<%BANNER%>

Pterin Metabolism and Diabetic Vasculopathy

Permanent Link: http://ufdc.ufl.edu/UFE0041725/00001

Material Information

Title: Pterin Metabolism and Diabetic Vasculopathy
Physical Description: 1 online resource (78 p.)
Language: english
Creator: Kearns, Patrick
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: dhfr, diabetes, enos, no
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: PTERIN METABOLISM AND DIABETIC VASCULOPATHY The number of diagnosed and un-diagnosed cases of diabetes in the United States is expected to double over the next twenty-five years. With the rise in diabetes comes a rise in cardiovascular disease and the occurrence of vascular complications in the form of macro- and micro-angiopathies. These vascular complications are the pathological manifestation of an impaired endothelium arising from reduced nitric oxide biosynthesis. Reduced NO bioavailability in the endothelium has been identified as a critical mediator in the increased cardiovascular disease susceptibility observed in diabetics and is believed to occur as a consequence of increased oxidative stress. Endothelial dysfunction is apparent in diabetes despite the fact that eNOS expression is actually increased. The paradoxical finding of a concomitant increase in eNOS expression and reduced endothelium-dependent vasodilation has drawn attention to the fact that eNOS itself, in pathological states, may be a source of superoxide anions, a process which has been termed 'eNOS uncoupling'. It is our hypothesis that the increased cardiovascular disease risk observed in diabetics is a result of altered pterin metabolism and subsequent pathological NO and ROS signaling. In support, our results indicate that in the diabetic state, tetrahydrobiopterin salvage enzymes are impaired leading to the accumulation of pterin oxidation products and subsequent eNOS uncoupling. Moreover, our studies identify dihydrofolate reductase as a therapeutic target for treating diabetic vascular dysfunction. Specifically, using a gene therapy approach we demonstrated that over-expression of DHFR in the aorta of diabetic mice significantly improved endothelial-dependent relaxation. Using a combination of cellular, molecular and physiological approaches we characterized the mechanisms involved in the regulation of pterin metabolism and the consequences on endothelial NO and ROS signaling as it pertains to the pathogenesis of diabetic macro- and micro-angiopathies. In summary, studies carried out in this thesis provide fundamental mechanistic information regarding the pathways through which diabetes alters endothelial cell function and may lead to new approaches to treat or prevent diabetic vascular complications.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Patrick Kearns.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Cardounel, Arturo J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041725:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041725/00001

Material Information

Title: Pterin Metabolism and Diabetic Vasculopathy
Physical Description: 1 online resource (78 p.)
Language: english
Creator: Kearns, Patrick
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: dhfr, diabetes, enos, no
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: PTERIN METABOLISM AND DIABETIC VASCULOPATHY The number of diagnosed and un-diagnosed cases of diabetes in the United States is expected to double over the next twenty-five years. With the rise in diabetes comes a rise in cardiovascular disease and the occurrence of vascular complications in the form of macro- and micro-angiopathies. These vascular complications are the pathological manifestation of an impaired endothelium arising from reduced nitric oxide biosynthesis. Reduced NO bioavailability in the endothelium has been identified as a critical mediator in the increased cardiovascular disease susceptibility observed in diabetics and is believed to occur as a consequence of increased oxidative stress. Endothelial dysfunction is apparent in diabetes despite the fact that eNOS expression is actually increased. The paradoxical finding of a concomitant increase in eNOS expression and reduced endothelium-dependent vasodilation has drawn attention to the fact that eNOS itself, in pathological states, may be a source of superoxide anions, a process which has been termed 'eNOS uncoupling'. It is our hypothesis that the increased cardiovascular disease risk observed in diabetics is a result of altered pterin metabolism and subsequent pathological NO and ROS signaling. In support, our results indicate that in the diabetic state, tetrahydrobiopterin salvage enzymes are impaired leading to the accumulation of pterin oxidation products and subsequent eNOS uncoupling. Moreover, our studies identify dihydrofolate reductase as a therapeutic target for treating diabetic vascular dysfunction. Specifically, using a gene therapy approach we demonstrated that over-expression of DHFR in the aorta of diabetic mice significantly improved endothelial-dependent relaxation. Using a combination of cellular, molecular and physiological approaches we characterized the mechanisms involved in the regulation of pterin metabolism and the consequences on endothelial NO and ROS signaling as it pertains to the pathogenesis of diabetic macro- and micro-angiopathies. In summary, studies carried out in this thesis provide fundamental mechanistic information regarding the pathways through which diabetes alters endothelial cell function and may lead to new approaches to treat or prevent diabetic vascular complications.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Patrick Kearns.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Cardounel, Arturo J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041725:00001


This item has the following downloads:


Full Text

PAGE 1

1 PTERIN METABOLISM AN D DIABETIC VASCULOPA THY By PATRICK KEARNS A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIEN CE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Patrick Kearns

PAGE 3

3 T o U ncle Joe

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my mentor, Dr. Arturo Cardounel, for makin g this work possible. Thanks for believing in me a nd giving me this great opportunity. I would also like to thank m y committee: Dr. Peter Sayeski and Dr. Gregory Schultz. The guidance has helped to shape the past two years of my graduate experience and I thank you for that. Thanks go out to the members of the Cardounel lab, Dr. Pope, Scott and Dr. Karrupiah I would like to thank my parents for their continuous love and support. I could not have done it without the advise and guidance. Last but certainly not least I would like to thank my fiance, K risten, for moving with me across the country and for the unconditional love and support.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...................................................................................................... 4 LIST OF FIGURES .............................................................................................................. 7 ABSTRACT .......................................................................................................................... 8 CHAPTER 1 INTRODUCTION ........................................................................................................ 10 2 REVIEW O F THE LITERATURE ............................................................................... 14 Nitric Oxide .................................................................................................................. 14 Endothelial Nitric Oxide Synthase ....................................................................... 14 Actions of Nitric Oxide .......................................................................................... 15 NOS Regulation .......................................................................................................... 17 Substrate Bioavailability: A rginine ....................................................................... 17 Substrate Bioavailability: Arginase ...................................................................... 19 NOS Cofactor and Protein-Protein Interactions ......................................................... 20 Calmodulin ........................................................................................................... 20 Caveolae .............................................................................................................. 20 Hsp90eNOS ........................................................................................................ 21 eNOS Post -translational Modifications ...................................................................... 22 eNOS Phosphorylation ........................................................................................ 22 Ser 1177/117 9 ...................................................................................................... 22 Thr 495/497 .......................................................................................................... 23 Generation of Oxidative Stress .................................................................................. 23 eNOS Uncoupling ................................................................................................ 23 eNOS Uncoupling and Tetrahydrobioterin (BH4) ................................................ 24 Pathophysiology of Diabetic Endothelial Dysfunction ............................................... 27 3 PTERIN METABOLISM AND DIABETIC VASCULOPATHY .................................... 33 Introduction ................................................................................................................. 33 Materials and Methods ............................................................................................... 36 EPR: Materials ..................................................................................................... 36 EPR: Methods ...................................................................................................... 36 Western Blot: Materials ........................................................................................ 37 Western Blot: Methods ......................................................................................... 38 Vessel Rea ctivity: Materials ................................................................................. 39 Vessel Reactivity: Methods .................................................................................. 39 PCR: Materials ..................................................................................................... 41 PCR: Methods ...................................................................................................... 41 High Pressure Liquid Chromatography: Materials .............................................. 42

PAGE 6

6 High Pressure Liquid Chromatography: Methods ............................................... 42 Results ........................................................................................................................ 43 eNOS Dysfunction in the Diabetic Mouse. .......................................................... 45 BH4 Supplementation in the Diabetic Mouse. ..................................................... 46 Effects of DHFR Over Expression on Endothelial Function in wt and db/db Mice ................................................................................................................... 47 Effects of BH4 Supplementation on Endothelial Dependent Relaxation of Internal Mammary Artery Segments from Non-Diabetic and Diabetic Humans. ............................................................................................................ 48 Discussion ................................................................................................................... 49 REFERENCES .................................................................................................................. 68 BIOGRAPHICAL SKETCH ................................................................................................ 78

PAGE 7

7 LIST OF FIGURES Figure page 2 -1 Mechanism of Nitric Oxide production and relaxation of smooth muscle cells .... 30 2 -2 Cellular arginine metabolism occurs through s everal pathways within the cell ... 31 2 -3 Mechanism of eNOS uncoupling and production of superoxide. ......................... 31 2 -4 BH4 biosynthesis pathway ..................................................................................... 32 3 -1 Effects of DAHP and HG on NO of BAECs ........................................................... 55 3 -2 Effects of DAHP and HG on superoxide of BAECs .............................................. 56 3 -3 eNOS catalytic activity. .......................................................................................... 57 3 -4 Endothelial dependent relaxation was measured in aorta from wt and db/db mice ........................................................................................................................ 58 3 -5 eNOS derived ROS production was measured using EPR spin trapping techniques .............................................................................................................. 59 3 -6 Effects of diabetes on vascular BH4 and BH2 levels ............................................. 60 3 -7 Effects of BH4, and SOD on Aortic rings. .............................................................. 61 3 -8 Effects of diabet es on DHFR expression .............................................................. 61 3 -9 Effects of diabetes on DHFR activity. .................................................................... 62 3 -10 Effects of DHFR over expression on vascular relaxation. ................................... 63 3 -11 Effects of DHFR over expression .......................................................................... 63 3 -12 Endothelial dependent relaxation males vs. females. ........................................... 64 3 -13 Endothelial dependent relaxation nondiabetic vs. diabetic .................................. 65 3 -14 Effects of age on endothelial relaxation ................................................................ 66 3 -15 Effects of BH4 and SOD on IMA ............................................................................ 67

PAGE 8

8 Abstract of Thesis Presented to the Graduate School o f the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science PTERIN METABOLISM AND DIABETIC VASCULOPATHY By Patrick Kearns May 2010 Chair: Arturo Cardounel Major: Medical Sciences The number of diagnosed and undiagnosed cases of diabetes in the United States is expected to double over the next twenty -five years. With the rise in diabetes comes a rise in cardiovascular disease and the occurrence of vascular complications in the form of macroand micro angiopathies. These vascular complications are the pathological manifestation of an impaired endothelium arising from reduced nitric oxide biosynthesis. Reduced NO bioavailability in the endothelium has been identified as a critical mediator in the increased cardiovascular disease susceptibility observed in diabetics and is believed to occur as a consequence of inc reased oxidative stress. Endothelial dysfunction is apparent in diabetes despite the fact that eNOS expression is actually increased. The paradoxical finding of a concomitant increase in eNOS expression and reduced endothelium -dependent vasodilation has drawn attention to the fact that eNOS itself, in pathological state s, may be a source of superoxide anions, a process which has been termed "eNOS uncoupling". It is our hypothesis that the increased cardiovascular disease risk observed in diabetics is a result of altered pterin metabolism and subsequent pathological NO a nd ROS signaling. In support, our results indicate that in the diabetic state, tetrahydrobiopterin salvage

PAGE 9

9 enzymes are impaired leading to the accumulation of pterin oxidation products and subsequent eNOS uncoupling. Moreover, our studies identify dihydr ofolate reductase as a therapeutic target for treating diabetic vascular dysfunction. Specifically, using a gene therapy approach we demonstrated that over expression of DHFR in the aorta of diabetic mice significantly improved endothelial -dependent relax ation. Using a combination of cellular, molecular and physiological approaches we characterized the mechanisms involved in the regulation of pterin metabolism and the consequences on endothelial NO and ROS signaling as it pertains to the pathogenesis of d iabetic macroand microangiopathies. In summary, studies carried out in this thesis provide fundamental mechanistic information regarding the pathways through which diabetes alters endothelial cell function and may lead to new approaches to treat or prevent diabetic vascular compli c ations.

PAGE 10

10 CHAPTER 1 INTRODUCTION The number of diagnosed and undiagnosed cases of diabetes in the United States is expected to double over the next twenty -five years. Currently there are 23.7 million Americans with diabetes with an estimated healthcare cost of $113 billion1. Approximately 6% of global mortality is due to diabetes with 50% of diabetic mortalities due to cardiovascular disease (CVD). Myocardial infarctions occur twice as often in individuals with diabetes than the general population. Men with diabetes have a two to three fold higher incidence of CVD and women have a 4 fold higher incidence of CVD than men and women without diabetes2. According to the National Health and Nutrition Survey in 19992000, the prevalence of patients categorized as overweight was up from 55.9% to 64.5% and obesity was 30.5% up from 22.9%. Furthermore, extreme obesity classified as a BMI>40 was increased to 4.7% from 2.9%3. T h e occurrence of diabetes is on the rise and is directly attributed to the rise in obesity. Among all ages, both sexes and all ethnic groups, the occurrence of diabetes r ose 4.9% to 6.5% from 1990-19985. With this ris e in diabetes comes a rise in CVD risk among this patient population. The occurrence of vascular complications in the form of macroand microangiopathies are expected to grow exponentiall y over the next several decades6. Microvascular disease is the leading cause of kidney failure, blindness and nerve damage in individuals with diabetes. Moreover, early stages of hyperglycaemia cause a decrease in activity of vasodilators such as nitric oxide leading to increased vas cular permeability, blood flow abnormalities and predisposition to cardiovascular disease. The permeability changes result in irreversible microvascular cell loss due to programmed cell death. Furthermore, growth factors initiate proliferative responses in

PAGE 11

11 the vascular wall in an attempt to replace damaged cells. This proliferative response manifests to progressive capillary occlusion. Individuals with diabetes also have a higher rate of atherosclerotic macrovascular disease affecting large vessels lead ing to the heart, brain, and lower extremities causing myocardial infarctions, stroke and limb amputations. A classical example of macroangiopathy is coronary atherosclerosis and vascular intimal hyperplasia. Microangiopathy is exemplified by diabetic fo ot disease, retinopathy and nephropathy. In patients suffering from diabetes, macroangiopathy manifests as atherosclerosis like in non-diabetic patients, characterized by formation of plaques that follows in stages but with an accelerated course due to t he different risk factors such as h yperglycemia and hyperlipidemia7. Thus, atherosclerosis in diabetes begins earlier, is more markedly pronounced and progresses more rapidly. The pathogenic concept behind the increased cardiovascular risk seen in diabetics has focused on altered endothelial function that occurs as a result of a diab etes induced endothelial damage8. Individuals with diabetes mellitus exhibit accelerated atherosclerosis, more diffuse disease, concomitant co-morbidities and have an increased risk for restenosis and graft failure followi ng revascularization procedures9, 10. In addition to these macrovascul ar complications, impairment of the microcirculation of diabetic patients contributes to secondary complications in the lower extremities, such as foot infections and ulcerations as a result of impaired wound healing. These microcirculatory changes, which are mainly functional rather than structural, are responsible for the impaired ability of the microvasculature to vasodilate in response to injury. Functional impairment of endothelial activity precedes the development of these morphological alterations11.

PAGE 12

12 Endothelial dysfunction results from reduced bioavailability of the vasodilator nitric oxide (NO), mainly due to decreased NO production and increased formation of reactive ox ygen species (ROS ) 12 14. Although hyperglycemia, insulin resistance, hyperinsulinemia and dyslipidemia independently contribute to endothelial dysfunction via several distinc t mechanisms, increased oxidative stress seems to be the first alteration triggering several others. Several mechanisms have been proposed for the increase in oxidative stress observed in diabetes; among them are the depletion of tetrahydrobiopterin (BH4) and the accumulation of its oxidation product dihydrobiopterin (BH2). In -vitro studies have demonstrated that the depletion of BH4, an essential cofactor for endothelial NO synthase (eNOS), causes eNOS to readily produce superoxide (O2)15, 16. Moreover, it is known that BH4 can be readily oxidized to its inactive form BH2, since it is highly redox sensitive. The oxidation of BH4 becomes important in the production of NO since BH4 an d BH2 have an equal affinity for eNOS. In this regard, BH2 binding results in incomplete electron transfer resulting in eNOS oxida se activity17. In the endothelial cell, BH4 is produced by two main pathways, the s alvage pathway and the de novo synthesis pathway. Through the de novo pathway, biosynthesis is a NADPH, zinc and magnesium dependent process that first requires the conversion of GTP to 7,8dyhydroneopterin triphosphate. The catalyst for this step is GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in BH4 biosynthesis18. Subsequently, pyruvoyl tetrahydropterin synthase (PTPS) converts 7,8 dihydroneopterin triphosphate into 6pryuvoyl 5,6,7,8-tetrahydropt erin. Alternatively, Dihydrofolate reductase (DHFR), an

PAGE 13

13 NADPH dependent enzyme catalyzes the salvage pathway in the reduction of BH2 to BH4 17. Impaired endothelial function is apparent in experimental diabetes and in diabetic patients despite the fact that eNOS expression is actually increased19 22. Based on these observations it has been proposed that in diabetes, eNOS is uncoupled and NOS oxidase activity contributes to the increased risk of cardiovascular disease seen in this population. This would be expected to result in a feed-forward cascade in which eNOS derived O2 results in further eNOS uncoupling and eventual obliteration of NO synthesis. Therefore, research efforts are needed to identify novel therapeutic targets to prevent eNOS uncoupling and reduce the micro and macrovascular complications associated with diabetes.

PAGE 14

14 CHAPTER 2 REVIEW OF THE L ITERATURE The endothelium is known to play a critical role in the maintenance of vascular homeostasis through it s anti proliferative, anti atherogenic and anti -thrombotic properties. One of the key pathways for regulating the biology of the endothelium is through the production of the gaseous free radical Nitric Oxide (NO). The identification of NO was elegantly identified by an acetycholine response in rabbit aortic rings by Furchgott and Zawadzi. These studies demonstrated that when the endothelial cel l layer was removed not only was the acetylcholine response negated, but res ulted in overt vasoconstriction23. The relaxation effect was described as the endothelial derived relaxation factor (EDRF); which was lat er shown independently by bot h Moncada, and Ignarro to be NO24, 25. One year later, NO was found to be synthesized from the substrate L-Arginine by the enzyme nitric oxide sythase26. Since these findings, NO has been extensively studied and found to be a significant regulator in vascular homeostasis and decreased levels are implicated in the pathogen esis of endothelial dysfunction. Moreover, endothelial dy sfunction has been observed in pre-diabetic stages of insulin resistance and has been shown to play a central role in vascular impairment and atherogenesis27, 28. Nitric Oxide Endothelial Nitric O xide Synthase Endothelial derived nitric oxide is synthesized by the enzyme eNOS T his is carried out through the oxidation of the guanidino carbon of the amino acid L-Argini ne, forming NO and L-Citrulline26. In the vasculature, one of the primary functions of NO is to cause vascular smooth muscle cell (VSMC) relaxation. Relaxation occurs by NO

PAGE 15

15 freely diffusing from the endothelium into the VSMC where it binds to the heme group of the enzyme guanylate cycla se. Guanylate cyclase catalyzes the conversion of guanosine triphosphate (GTP) to cyclic guanosine 35-monophosphate (cGMP) and inorganic phosphate25, 29. In return, cGMP activates protein kina se G (PKG) leading to phosphorylation of the myosin light chain phosphatase. The myosin light chain is then dephosphorylated by myosin light chain phosphatase, resulting in the relaxation of the vascular smooth muscle cell (figure 21) In addition to it s effects on SMC contractility, NO also counteracts pro proliferative agents involved in athero-proliferative disorders and helps maintai n smooth muscle cell quiescence30. Actions of N itric Oxide NO is important for m aintaining vascular homeostasis by modulating vascular tone and through its anti atherogenic, anti proliferative and anti thrombotic properties. Through animal models and human studies, it has been demonstrated that NO plays an important role in preventin g platelet aggregation. In a cyclic GMP secondary mechanism, NO and prostaglandin work together to prevent platelet aggregation31. In this regard, human studies with healthy volunteers demonstrated a decrease in bleeding when the NOS inhibitor L-NNMA was administered intravenously32. In further support, using a rat model of common carotid artery thombosis, platelet aggregation was increased following administration of the NOS inhibitor L-NAME33. The endothelium plays a critical role in thrombosis through the actions of Weibel palade bodies (WPBs). WPBs are endothelial granules that are released through exocytosis in response to physical damage, endogenous chemicals, proteins and lipid messengers. These factors include but are not limited to: hypoxia, shear stress, thrombin, oxidized low -density lipoproteins and ROS. WPBs release von Willebrand

PAGE 16

16 factor (VWF) into the blood, this increases platelet adhesion to the vessel wall and each other. Several families of proteins control the stages of exocytosis leading to the release of VWF. N ethylmaleimide -sensitive factor (NSF) is the protein family that drives the molecular motor of WPBs endothelial exocytosis through vesicle trafficking. It has been demonstrated that exogenous NO can S nitrosylate NSF rendering it inactive and inhibiting the exocytosis of WPBs34. This inhibition of WPBs s howcases NOs anti thrombotic capabilities. Furthermore, the role of NO in maintaining vascular homeostasis can be seen in its anti atherogenic properties. WPBs also releases P Selectin, by exocytosis, to the outer cell surface where it interacts with ligands on leukocytes. This interaction initiates leukocyte rolling, microparticle production and recruitment which can lead to inflammation and atherogenesis. As previously stated, NO inhibits WPBs exocytosis by S-nitrosylation of NSF. Moreover, NO also ex hibits anti atherogenic properties by inhibiting the NF kappa B signaling pathway preventing inflammatory responses in the endothelial cell monolayer. NO does not inhibit NF kappa B directly but through the induction and stabilization of the NF kappa B i nhibitor, I kappa B alpha. This prevents NF kappa B from interacting with its DNA binding motifs on select genes. Inhibiting NF kappa B results in inhibition of pro atherogenic adhesion molecules VCAM 1, E -selectin, and ICAM 135 36. In addition to anti -thrombotic and anti atherogenic effects, NO along with several other signaling molecules maintains the anti -proliferative properties of the endothelium. For individuals with CAD, specifically coronar y artery stenosis, balloon angioplasty is the standard treatment. Unfortunately, this intervention causes endothelial cell injury

PAGE 17

17 and denudation which is a primary cause for lumen loss and late restenosis. Both human and animal studies of restenosis have concluded that reduced endothelial NO bioavailability contributes to the neointimal hyperplasia37 39. Until recently, the mechanism behind NOs anti proliferative propertie s on the VSMC were unknown, however, it has now been recognized that NO inhibits cell progression in the S phase. Once a cell proceeds beyond the S phase, where DNA synthesis occurs, it will continue until the cell cycle is complete. Cyclin A and cyclin -dependent kinase 2 (cdk2) are both unregulated during S phase progression and are needed for the cell to complete this phase. NO halts the cell in S phase by inhibiting the phosphorylation of E2F, which is a gene family of transcription factors needed for progression of the S phase. Specifically, this is done by NO inducing down regulation of cyclin A gene transcription and inhibiting cdk2 phosphorylation of E2F during S phase40. NOS Regulation The role of eNOS in the regulation of cardiovascular function and its contribution to disease pathogenesis has been well defined. Current research efforts are now focused on identifying the molecular mechanisms through which eNOS activity is controlled. In this regard, research has identified several critical pathways through which eNOS is regulated including: subs trate/inhibitor bioavailability, proteinprotein interactions and post translational modifications. Substrate bioavailability has been studied extensively and results demonstrate that although the Km for Larginine is very low, L arginine bioavailability can play a regulatory role in the control of eNOS catalytic activity. Substrate Bioavailability: Arginine Arginine is made available to the body from various sour ces including: protein turnover, dietary intake and endogenous biosynthesis. During fasting states, the

PAGE 18

18 majority of circulating arginine is made available through protein turnover with a small amount derived from endogenous biosynthesis41. Endogenous biosynthesis of arginine, in a healthy adult human, is enough so that it is not considered an essential amino acid, however, in adults with kidney or intestinal dysfunction or children and infants endogenous bio synthesis may not be sufficient42. The gut kidney axis is where whole body synthesis of arginine occurs; this is an interaction between the small intestine and the kidney. The kidney takes up citrulline, which is produced from glutamine and proline in the small intestine, the citrulline is then converted to arginine. The liver also synthesizes arginine, however, the arginine is quickly hydrolyzed to urea and ornithine demonstrating that the liver is not a significant source of arginine43. The body receives its primary source of arginine from the kidney renal tubules, although the majority of cell types have the ability to synthesize arginine. Argininosuccinate synthase and argininocussi nate lyase (ASL) have synergistic action and are responsible for the synthesis of arginine from citrulline. ASL is the rate limiting step in the synthesis43. Within the endothelium, the Citrulline -NO cycle is a n alternative means of producing arginine, however, the Citrulline-NO cycle only recycles a fraction of the citrulline produced through eNOS oxidation of arginine41. In terms of the metabolic fate, almost half of the argin ine that is consumed through diet is catabolized within the intestines before reaching the whole body44. Cellular arginine metabolism occurs through several pathways within the cell, however, it is predominately metabolized by the enzyme arginase and this has been shown to play and important role in the regulation of endothelial NO production (figure 2 2)

PAGE 19

19 Substrate Bioavailability: Arginase Arginase is the key enzyme for ariginine metabolism through the urea cycl e and is responsible for the hydrolysis of arginine to ornithine and urea. The type I arginase isoform is expressed in the liver and is responsible for the majority of activity. The type II isoform of arginase is expressed predominately in the kidney as a mitochondrial protein with minimal expression in the liver41. Recent literature has shown that arginase is present in the vasculature and plays a role in vasomotor tone. Endothelial cells express both isoforms of argin ase while VSMC only express type I. High arginase activity was identified in rat aortic smooth muscle cells and both isoforms have been found to be expressed in the pulmonary artery, carotid artery and the aorta45. Since arginine is a substrate for arginase, it has been suggested that arginase may inhibit the production of NO by competing with NOS for Larginine. This has been shown to result in uncoupling of NOS and manifests in the production of superoxide. Zweier et al. demonstrated LArg inine depletion in macrophages results in a reduction of NO produced by iNOS and an increase in NOS -derived O2 production46. Although arginine has a higher affinity for NOS than arginase, the activity of arginase is 1000 fold higher. Based on these biochemical kinetics it is evident that arginase can compete with arginine for substrate binding of NOS47. In suppo rt, microvascular endothelial cells from Dahl salt sensitive rats demonstrated a decrease in NO mediated relaxation with an increase in arginase activity. Furthermore, it has been demonstrated that over expression of arginase in endothelial cells with eit her isoform of arginase can decrease

PAGE 20

20 NO derived from eNOS48. Moreover, the inhibition of arginase activity in endothelial cells has been demonstrated to increase eNOS derived NO49. NOS Cofactor and ProteinProtein Interactions Calmodulin In addition to substrate regulation of eNOS, several critical protein-protein interactions have been identified for eNOS. Among these, calmodulin (CaM) was the first protein discovered to regulate eNOS activity. Calmodulin is a calcium dependent regulatory protein that includes four binding domains for calcium and regulates numerous different protein targets. Under resting calcium levels, eNOS is in an inactive state and upon calcium binding calmodulin undergoes a conformational change enabling it to bind to eNOS50. Upon binding eNOS, the calcium/calmodulin complex confers an allosteric transition which facilitates electron flow from the reductase to the oxygenase domain. Specifically, this occurs through the CAM binding motif on eNOS which di splaces an auto-inhibitory loop51. Formation of the eNOS/CAM complex is also critical for NOS activation by catalyzing the dissociation of eNOS from Caveolin-1, an interaction which has been shown to t onically suppress eNOS activity52. Caveolae Caveolae are cholesterol rich invaginations located on t he surface of the cell membrane. They are found in large amounts in VSMC, adipocytes and endothelial cells. Caveolaes major structural protein is Caveolin, which can be seen in 3 protein isoforms, Caveolin 1 (Cav 1), Caveolin2 (Cav -2) and Caveolin3 (C av -3)53. Several studies have demonstrated that Cav -1 is a negative regulator of eNOS. Cav -1 directly associates with and inhibits eNOS activity in endothelial cells. As previously stated, eNOS is dependent on the binding of calcium/calmodulin complex for the production of

PAGE 21

21 NO. As intracellular calcium rises, the calcium/calmodulin complex triggers the dissociation NOS from Cav 1 and when calcium levels subside Cav -1 sequesters eNOS rendering the enzyme inactive. In support, cellular studies have demonstrated that over expression of Cav -1 reduces eNOS activity while Cav 1 KO mice exhibit increased NO production from the endothelium and enhanced endothelial dependent relaxation54 55. It is important to state that calmodulin and caveolin are not the only NOS associated proteins capable of influencing the activity of eNOS. Heat shock protein 90 has also been shown to enhance the activity of eNOS. Hsp90eNOS Hsp 90 is a chaperone protein whi ch accounts for 1 -2 percent of all cytosolic proteins within the eukaryotic cell. It is mainly localized in the cytoplasm and exists as two isoforms, Hsp90 alpha and Hp90 beta56. Hsp90 participates in the maturation o f proteins, when binding to proteins it influences the folding of the protein to its native state and prevents protein aggregation of unfolded proteins57. Hsp90 has also been shown to be important in signal transduction in cells. Several signaling proteins have been shown to interact with Hsp90, including MEK, v Src and Raf 158. With regards to eNOS, Hsp90 can allosterically enhance the activity of the enzyme following histamine, VEGF, and fluid shear stress stimulation59. Much of the data implicating Hsp90 involvement in NOS function comes from pharmacological studies using the ansamycin antibiotic and HSP90 inhibitor, Geldanamycin (GA). GA binds to the ATP binding site of Hsp90 inhibiting the ATP/ADP cycle which is required for protein -protein interaction60. Using this approach, Hsp90 was shown to be critical for eNOS activity in isolated m esenteric arter ies and aortas of rats61. More recent molecular studies using site directed mutagenesis has revealed a Hsp90 binding domain on eNOS which yields a

PAGE 22

22 mutant eNOS with a low affinity for Hsp90 reduced endothelial NO production and increased endothelial derived O2 62. These finding s suggest that Hsp90 eNOS interaction not only increases the activity of the enzyme but may play a role in regulating eNOS uncoupling. In addition to proteinprotein interaction, eNOS post -translational modifications have also been shown to play a critical role in the regulation of both eNOS -derived NO and superoxide. Among these, eNOS phosphorylation is the most widely studied and its role in the r egulation of endothelial function will be discussed in the next section. eNOS Post-translational Modifications eNOS Phosphorylation Five phosphorylation sites on eNOS have currently been identified as targets, Ser 1177 (human)/Ser1179 (bovine), Ser114 (H)/Ser116 (B), Ser633 (H)/Ser635 (B), Ser 615(H)/Ser617 (B) and Thr495 (H)/Thr497 (B). However, evidence indicates that phosphorylation primarily occurs at serine (SER) residues and less frequently at tyrosine (Tyr) and threonine (Thr) residues. Ser 1177/1179 The activation of eNOS through direct phosphorylation at Ser 1179 by Akt was first identified by Fulton et al. and later confirmed by Dimmeler63, 64. Using pharmacological approaches, the upstream signaling pathways involved in eNOS Ser1177 phosphorylation have been identified. Specifically, pharmacological inhibitors of pho sphatidylinositol 3 -kinase (PI3K) pathway have been shown to inhibit NO release following stimulation by VEGF and insulin65, 66. Sequence analysis subsequently revealed that eNOS is a target for phosphory lation by protein kinase Akt which is activated by PI3K67. Various stimuli can stimulate the phosphorylation site Ser1179 of

PAGE 23

23 eNOS such as the depletion of BH4, as seen in hyperglycemic states, insul in, shear stress and bradykinin68. Thr 495/497 The PKC pathway mediates phosphorylation of Thr495. Thr495 is located at the Ca2+/CaM binding domain of eNOS and it has been demonstrated that the phosphorylation interferes with the formation of the Ca2+/CaM eNOS complex69. As a consequence, Thr495 phosphorylation is implicated in the pathogenesis of endothelial dysfunction given the propensity of this modification to suppress NO production. Several agonists have been shown to dephosphorylate Thr495 such as calcium ionophore, VEGF and bradykinin, agents which stimulate NO production. Both S er1177 and Thr495 have also been shown to regulate eNOS oxidase activity with the former suppressing eNOS -derived ROS production and the latter inhibiting it. As such, these post -translation modifications are likely to play a critical role in NOS regulation under both normal physiological conditions as well as pathological conditions wherein eNOS uncoupling is lik ely to occur. Generation of Oxidative Stress eNOS U ncoupling After the identification of NOS as the enzyme responsible for the production of the elusive endothelial derived relaxation factor, Xia et al. and Vasquez Vivar et al. demonstrated the phenomen on of eNOS uncoupling, in which pterin-depleted eNOS catalyzed the formation of O2 from the oxygenase domain of eNOS15 16. Subsequent studies demonstrated the pathological relevance of this in vitro phenomenon in animal models of hypertension, diabetes, and hypercholesterolemia. The first of these studies by Landmesser et al. demonstrated the presence of increased L-NAME inhibitable

PAGE 24

24 vascular superoxide production in a desoxycorticosterone ac etate (DOCA) sal t induced model of hypertension22. This pioneering study laid the foundation for the hypothesis that endothelial dysfunction is manifested not only as impaired NO bioavailability but also increased eNOS oxidase activity. Similar findings have been reported in the diabetic state wherein endothelial dysfunction is apparent despite the fact that eNOS expression is actually increased70. Early studies using endot helial cells derived from diabetic mice demonstrated evidence of altered NO production as a result of insufficient BH4. These conclusions were largely based on the observation that increases in O2 formation occurred in parallel with a decrease in BH4 fo llowing a 48 hour exposure to high glucose71. More direct evidence for BH4 involvement in eNOS uncoupling was provided by Juul et al. whose work demonstrated that over expression of the rate limiting enzyme in BH4 synthes is (GTPCH1) increased pterin levels and restored endothelial dependent relaxation72. eNOS U ncoupling and Tetrahydrobioterin (BH4) First described as an essential cofactor for the aromatic amino acid hydroxylases, tetrahydrobipterin (BH4) is also an essential cofactor for all three NOS isoforms73 75. The role that BH4 plays in NOS regulation has only recently become more defined. Located within each domain of eNOS is a binding site for a BH4 molecule. In vitro studies demonstrate that BH4 stabilizes and donates electrons to the ferrous -dioxygen complex in the oxygenase domain to help ini tiate the oxidation of L-Arg inine76 78. BH4 depletion leads to the dissociation of the ferrous dioxygen complex and electrons from the flavin domain are donated to molecular oxygen instead, leading to the production of super oxide from the oxygenase domain79, 80. This altered electron transfer in the

PAGE 25

25 absence of BH4 leads to the phenomenon of NOS uncoupling which has been documented in a variety of cardiovascular related diseases including diabetes71 ,81, 82 (figure 23 ). As previously stated, BH4 is an essential cofactor for the aromatic amino acid hydroxylases and NOS. The synthesis of BH4 occurs via three pathways in the cell, the de novo pathway, the salvage pathway, and recycling pathway. In the recycling pathway, the oxidized product of BH4, tetrhydrobiopterin-4alpha -carbinolamine, is recycled back to BH4 in a two step enzymatic process. First Pterin4alpha carbionolamine dehydratase (PCD) reduces tetrhydrobiopterin4alpha -carbinolamine to a quinonoid dihydrobiopterin intermediate which is then further reduced by Dihydropteridine Reductase (DHRP) to BH4 83 84(figure 2 4 ). De novo biosynthesis of BH4 is a magnesium, zinc and NADPH dependent pathway. The first step requires the conver sion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is catalyzed by the enzyme GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in BH4 biosynthesis85. GTPCH can be regulated at both the gene and protein level. Cytokines such as Tu mor Necrosis Factor Alpha (TNF ) and Interferon (IFN ) increase GTPCH activity and result in increased levels of endothelial BH4 86 8 8. Following the GTPCH enzyme reaction, pyruvoyl tetrahydropterin synthanse (PTPS) converts 7,8 dihydroneopterin triphosphate into 6pryuvoyl 5,6,7,8tetrahydropterin. In macrophages, induction by cytokines leads to increased GTPCH activity, however, the activ ity of PTPS remains unchanged89 90. Under these conditions, PTPS becomes the rate limiting enzyme for BH4 synthesis, and as a result the 7, 8

PAGE 26

26 dihydroneopterin triphosphate intermediate accum ulates and can become oxidized to neopterin. Neopterin is a stable metabolite that can be detected in the plasma and used clinically as a marker of inflammation in CAD91. The final step in the de novo synthesis pathway involves the NADPH dependent sepiapterin reductase enzyme catalyzing the reaction of 6 -pyruvoyl -5,6,7,8-tetrahydropterin to the final product of de novo synthesis, BH4 92. A mouse SPR KO model has been generated and this model shows impaired synthesis of BH4. To date however, no studies have been done to assess the effects on vascular endothelial function in these mice65. The salvage pathway is another in which BH4 can be synthes ized. One mechanism through which the salvage pathway regulates BH4 is through the conversion of exogenous sepiapterin. Sepiapterin is metabolized to BH2 by sepiapterin reductase and subsequently to BH4 by the enzyme Dihydrofolate Redutase (DHFR). Alter natively, when BH4 is nonenyzmatically oxidized to qBH2 and then further oxidized to BH2, DHFR can reduce BH2 back to BH4 93. Recently, the role of endothelial DHFR in BAECs as it relates to NO regulation has been in vestigated. Results demonstrated that a loss in DHFR expression resulted in reduced endothelial NO production and decreased BH4 bioavailability94. These results provide strong evidence that DHFR may serve a critica l role in maintaining endothelial BH4 and subsequent NO production. Moreover, under conditions of oxidative stress, the salavage and recycling pathways maybe critical in maintaining endothelial BH4/BH2 and NO production. Recent studies from G ross et al. and Vazques -Vivar et al have independently demonstrated that increased levels of the BH4 oxidation product BH2, rather than BH4 depletion alone, is the molecular trigger for NO insufficiency17 76. Specifically, the Gross

PAGE 27

27 group has demonstrated that BH4 and BH2 bind eNOS with equal affinity and BH2 can rapidly and efficiently replace BH4 in preformed eNOS -BH4 complexes. This group has further shown that exposure of murine endothelial cells (ECs) to high glucose results in an increase in BH2 levels from undetectable to 40% of the total biopterin pool. This BH2 accumulation was associated with diminished NO activity and accelerated superoxide production. Since superoxide production was suppr essed by NOS inhibitor treatment, eNOS was implicated as the principal superoxide source17. These studies suggest that endothelial dysfunction and eNOS uncoupling in the setting of oxidative stress involves both BH4 depletion and oxidation and thus implicates impairment in both the de novo and recycling pathways, respectively. Pathophysiology of Diabetic Endothelial Dysfunction Maintaining vascular homeostasis is essential for preventing vascular disease and obtaining normal vascular function. It is known that diabetes can cause a devastating disruption of the endothelial environment; this disruption causes a loss of the endotheliums benefactors of anti proliferative, anti atherogenic and anti thrombotic propertie s. As previously stated, eNOS and its product NO are needed to maintain a healthy endothelium. There is a paradoxical finding within diabetic patients; namely, eNOS expression is increased despite a reduction in endothelium dependent vasodilation. There is growing evidence that the loss of NO is a result of diabetes related oxidative stress. A variety of ROS generating enzymes cause oxidative stress and have been shown to be upregulated in diabetes. Moreover, ROS has been implicated in the uncoupling o f eNOS by oxidation of the essential cofactor, BH4. In diabetic patient s analysis of pterin levels reflects reduced BH4 and elevated BH2. It is our hypothesis that disruption of pterin balance contributes to the increased endothelial

PAGE 28

28 O2 production and reduced NO bioavailability observed in diabetes as a result of uncoupling. The shift in NO and O2 renders the endothelium unable to maintain its homeostasic mechanisms manifesting in impaired vascular relaxation, endothelial barrier disruption and vasc ular remodeling. In an attempt to recouple NOS activity, several groups have undertaken studies using pterin supplementation. In rat and mouse models of hypercholesterolemia and diabetes, oral BH4 supplementation has been shown to significantly improve endothelial function95 97. The doses used in these studies followed human dosing regimens (1020 mg/kg) used for the treatment of phenyl ketonuria (PKU). However, these rod ent studies failed to correct for body surface area and thus yielded pharmacological levels 10 times less than the minimum therapeutic dose for treating PKU. In this regard, it is surprising that therapeutic benefit was achieved given that the doses used in the animal studies would not be expected to augment cellular BH4. Moreover, BH4 supplementation in a disease state associated with increased endothelial ROS production would be expected to worsen the outcome as a consequence of increased formation of t he BH4 oxidation product, BH2. Indeed, clinical studies evaluating BH4 supplementation have reported little if any benefit. Recent studies by Worthley et al. reported no benefit from intracoronary BH4 infusion in patients with atherosclerotic coronary artery disease98. In contrast, work by Mayahi et al. revealed beneficial effects of both 6R -BH4 and 6S -BH4 on reactive hyperemic forearm blood flow, this despite the fact that the 6S BH4 isomer is not a ligand for NOS99. The inconsistencies in the literature regarding BH4 supplementation therapy are not surprising given the complexity of the pterin metabolic pathways and highli ght the need for a more complete

PAGE 29

29 and mechanistic understanding of endothelial pterin regulatory pathways. With the exception of GTPCH -1, little is known regarding the effects of diabetes on pterin metabolism or the consequences on endothelial function21. In this regard, studies aimed at understanding the molecular mechanisms involved in the regulation of pterin metabolism and eNOS uncoupling in diabetes will provide novel insight into the role of eNOS cofactor involvement in the increased cardiovascular disease risks associated with diabetes and is the focus of this thesis.

PAGE 30

30 Figure 21. Mechanism of Nitric Oxide production and relaxation of smooth muscle cells. Khurana and Meyer Journal of Cerebral Blood Flow & Metab olism (2003) 23, 1251 1262

PAGE 31

31 Figure 22. Cellular arginine metabolism occurs through several pathways within the cell, however, it is predominately metabolized by the enzyme arginase and this has been shown to play and important role in the regulation of endothelial NO production. ASL arginosuccinate; ASS arginosuccinate synthetase; ADC arginine decarboxylase; AGAT arginine glycine amidinotransferase; NOS nitric oxide synthase; DDAH dimethyl arginine dimethylamino hydrolase; ODCamithine decarboxylase; OA T omithine aminotransferase. Figure 23 Mechanism of eNOS uncoupling and production of superoxide. Nicholas J. ALP et al. AJC 2007

PAGE 32

32 Figure 24 BH4 biosynthesis pathway. The synthesis of BH4 occurs via three pathways with in the cell, the de novo pathway, the salvage pathway, and recycling pathway

PAGE 33

33 CHAPTER 3 PTERIN METABOLISM AN D DIABETIC VASCULOPA THY Introduction The risk of cardiovascular disease (CVD) is increased in diabetic patients, occurs earlier and is often more severe and diffuse. Impaired endothelial dysfunction and its sequence of events culminating in vascular smooth muscle cell proliferation, inflammation and a hypercoagulative state are the key factors contributing to the pathogenesis of diabetic vasculopathy. Although hyperglycemia, insulin resistance, hyperinsulinemia and dyslipidemia independently contribute to endothelial dysfunction via several distinct mechanisms, increased oxidative stress and reduced NO bioavailability seem to be the first insult trigger ing several others. Endothelial NO synthase (eNOS), present in the vascular endothelium, produces NO by oxidation of L arginine to L -citrulline. NO has diverse anti atherogenic and anti proliferative properties which contribute to its role i n the mainten ance of vascular homeostasis. However, eNOS may be a source of superoxide production under certain conditions because of enzymatic "uncoupling" of Larginine oxidation and oxygen reduction by the oxygenase and reductase domains of eNOS, respectively. Stu dies suggest that reduced availability of the cofactor tetrahydrobiopterin (BH4) may result in eNOS uncoupling and that this may be an important contributor to the imbalance between production of NO and superoxide production in vascular disease. In suppor t, hyperglycemia has been shown to increase NOS -dependent superoxide production in human endothelial cells17, and recent data from animal studies suggest a possible role for BH4 in mediating the eNOS dysfunction observed in diabetic vessels and endothelial cells100.

PAGE 34

34 Oxidant stress, such as that associated with diabetes, can potentially overwhelm the natural antioxidant defense mechanisms that serve to maintain BH4 in its reduced form, resulting in endothelial dysfunction. Glutathione (GSH), Ascorbate and v itamin E are key cellular antioxidants that preserve BH4, and diminished levels of these antioxidants are evident in diabetic patients101. Vitamin C treatment has been shown to increase eNOS activity in ECs specifically via chemical stabilization of BH4 102. Augmentation of endothelial BH4 levels by adenovirus -mediated overexpression of the rate -limiting enzyme for BH4 synthesis, GTP cyclohydrolase 1 (GTPCH), was also found to restore eNOS activity in hyperglycemic endothelial cultures and streptozotocin models of diabetes21. In aortas of mice with deoxycorticosterone acetate salt -induced (DOCA salt) hypertension, production of NOS -derived ROS was markedly increased and BH4 oxid ation is evident22. Treatment of DOCA -salt mice with oral BH4 attenuated vas cular ROS production, increased NO levels and blunted hypertension compared with nonhypertensive control mice However, translation of these findings into efficacious treatment strategies in human disease has been less successful. Indeed, clinical studi es evaluating BH4 supplementation have reported little if any benefit. Recent studies by Anderson et al. reported no benefit from intracoronary BH4 infusion in patients with atherosclerotic coronary artery disease98. In contrast, work by Hingorani et al has revealed beneficial effects of both 6R -BH4 and 6S -BH4 on reactive hyperemic forearm blood flow, this despite the fact that the 6S BH4 isomer is not a ligand for NOS99. The inconsistencies in literature regarding BH4 supplementation therapy are not sur prising given the complexity of the pterin metabolic pathways and highlight the need

PAGE 35

35 for a more complete and mechanistic understanding of endothelial pterin regulatory pathways. In this regard, recent studies from Gross et al. and Vaszquez -Vivar have independently identified the BH4 oxidation product, BH2, as the molecular trigger for eNOS uncoupling17,76. Experiments described in these studies demonstrate that BH2 is required for eNOS uncoupling in the endothelium and that levels of this oxidized pte rin are increased several fold by the oxidative stress that accompanies hyperglycemia. However, bioaccumulation of BH2 following oxidation of BH4 would not be expected to occur in the endothelium as dihydrofolate reductase activity should efficiently reduce this oxidized pterins back to BH4. Dihydrofolate reductase is an enzyme within the salvage pathway that catalyzes the NADPH dependent reaction, reduction of BH2 to BH4. As previously stated, DHFR may serve a critical role in maintaining the levels o f endothelial BH4 and reducing the level of BH2. Thus, by normalizing BH4/BH2 ratios, DHFR may function to recouple eNOS and restore NO biovailability. Studies have shown that DHFR can be pharmacologically inhibited by methotrexate or genetically knocked down by RNA interference in cells a nd these interventions result i n reduced endothelial BH4 and increased BH2 levels In contrast when GTPCH, the rate limiting step in the de novo pathway, was knocked down, total pterin level s w ere reduced, however, the BH4/BH2 ratio remained the same103,104. In summary, these findings suggest that the increased cardiovascular risk observed with diabetes may involve impaired pterin salvage pathways resulting in increased BH4/BH2 ratios, eNOS uncoupling and endothelial

PAGE 36

36 d ysfunction. The current study will examine pterin metabolism in diabetes and assess the vascular protective effects of DHFR gene therapy. Materials a nd M ethods EPR: Materials Diethyldithiocarbamate and Desferrioxamine were purchased from Sigma Aldrich 1 hydroxy -3 methoxycarbonyl 2,2,5,5 -tetramethyl pyr rolidine HCl (CMH hydrochloride) was from Axxora A Benchtop ESR Spectrometer from Bruker Biospin was used for EPR measurements. C57BL/6J and db/db mice were purchased from Jackson Labs. All other chemic als were purchased from Sigma Aldrich. Cell Culture Bovine aortic endothelial cells (BAECs) were purchased from Cell Systems and cultured in DMEM (Sigma, St Louis, MO) containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Factor Supplement (ECGS) and 1% Antibotic -Antimyotic (Gibco, Carsbad, CA) and incubated at 37 C with air and 5% CO2. EPR: Methods EPR spin trapping in cells Spin-trapping measurements of NO were performed using a Bruker E -scan spectromet er with FE MGD as the spin trap. For measurem ents of NO produced by BAECs, cells were cultured as described above and spin trapping experiments were performed on cells grown in 6 well plates. Attached cells were studied since scraping or enzymatic removal leads to injury and membrane damage with impaired NO generation. The media from approximately 1x106 cells attached to the surface of the 6 well plates was removed an d the cells were washed 3 times in KREBS and incubated at 37C, 5% CO2 in 0.2 ml of KRBES buffer containing the spin trap complex FE -MGD (0.5mM Fe2+, 5.0mM) and the cells stimulated with calcium ionophore (1 M). Subsequent measurements of NO production were performed

PAGE 37

37 following a 30 min incubation period. Spectra recorded from cellular preparations were obtained using the following parameters: microwave power; 20mW, modulation amplitude 3.00 G and modulation frequency; 86 kHZ. EPR spin trapping in vesselsStock solution of CMH (10 mM) was dissolved in EPR buffer ( PBS con taining 2 0 M Diethyldithiocarbamate and 50 M Desferrioxamine) and bubbled with Nitrogen for 30 minutes on ice Six aortic ring segments (2 mm) extracted from either wt or db/db mice were placed in a six well cell culture plate with EPR buffer. CMH at a concentration of 50 M was then added and incubated at 37C for 60 min with and without L-NAME (1 mM). Samples were then flash frozen with liquid nitrogen and loaded into a finger Dewar filled with liquid nitrogen. The Dewar was placed in the EPR with f ollowing settings: microwave frequency 9.7 GHz, microwave power 1.2 mW, modulation amplitude 6.7 G, conversion time 10.3 ms and time constant 40.96 ms. Western Blot: Materials Mouse tissues were harvested from C57BL/6J and db/db mice purchased from Jackso n Labs. RIPA Lysis buffer kit for homogenization was purchased from Santa Cruz Biotechnology. The western blots were performed using 420% tris -glycine gels. The gels were labeled with a protein marker and magic mark western standard. The gels and markers were purchased from Invitrogen. Samples were run with SDS sample buffer from Biolabs. eNOS primary antibody was purchased from Cell Signaling and the corresponding secondary anti -rabbit antibody was purchased from Santa Cruz Biotechnology. DHFR prima ry antibody was purchased from Abcam and used an anti mouse secondary (Santa Cruz). Western blots were developed on clear blue x ray film

PAGE 38

38 from Thermo Scientific using ECL western blot detection reagents from GE Healthcare. A Konica SRX developer was used. Western Blot: Methods Heart and kidney tissues were harvested from wt and age matched db/db mice. Tissues were homogenized using a motor and pestle under liquid nitrogen. 200 L of RIPA buffer containing protease inhibitor cocktail was added to tissue s and further homogenized in a glass homogenizer with a teflon grinder. Samples were then sonicated twice at two second intervals and immediately placed on ice. Next, samples were spun down at 3,000 rpm for 1 minute at 4C and the supernatant was collect ed. Protein concentration was quantified using a Bradford assay. Samples (2550 g) were then loaded on to 420% SDS Tris -Glycine gradient gels and run at 150V for 1 hour and 45 minutes. Following electrophoresis, the protein was transferred onto a nitroc ellulose membrane via a semi dry transfer blot system (Bio-rad). Following the protein transfer, the nitrocellulose membrane was blocked for 1 hour using 5% milk powder dissolved in Tris Buffered Saline and 0.05% Tween (TBST). Next, the membrane was washed 5x for 10 minutes with TBST and then the respective primary antibody was added and incubated overnight at 4C. eNOS was detected by eNOS rabbit primary diluted 1:1000. DHFR was detected by DHFR mouse primary diluted 1:1000. Following the overnight incubation with primary antibody the membrane was washed with TBST 3x for 15 minutes and the respective secondary antibody was added (eNOS anti -rabbit, DHFR anti mouse diluted 1:2000). After 1 hour incubation with secondary antibody at room temperature, detection was preformed using enhanced chemiluminescence kit and a Konica developing system.

PAGE 39

39 Vessel Reactivity: Materials Vascular reactivity studies were carried out using a four chamber wire myograph system from Danish myograph (Aaruhus, Denmark). All chemicals were purchased from Sigma Aldrich. C57BL/6J and db/db mice were purchased from Jackson Labs. Vessel Reactivity: Methods Mouse aortaConstriction and relaxation of isolated mouse aortic rings were measured in an organ bath containing Krebs -Henseleit buffer (118 mM NaCl, 24 mM NaHCO3, 4.6 mM KCl, 1.2 mM NaH2PO4, 1.2 mM CaCl2, 4.6 mM HEPES and 18 mM glucose). The bath was aerated with 95%O2/5%CO2 and kept at 37C. The thoracic aorta was extracted from db/db and age matched wt control mice. The aorta was cut into 3 mm rings and mounted on a wire myograph. Force was measured via a force transducer interface with Chart software for data analysis. The segments were incubated for a 1 hour equilibration period during which the rings were stretched t o generate a resting tension of 0.5 grams. The optimum resting force of the aortic rings was determined by comparing the force developed by 40 mM KCl under varying resting force. Aortic rings were preconstricted with 0.5 M phenylephrine. The vascular r elaxation response was determined using increasing concentrations of acetylcholine (10 nM to 1 M). After the relaxation response, wells were washed out 3 times until vessels reached their original resting tension. For two consecutive trials, the constri ction and relaxation response was performed. Additional groups consisted of vessels incubated with 10 M BH4, 300 units/ml superoxide dismutase, 150 units/ml of catalase and 300 M arginine for 30 minutes followed by a constriction/relaxation dose respons e.

PAGE 40

40 Human Internal Mammary Artery Contraction and relaxation of human internal mammary artery rings were measured in an organ bath containing Krebs -Henseleit buffer. The bath was aerated with 95%O2/5%CO2 and kept at 37C. The IMA was cut into 4 mM segm ents and mounted on a wire myograph. Force was measured via a force transducer interface with Chart software for data analysis. The segments were incubated for a 3 hours equilibration period, during which the rings were stretched to generate a resting tension of 2.0 grams. Aortic rings were preconstricted with 2 M phenylephrine. Vascular relaxation response was determined using increasing concentrations of acetylcholine (500 nM to 10 M). After the relaxation response, wells were washed out 3 times until vessels reached original resting tension. For two consecutive trials, the constriction and relaxation responses were performed. In separate trials the vessels were incubated with 10 M BH4, 300 units/ml superoxide dismutase or 300M arginine for 30 minutes followed by a constriction/relaxation dose response. Adenovirus TransductionAortas were dissected and mounted on a culture perfusion system (Danish Myo). The vessels were perfused with DMEM containing 10% FBS for 1 hour followed by static lum inal transduction with adDHFR (1 x 1011 vp/mL of DMEM containing 0.3% FBS) for 1 hour. The perfusion buffer was returned to full media and perfusion continued (10 L/min) for 24 hours As previously stated, vessels underwent KCl, phenylphrine and acetylc holine dose response for two consecutive trials. On separate trials, the vessels were incubated with 10 M BH4, for 30 minutes followed by a constric tion/relaxation dose response.

PAGE 41

41 Adenoviral Vector Construction Full -length human DHFR cloned into pcDNA 3.1 was purchased from Invitrogen. The vector was then subcloned into a pAd destination vector using Gateway cloning technology. The pAd vector was transfected into HEK293 cells for viral amplification. The crude lysate was collected and sent to the Ge ne -therapy core at Nationwide Childr ens Hospital for purification. PCR: Materials RNAeasy Mini Kit was used from Qiagen (Valencia,CA). One Step RT -PCR kit was purchased from Inv i tr o gen (Carsbad,CA). Bovine Primers for DHFR w ere purchased from Invitrogen. C57BL/6J and db/db mice were purchased from Jackson Labs. PCR: Methods The thoracic aorta was extracted from wt and db/db mice and cut into 3 mM segments. Post extraction, vessels receiving adenovirus were placed in a Petri dish and incubated in DMEM containing 10% FBS for 1 hour followed by transduction with adDHFR (1 x 1011 vp/mL of DMEM containing 0.3% FBS) for a 24 hour period at 37C. The 3 mm vessel segments were then homogenized in lysis buffer from the RNAeasy Mini Kit. Following lysis RNA was extracted using a RNAeasy Mini Kit RNA concentration of the tissue sample was determined by absorbance of A260/280. cD NA was then isolated using the One Step RT -PCR kit Semiquantive PCR was preformed in order to detect changes in mRNA expression f ollowing DHFR transduction. Primers were, DHFR Forward (ACCTGGTTCTCCATTCCTGA) and DHFR Reverse (GTTTAAGATGGCCTGGGTGA). PCR product was run on a 2% agarose gel with a 1Kb marker for 1 hour at 90 volts.

PAGE 42

42 High Pressure Liquid Chromatography: Materials An ESA CoulArray high pressure liquid chromatography system was used for measurement of tissue pterin levels. Centricon centrifugal filter were purchased from Millipore. C57BL/6J and db/db mice were purchased from Jackson labs. 7,8dihydro-L biopterin ( BH2), NADPH, m ethotrexate (MTX) and KH2PO4 were purchased from Sigma Aldrich. EDTA and methanol were purchased from Fisher, while octyl sodium sulfate was from Fluka. High Pressure Liquid Chromatography: Methods For measurements of tissue DHFR activity kidneys were extracted from wt and db/db mice. Samples were homogenized in deionized water with ascorbic acid (1 mg/ml) in a glass homogenizer and teflon grinder. After homogenization, protein concentration was measured via Bradford assay. 250 g of p rotein was incubated with 100 M BH2, 100 M NADPH with or without 10 M Methotrexate (DHFR inhibitor) for 30 minutes in a 37C water bath. Following the incubation, samples were loaded into a 3,000 molecular weight cut off Centricon filter and centrifuged at 10,000 rpm, 4C for 60 minutes. DHFR activity was measured by the formatin of BH4 using HPLC with electrochemical detection at 400 mV. The mobile phase consisted of Buffer B (100 mM KH2PO4, 25 mM octyl sodium sulfate and 0.6 mM EDTA) and Buffer A (100 mM KH2PO4, 25 mM octyl sodium sulfate, 0.6 mM EDTA and 2% MeOH) at pH of 2.5 and run at room temperature with a flow rate of 1.3 ml/min. For measurements of endogenous levels of BH4 and BH2, kidney tissue was used. As previously stated, samples were homogenized in deionized water with ascorbic acid (1 mg/ml) in a glass homogenizer and teflon grinder. After

PAGE 43

43 homogenization, protein concentration was measured via Bradford assay. 500 g of protein was loaded into a 3,000 molecular weight cut off Centric on filter and centrifuged at 10,000 rpm, 4C for 60 minutes. BH4 and BH2 were detected using HPLC with electrochemical detection at 400 mV and 800 mV. Results Although purified enzyme systems clearly demonstrate that loss of BH4 results in eNOS uncoupling, the occurrence of this phenomenon in the cellul ar environment is less evident. Several recent studies have indicated that increased formation of the BH4 oxidation product BH2, is the molecular trigger of eNOS uncoupling and that BH4 depletion alone is an insufficient insult to cause eNOS uncoupling. Therefore, to further examine the molecular mechanisms involve d in endothelial eNOS uncoupling EPR studies were performed to measure both eNOS derived NO and O2 production from BAEC s following either depletion or oxidation of BH4. Intracellular BH4 levels were depleted by pharmacological inhibition of GTP cyclohydrolase, the rate limiting enzyme in BH4 synthe sis, using DAHP (5 mM). Previous studies from our group and Gross et al. have demonstrated that 48 hour exposure to DAHP depletes cellular BH4 to undetectable levels17. Hyperglycemia (30 mM, 48 hours) was used to induce BH4 oxidation as previously demonstrated17. EPR measurements of endothelial cell NO production were then carried out in order to establish the effects of BH4 depletion/oxidation on endothelial NO production. Results demonstrated that following stimulation with the calcium ionophore A23187, control (untreated) cells gave rise to a strong NO signal (fig. 3 -1 ). In the presence of the GTPCH -1 inhibitor (DAHP, 5 mM), the NO signal was inhibited by almost 80%. Following 48 hour exposure to

PAGE 44

44 hyperglycemic conditions (30 mM glucose), endothelial NO produc t ion was inhibited by 24 % (fig. 3-1 ). These results indicate that BH4 is essential for eNOS activity and that hyperglycemia impairs NOS activity. H owever, in order to determine whether NOS uncoupling is occurring, detection of eNOS derived O2 is requir ed. Therefore, to assess if depletion/oxidation of BH4 can in fact trigger eNOS oxidase activity, EPR spectroscopy was used to measure L -NAME inhibitable O2 production from BAECs. L NAME was used as it inhibits NOS derived superoxide generation. Resu lts demonstrated that DAHP treatment alone resulted in increased eNOS derived (L-NAME inhibitable) O2 with a measured concentration of 0.07 nmols/106 cells. Hyperglycemia increased the amount of eNOS derived O2 production to 0.23 nmols/106 cells (fig. 3 2 ). These results demonstrate that although BH4 depletion (DAHP group) inhibits NO generation almost completely, it does not result in significant eNOS derived O2 as oxidase activity is only a fraction of the total eNOS catalytic activity observed. In contrast, under hyperglycemic conditions, 25% of the total NOS catalytic activity was involved in O2 generation with the remaining 75% representing eNOS derived NO. These results demonstrate that BH4 oxidation and not depletion is the critical molecular trigger for eNOS uncoupling. These results clearly demonstrate that loss of BH4 results in inhibition of eNOS derived NO without a concomitant increase in superoxide. In contrast, under conditions of hyperglycemia, wherein BH4 oxidation is increased, 50% of the total endothelial ROS production is eNOS derived ( Figure 3 3 ). These results are consistent with a recent study from Channon et al demonstrating eNOS uncoupling in

PAGE 45

45 internal mammary arteries from diabetic patients95. In this study, eNOS derived superoxide accounted for 50% of the total ROS production in the vessel wall. Together, these results demonstrate a critical role of BH4 and its oxidation products in the reg ulation of eNOS derived NO and O2. eNO S D ysfunct ion in the Diabetic M ouse. Subsequent in -vivo studies were carried out to validate our cellular studies demonstrating eNOS uncoupling under hyperglycemic conditions. The db/db diabetic mouse was used as a model to study diabetic vascular function and eNOS uncoupling in vivo Diabetic db/db mice and agematched wild type controls at 16 weeks of ag e were sacrificed and the aortas were removed for vascular reactivity and EPR spin trapping studies. Results demonstrated significant endothelial dysfunction in the db/db mice with a 47% reduction in endothelial dependent relaxation to Ach (10 nM 1 M) following phenylephrine (0.5 M) constriction (fig. 3 -4 ). Additional studi es were performed to determine whether the impaired vascular relaxation was associated with eNOS uncoupling. Aortic rings from wt and db/db mice were incubated with the ROS spin trap CM -H (20 M) to measure NOS dependent ROS production. The L -NAME inhibitable component of the signal was interpreted as NOS derived O2. Results demonstrate increased ROS production in the db/db mouse which w as largely inhibited by L -NAME. These results provide clear evidence for NOS uncoupling in the diabetic endothelium ( fig. 3 5 ). HPLC studies were then carriedout to assess the effects of diabetes on BH4 and BH2 levels from aortic homogenates. Results demonstrate a decrease in BH4 from 22 pmols/mg protein to 7 pmols/mg protein in the diabetic group. The loss of BH4 wa s accompanied by an increase in BH2 in the db/db animals (fig 3 -6 ).

PAGE 46

46 BH4 Supplementation in t he Diabetic M ouse. Preliminary data clearly demonstrate impaired endothelial function in the db/db mouse which is associated with eNOS uncoupling. Subsequent studies were performed to assess whether supplementation with the NOS cofactor, BH4, could ameliorate the loss of endothelial function occurring in diabetes. Aortic rings from wt and db/db mice were placed on a wire myograph and the vascular relaxation re sponse to Ach (10 nM 1 M) was evaluated in the presence and absence of BH4 (10 M) supplementation to the buffer (fig. 3 -7 ). Initial relaxation responses were measured followed by 30 minute incubation in the presence of BH4. Results demonstrated that BH4 supplementation had no effect on endothelial dependent relaxation in the wt mice, however, in the db/db mice, the addition of BH4 resulted in a 55% decrease in the relaxation response (fig 3 7 ). We hypothesized that the attenuation in relaxation obser ved in the db/db mice was a result of increased BH4 oxidation resulting from increased oxidative stress in the diabetic vessels. To test this hypothesis, the BH4 supplementation experiments were repeated in the presence of PEG -SOD (300 U/mL) The combina tion of BH4 and PEG SOD restored endothelial function in the diabetics mice to values above those observed in the wt mice (fig. 3 7 ). These results suggest that BH4 oxidation is increased in the diabetic endothelium and plays a significant role in the los s of endothelial function observed in diabetes. Bioaccumulation of oxidized pterins BH2 or quinoid BH2 would not be expected to occur in the endothelium as the combination of dihydrofolate reductase and dihydropteridine reductase should efficiently reduce these oxidized pterins back to BH4. Therefore, subsequent studies were carried out to identify the cellular mechanisms responsible for the altered pterin levels. Activity assays were performed on tissue

PAGE 47

47 homogenates from wt and db/db mice to identify disease associated changes in BH4 metabolic pathways. Results clearly demonstrated reduced DHFR expression and activity in db/db mice (figs 3 8 3 9 ). Specifically, western blot analysis of DHFR expression revealed a 2.5 fold decrease in DHFR protein express ion in heart tissue from diabetic mice (fig. 3 8 ). This decrease in expression was associated with an 85 % decrease in DHFR activity (fig. 3 -9 ). These results are consistent with our observation of increased BH2 levels in the diabetic animals and provide a potential mechanism for BH2 accumulation and NOS uncoupling in the diabetic endothelium. Effec ts of DHFR Over-Expression on Endothelial Function in wt and db/db M ice Upon identification of impaired DHFR activity in the diabetic mice, we carried out a series of studies aimed at assessing the effects of adenoviral -mediated over expression of DHFR in aortas from both wt and db/db mice. Aortas were dissected and mounted on a culture perfusion system (Danish Myo). The vessels were perfused with DMEM containing 10% FBS for 1 hour followed by static luminal transduction with adDHFR (1 x 1011 vp/mL of DMEM containing 0.3% FBS) for 1 hour. The perfusion buffer was returned t o full media and perfusion continued (10 L/min) for 24 hours. At the end of the 24 hour incubation, the vessels were removed and mounted on a wire myograph for assessment of endothelial dependent relaxation. Results demonstrated significantly impaired vascular relaxation responses to Ach in the diabetic group as compared to control (28% relaxation vs. 65% relaxation ) (fig. 3 10). DHFR over expression increased relaxation responses to Ach by 57% in the diabetic group, but had no effect o n wt rings (fig. 3 -10 ). In order to verify transduction of the adDHFR, PCR analysis was carried out to evaluate tissue expression of DHFR message. Results demonstrated the presence of increased DHFR mRNA in transduced tissues (fig. 3 11) Overall, these

PAGE 48

48 results demonstrate that the impaired vascular function observed in db/db mice is at least in part manifested through increased BH2 levels. The fact that DHFR over expression was not able to fully restore vascular function suggests that other pterin metabolites, which are not amenable to reduction by DHFR, may also be involved in the observed endothelial dysfunction. Effects of BH4 Supplementation on E ndothelia l Dependent Relaxation of Intern al M ammary A rtery Segments f rom Non Diabetic and D iabetic H umans Subsequent studi es were performed to assess pterin metabolism and endothelial dysfunction in human diabetes. The IRB protocol inclusion criteria included all patients undergoing coronary artery bypass grafting between the ages of 18 and 80. Exclusion criteria included HIV or Hepatitis positive individuals as well as pregnant females. Because of the nature of the study, we are enrolling equal numbers of diabetic and nondiabetic patients regardless of age, sex, race or ethnicity. C linically diagnosed diabetic patients and prediabetic patient s identified by fasting glucose levels of > 150 mg/dL and mild protein urea were placed in the diabetic cohort Current recruitment efforts have yielded 8 patients with equal representation by diabetes status. Internal mammary arter y (IMA) tissues were collected during coronary artery bypass surgery and vascular reactivity assessed immediately after collection using a wire myograph system Briefly, the IMA tissue was dissected free of surrounding tissue and cut into 4 mm rings. The rings were allowed to equilibrate for a period of three hours while resting tension was increased to 2 grams. Upon stabilization of the tension, KCL responses were obtained followed by assessment of the endothelial dependent relaxation response to Ach in vessels pre-constricted with PE (2 M). Results demonstrated reduced endothelial dependent relaxation in the males as compared to the females with males exhibiting a

PAGE 49

49 maximal relaxation response of 29% and females 54 % (fig. 3 -1 2 ). When the participants we re stratified into diabetic and nondiabetic groups, results demonstrated a non-statistically significant trend toward worse maximal dilatory response in the diabetics (48% relaxation in non -diabetics vs. 40% relaxation in diabetics) (fig. 3 -1 3 ). Regressi on analysis was then used to assess whether any correlation existed between endothelial function and age at surgery. As expected, those who presented with advanced coronary artery disease at an early age had worse endothelial dependent reactivity as compa red to older cohorts (fig. 3 1 4 ). To assess pterin involvement in the impaired vascular reactivity observed in these patients, we carried out a series of experiments using pharmacological BH4 supplementation in the presence and absence of SOD. BH4 supple mentation resulted in a 15% reduc tion in endothelial dependent relaxation suggesting that BH4 oxidation was occurring and the endothelium was unable to reduce the oxidized pterins (fig. 3 1 5 ) Combination therapy with BH4 and SOD increased endothelial dep endent relaxation by 43% while SOD alone increased the response by only 21% (fig 3 1 5 ). Although statistical significance was not achieved in these studies, they provide some evidence that the redox environment of the diseased endothelium creates an oxidi zing milieu which facilitates BH4 oxidation leading to NOS impairment. Discussion While the mechanistic basis for the attenuated NO production observed in diabetic endothelial dysfunction is uncertain, both slowed NO synthesis and accelerated NO scavenging by ROS have been implicat ed as causative factors. Thus, increased production of reactive oxygen species and loss of endothelial NO bioactivity are key features of the vascular dysfunction associated with diabetes1 0 5. Among the current

PAGE 50

50 hypothesis in the field is that diabetes is a chronic inflammatory state associated with increased oxidative stress. This oxidative stress is believed to result in increased oxidation and decreased bioavailability of the essential eNOS cofactor BH4. This redox sensitive cofactor is required for NO synthesis and whereas fully reduced tetrahydrobiopterins support NOS catalysis, oxidized pterins are believed to be catalytically incompetent76. Biochemical studies using recombinant NOS have demonstrated that eNOS, in the absence of BH4, has the potential to be a major source of superoxide with catalytic rates approaching those of NADPH Oxidase and Xanthine Oxidase8. BH4 oxidation has been described in vascular cells under conditions of oxidative stress associated with hypertension, ischemia reperfusion injury and diabetes21 22 10 6. However, recent studies evaluating eNOS uncoupling suggest that BH4 depletion alone does not significantly increase superoxide fluxes76, 17. Instead, it appears that increased levels of the BH4 oxidation product, BH2, are required for eNOS uncoupling. Therefore, in the current study we examined the effects of both eNOS depletion and oxidation on eNOS oxidase activity. Results demonstrated that although BH4 depletion inhibits NO generation almost completely, it does not induce significant eNOS oxidase activity In contrast, hyperglycemi a was associated with both reduced eNOS -derived NO and significantly increased eNOS oxidase activity. These results demonstrate that BH4 oxidation and not depletion is the critical molecular trigger for eNOS uncoupling and are consistent with a recent pub lication by Gross et al. which reported that exposure of endothelial cells to diabetic glucose levels (30 mM) resulted in an increase in BH2 levels

PAGE 51

51 from undetectable to 40% of total biopterin17. This BH2 accumulati on wa s associated with diminished NO activity and accelerated superoxide production. Subsequent studies were carried out to examine whether eNOS uncoupling is involved in the endothelial dysfunction associated with diabetes. Male db/db mice at 16 weeks o f age were used as a model of diabetic vasculopathy as these animals exhibit significantly impaired endothelial -dependent relaxation. Results demonstrated significantly impaired relaxation responses to acetylcholine in the db/db mice which was associated with increased eNOS -derived superoxide production and a reduced BH4/BH2 ratio. These results were consistent with eNOS uncoupling and thus raised the question whether pharmacological supplementation of BH4 could recouple eNOS activity. Therefore, we us ed pharmacological supplementation with authentic BH4 and assessed the effects on endothelial -dependent relaxation. BH4 supplementation had no effect on wt aortic rings but elicited a marked reduction in the relaxation response of the diabetic vessels. T hese results indicate that the pathology in diabetes appears quite different from that of other cardiovascular diseases in that BH4 supplementation is not able to rescue the loss in eNOS function. In fact, our preliminary data clearly demonstrate that BH4 supplementation worsens endothelial function in diabetes. In contrast, we have previously published that BH4 infusion into the ischemia reperfused heart restores the coronary relaxation response to histamine10 6. We thus hypothesized that diabetes must be associated with both increased BH4 oxidation and an inability to reduce oxidized pterins back to BH4. However, it is unclear why BH2 would accumulate in cellular and animal models of diabetes. Bioaccumulation o f BH2 or quinoid BH2 following oxidation

PAGE 52

52 of BH4 would not be expected to occur in the endothelium as the combination of dihydrofolate reductase and dihydropteridine reductase should efficiently reduce these oxidized pterins back to BH4. Given that numerous studies have clearly identified increased BH2 formation in diabetes suggests that this condition is likely associated with impaired pterin salvage or recycling pathways. Therefore, we assessed the effects of diabetes on the enzymes involved in the BH4 s alvage/recycling pathways Using a combination of molecular and physiological approaches we evaluated the effects of diabetes on DHFR expression and activity. Results demonstrated that db/db mice have both reduced expression and activity of this enzyme wh ich is consistent with the increased level of oxidized pterins observed. In order to assess whether reduced activity of this enzyme is directly involved in the pathogenesis of diabetic endothelial dysfunction, we used a gene therapy approach to over expre ss DHFR in the vascular endothelium of wt and db/db mice. Results demonstrated that over expression of DHFR had no effect on relaxation responses in the wt group which would be expected since these animals do not accumulate oxidized pterins. In contrast, DHFR over expression in the db/db mice increased endothelial -dependent relaxation by >50% thus demonstrating that accumulation of oxidized pterins is directly involved in eNOS dysfunction associated with diabetes. Overall, these data demonstrate that in murine models of diabetes, BH4 oxidation is increased and the activity of the BH4 salvage enzyme, Dihydrofolate Reductase, is inhibited. Although these results demonstrate a clear role for eNOS uncoupling in the pathogenesis of diabetic endothelial dysfun ction, we acknowledge that other pathogenic mechanisms are likely involved in diabetic vasculopathy. Nevertheless, we believe that

PAGE 53

53 that NOS dysregulation may be central component regulating many others. For example, advanced glycation end product (AGE) f ormation is accelerated in diabetes due to the increase in available glucose and the pro oxidative environment. AGEs have the propensity to form crosslink between proteins through cysteine residue s which often result in loss of protein function and repres ents a process which has been implicated in diabetes related cellular pathol ogy107. AGE can also interacts with several cell -surface AGE binding receptors including, receptor for advanced glycation endproducts (RAGE), which can lead to endocytosis or cell ular activation resulting in prooxidant and proinflammatory events. The binding to RAGE activates NF KappaB, which controls several genes involved in pro-inflammatory responses108. Over time, AGE can post translationally modify proteins, contribute to atherosclerosis and cause inflammation leading to micro and macroangiopathy107. These are pathological events which are also closely linked to impaired NO bioavailability and suggest that some inter dependence may exist between AGE and NOS. Specifically, we hypothesize that cysteine may represent this link as it is a site for both NO signaling through the formation of S -nitrosyl complexes as well as AGE modification. Thus, we predict that loss of NO bioavailabilty secondary to diabetes may result in unmasking of cysteine residues and increased susceptibility to formation of AGE complexes on these proteins. Furthermore, oxidation of BH4 and eNOS uncoupling may amplify the production of AGE by c reating a more oxidizing environment. In this regard, we believe that NOS impairement is likely an early event in diabetes and thus contributes to many of the other related pathological processes. Future research efforts should examine these potential in ter -relationships during disease development.

PAGE 54

54 We are currently extending these observations to the human disease and have initiated a clinical study to assess the effects of diabetes on pterin metabolism and its role in diabetic vasculopathy. Although our current cohort is small, we have observed a trend toward worsened endothelial function among diabetics. Our current efforts will focus on delineating the pterin metabolic pathways in the endothelium and their role in the pathogensis of diabetic vasculopathy.

PAGE 55

55 Figure 31 Effects of DAHP and HG on NO of BAECs. BAECs were treated with DAHP (10 mM) or under hyperglycemic (HG) conditions (30 mM) for 48 hrs to induce BH4 depletion or oxidation, respectively. Left panel represents cellular NO production. R epresentative spectra are presented in the right panel. *represents statistical significance, p<0.05

PAGE 56

56 Figure 32 Effects of DAHP and HG on superoxide of BAECs. BAECs were treated with DAHP or under hyperglycemic (HG) conditions for 48 hrs to induce BH4 depletion or oxidation, respectively. EPR spectroscopy was performed using the spin trap CMH (50 M) to detect eNOS derived superoxide. Left panel represents cellular ROS production. Representative spectra are presented in the right panel. *represents sta tistical significance, p<0.05

PAGE 57

57 Figure 33 eNOS catalytic activity. BAECs were treated with DAHP (10 mM) or under hyperglycemic (HG) conditions (30 mM) for 48 hrs to induce BH4 depletion or oxidation.

PAGE 58

58 Figure 34 Endothelial dependent relaxation was measured in aorta from wt and db/db mice. Rings were constricted with PE (0.5 M) and the relaxation response to Ach (10 nM -1 M) was measured on a wire myograph. Data are presented as mean SEM of n=4. *represents st atistical significance, p<0.05

PAGE 59

59 Figure 35 eNOS derived ROS production was measured using EPR spin trapping techniques. Studies were performed on wild type (wt) and diabetic (db/db) mice in the presence and absence of L-NAME (1 mM) The O2 generator riboflavin/light was used as a positive control. The ROS signal can be observed between 3450-3470 gauss.

PAGE 60

60 Figure 36 Effects of diabetes on vascular BH4 and BH2 lev e ls. BH4 was detected using HPLC with electrochemical detection at 400 mV. BH2 was detected using flourescence detect ion at ex. 348, em. 444. B.) *represents statistical significance, p<0.05

PAGE 61

61 Figure 37 Effects of BH4, and SOD on Aortic rings. Aortic rings from age matched control (wild-type) and diabetic (db/db) mice were isol ated and endothelial dependent relaxation assessed with Ach. Rings were supplemented with BH4 (10 M) and SOD (150 U/mL). Using the Holm -Sidak method for comparison: rep resents p<0.05 as compared to respective control, ** represents p<0.05 as compared to wt control Figure 38 Effects of diabetes on DHFR expression. IP western blot (200 g) of kidney and heart DHFR expression

PAGE 62

62 Figure 39 Effects of diabetes on DHFR activity. 200 g of kidney and heart homogenate from wt and db/db were incubated in the presence of BH2 (100 M) and the conversion to BH4 measured by HPLC. represents p<0.05.

PAGE 63

63 Figure 310 Effects of DHFR over expression on vascular relaxation. Vascular reactiv ity to Ach (5 nM 5 M) in aorta s from wt and db/db mice with and with out adDHFR (1 x 1011vp/mL). n=4 -6. represents p<0.05 between db/db and db/db + adDHFR. Figure 311 Effects of DHFR over e xpression Semi -quantitative PCR analysis of DHFR expression in mouse aorta following 24 hour transduction with adDHFR

PAGE 64

64 Fi gure 312 Endothelial dependent relaxation males vs. females. Relaxation wa s measured in Internal Mammary Artery of human patients with and without diabetes All patients were undergoing coronary artery bypass grafting between the ages of 18 and 80. Comparing male vs. female, r ings were constricted with PE (2 M) and the relaxation response to Ach (500 nM -10 M) was measured on a wire myograph.

PAGE 65

65 Figure 313 Endothelial dependent relaxation nondiabetic vs. diabetic. Relaxation was measured in Internal Mammary Artery of human patients with and without diabetes. All patients were undergoing coronary artery bypass grafting between the ages of 18 and 80. Comparing nondiabetic vs. diabetic for both female and male patients, r in gs were constricted w ith PE (2 M) and the relaxation response to Ach ( 500 nM 1 0 M) was measured on a wire myograph.

PAGE 66

66 Figure 314 Effects of age on endothelial relaxation. Endothelial dependent relaxation was measured in Internal Mammary Artery of human patients with and without diabetes. All patients were undergoing coronary artery bypass grafting between the ages of 18 and 80. Comparing max relaxation vs. age of nondiabetic and diabetic for both female and male patients, rings were constricted with PE (2 M) and the relaxation response to Ach (500 nM -10 M) was measured on a wire myograph.

PAGE 67

67 Figure 315 Effects of BH4 and SOD on IMA. Endothelial dependent relaxation was measured in Internal Mammary Artery of human patients with and without diabetes. All patients were undergoing coronary artery bypass grafting between the ages of 18 and 80. Comparing bath supplementation of BH4, SOD and BH4+SOD of non -diabetic and diabetic for both female and male patients, rings were constricted with PE (2 M) and the relaxation response to Ach (500 nM 10 M) was measured on a wire myograph.

PAGE 68

68 R EFERENCES 1 Huang ES, Basu A, O'Grady M, Capretta JC. Projecting the future diabetes population size and related costs for the U.S. Diabetes Care 2009 Dec;32(12):22259. 2 Boucher JL, Hurrell DG. Car diovascular disease and diabetes. Diabetes Spectrum 2008 July;21(3):154-5. 3 Flegal KM, Carroll MD, Ogden CL, Johnson CL. Prevalence and trends in obesity among US adults, 1999200JAMA 2002 Oct 9;288(14):1723-7. 4 Jemal A, Ward E, Hao Y, Thun M. Trends in the leading causes of death in the united states, 1970-2002. JAMA 2005 Sep 14;294(10):12559. 5 Mokdad AH, Ford ES, Bowman BA, Nelson DE, Engelgau MM, Vinicor F, Marks JS. Diabetes trends in the U.S.: 19901998. Diabetes Care 2000 Sep;23(9):1278 83. 6 Mokdad AH, F ord ES, Bowman BA, Dietz WH, Vinicor F, Bales VS, Marks JS. Prevalence of obesity, diabetes, and obesity -related health risk factors, 2001. JAMA 2003 Jan 1;289(1):769. 7 Brownlee M. Biochemistry and molecular cell biology of diabetic complications. Nature 2001 Dec 13;414(6865):81320. 8 Druhan LJ, Forbes SP, Pope AJ, Chen CA, Zweier JL, Cardounel AJ. Regulation of eNOS -derived superoxide by endogenous methylarginines. Biochemistry 2008 Jul 8;47(27):725663. 9 Haffner SM, Lehto S, Ronnemaa T, Pyorala K, Laakso M. Mortality from coronary heart disease in subjects with type 2 diabetes and in nondiabetic subjects with and without prior myocardial infarction. N Engl J Med 1998 Jul 23;339(4):22934. 10. Stratton IM, Adler AI, Neil HA, Matthews DR, Manley SE, Cull CA, Hadden D, Turner RC, Holman RR. Association of glycaemia with macrovascular and microvascular complications of type 2 diabetes (UKPDS 35): Prospective observational study. BMJ 2000 Aug 12;321(7258):405-12. 11. Despres JP, Cartier A, Cote M, Arsenault BJ. The concep t of cardiometabolic risk: Bridging the fields of diabetology and cardiology. Ann Med 2008;40(7):51423. 12. Quyyumi AA, Dakak N, Andrews NP, Gilligan DM, Panza JA, Cannon RO,3rd. Contribution of nitric oxide to metabolic coronary vasodilation in the human heart. Circulation 1995 Aug 1;92(3):3206.

PAGE 69

69 13. Guzik TJ, West NE, Black E, McDonald D, Ratnatunga C, Pillai R, Channon KM. UltraRapid communications : Vascular superoxide production by NAD(P)H OxidaseAssociation wit h endothelial dysfunction and clinical risk factors. Circ Res 2000 May 12;86(9):1008. 14. Guzik TJ, Mussa S, Gastaldi D, Sadowski J, Ratnatunga C, Pillai R, Channon KM. Mechanisms of increased vascular superoxide production in human diabetes mellitus: Role of NAD(P)H oxidase and endothelial nitric oxide synthase. Circulation 2002 Apr 9;105(14):165662. 15. Xia Y, Tsai AL, Berka V, Zweier JL. Superoxide generation from endothelial nitric oxide synthase. A Ca2+/calmodulin dependent and tetrahydrobiopterin regulatory process. J Biol Chem 1998 Oct 2;273(40):25804-8. 16. Vasquez -Vivar J, Kalyanaraman B, Martasek P, Hogg N, Masters BS, Karoui H, Tordo P, Pritchard KA,Jr. Superoxide generation by endothelial nitric oxide synthase: The influence of cofactors. Proc Natl Acad Sci U S A 1998 Aug 4;95(16):9220-5. 17. Crabtree MJ, Smith CL, Lam G, Goligorsky MS, Gross SS. Ratio of 5,6,7,8tetrahydrobiopterin to 7,8-dihydrobiopterin in endothelial cells determines glucoseelicited changes in NO vs. superoxide production by eNOS. Am J Physiol Heart Circ Physiol 2008 Apr;294(4):H1530 40. 18. Burg AW, Brown GM. The biosynthesis of folic acid. 8. purification and properties of the enzyme that catalyzes the production of formate from carbon atom 8 of guanosine triphosphate. J Biol Chem 1968 May 10;243(9):2349 -58. 19. Vasquez -Vivar J, Kalyanaraman B, Martasek P, Hogg N, Masters BS, Karoui H, Tordo P, Pritchard KA,Jr. Superoxide generation by endothelial nitric oxide synthase: The influence of cofactors. Proc Natl Acad Sci U S A 1998 Aug 4;95(16):9220-5. 20. Xia Y, Tsai AL, Berka V, Zweier JL. Superoxide generation from endothelial nitric oxide synthase. A Ca2+/calmodulin dependent and tetrahydrobiopterin regulatory process. J Biol Chem 1998 Oct 2;273(40):25804-8. 21. Alp NJ, Mussa S, Khoo J, Cai S, Guzik T, J efferson A, Goh N, Rockett KA, Channon KM. Tetrahydrobiopterindependent preservation of nitric oxide mediated endothelial function in diabetes by targeted transgenic GTP cyclohydrolase I overexpression. J Clin Invest 2003 Sep;112(5):72535. 22. Landmesser U, Dikalov S, Price SR, McCann L, Fukai T, Holland SM, Mitch WE, Harrison DG. Oxidation of tetrahydrobiopterin leads to uncoupling of endothelial cell nitric oxide synthase in hypertension. J Clin Invest 2003 Apr;111(8):12019.

PAGE 70

70 23. Furchgott RF, Zawadzki JV. The obligatory role of endothelial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature 1980 Nov 27;288(5789):3736. 24. Ignarro LJ, Buga GM, Wood KS, Byrns RE, Chaudhuri G. Endothelium -derived relaxing factor produced and released from arter y and vein is nitric oxide. Proc Natl Acad Sci U S A 1987 Dec;84(24):9265 9. 25. Palmer RM, Ferrige AG, Moncada S. Nitric oxide release accounts for the biological activity of endothelium derived relaxing factor. Nature 1987 Jun 1117;327(6122):5246. 26. Palmer R M, Ashton DS, Moncada S. Vascular endothelial cells synthesize nitric oxide from Larginine. Nature 1988 Jun 16;333(6174):664 -6. 27. Arteaga RB, Chirinos JA, Soriano AO, Jy W, Horstman L, Jimenez JJ, Mendez A, Ferreira A, de Marchena E, Ahn YS. Endothelial mic roparticles and platelet and leukocyte activation in patients with the metabolic syndrome. Am J Cardiol 2006 Jul 1;98(1):70-4. 28. Schafer A, Alp NJ, Cai S, Lygate CA, Neubauer S, Eigenthaler M, Bauersachs J, Channon KM. Reduced vascular NO bioavailability in diabetes increases platelet activation in vivo. Arterioscler Thromb Vasc Biol 2004 Sep;24(9):1720-6. 29. Arnold WP, Mittal CK, Katsuki S, Murad F. Nitric oxide activates guanylate cyclase and increases guanosine 3':5' -cyclic monophosphate levels in various tis sue preparations. Proc Natl Acad Sci U S A 1977 Aug;74(8):32037. 30. Sarkar R, Webb RC. Does nitric oxide regulate smooth muscle cell proliferation? A critical appraisal. J Vasc Res 1998 May -Jun;35(3):13542. 31. Radomski MW, Palmer RM, Moncada S. The anti aggreg ating properties of vascular endothelium: Interactions between prostacyclin and nitric oxide. Br J Pharmacol 1987 Nov;92(3):63946. 32. Simon DI, Stamler JS, Loh E, Loscalzo J, Francis SA, Creager MA. Effect of nitric oxide synthase inhibition on bleeding time in humans. J Cardiovasc Pharmacol 1995 Aug;26(2):33942. 33. Stagliano NE, Zhao W, Prado R, Dewanjee MK, Ginsberg MD, Dietrich WD. The effect of nitric oxide synthase inhibition on acute platelet accumulation and hemodynamic depression in a rat model of throm boembolic stroke. J Cereb Blood Flow Metab 1997 Nov;17(11):1182-90. 34. Lowenstein CJ, Morrell CN, Yamakuchi M. Regulation of weibel -palade body exocytosis. Trends Cardiovasc Med 2005 Nov;15(8):302-8.

PAGE 71

71 35. Lefer AM, Ma XL. Decreased basal nitric oxide release in hy percholesterolemia increases neutrophil adherence to rabbit coronary artery endothelium. Arterioscler Thromb 1993 Jun;13(6):7716. 36. Peng HB, Libby P, Liao JK. Induction and stabilization of I kappa B alpha by nitric oxide mediates inhibition of NF -kappa B. J Biol Chem 1995 Jun 9;270(23):14214 9. 37. Lablanche JM, Grollier G, Lusson JR, Bassand JP, Drobinski G, Bertrand B, Battaglia S, Desveaux B, Juilliere Y, Juliard JM, Metzger JP, Coste P, Quiret JC, Dubois -Rande JL, Crochet PD, Letac B, Boschat J, Virot P, Fi net G, Le Breton H, Livarek B, Leclercq F, Beard T, Giraud T, Bertrand ME. Effect of the direct nitric oxide donors linsidomine and molsidomine on angiographic restenosis after coronary balloon angioplasty. the ACCORD study. angioplastic coronaire corvasal diltiazem. Circulation 1997 Jan 7;95(1):83 -9. 38. Janssens S, Flaherty D, Nong Z, Varenne O, van Pelt N, Haustermans C, Zoldhelyi P, Gerard R, Collen D. Human endothelial nitric oxide synthase gene transfer inhibits vascular smooth muscle cell proliferation and neointima formation after balloon injury in rats. Circulation 1998 Apr 7;97(13):127481. 39. Varenne O, Pislaru S, Gillijns H, Van Pelt N, Gerard RD, Zoldhelyi P, Van de Werf F, Collen D, Janssens SP. Local adenovirus mediated transfer of human endothelial nitric oxide synthase reduces luminal narrowing after coronary angioplasty in pigs. Circulation 1998 Sep 1;98(9):919-26. 40. Guo K, Andres V, Walsh K. Nitric oxide induced downregulation of Cdk2 activity and cyclin A gene transcription in vascular smooth muscl e cells. Circulation 1998 May 26;97(20):206672. 41. Wu G, Morris SM,Jr. Arginine metabolism: Nitric oxide and beyond. Biochem J 1998 Nov 15;336 ( Pt 1)(Pt 1):117. 42. Morris SM,Jr. Arginine metabolism in vascular biology and disease. Vasc Med 2005 Jul;10 Suppl 1:S837. 43. Hallemeesch MM, Lamers WH, Deutz NE. Reduced arginine availability and nitric oxide production. Clin Nutr 2002 Aug;21(4):2739. 44. Wu G. Intestinal mucosal amino acid catabolism. J Nutr 1998 Aug;128(8):124952. 45. Durante W, Johnson FK, Johnson RA. Arginase: A critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol 2007 Sep;34(9):90611.

PAGE 72

72 46. Xia Y, Zweier JL. Superoxide and peroxynitrite generation from inducible nitric oxide synthase in macrophages. Proc Natl Acad Sci U S A 1997 Jun 24;94(13):69548. 47. Reczkowski RS, Ash DE. Rat liver arginase: Kinetic mechanism, alternate substrates, and inhibitors. Arch Biochem Biophys 1994 Jul;312(1):317. 48. Johnson FK, Johnson RA, Peyton KJ, Durante W. Arginase inhibition restores a rteriolar endothelial function in dahl rats with salt -induced hypertension. Am J Physiol Regul Integr Comp Physiol 2005 Apr;288(4):R1057-62. 49. Chicoine LG, Paffett ML, Young TL, Nelin LD. Arginase inhibition increases nitric oxide production in bovine pulmon ary arterial endothelial cells. Am J Physiol Lung Cell Mol Physiol 2004 Jul;287(1):L608. 50. Venema RC, Sayegh HS, Kent JD, Harrison DG. Identification, characterization, and comparison of the calmodulinbinding domains of the endothelial and inducible nitric oxide synthases. J Biol Chem 1996 Mar 15;271(11):6435-40. 51. Nishida CR, Ortiz de Montellano PR. Autoinhibition of endothelial nitric -oxide synthase. identification of an electron transfer control element. J Biol Chem 1999 May 21;274(21):146928. 52. Michel JB, Feron O, Sacks D, Michel T. Reciprocal regulation of endothelial nitric oxide synthase by Ca2+ -calmodulin and caveolin. J Biol Chem 1997 Jun 20;272(25):155836. 53. Scherer PE, Lewis RY, Volonte D, Engelman JA, Galbiati F, Couet J, Kohtz DS, van Donselaar E, P eters P, Lisanti MP. Cell -type and tissue -specific expression of caveolin2. caveolins 1 and 2 co localize and form a stable hetero oligomeric complex in vivo. J Biol Chem 1997 Nov 14;272(46):2933746. 54. Michel JB, Feron O, Sacks D, Michel T. Reciprocal regu lation of endothelial nitric oxide synthase by Ca2+ -calmodulin and caveolin. J Biol Chem 1997 Jun 20;272(25):155836. 55. Drab M, Verkade P, Elger M, Kasper M, Lohn M, Lauterbach B, Menne J, Lindschau C, Mende F, Luft FC, Schedl A, Haller H, Kurzchalia TV. Los s of caveolae, vascular dysfunction, and pulmonary defects in caveolin1 gene disrupted mice. Science 2001 Sep 28;293(5539):2449-52. 56. Czar MJ, Welsh MJ, Pratt WB. Immunofluorescence localization of the 90kDa heat -shock protein to cytoskeleton. Eur J Cell B iol 1996 Aug;70(4):322 -30. 57. Wiech H, Buchner J, Zimmermann R, Jakob U. Hsp90 chaperones protein folding in vitro. Nature 1992 Jul 9;358(6382):16970.

PAGE 73

73 58. Oppermann H, Levinson W, Bishop JM. A cellular protein that associates with the transforming protein of rous sarcoma virus is also a heat -shock protein. Proc Natl Acad Sci U S A 1981 Feb;78(2):106771. 59. Garcia -Cardena G, Fan R, Shah V, Sorrentino R, Cirino G, Papapetropoulos A, Sessa WC. Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature 19 98 Apr 23;392(6678):8214. 60. Stebbins CE, Russo AA, Schneider C, Rosen N, Hartl FU, Pavletich NP. Crystal structure of an Hsp90-geldanamycin complex: Targeting of a protein chaperone by an antitumor agent. Cell 1997 Apr 18;89(2):23950. 61. Shah V, Wiest R, Garc ia -Cardena G, Cadelina G, Groszmann RJ, Sessa WC. Hsp90 regulation of endothelial nitric oxide synthase contributes to vascular control in portal hypertension. Am J Physiol 1999 Aug;277(2 Pt 1):G4638. 62. Xu H, Shi Y, Wang J, Jones D, Weilrauch D, Ying R, Wak im B, Pritchard KA,Jr. A heat shock protein 90 binding domain in endothelial nitric oxide synthase influences enzyme function. J Biol Chem 2007 Dec 28;282(52):37567 -74. 63. Dimmeler S, Fleming I, Fisslthaler B, Hermann C, Busse R, Zeiher AM. Activation of nitr ic oxide synthase in endothelial cells by akt -dependent phosphorylation. Nature 1999 Jun 10;399(6736):601-5. 64. Fulton D, Gratton JP, McCabe TJ, Fontana J, Fujio Y, Walsh K, Franke TF, Papapetropoulos A, Sessa WC. Regulation of endothelium derived nitric oxide production by the protein kinase akt. Nature 1999 Jun 10;399(6736):597-601. 65. Yang S, Lee YJ, Kim JM, Park S, Peris J, Laipis P, Park YS, Chung JH, Oh SP. A murine model for human sepiapterin-reductase deficiency. Am J Hum Genet 2006 Apr;78(4):57587. 66. Zeng G, Quon MJ. Insulin-stimulated production of nitric oxide is inhibited by wortmannin. direct measurement in vascular endothelial cells. J Clin Invest 1996 Aug 15;98(4):894 -8. 67. Fulton D, Gratton JP, Sessa WC. Post -translational control of endothelial nitric oxide synthase: Why isn't calcium/calmodulin enough? J Pharmacol Exp Ther 2001 Dec;299(3):81824. 68. Lane P, Gross SS. Disabling a C -terminal autoinhibitory control element in endothelial nitric oxide synthase by phosphorylation provides a molecular explanat ion for activation of vascular NO synthesis by diverse physiological stimuli. J Biol Chem 2002 May 24;277(21):19087 -94. 69. Matsubara M, Hayashi N, Jing T, Titani K. Regulation of endothelial nitric oxide synthase by protein kinase C. J Biochem 2003 Jun;133(6) :77381.

PAGE 74

74 70. Cosentino F, Hishikawa K, Katusic ZS, Luscher TF. High glucose increases nitric oxide synthase expression and superoxide anion generation in human aortic endothelial cells. Circulation 1997 Jul 1;96(1):25-8. 71. Cai S, Alp NJ, McDonald D, Smith I, Kay J, Canevari L, Heales S, Channon KM. GTP cyclohydrolase I gene transfer augments intracellular tetrahydrobiopterin in human endothelial cells: Effects on nitric oxide synthase activity, protein levels and dimerisation. Cardiovasc Res 2002 Sep;55(4):83849 72. Juul K, Tybjaerg-Hansen A, Marklund S, Heegaard NH, Steffensen R, Sillesen H, Jensen G, Nordestgaard BG. Genetically reduced antioxidative protection and increased ischemic heart disease risk: The copenhagen city heart study. Circulation 2004 Jan 6;109(1):59 -65. 73. Kwon NS, Nathan CF, Stuehr DJ. Reduced biopterin as a cofactor in the generation of nitrogen oxides by murine macrophages. J Biol Chem 1989 Dec 5;264(34):20496 -501. 74. Tayeh MA, Marletta MA. Macrophage oxidation of Larginine to nitric oxide, nitrite, and nitrate. tetrahydrobiopterin is required as a cofactor. J Biol Chem 1989 Nov 25;264(33):196548. 75. KAUFMAN S. Studies on the mechanism of the enzymatic conversion of phenylalanine to tyrosine. J Biol Chem 1959 Oct;234:2677 -82. 76. Vasquez -Vivar J, M artasek P, Whitsett J, Joseph J, Kalyanaraman B. The ratio between tetrahydrobiopterin and oxidized tetrahydrobiopterin analogues controls superoxide release from endothelial nitric oxide synthase: An EPR spin trapping study. Biochem J 2002 Mar 15;362(Pt 3 ):7339. 77. Hurshman AR, Krebs C, Edmondson DE, Huynh BH, Marletta MA. Formation of a pterin radical in the reaction of the heme domain of inducible nitric oxide synthase with oxygen. Biochemistry 1999 Nov 30;38(48):15689-96. 78. Schmidt PP, Lange R, Gorren AC, W erner ER, Mayer B, Andersson KK. Formation of a protonated trihydrobiopterin radical cation in the first reaction cycle of neuronal and endothelial nitric oxide synthase detected by electron paramagnetic resonance spectroscopy. J Biol Inorg Chem 2001 Feb;6(2):1518. 79. Vasquez -Vivar J, Kalyanaraman B, Martasek P, Hogg N, Masters BS, Karoui H, Tordo P, Pritchard KA,Jr. Superoxide generation by endothelial nitric oxide synthase: The influence of cofactors. Proc Natl Acad Sci U S A 1998 Aug 4;95(16):9220-5. 80. Xia Y Tsai AL, Berka V, Zweier JL. Superoxide generation from endothelial nitric oxide synthase. A Ca2+/calmodulin dependent and tetrahydrobiopterin regulatory process. J Biol Chem 1998 Oct 2;273(40):25804-8.

PAGE 75

75 81. Laursen JB, Somers M, Kurz S, McCann L, Warnholtz A Freeman BA, Tarpey M, Fukai T, Harrison DG. Endothelial regulation of vasomotion in apoE -deficient mice: Implications for interactions between peroxynitrite and tetrahydrobiopterin. Circulation 2001 Mar 6;103(9):12828. 82. Hattori Y, Hattori S, Wang X, Sato h H, Nakanishi N, Kasai K. Oral administration of tetrahydrobiopterin slows the progression of atherosclerosis in apolipoprotein E-knockout mice. Arterioscler Thromb Vasc Biol 2007 Apr;27(4):86570. 83. Kaufman S. A protein that stimulates rat liver phenylalanine hydroxylase. J Biol Chem 1970 Sep 25;245(18):4751-9. 84. Nakanishi N, Hasegawa H, Watabe S. A new enzyme, NADPH dihydropteridine reductase in bovine liver. J Biochem 1977 Mar;81(3):681 -5. 85. Burg AW, Brown GM. The biosynthesis of folic acid. 8. purification and properties of the enzyme that catalyzes the production of formate from carbon atom 8 of guanosine triphosphate. J Biol Chem 1968 May 10;243(9):2349-58. 86. Katusic ZS, Stelter A, Milstien S. Cytokines stimulate GTP cyclohydrolase I gene expression in cultur ed human umbilical vein endothelial cells. Arterioscler Thromb Vasc Biol 1998 Jan;18(1):27-32. 87. Linscheid P, Schaffner A, Blau N, Schoedon G. Regulation of 6pyruvoyltetrahydropterin synthase activity and messenger RNA abundance in human vascular endothelial cells. Circulation 1998 Oct 27;98(17):1703-6. 88. Huang A, Zhang YY, Chen K, Hatakeyama K, Keaney JF,Jr. Cytokine-stimulated GTP cyclohydrolase I expression in endothelial cells requires coordinated activation of nuclear factor kappaB and Stat1/Stat3. Circ R es 2005 Feb 4;96(2):164 -71. 89. Kaspers B, Gutlich M, Witter K, Losch U, Goldberg M, Ziegler I. Coordinate induction of tetrahydrobiopterin synthesis and nitric oxide synthase activity in chicken macrophages: Upregulation of GTP -cyclohydrolase I activity. Comp Biochem Physiol B Biochem Mol Biol 1997 Jun;117(2):209-15. 90. Werner ER, Werner -Felmayer G, Fuchs D, Hausen A, Reibnegger R, Yim JJ, Wachter H. Biochemistry and function of pteridine synthesis in human and murine macrophages. Pathobiology 1991;59(4):276-9. 91. G upta S, Fredericks S, Schwartzman RA, Holt DW, Kaski JC. Serum neopterin in acute coronary syndromes. Lancet 1997 Apr 26;349(9060):1252-3. 92. Curtius HC, Heintel D, Ghisla S, Kuster T, Leimbacher W, Niederwieser A. Biosynthesis of tetrahydrobiopterin in man. J Inherit Metab Dis 1985;8 Suppl 1:2833.

PAGE 76

76 93. Nichol CA, Lee CL, Edelstein MP, Chao JY, Duch DS. Biosynthesis of tetrahydrobiopterin by de novo and salvage pathways in adrenal medulla extracts, mammalian cell cultures, and rat brain in vivo. Proc Natl Acad Sci U S A 1983 Mar;80(6):154650. 94. Chalupsky K, Cai H. Endothelial dihydrofolate reductase: Critical for nitric oxide bioavailability and role in angiotensin II uncoupling of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A 2005 Jun 21;102(25):905661. 95. Guzik TJ, West NE, Pillai R, Taggart DP, Channon KM. Nitric oxide modulates superoxide release and peroxynitrite formation in human blood vessels. Hypertension 2002 Jun;39(6):108894. 96. Sasaki N, Yamashita T, Takaya T, Shinohara M, Shiraki R, Takeda M, E moto N, Fukatsu A, Hayashi T, Ikemoto K, Nomura T, Yokoyama M, Hirata K, Kawashima S. Augmentation of vascular remodeling by uncoupled endothelial nitric oxide synthase in a mouse model of diabetes mellitus. Arterioscler Thromb Vasc Biol 2008 Jun;28(6):106 8 -76. 97. Pannirselvam M, Simon V, Verma S, Anderson T, Triggle CR. Chronic oral supplementation with sepiapterin prevents endothelial dysfunction and oxidative stress in small mesenteric arteries from diabetic (db/db) mice. Br J Pharmacol 2003 Oct;140(4):701-6. 98. Worthley MI, Kanani RS, Sun YH, Sun Y, Goodhart DM, Curtis MJ, Anderson TJ. Effects of tetrahydrobiopterin on coronary vascular reactivity in atherosclerotic human coronary arteries. Cardiovasc Res 2007 Dec 1;76(3):539-46. 99. Mayahi L, Heales S, Owen D, Casas JP, Harris J, MacAllister RJ, Hingorani AD. (6R) -5,6,7,8-tetrahydroL -biopterin and its stereoisomer prevent ischemia reperfusion injury in human forearm. Arterioscler Thromb Vasc Biol 2007 Jun;27(6):13349. 100. Cai S, Khoo J, Mussa S, Alp NJ, Channon KM. Endothelial nitric oxide synthase dysfunction in diabetic mice: Importance of tetrahydrobiopterin in eNOS dimerisation. Diabetologia 2005 Sep;48(9):1933 40. 101. Griffith OW. Determination of glutathione and glutathione disulfide using glutathione reductase and 2vinylpyridine. Anal Biochem 1980 Jul 15;106(1):20712. 102. Huang A, Vita JA, Venema RC, Keaney JF,Jr. Ascorbic acid enhances endothelial nitric oxide synthase activity by increasing intracellular tetrahydrobiopterin. J Biol Chem 2000 Jun 9;275(23):17399406.

PAGE 77

77 103. Crabtree MJ, Tatham AL, Hale AB, Alp NJ, Channon KM. Critical role for tetrahydrobiopterin recycling by dihydrofolate reductase in regulation of endothelial nitric oxide synthase coupling: Relative importance of the de novo biopterin synthesis versus salvage pathways. J Biol Chem 2009 Oct 9;284(41):28128 -36. 104. Sugiyama T, Levy BD, Michel T. Tetrahydrobiopterin recycling, a key determinant of endothelial nitri c oxide synthase dependent signaling pathways in cultured vascular endothelial cells. J Biol Chem 2009 May 8;284(19):12691700. 105. Pennathur S, Heinecke JW. Mechanisms for oxidative stress in diabetic cardiovascular disease. Antioxid Redox Signal 2007 Jul;9(7):95569. 106. Dumitrescu C, Biondi R, Xia Y, Cardounel AJ, Druhan LJ, Ambrosio G, Zweier JL. Myocardial ischemia results in tetrahydrobiopterin (BH4) oxidation with impaired endothelial function ameliorated by BH4. Proc Natl Acad Sci U S A 2007 Sep 18;104(38): 150816. 107. Melpomeni Peppa, Jaime Uri barri, Helen Vlassara. Glucose, a dvanced glycation end p roducts, and diabetes c omplications: what is new and what w orks Clinical Diabetes 2003 Nov 4; (21):186-187. 108. Barlovic DP, Thomas MC, Jandeleit -Dahm K Cardiovascular Disease: What's All the AGE/RAGE About? Cardiovasc Hematol Disord Drug Targets 2009 Dec 30;10;1(9):7-15.

PAGE 78

78 BIOGRAPHICAL SKETCH Patrick Kearns graduated from The Ohio State University in 2006 with a Bachelor of Science in biology. Pat moved to Florida, in 2008, where he resumed vascular r esearch work in Dr. Cardounels lab at the University of Florida. Here, he enrolled in t he m asters program of medical s ciences