<%BANNER%>

Mapping Dominant Antigenic Regions on the Capsid Surfaces of Adeno-Associated Virions

Permanent Link: http://ufdc.ufl.edu/UFE0041541/00001

Material Information

Title: Mapping Dominant Antigenic Regions on the Capsid Surfaces of Adeno-Associated Virions
Physical Description: 1 online resource (214 p.)
Language: english
Creator: Gurda, Brittney
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aav, adk8, cryoem, gene, hbov, immunology, monoclonal, parvovirus, therapy
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Adeno-associated virus (AAV) is a small ssDNA virus that can package and deliver non-genomic DNA. Its low toxicity and relative lack of pathology, along with broad tropisms, has made it popular as a vector for gene delivery trials. However, despite the critical role of antibodies in the success of gene therapy with AAV vectors, the nature of the antigenic structure of the AAV capsids is not well understood. Here we defined the binding of monoclonal antibodies against AAV serotypes 1, 2, 5, 6, and 8 using cryo-electron microscopy and three-dimensional image reconstructions. Docking of capsid structures with fragment antibody models showed that the footprints on these viruses all fell on or around the three-fold protrusions of the capsid regardless of the serotype examined. Significant overlap between the binding sites led to the conclusion that this is a common region of antigenicity among the AAV capsid surfaces. In preliminary studies, mutagenesis of the proposed sites on the AAV1 capsid showed that certain surface loop changes resulted in viruses that were able to evade previous recognition from parental antibodies. These data support the hypothesis that the three-fold axes are antigenically important and that mutations in this region may avert a pre-existing immune response. Further characterization is necessary to better design escape mutants and fully understand if these mutants are still viable in their original tissue tropisms and transduction efficiencies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Brittney Gurda.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Agbandje-McKenna, Mavis.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041541:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041541/00001

Material Information

Title: Mapping Dominant Antigenic Regions on the Capsid Surfaces of Adeno-Associated Virions
Physical Description: 1 online resource (214 p.)
Language: english
Creator: Gurda, Brittney
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aav, adk8, cryoem, gene, hbov, immunology, monoclonal, parvovirus, therapy
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Adeno-associated virus (AAV) is a small ssDNA virus that can package and deliver non-genomic DNA. Its low toxicity and relative lack of pathology, along with broad tropisms, has made it popular as a vector for gene delivery trials. However, despite the critical role of antibodies in the success of gene therapy with AAV vectors, the nature of the antigenic structure of the AAV capsids is not well understood. Here we defined the binding of monoclonal antibodies against AAV serotypes 1, 2, 5, 6, and 8 using cryo-electron microscopy and three-dimensional image reconstructions. Docking of capsid structures with fragment antibody models showed that the footprints on these viruses all fell on or around the three-fold protrusions of the capsid regardless of the serotype examined. Significant overlap between the binding sites led to the conclusion that this is a common region of antigenicity among the AAV capsid surfaces. In preliminary studies, mutagenesis of the proposed sites on the AAV1 capsid showed that certain surface loop changes resulted in viruses that were able to evade previous recognition from parental antibodies. These data support the hypothesis that the three-fold axes are antigenically important and that mutations in this region may avert a pre-existing immune response. Further characterization is necessary to better design escape mutants and fully understand if these mutants are still viable in their original tissue tropisms and transduction efficiencies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Brittney Gurda.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Agbandje-McKenna, Mavis.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041541:00001


This item has the following downloads:


Full Text

PAGE 1

1 MAPPING DOMINANT ANTIGENIC REGIONS ON THE CAPSID SURFACES OF ADENO -ASSOCIATED VIRIONS By BRITTNEY LYNN GURDA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUI REMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Brittney L. Gurda

PAGE 3

3 To my mother, f or reminding me that I could when I said I couldnt and my father who said that he didnt care what I grew up to be as long as it made me happy

PAGE 4

4 ACKNOWLEDGMENTS I would like to begin with my mom, Chris tine Gurda. Not only has she been there financially, but also spiritually and mentally. I can think of no other who has shown greater su pport in all of my endeavors. My father, Thomas Gurda, my sister, CaryBeth, and my brother, Dean were always there for support I feel exceptionally lucky and honored to have had an excellent mentor. Dr. Mavis Agbandje McKenna s patience and encouragement make her the ideal mentor and I could have never found a better place to start. I would also like to thank Dr. Robert McKenna for insightful conversations and general advice in not only science, but life as well I also need to thank Michael DiMattia and E dward Miller for help with computational programs. The monoclonal work was done in collaboration at Cornell University by Wendy Weichert under Dr Colin Parrish, and the neutralization data was mostly done by Dr. Michael Schmidt and Beverly Handelman under Dr. Jay Chiorini at the NIH. As for data collection, all of our cryoEM data was collected at UCSD under the direction of Dr. Tim Baker by Norm Olson. My thanks also go to Dr. Bakers staff especially Drs. Robert Sinkovits and Kristin Parent who helped with the HBoV structure in Appendix A The data in Appendix B is almost entirely the work of Dr. Christina Raupp in Dr. Jurgen Kleinchmidts lab in Hieldelberg, Germany and I am excited to have been able to offer data that helped shaped the efforts of the epit ope mapping of the mAb ADK8. I am honored to have had the expertise of my committee members at my disposal; Dr. James B. Flanegan, Dr. Nicholas Muzyczka, Dr. Roland Herzog, and Dr. Arun Srivastava. All of whom are not only experts in their field, but also in the shaping of a project and the student involved. The IDP graduate student office was invaluable in making my first year transition smooth and I would also like to thank the staff in the biochemistry office Last but not least, I would like to thank t he hordes of undergraduate students that I have taught over the years, who have unknowingly taught me many valuable lessons in return.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 9 LIST OF FIGURES ............................................................................................................................ 10 LIST OF ABBREVIATIONS ............................................................................................................ 12 ABSTRACT ........................................................................................................................................ 14 CH A P T E R 1 BACKGROUND AND INTRODUCTION .............................................................................. 15 Introduction to Genetic Disease and Gene Therapy ................................................................. 15 Gene Delivery Systems ............................................................................................................... 16 Non -Viral Delivery Methods .............................................................................................. 17 Physical approaches ..................................................................................................... 17 Chemical methods ........................................................................................................ 19 Viral Delivery Methods ....................................................................................................... 22 Retroviruses .................................................................................................................. 23 Adenoviruses ................................................................................................................ 25 Herpesvirus ................................................................................................................... 27 Alphaviruses ................................................................................................................. 29 Adenoassociated viruses ............................................................................................. 31 Current Status and Issues in Gene Therapy ............................................................................... 33 Antibody Recognition of Viruses and Viral Neutralization ..................................................... 40 Parvovirus Capsid Structures, Receptor Binding, and Infection .............................................. 44 Parvovirus Antigenic Properties ................................................................................................. 47 Parvovirus Antigenic Structures for Autonomous Viruses ...................................................... 48 The Dependoviruses and their Antigenic Properties ................................................................. 51 AAV Capsid Structure and Serotypes ........................................................................................ 54 Significance ................................................................................................................................. 56 2 MATERIALS AND METHODS ............................................................................................... 59 Production and Purification of Recombinant AAV VLPs for Structural Studies ................... 59 Fv Antibody Modeling Using the Web Antibody Modelling (WAM) Server ........................ 60 Preliminary Neutralization Assays ............................................................................................. 61 Preliminary In -House Green Cell Assays .................................................................................. 61 Dot Blot Analysis to check Cross -Reactivity among VLPs ..................................................... 62 Generation of Fragment Antibodies from Monoclonal Antibodies ......................................... 62 Preparation of Fab:VLP Complexes .......................................................................................... 63

PAGE 6

6 CryoEM Data Collection ............................................................................................................ 63 Three Dimensional Reconstruction of AAV:Fab Complexes .................................................. 63 Fitting of Atomic and Pseudo -Atomic Models into CryoEM Density Maps .......................... 64 Mutagenesis of Proposed Antigenic Regions ............................................................................ 65 Production and Purification of Antigenic Mutants ................................................................... 67 Western Blot Analysis ......................................................................................................... 70 AAV1 Enzyme -Linked Immunosorbent Assay (ELISA) ................................................. 70 Dot Blot Analysis for Antigenic Reactivity ....................................................................... 71 Pixel Intensity Calculations from Native Dot Blots .......................................................... 71 Infectivity Assays ................................................................................................................ 71 DNA Extraction and Real Time Polyme rase Chain Reaction .......................................... 72 3 CHARACTERIZATION OF ANTIBODIES AGAINST AAV1 AND AAV5 CAPSIDS, CROSS REACTIVITY AND NEUTRALIZATION CAPABILIT IES .................................. 74 Introduction ................................................................................................................................. 74 Results .......................................................................................................................................... 76 Production of Anti -AAV Monoclonal Antibodies and Isotyping ..................................... 76 Cross Reactivity among Different AAV Serotypes .......................................................... 77 Neutralization Ability of the Monoclonal Antibody Panel ............................................... 77 Discussion .................................................................................................................................... 78 4 DETERMINATION OF DOMINANT ANTIGENIC SITES ON THE CAPSID SURFACE OF ADENO -ASOCIATED VIRUS SEROTYPES 1, 2, 5, 6, and 8 THROUGH CRYO ELECTRON MICROSCOPY STUDIES ................................................ 90 Introductio n ................................................................................................................................. 90 Results .......................................................................................................................................... 93 Analysis of the Fab-VLP CryoEM Complexes ................................................................. 93 Fab G7 and AA V1 ............................................................................................................... 94 Fab D11 with AAV1 and AAV6 Capsids .......................................................................... 94 Fab C37B and AAV2 .......................................................................................................... 95 Fab F4 and AAV5 Capsids ................................................................................................. 96 Fab ADK8 and AAV8 Capsids ........................................................................................... 97 Fab ADK1a and AAV1 Capsids ......................................................................................... 98 Common Features of Antibody Binding Sites on the AAV Capsid ................................. 99 Discussion .................................................................................................................................. 100 Viruses as Antigens Features Revealed ......................................................................... 100 Structures of Bound Antibodies and Possible Mechanisms of Neutralization or Effects on Capsid Functions .......................................................................................... 101 5 MUTATIONAL ANALYSIS OF PROPOSED DOMINANT ANTIGENIC SITES ON THE CAPSID SURFACE OF ADENO -ASSOCIATED VIRUS SEROTYPE 1 ................ 111 Introductio n ............................................................................................................................... 111 Results ........................................................................................................................................ 112 Generation of AAV1 Capsid Mutants .............................................................................. 112

PAGE 7

7 Analysis of Mutant Protein Expression ............................................................................ 113 Characterization of Mutant Capsid Production ................................................................ 113 Quantification of Mutant Particle Titers, Infectivity, and Packaging Ability ................ 114 Ability of Antigenic Mutants to Evade Monoclonal Antibody Recognition ................. 115 Direct Effects of Mutations on Neutralization ................................................................. 116 Discussion .................................................................................................................................. 117 Preliminary Ana lysis on Mutant AAV1 Viruses Reveals a Retained Ability to Assemble Infectious Capsids ........................................................................................ 117 Ability of Antigenic Escape is Limited to Specific Regions on the Capsid Surface .... 120 6 SUMMARY AND FUTURE DIRECTIONS ......................................................................... 128 Summary .................................................................................................................................... 128 Future Directions ....................................................................................................................... 131 AP P ENDIX A HUMAN BOCAVIRUS CAPSID STRUTURE: INSIGHTS INTO THE STRUCTURAL REPERTOIRE OF THE PARVOVIRIDAE ................................................. 133 Introduction ............................................................................................................................... 133 Materials and Methods .............................................................................................................. 136 Expression and Purification .............................................................................................. 136 Negative Stain Transmission Electron Microscopy ........................................................ 137 CryoEM and Image Reconstruction ................................................................................. 138 Generation of Density Maps for Representative Members of the Parvoviridae Genera ............................................................................................................................. 139 Sequence Analysis and Generation of Unrooted Phylogenic Tree ................................. 140 Generation and Docking of a Homology Model of HBoV VP2 into CryoReconstructed Density ................................................................................................... 140 Comparison of Parvovirus VP2 Structures ...................................................................... 141 Results and Discussion ............................................................................................................. 141 HBoV Capsid Structure ..................................................................................................... 141 Pseudo -Atomic Model of HBoV VP2 Built Based on the B19 VP2 Crystal Structure .......................................................................................................................... 143 HBoV VP2 Shares Low Sequence Identity but High Structural Similarity to Other Parvovirinae VP2s ......................................................................................................... 145 HBoV Capsid Surface Topology is Unique, but Shares Features Common to Other Vertebrate Parvoviruses ................................................................................................. 146 Summary .................................................................................................................................... 149 B MONOCLONAL ANTIBODY AGAINST THE ADENO -ASSOCIATED VIRUS TYPE 8 CAPSID AN D THE IDENTIFICATION OF CAPSID DOMAINS INVOLVED IN THE NEUTRALIZATION OF THE AAV8 INFECTION ........................ 159 Introduction ............................................................................................................................... 159 Materials and Methods .............................................................................................................. 162

PAGE 8

8 Animals, Cell Lines and Cell Culture ............................................................................... 162 Plasmids and Site Directed Mutagenesis ......................................................................... 163 Plasmids and Peptide Insertions ....................................................................................... 164 Transfection of 293T Cells and Vector Particle Purification .......................................... 164 Purification and Titration of Mutant AAV Stocks .......................................................... 165 Analysis of Viral Protein Expression ............................................................................... 165 Production and Purification of Monoclonal Antibody ADK8 ........................................ 165 Determination of Antibody Isotypes ................................................................................ 166 AAV Capture ELISA ........................................................................................................ 166 In Vitro and In Vivo Neutralization .................................................................................. 166 Binding Analysis by DNA Dot Blot ................................................................................. 167 Immune Fluorescence ........................................................................................................ 168 Native Dot Blot Assay ....................................................................................................... 168 Epitope Mapping ................................................................................................................ 169 Results and Discussion ............................................................................................................. 169 Three Dimensional Reconstruction and Model Docking of the AAV8:ADK8 Complex .......................................................................................................................... 169 Analysis of the 3D Models Identifies Proposed Monoclonal Antibody ADK8 Binding Sites on the AAV8 Capsid .............................................................................. 1 70 Characterization of rAAV8 and rAAV2 Capsid Mutants to Elucidate the ADK8 Binding Epitope ............................................................................................................. 170 In Vitro and In Vivo N eutralization of AAV8 by ADK8 ................................................ 172 Neutralization Analysis of ADK8 .................................................................................... 174 Impact on rAAV8 vector generation ................................................................................ 176 LIST OF REFERENCES ................................................................................................................. 184 BIOGRAPHICAL SKETCH ........................................................................................................... 214

PAGE 9

9 LIST OF TABLES Table page 3 1 Mouse monoclonal antibodies selected for further studies .................................................. 85 3 2 Amino acid differences between AAV1 -like viruses and AAV1* ..................................... 85 4 1 Summary of AAV-Fab complexes generated for cryoEM data studies ........................... 104 4 2 CryoEM data reconstruction statistics ................................................................................ 104 4 3 Scaling and fitting statistics of cryoEM 3D reconstructions with atomic models ........... 104 4 4 Proposed epitopes for each respective complex including residue numbers and sequence da ta ........................................................................................................................ 104 5 1 AAV1 mutational nomenclature and sequence differences .............................................. 122 5 2 AAV1 single -site mutant characterization .......................................................................... 122 A 1 Selected properties of representative members of Parvoviridae ...................................... 151 A 2 Sequence alignment statistics for representative members with st ructural data .............. 151

PAGE 10

10 LIST OF FIGURES Figure page 1 1 The antigenic structure of AAV2. ......................................................................................... 57 1 2 Panel of available AAV atomic structures. .......................................................................... 58 2 1 Coomassiee stained SDS -PAGE and EM images of purified AAV VLPs for structural studies. .................................................................................................................... 73 2 2 Images of the Fab WAM models. ......................................................................................... 73 2 3 Production, purification, and characterization of mAb and Fabs. ....................................... 73 3 1 Basic immunoglobulin structure ........................................................................................... 85 3 2 Monoclonal antibody characterization and cross -reactivity.. .............................................. 86 3 3 Preliminary neutraliz ation assay dat a for the anti -AAV5 monoclonals. ............................ 87 3 4 Preliminary neutralization assay data for the anti -AAV1 monoclonals. ............................ 87 3 5 The ability of the anti -AAV1 monoclonals to neutralize the AAV1 like viruses .............. 88 3 6 Differnces between the AAV1 and X1 sequences are mapped to the atomic coordinates of AAV1 and cluster at the three -fold axis of symmetry. ............................... 89 4 1 CryoEM 3D reconstructions shown with respective roadmap of epitope positions on the 3D capsid surface ........................................................................................................... 105 4 2 Variable regions of the AAV -VP3 monomer ..................................................................... 106 4 3 Docking of atomic models into cryoEM density ............................................................... 106 4 4 Diffe rence map between the AAV5:F4 reconstruction and a sim ilar scale AAV5 uncomplexed map ................................................................................................................ 107 4 5 Three dimensional reconstruction and model fi tting for the AAV8:ADK8 complex ..... 108 4 6 AAV1:ADK1a r econstruction and model fitting ............................................................... 109 4 7 Illustration of overlapping antigenic regions at the capsid surface level .......................... 109 4 8 Structure based sequence alignment of AAV1, 2, 5, and 6.. ............................................. 110 5 1 Western blot analysis on single -site mutant cell lysates .................................................... 123 5 2 Purification of single -site antigenic escape mutants .......................................................... 123

PAGE 11

11 5 3 Electron micrograph images of AAV1 mutant capsids.. ................................................... 124 5 4 ADK1a native dot blot of mutant cell lysates. ................................................................... 124 5 5 Analysis of a native dot blot of single and double -site mutants. ....................................... 125 5 6 Infectious green cell assay images of NAb treated single -site mutants. ........................... 126 5 7 Histograms for in vitro Nab treated mutant virus. ............................................................. 127 5 8 Heparin -binding analysis. .................................................................................................... 127 A 1 Characterization of recombinant HBoV VLPs.. ................................................................. 152 A 2 HBoV cryoreconstruction. ................................................................................................. 153 A 3 Comparison of six representative parvovirus capsid structures. ....................................... 154 A 4 Radi al density projections of six representative parvoviruses. ......................................... 155 A 5 Pseudo atomic model of HBoV VP2. ................................................................................. 156 A 6 Superposition of VP2 structures from six representative members of the Parvoviridae ........................................................................................................................ 158 B1 Three dimensional reconstruction and model fitting for the AAV8:ADK8 complex.. ... 178 B2 Homology alignment of a portion of the G H loop between AAV2 and AAV8. ............ 179 B3 Analysis of rAAV2 and rAAV8 mutant vector production. .............................................. 179 B4 Binding ability of rAAV2 and 8 mutant capsids by the ADK8 monoclonal. ................... 180 B5 in vitro and in vivo neutralization data ................................................................................ 181 B6 Neutralization analysis of the ADK8 mAb. ....................................................................... 182 B7 ADK8 and its impact on the N terminus externalization in the post-entry process. ........ 183

PAGE 12

12 LIST OF ABBREVIATIONS AAV adeno associated virus AAV1 adeno associated virus serotype 1 AAVS1 adeno associated virus integration site S1 Ab antibody AC artificial chromosome Ad adenovirus Ag antigen BCR B-cell receptor CC correlation coefficient cDNA copy deoxyribonucleic acid CF cystic fibrosis CFTR cystic fibrosis transmembrane conductance regulator Ch19 human chromosome chromosome 19 CNS central nervous system cryoEM cryo electon microscopy DMEM Dubelcos modified eagle media DNA deoxyribonucleic acid ELISA enzyme linked immunosorbent assay Fab fragment antibody -binding region FBS fetal bovine serum Fc fragment crystallizable region FV foamy vector HFV human foamy virus HIV 1 human immunodeficiency virus type 1

PAGE 13

13 HSPG heparan -sulfate proteoglycan HSV herpes simplex virus LAT latency associated transcript mAb monoclonal antibody mRNA messanger ribonucleic acid mtRNA mitochondrial ribonucleic acid MHC major histocompatibility complex PBS phosphate buffered saline PDGFR platelet deri ved growth factor receptor pDNA plasmid dexoyribonucleic acid pEI polyethleneinimine PLA2 Phospholipase A2 PLL poly -L lysine RNA ribonucleic acid RT reverse transcriptase RU resonance units SFV simian foamy virus SIN sindbis virus SPR surface plasmon reson ance TCR T cell recptor TMB tetramethylbenzodine VEE Venezuelan equine encephalitis VH heavy chain VL light chain V L P s viral like -proteins

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial F ulfillment of the Requirements for the Degree of Doctor of Philosophy MAPPING DOMINANT ANTIGENIC REGIONS ON THE CAPSID SURFACES OF ADENO -ASSOCIATED VIRIONS By Brittney L. Gurda May 2010 Chair: Mavis Agbandje -McKenna Major: Medical Sciences Biochemist ry and Molecular Biology The A denoassociated virus (AAV) is a small ssDNA virus that can package and deliver non -genomic DNA. Its low toxicity and relative lack of pathology along with broad tropisms, has made it popular as a vector for gene delivery tr ials. However, d espite the critical role of antibodies in the success of gene therapy with AAV vectors, the nature of the antigenic structure of the AAV c apsids is not well understood. Here we defined the binding of monoclonal antibodies against AAV seroty pes 1 2, 5 6, and 8 using cryo -electron microscopy and three dimensional image reconstructions. D ocking of capsid str uctures with fragment antibody models showed that the footprints on these viruses all fell on or around the three -fold protrusions of the capsid regard less of the serotype examined. S ignificant over lap between the binding sites le d t o the conclusion that this is a common region of antigenicity among the AAV capsid surfaces. In p reliminary studies, mutagenesis of the proposed sites on the AA V1 capsid showed that certain surface loop changes resulted in viruses that were able to evade previous r ecognition from parental antibodies. These data support the hypothesis that the t hree -fold axes are antigenically important and that mutation s in this region may avert a pre -exis ting immune response. F urther characterization is necessary to better design escape mutants and fully understand if these mutants are still via ble in their original tissue tropisms and transduction efficiencies.

PAGE 15

15 CHAPTER 1 BACKGR OUND AND INTRODUCTION Introduction to Gene tic Disease and Gene Therapy In the central dogma of molecular biology the normal flow of biological information is identified: DNA can be copied to DNA ( DNA replication ), DNA information can be copied into mRNA (t ranscription ), and proteins can be synthesized using the information in mRNA as a template ( translation ) (Crick, 1970) There are numerous factors involved in each stage of this flow that assist in the final outcome, which often leaves many opportunities f or mistakes to oc cur. Evolutionarily we have a distinct advantage in that there are also many checkpoints that aid in the correct outcome of these processes. Even so, a mistake can occur, but it is ofte n not evident at what point it occurred particularily for uncharacterized and multigenic diseases When the fault occurs at the level of DNA, it is ultimately our genes that become altered. These abnormalities are generally referred to as genetic disorders and can range from a small mutation in a single gene to the addition or subtraction of an entire chromosome or set of chromosomes. In s ingle gene d isorders a mutation causes the protein product of a single gene to be altered or missing, i.e., in cystic fibrosis. M ultiple gene disorders result from mutations in multiple genes, often coupled with environmental causes, i.e., Alzheimer s disease. In chromosome abnormalities, entire chromosomes, or large segments of them, are missing, duplicated, or otherwise altered, i.e., D own syndrome With the completion of the huma n genome project in 2003 and recent technological and medical advances the number of genetic disorders discovered has escalated. There are currently no cures for these diseases and most are treated symptomatically. In rare cases, replacement prote in therapies can alleviate the issues associated with the knock down or loss of a specific protein. Another option is gene therapy. In this DNA -based therapeutic, a functional gene is

PAGE 16

16 inserted or delivered to the cell in order to replace a dysfunctional on e. Although this concept is still in its infancy, many advances have been made over the last few decades that have identified this option as a possible mainstream therapy. Gene therapy can be seen in two schools of thought. The first, germ line therapy, ta kes place in the germ line cells, i.e., sperm or eggs. Modifications are created by the introduction of functional genes, which are ordinarily integrated into their genomes. Therefore, the change due to therapy would be heritable and would be passed on to later generations. The second is aptly termed somatic gene therapy and is a more accepted option that involves the passage of genetic material into the somatic cells of a patient. This allows for alterations to the patients genetic material only and does not transfer genetically to immediate or distant offspring ( http://www.dnapolicy.org/science.gm.php ). There are a variety of different methods to replace or repair the genes targeted in gene therapy: (I) An abnormal gene could be swapped for a normal gene through homologous recombination (II) T he abnormal gene could be repaired through selective reverse mutation, which returns the gene to its normal function or (III) T he regulation (the degree to wh ich a gene is turned on or off) of a particular gene could be altered (http://www.ornl.gov/sci/techresources/Human_Genome/medicine/ genetherapy.shtml ) In disord ers where mitochondrial DNA (mtDNA) is defective a new technique referred to as s pindle transfer can be used to replace entire mitochondria (Tachibana et al., 2009). The most c ommon approach is the delivery of a functional gene to a cell in context of a n episome This approach requires the use of a vector for delivery of the gene into the desired tissue. Gene Delivery Systems The delivery of naked DNA, or DNA -based drugs, has had limited success due to its poor cellular uptake profile and biological sta bility as well as a short half -life resulting in unpredictable pharmacokinetics (Patil et al., 2005). Furthermore, a broad application of naked

PAGE 17

17 DNA mediated gene transfer to gene therapy may not be conceivable because DNA, being large in size and highly h ydrophilic, is efficiently kept out of the cells in a whole animal by several physical barriers. These include the blood endothelium, the interstitial matrices, the mucus lining and specialized ciliate/tight junction of epithelial cells, and the plasma mem brane of all cells (Gao et al., 2007). The use of DNA delivery systems has not only improved the pharmacokinetics of DNA based therapeutics but has also achieved efficient targeted introduction of these m olecules into desired tissues (P atil et al., 2005). An ideal vector should be safe, stable, easy to produce in large quantities, and capable of achieving efficient and tissue specific gene expression when directly administered in vivo (Li and Ma 2001). These guidelines have aided in the development of nume rous delivery methods. There are currently two types of vectors for gene delivery; non -viral and viral vectors. Each system has its own set of advantages and disadvantages in both the production aspect and clinical counterpart. Non -Viral Delivery Methods N on -viral delivery vectors are particularly suitable with respect to simplicity, ease of large scale production, and lack of specific immune response. The delivery of therapeutic DNA in the absence of viral counterparts employs both physical and chemical ap proaches. The physical approaches include needle injection, hydrodynamic, electroporation, gene gun, and ultrasound delivery, which employ a physical force that permeates the cell membrane and facilitates intracellular gene transfer. Physical a pproaches D irect injection of naked plasmid DNA (pDNA) intramuscularly has been shown to transfer genes to myofibers although the levels of gene expression were shown to be low (Wolff et al., 1990). Intratracheal administration of p DNA in the mouse airway has been s hown to be safe and effective (Meyer et al., 19 95), which warrants further study for use in pulmonary

PAGE 18

18 diseases where gene transfer could be beneficial. Studies involving intravascular injection generally show limited transfer in all major organs ( Li and Ma 2001), however Budker et al (1998) reported that intravascular injection of naked DNA under high hydrostatic pressure in rats le d to high level s of foreign gene expression throughout all of the muscles of the targeted limb. These studies le d to the obse rvation that levels of gene expression could be increased by improving the method of i njection such as using hydrostati c pressure and clamping veins near the major injection vein to increase uptake of pDNA. Electroporation works through the notion that e xposing cells to an intense electrical field induces a transmembrane potential that facilitates cell permeabilization (Neumann et al., 1982). A number of tissues have been examined including liver, skin, subcutaneous tumors and muscle (Li and Ma 2001). M ost reports showed 10to 1000-fold differences in gene expression between naked DNA injection and DNA injection followed by electroporation and i n many cases, a broad distribution of transfected cells was also achieved ( Li and Ma 2001). Many tissues in cluding liver cells testes, skin, arteries, and tumors responded with high gene expression after electropartion (Parker et al., 2003), but it is noted that tissues may respond differently to electropo ration due to the variation in their local biological e nvironment (Li and Ma 2001). Typical voltages used in studies can be 1300 V/cm with 100 Heller et al., 2000) however; ultra short pulses of nanosecond (ns) durations and 10 300 kV/cm have been used for electroporation (Schoenbach et al., 2001). Since markers of apoptosis, i n cluding phosphatidylserine translocation and caspase activation have been observed with highintensity nanopulse electroporation it is thought that these methods could be useful f or cancer/gene therapy (Sundararajan et al., 2009). Besides local tissue dam age, other drawbacks include the

PAGE 19

19 amount of DNA needed to reach therapeutic levels of transgene expression as well as translational methodologies to include internal organs (Parker et al., 2003). The gene gun was originally designed to deliver genes to pla nt tissues It has shown promise in animal tissues as well albeit limited to superficial tissues. In this method, particles of varying sizes (1 3m) are coated in pDNA an d expelled out by a powerful burst of air. The bombardment of the particles through t he tissues allows for delivery of the genes. This approach has been reported to be superior to other methods of plasmid delivery to the skin, but tends to generate a Th2 (humoral) rather than the Th1 (cytotoxic) immune response that commonly follows intram uscular administration ( Wells 2004). For this reason, bio listic approaches are heavily studied in the delivery of DNA vaccines. Ultrasound is considered a noninvasive technique and has been used in the clinical setting for diagnostic and therapeutic applications The application of ultrasound results in acoustic cavitation that can disrupt tissues and produce transient membrane permeabilization, thus enhancing the delivery of plasmid to the cytoplasm (Wells 2004). Nucleation agents such as ultrasound contrast agents can enhance cavitation, and several studies have examined a range of such contrast agents, concluding that albumin -coated octa -fluoropropane gas microbubbles (Optison) is preferable to several other commonly available agents (Wells 2004). Re searchers have reported successful delivery of naked pDNA at lo w frequencies in lung (Xenariou et al., 2010), heart (Bekenedjian et al., 2003), tendon (Delalende et al., 2010), and skeletal muscle (Taniyama et al., 2002). However, current levels of cellula r transfection have not yet reached therapeutic levels (Parker et al., 2003) using this approach. Chemical methods The chemical approaches use synthetic or naturally occurring compounds as carriers to deliver the transgene into cells (Gao et al., 2007). Ef forts to develop deleivery systems that

PAGE 20

20 mimic the desired properties of a viral vector has incorporated the use of cationic lipid and protein carriers, termed lipoplexes and polyplexes, respectively. Lipoplexes consist of a positively charged or cationic lipid outer layer that encloses negatively charged DNA molecules. The positively charged lipid layer can self assemble around the negative DNA giving these lipoplexes more effective transfection efficiency of the negatively charged host cell membrane. Thes e particles can be ~1003 00nm in diameter (Midoux et al., 2009; Parker et al., 2003) and usually vary in shape depending on the DNA: lipid ratios. Internalization of the lipoplex is thought to occur through clathrin -mediated endocytosis (Midoux et al., 200 9 ) and its escape still remains a mystery. Several thoughts about their escape from the endosome have been proposed but it seems that a majority of the DNA complexes become trapped in the endosome and are eventually destroyed when fusion with a lysosome o ccurs (Midoux et al., 2009). This has greatly limited the efficiency of lipoplexes in gene delivery and ha s led to the use of fusogenic lipids and protein, as well as the incorporation of histidines and imidazole, in the complexes for improved endosomal es cape (Midoux et al., 2009) to the nucleus Another drawback is the tendency of the negatively charged particle to become associated with positively charged proteins and glycans in the extracellular milieu (Parker et al., 2003). Resear chers are also investi gating the interaction of lipoplexes with membrane associated proteoglycans into order to better characterize the effect of cell surface receptors and trafficking pathways on this approach (Mislick and Baldeschweieler, 1996). Polyplexes are cationic polym er s that have been mixed with DNA to form stable complexes. Several polymers have been studied for use in gene delivery including linear, i.e. poly -lysine (PLL) a nd branched, i.e. polyethylene imine (pEI), as well as block and grafted copolymers (De Smedt et al., 2000). These particles are often nanoparticulate (<100nm) and

PAGE 21

21 homogenous (Parker et al., 2003). Many of these studies have also involved the addition of ligands to aid in targeting specific tissues, i.e. galactose for hepatocyte delivery (Zanta et al., 2007). The uptake of polyplexes appears to happen through both clathrin -mediated and cholesterol -dependent pathways, which can also occur simultaneously (Midoux et al., 2008). Peptides that mimic viral proteins have also been used in conjunction with n anoscopic material to help target delivery to and aid in passage across the cell membrane (Roy et al., 2009). The major bar rier is, as for lipofection, endosomal escape (De Smedt et al., 2000 ). Protocols that use PLL have incorporated the use of endosome lytic functions, such as inactivated adenovirus or fusogenic peptides (Li and Ma, 2001). The most promi sing studies have use d pEI as it appears to have an inherent mechanism for escape into the cytoplasm (Parker et al., 2003). A lthough the mechanism of end osomal escape is still not well understood there are s evera l ideas that have been proposed These include an endosomal buffering capacity, quenching of lysosomal acidificat ion through protonation of amine groups, and an increase in osmolarity leading to eventual rupture of the endosomal membrane (Parker et al., 2003). Other novel nonviral delivery methods include transposons where the advantage of virus and naked DNA is combined, and artificial chromosomes (ACs). Both are highly appealing for gene therap y. Transposons are naturally occurring with a desirable safety/toxicity profile and integrate into chromosomes, providing long term expression of the gene of interest in cells (Izsvak et al., 2009). Current studies include recombinant forms of a fish trans poson, Sleeping Be auty, and have been fairly success ful, but require further optimization of cellular transduction (Ivics and Izsvak, 2006). On the contrary, ACs are autonomous and do not integrate into the host chromosome Although they offer escape from other issues surrounding gene therapy including,

PAGE 22

22 insertional mutagenesis and immune responses, they are highly complex, difficult to deliver, and technically challenging to construct (Macnab and Whitehouse, 2009). Optimization of non -viral vector delivery meth ods is a growing fiel d due to the safety of the vectors no or low immune response, and their relative ease of production. In summary, m ajor issues that surround these methods include specific tissue targeting, cellular uptake, trafficking to the nucl eus, and stable translation Many of these issues are being addressed by studying and applying viral methods, such as the addition of viral peptides, which will provide safer forms of delivery an d give an advanta ge over viral vectors Viral Delivery Met hods Viruses have spent thousands of years evolving to deliver their genomes into our tissues in order to express the proteins needed to continue their lifecycle. The application of viruses as vectors in gene transfer involves members who naturally infect mammalian tissues and can be used in diseases which are genetic or environmentally acquired (Lundstrom 2003). Although progress has been slower than expected, many advances have been made over the past two decades which have lead to various s uccesses and unfortunately, some failures (Flotte 2007). The engineering of integrating (retroviruses) and non integrating (herpes, adenovirus, and adenoassociated viruses) has made it increasingly obvious that there are no universally applicable ideal viral vector s ystems available (Lundstrom 2003). Several factors should be reviewed before the application of a vector including the various features of each vector as well as the type of disease being treated (Lundstrom 2003). Brief discussion s of several popular vir uses currently being studied as vehicles in gene delivery a re given below as well as the major advantages and disadvantages of each vector.

PAGE 23

23 Retroviruses Retroviruses have a large 7 10kb single -stranded RNA (ssRNA) genome which must be reverse -transcribed in order for viral replication to occur. Retroviruses follow a special case in the central dogma of molecular biology by first transcribing its mRNA to DNA In order to do this, the virus encodes for its own reverse transcriptase as well as an integrase, t o assist with integration of the viral genome into the host genome for transcription These proteins are translated from the polymerase or pol gene which also encodes for a viral protease. Retroviruses are enveloped viruses which obtain their membrane from the host during cell budding. This envelope is decorated with surface antigens that are encoded in the envelope or env gene and expressed on host cell membranes. The capsid proteins and membrane associated matrix proteins are found inside the membrane and are encoded by the group-specific antigen or gag gene (Coffin, 1992). Several of these viruses have been studied for use as gene therapy vectors including members of the Gamma -retroviruses (Buchschacher, 2001) Lentiviruses (Valori et al., 2008) and Spum aviruses (Trobridge 2009). Pioneering of in vivo gene t ransfer involved the retroviruses, namely murine leukemia virus (Lundstrom 2004). T he lentiviruses were used to show a vectors potential to transduce cells which have no or very low mitotic activity and have further since been developed for clinical application in neurological disorders (Lundberg et al., 2008). V ectors based on human immunodeficiency virus type 1 ( HIV1 ) have been developed for enzyme replacement and/ or delivery of neurotrophic fact ors for neurodegenerative diseases and CNS manifestations of lysosomal storage diseases, as well as deliver y of glial cell line -derived neurotrophic factor and ciliary neurotrophic factor for Parkinsons and Huntingtons diseases (Lundberg et al., 2008). T hese vectors have also shown great promise in the delivery of small hairpin RNA for gene therapy in neurological disorders and transgenic knockdown animals (Singer and Verma, 2008).

PAGE 24

24 The retroviruses offer the advantage of large packaging capabilities, the ability to efficiently transduce non -dividing cells, and to the ability to maintain stable gene expression (Cockrell and Kafri, 2007). Their ability to integrate into the host genome is appealing for stable gene expression, but is limited to cell division and has also been shown to randomly integrate ( Li et al., 2002). In comparison to conventional retroviruses, the lentiviruses can infect both dividing and non -dividing cells (Lundstrom 2004). One of the greatest successes in gene the rapy trials to date wa s the ex vivo retroviral mediated transfer of the c gene into CD34+ cells for Xlinked severe combined immunodeficiency disease (X -SCID) (Hacein Bey -Abina et al., 2002). Unfortunately, aberrant viral integration into the LMO -2 locus was found to cause leukemia in a few patien ts and the trial was halted ( Hacein -Bey -Abina et al., 2003). With the increase in knowl edge of retrovirus biology especially with the lentivirus the engineering of nonintegrat ing vectors continues (Sarkis et al., 2008; Valori et al., 2008). As toxicity of replication competent vect ors have increased, e fforts to improve the safety and titers of recombinant retroviral vectors have included the creation of replication incompetent vectors by the introduction of cis acting elements in trans during vector production (Sinn et al., 2005). T issue targeting is also an issue with many of the retroviruses due to their strict receptor specificity To address this issue, researchers have developed pseudotyping approaches which can greatly aid in re -trageting (Sanders, 2002). In this method, the retroviru s native envelope is replaced with a helper plasmid expressing heterologous envelope glycoproteins, including lyssaviruses, arenaviruses, hepadnaviridae, flaviviridae, paramyxoviridae, baculovirus, filoviruses, and alphaviruses (Sinn et al., 200 5 ). T he Foamy virus (FV) is a spuma virus, another subfamily of the retroviruses, and is unique in that they have evolved to exhibit no pathology in their host during transmission and

PAGE 25

25 infection (Trobridge 2009). The human foamy virus (HFV) was found to have evolved from the simian foamy virus (SFV) and it appears that humans are an ac cidental host ( Meiering and Linial, 2001 ). There is no evidence of human-to human transmission and it also appears to be contain ed among individuals working amid non-human pr imates with active infections ( Meiering and Linial, 2001 ). Their other promising attributes for gene therapy consist of a desirable safety profile, a broad tropism, a large transgene capacity, and the ability to persist in quiescent cells (Trobridge 2009). FV vectors have been shown to efficiently transduce embryonic stem cells and neuronal progenitor cells (Trobridge 2009), and their resistance to human sera provides further advantage for in vivo usage (Russell and Miller, 1996). Adenoviruses The Adeno viruses (Ad) are large non -enveloped, double -stranded DNA viruses that are commonly associated with upper res piratory tract infections and have been linked to other illnesses such as ga stroenteritis, conjunctiv iti s, cystitis, and rash (Horwitz, 1995). Pos itive factors making Ad an attractive vehicle for gene transfer include their ubiquitous nature; over 100 serotypes have been isolated from many different species, their ability to transfect a broad range of human cells including non-proliferating cells, their ability to yield a high rate of gene transfer, their relative low pathogenicity ; causing mild symptoms associated with the common cold, their large 7.5 kb genome and finally, their genome stability that allows for the mainte nance of recombinant gene s (Vorburger and Hunt, 2002). Ad vectors were originally studied for use as vehicles for gene transfer in patients suffering from cystic fibrosis (CF) a monogenic disease where a mutation disables the cystic fibrosis transmembrane conductance regulator ( CFTR) gene due to their specificity for pulmonary epithelial cells (Wilson, 19 96). Adenoviral DNA was also found in liver, skeletal muscle, heart, brain, lung pancreas, and tumor tissue (Bramson et al., 1995), expanding the range of cell lines

PAGE 26

26 for gene d elivery. Interestingly, w hen Ad vectors are administered intravenously, most of the virus accumulates in the liver (Vorburger and Hunt, 2002). Preliminary trials were met with several problems, including transient expression and a host immune response (Wi lson, 1996). It was eventually realized that viral products needed to be limited in order to minimize the immune response and from this realization came the second generation vectors. The Ad genome contains early genes which encode for regulatory proteins, and late genes which encode for structural proteins. In order to make the Ad virus less immunogenic, additional ea rly genes were removed to stop the upregulation of structural proteins that would continue the viral lifecycle (Wilson 19 96). Unfortunately, these vectors were sti ll toxic due to low transcription levels of the remaining viral genes (Yang e al., 19 95) One recombinant strategy to improve the vector included a Cre -loxP helper -dependent (HD -Ad) vector in which all viral coding sequences were de leted and a helper virus su pplied the necessary functions in trans (Parks and Graham, 1997). Another novel design in Ad vectors incorporated a transposon system in which the gene of interest could be inser ted into the host genome (Yates et al., 2002). Othe r strategies include the creation of hybrid vectors, which combine the infectivity of Ad with the integra tion processes of retroviruses or adenoassociated viruses, retargeting of Ad to non -CAR -expressing cells, and promoter regulation at the packaged genome level (Vorburger and Hunt, 2002). Although many of these systems have improved toxicity and prolonged gene expression (Schiedner et al., 1998), re administration of the vector is still problematic. In most cases, an initial immune response is seen up on first administration of the vector, and furthermore, most adults have been exposed to Ad2 and 5, the two serotypes most commonly used in gene therapy (Vorburger and Hurt, 2002). Because the Ad gene does not integrate into the host genome, vector

PAGE 27

27 re admi nistration is necessary, especially in chronic problems, like CF. However, this transient display of gene expression has been found to be useful in issues where a patient may benefit from an induced immune response, especially against cancer cells (Vorburger and Hunt, 2002). Ad vectors are common ly used in clinical trials for cancer, including head and neck, prostate, breast cancer melanomas (Vorburger and Hunt, 2002), and ovarian cancers (Matthews et al., 2009). Several unique vectors have been designed to target cancer cells and are termed conditionally replicating adenoviruses or CRAds (Matthews et al., 2009). One of the best examples is ONYX015 (Khuri et al., 2000). This system is modified in the early gene region, specifically, E1b, which normally al lows the virus to bind and inactivate the p53 gene (Barker and Berk, 1987). Ironically, this mutated virus cannot replicate in normal cells with a functioning p53 gene, but can replicate and kill cancer cells that have a defective p53 gene (Vorburger and H unt, 2002). One of the first commercial gene therapy products, Gendi cine, which was approved by the State Food and Drug of China (SFDA) in 2005, is ba sed on an Ad5 vector that expresses p53 (Wilson, 2009). More than 20 kinds of cancer indications have been treated with Gendicine, such as head and neck squamous cell carcinoma lung cancer, breast cancer, and liver cancers (Peng 2005). Another Ad -based therapy, Ocorine (H 101) was also released in China alongside Gendicine in 2005 (Shi and Zheng, 2009). Her pesvirus The herpes simplex virus (HSV) is one of the largest viruses being studied for use in viral mediated gene delivery. The two most commonly studied human s pecies are HSV 1 and 2, which are usually associated with watery blisters on the lips, mouth, and genitals. The HSV genome is single stranded DNA and encodes for ~100 200 genes. This relatively large, complex genome is ~152kb and is encapsulated in an icosahedral shell The capsid is then surrounded by the tegument, which contains about 20 different proteins that have structural and regulatory roles

PAGE 28

28 (Marconi et al., 2009). The tegument is encompassed by a membrane that is obtained when the virus leaves the host cell. This membrane is decorated with glycoproteins that are translated from viral genes at the late stage of infection. The HSV infection is c haracterized by immediate -early, ea rly, and late gene translation. The appealing feature s of the HSV are not only the large packaging ability, but also its neurotropism and ability to generate latent inf ections (Lundstrom 2004). A latent infection is established in the neural ganglia through the expression of a Latency Associated Transcipt. This allows the virus to maintain the host cell, by -passing cell death mechanisms, in order to pr eserve a copy of t he virus (Wang et al., 2005) Full length HSV are neurotoxic and are generally manipulated to be either replicationcompetent attenuated vectors, replication incompetent recombinant vectors, or defective helper dependent vectors known as amplicons. In at tenuated vectors, the removal of several non essential genes that are involved in the replication, immune evasion, and virulence of HSV allows for an alteration of the HSV virulence (Marconi et al., 2009). These have been tested as live viral vaccines, as oncolytic viruses and as gene therapy vectors to deliver transgenes to the nervous system (Marconi et al., 2009). The replication deficient vectors have mutated or deleted essential genes that render the virus incapable of replication (Marconi et al., 2009 ). T hese vectors are generated in transformed cell lines that offer the missing replication genes in trans which allows for the generation of second-generation vectors that have reduced toxicity associated with them (Marconi et al., 2009). The removal o f these genes also allows for larger foreign gene products, or multiple genes under separate promoters (Marconi et al., 2009). The HSV amplicon system has gained significance as a versatile gene transfer platform due to its extensive transgene capacity, wi despread cellular tropism, minimal immunogenicity, and its amenability to genetic manipulation (de Silva and Bowers, 2009). Among other components, the amplicon has only two

PAGE 29

29 non -coding sequences from the wild type HSV 1 genome which are required for repli cation and packaging of the amplicon into infectious particles (de Silva and Bowers, 2009). Upon delivery to cells, the genome remains episomal and does not integrate into the host system (de Silva and Bowers, 2009). Since this would be lost during cell re plication, several factors have been added to the amplicon to allow for repli cation -competency or to enhance its episomal retention within the transduced cell nucleus (Lufino et al., 2008). Packaging systems for the amplicons have also been developed and i ncluded either helper -free or helper -dependent systems based on HSV cosmids or HSV replication -deficient vectors, respectively (reviewed in de Silva and Bowers, 2009). Re t argeting of the HSV vectors natural tropism has also been attempted through the gen etic manipulation of HSV envelope glycoproteins, namely gC, gD, and gB (de Silva and Bowers, 2009). Conversely, restriction of the vector to its natural cell targets has also been attempted by replacing envelope glycoproteins with ligands (de Silva and Bow ers, 2009). HSV amplicons have been incorporated into therapeutic studies for disease of the CNS, including Parkinsons, Ischemia, and hereditary ataxia, as well as anti -cancer therapies (de Silva and Bowers, 2009). The limitations for implementation of HS V amplicons in clinical trials continue to be vector production, extension of transgene expression (mainly conventional amplicon vectors), and regulation of transgene expression (de Silva and Bowers, 2009 ). Overall, the major issue with HSV vectors is its innate and humoral immune response in the host system (Flotte 2007). Alphaviruses The alphaviruses have been found to infect a wide variety of hosts, including hum ans, rodent s, birds, and horses Their over all structure consists of a 9.7 11.8kb ssRNA geno me that is housed in a nucleocapsid, which is surrounded by a membrane ( http://www.expasy.org/ viralzone/all_by_species/625.html ). They have a relatively simple genome that encodes fo r both

PAGE 30

30 structural and non-structural genes The structural genes give rise to the capsid protein, as well as the envelope glycoproteins (E1 3), while the non-structural genes are important for transcription and replicati on Alphaviruses, such as Semliki Fo rest (SFV) (Liljestrom and Garoff, 1991), Sindbis (SIN) (Xiong et al., 1989), and one of the encephalitis producing members, Venezuelan Equine Encephalitis (VEE) (Davis et al., 1989), h ave all been use d to develop vehicles for gene transfer. There are several general features that make the alphaviruses appealing for gene transfer including; positive -sense RNA which allows for direct tr anslation of the message, mass production of viral mRNA which shuts down host protein synthesis and eventually leads to apo ptosis (may be beneficial in cancer therapy), their efficient packaging ability, and finally, their affinity for a broad range of host cells ( Ehrengruber and Lundstrom 2007). The alphaviruses have been used extensively for recombinant protein expression in cell lines, in expression studies in neurons, and in vaccine production (Lundstrom, 2003). Furthermore, i t appears that while SFV and SIN have been developed further on the gene therapy fron t, VEE has had more promise as a vaccine vector (Pushko et al., 1997; Lundstrom 2004), specifically as a DNA vaccine for bioterrorism (Lee et al., 2005; Dupuy and Schmaljohn, 2009). Animal studies using SF V vectors have shown efficient gene transfer of reporter and therapeutic genes to quite a few tumor models (Lunds trom 2003). In the case of SIN vectors, a morphological mutant vector has been shown to allow for an increase in packaging size from ~12 kb to an 18 kb cDNA insert (Nanda et al., 2009). It has been speculated that this heterologous vector could possibly package and transcribe an RNA insert as long as 32 kb (Nanda et al., 2009). Unfortunately, alphavirus is cytotoxic to most cell lines causing cell death between 12 and 24 hours post infection (Schlesinger 2001). On the other hand, studies in insect cell lines have shown that a persistent, non -cytopathi c infection occurs and that virus production

PAGE 31

31 can reach up to a 100-fold higher compared to mammalian cells (Schlesinger 2001). Vector design ha s included the use of replicons that eliminates most of the stru ctural proteins, as well as the use of two defective helpers, which offers the advantage of overcoming the copy-choice mechanisms of the replicase in order to avoid infectious particle production (Schlesinger 2001). Replicons with reduced cytopathogenic ity have been identified that allow replication of the virus in certain cell lines without causing cell death (Schlesinger 2001). Further limitations of the vector include transient transgene expression, a broad host tropism and a neuron-specific transge ne expression (Lundstrom 2003). In order to overcome these issues, advances in targeting have included genetic alteration of the E2 glycoproteins (Schlesinger 2001), which determines binding to cell receptors (Dubu isson and Rice, 1993), in addition to encapsulation of the v ector into liposomes (Lundstrom, 2003). A phase I trial using encapsulated SFV -particles produced no toxicity to the liposome or SFV -particle and allowed for repeat treatment with the vector (Lundstrom 2003). Adeno -associated v iruses The adeno associated viruses (AAVs) are the smallest of the gene transfer vectors, but have had a large impact in the field of gene therapy. Although over 100 different genotypes of AAV have been isolated from human and non human primate tissues alone, onl y a handf ul of them have been serotyped and studied through structural analysis (Gao et al., 2005; Xie et al., 2002; Govindasamy et al., 2006; Nam et al., 2007, Agbandje -McKenna unpublished data ). The s erotyped members include AAV1 12, with AAV2 being the best characterized and most studied among them (Mori et al., 2004). The AAVs are members of the genus dependovirus and are dependent on a larger DNA virus, like a denovirus, for replication. Ironically, t hey were originally found as contaminants of adenovir al stocks (Atchison et al., 1965) and have been continually isolated from a very broad rang e of hosts, including goats, birds sheep, snakes, and

PAGE 32

32 cows (Olson et al., 2004; Luchsinger et al., 1970; Farkas et al., 2004; Clarke et al., 1979; Yates et al., 197 3 ). The AAVs are non -enveloped and have a very simple genome, encoding just two open readings frames rep and cap Because of its simplicity, as well as relative lack of pathogenicity, low toxicity, and ease of manipulation, the AAVs have been extensively studied as vectors in gene transfer These vectors are also able to infect dividi ng and non-dividing cells, and can offer integration into a unique site, AAVS1, on human chromosome 19 (Ch19) under certain constraints, i.e. inclusion of rep proteins and spe cific integration site sequences (Surosky et al., 1997). The different serotypes have also been identified in animal studies as having different specificities for different tissues. For example, AAV1 has shown to have the best gene expression in the muscle, while AAV 8 has repeatedly been superior in the liver (Thomas et al, 2004; Davidoff et al., 2005; Jiang et al., 2006; Wang et al., 2005). Although AAV9 has been found to be best in cardiac tissue (Pacak et al., 2006), a recent study with AAV9 has identifi ed an ability to cross the blood brain barrier resulting in widespread transduction in neurons throughout the brain including the neocortex, hippocampus and cerebellum (Foust et al., 2009). AAV v ectors h ave already been tested in clinical trials for CF, h emophilia B, Parkinsons and Canavan disease, late infantile neuronal ceroid lipofuscinosis, arthritis, and an ex vivo study to treat prostate cancer (Carter 2005). The greatest success story involves a recombinant AAV2 (rAAV2) vector packaging the RPE65 gene for treatment in patients with Leber s Congenital A maurosis (LCA). These studies have not only improved eyesight in both animal models and human patients, but have also produced stable gene expre ssion for over a year for continued improvement of the d isease (Bainbridge et al., 2008; Maguire et al., 2008; Hauswirth et al., 2008; Cideciyan et al., 2009). Although these vectors have shown relative success in the field of gene therapy they also have a few disadvantages. First, their small size allows for m inimal

PAGE 33

33 packaging, and attempts to package more than 5 kb have been quite unsuccessful (Lai et al., 2010). This limits the size of the therapeutic gene that can be packaged as well as the disease targets, as many monogenic diseases can also involve large ge ne defects Second, many of the recombinant vectors are difficult to produce in the laboratory setting and efficient yields are difficult to produce for large scale studies (Flotte 2007). T hird, wild type AAV is known to have an integration site on the hu man chromosome during latent infection (Kotin et al., 1990; Samulski et al., 1991) and efforts to characterize this phenomenon will aid in the exploitation of AAV integration (Daya et al., 2009) The development of integrating AAV vectors may also help dea l with the transient expression of AAV delivered therapies in dividing cells Lastly and one of the largest concerns, is the immune response against AAV vectors. Fortunately the immune response is not lethal, but does raise concerns for re administration o f vectors and cell -mediated death of transduced cells. Several trial s in animal models have been able to express therapeutic genes stably in target tissues often resulting in impressive levels of protein expression but eventually are overc ome by an immune response in human trials (Wang et al., 2007; Zaiss and Muruve, 2008). The types and extent of these responses will be addressed further in the following sect ions, since the focus of this study is on the antigenic nature of the AAV capsid, more specificall y, the humoral response. Current Status and Issues in Gene Therapy To date, the Food and Drug Ad ministration (FDA) has not approved any human gene thera py products Although many animal trials have been relatively successful (hemophilia B, RPE, color -blin dness) past human clinical trials have had moderate to little success. However, success that has occurred throughout the last decade has gained gene therapy a runners up title in Sciences 2009 breakthrough of the year issue (The News Staff, 2009). G ene therapy is considered experimental and still has many hurdles to overcome. The field has definitely grown

PAGE 34

34 in knowledge since its conception and there are many different approaches to the current issues. These issues which are briefly discussed in the sec tion following, include short lived gene transfer, insertional mutagenesis immune respo nses to the vector and the transgene vector toxicity, ability of viral vectors to revert to wild type virus, horizontal gene transfer, and the correction of multi -gene disorders. Retroviral and lentiviral vectors appear to stand at the fore -front of integrating vectors due to their inherent ability to integrate into the host genome. Although this allows for long term gene expression, there are concerns involving the ef ficiency and effects of integration. Integration of the vector into host genes or regulatory elements can knock out the gene or cause truncation products, or even lead to changes in expression patterns ( Voigt et al., 2008). These results can have devastati ng effects on the host, including causing cancer ( Voigt et al., 2008). The AAVs also have the ability to integrate into the host genome at Ch19 where a persistent latency is established. Studies have shown that vectors containing rep gene were more e fficie nt at integration compared to vectors without AAV Rep (McCarty et al., 2004). The mechanisms and efficiency for AAV integration have been studied by several groups (McCarty et al., 2004; Daya et al., 2009; Linden et al., 1996) and have had difficulty in de fining either the mechanism or its actual efficiency which is apparently very low (McCarty et al., 2004). However these studies have also identified important regions on Ch19 for integration as well as cellular components and DNA sequences (McCarty et al ., 2004; Daya et al., 2009; Linden et al., 1996). One such study examines the rate of integration in mouse neonate livers. This study found that at least 0.05% of hepatocytes contained rAAV integration, while 68% of integrations occurred in genes, but none of them were near the mir 341 locus, the common rAAV integration site found in mouse hepatocellular carcinoma (Inagaki et al., 2008). Of course, integration is not limited to

PAGE 35

35 viral vectors. No n viral methods rely on the synthetic fish and frog transposons Sleeping Beauty and Frog Prince, respectively for integration (Voig t et al., 2008) These allow for a DNA cut and -paste mechanism that has been shown to be relatively safe in animal models as well as human tissues (Voig t et al., 2008). Non -viral vecto rs still lack targeting efficiency, but may be overcome by the combination of viral delivery with non -viral gene transfer. Most vector systems to date lack well characterized integration and generally exist as episomes in host cells, which are eventually l ost in dividing cells or silenced (Voight et al., 2008). Efforts to stabilize episomes include the removal of bacterial sequences and the inclusion of elements such as nuclear antigen I, from the Epstein Barr virus, and human scaffold or matrix attachmen t regions (S/MARs) can prolong persistence of the episom e (Wu Xiao, et al., 2000; Piechaczek et al., 1999). The use of viral vectors in gene delivery has many advantages, especially in targeting and gene transfer efficiency, but their disadvantages are r ather serious. The most obvious is that of a host immune response and the toxicity that can ensue. Of course, the types and severity of these factors will depend on the target tissue, mode and route of delivery vector being used and doses as well as the immunocompetence of the host (Waters and Lillicrap, 2009). For one, delivery of vector to the eye has shown only an attenuated response to new immunogens while systemic delivery through the circulatory system results in activation of the innate and ada ptiv e system at various sites (W aters and Lillicrap, 2009 ). Although non-viral transfer has shown better tolerance by the immune system, methods using hydrodynamic protocols have been shown to cause tissue damage which activates inflammatory responses and subs equent reaction can includ e the delivered transgene (Miao et al., 2006). Viral vectors are naturally immunogenic and most have developed methods to evade detection by the host immune system. At large doses, like those given in gene therapy settings, these reponses can be detrimental to t he host or the therapeutic

PAGE 36

36 outcome The adenovirus is a good example. This vector has great potential as it transduces many tissues including antigenic presentic cells (APCs), and although large doses up to 1 x 1013 are gen erally well tolerated in mice, studies in baboons highlight lethal toxicity ( Di Paolo and Shayakhmetov 2009). Compared to adenoviral -vectors, the AAVs do not transduce APCs well and therefore, do not tend to create a robust innate response ( Waters and Lil licrap, 2009). Although studies have shown that a cellular response can be elicited depending upon delivery methods, transgene, and species (Vandenberghe and Wilson 2007; Mingozzi et al., 2007; Lu and Song, 2009). The AAVs have also been shown to generate neutralizing antibodies against the vector capsid, which can cause issues upon re administrati on using the same AAV vector ( Zaiss and Muruve, 2008; Huang and Yang, 2009). Interstingly, responses to lentiviral vectors injected into animal tissues, such as non -human primate brain, cat eye, and mouse thymus have shown no, or limited, immune response ( Chang, 2009). However, the ability of lenti -vectors to transduce APCs such as dendritic cells, can result in immunological responses to the transgene as it will most likely be displayed in either major his tocompatability complexes I (MHCI) or MHC II (W aters and Lillicrap, 2009). The next issue would be the possibility of a recombinant virus reverting to its wild type disease causing form An extensive amount of ti me and research has gone into protecting ourselves from the very viruses that we have placed such high hopes in for gene delivery. Almost all ve ctors studied today use minimal wild type genome from the infectious viral parent and when needed can usually i ncorporate a helper replication system to provide replication proteins in trans (Walther and Stein, 2000; de Silva and Bowers, 2009; Valori et al., 2008). Specifically in the lenti vectors, removal of as much viral sequence as possible is important because the re are several genes that can cause detrimental effects on cells including oncogenesis (Tat), apoptosis

PAGE 37

37 (Vpr), MHC down regulation (Nef) and differentiation (Vpu) (Azzouz and Mazarakis, 2004) This ensures that replication of the vector cannot occur in the patient and minimizes the cellular toxicity seen in response to parental virus (de Silva and Bowers, 2009; Azzouz and Mazarakis, 2004). Another concern is that of vertical gene transfer, or the transfer of these therapeutic elements to the next ge neration. This line of thought breaches the Weismann barrier, proposed by August Weismann in 1885. Weismanns theory basically states that the germ cells are responsible for heredity and that the somatic cells, or other cells of the body, do not influence this heredity. Apparently there is enough evidence to suggest that there is a selective permeability to this theory. One such study using retroviral vectors delivered angiotensin II type I receptor antisense (AT1R-AS) cDNA to spontaneously hypertensive rat s (SHR) and found that subsequent generations had cardiovascular protection against hypertension as a result of a genomic integration and germ line transmission (Reaves et al., 1999). Another study for hemophilia using a viral delivery system was halted af ter viral DNA was identified in a patients semen (Boyce 2001). However, s ince semen contains other material, further testing was ordered and isolated sperm cells were eventually found to be negative for the viral DNA (Boyce 2001). Katherine A. High, an M.D. and Howard Hughs Medical Institute investigator suggests that: E ven if foreign DNA gains access to a germ cell, in order for harm to result, it must lodge in a site where it can have an effect. Based on reasonable assumptions about the human genome and on data from a recent AAV trial, the risk of detecting a birth defect caused by gene transfer appears to be less than one in one milliona negligible increase over the baseline risk of birth defects of about one in one hundred (highrisk of gene transfer ). Among concern for vertical transmissi on is also horizontal gene transfer. In this case, an organism receives DNA from another organism, without being the o ffspring of that organism Almost all vectors are typically gutted or have minimal elements retain ed in the vector construct

PAGE 38

38 but this does not rule out the chance of viral integration, or homologous recombination events leading to residual viral DNA elements. Interestingly enough, researchers have recen tly identified the presence of b ornavirus, a nega tive -sense RNA virus incorporated into the genomes of multiple mammalian lineages and at different times, ranging from more than 40 million years ago in anthropoid primates to less than 10 million years ago in squirrels (Horie et al., 2010; Feschotte 2010). This novel find, along with the data identified in ge ne transfer trials indicate that viruses have indeed optimized themselves for future revival and could have profound implications in viral vector mediated gene therapy. An additional consideration i s one of eco -pharmcovigilance. The excretion of active pharmaceutical material in the environment has been going on since the introduction of these compounds, but we have just recently begun to quantify their levels (Boxall 2004). The best known example i s t he effects of birth -control hormones in freshwater fish populations ( Kidd et al, 2007; Boxall 2004). A works hop, held in October 2007 by the International Conference on Harmonisation Gene Therapy Discussion Group aimed to provide a better understanding of the contribution of viral vector -shedding studies to the benefit risk assessment of gene therapy products (Khler et al., 2009). Topics discussed included advantages and disadvantages of assays used for detection of viral vector shed into excreta (K h ler et al., 2009). It is expected that more sensitive assays should be developed to test for viral nucleic acids and among that, the detection of transmission rates of shed vector to third -party persons or animals should be included in all trials (Khler e t al., 2009). Current strategies in gene therapy have focused on monogenic disorders or those resulting from a single gene disord er, such as CF. These disorders have been well characterized and the therapeutic target is generally one form of a gene. Unfor tunately, most genetic diseases are the

PAGE 39

39 result of multigene disorders, such as heart disease, high blood pressure, and diabetes These diseases pose multiple issues for gene therapy due to targeting and coordination of multiple gene delivery. More complica ted diseases will most likely need to be well characterized so that the molecular factors i nvolved can be fully corrected. Regrettably, it seems that many of these disorders, monogenic and multifactoria l alike have environmental factors involved that may not be reversible with gene therapy. The stage of disease will also make this more difficult, as many effects of disease, such as ti ssue damage, are limited in reversibility depending on the extent of damage. However, for the more characterized diseases, p revention may be the best cure here and may at some point involv e gene therapy of a single disorder at a time. It is obvious, from even the small amount of information presented here, that the issues in gene therapy are quite numerous and still require m ore detailed knowledge before a solution may be found. Depending on the nature of the disease in question, therapies through gene transfer will most likely not be able to rely on one method alone. An interesting combination is that of RNAi and Ad vectors, in which poor in vivo gene transfer of RNAi alone was overcome with the use of an Ad delivery system (Lundstrom 2004). Immune responses may be overcome with the encapsulation of viral vectors in liposomes (Lundstrom 2003), while pre -existing responses ma y be overcome by the use of vectors that have not been seen by the human patient, i.e. Goat -AAV (Arbetman et al., 2005). It may be that stable inducible, gene expression is achieved through the combination of well characterized integrating vectors combined with drug -regulating transcription (Auricchio et al., 2002). There seem to be endless possibilities and multiple combinations that have yet to be tried or optimized. Unfortunately, beyond the specific concerns associated with each method still exists the translation of observed therapies in animal models to the human patient. This major obstacle is currently being tackled as researchers advance to larger

PAGE 40

40 animal models and aim to further characterize the toxicity of introducing foreign genes and proteins in to our system. As one last point, b eyond the biological concerns are also the ethical c oncerns of human modification and enhancement. These issues are beyond the strictl y biological aspect of this study, but are definitely another barrier in the advancement of gene therapy and many of the techniques surrounding this modern marvel. As the focus of this project is on the antigenic nature of viruses as a vehicle for gene therapy, specifically the AAVs, it is necessary to look further at the events surrounding an immune response. As these vectors are foreign to our systems, we have adapted to respond to them for our own good. On the first insult our bodies will naturally work to clear the infection, generally beginning with a cellular response. The cellular re sponse will then alert the humoral responses which will aid in continued protection through antibody production and memory responses. This memory response will be a factor if treatment is needed again. As mentioned earlier, many of the current therapies ar e transient and will require a secondary, or even, more consistent delivery. This type of treatment will require superior engineering to evade the immune responses and it is our hope that the data generated here will eventually add to the understanding of the antigenic nature of viral vectors and their further exploitation and manipulat ion for successful gene delivery therapies. A ntibody Recognition of Viruses a nd Viral Neutralization Antibodies are critical for the control of many viruses and generally tar get proteins on the viral surface or on the surface of infected cells. Neutralization of a virus by these antibodies is defined as the loss of infectivity which ensues when antibody molecule(s) bind to a virus particle, and usually occurs without the involvement of any other agency (Burton 2002). The protective effects of neutralizing antibodies can be achieved not only by neutralization of free particles, but also by several activities directed against infected cells. Although there is much

PAGE 41

41 controversy surrounding the production and mechanisms of neutralizing antibodies (Burton 2002; Dimmock, 1984; Burton et al., 2000; Klasse and Sattentau, 2002), they remain imperative to most vaccine -mediated protective strategies. Efficient B -cell induction and gene ration of B -cell memory requires two signals. The first is mediated by the B -cell receptor (BCR) while the second signal is usually provided by T -cells. It has been postulated that extensive BCR cross linking can activate B -cells to produce IgMs without th e aid of T -cells. Antigens that conatin h ighly r epetitive epitope have been correlated to these specific B -cell responses (Bachmann and Zinkernagel, 1996). In fact, it has been suggested that for an antigen to be T -cell independent it must contain a thresh old number of appropriately spaced epitopes in order to stimulate the B -cell receptor (Dintzis et al., 1983). This includes all non -enveloped viruses, especially those that have a highly organized icosahedral structure like AAV. Interestingly in hepatiti s B (which is an enveloped structure) studies identified the nucleo capsid antigen to generate both T -cell dependent and independent response, while the surface antig en is T -cell dependent (Milich and McLachlan, 1986). Any antigen may have several epitopes, or specific sites that are recognized by a lymphocyte or an antibody. Epitopes for antibodies on proteins can be linear or continuous, like those recognized by T -cell receptors (TCRs) or they can be made up of different regions of a po lypeptide that come together in a three dimensional structure. The latter is often referred to as a discontinuous or a conformational epitope However, not all conformational epitope s are discontinuous (Harris et al., 2006). Indeed, linear stretches of residues have been iden tified in conformational epitopes where the unique structure of the paratope like a loop -helix motif, plays an important role in recognition (Harris et al., 2006). These antibodies are generally raised against native folded proteins, but may recognize fra gments of the protein if the proper binding elements of the structure are retained.

PAGE 42

42 When the heavychain (H c ) and light -chain (Lc ) regions of the antibodys variable region are paired their hypervariable loops form the complementarity -detemining regions o r CDRs. These regions determine antigen specificity by forming a surface complementary to the antigen. The formation of these shape complementary regions is an important determinant of the antibody antigen interaction along with solvent accessibility and c ontact energies (Rapberger et al., 2007). This interaction can be disrupted by extreme salt concentrations, large pH shifts, detergents, and even competition with high concentrations of pure epitope. The binding is therefore a reversible non-covalent inte raction that involves electrostatic forces, hydrogen bonds, Van der Waals forces, and hydrophobic interactions. A striking difference seen in antibody protein interactions is the involvement of aromatic residues (Janeway et al. 2005 ). Sev eral groups have addressed if an unusual amino acid composition exists in antigen antibody interactions. S tudies involving the physical properties of the se interfaces have revealed that high percentages (34%) of the antibody -contacting residues are aromatic, with tyrosine s and tryptophans in the CDRs being more solvent exposed (Davies and Cohen, 1996) In contrast, the contacting residues on the antigens contain relatively few aromatic amino acids (Davies and Cohen, 1996) The pattern of binding that emerges is similar to t hat found in other protein protein interactions, with good shape complementarity between the interacting surfaces (Davies and Cohen, 1996). Viruses are eliminated by the host through many different mechanisms, including cytokines, cytotoxic T -cells (CTLs), complement, and antibodies It follows that viruses that are efficiently controlled by antibodies are under a direct evolutionary pressure to form serotypes (Bachmann and Zinkernagel 1996). These serotypes exist so that neutralizing antibodies against se rotype A do not work against serotype B, thus an individual can be infected by two (or more)

PAGE 43

43 serotypes despite the pre existence of neutralizing antibodies to the first. The existence of many different antigenic forms of viruses (e.g. Rhinoviruses) makes t hem harder to control as they often have the ability to mutate rapidly to generate many different variants in a single host (e.g. HIV 1 in humans). The ability of viruses to produce structural variation while maintaining function and the effectiveness of t he antibody to neutralize are other factors involved in their response. The success of a vaccine will be determined by an antibod ys ability to neutralize and the subsequent protection after a natural infection. However, in the case of viral vectored gene therapy the ability of engineered viruses to escape neutralization may be beneficial to patients with pre -existing immunity or those in need of repeated treatment with the same vector. Antibodies directed at viruses may be able to completely block infectiv ity after direct binding to the virion, while others are less efficient. Mechanisms of neutralization can be classified according to the event in virus replication that they block. Studies have noted antibody interference at cellular attachment sites, post attachment interactions of the virus with receptor and co receptor, internalization, and fusion at the cell surface or in endosomal compartments of enveloped virions (Klasse and Sattent au 2002). Additional mechanisms can occur in vivo including Fc -mediat ed phagocytosis, complement binding and activation, opsonization, and antibody dependent cellular cytotoxicity of infected cells (Burton 2002). It has also been noted that some antibodies neutralize through mechanisms that have yet to be explored. Apparently some antibodies to Sindbis virus and poliovirus can eliminate infection or reduce progression in vitro even when added to cells several hours post -in fection (Smith, 2003). There is also evidence that some antibodies show non-neutralizing activity in vitro but offer protective immunity in vivo (Schmaljohn et al., 1982; McCullough et al., 1992). Although neutralizing antibody is one of the main arms of protective immunity and the type that is often desired in vaccination there is

PAGE 44

44 surprisingly little known about these interactions. Some of the best studied examples of neutralization include many common human pathogens such as HIV1, rhinovirus, influenza virus, and poliovirus (Reading and Dimmock 2007 ; Huber and Trkola, 2007; Smith 2001). The list has recently grown to include emerging pathogens like West Nile, Hendra, and Nipah virus (Reading and Dimmock 2007 ; Oliphant and Diamond 2007). Parvovirus Capsid Structures, Receptor Binding, a nd Infection It appears that the immune responses seen among pati ents and animals alike are ultimately dependent upon the structural nature and infectivity profile of the insulting virus, or vector. Since this work is dedicated to characterizing the immune responses seen in our vector of choice, AAV, it is best to have a detailed look at the infectious pathway and structural nature of this virus in c omparison with other family members and in context of the host. Members of the family Parvoviridae infect a variety of hosts, ranging from insects to primates, predominantl y causing disease in young vertebrates. These viruses are non -enveloped with a capsid shell of ~260 in diameter that exhibits a T=1 icosahedral symmetry. They are made up of 60 copies of between two and four overlapping capsid proteins designated viral p rotein (VP) 1 -VP4 (Table A 1) The autonomous parvoviruses (including minute virus of mice (MVM ) and canine parvovirus ( CPV)) are composed of ~50 copies of VP2, while the adenoassociated viruses (AAVs), a member of the genus Dependovirus, contain mostly V P3. The VP1 protein makes up about 5 % of the capsid and has been reported to contain phospholipase A2 (PLA2) activity in the VP1 unique region, as well as basic sequences which appear to act as nuclear localization sequences (Girod et al., 2002; Zadori et al., 2001; Grieger et al., 2007). The AAVs are also composed of ~ 5 % of an alternative ly splice d protein, also called VP2, which is reported to not be required for infectivity. Parvovirus capsids are similar in that there is one capsid protein that forms the majority of the structure, as well as minor proteins that form the

PAGE 45

45 same core structure, but have additional sequences on their amino -termini. Despite differences in sequence there are certain structural elements that have been identified as common among the parvoviruses These include raised regions at the five -fold axes of symmetry (Figure A 3 ), depressed regions or canyons surrounding the five -fold axes, one or three protrusions at or surrounding the three -fold axes of symmetry (three -fold spikes or pea ks ; Figure A 3 ), and depressed or dimpled regions at the two-fold axes of symmetry ( Chapman and Agbandje McKenna, 2006). All the viruses have a superimposable core ei ght -barrel domain that forms the interior of the capsid (Figure A 6A) The parvoviruses use a variety of proteins and carbohydrates as receptors or co -receptors for infectivity and entry. Sialic acid has been shown to be important for infectivit y of MVM and several of the AAV serotypes. However, studies have identified that an AAV serotypes ability to bind sialic acid depends on the linkages involved in the carbohydrate chemistry; AAV4 binds 2,3 O linked sialic acids, and AAV 1, 5, and 6 bind bot h 2,3 and 2,6 N linked sialic acids (Kaludov et al., 2001; Seiler et al., 2006; Wu et al, 2006). Receptors and co -receptors for AAV2 include heparin sulfate proteoglycan (HSPG), human fibroblast growth factor receptor 1, integrins and hepatocyte growth factor receptor (c -met) (Qing et al., 1999; Qiu and Brown, 1999; Summerford et al., 1999; Kashiwakura et al., 2005). P latelet -derived growth factor receptor (PDGFR) is the protein that mediates infection for A AV5 (Di Pasquale et al., 2003) while the t ransferrin receptor has been reported as a receptor for CPV and feline panleukopenia (FPV) ( Parker et al., 2001). The sites for interaction of some of these receptors with the parvovirus capsid have been mapped eit her by mutagenesis or through direct interactions at the structural level. In AAV2 HSPG binds to the three -fold axis of symmetry, whereas for CPV the transferrin receptor attachment site is near the top of a raised region around this three -fold axis of

PAGE 46

46 sym metry (Opie et al., 2003; Kern et al., 2003; Hafenstein et al., 2007; ODonnell et al., 2009; Levy et al., 2009). Mutations in AAV2 have been used to alter binding specificity and infectivity (Rabinowitz et al., 1999; Wu, Xiao, et al., 2000; Xu et al., 2005 ; Lochrie et al., 2006; Shi et al., 2006). T he receptor attachment sites are still unknown for the other AAV serotypes. Although the attachment sites vary among different parvoviruses, it is thought that they all enter by receptor -mediated endocytosis ( Weitzman, 2006). Entry of AAV2 and CPV into the cell occurs by endocytosis through clathrin-coated pits and is inhibited by overexpression of a dominant inte rfering mutant of dynamin (Duan et al., 1999; Parker and Parrish, 2000; Bartlett et al., 2000). Aft er uptake into the cell the pathway is less well characterized. Acidification has been suggested as being necessary for infectivity by using drugs that disrupt endosomal pH (Bartlett et al., 2000; Ros et al., 2002; Basak and Turner, 1992). Escape from the endosome seems less efficient, but studies identify a release of the VP1 unique region and its associated PLA2 activity, allowing the virion to enter the cytoplasm (Girod et al., 2002; Suikkanen et al., 2003; Zadori et al., 2001). The capsid is then propos ed to move through the cytoplasm by microtubule -mediated processes to the perinuclear region, the capsid then enters the nucleus possibly via a NLS that is found in the already exposed VP1 unique region (Ros and Kempf, 2004; VihinenRanta et al., 2002; Gir od et al., 2002; Greiger et al., 2007). Modifications to the capsid during transport may also result in the exposure of sequences that aid in transport through the nuclear membrane (Cotmore, 1999). Different entry and transport patterns by the different pa rvoviruses may also exist. For example, transduction of cells by AAV capsids can be enhanced by inhibitors of proteosomal degradation proteases, while the MVM and CPV capsids are not affected by those inhibitors (Denby et al., 2005; Yan et al., 2002, Ros et al. 2002, Yan et al., 2004)

PAGE 47

47 Parvovirus Antigenic Properties There have been many studies involving antibody binding and neutralization of the parvoviruses, most notably on MVM CPV, FPV, AAV2, and human parvovirus B19 (B19). These viruses differ in their host range, pathogenic nature and capsid protein composition, but still have structural similarities that determine the antigenic response due to infection (Agbandje McKenna and Chapman, 2006) The mechanisms of antibody induction, binding, and neutraliz at ion are not well understood, but the data presented in this work adds to the knowledge in this field and may eventually aid in their definition It appears that the elaborate loop regions barrel, which make up the protr usions at or surrounding the icosahedral threefold axes and the walls between the depressions at the twoand five -fold axes, are the most immunogenic sites in the parvovirus capsid (Agbandje et al., 1995; Govindasamy et al., 2003; Bloom et al., 2001; Xie et al., 2002; Simpson et al., 2002; Strassheim et al., 1994 ). Studies of CPV and MVM have used escape muta tions from neutralizing mAb s to map epitopes on the CPV FPV and MVM capsids (Lopez Bueno et al., 2003; Strassheim et al., 1994) while others have used peptide scans and ELISA based assays to map immunodominant regions on the parvovirus capsids including AAV2 (Wobus et al., 2000; Brown et al., 1992). Structural studies based on CPV and FPV have also u sed cryo electron microscopy (cryo EM ) to confirm previously identified antigenic regions on these capsid surfaces (Hafenstein 2009) much like this study has done with AAV The capsid s urface of the insect infecting densoviruses appear quite smooth compar ed to those of the viruses infecting vertebrates (Figure A 3) (Simpson et al., 1998; Bruemmer et al., 2005), suggesting that the raised structures in the vertebrate viruses provide a benefit when the virus is und er antibody selection. These data also confirm the idea that only viruses that are efficiently controlled by antibodies are under evolutionary pressure to form serotypes (Bachmann and Zinkernagel, 1996) as described below for the parvoviruses

PAGE 48

48 P arvovirus A ntigenic Structures f or Autonomous Viruses FPV isolates infect cats, mink, and other carnivores, while CPV infects dogs and close relatives, such as wolves, coyotes, and Asiatic raccoon dogs. CPV emerged in 1978 and the original strain (CPV type 2) was rep laced between 1979 and 1981 by a genetically and antigenically distinct virus (type 2a), which has recently been replaced by further variants (Parrish, 2006). FPV and CPV differ antigenically in at least 1 epitope, and after emerging in dogs CPV later gain ed 3 or 4 additional mutations in the VP2 gene which changed 2 different epitopes (Parrish et al., 1991; Parrish et al., 1985) There are close connections between the host ranges of the viruses and their antigenic structures a nd variation. The effects of antibody binding on the capsid surface of CPV and FPV have been previously examined (Parrish and Carmichael, 1983; Strassheim et al., 1994; Wikoff et al., 1994). Efforts to map epitope regions on the capsid have included the us e of natural variants or mAb -selected escape mutant analysis (Strassheim et al., 1994; Wikoff et al., 1994), peptide mapping, and cryoEM analysis with image reconstru ction of Fab :capsid complexes. Most of t hese studies have identified two major regions of antigenicity on the virus while a recent structural study using cryoEM has confirmed these regions (Hafenstein 2009) Site A is close to the top of the three -fold spike of the capsid, while site B is located on the shoulder of the three -fold spike (Chang et al., 1992; Langeveld et al., 1993; Lopez de Turiso et al., 1991; Strassheim et al., 1994). The capsid regions around epitopes A and B also show the greatest structural variation between CPV and FPV, and their host range and antigenic mutants (Agbandje et al., 1993; Govindasamy et al., 2003; Llamas Saiz et al., 1996; Simpson et al., 200 2 ). These methods have determined that VP2 residue 93 in epitope A and 299 and 300 in site B determine the canine host range of the viruses, by controlling the interaction of the capsid with canine and feline TfRs (Govindasamy et al., 2003; Hueffer et al., 2003). Antibodies to these regions preclude receptor attachment ultimately causing neutralization.

PAGE 49

49 Studies of MVM during long term immune therapy with a single neutraliz ing mAb in immunodeficient mice resulted in the isolation of mutant viruses escaping neutralization through single amino acid change s within the VP2 protein, residues 433 439, which are located on a surface-exposed loop at the three -fold axes of the capsid (Lopez -Bueno et al., 2003). Recent studies using cryoEM have led to the image reconstruction at 7 resolution of the structure of the immunosuppressive strain of MVM (MVMi) bound to the neutralizing antibody, B7 (Kaufmann et al., 2007). The VP2 residues involved in the contact are 225, 228, 229, 425, 426, and the loop 432440, which correlate with the escape mutant findings The structural results, together with the analysis of B7 binding and neutralization activity, suggest that this antibody may hinder conformational transitions in the viral capsid required for the MVMi infection process (Kaufmann et al., 2007). Antigenic studies on Aleutian mink disease virus (A M DV) have revealed some rather interesting results. Adult mink infected with A M DV develop a persistent infection associated with high levels of antiviral antibodies and hypergammaglobulinemia (Aasted et al., 198 4; Bloom et al., 1994). In spite of this robust immune response, virus is not eliminated in vivo and complications usually arise. Furthe rmore, antiviral antibody enables A M DV to infect cells such as macrophages via an Fc -receptor dependent mechanism termed antibody-dependent enhancement (ADE) (Bloom et al., 2001). It is also interesting to note that antiviral antibody does not protect adul t mink from infection, but rather, leads to an accelerated form of disease upon challenge (Aasted et al. 1998). Sites on the A M DV capsid have been mapped through peptide studies (Bloom et al., 1997; Bloom et al., 2001; McKenna et al., 1999) to regions sim ilar for AAV (see below) and CPV/FPV, located on the wall between the two -, three -, and five -fold axes, and on the inner wall of its three -fold mounds. Immunoreactive spans of peptides were

PAGE 50

50 located in VP2 residues 429524, which correlates with a residue s pan of 428446 that is recognized by infected minks (Bloom et al., 1997). This region is located in the wall of the twofold depression, and antibodies directed at this peptide, although elicit ADE, are able to neutralize infectivity in CrFK (feline kidney origin) cells. However, another well characterized epitope spanning from residues 487501 at the inner wall of the mounds of the icosahedral three fold axes, is capable of inducing ADE, but is not neutralizing. The observation that the same amino acid seq uence can both neutralize virus and induce ADE may explain the inability of capsid -based vaccines to protect against A M DV infection (Bloom et al., 2001). B19 a member of the erythrovirus genus, is a human pathogen that predominantly infects young children with mild flu -like symptoms and a characteristic red rash that gives the appearance of a slapped cheek. The disease usually runs its course with no complications, but has been known to have adverse effects in pregnant women and those with immune disorde rs. The B19 capsid epitopes have been mapped to the VP1 unique region and to the VP1/VP2 overlapping sequence, and most of the VP1/VP2 neutralizing epitopes are located on the loops that make up the protrusions on the B19 capsid surface (Kaufmann et al., 2004; Rosenfeld et al., 1992; Sato et al., 1991; Yoshimoto et al., 1991) Antibodies that recognize VP2 residues 57 77, 345365, and 446466 inhibit hemagglutination by B19 (Brown et al., 1992), while those generated for peptides wi th the residues 253515 are neutralizing. Mapping these residues onto the crystal structure of B19 identifies re sidues on the wall between the two and five -fold depr essions and at the base of the three -fold protrusions. The loop containing residues 309319 is disordered in the B19 structure (K aufmann et al., 2004) but residues 314330 structurally superimpose onto a portion of the C37B epitope for the dependovirus AAV2 (discussed below) (Wobus et al., 2000)

PAGE 51

5 1 The Dependoviruses and t heir Antigenic Properties The genus dependovirus houses the AAVs, which share a common, but not absolute requirement for an unrelated DNA helper virus ( e.g. adenovirus, herpesvirus, papillomavirus, vaccinia virus) to aid in the completion of their otherwise replication deficient life cycle (Muzyczka and Berns, 2001; Bowles et al., 2006). Phylogenic analysis now places the autonomously replicating goose (GPV) and duck parvoviruses into this genus where they cluster with the avian adeno associated virus (AA AV) (Tattersal, 2006). Probing s tudies have lead to the identi fication and cloning of 53 new AAV capsid DNA sequences from non-human primates (Gao et al., 2002; Gao et al., 2003) and 64 from human tissues (Gao et al., 2004). The identification of so many isolates has brought about the need for a classification system in order to move the field forward. The isolates have therefore been divided by three different classification systems based on differences in the capsid: serology, transcapsidation, and clades based on genetic relatedness. Much of the virus variation is concentrated into the regions of the sequence that make up the surface exposed loops of the capsids, and they therefore are mostly antigenically distinct when tested with polyclonal antibodies, being classified as AAV1 through AAV11. There are currently si x clades; A,B,D,E, and F, which house AAV1, AAV2, AAV7, AAV8, and AAV9 respectively, while the AAV2/3 hybrids belong to Clade C. AAV4, AAV5, do not fit any of the clades and are regarded as clonal isolates (Gao et al., 2004). Serology is no longer used to group t he AAVs, but the isolates still fall into serologically distinct groups. In addition to their genetic and antigenic differences, the AAV serotypes exhibit a wide range of distinct biological properties including receptor binding and tissue tropism (Chiorini et al., 1997, 1999; Xiao et al., 1999; Davidson et al., 2000; Rabinowitz et al., 2002, Choi et al., 2005). Their dependency upon helper viruses has generated a promiscuity among the AAVs tha t enables them to be in many different cell lines awaiting helper functions. In the absence of this

PAGE 52

52 helper, the virus has the ability to integrate into the host chromosome to set up a latent infection. This relatively simple strategy is not harmful to the host and has not been associated with any known disease or pathogenicity. These qualities have enabled the development of recombinant AAVs for use as vectors in gene therapy. Recombinant gene transfer vectors based on AAV2 have proven effective in animal models for the correction of genetic diseases of the eye brain, muscle, liver, and lung (Warrington and Herzog 2006). However, numerous studies have shown that other serotypes possess unique tissue tropisms and have improved gene transfer activities compared to that of AAV2 for some cell types and are also be ing studied to avoid the pre existing antibodies that are widespread in the human population, or which develop after primary AAV treatments and which reduce the efficacy of subsequent treatments (Jooss and Chirmule 2003; Zaiss and Muruve 2005, Calcedo 2009). AAV1, for example, can transduce rodent skeletal muscle more efficiently than AAV2 (Xiao et al., 1999). AAV4 has strong tropism for epe ndymal cells in the central nervous systems of mice (Davidson et al., 2000; Liu et al., 2005) and for retinal pigmented epithelium in rats, dogs, and nonhuman primates (Weber et al., 2003). Among the more recently discovered serotypes, AAV7 has also been s hown to have superior muscle transduction compared to AAV2, while AAV8 and AAV9 are the most efficient serotypes discovered so far for transducing the liver (Gao et al., 2004; Gao et al., 2002). Studies on AAV2 capsids and their mutants suggests that the polyclonal antibody response is focused on a relatively small number of sites on the capsid, and that reactivity can be reduced by mutations of residues within those sites (Lochrie et al., 2006). However until the developments of new mAb s to AAV1 and AAV5, discussed in this study there have been only a few mAb s reported that react with i ntact capsids (Kuck et al., 2007; Wobus et al., 2000). There is currently little

PAGE 53

53 information available about how the various anti -AAV IgGs recognize capsids, their mechanis ms of neutralization, or the distinction between cross reactive and specific epitopes. The antigenic structure of AAV2 is the best characterized among the dependoviruses, since peptide mapping has been used to identify both linear and conformation-depende nt epitopes on the capsid that are recognized by mAb (Wobus et al., 2000) Linear epitopes (recognized by antibodi es A1, A69, and B1) and conformational epitopes (recognized by antibodies A20, C24 B, C37B and D3) have been reported, although the C24 B site has not been mapped. The linear epitopes are not relevant to the infectious virus as A1 recognizes VP1 only, whi le A69 recognizes a peptide in the VP1/VP2 common region, and B1 recognizes all three capsid proteins via an epitope at their C -termini (Wobus et al., 2000) Antibodies to the conformation-dependent epitopes show multiple mechanisms of neutralization, as the C24-B and C37B antibodies inhibit receptor attachment, while the A20 antibody apparently neutralizes at a post attachment step, and D3 antibodies are non -neutralizing (Wobus et al., 2000; Figure 1 1 ). The C37B epitope (residu es 493502, 602610, VP1 numbering) is close to the HSPG binding site on the capsid, which is consistent with its ability to block receptor binding. Antibodies to the C37B epitope specifically recognize AAV2, but not AAV1, 3, 4, or 5, likely related to the fact that surface loops near the heparin binding region are the most variable in the AAV capsid structures (Govindasamy et al., 2006; Padron et al., 2005) The D3 epitope is fairly conserved in the sequences of most AAV serotypes (Padron et al., 2005) D3 antibodies recognize serotypes AAV1, 3 and 5, but not 4, and residues in that epitope are close to structural differences between AAV2 and AAV4 within the moun ds surrounding the icosahedral three -fold axes (Govindasam y et al., 2006; Padron et al., 2005). The A20 antibody reacts only with AAV2 and AAV3, and this epitope contains three different regions in the primary sequence (residues 272281, 369378, and 566575) (Wobus et

PAGE 54

54 al., 2000) that come together in the capsid structure (Xie et al., 2002) Comparisons of the AAV4, AAV5, AAV8 and AAV2 coat protein structures identified the A20 binding regions as some of the most vari able between the three viruses (Govindasamy et al., 2006; Padron et al., 2005; Walters et al., 2004; Nam et al., 2007). The AAV4 capsid protein is not recognized by the B1 antibody, which recognizes a linear epitope (residues 726 733) of denatured capsids near the C-terminus of the VP3 protein (Wobus et al., 2000) A comparison of the AAV2 an d AAV4 VP3 crystal structures showed that there is no major conformational difference in the B1 epitope region, suggesting that amino acid sequence differences may play a role in the capsid antibody recognition (Govindasamy et al., 2006). A panel of mutati ons of surface residues of AAV2 to either conservative substitutions (to Ala) or to radical changes were prepared and examined for their ability to bind HSPG and to bind or be neutralized by the A20 mAb by polyclonal antibodies in 3 human sera, or by a pool of human IgGs (Huttner et al., 2003; Lochrie et al., 2006) Mutations that reduce binding and neutralization by polyclonal human and monoclonal murine antibodies were identified as well as mutations that reduce, have no effect on, or increase transduction. There was not always a direct relationship between the change in IgG binding and neutralization, indicating that not all IgGs neutralize equally efficiently as has been reported for other virus families such as rhinovirus (Smith et al. 2001). AAV Capsid Structure a nd Serotypes The AAV2 capsid structure has been determine d by cryoEM and by X -ray crystallography to ~3 (Kronenberg et al., 2001; Xie et al., 2002). Even more recently the structure of AAV2 at 65 cryoEM (Kronenberg et al., 2005). Th is structure g ave some insight into the elusive location of the VP1 unique region in that it is known to be required for infectivity, but has not been identified in previous reconstructions. This structural region was described as

PAGE 55

55 globules located under the icosahedral two -fold axes of symmetry. Other serotype structures that have been solved by cryoEM and X ray crystallo graphy include AAV1, AAV4, and AAV5 9 by the Agbandje -McKenna lab ( Fig ure 1 2 A ) ( Govindasamy et al ., 2006; Nam et al., 2007; Walters et al., 2004; and Agbandje McKenna, unpublished data Sequence analysis has identif ied AAV4 and AAV5 as being the most diverse serotypes at the amino acid level and also antigenically (Gao et al., 2004). The AAV serotype structures can be placed into two categories based on their surface topology. AAV2 (Kronenberg et al., 2001; Xie et a l., 2002) and AAV1, and AAV6 8 (Nam et al., 2007 and unpublished data) exhibit pointed finger -like protrusions around the threefold axes, while AAV4, AAV5 and AAV9 (Govindasamy et al., 2006; Padron et al., 2005; Walters et al., 2004; and unpublished dat a ) have rounder mounds surrounding the icosahedral three -fold axis of symmetry (F ig ure 1 2B ). Sequence alignments and 3D modeling of AAV3, 6 and 10 shows that they will be similar to the AAV1, 2, and 8 class, while A AV11 will be more like AAV4, 5 and 9 Comparison of all the available AAV structures or models revealed a conserved -barrel motif, while the more variable regions were map ped to the exposed surface loops (Govindasamy et al., 2006; Figure 1 2C ). This has also held true for other parvovirus capsids (reviewed in Kontou et al., 2005). The surface loop regions become cluste red as VP monomers come together to form the capsids icosahedral symmetry. This assembly creates variations on the capsid surface at the five -fold axes, the shoulder regions and the tips of the three -fold protrusions, which surround the two-fold axes. Th ese variable regions localize with previously identified surface areas that affect receptor recognition, capsid recognition by conformational antibodies, specifically A20 (Wobus et al., 2000), and transduction efficiency for AAV2 (Lochrie et al. 2006). Th is study has map ped antigenic sites on five serotypes, including the

PAGE 56

56 already well characterized AAV2, the structurally similar AAV1 and AAV6, and the m ore distinctly related AAV5, as well as hepatrotrophic AAV8, which provide s a strong insight on the recog nition of antibodies by the AAV capsids and their resultant binding abiliti es Significance The generation of neutralizing antibodies during viral infections is often crucial to recovery and is usually the target response in vaccination strategies. Despite the important role that immunoglobulins have in animal virology there are still many aspects that are not completely understood. There are many other viruses, including such important pathogens as HIV, rhinovirus, hepatitis C, and influenza that induce on ly partially protective antibodies that do not aid in clearance of the virus. The rules that govern neutralization mechanisms are even less well known, as it has not yet been determined how the step in the viral lifecycle to be blocked is chosen. The evolution of viruses is partially driven by the hosts mechanisms of defense in that they must choose mutations that still allow for receptor attachment, replication, and immune evasion in ord er to survive. Through the data presented here i t will be possible to define dominant antigenic regions that are directly involved in binding and neutraliza tion by mAb s against the capsid of a simple and well characterized virus the AAVs. The parvoviruses are important pathogens in the veterinary sciences, as well as amon g humans including the erythrovirus B19, which had been recognized for many years as one of the classical rash illnesse s of childhood. There are many unknown autonomous parvoviruses identified by PCR (Candotti et al., 2004; Terossi et al., 2007), as well a s different AAVs (Chen et al., 2005; Gao et al., 2004). Because the AAVs are associated with no known pathology, have a wide range of infectivity, and can establish long -term transgene expression, they have great potential as a viral vector in gene therapy (Muzyczka, 1994; Choi et al., 2005; Muzyczka and Warrington 2005). The AAVs under examination here have distinct tissue tropisms likely due to

PAGE 57

57 differences in cellular receptor utilization which is thought to arise from structural differences between AAV serotypes at the capsid level (Wu, Asokan, et al., 2006). Similar to wild type viruses, recombinant vectors are detected by the immune system and generate a response that becomes effective usually before the virus infects its target cell. This immunity not only acts against the vector and the infected cells, but also results in a memory response that affects further efforts to use the same vector or even transgene again (Bessis et al., 2004). Efforts to enhance the safety and delivery of vectors are ongoing as well as the determination of strategies to sidestep the antiviral response. This study supports the idea that it would be useful to have well characterized AAV vectors with predictable tropisms and altered antig enic sites that can be used in the treatm ent of individuals with a pre -existing immune response as well as fo r subsequent therapies. Fi gure 1 1 The antigenic structure of AAV 2. Antigenic epitopes of AAV2 ( Wobus et al., 2000) displayed on the 3D capsid surface of PDB 1LP3 (Xie et al., 2002). A mino acids that form the A20 (green spheres), C37B (magenta), D3 (orange), and B1 (blue) epitopes are displayed in context of the entire capsid surface depicted in grey cartoon. The icsahedral symmetrical axes are indicated by red arrows and the 5-fold is also highlighted in dark grey for orientation purposes.

PAGE 58

58 Figure 1 2. P anel of available AAV atomic structures A ) VP3 is shown for each serotype that has been solved to date by X -ray crystallography. B) The two major surface topologies of the existing ser otype structures can be grouped into two classes. AAV5 represents those serotypes with rounder protrusion. The other class depicts finger like protrusions and is re presented by AAV2. C) Superimposed VP3 monomers reveal a common motif with variable regi ons at the exposed surface loops (I -IX) The symmetrical axes are represented by black shapes (same in A and C); the pentamer represents the five -fold axis, while the triangle and the oval represent the three -fold and the two -fold, repectively. An asymmetr ic unit is depicted as a white -outlined triangle in B

PAGE 59

59 CHAPTER 2 MATERIALS AND METHOD S Production and Purification of Recombinant AAV VLPs for Structural Studies The AAV capsid proteins VP1, VP2, and VP3, for serotypes 1, 4, and 5 9, were expressed in sf 9 insect cells under the baculovirus polyhedron promoter as previously reported (Miller et al., 2006) These proteins self assemble into virus like particles (VLPs). After 72 hours incubation at 27 ere spun down for 15 minutes at 1 500 rev min1 (4C), and the pellet was resuspended in lysis buffer (50mM.Tris pH8.0, 100mM NaCl, 0.2% Triton X 100). The pellets we re then subjected to three freeze/thaws with the addition of benzonase (Novagen) after the second cycle and then centrifuged for 15 30 minutes at 10 000 rev min1 (4C). The supernatant was then diluted with TNET buffer (50mM Tris pH 8.0, 100mM NaCl, 1mM EDTA, 0.2% Triton X 100) and pelleted through a 20% sucrose cushion for 3 hours at 45 000 rev min1 (4C). This pellet was resuspended o vernight at 4C and further purified by ultracentrifugation on a step gradient (5 40% sucrose) at 35 000 rev min1 (4 C). A visible blue fraction containing empty (no DNA) viral capsids, sedimenting at ~2025% sucrose, is expected and will be extracted an d dialyzed. AAV2 capsids were purified u sing iodixanol gradients and a heparin agarose affinity column. Discontinuous iodixanol step gradients were forme d in quick -seal tubes (2589 mm, Beckman) by underlaying and displacing the less dense cell lysate (15 ml) with iodixanol (5,5[(2 -hydroxy 1,3 propanediyl)bis(acetylamino)] bis[ N, Nbis(2,3dihydroxypropyl 2,4,6 triiodo 1,3 benzenecarboxamide] prepared using a 60% (w/v) sterile solution of OptiPrep (Nycomed) and PBS MK buffer (1 PBS containing 1 mM MgCl2 and 2.5 mM KCl). Therefore, each gradient consists of (from the bottom) 5 ml 60%, 5 ml 40%, 6 ml 25%, and 9 ml of 15% iodixanol; the 15% density step al so contains 1 M NaCl. Tubes were sealed and centrifuged in a

PAGE 60

60 Type 70 Ti rotor at 69 000 rev min1 for 1 h at 18C. Approximately 5 ml of the 40 25% step interface was aspirated after side puncturing each tube with a syringe equipped with an 18 -gauge needle (modified from Zolotukhin et al., 2002). A heparinagarose (H 6508, Sigma ) c olumn with a 2.5ml bed volum e was then prepared and equilibrated with 10 ml of PBS -MK buffer (1 PBS containing 1 mM MgCl2 and 2.5 mM KCl) then 10 ml of PBS MK/1 M NaCl, followed by 20 ml of PBS -MK buffer. The AAV2 capsid co ntaining iodixanol fraction(s) we re then diluted with twice the original volume and applied to the column. The col umn wa s washed with 3 10 column volum es of PBS MK buffer and sample was eluted with PBS MK/1M NaCl. Th e high sodium chloride content wa s reduced by buffer excha nge or dialysis and the eluent wa s checked for protein by optical density. Samples we re then concentrated on cent rifugal filter units (Millipore ) and checked for the VP1, VP2, and VP3 proteins by SDS PAGE analysis (Figure 2 1) Intact capsids were verified by negative stain electron microscopy (EM ) (Figure 2 -1) Fv Antibody M odeling U sing the Web Antibody Modelling (WAM) S erver Sequences (obtained for the Fab variable domain of AA4E4.G7, AA5H7.D11, and BB3C5.F4 by the Parrish group at Cornell) were were submitted to the WAM server (http://antibody.bath.ac.uk/index.html ). The modeling is done piecewise for the heavy and light chains and the canonical loops (Figure 2 2) which is based on the WAM algorithm (http://antibody.bath.ac.uk/algorithm.html ). Briefly, homology modeling is used to build the framework of the antibody structure, i.e., heavy and light chains. The canonical loops are also built through homology modeling with 5 rounds of minimization to smooth out joint regions. The more diverse, non -canonical regions are built based on a different algorithm, the Combined Antibody Modelling Algorithm ( CAMAL ) (Martin et al., 1989).

PAGE 61

61 Preliminary Neutralization A ssays Neutralization assays were conducted at NIH (Bethesda, MD) in collaboration with Dr. John Chiorini. Briefly, AAV1 and AAV5 capsids that were packaging the green fluorescing protein (GFP) gene were pre -incubated with serial dilutions of hybr idoma supernatant for 30 minutes at ro om t emperature prior to addition to cos7 cells and incubated for 1 hour at 37C. Fresh media was then added to the cells a nd the cultures incubated for 48 h ours at 37C. The percentage of infected cells was evaluated by measuring the GFP -expressing cells using flow cytometry. Preliminary In -House Green Cell Assays Purified monoclonal antibodies of AA4E4.G7, AA9A8.B12, and BB3C5.F4 were used in green cell assays to check their neutralization properties (for future studies aimed at deciphering theirmechanism s of neutralization). Briefly, cos7 cells grown to ~100% confluency in complete Dulbeccos Modified Eagle Media (with 10% FBS and 1% P/S; DMEM) were plated at a dilution of 1:4 in 96 -well dishes. Assuming 60 binding sites per capsid, purified virus and pur ified mAb were complexed at different ratios. As an example, one capsid to 240mAbs is a ratio of 1:4 (VP:mAb). Ratios of 1:1 and 1:0.5 VP:mAb were also examined. (To note, a mAb was considered to have one binding site although the presence of bivalent bind ing was not ruled out.) These capsid:mAb mixtures were incubated at 22C for ~30 minutes. Media was removed from the cells and the mixture was applied to the wells. The mixture was left on cells for 1 hour and incubated at 37C with 5% CO2. The mixtures we re then removed and complete DMEM was added. At ~48 hours post infection green cells were visualized by UV excitation on an Olympus scope. These experiments were done in triplicate for each VP:mAb ratio.

PAGE 62

62 Dot Blot Analysis to check Cross-Reactivity among VL Ps To examine the reactivity of the mAb s against different AAV serotypes, dot blots of previously purified VLPs were performed. PVDF membrane (Millipore ) was activated in 100% methanol for 30 seconds and then soaked in PBS for ~15 minutes. Approximately 100300ngs of each AAV serotype was applied to the prepared membrane through a vacuum -man ifold dot blot system PVDF membrane containing samples were then blocked in 10% n on-fat milk (Bio -Rad ) in PBS for ~1 hou r at 22C. Membranes were then incubated with primary antibody for 1 h ou r and then secondary antibody conjugated to horse radish peroxidas e (HRP) for another hour. The bound antibody HRP was detected with Supersignal luminescent substrate and exposed to X -ray film. Generation of Fragment Antibodies fr om Monoclonal Antibodies Intact IgGs were purified using 1 ml Hi TrapTM Protein G H P columns (GE Healthcare). Briefl y, hybridoma sera were and were equilibrated with 20mM sodium p hosphate pH7.0. The clarified supernatant was then diluted and applied to the Protein G column at 1ml/min as specified in the manufactures protocol (GE Heal thcare) Whole IgGs were eluted from the column with Glycine pH 2.5 into prepared 8.0. The IgGs were then concentrated and buffer exchanged into 20mM sodium p hoshate pH7.0, 10mM EDTA for papin cleavage. Samples were then incubated with activated immo bilized papain (Pierce ) at a suggested enzyme : substrate ratio of 1:160 w/ w at 37C for ~12 ho urs. The Fc fragment was then captured on a Hi Trap Protein A column (GE Healthcare) and the fragment antibody -binding portions (Fabs) were collected in the flow -through, which was then subjected to gel filtration on a Superdex 75 column (GE Healthcare) in PBS. Samples were checked through -out the

PAGE 63

63 purification and production process to ensure purity and further c haracterize products (Figure 2 3 ). Preparation of Fab :VLP C omplexes Purified capsids were mixed together with Fab s at a ratio of approximately 2 Fab s per potential binding site on the capsid, giving a final complexed ratio of ~1:120 ca psid: Fab Complexes were left at 4C for 1 hour and checked by negative stain electron microscopy for the presence of decorated particles before cryoEM data collection. CryoEM Data Collection Sample aliquots of 3.5 l were vitrified with a manual plunge freezing device either on grids with Quantifoil films or on grids with continuous carbon films. The samples were examined at 193 C on a FEI Tecnai G2 Polara electron microscope at an accelerating voltage of 200 keV and at a nomin al magnification of 59,000 X (in collaboration with Timothy Baker, UCSD) Images were recorded with a Gatan Ultrascan 4000 CCD camera at a step size of 1.883 / pixel The CCD images were saved in the Gatan DM3 format and later converted to the tiff format. All images were recorded with an objective lens underfocus value of 1.25 to 3.0 m. The total electron dose on each image was ~24 to 28 e/ 2. Three -Dimensional Reconstruction of AAV: Fab Complexes The software package RobEM ( h ttp://cryoEM.ucsd.edu/programs.shtm ) was used to extract individual particle images from collected micrographs or film Preprocessing of the selected images occurred as previously described, as well as estimation of the defocus levels of each micrograph w as as previously described (Baker et al ., 1999). A random -model computation procedure (Yan Dryden, et al 2007) was used to generate a starting model at ~30 resolution from 150 particle images. This map was then used to initiate full orientation and ori gin determinations and refinement of the entire set of images using the c urrent version of

PAGE 64

64 AUTO3DEM (Yan, Sinkovits, et al, 2007). Corrections to compensate for the effects of phase reversals in the contrast transfer functions of the images were performed as previously described (Bowman et al ., 2002; Zhang et al 2003), but amplitude corrections were not applied. Final 3D maps, reconstructed from the selected particle images were estimated to be reliable to ~10.8 22.8 resolution (Table 4 2), using the 0.5 threshold of the Fourier Shell Correlation (FSC0.5) criterion (data not shown). The handedness of the maps was determined by comparison of the surface features with those of AAV structures determined by X ray crystallogra phy Graphical representations of the constructed maps were generated with the RobEM and Chimera (http://www.cgl.ucsf.edu/CHIMERA ; Peterson et al., 2004) visualization software packages. Fitting of Atomic and Pseudo Atomic Models into CryoEM Density Maps The atomic coordinates for the capsid structures of AAV2 (PDB a ccession number 1LP3; Xie et al., 2002) and AAV8 (Nam et al. 2007), AAV1 and 5 (unpublished data), and a model built for AAV6 based upon AAV1, were used for capsid docking and sca ling of the cryoEM reconstruction density maps When necessary, t he capsid coordinates were rigid body docked into the cryo -reconstructed AAV-complexed map s using the COLORES subroutine in the SITUS program, version 2.3 (Chacon and Wriggers 2002). A visua l inspection of the docked model in the program COOT (Emsley and Cowtan 2004) identified either several small surface loop regions extending above the density envelope or into the capsid interior density depending on the specific map possibly indicating an incorrect initial map scaling factor. The absolute scales for the maps were thus determined by creating electron density maps of the cryoreconstructed AAV: Fab structure s at various /pixel values and comparing these maps to an electron density map gene rated for structure factors calculated for the docked homology model at cell -dimensions and grid sizes matching each of the scaled maps. The various cryo reconstructed and model maps were then normalized in the program MAPMAN (Kleywegt 1996) and compared using the

PAGE 65

65 programs similarity function ( http://xray.bmc.uu.se/usf/mapman_man.html ). The highest correlation coefficient was observed between the maps generated at 1.80 and 1.883/pixel (the original scale) depending on the respective structure ( Table 4 3 ) and was considered the absolute map scale. Difference maps between the cryoEM reconstructed maps and the atomic data (or AAV6 3D model) maps (as used above in scaling) were then generated in MAPM AN using the operation function (OP). The excess density that was displayed in the difference maps were identified as the bound Fab Atomic coordinates for an unrelated (generic) Fab (PDB 2FBJ; Suh et al., 1986) structure was manually docked into the Fab d ens ity, as web antibody models (WAM ) models of the respective Fab s were only generated f or the Fv arm of the antibody. Once the unrelated Fab was docked into the respective density, indicated by the least amount of amino acids seen jutting from the density a 60 -mer of the capsid and Fab model was generated in order to mimic the fully bound structure of the AAV: Fab complex. E lectron density map s generated from structure factors calculated for the se fully bound model s (at cell dimensions and grid sizes match ing each of the scaled maps ) were then compared to their respective complex density map using the similarity function in MAPMAN. Models with the highest correlation ( Table 4 3 ), or similarity index were then chosen as the properly docked representative Fa b model. WAM models generated from the sequenced Fab s were then superimposed onto the docked unrelated Fab (2FBJ) in COOT (SSM Superpose; Krissinel and Henrick, 2004) in order to visualize the variable loops on the AAV capsid surface that appear to interac t with the canonical and non canonical loop regions on the Fab models. Visualization and analysis of these models in context of their respective maps were completed in Chimera (Petteresen et al., 2004) Mutagenesis of Proposed Antigenic Regions Since a ma jority of the structures solved in the cryoEM studies were of AAV1, muta genesis studies were focused on this serotype. Specific r egions of t he capsid surface that

PAGE 66

66 appeared to be important in capsid recognition were identified by the p revious docking proced ures (Table 4 4 ) and primers were designed to generate antigenic escape mutants in these regions by muatatons of the AAV1 cap gene. The recombinant AAV1 plasmid (pAAV1cap ~8kb ) was a gift from Dr. Jay Chiorini (NIH, Bethesda, MD) and contained the AAV1 ca p gene and the AAV2 rep gene. Forward (Fwd) and re verse (Rvs) primers were designed to m utate mu ltiple regions in the AAV1 cap gene to structurally equivalent regions in AAV2 ( Table 4 4 ). The mutations from AAV1 to AAV2 were based on the observation that A AV2 was not recognized by anti -AAV1 antibodies (See Figure 3 1A and C ). The method involved mutating 1 2 amino acids at a time so several primers were designed for subsequent rounds of mutagenesis. For example, mutant 1AB (Mut1AB) was created by mutating A QNK (residues (aa) 456459) of the AAV1 cap gene to TTQS (of AAV2) using Fwd 1a : 5 GTCCGGAAGT A CCCAA CAG AAGGACTTGCTGTTTAGCCGTGG 3 Rev 1a : 5 CCACGGCTAAACAGCAAGTCCTTCTGTTGGGTACTTCCGGAC 3 and Fwd1b: 5 GTCCGGAAGTACCACACAGAGCGACTTGCTGTTTAGCCGTGG 3 Rev1b: 5 CCACGGCTAAACATGAAGTCAGTCTGTTGGGTACTTCCGGAC 3 where 1a mutated AQNK TQQK and 1b mutated TQQK TTQS. This method was repeated for all other mutants. Mut2AB was mutated from TK (aa 492493) to SA using, Fwd2a: 5 GCAGCGCGTTTCTAAAACAAGCACAGACAACAACAACAGC 3 Rev2a : 5 GCTGTTGTTGTTGTCTGTGCTTGTTTTAGAAACGCGCTGC 3 and Fwd2b: 5 GCAGCGCGTTTCTAAAACAAGCGCAGACAACAACAACAGC 3 and Rev2b: 5 GCTGTTGTTGTTGTCTGCGCTTGTTTTAGAAACGCGCTGC 3 Finally, Mut3AB was mutated from SSST (aa58 6 591 ) to RGNR using, Fwd3a : 5 GCAGTC AATTTCCAGAGAGCAACACAGACCCTGCGACCGG 3 Rev3b: 5

PAGE 67

67 CCGGTCGCAGGGTCTGTGTTGCTTCTCTGGAAATTGACTGC 3 and Fwd3b: 5 GCAGTCAATTTCCAGAGAGGCAACCGAGACCCTGCGACCGG 3 and Rev3b: 5 CCGGTCGCAGGGTCTCGGTTGCCTCTCTGGAAATTGACTGC 3 These mutants were then used in combination w ith the designed primers to generate AAV1 c apsid with multiple AAV2 region suvstitutions For example, Mut1AB served as the template to generate Mut1AB2AB, which served as the template to create a mutant with all three regions mutated, Mut1AB2AB3AB. Mutati ons were made with the QuickChange LightningTM kit (Stratagene ) following recommended parameters and primer and r eagent volumes. Final products were run out on a 0.8% agarose gel with ethidium bromide to check for purity and sent to the UF ICBR core for Sanger sequencing. Production and Purification of Antigenic Mutants Plasmids with positive mutations as well as plasmids containing Ad helper functions (pXX6 ~18kb ; Xiao et al., 1998) and green fluorescing protein (GFP) gene (UF11 ~7.5kb ; Klein et al., 1998), were amplified by inoculating 1L cultures of TB with glycerol stocks. Cultures were shaken at ~225 rev min1 with incubation at 37C for ~24 hours and were harvested by low -speed centrifugation (15 minutes, 5000 rev min1, 4C). 1L Cell pellets wer e resuspended in 20 mls buffer ( 25mM Tris pH8.0, 10mM EDTA, 15% sucrose (w/v), 0.1mg/ml RNAse) and incubated with 50mgs lysozyme for 5 10 minutes on ice Cells were lysed with the addition of 48 mls lysis buffer (1% SDS, 0.2 N NaOH) and gentle shaking. T he solution was neutralized with the addition of 36 ml s 3 M sodium acetat e (C2H3NaO2) pH5.2, and gently inverted several times. Chloroform (0.2 mls) was added and the solution was mixed by gentle inversion. The lysed cells were then spun at 9000 rev min1 for 20 minutes and the supernatant was poured into a new centrifuge bottle through a layer of gauze to remove any debris. The plasmid DNA was then precipitated by the addition of an equal volume of isopropanol and left

PAGE 68

68 overnight at 4C. The DNA was then pel leted at 9000 rev min1 for 10 minutes at 4C and resuspended in 20 mls double distilled filtered water (ddH2O). After allowing the DNA to dissolve, 20 mls 5.5 M lithium chloride (LiCl) was added to precipitate any proteinaceous material. The solution was incubated for 30 minutes on ice and then spun at 9000 rev min1 for 10 minutes at 4C. To avoid disrupting the protein pellet, the supernatant was carefully decanted into two 50 ml conical tubes and equal volumes of isopropanol were added to re -precipitate the plasmid DNA. This was spun at 9000 rev min1 for 10 minutes at 4C and the supernatant was discarded and the pellet was air -dried for several minutes. The pellet was allowed to gently dissolve in 7 mls ddH2O and cesium chloride (CsCl) was added at 1 g /ml. The CsCl was allowed to completely dissolve on ice and then 125uls of 10mg/ml ethidium bromide (EtBr) was added. This solution was then split into two 4.9 ml Optiseal tubes (Beck ma n ) and sealed. The EtBr gradient was transferred to an NVT90 rotor and a llowd to run at 78000 rev min1 for 4 hours at 15C, or 55000 rev min1 overnight (15C ). Bands were collected with an 18 gauge needle and transferred to a 15 ml centrifuge tube. EtBr was removed through several isoamyl alcohol extractions and the DNA was re precipitated by the addition of 2.5 volumes ddH2O and two times the combined volume of 95% ethanol. The DNA was then pelleted at 9000 rev min1 for 15 minutes at 4C. The supernatant was discarded and the DNA pellet was allowed to air -dry, and then all owed to resuspended in 500 uls ddH2O. The sample was subjected to two rounds of phenol/chloroform/iso amyl extractions and one chloroform/iso amyl extraction before a final round of re -precipitation. Finally, 0.1 volumes of 3 M C2H3NaO2 pH5.2, followed by 2.5 volumes 95% ethanol were added to precipitate the DNA and the mixture was spun at 14000 rev min1 at room temp. The pellet was then washed with 1 ml 75% ethanol and allowed to resuspend in 1 ml ddH2O. P urified D NA concentrations were obtained through optical density

PAGE 69

69 measurements at OD260 and DNA isoforms were verified on agarose gels. The plasmid DNA was also checked for purity and identified by restriction digests. Human endothelial kidney cells (HEK 293) were grown to ~70% confluency in 15cm plates wi th DMEM supplemented with 1% antibiotics and 10% serum (complete DMEM) at 37C and 5% carbon dioxide ( CO2) Cell m edia was aspirated and replaced with 12 mls of fresh complete DMEM and were then triple transfected using polyethyleneimine (pEI) inoculums T ransfection i noculums were made using 45ugs/plate p XX6, 15ugs/plate UF11, 15ugs/plate mutant plasmid, 160uls/plate pEI, and 1000uls /plate of DMEM (no FBS) Transfected cells were incubated for 24 hours and assayed for quality of transfection on a florescence scope by green cell visualization. Virus infected cells were then harvested at ~60 hours post infection by scraping and low -speed centrifugation (1200 rev min1, 15 minutes, 4C) Cell pellets wer e resuspended in 1 ml TD (1x PBS, 5mM MgCl2, 2.5mM KCl ) p er plate supplemented with protease in hibitor cocktail (Roche ) and cells were lysed by three rapid freeze/thaws with the addition of b enzonase (Novagen) at the second thaw, and subjected to a low -speed spin to pellet cell debris (10000 rev min1, 15 minute s, 4C). Clarified cell lysates were then used in dot blot, infectivity, and packaging ass a ys. For further purification, clarified cell lysates were loaded onto an iodixanol gradient and fractions were collected (as previously explained). Ionexchange chro matography was used to further purify capsids and remove iodixanol as pre viously described in Zolotukhin et al., 2002. Briefly, a 1 ml HiTrap Q -column (GE Healthcare) was equilibrated with 5 mls buffer A (20mM Tris pH8.5, 15mM NaCl) followe d by 5 mls buffe r B (20mM Tris pH8.05, 500mM NaCl) and an other round of 5 mls buffer A on a Gilson peristaltic pump at 1 ml/minute. The iodixanol fractions were then diluted 1:1 with buffer A and loaded onto the equilibrated c olumn at 1

PAGE 70

70 ml/minute and washed with 50 mls of buffer A. Bound virus was eluted with a gradient reaching 100% buffer B over a 5 minute time span at 1 ml/minute on a Pharmacia ATKA FPLC system. One ml fractions were collected and assayed for protein concentrations by OD280 optical density readings. Wes tern Blot Analysis Fractions were assayed fo r VPs by western bolt analysis F ractions were denatured by 10% SDS -PAGE and transferred to PVDF membranes (Millipore) overnight at 27V. The membrane was then blocked in 10% non-fat milk (BioRad) for 1 hour and p robed with B1 (Wistuba et al., 1997) a mouse monoclonal that recognizes denatured AAV capsids (except AAV serotype 4). The blot was then treated with secondary antibody conjugated to horse radish peroxidase (HRP) for another hour. The bound antibodyHRP was detected with Supersignal luminescent substrate and exposed to X -ray film. AAV1 Enzyme -Linked Immunosorbent Assay (ELISA) Mutant AAV1 capsids were tittered using a n AAV1 titration ELISA kit ( PRO GEN) Briefly, standards were prepared by diluting the pr ovided kit standard from 1:2 to 1:64 and cell lysates were initially diluted from 1:250 to 1:100000. Prepared dilutions and a blank were added to a microtiter strip and incubated at 37C for 1 hour. The strips were washed in 1x wash buffer provided by the kit and anti -AAV1 biotin conjugate was added to the wells for 1 hour at 37C. After washing, a streptavidin peroxidase conjugate was then added and the strips were incubated again at 37C for 1 hour. Strips were washed and then reacted with tetramethylbenz idine (TMB) or substrate for 10 minutes. A blue color indicated bound capsid and the color reaction was stopped with Stop Buffer, provided by the kit. The plate was then read on an ELx800 pla te reader (BioTek ) at a wavelength of 450nm.

PAGE 71

71 Dot Blot Analysis for Antigenic Reactivity Recombinant AAV1 mutant capsids (rAAV1muts) were generated, expressed, and purified as described above and further characterized for antibody recognition and cross reactivit y against mAbs originally generated against the rAAV1 pare ntal virus Native dot blots using cell lysates of the rAAV1muts were performed as described above Pixel Intensity Calculations from Native Dot Blots Native dot blots were scanned at about 600 pixels per inch (or higher) and analyzed using the freeware, imageJ ( http://rsbweb.nih.gov/ij ). Briefly, the stacked RGB image was divided into the different gamma channels; red, green, and blue, and stacks containing the most information were combined. Background and noise was removed from the images using a rolling ball function at a threshold just below the actual data points so as not to smooth the actual data. Finally, data points were chosen and analyzed using the plot lanes function. Pixels intensities were given as integrated optical densities. Negative cell lysates values were subtracted from the raw data and the final values were plotted in Excel against the respective mutant. Percent (%) calculations were performed by setting the rAAV1 pixel intensities for each m AB to 100% and subsequent data was calculated from this normalized value. Infectivity Assays Infectivity of the rAAV1muts was checked by green cell assays in HEK293 cells as previously described (Wu et al., 2000) Briefly, HEK293 cells were plated at a 1:4 dilution in 96 w ell d ishes and were allowed to attach for ~24 hours. In a separate 96 -well dish 20uls of cell lysates were added to the first column and serial dilutions were made from 101 to 108 in DMEM (no FBS) spiked with Ad 5 virus at a MOI of 10. T o the cells, 100 uls of the dilutions were added to corresponding rows and plates were incubated for 1 hour at 37C with 5% CO2. The dilutions were removed and wells were refilled with 100 uls complete DMEM. Cells were allowed to

PAGE 72

72 grow for 48 60 hours and i nfectivity was checked by counting green cells (GFP production) under a fluorescent microscope. The total number of green cells counted was multiplied by the original dilution factor and the plate dilution to get a f inal infectious particle count Negative controls included wells with Ad 5 virus only and no virus or cell lysate DNA Extraction and Real -Time Polymerase Chain Reaction Packaging efficiency was checked by determining the amount of vector genomes (vgs) in the cell lysate virus. Briefly, 2 uls of benzonase and benzonase buffer were added to 10 uls of cell lystate and incubated at 37C for ~2 hours To the sample, 2 uls p roteinase K and 22 uls p roteinase K buffer was added for a final volume of 224 uls. This reaction was allowed to incubate for 1 hour at 37C. Samples were then subjected to two rounds of phenol/chloroform/iso amyl extractions and one round of plain chloroform extraction. After the final extraction, 22.4 uls of 3 M C2H3NaO2 pH5.2, 2 uls glycogen (Novagen), and 670 uls of 100% ethano l were added to precipitate the DNA. Samples were left overnight at 20C and then spun at 14000 rev min1 for 20 minutes. The pellet was then washed in 75% ethanol and spun again at 14000 rev min1 for 5 minutes The DNA pellet was allowed to air -dry and was then resuspended in 20 uls ddH2O. Concentrations were checked by OD260 readings and were then diluted to be between 10 and 1 ng/ul for real -time polymerase chain reaction (qPCR) analysis. A master mix containing iQ SYBR Green Supermix (Bio Rad ) and fo r ward and reverse primers for each sample, was made and then delivered to 9 6 -well PCR plates ( BioRad) To this mix, extracted DNA sample s or standard s (rangin g from 10 ngs to 0.0001 ngs) were added to respective wells for a final reaction v olume of 25 uls and qPCR capture was performed. PCR parameters were set as suggested in the iQ SYBR Green Supermix handbook and analysis of the data was performed on the My iQ 2.0 software (Bio-Rad ).

PAGE 73

73 Figure 2 1. Coomassiee stained SDS PAGE and EM images of purified AAV VLPs for structural studies. Images for AAV serotypes illustrate stained bands for VP1, 2, and 3 at ~92, 78, and 67kDa, repectively and a corresponding EM image for each VLP depicting white, negatively stained intact VLPs against a black carbon background Figur e 2 2. I mages of the Fab WAM models Complimentary determining regio ns are colored differently an the heavy and light chai n portions are indicated in gray. Heavy and light chain hyper -variable regions are indicated as H1 3 and L1 3, respectively. Models w ere generated for A) AA5H7.D11 B) AA4E4.G7 C) BB3C5.F4 Figure 2 3 Production, purification, and characterization of mAb and Fabs. A) Superdex75 column data showing the milli absorbance units (mAU) at OD 280 on the y-axis and peak fractions (ve rtical red dotted lines) and column volume on the xaxis. The Fab peak at fraction 11 12 corresponds to a molecular weight calculation of ~41.7kDa. B) An SDS -PAGE analysis of the Superdex75 fraction 11 and the whole IgG before papain digestion indicating the loss of the Fc portion. Both images indicate by size and purity that Fabs have been obtained for the example IgG.

PAGE 74

74 CHAPTER 3 CHARACTERIZATION OF ANTIBODIES AGAINST AAV1 AND AAV5 CAPSIDS CROSS REACTIVITY AND NEUTR ALIZATION CAPABILITIES I ntroduction Ant ibodies are unique structures that have been found in various tissues of the body and are responsible for recognition and neutralization of foreign objects. There are five main classes, some of which have several subtypes. These classes represent the effec tor function and heavy chain structure of each isotype, which are: Immunoglobulin G (IgG), IgM, IgD, IgE, and IgA. The IgG and IgM molecules are the first of the secreted Igs to be present in early infection, while the IgD molecule functions at the B -cell surface as a recep tor. The IgE molecules are generally associated with allergies and parasites whereas the IgA has roles in preventing colonization at the mucosal surface. Of these isotypes, IgG is the most abundant isotype in plasma and represents the ty pical antibody structure. This structure is comp osed of four polypeptide chains; two heavy chain molecules (H c ) and two light chain molecules (L c ) (Figure 3 1A) These chains are broken down further into constant (C) and variable (V) regions T he variable regions VH and VL make up the Fab and contain the complimentary determining region (CDR) ( Figure 3 1 A ). This region is important for interaction with antigens and contains the paratope specific for antigen recognition. Both the heavy and light chains have three CDR s, generally referred to as h ypervariable regions 1 3 (Figure 2 2 ). Structures among the different isotypes are generally similar for IgG, IgD, and IgE, where differences occur mainly in the hinge regions and glycosylation. The IgM molecule exists as a pentameric structure (Figure 3 -1C ) with five IgE like molecules attached by a small peptide referred to as the J -chain. The IgA is also held together by the J -chain, but exists in a dimeric form (Figure 3 1B ). These structures can be abundantly produ ced by activated B -cells, which has le d to the creation of hybridomas. In this methodology, hybridomas were made by fusing B -cells with myeloma cells (a B cell cancer cell

PAGE 75

75 line) (Alkan 2004). Hybridomas specific for a certain antigen could then be separat ed and propagated t o generate mAbs This technology won Cesar Milstein Georges J. F. Khler and Niels Kaj Jerne the Nobel Peace Prize in Physiology or Medicine in 1984 (Alkan 2004). Since a virus can be neutralized in several different ways that are dete rmined primarily by the specificity of the reacting antibody, analysis of specific antibody-virus interactions is only possible using these mAbs (Reading and Dimmock 2007). Thus m Abs are used in various clinical and research approaches including diagnosi s of disease and production of vaccines (Nabel 2004). The antibody response is a key immu nity that develops against pathogens and foreign objects alike, making viral vectors no different than their wild type parents. Many people have already been infected with some parvoviruses (Schneider et al., 2008; Lindner and Modrow, 2008; Candotti et al., 2004) and AAV serotypes ( Gao et al., 2004; Calcedo et al., 2009) and have developed antibodies which can interfere with the application of AAV vectors (Manno et al ., 2006). In addition, it is likely that therapeutic application of AAV vectors will induce immune responses, which may interfere with re administration The primate and human AAV serotypes are mostly antigenically distinct when tested with polyclona l anti bodies although much of the sequences are similar, especially in structurally conserved domains (Gao et al., 2004; Agbandje Mckenna and Chapman, 2006 ). However, d espite the important role of antibodies in the recognition of AAV, the mechanisms of binding and neutralization or other ef fects are not well understood. I nformation regarding antigenicity has been obta ined for AAV 2, as well as the auto nomous virus es; CPV human B19 parvovirus (B19), and MVM (Wobus et al., 2000; Hafenstein et al., 2009; Tolfvensta m et al., 2000). The s e studies suggest that although most antibodies appear to bind on or near the protrusions at or surrounding the icosahedral three -fold axes, there is a complex interaction between the capsid surface and the host antibody response,

PAGE 76

76 and that the sites involved in antibody binding may be at least partially constrained by the capsid surface. Studies of AAV2 examining a small number of mAb s or polyclonal anti capsid antibodies, show that the an tibody response is affected by changes in only a small number of sites on the capsids, and that reactivity can be reduced by mutations of residues within those sites (Lochrie et al., 2006; Huttner et al., 2003; Wu et al., 2000b ). For AAV2 some epitopes have been described by mutational analysis and pep tide mapping. The se show neutralization of infectivity at either attachment or po st attachment step s ( Wobus et al. 2000) Here, a number of mAb s (both IgGs and IgMs) directed against the capsids of AAV1 and AAV5 have been generated. By comparing the ir re activities with the parental capsids and other AAV serotypes we seek to define the general mechanisms of anti body attachment the processes of neutralization, and to compare the structures that all ow these different serotypes to be successful in nature. Th is study also aims to characteri ze the antigenic nature, mainly the B -cell response, of the AAV serotypes and provide optimized tools for serotype recognition. R esults Production of Anti AAV Monoclonal Antibodies and Isotyping A panel of mAb s against AAV1 and AAV5 capsids (Table 3 1 ) were prepared in the Parrish laboratory at Cornell University T wo different immunization strategies were utilized The first involved immunization 2 3 months prior to the f usion of spleen cells, giving 4 IgG and 4 IgM -secreting hybridomas against AAV1. Seeking to derive cross reactive antibodies between AAV1 and AAV5 capsids mice were immunized with AAV1 capsids, then given an intravenous immunization with AAV5 capsids 4 days prior to the fusion. This protocol resulted in t he isolation of several hybridomas producing 9 IgMs and 1 IgG against AAV5 Three antibodies were chosen from each panel to continue on with the struct ur al studies: 4 IgGs and 2 IgMs The anti -AAV1 monoclonals were AA4E4.G7, AA5H7.D11, both IgG2a subtypes, and the IgG1

PAGE 77

77 subtype, AA9A8.B12 ( Table 3 1 ). For the anti -AAV5 final panel; the two IgMs were BB9F7.F12 and BB8F1.E8, with the last being BB3C5.F4, an IgG3 ( Table 3 1 ). Cross-Reactivity among D ifferent AA V S erotypes Cross reactivity among the available s erotypes was tested by dot blot analysis using the anti -AAV panel antibodies previously chosen. At low dilutions of ~1:4 c ross reactivity was observed with the anti -AAV5 mAbs against AAV1 (Figure 3 2 A) however, a t higher dilutions of hybridoma sera this phenomenon was completely abolished ( Figure 3 2 B). The slight recogn ition of AAV1 by A20 (Figure 3 2 A) has been previously reported at high concentrations of the A20 monoclonal (Kuck et al., 2007). All a ntibodies show ed specific reactions with their homolo gous antigen, but no cross reaction with the other capsids among AAV1, 2, 4, and 59 other than those previously mentioned ( Figure 3 2 C) All of the antibodies tested recognize conformational epitopes on assembled capsids rather than linear epitopes in denatured capsid proteins (Figure 1 1 ), as is seen for antibodies agai nst other parvovirus ca psids (Wobus et a l., 2000; Kuck et al., 2007, Hafenstein et al., 2009; Wistuba et al., 1997; Parrish and Carmichael, 1983). Neutralization Ability of the Monoclonal Antibody P anel Each of the antibodies w as tested for its ability to neutralize virus infectivity by determining the concentration of immunoglobulin required to neutra lize AAV1 and AAV5 vectors carrying the GFP -gene. Most of the antibodies tested in this s tudy neutralized AAV, where some of the antibodies were non -neutralizing. In the anti -AAV5 st udy, both IgMs were able to neutralize approximately 50% of cells at hybridoma supernatant dilutions of 1:200 and 1:400, BB9F7.F 12 and BB8F1.E8, respectively (Figu re 3 3 ). The only IgG in the anti -AAV5 panel, BB3C5.F4, was non-neutralizing, with the undiluted stock leading to only a 20% reduction in gene expression (Figure 3 3). This observation may have been due to an aggregation

PAGE 78

78 of viral particles due to excess of antibody and interstingly, the ability of non neutralizing antibodies to reduce gene transfer has been noted (Li and Ertl, 2009). This occurrence may be due to the aggregation of viral particles and further characterization of these events may eventually allow for useful generalizations in the future. Similar results were observed for the anti -AAV1 panel. Both IgG2a antibodies, AA5H7.D11 and AA4E4.G7, neutralized cells at approximately 50% at dilutions of ~1:1800 and ~1:1200, respectively (Figure 3 3 ), w hi le the IgG1, AA9A8.B12, was not able to neutralize AAV1 GFP vector ( Figure 3 -4 ). Studies were also completed using available AAV1 -like vectors X1, X25, and AAV6 (Figure 3 5 ). Neutralization of 50% was achieved for AAV6 with AA4E4.G7 at ~1:2000 (Figure 3 5 A) and ~1:3200 for AA5H7.D11 (Figure 3 4C), while AA9A8.B12 was not neutralizing (Figure 3 5 B). The X25 vector was neutralized at ~50% at dilutions of ~1:3200 for both AA4E4.G7 and AA5H7.D11 (Figures 3 5A and 3 5 C) AA9A8.B12 was also non -neutralizing for X25 (Figure 3 5 B). Interestingly, the X1 capsid was not neutralized with AA5H7.D11, whereas this antibody neutralized the X25, AAV1, and AAV6 vectors (Figures 3 4 and 3 5 C). It showed similar profiles as seen before with AA4E4.G7, neutralizing 50% of vecto r at a dilution of 1:1200, while AA9A8.B12 was again non -neutralizing (Figures 3 5A and 3 5 B) D iscussion The antigenic nature of viral capsids recognized by antibodies is crucial to the development o f protective immune responses. The AAVs provide an impo rtant model system to examine the antigenic structure of theses simple capsids as there are several different genetically distinct viru ses which have appeared to be antigenically distinct when ana lyzed in limited serological studies Antibodies are an imp ortant protective immunity against viral infection, including the AAVs. Immunoglobulins can develop shortly after initial infection, and can continue to provide protection through the duration of infection and by generation of a memory

PAGE 79

79 response (Drner and Radbruch, 2007). These responses are also effective against infection by antigenically related viruses. The use of monoclonals in viral neutralization assays is beneficial due to the existence of several epitopes on the capsid surface, which can lead to various mechanisms of neutralization through different antibodi es (Reading and Dimmock, 2007). Here we developed a variety of new IgG and IgM mAbs against the capsids of two AAV serotypes to examine the antigenic structures of the viruses, the cross -reactiv ity with the representative AAV clade members, and also the effects of IgG and IgM antibodies. The AAV capsid was a potent antigen; generatin g a panel of mAbs against AAV5 four days post immunization (Dr. Parrish, Cornell University). This is consistent wi th the fact that multivalent viral capsids and particles appear to be potent B -cell antigens and to give some immediate T independent responses (Reading and Dimmock, 2007; Janeway et al., 2005). For AAV5, although the mice had been previously immunized wit h AAV1, most of the antibodies produced were IgMs directed against AAV5, with only 1 IgG. The IgM response is one of the first responses to be seen in early infection due to circulating low affinity molecules (Janeway et al., 2005). It is possible that T h elper cell epitopes shared between the AAV1 used to pre immunize and the AAV5 capsids given in the boost enhanced the responses to the second virus. Characterization of antibod ies produced after vector delivery has become increasingly more important. In t he data presented here Balb/c mice were used to generate a diverse response of antibodies to AAV 1 and 5 capsid s Most animal studies have found patterns in antibody generation depending upon the animal strain and r oute of administration. Both IgG2a and IgG 3 responses were se en in intramuscularly (i.m. ) injected Balb/c mice, while C57B1/ 6 mice exhibited IgG2a (Chirmule et al., 1999). The s ubcutane ous (s.q.) injections used by the Parrish group produced IgG2a/b and IgG1 responses against AAV1, but AAV5 immuni zations produced

PAGE 80

80 an IgG3 with the majority of the response being IgMs (Table 3 1 ). Intravenous (i.v.) administration in C57B1/6 mice als o produced IgG2a and IgG2b response s (Zhang et al., 2005). This issue becomes important due to the different responses s een agains t both vector and transgene (Lu and Song, 2009; Lu et al., 2006; Vandenberghe et al., 2006; Lin and Ertl, 2009; Hernandez et al., 1999). Few studies have fully characterized the antibody response in humans, although it has been repeatedly reporte d that the human population has titerable antibodies to the better characterized AAV serotypes 1 9 (Erles et al., 1999, Chirmule et al., 1999; Moskalenko et al., 2000; Calcedo et al., 2009; Xiao et al., 1999; Mingozzi and High, 2007). One study sought to e xamine IgG subsets in serum samples of normal human subjects exposed to wildty pe AAV, injected i.m. with AAV ve ctors, or s ubjects injected i.v. with AAV vectors (Murphy et al., 2009). Although the ultimate findings were that a complex, nonuniform pattern of responses existed, it was interesting to note that IgG1 and IgG3 responses appeared more prominent in those exposed to AAV vector, while IgG2 and IgG4 appeared more robust in normal donors (Murphy et al., 2009). Thus, the inclusion of different isotype s into antigenic studies, such as this study, will further characterize the antigenic nature of the AAV vector and may help to isolate immunogenic differences among vector delivery routes, concentrations, and target tissues. Another such s tudy identified t hat IgG1 responses were the highest among the naturally infected population and suggests that this may be indicative of a cured subject or a chronic carrier of this virus (Sylvie et al., 2010). Most importantly, it appears that the antibody response is sub jective to many factors, including immunocompetence of the patient and their pre -existing immunity. Further characterization of these responses may one day enable us to predict the immune outcome based on the patient, the disease, and the vector type and a dministration.

PAGE 81

81 The new monoclonal antibodies described here react with the AAV1 and AAV5 capsids, providing a variety of useful reagents for the stu dy of AAVs in particular. Crossreactivity was checked by dot blot to determine if conserved regions on the AAV capsid serotypes were recognized among the different antibodies. Of note, the anti -AAV1 antibodies recognized the AAV6 capsid structure. This serotype was not used in the immunizations, but is 99% identical to AAV1 (Xiao et al., 19 99; Schmidt et al, 20 06). This crossrecognition implies that the differences between AAV1 and 6 are probably not involved in the antibody epitope but different affinities may be seen due to these differences However, it is interesting to find that in a recent seroprevalence study AAV6 IgG levels in human subjects was lower (46%) than those found for AAV1, suggesting that the differences at the capsid surface level play an important role in immunogenicity among humans (Sylvie et al., 2010). Although no cross reactivity was se en among other serotypes not used in the mouse immunizations, a weak cross reactivity of the anti AAV5 antibodies with the AAV1 capsid was observed. This is likely a result of pre immunization with AAV1 before the AAV5 boost. However, the recognition was very weak, as serial dilutions in hybridoma supernatant drastically lowered the recognition seen (Figure 3 2B). Similarily, in an unrelated study looking at pre -existing immune response models, mice immunized with Ad -AAV8cap vectors and then subsequently challenged with AAV2 transgene vectors produced low levels of non-neutralizing antibod ies that bound AAV2 capsids (Li and Ertl, 2009). Also of interest, these low levels of non-neutralizing antibodies against AAV8 found to be of IgG2a isotype were able to di srupt gene transfer in AAV2 studies (Li and Ertl, 2009). Preliminary neutralization studies on the anti -AAV1 and AAV5 mAbs (conducted by Dr. J. Chiorini, NIH) identified neutralizing ability for most of the mAbs generated. Am ong the anti -

PAGE 82

82 AAV5 mAb s, both of the IgMs selected for further study were neutralizing. Here the expression of GFP was reduced by ~50% at hybridoma supernatant (sup) dilutions of ~1/3001/150 for BB9F7.F12 and ~1/400 for BB8F1.E8 (Fig ure 3 3 ). These data were only repeated once at thi s point in the study and the jump seen for BB9F7.F12 between dilutions of 1/300 and 1/150 may have to do with pipeting errors or the avidity of the IgM itself. Repetitions will be needed to confirm the values for this anti -AAV5 IgM. The only IgG selected f rom the anti -AAV5 mAb s was non -neutralizing. Neutralization assays did not identify a diltion of BB3C5.F4 sup that was able to knock down GFP expression by 50%. In fact, at a 1/25 dilution, green cells were s till su stained at about 80% (Figure 3 3 ). Howeve r, neutralization assays for AAV5:BB3C5.F4 at a sup dilution of 1/25 show almost no change in GFP expression patterns (Figure 3 3) Since particles that escape from this aggregate become infectious once again, the on and off rates, or kinetics of antibody binding may allow for enough viral particles to escape and cause infectious events. Of note, these infections were done in the absence of helper virus and since few cells are infected to begin with, a significant change may not been s een in the materials u sed here. A similar trend was seen in anti -AAV1 neutralization assays. Two of the three mAb s chosen for further study were also neutralizing while one was non -neutralizing. The two IgG2a mAb s, AA4E4.G7 and AA5H7.D11, both neutralized ~50% of AAV1 GFP vecto rs at sup dilutions of ~1/1200 and >1/1600, respectively ( Figure 3 4 ). Both of these mAb s are strongly neutralizing as almost complete knockdown of GFP transduction was seen at dilutions of ~1/100. In comparison to the non -neutralizing anti -AAV5 mAb BB3C5 .F4, gene transfer of the AAV1 capsids was slightly more susceptible to the non -neutralizing anti -AAV1 mAb AA9A8.B12, as ~50% knockdown was seen at sup dilutions of ~1/50 ( Figure s 3 3 and 3 4 ). Again, in -house green cell

PAGE 83

83 assays mimic this observation as g reen cells are reduced by almost half in capsid: mAb ratios of 1:4 (data not shown) Neutralization assays were also done for the AAV1 mAbs against AAV1 like viruses, X1, X25, and AAV6. These vectors differ from AAV1 by only a few amino acids at the capsid surface. AAV6 differs from AAV1 at several sites on the VP1 protein, but only three of these are exposed at the capsid surface and reside in the common C terminus, VP3. These residues are E418D, E531K, and E584L (Table 3 2). The X25 capsid differs from AA V1 at T162S, V198L, which are buried in the capsid on VP2, and Q386K, which is surface exposed (Table 3 2). The X1 capsid differs from AAV1 at N327S, D495G, R514H, and D590H (Table 3 2). All 4 of these residues can be mapped to the capsid surface and fall in or around the three -fold axis (Figure 3 6). These viruses gave results similar to wtAAV1 in that AA9A8.B12 was still non -neutralizing while AA4E4.G7 was still able to neutralize ( Fig ure 3 5 ). However, a change was noted in the ability of AA5H7.D11 to ne utralize against the X1 virus. A reduction of ~50% in green cells was now seen at a sup dilution of ~1/200 ( Figure 3 5 C). The decline in sensitivity to this previously neutralizing virus is most likely due to the differences seen at the aa level Interesti ngly, single mutations on the AAV1 capsid surface to mimic the X1 surface (made in the Chiorini lab, NIH) resulted in no significant changes in neutralizing activit y against the AA4E4.G7 and AA5H7.D11 monoclonals (data not shown) This supports that idea that several amino acids are involved in the epitope and that it may be conformational in nature. This data corresponds to the mapping of the AAV2 mAb epitopes ( Figure 1 1 ), supporting the idea that these symmetrical axes are important in the antigenicity of the AAV capsids and also implies that some of these residues are involved in the epitope itself, or at least plays a role in stabilization

PAGE 84

84 The mAb s presented here will aid in the further characterization of antigenic regions on the AAV capsid surface i n hopes of engineering AAV capsids for efficient immune response evasion, whether it be pre -existing or an initial re s ponse. Conversely, this data will also aid in the manipulation of these sites to generate a desired response, as in vaccine development. T he next step in these studies is to determine the epitopes for these mAb s using a structural approach as detailed in the following chapter T hese data may then define the consequence of manipulation in these capsid regions and better define the antigenic n ature of the capsid surface while adding to the general knowledge of antigenantibody interactions.

PAGE 85

85 Table 3 1. Mouse monoclonal antibodies selected for further studies Monoclonal antibody (mAb) Parental AAV antigen Isotype AA4E4.G7 AAV1 IgG2a AA5H7.D1 1 AAV1 IgG2a AA9A8.B12 AAV1 IgG1 BB3C5.F4 AAV5 IgG3 BB9F7.F12 AAV5 IgM BB8F1.E8 AAV5 IgM Table 3 2. Amino acid differences between AAV1 like viruses and AAV1* 162 198 327 386 418 495 514 531 584 AAV6 T V N Q D D R K L X1 T V S Q E G H E F X25 S L N K E D R E F AAV1 T V N Q E D R E F *Red residues signify different amino acids Figure 3 1. Basic immunoglobulin structure. A) General structure of a monomeric antibody representing the IgG, IgE and IgD classes. The heavy chains (Hc) are colored in dark shades which are connected to the light chains (Lc, lighter shade ) by disulfide bridges. The Hc and Lc portion of the Fab structure is further divided into a variable (V) and constant (C) region, VH and VL, and CH and CL. The variable regi on contains the CDRs housing the hypervariable domains responsible for the antibody paratope. B) The IgA class is represented by a dimer which is held together by a J -chain (small structure colored gray). C) The pentameric structure depicts an IgM molecule. These structures are also held together by a J -chain (gray). Different colored structures represent a separate functional Ig unit.

PAGE 86

86 Figure 3 2 M onoclonal antibody characterizat ion and cross reactivity. A) Native blot using a mAb hybridoma supernatant dilution of 1:4. Recognition of native AAV1 by the anti AAV5 monoclonals is evident at th is dilution. B) Serial dilutions of the anti -AAV5 mAb hybridoma supernatant tested against native AAV1 and 5 capsids. A lack of recognition is already seen at a dilution of 1:25. C) Native dot blot analysis of AAV1, 2, and 4 9 against the anti -AAV1 and -AAV5 monoclonal antibodies. No cross reactivity is seen, except for anti -AAV1 recognition of AAV6 capsids. The B1 antibo dy recognizes denatured capsids at a linear epitope near the two-fold axis and is used here to emphasize lack of native virion binding. The ADK4 monoclonal only recognizes native AAV4 capsids, as the B1 epitope does not exist in this serotype.

PAGE 87

87 Figure 3 3 Preliminary neutralization assay data for the anti -AAV5 monoclonals. The non neutralizing effects of the IgG BB3C5.F4 (blue) can be seen from this assay, as GFP expression has shown only ~20% knockdown at dilutions of even 1:25. Both IgMs, BB8F1.E8 (magenta) and BB9F7.F12 (yellow) appear to be completely abolishing the ability of the vector to deliver GFP cDNA at dilutions of ~1:100 and ~1:50, respectively. Figure 3 4 Preliminary neutralization assay data for the anti -AAV1 monoclonals. The non neut ralizing monoclonal AA9A8.B12 (A8.B12; green) among the AAV1 antibodies appears to have an effect on the vectors ability to transduce cells at dilutions below ~1:100. While the other monoclonal, AA4E4.G7 (E4.G7; red) and AA5H7.D11 (H7.D11; blue), appear t o be able to completely abrogate transduction at dilutions of ~1:100 and ~1:200, respectively.

PAGE 88

88 Figure 3 5 The ability of the anti -AAV1 monoclonals to neutralize the AAV1 like viruses: X1, X25, and AAV6. A) AA4E4.G7 data. The G7 monoclonal antibody appears to retain neutralizing ability, although compared to the AAV1 data, a slight increase in transduction capability is seen for all vectors, especi ally among the X1 virus. B) AA9A8.B12 data. B12 monoclonal appears to retain its overall nonneutralizing e ffect even against the AAV1 like viruses. C) AA5H7.D11 data. Ne utralization data for D11 shows a significant reduction in neutralizing activity against the X1 virus, while X25 and AAV6 are still neutralized at levels similar to AAV1. AAV6 is shown in blue, X1 is red, and X25 is yellow.

PAGE 89

89 Figure 3 6 Differnces between the AAV1 and X1 sequences are mapped to the atomic coordinates of AAV1 and cluster at the three-fold axis of symmetry. A 3D surface representation of the AAV1 capsid is shown in radial colori ng from blue to red, where red represents the furthest distance from the capsid center. A three -fold axis is circled to illustrate the region of interest shown in more detail on the right. Here, three symmetry realted monomers, shown in green, red, and blu e, make up the interactions of the there -fold spike Residue differences netween AAV1 and X1 are highlighted in corresponding colors to depict the highly interactive nature of this region. It is also evident from this image how easily a conformational epit ope could be generated from the capsid surface.

PAGE 90

90 CHAPTER 4 DETERMINATION OF DOM INANT ANTIGENIC SITE S ON THE CAPSID SURF ACE OF ADENO -ASOCIATED VIRUS SEROTYPES 1, 2, 5, 6 AND 8 THROUGH CRYO ELECTRON MICROSCOPY STUDIES I ntroduction The use of structure appr oaches in biology has shed light on the mechanisms of many interactions, especially macromolecular assemblies and their function in general (Johnson and Chiu, 2000). It has also been equally important in virology, as it has given insight into the structura l basis of assembly, nucleic acid packaging, particle dynamics and interactions with cellular molecules (Johnson and Chiu, 2000). Structural characterizations of viruses are crucial to the design of therapeutics and vaccines against them and has allowed f or the elucidation of mechanistic pathways. There are many well developed methods for structural determination approaches available, and the one undertaken for a particular study is often dependent on the resolution and type of information desired. For ins tance, both nuclear magnetic resonance (NMR) and crystallography can give atomic resolution detail on bond interaction and backbone placement, but NMR also provides dynamic (ensemble) information while crystallography provides a snapshot and is often considered static. In cryoEM, macromolecules are frozen in their native state allowing for discrete selection of dynamic states to be visualized, albielt at lower resolution. The largest issue separating cryoEM from crystallography, besides size and the limitations of crystal formation, is resolution. CryoEM has generally been considered a low resolution technique, giving reconstructions around 15 30, but with advances in sample handling, instrumentation, image processing, and model building, near atomic reso lution can now be achieved (Zhou, 2008). In reality, hybrid approaches, combining NMR, X ray crystallography and cryoEM, is often adopted, which provides a power ful means of filling gaps that can arise in structural characterization of macromolecues. For e xample, in studies where

PAGE 91

91 large complexes or macromolecular assemblages cannot be crystallized, subcomponents can be crystallized to obtain high resolution information which can then be used to interprete the complex structure at lower resolution obtained b y cryoEM (R ossmann, 2000). An excellent example of this approach is highlighted in a recent review on the influenza virus where several crystallographic studies involving smaller portions of the viral polymerase were combined with a large cryoEM complex to enable functional interpretation (Ruigrok et al., 2010). Insights into the function of the replication machinery, like those of the viral polymerase, were deemed from t hese studies. This information ha s become increasingly important due to rising concerns of influenza pandemics, much like that reported for the 2009 H1N1 strain, and forms a basis for virtual screening of drug compounds for clinical trials (Ruigrok et al., 2010). A number of reported cryoEM virus complex structures offer insights into rece ptor or antibody interactions, as well as conformational changes associated with replication and virion assembly (Baker, 1999). CryoE M of immune complexes provides a method for visualizing antigen antibody interactions for viral capsids (Smith, 2003). The se structures are often interpreted by docking the known structures of the capsid and FAb or homologous 3D models (from the RCSB protein data bank, ( http://www.rcsb.org/pdb/home/home.do ) into a cryoEM d ensity map of the Fab-decorated capsid (Harris et al., 2006). The resulting pseudoatomic model may then be used to define the FAb binding sites in an attempt to identify the peptide(s) that make up the epitope (Harris et al., 2006). These studies better d efine the often dynamic surface of viruses and also further characterize antibody antigen interactions while offering insight into their mechanisms of neutralization and potential therapeutic targets. Numerous virus structures have been determined to date, big or small, pathogenic or non pathogenic. While these viruses have unique host characters and function, many similarities can

PAGE 92

92 be found among them. Most of the structural studies on virus -Ab complexes began with the influenza virus, which laid the foun dations for thoughts on how viruses avoid immune surveillance (Smith, 2003). However, the first study to visualize an intact virion complexed with a neutralizing antibody was done with rotavirus in 1990 (Prasad et al. 1990). This study had remarkable impa ct on the field at two levels. First, it established that protein ligand interactions could be visualized by cryoEM and second, it correlated structural and functional information for the rotavirus capsid proteins (Smith, 2003). Later on, studies with Cowp ea Mosaic Virus (CPMV) would show that pseudoatomic models could be generated from atomic models fitted in the density maps, which were then used to identify important regions on the capsid surface (Wang et al., 1992; Porta et al., 1994). Studies with th e Human Rhinovirus 14 (HRV14) took it one step further and demonstrated that pseudoatomic models could be generated using all of the structures in the complex and subsequently used to determine binding regions (Smith, 2003). There are several structures o f HRV14 bound to an antibody molecule (Smith, 2003), which all seem to be localized in one region. Studies with HRV2 brought more insight into antibody flexibili ty, with the observation that Fa bs binding to the same site can have distinctly different orien tations and mode of binding, such as bivalency, as well as the identification of a second antigenic site on the rhinovirus capsid (Smith, 2003). Peptide mapping and analysis of escape mutants were approaches originally used to identify dominant neutralizing sites to CPV and FPV capsids (Smith, 2003). CryoEM structures of virus -Ab complexes confirmed these sites (for CPV) and further demonstrated the recognition of a common antigenic epiope by several different mAbs generated against AAV the capsid as was observed for the HRVs (Hafenstein et al., 2009; Wikoff et al., 1994). Many of these studies highlight the fact that the location of these antigenic loops is a critical factor in determining how to engineer vectors and vaccines and the

PAGE 93

93 notion that dominant antigenic regions exist on the capsid surfaces. All of these data further support the techniques used here and the work presented in this chapter. Here cryoEM and image reconstruction of capsid -Fa b complexes was used to define the specif ic structural contac ts between 6 different mAbs (5 neutralizaing and one not) and the capsids of AAV1, AAV2, AAV5, AAV6 and AAV8, to provide a comprehensive view of the antigenic structure of the AAVs. These viruses are representative members of the AAV antigenic clade and c lonal isolate groups (Gao etal., 2004) and are ~55 to 99% identical in VP amino acid sequence, with AAV1 and AAV6 being the most similar and belonging to the same clade group A. Docking of atomic structures and models into the reconstructed density identif ied the AAV surface loops which in teract with the respective Fa b. R esults Analysis of the Fab VLP C r yoEM C omplexes In order to identify the binding sites of antibodies recognizing different AAV serotypes, six different mAb s were chosen for analysis in com plex with their respective capsid VLP ( Table 4 1 ). These studies report seven different complexes with resolutions between ~10.8 22.8 (Table 4 2 ). Two complexes involve d the same Fab AA9A8. D11 in complex with AAV1 and AAV6 serotypes, while the other thre e mAb s do not cross react with other serotype s One complex, AAV5:F4 appeared to be nonneutralizing in preliminary studies while the other mAb s neutralize the virus that they recognize (Figures 3 2 and 3 3 ). For each complex the final map was scale d by c omparison with known atomic virus capsid coordinates which were then docked into the c r yoEM reconstruction with fairly high confidence (ranging from a cc of 0.6 0.75) E xcess Fab density most likely accounted for correlations less than 100% (Table 4 3 ). M odels of the Fab Fv portions were derived from the sequencings o f the heavy and light variable domains of the antibodies which were submi tted to the WAM antibody modeler server (Figure 2 2; s ee

PAGE 94

94 chapter 2 ). These Fab models were then manually fit into the F ab density that extended from the capsid surface. Once the atomic capsid coordinates and the Fab homology models were fit into the cryoEM maps the exposed capsid surface loops that extended into the open Fab density could be analyzed for possible contact areas. The docked Fab models served as guide points to determine which loops were most likely involved in protein-protein contacts. Fab G7 and AAV1 A final map of ~13 resolution was derived from 2,870 particle images The most notable extensions of densit y occurr ed at the capsid three -fold axis of symmetry, and extended across the two -fold region to overlap with the density extension from a symmetry related two -fold region (F igure 4 1A ). This extension of density was recognized as the binding site of the F ab on the viral capsid sur face. The Fab density at this region is not as strong as the capsid density indicating that steric hindrance may prevent two Fab s binding at the same time. Capsid surface loops that play a role in the footprint ar e clustered in VRIV, V and VIII (Figure 4 1D and 4 2 ). These are loops from symmetry related capsid VPs that must be forming a conformational epitope. Residues that contact the fitted Fab in the model of a VP1 monomer include residues 456459 (AAV1 number ing), giving the short peptide A Q NK in VRIV, and residues 585590 highlighting the QSSSTD peptide in VRVIII; while residues in a three -fold related monomer include residues 492498 TKTDNNN in VRV (Table 4 4 ). Fab D11 with AAV1 and AAV6 C apsids Reconstru ctions were generated from 262 particles for AAV1:D11 and 2,527 particles for AAV6:D11, at resolutions of 22.8 and 15.3 respectively (Table 4 2) Docking of the atomic coordinates and Fab models identified the binding region as the large protrusion from the center of the three -fold symmetry axis of both complexes (F igure 4 1 B and 4 1 C). Density closer to the three -fold protrusions was stronger (2.20 than that seen for the region above the capsid

PAGE 95

95 correlating to the constant portions of the D11 Fab. Indeed, f itti ng of a model in both density portions, i.e. capsid and Fab density, revealed that the constant region of the Fab arm was angled ove r the three-fold canyon, just above the center of the two remaining three -fold peaks. This suggests that only one Fab at a time was bound, possibly due to steric hindrance Capsid surface loops in the Fab contact region were identified as VRIV, V, and VIII (Figure 4 1B and 41C, Figure 4 2 ), which create the three -fold protrusion. AAV1 and AAV6 differ by only six amino acid s, with three of them, E418D, E531K, and F584L located on the capsid surface at the threefold axis (Table 3 2 ). As t he Fab bound both v iruses in the same position, those residues are most likely not directly involved directly in the Fab binding, but they may play a role in stability of the protein interactions. Residues mapped to one VP3 monomer include 456459 (AAV1 numbering) with the s equence AQNK in VRIV; and 585590 of QSSSTD in VRVIII (Table 4 4 ). A three -fold related interaction places VRV between the VRIV and VIII fingers of the reference monomer; notably, D495, N496, N497, and N498. The same sequences were identified in the AAV6 c omplex due to the high degree of conservation among these two serotypes (Table 3 2) Fab C37B and AAV2 A total of 4,392 particles were extracted from 149 CCD images to generate a final 3D map with a resolution of ~10.8 (T able 4 2). D ensity was present at each three-fold protrusion, indicating that there is no steric hindrance for the binding of all three protrusions simultaneously (Figure 4 1 D ). The latter region has been identified as being important for the binding of the AAV2 primary receptor, HSPG (Opie et al ., 2003; Kern et al., 2003; Levy et al., 2009; ODonnell et al., 2009), and incubation of mAb C37B with AAV2 capsids has shown a strong reduction of infectivity, possibly due to blocking of receptor mediated entry (Wobus et al., 2000). The C37B mAb is not cross reactive with any of the serotypes studied here (Wobus et al., 2000). Peptide scans identified two binding regions on the AAV2 capsid surface including

PAGE 96

96 residue s 493 to 502 (SADNNNSEYSWT) which showed the highest binding, while residues 601 t o 610 ( LP GMVWQDRD) was involved to a lesser extent (Wobus et al., 2000 ). Those peptides are found near the three -fold axis of symmetry with 493502 located on the surface of the threefold protrusions in VRV, which is cradled by the fingers (VRIV and VIII) of a three-fold related symmetry monomer. Residues 601610 map to an interior region just below the central depression of the three -fold protrusions which is not accessible from the surface and is therefore most likely important for the structure of the t hree -fold axes Currently there is no sequence data available for this mAb thus an unrelated Fab structure (PDB 2FBJ) was used for docking into the Fab density (Figur e 4 3 ). Close inspection of the docked models revealed Fab coverage at the tips of the th ree -fold protrusions highlighting the variable regions (VR) within this region; VRIV, V, and VIII (F igure 4 2 ). The most obvious residues involved include a portion of the sequence identified as the major epitope by Wobus et al (2000), residues 496500 (T a ble 4 4 ). The peptide identified here, N NN SE, includes the two asparagines (underlined residues, N497 and N498) that when mutated in peptide competition experiments caused a partial reversal of competition (Wobus et al ., 2000). The other two proposed regions, in VRIV and VIII (peptides RGNRQ and TTT, respectively) flank VRV as symmetry related monomers that come together to form the three -fold protrusions, and possibly only contribute stability to the ma in interaction found at VRV. A surface exposed sequenc e identified to be important in receptor binding of HSPG (residues 585 590) located in VRVIII was also identi fied here ( Opie et al. 2003; Kern et al., 2003), consistent with the reduction in infectivity of AAV2 capsids when incubated with C37B mAb s due t o receptor blocking (Wobus et al ., 2000). Fab F4 and AAV5 Capsids The fnal density map of AAV5 with Fab BB3C5. F4 included 2,694 particles submitted for 3D rendering producing a density map to 15. 7 (Tabl e 4 2 ). These Fabs obscure the c apsid

PAGE 97

97 topology a nd the 3D map show s a stronger portion of the Fab arm extending from the shoulder of the three -fold protrusion towards the five -fold axis of symmetry (Figure 4 1 E ) Additional analysis also reveals a weaker extension between the shoulders of the three -fold protrusions at the base of the two -fold axis of symmetry ( Figure 4 4 ). It may be possible that these two regions are the binding sites for the heavy and light chain of the Fv portion where residues at the end of the chain may be stabilized in a non -speci fic manner. Docking of the AAV5 atomic coordinates and analysis of the bound Fab structure w ere done at a high sigma level (~3.5 in order to identify the capsid regions below the strongest density the likely contact sites These regions were visual ly mapped to the same symmetry regions that make up the three -fold spike on the capsid surface at VRIV, V, and VIII. Residues involved in this region were mapped to a reference monomer at the three -fold as 442448 (AAV5 VP1 numbering) giving the peptide NNTGVQ at VRIV; and 572578 of NNQSSTT at VRVIII. T he three -fold related monomer contributes peptide S GVNR (residues 479483) at VRV (T able 4 4 ) Fab ADK8 and AAV8 C apsids A total of 1,123 particles were extracted from 78 CCD images to generate a final 3D m ap with a resolution of ~18.4 (Figure 45 A). D ensity was present at each three -fold protrusion, indicating that there was no steric hindrance for the binding of all three protrusions simultaneously, as was seen for a previous recon struction, AAV2:C37B (Fi gure 4 1 D). An entire capsid molecule, or 60 -mer, was generated from the AAV8 atomic coordinates (PDB 2QA0 ; N am et al ., 2007) and was docked into the respective capsid density with a c orrelation coefficient (cc) of ~0.42. The cc of the fit was most likely low d ue to the presence of the uninterpretted density belonging to the bound Fabs as well as the use of a C 5 B). Since the ADK8 antibody has yet to be sequenced, a model has not been generated. The atomic coordinates for a generic Fab mod el (PDB 2FBJ ) were then docked into the identified Fab

PAGE 98

98 density and a density map was generated from this new model (Figure 4 5 C). A new cc was calculated (see chapter 2) and was found to be ~0.68. The correlation was improved when the excess density was fi lled, but this low correlation is most likely due to the use of C previously mentioned, in addition to the use of rigid -body and manual fitting techniques. In this case, these approaches do not account for conformational differences in the dock ed structures. This is evident from a comparison of the maps used in the determination of the cc between the cryoEM reconstruction a nd the fitted models (Figure 4 5 D). Docking atomic models into the cryoEM map allowed for further characterization of the ADK8 binding site on the AAV8 capsid (data presented in Appendix B). Visual inspection identified the Fab binding to the spikes at the three -fold axis of symmetry, leaving the twoand five -fold axes un -occluded. A more detailed inspection of the docked VP 3 capsid monomers identifi ed VRIV, V, and VIII (Figure 4 2 ) of th e three-fold axes to be important in the antibody interaction. A lesser, but possible interaction was also noticed at VRVI corresponding to a KDDEE peptide at aa530 534. These regions were al so noted in the previously determined reconstructions (Table 4 4). Sequence identification of this region proposes that the peptides GTANTQ (VRIV; aa455 460), TTTGQNNNS (VRV; aa493 501), and LQQQNT (VRVIII; aa586 591) could be involved in the epitope. It i s interesting to note that portions of the peptides from VRIV and V in AAV8 have been identified in studies as being immunogenic in cytotoxic T cell assays, while the peptide identified in VRVIII was found as an epitope in MHC II molecules (Chen et al., 20 06). Another interesting note includes the observation the sequences at VRV and VIII both have triplicate repeats of hydrophilic, polar residues, i.e. QQQ (Table 4 4). Fab ADK1 a and AAV1 C apsids The data collected for the ADK 1 Fab and AAV1 yielded a recons truction to ~10.8 from 1,271 particles (Figure 4 6 A) D ata for this particular complex was taken from 42 film images at

PAGE 99

99 a magnif ication of 50, 000. The data was collected on the 200KV FEI Sphera, inste ad of the 300KV FEI Polara used for the other complexes from 1.5 2.75 m underfocus. Scanning of the giving a final image size of 1.27/pixel. Film data was most likely the deciding factor in the higher resolution obtained for this structure. Fab density can be seen at each individual three -fold protrusion and appears to bind at an estimated angle ~45 to the capsid surface. The binding indicates that all axes are open for interactions, and if the antibody is neutralizing, it most likely does so by steric interference. The ADK1a monoclonal antibody has been shown to recognize assembled capsids (Kuck et al., 2009) most likely implying a conformational epitope at the tip of the three -fold protrusion Fitting of atomic models into the cryoEM map (Figure 4 6 B) has illustrated that the most probable region of interaction is at VRIV and corresponds to the peptide 453SGSAQ457. These residues flank the region previously found at VRIV in the other structures It appears that the region also pr eviously i dentified at VRV, 496NN NSNF501 may hel p to stabilize the interaction. B ecause this region is also found in AAV2 (495 NNNSN498) it is unlikely that it is involved in the epitope itself. However, i t is possible that the last two residues at AAV1, 500NF501 ar e involved, since these differ from AAV2 at 499SE500. Mutagenesis will be able to confirm this interaction. This antibody has also been found to recognize AAV6 capsids, which further supports the region identified here due to the identity between AAV1 and AAV6 at these regions Common Features of Antibody Binding Sites o n the AAV Capsid Mapping the antigenic re gions of the different virus antibody complexes shows that there is signifi cant overlap among these epitopes at the three -fold axis of symmetry ( Fi gure 4 7 ). A structure based sequence alignment of AAV1, 2, 5, 6, and 8 (Figure 4 8 ) shows that the epitope

PAGE 100

100 residues have stretchess of high variability, adopt different surface loop conformations, but form similar structural features, such as the protrusi ons in the proposed regions of antibody binding. D iscussion Here the antigenic structures of the AAV capsids that are recognized by a set of antibodies have been characterized. This study also shows that there are common antibody recognition properties th at are shared by the capsids of these four distinct AAV serotypes. The two mAb s tested that recognize the intact AAV1 capsid, AA4E4.G7 and AA5H7.D11, were produced after extended immunization of mice and likely represent affinity mature IgGs including the C37B ADK1a, and ADK8 IgGs. The BB3C5.F4 anti -AAV5 mAb was generated only 4 days after intact AAV5 capsid immunization of a mouse which had been previously immunized with AAV1 and may represent a n im mature antibody. Viruses a s Antigens Features Revealed The antibodies tested here all bound on or near the three -fold protrusions on the capsids of the four distinct serotypes While the specific sites of interaction var y, with some binding near er the top and others on the side of the se structures there was a common overlapping area within the footprints of all the antibodies on all capsids (Figure 4 7 ). All epitopes appeared conformational in nature as each antibody made multiple contacts wit h sequences from symmetry related monomers, which were displayed as variable loops in the asse mbled structure of the capsid. T he capsid surface contacted by the Fab s did not show any specific features, other than being a raised structure with three-fold symmetry, and the distribution s of amino acids in the interacting r egions w ere not significantly different from those seen in the remainder of the capsid surfaces. However, it is interesting to note that some residues identified in these proposed epitopes were highly repetitive Indeed, further examination of the AAV1 9 s equences show that there are several instances of identical triplet aa stretches, i.e. T TT, almost all occurring at the

PAGE 101

101 capsid surface regions. However, the significance of this find is yet to be determined. The regions identified as possible epitopes were also found to exhibit a n overall hydrophilic environment with predominantly polar side chains. The most obvious feature of the structures bound by the antibodies was that they were raised above the capsid surface T his feature is a structural property th at has been revealed for antigenic sites on the canine and feline parvoviruses, as well as other viral capsids ( Kaufmann et al., 2007; Hafenstein et al., 2009; Moskalenko et al., 2000; Smith, 2003). However, the other raised region of the AAV capsid, the c ylinder that surround s the pore structure at the five -fold axis of symmetry, did not bind the antibodies in this study or among the 8 antibodies examined for the canine a nd feline parvovirus capsid (Ha fenstein et al., 2009), and it may therefore require mo re than just structural prominence to induce the formation and affinity maturation of antibodies. The loops in that structure are flexible which may influence the attachment of antibodies and the selection of high affinity IgGs ( A gbandje McKenna and C hapma n 2006). S tructures of Bound Antibodies and Possible Mechanisms of Neutralization or Effects o n Capsid Functions Studies of other viruses and antibodies have shown that there are several possible mechanisms of neutralization by different antibody -virus combinations (Smith, 2003). The neutralization mechanisms of many anti -AAV antibodies have not been investigated in detail but som e examples have been reported. Although we have not yet examined the capsidcell infection processes of all the antibodies an d Fab s tested here, the structural analysis provides a number of predictions about the likely effects of antibody bindin g. At least for the AAV2:C37B structure there is more conclusive evidence that the mechanism of neutralization is indeed blocking by obs curing cellular receptor attachment as biochemical data ( Wistuba et al., 1997) and now structural data identify the HSPG receptor site as being involved.

PAGE 102

102 Since the structures were determined in context with Fabs instead of the full mAb it is difficult to conclude that bivalent binding had occurred for any of the antibodies studied here. However, there are some generalizations that can be made that suggest bivalent binding for the AA4E4.G7 mAb In the case of the AA4E4. G7 Fab, there is strong density seen a t the base of the three -fold protrusion and hovereing above the two-fold axes in a cross linking manner (Figure 4 2A). However, it has been shown that bivalent binding does not have to occur over the two-fold axis (Thouvenin et al., 1997). Bivalency on suc h a repetitive antigenic surface as a virl capsid generally hints at an increased avidity causing both Fab arms to bind the capsid surface, resulting in a marked decrease in capsid aggregation. There is no structure of the AA9A8. B12 Fab bound to an AAV1 ca psid, but preliminary complexing studies using negative staining techniques identified a lack of aggregagtion at several dilutions of mAb (Figure 3 6 ). It was previously noted in studies with a bivalent mAb against RHDV that small amounts of aggregation ma y be indicative of bivalency (Thouvenin et al., 1997). T he re are two thoughts here, one being the direct overlap of the antibody attachment site and the receptor binding site t hat would likely lead to comp etition for the binding site, and t he other would b e the occlusion of these regions o n the capsid surface by the Fab structures particularly where the Fab s bind at oblique angles so that they would block an even larger region of the capsid than the direct footprint. T he effectiveness of competition may be lower for the AA5H7. D11 Fab as th at only occupies one of 3 possible binding sites near the three -fold axis, meaning that forty sites would remain open even when the capsid was saturated for antibody binding However, other studies have noted that not all sites need to be covered to induce neutralization ( T houvenin et al., 1997). Some antibodies can stabilize the capsid against structural changes required for uncoating within the cell, which would still allow cel l binding and internalization (S mith 2003). It appears that AA4E4. G7, if

PAGE 103

103 binding across the two -fold as proposed, could lock the capsid in a position where uncoating may not be possible if the two -fold is involved in uncoating. Indeed, further studies are required to isolate the step in the life c ycle that is n eutralized by these antibodies, but studies in reovirus have identified large structural cha n ges at the binding sit e (N ason et al., 2001). Conversly, it has been proposed that antibodies do not neutralize by gross co nformational changes (Smit h, 2003). Most likely due to the thought that for antibody -induced conformational changes to be important for neutralization, clonal expansion of B -cells would need a mechanism to choose for B cells that would generate antibodies that induce conformational changes (S mith 2003). Although small structural changes were noted in a few virus a ntibody reconstructions (Li et al., 1994; Bothner et al., 1998, L ewis et al., 1998), it is more likely that capsid dynamic s play a role here instea d of antibody-induced changes (S mith 2003). Collaborative studies with Drs. Jurgen Kleinschmidt a nd Christina Raupp included the ADK8 dat a to further characterize this mAb and its interaction with the AAV capsid. In these studies mutations were made in the proposed antigenic re gions on the AAV8 capsid (Table 4 4) generating similar regions corresponding to AAV2 and ultimately found that when the AAV8 peptide 586LQQQNT591 at VRVIII was changed to the AAV2 peptide 586LQNRGNR591 ADK8 recognition was abolished (Appendix B). This reg ion was further confirmed when AAV2 capsids were mutated to the corresponding AAV8 antigenic peptide (Appendix B). Further analysis included investigating neutralization efficiency, using in vivo and in vitro techniques, and mechanisms of neutralization. B oth in vivo and in vitro data confirmed neutralization activity by the ADK8 monoclonal and preliminary mechanistic studies further identified that binding and internalization of AAV8 in HepG2 cells was not perturbed (Appendix B).

PAGE 104

104 Table 4 1. Summary of AA V -Fab complexes generated for cryoEM data studies Monoclonal a ntibody (mAb) Parental A ntigen Antigen u sed in c omplex Complex formed AAV4E4.G7 AAV1 AAV1 AAV1:G7 AA5H7.D11 AAV1 AAV1 AAV1:D11 C37B AAV2 AAV2 AAV2:C37B BB3C5.F4 AAV5 AAV5 AAV5:F4 AA5H7.D11 AAV1 AAV6 AAV6:D11 ADK1a AAV1 AAV1 AAV1:ADK1a ADK8 AAV8 AAV8 AAV8:ADK8 Table 4 2. CryoEM data reconstruction statistics Antigen: antibody complex Number of micrographs Range of defocus Includes focal pair data Number o f particles boxed Number of particles used Final resolution (~) AAV1:G7 95 1.50 3.0 No 2,376 1,914 12.3 AAV1:D11 31 1.25 3.0 No 313 262 22.8 AAV2:C37B 149 1.50 3.0 Yes 4,731 4,392 10.8 AAV5:F4 122 1.25 3.0 No 2,806 2 ,552 15.7 AAV6:D11 49 1.00 3.0 Yes 5,265 2,527 15.3 AAV1:ADK1a 49/film 1.00 3.0 No 1,387 1,271 10.8 AAV8:ADK8 78 1.00 3.0 No 1,923 1,123 18.4 Table 4 3. Scaling and fitting statistics of cryoEM 3D reconstructions with atomic models 3D Recon struction Scaling CC Final /pixel Fitted AAV + Fab model CC AAV1:G7 0.80 1.863 0.82 AAV1:D11 0.81 1.850 0.65 AAV2:C37B 0.65 1.883 0.73 AAV5:F4 0.67 1.800 n/a AAV6:D11 0.77 1.850 0.63 AAV8:ADK8 0. 60 1.900 0.68 Table 4 4. Pro posed epitopes for each respective comple x including residue numbers and sequence data Complex VRIV* peptide : amino acid sequence VRV* peptide : amino acid sequence VRVIII* peptide : amino acid sequence AAV1:G7 456 459 : AQNK 492 498 : T KT DNNN 585 590 : QSSSTD AAV1:D11 456 459 : AQNK 492 498 : T KT DNNN 585 590 : QSSSTD AAV1:ADK1a 453 456:SGSA --AAV6:D11 456 459 : AQNK 492 498 : T KT DNNN 585 590 : QSSSTD AAV2:C37B 454 456 : TTT 496 500 : NNNSE 585 590 : RGNRQ AAV5:F4 442 448 : NNTGVQ 479 483 : SGVNR 572 578 : NNQSSTT AAV8:ADK8 4 55 460:GTANTQ 493 501:TTTGQNNNS 586 591:LQQQNT *residue numbering is respective to the serotype indicated in each complex

PAGE 105

105 Figure 4 1 CryoEM 3D reconstructions shown with respective roadmap of epitope positions on the 3D capsid surface A) AAV1:G7 comple x to ~12.3 B) AAV1:D11 complex to ~22.8 C) AAV6:D11 complex to ~15.3 D) AAV2:C37B complex to ~10.8 E) AAV5:F4 complex to ~15.3 All viral surfaces are colored respectively, AAV1 purple, AAV2 blue, AAV5 grey, AAV6 pink, while the Fab density is shown in light grey. Maps are viewed down the two -fold axis as indicated in the roadmap image.

PAGE 106

106 Figure 4 2 Variable regions of the AAV -VP3 monomer A) Colored loops on the monomer represent the variable regions (VR) of the monomeric unit and are indicated wi th Roman numerals. The conserved co re structure is shown in grey. Icosahedral s ymmetrical axes are depicted with a triangle and the number 3 for the three-fold axis, while the two -fold axis is depicted by an oval and the number 2 and the five -fold is shown as the number 5 set into a pentagon shape. B) The same monomer repeated 60times generates an entire capsid structure and is viewed here in a surface representation. The VRs can be seen interacting with one another in context of the surface and it is evid ent that the capsid surface is highly variable. The VRs are colored the same as in part A and a triangle represents the asymmetric unit of the AAV capsid. Figure 4 3 Docking of atomic models into cryoEM density A) The atomic coordinates of AAV2 (PDB 1L P3) were docked into the capsid densit y for the AAV2:C37B complex while atomic coordinates of a generic Fab (PDB 2FBJ ) was used for the Fab density. Symmetry related capsid monomers at a three -fold axis are depicted in green, blue, and magenta and the Fab is shown in yellow. B) Zoomed in image of the broken line boxed region shown in part A. Surface loops from the Fab model can be seen in close proximity to the capsid surface monomers. These regions were chosen as sights of possible interaction.

PAGE 107

107 Figure 4 4 Difference map between the AAV5:F4 reconstruction and a similar scale AAV5 uncomplexed map. Difference map density can be seen as black mesh on the light grey capsid surface. The red dash oval depicts the region covered by an entire Fab molecule. Withi n this region there appeared to be two sites contacting the capsid surface. T he first can be seen at the regions between the five and three -fold axes, in a black -dash box and the second at the shoulders of the three -fold axis in a black -solid box, spillin g into the two -fold. Model docking appears to correlate better with Fab fitting to the region identified with the black solid box. The 3D map is viewed down the two -fold axis at a 90 degree rotation from the maps in Figure 4 1.

PAGE 108

108 Figure 4 5 Three -dimens ional reconstruction and model fitting for the AAV8:ADK8 complex. A) Final density map for the AAV8:ADK8 structure to ~18.4. The AAV8 viral surface is colored green while the excess density in white was identified as the Fab density. B) Fitting of the AAV 8 (PDB 2QA0) structure into the respective capsid density. Density map is shown in grey and the atomic coordinates are in green. The excess white space remaining for the Fabs could easily account for the low fitting statistics. C) Fitting of both Fab and A AV8 capsid models into the reconstructed density. One Fab portion, modeled in as PDB 2FBJ, is shown in red and is hovering above three symmetry related monomers, colored in green, blue, and magenta, at the three -fold axis of symmetry. D) Visual comparison of the maps used to generate the final correlation of the docked models (green) and the original cryoEM reconstruction (grey). An excess of green density from the fit model map can be seen extending beyond the cryoEM map, indicating regions that would decr ease the final corrolation. Black arrows mark example regions of density extension.

PAGE 109

109 Figure 4 6 AAV1:ADK1 a reconstruction and model fitting. A) Three -dimensional rendering of the ~10.8 density map. The virus is shown in purple with the Fabs depicted in white and the three -fold axis is marked by a black triangle. B) Atomic models were fit into the virus:Fab cryoEM map to isolate regions on the capsid that are interacting with capsid surface. The capsid monomers making up the highest point on one three -fol d protrusion are colored in green and blue. It appears that one major loop, identified as VRIV, is most involved in the interaction. It is highly possible that other VRs close by are helping to stabilize or interact directly with the antibody. Figure 4 7 Illustration of overlapping antigenic regions at the capsid surface level A) An AAV capsid surface is depicted in cartoon diagram illustrating the overlapping regions identified through structural epitope mapping. The DE and HI loops that make up the fiv e -fold pore and surrounding floor, respectively, are offset in dark grey for orientation, while the overlapping antigenic residues are highlighted in black spheres. These regions sit at the shoulders of the three -fold protrusion s. B) A roadmap of the 3D ca psid surface maps the regions of interest in black to the three -fold axes. An assymetrical unit is shown on both surfaces red triangle in A and a black tri angle in B. A pentamer shape is representing the five -fold axes, while an oval depicts the twofold, and filled triangles map the three -fold axes.

PAGE 110

110 Figure 4 8 Structure based sequence alignment of AAV1, 2, 5, and 6. Variable regions (VR) are marked by roman numerals and specific sequences of intere st are underlined in red The numbering to the above the sequences follows AAV2 VP3 numbering.

PAGE 111

111 CHAPTER 5 MUTATIONAL ANALYSIS OF PROPOSED DOMINANT ANTIGENIC SITES ON T HE CAPSID SURFACE OF AD ENO -ASSOCIATED VIRUS SER OTYPE 1 Introduction The AAV capsid surface is responsible for a multitude of interactions and f unctions within the viral life -cycle including host cell receptor recognition, pathogenicity determination, viral genome encapsidation, capsid assembly, nuclear import and export, endosomal escape, maturation to infectious virions, and recognition by and e vasion from the host immune res ponse (Agbandje Mckenna and C hapman 2006). Mutational analysis, including the use of insertions and cross -packaging, of the AAV capsids have answered many questions about the role of the VPs in assembly, tissue tropisms, ant igen icity, and even gene transfer (L ochrie et al., 2006; H auck et al., 2006; O pie et al., 2003; DiP rimo et al., 2009; Wu et al., 2000; Xu et al., 2005; S hi et al., 2006 R abinowitz et al., 1999, 2002; G rifman ; et al., 2001; H uttner et al., 2003). However, t hese studies have also created more questions. For example, AAV2 mutants that lack HSPG binding ability can no longer transduce the liver at comparable levels, but still retain a robust tropism for heart tissue (Kern et al., 2003). Since the atomic structu res of almost all of the known AAV serotypes have been solved examination of the capsid surface in a three dimensional context has aided in the identification of functional regions important in the viral lifecycle (Xie et al., 2002; Nam et al., 2007; Govi nda et al., 2006; unpublished data) Almost all of the structural studies conferring functionality to domains on the AAV capsid have involved AAV2. These studies include the identification of the primary cell -surface receptor, HSPG (Summerford and Samulsk i, 1998) and the capsid residues that confer binding (Opie et al., 2003; Kern et al., 2003) as well as the identification of p otential co receptors necessary for internalization of AAV2 (Qing et al., 1999; Kashiwakura et al., 2005; Summerford et a., 1999; Akache et al., 2006). Previous studies aimed at identifying antigenic regions have

PAGE 112

112 also identified both T -cell and B -cell epitopes which generally map to the core structural components and the capsid surface, respectively (Figure 1 1; Wobus et al., 2000; M ays et al., 2009). Further studies in cellular u ptake and trafficking have hinted that rearrangements at the capsid surface level occur during receptor interaction that may allow for the exposure of residues necessary for subsequent steps in the traffickin g pathway (Levy et al., 2009; Lochrie et al., 2006). This work has given new insight into the dynamics of these regions and the role that they play in the capsid framework. In further support, there are several structures available which incorporate recept ors and antibodies against AAV, including the work presented here, to further identify the multitude of interactions at the capsid surface level and beyond (Levy et al., 2009; ODonnell et al., 2009; unpublished data ). Increased interest in alternate sero types has broade ned many of these types of investigations to include other serotypes Several studies have already identifi ed cell -surface receptors for AAV1, 3, 4, 5, and 6 ( Walters et al., 2001; Kaludov et al., 2001; Wu et al., 2006; Di Pasquale et al., 2003). In this study we aim to further characterize t he antigenic properties of AAV1 through mutational analysis at variable regions previously identified to be involved in antibody recognition (Chapter 4). Results Gener ation of AAV1 Capsid M utants Reco mbinant AAV 1 mutants were generated in a plasmid encoding the AAV1 cap gene and a n AAV2 rep gene. Both the packaged genome, GFP, and the Ad virus helper functions were supplied in trans on another plasmid, using UF11 with the pXX6 respectively Mutational primers were designed against the VRs IV, V, and VIII and targeted the previously determined sequences (Table 4 4). The idea was to change the AAV1 sequence to that of the structurally similar region in AAV2 because the AAV2 capsids were not recognized in native dot blot

PAGE 113

113 analyses (Figure s 3 2A and 3 2 C). This would generate 7 mutants where the three regions could be tested separately and in context with one another. The first single -site mutant at VRIV was changed from 456AQNK459 on AAV1 to 455TTQS458 on AAV2 and named mut1AB as all the mutations were done in a two -step process (see methods chapter 2). The second mutant had mutations at VRV, from 492KT493 on AAV1 to 493SA494 on AAV2 and was re ferred to as mut2AB. The final single -site was at VRVIII and wa s changed from 586SSST589 on AAV1 to 585RGNR588 on AAV2, which has been associated with HSPG binding, and was referred to as mut3AB. The four remaining mutants included all the possible combinations of the single -sites to create double -sites, 1AB2AB, 1AB 3AB, and 2AB3AB, and finally a mutant which harbors AAV2 sequences at VRIV, V, and VIII, 1AB2AB3AB which has yet to be generated (Table 5 1). Analysis of Mutant Protein E xpression The ability of the capsid mutants to be expressed in the 293 cell system wa s checked by standard western blotting techniques using the B1 antibody that recognizes a common, linear epito pe at the C terminus (see chapter 2). The monoclonal, 1F, w as also used to detect that Rep proteins were being expressed. Western blots on c ell ly sates of single -site mutants revealed that a similar amount of the VPs were being expressed during transfections (Figure 5 1 ). This blot also identified the expression of Rep proteins 52 and 42 (Figure 5 1 ). Cha racterization of Mutant Capsid P roduction Th e observation of VPs in a western blot does not indicate that intact capsids are being generated during the transfection process. To check for the ability of the antigenic mutants to form particles a native dot blot could not be done as the nature of the m utants was to evade detection by capsid antibodies and the lack of recognition could therefore not confirm antibody escape, but possibly just be due to the lack of intact particles Thus, i n order to identify capsid

PAGE 114

114 populations, cell lysates were further purified by iodixanol -gradients and ion -exc hange chromatography (see chapter 2 methods). Fractions from the iodixanol gradient were similar to the rAAV1 vector having B1 positive fractions at the 40/60% and 40%, except for mut3AB which showed VP s in the 40% and 40/25% (Figure 5 2 A ). Anion exchange chromatography also showed identical elution fractions for all samples (Figure 5 2B ). These purified samples were then visually inspected by negative stain EM for the presence of intact particles. The single -site mutants were all capable of forming intact virions as indicated by the presence of particles in the EMs (Figure 5 3 ). Quantification of Mutant Particle Titers, Infectivity, and Packaging Ability In order to determine mutant capsid titers an ELISA was per formed using the ADK1a mAb. The binding region for this antibody has been mapped to regions just flanking the mutants at VRIV (Table 4 4) and it was determined by native dot blot (Figure 5 4 ) that this antibody will still bind the antigenic mutants and tha t any changes in titer seen can be directly correlated with a defect in the mutant itself. Capsid titers were determined from separate analyses using cell lysates from independent transfections performed at different times. T iters show that mut1AB and mut2 A B produced similar intact capsid amounts when compared to each other at 1.06 x 1014 and 1.72 x 1014 respectively (Table 5 2 ). However, there was a t least a two log decrease in the titers seen for mut3AB at 1.22 x 1012 (Table 5 2). rAAV1 controls produced higher amounts of intact capsid than all three single -site mutants at an average titer (n=3) of 2.70 x 1014 (Table 5 2). Preliminary particle assembly values for the double -site mutants confer a similar observation where mutants involving aa swapps from AA V1 to AAV2 at both VRIV and VRV (mut1AB2AB) have near control values (~2.34 x 1014 particles/ml ), while those harboring swapps from VRVIII show a slight loss when combined with VRV (2AB3AB; ~2.91 x 1013) and a drastic drop when VRIV is included (mut1AB3AB; 1.55 x 1011) (Table 5 -2).

PAGE 115

115 Infectivity of the mutants was checked by infectious assays using the direct visualization of green cells (see methods chapter 2). The mutants were all determined to be infectious at similar values with mut1AB being lowest by les s than one log (Table 5 2 ). Double -site mutants have yet to be checked for infectivity. Quantitative PCR (qPCR) was used to determine the packaging ability of each mutant in context of rAAV1 as a control. However, results indicated that more genome was pac kaged than capsids were made (Table 5 2). The error could easily be due to several instances, including background interference of non -specific primer recognition, pipetting errors, technique, or is a reflection of the sensitivity differences between ELISA and qPCR. Data for the double -site mutations is currently under evaluation and is not available for inclusion in this report. Assays will need to be repeated to ensure accurate data collection, possibly including optimization of DNA extraction protocols. Acquisition of the data for the double -site mutations is currently in progress. Ability of Antigenic Mutants to Evade Monoclonal Antibody Recognition Cell lysates were used in a native dot blot analysis to check for the ability of the parental mAbs to rec ognize the mutants. Of the single -site mutants, it appears that the mutations in VRIV and VR V reduce the ability of the AA4E4.G7 antibody to reco gnize the AAV1 capsid, seen as a ~27% and ~75% drop in pixel intensity, respectively (Figure 5 5 ). Prelimianry analysis thus indicates VRIV and VRV as important in AA4E4.G7 mAb recognition, with mut2AB (VRV) having a greater role but further analysis with combinatorial VR mutations in VRV and VRVIII (mut2AB3AB) shows a drastic reduction in recognition (Figure 5 5 B). Intersetingly, there is an increase (~32%; Figure 55B) in AA4E4.G7 recognition of mut3AB, possibly indicating a stabilization or increased affinity for these capsids. The AA5H7.D11 antibody was still able to recognize all o f the single -site mutants (F igure 5 5 A ), but a reduced pixel intensity was observed

PAGE 116

116 for mut3AB (~56% re duction) as well as the double -site mutants mut1AB3AB and 2AB3AB (at ~61% and 62% respectively) The AA9A8.B12 antibody still recognizes mut2AB and mut1AB, however there is definite ly a loss in the AA9A8.B12 ability to recognize mut3AB (~86% reduction; Figure 5 5B). This shows that the epitope fo r B12 exists in the AAV1 VRVIII. A negative cont rol of un-transfected cells was also used to isolate any unspecific recognition from the cel l lysates as this background was subtracted in pixel intensity calculations Direct Effects of Mutations on Neutralization An infectious assay for the singe -site mutants was repeated (as indicated for the neutralization assays done by the Chiorini lab, N IH) and the AA4E4.G7 and AA5H7.D11 neutralizing mAbs (Nabs) were included at a ratio of one mAb per one capsid binding site (or monomer). As seen in the native dot blot, both neutralizing antibodies knocked down rAAV1 infectivity to below visible detectable levels (Figure 5 6A C) while infectious units wer e drastically knocked down to ~10% of the original recombinant infectivi ty units (Figure 5 7A ). In conjunction with mut1AB un treated levels ( Figure 5 6D ) the mutants ability to escape recognition by the AA4E4.G7 Nabs (Figure 5 6F ) was evident as comparable levels of infectious units were accounted for in t he green cell assays (Figure 5 7B ). This data also confirms that mut1AB has retained recognition by AA5H7.D11 as was previously seen in the native dot blot (Figure 5 6E and Figure 5 5). Although, mut2AB has shown comparable results to rAAV1 titers, infectivity, and packaged genomes (Figure 5 6A and Figure 5 6G ; Table 2), as well as recognition by the AA5H7.D11 NAb (Figure 5 6 H ), it has now acquired the a bility to escape recognition by Nab AA4E4.G7 (Figure 5 6I ). The levels of infectious mutant virus treated with AA4E4.G7 are near un-treat ed levels of mut2AB (Figure 5 7C ). In accordance with the native dot blot (Figure 5 5), mut3AB was still recognized by AA4E4.G7 and AA5H7.D11 (Figure 5 6 J L ). However a slight drop in recognition by the AA5H7.D11 mAb for mut3AB was observed as

PAGE 117

117 seen by the appearance of green cells in the infectious assay, which is also in accordance with the pixel intensity calculations f or this mutant (Figure 5 5B) Discussion Previous structural studies involv ing complexes of AAV capsids an d anti -AAV Fabs (Chapter 4) led to the observation that antigenic regions on the capsid surface cluster at and around the three -fold axis A majorit y of these structures involved AAV1 and a different monoclonal antibody, including ADK1a, AA4E4.G7, and AA5H7.D11, hence the use of AAV1 as the backbone for mutational analyses Further analysis of these structures allowed for the selecti on of VRs within t he capsid monomers (VP3) that appeared to have contact with the antigen binding region s. The capsid sites were identified as VRIV, VRV, and VRVIII (Table 4 4) and a lthough there are several VRs that give rise to the topology seen at the three -fold these V Rs specifically make up the three -fold protrusions. In order to confirm that these VRs were involved in the antigenic epitope, the AAV1 cap gene was mutated in VRs IV, V, and VIII to corresponding VRs in AAV2 and subsequently tested agains t the anti-AAV1 a ntibody panel. Preliminary Analysis on M utant AAV1 Viruses Reveals a Retain ed Ability to Assemble Infectious Capsids A ssembly studies and mutational analysis on the AAV2 VPs have identi fied various regions that confer pr operties important for assembly pac kaging, and infectivity which ha ve variable levels of tolerance for mutagenesis (Wu et al., 2000, DiPrimio et al., 2008; u npublished data ). In addition, c ombinatorial studies among several differe nt serotypes also eluded that certain VR s can be switched be tween the different AAVs in order to produce chimeric vectors with different functional profiles (Rabinowitz et al., 2002). The mutations made here included swapping amino acids in variable surface loop regions among two different serotypes, AAV 1 and AAV 2, which have almost 83% identity. For the singe -site mutations, particle assembly

PAGE 118

118 appeared to be near recombinant AAV1 control values (Table 5 2) indicating that these regions in the AAV1 capsid tolerate the corresponding functional domains from the AAV2 ca psid. However, inclusion of the AAV2 receptor binding domain ( VRVIII) onto AAV1 (m ut3AB) appears to have decreased particle production by at least two logs (Table 5 2) This region is known to carry a highl y basic charge and may offer a chal lenge for the s tructural integrity of these residues in context of the AAV1 background. Similar observations have been identified for the double -site mutants where mut1AB3AB shows a drastic reduction (~3 logs) in particle assembly compared to recombinant controls (Table 5 2). Although the addition of VRV from AAV2 (mut2AB3AB) appears to rescue this defect as reasonable (near control values) capsid tites were identified (Tab le 5 2). This phenomenon is likely due to the structural arrangement of these VRs, as VRV from a sym metry related monomer sits between VRIV and VIII of another three -fold rel ated monomer. The addition of residues from AAV2 in VRV most likely act as a buffer by helping to further stabilize the normal interactions of the AAV2 type residues in the AAV1 ba ckground. Interestingly, VRV is fairly conserved between AAV1 and 2 (Figure 4 9) yet the inclusion of the two residues that differ here (AAV1:KT AAV2:SA) possibly offer more stability for capsid assembly at this region. This data may also support the imp ortance of these residues fo r AAV2 stability in this region Packaging ability was determined by qPCR analysis of extracted DNA and indicated that all capsids created retained the ability to package. Since the AAV1 single -site mutant capsids now harbor am ino acids in the outermost extensions of the three -fold VRs IV, V, and VIII, which were functional in the parental AAV2 capsid, it appears to be possible that no packaging defect exists for these mutants. Previous studies in AAV2 indicated packaging defect s fo r 4 5aa linker insertion at residues 595 and 597(VP1 numbering) (Rabinowitz et al., 2000), however this

PAGE 119

119 phenotype is not observed here as substitutions, and not insertions, were created. Also, previous studies have not exploited these regions as being impor tant for interactions with the R ep proteins or packaging (Wu et al., 2002). However, since the values for PCR were higher than those values obtained for capsid production (Table 5 2) it is hard to conclude that the packaging data is accurate. In furt her analysis, this may be an artifact of the sensitivity difference between the two techniques and will require more thorough confirmation, possibly with optimization of the DNA extraction protocol Gree n cell assays revealed that two of the three single -site mutants retained near control levels of infectivity with the exception of mut1AB which harbors VRIV residues from AAV2 Since total capsid levels of this mutant were lower compared to the others, it is possible that this drop is due to the differenc e in capsid production and also implies that infectivity assays should be repeated holding capsid titers comparable during the assay. With the data available, it appears that infectivity levels are within the same range suggesting that infectivity has not been altered and that these regions are not interfering with any primary cell surface receptor recognition in the cell type (HEK 293) tested. However, infectivity data will most likely be different depending on the cell type used and studies will benefit g reatly from taking these mutants into in vivo infectivity assays. AAV1 capsid s have been shown to very weakly bind heparin agarose beads (Opie et al., 2003), and AAV1 mutants with VRVIII (mut3AB, mut1AB3AB, and 2AB3AB) from AAV2 now con tain the heparin -bin ding motif RGNR (Opie et al., 2003; Kern et al., 2003). Subsequently, these mutants were tested on heparinagarose columns and re sults concluded that the more intense heparin binding ability of AAV2 was also transferred to the AAV1 capsids (Figure 5 8 ). O verall, these data show that the single -site mutant capsids were assembly competent (Figure 53) and retained the ability to infect cells at levels comparable to the rAAV1

PAGE 120

120 control (Table 5 2). The double -site mutants were only assumed to create capsids bas ed on recognition by the ADK1a ELISA and further studies are currently underway (Table 5 2). Ability of Antigenic Escape is Limited to Specific Regions on the Capsid Surface Single -site AAV1 mutants were tested for recognition by the anti -AAV1 panel of an tibodies that were used in the structure determination of this project (Chapter 4). Although these studies identified the three VRs IV, V, and VIII as being involved in the epitope, mutational analysis has made it increasingly more evident that antigen rec ognition is not a broad activity. T he site for AA4E4.G7 binding has been disrupted with the mutation of either VRIV (mut1AB) or VR V (mut2AB) although the reduction appears greater for mut2AB (Figure 5 5B). It is quite possible tha t either both sites are i nvolved in a conformational epitope, or that steric hindrance occurs when one site or t he other is altered. Intriguingly, the double -site mutants with either one or both of these re gions mutated appears to have a reduction in recogn ition of the capsid anti gen with ~ 65% and 56% reductions in VRIV+VRV (mut1AB2AB) and VRIV+VRVIII (mut1AB3AB), with VRV+VRVIII (mut2AB3AB) having nearly abolished recognition completely (Figure 5 5B ). This drastic reduction indicates that the combination of VR substitutions in mut2AB3AB (both VRV and VRVIII) contribute to the AA4E4.G7 epitope. In order to c onfirm this it is necessary to place these regions of AAV1 onto another serotype and re -probe for recognition. The lack of recognition for mut3AB mutants by AA9A8.B12 indicates that this region is involved in the antibody epitope (Figure 5 5). Double -site mutants incorporating AAV2 VRVIII residues also confirm this observation as mut1AB3AB and mut2AB3AB appear to have escaped recognition by the AA9A8.B12 antibody with an ~87% an d 91% reduction respectively (Figure5 5B). Since there is no structure yet of the AAV1 capsid and the AA9A8.B12 F ab this find illustrates the strength of this technique in the elucidation of common antigenic regions. Again, transferring these residues int o the background of another

PAGE 121

121 serotype will confer the binding region for this antibody. As an aside, it is intriguing to note that this specific monoclonal is nonneutralizing, and following that its binding site is structurally superimposable with the HSPG binding site of AAV2, the primary cell surface receptor -binding region is most likely not within this region. On the other hand, it has been noted before that parvoviruses have differing sites of receptor attachment (Agbandje -McKenna and Chapman, 2006) A A5H7.D11 still appears to recognize all double -site mutant capsids through native dot blot analysis, although recognition reductions were seen in the pixel intensity calculations for mut3AB, mut1AB3AB and 2AB3AB (Figure 5 5B). Infectivity assays conducted in the presence of the AA5H7.D11 Nab indicate that mutations in VRVIII (mut3AB) may play a role in escape from this mAB (Figure 5 6), as double -site mutants with VRVIII mutations also indicate a reduced binding ability (Figure 5 5B). Overall, it appears th at mutations in VRV and VRVIII (mut2AB3AB) have the greatest affect on antibody recognition for the specific panel of antibodies studied here as native dot blots revealed reduced recognition for AA4E4.G7 (near 100%), AA5H7.D11 (~62%), and AA9A8.B12 (~91%). In support, the AAV1 like virus X1 has mutations D495G and D590H, which are also mutated in mut2AB3AB, and correlate to the drop in AA5H7.D11 mAb recognition (Figure 5 5B). Infectivity assays for this double -site mutant should confirm this observation.

PAGE 122

122 T able 5 1. AAV1 mutational nomenclature and sequence differences AAV1 m utant AAV2 VRIV: 455TTQS458 AAV2 VRV: 493SA494 AAV2 VRVIII: 585RGNR588 mut 1AB X mut 2AB X mut 3AB X mut 1AB2AB X X mut 1AB3AB X X mut 2AB3AB X X X indicates by that c olumn is contained within the AAV1 capsid sequence. A dash ( ) indicates that it does not exist. T able 5 2. AAV1 single -site mutant characterization Vector Total capsid/ml Infectious capsid/ml Vector genomes/ml rAAV1 2.70 x 10 14 6.90 x 10 7 1.07 x 10 1 5 m ut1AB 1.06 x 10 14 4.88 x 10 6 3.50 x 10 14 m ut2AB 1.72 x 10 14 2.75 x 10 7 1.53 x 10 14 m ut3AB 1.22 x 10 12 1.38 x 10 7 1.38 x 10 1 4 mut1AB2AB 2.34 x 10 14 N d N d mut1AB3AB 1.50 x 10 1 1 N d N d mut2AB3AB 2.91 x 10 1 3 N d N d *(nd) not determined.

PAGE 123

123 Figure 5 1 W estern blot analysis on single -site mutant cell lysates. Cell lysates were probed with B1 antibody to detect VP1, 2, and 3 ratios and 1F to detect R ep proteins in the cell lysates. Both were used to ensure that all proteins from the rep/cap plasmid were be ing expressed. Mutant VP levels appear comparable to the rAAV1 control. Viral proteins are indicated with text (VP1, 2, and3) where VP3 is also indicated by a red arrow. Rep 52 and 42 are also indicated by text where rep52 is indicated below VP3 with a gre en arrow. Figure 5 2. Purification of single -site antigenic escape mutants A) B1 western blot analysis on iodixanol fractions for each mutant and the rAAV1 control. Bands for VP1, 2, and 3 can be seen in the 60/40% and 40% fractions for the rAAV1 contr ol as well as mut1AB and 2AB, while the VPs are seen in the 40% and 40/25% for mut3AB The lower bands in the 40% and 40/25% fractions appear to be degredation products, possibly an indication of unstable capsids. B) An example elution (mut1AB) from the io n exchange column indicating the peak that capsids were seen (Figure 5 3) Inset shows B1 positive western blot analysis for the ion-exchange elutin fractionfor each single -site mutant. VP3 is indicated by a red arrow.

PAGE 124

124 Figure 5 3 Electron micrograph ima ges of AAV1 mutant capsids. Ion-exchange fractions buffer exchanged out of high salt and were spotted onto carbon-coated electron microscopy grids which were viewed at 47, 000 times magnification. White spherical images indicate negatively stained AAV caps ids against a black carbon background. A) mut1AB capsids B) mut2AB capsids C) m ut3AB capsids Figure 5 4. ADK1a native dot blot of mutant cell lysates. Mutant cell lystates were blotted against ADK1a to determine if capsids could be detected by the AD K1a monoclonal for use by an ADK1a ELISA. The AA5H7.D11 is used as a positive control as it has already shown to recognize the single -site mutants.

PAGE 125

125 Figure 5 5. Analysis of a native dot blot of single and double -site mutants. A) Mutants were checked for r ecognition with anti -AAV1 mAbs AA4E4.G7, AA5H7.D11, and AA9A8.B12. The rAAV1 was used as a positive control and non-transduced cell lysates as a negative control. B) ImageJ analysis results indicating pixel intensities for the blots. Preliminary double -sit e mutant analysis revealed a reduced recognition by AA4E4.G7 against all double -site mutants; 1AB2AB, 1AB3AB, and 2AB3AB, indicating that VRIV and V are involved in the AA4E4.G7 epitope. A slightly reduced recognition for 3AB, 1AB3AB, and 2AB3AB by AA5H7.D 11 is seen from the pixel intensity calculations indicating VRVIII in the D11 epitope. A similar observation is indicated with the AA9A8.B12 mAb.

PAGE 126

126 Figure 5 6. Infectious green cell assay images of N A b treated single -site mutants. Mutant cell lysates an d rAAV1 control were left un treated or were saturated (1 mAb:1 VP) with the AA4E4.G7 and AA5H7.D11 N a bs and applied to 293 cells. Cells were imaged under UV light for the production of GFP. A) rAAV1 control untreated virus B) rAAV1:D11 NAb C) rAAV1:G7 N Ab. Both AA5H7.D11 and AA4E4.G7 neutralize rAAV1 infections as indicated by the lack of green cells in (B) and (C). D) Mut1AB untreated virus. E) Mut1AB:D11. F) Mut1AB:G7. G) Mut2AB untreated virus. H) Mut2AB:D11. I) Mut2AB:G7. AA5H7.D11 treated virus show s retained recognition and neutralization of mut1AB and mut2AB, while AA4E4.G7 appears to have lost the ability to recognize and subsequently neutralize both of these capsids. J) Mut3AB untreated virus. K) Mut3AB:D11. L) Mut3AB:G7. rAAV1 capsids with VRVII I mutations (mut3AB) appears to have retained recognition by both the neutralizing Nabs, althoug h quantification (Figure 5 7D) and visualization indicate a slight loss in recognition and neutralization of this particular mutant.

PAGE 127

127 Figure 5 7. Histograms for in vitro Nab treated mutant virus. Group ANOVA statistics and Tukeys post hoc results are indicated separately for each mutant as their comparisons are internal. A) rAAV1 control virus with D11(AA5H7.D11) and G7 (AA4E4.G7) w here F[2,3]=496.6, P= 0.0002 (***) B) mu t1AB with D11 and G7 where F[2,3]=2217, P=0.0001 (***) C) mu t2AB with D11 and G7 where F[2,3]=266.6, P=0.0004 (***) Here, a slightly significant value is noted as; *=P<0.05 D) mut 3AB with D11 and G7, where F[2,3]=230.2, P=0.0005 (***) F igure 5 8 Heparin -binding analysis. Single and double -site mutants with VRVIII (mutations including 3AB) from AAV2 were analyzed on a heparinagarose column Mutants 3AB, 1AB3AB, and 2AB3AB were loaded onto t he column and eluted off with 1 M sodium chlori de. Empty baculovirus expressed AAV2 capsids (bAAV2) were loaded as a positive control and non -transfected cell lysates were loaded as a negative control. The flow -through (FT) was collected during loading of the samples. bAAV2 blot samples were checked us ing mAB C37B, while AAV1 mutants were tested with mAb ADK1a.

PAGE 128

128 CHAPTER 6 SUMMARY AND FUTURE D IRECTIONS Summary The AAVs have shown great promise as vectors for gene delivery in therapeutic medicine. However, since the AAV capsid is a foreign antigen, pati ent immune responses are activated causing significant decrease in the therapeutic potential of gene therapy. The future aims of the field include generating vectors that escape immune surveilence, specifically pre existing humoral responses. Biochemical e ngineering of the capsid surface requires a working knowledge of not only capsid regions that confer antigenicity, but also receptor binding and tissue tropism. This study used a structural approach to determine antigenic regions on the capsid surface of s everal different AAV serotypes using monoclonal antibodies directed against intact capsid antigen. Although different serotypes (AAV1, 2, 5, 6, and 8) and monoclonal antibodies were used, data identified that the monoclonals studied were all recognizing ov erlapping regions at the three -fold axes of the capsid surface regardless of the serotype examined (Figure 4 7 ). This led to the conclusion that AAV capsids harbor common antigenic regions at the three -fold axes including VRs IV, V, and VIII. A majority o f the structures included AAV1 as the anti -AAV1 panel was largest at the time the study was initiated and thus this data was used for further verification of structurally mapped antigenic sites. Based on the structural analyses, two to four amino acid stretches in the AAV1 capsid VRs IV, V, and VIII were chosen for mutation (Table 4 4). These stretches were subsequently mutated to amino acid residues present in the AAV2 VP at structurally equivalent positions since this serotype was observed to have no cros s reactivity with the anti-AAV1 mAbs and is also ~83% similar to AAV1, possibly allowing for tolerable mutations. This led to the creation of six AAV1 mutant capsids three single -site mutants termed mut 1AB, mut 2AB, and mut 3AB, and three double -sites mutan ts termed mut 1AB2AB,

PAGE 129

129 mut 1AB3AB, and mut 2AB3AB. All mutants appeared to have comparable amounts of ca psid production, although mutants harborin g mut3AB (AAV2 VRVIII ) had a decrease in capsid production (Table 5 2). It was proposed that these mutants will most likely not have packaging defects as the r egions mutated have not been previously identified in packaging or assembly deficiencies of the recombinant virion. Preliminary vector genome evaluation could not be trusted due to the error seen between the ELI SA and qPCR values. Undeniably, PCR is a much more sensitive technique and will most likely require optimization of the DNA extraction protocol in order to reduce contaminating cellular DNA. Infectivity assays with single -site mutant cell lysates revealed comparable levels of infectiv ity, although mut1 AB had a slightly lower infectivity among them (Table 5 2) H owever, the lower value for mut1 AB may be due to lower capsid production and/or packaged genome. Interstingly, double -site mu tant capsid production for mut 1AB3AB and mut 2AB3AB had markedly less particles/ml (Table 5 2), possibly indicating a challenge in maintaining such a basic patch (AAV2 VRVIII residues 585RGNR588) within the background of AAV1 VP3. Interstingly, but not un expected, mutants which contained the AAV2 heparinbinding motif in VRVIII, were able to bind heparin (Figure 5 8). It is appealing to propose that receptor binding regions are heavily supported in the context of the capsid structure through neighboring residues and that these re gions may offer dual functionality in governing receptor -mediated entry as well as capsid stability. This observation will most likely cause issues in retaining desired functionality during capsid engineering, but may also reveal more simplistic engineering as changing one site to generate a desirable phenotype may remove the previous functionality that was con ferring therapeutic challenge.

PAGE 130

130 Following preliminary mutant characterization i n vitro neutralization assays using a GFP reporter mirrored recognitio n levels seen on a native dot blot. Here, capsids with mutations in VRIV and V showed the ability to escape recognition by neutralizing antibody AA4E4.G7 (Figure 5 6A C) Interstingly, green cell assays involving mut3AB illustrate a slight reduction in inf ectivity when incubated with the neutralizing mAb AA4E4.G7 which contradicts the dot blot analysis (Figure 5 5B). Here, an increase in recognition was observed by AA4E4.G7 with mut3AB capsids. As the epitope for the non-neutralizing mAb AA9A8.B12 was found to include VRVIII (mut3AB), it is likely that the increased recognition of the capsid has hindered its ability to either bind a receptor or traffic properly. This observation supports the notion that the close proximity of these variable regions confers a mixed functionality through indirect structural support. Also of note, a native dot blot indicated that all capsids were still recognized by the Nab AA5H7.D11, but pixel intensity calculations and green cell assays identified a slight drop in recognition by mutants with VRVIII muations (Figure 5 5B) and an enhanced ability to infect in the presence of the Nab (Figures 5 6D and 57K), respectively. It is likely that engineering of unique vectors will also include the replacement of adjacent residues to support the desired mutations/deletions in order to retain viability Taken as a whole, all three VRs identified through the structural analysis of complex ed AAV capsid revealed antigenic nature as mutations in these regions altered recognition to some level From the data p resented for this antibody panel, it appears that VRVIII plays an important role in the antigenic nature of the AAV1 capsid, including the surrounding regions of VRIV and VRV. T his study has at least developed a fou ndation for mutational ana lysis of antigenic regions on the AAV capsid and offers a starting point for engineering antigenic escape vectors. Ideally, the whole AAV capsid is antigenic in nature and current data shows that the majority of the

PAGE 131

131 raised regions on the AAV capsid surface other than the top of the five -fold cylindrical channel, are succestible to antibody recognition. Thus it is anticipated that new antigenic regions will arise following the use of escape mutant vectors and that new antibodies against the engineered vecto rs will arise. Further analysis of these responses will lead to strategies for better vector development because it will provide information on capsid regionswhere minimal mutations create novel antigenic profiles. This information can then inform the engi neering of new esacape vectors which encompase all potential epitopes. Future Directions The studies initiated here offer a pathway for further elucidation and definition of the common antigenic regions on the AAV capsid surface. Including more diverse ser otypes, like AAV4, and more similar serotypes, like AAV9, and expanding the number of antibodies tested, will most likely offer more support for these common antigenic regions, but may also identify other areas of the capsid that should be i ncluded in engi neering antibody escape vectors Broadening the antibody panel to include different isotypes, i.e. IgA, may also offer a different perspective among antibody binding and may also indicate preferential sites among isotypes. These studies could also identify m echanistical differences among the isotypes and the types of response mounted, i.e. IgM vs. IgG. Also, the use of serum from patients involved in AAV trials, and those with natural exposure, may also better identify which antigenic sites are more common, if such a thing exists. Structural studies including receptor binding regions will also support the functionality of the variable surface loops and will help to better guide capsid engineering. Future studies involving characterization of the mechanisms of neutralization for the antibodies proposed here may also link specific isotypes or binding regions with certain mechanisms, allowing for the prediction of antige n antibody interactions. M ore immediate goals

PAGE 132

132 will be to swap the identified epitope regions from AAV1 onto other serotypes to confer their specificity for the antibodies studied here. Also, testing of the intermediate mutants, i.e. 1A, where only half of the site has been altered may confer more specific residue interactions at the capsid surfac e level. Furthermore, a more thorough mutational analysis through this region will likely better indicate residues involved in antigenicity and may further define those residu es important for the structural integrity of this region.

PAGE 133

133 APPENDIX A HUMAN BOC AVIRUS CAPSID STRUTU RE: INSIGHTS INTO TH E STRU CTURAL REPERTOIRE OF THE PARVOVIRIDAE I ntroduction Human Bocavirus (HBoV), a newly discovered member of the family Parvoviridae was originally isolated in randomly selected nasopharyngeal aspirates (Allander e t al., 2005). Since this initial discovery, HBoV has also been detected worldwide predominantly in children under the age of two with respiratory infections, in serum, urine, and fecal samples (Lindner and Modrow, 2008). Symptomatic children commonly exhi bit acute diseases of the upper and lower respiratory tract s ( Arnold et al., 2006; Kesebir et al., 2006; Monteny et al., 2007 ; Vicente et al., 2007), and possibly, gastroenteritis ( Kapoor et al., 2009; Vicente et al., 2007) though the link to gastroenteri tis outbreaks has been questioned (Campe et al., 2008). It is still unclear if HBoV is the sole etiologic agent of respiratory disease as higher rates of co -infections with other respiratory pathogens such as human rhinovirus and Streptococcus spp. are oft en observed (Allander et al., 2007). H owever, Allander et al. recently reported (2007) that HBoV was found in 19% of children with acute wheezing, thereby making it the fourth most common virus, after rhinoviruses, enteroviruses, and Rous Sarcoma Virus de tected in children exhibiting this symptom. These findings suggest that, at high viral load, HBoV could be an etiologic agent of respiratory tract disease (Allander et al., 2007 ). HBoV infection is common in the first few years of life and clinical researc h suggests it may follow the primary pe riod for acquisition of Human Parvovirus B19 (B19), though there is no antigenic cross reactivity between B19 and HBoV (Kahn et al., 2008; Kantola et al., 2008). By age five most people have circulating antibodies aga inst HBoV as is also true for oth er respiratory viruses such as rous sarcoma virus rhinoviruses, and Human Metapneumovirus (Chow and Esper, 2008). HBoV has also been

PAGE 134

134 identified in adults, with ~63% of samples tested being seropositive, showing a positive correlation with age and a slight positive bias towards women (Cecchini et al., 2009). The Parvoviridae is a family of small, non -enveloped viruses that package a single stranded DNA (ssDNA) genome of ~5000 bases. These viruses are subdivided into two subf amilies: Parvovirinae and Densovirinae (Table A 1 ). The Parvovirinae are further subdivided into five genera, all of who se members infect vertebrates. The Densovirinae (four genera) only infect invertebrates. Phylogenetic analysis places HBoV in the rece ntly classified Bocavirus genus ( Table A 1 ). In addition to HBoV, numerous parvoviruses circulate among the human population. Among these are several dependoviruses, Adenoa ssociated v irus (AAV) serotypes AAV1 3, AAV5, and AAV9, the Erythrovirus B19 and t he newly discovered human parvovirus genotypes 4 (Parv4) and 5 (Parv5) ( Jones et al., 2006; Fryer et al., 2006; Schneider et al., 2008). Of these, only B19 ha d been implicated in disease until the discovery of HBoV and Parv4 which has been isolated from p atients who present symptoms of acute HIV infection (Schneider et al., 2008). The HBoV genome, like that of all members of the Bocavirus genus, contains thr ee open reading frames (ORFs). The first ORF (ns ), at the 5 end, encodes for NS1, a nonstructural protein. The next ORF, unique to the Bocaviruses, encodes for NP1, a second nonstructural protein. The third ORF ( cap ), at the 3 end, encodes the two structural capsid viral proteins (VPs), VP1 and VP2 The HBoV VPs share 42% and 43% amino aci d sequence i dentity with the corresponding VPs of bovine parvovirus and canine minute virus, respectively (Allander et al., 2005). More recently, two additional HBoV like viruses, HBoV 2 and HBoV 3, were identified in stool samples from children ( Arthur et al., 2009; Kapoor et al., 2009). The genome organization of these viruses is identical to that of HBoV, with the NS1, NP1, and VP proteins of

PAGE 135

135 HBoV2/3 being ~80/90%, ~70/80%, and ~80/80% identical to the respective proteins in HBoV (Arthur et al., 2009; Kapoor et al., 2009). Parvovirus genomes are packaged into a T=1 icosahedral capsid that is assembled from 60 copies of a combination of up to six types of capsid VPs (VP1 -VP6 ), all of which share a common C -terminus VP1 is always a minor component, typically comprisin g about five copies per capsid, whereas the smallest VP is always the major component. The unique N terminal region of VP1 (VP1u) contains a conserved phospholipase A2 (PLA2) motif within the first 131 amino acids that is essential for infection ( Qu et al. 2008; Zadori et al., 2001). Interestingly, AMDV, the only member of the Amdovirus genus, is the only exception in that this motif is absent, which suggests this virus employs a different mechanism to escape the endosome during infection (Tijssen et al., 2006). The X ray crystal structures of several parvoviruses show that all VPs contain a conserved, eight -stranded barrel motif ( B -I) that forms the core of the capsid (Chapman and Agbandje McKenna, 2006). There is also a conserved helix ( -A) observed in all parvovirus structures determined to date. The bulk of the VP consists of elaborate loops between the strands that form the surface of the capsid. For example, the GH loop between the G and H strands is ~230 residues. The composition and topology of these loops encode several important functions, including tissue tropism, pathogenic ity and the antigenic response directed against each parvovirus during infection (Agbandje McKenna and Chapman, 2006 ). A number of parvoviruses have been studied by cr yo -electron microscopy ( cryoEM ) and three dimensional (3D) image reconstruction in concert with and complementary to X ray crystallographic studies (reviewed in Agbandje -McKenna and Chapman, 2006). Report here is the 3D structure of a recombinant HBoV caps id solved to 7.9 resolution using cryoEM The

PAGE 136

136 capsid of HBoV was compared to representative members of Parvoviridae (Table A 1 ) with known atomic structures (AAV2, MVM, B19, GmDNV) or pseudoatomic models built into cryoEM reconstructed density (AMDV) to identify similarities and differences. The capsid topology of the newly emerging HBoV incorporates a combination of structural elements at the surface seen in other members of the Parvovirinae However, homology modeling, based on a compariso n of sequence s and available parvovirus structures, places the HBoV VP2 topology closest to B19, the only other structurally characterized parvovirus that is pathogenic to humans. M aterials and Methods Expression and P urification The putative HBoV VP2 gene was constr ucted by de novo synthesis using the published HBoV ST1 sequence ( NCBI Accession No. DQ000495; start codon, nt 3373), and cloned into a pUC vector (Epoch Bi olabs, Inc. ). The vector was cut with EcoRV and HindIII to release the insert, and recloned into a F astbac1 plasmid (Invitrogen). The sequence and orientation of the resulting plasmid were confirmed, and the plasmid was used to produce a recombinant baculovirus using the standard Bac -to Bac technology (Invitrogen). Sf9 insect cells (ATCC) were maintaine d in Graces medium (Invitrogen) with 10% fetal calf serum (FCS) and antibiotics, infected w ith recombinant baculovirus, harvested 4 or 7 days post infection into the medium, and collected by centrifugation. Production of baculovirus was confirmed by a com bination of immunofluorescence of infected cells with mouse antibody against baculovirus (eBioscience), and the typical cytopathic effect of baculovirus -infected cells. For the immunofluorescence testing, slides were prepared by cytocentrifugation ( 200 x g for 8 min in a Shan don Cytospin 4) or by spotting a concentrated c ell suspension onto each of 8 spots of a fluorescent a ntibody slide (Bellco Glass, Inc). The slides were allowed to air dry and were fixe d in 1:1 acetone:methanol at 20C for 10 min. The monoclonal antibody was diluted 1:50 in

PAGE 137

137 PBS plus 10% FCS, and 25 l of the solution was incubated with each cell s pot (~200 cells) for 1 h at 37 C After washing with PBS, the cells were incubated with 1:100 anti -mouse -FITC conjugated antibody in PBS plus 10% FCS and 1:200 Evan s Blue (Sigma) for 1 h at 37C After further washing, the cells were examined by UV microscopy. Sf9 cells were grown in suspension at 27 C in Sf 900 II SFM media (Gibco/Invitrogen Corporation) and infected at a multiplicity of infe ction of five plaque -forming units per cell. Resultant HBoV virus -like particles (VLPs) were released from infected cells by three cycles of freeze thaws in lysis buffer (50 mM Tris HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.2% Triton X 100), with the addition of benzonase (Merck KGaA) after the second cycle. The sample was clarifi ed by centrifugation at 12,100 x g for 15 min at 4 C The cell lysate was pelleted through a 20% (w/v) sucrose cushion (in 25 mM Tris HCl pH 8.0, 100 mM NaCl, 0.2% Triton X 100, 1 mM EDTA) by ultracentrifugation at 149,000 x g for 3 h at 4 C The pellet from the cushion was resuspended in the same buffer overnight at 4 subjected to multiple low -speed spins at 10, 000 x g in order to remove insoluble material. The cla rified sample was purified by separation within a 10 40 % (w/v ) sucrose -step gradient spun at 151,000 x g for 3 h at 4 C E quilibrium dialysis was performed against 20 mM Tris HCl pH 7.5, 150 mM NaCl, 2 mM MgCl2 at 4 C The final concentration of the sam ple was 10 mg mL1 calculated from optical density measurements at 280 nm with an extinction coefficient of 1.7 M1 cm1. The purity and integrity of the viral capsids were monitored by SDS -PAGE and negative stain electron microscopy, respectively. Negati ve Stain Transmission Electron M icroscopy Small (3.5 L ) aliquots of purified VLP s (~5 mg m L1) were applied to a continuous carbon support film that had been glow -discharged for 15 s in an Emitech K350 glow discharge unit and subsequently stained with 1% aqueous uranyl acetate. Micrographs were recorded on a

PAGE 138

138 2k x 2k Gatan CCD camera in an FEI Sphera microscope at a nominal magnification of 40,000 x at an accelerating voltage of 200 keV. CryoEM and Image R econstruction Small (3.5 L) aliquots of purified VLPs (~10 mg mL 1) were vitrified via standard rapid freeze -plunging procedures ( Adrian et al., 1984; Dubochet et al., 1988). Samples were applied to Quantifoil holey grids that had been glow -discharged for ~15 s in an Emitech K350 glow discharge unit. Gri ds were then blotted for ~5 s, plunged into liquid ethane, and transferred into a pre cooled FEI Polara multi -specimen holder, which maintained the specimen at liquid nitrogen temperature. Micrographs were recorded on Kodak SO 163 electronimage film at 20 0 keV in a FEI Polara microscope under minimal -dose conditions (~9 e/2) at a nominal magnification of 39,000 x. Sixteen micrographs exhibiting minimal astigmatism and specimen drift, recorded at underfocus settings ranging between 0.95 and 3.25 m, were digitized at 7 m intervals (representing 1.795 pi xels) on a Zeiss SCAI scanner. The software package RobEM (http://cryoEM.ucsd.edu/programs.shtm ) was used to extract 3,754 individual particle images (each 1 872 pixels), pre process the images, and estimate the defocus level of each micrograph (Baker et al., 1999). The random -model procedure (Yan, Dryden, et al., 2007) was used to generate an initial reconstruction at ~ 25 resolutions from 150 partic le images. This was then used as a starting model to initiate full orientation and origin determinations and refinement of the entire set of images using AUTO3DEM (Yan, Sinkovits, et al., 2007). Corrections to compensate for the effects of phase reversals in the contrast transfer functions of the images were performed as previously described ( Zhang et al., 2003; Bowman et al., 2002), but amplitude corrections were not applied. A final 3D map at an estimated resolution limit of 7.9 based on the 0.5 thresh old of the Fourier Shell Co rrelation (FSC0.5) criterion (van Heel and

PAGE 139

139 Schatz, 2005) (data not shown), was reconstru cted from all particle images. To verify the new structure, we computed two, completely independent, ab initio reconstructions from separate sets of micrographs consisting of 1770 and 1839 particle images. The resultant reconstructions showed excellent correspondence in all coarse and fine features as evidenced by good agreement (FSC0.5) at all spatial frequencies o ut to 1/9.8 1. An inverse t emperature factor of 1/100 2 was applied to the final 3D reconstruction (Havelka et al., 1995) to enhance fine details and to aid in the analysis and interpre tation of the capsid structure. A Gaussian function was applied to attenuate the Fourier data smo othly to zero between 7.24 and 6.75 The absolute handedness of the reconstruction was set to be consistent with surface features seen in parvovirus crystal structures (see below). Generation of Density Maps for Representative Members of t he Parvoviridae Genera Density maps were generated from the crystal structure C coordinates of AAV2 (PDB accession No. 1LP3 (Xie et al., 2002 )), B19 (PDB accession No. 1S58 (Kaufmann et al., 2004 )), GmDNV (PDB accession No. 1DNV (Simpson et al., 1998)), and MVM (PDB ac cession No. 1Z1C (Kontou et al., 2005)), and from the C pseudo atomic model of AMDV (McKenna et al., 1999). The coordinates for each VP2 subunit were used to generate a complete icosahedral capsid using the Oligomer generator in VIPERdb (Carrillo Tripp et al., 2009). The CCP4 software suite was used to calculate structure factors (7.9 resolution cutoff, B -factor =100 2) and electron density maps, using the SFALL and FFT routines, respectively (The CCP4 suite: programs for protein crystallography, 1994 ). The calculated maps were rendered with RobEM (http://cryoEM.ucsd.edu/programs.shtm ) and Chimera (Pettersen et al., 2004).

PAGE 140

140 Sequence Analysis and Generation o f Unrooted Phylogenic Tree VP2 sequences of r epresentative members of the six Parvoviridae genera (taken from the PDB accession files listed above ), AMDV (NCBI accession No. ABG20974), and HBoV (NCBI accession number ABN46897) were uploaded to the Bio logy Workbench (Subramaniam, 1998). A multiple seq uence alignment was conducted using ClustalW (Thompson et al., 1994) with default values and with B19 as the reference sequence. An unrooted phylogenetic tree was then created using the PHYLIP algorithm (Felsenstein, 1989). Generation and Docking of a Homo logy Model of H BoV VP 2 i nto Cryo Reconstructed Density A homology model was built for the HBoV VP2 (amino acids 37542) using the Swiss PDBviewer Deep View 3.7 software program (Guex and Peitsch, 1997), using the VP2 sequence (NCBI accession No. ABN46897) and the B19 VP2 coordinates (PDB accession No. 1S58) supplied as a template. B19 VP2 was chosen as a template for building the HBoV VP2 pseudoa tomic model because the comparison of density maps generated for the members of the different Parvoviri dae genera (see above) identified B19 as being the most structurally similar to HBoV even though the AAV2 VP2 sequence had a slightly higher sequence ide ntity The HBoV VP2 homology model was used to generate the coordinates for a complete 60 subunit capsid through icosahedral matrix multiplication in VIPERdb (Carrillo Tripp et al., 2009). The 60 -mer was then visualized within the HBoV cryoE M density map in COOT (Emsley and Cowtan, 2004). The core -strands B A regions fitted into density contoured at a 3.3 thresh old without further adjustment. -strands -strands H and I (HI loop) of a reference VP2 monomer were manually adjusted to fit into density contoured at a threshold of 1.0 structural features The remaining surface loops were adjusted to be within the reconstructed

PAGE 141

141 envelope at a density threshold of 0.5 del building included addition of amino acids at the N terminus of the VP2 monomer (residues 28 36) to satisfy density ( 0.5 inside the capsid under t he icosahedral five -fold axes. Following these adjustments the geometry of the model was regu larized under idealized geometric constraints in COOT The NCS function in COOT was used to generate the remaining 59 icosahedral symmetry related VP2 monomers to verify their fit within the cryo EM density map. The pseudoatomic capsid model coordinates w ere used to generate a density map for comparison with the HBoV cryoEM density in MAPMAN ( Kleywegt and Jones, 1996) using the programs similar ity function (http://xray.bmc.uu.se/usf/mapman_man.html ). Comparison of Parvovirus VP2 S tructures The structures of VP2 from representative members of six Parvoviridae genera (Table A 1) were al igned by superposition of th positions of their atomic coordinates (AAV2, B19, GmDNV, and MVM) or pseudo atomic coordinates built into cryo reconstructed densities (AMDV and HBoV) using the MatcherMaker Tool (Meng et al., 2006) in Chimera. R esults and Discussion HBoV Capsid S tructure Self assembled VP2 VLPs expressed and purified from insect cells were checked for composition and purity by SDS -PAGE ( Figure A 1A ), and fo r integrity by negative -stain electron microscopy ( Figure A 1B ) prior to sample vitrification and cryoEM (Figure A 1 C). A 3D reconstruction of the HBoV capsid, at an estimated resolution limit of 7.9 was computed from 3,754 individual particle images ( Figure A 2) and compared to the capsid structures of representative members of the Parvovirinae (B19, AAV2, AMDV, MVM) and Densovirinae (GmDNV) subfamilies (Figure A 3).

PAGE 142

142 The HBoV capsid exhibits three characteristic features common to other vertebrate pa rvoviruses. The first of the se is a dimple -like depression at each icosahedral two -fold axis (dimple) (Figures A 2A and A 3). The second is a large, trimeric protrusion that surrounds each three-fold axis or is located at the three -fold axis (protrusion) (Figures A 2A and A 3). The third is a channel at each five -fold axis ( channel), whose outermost opening is formed by a small, pentameric structure encircled by a wide, canyon -like region (canyon) (Figures A 2A and A 3). While the dimple is also obs erved among the invertebrate parvoviruses, these members lack the three -fold protrusions and canyon around the five -fold channel (e.g. GmDNV in Figure A 3). The external diameter of the HBoV capsid ranges from ~215 at the lowest points of the dimple and canyon to ~280 at the top of the protrusion. For comparison, the maximum diameters of AMDV and GmDNV (the largest and smallest capsids of the representative parvoviruses being compared) are 310 and 270 respectively, and the minimum diameter calculated from the capsid density maps generated from the atomic or pseudoatomic coordinates of all the viruses being compared is ~220 (F igure A 3). The spherical, relatively smooth topology of the invertebrate GmDNV clearly distinguishes it from the others, especially those with more prominent surface feature s such as AMDV, MVM, and AAV2. HBoV appears to be morphologically most similar to B19 since both display features intermediate to the above extremes. Radial density projections of the six representative Parv oviridae capsids reveal that structural similarity among them is greatest at low radii and most diver gent at the capsid surface (Figure A 4). Of note, all the vertebrate parvoviruses have strikingly similar structures at radii <

PAGE 143

143 98 sugges ting they share a common core. Again, GmDNV stands out among the parvoviruses as having a structure that is most distinct from the others at all radii. Pseudo Atomic Model of HBoV VP2 Built Based on the B19 VP2 Crystal S tructure The HBoV capsid surface topology was obs erved to be most similar to B19 (Figure A 3), even though t he AAV2 VP2 protein sequence is closer to that of HBoV in percentage identity (Table A 2). Preliminary docking of the crystal structure of the VP2 subunit for both AAV2 and B19 into the HBoV cryor econstruction showed that the barrel and -A helix in both viruses fitted into the HBoV density (with a MAPMAN correlation coefficient of 0.6 but for AAV2, the loop regions that form each protrusion extended outside the HBoV envelope (not shown) consist ent with HBOVs smoother surface features (Figure A 3) Thus, the B19 crystal structure coordinates (VP2 residues 19 554) were used to construct the initial homology model of HBoV VP2 (residues 37 542) for docking in to the cryo -EM density map (Figure A -5A and A 5 B). A map of HBoV at sub-nanometer resolution enabled precise, rigid -body fitting of the conserved secondary structural elements ( -barrel core and -A helix) as well as the DE and HI loops, which required only small manual adjustments followed by bond geometry refinement (Figure A 5B D). The remaining inter -strand loops and the C terminus of the VP2, including variable regions (VRs as defined in (Govindasamy et al., 2006)), were adjusted to conform to the HBoV density envelope (Fig. 5A and B) The initial homology mode l of HBoV started at residue 37 which corresponds to B19 residue 19, the first N terminal residue reported in the crystal structure (Kaufmann et a l., 2004). However, a clearly defined region of density at the base of the channel adjacent to residue 37 of the initial HBoV model remained un interpreted following the fitting proced ure. This density (denoted by an asterisk in Figure A 2C and A 2 D ) was modeled as residues 28 36 contri buted by five VP2 monomers (Figure A 5E). These nine

PAGE 144

144 residues were modeled as a small loop that projects into the additional density and extends towards the channel as seen in B19 and MVM (Agbandje -McKenna et al., 1998; Kaufmann et al., 2008) (dark blue loop in Figure A 5A and A 5 E ). This interpretation positions residue 28 of the HBoV model towards the remaining un interpreted density that lies close to the entrance of the channel and appears to form a plug like st ructure inside the capsid (black arrow in Figure A 2C and A 5E). The correlation coefficient between the map of the 60-subunit capsid (gener ated from the final HBoV VP2 pseudoatomic model, residues 28542) and the cryo-EM density map is 0.70. A similar plug at the base of the five -fold channel was also observed in the cryo reconstruction of B19 VLPs comprised solely of VP2 (Kaufmann et al., 2008). This plug appeared as negative difference density when the B19 VLP cryoreconstruction was subtracted from reconstructions of wild-type ful l (VP1, VP2, and DNA) and empty (VP1 and VP2) B19 capsid structures (Kaufmann et al., 2008 ). The location of the first ordered N ter minal residue in the B19 VP2 VLP crystal structure (starting with residue 18) overlapped this negative density, suggesting that the remaining, un-ordered residues lie inside the VLP capsid (Kaufmann et al., 2008). In the B19 report no effort was made to mode l the missing residues into the negative difference density. However, positive difference density was observed in the B19 full and empty capsid minus VLP density map subtraction, projecting into the channel towards the caps id surface, emerging between the DE loop ribbons onto the canyon at the capsid surface. This density was modeled as B19 VP2 residues 1 17 (Kaufmann et al., 2008). The diff erences in locations of the N terminal residues in B19 VLPs versus capsids with or without DNA and VP1 are likely dictated by the p resence of the DNA and/or VP1. The VP1u motif was not observed in B19 capsids (Kaufmann t al., 2008) most likely because only a few copies are present per

PAGE 145

145 particle, and their contributions to the density map would be averaged out by the icosahedral symmetry imposed during structure determin ation. The B19 channel appears to be closed or tightly constricted at the capsid surface (Figure A 3) (Kaufmann et al., 2008; Kaufmann et al., 2004). Thus, disposition of the N terminal residues of the B19 capsid proteins on the outer surface is consistent with previous reports that placed VP1u o n the B19 surface (Anderson et a l., 1995; Kajigaya et al., 1991; Kawase et al., 1995), which differs from other parvoviruses in which externalization is proposed to occur via the channel. In HBoV the channel is constricted at its b ase but open at the top (Figure A 2C and A D, and Figure A 3). Thus, it is difficult to assess whether the HBoV VP2 and/or VP1 N termini are also already located on the capsid surfa ce. Our current model of HB oV sugges ts the N -terminal residues (Figure A 5E) may protrude out through the channel in vi rions. Struc tural studies of capsids that contain VP1 or both VP1 and DNA are needed to verify this prediction HBoV VP2 Shares Low Sequence Identity but High Structural Similarity t o Other Parvovirin ae VP 2s Sequence alignments and a n unrooted phylogenetic tree were generated to quantitatively compare the HBoV VP2 sequence with the corresponding VP sequences in five other parvovirus genera (Table A 1) and to help guide homology modeling based on the HBoV cryoEM density map. The pairwise sequence ide ntities ranged bet ween 12 and 23%, with GmDNV, the sole invertebrate member in the comparison, being the most divergent from HBoV (Table A 2). Phylogenetic analysis based on a multiple sequence alignment of the six viruses being compared placed them almost equidistant from each other in an un rooted tree (data not show n) suggesting high divergence. pseudo atomic (AMDV) coordinates of the Parvovirinae VP2s with the pseudoatomic model

PAGE 146

146 generated for HBoV (residues 28 542) showed that, de spite the high (~50 %) sequence variability, the eight -stranded barrel (BIDG -CHEF) core and A helix are con served in all the viruses (Figure A 6A ). The most VRs in the VP2 structures of the Parvovirinae bei ng compared to HBoV are loca -strands and most occ ur at and around the three -fold axis (Chapman and Agbandje -McKenna, 2006). In the HBoV pseudoatomic model, the VRs in the loops are also predicted to be located around this axis (Figure A 5A). However, at the current resolution of the HBoV density map, the exact positions of the loop structures are unknown and thus preclude a comparison with those of the other viruses. As with the Parvovirinae members the core -strands are structurally very similar between HBoV and GmDNV, though the exact position of A differs slightly (Figure A 6A ). HBoV Capsid Surface Topology is Unique, but Shares Features Common t o Other Vertebrate Parvoviruses Based on the overall surf ace morphologies of their capsids, parvoviruses have been structurally assigned to three groups (Padron et al., 2005). Groups I and III comprise members of the Parvovirinae subfamily, all of which share three features as described earlier: dimples at two -fold axes, protrusions at or surrounding three -fold axes, and channels surrounded by canyons at the five -fold axes (Figure A 3). The primary diffe rence between these two groups occurs in the vicinity of each three -fold axis. Group I capsids have a single, relatively flat, pinwheel -shaped protrusion, whereas group III capsids have three distinct protrusions Current structural data place members of the Parvovirus genus in group I and members of the Dependovirus Amdovirus and Erythrovirus genera in group III (Table A 1, (Padron et a l., 2005)). A third topology (group II), seen in GmDNV and other members of the Densovirinae subfamily (Bruemmer et al., 2005; Simpson et al., 1998), is characterized by capsids which are relatively spherical and featureless compared to the vertebrate parvoviruses (Table 1, (Padron et

PAGE 147

147 al., 2005)). This morphology, exemplified by GmDNV, results from the reduced length of the surface loops compared to members of the other parvovirus genera (Simpson et al., 1998). HBoV possesses features common to groups I and III and also others that are unique. One distinguishing feature in HBoV aris es from a difference in surface topology at the two -fold axis, where the HBoV dimple is narrower and shallower than that in the other parvoviruses (Figure A 3). However, like B19, the HBoV dimple is flan ked by wider walls between the two and five fold depressions compared to the other viruses which may be due a conformational loop difference in modeled VR IX located close to the two -fold axis (Figure A 5A ). Residues that form the walls of the parvovirus dimple have been implicated in receptor attachment for MVM -Bueno et al., 2006) and as determinants of tissue tropism and pathogenicity for other members of the parvovirus genus (reviewed in (Kontou et al., 2005)). There is no evidence however that this region plays an analogous role in B19 or HBoV Other characteristic parvovirus features at the two -fold region are conserved in HBoV. Helix A, observed in all parvovirus structures determined to date (reviewed in (Chapman and Agbandje McKenna, 2006 )), is also present in HBoV (Fi gure A 5C and A 6A ). This helix forms stabilizing interactions at the icosahedral two -fold interface (Govindasamy et al., 2006). Even tho ugh there are fewer interactions at the two -fold interface compared to those at the three-fold interface, they are proposed to play a crucial role in parvovirus capsid assembly (Govindasamy et al., 2006; Wu et al., 2000). Conservation of this structural feature in the HBoV VP2 thus suggests that it plays a similar, central role i n capsid assembly. HBoV topology at the three -fold axis is intermediate between that of groups I and III. AAV2 and AMDV, group III viruses, have large protrusions that arise from the loops. The protrusions in HBoV are less pronounced than those of the group III parvoviruses

PAGE 148

148 loops. T his results in a less pronounced depression in this region (Figure A -3). MVM and AMDV group I viruses, also lack depressions at their three -fold axes (Figure A 3 ). Residues near the three -fold axes in AAV2 and B19 ha ve been implicated as receptor attachment sites (Chipman et al. 1996; Kern et al., 2003; Levy et al., 2009; O'Donnell et al., 2009, Opie et al., 2003). The protrusions surrounding this axis are responsible for the antigenic reactivity of members of the Parvovirinae subfamily (reviewed in (Agbandje -McKenna and Chapman, 2006)). Given this antigenic role of the group I and III surface protrusions, the lack of similar structures in group II viruses is consistent with the fact that invertebrate viruses are not subject to adaptive pressures of the host immune response (Simpson et al., 1998). As mentioned above, the capsid structures of members of the Parvovirinae have a conserved channel at the icosahedral five-fold ax is, surrounded by a canyon (Figure A 3). The channel is a -cylinder formed by five symmetry related ribbons inserted between -strands D and E with a loop at the top (referred to as the DE loop). In HBoV the DE loops form finger -like protrusions that surr ound the channel (Figures A 5 A, A 5 D and A 6B ) and proj ect away from the five -fold axis in a manner similar to the conform ation observed in AAV2, re sulting in an open channel (Figure A 3). In contrast, for the other Parvovirinae structures the DE loops cluster nearer the five -fold axis and constrict the chann el (Figure A 3 and A 6B). This channel in parvoviruses is postulated to serve several functions such as the site of (a) VP2 externalization in members of the parvovirus genus (e.g. MVM, in which VP3 is generated by a maturation cleavage event), (b) VP1u ex ternalization (except in B19 and GmDNV) for its PLA2 function, and (c) genomic DNA packaging However, because the diameter of the channel varies between ~5 and 25 at its narrowest and widest points, respectively, this is likely too small to

PAGE 149

149 accommodate extrusion of th e ~130aa in the PLA2 domain. It has thus been proposed that flexibility and structural re arrangement of the DE loop (and possibly the HI loop, see below) are required to facilitate these functions. Conservation of this channel in HBoV sugge sts that it p erforms analogous functions. Notably, HBoV appears to have the largest surface opening of the parvovirus str uctures determined to date (Figure A 3). The canyon depression in HBoV is less pronounced compared to that seen in all other parvovirus structures except for GmDNV which lacks that feature (Figure A 3). In HBoV the HI loop lies in the canyon and is structurally most similar to the HI loop of AAV2, and although shorter in HBoV, generates a similar surface topology for th e two viruses (Fi gure A 3 (red loop features on the canyon floor), Figure A 5D, and A 6B ). The HI loop conformation differs significantly in B19 because it projects radially from the capsid surface and lies very close to the DE loop to form a continuous, ra ised surface in the canyon (Figure A 3). This B19 HI loop conformation is similar to that proposed to occur in AAV2 following receptor attachment (Le vy et al., 2009). The HI loops in MVM and AMDV, which also lie on the canyon floor, are structurally similar to each other but differ from HBoV (Figure A 6B). In GmDNV the HI loop lies very clo se to the DE loop and together they fill in the canyon floo r (Fig. 3 and 6B ). The HI loop which has been proposed to undergo structural re arrangements in AAV2 to facilitate VP1 externalization upon receptor binding has also been reported to play a role in capsid assembly (DiPrimio et al., 2008; Levy et al., 2009). S ummary The structure of the HBoV capsid presented here represents the fi rst for a member of the newly established Bocavirus genus of the Parvoviridae The sub -nanometer resolution obtained in the cryo reconstruction clearly reveals that the newly identified HBoV assembles a capsid that retains the highly conserved structural c ore adopted by all other parvoviruses, and does so

PAGE 150

150 despite low sequence similarity between its major capsid protein and those of the other viruses which have existed for many years. Conserv ation of core structural features in the major coat protein, including the eight -stranded barrel, the A helix, the DE loop, and the HI lo op, is consistent with their contributing essential functions in capsid assembly and stability. Conservation of the -cylinder channel formed by the DE loop strongly suggests that this channel is essentia l for productive HBoV infection as it likely serves as a portal for VP1u externalization and DNA packaging as reported for other parvoviruses Overall, HBoV shares most of its capsid surface features with the two other human parvoviruses (B19 and AAV2) i n this comparative study, and these result in a unique capsid morphology whose functional domains are yet to be verified. The resemblance of B19 and AAV2 capsids at the three -fold axes suggests that this region confers similar, receptor attachment capabili ty. On the other hand, the structural difference of the HBoV five -fold axis from B19 (reported to have its VP1/VP2 localized on the capsid surface) and its similarity to AAV2 (proposed to externalize its VP1u for its PLA2 function via the channel) suggests that the HBoV capsid is required to undergo similar conformational transitions as AAV2 during cellular trafficking. Variable HBoV VP2 surface loops as built in the pseudoatomic model based on known parvovirus structures (Chapman and Agbandje -McKenna, 2006) and constrained by the reconstructed density envelope, likely reflect a daptations related to host cell recognition and evasion of the adaptive immune response. Significantly, the structure of HBoV provides an additional framework for the molecular annotation of parvovirus VP structures, which have evolved to facilitate infect ivity through the utilization of structural elements and capsid surface features that fulfill myriad functions.

PAGE 151

151 Table A 1. Selected properties of representative members of Parvoviridae Genus Members Number of VPs Group Major VP Subfamily Parvovirina e vertebrate hosts Parvovirus MVM*, CPV*, FPV* 3 I VP2 Erythrovirus B19*, SPV 2 III VP2 Dependovirus AAV2*, AAV4*, GPV 3 III VP3 Amdovirus AMDV 2 III VP2 Bocavirus HBoV, BPV, CnMV 2 III VP2 Subfamily Densovirinae invertebrate hos ts Densovir u s GmDNV*, JcDNV 4 II VP4 Iteravirus BmDNV 4 6 II VP1 4 Brevidensovirus AaeDNV, AalDNV 2 or 3 n/a VP1 or 2/3 Pefudensovirus PfDNV 5 n/a VP1 *Denotes structures determined by X ray crystallography, Denotes structures determine d by cryo -EM, (n/a) denotes structural group not assigned Table A 2 Sequence alignment statistics for representative members with structural data S equence % I dentity % S trong similarity % W eak similarity % D ifferent AAV2 23 17 14 46 B19 19 17 14 50 MVM 16 17 16 51 AMDV 14 17 13 56 GmDNV 12 13 11 64 *Percentage identity, similarity, and difference are as defined in Thompson et al., 1994.

PAGE 152

152 Figure A 1. Characteriza tion of recombinant HBoV VLPs. A) 10% SDS -PAGE of HBoV VLPs (right lane) and mol ecular mass marker (left lane), showing that VLPs con sist solely of VP2 (~61 kDa). B) Micrograph of negatively stained VLPs shows that most capsids exhibit a circular profile and fill with stain, consistent with them b eing empty, spherical shells. C) Micro graph of unstained, vitrified VLP sample highlights that these HBoV particles are intact, empty, and spherical.

PAGE 153

153 Figure A 2. HBoV cryo -reconstruction. A) Stereo, shaded -surface representation of the entire capsid viewed along a two -fold direction. The black equilateral triangle bounded by two three -fold (3) axes (separated by a two -fold (2) axis) and a five -fold (5) axis identifies one asymmetric uni t of the icosahedral capsid. B) Stereo, half particle image of (A) sectioned at the center and generated as a perspective view. C ) Central cross -section of the reconstructed map, with highest and lowest density features depicted in black and white, respectively. Arrows highlight the two (2), three (3), and five -fold (5) axes that lie in the plane of the cr oss-section in one quadrant. Density plugging the five -fold channel at low radii is indicated by th e short, black arrow for one channel. D ) Enlarged vie w of upper left quadrant from (C ) with circles drawn at radii corresponding to the radial d ensity pro jections shown in Figure A 4.

PAGE 154

154 Figure A 3. Comparison of six representative parvovirus capsid structures. Stereo, radially color cued, surface representation of HBoV cryo reconstruction shown with corresponding two -fold views of B19, AAV2, AMDV, MVM, and GmDNV highlight similarities and differences in the outer surfaces of the capsids. Density maps of the latter five virus capsids were computed from atomic (B19, AAV2, MVM, and GmDNV) or pseudo atomic (AMDV) coordinates and all rendered at the same res olut ion (7.9 )

PAGE 155

155 and magnification. Vertical bar depicts color cueing as a function of particle radius in Figure A 4. Radial density projections of si x representative parvoviruses. The virus labels are as defined in Table 1. Density distributi ons at d ifferent radii (see Figure A 2D) illustrate similarities (inside) and differences (towards the outside) among the virus capsids. Contrast same as that de picted in Figure A 2C

PAGE 156

156 Figure A 5. Pseudoatomic model of HBoV VP2. A) A C trace o f the VP2 pseudoatomic model. Labels highlight the -strands regions (BIDG CHEF) that form the core barrel, the helix A ( -A), the DE and HI loops, and the nine variable surface regions (VR 1 to VR -IX). The approximate two three and five -fold axis are shown by the numbers 2, 3, and 5, respectively. The dark blue, N terminal portion of the model represents nine residues that were not included in the initial HBoV homology model, but that can be fit into the HBoV cryo -reconstruction. B) An eq uatorial slab of pseudo atomic HBoV VP2 monomers docked into the reconstructed density map. Several icosahedral symm etry axes are labeled as in Figure A 2B. Regions outlined in red are enlarged in subsequent panels to further emphasize the fit of the mod e l. C) Stereo view of a small portion of the VP2 model (in red) showing the structurally conserved, barrel core ( -st rands A, B, I, D and G) and -A helix modeled into the reconstructed density (grey mesh, contoured at a threshold of 3.3 D) Same as (C) for a view of the region of the capsid near the five -fold axis, showing the fit of five, symmetry related, DE loop ribbon models that form the cylindrical channel and the fit of five HI loops that form the petal -like structures on the canyon floor. The five VP2 monomer s are distinguished by color. E, left) Same as (D) but for a view from inside the capsid that highlights the channel plug. Residues 2836 in the HBoV VP2 model are colored blue. E, right) Same as (E, left) but viewed from the side to sho w the model of one monomer and the DE loops of four symmetryrelated monomers at the pore of the five -fold channel. N -terminal residues 28 36 (in blue) were modeled as extending up into the five -fold channel. Color scheme same as in (D).

PAGE 157

157 Figure A 5. Cont inued

PAGE 158

158 Figure A 6. Superposition of VP2 structures from six representative members of the Parvoviridae The orientation of the VP monomer is relative to the exterior and interior of the capsid is indic ated by labels. A ) Enlarged view of the conserved A. Structural elements are labeled as in Figure A 5A. B ) Enlarged view of the HI loops

PAGE 159

159 APPENDIX B MONOCLONAL ANTIBODY AGAINST THE ADENO -ASSOCIATED VIRUS TYP E 8 CAPSID AND THE IDENT IFICATION OF CA PSID DOMAINS INVOLVE D IN THE NEUTRALIZATION OF THE AAV8 INFECTION Introduction As previously mentioned, the AAVs have become a useful tool in gene transfer. Several serotypes have been tested for use as vectors in gene therapy with AAV2 being the best cha racterized and most tested (Rabinowitz et al., 1999; Nicklin et al. 2001; Wu et al., 2000; Bartlett et al., 1998; Fischer et al., 2003; Simonelli et al., 2009; Wobus et al., 2000; Opie et al., 2003; Moskalenko et al., 2000; Flotte 2005). AAV vectors base d on other serotypes show transduction efficiency in various tissues: AAV1 in muscle, pancreatic islets, heart, vascular endothelium, brain and central nervous system (CNS), and liver ; AAV3 in Cochlear inner hair cells; AAV4 in brain; AAV5 in brain and CNS lung, eye, arthritic joints, and liver; AAV6 in muscle, heart, and airway epithelium; AAV7 in muscle ; and AAV8 in muscle, pancreas, heart, and l iver (Jiang et al., 2006). Most vectors are broad in their tropism, but many have specific points of localized infectivity that make them more efficient for one tissue over the other. Interstingly, i.v. and intraperitoneal (i.p.) injection of AAV8 -based vectors have been found to cross the blood vessel barrier and deliver transgene efficiently to striated muscles where as AAVs 1 and 6 have been shown to better deliver loc alized responses (Wang et al., 2003). Also, in studies to identify the best vector for transgene expression in specific tissues the AAV8 serotype repeatedly out transduces other serotype -based vect ors in the mouse liver (Gao et al. 2002; Jiang et al., 2006; Moscioni et al., 2006; Nakai et al., 2005; Davidoff et al., 2005; Sarker et al., 2004; Conlon et al., 2005; Sun et al., 2005). Concordantly, the first study to successfully correct hemophilia A in mice used an AAV8 vector and demonstrated the same phenomenon independent of vector cassette or injection route (Sarkar et al., 2004). Studies comparing AAV2,

PAGE 160

160 6, and 8 vectors in the liver have identified that AAV8 can efficiently transduce liver cells due to rapid uncoating of the viral capsid, thus allowing for a constant presence of ssDNA available for annealing and dsDNA production (Thomas et al., 2004). This phenomenon allows for more than 10% transduction of mouse liver cells compared to AAV2 vecto rs (Thomas et al., 2004). Al t hough AAV2/8 vectors have been successful in the correction or reduction of pathology in many murine disease models, there are many differences noted in the efficiency of treatment and gene expression. One study successfully tr ansduced adult mouse livers resulting in a sustained correction of a metabolic disease, but noted that juvenile livers, still growing, had markedly decreased gene express ion over time (Cunningham et al., 2008, 2009). A follow up study identified that re ad ministration was necessary but difficult due to an anti -capsid humoral condition and further concludes that efficient vector design and re admi nis tration techniques will be n ecessary (Cu n ningham et al., 2009). Although, the fold increase of transformed -he patic cells with AAV8 based vectors seen in the mouse is yet to be repeated in larger animal models (Murphy et al., 2009), recent studies in hemophilia dog models have demonstrated AAVmediated continuous expression of canine factor VIIa (cFVI Ia) (Margarit is et al., 2009). These results provide the first evidence for efficacy and safety of the gene based FVIII/FIX bypassing agent FVIIa for the treatment of hemophilia in a large animal model using rAAV8 vectors (Margaritis et al., 2009). However, a ntibody re sponses to the capsid have been shown to efficiently block gene transfer in l arge animal models (Wang et al., 2010; Davidoff et al., 2005). The same has held true in human patients (Manno et al., 2006; Li et al., 2009). Indeed, lower transgene expression w as primarily linked to AAV -binding antibodies rather than to AAV capsid specific CD8+ T cells (Manno et al., 2006).

PAGE 161

161 Few animal models exist where pre -existing antibody responses can be studied that will relate to the human conditions. Many studies use pas sive immunity models where animals are injected with human -derived immunoglobulin, often termed intravenous immunoglobu lin (IVIG) (Scallan et al., 2006; Wang et al., 2010). Pre -existing immune response studies in mice using AAV2 and 8 vectors indeed suppor t that even non -neutralizing antibodies can have a negative effect on gene transfer stability, as well as an interesting find that mice immunized with AAV8cap vector and subsequently challenged with an AAV2 -gene vector induced cross -reactive antibodies to AAV2, but the converse was not found in the opposite studies (Li et al., 2009). However, when compared to rh32.33 vectors, AAV8 generated a lower immune response to the viral vector allowing for longer sustainment of the transduced gene (Mays and Wilson, 2009). The use of alternate serotypes to bypass pre -exis ting immune responses (Halberd et al., 2006; De et al., 2006; W ang et al., 2005) has drawn much attention as the list of naturally and engineer ed capsids continue to expand (G ao et al., 2004; Koerber e t al., 2008; Excoffon., 2009; Cho i et al., 2005) These new vectors utilize variability among the surface loops as a general means of antibody escape and retargeting. It is a well known fact that the human population already has high neutralizing antibody titers to the more common AAV, serotype 2 (Blacklow et al., 1968, 1971; Chirmule et al., 1999; Erles et al., 1999; C alcedo et al., 2009; Boutin et al., 2010). A more comprehensive study looking at serum samples from around the world, implicated that titers to the non-human primate isolates AAV7 and 8 were relatively low compared to AAV2 and 1, while rh32.33, an engineered vector from primate tissue, was rarely detected (Calcedo et al., 2009). Of note, a more recent study identified that AAV8 seroprevelence was the lowest, less than 40%, when compared to AAV1,2,5,6, and 9 (Boutin et al., 2010). These vectors may therefore be useful in clinical trials with patients who have already been exposed to other

PAGE 162

162 serotypes (Calcedo et al., 2009; Boutin et al., 2010). Ho wever, given that AAV reactive antibodies are present in a la rge portion of the population (Moskalenk o et al., 2000), combined with the fact that a high degree of homology exists among the serotypes, it may become increasing difficult to overcome pre exist ing immunity (Lin and Ertl, 2009). Indeed, it has been noted that patients who have titerable antibodies to AAV1 will generally have antibodies to the rest of the serotypes currently being studied (Dr. Luk Vandenberghe, personal communication). This underl ines the increasing importance of understanding the antigenic nature of the AAV vector in context with the patient response. A better understanding of these regions will aid in engineering or choosing vectors that have specific properties for use with a certain disease or special circumstances that arise among the different patients. This study specifically focuses on identifying regions on the AAV8 capsid surface that are recognized by a monoclonal antibody, ADK8. In order to identify regions involved in t he antigen antibody interaction, 3D reconstructions were generated from cryoEM data of the AAV8:ADK8 complex (see chapter 2). Possible sites of antibody recognition were identified on the capsid surface and mutational analysis was then performed. These vec tors were tested in vivo and in vitro for their inherent ability to evade pre -existing responses while retaining the transduction efficiency previously noted for the first generation AAV8 vector. Materials and Methods Animals, Cell Lines a nd Cell Culture Six -to -nine weeks old, female NMRI mice were used for all experiments. Mice were purchased from Charles River Wiga (Sulzfeld, Germany). Mice were kept according to the guidelines of the German Cancer Research Center. 293T (Pear et al. 1993) HeLa cells (laboratory stock) and HepG2 (Knowles et al., 1980) cells were maintained in Dulbeccos Mo dified Eagles Medium (DMEM) supplemented with 10% heat inactivated fetal -calf serum

PAGE 163

163 and 100 U/ml penicillin and 100 g streptomycin at 37C in 5% CO2. For transfection, a confluency of 70% of 293T cells is needed. For binding assays, a 90 % confluency of H ep G2 cells should be ensured. X63/Ag8 lymphoma cells (kindly provided by P.Krammer, DKFZ) were cultured in RPMI 1640 supplemented with 10% heat inactivated fetal -calf serum, 100 U/ml penicillin, 100 g/ml streptomycin, 2 mM L -Glutamin, 20 mM Hepes pH 7.2, at 37C, 5% CO2. Plasmids and Site -Directed M utagenesis Vector plasmid pTRUF2CMV -Luc is a recombinant AAV2 plasmid expressing a luciferase reporter gene from a cytomegalovirus ( CMV ) promoter and is flanked by inverted terminal repeats (Zolotukhin et al. 1996) proteins. It is based on plasmid pDG but prevents expression of VPs (Grimm et al. 1998) The p5E18-VD2/8 helper construct (Gao et al. 2002) supports the syn thesis of AAV2 Rep proteins (Weger et al. 1997) Both plasmids served as templates for site -directed mutagenesis reactions. Mutagenesis was performed using the QuickChange site directed mutagenesis kit (Stratagene, Amsterdam, The Netherlands) according to the manufacturers manual. For each mutant two complementary PCR prim ers were designed containing the substitution, flanked by 10 to 15 homologous base pairs on each site of the mutation. Three sets of primer were produced and inserted into the cap gene of P5E18-VD2/8: forward primer 5GGAGGCACGACAACTCAGTC GACCCTCTGGGC 3, reverse primer 5GCCCAGAGTCGACTGAGTTGTCGTGCCTCC 3 (455GTANTQ CTTTGAGACGCG 3, reverse primer 5CGCGTCTCAAAGACAAGCGCGGACAACAAC AA TAGC 3 (493TTTGQ GGGGAAACAGGGCTCCTC 3, reverse primer 5GAGGAGCCCTGTTTCCCCGCTGCA AGT TATCTGC 3 (586LQQQNT

PAGE 164

164 CCAAGTGG AACCACCAATACGCAAACTCTTGGGTTTTCTCAGGC 3, reverse primer 5`GCCTG AGAAAACCCAAGAGTTTGCGTATTGGTGGTTCCACTTGG 3 (457QSRLQ TLG 461); forward primer 5CCACCTCCAGCAACAAAACACAGCGGCAGCTACCGC 3, reverse primer 5GCGGTAGCTGCCGCTGTGTTTTGTTGCTGGAGGTTGG3 (585RGNR Q Plasmids and Peptide I nsertions To i nsert a peptide into the AAV8 VPs, a SFII binding site had to be constructed (Muller, Kaul et al. 2003) and a fragment of 743 bp was synthesized (GeneArt, Regensburg, Germany). It was cloned with XcmI 1277 EcoRV 2 020 into the plasmid P5E18-VD2/8. Four peptides were chosen for insertion into the SFII binding site: PSVPRPP, VNSTRLP, GQHPRPG (Ying Y. et al., paper under revision) and ASSLNIA (Yang et al. 2009) The fragments c ontaining the insertion sites were sequenced for verification. Transfection of 293T Cells and Vector Particle P urification A triple transfection was carried out by calcium phosphate precipitation. For each mutant, twenty plates with 5E+6 cells each, were seeded o ut and transfected 24 h later. Per plate, 50 60 g DNA was resuspended in 1.125ml sterile Braun H20, mixed with 125 l CaCl2 (Sigma, St. Louis, USA) and added slowly to 1.25 ml of 2 x HBSS (280 mM NaCl, 50 mM Hepes, 1.5mM Na2HPO4, 10 mM KCL, 12 mM glucose, pH 7.05), shaking constantly. After 1 min of incubation, the mix was added to 7.5 ml medium and append to the cells. After 48 h at 37C, 5% CO2, cells were harvested, washed with PBS, centrifuged at 200x g for 15min and stored at 80C until fu rther purification steps took place.

PAGE 165

165 Purification and Titration of Mutant AAV S tocks 15 ml of a lysis buffer (150 mM NaCl, 50 mM Tris HCl, pH8.5) was added to the cell pellets, followed by 5 rounds of freeze thawing (N2 and 37C) 30 min of Benzonase (50 U per ml) treatment at 37C and 15 min at 3000 x g Via an iodixanol -step gradient ( 40 ml Beckman Quick Seal Tube), AAV particles were purified from the crude cell lysate (Zolotukhin et al. 1999) Sealed gradients were centrifuged at 50,000 x g at 4C for 2 h. Viral particles were aspirated from the 40 % iodixanol phase and deep-frozen at 20C. Quantitation of AAV genomic particles was achieved by quantitative real -time PCR adapted from previously described methods (Veldwijk et al. 2002) After the alkaline lysis of the AAV particles, genomes were subjected to Taqman Universal Master mix including primer (for 5TGCCCAGTACATGAC CTTATGG 3, rev 5GAAATCCCCGTGAGTCAAACC 3), probe (6 -fa m -AGTCATCGC TATTACCATGG MGB) and analysed under standard QR -PCR conditions (Applied Biosystems Inc, Fost er City, USA). Analysis of Viral Protein E xpression Western blot analysis was performed with equal amounts of genome containing particles according to standard methods (Harlow and Lane 1988). Monoclonal antibodies were applied as previously described (Wistuba et al., 1995) Production and Purification of Monoclonal A ntibody ADK8 After fusion (Wobus et a l. 2000) and screening of hybridoma supernatants (Kuck et al. 2007) a monocl onal antibody was identified and its hybridoma cells were cultivated with increasing medium amounts (maximum 1.5 ml) in expanded surface roller bottles (Sigma Aldrich, St. Louis, USA) for 12 days. Cells were centrifuged at 4000 x g, 10min, and supernatant was collected. For preservation, 0.01% thimerosal was added to the supernatant. A monoclonal antibody was purified from the hybridoma supernatant by affinity chromatography using a

PAGE 166

166 protein G sepharose column (GE Healthcare Europe GmbH, Munich, Germany). Hy bridoma culture was filtered through a 0.45m filter and applied onto the column at room temperature overnight. Wash column with PBS and elute the antibody with 10 x 1ml Na azide (0.1 M)/NaCl (0.15 M), pH 4.4. The eluted antibody was neutralized with 5% T ris pH 9.5. The total antibody amount was determined (Nanodrop ND1000, Peqlab Biotechnology, Erlangen, Germany) at an OD of 280nm. Determination of A ntibody I sotypes Subclasses of antibodies were determined by using the Amersham mouse antibody isotyping kit (RPN29, Braunschweig, Germany) according to manufactueres guidelines. AAV Capture ELISA ELISA was carried out using ADK8 (50ng per well) coated flexible microtiter plates (Becton Dickinson, Heidelberg, Germany). Particles of rAAV8 for the standard we re determined by particle calculation of negative staining from 10 randomly taken pictures on an electron microscope. 1E+10 genome containing particles were applied and serial diluted. HRP -labelled (ApD Serotech, Oxford, UK) ADK8 (1g/ml) antibodies were a pplied and analysed by an ELISA reader (Ascent FL, Thermo Labsystems, Egelsbach, Germany). In V itro and In V ivo N eutralization HepG2 cells were seeded out on a 96 -well plate (NuncTM, Rochester, USA) 24 h in advance. Monoclonal antibodies were preincubated with vector particles at 37C for 30 min. Antibody particle mix was added to FCS -free medium of HepG2 cells. After 4 h, medium was aspirated, cells were washed with PBS and DMEM+FCS was added. After 72 h medium was aspirated, cells were washed with PBS on ce again and 1x RLB (Reporter lysis buffer, Promega GmbH, Mannheim, Germany) was applied. Cell extracts were stored at 80C until expression analysis was performed.

PAGE 167

167 Mice were injected intraper itoneal with 50 or 500 g monoclonal antibodies 4 h prior to i ntravenous injection of the viral particles. 1E+11 viral genome containing particles were injected into each mouse. 14 days after injection animals were analysed by the IVIS Imaging software ( Xenogen, Alameda, USA) for 5 min, 10 min after D Luciferin (3 0 mg/ml) (Synchem OHG, Altenburg, Germany) injection. Mice were sacrificed, liver and heart were extracted and a luciferase expression analysis was performed. The amount of protein was determined with a NanoOrange protein quantitation kit (Invitrogen, Karl sruhe, Germany). Binding Analysis by DNA Dot B lot For the DNA binding analysis, HeLa cells were seeded out on 6 -well plates 24 h before infection. Viral particles were pre incubated with 50 g or 250 g of antibody at 37C for 30 min. After inc ubation, vi rus antibody mix was shifted to 4C before being applied onto the cells for 30 min. Cells were washed with medium and either harvested directly or transferred to 37C for 2 h and harvested. Without a temperature shift, cells were centrifuged at 200 x g fo r 10 min and medium aspirated. The latter were centrifuged, medium aspirated, 100 l of pre -warmed trypsin (0.05%) added for 5 min, centrifuged again and medium carefully removed. Pellets were stored at 20C. After Nuclease (1mg/ml) and Proteinase K (10 m g/ml) treatment (Roche, Pensberg, Germany), phenol -chloroform extraction was performed, DNA was spotted onto a nylon membrane (Gene ScreenTM, DuPont Boston, USA)in a dot blot chamber, 10 min denaturated (1.5 M NaCl, 0.5 M NaOH), 10 min neutralized (0.5 M Tris HCL pH 7.0, 0.3 M Tris Sodium -Citrate, 3M NaCl) and by UV -cross -linking at 1200 Joule. A radioactive probe, directed against CMV was produced with standard protocol of the DNA Labeling kit (Roche, Pensberg, Germany) and template DNA was pre -hybridized in 15 ml hybridization buffer (125 mM Na2HPO4, 250 mM NaCL, 1 mMEDTA, 45% formamide, 7% SDS), probe was added and DNA was labelled in a

PAGE 168

168 hybridization oven with rota tion at 42C overnight. Membrane was washed 6 x 5 min with wash buffer I (2 x SSC, 0.1% SDS) at 42C and 3 x 20 min with wash buffer II (0.1 x SSC, 0.1% SDS) at 68 C. Membrane was exposed to an X ray film (Kodak BioMax MS, Sigma, St. Louise, USA). Immune Fluorescence HeLa cells were seeded out on cover slides in 24 -well plates. Viral particles were pre incubated with 0.1 mg antibody ADK8 or IVA7 (own stock) at 37C for 30 min then on ice for 10 min. Virus antibody mix was added to pre -cooled cell slides a nd kept at 4C for 30 min. Cells were wash ed with PBS and directly fixed with ice -cold methanol for 10 min. After fixation, ADK8 hybridoma culture was applied overnight, then washed 3 x 10 min with PBS, kept 1 h at room temperature in the dark after second ary antibody (Dianova GmbH, Hamburg, Germany) goat anti -mouse Alexa Fluor 488, diluted 1:700 in PBS 1% BSA, was applied. Finally cell slides were washed twice with PBS and embedded in Permafluor mounting medium. Examination was carried out with a fluoresce nce microscope (Leica DMRD). Native Dot Blot A ssay V iral genome containing particles per mutant vector were incubated at 37C for 30 min either without or with the monoclonal antibody ADK8 (2 mg/ml), then 10 min on ice. Next, samples were subjected to a te mperature treatment, 37C, 65C, 75C or 99C for 5 min. Samples were spotted on a nitrocellulose membrane ( Schleicher&Schuell, Dassel, Germany) in a dot blot chamber. Membrane was blocked in PBS/10% skimmed milk powder and incubated with A1 antibody, wh ich had been linked to HRP (Zenon labelling Kit, Invitrogen). Particle visualization was performed using an enhanced chemiluminescence detection kit (Perkin Elmer, Boston, USA)

PAGE 169

169 Epitope Mapping See above section in Chapter 2. Results and Discussion Three -Di mensional Reconstruction and Model Docking of the AAV8:ADK8 Complex A total of 982 particles were extracted from 78 CCD images to generate a final 3D map with a resolution of ~18.4 ( Figure B 1 A ). Independent density was present at each three -fold protrus ion, indicating that there was no steric hindrance for the binding of all three protrusions simultaneously, as was seen for a previous reconstruction, AAV2:C37B (Figure 4 2). An entire capsid molecule, or 60 -mer, was generated from the AAV8 atomic coordina tes (PDB 2QA0; N am et al ., 2007) and was docked into the respective capsid density with a corr elation coefficient (cc) of ~0.42. The cc of the fit was most likely low due to the presence of the excess density belonging to the bound Fabs as well as the use of a C 1B ). Since the ADK8 antibody has yet to be sequenced, a model has not been generated. The atomic coordinates for a generic Fab model (PDB 2FBJ; Suh et al., 1986) were then docked into the identified Fab density and a density map wa s generated from this new model ( Figure B 1C). A new cc was calculated (see cha pter 2) and was found to be ~0.68. The correlation was improved when the excess density was filled, but this low correlation is most likely due to the use of C previ ously mentioned, in addition to the use of rigid-body and manual fitting techniques. In this case, these functions do not refine or take possible low -energy conformational movements into account, causing portions of the atomic structures to be outside of t he density in order to better fit more important regions. This is evident from a comparison of the maps used in the determination of the cc between the cryoEM reconstruction a nd the fitted models (Figure B 1D ).

PAGE 170

170 Analysis of the 3D Models Identifies Propos ed Monoclonal Antibody ADK8 Binding Sites on the AAV 8 Capsid Docking atomic models into the cryoEM map allowed for further characterization of the ADK8 binding site on the AAV8 capsid. First glance identifies the Fab binding to the protrusion s at the three -fold axis of symmetry, leaving the two and five -fold axes un-occluded. A more detailed inspection of the docked VP3 capsid monomers identifies VRIV, V, and VIII (Figure 4 3) of the three -fold axes to be prominent in the antibody interaction. A lesser, bu t possible interaction was also noticed at VRVI corresponding to a KDDEE peptide at aa530 534. The symmetry related manner of this region brings VRV into a position to be cradled by VRs IV and VIII from an other symmetry related monomer. These regions wer e also noted in the previously determined reconstructions (Table 4 4). Sequence identification of this region proposes that the peptides GTANTQ (VRIV; aa455 460), TTTGQNNNS (VRV; aa493 501), and LQQQNT (VRVIII; aa586 591) could be involved in the epitope. It is also interesting to note that portions of the peptides from VRIV and V have been identified in studies as being immunogenic in cytotoxic T cell assays, while the peptide identified in VRVIII was found as an epitope in MHC II molecules (Chen et al., 2 006). Indeed, these regions also overlap with the sequence based structural alignment from previously determined reconstructions and show similar patterns. Mainly, the sequences at VRV and VIII both have triplicate repeats of hydrophilic, polar residues, i .e. QQQ (Tab le 4 4). Charact erization of rAAV8 and rAAV2 Capsid Mutants to Elucidate the ADK8 Binding Epitope Many monoclonal ant ibodies, such as B1, A1, A69 and A20, have been well studied and characterized in the past (Wistuba et al. 1995; Wobus et al. 2000) The collection of generated monoclonal antibodies has been rapidly increasing and has greatly contributed to a detailed analysis of AAV2 (Grimm et al., 1999; Kern e t al. 2003) the best studied serotype. The

PAGE 171

171 monoclonal antibody ADK8 is of importance as it could help to further analyz e the rhesus monkey derived AAV8, which is of particular interest to gene therapy (Gao et al. 2002; Wang et al. 2005) To investigate possible binding epitopes of ADK8, we chose to construct mutants with amino acid exchanges of AAV8 towards AAV2 and vice versa. Mutations in the cap gene were chosen according to the aa identified in the previousl y described antibody mapping. However, a homology alignment confirmed that only three of the four optional binding sites are localized in non -homologous region between AAV 2 and AAV8 ( Figure B 2 ). Therefore, binding site KDDEE (aa sequence underlined in gr een) was excluded in the next set of experiments. A reduced VP expression combined with an impaired capsid assembly has been observed for several mutants in previous studies (Bleker et al., 2005) On that account, quantitative real -time PCR and w estern blot analysis was assayed. In two independent productions, rAAV2 and rAAV8 as well as the five mutants had been produced and purified. The results of the quantita tive real time PC R indicate that all mutants, except mutant rAAV8 586LQRGNR591 showed no decrease in capsid assembly ( Figure B 3 A ). The lat ter did show a 20-fold decrease, but VP expression was no t impaired for any mutant ( Figure B 3 B). It is interes ting to note an extra band for the rAAV2 rAAV8 493KTSAD497 mutant and a change in the banding position for all three rAAV2 rAAV8 vectors. It is quite possible that these small changes at the capsid surface cause differences in glycosylation events or a cha nge in the break down pattern of the capsid during denaturing. These results permitted an ADK8 ELISA to parse mutant vectors for their monoclonal antibody binding ability. We decided to use 1E+10 viral genome containing particles to check if the assay coul d be used to detect the amount of mutant capsids. In case of the first set of produced mutants (aa exchanged from rAAV8

PAGE 172

172 capsids of two mutant vectors, rAAV8 493KTSAD497, could be detected in range of rAAV8. Ten -fold more capsids were detected than viral genome containing p articles had been applied ( Figure B 4A ). This finding is conform with the literature, a 10 to 100fold higher amount of capsids is normally found after the purification with a single iodi xanol step gradient (Grimm et al. 1999) In contrast to the previously described mutants, the third mutant vector, rAAV8 with the ADK8 ELISA. It indicates that the binding site 586 591 LQQQNT is of utmost importance in ADK8 binding to rAAV 8. This finding was further substantiated by a second set of produced mutants (aa exchange from rAAV2 rAAV2 ELISA, just like rAAV2, the mutant vector rAAV2 585QQN TA589, was detected (Figure B 4 B). If a seven aa peptide was inserted at position 590 of rAAV8, ADK8 ELISA was not a ble to detect any capsids (Figure B 4 C). The motifs had been chosen either from an AAV2 in vitro and in vivo heart tissue selection (Ying et al. paper under revision) and a muscle -targeting peptide (Yu et al., 2009) Taken together, the experiments could dem onstrate that of all possible binding sites, the position 586591 LQQQNT is directly involved in ADK8 binding to AAV8. Due to a mutation from AAV8 to AAV2 at this position, ADK8 was not able to recognize the AAV8 mutant anymore. Additionally, AAV2 mutated to AAV8 at the given locus, allowed mutant vector capsid detection in the ADK8 ELISA. Insertion of a 7 aa peptide motif in the binding site at aa 590 caused a complete loss of capsid recognition in the ADK8 ELISA. In V itro and In V ivo N eutralization of A AV8 by ADK8 It has been revealed that the seroprevalence of AAV8 is lower than AAV1 and AAV2 in ten different countries on four different continents (Calcedo et al. 2009) Due to the fact that AAV2 d irected antibodies dominate the global seroprevalence, the AAV8 serotype is more

PAGE 173

173 feasible for the avoidance of antibody -mediated AAV vector neutralization in clinical application. To gain insi ght into the basis of neutralization, it is of importance to ch aracterize neutralization competency of t he derived monoclonal antibody ADK8 We decided to investigate if ADK8 impacts transduction efficiency in vitro and in vivo At first, three different vectors, rAAV2, rAAV8 and mutant rAAV2 pre -incubated either without, with 250 ng or 500 ng of monoclonal antibodies (ADK8 or A20). ADK8 was able to decrease transduction efficiency of AAV8 as well as of mutant rAAV2 585QQNTA589 by more than 50 -fold compared to vector transduction without antibody addition (Figure B 5 A ). Furthermore, neutralization was already found if less antibody (250 ng) ADK8 had been applied. However, ADK8 was not able to neutralize AAV2 as this sequence is not identical in AAV2. As a second control, vectors were pre incubated with A20, a monoclonal antibody for AAV2. AAV2 transduction was almost completely neutra lized after A20 preincubation Conversely, A20 did not have any influence on AAV8 transduction, indicating that the sequence responsible for A20 binding to AAV2 is not found in AAV8. This further implies that the A20 epitope is most likely in a variable region where AAV2 and 8 differ. Transduction efficiency for mutant rAAV2 neutralization was also analy zed in vivo Four groups of 4 (6 9 week old, female NMRI) mice were chosen for this experiment. As a control, mice were injected with rAAV8 without any antibodies. The other three groups were i.p. injected with ADK8 (50 g and 250 g ) or with ADK4 (250 g ) and 4 h later with rAAV8. Two weeks later, luciferase expression was measured with an IVIS imaging system. The imaging ascertained that already the amount of 50 g ADK8 was enough to achieve a complete neutralization of rAAV8 vector transduction ( Figure B 5 B).

PAGE 174

174 Without i.p. antibody injection, transduction efficiency had a typical imaging pattern of a hepatotropic AAV vector (Sarkar et al. 2004) The results of the fourth group of mice which had been injected with ADK4, a monoclonal antibody against AAV4 only, clearly demonstrated that a monoclonal antibody has to bind rAAV8 for neutralization. Antibodies present in the mouse system which are not able to bind AAV8, are rapidly cleared from the system and do not impact reporter expression. Results were verified by reporter expression analysis of liver and muscle after dissection of the animals ( Figure B 5 C). As already observed in the imaging, luciferase reporter expression was reduced more than 100 -fold in liver and heart after the 50 g ADK8 i.p. injections. After a 250 g ADK8 i.p. injection, RLU were even below the detection lim it. Injection of ADK4 did not have any impact on luciferase reporter expression. Similar transduction efficiency was confirmed as for rAAV8 transduction without antibody injection. The obtained results are in agreement with the fact that ADK8 is a monoclo nal antibody which neutralizes rAAV8 vector and mutant rAAV2 (with inserted binding epitope of ADK8, 585QQNTA589) transduction in vitro and in vivo Therefore, this monoclonal antibody can be used to elucidate the basis of neutralization of rAAV8. Neutrali zation A nalysis of ADK8 Clear attempts have been made to understand the molecular mechanisms of novel hepatotropic AAVs (Thomas et al. 2004) However, the transduction pathway itself has not been analyzed as a whole yet. ADK8 is k nown to neutralize AAV8 in vitro and in vivo it is of interest to ask if neutralization occurs at cell -surface binding, endosomal release, or uncoating. To identify the point of ADK 8 neutralization, a series of experiments was designed. Binding of AAV8 in presence of ADK8 was analysed by immune fluorescence and DNA dot blot. In the past it has been demonstrated that monoclonal antibodies such as C37B or C24 B (Wobus et al. 2000) prevent AAV2 binding. This does not appear to be the case for ADK8.

PAGE 175

175 Neither in presence of IVA7 nor in presence of ADK8, could a reduction in rAAV8 vector binding to HeLa cells be demonstra ted ( Figure B 6 A), which was also consistent with the DNA dot blot analysis ( Figure B 6 B). The same amounts of vector genomes of bound particles could be identified with and without ADK8 pre incubation. Interestingly, the addition of ADK4 improved rAAV8 v ector binding to the HepG2 cells, but not for rAAV2. To investigate if all bound particles can enter, infected cells were incubated in 0.05% trypsin to deplete defective or un -internalized particles from cell surfaces. For rAAV8 and mutant rAAV2 (with ins erted binding epitope of ADK8, 585QQNTA589), less particles could be detected after trypsin treatment, but not rAAV2. Additionally, pre incubation of ADK8 showed a reduction in detected vector genomes after trypsin treatment. However, spots are very low in contrast and needed confirmation by the analysis of the spots with the plot lane analysis software ImageJ ( Figure B 6 C and D). According to the pixel intensity, AAV2 binding and internalization is not hampered but is even improved by the addition of ADK8 (about 15% increase in pixel intensity). In case of rAAV8 and mutant rAAV2, ADK8 does not impact vector binding, but viral entry. About 15% less viral genomes for AAV8 and the AAV2 mutant could be detected after trypsin treatment. ADK8 pre incubation cause d an additional decrease of detectable viral genomes, the pixel intensity was 20% reduced in these spots compared to vector genomes without previous antibody treatment. It has been observed previously that the A20 antibody has a direct impact on N -terminu s externalization (data not shown). The exposure of the VP1 N termini was conducted by using a monoclonal antibody A1. A1 is known to bind a defined epitope close to the PLA2 domain on the N terminus of VP1 (Wobus et al. 2000) Figure B 7 shows that after the incubation of virions for 5 min at 37C, no reaction upon A1 supernatant application to the nitrocellulose me mbrane

PAGE 176

176 could be detected. Detection was found after 5 min treatment at 65C for rAAV2 and mutant rAAV2, but not for rAAV8. N termini became accessible at this point. At 71C and 99C, signal detection was shown for all analysed vectors after A1 supernatant was applied. Due to the fact HRP recognizes A1 supernatant and ADK8 which is used in the preincubation step, the experiment had to be repeated with purified monoclonal A1 directly coupled to HR -peroxidase. The results were similar, although the N -terminus was already partially accessible for rAAV8 at 65C. If rAAV8 particles were pre incubated with ADK8, the N terminus became even better accessible at 65C. Reduction of detection signal due to ADK8 pre treatment was not obse rved. Taken together, these results indicate, that ADK8 does not influence AAV8 binding to the cell but has a slight impact on endocytosis. Additionally, there is no direct or indirect influence on the N terminus externalization. This may lead to the hypot hesis that ADK8 prevents uncoating and neutralizes reporter expression of vectors below detection limit if antibody binding site is present on the capsids. Impact on rAAV8 vector generation Pre -existing immune reponses have proven to be a challenge in the field of gene therapy Current studies involved in circumventing these responses include shuffling of the cap gene to produce chimeric vector s and generating wildtyp e capsids under immunoselective strain, as well as identifying natural AAVs from other an imal species These methods create highly diversified AAVs with capsids that incorporate different VRs that often mirror those seen in already identified genotypes, yet also yield radically different phenotypes. Preliminary charcterization of many of these vectors have identified poor capsid production, as well as reduced packaging and altered infectivity profiles, which generally leads to a limited number of viable vectors. S tudies aimed at determining functional regions on the capsid surface have identifi ed VRs that are

PAGE 177

177 necessary for structural integrity, receptor binding, infectivity, and antigenicity. All of these types of studies add to the basic biology and further characterization of the capsid surface as human engineering of the c a psid component is only fruitful when applied appropriately in a manner that allows for the generation of vectors that mimic or exceed wt virus production and infectivity values. The knowledge provided in the study pre sented here has identified VRs on the AAV8 capsid surface that are specifically important in antigenicity and thus add to the basic biology of the capsid surface. The VR s identified here will provide a basis where vector development using mutational analysis in these regions may help generate antigenic escape vec tors.

PAGE 178

178 Figure B 1 Three dimensional reconstruction and model fitting for the AAV8:ADK8 complex. A) Final density map for the AAV8:ADK8 structure to ~21. The AAV8 viral surface is colored green while the excess density in white was identified as the Fa b density. B) Fitting of the AAV8 (PDB 2QA0) structure into the respective capsid density. Density map is shown in grey and the atomic coordinates are in green. The excess white space remaining for the Fabs could easily account for the low fitting statisti cs. C) Fitting of both Fab and AAV8 capsid models into the reconstructed density. One Fab portion, modeled in as PDB 2FBJ, is shown in red and is hovering above three symmetry related monomers, colored in green, blue, and magenta, at the three -fold axis of symmetry. D) Visual comparison of the maps used to generate the final correlation of the docked models (green) and the original cryoEM reconstruction (grey). An excess of green density from the fit model map can be seen extending beyond the cryoEM map, indicating regions that would decrease the final corrolation. Black arrows mark example regions of density extension.

PAGE 179

179 Figure B 2 Homology alignment of a portion of the G H loop between AAV2 and AAV8. Amino acid differences are highlighted in blue and sequences of interest are underlined in black. The sequence underlined in green was found to have a possible interaction in the structure analysis, but is obviously conserved among the two viruses, indicating little or no involvement in the epitope. Figu re B 3 Analysis of rAAV2 and rAAV8 mutant vector production. A) A quantitative real time analysis demonstrated viral genome containing particles for all produced mutants above the detection level (detection limit 5E+7Vg/ml). Compared to AAV2 and AAV8, non e of the produced mutants showed a completely diminished packaging capacity. Production of viral genome containing particles was performed twice for each mutant and an average is shown. B) In a western blot analysis, VP protei ns are analyz ed with a monoclonal antibody (B1). VP1, 2 and 3 are marked with arrows, the stoich i ometry of ~1:1:10 is evident.

PAGE 180

180 Figure B 4 Binding ability of rAAV2 and 8 mutant capsids by the ADK8 monoclonal. A ) Shows the reaction of the ADK8 antibody with capsids containing 1E+10 v iral genomes in an AAV8 capsid ELISA. The effects on the mAb ADK8 detection due to the exchanges of aa 455 460 (GTANTQ 497 (TTTGQ KTSAD), aa 586 591 (LQQQNT demonstrated. B) Detection of AAV2 capsid mutants derived from the exchange of aa 457 461 (QSRLG 589 (RGNRQ AAV 2 capsid. C) Seven aa peptide insertion at position 590 into the rAAV8 capsid and disrupt sequence QNTA influence the mAb ADK8 detection. Mean standard deviations from four independent experiments are shown, an asterik indicates mutants for which capsids could not be detected in the ADK8 ELISA (detection limit, 1E+8 capsids/ml)

PAGE 181

181 Figure B 5 in vitro and in vivo neutralization data A) Prior toHepG2 cell infection (MOI 5E+4), viral vectors were pre incubated with different amounts (250 ng and 500 ng) of antibody for 30 min at 37C. After 6 h, viral vector antibody mix was washed off and cells were harvested two days after infection for the determination of reporter gene expression. B) Four hours after i.p. injection of ADK8 (50 g and 250 g) or ADK4, respectively, NMRI mice ( female, 9 weeks old, n= 4) were i.v. injected with 1E+11 viral genome containing rAAV8 vectors. Two weeks after injecti on, mice were injected with D -luciferin, imaged for 5 min (10 min after D -luciferin injection) and sacrificed. C) Transgene expression per mg protein was determined for heart and liver of sacrificed mice with a luciferase reporter assay and NanoOrange. Das hed line indicates the detection limit of the luciferase reporter assay

PAGE 182

182 Figure B 6 Neutralization analysis of the ADK8 mAb. A) Hela cells which had been seeded out on glas slides 24 h earlier, were infected with rAAV8 (MOI 1E+6). After viral vector pr eincubation with or without ADK8 (0.1 mg) for 30 min at 37C,. infected Hela cells were kept at 4C for 30 min. Next, glas slides were washed with PBS, then cells were fixed with ice cold methanol for 10 min and washed with PBS once again. As a negative co ntrol, ADK8 was added to the cells or no virus without antibody preincubation at all was applied. As a positive control, rAAV8 infected Hela cells without ADK8 preincubation or with IVA7 preincubation. After fixation, ADK8 hybridoma supernatant was applie d for 24 h. Three -A488 was added (1:700). After a last washing step, glas slides were embedded in Permafluor. B).Binding analysis was performed by DNA dot blot analysis after infection of HepG2 cells with rAAV8, rAAV 2 and rAAV2 with aa exchanges at position (585RGNRQ (MOI5E+4) were preincubation with ADK8 or ADK4 for 30 min. Then, cells were infected for 30 min and washed with PBS. Cells were either directly harveste d or kept at 37C for 2 h before harvest and trypsin treatment. For all samples, DNA was extracted and transfered to a membrane for radioactive labelling. Positive control is the viral load without cell infection. The dot blot was performed three times. C) Analysis of spots by a plot lane analysis was performed using ImageJ software. Pixel intensity was determined for all spots containing viral genomes of bound vector particles to the cells. D) shows pixel intensities of viral genome containing particles which entered the cells at 37C.

PAGE 183

183 Figure B 6. Continued. Figure B 7 ADK8 and its impact on the N terminus externalization in the post-entry process. AAV8 genome containing particles (1E+9) were incubated with or without ADK8 (1 37C. Thereafter, they were kept at either 37C, 65C, 71 C or 95C for 5 min. Particles or particle ant ibody mixes were spotted onto a nitrocellulose membrane and reacted with A1 hybridoma supernatant or HR peroxidase coupled A1 an tibodies.

PAGE 184

184 LIST OF REFERENCES Aasted, B., Alexandersen, S., and Christensen, J. (1998). Vaccination with Aleutian mink disease parvovirus (AMDV) capsid proteins enhances disease, while vaccina tion with the major non-structural AMDV protein ca uses partial protection from disease. Vaccine 16, 11581165. Aasted, B., Tierney, G. S., and Bloom, M. E. (1984). Analysis of the quantity of antiviral antibodies from mink infected wi th different Aleutian disease virus strains. Scand. J. Immunol 19, 395-402. Adrian, M., Dubochet, J., Lepault, J., and McDo wall, A. W. (1984). Cryo-electron microscopy of viruses. Nature 308, 32-36. Agbandje, M., McKenna, R., Rossmann, M. G., St rassheim, M. L., and Parrish, C. R. (1993). Structure determination of feline panleukopeni a virus empty particle s. Proteins 16, 155171. Agbandje, M., Parrish, C. R., and Rossmann, M. G. (1995). The structure of parvoviruses. Semin Virol 6, 299-309. Agbandje-McKenna, M., Llamas-Saiz, A. L., Wa ng, F., Tattersall, P., and Rossmann, M. G. (1998). Functional implications of the structur e of the murine parvovirus, minute virus of mice. Structure 6, 1369-1381. Akache, B., Grimm, D., Pandey, K., Yant, S. R., Xu, H., and Kay, M. A. (2006). The 37/67kilodalton laminin receptor is a receptor for adeno-associated virus serotypes 8, 2, 3, and 9. J. Virol 80, 9831-9836. Alkan, S. S. (2004). Monoclonal antibodies: the stor y of a discovery that revolutionized science and medicine. Nat Rev Immunol 4, 153-156. Allander, T., Jartti, T., Gupta, S., Niesters, H. G. M., Lehtinen, P., Osterback, R., Vuorinen, T., Waris, M., Bjerkner, A., Tiveljung-Lindell, A., et al. (2007). Huma n bocavirus and acute wheezing in children. Clin. Infect. Dis 44, 904-910. Allander, T., Tammi, M. T., Eriksson, M., Bjer kner, A., Tiveljung-Linde ll, A., and Andersson, B. (2005). Cloning of a human parvovirus by mo lecular screening of respiratory tract samples. Proc. Natl. Acad. Sci. U.S.A 102, 12891-12896. Anderson, S., Momoeda, M., Kawase, M., Kajigaya, S., and Young, N. S. (1995). Peptides derived from the unique region of B19 parvovi rus minor capsid protein elicit neutralizing antibodies in rabbits. Virology 206, 626-632.

PAGE 185

185 Arbetman, A. E., Lochrie, M., Zhou, S., Wellma n, J., Scallan, C., Doroudchi, M. M., Randlev, B., Patarroyo-White, S., Liu, T., Smith, P., et al. (2005). Novel caprine adeno-associated virus (AAV) capsid (AAV-Go.1) is closely rela ted to the primate AAV-5 and has unique tropism and neutralization pr operties. J. Virol 79, 15238-15245. Arnold, J. C., Singh, K. K., Spector, S. A., and Sawyer, M. H. (2006). Human bocavirus: prevalence and clinical spectrum at a child ren's hospital. Clin Infect. Dis 43, 283-288. Arthur, J. L., Higgins, G. D., Davidson, G. P., Givney, R. C., and Ratcli ff, R. M. (2009). A novel bocavirus associated with acute gastroente ritis in Australian children. PLoS Pathog 5, e1000391. Atchison, R. W., Casto, B. C., and Hammon, W. M. (1965). Adenovirus-Associated Defective Virus Particles. Science 149, 754-755. Auricchio, A., Rivera, V. M., Clackson, T., O'Connor, E. E., Maguire, A. M., Tolentino, M. J., Bennett, J., and Wilson, J. M. (2002). Pharm acological regulation of protein expression from adeno-associated viral vectors in the eye. Mol. Ther 6, 238-242. Azzouz, M., and Mazarakis, N. (2004). Non-pr imate EIAV-based lentiviral vectors as gene delivery system for motor neuron di seases. Curr Gene Ther 4, 277-286. Baac, H., Hajs, J. P., Lee, J., Kim, D., Kim, S. J., and Shuler, M. L. (2006). Antibody-based surface plasmon resonance detection of intact viral pathogen. Biotechnol. Bioeng 94, 815-819. Bachmann, M. F., and Zinkernagel, R. M. (1996) The influence of virus structure on antibody responses and virus serotype fo rmation. Immunol. Today 17, 553-558. Bainbridge, J. W. B., Smith, A. J., Barker, S. S., Robbie, S., Henderson, R., Balaggan, K., Viswanathan, A., Holder, G. E., Stockman, A., Tyler, N., et al. (2008). Effect of gene therapy on visual function in Leber's c ongenital amaurosis. N. Engl. J. Med 358, 22312239. Baker, T. S., Olson, N. H., and Fuller, S. D. (1999). Adding the third dimension to virus life cycles: three-dimensional reconstruction of icosahedral viruses from cryo-electron micrographs. Microbiol. Mol. Biol Rev 63, 862-922, table of contents. Barker, D. D., and Berk, A. J. (1987). Adenovi rus proteins from both E1B reading frames are required for transformation of rodent cel ls by viral infection and DNA transfection. Virology 156, 107-121. Bartlett, J. S., Samulski, R. J., and McCown, T. J. (1998). Selective and rapid uptake of adenoassociated virus type 2 in br ain. Hum. Gene Ther 9, 1181-1186.

PAGE 186

186 Bartlett, J. S., Wilcher, R., and Samulski, R. J. (2000). Infectious entry pathway of adenoassociated virus and adeno-associat ed virus vectors. J. Virol 74, 2777-2785. Basak, S., and Turner, H. (1992). Infectious en try pathway for canine parvovirus. Virology 186, 368-376. Bekeredjian, R., Chen, S., Fre nkel, P. A., Grayburn, P. A., and Shohet, R. V. (2003). UltrasoundTargeted Microbubble Destruction Can Repeat edly Direct Highly Specific Plasmid Expression to the Hear t. Circulation 108, 1022-1026. Bessis, N., GarciaCozar, F. J., and Boissier, M. (2004). Immune responses to gene therapy vectors: influence on vector function and effector mechanisms. Gene Ther 11 Suppl 1, S10-17. Blacklow, N. R., Hoggan, M. D., and Rowe, W. P. (1968). Serologic evidence for human infection with adenovirus-associated vi ruses. J. Natl. Cancer Inst 40, 319-327. Blacklow, N. R., Hoggan, M. D., Sereno, M. S., Br andt, C. D., Kim, H. W., Parrott, R. H., and Chanock, R. M. (1971). A seroepidemiologi c study of adenovirus-associated virus infection in infants and children. Am. J. Epidemiol 94, 359-366. Bleker, S., Sonntag, F., and Kleinschmidt, J. A. (2005). Mutational analys is of narrow pores at the fivefold symmetry axes of adeno-associated virus type 2 capsids reveals a dual role in genome packaging and activation of phospho lipase A2 activity. J. Virol 79, 2528-2540. Bloom, M. E., Best, S. M., Hayes, S. F., Wells R. D., Wolfinbarger, J. B., McKenna, R., and Agbandje-McKenna, M. (2001). Identification of aleutian mink disease parvovirus capsid sequences mediating antibody-dependent enhanc ement of infection, virus neutralization, and immune complex formation. J. Virol 75, 11116-11127. Bloom, M. E., Kanno, H., Mori, S., and Wolfi nbarger, J. B. (1994). Aleutian mink disease: puzzles and paradigms. Infect Agents Dis 3, 279-301. Bloom, M. E., Martin, D. A., Oie, K. L., Huht anen, M. E., Costello, F., Wolfinbarger, J. B., Hayes, S. F., and Agbandje-McKenna, M. (1997). Expression of Aleutian mink disease parvovirus capsid proteins in defined segm ents: localization of immunoreactive sites and neutralizing epitopes to specifi c regions. J. Virol 71, 705-714. Bothner, B., Dong, X. F., Bibbs, L., Johnson, J. E., and Siuzdak, G. (1998). Evidence of viral capsid dynamics using limited proteolysis and mass spectrometry. J. Biol. Chem 273, 673-676. Boutin, S., Monteilhet, V., Veron, P., Leborgne, C., Benveniste, O., Montus, M., and Masurier, C. (2010). Prevalence of serum IgG and neut ralizing factors agains t adeno-associated virus types 1, 2, 5, 6, 8 and 9 in the healt hy population: implications for gene therapy using AAV vectors. Huma n Gene Therapy, 100122110120098.

PAGE 187

187 Bowles, D., J.E.R, and Samulski, R. J. (2006). The genus Dependovirus. In Parvoviruses, J. R. Kerr, M. E. Bloom, R. Linden, and C. Parris h, eds. (New York: Oxford University Press Inc.), pp. 15-23. Boxall, A. B. (2004). The environmental side effects of medication. EMBO Rep 5, 1110-1116. Boyce, N. (2001). Trial halted after gene shows up in semen. Nature 414, 677. Bramson, J. L., Graham, F. L., and Gauldie, J. (1995). The use of ade noviral vectors for gene therapy and gene transfer in vivo. Current Opinion in Biotechnology 6, 590-595. Brown, C. S., Jensen, T., Meloe n, R. H., Puijk, W., Sugamura, K ., Sato, H., and Spaan, W. J. (1992). Localization of an immunodominant do main on baculovirus-produced parvovirus B19 capsids: correlation to a major surface region on the native virus particle. J. Virol 66, 6989-6996. Bruemmer, A., Scholari, F., Lopez-Ferber, M., Conway, J. F., and Hewat, E. A. (2005). Structure of an insect parvovirus (Junonia coenia Densovirus) determined by cryo-electron microscopy. J. Mol. Biol 347, 791-801. Buchschacher, G. L. (2001). Introdu ction to retroviruses and retrovir al vectors. Somat. Cell Mol. Genet 26, 1-11. Budker, V., Zhang, G., Danko, I., Williams, P., and Wolff, J. (1998). The efficient expression of intravascularly delivered DNA in rat muscle. Gene Ther 5, 272-276. Burton, D. R., Saphire, E. O., and Parren, P. W. (2001). A model for neutralization of viruses based on antibody coating of the virion surf ace. Curr. Top. Microbiol. Immunol 260, 109143. Burton, D. R. (2002). Antibodies, viruses and vaccines. Nat Rev Immunol 2, 706-713. Calcedo, R., Vandenberghe, L. H., Gao, G., Lin, J., and Wilson, J. M. (2009). Worldwide epidemiology of neutralizing antibodies to ade no-associated viruses. J. Infect. Dis 199, 381-390. Campe, H., Hartberger, C., and Sing, A. (2008) Role of Human Bocavirus infections in outbreaks of gastroenteritis J. Clin. Virol 43, 340-342. Candotti, D., Etiz, N., Parsyan, A., and Allain, J. (2004). Identification an d characterization of persistent human erythrovirus infection in blood donor samples. J. Virol 78, 1216912178.

PAGE 188

188 Carrillo-Tripp, M., Shepherd, C. M., Borelli, I. A., Venkataraman, S., Lander, G., Natarajan, P., Johnson, J. E., Brooks, C. L., and Reddy, V. S. (2009). VIPERdb2: an enhanced and web API enabled relational database for structural virology. Nucleic Acids Res 37, D436-442. Carter, B. J. (2005). Adeno-associ ated virus vectors in clinical trials. Hum. Gene Ther 16, 541550. Cecchini, S., Negrete, A., Virag, T., Graham, B. S., Cohen, J. I., and Kotin, R. M. (2009). Evidence of prior exposure to human bocav irus as determined by a retrospective serological study of 404 serum samples from a dults in the United States. Clin. Vaccine Immunol 16, 597-604. Chacn, P., and Wriggers, W. (2002). Multi-resolu tion contour-based fit ting of macromolecular structures. J. Mol. Biol 317, 375-384. Chang, L. (2009). Immune responses to lentivir al vectors. In Gene Therapy Immunology (New Jersey: Wiley-Blackwell), pp. 85-96. Chang, S. F., Sgro, J. Y., and Parrish, C. R. (1992) Multiple amino acids in the capsid structure of canine parvovirus coordinate ly determine the canine host range and specific antigenic and hemagglutination propert ies. J. Virol 66, 6858-6867. Chao, H., Liu, Y., Rabinowitz, J., Li, C., Samulski R. J., and Walsh, C. E. (2000). Several log increase in therapeutic transg ene delivery by distinct aden o-associated viral serotype vectors. Mol. Ther 2, 619-623. Chapman, M. S., and Agbandje-McKenna, M. (2006). Atomic structures of viral particles. In Parvoviruses, J. R. Kerr, S. F. Cotmore, M. E. Bloom, Linden, R L, and Parrish, C R, eds. (New York, NY: Edward Arnold,Ltd.), pp. 107-123. Chen, C., Jensen, R. L., Schnepp, B. C., Connell, M. J., Shell, R., Sferra, T. J., Bartlett, J. S., Clark, K. R., and Johnson, P. R. (2005). Mol ecular characterization of adeno-associated viruses infecting children. J. Virol 79, 14781-14792. Chen, J., Wu, Q., Yang, P., Hsu, H., and Mountz, J. D. (2006). Determination of specific CD4 and CD8 T cell epitopes after AAV2and AAV8-h F.IX gene therapy. Mol. Ther 13, 260269. Chiorini, J. A., Kim, F., Yang, L., and Kotin, R. M. (1999). Cloning and characterization of adeno-associated virus type 5. J. Virol 73, 1309-1319. Chiorini, J. A., Yang, L., Liu, Y., Safer, B., and Kotin, R. M. (1997). Cloning of adenoassociated virus type 4 (AAV4) and generati on of recombinant AAV4 particles. J. Virol 71, 6823-6833.

PAGE 189

189 Chipman, P. R., Agbandje-McKenna, M., Kajigaya, S., Brown, K. E., Young, N. S., Baker, T. S., and Rossmann, M. G. (1996). Cryo-electron mi croscopy studies of empty capsids of human parvovirus B19 complexed with its cellu lar receptor. Proc. Natl. Acad. Sci. U.S.A 93, 7502-7506. Chirmule, N., Propert, K., Magosin, S., Qian, Y., Qian, R., and Wilson, J. (1999). Immune responses to adenovirus and adeno-associat ed virus in humans. Gene Ther 6, 1574-1583. Choi, V. W., McCarty, D. M., and Samulski, R. J. (2005). AAV hybrid serotypes: improved vectors for gene delivery. Curr Gene Ther 5, 299-310. Chow, B. D. W., and Esper, F. P. (2009). The human bocaviruses: a review and discussion of their role in infection. Clin. Lab. Med 29, 695-713. Cideciyan, A. V., Hauswirth, W. W., Aleman, T. S ., Kaushal, S., Schwartz, S. B., Boye, S. L., Windsor, E. A. M., Conlon, T. J., Sumaroka, A., Roman, A. J., et al. (2009). Vision 1 year after gene therapy for Leber's conge nital amaurosis. N. Engl. J. Med 361, 725-727. Clarke, J. K., McFerran, J. B., McKillop, E. R., and Curran, W. L. (1979). Isolation of an adeno associated virus from sheep. Archives of Virology 60, 171-176. Cockrell, A., and Kafri, T. (2007). Gene delivery by lentivirus vectors. Molecular Biotechnology 36, 184-204. Conlon, T. J., Cossette, T., Erger, K., Choi, Y., Clarke, T., Scott-Jorgensen, M., Song, S., Campbell-Thompson, M., Crawford, J., and Fl otte, T. R. (2005). Efficient hepatic delivery and expression from a recombinant adeno-associated virus 8 pseudotyped alpha1-antitrypsin vector. Mol. Ther 12, 867-875. Cotmore, S. F., D'abramo, A. M., Ticknor, C. M., and Tattersall, P. (1999). Controlled conformational transitions in the MVM vi rion expose the VP1 N-terminus and viral genome without particle disassembly. Virology 254, 169-181. Crick, F. (1970). Central dogma of molecular biology. Nature 227, 561-563. Cunningham, S. C., Dane, A. P., Sp inoulas, A., Logan, G. J., and Alexander, I. E. (2008). Gene delivery to the juvenile mouse liver us ing AAV2/8 vectors. Mol. Ther 16, 1081-1088. Cunningham, S. C., Spinoulas, A., Carpenter, K. H., Wilcken, B., Kuchel, P. W., and Alexander, I. E. (2009). AAV2/8-mediated correction of OT C deficiency is robus t in adult but not neonatal Spf(ash) mice. Mol. Ther 17, 1340-1346. Davidoff, A. M., Gray, J. T., Ng, C. Y. C., Zhang, Y., Zhou, J., Spence, Y., Bakar, Y., and Nathwani, A. C. (2005). Comparison of the ab ility of adeno-associated viral vectors pseudotyped with serotype 2, 5, and 8 capsid prot eins to mediate efficient transduction of the liver in murine and nonhuman pr imate models. Mol. Ther 11, 875-888.

PAGE 190

190 Davidson, B. L., Stein, C. S., Heth, J. A., Martins, I., Kotin, R. M., Derksen, T. A., Zabner, J., Ghodsi, A., and Chiorini, J. A. (2000). Recomb inant adeno-associated virus type 2, 4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system. Proc. Natl. Acad. Sci. U.S.A 97, 3428-3432. Davies, D. R., and Cohen, G. H. (1996). Interacti ons of protein antigens with antibodies. Proc. Natl. Acad. Sci. U.S.A 93, 7-12. Davis, N. L., Willis, L. V., Smith, J. F., and Johnston, R. E. (1989). In vitro synthesis of infectious venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a viable deletion mutant. Virology 171, 189-204. Daya, S., Cortez, N., and Berns, K. I. (2009). Ade no-associated virus site-s pecific integration is mediated by proteins of the nonhomologous end-joining pathway. J. Virol 83, 1165511664. De Smedt, S. C., Demeester, J., and Henni nk, W. E. (2000). Cationi c polymer based gene delivery systems. Pharm. Res 17, 113-126. De, B. P., Heguy, A., Hackett, N. R., Ferris, B ., Leopold, P. L., Lee, J., Pierre, L., Gao, G., Wilson, J. M., and Crystal, R. G. (2006). High levels of persistent expression of alpha1antitrypsin mediated by the nonhuman primate serotype rh.10 adeno-associated virus despite preexisting immunity to common human adeno-associat ed viruses. Mol. Ther 13, 67-76. Delalande, A., Bureau, M., Midoux, P., Bouakaz, A., and Pichon, C. (2010). Ultrasound-assisted microbubbles gene transfer in tendons fo r gene therapy. Ultrasonics 50, 269-272. Denby, L., Nicklin, S. A., and Baker, A. H. ( 2005). Adeno-associated virus (AAV)-7 and -8 poorly transduce vascular endothelial cells a nd are sensitive to proteasomal degradation. Gene Ther 12, 1534-1538. Di Paolo, N., and Shayakhmetov, D. (2009). Immune responses to adenoviral vectors. In Gene Therapy Immunology, R. W. Herzog, ed. (N ew Jersey: Wiley-Blackwell), pp. 57-84. Di Pasquale, G., Davidson, B. L., Stein, C. S., Ma rtins, I., Scudiero, D., Monks, A., and Chiorini, J. A. (2003). Identification of PDGFR as a receptor for AAV-5 transduction. Nat. Med 9, 1306-1312. Dimmock, N. J. (1984). Mechanisms of neutralizati on of animal viruses. J. Gen. Virol 65 ( Pt 6), 1015-1022. Dimmock, N. J., and Hardy, S. A. (2004). Va lency of antibody binding to virions and its determination by surface plasmon resonance. Rev. Med. Virol 14, 123-135.

PAGE 191

191 Dintzis, R. Z., Middleton, M. H., and Dintzis, H. M. (1983). Studies on the immunogenicity and tolerogenicity of T-independent antigens. J. Immunol 131, 2196-2203. DiPrimio, N., Asokan, A., Govindasamy, L., Ag bandje-McKenna, M., and Samulski, R. J. (2008). Surface loop dynamics in adeno-associated virus capsid assembly. J. Virol 82, 5178-5189. Drner, T., and Radbruch, A. (2007). Antibodies and B cell memory in viral immunity. Immunity 27, 384-392. Duan, D., Li, Q., Kao, A. W., Yu e, Y., Pessin, J. E., and Engelhardt, J. F. (1999). Dynamin is required for recombinant adeno-associated virus type 2 inf ection. J. Virol 73, 1037110376. Dubochet, J., Adrian, M., Chang, J. J., Homo, J. C., Lepault, J., McDowall, A. W., and Schultz, P. (1988). Cryo-electron microscopy of v itrified specimens. Q. Rev. Biophys 21, 129228. Dubuisson, J., and Rice, C. M. (1993). Sindbis virus attachment: isol ation and characterization of mutants with impaired binding to vertebrate cells. J. Virol 67, 3363-3374. Dupuy, L. C., and Schmaljohn, C. S. (2009). DNA v accines for biodefense. Expert Rev Vaccines 8, 1739-1754. Ehrengruber, M. U., and Lundstrom, K. (2007). Al phaviruses: Semliki Forest virus and Sindbis virus vectors for gene transfer into neur ons. Curr Protoc Neurosci Chapter 4, Unit 4.22. Emsley, P., and Cowtan, K. (2004). Coot: modelbuilding tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr 60, 2126-2132. Erles, K., Sebkov, P., and Schlehofer, J. R. (1999). Update on the prevalence of serum antibodies (IgG and IgM) to adeno-associated virus (AAV). J. Med. Virol 59, 406-411. Excoffon, K. J. D. A., Koerber, J. T., Dickey, D. D., Murtha, M., Keshavjee, S., Kaspar, B. K., Zabner, J., and Schaffer, D. V. (2009). Directed evolution of adeno-associated virus to an infectious respiratory virus. Proc Natl. Acad. Sci. U.S.A 106, 3865-3870. Farkas, S. L., Zadori, Z., Benko, M., Essbauer S., Harrach, B., and Tijssen, P. (2004). A parvovirus isolated from royal python (P ython regius) is a member of the genus Dependovirus. J Gen Virol 85, 555-561. Felsenstein, J. (1989). PHYLIPPhylogeny inference package (version 3.2). Cladistics 5, 164166. Feschotte, C. (2010). Virology: Bornavirus enters the genome. Nature 463, 39-40.

PAGE 192

192 Fischer, A. C., Beck, S. E., Smith, C. I., Laube, B. L., Askin, F. B., Guggino, S. E., Adams, R. J., Flotte, T. R., and Guggino, W. B. (2003). Su ccessful transgene expression with serial doses of aerosolized rAAV2 vectors in rhesus macaques. Mol. Ther 8, 918-926. Flotte, T. R. (2005). Adeno-associ ated virus-based gene therapy for inherited disorders. Pediatr. Res 58, 1143-1147. Flotte, T. R. (2007). Gene therapy: The first two decades and the current st ate-of-the-art. J. Cell. Physiol. 213, 301-305. Foust, K. D., Nurre, E., Montgomery, C. L., Hernandez, A., Chan, C. M., and Kaspar, B. K. (2009). Intravascular AAV9 prefer entially targets neonatal ne urons and adult astrocytes. Nat. Biotechnol 27, 59-65. Fryer, J. F., Kapoor, A., Minor, P. D., Delwart, E., and Baylis, S. A. (2006). Novel parvovirus and related variant in human pl asma. Emerging Infect. Dis 12, 151-154. Gao, G., Alvira, M. R., Somanathan, S., Lu, Y ., Vandenberghe, L. H., Rux, J. J., Calcedo, R., Sanmiguel, J., Abbas, Z., and Wilson, J. M. (2003). Adeno-associated viruses undergo substantial evolution in primat es during natural infections. Proc. Natl. Acad. Sci. U.S.A 100, 6081-6086. Gao, G., Vandenberghe, L. H., Alvira, M. R., L u, Y., Calcedo, R., Zhou, X., and Wilson, J. M. (2004). Clades of Adeno-associat ed viruses are widely dissem inated in human tissues. J. Virol 78, 6381-6388. Gao, G., Vandenberghe, L. H., and Wilson, J. M. (2005). New recombinant serotypes of AAV vectors. Curr Gene Ther 5, 285-297. Gao, G., Alvira, M. R., Wang, L., Calcedo, R., Johnston, J., and Wilson, J. M. (2002). Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc. Natl. Acad. Sci. U.S.A 99, 11854-11859. Gao, X., Kim, K., and Liu, D. (2007). Nonviral gene delivery: What we know and what is next. AAPS J 9, E92-E104. Girod, A., Wobus, C. E., Zdori, Z., Ried, M., Le ike, K., Tijssen, P., Kleinschmidt, J. A., and Hallek, M. (2002). The VP1 capsid protein of ad eno-associated virus type 2 is carrying a phospholipase A2 domain required for vi rus infectivity. J. Gen. Virol 83, 973-978. Govindasamy, L., Hueffer, K., Parrish, C. R., and Agbandje-McKenna, M. (2003). Structures of host range-controlling regions of the capsids of canine and feline parvoviruses and mutants. J. Virol 77, 12211-12221.

PAGE 193

193 Govindasamy, L., Padron, E., McKenna, R., Muzy czka, N., Kaludov, N., Chiorini, J. A., and Agbandje-McKenna, M. (2006). Structurally mapping the diverse phenotype of adenoassociated virus serotype 4. J. Virol 80, 11556-11570. Grieger, J. C., Johnson, J. S., Gurda-Whitaker, B., Agbandje-McKenna, M., and Samulski, R. J. (2007). Surface-exposed adeno-associated vi rus Vp1-NLS capsid fu sion protein rescues infectivity of noninfectious wild-type Vp2/Vp3 and Vp3-only capsids but not that of fivefold pore mutant virions. J. Virol 81, 7833-7843. Grifman, M., Trepel, M., Speece, P., Gilbert, L. B., Arap, W., Pasqualini, R., and Weitzman, M. D. (2001). Incorporation of tumor-targeting pe ptides into recombinant adeno-associated virus capsids. Mol. Ther 3, 964-975. Grimm, D., Kern, A., Pawlita, M., Ferrari, F ., Samulski, R., and Kleinschmidt, J. (1999). Titration of AAV-2 particles via a novel capsi d ELISA: packaging of genomes can limit production of recombinant AAV-2. Gene Ther 6, 1322-1330. Grimm, D., Kern, A., Rittner, K., and Kleinschmidt J. A. (1998). Novel tools for production and purification of recombinant adenoassociated virus vectors. Hum. Gene Ther 9, 27452760. Guex, N., and Peitsch, M. C. (1997). SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative prot ein modeling. Electrophoresis 18, 2714-2723. Hacein-Bey-Abina, S., von Kalle, C., Schmidt, M., Le Deist, F., Wulffraat, N., McIntyre, E., Radford, I., Villeval, J., Fraser, C. C., Cavazzana-Calvo, M., et al. (2003). A serious adverse event after succe ssful gene therapy for X-linked severe combined immunodeficiency. N. Engl. J. Med 348, 255-256. Hacein-Bey-Abina, S., Le Deist, F., Carlier, F., Bouneaud, C., Hue, C., De Villartay, J., Thrasher, A. J., Wulffraat, N., Sorensen, R ., Dupuis-Girod, S., et al. (2002). Sustained Correction of X-Linked Severe Combined Immunodeficiency by ex Vivo Gene Therapy. N Engl J Med 346, 1185-1193. Hafenstein, S., Bowman, V. D., Sun, T., Nels on, C. D. S., Palermo, L. M., Chipman, P. R., Battisti, A. J., Parrish, C. R., and Rossma nn, M. G. (2009). Structural comparison of different antibodies interacting with parvovirus capsids. J. Virol 83, 5556-5566. Hafenstein, S., Palermo, L. M., Kostyuchenko, V. A., Xiao, C., Morais, M. C., Nelson, C. D. S., Bowman, V. D., Battisti, A. J., Chipman, P. R., Parrish, C. R., et al. (2007). Asymmetric binding of transferrin receptor to parvovirus capsids. Proc. Natl. Acad. Sci. U.S.A 104, 6585-6589.

PAGE 194

194 Halbert, C. L., Miller, A. D., McNamara, S., Em erson, J., Gibson, R. L., Ramsey, B., and Aitken, M. L. (2006). Prevalence of neutralizing antibodies against adeno-associated virus (AAV) types 2, 5, and 6 in cystic fibrosis and normal populations: Implications for gene therapy using AAV vectors. Hum. Gene Ther 17, 440-447. Hardy, S. A., and Dimmock, N. J. (2003). Valency of antibody binding to enveloped virus particles as determined by surface pl asmon resonance. J. Virol 77, 1649-1652. Harris, A., Belnap, D., Watts, N., Conway, J., Cheng, N., Stahl, S., Vethanayagam, J., Wingfield, P., and Steven, A. (2006). Epitope Diversity of Hepatitis B Virus Capsids: Quasiequivalent Variations in Spike Epitopes and Binding of Different An tibodies to the same Epitope. Journal of Molecular Biology 355, 562-576. Hauck, B., Xu, R. R., Xie, J., Wu, W., Ding, Q., Sipler, M., Wang, H., Che n, L., Wright, J. F., and Xiao, W. (2006). Efficient AAV1-AAV2 hybrid vector for gene therapy of hemophilia. Hum. Gene Ther 17, 46-54. Hauswirth, W. W., Aleman, T. S., Kaushal, S ., Cideciyan, A. V., Schw artz, S. B., Wang, L., Conlon, T. J., Boye, S. L., Flotte, T. R., Byrne, B. J., et al. (2008). Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adenoassociated virus gene vector: short-term resu lts of a phase I trial. Hum. Gene Ther 19, 979-990. Havelka, W. A., Henderson, R., and Oesterhelt, D. (1995). Three-dime nsional structure of halorhodopsin at 7 A resolution. J. Mol. Biol 247, 726-738. van Heel, M., and Schatz, M. (2005) Fourier shell correlation thres hold criteria. J. Struct. Biol 151, 250-262. Heller, R., Gilbert, R., and Jaro szeski, M. J. (2000). Clinical Trials for Solid Tumors Using Electrochemotherapy Available at: http ://dx.doi.org.lp.hscl.uf l.edu/10.1385/1-59259-0802:137 [Accessed January 7, 2010]. Horie, M., Honda, T., Suzuki, Y., Kobayashi, Y. Daito, T., Oshida, T., Ikuta, K., Jern, P., Gojobori, T., Coffin, J. M., et al. (2010). Endogenous non-retroviral RNA virus elements in mammalian genomes. Nature 463, 84-87. Huang, X., and Yang, Y. (2009). Innate immune r ecognition of viruses and viral vectors. Hum. Gene Ther 20, 293-301. Huber, M., and Trkola, A. ( 2007). Humoral immunity to HIV-1: neutralization and beyond. J. Intern. Med 262, 5-25. Hueffer, K., Govindasamy, L., Agbandje-McKenna, M., and Parrish, C. R. (2003). Combinations of two capsid regions controlling canine hos t range determine canin e transferrin receptor binding by canine and feline parvoviruses. J. Virol 77, 10099-10105.

PAGE 195

195 Huttner, N. A., Girod, A., Perabo, L., Edbauer, D., Kleinschmidt, J. A., Bning, H., and Hallek, M. (2003). Genetic modifications of the adenoassociated virus type 2 capsid reduce the affinity and the neutralizing effects of human serum antibodies. Gene Ther 10, 21392147. Inagaki, K., Piao, C., Kotchey, N. M., Wu, X., and Nakai, H. (2008). Frequency and spectrum of genomic integration of recombinant adeno-associ ated virus serotype 8 vector in neonatal mouse liver. J. Virol 82, 9513-9524. Ivics, Z., and Izsvk, Z. (2006). Transposons for gene therapy! Curr Gene Ther 6, 593-607. Izsvk, Z., Chuah, M. K. L., Vandendriessche, T ., and Ivics, Z. (2009). Efficient stable gene transfer into human cells by the Sleeping Beauty trans poson vectors. Methods 49, 287297. Janeway, C., Travers, P., Walport, M., and Shlomchik, M. (2005). Immu nobiology: the immune system in health and disease (New York: Garland Science Publishing). Jiang, H., Lillicrap, D., Patarroyo-White, S., Liu, T., Qian, X., Scallan, C. D., Powell, S., Keller, T., McMurray, M., Labelle, A., et al. (2006) Multiyear therapeutic benefit of AAV serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice and dogs. Blood 108, 107-115. Johnson, J. E., and Chiu, W. (2000) Structures of virus and viru s-like particles. Curr. Opin. Struct. Biol 10, 229-235. Jooss, K., and Chirmule, N. (2003). Immunity to adenovirus and adeno-asso ciated viral vectors: implications for gene therapy. Gene Ther 10, 955-963. Kahn, J. S., Kesebir, D., Cotmore, S. F., D'Abram o, A., Cosby, C., Weibel, C., and Tattersall, P. (2008). Seroepidemiology of human bocavirus defined using recombinant virus-like particles. J. Infect. Dis 198, 41-50. Kajigaya, S., Fujii, H., Field, A., Anderson, S., Ro senfeld, S., Anderson, L. J., Shimada, T., and Young, N. S. (1991). Self-assembled B19 par vovirus capsids, produced in a baculovirus system, are antigenically and immunogenically similar to native virions. Proc. Natl. Acad. Sci. U.S.A 88, 4646-4650. Kaludov, N., Brown, K. E., Walters, R. W., Zabn er, J., and Chiorini, J. A. (2001). Adenoassociated virus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemagglutination and efficient transduction but differ in sialic acid linkage specificity. J. Virol 75, 6884-6893.

PAGE 196

196 Kantola, K., Hedman, L., Allander, T., Jartti, T., Lehtinen, P., Ruuskanen, O., Hedman, K., and Sderlund-Venermo, M. (2008). Serodiagnosis of human bocavirus infection. Clin. Infect. Dis 46, 540-546. Kapoor, A., Slikas, E., Simmonds, P., Chieochansi n, T., Naeem, A., Shaukat, S., Alam, M. M., Sharif, S., Angez, M., Zaidi, S., et al. ( 2009). A newly identified bocavirus species in human stool. J. Infect. Dis 199, 196-200. Kashiwakura, Y., Tamayose, K., Iwabuchi, K ., Hirai, Y., Shimada, T., Matsumoto, K., Nakamura, T., Watanabe, M., Oshimi, K., a nd Daida, H. (2005). Hepatocyte growth factor receptor is a coreceptor for adeno-a ssociated virus type 2 infection. J. Virol 79, 609-614. Kaufmann, B., Chipman, P. R., Kostyuchenko, V. A., Modrow, S., and Rossmann, M. G. (2008). Visualization of the external ized VP2 N termini of infec tious human parvovirus B19. J. Virol 82, 7306-7312. Kaufmann, B., Lpez-Bueno, A., Mateu, M. G., Chip man, P. R., Nelson, C. D. S., Parrish, C. R., Almendral, J. M., and Rossmann, M. G. (2007) Minute virus of mice, a parvovirus, in complex with the Fab fragment of a neut ralizing monoclonal an tibody. J. Virol 81, 98519858. Kaufmann, B., Simpson, A. A., and Rossmann, M. G. (2004). The structure of human parvovirus B19. Proc. Natl. Acad. Sci. U.S.A 101, 11628-11633. Kawase, M., Momoeda, M., Young, N. S., and Ka jigaya, S. (1995). Most of the VP1 unique region of B19 parvovirus is on the capsid surface. Virology 211, 359-366. Kern, A., Schmidt, K., Leder, C., Mller, O. J ., Wobus, C. E., Bettinger, K., Von der Lieth, C. W., King, J. A., and Kleinschmidt, J. A. ( 2003). Identification of a heparin-binding motif on adeno-associated virus type 2 capsids. J. Virol 77, 11072-11081. Kesebir, D., Vazquez, M., Weibel, C., Shapiro, E. D., Ferguson, D., Landry, M. L., and Kahn, J. S. (2006). Human bocavirus infection in young children in the United States: molecular epidemiological profile and clinical characteri stics of a newly emerging respiratory virus. J. Infect. Dis 194, 1276-1282. Khuri, F. R., Nemunaitis, J., Ganly, I., Arseneau, J., Tannock, I. F., Romel, L., Gore, M., Ironside, J., MacDougall, R. H., Heise, C., et al. (2000). a controlled trial of intratumoral ONYX-015, a selectively-replicating adenovirus, in combination with cisplatin and 5fluorouracil in patients with recurrent h ead and neck cancer. Nat. Med 6, 879-885. Kidd, K. A., Blanchfield, P. J., Mills, K. H., Pa lace, V. P., Evans, R. E., Lazorchak, J. M., and Flick, R. W. (2007). Collapse of a fish popul ation after exposure to a synthetic estrogen. Proc. Natl. Acad. Sci. U.S.A 104, 8897-8901.

PAGE 197

197 Klasse, P. J., and Sattentau, Q. J. (2002). Occupancy and mechanism in antibody-mediated neutralization of an imal viruses. J. Gen. Virol 83, 2091-2108. Kleywegt, G. J., and Jones, T. A. ( 1996). xdlMAPMAN and xdlDAT AMAN programs for reformatting, analysis and manipulation of biomacromolecular electron-density maps and reflection data sets. Acta Crysta llogr. D Biol. Crys tallogr 52, 826-828. Knowles, B. B., Howe, C. C., and Aden, D. P. (1980). Human hepatocellular carcinoma cell lines secrete the major plasma proteins a nd hepatitis B surface antigen. Science 209, 497499. Koerber, J. T., Jang, J., and Schaffer, D. V. (2008). DNA shuffling of adeno-associated virus yields functionally diverse vira l progeny. Mol. Ther 16, 1703-1709. Kontou, M., Govindasamy, L., Nam, H., Bryant, N., Llamas-Saiz, A. L., Foces-Foces, C., Hernando, E., Rubio, M., McKenna, R., Almendr al, J. M., et al. (2005). Structural determinants of tissue tropism and in vivo pa thogenicity for the parvovirus minute virus of mice. J. Virol 79, 10931-10943. Kotin, R. M., Siniscalco, M., Samulski, R. J ., Zhu, X. D., Hunter, L., Laughlin, C. A., McLaughlin, S., Muzyczka, N., Rocchi, M., and Berns, K. I. (1990). Site-specific integration by adeno-associated virus. Pro ceedings of the National Academy of Sciences of the United States of America 87, 2211-2215. Krissinel, E., and Henrick, K. (2004). Secondary-s tructure matching (SSM), a new tool for fast protein structure alignment in three dimensi ons. Acta Crystallogr. D Biol. Crystallogr 60, 2256-2268. Kronenberg, S., Bttcher, B., von der Lieth, C. W., Bleker, S., and Kleinsch midt, J. A. (2005). A conformational change in the adeno-associated virus type 2 capsid leads to the exposure of hidden VP1 N termini. J. Virol 79, 5296-5303. Kuck, D., Kern, A., and Kleinschmidt, J. A. (2007). Development of AAV serotype-specific ELISAs using novel monoclonal antibodi es. J. Virol. Methods 140, 17-24. Khler, T. C., Andersson, M., Carlin, G., John sson, A., and Akerblom, L. (2009). Do biological medicinal products pose a risk to th e environment?: a current view on ecopharmacovigilance. Drug Saf 32, 995-1000. Lai, Y., Yue, Y., and Duan, D. (2010). Eviden ce for the failure of adeno-associated virus serotype 5 to package a viral genom e > or = 8.2 kb. Mol. Ther 18, 75-79. Langeveld, J. P., Casal, J. I., Vela, C., Dalsgaar d, K., Smale, S. H., Puijk, W. C., and Meloen, R. H. (1993). B-cell epitopes of canine parvovirus: distribution on the primary structure and exposure on the viral surface. J. Virol 67, 765-772.

PAGE 198

198 Lee, J. S., Hadjipanayis, A. G., and Parker, M. D. (2005). Viral vectors for use in the development of biodefense vaccin es. Adv. Drug Deliv. Rev 57, 1293-1314. Levy, H. C., Bowman, V. D., Govindasamy, L ., McKenna, R., Nash, K., Warrington, K., Chen, W., Muzyczka, N., Yan, X., Baker, T. S ., et al. (2009). Heparin binding induces conformational changes in Ade no-associated virus serotype 2. J. Struct. Biol 165, 146156. Lewis, J. K., Bothner, B., Smith, T. J., and Si uzdak, G. (1998). Antiviral agent blocks breathing of the common cold virus. Proc. Natl. Acad. Sci. U.S.A 95, 6774-6778. Li, H., Lin, S., Giles-Davis, W., Li, Y., Zhou, D., Xiang, Z. Q., Hi gh, K. A., and Ertl, H. C. J. (2009). A preclinical animal model to asse ss the effect of preexisting immunity on AAV-mediated gene transf er. Mol. Ther 17, 1215-1224. Li, Q., Yafal, A. G., Lee, Y. M., Hogle, J ., and Chow, M. (1994). Poliovirus neutralization by antibodies to internal epitopes of VP4 and VP 1 results from reversible exposure of these sequences at physiological temp erature. J. Virol 68, 3965-3970. Li, S., and Ma, Z. (2001). Nonviral gene therapy. Curr Gene Ther 1, 201-226. Li, Z., Dullmann, J., Schiedlmeier, B., Schmidt, M., von Kalle, C., Meyer, J., Forster, M., Stocking, C., Wahlers, A., Frank, O., et al. (2002). Murine Leukemia Induced by Retroviral Gene Marking. Science 296, 497. Liljestrm, P., and Garoff, H. (1991). A new gene ration of animal cell expression vectors based on the Semliki Forest virus repl icon. Biotechnology (N.Y.) 9, 1356-1361. Lin, S., and Ertl, H. C. (2009). Immune responses to Adeno-associated virus vectors. In Gene Therapy Immunology, Roland Herzog, ed. (H oboken, New Jersey: John Wiley & Sons, Inc.), pp. 97-124. Linden, R. M., Ward, P., Giraud, C., Winocour, E ., and Berns, K. I. (1996). Site-specific integration by adeno-associated virus. Pro ceedings of the National Academy of Sciences of the United States of America 93, 11288-11294. Lindner, J., and Modrow, S. (2008). Human bocavirus--a novel pa rvovirus to infect humans. Intervirology 51, 116-122. Liu, G., Martins, I. H., Chiorini, J. A., and Davidson, B. L. (2005). Adeno-associated virus type 4 (AAV4) targets ependyma and astrocytes in the subventricular zone and RMS. Gene Ther 12, 1503-1508. Llamas-Saiz, A. L., Agbandje-McKenna, M., Parker, J. S., Wahid, A. T., Parrish, C. R., and Rossmann, M. G. (1996). Structural analysis of a mutation in can ine parvovirus which controls antigenicity and host range. Virology 225, 65-71.

PAGE 199

199 Lochrie, M. A., Tatsuno, G. P., Christie, B., McDonnell, J. W., Zhou, S., Surosky, R., Pierce, G. F., and Colosi, P. (2006). Mutations on the ex ternal surfaces of ad eno-associated virus type 2 capsids that affect transducti on and neutralization. J. Virol 80, 821-834. Lpez de Turiso, J. A., Corts, E., Ranz, A., Garca J., Sanz, A., Vela, C., and Casal, J. I. (1991). Fine mapping of canine parvovi rus B cell epitopes. J. Gen. Virol 72 ( Pt 10), 2445-2456. Lpez-Bueno, A., Mateu, M. G., and Almendral J. M. (2003). High mutant frequency in populations of a DNA virus allows evasion from antibody therapy in an immunodeficient host. J. Virol 77, 2701-2708. Lu, Y., and Song, S. (2009). Distinct immune res ponses to transgene products from rAAV1 and rAAV8 vectors. Proc. Natl. Acad. Sci. U.S.A 106, 17158-17162. Luchsinger, E., Strobbe, R., Wellemans, G., Deke gel, D., and Sprececher-Goldbeeger, S. (1970). Haemagglutinating adeno-associated virus ( AAV) in association with bovine adenovirus type 1. Archives of Virology 31, 390-392. Lufino, M. M. P., Edser, P. A. H., and Wade-M artins, R. (2008). Advances in high-capacity extrachromosomal vector technology: epis omal maintenance, vector delivery, and transgene expression. Mol. Ther 16, 1525-1538. Lundberg, C., Bjrklund, T., Carlsson, T., Jakobss on, J., Hantraye, P., Dglon, N., and Kirik, D. (2008). Applications of lentiviral vectors for biology and gene therapy of neurological disorders. Curr Gene Ther 8, 461-473. Lundstrom, K. (2004). Gene therapy applications of viral vectors. Technol. Cancer Res. Treat 3, 467-477. Lundstrom, K. (2003). Latest development in viral vectors for gene ther apy. Trends Biotechnol 21, 117-122. M, A., and Chapman, M S (2006). Corrleating structure with func tion in the viral capsid. In Parvoviruses, Kerr, J R, Cotmore, S F, Bloom, M E, Linden, R M, and Parrish, C R, eds. (New York, NY: Edward Arnold,Ltd.), pp. 125-139. Macnab, S., and Whitehouse, A. (2009). Progress and prospects: human ar tificial chromosomes. Gene Ther 16, 1180-1188. Maguire, A. M., Simonelli, F., Pierce, E. A., Pugh E. N., Mingozzi, F., Bennicelli, J., Banfi, S., Marshall, K. A., Testa, F., Surace, E. M., et al. (2008). Safety and efficacy of gene transfer for Leber's congenital amau rosis. N. Engl. J. Med 358, 2240-2248.

PAGE 200

200 Manno, C. S., Pierce, G. F., Arruda, V. R., Glad er, B., Ragni, M., Rasko, J. J., Rasko, J., Ozelo, M. C., Hoots, K., Blatt, P., et al. (2006). Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat. Med 12, 342347. Marconi, P., Argnani, R., Epstein, A. L., and Manservigi, R. (2009). HSV as a Vector in Vaccine Development and Gene Thera py. Adv. Exp. Med. Biol 655, 118-144. Margaritis, P., Roy, E., Aljamali, M. N., Down ey, H. D., Giger, U., Zhou, S., Merricks, E., Dillow, A., Ezban, M., Nichols, T. C., et al. (2009). Successful treatment of canine hemophilia by continuous expression of canine FVIIa. Blood 113, 3682-3689. Martin, A. C., Cheetham, J. C., and Rees, A. R. (1989). Modeling antibody hypervariable loops: a combined algorithm. Proc. Natl. Acad. Sci. U.S.A 86, 9268-9272. Matthews, K. S., Alvarez, R. D., and Curiel, D. T. (2009). Advancements in adenoviral based virotherapy for ovarian cancer. A dvanced Drug Delivery Reviews 61, 836-841. Mays, L. E., and Wilson, J. M. (2009). Iden tification of the murine AAVrh32.33 capsid-specific CD8+ T cell epitopes. J Gene Med 11, 1095-1102. McCarty, D. M., Young, S. M., and Samuls ki, R. J. (2004). INTEGRATION OF ADENOASSOCIATED VIRUS (AAV) AND RECOMBINANT AAV VECTORS. Annu. Rev. Genet. 38, 819-845. McCullough, K. C., De Simone, F., Brocchi, E ., Capucci, L., Crowther, J. R., and Kihm, U. (1992). Protective immune re sponse against foot-and-mout h disease. J. Virol 66, 18351840. McKenna, R., Olson, N. H., Chipman, P. R., Baker, T. S., Booth, T. F., Christensen, J., Aasted, B., Fox, J. M., Bloom, M. E., Wolfinbarger, J. B., et al. (1999). Three-dimensional structure of Aleutian mink disease parvovirus: implications for dis ease pathogenicity. J. Virol 73, 6882-6891. Meng, E. C., Pettersen, E. F., Couch, G. S., Huang, C. C., and Ferrin, T. E. (2006). Tools for integrated sequence-structur e analysis with UCSF Chimer a. BMC Bioinformatics 7, 339. Meyer, K. B., Thompson, M. M., Levy, M. Y., Barron, L. G., and Szoka, F. C. (1995). Intratracheal gene delivery to the mous e airway: characteri zation of plasmid DNA expression and pharmacokine tics. Gene Ther 2, 450-460. Miao, C. H., Ye, P., Thompson, A. R., Ra wlings, D. J., and Ochs, H. D. (2006). Immunomodulation of transgene responses following naked DNA transfer of human factor VIII into hemophilia A mice. Blood 108, 19-27.

PAGE 201

201 Midoux, P., Breuzard, G., Gomez, J. P., and Pichon, C. (2008). Polymer-based gene delivery: a current review on the uptake and intracellular trafficking of polyplexes. Curr Gene Ther 8, 335-352. Midoux, P., Pichon, C., Yaouanc, J., and Jaffrs, P. (2009). Chemical vectors for gene delivery: a current review on polymers, peptides and lip ids containing histidine or imidazole as nucleic acids carriers. British Journal of Pharmacology 157, 166-178. Miller, E. B., Gurda-Whitaker, B., Govindasa my, L., McKenna, R., Zolotukhin, S., Muzyczka, N., and Agbandje-McKenna, M. (2006). Produc tion, purification and preliminary X-ray crystallographic studies of adeno-associated virus seroty pe 1. Acta Crystallogr. Sect. F Struct. Biol. Crys t. Commun 62, 1271-1274. Milich, D. R., and McLachlan, A. (1986). The nucleo capsid of hepatitis B vi rus is both a T-cellindependent and a T-cell-depe ndent antigen. Science 234, 1398-1401. Mingozzi, F., Maus, M. V., Hui, D. J., Sabatino, D. E., Murphy, S. L., Rasko, J. E. J., Ragni, M. V., Manno, C. S., Sommer, J., Jiang, H., et al (2007). CD8(+) T-cell responses to adenoassociated virus capsid in humans. Nat. Med 13, 419-422. Mislick, K. A., and Baldeschwieler, J. D. (1996) Evidence for the role of proteoglycans in cation-mediated gene transfer Proceedings of the National Academy of Sciences of the United States of America 93, 12349-12354. Monteny, M., Niesters, H. G. M., Moll, H. A., and Berger, M. Y. (2007) Human bocavirus in febrile children, The Netherlands Emerging Infect. Dis 13, 180-182. Mori, S., Wang, L., Takeuchi, T., and Kanda, T. (2004). Two novel adeno-associated viruses from cynomolgus monkey: pseudotyping char acterization of capsi d protein. Virology 330, 375-383. Moscioni, D., Morizono, H., McCarter, R. J., Stern, A., CabreraLuque, J., Hoang, A., Sanmiguel, J., Wu, D., Bell, P., Gao, G., et al. (2006). Long-term correction of ammonia metabolism and prolonged survival in or nithine transcarbamylase-deficient mice following liver-directed treatmen t with adeno-associated viral vectors. Mol. Ther 14, 2533. Moskalenko, M., Chen, L., van Roey, M., Donahue, B. A., Snyder, R. O., McArthur, J. G., and Patel, S. D. (2000). Epitope mapping of hu man anti-adeno-associated virus type 2 neutralizing antibodies: implicat ions for gene therapy and vi rus structure. J. Virol 74, 1761-1766. Muzyczka, N. (1994). Adeno-associated virus (AAV) vectors: will they work ? J. Clin. Invest 94, 1351.

PAGE 202

202 Muzyczka, N., and Berns, K. I. (2001). In Fiel ds Virology, D. Knipe and P. Howley, eds. (New York: Lippincott, Williams and Wilkins), pp. 2327-60. Muzyczka, N., and Warrington, K. H. (2005). Custom adeno-associated virus capsids: the next generation of recombinant vectors with novel tropism. Hum. Gene Ther 16, 408-416. Nabel, G. J. (2004). Genetic, cellular and immune a pproaches to disease therapy: past and future. Nat Med 10, 135-141. Nakai, H., Fuess, S., Storm, T. A., Muramatsu, S., Nara, Y., and Kay, M. A. (2005). Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in mice. J. Virol 79, 214-224. Nam, H., Lane, M. D., Padron, E., Gurda, B., McKenna, R., Kohlbrenner, E., Aslanidi, G., Byrne, B., Muzyczka, N., Zolotukhin, S., et al. (2007). Structure of adeno-associated virus serotype 8, a gene ther apy vector. J. Virol 81, 12260-12271. Nanda, K., Vancini, R., Ribeiro, M., Brown, D. T., and Hernandez, R. (2009). A high capacity Alphavirus heterologous gene deli very system. Virology 390, 368-373. Nason, E. L., Wetzel, J. D., Mukherjee, S. K., Ba rton, E. S., Prasad, B. V., and Dermody, T. S. (2001). A monoclonal antibody specific for reoviru s outer-capsid protein sigma3 inhibits sigma1-mediated hemagglutination by steric hindrance. J. Virol 75, 6625-6634. Neumann, E., Schaefer-Ridder, M., Wang, Y., and Hofschneider, P. H. (1982). Gene transfer into mouse lyoma cells by electroporation in high electric fields. EMBO J 1, 841-845. Nicklin, S. A., Buening, H., Dishart, K. L., de Al wis, M., Girod, A., Hacker, U., Thrasher, A. J., Ali, R. R., Hallek, M., and Baker, A. H. (2001). Efficient and selective AAV2-mediated gene transfer directed to human vascul ar endothelial cells. Mol. Ther 4, 174-181. O'Donnell, J., Taylor, K. A., and Chapman, M. S. (2009). Adeno-associated virus-2 and its primary cellular receptor--Cryo-EM struct ure of a heparin complex. Virology 385, 434443. Oliphant, T., and Diamond, M. S. (2007). Th e molecular basis of antibody-mediated neutralization of West Nile virus. Expert Opin Biol Ther 7, 885-892. Olson, E. J., Haskell, S. R. R., Frank, R. K ., Lehmkuhl, H. D., Hobbs, L. A., Warg, J. V., Landgraf, J. G., and Wnschmann, A. (2004). Is olation of an adenovirus and an adenoassociated virus from goat kids with enteritis. J. Vet. Diagn. Invest 16, 461-464. Opie, S. R., Warrington, K. H., Agbandje-McKe nna, M., Zolotukhin, S., and Muzyczka, N. (2003). Identification of amino acid residues in the capsid prot eins of adeno-associated virus type 2 that contribute to heparan sulfate proteoglycan binding. J. Virol 77, 69957006.

PAGE 203

203 Pacak, C. A., Mah, C. S., Thattaliyath, B. D., Conlon, T. J., Lewis, M. A., Cloutier, D. E., Zolotukhin, I., Tarantal, A. F., and Byrne, B. J. (2006). Recombinant adeno-associated virus serotype 9 leads to pr eferential cardiac transduction in vivo. Circ. Res 99, e3-9. Padron, E., Bowman, V., Kaludov, N., Govindasamy, L., Levy, H., Nick, P., McKenna, R., Muzyczka, N., Chiorini, J. A., Baker, T. S., et al. (2005). Structure of adeno-associated virus type 4. J. Virol 79, 5047-5058. Parker, A. L., Newman, C., Briggs, S., Seymour, L., and Sheridan, P. J. (2003). Nonviral gene delivery: techniques and implications for mo lecular medicine. Expert Rev Mol Med 5, 115. Parker, J. S., Murphy, W. J., Wang, D., O'Brien, S. J., and Parrish, C. R. (2001). Canine and feline parvoviruses can use human or feline tran sferrin receptors to bind, enter, and infect cells. J. Virol 75, 3896-3902. Parker, J. S., and Parrish, C. R. (2000). Cellula r uptake and infection by canine parvovirus involves rapid dynamin-regulated clathrin-m ediated endocytosis, followed by slower intracellular trafficking. J. Virol 74, 1919-1930. Parks, R., and Graham, F. (1997). A helper-dep endent system for ade novirus vector production helps define a lower limit for effici ent DNA packaging. J. Virol. 71, 3293-3298. Parrish, C. R., Aquadro, C. F., Strassheim, M. L., Evermann, J. F., Sgro, J. Y., and Mohammed, H. O. (1991). Rapid antigenic-type repl acement and DNA sequence evolution of canine parvovirus. J. Virol 65, 6544-6552. Parrish, C. R., O'Connell, P. H., Evermann, J. F., and Carmichael, L. E. (1985). Natural variation of canine parvovirus. Science 230, 1046-1048. Parrish, C. R. (2006). Pathogene sis of feline panleukopenia viru s and canine parvovirus. In Parvoviruses, J. R. Kerr, M. E. Bloom, R. Linden, and C. Parrish, eds. (New York: Oxford University Press Inc.), pp. 429-434. Parrish, C., and Carmichael, L. (1983). Antigenic structure and variati on of canine parvovirus type-2, feline panleukopenia virus, and mink enteritis virus. Virology 129, 401-414. Patil, S. D., Rhodes, D. G., and Burgess, D. J. (2005). DNA-based therapeutics and DNA delivery systems: A comprehens ive review. AAPS J 7, E61-E77. Pear, W. S., Nolan, G. P., Scott, M. L., and Ba ltimore, D. (1993). Production of high-titer helperfree retroviruses by transien t transfection. Proc. Natl. Acad. Sci. U.S.A 90, 8392-8396. Peng, Z. (2005). Current status of gendicine in China: recombinant human Ad-p53 agent for treatment of cancers. Hum. Gene Ther 16, 1016-1027.

PAGE 204

204 Pettersen, E. F., Goddard, T. D., Huang, C. C., C ouch, G. S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. (2004). UCSF Chimera--a visualiz ation system for expl oratory research and analysis. J Comput Chem 25, 1605-1612. Piechaczek, C., Fetzer, C., Baiker, A., Bode, J., and Lipps, H. J. (1999). A vector based on the SV40 origin of replication and chromosoma l S/MARs replicates episomally in CHO cells. Nucleic Acids Res 27, 426-428. Porta, C., Wang, G., Cheng, H., Chen, Z., Baker, T. S., and Johnson, J. E. (1994). Direct Imaging of Interactions between an Icosahedral Virus and Conjugate Fab Fragments by Cryoelectron Microscopy and X-Ra y Crystallography. Virology 204, 777-788. Prasad, B. V., Burns, J. W., Marietta, E., Estes, M. K., and Chiu, W. (1990). Localization of VP4 neutralization sites in rotavirus by three-dimensional cryo-electron microscopy. Nature 343, 476-479. Pushko, P., Parker, M., Ludwig, G. V., Davis, N. L., Johnston, R. E., and Smith, J. F. (1997). Replicon-helper systems from attenuated Venezuelan equine encephalitis virus: expression of heterologous genes in v itro and immunization against heterologous pathogens in vivo. Virology 239, 389-401. Qing, K., Mah, C., Hansen, J., Zhou, S., Dwark i, V., and Srivastava, A. (1999). Human fibroblast growth factor receptor 1 is a co-r eceptor for infection by adeno-associated virus 2. Nat. Med 5, 71-77. Qiu, J., and Brown, K. E. (1999). Integrin alphaVbeta5 is not involved in adeno-associated virus type 2 (AAV2) infection. Virology 264, 436-440. Qu, X., Liu, W., Qi, Z., Duan, Z., Zheng, L ., Kuang, Z., Zhang, W., and Hou, Y. (2008). Phospholipase A2-like activity of human bocavirus VP1 unique region. Biochem. Biophys. Res. Commun 365, 158-163. Rabinowitz, J. E., Xiao, W., and Samulski, R. J. (1999). Insertional mutagenesis of AAV2 capsid and the production of recombinant virus. Virology 265, 274-285. Rabinowitz, J. E., Rolling, F., Li, C., Conrath, H ., Xiao, W., Xiao, X., and Samulski, R. J. (2002). Cross-packaging of a single adeno-asso ciated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J. Virol 76, 791-801. Rapberger, R., Lukas, A., and Mayer, B. ( 2007). Identification of discontinuous antigenic determinants on proteins based on shape complementarities. J. Mol. Recognit 20, 113121.

PAGE 205

205 Reading, S. A., and Dimmock, N. J. (2007). Neut ralization of animal virus infectivity by antibody. Arch. Virol 152, 1047-1059. Reaves, P. Y., Gelband, C. H., Wang, H., Yang, H ., Lu, D., Berecek, K. H., Katovich, M. J., and Raizada, M. K. (1999). Permanent Cardiova scular Protection From Hypertension by the AT1 Receptor Antisense Gene Therapy in H ypertensive Rat Offspring. Circ Res 85, e4450. Rini, J. M., Schulze-Gahmen, U., and Wilson, I. A. (1992). Structural evidence for induced fit as a mechanism for antibody-antigen recognition. Science 255, 959-965. Ros, C., Burckhardt, C. J., and Kempf, C. ( 2002). Cytoplasmic trafficking of minute virus of mice: low-pH requirement, routing to late endosomes, and proteasome interaction. J. Virol 76, 12634-12645. Ros, C., and Kempf, C. (2004). The ubiquitin-pr oteasome machinery is essential for nuclear translocation of incoming minute virus of mice. Virology 324, 350-360. Rosenfeld, S. J., Yoshimoto, K., Kajigaya, S., Anderson, S., Young, N. S., Field, A., Warrener, P., Bansal, G., and Collett, M. S. (1992). Un ique region of the minor capsid protein of human parvovirus B19 is exposed on the virion surface. J. Clin. Invest 89, 2023-2029. Rossmann, M. G. (2000). Fitting atomic mode ls into electron-microscopy maps. Acta Crystallogr. D Biol. Crystallogr 56, 1341-1349. Roy, R., Jerry, D. J., and Thayumanavan, S. (2009). Virus-Inspired Approach to Nonviral Gene Delivery Vehicles. Biomacromolecules 10, 2189-2193. Ruigrok, R. W., Crpin, T., Hart, D. J., and Cu sack, S. (2010). Towards an atomic resolution understanding of the influenza virus replication machinery. Curr Opin Struct Biol. Available at: http://www.ncbi.nlm.ni h.gov.lp.hscl.ufl.edu/pubmed/20061134 [Accessed January 28, 2010]. Russell, D. W., and Miller, A. D. (1996). Foamy virus vectors. J. Virol 70, 217-222. Samulski, R. J., Zhu, X., Xiao, X., Brook, J. D., H ousman, D. E., Epstein, N., and Hunter, L. A. (1991). Targeted integration of adeno-associ ated virus (AAV) into human chromosome 19. EMBO J 10, 3941-3950. Sanders, D. A. (2002). No false start for novel pseudotyped vectors. Cu rr. Opin. Biotechnol 13, 437-442. Sarkar, R., Tetreault, R., Gao, G., Wang, L., Bell, P., Chandler, R., Wilson, J. M., and Kazazian, H. H. (2004). Total correction of hemoph ilia A mice with canine FVIII using an AAV 8 serotype. Blood 103, 1253-1260.

PAGE 206

206 Sarkis, C., Philippe, S., Mallet, J., and Serguera, C. (2008). Non-integrating lentiviral vectors. Curr Gene Ther 8, 430-437. Sato, H., Hirata, J., Kuroda, N., Shiraki, H., Maeda, Y., and Okochi, K. (1991). Identification and mapping of neutralizing epitopes of human parvovirus B19 by using human antibodies. J. Virol 65, 5485-5490. Scallan, C. D., Jiang, H., Liu, T., Patarroyo-Whit e, S., Sommer, J. M., Zhou, S., Couto, L. B., and Pierce, G. F. (2006). Human immunogl obulin inhibits liver transduction by AAV vectors at low AAV2 ne utralizing titers in SC ID mice. Blood 107, 1810-1817. Schiedner, G., Morral, N., Parks, R. J., Wu, Y ., Koopmans, S. C., Langs ton, C., Graham, F. L., Beaudet, A. L., and Kochanek, S. (1998). Ge nomic DNA transfer with a high-capacity adenovirus vector results in improved in vi vo gene expression and decreased toxicity. Nat. Genet 18, 180-183. Schlesinger, S. (2001). Alphaviru s vectors: development and poten tial therapeutic applications. Expert Opin Biol Ther 1, 177-191. Schmaljohn, A. L., Johnson, E. D., Dalrymple, J. M., and Cole, G. A. (1982). Non-neutralizing monoclonal antibodies can prevent lethal alphavirus encephalitis. Nature 297, 70-72. Schmidt, M., Grot, E., Cervenka, P., Wainer S., Buck, C., and Chiorini, J. A. (2006). Identification and characterization of novel adeno-associated viru s isolates in ATCC virus stocks. J. Virol 80, 5082-5085. Schmidt, M., Voutetakis, A., Afione, S., Zheng, C., Mandikian, D., and Chiorini, J. A. (2008). Adeno-associated virus type 12 (AAV12): a novel AAV serotype with sialic acidand heparan sulfate proteoglycan -independent transduction activity. J. Virol 82, 1399-1406. Schneider, B., Fryer, J. F., Ol denburg, J., Brackmann, H., Baylis, S. A., and Eis-Hbinger, A. M. (2008). Frequency of contamination of coagulation factor concentrates with novel human parvovirus PARV4. Haemophilia 14, 978-986. Schoenbach, K. H., Beebe, S. J., and Buescher, E. S. (2001). Intracellula r effect of ultrashort electrical pulses. Bioe lectromagnetics 22, 440-448. Seiler, M. P., Miller, A. D., Zabner, J., and Halb ert, C. L. (2006). Adeno-associated virus types 5 and 6 use distinct receptors for cel l entry. Hum. Gene Ther 17, 10-19. Shi, J., and Zheng, D. (2009). An update on gene therapy in China. Curr. Opin. Mol. Ther 11, 547-553.

PAGE 207

207 Shi, X., Fang, G., Shi, W., and Bartlett, J. S. (2 006). Insertional mutagenesis at positions 520 and 584 of adeno-associated virus type 2 (AAV2) capsid gene and generation of AAV2 vectors with eliminated heparinbinding ability and introduced novel tropism. Hum. Gene Ther 17, 353-361. de Silva, S., and Bowers, W. J. (2009). Herpes Virus Amplicon Vectors. Viruses 1, 594-629. Simonelli, F., Maguire, A. M., Testa, F., Pierce, E. A., Mingozzi, F., Bennicelli, J. L., Rossi, S., Marshall, K., Banfi, S., Surace, E. M., et al (2009). Gene Therapy for Leber's Congenital Amaurosis is Safe and Effective Through 1.5 Years After Vector Administration. Mol. Ther. Available at: http://www.nc bi.nlm.nih.gov.lp.hscl.ufl.edu/pubmed/19953081 [Accessed January 19, 2010]. Simpson, A. A., Chipman, P. R., Baker, T. S., Tijssen, P., and Rossmann, M. G. (1998). The structure of an insect parvovirus (Galleri a mellonella densovirus) at 3.7 A resolution. Structure 6, 1355-1367. Simpson, A. A., Hbert, B., Sullivan, G. M., Parrish, C. R., Zdori, Z., Tijssen, P., and Rossmann, M. G. (2002). The structure of porcine parvovirus: comparison with related viruses. J. Mol. Biol 315, 1189-1198. Singer, O., and Verma, I. M. (2008). Applications of lentiviral vectors for shRNA delivery and transgenesis. Curr Gene Ther 8, 483-488. Sinn, P. L., Sauter, S. L., and McCray, P. B. (2005). Gene therapy progress and prospects: development of improved lentiviral and re troviral vectors--d esign, biosafety, and production. Gene Ther 12, 1089-1098. Smith, T. J. (2001). Antibody interactions with rhinovirus: lessons for mechanisms of neutralization and the ro le of immunity in viral evolu tion. Curr. Top. Microbiol. Immunol 260, 1-28. Smith, T. J. (2003). Structural studies on anti body-virus complexes. Adv. Protein Chem 64, 409453. Strassheim, M. L., Gruenberg, A., Veijalainen, P ., Sgro, J. Y., and Parrish, C. R. (1994). Two dominant neutralizing antigen ic determinants of canine parvovirus are found on the threefold spike of the virus capsid. Virology 198, 175-184. Subramaniam, S. (1998). The Biology Workbe nch--a seamless database and analysis environment for the biologist. Proteins 32, 1-2. Suh, S. W., Bhat, T. N., Navia, M. A., Cohen, G. H., Rao, D. N., Rudikoff, S., and Davies, D. R. (1986). The galactan-binding immunoglobulin Fab J539: an X-ray diffraction study at 2.6-A resolution. Proteins 1, 74-80.

PAGE 208

208 Suikkanen, S., Antila, M., Jaatinen, A., VihinenRanta, M., and Vuento, M. (2003). Release of canine parvovirus from endocyt ic vesicles. Virology 316, 267-280. Summerford, C., Bartlett, J. S., and Samulski, R. J. (1999). AlphaVbeta5 integrin: a co-receptor for adeno-associated virus type 2 infection. Nat. Med 5, 78-82. Sun, B., Zhang, H., Franco, L. M., Young, S. P., Schneider, A., Bird, A., Amalfitano, A., Chen, Y., and Koeberl, D. D. (2005). Efficacy of an adeno-associated virus 8-pseudotyped vector in glycogen storage diseas e type II. Mol. Ther 11, 57-65. Sundararajan, R. (2009). Nanosecond electropora tion: another look. Mol. Biotechnol 41, 69-82. Surosky, R. T., Urabe, M., Godwin, S. G., McQu iston, S. A., Kurtzman, G. J., Ozawa, K., and Natsoulis, G. (1997). Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. J Virol 71, 7951-7959. Tachibana, M., Sparman, M., Sritanaudomchai, H ., Ma, H., Clepper, L., Woodward, J., Li, Y., Ramsey, C., Kolotushkina, O., and Mitalipov, S. (2009). Mitochondrial gene replacement in primate offspring and embryonic stem cells. Nature 461, 367-372. Taniyama, Y., Tachibana, K., Hiraoka, K., Aoki M., Yamamoto, S., Matsumoto, K., Nakamura, T., Ogihara, T., Kaneda, Y., and Morishita, R. (2002). Development of safe and efficient novel nonviral gene transfer using ultrasound: en hancement of transfection efficiency of naked plasmid DNA in skeletal muscle. Gene Ther 9, 372-380. Tattersall, P. (2006). The evolution of parvovi rus taxonomy. In Parvoviruses, J. R. Kerr, S. Cotmore, M. E. Bloom, R. Linden, and C. R. Parrish, eds. (Hodder Arnold), pp. 5-14. Terrosi, C., Fabbiani, M., Cellesi, C., and Cusi, M. G. (2007). Human bocavirus detection in an atopic child affected by pneumonia associated with wheezing. J. Clin. Virol 40, 43-45. The CCP4 suite: programs for protein crystallography (1994). Acta Crystallogr. D Biol. Crystallogr 50, 760-763. The News Staff (2009). The Runners-Up. Science 326, 1600-1607. Thomas, C. E., Storm, T. A., Huang, Z., and Kay, M. A. (2004). Rapid uncoating of vector genomes is the key to efficient liver tran sduction with pseudotyped adeno-associated virus vectors. J. Virol 78, 3110-3122. Thompson, J. D., Higgins, D. G., and Gibs on, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 46734680.

PAGE 209

209 Tijssen, P., Szelei, J., and Zdori, Z. (2006). Phospholipase A2 domain s in structural proteins of parvoviruses. In Parvoviruses, J. Kerr, S. Cotmore, M. E. Bloom, R. Linden, and C. R. Parrish, eds. (New York, NY: Edward Arnold,Ltd.), pp. 95-105. Tolfvenstam, T., Lundqvist, A., Levi, M., Wahre n, B., and Broliden, K. (2000). Mapping of Bcell epitopes on human Parvovirus B19 non-struct ural and structural proteins. Vaccine 19, 758-763. Trobridge, G. D. (2009). Foamy virus vectors for gene transfer. Expert Opin Biol Ther 9, 14271436. Valori, C. F., Ning, K., Wyles, M., and Azzouz M. (2008). Development and applications of non-HIV-based lentiviral vector s in neurological disorder s. Curr Gene Ther 8, 406-418. Vandenberghe, L. H., Wilson, J. M., and Gao, G. (2009). Tailoring the AAV vector capsid for gene therapy. Gene Ther 16, 311-319. Vandenberghe, L. H., and Wilson, J. M. (2007) AAV as an immunogen. Curr Gene Ther 7, 325333. Veldwijk, M. R., Topaly, J., Laufs, S., Hengge, U. R., Wenz, F., Zeller, W. J., and Fruehauf, S. (2002). Development and optimization of a real-time quantitative PCR-based method for the titration of AAV-2 vector stocks. Mol. Ther 6, 272-278. Vicente, D., Cilla, G., Montes, M., Prez-Yarza, E. G., and Prez-Trallero, E. (2007). Human bocavirus, a respiratory and enteric virus. Emerging Infect. Dis 13, 636-637. Vihinen-Ranta, M., Wang, D., Weichert, W. S., and Parrish, C. R. (2002). The VP1 N-terminal sequence of canine parvovirus affects nuclear transport of capsids and efficient cell infection. J. Virol 76, 1884-1891. Voigt, K., Izsvk, Z., and Ivics, Z. (2008). Targ eted gene insertion for molecular medicine. J. Mol. Med 86, 1205-1219. Vorburger, S. A., and Hunt, K. K. (2002). Adenoviral Gene Thera py. Oncologist 7, 46-59. Walters, R. W., Yi, S. M., Keshavjee, S., Brown, K. E., Welsh, M. J., Chiorini, J. A., and Zabner, J. (2001). Binding of adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene transfer. J. Biol. Chem 276, 20610-20616. Walters, R. W., Agbandje-McKenna, M., Bowman, V. D., Moninger, T. O., Olson, N. H., Seiler, M., Chiorini, J. A., Baker, T. S., and Zabner, J. (2004). Structure of adeno-associated virus serotype 5. J. Virol 78, 3361-3371. Walther, W., and Stein, U. (2000). Viral vectors for gene transfer: a review of their use in the treatment of human diseases. Drugs 60, 249-271.

PAGE 210

210 Wang, G., Porta, C., Chen, Z., Baker, T. S., and Johnson, J. E. (1992). Identification of a Fab interaction footprint site on an icosahedral virus by cryoelectron microscopy and X-ray crystallography. Nature 355, 275-278. Wang, L., Calcedo, R., Nichols, T. C., Bellinger, D. A., Dillow, A., Verma, I. M., and Wilson, J. M. (2005). Sustained correction of disease in naive and AAV2-pretreated hemophilia B dogs: AAV2/8-mediated, liver-directed gene therapy. Blood 105, 3079-3086. Wang, L., Calcedo, R., Wang, H., Bell, P., Grant, R., Vandenberghe, L. H., Sanmiguel, J., Morizono, H., Batshaw, M. L., and Wilson, J. M. (2010). The pleiotropic effects of natural AAV infections on liver-directed gene transfer in macaques. Mol. Ther 18, 126134. Wang, L., Figueredo, J., Calcedo, R., Lin, J., and Wilson, J. M. (2007). Cross-presentation of adeno-associated virus serotype 2 capsids activates cytotoxic T cells but does not render hepatocytes effective cytolytic ta rgets. Hum. Gene Ther 18, 185-194. Wang, Z., Zhu, T., Qiao, C., Zhou, L., Wang, B., Zhang, J., Chen, C., Li, J., and Xiao, X. (2005). Adeno-associated virus serotype 8 efficiently delivers genes to muscle and heart. Nat. Biotechnol 23, 321-328. Warrington, K. H., and Herzog, R. W. (2006). Trea tment of human disease by adeno-associated viral gene transfer. Hum Genet 119, 571-603. Waters, B., and Lillicrap, D. (2009). The immunol ogy of gene transfer: an overview. In Gene Therapy Immunology, R. W. Herzog, ed. (N ew Jersey: Wiley-Blackwell), pp. 1-18. Weber, M., Rabinowitz, J., Provost, N., Conrath, H., Folliot, S., Br iot, D., Chrel, Y., Chenuaud, P., Samulski, J., Moullier, P., et al. (2003). Recombinant adeno-associated virus serotype 4 mediates unique and exclus ive long-term transduction of retinal pigmented epithelium in rat, dog, and nonhuman primate after s ubretinal delivery. Mol. Ther 7, 774-781. Weger, S., Wistuba, A., Grimm, D ., and Kleinschmidt, J. A. (1997) Control of adeno-associated virus type 2 cap gene expression : relative influence of helper virus, terminal repeats, and Rep proteins. J. Virol 71, 8437-8447. Weitzman, M. (2006). The parvoviru s life cycle: an in troduction to molecular interactions important for infection. In Parvoviruses, J. R. Kerr, M. E. Bloom, R. Linden, and C. R. Parrish, eds. (New York: Oxford University Press Inc.), pp. 143-56. Wells, D. J. (2004). Gene Therapy Progress and Prospects: Electroporation and other physical methods. Gene Ther 11, 1363-1369.

PAGE 211

211 Wikoff, W. R., Wang, G., Parrish, C. R., Cheng, R. H., Strassheim, M. L., Baker, T. S., and Rossmann, M. G. (1994b). The structure of a neutralized virus: canine parvovirus complexed with neutralizing anti body fragment. Structure 2, 595-607. Wilson, J. M. (1996). Adenoviruses as gene-d elivery vehicles. N. Engl. J. Med 334, 1185-1187. Wilson, J. M. (2009). Progress in the Commercial -Scale Production of Adeno-Associated Viral Vectors. Human Gene Therapy 20, 695-695. Wistuba, A., Kern, A., Weger, S., Grimm, D., and Kleinschmidt, J. A. (1997). Subcellular compartmentalization of adeno-associated virus type 2 assembly. J. Virol 71, 1341-1352. Wistuba, A., Weger, S., Kern, A., and Kleinsch midt, J. A. (1995). Intermediates of adenoassociated virus type 2 assembly: identifica tion of soluble complexes containing Rep and Cap proteins. J. Virol 69, 5311-5319. Wolff, J. A., Malone, R. W., Williams, P., Chong, W., Acsadi, G., Jani, A., and Felgner, P. L. (1990). Direct gene transfer into mouse muscle in vivo. Science 247, 1465-1468. Wu, H., Ceccarelli, D. F., and Frappier, L. (2000). The DNA segregation mechanism of EpsteinBarr virus nuclear antigen 1. EMBO Rep 1, 140-144. Wu, P., Xiao, W., Conlon, T., Hughes, J., Agbandj e-McKenna, M., Ferkol, T., Flotte, T., and Muzyczka, N. (2000b). Mutational Analysis of the Adeno-Associated Virus Type 2 (AAV2) Capsid Gene and Construction of AAV 2 Vectors with Altered Tropism. J Virol 74, 8635-8647. Wu, Z., Asokan, A., and Samulski, R. J. (2006). Ad eno-associated virus sero types: vector toolkit for human gene therapy. Mol. Ther 14, 316-327. Wu, Z., Miller, E., Agbandje-McKenna, M., a nd Samulski, R. J. (2006). Alpha2,3 and alpha2,6 N-linked sialic acids facilitate efficient binding and transduction by adeno-associated virus types 1 and 6. J. Virol 80, 9093-9103. Xenariou, S., Liang, H., Griesenbach, U., Zhu, J., Farley, R., Somerton, L., Singh, C., Jeffery, P. K., Scheule, R. K., Cheng, S. H., et al. (2010). Low-frequency ultrasound increases nonviral gene transfer to the mouse lung. Acta Biochim. Biophys. Sin. (Shanghai) 42, 45-51. Xiao, W., Chirmule, N., Berta, S. C., McCulloug h, B., Gao, G., and Wilson, J. M. (1999). Gene therapy vectors based on adeno-associ ated virus type 1. J. Virol 73, 3994-4003. Xie, Q., Bu, W., Bhatia, S., Hare, J., Somasunda ram, T., Azzi, A., and Chapman, M. S. (2002). The atomic structure of adeno-associated virus (AAV-2), a vector for human gene therapy. Proc. Natl. Acad. Sci. U.S.A 99, 10405-10410.

PAGE 212

212 Xiong, C., Levis, R., Shen, P., Schlesinger, S ., Rice, C. M., and Huang, H. V. (1989). Sindbis virus: an efficient, broad hos t range vector for gene expression in animal cells. Science 243, 1188-1191. Xu, J., Ma, C., Bass, C., and Terwilliger, E. F. (2005). A combination of mutations enhances the neurotropism of AAV2. Virology 341, 203-214. Yan, X., Dryden, K. A., Tang, J., and Baker, T. S. (2007). Ab initio random model method facilitates 3D reconstruction of icosahed ral particles. J. Struct. Biol 157, 211-225. Yan, X., Sinkovits, R. S., and Baker, T. S. (2007). AUTO3DEM--an automated and high throughput program for image reconstruction of ic osahedral particles. J. Struct. Biol 157, 73-82. Yan, Z., Zak, R., Luxton, G. W. G., Ritchie, T. C., Bantel-Schaal, U., and Engelhardt, J. F. (2002). Ubiquitination of both adeno-associated virus type 2 and 5 capsid proteins affects the transduction efficiency of reco mbinant vectors. J. Virol 76, 2043-2053. Yan, Z., Zak, R., Zhang, Y., Ding, W., Godwin, S., Munson, K., Peluso, R., and Engelhardt, J. F. (2004). Distinct classes of proteasome-m odulating agents cooperatively augment recombinant adeno-associated virus type 2 and type 5-mediated transduction from the apical surfaces of human airw ay epithelia. J. Virol 78, 2863-2874. Yang, L., Jiang, J., Drouin, L. M., Agbandje-McKe nna, M., Chen, C., Qiao, C., Pu, D., Hu, X., Wang, D., Li, J., et al. (2009). A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selecti on. Proc. Natl. Acad. Sci. U.S.A 106, 39463951. Yang, Y., Li, Q., Ertl, H. C., and Wilson, J. M. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung -directed gene therapy with recombinant adenoviruses. J. Virol 69, 2004-2015. Yates, F., Malassis-Sris, M., Stockholm, D., Bouneaud, C., Lar ousserie, F., Noguiez-Hellin, P., Danos, O., Kohn, D. B., Fischer, A., de Villart ay, J., et al. (2002). Gene therapy of RAG2-/mice: sustained correction of the immunodeficiency. Blood 100, 3942-3949. Yates, V. J., el-Mishad, A. M., McCormick, K. J., and Trentin, J. J. (1973). Isolation and characterization of an Avian adenovirus-a ssociated virus. Infect. Immun 7, 973-980. Yoshimoto, K., Rosenfeld, S., Frickhofen, N., Kennedy, D., Hills, R., Kajigaya, S., and Young, N. S. (1991). A second neutralizing epitope of B19 parvovirus implicates the spike region in the immune response. J. Virol 65, 7056-7060. Yu, C., Yuan, Z., Cao, Z., Wang, B., Qiao, C., Li J., and Xiao, X. (2009). A muscle-targeting peptide displayed on AAV2 improves muscle tropism on systemic delivery. Gene Ther 16, 953-962.

PAGE 213

213 Zdori, Z., Szelei, J., Lacoste, M. C., Li, Y., Garipy, S., Raymond, P., Allaire, M., Nabi, I. R., and Tijssen, P. (2001). A viral phospholipase A2 is required for pa rvovirus infectivity. Dev. Cell 1, 291-302. Zaiss, A. K., and Muruve, D. A. (2008). Immunity to adeno-associated virus vectors in animals and humans: a continued challenge. Gene Ther 15, 808-816. Zaiss, A. K., and Muruve, D. A. (2005). Immune responses to adeno-associated virus vectors. Curr Gene Ther 5, 323-331. Zanta, M. A., Boussif, O., Adib, A., and Behr, J. P. (1997). In vitro gene delivery to hepatocytes with galactosylated polyethylenimine. Bioconjug. Chem 8, 839-844. Zhang, H., High, K. A., Wu, Q., Yang, P., Schl achterman, A., Yu, S., Yi, N., Hsu, H., and Mountz, J. D. (2005). Genetic analysis of the antibody response to AAV2 and factor IX. Mol. Ther 11, 866-874. Zhang, X., Walker, S. B., Chipman, P. R., Nibe rt, M. L., and Baker, T. S. (2003). Reovirus polymerase lambda 3 localized by cryo-electron microscopy of virions at a resolution of 7.6 A. Nat. Struct. Biol 10, 1011-1018. Zhou, Z. H. (2008). Towards atomic resolution structural determination by single-particle cryoelectron microscopy. Current Opinio n in Structural Biology 18, 218-228. Zolotukhin, S., Byrne, B. J., Mason, E., Zolotukh in, I., Potter, M., Chesnut, K., Summerford, C., Samulski, R. J., and Muzyczka, N. (1999). Recombinant adeno-associated virus purification using novel methods improves infe ctious titer and yield. Gene Ther 6, 973985. Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., and Muzyczka, N. (1996). A "humanized" green fluorescent protein cDNA adapted for hi gh-level expression in mammalian cells. J. Virol 70, 4646-4654. Zolotukhin, S., Potter, M., Zolotukhin, I., Sakai, Y., Loiler, S., Fraites, T. J., Chiodo, V. A., Phillipsberg, T., Muzyczka, N., Hauswirt h, W. W., et al. (2002). Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28, 158-167.

PAGE 214

214 BIOGRAPHICAL SKETCH Brittney Lynn Gurda was born in Hinsdale, Illinois to Thomas and Christine Gurda. Her family moved from Chicago to Orlando, Florida in the spring of 1985. She has two siblings. Senior to her is CaryBeth Bevan, who is married to Nathan Bevan. She has one nephew, Corbin Bailey Stevens, and two nieces, Eden and Rowan Bevan. Her brother, Dean Thomas is younger only by 25 months. Like most kids with a love for her pets Brittneys original goal was to become a veterinarian. She graduated from Dr. Philips High School in May 1996 and immediately moved to New Smyrna Beach to begin work at Beachwood Animal Hospital under Dr. Donald Needham, D V M. While acquiring experience in the veterinary setting she went to school full time at Daytona Beach Community College. She returned to Orlando, Fl in the summer of 1997 and continue d her undergraduate education at V alencia Community College while working part time to fund her schooling. She eventually obtained her Associate in Arts from VCC in 1999 and began the necessary requirements for a Bachelor in Science in microbiology and mol ecular b iology at the University of Central Florida. Wanting to eventually transfer t o the University of Florida for vet school, Brittney moved to Gainesville, Florida in 2003. While attending UF, Brittney began undergraduate research under the guidance of Dr. Mavis Agbandje -McKenna, Ph.D. in the department of Biochemistry and Molecular Biology. This experience opened her up to a whole new realm of medicine and after graduating in the spring of 2004 from UF with a BS in microbiology and cell s cience she acq uired a full -time position with Dr. Agbandje McKenna as a laboratory technician. This role eventually led to her acceptance into the Interdisciplinary Program in Biomedical Sciences in the College of Medicine in the fall of 2005 where she continued her res earch as a graduate assistant in the A gbandje McKenna laborator y.