<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2012-08-31.

Permanent Link: http://ufdc.ufl.edu/UFE0041625/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2012-08-31.
Physical Description: Book
Language: english
Creator: Allam, Ayman
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Ayman Allam.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Brown, Mary B.
Local: Co-adviser: Reyes, Leticia.
Electronic Access: INACCESSIBLE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041625:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041625/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2012-08-31.
Physical Description: Book
Language: english
Creator: Allam, Ayman
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Ayman Allam.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Brown, Mary B.
Local: Co-adviser: Reyes, Leticia.
Electronic Access: INACCESSIBLE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041625:00001


This item has the following downloads:


Full Text

PAGE 1

1 GENETIC MANIPULATIONS AND GENE REGULATION OF S1 PEPTIDASE (ctp A) EXPRESSION IN Mycoplasma mycoides SUBSP. capri By AYMAN B. ALLAM A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Ayman B. Allam

PAGE 3

3 ACKNOWLEDGMENTS I thank my committee members Drs. Mary Brown, Leticia Reyes, Ann ProgulskeFox, John Dame and Thomas Rowe for t heir time and advice. I am grateful for Dr. Mary Brown for making a home for me in her laboratory, her mentorship, and for creating a supportive environment for my professional development. I would like to thank Dr. Leticia Reyes for her friendship and for her help addressing and treating some of the shortcomings. I also thank members of our lab; Jan Stevenson, Lori Wendland, and Fiona Maunsell for their friendship and support I would like to acknowledge the Interdisciplinary Core of Biotechnology Researc h (ICBR) Proteomics Core Facility for their help with 2D gels, iTRAQ and MS data. The majority of the work was funded by USDA CSREES grant 9935204 and subcontract 6415100607 from the University of South Florida Center for Biological Defense (contract W911SR 06C 0023).

PAGE 4

4 TABLE OF CONTENTS ACKNOWLEDGMENTS .................................................................................................. 3 page LIST OF TABLES ............................................................................................................ 6 LIST OF FIGURE S .......................................................................................................... 7 ABSTRACT ..................................................................................................................... 8 CHAPTER 1 INTRODUCTION .................................................................................................... 10 Overview ................................................................................................................. 10 Genetic Regulation in Mycoplasmas ................................................................ 13 Tools for Genetic Manipulation in Mycoplasmas .............................................. 18 The Mycoides Cluster ....................................................................................... 22 Goals of Study and Summary of Findings ........................................................ 24 2 TARGETED HOMOLOGOUS RECOMBINATION IN MYCOPLASMA M YCOIDES SUBSP. CAPRI IS ENHANCED BY INCLUSION OF HETEROLOGOUS RECA ....................................................................................... 25 Introduction ............................................................................................................. 25 Materials and Methods ............................................................................................ 27 Mycoplasma Strains and Cultivation ................................................................ 27 PCR Primers and Conditions. ........................................................................... 27 Construction of Plasmids .................................................................................. 28 PEG8000 Mediated Chemical Transformation. ................................................ 31 Random and Targeted Transformation ............................................................ 31 Confirmation of Disruption of ctpA and Location of Insertion Sites ................... 33 Southern and Northern Blots ............................................................................ 33 R esults .................................................................................................................... 34 D iscussion .............................................................................................................. 36 3 TARGETED DELETION OF S41 PEPTIDASE IN MYCOPLASMA MYCOIDES SUBSP. CAPRI RESULTS IN STRESS RES PONSE, AND PERTURBED GLYCOLYSIS/GLUCONEOGESIS ......................................................................... 54 Introduction ............................................................................................................. 54 Proteomic Studies in Mycoplasmas .................................................................. 56 Materials and Methods ............................................................................................ 57 Mycoplasma Strains and Their Cultivation ....................................................... 57 Preparation of Protein Extracts for Proteomics ................................................. 58

PAGE 5

5 Proteome Profiling by 2 Dimensional Differential Gel Electrophoresis (2D DIGE) ............................................................................................................ 58 Differential Image Analysis of Protein Gels ...................................................... 59 Protein Spot Excision ....................................................................................... 60 Quantitative Proteomics Using Peptide Labeling and 2D LC MS/MS .............. 60 Growth Curves for M. mycoides subsp. capri Wild Type and ctpA Mutant at Different Temperatures ................................................................................. 63 Results .................................................................................................................... 63 Discussion .............................................................................................................. 65 4 TRANS CRIPTION OF S41 PEPTIDASE (CTPA) GENE ........................................ 77 Introduction ............................................................................................................. 77 Materials and Methods ............................................................................................ 79 Mycoplasma Strain and Cultivation .................................................................. 79 PEG8000 Mediate d Chemical Transformation. ................................................ 80 Transcription of ctpA in Mycoplasma mycoides subsp. capri Wild Type and in Mutants with Altered Proteolytic Activity .................................................... 81 Effects of pH and Heat Shock on Transcritpton of ctpA. .................................. 82 Extraction of RNA and Quantitative Real Time PCR for ctpA Transcription ..... 8 2 Construction of Transcriptional lacZ Fusions of ctpA Gene .............................. 83 Determination of Activity of LacZ Fusion Constructs ........................................ 85 Expression of lacZ Reporter Gene in Response to pH and Heat Shocks ......... 85 Results .................................................................................................................... 86 Identification of Mutants with A ltered Proteolytic Phenotypes .......................... 86 Transcription of ctpA in Mutants with Altered Proteolytic Phenotypes. ............. 88 Effect of pH and Tempe rature on the Transcription of ctpA : Real Time RT PCR. ............................................................................................................. 88 Expression of Transcriptional Fusion of lacZ Reporter Gene in E. coli ............. 88 Effect of pH and Temperature on the Transcription of lacZ reporter Gene in E. coli ............................................................................................................ 89 Discussion .............................................................................................................. 89 5 SUMMARY AND FUTURE DIRE CTIONS ............................................................ 106 Major Findings ................................................................................................ 107 Future Directions ............................................................................................ 110 LIST OF REFE RENCES ............................................................................................. 113 BIOGRAPHICAL SKETCH .......................................................................................... 128

PAGE 6

6 LIST OF TABLES Table page 2 1 Primer pairs used for PCR. ................................................................................. 39 2 2 Sequence for M. mycoides capri ctpA::tetM mutant created by random mutagenesis using Tn4001t. ............................................................................... 40 2 3 Sequence for M. mycoides capri ctpA::tetM mutant created by homologous recombination using disruption plasmid II ( pExp1ctpA::tetM recAec) ............... 41 2 4 Internal sequence for M. mycoides capri ctpA::tetM mutant created by homologous recombination using disruption plasmid II ( pExp1 ctpA::tetM recAec) .............................................................................................................. 42 2 5 Sequence of tetM probe. .................................................................................... 43 2 6 Sequence of the plasmid backbone probe. ........................................................ 44 2 7 Sequence of the ctpA probe used for the Northern blot. ..................................... 45 2 8 Generation of ctpA mutants by random insertion mutagenesis and homologous recombination. ............................................................................... 46 3 1 Proteins that significantly differed (P < 0.006) in M. mycoides subsp. capri ctpA::tetM as determined by 2D DIGE. .............................................................. 70 3 2 Proteins in Mycoplasma mycoides subsp. capri that are present in the glycolysis/gluconeogenesis pathway. ................................................................. 71 4 1 Primers u sed for PCR. ........................................................................................ 97 4 2 Tn916 (J8 only) and Tn4001T random insertional mutants of M. mycoides capri with altered proteolytic phenotype. ........................................................... 98 4 3 Genomic location of genes and site of disruption of the coding sequence by Tn4001T random insertion. ................................................................................ 99

PAGE 7

7 LIST OF FIGURES Figure page 2 1 C onstructs used for targeted mutagenesis of Mycoplasma mycoides subsp. capri .. .................................................................................................................. 47 3 1 Diagrammatic representation of domains identified in the S4 peptidase (CtpA) protein of M. mycoides subsp. capri ....................................................... 72 3 2 Complete amino acid sequence of the S41 peptidase (CtpA) of M. mycoides subsp. capri MCAP 0241 ................................................................................... 73 3 3 Differentia l 2 dimensional electrophoresis of M. mycoides subsp capri GM12 and M. mycoides ctpA::tetM .. ............................................................................. 74 3 4 Distribution of biological function categories of Mycoplasma mycoides subsp. capri GM12 ........................................................................................................ 75 3 5 Growth curves for M. mycoides subsp. capri wt and the ctpA mutant at 37oC and 42oC. ............................................................................................................ 76 4 1 Measurement of ctpA gene expres sion in WT M. mycoides and Tn4001T, Tn916 generated mutants by real time RT PCR.. ............................................ 100 4 2 Preparation of transcriptional fusion constructs of lacZ reporter to ctpA gene promoter and upstream elements .................................................................... 101 4 3 Sequence of lacZ deletion constructs. The deleted sequences for each construct are shown in gray font.. ..................................................................... 102 4 4 Expression of lac Z in E. coli under the control of USE and promoter of ctpA .. 103 4 5 Measurement of ctpA gene expression in M. mycoides capri wild type by real time RT PCR.. ........................................................................................... 104 4 6 Effect o f pH and heat shock on ctpA USE and P driven lacZ expression in E. coli.. .................................................................................................................. 105

PAGE 8

8 Abstract of Dissertation Presented to the Graduate School of the University of F lorida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC MANIPULATIONS AND GENE REGULATION OF S1 PEPTIDASE (CTP A ) EXPRESSION IN MYCOPLASMA MYCOIDES SUBSP. CAPRI By Ayman Bialy Allam August 2010 Cha ir: Mary B. Brown Co chair: Leticia Reyes Major: Veterinary Medical Sciences Mycoplasmas are exquisitely simple with the smallest genomes of freeliving organisms, yet the range of infections and host species are among the most diverse in the microbial world A major limiting factor in unraveling the virulence factors of these microbes is the paucity of tools for genetic manipulation. As a target gene for disruption, we chose the Mycoplasma mycoides subsp. capri ( M. mycoides capri ) S1 peptidase ( ctpA ) that confers a proteolytic phenotype that can be readily determined by growth on agar supplemented with casein. We developed a suicide plasmid employing RecA from Escherichia coli under the direction of a mycoplasmal promoter and with tetM as a selection marker. The desired targeted doublecrossover event was obtained in 24% of transformants obtained using pExp1ctpA ::tetM recA ec, which represents a substantive 140fold improvement in the percentage of transformants with the desired gene disruption as well as d emonstrates targeted double crossover events in a mycoplasma species other than Mycoplasma genitalium The expression profile of mutant versus the wild type was determined using two proteomic technologies: 2D gel and iTRAQ Results from the proteomic data showed

PAGE 9

9 significant difference in the expression profile of mutant in comparison to the wild type. Genes involved in glycolysis were downregulated while genes participating in glycerol metabolism were upregulated. Als o many of the ribosomal proteins were upregulated. Taken together the data suggest that the disrupted gene may influence or modulate the expression of stress response genes, especially those expressed during oxidative stress.

PAGE 10

10 CHAPTER 1 INTRODUCTION Overview Mycoplasmal infections present one of the most intriguing paradoxes in infectious diseases. On one hand, these microbes are exquisitely simple with the smallest genomes of freeliving organisms ( Fadiel et al. 2007, Krause et al. 2004, Rocha et al. 2002) C onversely, the range of infections and host species are among the most diverse in the microbial world. Mycoplasmas are members of the family Mollicutes and are prokaryotes that lack a cell wall. This essential difference between mycoplasmas and prokaryotes including cell walldeficient forms of other bacteria, is their inherent inability to make any cell wall components due to their lack of the genes for cell wall biosynthesis. In contrast, other cell wall deficient bacteria have the genes, and thus the p otential, for making a cell wall (Mattman 2001). Phylogenetically, 16S rRNA sequences indicate that mycoplasmas are eubacteria emerging from or related to Gram positive bacteria (Woese et al. 1980). They are thought to have originated from Gram positive bacteria through degenerative or reductive evolution (Razin 1992, Neimark 1986, Maniloff 1983). Specifically, mycoplasmal genomes are thought to have evolved by attrition from the genomes of species in the Lactobacillus group (Maniloff 2002, Maniloff 1992) Mycoplasmas are currently considered to be the smallest and simplest self replicating organisms (Razin et al. 1985). The full genome sequence is available for a large number of mycoplasma species and a dedicated site is available for comparative analyses (see cbi.labri.fr/eng/molligen.htm). T he small genome size of these bacteria is thought to define the lower limit of naturally existing independent life. The analysis of the minimal

PAGE 11

11 gene complement of some mycoplasmas is one of the sources of synthetic bi ology, a new discipline of biology (Gibson et al. 2008, Glass et al. 2006). Another characteristic that sets mycoplasmas apart from many other bacteria is the low CG ratio of mycoplasma genome, which can go as low as 23% (Jones et al. 1963). Through their evolution and likely as a direct result of the low GC content, mycoplasmas deviated from the conventional genetic code of using UGA as a univers al stop codon. Instead the UGA i s a code for tryptophan (Blanchard 1990), a feature shared by mitochondria and ciliates that also use UGA to code for tryptophan (Fox 1987). Therefore, mycoplasmas have only one release factor, RF 1, which recognizes both UAA and UAG stop codons (Inagaki et al. 1996, Inagaki et al. 1993). Release factor RF 2, which recognizes both U AA and UGA stop codons and is present in most eubacteria, is absent in mycoplasmas. Mycoplasmas also have undergone a rapid rate of evolution. It has been estimated that mycoplasmal phylogenetic tree branches have accumulated an average of about 50% more base changes than has the Lactobacillus group (Woese et al. 1985). In the course of their evolution, mycoplasmas appear to have lost many of the genes and, in turn, enzymatic functions for synthesis of macromolecule precursors and pathways including biochem ical pathways for cell wall biosynthesis, amino acids biosynthesis, nucleotides, and fatty acids biosynthesis. Instead, mycoplasmas possess a number of hydrolytic and degrading enzymes, including both proteases and nucleases (Maniloff 1992). It is likely t hat many of the precursors for macromolecules are derived from the host, and mycoplasmas do maintain a large complement of transporter genes. Mycoplasmas have retained a variety of genes for intermediary metabolism and energy

PAGE 12

12 production. Those include pathways for the degradation of organic substrates to generate small molecules for biosynthetic reactions as well as genes for energy production via substratelevel phosphorylation (Pollack 2002, Maniloff 1992). The number of genes for transc ription and translation apparatus in mycoplasmas is comparable to those present in other bacteria. These genes comprise more 20% of the total ORFs annotated in mycoplasma genomes (Glass et al. 2000, Himmelreich et al. 1997, Himmelreich et al. 1996, Fraser et al. 1995). My coplasmal RNA polymerase resembles those RNA polymerases in other bacteria, and they seem to recognize 70 type in E. coli A vegetative type in Gram positive bacteria. Those promoters contain a 35 region (TTGACA) and 10 Pribnow Box (TATAAT) with about 17 bp spacer between them (Razin et al. 1998, Muto et al. 1987). In fact, mycoplasma promoters have been recognized by E. coli RNA polymerase both in vivo and in vitro a s well (Taschke et al. 1988). Analysis of many promoters upstream of mycoplasma genes showed that the 10 region seems to be conserved while there are variations in the sequence of the 35 region (Halbedel et al. 2007, Weiner et al. 2000, Waldo et al. 1999). Ribosomal Binding Sites (RBS) or ShineDalgarno (SD) sequences have been identified in the 5 upstream region of most mycoplasma genes (Bove 1993, Muto et al. 1987). Termination of transcription in mycoplasmas is Rhoindependent. The gene for Rho term inator has not been detected in mycoplasma genomes while the stem loop structure followed by a string of T(U)s has been found downstream of many ORFs. Genes for termination modulators NusA and NusG have been found in mycoplasmas (Fraser et al. 1995, Glass et al. 2000, Himmelreich et al. 1996, Muto et al. 1987). Similar

PAGE 13

13 to other bacteria mycoplasmas have many tRNA and rRNA genes that are clustered in operons (Yamao et al. 1988, Muto 1987, Samuelsson et al. 1985, Yamao et al. 1985). However, unlike most bac teria mycoplasmas have little or no redundancy for rRNAs and tRNAs (Glass et al. 1992, Andachi et al. 1989). Mycoplasmas have all three initiation factors IF1, IF2, and IF3; they also have all four elongation factors EF Tu, EF Ts, EF G, and EF P (Glass et al. 2000, Himmelreich et al. 1996, Bork et al. 1995, Fraser et al. 1995). Genetic Regulation in Mycoplasmas The current view of gene regulation in mycoplasmas is that, with few notable exceptions (including variable surface proteins), mycoplasmas do not regulate the expression of their genes. Mycoplasmas are thought to lack refined onoff switching mechanisms and global regulation for transcriptional adaptation to environmental changes. Their genes are generally thought to be constitutively expressed rather than regulated (Muto and Ushida 2002), albeit coordinated with the growth rate of the cell through stringent control (Cashel et al. 1996, Gourse et al. 1996). Furthermore, most known or common bacterial regulatory mechanisms are absent in mycoplasmas. F or example, unlike Escherichia coli Bacillus subtilis and many other bacteria, mycoplasmas have only one sigma factor even though they contain many stress response genes (Muto et al. 1987, Razin et al. 1998). The presence of these stress response genes in mycoplasmas suggests that either these genes are not under regulatory control or that the regulation might occur by a yet unknown mechanism not involving the alternate Sigma factors. Very few repressor like proteins have been reported in mycoplasma genomes (Bork et al. 1995, Fraser et al. 1995, Glass et al. 2000, Himmelreich et al. 1996, Glass

PAGE 14

14 et al. 2006). The limited number of these proteins implies that classic regulatory mechanism for turning genes on/off may be limited or lacking in mycoplasmas. Also absent from the genomes of mycoplasmas are genes for quorum sensing and twocomponent systems (Simmons et al. 2007). Taken together, these findings imply that in addition to limited individual gene regulation mechanisms, mycoplasmas appear to lack commonly identified global regulatory mechanisms for influencing gene expression. No global regulator has been reported to date, and a recently emerging view is that mycoplasmas implement post translational regulation as the primary mechanism for controlling biological activities in response to changing environmental conditions (Schmidl et al. 2010). Mycoplasmas are therefore thought to use stochastic mechanisms similar to those controlling phase and size variations to genetically regulate processes as complex as biofilm formation (Simmons et al. 2007). The notable exceptions regarding gene regulation in mycoplasma are the stochastic mechanisms responsible for phase and size variations (reviewed in Citti et al. 2005). Mycoplasmas exhibit an extremely high rate (>103) of antigenic variation of many surface proteins (Rosengarten et al. 2000, Rosengarten et al. 1990). The mechanisms for phase, size, and antigenic variations are well studied and include slippedstrand mispairing, sitespecific recombination, and gene c onversion. The specific method of regulation is dependent upon the individual mycoplasmal species, and not all mechanisms apply to each species. Some genes contain short homo (poly A) or heteropolymeric (poly AT) tracts that undergo frequent and reversibl e changes in their nucleotide number. These mutational changes are thought to be the result of slippedstrand mispairing (SSM) during DNA

PAGE 15

15 replication or processes that require DNA synthesis. The consequence of these changes is to switch on or off the corresponding gene expression. As described below, SSM can affect the gene expression at the level of transcription or translation, depending on the location of these poly A/poly AT tracts. Genes that are transcriptionally affected by SMM mechanism contain their poly tracts in the promoter region. For example, the vlp gene family of M. hyorhinis contains a poly A tract in the promoter between the 35 and 10 regions. Expression of the gene is dependent on the length of poly A tract, with a specific nt tract length (N=17 A) required for gene expression. Reversible deletion or insertion of a single nucleotide abolishes the transcription of the gene (Citti et al. 1995). A similar mechanism is thought to control the phase variation of Vmm of M. mycoides and MAA2 of M. arthritidis (Persson et al. 2002). In the case of translational control by SSM mechanism, the homo or hetero poly tract is located in the coding sequence of the gene. A reversible addition or deletion of a single nucleotide by SSM results in a reversible frameshift mutation, which in turn produces an inframe stop codon leading to a premature termination of the translation process. The final outcome is a truncated gene product. This mechanism has been reported for Vaa adhesion surface protein of M. homi nis (Zhang et al. 1997) and for P78 in M. fermentans (Theiss et al. 1997). Site specific recombinases and integrases can control the expression of some surface proteins through a cut and paste type mechanism. In this mechanism, four DNA strands are broke n, exchanged, and then religated at specific locations. The relative positions of the two targeted recombination sites dictate the outcome of this

PAGE 16

16 type of recombination. Inverted recombination sites result in DNA inversion; in contrast, directly repeated r ecombination sites lead to excision. This mechanism has been documented in the vsa vsp and vpma gene families of M. pulmonis M. bovis and M. agalactiae respectively (Bhugra et al. 1995, Lysnyansky et al. 2001, Glew et al. 2002). To date, the only example of gene conversion has been described in M. synoviae The M. synoviae genome contains a single copy of the full length vlhA gene, but it also possesses a large family of pseudogenes that encodes different extents of the expressed vlhA Variants of the vlhA gene are generated by unidirectional recombination between the expressed gene and the pseudogenes. The recombined pseudogene sequence was shown to duplicate, while the region replaced in the expressed gene was lost (Noormohammadi et al. 2000).These conversions events appear to be mediated through highly conserved regions at the boundaries of each pseudogene. This suggests that the recombination events are carried out by a yet unidentified sitespecific recombinase. Regulation of a few heat shock proteins has been reported (Chang et al. 2008, Musatovova et al. 2006). CIRCE ( C ontrolling I nverted R epeat of C haperon E xpression) is a cis DNA regulatory element that consists of a 9 bp inverted repeat that is separated by a 9 bp spacer. HrcA ( H eat R egulation at C IRCE) is a repressor protein that binds to CIRCE sequence and negatively regulates the downstream gene by preventing its transcription (Zuber et al. 1994). Although mycoplasmas do have heat shock proteins, CIRCE elements in the upstream of their promot ers have been identified only in M. genitalium M. pneumoniae, and M. hypopneumoniae (Himmelreich R. et al. 1996). Interestingly, Musatovova et al. showed that some of the typical prokaryotic heat shock

PAGE 17

17 genes (for example, groEL, groES ) did not respond to heat shock. Transcriptome studies in mycoplasmas that lacked HrcA CIRCE upstream of the promoter demonstrated that some heat shock proteins were responsive to temperature shock, implying that the HrcA CIRCE mechanism is not universally implemented by mycop lasmas to regulate response to heat shock. However, with the exception of gene regulation in variable surface proteins and limited heat shock response genes, a conundrum remains. On one hand, a large number of mycoplasmal genomes have been sequenced, yet because of the absence of regulatory proteins there is still a dearth of knowledge regarding the mechanisms that control gene expression in these microbes. Despite this absence of clearly identified global regulators, recent in vivo and in vitro transcript ome and proteomic studies reported global responses to environmental or host stimuli (Oneal et al. 2008, Madsen et al. 2008, Schafer et al. 2007, Cecchini et al. 2007, Pinto et al. 2007, Madsen et al. 2006a, Madsen et al. 2006b). Importantly, even with a v ery limited number of transcriptional factors, genome wide analyses of some of the smallest and simplest mycoplasmas revealed an unexpected level of complexity and versatility in their in metabolic responses to environmental conditions. Their adaptation seems to be similar to that of more complex bacteria, providing hints that other, unknown regulatory mechanisms might exist (Yus et al. 2009). Furthermore, proteome complexity could not be directly inferred from the composition and organization of their mini mal genomes or even their extensive genome wide transcriptional analysis (Kuhner et al. 2009). In addition, transcriptome analysis also showed surprisingly unanticipated diversity and heterogeneity in mycoplasma transcription profiles including the presence of many

PAGE 18

18 operons, the production of alternative transcripts in response to environmental perturbations, and the high frequency of antisense RNA (Guell et al. 2009). Therefore, it is becoming increasingly clear that mycoplasmas are able to respond to env ironmental cues and regulate gene expression, but the underlying mechanisms for their global and individual gene regulation are not understood. Tools for Genetic Manipulation in Mycoplasmas A major challenge to understanding the fundamental biology of Mol licutes at the molecular level and at the host:pathogen interface is our limited capacity to genetically manipulate mycoplasmas ((Renaudin 2002, Halbedel et al. 2007). The lack of genetic tools to specifically manipulate and disrupt genes in mycoplasmas or to carry out complementation studies has been a major impediment in understanding their genetics and elucidating regulatory mechanisms ((Renaudin 2002, Halbedel et al. 2007). At present, four basic approaches have been reported for genetic manipulation of mycoplasmas: random transposon mutagenesis, targeted doublecrossover homologous recombination using suicide plasmids, targeted recombination using oriC plasmids, and creation of new mycoplasma strains from genomes that have been cloned and engineered in yeast. The most widely used approach to genetic manipulation of the Mollicutes has been the use of transposonbased mutagenesis ( ChopraDewasthal y et al. 2005, French et al. 2008, Glass et al. 2006, Halbedel et al. 2007, Hutchison et al. 1999, and Voelker, et al. 1998) Transposons have been used successfully in a global approach of gene inactivation to define the minimally essential genes for sus taining life and also to generate mutants of interest (Glass et al. 2006, Hutchison et al. 1999) Recently, Janis et al. 2008 incorporated the resolvase gene into an OriC plasmid and used this

PAGE 19

19 construct to transform a randomly generated mutant of M. mycoides subsp mycoides resulting in a mutant which lacked the majority of the transposed sequences introduced by the first random insertional m utagenesis step. All of these approaches are limited in that random insertion of transposons does not allow the specific targeting of a gene of interest and requires screening of large numbers of transformants to identify an insertion in a specific gene. I n contrast to random insertional mutagenesis, targeted gene disruption has been far less successful in mycoplasmas. Two different strategies have been used for targeted gene disruption in Mollicutes: the use of replicating plasmids and the use of nonrepl icating (suicide) plasmids. Replicating plasmids based on oriC, a chromosomal region that harbors the dnaA gene and adjacent DnaA boxes have been developed for many Mollicutes species (ChopraDewasthaly et al 2005a, ChopraDewasthaly et al. 2005b, ChopraDewasthaly et al 2008, Cordova et al 2002, Cox, 2007, Duret et al 2005, Duret et al 2003, Halbe del and Stulke 2007, Janis et al 2005, Jarhede et al 1995, Lartigue et al. 2003) although for some mycoplasmas efforts to create replicating plasmids have been unsuccessful. These plasmids were able to replicate within their respective hosts (Renaudin et al. 2005).These oriC plasmids have been used for heterologous gene expression as well as for targeted gene disruption by singlecrossover recombination (ChopraDewasthaly et al 2005b, ChopraDewasthaly et al 2008, Duret et al 2005, Duret et al 2003, Janis et al 2005, Lartigue et al 2003) The underlying concept behind the use of homologous OriC based plas mid as a means for targeted gene integration is that replicative plasmids increase the time over which homologous

PAGE 20

20 recombination can take place compared to nonreplicative suicide plasmids ( Duret et al. 1999, Janis et al. 2005). Homologous OriC plasmids have been developed for some mycoplasmas including the mycoides cluster (Lartigue et al. 2003), M. pulmonis (Cordova et al. 2002), M. agalactiae ( ChopraDewasthaly et al. 2005), and S. citri ( Ye et al. 1994). These replicating plasmids use minimal sequences of the respective chromosomal OriC in order to limit their integration at the homologous chromosomal OriC region and favor their chance to integrate at the site of interest ( Janis et al. 2005, Renaudin et al. 1995). Although this approach has met wit h limited success, several confounding issues regardless of the type of oriC used in the plasmid construct do exist. Even when integration of the OriC plasmid at the gene of interest occurred, consistently the frequency was still very low and occurred thr ough a single cross over event ( ChopraDewasthaly et al. 2005a, Lartigue et al. 2003, Cordova et al. 2002). In other cases, homologous OriC plasmids replicated freely and did not integrate at either the desired gene or chromosomal origin of replication, despite the presence of long sequences of perfect homology ( Janis et al. 2005, Cordova et al. 2002). Eventually, this led to loss of the gene copy from the integrative plasmid, presumably through deletion. Another complication was that the disruption of the gene of interest occurred, but there was another intact copy of the gene present on the freely replicating plasmid; this made it difficult to recognize the mutant phenotype and also confounded the interpretation and the analysis of the experiments ( Janis e t al. 2005). The instability of the mutants was another concern and ensued as a consequence of the incompatibility of the two OriC

PAGE 21

21 regions carried on the same chromosome, resulting in the resolution and then the loss of the integrated material ( Cordova et al. 2002 Ogasawara et al. 1991). Classical double crossover homologous recombination using a suicide plasmid is potentially a powerful technique to delete mycoplasma genes. However, it has been reported previously only in Mycoplasma genitalium (Burgos et al 2008, Dhandayuthapani et al 1999; Dhandayuthapani et al 2001) and M. pneumoniae (Krishnakumar et al. 2010) To date, targeted gene disruption in M. genitalium stands out as the only successful attempt to inactivate genes through a classical doublecrossover homologous recombination using a suicide plasmid ( Dhandayuthapani et al 1999, Dhandayuthapani et al 2001 ). The majority of other reported attempts to create doublecrossover mutations in target genes, including the lppA gene in M. capricolum (Janis et al. 2005, Muto et al. 2002), the hemolysin A( hlyA ) gene in M. pulmonis ( Cordova et al. 2002 ), the motility gene scm1 in Spiroplasma citri (Duret et al. 1999), failed to produce any transformants at all, not even a single cross over integration despite extensive sequence homolog y with the target gene. A few groups did produce transformants in M. gallisepticum and Acholeplasma laidlawii Two studies were performed in M. gallisepticum. The first was aimed at proving the ability the of M. gallisepticum to carry out homologous recombination. The suicide plasmids, carrying randomly cloned restriction fragments with uninterrupted perfect homology up to 5 Kb in size, were able to integrate into the chromosome ( Cao et al. 1994). The second study inactivated the surface protein P47 through a singlecrossover plasmid i ntegration ( Markham et al. 2003) Disruption of the A. laidlawii recA gene was accomplished through a single crossover recombination event, and the plasmid integration was found

PAGE 22

22 to depend on the presence of a fully functional RecA. The transformation frequency, however, was 10 fold less than that of the replicating plasmid or that of suicide plasmid containing Tn916 ( Dybvig et al. 1992). Recently, a new method for manipulating Mollicutes genomes was reported where the genome of Mycoplasma mycoides subs p capri was cloned as a YAC. Once in a yeast cell the mycoplasmal genome could readily be manipulated using the significant power of yeast genetic tools. Then the altered yeast artificial chromosome ( YAC ) was transplanted back into a recipient Mycoplasm a capricolum cell to produce a new strain of M. mycoides subsp. capri (Lartigue et al 2009) This approach is applicable for large scalegenome alterations, but may be expensive and technically challenging for investigators interested in specific gene targets. The Mycoides Cl uster The Mycoplasma mycoides cluster of organisms is among the most virulent of the mycoplasmas. They are of major worldwide economic significance in diseases of cattle and goats (Rodreguez et al. 1995). There are six groups recognized within the clust er, and these mycoplasmas are closely related as evidenced by serological cross reactions and a 5060% DNA homology (AbouGroun et al. 1994, Cottew 1987). Two members of the cluster, M. mycoides subsp. mycoides Small Colony type and M. capricolum subspeci es capripneumoniae (formerly F38 group), are listed as class B agent s of special concern by USDA and APHIS (Federal Register 67, No. 155, 9 CFR 121.2b) and cause contagious bovine and caprine pleuropneumonia, respectively. Based on recent DNA analysis separate subspecies designation has been given to M. capricolum subsp. capricolum and (formerly M. mycoides subsp. mycoides Large

PAGE 23

23 Colony type) and distinguishes them from the causative agents of contagious pleuropneumonia (MansoSilvn et al. 2009). Mycoplasma mycoides subsp. capri GM12 mainly causes pneumonia in sheep and goats. It is also associated with mastitis and arthritis of sheep and goats as well as septicemia in goats (Frey 2002). One phenotypic difference between the USDA class B agents causing cont agious pleuropneumonia and the two closely related subspecies is the ability to degrade casein, an activity that is quite uncommon in mycoplasmas. We have identified the gene encoding the proteolytic activity in both M. mycoides subsp. capri GM12 type AT CC 35297 (DaMassa et al. 1983) and M. capricolum ATCC 27343 (Leach et al. 1993) The predicted gene ( ZP_02512724) product is a membrane protease, has a tail specific protease (TSPc) domain, and confers a proteolytic phenotype that can be readily determined by growth on agar supplemented with casein. Because of its homology with the carboxyl tail specific processing domain and oth er similar proteins in other bacterial species, we have referred to this gene as ctpA. Our long term goal is to understand mechanisms of gene regulation in mycoplasmas. Critical to this goal is the ability to target specific genes for mutagenesis, preferably by double cross over events. Because of the lack of selection and phenotypic markers in most mycoplasmas, we chose to target a gene that conferred a readily identified phenotype (casein hydrolysis).

PAGE 24

24 Goals of Study and Summary of Findings The specific goals of this study are to develop a new approach for targeted mutagenesis using a suicide plasmid, to characterize the mutant with the gene disruption, and to determine if this gene could be used as a potential model for gene regulation in mycoplasmas. W e developed a suicide plasmid employing RecA from Escherichia coli under the direction of a mycoplasmal promoter and with tetM as a selection marker. The ctpA gene of M. mycoides subs. capri was targeted for disruption. We consistently obtained a marked im provement in the percentage of transformants with the desired gene disruption, all of which occurred by targeted double crossover event. To our knowledge, this is the only mycoplasma species other than Mycoplasma genitalium in which a targeted double cross over mutation has been obtained. We also demonstrated that the disruption of this gene had a significant impact on the proteomic profile of the microbe, most notably with respect to proteins associated with oxidative stress, protein repair, and a shift for m glycolysis to glycerol metabolism. Finally, we determined that the mutation altered the manner in which M. mycoides subs. capri responds to heat shock.

PAGE 25

25 CHAPTER 2 TARGETED HOMOLOGOUS RECOMBINATION IN MYCOPLASMA MYCOIDES SUBSP. CAPRI IS ENHANCED BY INCLUS ION OF HETEROLOGOUS RECA Introduction Mycoplasmal infections present one of the most intriguing paradoxes in infectious diseases. On one hand, these microbes are exquisitely simple with the smallest genomes of freeliving organisms (Fadiel et al 2007, Kraus e a nd B alish 2004, Rocha and Blanchard 2002) Conversely, the range of infections and host species are among the most diverse in the microbial world (Fadiel et al 2007) Perhaps the greatest challenge to understanding the fundamental biology of Mollicutes at th e molecular level and at the host:pathogen interface is our limited capacity to genetically manipulate mycoplasmas (Halbedel and Stulke 2007, Pilo et al. 2007) At present four basic approaches have been reported: random transposon mutagenesis, targeted doublecrossover homologous recombination using suicide plasmids, targeted recombination using oriC plasmids, and creation of new mycoplasma strains from genomes that have been cloned and engineered in yeast. The most widely used approach to gen etic manipulation of the Mollicutes has been the use of transposonbased mutagenesis (ChopraDewasthaly et al. 2005b, French et al. 2008, Glass et al 200 6, Halbedel and Stulke 2007, Hutchison et al 1999, Voelker and Dybvig 1998) Transposons also have been used successfully in a global approach of gene inactivation to define the minimally essential genes for sustaining life and also to generate mutants of interest (Glass et al 2006, Hutchison et al 1999) Recently, Janis et al. 2008 (Janis et al 2008) incorporated the resolvase gene into an OriC plasmid and used this construct to transform a randomly generated mutant of M. mycoides subsp mycoides resulting in a mutant which lacked the majority of the

PAGE 26

26 transposed sequences introduced by the first random insertional mutagenesis step. All of these approaches are limited in that random insertion of transposons does not allow the specific targeting of a gene of interest and requires screening of large numbers of transformants to identify an insertion in a specific gene. In contrast to r andom insertional mutagenesis, targeted gene disruption has been far less successful in mycoplasmas. Replicating plasmids based on oriC, a chromosomal region that harbors the dnaA gene and adjacent DnaA boxes, have been developed for Mollicutes species (ChopraDewasthaly et al 2005a, ChopraDewasthaly et al 2005b, ChopraDewasthaly et al 2008; Cordova e t al 2002, Cox 2007, Duret et al 2005, Duret et al 2003, Halbedel and Stulke 2007, Janis et al 2005, Jarhede et al 1995, Lartigue et al. 2003) and have been used for heterologous gene expression as well as for targeted gene disruption by sing le crossover recombination (Chopra Dewasthaly et al 2005b, ChopraDewasthaly et al. 2008, Duret et al. 2005, Du ret et al 2003, Janis et al 2005, Lartigue et al 2003) Unfortunately, this approach still has relatively limited success and also has several confounding issues, regardless of the type of oriC used in the plasmid construct. Although classical doubl e crossover homologous recombination using a suicide plasmid is potentially a powerful technique, recombination by double crossover has been reported only for M. genitalium and even then it occurs at a very low frequency (Burgos et al 2008, Dhandayuthapani et al. 1999, Dhandayuthapani et al 2001) Recently a new method for manipulating Mollicutes genomes was reported where the genome of Mycoplasma mycoides subspecies capri was cloned as a YAC. Once in a yeast cell, the mycoplasmal genome could readily be manipulated using the significant power of yeast

PAGE 27

27 genetic tools. Th e altered YAC was then transplanted back into a recipient Mycoplasma capricolum cell to produce a new strain of M. mycoides subspecies capri (Lartigue et al. 2009) We report here the development of a novel suicide plasmid employing RecA from E. coli under the direction of a mycoplasmal promoter and with tetM as a selection marker that resulted in consistent recovery of targeted stable doublecrossover mutants, with a 140 fold increase over random insertional mutagenesis with respect to the number of desired gene disruptions relative to the number of total transformants generated. Materials and Methods Mycoplasma Strains and Cultivation Mycop lasma mycoides subsp. capri GM12 type ATCC 35297 ( M. mycoides capri (DaMassa et al 1983) formerly known as M. mycoides subsp. mycoides Large Colony type (Ma nso Silvan et al 2009) ; and Mycoplasma capricolum ATCC 27343 (Leach et al 1993) were grown at 37 C in SP4 medium (Tully et al. 1979) ; SP4 casein agar was supplemented with a final concentration of 1% skim milk (DIFCO, Detroit, MI). For growth of mutants, tetracycline (final concentration, 5g/ml) was added to the media. PCR Primers and Conditions The primers used for PCR reactions are given in Table 21. The reactions used either 1g of genomic DNA or 100 ng of plasmid DNA as a template for the PCR reactions. For a given reaction, 30 pmol of primer (Genosys Sigma Aldrich Co) was used. To facilitate cloning, restriction enzyme recognition sites were created in selected primers (Table 21) The PCR reactions were performed using Applied Biosystems Perkin Elmer GeneAmp 2400 PCR System (see supplementary material for details).

PAGE 28

28 Cloned Pfu DNA Polymerase (Stratagene) was used with primer pair 1; Taq DNA polymerase (Invitrogen) was used with pr imer pairs 2, 3 and 5; TaqPlus Long PCR System (Stratagene) was used for primer pair 4. All reactions were held at 95oC for 3 min and subjected to 25 cycles of template denaturation at 95C for 1 min, except tetM amplifications which were allowed to denature for 3 min. Primer annealing occurred for 1 min at 42C (primer pairs 1 and 2), 50C (primer pair 3) or at 40C (primer 4) or for 30 sec at 44C (primer pair 5). Polymerization at 72C occurred for 2 min (primer pairs 3 and 5), 3 min (primer pairs 1 and 2), or 10 min (primer pair 4). Polymerization was then followed by a final extension for 7 min at 72C for all reactions. Construction of Plasmids An overview of the constructs used is shown in Figure 21. To construct pExp1ctpA, the tetM gene, obtaine d from plasmid pIVT 1 and flanked by 828 bp of the 5' end of the ctpA gene and 456 bp of the ctpA 3' end, was cloned into pExp1ctpA to produce pExp1ctpA :: tetM (Figure 2 1). Specifically pExp1ctpA was digested with BclI and PstI, the two fragments were separated by gel electrophoresis, and the larger fragment was gel purified. Plasmid pIVT 1 was digested with BamHI and PstI, the fragment containing the tetM gene was gel purified and ligated to the pExp1ctpA backbone to produce pExp1ctpA :: tetM (Figure 2 2, A and B). Genomic DNA was prepared from M. mycoides capri using the Epicentre DNA extraction kit according to the instructions provided. The ctpA gene was amplified using primer pair 1 (Table 21), gel purified, and cloned into Topo ENTER vector (Invit rogen). The plasmid pENTER ctpA was propagated in E. coli Top10 strain and transferred to the cloning vector EXP1DEST using the LR Clonase kit (Invitrogen). The presence and direction of the cloned ctpA gene was confirmed by restriction enzyme digestion at each step (Figure 22). The size of the flanking

PAGE 29

29 sequences was chosen to provide sufficient homologous sequences to facilitate recombination in the target gene (Dhandayuthapani et al. 1999; Duret et al. 2005) The direction as well as the ins ertion was verified by digestion with KpnI (Figure 22B). To construct pEXP ctpA::tetM recAec t he E. coli recA gene was cloned under the upstream sequences and promoter region of ctpA The upstream sequences and promoter region (USE) as well as the firs t 12 nt of ctpA coding sequence were amplified using primer pair 2 (Table 21), gel purified and cloned in the Topo vector pXLPCR (pXL USE ctpA ). PCR primer pair #2 (Table 2 1) amplifies the upstream sequences, the promoter region, and the ctpA coding se quence. Construction of pExp1ctpA::tetM recAec is shown in Figure 22, C and D. The PCR amplified fragment (USE ctpA ) was gel purified, cloned in the Topo vector pXLPCR, and the insertion of USE ctpA as well as the correct direction was confirmed by digest ion with BamHI. The coding sequence of the E. coli recA gene was amplified from genomic D NA using primer pair 3 (Table 21). The PCR product containing the coding sequence of the recA gene was gel purified and cloned in Topo vector pXLPCR, producing the plasmid pXLrecA Plasmid pXL recA was digested with SpeI, and the smaller fragment containing the recA gene was gel purified. Plasmid pXLUSE ctpA was digested with SpeI, and the backbone (larger fragment) was gel purified. The backbone fragment of pXLUSE ct pA and the E. coli recA were ligated together, and E. coli strain Stbl2 was transformed. The resulting plasmid pXLUSE recA contained the E. coli recA gene inserted in frame behind the first four amino acids of M. mycoides capri ctpA gene. The expression of recAec was regulated by the promoter and the upstream sequences of M. mycoides capri ctpA

PAGE 30

30 The capability of the promoter and the upstream sequences of M. mycoides capri ctpA to drive expression of an E. coli gene was confirmed by placing lacZ under the direction of M. mycoides capri ctpA USE and ctpAp (Figure 2 3). Using primer pair #5 (Table 21) and identical methodology as for recA E. coli lacZ was cloned into the same construct and position as recA to produce plasmid pXLUSE lacZ After PCR amplification of lacZ with an engineered SpeI site at the 5 end, the PCR product was cloned into pCR XL Topo vector to produce pXL(SpeI) lacZ pXL (SpeI) lacZ was digested with SpeI to produce the (SpeI) lacZ fragment. The fragment was gel purified and ligated to the same plasmid backbone (pXLUSE ctpAp) used to create pXLUSE ctpAprecA ec. This placed the lacZ expression under the regulatory control of the USE and promoter of the ctpA gene. The construct was digested with NdeI and XbaI to verify the correct orientation of the cloned fragment. The plasmid was introduced into E. coli Top10 F 10 (TetR)} mcr A mrr hsd RMS mcr BC) lacZ lac X74 recA 1 ara D139 ara leu )7697 gal U gal K rps L end A1 nupG}(Invitrogen). Transformants were plated on LB agar coated with X gal; a blue color confirmed the capacity of the ctpA promoter and the USE to drive the expression of the downstream gene. The same construct, but without USE and ctpAp, was used as a control and was galactosidase negative.

PAGE 31

31 PEG8000 Mediated Chemical Transformation. An overnight culture of M. mycoides capri was diluted 1/1000 in 40 ml of fresh SP4 broth. The culture was grown until the midlog phase (~78 hrs) and then placed on ice for 2 min. M. mycoides capri was pelleted by centr ifugation at 12,000g for 30 min at 4 C, the supernatant was decanted, and the cells were washed in 10 mM Tris buffer, pH 6.5. Cells were centrifuged at 12,000g for 30 min at 4 C, resuspended in 1 ml of 0.1 M CaCl2, and incubated on ice for 1 hr. Yeast t RNA (10 g, Sigma Aldrich), plasmid DNA (30 g), and 9 ml of 60% (w/v) PEG8000 in 10 mM Tris pH 6.5 (final concentration, 54% PEG8000) were added, and the cells were incubated for 2 min at room temperature. Twenty five ml of 10 mM Tris buffer, pH 6.5, was added, and the cells were centrifuged at 12,000g for 30 min at 4C. The supernatant was decanted, and the cells were suspended in 2 ml of warm (37C) SP4 broth supplemented with 2 mM MgCl2 (Lavery et al. 1992, Hoffman et al. 2000, Goryshin et al. 1998, G oryshin et al. 2000) and incubated at 37C for 2 hrs. Following the 2 hr recovery time, the cells were plated on SP4 agar plates containing 5 g/ml tetracycline and 1% casein. Colony growth was observed after 48 hr. All colonies were picked, expanded in SP 4 broth, and genomic DNA obtained. PCR was performed using primer pair 4 to detect the disruption of ctpA gene. Random and Targeted Transformation For random mutagenesis, M. mycoides capri was transformed with Tn4001T, a gift from K. Dybvig, (plasmid pIV T 1 (Dybvig et al. 2000) by PEG8000 (Sigma Aldrich) mediated chemical transformation as previously described (Dybvig et al 2000, Lartigue et al 2009),. For targeted mutagenesis, M. mycoide s capri GM12 was transformed with pExp1ctpA::tetM or pExp1ctpA ::tetM recA ec using PEG8000mediated chemical

PAGE 32

32 transformation. M. capricolum was transformed by electroporation. Disruption of ctpA was confirmed by loss of phenotype on casein agar and by PCR of the flanking regions of the ctpA coding sequence. The location, precise site of insertion, and direction of insertion of tetM into the coding sequence of ctpA were determined by sequencing. The random mutagenesis of M. capricolum was performed at the J Craig Venter Institute in collaboration with Dr. John Glass, and selected mutants were provided to us. Ten ml cultures of log phase M. capricolum cells were pelleted and washed twice with electroporation buffer (EB) comprised of 8 mM HEPES + 272 mM sucrose at pH 7.4. Cells were then scraped into 25 ml of 4C EB, and the suspension triterated to break up any cell clumps, after which the cells were pelleted by centrifuging for 10 min at 4oC at 4575g. The supernatant was decanted, and the centrifuge tubes were inverted a few minutes to insure there was no residual supernatant, which could contain enough salts from the medium to compromise electroporation. Cells were resuspended in a total volume of 200300 m l EB. On ice, 100 m l cells were mixed with 30 m g pIV T 1 plasmid DNA, transferred to a 2 mm chilled electroporation cuvette (BioRad, Hercules, CA), and electroporated using 2500 V, 25 m resuspended in 1 ml of 37C SP4 medium and the cells were allowed to recover for 2 hours at 37oC with 5% CO2. Aliquots of 200 m l of cells were spread onto SP4 agar plates containing 2 mg/l tetracycline hydrochloride (VWR, Bridgeport, NJ). The plates were incubated for 34 weeks at 37oC with 5% CO2 until colonies were visible.

PAGE 33

33 Conf irmation of Disruption of ctpA and Location of Insertion Sites For M. mycoides capri genomic DNA was sequenced using primer pair # 6 (Table 21) to verify tetM in these mutants. The precise site of insertion was further pinpointed by sequencing the junct ion between the tetM gene and the flanking sequence of the ctpA gene using primer 6 and primer pair # 4 (Table 21). The location and direction of insertion of tetM into the coding sequence of ctpA was confirmed by sequencing. This was done for both M. myc oides capri ctpA::tetM mutant created by random mutagenesis using Tn4001T (Table 2 2) and a representative mutant created by homologous recombination using pExp1 ctpA::tetM recAec (Tables 23 and 24) In the M. capricolum ctpA::tetM mutant generated by r andom mutagenesis, Tn4001T inserted 1269 bp from the 5 ctpA gene (MCAP_0240, YP_424227, J. Glass, personal communication). t etM insertion sites in M. capricolum were located by DNA sequencing from genomic templates containing ~0.5 g of genomic DNA. A 30 base oligonucleotide GTACTCAATGAATTAGGTGG AAGACCGAGG ( Integrated DNA Technologies, Coralville, IA) primer that binds in the tetM gene103 base pairs f rom one of the transposon/genome junctions was used, and, the insertion site was located on the M. capricolum genome using BLAST. Southern and Northern Blots For Southern blots, genomic DNA samples were prepared (DNeasy Tissue kit, Qiagen) from M. mycoide s capri (wt), M. mycoides capri ctpA::tetM created via homologous recombination using pExp1ctpA ::tetM recA ec and from M. mycoides capri ctpA ::Tn4001T created by random mutagenesis. Following electrophoresis on a 0.8% agarose gel and transfer to a positively charged 1.2m nylon membrane (Roche), membranes were hybridized with labeled probes (DIG High Prime DNA labeling and

PAGE 34

34 Detection Starter Kit I, Roche) to either a 1,157 bp tetM fragment (Table 25) obtained from plasmid pMP05 (Cordova et al. 2002) courtesy of A. Blanchard and J. Renaudin, or a 1,018 bp fragment (Table 26) with homology to the plasmid backbones used in preparation of the constructs For Nort hern blots, total RNA was extracted from early s tationary phase M. mycoides capri or M. mycoides capri ctpA::tetM using RiboPureBacteria Kit (Ambion) according to the manufacturers instructions. The NorthernMax kit (Ambion) protocols were followed for gel separation, transfer of RNA to the membrane, and hybridization steps. A 1,446 bp ctpA DIG labeled probe (Table 27) was generated by random primed DNA labeling using DIG High Prime DNA labeling and Detection Starter Kit I (Roche) according to the manufacturers instructions. R esults Inclusion of recA from E. coli in disruption plasmid II (pExp1ctpA ::tetM recA ec) greatly enhanced the recovery of ctpA mutants (Table 28). In an earlier study in our laboratory, random mutagenesis of M. mycoides capri using the conjugative transposon Tn916 (Dybvig and C assell 1987, Dybvig and Alderete 1988, Whitley and Finch 1989) yielded 1,776 transformants, but only two (0.11%) had an insertion in the gene of i nterest. When the smaller plasmid, Tn4001T (Dybvig et al. 2000) was used in this current study, the efficiency of obtaining the desired mutant was increased to 1/674 (0.15%) for M. mycoides ca pri and 1/384 (0.26%) for M. capricolum In three independent experiments using pExp1ctpA :: tetM to create a targeted mutation, only one ctpA::tetM mutant of 152 tetracyclineresistant clones (0.66% efficiency) was obtained as a result of homologous recombination. Although this approach required fewer transformants be screened (1/152 for an overall efficiency of 0.65%) than for

PAGE 35

35 random mutagenesis, only one of three experiments yielded a ctpA::tetM mutant and this lack of consistency was a concern. When recA was added to the construct, a dramatic and consistent increase in the efficiency of obtaining a ctpA::tetM mutant was observed. Using pExp1ctpA::tetM recAec, we obtained ctpA::tetM mutants in each of three independent transformation experiments, with 21.4 % to 26.7% of transformants having a disruption in the targeted gene. Although the overall number of transformants obtained with pExp1ctpA::tetM recAec was low (<20 per experiment), the high recovery rate of transformants with the target gene disrupted far outweighed the minor difficulty of having to use at least a log higher number of wild type M. mycoides capri for transformation with pExp1ctpA::tetM recAec than for transformation with Tn4001T. Disruption of ctpA resulted in loss of the proteolytic phenotype (Figures 24 and 2 5). Insertion of tetM into the ctpA gene via targeted mutagenesis with pExp1ctpA::tetM recAec (Figure 2 4, A and C) resulted in the loss of proteolytic ac tivity on casein agar (Figure 24, B and Figure 25). All M. mycoides capri ctpA::tetM mutants had identical inserts of the expected size (Figure 25, C) as well as loss of the proteolytic phenotype. Disruption by Tn4001T random insertional mutagenesis of both the M. mycoides capri ctpA gene and the ctpA homologous gene in My coplasma capricolum ( YP_424227) resulted in loss of the prot eolytic phenotype (see Figure 25, panels B, C and E). The presence of tetM in all mutants, regardless of method of transformation, was confirmed by PCR (Figures 2 4, A, C and 25, lanes 4, 5 and 7). The presence and location of the tetM gene in ctpA::tetM mutants was confi rmed by Southern blot (Figure 26) and sequencing (Tabl es 2 3 and 24), respectively The acquisition and copy number of the tetM gene in ctpA::tetM mutants and the presence

PAGE 36

36 of the tetM gene inserted by Tn4001T mediated random mutagenesis was verif ied by Southern blot (Figure. 26, A). Based on the size of the PCR fragment obtained using primer s specific for the flanking regions of the ctpA gene (Table 1, primer pair 4) and sequencing (Tables 23 and 24) provided in supplementary material), a double crossover homologous recombination was determined to have occurred when M. mycoides capri was tr ansformed with pExp1ctpA::tetM recAec The plasmi d backbone was absent (Figure 26 B, lane 3) in the ctpA::tetM mutant generated by pExp1ctpA::tetM recAec while the ctpA::tetM mutant generated by Tn4001T random insertional mutagenesis retained the plasm id backbone (Figure 26 B, Lane 4). CtpA appears to be monocistronic. The absence of transcription of ctpA in the mutants was confi rmed by Northern blot (Figure 27). The length of the transcript in M. mycoides capri was the same size as the mature ORF, supporting the monocistronic transcription of CtpA Additionally, disruption of either the upstream or downstream gene had no impact of the proteolytic phenotype. D iscussion The likelihood of obtaining an insertion in the gene of interest by random inser tional mutagenesis varies depending on the mycoplasma species and the specific gene of interest. Even if the desired insertion occurs, screening of large numbers of transformants is required. As an example, less than 0.2% of M. mycoides capri or M. caprico lum transformants obtained using Tn4001T contained insertions in the ctpA gene. Further, random insertional mutagenesis does contain an inherent bias for preferred insertion sites (Boesen et al 2004, Glass et al 2006) Cloning and engineering mycoplasma genomes in Saccharomyces cerev isiae offers all the genetic tools available to yeast biologists for seamless manipulation of

PAGE 37

37 mycoplasma genomes. Thus multiple modifications are possible. The main drawback of this method is that it is technically very demanding and laborious, and costly Additionally, the yeast cloning process takes two to three weeks to complete (Lartigue et al 2009) Targeted gene disruption in Mollicutes using replicating plasmids based on oriC has been reported for a number of mycoplasma species, including members of the Mycoides, Pneumoniae, and Hominis subgroups (Chopra Dewasthaly et al. 2005b, ChopraDewasthaly et al. 2008, Duret et al 2005, Duret et al 2003, Janis et al 2005, Lartigue et al. 2003, Lee et al 2008) However, mutagenesis by singlecrossover homologous recombination using oriC plasmids has met with limited success. Even in M. gallisepticum and the Mycoides group species in which the OriC plasmids work best, replicating plasmids require many passages before the plasmid integrates into the chromosome (Cordova et al 2002, Lee et al 2008) and when obtained, the mutants are not stable. Replicative plasmids based on OriC actually were less efficient than suicide plasmids in generating targeted mutants (Dybvig and Woodard 1992, Kannan and Baseman 2006) and also less effective than our results using both pExp1ctpA::tetM and pExp1 ctpA::tetM:recAec In mycoplasmas, as in other bacteria, recA is the only recombination gene universally present, although it is not part of the essential gene set (F rench et al 2008, Glass et al 2006) Studies have confirmed the critical role of RecA in recombination events in Mollicutes (Ogasawara et al 1991, Rocha et al 2005) In Acholeplasma laidlawii, the recA gene was disrupted t hrough a single crossover recombination event (Dybvig and Woodard 1992) and plasmid integration was found to depend on the

PAGE 38

38 presence of a fully functional RecA. Therefore, it seems that homologous recombination in mycoplasmas, when it occurs, is likely RecA dependent (Dybvig and Woodard 1992) Thus, we reasoned we might be able to augment homologous recombination by expression of a heterologous source of R ecA with a high GC content to minimize hybridization with the indigenous RecA In our study, inclusion of the E. coli RecA in our construct resulted in a 140fold increase in recovery of the desired mutant over other techniques currently used for genetic manipulation of mycoplasmas in general and members of the Mycoides cluster specifically. Although the overall number of transformants obtained with pExp1ctpA::tetM recA ec was relatively low (<20 transformants) and the number of wild type M. mycoides capri needed for transformation was high, >20% of the transformants in each experimental repetition had the insertion in the targeted gene. Importantly, all ctpA::tetM mutants that were obtained using pExp1ctpA::tetM recA ec occurred by double crossover homolog ous recombination and are therefore far more likely to be stable. Unlike the mutant obtained by random insertional mutagenesis using Tn4001T, the mutants obtained with pExp1ctpA::tetM recA ec did not contain remnants of the plasmid backbone, which may als o enhance stability. To the best of our knowledge, a successful classical doublecrossover homologous recombination using a suicide plasmid has been reported previously only in M. genitalium (Burgos et al. 2008; Kannan and Baseman 2006) Importantly, this simple yet elegant approach provides a significant advance in our ability to manipulate the M. mycoides capri genome. Like OriC this technique may have applicability in other mycoplasmal species. This technique provides a new and promising approach that provides an additional genetic

PAGE 39

39 tool to use in unraveling the pathogenic mechanisms by which these microbes induce disease. Table 21. Primer pairs used for PCR. Primers 5 1 For ctpA Coding sequence For: CACCATGAA ACTAGTTAAAAAAATAG 1 Rev ctpA Coding sequence Rev CTTACTAAGGTTAATTTTTGTTATTTTAA 2 For a USE ctpA For : GGATCC 2 Rev CATTTTTATACAAATGTTTTTTTCTTTGG ctpA Coding sequence Rev: CTTACTAAGGTTAATTTTTGTTATTTTAA 3 For b E.coli RecA For: ACTAGT 3 Rev TATGGCTATCGACGAAAACAAACA G c E.coli RecA Rev: C TCTAGA 4 For GATGCGACCCTTGTGTATCAAAC CtpA Flanking For(thi): GGATCCGTTTATAAAAATGGAGAATTTGCACAA 4 Rev ctpA Flanking Rev: CTATTCACTATAGTATTAGGAAAAAAA 5 For tetM BB14 : CGTATATATGCAAGACG 5 Rev tetM BB15 : TTATCAACGGTTTATCAGG 6 Tn4001tSeq : GTACTCAATGAATTAGGTGGAAGACCGAGG Restriction enzyme sites that were created for cloning purposes are underlined. a GGATCC is an introduced BamHI site. b ACTAGT is an introduced SpeI site. c TCTAGA is an introduced XbaI site.

PAGE 40

40 Table 22. Sequence for M. mycoides capri ctpA::tetM mutant created by random mutagenesis using Tn4001t. Nucleotide Sequence 1 CCGAGGCACT GCATAACATC TTCCGCAGTA CCGCCCGATT CCACCTGTAT 51 AATCGCAAGA AGTATGTTGG GACTTTTACA CAATTATACG GACTTTATC A 101 151 TTATGTTTTA ACTTCACCAT TTTCATTCTC AGCTGGAAAC ATTTTCCCTC 201 AACTAGTTAA AGATAATAAT GTTGCAAAAG TAATTGGATT TAAAACTGCA 251 GGTGGAGCTT CAGCGATTAG TCAAGCAATT CTACCAACTG GAGATATTAT 301 TCAATTAAGT AGTAATAATG TTTTAACTAA TAAATCTCAT CAAAGTTTAG 351 AATATGGTGT TAATCCAGAT ATTACACTTG GATTTGATCC ATTCAAACAA 401 ACTGAAAAAT TCTTTGATTC AGCTTATATT CAACAAGCTA TTAATAAAGA 451 TACAAATACA TTAAATTCAA TTCCAGCTAC TCATTCTAGT GTTGTTGAAC 501 CAAATTATGT ACATAAACTT GTAGAACAAC CTCAACCACT ACAATTAAGT 551 AGAAAAACTG ATGAAACTGA AATAAAAAAT CTTAATAATT TATTTTCTAG 601 TATAAAAGAA ACCGAAAGAA AAGATGCATA TTTTGTACTT GGAGCACTTG 651 GTGTTGTTAT TAGTTTAGCA ATCTCATTTG TAATTATTAA AAAAATATTA AAATAACAAA AATTAACCTT AGTAAGAAAT ACTAAGG 701 TTTAAAAAAA TAGGTCACTT TTAAAATTTT TTTCCTAATA CTATAGTGAA TTT TTTTATTTTT 751 TAGAAAAAAG AAAGGAATTA ATTATGAAAA AAGCTTTAAA AGTATTTTCG 801 ATTTATTCAT TAGACCCAGT TGA The dotted underlined sequence is the Tn4001 sequence. The solid underlined sequence indicates the resumption of the ctpA coding sequence at nt1400 ct p. The normal text indicates the start of sequences downstream from ctpA

PAGE 41

41 Table 23. Sequence for M. mycoides capri ctpA::tetM mutant created by homologous recombination using disruption plasmid II ( pExp1ctpA::tetM recAec) Nucleotide Sequence 1 51 ACCGAAAAAA ACCTTTTTTA TACAAATGTT TTTTTCTTTG GATTTTTTTA 101 TTTAAAAAAC GTCTAAAAAA CCAGTATAGA TCTTGTATAA GCAAAAAAAT GGACTAATAT TTAAATAAAG CAAAAAGGAG AAAAAGATT 151 TAAAAAAATA GGCTTTTTAA GCTTAAGTGC AATTAGCATA TTAGGACCAC A TGAAACTAGT 201 TAGCTATGAT TAACAATCTA ACTACTGATA ATAATCTTTT AATAACCAAA 251 AGGTTTTTAA GTAGTTCAAA CTCTAATGTT GGGTTAAAAT CATATGATTA 301 TATAAACTTA ATTAACAACA AATATATACC TACAAAAATT AATTTACACG 351 ATCATAATGG GATTGCTTAT ATTGGAGTTA AAGAATTCTT AAAGTCTCTA 401 GACGGACTTA TTAGTTTTTC TAAAATAAAA GTAAGACCAT ATCAAAACGC 451 AAATTTTTAT AAAGAAAAAG AAATTAGTTA TAATTACAAA AACAATAAAG 501 TTGTTTTAAA CTCAATTAGT AAATATTCAA ATAATAATAA AACTACTAAC 551 TATCAACTAG AAATTGATAG TAAAAATAAA ACTATTACAG TATCTGATAA 601 TGACTTTTTT ACAGATATTT TCACTTTTTA TAGACGTGGT GAAGAAGATT 651 TAAATATTGA CTTTTTAAAT ACTGAAATTG TAAATAAAAA TAAACATATA 701 GTATTTGATT TAAACAAGTA TGGAATCGAA ATTTTAAATG ATCAAAATGA 751 CTTGTATTTA CCATTAGTAC TAATTAATCA ACTATTTTTA AATCAATCAA 801 ATGTGCAATT GTATTTTAAT GGACAATCTG TTAATTTATT TGCATACAGT 851 AAAACACTTG GAAAAGTTGA ATTATTAAAG CAATTAAAAC ACTCATATTT 901 AATAATCAGA ATCATATACC AGCGGTTTAA AAGATTTTCA ATATAAATAT 951 TTAGGATTTT ATTTGATCCC CGACCTCCAA CAAACCGCCA TTTGGAAAGT 1001 AATATACAAT ATTTTAAACA GCGTAAATAG CAACTACCAT TATACGGTTT 1051 TTTTAATTGG CGTTTAGTAA G The sequence shows the insertion site of tetM into the coding sequence. The solid underlining indicates the upstream sequences of ctpA that are not found in the disruption construct. The nnormal text indicates sequences of ctpA tha t are present in the disruption construct. The double underlining indicates tetM sequences present in the disruption construct. The bold, underlined sequence indicates the insertion site for tetM

PAGE 42

42 Table 24. Internal sequence for M. mycoides capri ctpA: :tetM mutant created by homologous recombination using disruption plasmid II ( pExp1 ctpA::tetM recAec) Nucleotide Sequence 1 AATATTCCCG AGGATGCATA ACATCTTCCG CAGTACCGCC CGATTCCCCT 51 GTATAATCGC AAGAAGTATG TTGGGACTTT TACACAATTA TACGGACTTT 101 ATCCTTTCTG ATGTATTAGA AGTAACAGGT ATTGTTTGGA ATGCAACTTT 151 AACTTTTGTG GCTGTTATTC TTATTTCATT AATATTAGAT GAAATTGGTT 201 TTTTTGAATG GTCTGCGATA CATATGGTCA AGGCTTCAAA CGGTAATGGC 251 TTAAAAATGT TTGTTTTTAT TATGTTACTT GGGGCAATTG TAGCAGCATT 301 TTTCGCAAAT GATGGTGCAG CTTTAATCTT AACGCCTATT GTATTAGCGA 351 TGGTAAGGAA TCTAGGATTT AATCAAAAAG TGATTTTCCC CTTTATTATT 401 GCCAGTGGTT TTATTGCTGA TACTACATCA CTTCCCTTAA TTGTAAGTAA 451 CTTAGTTAAT ATCGTTT CTG CAG 501 TTCTACCAAC TGGAGATATT ATTCAATTAA GTAGTAATAA TGTTTTAACT GTGGAGC TTCAGCGATT AGTCAAGCAA 551 AATAAATCTC ATCAAAGTTT AGAATATGGT GTTAATCCAG ATATTACACT 601 TGGATTTGAT CCATTCAAAC AAACTGAAAA ATTCTTTGAT TCAGCTTATA 651 TTCAACAAGC TATTAATAAA GATACAAATA CATTAAATTC AATTCCAGCT 701 ACTCATTCTA GTGTTGTTGA ACCAAATTAT GTACATAAAC TTGTAGAACA 751 ACCTCAACCA CTACAATTAA GTAGAAAAAC TGATGAAACT GAAATAAAAA 801 ATCTTAATAA TTTATTTTCT AGTATAAAAG AAACCGAAAG AAAAGATGCA 851 TATTTTGTAC TTGGAGCACT TGGTGTTGTT ATTAGTTTAG CAATCTCATT 901 TGTATTATTA AAAAAAATAT TAAAATACAA AAATTAACCT TAGTGAAGAA 951 ATACTAAGTT TTATTTTTTT TAAAAATAGG TCACTTTAA The sequence shows the end of the tetM gene and the resumption of the ctpA coding sequence. The double underlining indicates tet M sequences. The single underlined CTG CAG denotes the end of the tetM sequence and the resumptio n of the downstream ctpA coding sequence.

PAGE 43

43 Table 25. Sequence of tetM probe. CATATG TATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTA GATTTCTTAGCAGAAGTATATCGTTCAT CAAGCACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCC CACAATCTTTTTTATCAATAAGATTGACCAAAATGGAATTGATTTATCAA CGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAA CAGAAGGTAGAACTGTATCCTAATGTGTGTGTGACGAACTTTACCGAATC TGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGAGAAAT ATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGC ATAAGATTTCAGAATTGTTCTCTGTTCCCTCTTTATCATGGAAGTGCAAA AAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTT ATTCATCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAA ATTGAATATACAAAAAAAAGACAACGTCTTGCATATATACGCCTTTATAG TGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAGGAAAAAA TAAAAGTTACAGAAATGTATACTTCAATAAATGGTGAATTATGTAAGATT GATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTTTTGAA GTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGA TTGAAAATCCGCACCCTCTACTACAAACAACTGTTGAACCGAGTAAACCT GAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGA TCCGCTTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTT CTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGTGCACTGTTGCAAGAA AAGTATCATGTGGAGATAGAAATAACAGAGCCTACAGTCATTTATATGGA GAGACCGTTAAAAAATGCAGAATATACCATTCACATCGAAGTGCCGCCAA ATCCTTTCTGGGCTTCCATTGGTCTATCTGTATCACCGCTTCCGTTGGGA AGTGGAATGCAGTATGA The NdeI (CATATG) a nd SacI (GAGCTC ) restriction sites are underlined. GAGCTC

PAGE 44

44 Table 26. Sequence of the plasmid backbone probe. TCGGAAAAAG AGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTG CAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTAC GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC AAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAG TATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTC AGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTAC GATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTC ACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGG TCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAG TAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTC ACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTAC ATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAG AAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTAC TGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTG AGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGC GCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACT CTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCG

PAGE 45

45 Table 27. Sequence of the ctpA probe used for the Northern blot. ACTAGT TAAAAAAAT AGGCTTTTTAAGCTTAAGTGCAATTAGCATATTAGGACCACTAGCTATGA TTAACAATCTAACTACTGATAATAATCTTTTAATAACCAAAAGGTTTTTA AGTAGTTCAAACTCTAATGTTGGGTTAAAATCATATGATTATATAAACTT AATTAACAACAAATATATACCTACAAAAATTAATTTACACGATCATAATG GGATTGCTTATATTGGAGTTAAAGAATTCTTAAAGTCTCTAGACGGACTT ATTAGTTTTTCTAAAATAAAAGTAAGACCATATCAAAACGCAAATTTTTA TAAAGAAAAAGAAATTAGTTATAATTACAAAAACAATAAAGTTGTTTTAA ACTCAATTAGTAAATATTCAAATAATAATAAAACTACTAACTATCAACTA GAAATTGATAGTAAAAATAAAACTATTACAGTATCTGATAATGACTTTTT TACAGATATTTTCACTTTTTATAGACGTGGTGAAGAAGATTTAAATATTG ACTTTTTAAATACTGAAATTGTAAATAAAAATAAACATATAGTATTTGAT TTAAACAAGTATGGAATCGAAATTTTAAATGATCAAAATGACTTGTATTT ACCATTAGTACTAATTAATCAACTATTTTTAAATCAATCAAATGTGCAAT TGTATTTTAATGGACAATCTGTTAATTTATTTGCATACAGTAAAACACTT GGAAAAGTTGAATTATTAAAGCAATTAAAACACTCATATTTAAATAATCA GAATCATATACCAGCAGGTTTAAAAGATTTTCAATATAAATATTTAGGAT TTTTATTTGATCATTTTTATGGTATTAAATTAGATAAAAATGCTTCATAT AAAGATTTATTTAAAAAATATGAAAAATACATTAAAGCAGATAATACTAC TCACTACTTAACAAGTAGATATTTAATTGAACAATTAGATGATTTACATT CATCATATTTATTAACAGGATATTATAATAAAGATTTAGAAACAATTAAT AAAGCTGTTTTAAAAACAACAACACCTAGATCTGATAGATTTAAAGATAT TGCAAGAAGATTAAGCGCATATTATGATAAAGAGTTAAACTATAAAAATG TTTATACTCCAGATAGAAAAACAAGTGTTATTTCATTTAAAAACTTTGAA GCTAATTCAGCTTTTAAAATCGAAGAAAGCTTAAAACAAGCTCAAAGAGA TGGTATTAAAAATATTGTTTTAGATGTAAGCTTTAATAGAGGTGGTTATT TAGGAACTGCTTTTGAAATCATGGGATTTTTAACAGATAAACCATTTAAA TCTTATTCATATAATCCTTTAACAAAAGAACAACAAGTTGAAACTATTAA ATCAAGATTTAAAAAATATGATTTTAACTATTATGTTTTAACTTCACCAT TTTCATTCTCAGCTGGAAACATTTTCCCTCA The Spe I sites are underlined. ACTAGT

PAGE 46

46 Table 28. Generation of ctpA mutants by random insertion mutagenesis and homologous recombination. Species a Method b Number ctpA mutants/ Number transformants (%) Mmc RIM with Tn916 2/1776 (0.11) Mmc RIM with Tn4001T 1/674 (0.15) Mcap RIM with Tn4001T 1/384 (0.26) Mmc Experiment 1: HR with Pexp1 ctpA :: tetM 1/59 (1.69) Mmc Experiment 2: HR with Pexp1 ctpA :: tetM 0/42 (0) Mmc Experiment 3: HR with Pexp1 ctpA :: tetM 0/51 (0) Mmc Experiment 1: HR with Pexp1ctpA :: tetM recAec 3/14 (21.4) Mmc Experiment 2: HR with Pexp1 ctpA :: tetM recAec 4/15 (26.7) Mmc Experiment 3: HR with Pexp1 ctpA :: tetM r ecAec 4/17 (23.5) a Mmc indicates Mycoplasma mycoides subsp. capri GM12. Mcap indicates Mycoplasma capricolum. b RIM indicates random insertion mutagenesis. HR indicates homologous recombination.

PAGE 47

47 Figure 21. Constructs used for targeted mutagenesis o f Mycoplasma mycoides subsp. capri A) Diagrammatic information on preparation of pExp1ctpA::tetM The 672 kb removed from ctpA and subsequent insertion of tetM is shown between BclI site at nt 828 and PstI site at nt 1500 of the coding sequence. B) Diag rammatic information on preparation of pExp1ctpA::tetM recAec RecAec under the direction of the upstream elements and promoter region of ctpA was cloned following nt12 of the ctpA coding sequence and ligated into the XbaI site of pExp1 ctpA::tetM

PAGE 48

48 Figure 22. Construction of pExp1ctpA::tetM and pExp1ctpA::tetM recAec. A) Gel demonstrating the key features of preparation of pExp1 ctpA Lane1: 1KbPlus DNA Marker (Invitrogen); Lane 2: PCR of ctpA coding sequence; Lane 3: Undigest ed pENTER ctpA ; Lane 4: pENTER ctpA +SpeI; Lane 5: pENTER ctpA +NotI and XbaI; Lane 6: Undigested pExp1ctpA ; Lane 7: pExp1ctpA +NdeI. B) Gel demonstrating the key features of preparation of pExp1ctpA::tetM Lane 1: 1 Kb Plus DNA Marker (Invitrogen); Lane 2: Undigested pIVT 1; Lane 3: pIVT 1+BamHI and PstI; Lane 4: pExp1 ctpA +BclI and PstI, showing 672 bp removed from ctpA gene (arrow); Lane 5: Undigested pExp1ctpA::tetM ; Lane 6: pExp1ctpA +KpnI; Lane 7: pExp1ctpA::tetM +KpnI, showing linearization of pEx p1ctpA::tetM due to introduction of KpnI site found in tetM C) Gel demonstrating the key features of preparation of construction of pXL USE ErecAec Lane 1: 1KbPlus Marker (Invitrogen); Lane 2: PCR of USE ctpA from M. mycoides capri wild type; Lane 3: Undigested pXLURE ctpA ; Lane 4: pXLURE ctpA +BamHI; Lane 5: PCR of recA gene from E. coli ; Lane 6: Undigested pXLrecAec ; Lane 7: pXLrecAec +SpeI; Lane 8: pXLUSE ctpA +SpeI; Lane 9: Undigested pXLUSE recAec D) Gel demonstrating the key features of preparation of pExp1ctpA::tetM recAec Lane 1: 1KbPlus Marker (Invitrogen); Lane 2: pXLUSE recAec +XbaI; Lane 3: pExp1ctpA::tetM +XbaI; Lane 4: Undigested pExp1ctpA::tetM recAec ; Lane 5: pExp1ctpA::tetM recAec +XbaI; Lane 6: pExp1ctpA::tetM recAec +BglII. The ar row denotes the 342 bp fragment that was deleted from pExp1ctpA::tetM B D C 1 2 3 4 5 6 7 1 2 3 4 5 6 7 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6

PAGE 49

49 Figure 23. Construction of pXL USEcptAplacZ. A) Gel demonstrating the key features in the preparation of pXL USEcptAplacZ Lane 1: 1 kbPlus DNA marker (Invitrogen); Lane 2: pXL( SpeI) lacZ ; Lane 3: pXL(SpeI) lacZ + SpeI; Lane 4: pXL USE cptAplacZ ; Lane 5 : pXLUSE cptAplacZ + NdeI and XbaI. B) E. coli transformed with pXLUSE cptAplacZ showing capability of M. mycoides capri ctpA USE and promoter to drive expression of LacZ C) E. coli transformed with pXL lacZ showing no LacZ expression in the absence of the M. mycoides capri ctpA USE and promoter C B A 1 2 3 4 5

PAGE 50

50 Figure 24. Disruption of the ctpA gene through homologous recombination results in loss of proteolytic phenotype. A) PCR amplif ication of genomic DNA from M. mycoides capri wild type and M. mycoides capri ctpA::tetM mutant obtained by homologous recombination using pExp1ctpA::tetM recAec The PCR primers were specific for the genes flanking the ctpA gene. Lane 1: 1KbPlus Marker (Invitrogen); Lane 2: M. mycoides capri wild type; Lane 3: M. mycoides capri ctpA::tetM showing the 4 kb insertion in the ctpA gene. B) Growth of M. mycoides capri ctpA::tetM (top) and M. mycoides capri wild type (bottom) on casein agar. Note absence of proteolytic zone around M. mycoides capri ctpA::tetM C) PCR amplification of genomic DNA from M. mycoides capri wild type and six ctpA::tetM mutants obtained through homologous recombination using either pExp1ctpA::tetM or pExp1ctpA::tetM recAec Lane 1 : 1KbPlus Marker (Invitrogen); Lane 2: M. mycoides capri wild type; Lane 3: M. mycoides capri ctpA::tetM mutant obtained with pExp1ctpA::tetM ; Lanes 4 8: Representative M. mycoides capri ctpA::tetM mutants obtained with pExp1ctpA::tetM recAec All insert s were of the expected size and occurred at the same location 1 nt in the ctpA coding sequence. 1 2 3 1 2 3 4 5 6 7 8

PAGE 51

51 Figure 25. Amplification of tetM gene and corresponding phenotype. The tetM gene was amplified from genomic DNA of wild type and mutant strains to conf irm insertion (gel on left): Lane1: 1KbPlus Marker (Invitrogen); Lane 2: pIVT 1; Lane 3: M. mycoides capri wild type genomic DNA; Lane 4: M. mycoides capri ctpA::tetM mutant generated by homologous recombination; Lane 5: M. mycoides capri :: Tn4001t( ctpA ) generated by random insertional mutagenesis; Lane 6: Mycoplasma capricolum wild type genomic DNA; Lane 7: M.capricolum:: Tn4001t (ctpA) generated by random insertional mutagenesis. The phenotype was confirmed by growth on casein agar (right). Shown are M. m ycoides capri wild type (Lane 3, Panel A), M. mycoides capri ctpA::tetM mutant (Lane 4, Panel B), M. mycoides capri ctpA:: Tn4001t (Lane 5 and Panel C), M. capricolum wild type (Lane 6, Panel D), and M. capricolum ctpA:: Tn4001t (Lane 7, Panel E). C A B E D 1 2 3 4 5 6 7

PAGE 52

52 Fi gure 2.6. Presence of tetM and plasmid vector backbone in M. mycoides capri GM 12 wild type and M. mycoides capri ctpA::tetM mutant. SpeI was used for restriction digest because Tn4001T lacks this site. A) Southern blot was developed using a probe specifi c for tetM Both the M. mycoides capri ctpA::tetM mutants obtained by HR and RIM had a single copy of tetM Lane 1: 1KbPlus Marker (Invitrogen); Lane 2: SpeI restriction digest of genomic DNA from M. mycoides capri wild type; Lane 3: SpeI restriction digest of genomic DNA from M. mycoides capri ctpA::tetM mutant obtained by a double cross over homologous recombination (HR) event using pExp1 ctpA::tetM recAec ; Lane 4: SpeI restriction digest of genomic DNA from M. mycoides capri ctpA::tetM mutant obtained by random insertional mutagenesis (RIM) using Tn4001T. B) Southern blot was developed using a probe specific for sequences present in the plasmid backbones of both pExp1 ctpA::tetM recAec and Tn4001T. Lane 1: 1KbPlus Marker (Invitrogen); Lane 2: SpeI restr iction digest of genomic DNA from M. mycoides capri wild type; Lane 3: SpeI restriction digest of genomic DNA from M. mycoides capri ctpA::tetM mutant obtained by a double cross over HR event using pExp1ctpA::tetM recAec ; Lane 4: SpeI restriction digest o f genomic DNA from M. mycoides capri ctpA::tetM mutant obtained by RIM using pIVT 1 Tn4001T; Lane 5: Tn4001T transposon, which lacks a SpeI site, as a positive control. Note that the plasmid backbone was not retained in M. mycoides capri ctpA::tetM obtained by HR (Lane 3) but was present in the M. mycoides capri ctpA::tetM mutant obtained by RIM (Lane 4). B A 1 2 3 4 1 2 3 4 5

PAGE 53

53 Figure 27. Northern blot confirming the absence of a ctpA transcript in M. mycoides capri ctpA::tetM mutant. Lane 1: DIG labeled RNA MW marker I ( Roche); Lane 2: Total RNA extracted from M. mycoides capri wild type; Lane 3: Total RNA extracted from M. mycoides capri ctpA::tetM mutant. Probe: Spe I gel purified fragment of ctpA gene. 1821 2661 1 2 3

PAGE 54

54 CHAPTER 3 TARGETED DELETION OF S41 PEPTIDASE IN MYC OPLASMA MYCO IDES SUBSP. CAPRI RESULTS IN ST RESS RESPONSE, AND PERTURBED GLYCOLYSIS/GLUCONEOGESIS Introduction Carboxyl terminal proteases belong to a group of proteases that were initially identified by genetic complementation analysis of specific photosynthetic mut ants of the cyanobacterium Synechocystis sp. strain PCC 6803. CtpA protein was shown to be responsible for cleavage of the D1 precursor (pD1) polypeptide of photosystem II (PSII) (Nixon et al. 1992). This C terminal processing is essential for the subsequent water oxidation and the generation of oxygen molecules in oxygenic photosynthetic organism s hence it is important for correct functioning of the PSII complex (Diner et al. 1988). Subsequently they have been identified in the chloroplasts of algae and hi gher plants. TSP proteins have also been identified in many bacterial pathogens including Borrelia, Chlamydia, Shigella, Vibrio, and Yersinia Although their overall physiological functions in bacteria are not well understood; they have been reported to pl ay important roles in the modification of some bacterial proteins with consequences to their virulence or their physiology (Baumler et al 1994). For example the inactivation of TSP of Borrelia burgdorferi the etiologic agent of Lyme borreliosis, affected the synthesis and the processing of the outer membrane protein P13 and the inactivation of CtpA protein had a pleiotropic effect on the protein expression profile in Borrelia (Ostberg et al. 2004). in Chlamydiae, two TSP proteins CT441 and CT858 have been found to target and interfere with host proteins that are involved in the host immune response against microbial infection. CT858 degrades the regulatory factor X5(RFX5) and Upstream Stimulation Factor 1(USF 1), these transcription factors are required for the expression

PAGE 55

55 of the major histocompati bilty complex (Zhong et al. 2001). CT441 has been reported to cleave p65 protein which is an important regulator for the NF the inflammatory response (Lad et al. 2007). They are considered to be unique among serinetype proteases due to their resistance to the conventional protease inhibitors and their characteristic catalytic center (Ekici et al. 2008, Liao et al. 2000, Paetzel et al. 1997). They selectively target and cleave the nonpolar C termini of many precursor proteins (Silber et al. 1992) either during the course of their maturation (Gollin et al. 1992, Hatchikian et al. 1999. Islam et al. 1993, Menon et al. 1993, Rossmann et al. 1994) or during their transportation into other organelles or export to the periplasm (Diner et al. 1988, Nagasawa et al. 1989). They may also target and degrade damaged or aberrant proteins (Keiler et al 1996). In G ram positive bacteria C terminal processing is a required step in the transpeptidation mechanism to anchor some surface proteins to the cell env elope (Mazmanian et al. 2001). The gene ctpA ( ZP_02512724) has been identified through random transposon mutagenesis and then specifically disrupted through targeted mutagenesis as explained in chapter 2 In silico analysis of the DNA sequence and the predicted protein product indicated that it belongs to Carboxyl terminal processing proteases with the presence of a tail specific protease domain (TSPc) located between amino acid residues 340 and 544 (Figure 3 1) This domain has been shown to recognize and cleave specific hydrophobic residues of the substrate (Beebe et al. 2000). It also contains a signal peptide (aa 124) that overlaps with the transmembrane domainTMD (aa 729) (Figure 3 1 and 32) ; these domains indicate that the protein is targeted and anchored to the

PAGE 56

56 cell membrane. The protein with its domain composition resembles another E. coli periplasmic TSP containing protease known as Prc (processing involving C terminal cleavage). Prc is a 76kDa periplasmic protein involved in processing of penicillin binding protein 3 (PBP3) an integral protein in the inner membrane; Inactivation of Prc in E. coli results in a mutant that exhibits sensitivity to high temper ature and leakage of periplasmic proteins under osmotic stress (Hara et al. 1991). Other characterized CtpA proteases also contain N terminal signal sequences to transport it across the thy lakoid membrane in chloroplast (Karnauchov et al. 1997, Mitchell et al. 1997). Proteomic Studies in Mycoplasmas Mycoplasmas are very attractive and suitable microorganisms for the proteomic studies and this fact was recognized very early. Two of the smallest mycoplasmas M. genitalium and M. pneumoniae were among the firs t organisms for which proteomic profiles were determined (Jaffe et al 2004, Wasinger et al 2000, Ueberle et al 2002). In addition, there are advantages of performing proteomic analysis in mycoplasmas. Those include the availability of several fully and par tially sequenced mycoplasma genomes; this knowledge of the genomic sequences and potential protein coding sequences is almost an absolute prerequisite for proteomic technologies. The small size of the mycoplasma genomes and their relatively few proteins t hey encode (less than 1000) should make a high experimental coverage possible, while the paucity of their transcriptional factors and regulators (Razin et al 1998) should permit the detection of nearly all of the gene products made by the organism in a rel atively small number of environmental stimuli or culture conditions. As part of this study, differential proteome profiling was carried out followed by pattern discovery analysis; the objective of these proteomic experiments and analyses

PAGE 57

57 was to gain a per spective as to what the role of ctpA may be and the effect of its disruption on the overall protein expression profile of Mycoplasma mycoides subsp. capri Determining some of the proteins impacted by the ctpA disruption would shed light on the function of this gene and the type of pathways and reactions wherein it may participate or perform. Materials and Methods Mycoplasma Strains and Their Cultivation Mycoplasma mycoides subsp. capri GM12 type ATCC 35297 ( M. mycoides capri ) ( MansoSi lvn et al. 2009 ) and Mycoplasma mycoides subsp. capri GM12 ctpA::tetM were used for this study. M. mycoides subsp. capri GM12 ctpA::tetM was generated by double cross over homologous recombination as described in Chapter 2. For all experiments both my coplasmas strains were cultivated in parallel at 37 C in the same batch of SP4 medium. The SP4 medium that was used to culture M. mycoides ctpA::tetM w was monitored by optical density readings that were performed at 640 nm and all cultures were harvested at late log phase (OD640 = 0.08). All microbial cultures contained 1012 CFU per ml of me dia at the time of harvest, which was confirmed by culture. Cultivation of mycoplasmas was performed 3 times and each culture was considered a biological replicate.

PAGE 58

58 Preparation of Protein Extracts for Proteomics Bacterial suspensions were divided into 2 aliquots so that one aliquot was used for 2 dimensional electrophoresis and the second was used for amine specific peptide based labeling (iTRAQ) followed by tandem mass spectrometry. Bacterial suspensions were pelleted by centrifugation at 8,000 x g, for 30 minutes at 40 C and pellets were washed with wash buffer solution (Calbiochem ProteoExtract k it, San Diego, CA). Protein from pellets that were to be analyzed by 2 dimensional electrophoresis were extracted with T rizol (Invitrogen Corp., Carlsbad, CA) according to the manufacturers protocol. Pelleted protein extracts were allowed to air dry and were stored at 20 C. Protein from samples that were to be analyzed by iTRAQ analysis were extracted with ProteoExtract Complete Mammalian Proteome Extraction Kit (Calbiochem, San Diego, CA). Proteome Profiling by 2 Dimensional Differential Gel Electrophoresis (2D DIGE) Protein pellets were dissolved in buffer containing 8 M urea, 2 M thiourea, 4% CHAPS, and 10 mM Tris, pH 8.5. Total protein from each biological replicate was first determined by Lowry assay. The protein concentration of each sample was adjusted so that both protein samples, M. mycoides ctpA::tetM and wild type M. mycoides contained the same amount of protein before labeling with CyDye Fluor minimal dyes (GE Healthcare, Piscataway, NJ). M. mycoides ctpA::tetM was labeled with Cy5 and wild type M. mycoides (control) was labeled with Cy3 fluorescent dyes. The Cy2 labeled mix ture that was composed of an equal amount of M. mycoides ctpA::tetM and wild type M. mycoides was used as an internal standard. Fifty micro grams of each sample was mixed and loaded onto a 24 cm, pH 3 11 IPG strip (GE Healthcare, Piscataway, NJ).

PAGE 59

59 Electrofo cusing of proteins was performed overnight at 1000 volts with a temperature controlled IPGphor Isoelectrofocusing unit (GE Healthcare, Piscataway, NJ). The separated IPG strip was then loaded into a precast 8 to 16% SDS polyacrylamide gel (Jule, Inc. Milf ord. CT). Three 2dimensional electrophoresis experiments were performed, and each experiment contained a different biological replicate. Differential Image Anal ysis of Protein Gels G el images were obtained with Typhoon 9600 Variable Mode Imager (GE Healt hcare) which is designed to optimally detect each protein bound to different CyDye Fluor Cy3 was detected with a 532 nm excitation laser and a 580 BP 30 emission filter Cy5 was detected with a 633 nm excitation laser and a 670 BP 30 emission filter Cy2 was detected with a 488 nm excitation laser and a 520 BP 40 emission filter The digital image information from each gel was acquired and analyzed with DeCyder 2D version 7.0 software ( GE Healthcare, Piscataway, NJ). Specifically, the Cy2 internal standard was used to co detect, match and normalize protein spots in all 3 gels. Protein ratios for each gel spot were generated by dividing the total area of M. mycoides ctpA::tetM spot by the total area of the corresponding wild type M. mycoides spot. For statistical analysis, protein ratios from all 3 biological replicates were analyzed by Students t test and 1 way ANOVA. A composite image of all 3 biological replicates was generated with the Biological Variation Analysis module from DeCyder 2D version 7.0 software ( GE Healthcare, Piscataway, NJ).

PAGE 60

60 Protein Spot E xcision Only protein ratios that were 2 fold or greater in difference were considered for further analysis. In order to visually detect protein spots of interest, all 3 gels were counter stained with DeepPurple (GE Healthcare) fluorescent stain. Protein spot coordinates that were obtained from DeCyder 2D version 7.0 software ( GE Healthcare, Piscataway, NJ) were used to locate the specific protein spot of interest in each gel. An automated spot picker, ProPic Workstation (Digilab Genomic Solutions Inc., Ann Arbor, MI) selected protei n targets. The same protein spot from each biological replicate was pooled for processing and identification by tandem mass spectrometry. Protein destaining and enzymatic digestion was performed as previously described (Stone et al. 1997). Briefly, gel sp ots were destained and washed in 50% acetonitrile in 25 mM ammonium bicarbonate buffer and dehydrated in a speedvac centrifuge for 15 minutes. Protein was reduced and alkylated by incubating with 45 mM dithiothreitol and incubation for 30 minutes at room t emperature followed by incubation with 100 mM iodoacetamide for 30 min in darkness. Gel pieces were then washed in 50% acetonitrile in 50 mM ammonium bicarbonate and dehydrated in the speedvac for 15 minutes prior to digestion with trypsin enzyme cocktail ( ammonium bicarbonate pH 8.4, 5 mM CaCl2). Enzyme cocktail was added to the sample at a ratio of 1:20, enzyme to protein. Digested protein samples were separated and identified using LC MS/MS as described for the iTRAQ pro tein fractions. Quantitative Proteomics Using Peptide Labeling and 2D LC MS/MS The total protein concentration of all protein samples was determined with the Non Interfering Protein Assay Kit (Calbiochem, San Diego, CA). In order to minimize variability, the protein extracts from all 3 biological replicates of wild type M. mycoides

PAGE 61

61 subsp. capri (control) were combined and the total protein concentration of the pooled sample was adjusted to match the total protein concentration of each M. mycoides ctpA::te tM biological replicate. Bacterial protein extracts were processed and labeled with an amine specific peptidebased labeling system iTRAQ according to the manufacturers instructions (Applied Biosystems, Foster City, CA). Briefly, a 60 g aliquot of each sample was dissolved in reduced with reducing agent (50 mM tri s2 carboxyethyl phosphine) at 60C for 1 hour. After reduction, cysteines were blocked with 200 mM methyl methanethiosulfonate for 10 minutes at room temperature. Ten microliters of a trypsin solution (Promega Corporation, Madison, WI) was added to each s ample and incubated overnight at 37C. After digestion, the pooled wild type control sample was labeled with 114 reagent, and biological replicates 1, 2, and 3 of M. mycoides ctpA::tetM was labeled with 115, 116 or 117 reagent respectively. All labeled sam ples were combined, and desalted by using a macrospin column Vyadac Silica C18 (The Nest Group Inc, Southboro, MA) prior to strong cation exchange (SCX) procedure. SCX fractionation of desalted iTRAQ labeled peptides was performed with a polysulfoethyl A ). Peptides resuspended in buffer A (75% 0.01 M ammonium formate, 25% ACN) were eluted during a linear gradient of 020% buffer B (75% 0.5 M ammonium formate, 25% ACN) and detected at an absorbance of 280 nm. Eluted fracti ons were further separated by capillary reverse phase HPLC using an LC Packing C18 Pep Map column (DIONEX, Sunnyvale, CA). Mass spectrometric analysis of column elute was performed inline with a hybrid

PAGE 62

62 quadrupoleTOF mass spectrometer QSTAR (Applied Biosys tems Inc). The focusing potential and ion spray voltage was set to 275 V and 2600 V, respectively. The informationdependent acquisition mode of operation was employed in which a survey scan from m/z 400 1200 was acquired followed by collision induced di ssociation of the three most intense ions. Tandem mass spectra were extracted by Analyst (v 1.1. ; Applied Biosystem Inc). The National Center for Biotechnology Information bacterial protein database (concatenation of the forward and random sequences) was used for protein identification. Searches were performed using MS/MS data interpretation algorithms from Protein Pilot (Paragon algorithm, v 3.0, Applied Biosystem Inc) and Mascot (v 2.2, Matrix Science, London, UK). The Paragon algorithm from Protein Pilot was set up to search iTRAQ 4 plex samples as variable modifications with methyl methanethiosulfonate as a fixed modification. The Protein Pilot algorithm was selected to search automatically for biological modifications such as homocysteines. A dditional information on this algorithm can be found in ( Shilov et al. 2007). The confidence level for protein identification was set up to 1.3 (95%) which is the default for the detected protein threshold in a Paragon method. The differential expression ratios for protein quantitation were obtained from Protein Pilot which calculates protein ratios using only ratios from the spectra that are distinct to each protein, excluding the shared peptides of protein isoforms Peptides with low spectral counts were also excluded from the calculation of averages by setting the intensity threshold for the sum of the signal to noise ratio for all the peak pairs at greater than 9. All the quantitative ratios were then corrected for bias automatically by Protein Pil ot when

PAGE 63

63 processing the data to create the Pro Group algorithm results. The bias factor calculated for the iTRAQ ratios were 0.3650 for 115/114; 0.4357 for 116/114; and 0.4286 for 117/114. Each protein that was quantified was identified by a minimum of t hree spectra that had an error factor (EF) less than 2. The EF is a measure of the variation between the different iTRAQ ratios (the greater the variation, the greater the uncertainty) and represents the 95% uncertainty range for a reported ratio. The P value is calculated based on the 95% confidence interval. Only protein ratios with a P value 0.01 were considered significant. Proteins were grouped according to global biologic functions as assigned in the Molligen 2.0 database (Barr et al. 2004). E nrichment analysis using Fisher exact test with false discovery rate correction for multiple comparisons was used to identify any biological function categories that were significantly over or underrepresented in the M. mycoides ctpA::tetM peptidase mutant Growth Curves for M. mycoides subsp. capri Wild Type and ctpA Mutant at Different Temperatures Both M. mycoides subsp. capri wild type and ctpA mutant were grown to log phase (OD640=0.06) in SP4 medium, these cultures were then used to inoculate fresh m edia for constructing growth curves. For each strain, 1 ml of the inoculum culture was added to 1 liter of fresh SP4 medium. This 1L culture medium was then divided into two 500 ml cultures; one of them was incubated at 37oC and the other at 42oC. The cult ures were monitored for the bacterial growth by measuring OD640 and CFU count. Results The 2 dimensional gel images are presented in Figure 33. Only 10 proteins were identified with 99% or greater accuracy. They are listed in Table 31. Most proteins

PAGE 64

64 we re detected were found to be significantly decreased in M. mycoides ctpA::tetM These were: preprotein translocase SecA, adenylsuccinate succinate synthase, phosphoglycerate kinase, and hypothetical proteins MSC 0133 and 0539. The only proteins found to be significantly increased in the mutant were the transcription anti termination protein NusG and seryl tRNA synthetase. Two hundred twenty one proteins were identified with the iTRAQ system. Of these, 61 proteins exhibited a significant change as a result of the S41 gene deletion (see Table 32). Proteins that are involved in several biological pathways were affected. How ever, the only biological function category to exhibit a significant perturbation as a result of the S41 gene deletion was the glycolysis pathway (P 4. These proteins included the glucose specific II A component of the phosphotransferase system, the glycolysis core module, and pyruvate metabolism. Although enrichment analysis did not recognize a significant perturbation in genetic information process, it was interesting to note that at least 18 of the 41 ribosomal genes that were detect ed were significantly increased in the mutant. At 37oC the growth rates of the wild type and ctpA were comparable; however at higher temperature 42oC the ctpA mutant had significantly slower growth than the wild type and showed significant loss viability much sooner than the wild type (Figure 35).

PAGE 65

65 Discussion The disruption of ctpA gene has a plei o tropic effect on the expression profile of the mutant in comp arison to the wild type strain. A s imilar effect has been reported for disruption of the ctpA gene in Borrelia burgdorferi (Ostberg et al 2004). Proteins involved in the gylcolysis/gluconeogenesis pathway have been impacted the most. Their expression was downregulated in the mutant in comparison to those of the wild type. Because of the interconnections between the glycolysis pathway and other central metabolic pathways (Deutscher et al. 2002); proteins and enzymes participating in nucleotides, amino acids, and lipids metabolism have also been affected by the disruption of ctpA gene. Dihydroxyacetone ki nase showed a two fold increase in its expression in the mutant. This enzyme catalyses the phosphorylation of dihydroxyacetone (Dha) into the glycolytic intermediate dihydroxyacetone phosphate (DhaP) (Garcia Alles 2004). In bacteria Dha is produced via oxi dation of glycerol (Forage et al. 1982) and possibly by aldol cleavage of fructose 6phosphate (Schurmann et al. 2001). Therefore, disruption of the ctpA gene in Mycoplasma mycoides subsp. capri might signify a shift in carbon source and energy metabolism toward glycerol. This shift toward glycerol would have implications for the cell not only in terms of energy and growth but also in coping with the byproducts and consequences of its metabolic activity, most prominently the increase in the level of H2O2 and oxidative stress. In addition to the ubiquitous and constitutively expressed glycerol facilitator GlpF (Vilei et al. 2000) Mycoplasma mycoides subsp. capri like the more virulent Mycoplasma mycoides subsp. mycoides Small Colony, has t he genes for a g lycerol import protein, an ABC transporter ( gtsABC ) and the gene for l glycerophosphate

PAGE 66

66 oxidase ( glpO ), which catalyzes the oxidation of glycerol 3 phosphate (G3P) to yield dihydroxyacetone phosphate (DhaP) with the concomitant release of H2O2. GlpO was identified as the membrane protein that plays a c entral role in cytotoxicity of M. mycoides subsp. mycoides SC strains towards embryonic calf nasal epithelial (ECaNEp) cells (Pilo et al. 2005). Glycerol metabolism and the subsequent release of H2O2 were important in the cytotoxicity of M. pneumoniae (Ham es et al 2009). The production of H2O2, a reactive oxygen species (ROS), has been proposed as the causative agent for the host cellular and tissue damage, (Tryon et al. 1992), and an inducer of the inflammatory process (Bischof et al. 2008). ROS causes ce ll damage through its reactions with major components of the cell including lipids, proteins, and nucleic acids. ROS causes peroxidation of unsaturated fatty acids which in turn leads to the release of more radicals and fatty aldehydes opening the way for more modifications of cellular structures. ROS also causes chemical modification of protein backbones, chain fragmentation and the oxidation of amino acid side chains. ROS are potentially mutagenic because of their reactions with DNA at purine bases that l ead to strand breaking. Lactate dehydrogenase was downregulated in the mutant while the level of acetate kinase expression did not change in the mutant versus the wild type. This imbalance between the two reactions in the mutant may have repercussions on t he redox potential and consequently the level of oxidative stress within the cell. Mycoplasmas can utilize glucose, fructose and glycerol as a carbon and energy source s. They are catabolized to pyruvate via glycolysis. Pyruvate then can be converted to acetyl CoA by the pyruvate dehydrogenase complex and finally to acetate

PAGE 67

67 by the enzymes phosphotransacetylase and acetate kinase. Alternatively, pyruvate can be reduced to lactate by lactate dehydrogenase. Both reactions have their specific advantage and downs ide. While the conversion of pyruvate to acetate yields two additional molecules of ATP and two more molecules NADH per molecule glucose, the regeneration of NAD+ from NADH is not possible. The recycling of NADH is important for balancing the redox potential and is expected to be a crucial point for the adjustment of Mycoplasmas metabolism, since they do not possess an electron respiratory chain that can be used for this purpose (Pollack et al. 1981). Reoxidation of NADH into NAD+ can only occur either i n the course of the reduction of pyruvate to lactate by lactate dehydrogenase; this reaction does not generate H2O2 (Halbedel et al 2007b) or through the oxidation of NADH by the enzyme NADH oxidase which in this process converts molecular oxygen to hydrog en peroxide. Because of the decrease in the lactate dehydrogenase expression the mutant is expected to either suffer the imbalance in the redox potential or to rely more on the NADH oxidase activity for the regeneration of NAD.+ Glycerol metabolism offers another source for generating hydrogen peroxide; it does so via the oxidation of glycerol 3 phosphate by the enzyme glycerol 3 phosphate oxidase which also uses molecular oxygen as the electron acceptor (Pilo et al. 2005). Due to the increase in NADH oxidase mediated regeneration of NAD+ and the oxidation of glycerol, the mutant would generate more H2O2 hence increase the level of oxidative stress compared to the wild type. Therefore the presence of an intact ctpA gene in the wild type might help strik e the balance between the production of ATP

PAGE 68

68 (conversion of pyruvate to acetate) and the regeneration of NAD+ without generating ROS (conversion of pyruvate to lactate) or disruption of the Redox potential. An alternative interpretation of the proteomic data could be predicated on the premise that glycerol synthesis rather than its catabolism occurs in the mutant as a result of downregulation of the glycolysis pathway and disruption of the redox potential. The rational for this view is that, first, SP4 medium is supplemented with glucose not glycerol, and the proteomic data s h owed that glycerol kinase expression did not increase in the mutant in comparison to the wild type. This is consistent with the finding that glycerol kinase activity could be modulated to prevent excessive uptake of glycerol in response to the presence of another more preferred carbon source such as glucose (Holms 1996). The glycerol kinase level should have been higher in the mutant as a result of an increase in the glycerol metabolis m. Secondly, in Mycoplasma pneumoniae, proteomic studies showed that the presence of glycerol in the medium has a repressive effect on the expression of acetate kinase, while glucose increased its expression. This is consistent with the fact that in the pr esence of glucose, pyruvate conversion into acetate produces an additional ATP molecule (Miles 1992). The effect of carbon source on lactate dehydrogenase was quite the opposite, with glucose having the repressive effect while glycerol increased its expres sion (Halbedel et al. 2007b). Since the proteomic data shows a decrease in the lactate dehydrogenase expression but no decrease in the acetate kinase level, it is unlikely that gl ycerol uptake and catabolism is increased in the mutant. Consideri ng the fact that dihydroxyacetone (Dha) can be produced from aldol cleavage of fructose 6phosphate (Schurmann et al. 2001), an alternative scenario

PAGE 69

6 9 might be that glycerol can be produced intracellularly, where Dha is converted into DhaP via the action of dihydroxyacetone kinase, and then can be reduced to glycerol 3 phosphate (through action of glycerol 3 phosphate dehydrogenase) (Cocks et al. 1985). Glycerol 3 phosphate can then be used in the synthesis of lipids, lipopro teins, and nucleotides One very important and pertinent corollary to the shift toward g lycerol synthesis in the mutant is the conversion of excess NADH to yield NAD+ an essential step to redress the balance in the redox potential. Unlike glycerol catabolism, in the case of glycerol synthesis the regeneration of NAD+ does not lead to the release of H2O2. In addition, glycerol is involved in the recycling of inorganic phosphate consumed in the glycolysis (Ansell et al. 1997). This metabolic shunt may also have a compensatory effect to the downreg ulation of the enzymes participating in n ucleotide biosynthesis. Finally since many of the ribosomal proteins in the mutant were upregulated, and so was the signal recognition particle protein, glycerol biosynthesis may indicate change in the composition or an increase in the biogenesis of the cell membrane of the mutant. Disruption of the ctpA gene resulted in increased susceptibility toward high temperature in the mutant. This is similar to the effect of knocking out Prc, another TSP containing protease in protein in E. coli Disruption of prc resulted in E. coli mutants that were sensitive to high temperature and osmotic pressure (Hara et al. 1991). It is not clear if there is a connection between the impact of CtpA on metabolism and its role in heat tolerance.

PAGE 70

70 Disruption of ctpA has a pleiotropic impact on the expression profile of M mycoides subsp. capri ; notably its effect on the glycolysis/gluconeogenesis pathway. The CtpA knock out mutant has a two fold increase in the expression of dihydroxyacetone kinase, which suggests that CtpA may be involved in maintaining the balance between utilization of glucose and glycerol as a carbon and energy source. This balance is important for managing oxidative and minimizing the production of potentially harmful H2O2. Table 31. Proteins that significantly differed (P < 0.006) in M. mycoides subsp. capri ctpA::tetM as determined by 2D DIGE. Spot pI/MW Ratio Accession Function Protein name Prot. ID prob 1468 4.64/32252 7.48 gi|42561478 Genetic information proce ss NusG 99.9% 1471 4.8/32239 12.03 gi|42561478 Genetic information process NusG 100% 1472 4.98/32222 4.46 gi|42561478 Genetic information process NusG 100% 206 5.11/105679 6.26 gi|42560648 Genetic information process SecA 100% 1844 3.35/18579 6.32 gi |42560687 Metabolism l Hypothetical protein MSC_0133 99% 602 5.41/70969 7.74 gi|42560626 Metabolism Seryl tRNA synthetase 100% 962 6.54/48816 2.26 gi|42561370 Metabolism Adenylosuccinate synthase 100% 1001 5.93/50641 2.08 gi|42561204 Metabolism Phosph oglycerate kinase 100% 123 3.9/129473 8.89 gi|42561072 Unclassified Hypothetical protein MSC_0539 100% 517 5.76/75928 4.74 gi|108795342 Antibiotic selection gene TetM 100% P values were obtained by Students t test (N = 3). Numbers correspond to sp ot identifications on Figure 3 3 Isoelectric point (pI) and molecular weight (MW) in Daltons are actual experimental values obtained from the 2D gel. Ratios were obtained by dividing the spot area of the M. mycoides subspecies capri mutant sample (N = 3) by t he spot area of wild type M. mycoides subspecies capri.

PAGE 71

71 Table 32. Proteins in Mycoplasma mycoides subsp. capri that are present in the glycolysis/gluconeogenesis pathway. EC number Gene Product Expression in ctpA mutant Mmcap locus Mcap locus 5.3.1.9 pgi glucose 6 phosphate isomerase Decreased MMCAP1_0445 MCAP_0465 2.7.1.11 pfkA 6 phosphofructokinase Decreased MMCAP1_0220 MCAP_0220 4.1.2.13 fba fructose 1,6 bisphosphate Decreased MMCAP1_0131 MCAP_0136 5.3.1.1 tpiA triose phosphate isomerase Decrease d MMCAP1_0727 MCAP_0750 1.2.1.12 gap glyceraldehyde 3 phosphate dehydrogenase, type I Decreased MMCAP1_0607 MCAP_0632 2.7.2.3 pgk phosphoglycerate kinase Decreased MMCAP1_0606 MCAP_0631 5.4.2.1 gpmI 2,3 bisphosphoglycerate independent phosphoglycerate m utase Decreased MMCAP1_0729 MCAP_0752 4.2.1.11 eno phosphopyruvate hydratase Decreased MMCAP1_0213 MCAP_0213 2.7.1.40 pyk pyruvate kinase Decreased MMCAP1_0221 MCAP_0221 1.1.1.27 ldh L lactate dehydrogenase (probable) Decreased MMCAP1_0475 MCAP_0439 2. 3.1.12 pdhC dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex Decreased MMCAP1_0227 MCAP_0227 1.2.4.1 pdhA pyruvate dehydrogenase (acetyl transferring) E1 component, alpha subunit Decreased MMCAP1_0225 MCAP_0225 1.2.4.1 pdhB pyruvate dehydrogenase E1 component subunit beta (S complex, 36 kDa subunit Decreased MMCAP1_0226 MCAP_0226 1.8.1.4 lpdA dihydrolipoyl dehydrogenase Decreased MMCAP1_0228 MCAP_0228

PAGE 72

72 Figure 3 1. Diagrammatic representation of domains i dentified in t he S4 peptidase (C tpA) protein of M. mycoides subsp. capri Domains were identified using the SMART algorithm search ( Letunic et al. 2009), and the figure is adapted from the SMART output.

PAGE 73

73 1 11 21 31 MKLVKK I GFL S LSAISILGP LAMI NNLTT D NNLLITKRFL 41 51 61 71 SSSNSNVGLK SYDYINLINN KYIPTKINLH DHNGIAYIGV 81 91 101 111 KEFLKSLDGL ISFSKIKVRP YQNANFYKEK EISYNYKNNK 121 131 141 151 VVLNSISKYS NNNKTTNYQL EIDSKNKTIT VSDNDFFTDI 161 171 181 191 FTFYRRGEED LNIDFLNTEI VNKNKHIVFD LNKYGIEILN 201 211 221 231 DQNDL YLPLV LINQLFLNQS NVQLYFNGQS VNLFAYSKTL 241 251 261 271 GKVELLKQLK HSYLNNQNHI PAGLKDFQYK YLGFLFDHFY 281 291 301 311 GIKLDKNASY KDLFKKYEKY IKADNTTHYL TSRYLIEQLD 321 331 341 351 DLHSSYLLTG YYNKDLETI N KAVLKTTTPR SDRFKDIARR 361 371 381 391 LSAYYDKELN YK NVYTPDRK TSVISFKNFE ANSAFKIEES 401 411 421 431 LKQAQRDGIK NIVLDVSFNS GG YLGTAFEI MGFLTDKPFK 441 451 461 471 SYSYNPLTKE QKVETIKSRF KKYDFNYYVL TSPFSF SAGN 481 491 501 511 IFPQLVKDNN VAKVIGFKTA GGASAIS QAI LPTGDIIQLS 521 531 541 551 SNNVLTNKSH QSLEYGVNPD ITLG FDPFKQ TEKFFDSAYI 561 571 581 591 QQAINKDTNT LNSIPATHSS VVEPNYVHKL VEQPQPLQLS 601 611 621 631 RKTDETEIKN LNNLFSSIKE TERKDAYFVL GALGVVISLA 641 651 ISFVIIKKIL K Figure 32. Complete amino acid sequence of the S41 peptidase (CtpA) of M. myco ides subsp. capri MCAP 0241 protein showing identified domains. The protein is 651 amino acids in length, with a predicted molecular weight of 75.09 KD and pI of 9.25. The signal peptide domain (aa 124) is shown in blue font. The two transmembrane domains (aa 7 29 and 631 650) are highlighted in yellow. Overlaps between the signal peptide and first transmembrane region are denoted by blue font with yellow highlight. The tail specific protease ( TSPc) domain from aa 340 to 544 is denoted by red underline. Th e two ctpA domains are within the TSPc domain: ctpA domain 1 (pink highlight) extends from aa 411422; ctpA domain 2 (turquoise highlight) extends from aa 477 507

PAGE 74

74 Figure 33 Differential 2dimensional electrophoresis of M. mycoide s subsp capri GM12 and M. mycoides ctpA::tetM Panel A shows the distribution of proteins with Cy3 (red) and Cy5 (green) labeling. Panel B shows the distribution of protein spots that were significantly increased in M. mycoides ctpA::tetM Panel C shows t he distribution of protein spots that were significantly increased in M. mycoides subsp capri

PAGE 75

75 Figure 34 Distribution of biological function categories of Mycoplasma mycoides subsp. capri GM12 proteins that were significantly altered (A) or unchanged (B) by genetic deletion of S41 peptidase gene. Values represent the percent of proteins assigned to each biological function group that were significantly altered by deletion of ctpA gene (A), and the percent of proteins that were not aff ected by the gene deletion (B). Gene ontology designations were obtained from the NCBI protein database or Molligen 2.0 database. *Biological function categories significantly different (P A B Metabolism 18% Genetic Information Process 29% Environment Information Process 6% Cellular Processes 1% Carbohydrate Metabolism 0% Glycolysis / Gluconeogenesis 1% Amino Acid Metabolism 8% Glycerolipid metabolism 2% Purine/pyrimidine Metabolism 3% Unclassified 32% Genetic Information Process 37% Amino Acid Metabolism 10% Unclassified 18% Environment Information Process 2% Carbohydrate Metabolism 2% Glycolysis / Gluconeogenesis 11%* Cellular Process 2% Metabolism 13% Purine/pyrimidine Metabolism 3% Glycerolipid Metabolism 2%

PAGE 76

76 Figure 35. Growth curves for M. mycoides subsp. capri wt and the ctpA mutant at 37oC and 42oC. The mutant grew more slowly at 42oC in comparison to the wild type. Also the mutant gr owth declined rapidly at 42oC.

PAGE 77

77 CHAPTER 4 TRA NSCRIPTION OF S41 PEPTIDASE (CTPA) GENE Introduction The current view of gene regulation in mycoplasmas is that, with few notable exceptions (including variable surface proteins), mycoplasmas do not regulate the expression of their genes (refer to Chapter 1 for an in depth discussion). Most known or common bacterial regulatory mechanisms are absent in mycoplasmas, and therefore these microorganisms are thought to lack refined onoff switching mechanisms and g lobal regulation for transcriptional adaptation to environmental changes. Conceptually, mycoplasmas lack most of the conventional regulatory components and factors that other bacteria have. The absence of the conventional regulatory components and factors makes it difficult to understand how mycoplasmas regulate their gene expression in response to environmental and host signals or to adapt to different habitats and host niches. For instance, unlike other bacteria, mycoplasmas do not possess the putative repressor and activator proteins (Muto et al. 1987, Razin et al. 1998) nor do they have twocomponent systems (Simmons et al. 2007). Transcription factors and proteins constitute only about 0.5% of the protein coding sequences in mycoplasma genomes (Schmidl et al. 2010), while other bacteria reserve as much as 10% of their coding capacity to transcriptional regulation (Greenberg 2000). Moreover, although mycoplasmas have many genes involved in the stress response, they have only one sigma factor, that makes i t unclear how they regulate these genes in response to stress conditions (Dandekar et al. 2000). Despite the absence of clearly identified global regulators, recent in vivo and in vitro transcriptome and proteomic studies reported global responses to envir onmental or

PAGE 78

78 host stimuli (Oneal et al. 2008, Madsen et al. 2008, Schafer et al. 2007, Cecchini et al. 2007, Pinto et al. 2007, Madsen et al. 2006a, Madsen et al. 2006b). Importantly, even with a very limited number of transcriptional factors, genome wide analyses of some of the smallest and simplest mycoplasmas revealed an unexpected level of complexity and versatility in their in metabolic responses to environmental conditions. Their adaptation seems to be similar to that of more complex bacteria, providing hints that other, unknown regulatory mechanisms might exist (Yus et al. 2009). Furthermore, proteome complexity could not be directly inferred from the composition and organization of their minimal genomes or even their extensive genome wide transcriptio nal analysis (Kuhner et al. 2009). In addition, transcriptome analysis also showed surprisingly unanticipated diversity and heterogeneity in mycoplasma transcription profiles including the presence of many operons, the production of alternative transcript s in response to environmental perturbations, and the high frequency of antisense RNA (Gardner and Minion, 2010, Guell et al. 2009). Therefore, it is becoming increasingly clear that mycoplasmas are able to respond to environmental cues and regulate gene expression, but the underlying mechanisms for individual and global gene regulation are not understood. In part because of the dearth of classical transcriptional factors most investigators have concluded that mycoplasmas regulate their genes mainly at t he post translational level (Schmidl et al. 2010) and lack a refined transcriptional regulation; instead mycoplasmas are believed to employ stochastic processes similar to those responsible for generating antigenic variations (Simmons et al. 2007). However mycoplasmas have recently been shown to respond to different stress factors at the transcriptional as well as post transcriptional levels (Oneal et al. 2008, Madsen et al.

PAGE 79

79 2008, Schafer et al. 2007, Cecchini et al. 2007, Pinto et al. 2007, Madsen et al. 2006a, Madsen et al. 2006b). M ycoplasmas also transcriptionally control some of their gene expression according to the type of carbon source available in the medium (Helbedel et al. 2007). Most recently, expression of the Mycoplasma pneumoniae community a cquired respiratory distress syndrome (CARDS) toxin was shown to be regulated at the transcriptional level in response to the growth phase or the attachment to the host cell (Kannan et al. 2010). We also noted that t he expression of the ctpA gene in M. myc oides subsp. capri appeared to correlate with the growth phases, with the highest expression occurring at the stationary phase when pH of media drops to 5.5 Proteomic studies described in Chapter 3 suggested that C tpA may be a part of the stres s response with emphasis on oxidative stress and pH. In addition, CtpA knock out mutant exhibits sensitivity to heat shock. Since CtpA seems to be involved in stress response to pH and heat shock, we hypothesized that ctpA expression would be coordinated with increas ing the acidity of the medium and shifting to higher temperature. The objectives of the current studies were (1) to determine if the ctpA gene expression is regulated in response to stress conditions, (2) to determine if ctpA gene expression is regulated at the transcriptional level, and (3) to develop an alternative model system using the more efficient and genetically defined E. coli to study the regulation of ctpA expression. Materials and Methods Mycoplasma Strain and Cultivation Mycoplasma mycoides subsp. capri GM12 type ATCC 35297 (DaMassa et al. 1983) formerly known as M. mycoides subsp. mycoides Large Colony type (Manso -

PAGE 80

80 Silvan et al. 2009) was grown at 3 7 C in SP4 medium (Tully et al 1979) ; SP4 casein agar was supplemented with a final concentration of 1% skim milk (DIFCO, Detroit, MI). For growth of mutants, tetracycline (final concentration, 5g/ml) was added to the media. PEG8000 Mediated Chemical Transformation. For random mutagenesis, M. mycoides capri was transformed with Tn4001T (plasmid pIVT 1), a gift from K. Dybvig, (Dybvig et al. 2000) by PEG80 00 (Sigma Aldrich) mediated chemical transformation as previously described (Dybvig et al. 2000, Lartigue et al. 2009). For targeted mutagenesis (additional details are provided in Chapter 2), M. mycoides capri GM12 was transformed with pExp1ctpA :: tetM re cA ec using PEG8000mediated chemical transformation. An overnight culture of M. mycoides capri was diluted 1/1000 in 40 ml of fresh SP4 broth. The culture was grown until the midlog phase (~78 hrs) and then placed on ice for 2 min. M. mycoides capri was pelleted by centrifugation at 12,000g for 30 min at 4 C, the supernatant was decanted, and the cells were washed in 10 mM Tris buffer, pH 6.5. Cells were centrifuged at 12,000g for 30 min at 4 C, resuspended in 1 ml of 0.1 M CaCl2, and incubated on ice for 1 hr. Yeast t RNA (10 g, Sigma Aldrich Co), plasmid DNA (pIVT, random insertional mutagenesis or pExp1ctpA ::tetM recA ec, targeted homologous recombination; 30 g), and 9 ml of 60% (w/v) PEG8000 in 10 mM Tris pH 6.5 (final concentration, 54% PEG8000) were added, and cells were incubated for 2 min at room temperature. Twenty five ml of 10 mM Tris buffer, pH 6.5, was added, and the cells were centrifuged at 12,000g for 30 min at 4C. The supernatant was decanted, and the cells were suspended in 2 ml of warm (37C) SP4 broth supplemented with 2 mM MgCl2 (Lavery et al. 1992, Hoffman et al. 2000, Goryshin et al. 1998, Goryshin et al.

PAGE 81

81 2000) and incubated at 37C for 2 hrs. Following the 2 hr recovery time, the cells were plated on SP4 agar plates containing 5 g/ml tetracycline and 1% casein. Colony growth was observed after 48 hr. All colonies were picked and expanded in SP4 broth. The clones were then grown to the same early log phase (OD640 = 0.03) and plated on SP4 agar plate supplemented with 1% casein. The diameters of the clear zones around the different clones were measured, and t hose showing altered or no proteolytic activity were further expanded. Genomic DNA was extracted from the expanded colonies using the DNeasy Blood and Tissue Kit (catalogue # 69504) from Qiagen (Valencia, CA). The point of insertion and the disrupted genes were identified by sequencing from the 3 end of the Tn4001T transposon past the point of insertion using the sequencing primer Tn4001tSeq. DNA sequencing was carried out at TIGR and the University of Florida DNA sequencing Core Facility. Transcription of ctpA in Mycoplasma mycoides subsp. capri Wild Type and in Mutants with Altered Proteolytic Activity Mycoplasma mycoides subsp. capri wild type and 9 mutants created by random insertional mutagenesis with Tn4001T as well as an earlier mutant created by random insertional mutagenesis with Tn916 (Rosentel, 2003) were grown from overnight cultures to midlog phase (OD640 = 0.06). The cells were collected by centrifugation as des cribed above and total RNA was extracted from each culture as described below. For each mutant, three replicates were assayed for transcription of ctpA; one replicate was used for the 50S ribosomal protein L13 gene that served as the internal reference gen e.

PAGE 82

82 Effects of pH and Heat Shock on Transcritpton of ctpA Mycoplasma mycoides subsp. capri wild type was grown to log phase (OD640 = 0.04), and the cells were harvested by centrifugation at 10,000 rpm for 10 minutes at 4oC. To determine the effects of pH o n ctpA expression, cells were resuspended in fresh SP4 medium that had been adjusted to pH 5.0, 7.0, or 9.0. To assess the effects of heat shock, temperature shock was done at 42 oC, with 37 oC as a reference. The cells were subjected to growth under the different pH and temperature points for 1 hour, harvested by centrifugation as described before, and total RNA extracted as described below. For each experiment, five independent replicates were assayed for ctpA transcription; ribosome L013 served as the i nternal reference gene. Extraction of RNA and Quantitative Real TimePCR for ctpA Transcription Total RNA was extracted using the RiboPureBacteria kit (catalogue # 1925) from Ambion (Austin, Texas) according to the instruction manual. Primers for the qRT PCR (Table 41) were ordered from Genosys SigmaAldrich Co. Quantitative RT PCR was performed using QuantiTect SYBR Green RT PCR Kit (catalogue # 204243) from primer wer e used. The remaining steps and cycling conditions were performed according to the instruction manual. Briefly, a reverse transcription step was carried out for 20 minutes at 50oC, followed by a PCR initial activation step for 15 minutes at 95oC. All react ions were subjected to 55 cycles of template denaturation at 94C for 15 sec. Primer annealing occurred for 30 sec. at 50C. Extension at 72C occurred for 30 sec. Data collection was performed during the extension step. PCR cycles were performed in an i Cycler iQ RealTime PCR Detection System (catalogue # 1708740) from BioRad (Hercules, CA). Three genes (50S ribosomal

PAGE 83

83 protein L13, 50S ribosomal protein L09, and transcriptional elongation factor) were selected as internal control candidates under the experimental conditions. These genes were chosen based on their steady expression in the proteomic data of M. mycoides capri wild type and the ctpA:tetM mutant (Chapter 3). Ribosome L013 was chosen and served as the internal reference gene for all data normal ization. Construction of Transcriptional lacZ Fusions of ctpA Gene The promoterless lacZ gene was amplified by PCR using pET200/D/lacZ as a template and cloned in frame behind the upstream nucleotide sequence and promoter region of ctpA and the first three coding sequences of ctpA to create the plasmid construct pXLUSE ctpA lacZ (see C hapter 2 for details). pXLUSEctpAlacZ which contained the full upstream nucleotide sequence and promoter region, was used as a template to create five constructs with delet ions in the upstream nucleotides sequence and promoter regions. The constructs were created using PCR and forward primers specifically designed for five different regions of the USE ctpA in the pXLUSEctpAlacZ (Figure 4 3). The reverse primer was common and recognized the terminator of lacZ (Table 4.1). In order to facilitate the identification of the positive clone as well as to confirm the correct orientation of the cloned fragment, the forward primers contained an engineered BamHI site at the 5 end of the coding sequence being amplified. In addition, the lacZ coding sequence was also amplified and cloned in frame with the native E. coli lacZ promoter and RBS, creating a construct wherein the lacZ reporter gene was driven by its own promoter Plac, (Table 4.1). 2

PAGE 84

84 of forward and reverse primers, and 50 ng of the template plasmid pXLUSEctpALacZ. P CR was performed on a BioRad Icycler (catalogue # 1708720, Hercules, CA). All reactions were held at 95oC for 3 min and subjected to 25 cycles of template denaturation at 95C for 30 sec. Primer annealing occurred for 40 sec at 50C. Polymerization at 68C occurred for 4 min. Polymerization was then followed by a final extension for 7 min at 68C. The PCR fragments were cloned by ligation into pXLPCRTopo vectors (catalogue # k475010, Invitrogen, Carlsbad, CA) according to the instruction manual. The l igation reactions were used to chemically transform E. coli Stbl2 strain (catalogue # 10268019, Invitrogen, Carlsbad, CA which does not contain LacZ. The transformed Clones wer e then picked and expanded. Plasmids were purified using a QIAprep Spin Miniprep kit (catalogue # 27104) from Qiagen (Valencia, CA). The resulting plasmids were digested with BamHI and NcoI (New England Biolabs, Ipswich, MA) to confirm the presence of the cloned fragment. If the cloned fragment was present, then plasmids were digested with XbaI and NdeI (New Englands Biolabs, Ipswich, MA) to confirm the right orientation of the cloned fragment. All the cloned fragments contained lacZ cloned in frame after t he first three amino acids of the coding sequence of ctpA but the fusion constructs differed in the nucleotide sequence upstream of the coding sequence (Figure 4.3) The six E. coli Stbl2 clones that contained the transcriptional fusion of the reporter lac Z gene driven by different truncated versions of the nucleotides upstream of the coding sequence of ctpA were screened for LacZ activity using the bromochloro-

PAGE 85

85 indolyl galactopyranoside (X gal) Blue/White test. Clones were plated on LB agar plate containing 20 mg/ml X gal and screened for the ability to produce bluepigmented colonies. Determination of Activity of LacZ Fusion Constructs The activity of the L acZ expressed from the fusion constructs were determined Galactosidae Assay Kit (catalogue # 200710 Statagene, La Jolla, CA). In all the experiments, E. coli Stble2 was the host strain and pXL PCR Topo was the plasmid vector. Activity was assessed in four different clones: (1) RBS lacZ that served as a negative control; (2) PlaclacZ as an internal control wherein lacZ expression is under the control of its own native promoter and therefore is not regulated by either pH or temperature (Wilson, et al. 2007), (3) experimental clone USE lacZ in which LacZ expression is driven by the entire upstream nucleotide sequence plus the promoter of ctpA and finally (4) experimental clone ProctpAlacZ wherein the upstream nucleotides sequence were deleted so that lacZ is driven only by the full promoter region of ctpA Expression of l acZ Reporter Gene in Response to pH and Heat Shocks Each E. coli clone was grown in 50 ml LB medium (LuriaBertani medium) at 37oC. When the culture reached log phase (OD600 = 0.5), the cells were equally divided into five tubes (10 /per tube) and pelleted at 4000 rpm for 10 minutes. The supernatant s are discarded. To determine pH shock effects, pellets from tubes 13 were resuspended in10 ml each of LB medium adjusted to different pH values (5.0, 7.0, and 9.0). Each of these cultures was immediately divided into five 2ml cultures, resulting in 5 replicas for each pH point. The pH shock was performed at 37 oC for 10 minutes (Coll et al. 1994). For heat shock studies, cells from the remaining two tubes (4 and 5) were resuspended

PAGE 86

86 in in10 ml each of LB medium, pH 7.0, immediately divided into five 2ml cultures per treatment. Heat shock (N=5) was carried out at 42oC for 30 minutes; controls were incubated at 37 oC (N=5). After the measure the total protein concentration. The total protein concentration was measured using the Non Interfering Protein Assay Kit (catalogue # 488250, Calbiochem, San Diego, CA). An a galactosidas galactosidae assay was performed according to the instructions provided with the kit. Results Identif ication of Mutants with Altered Proteolytic Phenotypes A total of 674 mutants were obtained by random insertional mutagenesis. Nine mutants of M. mycoides subsp. capri ::Tn4001T were selected on a SP4 casein agar plate because of their altered proteolytic activities as indicated by the diameter of the clear zones relative to that of the wild type. One additional mutant (J8) was available from a previous study using Tn916 (Rosentel, 2003). All mutants were sequenced. The DNA sequence data were searched using BLAST, and the homologues of the disrupted genes were identified (Table 4.2). The full genome of M. mycoides capri GM12 can be accessed via either GenBank or the dedicated Molligen database ( http://cbi.labri.fr/outils/molligen/ ). Mutant #152 was the only mutant that showed a complete loss of proteolytic activity. Subsequent DNA sequencing and BLAST analysis indicated that this mutant had Tn4001T inserted in the coding sequence of the ctpA gene, MMCAP_0241. Mutant M. mycoides subsp. capri ::Tn916 (J8) had Tn916 inserted in the noncoding sequence

PAGE 87

87 upstream of the ctpA gene. The Tn916 insertion in mutant J8 was 23 bp upstream of a presumptive 35 and 10 transcription promoter sequence (TTGTAT and TAATAT, respectively) and 67 bp upstream of a probable ribosome binding (ShineDalgarno) sequence (GGAG). Mutant M. mycoides subsp. capri ::Tn916 (J8) showed significant reduction in proteolytic activity. The distribution of the disrupted genes was throughout the M. mycoides subsp. capri genome (Table 4 3). Mutant #10 (MMCAP_0157, mgtE ) was the only mutant that showed a slightly increased protease phenotype as indicated by a greater zone size than the wild type (Table 42). The remaining 7 mutants had a relatively reduced proteolytic activity (Table 42). Three mutants (mutants # 2, 153, and 154) had disrupted genes coding for hypothetical proteins (Table 42). The remaining disrupted genes had known functions. Mutant # 7 had a disruption in MMCAP_0038, ftsH FtsH is an ATP and Zn++dependent metalloproteinase that belongs to AAA proteases (ATPases associated with a variety of cellular activities) and is also considered a Charonin (proteins with proteaseassociated chaperone activity) (Van Melderen et al. 1996). M utant # 9 (MMCAP_0169) had a disrupted gene that codes for opp an ATP dependent oligopeptide ABC transporter that plays a role in capturing and transporting peptides, providing a source for amino acids for growth (Monnet 2003). Mutant # 38 (MMCAP_0792) had a disruption in atp the gene coding for ATP synthase. Nox the gene coding for NADH oxidase, was disrupted in Mutant # 155 (MMCAP_0223). NADH oxidase is a flavincontaining enzyme that is involved in the transfer of electrons to oxygen as the terminal electron acceptor.

PAGE 88

88 With the exception of mutant J8, all disruptions occurred within the coding sequence of the gene (Table 43). Transcription of ctpA in Mutants with Altered Proteolytic Phenotypes. The level of ctpA transcription in the mutants was invest igated using Real Time RT PCR. The gene for 50S ribosomal protein L13 was chosen as an internal control while the level of ctpA transcript in the mutants was normalized to that of the wild type. Despite the differences in the identities and functions of the disrupted genes, all the mutants except the mgtE, magnesium transport knock out mutant exhibited a reduction in transcription of ctpA (Figure 4.1). In the mgtE mutant, transcription of ctpA was not significantly different from that of the wild type (Fig ure 4.1). Effect of pH and Temperature on the Transcription of ctpA : Real Time RT PCR. The gene for transcription elongation factor was chosen as an internal control in the pH shock experiments while the gene for 50S ribosomal protein L09 was selected as a n internal control in heat shock experiments. Quantitative RT PCR showed an increase in the transcription of ctpA gene in response to the shift from neutral pH 7.0 to acidic pH 5.0 (Figure 4.5 A). In contrast, transcription declined in response to alkaline shift (pH 7.0 to pH 9.0). Real Time RT PCR also showed an increase in the transcription of ctpA in response to heat shock at 42oC (Figure 4.5 B). Thus, it appears likely that transcription of ctpA is regulated in response to both pH and temperature. Expr ession of Transcriptional Fusion of lacZ Reporter Gene in E. coli LacZ expression was observed with all constructs except when the promoter region was deleted (Figure 4.4). The lacZ reporter was transcriptionally driven by both complete and different trunc ations of the upstream nucleotide sequences and the

PAGE 89

89 promoter region. The presence of the RBS alone was not sufficient to drive the transcription of lacZ gene. Effect of pH and Temperature on the Transcription of lacZ reporter Gene in E. coli In the presen galactosidase activity increased in response to acidic pH 5.0 and decreased with alkaline pH 9.0 galactosidase activities was measured in resp onse to heat shock to 42oC (Figure 4.6 Lower panel). This pattern was similar to transcription of ctpA in response to pH and heat shock in M. mycoides subsp. capri as indicated from the qRT PCR data. Deletion of upstream sequence element did not abrogate t he expression of the reporter lacZ gene; indicating that the presence of the promoter alone is sufficient for expressing the downstream gene. This coincides with results from the X gal Blue/White test (Figure 4.4). However, when the upstream nucleotide seq uence was removed, lacZ expression was constitutive across all the experimental conditions. Discussion Mycoplasmas are thought to lack refined onoff switching mechanisms and global regulation for transcriptional adaptation to environmental changes. Their genes are generally thought to be constitutively expressed rather than regulated (Muto and Ushida 2002), albeit coordinated with the growth rate of the cell through stringent control (Cashel et al. 1996, Gourse et al. 1996). Furthermore, most known or com mon bacterial regulatory mechanisms are absent in mycoplasmas. For example, unlike Escherichia coli, Bacillus subtilis and many other bacteria, mycoplasmas have only one sigma factor even though they contain many stress response genes (Muto et al. 1987, Razin et al. 1998). In addition, very few repressor like proteins have been reported in mycoplasma

PAGE 90

90 genomes (Bork et al. 1995, Fraser et al. 1995, Glass et al. 2000, Himmelreich et al. 1996, Glass et al. 2006). Despite the absence of clearly identified global regulators, recent in vivo and in vitro transcriptome and proteomic studies reported global responses to environmental or host stimuli (Oneal et al. 2008, Madsen et al. 2008, Schafer et al. 2007, Cecchini et al. 2007, Pinto et al. 2007, Madsen et al. 2006a, Madsen et al. 2006b). Results from our study confirm that the transcription of ctpA is likely modified in response to pH and temperature, and also is impacted by products of other genes as well. Mycoplasma mycoides subsp. capri mutants (N=10) with altered proteolytic phenotypes were generated by random mutagenesis using either Tn4001T or Tn916. Although only a direct disruption of the ctpA gene caused a complete loss of the proteolytic phenotype, other gene disruptions affected the protease phenotype qu antitatively as demonstrated by RT PCR. The disrupted genes were diverse with respect to identity, function, and genomic distribution. Therefore, we expected that the effects on altered proteolytic activity would occur at different levels, i.e. transcription translation, post translational modification, indirect effects, etc. However, qRT PCR data showed that, with one exception ( M. mycoides subsp. capri mgtE::Tn4001t) all mutants had a reduced level of ctpA transcription in comparison to the wild type. These results, while somewhat surprising, may underscore the importance of transcription regulation as a key component for controlling ctpA expression. A possible explanation for these unexpected results may be that the proteins affecting ctpA expression are involved in fundamental processes such as energy metabolism, maintenance, stress response, and homeostasis. As such, their disruption would have a profound impact on

PAGE 91

91 the cell as a whole. The consequence of their disruption may not necessarily be exclus ive or specific to the ctpA gene, but rather a part of their pleiotropic effect on the expression of several genes. Three genes encoded conserved hypothetical proteins of unknown f unction but with homologs in other members of the mycoides cluster. Of the genes with known function, ftsH encodes an ATP and Zn++dependent metalloproteinase which belongs to the AAA protease family (ATPases associated with a variety of cellular activities) and may also be a putative Charonin, or protein with proteaseassociat ed chaperone activity (Van Melderen et al. 1996). The FtsH protein also is involved in the degradation of cytosolic regulatory proteins and proteins with short nonpolar carboxyl termini. Thus, FtsH may be part of a quality control system to avoid potential ly harmful accumulation of free subunits of membraneembedded protein complexes (Schumann 1993). The opp gene (mutant 9) codes for an oligopeptide ABC transporter, an ATP dependent transporter that plays a role in capturing and transporting peptides as a nutritional source for amino acids (Monnet 2003). It has also been implicated in sensing the environment and signaling processes through transporting dipeptides (Abouhamad et al. 1991). This is particularly intriguing since ctpA transcription is quantitat ively responsive to at least two environmental signals (pH and temperature). Mutant # 38 has a disrupted atp synthase. In mycoplasmas, ATP synthase acts mainly as an ATPase, hydrolyzing ATP in order to export H+, thereby generating and maintaining the proton motive potential (Cirillo 1993, Shirvan et al 1993). Finally, the gene product NADH O xidase (mutant 155) plays an important role in energy metabolism and ATP generation (Pollack et al. 1997). This flavincontaining enzyme is involved in the transfer o f

PAGE 92

92 electrons to oxygen as the terminal electron acceptor. Additionally, NADH O xidase has a particularly important metabolic role in the cytochromeless mycoplasmas because it regenerates NAD+ from NADH (Pollack 2002). The transcription of the ctpA gene is m odulated not only by cellular metabolism and energy status, but also is responsive to environmental stimuli and stress conditions. Both pH and temperature shifts impacted the transcription of ctpA qRT PCR showed an increase in ctpA transcription in response to acidic pH (5.0) and heat shock at 42oC; while shifting to alkaline pH (9.0) reduced the transcription level. Mutant #J8 has an insertion of Tn916 that occurred 23 bp upstream of a presumptive 35 and 10 transcription promoter sequence (TTGTAT and TAATAT, respectively) and 67 bp upstream of a probable ribosome binding (ShineDalgarno) sequence (GGAG). Therefore, a unique feature of this mutant is that it has a disruption in the noncoding upstream nucleotide sequence while the promoter and coding sequence of ctpA gene are left intact. Importantly, as shown by qRT PCR, this disruption adversely affected the transcription of ctpA gene. This finding led us to question the possible role that this noncoding nucleotide sequence may play in modulating ctpA transcription To address the hypothesis that the upstream nucleotides s equence and promoter region may be instrumental in regulating transcription of ctpA mutation analysis was performed. D ifferent truncated versions of these regions were created as in fr ame transcriptional fusions of lacZ reporter gene, and expression of LacZ in these constructs was used to investigate the consequences of deletions in the upstream region. These were made and cloned in plasmid constructs (pXLUSEctpA PctpA lacZ ) in E. co li clones (see material and methods).

PAGE 93

93 Initially, I introduced these different fusions into M. mycoides subsp. capri using Tn4001T carried on plasmid pIVT 1 as a cloning vector Unfortunately, although the expression of lacZ from these constructs in M. my coides subsp. capri was visible enough to discern a pattern of expression correlated with the extent of truncations in USE and promoter regions, the reaction was too weak to document using the galactosidase assay. Deletion of the entire upstream nucleoti de sequence did not affect expression of lacZ but removing the promoter abolished all traces of lacZ expression. However, this expression system in M. mycoides subsp. capri was unsuitable to use for accurate and quantitative analysis. The weakness of lacZ expression can be attributed to many factors. The lacZ gene is a 3 Kb fragment cloned from E. coli with relatively higher GC content than the mycoplasma genomes which may adversely impact the translation efficiency in mycoplasmas. The gene was likely intr oduced as a single or low copy number in the genome; that in turn may limit the expression of LacZ. It is also possible that either cloned sequence or Tn4001T when used as cloning vector may have instability issues (GawronBurke et al. 1984). Transcription al attenuation by the flanking sequence on the cloned gene of interest may also be a factor (Su et al. 1992). Finally, for convenience, the cloning of lacZ took place at the expense of the signal and leader peptide, which prevented the secretion of LacZ in to the medium. This, in addition to the low copy number, may have exacerbated the sensitivity issue and made it more difficult to be more perceptually visible and quantifiable. Apart from the weakness of reporter gene expression, another confounding factor is the concomitant random insertion mutagenesis of transposons which would make it difficult to draw meaningful

PAGE 94

94 conclusions about the quantitative response of gene expression to the mutagenesis of USE. As an alternative to expressing lacZ transcriptional fusions in M. mycoides subsp. capri the possibility of using E. coli as an expression host was considered. The original plasmid constructs (pXLUSEctpA PctpA lacZ ) were used to transform E. coli Stbl2 cells. Because the plasmids are self replicating, we felt that the issue of genome disruption would be eliminated and the multiple copy number of plasmid should enhance the expression and, in turn, increase the sensitivity of detection. All E. coli clones but one formed blue colonies on LB agar + X gal plat es within 24 hours. Unlike the expression of lacZ in M. mycoides subsp. capri in E. coli lacZ expression was strong and prominently visible. The formation of blue colonies indicates that ctpA promoter successfully drove the expression of lacZ gene in E. coli; this is consistent with previous reports regarding the ability of E. coli RNA polymerase to recognize mycoplasma promoters (Taschke et al. 1988). The complete and truncated versions of USE and promoter regions of ctpA produced a similar pattern of la cZ expression to that was observed in M. mycoides subsp. capri ; that is, successive deletions in the region upstream lacZ fusion did not affect its expression until the deletion of the promoter region, which abolished the expression of lacZ This suggests that the promoter region may be the minimum regulatory sequence of ctpA required for expression of the downstream gene. The next step was to determine if the transcription of lacZ under the control of ctpA USE and promoter in E. coli showed a similar response to pH and temperature shifts as did ctpA transcription in M. mycoides subsp. capri Simultaneously, the link

PAGE 95

95 between the USE and the effect of the pH and temperature on ctpA transcription was investigated. The presence of clones of lacZ gene under the control of a complete and deleted upstream sequence element (USE) made it possible to characterize the significance of USE in response to shifts in pH and temperature. E. coli lacZ gene under the control of its own cognate promoter was used as an internal reference. The rationale for this control is that in E. coli lacZ gene driven by its native promoter is regulated by lactose and subjected to catabolite repression by glucose but it is influenced by neither pH nor temperature (Wilson et al. 2007). Only with the presence of upstream nucleotide sequence (USE) was the expression of lacZ affected by the shift in pH and temperature, while the ctpA promoter alone ( i.e. without upstream nucleotides sequence) elicited a constitutive expression of lacZ regardles s of change in pH or temperature. Therefore, while the upstream nucleotide sequence is not required for the expression of the downstream gene, it may play a role in its regulation in response to pH and temperature. Interestingly, in E. coli, the upstream nucleotide sequence increased lacZ expression in response to acidic pH and temperature shock while decreased it at alkaline pH. This pattern of gene expression in E. coli coincides with the one observed with ctpA transcription in M. mycoides subsp. capri This similarity regarding pH and temperature regulated ctpA expression in two phylogenetically distant bacteria has many implications. First, it signifies the conservation of the regulatory mechanism. Second, since mycoplasmas have only one sigma factor and no specific activators or repressors, the ctpA regulatory region driving lacZ expression in E. coli is very likely to depend only on the basal transcriptional

PAGE 96

96 70). Third, an importantly practical corollary f or the conservation of the mechanism is to afford us the study of ctpA regulation in E. coli. There is a wealth of information about genetics, physiology and metabolism of E. coli In addition, tools, protocols, sensitive assays, and a variety of well defi ned media have been developed for E. coli These features facilitate investigating gene regulation mechanisms in relatively easy, well controlled experiments and without confounding factors. In contrast, mycoplasmas are fastidious, genetically difficult to manipulate, lack necessary cloning vectors and molecular tools, and their genetics is poorly defined. For these reasons, genetics and gene regulation studies are plagued with many confounding issues and hurdles to overcome. Therefore, unraveling the regul atory mechanism(s) may be more amenable in E. coli ; however, ultimately it will have to be confirmed or disproved in Mycoplasmas. Taken together, the data from these experiments indicate that the expression of ctpA is not constitutive; rather it is sensit ive to the intracellular milieu as well as modified in response to environmental/host stimuli. These experiments have also shown that the expression of ctpA has been influenced through modulating the level of mRNA. This suggests that ctpA is regulated prim arily at the transcription level. Moreover, this ctpA regulation is more likely to be quantitative rather than a switchtype mechanism. This coincides with recent findings in M. capricolum M. genitalium Ureaplasma urealyticum and M. pneumoniae (Kannan et al. 2010, Muto and Ushida 2002, Glass et al. 2000, Himmelreich et al. 1996, Bork et al. 1995, Fraser et al. 1995) and is consistent with the paucity of repressors and activators in mycoplasma genomes (Bork et al. 1995, Fraser et al. 1995, Glass et al. 2000, Himmelreich et al. 1996, Glass et al. 2006).

PAGE 97

97 In conclusion, the expression of ctpA was quantitatively regulated in response to environmental or host stimuli, including pH and temperature. The level of gene regulation is primarily at the transcription step. This does not, however, exclude other levels of regulation, especially posttranslational regulation. The mechanism of ctpA transcription is likely to be conserved, dependent on the basal transcriptional machinery, and influenced by the nucleotid e sequence upstream of the ctpA promoter. Table 41. Primers used for PCR. Primers 5 BamHI USE ctpA For GGATCC BamHI Trunc1 For GTTTATAAAAATGGAGAATTTGCACAA GGATCC BamHI Trunc2 For CATTTTTATACAAATGTTTTTTTCTTTGG GGATCC BamHI Trunc3 For GGATTTTTTTATTTAAAAAACGTCTAAA GGATCC BamHI Promoter ctpA For ATTTAAAAAACGTCTAAAAAACCAGTA GGATCC BamHI RBS ctpA For CGTCTAAAAAACCAGTATAGATCTTGTATAA GGATCC SpeI lacZ For AAATAAAGCAAAAAGGAGAAAAA ACTAGT lacZ Rev TATAGATCCCGTCGTTTTACAACGT TAGTTATTGCTCAGCGGTGG qRT PCR_ctpA For CACTTTTTATAGACGTGGTGAAGAAG qRT PCR_ctpA Rev GTACTAATGGTAAATACAAGTCATT TTG qRT PCR_RiboL13 For GGAGATCACGTTATTATAATTAATGCTG qRT PCR_RiboL13 Rev GCATCTAGTTCTCTTTGAACTTCAAC qRT PCR_RiboL09 For GAAGTTAGTGACGGATATGCAAG qRT PCR_RiboL09 Rev GCTAGTTCTTTTTCTTCTTGATCAG qRT PCR_TEF For AGAAGTTGTTAGACCTAAAGTAATTGAAG qRT PCR_TE F Rev AGCTTGTCTGTTTCTAGCAGCATC Tn4001tSeq GTACTCAATGAATTAGGTGGAAGACCGAGG

PAGE 98

98 Table 42. Tn916 (J8 only) and Tn4001T random insertional mutants of M. mycoides capri with altered proteolytic phenotype. Gene locus Mutant # Z one (mm) Relative activity Gen e Protein ID MMCAP_0241 J8 2.5 ctpA (upstream) ACU79406.1; GI:256384837 MMCAP_0343 2 2.0 CHP ACU79457.1; GI:256384888 MMCAP_0038 7 3.0 CHP, presumed ftsH ACU79266.1; GI:256384697 MMCAP_0169 9 3.0 Putative lipoprotein ACU79312.1; GI:2563847 43 MMCAP_0157 10 4.5 mgtE ACU79055.1; GI:256384486 MMCAP_0792 38 3.0 atp ACU79340.1; GI:256384771 MMCAP_0241 152 0 None S41 peptidase (ctpA) ACU79406.1; GI:256384837 MMCAP_0144 153 3.0 CHP ACU79095.1; GI:256384526 MMCAP_0902 154 3.0 vlcH (up stream) ACU79765.1; GI:256385196 MMCAP_0223 155 2.0 nox ACU79270.1; GI:256384701 The reference proteolytic zone size for M. mycoides capri GM12 wild type control was 4.0 mm. Tn916 was used to obtain mutant J8 only; all other mutants were obtained usi ng Tn4001T. CHP denotes conserved hypothetical protein. MMCAP_0241 is currently annotated as an S41 peptidase; however this will likely be changed to ctpA (J. Glass, pers. communication). CHP denotes conserved hypothetical protein. The full genome of M. my coides capri GM12 is available via GenBank as well as the Molligen database ( http://cbi.labri.fr/outils/molligen/).

PAGE 99

99 Table 43. Genomic location of genes and site of disruption of the coding sequence by Tn4001T random insertion. Mutant Mnemonic CD nt Insertion Site nt Strand Gene/Product 2 MMCAP2_0343 429776430471 ::428632 + CHP 7 MMCAP2_0038 5362354906 ::54359 + CHP 9 MMCAP2_0169 213034216135 ::213252 + P utative lipoprotein 10 MMCAP2_01 57 196489197892 ::197650 mgtE 38 MMCAP2_0792 931805933382 ::932755 atpA 152 MMCAP2_0241 302759304714 ::304151 + ctpA 153 MMCAP2_0144 178992179492 ::179286 + CHP 154 MMCAP2_0902 10776031078082 ::1077510 + vlcH 155 MMCAP2_0223 28 2548283912 ::282766 + nox CD denotes coding sequence; nt denotes nucleotide; CHP denotes conserved hypothetical protein. :: denotes insertion site of Tn4001T. The full genome of M. mycoides capri GM12 is available via GenBank as well as the Molligen d atabase ( http://cbi.labri.fr/outils/molligen/ ).

PAGE 100

100 WT #2 #7 #9 #10 #38 #153 #154 #155 #J8 0.0 0.5 1.0 1.5*Fold expression Figure 41. Measurement of ctpA gene expression in WT M. mycoides and Tn4001T, Tn916 generated mutants by real time RT PCR Bacterial cultures were grown to log phase at 370 C. For RT PCR reactions, RNA from Ribosome L013 was used as an internal reference. The threshold cycle number for each experimental sample was converted to fold expression. Fold expressions were normalized to that of WT. Va lues represent the mean fold change SD of 3 biological replicates. ANOVA confirmed that there was statistically significant difference among groups (P that all mutants except 10 (*) displayed a significantly different fold change in ctpA expression when compared to wild type M. mycoides (P < 0.02).

PAGE 101

101 Figure 42. Preparation of transcriptional fusion constructs of lacZ reporter to ctpA gene promoter and upstream elements The gel is demonstrates the key features in the preparation of the modified pXLUSE ctpA LacZ constructs. Lane 1: 1kb DNA marker (Invitrogen); Lane 2: pXLUSE ctpAplacZ plasmid template; Lane 3: PCR of Full PromoterctpAlacZ fragment; Lane 4; intact pXLPromoterctpAlacZ ; Lane 5: verification of cloned pXLPromoterctpAlacZ intact plasmid was cut with BamHI and NcoI; Lane 6: confirmation of desired orientation of the cloned fragment, pXLPromoterctpAlacZ cut with XbaI and NdeI.

PAGE 102

102 Figure 43. Sequence of lacZ deletion constructs. The deleted sequ ences for each construct are shown in gray font. The 35 region of the promoter (CTTGTAT) is shown in yellow highlight. The 35 region of the promoter (CTTGTAT) is shown in yellow highlight. The 10 region of the promoter (TAATAT) is shown in green highlig ht. The ribosomal binding site (GGAG) is shown in red highlight. The codons of the ctpA for the first three amino acids (MLK) are shown in turquoise highlight. The lacZ coding sequence that was cloned in frame is shown in pink highlight. I n tact US EctpA + P r o m ote rctpA ATAATATTAAAACATTTGTTTATAAAAATGGAGAATTTGCACAAGAATAAAAACATTTT TATACAAATGTTTTTTTCTTTGGATTTTTTTATTTAAAAAA CGTCTAAAAAACCAGTAT AGAT CTTGTAT AAGCAAAAAAATGGAC TAATAT TTAAATAAAGCAAAAA GGAG AAAAAG ATT AT GAAACTA LacZ coding sequence USETrunc 1 + P r o m ote rctpA ATAATATTAAAACATTT GTTTATAAAAATGGAGAATTTGCACAAGAATAAAAACATTTTT ATACAAATGTTTTTTTCTTTGGATTTTTTTATTTAAAAAA CGTCTAAAAAACCAGTATAG AT CTTGTAT AAGCAAAAAAATGGAC TAATAT TTAAATAAAGCAAAAA GGAG AAAAAGATT ATGAAACTA LacZ coding seque nce USETrunc 2 + P r o m ote rctpA ATAATATTAA AACATTTGTTTATAAAAATGGAGAATTTGCACAAGAATAAAAA CATTTT TATACAAATGTTTTTTTCTTTGGATTTTTTTATTTAAAAAA CGTCTAAAAAACCAG TAT AGAT CTTGTAT AAGCAAAAAAATGGAC TAATAT TTAAATAAAGCAAAAA GGAG AAAAAG ATT ATGAAACTA LacZ coding sequence USETrunc 3 + P r o m ote rctpA ATAATATTAAAACATTTGTTTATAAAAATG GAGAATTTGCACAAGAATAAAAACATTTT TATACAAATGTTTTTTTCTTTGGATTTTTTT ATTTAAAAAA CGTCTAAAAAACCAG TAT AGAT CTTGTAT AAGCAAAAAAATGGAC TAATAT TTAAATAAAGCAAAAA GGAG AAAAAG ATT ATGAAACTA LacZ coding sequence P r om o terc tpA ATAATATTAAAACATTTGTTTATAAAAATGGAGAATTTGCACAAGAATAAAAACATTTT TAT ACAAATGTTTTTTTCTTTGGATTTTTTTATTTAAAAAA CGTCTAAAAAACCAG TAT AGAT CTTGTAT AAGCAAAAAAATGGAC TAATAT TTAAATAAAGCAAAAA GGAG AAAAAG ATT ATGAAACTA LacZ coding sequence RBSc tpA AT AATATTAAAACATTTGTTTATAAAAATGGAGAATTTGCACAAGAATAAAAACATTTT TATACAAATGTTTTTTTCTTTGGATTTTTTT ATTTAAAAA ACGTCTAAAAAACCAGTAT AGAT CTTGTAT AAGCAAAAAAATGGAC TAATAT TT AAATAAAGCAAAAA GGAG AAAAAG ATT ATGAAACTALacZ coding sequence

PAGE 103

103 Figure 44. E xpression of lac Z in E. coli under the control of USE and promoter of ctpA Deletion of the promoter region (6) abrogated lacZ expression, whereas successive deletions of upstream nucleotides sequences (14) of ctpA did not affect lacZ expression. See Fig ure 43 for nucleotide sequences that were deleted. 1 = USEctpA + PromoterctpA; 2 = USETrunc1 + PromoterctpA; 3 = USETrunc2 + PromoterctpA; 4 = USETrunc3 + PromoterctpA; 5 = PromoterctpA; 6 = Ribosomal Binding SitectpA.

PAGE 104

104 pH 5 pH 7 pH 9 0.0 0.5 1.0 1.5P < 0.0001 A.Fold expression 37 42 0.0 0.5 1.0 1.5P < 0.002 B.Fold expression Figure 45. Measurement of ctpA gene expression in M. mycoides capri wild type by real time RT PCR. Bacterial cultures were grown to log phase then subjected to varying pH (A) or varying temperature (B). For RT PCR reactions, mRNA for tef gene was used as an internal reference for pH experiment while mRNA for 50S Ribosome L09 was used as an internal reference for heat shock experiment. The threshold cycle number for each experimental sample was converted to fold expression. Fold expression values were normalized to pH 7 (graph A) or 370 C (graph B). Values represent the mean fold change SD of 5 replicates. ANOVA confirmed that there was a statistical significance among groups (P confirmed that the fold change observed in ctpA exp ression at either pH 5 or 9 was significantly different from expression at pH 7. Unpaired students t test showed there was a statistically significant fold change in ctpA expression in cultures grown at 420 C.

PAGE 105

105 Figure 46. Effect of pH and heat shock on ctpA USE and P driven lacZ expression in E. coli. Upper panel: effect of USE on the lacZ expression in response to pH change. LacZ expressed from its own native promoter (PROEc) was used as an internal reference for all experiments. LacZ under the contr ol of ctpA (RBSctpA) alone without the promoter was a negative control for all experiments. Five replicas were used for each experiment. Complete USE and P region (USEPctpA) increased lacZ expression in response to acidic pH, while LacZ expression was reduced at alkaline pH. The ctpA promoter (PROctpA) alone resulted in constitutive expression of lacZ and rendered it nonresponsive to shift in pH. Lower panel: effect of USE on lacZ expression in response to heat shock. An increase in lacZ expression in response to heat shock to 42oC was seen with the complete USE and P region. Deletion of USE caused lacZ expression to be irresponsive to heat shock.

PAGE 106

106 CHAPTER 5 SUMMARY AND FUTURE DIRECTIONS Mycoplasmas, which have the smallest genomes known among bacteria, are thought to represent the minimum gene set required for sustaining an independent and self replicating organism (Fadiel et al. 2007). The genetics of these microbes and their use to create a synthetic bacterium have attracted significant attention in recent years (Gibson et al. 2010, Lartigue et al. 2009, Gibson et al. 2008). Studies aimed at analysis of the whole genome or the global gene expression have revealed surprising degrees of complexity and versatility at many levels of gene expression. Despite the accumulation of data about mycoplasma genomes and their expression profiles, a mechanistic view of how they manage and regulate their gene expression is still lacking. In order to unravel the mycoplasma gene regulatory mechanisms, many hurdles have to be overcome. Among the factors impeding progress are the lack of effective genetic tools to target and manipulate specific genes in mycoplasmas as well as the lack of good models to study gene regulation in controlled and precise experimental settings. Thes e factors are particularly challenging in mycoplasmas because of their fastidious growth requirements and complex medium components. In addition, very few genes can offer a discernible phenotype that would facilitate investigating a gene response, and scr eening or identifying mutants of interest. In this study, I identified a target gene with an identifiable phenotype that allowed me to develop improved methods to create targeted gene disruptions and to investigate gene regulation. Mycoplasma mycoides sub sp. capri a member of the mycoides cluster, is characterized by its ability to hydrolyze casein on an agar plate. The gene responsible for this proteolytic phenotype has been identified through random mutagenesis. The

PAGE 107

107 sequence of the gene revealed that it encodes for an S41 peptidase protein belonging to carboxyl terminal proteases and shares key conserved motifs with CtpA proteases of several bacterial species (Hara et al. 1991). Expression of this gene seems to be coordinated with the growth phase, reaching its maximum at stationary phase. The discernible phenotype and the consistent response to the growth phase made the ctpA gene a good target for developing a specific gene disruption method and a model for studying gene regulation in mycoplasma. Major F indings In Chapter 2, I describe the development of a new technique for targeted mutagenesis through homologous recombination in M. mycoides subsp. capri A novel method was developed for targeted mutagenesis that substantially increased the efficiency of targeted gene disruption. This method is a major improvement over existing methods in terms of both consistency and efficiency. By including the E. coli RecA gene in frame behind the promoter and RBS of the ctpA gene, the consistency and efficiency of obta ining the desired mutation in M. mycoides subsp. capri were significantly increased. Although the decision to include E. coli RecA might not be intuitively obvious, the rationale was based on knowledge of mycoplasmal systems. The complete pathway of homologous recombination is missing in mycoplasma genomes (Rocha et al., 2005). In addition, initiator systems and resolving complexes do not seem to be conserved among mycoplasmas (Ingleston et al. 2002). These findings have led to the belief that mycoplasmas are deficient or incapable of performing homologous recombination. However, when homologous recombination events have been reported (Dybvig and Woodard 1992), they were dependent on the presence of RecA. The exact

PAGE 108

108 mechanism for the increased efficiency o f homologous recombination in mycoplasmas when E. coli RecA was included remains to be determined. Importantly, to the best of our knowledge, the successful and consistent disruption of ctpA represents one of the very few documented, targeted, double cross over homologous recombination events in Mollicutes, and the only case achieved deliberately by experimental design. Creation of an isogenic mutant of M. mycoides subsp. capri made it possible to investigate the consequences of ctpA disruption on the expres sion profile in the mutant. In Chapter 3, I used differential proteome profiling to investigate the impact of ctpA gene disruption on M. mycoides subsp. capri The disruption of ctpA had a pleiotropic effect on the expression profile. Particularly noticeable was its impact on the glycolysis/gluconeogenesis pathway in carbon and energy metabolism. Disruption of ctpA seems to cause a shift toward glycerol metabolism and downregulation of lactate dehydrogenase genes. Both of these effects may precipitate an increase in oxidative stress. A corollary of increased glycerol metabolism is an elevated production of H2O2 which has been considered a virulence factor in the closely related M. mycoides subsp. mycoides Small Colony (Pilo et al., 2007). Disruption of the c tpA gene seems to increase the sensitivity of the mutant to heat shock. It is not clear whether there is a link between the shift toward glycerol metabolism and possible increase of H2O2 production on one hand and the temperature sensitivity on the other. The role of CtpA as part of the stress response is also consistent with its elevated expression at the stationary phase and its response to acidic stress. Because mycoplasmas lack cytochromes and therefore depend on the proton motive potential as a source of energy (Pollack et al. 1981), an increasing concentration of H+ ions can also

PAGE 109

109 be a source of oxidative stress. Since the ctpA gene seems to be part of the stress response, determining genes affected by ctpA disruption in the mutant may help us understan d how mycoplasmas cope with stress conditions. The proteomic profiling results in Chapter 3 indicated that CtpA is likely a component of the stress response, particularly acidic and heat stress. Therefore, in Chapter 4, I investigated the effect of pH and temperature on the expression of ctpA and the step at which ctpA expression is controlled. I used qRT PCR to confirm that ctpA is quantitatively regulated at the transcriptional level by pH and temperature as well as certain genes other than ctpA whos e disruptions altered the proteolytic phenotype. Interestingly, transcriptional levels of ctpA in these mutants were impacted. The common factor among these disrupted genes is that they are all involved in the maintenance, homeostasis and in fundamental bi ochemical and metabolic processes. It was noted in a previous study that random insertion of Tn916 into the noncoding upstream (USE) region of ctpA resulted in decreased transcription and marked reduction of proteolytic activity (Rosentel 2003). Therefore, in Chapter 4, I also used mutation analysis to address the role of this noncoding upstream sequence (USE) region in transcriptional regulation of ctpA. Initially, lacZ transcriptional fusion constructs were created and tested in M. mycoides subsp. mycoi des. However, weak galactosidase enzymatic activity precluded effective use of the constructs in M. mycoides subsp capri In order to study the effects of these mutations in USE, I developed lacZ transcriptional fusion constructs that could be cloned a nd used in E. coli Us ing this model, I confirmed by galactosidase enzymatic assay that the impacts of temperature

PAGE 110

110 and pH in E. coli were similar to those observed i n M. mycoides subsp. mycoides. These results suggest that the mechanism of regulation is conserved and is dependent on the basal transcriptional machinery; this in turn made it possible to further investigate the transcription mechanism in E. coli With this approach, I demonstrated that the ctpA promoter alone could drive transcription. How ever, the promoter region alone was not responsive to environmental stimuli such as pH and temperature. However, if the upstream nucleotide sequence (USE) was present, then ctpA transcription was responsive to these environmental signals. Based on the curr ent literature, this is the first description of the quantitative regulation of a mycoplasmal gene that is mediated by the noncoding upstream nucleotides. This is also the first report that transcriptional regulation in mycoplasmas can be studied in E. col i using reporter gene fusion constructs. Future Directions Despite the fact that the suicide plasmid that was described in Chapter 2 significantly improved the ability to perform targeted mutagenesis in M. mycoides subsp. capri further improvements could be made. For example, one approach is to place E. coli recA under the control of a stronger promoter such as the spiralin promoter (Cordova et al. 2005), which also has the advantage of being constitutively expressed. Another possibility is to transiently express some of the components of the initiation or resolution complexes that are missing in mycoplasmas (Rocha et al. 2005), preferably, in combination with E. coli recA. Finally, improved constructs should be tested in other mycoplasmal species.

PAGE 111

111 Further investigations of the network of proteins involved in the stress response are warranted. Future experiments could address the effect of carbon source on metabolism, H2O2 production, and tolerance for heat shock. Finally, a comprehensive study of the upstr eam elements could provide further insights into the mechanism by which mycoplasmal genes are quantitatively regulated in response to environmental signals. Determination of the specific nucleotides of USE region required for transcriptional regulation as well as identification of proteins that might bind to, and interact with, USE could help elucidate the specific mechanism(s) involved in transcriptional regulation. Mutagenesis could be used to determine the minimal nucleotide sequence and critical bases r esponsible for regulation of ctpA expression. The identities of potential DNA binding proteins could be investigated using molecular biology assays such as the DNaseI Footprinting assay, the filter binding assay, and the gel mobility shift assay. There ha ve been few genetic tools developed for mycoplasmas including transposon Tn4001T. The attempt to use Tn4001T as a cloning vector has been encumbered with instability of the cloned DNA fragment. In addition, the expression and detection of lacZ gene from E. coli in M. mycoides subsp. capri was found to be too inefficient and weak to use for quantitative analysis. Developing a better reporter gene that functions well in mycoplasmas would permit addressing regulatory questions directly in mycoplasmas. Express ion of the LacZ in M. mycoides subsp. capri was disappointing in my study. However, improving the translation efficiency of E. coli lacZ gene expression in mycoplasmas through codon optimization is one potential approach. Another approach may be to include alternative

PAGE 112

112 reporter genes that are more suitable for mycoplasmas in lieu of lacZ For example, one candidate is the sialidase gene that has been reported in many mycoplasma species (May et al. 2007). Sialidase activity can be quantitatively assayed using a fluorogenic substrate such as 2 (4 methylumbelliferyl) D N acetylneuraminic acid (MUAN ) and spectrofluorometry (Hunt and Brown 2007). Therefore, activity would be quantifiable and codon optimization would require no or minimal effort. In conclusion, my study has provided two significant tools to better manipulate and investigate gene regulation in mycoplasmas. Both the ability to target specific genes for disruption by homologous recombination and the development of a model system to study mycoplasmal gene regulation in E. coli are significant contributions to the field. Finally, my studies have revealed that quantitative regulation of ctpA occurs by mechanisms other than those associated with antigenic variation (Citti et al. 2005) or stochastic proc esses (Simmons et al. 2007). The importance of the noncoding upstream nucleotides in the quantitative regulation of a gene in response to environmental stimuli has provided new insights into the regulation of mycoplasmal genes.

PAGE 113

113 LIST OF REFERENCES Abu Gro un, E. A. M., Taylor, R. R., Varsani, H., Wadher, B. J., Leach, R. H. & Miles, R. J. (1994). Biochemical diversity within the Mycoplasma mycoides cluster. Microbiology 140, 2033 42. Abouhamad, W. N., Manson, M., Gibson, M. M. & Higgins, C. F. (1991). Peptide transport and chemotaxis in Escherichia coli and Salmonella typhimurium : characterization of the dipeptide permease (Dpp) and the dipeptidebinding protein. Mol Microbiol 5, 103547. Ansell, R., Granath, K., Hohmann, S., Thevelein, J. M. & Adler, L. (1997). The two isoenzymes for yeast NAD+ dependent glycerol 3phosphate dehydrogenase encoded by GPD1 and GPD2 have distinct roles in osmoadaptation and redox regulation. EMBO J 16, 2179 2187. Barr, A., de Daruvar, A. & Blanchard, A. (2004). M olliGen, a database dedicated to the comparative genomics of Mollicutes. Nucleic Acids Res 32, D307 10. Baumler, A. J., Kusters, J. G., Stojiljkovic, I. & Heffron, F. (1994). Salmonella typhimurium loci involved in survival within macrophages. Infect Im mun 62, 162330. Beebe, K. D., Shin, J., Peng, J., Chaudhury, C., Khera, J. & Pei, D. (2000). Substrate recognition through a PDZ domain in tail specific protease. Biochemistry 39, 31493155. Bischof, D. F., Janis, C., Vilei, E. M., Bertoni, G. & Fre y J. (2008). Cytotoxicity of Mycoplasma mycoides subsp mycoides small colony type to bovine epithelial cells. Infect Immun 76, 263 9. Boesen, T., Emmersen, J.,Baczynska, A., Birkelund, S. & Christiansen, G. (2004). The vaa locus of Mycoplasma hominis contains a divergent genetic islet encoding a putative membrane protein. BMC Microbiol 4, 37. Bork, P., Ouzounis, C., Casari, G., Schneider, R., Sander, C., Dolan, M., Gilbert, W. & Gillevet, P. M. (1995). Exploring the Mycoplasma capricolum genome: a min imal cell reveals its physiology. Mol Microbiol 16, 955 67. Burgos, R., Pich, O. Q., Querol, E. & Pinol, J. (2008). Deletion of the Mycoplasma genitalium MG_217 gene modifies cell gliding behaviour by altering terminal organelle curvature. Mol Microbiol 69, 102940. Burgos, R., Pich, O. Q., Querol, E. & Pinol, J. (2007). Functional analysis of the Mycoplasma genitalium MG312 protein reveals a specific requirement of the MG312 N terminal domain for gliding motility. J Bacteriol 189, 7014 23.

PAGE 114

114 Carvalho, F. M., Fonseca, M. M., De Medeiros, S. B., Scortecci, K. C., Blaha, C. A. & Agnez Lima, L. F. (2005). DNA repair in reduced genome: the Mycoplasma model. Gene 360, 1119. Cecchini, K. R., Gorton, T. S. & Geary, S. J. (2007). Transcriptional responses of Mycoplasma gallisepticum strain R in association with eukaryotic cells. J Bacteriol 189, 58037. Chopra Dewasthaly, R., Citti, C., Glew, M. D., Zimmermann, M.,Rosengarten, R. & Jechlinger, W. (2008). Phaselocked mutants of Mycoplasma agalactiae: defi ning the molecular switch of highfrequency Vpma antigenic variation. Mol Microbiol 67, 1196210. Chopra Dewasthaly, R., Marenda, M., Rosengarten, R., Jechlinger, W. & Citti, C. (2005). Construction of the first shuttle vectors for gene cloning and homologous recombination in Mycoplasma agalactiae. FEMS Microbiol Lett 253, 8994. Chopra Dewasthaly, R., Zimmermann, M., Rosengarten, R. & Citti, C. (2005). First steps towards the genetic manipulation of Mycoplasma agalactiae and Mycoplasma bovis using the transposon Tn4001mod. Int J Med Microbiol 294, 44753. Cirillo, V. P. (1993). Transport systems in mycoplasmas. Subcell Biochem 20, 293 310. Cocks, B. G., Brake, F. A., Mitchell, A. & Finch L. R. (1985). Enzymes of intermediary carbohydrate metabolism in Ureaplasma urealyticum and Mycoplasma mycoides subsp. mycoides J Gen Microbiol 131, 2129 35. Coll, J. L., Heyde, M. & Portalier, R. (1994). Expression of the nmpC gene of Escherichia coli K 12 is modulated by external pH. Identification of cis a cting regulatory sequences involved in this regulation. Mol Microbiol 12, 8393. Cordova, C. M., Lartigue, C., Sirand Pugnet, P., Renaudin, J., Cunha, R. A. & Blanchard, A. (2002). Identification of the origin of replication of the Mycoplasma pulmonis ch romosome and its use in oriC replicative plasmids. J Bacteriol 184, 542635. Cottew, G. S., Breard, A., DaMassa, A. J., Ern, H., Leach, R. H., Lefevre, P. C., Rodwell, A. W. & Smith, G. R. (1987). Taxonomy of the Mycoplasma mycoides cluster. Isr J Med Sci 2, 632 5. Cox, M. M. (2007). Motoring along with the bacterial RecA protein. Nat Rev Mol Cell Biol 8, 127 38.

PAGE 115

115 DaMassa, A. J., Brooks, D. L. & Adler, H. E. (1983). Caprine mycoplasmosis: widespread infection in goats with Mycoplasma mycoides subsp mycoides (large colony type). Am J Vet Res 44, 322 5. Dandekar, T., Huynen, M., Regula, J. T., Ueberle, B., Zimmermann, C. U., Andrade, M. A., Doerks, T., Snchez Pulido, L., Snel, B., Suyama, M., Yuan Y. P., Herrmann, R. & Bork P. (2000). Re annotating the Mycoplasma pneumoniae genome sequence: adding value, function and reading frames. Nucleic Acids Res 28, 3278 88. Deutscher, J., Galinier, A. & Martin Verstraete, I. (2002). Carbohydrate uptake and metabolism. In Bacillus Subtilis and Its Closest Relatives pp. 129 150. Edited by A. L. Sonenshein and others. Washington, DC: American Society for Microbiology. Dhandayuthapani, S., Blaylock, M. W., Bebear, C. M., Rasmussen, W. G. & Baseman, J. B. (2001). Peptide methionine sulfoxide reductase (MsrA) is a virulence determinant in Mycoplasma genitalium J Bacteriol 183, 564550. Dhandayuthapani, S., Rasmussen, W. G. & Baseman, J. B. (1999). Disruption of gene mg218 of Mycoplasma genitalium through homologous recombination leads to an adherence deficient phenotype. Proc Natl Acad Sci USA 96, 522732. Diner, B. A., Ries, D. F., Cohen, B. N. & Metz, J. G. (1988). COOH terminal processing of polypeptide D1 of the photosystem II reaction center of Scenedesmus obliquus is necessary for the as sembly of the oxygenevolving complex. J Biol Chem 263, 89728980. Duret, S., A. Andre, A. & Renaudin, J. (2005). Specific gene targeting in Spiroplasma citri : improved vectors and production of unmarked mutations using sitespecific recombination. Mi crobiology 151, 2793803. Duret, S., Berho, N., Dan et, J. L., Garnier, M. & Renaudin, J. (2003). Spiralin is not essential for helicity, motility, or pathogenicity but is required for efficient transmission of Spiroplasma citri by its leafhopper vector C irculifer haematoceps Appl Environ Microbiol 69, 622534. Duret, S., Danet, J. L., Garnier, M. & Renaudin, J. (1999). Gene disruption through homologous recombination in Spiroplasma citri : an scm1disrupted motility mutant is pathogenic. J Bacteriol 181, 7449 56. Dybvig, K. & Voelker, L. L. (1996). Molecular biology of mycoplasmas. Annu Rev Microbiol 50 25 57.

PAGE 116

116 Dybvig, K. & Woodard, A. (1992). Construction of recA mutants of Acholeplasma laidlawii by insertional inactivation with a homologous DN A fragment. Plasmid 28, 2626. Ekici, O. D., Paetzel, M. & Dalbey, R. E. (2008). Unconventional serine proteases: variations on the catalytic Ser/His/Asp triad configuration. Protein Sci 17, 202337. Ezraty, B., Aussel, L. & Barras, F. (2005). Methioni ne sulfoxide reductases in prokaryotes. Biochim Biophys Acta 17, 221 9. Fadiel, A., Eichenbaum, K. D., Semary, N. El. & Epperson, B. (2007). Mycoplasma genomics: tailoring the genome for minimal life requirements through reductive evolution. Front Bio sci 12, 20208. Forage, R. G. & Lin, E. C. (1982). DHA system mediating aerobic and anaerobic dissimilation of glycerol in Klebsiella pneumoniae NCIB 418. J Bacteriol 151, 591 Fraser, C. M. Gocayne, J. D.,White, O., Adams, M. D., Clayton, R. A ., Fleischmann, R. D., Bult, C. J., Kerlavage, A. R., Sutton, G., Kelley, J. M., Fritchman, R. D., Weidman, J. F., Small, K. V., Sandusky, M., Fuhrmann, J., Nguyen, D., Utterback, T. R., Saudek, D. M., Phillips, C. A., Merrick, J. M., Tomb, J. F., Doughert y, B. A., Bott, K. F., Hu, P. C., Lucier, T. S. Peterson, S. N., Smith, H. O., Hutchison 3rd, C. A. & Venter, J. C. (1995). The minimal gene complement of Mycoplasma genitalium Science 270, 397 403. French, C. T., Lao, P., Loraine, A. E., Matthews, B. T., Yu, H. & Dybvig, K. (2008). Largescale transposon mutagenesis of Mycoplasma pulmonis Mol Microbiol 69, 6776. Frey, J. (2002). Mycoplasmas of animals. In Molecular Biology and Pathogenicity of mycoplasmas pp. 7390. Edited by S. Razin & R. Herrmann. New York: Plenum. Gamper, M. & Kas, P. (2005). Strategy for chromosomal gene targeting in RecA deficient Escherichia coli strains. Biotechniques 38, 4058. GarciaAlles, L. F., Siebold, C., Nyffeler, T. L., Flkiger Brhwiler, K., Schneider, P., Brgi, H. B., Baumann, U. & Erni, B. (2004). Phosphoenolpyruvateand ATP dependent dihydroxyacetone kinases: covalent substratebinding and kinetic mechanism. Biochemistry 19, 13037 45. Gardner, S. W. & Minion, F. C. (2010). Detection and Quantific ation of Intergenic Transcription in Mycoplasma hyopneumoniae Microbiology 2010 Apr 29. [Epub ahead of print]

PAGE 117

117 Gawron Burke, C. & Clewell, D. B. (1984). Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram positive bacteria. J Bacteriol 159, 214 21. Gibson, D. G., Glass, J. I., Lartigue, C., Noskov, V. N., Chuang, R. Y., Algire, M. A., Benders, G. A., Montague, M. G., Ma, L., M oodie, M. M., Merryman, C., Vashee, S., Krishnakumar, R., Assad Garcia, N., Andrews Pfannkoch, C., Denisova, E. A., Young, L., Qi, Z. Q., SegallShapiro, T. H., Calvey, C. H., Parmar, P. P., Hutchison, C. A. 3rd, Smith, H. O. & Venter, J. C. (2010). Creat ion of a bacterial cell controlled by a chemically synthesized genome. Science 329, 526 Gibson, D. G., Benders, G. A., Andrews Pfannkoch, C., Denisova, E. A., Baden Tillson, H., Zaveri, J., Stockwell, T. B., Brownley, A., Thomas, D. W., Algire, M. A., M erryman, C., Young, L., Noskov, V. N., Glass, J. I., Venter, J. C., Hutchison III, C. A. & Smith, H. O. ( 2008). Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science 319, 1215 1220. Glass, J. I., Assad Garcia, N ., Alperovich, N., Yooseph, S., Lewis, M. R., Maruf, M.,Hutchison III, C. A., Smith, H. O. & Venter, J. C. ( 2006). Essential genes of a minimal bacterium. Proc Natl Acad Sci USA 103, 425 430. Glass, J. I., Lefkowitz, E. J., Glass, J. S., Heiner, C. R., Chen, E Y. & Cassell, G. H. (2000). The complete sequence of the mucosal pathogen Ureaplasma urealyticum Nature 407, 75762. Gollin, D. J., L. E. Mortenson, L. E. & Robson, R. L. (1992). Carboxyl terminal processing may be essential for production of active NiFe hydrogenase in Azotobacter vinelandii FEBS Lett 309, 371 375. Goryshin, I. Y., Jendrisak, J., Hoffman, L. M., Meis, R. & Reznikoff, W. S. (2000). Insertional transposon mutagenesis by electroporation of released Tn5 transposition complex es. Nat Biotechnol 18, 97100. Goryshin, I. Y. & Reznikoff, W. S. (1998). Tn5 in vitro transposition. J Biol Chem 273, 736774. Greenberg, E. P. (2000). Bacterial genomics. Pump up the versatility. Nature 31 947. Gell, M., van Noor,t V., Yus, E., Chen, W. H., Leigh Bell, J., Michalodimitrakis, K., Yamada, T., Arumugam, M., Doerks, T., Khner, S., Rode, M., Suyama, M., Schmidt, S., Gavin, A. C., Bork, P. & Serrano L. (2009). Transcriptome complexity in a genomereduced bacterium. Science 326, 126871.

PAGE 118

118 Gutknecht, R., Beutler, R., Garcia Alles, L. F., Baumann, U. & Erni, B. (2001). The dihydroxyacetone kinase of Escherichia coli utilizes a phosphoprotein instead of ATP as phosphoryl donor. EMBO J 15, 2480 6. Halbedel, S. & Stulke, J. (2007). Tools for the genetic analysis of Mycoplasma. Int J Med Microbiol 297, 37 44. Halbedel, S., Eilers, H., Jonas, B., Busse, J., Hecker, M., Engelmann, S. & Stlke, J. (2007). Transcription in Mycoplasma pneumoniae: analysis of the promoters of the ack A and ldh genes. J Mol Biol 371, 596 607. Hames, C., Halbedel, S., Hoppert, M., Frey, J. & Stlke, J. (2009). Glycerol metabolism is important for cytotoxicity of Mycoplasma pneumoniae J Bacteriol 191, 747 53. Hara, H., Yamamoto, Y., Higashitani, A., Suzuki, H. & Nishimura, Y. (1991). Cloning, mapping, and characterization of the Escherichia coli prc gene, which is involved in Cterminal processing of penicillinbinding protein 3. J Bacteriol 173, 4799813. Hatchikian, E. C., Magro, V., Forge t, N., Nicolet, Y. & Fontecilla Camps, J. C. (1999). Carboxy terminal processing of the large subunit of [Fe] hydrogenase from Desulfovibrio desulfuricans ATCC 7757. J Bacteriol 181, 2947 2952. Himmelreich, R., Hilbe rt, H., Plagens, H., Pirkl, E., Li, B. C. & Herrmann, R. (1996). Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res 24, 442049. Hoffman, L. M., Jendrisak, J. J., Meis, R. J., Goryshin, I. Y. & Reznikof, S. W. (2000). Transposome insertional mutagenesis and direct sequencing of microbial genomes. Genetica 108, 1924. Holms, H. (1996). Flux analysis and control of the central metabolic pathways in Escherichia coli FEMS Microbiol Rev 19, 85 116. Horii, T., Ozawa, N., Ogawa, T. & Ogaw a, H. (1992). Inhibitory effects of N and C terminal truncated Escherichia coli recA gene products on functions of the wildtype recA gene. J Mol Biol 5, 105 14. Hunt, M. E. & Brown, D. R. (2007). Role of sialidase in Mycoplasma alligatoris induced pulm onary fibroblast apoptosis. Vet Microbiol 121, 73 82. Hutchison, C. A., Peterson, S. N., Gill, S. R., Cline, R. T., White, O., Fras er, C. M., Smith, H. O. & Venter, J. C. (1999). Global transposon mutagenesis and a minimal Mycoplasma genome. Science 2 86, 21659.

PAGE 119

119 Ingleston, S. M., Dickman, M. J., Grasby, J. A., Hornby, D. P., Sharples, G. J. & Lloyd, R. G. (2002). Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae. Eur J Biochem 269, 1525 33. Islam, M. R., Grubb, J. H. & Sly, W. S. (1993). C terminal processing of human betaglucuronidase. The propeptide is required for full expression of catalytic activity, intracellular retention, and proper phosphorylation. J Biol Chem 268, 2262722633. Jaffe, J. D., Berg, H. C., & Church, G. M. (2004). Proteogenomic mapping as a complementary method to perform genome annotation. Proteomics 4, 59 77. Janis, C., Bischof, D., Gourgues, G., Frey, J., Blanchard, A. & Sirand Pugnet, P. (2008). Unmarked insertional mutagenesis in the bovine pathogen Mycoplasma mycoides subsp. mycoides SC: characterization of a lppQ mutant. Microbiology 154, 242736. Janis, C., Lartigue, C., Frey, J., Wroblewski, H., Thiaucourt, F., Blanchard, A. & SirandPugnet, P. (2005). Versatile use of or iC plasmids for functional genomics of Mycoplasma capricolum subsp. capricolum Appl Environ Microbiol 7 1, 288893. Jarhede, T. K., Le Henaff, M. & Wieslander, A. (1995). Expression of foreign genes and selection of promoter sequences in Acholeplasma laidlawii. Microbiology 141, 20719. Jores, J., Meens, J., Buettner, F. F., Linz, B., Naessens, J. & Gerlach, G. F. (2009). Analysis of the immunoproteome of Mycoplasma mycoides subsp. mycoides small colony type reveals immunogenic homologues to other kn own virulence traits in related Mycoplasma species. Vet Immunol Immunopathol 131, 238 45. Kannan, T. R., Musatovova, O., Balasubramanian, S., Cagle, M., Jordan, J. L., Krunkosky, T. M., Davis, A., Hardy, R. D. & Baseman, J. B. (2010). Mycoplasma pneumoniae CARDS toxin expression reveals growth phase and infection dependent regulation. Mol Microbiol 2010 Feb 28. [Epub ahead of print] Kannan, T. R., & J. B. Baseman, J. B. (2006). ADP ribosylating and vacuolating cytotoxin of Mycoplasma pneumoniae repres ents unique virulence determinant among bacterial pathogens. Proc Natl Acad Sci USA 103, 67249. Karnauchov, I., Herrmann, R. G., Pakrasi, H. B. & Klosgen, R. B. (1997). Transport of CtpA protein from the cyanobacterium Synechocystis 6803 across the t hylakoid membrane in chloroplasts. Eur J Biochem 249, 497 504.

PAGE 120

120 Keiler, K. C., Waller, P. R. H. & Sauer, R. T. (1996). Role of a peptide tagging system in degredation of proteins synthesized from damaged messenger RNA. Science 271, 990 3. Krishnak umar, R., Assad Garcia, N., Benders, G. A., Phan, Q., Montague, M. G. & Glass, J. I. (2010). Targeted Chromosomal Knockouts in Mycoplasma pneumoniae. Appl Environ Microbiol 2010 Jun 11. [Epub ahead of print] Khner, S., van Noort, V., Betts, M. J., Leo Macias, A., Batisse, C., Rode, M., Yamada, T., Maier, T., Bader, S., Beltran Alvarez, P., Castao Diez, D., Chen, W. H., Devos, D., Gell, M., Norambuena, T., Racke, I., Rybin, V., Schmidt, A., Yus, E., Aebersold, R., Herrmann, R., Bttcher, B., Frangakis A. S., Russell, R. B., Serrano, L., Bork, P. & Gavin, A. C. (2009). Proteome organization in a genomereduced bacterium. Science 326, 123540. Lad, S. P., Yang, G., Scott, D. A., Wang, G., Nair, P., Mathison, J., Reddy, V. S. & Li, E. (2007). Chlamydia l CT441 is a PDZ domain containing tail specific protease that interferes with the NF kappaB pathway of immune response. J Bacteriol 189, 661925. Lartigue, C., Vashee, S., Algire, M. A., Chuang, R. Y., Benders, G. A., Ma, L., Noskov, V. N., Denisova, E. A., Gibson, D. G., Assad Garcia, N., Alperovich, N., Thomas, D. W., Merryman, C., Hutchison 3rd, C. A., Smith, H. O., Venter, J. C. & Glass, J. I. (2009). Creating bacterial strains from genomes that have been cloned and engineered in yeast. Science 325 16936. Lartigue, C., Blanchard, A., Renaudin, J., Thiaucourt, F. & SirandPugnet, P. (2003) Host specificity of mollicutes oriC plasmids: functional analysis of replication origin. Nucleic Acids Res 31, 6610 8. Lavery, P. E. & Kowalczykowski, S. C (1992). Enhancement of recA proteinpromoted DNA strand exchange activity by volumeoccupying agents. J Biol Chem 267, 930714. Leach, R. H., Erno, H. & MacOwan, K. J. (1993). Proposal for designation of F38type caprine mycoplasmas as Mycoplasma capr icolum subsp. capripneumoniae subsp. nov. and consequent obligatory relegation of strains currently classified as M. capricolum (Tully, Barile, Edward, Theodore, and Erno 1974) to an additional new subspecies, M. capricolum subsp. capricolum subsp. nov. In t J Syst Bacteriol 43, 603 5. Lee, C. D. & Wang, T. F. (2009). The N terminal domain of Escherichia coli RecA have multiple functions in promoting homologous recombination. J Biomed Sci 1, 16:37.

PAGE 121

121 Letunic, I., Doerks, T. & Bork, P. (2009). SMART 6: recent updates and new developments. Nucleic Acids Res 37, D229 32. Liao, D. I., Qian, J., Chisholm, D. A., Jordan, D. B. & Diner, B. A. (2000). Crystal structures of the photosystem II D1 C terminal processing protease. Nat Struct Biol 7, 749 53. M adsen, M. L., Puttamreddy, S., Thacker, E. L., Carruthers, M. D. & Minion, F. C. (2008). Transcriptome changes in Mycoplasma hyopneumoniae during infection. Infect Immun 76, 658 63. Madsen, M. L., Nettleton, D., Thacker, E. L., Edwards, R. & Minion, F. C. (2006). a Transcriptional profiling of Mycoplasma hyopneumoniae during heat shock using microarrays. Infect Immun 74, 160 6. Madsen, M. L., Nettleton, D., Thacker, E. L. & Minion, F. C. (2006). b Transcriptional profiling of Mycoplasma hyopneumoniae du ring iron depletion using microarrays. Microbiology 152, 937 44. Manso Silvn, L., Vilei, E. M., Sachse, K., Djordjevic, S. P., Thiaucourt, F. & Frey, J. (2009). Mycoplasma leachii sp. nov. as a new species designation for Mycoplasma sp. bovine group 7 of Leach, and reclassification of Mycoplasma mycoides subsp. mycoides LC as a serovar of Mycoplasma mycoides subsp. capri. Int J Syst Evol Microbiol 59, 13538. Marais, A., Bove, J. M. & Renaudin, J. (1996). Spiroplasma citri virus SpV1 derived clonin g vector: deletion formation by illegitimate and homologous recombination in a spiroplasmal host strain which probably lacks a functional recA gene. J Bacteriol 178, 862 70. Markham, P. F., Kanci, A., Czifra, G., Sundquist, B., Hains, P. & Browning, G. F. (2003). Homologue of macrophageactivating lipoprotein in Mycoplasma gallisepticum is not essential for growth and pathogenicity in tracheal organ cultures. J Bacteriol 185, 253847. Masui, R., Mikawa, T. & Kuramitsu, S. (1997). Local folding of the N terminal domain of Escherichia coli RecA controls proteinprotein interaction. J Biol Chem 31, 2770715. Mattman, L. H. (2001). Cell wall Deficient forms: Stealth Pathogens. Boca Raton, Florida: CRC Press LLC. May, M., Kleven, S. H. & Brown, D. R. (200 7). Sialidase activity in Mycoplasma synoviae Avian Dis 51, 829 33.

PAGE 122

122 Mazmanian, S. K., TonThat, H. & Schneewind, O. (2001). Sortasecatalysed anchoring of surface proteins to the cell wall of Staphylococcus aureus Mol Microbiol 40, 10491057. Menon, N. K., Robbins, J., Der Vartanian, M., Patil, D., Peck, H. D., Menon, A. L., Robson, R. L. & Przybyla, A. E. (1993). Carboxy terminal processing of the large subunit of [NiFe] hydrogenases. FEBS Lett 331, 9195. Michel, B. (1999). Illegitimate recombination in bacteria. In Organization of prokaryotic genome, pp. 129150. Edited by R. L. Charlebois. Washington DC: American Society for Micorbiology Miles, R. J. (1992). Catabolism in mollicutes. J Gen Microbiol 138, 177383. Mitchell, S. J. & Minnick, M. F. (1997). A carboxy terminal processing protease gene is located immediately upstream of the invasionassociated locus from Bartonella bacilliformis Microbiology 143, 12211233. Monnet, V. (2003). Bacterial oligopeptidebinding proteins. C ell Mol Life Sci 60, 210014. Muto, A. & Ushida, C. (2002). Transcription and Translation. p323345. In Molecular biology and pathogenicity of mycoplasmas pp. 323345. Edited by S. Razin & R. Herrmann. New York: Plenum. Muto, A., Yamao, F. & Osawa, S (1987). The genome of Mycoplasma capricolum Prog Nucleic Acid Res Mol Biol 34, 2958. Muto, A. (1987). The genome structure of Mycoplasma capricolum Isr J Med Sci 23, 33441. Nagasawa, H., Sakagami, Y., Suzuki, A., Suzuki, H., Hara, H. & Hir ota, Y. (1989). Determination of the cleavage site involved in C terminal processing of penicillinbinding protein 3 of Escherichia coli J Bacteriol 171, 58905893. Nicholas, R. A. & Bashiruddin, J. B. (1995). Mycoplasma mycoides subspecies mycoides (s mall colony variant): the agent of contagious bovine pleuropneumonia and member of the Mycoplasma mycoides cluster". J Comp Pathol 113, 1 27. Nixon, P. J., Trost, J. T. & Diner, B. A. (1992). Role of the carboxy terminus of polypeptide D1 in the assembl y of a functional water oxidizing manganese cluster in photosystem II of the cyanobacterium Synechocystis sp. PCC 6803: assembly requires a free carboxyl group at C terminal position 344. Biochemistry 31, 1085910871.

PAGE 123

123 Ogasawara, N., Moriya, S. & Yoshikaw a, H. (1991). Initiation of chromosome replication: structure and function of oriC and DnaA protein in eubacteria. Res Microbiol 142, 851 9. Oneal, M. J., Schafer, E. R., Madsen, M. L. & Minion, F. C. (2008). Global transcriptional analysis of Mycoplasma hyopneumoniae following exposure to norepinephrine. Microbiology 154, 25818. Ostberg, Y., Carroll, J. A., Pinne, M., Krum, J. G., Rosa, P. & Bergstrm, S. (2004). Pleiotropic effects of inactivating a carboxyl terminal protease, CtpA, in Borrelia burgd orferi J Bacteriol 186, 2074 84. Paetzel, M. & Dalbey, R. E. (1997). Catalytic hydroxyl/amine dyads within serine proteases. Trends Biochem Sci 22, 2831. Pelicic, V., Reyrat, J. M. & Gicquel, B. (1996). Expression of the Bacillus subtilis sacB ge ne confers sucrose sensitivity on mycobacteria. J Bacteriol 178, 11979. Pilo, P., Frey, J. & Vilei, E. M. (2007). Molecular mechanisms of pathogenicity of Mycoplasma mycoides subsp. mycoides. SC Vet J 174, 513 21. Pilo, P., Vilei, E. M., Peterhans E., Bonvin Klotz, L., Stoffel, M. H., Dobbelaere, D. & Frey, J. (2005). A metabolic enzyme as a primary virulence factor of Mycoplasma mycoides subsp. mycoides small colony. J Bacteriol 187, 682431. Pinto, P. M., Chemale, G., de Castro, L. A., Costa A. P., Kich, J. D., Vainstein, M. H., Zaha, A. & Ferreira, H. B. (2007). Proteomic survey of the pathogenic Mycoplasma hyopneumoniae strain 7448 and identification of novel post translationally modified and antigenic proteins. Vet Microbiol 121, 83 9 3. Pollack, J. D. (2002). Central carbohydrate pathways: metabolic flexibility and the extra role of some housekeeping enzymes. In Molecular biology and pathogenicity of mycoplasmas pp. 163 199. Edited by S. Razin & R. Herrmann. New York: Plenum. Po llack, J. D., Williams, M. V. & McElhaney R. N. (1997). The comparative metabolism of the mollicutes (Mycoplasmas): the utility for taxonomic classification and the relationship of putative gene annotation and phylogeny to enzymatic function in the smalles t free living cells. Crit Rev Microbiol 23, 269 354. Pollack, J. D., Merola, A. J., Platz, M. & Booth Jr., R. L. (1981). Respiration associated components of Mollicutes. Journal of Bacteriology, 146 (3), pp. 907913.

PAGE 124

124 Razin, S., D. Yogev, D. & Naot, Y. (1998). Molecular biology and pathogenicity of mycoplasmas. Microbiol Mol Biol Rev 62, 1094156. Renaudin, J. & Lartigue, C. (2005). OriC plasmids as gene vectors for mollicutes. In Mycoplasmas: Pathogenesis, Molecular Biology, and Emerging Strategies for Control pp. 3 30. Edited by A. Blanchard & G. Browning. Norwich, UK: Horizon Scientific Press. Renaudin, J. (2002). Extrachromosomal elements and gene transfer. In Molecular biology and pathogenicity of mycoplasmas, pp. 347371. Edited by S. Razin & R. Herrmann. New York: Plenum. Rocha, E., Sirand Pugnet P. & Blanchard A (2005). Genome analysis: Recombination, Repair, and Recombinational Hotspots. In Mycoplasmas: Molecular biology, Pathogenicity, and Strategies for control pp. 3173. Edi ted by A. Blanchard & G. Browning. UK: Horizon Bioscience. Rocha, E. P., and A. Blanchard, A. (2002). Genomic repeats, genome plasticity and the dynamics of Mycoplasma evolution. Nucleic Acids Res 30, 2031 42. Rodreguez, J. L., Proveda, J. B., Oros, J. Herraez, P., Sierra, M. A. & Fernandez, A. (1995). High mortality in goats associated with the isolation of a strain of Mycoplasma mycoides subsp mycoides (Large Colony type). ZentralbleVeterinarmedB 42, 587 593. Rosentel, J. K. (2003). Extracellul ar proteases: potential virulence factor of Mycoplasma mycoides subsp. mycoides Ph.D. dissertation. University of Florida. Florida. Rossmann, R., Sauter, M., Lottspeich, F., & Bock, A. (1994). Maturation of the large subunit (HYCE) of Escherichia coli hy drogenase 3 requires nickel incorporation followed by C terminal processing at Arg537. Eur J Biochem 220, 377384. Samuelsson, T., Elias, P., Lustig, F. & Guindy, Y. S. (1985). Cloning and nucleotide sequence analysis of transfer RNA genes from Mycopl asma mycoides Biochem J 232, 223 8. Schafer, E. R., Oneal, M. J., Madsen, M. L. & Minion, F. C. (2007). Global transcriptional analysis of Mycoplasma hyopneumoniae following exposure to hydrogen peroxide. Microbiology 153, 378590. Schmidl, S. R. Gronau, K., Hames, C., Busse, J., Becher, D., Hecker, M. & Stlke, J. (2010). The stability of cytadherence proteins in Mycoplasma pneumoniae requires activity of the protein kinase PrkC. Infect Immun 78, 184 92.

PAGE 125

125 Schumann, W. (1999). FtsH --a single chain charonin? FEMS Microbiol Rev 23, 1 11. Schurmann, M., & Sprenger, G. A. (2001). Fructose 6 phosphate aldolase is a novel class I aldolase from Escherichia coli and is related to a novel group of bacterial transaldolases. J Biol Chem 276, 110551 1061. Shahram, M., Nicholas, R. A., Miles, R. J., Wood, A. P. & Kelly, D. P. (2009). Kinetics of substrate oxidation and hydrogen peroxide production by Mycoplasma mycoides subsp. mycoides Large Colony (LC) type and Mycoplasma mycoides subsp. capri Res V et Sci 87, 364 6. Shilov, I. V., Seymour, S. L., Patel, A. A., Loboda, A., Tang, W. H., Keating, S. P., Hunter, C. L., Nuwaysir, L. M. & Schaeffer, D. A. (2007). The Paragon Algorithm, a next generation search engine that uses sequence temperature values and feature probabilities to identify peptides from tandem mass spectra. Mol Cell Proteomics 6, 16381655. Shirvan, M. H. & Rottem, S. (1993). Ion pumps and volume regulation in mycoplasma. Subcell Biochem 20, 261 92. Silber, K. R., Keiler, K. C. & Sauer, R. T. (1992). Tsp: a tail specific protease that selectively degrades proteins with nonpolar C termini. Proc Natl Acad Sci 89, 295299. Simmons, W. L., Bolland, J. R., Daubenspeck, J. M. & Dybvig, K. (2007). A stochastic mechanism for biof ilm formation by Mycoplasma pulmonis. J Bacteriol 189, 190513. Smits, W. K., Dubois, J. Y., Bron, S.,van Dijl, J. M. & Kuipers, O. P. (2005). Tricksy business: transcriptome analysis reveals the involvement of thioredoxin A in redox homeostasis, oxidati ve stress, sulfur metabolism, and cellular differentiation in Bacillus subtilis J Bacteriol 187, 392130. Stintzi, A., D. Marlow, D., Palyada, k., Naikare, H., Panciera, R., Whitworth, L. & Clarke, C. (2005). Use of genome wide expression profiling and mutagenesis to study the intestinal lifestyle of Campylobacter jejuni Infect Immun 73, 1797810. Stone, K. L. & Williams, K. R. (1997). Digestion of Proteins in Gels for Sequence Analysis. (ed.) In Current protocols in protein science, vol. 2 pp. 11.3.1 11.3.12. Edited by J. E. Coligan and others. NJ: Wiley & Sons, Inc. Story, R. M. & Weber, I. T. & Steitz T. A. (1992). The structure of the E. coli recA protein monomer and polymer. Nature 355 31825.

PAGE 126

126 Su, Y. A., He, P. & Clewell, D. B. (1992) Characterization of the tet(M) determinant of Tn916: evidence for regulation by transcription attenuation. Antimicrob Agents Chemother 36, 769 78. Taschke, C. & Herrmann, R. (1988). Analysis of transcription and processing signals in the 5' regions of the two Mycoplasma capricolum rRNA operons. Mol Gen Genet 212, 522 30. Tryon, V. V. & Baseman, J. B. (1992). Pathogenic determinants and mechanisms. In Mycoplasmas: molecular biology and pathogenesis, pp. 457471. Edited by J. Maniloff. Washington, DC: American Society for Microbiology. Tully, J. G., Rose, D. L., Whitcomb, R. F. & Wenzel, R. P. (1979). Enhanced isolation of Mycoplasma pneumoniae from throat washings with a newly modified culture medium. J Infect Dis 139, 47882. Ueberle, B., Fran k, R. & Herrmann, R. (2002). The proteome of the bacterium Mycoplasma pneumoniae: comparing predicted open reading frames to identified gene products. Proteomics 2, 754 64. Van Melderen, L., Thi, M. H. D., Lecchi, P., Gottesman, S., Couturier, M. & Maur izi, M.R. (1996). ATP dependent degradation of CcdA by Lon protease effects of secondary structure and heterologous subunit interactions. J Biol Chem 271, 27730 27738. Vilei, E. M., Abdo, E. M., Nicolet, J., Botelho, A., Gonalves, R. & Frey, J. (2000). Genomic and antigenic differences between the European and African/Australian clusters of Mycoplasma mycoides subsp. mycoides SC. Microbiology 146, 47786. Voelker, L. L. & Dybvig, K. (1998). Transposon mutagenesis. Methods Mol Biol 104, 2358 Waldo, R. H., Popham, P. L., RomeroArroyo, C. E.,Mothershed, E. A., Lee, K. K. & Krause, D. C. (1999). Transcriptional analysis of the hmw gene cluster of Mycoplasma pneumoniae. J Bacteriol 181, 497885. Wasinger, V. C., Pollack, J. D., & Humphery Smith, I. (2000). The proteome of Mycoplasma genitalium Chaps soluble component Eur J Biochem 267, 157182. Weiner, J. 3rd, Zimmerman, C. U., Ghlmann, H. W. & Herrmann, R. (2003). Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 630620.

PAGE 127

127 Weiner, J. 3rd, Herrmann, R. & Browning, G. F. (2000). Transcription in Mycoplasma pneumoniae. Nucleic Acids Res 28, 448896. Wilson, C. J., Zhan, H., Swint Kruse, L. & Matthews, K. S. (200 7) The lactose repressor system: paradigms for regulation, allosteric behavior and protein folding. Cell Mol Life Sci 64, 3 16. Yamao, F., Iwagami, S., Azumi, Y., Muto, A., Osawa, S., Fujita, N. & Ishihama, A. (1988). Evolutionary dynamics of tryptophan tRNAs in Mycoplasma capricolum Mol Gen Genet 212, 3649. Yamao, F., Muto, A., Kawauchi, Y., Iwami, M., Iwagami, S., Azumi, Y. & Osawa, S. (1985). UGA is read as tryptophan in Mycoplasma capricolum Proc Natl Acad Sci USA 82, 23069. Ye, F., Re naudin, J., Bov, J. M. & Laigret, F. (1994). Cloning and sequencing of the replication origin (oriC) of the Spiroplasma citri chromosome and construction of autonomously replicating artificial plasmids. Curr Microbiol 29, 239. Yus, E., Maier, T., Mi chalodimitrakis, K., van Noort, V., Yamada, T., Chen, W. H., Wodke, J. A., Gell, M., Martnez, S., Bourgeois, R., Khner, S., Raineri, E., Letunic, I., Kalinina, O. V., Rode, M. Herrmann, R., Gutirrez Gallego, R., Russell, R. B., Gavin, A. C., Bork P. & Serrano L. (2009). Impact of genome reduction on bacterial metabolism and its regulation. Science 326, 12638. Zeller, T. & G. Klug. (2006). Thioredoxins in bacteria: functions in oxidative stress response and regulation of thioredoxin genes. Naturwissenschaften 93, 25966. Zhong, G., Fan, P., Ji, H., Dong, F. & Huang, Y. (2001). Identification of a chlamydial proteaselike activity factor responsible for the degradation of host transcription factors. J Exp Med 193, 93542. Zou, N. & Dybvig, K. (2002). DNA replication, repair, and stress response. In Molecular Biology and pathogenicity of Mycoplasmas pp. 303321. Edited by S. Razin & R. Herrmann. New York: Plenum.

PAGE 128

128 BIOGRAPHICAL SKETCH Ayman Allam was born in the City of Cairo, Egypt He received his B.SC (Botany/Chemistry) from Ain Shams University/ Cairo, Egypt. As a one year compulsory military ser vice, he served in the army as a chemist specialized in rocket fuel analysis. He then joined the Plant Taxonomy and Natural Products Unit at the National Research Center (NRC) Cairo, Egypt. At NRC he began working on identification and isolation of plant phytoalexins, antimicrobial substances synthesized de novo by plants that rapidly accumulate at the site of pathogen infection. He won the National ICGEB (the International Center for Genetic Engineering and Biotechnology Trieste, Italy) fellowship to study molecular biology, DNA recombinant technology and biotechnology. He studied at Department of Biochemistry and Molecular Biology, Bari University, Bari Italy. His Diploma of Specialization was in Plant Molecular Biology. Upon returning to NRC in Cairo he joined the Microbial Biotechnology Unit working on metal chelation by algae and fungi. He won a scholarship from Georgia State University where he studied and obtained a M.SC on Molecular microbial Genetics of Bacillus stearothermophilus He then joined KBI (Kinetic Biosystems Inc.), a research company located in Advanced Technology Development Center (ATDC) on the campus of th e Georgia Institute of Technology. He worked as a microbiologist to study the possibility of using and/or genetically adapting P. putida to treat the nitrate contaminated groundwater. He was accepted as a Ph.D. student at the Department of Biochemistry and Molecular Biology, College of Medicine, University of Florida and then transferred to the College of Veterinary Medicine, De partment of Infec t ious Diseases and Pathology