<%BANNER%>

Effects of Mineralocorticoid and Glucocorticoid Agonists on Gene and Protein Expression, Structural Maturation and Compl...

Permanent Link: http://ufdc.ufl.edu/UFE0041850/00001

Material Information

Title: Effects of Mineralocorticoid and Glucocorticoid Agonists on Gene and Protein Expression, Structural Maturation and Compliance in the Ovine Preterm Fetal Lung
Physical Description: 1 online resource (85 p.)
Language: english
Creator: Mccartney, Jarret
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aldosterone, betamethasone, corticosteroids, dexamethasone, enac, fetal, glucocorticoid, lung, mineralocorticoid, ovine, preterm, respiratory, sheep
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: EFFECTS OF MINERALOCORTICOID AND GLUCOCORTICOID AGONISTS ON GENE AND PROTEIN EXPRESSION, STRUCTURAL MATURATION AND COMPLIANCE IN THE OVINE PRETERM FETAL LUNG In mammalian pregnancy, the in utero fetal cortisol surge that occurs shortly before parturition stimulates lung maturation and is thought to occur through glucocorticoid receptor (GR) dependent effects. Antenatal treatment of women threatening preterm labor with synthetic glucocorticoids has been shown to significantly decrease respiratory distress in preterm infants. We have found that the mineralocorticoid receptor (MR) is abundantly expressed in ovine fetal lungs, as are several genes known to be induced by MR action in the adult kidney, including the epithelial sodium channel alpha subunit (?-ENaC) and sodium potassium adenosine triphosphatase (Na,K ATPase -?1). However, the role of MR activation in fetal lung maturation is not clear. The purpose of this study was to determine if administration of an MR agonist would increase lung structural maturation, effect gene and protein expression, and lung compliance in ovine fetuses at 130d gestation. Fetuses were infused with a solution containing the MR specific agonist aldosterone (0.2 mg/48h), the synthetic GR specific agonist betamethasone (0.25 mg or 0.75 mg 48h), or a combined 0.2mg aldosterone and betamethasone solution with both 0.25mg and 0.75mg betamethasone doses. In situ fetal lung compliance was then determined by measurement of intrapulmonary pressure produced by inflation of the lungs by 4-5 10ml stepwise volumes of air injected into the trachea. While there was not an overall aldosterone effect on fetal lung peak pressure measurements, inflation pressure measurements showed a distinct effect of aldosterone to decrease intrapulmonary pressure at the initial inflation volume and again at the majority of subsequent volumes, indicating an apparent initial and transiently sustained increase in ovine fetal lung compliance. There were few significant effects of either dose of betamethasone alone and the lower concentration of betamethasone infusion decreased the effect of aldosterone to increase fetal lung compliance. Combined 0.75 mg dose of betamethasone with aldosterone only transiently improved lung compliance. These results suggest an effect of aldosterone to increase lung compliance in the preterm ovine lung that involves a mechanism occurring through MR-specific factors. Quantitative real-time polymerase chain reaction (PCR) data suggest that GR agonists increase expression of ?-ENaC and Na,K ATPase, while MR agonists do not. Western blot of ? and ? ENaC protein did not indicate a significant change in ?-ENaC abundance in membrane. However, whole cell abundance and relative ratios of these two subunits are greatly affected by corticosteroid infusion suggesting a complex stoichiometric relationship that is perhaps affecting the efficacy of these channels. Tissue histology confirmed a significant increase in elastin and collagen abundance in GR agonist infused fetuses but not in aldosterone infused fetuses. Perhaps indicating that structural changes in ovine lung extra cellular matrix (ECM) proteins are contributing to the observed changes in lung compliance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jarret Mccartney.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Keller-Wood, Maureen.
Local: Co-adviser: Wood, Charles E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041850:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041850/00001

Material Information

Title: Effects of Mineralocorticoid and Glucocorticoid Agonists on Gene and Protein Expression, Structural Maturation and Compliance in the Ovine Preterm Fetal Lung
Physical Description: 1 online resource (85 p.)
Language: english
Creator: Mccartney, Jarret
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aldosterone, betamethasone, corticosteroids, dexamethasone, enac, fetal, glucocorticoid, lung, mineralocorticoid, ovine, preterm, respiratory, sheep
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: EFFECTS OF MINERALOCORTICOID AND GLUCOCORTICOID AGONISTS ON GENE AND PROTEIN EXPRESSION, STRUCTURAL MATURATION AND COMPLIANCE IN THE OVINE PRETERM FETAL LUNG In mammalian pregnancy, the in utero fetal cortisol surge that occurs shortly before parturition stimulates lung maturation and is thought to occur through glucocorticoid receptor (GR) dependent effects. Antenatal treatment of women threatening preterm labor with synthetic glucocorticoids has been shown to significantly decrease respiratory distress in preterm infants. We have found that the mineralocorticoid receptor (MR) is abundantly expressed in ovine fetal lungs, as are several genes known to be induced by MR action in the adult kidney, including the epithelial sodium channel alpha subunit (?-ENaC) and sodium potassium adenosine triphosphatase (Na,K ATPase -?1). However, the role of MR activation in fetal lung maturation is not clear. The purpose of this study was to determine if administration of an MR agonist would increase lung structural maturation, effect gene and protein expression, and lung compliance in ovine fetuses at 130d gestation. Fetuses were infused with a solution containing the MR specific agonist aldosterone (0.2 mg/48h), the synthetic GR specific agonist betamethasone (0.25 mg or 0.75 mg 48h), or a combined 0.2mg aldosterone and betamethasone solution with both 0.25mg and 0.75mg betamethasone doses. In situ fetal lung compliance was then determined by measurement of intrapulmonary pressure produced by inflation of the lungs by 4-5 10ml stepwise volumes of air injected into the trachea. While there was not an overall aldosterone effect on fetal lung peak pressure measurements, inflation pressure measurements showed a distinct effect of aldosterone to decrease intrapulmonary pressure at the initial inflation volume and again at the majority of subsequent volumes, indicating an apparent initial and transiently sustained increase in ovine fetal lung compliance. There were few significant effects of either dose of betamethasone alone and the lower concentration of betamethasone infusion decreased the effect of aldosterone to increase fetal lung compliance. Combined 0.75 mg dose of betamethasone with aldosterone only transiently improved lung compliance. These results suggest an effect of aldosterone to increase lung compliance in the preterm ovine lung that involves a mechanism occurring through MR-specific factors. Quantitative real-time polymerase chain reaction (PCR) data suggest that GR agonists increase expression of ?-ENaC and Na,K ATPase, while MR agonists do not. Western blot of ? and ? ENaC protein did not indicate a significant change in ?-ENaC abundance in membrane. However, whole cell abundance and relative ratios of these two subunits are greatly affected by corticosteroid infusion suggesting a complex stoichiometric relationship that is perhaps affecting the efficacy of these channels. Tissue histology confirmed a significant increase in elastin and collagen abundance in GR agonist infused fetuses but not in aldosterone infused fetuses. Perhaps indicating that structural changes in ovine lung extra cellular matrix (ECM) proteins are contributing to the observed changes in lung compliance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jarret Mccartney.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Keller-Wood, Maureen.
Local: Co-adviser: Wood, Charles E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041850:00001


This item has the following downloads:


Full Text

PAGE 1

1 EFFECTS OF MINERALOCORTICOID AND GLUCOCORTICOID AGONISTS ON GENE AND PROTEIN EXPRESSION, STRUCTURAL MATURATION AND COMPLIANCE IN THE OVINE PRETERM FETAL LUNG By JARRET MCCARTNEY A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Jarret McCartney

PAGE 3

3 To my mom, whose perseverance and love for her family has always been an inspiration to me, a lso to my entire family, friends and especially Julie for their support and understanding

PAGE 4

4 ACKNOWLEDGMENTS I would like to acknowledge my mentor Dr. Maureen Keller Wood for the opportunity to learn and work under her guidance. She and Dr. Charl es Wood demonstrate unquestionable enthusiasm for scientific research and have been instrumental in my development as a scientist and as an individual. I would also like to thank Dr. Charles Wood for selflessly performing all the fetal surgeries utilized i n this study and for his invaluable tutelage in the subject of cardiovascular and endocrine physiology. I also acknowledge my committee member Dr. Nancy Denslow for all of her helpful suggestions and advice. Dr. Elaine Sumners deserves special recognition for her instruction of laboratory techniques, friendship and all of her advice scientific and otherwise. Finally, I would like to acknowledge the contribution of every member of the Wood and Keller Wood laboratories that have helped me along the way. Than k you everyone.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 Fetal Lung Development ................................ ................................ ......................... 11 Collagen, Elastin Fibers and Surfactant ................................ ................................ .. 14 The H ypothalamic P ituitary A drenal (HPA) Axis ................................ ..................... 17 Pregnancy and Development of the Fetal HPA Axis ................................ ............... 18 Regulation and Action of Cortisol ................................ ................................ ............ 20 Fetal Cortisol Surg e ................................ ................................ ................................ 21 Fetal Respiratory Distress ................................ ................................ ....................... 22 Synthetic Glucocorticoids and the Attenuation of Respiratory Distress .................. 23 Fetal Lung Fluid Secretion ................................ ................................ ...................... 25 Fetal Lung Fluid Reabsorption ................................ ................................ ................ 26 E pithelial Sodium Channel (ENaC) Sodium Potassium Adenosine T riphosphatase (Na, K ATPase) S erum G lucocorticoid Regulated K inase (SGK) and Regulation by Glucocorticoids ................................ ........................... 26 E NaC Activity in the Kidney and the Role of Al dosterone ................................ ....... 29 Prospective Study Rationale ................................ ................................ ................... 30 Specific Aims ................................ ................................ ................................ .......... 32 2 EXPE RIMENTAL METHODS ................................ ................................ ................. 34 Surgical Procedures ................................ ................................ ............................... 34 Experiment Procedures ................................ ................................ .......................... 35 Experiment Analysis ................................ ................................ ............................... 38 Western Blotting ................................ ................................ ................................ ..... 38 Western Blotting Analysis ................................ ................................ ....................... 40 Messenger Ribonucleic Acid ( mRNA ) E xtraction and Quantitative Real Time P olymerase Chain Reaction (PCR) ................................ ................................ ..... 41 Quantitative Real Time P CR Analysis ................................ ................................ .... 42 Collagen Staining ................................ ................................ ................................ .... 42 Collagen Staining Analysis ................................ ................................ ..................... 43 Elastin Staining ................................ ................................ ................................ ....... 43 Elastin Staining Analysis ................................ ................................ ......................... 44

PAGE 6

6 3 RESULTS ................................ ................................ ................................ ............... 45 Fetal Lung Inflation Curves ................................ ................................ ..................... 45 Inflation Curve Plateau Pressure Data ................................ ................................ .... 46 Expression of ENaC, Na, K ATPase and SGK mRNA ................................ ........ 47 Expres sion ENaC Membrane and Whole Cell Protein ................................ ........ 48 Expression EnaC Membrane and Whole Cell Protein ................................ ......... 49 Expression of Mineralocorticoi d Receptor (MR) and Glucocorticoid Receptor (GR) mRNA ................................ ................................ ................................ ......... 50 Expression of Aquapori n (AQP) 1 and AQP 5 mRNA ................................ ............ 51 Expression of Surfactan t Related Protein (SP) A and SP B mRNA ........................ 51 Plasma Cortisol and Aldosterone ................................ ................................ ............ 51 Histology ................................ ................................ ................................ ................. 52 4 DISCUSSION ................................ ................................ ................................ ......... 63 Effects of Corticosteroid Infusion on Lung Compliance ................................ .......... 63 Expression of ENaC, Na, K ATPase and SGK 1 mRNA ................................ .... 66 Expression of MR and GR mRNA ................................ ................................ ........... 67 Expression of AQP 1, AQP 5, SP A and SP B mRNA ................................ ........... 68 ENaC Whole Cell and Membrane Protein ................................ ........................... 70 ENaC Whole Cell and Membrane Protein ................................ ........................... 71 Histology and Lung Percent Wet Weight ................................ ................................ 73 Significance and Future Directions ................................ ................................ ......... 74 REFERENCES ................................ ................................ ................................ .............. 78 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 85

PAGE 7

7 LIST OF TABLES Table page 3 1 Percent lung weight determined after baking the lungs. ................................ .... 59 3 2 Primer s and Probes used in real time p olymerase c hain r eaction assays. ........ 60

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Proposed mechanism of lung flu id reabsorption across fetal lung epithelium ... 33 3 1 Peak pressure inflation data for both inflation series ................................ ......... 53 3 2 Plateau pressu re measurements for in situ lung compliance data ..................... 54 3 3 Quant i tative r eal t ime polymerase c hain r eaction (PCR) data of genes involved in lung fluid homeostasis. ................................ ................................ ..... 55 3 4 Western blots of e pithelial s odium c hannel alpha (ENaC) protein in whole cell and membrane ................................ ................................ ............................. 56 3 5 Western blots of ENaC protein in whole cell and membrane .......................... 57 3 6 Fetal plasma aldos terone and cortisol concentrations at 0h pre infusion and 48h post sta rt of corticosteroid infusion. ................................ ............................. 58 3 7 ......................... 61 3 8 Typcial picrosirius red solution staining of ovine fetal lung parenchyma. ............ 62

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of F lorida in Partial Fulfillment of the Requirements for the Master of Science EFFECTS OF MINERALOCORTICOID AND GLUCOCORTICOID AGONISTS ON GENE AND PROTEIN EXPRESSION, STRUCTURAL MATURATION AND COMPLIANCE IN THE OVINE PRETERM FETAL LUNG By J a rret M c C artney August 2010 Chair: Maureen Keller Wood Cochair: Charles Wood Major: Medical Sciences In mammalian pregnancy, the in utero fetal cortisol surge that occurs shortly before parturition stimulates lung maturation and is thought to occur throu gh glucocorticoid receptor (GR) dependent effects. Antenatal treatment of women threatening preterm labor with synthetic glucocorticoids has been shown to significantly decrease respiratory distress in preterm infants. We have found that the mineralocortic oid receptor (MR) is abundantly expressed in ovine fetal lungs, as are several genes known to be induced by MR action in the adult kidney, including the epithelial sodium channel alpha s ENaC) and sodium potassium adenosine triphosphatase ( Na,K ATPase ) However, the role of MR activation in fetal lung maturation is not clear. The purpose of this study was to determine if administration of an MR agonist would increase lung str uctural maturation, effect gene and protein expression, and lung compliance in ovine fetuses at 130d gestation. Fetuses were infused with a solution containing the MR specific agonist aldosterone (0.2 mg/48h), the synthetic GR specific agonist betamethason e (0.25 mg or 0.75 mg 48h), or a combined 0.2mg aldosterone and betamethasone solution with both

PAGE 10

10 0.25mg and 0.75mg betamethasone doses. In situ fetal lung compliance was then determined by measurement of intrapulmonary pressure produced by inflation of the lungs by 4 5 10ml stepwise volumes of air injected into the trachea. While there was not an overall aldosterone effect on fetal lung peak pressure measurements, inflation pressure measurements showed a distinct effect of aldosterone to decrease intrapulm onary pressure at the initial inflation volume and again at the majority of subsequent volumes, indicating an apparent initial and transiently sustained increase in ovine fetal lung compliance. There were few significant effects of either dose of betametha sone alone and the lower concentration of betamethasone infusion decreased the effect of aldosterone to increase fetal lung compliance. Combined 0.75 mg dose of betamethasone with aldosterone only transiently improved lung compliance. These results sugges t an effect of aldosterone to increase lung compliance in the preterm ovine lung that involves a mechanism occurring through MR specific factors. Quantitative real time polymerase chain reaction ( PCR ) data suggest that GR agonists increase expression of ENaC and Na,K ATPase, while MR agonists do not. Western blot of and ENaC protein did not indicate a significant change in ENaC abundance in membrane. However, whole cell abundance and relative ratios of these two subunits are greatly affected by co rticosteroid infusion suggesting a complex stoichiometric relationship that is perhaps affecting the efficacy of these channels. Tissue histology confirmed a significant increase in elastin and collagen abundance in GR agonist infused fetuses but not in al dosterone infused fetuses. Perhaps indicating that structural changes in ovine lung extra cellular matrix ( ECM ) proteins are contributing to the observed changes in lung compliance.

PAGE 11

11 CHAPTER 1 INTRODUCTION Fetal Lung Development The human fetal lung beg ins to develop at the third week of gestation and development of the lung continues until early adulthood. The stages of fetal lung development are divided into five separate and distinct phases consisting of: Embryonic, Pseudoglandular, Canalicular, Saccu lar, and Alveolar stages (Joshi and Kotecha, 2007; Kotecha, 2000). The human embryonic stage of development encompasses the first 7 weeks of fetal life and during this time the lung initially develops as an outgrowth from the ventral wall of the fetal fo rgut with concurrent development of the trachea, bronchi, and segmental bronchi (Kotecha, 2000). The human embryonic stage of development is further characterized as the beginning of fetal pulmonary vasculogenesis. Vascular proliferation occurs from an out growth located on the aortic arch, to form the early pulmonary arteries and veins accompanying the developing airways. It is during the human embryonic stage of lung development that the majority of congenital malformations manifest, due to improper pulmon ary structural or vascular development (Joshi and Kotecha, 2007). The ovine fetus was the model of pregnancy utilized in this study and the comparable embryonic gestational age for these fetuses occurs from days 17 40 of development of an approximate 147 d ay period of gestation. During this time the trachea divides into the right and left bronchi and further branching into lobar and segmental bronchi occurs by day 25 of gestation (Bryden et al., 1973) Weeks 7 17 of fetal life mark the period of the pseudoglandular stage of development and it is during this time that further branching of the airways and

PAGE 12

12 vasculature occurs. The pseudoglandular stage is characterized as the fastest stage of airway branching and prolifer ation with approximately 70 % of the total airway present at the time of birth formed by this completion of this stage at 17 weeks gestational age. It is also during this stage that a marked increase in epithelial cell differentiation into primitive type I I pneumocytes occurs, and the beginning of pulmonary cartilage and smooth muscle formation (Joshi and Kotecha, 2007). In the ovine fetus, the psuedoglandular stage of development occurs during days 40 80 of gestation and the epithelium consist of branching tubular system embedded loosely in mesenchyme tissue. The larger central tubules are surrounded by cartilage aggregates and smooth muscle sheaths (Alcorn et al., 1981) The pseudoglandular stage of human fetal lung development is followed by the canalicular stage during weeks 17 27 of gestation. It is during this phase that surfactant production is first observed at 24 weeks gestational age. Further cellular differentiation of epithelial cells into type I and surfact ant producing type II pneumocytes and the formation of a functional alveolar capillary barrier for gas exchange occurs at this time (Joshi and Kotecha, 2007; Kotecha, 2000). The importance of these changes in lung development are evident in preterm fetuses born during this stage in development, with fetal survival often observed in neonates as young as 26 weeks gestational age. However, these fetuses do suffer from surfactant insufficiency and a lack of lung structural maturation does present a predilection for fetal respiratory distress syndrome and development of transient tachypnea of the newborn (Kotecha, 2000) In the ovine fetus, the canalicular stage of development occurs during days 80 120 of gestation and is not subdivided into a following saccular stage of development. During this time the

PAGE 13

13 lung parenchyma consist of a fine network of alveoli and the peripheral airways develop from the primitive tubular structures to greatly increase the potential airspace volume of the lungs. Proliferation of the pulmonary vasculature also increases during this time (Alcorn et al., 1981) Although, while the human lung is producing small amounts of surfactant and is much more structurally m ature in the canalicular stage than in earlier stages of development, it is hypothesized that fetal survival during the canalicular stage is influenced by the chronic fetal stressors that precipitate preterm birth and it is the effect of these stressors th at act to increase the structural maturation and viability of the lung and contribute to the survival of these neonates (Jobe, 2010) The next stage of human fetal lung development is the saccular stage during 28 36 we eks gestational age. During this stage there is significant enlargement of peripheral airways and thinning of the airway walls resulting in subsequent increases in surface area available for gas exchange. Further differentiation of type I cells into type I I cells is observed with concomitant increases in surfactant production. Structural maturation of the lung continues to progress with a reduction of the distance in the air blood interface at areas of gas exchange due to increased proximity of pulmonary ca pillaries and type I cells (Joshi and Kotecha, 2007; Kotecha, 2000) The final stage of fetal lung development is the alveolar stage from 36 weeks gestational age until two years of age. This stage is characterized by formation of secondary septa from the alveoli located in terminal airways. The protruding secondary septa act to bifurcate the air space, creating two distinct and functional alveoli and this process of secondary septa formation and alveo lar bifurcation continues until 2 3 years

PAGE 14

14 of age. At the time of parturition, alveoli can be readily identified and estimates of alveoli number range from 20 50 million with subsequent increases in alveolar number to approx 300 800 million by 2 3 years of age. Afterwards, alveoli proliferation ceases while alveolar size and surface area continue to increase until early adulthood (Joshi and Kotecha, 2007; Kotecha, 2000) In the ovine fetus, the alveolar stage of development occurs from 120 days gestational age and continues after birth. In this stage of development the lung parenchyma consists of a fine network of alveoli and the large bronchi are lined with a developed epithelium. Blood vessels are surr ounded in a thick fibromuscular coat. Alveolar wall thickness decreases and alveolar number increases by bifurcation by secondary septal crests (Alcorn et al., 1981) It is important to note that ovine lungs at term are more advanced than human lungs in terms of relative alveoli formation (Alcorn et al., 1981) However the ovine fetal lung at term is more similar to term human lungs than other species such as rabbit (Kikkawa et al., 1968) mouse (Amy et al., 1977) and rat (Burri et al., 1974) Compared to human and ovine fetuses, all of these species have large sacc ular structures at birth and lack considerable mature alveoli. The ovine lung is therefore a more appropriate analog for human lung development than these other species with the notable exception of non human primates. Collagen, Elastin Fibers and Surfacta nt A brief description of lung biomechanics is essential to understand the factors that contribute to the functional efficacy of the fetal lung. Furthermore, the major elements that comprise lung intrapulmonary structures, namely the extra cellular matrix (ECM) proteins such as elastin fibers, collagen, proteoglycans, and

PAGE 15

15 glycosaminoglycans, can have profound effects on lung function depending on their relative abundance and distribution (Faffe and Zin, 2009; Suki et al., 2005) Collagen and elastin fibers are the major constituents of the lung ECM. Generation and organization of lung elastin begins in the psuedoglandular stage of fetal lung development at sites of lung airway branching and elastin syn thesis increases throughout gestation until peaking during the alveolar stage of development. Elastin is intrinsically associated to the process of alveolarization, forming fibers at areas of stress and concentrated deposits at alveolar junctions. Small el astin fibers form delicate lattice structures connecting newly formed alveoli and act to define boundaries between these developing cells. Elastin fibers further ensure that newly formed septa are continuously interconnected and that the newly forming alve olar cells do not obstruct alveolar ducts. For these reasons, it is thought that normal alveolarization is dependent upon proper elastin fiber formation (Starcher, 2000) While elastin fibers are an important compo nent of the lung extracellular matrix they are also an essential element for the normal stretch and recoiling properties of the lung. Lung tissue is constantly under stress and distension by a positive transpulmonary pressure. The chest wall and diaphragm distend in order for the lung to remain inflated and to increase the transpulmonary pressure to facilitate air movement into the lung and conversely relax to decrease transpulmonary pressure to allow air movement out of the lung. This stress is distributed throughout the lung by the hydrostatic pressure in the pleural space surrounding the lung and is heterogeneously distributed due to the shape of the lung (Suki et al., 2005) This prestress is in turn distributed through out the extra cellular matrix and, in the lung parenchyma, it acts to properly support the distension of

PAGE 16

16 intrapulmonary structures. Under low stress conditions, the highly stretchable nature of elastin provides the majority of the lungs elastic properties. This elastic recoil can be attributed to the tight linear arrangement of elastin fibers, and their increased responsiveness to lower stresses than that of other stiffer components of the extra cellular matrix, such as collagen (Faffe and Zin, 2009) In a study using a rat model of lung growth to determine the relationship of elastin, collagen and their effects on the mechanical properties of the lung, increases in elastin content were found to also increase lung reco il (Nardell and Brody, 1982) Although, other studies have shown that the orientation of ECM proteins, rather than absolute concentration, has a greater effect on lung mechanical properties (Tanaka and Ludwig, 1999) elastin is clearly an important mediator of the recoil properties of the lung. Collagen is by far the most abundant and important ECM protein for lung structural integrity. While over 20 different collagen subtypes have been identified, the majority of lung parenchyma collagen is comprised of only type I and type III collagen. These collagens form in thick networks of fibers and fibrils in random or semiordered orientation, and the thickness of these fibers can vary from several hundred nanometers to over a micrometer. In the lung parenchyma, collagen fiber networks extend down central airways to alveolar ducts and are also present in the lung pleura (Suki et al., 2005) Collagen abu ndance increases throughout gestation in the same fashion as elastin also peaking during the alveolar stage of development (Faffe and Zin, 2009) Studies examining the changes of collagen content during development an d in models of lung fibrosis have shown collagen to affect the biomechanical properties of the lung

PAGE 17

17 (Suki et al., 2005) However, different organs with similar collagen content can have very different biomechanical proper ties. This highlights that both complex interactions between ECM proteins and abundance of these proteins has profound effects on lung function. Another element affecting the biomechanical properties of lung function is pulmonary surfactant. Pulmonary su rfactant is composed of a mixture of phospholipids and proteins secreted by type II alveolar cells and it functions to attenuate recoil pressures and to decrease the surface tension that arises by the difference in attractive forces between molecules that reside on the air alveolus interface. On the surface of alveolus buds, this surface tension resists expansion of these buds and acts to contract the surface area. The phospholipids in surfactant resist this force and are capable of lowering the surface ten sion due to their insolubility with water and their ability to form lipid bilayers. Surfactant is essential to prevent collapse of alveolus buds following exhalation and its importance is evident in fetuses that suffer respiratory distress from inadequate surfactant production. There are four surfactant proteins comprised of surfactant related protein (SP) A, B, C, and D. SP B and C are thought to enhance the absorption of lipids at the air alveolus interface, while SP A and D are thought to play critical r oles in host defense from bacteria, fungal, and viral infection (Nkadi et al., 2009; Suki et al., 2005) The H ypothalamic P ituitary A drenal Axis The hypothalamic pituitary adrenal (HPA) axis plays an essential role in fetal; development, maturation, and response endorphin, noradrenaline and cortisol (Giannakoulopoulos et al., 1999) The actions of the HPA axis are principally controlled through the release of corticotrophin releasing

PAGE 18

18 hormone (CRH) and arginine vasopressin (AVP). These neuropeptides are synthesized in the paraventricular nucleus (PVN) of the hypothalamus and are released in the hypophyseal portal blood system through axons that project down the median eminence to the anterior pituitary (Swanson et al., 1983) CRH then binds to type I CRH receptors in the anterior pituitary and stimulates the release of the proopiomelanocortin (POMC) derivative adrenocorticotropic hormone (ACTH). AVP released into the hypophyseal portal system is also capable of acting at these receptors to facilitate the synthesis and release of ACTH (Mastorakos and Ilias, 2003) In humans, plasma ACTH then binds to receptors at the adrenal glands and acts to increase cholesterol transport into the cell and biosynthesis of cortisol, aldosterone and dehydroepiandrosterone (DHEA) (Conaglen et al., 1984) The secretion of CRH is controlled by normal circadian rhythm as well as a complex glucocorticoid negative feedback mechanism capable of decreasing HPA axis activity at higher limbic brain regions, hypothalamus and anterior pituitary (Kapoor et al., 2006 Mastorakos and Ilias, 2003) Pregnancy and Development of the Fetal HPA Axis In the human fetus, development of the glands of the HPA axis occurs early and rapidly in pregnancy with detectable generati on of steroids between the eight to tenth week of pregnancy (Tegethoff et al., 2009) Species that give birth to less mature offspring such as rodents have a less developed HPA axis, but experience maturity after bir th (Sapolsky and Meaney, 1986) The human fetal HPA axis differs from fully developed adult HPA axis in that the fetal HPA axis undergoes significant structural changes during gestation and is under further regulati on by placental control (Tegethoff et al., 2009)

PAGE 19

19 The human fetal adrenal is unique in that it is comprised of three distinct regions consisting of the fetal, definitive, and transitional zones. The fetal zone is d etectable by the eighth week of primate gestation. It is the primary area of adrenal enlargement and is responsible for the synthesis of DHEA that is then utilized in the production of fetal estrogens, while the definitive and transitional zones produce mi neralocorticoids and glucocorticoids respectively (Kapoor et al., 2006; Mastorakos and Ilias, 2003) The fetal hypothalamus exhibits detectable releases of neuropeptides by the 11.5 week of gestat ion, while the pituitary reaches maturity by the eighth week of gestation (Tegethoff et al., 2009) Similarly to human fetal HPA axis development, the ovine fetus HPA axis develops early and rapidly in pregnancy. The production of CRH by the ovine fetal hypothalamus has been observed as early as day 63 of gestation and by day 90 in isolated PVN and median eminence neurons (Brieu et al., 1988) AVP in the ovine hypothalamus is detec table by gestational day 63 and as early as day 42 in isolated PVN and median eminence neurons with an increase in abundance observed progressively until gestational day 143. However, the ratio of AVP to CRH decreases as the fetus approaches term. Indicati ng that AVP is likely a more potent stimulator of ACTH than CRH in early gestation while CRH becomes the dominate stimulator of ACTH release in late gestation (Brieu et al., 1988) A functional hypophyseal portal system between the ovine hypothalamus and the pituitary is present by gestational day 45 and pituitary ACTH production is observed as early as gestational day 40 (Levidiotis et al., 1987) The ovine adrenal gland is reco gnizable by gestational day 28 (Wintour et al., 1975) and the weight of the adrenal gland increases exponentially in the last 15 20 days of

PAGE 20

20 gestation in two phases of growth. The first phase of adrenal growth occurs by adrenal hypertrophy between 124 136d and the second phase occurs through both hypertrohic and hyperplasic growth from gestational day 130 until birth (Durand et al., 1980) The primary ovine glucocorticoid cortisol secreted by the fetal adrenal is also observed to increase in the final 25 days of gestation with highest concentrations observed during the last 48h before birth (Bassett and Thorburn, 1969; E lsner et al., 1980) Regulation and Action of Cortisol Cortisol is a potent glucocorticoid and exerts great influence on fetal organ development and maturation necessary for extrauterine life by binding with high affinity to either the glucocorticoid rec eptor (GR) or the mineralocorticoid receptor (MR). The activity of a corticosteroid such as cortisol occurs by first binding to either MR or GR located at target organs to form a corticosteroid receptor complex. The corticosteroid receptor complex then dim erizes and translocates to the nucleus where it binds to hormone response elements located on genomic deoxyribonucleic acid ( DNA ) The receptor complex then acts as a transcription factor to upregulate the transcription of messenger ribonucleic acid ( mRNA ) molecules that direct translation of specific proteins necessary for organ development and maturation (Bizzarro and Gross, 2004). Through this mechanism, cortisol regulates cardiovascular, neurobiological, and immunological development and exerts organ sp ecific maturation of the fetal lungs, liver and digestive tract (Tegethoff et al., 2009) Cortisol is elevated in times of stress, but is also increased during pregnancy (Mas torakos and Ilias, 2003) In instances of insufficient cortisol during pregnancy; fetal growth, uterine blood flow, placental morphology and fetal hypoxia may result (Jensen et al., 2005) Conversely, excessive cortiso l during pregnancy has been shown in late

PAGE 21

21 gestation ovine fetuses to produce increased fetal heart mass by increasing hyperplastic cardiomyocyte proliferation (Giraud et al., 2006) Thus, cortisol has profound effect s on fetal development and correct regulation of cortisol is critical to insure proper fetal development and survival in the extrauterine environment. hydroxysteroid dehydrogenase 2. Cortisol is converted to 2 1. In both the adult animals and d 1 2 function to regulate access to MR and GR. In the kidney, high amounts 2 ensure that cortisol is inactive and that abundant MR receptors are available to bind with the MR spe cific agonist aldosterone (Ferrari and Krozowski, 2000) Organs such as the heart that are both GR and MR rich contain only a small 2 mRNA that is present in the kidney, suggesting that cortisol plays a greater regulatory role in these tissues (Reini et al., 2006) The fetal lung 1, suggesting that endogenous cortisol would similarly occupy both recept ors in this organ (Keller Wood et al., 2009) Fetal Cortisol Surge At term, fetal ACTH plasma concentrations increase even in the presence of high circulating glucocorticoid concentrations and this increase is li kely due to changes in glucocorticoid feedback sensitivity (Kapoor et al., 2006; Wood, 1988). This disruption in precedes parturition in order to facilitate rapid ma turation of the lungs, liver, kidneys and brain (Liggins, 1994) In the lung, this increase in plasma cortisol acts to increase

PAGE 22

22 surfactant production, engender structural maturation, and mediate lung fluid metabolism through GR and possibly MR dependent mechanisms (Bizzarro and Gross, 2004; Jobe, 2010) Fetal Respiratory Distress Preterm infants are predisposed to increased risk of lung immaturity and develo pment of respiratory distress (RD) that can manifest in numerous conditions that include: respiratory distress syndrome (RDS), transient tachypnea of the newborn (TTN), meconium aspiration syndrome (MAS), and bacterial infection. TTN is the most common cau se of respiratory distress in term neonates and is implicated in 40% of instances of neonatal RD (Hermansen and Lorah, 2007). The condition is typically benign and occurs when there is an excess of fluid in the lung and presents as neonatal shallow rapid b reathing. RDS is the most common cause of respiratory distress in neonates born prematurely, affecting the majority of fetuses born before 28 weeks gestational age and 1/3 of fetuses born between 28 34 weeks gestational age. RDS is attributed to lung str uctural immaturity and insufficient surfactant production engendering, decreased compliance, increased alveolar surface tension, and areas of atelectasis in the fetal lung (Hermansen and Lorah, 2007). At areas of atelectasis, localized ischemia and ventila tion perfusion mismatch occurs, resulting in vascular constriction at atelectatic areas and shunting of blood by pulmonary and extrapulmonary means. This shunting engenders the circulation of poorly oxygenated mixed venous blood and is evident by subsequen t fetal hypoxia and cyanosis observed in fetuses with RDS (Verma, 1995). While surfactant insufficiency associated with RDS produces a pathological overall decrease in surface area available for gas exchange, preterm lung structural immaturity

PAGE 23

23 further con tributes to the RDS pathology and decreases in surface area available for gas exchange. RDS is a serious life threatening condition that requires immediate supportive therapy and is one of the most common causes of preterm infant mortality (Hermansen and L orah, 2007; Verma, 1995). RD can occur in term and post term infants by evacuation of meconium into the amniotic fluid and subsequent aspiration of this meconium stained amniotic fluid through fetal breathing movements resulting in MAS (Nkadi et al., 2009) MAS is a significant contributor to infant morbidity and mortality and the presence of meconium stained amniotic fluid is indicative of fetal distress. Meconium is a mixture of gastrointestinal secretions and aspiration of meconium obstructs airways, pro duces ventilation perfusion mismatches, inhibits pulmonary surfactant, and elevates proinflammatory cytokines (Donn and Dalton, 2009). While meconium is generally sterile, it does serve as an effective medium for bacterial growth in the extrauterine enviro nment. Bacterial infection secondary to MAS or otherwise is another significant contributor to neonatal RD. Unlike other causes of RD, bacterial infection takes hours to days to develop in neonates and presents with elevated temperature in addition to the symptoms of respiratory distress (Hermansen and Lorah, 2007). Synthetic Glucocorticoids and the Attenuation of Respiratory Distress The original pioneering work of Dr. Graham Liggins, conducted in 1969, demonstrated that antenatal administration of synthe tic glucocorticoids in ovine fetuses increased lung viability and decreased neonatal morbidity and mortality by accelerating the induction of surfactant production (Liggins, 1969). Glucocorticoid acceleration of fetal lung surfactant production was later c onfirmed in studies utilizing twin ovine fetuses in which one fetus served as a saline infused control while the other fetus received an

PAGE 24

24 infusion of betamethasone (DeLemos et al., 1970). The results of the first control trial examining the role of syntheti c glucocorticoids, for the attenuation of fetal RD in human subjects, were published in 1972. This study showed that the antenatal administration of the synthetic glucocorticoid betamethasone to pregnant women in danger of delivering prematurely decreased the incidence of fetal RD from 25.8 % in control subject to 9.0 % in subjects treated with synthetic glucocorticoids (Liggins and Howie, 1972). In the decades following these pivotal studies, the use of synthetic glucocorticoids and surfactant replacement therapy has become common practice by obstetricians and neonatologists for the prevention and treatment of fetal RD (Hermansen and Lorah, 2007). Synthetic glucocorticoids such as dexamethasone differ from endogenous glucocorticoids in that they have appro x 25 times higher affinity for GR than that of endogenous cortisol and very low affinity for MR, while cortisol retains affinity for both MR and GR (Rupprecht et al., 1993) Synthetic glucocorticoids and endogenous glucocorticoids further differ in their duration of biological activity, with betamethasone and dexamethasone having long acting characteristics between 36 to 54h duration and cortisol with relatively shot biological activity of 8 to 12h (Melby, 1977). Bot h endogenous and synthetic glucocorticoids are able to cross from the maternal circulation to the fetus via the placenta (Moss et al., 2003), but differ in that cortisol is 2 into inactive cortisone, while synthetic 2 (Kapoor et al., 2006). Thus, synthetic glucocorticoids readily cross the placenta, are biological active and capable of exerting profound influence at GR rich fetal organs. While the importance of

PAGE 25

25 en dogenous and synthetic glucocorticoids to accelerate lung structural maturation and surfactant production clearly affects the biomechanical properties of the lung, the ability of glucocorticoids to accelerate lung fluid reabsorption shortly before birth al so exerts profound influence on fetal lung function. Fetal Lung Fluid Secretion Throughout the majority of gestation, the fetal lung is a secretory organ producing lung liquid in a mechanism dependent upon the action of epithelial chloride channels secre ting Cl ions against their electrochemical gradient by active transport with a passive secretion of Na + ions and interstitial fluid along this gradient into the intrapulmonary space (Olver and Strang, 1974) While mi xing of lung liquid with amniotic fluid occurs during fetal breathing movements, the majority of lung liquid is contained inside the lungs by the closure of the vocal cords, larynx, and nasopharynx creating a positive intrapulmonary pressure (Fewell and Johnson, 1983) Maintenance of this positive pressure is necessary to prevent the collapse of developing lung structures and for normal lung development to occur. Hypoplastic lung growth occurs in instances of oligohydr amnios, when amniotic fluid and lung liquid is depleted (Moessinger et al., 1986) Conversely, laryngeal atresia produces excessive lung liquid retention that results in an increased intrapulmonary pressure and hy perplastic lung growth (Wigglesworth et al., 1987) This effect was demonstrated using ovine fetuses in which one lung lobe was drained of lung liquid while the other lobe was ligated in order to increase lung l iquid volume. The ligated lobe experienced hyperplastic growth while the drained lobe experienced hypoplastic growth (Moessinger et al., 1990) Thus demonstrating that proper balance of lung liquid throughout gest ation is essential for normal lung development.

PAGE 26

26 Fetal Lung Fluid Reabsorption While lung liquid production and volume increases throughout the majority of gestation, shortly before birth, lung liquid production rapidly decreases with concomitant increases in lung liquid reabsorption and pulmonary perfusion to facilitate the transition of the fetal lung to effectively participate in gas exchange in the extrauterine environment (Bland, 1983; Kitterman et al., 1979; Pfister et al., 2001) The reabsorption of lung liquid is evident in studies involving newborn rabbits that have shown significant decreases in lung weight during the first two hours following parturition with furthe r decreases throughout the first day of extrauterine life (Bland et al., 1980) In ovine fetuses, lung liquid production has also been shown to decrease in the days preceding term vaginal birth (Fewell and Johnson, 198 3; Kitterman et al., 1979). However, rabbit fetuses born prematurely by cesarean birth before the onset of labor have excessive lung liquid, thus emphasizing the importance of the periparturient absorption of lung liquid and the beneficial effects of labor (Bland et al., 1979) E pithelial Sodium Channel (ENaC) Sodium Potassium Adenosine Triphosphatase (Na, K ATPase) Serum Glucocorticoid Regulated Kinase (SGK) and Regulation by Glucocorticoids The mechanism by which lu ng liquid is reabsorbed at birth is complex and its regulation is not fully understood, however it is known that glucocorticoids (synthetic or endogenous) effect fluid reabsorption by acting at GR in the fetal lung to increase transcription of the amilorid e sensitive epithelial sodium channel (ENaC) (Itani et al., 2002; Venkatesh and Katzberg, 1997) In the lung, ENaC channels are abundantly present on type I and type II pneumocytes that compose the lung alveolar epithelium and function to actively transport Na + ions across the epithelium into the lung interstitial space. Transport of Na + ions through ENaC channels is facilitated by a favorable

PAGE 27

27 electrochemical gradient generated by the activity o f sodium potassium adenosine triphosphatase ( Na,K ATPase ) pumps located on the basolateral surface of lung pneumocytes that pump intracellular Na + into the interstitial space at the expense of adenosine triphosphate (ATP) (Matalon, 1991) The active transport of Na + ion across the alveolar epithelium then precipitates a secondary active transport of an osmotic equivalent amount of Cl ions through cystic fibrosis transmembrane regulator (CFTR) and Cl channels located o n the epithelial apical surface. Water then follows the osmotic gradient generated by the primary active transport of Na + ions and secondary active transport of osmoticly equivalent Cl ions across the apical surface and exits the epithelium into the inte rstitum passively through aquaporins and transcellular pathways (Eaton et al., 2009) The pathway and mechanism of fluid reabsorption in the lung epithelium is illustrated in figure 1 1. The maintenance of the electro chemical gradient between the apical and basolateral membrane, and consequently the balance of fluid secretion and reabsorption, is dependent on the presence of tight junctions between type I and type II pneumocytes acting as a barrier to passive flux of i ons and water. The importance of tight junction resistance to passive secretion of ions and fluid is evident in pathologies that increase pulmonary blood pressure or cause inflammation that affects the permeability of these junctions. The resultant increas e in junction permeability increases passive secretion of fluid through these junctions and pulmonary edema occurs (Koval et al., 2010) The presence of ENaC in the human lung has been detected as early as the embryonic stage of development on alveolar bud epithelium and is later dispersed

PAGE 28

28 throughout the lung in late gestation (Smith et al., 2000) Studies utilizing cultured human fetal lung found glucocorticoids act to increase mRN ENaC subunits by 2 3 fold and RNA polymerase II inhibitors attenuate this increase in ENaC mRNA expression (Venkatesh and Katzberg, 1997) While ENaC are three subunit domain protein ch annels, the alpha subunit is critical for adequate fluid clearance following parturition. Inactivation of the a ENaC gene in mice has been shown to result in the development of RD and death within 40h following parturition from an inability to clear the lu ngs of fluid (Hummler et al., 1996) ENaC was shown to be diminished by real time polymerase chain reaction (PCR) ENaC protein was not detectable by western expression in these animals. Measurements of lung liquid clearance showed a 32% relationship of the three subunits greatly affects the efficacy of ENaC channels (Randrianarison et al., 2008) The activity of E NaC is further regulated by serum glucocorticoid regulated kinase (SGK) and the expression of SGK is principally regulated by MR and GR agonists. In vitro data utilizing bronchiolar epithelial and alveolar type II cells confirmed that exposure of these cel ls to corticosteroids increases expression of SGK mRNA (Itani et al., 2002) ENaC membrane proteins are subject to ubiquitylation by the ubiquitin protein ligases Nedd4 1 and Nedd4 2. Nedd4 attachment of ubiquitin poly peptides

PAGE 29

29 inactivates ENaC protein by signaling intracellular pathways to internalize the protein from the plasma membrane and to then target ENaC for destruction. SGK increases ENaC activity and inhibits the activity of Nedd4 ubiquitin protein ligases by p hosphorylating Nedd4 which attenuates the ability of Nedd4 to ubiquitinate ENaC (Snyder et al., 2002) ENaC Activity in the Kidney and the Role of Aldosterone Renal regulation of sodium reabsorption and excretion is critically important for the maintenance of blood pressure and extracellular volume homeostasis. Sodium reabsorption in the kidney is thought to occur by a mechanism similar to that of fetal lung liquid reabsorption and is likewise dependent upon the actio n of apical ENaC channels, basolateral Na,K ATPase and SGK (Fuller and Young, 2005) The importance of ENaC in renal sodium regulation for proper volume homeostasis is evident in conditions of ENaC loss of function m utations (pseudohypoaldosteronism) excessive salt reabsorption and severe hypertension (Rossier and Stutts, 2009) While sodiu m is reabsorbed in multiple locations throughout the nephron, the principal area of the nephron that dictates the ultimate sodium concentration of urine is comprised of: the distal convoluted tubule, connecting tubule, and collecting duct. Together these s tructures are considered the aldosterone sensitive distal nephron (ASDN) and account for less than 10% of total filtered sodium reabsorption (Loffing et al., 2001) In the 2 that acts to attenuate the activity of glucocorticoids such as cortisol that bind with high affinity to MR and GR. By inactivating endogenous cortisol to cortisone, kidney sodium reabsorption is principally regulated by the MR agonist aldosterone binding t o MR and subsequently acting at hormone

PAGE 30

30 response elements to increase the transcription of ENaC, Na,K ATPase, and SGK (Fuller and Young, 2005) Prospective Study Rationale While the importance of MR action in regulat ing sodium reabsorption and extracellular fluid homeostasis is evident in the kidney, MR may be equally important in mediating lung fluid reabsorption at birth (Fuller and Young, 2005) A study utilizing ex vivo whol e lung preparations from near term guinea pigs found that low concentrations of the MR agonist aldosterone induced fetal lung liquid reabsorption. This effect was attenuated in the presence of the MR antagonist spironolactone, and spironolactone alone did not affect lung liquid production (Kindler et al., 1993) Aldosterone has been shown to mediate renal sodium reabsorption and extracellular volume homeostasis by increasing expression of ENaC, Na,K ATPase, and SGK i n an MR dependent mechanism (Loffing et al., 2001) When one considers the aldosterone mediated attenuation of lung fluid production, it is not unreasonable to hypothesize that stimulation of fetal lung MR, by MR agon ists such as cortisol and/or aldosterone, could also induce a similar mechanism of sodium and fluid reabsorption in the fetal lung as that observed in the kidney. The maturational benefits of the preparturient cortisol surge are evident in term fetuses de livered by vaginal birth that exhibit greater lung maturation, surfactant production and lowered risk of developing RD compared to fetuses delivered pre maturely and/or by cesarean section (Bizzar ro and Gross, 2004; Bland et al., 1979) Endogenous cortisol possessing high affinity for both MR and GR would likely act at both receptors in target organs such as the fetal lung and exert a maturational influence that is both MR and GR mediated. Howeve r the general paradigm and clinical approach

PAGE 31

31 of antenatal corticosteroid therapy involves the administration of synthetic glucocorticoids with specificity for only GR, under the assumption that the lung maturational influence of corticosteroids occurs thro ugh primarily GR mediated pathways (Gibbs, 2009; Itani et al., 2002) A study of ontogenetic gene expression in ovine fetuses conducted by Keller Wood et al, has shown by quantitative real time PCR tha t expression of lung MR and Na,K ATPase mRNA increases significantly at 130d gestation, followed by a significant 1, and SGK at 145d mRNA. Western blot analysis of membrane enriched lung protein extracts from these fetuses also s howed an increase ENaC and Na,K ATPase protein at 130 days and an increase in whole cell protein SGK at 120d that is sustained for the remained of gestation (Keller Wood et al., 2009) These data indicate bo th a marked transcriptional and translational increase in the cellular machinery necessary for fluid reabsorption that preceded parturition, with 1, implying that endogenous cortisol would retain its activity and exer t influence at lung MR to regulate lung fluid homeostasis. It is accepted that synthetic glucocorticoids have potent and long lasting biological activity, and nearly 40 years of empirical evidence supports the assertion that antenatal administration of s ynthetic glucocorticoids reduces fetal RD, stimulates lung maturation and increases preterm fetal viability (Gibbs, 2009; Helve et al., 2009; It ani et al., 2002; Jobe, 2010; Liggins and Howie, 1972 Liggins, 2000) However, data exist that indicates a possible MR mediated mechanism of fetal lung maturation that has not been adequately investigated (Kindler et al., 1993) Furthermore, it is possible that combined antenatal administration of MR and synthetic GR agonists will manifest a synergistic

PAGE 32

32 benefit as a consequence of these two agonists acting as a biological mim etic of endogenous cortisol without the deleterious inactivation of antenatally administered cortisol by placental 11 HSD 2. The objectives of this thesis were to determine if antenatal administration of MR, GR and combined MR/GR agonists to 130day ovine fetuses will increase the mRNA expression of genes and the abundance of proteins involved in the absorption of lung liquid, determine if MR agonists induce lung structural maturation, and ascertain if MR agonists improve lung compliance. In order to answe r the specific aims of this thesis the following techniques were utilized; in vivo chronic catheterization of fetal sheep, in situ lung pressure measurements, tissue histology, radioimmunoassay (RIA), quantitative real time PCR and western blotting. Speci fic Aims Specific Aim 1: Using chronically catheterized 130d gestational age ovine fetuses, determine the effect of 48h antenatal administration of aldosterone, betamethasone, and aldosterone combined with betamethasone on ovine fetal lung compliance by in situ lung pressure measurements. Specific Aim 2: To determine by quantitative real time PCR the effect of 48h corticosteroid infusion on mRNA expression of genes important in lung function, lung liquid reabsorption and lung structural maturation. Specif ic Aim 3: To determine by Western blotting the effect of 48h corticosteroid infusion on abundance and location of ENaC and ENaC proteins using both membrane enriched and whole cell protein extracts of lung tissues. Specific Aim 4: To use tissue histo logical staining methods to determine the effect of 48h corticosteroid infusion on elastin and collagen fiber abundance in lung parenchyma.

PAGE 33

33 Figure 1 1. Proposed mechanism of lung fluid reabsorption across fetal lung epithelium

PAGE 34

34 CHAPTER 2 EXPERIMENTAL MET HODS Surgical Procedures As this study involved studying fetal lung development in utero, an analogous animal model of human fetal lungs was necessary. Ovine fetal lungs are more analogous to human fetal lungs than other animal species such as rabbit (Kikkawa et al., 1968) mouse (Amy et al., 1977) and rat (Burri et al., 1974) Compared to human and ovine fetuses, all of these species have lar ge saccular structures at birth and lack considerable mature alveoli. The ovine lung is therefore a more appropriate analog for human lung development than these other species with the notable exception of non human primates. All animal use was approved by the University of Florida Institutional Animal Care and Use Committee and conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Isoflurane (2 3%) in oxygen was used to anesthetize ewes before and during surgery. then removed from inside the uterus and tibial artery and vein catheters were inserted. A cathe ter was then sutured to the leg for measurement of amniotic fluid and this catheter was placed inside the uterus along with the fetus at the end of the procedure. When twin fetuses were present the procedure was repeated in the twin. The uterus was then cl osed with umbrication of the myometrium with silk suture (Ethicon, Somerville NJ) and the fetal catheters were routed subcutaneously along the abdomen and out of an exit site in the ewes flank. After closure of the uterus and abdominal incision, catheters were placed in the maternal femoral artery and vein and exited along

PAGE 35

35 with the fetal catheters through the maternal flank. The catheters were secured in a were treated with Banamine (1 mg/kg IM; Fort Dodge Animal Health, Fort Dodge, IA) before recovery from anesthesia. The ewe was then returned to her individual pen and provided water, and salt blocks ad libitum. Ruminant pellet food was weighed to 2.5kg and placed in the pen with the ewe after the animal had completely recovered. Polyflex (500mg SC bid; Fort DodgeAnimal Health, Fort Dodge, IA) was administered for 3 days postoperatively. Banamine 1 mg/kg IM was again administered on the morning after surgery. Daily food intak e was monitored on each postoperative day. Experiment Procedures Fetuses from 17 twin and 5 singleton pregnancies were catheterized at 122 124 days gestational age. After at least five days of recovery after surgery, (127 131 days gestation) fetal and ma ternal blood samples (approx 7 ml) were withdrawn for determination of blood gases, hematocrit, electrolytes, and plasma hormones (aldosterone and cortisol) concentrations. All blood samples were taken immediately after entering the room in which the ewes were housed in order to minimize the effect of handling on plasma adrenocorticotropic hormone ( ACTH ) and cortisol concentrations. A fetal vein catheter was subsequently used to deliver an infusion of steroid to the fetus over the following 48h. Infusions w ere delivered using a syringe pump at a rate of 1.45 ml/h. Fetuses in the five experimental groups were infused with a solution containing the mineralocorticoid receptor (MR) specific agonist aldosterone (0.2 mg/48h; n=5), the synthetic glucocorticoid rece ptor (GR) specific agonist betamethasone (0.25 mg or 0.75 mg 48h; n=4, n=4 respectively), or a combined 0.2mg aldosterone and betamethasone solution with both 0.25mg and 0.75mg betamethasone doses (n=4, n= 5 respectively).

PAGE 36

36 The higher betamethasone dose con sisted of a 0.25mg initial bolus of betamethasone followed by infusion of betamethasone 0.48 mg/48h (total dose 0.75 mg/48h; n=4). Control experiments were performed in twin pregnancies, one fetus received corticosteroids while the untreated fetuses served as controls (n=9 after exclusion of any hypoxic twins). The doses of steroids were chosen to simulate physiologic increases in corticosteroids based on relative efficacy of the agonists at MR and GR and the clearance of these agonists. Calculations of fet al GR occupancy after betamethasone infusion that considered fetal weight, betamethasone clearance rate, percent bound synthetic glucocorticoid and infusion rate, determined that 100% of GR would be expected to be activated by both 0.25mg and 0.75mg doses of betamethasone (Richards et al., 2003). Calculations of fetal MR occupancy found that approx 85% of MR receptors would be expected to be occupied by aldosterone alone, however it is likely that all MR receptors were occupied in these fetuses as endogenou s cortisol will also occupy MR as well (Richards et al., 2003; Zipser et al., 1980). After 48hours of infusion, fetal and maternal blood samples were collected (7ml) and analyzed for blood gases, hematocrit, electrolytes, and plasma hormones (aldosterone and cortisol) concentrations. Fetal blood pressure(s) and heart rate(s) were recorded over a 40 minute interval using LabView software (National Instruments, Austin, TX) and disposable pressure transducers (Transpac; Hospira, Lake Forest, IL). Amniotic flu id pressures were subtracted from fetal arterial pressures in order to normalize fetal arterial pressure. Following the blood pressure recording, fetal blood samples were collected again (7ml) and analyzed as before.

PAGE 37

37 The ewe and fetus was killed with an ov erdose of pentobarbital (Euthasol solution, (Virbac AH, Fort Worth, TX). Immediately after euthanizing the ewe, the fetus(es) were removed from the uterus and the sex of the fetus was recorded as well as fetal weight. The fetus was then placed on a sterile pad and the chest was exposed to air. An incision was made in the upper fetal trachea and a 4mm endotracheal tube with an inflatable cuff was then inserted into the trachea and the cuff was inflated. The upper lobe of the right lung was then ligated and t he endotracheal tube was connected via a three way stop cock to both a 60 ml syringe and to a pressure transducer (Transpac; Hospira, Lake Forest, IL). Pressure measurements from the transducer were recorded in real time using LabView software (National In struments, Austin, TX). With the chest wall open, lung compliance was then determined by measuring the airway pressure responses to injections of five 10ml boluses of air into the trachea for a total of 50ml of air infused into the lung. The lung was then allowed to equilibrate to room pressure after opening the three way stopcock to air and then a second series of inflations were performed. After pressure data recording was complete and the endotracheal tube was removed, individual samples of lung tissue f rom the right lobe were collected and flash frozen in liquid nitrogen for messenger ribonucleic acid ( mRNA ) and protein extractions. These samples where then transferred to a 80 C freezer for long term storage. A sample of right lobe lung tissue was also collected and fixed in a 4% buffered paraformaldehyde solution for histology. The entire left lobe was collected, weighted to baking to determine lung percent wet weight.

PAGE 38

38 Experiment Analysis Fetal blood gases and pH were measured with a blood gas/ electrolyte analyzer (ABL77;Radiometer America, Westlake, OH). Maternal and fetal plasma electrolytes (sodium and potassium) were measured using an electrolyte analyzer (Roche 9180, Basel, Switzerland). For measurement of packed cell volume (PCV), blood wa s spun in microcapillary tubes for 3 minutes at 12,000 rpm (Damon Division, International Equipment, Needham Heights, MA). Plasma protein was determined using a refractometer. Fetal plasma cortisol (EA 65, Oxford Biomedical, Oxford, MI) and aldosterone (TK AL2, Siemens, Deerfield, IL) concentrations were measured using commercially available enzyme immunoassay and radio immunoassay kits respectively. Electrolyte, PCV, plasma protein, plasma cortisol, plasma aldosterone, and lung percent wet weight data were analyzed for difference s among treatment groups by two way analysis of variance (ANOVA) using Sigma Stat software (Systat Software Inc, Chicago, IL) The pulmonary airway pressure data was analyzed by determining peak pressures for each inflation volume and analyzing the relaxation curve following each volume peak pressure. The relaxation curve data was fit to a 3 parameter exponential decay regression curve: y= y0 + ae bx, and the value of the parameter y0, representing the steady state pressure in the rel axation phase after each inflation was determined. Differences among treatment group for both peak pressure and y0 were analyzed by 2 and 3 way (ANOVA) corrected for repeated measures using Sigma Stat and SPSS software (SPSS Inc, Chicago, IL). Western Blo tting Immunoblot detection with antibodies to (ENaC) Actin proteins were performed on whole cell and membrane protein

PAGE 39

39 fractions isolated from fetal lung samples. Tissue samples (0.5 1.0 g) were pulverized over dr y ice, and placed in a cold Potter Elvehjem tissue grinder with 2 volumes of ice cold sucrose buffer (1 mM ethylenediaminetetraacetic acid disodium salt, 0.32 M sucrose, 1 mM ( N [2 hydroxyethyl]piperazine N [2 ethanesulfonic acid]), pH 7.4, 1: 100 prote ase inhibitor cocktail, Sigma P8340) and homogenized with three up and down strokes. The slurry was spun at 500g, at 4 C for 5 minutes. 300l of the supernatant was mixed with 300l of 2X lysis buffer (4% sodium dodecyl sulfate, 20% glycerol, 125 mM (Tri s[hydroxymethyl] aminomethane) pH 6.8, 5% 2 mercaptoethanol) and boiled for 5 minutes. The tubes were spun at 11,300 g for 5 minutes at room temperature. The supernatant was then aliquoted and frozen at 80C for analysis of whole cell protein contents. Th e remaining supernatant from the 500g spin was spun at 5,000g for 5 minutes at 4C. The supernatant was collected and spun at 45,000g for 20 minutes at 4C. The pellet was reconstituted with an equal volume of 2X lysis buffer. The samples were placed in a warm water bath for 10 minutes, aliquoted and stored at 80C for analysis of membrane protein contents. Protein concentrations for whole cell and membrane extracts utilized in actin were determined by protein assay using Biorad DC protein assay, (Bio Rad, Hercules, Calif., USA) with bovine serum albumin (BSA) as the s tandard. The samples were diluted 1:100 to reduce interference from lysis buffer components and the standards were run with the same lysis buffer concentrations as the samples. All samples were run on an 18 well 7.5% Tris polyacrylamide gels at 150 V fo r approximately for 1 hour. Lanes containing molecular weight standards (Bio Rad Dual

PAGE 40

40 Color Standard) were also included on each gel. Sample sets required four gels and were run with a subset of samples from all treatment groups on each gel, and then trans ferred and developed at the same time. All gels were transferred at 100 V for 1 hour to 0.45 m nitrocellulose membranes. All blots were blocked with a 10% non fat dairy milk in Tris buffered saline Tween 20 solution and exposed to appropriate primary ant subunit of ENaC (Abcam, Cambridge, Mass., USA; 3464; 1: 100 in San Antonio, TX, ENaCb21 actin (Sigma, St. Loui s,Mo., USA; A 5441; 1: 20,000 in blocking solution with 1% BSA for1 h). A goat anti rabbit horseradish peroxidase conjugated secondary antibody (Sigma A0545; 1: ENaC immunoblots. A rabbit anti mouse horseradish peroxidase actin immunoblots (Sigma, A9044; 1: 16,000). Immunoreactive proteins were visualized with e lectrochemiluminescence ( ECL ) detection reagents (GE Healthcare, Piscataway, N.J., USA) and developed with Kodak BioMax XAR film. Western Blotting Analysis The blots were analyzed with a Bio Rad Chemi Doc system and Quantity One software. The results of the densitometr ic analysis were then expressed as relative actin or to total protein determined by Ponseau S staining (0.1% Ponseau S in 5% acetic acid solution) of the nitrocellulose membrane. The changes between treatment groups in abundance of the protein of interest were analyzed by two way ANOVA of normalized optical density values.

PAGE 41

41 Messenger Ribonucleic Acid (mRNA) E xtraction and Quantitative Real Time P olymerase Chain Reaction (PCR) Total ribonucleic acid ( RNA ) was extracted from lung t issue samples prepared over dry ice. Samples were homogenized in Trizol (Invitrogen, Carlsbad, CA) with an Ultra Turrax T25 tissue homogenizer (IKA Works, Inc., Wilmington, NC). Total RNA was then purified using Qiagen RNeasy Plus Mini Kit genomic deoxyrib onucleic acid (gDNA) eliminator spin columns according to manufactures instructions. Correct usage of these kits has been demonstrated in our lab to yield high quality RNA. RNA was checked for genomic DNA contamination by real time PCR using RNA extracted from lung tissues as a template in place of complementary deoxyribonucleic acid ( cDNA ) with probes and primers for GR (which produces a product within exon 2). No detectable GR amplification occurred after 40 cycles, while GR was detected in cDNA made from these RNA extracts at approx 30 cycles. Total RNA concentration was determined for each sample, as well as the (A260/A280) RNA/DNA to protein ratio using a Nanodrop spectrophotometer (Wilmington, DE) to assess the quantity and quality of RNA. RNA was then reverse transcribed into cDNA using a high capacity cDNA archive kit (Applied Biosystems, Carlsbad, CA) according to the manufactures instructions. cDNA was then aliquoted and dilutions were made for use in quantitative real time PCR reactions. Gene expre ssion was then measured using quantitative real time PCR for each sample in actin), serum glucocorticoid regulated ENaC), sodium potassium adenosine triphosphatas e (Na, K ATPase receptor (GR), aquaporin 5 (AQP5), aquaporin 1 (AQP 1), surfactant related protein a (SP A ), and surfactant related protein b (SP B ).

PAGE 42

42 Previously published sequences of ovine probes and p rimers were used for MR, ENaC (Keller Wood et al., 2005), Na,K ATPase Actin (Keller Wood et al., 2009), AQP1 and AQP5 (Jesse et al., 2009). Primer Express 2.0 (Applied Biosystems, Carlsbad, CA) software was used to design probes and prime rs for SP A and SP B based on ovine sequences in the National Center for Biotechnology Information ( NCBI ) database. For SP A probe and primer design, the ovis aries pulmonary surfactant associated protein a sequence was used (accession number NM_001009728) The amplified sequence corresponds to (base pairs 62 136). For SP B probe and primer design, the ovis aries pulmonary surfactant protein b sequence was used (accession number AF211857). The amplified sequence corresponds to (base pairs 445 514) and prime r specificity was determined by BLAST analysis. Quantitative Real Time PCR Analysis All q uantitative real time PCR reactions were preformed in an ABI PRISM 7000 sequence Detection System (Applied Biosystems, Carlsbad, CA). Reactions were carried out with either 20 or 100ng of cDNA template; and all gene cycle threshold (Ct) calculating the difference between the mean sample Ct for the gene of interest and the Actin for the same gene. Template cDNA conc and reaction efficiency was checked for SP A and SP B using pooled lung cDNA from control animals. The changes in gene expression between treatment groups were analyzed by two way ANOVA of the f interest. Collagen Staining To determine the localization and deposition of Collagen, fetal sheep lung tissues from the corticosteroid infusion study fetuses were collected and fixed in a 4% buffered

PAGE 43

43 paraformaldehyde solution. The tissues were dehydrat ed with increasing concentrations were cut by a Zeiss rotary microtome and placed onto tissue slides. Deparaffinization and rehydration was performed using standard methods. Sections from each fetal lung sample were stained with picrosirius red solution, 0.1% in saturated picric acid (Sigma, St. Louis,Mo., USA). Sections were hydrated and immersed in picrosirius red solution for one hour. The sections were then washed in two c hanges of acidified water (0.5% glacial acetic acid), dehydrated in three changes of 100% ethanol for three minutes each, cleared in two changes of xylene for ten minutes each, and mounted in permount. Collagen Staining Analysis All images were visualized using an Olympus DP71 microscope and Olympus software. Images of ten random fields of lung parenchyma were taken from each lung sample while avoiding blood vessels which stain heavily for collagen. The picrosirius red staining was then quantified using Im age J software (NIH, Bethesda, MD). The percent area of collagen staining was calculated for each field and the average value of all ten measurements was determined. The changes in collagen content between treatment groups were analyzed by two way ANOVA of the averaged percent area value for each sample. Elastin Staining To determine the localization and deposition of elastin, fetal sheep lung tissues from the corticosteroid infusion study fetuses were collected and fixed in a 4% buffered paraformaldehyde solution. The tissues were dehydrated with increasing concentrations of reagent alcohol followed by xylene, and embedded in par were cut by a Zeiss rotary microtome and placed onto tissue slides. Deparaffinization

PAGE 44

44 and rehydration was performed using standard methods. Sections from each fetus were which selectively stains elastin content. Sections were hydrated and immersed in 0.5% acidified potassium permanganate (Sigma, St. Louis,Mo., USA) for two minutes, rinsed in water, bleached in 1% Oxalic acid for 1 minute, washed in water, washed in 95% et hanol and then placed in Miller Solution for 1 hour. Samples were then washed in 95% ethanol and counterstained in 0.25% Tartrazine (Sigma, St. Louis,Mo., USA) in saturated picric acid solution for 1 minute. The sections were then washed in two changes of 100% ethanol, cleared in two changes of xylene, and mounted in permount. Elastin Staining Analysis All images were visualized using an Olympus DP71 microscope and Olympus software. Images of ten random fields of lung parenchyma were taken from each lung s ample while avoiding blood vessels which stain heavily for elastin. Elastin staining was then quantified using Image J software (NIH, Bethesda, MD). The percent area of elastin staining was calculated for each field and the average value of all ten measure ments was determined. The changes in elastin content between treatment groups were analyzed by two way ANOVA of the mean percent area values for each sample.

PAGE 45

45 CHAPTER 3 RESULTS Fetal Lung Inflation Curves Pressure curves indicative of the intrap ulmonary dynamic compliance of mean peak pressure and standard error measurement at each inflation volume of corticosteroid infused fetuses and control fetuses are shown in figure 3 1. In the first inflation series, 0.2mg aldosterone treatment for 48h prod uced significantly lower initial mean pressure at 10ml than control fetus mean pressure at 10ml. This decreased mean pressure in aldosterone infused fetuses was again significant at 30, 40 and 50ml inflation volumes compared to control fetuses. This decrea sed pressure was not observed in fetuses infused for 48h with 0.25mg betamethasone (beta) 0.75mg betamethasone or 0.2mg aldosterone combined with 0.25mg betamethasone. Analysis of changes in mean pressure measurements after each volume of air infused into 0.2mg aldosterone infused fetuses showed that a significant increase in pressure occurred between 10ml and 20ml, but significant increases in pressure did not occur after 20ml. Analysis of changes in mean pressure after each successive increase in volume for control fetuses and fetuses infused with either 0.75mg beta or combined aldosterone with 0.25mg beta showed significant increases in pressure after each successive increase in volume. Fetuses infused with aldosterone and 0.75mg beta along with fetuses infused with 0.25mg beta had transient decreases in pressure at 50 and 40ml inflation volumes respectively. Treatment with combined aldosterone and 0.25mg beta did not result in the prevention of increases in pressure with increases in volume as was observ ed in fetuses infused with only aldosterone for 48h. In addition, aldosterone

PAGE 46

46 infused fetuses also had significantly decreased mean pressures at 30, 40 and 50ml volumes when compared to fetuses infused with both aldosterone and 0.25mg beta. In the second inflation series in figure 3 1, 0.2mg aldosterone infused fetuses had lower initial mean pressures at 10ml volume than control fetuses at 10ml. No statistical difference in mean pressure was observed during the remaining inflations between aldosterone infu sed fetuses and control fetuses. However, a dose dependent effect between infusion of combined 0.25mg beta with aldosterone and 0.75mg beta with aldosterone was observed at the 20ml inflation volume. At this volume, fetuses infused with aldosterone combine d with 0.75mg beta had significantly lower pressures than that of fetuses infused with aldosterone combined with 0.25mg beta. Inflation Curve Plateau Pressure Data Pressure curves indicative of intrapulmonary static compliance of mean plateau relaxation pressures and standard error measurements after each inflation volume of corticosteroid infused fetuses and control group fetuses from both inflation series are shown in figure 3 2. In the first inflation series, 0.2mg aldosterone treatment for 48h produce d significantly lower initial mean plateau relaxation pressure at 10ml as compared to control fetus mean plateau relaxation pressure at 10ml. This decreased mean plateau relaxation pressure in aldosterone infused fetuses was again significant at 30 and 40m l inflation volumes compared to control fetuses. Infusion of 0.75mg beta also produced a lower initial inflation relaxation plateau pressure compared to 10ml control fetuses. This decreased plateau relaxation pressure at 10ml volume was not observed in any other groups of corticosteroid infused fetuses Analysis of mean pressure measurements after each volume of air infused into 0.2mg aldosterone infused fetuses showed that a significant increase in pressure occurred between 10ml and

PAGE 47

47 20ml, but there was no s ignificant increase in pressure between 20 and 30ml volume. Fetuses infused with 0.25mg beta did not exhibit any significant increase in plateau relaxation pressure after the 20ml inflation volume. Analysis of changes in mean plateau relaxation pressure af ter each successive increase in volume for control fetuses and fetuses infused with either 0.75mg beta, combined aldosterone with 0.25mg beta or combined aldosterone with 0.75mg beta showed significant increases in pressure after each successive increase i n volume. In the second inflation series, no changes in initial plateau relaxation pressure occurred in any corticosteroid infused fetuses compared to control fetuses at 10ml. However, Analysis of mean plateau relaxation pressure measurements after each v olume of air infused into 0.2mg aldosterone infused fetuses showed no significant increase in pressure after the initial 10ml volume. A significant decrease in plateau relaxation pressure occurred at both the 30 and 40 ml inflation volumes in aldosterone i nfused fetuses. Similarly, no increase in plateau relaxation pressure was observed in fetuses infused with 0.75mg beta and 0.25mg beta at 30 and 40ml inflation volumes respectively. Expression of ENaC, Na, K ATPase and SGK mRNA There were significant ef fects of betamethasone (beta) treatment on the expression of alpha epithelial sodium channel ( ENaC ) and sodium potassium adenosine triphosphatase ( Na, K ATPase ) messenger ribonucleic acid ( mRNA ) in lung. Both doses of betamethasone increased expression o f ENaC and Na, K ATPase mRNA with and without out aldosterone. There were no differences between the effects of 0.25 mg and 0.75 mg beta. Aldosterone infusion did not alter expression of either

PAGE 48

48 gene. Expression of serum glucocorticoid regulated kinase ( S GK ) mRNA did not differ in any treatment group compared to control fetuses or aldosterone infused fetuses. Figure 3 3 depicts these data in fold changes relative to control fetuses, as described in the figure legend. Expression ENaC Membrane and Whole Ce ll Protein Previous studies performed by Keller Wood et al have described the immature and mature ENaC protein detected in ovine fetuses at multiple time points during gestation. Mature and immature ENaC protein have masses of approx 68 kDa and 100 kDa respectively (Jesse et al., 2009). In fetal lung whole cell protein extracts, there was a significant overall effect of betamethasone on the 68kDa form of ENaC protein, but no overall effect of betamethasone on the 100kDa form. There was no effect of a ldosterone on either form of ENaC protein. Fetuses infused with 0.25mg beta had significantly increased expression of both 100 kDa and 68 kDa forms of ENaC protein relative to fetuses infused with 0.75mg beta. There was a tendency for this effect to al so occur in fetuses that received aldosterone with betamethasone, but these data were not statistically significant. Analysis of expression of mature 68 kDa ENaC in fetal lung membrane enriched protein extracts showed no significant difference in protei n expression among corticosteroid treated fetuses relative to control fetuses or aldosterone infused fetuses, but a tendency of 0.25mg beta with and without aldosterone to increase protein expression was observed. However this tendency was not statisticall y significant. No

PAGE 49

49 detectable amount of 100 kDa immature ENaC protein was present in membrane enriched samples. Analysis of the ratio of the mature 68KDa to the immature 100kDa form in whole cell showed an overall effect of betamethasone; 0.75mg beta tend ed to increase the ratio, but this effect was only significant when the fetuses were also infused with aldosterone. Analysis of membrane/whole cell ratio of the mature 68 kDa form of ENaC protein showed an overall significant increase in this ratio in 0. 75mg beta fetuses relative to control and 0.25mg beta fetuses. There was also a tendency for this effect to persist in fetuses infused with aldosterone and beta, but this difference was not statistically significant. These data are contained in Figure 3 4 and significance is expressed as described in the figure legend. Expression EnaC Membrane and Whole Cell Protein Previous studies performed by Keller W ood et al have described the immature and mature ENaC protein detected in ovine fetuses at multiple time points during gestation. Mature and immature ENaC protein have masses of approx 112 kDa and 102 kDa respectively (Jesse et al., 2009). There were significant effects of betamethasone alone and significant aldosterone betamethasone interactions on e xpression of the mature 112 kDa form of ENaC in fetal lung membranes and in the whole cell. Expression of mature 112 kDa ENaC protein in lung whole cell extracts showed an effect of 0.25mg beta to significantly increase protein expression in these fetu ses relative to control and 0.75mg beta infused fetuses. However, aldosterone prevented this effect of 0.25 mg beta infusion. Infusion of aldosterone alone increased expression of the 112kDa form of ENaC protein in whole

PAGE 50

50 cells as compared to control fetu ses, or fetuses infused with 0.75beta with aldosterone. Additionally, fetuses receiving 0.25mg beta with aldosterone had similarly increased protein expression to that of aldosterone alone, and greater expression than fetuses receiving 0.75mg beta with ald osterone. Analysis of expression of 112 kDa ENaC in fetal lung membrane enriched protein extracts showed that 0.25mg beta significantly increased protein expression relative to control, 0.75mg beta, and 0.25mg beta with aldosterone infused fetuses. In c ontrast, infusion of 0.75mg beta with aldosterone decreased expression of 112 kDa form of ENaC as compared to infusion of aldosterone alone. There was also an overall effect of betamethasone and an interaction between betamethasone and aldosterone in th e expression of the immature 102 kDa form of ENaC protein in whole cell extracts. 0.25mg beta infused fetuses had increased protein expression relative to control and 0.75mg beta fetuses. Fetuses receiving aldosterone with betamethasone had no increase i n expression. No significant difference in 112/102 kDa ENaC expression ratio was found in any corticosteroid infused group. Likewise no significant difference in the expression ratio of 112 kDa ENaC membrane/whole cell ratio was found among corticoster oid infused fetuses. These data are contained in Figure 3 5 and significance is expressed as described in the figure legend. Expression of Mineralocorticoid Receptor and Glucocorticoid Receptor mRNA Expression of mineralocorticoid receptor ( MR ) mRNA in fet uses that received 0.25mg beta was significantly decreased relative to control fetuses. Expression of MR mRNA did not differ among fetuses receiving aldosterone or aldosterone with either dose of betamethasone. Expression of glucocorticoid receptor ( GR ) mR NA was

PAGE 51

51 decreased in fetuses that received 0.75mg beta with aldosterone relative to fetuses that only received 0.75mg beta, and no significant changes in GR mRNA expression occurred among either betamethasone dose and control fetuses. Figure 3 3 expresses t hese data in fold changes relative to control fetuses, as described in the figure legend. Expression of Aquaporin ( AQP ) 1 and AQP 5 mRNA No significant changes in expression of aquaporin ( AQP ) 1 or AQP 5 mRNA occurred among fetuses infused with corticoster oids relative to control fetuses Corticosteroid infused fetuses expression of lung AQP1 and AQP 5 mRNA did not significantly differ relative to aldosterone infused fetuses. Figure 3 3 depicts these data as fold changes relative to control fetuses, as desc ribed in the figure legend. Expression of S urfactant Related Protein (SP) A and SP B mRNA No Significant change in SP A or SP B mRNA expression occurred among fetuses infused with corticosteroids relative to control fetuses or aldosterone infused fetuses. Corticosteroid infused fetuses expression of lung SP A and SP B mRNA did not significantly differ relative to aldosterone infused fetuses. Figure 3 3 depicts these data as fold changes relative to control fetuses, as described in the figure legend. Plasma Cortisol and Aldosterone Ovine fetal plasma aldosterone and cortisol concentrations at 0h and 48h after beginning corticosteroid infusion are represented in Figure 3 6. Fetuses infused with aldosterone, both without and with either dose of betamethasone, h ave significantly elevated plasma aldosterone concentrations at 48h post beginning of infusion. No difference in plasma aldosterone concentration was present in any group before beginning the corticosteroid infusion. Fetuses at 0h did not have significant differences

PAGE 52

52 in plasma cortisol concentration and no difference in plasma cortisol was detected in any corticosteroid infused group or in control fetuses at 48h post beginning of Infusion. Histology Table 3 1 contains percent left lung lobe wet weight and percent total area of collagen and elastin staining in ovine fetal lung sections. No significant change in left lung lobe percent wet weight was found between corticosteroid infused and control fetuses. The percent total area of collagen staining in lung s ections from fetuses infused with 0.75mg beta was significantly greater than that in control fetuses or fetuses infused with 0.25mg beta. The percent total area of elastin staining in lung sections from fetuses infused with 0.75mg beta was significantly gr eater than that in control fetuses. Fetuses infused with 0.75mg beta with aldosterone also had significantly greater elastin percent area than aldosterone fetuses. Figures 3 7 and 3 8 are representative examples of typical elastin and collagen staining in ovine fetal lung parenchyma.

PAGE 53

53 Figure 3 1. Peak pressure inflation data for both inflation series are expressed as group means and standard errors for each treatment group over all 5 in flation volumes

PAGE 54

54 Figure 3 2. Plateau pressure measurements for in situ lung compliance data as determined by steady state pressure between inflations.

PAGE 55

55 Figure 3 3. Quantitative real t ime PCR data of genes involved in lung fluid homeostasis. Data are depicted as mRNA fold changes relative to control Asterix over horizontal bars indicate si gnificant differences (p<0.05) Vertical bars from left to right 1: Control, 2: 0.25mg Betamethasone (beta), 3 : 0.75mg Betamethasone 4 : 0.2mg Al dosterone 5 : 0.2mg Aldosterone+ 0.25mg Betamethasone 6 : 0.2mg Aldosterone + 0.75mg Betamethasone fetuses Fold changes relative to control

PAGE 56

56 Figure 3 4. Western blots of epithelial sodium channel alpha ( ENaC ) protein in whole cell and membrane enriched extracts from fet al lungs. Data are expressed as group mean SEM. Significant differences are denoted by lines. Bars below each end of a line are significantly different from each other. (p<0.05)

PAGE 57

57 Figure 3 5. Western blots of ENaC protein in whole cell and membrane enriched extracts from fetal lungs. Data are expressed as group mean SEM. Significant differences are denoted by lines. Bars below each end of a line are significantly different from each other. (p<0.05)

PAGE 58

58 Figure 3 6. Feta l plasma aldosterone and cortisol concentrations at 0h pre infusion and 48h post start of corticosteroid infusion. 0h and 48h plasma aldosterone and cortisol concentrations of control fetuses that did not receive infusion of steroid are also included.

PAGE 59

59 Table 3 1. Percent lung weight determined after baking the lungs. Percent collagen and elastin in corticosteroid treated fetuses and control animals were determined by fraction of total area stained for collagen and elastin in fetal lung sections. Control Aldo Beta (0.25 mg) Aldo + Beta (0.25 mg) Beta (0.75 mg) Aldo+ Beta (0.75 mg) % Wet Weight 92.63 0.18 93.83 1.47 93.13 0.50 93.30 0.46 92.63 1.01 93.08 0.70 % Collagen 7.948 0.81 6.92 2.21 6.37 0.32 7.41 0.90 11.37 1.36 ^ 10.59 1.03 % Elastin 1.32 0.15 1.43 0.09 1.56 0.32 1.90 0.19 2.16 0.19 2.46 0.26 # Data are expressed as means SEM, ( ) denotes significance relative to control, ( # ) denotes significance relative to Aldo, and( ^ ) denotes signif icance relative to 0.25mg Beta fetuses,(p<0.05)

PAGE 60

60 Table 3 2. Primers and Probes used in real time PCR assays. Gene Forward Primer Reverse Primer AQP 1 CCATCGTCGCCACTGTCAT GAGGCCAAGCGAGTTGTCA AQP 5 CGCCGCAATCCTCTATGG CGCAGTCGTGTTGTTGTTGAG a ENaC CCCGGGTGATGGTGCATGAA TCACGCCCGGCCGCAG GR ACTGCCCCAAGTGAAAACAGA GCCCAGTTTCTCCTGCTTAATTAC MR ATTTCACTGAGTACCTGTTGATTATCATC GGGAAACTTAATA TGATTGCACTAAAT AAA Na,K ATPase a1 GGTGTTGCCCTGAGGATGTATC CCGGACTTCGTCATACACGAA SGK 1 GACTTTGGACTCTGCAAGGAGAA CGGGCGTGCCACAGAA b actin TTCCTTCCTGGGCATGGA GACGTCACACTTCATGATGGAATT SP A TGACCCTTATGCTCCTCTGGAT CAGGGCTTCCAAGACAAACTTC SP B TCCCTGCCTGGAGAATG G CTGCCTGAGTGGTCACAAACA Gene Probe AQP 1 TCTCGGGCATCACCTCCTCTCTGC AQP 5 CAATGCCCGAAGCAATCTGGCTG a ENaC TAAAGCCAGCATCATCCATAAAGGCG GR AAAGAAGATTTTATCGAACTCTGCACCCCTGG MR CTTTTCCAAGATTA ATTTGGCCTCTATTCAAAGCA Na, K ATPase a1 TTCTGTGCCTTCCCCTACTCGCTTCTCATT SGK 1 TTGAACACAATGGCACGACGTCCAC b actin TCCTGCGGCATTCACGAAACTACCTT SP A TTCTGGCCTCGAGTGCGACACAAA SP B TGCCACAAGTCTCTGAGTGCCAGCT

PAGE 61

61 Figure 3 elastin staining of ovine fetal lung parenchyma. Elastin fibers are clearly visible as black fibers over yellow secondary tartrazine stained tissue.

PAGE 62

62 Figure 3 8.Typical picrosirius red solution staining of ovine fetal lung parenchyma Collagen fibers stain red over yellow background tissue.

PAGE 63

63 CHAPTER 4 DISCUSSION Effects of Corticosteroid Infusion on Lung Compliance While there was not an overall aldosterone effect on fetal lung in situ peak pressure measurements, the results of first and second inflation pressure measurements showed a distinct effect of aldosterone to decrease intrapulmonary pressure at the initial inflation volume and also at the subsequent higher volumes as compared to control fetuses, indicating an apparent initial and transiently sustained increase in ovine fetal lung dynamic compliance as determined by the intrapulmonary volume/pressure ratio. Initial intrapulmonary volumes are most analogous to the first breaths of fetal extrauterine life and these data in dicate that aldosterone infusion had beneficial effects on fetal lung function during a time that would correlate to the initial breaths of life. This increased dynamic compliance is again apparent in the first inflation series as aldosterone infused fetus es did not have significant increases in intrapulmonary pressure after inflation to 20ml, while control fetal lungs had significant increases in pressure with each stepwise increase in intrapulmonary volume. The aldosterone effect to increase fetal lung dynamic compliance was not entirely expected, however it was surprising that neither dose of betamethasone (beta) had significant effects on ovine lung dynamic compliance and betamethasone infused fetal intrapulmonary pressures differed little from control animal pressure measurements. These results were unexpected because antenatal administration of synthetic glucocorticoids has been demonstrated to effectively enhance preterm fetal lung function (Liggins and Howie, 1 972) Both doses of glucocorticoid receptor ( GR ) agonist were expected to occupy all GR receptors and aldosterone infusion would occupy

PAGE 64

64 approx 85% of fetal mineralocorticoid receptor ( MR ) However, it is important to note that the doses of GR agonists use d in this study were physiological and not representative of clinical doses. Rather than attempt to reproduce clinical observations and make direct clinical correlations, this study was designed to provide insight into possible mechanisms of action of MR a nd/or GR agonists in response to a physiological increase in these agonist and to determine what effect combined administration of MR/GR agonist have on fetal lung maturation. These data do indicate a plausible mechanism of MR agonist inducible lung matura tion that is ameliorating the intrapulmonary pressure in aldosterone infused animals while GR agonist did not induce this mechanism. Interestingly, the beneficial effect of aldosterone infusion to increase fetal lung dynamic compliance was ablated in fetu ses that received either dose of betamethasone combined with aldosterone. Only fetuses that received 0.75mg beta with aldosterone showed any significant difference from control fetuses during the first inflation, but this effect did not occur until the 50m l inflation volume. The initial decreased pressure and insignificant changes in pressure with stepwise increases in volume observed in aldosterone infused fetuses did not occur in other corticosteroid infused fetuses. As GR agonists are known to increase s urfactant production (DeLemos et al., 1970) and induce potential mediators of lung fluid reabsorption (Venkatesh and Katzberg, 1997) it was expected that an increase in com pliance would occur in these fetuses relative to control animals. Why these data do not indicate a change in compliance and why betamethasone combined with aldosterone ablates the aldosterone effect is not clear. There could possibly be an unknown inhibito ry effect of betamethasone on aldosterone

PAGE 65

65 or combined infusion of both betamethasone and aldosterone may possibly result in formation of heterodimer receptor GR/MR complexes that are ineffective at HRE (Liu et al., 1995) further investigation is clearly needed. However, the significance of these results directly correlates to the apparent increased viability of these aldosterone infused fetuses and their ability to survive in the extrauterine environment. Determinatio n of plateau relaxation pressures yielded similar results in the first inflation series to those of peak pressure measurements, with aldosterone again mediating lower intrapulmonary pressure at initial inflation volume and again at the majority of subseque nt volumes compared to control fetuses. Indicating an apparent initial and transiently sustained increase in ovine fetal lung static compliance compared to control fetuses. Other than aldosterone infused fetuses, only fetuses infused with 0.75mg beta and a ldosterone also had lower initial pressures than control fetuses. Again infusion of 0.25mg beta with aldosterone attenuated the positive effects of aldosterone infusion. Plateau pressure data from the second inflation series did not show any difference in initial pressure measurements in any corticosteroid infused fetuses. However, aldosterone infused fetuses did not have significant increases in pressure after each stepwise increase in pressure. Surprisingly, in fetuses that received aldosterone significa nt decreases in pressure were observed at the 30 and 40ml inflation volumes. Indicating the possibility that perhaps a pressure threshold at some point before 30ml was exceeded, allowing the highly compliant nature of these lungs to afford repeated increas es in volume without concomitant increases in pressure. While these decreased pressures are indicative of increased static compliance, the specific cause of this

PAGE 66

66 increased compliance is not clear. There could potentially be remodeling of collagen and elast in fiber abundance and/or organization that could result in profound changes in the biomechanical properties of the lung (Tanaka and Ludwig, 1999) However lung tissue histological staining did not indicate significant changes in abundance of collagen or elastin in aldosterone treated fetuses when compared to control fetuses. It is possible that the arrangement of these fibers was affected by aldosterone infusion and a more sophisticated analysis of elastin and collagen stained fetal lung sections by scanning electron microscopy could potentially provide useful data. Expression of ENaC, Na, K ATPase, and SGK 1 mRNA As transient tachypnea of the newborn (TTN) is attributed to excessively wet lungs and is a major contributor to neonatal respiratory distress, it is reasonable to hypothesize that increased lung liquid reabsorption be fore birth would potentially ameliorate the risk of developing TTN. GR agonists are known to increase alpha epithelial sodium channel ( ENaC ) messenger ribonucleic acid ( mRNA ) expression (Itani et al., 2002; Venkatesh and Katzberg, 1997) and it was expected that infusion of ENaC mRNA in all fetuses that received corticosteroid infusion. With this in mind, and the known function of ENaC activity in the aldosterone sensitive distal nephron (ASDN) to increase sodium reabsorption and volume (Loffing et al., 2001) lung ENaC could potentially contribute to increased lung fluid reabsorption in a similar mechanism through induction by MR and GR agonists. Of specific interest was the potential of aldosterone to greatly upregulate ENaC activity, as was observed in ex vivo fetal hamster lung data in which aldosterone increased lung liquid reabsorption (Kindler et al., 1993)

PAGE 67

67 However q uantitative real time polymerase chain reaction ( PCR ) ENaC, sodium potassium adenosine triphosphatase ( Na, K ATPase ) and serum glucocorticoid regulated kinase ( SGK ) mRNA extracts from corticosteroid infused fetal lungs did not indicate an effect of aldosterone infusion to increase expression of the s e genes, and no changes in SGK mRNA expression occurred among any fetal group. As expected, both ENaC and Na, K ATPase compared to control animals (Itani et al., 2002; Venkatesh and Katzberg, 1997) ENaC and Na, K ATPase mRNA expression was also observed in fetuses receiving either dose of betamethasone with aldosterone compared to fetuses that received only aldosterone. As the in situ lung pressure data did not indicate that betamethasone infused fetuses had significant increases in pulmonary compliance, the increase in expression of these genes did not substantially affect the biomechanical properties of the lung. Also, as per cent wet weight did not differ among corticosteroid infused fetuses and control fetuses it is unlikely that there was an appreciable change in lung fluid homeostasis. However, due to the large percentage of water weight in these lungs, small changes in per cent wet weight may not have been able to be distinguished through our detection method. Expression of MR and GR mRNA The mRNA expression of both MR and GR did not differ greatly among corticosteroid infused fetuses. However there were significant decrea ses in MR mRNA expression in 0.25mg beta fetuses, the significance of which is unclear as synthetic glucocorticoids have very little affinity for MR receptors (Rupprecht et al., 1993) It would not be expected for b etamethasone to directly affect MR expression, but betamethasone occupation of GR receptors could potentially afford increased binding of

PAGE 68

68 endogenous cortisol to MR receptors and this decrease in MR mRNA expression could then be attributed to MR mRNA expres sion negative feedback regulation in response to increased MR activity. Also, transcriptional regulation of MR expression by increased GR activation is a potential explanation for the observed decrease in MR expression as well as complex MR/GR heterodimer formation downregulating MR expression (Liu et al., 1995) A dissimilar expression pattern is observed for GR mRNA expression in which 0.25mg beta with aldosterone has significantly greater GR expression then 0.75mg beta with aldosterone infused fetuses. However these data can also be attributed to increased occupancy of GR receptors and negative feedback regulation of GR mRNA expression. While these data are only significant among fetuses that received betamethasone with aldosterone, there appears to be a specific dose dependent effect of betamethasone decreasing GR mRNA expression that is in agreement with the plausible explanation of increased negative feedback. Expression of AQP 1, AQP 5, SP a, and SP b mRNA There was a tendency for 0.75mg beta to increase transcription of aquaporin ( AQP ) 1 mRNA expression but these data did not reach statistical significance and AQP 5 expression did not differ among corticosteroid infused fetuses. A QP 1 and 5 are thought to provide th e principal route for osmotic water transport of intrapulmonary fluid into the pulmonary capillaries with AQP 5 associated with type I cells located on the apical membrane of distal airways and contribute to intrapulmonary lung fluid reabsorption, while AQ P 1 is more closely associated with microvascular endothelia and absorbing institutial fluid into the vascular compartment (Verkman, 2007). Increased lung AQP 1 and/or AQP 5 mRNA expression would possibly upregulate passive

PAGE 69

69 reabsorption of lung liquid thro ugh either route, but corticosteroid infusion did not affect expression of these genes. It was expected that mRNA expression of surfactant related proteins (SP) A and B would both be increased in fetuses that received betamethasone (Liggins, 1969) and pote ntially be increased in aldosterone infused fetuses, but surprisingly mRNA expression of both SP A and SP B did not differ from control fetuses in any corticosteroid infused groups. There was a tendency for 0.25mg beta to increase expression of SP A but v ariability among these fetuses was too great for these data to be significant. However, SP A protein is generally associated with increased host defense from bacterial, fungal, and viral infection and increases in SP A would not affect the biomechanical pr operties of the lung to the same extent as increased mRNA expression of SP B (Nkadi et al., 2009). There did appear to be a general increase in mRNA expression of SP B in all fetuses that received aldosterone with or without betamethasone. However the varia bility among these fetuses was again too great for significance to be obtained. As SP B is more closely associated with decreasing alveolar surface tension and increasing efficacy of the air alveolus interface (Nkadi et al., 2009) increased mRNA expression of SP B could potentially contribute to the observed increased compliance of aldosterone infused fetuses. The variability in SP A and SP B mRNA expression can possibly be attributed to the gestational age at which these fetuses were studied, and that init ial surfactant production first occurs in the later canalicular stage of lung development in human fetuses (17 27 weeks) and the equivalent ovine stage of lung development occurs at (80 120d) gestation (Alcorn et al., 1981; Kotecha, 2000). When the gestati onal age of

PAGE 70

70 these fetuses is considered, significant variability in the expression of surfactant related protein mRNA would be expected as surgery was performed on these fetuses between (122 124d) gestation and tissue collection occurred 7 days after surge ry at a time in which upregulation of these genes is still only initially beginning. Therefore, there may be inherent variability in specific timing of SP A and B mRNA expression upregulation from fetus to fetus, and this variability may prevent the actual effect of aldosterone from obtaining statistical significance. ENaC Whole Cell and Membrane Protein For lung apical alveolar epithelial ENaC channels to effectively participate in sodium reabsorption, insertion of ENaC protein into the alveolar apical membrane is critical. Western blot data of fetal lung whole cell and membrane enriched protein extracts confirmed that corticosteroid infusion or MR, GR or combined MR/GR agonists distinctly affect the abundance and potentially the stoichiometric relationship of ENaC subunits. The most prominent increase in abun dance of the vitally important nearly significant increases in whole cell and membrane protein extracts respectively. While numerous data have shown betamethasone to increa se ENaC transcription (Itani et al., 2002; Venkatesh and Katzberg, 1997) it was surprising to not see a similar effect in fetuses that received 0.75mg beta. However, when the ratio of whole ce ll to ENaC protein was determined, a substantial increase in the ENaC was found in fetuses that received 0.75mg beta. These data indicate that there is perhaps increased insertion of intracellula ENaC into the alveolar membrane in fetuses receiving 0.75mg beta, which could potentially stimulate increased sodium reabsorption and passive lung

PAGE 71

71 fluid reabsorption. This effect of betamethasone appears to be dose dependent, and while greater a ENaC is observed in 0.25mg beta infused fetal whole cell protein extracts, this dose may be insufficient to increase insertion of these channels into alveolar membrane. These data also indicate that fetuses receiving 0.25mg beta have significantly ENaC protein, while 0.75mg beta infused fetuses have a ENaC protein. This suggests that there may be an increase in the necessary post translational modification of these channel s (Hughey et al., 2003) ENaC channels in response to the 0.75mg dose of betamethasone but that 0.25mg beta dose is not sufficient to cause increased post translatio nal modification. Aldosterone attenuated the effects of both doses of betamethsone infusion but similar patterns of protein expression ENaC protein extracts as well as a similar ratio of ENaC protein in membran e and whole cell fractions. These data suggest that aldosterone is reducing but not completely inhibiting the dose dependent action of ENaC abundance and membrane insertion. However, as in situ intrapulmonary pressure has demons trated aldosterone infused fetuses to have ENaC protein expression do not appear to have a significant impact on lung biomechanical properties. ENaC Whole Cell and Memb rane Protein Similar changes in ENaC protein expression were also observed in corticosteroid infused fetuses. Again 0.25mg beta most significantly affected ENaC expression and greatly increased abundance of the in both membrane

PAGE 72

72 enriched and w hole cell protein extracts as well as Immature 102 kDa ENaC protein. The significance of this is not entirely clear as highly selective sodium channels are thought to contain subunits (Jain et al., 2001) but expressi on of ENaC protein in ovine fetuses is also known to decrease greatly before parturition when rapid reabsorption of lung liquid occurs (Jesse et al., 2009) When considering the in situ pressure data in 0.25mg beta f etuses, these data do not suggest that there is a correlation between increased ENaC protein expression and changes in fetal lung compliance. Aldosterone again attenuated the increase in ENaC when combined with betamethasone and as fetuses infused with only aldosterone had the greatest increase in lung compliance, increases in ENaC protein expression likely do not affect lung biomechanical properties. This observation is in agreement with knockout studies indicating that the ENaC subunit is not crit ical for the transition into the extrauterine environment at birth (Randrianarison et al., 2008) while similar studies have shown that ENaC results in death shortly after birth (Hummler et al., 1996) These data considered along with the lack of agreement on exact ENaC subunit stoichiometry (Eskandari et al., 1999; Firsov et al., 1998) prevents any d efinitive conclusion to be drawn as changes in subunit abundance may also effect the formation and activity of nonselective, and highly selective channels (Jain et al., 2001) in a manner that is not easily predicted. As the role of ENaC to increase fluid reabsorption is thought to occur shortly before birth, it may not be feasible to increase lung liquid reabsorption at the stage of gestation these fetuses were studied. Lung liquid secretion is an important and vital comp onent of normal lung structural development, and there are likely multiple feedback mechanisms to insure that this process continues until shortly before birth.

PAGE 73

73 Also, the dose of MR and GR agonist utilized may not be sufficient to adequately affect ENaC pr otein abundance or subunit relationship in a manner that would significantly increase lung fluid reabsorption. Therefore, it is not entirely surprising that these changes in ENaC protein did not apparently affect fetal lung dynamic or static compliance. Hi stology and Lung Percent Wet Weight GR and MR agonists were expected to potentially effect expression of mediators of lung fluid reabsorption, and increased expression of these proteins could potentially have resulted in decreased lung percent wet weight. However, no changes in percent wet weight occurred in these fetuses, suggesting that corticosteroid infusion did not affect lung liquid reabsorption. As fluid reabsorption did not appear to be affect by these corticosteroids, infusion of MR and/or GR agoni sts could also potentially change expression of collagen and elastin proteins, resulting in significant changes in lung biomechanical properties. Betamethasone has been shown to increase expression of both collagen and elastin in lung (Beck et al., 1981) therefore it was not surprising that 0.75mg beta infusion significantly increased both lung percent collagen and elastin in these fetuses. However, it was interesting that increases in collagen were ablated when 0.75mg beta was infused along with aldosterone and that infusion of aldosterone alone did not affect collagen expression. Aldosterone did not attenuate the increase in elastin expression in fetuses that received both 0.75mg beta and aldosterone, but increases in elastin were not observed in aldosterone infused fetuses. Changes in percent lung collagen and elastin does not appear to explain the observed change in lung compliance of MR agonist infused fetuses, but as elastin was increased in fetuses that received aldosterone with 0.75mg beta, this increase in elastin

PAGE 74

74 could potentially explain why these fetuses did not have the same increases in lung compliance as that of aldosterone infused fetuses in which percent elastin did not increase. As increases in elastin content have been shown by others to increase the recoil properties of rat lungs, the increase in elastin content of synthetic glucocorticoid infused fetuses in this study may explain the lack of increases in lung compliance observed when elastin content a lso increased (Nardell and Brody, 1982) Significance and Future Directions This study indicates that antenatal administration of aldosterone can potentially enhance the viability of ovine preterm fetal lungs and th ese data are significant as no similar study in ovine fetuses has been previously conducted. In contrary to our hypothesis, the affect of aldosterone infusion does not appear to occur through increases in lung liquid reabsorption. Rather, there is potentia lly a novel undiscovered mechanism of MR activation in the ovine lung facilitating the increased lung compliance observed in aldosterone infused fetuses. Analysis of mRNA and protein expression of potential mediators of lung fluid homeostasis from aldoster one infused fetuses did not indicate a change in expression in either mRNA or protein expression that would explain the decreases in intrapulmonary pressures, however lack of increases in percent extra cellular matrix ( ECM ) proteins in aldosterone infused fetuses may provide valuable insight into why these pressures are decreased in aldosterone infused fetuses and are not decreased in betamethasone infused fetuses. As the exact cause of the increases in lung compliance observed in aldosterone infused fetus es remain unclear, there are many potential changes in the fetal lung that may be contributing to this effect. The increased compliance may potentially be the result of aldosterone causing lung hypertrophy relative to non aldosterone infused

PAGE 75

75 fetuses. This would result in decreased intrapulmonary pressures at equivalent volumes of air infused into the lungs of aldosterone infused fetuses. Increased thinning of the alveolar epithelial membrane after infusion of aldosterone would result in increased lung expan sion at equivalent volumes of air in these lungs and also result in decreased intrapulmonary pressures and the observed increased compliance. Changes in the relative abundance of type II epithelial cells could potentially increase overall surfactant produc tion without increased mRNA expression of surfactant related protein detectable by q uantitative real time PCR. Increases in the amount of type II cells would increase overall pulmonary surfactant secretion and would afford greater expansion of the lung. Also, while western blot and quantitative real time PCR analysis of ENaC did not indicate increased transcri ptional or translational expression in aldosterone infused fetuses, increased insertion of ENaC into the alveolar epithelial apical membrane would afford greater reabsorption of sodium and intrapulmonary fluid and potentially result in increased compliance as well. Further investigation by immunohistochemistry (IHC) of lung parenchyma to determine ENaC and MR abundance, localization and/or colocalization could potentially elucidate the mechanism of aldosterone action in these fetuses. As ENaC and MR abun dance may potentially be increased in the alveolar apical membrane and nucleus of the alveolar epithelial cells respectively in a manner not detectable by western blot. Membrane enriched protein extracts analyzed by western blot contained both apical and b asolateral membrane proteins along with other cellular contents. Thus, only general changes in membrane abundance, but not specific changes in abundance of apical membrane ENaC was visible by western blot. However, IHC of lung sections

PAGE 76

76 would afford determi nation of ENaC abundance in lung epithelial apical membrane as well as MR abundance in epithelial cell nucleus. If increased insertion of ENaC into the apical membrane did occur after aldosterone infusion, this could potentially explain the observed increa ses in compliance in these fetuses. Also, increased MR localization into the nucleus of lung epithelial cells would imply that the mechanism of action responsible for the observed increased lung compliance is MR mediated. As the use of synthetic glucocor ticoids has become more commonplace over the last 30 years for the attenuation and prevention of respiratory distress in preterm infants, the possible deleterious consequences of their overuse are of particular concern. Recently, published finding have sho wn that in a cohort of women given multiple doses of synthetic glucocorticoids, multiple doses did not decrease infant morbidity and mortality more so than a single dose of synthetic glucocorticoids. These data show that multiple doses resulted in reduced birth weight, body length and head circumference at birth. Therefore the judicious use of a single course of antenatal synthetic glucocorticoids is recommended over the use of multiple courses (Murphy et al., 2008). However, while these steroids are intend ed to mimic the action of endogenous cortisol that increases before labor to rapidly mature fetal organs, synthetic glucocorticoids lack the same biological activity as cortisol and do not have appreciable biological activity at MR receptors. Antenatal adm inistration of combined MR and GR agonists may more accurately mimic the action of endogenous cortisol and may provide additional benefits for fetal lung maturation. As this study demonstrated that a physiological infusion of MR agonist decreased intrapulm onary pressure in ovine fetal lungs, clinical administration of MR agonist may potentially provide benefits not provide

PAGE 77

77 by GR agonists alone. Further research into the role of MR agonists and the mechanism by which these corticosteroids decrease fetal intr apulmonary pressure would provide valuable insight into their future therapeutic potential in clinical doses. Moreover as antenatal synthetic glucocorticoids are known to potentially cause deleterious side effects in fetuses that may not manifest until lat er in life, reduced dosages of glucocorticoids or alternative usage of antenatal mineralocorticoid agonists may avoid these side effects and provide improved fetal outcomes. Further research of mineralocorticoid agonist mechanism of action and therapeutic potential may provide important advances in the prevention and treatment of preterm infant respiratory distress and should be pursued.

PAGE 78

78 REFERENCES Alcorn, D.G., Adamson, T.M., Maloney, J.E., and Robinson, P.M. (1981). A morpholog ic and morphometric analysis of fetal lung development in the sheep. Anat. Rec. 201, 655 667. Amy, R.W., Bowes, D., Burri, P.H., Haines, J., and Thurlbeck, W.M. (1977). Postnatal growth of the mouse lung. J. Anat. 124, 131 151. Bassett, J.M., and Thorbur n, G.D. (1969). Foetal plasma corticosteroids and the initiation of parturition in sheep. J. Endocrinol. 44, 285 286. Beck, J.C., Mitzner, W., Johnson, J.W., Hutchins, G.M., Foidart, J.M., London, W.T., Palmer, A.E., and Scott, R. (1981). Betamethasone an d the rhesus fetus: effect on lung morphometry and connective tissue. Pediatr. Res. 15, 235 240. Bizzarro, M.J., and Gross, I. (2004). Effects of hormones on fetal lung development. Obstet. Gynecol. Clin. North Am. 31, 949 61, xii. Bland, R.D. (1983). Dy namics of pulmonary water before and after birth. Acta Paediatr. Scand. Suppl. 305, 12 20. Bland, R.D., Bressack, M.A., and McMillan, D.D. (1979). Labor decreases the lung water content of newborn rabbits. Am. J. Obstet. Gynecol. 135, 364 367. Bland, R.D ., McMillan, D.D., Bressack, M.A., and Dong, L. (1980). Clearance of liquid from lungs of newborn rabbits. J. Appl. Physiol. 49, 171 177. Brieu, V., Cathiard, A.M., Darbeida, H., Naaman, E., Saez, J.M., and Durand, P. (1988). Development of the fetal pitu itary adrenal axis in the sheep. Reprod. Nutr. Dev. 28, 1129 1144. Bryden, M.M., Evans, H., and Binns, W. (1973). Embryology of the sheep. 3. The respiratory system, mesenteries and celom in the fourteen to thirty four day embryo. Anat. Rec. 175, 725 735. Burri, P.H., Dbaly, J., and Weibel, E.R. (1974). The postnatal growth of the rat lung. I. Morphometry. Anat. Rec. 178, 711 730. Conaglen, J.V., Donald, R.A., Espiner, E.A., Livesey, J.H., and Nicholls, M.G. (1984). The effect of ovine corticotropin rele asing factor on catecholamine, vasopressin, and aldosterone secretion in normal man. J. Clin. Endocrinol. Metab. 58, 463 466. DeLemos, R.A., Shermeta, D.W., Knelson, J.H., Kotas, R., and Avery, M.E. (1970). Acceleration of appearance of pulmonary surfacta nt in the fetal lamb by administration of corticosteroids. Am. Rev. Respir. Dis. 102, 459 461.

PAGE 79

79 Donn, S.M., and Dalton, J. (2009). Surfactant replacement therapy in the neonate: beyond respiratory distress syndrome. Respir. Care 54, 1203 1208. Durand, P., Bosc, M.J., and Locatelli, A. (1980). Adrenal maturation of the sheep fetus during late pregnancy. Reprod. Nutr. Dev. 20, 339 347. Eaton, D.C., Helms, M.N., Koval, M., Bao, H.F., and Jain, L. (2009). The contribution of epithelial sodium channels to alveo lar function in health and disease. Annu. Rev. Physiol. 71, 403 423. Elsner, C.W., Magyar, D.M., Fridshal, D., Eliot, J., Klein, A., Glatz, T., Nathanielsz, P.W., and Buster, J.E. (1980). Time trend analysis of plasma C 21 steroids in fetal and maternal s heep during the last 18 days of gestation. Endocrinology 107, 801 808. Eskandari, S., Snyder, P.M., Kreman, M., Zampighi, G.A., Welsh, M.J., and Wright, E.M. (1999). Number of subunits comprising the epithelial sodium channel. J. Biol. Chem. 274, 27281 27 286. Faffe, D.S., and Zin, W.A. (2009). Lung parenchymal mechanics in health and disease. Physiol. Rev. 89, 759 775. Ferrari, P., and Krozowski, Z. (2000). Role of the 11beta hydroxysteroid dehydrogenase type 2 in blood pressure regulation. Kidney Int. 5 7, 1374 1381. Fewell, J.E., and Johnson, P. (1983). Upper airway dynamics during breathing and during apnoea in fetal lambs. J. Physiol. 339, 495 504. Firsov, D., Gautschi, I., Merillat, A.M., Rossier, B.C., and Schild, L. (1998). The heterotetrameric ar chitecture of the epithelial sodium channel (ENaC). EMBO J. 17, 344 352. Fuller, P.J., and Young, M.J. (2005). Mechanisms of mineralocorticoid action. Hypertension 46, 1227 1235. Giannakoulopoulos, X., Teixeira, J., Fisk, N., and Glover, V. (1999). Human fetal and maternal noradrenaline responses to invasive procedures. Pediatr. Res. 45, 494 499. Gibbs, R. (2009). Glucocorticoid therapy in acute respiratory distress syndrome. Br. J. Hosp. Med. (Lond) 70, 665 Unknown. Giraud, G.D., Louey, S., Jonker, S., Schultz, J., and Thornburg, K.L. (2006). Cortisol stimulates cell cycle activity in the cardiomyocyte of the sheep fetus. Endocrinology 147, 3643 3649. Helve, O., Pitkanen, O., Janer, C., and Andersson, S. (2009). Pulmonary fluid balance in the human new born infant. Neonatology 95, 347 352.

PAGE 80

80 Hermansen, C.L., and Lorah, K.N. (2007). Respiratory distress in the newborn. Am. Fam. Physician 76, 987 994. Hughey, R.P., Mueller, G.M., Bruns, J.B., Kinlough, C.L., Poland, P.A., Harkleroad, K.L., Carattino, M.D., and Kleyman, T.R. (2003). Maturation of the epithelial Na+ channel involves proteolytic processing of the alpha and gamma subunits. J. Biol. Chem. 278, 37073 37082. Hummler, E., Barker, P., Gatzy, J., Beermann, F., Verdumo, C., Schmidt, A., Boucher, R., and Rossier, B.C. (1996). Early death due to defective neonatal lung liquid clearance in alpha ENaC deficient mice. Nat. Genet. 12, 325 328. Itani, O.A., Auerbach, S.D., Husted, R.F., Volk, K.A., Ageloff, S., Knepper, M.A., Stoke s, J.B., and Thomas, C.P. (2002 ). Glucocorticoid stimulated lung epithelial Na(+) transport is associated with regulated ENaC and sgk1 expression. Am. J. Physiol. Lung Cell. Mol. Physiol. 282, L631 41. Jain, L., Chen, X.J., Ramosevac, S., Brown, L.A., and Eaton, D.C. (2001). Expre ssion of highly selective sodium channels in alveolar type II cells is determined by culture conditions. Am. J. Physiol. Lung Cell. Mol. Physiol. 280, L646 58. Jensen, E., Wood, C.E., and Keller Wood, M. (2005). Chronic alterations in ovine maternal corti costeroid levels influence uterine blood flow and placental and fetal growth. Am. J. Physiol. Regul. Integr. Comp. Physiol. 288, R54 61. Jesse, N.M., McCartney, J., Feng, X., Richards, E.M., Wood, C.E., and Keller Wood, M. (2009). Expression of ENaC subun its, chloride channels, and aquaporins in ovine fetal lung: ontogeny of expression and effects of altered fetal cortisol concentrations. Am. J. Physiol. Regul. Integr. Comp. Physiol. 297, R453 61. Jobe, A.H. (2010). Lung maturation: the survival miracle o f very low birth weight infants. Pediatr. Neonatol. 51, 7 13. Joshi, S., and Kotecha, S. (2007). Lung growth and development. Early Hum. Dev. 83, 789 794. Kapoor, A., Dunn, E., Kostaki, A., Andrews, M.H., and Matthews, S.G. (2006). Fetal programming of h ypothalamo pituitary adrenal function: prenatal stress and glucocorticoids. J. Physiol. 572, 31 44. Keller Wood, M., von Reitzenste in, M., and McCartney, J. (2009 ). Is the fetal lung a mineralocorticoid receptor target organ? Induction of cortisol regulat ed genes in the ovine fetal lung, kidney and small intestine. Neonatology 95, 47 60. Keller Wood, M., Wood, C.E., Hua, Y., and Zhang, D. (2005). Mineralocorticoid receptor expression in late gestation ovine fetal lung. J. Soc. Gynecol. Investig. 12, 84 91

PAGE 81

81 Kikkawa, Y., Motoyama, E.K., and Gluck, L. (1968). Study of the lungs of fetal and newborn rabbits. Morphologic, biochemical, and surface physical development. Am. J. Pathol. 52, 177 210. Kindler, P.M., Chuang, D.C., and Perks, A.M. (1993). Fluid produc tion by in vitro lungs from near term fetal guinea pigs: effects of cortisol and aldosterone. Acta Endocrinol. (Copenh) 129, 169 177. Kitterman, J.A., Ballard, P.L., Clements, J.A., Mescher, E.J., and Tooley, W.H. (1979). Tracheal fluid in fetal lambs: sp ontaneous decrease prior to birth. J. Appl. Physiol. 47, 985 989. Kotecha, S. (2000). Lung growth: implications for the newborn infant. Arch. Dis. Child. Fetal Neonatal Ed. 82, F69 74. Koval, M., Ward, C., Findley, M.K., Roser Page, S., Helms, M.N., and Roman, J. (2010). Extracellular matrix influences alveolar epithelial claudin expression and barrier function. Am. J. Respir. Cell Mol. Biol. 42, 172 180. Levidiotis, M., Oldfield, B., and Wintour, E.M. (1987). Corticotrophin releasing factor and arginine vasopressin fibre projections to the median eminence of fetal sheep. Neuroendocrinology 46, 453 456. Liggins, G.C. (2000). The role of the hypothalamic pituitary adrenal axis in preparing the fetus for birth. Am. J. Obstet. Gynecol. 182, 475 477. Liggin s, G.C. (1994). The role of cortisol in preparing the fetus for birth. Reprod. Fertil. Dev. 6, 141 150. Liggins, G.C., and Howie, R.N. (1972). A controlled trial of antepartum glucocorticoid treatment for prevention of the respiratory distress syndrome in premature infants. Pediatrics 50, 515 525. Liggins, G.C. (1969). Premature delivery of foetal lambs infused with glucocorticoids. J. Endocrinol. 45, 515 523. Liu, W., Wang, J., Sauter, N.K., and Pearce, D. (1995). Steroid receptor heterodimerization demo nstrated in vitro and in vivo. Proc. Natl. Acad. Sci. U. S. A. 92, 12480 12484. Loffing, J., Zecevic, M., Feraille, E., Kaissling, B., Asher, C., Rossier, B.C., Firestone, G.L., Pearce, D., and Verrey, F. (2001). Aldosterone induces rapid apical transloca tion of ENaC in early portion of renal collecting system: possible role of SGK. Am. J. Physiol. Renal Physiol. 280, F675 82. Mast orakos, G., and Ilias, I. (2003 ). Maternal and fetal hypothalamic pituitary adrenal axes during pregnancy and postpartum. Ann. N. Y. Acad. Sci. 997, 136 149.

PAGE 82

82 Matalon, S. (1991). Mechanisms and regulation of ion transport in adult mammalian alveolar type II pneumocytes. Am. J. Physiol. 261, C727 38. Melby, J.C. (1977). Clinical pharmacology of systemic corticosteroids. Annu. Rev Pharmacol. Toxicol. 17, 511 527. Moessinger, A.C., Collins, M.H., Blanc, W.A., Rey, H.R., and James, L.S. (1986). Oligohydramnios induced lung hypoplasia: the influence of timing and duration in gestation. Pediatr. Res. 20, 951 954. Moessinger, A.C., Ha rding, R., Adamson, T.M., Singh, M., and Kiu, G.T. (1990). Role of lung fluid volume in growth and maturation of the fetal sheep lung. J. Clin. Invest. 86, 1270 1277. Moss, T.J., Doherty, D.A., Nitsos, I., Harding, R., and Newnham, J.P. (2003). Pharmacoki netics of betamethasone after maternal or fetal intramuscular administration. Am. J. Obstet. Gynecol. 189, 1751 1757. Murphy, K.E., Hannah, M.E., Willan, A.R., Hewson, S.A., Ohlsson, A., Kelly, E.N., Matthews, S.G., Saigal, S., Asztalos, E., Ross, S. et a l. (2008). Multiple courses of antenatal corticosteroids for preterm birth (MACS): a randomised controlled trial. Lancet 372, 2143 2151. Nardell, E.A., and Brody, J.S. (1982). Determinants of mechanical properties of rat lung during postnatal development. J. Appl. Physiol. 53, 140 148. Nkadi, P.O., Merritt, T.A., and Pillers, D.A. (2009). An overview of pulmonary surfactant in the neonate: genetics, metabolism, and the role of surfactant in health and disease. Mol. Genet. Metab. 97, 95 101. Olver, R.E., a nd Strang, L.B. (1974). Ion fluxes across the pulmonary epithelium and the secretion of lung liquid in the foetal lamb. J. Physiol. 241, 327 357. Pfister, R.E., Ramsden, C.A., Neil, H.L., Kyriakides, M.A., and Berger, P.J. (2001). Volume and secretion rat e of lung liquid in the final days of gestation and labour in the fetal sheep. J. Physiol. 535, 889 899. Randrianarison, N., Clerici, C., Ferreira, C., Fontayne, A., Pradervand, S., Fowler Jaeger, N., Hummler, E., Rossier, B.C., and Planes, C. (2008). Low expression of the beta ENaC subunit impairs lung fluid clearance in the mouse. Am. J. Physiol. Lung Cell. Mol. Physiol. 294, L409 16. Reini, S.A., Wood, C.E., Jensen, E., and Keller Wood, M. (2006). Increased maternal cortisol in late gestation ewes decr eases fetal cardiac expression of 11beta HSD2 mRNA and the ratio of AT1 to AT2 receptor mRNA. Am. J. Physiol. Regul. Integr. Comp. Physiol. 291, R1708 16.

PAGE 83

83 Richards, E.M., Hua, Y., and Keller Wood, M. (2003). Pharmacology and physiology of ovine corticoste roid receptors. Neuroendocrinology 77, 2 14. Rossier, B.C., and Stutts, M.J. (2009). Activation of the epithelial sodium channel (ENaC) by serine proteases. Annu. Rev. Physiol. 71, 361 379. Rupprecht, R., Reul, J.M., van Steensel, B., Spengler, D., Soder, M., Berning, B., Holsboer, F., and Damm, K. (1993). Pharmacological and functional characterization of human mineralocorticoid and glucocorticoid receptor ligands. Eur. J. Pharmacol. 247, 145 154. Sapolsky, R.M., and Meaney, M.J. (1986). Maturation of th e adrenocortical stress response: neuroendocrine control mechanisms and the stress hyporesponsive period. Brain Res. 396, 64 76. Smith, D.E., Otulakowski, G., Yeger, H., Post, M., Cutz, E., and O'Brodovich, H.M. (2000). Epithelial Na(+) channel (ENaC) exp ression in the developing normal and abnormal human perinatal lung. Am. J. Respir. Crit. Care Med. 161, 1322 1331. Snyder, P.M., Olson, D.R., and Thomas, B.C. (2002). Serum and glucocorticoid regulated kinase modulates Nedd4 2 mediated inhibition of the e pithelial Na+ channel. J. Biol. Chem. 277, 5 8. Starcher, B.C. (2000). Lung elastin and matrix. Chest 117, 229S 34S. Suki, B., Ito, S., Stamenovic, D., Lutchen, K.R., and Ingenito, E.P. (2005). Biomechanics of the lung parenchyma: critical roles of colla gen and mechanical forces. J. Appl. Physiol. 98, 1892 1899. Swanson, L.W., Sawchenko, P.E., Rivier, J., and Vale, W.W. (1983). Organization of ovine corticotropin releasing factor immunoreactive cells and fibers in the rat brain: an immunohistochemical st udy. Neuroendocrinology 36, 165 186. Tanaka, R., and Ludwig, M.S. (1999). Changes in viscoelastic properties of rat lung parenchymal strips with maturation. J. Appl. Physiol. 87, 2081 2089. Tegethoff, M., Pryce, C., and Meinlschmidt, G. (2009). Effects o f intrauterine exposure to synthetic glucocorticoids on fetal, newborn, and infant hypothalamic pituitary adrenal axis function in humans: a systematic review. Endocr. Rev. 30, 753 789. Venkatesh, V.C., and Katzberg, H.D. (1997). Glucocorticoid regulation of epithelial sodium channel genes in human fetal lung. Am. J. Physiol. 273, L227 33. Verkman, A.S. (2007). Role of aquaporins in lung liquid physiology. Respir. Physiol. Neurobiol. 159, 324 330. Verma, R.P. (1995). Respiratory distress syndrome of the n ewborn infant. Obstet. Gynecol. Surv. 50, 542 555.

PAGE 84

84 Wigglesworth, J.S., Desai, R., and Hislop, A.A. (1987). Fetal lung growth in congenital laryngeal atresia. Pediatr. Pathol. 7, 515 525. Wintour, E.M., Brown, E.H., Denton, D.A., Hardy, K.J., McDougall, J. G., Oddie, C.J., and Whipp, G.T. (1975). The ontogeny and regulation of corticosteroid secretion by the ovine foetal adrenal. Acta Endocrinol. (Copenh) 79, 301 316. Wood, C.E. (1988). Insensitivity of near term fetal sheep to cortisol: possible relation t o the control of parturition. Endocrinology 122, 1565 1572. Zipser, R.D., LeBoff, M., Meidar, V., Duke, R., and Horton, R. (1980). Deoxycorticosterone and aldosterone clearance and binding in normal and hypertensive man. J. Clin. Endocrinol. Metab. 51, 10 85 1088.

PAGE 85

85 BIOGRAPHICAL SKETCH Jarret McCartney was born in Morgantown, West Virginia in 1982, the youngest of three boys and the son of Stephanie McCartney King and Fred McCartney. He moved to Port Charlotte, Florida at the age of five where he attended p ublic school and graduated from Port Charlotte High School in 2000. Afterwards, Jarret received an A ssociate of A rts degree from Edison State College in 2002 and proceeded to attend the University of South Florida. At the University of South Florida, Jarre t received his B achelor of A rts degree with a major in chemistry with e mphasi s for health p rofessions in 2005. Afterwards Jarret was employed in the laboratory of Dr. Maureen Keller Wood as a veterinary technician. After developing an interest in fetal ph ysiology, Jarret enrolled in the University of Florida, College of Medicine, Medical Sciences M aster of S cience graduate program in August 2008. His thesis work was completed with Dr. Maureen Keller Wood in the department of pharmacodynamics and focused on the effects of mineralocorticoid and glucocorticoid agonists on fetal lung development. Jarret plans to live in Charlotte, North Carolina and pursue a career in scientific research.