<%BANNER%>

Carbohydrate-regulated gene expression of Streptococcus mutans

Permanent Link: http://ufdc.ufl.edu/UFE0041624/00001

Material Information

Title: Carbohydrate-regulated gene expression of Streptococcus mutans
Physical Description: 1 online resource (73 p.)
Language: english
Creator: Rivera, Mercedes
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: carbohydrate, caries, ccpa, expression, gene, hpr, mutans, pts, regulation, streptococcus
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Streptococcus mutans, the principal etiological agent of human dental caries, metabolizes carbohydrates to produce primarily lactic acid. This causes demineralization of the tooth enamel leading to caries formation. Thus, understanding the mechanism by which S. mutans regulates carbohydrate catabolism is essential in the development of new treatments for the prevention and treatment of dental caries. The histidine containing phosphocarrier protein (HPr), the product of the pstH gene, participates in both the phosphorelay reaction of the phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS) (the main carbohydrate intake system of oral bacteria) and in activation of the catabolite control protein A (CcpA) (a global regulator in gene expression). CcpA regulates gene expression by binding to the catabolic response elements (cre) located in the promoter regions of carbon catabolite repression or CCR-sensitive genes. Loss of CcpA affects the expression of the fructanase (fruA) and glucosyltransferase B (gtfB) genes, which encode known virulence attributes of S. mutans. One goal of this study was to determine if CcpA binds the cre sequences of the fruA and gtfB promoters and if HPr or derivatives of HPr, enhance the binding between CcpA and these two genes. Since sugar phosphates have been shown to enhance CcpA binding, in vitro experiments were done to test whether the sugar phosphates (F-1,6-bP, F-6-P or G-6-P) enhance CcpA binding. Further, previous data suggested that the ManL protein, containing the AB domains of a mannose permease, was also involved in regulation of the gtfB gene. Therefore, an investigation into the interaction of ManL with the gtfB gene was performed. Finally, given that the PTS plays a central role in regulation of carbohydrate catabolism and that HPr is a major contributor to this regulation, three mutant strains (hprKV265F, pstHS46A, pstHS46D) of S. mutans UA159 were examined for glycolytic rates, acid tolerance and PTS activity. Gel shift assays were performed to determine if CcpA binds the fruA and gtfB promoters and to determine if HPr, ManL and/or glycolytic intermediates enhance the ability of CcpA to bind. The results revealed that the CcpA protein binds the cre sequences of both the fruA and the gtfB promoters and that addition of sugar phosphates and/or HPr influences CcpA binding. It is understood that in order for HPr to complex with CcpA, it must be phosphorylated at the serine-46 residue. Therefore, modified HPr proteins were tested for possible enhancement in the binding between CcpA and fruA and gtfB promoters. Specifically, a mutant form of HPr (HPrS46D) which mimics a constitutively phosphorylated HPr protein and an in vitro phosphorylated form of HPr (HPrSerPO4), were tested for possible enhancement of CcpA binding. Only the HPrSerPO4 protein resulted in an enhancement of binding between CcpA and the fruA promoter and a decrease in binding between CcpA and the gtfB promoter. Although the ManL protein has been shown to regulate gtfB expression, no molecular interaction between these molecules was observed. Physiological and enzymatic assays were performed on strains with mutations in the HPr and HPrK (an HPr specific kinase/phosphotase). These results showed that the pstHS46D strain had a faster glycolytic rate and increased acid tolerance response when compared to wild-type. Thus, an increased amount of serine-46 phosphorylated HPr in the cell may enhance survival of S. mutans during times of starvation and increased acid stress. Mutations in HPr (hprKV265F, pstHS46A, pstHS46D) resulted in lower glucose, fructose and mannose PTS activity when strains were grown in glucose. Collectively, the data reveal a critical role for HPr in modulating gene expression and virulence attributes in the oral pathogen S. mutans. Results also reveal an influence by glycolytic intermediates in gene expression via CcpA.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mercedes Rivera.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Burne, Robert A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041624:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041624/00001

Material Information

Title: Carbohydrate-regulated gene expression of Streptococcus mutans
Physical Description: 1 online resource (73 p.)
Language: english
Creator: Rivera, Mercedes
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: carbohydrate, caries, ccpa, expression, gene, hpr, mutans, pts, regulation, streptococcus
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Streptococcus mutans, the principal etiological agent of human dental caries, metabolizes carbohydrates to produce primarily lactic acid. This causes demineralization of the tooth enamel leading to caries formation. Thus, understanding the mechanism by which S. mutans regulates carbohydrate catabolism is essential in the development of new treatments for the prevention and treatment of dental caries. The histidine containing phosphocarrier protein (HPr), the product of the pstH gene, participates in both the phosphorelay reaction of the phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS) (the main carbohydrate intake system of oral bacteria) and in activation of the catabolite control protein A (CcpA) (a global regulator in gene expression). CcpA regulates gene expression by binding to the catabolic response elements (cre) located in the promoter regions of carbon catabolite repression or CCR-sensitive genes. Loss of CcpA affects the expression of the fructanase (fruA) and glucosyltransferase B (gtfB) genes, which encode known virulence attributes of S. mutans. One goal of this study was to determine if CcpA binds the cre sequences of the fruA and gtfB promoters and if HPr or derivatives of HPr, enhance the binding between CcpA and these two genes. Since sugar phosphates have been shown to enhance CcpA binding, in vitro experiments were done to test whether the sugar phosphates (F-1,6-bP, F-6-P or G-6-P) enhance CcpA binding. Further, previous data suggested that the ManL protein, containing the AB domains of a mannose permease, was also involved in regulation of the gtfB gene. Therefore, an investigation into the interaction of ManL with the gtfB gene was performed. Finally, given that the PTS plays a central role in regulation of carbohydrate catabolism and that HPr is a major contributor to this regulation, three mutant strains (hprKV265F, pstHS46A, pstHS46D) of S. mutans UA159 were examined for glycolytic rates, acid tolerance and PTS activity. Gel shift assays were performed to determine if CcpA binds the fruA and gtfB promoters and to determine if HPr, ManL and/or glycolytic intermediates enhance the ability of CcpA to bind. The results revealed that the CcpA protein binds the cre sequences of both the fruA and the gtfB promoters and that addition of sugar phosphates and/or HPr influences CcpA binding. It is understood that in order for HPr to complex with CcpA, it must be phosphorylated at the serine-46 residue. Therefore, modified HPr proteins were tested for possible enhancement in the binding between CcpA and fruA and gtfB promoters. Specifically, a mutant form of HPr (HPrS46D) which mimics a constitutively phosphorylated HPr protein and an in vitro phosphorylated form of HPr (HPrSerPO4), were tested for possible enhancement of CcpA binding. Only the HPrSerPO4 protein resulted in an enhancement of binding between CcpA and the fruA promoter and a decrease in binding between CcpA and the gtfB promoter. Although the ManL protein has been shown to regulate gtfB expression, no molecular interaction between these molecules was observed. Physiological and enzymatic assays were performed on strains with mutations in the HPr and HPrK (an HPr specific kinase/phosphotase). These results showed that the pstHS46D strain had a faster glycolytic rate and increased acid tolerance response when compared to wild-type. Thus, an increased amount of serine-46 phosphorylated HPr in the cell may enhance survival of S. mutans during times of starvation and increased acid stress. Mutations in HPr (hprKV265F, pstHS46A, pstHS46D) resulted in lower glucose, fructose and mannose PTS activity when strains were grown in glucose. Collectively, the data reveal a critical role for HPr in modulating gene expression and virulence attributes in the oral pathogen S. mutans. Results also reveal an influence by glycolytic intermediates in gene expression via CcpA.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mercedes Rivera.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Burne, Robert A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041624:00001


This item has the following downloads:


Full Text

PAGE 1

1 CARBOHYDRATE REGULATED GENE EXPRESSION OF STREPTOCOCCUS MUTANS By MERCEDES F. RIVERA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MAS TER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Mercedes F. Rivera

PAGE 3

3 To my Mom, whose love and support I have never been without

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my graduate advisor Dr. Robert Burne and my supervisory committee, Dr. Jean nine Brady, Dr. Paul Gulig, Dr. Ann Progulske Fox and Dr. Peter Sayeski. I especially thank Dr. Tom Wen for providing me with the initial guidance in this endeavor, and to Dr. Lin Zeng for guiding me the rest of the way. I also want to thank Dr. Bryan Kor ithoski for taking the time to answer question after question. I am also thankful for Chris, whom without I think the entire lab would fall apart and I thank him for him just putting up with me. Last, but not least, I would like to thank the entire Burne Lab, e specially Kinda, for keeping me as sane as possible, sharing the good times and helping me through the bad. Most of all I would like to thank my Mom, for always being there and never letting me down, and Frederick, for being a shoulder when I neede d someone to lean on and ears when I needed someone to listen. Thanks.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT .....................................................................................................................................9 CHAPTER 1 INTRODUCTION ..................................................................................................................12 Mutans Streptococci and the Oral Cavity ...............................................................................12 Streptococci and Mutans Streptococci ............................................................................12 Streptococcus Mutans and Dental Caries ........................................................................12 Streptococcus Mutans Pathogenicity ...............................................................................13 Stress Tolerance ......................................................................................................................14 Aciduricity: Survival of S. mutans in Acidic Conditions ................................................14 The Effects of Oxygen and Biofilms on Virulence .........................................................15 Sugar Metabolism ...................................................................................................................15 CCR in Bacteria ...............................................................................................................15 Phosphorelay and Sugar Uptake ......................................................................................16 CcpA ................................................................................................................................17 ManL ...............................................................................................................................18 Summary .................................................................................................................................19 2 MATERIALS AND METHODS ...........................................................................................20 DNA Manipulations ................................................................................................................20 Creation of hprK V265F, pstH S46A, pstH S46D Mutations in S. mutans Chromosome ................................................................................................................20 Creation of Streptococcus mutans Biotinylated DNA Probes for Use in Electromobility Shift Assay .........................................................................................21 Protein Manipulations .............................................................................................................21 Creation of N Terminal 6X His tagged CcpA of S. mutans ...........................................21 Creation of N Terminal 6X His tagged ManL of S. mutans ...........................................22 Creation of N Terminal 6X His tagged HPr of S. mutans ..............................................23 Protein Purification and Dialysis ............................................................................................24 Creation of E. coli M15 Chemically Competent Cells ...........................................................25 P s er46HPr Phosphorylation Assay ......................................................................................25 Electromobility Shift Assay (EMSA) .....................................................................................26 Acid Killing Assay .................................................................................................................26 pH Drop Experiment ...............................................................................................................27 PTS Assay ...............................................................................................................................27

PAGE 6

6 3 In vitro ASSESSMENT OF THE BINDING CHARACTERISTICS OF PURIFIED CCPA WITH THE fruA PROMOTER OF S. mutans UA159 ...............................................33 Introduction .............................................................................................................................33 Results .....................................................................................................................................34 In vitro Binding Analysis of S. mutans CcpA to the fruA Promoter with Addition of Phosphate Sugars .........................................................................................................34 In vitro Binding Analysis of S. mutans CcpA to the fruA Promoter with Addition of Phosphate Sugars and HPr ...........................................................................................36 In vitro Binding Analysis of S. mutans CcpA to the fruA Promoter with Addition of HPr ...............................................................................................................................37 Summary .................................................................................................................................37 4 In vitro BINDING ASSESSMENT OF THE INTERACTIONS BETWEEN PURIFIED CCPA AND THE gtfB PROMOTER OF S. mutans UA159 ..................................................43 Introduction .............................................................................................................................43 Results .....................................................................................................................................44 In vitro Binding Analysis of S. mutans CcpA to the gtfB Promoter with Addition of ManL ............................................................................................................................44 In vitro Binding Analysis of S. mutans CcpA to the gtfB Promoter with Addition of F 1,6bP, F 6P and G 6P ...........................................................................................45 Summary .................................................................................................................................45 5 PHENOTYPIC ASSESSMENT OF THE EFFECTS OF SELECTED ptsH AND ptsK POINT MUTATIONS ON THE PHYSIOLOGY OF S. mutans UA159 ..............................49 Introduction .............................................................................................................................49 Results .....................................................................................................................................50 Glycolytic Rates ..............................................................................................................50 Final pH ...........................................................................................................................52 Ability to be Acid Tolerant ..............................................................................................52 PTS Activity ....................................................................................................................53 Summary .................................................................................................................................54 6 SUMMARY ............................................................................................................................61 LIST OF REFERENCES ...............................................................................................................68 BIOGRAPHICAL SKETCH .........................................................................................................73

PAGE 7

7 LIST OF TABLES Table page 21 Primers used in this study ..................................................................................................29 22 Bacterial strains and growth media ....................................................................................30

PAGE 8

8 LIST OF FIGURES Figure page 21 MAMA PCR. .....................................................................................................................31 22 Model of regulation ............................................................................................................32 31 EMSA of CcpA and the biotinylated fruA promoter and phosphate sugars ......................39 32 EMSA of CcpA and the biotinylated fruA promoter, including HPr and phosphate sugars. ................................................................................................................................40 33 EMSA of CcpA and the biotinylated fruA promoter, including variants of HPr. ...........41 34 EMSA of CcpA and the biotinylated fruA promoter, including low CcpA concentrations. ...................................................................................................................42 41 EMSA of CcpA and the biotinyla ted gtfB promoter, including ManL.. ............................47 42 EMSA of CcpA and the biotinylated gtfB promoter, including phosphate sugars. ........48 51 Glycolytic rate assay.. ........................................................................................................56 52 Final pH assay.. ..................................................................................................................57 53 Acid tolerance assay.. ........................................................................................................58 54 PTS activity grown in glucose. ..........................................................................................59 55 PTS activity grown in fructose. .........................................................................................60

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CARBOHYDRATE REGULATED GENE EXPRESSION OF STREPTOCOCCUS MUTANS By Mercedes Felicita Rivera May 2010 Chair: Robert A. Burne Major: Medical Sciences Streptococcus mutans, the principal etiological agent of human dental caries, metabolizes carbohydrates to produce primarily lactic acid. This causes demineralization of the tooth enamel leading to caries formation. Thus, understanding the mec hanism by which S. mutans regulates carbohydrate catabolism is essential in the development of new treatments for the prevention and treatment of dental caries. The histidine containing phosphocarrier protein (HPr), the product of the pstH gene, participa tes in both the phosphorelay reaction of the phosphoenolpyruvate (PEP) dependent phosphotransferase system (PTS) (the main carbohydrate intake system of oral bacteria) and in activation of the catabolite control protein A (CcpA) (a global regulator in gene expression). CcpA regulates gene expression by binding to the catabolic response elements ( cre ) located in the promoter regions of carbon catabolite repression or CCR sensitive genes. Loss of CcpA affects the expression of the fructanase ( fruA ) and gluc osyltransferase B ( gtfB ) genes, which encode known virulence attributes of S. mutans One goal of this study was to determine if CcpA binds the cre sequences of the fruA and gtfB promoters and if HPr or derivatives of HPr, enhance the binding between CcpA and these two genes. Since sugar phosphates have been shown to enhance CcpA binding, in vitro

PAGE 10

10 experiments were done to test whether the sugar phosphates (F 1,6bP, F 6P or G 6P) enhance CcpA binding. Further, previous data suggested that the ManL protein, containing the AB domains of a mannose permease, was also involved in regulation of the gtfB gene. Therefore, an investigation into the interaction of ManL with the gtfB gene was performed. Finally, given that the PTS plays a central role in regulation of carbohydrate catabolism and that HPr is a major contributor to this regulation, three mutant strains (hprK V265F, pstH S46A, pstH S46D) of S. mutans UA159 were examined for glycolytic rates, acid tolerance and PTS activity. Gel shift assays were perfo rmed to determine if CcpA binds the fruA and gtfB promoters and to determine if HPr, ManL and/or glycolytic intermediates enhance the ability of CcpA to bind. The results revealed that the CcpA protein binds the cre sequences of both the fruA and the gtfB promoters and that addition of sugar phosphates and/or HPr influence s CcpA binding. It is understood that in order for HPr to complex with CcpA it must be phosphorylated at the serine 46 residue. Therefore, modified HPr proteins were tested for possible enhancement in the binding between CcpA and fruA and gtfB promoters Specifically, a mutant form of HPr (HPrS46D) which mimics a constitutively phosphorylated HPr protein and an in vitro phosphorylated form of HPr (HPrSerPO4), were tested for possible enhancement of CcpA binding. Only the HPrSerPO4 protein resulted in an enhancement of binding between CcpA and the fruA promoter and a decrease in binding between CcpA and the gtfB promoter. Although the ManL protein has been shown to regulate gtfB expre ssion, no molecular interaction between these molecules was observed. Physiological and enzymatic assays were performed on strains with mutations in the HPr and HPrK (an HPr specific kinase/phosphotase). These results showed that the pstH S46D strain had a faster glycolytic rate and increased acid tolerance response when compared to wild type

PAGE 11

11 Thus, an increased amount of serine 46 phosphorylated HPr in the cell may enhance survival of S. mutans during times of starvation and increased acid stress. Muta tions in HPr (hprK V265F, pstH S46A, pstH S46D) resulted in lower glucose, fructose and mannose PTS activity when strains were grown in glucose. Collectively, the data reveal a critical role for HPr in modulating gene expression and virulence attributes in the oral pathogen S. mutans Results also reveal an influence by glycolytic intermediates in gene expression via CcpA.

PAGE 12

12 CHAPTER 1 INTRODUCTION Mutans Streptococci and the Oral Cavity Streptococci and Mutans Streptococci Streptococci are spherical, g ram positive, facultative anaerobic and nonmotile bacteria from the genus Streptococcus and the phylum Firmicute They are oxidase and catalasenegative and grow in pairs or chains due to cellular division occurring along a single axis. These organisms are categorized into groups according to their hemolytic properties. Mutans streptococci belong t o the viridans group, which has no defined Lancefield group antigens. The name viridans describes th hemolysis that forms when streptococci are grown on blood agar. Streptococcus mutans hemolytic capabilities and their ability to ferment sorbitol and mannitol and produce glucans fr om the metabolism of sucrose. These particular streptococci are also acid resistant and can grow and persist in low pH environments. Streptococcus Mutans and Dental C aries The organism Streptococcus mutans is the principle etiological agent of human denta l caries (also referred to as cavities or dental lesions) and this organism can also be a source of infective endocarditis (Franco et al. 1996, Banas, 2004, Han et al. 2006, Durack et al. 1978) The prevalence o f dental caries increases with age, from 26% in children 5 11 years of age, to 67% among people 1217 years of age and 94% for adults older than 18 years (Kaste et al. 1996, Winn et al. 1996) Dental caries damag e the structure of teeth (Gibbons et al. 1974, Loesche et al., 1975) and if left untreated can lead to pain, severe infection and tooth loss. Despite this many people do not get the dental treatment needed due t o high costs in dental care. According to the CDC (Center for Disease Control) about 21% of males and 37% of females in the U.S. do

PAGE 13

13 not attend a dentist due to cost. S. mutans contributes to dental caries by producing copious amounts of lactic acid from carbohydrates that breaks down tooth enamel, causing caries (Berry & Henry, 1977, Ikeda et al. 1978) Therefore, understanding the mechanism by which S. mutans regulates carbohydrate catabolism is essential in the development of therapeutic tactics for prevention and treatment of dental caries. Streptococcus Mutans P athogenicity Dental caries is a prevalent infectious disease in the US and developing countries among people of all age groups. Dietary carbohydrate intake is an essential environmental influence on the pathogenicity of the organisms found in the mouth. For instance, S. mutans survival and prolonged acidification of the oral environment depends greatly on the carbohydrates available to the organism f or metabolism. When fermentable carbohydrates are present, oral acidogenic and aciduric organisms many of which are Streptococcus mutans produce a large amount of organic acids (Geddes, 1975) Since saliva is normally found at neutral pH, the environment in the mouth goes through alkalinization and acidification periods before and after eating, respectively. During the alkalinization phase remineralization of the teeth is occurs while during the acidification phase, tooth enamel is depleted. Dental caries is the consequence of a shift in the remineralization:demineralization balance toward the la tter. S. mutans attaches to the pellicle of the teeth using surface bound adhesins or through the concerted actions of glucosyltransferases, protein antigen C and glucan binding proteins (Fujita et al. 2007) GTFs utilize sucrose to synthesize an 1,3rich homopolymer of glucose that acts as an adhesive scaffold for initial bacterial adherence and accumulation of mutans streptococcci In order for acidogenic bacterial species to survive acid stress they need to react in an efficient manner by altering their gene expression and physiology (Burne, 1998) For example, the aciduricity acquired in S. mutans

PAGE 14

14 occurs due to the protection it obtains fr om biofilms and predominantly from physiological changes that allow the pH inside the cell to be 0.5 to 1 unit above the outside environment. Stress Tolerance Aciduri city: Survival of S. mutans in Acidic C onditions Salivary secretion makes up the main nutrient source of oral microorganisms. The normal pH of saliva is neutral, which is optimal for the growth of most of the flora found in the oral cavity. As dietary sugar levels increase, the pH of oral biofilms decreases dramatically. This decrease is a result of acidogenic/aciduric organisms like Streptococcus mutans carrying out glycolysis. At low plaque pH this bacterium gains a selective advantage over organisms that are less aciduric. One mechanism used by S. mutans to survive in this low pH enviro nment is the F0F1ATPas e, which pumps protons out of the cell at the expense of ATP or in certain cases the ATPase can work in reverse to produce ATP (Sheng & Marquis, 2006) The F ATPase helps to maintain the int ernal pH at 0.5 to 1 unit above the external environmental pH. Studies done in S. mutans grown in a steadystate chemostat culture at pH 5 show an increase in survival when subjected to acid killing. Cells grown at pH 5 are able to decrease the pH to val ues lower than cells grown at neutral pH (Nascimento et al. 2004, Seidl et al. 2008) A 2.4 fold increase in mRNA expression of atpB (the F0F1ATP synthase subunit A) was seen in S. mutans growing under acidic co nditions. One of the ways that S. mutans protects itself from environmental acid is by forming biofilms. Cells in biofilm at pH values below 5.0 are more acid tolerant than planktonic cells (36.5% survival versus 11.2%, respectively) (Welin Neilands & Svensater, 2007) Bacteria are also able to make ammonia to neutralize some of the acidity in the environment through the arginine deaminase system or utilizing the urease enzyme. S. mutans lacks both these systems, but h as an agmatine deaminase system that converts agmatine to

PAGE 15

15 putrescince, ammonia and CO2 (Griswold et al. 2006) Yet another pathway that provides S. mutans with some protection at low pH is malolactic fermentation (MLF) where the bacteria use malic acid to produce lactic acid and CO2. Although consumption of malate is not useful for energe generation by S. mutans, it is still effective against acid killing because MLF it increases the cytoplasmic pH due to CO2 production (Lemos et al. 2005) The Effects of Oxygen and Biofilms on V irulence As biofilms mature, oxygen concentration goes down. A study by Ahn et al shows that exposure t o oxygen causes 5% of genes in S. mutans to be differentially expressed and inhibit biofilm formation (Ahn et al. 2007) Although S. mutans lacks a complete electron transport chain and lacks s ome of the major enzymes that aid in oxygen metabolism, like cytochromes and catalase (Martin et al. 1984) is is able to grow in oxygen because it produces flavoenzymes like (NADH oxidase, pyruvate oxidase, and antioxidants like Dpr, a manganous containing superoxide dismutase and nonheme peroxidases) (Abbe et al. 1982, Martin et al., 1984, Yamamoto et al. 1999, Yamamoto et al. 2002, Higuchi et al. 1999) CcpA dependent gene regulation is also affected by the oxygen concentration to which cells are exposed. It has been seen that the ccpA gene was upregulated 3.6fold when cells of S. mutans were grown in air (Ahn et al., 2007) It is important to have an understanding of this regulation. Sugar Metabolism CCR in Bacteria Although many environmental i nfluences, such as pH and oxygen, contribute to the global regulatory response of plaque bacteria, carbohydrate availability and source have a major impact on gene expression. There are several enzymes that bacteria use to metabolize carbohydrates. Many of the genes that encode those enzymes and other proteins, such as permeases, that would allow carbohydrates to enter the cell, are regulated by the sugar that is available to the cell. The

PAGE 16

16 term carbon catabolite repression (CCR) describes the activation or silencing of genes in response to carbohydrate source and availability. An example of this regulation is illustrated by the reduction in transport of sugars other than glucose when glucose is present. The mechanisms involved in the CCR response of gra m negative bacteria are unlike what is known for gram positives and ha ve been extensively studied in E. coli (Guidi Rontani et al. 1980, Leboeuf et al. 2000) Unlike gram negatives, some gram positives lack both c AMP synthesis and the CRP protein. Gram positives contain catabolite responsive elements ( cre ) for the CcpA protein to bind in the promoter region of genes (Lorca et al. 2005) Studies in Bacillus magetarium show that not only (P (ser46) HPr) or (HPr) Histidine containing phosphocarrier protein but also pH, influences the ability of glycolytic intermediates to elicit cooperative binding of CcpA to the promoter of genes containing functional cre sequences making both HPr and pH essential players in gene regulation. Phosphorelay and Sugar U ptake Activation of CcpA is dependent on Histidine containing phosphocarrier protein (HPr). HPr is also an essential protein of the PEP dependent PTS (phosphotransferase system) (Christensen et al. 1999, Deutscher et al. 2005, Viana et al. 2000) During periods of little sugar availability, the PTS is the main sugar uptake system in S. mutans There are two common components of the PTS, Enzyme I (EI) and HPr as well as a variety of sugar specific Enzyme II (EII) complexes EII s are composed of at least three domains (A, B and C), and sometimes a fourth domain, D. EII A and EII B are cytoplasmic proteins involved in the phosphorylation of incoming sugars, EII C and EII D are proteins that make up the membrane associated permease (Gorke & Stulke, 2008) This phosphoryl transfer process begins with PEP hydrolysis, which allows the donation of a phosphate molecule to EI. EI then donates a phosphate to HPr at histidine 15. The phosphate is now transferred to EIIAB, then to EIIC and EIID. This

PAGE 17

17 transmembrane permease complex will concomitantly phospha rylate and internalize the cognate sugar (Gorke & Stulke, 2008) EII permeases display a high degree of sugar specificity but many are able to tran sport more than one type of sugar. Once sugars enter the cell they are generally converted to fructose 1,6bisphosphate (F 1,6bP) and metabolized by glycolysis. F 1,6bP is an intermediate of the glycolysis metabolic pathway (via the EmbdenMeyerhoff pa thway) and is produced by phosphorylation of fructose 6 phosphate. Glycolytic intermediates, specifically F 1,6bP, F 6P and G 6P, and others to a lesser extent, activate an ATP dependent HPr kinase, which phosphorylates HPr at serine 46 (P Ser46 HPr) P Ser46 HPr binds to CcpA, inducing a change in conformation that allows it to bind cre sequences. Therefore, a major factor in CCR in gram positive bacteria involved sensing of the levels of specific glycolytic intermediates. CcpA The four major contrib utors to S. mutans virulence are its ability to adhere to the tooth surface, form biofilms, form acid and survive in this acidic environment. The global regulator, CcpA, is a member of the LacI GalR family of transcriptional regulators that have been stud ied extensively in B. subtilis (Henkin et al., 1991) CcpA contains an effector binding site and both a dimerization and a helix turn helix DNA binding domain and forms dimers containing 37kDa monomers when active (Kim & Chambliss, 1997) CcpA is an essential component in the regulation of genes, especially genes involved in energy metabolism and virulence. Many of the genes regulated by CcpA are fundamental in determining the cariogenicity of S. mutans. Cariogenic properties are a result of its ability to express several virulence factors, including the production of lactic acid from sugar metabolism (Abbe et al., 1982) Long afte r the dietary carbohydrate sources have been exhausted, S. mutans can continue to degrade fructan polysaccharides to fructose, which can then function as an extracellular carbohydrate reserve,

PAGE 18

18 prolonging bacterial survival and exposure of the teeth to lowe r pH (Wexler et al. 1992) Microarray analysis shows several genes regulated by CcpA that are either being activated or repressed by this protein (Abranches et al. 2008) emphasizing the importance of investigating how CcpA influences the resulting effects on these genes, whether by direct contact by binding to cre or indirectly. Most of the genes that have been seen to be under the control of CcpA are known to contain consensus sequences known as catabolite response elements or cre (Lorca et al., 2005) This consensus sequence is WWTGNAARCGNWWWCAWW, which is partially palindromic (Miwa & Fujita, 2001, Miwa et al. 2000) Cre s can be found near most, but certainly not all, gene s that have been shown by microarray analysis to be regulated by CcpA, located either upstream of the hexameric 35 sequence (where it confers activation) or downstream of putative 35 and 10 (where it confers repression). Therefore, the importance of uncovering whether or not CcpA is binding directly to the cre sequences in the genes it influences in Streptococcus mutans is evident Characterizing the binding of CcpA is also important because many of the genes it regulates are essential to S. mutans vir ulence. ManL A novel finding suggests that manL, a component of the EIIman PTS permease, may be able to influence CcpA dependent gene regulation. Previous studies have suggested that the EIIABman or ManL, could be involved not only in transfer of sugars, but also in gene regulation (Zeng & Burne, 2008) A manL deletion mutant (JAM1) was created and cat fusion activity of the glucosyltransferase gene was examined. Glucosyltransferase genes ( gtfBC ) are required for the virulence of S. mutans, allowing it to produce glucans through the use of environmental sucrose, which is an integral constituent in biofilm formation. Results of gtfBC activity in respo nse to deletion of manL shows a decrease in gtfBC gene activity in strains lacking ManL (Abranches et al., 2003) It has also been shown that S. mutans strains that lack ManL do not exhibit diauxic

PAGE 19

19 growth (Abranches et al., 2003) on combinations of preferred and nonpreferred carbohydrate sources. Theref ore, a strong possibility that ManL is involved in CCR exists. It was known that ManL influences the expression of gtfBC but not how it did this. Microarrays of JAM1 revealed that ManL in S. mutans has a role in regulation of energy metabolism genes. R egulation by ManL may be due interactions with transcription factors, like CcpA (Abranches et al. 2006) Summary The effect CcpA has on gene expression is evident in its ability to cause carbohydrate catabolite rep ression (CCR). CCR is the regulation of expression of genes in response to carbohydrate source and availability. CCR is accomplished through many regulatory mechanisms, such as transcription al activation and repression translation manipulation by RNA bi nding proteins and inducer exclusion exerted through transport proteins (Gorke & Stulke, 2008) We previously demonstrated that CcpA plays a direct role in CCR using the fructan hydrolase gene ( fruA ) as a model and know CcpA is directly activated by the serine phosphorylated HPr protein (Abranches et al., 2008) FruA is the enzyme that breaks down fructan polymers to make fructose and has been shown to be a factor that contributes to virulence in S. mutans (Burne et al. 1996) Our group has results that confirm that CcpA plays a major role in CCR regulated gene expression (Abranches et al., 2008) These data also support the possibility of a CcpA independent network of CCR, since it was seen that loss of CcpA did not eliminate diauxic growth ( the diphasic response of a bacteria to the addition of a second carbohydrate source) of S. mutans grown in CCR controlled carbohydrates. CcpA and HPr impact the ability of S. mutans to transport and grow in cer tain sugars, as well as enhance glycolysis, intracellular stores of sugars and acid to lerance.

PAGE 20

20 CHAPTER 2 MATERIALS AND METHOD S DNA Manipulations Creation of hprK V265F, pstH S46A, pstH S46D M utations in S. mutans C hro mosome Mismatch amplification mutation analysis (MAMA) PCR (Cha et al. 1992) was used to verify point mutations in the S. mutans genome. A 1~2kbp fragment with the desired mutation located roughly in the middle of the fragment was generated by recombinant PCR. This fragment was then transformed into S. mutans wild type strain UA159 (Murchison et al. 1986) along with an indicator plasmid that carries a p levD cat reporter fusion and a Km resistance cassette (Zeng & Burne, 2008) The plasmid was used at concentrations lower (at least 100 fold) than the mutant fragment was integrated into the p hnA mtlA site. Transformations were then plated on (BHI) Brain heart infusion media (Becton, Dickinson and Company, Sparks, MD.) containing 1 mg/ml kanamycin. MAMA PCR was then performed on each visible colony that resulted. MAMA PCR primers were designed by Dr. Lin Zeng to be used for the detection of site directed mutations in the following strains ( hprK V265F, pstH S46A, pstH S46D). In principle a MAMA primer only initiates the PCR reactions when a wild type template is present. For example, MAMA primers have only one mismatch when compared to wildtype located on the last three nucleotides of the oligo, while it has two mismatches when compared to the designed mutant and this is why the previous reaction fails. The 50 l PCR reactions contained 0.6 M primer A (5 primer), 0.4 M MAMA primer (3 primer) and 0.2 M control primer (3 primer). The PCR reaction was heated to 95 C for 5 minutes, followed by 30 cycles of 95C for 25 seconds, 55 C for 25 seconds and 72C for 2 minutes. A control primer was used to ensure that the PCR amplification succeeded If a wild type strand is present, the abundance of the MAMA

PAGE 21

21 primer and the smaller size of the intended product, allow for the preferential amplification of a shorter (e.g. 0.5Kbp) fragment. If the mutation was successful, the amplification of a larger ( e.g. 1Kbp) fra gment resulted, due to the extra mutation not allowing annealing of the MAMA primer to occur (Figure 2 1). Creation of Streptococcus mutans Biotinylated DNA Probes for Use in Electromobility Shift Assay Catabolite response elements ( cre) located on the pr omoter region of the S. mutans fruA and gtfB genes were PCR amplified using S. mutans genomic DNA to be used as the DNA probes for e lectromobility shift assays. The primers fruA5 biotin and fruA3 and pgtfB5 biotin and pgtfB3 were used (primers were synthesized by Integrated DNA Technologies Inc., Coralville, IA). The resulting 60 bp fruA fragment and 260bp gtfB fragment of each promoter contained the known cre sequences ( fruA contains two consecutive cre sequences, one of weak and one of strong homology to the consensus sequence) (Lorca et al., 2005) The PCR products were then purified from a 0.8% TAE agarose gel and extracted using the QiaQuick gel extraction kit (Quiagen inc., Valencia, CA.). Both fruA and gtfB PCR reactions resulted in a 5 biotinylated fragment. An unbiotinylated 5 primer was made as an exact replica of the biotinylated one both the fruA and gtfB genes. These primers were used in conjunction with their respective 3 primers to make identical unbiotinylated fragments for use in cold competition assays. Protein Manipulations Creation of N Terminal 6X His tagged CcpA of S. mutans Several proteins including (CcpA, ManL and HPr) of S. mutans were expressed with a pQE30 vector, extrac ted a nd purified to be used in e lectromobility shift assays. PCR amplification was performed using (ccpa ep5 and ccpa ep3 ) primers designed to amplify the entirety of the 1 Kbp ccpA gene of S. mutans (primers were synthesized by Integrated DNA

PAGE 22

22 Technologies Inc., Coralville, IA). The primers contained sites for digesti on with restriction enzyme BamHI and PstI, respectively. R estriction enzymes were purchased from New England Biolabs (Ipswich, MA). The pQE30 vector, which included a multiple cloning site an d ampicillin cassette, was used to manufacture the S. mutans CcpA protein using the E. coli M15 strain, which contained a cassette for kanamycin resistance. pQE30 is a 3.4 Kbp, low copy number expression vector, containing a T5 promoter and also facilitat es a 6Xhistag fusion at the N terminus. The PCR product of the ccpA gene and vector DNA were purified from a 0.8% TAE agarose gel and extracted using the QiaQuick gel extraction kit (Quiagen inc. Valencia, CA.). Both vector DNA and the ccpA PCR product w ere cut with the above mentioned enzymes and then ligated using the recombinant ends. The ligation mixture was introduced into E coli M15 chemically competent cells using the heat/cold shock method. The ligation mixture was incubated on ice for 20 minute s, then heat shocked in 42C water bath for 2 minutes, followed by cold shock on ice for 2 minutes. 900 l of SOC media (tryptone and yeast media containing 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose) was added to each ligation re action and the reactions were placed in a 37C shaker for 50 minutes at 200 rpm. The cells were spun down and the supernatant discarded. Cells were then suspended in the residual supernatant and plated. Selection for colonies of M15 cells containing the cloned product was performed on LB (Luria Broth) plates containing both ampicillin (100 g ml1) and kanamycin (40 g ml1) antibiotics. Colonies were picked the day after and the correct ligation product was verified by sequencing. Creation of N Ter minal 6X His tagged ManL of S. mutans The above protocol, describing the creation of the 6X His tagged CcpA protein, was also performed to create the S. mutans 6X His tagged ManL protein using the (manL ep5 manL -

PAGE 23

23 ep3 ) primers for PCR amplification of the 1 Kbp manL gene (primers were synthesized by Integrated DNA Technologies Inc., Coralville, IA). Each primer contained sites for digesti on with restriction enzyme BamHI in manL ep5 and PstI in manL ep3 purchased from New England Biolabs (Ipswich, MA). The pQE30 vector mentioned above was also used for cloning the gene into E. coli M15 strain. The PCR product of the manL gene was purified from a 0.8% TAE agarose gel and extracted using the QiaQuick gel extraction kit (Quiagen inc. Valencia, CA.). Vect or DNA and the clean PCR product were both cut with the above mentioned enzymes and then ligated using the recombinant ends. The ligation mixture was introduced into E.coli M15 chemically competent cells using the heat/cold shock method mentioned above, transformations were plated on LB (Luria Broth) plates containing both ampicillin (100 g ml1) and kanamycin (40 g ml1). Colonies were picked the day after and confirmation of the correct ligation product was verified by sequencing. Creation of N Termi nal 6X His tagged HPr of S. m utans The s ame procedure as, mentioned above for the creation of the 6X His tagged CcpA and ManL proteins was also performed to create the 6X His tagged HPr protein (product of the pthP gene of S. mutans The primers (HPr5 Bam HI and HPr3 SalI ) contain ing the BamHI and SalI restriction sites, respectively, were used to amplify the 264 bp pthP gene of S. mutans (primers were synthesized by Integrated DNA Technologies Inc., Coralville, IA) The PCR product of the pthP gene was pur ified from a 0.8% TAE agarose gel and extracted using the QiaQuick gel extraction kit (Quiagen inc. Valencia, CA.). pQE30 vector DNA and the pthP PCR product were both cut with the above mentioned enzymes and then ligated using the recombinant ends. E.co li M15 chemically competent cells were used to induce the ligation mixture using the heat/cold shock method mentioned above, transformations were plated on LB (Luria Broth) plates and selected for using both ampicillin (100 g ml1) and kanamycin (40 g m l1) antibiotics.

PAGE 24

24 Colonies were picked the day after and confirmation of the correct ligation product was verified by sequencing. Protein Purification and Dialysis After the correct sequences for each protein (either CcpA, ManL or HPr) were confirmed, each transformant strain was grown for expression and purification of the S. mutans proteins. Cultures of each of the E. coli M15 transformants were grown over night in LB media (Luria Broth) with 100 g ml1 of a mpicillin and 40 g ml1 of k anamicin in a CO2 incubator at 37C. A 1:30 dilution of the overnight cultures was made and these dilutions were allowed to grow to an optical density at 600 nm of 0.5, when this optical density was reached, 1 mM isopropylthioD galactopyranoside (IPTG) was added, the cultures were then allowed to shake at 37C for 45 hours. Each 600 mls of culture were spun down and resuspended in 4ml lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, adjusted to pH 8 with NaOH). 2 ml of 0.1 mm glass beads (Biospec, Inc., Bartleville, OK) was added to the resuspended cells and the cells were lysed by bead beating (Minibeadbeater, Biospec, Inc., Bartleville, OK), twice at 4C for 20 seconds. The lysed cells were spun down and the cell lysate was incubated fo r 90 minutes wi th 2 ml of Nickel resin (NiNTA Agarose, Qiagen, Valencia, CA.) at 4C. The mixtures were loaded onto columns and washed with 10 mls of wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, adjusted to pH 8 with NaOH). Finally, the 6XHis protein was eluted by increasing the imidazole concentration in the buffer to 250 mM. Ten individual elution fractions were collected, each containing 250 l of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, adjusted to pH 8 with NaOH). SDS PAGE was u sed to verify which elutions contained the correct protein size and to assure the purity of the protein. The final preparati on was to dialyze the fragments c ontaining the purified proteins in 2.1 L of 1X binding buffer (10

PAGE 25

25 mM Hepes, pH 7.9, 50 mM KCl, 1 m M EDTA, 5 mM DTT, and 10% glycerol)). The elution fractions containing the proteins were inserted into either a 10,000 molecular weight cut off dialysis cassette (Slide A Lyser, Pierce, Rockford, IL.), for CcpA or ManL, or a 3,000 MWCO dialysis cassette f or HPr. The dialysis cassettes were allowed to float in 2.1 L of binding buffer at 4C, overnight. The next day the dialyzed protein was retrieved from the cassette and stored at 20C. Creation of E. coli M15 Chemically Competent Cells E. coli M15 cells were made chemically competent for the use as transformants for protein expression. A 100 ml flask of autoclaved LB (Luria Broth) was inoculated with 1 ml of overnight culture of the E. coli M15 cells and 1.5 l of 30 g ml1 kanamycin was added for selection. The flask was placed in a 37C incubator/shaker for 1 hour. The samples were grown to optical density at 600 nm of 0.4 and then transferred to 50 ml conical tubes and chilled on ice for 30 minutes. Cells were spun down and the supernatant was dec anted. Then cells were suspend in 40 ml CaCl2 solution (autoclaved 10% Glycerol in distilled water and 75 mM CaCl2 ) and chilled on ice for 30 minutes shaking every 5 minutes. Finally, cells were spun down and the supernatant was decanted and cells were suspend in 1 ml of CaCl2 Solution. These cells were quick frozen in an ethanol and dry ice bath and stored at 80C. P ser46 HPr Phosphorylation A ssay In vitro phosphorylation of the S. mutans H Pr protein was performed for use in e lectromobility shifting The HPr kinase (HPrK) used for this assay was generated by Dr. Lin Zeng using similar methods to the protein expression and purification protocols mentioned above. The HPr phosphorylation assay was standardized by Dr. Bryan Korithoski. HPr phosphoryla tion at the serine 46 residue was accomplished using the following method. 20 l of the above mentioned HPr purified protein (dialyzed against 1 mM Tris buffer) was heated in the

PAGE 26

26 thermal cycler to 80C for 30 minutes, then was cooled to room temperature. 10 M of this HPr protein was combined with 0.5 M of purified HPrK, 1 mM ATP, 5 mM MgCl2 and 300 l of 10 mM HCl for a total volume of 500 l per reaction. This reaction was incubated for 30 minutes in a 37C water bath. Finally, a nondenaturing PAGE w as used to assure the presence of the correct phosphorylated state of the HPr protein. Electromobility Shift Assay (EMSA) Electrophoretic mobility shift assay (EMSA) was used to look at binding of CcpA to the fruA and gtfB promoters of S. mutans Binding reactions contained (varying concentrations of CcpA purified protein, varying concentrations of DNA probe (either the fruA or gtfB biotinylated promoter sequence), and some reactions also contain ed either 2 mM fructose1,6bisphosphate (F 1,6bP), 2 mM fructose6phophate (F 6 P), or 2 mM Glucose 6phosphate (G 6 P). All reactions contained 5 mM MgCl2, 1 g of poly DI DC, 1X binding buffer (10 mM Hepes, pH 7.9, 50 mM KCl, 1 mM EDTA, 5 mM DTT, and 10% glycerol), and/or varying concentrations of ManL, HPr an d P HPr purified proteins, to a final volume of 10 l per reaction) and were incubated on ice for 30 minutes. All specified concentrations are listed with each diagram in the results section. Each reaction was then loaded onto a nondenaturing low ionic strength PAGE (1X TBE, 30% Acrylamide, 2% bisacrylamide, 30% APS and temed). After electrophoresis the DNA was transferred to a hybridization membrane by Genescreen Plus (Boston, MA) and the results are seen on autoradiograph, after an exposure time of 30 seconds to 2 minutes Acid Killing Assay The acid killing assay was used to measure cell survival of the mutant strains ( hprK V265F, pstH S46A, pstH S46D) of S. mutans UA159. Each strain was grown overnight in (BHI) Brain heart infusion media (Becton, Dickinson and Company, Sparks, MD.). The next day cultures were diluted 1:50 and grown to optical density at 600 nm of 0.5. The cells were harvested and

PAGE 27

27 washed in 0.1 M glycine pH 7.0, then suspended in 0.1 M glycine pH 2.85. After incubation in 0.1 M glyci ne pH 2.85 for 0, 30, 60 and 90 minutes, samples were collected, serially diluted and plated to grow overnight. The next day the surviving colonies were counted. pH Drop E xperiment pH drop experiments were performed to assess the glycolytic activity in t he mutant strains ( hprK V265F, pstH S46A, pstH S46D) of S. mutans UA159 Overnight cultures, grown in BHI, were diluted 1:25 in brain heart infusion (BHI) and grown to optical density at 600 nm of 0.5, centrifuged and washed with cold distilled water. The c ells were then suspended in 1/10 of the original volume in 50 mM KCl/ 1 mM MgCl2 and titrated with 0.1 M KOH to pH 7.2. When the pH of the suspension was stable (no fluctuation was exhibited) at pH 7.2, 55.6 mM glucose was a dded to the culture and the pH wa s monitored every 30 seconds for 60 minutes using the pH application software and meter from HANA instruments (Woonsocket, RI). For assessment of final pH the same procedure was performed, except after addition of the 55.6 mM glucose, the cultures were shaken on the rocker for 1.5 hours and the final pH was evaluated using the above mentioned pH meter. PTS A ssay The Kornberg and Reeves method was used (with modifications) to measure oxidation of NADH in a phosphoenolpyruvate dependent manner in the muta nt strains ( hprK V265F, pstH S46A, pstH S46D) of S. mutans PEPphosphotransferase activity was specified in nmole of NADH hydrolyzed min1 (mg1 total cell protein). Strain s to be assayed were grown over night in Tryptone vitamin media (TV) (Burne & Penders, 1992) and 0.5% of appropriate sugar (either glucose, fructose or mannose). The overnight cultures were diluted 1:25 and harvested after grow th to optical density at 600 nm of 0.4. Cells were then washed with 100 mM Na K PO4 buffer, which contained 5 mM MgCl2 and suspended in this buffer to 1:20 of the original

PAGE 28

28 volume. Permeabilization of the cells was achieved by the addition of 100 l of 1: 9 toluene:acetone, then this mixture was vortexed for 2 minutes and placed on ice for 2 minutes and repeated. A 50 ml Solution A was made containing (5 ml of 0.7 mg/ml NADH, 0.5 ml of 1 M NaF, 40.5 ml 100 mM Na K PO4 buffer with 5mM MgCl2, 0.5 ml LDH). For assaying of PEPdependent phosphotransferase activity the following mixture was made (10 l of 100 mg ml1 PEP, 10 l of 1 M appropriate sugar substrate (either glucose, fructose or mannose), 930 l of the above mentioned Solution A and 50 l of perme abilized cells (in this order to control reaction start time). The reaction was allowed to go for 2 minutes while measurements of NaOH hydrolyzation were taken.

PAGE 29

29 Table 2 1. Primers used in this study Primers Sequence Application HprKV265F 5 5' CCACGTATT CGCATTCCGTTTAAAACTGGACGAAAT GT 3' Mutation in hprK HprKV265F 3 5' ACATTTCGTCCAGTTTTAAACGGAATGCGAATACGT GG 3' Mutation in hprK HprK 1 5' GCCGCGTAAACGAAAAGATGCTGAA 3' Amplification of hprK HprK 4 5' CCAGAACAGCAAAGGCAATAGCAA 3' Amplification of hprK HprKV26 5F 5MAMA 5' GTTAAAATTCCACGTATTCGCATTCTGG 3' MAMA PCR HprS46A 5 5' GCAGTAAACCTTAAGGCAATTATGGGTGTTATG 3' Mutation in pstH HprS46A 3 5' CTCATAACACCCATAATTGCCTTAAGGTTTACT 3' Mutation in pstH Mut35 5' AGCAGTAAACCTTAAGCACATTATG 3' Mutation in pstH Mut53 5' A CACCCATAATGTCCTTAAGGTTTAC 3' Mutation in pstH Hpr 5 5' GTGAAATTCATCCAGCCCTCAGTTAT 3' Amplification of pstH Hpr 3 5' GTGTACGTGCCATAATAGCAGAATGACTT 3' Amplification of pstH HprS46A 3MAMA 5' CACCAAGGGTCATAACACTAATCGA 3' MAMA PCR HprS46D 3MAMA 5' CACCAAGGC TCATAACACCCATAGTT 3' MAMA PCR HprK5 BamH1 5' CTTTTAAAGCGGATCCCCCC 3' Protein Expression HprK Pst1 5' GGAATACCTGCAGATGGCC 3' Protein Expression Hpr5 BamH1 5' ATGGATCCGCTTCAAAAGATTTTCAC 3' Protein Expression Hpr3 Sal1 5' TAGTCGACCCTCTTCTGCTTGTGTAT 3' Pro tein Expression ManL ep5 5' AAATATTTAAAAGGATCCAGAACAA 3' Protein Expression ManL ep3 5' GCGATGATCCTAGGCAAAAT 3' Protein Expression CcpA ep5 5' CCAATGGATCCGTAATTTTCA 3' Protein Expression CcpA ep3 5' TGGATTAGCTCCTAGGTAAAATGG 3' Protein Expression

PAGE 30

30 Table 21. Continued Primers Sequence Application FruA5 Biotin 5' 5Biosg/ATGGAAGATAGATAGCGATTT 3' EMSA Probe FruA5 5' ATGGAAGATAGATAGCGATTTGGTAT 3' EMSA Probe FruA3 5' TTAAAATGTTGTAAGCGCT ATCTTAT 3' EMSA Probe Mcre3 5' TTAAAATGTTTTAGGTACCATCTTAT 3' EMSA Pro be 5 Biotin ftf 5' 5Biosg/TAGCTAGTGGACAGACTCTG 3' EMSA Probe Pftf5 5' GGGGATCCTAGCTAGTGGACAGACTCTG 3' EMSA Probe Pftf3 5' AACTGCAGTTTCCATTAGCAAACCTCC 3' EMSA Probe 5 Biotin gtfbc 5' 5Biosg/CGACAATGGTGGGTACT 3' EMSA Probe Pgtfb5 5' ATGCATCCGACAATTGTGGT GGGTAC 3' EMSA Probe Pgtfb3 5' CGCTGCAGCTTGTTCATTAACCTCC 3' EMSA Probe Table 2 2. Bacterial strains and growth media Bacterial Strains Growth Media Escherichia coli M15 Luria Broth Escherichia coli M15 : p QE 30 : ccpA Luria Broth Escherichia coli M1 5 : p QE 30 : manl Luria Broth Escherichia coli M15 : pQE 30 : pstH Luria Broth Escherichia coli M15 : p QE 30 : hprK Luria Broth Streptococcus mutans UA159 Brain Heart Infusion Medium Streptococcus mutans UA159 : p levD cat Brain Heart Infusion Medium Stre ptococcus mutans UA159 : plevD cat : pstH S46D Brain Heart Infusion Medium Streptococcus mutans UA159 : plevD cat : pstH S46A Brain Heart Infusion Medium Streptococcus mutans UA159 : plevD cat : hprK V265F Brain Heart Infusion Medium

PAGE 31

31 Figure 21. MAMA PCR. Mismatch amplification mutation analysis (MAMA) PCR was used to verify point mutations in the S. mutans genome. Mutations were done by recombinant PCR using S. mutans genomic DNA and primers containing a mutation similar to the illustration above. To assure the presence of a mutation MAMA PCR was performed. A mutation from TGG to CGG will not affect read through of the MAMA primer due to the two mismatched nucleotides. If no mutation is formed, therefore wild type DNA is the product, read through of the MAMA primer is allowed. A wild type 5 and 3 primer are also added to the reaction, the length of the product will depend on whether a mutation in the genome is present or not. A full length product suggests a mutation is present since there is no read through of the test primer. No mutation, or read through of the test primer will result in a product that is half the length of the mutant product. Arrows represent primers.

PAGE 32

32 Figure 22. Model of regulation. HPrHis15P controls the upta ke of sugar into the cell via the PTS in a positive manner, while HPrSer46 P negatively controls this uptake. If HPrSer46 P is high inside the bacterial cell there is a reduction in the amount of HPrHis15 P available for use in the PTS, thereby, decreasin g PTS activity. This was observed in the ptsH S46D and hprK V265F mutants. Decrease in PTS activity causes a decrease in glycolytic activity and also decreases the expression of important catabolic genes that are under the negative control of CcpA. An inc rease in CcpA activity would decrease ManL and FruI expression causing a decrease in mayor regulatory two component systems. Since phosphate sugars are also involved in CcpA regulation, they too would cause a fluxuation in CcpA regulated expression when glycolysis is altered.

PAGE 33

33 CHAPTER 3 IN VITRO ASSESSMENT OF THE BI NDING CHARACTERISTICS OF PURIFIED CCPA WITH THE FRUA PROMOTER OF S. MUTANS UA159 Introduction In many organisms CcpA, a LacI family transcriptional regulator, is known for its ability to regul ate the expression of genes whose promoters contain cre sequences (Abranches et al., 2008, Browngardt et al. 2004, Zeng & Burne, 2008, Lorca et al., 2005) Although the nomenclature of transcriptional regulators o f the LacI family suggests they are repressors, CcpA has been seen to have the ability to also facilitate the activation of transcription. Activation or repression of gene transcription by CcpA is dependent on the location of the cre sequence WWTGNAARCGNW WWCAWW (R stands for G or A) located in the promoter of the gene it is regulating. In order for CcpA to activate transcription, it would need to bind a cre sequence located upstream of the 35 region of the gene promoter. To repress transcription, CcpA w ould bind a cre sequence located downstream of the 35 region. For example, data from L. lactis shows CcpA dependent activation of the pepQ gene, encoding prolidase, in which the cre is found upstream of the 35 region (Zomer et al. 2007) Transcriptional data of the ackA gene, encoding acetate kinase in B. subtilis, has also suggested activation via regulation by CcpA binding to the cre sequence located upstream of the 35 region of the the AckA promoter (Turinsky et al. 1998) Data from the S. mutans UA159 str ain show CcpA de pendent activation of the fructosyltransferase ( ftf ) and glucosyltransferase ( gtfB ) genes, whose cre sequences are both located upstream of the 35 region (Browngardt et al., 2004) Similarly, data collected from w ild type S. mutans UA159 and a CcpA deficient mutant demonstrate that CcpA behaves accordingly as a repressor, by repressing the fructan hydrolase ( fruA) gene, whose cre is located downstream of the 35 region (Abranches et al., 2008)

PAGE 34

34 Allosteric effectors, like glycolytic intermediates, are known to enhance CcpA activity (Gosseringer et al. 1997, Deutscher et al. 1995) A study done in B. megaterium links glycolytic activity to carbon catabolite repression (CCR) in gram positive ba cteria (Deutscher et al., 1995) For example, it has been shown that glycolytic intermediates stimulate HPr kinase to phosphorylate HPr at the serine 46 residue, facilitating P ser46 HPr/CcpA complex formation. I t is known that the formation of this complex promotes CcpA regulation or carbon catabolite repression (CCR). In B. megaterium the formation of this complex is sensitive to the phosphorylation of P His15 HPr (involved in the PTS), suggesting a link betwee n carbon catabolite repression and PTS transport activity. If we consider carbohydrate uptake via PTS and the sequence of events from which the HPr/CcpA complex arises, we can predict that increase in the amount of carbohydrates brought in via PTS, would result in an increase in the amount of HPr/CcpA complexes made. Since glycolytic intermediates rely on carbohydrate uptake for gycolysis, the amount of (F 1,6bP, G 6P and F 6 P) will change with the amount of available sugar, thereby altering the amount of P Ser46 HPr and the effects on transcription by CcpA. Therefore, in addition to looking at CcpA binding, the effect of allosteric effectors on CcpA binding was also investigated. The allosteric eff ectors used are unphosphorylated HPr, HPr phosphoryla tion mimic (HPr(S46D)), in vitro phosphorylated HPr and glycolytic intermediates (G 6P, F 6P and F 1,6bP). The goal of these experiments was to determine the binding characteristics of CcpA with the fruA gene of S. mutans Results In vitro Binding Anal ysis of S. mutans CcpA to the fruA Promoter with Addition of Phosphate Sugars Prior to this study, microarray data gathered by form er residents of the laboratory showed definitive differences between genes expressed by wild type S. mutans UA159 and the Cc pA -

PAGE 35

35 deficient strain (Abr anches et al., 2008) Many of the genes that were found to be differentially expressed by the loss of CcpA where associated with energy metabolism and PTS function. From the many genes seen to be differentially regulated in the microarray, fruA was chos en to be assayed for binding by the S. mutans UA159 CcpA protein. This gene was chosen because of its role in carbohydrate metabolism and also its ability to be a virulence attribute of S. mutans by breaking down fructan polymers allowing for its survival during periods of starvation. The fruA gene was chosen for the following experiments since a link exists between CcpA and its regulation as just mentioned. Due to the variability which results from the quantification method chosen to represent the data collected via EMSA, statistical significance is not available for these data. Instead a representative gel and quantitative graph is shown for all of the following EMSA experiments. The experiments shown were repeated a minimum of three times, and in many cases significantly more repetitions were performed. The results as reported were consistent in each gel, although the quantitative method (denisitometry) did not show statistical significance when either t test or non parametric analyes were conducted. This quantitative method, measuring pixel intensity, is subject to many variables (exposure time, light intensity, quality of radiographic film, etc). Although many steps were taken to diminish the effects of these variables, p values of less than 0.05 c ould not be obtained. In the future, the molecular interactions described in these experiments will need to be evaluated using a more sensitive and quantitative method, e.g. Biacore method, to accurately measure changes in affinity of CcpA for its targets in response to the presence of allosteric effectors. Data suggests that the 6X His CcpA protein specifically bind the cre sequence (with strong homology to the consensus sequence) in the fruA gene (Abranches et al., 2008) The fruA

PAGE 36

36 gene contains two consecutive cre sequences within its promoter (one of strong homology and one of weak homology to the consensus sequence. In order to address the binding specificity by CcpA to the cre sequence of strong homology to the consensus sequence in the fruA gene, a mutation was construct ed in only the cre with strong homology. Purified CcpA protein was seen to bind only the wild type cre sequence of strong homology to the consensus sequence. No binding was observed to the cre containing a mutati on in this sequence For the following ex periment a 60bp region of the fruA promoter of S. mutans which included two wild type cre consensus sequences, was PCR amplified using biotinylated primers. The 6X His CcpA protein of S. mutans was purified from E. coli, using a nickel column. All binding reactions were incubated for 30 minutes on ice and the reactions were loaded onto a polyacrylamide gel to observe shift caused by binding. Results suggests binding of the 6X His CcpA protein to the fruA promoter. This was expected as the fruA gene has two cre sequences incorporated in the promoter region. Phosphate sugars were also tested for possible enhancement of binding by the CcpA protein to the fruA promoter. Data from Bacillus megaterium suggest that g lucose 6 phosphate triggers CcpA binding to the cre sequence of the xyl promoter (Gosseringer et al., 1997) When tested in S. mutans no significant difference was observed. Only slight differences were observed when F 1,6bP (Abranches et al., 2008) or G 6P were added (Figur e 3 1 and 32). In vitro Binding Analysis of S. mutans CcpA to the fruA Promoter with Addition of Phosphate Sugars and HPr Data suggests the presence of HPr ser46 P enhances CcpA binding to the xyl promoter of B. megaterium (Gosseringer et al., 1997) In order to test if the addition of the HPr protein enhances the binding of CcpA to the fruA promoter of S. mutans binding reactions with low concentrations (13.5 and 34 pmole) of the 6X His CcpA protein were examined. 6X His HPr

PAGE 37

37 was added to the reactions containing the fruA promoter and either (13.5 and 34 pmole) of CcpA and either (F 1,6bP, F 6 P or G 6P). Results show a significant increase in binding of CcpA to the cre of the fruA promoter after the addition of HPr to the binding reactions (Figure 32). A noticeable increase was seen when HPr was added to the reaction containing (F 1,6bP, F 6P or G 6P shown in columns 4 and 5, 6 and 7, 8 and 9, respectively) when compared to the reaction containing CcpA on ly (represented in c olumns 2 and 3) (Figure 32). In vitro Binding Analysis of S. mutans CcpA to the fruA Promoter with A ddition of HPr Because the addition of HPr had effects on CcpA binding and there are several species of differentially phosphorylate d HPr found in S. mutans, binding reactions including 60 pmole of either 6X His HPr, 6X His HPrS46D or 6X His HPrserPO4 were considered for enhancement of CcpA binding to the fruA promoter of S. mutans Although no enhancement in the binding of 6X His Ccp A to the fruA promoter was seen with the addition of 6X His HPr (represented in columns 4 and 5) and 6X His HPrS46D (represented in columns 6 and 7) (Figure 33) A significant increase in binding was observed consistently, when the 6X His HPrserPO4 protei n was added to the above reaction of 6X His CcpA and the fruA promoter of S. mutans (represented in columns 8 and 9) (Figure 33). This experiment was repeated with a wider range of concentrations of the CcpA protein, including low concentrations and the same increase in shift was observed after the addition of 6X His HPrserPO4 protein (Figure 3 4). Summary Glycolytic intermediates and other allosteric effectors have been seen to alter the ability of CcpA to bind certain promoters. In these studies the effects of glycolytic intermediates (F 1,6bP, F 6P and G 6P) on CcpA binding to the S. mutans fruA promoter, were observed. It was first assessed that 6X His CcpA has the ability to bind the cre of the fruA promoter. Then the ability of glycolytic inte rmediates (F 1,6bP, F 6P and G 6P) to enhance or repress CcpAs

PAGE 38

38 ability to bind was assessed. These glycolytic intermediates alone had minimal effect on CcpA binding to the fruA promoter. Then the HPr protein, in its various forms, was investigated for its possible effects on CcpA binding. Several forms of HPr including (HPr, HPrS46D mutant and in vitro serine 46 phosphorylated HPr) were also tested. HPr and the HPrS46D mutant showed no enhancement on the binding of CcpA, but serine 46 phosphorylated HPr showed a significant increase in CcpA binding to the fruA promot er.

PAGE 39

39 1 2 3 4 5 6 7 8 9 Figure 31. EMSA of CcpA and the biotinylated fruA promoter and phosphate sugars. The fruA promoter consists of a 60bp fragment containing two consecutive cre sequences. All columns contain 8 fmole of fruA probe Column 1 contains fruA probe alone. Columns 2 and 3 contain 34 pmole and 102 pmole of purified 6X His CcpA of S. mutans respectively Columns 4 and 5 contain 6X His CcpA in the same concentrations as mentioned previously and 2 mM F 1,6bP. Columns 6 and 7 also contain 6X His CcpA in the same concentrations as mentioned p reviously and 2 mM F 6P. Columns 8 and 9 also contain 6X His CcpA in the same concentrations as mentioned previously and 2 mM G 6P. A low ionic strength polyacrylamide gel was used to observed migration of bound products on radiograph. Quantitative re sults shown below image, represent shift as percent pixel intensity.

PAGE 40

40 1 2 3 4 5 6 7 8 9 Figure 32. EMSA of CcpA and t he biotinylated fruA promoter, including HPr and phosphate sugars. The fruA promoter consists of a 60bp fragment containing two consecutive cre sequences. All columns contain 8 fmole of fruA probe Column 1 contains fruA probe alone. Columns 2 and 3 c ontain 13.5 pmole and 34 pmole of purified 6X His CcpA of S. mutans respectively Columns 4 and 5 contain 6X His CcpA in the same concentrations as mentioned previously, 2 mM F 1,6bP and 60 pmole 6X His HPr of S. mutans Columns 6 and 7 also contain 6X His CcpA in the same concentrations as mentioned previously, 2 mM F 6P and 60 pmole 6X His HPr of S. mutans Columns 8 and 9 also contain 6X His CcpA in the same concentrations as mentioned previously, 2 mM G 6P and 60 pmole 6X His HPr of S. mutans A low ionic strength polyacrylamide gel was used to observed migration of bound products on radiograph. Quantitative results shown below image, represent shift as percent pixel intensity.

PAGE 41

41 1 2 3 4 5 6 7 8 9 Figure 33. EMSA of CcpA and the biotinylated fruA promoter, including variants of HPr. The fruA promoter consists of a 60bp fragment containing two consecutive cr e sequences. All columns contain 8 fmole of fruA probe Column 1 contains fruA probe alone. Columns 2 and 3 contain 34 pmole and 102 pmole of purified 6X His CcpA of S. mutans respectively Columns 4 and 5 contain 6X His CcpA in the same concentration s as mentioned previously and 60 pmole 6X His HPr of S. mutans Columns 6 and 7 also contain 6X His CcpA in the same concentrations as mentioned previously and 60 pmole 6X His HPrS46D of S. mutans Columns 8 and 9 also contain 60 pmole 6X His CcpA in the same concentrations as mentioned previously and 60 pmole 6X His HPrserPO4 of S. mutans A low ionic strength polyacrylamide gel was used to observed migration of bound products on radiograph. Quantitative results shown below image, represent shift as pe rcent pixel intensity.

PAGE 42

42 1 2 3 4 5 6 7 Figure 34. EMSA of CcpA and the biotinylated fruA promoter, including low CcpA concentrations. The fruA promoter consists of a 60bp fragment containing two consecutive cre sequences. All columns contain 8 fmole of fruA probe Column 1 contains fruA probe alone. Columns 2, 3 and 4 contain 13.5 pmole, 34 pmole and 68 pmole of puri fied 6X His CcpA of S. mutans respectively Columns 5, 6 and 7 contain 6X His CcpA in the same concentrations as mentioned previously and 60 pmole 6X His HPrserPO4. A low ionic strength polyacrylamide gel was used to observed migration of bound products on radiograph. Quantitative results shown below image, represent shift as percent pixel intensity.

PAGE 43

43 CHAPTER 4 IN VITRO BINDING ASSESSMENT OF THE INTERACTIONS B ETWEEN PURIFIED CCPA AND THE GTFB PROMOTER OF S. MUTANS UA159 Introduction The ability of S. mut ans to adhere to the tooth surface is essential for its ability to cause pathogenicity. Glucosyltransferases are enzymes that contribute to glucan (polysaccharides consisting of only glucose residues) biosynthesis. These surface structures allow the bact eria to adhere to the tooth pellicle while also contributing to the formation of biofilm, thereby, enhancing the environmental protection mechanisms of the bacteria. S. mutans is known to contain three different types of GTFs (GTF I, GTF SI and GTFS) whi ch are encoded by the gtfB, gtfC and gtfD genes, respectively (Terao et al. 2009) As mentioned previously, microarray data showed that CcpA is responsible for the transcriptional regulation of many genes involved in sugar transport. One of the genes that was seen to be upregulated by CcpA, in glucose, is glucosyltransferasesI or gtfB. gtfB processing results in a 165 KDa protein, glucosyltransferaseI, involved in cell adhesion and energy metabolism. As much a s a 10 fold reduction in gtfB expression was observed in an S.mutans ccpA deficient mutant strain, grown in different environmental conditions (varying pH and glucose availability) (Browngardt et al., 2004) A no vel finding suggests that manL, a component of the EIIman PTS permease, may influence CcpA dependent gene regulation directly. Previous studies have suggested that the EIIABman or ManL, could be involved not only in sugar transport, but also in gene regula tion (Zeng & Burne, 2008) A manL deletion mutant (JAM1) was created and cat fusion activity of the glucosyltransferase gene was examined. Result s of gtfBC activity in response to deletion of manL shows a decrease in gtfBC gene activity in strains lacking ManL (Abranches et al., 2003) (Figure 4 1). It has also been shown that S. mutans strains that lack ManL do not exhibit diauxic

PAGE 44

44 growth (Abranches et al., 2003) Therefore it seems that ManL is in volved in CCR. Data has shown that ManL influences the expression of gtfBC but the mechanism of how it does this is still unclear. Microarrays of JAM1 revealed that ManL in S. mutans has a role in regulation of genes involved in energy metabolism. This regulation may be due to influence by ManL on the activity of transcription factors, like CcpA (Abranches et al., 2006) The reason the glucosyltransferase genes ( gtfB ) was chosen for this study is because it is required for the virulence of S. mutans, allowing it to produce glucans through the use of environmental sucrose, which is an integral constituent in biofilm formation. The purpose of the following experiments was to assess the binding of CcpA to the singl e cre consensus sequence located in the gtfB promoter, also to assess the influence of ManL, if any, on CcpA binding. Results In vitro Binding Analysis of S. mutans CcpA to the gtfB Promoter with A ddition of ManL The gtfB gene contains one cre sequence l ocated in the 94 to 86 region relative to the ATG sequence, and is known to be positively regulated by CcpA. In figure 42, c olumn 1 is the negative binding control showing only the biotinylation reaction was successful. The 6X His ManL protein was also included in a binding reaction with the gtfB gene in columns 2 and 3, but did not result in binding on its own. Data in column 4 and 5 suggest that 6X His CcpA is binding to the promoter of the of the gtfB gene, seen by a shift in these lanes Columns 6 and 7 show that the addition of 6X His ManL to the binding reactions between CcpA and gtfB results in no enhancement in binding of 6X His CcpA to the gtfB promoter. An in vitro phosphorylated HPr protein (6X His HPrserPO4 ) of S. mutans (resulting in a serine 46 phosphorylated HPr) was also included in the 6X His CcpA binding reaction to the gtfB promoter. A slight decrease in binding of the 6X His CcpA protein to the gtfB promoter was observed in columns 8 and 9, when 6X His ManL and 6X His HPrserPO4 w ere both added to the reactions. No binding of

PAGE 45

45 serine 46 phosphorylated HPr to gtfB was observed when 6X His HPrserPO4 was added to the gtfB promoter alone (represen ted in column 10) (Figure 41 ). In vitro Binding Analysis of S. mutans CcpA to the gtfB Promoter with A ddition of F 1,6bP, F 6P and G 6P Previous data suggest that phosphate sugars may enhance CcpA binding to DNA (Gosseringer et al., 1997, Deutscher et al., 1995) For this reason the above mentione d experiments were repeated with the addition of the following phosphate sugars; F 1,6 bP, F 6P and G 6P. The binding reactions containing CcpA and the gtfB promoter resulted in a shift, suggesting that CcpA binds to the cre sequence of the gtfB gene, as seen previously. A slight increase in binding of CcpA to the gtfB promoter was observed after the addition of F 1,6bP to the reaction (represented in columns 4 and 5). No consistent difference was seen resulting from the addition of F 6P (represented in columns 7 and 8). Finally, a decrease in binding was consistently observed when G 6P was added to the reactions (represented in columns 8 and 9) (Figure 4 2). Summary Glucosyltransferases are essential for S. mutans pathogenicity by allowing this organism to adhere to the tooth pellicle. Because gtfB contains a cre sequence in the promoter and there is evidence that this gene is CcpA regulated, it was chosen for evaluation of binding by purified S. mutans CcpA protein. The effects of the ManL protein on binding were also investigated. Data suggests that ManL could be involved in gene regulation by decreasing the activity of the gtfB gene. Results from this study suggest CcpA is binding to the cre sequence of the gtfB gene and that ManL has no cl ear effect on CcpA binding. Involvement of glycolytic sugars and the serine 46 phosphorylated HPr protein was also investigated and no difference was detected by the

PAGE 46

46 addition of HPr or F 6P, but a slight increase in binding was observed by the addition of F 1,6bP and a slight decrease was seen by the addition of G 6P.

PAGE 47

47 Figure 41. EMSA of CcpA and the biotinylated gtfB promoter, including ManL. The gtfB promoter consists of a 260bp fragment containing one cre sequence. All columns contain 8 fmole of gtfB probe Column 1 contains gtfB probe alone. Columns 2 and 3 contain the 8 fmole gtfB probe and 68 pmole and 136 pmole of 6X His ManL purified protein Columns 4 and 5 contain contain the 8 fmole gtfB probe and 34 pmole and 102 pmole of purified 6X His CcpA of S. mutans respectively Columns 6 and 7 also contain the 8 fmole gtfB probe, 6X His CcpA in the same concentrations as mentioned previously and 68 pmole of the 6X His ManL. Columns 8 and 9 contain the same as colum ns 6 and 7 plus t he addition of 60 pmole of 6X His HPr ser46 P A low ionic strength polyacrylamide gel was used to observed migration of bound products. Quantitative results shown below image, represent shift as percent pixel intensity.

PAGE 48

48 1 2 3 4 5 6 7 8 9 F igure 42. EMSA of CcpA and the biotinylated gtfB promoter, including phosphate sugars. The gtfB promoter consists of a 260bp fragment containing one cre sequence. All columns contain 8 fmole of gtfB probe Column 1 contains gtfB probe alone. Columns 2 and 3 contain the 8 fmole gtfB probe and 34 pmole and 102 pmole of purified 6X His CcpA of S. mutans respectively Columns 4 and 5 conta in the 8 fmole gtfB probe, 6X His CcpA in the same concentrations as mentioned previously and 2 mM F 1,6bP. Columns 6 and 7 also contain the 8 fmole gtfB probe, 6X His CcpA in the same concentrations as mentioned previously and 2 mM F 6P. Columns 8 and 9 contain the 8 fmole gtfB probe, 6X His CcpA in the same concentrations as mentioned previously and 2 mM G 6P. A low ionic strength polyacrylamide gel was used to observed migration of bound products. Quantitative results shown below image, represent shift as percent pixel intensity. CHAPTER 5

PAGE 49

49 PHENOTYPIC ASSESSMENT OF THE EFFEC TS OF SELECTED PTSH AND PTSK POINT MUTATIONS ON THE PHY SIOLOGY OF S. MUTANS UA159 Introduction Histidine containing phosphocarrier protein (HPr), the product of the ptsH gene, is considered an important component of the PTS, and is also essential in CcpA activation. The PTS pathway is used by many bacteria as their main carbohydrate uptake system. This phosphorelay system is executed by PEP dependent phosphorylation of Enzyme I. Enzyme I donates the phosphate to HPr, phosphorylating HPr at the histidine 15 residue. The phosphate then passes to a membrane bound complex, Enzyme II, which is able to phosphorylate external sugars allowing their entrance into the cell. Once sugar i s metabolized via glycolysis, glycolytic intermediates aid in the activation of histidine containing phosphocarrier protein kinase (HPrK), which in turn phosphorylates HPr at the serine 46 residue. This serine 46 phosphorylated form of HPr binds and activates the global transcriptional regulator protein (CcpA). The oral cavity undergoes changes in carbohydrate source and availability, pH and oxygen. Therefore, the ability of S. mutans to survive these fluctuations is essential for pathogenesis. We know that environmental stimuli regulate the expression of genes associated with virulence in S. mutans. Two of the most important virulence attributes in S. mutans are its abilities to be both acidogenic and aciduric. Data show that differences in the amou nt of glucose available to the cell accounts for differences in the amount of intracellular polysaccharides (glycogen storage) and lactate production (Abranches et al., 2008) 78% higher PDH activity was observed in an S. mutans CcpA deficient strain, grown in glucose, when com pared to wild type This suggests the involvement of CcpA in repression of pyruvate dehydrogenase (PDH) expression, r esulting in a CcpA mediated shunt of the alcohol pathway towards the lactic acid pathway. Low glucose conditions also show an increase toward the lactic acid pathway. The data imply an effect on

PAGE 50

50 CcpA mediated aciduricity, by the presence of glucose. Consequently, when glucose concentrations are decreased, CcpA regulation is increased and F ATPase concentration is increased, thereby, allow ing an increase in acid tolerance (Nascimento e t al., 2004) A p revious experiment done with both wild type UA159 and TW1 (a CcpA deficient strain) suggests tha t TW1 is more acid resistant. The d oubling time of the TW1 strain was decreased when compared to wild type when challenged with acid (growt h at low pH). It is known that S. mutans can grow and carry out glycolysis at low pH and can also cause acid tolerance One way it is able to do this is by up regulation of F ATPase activity in the cell. A twofold increase in F ATPase activity in S. mut ans UA159 growing at pH 5 compared to that in cells grown at pH 7, has been seen. Th e study by Nascimento et. al. also shows that cells of Streptococcus mutans had higher PTS activity at pH 7 rather than pH 5 (Nascimento et al., 2004) Cells seem to be shutting down genes involved in growth and meta bolism for genes important in survival. Because of the multitude of functions the HPr protein performs, specifically the influence it has on CcpA, the goal of this study was to investigate the effects of mutations in HPrK and HPr on glycolytic rate, acid tolerance and PTS activity. Results Glycolytic Rates The intracellular pH of bacterial organisms stay s relatively constant regardless of environmental pH changes, but in the case of S. mutans the internal pH has been observed to reach 0.5 to 1 unit diff erence from extracellular pH. A pH drop assay was performed to determine the quality and intensity of an acid tolerance response mounted by the mutant strains ( hprK V265F, pstH S46A, pstH S46D) of S. mutans UA159 when compared to the UA159 wild type after gr owth in BHI.

PAGE 51

51 Since loss of CcpA enhances acid tolerance as seen in the Abranches, et al. 2008 paper, it was assumed that the pstH S46D mutant strain would exhibit better acid tolerance, since the mutation of serine to aspartic acid provides a negative charg e which mimics a constitutively phosphorylated HPr protein at the serine 46 residue. An increase in acid tolerance was also expected from the HPrK V265F mutant. Since this mutation of valine to phenylalanine shunts the ability of the histidine containing phosphocarrier protein kinase/phosphatase (HPrK) of its phosphatase activity, allowing for a constitutive kinase. This kinase activity will in essence phosphorylate the available HPr at the serine 46 residue, increasing the concentration of this phosphorylated form. Therefore, it was speculated that both these strains would be able to increase the activation of CcpA compared to wild type The glycolytic rates of cultures of the three mutant strains (hprK V265F, pstH S46A, pstH S46D) and of S. mutans UA159 wild type grown in BHI to an optical density at 600 nm of 0.5 were assayed. Although results indicate an increase in the initial drop in pH for the pstH S46D mutant, after 25 minutes the rates of all strains were comparable (Figure 5 1). This could be exp lained by the initially higher concentration of the activated HPr protein in the pstH S46D mutant. O nce the sugar gets metabolized and the kinase is able to phosphorylate HPr in the hprK V265F mutant, therefore, the levels of activated HPr protein would be similar in these two strains after some time. It was also expected that the pstH S46A (serine residue 46 to alanine) mutant would have decreased acid tolerance because of its unphosphorylatable nature. Results for the pstH S46A mutant, showed a slightly lower glycolytic rate in the first ten minutes, but ultimately a comparable rat e to that of wild type (figure 5 1). These results may indicate that unphosphorylated HPr protein (although possibly with less affinity) is also able to bind and activate CcpA.

PAGE 52

52 Final pH Also examined was the final pH of these strains after incubation with 55.6 mM glucose for 1.5 hours. The data (Figure 52) is a representative sample of 5 different tria ls. The results show the final pH for the wild type strain was the lowest a t about 3.3 (Figure 52). The results from the pstH S46A mutant were expected to mimic what was observed by the TW1 (CcpA deficient) strain in the study mentioned previously. The f inal pH for the pstH S46A mutant strain was the highest, at 3.6, although it was expected to be the lowest since it would presumably lack activated CcpA protein (or at least contain a lower amount than wild type or than the pstH S46D mutant) (Figure 5 2). No significant difference was seen between the pstH S46D and hprK V265F mutants averaged between 3.4 and 3.5) although the final pH was slightly higher than that of wild type which was expected since they presumably have an increased amount of active HPr which in turn activates CcpA (Figure 5 2). A higher active CcpA concentration means less acid tolerance and therefore less acid production or lower levels of intracellular polysaccharides (IPS) Ability to be Acid Tolerant As mentioned above the lack of CcpA enhances acid tolerance in S.mutans Therefore, acid tolerance was measured in the HPrK and HPr mutant strains to see what impact, if any, HPr directly has on CcpA dependent acid tolerance. Cell survival was measured for the mutant strains (hprK V265F, pstH S46A, pstH S46D) and for S. mutans UA159 wild type, after exposure to pH 2.85. The results show an increase in acid tolerance for pstH S46D of almost one log higher than the other strains (Figure 5 3). The results suggest that the pstH S46D mutation effects S. mutans survival after an acid attack. This may not be directly CcpA dependent as a slower growth phenotype was observed with this strain and it also displays a high frequency of reversion to wild type which might be due to selective pressure against the high concentration of

PAGE 53

53 serine phosphorylated mimic of HPr. Sinc e HPr is also involved in the PTS when phosphorylated at the histidine 15 residue, the higher concentration of HPr phosphorylated at the serine 46 residue, might decrease the ability to form histidine 15 phosphorylated HPr. Although a double phosphorylate d species of HPr (HPr phosphorylated at both the serine 46 and histidine 15 residue) has been observed, the role is uncertain. The data for UA159 wild type and the mutant strains ( pstH S46A and hprK V265F) were almost identical (Figure 5 3). No significant difference was seen in their ability to form an acid tolerance response (withstand an acid attack). PTS Activity PTS activity has also been seen to be influenced by the environment the cells are grown in. Since the role of CcpA appears to change depend ing on the environment (like carbohydrate availability), we want to know how the PTS in S. mutans responds to the fluctuations in activated CcpA via manipulation of HPr. A correlation between PTS permease activity and acid tolerance was seen when ACID TOL ERANCE was measured in the TW1 (CcpA deficient strain). An increase in acid tolerance resulted without an increase in ATPase gene expression, but with an inc rease in PTS activity. C onsider what CcpA does, it regulates genes that are important in sugar me tabolism, it is likely that CcpA and PTS activity are linked. The genes that CcpA regulated affects what sugars enter the cell by repressing the expression of certain PTS permease proteins. The sugar that enters the cell via PTS will in return influence CcpA regulation. Therefore we can look at PTS activity in the context of sugar related influences on CcpA regulation. The Kornberg and Reeves method was used (with modifications) to measure oxidation of NADH in a phosphoenolpyruvate dependent manner in the mutant strains ( hprK V265F, pstH S46A, pstH S46D) of S. mutans The data show higher overall PTS activity when the strains were grown overnight in fructose than when grown in glucose (Figures 54 and 55). The results for the HPr mutants were compared wit h wild type S. mutans UA159. Previous data suggested

PAGE 54

54 an increase in PTS activity for the CcpA deficient strain. Therefore, an increase was expected for the pstH S46A mutant, but was not observed. Most PTS data collected for this mutant show comparable activity to wild type and the only significant difference s seen in this mutant were slight decreases in the PTS activity especially when assayed in mannose (Figure 5 4 and 55). This suggests that unphosphorylated HPr or CcpA alone may be able to compensat e when HPr serPO4 (HPr phosphorylated at the serine 46 residue) is not available. Lower PTS activity of all three transporters (glucose, fructose and mannose) was observed for all mutant strains grown in glucose, except pstH S46A when assayed in fructos e shows comparable activity to wild type No significant difference was observed in any mutant when grown in fructose, except mannose PTS of pstH S46A was decreased. Although the pstH S46D and hprK V265F mutants show expected decreased PTS activity when gr own in glucose, there was no significant difference when compared to wild type when grown in fructose. Summary Mutations to the pstH and hprK genes of S. mutans UA159 obtained via MAMA PCR were assayed for physiological and enzymatic activity. The glycol ytic rates of mutants ( hprK V265F, pstH S46A, pstH S46D) of S. mutans and of the UA159 wild type were assessed after exposure to 55.6 mM glucose. The glycolytic rate for pstH S46D was slightly faster initially. The glycolytic rates of pstH S46D and hprK V265F were comparable to that of wild type although the final pH after 1.5 hours was higher for all mutants, meaning that the mutant strain probably contained a higher concentration of intracellular polysaccharides than did wild type When ACID TOLERANCE was assessed, pstH S46D, did show an increased ability to survive an acid attack, by about one log unit higher percent survival when compared to wild type and to the hprK V265F and pstH S46A mutants. No significant difference was observed as a

PAGE 55

55 result of the hprK V 265F and pstH S46A mutations. The resu lts of the PTS activity assay suggest lower activity of all three sugar transporters (glucose, fructose and mannose) for the mutant strains grown in glucose, when compared to wild type and no significant difference whe n grown in fructose.

PAGE 56

56 Figure 51. Glycolytic rate assay. Glycolytic rates of S. mutans wild type UA159 and the HPr K and HPr mutant strains ( hprK V265F, pstH S46A, pstH S46D) grown overnight in BHI broth. Culture was diluted 1:25 the next morning and grown to an optical density at 600 nm of 0.5 and cells were suspended at 1/10 of the original volume with 50 mM KCl/ 1 mM MgCl2 and titrated with 0.1 M KOH to pH 7.2. The pH was measured every 30 seconds for 30 minutes. Data values are averages of three separate runs. Time (minutes)

PAGE 57

57 Figure 52. Final pH assay. Final pH aft er 1.5 hours after exposure to 55.6 mM glucose of S. mutans wild type UA159 and the HPr K and HPr mutant strains ( hprK V265F, pstH S46A, pstH S46D). Cells were grown overnight in BHI broth, dilut ed 1:25 the next morning and grown to an optical density at 600 nm of 0.5. Cells were suspended at 1/10 of the original volume with 50 mM KCl/ 1 mM MgCl2 and 55.6 mM glucose and were allowed to incubate for 1.5 hours before the final pH was measured. Dat a values are averages of three separate runs. UA159 pstHS46A pstHS46D hprKV265F

PAGE 58

58 Figure 53. Acid tolerance assay. Measure o f acid tolerance by cell percent survival after incubation in 0.1 M glycine pH 2.85 for 0, 30, 60, and 90 minutes (labeled T0, T30, T60, T90, respectively). C ells were grown overnight in BHI, diluted 1:50 the next morning and grown to optical density at 600 nm of 0.5 before re suspension at low pH. Values are comparable to at least three individual experiments.

PAGE 59

59 Figure 54. PTS activity grown in glucose. PTS activity measured in nmole of NADH hydrolyzed min1 (mg1 total cell protein). Cells of UA159, pstHS46A, hprKV265F, and pstHS46D (labeled as UA159, S46A, KVF and S46D, respectively), were grown overnight in BHI plus 0.5% glucose and diluted 1:25 the next morning. Each strain was grown to its respective mid log phase and cells were harvested and resuspended in 100 mM Na K PO4 buffer, which contained 5 mM at 1:20 of the original volume, then permeabilized using 100 l of 1:9 toluene:acetone while vor texing. Substrate for the assay was 1 M of the sugar (either glucose, fructose, or mannose). Values are means and standard deviations from three individual experiments. The asterisks indicate a significant difference when compared to wild type with a p value of less than 0.05. * *

PAGE 60

60 Figure 55. PTS activity grown in fructose. PTS activity measured in nmole of NADH hydrolyzed min1 (mg1 total cell protein). Cells of UA159, pstHS46A, hprKV265F, and pstHS46D (labeled as UA159, S46A, KVF and S46D, respect ively), were grown overnight in BHI plus 0.5% fructose and diluted 1:25 the next morning. Each strain was grown to its respective mid log phase and cells were harvested and resuspended in 100 mM Na K PO4 buffer, which contained 5 mM at 1:20 of the original volume, then permeabilized using 100 l of 1:9 toluene:acetone while vortexing. Substrate for the assay was 1 M of the sugar (either glucose, fructose, or mannose). Values are means and standard deviations from three individual experiments. The aster isks indicate a significant difference when compared to wild type with a p value of less than 0.05.

PAGE 61

61 CHAPTER 6 SUMMARY Streptococcus mutans is the principal etiological agent of human dental caries and can be a source of infective endocarditis (Durack et al., 1978, Franco et al., 1996, Banas, 2004) S. mutans metabolizes carbohydrates to produce a number of acids, via fermentation, including lactic acid. The lactic acid produced by S. mutans results in a localized pH decrease, causing subsequent demineralization of the tooth enamel, which leads to caries formation. Thus, understanding the mechanism by which S. mutans regulates carbohydrate catabolism is essential in the development of therapeutic tactics for preven ting and treating dental caries. Many genes involved in metabolism of carbohydrates are regulated by the global regulator, catabolite control protein A (CcpA), which is activated by serine46phosphorylated histidine containing phosphocarrier protein (HPr) (Henkin et al., 1991, Abbe et al., 1982, Abranches et al., 2008, Lorca et al., 2005) CcpA regulates gene expression by binding to the catabolic response elements ( cre ), located on the gene promoter regions of CCR sensitive genes (Miwa et al., 2000, Miwa & Fujita, 2001) CcpA is involved in the regulation of both the fructanase gene ( fruA ) and the glucosyltransferase ( gtfB) gene whose products are a fructan hydrolase and a glucosyltransferase enzyme, respectively. Glucosyltransferase and fructanase are both virulence attributes of S. mutans which allow this organism to adhere to teeth and persist during periods when sugars are not readily available for metabolism and allow them to form biofilm, respectively (Wexler et al., 1992, Abranches et al., 2008) The phosphoenol pyruvate (PEP) dependent phosphotransferase system (PTS) is the main carbohydrate intake system of oral bacteria. Enzyme I of the PTS donates the phosphate from PEP to the histidine 15 residue of HPr. HPr then donates this phosphate to the EII sugar permease complex. These permeases uptake sugars for metabolism via glycolysis. Glycolytic

PAGE 62

62 intermediates, like F 1,6 bP, have resulted in further activation of CcpA (Gosseringer et al., 1997) HPr is phosphorylated at the histidine 15 residue, for use in PTS, and can be phosphorylated at the serine 46 residue for use in gene reg ulation via CcpA (Deutscher et al., 2005, Christensen et al., 1999, Viana et al., 2000) For this reason several forms of the HPr protein were investigated in these studies. Previous data including a CcpA deficient strain of S. mutans suggested the possibility of a CcpA independent network of CCR, since it was seen that loss of CcpA did not eliminate diauxic growth (Abranches et al., 2008) On the other hand these data also suggested that CcpA does play a role in the regulation of both the fruA and gtfB genes. The fruA and gtfB genes contain cre sequences and require CcpA for expression, allowing S. mutans to thrive in the oral cavity. Gel shift assays were performed to determine whether CcpA binds the fruA and gtfB promoters. The results revealed that the CcpA protein binds the cre sequences of both the fruA and the gtfB promoters. These results suggest that CcpA does function in the direct regulation of these two genes. These experiments answered the question of whether or not CcpA directly binds to the cre sequence of genes in S. mutans since the results show that CcpA binds specifically to the cre of both the fruA and gtfB promoters. Since sugar phosphates have been shown to enhance binding of CcpA to the fruA promoter of B. subtilis (Gosseringer et al., 1997) the sugar phosphates (F 1,6bP, F 6P or G 6P) were tested for possible enhancement of binding between the CcpA protein and the fruA promoter of S. mutans The addition of these phosphate sug ars resulted in minimal effect o n binding between CcpA and fruA. It is also known that CcpA binds to the HPr protein to facilitate gene regulation, in vivo Therefore, to determine whether HPr can enhance CcpA binding to the fruA promoter ad ditional binding experiments were carried out in the presence of both HPr and the sugar

PAGE 63

63 phosphates (F 1,6bP, F 6P or G 6P) This resulted in a noticeable enhancement in CcpA binding when compared to reactions that did not contain HPr It is clear that HPr plays an important role in S. mutans since the removal of this gene is lethal to the organism, yet it has been successfully knocked out in other organisms. These data suggest that HPr may play a larger role in gene regulation of S. mutans than previously thought. Future studies using more quantitative methods will be needed to determine conclusively whether sugar phosphates affect CcpA binding to as great an extent as in some other species. It is understood that HPr complexes with CcpA when phosphorylated at the serine 46 residue. Therefore, modifications were made to the HPr protein and these were also tested for possible enhancement in the binding between CcpA and fruA. In addition to HPr a mutant form of HPr (HPrS46D) and an in vitro phosphoryla ted form of HPr (HPrserPO4) were all considered, but only HPrserPO4 resulted in an enhancement of binding between CcpA and the fruA promoter. This study investigated if the in vitro phosphorylation of the purified HPr protein effects CcpA binding versus t he amino acid manipulation of the HPr protein to mimic the serine 46 phosphorylation of HPr. The resul ts indicate that the S46D mimic of the H pr protein may not be as effective in regulating CcpA binding as the Ser46 phosphorylat ed form of this protein. Consistent with this idea, the S46D mutant did show changes in behavior, but it was not identical to the strain expressing a kinase constitutive form of HPr kinase, which has substantially elevated HPr Ser PO4 levels. Future directions involve investigati ng the affinity of CcpA for these genes and to see if this affinity is affected by allosteric effectors, like sugar phosphates and HPr. Also an in vivo look at the physical interactions of these molecules is warranted and the investigation into the possible involvement of gene regulation by sugars of the PTS.

PAGE 64

64 Since the addition of HPrserPO4 resulted in an increase in binding between CcpA and fruA, HPrserPO4 was also investigated for possible enhancement of binding between CcpA and the gtfB promoter, and a decrease in binding was observed. There are data suggesting CcpA independent regulation of the gtfB gene, which may explain the decrease in binding after the addition of the serine 46 phosphorylated HPr protein. Similar experiments were repeated using the gtfB promoter. Sugar phosphates (F 1,6bP, F 6P or G 6P) were added to the binding reactions containing CcpA and the gtfB promoter. A slight increase in binding of CcpA to the gtfB promoter was observed after the addition of F 1,6bP to the reaction, no significant difference resu lted from the addition of F 6P. H owever, a decrease in binding was observed when G 6P was added. Previous data suggested the ManL protein, containing the AB domains of a mannose permease, was also involved in regulation of the gtfB gene (Zeng & Burne, 2008, Abranches et al., 2003, Abranches et al., 2006) However, addition of the ManL protein to binding reactions of CcpA and the gtfB promoter did not result in enhancement of binding by CcpA. To rule out a direct interaction between the ManL protein and the gtfB promoter, a binding reaction containing only the ManL protein and the gtfB promoter was performed, and no binding between these molecules resulted. As mentioned previously there is a possibility of an alternate regulator of catabolite repression other than CcpA, and ManL was investigated as this possible alternative. Unfortunately, no evidence came to light that suggests pure, unphosphorylated ManL protein directly regulates CCR or ind irectly regulates CCR via CcpA. Future directions for this study are to investigate the ManL protein, the mannose permease and other sugar permeases for possible CcpA dependent or independent gene regulation and CCR and also to explore whether an interaction of CcpA and ManL could

PAGE 65

65 occur in vivo perhaps because additional factors, that were not present in the EMSA studies, are required for the interaction Given that the PTS plays a central role in regulation of carbohydrate catabolism, the glyc olytic rates, acid tolerance and PTS activity of three mutant strains ( hprK V265F, pstH S46A, pstH S46D) of S. mutans UA159 were examined. Although the glycolytic rate for pstH S46D (a mutation in the HPr protein converting the serine 46 residue to aspartic a cid) was slightly faster initially than wild type the final pH was more alkali after 1.5 hours. This suggests a decrease in intracellular polysaccharides (IPS) for this mutant, which may further su ggest that this mutation is effec tive in CcpA activation. Similar decreased IPS were seen in a CcpA deficient strain of S. mutans (Nascimento et al. 2008) The glycolytic rates of pstH S46A (a mutation in the HPr protein converting the serine 46 residue to alanine) and hprK V265F (a mutation in the HPrK protein converting the valine 265 residue to phenylalanine) were comparable to that of wild type although the final pH after 1.5 hours was higher for all mutants. Due to the unphosphorylatable nature of the pstH S46A mutant a decrease in acid tolerance was expected. Results for the pstH S4 6A mutant showed a slightly lower glycolytic rate in the first ten minutes, but ultimately a comparable rate to that of wild type These results may indicate that unphosphorylated HPr protein is also able to bind and activate CcpA. Acid tolerance of all three mutant strains was compared to S. mutans UA159 wild type Acid tolerance for pstH S46D resulted in higher percent survival when compared to wild type and to the hprK V265F and pstH S46A mutants N o significa nt difference was observed between the mutants hprK V265F and pstH S46A in their ability to withstand an acid attack. The results suggest that the pstH S46D mutation effects S. mutans survival after an acid attack. CcpAs effect in this result is questionab le since a slower growth phenotype was observed with the

PAGE 66

66 pstH S46D strain and it also displays a high frequency of reversion to wild type which might be due to selective pressure against the high concentration of the serine phosphorylated mimic of HPr. P revious data suggest an increase in PTS activity for the CcpA deficient strain. Therefore, PTS activity of the glucose, fructose and mannose porters of all mutant strains, grown overnight in glucose, was assayed and compared to that of wild type The res ults suggest lower activity in all mutant strains for all three (glucose, fructose and mannose) sugar transporters assayed. A decrease in PTS activity was expected in the pstH S46D and possibly the hprK V265F mutants since previous data involving an S46D mutation in HPr resulted in decreased PTS activity due to inhibition of phosphorylation at the histidine 15 residue of HPr (used in PTS) (Reizer et al. 1989, Reizer et al. 1984, Deutscher et al. 1989) Although these results were expected for the pstH S46D and the hprK V265F mutants since they confer an increased activation of CcpA, these results were not expected for the pstH S46A mutant. A decrease in PTS activity of the pstH S46D and the hprK V265F mutants may sugge st a decrease in the expression of the levDEFG genes which transport glucose, fructose and mannose (the three sugar porters assayed) (Abranches et al., 2008) These data can also suggest a secondary regulation of the synthesis or activation of these sugar transporters (Abranches et al., 2008) When t he mutant strains were grown overnight in fructose, no significant difference in PTS activity of any of the mutant strains was observed for any of the three sugar porters assayed. The exception was slightly lower PTS activity of the mannose porter observe d for the pstH S46A strain when compared to the other mutant strains, but activity was similar to that of wild type These constantly lower PTS activities for the pstH S46A strain were not expected since CcpA activation is suggested to decrease in this stra in and the ability of this strain to contain histidine

PAGE 67

67 15 phosphorylated HPr (used for PTS) is increased. An alternative explanation to these results could be an overall decrease in function of this strain due to the inability to regulate CcpA dependent g enes. A model for this regulation is described in figure 22. Collectively, the data reveal a critical role for HPr in modulating gene expression and virulence attributes in the oral pathogen S. mutans.

PAGE 68

68 LIST OF REFERENCES Abbe, K., S. Takahashi & T. Yamada, (1982) Involvement of oxygensensitive pyruvate formate lyase in mixedacid fermentation by Streptococcus mutans under strictly anaerobic conditions. Journal of bacteriology 152 : 175182. Abranches, J., M. M. Candella, Z. T. Wen, H. V. Baker & R. A. Burne, (2006) Different roles of EIIABMan and EIIGlc in regulation of energy metabolism, biofilm development, and competence in Streptococcus mutans. Journal of bacteriology 188: 37483756. Abranches, J., Y. Y. Chen & R A. Burne, (2003) Characterization of Streptococcus mutans strains deficient in EIIAB Man of the sugar phosphotransferase system. Applied and environmental microbiology 69: 47604769. Abranches, J., M. M. Nascimento, L. Zeng, C. M. Browngardt, Z. T. Wen, M. F. Rivera & R. A. Burne, (2008) CcpA regulates central metabolism and virulence gene expression in Streptococcus mutans. Journal of bacteriology 190 : 23402349. Ahn, S. J., Z. T. Wen & R. A. Burne, (2007) Effects of oxygen on virulence traits of Strepto coccus mutans. Journal of bacteriology 189 : 85198527. Banas, J. A., (2004) Virulence properties of Streptococcus mutans. Front Biosci 9 : 12671277. Berry, C. W. & C. A. Henry, (1977) The effect of adsorption on the acid production of caries and noncaries producing streptococci. Journal of dental research 56: 11931200. Browngardt, C. M., Z. T. Wen & R. A. Burne, (2004) RegM is required for optimal fructosyltransferase and glucosyltransferase gene expression in Streptococcus mutans. FEMS microbiology letter s 240: 7579. Burne, R. A., (1998) Oral streptococci... products of their environment. Journal of dental research 77 : 445452. Burne, R. A., Y. Y. Chen, D. L. Wexler, H. Kuramitsu & W. H. Bowen, (1996) Cariogenicity of Streptococcus mutans strains with def ects in fructan metabolism assessed in a program fed specificpathogenfree rat model. Journal of dental research 75: 15721577. Burne, R. A. & J. E. Penders, (1992) Characterization of the Streptococcus mutans GS 5 fruA gene encoding exobeta D fructosida se. Infection and immunity 60: 4621 4632. Cha, R. S., H. Zarbl, P. Keohavong & W. G. Thilly, (1992) Mismatch amplification mutation assay (MAMA): application to the cH ras gene. PCR Methods Appl 2: 14 20. Christensen, D. P., A. K. Benson & R. W. Hutkins, (1999) Mutational analysis of the role of HPr in Listeria monocytogenes. Applied and environmental microbiology 65 : 21122115.

PAGE 69

69 Deutscher, J., R. Herro, A. Bourand, I. Mijakovic & S. Poncet, (2005) P Ser HPr -a link between carbon metabolism and the virulence of some pathogenic bacteria. Biochimica et biophysica acta 1754: 118 125. Deutscher, J., E. Kuster, U. Bergstedt, V. Charrier & W. Hillen, (1995) Protein kinase dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in grampositive bacteria. Molecular microbiology 15: 10491053. Deutscher, J., G. Sossna & G. GonzyTreboul, (1989) Regulatory functions of the phosphocarrier protein HPr of the phosphoenol pyruvate dependent phosphotransferase system in gram positive bacter ia. FEMS microbiology reviews 5: 167174. Durack, D. T., B. C. Gilliland & R. G. Petersdorf, (1978) Effect of immunization on susceptibility to experimental Streptococcus mutans and Streptococcus sanguis endocarditis. Infection and immunity 22: 5256. Fran co, E., C. P. Saunders, G. J. Roberts & A. Suwanprasit, (1996) Dental disease, caries related microflora and salivary IgA of children with severe congenital cardiac disease: an epidemiological and oral microbial survey. Pediatric dentistry 18: 228235. Fuj ita, K., M. MatsumotoNakano, S. Inagaki & T. Ooshima, (2007) Biological functions of glucanbinding protein B of Streptococcus mutans. Oral microbiology and immunology 22: 289292. Geddes, D. A., (1975) Acids produced by human dental plaque metabolism in situ. Caries research 9 : 98109. Gibbons, R. J., P. F. Depaola, D. M. Spinell & Z. Skobe, (1974) Interdental localization of Streptococcus mutans as related to dental caries experience. Infection and immunity 9: 481488. Gorke, B. & J. Stulke, (2008) Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nature reviews 6: 613624. Gosseringer, R., E. Kuster, A. Galinier, J. Deutscher & W. Hillen, (1997) Cooperative and noncooperative DNA binding modes of catabolite control p rotein CcpA from Bacillus megaterium result from sensing two different signals. Journal of molecular biology 266 : 665676. Griswold, A. R., M. JamesonLee & R. A. Burne, (2006) Regulation and physiologic significance of the agmatine deiminase system of Str eptococcus mutans UA159. Journal of bacteriology 188: 834 841. Guidi Rontani, C., A. Danchin & A. Ullmann, (1980) Catabolite repression in Escherichia coli mutants lacking cyclic AMP receptor protein. Proceedings of the National Academy of Sciences of the United States of America 77: 5799 5801.

PAGE 70

70 Han, T. K., C. Zhang & M. L. Dao, (2006) Identification and characterization of collagenbinding activity in Streptococcus mutans wall associated protein: a possible implication in dental root caries and endocarditis Biochemical and biophysical research communications 343: 787 792. Henkin, T. M., F. J. Grundy, W. L. Nicholson & G. H. Chambliss, (1991) Catabolite repression of alpha amylase gene expression in Bacillus subtilis involves a transacting gene product homo logous to the Escherichia coli lacl and galR repressors. Molecular microbiology 5: 575584. Higuchi, M., Y. Yamamoto, L. B. Poole, M. Shimada, Y. Sato, N. Takahashi & Y. Kamio, (1999) Functions of two types of NADH oxidases in energy metabolism and oxidati ve stress of Streptococcus mutans. Journal of bacteriology 181 : 59405947. Ikeda, T., T. Shiota, J. R. McGhee, S. Otake, S. M. Michalek, K. Ochiai, M. Hirasawa & K. Sugimoto, (1978) Virulence of Streptococcus mutans: comparison of the effects of a coupling sugar and sucrose on certain metabolic activities and cariogenicity. Infection and immunity 19: 477480. Kaste, L. M., R. H. Selwitz, R. J. Oldakowski, J. A. Brunelle, D. M. Winn & L. J. Brown, (1996) Coronal caries in the primary and permanent dentition of children and adolescents 1 17 years of age: United States, 19881991. Journal of dental research 75 Spec No : 631641. Kim, J. H. & G. H. Chambliss, (1997) Contacts between Bacillus subtilis catabolite regulatory protein CcpA and amyO target site. Nuclei c acids research 25 : 34903496. Leboeuf, C., Y. Auffray & A. Hartke, (2000) Cloning, sequencing and characterization of the ccpA gene from Enterococcus faecalis. International journal of food microbiology 55 : 109113. Lemos, J. A., J. Abranches & R. A. Bur ne, (2005) Responses of cariogenic streptococci to environmental stresses. Current issues in molecular biology 7: 95107. Loesche, W. J., J. Rowan, L. H. Straffon & P. J. Loos, (1975) Association of Streptococcus mutants with human dental decay. Infection and immunity 11 : 12521260. Lorca, G. L., Y. J. Chung, R. D. Barabote, W. Weyler, C. H. Schilling & M. H. Saier, Jr., (2005) Catabolite repression and activation in Bacillus subtilis: dependency on CcpA, HPr, and HprK. Journal of bacteriology 187: 78267839. Martin, M. E., R. C. Strachan, H. Aranha, S. L. Evans, M. L. Salin, B. Welch, J. E. Arceneaux & B. R. Byers, (1984) Oxygen toxicity in Streptococcus mutans: manganese, iron, and superoxide dismutase. Journal of bacteriology 159 : 745749. Miwa, Y. & Y. F ujita, (2001) Involvement of two distinct catabolite responsive elements in catabolite repression of the Bacillus subtilis myo inositol (iol) operon. Journal of bacteriology 183: 58775884.

PAGE 71

71 Miwa, Y., A. Nakata, A. Ogiwara, M. Yamamoto & Y. Fujita, (2000) E valuation and characterization of cataboliteresponsive elements (cre) of Bacillus subtilis. Nucleic acids research 28 : 12061210. Murchison, H. H., J. F. Barrett, G. A. Cardineau & R. Curtiss, 3rd, (1986) Transformation of Streptococcus mutans with chromosomal and shuttle plasmid (pYA629) DNAs. Infection and immunity 54: 273282. Nascimento, M. M., J. A. Lemos, J. Abranches, R. B. Goncalves & R. A. Burne, (2004) Adaptive acid tolerance response of Streptococcus sobrinus. Journal of bacteriology 186 : 63836390. Nascimento, M. M., J. A. Lemos, J. Abranches, V. K. Lin & R. A. Burne, (2008) Role of RelA of Streptococcus mutans in global control of gene expression. Journal of bacteriology 190: 2836. Reizer, J., M. J. Novotny, W. Hengstenberg & M. H. Saier, Jr., (1984) Properties of ATP dependent protein kinase from Streptococcus pyogenes that phosphorylates a seryl residue in HPr, a phosphocarrier protein of the phosphotransferase system. Journal of bacteriology 160: 333340. Reizer, J., S. L. Sutrina, M. H. Sai er, G. C. Stewart, A. Peterkofsky & P. Reddy, (1989) Mechanistic and physiological consequences of HPr(ser) phosphorylation on the activities of the phosphoenolpyruvate:sugar phosphotransferase system in gram positive bacteria: studies with site specific m utants of HPr. EMBO J 8: 21112120. Seidl, K., M. Bischoff & B. Berger Bachi, (2008) CcpA Mediates the Catabolite Repression of tst in Staphylococcus aureus. Infection and immunity 76 : 50935099. Sheng, J. & R. E. Marquis, (2006) Enhanced acid resistance of oral streptococci at lethal pH values associated with acid tolerant catabolism and with ATP synthase activity. FEMS microbiology letters 262 : 9398. Terao, Y., R. Isoda, J. Murakami, S. Hamada & S. Kawabata, (2009) Molecular and biological characterizati on of gtf regulationassociated genes in Streptococcus mutans. Oral microbiology and immunology 24: 211 217. Turinsky, A. J., F. J. Grundy, J. H. Kim, G. H. Chambliss & T. M. Henkin, (1998) Transcriptional activation of the Bacillus subtilis ackA gene requ ires sequences upstream of the promoter. Journal of bacteriology 180: 59615967. Viana, R., V. Monedero, V. Dossonnet, C. Vadeboncoeur, G. Perez Martinez & J. Deutscher, (2000) Enzyme I and HPr from Lactobacillus casei: their role in sugar transport, carbon catabolite repression and inducer exclusion. Molecular microbiology 36 : 570584. Welin Neilands, J. & G. Svensater, (2007) Acid tolerance of biofilm cells of Streptococcus mutans. Applied and environmental microbiology 73: 56335638.

PAGE 72

72 Wexler, D. L., J. E. Penders, W. H. Bowen & R. A. Burne, (1992) Characteristics and cariogenicity of a fructanasedefective Streptococcus mutants strain. Infection and immunity 60 : 36733681. Winn, D. M., J. A. Brunelle, R. H. Selwitz, L. M. Kaste, R. J. Oldakowski, A. Kingma n & L. J. Brown, (1996) Coronal and root caries in the dentition of adults in the United States, 19881991. Journal of dental research 75 Spec No : 642651. Yamamoto, Y., Y. Kamio & M. Higuchi, (1999) Cloning, nucleotide sequence, and disruption of Streptoc occus mutans glutathione reductase gene (gor). Bioscience, biotechnology, and biochemistry 63: 10561062. Yamamoto, Y., L. B. Poole, R. R. Hantgan & Y. Kamio, (2002) An ironbinding protein, Dpr, from Streptococcus mutans prevents iron dependent hydroxyl r adical formation in vitro. Journal of bacteriology 184: 29312939. Zeng, L. & R. A. Burne, (2008) Multiple sugar: phosphotransferase system permeases participate in catabolite modification of gene expression in Streptococcus mutans. Molecular microbiology 70: 197208. Zomer, A. L., G. Buist, R. Larsen, J. Kok & O. P. Kuipers, (2007) Time resolved determination of the CcpA regulon of Lactococcus lactis subsp. cremoris MG1363. Journal of bacteriology 189: 13661381.

PAGE 73

73 BIOGRAPHICAL SKETCH Mercedes F. River a wa s born in Chicago, Illinois. She and her parents, Elizabeth Rivera and Thomas Castaneda moved from Chicago to Miami, Florida in the early nineties. From 1998 to 2002 she attended the University of Miami, during which time she was an American Cancer Socie ty Scholarship Recipient and treasurer of Humans Helping Animals. She graduated with a Bachelor of Science degree in biology, and a minor in chemistry and psychology in May 2002. In July of 2006 she received the Board of Education Summer Fellowship for Mi nority Graduate Students, and began graduate school at the University of Florida in August 2006. Her graduate research in the Medical Sciences was done under the mentorship of Robert Burne, Ph.D.