<%BANNER%>

Targeting Protein Interactions of FAK and IGF-1R in Human Cancer as a Novel Anti-Neoplastic Approach

Permanent Link: http://ufdc.ufl.edu/UFE0041606/00001

Material Information

Title: Targeting Protein Interactions of FAK and IGF-1R in Human Cancer as a Novel Anti-Neoplastic Approach
Physical Description: 1 online resource (96 p.)
Language: english
Creator: Ucar, Deniz
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: esophageal, fak, igf1r, melanoma, pancreatic, protein
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Previously, we have shown that FAK (focal adhesion kinase) and IGF-1R (insulin-like growth factor receptor-1) directly interact with each other and this interaction provides activation of crucial signaling pathways that benefit cancer cells. Inhibition of FAK and IGF-1R function by knock down of genes and kinase inhibitors have shown to significantly decrease cancer cell proliferation and decrease resistance to chemotherapy and radiation treatment. In this study, as a novel approach, I evaluated the effect of a small molecule compound that disrupts the interaction of FAK and IGF-1R. Using virtual screening and functional testing, I identified a lead compound INT2-31 that targets the known FAK-IGF-1R interaction site. I studied the effect of this compound on FAK-IGF-1R protein interactions, when administered alone or in combination with 5-FU or gemcitabine chemotherapy on cell signaling, viability and apoptosis in human melanoma (A375, C8161, SK-Mel28), esophageal (KYSE 70, 140) and pancreatic (Miapaca-2, Panc-1) cancer cells and on in vivo tumor growth in xenograft mouse models. Based on GST pull down assay with purified protein fragments of FAK-FERM domain and IGF-1R?, I concluded that INT2-31 blocked the interaction of FAK and IGF-1R. INT2-31 caused a disruption of protein interactions between FAK and IGF-1R in vitro in cancer cells starting at a concentration of 2.5 microM. It also caused a dose dependent inhibition of cell viability and induction of apoptosis starting at doses of 0.5 microM and 5microM, respectively. These effects were associated with a decrease in phosphorylation of Akt and ERK1/ERK2. Furthermore, treatment with INT2-31 sensitized cancer cells to chemotherapy since 5-FU synergistically decreased cell growth and increased apoptosis when combined with INT2-31 compared to 5-FU or INT2-31 alone. In vivo INT2-31 treatment has dramatic inhibitory effect on tumor growth, when administered via subcutaneous or intraperitoneal injection, at 15 to 50mg/kg daily, in both subcutaneous xenografts and pancreatic orthotopic mouse models. For instance, the size of the tumor, grown from an esophageal cancer specimen in the subcutaneous location was reduced by 70% in INT2-31 treated animals vs control (236 +131 vs 931 +375 mm3, respectively, p < 0.005). This was associated with a decrease in cell proliferation (tumors from INT2-31 treated animals stained with Ki67 demonstrated a significant decrease in positive cells 52% vs 32%, control vs INT2-31, respectively, p < 0.05) and decreased activation of p-AKT in tumor cells. Our data suggest that the FAK-IGF-1R protein interaction is an important target and disruption of this protein-protein interaction with a small molecule has a potential anti-neoplastic therapeutic effect.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Deniz Ucar.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Hochwald, Steven N.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041606:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041606/00001

Material Information

Title: Targeting Protein Interactions of FAK and IGF-1R in Human Cancer as a Novel Anti-Neoplastic Approach
Physical Description: 1 online resource (96 p.)
Language: english
Creator: Ucar, Deniz
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: esophageal, fak, igf1r, melanoma, pancreatic, protein
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Previously, we have shown that FAK (focal adhesion kinase) and IGF-1R (insulin-like growth factor receptor-1) directly interact with each other and this interaction provides activation of crucial signaling pathways that benefit cancer cells. Inhibition of FAK and IGF-1R function by knock down of genes and kinase inhibitors have shown to significantly decrease cancer cell proliferation and decrease resistance to chemotherapy and radiation treatment. In this study, as a novel approach, I evaluated the effect of a small molecule compound that disrupts the interaction of FAK and IGF-1R. Using virtual screening and functional testing, I identified a lead compound INT2-31 that targets the known FAK-IGF-1R interaction site. I studied the effect of this compound on FAK-IGF-1R protein interactions, when administered alone or in combination with 5-FU or gemcitabine chemotherapy on cell signaling, viability and apoptosis in human melanoma (A375, C8161, SK-Mel28), esophageal (KYSE 70, 140) and pancreatic (Miapaca-2, Panc-1) cancer cells and on in vivo tumor growth in xenograft mouse models. Based on GST pull down assay with purified protein fragments of FAK-FERM domain and IGF-1R?, I concluded that INT2-31 blocked the interaction of FAK and IGF-1R. INT2-31 caused a disruption of protein interactions between FAK and IGF-1R in vitro in cancer cells starting at a concentration of 2.5 microM. It also caused a dose dependent inhibition of cell viability and induction of apoptosis starting at doses of 0.5 microM and 5microM, respectively. These effects were associated with a decrease in phosphorylation of Akt and ERK1/ERK2. Furthermore, treatment with INT2-31 sensitized cancer cells to chemotherapy since 5-FU synergistically decreased cell growth and increased apoptosis when combined with INT2-31 compared to 5-FU or INT2-31 alone. In vivo INT2-31 treatment has dramatic inhibitory effect on tumor growth, when administered via subcutaneous or intraperitoneal injection, at 15 to 50mg/kg daily, in both subcutaneous xenografts and pancreatic orthotopic mouse models. For instance, the size of the tumor, grown from an esophageal cancer specimen in the subcutaneous location was reduced by 70% in INT2-31 treated animals vs control (236 +131 vs 931 +375 mm3, respectively, p < 0.005). This was associated with a decrease in cell proliferation (tumors from INT2-31 treated animals stained with Ki67 demonstrated a significant decrease in positive cells 52% vs 32%, control vs INT2-31, respectively, p < 0.05) and decreased activation of p-AKT in tumor cells. Our data suggest that the FAK-IGF-1R protein interaction is an important target and disruption of this protein-protein interaction with a small molecule has a potential anti-neoplastic therapeutic effect.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Deniz Ucar.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Hochwald, Steven N.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041606:00001


This item has the following downloads:


Full Text

PAGE 1

1 TARGETING PROTEIN INTERACTIONS OF FAK AND IGF 1R IN HUMAN CANCER AS A NOVEL ANTI NEOPLASTIC APPROACH By DENIZ A. UCAR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Deniz A Ucar

PAGE 3

3 To my l oves Mine and Arslan U car

PAGE 4

4 ACKNOWLEDGMENTS From the bottom of my heart, I would first like to thank my mentor, Dr. Steven N. Hochwald who provided me the opportunity to work on this project, endured and patiently supported my endless demands. I gratefully thank Dr. Elena Kurenova for her excellent guidance and opportunities she has provided me during my stay in this lab. I would also thank Dr. William Cance who provided the support for this project. I would also like to thank my committee members, Drs. Thomas Rowe, Brian Law, and James Resnic, for their time, positive energy, and guidance. I would also appreciate the members of the Cance/Hochwald lab, especially DiHua He, Carl Nyberg, Donghan Zheng, and Audrey Cox. My deepest thanks also are extended to my friends Marda Jorgensen for her invaluable guidance and time for immunohistochemistry analysis; Steve McClellan for his time, patience and efforts to help me for FACS analysis and confocal imaging. I also gratefully thank Dr. LungJi Chang for his guidance and support for the transfection of cells. I would like to thank Dr. Wayne McCormack for his endless support and motivation though out my Master's and PhD programs. Their help was invaluable and t heir presence made work a pleasant place. I also appreciate Joyce Conners for her endless support since the day I met her six years ago. She has been a wonderful caring American Mom. I would also include my previous professors; Dr. Philip Laipis, Dr. Ed ward Scott and their lab members in my list of the people who I deeply appreciate for their guidance and continuing friendships. I thank also flow cytometry core members, especially Neal Benson for giving me technical advice on many occasions and for their help in maintain the core. Outside the UF, and most importantly, I would like to thank my parents, Mine and Arslan Ucar, my sister, Derya Sehri and her family, my brother, Yigit Ucar and his family. Although they live in Turkey, whenever I need them, the y do not hesitate to travel a thousand miles to be

PAGE 5

5 beside me. I do appreciate them for their support and caring. I would like to thank my friends, Robert Fisher, Shuhong Han, Qing Yang, Jennifer Stamp, Robert Mann, Brian Motyer, Jennifer Barrell, and Slava who ha ve provided strength, wisdom, motivation, and love. Finally, the biggest thanks is reserved for my doctor Bulent Urman, whose surgical skills and expertise provided me a cancer free life. I DO LOVE ALL OF THEM.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................8 LIST OF FIGURES .........................................................................................................................9 ABSTRACT ...................................................................................................................................11 CHAPTER 1 INTRODUCTION AND BACKGROUND ...........................................................................13 Focal Adhesion Kinase ...........................................................................................................13 Molecular Structure of Focal Adhesion Kinase ..............................................................14 Activation and Signaling Through FAK .........................................................................15 FAK as a Target for Therapy ...........................................................................................16 The Insulinlike Growth Factor Receptor ...............................................................................19 IGF 1R and Signaling Pathways .....................................................................................19 IGF 1R and Cancer ..........................................................................................................21 Interaction Between FAK and IGF 1R ...................................................................................21 Dual Inhibition of FAK and IGF 1R ...............................................................................22 Disruption of Protein Protein Interactions ......................................................................23 Targeted Cancer Types ...........................................................................................................24 Melanoma ........................................................................................................................24 Esophageal Cancer ..........................................................................................................25 Pancreatic Cancer ............................................................................................................26 Molecular Abno rmalities in Pancreatic Cancer ......................................................................26 2 MATERIALS AND METHODS ...........................................................................................30 Cell Lines and Cell Culture ....................................................................................................30 Melanoma Cell Lines ......................................................................................................30 Esophageal Cancer Cell Lines .........................................................................................30 Pancreatic Cancer Cell Lines ...........................................................................................30 Other Cell Lines ..............................................................................................................31 Reagents and Antibodies ........................................................................................................32 Cell Viability (MTT) and CFSE Proliferation Assay .............................................................32 Computational Docking ..........................................................................................................33 Production of GST Fusion Proteins ........................................................................................34 Pull Down Assay ....................................................................................................................34 Immunoprecipitation and Western Blotting ...........................................................................34 Short Hairpin RNA Transfection of Cells ..............................................................................35 GFP Fused FAK Constructs and Transfection of Cells .........................................................35 Stable Transduction of Cell Lines ..........................................................................................36

PAGE 7

7 Detachment Assay ..................................................................................................................36 Apoptosis Assays ....................................................................................................................36 Tunnel Assay ...................................................................................................................36 Hoechst Staining ..............................................................................................................37 Caspase 3/7 Apoptosis Assay ..........................................................................................37 Kinase Profiler Screening .......................................................................................................38 Tumor Growth in Nude Mice in vivo .....................................................................................38 Melanoma Xenograft .......................................................................................................38 Patient Subjects and Xenograft .......................................................................................38 Orthotopic model of pancreatic cancer ............................................................................40 In vivo Imaging of Mice ..................................................................................................41 Immunohistochemistry ....................................................................................................42 Statistical Analyses .................................................................................................................42 Further Studies ........................................................................................................................42 ELISA Test .....................................................................................................................43 BIACORE Analysis .........................................................................................................44 FAKNT immobilization ..........................................................................................44 Capture of IGF 1R ...................................................................................................45 Preparation of analyte solutions ...............................................................................45 Analysis parameters .................................................................................................46 Data analysis ............................................................................................................46 3 RESULTS AND DISCUSSION .............................................................................................48 Results .....................................................................................................................................48 Structure Based in silico Molecular Modeling and Computational Docking .................48 INT2 31 Disrupts the Interaction of FAK and IGF 1R ...................................................49 INT2 31 Reduces the Viability of Cancer Cells ..............................................................50 INT2 31 Inhibits Cancer Cell Proliferation and its Activity Depends on the Presence of FAK and IGF 1R ......................................................................................50 INT2 31 Induces Apoptosis ............................................................................................51 INT2 31 Decreases Activation of Akt .............................................................................52 INT2 31 Sensitized Cancer Cells to Chemotherapy .......................................................54 INT2 31 Decreases Tumor Growth in Melanoma Xenograft Model Through Inhibiting Phosphorilation of Akt ................................................................................54 In vitro and in vivo Inhibition of Esophageal Cancer Viability and Proliferation With INT2 31 Treatment .............................................................................................55 Inhibition of Orthotopic Pancreatic Xenografts With INT231 Treatment .....................56 Discussion ...............................................................................................................................57 LIST OF REFERENCES ...............................................................................................................89 BIOGRAPHICAL SKETCH .........................................................................................................96

PAGE 8

8 LIST OF TABLES Table page 31 The top scoring compounds for the third orientation.........................................................63 32 IC50 of INT2 31 for cancer cell lines .................................................................................65

PAGE 9

9 LIST OF FIGURES Figure page 11 FAK structure and interacting proteins.. ............................................................................27 12 FAK signaling. ...................................................................................................................28 13 FAK constructs and the domains of interaction between FAK and IGF 1R. ....................29 31 Pmol modeling of FAK and IGF 1R interaction ...............................................................67 32 Screening of top scoring compounds. ................................................................................67 33 In silico modeling of FAK and IGF 1R interaction. ..........................................................68 34 The structure of INT231 (NSC 344553)...........................................................................69 35 GST FAKNT2 pull down of IGF 1R ............................................................................69 36 Effects of INT2 31 on FAK and IGF 1R interaction. ........................................................70 37 Effect of INT2 31 on cell viability. ...................................................................................71 38 CSFE cell proliferation assay .............................................................................................72 39 C8161 melanoma cell counts in the presence of INT2 31 or TAE 226 .............................73 310 Effects of INT2 31 on FAK shRNA transfected C8161 cells. ..........................................73 311 Effects of INT2 31 on FAK and IGF 1R deficient MEFs. ................................................74 312 Effects of INT2 31 on detachment of C8161 cells. ...........................................................75 313 Hoescht staining of INT231 treated cells. ........................................................................75 314 Confocal image of Caspase 3/7 activated INT2 31 treated cells .......................................76 315 Western blot analysis of biochemical markers of the apoptotic pathway. .........................77 316 Western blot analysis of phosphorylated and total proteins from INT231 treated cells.. ..................................................................................................................................79 317 Effects of INT2 31 on in vitro kinase activity. ..................................................................80 318 Overexpression of FAK NT2 fragment reduces IGF 1 induced phosphorylation of AKT. ..................................................................................................................................80 319 INT2 31 sentisized esophageal cancer cells to chemotherapy MTT assay showing the viability. 81

PAGE 10

10 320 INT2 31 sentisized pancreatic cancer cells to chemotherapy. ...........................................82 321 Melanoma xenograft analysis.. ..........................................................................................85 322 Effects of INT2 31 on direct esophageal cancer patient#5 specimen.. ..............................87 323 Effects of INT2 31 on orthotopic pancreatic mice model.. ...............................................88

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TARGETING PROTEIN INTERACTIONS OF FAK AND IGF 1R IN HUMAN CANCER AS A NOVEL ANTI NEOPLASTIC APPROACH By Deniz A. Ucar M ay 2010 Chair: Steven N. Hochwald Major: Medical Sciences Genetics Previously, we have shown that FAK (focal adhesion kinase) and IGF 1R (insulin like growth factor receptor 1) directly interact with each other and this interaction provides activation of crucial signaling pathways that benefit cancer cells. Inhibition of FAK and IGF 1R function by knock down of genes and kinase inhibitors have shown to significantly decrease cancer cell proliferation and decrease resistance to chemotherapy and radiation treatment. In this study, as a novel approach, I evaluated the effect of a small m olecule compound that disrupts the interaction of FAK and IGF 1R. Using virtual screening and functional testing, I identified a lead compound INT2 31 that targets the known FAK IGF 1R interaction site. I studied the effect of this compound on FAK I GF 1R protein interactions, when administered alone or in combination with 5 FU or gemcitabine chemotherapy on cell signaling, viability and apoptosis in human melanoma (A375, C8161, SK Mel28), esophageal (KYSE 70, 140) and pancreatic (Miapaca 2, Panc 1) c ancer cells and on in vivo tumor growth in xenograft mouse model s Based on GST pull down assay with purified protein fragments of FAK FERM domain and IGF 1R I concluded that INT2 31 blocked the interaction of FAK and IGF 1R. INT2 31 caused a disruption of protein interactions between FAK and IGF 1R in vitro in cancer cells

PAGE 12

12 starting at a concentration of 2.5 M. It also caused a dose dependent inhibition of cell viability and induction of apoptosis starting at doses of 0.5 M and 5M, respectively. These effects were associated with a decrease in phosphorylation of Akt and ERK1/ERK2. Furthermore, treatment with INT2 31 sensitized cancer cells to chemotherapy since 5FU synergistically decreased cell growth and increase d apoptosis when combined with INT231 compared to 5FU or INT2 31 alone. In vivo INT2 31 treatment has dramatic inhibitory effe ct on tumor growth, when administered via subcutaneous or intraperitoneal injection, at 15 to 50mg/kg daily, in both subcutaneous xenografts and pancreatic orthotopic mouse models. For instance, the size of the tumor grown from an esophageal cancer speci men in the subcutaneous location was reduced by 70% in INT2 31 treated animals vs control (236 + 131 vs 931 + 375 m m3, respectively, p<0.005). This was associated with a decrease in cell proliferation (tumor s from INT2 31 treated animals stained with Ki67 demonstrated a significant decrease in positive cells 52% vs 32%, control vs INT2 31, respectively, p<0.05) and decreased activation of pAKT in tumor cells. Our data suggest that the FAKIGF 1R protein interaction i s an important target and disruption of this protein protein interaction with a small molecule has a potential anti neoplastic therapeutic effect.

PAGE 13

13 CHAPTER 1 INTRODUCTION AND BACKGROUND Despite recent advances in conventional cancer treatment methods, survival of cancer patients remains suboptimal. Fortunately, the revolution in cancer research expanded our knowledge about mechanisms involved in tumor initiation and progression. Therefore specific aberrancies in tumors and their microenvironment can be uncovered and targeted for the development of new anti cancer drugs. Growing evidence indicates that cancer cells progress through altered signaling pathways. Malignant cells acquire aberr ations that favor their survival, growth, invasion and motility. Among these key regulatory factors, insulin like growth factor receptor (IGF 1R) and focal adhesion kinase (FAK) are tyrosine kinases which have been shown to be over expressed in many human cancers and play an important role in signal transduction of the malignant phenotype (Kanter Lawensohn et al. 1998, Kanter Lawensohn et al. 2000, Kahana et al. 2002, Mori et al. 1996, Liu et al. 2002, Ouban et al. 2003, Zheng et al. 2009, Liu et al. 2008). In addition, both of these proteins have shown to be involved in chemo and radiation resistance as well as inducing cell survival and proliferation. We previously identified the site of interaction between FAK and IGF 1R. We hypothesi ze that the FAK and IGF 1R interaction provides survival signals for cancer cells and disruption of this binding with novel small molecules can inhibit essential signaling pathways and inhibit tumor growth Focal Adhesion Kinase Focal Adhesion Kinase (FAK) is a key regulatory factor of the cell signaling cascade initiated either at the site of cell attachment or at growth factor receptors. In normal cells, FAK and adhesion signaling pathways are involved in important and interesting cellular processes, incl uding development, vascular function, and repair. On the other hand, activation of FAK plays

PAGE 14

14 an important role in survival, proliferation, migration and invasion of cancer cells that are crucial in the development and progression of malignancies. In many c ancers, there is a correlation between over expression of FAK and progression to higher grade malignancy. In invasive and metastatic human breast and colon cancer, FAK expression has shown to be up regulated compared to normal tissue (Weiner et al. 1993). Experiments designed to disrupt FAK signaling, with overexpression of a kinase dead FAK mutant dominant negative FAK CD or a small interfering RNA induced silencing of the expression of FAK, resulted in reduced cell proliferation, viability and increased cell death (Hauck et al. 2002, Han et al. 2004). Therefore, it is timely to pinpoint FAK in the onset and progression of cancer. Molecular Struct u re of Focal Adhesion Kinase Focal adhesion kinas e (FAK), also known as protein tyrosine kinase 2 alpha (PTK2a), is a nonreceptor tyrosine kinase that resides at focal adhesion protein clusters (Fiodorek et al. 1995). The FAK protein has a molecular mass of 125kDa and is encoded by the FAK gene located on human chromosome 8q24.This protein consists of an aminoterminal regulatory FERM (band 4 .1, e zrin, r adixin, m oesin homology) domain, a central catalytic kinase domain, two proline rich motifs, and a carboxy terminal focal adhesion targeting (FAT) domain (Figure 1 1). Closely related to the FAK, PTK2b, proline rich tyrosine kinase 2 (PYK2), is also located on human chromosome 8p22p11.2 and shares a similar domain structure with FAK (Manning et al. 2002). The FERM and FAT domain regions have around 40% a nd the kinase domain 60% conserved amino acid sequences. Although FAK is ubiquitously expressed in all tissues and cell types, the Pyk2 is expressed primarily in hematopoietic and neuronal cell types (Avraham et al. 2000, Orr et al. 2004). The amino acid sequence of FAK is more than 90% homologous between human, chicken, mouse and frog, suggesting it ha s a critical role in signal transduction and regulation among

PAGE 15

15 species (Corsi et al. 2006). The expression of the human FAK gene is regulated by a 600 base pair promoter region that contains many transcription binding sites including AP 1, AP 2, SP 1, PU.1, GCF, TCF 1, EGR 1, NF kappa B and p53 ( Golubovskaya et al. 2004). NF kappa B induces the transcription of FAK whereas p53 blocks FAK promoter and inhibits its activity. FAK mRNA and protein levels increase from embryonic day 7.5 and FAK null embryos die at day 8.5 during mouse development, indicating that FAK is essential in embryonic development (llik et al. 1995). Pathological analysi s of FAK null embryos demonstrated mesodermal defects; involution of head mesenchyme, and absence of notochord or somite was formation. Ac tivation and Signaling Through FAK FAK is a multi functional protein that has a kinase activity as well as serving as a scaffold protein. In the focal adhesion complex, FAK exists in its inactive state by masking the catalytic cleft with its FERM domain (C ooper et al. 2003). Interaction with integrins and growth factor receptors as well as intracellular kinases cause a conformational change in FAK and allow autophosporylation of the Y397 site, which leads to additional phosphorylation and full activation of FAK. The Y397 phos phorylated tyrosine creates a binding site for the SH2 domain of Src family kinases. SH2 domain binding of Src to the FAK releases Src Y527 autoinhibitory interaction and leads to the activation of Src (Figure 11). In return, activated Src phosphorylates additional sites on FAK, including residues Y576 and Y577 in the kinase activation loop, promoting further increased catalytic activity of FAK. The activated FAK/Src complex then initiates a cascade of phosphorylation events and new protein protein interactions to trigger numerous signaling pathways. These FAK signaling pathways have been shown to regulate a variety of cellular functions in both normal and cancer cells (Figure 1 2).

PAGE 16

16 FAK as a T arget for T herapy Recently, several reports describe d the properties of FAK inhibitors and FAK has been proposed to be a new therapeutic target (McLean et al. 2005) Initial studie s, which evaluated the effects of FAK inhibition in preclinical models focused on dominant negative mutants of FAK, antisense oligonucleotides and siRNAs (Parsons et al. 2008). More recently, scientists at Novartis Pharmaceuticals designed and synthesized a series of 2 amino 9aryl 7H pyrrolo [2,3d] pyrimidines to inhibit FAK kinase activity (Choi et al. 2006). Chemistry was developed to introduce functionality onto the 9 aryl ring, which resulted in the identification of potent FAK inhibitors. Others and we have published reports on the use of such FAK inhibitors that have targeted the ATP binding site in the kinase domain. In human pancreatic cancer, we have shown widespread expression of FAK in primary pancreatic adenocarcinoma. In addition, we have s hown significant upregulation of FAK protein expression in metastatic lesions. In human pancreatic cancer cells, we showed that the FAK kinase inhibitor, TAE226, decreases viability, increases cell detachment and increases apoptosis (Liu e t al. 2008). Other studies have shown that TAE226 readily induced apoptosis in human breast cancer cells with overexpressed Src or EGFR. Of note, these cells were resistant to adenoviral FAK dominant negative treatment, indicating that kinase inhibition was important for dowregulation of FAK function and the observed phenotypic changes ( Golubovskaya et al. 2008). Subsequent studies have analyzed the in vivo effects of TAE226. In a subcutaneous model of human esophageal cancer, TAE226 given orally at 30 mg/kg significantly decreased tumor volume and weight compared to placebo (Watanabe et al. 2008). Similar results from in vivo studies have conf irmed the ability of TAE226 to decrease the growth of ovarian and glioma xenografts (Shi et al. 2007) We have also used thi s inhibitor in other cancer cell lines including pancreatic cancer cells and found that this inhibitor can effectively cause apoptosis.

PAGE 17

17 While initial results with inhibition of kinase activity of FAK has shown anti neoplastic effects, TAE226 has been shown to also inhibit the activity of IGF 1R at nanomolar concentrations (Liu et al. 2007). Therefore, the activities against multiple tumor types likely reflect its dual inhibition of adhesion and growth promoting pathways. However, cross reactivity with oth er kinases may increase toxicity. Recently, Pfizer pharmaceuticals have published results on an ATP competitive reversible inhibitor of FAK that has bioavailability suitable for preclinical animal and human studies (Roberts et al. 2008). It also crossreact s with Py k2. PF562, 271 was shown to exhibit >100 fold selectivity for FAK when assayed against a panel of unrelated kinases. Treatment of cancer cell lines showed a dose dependent decrease in FAK phosphorylation at the Y397 site. The IC50 for FAK phosphorylation was reported to be 5 nmol/L. Antitumor efficacy was observed in mice subcutaneous xenograft models with minimal weight loss or mortality (Roberts et al. 2008). PF562, 271 is currently in phase II clinical trials. Phase 1 study r esults with this drug in patients with advanced solid malignancy have been reported in abstract form (Siu et al. 2007). Studies have been performed in two centers in the United States and one center in Canada and Australia with oral dosing as a single age nt. Thirtytwo patients received from 5 mg up to 105 mg twice a day. Adverse events possibly related to the drug in over 10% were nausea, vomiting, fatigue, anorexia, abdominal pain, diarrhea, headache, sensory neuropathy, rash, constipation and dizziness. Adverse events were generally grade 1 2 and reversible. Doses over 15 mg twice a day produced steady state plasma concentrations exceeding target efficacious levels predicted from preclinical models. Prolonged disease stabilization was observed in several tumor types. Phase 1 results indicated good tolerability to this drug with favorable pharmacokinetics and

PAGE 18

18 pharmacodynamics (Siu et al. 2007). This drug represents the sole FAK inhibitor being tested in humans to date. Another approach to inhibit FAK function can be to target protein protein interactions between FAK and its binding partners such as p53, IGF 1R, VEGFR3 or EGFR or targeting sites of FAK phosphorylation ( Golubovskaya et al. 2008, Zheng et al. 2009, Kurenova et al. 2009). Tyrosine 397 is an autophosphorylation site of FAK that is a critical component in downstream signaling, providing a highaffinity binding site for the SH2 domain of Src family kinases. Y397 is also a site of binding of PI3 kinase, growth factor receptor binding Grb7, Shc and other proteins. Thus, the Y397 site is one of the main phosphorylation sites that can activate FAK signaling in cells. It was recently demonstrated that computer modeling and screening can be performed to identify novel small mol ecules that inhibit protein protein interactions at the Y397 site ( Golubovskaya et al. 2008). In this approach, more than 140,000 small molecule compounds were docked into the N terminal domain of the FAK crystal structure in 100 different orientations. Those compounds with the greatest energy of interaction based on van der Waals and electrostat ic charges were identified as lead compounds. One compound, 1,2,4,5benzenetetraamine tetrahydrocholoride (Y15) significantly decreased viability in most cancer cells and specifically and directly blocked phosphorylation of Y397FAK in a dose and time dependent manner. Furthermore, it inhibited cell adhesion and effectively caused breast tumor regression in vivo ( Golubovskaya et al. 2008). Finally, we have shown that it inhibits pancreatic cancer growth in vivo both alone and in combination with gemcitabine chemotherapy (Hochwald et al. 2009). One potential advantage of our approach to identify small molecules through in silico screening is increased target specificity. Y15 did not affect phosphorylation of the F AK

PAGE 19

19 homologue, Pyk2, which can be explained by only 43% amino acid identity between N terminal domains of FAK and Pyk2. Other kinase inhibitors of FAK have shown inhibition of Pyk2 autophosphorylation and likely are less specific for inhibition of FAK f unction. The I nsulinlike G rowth F actor R eceptor The insulinlike growth factor (IGF) signaling system also plays an important role in the formation and progression of human cancer. Deregulation of the IGF pathways such as the overexpression and over activation of insulin like growth factor 1 receptor (IGF 1R) is a common event in several malignancies (Vincent et al. 2002). Mature IGF 1R is a heterotetramer bunit contains a transmembrane domain, a juxtamembrane domain, a tyrosine kinase domain and a C terminal tail. Initiated by ligand binding, IGF 1R undergoes conformational changes and autophosphorylation that trigger an intracellular signaling cascade incl uding activation of the mitogenactivated protein kinase (MAPK) and the phosphatidylinositol 3 kinase (PI3K) pathways, two main downstream signals of IGF 1R (Dews et al. 2000). IGF 1R signaling is required for cellular transformation by most oncogenes and facilitates the survival and spread of transformed cells (Valentinis et al. 1999). Interruption of IGF 1R signaling has been shown to inhibit tumor growth and block metastasis in a wide variety of tumor models (Pollak et al. 2008). IGF 1R and Signaling P athways Both the IGF 1 and insulin receptors are heterotetrameric transmembrane glycoproteins with intrinsic tyrosine kinase activity. Following ligand binding, both receptors undergo phosphorylation and thus activate insulin receptor substrate 1 (IRS 1), which then initiates a cascade of events that have mitogenic and metabolic effects (Vincent et al. 2002). Insulin, unlike IGF 1, is produced by the beta cells of the Islet of Langerhans and is primarily involved in glucose homeostasis and the regulation of metabolic pathways. The role of insulin in

PAGE 20

20 tumorigenesis is less clear; in pancreatic cancer, its effect appears to be its ability to activate the IGF 1 receptor (Korc et al. 1998). The best defined pathway by which IGF 1R signaling can prevent apoptosis is mediated by signaling from phosphoinositide 3kinase (PI3K) to Akt. Tyrosine phosphorylation of IRS 1 by IGF 1R leads to PI3K activation as a result of binding its regulatory subunit through the SH2 domain to IRS 1 an d subsequent increase in phosphatidylinositol 3,4,5 trisphosphate (PIP3). The proteins Akt/PKB and phosphoinositide dependent kinase 1 (PDK1) are then bound by PIP3. Residue Thr308 on Akt/PKB is then phosphorylated by PDK 1. Acti vated Akt/PKB plays a key role in the prevention of apoptosis. It phosphorylates and inactivates several proapoptotic proteins including Bad (Bcl 2 family member). Akt/PKB also can prevent the initiation of the caspase cascade through phosphorylation and inactivation of caspase 9. In addition to the inhibition of proapoptotic transcription factors, the activity of Akt/PKB also increases the levels of anti apoptotic proteins including Bcl 2 and Bcl X. With activation of Akt/PKB, the expression of the anti apoptotic transcription factor NF kB is also increased (Vincent et al. 2002). There is evidence of Akt involvement in human malignancies. Akt was found to be amplified 20fold in primary gastric adenocarcinoma. Additional studies have shown genomic amplification and overexpression of Akt in several pancreatic cancer cell lines. Of particular note is the fact that overexpre ssion of Akt occurs more frequently in undifferentiated, and thus more aggressive, tumors. It has been shown that MAPK can also influence Akt phosphorylation, contributing to tumor cells resistance to apoptosis (Staal et al. 1998, Ruggeri et al. 1998).

PAGE 21

21 The mitogenactivated protein (MAP) kinases are also activated by IGF 1R and are involved in the regulation of apoptosis in different cell types (Dews et al. 2000). One principal MAPK pathway involves the extracellular signal regulated kinase (ERKs) ERK1 a nd ERK2. Upon IGF 1R autophosphorylation, the protein Shc is recruited to the IGF 1 receptor and becomes phosphorylated on tryosine residues. Activated Shc then binds the adaptor Grb2 in an IRS 1 independent manner, leading to activation of the Ras ERK p athway (Kim et al. 1998). This pathway has been shown to be important in fibroblasts in regulating the machinery of apoptosis in detachment induced death or anoikis (Valentinis et al. 1999). Similar to the Akt pathway, the downstream target of ERK mig ht prevent apoptosis through Bad inactivation. IGF 1R and C ancer Several members in the IGF family signaling pathway, including IGF 1, IGF 1R, IGF 2R and IRS 1 are overexpressed in cancer including pancreatic malignancy (Stoeltzing et al. 2003, Bergmann et al. 1995, Bergmann et al. 1996, Ishiwata et al. 1997). Several studies support the significance of the IGF 1 receptormediated mitogenic signal in cancer cells. Both IGF 1 receptor antisense oligonucleotides and anti IGF 1R antibodies have been shown to inhibit the proliferation of human pancreatic cancer cells. Overexpression of IRS 1 in pancreatic cancer contributes to increased activation of the IGF 1R signaling pathway (Bergmann et al. 1995, Bergmann et al. 1996). Interaction B etween FA K and IGF1R Our laboratory has demonstrated by coimmunoprecipitation and confocal microscopy studies that FAK and IGF 1R physically interact in human cancer cells and that these cells have survival signals operative through FAK and IGF IR activities. As shown in figure 13, the kinase domain of IGF 1R the NT2 region (aa 126243) of FAK FERM domain. In addition, our lab has shown that dual inhibition of both kinases synergistically induces cell

PAGE 22

22 detachment, decreases cell viability and increases apoptosis, which was demonstrated by multiple approaches in fibroblast and cancer cells with the use of multiple inhibitors including transient expression of a dominant negative FAK (Ad FAK CD), FAK knockdown with siRNA, stable expr ession of an IGF 1R dominant negative, a selective small molecule inhibitor of IGF 1R (AEW 541) and a novel small molecule kinase inhibitor of both FAK and IGF 1R TAE226 (Liu et al. 2008). The mechanism for this synergistic effect appears to be through pat hways that involve ERK and Akt Both pERK and pAkt were decreased following dual inhibition of FAK and IGF 1R. The strategy of dual FAK and IGF 1R kinase inhibition has been shown to be effective in tumor models involving several human malignancies. The FAK and IGF 1R kinase inhibitor (TAE226) was shown to inhibit growth of human ovarian carcinoma cell lines in a time and dose dependent fashion. TAE226 significantly reduced tumor growth in vivo both when administered alone and when given concomitantly with docetaxel chemotherapy. The therapeutic efficacy was related to reduced pericyte coverage, induction of apoptosis of tumor associated endothelial cells and reduced microvessel density and tumor cell proliferation (Halder et al. 2007). In addition, TAE226 was shown to inhibit human glioma cell growth as assessed by a cell viability assay and attenuated G(2) M cell cycle progression associated with a decrease in cyclin B1 and phosphorylated cdc2 protein expression. TAE226 treatment significantly increased the survival rate of animals in an intracranial glioma xenograft model (Liu et al. 2007). Finally, TAE226 was found to induce apoptosis in human breast cancer cells that overexpressed Src or EGFR (Goluboyskoya et al. 2008). Dual I nhibition of FAK and IGF1R FAK inhibition: While emerging data strongly suggests that FAK is an excellent target for developmental therapeutics of cancer, specific small molecule kinase inhibitors of FAK have

PAGE 23

23 been difficult to obtain (McLean et al. 2005, Van Nimwegen et al. 2007). Three such kinase inhibitors were reported from Novartis (NVP TAE 226 ) and Pfizer (PF 573, 228 and PF 562, 271), but only PF 562, 271 is in clinical trials in cancer patients (Shi et al. 2007, SlackDavis et al. 2007, Roberts at al. 2008). IGF 1R inhibition: Industry leaders are exploring the utility of antibodies to the extracellular domain of IGF 1R. These antibodies are under investigation in multiple tumor types. Six companies are currently testing small molecule inhibitors targeting the IGF 1R tyrosine kinase (Hewis et al. 2009, Pollak et al. 2008). Disruption of P rotein P rotein I nteractions Up to the present, the approach to dual FAK and IGF 1R inhibition was based on inhibiti ng their kinase activities. Due to sequence homology, particularly in the kinase domain, and structural similarity of IGF 1R to other receptors such as the insulin receptor, the main problem with kinase inhibitors is their lack of specificity. Approaches of targeting the ATP competitive binding site lack specificity for IGF 1R or FAK inhibition. In addition, it frequently appears that disruption of the kinase domain does not specifically interfere with the downstream signaling of FAK or IGF 1R and it is uncl ear whether the kinase function or the scaffolding function of these proteins is more important. Targeting FAK protein protein interaction sites represents a novel approach to FAK inhibition and it was developed in the Cance/Hochwald laboratory and prove n by developing a FAKVEGFR3 inhibitor C4 (Kurenova et al. 2009) There have been no previous studies, which have examined applicability of this strategy to FAK and IGF 1R protein interactions targeting in human cancer cells. Small organic molecules are pa rticularly attractive as inhibitors of intracellular protein protein interactions because of the ability to modify their structures to achieve optimal target binding, and because of their ease of delivery in in vivo systems.

PAGE 24

24 Targeted C ancer T ypes Both FAK and IGF 1R are expressed in varying amount in several cancer types. For our study, we focused on melanoma, esophageal and pancreatic cancers to stu dy the effects of disruption of FAK and IGF 1R. The rationale to target these cancer types is that they are refractory to most standard therapies and are associated with high cancer mortality rates. Melanoma Cutaneous melanoma is one of the cancers with the greatest incidence in the last 50 years. Melanoma patients with metastatic disease have a very poor prognosis with a 5 year survival probability of less than 5%. This is largely due to the failure of chemotherapy or immunotherapy treatments to impact advanced disease ( Eggermont et al. 2009). Researchers have demonstrated that progression from benign nevi to malignant melanoma is paralleled by an increased expression of FAK and IGF 1R (Kanter Lawensohn et al. 1998, Kanter Lawensohn et al. 2000, Kahana et al. 2002). The MAPK and PI3K A kt signaling pathways are constitutively activated through multiple mechanisms in melanoma and plays a major role in tumor progression. It has recently been shown that aggressive melanoma cell lines are resistant to bo th MEK and PI3K inhibitors when administered alone, whereas the combination of MEK with PI3K inhibitors suppresses melanoma growth and invasion (Jaiswal et al. 2009). In this study, I demonstrate a unique approach to melanoma therapy by inhibiting FAK a nd IGF 1R function through specific targeting of the site of their proteinprotein interaction. This study demonstrates that I can inhibit downstream signaling from these tyrosine kinases by targeting their binding site resulting in inhibition of tumor growth in both in vitro and in vivo models.

PAGE 25

25 Esophageal Cancer Esophageal cancer is one of the deadliest cancers worldwide, yet studied the least (Jemal et al. 2003). Worldwide, esophageal cancer is the sixth leading cause of death from cancer (Pisani et al. 1999). According to the National Cancer Institute estimate i n 2009, in the United States, there were approximately 16,500 new cases of esophageal cancer and nearly 14,500 esophageal cancer deaths, making esophageal cancer one of the most deadly of all cancers (http://www.cancer.gov/cancertopics/types/esophageal/). By the time esophageal cancer is diagnosed, >50% of patients have either unresectable tumors or radiographically visible metastases. It is very likely therefore; the 5 year survival rate for all esophageal cancer patients is approximately 1015%. Strong expression of FAK was found in 94.0% of Barrett's esophageal adenocarcinoma compared with 17.9% of Barrett's epithelia, suggesting that FAK might play a critical role in the progression of Barrett's esophageal adenocarcinoma. When esophageal adenocarcinoma cells were treated with the dual FAK and IGF 1R kinase inhibitor, TAE226, cell proliferation and migration were greatly inhibited with an apparent structural change of actin fiber and a loss of cell adhesion. The activities of FAK, IGF IR, and AKT were suppressed by TAE226 and subsequent dephosphorylation of BAD at Ser (136) occurred, resulting in caspase mediated apoptosis (Watanabe et al. 2008). Both IGF IR and its ligands are overexpressed in esophageal cancer tissues compared with the normal ones (Mori et al. 1996, Liu et al. 2002, Ouban et al. 2003). Kalinina et al. examined IGF 1R expression in 234 esophageal tumors and detected over expression of the IGF 1 receptor in 121 of the tumors (52%). They also identified a correlation between the over expression of IGF 1R and reduced overall survival for adenocarcinoma (P=0.05) patients. Subsequently, evaluation of a new tyrosine kinase inhibitor of IGF IR, NVP AEW541, on the signal transduction and the progression of of gastrointestinal (GI) cancers

PAGE 26

26 demonstrated that inhibition of IGF 1R suppressed proliferation and tumorigenicity in vitro and in vivo in a dose dependent manner (Piao et al. 2008). Pancreatic Cancer Pancreatic cancer ranks 13th in incidence, but 8th as a cause of cancer death worldwide. In the United States, pancreatic cancer is the fourth leading cause of cancer death in both men and women. Every year, nearly 30,000 Americans die of pancreatic cancer, which accounts for 22% of gastrointestinal cancer deaths and 5% of all ca ncer deaths (Jemal et al.2004). There is no effective therapy for pancreatic cancer besides surgical resection. Unfortunately, only a minority of patients are candidates for potentially curative surgery as the tumor spreads early to extrapancreatic sites. Patients with metastatic pancreatic cancer survive less than 1 year following diagnosis. The current challenge for both clinicians and scientists is to translate the growing body of knowledge of the molecular basis of this disease into effective strategies for early diagnosis and systemic treatment. Molecular A bnormalities in P ancreatic C ance r The pancreatic ducts are one of the most common sites of human neoplasia, affecting nearly half of the elderly population (Kloppel et al. 1980, Kozuka et al. 1979, Pour at al. 1979). Just as multiple adenomas can occur within the colorectum of an individual, multiple independent benign pancreatic neoplasms tend to be present simultaneously. Only about 1in 500 intraductal neoplasms progresses to cancer, and appears to do so through a series of progressive lesions (Frukawa et al. 1994). The tumor progress ion model for pancreatic neoplasia therefore follows closely upon the model established for colorectal tumors. Molecular studies of pancreatic duct carcinomas have revealed that this cancer is associated with several genetic mutations. Current genetic p rofiles of pancreatic cancer detail are amongst the highest number of gene mutations, per tumor, for any human system known. These

PAGE 27

27 mutations include very frequent mutations of the K ras gene leading to its activation, inactivation of the p16 gene, as well as common inactivations of the p53 and DPC4 genes (Blanck et al. 1999, Almoguera at al. 1988, Caldas et al. 1994). Other alterations that occur in pancreatic cancer include deregulation of growth factors and growth factor receptors, matrix metalloproteinases and regulators of tumor angiogenesis. In addition, amplification of genes from the 8q, 11q, 17q and 20q chromosome arms is common in pancreatic cancer (Mahlamaki et al. 2002). Data from our laboratory has shown increased expression of FAK and IGF 1R in human pancreatic cancers as they progress from normal pancreas to adenocarcinoma and subsequently to metastases (Zheng et al. 2010). Therefore, FAK and IGF 1R appear to be valid targets in pancreatic cancer. Figure 11. FAK struc ture and interacting proteins. FAK protein is composed of an aminoterminal regulatory FERM (band 4 .1, e zrin, r adixin, m oesin homology) domain, a central catalytic kinase domain, two proline rich motifs, and a carboxy terminal focal adhesiontargeting (FAT) domain. Interaction with integrins and growth factor receptors as well as intracellular kinases cause conformational changes in FAK and allow autophosporylation of the Y397 site, which leads to additional phosphorylation and its full activation. Once it is activated, phoshorylated tyrosine sites of FAK create a binding site for the SH2 domain of Src family kinases. SH2 do main binding of Src to FAK releases Src Y527 auto inhibitory interaction and leads the activation of Src. In return, activated Src phosphorylates additional sites on FAK, including residues Y576 and Y577 in the kinase activation loop, promoting further inc reased catalytic activity of FAK (Ucar et al. in press).

PAGE 28

28 Figure 12. FAK signaling. Schematic diagram of FAK interacting proteins and signaling cascades that are involved in apoptosis, cell survival, proliferation, migration, angiogenesis and lymphogenesis (Ucar et al. in press). Interaction with integrins and growth factor receptors as w ell as intracellular kinases cause a conformational change in FAK and allow autophosporylation of the Y397 site, which leads to additional phosphorylation and full activation of FAK. The Y397 phosphorylated tyrosine creates a binding site for the SH2 domai n of Src family kinases. SH2 domain binding of Src to the FAK releases Src Y527 auto inhibitory interaction and leads to the activation of Src. In return, activated Src phosphorylates additional sites on FAK, including residues Y576 and Y577 in the kinase activation loop, promoting further increased catalytic activity of FAK. The activated FAK/Src complex then initiates a cascade of phosphorylation events and new proteinprotein interactions to trigger numerous signaling pathways.

PAGE 29

29 Figure 13. FAK constructs and the domains of interaction between FAK and IGF 1R.

PAGE 30

30 CHAPTER 2 MATERIALS AND METHOD S Cell Lines and Cell Culture Melanoma Cell Lines A375, SK MEL28 cells were obtained from American Type Culture Collection (Rockville, MD). A375 and SK MEL28 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS) and 1 g/ml penicillinstreptomycin. The C8161 cell lines, kindly provided by Dr. William Cance (The Roswell Park Cancer Institute, Buffalo NY), were maintained in RPMI 1640 supplemented with 10% FBS, 1 g/ml penicillin streptomycin. Melanocytes were obtained from Lifeline Cell Technology (Walkersville, MD) and maintained in DermaLife M Melanocyte Culture Medium (Lifeline Cell Technology, W alkersville, MD). All cell lines were incubated at 37C in a 5% CO2 humidified incubator. Esophageal Cancer Cell Lines TE and KYSE group cell lines kindly provided by Dr. Yutaka Shimada (University of Toyama, Toyama, Japan). Esophageal cancer lines were maintained in RPMI 1640 supplemented with 10% FBS, 1 g/ml penicillinstreptomycin. All cell lines were incubated at 37C in a 5% CO2 humidified incubator. Pancreatic Cancer Cell Lines As PC1, Bx PC3, Panc 1 and MiaPaca2 cells were obtained from American Ty pe Culture Collection (Rockville, MD). Panc 1 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS) and 1 g/ml penicillinstreptomycin. MiaPaca 2 cells were maintained in Dulbecco's modified Eagle's med ium supplemented with 10% FBS, 2.5% horse serum and 1 g/ml penicillinstreptomycin. The As PC1 and BxPC3 cell lines were maintained in RPMI 1640 supplemented with 10% FBS, 1 g/ml penicillin

PAGE 31

31 streptomycin. Human pancreatic duct epithelial (HPDE) cells wer e kindly provided by Dr. Carol Otey (University of North Carolina, Chapel Hill, NC) and maintained in Keratinocyte SFM Serum free medium ( Gibco / Invitrogen Carlsbad, CA) supplemented with L Glutamine, EGF&BPE and soy bean trypsin inhibitor ( Gibco / Invitroge n Carlsbad, CA) All cell lines were incubated at 37C in a 5% CO2 humidified incubator. Other Cell Lines FAK knockout mouse embryonic fibroblast cells (FAK / MEFs) were kindly provided by Dr. William Cance (Roswell Park, Buffalo, NY) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS) and 1 g/ml penicillinstreptomycin. IGF 1R knockout mouse embryonic fibroblast cells (IGF 1R / MEF) were kindly provided by Dr. Renato Baserga (Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS) and 1 g/ml penicillin streptomycin. IGF 1R / clones were selected by using 200 mg/ml of Hygromycin B. MCF7, MCF 10A and BT474 cells were purchased from American Type Culture Collection (ATCC, Rockville, MD). BT474 were maintained in RPMI 1640 with 10% fetal bovine serum and insulin 250 ug/ml. MCF7 cells were maintained with Modified minimum Eagles media with 10% fe tal bovine serum, 1X nonessential amino acids (Cellgro, human mammary epithelial cell line was cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium and F12 medium (DMEM F12) supplemented with 5% horse serum, hydrocortisone (0.5 g/ml), insulin (10 g/ml), epidermal growth factor (20 ng/ml), and penicillinstreptomycin (100 g/ml each).

PAGE 32

32 Reagents and Antibodies MTT reagent was purchased from Promega (Madison, WI). CFSE was purchased from Molecular Probes (Eugene, OR). TAE226 was obtained from Novartis (East Hanover, NJ). Gemcitabine (Gemzar) was purchased from Eli Lilly (Indianapolis, IN ). 5 Fluorouracil (5FU) was supplied by Sigma Aldrich Chemical (Poole, UK ). Recombinant Human IGF I was purchased from R&D (Minneapolis, MN). Anti FAK monoclonal (4.47) and anti phosphotyrosine monoclonal (4G10) antibodies were obtained from Upstate (Lake Placid, NY). Anti FAK (C20) antibody and anti IGF Biotechnology (Santa Cruz, CA). Anti His antibody and anti GST antibody were obtained from Sigma (Saint Louis, MS). Anti phosphoIGF 1R and anti IGF 1R antibodies were from Calbiochem (San Diego, CA). Anti phosphoFAK (Tyr397) and anti phosphoSrc antibody were from Biosource (Camarillo, CA). Ant i src, anti caspase 8, anti caspase 9, anti phospho Akt anti Akt anti phosphoERK1/2, anti ERK1/2, were from Cell Signaling Technology (Beverly, MA). Anti caspase 3/7 and anti PARP antibodies were from BD Biosciences (Catalogue #611038, San Jose, C A). This PARP antibody recognized the full length, uncleaved form of PARP. Anti actin antibodies were from Sigma (St Louis, MO). Antiglyceraldehyde 3phosphate dehydrogenase (GAPDH) antibody was from Advanced ImmunoChemical (Long Beach, CA). Cell Viability (MTT) and CFSE Proliferation Assay Cells were plated in 96 well plates and let adhere overnight. After cell treatment, cell viability was measured by 3(4,5dimethylthiazol 2yl) 2,5 diphenyl tetrazolium bromide (MTT) assay (CellTiter 96 AQueous). Br iefly, 20 l of the tetrazolium compound was added to each well. The cells were then incubated at 37C for 1 h. The plate was read at 490 nm with a plate reader to determine the viability. In detachment assays, detached and attached cells were

PAGE 33

33 harvested se parately and counted in a hemocytometer. The percentage of detachment was calculated by dividing the number of detached cells by the total number of cells. For staining with CFSE ( CF(DA)SE, 5,6 carboxy fluorescein diacetate succinimidyl ester ) 1107/ml c CFSE. Staining was terminated by adding culture medium. The cells were washed once in PBS, resuspended in culture medium and 5105 cells plated. Stained cells were cultured with medium alone or with compound for 24, 48, and 72 hours, fixed and analyzed by a FACS Calibur cytometer (Becton Dickinson, San Jose, CA). Unstained cells were included in all experiments and were used to set the conditions on the flow cytometer. Computatio nal Docking The crystal structures of the N terminal domain of FAK (PDB code 2AL6) and the kinase domain of IGF 1R (PDB 1P40A) were utilized for in silico molecular modeling of their interaction as previously described (Ceccarelli et al. 2006, Munshi et al 2002). The three dimensional coordinates of compound NSC344553, obtained from the database of the National Cancer Institute, Developmental Therapeutics Program (NCI/DTP), were docked onto the predicted interface of the amino terminus of FAK (amino acids 127243) with the intracytoplasmic portion of IGF 1R (Zheng et al. 2009). All docking calculations were performed with the University of California San Francisco DOCK 5.1 program, using a clique matching algorithm to orient small molecule structures with s ets of spheres that describe the target sites on FAK (Hewish et al. 2009). 100 orientations were created for NSC344553 in the target site and were scored using the computer program grid based scoring function. Docking calculations were performed on the University of Florida High Performance Computing supercomputing cluster using 16 processors (http:hpc.ufl.edu). The intermolecular energies for all configurations of NSC 344553 in binding to FAK NT2 were calculated as the sum of

PAGE 34

34 electrostatic and van der Waal s energies. These energy terms were evaluated as correlation functions, which were computed efficiently with Fast Fourier Transforms. Production of GST F usion Proteins The FAK GST plasmid constructs (pGEX vector) were kindly provided by Dr. Elena Kurenova (Roswell Park Cancer Insititute, Buffalo, NY). His tagged IGF 1R protein was purchased from Blue Sky Biotechnology (Worchester, MA). The GST fusion proteins (FAK fragments) were expressed in BL21 (DE3) Escherichia coli bacteria by incubation with 0.2 m M isopropyl b D galactopyranoside (IPTG) for 6 h at 37 C. The bacteria were lysed by sonication, and the fusion proteins were puri Sepharose 4B beads (GE Healthcare, NJ). Pull D own Assay For the pull down binding assay, His tagged IGF 1R fragment protein (200 ng) were precleared with GST immobilized on glutathione Sepharose 4B beads by rocking for 1 h at 4 C. The precleared HisFAK fusion protein immobilized on the glutathione Sepharose 4B beads for 1 h at 4 C and then washed three times with PBS. Equal amounts of GST fusion proteins were used for each binding assay. Bound proteins were boiled in 6 Laemmli buffer and analyzed by SDS PAGE and Western blotting. Immunoprecipitation and Wes tern Blotting Cells were washed twice with ice cold 1x phosphatebuffered saline (PBS) and lysed on ice for 30 min in buffer containing 20 mM Tris, pH 7.4, 150 mM NaCl, 1% NP 40, 5 mM ethylenediaminetetraacetic acid, protease inhibitors (CompleteTM Proteas e Inhibitor, Roche, NJ) and phosphatase inhibitors (Calbiochem, CA). The lysates were centrifuged at 13,000 r.p.m. for 30 min at 4C and the supernatants were collected. Protein concentration was determined using Bio Rad Protein Assay. For immunoprecipitat ion, 100200 g of total cell extract was used for each sample. The extracts were incubated with 1 g of antibody overnight at 4C. Twentyfive

PAGE 35

35 microliters of protein A/G agarose beads (Oncogene Research Products, CA) were added and the samples were incuba ted with rocking for an additional 2 h at 4C. The precipitates were washed four times with lysis buffer, resuspended in 30 l Laemmli buffer. For western blotting, boiled samples containing 30 g of protein were resolved by SDS PAGE followed by transferri ng to polyvinylidene difluoride membrane (BioRad, CA). The immunoblots were developed with the Western LightningTM Chemiluminescence Reagent Plus (Pierce Thermoscientific, Rockford, IL). The intensity of the bands in the western blots was measured with sc ion image analysis software program. Short Hairpin RNA Transfection of Cells Control shRNA (mock) and FAK shRNAs was obtained from Open Biosystems. The sequences of short hairpin RNAs against human FAK were: (5CCGGCCGATTGGAAACCAACATATACTCGAGTATATGTTGGTT TCCAATCGTTTTG 3; 5 CCGGGCCCAGAAGAAGGAATCAGTTCTCGAG AACTGATTCTTCTTCTGGGCTTTTTG3) and control shRNA (mock) (5' TCCGAACGTGTCACGT TCTCTTGAA ACGTGACACGTTCGGAGA3'). For the transfection of cells (2x105 cells/well) were seeded into 6 well plates in 2 ml medium one day prior to transfection. According to the protocols of the manufacturer, cells were transfected using Lipofectamine 2000 reagent (Invitrogen, CA). Control cells were only transfected with the Lipofectamine 2000 reagent. GFPF used FAK Constructs and Transfection of Cells FAKNT1 (a.a. 1126), FAK NT2 (a.a. 127243), and FAK NT3 (a.a. 244415) were amplified by PCR using gene specific primers and cloned into the pEGFP C2 vector (Clonetech, Mountain View, CA). All sequences were confirmed by automatic sequencing (ICBR Sequencing Facility, University of Florida). To over express FAK fragments, plasmids pEGFP -

PAGE 36

36 FAKNT1, pEGFPFAK NT2 and pEGFP FAK NT3 were transfected into cells with Lipofectamine 2000 (Invitrogen, CA) according to instructions from the provider. Stable Transduction of Cell Lines Infection of pancreatic cancer cell lines, Panc 1 and Mia paca 2 was done in the laboratory of Dr. Lungji Chang. The lentiviral vectors for luciferase expression were registered on RD 0637 and RD 0633 protocol at the University of Florida. Pancreatic cancer cell lines were trypsinized and counted. The cells were then plated to 24 well trays and incubated at 37 C, humidified 5%CO295% air until 6080% confluent. In each well, volume of 10 l the firefly luciferase and red fluorescent protein (RFP) containing lentivirus particles were added to the medium. After gently swirling the plate to mix, cells were incubated at 37C in a humidified incubator in a n atmosphere of 5% CO2, to allow the optimal transduction efficiency. Four hours later, viral containing medium replaced with fresh medium. Based on expression of RFP protein and flow cytometric sorting of the cells, the pure population of transduced cell was obtained. Detachment Assay Cells were plated with and without inhibitors for 24, 48, and 72 hours, and detached and attached cells were counted in a hemocytometer. I calculated the percent of detachment by dividing the number of detached cells by the total number of cells. The percent of detached cells was calculated in three independent experiments. Apoptosis Assays Tunnel A ssay After treatment of cells for 24, 48, and 72 hours, attached and detached cells were collected, counted and prepared for terminal uridine deoxynucleotidyl transferase (TUNEL) assay by utilizing an APO BRDU kit (BD Pharmingen, San Diego, CA) according to the

PAGE 37

37 manufacturer's instructions. Stained cells were analyzed with a FACSCalibur cytometer (Becton Dickinson, San Jose, CA). Calculation of the percentage of apoptotic cells in the sample was completed with CellQuest software (BD Biosciences). Hoechst S tainin g In addition, apoptotic cells were also analyzed by Hoechst staining. To the prepared cells as described above, Hoechst 33342 (1 g/ml) was added, incubated in the dark room temperature for 10 minutes, and the specimens were mounted on glass coverslips. The slides were viewed under the Zeiss microscope for apoptotic nuclei. The percent of apoptotic cells was calculated as the ratio of apoptotic cells to total number of cells. Over 300 cells per sample were analyzed. Caspase 3/7 A poptosis A ssay For detection of activated caspase 3/7 enzymes, as a confirmation of apoptosis in the treated cells, Apo ONE Caspase3/7 Reagent kit was used (Promega, Madison, WI). 2000 cells were plated into a 96 well glass bottom plate, and treated with different concentrations of the compound. 24, 48 and 72h after the treatment, cells were incubated with 10 profluorescent caspase 3/7 consensus substrate, rhodamine 110 bis (N CBZ L aspartylL glutamyl L valyl aspartic acid amide) (Z DEVDR110), for 30 minutes in the dark at room temperature. Upon cleavage on the C terminal side of the aspartate residue in the DEVD peptide substrate sequence by caspase3/7 enzymes, the rhodamine 110 becomes fluorescent when excited at a wavelength of 498nm. The emission maximum is 521nm. T he amount of fluorescent product generated is representative of the amount of active caspase3/7 present in the sample. Imaging was with a Leica TCS SP5 laser scanning confocal microscope with LAS AF imaging software, using a 40x oil objective.

PAGE 38

38 Kinase Pro filer Screening Kinase specificity screening was performed with Invitrogen's SelectScreen Kinase Profiling Services http://www.invitrogen.com/site/us/en/home/Products and Services/Ser vices/Discovery Research/SelectScreen Profiling Service/SelectScreen KinaseProfiling Service.html INT2 31 ATP, and kinase substrates against ten recombinant kinases according to Z' LYTE Kinase Assay. Invitrogen Adapta Universal Kinase Assay protocol. Tumor Growth in Nude Mice in vivo Six week old athymic, female nude mice were purchased from Harlan Laboratory. The mice were maintained in the animal facility, and all experiments were performed in compliance with NIH animaluse guidelines and under the University of Florida Institutional Animal Care and Use Committees (IACUC) approved protocol. Melanoma X enograft For melanoma study, the University of Florida IACUC approved the following protocol (IACUC Study #200801077). Melanoma cells were injected, 5 106 cells, subcutaneously. When the tumor size reached 100mm3, the INT231 was introduced by intraperitoneal inje ction at a dose of 15 mg/kg daily. Tumor diameters were measured with calipers, and tumor volume in mm3 was calculated using the formula [(width)2 length]/2. At the end of experiment, tumor weight and volume were determined. Patient S ubjects and X enograft The use of human subjects in this study is for the sole purpose of the procurement of solid esophageal and pancreatic tumor tissue for studies reviewed and the specific approval of the

PAGE 39

39 University of Florida Health Center Institution Review Board (IRB) under protocols # 2762008 and 3212005 has already been obtained. For tumor samples from human patients with esophageal or pancreatic cancer, the University of Florida IACUC approved the following protocol (IACUC Study# 2000902767). Up to now, a total of 25 patients, 10 with pancreatic cancer and 15 with esophageal cancer identified and implanted into nude mice. Initially small pieces (0.3 x 0.3 x 0.3 cm) from fresh pancreatic and esophageal human tumor samples were obtained from surgical specimens of patients operated at the University of Florida Shands Hospital, and implanted subcutaneously ingroup of 2 mice for each patient. For esophageal cancer specimens, when one of them has reached 1.5 cc, it excised and was cut into small pieces of (0.3 x 0.3 x 0.3 cm), and transplanted subcutaneously into another 10 mice. When tumors reached ~ 100 mm3, mice were randomized in the following 2 groups, with 5 mice in each group: Group 1: Control: no treatment. Group 2: INT231 (Compound 31): 50 mg/kg/ day in 50 days. This drug has been previously tested by our laboratory and has no measurable toxicity at this dose. Mice were euthanized 30 40 days after tumor innoculation and tumor and tissue collected. For inhibition of tumor growth in our subcutaneous model, tumor volumes (length X width X height X p/ 6) and body weights were determined daily including weekends and holidays, to monitor tumor growth and evaluate overall clinical condition, taking into account weight loss and indications of pain, distress, or abnormal behavior and physiology. Experiments were terminated when the mean control tumor volume is 1.5cc (approximately 3040 days).

PAGE 40

40 Antitumor activity was expressed as T/C% (mean increase of tumor volumes of treated animals divided by the mean increase of tumor volumes of control animals multiplied by 100). Orthotopic model of pancreatic cancer For othotopic model of pancreatic cancer, the University of Florida IACUC a pproved the following protocol (IACUC Study# 2000801506). The pancreatic cancer cell lines, Mia paca 2 and Panc 1 cells were stably transfected using luciferase RFP (red fluorescent protein) reporter gene for in vivo imaging of the xenografts. Following expansion and sorting of RFP positive cells, cells were expanded in culture and 5x106 tumor cells were implanted into pancreas of 20 mice. For intra pancreatic implantation of cells, mice were anesthetized with Isoflurane using the ACS provided and ma intained rodent anesthesia machine. Under sterille surgical conditions, via 1.0 cm incision of the skin, abdominal wall and peritonium, the spleen was retracted and cells were injected in 30 gauge needle. T he abdominal wall and peritoneum was sutured using 5.0 absorbable surgical sutures and the skin was closed with medical glue (dermabond). Postoperative analgesia was 0.05 mg/kg of buprenorphine subcutaneously per 8 12 hours postoperatively. When tumors re ach ~ 100 mm3, mice were randomized in the following 4 groups, with 3 mice in each group: Group 1: Control: no treatment. Group 2: Gemcitabine: 40 mg/kg in 50 L treated every 5 days for three weeks by intraperitoneal (i.p) administration. Group 3: IN T2 31: 15 mg/kg/ day in 50 L by i.p administration Group 4: Combination of Gemcitabine and INT231 treatments Mice were hand restrained prior to intraperitoneal injections. Mice were euthanized 6 weeks after tumor innoculation and tumor and tissue col lected. As described below, mice were

PAGE 41

41 imaged weekly with the IVIS lumina imager and tumor size will be estimated by the bioluminescent signal. In vivo I maging of M ice I performed noninvasive imaging in all tumor bearing mice expressing bioluminescent tags. I used the IVIS lumina platform and employ ed tumors that express a luciferase reporter gene. To accomplish the imaging, mice were anesthetized with Isoflurane using the ACS provided and maintained rodent anesthesia machine. I used a cryogenically cooled IVIS Imaging System (Xenogen) with Living Image acquisition and analysis software (Version 2.11, Xenogen) to detect the bioluminescence signals in mice. For mice be aring tumors expressing a luciferase reporter gene, prior to imaging, mice were injected intraperitoneally or subcutaneously with 150 mg of luciferin (Xenogen Corp., Alameda, Calif.) per kg of body weight in 100 L using a 2527 g needle. The area of injection was cleaned using standard surgical disinfectant, all solutions are sterile and satisfy the drug policy of the University of Florida. After 10 min, the mice were anesthetized as described above and placed on heated sample shelf. The imaging system fir st took a photographic image in the chamber under dim illumination; this followed by luminescent image acquisition. An integration time of 1 min will be used for luminescent image acquisition for all mouse tumor models. I used Living Image software to i ntegrate the total bioluminescence signals (in terms of photon counts) obtained from mice. The in vitro detection limit of the IVIS Imaging System is 1,000 ES 2/luc cells. E ach animal studied no more than weekly over a six weeks period. Based on the luminescent signal, the tumor size can be easily estimated. On day 42 or when the tumor size reached 1.5 cc in size, the mice were euthanized.

PAGE 42

42 Immunohistochemistry Xenograft tumor tissue was fixed in 10% formalin and embedded in paraffin. For Ki67 st aining, samples underwent deparaffinization utilizing 3% hydrogen peroxide and blocked with methanol for 10 minutes. Antigen retrieval was performed with pH 6 Dako solution (s1699) heated in a steamer for 20 minutes followed by a 20 minute cool down in sol ution. Following antigen retrieval, the samples were incubated with the blocking reagent, Background Sniper (BioCare), for 15 minutes. Subsequently, the primary antibody, Ki 67 (Dako M7240), was applied at 1:200 concentration and incubated overnight at 4oC. The secondary antibody used was Mach 2 Anti Mouse HRP Polymer (BioCare), applied for 30 minutes. The tissues were stained with the chromogen DAB and counterstained with hematoxylin and 1% TBS. For assessment of apoptotic cells, in situ TUNEL staining ( DeadEndTM Colorimetric Apoptosis Detection System, Promega, Madison, WI) was performed according to instructions from the provider. Statistical Analyses Data presented are the means and 95% confidence intervals of the three or more experiments. For in vitro and in vivo experiments comparison between groups were made using a two tailed two sample Students t test. Differences for which P value was less than 0.05 were considered statistically significant. Further Studies Up to present, I have been evaluating a couple of lead compounds that target the interaction site of FAK and IGF 1R. Currently, I have started to evaluate derivatives of our leading compounds to modify their structures to achieve optimal target binding. In addition, characterization of the structural features of the compounds would allow us to define a site on the compound where I can place a ligand to bind our compound to a column and capture proteins

PAGE 43

43 from cell lysates to determine possible interaction partners of the compound. To test the binding of derivatives of the compounds and their ability to disrupt protein protein interactions we are planning to use ELISA and Biacore analysis as biophysical approaches. ELISA Test Two different enzyme lin ked immunosorbent assays were performed to study binding between IGF 1R beta subunit and FAK NT. The first assay involves interaction of IGF 1R with immobilized FAK NT; the second involves interaction of FAK NT with immobilized IGF 1R. In the first case, 9 6microtiter plate wells were coated with purified GST fused FERM domain of FAK in 50 l of PBS (NaCl 137 mM, KCl 2.7 mM, Na2HPO4 4.3 mM, KH2PO4 1.4 mM) overnight at 4C. Wells were then rinsed with wash buffer (PBS, 0.05% Tween) and blocked with 200 l of blocking buffer (PBS, 1% BSA) for 3 h at 37C. After rinsing three times with wash buffer, with or without the compounds,100 l of binding buffer (PBS, 0.05% Tween, 1% BSA) containing 0.2 M of purified IGF 1R whole protein was added to the wells and let to react for 1 h at 37C. Wells were rinsed again three times and 100 l of binding buffer containing 200 ng/ml of a primary antibody anti IGF 1R (sc 613 Santa Cruz) was added and incubated for 1 h at 37C. After three additional rinsings, 100 l of the sa me buffer containing a secondary HRP anti rabbit antibody was added and incubated for another hour at 37C. Finally, 100 l of ABTS substrate (2,2' azinobis [3ethylbenzothiazoline 6sulfonic acid] diammonium salt) was applied and the plate was kept in the dark until the color intensity of positive controls was maximum and the negative controls did not develop nonspecific reactions (6 10 min). The ELISA plate was scanned in a Biotech ELISA reader at 450 nm.

PAGE 44

44 For the second assay, the same method was applied, but IGF 1R was immobilized in the wells and incubated with FAK NT. Primary antibody anti FAK4.47 (05537, Upstate) was used to reveal the binding reaction. BIACORE Analysis Biacore T100 technology was used in conjunction with ELISA analysis to characteri ze the thermodynamic binding parameters of small molecule compounds targeting interaction site of FAK and IGF 1R. All experiments were performed using a Biacore T100 optical biosensor (http://www.biacore.com). Series S CM5 sensor chips, N hydroxysuccinimide (NHS), N ethyl N (3 dimethylaminopropyl) carbodiimide (EDC), ethanolamine HCl, and instrument specific consumables and accessories were provided by ICBR at the University of Florida. FAK NT immobilization In order to reuse of sensor c hip for both FAK and IGF 1R, I decided to immobilize anti mouse secondary antibody to the sensor chip surface. By this way, I would be able to use primary antibody to immobilize the ligand protein on the surface as well as eliminating the possibility to masking the interaction site of proteins during immobilization of protein on the chip surface. Immobilization procedures were performed using Hepes buffered saline (HBS: 10 mM Hepes and 150 mM NaCl, pH 7.4) as the running buffer. Sensor chip surfaces were first preconditioned with two 6s pulses each of 100 mM HCl, 50 mM NaOH, and 0.1% sodium mouse antibody surfaces were prepared using amine l/min. NHS/EDC was injected for 15 min to activate the surface, 100 g/ml antibody (dissolved in 10 mM sodium acetate, pH 4.5) was injected for 10 min, and finally ethanolamine was injected for 7 min to block residual

PAGE 45

45 activated groups. This immobilization procedure yielded 5000 to 7000 resonance units (RU) of immobilized antibody. After immobilization, the instrument was primed extensively with the analysis running buffer (50 mM Tris HCl, 150 mM NaCl, 10 mM MgCl2, 0.1% Tween 20, 0.1% Brij35, and 5% dimethyl sulfoxide [DMSO], pH 8.0). After immobilization of anti mouse antibody, 100 g/ml mouse anti FAK 4.47 antibody (05537, Upstate) (dissolved in 10 mM sodium acetate, pH 4.5) was injected for 10 min, and sensor chip surfaces were washed to remove unbound a ntibodies with three 5 s pulses each of 100 mM HCl, 50 mM NaOH, and 0.1% yielded 15000 to 20000 resonance units (RU) of immobilized primary antibody. Finally, 200 g/m l FAKNT (dissolved in 10 mM sodium acetate, pH 4.5) was injected for 10 min and and sensor chip surfaces were washed with three 5 s pulses each of 100 mM HCl, 50 mM NaOH, and ion yielded 30000 to 40000 resonance units (RU) of immobilized FAK NT. Capture of IGF 1R Aliquots of IGF 1R were kept frozen at 200 g/ml IGF 1R (dissolved in 10 mM sodium acetate, pH 4.5) was injected for 10 min and unbound protein was removed by passing the solution over a fast desalting column (equilibrated with 50 mM Tris HCl, 150 mM NaCl, and 10 mM MgCl2, pH 8.0) twice. The capture procedure yielded typically to densities of 20004000 RU) onto a FAK NT su rface at 25 C. A primary antibody bound surface served as the reference. Preparation of analyte solutions For stock solutions, the compounds were dissolved in 100% DMSO to a concentration of 10 mM; further dilutions of the compound stocks into DMSO and/or running buffer were performed immediately prior to analysis. To match precisely the DMSO content of the analytes

PAGE 46

46 and running buffer, a secondary stock of lower concentration was prepared by diluting the compound in DMSO to a concentration such that the ad 1 ml of 50 mM Tris HCl, 150 mM NaCl, 10 mM MgCl2, 0.1% Tween 20, and 0.1% Brij 35 (pH 8.0) yielded a compound concentration that was nine times greater than the high concentration chosen for analysis. This startin g concentration was diluted ninefold in analysis running buffer to yield the high concentration. An additional ninefold dilution of this sample produced the low concentration. The propagated errors in the concentrations of the high and low analyte concentr ations were calculated to be approximately 3.0%. Analysis parameters At each temperature, five buffer blanks were first injected to equilibrate the instrument wa s monitored for 1 to 20 min. (The selected injection and dissociation times were determined in preliminary binding tests.) For the tightly bound complexes, a regeneration step was required. At 4 to 11 C, the surface was regenerated with 10 100s pulses of 60% ethylene glycol; at 16 to 18 C, 40% ethylene glycol; at 22 to 28 C, 30% ethylene glycol; and at 32 to 39 C, 50 mM Tris HCl, 150 mM NaCl, 10% ethylene glycol, 15 mM ATP, 15 mM MgCl2, 5% DMSO, and 0.1% Tween 20 (pH 8.0). The data collection rate was 10 Hz. Data analysis Biosensor data, processed and analyzed using Scrubber 2 (BioLogic Software, Australia), were fit to either a simple 1:1 model (A + B = AB) or a 1:1 interaction model that included a mass transport term (Ao = A, A + B = AB). Equilibrium dissociation constants determined in curvature in the ln(KD) versus 1/T plots indicated that using this approach was unnecessary.)

PAGE 47

47 1/T plot s using the Regression function in Excel, where the slope and intercept corresponded to a downloadable macro called SolverAid (http://www.bowdoin.edu/~rdelevie/ex cellaneous). a statistical readout in Microsoft Excel. The values obtained from both methods agreed well. Standard errors were propagated according to the general formula downloadable macro Propagate (also available at http://www.bowdoin.edu/~rdelevie/excellaneous).

PAGE 48

48 CHAPTER 3 RESULTS AND DISCUSSI ON Results Structure B ased in silico M olecular M odeling and C omputational D ocking Previous studies in our laboratory have demonstrated that the amino terminus of FAK (aa 127243, FAK NT2) directly binds with a portion of the intracytoplasmic portion of IGF 1R containing kinase domain (aa 9591266) (Zheng et al.2009). In collaboration with Dr. David Ostrov, we analyzed the possible models of interaction of the FAK FERM domain and IGF 1R kinase domain using DOCK5.1 computer program and selected small molecule compounds predicted to disrupt these proteins interactions. Based on the known crystal structures of the FAK FERM domain and IGF 1R kinase domain the pmol computer program predicted three possible orientation s for the interaction (Figure 3 1). 250,000 small molecule compounds from NCI Database with known 3D structure and which correspond to Lipinski rules were docked into the site of interaction between FAK and IGF 1R in 100 different orientations for each possible orientation The top scoring compounds were obtained from the National Cancer Institute Developmental Therapeutics Program. The initial screening of IGF 1R/FAK targeted small molecules was performed based on compounds effect on cell viability using MTT assay (Figure 32). Subsequently, compounds with high probability to bind to the interface (by predicted energies of interaction) and causing reduced cell viability were screened for their ability to inhibit the interaction of FAK and IGF 1R. Among all the compounds tested, I identified our lead compound, INT231 (NSC 344553), as the most potent FAK/IGF 1R binding inhibitor ( Figure 3 3). This compound is listed as interacting in the third predicted orientation of FAK with IGF 1R (Table 3 1). The structure and predicted energies of interaction are demonstrated in Figure 34. The intermolecular energies for all configurations of INT2 31 in binding to FAK NT

PAGE 49

49 were calculated as the sum of electrostatic and van der Waals energies. These energy ter ms were evaluated as correlation functions, which were computed efficiently with Fast Fourier Transforms. INT2 31 Disrupts the I nteraction of FAK and IGF1R The potency of INT231 to disrupt the proteinprotein interactions of FAK and IGF 1R was evaluated by pull down assays using tagged purified protein constructs. INT231 caused a dose dependent decrease in binding between purified GST FAKNT and IGF 1R average IC50 of 3.96 M ( Figure 3 5). Because other compounds had higher predicted energies of interaction with the FAK FERM domain as compared to INT2 31, I evaluated several top scoring compounds for their effects on the disruption of the interaction between FAK and IGF 1R. I chose to evaluate compounds that both inhibited cell viability by MTT and those that did not significantly reduce cell viability. It is possible that compounds that did not reduce cell viability were not able to penetrate into the cell and therefore, required testin g in purified protein assays using GST pul ldowns. If compounds could disrupt protein interactions but not reduce cell viability, such compounds could be considered for modifications allowing for better cell penetration. Therefore, two other high scoring compounds that demonstrated affinity for the FAKFERM domain but did not significantly alter cell viability by MTT assay were evaluated and were found to not disrupt the binding by GST pulldown. To characterize effects of INT2 31 in vitro I chose two melanoma cell lines that we already had in our lab and first analyzed FAK and IGF 1R expression. I found that INT231 disrupted binding in C8161 and A375 melanoma cancer cells at low micromolar concentrations (IC50 of 2.72 and 3.17 M, respectively) as demonstrated by co immunoprecipitation assay ( Figure 36A, B). In contrast, another NCI compound ( NSC 250435, compound 17 ) that was shown to

PAGE 50

50 inhibit cell viability by MTT assay did not disrupt the protein inter action by coIP in C8161 cells. INT2 31 R educes the V iability of C ancer C ells To determine the effect on melanoma cell viability, three human melanoma cell lines were exposed to increasing doses of INT231 over 72 hours and the results compared to human melanocytes. As shown in Figure 3 7, INT2 31 inhibit s viability of cancer cells more than normal cells. All three melanoma cell lines had upregulated FAK and IGF 1R expression and increased sensitivity to INT2 31 compared to normal human melanocytes. The effects of INT231 varied in the three cell lines a nd were possibly related to constitutive FAK and IGF 1R activation with the least sensitive cell line (SK MEL 28) having the greatest expression of FAK and IGF 1R. In addition, I analyzed the effect of INT2 31 on cell viability of esophageal, pancreati c and breast cancer cell lines and determined the IC50 value for each cell lines as shown in T able 32. To get the average IC50 value, each cell line was treated with increasing concentrations of the compound for 72 hours in triplicates and the average of IC50 values from three separate experiments was calculated. Similar to melanoma results, INT2 31 inhibits viability more in cancer cells compared to normal cells. Of not e, sensitivity of the cells to INT231 varies and directly correlated to FAK and IGF 1R expression in the cells. INT2 31 I nhibits C ancer C ell P roliferation and its A ctivity D epends on the P resence of FAK and IGF1R To assess the effects of INT2 31 on cell proliferation, a CSFE cell distribution assay was perform ed. As shown in Figure 38 INT2 31 inhibited cell proliferation in both C8161 and A375 cells with C8161 cells being more sensitive. A time course of cell counting demonstrated potent inhibition of the growth of C8161 melanoma cells ( Figure 39). After 24 hours of

PAGE 51

51 treatment, cell number was decreased by more than 60%, which correlates with MTT data ( Figure 3 7). I also obtained similar results when I analyzed the effects of INT2 31 on cell proliferation in esophageal and pancreatic cancer cell lines (data not shown). To show that the effect of INT2 31 was specific for cells expressing FAK, C8161 were treated with FAK shRNA constructs resulting in transient knockdown of FAK ( Figure 310A). C8161 cells expressing FAK shRNA were sig nificantly less sensitive to the effects of INT2 31 than parental and mock transfected cells ( Figure 310B). Currently, I are designing shRNA constructs to stably knockdown of FAK in esophageal and pancreatic cell lines to perform in vitro an d in vivo experiments to show the specificity of the compound. Moreover, I assessed the specificity of compound on FAK and IGF 1R proficient and deficient mouse embryonic fibroblasts (MEFs). The treatment of cells with 0.01 to 1 M concentrations of INT231 for 72 hours was analyzed by MTT assay. As shown in Figure 311A, B, FAK/ and IGF 1R / fibroblasts were significantly less sensitive to the effects of INT2 31 than FAK+/+ and IGF 1R +/+ cells (p<0.05). On the other hand, the dual inhibitor of FAK and IGF 1R, TAE 226 (Novartis, Basel) control was ineffective on IGF 1R / yet reduced the viability of FAK / cells ( Figure 3 1 1). The sensitivity of FAK / cells to TAE 226 is very likely due to nonspecific effects of TAE 22 6 with inhibition of IGF 1R kinase activity and possibly other kinases. INT2 31 I nduces A poptosis but not Detachment Since FAK is an important protein for adherence of cells and targeting FAK raises concern about the detachment and metastasis of cancer cells, I assessed the effect of INT2 31 on detachment of treated cells. Detachment of cells was determined in the presence of increasing concentrations of INT231. As shown in Figure 311, only 7% of C8161 cells detached from the plate after 72 hours of treatment with 5 M 31. The effect of INT2 31 was significantly

PAGE 52

52 less than the dual FAK and IGF 1R kinase inhibitor TAE 226 (Novartis, Basel). This result shows that inhibition of the kinase activity of FAK may allow cancer cells to become detached and metastasize, whereas disruption of interaction between FAK and IGF 1R with a small molecule blocks downstream signa ling without interfering normal function of FAK. Similar to melanoma cell lines, adherence of esophageal and pancreatic cancer cell lines were unaffected by the treatment of compound (data not shown). The effect of INT2 31 on cell survival was marked with a greater than 50% induction of cell death as indicated by the detection of apoptotic cells in Hoescht staining after 72 hours of treatment with a 5 M dose ( Figure 313). This was confirmed by presence of activated caspase 3/7 in C8161 melanoma cells after treatment for 48h with 1 M and 5 M of INT2 31 as detected by confocal microscopy ( Figure 314). Finally, the effect of INT2 31 was evaluated by Western blot. As demonstrated in Figure 315, PARP and caspase9 cleavage is seen after 48 hours treatment with INT2 31 at low 1 M concentration. There was no significant effect of INT2 31 on caspase 8 levels indicating induction of apoptosis through activation of t he intrinsic pathway only. INT2 31 D ecreases A ctivation of Akt The effect of INT2 31 on FAK and IGF 1R pathway effectors was analyzed in three melanoma cell lines at different concentration and treatment times (Figure 316). INT2 31 treatment resulted in a consistent inhibition of constitutive and IGF 1 induced signaling to AKT Of note, there was no significant effect of INT2 31 on the constitutive phosphorylation of FAK or the constitutive or IGF 1induced phosphoryl ation of IGF 1R. In addition, while there was a pronounced effect on Akt the effects on signaling to ERK was minimal with a slight decrease in pERK in all cell lines after treatment with higher doses The effects of INT2 31 on pAkt correlated wi th the effects on cell growth, viability and apoptosis in melanoma cell lines. C8161

PAGE 53

53 cells were the most sensitive with significant inhibition of pAkt at 0.51 M, while higher doses of INT2 31 were necessary to significantly decrease p Akt in A375 and SK MEL28 cells (1 5 M and 510 M, respectively) ( Figure 3 16B, C) The analysis of time course of the INT2 31 treatment on Akt phosphorylation revealed some dephosphorylation after 24 hours of treatment with a sustained effect at 72 hours ( Figure 316 D). Therefore, INT231 decreases signaling through pathways downstream of FAK and IGF 1R. Because treatment of cells with INT2 31 decreases the phosphorylation of Akt I evaluated the effect of INT2 31 on kinase activity of proteins that are involved in this signaling pathway. To insure that the decrease in the phosphorylation of Akt is due to disruption of FAK and IGF 1R interaction but not due to off target inhibition of kinases, I utilized the Invitrogen's kinase screening s ervice. The effect of this compound on the kinase activity of FAK, IGF 1R, insulin receptor, VEGFR 1, AKT 1, EGFR, VEGFR2, c MET, PDGFRa, p70S6K, Src and PI3Kinase was determined (Figure 317). At a dose of 1 M, this compound did not inhibit the kinase activity of FAK or IGF 1R and did not inhibit any of the other protein kinases by more than 22%. Further more to confirm that INT2 31 specifically binds to NT2 (aa 127243) region of FAK to disrupt interaction with IGF 1R and decreases phosphorylat ion of Akt I transfected C8161 cells with 3 GFP fragments of the FAK N terminus (FAK NT1, FAKNT2 and FAKNT3). As shown in Figure 318, overexpression of FAK NT2 fragment reduced the IGF 1 induced phosphorylation of AKT compared to FAK NT1 and NT3 overexpressed cells. Therefore, it appears that over expression of the FAK interaction module (FERM NT2 region) yield the same phenotype Confirmation of these results is required as FAK overexpression frequently results in c ell toxicity and inconsistent results. In addition, FAK NT fragments

PAGE 54

54 frequently are seen in the nucleus following overexpression and therefore may not accurately reflect findings compared to normal intact FAK expression. INT2 31 S ensitized C ancer C ells t o C hemotherapy To evaluate and correlate the effect of INT2 31 on Akt de phosphorylation with the sensitivity of cells to conventional chemotherapy, esophageal and pancreatic cancer cell lines were analyzed for the effects of combination therapies on cell viability and apoptosis. Both KYSE 70 and 140 esophageal cancer cells were sensitive to INT2 31 and 5FU treatment and 0.5 and 1 M INT2 31 had synergistic effects with 5FU ( Figure 319). In our pancreatic cancer cells, while the effect on cell viability of INT2 31 was only additive when combined with gemcitabine (data not shown), INT231 had synergistic effects with 5 FU chemotherapy at 1 M concentrations ( Figure 3 20). INT2 31 D ecreases T umor G rowth in M elanoma X enograft M odel T hrough I nhibiting P hosphorilation of Akt The effect of INT2 31 was evaluated in two melanom a subcutaneous xenograft models For defining the optimal dose, I used 100, 50, 20 and 15 mg/kg doses via intraperitoneal injection The 100mg/kg dose was highly toxic and in a week caused death of two mice out of five (data not shown) The 50mg/kg dose when administrated via daily intraperitoneal injection caused slight body weight loss. Therefore, a s d emonstrated in Figure 32 1A and B I preferred to use the 15mg/kg dose for further experiments D aily intraperitoneal injection of 15mg/kg of INT2 31 for 21 days resulted in a significant decrease in C8161 and A375 tumor growth compared to mice receiving PBS control injections (p<0.05). At this concentration the drug did not have serious toxic ity as there was no significant difference in body weights betwe en animals in each group. To assess the in vivo effects of INT2 31 on cell proliferation, I stained C8161 xenografts with Ki67 antibody. As shown in Figure 321 C, immunohistochemical staining of

PAGE 55

55 C8161 tumors demonstrated that the percent of cells reactive to Ki67 and the intensity of Ki67 staining were significantly decreased in the C8161 tumors from mice treated with INT2 31 compared to PBS group. In addition, the percent of cells undergoing apoptosis was significantly increased in the tum ors treated with INT2 31 compared to control ( Figure 3 21C, p<0.05). This confirmed our in vitro data that the drug decreases proliferation and increases apoptosis of cancer cells. The effect of INT2 31 on the in vivo interaction of FAK and IGF 1R in C8161 tumors was analyzed by immunoprecipitation of FAK from treated and untreated tumor and is illustrated in Figure 321 D. Western blot for IGF 1R demonstrates a decrease in the coimmunoprecipitation of FAK and IGF 1R. Densitometry of t he ratio of IGF 1R to FAK in each tumor showed a decreased mean ratio in INT2 31 treated (0.78 + 0.16) compared to PBS treated (0.98 + 0.11, p=0.09) tumor samples. Finally, tumor analysis for pAKT expression by Western blot analysis demonstrates a decrease in phosphorylation of AKT in animals treated with INT2 31 vs PBS control (Figure 3 21E). Therefore, our lead compound, INT231, decreases in vivo tumor growth, disrupts the in vivo interaction of FAK and IGF 1R and results in a decrease in phosphorylation of AKT In vitro and in vivo I nhibition of E sophageal C ancer V iability and P roliferation With INT2 31 T reatment Esophageal cancer ha s been shown to overexpress FAK and IGF 1R. To assimilate the effects of targeting the interaction of these proteins in direct patient specimens, I developed a system in which I grow direct esophageal cancer specimens in mice and tissue culture plates to allow fresh human tissue for experimentation Up to now, I have collected more than 20 tumors and corresponding normal tissue specimens from cancer p atient s Immunohistochemical and western blot analysis of the samples also demonstrated increased level of FAK and IGF 1R in tumor samples compared to the normal tissue. To evaluate the in vitro effect s of INT2 31 on

PAGE 56

56 patient specimens, I utilized MTT assay of cells grown in a tissue culture plate maximum up to eight passages. A representative result of MTT assay of esophageal patient # 5 shown in Figure 322A I ncreasing concent r ations of INT131 effectively decreased the viability of cells with an average IC50 value of 2.18 M. Subsequently, I evaluated the inhibition of in vivo tumor growth of esophageal patient #5 specimen. As described in method s section, I initially implanted small pieces (0.3 x 0.3 x 0.3 cm) from a fresh esophageal human adenocarcinoma tumor sample subcutaneously into 2 mice. When one of tumors has reached 1.5 cc3, it was excised and cut into small pieces of (0.3 x 0.3 x 0.3 cm), and transplanted subcutaneously into another 10 mice. When tumors reached ~ 100 mm3, mice were randomized in the 2 groups, with 5 mice in each group. As demonstrated in Figure 322B, daily intraperitoneal injection of 50 mg/kg of I NT2 31 for 21 days resulted in a significant decrease in fresh esophageal adenocarcinoma tumor growth compared to mice receiving PBS control injections (p<0.05). At this concentration the drug did not have serious toxic effect s as t here was no significant difference in body weights between animals in each group. To assess the in vivo effects of INT2 31 on cell proliferation, I stained esophageal patient #5 tumor specimen xenografts with Ki67 antibody. As shown in Figure 322C, immunohistochemical staining of tumors demonstrated that the percent of cells reactive to Ki67 were significantly decreased in the tumors from mice treated with INT2 31 compared to PBS group. This confirmed our in vitro data that the drug decreases proliferation of cancer cells and in vivo data for melanoma model. Inhibition of Orthotopic P ancreatic Xenografts With INT2 31 T reatment Since human pancreatic cancer is an aggressive malignancy with redundant survival pathways, I hypothesized that FAK and IGF 1R physically interact to provide essential survival signals for pancreatic cancer cells. In addition, I hypothesize that simultaneous inhibition of

PAGE 57

57 these signals will induce cellular apoptosis and sensitize these cells to proapoptotic therapies. To further validate the activity and specificity of INT2 31, I employed orthotopic mouse models. The pancreatic cancer cell lines, Mia paca2 and Panc 1 cells were stably transfected using luciferaseRFP (red fluorescent protein ) reporter gene for in vivo imaging of the xenografts. Following expansion and sorting of RFP positive cells, cells were expanded in culture and 5x106 tumor cells were implanted into the pancreas of 14 mice. As described in the materials and methods section mice were imaged weekly with the IVIS lumina imager and tumor size were be estimated by the bioluminescent signal. When tumors reach ~ 100 mm3, mice were randomized in the following 2 groups, with 7 mice in each group: Control and 15mg/kg INT2 31. As shown in Figure 3 23, daily intraperitoneal 50mg/kg treatment of Miapaca2 and subcutaneous 15mg/kg injection of INT2 31 for 21 days sufficiently reduced the growth of the orthotopic pancreatic xenografts without any significant side effects as measu red by body weights and the appearances of the animals. Discussion FAK and IGF 1R are two important tyrosine kinases that control many signals leading to proliferation, invasion and metastasis. Our hypothesis is that FAK interacts with IGF 1R to provide essential survival signals for many cancer cells. FAK and IGF 1R also interact with many other proteins that provide survival signals to tumors. The best defined pathway by which IGF 1R signaling can prevent apoptosis is mediated by phosphoinositide 3kin ase (PI3K) signaling to Akt Activated Akt /PKB plays a key role in the prevention of apoptosis. It phosphorylates and inactivates several proteins that are involved in apoptosis including Bad (Bcl 2 family member). There is evidence of Akt involvement in human malignancies. Akt was found to be amplified 20fold in primary gastric adenocarcinoma. Additional

PAGE 58

58 studies have shown genomic amplification and overexpression of Akt in several cancer cell lines (Staal et al. 1987, Ruggeri et al. 1998). It has been shown that FAK activates proliferation and inhibits apoptosis through PKC and the PI3K Akt pathway, which results in induction of cyclin D3 expression and CDK activity (Yamamoto et al. 2003). Therefore, activation of either FAK or IGF 1R induces the PI3KAkt pathway and cell survival. Clearly, there is crosstalk and redundancy in the signaling via these tyrosine kinases, but the pathways diverge as well. Induction of the IGF 1R results in MAPK pathway activation, which is inde pendent of FAK phosphorylation and activation (AlbertEngels et al. 1999). It has been shown that a member of the MAPK pathway (MEK kinase 1) binds to FAK, linking FAK to possible activation of this pathway (Yujiri et al. 2002). It has also been shown that FAK is activated by IGF 1R, and that IRS 1 is a substrate for FAK and that FAK activity regulates IRS 1 mRNA levels (Baron et al. 1998, Lebrun et al. 1998). Furthermore, it has been shown that FAK participates in integrinmediated phosphorylation of the insulin receptor (Annabi et al. 2001). However, IGF 1R activity is not required for the phosphorylation of FAK and FAK activity is not required for phosphorylation of the IGF 1R. Due to this overlap and divergence in signaling from these tyrosine kinases, inhibition of either pathway alone may not be as efficacious as dual inhibition of both FAK and IGF 1R. While emerging data strongly suggests that FAK is an excellent target for developmental therapeutics of cancer, specific small molecule kinase inhibitors of FAK have been difficult to obtain (McLean et al. 2005, Van Nimwegen et al. 2007). Three such kinase inhibitors were reported from Novartis (NVP TAE 226) and Pfizer (PF573,228 and PF 562,271), but only PF 562,271 is in clinical trials in cancer pa tients (Shi et al. 2007, SlackDavis et al. 2007, Roberts et

PAGE 59

59 al. 2008). Industry leaders are exploring the utility of antibodies to the extracellular domain of IGF 1R. These antibodies are under investigation in multiple tumor types. Six companies are cu rrently testing small molecule kinase inhibitors targeting the IGF 1R tyrosine kinase (Pollak et al. 2008, Hewis et al. 2009). Such approaches targeting the ATP competitive binding site lack specificity for IGF 1R or FAK inhibition. Due to sequence homogeneity, particularly in the kinase domain, and structural similarity of IGF 1R to other receptors such as the insulin receptor, the main problem with kinase inhibitors is their lack of specificity. In addition, it frequently appears that disruption of the kinase domain does not specifically interfere with the downstream signaling of FAK or IGF 1R a nd it is unclear whether the kinase function or the scaffolding function of these proteins is more important. To date, the approaches to dual FAK and IGF 1R inhibition by our laboratory and others have mainly focused on direct kinase inhibition. In this work, I demonstrate a novel approach for therapy in several cancer types by targeting FAK IGF 1R protein protein binding. Our data, using computer modeling and functional approaches has identified a novel small molecule (INT2 31, NSC 344553) that disrupts the interaction of FAK with IGF 1R. This small molecule inhibits FAK and IGF 1R dependent signaling and cancer cell viability in vitro and inhibits in vivo tumor growth. It is possible that the observed effects of INT2 31 are due to multiple effects on cancer cells including inhibition of cell proliferation resulting in cell apoptosis. Lending support to this consideration is the structure of INT2 31 as it resembles a nuc leoside analog which can have effects on DNA and the cell cycle. Further studies to confirm the mechanism of action of this compound are necessary. In order to confirm that this inhibitor is truly binding to FAK, secondary confirmatory experiments must be undertaken using biophysical techniques. The

PAGE 60

60 molecular mode of action of the FAK IGF 1R inhibitors at the atomic level, can be provided by c ocrystallization with the N terminal domain of FAK. This will also provide key structural information that will be essential for the rational development of improved compounds. The prospect for novel inhibitors of protein interactions is very promising, especially, when the X ray crystal structure of the small molecule bound to its target can be obtained. This pr ovides detailed molecular information about the targetsmall molecule fragment interaction surface on which to build, using in silico methods, chemicals that both look like the binding site and have similar contacts with the target molecule. Other noncry stallographic methods such as Biacore and ITC ( i so t hermal c alorimetry) should be used to provide evidence of binding. If these methods are not successful in evaluating the kinetics of interaction of INT2 31 with FAK and/or IGF 1R, alternative approaches a re routinely available such as an ELISA assay as a secondary method to validate target interaction. Demonstration of physical binding by these methods is important as a triage step prior to cocrystallization. Although our data suggests that INT231 does not significantly alter the kinase activity of the 12 kinases selected for study, it is still possible that INT2 31 alters the kinase activity of other kinases. Since, a limited kinase profiler screen was performed showing lack of direct target inhibitio n and it would be worthy to expand this screen to potentially identify some targets that may be regulating cell cycle progression as this (rather than apoptosis) connection is the strongest with regard to connecting the in vitro with in vivo effects. In addition, while some cell lines are sensitive to INT2 31 inhibition at submicromolar and low micromolar concentrations, others are not and it may be usefu l to evaluate the effect of 5 25 M of INT 2 31 on the kinase activity of multiple select ed kinases.

PAGE 61

61 FAK is a large molecule that interacts with IGF 1R and several other receptor tyrosine kinases including EGFR and VEGFR 3 as well as other cytoplasmic proteins including paxillin and p53. The specificity of our lead compound, INT231, to disrupt the interactions of IGF 1R at the amino terminus of FAK (aa 126243) should be confirmed as compared to other molecules known to interact with FAK at the C terminus. To determine the selectivity of the inhibitors for FAK/IGF 1R binding over FAK binding to other proteins such as paxillin, VEGFR 3 and Src, we will perform similar studies with HA tagged paxillin, HA VEGFR3 and HA Src and FLAG tagged FAK. Furthermore, it also possible to determine t he selectivity of INT2 31 for FAK/IGF 1R binding over other protein protein interactions. For exampl e, the ability of INT231 to disrupt the binding of HA Grb2 to FLAG SOS and HAp85 (PI3K subunit) to FLAG EGFR will also be determined using the same whole cell assay. The rationale for combination cytotoxic therapy is centered on interfering with different biochemical targets, overcoming drug resistance in heterogeneous tumors, and by taking advantage of tumor growth kinetics with increasing the dose density of combination treatments. The overall goal is to i mprove clinical efficacy with acceptable toxicity. Our data demonstrates that there may be synergistic activity between INT2 31 and 5FU but not gemcitabine. Some chemotherapeutic agents are more cell cycle dependent than others. The available data sugg ests that gemcitabines activity is cell cycle dependent while 5 FU is not ( Allegra et al. 1997 ) With our increased understanding of the cell cycle and the impact chemotherapeutic agents have on the cell cycle, it is increasingly apparent that this can create drug resistance, thereby reducing combination chemotherapeutic efficacy. This is particularly relevant with the advent of cell cycle specific inhibitors but also has relevance for the action of standard chemotherapeutic

PAGE 62

62 agents currently in clinical practice. Appropriate sequencing and scheduling of agents in combination with chemotherapy may overcome this cell cycle mediated resistance. Our studies provide in vivo proof of principle that inhibitors of protein protein interactions can be efficacious anticancer drugs. Previously, this approach has been successfully used to target FAK VEGFR3 protein interactions (Kurenova et al. 2009). Therapy could be individualized to melanoma or other malignancies with cancer related FAK or IGF 1R overexpression. Disruptors of protein protein interactions may be active without the genotoxicity of traditional cancer chemotherapy or radiation therapy. This lac k of genotoxicity may reduce both DNA damage in normal cells and the potential of inducing mutant clones of cancer cells that are resistant to cancer therapy. Successful incorporation of an approach targeting proteinprotein interactions would greatly expand the available treatment options for neoplasms, such as metastatic melanomas, that are resistant to all known therapy. The strategy of using druglike small molecules to block such protein protein interactions has not been considered as attractive by bo th academia and the pharmaceutical industry as are inhibitors of key cancer related enzymes such as kinases. While enzymes are in principle amenable to blocking by small molecule inhibitors, other therapeutic routes are needed for a large number of cancer targets that work via protein protein interaction. However, the current dogma argues for the intractability of protein protein interaction as a small molecule drug target due to the large and often flat surfaces where two proteins bind to each other. Some successes have begun to appear, such as Nutlin 3 specifically binding to MDM2, inhibiting MDM2p53 interaction and activating p53 and indeed the notion of the intractability of ablating protein interactions is being questioned (Vassilev et al. 2002). Rec ently, evidence has begun to

PAGE 63

63 accumulate that interference with protein interactions can be a route to design of cancer drugs, including macrodrugs and small molecules. In summary, a novel small molecule compound that disrupts the protein interaction of FAK and IGF 1R has potent antineoplastic effects in both in vitro and in vivo models. Further studies, which explore the targeting of proteinprotein interactions, are indicated in diverse tumor types. Table 31. The top scoring compounds for the third orientation NCI Number Docking Score NCI Number Docking Score 18468 68.126091 243172 52.02042389 407817 67.22935486 47091 51.94153214 128977 65.1653595 166346 51.84930801 407819 64.94876099 17151 51.84696198 605085 63.69062424 37053 51.82419586 243620 62.32995224 174007 51.75821686 128977 62.24939728 42215 51.72647095 608071 62.18764496 244047 51.58001709 250435 62.17018127 244047 51.54472351 243620 61.87368393 147708 51.51343155 122277 61.27615356 163994 51.33721161 21371 60.72781372 408182 51.28966904 21371 60.30609894 113368 51.1672287 21371 60.17605591 174007 51.05070496 243620 59.90954208 141845 50.85812378

PAGE 64

64 Table 31. Continued NCI Number Docking Score NCI Number Docking Score 73712 59.85826492 8447 50.79795074 243620 58.77994156 244047 50.71466446 93369 58.23083878 36997 50.6452179 43078 58.10844421 141845 50.6200943 133881 57.29674149 18951 50.61251068 40837 56.9882164 147708 50.49430466 21371 56.87865067 379390 50.48746109 408156 56.48332977 9019 50.43544769 129465 55.56538773 244047 50.42672729 129455 55.30924606 59711 50.41436768 129460 55.09999084 74737 50.35530853 122277 54.89561081 37273 50.29539871 129448 54.80198288 141842 50.27738953 129478 54.74204254 174007 50.25862885 46475 54.56863785 45202 50.21681976 667507 54.45470428 49485 50.21675491 627180 54.1296463 74737 50.19744873 4907 54.01021957 37044 50.17610168 129463 54.00395966 344553 50.12093353 117489 53.83126831 68045 49.93840408 408732 53.79541779 141845 49.78398895

PAGE 65

65 Table 31. Continued NCI Number Docking Score NCI Number Docking Score 163897 53.72097015 255125 49.78347397 127006 53.65956879 4460 49.64286041 129464 53.6010437 72986 49.60755157 652894 53.59884262 60156 49.6008606 13565 53.49819946 249211 49.55879974 405849 53.44078445 404012 49.47080994 141172 53.25966644 7561 49.44004822 627180 53.1901207 627180 49.39595795 141842 53.1071434 147708 49.38103867 129466 52.8824234 41357 49.13315582 46713 52.75917053 127010 49.12238312 46713 52.54545975 243172 48.99539566 129468 52.44723892 287499 48.97979355 129467 52.25016785 141842 48.9745903 Table 3 2. IC50 of INT2 31 for cancer cell lines Cell Lines [INT2 31] M Melanoma Melonocyte 97.3 A375 2.7 C8161 0.5 SK MEL 28 22.1 EsophagealCancer TE3 5.6 TE7 3.2 TE9 3.6 KYSE70 4.6

PAGE 66

66 Table 3 2. Continued Cell Lines [INT2 31] M KYSE140 2.5 KYSE180 19.8 Pancreatic Cancer HPDE Panc 1 6.7 Miapaca 2 4.73 AsPC1 16.9 BxPC3 45.6 Breast Cancer MCF10A 100 MCF7 0.03 BT474 2.39

PAGE 67

67 Figure 31. Pmol modeling of FAK and IGF 1R interaction b ased on the known crystal structures of FAK FERM domain ( space filled structure) and IGF 1R subunit (shown in helical ribbon structure). P ossible orientation of interaction of FAK and IGF 1R is dem onstrated based on computational modeling showing three alternative orientations Figure 32. Screening of top scoring compounds. MTT assay of compounds with high scores of interaction based on van der Waals and hydrostatic charges. Data shown in Miapaca2 pancreatic cancer cells at 72 hours with 100 M concentrations of compounds.

PAGE 68

68 Figure 33. In silico modeling of FAK and IGF 1R interaction. The proposed site of interaction of FAK and IGF 1R is demonstrated based on computational modeling. Lea d small molecule docked in pocket on FAK is shown on left. INT231 is modeled in the pocket on FAK (aa 127243) corresponding to the site of FAK interaction with IGF 1R.

PAGE 69

69 Figure 34. The structure of INT231 (NSC 344553). Structure and molecular formul a of INT2 31 are demonstrated. The energies of interaction between FAK and NSC 344553 are computed as the sum of the van der waals and electrostatic interactions. Figure 35. GST FAKNT2 pull down of IGF 1R 31, 200ng GST FAKNT2 pull down of IGF 1R IGF 1R to GST FAK is shown below Western blot. Average IC50 of INT2 31 for disruption of proteins is 3.96 M.

PAGE 70

70 A B Figure 36. Effects of INT2 31 on FAK and IGF 1R interaction. A)With increasing doses of INT2 31, coimmunoprecipitation of FAK and IGF 1R is decreased in C8161 melanoma cells. Densitometry showing the ratio of IGF 1R to FAK is shown below the western blot (IC50 = 2.72 M ). B) With increasing doses of INT231, coimmunoprecipitation of FAK and IGF 1R is decreased in A375 melanoma cells. Densitometry showing the ratio of IGF 1R to FAK is shown below the western blot (IC50 = 3.17 M ).

PAGE 71

71 Figure 37. Effect of INT2 31 on cell viability. A) MTT Assay of melanoma cell lines showing that INT2 31inhibited the cell viability of normal melanocytes and three melanoma cell lines in a dose dependent fashion over 72 hours, B) Protein expression of FAK, IGF 1R Akt and ERK in the three melanoma cell lines and melanocytes.

PAGE 72

72 Figure 38. CSFE cell proliferation assay with A375 melanoma cells (left) and C8161 melanoma cells (right) in the presence of increasing doses of INT2 31 or TAE 226 (dual FAK and IGF 1R kinase inhibitor).

PAGE 73

73 Figure 39. C8161 melanoma cell counts in the presence of INT2 31 or TAE 226. There is a dose and time dependent effect with inhibition of cell growth with our lead compound. A B Figure 310. Effects of INT2 31 on FAK shRNA transfected C8161 cells. A) MTT assay showing decreased effect of a 72 hour treatment with INT231 in C8161 cells expressing FAK shRNA compared to parental and mock transfected cells. B) Western blot showing knockdown of F AK with FAK shRNA. FAK shRNA1 utilized for MTT assay due to greater knockdown of FAK compared to FAK shRNA2.

PAGE 74

74 A B Figure 311. Effects of INT2 31 on FAK and IGF 1R deficient MEFs. A) FAK specificity. MTT assay showing the increased effect of INT2 31 (31) or TAE 226 (dual FAK and IGF 1R kinase inhibitor), on FAK wild type fibroblasts compared to null cells. B) IGF 1R specificity. MTT assay showing the increased effect of INT2 31 (31) or TAE 226 (dual FAK and IGF 1R kinase inhibitor), on IGF 1R wild type fibroblasts compared to IGF 1R null cells.

PAGE 75

75 Figure 312. Effects of INT2 31 on detachment of C8161 cells. Following treatment with increasing concentrations of INT231 or TAE, the number of detached and adherent cells, were counted in three separate experiments, and the average counted numbers used for the graph. There is a dose and time dependent effect on detachment in cells 31 at 72 hours. Greater effects are observed with TAE (TAE 226) at 48 and 72 hours (*p<0.05 vs control). Figure 313. Hoescht staining of INT231 treated cells. C8161 cells were treated with increasing concentrations of INT231 or TAE 226 for 24, 48 and 72 hours, and stained with Hoechst 33342 by adding 1 g/ml to the fixed cells and 10 l of cells were mounted on glass coverslips. The slides were viewed under a Zeiss microscope for apoptotic nuclei. The percent of apoptotic cells was calculated as the ratio of apoptotic cells to total number of cells. Over 300 cells per sample were analyzed in three separate experiments, and the average counted numbers used for the graph.

PAGE 76

76 Figure 314. Confocal image of Caspase 3/7 activated INT2 31 treated cells. In a 96well glass bottom plate, 2000 C8161 cells were plated and treated with 5 31 or TAE 226 for 48 hours. Activation of Caspase 3/7 was detected by adding 10 l of profluorescent caspase 3/7 consensus substrate to 100l medium and incubated for 30 minutes in the dark at room temperature. Activation of caspase3/7 enzymes was detected by imaging with a Leica TCS SP5 laser scanning confocal microscope, when excited at a wavelength of 498nm and emission of 521nm and representative images were captured.

PAGE 77

77 Figure 315. Western blot analysis of biochemical markers of the apoptotic pathway. C8161 cells were plated into a 6 well plate and treated with 5 31 or TAE 226 for 24, 48, and 72 hours. Subsequently, cells were lysed and used for western blot analysis. A

PAGE 78

78 B C

PAGE 79

79 D Figure 316. Western blot analysis of phosphorylated and total proteins from INT231 treated cells. A) C8161 cells were plated into a 6well plate and treated with increasing concentrations of INT231 for 24 hours. B) A375 cells were plated into a 6well plate and trea ted with increasing concentrations of INT231 for 24 hours. C) SK MEL28 cells were plated into a 6 well plate and treated with increasing concentrations of INT2 31 for 24 hours D) C8161 cells were plated into a 6 well plate and treated with 5 M INT2 31 for 24, 48, and 72 hours.

PAGE 80

80 Figure 317. Effects of INT2 31 on in vitro kinase activity. 1 M of INT2 31 did not significantly inhibit the kinase activity of these 12 kinases. The maximal inhibition of kinase activity was 22%. Figure 318. Overexpression of FAK NT2 fragment reduces IGF 1 induced phosphorylation of AKT C8161 cells transfected with 3 GFP fragments of the FAK N terminus (FAK NT1, FAK NT2 and FAK NT3).

PAGE 81

81 A B Figure 319. INT2 31 sentisized esophageal cancer cells to chemotherapy. MTT assay showing the viability of A) KYSE70 and B) KYSE140 esophageal cancer cell lines treated with increasing concentrations of INT231, 5FU or combination for 72 hours.

PAGE 82

82 A Figure 320. INT2 31 sentisized pancreatic cancer cells to chemotherapy. A)MTT assay showing the viability of Panc 1 cell lines treated with increasing concentrations of INT2 31, 5FU or combination for 72 hours.

PAGE 83

83 A B

PAGE 84

84 C D

PAGE 85

85 E F Figure 321. Melanoma xenograft analysis. A) Animals were inoculated subcutaneously with C8161 or B) A375 tumor cells and were treated with 15 mg/kg of INT231 vs PBS via intraperitoneal injection. Treatment was started on day 7 after tumor implantation. Animal weights are shown below growth curves. p<0.05 C) Ki67 staining of C8161 tumors treated with INT231, 15 mg/kg, vs PBS control. The percent of reactive cells is shown in the u pper graph. The intensity of staining is shown in the lower graph. The representative micrographs on the right demonstrate the staining patterns. p<0.05 D) TUNEL staining of excised tumors at the completion of the experiment. p<0.05 E) The effec t of INT2 31 on the coimmunoprecipitation of FAK and IGF 1R from tumor specimens. The lower graph shows the densitometry of the ratio of the IGF 1R to FAK signal. F) The effect of INT2 31 (15 mg/kg) on the phosphorylation of AKT in vivo

PAGE 86

86 A B

PAGE 87

87 C Figure 322. Effects of INT2 31 on direct esophageal cancer patient#5 specimen. A) MTT assay showing that increasing concentrations of INT231inhibited the cell viability of esophageal patient #5 cells. B) Esophageal patient #5 xenografts were tr eated with 50 mg/kg of INT231 vs PBS via intraperitoneal injection. Treatment was started on day 10 after tumor implantation. Animal weights are shown below growth curves. p<0.05 C) The percentage of reactive cells stained with Ki67 antibody is sho wn in the treatment vs control xenografts. p<0.05. A

PAGE 88

88 B Figure 323. Effects of INT2 31 on orthotopic pancreatic mice model. A) Miapaca 2 xenografts were treated with 50 mg/kg of INT231 vs PBS via intraperitoneal injection. Treatment was started on day 7 after tumor implantation. B) Panc 1 xenografts were treated with 15 mg/kg of INT231 vs PBS via subcutaneous injection. Treatment was started on day 15 after tumor implantation.

PAGE 89

89 LIST OF REFERENCES Allegra CJ, Grem JL. Antimetabolites. (1997). In: V. T. DeVita, S. Hellman, and S. A. Rosenberg (eds.), Cancer: Principles and Practice of Oncology, Ed. 5, pp. 432452. Philadelphia: Lippincott Raven. Almoguera C, Shibata D, Forrester K, Martin J, Arnheim N, Perucho M. (1988). Most human carcinomas of the exocrine pancreas contain mutant cK ras genes. Cell 53: 549554. Annabi SE, Gautier N, Baron V. (2001). Focal adhesion kinase and src mediate integrin regulation of insulin receptor phosphorylation. FEBS Letters 507: 247252. Arbet Engels C, Janknecht R, Eckhart W. (1999). Role of focal adhesion kinase in MAP kinase activation by insulin like growth factor I or insulin. FEBS Letters 454 : 252 256. Av raham, H, Park SY, Schinkmann K, Avraham S. (2000). RAFTK/Pyk2mediated cellular signaling. Cell Signal 12 : 123133. Baron V, Calleja V, Ferrari P, Alengrin F, Van Obberghen E. (1998). p125Fak focal adhesion kinase is a substrate for the insulin and insul in like growth factor I tyrosine kinase receptors. J Biol Chem 273: 71627168. Bergmann U, Funatomi H, Kornmann M, Beger HG, Korc M. (1996). Increased expression of insulin receptor substrate 1 in human pancreatic cancer. Biochem Biophys Res Commun 220: 886890. Bergmann U, Funatomi H, Yokoyama M, Beger HG, Korc M. (1995). Insulin like growth factor 1 overexpression in human pancreatic cancer: evidence for autocrine and paracrine roles. Cancer Res 55: 20072011. Blanck HM, Tolbert PE, Hoppin JA. (1999) Patterns of genetic alterations in pancreatic cancer: a pooled analysis. Environ Mol Mutagen 33: 111 122. Caldas C, Hahn SA, da Costa LT, Redston MS, Schutte M, Seymour AB, Weinstein CL, Hruban RH, Yeo CJ, Kern SE. (1994). Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinoma Nat Genet 8: 27 32. Choi HS, Wang Z, Richmond W, He X, Yang K, Jiang T, Karanewsky D, Gu X J, Zhou V, Liu Y, Che J, Lee C C, Caldwell J, Kanazawa T, Umemura I, Matsuura N, Ohmori O, Honda T, Gray N, He Y. (2006). Design and synthesis of 7H pyrrolo[2,3d]pyrimidines as focal adhesion kinase inhibitors. Part 2. Bioorg Med Chem Lett 16: 26892692. Cooper LA, Shen TL, Guan JL. (2003). Regulation of focal adhesion kinase byits aminote rminal domain through an autoinhibitory interaction. Mol Cell Biol 23 : 80308041.

PAGE 90

90 Corsi JM, Rouer E, Girault JA, Enslen H. (2006). Organization and post transcriptional processing of focal adhesion kinase gene. BMC Genomics 7: 198. Dews M, Prisco M, Peruzzi F, Romano G, Morrione A, Baserga B. (2000). Domains of the insulin like growth factor 1 receptor required for the activation of extracellular signalregulated kinases. Endocrinology 141 : 12891300. Eggermont AM, Testori A, Marsden J, Hersey P, Quirt I, Petrella T, Gogas H, MacKie RM, MacKie RM, Hauschild A. (2009) Utility of adjuvant systemic therapy in melanoma. Annals of Oncology Supplement 6 : 3034. Fiedorek FT, Kay ES. (1995) Mapping of the focal adhesion kinase (Fadk) gene to mouse chromosome 15 and human chromosome 8. Mammalian Genome 6: 123126. Furukawa T, Chiba R, Kobari M, Matsuno S, Nagura H, Takahashi T. (1994). Varying grades of epithelial atypia in the pancreatic ducts of humans. Classification based on morphometry and multivariate anal ysis and correlative with positive reactions of carcinoembryonic antigen. Arch Pathol Lab Med 118: 227234. Golubovskaya V, Kaur A, Cance W. (2004) Cloning and characterization of the promoter region of human focal adhesion kinase gene: nuclear factor ka ppa B and p53 binding sites*1. Biochimica et Biophysica Acta (BBA) Gene Structure and Expression 1678: 111125. Golubovskaya VM, Nyberg C, Zheng M, Kweh F, Magis A, Ostrov D, Cance WG. (2008). A Small Molecule Inhibitor, 1,2,4,5Benzenetetraamine Tetrahy drochloride, Targeting the Y397 Site of Focal Adhesion Kinase Decreases Tumor Growth. J Med Chem 51: 74057416. Golubovskaya VM, Virnig C, Cance WG. (2008) TAE226 induced apoptosis in breast cancer cells with overexpressed Src or EGFR. Mol Carcinog 47: 222 234. Halder J, Lin YG, Merritt WM, Spannuth WA, Nick AM, Honda T, Kamat AA, Han LY, Kim TJ, Lu C, Tari AM, Bornmann W, Fernandez A, Lopez Berestein G, Sood AK. (2007). Therapeutic efficacy of a novel focal adhesion kinase inhibitor TAE226 in ovarian carcinoma. Cancer Res 15: 1097610983. Han EK, McGonigal T, Wang J, Giranda VL, Luo Y. (2004). Functional analysis of focal adhesion kinase (FAK) reduction by small inhibitory RNAs. Anticancer Res 24: 3899 3905. Hauck CR, Hsia DA, Puente XS, Cheresh DA, Schl aepfer DD. (2002). FRNK blocks vSrc stimulated invasion and experimental metastases without effects on cell motility or growth. EMBO J 21: 62896302. Hauschild. (2009). Utility of adjuvant systemic therapy in melanoma. Ann Oncol 20:Suppl

PAGE 91

91 Hewish M, Chau I, Cunningham D. (2009). Insulinlike growth factor 1 receptor targeted therapeutics: novel co mpounds and novel treatment strategies for cancer medicine. Recent Pat Anticancer Drug Discov 3: 5472. Hildebrand JD, Taylor JM, Parsons JT. (1996). An SH3 domaincontaining GTPase activating protein for Rho and Cdc42 associates with focal adhesion kinase Mol Cell Biol 16: 31693178. Hochwald SN, Nyberg C, Zheng M, Zheng D, Wood C, Massoll NA, Magis A, Ostrov D, Cance WG, Golubovskaya V. (2009). A novel small molecule inhibitor of FAK decreases growth of human pancreatic cancer. Cell Cycle 8: 2435 2443. Huanwen W Zhiyong L Xiaohua S Xinyu R Kai W Tonghua L (2009). Intrinsic chemoresistance to Gemcitabine is associated with constitutive and laminin induced phosphorylation of FAK in pancreatic cancer cell lines. Mol Cancer 8: 125. Imsumran A, Adachi Y, Yamamoto H, Li R, Wang Y, Min Y, Piao W, Nosho K, Arimura Y, Shinomura Y, Hosokawa M, Lee CT, Carbone DP, Imai K. (2007). Insulin like growth factorI receptor as a marker for prognosis and a therapeutic target in human esophageal squamous cell carcinoma. Carcinogenesis 28 : 947 956. Ishiwata T, Bergmann U, Kornmann M, Lopez M, Beger HG, Korc M. (1997). Altered expres sion of insulinlike growth factor II receptor in human pancreatic cancer. Pancreas 15: 367373. Jaiswal BS Janakiraman V Kljavin NM Eastham Anderson J Cupp JE Liang Y Davis DP Hoeflich KP Seshagiri S (2009) Combined targeting of BRAF and CRAF or BRAF and PI3K effector pathways is required for efficacy in NRAS mutant tumors. PLoS One 4: e5717. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ. (2003). Cancer statistics, 2003. CA Cancer J Clin 53: 5 26. Jemal A Tiwari RC, Murray T, Ghafoor A, Samuels A, Ward E, Feuer EJ, Thun MJ. (2004). Cancer Statistics 2004. CA Cancer J Clin 54: 8 30. Kahana O Micksche M Witz IP Yron I (2002). The focal adhesion kinase (P125FAK) is constitutively active in human malignant melanoma Oncogene 21: 39693977. Kalinina T, Bockhorn M, Kaifi JT, Thieltges S, Gngr C, Effenberger KE, Strelow A, Reichelt U, Sauter G, Pantel K, Izbicki JR, Yekebas EF. (2010). Insulin like growth factor 1 receptor as a novel prognostic marker and its implication as a Co Target in the treatment of human adenocarcinoma of the esophagus. Int J Cancer Jan 26 [Epub ahead of print]

PAGE 92

92 Kanter Lewensohn L Dricu A Girnita L Wejde J, Larsson O (2000). Expression of insulin like growth factor 1 receptor (IGF 1R) and p27Kip1 in melanocytic tumors: a potential regulatory role of IGF 1 pathway in distribution of p27Kip1 between different cyclins. Growth Factors 17: 193 202. Ka nter Lewensohn L, Dricu A, Wang M, Wejde J, Kiessling R, Larsson O. (1998). Expression of the insulinlike growth factor1 receptor and its anti apoptotic effect in malignant melanoma: a potential therapeutic target. Melanoma Res 8: 389397. Kim B, Cheng H L, Margolis B, Feldman EL. (1998). Insulin receptor substrate 2 and Shc play different roles in insulin like grow th factor 1 signaling. J Biol Chem 273: 3454334550. Kloppel G, Bommer G, Ruckert K, Seifert G. (1980). Intraductal proliferation in the pancreas and its relationship to human and experimental carcinogenesis. Virchows Arch 387: 221 233. Korc M. (1998). Rol e of polypeptide growth factors and their receptors in human pancreatic cancer. In: Reber HA, ed. Pancreatic Cancer: Pathogenesis, Diagnosis, and Treatment. Totowa, NJ: Humana Press : : 21 29. Kozuka S, Sassa R, Taki T, Masamoto K, Saga S, Hasegaw K, Takeu chi M. (1979). Relation of pancreatic duct hyperplasia to carcinoma. Cancer 43: 14181428. Lebrun P, Baron V, Hauck CR, Schlaepfer DD, Van Obberghen E. (2000). Cell adhesion and focal adhesion kinase regulate insulin receptor substrate 1 expression. J Bi ol Chem 275 : 3837138377. Liu YC, Leu CM, Wong FH, Fong WS, Chen SC, Chang C, Hu CP. (2002). Autocrine stimulation by insulin like growth factor I is involved in the growth, tumorigenicity and chemoresistance of human esophageal carcinoma cells. J Biomed Sci 9: 665 674. Liu TJ LaFortune T Honda T Ohmori O Hatakeyama S Meyer T Jackson D de Groot J Yung WK (2007). Inhibition of both focal adhesion kinase and insulin like growth factor I receptor kinase suppresses glioma proliferati on in vitro and in vivo Mol Cancer Ther 6: 13571367. Liu W, Bloom DA, Cance WG, Golubovskaya V, Kurenova E, Hochwald SN. (2008). FAK and IGF IR interact to provide survival signals in human pancreatic adenocarcinoma cells. Carcinogenesis 29: 1096107. Lli cacute D, Furuta Y, Kanazawa S, Takeda N, Sobue K, Nakatsuji N, Nomura S, Fujimoto J, Okada M, Yamamoto T, Aizawa S. (1995). Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK deficient mice. Nature 377 : 539544.

PAGE 93

93 Mahlamaki EH, Barlund M, Tanner M, Gorunova L, Hoglund M, Karh R, Kallioniemi A. (2002). Frequent amplification of 8q24, 11q, 17q, and 20qspecific genes in pancreatic cancer. Genes Chromosomes Cancer 35: 353358. Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S. (2002). The protein kinase complement of the human genome. Science 298 : 19121934. McLean GW, Carragher NO, Avizienyte E, Evans J, Brunton VG, Frame MC. (2005). The role of focal adhesion kinase in cancer a new therapeutic oppo rtunity. Nat Rev Cancer 5: 505515. Miyazaki T, Kato H, Nakajima M, Sohda M, Fukai Y, Masuda N, Manda R, Fukuchi M, Tsukada K, Kuwano H. (2003). FAK overexpression is correlated with tumour invasiveness and lymph node metastasis in oesophageal squamous cell carcinoma. Br J Cancer 89: 140145. Orr AW, MurphyUllrich JE. (2004). Regulation of endothelial cell function BY FAK and PYK2. Front Biosci 9: 12541266. Ouban A, Muraca P, Yeatman T, Coppola D. (2003) Expression and distribution of insulinlike growth factor 1 receptor in human carcinomas. Hum. Pathol 34:803808. Parsons JT, Slack Davis J, Tilghman R, Roberts W G. (2008). Focal adhesion kinase: targeting adhesion signaling pathways for therapeutic intervention. Clin Cancer Res 14: 627632. Piao W, Wang Y, Adachi Y, Yamamoto H, Li R, Imsumran A, Li H, Maehata T, Ii M, Arimura Y, Lee CT, Shinomura Y, Carbone DP, Imai K. (2008). Insulin like growth factor I receptor blockade by a specific tyrosine kinase inhibitor for human gastrointestinal carcinomas. Mol Cancer Ther 7: 14831493. Pisani P, Parkin DM, Bray F, Ferlay J. (1999). Estimates of the worldwide mortality from 25 cancers in 1990 Int J Cancer 83: 18 29. Pollak M. (2008). Insulin and insulinlike growth factor signaling in neoplasia. Nat Rev Cancer 8: 915928. Pour PM, Sayed S, Sayed G. (1982). Hyperplastic, preneoplastic and neoplastic lesions f ound in 83 human pancreases. Am J Clin Pathol 77: 137 152. Roberts WG, Ung E, Whalen P, Cooper B, Hulford C, Autry C, Richter D, Emerson E, Lin J, Kath J, Coleman K, Yao L, Martinez Alsina L, Lorenzen M, Berliner M, Luzzio M, Patel N, Schmitt E, LaGreca S, Jani J, Wessel M, Marr E, Griffor M, Vajdos F. (2008). Antitumor activity and pharmacology of a selective focal adhesion kinase inhibitor, PF 562,271. Cancer Res 68: 19351944.

PAGE 94

94 Ruggeri BA, Huang L, Wood M, Cheng JQ, Testa JR. (1998). Amplification and overexpression of the AKT 2 oncogene in a subset of human pancreatic ductal adenocarcinomas. Mol Carcinog 21: 8186. Shi Q, Hjelmeland AB, Keir ST, Song L, Wickman S, Jackson D, Ohmori O, Bigner DD, Friedman HS, Rich JN. (2007). A novel low molecular wei ght inhibitor of focal adhesion kinase, TAE226, inhibits glioma growth. Mol Carcinog 46: 488 496. Siu LL, Burris HA, Mileshkin L, Camidge DR, Rischin D, Chen EX, Jones S, Yin D, Fingert H. (2007). Journal of Clinical Oncology, 2007 ASCO Annual Meeting Pro ceedings Part 1. 25: 3527. Slack Davis JK, Martin KH, Tilghman RW, Iwanicki M, Ung EJ, Autry C, Luzzio MJ, Cooper B, Kath JC, Roberts WG, Parsons JT. (2007). Cellular characterization of a novel focal adhesion kinase inhibitor. J Biol Chem 282: 1484514852. Staal SP. (1987). Molecular cloning of the Akt oncogene and its human homologues AKT 1 and AKT 2: amplification of AKT 1 in a primary human gastric adenocarcinoma. Proc Natl Acad Sci 84: 50345037. Stoeltzing O, Liu W, Reinmuth N, Fan F, Parikh AA, Bucana CD, Evans DB, Semenza GL, Ellis LM. (2003). Regulation of Hypoxia inducible factor 1alpha, vascular endothelial growth factor, and angiogenesis by an insulinlike growth factor 1 receptor autocrine loop in human pancreatic cancer. Am J Pathol 163: 1001 1011. Ucar D, Hochwald S. FAK as a the rapeutic target in malignancy. Recent advances in carcinogenesis, in press. Valentinis B, Morrione A, Peruzzi F, Prisco M, Reiss K, Baserga R. (1999). Anti apoptotic signaling of the IGF 1 receptor in fibroblasts following loss of matrix adhesion. Oncogene 18: 18271836. Van Nimwegen MJ, van de Water B. (2007). Focal adhesion kina se: a potential target in cancer therapy. Biochem Pharmacol 73: 597 609. Vincent AM, Feldman EL. (2002). Control of cell survival by IGF signaling pathways. Growth Hormone and IGF Research 12: 193197. Wang ZG, Fukazawa T, Nishikawa T, Watanabe N, Sakuram a K, Motoki T, Takaoka M, Hatakeyama S, Omori O, Ohara T, Tanabe S, Fujiwara Y, Shirakawa Y, Yamatsuji T, Tanaka N, Naomoto Y. (2008). TAE226, a dual inhibitor for FAK and IGF IR, has inhibitory effects on mTOR signaling in esophageal cancer cells. Oncol Rep 20: 14731477. Watanabe N Takaoka M Sakurama K Tomono Y Hatakeyama S Ohmori O Motoki T Shirakawa Y Yamatsuji T Haisa M Matsuoka J Beer DG, Nagatsuka H Tanaka N

PAGE 95

95 Naomoto Y (2008). Dual tyrosine kinase inhibitor for focal adhesion kinase and insulinlike growth f actor1 receptor exhibits anticancer effect in esophageal adenocarcinoma in vitro and in vivo Clin Cancer Res 14 : 46314639. Weiner TM, Liu ET, Craven RJ, Cance WG. (1993). Expression of focal adhesion kinase gene and invasive cancer. Lancet 342: 10241025. Yamamoto D, Sonoda Y, Hasegawa M, Funakoshi Tago M, Aizu Yokota E, Kasahara T. (2003). FAK overexpression upregulates cyclin D3 and enhances cell proliferation via the PKC and PI3 kinase Akt pathways. Cellular Signaling 15: 575 583. Yujiri T, Nawata R, Takahashi T. (2002). MEK kinase 1 interacts with focal adhesion kinase and regulates insulin receptor substrate 1 expression. J Biol Chem 278: 38463851. Zheng D, Kurenova E, Ucar D, Magis A, Ostrov D, Golubovskaya V, Cance WG, Hoc hwald SN. (2009). Targeting of the protein interaction site between FAK and IGF 1R. Biochem Biophys Res Comm 388: 301305.

PAGE 96

96 BIOGRAPHICAL SKETCH Deniz A. Ucar was born in Ankara, Turkey. After graduating from Ozel Ari Kolleji High School in Ankara, Turkey, she attended University of Istanbul, where she earned her Doctor of Veterinary Medicine (DVM) degree in 1997. After four year s as a volunteer and employment in various animal hospitals, Deniz had her own veterinary practice in Ortakoy, Istanbul. Encouraged by her professors, she left her successful veterinary practice to come to the U.S. to do science. She came to the U.S. speaking no English. While she was learning English at the English Language Institute, she was a warded a scholarship for tuition and then she finished the premedical program at Santa Fe Community Coll e ge in one year. In 2005, she became a volunteer in the laboratory of Dr. LungJi Chang to gain some experience while waiti ng her Master s Program application result. Deniz began with the University of Floridas College of Medicine Master s Program in Fall 2005. After joining the laboratory of Dr. Edward Scott, she began working on different projects and completed her master s program in 2007 with a project on establishing a system for the enrichment of cancer initiating cells. After graduation, she continued on to pursue a doctorate also at the University of Floridas College of Medicine. She received her Ph.D. in 2010 and wi ll apply to medical school.