis has also been well documented in preimplantation

embryo for variety of species including; mouse, rabbit (Fabian et al., 2007), human









(Hardy et al., 1993; Jurisicova et al., 1996), bovine (Byrne et al., 1999; Matwee et al.,

2000), and porcine (Long et al., 1998). Several comparative studies also shown that

there was higher incidence of apoptosis for embryos produced in vitro as compared

embryos produced in vivo (Long et al., 1998; Gjorret et al., 2003). It is because of the

importance of apoptosis for determining developmental potential of the oocyte and

embryo that it is important to understand mechanisms involved in activation of apoptosis

in the oocyte and early cleavage embryo.

To understand apoptosis in the preimplantation embryo, a variety of studies have

used various stimuli to induce an apoptotic response: pro-oxidants (Yang et al., 1998;

Feugang et al., 2003; Feugang, 2004; Moss et al., 2009), ultraviolet radiation (Herrler et

al., 1998), heat-shock (Paula-Lopes and Hansen, 2002a), ceramide (de Castro e Paula

and Hansen, 2008), arsenic (Krininger et al., 2002), and TNF (Soto et al., 2003;

Loureiro et al., 2007). In these experiments, the hallmark of apoptosis has been DNA

fragmentation measured by terminal deoxynucleotidyl transferase deoxyuridine

triphosphate nick end labeling (TUNEL) (Gavrieli et al., 1992).

Stress induced apoptosis is mediated through a caspase-dependent pathway in

oocytes and preimplantation embryos. Stress leads to activation of the caspase

cascade beginning with the initiator caspase, caspase-9 (Brad et al., 2007; Loureiro et

al., 2007; de Castro e Paula and Hansen, 2008) which leads to the induction of group II

caspases, including caspase-2, -3, -7 which are responsible for the activation of DFFB

leading to DNA fragmentation and TUNEL (Krininger et al., 2002; Paula-Lopes and

Hansen, 2002; Paula-Lopes and Hansen, 2002; Roth and Hansen, 2004; Brad et al.,

2007). One of the best studied stress stimuli in preimplantation embryos is heat-shock.









Not only does heat-shock induce caspase-9 activity (Brad et al., 2007; Loureiro et al.,

2007) and group II caspase activity (Paula-Lopes and Hansen, 2002; Paula-Lopes and

Hansen, 2002), but inhibition of caspases with z-LEHD-fmk, a specific inhibitor of

caspase-9, or z-DEVD-fmk, a specific inhibitor of group II caspases, blocks heat-shock

induced TUNEL in the oocyte and preimplantation embryo (Paula-Lopes and Hansen,

2002; Roth and Hansen, 2004; Loureiro et al., 2007)

Apoptosis as a Protective Mechanism

One of the most interesting features of heat-shock induced apoptosis, in the

preimplantation embryo, is the protective role that apoptosis plays. When a

preimplantation embryo is exposed to a stress signal, upregulation of apoptosis can

help the embryo survive. This has been shown experimentally in several studies.

Paula-Lopes and Hansen (2002a) pre-treated bovine embryos that were 216-cells on

day 4 of culture with 200 pM z-DEVD-fmk or vehicle for 15 h at 38.5C. After pre-

treatment embryos were exposed to heat-shock for 9 h at 41 C and then cultured

continuously at 38.5C until day 8 when blastocyst rate was measured. Addition of z-

DEVD-fmk blocked the induction of group II caspases and DNA fragmentation caused

by heat-shock. Control embryos, which were continuously cultured at 38.5C in either

vehicle or z-DEVD-fmk, had 20% blastocyst development. Embryos that were exposed

to heat-shock for 9 h had a significant decrease blastocyst development to 10%. Pre-

treatment of heat-shock embryos with z-DEVD-fmk significantly lowered percent

blastocyst development to 3%. Showing that while heat-shock has a negative effect on

development, if apoptosis is also inhibited by a caspase inhibitor development is further

reduced. In another study, embryos collected at Day 5 of development, and treated

with z-DEVD-fmk did not modify embryo survival after heat-shock (Jousan and Hansen,









2007). However, when embryos were also treated with IGF1, which also reduced

apoptosis, effects of heat-shock were greater when embryos were also treated with z-

DEVD-fmk.

Developmental Regulation of Apoptosis in Preimplantation Embryos

Experiments evaluating effects of stress on the bovine preimplantation embryo can

be interpreted as indicating that there is a developmental acquisition of resistance to

cellular stresses as the embryo advances in development. For example, embryos

become more resistant to the effects of heat-shock as they develop, with the 2-cell

embryo being most susceptible (Edwards and Hansen, 1997; Krininger et al., 2002;

Sakatani et al., 2004). In fact, the oocyte, is more resistant to effects of heat-shock on

development than the 2-cell embryo (Edwards and Hansen, 1997). One mechanism

that could explain this developmental acquisition of resistance is apoptosis.

Apoptosis occurs in the oocyte where it is involved in cell death in ovulated and

cultured oocytes (van Blerkom and Davis, 1998; Morita et al., 1999; Perez et al., 1999;

Tilly, 2001). For example, Roth and Hansen (2004) matured bovine oocytes at 38.50C,

40C, and 41 C. Maturation under heat-shock conditions reduced the number of

oocytes that cleaved and the percentage that became blastocysts. Moreover, treatment

of oocytes with heat-shock increased group II caspase activity along with TUNEL.

Blocking apoptosis with z-DEVD-fmk blocked the effect of heat-shock on oocyte

competence for development (Roth and Hansen, 2004).

During or after fertilization, apoptosis becomes blocked. Apparently spontaneous

apoptosis is first observed at different time points in early preimplantation development:

the late 1-cell in mouse (Jurisicova et al., 1998), 2-cell to uncompacted morulae in

human (Jurisicova et al., 1996), 16-cell in rabbit (Fabian et al., 2007), and 8-16 cells in









porcine and bovine (Long et al., 1998; Byrne et al., 1999; Matwee et al., 2000).

Developmental acquisition of apoptosis has also been shown in response to apoptotic

stimuli. Paula-Lopes and Hansen (2002b) treated 2-cell and 216-cell embryos with

heat-shock at 41 C for 9 h. In both heat-shock and control 2-cell embryos there was no

TUNEL, while in 216-cell embryo there was a significant increase in heat-shock induced

TUNEL. Both control and heat-shocked 2-cell embryos had very low amounts of group

II caspase activity, where 216-cell embryos had higher amounts of groups II caspase

activity in control embryos, compared to the 2-cell, and there was significant heat-shock

induced increase of group II caspase activity.

Due to the temporal coincidence of early signs of apoptosis and embryonic

genome activation (EGA), it has been hypothesized that apoptotic regulation in the

preimplantation embryo is dependent on EGA (Jurisicova et al., 1998; Byrne et al.,

1999). Early cleavage embryos are in a transcriptionally quiescent state where the

majority of the proteins produced during this period are translated from maternal stores

of mRNA in the oocyte (van Blerkom, 1981). There is a transition over time from

maternal stores to new transcripts produced by the embryo (Flach et al., 1982), with

minor amounts of transcription occurring followed by a major wave transcription that

occurs again in a species specific manner; late 1-cell to early 2-cell in the mouse (Aoki

et al., 1997; Aoki et al., 2003), 4- to 8-cell stage in human, porcine, equine, and feline:

(Braude et al., 1988; Tomanek et al., 1989; Brinsko et al., 1995; Hoffert et al., 1997) and

8-16 cell stage in rabbit, ovine, and bovine (Crosby et al., 1988; Kopecny et al., 1989;

Memili et al., 1998).









Possible Causes for Developmental Regulation

A series of studies have looked at various aspects of the apoptotic cascade and its

developmental regulation to try to elucidate why there is a need for EGA and

transcription. As previously discussed, heat-shock induced apoptosis begins with the

conversion of sphingomyelin into ceramide (Chung et al., 2003). To investigate if the

developmental regulation of apoptosis was due to a failure to initiate this signaling

cascade, de Castro e Paula and Hansen (2008) compared 2-cell and 216-cell embryos

treated with 50 pM ceramide. Embryos treated at 216-cells with ceramide had an

increase in caspase-9 activity, a decrease in number of nuclei, an increase in TUNEL,

and a decrease in further development. Treatment of 2-cell embryos with ceramide also

decreased developmental competence, but ceramide did not increase caspase-9

activity or TUNEL. Thus, there is a block to apoptosis in the 2-cell embryos at one or

more regulatory events downstream of ceramide signaling.

Another approach to studying developmental regulation of apoptosis has been to

treat embryos with staurosporine. This protein kinase inhibitor can activate apoptosis

through a caspase-dependent or caspase-independent pathway (Belmokhtar et al.,

2001; Nicolier et al., 2009). Caspase-dependent effects of staurosporine cause DNA

cleavage in less than 3 h, where the addition of a caspase inhibitor or use of a cell line

with defective caspases delays DNA cleavage until after 12 h of treatment (Belmokhtar

et al., 2001). Caspase-dependent effects of staurosporine involve regulation of the

BCL2 family of proteins such as the activation of BAD by inhibition of its

hyperphosphorylation (Zha et al., 1996) and through the cleavage of BAD-L to BAD-S

by caspase (Seo et al., 2004). The caspase-independent effects of staurosporine

involve either AIF1 (Nicolier et al., 2009) or endonuclease G (Zhang et al., 2003).









Matwee et al. (2000) treated bovine embryos ranging from 1- to 16-cells with 10

pM staurosporine for 30 hours. Treated embryos did not cleave during the 30 h of

culture and 56 of 59 embryos (95%) displayed TUNEL. The authors concluded that cell

death could be induced with staurosporine in the preimplantation embryo, but there may

be specific upstream mechanisms necessary for the induction of apoptosis by other

common environmental stressors. Matwee et al. (2000) observed no cell cycle events

during staurosporine treatment of 30 h. The lack of cell cycle is unusual for this stage of

development, suggesting an interaction of staurosporine with cell cycle events may also

have an effect on DNA fragmentation.

In a second study, Gjorret et al. (2007) treated various stages of bovine

preimplantation embryos with 10 pM staurosporine for 24 h. There was no induction of

TUNEL in 2-cell embryos and only small amounts of TUNEL in 4- and 8-cell embryos.

However, most morulae and blastocyst had several blastomeres with TUNEL. Similarly,

there was no activated caspase-3 in 2-cell embryos, only small amounts of activated

caspase-3 in 4- and 8-cell embryos. Again like TUNEL, the majority of morulae and

blastocysts had several blastomeres with activated caspase-3. Taken together these

data suggest that the 2-cell embryo may have the capacity for staurosporine induced

DNA fragmentation, however due to the extended period of treatment (24-30 h) and the

lack of a caspase inhibition study it is unclear if DNA fragmentation is through a

caspase-dependent mechanism.

Another model to study developmental regulation of apoptosis has been to

evaluate effects of the chemical depolarization of the mitochondria using carbonyl

cyanide 3-chlorophenylhydrazone (CCCP). CCCP bypasses the control of the BCL2









family of proteins to chemically depolarize the mitochondrial membrane and sets into

motion the caspase cascade. Brad et al. (2007) found that CCCP led to the activation

of caspase-9 and group II caspases in both the 2-cell and 216-cell embryos. Thus, an

intact system leading to activation of executioner caspase is present in the 2-cell

embryo. However, CCCP did not induce TUNEL in 2-cell embryos, although it did in

216-cell embryos, suggesting that there is block at the level of the nucleus preventing

caspase-dependent DNA fragmentation.

One possible explanation for the lack of DNA fragmentation could be the structure

of the DNA in the early preimplantation embryo. Prior to the EGA, the DNA is highly

methylated (Jung Sun Park et al., 2007). As the embryo approaches EGA, the DNA

becomes demethylated with each cell cycle (Dean et al., 2001). Carambula et al.

(2009) found that treatment of 2-cell embryos with 100 pM of 5-aza-2'-deoxycytidine

(AZA) to reduce DNA methylation or 100nM trichostatin-A (TSA) to inhibit histone

deacetylation allowed a CCCP dependent increase of TUNEL positive nuclei in 2-cell

embryos. These data suggest that that apoptosis is blocked by the inaccessibility of

DNA to DFFB due to extensive chromatin structure caused by DNA methylation and

histone acetylation.

Thesis

In addition to the nuclear block, Brad et al. (2007) identified a second

developmental block of apoptosis in the bovine preimplantation embryo; at the level of

the mitochondria. Bypassing the upstream intrinsic signaling mechanism, CCCP

induces mitochondrial depolarization and caspase activation (Brad et al., 2007).

However, induction of the upstream signaling mechanism, specifically the BCL2 family

of proteins, with either heat-shock or ceramide fails to induce mitochondrial









depolarization and caspase activation in 2-cell embryo (Paula-Lopes and Hansen, 2002;

de Castro e Paula and Hansen, 2008). Indicating that anti- and pro-apoptotic proteins

involved in this upstream signaling mechanism may be developmentally regulated.

To further investigate the developmental acquisition of apoptosis in the bovine

embryo, we hypothesize that the block at the level of the mitochondria involves an

upregulation of anti-apoptotic genes (BCL2, BCL2L1, HSPA1A, DFFA) and a down

regulation of pro-apoptotic genes (BAX, BAD, DFFB) in the 2-cell bovine

preimplantation embryo.

Objective 1 measure steady state mRNA using quantitative real-time RT-PCR to

identify transcriptional regulation in the ooctye, 2-cell embryo, 2-cell embryo treated with

a transcription inhibitor a-amanitin, and embryos that have undergone genome

activation (216-cell).

Objective 2 determine the presence and quantify immunoreactive concentrations

of anti-apoptotic proteins (BCL2, BCL2L1, HSPA1A) and pro-apoptotic proteins (BAX,

BAD) using immunocytochemistry to identify protein expression differences between 2-

cell and 216-cell bovine embryos.

Objective 3 verify significant differences found by immunocytochemical results by

Western blotting.










TNF Extrinsic Apoptotic Pathway
I I I


-caspase-8


DISC Compi


TNFRSF1A


ADD


Caspa

U.1


-/


ex

7


SIntrinsic Pathway
Activation
.. .-


se-8




Pro-caspase-3


Caspas


Pro-caspase-7



Caspase-7




e-3


4 -- DFFA:DFFB
44^-1


DFFB


Figure 1-1.


Schematic of the extrinsic or receptor-mediated apoptotic pathway. Dashed
lines represent a cleavage event changing a protein from an inactive to
active form. Solid lines represent the protein acting upon another molecule.
Adapted from MacFarlane (2003).


Pro










Intrinsic Apoptotic Pathway


Stress


Apop

/
,s:


SProcaspae-
ProcasPpase-9
r Procaspase-3
twosome \
Caspase-3


DFFA:DFFB

DFFB

4'


Figure 1-2.


Schematic of the intrinsic or mitochondrial apoptotic pathway. Dashed lines
represent a cleavage event changing a protein from an inactive to active
form. Solid lines represent the protein acting upon another molecule.


S.
*S


dATP
dADP


J


APAF1










Anti-Apoptotic


al
BCL2L1 RM


a2 a3 a4 a5 a6 a7a8
091B. 21


Interacting Domains


Figure 1-3.


Schematic drawing of the BCL2 family proteins. There are two major forms
of BCL2 family proteins, anti-apoptotic and pro-apoptotic. BCL2L1 (green)
represents the anti-apoptotic proteins including BCL2, BCL2L2, and MCL1.
The pro-apoptotic BCL2 family members (red) are further separated into
those that contain multiple BH domains (multi-domain) and those that
contain only the BH3 domain (BH3-only). BAX represents the multi-domain
pro-apoptotic proteins including BAK1 and BOK. BID represents BH3-only
proteins including BAD and BCL2L11. Adapted from Yin et al. (2003).


Loop


Transmembrane
Domain









CHAPTER 2
DEVELOPMENTAL ACQUISITION OF APOPTOSIS IN THE BOVINE
PREIMPLANTATION EMBRYO

Introduction

Exposure of preimplantation embryos to a variety of cellular stresses can induce

apoptosis in all or a fraction of blastomeres. Among the conditions that induce

apoptosis in the bovine embryo are heat-shock (Paula-Lopes and Hansen, 2002; Paula-

Lopes and Hansen, 2002), arsenic (Krininger et al., 2002), pro-oxidants (Feugang et al.,

2003; Feugang, 2004; Moss et al., 2009), and tumor necrosis factor-a (TNF) (Soto et

al., 2003; Loureiro et al., 2007). The consequences of apoptosis on the developmental

competence of the embryo are dependent on the extent of its induction. Induction of

apoptosis in up to 30% of blastomeres, as for example occurs after TNF administration

(Soto et al., 2003a), has no effect on development to the blastocyst stage. In fact,

apoptosis may allow the embryo to survive stress by removal of damaged cells.

Inhibition of apoptosis by the addition of the group II caspase inhibitor z-DEVD-fmk

exacerbated the deleterious effect of heat-shock on development to the blastocyst stage

(Paula-Lopes and Hansen, 2002; Jousan and Hansen, 2007). Extensive apoptosis, as

it occurs after inhibition of survivin synthesis through RNA interference (SY Park et al.,

2007), leads to a block in development.

Induction of apoptosis is developmentally regulated. In cultured bovine embryos,

TUNEL-positive cells are first seen between the six- and eight-cell stage (Matwee et al.,

2000; Gjorret et al., 2003). Similarly, acquisition of an apoptotic response to heat-shock

(Paula-Lopes and Hansen, 2002b) and TNF (Soto et al., 2003a) also occurs after the

eight-cell stage. Heat shock induces apoptosis through the mitochondrial or intrinsic

pathway by activation of caspase-9 and group II caspases such as caspase-3 (Krininger









et al., 2002; Paula-Lopes and Hansen, 2002; Paula-Lopes and Hansen, 2002; Brad et

al., 2007; Loureiro et al., 2007). The induction of apoptosis by heat-shock, as shown by

TUNEL, can be blocked by the addition of caspase-9 or group II caspase inhibitors

(Paula-Lopes and Hansen, 2002; Loureiro et al., 2007). Interestingly, TNF also acts in

the bovine preimplantation embryo through a caspase-9 dependent pathway (Loureiro

et al., 2007). The inhibition of apoptosis in early-cleavage stage embryos involves at

least two blocks in the intrinsic pathway. The mitochondria itself is resistant to

depolarization since neither heat-shock (Paula-Lopes and Hansen, 2002; Brad et al.,

2007) nor ceramide (a putative signaling molecule for activation of the intrinsic pathway)

(de Castro e Paula and Hansen, 2008) induce caspase-9 or group II caspase activation

in the 2-cell embryo. In addition, the nucleus is resistant to caspase-mediated TUNEL.

Artificial activation of the intrinsic pathway by carbonyl cyanide 3-chlorphenylhydrazone

(CCCP), a chemical inducer of mitochondrial depolarization, activated caspase-9 and

group II caspases in 2-cell embryos but did not result in DNA fragmentation (Brad et al.,

2007). Resistance to caspase-activated DNases is caused, at least in part, by

epigenetic modifications that can be reversed by interfering with DNA methylation or

histone deacetylation (Carambula et al., 2009).

The objective of the present study was to determine the molecular basis for the

developmental changes in mitochondrial and nuclear responses to pro-apoptotic

signals. We hypothesized that the 2-cell embryo contains more anti-apoptotic proteins

and less pro-apoptotic proteins as compared to the 216-cell embryo. The focus was on

several members of the BCL2 family of proteins regulating mitochondrial permeability in

response to pro-apoptotic signals (Youle and Strasser, 2008), heat shock protein 70









(HSPA1A), which can inhibit mitochondrial depolarization by interrupting the BCL2

family signaling cascade (Stankiewicz et al., 2005), inhibit caspase activation, and

caspase-3 activity (Garrido et al., 2001), and DFFA (also called inhibitor of caspase-

activated DNase), which is cleaved during apoptosis to activate caspase-activated

DNase (DFFB) (Liu et al., 1997).

Materials and Methods

Materials

Media for in vitro production of embryos were obtained as follows. HEPES-

Tyrodes Lactate (TL) and IVF-TL were purchased from Millipore (Billerica, MA, USA) or

Caisson Laboratories, Inc. (North Logan, UT, USA) and used to prepare HEPES-

Tyrodes albumin lactate pyruvate (TALP) and IVF-TALP as described by Parrish et al.

(1986). Oocyte collection medium was Tissue Culture Medium 199 (TCM-199) with

Hank's salts without phenol red (Atlanta Biologicals, Lawrenceville, GA, USA)

supplemented with 2% (v/v) bovine steer serum (Pel-Freez Biologicals, Rogers, AR,

USA) containing 2 U/mL heparin, 100 U/mL penicillin-G, 0.1 mg/mL streptomycin, and 1

mM glutamine. Oocyte maturation medium was TCM-199 (Gibco, Invitrogen,

Carlsbad, CA, USA) with Earle's salts supplemented with 10% (v/v) bovine steer serum,

2 pg/mL estradiol 17-3, 20 pg/mL bovine FSH (Folltropin-V; Agtech Inc., Manhattan, KS,

USA), 22 pg/mL sodium pyruvate, 50 pg/mL gentamicin sulfate (Sigma-Aldrich, St.

Louis, MO, USA), and 1 mM L-glutamine or alanyl-glutamine. Percoll was from GE

Healthcare (Uppsala, Sweden). Frozen semen from various bulls was donated by

Southeastern Semen Services (Wellborn, FL, USA). Potassium simplex optimized

medium (KSOM), containing 1 mg/mL bovine serum albumin, was obtained from

Millipore or Caisson Laboratories Inc. KSOM was modified with 3 mg/mL essentially









fatty-acid free BSA (Sigma-Aldrich), 2.5 mg/mL gentamicin, 100 U/mL penicillin-G, and

1x nonessential amino acids (Sigma-Aldrich), to produce KSOM-Bovine Embryo 2

(BE2) as described elsewhere (Soto et al., 2003b).

Medium for culture of BEND cells was prepared using powdered Eagle's Minimum

Essential Medium and Ham's F12 from Sigma-Aldrich. Fetal bovine serum and heat-

inactivated horse serum were from Atlanta Biologicals. Penicillin-streptomycin was

purchased from Millipore, human recombinant insulin was purchased from Invitrogen,

and D-valine and sodium bicarbonate were from Sigma-Aldrich. BEND cell culture

medium, as previously described (Staggs et al., 1998), was 4.81 g/L powdered Eagle's

Minimum Essential Medium and 5.35 g/L powdered Ham's F-12 with 10% (v/v) fetal

bovine serum, 10% (v/v) heat-inactivated horse serum, 0.2 U/mL insulin, 0.034 mg/mL

D-valine, 1.685 mg/mL sodium bicarbonate, 100 U/mL penicillin-G, and 0.1 mg/mL

streptomycin.

In Vitro Production of Embryos

Embryo production was performed as previously described (Soto et al., 2003b).

Briefly, a mixture of beef and dairy cattle ovaries were obtained from a local abattoir

(Central Beef Packing Co., Center Hill, FL, USA) and cumulus-oocyte complexes

(COCs) were collected by slicing follicles that were 2 to 10 mm follicles in diameter on

the surface of ovaries. Cumulus-oocyte complexes containing at least one layer of

compact cumulus cells were selected for subsequent steps. These COCs were washed

twice in oocyte collection medium and placed in groups of 10 in 50 pL drops of oocyte

maturation medium with a mineral oil overlay and matured for 20 to 22 h at 38.50C and

5% C02 in humidified air. Matured oocytes were then washed twice with HEPES-TALP

and transferred in groups of 200 to a 35 mm x 10 mm petri dish containing; 1.7 mL IVF-









TALP, 80 pL PHE (0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 pM epinephrine

in 0.9% (w/v) NaCI), and 120 pL Percoll-purified spermatozoa [17x106 sperm/mL] from

a pool of frozen-thawed semen (3 to 4 bulls; a separate pool of semen was used for

each replicate) for a final concentration of approximately 1.2x106 sperm/mL at

fertilization. After 8 to 10 h of co-incubation at 38.50C, 5% CO2 in humidified air,

putative zygotes were removed from fertilization plate and denuded of cumulus cells by

vortexing in 100 pL hyaluronidase (1000 U/mL in HEPES-TALP). Denuded putative

zygotes were cultured in groups of 25 to 30 in 50-pL drops of KSOM-BE2 or KSOM-BE2

+ a-amanitin [50 pM] with a mineral oil overlay at 38.50C, 5% C02, 5% 02, ~90% N2,

with humidified air.

BEND Cell Culture

The BEND cell line, derived from bovine endometrium, was purchased from

American Type Culture Collection (Manassas, VA, USA). Cells were grown in BEND

cell culture medium at 38.50C and 5% CO2 with humidified air. At confluence, cells

were trypsinized, centrifuged for 10 min at 300 x g and re-suspended in fresh complete

medium. Cells were then either collected or propagated.

RNA Extraction

Oocytes were collected after 22 h of maturation, 2-cell and 2-cell embryos treated

with a-amanitin were collected between 28 to 29 h post-insemination (hpi) and 216-cell

embryos were collected at Day 5 post-insemination. Total RNA was extracted using the

PicoPure RNA isolation kit (Molecular Devices, Sunnyvale, CA, USA) following the

manufacturer's instructions. Briefly, 100 pL of extraction buffer was added to 20

oocytes or embryos and the mixture incubated at 420C for 30 min. Thereafter, 100 pL

of 70% (v/v) ethanol was added and the mixture added to a pre-conditioned RNA









purification column. After a series of 3 washes using two different wash buffers, RNA

was eluted using 15 pL of elution buffer into a clean 1.5 mL microcentrifuge tube. RNA

concentration was determined using a NanoDrop 2000 (Thermo Fisher Scientific Inc.,

Waltham, MA, USA) and samples were stored at -800C until analysis.

Total RNA was extracted from BEND cells using the RNeasy Plus Micro Kit

(Qiagen, Valencia, CA) following the manufacturer's instructions. Briefly, 5x105 BEND

cells were lysed in a 1.5 mL microcentrifuge tubes by repeat pipetting with a 20 gauage

needle in 350 pL lysis buffer. Cell lysate was placed into gDNA eliminator columns to

remove genomic DNA. After mixing with 70% (v/v) ethanol, samples were transferred to

the RNeasy MiniElute spin columns. Samples were then washed with a series of

buffers and 80% ethanol and total RNA was eluted with 14 pL RNase-free water into a

clean 1.5 mL microcentrifuge tube. The RNA concentration was determined using a

NanoDrop 2000 and samples were stored at -800C.

Quantitative Real-Time RT-PCR (qPCR)

Primers used for qPCR were manufactured by Integrated DNA technologies and

are described in Table 2-1. To remove contaminating DNA, RNA samples were treated

with DNase I (New England Biolabs, Ipswich, MA, USA) according to manufacturer's

specifications. Briefly, 10 pL RNA sample was treated with 10 pL DNase mix (1 pL

DNase I, 2 pL DNase Buffer, and 7 pL 0.1% (v/v) Diethyl Pyrocarbonase treated H20

(DEPC) at 370C for 30 min followed by 750C for 15 min. cDNA was produced using the

High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA,

USA) according to the manufacturer's directions. DNase treated samples (20 pL) were

diluted to a final volume of 35 pL with DEPC H20. Reverse transcription was performed

in 15 pL reactions by adding 7.5 pL diluted DNase treated sample to either 7.5 pL of









RT(+) master mix (3.15 pL DEPC H20, 1.5 pL 10X reaction buffer, 1.5 pL 10X random

primers, 0.6 pL 25X dNTPs, and 0.75 pL 20X RTase) or 7.5 pL of RT(-) master mix (3.9

pL DEPC H20, 1.5 pL 10X reaction buffer, 1.5 pL 10X random primers, and 0.6 pL 25X

dNTPs). Reaction conditions were as follows; 250C for 10 min, 370C for 2 h, and 850C

for 5 min.

cDNA from BEND cell samples was used to produce a standard curve to test

efficiency of each primer. After reverse transcription, samples were diluted using

fivefold dilutions to create a five point standard curve. Standard curves were run in a

25 pL reaction volume [12.5 pL 2x SYBR Geen PCR master mix (Applied

Biosystems), 0.75 pL each of 10 mM forward and reverse primers (Table 2-1) and 8.5

pL DEPC H20] using an ABI 7300 instrument (Applied Biosystems). The conditions for

amplification were as follows: 1 cycle for 10 min at 950C followed by 50 cycles of 15 sec

at 950C and 1 min at 600C. Cycle threshold (Ct) values were plotted against the logo of

the template concentration and primers used if the slope was between -2.9 to -3.7 with

an R2 >0.95. In addition, agarose gel electrophoresis was performed to verify synthesis

of a single product at the appropriate size (data no shown).

cDNA from multiple RT(+) reactions, from the same pool 20 of oocytes or

embryos, were pooled together to ensure adequate cDNA. Each real-time plate

consisted of one replicate of all genes in all sample groups (oocyte, 2-cell, 2-cell + a-

amanitin, and 216-cell embryos). Samples were analyzed in duplicate in 25 pL

reactions [12.5 pL 2x SYBR Geen PCR master mix, 0.75 pL each 10 mM forward and

reverse primers (Table 2-1), and 8.5pL DEPC H20] using an ABI 7300 PCR machine









(Applied Biosystems). Amplification proceeded for 1 cycle for 10 min at 950C followed

by 50 cycles of 15 sec at 950C and 1 min at 600C.

Immunocytochemistry

Two-cell embryos were collected between 28 to 29 hpi and 216-cell embryos were

collected at Day 5 post-insemination. Two-cell embryos and 216-cell embryos were

washed four times in 50 pL drops of 10 mM KPO4, pH 7.4 containing 0.9% (w/v) NaCI

(PBS) and 1 mg/mL polyvinylpyrrolidone (PBS-PVP) by transferring from drop to drop.

Embryos were fixed for 15 min in PBS containing 4% (v/v) paraformaldehyde. After

fixation, embryos were washed in PBS-PVP and placed in 500 pL of PBS-PVP and

stored at 40C for up to a week.

Antibodies were affinity purified rabbit polyclonal antibodies for BCL2 (Santa Cruz

Biotechnology, Santa Cruz, CA, USA), BCL2L1 (AbCam Cambridge, MA, USA), BAX

(Santa Cruz Biotechnology) and BAD (Assay Designs, Ann Arbor, MI, USA) or a purified

mouse monoclonal antibody for HSPA1A (Chemicon International) and either fraction

purified rabbit IgG or mouse IgG (Sigma-Aldrich) was used as a negative control. Each

antibody was used at a concentration determined to be optimal in preliminary

experiments (BCL2: 4 pg/mL, BCL2L1: 10 pg/mL, HSPA1A: 5 pg/mL, BAX: 2 pg/mL,

BAD: 10 pg/mL). Antibodies were labeled using the Zenon 488 labeling kit

(Invitrogen) following the manufacturer's instructions For every 1 pg antibody or non-

specific IgG being labeled, 5 pL of the Zenon Fab fragment mixture was added and

incubated for 5 min in the dark. An equal mass of Zenon nonspecific IgG was then

added to block unbound Fab fragments and incubated for 5 min in the dark.

Two-cell and 216-cell embryos were permeabilized in groups of 30-50 in 500 pL

PBS + 0.2% (v/v) Triton-x (Sigma-Aldrich) for 30 min at room temperature. Embryos









were washed four times in PBS-PVP and placed into 50 pL PBS containing 20% (v/v)

normal goat serum (Pel-Freez Biologicals, Rogers, AR, USA ) for at least 1 h at room

temperature. After blocking, embryos were briefly washed in 1 drop of PBS-PVP and

then transferred to a drop of Zenon labeled antibody or labeled IgG and incubated for

1 h at room temperature. Embryos were then washed 4 times, fixed for 15 min in 4%

(v/v) paraformaldehyde and nuclei labeled with Hoescht 33342 (1 pg/mL, Sigma-

Aldrich) for 15 min. Embryos were washed 4 to 5 times, mounted on a microscope slide

using ProLong Gold Anti-Fade mounting medium (Thermo Fisher Scientific Inc), and

fluorescence visualized using the a Zeiss Axioplan microscope (Zeiss, Gottingen,

Germany) with a 40x objective and the FITC, DAPI, and DIC filter sets. Digital images

were acquired using the AxioVision software and a high-resolution black and white

AxioCam MRm digital camera (Zeiss).

Image Analysis

Using ImageJ (National Institute of Heath, Bethesda, MA, USA), individual

embryos were outlined by hand with the polygon selection tool. After selection,

additional exclusion was made for areas that did not correspond to the embryo as well

as areas within the embryo between cells and, in cases where it occurred, in regions of

the embryo that had broken through the zona pellucida. In the latter case, extrusion

through the zona pellucida was a fixation artifact and extruded areas were consistently

associated with lower fluorescent intensity. Mean gray pixel intensity of the selected

area was measured using the FITC channel. Background and non-specific binding was

removed by averaging mean pixel for IgG controls and subtracting these values from

individual mean pixel intensities of embryos in corresponding stages. Adjusted mean

pixel intensities that were below zero were set to zero.









Western Blotting

Oocytes were collected after 22 h of maturation, 2-cell and 2-cell embryos treated

with a-amanitin were collected between 28 to 29 hpi and 216-cell embryos were

collected at Day 5 post-insemination. Before collecting oocytes, cumulus-oocyte

complexes were washed twice with HEPES-TALP and then denuded of cumulus cells

by vortexing in 100 pL hyaluronidase (1000 U/mL in HEPES-TALP). Denuded oocytes

and embryos were washed four times in 50 pL drops of PBS-PVP by transferring from

drop to drop. Groups of 25 to 100 ooctyes/embryos were placed in a pre-warmed 50 pL

drop pronase for 2-5 min on a slide warmer to digest the zona pellucida. Groups of

oocytes or embryos up to 200 in number were then placed into 1.5 mL microcentrifuge

tubes containing 1 mL PBS-PVP. Samples were centrifuged at 13,600xg, supernatant

removed and samples were stored at -800C.

BEND cells were used as a positive control. They were collected after

trypsinization, washed once with 1 mL PBS, adjusted to xlO06/mL and then aliquoted in

groups of 105 cells into 1.5 mL microcentrifuge tubes. Tubes were then centrifuged for

10 min at 13,600xg and supernatant was removed. Cells were stored at -200C.

Oocyte and embryo samples were pooled to create groups of 200 in 20 pL loading

buffer [0.125 M Tris-HCI pH 6.8 containing 20% (v/v) sucrose, 10% (w/v) sodium

dodecyl sulfate (SDS), trace amounts of bromophenol blue, and 5% (v/v) 2-

mercaptoethanol]. Similarly, BEND cell samples were resuspended in 20 pL loading

buffer. Samples were boiled at 950C for 5 min and cooled on ice for 1 min before

performing one-dimensional, discontinous SDS-polyacrylamide gel electrophoresis

(SDS-PAGE) using a Ready Gel 4-15% (w/v) Tris-HCI (Bio-Rad, Hercules, CA, USA)

gel. Conditions for electrophoresis were 125 V, 40 mA for 1 to 1.5 h at room









temperature. Proteins were then transferred electrophoretically to a Hybond ECL 0.2

pm nitrocellulose membrane (GE Healthcare). Conditions for transfer were 30 V, 90 mA

for 12 h at 40C using a degassed buffer of 25 mM Tris, 193 mM glycine, and 20% (v/v)

methanol. Membranes were blocked overnight in TBS-T [10 mM Tris pH 7.6, 0.87%

(w/v) NaCI, and 0.3% (v/v) Tween-20] that also contained 5% (w/v) non-fat dry milk

(TBS-TM). Membranes were rinsed 2 times with TBS-T and incubated for 2 h at 40C

with either a polyclonal antibody (BCL2 or BAX: Santa Cruz Biotechnology) or rabbit

IgG at 1 pg/mL in TBS-TM. Membranes were washed 4 times with TBS-T and then

incubated for 1.5 h at 40C with horseradish peroxidase conjugated to goat ant-rabbit IgG

(0.04 pg/mL, Santa Cruz) in TBS-TM and then washed as above. Blots were exposed

to the ECL Plus Western blotting chemiluminescence substrate kit (GE Healthcare) for 5

min and then exposed to film for 3 to 15 min.

To allow re-probing, membranes were stripped using a stripping buffer [62.5 mM

Tris-HCI, 2% (w/v) SDS, 100 mM 2- mercaptoethanol] for 30 min at 500C. Membranes

were washed and re-probed as described before. Peptide neutralization was performed

to verify the specificity of the two antibodies. Briefly, 5 pg/mL of the peptide used to

produce a-BCL2 or a-Bax (Santa Cruz) was pre-incubated with 1 pg/mL of the

respective antibody for 1 h and the antibody mixture was used to probe blots as

described above.

Experimental Design

For all experiments, control drops were set aside to assess cleavage at Day 3

post-insemination and development to the blastocyst stage at Day 8 post-insemination.

Only replicates with characteristic cleavage and blastocyst development rates were

used for molecular or immunochemical analysis.









qPCR: Treatments included MII oocytes, 2-cell embryos, 2-cell embryos treated

with 50 pM a-amanitin, and 216-cell embryos. Oocytes and embryos were collected

and analyzed in groups of 20. Eight genes were analyzed for each treatment four anti-

apoptotic (BCL2, BCL2L1, HSPA1A, and DFFA), three pro-apoptotic (DFFB, BAX, and

BAD), and HISTIH2A as a housekeeping gene (Robert et al., 2002). The qPCR

experiments were replicated 5 times.

Immunocytochemsity: For each antibody, treatments included 2-cell embryos

and 216-cell embryos. Each replicate consisted of at least 10 2-cell and 10 216-cell

embryos for IgG negative controls and at least 10 2-cell and 10 216-cell embryos for

antibody labeling (BCL2, BCL2L1, HSPA1A, BAX, BAD). Experiments were replicated 4

to 8 times with (BCL2, n= 111; BCL2L1, n= 183; HSPA1A, n= 239; BAX, n= 142; BAD,

n= 186).

Western blotting: A total of 4 Western blots were performed. Treatments

included on all blots were Ml oocytes, 2-cell embryos, 216-cell embryos. In addition, 2-

cell embryos treated with 50 pM a-amanitin and BEND cells were included on one blot.

Except for BEND cells or where noted, each lane contained 200 oocytes or embryos.

Membranes were stripped to allow for blotting with different antibodies.

Statistical Analysis

Data on mRNA abundance were subjected to least-squares analysis of variance

using the General Linear Models procedure (GLM) of the Statistical Analysis System

(SAS for Linux, Release 9.2, SAS Institute Inc., Cary, NC, USA). PCR data were

analyzed using ACt. In preliminary analysis using cycle threshold (Ct) values,

HISTIH2A had significant variation between treatments, accordingly DFFB was used

instead as a housekeeping gene because it was similarly expressed between









treatments. The p-diff procedure with Tukey adjustment was used as a means

separation test. The AACt value for each gene was calculated by the difference

between the ACt of the embryo groups and the ACt of MII oocytes. Data are reported

as fold change calculated by 2-act.

Data on adjusted pixel intensity from immunocytochemical analysis were also

analyzed by least-squares analysis of variance using PROC GLM. Replicate was

considered as a fixed effect and the p-diff procedure was used as a means separation

test.

Results

Quantitative Real-Time RT-PCR

A total of 8 genes were analyzed by qPCR including anti-apoptotic genes (BCL2,

BCL2L1, HSPA1A and DFFA), pro-apoptotic genes (BAX, BAD, and DFFB), and

HIST1H2A. DFFB did not vary between stages and was used as a housekeeping gene

for calculation of ACt. Differences in steady state concentrations of mRNA for each

gene are shown in Figure 2-1. Of the anti-apoptotic genes, BCL2 steady state mRNA

did not differ significantly different between MII oocytes, 2-cell embryos and a-amanitin

treated 2-cells, but was lower in 216-cell embryos compared to the earlier stages (panel

A; P<0.0001). There was no significant effect of stage of development on steady state

mRNA concentrations of BCL2L1 (panel B). Patterns of mRNA concentrations for

HSPA1A (panel C) and DFFA (panel D) were similar to those for BCL2, with a

reduction in concentration in embryos 216 cells. This difference was significant for

HSPA IA (P=0.0005) but not for DFFA. For the pro-apoptotic genes, steady state

concentrations of BAXwere not affected by stage (panel E). However, steady-state









concentrations of BAD had a distinct temporal pattern with a significant increase in

mRNA levels in embryos 216-cells (panel F; P<0.0001).

Immunocytochemistry and Western Blotting

As shown in Figure 2-2, immunoreactive BCL2 detected by immunoflourescence

was greater for 2-cell embryos than for embryos 216 cells (compare Figure 2-2 B with

Figure 2-2 panel E). Adjusted mean pixel intensity of immunoflourescence was greater

(P=0.001) for 2-cell embryos (Figure 2-2 panel G). These results were confirmed by

Western blotting in three separate replicates. In the first (panel H), the BCL2 band was

more intense for 2-cell embryos (lane 3) than 216-cell embryos (lane 4) despite fewer

embryos being loaded per lane. In the second blot (panel J), equal numbers of oocytes

or embryos were loaded per lane and there was higher amounts of immunoreactive

BCL2 in 2-cell embryos (lane 2) compared to 216-cell embryos (lane 3). In the final blot

(panel J), with equal numbers per lane, a membrane defect partially obscured the lane

with 2-cell embryos (lane 2). However, amounts of immunoreactive BCL2 were lowest

for 216-cell embryos (lane 4). Immunolabeling of BCL2 was eliminated when antibody

was co-incubated with a BCL2 peptide (results not shown).

Shown in Figure 2-3 are immunocreactive amounts of BAX using

immunocytochemistry (panels A-G) and Western blotting (panels H-J). Immunoreactive

BAX detected by immunoflourescence was lower for 2-cell embryos than for embryos

216 cells (compare Figure 2-3 B with Figure 2-3 panel E). Pixel intensity of

immunoflourescence was lower (P<0.0001) for 2-cell embryos (Figure 2-3 panel G).

Three Western blots were performed to further evaluate developmental changes in

immunoreactive BAX. In the first blot, immunoreactive BAX was detected at the

expected molecular weight (23 kDa) and there was slightly less BAX in embryos 216









cells than for MII oocytes and 2-cell embryos (panel H). In the second (panel I) and

third blots (panel J), a different pattern was present. Three immunoreactive bands were

detected, all of which could be eliminated by co-incubation of antibody with BAX peptide

(data no shown). One band was of expected size (23 kDa), another larger band of 46

kDa was present that presumably represents BAX dimmers, and a third, low molecular

weight band that could represent proteolytic cleavage products was present.

Differences between stages in amounts of the 23 kDa BAX were variable. The higher

molecular weight 46 kDa form was present in higher amounts in 2-cell embryos than in

MII oocytes and yet higher amounts in 216 cell embryos.

There were no effects of stage of development on amounts of immunoreactive

BCL2L1, HSPA1A or BAD as determined by immunofluorescence (Figure 2-4).

Discussion

The ability of the preimplantation bovine embryo to undergo an apoptotic response

is developmentally regulated with stress-induced apoptosis being blocked prior to

embryonic genome activation, around the 8- to 16-cell stage in the bovine, (Krininger et

al., 2002; Paula-Lopes and Hansen, 2002; Soto et al., 2003; Brad et al., 2007;

Carambula et al., 2009). The block to apoptosis is not caused by a lack of apoptotic

machinery because chemical depolarization of the mitochondria using CCCP leads to

the activation of both caspase-9 and group II caspases (Brad et al., 2007). These data

indicate that one of the developmental blocks to the apoptotic pathway is at the level of

the mitochondria.

Life and death of a cell is dictated by a delicate balance of anti- and pro-apoptotic

BCL2 family proteins (Adams and Cory, 1998). Anti-apoptotic BCL2 family members

(BCL2 and BCL2L1) inhibit apoptosis by heterodimerizing with pro-apoptotic BCL2









family members (BAX, BAK, BOK). Heterodimerization prevents the pro-apoptotic BCL2

family proteins from forming homodimers which are required for mitochondrial pore

formation and depolarization. Present results indicate that there is a switch from an

abundance of BCL2 in early cleavage-stage embryos, which are not capable of

apoptosis, to increased amounts of BAX protein and BAD mRNA in later stage

embryos, which possess the capacity for apoptosis.

Quantitative real-time RT-PCR indicated higher amounts of BCL2 in oocytes and

2-cell embryos compared to 216-cell embryos. BCL2 has also been shown to

significantly decrease from the zygote to the 2-cell embryo in the mouse (Exley et al.,

1999), which is also coincident with mouse genome activation (Flach et al., 1982). In

the human preimplantation embryo BCL2 is present at all stages however, it is highly

expressed in the 2-cell embryo and expression decreases in the 4- to 6-cell embryo

again coincident with genome activation (Spanos et al., 2002).

Immunoreactive amounts of BCL2 protein is also higher in the 2-cell embryo than

in the 216-cell embryo. While BCL2 is higher in the 2-cell embryo, it is not the result of

active transcription since treatment with a-amanitin, a transcription inhibitor, has no

effect on steady-state amounts of BCL2 mRNA or protein expression. Therefore, most

likely BCL2 in the early cleavage embryo is maternally derived.

Prior to embryonic genome activation the embryo is transcriptionally quiescent

with the majority of its mRNA and proteins being derived from maternal stores in the

oocyte (van Blerkom, 1981; Flach etal., 1982). Total RNA, mRNA, and protein

concentration decrease throughout preimplantation development until after embryonic

genome activation. This temporal expression pattern has been seen in bovine with









RNA and protein expression decreasing from the 2-cell to the 8-cell stage and then

slowly increasing from the morula to the blastocyst stage (Gilbert et al., 2009). Data

presented show the same expression pattern for BCL2. The higher concentration of

BCL2 in 2-cell embryos contributes to making the mitochondria refractory to stimuli

leading to apoptosis.

Steady-state mRNA of HSPA1A is also higher in the oocyte and 2-cell embryo

than the 216 cell embryo. HSPA A mRNA follows the same temporal decrease as

BCL2, but immunoreactive concentration of HSPA1A protein remained constant through

the 216-cell stage. One possible explanation for this could be post-transcriptional

regulation of HSPA1A by RNA-binding proteins. RNA-binding proteins influence RNA

localization, stability and translation. They serve an important role in the oocyte and

preimplantation embryo maintaining mRNA stores throughout development until

embryonic genome activation. The bovine embryo has been shown to have a variety of

these RNA binding proteins including staufen 1 and 2 and ELAVL1 (Calder et al., 2008).

ELAVL1 has been shown to bind to HSPA1A mRNA in the brain, and post-

transcriptionally regulate HSPA1A expression (Amadio et al., 2008). The stability of

HSPA1A protein concentration may be related to the regulatory control of ELAVL1 or

other RNA binding proteins present in the preimplantation embryo.

BCL2L1, another anti-apoptotic member of the BCL2 family, does not show signs

of developmental regulation in either mRNA or protein expression. BCL2L1 mRNA and

BCL2L1 protein concentration is extremely stable during preimplantation development

confirming previous results in the bovine (Knijn et al., 2005) and mouse (Exley et al.,

1999). However, BCL2L1 expression pattern may be extremely important in









preimplantation development. Unlike, BCL2 and HSPA1A where there is a temporal

decrease of mRNA and protein, BCL2L1 expression remains constant. This suggests

that BCL2L1 may be actively transcribed prior to embryonic genome activation, or there

may be tight post-transcriptional controls to maintain BCL2L1 protein concentration.

Acquisition of capacity for apoptosis at the 216 cell stage is accompanied not only

with a decrease in amounts of BCL2 but also by changes in the pro-apoptotic BCL2

family members. There are two major classes of the pro-apoptotic BCL2 family

members; multi-domain proteins (BAX, BAK, BOK) and BH3-only domain proteins

(BAD, BID, BIK, etc.). The multi-domain members form heterodimers with the anti-

apoptotic proteins in the cytosol and mitochondrial membrane. Upon apoptotic stimuli,

BH3-only members are activated and either heterodimerize with anti-apoptotic proteins

(BCL2, BCL2L1, MCL1) to inhibit their function or bind to the multi-domain pro-apoptotic

proteins leading to mitochondrial localization and pore formation (Lucken-Ardjomande

and Martinou, 2005). In the current study we investigated the multi-domain member

BAX and the BH3-only member BAD. There are complex developmental changes for

both molecules.

Steady state mRNA for BAX does not vary between developmental stages.

Similar results have been described in the mouse (Exley et al., 1999) and human

(Metcalfe et al., 2004). In contrast, immunocytochemical analysis indicates not only an

increase in immunoreactive amounts BAX at the 216-cell stage, but also an increased

amount of high molecular weight BAX as detected in some of the Western blot results.

Such results suggest post-translational regulation of BAX increasing its capacity for

dimerization and therefore activity.









In SDS-PAGE under reducing conditions, proteins are denatured by the addition of

a reducing agent such as 2-mercaptoethanol or dithiothreitol, which removes disulfide

bonds resulting in the loss of oliomers and tertiary structure. As a result, BAX should

not form multimers under these conditions, unlike our Western blotting results.

However, there is evidence that a-helical pore forming proteins can and do form

multimer units under reducing conditions (Lemmon et al., 1992a, 1992b). BAX and

BAK1 belong to a class of amphipathic proteins called a-pore-forming proteins that

contain several a-helices that are involved in their pore forming properties (Qian et al.,

2008). It is these a-helical transmembrane domains and the extreme hydrophobic

pockets that allow pore forming proteins to produce stable multimers even under

reducing conditions (Lemmon et al., 1992a). Not only are the BAX multimer bands

specific, bands are removed with peptide neutralization, but because of its pore forming

properties structural domains, multimer formation under reducing conditions has

previously been demonstrated.

BAD has the most interesting pattern of mRNA expression and protein

concentration. The steady-state mRNA for BAD is very low through the 2-cell stage and

then increases almost 10 fold at the 216-cell stage. This same pattern is seen in the

human preimplantation embryo, with very low levels of BAD expression until compaction

when there is an increase in expression (Spanos et al., 2002; Metcalfe et al., 2004).

Despite the increase of BAD mRNA at the 216 cell stage, there is no change in

immunoreactive amounts of BAD as determined by immunohistochemistry.

BH3-only proteins have been shown to be regulated transcriptionally and post-

translationally. For example BBC3 (previously PUMA) is shown to be transcriptionally









upregulated by both p53 (Nakano and Vousden, 2001) and forkhead box 03 (FOXO3)

(You et al., 2006) upon DNA damage or growth factor deprivation. BAD is shown to be

post-translationally regulated undergoing two phosphorylation events at Ser112 (Zha et

al., 1996; Harada et al., 1999) and Ser136 (Datta et al., 1997) leading to BAD being

sequestered by YWHAQ proteins (Zha et al., 1996; Datta et al., 1997). Upon apoptotic

stimuli these serine become dephosphrylated and BAD is released from YWHAQ

proteins and contributes to cell death (Zha et al., 1996). Neither of these forms of

regulation would contribute to our increase in mRNA after 216-cell stage without a

change in protein concentration.

A novel post-transcriptional mechanism has recently been proposed by Lam et al.

(2009). Using RNAi they identified a novel kinase, MAP4K3. They show that MAP4K3

plays a role in DNA damaged induced cell death and its suppression results in a

significant resistance to DNA damage. They also found a MAP4K3 dependent induction

of BAD and BBC3 independent of p53.

MAP4K3 functions by activating the mechanistic target of rapamycin (mTOR)

pathway. mTOR modulates the activity of eukaryotic translation initiation factors

(elF4B, elF4E, elF4F) which are involved in CAP-binding and mRNA stability (Ramirez,

2002). The authors suggest that this MAP4K3 stimulation of mTOR leads to the

stabilization of BBC3 and BAD and may contribute to and enhancement of BBC3 and

BAD translation.

This novel post-transcriptional mechanism of regulation can explain the pattern of

BAD expression. After the 216-cell stage a 10 fold increase of BAD mRNA can result in

an increased availability of transcript that will be translated upon apoptotic stimuli.









While in the 2-cell embryo, the lack of pre-formed BAD mRNA will blunt the magnitude

of a pro-apoptotic signal.

These data indicate that there is a developmental transition of anti- versus pro-

apoptotic genes from the 2-cell to the 216-cell embryo. This is complicated by the fact

that the oocyte can undergo heat-shock induced apoptosis (Roth and Hansen, 2004)

despite having similar expression of BCL2, BCL2L1, HSPA1A, BAX and BAD when

compared to the 2-cell embryo. So why does the ooctyte undergo apoptosis when the

2-cell embryo cannot?

Oocytes are extremely variable in both quality and development potential. Along

with these variations in quality there is evidence for changes in certain protein

concentrations. BAX is equally expressed in low and high quality bovine oocytes, but

there is a higher amount of immunoreactive BCL2 in high quality oocytes compared to

low quality oocytes (Yang and Rajamahendran, 2002). This variation in BCL2

concentration, similar to what is seen between the 2-cell and 216-cell embryo, is a

possible mechanism by which apoptosis could occur in the oocyte. For this study only

high quality oocytes were selected, possibly explaining the lack of differences between

our BCL2 expression in oocytes and 2-cell embryo. In addition to inherent variation

among oocytes there could also be other molecular mechanisms at work such as

oocyte ageing.

Post-ovulatory oocyte ageing has been implicated with an increased incidence of

apoptosis (Fissore et al., 2002). Like oocyte quality in bovine, oocyte ageing in mouse

shows a stable expression of BAX mRNA, but an age dependent decrease in both

BCL2 mRNA and BCL2 protein expression (Gordo et al., 2002). Again it is a change in









BCL2 expression that is related to the capacity for apoptosis. Although it is not fully

understood how the oocyte undergoes heat-shock induced apoptosis, one potential

mechanism is the pre-mature ageing of the oocyte resulting in the degradation of BCL2

allowing for apoptotic signal propagation.

Apoptosis is a tightly regulated pathway with multiple checks and balances to

prevent accidental activation of cellular death without an appropriate signal. While

caspases and DNases are the cellular executioners, it is the mitochondria in

concordance with BCL2 family of proteins that serve as judge and jury. The data

presented here show that developmental regulation of mRNA and immunoreactive

amounts of protein, in particular BCL2, BAX and BAD, are key factors in preventing

mitochondrial depolarization and apoptosis in the early preimplantation embryo and for

establishing the capacity for apoptosis at the 216-cell stage.









Table 2-1. Primer sets used for qRT-PCR.


Gene Accession number
BCL2 XM_586976.4



BCL2L1 NM_001077486.2


HSPAIA NM_174550.1



DFFA NM_001075342.1



BAX NM_173894.1


BAD NM_001035459.1



DFFB NM 001035109.1


HISTIH2A


U62674


Tm (oC)
60


Product
size (bp)


Reference


109


Sequence
5'-TCGTGGCCTTCTTTGAGTTC-3'

5'-CGGTTCAGGTACTCGGTCAT-3'

5'-CTCAGAGTAACCGGGAGCTG-3'

5'-CTGGGGGTTTCCATATCTGA-3'

5'-GGGGAGGACTTCGACAACAGG-3'

5'-CGGAACAGGTCGGAGCACAGC-3'

5'-GGTGCTTGACCAGAGAGAGG-3'

5'-CCAAGGTCAGCTCTGGACTC-3'

5'-CTCCCCGAGAGGTCTTTTTC-3'

5'-TCGAAGGAAGTCCAATGTCC-3'

5'-CTTTTCTGCAGGCCTTATGC-3'

5'-GGTAAGGGCGGAAAAACTTC-3'

5'-CCCTGCATAGCGAGAAGAAG-3'

5'-ATTCCGTGCCATCCTCATAG-3'

5'-GTCGTGGCAAGCAAGGAG-3'

5'-GATCTCGGCCGTTAGGTACTC-3'


57 182 (Robert et al., 2002)


60 142



60 245 (Block et al., 2008)


60 120



60 176



59 151



60 129











Anti-Apoptotic
A BCL2
a a
a


b


B BCL2L1








C HSPA1A

a a a






D DFFA









cpl m


ciu

CD
V
- 0















0
U-
O
o












ci>
LL









CD








(._
O
O
LL
.i
'n,
c5
or:


Stage


Pro-Apoptotic
E BAX








F BAD
b





a a a







Stage

Other

G H2A














Stage


Figure 2-1.


Quantitative real-time RT-PCR for anti-apoptotic genes A) BCL2, B)
BCL2L1, C) HSPAIA, and D) DFFA and pro-apoptotic genes E) BAX and F)
BAD and the housekeeping gene G) HISTIH2A. Data on steady state
mRNA concentrations for bovine MII oocytes, 2-cell embryos, 2-cell
embryos treated with a-amanitin, and 216-cell embryos are expressed as
fold change relative to MII oocytes (least-squares means SEM).
Reactions were performed with cDNA samples (n=5) from individual groups
of 20 oocytes or embryos. Different letters indicate a significant difference
in relative mRNA abundance (P<0.05).









Adjusted Mean Pixel Intensity

0 100 200 300 400 500 600
SIII I I


Figure 2-2.


Immunoreactive amounts of BCL2 in 2-cell and 216-cell in vitro produced embryos as determined by
immunocytochemistry (A-G) and Western blotting (H-J). Immunocytochemical results are representative
images of 2-cell embryos (A-C) and 216-cell embryos (D-F). Shown are merged fluorescent images of Zenon
488 labeled anti-BCL2 (green) and nuclei labeled with Hoescht 33342 (blue) (B,C, E, F), or merged images of
fluorescent labeling with differential interference contrast (A,D). Images of anti-BCL2 labeling are in panels
(A,B,D,E) and labeling with the negative control (non-specific IgG labeled with Zenon 488) are in panels (C,F).
The average pixel intensity of fluoresence associated with labeling with anti-BCL2, after correction for non-
specific labeling, is shown in panel G (least-squares means S.E.M.). Intensity of fluorescence was higher
for 2-cell embryos as indicated by a different letter (P=0.001). Results of Western blotting for BCL2 in MII
oocytes, 2-cell embryos, a-amanitin treated 2-cell embryos, >16-cell embryos, and BEND cells (positive
control) are shown in panels (H-J). The arrow indicates the band of interest at 26 kDa. All lanes of oocytes
and embryos represent 200 oocytes or embryos except for panel H where 200 MII oocytes, 110 2-cell
embryos and 150 216-cell embryos were loaded.


a-BCL2


Negative
Control

















IV


S(D D
m =
Z 0 (D
o 3 3

(D 0 0
(A Ccnl c


IV
rJ 0



0 3 3
O o o
CD 0 0
W) cW (A


5 IV
o r) 0)


oo
o CD CD (D
0 3 3 3

CD 0 0 0
cn CA UA (n


Figure 2-2. Continued


26 kDa--










Negative
Control


Adjusted Mean Pixel Intensity

0 100 200 300 400 500


Figure 2-3.


Immunoreactive amounts of BAX in 2-cell and 216-cell in vitro produced embryos as determined by
immunocytochemistry (A-G) and Western blotting (H-J). Immunocytochemical results are representative
images of 2-cell embryos (A-C) and 216-cell embryos (D-F). Shown are merged fluorescent images of Zenon
488 labeled anti-BAX (green) and nuclei labeled with Hoescht 33342 (blue) (B,C, E, F), or merged images of
fluorescent labeling with differential interference contrast (A,D). Images of anti-BAX labeling are in panels
(A,B,D,E ) and labeling with the negative control (non-specific IgG labeled with Zenon 488) are in panels
(C,F). The average pixel intensity of fluoresence associated with labeling with anti-BAX, after correction for
non-specific labeling, is shown in panel G (least-squares means S.E.M.). Intensity of fluorescence was
lower for 2-cell embryos as indicated by a different letter (P<0.0001). Results of Western blotting for BAX in
MII oocytes, 2-cell embryos, a-amanitin treated 2-cell embryos, 216-cell embryos, and BEND cells (positive
control) are shown in panels (H-J). The arrow indicates the bands of interest at 46 and 23 kDa. All lanes
represent 200 oocytes or embryos.


a-BAX


600











IV

l 0
CD C(D

o (D CD
S o

8 O
0 3 3

(D 0 0
Cn) W) )


(D

0 (D
0 3
I <
0 O



(D 0
(n ()


N3 0)

S(D (D
o
C )
0 3 3

(D 0 0
C, (n (n


Figure 2-3. Continued


46 kDa


23 kDa--










Anti-Apoptotic


1400
1200
1000
800
600
400
200
0




1400
1200
1000
800
600
400
200
0


Pro-Apoptotic


1400
1200
1000
800
600
400
200
0


C BAD









2-cell 216-cell


Figure 2-4.


Immunoreactive amounts of A) BCL2L1, B) HSPA1A, and C) BAD in 2-cell
and 216-cell in vitro produced embryos. Data are the average pixel intensity
of fluoresence associated with labeling with antibody, after correction for
non-specific labeling (least-squares means S.E.M.). There were no
significant differences between 2-cell embryos and embryos 216 cells.


A BCL2L1



m r




2-cell 216-cell



B HSPA1









2-cell :16-cell









APPENDIX
COWS IN SPACE: A PRELIMINARY INVESTIGATION TO DETERMINE EFFECTS OF
SPACE FLIGHT ON BOVINE PREIMPLANTATION EMBRYO DEVELOPMENT

Introduction

The effects of space flight have been studied for a variety of cell types in different

organisms. Despite the variation of cell types studied one common consequence of

space flight are changes in the cell's physical structure as a result of disruption of

cytoskeletal organization. Microtuble formation is disrupted leading to diffuse and

shortened microtubles with poorly defined microtuble organizing centers (Lewis et al.,

1998). Perinuclear cytokeratin networks are also disrupted and become diffuse (Vassy

et al., 2003). Disruption of these cytoskeletal networks has a profound effect on the cell

resulting in architectural changes, loss of morphological phenotypes (Gaboyard et al.,

2002), changes in mitochondrial distribution (Schatten et al., 2001), and disruption of

cellular function.

One major function of cytoskeletal structure is its involvement in cellular

proliferation and mitosis, which is reduced as a result of space travel. This reduction

could be seen in osteoblasts after as little as 3 days of exposure to space (Kacena et

al., 2003) the number of MCF-7 cells undergoing progression through the cell cycle as

measured by Ki-67 staining was similar between flight and ground controls but the

duration of mitosis was significantly longer in the flight group (Vassy et al., 2003).

Jurkat cells exposed to space flight actively progressed through the cell cycle and

metabolized glucose, but cell numbers did not increase (Lewis et al., 1998).

In addition to decreases in proliferation, a reduction in size of a cellular population

could be due to removal of cells by apoptosis. As apoptosis is a common mechanism

used to remove damaged cells (Friedberg, 2003), cells with aneuploidy (Hardy, 1999;









Liu et al., 2002), and cells that fail to become properly polarized (Zahir and Weaver,

2004). Space travel leads to an increase in cellular damage due to ionizing radiation

(Jones et al., 2007), the extreme g-forces during launch (Vassy et al., 2003), and

microgravity effects on cellular polarization and cytoskeletal structure. As a result, one

would expect an increase in apoptotic index among cells exposed to space. Lewis et al.

(1998) showed that 4 h of space flight increased DNA condensation from 17% in ground

controls to 30% in flight cells. They also found that there was a time dependent

increase in expression of FAS, a member of the TNF receptor superfamily involved in

the extrinsic apoptotic pathway.

Given the difficulty and expense of space travel, various conditions encountered in

space have been partially replicated here on Earth. Microgravity can be simulated in

the lab using clinostatic rotation in a rotating cell culture system. Clinostat rotation

simulates microgravity by rotating the culture vessel on the horizontal axis so that cells

or embryos within the vessel experience a gravitational pull from multiple directions

leading to the cancellation of gravitational forces over time. Clinostat rotation has been

used in a variety of culture environments to provide preliminary data to the effects of

microgravity.

Simulated microgravity has been used to allow more in-depth investigation of

changes in cytoskeletal structure (Uva et al., 2002) and apoptosis (Schatten et al.,

2001). While fertilization and embryogenesis in space have also been studied, typical

models include amphibians (Souza et al., 1995; Dournon et al., 2001; Gualandris-

Parisot et al., 2002), fish (Ijiri, 1995), and pregnant rats (Ronca and Alberts, 2000).

Studies of this type in space are few in number and are technically limited thus,









simulated microgravity has been used for a more in-depth examination of the effects of

microgravity on fertilization and embryonic development.

Unfortunately, the effects of simulated microgravity on mammalian fertilization and

embryonic development are not consistent. In the mouse, fertilization was not affected

by clinostat rotation (Kojima et al., 2000). In a recent study in the bovine, however,

clinostat rotation resulted in complete inhibition of fertilization compared to controls

which had a 77% fertilization rate (Jung et al., 2009). Developmental competence has

also been looked at under microgravity conditions. Using the mouse as a model there

was a significant reduction in the number of embryos reaching the morulae or blastocyst

stage (70% controls versus 40% clinostat rotation) (Kojima et al., 2000). In the bovine,

none of the embryos under simulated microgravity reached the morulae or blastocyst

stage while in the controls only 11% became morulae and only 3.6% developed to the

blastocyst stage (Jung et al., 2009). While results do vary, they indicate that there is an

effect of simulated microgravity on embryogenesis and development potential.

Both simulated microgravity and space flight have a wide variety of effects that

could cause a decrease in development potential. As previously discussed, these

effects most likely involve disruption of cytoskeletal structure, which would lead to

disruption of fertilization, pronuclear formation, and retardation of mitosis. Cellular

polarization could also be disrupted effecting; differentiation, gene expression, and tight

junction formation. Finally, apoptotic index could increase due to up-regulation of pro-

apoptotic genes (Lewis et al., 1998), or by disruption of mitochondrial networks due to

cytoskeletal changes (Schatten et al., 2001). The objective of this study was to

evaluate effects of space flight on development of bovine preimplantation embryos.









Given previous evidence, we hypothesized that space flight would inhibit development,

possibly because of interference with tight junction formation, blastocoele formation or

induction of apoptosis.

Materials and Methods

Materials

Media for in vitro production of embryos were obtained as follows. HEPES-TL and

IVF-TL were purchased from Millipore (Billerica, MA, USA) or Caisson Laboratories, Inc.

(North Logan, UT, USA) and used to prepare HEPES-TALP and IVF-TALP as described

by Parrish et al. (1986). Oocyte collection medium was TCM-199 with Hank's salts

without phenol red (Atlanta Biologicals, Lawrenceville, GA, USA) supplemented with 2%

(v/v) bovine steer serum (Pel-Freez Biologicals, Rogers, AR, USA) containing 2 U/mL

heparin, 100 U/mL penicillin-G, 0.1 mg/mL streptomycin, and 1 mM glutamine. Oocyte

maturation medium was TCM-199 (Gibco, Invitrogen, Carlsbad, CA, USA) with Earle's

salts supplemented with 10% (v/v) bovine steer serum, 2 pg/mL estradiol 17-3, 20

pg/mL bovine FSH (Folltropin-V; Agtech Inc., Manhattan, KS, USA), 22 pg/mL sodium

pyruvate, 50 pg/mL gentamicin sulfate (Sigma-Aldrich, St. Louis, MO, USA), and 1 mM

L-glutamine or alanyl-glutamine. Percoll was from GE Healthcare (Uppsala, Sweden).

Frozen semen from various bulls was donated by Southeastern Semen Services

(Wellborn, FL, USA). Modified BBH7 was provided by Cooley Biotech LLC.

(Gainesville, FL, USA). All flight hardware was provided by BioServe Space

Technologies (Boulder, CO, USA)

In Vitro Production of Embryos

Embryo production was performed as previously described (Soto et al., 2003b). A

mixture of beef and dairy cattle ovaries were obtained from a local abattoir (Central Beef









Packing Co., Center Hill, FL, USA) and cumulus-oocyte complexes (COCs) were

collected by slicing follicles that were 2 to 10 mm follicles in diameter on the surface of

ovaries. Cumulus-oocyte complexes containing at least one layer of compact cumulus

cells were selected for subsequent steps. These COCs were washed twice in oocyte

collection medium and placed in groups of 10 in 50 pL drops of oocyte maturation

medium with a mineral oil overlay and matured for 23 h at 38.50C and 5% C02 in

humidified air. Matured oocytes were then washed twice with HEPES-TALP and

transferred in groups of 50 to a 4-well plate containing; ~1x106 percoll-purified

spermatozoa from a pool of frozen-thawed semen from three bulls (Dove IRL 95/068

Hochschwab SIM HWB, 90HH407 1922240 L1 Domino 910382 11-24-92, and

153LM46 NPM-1293502) 425 pL IVF-TALP, and 20 pL PHE (0.5 mM penicillamine,

0.25 mM hypotaurine, and 25 pM epinephrine in 0.9% (w/v) NaCI). After 16 h of co-

incubation at 38.5C, 5% CO2 in humidified air, putative zygotes were removed from

fertilization plate and denuded of cumulus cells by vortexing in 100 pL hyaluronidase

(1000 U/mL in HEPES-TALP). Denuded putative zygotes were placed in groups of 25

in 50 pL drops of modified BBH7 with a mineral oil overlay at 38.50C, 5% C02, 5% 02,

-90% N2, with humidified air for 2 h.

Fluid Processing Apparatus

Fluid Processing Apparatuses (FPAs; Figure A-1) were provided by BioServe

Space Technologies. FPA glass barrels and rubber septa were coated with Sigmacote

(Sigma-Aldrich) and autoclaved along with 3-well culture insert and gas exchange

insert. Each well of a 3-well culture insert was loaded with 45 pL of pre-equilibrated

modified BBH7 and 25 embryos. Three-well inserts were then loaded into the FPA

culture chamber with 0.7 mL of pre-equilibrated modified BBH7 Figure A-1. Two rubber









septa sealed the culture chamber. A total of 1 mL of fixative, either 3.4% (v/v)

glutaraldehyde or 6.8% (v/v) paraformaldehyde, was loaded into the fixative chamber

and sealed with rubber septa. For FPAs that were to be fixed on day 9 of culture, a 1

mL displacement block was added with another rubber septa (Figure A-1). FPAs were

returned to culture at 38.50C, 5% C02, 5% 02, ~90% N2, with humidified air.

Group Activation Pack Preparation and Handoff

When contacted by BioServe staff, FPAs were removed from culture and loaded

into the plunger apparatus. Plunger apparatuses were gassed with 5% C02, 5% 02,

~90% N2 for 30 seconds and sealed (Figure A-2). Plunger apparatuses were then

loaded into Group Activation Packs (GAPs; Figure A-3) and turned over to the BioServe

staff. BioServe had approximately 24 h pre-launch to perform a series of tests on all

FPAs and GAPs and loaded them into flight incubators which were maintained at 37C

(Figure A-4).

Launch, Fixation, and Recovery

Space shuttle Endeavour launched on November 14, 2008 at 1955 H or at

approximately 52 hpi. While in orbit, on Day 9 of culture or Day 16 of culture, a crew

member of STS-126 activated the GAP by mixing the fixative chamber with the culture

chamber. STS-126 returned to Earth on November 30, 2008 at 1625. FPAs were

received and embryos removed on December 2, 2008.

TUNEL and Hoescht 33342 Labeling

TUNEL was used to detect DNA fragmentation that is associated with the late

stages of apoptosis. The enzyme terminal deoxynucleotidyl transferase was used to

catalyze the transfer of a fluorescein isothiocyanate-conjugated dUTP nucleotide to the

free 3' hydroxyl group that is exposed after DNA cleavage. Embryos were washed four









times in 50 pL drops of 10 mM KPO4, pH 7.4 containing 0.9% (w/v) NaCI (PBS) and 1

mg/mL polyvinylpyrrolidone (PBS-PVP) by transferring from drop to drop. Embryos

were then permeabilized in groups of 30-50 in 500 pL PBS + 0.1% (v/v) Triton-x

(Sigma-Aldrich) for 15 min at room temperature. After permeabilization, embryos were

washed four times in 50 pL drops of PBS-PVP. Embryos cultured under standard

conditions were used as positive and negative controls for the TUNEL procedure.

Positive and negative controls were treated in 50 pL drops of RQ1 -RNase-free DNase

(50 U/mL; Promega, Madison, WI, USA) at 370C in the dark for 1 h. Positive controls

and experimental embryos were washed in PBS-PVP and incubated with 25 pL of

TUNEL reaction mixture (In Situ Cell Death Detection Kit, Fluorescein: Roche

Diagnostics Corporation, Indianapolis, IN, USA) (containing fluorescein- conjugated

dUTP and the enzyme terminal deoxynucleotidyl transferase) for 1 h at 370C in the

dark. Negative controls were incubated in the absence of terminal deoxynucleotidyl

transferase. Embryos were washed four times in PBS-PVP and incubated in a 25 pL

drop of Hoechst 33342 (1 pg/mL) for 15 min at room temperature. Embryos were

washed four times, mounted on a microscope slide using ProLong Gold Anti-Fade

mounting medium (Thermo Fisher Scientific Inc), and fluorescence was visualized using

a Zeiss Axioplan microscope (Zeiss, Gottingen, Germany) with a 20x objective and the

FITC, DAPI, and DIC filter sets. Digital images were acquired using the AxioVision

software and a high-resolution black and white AxioCam MRm digital camera (Zeiss).

Experimental Design

A total of 1200 embryos were used in this experiment. Eight FPAs or 600

embryos were kept in an incubator at 370C at Kennedy Space Center, Space Life

Science Laboratory as ground control (GROUND). Another 8 FPAs or 600 embryos









were loaded onto the space shuttle Endeavour (FLIGHT). Within each group of 8 FPAs,

3 FPAs were fixed with 4% (v/v) parafromaldehyde on Day 9 of culture, 3 FPAs were

fixed with 2% (v/v) gluteraldehyde on Day 9 of culture, and 2 FPAs were fixed with 2%

(v/v) gluteraldehyde on Day 16 of culture.

Scanning electron microscopy was to be performed by the USDA on blastocysts

recovered from embryos fixed with 2% (v/v) gluteraldehyde on Day 9 or Day 16 of

culture. Development along with apoptotic index (TUNEL) was assessed for recovered

embryos that were fixed in 4% paraformaldehyde on Day 9 of culture.

Statistical Analysis

Data were subjected to least-squares analysis of variance using the General

Linear Models procedure (GLM) with p-diff as means separation test. Binomial data

(cleaved embryos greater than six cells) was analyzed using a chi square with PROC

FREQ from the Statistical Analysis System (SAS for Linux, Release 9.2, SAS Institute

Inc., Cary, NC, USA).

Results

Of the 1200 embryos loaded (600 FLIGHT and 600 GROUND), 1067 were

recovered (547 FLIGHT and 520 GROUND). No blastocysts were obtained from either

group. Cleavage rate was not significantly different between FLIGHT (9.98%) and

GROUND (11.84%). Of those embryos that cleaved, the majority were at the 2-4 cell

stage (78% FLIGHT and 89% GROUND) (Table A-1), which would coincide with the

approximate time of development the embryos would have been at the time launch (52

hpi). The percent of cleaved embryos that were 26 cells (i.e., embryos that developed at

a time typically coincident with space flight) tended to be greater for FLIGHT (22% vs









11% GROUND) but differences were not significant (X2 = 2.4681; P=0.1162) (Table A-

2).

In addition to development data, embryos were analyzed for apoptotic index using

TUNEL. A total of 367 embryos were analyzed using TUNEL (189 FLIGHT and 178

GROUND). In addition, an external set of embryos were used as a positive and

negative controls for the TUNEL reaction. There was no evidence of TUNEL in FLIGHT

or GROUND embryos (Figure A-5).

Discussion

There was an inadequate amount of development in both FLIGHT and GROUND.

Initially the USDA was going to perfrom scanning electron microscopy of any

blastocysts recovered to examine morphological differences between FLIGHT and

GROUND but this was not done because no blastocyst were recovered. TUNEL

analysis to compare variations in apoptotic index was also performed. There were no

TUNEL positive blastomeres from the embryos recovered from this experiment. This is

not unexpected because all of the embryos recovered were 16-cells, embryos are

refractory to apoptosis (Krininger et al., 2002; Paula-Lopes and Hansen, 2002; Soto et

al., 2003; Brad et al., 2007; Jousan and Hansen, 2007; Carambula et al., 2009).

The lack of development is due to a combination of the culture conditions along

with the handling procedure required for these types of experiments. As their names

suggest, FPAs were designed for fluid processing and not as a culture environment.

Due to the tight regulation of materials that are allowed on board of the Space Shuttle,

they have been adapted to be used as a culture system. Besides not being designed

for embryo culture, FPAs are coated with a silicon compound (Sigmacote) to aid in the









insertion and removal of the rubber septa used in this system. We are unaware of the

effects, if any, this compound may have had on the embryos.

In the bovine in vitro production system, like other in vitro production systems,

embryos are cultured in groups in 10-50 pL volumes. The FPA is designed to use a

culture volume of 1 mL. To compensate for the larger volume, a 3-well insert was used,

where each well held a volume of ~45 pL. While the majority of the 3-well insert was

made from plastic, there was a metal piece and a screw as part of the assembly. The

plastic or metal parts of the 3-well insert could also conceivably affect embryonic

development.

Bovine embryos are also typically cultured in low oxygen at 38.5C (Soto et al.,

2003b). Individual plunger devices were gassed with a low oxygen mixture (5% CO2,

5% 02, ~90% N2), but the incubator was maintained at 37C. This could have a

negative effect on embryonic development. In addition, working with FPAs is a more

time consuming process compared to standard IVF culture systems. This fact, along

with the required quality control leak testing, kept the embryos at room temperature

longer than in a typical embryo culture system.

Our results are consistent with those experienced by Jung et al. (2009) using a

rotating culture system. There was too little development in control embryos to make

reliable conclusions about the effects of space flight. In conclusion, our initial attempt to

achieve development of bovine embryos in space was limited by inadequate culture

conditions and time to optimize these conditions before launch.











Day 9 Fixation Day 16 Fixation


-45 mm


1 mL
(3.4% Glutaraldehyde)
or
(6.8% Paraformaldehyde)












-55 mm


-45 mm

1 mL
(3.4% Glutaraldehyde)


(BBH7+BSA)


-55 mm


Rubber Septa


1 mL displacement block


3 well culture insert (25 embryos/45 pL/well)


IIIH Gas Exchange Insert



3 Well Insert

Thin Plastic wheel


Thick Plastic Wheel



0.025 pm Membrane


Thin metal wheel


Figure A-1.


Schematic drawing the the fluid processing apparatus (FPA). Two different FPA layouts were used to
determine the timing of fixation. FPAs to be fixed on Day 9 of culture a 1 mL plastic displacement bock was
added. FPA assembly consisted of rubber septa (dark gray), 3-well culture inserts, and a gas exchange insert
(yellow). 3-well culture inserts consisted of four pieces held together with a small screw. Pieces were
assembled as shown, holes for the inserts were aligned for loading, and then offset to prevent embryos from
falling out.


0
00

/0


00



10
(0
00


\




g






































Figure A-2.


Plunger apparatus. Each plunger contained a single FPA and were gassed
with 5% C02, 5% 02, ~90% N2 for 30 sec and sealed. Plungers are loaded
into the GAP and on Day 9 or Day 16 of culture plungers were depressed to
mix fixative with culture medium.


































Figure A-3.


Group activation pack (GAP). GAPs consisted of a plastic cylinder with two
aluminum lids. Eight FPAs were loaded per GAP. To activate fixative, a
crank was inserted on the top of the GAP and a metal plate was lowered
depressing the plunger apparatus, mixing fixative and culture medium.

































Figure A-4. Flight incubator. The flight incubator contained 9 GAPs. Incubator was
maintained at 370C.









Table A-1. Developmental distribution of embryos recovered from FLIGHT and GROUND.
Recovered Cleaved 2-cell 3-cell 4-cell 6-cell 8-cell 16-cell >16-cell

Flight 547 50 10 14 15 0 9 2 0

Ground 520 63 25 17 14 1 4 2 0


100









Table A-2. Comparison of embryonic development coincident with orbital flight.

Cleaved 26-cells X2 P-Value
Flight 50 11 2.4681 0.1162

Ground 63 7






































Figure A-5.


Representative images of TUNEL analysis. Images are merged and
pseudo colored with differential interfence contrast (DIC), Hoechst 33342
(blue), and TUNEL (green). Panels (A, C) are experimental embryos and
Panels (B, D) are control Embryos. A) 4-cell FLIGHT embryo, C) 2-cell and
uncleaved GROUND embryo, B) Positive control, D) Negative control.


102









LIST OF REFERENCES


Acehan D, Jiang X, Morgan DG, Heuser JE, Wang X, and Akey CW. 2002. Three-
dimensional structure of the apoptosome: implications for assembly, procaspase-9
binding, and activation. Mol Cell 9:423-32.

Adams JM, and Cory S. 1998. The Bcl-2 protein family: arbiters of cell survival. Science
281:1322-6.

al-Katanani YM, Webb DW, and Hansen PJ. 1999. Factors affecting seasonal variation
in 90-day nonreturn rate to first service in lactating Holstein cows in a hot climate. J
Dairy Sci 82:2611-6.

Amadio M, Scapagnini G, Laforenza U, Intrieri M, Romeo L, Govoni S, and Pascale A.
2008. Post-transcriptional regulation of HSP70 expression following oxidative stress
in SH-SY5Y cells: the potential involvement of the RNA-binding protein HuR. Curr
Pharm Des 14:2651-8.

Antonsson B, Montessuit S, Lauper S, Eskes R, and Martinou JC. 2000. Bax
oligomerization is required for channel-forming activity in liposomes and to trigger
cytochrome c release from mitochondria. Biochem J 345 Pt 2:271-8.

Aoki F, Worrad DM, and Schultz RM. 1997. Regulation of transcriptional activity during
the first and second cell cycles in the preimplantation mouse embryo. Dev Biol
181:296-307.

Aoki F, Hara KT, and Schultz RM. 2003. Acquisition of transcriptional competence in the
1-cell mouse embryo: requirement for recruitment of maternal mRNAs. Mol Reprod
Dev 64:270-4.

Arnoult D, Grodet A, Lee Y, Estaquier J, and Blackstone C. 2005a. Release of OPA1
during apoptosis participates in the rapid and complete release of cytochrome c and
subsequent mitochondrial fragmentation. J Biol Chem 280:35742-50.

Arnoult D, Rismanchi N, Grodet A, Roberts RG, Seeburg DP, Estaquier J, Sheng M,
and Blackstone C. 2005b. Bax/Bak-dependent release of DDP/TIMM8a promotes
Drpl-mediated mitochondrial fission and mitoptosis during programmed cell death.
Curr Biol 15:2112-8.

Ashen JB, and Goff LJ. 2000. Molecular and ecological evidence for species specificity
and coevolution in a group of marine algal-bacterial symbioses. Appl Environ
Microbiol 66:3024-30.

Ashkenazi A, and Dixit VM. 1998. Death Receptors: Signaling and Modulation. Science
281:1305-1308.


103









Badinga L, Collier RJ, Thatcher WW, and Wilcox CJ. 1985. Effects of climatic and
management factors on conception rate of dairy cattle in subtropical environment. J
Dairy Sci 68:78-85.

Bakhshi A, Jensen JP, Goldman P, Wright JJ, McBride OW, Epstein AL, and Korsmeyer
SJ. 1985. Cloning the chromosomal breakpoint of t(14;18) human lymphomas:
clustering around JH on chromosome 14 and near a transcriptional unit on 18. Cell
41:899-906.

Bao Q, and Shi Y. 2007. Apoptosome: a platform for the activation of initiator caspases.
Cell Death Differ 14:56-65.

Basu S, Bayoumy S, Zhang Y, Lozano J, and Kolesnick R. 1998. BAD enables
ceramide to signal apoptosis via Ras and Raf-1. J Biol Chem 273:30419-26.

Basu S, and Kolesnick R. 1998. Stress signals for apoptosis: ceramide and c-Jun
kinase. Oncogene 17:3277-85.

Belmokhtar CA, Hillion J, and Segal-Bendirdjian E. 2001. Staurosporine induces
apoptosis through both caspase-dependent and caspase-independent mechanisms.
Oncogene 20:3354-62.

Bernardi P, and Azzone GF. 1981. Cytochrome c as an electron shuttle between the
outer and inner mitochondrial membranes. J Biol Chem 256:7187-92.

Bernardi P. 1999. Mitochondrial transport of cations: channels, exchangers, and
permeability transition. Physiol Rev 79:1127-55.

Billen LP, Kokoski CL, Lovell JF, Leber B, and Andrews DW. 2008. Bcl-XL inhibits
membrane permeabilization by competing with Bax. PLoS Biol 6:e147.

Bingle CD, Craig RW, Swales BM, Singleton V, Zhou P, and Whyte MK. 2000. Exon
skipping in Mcl-1 results in a bcl-2 homology domain 3 only gene product that
promotes cell death. J Biol Chem 275:22136-46.

Biswas SC, Shi Y, Sproul A, and Greene LA. 2007. Pro-apoptotic Bim induction in
response to nerve growth factor deprivation requires simultaneous activation of three
different death signaling pathways. J Biol Chem 282:29368-74.

Blachly-Dyson E, and Forte M. 2001. VDAC channels. IUBMB Life 52:113-8.

Block J, Wrenzycki C, Niemann H, Herrmann D, and Hansen PJ. 2008. Effects of
insulin-like growth factor-1 on cellular and molecular characteristics of bovine
blastocysts produced in vitro. Mol Reprod Dev 75:895-903.

Boatright KM, Renatus M, Scott FL, Sperandio S, Shin H, Pedersen IM, Ricci JE, Edris
WA, Sutherlin DP, Green DR, and Salvesen GS. 2003. A unified model for apical
caspase activation. Mol Cell 11:529-41.


104









Boise LH, Gonzalez-Garcia M, Postema CE, Ding L, Lindsten T, Turka LA, Mao X,
NuQez G, and Thompson CB. 1993. bcl-x, a bcl-2-related gene that functions as a
dominant regulator of apoptotic cell death. Cell 74:597-608.

Brad AM, Hendricks KE, and Hansen PJ. 2007. The block to apoptosis in bovine two-
cell embryos involves inhibition of caspase-9 activation and caspase-mediated DNA
damage. Reproduction 134:789-97.

Braude P, Bolton V, and Moore S. 1988. Human gene expression first occurs between
the four- and eight-cell stages of preimplantation development. Nature 332:459-61.

Brinsko SP, Ball BA, Ignotz GG, Thomas PG, Currie WB, and Ellington JE. 1995.
Initiation of transcription and nucleologenesis in equine embryos. Mol Reprod Dev
42:298-302.

Byrne AT, Southgate J, Brison DR, and Leese HJ. 1999. Analysis of apoptosis in the
preimplantation bovine embryo using TUNEL. J Reprod Fertil 117:97-105.

Calder MD, Madan P, and Watson AJ. 2008. Bovine oocytes and early embryos
express Staufen and ELAVL RNA-binding proteins. Zygote 16:161-8.

Carambula SF, Oliveira LJ, and Hansen PJ. 2009. Repression of induced apoptosis in
the 2-cell bovine embryo involves DNA methylation and histone deacetylation.
Biochem Biophys Res 388:418-21.

Cartron P, Gallenne T, Bougras G, Gautier F, Manero F, Vusio P, Meflah K, Vallette
FM, and Juin P. 2004. The first alpha helix of Bax plays a necessary role in its ligand-
induced activation by the BH3-only proteins Bid and PUMA. Mol Cell 16:807-18.

Cavestany D, el-Wishy aB, and Foote RH. 1985. Effect of season and high
environmental temperature on fertility of Holstein cattle. J Dairy Sci 68:1471-8.

Chalmers CJ, Balmanno K, Hadfield K, Ley R, and Cook SJ. 2003. Thrombin inhibits
Bim (Bcl-2-interacting mediator of cell death) expression and prevents serum-
withdrawal-induced apoptosis via protease-activated receptor 1. Biochem J 375:99-
109.

Chang BS, Minn AJ, Muchmore SW, Fesik SW, and Thompson CB. 1997. Identification
of a novel regulatory domain in Bcl-X(L) and Bcl-2. EMBO J 16:968-77.

Chao DT, and Korsmeyer SJ. 1998. BCL-2 family: regulators of cell death. Annu Rev
Immunol 16:395-419.

Chao JR et al. 1998. mcl-1 is an immediate-early gene activated by the granulocyte-
macrophage colony-stimulating factor (GM-CSF) signaling pathway and is one
component of the GM-CSF viability response. Mol Cell Biol 18:4883-98.


105









Cheng EH, Sheiko TV, Fisher JK, Craigen WJ, and Korsmeyer SJ. 2003. VDAC2
inhibits BAK activation and mitochondrial apoptosis. Science 301:513-7.

Chittenden T, Flemington C, Houghton AB, Ebb RG, Gallo GJ, Elangovan B,
Chinnadurai G, and Lutz RJ. 1995. A conserved domain in Bak, distinct from BH1
and BH2, mediates cell death and protein binding functions. EMBO J 14:5589-96.

Chung HS, Park SM, Choi EK, Park H, Griffin RJ, Song CW, and Park H. 2003. Role of
sphingomyelin-MAPKs pathway in heat-induced apoptosis. Exp Mol Med 35:181-8.

Cipolat S, Martins De Brito O, Dal Zilio B, and Scorrano L. 2004. OPA1 requires
mitofusin 1 to promote mitochondrial fusion. Proc Natl Acad Sci U S A 101:15927-32.

Cleary ML, and Sklar J. 1985. Nucleotide sequence of a t(14;18) chromosomal
breakpoint in follicular lymphoma and demonstration of a breakpoint-cluster region
near a transcriptionally active locus on chromosome 18. Proc Natl Acad Sci U S A
82:7439-43.

Cohen GM. 1997. Caspases: the executioners of apoptosis. Biochem J 326 ( Pt 1:1-16.

Crosby IM, Gandolfi F, and Moor RM. 1988. Control of protein synthesis during early
cleavage of sheep embryos. J Reprod Fertil 82:769-75.

C6te J, and Ruiz-Carrillo A. 1993. Primers for mitochondrial DNA replication generated
by endonuclease G. Science 261:765-9.

Dahal GR, Karki P, Thapa A, Shahnawaz M, Shin SY, Lee JS, Cho B, and Park I. 2007.
Caspase-2 cleaves DNA fragmentation factor (DFF45)/inhibitor of caspase-activated
DNase (ICAD). Arch Biochem Biophys 468:134-9.

Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, and Greenberg ME. 1997. Akt
phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery.
Cell 91:231-41.

de Bruyne E, Bos TJ, Schuit F, Van Valckenborgh E, Menu E, Thorrez L, Atadja P,
Jernberg-Wiklund H, and Vanderkerken K. 2010. IGF-1 suppresses Bim expression
in multiple myeloma via epigenetic and posttranslational mechanisms. Blood
115:2430-40.

de Castro e Paula LA, and Hansen PJ. 2008. Ceramide inhibits development and
cytokinesis and induces apoptosis in preimplantation bovine embryos. Mol Reprod
Dev 75:1063-70.

Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, and Reik W. 2001.
Conservation of methylation reprogramming in mammalian development: aberrant
reprogramming in cloned embryos. Proc Natl Acad Sci U S A 98:13734-8.


106









Desagher S, Osen-Sand A, Nichols A, Eskes R, Montessuit S, Lauper S, Maundrell K,
Antonsson B, and Martinou JC. 1999. Bid-induced conformational change of Bax is
responsible for mitochondrial cytochrome c release during apoptosis. J Cell Biol
144:891-901.

Dewson G, Kratina T, Sim HW, Puthalakath H, Adams JM, Colman PM, and Kluck RM.
2008. To trigger apoptosis, Bak exposes its BH3 domain and homodimerizes via
BH3:groove interactions. Mol Cell 30:369-80.

Ding W, and Yin X. 2004. Dissection of the multiple mechanisms of TNF-alpha-induced
apoptosis in liver injury. J Cell Mol Med 8:445-54.

Dournon C, Durand D, Tankosic C, Membre H, Gualandris-Parisot L, and Bautz A.
2001. Effects of microgravity on the larval development, metamorphosis and
reproduction of the urodele amphibian Pleurodeles waltl. Dev Growth Differ 43:315-
26.

Du C, Fang M, Li Y, Li L, and Wang X. 2000. Smac, a mitochondrial protein that
promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition.
Cell 102:33-42.

Durrieu F, Samejima K, Fortune JM, Kandels-Lewis S, Osheroff N, and Earnshaw WC.
DNA topoisomerase Ilalpha interacts with CAD nuclease and is involved in chromatin
condensation during apoptotic execution. Curr Biol 10:923-6.

Edwards JL, and Hansen PJ. 1997. Differential responses of bovine oocytes and
preimplantation embryos to heat shock. Mol Reprod Dev 46:138-45.

Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, and Nagata S. 1998. A
caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor
ICAD. Nature 391:43-50.

Eskes R, Desagher S, Antonsson B, and Martinou JC. 2000. Bid induces the
oligomerization and insertion of Bax into the outer mitochondrial membrane. Mol Cell
Biol 20:929-35.

Exley GE, Tang C, McElhinny AS, and Warner CM. 1999. Expression of caspase and
BCL-2 apoptotic family members in mouse preimplantation embryos. Biol Reprod
61:231-9.

Fabian D, Makarevich AV, Chrenek P, Bukovska A, and Koppel J. 2007. Chronological
appearance of spontaneous and induced apoptosis during preimplantation
development of rabbit and mouse embryos. Theriogenology 68:1271-81.

Fang G, Chang BS, Kim CN, Perkins C, Thompson CB, and Bhalla KN. 1998. "Loop"
domain is necessary for taxol-induced mobility shift and phosphorylation of Bcl-2 as
well as for inhibiting taxol-induced cytosolic accumulation of cytochrome c and
apoptosis. Cancer Res 58:3202-8.


107









Feugang J, Van Langendonckt A, Sayoud H, Rees J, Pampfer S, Moens A, Dessy F,
and Donnay I. 2003. Effect of prooxidant agents added at the morula/blastocyst
stage on bovine embryo development, cell death and glutathione content. Zygote
11:107-118.

Feugang J. 2004. Addition of 3-mercaptoethanol or Trolox at the morula/blastocyst
stage improves the quality of bovine blastocysts and prevents induction of apoptosis
and degeneration by prooxidant agents. Theriogenology 61:71-90.

Fissore RA, Kurokawa M, Knott J, Zhang M, and Smyth J. 2002. Mechanisms
underlying oocyte activation and postovulatory ageing. Reproduction 124:745-54.

Flach G, Johnson MH, Braude PR, Taylor RA, and Bolton VN. 1982. The transition from
maternal to embryonic control in the 2-cell mouse embryo. EMBO J 1:681-6.

Friedberg EC. 2003. DNA damage and repair. Nature 421:436-40.

Fu NY, Sukumaran SK, Kerk SY, and Yu VC. 2009. Baxbeta: a constitutively active
human Bax isoform that is under tight regulatory control by the proteasomal
degradation mechanism. Mol Cell 33:15-29.

Gaboyard S, Blanchard M, Travo C, Viso M, Sans A, and Lehouelleur J. 2002.
Weightlessness affects cytoskeleton of rat utricular hair cells during maturation in
vitro. Neuroreport 13:2139-42.

Ganesan V, Perera MN, Colombini D, Datskovskiy D, Chadha K, and Colombini M.
2010. Ceramide and activated Bax act synergistically to permeabilize the
mitochondrial outer membrane. Apoptosis 15:553-62.

Ganesan V, and Colombini M. 2010. Regulation of ceramide channels by Bcl-2 family
proteins. FEBS Lett.

Gao W, Pu Y, Luo KQ, and Chang DC. 2001. Temporal relationship between
cytochrome c release and mitochondrial swelling during UV-induced apoptosis in
living HeLa cells. J Cell Sci 114:2855-62.

Garland JM, and Rudin C. 1998. Cytochrome c induces caspase-dependent apoptosis
in intact hematopoietic cells and overrides apoptosis suppression mediated by bcl-2,
growth factor signaling, MAP-kinase-kinase, and malignant change. Blood 92:1235-
46.

Garrido C, Gurbuxani S, Ravagnan L, and Kroemer G. 2001. Heat shock proteins:
endogenous modulators of apoptotic cell death. Biochem Biophys Res 286:433-42.

Gavrieli Y, Sherman Y, and Ben-Sasson SA. 1992. Identification of programmed cell
death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119:493-
501.


108









Gilbert I, Scantland S, Sylvestre E, Gravel C, Laflamme I, Sirard M, and Robert C. 2009.
The dynamics of gene products fluctuation during bovine pre-hatching development.
Mol Reprod Dev 76:762-72.

Gjorret JO, Knijn HM, Dieleman SJ, Avery B, Larsson L, and Maddox-Hyttel P. 2003.
Chronology of apoptosis in bovine embryos produced in vivo and in vitro. Biol Reprod
69:1193-200.

Gjorret JO, Fabian D, Avery B, and Maddox-Hyttel P. 2007. Active caspase-3 and
ultrastructural evidence of apoptosis in spontaneous and induced cell death in bovine
in vitro produced pre-implantation embryos. Mol Reprod Dev 74:961-71.

Goldstein JC, Waterhouse NJ, Juin P, Evan GI, and Green DR. 2000. The coordinate
release of cytochrome c during apoptosis is rapid, complete and kinetically invariant.
Nat Cell Biol 2:156-62.

Goping IS, Gross A, Lavoie JN, Nguyen M, Jemmerson R, Roth K, Korsmeyer SJ, and
Shore GC. 1998. Regulated targeting of BAX to mitochondria. J Cell Biol 143:207-15.

Gordo AC, Rodrigues P, Kurokawa M, Jellerette T, Exley GE, Warner C, and Fissore R.
2002. Intracellular calcium oscillations signal apoptosis rather than activation in in
vitro aged mouse eggs. Biol Reprod 66:1828-37.

Green DR, and Kroemer G. 2004. The pathophysiology of mitochondrial cell death.
Science 305:626-9.

Griparic L, van Der Wel NN, Orozco IJ, Peters PJ, and van Der Bliek AM. 2004. Loss of
the intermembrane space protein Mgml/OPA1 induces swelling and localized
constrictions along the lengths of mitochondria. J Biol Chem 279:18792-8.

Gualandris-Parisot L, Husson D, Bautz A, Durand D, Kan P, Aimar C, Membre H,
Duprat A, and Dournon C. 2002. Effects of space environment on embryonic growth
up to hatching of salamander eggs fertilized and developed during orbital flights. Biol
Sci Space 16:3-11.

Guo B, Godzik A, and Reed JC. 2001. Bcl-G, a novel pro-apoptotic member of the Bcl-2
family. J Biol Chem 276:2780-5.

Haldar S, Basu A, and Croce CM. 1997. Bcl2 is the guardian of microtubule integrity.
Cancer Res 57:229-33.

Hamner S, Arumae U, Li-Ying Y, Sun YF, Saarma M, and Lindholm D. 2001. Functional
characterization of two splice variants of rat bad and their interaction with Bcl-w in
sympathetic neurons. Mol Cell Neurosci 17:97-106.

Hanada M, Aime-Sempe C, Sato T, and Reed JC. 1995. Structure-function analysis of
Bcl-2 protein. Identification of conserved domains important for homodimerization
with Bcl-2 and heterodimerization with Bax. J Biol Chem 270:11962-9.


109









Handyside AH, and Hunter S. 1986. Cell division and death in the mouse blastocyst
before implantation. Rouxs Arch Dev Biol 195:519026.

Hanson PI, and Whiteheart SW. 2005. AAA+ proteins: have engine, will work. Nat Rev
Mol Cell Biol 6:519-29.

Harada H, Becknell B, Wilm M, Mann M, Huang LJ, Taylor SS, Scott JD, and
Korsmeyer SJ. 1999. Phosphorylation and inactivation of BAD by mitochondria-
anchored protein kinase A. Mol Cell 3:413-22.

Hardwick JM. 1998. Viral interference with apoptosis. Semin Cell Dev Biol 9:339-49.

Hardy K, Winston RM, and Handyside AH. 1993. Binucleate blastomeres in
preimplantation human embryos in vitro: failure of cytokinesis during early cleavage.
J Reprod Fertil 98:549-58.

Hardy K. 1997. Cell death in the mammalian blastocyst. Mol Hum Reprod 3:919-25.

Hardy K. 1999. Apoptosis in the human embryo. Rev Reprod 4:125-34.

Herrler A, Krusche CA, and Beier HM. 1998. Insulin and insulin-like growth factor-I
promote rabbit blastocyst development and prevent apoptosis. Biol Reprod 59:1302-
10.

Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL, and Korsmeyer SJ. 1993. Bcl-2
functions in an antioxidant pathway to prevent apoptosis. Cell 75:241-51.

Hoffert KA, Anderson GB, Wildt DE, and Roth TL. 1997. Transition from maternal to
embryonic control of development in IVM/IVF domestic cat embryos. Mol Reprod Dev
48:208-15.

Holopainen JM, Lemmich J, Richter F, Mouritsen OG, Rapp G, and Kinnunen PK. 2000.
Dimyristoylphosphatidylcholine/C16:0-ceramide binary liposomes studied by
differential scanning calorimetry and wide- and small-angle x-ray scattering. Biophys
J 78:2459-69.


Hong SJ, Dawson TM, and Dawson VL. 2004. Nuclear and mitochondrial conversations
in cell death: PARP-1 and AIF signaling. Trends Pharmacol Sci 25:259-64.

Hsu SY, Kaipia A, McGee E, Lomeli M, and Hsueh AJ. 1997. Bok is a pro-apoptotic Bcl-
2 protein with restricted expression in reproductive tissues and heterodimerizes with
selective anti-apoptotic Bcl-2 family members. Proc Natl Acad Sci U S A 94:12401-6.

Hsu SY, Lin P, and Hsueh AJ. 1998. BOD (Bcl-2-related ovarian death gene) is an
ovarian BH3 domain-containing proapoptotic Bcl-2 protein capable of dimerization
with diverse antiapoptotic Bcl-2 members. Mol Endocrinol 12:1432-40.


110









Hu SI, Carozza M, Klein M, Nantermet P, Luk D, and Crowl RM. 1998. Human HtrA, an
evolutionarily conserved serine protease identified as a differentially expressed gene
product in osteoarthritic cartilage. J Biol Chem 273:34406-12.

Huang DC, Adams JM, and Cory S. 1998. The conserved N-terminal BH4 domain of
Bcl-2 homologues is essential for inhibition of apoptosis and interaction with CED-4.
EMBO J 17:1029-39.

Huang Q, Petros AM, Virgin HW, Fesik SW, and Olejniczak ET. 2002. Solution structure
of a Bcl-2 homolog from Kaposi sarcoma virus. Proc Natl Acad Sci U S A 99:3428-
33.

Hunter JJ, Bond BL, and Parslow TG. 1996. Functional dissection of the human Bc12
protein: sequence requirements for inhibition of apoptosis. Mol Cell Biol 16:877-83.

Ihrlund LS, Hernlund E, Viktorsson K, Panaretakis T, Barna G, Sabapathy K, Linder S,
and Shoshan MC. 2006. Two distinct steps of Bak regulation during apoptotic stress
signaling: different roles of MEKK1 and JNK1. Exp Cell Res 312:1581-9.

Ijiri K. 1995. Fish mating experiment in space--what it aimed at and how it was
prepared. Biol Sci Space 9:3-16.

Ito T, Deng X, Carr B, and May WS. 1997. Bcl-2 phosphorylation required for anti-
apoptosis function. J Biol Chem 272:11671-3.

Jones JA, Riggs PK, Yang TC, Pedemonte CH, Clarke MS, Feeback DL, and Au WW.
2007. Ionizing radiation-induced bioeffects in space and strategies to reduce cellular
injury and carcinogenesis. Aviat Space Enbiron Med 78:A67-78.

Jousan FD, and Hansen PJ. 2007. Insulin-like growth factor-I promotes resistance of
bovine preimplantation embryos to heat shock through actions independent of its
anti-apoptotic actions requiring P13K signaling. Mol Reprod Dev 74:189-96.

Joza N, Pospisilik JA, Hangen E, Hanada T, Modjtahedi N, Penninger JM, and Kroemer
G. 2009. AIF: not just an apoptosis-inducing factor. Ann N Y Acad Sci 1171:2-11.

Jung S, Bowers SD, and Willard ST. 2009. Simulated Microgravity Influences Bovine
Oocyte in vitro Fertilization and Preimplantation Embryo Development. J Anim Vet
Adv 8:1807-1814.

Jurisicova A, Varmuza S, and Casper RF. 1996. Programmed cell death and human
embryo fragmentation. Mol Hum Reprod 2:93-8.

Jurisicova A, Latham KE, Casper RF, and Varmuza SL. 1998. Expression and
regulation of genes associated with cell death during murine preimplantation embryo
development. Mol Reprod Dev 51:243-53.


111









Kacena MA, Todd P, and Landis WJ. 2003. Osteoblasts subjected to spaceflight and
simulated space shuttle launch conditions. In Vitro Cell Dev Biol 39:454-9.

Kaiser N, and Edelman IS. 1977. Calcium dependence of glucocorticoid-induced
lymphocytolysis. Proc Natl Acad Sci U S A 74:638-42.

Kalinowska M, Garncarz W, Pietrowska M, Garrard WT, and Widlak P. 2005.
Regulation of the human apoptotic DNase/RNase endonuclease G: involvement of
Hsp70 and ATP. Apoptosis 10:821-30.

Karbowski M, Lee Y, Gaume B, Jeong S, Frank S, Nechushtan A, Santel A, Fuller M,
Smith CL, and Youle RJ. 2002. Spatial and temporal association of Bax with
mitochondrial fission sites, Drp1, and Mfn2 during apoptosis. J Cell Biol 159:931-8.

Kelekar A, Chang BS, Harlan JE, Fesik SW, and Thompson CB. 1997. Bad is a BH3
domain-containing protein that forms an inactivating dimer with Bcl-XL. Mol Cell Biol
17:7040-6.

Kerr JF, Wyllie AH, and Currie AR. 1972. Apoptosis: a basic biological phenomenon
with wide-ranging implications in tissue kinetics. Br J Cancer 26:239-57.

Kim H, Du F, Fang M, and Wang X. 2005. Formation of apoptosome is initiated by
cytochrome c-induced dATP hydrolysis and subsequent nucleotide exchange on
Apaf-1. Proc Natl Acad Sci U S A 102:17545-50.

Kim H, Tu H, Ren D, Takeuchi O, Jeffers JR, Zambetti GP, Hsieh JJ, and Cheng EH.
2009. Stepwise activation of BAX and BAK by tBID, BIM, and PUMA initiates
mitochondrial apoptosis. Mol Cell 36:487-99.

Knijn HM, Wrenzycki C, Hendriksen PJ, Vos PL, Zeinstra EC, van Der Weijden GC,
Niemann H, and Dieleman SJ. 2005. In vitro and in vivo culture effects on mRNA
expression of genes involved in metabolism and apoptosis in bovine embryos.
Reprod Fertil Dev 17:775-84.

Ko J, Lee M, Cho S, Cho J, Lee B, Koh JS, Lee S, Shim Y, and Kim C. 2003. Bfl-1S, a
novel alternative splice variant of Bfl-1, localizes in the nucleus via its C-terminus and
prevents cell death. Oncogene 22:2457-65.

Kojima Y, Sasaki S, Kubota Y, Ikeuchi T, Hayashi Y, and Kohri K. 2000. Effects of
simulated microgravity on mammalian fertilization and preimplantation embryonic
development in vitro. Fertil Steril 74:1142-7.

Kolesnick RN. 1991. Sphingomyelin and derivatives as cellular signals. Prog Lipid Res
30:1-38.

Kolliputi N, and Waxman AB. 2009. IL-6 cytoprotection in hyperoxic acute lung injury
occurs via PI3K/Akt-mediated Bax phosphorylation. Am J Physiol Lung Cell Mol
Physiol 297:L6-16.


112









Kopecny V, Flechon JE, Camous S, and Fulka J. 1989. Nucleologenesis and the onset
of transcription in the eight-cell bovine embryo: fine-structural autoradiographic study.
Mol Reprod Dev 1:79-90.

Krininger CE, Stephens SH, and Hansen PJ. 2002. Developmental changes in inhibitory
effects of arsenic and heat shock on growth of pre-implantation bovine embryos. Mol
Reprod Dev 63:335-40.

Kroesen B, Jacobs S, Pettus BJ, Sietsma H, Kok JW, Hannun YA, and de Leij LF. 2003.
BcR-induced apoptosis involves differential regulation of C16 and C24-ceramide
formation and sphingolipid-dependent activation of the proteasome. J Biol Chem
278:14723-31.


Kumarswamy R, and Chandna S. 2009. Putative partners in Bax mediated cytochrome-
c release: ANT, CypD, VDAC or none of them? Mitochondrion 9:1-8.

Lam D, Dickens D, Reid EB, Loh SH, Moisoi N, and Martins LM. 2009. MAP4K3
modulates cell death via the post-transcriptional regulation of BH3-only proteins. Proc
Natl Acad Sci U S A 106:11978-83.

Lechardeur D, Drzymala L, Sharma M, Zylka D, Kinach R, Pacia J, Hicks C, Usmani N,
Rommens JM, and Lukacs GL. 2000. Determinants of the nuclear localization of the
heterodimeric DNA fragmentation factor (ICAD/CAD). J Cell Biol 150:321-34.

Lee M, Hung W, Chen F, and Huang HW. 2008. Mechanism and kinetics of pore
formation in membranes by water-soluble amphipathic peptides. Proceedings of the
National Academy of Sciences of the United States of America 105:5087-92.

Lemmon Ma, Flanagan JM, Hunt JF, Adair BD, Bormann BJ, Dempsey CE, and
Engelman DM. 1992a. Glycophorin A dimerization is driven by specific interactions
between transmembrane alpha-helices. J Biol Chem 267:7683-9.

Lemmon Ma, Flanagan JM, Treutlein HR, Zhang J, and Engelman DM. 1992b.
Sequence specificity in the dimerization of transmembrane alpha-helices.
Biochemistry 31:12719-25.

Letai A, Bassik MC, Walensky LD, Sorcinelli MD, Weiler S, and Korsmeyer SJ. 2002.
Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as
prototype cancer therapeutics. Cancer Cell 2:183-92.

Lewis ML, Reynolds JL, Cubano LA, Hatton JP, Lawless BD, and Piepmeier EH. 1998.
Spaceflight alters microtubules and increases apoptosis in human lymphocytes
(Jurkat). FASEB J 12:1007-18.

Li H, Zhu H, Xu CJ, and Yuan J. 1998. Cleavage of BID by caspase 8 mediates the
mitochondrial damage in the Fas pathway of apoptosis. Cell 94:491-501.


113









Li J, Viallet J, and Haura EB. 2008. A small molecule pan-Bcl-2 family inhibitor, GX15-
070, induces apoptosis and enhances cisplatin-induced apoptosis in non-small cell
lung cancer cells. Cancer Chemother Pharmacol 61:525-34.

Li LY, Luo X, and Wang X. 2001. Endonuclease G is an apoptotic DNase when
released from mitochondria. Nature 412:95-9.

Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, and Wang X.
1997. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex
initiates an apoptotic protease cascade. Cell 91:479-89.

Liu J, Chandra D, Tang S, Chopra D, and Tang DG. 2002. Identification and
characterization of Bimgamma, a novel proapoptotic BH3-only splice variant of Bim.
Cancer Res 62:2976-81.

Liu X, Kim CN, Yang J, Jemmerson R, and Wang X. 1996. Induction of apoptotic
program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86:147-
57.

Liu X, Zou H, Slaughter C, and Wang X. 1997. DFF, a heterodimeric protein that
functions downstream of caspase-3 to trigger DNA fragmentation during apoptosis.
Cell 89:175-84.

Liu X, Li P, Widlak P, Zou H, Luo X, Garrard WT, and Wang X. 1998. The 40-kDa
subunit of DNA fragmentation factor induces DNA fragmentation and chromatin
condensation during apoptosis. Proc Natl Acad Sci U S A 95:8461-6.

Liu X, Zou H, Widlak P, Garrard W, and Wang X. 1999. Activation of the apoptotic
endonuclease DFF40 (caspase-activated DNase or nuclease). Oligomerization and
direct interaction with histone H1. J Biol Chem 274:13836-40.

Long CR, Dobrinsky JR, Garrett WM, and Johnson LA. 1998. Dual labeling of the
cytoskeleton and DNA strand breaks in porcine embryos produced in vivo and in
vitro. Mol Reprod Dev 51:59-65.

Loskutoff N, Johnson W, and Betteridge K. 1993. The developmental competence of
bovine embryos with reduced cell numbers. Theriogenology 39:95-107.

Loureiro B, Brad AM, and Hansen PJ. 2007. Heat shock and tumor necrosis factor-
alpha induce apoptosis in bovine preimplantation embryos through a caspase-9-
dependent mechanism. Reproduction 133:1129-37.

Lovell JF, Billen LP, Bindner S, Shamas-Din A, Fradin C, Leber B, and Andrews DW.
2008. Membrane binding by tBid initiates an ordered series of events culminating in
membrane permeabilization by Bax. Cell 135:1074-84.

Lucken-Ardjomande S, and Martinou J. 2005. Regulation of Bcl-2 proteins and of the
permeability of the outer mitochondrial membrane. C R Biol 328:616-31.


114









MacFarlane M. 2003. TRAIL-induced signalling and apoptosis. Toxicol Lett 139:89-97.

Marani M, Tenev T, Hancock D, Downward J, and Lemoine NR. 2002. Identification of
novel isoforms of the BH3 domain protein Bim which directly activate Bax to trigger
apoptosis. Mol Cell Biol 22:3577-89.

Matwee C, Betts DH, and King WA. 2000. Apoptosis in the early bovine embryo. Zygote
8:57-68.

Maundrell K, Antonsson B, Magnenat E, Camps M, Muda M, Chabert C, Gillieron C,
Boschert U, Vial-Knecht E, Martinou JC, and Arkinstall S. 1997. Bcl-2 undergoes
phosphorylation by c-Jun N-terminal kinase/stress-activated protein kinases in the
presence of the constitutively active GTP-binding protein Racl. J Biol Chem
272:25238-42.

McConkey DJ, Nicotera P, Hartzell P, Bellomo G, Wyllie AH, and Orrenius S. 1989.
Glucocorticoids activate a suicide process in thymocytes through an elevation of
cytosolic Ca2+ concentration. Arch Biochem Biophys 269:365-70.

Memili E, Dominko T, and First NL. 1998. Onset of transcription in bovine oocytes and
preimplantation embryos. Mol Reprod Dev 51:36-41.

Metcalfe AD, Hunter HR, Bloor DJ, Lieberman BA, Picton HM, Leese HJ, Kimber SJ,
and Brison DR. 2004. Expression of 11 members of the BCL-2 family of apoptosis
regulatory molecules during human preimplantation embryo development and
fragmentation. Mol Reprod Dev 68:35-50.

Modjtahedi N, Giordanetto F, Madeo F, and Kroemer G. 2006. Apoptosis-inducing
factor: vital and lethal. Trends Cell Biol 16:264-72.

Morita Y, Perez GI, Maravei DV, Tilly KI, and Tilly JL. 1999. Targeted expression of Bcl-
2 in mouse oocytes inhibits ovarian follicle atresia and prevents spontaneous and
chemotherapy-induced oocyte apoptosis in vitro. Mol Endocrinol 13:841-50.

Morita Y, and Tilly JL. 1999. Oocyte apoptosis: like sand through an hourglass. Dev Biol
213:1-17.

Moss JI, Pontes E, and Hansen PJ. 2009. Insulin-like growth factor-1 protects
preimplantation embryos from anti-developmental actions of menadione. Arch Toxicol
83:1001-7.

Moulin M, Carpentier S, Levade T, and Arrigo A. 2007. Potential roles of membrane
fluidity and ceramide in hyperthermia and alcohol stimulation of TRAIL apoptosis.
Apoptosis 12:1703-20.

Muchmore SW et al. 1996. X-ray and NMR structure of human Bcl-xL, an inhibitor of
programmed cell death. Nature 381:335-41.


115









Muzio M, Stockwell BR, Stennicke HR, Salvesen GS, and Dixit VM. 1998. An induced
proximity model for caspase-8 activation. J Biol Chem 273:2926-30.

Nagata S. 1997. Apoptosis by death factor. Cell 88:355-65.

Nagata S. 1999. Fas ligand-induced apoptosis. Annu Rev Genet 33:29-55.

Nakano K, and Vousden KH. 2001. PUMA, a novel proapoptotic gene, is induced by
p53. Mol Cell 7:683-94.

Nechushtan A, Smith CL, Hsu YT, and Youle RJ. 1999. Conformation of the Bax C-
terminus regulates subcellular location and cell death. EMBO J 18:2330-41.

Nicolier M, Decrion-Barthod A, Launay S, Pretet J, and Mougin C. 2009. Spatiotemporal
activation of caspase-dependent and -independent pathways in staurosporine-
induced apoptosis of p53wt and p53mt human cervical carcinoma cells. Biol Cell
101:455-67.

NuQez G, London L, Hockenbery D, Alexander M, McKearn JP, and Korsmeyer SJ.
1990. Deregulated Bcl-2 gene expression selectively prolongs survival of growth
factor-deprived hemopoietic cell lines. J Immunol 144:3602-10.

O'Connor L, Strasser A, O'Reilly LA, Hausmann G, Adams JM, Cory S, and Huang DC.
1998. Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J
17:384-95.

Oberhammer F, Wilson JW, Dive C, Morris ID, Hickman JA, Wakeling AE, Walker PR,
and Sikorska M. 1993. Apoptotic death in epithelial cells: cleavage of DNA to 300
and/or 50 kb fragments prior to or in the absence of internucleosomal fragmentation.
EMBO J 12:3679-84.

Oda E. 2000. Noxa, a BH3-Only Member of the Bcl-2 Family and Candidate Mediator of
p53-Induced Apoptosis. Science 288:1053-1058.

Olichon A, Baricault L, Gas N, Guillou E, Valette A, Belenguer P, and Lenaers G. 2003.
Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity,
leading to cytochrome c release and apoptosis. J Biol Chem 278:7743-6.

Otera H, Ohsakaya S, Nagaura Z, Ishihara N, and Mihara K. 2005. Export of
mitochondrial AIF in response to proapoptotic stimuli depends on processing at the
intermembrane space. EMBO J 24:1375-86.

Parchment RE. 1993. The implications of a unified theory of programmed cell death,
polyamines, oxyradicals and histogenesis in the embryo. Int J Dev Biol 37:75-83.

Park JS, Jeong YS, Shin ST, Lee K, and Kang Y. 2007. Dynamic DNA methylation
reprogramming: active demethylation and immediate remethylation in the male
pronucleus of bovine zygotes. Dev Dyn 236:2523-33.


116









Park SY, Kim EY, Jeon K, Cui X, Lee WD, Kim N, Park SP, and Lim JH. 2007. Survivin
acts as anti-apoptotic factor during the development of bovine pre-implantation
embryos. Mol Reprod Dev 74:582-90.

Parker MW, and Pattus F. 1993. Rendering a membrane protein soluble in water: a
common packing motif in bacterial protein toxins. Trends Biochem Sci 18:391-5.

Parone Pa, James DI, Da Cruz S, Mattenberger Y, Donze O, Barja F, and Martinou J.
2006. Inhibiting the mitochondrial fission machinery does not prevent Bax/Bak-
dependent apoptosis. Mol Cell Biol 26:7397-408.

Parra V, Eisner V, Chiong M, Criollo A, Moraga F, Garcia A, Hartel S, Jaimovich E,
Zorzano A, Hidalgo C, and Lavandero S. 2008. Changes in mitochondrial dynamics
during ceramide-induced cardiomyocyte early apoptosis. Cardiovasc Res 77:387-97.

Parrish JJ, Susko-Parrish JL, Leibfried-Rutledge ML, Critser ES, Eyestone WH, and
First NL. 1986. Bovine in vitro fertilization with frozen-thawed semen. Theriogenology
25:591-600.

Paula-Lopes FF, and Hansen PJ. 2002a. Apoptosis is an adaptive response in bovine
preimplantation embryos that facilitates survival after heat shock. Biochem Biophys
Res 295:37-42.

Paula-Lopes FF, and Hansen PJ. 2002b. Heat shock-induced apoptosis in
preimplantation bovine embryos is a developmentally regulated phenomenon. Biol
Reprod 66:1169-77.

Perez GI, Tao XJ, and Tilly JL. 1999. Fragmentation and death (a.k.a. apoptosis) of
ovulated oocytes. Mol Hum Reprod 5:414-20.

Perfettini J, Roumier T, and Kroemer G. 2005. Mitochondrial fusion and fission in the
control of apoptosis. Trends Cell Biol 15:179-83.

Petros AM, Medek A, Nettesheim DG, Kim DH, Yoon HS, Swift K, Matayoshi ED,
Oltersdorf T, and Fesik SW. 2001. Solution structure of the antiapoptotic protein bcl-
2. Proc Natl Acad Sci U S A 98:3012-7.

Petros AM, Olejniczak ET, and Fesik SW. 2004. Structural biology of the Bcl-2 family of
proteins. Biochim Biophys Acta 1644:83-94.

Pierce GB, Lewellyn AL, and Parchment RE. 1989. Mechanism of programmed cell
death in the blastocyst. Proc Natl Acad Sci U S A 86:3654-8.

Polster BM, Basaiez G, Etxebarria A, Hardwick JM, and Nicholls DG. 2005. Calpain I
induces cleavage and release of apoptosis-inducing factor from isolated
mitochondria. J Biol Chem 280:6447-54.


117









Poruchynsky MS, Wang EE, Rudin CM, Blagosklonny MV, and Fojo T. 1998. Bcl-xL is
phosphorylated in malignant cells following microtubule disruption. Cancer Res
58:3331-8.

Qian S, Wang W, Yang L, and Huang HW. 2008. Structure of transmembrane pore
induced by Bax-derived peptide: evidence for lipidic pores. Proc Natl Acad Sci U S A
105:17379-83.

Ramirez C. 2002. Modulation of Eukaryotic mRNA Stability via the Cap-binding
Translation Complex elF4F. J Mol Biol 318:951-962.

Renatus M, Stennicke HR, Scott FL, Liddington RC, and Salvesen GS. 2001. Dimer
formation drives the activation of the cell death protease caspase 9. Proc Natl Acad
Sci U S A 98:14250-5.

Renshaw SA, Dempsey CE, Barnes FA, Bagstaff SM, Dower SK, Bingle CD, and Whyte
MK. 2004. Three novel Bid proteins generated by alternative splicing of the human
Bid gene. J Biol Chem 279:2846-55.

Riedl SJ, Li W, Chao Y, Schwarzenbacher R, and Shi Y. 2005. Structure of the
apoptotic protease-activating factor 1 bound to ADP. Nature 434:926-33.

Riedl SJ, and Salvesen GS. 2007. The apoptosome: signalling platform of cell death.
Nat Rev Mol Cell Biol 8:405-13.

Robert C, McGraw S, Massicotte L, Pravetoni M, Gandolfi F, and Sirard M. 2002.
Quantification of housekeeping transcript levels during the development of bovine
preimplantation embryos. Biol Reprod 67:1465-72.

Ronca AE, and Alberts JR. 2000. Physiology of a microgravity environment selected
contribution: effects of spaceflight during pregnancy on labor and birth at 1 G. J Appl
Physiol 89:849-54; discussion 848.

Roth Z, and Hansen PJ. 2004. Involvement of apoptosis in disruption of developmental
competence of bovine oocytes by heat shock during maturation. Biol Reprod
71:1898-906.

Sakahira H, Enari M, and Nagata S. 1998. Cleavage of CAD inhibitor in CAD activation
and DNA degradation during apoptosis. Nature 391:96-9.

Sakahira H, Enari M, and Nagata S. 1999. Functional differences of two forms of the
inhibitor of caspase-activated DNase, ICAD-L, and ICAD-S. J Biol Chem 274:15740-
4.

Sakahira H, and Nagata S. 2002. Co-translational folding of caspase-activated DNase
with Hsp70, Hsp40, and inhibitor of caspase-activated DNase. J Biol Chem
277:3364-70.


118









Sakatani M, Kobayashi S, and Takahashi M. 2004. Effects of heat shock on in vitro
development and intracellular oxidative state of bovine preimplantation embryos. Mol
Reprod Dev 67:77-82.

Samejima K, and Earnshaw WC. 2000. Differential localization of ICAD-L and ICAD-S in
cells due to removal of a C-terminal NLS from ICAD-L by alternative splicing. Exp
Cell Res 255:314-20.

Santel A, Frank S, Gaume B, Herrler M, Youle RJ, and Fuller MT. 2003. Mitofusin-1
protein is a generally expressed mediator of mitochondrial fusion in mammalian cells.
J Cell Sci 116:2763-74.

Sattler M et al. 1997. Structure of Bcl-xL-Bak peptide complex: recognition between
regulators of apoptosis. Science 275:983-6.

Scaffidi C, Fulda S, Srinivasan A, Friesen C, Li F, Tomaselli KJ, Debatin KM, Krammer
PH, and Peter ME. 1998. Two CD95 (APO-1/Fas) signaling pathways. EMBO J
17:1675-87.

Schatten H, Lewis ML, and Chakrabarti A. 2001. Spaceflight and clinorotation cause
cytoskeleton and mitochondria changes and increases in apoptosis in cultured cells.
Acta Astronaut 49:399-418.

Scorrano L, Ashiya M, Buttle K, Weiler S, Oakes SA, Mannella CA, and Korsmeyer SJ.
2002. A distinct pathway remodels mitochondrial cristae and mobilizes cytochrome c
during apoptosis. Dev Cell 2:55-67.

Senkal CE, Ponnusamy S, Rossi MJ, Bialewski J, Sinha D, Jiang JC, Jazwinski SM,
Hannun YA, and Ogretmen B. 2007. Role of human longevity assurance gene 1 and
C18-ceramide in chemotherapy-induced cell death in human head and neck
squamous cell carcinomas. Mol Cancer Ther 6:712-22.

Seo SY, Chen Y, Ivanovska I, Ranger AM, Hong SJ, Dawson VL, Korsmeyer SJ,
Bellows DS, Fannjiang Y, and Hardwick JM. 2004. BAD is a pro-survival factor prior
to activation of its pro-apoptotic function. J Biol Chem 279:42240-9.

Sergeev IN, and Norman AW. 2003. Calcium as a mediator of apoptosis in bovine
oocytes and preimplantation embryos. Endocrine 22:169-76.

Siskind LJ, Feinstein L, Yu T, Davis JS, Jones D, Choi J, Zuckerman JE, Tan W, Hill
RB, Hardwick JM, and Colombini M. 2008. Anti-apoptotic Bcl-2 Family Proteins
Disassemble Ceramide Channels. J Biol Chem 283:6622-30.

Siskind LJ, Mullen TD, Romero Rosales K, Clarke CJ, Hernandez-Corbacho MJ,
Edinger AL, and Obeid LM. 2010. The BCL-2 protein BAK is required for long-chain
ceramide generation during apoptosis. J Biol Chem 285:11818-26.


119









Slee EA et al. 1999. Ordering the cytochrome c-initiated caspase cascade: hierarchical
activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-dependent manner. J
Cell Biol 144:281-92.

Smirnova E, Griparic L, Shurland DL, and van Der Bliek AM. 2001. Dynamin-related
protein Drpl is required for mitochondrial division in mammalian cells. Mol Biol Cell
12:2245-56.

Song Q, Kuang Y, Dixit VM, and Vincenz C. 1999. Boo, a novel negative regulator of
cell death, interacts with Apaf-1. EMBO J 18:167-78.

Soto P, Natzke RP, and Hansen PJ. 2003a. Actions of tumor necrosis factor-alpha on
oocyte maturation and embryonic development in cattle. Am J Reprod Immunol
50:380-8.

Soto P, Natzke RP, and Hansen PJ. 2003b. Identification of possible mediators of
embryonic mortality caused by mastitis: actions of lipopolysaccharide, prostaglandin
F2alpha, and the nitric oxide generator, sodium nitroprusside dihydrate, on oocyte
maturation and embryonic development in cattle. Am J Reprod Immunol 50:263-72.

Souza KA, Black SD, and Wassersug RJ. 1995. Amphibian development in the virtual
absence of gravity. Proc Natl Acad Sci U S A 92:1975-8.

Spanos S, Rice S, Karagiannis P, Taylor D, Becker DL, Winston RM, and Hardy K.
2002. Caspase activity and expression of cell death genes during development of
human preimplantation embryos. Reproduction 124:353-63.

Srinivasula SM, Ahmad M, Fernandes-Alnemri T, and Alnemri ES. 1998. Autoactivation
of procaspase-9 by Apaf-1-mediated oligomerization. Mol Cell 1:949-57.

Srinivasula SM, Hegde R, Saleh a, Datta P, Shiozaki E, Chai J, Lee Ra, Robbins PD,
Fernandes-Alnemri T, Shi Y, and Alnemri ES. 2001. A conserved XIAP-interaction
motif in caspase-9 and Smac/DIABLO regulates caspase activity and apoptosis.
Nature 410:112-6.

Staggs KL, Austin KJ, Johnson GA, Teixeira MG, Talbott CT, Dooley VA, and Hansen
TR. 1998. Complex induction of bovine uterine proteins by interferon-tau. Biol Reprod
59:293-7.

Stankiewicz AR, Lachapelle G, Foo CP, Radicioni SM, and Mosser DD. 2005. Hsp70
inhibits heat-induced apoptosis upstream of mitochondria by preventing Bax
translocation. J Biol Chem 280:38729-39.

Sun YF, Yu LY, Saarma M, Timmusk T, and Arumae U. 2001. Neuron-specific Bcl-2
homology 3 domain-only splice variant of Bak is anti-apoptotic in neurons, but pro-
apoptotic in non-neuronal cells. J Biol Chem 276:16240-7.


120









Susin Sa et al. 1999. Molecular characterization of mitochondrial apoptosis-inducing
factor. Nature 397:441-6.

Suzuki M, Youle RJ, and Tjandra N. 2000. Structure of Bax: coregulation of dimer
formation and intracellular localization. Cell 103:645-54.

Suzuki Y, Imai Y, Nakayama H, Takahashi K, Takio K, and Takahashi R. 2001. A serine
protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing
cell death. Mol Cell 8:613-21.

Tan KO, Tan KM, Chan SL, Yee KS, Bevort M, Ang KC, and Yu VC. 2001. MAP-1, a
novel proapoptotic protein containing a BH3-like motif that associates with Bax
through its Bcl-2 homology domains. J Biol Chem 276:2802-7.

Tilly JL. 2001. Commuting the death sentence: how oocytes strive to survive. Nat Rev
Mol Cell Biol 2:838-48.

Tomanek M, Kopecny V, and Kanka J. 1989. Genome reactivation in developing early
pig embryos: an ultrastructural and autoradiographic analysis. Anat Embryol 180:309-
16.

Tsujimoto Y, Finger LR, Yunis J, Nowell PC, and Croce CM. 1984. Cloning of the
chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome
translocation. Science 226:1097-9.

Uva BM, Masini MA, Sturla M, Bruzzone F, Giuliani M, Tagliafierro G, and Strollo F.
2002. Microgravity-induced apoptosis in cultured glial cells. Eur J Histochem 46:209-
14.

van Blerkom J. 1981. Structural relationship and posttranslational modification of stage-
specific proteins synthesized during early preimplantation development in the mouse.
Proc Natl Acad Sci U S A 78:7629-33.

van Blerkom J, and Davis PW. 1998. DNA strand breaks and phosphatidylserine
redistribution in newly ovulated and cultured mouse and human oocytes: occurrence
and relationship to apoptosis. Hum Reprod 13:1317-24.

van Blerkom J, and Davis P. 2007. Mitochondrial signaling and fertilization. Mol Hum
Reprod 13:759-70.

van Loo G et al. 2001. Endonuclease G: a mitochondrial protein released in apoptosis
and involved in caspase-independent DNA degradation. Cell Death Differ 8:1136-42.

van Loo G, van Gurp M, Depuydt B, Srinivasula SM, Rodriguez I, Alnemri ES, Gevaert
K, Vandekerckhove J, Declercq W, and Vandenabeele P. 2002. The serine protease
Omi/HtrA2 is released from mitochondria during apoptosis. Omi interacts with
caspase-inhibitor XIAP and induces enhanced caspase activity. Cell Death Differ
9:20-6.


121









Vassy J, Portet S, Beil M, Millot G, Fauvel-Lafeve F, Gasset G, and Schoevaert D.
2003. Weightlessness acts on human breast cancer cell line MCF-7. Adv Space Res
32:1595-603.

Vaux DL, Cory S, and Adams JM. 1988. Bcl-2 gene promotes haemopoietic cell survival
and cooperates with c-myc to immortalize pre-B cells. Nature 335:440-2.

Veresov VG, and Davidovskii Al. 2009. Activation of Bax by joint action of tBid and
mitochondrial outer membrane: Monte Carlo simulations. Eur Biophys J 38:941-60.

Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL,
Simpson RJ, and Vaux DL. 2000. Identification of DIABLO, a mammalian protein that
promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102:43-53.

Verhagen AM et al. 2002. HtrA2 promotes cell death through its serine protease activity
and its ability to antagonize inhibitor of apoptosis proteins. J Biol Chem 277:445-54.

Verheij M et al. 1996. Requirement for ceramide-initiated SAPK/JNK signalling in stress-
induced apoptosis. Nature 380:75-9.

Wang K, Gross A, Waksman G, and Korsmeyer SJ. 1998. Mutagenesis of the BH3
domain of BAX identifies residues critical for dimerization and killing. Mol Cell Biol
18:6083-9.

Wang K, Yin XM, Chao DT, Milliman CL, and Korsmeyer SJ. 1996. BID: a novel BH3
domain-only death agonist. Genes Dev 10:2859-2869.

Wasiak S, Zunino R, and McBride HM. 2007. Bax/Bak promote sumoylation of DRP1
and its stable association with mitochondria during apoptotic cell death. J Cell Biol
177:439-50.

Wei MC, Lindsten T, Mootha VK, Weiler S, Gross A, Ashiya M, Thompson CB, and
Korsmeyer SJ. 2000. tBID, a membrane-targeted death ligand, oligomerizes BAK to
release cytochrome c. Genes Dev 14:2060-71.

Wei MC, Zong WX, Cheng EH, Lindsten T, Panoutsakopoulou V, Ross aJ, Roth Ka,
MacGregor GR, Thompson CB, and Korsmeyer SJ. 2001. Proapoptotic BAX and
BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292:727-
30.

Whitaker M. 2006. Calcium at fertilization and in early development. Physiol Rev 86:25-
88.

Widlak P, Lanuszewska J, Cary RB, and Garrard WT. 2003. Subunit structures and
stoichiometries of human DNA fragmentation factor proteins before and after
induction of apoptosis. J Biol Chem 278:26915-22.


122









Widlak P, and Garrard WT. 2005. Discovery, regulation, and action of the major
apoptotic nucleases DFF40/CAD and endonuclease G. J Cell Biochem 94:1078-87.

Willis SN, Chen L, Dewson G, Wei A, Naik E, Fletcher JI, Adams JM, and Huang DC.
2005. Proapoptotic Bak is sequestered by Mcl-1 and Bcl-xL, but not Bcl-2, until
displaced by BH3-only proteins. Genes Dev 19:1294-305.

Woo E, Kim Y, Kim M, Han W, Shin S, Robinson H, Park S, and Oh B. 2004. Structural
mechanism for inactivation and activation of CAD/DFF40 in the apoptotic pathway.
Mol Cell 14:531-9.

Wu X, and Deng Y. 2002. Bax and BH3-domain-only proteins in p53-mediated
apoptosis. Front Biosci 7:d151-6.

Wyllie AH, Kerr JF, and Currie AR. 1980. Cell death: the significance of apoptosis. Int
Rev Cytol 68:251-306.

Wyllie AH. 1995. The genetic regulation of apoptosis. Curr Opin Genet Dev 5:97-104.

Yamaguchi R, Lartigue L, Perkins G, Scott RT, Dixit A, Kushnareva Y, Kuwana T,
Ellisman MH, and Newmeyer DD. 2008. Opal-mediated cristae opening is Bax/Bak
and BH3 dependent, required for apoptosis, and independent of Bak oligomerization.
Mol Cell 31:557-69.

Yamamoto K, Ichijo H, and Korsmeyer SJ. 1999. BCL-2 is phosphorylated and
inactivated by an ASK1/Jun N-terminal protein kinase pathway normally activated at
G(2)/M. Mol Cell Biol 19:8469-78.

Yang E, Zha J, Jockel J, Boise LH, Thompson CB, and Korsmeyer SJ. 1995. Bad, a
heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death.
Cell 80:285-91.

Yang HW, Hwang KJ, Kwon HC, Kim HS, Choi KW, and Oh KS. 1998. Detection of
reactive oxygen species (ROS) and apoptosis in human fragmented embryos. Hum
Reprod 13:998-1002.

Yang MY, and Rajamahendran R. 2002. Expression of Bcl-2 and Bax proteins in
relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod Sci
70:159-69.

Yin XM, Oltvai ZN, and Korsmeyer SJ. 1994. BH1 and BH2 domains of Bcl-2 are
required for inhibition of apoptosis and heterodimerization with Bax. Nature 369:321-
3.

Yin X, Ding W, and Zhao Y. 2003." Bcl-2 Family Proteins: Master Regulators of
Apoptosis." In Essentials of Apoptosis: A Guide for Basic and Clinical Research,
Xiao-Ming Yin and Zheng Dong. Totowa, NJ: Humana Press Inc., p. 19.


123









You H, Pellegrini M, Tsuchihara K, Yamamoto K, Hacker G, Erlacher M, Villunger A,
and Mak TW. 2006. FOXO3a-dependent regulation of Puma in response to
cytokine/growth factor withdrawal. J Exp Med 203:1657-63.

Youle RJ, and Karbowski M. 2005. Mitochondrial fission in apoptosis. Nat Rev Mol Cell
Biol 6:657-63.

Youle RJ, and Strasser A. 2008. The BCL-2 protein family: opposing activities that
mediate cell death. Nat Rev Mol Cell Biol 9:47-59.

Yu S, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ, Poirier GG, Dawson
TM, and Dawson VL. 2002. Mediation of poly(ADP-ribose) polymerase-1-dependent
cell death by apoptosis-inducing factor. Science 297:259-63.

Yu X, Acehan D, Menetret J, Booth CR, Ludtke SJ, Riedl SJ, Shi Y, Wang X, and Akey
CW. 2005. A structure of the human apoptosome at 12.8 A resolution provides
insights into this cell death platform. Structure 13:1725-35.

Zahir N, and Weaver VM. 2004. Death in the third dimension: apoptosis regulation and
tissue architecture. Curr Opin Genet Dev 14:71-80.

Zha H, and Reed JC. 1997. Heterodimerization-independent functions of cell death
regulatory proteins Bax and Bcl-2 in yeast and mammalian cells. J Biol Chem
272:31482-8.

Zha J, Harada H, Yang E, Jockel J, and Korsmeyer SJ. 1996. Serine phosphorylation of
death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-
X(L). Cell 87:619-28.

Zhang D, Lu C, Whiteman M, Chance B, and Armstrong JS. 2007. The Mitochondrial
Permeability Transition Regulates Cytochrome c Release for Apoptosis during
Endoplasmic Reticulum Stress by Remodeling the Cristae Junction. J Biol Chem
283:3476-3486.

Zhang J et al. 2003. Endonuclease G is required for early embryogenesis and normal
apoptosis in mice. Proc Natl Acad Sci U S A 100:15782-7.

Zou H, Henzel WJ, Liu X, Lutschg A, and Wang X. 1997. Apaf-1, a human protein
homologous to C. elegans CED-4, participates in cytochrome c-dependent activation
of caspase-3. Cell 90:405-13.


124









BIOGRAPHICAL SKETCH

Justin Matthew Fear was born on July 15, 1982, the second of two sons, to Karen

M and Jerry J. Fear, in St. Louis Missouri. In 2004, he received his Bachelor of Science

degree in animal science from the University of Missouri-Columbia. He then enrolled at

The Ohio State University as a non-degree graduate student in Fisheries and Wildlife in

2005. In 2006 he began to work as a laboratory manager for Dr. Joy L. Pate at The

Ohio State University. In the summer of 2007 he enrolled at the University of Florida on

a research assistantship in the laboratory of Dr. Peter J. Hansen. He is currently a

candidate for the Master of Science degree in the Animal Molecular and Cellular Biology

Graduate Program while conducting research in the Department of Animal Sciences.

On completion of this degree, he will continue his education by pursuing a Doctor of

Philosophy in the Genetics and Genomics Program at the University of Florida.


125





PAGE 1

1 DEVELOPMENTAL ACQUIS ITION OF APOPTOSIS I N THE PREIMPLANTATIO N BOVINE EMBRYO: RETUR NING TO THE BALANCE OF LIFE AND DEATH By JUSTIN M. FEAR A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL F ULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Justin M. Fear

PAGE 3

3 To Laura M. Neumann, for all of her love, help, and understanding and to my parents ; Karen M. and Jerry J. Fear for the ir love, support and the many o pportunities they have given me

PAGE 4

4 ACKNOWLEDGMENTS This thesis would not have been possible without the guidance, encouragement, and dedication of Dr. Peter J. Hansen, chair of my supervisory committee. Dr. Hansen accepted me into the Animal Molecular and Cellular Biology program, and it was with his support that this project was made possible ; for this is am truly gra teful. I would also like to tha nk my superviso ry committee: Dr. Sally Johnson and Dr. Lei Zhou for their contributi ons and suggestions I would like to thank all my lab mates, Dr. Jeremy Block, Aline Bonilla, Luciano Bonilla, Dr. Silvia Carambula, Sarah Fields, Dr. Katherine Hendricks, Barbara Loureiro, Dr. James Moss, Dr. Lilian Oliveira Dr. Manabu Ozawa, and Dr. Mar ia Padua. It is with their help and guidance I have been able to carry out this project. I would like to thank the personnel at Central Packing Co., Center Hill, FL for providing the ovaries used in this thesis and to William Rembert for his dedication and willingness collect ovaries throughout these project s, on Earth and in space I am also thankful to the extended faculty, staff, and students of the Department of Animal Sciences and the Animal Molecular and Cell Biology program for their support. I would like to give special thanks to John Wayne Kennedy (Zero Gravity Inc.), Dr. Neil Talbot (USDA) and Louis Stodieck (BioServe Space Technologies) for allowing me to participate in the joint project with the USDA to study bovine embryo development in s pace I would like to thank the staff of the Kennedy Space Center Space Life Science L ab for providing the facilities and assistance on th at project. I also thank the crew of the space shuttle Endeavour along with all those who participated on mission ST S 126. Special thanks to Luciano Bonilla who was my partner on this project, I could not have done this alone.

PAGE 5

5 I would like to express my deepest gratitude to my parents, Jerry J. and Karen M. Fear along with my brother Joseph M. Fear for their support an d helping me to be the person I am today. Finally, I thank the love of my life Laura M. Neumann for her care, love, understanding and devotion over these years. Truly without her I would be lost on this great journey of life.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 17 Overview of the Role of Apoptosis During Preimplantation Development .............. 17 Pathways of Apoptosis ................................ ................................ ............................ 19 The Extrinsic Pathway ................................ ................................ ...................... 19 The Intrinsic Pathway ................................ ................................ ....................... 20 Molecular Events Controlling Apoptosis in the Intrinsic Pathway ............................ 21 Pore Formation and Permeabilization ................................ .............................. 24 Cytochrome C Release ................................ ................................ .................... 26 Other Apoptogeni c Factors ................................ ................................ ............... 27 The Apoptosome ................................ ................................ .............................. 29 The Caspase Cascade ................................ ................................ ..................... 31 The Role o f Ceramide as a Signaling Molecule Triggering Apoptosis .............. 34 BCL2 Family Proteins ................................ ................................ ............................. 36 Structure ................................ ................................ ................................ ........... 36 Membrane Permeabilization and Pore Formation ................................ ............ 38 Protein Interactions and Signal Transduction ................................ ................... 39 Regulation of BCL2 Family Members ................................ ............................... 41 Apoptosis in the Preimplantation Embryo ................................ ............................... 45 Occurrence of Apoptosis in the Oocyte and the Pr eimplantation Embryo ........ 45 Apoptosis as a Protective Mechanism ................................ .............................. 47 Developmental Regulation of Apoptosis in Preimplantation Embryos .............. 48 Possible Causes for Developmental Regulation ................................ ............... 50 Thesis ................................ ................................ ................................ ..................... 52 2 D EVELOPMENTAL ACQUISITION OF APOPTOSIS IN THE BOVINE PREIMPLANTATION EMBRYO ................................ ................................ ............. 57 Introduction ................................ ................................ ................................ ............. 57 Materials and Methods ................................ ................................ ............................ 59 Materials ................................ ................................ ................................ ........... 59 In Vitro Production of Embryos ................................ ................................ ......... 60

PAGE 7

7 BEND Cell Culture ................................ ................................ ............................ 61 RNA Extraction ................................ ................................ ................................ 61 Quantitative Real Time RT PCR (qPCR) ................................ ......................... 62 Immunocytoc hemistry ................................ ................................ ...................... 64 Image Analysis ................................ ................................ ................................ 65 Western Blotting ................................ ................................ ............................... 66 Experimental D esign ................................ ................................ ........................ 67 Statistical Analysis ................................ ................................ ............................ 68 Results ................................ ................................ ................................ .................... 69 Quantitative Real Ti me RT PCR ................................ ................................ ...... 69 Immunocytochemistry and Western Blotting ................................ .................... 70 Discussion ................................ ................................ ................................ .............. 71 APPENDIX: COWS IN SPACE: A PRELIMINARY INVESTIGATION TO DETERMINE EFFECTS OF SPACE FLIGHT ON BOVINE PREIMPLANTATION EMBRYO DEVELOPMENT ................................ ................. 86 Introduction ................................ ................................ ................................ ............. 86 Materials and Methods ................................ ................................ ............................ 89 Materials ................................ ................................ ................................ ........... 89 In Vitro Production of Embryos ................................ ................................ ......... 89 Fluid Processing Apparatus ................................ ................................ .............. 90 Group Activation Pack Preparation and Handoff ................................ .............. 91 Launch, Fixation, and Recovery ................................ ................................ ....... 91 TUNEL and Hoescht 33342 Labeling ................................ ............................... 91 Experimental Design ................................ ................................ ........................ 92 Statistical Analysis ................................ ................................ ............................ 93 Results ................................ ................................ ................................ .................... 93 Discussion ................................ ................................ ................................ .............. 94 LIST OF REFERENCES ................................ ................................ ............................. 103 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 125

PAGE 8

8 LIST OF TABLES Table page 2 1 Primer sets used for qRT PCR. ................................ ................................ .......... 79 A 1 Developmental distribution of embryos r ecovered from FLIGHT and GROUND ................................ ................................ ................................ .......... 100 A 2 Comparison o f embryonic development coincident with orbital flight. ............... 101

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Schematic of the extrinsic or rece ptor mediated apoptot ic pathway ................... 54 1 2 Schematic of the intrinsic or mitochon drial apoptotic pathway ........................... 55 1 3 Schematic drawing of the BCL2 family prot eins ................................ ................. 56 2 1 Quantitative real time RT PCR for anti apoptotic genes ................................ ..... 80 2 2 Immunoreactive amounts of BCL2 ................................ ................................ ..... 81 2 3 Immunoreactive amounts of BAX ................................ ................................ ....... 83 2 4 Immunoreactive amounts of BCL 2L1, HSPA1A, and BAD ................................ 85 A 1 Schematic drawing the the fluid processing apparatus (FPA) ............................ 96 A 2 Plunger apparatus ................................ ................................ .............................. 97 A 3 Group activation pack ( GAP) ................................ ................................ .............. 98 A 4 Flight incubator ................................ ................................ ................................ ... 99 A 5 Representative images of TUNEL analysis ................................ ...................... 102

PAGE 10

10 LIST OF ABBRE VIATIONS Abbreviation Term (Alias) AZA 5 Aza 2' Deoxycytidine ANT Adenine Nuclotide Translocator ADP Adenosine Diphosphate ATP Adenosine Triphosphate AIF Apoptosis Inducing Factor 1 ART Apoptosis Regulating and Targeting Sequence APAF1 Apoptotic Peptidase Activating Factor 1 BIR Baculoviral IAP Repeat BCL2 B cell CLL/Lymphoma 2 BBC3 BCL2 Binding Component 3 (PUMA) BAK1 BCL2 Antagonist/Killer 1 (BAK) BAD BCL2 Associated Agonist of Cell Death BAX BCL2 Associated X Protein BCL2L1 BCL2 Like 1 (BCL xL) BCL211 BC L2 Like 11 (BIM) BOK BCL2 Related Ovarian Killer BID BH3 Interacting Domain Death Agonist BEND cell Bovine Endometrial Cell Line CCCP Carbonyl Cyanide 3 Chlorophenyl Hydrazone CARD Caspse Recruitment Domain CAPK Ceramide Activated Protein Kinase cDNA Compl ementry DNA COCs Cumulus Oocyte Complexes

PAGE 11

11 Ct Cycle Threshold DD Death Domain DED Death Effector Domains DISC Death Inducing Signaling Complex Diablo Diablo Homolog (SMAC/DIABLO) DEPC Diethyl Pyrocarbonate DFF DNA Fragmentation Factor DFFA DNA Fragmentation Factor A (DFF45, ICAD) DFFB DNA Fragmentation Factor B (DFF40, CAD) DNA Deoxyribonucleic Acid DNAJB1 DNAJ Homolog 1 DRP1 Dynamin Related Protein 1 EGA Embryonic Genome Activation FASLG Fas Ligand (FASL) FADD Fas Associated Protein with Death Domain FIS1 F ission 1 FPA Fluid Processing Apparatus GLM General Linear Model GAP Group Activation Pack HSPA1A Heat Shock Protein 70 kDa 1A (HSP70.1) HPM High Polarized Mitochondria HIST1H2A Histone Cluser 1, H2a (H2A.1) hpi Hours Post Insemination HTRA2 HtrA Serine Pe ptidase 2 (OMI) IVF In Vitro Fertilization

PAGE 12

12 IAP Inhibitors of Apoptosis ICM Inncer Cell Mass KSR1 Kinase Supressor of RAS (KSR) KSOM BE2 KSOM Bovine Embryo 2 MII Metaphase 2 MOM Mitochondrial Outer Membrane MOMP Mitochondrial Outer Membrane Permeabilization MFN1 Mitofusin 1 MAPK Mitogen Activated Protein Kinase MAPK8 Mitogen Activated Protein Kinase 8 (JNK) MAPK9 Mitogen Activated Protein Kinase 9 (SAPK) MAP3K1 Mitogen Activated Protein Kinase Kinase Kinase 1 (MEKK1) MCL1 Myeloid Cell Leukemia Sequence 1 NLS Nuclear Localization Signal NB ARC Nucleotide Binding and Oligomerization OPA1 Optic atrophy 1 Homolog PBS PVP PBS + Polyvinylpyrrolidone PHE Penicillamine Hypotaurin Epinephrine PTP Permeability Transition Pore PBS Phophate Buffered Saline PMAIP1 Phorbol 12 Myristate 13 Acetate Induced protein 1 (NOXA) PARP1 Poly (ADP ribose) Polymerase 1 PCR Polymerase Chain Reaction KSOM Potassium Simplex Optomized Medium PCD Programmed Cell Death

PAGE 13

13 qPCR Quantitative Real Time RT PCR ROS Reactive Oxygen Species RT PCR Rev erse Transcription PCR RNA Ribonucleic Acid RNAi RNA Interference SDS Sodium Dodecyl Sulfate SMPD Sphingomyelin Phosphodiesterase (SMase) SMPD1 Sphingomyelin Phosphodiesterase 1 (aSMase) SMPD2 Sphingomyelin Phosphodiesterase 2 (nSMase) SAS Statistical Anal ysis System TBS T TBS + Tween TBS TM TBS + Tween + Non Fat Dry Milk TUNEL Terminal Deoxynucleotidyl Transferase Deoxyuridine Triphosphate Nick End Labeling TCM 199 Tissue Culture Medium 199 TIMM8A Translocase of Inner Mitochondrial Membrane 8 Homolog A TSA Trichostatin A TBS Tris Buffered Saline TE Trophectoderm tBID Truncated BID TNFSF10 Tumor Necrosis Factor (Ligand) Superfamily, Member 10 (TRAIL) TNF Tumor Necrosis Factor (TNF ) TALP Tyrodes Albumin Lactate Pyruvate TL Tyrodes Lactate YWHAQ Tyrosine 3 Monooxygenase/Tryptophan 5 Mon ooxygenase Activation Proteins (14 3 3)

PAGE 14

14 AKT1 v akt Murine Thymoma Viral Oncogene Homolog 1 (AKT/PKB) VDAC Voltage Dependent Anion Channel VDAC1 Voltage Dependent Anion Channel 1 VDAC2 Voltage Dependent Anion Channel 2 XIAP X Linked Inhibitor of Apoptosis PFPs Pore Forming Proteins

PAGE 15

15 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science DEVELOPMENTAL ACQUIS ITION OF APOPTOSIS I N THE PREIMPLANTATION BOVINE EMBRYO: RETUR NING TO THE BALANCE OF LIFE AND DEATH By Justin M. Fear August 2010 Chair: Peter J. Hansen Major: Animal Molecular and Cellular Biology The developmental acquisition of apoptosis occurs in a stage dependent manner in the bovine p reimplantation embryo Two cell embryo s lack the capacity for apoptosis and the embryo remains refractory to apoptotic stimuli until the 8 to 16 cell stage. The a poptotic machinery is present in the 2 cell embryo but the mitochondria are r esistant to depolarization following apoptotic stimuli This suggests that there is a developmental regulation of apoptosis at the level of the mitochondria Propagation of an apoptotic signal requires mitochondrial outer membrane depolarization, which is depend ent upon the complex balance of anti versus pro apoptotic proteins. It was hypothesize d that 2 cel l embryo s ha ve higher amounts of anti apoptotic proteins and lower amounts of pro apoptotic proteins thereby shifting the balance towards life and preventing the capacity for apoptosis. After embryonic genome activation, at the 8 to 16 cell stage, there is a decrease in anti apoptotic proteins and an increase in pro apoptotic proteins causing the embryo to adjust the balance of life and death and a cquire cell embryo s Accordingly, a series of experiments were conducted to test variations in expression of anti and pro apoptotic genes early during stages of preimplantation development.

PAGE 16

16 Expression of anti apoptotic genes BC L2 and HSPA1A were higher in oocytes, 2 cell embryos, and 2 cell embryos treated with a transcription inhibitor cell embryos In contrast, expression of pro apoptotic gene B AD cell embryo s when compared to oocytes, 2 cell embryos, and 2 cell embryos treated transcription inhibitor Steady state mRNA for BCL2L1 BAX DFFA and HIST1H2A was not affected by stage of development. Protein concentrations also varied between the 2 cell embryo. T he 2 cell embryo ha d higher immunoreactive amounts of the anti apoptotic protein BCL2 compared to the cell embryo. In contrast, cell embryo had higher immunoreactive amounts of BAX when compared to the 2 cell embryo Immunoreactive a mounts of BCL2L1, HSPA1A and BAD were not significantly aff ected by stage of development. T hese results suggests that the loss of capacity for apoptosis in the 2 cell embryo is due at least in part to higher amounts the anti apoptotic protein BCL2. D evelopmental acquisiti on of apoptosis is dependent upon a decrease in expression of BCL2 along with an increase in expression of the pro apoptotic protein BAX and possibly increased availability of BAD after embryonic genome activation.

PAGE 17

17 CHAPTER 1 LITERATURE REVIEW The term ap optosis is proposed for a hitherto little recognized mechanism of controlled cell deletion, which appears to play a complementary but opposite role to mitosis in the regulation of animal cell populations Kerr et al. 1972 Overview of the Role of Apoptosis During Preimplantation Development The developmental success of a preimplantation embryo is dependent on its ability to adapt to the surrounding environment and protect itself against intrinsically or extrinsically induced cellular damage. Upon damage to DNA or organelles, somatic cells respond by arresting the cell cycle and activating repair mechanisms (Friedberg, 2003) If damage is repaired, the cell cycle resumes; otherwise the cell undergoes programmed cell death (PCD), also termed apoptosis (Friedberg, 2003) Apoptosis is a cascade of events leading to cytoplasmic, nuclear, and DNA fragmentation. The cell fragments into membrane boun d apoptotic bodies which are either dispersed or phagocytized by neighboring cells (Kerr et al., 1972; Wyllie et al., 1980) Apoptosis is heavily regulated to prevent unwanted cell death. Regulation ranges from genetic controls (Wyllie, 1995) to complex protein interactions (Hanada et al., 1995; Yang et al., 1995; Wang et al., 1996; Zha et al., 1996; Garland and Rudin, 1998) Apoptosis plays a variety of roles in the preimplantation embryo including removal of cells with chromosomal defects (aneuploidy) (Hardy, 1999; Liu et al., 2002) or those with i nappropriate developmental potential such as cells of the inner cell mass (ICM) that fail to lose the potential to form trophectoderm (TE) (Handyside and Hunter, 1986; Pierce et al., 1989; Parchment, 1993; Hardy, 1997) Apoptosis is also involved in elimination of damaged cells in the preimplantation embryo as has been shown

PAGE 18

18 experimen tally for embryos exposed to reactive oxygen species (ROS) (Yang et al., 1998) menadione (Moss et al., 2009) ultrav iolet radiation (Herrler et al., 1998) heat shock (Paula Lopes and Hansen, 2002a) and arsenic (Krininger et al., 2002) Indeed, clearance of damaged cells in a compromised blastocyst by apoptosis can enhance the probability that an embryo can survive stress (Pau la Lopes and Hansen, 2002; Jousan and Hansen, 2007) One characteristic of apoptosis responses during the preimplantation period is that the capacity for apoptosis is developmentally acquired. In the bovine preimplantation embryo, it is between the 8 to 16 cell stage, that signals such as heat shock (Paula Lopes and Hansen, 2002; Brad et al., 2007) ceramide (de Castro e Paula and Hansen, 2008) arsenic (Krininger et al., 2002) or tumor necrosis factor (TNF) (Soto et al., 2003a) first are capable of inducing apoptosis. Earlier in developm ent, apoptosis is not possible. Apoptosis responses may be inhibited early in development to prevent acciden tal triggering of apoptosis by signals generated during fertilization and preimplantation development. Fertilization causes a complex set of intracellular [Ca 2+ ] oscillations which allow the oocyte to complete the second meiotic division (Whitaker, 2006) These oscillations may have the potential to induce an apoptotic response given that increases in intracellular [Ca 2 + ] have been associated with apoptosis (Kaiser and Edelman, 1977; McConkey et al., 1989) calpain, calpain reduced apoptotic indices (Sergeev and Norman, 2003) showing it is involved in apoptosis in the early preimplantation embryo.

PAGE 19

19 It may also be that, when cell number is low, removal of cells by apoptosis in r esponse to stress is harmful rather than beneficial. For example, the elimination of 10 damaged cells from a 150 cell blastocyst may be an effective strategy for facilitating continued development but removal of 1 damaged cell from a 2 cell embryo may acc entuate reduction in developmental potential caused by stress. Although a bisected 2 cell embryo can develop into a blastocyst (Loskutoff et al., 1993) insults to the embryo are likely to affect b oth blastomeres and loss of one cell to apoptosis may make f urther development problematic. Pathways of Apoptosis There are two well known pathways of apoptosis the extrinsic or receptor mediated pathway and the intrinsic or mitochondrial pathway. Both of these pathways result in the activation of caspases and DNases that cause cytoplasmic, nuclear, and DNA fragmentation and lead to the classic morphological signs of apoptosis, membrane blebbing and formation of apoptotic bodies. The major difference be tween the two pathways is the involvement of a receptor mediated signal versus an internally generated, mitochondrial signal. The Extrinsic Pathway The extrinsic pathway, illustrated in Figure 1 1 utilizes specialized membra ne bound 'death receptors' that are members of the tumor necrosis factor superfamily (Ashkenazi and Dixit, 1998) These receptors share a homologous domain (about 80 amino acids) in their cytoplasm ic region called the death domain (DD) (Nagata, 1999) Binding of a variety of extra cellular signaling molecules such as Fas ligand (FASLG) (Nagata, 1997) TNF related apoptosis inducing ligand (TNFSF10 previously TRAIL ) (MacFarlane, 2003) and TNF (Ding and Yin, 2004) activa tes these receptors. An

PAGE 20

20 adapter molecule, Fas associated protein with death domain (FADD), is recruited by the receptor and interacts with the DD. FADD then interacts with procaspase 8. Two death effector domains (DED) on the N terminal region of procas pase 8 combine to form the death inducing signaling complex (DISC). Procaspase 8 contains a weak proteinase activity that is activated upon DISC formation, allowing self cleavage to produce active caspase 8 (Nagata, 1997) Caspase 8 preferentially cleaves procaspase 3 and 7 into caspase 3 and 7 which in turn activate other caspases and cleave a variety of cellular proteins. There are two cell types with regards to the extrinsic pathway based on w hether the cell has sufficient quantities of caspase 8, 3, and 7 for induction of apoptosis. For cells with insufficient quantities, the intrinsic pathway (see below) is activated through cleavage of BH3 interactive domain death agonist (BID) into trunc ated BID (tBID) by casapse 8, allowing for the apoptosis signal to be amplified (Scaffidi et al., 1998) Caspase 3 and 7 then cleave DNA fragmentation factor A (DFFA), also known as the inhibitor of caspase activated DNase. Cleavage of DFFA leads to its release from the DNA fragmentation factor B (DFFB) or caspase activated DNase. As a result, DFFB becomes an active DNase and cleaves internucleosomal regions of chromosomal DNA (Nagata, 1999) The Intrinsic Pathway The intrinsic pathway, illustrated in Figure 1 2 is the stress induced pathway of apoptosis. This pathway does not utilize membrane bound receptor s like the extrinsic pathway but instead depends upon activation for a stress induced signal such as the activation of sphingomyelin phosphodiesterase (SM PD ) by heat shock causing the hydrolysis of sphingomyelin to ceramide. Ceramide, in turn activates BH 3 only

PAGE 21

21 members of the BCL2 family through mitogen activated protein kinase (MAPK9; previously SAPK) or mitogen activated protein kinase 8 (MAPK8; previously JNK). B H3 only proteins inhibit anti apoptotic actions of B cell CLL/lymphoma 2 (BCL2) and BCL2 li ke 1 (BCL2L1, previously BCL xL) by binding to the anti apoptotic BCL2 and BCL2L1 causing release of the pro apoptotic proteins BCL2 associated X protein (BAX) and BCL2 antagonist/killer 1 ( BAK1 ). In addition to the inhibition of BCL2 and BCL2L1, some BH3 only proteins bind to BAX and BAK1 caus ing a conformational change allowing targeting to the mitochondrial outer membrane and formation of multimers. BAX and BAK1 then form pores in the mitochondrial outer membrane leading to mitochondrial depolarization Consequently, cytochrome c is released into the cytosol. Cytochrome c binds to apoptosis inducing factor 1 (APAF1) and causes a conformational change allowing it to form a 7 member unit called the apoptosome. The apoptosome recruits multiple units of the zymogen procaspase 9. Once procaspase 9 concentrations are high enough, there is a conformational change in procaspase 9 exposing the enzymatically active site of caspase 9. Caspase 9 in turn cleaves and activates the executioner or group II caspases ( 3, 6, and 7). The caspase cascade terminates with cleavage of DFFA leading to its disassociation from DFFB activating the DNase. DFFB then cuts DNA into the internucleosomal fragments which are the hallmark of apoptosis (Wyllie et al., 1980) Molecular Events Controlling Apoptosis in the Intrinsic Pathway Mitochondria are membrane enclosed organelles found in the majority of eukaryotic cells. It was incorporated during eukaryotic evolution fr om symbiotic bacteria. The mitochondrion has retained its own genome that encodes 37 genes but it also requires nuclear encoded genes. The major function of the mitochondria is the

PAGE 22

22 production of adenosine tri phosphate (ATP). As part of the process of en ergy production, the outer mitochondrial membrane becomes highly polarized with respect to H + Polarization is also key to the participation of mitochondria in signal transduction in several cellular pathways including apoptosis. Mitochondria have the abi lity to form complex and dynamic networks. These networks allow for mitochondrial communication, cellular signal transduction and signal amplification. Perhaps the clearest example of this is the signal transduction event at fertilization. D uring oocyte maturation there is a formation of a ring of high polarized mitochondria (HPM) in the subplasmalemmal region. This ring of HPM is required for sperm penetration and cortical granule exocytosis (van Blerkom and Davis, 2007) The authors suggested that the HPM establish a continuous circumferential circuit, capable to reacting to and propagating a signal across the subplasmalemmal cytoplasm. Apoptosis leads to fragmentation of the mitochondrial netw ork communication both upstream and downstream of apoptotic stimuli (Gao et al., 2001; Arnoult et al., 2005 a ; Youl e and Karbowski, 2005) In the initial stages of apoptosis, however, the mitochondrial network is important for propagation of the apoptotic signal because early fragmentation of the mitochondrial network prevents cell death (Perfettini et al., 2005) The key event in induction of apoptosis by the intrinsic pathway is permeabilization of the mitochondrial outer membrane (MOM) (termed mitochondrial outer membrane permeabilization or MOMP). Sensitiv ity of the mitochondrion to outer membrane permeabilization may be affected by mitochondrial shape which is derived from equilibrium of fusion and fission events affecting membrane integrity and structural proteins. The mitochondria can undergo fusion wit h other mitochondria, or fission

PAGE 23

23 leading to the production of two daughter organelles. Both mitochondrial fusion and fission depend upon GTPases; mitofusin 1 (MFN1), optic atrophy 1 (OPA1) and dynamin related protein 1 (DRP1) (Smirnova et al., 2001; Santel et al., 2003; Cipolat et al., 2004) While early fragmentation of the mitochondrial network may prevent apoptotic sig naling from propagation, there is evidence show ing the induction of network fragmentation downstream of BAX/ BAK1 signaling events (Arnoult et al., 2005a) BAX has been shown to co localize with DRP 1 at mitochondrial fission sites suggesting its involvement (Karbowski et al., 2002) BAX and BAK1 also induce sumoylation of DRP1 during apoptosis prior to pore formation which leads to the stab ilization and prevents lysosomal degradation of DRP1 (Wasiak et al., 2007) Finally as a result of MOMP there is a release of the mitochondrial factor translocase of inner mitochondrial membrane 8 homolog A (TIMM8a) which leads to further activation of DRP1 (Arnoult et al., 2005b) Even thought mitochondrial network breakdown i s part of apoptosis, its inhibition does not prevent BAX/ BAK1 d ependent apoptosis (Parone et al., 2006) Mitochondrial outer membrane depolarization leads to the release of many mitochondrial factors including cytochrome c, endonuclease g and Diablo homolog (D IABLO ; previously SMAC/DIABLO ). These factors are involved in further signal transduction by the creation of the apoptosome and initiation of the caspase signaling cascade. Indeed, MOMP and cytochrome c release is the "point of no return" in the apoptotic signal transduction system so that once activated the cell is committed to destruction. It is the irreversibility of events contingent on MOMP that has lead to development of tight regulatory control mechanisms for MOMP.

PAGE 24

24 Pore Formation and Permeabilizati on At the level of the mitochondria, the first step in signal propagation is pore formation and permeabilization of the MOM. Currently there are several competing models to explain this mechanism. The first model suggests that there is an opening of the permeability transition pore (PTP). The PTP spans both the outer and inner mitochondrial membranes with a voltage dependent anion channel (VDAC) on the outer membrane and the adenine nucleotide translocator (ANT) channel or a similar channel on the inner membrane (Green and Kroemer, 2004) In addition, there is possible involvement of several other proteins including cyclophilin D and hexokinase II (Kumarswamy and Chandna, 2009) In this model VDAC is semipermeable to allow passage of molecules up to 5 kDa, while the ANT is nearly impermeable. Differential permeability is essential for the generation of the electrochemcial proton gradient u sed for oxidative phosphorylation (Bernardi, 1999) In response to an apoptotic stimulus, mitochondrial calcium concentrations increase, which leads to the opening of the PTP allowing calcium, wate r, and other low molecular weight molecules (~1.5 kDa) to pass through the inner membrane (Green and Kroemer, 2004) With the influx of water, there is a swelling of the mitochondrial matrix which is sufficient enough to lead to rupture of the outer membrane and release of cytochrome c. There are two major issues with this model. First, mitochondrial function and structure are preserved after cytochrome c release suggesting that there is not a ruptu re of the outer membrane (Ashen and Goff, 2000) Also, cells lacking BAX and BAK1 fail to undergo MOMP in response to a wide range of apoptotic stimuli including staurosporine, ultraviolet radiatio n, growth factor deprivation, and tBID induced

PAGE 25

25 cytochrome c release (Wei et al., 2001) Thus, the two major pro apoptotic members of the BCL2 family, BAX and BAK1 are necessary for initiation of p ore formation. BAX is primarily localized to the cytosol and translocates to the mitochondrial membrane when activated by the binding of certain BH3 only domain proteins like BID and BCL2 like 11 (BCL2L11, previously BIM) (Lovell et al., 2008) BAK1 is localized to the mitochondrial outer membrane associated with VDAC2, myeloid cell leukemia sequence 1 (MCL1) and BCL2L1 (Cheng et al., 2003; Willis et al., 2005; Li et al., 2008) Like BAX, BAK1 is also activated by binding of BH3 only proteins (e.g. BID). BAX and BAK1 belong to a class of amphipathic proteins calle pore forming helices that can bind to the water lipid interface of the mitochondrial lipid bi layer. BAX and BAK1 then form multimer units in the mitochondrial membrane resulting in the interfacial area increas ing and stretching the hydrocarbon core of the bi layer. This strain on the membrane increases with protein concentration, when the concentration is such that it exceeds a threshold, a stable pore is formed with a defined size (Lee et al., 2008) T helix of BAX forms a type of pore referred to as toroidal or lipidic pore which is made of both protein and lipids (Qian et al., 2008) When the pore is formed, it relieves some of the interfa cial strain and becomes stable. One interesting player that appears to be involved in both models of mitochondrial outer membrane permeabilization are VDACs. There are three isoforms of VDACs and each have different functions with regards to pore formati on ( reviewed Blachly Dyson and Forte, 2001) VDAC2 has been shown to be inhibitory of BAK1 (Cheng et al., 2003) while VDAC1 appears to be a contributing factor to pore formation in ROS

PAGE 26

26 stimulated apoptosis, through its binding with active BAX or BAK1 The VDACs may function to group small amounts of cardiolipin and related lipids present in the MOM into microdomains. When active BAX and BAK1 associate with VDAC1, these lipid domains may aid in the lipidic pore formation and permeabilization. Cytochrome C Release Regardless of how MOMP occurs, cytochrome c release is "the point of no return". Cytochrome c is a molecule that has been shown to be involved in electron transportation between the mitochondrial inner and outer membranes (Bernardi and Azzone, 1981) Beyond its role in respiration, cytochrome c is a major signaling f actor in the apoptotic cascade (Liu et al., 1996) Release of cytochrome c occurs within minutes following an apoptotic stimulus (Goldstein et al., 2000) leading to the propagation of the apoptotic signal. Cytochrome c resides in the mitochondrial inter membrane space. Approximately 10 15% of cytochrome c is available in the mitochondrial inter membrane space while the rest is compartmentali zed within pockets formed by the cristae or inner membrane folds (Bernardi and Azzone, 1981) One implication of the localization of cytochrome c is that apoptosis requires not only formation of po res in the MOM but also remodeling of the cristae (Scorrano et al., 2002) to allow complete cytochrome c releases as it occurs in programmed cell death (Goldstein et al., 2000) Like in mitochondrial network plasticity, OPA1 is involved in cristae remodeling. OPA1 is the major factor involved in maintenance and formation of the cristae folds (Olichon et al., 2003) Depletion of OPA1 using RNA interference (RNAi) results in restructuring the cristae allowing complete release of cytochrome c (Olichon et al., 2003; Griparic et al., 2004; Zhang et al., 2007) With an apoptotic stimulus, OPA1 is also depleted by its release from the

PAGE 27

27 mitochondria at the same rate as cytochrome c (Arnoult et al., 2005; Yamaguchi et al., 2008) In addition to OPA1, active BAX and BAK1 have been shown to be involved with cristae restructuring during apoptosis. Yamaguchi et al. (20 08) evaluate d the role of BH3 only proteins BID, BCL2L11, and BCL2 associated agonist of cell death (BAD) along with the multi domain proteins BAX and BAK1 in cristae remodeling and cytochrome c release. Active forms of BID and BCL2L11 showed a loss of O PA1 complexes and a complete release of cytochrome c BAD had no effect on loss of OPA1 or cytochrome c release Using different BAX and BAK1 knockdown or knockout models, they concluded that BID induced cristae remodeling was dependent on either BAX or BAK1 BAX/ BAK1 dependent events on the mitochondrial inner membrane (cristae remodeling) and on the mitochondrial outer membrane (pore formation) could experimentally separated (Yamaguchi et al., 20 08) Other Apoptogenic Factors Besides cytochrome c, there are other apoptogenic factors that are released at the time of mitochondrial permeabilization i nclud ing DIABLO, HTRA serine peptidase 2 (HTRA2; previously OMI), endonuclease g, and apoptosis induc ing factor 1 ( AIF1 ). DIABLO is a nuclear encoded protein that is imported into the mitochondria and co localize s with cytochrome c (Du et al., 2000) omplete release fr om mitochondria requires cristae remodeling (Yamaguchi et al., 2008) When released into the cytosol, DIABLO binds to inhibitors of apoptosis (IAPs) such as X linked IAP (XIAP) and survivin (Du et al., 2000; Verhagen et al., 2000; Srinivasula et al., 2001) IAPs contain three baculoviral IAP repeat (BIR) domains. These domains function together to bind both procaspases and activated caspases and thereby inhibit

PAGE 28

28 their enzymatic activity (Srinivasula et al., 2001) DIABLO binds to the BIR2 and BIR3 domains an d block s the action of IAPs enhancing caspase activity. HTRA2 is an evolutionarily conserved nuclear encoded protein with serine proteinase activity (Hu et al., 1998) it is found in the endoplasmic reticulum, nucleus, and mitochondria. HTRA2 is released from the mitochondria upon apoptotic stimuli (anti FAS antibodies, ultraviolet irradiation, or tBID) (V erhagen et al., 2002; van Loo et al., 2002) The N terminus of HTRA2 is almost identical to DIABLO and has been shown to have similar binding and inhibitory properties towards IAPs (Suzuki et al., 2001) In addition to the inhibition of IAPs, the serine proteinase also has a pro apoptotic function. Over expression of HTRA2 outside of the mitochondria leads to a caspase independent cell death (Suzuki et al., 2001; Verhagen et al., 2002) Endonuclease g is a nuclear encoded protein that is imported into the mitochondria and is involved in mitochondrial DNA processing and generation of RNA primers require d for DNA synthesis (C t and Ruiz Carrillo, 1993) Endonuclease g is also released from the mitochondria upon apoptotic stimuli such as ultraviolet radiation or treatment with tBID coincident with release of cytochrome c (Li et al., 2001) Release of endonuclease g is independent of release of mitochondrial heat shock protein 70 (HSPA1A), which is localized to the inner membrane matrix, sug gesting that there are substantial amounts of endonuclease g in the inter memb rane space and not in the inner membrane matrix where DNA processing occurs (Li et al., 2001) Like HTRA2, the release of endonuclease g can be blocked by the over expression of BCL2 (Li et al., 2001; van Loo et al., 2001) Once in the cytosol, endonuclease g translocates to th e nucleus where it cleaves chromatin DNA into fragments (Li et al., 2001; van Loo et al.,

PAGE 29

29 2001) This activity is similar to DFFB except that endonuclease g h as been shown to act as a caspase independent DNase (van Loo et al., 2001) Endonuclease g also has RNase activity that has been suggested may play a role as an apoptotic RNase (Kalinowska et al., 2005) Apoptosis inducing factor 1 is a flavoprotein with homology to a bacterial oxidoreductase; it is encoded in the nucleus and imported into the mitochondria where it is anchored to the inner me mbrane by an amino terminal transmembrane segment (Otera et al., 2005) and plays a role in oxidative phosphorylation and redox control (Modjt ahedi et al., 2006) During MOMP, the transmembrane portion of AIF1 is cleaved by calpain I a class of cysteine proteinase s, and is released into the cytosol (Otera et al., 2005; Polster et al., 2005) Once in the cytosol, AIF1 translocates to the nucleus and causes large scale (~50 kb) DNA fragmentation and chromatin condensation (Susin et al., 1999) Like for endonuclease g, this apoptogenic function is caspase independent (Susin et al., 1999) AIF1 has been shown to play a central role in several caspase independent apoptotic signaling mech anisms such as response to DNA damage (Yu et al., 2002) and by interacting poly(ADP ribose) polymerase 1 (PARP1). PARP1 is a nuclear enzyme involved in DNA repair by transferring ADP ribose to an a cceptor protein such as histone (Hong et al., 2004) AIF1 also stimulates the DNase activity of endonuclease g (Joza et al., 2009) The Apo ptosome As mentioned previously, the point of no return for cell death is the release of cytochrome c and its translation into an irreversible death signaling cascade. Several signaling modules are required to translate and propagate th is signal. The fir st is apoptotic peptidase activating factor 1 ( APAF1 ) a monomeric cytosolic protein (Zou et

PAGE 30

30 al., 1997) that senses mitochondri al depolarization by binding to cytochrome c leading to its oligomeriz ation and formation of a wheel shaped signaling platform with seven spokes, the apoptosome (Acehan et al., 2002) Given the importance of regulating this signal, the formation of the apoptosome is a multi step process requiring ei ther 2' deoxy ATP (dATP) or ATP (Riedl et al., 2005) for simplicity will refer to them as (d)ATP To understand the regulation of the apoptosome, it is necessary to first understand the structure and function of APAF1. APAF1 is a multi domain protein consisting of a N terminal caspase recruitment domain (CARD), two C terminal domains consisting of a string of WD40 repeats, and three central domains called a nucleo tide binding and oligomerization (NB ARC) region that contain an ATPase domain (Hanson and Whiteheart, 2005) In the monomeric form, both the CARD and NB ARC domains are in a locked conformational state with the WD40 domain folded over (Bao and Shi, 2007; Riedl and Salvesen, 2007) Associated with the NB ARC region is a ( d ) ATP that is hydrolyzed to ( d ) A DP with binding of cytochrome c to the WD40 domain. This leads to a conformational change removing the WD40 domains from inhibiting the CARD and NB ARC domains (Li et al., 1997; Riedl et al., 2005) The CARD and NB ARC domains are still in an inhibitory conformation and require the exchange of ( d ) ADP for ( d ) ATP to become activated (Kim et al., 2005; Riedl et al., 2005; Yu et al., 2005) Therefore, the ADP to ATP exchange represent another level of control in apoptosome formation. With the exchange of ADP for ATP, the CARD and NB ARC domains undergo a conformational change that remove s their inhibition. The active NB ARC domain can then oligomerize to form the 7 member holoenzyme that is

PAGE 31

31 arranged in a wheel shape with the WD40 domains extending out like spokes and the CARD doma in sitting in on top of the NB ARC domain in the center. After apoptosome formation, the final step is for this cytosolic receptor to bind and activat e procaspase 9. The CARD domain of procaspase 9 bind s to the CARD domain of the apoptosome. Caspase 9 is an initiator caspase and functions upstream in the intrinsic pathway. Caspase 9 is present as a monomeric zymogen (procaspase 9) in the cytosol. Like other initiator caspases, caspase 9 is sensitive to apoptotic stimuli but is not easily activated so th at the caspase cascade is not accidentally triggered. The monomeric form of caspase 9 has very little enzymatic activity (Renatus et al., 2001) but activity increases upon dimerization suggesting that caspase 9 is activated by a conformation al change caused by dimerization instead of a cleavage cleavage event like the group II caspases (Riedl and Salvesen, 2007) Procaspase 8 also has a sim ilar activation mechanism and both require being physically brought together onto an activation platform (Boatright et al., 2003) This model, called the induced proximity model, suggests that the role of the apoptosome is to bring multiple units of procaspase 9 together not to cause a cleavage event, but to induce dimer formation leading to a conformational change activating caspase 9 (Muzio et al., 1998; Boatright et al., 2003) The Caspase Cascade Caspases are cysteine proteinases that cleave peptide bonds on the carboxyl side of aspartic acid residues (Cohen, 1997) Caspases are synthesized as zymogens or procaspases with little to no enzymatic activity. Procaspases are structurally organized into three regions; a prodomain, a large subunit, and a small subunit. Caspases involved in apoptosis ( 2, 3, 6, 7, 8, 9, 10, 12) can be split into two groups based

PAGE 32

32 on the size of their prodomains; initiator caspases with long prodomains ( 2, 8, 9, 10) and executioner caspases with short prodomains ( 3, 6, 7, 12). As previously alluded to, i t is hypothesized that the long prodomains on initiator caspases can be activated by a dimerization event that causes a conformational change allowing for exposure of an enzymatic active site, while the short prodomain of executioner caspases requires a cl eavage event for activation (Muzio et al., 1998; Boatright et al., 2003) In the intrinsic apoptotic pathway, caspase 9 is activated by its recruitment to th e apoptosome and dimerization as previously discussed. The executioner caspases 3 and 7 exist at physiological concentrations as dimers with no detectable activity. Active caspase 9 acts enzymatically on caspase 7 and caspase 3 to cleave the Asp X bond between the prodomain and the large subunit and then cleave the Asp X bond between the large and small subunits to allow the formation of a tetramer with two large and two small subunits (Muzio et al., 1998; Slee et al., 1999; Boatright et al., 2003) Activat e d caspase 3 has a variety of cellular targets including BCL2 family proteins, a variety of IAPs, various cytoskele tal proteins (e.g. gelsolin, fodrin, actin, kereatin), other caspases ( 2 and 6), and even a feedback amplification loop that further processes caspase 9 (Srin ivasula et al., 1998; Slee et al., 1999) Activation of caspase 2 and 6 is through a similar mechanism as caspase 3 activation, with cleavage of the prodomain and large and small subunits. Caspase 2 and 6 then activate caspase 8 and 10. The caspase cascade continues to disassemble the cell with cleavage of various proteins and finally terminates with the activation of DNA fragmentation factor.

PAGE 33

33 DNA fragmentation factor (DFF) is a heterodimer consisting of DFFA and DFFB. DFFA and DFFB each contain their own nuclear localization signal (NLS) on the C terminus. As a result, DFF is localized to the nucleus in non apoptotic cells (Liu et al., 1998; Lechardeu r et al., 2000) In addition to the normal 45 kDa form of DFFA there is a splice variant that is 35 kDa (DFFA short) that missing the C terminal NLS and is therefore localized to the cytosol (Sakahira et al., 1999; Samejima and Earnshaw, 2000) DFFB contains an endonuclease active site that is inhibited by its dimerization with DFFA (Enari et al., 1998; Sakahira et al., 1998) DFFA binds to DFFB during translation, allowing for the proper folding of DFFB into an enzymatically capable protein (Enari et al., 1998; Liu et al., 1998) with the possible involvment of HSPA1A and DNAJ homolog 1 (DNAJB1, previously HSP40) (Sakahira and Nagata, 2002) With activation of t he caspase cascade, DFFA is cleaved at two specific sites by caspase 2, 3 or 7 (Liu et al., 1997; Wid ak et al., 2003; Woo et al., 2004; Dahal et al., 2007) Cleavage of DFFA causes it to disassociate from DFFB endonuclease site ( reviewed Wid ak and Garrard, 2005) After removal of DFFA, DFFB forms a homo oligomer that increases its endonuclease activity (Liu et al., 1999; Woo et al., 2004) however this large unit can still b e inhibited by binding of either DFFA or DFFA short (Wid ak et al., 2003) Multiple layers of activation and inhibition suggest that there are multiple fail safes in non apoptotic cells to prevent the accidental activation of DFFB (Wid ak and Garrard, 2 005) DFFB cleaves DNA leaving double strand breaks with 5' phosphate and 3' hydroxyl groups exposed (Liu et al., 1999; Wid ak and Garrard, 2005) Cleavage occurs

PAGE 34

34 intervals (Oberhammer et al., 1993) possibly due to DFFB interacting with other nuclear proteins such a s histone H1 (Liu et al., 1999) (Durrieu et al.) The second stage is the preferential cleavage of DNA into internucl eosomal fragments (Wyllie et al., 1980) The Role of Ceramide as a Signaling Molecule Triggering Apoptosis The early signaling mechanism for stressed induced MOMP is not well understood. One possib le pathway is through sphingomyelin signaling which involves hydrolysis of the phospholipid sphingomyelin (N acylsphingosine 1 phosphocholine) into the sphingolipid ceramide. Ceramide is a second messenger in the stress induced pathway caused by heat shoc k, ultra violet radiation, and ROS (Basu and Kolesnick, 1998; Chung et al., 2003; Moulin et al., 2007; de Castro e Paula and Hansen, 2008) Sphingomyelin is a ceramide linked to a phosphocholine with a phosphodiester bond (Kolesnick, 1991) Hydrolysis is performed by a sphingo myelin specific phospholipase C termed sphingomyelin phosphodiesterase ( SMPD; previously SMase). There are two specific forms of SMPD an acidic form that functions at a pH around 5 ( SMPD1 ) and neutral form that functions at a pH around 7.4 ( SMPD2 ), both yield ceramide and phosphocholine (Kolesnick, 1991) Ceramide can have a variety of chain lengths ranging from a short chain C(2) ceramide to a very long chain C(24) ceramide. Chain lengths may a ffect how ceramide is involved in cellular responses (Kroesen et al., 2003; Senkal et al., 2007) There are two potential ways ceramide may interact with mitoc hondrial signaling, one of which involves BCL2 family proteins. The first signaling mechanism is through the stimulation or inactivation of various kinase leading to the phosphorylation or

PAGE 35

35 dephosphorylation of various members of the BCL2 family. Kinase p athways implicated in ceramide signaling include MAPK9 /MAPK8 and kinase suppressor of RAS/ceramide activated protein kinase (KSR 1 /CAPK ) (Basu and Kolesnick, 199 8; Basu et al., 1998) For example, the phosphroylation of the BH3 only pro apoptotic protein BAD by v akt murine thymoma viral oncogene homolog 1 (AKT1; previously AKT/PKB) on serine 112 and 136 prevents BAD from heterodimerizing with BCL2 or BCL2L1. I nstead BAD is targeted for binding with members of the tyrosine 3 monooxygenase/tryptophan 5 monooxygenase activation proteins (YWHAQ; previously 14 3 3) that sequester and inactivate BAD (Zha et al. 1996) Stimulation of ceramide leads to activation of various kinase that cause prolonged deactivation of AKT1, resulting in the dephosphorylation of BAD on serine 112 and 136 allowing BAD to form h eter odimers with BCL2 and BCL2L1 (Basu et al., 1998) Heat shock induced ceramide signaling, has been shown to stimulate MAPK9 /MAPK8, triggering apoptosis in human monoblastic leukemia cells and bovine aorta endothelial cells (Verheij et al., 1996) The addition of C(2) ceramide to cells has also been shown activate MAPK9 in a concentration dependent manner and induce apoptosis (Verheij e t al., 1996) may also affect mitochondrial biophysics either in cooperation or separately from involvement of the BCL2 family pathway. Ceramides has been shown modify membrane curvature in liposomes leading to their fragmentation (Holopainen et al., 2000) a similar action may occur in the mitochondria (Siskind et a l., 2010) Addition of C(2) ceramide altered the shape of the mitochondria, this was associated with a transient increase of DRP1 and fission 1 (FIS1), which are involved with mitochondrial

PAGE 36

36 fission (Parra et al., 2008) In addition to of ceramide affecting mitochondrial membrane structure, ceramide has been shown to induce MOMP through the formation of ceramide channels in the absence of pro apoptotic BCL2 family members BAX and BAK1 or synergisti cally in cooperation with them (Ganesan et al., 2010) BCL2 and BCL2L1 have also been shown to prevent the formation of ceramide channels probably by the inhibition of ceramide accumulation, and BC L2L1 has been shown to disassemble ceramide channels with an unknown mechanism (Siskind et al., 2008; Ganesan and Colombini, 2010) BCL2 Family Proteins BCL2 w as first identified as a proto oncogene in human follicular lymphoma (Tsujimoto et al., 1984; Bakhshi et al., 1985; Clear y and Sklar, 1985) Whereas most oncogenes promote proliferation, BCL2 promote d cellular survival (Vaux et al., 1988; N ez et al., 1990) Since the initial discovery of BCL2, other proteins in the family have been identified (BCL2L1, BCL2L2, BCL2L3, BCL2L10, BCL2L11, BCL2L12, BCL2L15, BAX, BAK1 BAD, BID, BMF, BOK, PMAIP1, BBC2). BCL2 family proteins are evolutionarily conserved, and a BCL2 homolog is encod ed by a number of viruses, including the majority of gamma herpes viruses and African swine fever virus (Hardwick, 1998; Huang et al., 2002) Structure BCL2 fa mily proteins exist as a globular structure consisting of 5 helices surrounding two central hydrophobic helices (Muchmore et al., 1996; Petros e t al., 2001) Similar structures have been characterized in the membrane translocation domains of pore forming bacterial toxins (Parker and Pattus, 1993; Petr os et al., 2004) The C terminal domain of the some of the BCL2 proteins (e.g. BCL2, BCL2L1, BAX,

PAGE 37

37 BAK1 ) contain a single membrane spanning region consisting of hydrophobic amino acids that allows insertion into the membrane of the mitochondria, endoplasm ic reticulum, and the nuclear envelope (Adams and Cory, 1998; O'Connor et al., 1998; Wang et al., 1998) BCL2 family pr oteins also contain up to 4 BCL2 homology (BH) domains. These domains are important for protein protein interactions, signal transduction, and regulation of cytosolic solubility ( Figure 1 3 ). Anti apoptotic family members ( e.g. BCL2, BCL2L1, BCL2L2, and MCL1) contain all 4 BH domains (Yin et al., 1994; C hittenden et al., 1995; Hunter et al., 1996; Huang et al., 1998) It is the BH4 domain that allows the anti apoptotic proteins to heterodimerize with other members of the BCL2 family. Multi domain pro apoptotic family members contain either 3 BH domain s (BH 1, 2, 3), e.g. BAX, BAK1 BCL2L1 short, and BCL2 related ovarian killer (BOK) (Yin et al., 1994; Chittenden et al., 1995) The BH3 only pro apoptotic fa mily members contain only 1 BH domain (BH3) (e.g. BID, BAD, BCL2L11, BIK, BMF, BLK, BCL GS, PMAIP1, and BBC2) (Wang et al., 1996; Kelekar et al., 1997; Adams and Cory, 1998; Hsu et al., 1998; O'Connor et al., 1998; Oda, 2 000; Wu and Deng, 2002) The BH1, BH2, and BH3 domains form hydrophobic pockets which allow proteins existing in the cytoplasm, for example BAX and BCL2L1, to be soluble (Muchmore et al., 1996) Th e hydrophobic C terminal transmembrane domain region inserts into the hydrophobic pocket created by the BH1 and BH2 domains (Nechushtan et al., 1999; Suzuki et al., 2000; Petros et al., 2004) Interactions of BH3 only proteins with multi domain proteins are a result of the BH3 domain of the BH3 only protein acting as a

PAGE 38

38 domain protein's hydrophobic po cket (BH 1, 2, 3) acting as an (Eskes et al., 2000; Wei et al., 2000; L etai et al., 2002; Cartron et al., 2004) Membrane Permeabilization and Pore Formation The outer mitochondrial membrane is permeabilized by active BAX or BAK1 The N terminus of BAX contains a localization sequence, termed apoptosis regulating and targeti ng sequence (ART), which allows the specific targeting of BAX to the MOM (Goping et al., 1998) The C terminal contains the transmembrane domain which is inserted into the MOM (Eskes et al., 2000; Marani et al., 2002; Lucken Ardjomande and Martinou, 2005; Youle and Strasser, 200 8) Activation occurs with binding of certain BH3 only proteins (e.g. BID and BCL2L11) in response to apoptotic stimuli that in turn leads to several structural changes. The hydrophobic C terminal is removed from the hydrophobic pocket, and the N termin us undergoes a conformational change. Also, some BH3 only proteins recruit BAX to the MOM For example, tBID is rapidly targeted to the MOM following an apoptotic signal (Lovell et al., 2008) even though it lacks a transmembrane domain (Wang et al., 1996) Once associated with the membrane, tBID recruits BAX, inducing a conformational change allowing hairpin formed by helices of BA X to be inserted into the outer membrane (Veresov and Davidovskii, 2009) Thereafter, BAX forms oligomers via interactions of BH3 hydrophobic pockets to form pores that allow components of the mito chondrial inter membrane space proteins such as DIABLO, cytochrome c AIF1 and endonuclease G to be released and trigger apoptosis (Antonsson et al., 2000; Eskes et al., 2000; Wei et al., 2000) This process can be prevented by the addition of BCL2L1, which can bind tBID and to a lesser extent with BAX (Billen et al ., 2008) The BH3 protein, BAD, in turn, can neutralize BCL2L1 to allow BAX activation and pore formation (Lovell et al., 2008)

PAGE 39

39 In contrast to BAX, BAK1 is constitutively inserted into the MOM wh ere, in the absence of apoptotic signals, it is inhibited by binding with VDAC2, MCL1, and BCL2L1 (Cheng et al., 2003; Wi llis et al., 2005; Li et al., 2008) Like BAX, BAK1 activation is dependent on BH3 only proteins such as tBI D where binding causes a conformational change that exposes the BH3 domain of BAK1 allowing it to associate with the hydrophobic pocket of anothe r BAK1 protein and form oligomers (Wei et al., 2000; Dewson et al., 2008) BAX and BAK1 helices that can bind to the water lipid interface of the mitochondrial lipid bi layer. BAX and BAK1 form multimer units in the mitochondrial membrane resulting in stretching the hydrocarbon core of the bi layer in a concentration dependent manner that leads eventually to the formation of a stable pore that is made up of both proteins and lipids (Lee et al., 2008; Qian et al., 2008) Protein Interactions and Signal Transduction Many death stimuli are propagated by BH3 only proteins by signal transduction to the multi domain BCL2 family members. Two different models for signal transduction suggests that certain BH3 only proteins (e.g BID, BCL211, and BBC3) bind directly to the hydrophobic pocket of BAX or BAK1 activating them. The truncated form of BID, tBID, helps recruit BAX to the MOM (Lovell et al., 2008) and participates in the oligomerization and pore formation with BAX (Eskes et al., 2000; Tan et al ., 2001; Marani et al., 2002; Cartron et al., 2004) BAK1 on the other hand, resides in complexes in the mitochondrial outer membrane and endoplasmic reticulum (Wei et al., 2000) Binding of BH3 only proteins causes a conformational change that allows for BAK1 oligomerization (Wei et al., 2000; Cheng et al., 2003; Willis et al., 2005; Dewson et al., 2008)

PAGE 40

40 In addition to activation of pro apoptotic BCL2 family members (BAX and BAK1 ) 3only protein group of BH3 only proteins that function in an capacity. These BH3 only proteins (BAD and BIK) bind the anti apoptotic proteins (BCL2 and BCL2L1) prevent ing them from only proteins (tBID, BCL2L11, and BBC3) As a result, the activator BH3 only proteins are available to bind and activate BAX and BAK1 (Letai et al., 2002) As is apparent from the previous paragraph, the role of the anti apoptotic f amily members in the model of apoptosis is to bind and neutralize the pro apoptotic activator BH3 only proteins prevent ing their action on BAX/ BAK1 In the only proteins activate BAX / BAK1 by removing the direct inhibition of the anti apoptotic proteins on BAX and BAK1 (Adams and Cory, 1998) In this model, BAX and BAK1 are constitutively bound to BCL2 and BCL2L1, thereby they are prevented from acting on the MOM. Upon signal transduction, the BH3 only proteins bind to BCL2 and BCL2L1 via the the BH3 domain interacting with the hydrophobic pocket of BCL2 and BCL2L1 freeing BAX and BAK1 (Kelekar et al., 1997; Sattler et al., 1997) Free BAX and BAK1 then can form multimers within the MOM causing MOMP without th e need for further activation. Current evidence suggests that signal trans duction involves a combination of events described in both models. The activation of BAX and BAK1 only proteins has been demonstrated often (Wang et al., 1996; Desagher et al., 1999; Eskes et al., 2000; Wei et al., 2000; Letai et al., 2002; Cheng et al., 2003; Cartron et al., 2004; Lovell et al., 2008; Kim et al., 2009) There is also evidence showing inhibitory

PAGE 41

41 f unction of anti apoptotic proteins directly on the BAX and BAK1 Interestingly, BCL2, which is expressed only in the mitochondrial outer membrane, binds to and inhibits BAX localized in the cytosol (Zha and Reed, 1997; Wang et al., 1998) BCL2L1, which is membrane bound and cytosolic, also bind s and inhibit s BAX (Billen et al., 2008) Finally, BCL2L1/MCL1, but no t BCL2/BCL2L2, sequester and inhibit BAK1 until BH 3 only activation (Willis et al., 2005) Regulation of BCL2 Family Members Tight regulatory controls of BCL2 family proteins are necessary in order to preserve the balance of life and death. Like the apoptotic cascade itself, there are multiple layers of regulation. The first layer is at the level of gene expression. While some of the BCL2 family proteins are expressed ubiquitously, certain members, especially the pro apoptotic BH3 only members, are transcriptionally upregulated upon an apoptotic stimulus. One example is the p53 dependent upregulation of the BH3 only pro apoptotic proteins phorbol 12 myristate 13 acetate induced protein 1 ( PMAIP1 ; pr eviously NOXA) and BCL2 binding component 3 ( BBC3 ; previously PUMA) upon DNA damage (Oda, 2000; Nakano and Vousden, 2001) Another example is the upregulation of expression of the BH3 only pro apoptotic gene BCL2L11 EL by serum or growth factor starvation (Chalmers et al., 2003; Biswas et al., 2007) Interestingly, upregulation of BCL2L11 EL expression could be blocked by addition of the serine proteinase thrombin (Chalmers et al., 2003) Survival factors, like apoptotic signals, can also effect gene expressio n of BCL2 family members. For example, insulin like growth factor 1 (IGF1) causes reduced expression of the pro apoptotic gene BCL2L11 (De Bruyne et al., 2010) while the

PAGE 42

42 addition of granulocyte ma crophage stimulating factor (CSF2) leads to increased expression of the anti apoptotic gene MCL1 (Chao et al., 1998) Besides inducible changes in gene expression by various factors, there is also temporal and cell/tissue specific variation in gene expression of BCL2 family members. An example is the reciprocal expression of BCL2 and BCL2L1 in various lymphocyte populations (Chao and Korsmey er, 1998) BCL2 is highly expressed in pro B cells and mature B cells, but there is low expression in pre B cells. In contrast, BCL2L1 has low expression in pro B cells and high expression in pre B cells (Chao and Korsmeyer, 1998) Finally BOK BCL2L10 and BCL2L11 are only expressed in the reproductive tissues (Hsu et al., 1997; Song et al., 1999) A lternative splicing is another form of regulation for BCL2 family members. Leading to multiple isoforms in the majority of the BCL2 family members Some variants have no apparent effect on the resulting protein such as the anti apoptotic protein BCL2 L 1 (Ko et al., 2003) or the pro apoptotic protein BAD (Hamn r et al., 2001; Seo et al., 2004) For other splice variants, certain isoforms have greater potency. BCL2 has a long and short isoform (BCL2 L and BCL2 S) of which the long form is more potent (Hockenbery et al., 1993) The pro apoptotic pr otein BCL2L11 has three isoforms, BCL2L11 S, BCL2L11 L and BCL2L11 EL. The shortest of these, BCL2L11 S, is the most potent (O'Connor et al., 1998) Alternative splicing can also affects the functi onal properties of the protein. BAX 3 domains but differ in their C terminal targets it for immediate proteasomal degradation. ibition of its ubiquitination. Moreover,

PAGE 43

43 changes in the C active so that it can be inserted into the MOM without need for further activation (Fu et al., 2009) Sp lice variants can even result in ordinarily anti apoptotic proteins acting as pro apoptotic proteins as is seen with BCL2L1 (Boise et al., 1993) and MCL1 (Bingle et al., 2000) Similarly, some isoforms of the pro apoptotic BID can act as an anti apoptotic protein (Renshaw et al., 2004) Some splice variants only occur in specific cell types or tissues. BCL2L14 is a pro apoptotic protein that has two isoforms, BCL2L14 L and BCL2L14 S. BCL2L14 L is widely expressed while BCL2L14 S is only expressed in the testis (Guo et al., 2001) Another example is the fourth isoform of BCL2L11 called BCL2L11 which is mostly expressed in the small intestine and colon (Liu et al., 2002) The final and perhaps most complex example is a splice variant of BAK1 called N BAK1 which has cell specific expres sion and function. BAK1 is expressed ubiquitously except in central and peripheral neurons, which is the only location where N BAK1 is expressed N BAK1 includes a novel 20 base pair exon that changes BAK1 from a pro apoptotic multi domain (BH 1, 2, 3) p rotein to a BH3 only protein. As a BH3 only protein, N BAK1 functions in neurons as an anti apoptotic protein, but if N BAK1 is experimentally expressed in a non neuronal cell type it functions as a pro apoptotic BH3 only protein (Sun et al., 2001) The final layer of regulation of BCL2 family members involves post translational modifications. Post translational modifications activate BCL2 by phosphorylating the serine residual Ser70 (Haldar et al., 1997; Ito et al., 1997; Maundrell et al., 1997) In addition to activation events, post translation modifications can also lead to the

PAGE 44

44 inactivation of anti apoptotic proteins. BCL2 and BCL2L1 inhibit pro apoptotic proteins by inserting their BH4 domain into the pro created by the BH2 and BH3 domains. In response to apoptotic stimu li BCL2 and BCL2L1 are phosphorylated on serine residuals in the loop region between their BH4 and BH3 domains ( Figure 1 3 ) (Fang et al., 1998; Poruchynsky et al., 1998) possibly by activated MAPK8 (Chang et al., 1997) This phosphorylation event prevents the binding of BCL2 and BCL2L1 to their pro apoptotic targets (Yamamoto et al., 1999) Other post translational modifications convert BCL2 and BCL2L1 from anti apoptotic to pro apoptotic proteins. Caspase 3 can cleave BCL2 and BCL2L1 in the loop region resulting in the production of C terminal truncations (tBCL2 and tBCL2L1) that are missing their BH4 domain changing the function protein to pro apoptotic (Chang et al., 1997) Post translation regulation is al so used on pro apoptotic proteins to maintain them in an inactive state until apoptotic stimuli. MAPK8 and phosphatidylinositol 3 kinase can phosphorylate BAX at Ser184, leading to its insertion into the mitochondrial membrane (Kolliputi and Waxman, 2009) BAK1 is also regulated by mitogen activated protein kinase kinase kinase 1 (MAP3K1; previously MEKK1) and MAPK8 (Ihrlund et al., 2006) MAP3K1 is involved in the conformational change caused by binding to proteins like tBID and may also prevent deconvolution of BAK1 by cross linking several residues After unfolding and activat ing BAK1 it has been proposed that MAPK8 induces the formatio n of BAK1 complexes of 80 170 kDa (Ihrlund et al., 2006) The pro apoptotic BH3 only proteins are another group of BCL2 family members regulated by post translational modifications. This group of proteins uses

PAGE 45

45 phosphorylation, dephosphorylation, and cleavage events for regulation, resulting in changes in cellular localization and binding potential. BAD is phosphorylated at Ser112 by cAMP dependent kinase (Zha et al., 1996; Harada et al., 1999) and Ser136 by AKT1 (Datta et al., 1997) The phosphorylation of these two serine causes BAD to be seque stered in the cytosol by YWHAQ proteins, preventing its interaction with anti apoptotic proteins (Zha et al., 1996; Datta et al., 1997) Dephosphorylation occ urs in response to an apoptotic stimulus leading to its release from YWHAQ and allowing BAD to contribute to cell death (Zha et al., 1996) BID is activated by caspase 8 dependent cleavage (Li et al., 1998) This cleavage event occurs in different parts of the loop region leading to the formation of a truncated form of BID (tBID) (Li et al., 1998) This truncation event leads to the exposure of a to translocate to the MOM (Lovell et al., 2008) Apoptosis in the Preimplantation Embryo Occurrence of Apoptosis in the Oocyte and the Preimplantation Embryo Spontaneous apoptosis is used throughout life as a means to deplete ovarian pools of oocytes (Morita and Tilly, 1999; Perez et al., 1999; Tilly, 2001) signal cell death in ovulated and cultured oocytes (van Blerkom and Davis, 1998; Perez et al., 1999) and as a mechanism responsible for stress induced infertility. For example, dairy cattle show a decrease in fertility rates during summer as a result of heat stress (Badinga et al., 1985; Cavestany et al., 1985; al Katanani et al., 1999) that may be a due to heat shock induced apoptosis in the oocyte (Roth and Hansen, 2004) In addition to the oocyte, spontaneous apoptosis has also been well documented in preimplantation embryo for variety of species including; mouse, rabbit (Fabian et al., 2007) human

PAGE 46

46 (Hardy et al., 1993; Jurisicova et al., 1996) bovine (Byrne et al., 1999; Matwee et al., 2000) and porcine (Long et al., 1998) Several comparative studies also shown that there was higher incidence of apoptosis for embryos produced in vitro as compared embryos produced in vivo (Long et al., 1998; Gj rret et al., 2003) It is because of the imp ortance of apoptosis for determining developmental potential of the oocyte and embryo that it is important to understand mechanisms involved in activation of apoptosis in the oocyte and early cleavage embryo. To understand apoptosis in the preimplantation embryo, a variety of studies have used various stimuli to induce an apoptotic response: pro oxidants (Yang et al., 1998; Feugang et al., 2003; Feugang, 2004; Moss et al., 2009) ultraviolet radiation (Herrler et al., 1998) heat shock (Paula Lopes and Hansen, 2002a) ceramide (de Castro e Paula and Hansen, 2008) arsenic (Krininger et al., 2002) and TNF (Soto et al., 2003; Loureiro et al., 2007) In these experiments, the hallmark of apoptosis has been DNA fragmentation measured by terminal deoxynucleotidyl tran sferase deoxyuridine triphosphate nick end labeling (TUNEL) (Gavrieli et al., 1992) Stress induced apoptosis is mediated through a caspase dependent pathway in oocytes and preimplantation embryos. Stress leads to activation of the caspase cascade beginning with the initiator caspase, caspase 9 (Brad et al., 2007; Lo ureiro et al., 2007; de Castro e Paula and Hansen, 2008) which leads to the induction of group II caspases, including caspase 2, 3, 7 which are responsible for the activation of DFFB leading to DNA fragmentation and TUNEL (Krininger et al., 2002; Paula Lopes and Hansen, 2002; Paula Lopes and Han sen, 2002; Roth and Hansen, 2004; Brad et al., 2007) One of the best studied stress stimuli in preimplantation embryos is heat shock.

PAGE 47

47 Not only does heat shock induce caspase 9 activity (Brad et al., 2007; Loureiro et al., 2007) and group II caspase activity (Paula Lopes and Hansen, 2002; Paula Lopes and Hansen, 20 02) but inhibition of caspases with z LEHD fmk, a specific inhibitor of caspase 9, or z DEVD fmk, a specific inhibitor of group II caspases, blocks heat shock induced TUNEL in the oocyte and preimplantation embryo (Paula Lopes and Hansen, 2002; Roth and Hansen, 2004; Loureiro et al., 2007) Apoptosis as a Protective Mechanism One of the most interesting features of heat sh ock induced apoptosis, in the preimplantation embryo, is the protective role that apoptosis plays. When a preimplantation embryo is exposed to a stress signal, upregulation of apoptosis can help the embryo survive. This has been shown experimentally in s everal studies. Paula Lopes and Hansen ( 2002a) pre cells on DEVD fmk or vehicle for 15 h at 38.5C. After pre treatment e mbryos were exposed to heat shock for 9 h at 41C and then cultured continuously at 38.5C until day 8 when blastocyst rate was measured. Addition of z DEVD fmk blocked the induction of group II caspases and DNA fragmentation caused by heat shock. Contro l embryos which were continuously cultured at 38.5C in either vehicle or z DEVD fmk had 20% blastocyst development E mbryos that were exposed to heat shock for 9 h had a significant decrease blastocyst development to 10% Pre treatment of heat shock e mbryos with z DEVD fmk significantly lowered percent blastocyst development to 3%. Showing that while heat shock has a negative effect on development, if apoptosis is also inhibited by a caspase inhibitor development is further reduced. In another study, embryos collected a t Day 5 of development, and treated with z DEVD fmk did not modify embryo survival after heat shock (Jousan and Hansen,

PAGE 48

48 2007) However, when embryos were also treated with IGF1, which also reduced apoptosis, effects of heat shock were greater when embryos were also treated with z DEVD fmk. Developmental Regulation of Apoptosis in Preimplantation Embryos Experiments evaluating effects of stress on the bovine preimplantation embry o can be interpreted as indicating that there is a developmental acquisition of resistance to cellular stresses as the embryo advances in development. For example, embryos become more resistant to the effects of heat shock as they develop, with the 2 cell embryo being most susceptible (Edwards and Hansen, 1997; Krininger et al., 2002; Sakatani et al., 2004) In fact, the oocyte, is more resistant to effects of heat shock on development than the 2 cell embryo (Edwards and Hansen, 1997) One mechanism that could explain this developmental acquisition of resistance is apoptosis. Apoptosis occurs in the oocyte where it is involved in cell death in ovulated and cultured oocytes (van Blerkom and Davis, 1998; Morita et al., 1999; Perez et al., 1999; Tilly, 2001) For example, Roth and Hansen ( 2004) matured bovine oocytes at 38.5C, 40 C, and 41C M aturation under heat shock conditions reduced the number of oocytes that cleaved and the percentage that became blastocysts. Moreover, treatment of oocytes with heat shock increased group II caspase activity along with TUNEL. Blocking apop tosis with z DEVD fmk blocked the effect of heat shock on oocyte competence for development (Roth and Hansen, 2004) During or after fertilization, apoptosis becomes blocked. Apparently spontaneous apoptosis is first observed at different time points in early preimplantation development: the late 1 cell in mouse (Jurisicova et al., 1998) 2 cell to uncompacted morulae in human (Jurisicova et al., 1996) 16 cell in rabbit (Fabian et al., 2007) and 8 16 cells in

PAGE 49

49 porcine and bovine (Long et al., 1998; Byrne et al., 1999; Matwee et al., 2000) Developmental acquisition of apoptosis has also been shown in response to apoptotic stimuli. Paula Lopes and Hansen ( 2002b) treated 2 cell embryos with heat shock at 41C for 9 h. In both heat shock and control 2 cell embryos there was no cell embryo there was a significant increase in heat shock induced TUNEL. Both control and heat shocked 2 cell embryos had very low amounts of group cell embryos had higher amounts of groups II caspase activity in control embryos compared to the 2 cell, and there was significant heat shock induced increase of group II caspase a ctivity. Due to the temporal coincidence of early signs of apoptosis and embryonic genome activation (EGA), it has been hypothesized that apoptotic regulation in the preimplantation embryo is dependent on EGA (Jurisicova et al., 1998; Byrne et al., 1999) Early cleavage embryos are in a transcriptionally quiescent state where the majority of the proteins produced during this period are translated from maternal stores of mRNA in the oocyte (van Blerkom, 1981) There is a transition over time from maternal stores to new transcripts produced by the embryo (Flach et al., 1982) with minor amounts of transcription occurring followed by a major wave transcription that occurs again in a species specific manner ; late 1 cell to early 2 cell in the mouse (Aoki et al., 1997; Aoki et al., 2003) 4 to 8 cell stage in human, porcine, equine, and feline: (Braude et al., 1988; Tom nek et al., 1989; Brinsko et al., 1995; Hoffert et al., 1997) and 8 16 cell stage in rabbit, ovine, and bovine (Crosby et al., 1988; Kopecn et al., 1989; Memili et al., 1998)

PAGE 50

50 Possible Causes for Developmental Regulation A series of studies have looked at various aspects of the apoptotic cascade and its developmental regulation to try to elucidate why there is a need for EGA and transcription. As previously discussed, heat shock induced apoptosis begins with the conversion of sphingomyelin into ceramide (Chung et al., 2003) To investigate if the developmental regulation of apoptosis was due to a failure to initiate this signaling cascade de Castro e Paula and Hansen ( 2008) compared 2 cell embryos cells with ceramide had an increase in caspase 9 activity, a decrease in number of nuclei, an increase in TUNEL and a decrease in further development. Treatment of 2 cell emb ryo s with ceramide also decreased developmental competence but ceramide did not increase caspase 9 activity or TUNEL. Thus, there is a block to apoptosis in the 2 cell embryos at one or more regulatory events downstream of ceramide signaling. Another app roach to studying developmental regulation of apoptosis has been to treat embryos with staurosporine. This protein kinase inhibitor can activate apoptosis through a caspase dependent or caspase independent pathway (Belmokhtar et al., 2001; Nicolier et al., 2009) C aspase dependent effects of staurosporine cause DNA cleavage in less than 3 h, where the addition of a caspase inhibitor or use of a cell line with defective caspases delays DNA cleavage until after 12 h of treatment (Belmokhtar et al., 2001) Caspase dependent effects of staurosporine involve regulation of the BCL2 family of proteins such as the activation of BAD by inhibition of its hyperphosphorylation (Zha et al., 1996) and through the cleavage of BAD L to BAD S by caspase (Seo et al., 2004) The caspase independent effects of staurosporine involve either AIF1 (Nicolier et al., 2009) or endonuclease G (Zhang et al ., 2003)

PAGE 51

51 Matwee et al. ( 2000) treated bovine embryos ranging from 1 to 16 cells with 10 Treated e mbryos did not cleave during the 30 h of culture and 56 of 59 embryos (95%) displayed TUNEL. The authors concluded that cell death could be induced with staurosporine in the preimplantation embryo but there may be specific upstream mechanisms necessary for the induction of apoptosis by other common environmental stressors. Matwee et al. ( 2000) observed no cell cycle events during staurosporine treatment of 30 h The lack of cell cycle is unusual for this stage of development, suggesting an interac tion of staurosporine with cell cycle events may also have an effect on DNA fragmentation. In a second study, Gj rret et al. ( 2007) treated various stages of bovine preimplantation embryos w ith 10 There was no induction of TUNEL in 2 cell embryos and only small amounts of TUNEL in 4 and 8 cell embryos However, m ost morulae and blastocyst had several blastomeres with TUNEL. Similarly, there was no activated caspase 3 in 2 cell embryos, only small amounts of activated caspase 3 in 4 and 8 cell embryos Again like TUNEL, the majority of morulae and blastocysts had several blastomeres with activated caspase 3 Taken together these data suggest that the 2 cell embryo ma y have the capacity for s taurosporine induced DNA fragmentation however due to the extended period of treatment (24 30 h) and the lack of a caspase inhibition study it is unclear if DNA fragmentation is through a caspase dependent mechanism. Another model to study developmental regulation of apoptosis has been to evaluate effects of the chemical depolarization of the mitochondria using carbonyl cyanide 3 chlorophenylhydrazone (CCCP). CCCP bypasses the control of the BCL2

PAGE 52

52 family of proteins to chemically d epolarize the mitochondrial membrane and sets into motion the caspase cascade. Brad et al. ( 2007) found that CCCP led to the activation of caspase 9 and group II caspases in both the 2 cell cell embryo s Thus, an intact system leading to activation of executioner caspase is present in the 2 cell embryo. However, CCCP did not induce TUNEL in 2 cell embryos, although it did in cell embryos, suggesting that there is block at the le vel of the nucleus preventing caspase dependent DNA fragmentation. One possible explanation for the lack of DNA fragmentation could be the structure of the DNA in the early preimplantation embryo. Prior to the EGA, the DNA is highly methylated (Jung Sun Park et al., 2007) As the embryo approaches EGA, the DNA becomes demethylated with each cell cycle (Dean et al., 2001) Carambula et al. ( 2009) found that treatment of 2 aza 2' deoxycytidine (AZA) to reduce DNA methylation or 100nM trichostatin A (TSA) to inhibit histone deacetylation allowed a CCC P dependent increase of TUNEL positive nuclei in 2 cell embryos. These data suggest that that apoptosis is blocked by the inaccessibility of DNA to DFFB due to extensive chromatin structure caused by DNA methylation and histone acetylation. Thesis In add ition to the nuclear block, Brad et al. ( 2007) identified a second developmental block of apoptosis in the bovine preimplantation embryo; at the level of the mitochondria. Bypassing the upst ream intrinsic signaling mechanism, CCCP induces mitochondrial depolarization and caspase activation (Brad et al., 2007) However, induction of the upstream signaling mechanism, specifically the BC L2 family of proteins, with either heat shock or ceramide fails to induce mitochondrial

PAGE 53

53 depolarization and caspase activation in 2 cell embryo (Paula Lopes and Hansen, 2002; de Castro e Paula and Hansen, 2008) Indicating that anti and pro apoptotic proteins involved in this upstream signaling mechanism may be developmentally regulated. To further investigate the developmental acquisition of apoptosis in the b ovine embryo, we hypothesize that the block at the level of the mitochondria involves an upregulation of anti apoptotic genes (BCL2, BCL2L1, HSPA1A, DFFA) and a down regulation of pro apoptotic genes (BAX, BAD, DFFB) in the 2 cell bovine preimplantation em bryo. Objective 1 measure steady state mRNA using quantitative real time RT PCR to identify transcriptional regulation in the ooctye 2 cell embryo 2 cell embryo treated with amanitin, and embryos that have undergone genome a cell). Objective 2 determine the presence and quantify immunoreactive concentrations of anti apoptotic protein s (BCL2, BCL2L1, HSPA1A) and pro apoptotic proteins (BAX, BAD) using immunocytochemistry to identify protein expression differences between 2 cell bovine embryos. Objective 3 verify significant differences found by immunocytochemical results by Western blotting

PAGE 54

54 Figure 1 1 Schematic of the extrinsic or receptor mediated apoptotic pathway. Dashed lines represent a cleavage event changing a protein from an inactive to active form. Solid lines represent the protein acting upon another molecule. Adapted from MacFarlane ( 2003)

PAGE 55

55 Figure 1 2. Schemati c of the intrinsic or mitochondrial apoptotic pathway. Dashed lines represent a cleavage event changing a protein from an inactive to active form. Solid lines represent the protein acting upon another molecule.

PAGE 56

56 Figure 1 3 Schematic drawing of the BCL2 family proteins. There are two major forms of BCL2 family proteins, anti apoptotic and pro apoptotic. BCL2L1 (green) represents the anti apoptotic proteins including BCL2, BCL2L2, and MCL1. The pro apoptotic BCL2 family members (red) are further se parated into those that contain multiple BH domains (multi domain) and those that contain only the BH3 domain (BH3 only). BAX represents the multi domain pro apoptotic proteins including BAK1 and BOK. BID represents BH3 only proteins including BAD and BC L2L11. Adapted from Yin et al. ( 2003)

PAGE 57

57 CHAPTER 2 DEVELOPMENTAL ACQUIS ITION OF APOPTOSIS I N THE BOVINE PREIMPLANTATION EMBR YO Introduction Exposure of preimplantation embryos to a variety o f cellular stresses can induce apoptosis in all or a fraction of blastomeres. Among the conditions that induce apoptosis in the bovine embryo are heat shock (P aula Lopes and Hansen, 2002; Paula Lopes and Hansen, 2002) arsenic (Krininger et al., 2002) pro oxidants (Feugang et al., 2003; Feugang, 2004; Moss et al., 2009) and tumor necrosis factor (Soto et al., 2003; Loureiro et al., 2007) The consequences of apoptosis on the developmental competence of the embryo ar e dependent on the extent of its induction. Induction of apoptosis in up to 30% of blastomeres, as for example occurs after TNF administration (Soto et al., 2003a) has no effect on development to the blastocyst stage. In fact, apoptosis may allow the embryo to survive stress by removal of damaged cells. Inhibition of apoptosis by the addition of the group II caspase inhibitor z DEVD fmk exacerbated the deleterious effect of heat shock on developm ent to the blastocyst stage (Paula Lopes and Hansen, 2002; Jousan and Hansen, 2007) Extensive apoptosis, as it occurs after inhibition of survivin synthesis through RNA interference (SY Park et al., 2007) leads to a block in development. Induction of apoptosis is developmentally regulated. In cultured bovine embryos, TUNEL positive cells are f irst seen between the six and eight cell stage (Matwee et al., 2000; Gj rret et al., 2003) Similarly, acquisition of an apoptotic response to heat shock (Paula Lopes and Hansen, 2002b) and TNF (Soto et al., 2003a) also occurs after the eight cell stage. Heat shock induces apoptosis through the mitochondrial or intrinsic pathway by activation of caspase 9 and group II caspases such as caspase 3 (Krininger

PAGE 58

58 et al., 2002; Paula Lopes and Hansen, 2002; Paula Lopes and Hansen, 2002; Brad et al., 2007; Loureiro et al., 2007) The induction of apoptosis by heat shock, as shown by TUNEL, can be blocked by the addition of caspase 9 or group II caspase inhibitors (Paula Lopes and Hansen, 2002; Loureiro et al., 2007) Interestingly TNF also acts in th e bovine preimplantation embryo through a caspase 9 dependent pathway (Loureiro et al., 2007) The inhibition of apoptosis in early cleavage stage embryos involves at least two blocks in the intrin sic pathway. The mitochondria itself is resistant to depolarization since neither heat shock (Paula Lopes and Hansen, 2002; Brad et al., 2007) nor ceramide (a putative signaling molecule for activation of the intrinsic pathway) (de Castro e Paula and Hansen, 2008) induce caspase 9 or group II caspase activation in the 2 cell embryo In addition, the nucl eus is resistant to caspase mediated TUNEL. Artificial activation of the intrinsic pathway by carbonyl cyanide 3 chlorphenylhydrazone (CCCP), a chemical inducer of mitochondrial depolarization, activated caspase 9 and group II caspases in 2 cell embryos b ut did not result in DNA fragmentation (Brad et al., 2007) Resistance to caspase activated DNases is caused, at least in part, by epigenetic modifications that can be reversed by interfering with DNA methylation or histone deacetylation (Carambula et al., 2009) The objective of the present study was to determine the molecular basis for the developmental changes in mitochondrial and nuclear responses to pro apoptotic signals. We hypothesized that the 2 cell embryo contains more anti apoptotic proteins and les s pro cell embryo. The focus was on several members of the BCL2 family of proteins regulating mitochondrial permeability in response to pro apoptotic signals (Youle and Strasser, 2008) heat shock protein 70

PAGE 59

59 ( HSP A1A ), which can inhibit mitochondrial depolarization by interrupting the BCL2 family signaling cascade (Stankiewicz et al., 2005) inhibit ca spase activation and caspase 3 activity (Garrido et al., 2001) and DFFA (also called inhibitor of caspase activated DNase), which is cleaved during apoptosis to activate caspase activated DNase ( DFFB) (Liu et al., 1997) Materials and Methods Materials Media for in vitro production of embryos were obtained as follows. HEPES Tyrodes Lactate (TL) and IVF TL were purchased from Millipore (Bill erica, MA, USA) or Caisson Laboratories, Inc. (North Logan, UT, USA) and used to prepare HEPES Tyrodes albumin lactate pyruvate (TALP) and IVF TALP as described by Parrish et al. ( 1986) Ooc yte collection medium was Tissue Culture Medium 199 (TCM 199) with supplemented with 2% (v/v) bovine steer serum (Pel Freez Biologicals, Rogers, AR, USA) containing 2 U/mL hepari n, 100 U/mL penicillin G, 0.1 mg/mL streptomycin, and 1 mM glutamine. Oocyte maturation medium was TCM 199 (Gibco, Invitrogen, e steer serum, 2 g/mL estradiol 17 V; Agtech Inc., Manhattan, KS, USA), 22 g/mL sodium pyruvate, 50 g/mL gentamicin sulfate (Sigma Aldrich, St. Louis, MO, USA), and 1 mM L glutamine or alanyl glutamine. Percoll was fr om GE Healthcare (Uppsala, Sweden). Frozen semen from various bulls was donated by Southeastern Semen Services (Wellborn, FL, USA). Potassium simplex optimized medium (KSOM), containing 1 mg/mL bovine serum albumin, was obtained from Millipore or Caisson Laboratories Inc. KSOM was modified with 3 mg/mL essentially

PAGE 60

60 fatty acid free BSA (Sigma Aldrich), 2.5 mg/mL gentamicin, 100 U/mL penicillin G, and 1x nonessential amino acids (Sigma Aldrich), to produce KSOM Bovine Embryo 2 (BE2) as described elsewhere (Soto et al., 2003b) Medium for culture of BEND cells was prepared using powdered Eagle's Minimum Essential Medium and Ham's F12 from Sigma Aldrich. Fetal bovine serum and heat inactivated horse se rum were from Atlanta Biologicals. Penicillin streptomycin was purchased from Millipore, human recombinant insulin was purchased from Invitrogen, and D valine and sodium bicarbonate were from Sigma Aldrich. BEND cell culture medium, as previously describe d (Staggs et al., 1998) Minimum Essential Medium and 5.35 g/L powdered Ham's F 12 with 10% (v/v) fetal bovine serum, 10% (v/v) heat inactivated horse serum, 0.2 U/mL i nsulin, 0.034 mg/mL D valine, 1.685 mg/mL sodium bicarbonate, 100 U/mL penicillin G, and 0.1 mg/mL streptomycin. In Vitro Production of Embryos Embryo production was performed as previously described (Soto et al., 2003b) Briefly, a mixture of beef and dairy cattle ovaries were obtained from a local abattoir (Central Beef Packing Co., Center Hill, FL, USA) and cumulus oocyte complexes (COCs) were collected by slicing follicles that were 2 to 10 mm f ollicles in diameter on the surface of ovaries. Cumulus oocyte complexes containing at least one layer of compact cumulus cells were selected for subsequent steps. These COCs were washed twice in oocyte collection medium and placed in groups of 10 in 50 L drops of oocyte maturation medium with a mineral oil overlay and matured for 20 to 22 h at 38.5C and 5% CO2 in humidified air. Matured oocytes were then washed twice with HEPES TALP and transferred in groups of 200 to a 35 mm x 10 mm petri dish contai ning; 1.7 mL IVF

PAGE 61

61 TALP, 80 L PHE (0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 M epinephrine in 0.9% (w/v) NaCl), and 120 L Percoll purified spermatozoa [17x10 6 sperm/mL] from a pool of frozen thawed semen (3 to 4 bulls; a separate pool of semen wa s used for each replicate) for a final concentration of approximately 1.2x10 6 sperm/mL at fertilization. After 8 to 10 h of co incubation at 38.5C, 5% CO 2 in humidified air, putative zygotes were removed from fertilization plate and denuded of cumulus ce lls by vortexing in 100 L hyaluroni dase (1000 U/mL in HEPES TALP). Denuded putative zygotes were cultured in groups of 25 to 30 in 50 L drops of KSOM BE2 or KSOM BE2 2 5% O 2 ~90% N 2 with humidified air. BEND Cell Culture The BEND cell line, derived from bovine endometrium, was purchased from American Type Culture Collection (Ma nassas, VA, USA). Cells were grown in BEND cell culture medium at 38.5C and 5% CO 2 with humidified air. At confluence, cells were trypsinized, centrifuged for 10 min at 300 x g and re suspended in fresh complete medium. Cells were then either collected or propagated. RNA Extraction Oocytes were collected after 22 h of maturation 2 cell and 2 cell embryos treated amanitin were collected between 28 to 29 h post cell embryos were collected at Day 5 post insemination. Total RNA was extracted using the PicoPure RNA isolation kit (Molecular Devices, Sunnyvale, CA, USA) following the of 70% (v/v) ethanol was added and the mixture added to a pre conditioned RNA

PAGE 62

62 purification column. After a series of 3 washes using two different wash buffers, RNA concentration was determined using a NanoDrop 2000 (Therm o Fisher Scientific Inc., Waltham, MA, USA) and samples were stored at 80C until analysis. Total RNA was extracted from BEND cells using the RNeasy Plus Micro Kit 5 BEND cel ls were lysed in a 1.5 mL microcentrifuge tubes by repeat pipetting with a 20 gauage remove genomic DNA. After mixing with 70% (v/v) ethanol, samples were transferred t o the RNeasy MiniElute spin columns. Samples were then washed with a series of free water into a clean 1.5 mL microcentrifuge tube. The RNA concentration was determined using a NanoDrop 20 00 and samples were stored at 80C. Quantitative Real Time RT PCR (qPCR) Primers used for qPCR were manufactured by Integrated DNA technologies and are described in Table 2 1 To remove contaminating DNA, RNA samples were tr eated with DNase I (New England Biolabs, Ipswich, MA, USA) according to manufacturer's 2 O (DEPC) at 37C for 30 min followed by 75C for 15 min. cDNA was produced using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, DEPC H 2 O. Reverse transcription was performed

PAGE 63

63 2 ) master mix (3.9 2 dNTPs). Reaction conditions were as follows; 25C for 10 min, 37C for 2 h, and 85C for 5 min. cDNA from BEND cell samples was used to produce a standard curve to test efficiency of each primer. After reverse transcription, samples were diluted using fivefold dilutions to create a five point standard curve. Standard curves were run in a Geen PCR master mix (Applied Table 2 1 ) and 8.5 2 O] using an ABI 7300 instrument (Applied Biosystems). The conditions for amplification were as follows : 1 cycle for 10 min at 95C followed by 50 cycles of 15 sec at 95C and 1 min at 60C. Cycle threshold (Ct) values were plotted against the log 10 of the template concentration and primers used if the slope was between 2.9 to 3.7 with an R 2 >0.95 In ad dition agarose gel electr o phoresis was performed to v erify synthesis of a single product at the appropriate size (data no shown). cDNA from multiple RT(+) reactions, from the same pool 20 of oocytes or embryos, were pooled together to ensure adequate cDN A. Each real time plate consisted of one replicate of all genes in all sample groups (oocyte, 2 cell, 2 mM forward and reverse primers ( Table 2 1 2 O] using an ABI 7300 PCR machine

PAGE 64

64 (Applied Biosystems). Amplification proceeded for 1 cycle for 10 min at 95C followed by 50 cycles of 15 sec at 95C and 1 min at 60C. Immunocytochemistry Two cell embryos were collected at Day 5 post insemination. Two cell embryos were 4 pH 7.4 containing 0.9 % (w/v) NaCl (PBS) and 1 mg/mL polyvinylpyrrolidone (PBS PVP) by transferring from drop to drop. Embryos were fixed for 15 min in PBS containing 4% (v/v) paraformaldehyde. After fixation, embryos were washed in PBS PVP and stored at 4C for up to a week. Antibodies were affinity purified ra bbit polyclonal antibodies for BCL2 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2L1 (AbCam Cambridge, MA, USA), BAX (Santa Cruz Biotechnology) and BAD (Assay Designs, Ann Arbor, M I, USA) or a purified mouse monoclonal antibody for HSPA1A (Chemicon International) and either fraction purified rabbit IgG or mouse IgG (Sigma Aldrich) was used as a negative control. Each antibody was used at a concentration determined to be optimal in preliminary specif incubated for 5 min in the dark. An equal mass of Zenon nonspecific IgG was then added to block unbound Fab fragments and incubated for 5 min in the dark. Two cell embryos were permeabilized in groups of 30 PBS + 0.2% (v/v) Triton x (Sigma Aldrich) for 30 min at room temperature. Embryos

PAGE 65

65 were washed four times in PBS normal goat serum (Pel Freez Biologi cals, Rogers, AR, USA ) for at least 1 h at room temperature. After blocking, embryos were briefly washed in 1 drop of PBS PVP and then transferred to a drop of Zenon labeled antibody or labeled IgG and incubated for 1 h at room temperature. Embryos wer e then washed 4 times, fixed for 15 min in 4% Aldrich) for 15 min. Embryos were washed 4 to 5 times, mounted on a microscope slide using ProLong Gold Anti Fade mounting medium ( Thermo Fisher Scientific Inc), and fluorescence visualized using the a Zeiss Axioplan microscope (Zeiss, Gttingen, Germany) with a 40x objective and the FITC, DAPI, and DIC filter sets. Digital images were acquired using the AxioVision software and a hig h resolution black and white AxioCam MRm digital camera (Zeiss). Image Analysis Using ImageJ (National Institute of Heath, Bethesda, MA, USA), individual embryos were outlined by hand with the polygon selection tool. After selection, additional exclusion was made for areas that did not correspond to the embryo as well as areas within the embryo between cells and, in cases where it occurred, in regions of the embryo that had broken through the zona pellucida. In the latter case, extrusion through the zona pellucida was a fixation artifact and extruded areas were consistently associated with lower fluorescent intensity. Mean gray pixel intensity of the selected area was measured using the FITC channel. Background and non specific binding was removed by ave raging mean pixel for IgG controls and subtracting these values from individual mean pixel intensities of embryos in corresponding stages. Adjusted mean pixel intensities that were below zero were set to zero.

PAGE 66

66 Western Blotting Oocytes were collected after 22 h of maturation, 2 cell and 2 cell embryos treated cell embryos were collected at Day 5 post insemination. Before collecting oocytes, cumulus oocyte complexes were washed twice with HEPES TAL P and then denuded of cumulus cells by vortexing in 100 L hyaluronidase (1000 U/mL in HEPES TALP). Denuded oocytes PVP by transferring from drop to drop. Groups of 25 to 100 ooctyes/embryos were p laced in a pre drop pronase for 2 5 min on a slide warmer to digest the zona pellucida. Groups of oocytes or embryos up to 200 in number were then placed into 1.5 mL microcentrifuge tubes containing 1 mL PBS PVP. Samples were centrifuged at 13,600xg, supernatant removed and samples were stored at 80C. BEND cells were used as a positive control. They were collected after trypsinization, washed once with 1 mL PBS, adjusted to 1x10 6 /m L and then aliquoted in groups of 10 5 cells into 1.5 mL mic rocentrifuge tubes. Tubes were then centrifuged for 10 min at 13,600xg and supernatant was removed. Cells were stored at 20C. buffer [0.125 M Tris HCl pH 6.8 containing 20% (v/v) sucrose, 10% (w/v) sodium dodecyl sulfate (SDS), trace amounts of bromophenol blue, and 5% (v/v) 2 mercaptoethanol]. Simila buffer. Samples were boiled at 95C for 5 min and cooled on ice for 1 min before performing one dimensional, discontinous SDS polyacrylamide gel electrophoresis (SDS PAGE) using a Ready Gel 4 15% ( w/v) Tris HCl (Bio Rad, Hercules, CA, USA) gel. Conditions for electrophoresis were 125 V, 40 mA for 1 to 1.5 h at room

PAGE 67

67 temperature. Proteins were then transferred electrophoretically to a Hybond ECL 0.2 tions for transfer were 30 V, 90 mA for 12 h at 4C using a degassed buffer of 25 mM Tris, 193 mM glycine, and 20% (v/v) methanol. Membranes were blocked overnight in TBS T [10 mM Tris pH 7.6, 0.87% (w/v) NaCl, and 0.3% (v/v) Tween 20] that also contained 5% (w/v) non fat dry milk (TBS TM). Membranes were rinsed 2 times with TBS T and incubated for 2 h at 4C with either a polyclonal antibody (BCL2 or B AX : Santa Cruz Biotechnology) or rabbit TM. Membranes were washed 4 times with TBS T and then incubated for 1.5 h at 4C with horseradish peroxidase conjugated to goat ant rabbit IgG TM and then washed a s above. Blots were exposed to the ECL Plus Western blotting chemiluminescence substrate kit (GE Healthcare) for 5 min and then exposed to film for 3 to 15 min. To allow re probing, membranes were stripped using a stripping buffer [62.5 mM Tris HCl, 2% (w /v) SDS, 100 mM 2 mercaptoethanol] for 30 min at 50C. Membranes were washed and re probed as described before. Peptide neutralization was performed produce BCL2 or Bax (Santa Cruz) was pre respective antibody for 1 h and the antibody mix ture was used to probe blots as described above. Experimental Design For all experiments, control drops were set aside to assess cleavage at Day 3 post insemination and development to the blastocyst stage at Day 8 post insemination. Only replicates with characteristic cleavage and blastocyst development rates were used for molecular or immunochemical analysis.

PAGE 68

68 q PCR : Treatments included MII oocytes, 2 cell embryos, 2 cell embryos treated with 50 cell embryos. Oocytes and embryos were collected and analyzed in groups of 20. Eight genes were analyzed for each treatment four anti apoptotic ( BCL2 BCL2L1 HSPA1A and DFFA ) three pro apoptotic ( DFFB BAX and BAD ), and HIST1H2 A as a house keeping gene (Robert et al., 2002) The q PCR experiment s w ere replicated 5 times. Immunocytochemsity: For each antibody, treatments included 2 cell embryos and cell embryos. Each replicate consisted of at least 10 2 cell and 10 cell embryos for IgG negative controls and at least 10 2 cell embryos for antibody labeling (BCL2, BCL2L1, HSPA1A, BAX, BAD). E xperiments were replicated 4 to 8 times with (BCL2, n= 111; BCL2L1, n= 183; HSPA1A, n= 239; BAX, n= 142; BAD, n= 186). Western blotting : A total of 4 Western blots were performed. Treatments included on all blots were MII oocytes, 2 cell embryos, cell embryos. In addition, 2 cell embryos treated with 50 amanitin and BEND cells were included on one blot. Except for BEND cells or where noted e ach lane contained 200 oocytes or embryos. Membranes were stripped to allow for blotting with different antibodies. Statistical Analysis Data on mRNA abundance we re subjected to least squares analysis of variance using the General Linear Models procedure (GLM) of the Statistical Analysis System (SAS for Linux, Release 9.2, SAS Institute Inc., Cary, NC, USA). PCR data were analyzed using Ct. In preliminary analysis using cycle threshold (Ct) values, HIST1H2 A had significant variation between treatments, accordingly DFFB was used instead as a housekeeping gene because it was similarly expressed between

PAGE 69

69 treatments. The p diff procedure wi th Tukey adjustment was used as a means separation test. The Ct value for each gene was calculated by the difference between the Ct of the embryo groups and the Ct of MII oocytes. Data are reported as fold change calculated by 2 Ct Data on adjuste d pixel intensity from immunocytochemical analysis were also analyzed by least squares analysis of variance using PROC GLM. Replicate was considered as a fixed effect and the p diff procedure was used as a means separation test. Results Quantitative Real Time RT PCR A total of 8 genes were analyzed by q PCR including anti apoptotic genes ( BCL2 BCL2L1 HSPA1A and DFFA ), pro apoptotic genes ( BAX BAD and DFFB ), and HIST1H2A DFFB did not vary between stages and was used as a housekeeping gene for calculati on of Ct. Differences in steady sta t e concentrations of m RNA for each gene are shown in Figure 2 1 Of the anti apoptotic genes, BCL2 steady state mRNA did not differ significantly different between MII oocytes, 2 cell embr amanitin treated 2 cells, but was lower in cell embryos compared to the earlier stages (panel A; P<0.0001). There was no significant effect of stage of development on steady state mRNA concentrations of BCL2L1 (panel B). Patterns of m RNA con centrations for HSPA1 A ( p anel C) and DFFA (panel D) were similar to those for BCL2 with a 16 cells. This difference was significant for HSPA1 A (P=0.0005) but not for DFFA For the pro apoptotic genes, steady state concentrations of BAX were not affected by stage (panel E). However, steady state

PAGE 70

70 concentrations of BAD had a distinct temporal pattern with a significant increase in cells (panel F; P<0.0001). Immunocytochemistry and Western Bl otting As shown in Figure 2 2 immunoreactive BCL2 detected by immunoflourescence was greater for 2 Figure 2 2 B with Figure 2 2 panel E). Adjusted mean p ixel intensity of immunoflourescence was greater (P=0.001) for 2 cell embryos ( Figure 2 2 panel G). These results were confirmed by Western blotting in three separate replicates. In t he first (panel H), the BCL2 band was more intense for 2 cell embryos (lane 3) than cell embryos (lane 4) despite fewer embryos being loaded per lane. In the second blot (panel J), equal numbers of oocytes or embryos were loaded per lane and there was higher amounts of immunoreactive BCL2 in 2 ce ll embryos (lane 3). In the final blot (panel J), with equal numbers per lane, a membrane defect partially obscured the lane with 2 cell embryos (lane 2). However, amounts of immunoreactive BCL2 were lowest cell embryos (lane 4). Immunolabeling of BCL2 was eliminated when antibody was co incubated with a BC L2 peptide (results not shown). Shown in Figure 2 3 are immunocreactive amounts of BAX using immunocytochemistry (panels A G) and Western blotting (panels H J). Immunoreactive BAX detected by immunoflourescence was lower for 2 cell embryos than for embryos Figure 2 3 B with Figure 2 3 panel E). Pixel intensity of immunoflourescence was lower (P < 0.0001) for 2 cell embryos ( Figure 2 3 panel G). Three Western blots were performed to further evaluate developmental changes in immunoreactive BAX. In the first blot, immunoreactive BAX was detected at the expected molecular weight (23 kDa) and there was slightly less BAX i n embryos 16

PAGE 71

71 cells than for MII oocytes and 2 cell embryos (panel H). In the second (panel I) and third blots (panel J), a different pattern was present. Three immunoreactive bands were detected, all of which could be eliminated by co incubation of antibody with BAX peptide (data no shown). One band was of expected size (23 kDa), another larger band of 46 kDa was present that presumably represents BAX dimmers, and a third, low molecular weight band that could represent proteolytic cleavage products was present. Differences between stages in amounts of the 23 kDa BAX were variable. The higher molecular weight 46 kDa form was present in higher amounts in 2 cell embryos than in MII oocytes and yet higher amounts in 16 cell embryos. There were no effects of stage of development on amounts of immunoreactive BCL2L1, HSPA1A or BAD as determined by immunofluorescence ( Figure 2 4 ). Discussion The ability of the preimplantation bovine embryo to undergo an apoptotic response is developmentally regulated with stress induced apoptosis being blocked prior to embryonic genome activation, around the 8 to 16 cell stage in the bovine, (Krininger et al., 2002; Paula Lopes and Hansen, 2002; Soto et al., 2003; Brad et al., 2007; Carambula et al. 2009) The block to apoptosis is not caused by a lack of apoptotic machinery because chemical depolarization of the mitochondria using CCCP leads to the activation of both caspase 9 and group II caspases (Brad et al., 2007) These data indicate that one of the developmental blocks to the apoptotic pathway is at the level of the mitochondria. Life and death of a cell is dictated by a delicate balance of anti and pro apoptotic BCL2 family protei ns (Adams and Cory, 1998) Anti apoptotic BCL2 family members (BCL2 and BCL2L1) inhibit apoptosis by heterodimerizing with pro apoptotic BCL2

PAGE 72

72 family members (BAX, BAK, BOK). Heterodimerization prev ents the pro apoptotic BCL2 family proteins from forming homodimers which are required for mitochondrial pore formation and depolarization. Present results indicate that there is a switch from an abundance of BCL2 in early cleavage stage embryos, which are not capable of apoptosis, to increased amounts of BAX protein and BAD mRNA in later stage embryos, which possess the capacity for apoptosis. Quantitative real time RT PCR indicated higher amounts of BCL2 in oocytes and 2 cell embryos. BCL2 has also been shown to significantly decrease from the zygote to the 2 cell embryo in the mouse (Exley et al., 1999) which is also coincident with mouse genome activation (Flach et al., 1982) I n the human preimplantation embryo BCL2 is present at all stage s however it is highly expressed in the 2 cell embryo and expression decreases in the 4 to 6 cell embry o again coincide nt with genome activation (Spanos et al., 2002) Immunoreactive amounts of BCL2 protein is also higher in the 2 cell embryo than cell embryo. While BCL2 is higher in the 2 cell embryo, i t is not the result of amanitin, a transcription inhibitor, has no effect on steady state amounts of BCL2 mRNA or protein expression. Therefore, most likely BCL2 in the early cleavage embryo is maternally derive d. Prior to embryonic genome activation the embryo is transcriptionally quiescent with the majority of its mRNA and proteins being derived from maternal stores in the oocyte (van Blerkom, 1981; Flach et al., 1982) Total RNA, mRNA, and protein concentration decrease throughout preimplantation development until after embryonic genome activation. This temporal expression pattern has been seen in bovine with

PAGE 73

73 RN A and protein expression decreasing from the 2 cell to the 8 cell stage and then slowly increasing from the morula to the blastocyst stage (Gilbert et al., 2009) Data presented show the same expre ssion pattern for BCL2. The higher concentration of BCL2 in 2 cell embryos contributes to making the mitochondria refractory to stimuli leading to apoptosis. Steady state mRNA of HSPA1A is also higher in the oocyte and 2 cell embryo than the 16 cell embryo HSPA1A mRNA follows the same temporal decrease as BCL2 but immunoreactive concentration of HSPA1A protein remained constant through cell stage. One possible explanation for this could be post transcriptional regulation of HSPA1A by RNA binding proteins. RNA binding proteins influence RNA localization, stability and translation. They serve an important role in the oocyte and preimplantation embryo maintaining mRNA stores throughout development until embryonic genome activation. The bovine embryo has been shown to have a variety of these RNA binding proteins including staufen 1 and 2 and ELAVL1 (Calder et al., 2008) ELAVL1 has been shown to bind to HSPA1A mRNA in the bra in, and post transcriptionally regulate HSPA1A expression (Amadio et al., 2008) The stability of HSPA1A protein concentration may be related to the regulatory control of ELAVL1 or other RNA bindin g proteins present in the preimplantation embryo. BCL2L1, another anti apoptotic member of the BCL2 family, does not show signs of developmental regulation in either mRNA or protein expression. BCL2L1 mRNA and BCL2L1 protein concentration is extremely sta ble during preimplantation development confirming previous results in the bovine (Knijn et al., 2005) and mouse (Exley et al., 1999) Howev er, BCL2L1 expression pattern may be extremely important in

PAGE 74

74 preimplantation development. Unlike, BCL2 and HSPA1A where there is a temporal decrease of mRNA and protein, BCL2L1 expression remains constant. This suggests that BCL2L1 may be actively transcr ibed prior to embryonic genome activation, or there may be tight post transcriptional controls to maintain BCL2L1 protein concentration. Acquisition of capacity for apoptosis at the 16 cell stage is accompanied not only with a decrease in amounts of BCL2 but also by changes in the pro apoptotic BCL2 family members. There are two major classes of the pro apoptotic BCL2 family members; multi domain proteins (BAX, BAK, BOK) and BH3 only domain proteins (BAD, BID, BIK, etc.). The multi domain members form he terodimers with the anti apoptotic proteins in the cytosol and mitochondrial membrane. Upon apoptotic stimuli, BH3 only members are activated and either heterodimerize with anti apoptotic proteins (BCL2, BCL2L1, MCL1) to inhibit their function or bind to the multi domain pro apoptotic proteins leading to mitochondrial localization and pore formation (Lucken Ardjomande and Martinou, 2005) In the current study we investigated the multi domain member BAX and the BH3 only member BAD. There are complex developmental changes for both molecules. Steady state mRNA for BAX does not vary between developmental stages. Similar results have been described in the mouse (Exley et al., 1999) and human (Metcalfe et al., 2004) In contrast, immunocytochemical analysis indicates not only an cell stage, but also an increased amount of high molecular weight BAX as detected in some of the Western blot results. Such results suggest post translational regulation of BAX increasing its capacity for dimerization and therefore activity.

PAGE 75

75 In SDS PAGE under reduci ng conditions, proteins are denatured by the addition of a reducing agent such as 2 mercaptoethanol or dithiothreitol, which removes disulfide bonds resulting in the loss of oliomers and tertiary structure. As a result, BAX should not form multimers under these conditions, unlike our Western blotting results. helical pore forming proteins can and do form multimer units under reducing conditions (Lemmon et al., 1992 a 1992 b ) BAX and pore forming proteins that helices that are involved in their pore forming properties (Qian et al., 2008) helical transmembrane domains and the extreme hydrophobic pockets that allow pore forming proteins to produce stable multimers even under reducing conditions (Lemmon et al., 1992a) Not only are the BAX multimer bands specific, bands are removed with peptide neutralization, but because of its pore forming properties structural domain s multimer formation under reducing conditions has pr eviously been demonstrated. BAD has the most interesting pattern of mRNA expression and protein concentration. The steady state mRNA for BAD is very low through the 2 cell stage and then increases cell stage. This same pattern is seen in the human preimplantation embryo, with very low levels of BAD expression until compaction when there is an increase in expression (Spanos et al., 2002; Metcalfe et al., 2004) Despite the increase of BAD mRNA immunoreactive amounts of BAD as determined by immunohistochemistry. BH3 only proteins have been shown to be regulated transcriptionally and post translationally. For example BBC3 (previously PUMA ) is shown to be transcriptionally

PAGE 76

76 upregulated by both p53 (Nakano and Vousden, 2001) and fo rkhead box O3 (FOXO3) (You et al., 2006) upon DNA damage or growth factor deprivation. BAD is shown to be post translationally regulated undergoing two phosphorylation events at Ser112 (Zha et al., 1996; Harada et al., 1999) and Ser136 (Datta et al., 1997) leading to BAD being sequestered by YWHAQ proteins (Zha et al., 1996; Datta et al., 1997) Upon apoptotic stimuli these serine become dephosphrylated and BAD is released from YWHAQ proteins and contr ibutes to cell death (Zha et al., 1996) Neither of these forms of cell stage without a change in protein concentration. A novel post t ranscriptional mechanism has recently been proposed by Lam et al. ( 2009) Using RNAi they identified a novel kinase, MAP4K3. They show that MAP4K3 plays a role in DNA damaged induced cell d eath and its suppression results in a significant resistance to DNA damage. They also found a MAP4K3 dependent induction of BAD and BBC3 independent of p53. MAP4K3 functions by activating the mechanistic target of rapamycin (mTOR) pathway. mTOR modulates the activity of eukaryotic translation initiation factors (eIF4B, eIF4E, eIF4F) which are involved in CAP binding and mRNA stability (Ramirez, 2002) The authors suggest that this MAP4K3 stimulati on of mTOR leads to the stabilization of BBC3 and BAD and may contribute to and enhancement of BBC3 and BAD translation. This novel post transcriptional mechanism of regulation can explain the pattern of cell stage a 10 fold increase of BAD mRNA can result in an increased availability of transcript that will be translated upon apoptotic stimuli.

PAGE 77

77 While in the 2 cell embryo, the lack of pre formed BAD m RNA will blunt the magnitude of a pro apoptotic signal. These data indicate that there is a developmental transition of anti versus pro apoptotic genes from the 2 cell embryo. This is complicated by the fact that the oocyte can undergo he at shock induced apoptosis (Roth and Hansen, 2004) despite having similar expression of BCL2, BCL2L1, HSPA1A, BAX and BAD when compared to the 2 cell embryo. So why does the ooctyte undergo apoptos is when the 2 cell embryo cannot? Oocytes are extremely variable in both quality and development potential. Along with these variations in quality there is evidence for changes in certain protein concentrations. BAX is equally expressed in low and high q uality bovine oocytes, but there is a higher amount of immunoreactive BCL2 in high quality oocytes compared to low quality oocytes (Yang and Rajamahendran, 2002) This variation in BCL2 concentrati on, similar to what is seen between the 2 cell embryo, is a possible mechanism by which apoptosis could occur in the oocyte. For this study only high quality oocytes were selected, possibly explaining the lack of differences between our BCL2 expr ession in oocytes and 2 cell embryo. In addition to inherent variation among oocytes there could also be other molecular mechanisms at work such as oocyte ag e ing. Post ovulatory oocyte ageing has been implicated with an increased incidence of apoptosis (Fissore et al., 2002) Like oocyte quality in bovine, oocyte ageing in mouse shows a stable expression of BAX mRNA, but an age dependent decrease in both BCL2 mRNA and BCL2 protein expression (Gordo et al., 2002) Again it is a change in

PAGE 78

78 BCL2 expression that is related to the capacity for apoptosis. Although it is not fully understood how the oocyte undergoes heat shock induced apoptosis, on e potential mechanism is the pre mature ageing of the oocyte resulting in the degradation of BCL2 allowing for apoptotic signal propagation. Apoptosis is a tightly regulated pathway with multiple checks and balances to prevent accidental activation of cell ular death without an appropriate signal. While caspases and DNases are the cellular executioners, it is the mitochondria in concordance with BCL2 family of proteins that serve as judge and jury. The data presented here show that developmental regulation of mRNA and immunoreactive amounts of protein, in particular BCL2 BAX and BAD are key factors in preventing mitochondrial depolarization and apoptosis in the early preimplantation embryo and for establishing the capacity for a cell stage.

PAGE 79

79 Table 2 1 Primer sets used for qRT PCR. Gene Accession number Sequence T m (C) Product size (bp) Reference BCL2 XM_586976.4 5' TCGTGGCCTTCTTTGAGTTC 3' 60 109 5' CGGTTCAGGTACTCGGTCAT 3' BCL2L1 NM_001077486 .2 5' CTCAGAGTAACCGGGAGCTG 3' 60 142 5' CTGGGGGTTTCCATATCTGA 3' HSPA1A NM_174550.1 5' GGGGAGGACTTCGACAACAGG 3' 60 245 (Block et al., 2008) 5' CGGAACAGGTCGGAGCACAGC 3' DFFA NM_00 1075342.1 5' GGTGCTTGACCAGAGAGAGG 3' 60 120 5' CCAAGGTCAGCTCTGGACTC 3' BAX NM_173894.1 5' CTCCCCGAGAGGTCTTTTTC 3' 60 176 5' TCGAAGGAAGTCCAATGTCC 3' BAD NM_001035459.1 5' CTTTTCTGCAGGCCTTATGC 3' 59 151 5' GGTAAGGGCGGAAAAACTTC 3' D FFB NM_001035109.1 5' CCCTGCATAGCGAGAAGAAG 3' 60 129 5' ATTCCGTGCCATCCTCATAG 3' HIST1H2A U62674 5' GTCGTGGCAAGCAAGGAG 3' 57 182 (Robert et al., 2002) 5' GATCTCGGCCGTTAGGTACTC 3'

PAGE 80

80 Figure 2 1 Quantitative real time RT PCR for anti apoptotic genes A) BCL2 B) BCL2L1 C) HSPA1A and D) DFFA and pro apoptotic genes E) BAX and F) BAD and the housekeeping gene G) HIST1H2A Data on steady state mRNA concentrations for bovine MII oocy tes, 2 cell embryos, 2 cell cell embryos are expressed as fold change relative to MII oocytes (least squares means SEM) Reactions were performed with cDNA samples (n=5) from individual grou ps of 20 oocytes or em bryos. Different letters indicate a significant difference in relative mRNA abundance (P<0.05).

PAGE 81

81 Figure 2 2. Immunoreactive amounts of BCL2 in 2 cell in vitro produced embryos as determined by immunocytochemistry (A G) and Western blotting (H J). Immunocytochemical results are representative images of 2 cell embryos (A cell embryos (D F). Shown are merged fluorescent images of Zenon 488 labeled anti BCL2 (green) and nuclei labeled with Hoescht 33342 (blue) (B,C, E, F), or merged images of fluorescent labeling with differential interference contrast (A,D). Images of anti BCL2 labeling are in panels (A,B,D, E ) and labeling with the negative control (non specific IgG labeled with Zenon 488) are in panels ( C ,F) The average pixel in tensity of fluoresence associated with labeling with anti BCL2, after correction for non specific labeling, is shown in panel G (least squares means S.E.M.). Intensity of fluorescence was higher for 2 c ell embryos as indicated by a different letter (P=0 .001). Results of Western blotting for BCL2 in MII oocytes, 2 cell embryos, amanitin treated 2 cell embryos, and BEND cells (positive control) are shown in panels ( H J ) The arrow indicates the band of interest at 26 kDa. All lanes of oocytes and embryos represent 200 oocytes or em bryos except for panel H where 200 MII oocytes, 110 2 cell cell embryos were loaded.

PAGE 82

82 Figure 2 2. Continued

PAGE 83

83 Figure 2 3 Immunoreactive amounts of BAX in 2 cell in vi tro produced embryos as determined by immunocytochemistry (A G) and Western blotting (H J). Immunocytochemical results are representative images of 2 cell embryos (A cell embryos (D F). Shown are merged fluorescent images of Zenon 488 labeled a nti BAX (green) and nuclei labeled with Hoescht 33342 (blue) (B,C, E, F), or merged images of fluorescent labeling with differential interference contrast (A,D). Images of anti BAX la beling are in panels (A,B,D, E ) and labeling with the negative control (non specific IgG labeled with Zenon 488) are in panels ( C F ) The average pixel intensity of fluoresence associated with labeling with anti BAX, after correction for non specific labeling, is shown in panel G (least squares means S.E.M.). Intensity of fluorescence was lower for 2 ce ll embryos as indicated by a different letter (P<0.0001). Results of Western blotting for BAX in MII oocytes, 2 cell embryos, amanitin treated 2 cell embryos, and BEND cells (positive control) are shown i n panels ( H J ) The arrow indicates the bands of interest at 46 and 23 kDa. All lanes represent 200 oocytes or embryos.

PAGE 84

84 Figure 2 3. Continued

PAGE 85

85 Figure 2 4 Immu noreactive amounts of A) BCL2L1, B) HSPA1A and C) BAD in 2 cell cell in vitr o produced embryos. Data are the average pixel intensity of fluoresence associated with labeling with antibody, after correction for non specific labeling (least squares means S.E.M.). There were no significant differences between 2 cell embryos and e mbryos 1 6 cells.

PAGE 86

86 APPENDIX COWS IN SPACE: A PRE LIMINARY INVESTIGATI ON TO DETERMINE EFFECTS OF SPACE FLIGHT ON BOVI NE PREIMPLANTATION EMBR YO DEVELOPMENT Introduction The effects of space flight have been studied for a variety of cell types in different organism s Despite the variation of cell types studied one common consequence of space flight are changes in as a result of disruption of cytoskeletal organization. Microtuble formation is disrupted leading to diffuse and shortened microtubles with poorly defined microtuble organizing centers (Lewis et al., 1998) Perinuclear cytokeratin networks are also disrupted and become diffuse (Vassy et al., 2003) Disruption of these cytoskeletal networks has a profound effect on the cell resulting in architectural changes, loss of morphological phenotypes (Gaboyard et al ., 2002) changes in mitochondrial distribution (Schatten et al., 2001) and disruption of cellular function. One major function of cytoskeletal structure is its involvement in cellular proliferati on and mitosis, which is reduced as a result of space travel. This reduction could be seen in osteoblasts after as little as 3 days of exposure to space (Kacena et al., 2003) the number of MCF 7 ce lls undergoing progression through the cell cycle as measured by Ki 67 staining was similar between flight and ground controls but the duration of mitosis was significantly longer in the flight group (Vassy et al., 2003) Jurkat cells exposed to space flight actively progressed through the cell cycl e and metaboliz ed glucose, but cell numbers did not increase (Lewis et al., 1998) In addition to decreases in proliferation, a reduction in size of a cellular population could be due to removal of cells by apoptosis. As apoptosis is a common mechanism used to r emove damaged cells (Friedberg, 2003) cells with aneuploidy (Hardy, 1999;

PAGE 87

87 Liu et al., 2002) and cells that fail to become properly polarized (Zahir and Weaver, 2004) Space travel leads to an increase in cellular damage due to ionizing radiation (Jones et al., 2007) the extreme g forces during lau n ch (Vassy et al., 2003) and microgravity effects on cellular polarization and cytoskeletal structure. As a result one would expect an increase in apoptotic index among cells exposed to space. Lewis et al. ( 1998) showed that 4 h of space flight increased DNA condensation from 17% in ground controls to 30% in flight cells. They also found that there was a time dependent increase in expression of FAS, a member of the TNF receptor superfamily involved in the extrinsic apoptotic pathway. Given the difficulty and expense of space travel, various conditions encountered in space have been partially replicated here on Earth. Microgravity can be simulated in the lab using clinostatic rotation in a rotating cell culture system. Clinostat rotation simulates microgravity by rotating the culture vessel on the horizontal axis so that cells or embryos within the vessel experience a gravitational pull from multiple directio ns leading to the cancellation of gravitational forces over time. Clinostat rotation has been used in a variety of culture environments to provide preliminary data to the effects of microgravity. Simulated microgravity has been used to allow more in depth investigation of changes in cytoskeletal structure (Uva et al., 2002) and apoptosis (Schatten et al., 2001) While fertilization and embry ogenesis in space have also been studied typical models include amphibians (Souza et al., 1995; Dournon et al., 2001; Gu alandris Parisot et al., 2002) fish (Ijiri, 1995) and pregnant rat s (Ronca and Alberts, 2000) S tudies of this type in space are few in number and are technically limited thus,

PAGE 88

88 simulated microgravity has been used for a more in depth examination of the effects of microgravity on fertilization and embryonic development. Unfortunately the effects of simulated microgravity on mammalian fer tilization and embryonic development are not consistent. In the mouse fertilization was not a ffected by clinostat rotation (Kojima et al., 2000) I n a recent study in the bovine, however, cl inost at rotation resulted in complete inhibition of fertilization compared to control s which had a 77% fertilization rate (Jung et al., 2009) Developmental competence has also been looked at under micr ogravity conditions. Using the mouse as a model there was a significant reduction in the number of embryos reaching the morulae or blastocyst stage (70% controls versus 40% clinostat rotation) (Koji ma et al., 2000) In the bovine none of the embryos under simulated microgravity reached the morulae or blastocyst stage while in the controls only 11% became morulae and only 3.6% developed to the blastocyst stage (Jung et al., 2009) While results do vary they indicate that there is an effect of simulated microgravity on embryogenesis and development potential. Both simulated microgravity and space flight have a wide variety of effects that co uld cause a decrease in development potential. As previously discussed, these effects most likely involve disruption of cytoskeletal structure, which would lead to disruption of fertilization, pronuclear formation, and retardation of mitosis. Cellular po larization could also be disrupted effecting; differentiation, gene expression, and tight junction formation. Finally, apoptotic index could increase due to up reg ulation of pro apoptotic genes (Lew is et al., 1998) or by disruption of mitochondrial networks due to cytoskeletal changes (Schatten et al., 2001) The objective of this study was to evaluate effects of space flight on development of bovine preimplantation embryos.

PAGE 89

89 Given previous evidence we hypothesized that space flight would inhibit development, possibly because of interference with tight junction formation, blastocoele formation or induction of apoptosis. Materials and Method s Materials Media for in vitro production of embryos were obtained as follows. HEPES TL and IVF TL were purchased from Millipore (Billerica, MA, USA) or Caisson Laboratories, Inc. (North Logan, UT, USA) and used to prepare HEPES TALP and IVF TALP as descri bed by Parrish et al. ( 1986) Oocyte collection medium was TCM without phenol red (Atlanta Biologicals, Lawrenceville, GA, USA) supplemented with 2% (v/v) bovine steer serum (Pel Freez Biologicals, Rogers, AR, USA) containing 2 U/mL heparin, 100 U/mL penicillin G, 0.1 mg/mL streptomycin, and 1 mM glutamine. Oocyte maturation medium was TCM salts supplemented with 10% (v/v) bovine steer serum, 2 g/mL estr adiol 17 g/mL bovine FSH (Folltropin V; Agtech Inc., Manhattan, KS, USA), 22 g/mL sodium pyruvate, 50 g/mL gentamicin sulfate (Sigma Aldrich, St. Louis, MO, USA), and 1 mM L glutamine or alanyl glutamine. Percoll was from GE Healthcare (Uppsala, Sweden). Frozen semen from various bulls was donated by Southeastern Semen Services (Wellborn, FL, USA). Modified BBH7 was provided by Cooley Biotech LLC. (Gainesville, FL, USA). All flight hardware was provided by BioServe Space Technologies (Boulder, C O, USA) In Vitro Production of Embryos Embryo production was performed as previously described (Soto et al., 2003b) A mixture of beef and dairy cattle ovaries were obtained from a local abattoir (C entral Beef

PAGE 90

90 Packing Co., Center Hill, FL, USA) and cumulus oocyte complexes (COCs) were collected by slicing follicles that were 2 to 10 mm follicles in diameter on the surface of ovaries. Cumulus oocyte complexes containing at least one layer of compact cumulus cells were selected for subsequent steps. These COCs were washed twice in oocyte collection medium and placed in groups of 10 in 50 L drops of oocyte maturation medium with a mineral oil overlay and matured for 23 h at 38.5C and 5% CO2 in humidi fied air. Matured oocytes were then washed twice with HEPES TALP and transferred in groups of 50 to a 4 well plate containing; ~1x10 6 percoll purified spermatozoa from a pool of frozen thawed semen from three bulls (Dov e IRL 95/068 Hochschwab SIM HWB, 90H H407 1922240 L1 Domino 910382 11 24 92 and 153LM46 NPM TALP, and 20 L PHE (0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 M epinephrine in 0.9% (w/v) NaCl). After 16 h of co incubation at 38.5C, 5% CO 2 in humidified air, putative zygotes were removed from fertilizati on plate and denuded of cumulus cells by vortexing in 100 L hyaluronidase (1000 U/mL in HEPES TALP). Denuded putative zygotes were placed in groups of 25 in 50 L drops of modified BBH7 with a mineral oil overlay at 38.5C, 5% CO 2 5% O 2 ~90% N 2 with h umidified air for 2 h. Fluid Processing Apparatus Fluid Processing Apparatuses (FPAs; Figure A 1 ) were provided by BioServe Space Technologies. FPA glass barrels and rubber septa were coated with Sigmacote (Sigma Aldrich) and autoclaved along with 3 well culture insert and gas exchange insert. Each well of a 3 equilibrated modified BBH7 and 25 embryos. Three well inserts were then loaded into the FPA culture chamber with 0.7 mL of pre equilibrated modified BBH7 Figure A 1 Two rubber

PAGE 91

91 septa sealed the culture chamber. A total of 1 mL of fixative either 3.4% (v/v) glutaraldehyde or 6.8% (v/v) paraformaldehyde was loaded into the fixative chamber and sealed with rubber septa. For FPAs that were to be fixed on day 9 of culture a 1 mL displacement block was added with another rubber septa ( Figure A 1 ) FPAs were returned to culture at 38.5C, 5% CO 2 5% O 2 ~90% N 2 with hum idified air Group Activation Pack Preparation and Handoff When contacted by BioServe staff, FPAs were removed from culture and loaded into the plunger apparatus. Plunger apparatuses were gassed with 5% CO 2 5% O 2 ~90% N 2 for 30 seconds and sealed ( Figure A 2 ) Plunger apparatuses were then loaded into Group Activation Packs (GAPs; Figure A 3 ) and turned over to the BioServe staff. BioServe had approximately 24 h pre launch to perform a series of tes ts on all FPAs and GAPs and loaded them into flight incubators which were maintained at 37C ( Figure A 4 ) Launch, Fixation, and Recovery Space shuttle Endeavour launched on November 14, 2008 at 1955 H or at approximately 52 hp i. While in orbit, on Day 9 of culture or Day 16 of culture a crew member of STS 126 activated the GAP by mixing the fixative chamber with the culture chamber. STS 126 returned to E arth on November 30, 2008 at 1625. FPAs were received and embryos remov ed on December 2, 2008. TUNEL and Hoescht 33342 Labeling TUNEL was used to detect DNA fragmentation that is associated with the late stages of apoptosis. The enzyme terminal deoxynucleotidyl transferase was used to catalyze the transfer of a fluorescein i sothiocyanate conjugated dUTP nucleotide to the

PAGE 92

92 4 pH 7.4 containing 0.9% (w/v) NaCl (PBS) and 1 mg/mL polyvinylpyrrolidone (PBS PVP) by t ransferring from drop to drop. Embryos were then permeabilized in groups of 30 x (Sigma Aldrich) for 15 min at room temperature. After permeabilization embryos were PVP. Embry os cultured under standard conditions were used as positive and negative controls for the TUNEL procedure. RNase free DNase (50 U/mL; Promega, Madison, WI, USA) at 37C in the dark for 1 h. Positive controls and experimental embryos were washed in PBS TUNEL reaction mixture (In Situ Cell Death Detection Kit, Fluorescein: Roche Diagnostics Corporation, Indianapolis, IN, USA) (containing fluorescein conjugated dUTP and the enzyme terminal deoxynucleotidyl transferase) for 1 h at 37C in the dark. Negative controls were incubated in the absence of terminal deoxynucleotidyl transferase. Embryos were washed four times in PBS drop of washed four times, mounted on a microscope slide using ProLong Gold Anti Fade mounting medium (Thermo Fisher Scientific Inc), and fluorescence was visualized using a Zeiss Axioplan micr oscope (Zeiss, Gttingen, Germany) with a 20x objective and the FITC, DAPI, and DIC filter sets. Digital images were acquired using the AxioVision software and a high resolution black and white AxioCam MRm digital camera (Zeiss). Experimental Design A tot al of 1200 embryos were used in this experiment. Eight FPAs or 600 embryos were kept in an incubator at 37C at Kennedy Space Center Space Life Science Lab oratory as ground control (GROUND). Another 8 FPAs or 600 embryos

PAGE 93

93 were loaded onto the space shutt le Endeavour (FLIGHT). Within each group of 8 FPAs 3 FPAs were fixed with 4% (v/v) parafromaldehyde on Day 9 of culture, 3 FPAs were fixed with 2% (v/v) gluteraldehyde on Day 9 of culture, and 2 FPAs were fixed with 2% (v/v) gluteraldehyde on Day 16 of c ulture. Scanning electron microscopy was to be performed by the USDA on blastocysts recovered from embryos fixed with 2% (v/v) gluteraldehyde on Day 9 or Day 16 of culture. Development along with apoptotic index (TUNEL) was assessed for recovered embryos that were fixed in 4% paraformaldehyde on Day 9 of culture. Statistical Analysis Data were subjected to least squares analysis of variance using the General Linear Models procedure (GLM) with p diff as means separation test. Binomial data (cleaved embryos greater than six cells) was analyzed using a chi square with PROC FREQ from the Statistical Analysis System (SAS for Linux, Release 9.2, SAS Institute Inc., Cary, NC, USA). Results Of the 1200 embryos loaded (600 FLIGHT and 600 GROUND ), 1067 were recovere d (547 FLIGHT and 520 GROUND ). No blastocysts were obtained from either group Cleavage rate was not significantly different between FLIGHT ( 9.98 %) and GROUND ( 11.84 %). Of those embryos that cleaved, the majority were at the 2 4 cell stage (78% FLIGHT an d 89% GROUND ) ( Table A 1 ) which would coincide with the approximate time of development the embryos would have been at the time launch (52 hpi) a time typically coincident with space flight) tended to be greater for FLIGHT (22% vs

PAGE 94

94 11% GROUND ) but differences were not significant ( 2 = 2.4681; P =0.1 162) ( Table A 2 ) In addition to development data, embryos were analyzed for apoptotic index using TUNEL. A total of 367 embryos were analyzed using TUNEL (189 FLIGHT and 178 GROUND) I n addition, an external set of embryos were used as a positi ve and negative controls for the TUNEL reaction. There was no evidence of TUNEL in FLIGHT or GROUND embryos ( Figure A 5 ) Discussion There was an inadequate amount of development in both FLIGHT and GROUND. Initially the USDA wa s going to perfrom scanning electron microscopy of any blastocysts recovered to examine morphological differences between FLIGHT and GROUND but this was not done because no blastocyst were recovered. TUNEL analysis to compare variations in apoptotic index was also performed. There were no TUNEL positive blastomeres from the embryos recovered from this experiment. This is not unexpected because cells embryos are refractory to apoptosis (Krininger et al., 2002; Paula Lopes and Hansen, 2002; Soto et al., 2003; Brad et al., 2007; Jousan and Hansen, 2007; Carambula et al., 2009) The lack of development is due to a combination of the culture conditions along with the handling procedure required for these types of experiments. As their names suggest, FPAs were designed for fluid processing and not as a culture environment. Due to the tight regulation of materials that are allowed on board of the S pace S huttle they have been adapted to be used as a culture system. Besides not being designed for embryo culture, FPAs are coated with a silicon compound (Sigmacote) to aid in the

PAGE 95

95 insertion and removal of the rubber sep ta used in this system. We are unaware of the effects if any this compound may have had on the embryos In the bovine in vitro production system, like other in vitro production systems, embryos are cultured in groups in 10 culture volume of 1 mL. To compensate for the larger volume, a 3 well insert was used, he 3 well insert was made from plastic, there was a metal piece and a screw as part of the assembly. The plastic or metal parts of the 3 well insert could also conceivably a ffect embryonic development Bovine embryos are also typically cultured in low oxy gen at 38.5C (Soto et al., 2003b) Individual plunger devices were gassed with a low oxygen mixture (5% CO 2 5% O 2 ~90% N 2 ), but the incubator was maintained at 37C. This could have a negative effect on embryonic development. In addition, working with FPAs is a more time consuming process compared to standard IVF culture systems. This fact, along with the required quality control leak testing kept the embryos at room temperature longer than i n a typical embryo culture system. Our results are consistent with those experienced by Jung et al. ( 2009) using a rotating culture system. There was too little development in control embryo s to make reliable conclusions about the effects of space flight. In conclusion, our initial attempt to achieve development of bovine embryos in space was limited by inadequate culture conditions and time to optimize these conditions before launch

PAGE 96

96 F igure A 1 Schematic drawing the the fluid processing apparatus (FPA). Two different FPA layouts were used to determine the timming of fixation. FPAs to be fixed on Day 9 of culture a 1 mL plastic displacement bock was added. FPA assembly consisted of rubber septa (dark gray), 3 well culture inserts, and a gas exchange insert (yellow). 3 well culture inserts consisted of four pieces held together with a small screw. Pieces were assempled as shown, holes for the inserts were aligned for loading, and th en offset to prevent embryos from falling out.

PAGE 97

97 Figure A 2 Plunger apparatus. Each plunger contained a single FPA and were gassed with 5% CO 2 5% O 2 ~90% N 2 for 30 sec and seal ed. Plungers are loaded into the GAP and on Day 9 or Day 16 of culture pl ungers were depressed to mix fixative with culture medium.

PAGE 98

98 Figure A 3 Group activation pack (GAP). GAPs consisted of a plastic cylinder with two aluminum lids. Eight FPAs were loaded per GAP. To activate fixative, a crank was inserted on the top of the GAP and a metal plate was lowered depressing the plunger apparatus, mixing fixative and culture medium.

PAGE 99

99 Figure A 4 Flight incubator. The flight incubator contained 9 GAPs. Incubator was maintained at 37C.

PAGE 100

100 Table A 1 Developmental distributi on of embryos recovered from FLIGHT and GROUND. Recovered Cleaved 2 cell 3 cell 4 cell 6 cell 8 cell 16 cell >16 cell Flight 547 50 10 14 15 0 9 2 0 Ground 520 63 25 17 14 1 4 2 0

PAGE 101

101 Table A 2 Comparison of embryonic development coincident with orbita l flight. Cleaved cells 2 P Value Flight 50 11 2.4681 0.1162 Ground 63 7

PAGE 102

102 Figure A 5 Representative images of TUNEL analysis. Images are merged and pseudo colored with differential interfence contrast (DIC), Hoechst 33342 (blue), and TUNEL (green). Pane ls ( A C) are experimental embryos and Panels (B D) are control Embryos. A) 4 cell FLIGHT embryo, C) 2 cell and uncleaved GROUND embryo, B) Positive control, D) Negative control.

PAGE 103

103 LIST OF REFERENCES Acehan D, Jiang X, Morgan DG, Heuser JE, Wang X, and A key CW. 2002. Three dimensional structure of the apoptosome: implications for assembly, procaspase 9 binding, and activation. Mol Cell 9:423 32. Adams JM, and Cory S. 1998. The Bcl 2 protein family: arbiters of cell survival. Science 281:1322 6. al Katanan i YM, Webb DW, and Hansen PJ. 1999. Factors affecting seasonal variation in 90 day nonreturn rate to first service in lactating Holstein cows in a hot climate. J Dairy Sci 82:2611 6. Amadio M, Scapagnini G, Laforenza U, Intrieri M, Romeo L, Govoni S, and P ascale A. 2008. Post transcriptional regulation of HSP70 expression following oxidative stress in SH SY5Y cells: the potential involvement of the RNA binding protein HuR. Curr Pharm Des 14:2651 8. Antonsson B, Montessuit S, Lauper S, Eskes R, and Martinou JC. 2000. Bax oligomerization is required for channel forming activity in liposomes and to trigger cytochrome c release from mitochondria. Biochem J 345 Pt 2:271 8. Aoki F, Worrad DM, and Schultz RM. 1997. Regulation of transcriptional activity during the first and second cell cycles in the preimplantation mouse embryo. Dev Biol 181:296 307. Aoki F, Hara KT, and Schultz RM. 2003. Acquisition of transcriptional competence in the 1 cell mouse embryo: requirement for recruitment of maternal mRNAs. Mol Reprod D ev 64:270 4. Arnoult D, Grodet A, Lee Y, Estaquier J, and Blackstone C. 2005 a Release of OPA1 during apoptosis participates in the rapid and complete release of cytochrome c and subsequent mitochondrial fragmentation. J Biol Chem 280:35742 50. Arnoult D, Rismanchi N, Grodet A, Roberts RG, Seeburg DP, Estaquier J, Sheng M, and Blackstone C. 2005 b Bax/Bak dependent release of DDP/TIMM8a promotes Drp1 mediated mitochondrial fission and mitoptosis during programmed cell death. Curr Biol 15:2112 8. Ashen JB, a nd Goff LJ. 2000. Molecular and ecological evidence for species specificity and coevolution in a group of marine algal bacterial symbioses. Appl Environ Microbiol 66:3024 30. Ashkenazi A, and Dixit VM. 1998. Death Receptors: Signaling and Modulation. Scien ce 281:1305 1308.

PAGE 104

104 Badinga L, Collier RJ, Thatcher WW, and Wilcox CJ. 1985. Effects of climatic and management factors on conception rate of dairy cattle in subtropical environment. J Dairy Sci 68:78 85. Bakhshi A, Jensen JP, Goldman P, Wright JJ, McBride O W, Epstein AL, and Korsmeyer SJ. 1985. Cloning the chromosomal breakpoint of t(14;18) human lymphomas: clustering around JH on chromosome 14 and near a transcriptional unit on 18. Cell 41:899 906. Bao Q, and Shi Y. 2007. Apoptosome: a platform for the acti vation of initiator caspases. Cell Death Differ 14:56 65. Basu S, Bayoumy S, Zhang Y, Lozano J, and Kolesnick R. 1998. BAD enables ceramide to signal apoptosis via Ras and Raf 1. J Biol Chem 273:30419 26. Basu S, and Kolesnick R. 1998. Stress signals for a poptosis: ceramide and c Jun kinase. Oncogene 17:3277 85. Belmokhtar CA, Hillion J, and Sgal Bendirdjian E. 2001. Staurosporine induces apoptosis through both caspase dependent and caspase independent mechanisms. Oncogene 20:3354 62. Bernardi P, and Azzon e GF. 1981. Cytochrome c as an electron shuttle between the outer and inner mitochondrial membranes. J Biol Chem 256:7187 92. Bernardi P. 1999. Mitochondrial transport of cations: channels, exchangers, and permeability transition. Physiol Rev 79:1127 55. B illen LP, Kokoski CL, Lovell JF, Leber B, and Andrews DW. 2008. Bcl XL inhibits membrane permeabilization by competing with Bax. PLoS Biol 6:e147. Bingle CD, Craig RW, Swales BM, Singleton V, Zhou P, and Whyte MK. 2000. Exon skipping in Mcl 1 results in a bcl 2 homology domain 3 only gene product that promotes cell death. J Biol Chem 275:22136 46. Biswas SC, Shi Y, Sproul A, and Greene LA. 2007. Pro apoptotic Bim induction in response to nerve growth factor deprivation requires simultaneous activation of th ree different death signaling pathways. J Biol Chem 282:29368 74. Blachly Dyson E, and Forte M. 2001. VDAC channels. IUBMB Life 52:113 8. Block J, Wrenzycki C, Niemann H, Herrmann D, and Hansen PJ. 2008. Effects of insulin like growth factor 1 on cellular and molecular characteristics of bovine blastocysts produced in vitro. Mol Reprod Dev 75:895 903. Boatright KM, Renatus M, Scott FL, Sperandio S, Shin H, Pedersen IM, Ricci JE, Edris WA, Sutherlin DP, Green DR, and Salvesen GS. 2003. A unified model for ap ical caspase activation. Mol Cell 11:529 41.

PAGE 105

10 5 Boise LH, Gonzlez Garca M, Postema CE, Ding L, Lindsten T, Turka LA, Mao X, Nez G, and Thompson CB. 1993. bcl x, a bcl 2 related gene that functions as a dominant regulator of apoptotic cell death. Cell 74:5 97 608. Brad AM, Hendricks KE, and Hansen PJ. 2007. The block to apoptosis in bovine two cell embryos involves inhibition of caspase 9 activation and caspase mediated DNA damage. Reproduction 134:789 97. Braude P, Bolton V, and Moore S. 1988. Human gene ex pression first occurs between the four and eight cell stages of preimplantation development. Nature 332:459 61. Brinsko SP, Ball BA, Ignotz GG, Thomas PG, Currie WB, and Ellington JE. 1995. Initiation of transcription and nucleologenesis in equine embryos Mol Reprod Dev 42:298 302. Byrne AT, Southgate J, Brison DR, and Leese HJ. 1999. Analysis of apoptosis in the preimplantation bovine embryo using TUNEL. J Reprod Fertil 117:97 105. Calder MD, Madan P, and Watson AJ. 2008. Bovine oocytes and early embryo s express Staufen and ELAVL RNA binding proteins. Zygote 16:161 8. Carambula SF, Oliveira LJ, and Hansen PJ. 2009. Repression of induced apoptosis in the 2 cell bovine embryo involves DNA methylation and histone deacetylation. Biochem Biophys Res 388:418 2 1. Cartron P, Gallenne T, Bougras G, Gautier F, Manero F, Vusio P, Meflah K, Vallette FM, and Juin P. 2004. The first alpha helix of Bax plays a necessary role in its ligand induced activation by the BH3 only proteins Bid and PUMA. Mol Cell 16:807 18. Cave stany D, el Wishy aB, and Foote RH. 1985. Effect of season and high environmental temperature on fertility of Holstein cattle. J Dairy Sci 68:1471 8. Chalmers CJ, Balmanno K, Hadfield K, Ley R, and Cook SJ. 2003. Thrombin inhibits Bim (Bcl 2 interacting me diator of cell death) expression and prevents serum withdrawal induced apoptosis via protease activated receptor 1. Biochem J 375:99 109. Chang BS, Minn AJ, Muchmore SW, Fesik SW, and Thompson CB. 1997. Identification of a novel regulatory domain in Bcl X( L) and Bcl 2. EMBO J 16:968 77. Chao DT, and Korsmeyer SJ. 1998. BCL 2 family: regulators of cell death. Annu Rev Immunol 16:395 419. Chao JR et al. 1998. mcl 1 is an immediate early gene activated by the granulocyte macrophage colony stimulating factor (G M CSF) signaling pathway and is one component of the GM CSF viability response. Mol Cell Biol 18:4883 98.

PAGE 106

106 Cheng EH, Sheiko TV, Fisher JK, Craigen WJ, and Korsmeyer SJ. 2003. VDAC2 inhibits BAK activation and mitochondrial apoptosis. Science 301:513 7. Chit tenden T, Flemington C, Houghton AB, Ebb RG, Gallo GJ, Elangovan B, Chinnadurai G, and Lutz RJ. 1995. A conserved domain in Bak, distinct from BH1 and BH2, mediates cell death and protein binding functions. EMBO J 14:5589 96. Chung HS, Park SM, Choi EK, Pa rk H, Griffin RJ, Song CW, and Park H. 2003. Role of sphingomyelin MAPKs pathway in heat induced apoptosis. Exp Mol Med 35:181 8. Cipolat S, Martins De Brito O, Dal Zilio B, and Scorrano L. 2004. OPA1 requires mitofusin 1 to promote mitochondrial fusion. P roc Natl Acad Sci U S A 101:15927 32. Cleary ML, and Sklar J. 1985. Nucleotide sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint cluster region near a transcriptionally active locus on chromosome 18. Pro c Natl Acad Sci U S A 82:7439 43. Cohen GM. 1997. Caspases: the executioners of apoptosis. Biochem J 326 ( Pt 1:1 16. Crosby IM, Gandolfi F, and Moor RM. 1988. Control of protein synthesis during early cleavage of sheep embryos. J Reprod Fertil 82:769 75. Ct J, and Ruiz Carrillo A. 1993. Primers for mitochondrial DNA replication generated by endonuclease G. Science 261:765 9. Dahal GR, Karki P, Thapa A, Shahnawaz M, Shin SY, Lee JS, Cho B, and Park I. 2007. Caspase 2 cleaves DNA fragmentation factor (DFF4 5)/inhibitor of caspase activated DNase (ICAD). Arch Biochem Biophys 468:134 9. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, and Greenberg ME. 1997. Akt phosphorylation of BAD couples survival signals to the cell intrinsic death machinery. Cell 91:2 31 41. de Bruyne E, Bos TJ, Schuit F, Van Valckenborgh E, Menu E, Thorrez L, Atadja P, Jernberg Wiklund H, and Vanderkerken K. 2010. IGF 1 suppresses Bim expression in multiple myeloma via epigenetic and posttranslational mechanisms. Blood 115:2430 40. de Castro e Paula LA, and Hansen PJ. 2008. Ceramide inhibits development and cytokinesis and induces apoptosis in preimplantation bovine embryos. Mol Reprod Dev 75:1063 70. Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, and Reik W. 2001. C onservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 98:13734 8.

PAGE 107

107 Desagher S, Osen Sand A, Nichols A, Eskes R, Montessuit S, Lauper S, Maundrell K, Antonsson B, and Martinou JC 1999. Bid induced conformational change of Bax is responsible for mitochondrial cytochrome c release during apoptosis. J Cell Biol 144:891 901. Dewson G, Kratina T, Sim HW, Puthalakath H, Adams JM, Colman PM, and Kluck RM. 2008. To trigger apoptosis, Bak exposes its BH3 domain and homodimerizes via BH3:groove interactions. Mol Cell 30:369 80. Ding W, and Yin X. 2004. Dissection of the multiple mechanisms of TNF alpha induced apoptosis in liver injury. J Cell Mol Med 8:445 54. Dournon C, Durand D, Tankosic C, Membre H, Gualandris Parisot L, and Bautz A. 2001. Effects of microgravity on the larval development, metamorphosis and reproduction of the urodele amphibian Pleurodeles waltl. Dev Growth Differ 43:315 26. Du C, Fang M, Li Y, Li L, and Wang X. 2000. Sm ac, a mitochondrial protein that promotes cytochrome c dependent caspase activation by eliminating IAP inhibition. Cell 102:33 42. Durrieu F, Samejima K, Fortune JM, Kandels Lewis S, Osheroff N, and Earnshaw WC. DNA topoisomerase IIalpha interacts with CAD nuclease and is involved in chromatin condensation during apoptotic execution. Curr Biol 10:923 6. Edwards JL, and Hansen PJ. 1997. Differential responses of bovine oocytes and preimplantation embryos to heat shock. Mol Reprod Dev 46:138 45. Enari M, Saka hira H, Yokoyama H, Okawa K, Iwamatsu A, and Nagata S. 1998. A caspase activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391:43 50. Eskes R, Desagher S, Antonsson B, and Martinou JC. 2000. Bid induces the oligomerization an d insertion of Bax into the outer mitochondrial membrane. Mol Cell Biol 20:929 35. Exley GE, Tang C, McElhinny AS, and Warner CM. 1999. Expression of caspase and BCL 2 apoptotic family members in mouse preimplantation embryos. Biol Reprod 61:231 9. Fabian D, Makarevich AV, Chrenek P, Bukovsk A, and Koppel J. 2007. Chronological appearance of spontaneous and induced apoptosis during preimplantation development of rabbit and mouse embryos. Theriogenology 68:1271 81. Fang G, Chang BS, Kim CN, Perkins C, Thomp son CB, and Bhalla KN. 1998. "Loop" domain is necessary for taxol induced mobility shift and phosphorylation of Bcl 2 as well as for inhibiting taxol induced cytosolic accumulation of cytochrome c and apoptosis. Cancer Res 58:3202 8.

PAGE 108

108 Feugang J, Van Langend onckt A, Sayoud H, Rees J, Pampfer S, Moens A, Dessy F, and Donnay I. 2003. Effect of prooxidant agents added at the morula/blastocyst stage on bovine embryo development, cell death and glutathione content. Zygote 11:107 118. mercaptoethanol or Trolox at the morula/blastocyst stage improves the quality of bovine blastocysts and prevents induction of apoptosis and degeneration by prooxidant agents. Theriogenology 61:71 90. Fissore RA, Kurokawa M, Knott J, Zhang M, and Smyth J. 2002. Mechanisms underlying oocyte activation and postovulatory ageing. Reproduction 124:745 54. Flach G, Johnson MH, Braude PR, Taylor RA, and Bolton VN. 1982. The transition from maternal to embryonic control in the 2 cell mouse embryo. EMBO J 1:681 6. Friedberg EC. 2003. DNA damage and repair. Nature 421:436 40. Fu NY, Sukumaran SK, Kerk SY, and Yu VC. 2009. Baxbeta: a constitutively active human Bax isoform that is under tight regulatory control by the proteasomal degradation mechanism. Mol Cell 33:15 29. Gaboyard S, Blanchard M, Travo C, Viso M, Sans A, and Lehouelleur J. 2002. Weightlessness affects cytoskeleton of rat utricular hair cells during maturation in vitro. Neuroreport 13:2139 42. Ganesan V, Perera MN, Colombini D, Datskovskiy D, Chadha K, a nd Colombini M. 2010. Ceramide and activated Bax act synergistically to permeabilize the mitochondrial outer membrane. Apoptosis 15:553 62. Ganesan V, and Colombini M. 2010. Regulation of ceramide channels by Bcl 2 family proteins. FEBS Lett. Gao W, Pu Y, Luo KQ, and Chang DC. 2001. Temporal relationship between cytochrome c release and mitochondrial swelling during UV induced apoptosis in living HeLa cells. J Cell Sci 114:2855 62. Garland JM, and Rudin C. 1998. Cytochrome c induces caspase dependent apopto sis in intact hematopoietic cells and overrides apoptosis suppression mediated by bcl 2, growth factor signaling, MAP kinase kinase, and malignant change. Blood 92:1235 46. Garrido C, Gurbuxani S, Ravagnan L, and Kroemer G. 2001. Heat shock proteins: endog enous modulators of apoptotic cell death. Biochem Biophys Res 286:433 42. Gavrieli Y, Sherman Y, and Ben Sasson SA. 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119:493 501.

PAGE 109

109 Gilbert I Scantland S, Sylvestre E, Gravel C, Laflamme I, Sirard M, and Robert C. 2009. The dynamics of gene products fluctuation during bovine pre hatching development. Mol Reprod Dev 76:762 72. Gjrret JO, Knijn HM, Dieleman SJ, Avery B, Larsson L, and Maddox Hy ttel P. 2003. Chronology of apoptosis in bovine embryos produced in vivo and in vitro. Biol Reprod 69:1193 200. Gjrret JO, Fabian D, Avery B, and Maddox Hyttel P. 2007. Active caspase 3 and ultrastructural evidence of apoptos is in spontaneous and induced cell death in bovine in vitro produced pre implantation embryos. Mol Reprod Dev 74:961 71. Goldstein JC, Waterhouse NJ, Juin P, Evan GI, and Green DR. 2000. The coordinate release of cytochrome c during apoptosis is rapid, com plete and kinetically invariant. Nat Cell Biol 2:156 62. Goping IS, Gross A, Lavoie JN, Nguyen M, Jemmerson R, Roth K, Korsmeyer SJ, and Shore GC. 1998. Regulated targeting of BAX to mitochondria. J Cell Biol 143:207 15. Gordo AC, Rodrigues P, Kurokawa M, Jellerette T, Exley GE, Warner C, and Fissore R. 2002. Intracellular calcium oscillations signal apoptosis rather than activation in in vitro aged mouse eggs. Biol Reprod 66:1828 37. Green DR, and Kroemer G. 2004. The pathophysiology of mitochondrial cell death. Science 305:626 9. Griparic L, van Der Wel NN, Orozco IJ, Peters PJ, and van Der Bliek AM. 2004. Loss of the intermembrane space protein Mgm1/OPA1 induces swelling and localized constrictions along the lengths of mitochondria. J Biol Chem 279:18792 8. Gualandris Parisot L, Husson D, Bautz A, Durand D, Kan P, Aimar C, Membre H, Duprat A, and Dournon C. 2002. Effects of space environment on embryonic growth up to hatching of salamander eggs fertilized and developed during orbital flights. Biol Sci Spac e 16:3 11. Guo B, Godzik A, and Reed JC. 2001. Bcl G, a novel pro apoptotic member of the Bcl 2 family. J Biol Chem 276:2780 5. Haldar S, Basu A, and Croce CM. 1997. Bcl2 is the guardian of microtubule integrity. Cancer Res 57:229 33. Hamnr S, Arume U, L i Ying Y, Sun YF, Saarma M, and Lindholm D. 2001. Functional characterization of two splice variants of rat bad and their interaction with Bcl w in sympathetic neurons. Mol Cell Neurosci 17:97 106. Hanada M, Aim Semp C, Sato T, and Reed JC. 1995. Structu re function analysis of Bcl 2 protein. Identification of conserved domains important for homodimerization with Bcl 2 and heterodimerization with Bax. J Biol Chem 270:11962 9.

PAGE 110

110 Handyside AH, and Hunter S. 1986. Cell division and death in the mouse blastocyst before implantation. Rouxs Arch Dev Biol 195:519026. Hanson PI, and Whiteheart SW. 2005. AAA+ proteins: have engine, will work. Nat Rev Mol Cell Biol 6:519 29. Harada H, Becknell B, Wilm M, Mann M, Huang LJ, Taylor SS, Scott JD, and Korsmeyer SJ. 1999. Ph osphorylation and inactivation of BAD by mitochondria anchored protein kinase A. Mol Cell 3:413 22. Hardwick JM. 1998. Viral interference with apoptosis. Semin Cell Dev Biol 9:339 49. Hardy K, Winston RM, and Handyside AH. 1993. Binucleate blastomeres in p reimplantation human embryos in vitro: failure of cytokinesis during early cleavage. J Reprod Fertil 98:549 58. Hardy K. 1997. Cell death in the mammalian blastocyst. Mol Hum Reprod 3:919 25. Hardy K. 1999. Apoptosis in the human embryo. Rev Reprod 4:125 3 4. Herrler A, Krusche CA, and Beier HM. 1998. Insulin and insulin like growth factor I promote rabbit blastocyst development and prevent apoptosis. Biol Reprod 59:1302 10. Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL, and Korsmeyer SJ. 1993. Bcl 2 functio ns in an antioxidant pathway to prevent apoptosis. Cell 75:241 51. Hoffert KA, Anderson GB, Wildt DE, and Roth TL. 1997. Transition from maternal to embryonic control of development in IVM/IVF domestic cat embryos. Mol Reprod Dev 48:208 15. Holopainen JM, Lemmich J, Richter F, Mouritsen OG, Rapp G, and Kinnunen PK. 2000. Dimyristoylphosphatidylcholine/C16:0 ceramide binary liposomes studied by differential scanning calorimetry and wide and small angle x ray scattering. Biophys J 78:2459 69. Hong SJ, Dawso n TM, and Dawson VL. 2004. Nuclear and mitochondrial conversations in cell death: PARP 1 and AIF signaling. Trends Pharmacol Sci 25:259 64. Hsu SY, Kaipia A, McGee E, Lomeli M, and Hsueh AJ. 1997. Bok is a pro apoptotic Bcl 2 protein with restricted expres sion in reproductive tissues and heterodimerizes with selective anti apoptotic Bcl 2 family members. Proc Natl Acad Sci U S A 94:12401 6. Hsu SY, Lin P, and Hsueh AJ. 1998. BOD (Bcl 2 related ovarian death gene) is an ovarian BH3 domain containing proapopt otic Bcl 2 protein capable of dimerization with diverse antiapoptotic Bcl 2 members. Mol Endocrinol 12:1432 40.

PAGE 111

111 Hu SI, Carozza M, Klein M, Nantermet P, Luk D, and Crowl RM. 1998. Human HtrA, an evolutionarily conserved serine protease identified as a diffe rentially expressed gene product in osteoarthritic cartilage. J Biol Chem 273:34406 12. Huang DC, Adams JM, and Cory S. 1998. The conserved N terminal BH4 domain of Bcl 2 homologues is essential for inhibition of apoptosis and interaction with CED 4. EMBO J 17:1029 39. Huang Q, Petros AM, Virgin HW, Fesik SW, and Olejniczak ET. 2002. Solution structure of a Bcl 2 homolog from Kaposi sarcoma virus. Proc Natl Acad Sci U S A 99:3428 33. Hunter JJ, Bond BL, and Parslow TG. 1996. Functional dissection of the hum an Bc12 protein: sequence requirements for inhibition of apoptosis. Mol Cell Biol 16:877 83. Ihrlund LS, Hernlund E, Viktorsson K, Panaretakis T, Barna G, Sabapathy K, Linder S, and Shoshan MC. 2006. Two distinct steps of Bak regulation during apoptotic st ress signaling: different roles of MEKK1 and JNK1. Exp Cell Res 312:1581 9. Ijiri K. 1995. Fish mating experiment in space -what it aimed at and how it was prepared. Biol Sci Space 9:3 16. Ito T, Deng X, Carr B, and May WS. 1997. Bcl 2 phosphorylation requ ired for anti apoptosis function. J Biol Chem 272:11671 3. Jones JA, Riggs PK, Yang TC, Pedemonte CH, Clarke MS, Feeback DL, and Au WW. 2007. Ionizing radiation induced bioeffects in space and strategies to reduce cellular injury and carcinogenesis. Aviat Space Enbiron Med 78:A67 78. Jousan FD, and Hansen PJ. 2007. Insulin like growth factor I promotes resistance of bovine preimplantation embryos to heat shock through actions independent of its anti apoptotic actions requiring PI3K signaling. Mol Reprod Dev 74:189 96. Joza N, Pospisilik JA, Hangen E, Hanada T, Modjtahedi N, Penninger JM, and Kroemer G. 2009. AIF: not just an apoptosis inducing factor. Ann N Y Acad Sci 1171:2 11. Jung S, Bowers SD, and Willard ST. 2009. Simulated Microgravity Influences Bovin e Oocyte in vitro Fertilization and Preimplantation Embryo Development. J Anim Vet Adv 8:1807 1814. Jurisicova A, Varmuza S, and Casper RF. 1996. Programmed cell death and human embryo fragmentation. Mol Hum Reprod 2:93 8. Jurisicova A, Latham KE, Casper R F, and Varmuza SL. 1998. Expression and regulation of genes associated with cell death during murine preimplantation embryo development. Mol Reprod Dev 51:243 53.

PAGE 112

112 Kacena MA, Todd P, and Landis WJ. 2003. Osteoblasts subjected to spaceflight and simulated sp ace shuttle launch conditions. In Vitro Cell Dev Biol 39:454 9. Kaiser N, and Edelman IS. 1977. Calcium dependence of glucocorticoid induced lymphocytolysis. Proc Natl Acad Sci U S A 74:638 42. P. 2005. Regulation of the human apoptotic DNase/RNase endonuclease G: involvement of Hsp70 and ATP. Apoptosis 10:821 30. Karbowski M, Lee Y, Gaume B, Jeong S, Frank S, Nechushtan A, Santel A, Fuller M, Smith CL, and Youle RJ. 2002. Spatial and temporal a ssociation of Bax with mitochondrial fission sites, Drp1, and Mfn2 during apoptosis. J Cell Biol 159:931 8. Kelekar A, Chang BS, Harlan JE, Fesik SW, and Thompson CB. 1997. Bad is a BH3 domain containing protein that forms an inactivating dimer with Bcl XL Mol Cell Biol 17:7040 6. Kerr JF, Wyllie AH, and Currie AR. 1972. Apoptosis: a basic biological phenomenon with wide ranging implications in tissue kinetics. Br J Cancer 26:239 57. Kim H, Du F, Fang M, and Wang X. 2005. Formation of apoptosome is initiat ed by cytochrome c induced dATP hydrolysis and subsequent nucleotide exchange on Apaf 1. Proc Natl Acad Sci U S A 102:17545 50. Kim H, Tu H, Ren D, Takeuchi O, Jeffers JR, Zambetti GP, Hsieh JJ, and Cheng EH. 2009. Stepwise activation of BAX and BAK by tBI D, BIM, and PUMA initiates mitochondrial apoptosis. Mol Cell 36:487 99. Knijn HM, Wrenzycki C, Hendriksen PJ, Vos PL, Zeinstra EC, van Der Weijden GC, Niemann H, and Dieleman SJ. 2005. In vitro and in vivo culture effects on mRNA expression of genes involv ed in metabolism and apoptosis in bovine embryos. Reprod Fertil Dev 17:775 84. Ko J, Lee M, Cho S, Cho J, Lee B, Koh JS, Lee S, Shim Y, and Kim C. 2003. Bfl 1S, a novel alternative splice variant of Bfl 1, localizes in the nucleus via its C terminus and pr events cell death. Oncogene 22:2457 65. Kojima Y, Sasaki S, Kubota Y, Ikeuchi T, Hayashi Y, and Kohri K. 2000. Effects of simulated microgravity on mammalian fertilization and preimplantation embryonic development in vitro. Fertil Steril 74:1142 7. Kolesni ck RN. 1991. Sphingomyelin and derivatives as cellular signals. Prog Lipid Res 30:1 38. Kolliputi N, and Waxman AB. 2009. IL 6 cytoprotection in hyperoxic acute lung injury occurs via PI3K/Akt mediated Bax phosphorylation. Am J Physiol Lung Cell Mol Physio l 297:L6 16.

PAGE 113

113 Kopecn V, Flchon JE, Camous S, and Fulka J. 1989. Nucleologenesis and the onset of transcription in the eight cell bovine embryo: fine structural autoradiographic study. Mol Reprod Dev 1:79 90. Krininger CE, Stephens SH, and Hansen PJ. 2002. Developmental changes in inhibitory effects of arsenic and heat shock on growth of pre implantation bovine embryos. Mol Reprod Dev 63:335 40. Kroesen B, Jacobs S, Pettus BJ, Sietsma H, Kok JW, Hannun YA, and de Leij LF. 2003. BcR induced apoptosis involve s differential regulation of C16 and C24 ceramide formation and sphingolipid dependent activation of the proteasome. J Biol Chem 278:14723 31. Kumarswamy R, and Chandna S. 2009. Putative partners in Bax mediated cytochrome c release: ANT, CypD, VDAC or no ne of them? Mitochondrion 9:1 8. Lam D, Dickens D, Reid EB, Loh SH, Moisoi N, and Martins LM. 2009. MAP4K3 modulates cell death via the post transcriptional regulation of BH3 only proteins. Proc Natl Acad Sci U S A 106:11978 83. Lechardeur D, Drzymala L, S harma M, Zylka D, Kinach R, Pacia J, Hicks C, Usmani N, Rommens JM, and Lukacs GL. 2000. Determinants of the nuclear localization of the heterodimeric DNA fragmentation factor (ICAD/CAD). J Cell Biol 150:321 34. Lee M, Hung W, Chen F, and Huang HW. 2008. M echanism and kinetics of pore formation in membranes by water soluble amphipathic peptides. Proceedings of the National Academy of Sciences of the United States of America 105:5087 92. Lemmon Ma, Flanagan JM, Hunt JF, Adair BD, Bormann BJ, Dempsey CE, and Engelman DM. 1992 a Glycophorin A dimerization is driven by specific interactions between transmembrane alpha helices. J Biol Chem 267:7683 9. Lemmon Ma, Flanagan JM, Treutlein HR, Zhang J, and Engelman DM. 1992 b Sequence specificity in the dimerization o f transmembrane alpha helices. Biochemistry 31:12719 25. Letai A, Bassik MC, Walensky LD, Sorcinelli MD, Weiler S, and Korsmeyer SJ. 2002. Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics. Cancer Cell 2:183 92. Lewis ML, Reynolds JL, Cubano LA, Hatton JP, Lawless BD, and Piepmeier EH. 1998. Spaceflight alters microtubules and increases apoptosis in human lymphocytes (Jurkat). FASEB J 12:1007 18. Li H, Zhu H, Xu CJ, and Yuan J. 1998. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94:491 501.

PAGE 114

114 Li J, Viallet J, and Haura EB. 2008. A small molecule pan Bcl 2 family inhibitor, GX15 070, induces apoptosis and enhances cisplatin induced apoptosis in non small cell lung cancer cells. Cancer Chemother Pharmacol 61:525 34. Li LY, Luo X, and Wang X. 2001. Endonuclease G is an apoptotic DNase when released from mitochondria. Nature 412:95 9. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnem ri ES, and Wang X. 1997. Cytochrome c and dATP dependent formation of Apaf 1/caspase 9 complex initiates an apoptotic protease cascade. Cell 91:479 89. Liu J, Chandra D, Tang S, Chopra D, and Tang DG. 2002. Identification and characterization of Bimgamma, a novel proapoptotic BH3 only splice variant of Bim. Cancer Res 62:2976 81. Liu X, Kim CN, Yang J, Jemmerson R, and Wang X. 1996. Induction of apoptotic program in cell free extracts: requirement for dATP and cytochrome c. Cell 86:147 57. Liu X, Zou H, Sla ughter C, and Wang X. 1997. DFF, a heterodimeric protein that functions downstream of caspase 3 to trigger DNA fragmentation during apoptosis. Cell 89:175 84. kDa subunit of DNA frag mentation factor induces DNA fragmentation and chromatin condensation during apoptosis. Proc Natl Acad Sci U S A 95:8461 6. endonuclease DFF40 (caspase activated DNase or nucl ease). Oligomerization and direct interaction with histone H1. J Biol Chem 274:13836 40. Long CR, Dobrinsky JR, Garrett WM, and Johnson LA. 1998. Dual labeling of the cytoskeleton and DNA strand breaks in porcine embryos produced in vivo and in vitro. Mol Reprod Dev 51:59 65. Loskutoff N, Johnson W, and Betteridge K. 1993. The developmental competence of bovine embryos with reduced cell numbers. Theriogenology 39:95 107. Loureiro B, Brad AM, and Hansen PJ. 2007. Heat shock and tumor necrosis factor alpha in duce apoptosis in bovine preimplantation embryos through a caspase 9 dependent mechanism. Reproduction 133:1129 37. Lovell JF, Billen LP, Bindner S, Shamas Din A, Fradin C, Leber B, and Andrews DW. 2008. Membrane binding by tBid initiates an ordered series of events culminating in membrane permeabilization by Bax. Cell 135:1074 84. Lucken Ardjomande S, and Martinou J. 2005. Regulation of Bcl 2 proteins and of the permeability of the outer mitochondrial membrane. C R Biol 328:616 31.

PAGE 115

115 MacFarlane M. 2003. TRAI L induced signalling and apoptosis. Toxicol Lett 139:89 97. Marani M, Tenev T, Hancock D, Downward J, and Lemoine NR. 2002. Identification of novel isoforms of the BH3 domain protein Bim which directly activate Bax to trigger apoptosis. Mol Cell Biol 22:35 77 89. Matwee C, Betts DH, and King WA. 2000. Apoptosis in the early bovine embryo. Zygote 8:57 68. Maundrell K, Antonsson B, Magnenat E, Camps M, Muda M, Chabert C, Gillieron C, Boschert U, Vial Knecht E, Martinou JC, and Arkinstall S. 1997. Bcl 2 undergo es phosphorylation by c Jun N terminal kinase/stress activated protein kinases in the presence of the constitutively active GTP binding protein Rac1. J Biol Chem 272:25238 42. McConkey DJ, Nicotera P, Hartzell P, Bellomo G, Wyllie AH, and Orrenius S. 1989. Glucocorticoids activate a suicide process in thymocytes through an elevation of cytosolic Ca2+ concentration. Arch Biochem Biophys 269:365 70. Memili E, Dominko T, and First NL. 1998. Onset of transcription in bovine oocytes and preimplantation embryos. Mol Reprod Dev 51:36 41. Metcalfe AD, Hunter HR, Bloor DJ, Lieberman BA, Picton HM, Leese HJ, Kimber SJ, and Brison DR. 2004. Expression of 11 members of the BCL 2 family of apoptosis regulatory molecules during human preimplantation embryo development and fragmentation. Mol Reprod Dev 68:35 50. Modjtahedi N, Giordanetto F, Madeo F, and Kroemer G. 2006. Apoptosis inducing factor: vital and lethal. Trends Cell Biol 16:264 72. Morita Y, Perez GI, Maravei DV, Tilly KI, and Tilly JL. 1999. Targeted expression o f Bcl 2 in mouse oocytes inhibits ovarian follicle atresia and prevents spontaneous and chemotherapy induced oocyte apoptosis in vitro. Mol Endocrinol 13:841 50. Morita Y, and Tilly JL. 1999. Oocyte apoptosis: like sand through an hourglass. Dev Biol 213:1 17. Moss JI, Pontes E, and Hansen PJ. 2009. Insulin like growth factor 1 protects preimplantation embryos from anti developmental actions of menadione. Arch Toxicol 83:1001 7. Moulin M, Carpentier S, Levade T, and Arrigo A. 2007. Potential roles of membra ne fluidity and ceramide in hyperthermia and alcohol stimulation of TRAIL apoptosis. Apoptosis 12:1703 20. Muchmore SW et al. 1996. X ray and NMR structure of human Bcl xL, an inhibitor of programmed cell death. Nature 381:335 41.

PAGE 116

116 Muzio M, Stockwell BR, St ennicke HR, Salvesen GS, and Dixit VM. 1998. An induced proximity model for caspase 8 activation. J Biol Chem 273:2926 30. Nagata S. 1997. Apoptosis by death factor. Cell 88:355 65. Nagata S. 1999. Fas ligand induced apoptosis. Annu Rev Genet 33:29 55. Nak ano K, and Vousden KH. 2001. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 7:683 94. Nechushtan A, Smith CL, Hsu YT, and Youle RJ. 1999. Conformation of the Bax C terminus regulates subcellular location and cell death. EMBO J 18:2330 41. Nic olier M, Decrion Barthod A, Launay S, Prtet J, and Mougin C. 2009. Spatiotemporal activation of caspase dependent and independent pathways in staurosporine induced apoptosis of p53wt and p53mt human cervical carcinoma cells. Biol Cell 101:455 67. Nez G London L, Hockenbery D, Alexander M, McKearn JP, and Korsmeyer SJ. 1990. Deregulated Bcl 2 gene expression selectively prolongs survival of growth factor deprived hemopoietic cell lines. J Immunol 144:3602 10. O'Connor L, Strasser A, O'Reilly LA, Hausman n G, Adams JM, Cory S, and Huang DC. 1998. Bim: a novel member of the Bcl 2 family that promotes apoptosis. EMBO J 17:384 95. Oberhammer F, Wilson JW, Dive C, Morris ID, Hickman JA, Wakeling AE, Walker PR, and Sikorska M. 1993. Apoptotic death in epithelia l cells: cleavage of DNA to 300 and/or 50 kb fragments prior to or in the absence of internucleosomal fragmentation. EMBO J 12:3679 84. Oda E. 2000. Noxa, a BH3 Only Member of the Bcl 2 Family and Candidate Mediator of p53 Induced Apoptosis. Science 288:10 53 1058. Olichon A, Baricault L, Gas N, Guillou E, Valette A, Belenguer P, and Lenaers G. 2003. Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. J Biol Chem 278:7743 6. Otera H, Ohsakaya S, Nagaura Z, Ishihara N, and Mihara K. 2005. Export of mitochondrial AIF in response to proapoptotic stimuli depends on processing at the intermembrane space. EMBO J 24:1375 86. Parchment RE. 1993. The implications of a unified theory of progr ammed cell death, polyamines, oxyradicals and histogenesis in the embryo. Int J Dev Biol 37:75 83. Park JS, Jeong YS, Shin ST, Lee K, and Kang Y. 2007. Dynamic DNA methylation reprogramming: active demethylation and immediate remethylation in the male pron ucleus of bovine zygotes. Dev Dyn 236:2523 33.

PAGE 117

117 Park SY, Kim EY, Jeon K, Cui X, Lee WD, Kim N, Park SP, and Lim JH. 2007. Survivin acts as anti apoptotic factor during the development of bovine pre implantation embryos. Mol Reprod Dev 74:582 90. Parker MW, and Pattus F. 1993. Rendering a membrane protein soluble in water: a common packing motif in bacterial protein toxins. Trends Biochem Sci 18:391 5. Parone Pa, James DI, Da Cruz S, Mattenberger Y, Donz O, Barja F, and Martinou J. 2006. Inhibiting the mitoc hondrial fission machinery does not prevent Bax/Bak dependent apoptosis. Mol Cell Biol 26:7397 408. Parra V, Eisner V, Chiong M, Criollo A, Moraga F, Garcia A, Hrtel S, Jaimovich E, Zorzano A, Hidalgo C, and Lavandero S. 2008. Changes in mitochondrial dyn amics during ceramide induced cardiomyocyte early apoptosis. Cardiovasc Res 77:387 97. Parrish JJ, Susko Parrish JL, Leibfried Rutledge ML, Critser ES, Eyestone WH, and First NL. 1986. Bovine in vitro fertilization with frozen thawed semen. Theriogenology 25:591 600. Paula Lopes FF, and Hansen PJ. 2002 a Apoptosis is an adaptive response in bovine preimplantation embryos that facilitates survival after heat shock. Biochem Biophys Res 295:37 42. Paula Lopes FF, and Hansen PJ. 2002 b Heat shock induced apopto sis in preimplantation bovine embryos is a developmentally regulated phenomenon. Biol Reprod 66:1169 77. Perez GI, Tao XJ, and Tilly JL. 1999. Fragmentation and death (a.k.a. apoptosis) of ovulated oocytes. Mol Hum Reprod 5:414 20. Perfettini J, Roumier T, and Kroemer G. 2005. Mitochondrial fusion and fission in the control of apoptosis. Trends Cell Biol 15:179 83. Petros AM, Medek A, Nettesheim DG, Kim DH, Yoon HS, Swift K, Matayoshi ED, Oltersdorf T, and Fesik SW. 2001. Solution structure of the antiapopt otic protein bcl 2. Proc Natl Acad Sci U S A 98:3012 7. Petros AM, Olejniczak ET, and Fesik SW. 2004. Structural biology of the Bcl 2 family of proteins. Biochim Biophys Acta 1644:83 94. Pierce GB, Lewellyn AL, and Parchment RE. 1989. Mechanism of programm ed cell death in the blastocyst. Proc Natl Acad Sci U S A 86:3654 8. Polster BM, Basaez G, Etxebarria A, Hardwick JM, and Nicholls DG. 2005. Calpain I induces cleavage and release of apoptosis inducing factor from isolated mitochondria. J Biol Chem 280:64 47 54.

PAGE 118

118 Poruchynsky MS, Wang EE, Rudin CM, Blagosklonny MV, and Fojo T. 1998. Bcl xL is phosphorylated in malignant cells following microtubule disruption. Cancer Res 58:3331 8. Qian S, Wang W, Yang L, and Huang HW. 2008. Structure of transmembrane pore ind uced by Bax derived peptide: evidence for lipidic pores. Proc Natl Acad Sci U S A 105:17379 83. Ramirez C. 2002. Modulation of Eukaryotic mRNA Stability via the Cap binding Translation Complex eIF4F. J Mol Biol 318:951 962. Renatus M, Stennicke HR, Scott F L, Liddington RC, and Salvesen GS. 2001. Dimer formation drives the activation of the cell death protease caspase 9. Proc Natl Acad Sci U S A 98:14250 5. Renshaw SA, Dempsey CE, Barnes FA, Bagstaff SM, Dower SK, Bingle CD, and Whyte MK. 2004. Three novel B id proteins generated by alternative splicing of the human Bid gene. J Biol Chem 279:2846 55. Riedl SJ, Li W, Chao Y, Schwarzenbacher R, and Shi Y. 2005. Structure of the apoptotic protease activating factor 1 bound to ADP. Nature 434:926 33. Riedl SJ, and Salvesen GS. 2007. The apoptosome: signalling platform of cell death. Nat Rev Mol Cell Biol 8:405 13. Robert C, McGraw S, Massicotte L, Pravetoni M, Gandolfi F, and Sirard M. 2002. Quantification of housekeeping transcript levels during the development of bovine preimplantation embryos. Biol Reprod 67:1465 72. Ronca AE, and Alberts JR. 2000. Physiology of a microgravity environment selected contribution: effects of spaceflight during pregnancy on labor and birth at 1 G. J Appl Physiol 89:849 54; discussion 848. Roth Z, and Hansen PJ. 2004. Involvement of apoptosis in disruption of developmental competence of bovine oocytes by heat shock during maturation. Biol Reprod 71:1898 906. Sakahira H, Enari M, and Nagata S. 1998. Cleavage of CAD inhibitor in CAD acti vation and DNA degradation during apoptosis. Nature 391:96 9. Sakahira H, Enari M, and Nagata S. 1999. Functional differences of two forms of the inhibitor of caspase activated DNase, ICAD L, and ICAD S. J Biol Chem 274:15740 4. Sakahira H, and Nagata S. 2 002. Co translational folding of caspase activated DNase with Hsp70, Hsp40, and inhibitor of caspase activated DNase. J Biol Chem 277:3364 70.

PAGE 119

119 Sakatani M, Kobayashi S, and Takahashi M. 2004. Effects of heat shock on in vitro development and intracellular o xidative state of bovine preimplantation embryos. Mol Reprod Dev 67:77 82. Samejima K, and Earnshaw WC. 2000. Differential localization of ICAD L and ICAD S in cells due to removal of a C terminal NLS from ICAD L by alternative splicing. Exp Cell Res 255:3 14 20. Santel A, Frank S, Gaume B, Herrler M, Youle RJ, and Fuller MT. 2003. Mitofusin 1 protein is a generally expressed mediator of mitochondrial fusion in mammalian cells. J Cell Sci 116:2763 74. Sattler M et al. 1997. Structure of Bcl xL Bak peptide co mplex: recognition between regulators of apoptosis. Science 275:983 6. Scaffidi C, Fulda S, Srinivasan A, Friesen C, Li F, Tomaselli KJ, Debatin KM, Krammer PH, and Peter ME. 1998. Two CD95 (APO 1/Fas) signaling pathways. EMBO J 17:1675 87. Schatten H, Lew is ML, and Chakrabarti A. 2001. Spaceflight and clinorotation cause cytoskeleton and mitochondria changes and increases in apoptosis in cultured cells. Acta Astronaut 49:399 418. Scorrano L, Ashiya M, Buttle K, Weiler S, Oakes SA, Mannella CA, and Korsmeye r SJ. 2002. A distinct pathway remodels mitochondrial cristae and mobilizes cytochrome c during apoptosis. Dev Cell 2:55 67. Senkal CE, Ponnusamy S, Rossi MJ, Bialewski J, Sinha D, Jiang JC, Jazwinski SM, Hannun YA, and Ogretmen B. 2007. Role of human long evity assurance gene 1 and C18 ceramide in chemotherapy induced cell death in human head and neck squamous cell carcinomas. Mol Cancer Ther 6:712 22. Seo SY, Chen Y, Ivanovska I, Ranger AM, Hong SJ, Dawson VL, Korsmeyer SJ, Bellows DS, Fannjiang Y, and Har dwick JM. 2004. BAD is a pro survival factor prior to activation of its pro apoptotic function. J Biol Chem 279:42240 9. Sergeev IN, and Norman AW. 2003. Calcium as a mediator of apoptosis in bovine oocytes and preimplantation embryos. Endocrine 22:169 76. Siskind LJ, Feinstein L, Yu T, Davis JS, Jones D, Choi J, Zuckerman JE, Tan W, Hill RB, Hardwick JM, and Colombini M. 2008. Anti apoptotic Bcl 2 Family Proteins Disassemble Ceramide Channels. J Biol Chem 283:6622 30. Siskind LJ, Mullen TD, Romero Rosales K, Clarke CJ, Hernandez Corbacho MJ, Edinger AL, and Obeid LM. 2010. The BCL 2 protein BAK is required for long chain ceramide generation during apoptosis. J Biol Chem 285:11818 26.

PAGE 120

120 Slee EA et al. 1999. Ordering the cytochrome c initiated caspase cascade: hierarchical activation of caspases 2, 3, 6, 7, 8, and 10 in a caspase 9 dependent manner. J Cell Biol 144:281 92. Smirnova E, Griparic L, Shurland DL, and van Der Bliek AM. 2001. Dynamin related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 12:2245 56. Song Q, Kuang Y, Dixit VM, and Vincenz C. 1999. Boo, a novel negative regulator of cell death, interacts with Apaf 1. EMBO J 18:167 78. Soto P, Natzke RP, and Hansen PJ. 2003 a Actions of tumor necrosis factor alp ha on oocyte maturation and embryonic development in cattle. Am J Reprod Immunol 50:380 8. Soto P, Natzke RP, and Hansen PJ. 2003 b Identification of possible mediators of embryonic mortality caused by mastitis: actions of lipopolysaccharide, prostaglandin F2alpha, and the nitric oxide generator, sodium nitroprusside dihydrate, on oocyte maturation and embryonic development in cattle. Am J Reprod Immunol 50:263 72. Souza KA, Black SD, and Wassersug RJ. 1995. Amphibian development in the virtual absence of g ravity. Proc Natl Acad Sci U S A 92:1975 8. Spanos S, Rice S, Karagiannis P, Taylor D, Becker DL, Winston RM, and Hardy K. 2002. Caspase activity and expression of cell death genes during development of human preimplantation embryos. Reproduction 124:353 6 3. Srinivasula SM, Ahmad M, Fernandes Alnemri T, and Alnemri ES. 1998. Autoactivation of procaspase 9 by Apaf 1 mediated oligomerization. Mol Cell 1:949 57. Srinivasula SM, Hegde R, Saleh a, Datta P, Shiozaki E, Chai J, Lee Ra, Robbins PD, Fernandes Alnemr i T, Shi Y, and Alnemri ES. 2001. A conserved XIAP interaction motif in caspase 9 and Smac/DIABLO regulates caspase activity and apoptosis. Nature 410:112 6. Staggs KL, Austin KJ, Johnson GA, Teixeira MG, Talbott CT, Dooley VA, and Hansen TR. 1998. Complex induction of bovine uterine proteins by interferon tau. Biol Reprod 59:293 7. Stankiewicz AR, Lachapelle G, Foo CP, Radicioni SM, and Mosser DD. 2005. Hsp70 inhibits heat induced apoptosis upstream of mitochondria by preventing Bax translocation. J Biol C hem 280:38729 39. Sun YF, Yu LY, Saarma M, Timmusk T, and Arumae U. 2001. Neuron specific Bcl 2 homology 3 domain only splice variant of Bak is anti apoptotic in neurons, but pro apoptotic in non neuronal cells. J Biol Chem 276:16240 7.

PAGE 121

121 Susin Sa et al. 199 9. Molecular characterization of mitochondrial apoptosis inducing factor. Nature 397:441 6. Suzuki M, Youle RJ, and Tjandra N. 2000. Structure of Bax: coregulation of dimer formation and intracellular localization. Cell 103:645 54. Suzuki Y, Imai Y, Nakaya ma H, Takahashi K, Takio K, and Takahashi R. 2001. A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol Cell 8:613 21. Tan KO, Tan KM, Chan SL, Yee KS, Bevort M, Ang KC, and Yu VC. 2001. MAP 1, a nov el proapoptotic protein containing a BH3 like motif that associates with Bax through its Bcl 2 homology domains. J Biol Chem 276:2802 7. Tilly JL. 2001. Commuting the death sentence: how oocytes strive to survive. Nat Rev Mol Cell Biol 2:838 48. Tomnek M, Kopecn V, and Kanka J. 1989. Genome reactivation in developing early pig embryos: an ultrastructural and autoradiographic analysis. Anat Embryol 180:309 16. Tsujimoto Y, Finger LR, Yunis J, Nowell PC, and Croce CM. 1984. Cloning of the chromosome breakpo int of neoplastic B cells with the t(14;18) chromosome translocation. Science 226:1097 9. Uva BM, Masini MA, Sturla M, Bruzzone F, Giuliani M, Tagliafierro G, and Strollo F. 2002. Microgravity induced apoptosis in cultured glial cells. Eur J Histochem 46:2 09 14. van Blerkom J. 1981. Structural relationship and posttranslational modification of stage specific proteins synthesized during early preimplantation development in the mouse. Proc Natl Acad Sci U S A 78:7629 33. van Blerkom J, and Davis PW. 1998. DNA strand breaks and phosphatidylserine redistribution in newly ovulated and cultured mouse and human oocytes: occurrence and relationship to apoptosis. Hum Reprod 13:1317 24. van Blerkom J, and Davis P. 2007. Mitochondrial signaling and fertilization. Mol H um Reprod 13:759 70. van Loo G et al. 2001. Endonuclease G: a mitochondrial protein released in apoptosis and involved in caspase independent DNA degradation. Cell Death Differ 8:1136 42. van Loo G, van Gurp M, Depuydt B, Srinivasula SM, Rodriguez I, Alnem ri ES, Gevaert K, Vandekerckhove J, Declercq W, and Vandenabeele P. 2002. The serine protease Omi/HtrA2 is released from mitochondria during apoptosis. Omi interacts with caspase inhibitor XIAP and induces enhanced caspase activity. Cell Death Differ 9:20 6.

PAGE 122

122 Vassy J, Portet S, Beil M, Millot G, Fauvel Lafve F, Gasset G, and Schoevaert D. 2003. Weightlessness acts on human breast cancer cell line MCF 7. Adv Space Res 32:1595 603. Vaux DL, Cory S, and Adams JM. 1988. Bcl 2 gene promotes haemopoietic cell sur vival and cooperates with c myc to immortalize pre B cells. Nature 335:440 2. Veresov VG, and Davidovskii AI. 2009. Activation of Bax by joint action of tBid and mitochondrial outer membrane: Monte Carlo simulations. Eur Biophys J 38:941 60. Verhagen AM, E kert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL, Simpson RJ, and Vaux DL. 2000. Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102:43 53. Verhagen AM et al. 2002. HtrA2 p romotes cell death through its serine protease activity and its ability to antagonize inhibitor of apoptosis proteins. J Biol Chem 277:445 54. Verheij M et al. 1996. Requirement for ceramide initiated SAPK/JNK signalling in stress induced apoptosis. Nature 380:75 9. Wang K, Gross A, Waksman G, and Korsmeyer SJ. 1998. Mutagenesis of the BH3 domain of BAX identifies residues critical for dimerization and killing. Mol Cell Biol 18:6083 9. Wang K, Yin XM, Chao DT, Milliman CL, and Korsmeyer SJ. 1996. BID: a nov el BH3 domain only death agonist. Genes Dev 10:2859 2869. Wasiak S, Zunino R, and McBride HM. 2007. Bax/Bak promote sumoylation of DRP1 and its stable association with mitochondria during apoptotic cell death. J Cell Biol 177:439 50. Wei MC, Lindsten T, Mo otha VK, Weiler S, Gross A, Ashiya M, Thompson CB, and Korsmeyer SJ. 2000. tBID, a membrane targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev 14:2060 71. Wei MC, Zong WX, Cheng EH, Lindsten T, Panoutsakopoulou V, Ross aJ, Roth Ka, MacGregor GR, Thompson CB, and Korsmeyer SJ. 2001. Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292:727 30. Whitaker M. 2006. Calcium at fertilization and in early development. Physiol Rev 86:25 88. Lanuszewska J, Cary RB, and Garrard WT. 2003. Subunit structures and stoichiometries of human DNA fragmentation factor proteins before and after induction of apoptosis. J Biol Chem 278:26915 22.

PAGE 123

123 action of the major apoptotic nucleases DFF40/CAD and endonuclease G. J Cell Biochem 94:1078 87. Willis SN, Chen L, Dewson G, Wei A, Naik E, Fletcher JI, Adams JM, and Huang DC. 2005. Proapoptotic Bak is sequestered by Mcl 1 and Bcl xL, but not Bcl 2, unti l displaced by BH3 only proteins. Genes Dev 19:1294 305. Woo E, Kim Y, Kim M, Han W, Shin S, Robinson H, Park S, and Oh B. 2004. Structural mechanism for inactivation and activation of CAD/DFF40 in the apoptotic pathway. Mol Cell 14:531 9. Wu X, and Deng Y 2002. Bax and BH3 domain only proteins in p53 mediated apoptosis. Front Biosci 7:d151 6. Wyllie AH, Kerr JF, and Currie AR. 1980. Cell death: the significance of apoptosis. Int Rev Cytol 68:251 306. Wyllie AH. 1995. The genetic regulation of apoptosis. C urr Opin Genet Dev 5:97 104. Yamaguchi R, Lartigue L, Perkins G, Scott RT, Dixit A, Kushnareva Y, Kuwana T, Ellisman MH, and Newmeyer DD. 2008. Opa1 mediated cristae opening is Bax/Bak and BH3 dependent, required for apoptosis, and independent of Bak oligo merization. Mol Cell 31:557 69. Yamamoto K, Ichijo H, and Korsmeyer SJ. 1999. BCL 2 is phosphorylated and inactivated by an ASK1/Jun N terminal protein kinase pathway normally activated at G(2)/M. Mol Cell Biol 19:8469 78. Yang E, Zha J, Jockel J, Boise LH Thompson CB, and Korsmeyer SJ. 1995. Bad, a heterodimeric partner for Bcl XL and Bcl 2, displaces Bax and promotes cell death. Cell 80:285 91. Yang HW, Hwang KJ, Kwon HC, Kim HS, Choi KW, and Oh KS. 1998. Detection of reactive oxygen species (ROS) and ap optosis in human fragmented embryos. Hum Reprod 13:998 1002. Yang MY, and Rajamahendran R. 2002. Expression of Bcl 2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod Sci 70:159 69. Yin XM, Oltvai ZN, and Korsmeyer SJ. 1994. BH1 and BH2 domains of Bcl 2 are required for inhibition of apoptosis and heterodimerization with Bax. Nature 369:321 3. Yin X, Ding W, and Zhao Y. 2003." Bcl 2 Family Proteins: Master Regulators of Apoptosis." In Essentials of Apoptosi s: A Guide for Basic and Clinical Research, Xiao Ming Yin and Zheng Dong. Totowa, NJ: Humana Press Inc., p. 19.

PAGE 124

124 You H, Pellegrini M, Tsuchihara K, Yamamoto K, Hacker G, Erlacher M, Villunger A, and Mak TW. 2006. FOXO3a dependent regulation of Puma in respo nse to cytokine/growth factor withdrawal. J Exp Med 203:1657 63. Youle RJ, and Karbowski M. 2005. Mitochondrial fission in apoptosis. Nat Rev Mol Cell Biol 6:657 63. Youle RJ, and Strasser A. 2008. The BCL 2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol 9:47 59. Yu S, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ, Poirier GG, Dawson TM, and Dawson VL. 2002. Mediation of poly(ADP ribose) polymerase 1 dependent cell death by apoptosis inducing factor. Science 297:25 9 63. Yu X, Acehan D, Mntret J, Booth CR, Ludtke SJ, Riedl SJ, Shi Y, Wang X, and Akey CW. 2005. A structure of the human apoptosome at 12.8 A resolution provides insights into this cell death platform. Structure 13:1725 35. Zahir N, and Weaver VM. 2004. Death in the third dimension: apoptosis regulation and tissue architecture. Curr Opin Genet Dev 14:71 80. Zha H, and Reed JC. 1997. Heterodimerization independent functions of cell death regulatory proteins Bax and Bcl 2 in yeast and mammalian cells. J Bi ol Chem 272:31482 8. Zha J, Harada H, Yang E, Jockel J, and Korsmeyer SJ. 1996. Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14 3 3 not BCL X(L). Cell 87:619 28. Zhang D, Lu C, Whiteman M, Chance B, and A rmstrong JS. 2007. The Mitochondrial Permeability Transition Regulates Cytochrome c Release for Apoptosis during Endoplasmic Reticulum Stress by Remodeling the Cristae Junction. J Biol Chem 283:3476 3486. Zhang J et al. 2003. Endonuclease G is required for early embryogenesis and normal apoptosis in mice. Proc Natl Acad Sci U S A 100:15782 7. Zou H, Henzel WJ, Liu X, Lutschg A, and Wang X. 1997. Apaf 1, a human protein homologous to C. elegans CED 4, partic ipates in cytochrome c dependent activation of caspase 3. Cell 90:405 13.

PAGE 125

125 BIOGRAPHICAL SKETCH Justin Matthew Fear was born on July 15, 1982, the second of two sons, to Karen M and Jerry J. Fear, in St. Louis Missouri. In 2004, he received his Bachelor of Science d egree in a nimal s cience from the University of Missouri Columbia. He then enrolled at The Ohio State University as a non degree graduate student in F isheries and W ildlife in 2005. In 2006 he began to work as a laboratory manager for Dr. Joy L. Pate at The Ohio State University. In the summer of 2007 he enrolled at the University of Florida on a research assistantship in the laboratory of Dr. Peter J. Hansen. He is currently a candidate for the Master of Science degree in the Animal Molecular a nd Cellular Biology Graduate P rogram while conducting research in the Department of Animal Sciences. On completion of this degree he will continue his education by pursuing a Doctor of Philosophy in the Genetics and Genomics P rogram at the University of Florida.