<%BANNER%>

Porphyromonas gingivalis Inhibits Mitochondrion-Induced Apoptosis through Akt Pathway

Permanent Link: http://ufdc.ufl.edu/UFE0041799/00001

Material Information

Title: Porphyromonas gingivalis Inhibits Mitochondrion-Induced Apoptosis through Akt Pathway
Physical Description: 1 online resource (49 p.)
Language: english
Creator: Jermanus, Caroline
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: akt, apoptosis, epithelial, pgingivalis
Dentistry -- Dissertations, Academic -- UF
Genre: Dental Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Periodontal disease affects the supporting structures surrounding teeth in the oral cavity. Periodontal diseases are polymicrobial chronic infections of multifactorial etiology. Bacteria in the dental plaque colonizing human dentition are recognized as the primary etiologic agent in periodontal disease. Host susceptibility greatly modifies disease expression including the extent and severity of the disease. Chronic periodontitis is the most common type of periodontal disease treated today. Bacteria categorized in Socransky?s red complex; P. gingivalis, B. forsythus, and T. denticola are identified as the major pathogenic in chronic periodontal disease. Of the three pathogens, P. gingivalis has been widely associated with adult chronic forms of periodontal disease probably due to its ability to invade primary gingival epithelial cells (GECs) and modulate immune responses, local and systemic. Gingival epithelium is one of our first defense mechanisms against bacterial invasion. P. gingivalis can replicate and survive undetected inside GECs for extended periods, contributing to host tissue destruction. This capability is possibly due to the large number of virulence factors P. gingivalis produces, which affect multiple intra-cellular pathways. In addition,P. gingivalis-infected GECs are protected from mitochondrion dependent apoptosis, partially through activation of the Phosphotidylinsitol 3 kinase (PI3K)/Akt signaling pathway. Biochemical events associated with P. gingivalis-induced inhibition of apoptosis include blocking of mitochondrial membrane permeability and cytochrome-c release. The Akt signaling pathways were investigated during P. gingivalis infection along with other key mitochondrial molecules downstream from Akt, including pro-apoptotic Bad. We demonstrated that P. gingivalis infection caused significant phosphorylation of Bad, while mRNA levels for Bad slowly decreased. P. gingivalis infection resulted in the translocation of the mitochondria-associated protein (Bad) in the cytosol as seen with fluorescence microscopy. P. gingivalis lost the ability to induce phosphorylation and translocation of Bad in Akt-deficient GECs. Thus, P. gingivalis inactivates pro-apoptotic Bad by phosphorylation through Akt. In summary, our findings suggest that Akt is a key modulator of anti-apoptotic pathways activated by P. gingivalis. P. gingivalis utilizes multiple mitochondrial pathways to prevent gingival epithelial cells from cell death and secures its persistence in primary GECs
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Caroline Jermanus.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Yilmaz, Ozlem.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041799:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041799/00001

Material Information

Title: Porphyromonas gingivalis Inhibits Mitochondrion-Induced Apoptosis through Akt Pathway
Physical Description: 1 online resource (49 p.)
Language: english
Creator: Jermanus, Caroline
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: akt, apoptosis, epithelial, pgingivalis
Dentistry -- Dissertations, Academic -- UF
Genre: Dental Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Periodontal disease affects the supporting structures surrounding teeth in the oral cavity. Periodontal diseases are polymicrobial chronic infections of multifactorial etiology. Bacteria in the dental plaque colonizing human dentition are recognized as the primary etiologic agent in periodontal disease. Host susceptibility greatly modifies disease expression including the extent and severity of the disease. Chronic periodontitis is the most common type of periodontal disease treated today. Bacteria categorized in Socransky?s red complex; P. gingivalis, B. forsythus, and T. denticola are identified as the major pathogenic in chronic periodontal disease. Of the three pathogens, P. gingivalis has been widely associated with adult chronic forms of periodontal disease probably due to its ability to invade primary gingival epithelial cells (GECs) and modulate immune responses, local and systemic. Gingival epithelium is one of our first defense mechanisms against bacterial invasion. P. gingivalis can replicate and survive undetected inside GECs for extended periods, contributing to host tissue destruction. This capability is possibly due to the large number of virulence factors P. gingivalis produces, which affect multiple intra-cellular pathways. In addition,P. gingivalis-infected GECs are protected from mitochondrion dependent apoptosis, partially through activation of the Phosphotidylinsitol 3 kinase (PI3K)/Akt signaling pathway. Biochemical events associated with P. gingivalis-induced inhibition of apoptosis include blocking of mitochondrial membrane permeability and cytochrome-c release. The Akt signaling pathways were investigated during P. gingivalis infection along with other key mitochondrial molecules downstream from Akt, including pro-apoptotic Bad. We demonstrated that P. gingivalis infection caused significant phosphorylation of Bad, while mRNA levels for Bad slowly decreased. P. gingivalis infection resulted in the translocation of the mitochondria-associated protein (Bad) in the cytosol as seen with fluorescence microscopy. P. gingivalis lost the ability to induce phosphorylation and translocation of Bad in Akt-deficient GECs. Thus, P. gingivalis inactivates pro-apoptotic Bad by phosphorylation through Akt. In summary, our findings suggest that Akt is a key modulator of anti-apoptotic pathways activated by P. gingivalis. P. gingivalis utilizes multiple mitochondrial pathways to prevent gingival epithelial cells from cell death and secures its persistence in primary GECs
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Caroline Jermanus.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Yilmaz, Ozlem.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041799:00001


This item has the following downloads:


Full Text

PAGE 1

1 Porphyromonas gingivalis INHIBITS MITOCHONDRI ON INDUCED APOPTOSIS THROUGH AKT PATHWAY By CAROLINE JERMANUS A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Caroline Jermanus

PAGE 3

3 To my parents

PAGE 4

4 ACKNOWLEDGMENTS I thank my mentor and dear friend Dr. Yilmaz for her endless support throughout my residency. I also thank Dr. Koutouzis for his contribution to my education and outstanding commitment to our profession.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 TABLE OF CONTENTS .................................................................................................. 5 LIST OF FIGURES .......................................................................................................... 6 LIST OF ABBREVIATIONS ............................................................................................. 7 ABSTRACT ..................................................................................................................... 8 CHAPTER 1 INTRO DUCTION ..................................................................................................... 10 2 MATERIALS AND METHODS ................................................................................. 19 Bacteria and Cell Cul ture ........................................................................................ 19 Infection of Cells with P. gingivalis and Treatment with .......................................... 19 Staurosporine, and PI3K Inhibitor ........................................................................ 19 Analysis of Apoptosis by Annexin V and Propidium Iodide Staining ....................... 20 Depletion of Akt by RNA Interference ..................................................................... 21 Confirmation of Akt Knockdown by WesternImmunoblotting ................................. 21 Assay of Bad Activation by Immunoprecipitation .................................................... 22 Bad Localization Assay by Fluorescence Microscopy ............................................ 23 Real Time Quantitative PCR ................................................................................... 23 3 RESULTS ................................................................................................................ 25 P. gingivalis Induced Protection of GECs Against Cell Death is Reversed ............. 25 with the Depletion of Akt by siRNA Technology ...................................................... 25 Pro Apoptotic Bad Phosphorylation in P. gingivalis Infected GECs is .................... 26 Mediated by Akt ...................................................................................................... 26 Ef fect of P. gingivalis Infection on mRNA Levels of ProApoptotic Bad .................. 28 P. gingivalis Infection Sequesters Bad in Cytosol of GECs Through Akt ................ 28 4 DISCUSSION .......................................................................................................... 36 LIST OF REFERENCES ............................................................................................... 43 BIOGRAPHICAL SKETCH ............................................................................................ 49

PAGE 6

6 LIST OF FIGURES Figure page 1 1 Periodontitis affected human dentitionProperty of the University of Florida. ....... 16 1 2 Microbial complexes, Adapted from Socransky et al. 1998 .................................... 17 1 3 P. gingivalis scanning electron microscopy by O. Yilmaz ....................................... 17 1 4 Threedimentional confocal scanning flurescence microscopy showing a 24hour infected primary GEC ................................................................................. 18 3 1 Knockdown of Akt by siRNA in primary GECs. ...................................................... 29 3 2 Quantitative analysis of cell death by AnnexinV and Propidi um iodide (PI). ........ 30 3 3 P. gingivalis infection induces a large gradual increase in Bad phosphorylation. .. 34 3 4 Bad mRNA levels slowly decreased by P. gingivalis infection .............................. 34 3 5 P gingivalis infection redistribut es Bad localization in primar y GECs through Akt ...................................................................................................................... 35 4 1 The mechanisms for primary GECs protection against cell death induced by P. gingivalis infection .............................................................................................. 42

PAGE 7

7 LIST OF ABBREVIATIONS P. gingivalis P orphyromonas gingivalis B. forsythus Bacteriodes forsythus T. denticola Tannerella denticola GECs Gingival epithelial cells PI3 kinase Phosphoinositide 3 kinase B ad Mitochondrionassociated protein, a Bcl 2 family prot ein F. nucleatum Fusobacterium nucleatum mRNA massenger RNA siRNA short interfering RNA Ser Serine STS Staurosporine Cas 9 Caspase9 BCA Bicinchoninic acid

PAGE 8

8 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science Porphyromonas gingivalis INHIBITS MITOCHONDRI ON INDUCED APOPTOSIS THROUGH AKT PATHWAY By Caroli ne Jermanus May 2010 Chair: Ozlem Yilmaz Major: Dental S ciences Periodontics Periodontal disease affects the supporting structures surrounding teeth in the oral cavity. Periodontal diseases are polymicrobial chronic infections of mult ifactorial etiology. Bacteria in the dental plaque colonizing human dentition are recognized as the primary etiologic agent in periodontal disease. Host susceptibility greatly modifies disease expression including the extent and severity of the disease. Chronic periodontitis is the most common type of periodontal disease treated today. Bacteria categorized in Socranskys red complex; P. gingivalis, B. forsythus, and T. denticola are identified as the major pathogenic in chronic periodontal disease. Of t he three pathogens P. gingivalis has been widely associated with adult chronic forms of periodontal disease probably due to its ability to invade primary gingival epithelial cells (GECs) and modulate immune responses, local and systemic. Gingival epitheli um is one of our first defense mechanisms against bacterial invasion. P. gingivalis can replicate and survive undetected inside GECs for extended periods, contributing to host tissue destruction. This capability is possibly due to the large number of virul ence

PAGE 9

9 factors P. gingivalis produces, which affect multiple intra cellular pathway s. In addition, P. gingivalis infected GECs are protected from mitochondrion dependent apoptosis, partially through activation of the Phosphotidylinsitol 3 kinase (PI3K)/Akt si gnaling pathway. Biochemical events associated with P. gingivalis induced inhibition of apoptosis include blocking of mitochondrial membrane permeability and cytochrome-c release. The Akt signaling pathways were investigated during P. gingivalis infection along with other key mitochondrial molecules downstream from Akt, including proapoptotic Bad. We demonstrated that P. g ingivalis infection caused significant phosphorylation of B ad, while mRNA levels for Bad slowly decreased. P. gingivalis infection resulted in the translocation of the mitochondriaassociated protein ( B ad) in the cytosol as seen with fluorescence microscopy. P. gingivalis lost the ability to induce phosphorylation and translocation of Bad in Akt deficient GECs. Thus, P. gingivalis inactiv ates proapoptotic B ad by phosphorylation through Akt. In summary, our findings suggest that Akt is a key modulator of anti apoptotic pathways activated by P. gingivalis. P. gingivalis utilizes multiple mitochondrial pathways to prevent gingival epithelial cells from cell death and secures its persistence in primary GECs.

PAGE 10

10 CHAPTER 1 INTRODUCTION Periodontal diseases are infections of multi factorial etiology which affect the human dentition and ultimately lead to tooth loss (Machtei et al. 1999, Grossi et al. 1994; Grossi et al. 1995). Chronic periodontal disease is the most common of periodontal diseases treated today (Albandar et al. 1999). Many risk factors have been implemented in the etiology of chronic periodontitis including plaque control, smoking and age ( Beck et al. 1992; Grossi et al. 1995, Grossi et al. 1994; Haffajje & Socransky, 1994; Haffajje & Socransky, 2000) It is established today that bacteria colonizing tooth surfaces in the dental biofilm are the c ausative agents (Beck et al. 1992, Socranksy et al. 1998) (Figure 11 ). However factors such as host susceptibility and host exposure to environmental and systemic factors such as smoking socioeconomic status and diabetes can greatly modify expression of such infections (Seppala et al., 1993, Grossi et al., 1995, Axelsson et al., 1998, Haffajee & Socransky, 2000). Bacteria in the dental biofilm have been investigated over the past fifty years to identify key species involved in peri odontal disease (Listgarten, 1976; Listgarten, 1988; Listgarten, 1999). Several bacterial species in the subgingival microflora (Figure 1 2 ) are recognized today in the pathogenesis of chronic periodontit is, (Haffajee & Socrasnky, 1994; Socransky et al., 1998). Along with the complexity of such bacterial organization, an order of bacterial adhesion, colonization and maturation are found in the periodontal pocket. Microbiological analyses of subgingival plaque consistently show gram negative bacteria adjacent to the epitheli al lining of the pocket (Liakoni et al., 1987). Subgingival bacterial complexes were first characterized by Socransky and coworkers in 1998

PAGE 11

11 (F igure 1 2). They used DNA probes from forty bacterial species frequently isolated from the oral cavity to identify species from periodontally diseased sites. Cluster and community ordination analyses were performed in attempt to characterize the complex relationships amongst bacteria in the subgingival biofilm. Therefore the so called red complex bacteria, P. gingivalis, B. forsythus and T. denticola were found to be associated with increased pocket depth probing and are recognized today as the causative agents in periodontal disease ( Socransky et al., 1998). The intricate interactions of these species with others that colonize the periodontal pocket have been greatly investigated to shed light on the mechanism of action leading to periodontal tissue destruction and possible treatment modalities. Of Socranskys red complex bacteria, P. gingivalis has been isolated from severely diseased but also healthy patients (Lamont & Yilmaz, 2002; R udney et al., 2005). P. gingivalis has also been recently implicated in cardiovascular disease and preterm birth ( Beck et al., 1996, Herzberg and Weyer 1998, Offenbacher, 2004; Offenbacher et al. 2006, Stein et al., 2009). Extensive research has been conducted in the pathogenesis of P. gingivalis The structure of P. gingivalis is shown using scanning electron microscopy (Figure13) The mechanism of such pathogenesis is directly related to the multiple virulence factors this organism utilizes, including extracellular proteases such as gingipains (Sheets et al 2008, Curtis et al., 2005), endotoxins such as lipopolysaccharide (LPS)(Darveau et al. 1998), other adhesion proteins that modulate the hosts immunologic and inflammatory responses( Lamont Jenkinson, 2000; Tribble et al 2006).

PAGE 12

12 All of the above factors seem to allow for successful invasion and subsequent alterations of the host cells by P. gingivalis without t he expected immune response. It has been shown that P. gingivalis can down regulate the secretion of an important pro inflammatory chemokine, interleukin8 (IL 8) transcriptionally and post translation, even in the presence of another proinflammatory bac terium such as F. nucleatum (Darveau et al., 1998, Huang et al., 1998; Huang et al., 2001). IL 8 is responsible for attracting neutrophils to the site of an infection. The inhibition of production of IL8 at infection sites would have a detrimental effect at the bacteriaepithelium interface (Lamont & Yilmaz, 2002). It has been shown that P. gingivalis can invade and replicate inside human gingival epithelial cells surviving for extended periods of time (Lamont et al., 1995; Belton et al 1999; Yilmaz et al., 2006). In addition, P. gingivalis has been shown to affect multiple signaling pathways intracellularly such as the activation of an integrinassociated pathway leading to actin cytoskeletal rearrangements within epithelial cells (Darveau et al., 1998; Zhang et al., 2005; Yilmaz, 2008). These cytoskeletal arrangement s appear to be the primary mediators for the bacterial internalization into GECs, after which p. gingivalis replicates rapidly in the cytoplasm of GECs, in the peri nuclear region (Belton et al 1999, Lamont et al., 1995) The adhesion of P. gingivalis to primary GECs and subsequent invasion is mainly mediated by the binding of major fimbriae to an integrin receptor and activation of a putative integrin signaling proteins FAK (focal a dhesion kinase) and paxillin with simultaneous remodeling of the actin cytoskeleton (Yilmaz et al 2002; Yilmaz et al 2003). S everal studies by using transformed nonoral epithelial cell lines such as HEp2 also verified that the bacterial fimbriae 1 integrin receptor s in volvement with the cell lipid membrane rafts could

PAGE 13

13 lead to the activation of the actin cytoskeleton reorganization, thereby providing P. gingivalis to internalize host cells ( Tsuda et al 2005). Subsequently, a number of studi es have been published regarding P. gingivaliss survival intra celluarly, its ability to maintain viability for extended periods of time in primary GECs, and spread from cell to cell through actinbased membrane projections later in the infection (Yilmaz et al. 2006; Yilmaz, 2008) Infected GECs harboring large numbers of intracellular P. gingivalis do not undergo apoptotic or necrotic death. A large body of in vitro evidence indicated that P. gingivalis infection induces an anti apoptotic phenotype in primary GECs by rendering the host cells resistant to cell death from various potent proapoptotic agents including staurosporine, camptothecin, and extracellular ATP (Yilmaz et al. 2008a; Mao et al. 2007; Yilmaz et al. 2004; Nakhjiri et al. 2001). I n the same way, different studies examining the healthy human buccal epithelial cells for the identification of intra cellular bacteria found high levels of P.gingivalis in each sample (Rudney et al. 2005) Interestingly, a further study by Rudney et al. analyzed the oral epithelial samples collected from healthy subjects f or viability using both markers of cell membrane integrity and metabolic activity which indicated no significant level of apoptosis or necrosis in those heavily bacteria invaded epithelia ( Rudney & Chen, 2006) These in vivo studies provided logical results to the previously reported in vitro research on P. gingivalis interaction with primary gingival epithelial cells. However the contribution made by other intra cellula r bacteria in shaping the overall status of the oral epithelium needs to be considered. It has also been shown that P gingivalis infected GECs undergo successful mitosis and that infection with P. gingivalis accelerates the host cell cycle progression

PAGE 14

14 (Kuboniwa et al. 2008) ( Figure 14) This organism impacts multiple anti apoptoti c and survival host pathways and can prevent host cell death by partially blocking mitochondriadepen dent apoptosis. Gingival epithelial cells have also been shown to express the functional purinergic receptor P2X7, which is involved in ac tivating programmed cell death ( apoptosis) by binding to extracellular ATP (Yilmaz et al., 2008). Infection with P. gingivalis has demonstrated this organisms ability to consume the extra celluar ATP that is released from the infected cells to induce apoptosis and therefore inhibiting an apoptotic signal. The intrinsic anti apoptotic mechanism include the inhibition of mitochondrial membrane depolarization and cytochrome-c release, upregulation of the anti apoptotic protein of the Bcl2 family also named Bcl 2 and downregulation of proapoptotic member B ax of the same family of proteins in addition to the inhibition of caspase3 activation through dual JAK/Stat and Akt signaling (Mao et al. 2007; Yilmaz et al. 2004; Nakhjiri et al. 2001). Furthermore, P. gingivalis infection upregulates an important cyclin; PI3 kinase/Akt pathway in primary gingival epithelial cel ls. A specific PI3 kinase inhibitor, LY294002, substantially diminishes the infecte d cells resistance to staurosporinestimulated apoptosis P. gingivaliss phosphorylation of Akt during the infection promotes a strong anti apoptotic effect resulting in loss of mitochondrial membrane potential, cytochrome-c release, and DNA fragmentation (Yilmaz et al. 2004). Another important family of apoptosis related family of proteins the Bcl2 family has been shown to strictly control mitochondrial function in m ammalian cells (Cosulich et al. 1999; Chao and Korsmeyer, 1998). One of the important members of the Bcl2 family of proteins is Bad. Bad is a proapoptotic protein that mediates mitochondrial release of cytochrome-C inducing apoptotic death. These pro-

PAGE 15

15 a poptotic activities of Bad have been shown downregulated through phosphorylation by Akt kinase (Chen et al. 2005; Datta et al. 1999). Thus, Akt can partially modulate mitochondriaassociated cell death along with key mitochondrial molecules. Bacteria in duced epithelial apoptosis can be regarded as a mechanism the host utilizes to inhibit bacterial infection. However, some bacteria may still be able to propagate to surrounding tissues through apoptotic bodies released from the dead epithelial cells. For example, Pseudomonas aeruginosa causes excessive apoptosis to disseminate infection ( reviewed in Finlay et al 1989). On the other hand, bacterial inhibition of apoptosis can provide a safe haven for bacterial proliferation and make intracellular pathogens invisible to the immune system. Salmonella, Shigella, Mycobacterium tuberculosis some Chlamydia and Neisseria species appear to delay or inhibit apoptosis in epithelial cells (Finlay et al ., 1989; Zychlinsky et al 1992; Monack et al., 1996; Knodler et al., 2001, Verbeke et al 2006) preventing cell death. Similarly, successful persistent oral bacterium, P. gingivalis appears to use the latter strategy. The se interactions between bacteria and epithelial cells are highly dynamic and result in complex responses. Thus, the modulation of epithelial apoptosis by bacterial pathogens is common theme and may have significant repercussions on ultimate status of epithelium and its functions including impaired immune response and imbalance in cellular homeostasi s Understanding the effects of P.gingivalis infection on inhibition of apoptosis in primary GECs and the molecular aspects associated with this process could add considerably to our knowledge of the fates of the infected GECs and the intracellular P. gin givalis besides mechanisms of host injury. Knowledge of these diverse mechanisms could aid

PAGE 16

16 in the production of more targeted treatment modalities to control P .gingivalis associated periodontal disease. W e propose anti apoptotic Akt signaling pathway along with other associated key molecules (Bad) can contribute the ability of P. gingivalis to modulate GEC apoptosis to avoid host cell defense and intracellular killing, thereby further disseminating the infection. Thus, the overall hypothesis to be addr essed is that Akt signaling is likely to have functional significance on P. gingivalis mediated survival of primary GECs and P. gingivalis association with some key mitochondrial molecules including Bad through Akt may modulate apoptotic cell death. The aims of this study are designed to determine the functional importance of Akt during P. gingivalis infection by using RNA interference technology, and to characterize the role of proapoptotic Bad in this interaction. Figure 11 Periodontitis affected human dentitionProperty of the University of Florida.

PAGE 17

17 Figure 1 2 Microbial complexes, Adapted from Socransky et al. 1998 Figure 13 P. gingivalis scanning electron microscopy by O. Yilmaz Actinomyces speceis V. parvula A. odontolyticus S. mitis S. sanguis S.oralis Strep species E. corrodens C. gingivalis C rectus F. nucleatum P intermedia P micros E..nudatum P. gingivalis B. forsythus T. denticola N= 185 N samples 13,261 Cluster analysis

PAGE 18

18 Figure 14. Threedimentional confocal scanning flurescence microscopy showing a 24hour infected primary GEC (actin, red; nuclei, blue) with high numbers of intracellular P. gingivalis (green) undergoing successful mitosis, adapted from Microbiology, Yilmaz.2008.

PAGE 19

19 CHAPTER 2 MATERIALS AND METHODS Bacteria and C ell C ulture P. gingivalis ATCC 33277 was cultured anaerobically for 24 hours at 37C in trypticase soy broth supplemented with yeast extract (1 ug/ ml), haemin (5 ug/ ml) and menadione (1 ug/ ml). Bacteria were grown for 24 hrs, harvested by centrifugation at 6000 g and 4C for 10 min, washed twice, and resuspended in Dulbeccos Phos phatebuffered saline (PBS), pH 7.3, before incubation with host cells. Bacteria were quantified using a Klett Summerson photometer. Primary GECs were obtained after oral surgery in the clinics of University of Florida from healthy gingival tissue as previ ously described (Lamont et al. 1995). Cells were cultured as monolayers in serum free keratinocyte growth medium (KGM) (Lonza, Walkersville, MD ) at 37C in 5% CO2. GECs were used for experimentation at 80% confluence and cultured for 48 hours before infection with bacterial cells or exposure to other test reagents in KGM. Infection of C ells with P. gingivalis and Treatment with S taurosporine, and PI3K I nhibitor Gingival epi thelial cells were infected at a multiplicity of infection of 100 with P. gingivalis 33277 for 30 minutes, 60 minutes, 2, 6, 12, and 24 hours at 37 C, in a CO2 incubator. All time points for the infections were carried out backwards; i.e., instead of beginning all infections at the same time, infections were initiated at the indicated times before time zero so that all incubations could be stopped at the same time. For induction of apoptosis studies, GECs were treated with a potent apoptotic inducer, staurosporine (STS), 2 uM or 4 uM (Sigma, St. Louise, MO), for 3 hours after 21 hours infections with or without the bacteria. Additionally, after 3 hours infection with P.

PAGE 20

20 gingivalis 33277, GECs were treated with the PI3 kinase inhibitor, LY294002 (LY), 20 um (Sigma), for 18 hours (3 hours post infection) prior to the 3 hours STS treatment. All treatments were performed in GEC culture media at 37 C in the CO2 incubator. Analysis of A poptosis by A nnexinV and P ropidium I odide S taining Early apoptotic changes were identified by using fluorescein isothiocyanate (FITC) conjugated AnnexinV fluos (green fluorescence) (Roche Applied Science, Indianapolis, IN ), which binds to phosphatidylserine (PS) a molecule exposed on the outer leaflet of apoptoti c cell membranes. Propidium iodide (PI) (red fluorescence) (Sigma) was used for the discrimination of necrotic cells from the AnnexinV positively stained cells. Briefly, GECs were grown on 4well chambered slides (Nalge Nunc International Rochester, NY ), infected with P. gingivalis for 24 hours and incubated with various agents as described above. The slides were washed with ice cold PBS and immediately treated with 100 ul AnnexinV Fluos binding solution containing 10 ul AnnexinV Fluos labeling reagent per 1000 ul H EPES buffer (10 mM HEPES/ NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) and 1 mg/ml PI. After 15 min incubation in the dark at room temperature, the slides were washed with ice cold PBS and fixed in 10 % neutral buffered formalin for 20 min. Slides w ere mounted in Vectashield Mounting Medium (Vector Laboratories Burlingame, CA) containing 4, 6diamidino phenylindole (DAPI) for nuclear staining and examined using a fluorescence microscope (Zeiss Axio imager A1) equipped with band pass optical filter sets appropriate for imaging of dyes. The images were captured with a cooled CCD camera (Qimaging, Surray, Canada) controlled by Q capture software. Cells that were untreated and incubated in the binding buffer with AnnexinV and PI or only with AnnexinV or PI separately served as controls for determining the threshold of fluorescence intensity. Cells that were treated with only

PAGE 21

21 STS or ethanol served as positive staining for AnnexinV and PI respectively. Approximately 1000 cells per condition from 3 separ ate experiments were analyzed to determine the percentage of cells positively stained for AnnexinV and PI. The same microscopy settings were employed throughout all experiments. Depletion of Akt by RNA I nterference Primary cultures of GECs at 50% confluence were transfected in GECs growth media using 100 nM of siRNA duplexes in 5 ul siRNA Akt DharmaFECT1 agent (Dharmacon, Lafayette, CO ). Briefly, 5 ul transfection agent was added drop wise into 195 ul of GEC growth media and the incubation was performed for 10 min at room temp erature. 100 nM siRNA Akt sequences (Dharmacon) were added to diluted transfection agent, mixed gently, and incubated for 10 min at room temperature. Finally, 50 ml of this mixture was added to each well, the plate was rocked gently, and further incubated for 48 hrs at 37 C 5% CO2 Non target pool siRNA (Dharmacon) and transfection agent alone were used as negative controls. Confirmation of Akt K nockdown by WesternImmunoblott ing Westernblot analysis was performed up to 48 hours post transfection using equal amount of protein in each sample determined by a bicinchoninic acid (BCA) protein assay (Pierce Biotechnology Rockford, IL ) and the samples were subjected to 10% sodium dodeocyl sulfatepolyacrylamide ( SDSPAGE) gel electrophoresis. Proteins were blotted onto nitrocellulose membrane, blocked in 5% dried milk solution diluted in Tris buffered saline containing 0.01% Tween 20 (TBS/T), incubated with Akt (1/2/3) antibody at a dilution of 1:2000 (Cell Signaling, Danvers, MA ) and treated with horseradish peroxidase( HRP) conjugated secondary antibody at 1:5000 (Cell Signaling). The blot was then stripped and probed with anti B actin antibody 1:1000

PAGE 22

22 and HRP conjugated sec ondary antibody (Cell signaling) at 1:2000 used as control. Results were visualized using an enhanced chemiluminescence detection kit (Amersham Biosciences Piscataway, NJ ). Densitometry scanning was quantified using NIHI mage J analysis (Bethesda, MD) The knockdown experiments were repeated at least 3 separate times. Assay of Bad A ctivation by I mmunoprecipitation Gingival epithelial cells were infected with P. gingivalis 33277 for 6, 12, or 24 hours. Cells were washed twice with cold PBS and solubilized in lysis buffer (50 mM Tris HCI pH 7.2, 150 mM NaCl, 1% Triton X 100, 0.5% sodium deoxycholate, 1 mM EDTA with phosphatase inhibitor and protease cocktail inhibitor (Sigma). Lysates were clarified by centrifugation at 10000 g for 15 min at 4 C and protein concentration was determined by the BCA protein assay (Pierce Company). Bad was precipitated from the cell lysates with anti Bad specific antibody (Cell Signaling) overnight at 4C with 1:50 dilution. The proteinantibody complexes were collected with Protein A Sepharose beads at 1:10 by volume and washed three times with lysis buffer. Samples were boiled in 12% SDSPAGE sample buffer and transferred to nitrocellulose membranes. Ser136 phosphorylation of Bad was assessed by reacting at 4C overnight with a 1:500 dilution of specific anti phospho Bad antibody to the Ser136 (Cell Signaling) followed by a 1:2000 dilution of HRP conjugated secondary antibody (Cell Signaling). Results were v isualized by the enhanced chemi lumin escence detection system (Amersham Pharmacia), analyzed by scanning densitometry and quantified using NIH Image J. Blots were then stripped and reprobed with a 1:1000 dilution of anti Bad and 1:2000 dilution of HRP conjugated secondary antibody (Cell Sign aling) to determine total Bad in the samples.

PAGE 23

23 Bad L ocalization A ssay by F luorescence M icroscopy Gingival epithelial cells were grown on 4 well chambered slides (NalgeNunc International), washed with ice cold PBS, and fi xed in 10% neutral buffered formalin for 20 min. The cells were permeabilized for 10 min with 0.1% Triton X 100 at 4C and the same slides incubated with anti Bad monoclonal antibody 1:50 (Santa Cruz) and anti P. gingivalis 33277 rabbit polyclonal antibody at 1:1000 in PBS containing 0.1 % Tween and 3 % BSA for one hour. After washing with PBS twice, samples were stained with Oregon Green 488 goat anti mouse secondary antibody and AlexaFluor 594 anti rabbit secondary antibody respectively for one hour at r oom temperature (Invitrogen, Carlsbad, CA ). Samples with no primary antibody incubation were included as control. Slides were mounted in Vectashield Mounting Medium (Vector Laboratories) containing 4,6 diamidino2 phenylindole (DAPI) for nuclear staining and examined using a fluorescence microscope (Zeiss Axio imager A1) as described previously (Yilmaz et al. 2006). The images were captured by multiple exposures using a cooled CCD camera controlled by Qcapture software. The images are representative of 100 cells studied per sample from at least two separate experiments performed. Real T ime Q uantitative PCR Total RNA was isolated from triplicate independent control and P. gingivalis infected GECs using R Neasy Mini Kit (Qiagen Germantown, MD ). The genomic DNA was removed by DNase 1 treatment (Ambion, Austin, TX). Total RNA (1 u g) from each sample was reverse transcribed using M MLV reverse transcriptase (Promega, Madison, WI ). Real time quantitative PCR was conducted in triplicate for each cDNA sample with the iCycler iQ real time PCR detection system using iQTM SYBR Green Supermix (Bio Rad Hercules, CA). Two microliters template cDNA was added to final

PAGE 24

24 volume of 25 ul with 1XSYBR Green Supermix and 1ul (20 um) of the following primer pairs: Bad Forward: 5 GGGCACAGCAACGCAGATG 3 Reverse: 5 TGGGAACGGGTGGAGTTTCG3 18s rRNA Forward: 5 CGCCGCTAGAGGTGAAATTC3 Reverse: 5 TCTTGGCAAATGCTTTCGCT3 The sequence 18s rRNA was used as an endogenous control. Real time results were analyzed using I Cycler iQ Optical System software (Bio Rad). The melt curve profile was analyzed to verify a single peak for each sample, indicating primer specificity. Preparation of standards: Specific DNA products for each gene u nder investigation were synthesized from chromosomal DNA using standard PCR methods and visualized by gel electrophoresis to verify that a single specific product had been generated. Each product was purified using the QIAquick PCR Purification Kit (Qiagen), and quantified using the GeneQuant spectrophotometer. DNA product copy number was calculated using the formula (Yin et al. 2001): Copies /u l = Starting Quantity (SQ) = {( 6.023 x 1023 x [DNA] g / ml )/ molecular weight of product (basepairs ) } x1000 A 10 fold dilution series of each DNA standard was prepared for starting quantities of 108 to 1010 copies / ml. These were used at least in duplicate in each Real time PCR assay to allow the Real time PCR software to estimate SQ of that gene in cDNA samples.

PAGE 25

25 C HAPTER 3 RESULTS P. gingivalisInduced P rotection of GECs A gainst C ell D eath is R eversed with the D epletion of Akt by siRNA T echnology Akt signaling pathway is essential in the protection of cells from a var iety of severe stresses that may develop during infection by intracellular pathogens ( Datta et al 1999; Verbeke et al. 2006). Form our previous investigations (Yilmaz et al 2004) the pharmacological inhibition and phosphorylation assays revealed a pot entially important role for Akt pathway in P. gingivalis induced protection against cell death by exogenous apoptotic stimuli targeting mitochondria, such as STS). Therefore, we further examined the involvement of Akt in this process by RNA interference. Forty eight hours after transfection with short interfering Akt RNA, about 85% of the protein levels of Akt were reduced in primary GECs as determined by Western blotting ( Fig ure. 3 1 ). We confirmed that Akt siRNA by itself did not induce apoptosis of uninfected cells, and Akt deficient cells had infection levels comparable to siRNA untreated cells demonstrating that Akt deficiency did not affect the internalization capability of P. gingivalis (not shown). We first measured 24 hours infected and uninfect ed GECs treated with the various concentrations (2mM and 4mM) of the apoptosis inducer, STS for 3 hours and analyzed cell death by immunefluorescence microscopy using AnnexinV PI doublestaining ( Figure. 32A and B ). In addition, we utilized LY294002 (20 mM), a specific inhibitor of PI3 kinase, an immediate upstream mediator of Akt as we described previously (Yilmaz et al. 2004). Following treatment with LY294002, the infected and uninfected GECs were incubated with the varying concentrations of STS ( Fig ure. 3 2 A ). Simultaneously, we measured the cell death in the Akt deficient cells. The GECs were

PAGE 26

26 first transfected with Akt siRNA, infected with P. gingivalis and then treated with STS and/or LY294002 similar to the treatment of normal cells ( Fig ure. 3 2 C and D ). Consistent with previous findings (Yilmaz et al. 2004) P. gingivalis did not promote cell death. Approximately 83% and 74% of normal cells that were infected with P. gingivalis and treated with 2 mM or 4 mM STS, respectively, were resistant to apoptosis, while 45% and 53% of normal cells without infection became severely apoptotic in a concentrationdependent manner following treatment with 2mM or 4 mM STS ( Fig ure. 3 2A ). In the absence of Akt, the level of apoptosis in the infected cells and the cells infected and treated with STS displayed 3 to 4fold increases. These results were statistically significant ( P value < 0.05 and P value < 0.01 respectively) by students t test (Fig ure 3 2C and D ). Treatment of both normal GECs and the Akt defici ent cells with LY294002 without infection and STS did not induce any significant level of apoptosis (not shown). In addition, the treatment of the infected deficient cells with PI3 kinase specific inhibitor followed by STS treatment did not cause further i ncrease in the level of apoptosis proposing a specific role for Akt ( Fig ure. 32C and D ) as LY294002 will also inhibit PI3 kinase and downstream pathways parallel to Akt, Hence, these results suggest that Akt plays a critical role in P. gingivalis mediat ed protection against mitochondriondependent cell death in primary GECs as knockdown of Akt by siRNA significantly inhibits the anti apototic phenotype of primary GECs cells activated during infection with P. gingivalis Pro A poptotic Bad P hosphorylation in P. gingivalisI nfected GECs is Mediated by Akt In a previous investigation (Yilmaz et al. 2004) it was shown P. gingivalis infection results in phosphorylation and subsequent activation of Akt. It has been

PAGE 27

27 demonstrated that Akt promotes cell survival through its capability to phosphorylate Bad at the amino acid Serine, specifically and predominantly Ser136 ( Seo et al. 2004; Yilmaz et al. 2004; Datta et al. 1997). Phosphorylated Bad dissociates from a heterodimeric complex formed with anti apoptotic Bcl 2 and BclxL proteins, thereby, increasing anti apoptotic effects of the Bcl 2 family. In light of our new results, we investigated next whether activated Akt can phosphorylate proapoptotic Bad. We thus measured phosphorylation from the samples immunoprecipitated with specific Bad antibody over the course of infection in normal versus Akt deficient GECs by immunoblots using antibodies against a phosphorylation site of Bad Ser136 residue. We found that phosphorylation of Bad noticeably increased (1.6fold) at 6 hours infection, raised to more than 3fold at 12 hrs and peaked to ~4.5fold after a 24 hours infection in the ratio of phosphorylated: total Bad determined by dens itometry analysis of Western blotting products ( Fig ure.33A and B ). There was no change detected at 2 hrs infection (not shown). In contrast, the level of phosphorylated Bad remained unchanged in Akt siRNA transfected cells over the course of infection ( F ig ure. 3 3 A ) as verified by the ratio of phosphorylated: total Bad ( Fig ure. 3 3 C ). Thus, the protection of P. gingivalis infected GECs against cell death appears partially due to inactivation of proapoptotic Bad, which appears to be directly associated wit h activation of Akt signaling. These results were validated by the analysis of Akt phosphorylation on Ser473 residue by an quantitative immunefluorescence assay, which revealed enhanced activation kinetics(maximal 2.5 fold increase) for Akt for the similar time points of P. gingivalis infection in GECs (data not shown). This finding was consistent with previous

PAGE 28

28 immunoblotting phosphorylation assays performed for Akt in P. gingivalis infected GECs ( Yilmaz et al. 2004). Effect of P. gingivalis I nfection on mRNA Levels of ProApoptotic Bad In an investigation by Nakhjiri et al. it was shown that the P. gingivalis infection in primary GECs modulates the expression of Bcl 2 family members transcriptionally. This includes downregulation of expression of proapoptotic molecule Bax and up regulation in the expression of anti apoptotic molecule Bcl 2. Similarly, we wanted to further characterize the effect of infection on Bad at the mRNA level both in normal and Akt deficient GECs. Although our protein phosphorylation assays ( Fig ure. 3 4 A ) illustrated a major increase in the levels of Bad phosphorylation, quantitative (real time) RTPCR was performed on mRNA extracted from primary GECs infected with P. gingivalis and showed gradual (approximately 60%) decrease in Bad mRNA levels following the 24 hrs incubation ( Fig ure. 3 4 A ). Interestingly, there was no change in the levels of Bad mRNA from the uninfected samples deficient in Akt, but there was an approximately 20% increase in the samples treated with P. gingivalis for 24 hrs ( Fig ure. 34B ), indicating a potentially additional role for Akt pathway in downregulating proapoptotic Bad at the transcriptional level. P. gingivalis Infection Sequesters Bad in Cytosol of GECs T hrough Akt Due to the noted significant increase in the levels of phosphorylated Bad during the 24 hr infection of P. gingivalis in GECs and phosphorylated Bad is normally maintained in cytosol in an inactive form, we wanted to next determine whether 24 hour infection alters the intracellular distribution of Bad in GECs using immunofluorescent microscopy. Akt deficient GECs were also analyzed in order to further verify the importance of Akt in this interaction. Uninfected control cells demonstrated that large

PAGE 29

29 proportion of Bad is localized in the cytosol in the absence of apoptotic stimuli ( Fi g ure. 3 5 A ). Addition of STS to the uninfected cells resulted in strong staining of Bad around the nuclei where typically mitochondria are clustered in the cell indicating a large amount of Bad translocated to mitochondria ( Fig ure.35A ). Howe ver, the cells infected with P. gingivalis showed abundant amount of Bad accumulated in cytosol. ( Collins & Bootman, 2003) On the other hand, GECs that are lacking Akt displayed similarly strong staining of Bad around the nucleus both in infected and STS treated uninfected cells ( Fig ure. 3 5 B ). Overall results further confirmed the role of Akt associated signaling in sequestration of proapoptotic Bad in cytosol, during P. gingivalis in fection, thereby, increasing anti apoptotic effects of the organism in primary GECs. Figure 3 1. Knockdown of Akt by siRNA in primary GECs. A target specific Akt antibody was used to conf irm the inhibition of Akt expression by w estern blotting. A nontarget antibody ( Beta actin) was used to controLproper loading and specificity of Akt siRNA. Column 1 is non target siRNA ( control), column 2 is transfection agent alone (control), and column 3 is target siRNA with transfection agent. Densitometric scanning of the products from the 48 hrs post transfected samples (column 3, Akt lane) displayed a ~85% decrease in the level of Akt demonstrating a successful inhibition of the protein in the primary cultures of GECs.

PAGE 30

30 Figure 32. Quantitative analysis of cell death by Anne xin V and Propidium iodide (PI) The percentage of dying cells was determined by dual staining with FITC conjugated Annexin V and PI using fluorescence microscopy. The threshold of fluoresc ence intensity was determined with samples that were uninfected and untreated., respectively, were used to evaluate the positively AnnexinV and/or PI stained cells. At least 10 separate fields containing an average of 50 cells were studied quantitatively from 3 independent experiments performed in duplicate A ) Primary GEC monolayers grown on microscopic chambers were incubated in the binding buffer containing AnnexinV (green fluorescence) and PI (red fluorescence). PI was used for the discrimination of necrotic or late apoptotic cells from the Annexin V positively stained cells. The nuclear stain DAPI (blue fluorescence) was used to visualize the number of cells in the field. B ) The simultaneous quantitative analysis and microscopic xaminations were employed in the Akt deficient GECsfor the similar conditions employed with normal GECs (C and D ). (*), (**), and (***) denote). statistical significance ( P = 0.006, P = 0.001, and P = 0.01 t test) f or 24 hrs uninfected + STS (2mM_treated GECs versus 24 hrs infected + STS ( 2 u M treated GECs, for 24 hrs uninfected + STS (4 u M treated GECs versus 24 hrs infected + STS treated ( 4 uM GECs, and for 24hrs infected GECs versus 24 hrs infected + STS (2 uM+LY treated GECs, r espectively (A ) (*), and (**) denote statistical significance ( P = 0.03 and P = 0.005 t test) for 24 hrs uninfected +siRNA tre ated GECs versus 24hrs infected + siRNA treated GECs and 24 hrs infected + siRNA treated GECs versus 24 hrs infected + STS+ siRNA treated GECs, respectively ( C)

PAGE 31

31 B C Figure 32. Continued. **

PAGE 32

32 D Figure 32. Continued A Figure 3 3 P gingivalis infection induces a large increase in Bad P hosphorylation. Primary GECs and the Akt deficient GECs were infected with P. gingivalis for 0 min (control), 6, 12, and 24 hrs. Cell lysates immune precipitated with anti Bad specific antibody w ere analyzed by immunoblotting with antibodies against phosphorylated Bad (Ser136) A) Blots were analyzed by scanning densitometry and ratios of phosphorylated: total Bad determined relative to ratios in control cells. The values show relative fold change calculated for a representative experiment and represent r esults obtained from at least three experiments (B and C ).

PAGE 33

33 B C Figure 33. Continued

PAGE 34

34 A B Figure 34 Bad mRNA levels slowly decreased by P. gingivalis infection. Gene expression was measured by quantitative RTPCR on mRNA from primary GECs A ) and Akt deficient GECs B) infected with P. gingivalis for 0 min (control), 6, 12, and 24 hrs. Relative fold change was calculated by dividing the copy number o f the gene transcript in P. gingivalis infected cells by the copy number in control cells. Data are representative of three independent experiments performed in triplicate. (*) denotes statistical significance ( P = 0.05 t test) for 24 hrs uninfected GECs versus 24hrs infected GECs.

PAGE 35

35 A B Figure 35 P gingivalis infection redistributes Bad local ization in primary G ECs through Akt. Intracellular Bad localization was detected by immunefluorescence using antibodies against Bad (green). The samples were also st ained with P. gingivalis antibody (red) and DAPI (blue) to visualize the nuclei. A ) Uninfected cells displayed large proportion of Bad localized in cytosol. However, incubation with the apoptosis inducer STS caused strong staining in the perinuclear area indicating translocation of Bad to mitochondria. Infection with P. g ingivalis showed sequestration of Bad in cytosol. B ) Akt knockdown cells were prepared as in Fig ure 3 5 A The localization of Bad showed intense staining around T he nuclei, where mitochondria are. This was similar in the uninfected STS treated cells (control). The images were captured with a fluorescence microscope equipped with a cooled CCD.

PAGE 36

36 CHAPTER 4 DISCUSSION Chronic adult periodontitis is primarily a mixed infection of multi factorial etiology (Machtei et al 1999, Grossi et al. 1994, Grossi et al ., 1995) Host factors play a critical role in extent and expression of the disease in the oral cavity. Host factors including immunologic, and environmental factors such as smoking, age, race, and socioeconomic status greatly influence the phenotypic expr ession of periodontitis, mainly the extent and severity of periodontitis (Grossi et al 1994, Grossi et al ., 1995, Haffajee & Socransky, 1994) Other systemic factors also influence and are influenced by these periodontal infections including diabetes mel litus, cardiovascular disease, and preterm births (Grossi et al 1994; Herzberg & Weyer 1998; Offenbacher et al 2004; Kibumitsu et al. 2002). As previous ly discussed multiple organisms have been implicated in the pathogenesis of periodontal disease ( Haf fajje & Socransky 1994; Socransky et al 1998). Recent focus has shifted from a single organism infection to include the dental biofilm as a whole in the initiation and progression of periodontitis (Haffajee & Socransky 2000). Synergistic relationships ex ist in the biofilm leading to accumulation of key periodontal pathogens, along with the presence of the necessary host factors ultimately resulting in destruction of the periodontium and eventual tooth loss (Haffajee and Socransky 1994). As a successful colonizer of the dental biofilm and key pathogenic organism in chronic periodontitis, P. gingivalis has established itself as a powerful and opportunistic organism of the oral cavity (Lamont & Yilmaz, 2002). P. gingivaliss multiple virulence factors contr ibute to the ability of this bacterium to utilize multiple pathways to invade, and replicate successfully in oral epithelial cells (Lamont et al 2002; Yilmaz et al 2006). As it invades gingival epithelial cells, P. gingivalis

PAGE 37

37 modulates multiple signali ng pathways to insure its survival and possible escape from immune responses. Namely, P. gingivalis infection intracellularly downregulates the secretion of IL8, an important chemokine attracting neutrophils to sites of infection. O ther mechanisms include the modulation of intracellular calcium concentration and the activation of integrinreceptor associated pathway (paxillin), leading to internalization of P. gingivalis and cytoskeletal arrangements ( Darveau et al. 1998, Yilmaz et al 2002; Zhang et al 2005) This activation results in cell actin cytoskeletal rearrangements facilitating P. gingivaliss ability to propagate within the cell and possibly outside. In addition, intracellular spreading capabilities of P. gingivalis contribute to this organisms endurance by modulating local and systemic immune responses such as host cell apoptotic pathways ( Yilmaz et al 2006). Moreover, infection by the intracellular pathogens illustrates that there is a great level of control on these host cell apoptoti c pathways (Byrne & Ojcius, 2004; Danelishvili et al 2003; Collins, 1995). Apoptosis is a significant process in host pathogen dynamics that can be advantageous to the host by contributing to pathogen removal. Induction of apoptosis can also be used by t he pathogen as a virulence strategy facilitating dissemination of infection. For microorganisms that require a eukaryotic cell structure for survival, a viable host is essential for replication and colonization. Consequently, inhibition of apoptosis can pr ovide a safe haven for microbes, and make intracellular organisms invisible to the immune system (Hacker et al. 2006). The sites of entry for the potential pathogens frequently include mucosal regions lined by epithelial tissues, which function as an impo rtant part of innate immunity. As a result, the epithelial cells can serve as effectual colonizing niches for these opportunistic species. A common finding for an increasing

PAGE 38

38 number of successful host adapted bacteria is that they delay or inhibit apoptotic pathways in epithelial cells while the same bacteria act as proapoptotic stimuli in other tissue types (Hacker et al 2006; Byrne & Ojcius, 2004). For example, Salmonella typhimurium infection is shown to cause apoptosis in macrophages but not epithelial cells ( Monack et al 1996) Similar to Salmonella Shigella flexneri, which kills macrophages rapidly through apoptosis, also does not induce cell death in epithelial cells (Knodler & Finlay, 2001; Monack et al. 1996; Zychlinsky et al 1992). P. gingiv alis one of the major constituents of oral subgingival microflora, is predominantly identified in severe forms of periodontal disease, possesses the ability to successfully colonize, adapt, and persist in its target gingival epithelial cells without being destructive until the environment becomes favorable for disease initiation and progression (Yilmaz et al 2008). The suppression of cell death and promotion of cell survival in GECs by P. gingivalis appears to trigger the bacteriums capacity to disseminate inter cellularly. GECs harboring high level of intracellular P. gingivalis also demonstrate increased host cell cycle progression and successful mitosis following one day infection (Kuboniwa et al. 2008; Yilmaz et al. 2006). In conjunction with the above findings, a recent study showed P. gingivalis infection can inhibit the P2X7 receptor dependent apoptosis of primary GECs by consuming extracellular ATP via its secreted putative nucleoside diphosphate kinase (NDk) and preventing activation of P2X7 r eceptors by ATP binding ( Yilmaz et al 2008). This ATP signal is recognized as a universal danger signal released by stressed and/or apoptotic cells and is being consumed by a P. gingivalis enzyme during the infection, thus blocking this apoptotic signali ng pathway (Yilmaz et al 2008). Previous studies showed that P. gingivalis promotes the gingival epithelial

PAGE 39

39 host cell survival partially by activating PI3 kinase/Akt pathway, blocking caspase3 activation via JAK/Stat signaling, and targeting the members of the Bcl 2 family proteins (Mao et al. 2007; Yilmaz et al. 2004; Nakhjiri et al. 2001). Our study verified the predicted functional role of PI3 kinase/Akt signaling in promoting epithelial cell survival stimulated by P. gingivalis infection since P I3kinase is an immediate regulator of Akt. Knock down of Akt by siRNA confirmed that Akt is likely central to the ability of the organism in limiting mitochondriondependent host cell death and in colonizing gingival epithelial tissues as a thriving persi stent opportunistic pathogen. The biochemical events that are associated with inhibition of apoptosis during P. gingivalis infection include blocking of mitochondrial permeability transition and inhibition of cytochrome-c release from mitochondria (Yilmaz et al 2004). Anti apoptotic Bcl 2 and Bcl xLproteins of Bcl2 family are located at the outer membrane of mitochondria and can inhibit release of cytochrome C In the presence of apoptotic inducer, proapoptotic Bad translocates to mitochondria to associ ate with Bcl 2 and Bcl -xL. This induces membrane depolarization of mitochondria and subsequent release of cytochrome-c (Chao & Korsmeyer, 1998) On the other hand, the apoptotic activity of Bad can be inhibited through its phosphorylation by Akt (Datta et al 1997). The phosphorylated form of Bad dissociates from a heterodimeric complex formed with anti apoptotic Bcl 2 and/or Bcl xL proteins and it stays in the cytosol in an inactive form, thereby, increasing anti apoptotic effects of the Bcl 2 family. He nce, the phosphorylation status and intracellular localization of Bad are critically important biochemical events in cell death pathways. Accordingly, our results showed P. gingivalis infection causes a significant level of Bad phosphorylation in GECs through Akt. This results in sequestering of Bad

PAGE 40

40 away from mitochondria and blocking its proapoptotic action. The results also suggested that the inactivation of Bad mediated by Akt during the infection occurred gradually and it was a timedependent process. The inactivation of Bad appears to be maximized at 24 hour infection. Interestingly the large decrease in Bad mRNA levels following the 24 hours infection proposed a potentially additional mechanism for the Bad inactivation. Recent studies investigating the quantitative proteomics of intracellular P. gingivalis in gingival epithelial cells showed the secretion of a number of distinctive P. gingivalis proteins that could be important for adaptation and survival (Yilmaz et al 2008; Xia et al. 2007). It is certainly valid to hypothesize that secretion of effector molecules by the intracellular bacterium may provide additional strategy for the inhibition of proapoptotic Bcl 2 family proteins. On the other end, Caspase3 activation, which significantly inc reases the mitochondrial permeability, is shown to be inhibited by P. gingivalis infection through dual Akt and JAK/Stat signaling (Mao et al. 2007). Similarly, Yao et al. recently demonstrated that caspase9 activation is significantly impaired by P. gin givalis in a time dependent manner. Yet, the inhibition of caspase9 was independent of Akt and JAK as indicated by the joint siRNA and the pharmacological inhibition assays (Yao et al. 2010). The early and short lived detection of caspase9 activation was not unexpected, since our previous study showed P. gingivalis triggers activation of caspases at early time points of infection in GECs determined by the inhibition of rapid PS exposure by the broadspectrum caspase inhibitor zVADfmk. However, neither c aspase activation nor PS externalization lead to host cell apoptosis (Yilmaz et al 2004). In addition, caspase9 activation is also required for transcription factor p53 dependent cell death. Infection of GECs with P.

PAGE 41

41 gingivalis causes a large reduction in p53 levels determined by a recent study (Kuboniwa et al 2008). Nonetheless, Yao et al. study showed Akt is not responsible for the caspase9 inhibition stimulated by P. gingivalis infection. To date, an extensive body of research indicates that P. gingivalis utilizes multiple virulence factors and manages to regulate many host cell molecules, which are involved in cell to cell signaling in order to survive and successfully replicate intracelluarly and simultaneously modulating the immunologic response to bacterial invasion. Furthermore P. gingivalis ability to prolong host cell survival and enhance the proliferation of gingival cells seems to allow the organisms to contribute to periodontal disease progression provided that necessary host and microbial factors are present Association of P. gingivalis with apoptosis has been examined in a variety of cell types. Previous studies have indicated P. gingivalis induces apoptosis in Jurkat T cells, KB cells, B cells human gingival fibroblasts and human trophoblasts, yet inhibits apoptosis in human monocytes, macrophages, neutrophils and GECs ( Geatch et al 1999, Chen et al 2001, Belibasakis et al 2010, Bostanci et al 2009, Pollreisz et al 2009) Thus, this investigation outlined significant e vents occurring between the intracellular molecules Akt and Bad, as a result of P gingivalis infection, which may be central for the organisms survival and colonization in oral epithelial tissues. Collectively, these findings illustrate the complexity of the modulation of mitochondriondependent cell death during the infection of P. gingivalis in GECs and may be used as therapeutic targets to treat periodontal disease in the future. These interactions are summarized in F igure 41

PAGE 42

42 In conclusion, appreciating these complex microbiological and immunological interactions would help understand and possibly provide novel therapeutic modalities for the treatment of periodontitis especially in patients where conventional methods have failed. P P P AKT PI3K P. gingivalis Inhibition of Cytochrome c release Inhibition of Cascade Caspases Activation Propagation & Colonization of P. gingivalis via Modulation of Cell Death CM P2X 7 Intracellular P. gingivalis FAK Paxillin Bad Cas 3 Cas 9 Modulation of Infection & Inflammation ATP Intracellular P. gingivalis Ndk Bcl 2 Bax Figure 41. T he mechanisms for primary GECs protection against cell death induced by P. gingivalis infection, adapted from Dr. Yilmazs work.

PAGE 43

43 LIST OF REFERENCES Albandar, J.M., Brunelle, J.A. and Kingman, A (1999). Destructive periodontal disease in adults 30 years and older in the United States, 1988194. J Periodontol 70:3043. Axelsson, P., Paulander, J. and Lindhe, J. (1998). Relationship between smoking and dental status in 35,50,65, and 75year old individuals. J Clin Periodontol 25: 297305. Beck,J., Koch, G.G., Zambon J.J., Genco, R.J. and Tudor G.E. (1992). Evaluation of oral bacteria as risk indicators for periodontitis in older adults. J Periodontol 63: 9399. Beck,J., Garcia, R.,Heiss G., Voconas, P. and Offenbacher, S.(1996). Periodontal disease and cardiovascular disease. J Periodontol 67:11231137. Belibasakis, G.N., Bostanci, N., and Reddi, D.(2010) Regulation of proteaseassociated receptor 2 expression in gingival fibroblasts and Jurkat cells by Porphyromonas gingivalis Cell Biol Int ., 34(3); 287292. Belton, C.M., Izutsu, K.T., Goodwin, P.G., Park, Y. and Lamont, R.J. (1999) Fluorescence image analysis of the association between Porphyromonas gingivalis and gingival epithel ial cells. Cell. Microbiol. 1: 215223. Bostanci, N., Reddi, D., Rangarajan, M., Curtis, M.A. and Belibaskis, G.N.(2009). Porphyromonas gingivalis stimulates TACE production by Tcells. Oral Microbiol Immunol, 24(2); 146151. Byrne, G.I. and Ojcius, D.M. (2004) Chlamydia and apoptosis: life and death decisions of an intracellular pathogen. Nature Rev. Microbiol. 2: 802808. Chao, D.T. and Korsmeyer, S.J. (1998) BCL2 family: regulators of cell death. Ann. Rev. Immunol. 16: 395419. Chen, Y.L., Law, P.Y. and Loh, H.H. (2005) Inhibition of PI3K/Akt signaling: an emerging paradigm for targeted cancer therapy. Curr. Med. Chem. Anticancer Agents 5: 575589. Collins, M. (1995) Potential roles of apoptosis in viral pathogenesis. Amer. J. Resp. Crit Care Med. 1 52: S20S24. Collins, T.J. and Bootman, M.D. (2003).mitochondia are morphologically heterogeneous within cells. J Experimental Biol 206: 19932000. Colombo, A.V., da Silva, C.M., Haffajee, A. and Colombo, A.P. (2007) Identification of intracellular oral species within human crevicular epithelial cells from subjects with

PAGE 44

44 chronic periodontitis by fluorescence in situ hybridization. J Periodontal Res 42: 236243. Cosulich, S.C., Savory, P.J. and Clarke, P.R. (1999) Bcl 2 regulates amplification of caspase activation by cytochrome c. Current Biol. 9: 147150. Curtis, M.A., Slaney, J.M., and Aduse Opoku, J.(2005) Critical pathways in microbial virulence. J Clin Peirodontol 32(6); 2838. Danelishvili, L., McGarvey, J., Li, Y.J. and Bermudez, L.E. (2003) My cobacterium tuberculosis infection causes different levels of apoptosis and necrosis in human macrophages and alveolar epithelial cells. Cell. Microbiol 5: 649660. Darveau, R.P., Belton, C.M., Reife, R.A. and Lamont, R.J. (1998) Local chemokine paralysis a novel pathogenic mechanism for Porphyromonas gingivalis Infect Immun 66: 16601665. Datta, S.R., Brunet, A. and Greenberg, M.E. (1999) Cellular survival: a play in three Akts. Genes & Dev. 13: 29052927. Datta, S.R., Dukek, H., Tao, X., Masters, S. Fu, H., Gotoh, Y. and Greenberg, M.E. (1997) Akt phosphorylation of Bad couples survival signals to the cell intrinsic death machinery. Cell. 91: 231241. Finlay, B.B. and Falkow, S. (1989) Common themes in microbial pathogenecity. Microbiol. Rev. 53: 210230. Grossi, S. G., Genco, R.J., Machtei, E. E., Ho, A.W., Kocj, G., Dunford, R.G., Zambon, J.J. and Hausman, E. (1995). Assessment of risk for periodontal disease II. Risk indicators for bone loss. J Periodontol 66: 2329. Grossi, S.G., Zambon, J.J ., Ho, A.W., Koch, G., Dunford, R.G., MAchtei, E.E., Norderyd, O.M. and Genco, R.J. (1994). Assessment of risk for periodontal disease I. Risk indicators for attachment loss J Periodontol 65:260267. Hacker, G., Kirschnek, S. and Fischer, S.F. (2006) A poptosis in infectious disease: howbacteria interfere with the apoptotic apparatus. Med. Microbiol. Immunol.(Berlin) 195: 1119. Haffajee, A. D. and Socransky, S.S. (1994). Microbial etiological agents of destructive periodontal diseases. In Socransky, S .S. and Haffajee A.D., eds.Microbiology and Immunology of periodontal diseases. Periodontolgy 2000,5: 78111. Haffajee, A.W. and Socransky, S.S.(2000). Relationship of cigarette smoking to attachment level profiles. J Clin Periodontol 28: 283295.

PAGE 45

45 Haffa jee, A.W., Socransky, S.S. and Goodson, J.M. (1992). Subgingival temperature.(I). Relation to baseline clinical parameters. J Clin Periodontol 19:401408. Herzberg, M.C. and Weyer, M.W. (1998). Dental plaque, platelets and cardiovascular diseases. Ann P eriodontol 3: 151160. Huang, GT, Haake SK, Kim JW, Park N.(1998) Differential expression of interleukin 8 and intercellular adhesion molecule1 by human gingival epithelial cells in response to Actinobacillus actinomycecomitans or Porphyromonas gingiv alis infection. Oral Microbiol Immunol 13: 301309. Huang GT, Kim D., Lee JK., Kuramitsu HK.,Kinder Haake S. Interleukin8 nad intercellular adhesion molecule 1 regulation in oral epithelial cells by selected periodontal bacteria: multiple effects of Por phyromonas gingivalis via antagonistic mechanisms(2001) Infect Immun 69:13641372. Inaba, H., Kuboniwa, M., Bainbridge B., Yilmaz O., Katz, J., Shiverick K.T., Amano A., and Lamont R.J. (2009). Porphyromonas gingivalis invades human trophoblasts and inhibits proliferation by inducing G1 arrest and apoptosis. Cell MIcrobiol 11(10): 15171532. Jenkinson, H.F. and Lamont, R.J. (2005) Oral microbial communities in sickness and in health. Trends Microbiol 13: 589595. Kennedy, S.G., Wagner, A.J., Conzen, S.D ., Jordan, J., Bellacosa, A., Tsichlis, P.N. and Hay, N. (1997) The PI 3kinase/Akt signaling pathway delivers an anti apoptotic signal. Genes & Dev. 11: 701713. Knodler, L.A. and Finlay, B.B. (2001) Salmonella and apoptosis: to live or let die? Microbes Infect. 3: 13211326. Kuboniwa, M., Hasegawa, Y., Mao, S., Shizukuishi, S., Amano, A., Lamont, R.J. and Yilmaz, O. (2008) P. gingivalis accelerates gingival epithelial cell progression through the cell cycle. Microbes Infect 10: 122128. Lamont, R.J. and Jenkinson, H.F. (2000) Subgingival colonization by Porphyromonas gingivalis Oral Microbiol Immunol 15: 341349. Lamont, R.J. and Yilmaz, O. (2002) In or out: the invasiveness of oral bacteria. Periodontol. 30: 6169. Lamont, R.J., Chan, A., Belton, C .M., Izutsu, K.T., Vasel, D.J. and Weinberg, A. (1995) Porphyromonas gingivalis invasion of gingival epithelial cells. Infect. Immun 63: 38783885.

PAGE 46

46 Liakoni, H., Barber, P. and Newman, H.N. (1987) Bacterial penetration of pocket soft tissues in chronic adult and juvenile periodontitis cases. An ultrastructural study. J Clin Periodontol 14:2228. Listgarten, M.A. (1976). Structure of the microbial flora associated with periodontal health and diease in man. A light and electron microscopic study. J Perio dontol 47:118. Listgarten, M.A. (1988). Bacterial invasion of periodontal tissues (letter). J Periodontol 59:412. Listgarten, M.A. (1999). Formation of dental plaque and other oral biofilms. In: Newman, N.H. and Wilson, M., eds, Dental Plaque Revisited Cardiff, Bioline, pp: 187210. Machtei, E. E., Hausmann, E., Dunford, R., Grossi, S., Ho, A., Chandler, J., Zambon, J. and Genco R. J. (1999). Longitudinal study of predictive factors for periodontal disease and tooth loss. J Clin Periodontol 26: 374380. Mao, S., Park, Y., Hasegawa, Y., Tribble, G.D., James, C.E., Handfield, M., et al (2007) Intrinsic apoptotic pathways of gingival epithelial cells modulated by Porphyromonas gingivalis. Cell Microbiol. 9: 19972007. Monack, D.M., Raupach, B., Hromoc kyj, A.E. and Falkow, S. (1996) Salmonella typhimurium invasion induces apoptosis in infected macrophages. Proc. Natl. Acad. Sci. USA. 93: 98339838. Nakhjiri, S.F., Park, Y., Yilmaz, O., Chung, W.O., Watanabe, K., El Sabaeny, A. et al (2001) Inhibition of epithelial cell apoptosis by Porphyromonas gingivalis FEMS Microbiol Lett 200: 145149. Nicholson, D.W. and Thornberry, N.A. (1997) Caspases: killer proteases. Trends Biochem.Sci. 22: 299306. Offenbacher, S. (2004). Maternal periodontal infections, prematurity and growth restrictions. Clin Obstet Gynecol ,; 47(4): 808 821. Offenbacher, S., Boggess, K.A., Murtha, A.P., Jared H.L.,Lieff, S., Mckaig, R.G., Mauriello, S.M., Moss, K.L. and Beck J.D.(2006). Progressive periodontal disease and risk of ver y preterm delivery. Obstet Gynecol ; 107(1): 29 36. Pollreisz, A., Huang, Y., Roth, A., Chang B., Kebschull, M., Papapanou P.N., Schmidt A.M. and Lalla, E. (2009). Enhanced monocyte migration and proinflammatory cytokine production by Porphyromonas gingiv alis infection. J Perio Res 9(23). Rudney, J.D., Chen, R. and Sedgewick, G.J. (2005) Actinobacillus Actinomycetemcomitans, Porphyromonas gingivalis, and Tannerella forsythensis are

PAGE 47

47 components of a polymicrobial intracellular flora within human buccal cel ls. J Dent Res 84: 5963. Rudney, J.D. and Chen, R. (2006). The vital status of human buccal epithelial cells and the bacteria associated with them. Arch Oral Biol. 55:291298. Seo, Y.S., Chen, Y. b., Ivanovska, I., Ranger, A.M., Hong, S.J., Dawson, V.L. et al (2004) BAD is a prosurvival factor prior to activation of its proapoptotic function. J. Biol. Chem. 279: 4224042249. Seppala, B., Seppala, M. and Ainamo, J. (1993). A longitudinal study on insulin dependent diabetes mellitus and periodontal dis ease. J Clin Periodontol 20:161165. Sheets, S.M., Robles Price, A.G., McKenzie, R.M., Casiano, C.A. and Fletcher, H.M. (2008) gingipaindependant interactions with the host are important for survival of P. gingivalis Front Biosc i, 13; 32153238. Socra nsky, S.S., Haffajee, A.D., Cugini, M.A., Smith, C. and Kent, R.L., Jr. (1998) Microbial complexes in subgingival plaque. J Clin Periodontol 25: 134144. Stein, J.M., Kuch, B. Conrads, G. Fickl, S., Chrobot,J. Schulz,S., Ocklenburg, C. and Sweets, R.(2009) Clinical periodontal and microbiologic parameters in patients with acute myocardial infarction. J Periodontol 80(10): 15811589. Tribble, G.D., Rassendren, F., Kawashima, E. North, R.A. and Buell, G. (1996) A Porphyromonas gingivalis haloacid dehalo genase family phosphotaase interacts with human phosphoproteins and is important for invasion. Proc Natl Acad Sci USA 103:1102711032. Tsuda, K. Amano, A., Umeloayashi, K., Inaba, H., Nakagawa, I., Nakanishi, Y., and Yoshimori, T. (2005). Molecular dissec tion of internalization of Porphorymonas gingivalis by cells using fluorescent beads coated with bacterial membrane vesicle. Cell Struct Funct, 30(2): 81 91. Verbeke, P., Welter Stahl, L., Ying, S., Hansen, J., Hcker, G., Darville, T. and Ojcius, D.M. (2 006) Recruitment of BAD by the Chlamydia trachomatis vacuole correlates withhost cell survival. PLoS Pathogens 2: e45. Xia, Q., Wang, T., Taub, F., Park, Y., Capestany, C.A., Lamont, R.J. and Hackett, M. (2007) Quantitative proteomics of intracellular P orphyromonas gingivalis Proteomics 7: 43234337. Yao, L., Jermanus, C., Barbetta, B., Choi, C., Verbeke, P., Ojcius, D. and Yilmaz, O. (2010) Porphyromonas gingivalis infection sequesters proapoptotic Bad through Akt in primary gingival epithelial cells. Molecular Oral Microbiol .( In press April 2010).

PAGE 48

48 Yilmaz, O. (2008) The chronicles of Porphyromonas gingivalis : the microbium, the human oral epithelium and their interplay. Microbiology 154: 28972903. Yilmaz, O., Young, P.A., Lamont R.J., and Kenney G.E.(2003). Gingival epithelial cells signaling and cytoskeletal responses to Phorphorymonas gingivalis invasion. Microbiology 149; 24172426. Yilmaz, O., Jungas, T., Verbeke, P. and Ojcius, D.M. (2004) Activation of the phosphatidylinositol 3kinase/A kt pathway contributes to survival of primary epithelial cells infected with the periodontal pathogen Porphyromonas gingivalis Infec. Immun. 72: 37433751. Yilmaz, O., Verbeke, P., Lamont, R.J. and Ojcius, D.M. (2006) Intercellular spreading of Porphyrom onas gingivalis infection in primary gingival epithelial cells. Infect. Immun. 74: 703710. Yilmaz, O., Watanabe, K. and Lamont, R.J. (2002) Involvement of integrins in fimbriaemediated binding and invasion by Porphyromonas gingivalis Cell Microbiol 4:305 314. Yilmaz, O., Yao, L., Maeda, K., Rose, T.M., Lewis, E.L., Duman, M., et al (2008) ATP scavenging by the intracellular pathogen Porphyromonas gingivalis inhibits P2X(7) mediated host cell apoptosis. Cell. Microbiol. 10: 863875. Yin, J.L., Shackel, N.A., Zekry, A., McGuinness, P.H., Richards, C., Putten, K.V., et al (2001) Real time reverse transcriptasepolymerase chain reaction (RTPCR) For measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I. Immunol Cell Biol. 79: 213221. Zhang, H.M., Rao, J.N., Guo, X., Liu, L., Zou, T., Turner, D.J. and Wang, J.Y. (2004) Akt kinase activation blocks apoptosis in intestinal epithelial cells by inhibiting caspase3 after polyamine depletion. J Biol Chem 279: 2253922547. Zychlinsky, A., Prevost, M.C. and Sansonetti, P.J. (1992) Shigella felxneri induce apoptosis in infected macrophages. Nature. 358: 167169.

PAGE 49

49 BIOGRAPHICAL SKETCH Dr. Caroline Jermanus studied Biochemistry at the University of Florida, where she graduated in the spring of 2003. After which, she attended dental school at Nova Southeastern University where she received his Doctor of Dental Medicine degree in the summer of 2007. In July of 2007, she started her post doctoral residency in periodontics and her Master of Science degree at the University of Florida. Dr. Jermanus received prestigious AADR travel bloc grant and won second place at the University of Florida Annual Research day. Upon graduation in the spring of 2010, Caroline will return to Jacksonville, Florida to practice clinical periodontics.