<%BANNER%>

Cdkn2c

Permanent Link: http://ufdc.ufl.edu/UFE0041722/00001

Material Information

Title: Cdkn2c A Candidate Gene for the Sle2c1 Lupus Susceptibility Locus
Physical Description: 1 online resource (47 p.)
Language: english
Creator: Vallurupalli, Anusha
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: b1acells, cdkn2c, sle
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Systemic Lupus Erythomatosus (SLE) is a multifactorial and multigenic autoimmune disease characterized by autoantibodies and chronic inflammation in affected tissues. Multiple lupus susceptibility loci have been identified using mouse models. Congenic strains developed from the lupus-susceptible NZM2410 (New Zealand Mixed) mice have been used to study the role of individual genes in the pathogenesis of SLE. The Sle2 locus is responsible for the generation of autoreactive B cells by lowering BCR (B-cell Receptor) thresholds. Sle2 congenic mice also have increased age-dependent accumulation of the B1a cell population in the peritoneal cavity. The Sle2 locus has been further characterized into three independent loci: Sle2a, Sle2b and Sle2c. The increased B1a cell phenotype has been mapped to a shorter locus termed Sle2c1. The purpose of my study was to screen candidate genes in the Sle2c1 locus for polymorphisms associated with the Sle2c1 phenotypes. Among these candidate genes, we found that there is decreased mRNA expression of Cdkn2c (cyclin-dependent kinase inhibitor 2C) in Sle2c1 mice as compared to C57BL/6 (B6) controls. Cdkn2c is an INK4 family cyclin kinase inhibitor and regulates cell cycling by inhibiting CDK4 and CDK6. Cdkn2c also regulates plasma cell maturation by causing G1 arrest. Due to decrease in expression of Cdkn2c, Sle2c1 mice have decreased responses to T cell-dependent immunization (TD) as evidenced by decreased antibody secretion. There is also an increased proliferation of B1a cells associated with the decreased Cdkn2c expression. We found a novel single base pair polymorphism in the highly conserved promoter of Cdkn2c. Importantly, the identified single nucleotide polymorphism (SNP) was only observed in Sle2c recombinants with increased B1a cell numbers and decreased Cdkn2c expression. The mutated sequence in Sle2c1 mice creates an additional YY1 binding site, which may be the cause of decreased Cdkn2c expression. Hence, we believe that the polymorphism in the promoter is responsible for decreased expression of Cdkn2c and increased B1a cell numbers in Sle2c1 mice.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Anusha Vallurupalli.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Morel, Laurence.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041722:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041722/00001

Material Information

Title: Cdkn2c A Candidate Gene for the Sle2c1 Lupus Susceptibility Locus
Physical Description: 1 online resource (47 p.)
Language: english
Creator: Vallurupalli, Anusha
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: b1acells, cdkn2c, sle
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Systemic Lupus Erythomatosus (SLE) is a multifactorial and multigenic autoimmune disease characterized by autoantibodies and chronic inflammation in affected tissues. Multiple lupus susceptibility loci have been identified using mouse models. Congenic strains developed from the lupus-susceptible NZM2410 (New Zealand Mixed) mice have been used to study the role of individual genes in the pathogenesis of SLE. The Sle2 locus is responsible for the generation of autoreactive B cells by lowering BCR (B-cell Receptor) thresholds. Sle2 congenic mice also have increased age-dependent accumulation of the B1a cell population in the peritoneal cavity. The Sle2 locus has been further characterized into three independent loci: Sle2a, Sle2b and Sle2c. The increased B1a cell phenotype has been mapped to a shorter locus termed Sle2c1. The purpose of my study was to screen candidate genes in the Sle2c1 locus for polymorphisms associated with the Sle2c1 phenotypes. Among these candidate genes, we found that there is decreased mRNA expression of Cdkn2c (cyclin-dependent kinase inhibitor 2C) in Sle2c1 mice as compared to C57BL/6 (B6) controls. Cdkn2c is an INK4 family cyclin kinase inhibitor and regulates cell cycling by inhibiting CDK4 and CDK6. Cdkn2c also regulates plasma cell maturation by causing G1 arrest. Due to decrease in expression of Cdkn2c, Sle2c1 mice have decreased responses to T cell-dependent immunization (TD) as evidenced by decreased antibody secretion. There is also an increased proliferation of B1a cells associated with the decreased Cdkn2c expression. We found a novel single base pair polymorphism in the highly conserved promoter of Cdkn2c. Importantly, the identified single nucleotide polymorphism (SNP) was only observed in Sle2c recombinants with increased B1a cell numbers and decreased Cdkn2c expression. The mutated sequence in Sle2c1 mice creates an additional YY1 binding site, which may be the cause of decreased Cdkn2c expression. Hence, we believe that the polymorphism in the promoter is responsible for decreased expression of Cdkn2c and increased B1a cell numbers in Sle2c1 mice.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Anusha Vallurupalli.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Morel, Laurence.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041722:00001


This item has the following downloads:


Full Text

PAGE 1

1 CDKN2C: A CANDIDATE GENE FOR THE SLE2C1 LUPUS SUSCEPTIBILITY LOCUS By ANUSHA VALLURUPALLI A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE O F MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Anusha V allurupalli

PAGE 3

3 To my mother who has the unfailing confidence in me and who has alway s stood by me and encouraged me

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my parents for their unfailing support confidence and always being there for me I would thank my brother for continuous encouragement. I would like to thank my grand parents for believing in me. I thank my mentor Dr. Laurence Morel for advice, guidance and support with the project. I thank my committee members for their advice and guidance. I thank Dr. Zhiwei Xu for guidance in the whole project and help with the experiments. I thank Daniel Perry for help with flow cytometry. I would like to thank Dr. Haitao Niu for help with imm unization experiments. I would like to acknowledge my lab members Allison Sang and Dr. Harihara Potula for help in the lab and stimulating discussions. I also thank Leilani Zeumer Xuekun Su and Nathan Weinstock for excellent animal care

PAGE 5

5 TABLE OF CONTEN TS page ACKNOWLEDGMENTS ...................................................................................................... 4 LIST OF TABLES ................................................................................................................ 6 LIST OF FIGURES .............................................................................................................. 7 ABSTRACT .......................................................................................................................... 8 CHAPTER 1 INTRODUCTION ........................................................................................................ 10 2 MATERIALS AND METHODS ................................................................................... 13 Mice ............................................................................................................................. 13 Cell Preparation .......................................................................................................... 13 Immunization ............................................................................................................... 14 Flow Cytometry ........................................................................................................... 14 Polyclonal in Vitro Stimulation of B and B1a Cells .................................................... 14 RNA Isolation and RT -PCR (Reverse Transcript ion PCR) ....................................... 15 Sequencing of the Cdkn2c Exons, Promoter and 3' end .......................................... 15 Antibody Measurements ............................................................................................. 16 Proliferation Assays .................................................................................................... 16 Statistical Analysis ...................................................................................................... 16 3 RESULTS .................................................................................................................... 17 Sle2c1 Mice have Decreased Expression of Cdkn2c ............................................... 17 Decreased Cdkn2c Expression Results in Decreased T Dependent Immune Responses in Sle2c1 Mice ...................................................................................... 17 Cdkn2c Expression Remains Decreased in Sle2c1 Mice after Polyclonal Activation of Splenic B Cells and Peritoneal Cavity B1a Cells in Vitro .................. 19 Decreased Cdkn2c Expression is Associated with Increased Proliferation of B1a Cells ................................................................................................................. 20 A Novel Polymorphism in the Cdkn2c Promoter is Responsible for Decreased Cdkn2c Expression in Sle2c1 Mice ........................................................................ 21 4 DISCUSSION .............................................................................................................. 23 LIST OF REFERENCES ................................................................................................... 43 BIOGRAPHICAL SKETCH ................................................................................................ 47

PAGE 6

6 LIST OF TABLES Table page 2 -1 List of murine Cdkn2c primers used for sequencing. ............................................ 27 3 -1 Ge nes contained within the Sle2c1 locus between Rs28132547 and the D4MIT278 microsatellite marker. ........................................................................... 28

PAGE 7

7 LIST OF FIGURES Figure page 1 -1 Role of Cdkn2c (p18INK4c) in cell cycle regulation. ............................................. 29 3 -1 Recombinant map of congenic mice. .................................................................... 30 3 -2 Cdkn2c mRNA expression by REAL time PCR. ................................................... 31 3 -3 Decreased antibody secretion after primary TD NP19-KLH immunization.. ........ 32 3 -4 Decreased antibody secretion after secondary T D NP19 KLH immunization.. ... 33 3 -5 Cdkn2c mRNA expression by REAL time PCR after immunization. ................... 34 3 -6 Relative Cdkn2c mRNA expres sion in in vitro LPS and anti IgM stimulated B cells.. ....................................................................................................................... 35 3 -7 Cdkn2c mRNA expression in peritoneal cavity B1a cells.. ................................... 36 3 -8 Tot al IgM levels after in vitro Stimulation.. ............................................................. 37 3 -9 In vitro cell proliferation assay of total splenocytes .............................................. 38 3 -10 In vitro cell proliferation assay of peritoneal cavity cells ...................................... 39 3 -11 Cdkn2c promoter sequence and single nucleotide polymorphism (SNP).. .......... 40 3 -12 Correlation of SNP in promoter region with Cdkn2c expression.. ........................ 41 3 -13 Predicted transcription factor binding to Sle2c1 Cdkn2c promoter.. .................... 42

PAGE 8

8 Abstract of T hesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CDKN2C: CANDIDATE GENE OF SLE2C1 LUPUS SUSCEPTIBILITY LOCUS B y Anusha Vallurupalli May 2010 Chair: Laurence Marguerite Morel Major: Medical Sciences Systemic Lupus Erythomatosus (SLE) is a multifactorial and multigen ic autoimmune disease characterized by autoantibodies and chronic inflammation in affected tissues. Multiple lupus susceptibility loci have been identified using mouse models. Congenic s trains developed from the lupus -susceptible NZM2410 (New Zealand Mixed) mice have been used to study the role of individual genes in the pathogenesis of SLE. The Sle2 locus is responsible for the gen eration of autoreactive B cells by lowering BCR (B -cell Receptor) threshold s Sle2 congen ic mice also have increased age dependent accumulation of the B1a cell population in the peritoneal cavity. The Sle2 locus has been further char acterized in to three independent loci: Sle2a, Sle2b and Sle2c The increased B1a cell phenotype has been mapped to a shorter locus termed Sle2c1. The purpose of my study was to screen candidate genes in the Sle2c1 locus for polymorphisms associated with the Sle2c1 phenotypes. Am ong these candidate genes, we found that there is decreased mRNA expression of Cdkn2c (cyclin dependent kinase inhibitor 2C ) in Sle2c1 mice as compared to C57BL/6 (B6) controls. Cdkn2c is an INK4 family cyclin kinase inhibitor and regulates cell cycling by inhibiting CDK4 and CDK6. Cdkn2c also regulates plasma cell maturation by causing G1 arrest.

PAGE 9

9 Due to decrease in expression of Cdkn2c Sle2c1 mice have decreased responses to T cell dependent immunization (TD) as evidenced by decreased antibody secretion. There is also an increased proliferation of B1a cells associated with the decreased Cdkn2c expression We found a novel single base pair polymorphism in the highly conserved promoter of Cdkn2c Importantly, the identified single nucleotide polymorphism (S NP) was only observed in Sle2c recombinants with increased B1a cell numbers and decreased Cdkn2c expression. The mutated sequence in Sle2c1 mice creates an additional YY1 binding site, which may be the cause of decreased Cdkn2c expression. Hence, we believ e that the polymorphism in the promoter is responsible for decreased expression of Cdkn2c and increased B1a cell numbers in Sle2c1 mice.

PAGE 10

10 CHAPTER 1 INTRODUCTION Systemic Lupus Erythomatosus (SLE) is an autoimmune disease characterized by acute and chronic inflammation and autoantibody production. The autoantibodies are mainly against nuclear antigens. Kidneys, skin, joints and other organs are variably involved due to destruction by immune complex deposition and chronic inflammation. It is about 9 times mo re common in women than men. The etiology is multifactorial with polymorphisms in multiple genes, potentiated by e nvironmental factors and drugs 1. Murine mouse models of SLE have played a major role in understanding the disease pathogenesis. NZM (New Zeal and Mixed) 2410 is a recombinant inbred strain developed from F1 generation cross between NZB (New Zealand Black) and NZW (New Zealand White) inbred strain. NZM2410 mice are highly susceptible to SLE and develop a highly penetrant form of lupus at an early age23. As a result this strain forms an ideal mouse model to study the pathogenesis of SLE. Four major lupus susceptibility loc have been identified on NZM2410 mice23. Sle1 on chromosome 1, Sle2 on chromosome 4, Sle3 on chromosome 7 and H2 locus on chromosome 17 confer strong lupus susceptibility23. NZM2410 has been cross bred to lupus resistant C57BL/6 (B6) mice and congenic mice strains were developed to study these susceptibility loci independently 1. By using congenic models, it has been shown that each locus breaches tolerance to self antigens at different levels and on different cell types 2 4 3, 5. Among the four lupus susceptibility loci t he Sle2 locus was shown to alter B cell responses to antigens 2. It lowers the threshold of BCR (B -cell Receptor) activation leading to B cell hyperactivity, increased levels of polyclonal/polyreactive IgM and increased B1a cell numbers in the peritoneal cavity 2. The Sle2 locus alone is

PAGE 11

11 insufficient in generating anti -nuclear antibodies but can influence B cell ant igen specificity and potentiate autoantibody secretion from the anti -DNA 56R immunoglobulin heavy chain transgene 4. It causes a full blown disease when bred with both Sle1 and Sle3 locus on to triple congenic mice 6. Three independent loci have been identified within the Sle2 locus and their phenotypes have been characterized previously 7.The increased B1a cell phenotype has been mapped to Sle2c locus 8.In summary, the Sle2c locus independently results in increased B1a cell numbers in the peritoneal cavity in an age dependent manner 8, ( Xu et al unpublished data). The phenotype of increased B1a cell number h as been further narrowed down to the Sle2c1 locus which also have increased amounts of IgM autoantibodies (Xu et al unpublished) but this locus is n ot essential for development of lupus nephritis 7. Sle2c1 mice have normal life span as B6 mice B1a cells reside mainly in the peritoneal cavity and other body cavities. They are mainly derived from fetal liver and are kn own to play a role in innate immunity by producing natural polyclonal IgM antibodies. They also secrete IgG3 and IgA antibodies 9. They are long lived and undergo self renewal 10. They are characterized by surface expression of CD5 (Ly -1) and high levels of IgM along with low levels of B220 10. They differ from conventional follicular splenic B2 (B2) cells in having constitutive up regulation of plasma cell differentiation markers Blim p 1 and XBP -1 11. They also have constitutively activated STAT 3 and higher levels of Cyclin D2 involved in differential cell cycle regulation 12 13. They can also present antigens to T cells in lupus prone mice 14. B1a cells recognize self antigens and secrete polyclonal IgM antibodies with a skewed repertoire against mostly pho s photidylcholine (PtC) 15. They respond to phorbol ester

PAGE 12

12 stimulation faster than B2 cells and do not need to undergo G1 arrest f or antibody secretion 13. Cdkn2c also known as p18 is an INK4c family cyclin kinase inhibitor. These cyclin kinase inhibitors are differentially expressed in different tissu es. Cdkn2c is preferentially expressed in B lymphocytes, pituitary gland and pancreas 16 17 18. It binds to CDK4 and CDK6 and prevents their binding to D type cyclins, thus preventing cell cycle progression resulting in G1 arrest (Fig 1 -1 ). Cdkn2c was shown to induce G1 arrest in B cells and t hus promote their maturation into plasma cells 19 20. Cdkn2c homozygous knockout mice have defective primary and secondary immune responses to T dependent antigens due to a defect in plasma cell maturation 21. This gene has also been implicated in development of many B cells tumors due to its role in cell cycle reg ulation 16. Cd kn2c has also been shown to play a role in T cell proliferation 22. Here we show that defective Cdkn2c expression in Sle2c1 mice is responsible for the phenotype observed in these mice.

PAGE 13

13 CHAPTER 2 MATERIALS AND METHODS Mice C57BL/6 (B6) mice were or iginally obtained from the Jackson L aboratory. The production of B6.NZM 2410 Sle2 mice has been described previously 1. Sle2 is a 26cM interval on murine chromosome 4 and confers lupus susceptibility around the D4MIT 9 marker 23. The B6.NZM 2410 Sle2c1 sub-congenic mice carry a 6.28 Mb region between and excluding the SNP Rs28132547 and the D4MIT278 microsatellite marker. Unless specified, all experiments were conducted with age matched mice and two to seven mice per group. Both males and females were used. All mice were bred and maintained at the University of Florida in specific pathogen -free conditions. All experiments were conducted ac cordi ng to protocols approved by the University of Florida Institutional Animal Care and Use Committee. Cell Preparation Peritoneal Cavity (PerC) cells were obtained by f lushing the cavity with 10% Fetal Bovine Serum (FBS) in Phosphate Buffered Saline ( PBS). Pe rC B1a cells were isolated in a three-step process. Macrophages were depleted with panning of adherent cells for 2 hours in a 5% CO2 incubator at 37C. Then, T cells were removed by positive selection with a biotinylated antibody cocktail of anti -Thy1.2 (P an T cell marker) and anti and removed by MACS columns after coating with anti biotin microbeads. B1a cells were positively selected in the final step by using the anti -CD5 positive selection kit (Milteyni). B and T cells were isolated from spl een using B and T cell selection kits from Milteyni after deleting the RBC's (Red Blood Cells) with 0.83% ammonium chloride.

PAGE 14

14 Immunization Immunization experiments were done as described previously 24. T -dependent (TD) immu ne 19 ( 4 Hydroxy 3 -nitrophenylacetyl) -KLH (Keyhole Limpet Hemocyanin) from Biosearch Technologies along with Alum (Pierce Biotechnology) at a 1:1 ratio. Mice were sacrificed after 7 days to check the primary immunization response. For secondary immunization response, mice were boosted with the same dose of NP19KLH and Alum 3 weeks after the primary immunization. Mice were sacrificed 10 days after the booster dose to check the secondary immunization response. Each experiment was done with a group of two to seven mice. Two month old male and female mice were used. Each experiment was done twice. Flow Cytometry Isolated single cell suspensions were blocked in FACS (Fluorescence activated cell -sorting ) staining buffer (PBS, 5% horse serum, and 0.09% sodium azide) along with 10% rabbit serum and anti -CD16/32 (1:50). Cells were stained with Fluorescein ( FITC )-, Phycoerythrin ( PE )-, allophycocyani n (APC ) or biotin conjugated antibodies, followed by streptavidin PerCP Cy5.5 conjugation for biotin. Antibodies against CD5, B220, CD4, ontrols were purchased from BD B iosciences. Anti -24.Stained cells were analyzed on a FACScalibur cytometer (BD Biosciences, Mountain view, CA) and FCS software. Polyclonal in Vitro Stimulation of B and B1a C ells B cells were isolated from spleen and B1a cells were isolated from per itoneal cavity of Sle2c1 and B6 mice as described above. B cells were stimulated with different doses (2g/ml, 4g/ml, 6g/ml and 8g/ml) of both (Lipopolysaccharide) LPS and anti -

PAGE 15

15 IgM and cultured for 24, 48 and 72 hours. B1a cells were stimulated with 5 g/ml of LPS for 48 hours. Supernata nts were stored at 80C for total IgM level measurement by ELISA (Enzyme linked immunosorbent assay) RNA I solation and RT PCR (Reverse Transcription PCR) RNA (Ribonucleic acid) isolation from single cell suspensions was done using the Qiagen RNeasy mini kit. RNA was quantified and cDNA (complementary Deoxyribonucleic acid) was prepared using the Promega reverse transcription kit. Reverse Transcription PCR (Polymerase Chain Reaction) was done for Cdkn2c using forward prim er 5' -CAGTCCTTCTGTCAGCCTCC-3' and reverse primer 5' CTCCGGATTTCCAAGTTTCA -3'. Band density was measured by Quality One software and Cdkn2c mRNA exp ression was measured as a ratio compared to actin mRNA expression. Quantitative RT -PCR was done using TaqM an probe Mm00483243_m1 (ABI). Cdkn2c mRNA expression was normalized to Gapdh expression. Quantitation was done by the comparative Ct method. Unimmunized B6 mice normalized Cdkn2c mRNA expressi on was used as control unless otherwise specified. Sequencing of the Cdkn2c Exons, P romoter and 3' end For DNA s equencing reactions, PCR was done with respective primers (Table 21). After amplification, PCR products were cleaned of dNTPs primers and extra buffer by using EXO SAP IT (USB). Then the sequenci ng reaction was done using Big D ye 3.0 cycle sequencing Amplification was done for 34 cycles at 94C for 10 seconds, 50C for 5 seconds, 60C for 2 minutes using both forward and reverse primers in separate reactions. Ethanol purification was done to extract DNA and samples were analyzed at the UF center for Epigenetics DNA sequencing core lab.

PAGE 16

16 Antibody M easurements Anti -NP IgM and IgG were quantified by ELISA using plates coated with NP3BSA (Bovin e serum albumin) or NP23BSA (Biosearch Tec in PBS 24. Diluted sera were incubated after blocking with blocking buffer M Secondary antibodies conjugated to the enzyme alkaline phosphatase were used to detect IgM and IgG (Southern Biotech). In the final step, substrate (4 nitrophenyl phosphate disodium salt hexahydrate from S igma) for the enzyme was used for developing and the optical density was read at 405nm o a 96well plate reader Tot al IgM and IgG were quantified as described previously 24. Proliferation A ssays For in vivo assessment, mice were injected with 100l of BrdU (Bromodeoxyuridine) intra-peritoneally (i.p). T otal splenocytes were isolated after 16 hours and flow cytometry was done for BrdU+ B, T and B1a cells. B cells were gated as B220+, T cells as CD4+ and B1a cells as CD5+ B220lo. For in vitro proli feration experiments, total splenocytes were isolated, labeled with CFSE (Carboxyfluorescein succinimidyl ester) (Roswell Park Memorial Institute medium) medium for 72 hours. Cells were stained with anti -CD 5 PE, anti -B220 APC and anti CD3biotin after 72 hours and flow analyzed for CFSE dilution. Statistic al A nalysis Unpaired t -tests were used to compare the B6 and B6.Sle2c1 congenic mice. Data was analyzed with Graph pad Prism 4.0 software. One tailed student t -test was used for statistical analysis 95% confidence interval was used and the p value was indicated in respective figures.

PAGE 17

17 CHAPTER 3 RESULTS Sle2c1 Mice have Decreased E xpression of Cdkn2c Previous results had narrowed the Sle2c1 lupus susceptibil ity locus to a 6.28 Mb region in between and excluding SNP Rs 28132547 and the D4MIT278 microsatellite marker, using the increased B1a cell number phenotype (Xu et al, unpublished). Several recombinant strains have been developed to further characterize t he locus (Fig. 2 1 ). According to Ensemble ( www.ensembl.org), there are 18 identified genes in the 6.28 Mb region (Table 3 1 ), among which 7 genes are shown to be important in immune cells 25 26 27 28 29 30 31 (Table 3 1 ). The level of mRNA expression for each of these 7 genes was compared between B6 and Sle2c1 splenocytes. A decrease in mRNA expression levels by quantitative RT -PCR of Cdkn2c in total splen ocytes was observed in B6.Sle2c1 mice compared to B6 mice (Fig. 3 2a ). mRNA expression levels were also lower in isolated splenic B (Fig. 3 2 b) and CD4+ T cells from spleen (Fig. 3 2 c). No difference in mRNA expression of other genes by RT -PCR was observed between the two congenic strains (data not shown). Decreased Cdkn2c Expression R esul ts in D e creased T Dependent Immune R esponses in Sle2c1 M ice Cdkn2c knockout mice have a decrease in primary immune response s and a pronounced de crease in secondary immun e response s to T -dependent immunization 21. A decrease in the amounts of secreted antibodies was observed in the knockout mice, though there was an increase in surface antibody positive cells. Also, increased numbers of cells were observed undergoing cell cycle. Sinc e, Sle2c1 mice have a decreased expression of Cdkn2c I hypothesized that there would be a de crease in humoral response to T dependent antigens as observed in Cdkn2c knockout mice. This

PAGE 18

18 would be manifested as a decrease in secreted antibodies. I performed T -dependent immunizations with NP -KLH and measured the anti -NP humoral immune response of Sle2c1 mice compared to B6 mice. Two month old mice were used for the experiments as these mice start accumulating B1a cells and have higher levels of IgM antibodies at a later age. There was a significantly lower amount of secreted anti NP antibodies after both primary and secondary immunizations (Fig. 3 3 Fig. 3 -4 ). Total IgM levels were significantly lower after primary immunization (Fig. 3 -3 ). Total IgG levels were lower consistently but the difference was not significant (Fig. 3 3 ). After secondary immunization total IgM and IgG levels were lower but the difference was not significant (Fig. 3 -4 ). Surface antibody positive cells were measured by flow cytometry an d no difference was observed (data not shown). A significant decrease in Cdkn2c mRNA expression as measured by quantitative RT -PCR was observed in Sle2c1 total splenocytes after primary and secondary immunization (Fig. 3 -5 a, Fig. 3 5 b). In B6 mice, a decr ease in Cdkn2c expression was observed after primary immunization compared to B6 unimmunized mice and an increased expression was observed after secondary immunization (Fig. 3 5 c). No significant changes were observed in Sle2c1 mice after primary and secondary immunization in expression levels compared to unimmunized Sle2c1 mice (Fig. 3 -5 c). Both primary and secondary immunization experiments were repeated twice and the results are replicable. Hence, there is decreased humoral immune response in Sle2c1 mice similar to that in Cdkn2c knockout mouse, though not to the same extent. Expression differences were also observed in protein levels as shown by Immunoblotting (Potula et al, unpublished). Also, a decrease in CDK4 bound Cdkn2c was observed in Sle 2c 1 mice by immunoprecipitation (Potula et

PAGE 19

19 al, unpublished). CDK6 bound Cdkn2c was same in both strains (Potula et al, unpublished). Cdkn2c Expression Remains D ecreased in Sle2c1 Mice after Polyclonal Activation of Splenic B Cells and Peritoneal Cavity B1a Cells in Vitro To examine the expression of levels of Cdkn2c mRNA and antibody secretion after polyclonal activation, we stimulated B lymphocytes isolated from spleen with LPS and anti -IgM. There should be an initial decrease and followed by an increase in Cdkn2c mRNA expression after stimulation in B6 mice compared to unstimulated relative expression at time zero. In Sle2c1 mice, the expression levels should remain low. After polyclonal activation, a decrease in relative Cdkn2c mRNA expression was observed in Sle2 c1 mice as with in vivo immunization (Fig. 3 -6 a, Fig. 3 -6 b). In B6 mice, there was a decrease in relative Cdkn2c expression at 24 hours at all doses of LPS and anti -IgM stimulation (Fig 3 6 a, Fig 3 6 b) followed by a significant increase at 48 and 72 hours (Fig 3 -6 a, Fig 3 -6 b). This initial decrease and subsequent increase was observed in B6 mice after in vivo T -dependent immunization indicating a tight regulation of Cdkn2c at the transcriptional level. These alterations were not observed in Sle2c1 mice both after in vitro polyclonal stimulation and i n vivo T -dependent immunization, indicating a defect in regulation of Cdkn2c expression at either genetic or epigenetic level. The level of Cdkn2c expression in B6 B1a cells remained unchanged after LPS stim ulation. In contrast a dramatic decrease in Cdkn2c expression was observed in Sle2c1 peritoneal B1a cells after stimulation (Fig. 3 7 ). We did not observe a decreased Cdkn2c expression in unstimulated Sle2c1 B1a cells as compared to B6 B1a cells. ELISA wa s done on the supernata nts collected from the culture and total IgM levels were measured for supernata nts from splenic B cells and peritoneal B1a cells. A

PAGE 20

20 decrease in total IgM antibody secretion was observed after in vitro stimulation of Sle2c1 splenic B2 cells compared to B6 similar to the invivo response s (Fig. 3 8 a). In contrast, an increase in total IgM antibody secretion was observed from Sle2c1 peritoneal B1a cells after stimulation (Fig 3 -8 b). Therefore, in vitro stimulated splenic B2 cells showed similar Cdkn2c mRNA levels and IgM antibody secretion as in vivo T dependent immunization. I believe that the differential regulation of maturation and antibody secretion in conventional B cells and peritoneal cavity B1a cells is responsible for the increa se in secretion of IgM antibodies was observed in Sle2c1 B1a cells 11 12 13 15. This difference may be the reason for increased IgM antibodies observed in Sle2c1 mice as they have increased age-dependent accumulation of peritoneal cavity B1a cells. De creased Cdkn2c Expression is A ssociated with Increased Proliferation of B1a C ells As shown in Fig. 1 1, Cdkn2c inhibi ts cell cycle prolifera tion by causing G1 arrest. A decrease in Cdkn2c expression should therefore result in increased proliferation of Sle2c1 B2 cells and other cells expressing Cdk n2c Cel l proliferation was measured in vivo by injecting Sle2c1 and B6 mic e with BrdU i.p. Sixteen hours later total splenocytes were isolated and BrdU+ cells were analyzed by flow cytometry using lineage specific markers. No difference was observed in BrdU+ cells B, B1a and T cells (data not shown). We then used an in vitro cell proliferation assay with CFSE labeled cells. Total splenocytes were stimulated with 10g/ml of LPS and cultured for 72 hours. Flow cytometric analysis was done and B, B1a and T cells were analyzed for CFSE dilution using lineage specific markers. An increase in proliferation as evidenced by CFSE dilution was observed in B1a cells in both spleen and peritoneal cavity (Fig. 3 9

PAGE 21

21 Fig 3 -10 ). As B1a cells constitute only a small percentage of total B cells, increase s in proliferation of B1a cells is not refle cted in total B cells (Fig. 3 9 Fig 3 -10 ). B1a cells from Sle2c1 mice show increased proliferation in vitro associated with a defect in Cdkn2c expression and may be the reason for increased accumulation of B1a cells in these mice. Cell cycle regulation is different in B1a and B2 cells and probably is the reason for no difference in proliferation of B2 cells 9 12 13. An increase in T cell proliferation was observed in spleen in Sle2c1 mice (Fig. 3 -9 ). This correlates with the decrea sed Cdkn2c mRNA expression in CD4+ T cells in Sle2c1 mice (Fig. 3 -2 c). The invitro increased cell proliferation of B1a cells was not observed in invivo BrdU injected mice. Possible explanation for this could be shorter time of BrdU exposure in the mice. We may see a difference in proliferation with increased time of BrdU exposure. A N ovel Polymorphism in the Cdkn2c Promoter is Responsible for D ecreased Cdkn2c Expression in Sle2c1 M ice We found significantly decreased mRNA and protein levels of Cdkn2c in Sle 2c1 mice. I sequenced the two exons of isoform 2 and we did not observe any sequence difference s in the exonic sequence of Cdkn2c between Sle2c1 and B6 mice. Then, I sequenced the previously described promoter and 3UTR regions of the Cdkn2c gene. The Cdkn 2c promoter has been identified as the 1600 bp (base pair) upstream region from isoform 2 32 33. I sequenced the whole 1600 bp region upstream of the +1 transcription start site of isoform 2 and observed a single nucleotide polymorphism (SNP) in th e highly conserved region 32 34 (Fig. 3 -11a) in Sle2c1 mice (Fig. 3 -11 b). The entire 1600bp region was sequenced in both Sle2c1 and B6 alleles. The C nucleotide in the B6 allele has been converted to T in the Sle2c1 allele. This 1359 C> T SNP wa s only observed in the recombinants mice with decreased Cdkn2c expression and

PAGE 22

22 increased B1a cells (Fig. 3 -12 ). I also observed that the SNP is homozygous in Sle2c1 mice. I later used the primer set 1 (Table 2 1) to sequence other recombinant strains and parent strains and looked specifically for the SNP. I also observed the mutation in the NZB parent strain of Sle2c1 locus and NZM2410 mice and but in the NZW mice. The mutation was observed only in the recombinant strains with increased B1a cell number. When a transcription factor binding prediction was done with mapper software35, we observed an extra predicted YY1 binding site in the mutated Sle2c1 promoter (Fig. 3 1 3 ). There is also a predicted loss of binding sites of NRF2 and Hunchback in Sle2c1 promoter. We also observed decreased luciferase activity from the Sle2c1 Cdkn2c promoter with the mutated sequence compared to the B6 Cdkn2c promoter in N I H3T3 cell lines (Potula et al unpublished). A 592 bp region including 373 bp of 3UTR region has also been sequenced and no difference was observed between Sle2c1 and B6 in this region (data not shown). Based on the correlation between Cdkn2c expression levels and phenotype of B1a cells in the congenic mice, along with the mutation in the promoter, we believe that this mutation is responsible for the decreased expression of Cdkn2c in Sle2c1 mice.

PAGE 23

23 CHAPTER 4 DISCUSSION As shown previously, Sle2 lowers the BCR activation threshold and results in increased amounts of autoreactive B cells. Sle2c1 mice have increased numbers of B1a cells in their peritoneal cavity 8. Sle2c 1 mice also have increased amounts of natural polyclonal IgM antibodies 4 2. By narrowing the Sle2 locus by using the increased B1a cell phenotype, we showed here that there is a decreased expression of Cdkn2c at both mRNA and protein (Potula et al unpublished) levels in Sle2c 1 mice. The expression difference correlates with phenotype based on the recombinant strains we have tested. B1a cells recognize self antigens and secrete polyclonal IgM antibodies against them. Their antibody repertoire is skewed towards recognizing self antigens, mostly phophotidylcholine (PtC) which cross -reacts with bacterial polysaccharide antige ns thus clearing capsular bacteria through the innate immune response 15 36 37. Anti PtC antibodies have been shown to cross -react with protease -treated autologous erythrocytes 15, 36. IgM and IgG antibodies secreted from B1a cells have been shown to react with ds -DNA 38. B1a cells have constitutively activated phophoSTAT3 resulting in higher levels of Cyclin D2 12 13. As a result B1a cells are shown to enter the cell cycle more efficiently as early as 2 -4 hours after stimulation 12. With decreased Cdkn2c expression and more available Cyclin D2, B1a cells from the Sle2c1 mice are predicted to progress to the S phase in cell cycle more efficiently resulting in increased numbers. Increased numbers of B1 cells in Sle2c1 mice are thus likely to be the reason for elevated IgM autoantibodies in these mice. We showed that there is an increased proliferation of B1a cells and increased IgM antibody secretion after in vitro stimulation in Sle2c1 mice. Decreased Cdkn2c -bound CDK4 was observed

PAGE 24

24 in Sle2c1 mice in immunoprecipitation. It has been previously shown that Cdkn2c is more dependent functionally on CDK4 to inhibit the cell cycle progression 39. If there is less bound CDK4, the n there would be more cyclin D2 bound CDK4 resulting in cell cycle progression to S phase. A microarray analysis of Sle2c1 and B6 B cells and B1a cells showed a significant difference in the cell cycle pathway in both cell subsets (Xu et al. unpublished). We plan to shown direct evidence of cell cycle progression in B1a cells in Sle2c1 mice by measuring levels of Cyclin D2 and CDK4 binding in Sle2c1 and B6 mice by immunoprecipitation. We are also plannin g to perform a kinase assay to test the levels of Retinoblastoma (Rb) phosphorylation in Sle2c1 and B6 mice. Since there is increased proliferation in Sle 2c 1 B1a cells, we should see an increased expression of proteins or protein modifications favoring cell cycle, increased cyclin D2-bound CDK4, and increased phosphorylation of Rb protein in Sle2c1 mice compared to B6. It has been shown that cyclin D3 is more essential for B cells compared to Cyclin D2 in some reports 40. Therefore, we also plan to look at Cyclin D3 bound CDK4 in Sle2c1 mice. We also plan to do a rescue of Cdkn2c in Sle2c1B1a cells with Cdkn2c -GFP lentiviral Transfection and test for changes in cell proliferation. If decrease in Cdkn2c expression is responsible for increased B1a cell proliferation, then we should observe a decrease in cell proliferation in Cdkn2c -GFP transfected Sle2c1 B1a cells compared to untransfected cells. B1a cells also have been shown to present antigens to T cells 41 42 43. They have been shown to express high levels of co -stimulatory molecules including CD80, CD86, CD24, lymphocyte functionassociated antigen 1 (LFA -1) and intracellular adhesion molecule 1 41. T cells have been sh own to undergo differentiation in to Th17 and Th1

PAGE 25

25 helper cells preferentially and less towards T reg phenotype in vitro after antigen presentation by B1a cells 42 43. Other phenotypes for Sle2c1 that have been identi fied were decreased IL2 secretion and significantly lower numbers of Treg cells (Xu et al unpublished). We are currently looking at Th17 cells in Sle2c1 mice. It may also be resulting in decreased IL2 secretion in Sle2c1 mice and thus resulting in loss o f Treg and Th17 balance. We also found a mutation in the highly conserved promoter (Fig. 3 -11a) sequence which results in decreased Cdkn2c transcription as observed in luciferase reporter assay. M apper software 35, pr e dicted that this mutated sequence results in an extra YY1 binding site. YY1 is a transcription factor and plays a role in cell cycle 44. YY1 can act as both transcriptional co activator and co-repressor and regulates gene expression. It has been shown to promote cell cycle progression by inhibiting the expression of Rb gene44. It has not been shown to regulate Cdkn2c expression but may be potentially down regulating Cdkn2c expression. Therefore, it could be potentially actin g as a co -repressor at Cdkn2c promoter, which will be investigated with a luciferase reporter assay with YY1 expression vector. We are also planning to do EMSA (Electrophoretic Mobility Shift Assay) and ChiP (Chromatin Immunoprecipitation) to test for the binding of YY1 to the Sle2c1 Cdkn2c promoter. We did not find any alterations in exonic sequence or 3UTR region. So, this mutation in promoter region m ight be likely resulting in decreased the C dkn2c expression possibly due to repression by YY1. A small percentage of SLE patients has de creased immune responses to immunizations and fail to mount an immune response against infections. In Sle2c1 mice, we observe a de creases humoral immune response to T -dependent antigens in

PAGE 26

26 Sle 2 c 1 mice due to de creased Cdkn 2c expression. Cdkn2c is also responsible for increased B1a cell numbers resulting in increased secretion of IgM autoantibodies. In both mice and humans, B1a cells constitute only a small percentage of total B cell population. So the increase in IgM antibodies may not result in increase in total serum antibodies in humans, but they may have more autoantibodies. It may also potentially be responsible for altering T cell homoeostasis in Sle2c1 mice. Cdkn2c may be one of the genes responsible for development o f SLE in human patients.

PAGE 27

27 Table 2 1. List of murine Cdkn2c primers used for sequencing. Region Forward primer Reverse primer Location amplified by primers* 1 Promoter 5' AGCCTCTAAGGGCCTCCGCC 3' 5' GCAACTGCTGCTACGGTTGCC 3' 1694 to 1226 2 Promoter 5' TGGGGGCGGGTTTTTCAACTCA 3' 5' GCGTCCGATGATGGGAAGGGT 3' 1352 to 854 3 Promoter 5' GCCGGAGGACCGCCAAGAAC 3' 5' TCTCCGGAGGCTGGTGGGTG3' 1000 to 564 4 Promoter 5' TCGCCGTGCACCGTCTTCAG 3' 5' GTCAGCTCAGACAACACCGCGA 3' 666 to 196 5 Promoter 5' TCT GGACTACCCCCTTCGGCT 3' 5' CCCGCCCCTCGATTCACACG 3' 351 to +56 6 3'UTR 5' TCGACTTGGCCAGGTTCTAT 3' 5' CACACTACACCAGGCTTCCA 3' +647 to +1239 7 Exon 1 5' CAGTCCTTCTGTCAGCCTCC 3' 5' CTCCGGATTTCCAAGTTTCA 3' +115 to +381 8 Exon 2 5 TTGTTGTGGCTCAAGAGCTG 3' 5' GCGGTGTTAGCCAATGAAAT 3' +356 to +1106 *All the locations were calculated relative to +1 transcription start site of isoform 2 excluding intronic sequence.

PAGE 28

28 Table 3 1. Gene s contained within the Sle2c1 locus betw een Rs28132547 and the D4MIT278 microsatellite marker. + based on 25 26 27 45 29 30 31 and BioGPS website ( http://biogps.gnf.org/ ). Start End Gene symbol Gene description Important in i mmune cells + 108673260 108734382 Nrd1 nardilysin, N arginine dibasic convertase, NRD convertase 1 108734260 108874821 Osbpl9 oxysterol binding protein like 9 108907090 108927174 Calr4 calreticulin 4 T cells 108952906 109060255 Eps15 epidermal growth factor receptor pathway substrate 15 109125504 109149588 Rnf11 ring finger protein 11 T cells 109333481 109339262 Cdkn2c cyclin dependent kinase inhibitor 2C (p18, in hibits CDK4) B,T cells 109349299 109634646 Faf 1 Fas associated factor B,T cells 109650630 1096 56289 Dmrta2 doublesex and mab3 related transcription factor like family A2 109876327 110024419 Elavl4 embryonic lethal, abnormal vision, Drosophila like 4 (Hu antigen D) Anti HU D antibodies are positive in autoimmunity 111392615 111501789 Spata6 spermatogenesis associated 6 111547980 111575523 Slc5a9 solute carrier family 5 (sodium/glucose cotransporter), member 9 114578887 114581478 Foxd2 forkhead box D2 T cells 114597752 114598618 Foxe3 forkhead box E3 114633245 114659751 Cmpk cytidine monophosphate (UMP CMP) kin ase 1 114672805 114715476 Stil Scl/Tal1 inter rupting locus BM(Bone marrow) 114729031 114744360 Tal1 T cell acute lymphocytic leukemia 1 BM 114761328 114766498 Pdzk1ip1 PDZK1 interacting protein 1 114778928 114806886 Cyp4x1 cytochrome P450, family 4, subfamily x, polypeptide 1

PAGE 29

29 Figure 11. Role of Cdkn2c (p18INK4c) in cell cycle regulation. CDK4/6 interacts with D type cyclins and phosphorylates Retinoblastoma (Rb) which then releases E2F factors and help cell cycle progression in to S phase from G1 phase. Cdkn2c inhibits interaction of C DK4/6 with D type cyclins thus preventing their phosphorylation of retinoblastoma protein. Figure has been adapted and mo dified from Neurosurgery Focus. (www.medscape.com/viewarticle/518154_2) Decr eased Cdkn2c will result in increased Rb phosphorylation and release of cell cycle arrest.

PAGE 30

30 Figur e 3 1. Recombinant map of congenic mice developed from Sle2c1 strain to further narrow the locus. Strain name of each mouse is shown on the lef t side. Genome of the congenic mice is B6 except for the filled region shown for each recombinant strain. On the right side, B1a cell phenotype is mentioned. The two highlighted boxes on the top represent the SNP and microsatellite marker showing the narrowed Sle2c1 locus in between them.

PAGE 31

31 A Figure 32. Cdkn2c mRNA expression by quantitative RT -PCR (normalized to GAPDH). A) Total splenocytes were used for quantitative RT -PCR. B) B cells were isolated from spleen by negative selection. C ) CD4+ T c ells isolated from spleen by positive selection. Quantitative Ct method was used to analyze the data. Normalized B6 Cdkn2c mRNA expression was used as control for comparison in comparative Ct method. Each dot in the figure represents a mouse The horizonta l line indicates the mean expression of the two samples. Both male and female mice were used. B C

PAGE 32

32 Figure 33. D ecreased invivo antibody secretion after primary TD NP19-KLH immunization. A) T otal IgM antibody level measured by ELISA and expressed as n g/ml. B) IgG antibodielevel measured by ELISA and expressed as ng/ml. C) Anti NP specific IgM antibody level measured by ELISA and expressed in OD (Optical density) measured at 405nm. D) Anti NP specific IgG antibody level measured by ELISA and expressed i n OD (O ptical density) measured at 405nm. Total of five male and female mice were used and the experiment was repeated twice. A B C D

PAGE 33

33 Figure 34. De creased invivo antibody secretion after secondary TD NP19KLH immunization. A) Total IgM antibody level meas ured by ELISA and expressed as ng/ml. B) IgG antibodie level measured by ELISA and expressed as ng/ml. C) Anti NP specific IgM antibody level measured by ELISA and expressed in OD (Optical density) measured at 405nm. D) Anti NP specific IgG antibody level measured by ELISA and expressed in OD (Optical density) measured at 405nm. Total of five male and female mice were used and the experiment was repeated twice. A B C D

PAGE 34

34 Figure 3 5. Cdkn2c mRNA expression by quantitative RT -PC R (normalized to GAPDH). A) Quantitative RT PCR done after primary immunization with NP19KLH from RNA of total splenocytes. Total of five male and female mice were used and the e xperiment was repeated twice. B) Quantitative RT PCR done after secondary immunization with NP 19 -KLH from RNA of total splenocytes. Total of nine male and female mice were used and the experiment was repeated twice. C ) Comparison of Cdkn2c mRNA expression pattern in Sle2c1 mice after primary and secondary immunization in relation to unimmunized mic e. Total splenocytes from the immunized mice were used. Taqman probes were used and comparative Ct method was used for quantization. Normalized B6 Cdkn2c mRNA expression was used as control for comparison in comparative Ct method. Sle2c1 mice have decreased Cdkn2c expression both after primary and secondary immunization resulting in decreased antibody secretion. C B A

PAGE 35

35 Figure 3 6. Relative Cdkn2c mRNA expression in invitro LPS and anti -IgM stimulated B2 cells. A ) Relative Cdkn2c expression in Sle2c1 and B6 LP S stimulated splenic B cells. B) Relative Cdkn2c mRNA expression in Sle2c1 and B6 anti IgM stimulated splenic B 2 cells. A decreased relative Cdkn2c mRNA expression was observed in Sle2c1 mice compared to B6. B2 cells were isolated from spleen and stim ulated at four different doses of either LPS or anti -IgM and cultured for 24, 48 and 72hours. Quantity one software was used to quantify bands and relative Cdkn2c mRNA expression is expressed as ratio to -actin mRNA expression. The relative expression has been compared to unstimulated B6 B2 cells at zero time point which is considered to be 1.0 Each line indicates the respective dose of either LPS or anti -IgM stimulation. Two female mice per strain were used. A B

PAGE 36

36 Figure 3 7. Cdkn2c mRNA expression in perit oneal cavity B1a cells. B1a cells were for 48 hours. REAL time PCR was done with RNA isolated from these cultured cell s. Taq man probes were used and comparative Ct method was used for quantization. Unstimulated normalized B6 B1a Cdkn2c mRNA expression was used as control. Cdkn2c mRNA expression was normalized to GAPDH. Total of three male and female mice per strain were used. As less number of B1a cells are obtained after isolation, cells from the all the three mice were combined for the experiment.

PAGE 37

37 Figure 3 8. Total IgM levels after i nvitro Stimulation. A) Superna ta nts from the in vitro LPS stim ulated splenic B 2 cells were collected and ELISA was done for total IgM levels. All the different doses were included in the same graph as there was little variation between different doses. 72 hour culture supernants were used here as 24 and 48 hour cultures very low levels of IgM to quantify. Two fema le mice per strain were used. B) Supernata nts from peritoneal cavity B1a levels were calculated by ELISA. Y axis indicates the level of IgM in ngml. Total IgM levels were high in Sle2c1 mice compared to B6 at the serial serum dilutions shown on the X axis. Total of three male and female mice per strain were used. As less number of B1a cells are obtained after isolation, cells from the all the three mice were combined for the experiment. A B

PAGE 38

38 Figure 3 9. In vitro cell proliferation measured after LPS stimulation. A) B1a cells gated as CD5+ B220lo. B) Total splenic B cells gated as B220+. C) Splenic B2 cells gated as B220hi CD5-. D) T cells gated as Total splenocytes labeled so rted for CFSE diluted cells. Black colored graphs represent B6 and green colored overlay represents Sle2c1 mice. The brown bar is the marker (M1) for CF SE diluted cells Two female mice per strain were used. A B C D

PAGE 39

39 Figure 3 10. In vitro cell proliferation measured after LPS stimulation. A) B1a cells gated as CD5+ B220lo. B) Total PerC B cells gated as B220+. C) PerC B2 cells gated as B220hi CD5-. D) T ce lls gated as Peritoneal cavity cells FACS sorted for CFSE diluted cells. Black colored graphs represent B6 and green colored overlay represents Sle2c1 mice. The brown bar is the marker (M1) for CFSE diluted cells. Two female mice per strain were used and the cells were combined due to low yield of peritoneal cavity cells. A B C D

PAGE 40

40 A 1391 1342 Mouse CCTAACTCGGCGGAGCCTCCTTAAAACTCTGCCGTTAAAATGGGGGCGGG Rat CCTAACTCCGCCGAGCCTCCTTAAAACTCTGCCGTTAAAATGGGGGCGGG Human TGCAACTCTGCCGAGCCTCCTTAAAACTCTGCCGTTAAAATGGGGGCGGG Dog TGCAACTCGGCCGAGCCTCCTTAAAACTCTGCCG TTAAAATGGGGGCGGG B 1585 CCGAACCCACCCCGCTTCGGCAGGGGAGACTAGCGAAGCGAGAGGGCAGGCGGGAGCGCC AGCGAACCCAGGCCCAGCGCGGGCAGAGAAGGGCGCAGGGCCGCGAGGGCGGAGCGAGCG GGCTGCCGGCCACTGCGCCGCCAGGGCGTTGGGCGGGGCGTGGGCGGGGCCCGGCCTTCC 1359 CGCTCCCGCGGCGCCCTAACTCGGCGGAGCCTCCTTAAAACTCTGCC/TGTTAAAATGGGGG CGGGTTTTTCAACTCAAAAAGCGCTCAATTTTTTTCTTTTCAAAAAAAGCTGATGAGGTC Figure 3 11. Cdkn2c promoter sequence. A) Promoter sequence compared between different species. The region is highly conser ved. The highlighted nucleotide is the base th at is altered in Sle2c1 mice. B) The promoter sequence of the mice along with the SNP highlighted at 1359 bp from th e start site of isoform 2. -1359 C> T is the SNP identified in Sle2c1 mice. A total of 300 bp of promoter region is shown.

PAGE 41

41 Figure 3 12. Correlation of SNP in promoter region with Cdkn2c expression. Different strains are shown. The boxed region is the genomic region from NZM2410 mice and the rest of the genome is from B6 mice. Cdkn2c expr ession is shown in the middle panel. The base pair observed in each strain is shown to extreme right. The parent strains NZB, NZM 2410, NZB and B6 are shown below along with the base pair. The Sle2c1 region of the NZM2410 is originally from NZB.

PAGE 42

42 Fig ure 313. Predicted transcription factor binding to Sle2c1 promoter. Mapper software was used to predict transcription factor binding to Sle2c1 promoter. The arrow points to the SNP location. The unfilled boxes represent the lost transcription factor bind ing sites of NRF2, Hunchback and GAMYB. The filled box represents the extra YY1 prediction site.

PAGE 43

43 LIST OF REFERENCES 1. Morel,L., Yu,Y., Blenman,K.R., Caldwell,R.A., & Wakeland,E.K. Production of congenic mouse strains carrying genomic intervals contain ing SLE -susceptibility genes derived from the SLE prone NZM2410 strain. Mammalian Genome 7, 335339 (1996). 2. Mohan,C., Morel,L., Yang,P., & Wakeland,E.K. Genetic dissection of systemic lupus erythematosus pathogenesis Sle2 on murine chromosome 4 l eads to B cell hyperactivity. J. Immunol. 159, 454465 (1997). 3. Morel,L. Mohan C, Yu Y, Croker BP, Tian N, Deng A, Wakeland EK. Functional dissection of systemic lupus erythematosus using congenic mouse strains. J. Immunol 158, 6019 -6028 (1997). 4. Liu,Y. Li L, Kumar KR, Xie C, Lightfoot S, Zhou XJ, Kearney JF, Weigert M, Mohan C. Lupus susceptibility genes may breach tolerance to DNA by impairing receptor editing of nuclear antigen-reactive B cells. J. Immunol. 179, 1340 1352 (2007). 5. M orel,L., Blenman,K.R., Croker,B.P., & Wakeland,E.K. The major murine systemic lupus erythematosus susceptibility locus, Sle1, is a cluster of functionally related genes. Proc. Natl. Acad. Sci. U. S. A. 98, 17871792 (2001). 6. Morel,L. Croker BP, Blenman KR, Mohan C, Huang G, Gilkeson G, Wakeland EK. Genetic reconstitution of systemic lupus erythematosus immunopathology with polycongenic murine strains. Proc. Natl. Acad. Sci. U. S. A. 97 6670 6675 (2000). 7. Xu,Z., Duan,B., Croker,B.P., Wakeland, E.K., & Morel,L. Genetic dissection of the murine lupus susceptibility locus Sle2: contributions to increased peritoneal B 1a cells and lupus nephritis map to different loci. J. Immunol. 175, 936 -943 (2005). 8. Xu,Z., Butfiloski,E.J., Sobel,E.S., & Mo rel,L. Mechanisms of peritoneal B 1a cells accumulation induced by murine lupus susceptibility locus Sle2. J. Immunol. 173 60506058 (2004). 9. Fagarasan,S., Watanabe,N., & Honjo,T. Generation, expansion, migration and activation of mouse B1 cells. I mmunological Reviews 176 205-215 (2000). 10. Duan,B. & Morel,L. Role of B -1a cells in autoimmunity. Autoimmun. Rev. 5, 403408 (2006). 11. Tumang,J.R., Frances,R., Yeo,S.G., & Rothstein,T.L. Cutting Edge: Spontaneously Ig-secreting B -1 cells violate the accepted paradigm for expression of differentiationassociated transcription factors. J. Immunol. 174, 3173 -3177 (2005).

PAGE 44

44 12. Karras,J.G, Wang Z, Huo L, Howard RG, Frank DA, Rothstein TL. Signal Transducer and Activator of Transcription3 (STAT3) Is C onstitutively Activated in Normal, Self -renewing B 1 Cells but Only Inducibly Expressed in Conventional B Lymphocytes. J. Exp. Med. 185, 1035 -1042 (1997). 13. Tanguay,D.A. Colarusso TP, Pavlovic S, Irigoyen M, Howard RG, Bartek J, Chiles TC, Rothstein TL. Early Induction of Cyclin D2 Expression in Phorbol Ester responsive B -1 Lymphocytes. J. Exp. Med. 189 16851690 (1999). 14. Mohan,C., Morel,L., Yang,P., & Wakeland,E.K. Accumulation of splenic B1a cells with potent antigenpresenting capability in NZ M2410 lupus prone mice. Arthritis and Rheumatism 41 1652 1662 (1998). 15. Carmack,C.E., Shinton,S.A., Hayakawa,K., & Hardy,R.R. Rearrangement and Selection of Vh11 in the Ly -1 B -Cell Lineage. J Exp Med 172, 371374 (1990). 16. Leone PE, Walker BA, Jenne r MW, Chiecchio L, Dagrada G, Protheroe RK, Johnson DC, Dickens NJ, Brito JL, Else M, Gonzalez D, Ross FM, Chen-Kiang S, Davies FE, Morgan GJ Deletions of CDKN2C in multiple myeloma: biological and clinical implications. Clinical Cancer Research 14 6033 6041 (2008). 17. Hossain MG, Iwata T, Mizusawa N, Qian ZR, Shima SW, Okutsu T, Yamada S, Sano T, Yoshimoto K. Expression of p18(INK4C) is down-regulated in human pituitary adenomas. Endocrine Pathology 20 114121 (2009). 18. Karnik SK, Hughes CM, Gu X, Rozenblatt -Rosen O, McLean GW, Xiong Y, Meyerson M, Kim SK. Menin regulates pancreatic islet growth by promoting histone methylation and expression of genes encoding p27Kip1 and p18INK4c. PNAS 102, 14659-14664 (2005). 19. Schrantz N Beney GE Auffredou MT Bourgeade MF Leca G Vazquez A The expression of p18 INK4c and p21 kip1cyclin dependent kinases is regulated differentially during human B cell differentiation. J Immunology 165 4346 4352 (2000). 20. Morse L, Chen D, Franklin D, Xiong Y, Chen -Ki ang S. Induction of cell cycle arrest and B cell terminal differentiation by CDK inhibitor p18(INK4c) and IL-6. Immunity 6 4756 (1997). 21. Tourigny,M.R. Ursini-Siegel J Lee H Toellner KM Cunningham AF Franklin DS Ely S Chen M Qin XF Xiong Y MacLennan IC Chen-Kiang S CDK inhibitor p18(INK4c) is required for the generation of functional plasma cells. Immunity 17, 179-189 (2002). 22. Kovalev GI, Franklin DS, Coffield VM, Xiong Y, Su L. An important role of CDK inhibitor p18(INK4c) in modul ating antigen receptor mediated T cell proliferation. J Immunology 15 3285 -3292 (2001).

PAGE 45

45 23. Morel,L., Rudofsky,U.H., Longmate,J.A., Schiffenbauer,J., & Wakeland,E.K. Polygenic control of susceptibility to murine systemic lupus erythematosus. Immunity 1 2 19229 (1994). 24. Niu,H., Sobel,E.S., & Morel,L. Defective B -cell response to T -dependent immunization in lupus -prone mice. Eur. J. Immunol. 38 3028 -3040 (2008). 25. Park MY, Jang HD, Lee SY, Lee KJ, Kim E. Fas associated factor -1 inhibits nuclear factor -kappaB (NF kappaB) activity by interfering with nuclear translocation of the RelA (p65) subunit of NF kappaB. J. Biol. Chem. 279 2544 2549 (2004). 26. Shembade N, Parvatiyar K, Harhaj NS, Harhaj EW. The ubiquitin editing enzyme A20 requires RNF1 1 to downregulate NF kappaB signalling. EMBO J 28, 513522 (2009). 27. Johansson CC, Dahle MK Blomqvist SR Grnning LM Aandahl EM Enerbck S Taskn K A winged helix forkhead (FOXD2) tunes sensitivity to cAMP in T lymphocytes through regulation of c AMP dependent protein kinase RIalpha. J. Biol. Chem. 278, 1757317579 (2003). 28. Benyahia B, Liblau R MerleBral H Tourani JM Dalmau J Delattre JY Cell mediated autoimmunity in paraneoplastic neurological syndromes with anti -Hu antibodies. Ann Neur ology 45 162167 (1999). 29. Fu H, Liu C, Flutter B, Tao H, Gao B. Calreticulin maintains the low threshold of peptide required for efficient antigen presentation. Mol. Immunol 46, 3198 3206 (2009). 30. Kim D, Xu M, Nie L, Peng XC, Jimi E, Voll RE, N guyen T, Ghosh S, Sun XH. Helix loophelix proteins regulate pre -TCR and TCR signaling through modulation of Rel/NF kappaB activities. Immunity 16 9 21 (2002). 31. Cheng Y, Zhang Z Slape C Aplan PD Cre -loxP mediated recombination between the SIL and SCL genes leads to a block in T -cell development at the CD4 CD8 to CD4+ CD8+ transition. Neoplasia 9 315-321 ( 2007 ). 32. Blais A, Mont D, Pouliot F, Labrie C. Regulation of the human cyclin-depende nt kinase inhibitor p18INK4c by the transcription factors E2F1 and Sp1 J. Biol. Chem. 30 31679-31693 (2002). 33. Tallack MR, Keys JR, Perkins AC. Erythroid Kruppel like factor regulates the G1 cyclin dependent kinase inhibitor p18INK4c. Journal of Molecular Biology 369, 313-321 (2007). 34. Marinescu,V.D., Kohane,I.S., & Riva,A. MAPPER: a search engine for the computational identification of putative transcription factor binding sites in multiple genomes. BMC. Bioinformatics. 6, 79 (2005).

PAGE 46

46 35. Mercol ino TJ, Arnold LW Hawkins LA Haughton G Normal mouse peritoneum contains a large population of Ly -1+ (CD5) B cells that recognize phosphatidyl choline. Relationship to cells that secrete hemolytic antibody specific for autologous erythrocytes. J Exp Med 168, 687-698 (1988). 36. Wang,H.S. & Clarke,S.H. Positive selection focuses the V(H)12B -cell repertoire towards a single B1 specificity with survival function. Immunological Reviews 197, 5159 (2004). 37. Ishida,D, Su L, Tamura A, Katayama Y, Kawai Y, W ang SF, Taniwaki M, Hamazaki Y, Hattori M, Minato N. Rap1 Signal Controls B Cell Receptor Repertoire and Generat ion of Self -Reactive B1a Cells. Immunity 24, 417-427 (2006). 38. Pei XH, Bai F, Tsutsui T, Kiyokawa H, Xiong Y. Genetic evidence for functional dependency of p18Ink4c on Cdk4. Molecular cell Biology 24, 6653 -6664 (2004). 39. Mataraza,J.M. Tumang JR, Gumina MR, Gurdak SM, Rothstein TL, Chiles TC. Disruption of Cyclin D3 Blocks Proliferation of Normal B -1a Cells, but Loss of Cyclin D3 Is Com pensated by Cyclin D2 in Cyclin D3-Deficient Mice. J Immunol 177, 787-795 (2006). 40. Wang CC, Chen JJ Yang PC Multifunctional transcription factor YY1: a therapeutic target in human cancer? Expert Opinion on Therapeutic Targets 10, 253-266 (2006). 41. Mohan,C., Morel,L., Yang,P., & Wakeland,E.K. Accumulation of splenic B1a cells with potent antigenpresenting capability in NZM2410 lupus prone mice. Arthritis Rheum 41 1652 -1662 (1998). 42. Zhong X, Lau S Bai C Degauque N Holodick NE Steven SJ Tumang J Gao W Rothstein TL. A novel subpopulation of B -1 cells is enriched with autoreactivity in normal and lupus -prone mice. Arthritis & Rheumatism 60, 3734 3743 (2009). 43. Zhong,X. Gao W, Degauque N, Bai C, Lu Y, Kenny J, Oukka M, Strom TB, Rot hstein TL. Reciprocal generation of Th1/Th17 and T(reg) cells by B1 and B2 B cells. Eur. J Immunol 37 (9):2405-10. (2007).

PAGE 47

47 BIOGRAPHICAL SKETCH Anusha Vallurupalli was born in 1985 in Gudivada, India. She is the eldest of two children and grew up in India In achieving her dream of becoming a physician-scientist, she completed her under -graduation and medical school in India. She graduated from medical school in August 2008 from Andhra Medical College, Visakhapatnam in India. While in the final year of medical school, she decided to get research experience enabling her to become a good scientist. She decided to come to Unites States of America (US ) to pursue her further studies. She appli ed for different masters degree programs and decided to join the Unive rsity of Florida. After completing medical school in India, she joined the Master in Molecular Genetics and Microbiology Program sponsored by the Interdisciplinary program (IDP), College of Medicine at University of Florida, Gainesville in Fall 2008. In Sp ring 2009, she was offered a position as graduate research assistant in Dr. Laurence Morel 's lab oratory in the Department of Pathology, Immunology and Laboratory Medicine for studying a congenic murine model of systemic lupus erythematosus.