<%BANNER%>

Development of an Improved Seed Screening Method for Fusarium circinatum, Causal Agent of Pitch Canker Disease

Permanent Link: http://ufdc.ufl.edu/UFE0041540/00001

Material Information

Title: Development of an Improved Seed Screening Method for Fusarium circinatum, Causal Agent of Pitch Canker Disease
Physical Description: 1 online resource (29 p.)
Language: english
Creator: Dreaden, Tyler
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Forest Resources and Conservation -- Dissertations, Academic -- UF
Genre: Forest Resources and Conservation thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Fusarium circinatum is a serious pathogen of Pinus spp. worldwide, causing pitch canker disease. The pathogen can contaminate seeds both internally and externally and is readily disseminated via contaminated seed. Many countries require pine seeds to be screened for the pathogen before they can be imported. The currently accepted screening method is based on culturing the pathogen and identifying it morphologically. This method is time consuming and does not necessarily identify the pathogen to the species level. A high throughput, economical and specific seed screening method is needed. A real time PCR procedure and a bulk DNA extraction to screen seeds for the presence of F. circinatum were developed. The real-time PCR method detected the pathogen in 5 of 6 commercial seed lots tested and has a detection limit of 1x10-5ng of F. circinatum DNA. The culture based method detected Fusarium spp. in 4 out of 6 of the same seedlots. The real-time PCR method can screen a seedlot in two days while the culture based method requires a minimum of one to two weeks. This new real-time PCR seed screening method allows for fast, sensitive screening of slash pine seed and can handle large volumes of seed.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Tyler Dreaden.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Smith, Jason A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041540:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041540/00001

Material Information

Title: Development of an Improved Seed Screening Method for Fusarium circinatum, Causal Agent of Pitch Canker Disease
Physical Description: 1 online resource (29 p.)
Language: english
Creator: Dreaden, Tyler
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: Forest Resources and Conservation -- Dissertations, Academic -- UF
Genre: Forest Resources and Conservation thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Fusarium circinatum is a serious pathogen of Pinus spp. worldwide, causing pitch canker disease. The pathogen can contaminate seeds both internally and externally and is readily disseminated via contaminated seed. Many countries require pine seeds to be screened for the pathogen before they can be imported. The currently accepted screening method is based on culturing the pathogen and identifying it morphologically. This method is time consuming and does not necessarily identify the pathogen to the species level. A high throughput, economical and specific seed screening method is needed. A real time PCR procedure and a bulk DNA extraction to screen seeds for the presence of F. circinatum were developed. The real-time PCR method detected the pathogen in 5 of 6 commercial seed lots tested and has a detection limit of 1x10-5ng of F. circinatum DNA. The culture based method detected Fusarium spp. in 4 out of 6 of the same seedlots. The real-time PCR method can screen a seedlot in two days while the culture based method requires a minimum of one to two weeks. This new real-time PCR seed screening method allows for fast, sensitive screening of slash pine seed and can handle large volumes of seed.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Tyler Dreaden.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Smith, Jason A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041540:00001


This item has the following downloads:


Full Text

PAGE 1

1 DEVELOPMENT OF AN IMPROVED SEED SCREENING METHOD FOR Fusarium Circinatum CAUSAL AGENT OF PITCH CANKER DISEASE. By TYLER DREADEN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Tyler Dreaden

PAGE 3

3 To my wife

PAGE 4

4 ACKNOWLEDGMENTS I am truly appreciative fo r the continuous support, advice, patience, and time my Committee Chair, Jason Smith, and committe e members, George Blakeslee an d Ed Barnard, have shown me. I feel privileged to have had such wonderful guidance and assistance from my advisors. I would also like to express my gratit ude to Claire Anderson, for her technical assistance; the UF Forest Genomics Lab, for allowing me to use their facilities, during the course of my research; the US Forest Service, for their support; and the members of the UF Forest Pathology l ab, for their assistance.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDG MENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 6 LIST OF FIGURES .......................................................................................................... 7 ABSTRACT ..................................................................................................................... 8 CHA PTER 1 INTRODUC TION ...................................................................................................... 9 2 METHODS .............................................................................................................. 11 Seed Lots ................................................................................................................ 11 Extraction of DNA ................................................................................................... 11 Real-Time PCR Protocol Te sting and Opti mization ................................................ 12 Dual-Labeled Probe Real-Tim e PCR ............................................................... 13 SYBR Green Real-Time PCR ........................................................................... 13 Blotter Paper Seed Screening Method.................................................................... 14 Pathogenicity Testing of Isol ates ............................................................................ 15 Data Anal ysis .......................................................................................................... 16 3 RESULTS ............................................................................................................... 18 Real-Time P CR Results .......................................................................................... 18 Blotter Paper Results .............................................................................................. 18 Pathogenicity Testing of Isol ates ............................................................................ 18 4 DISCUSSI ON ......................................................................................................... 23 LIST OF RE FERENCES ............................................................................................... 27 BIOGRAPHICAL SKETCH ............................................................................................ 29

PAGE 6

6 LIST OF TABLES Table page 2-1 Primers and dual-labled probe used in the study ................................................ 17 3-1 Slash pine seed screeni ng for the presence of Fusarium circinatum results, using the traditional blotter paper method and a new real-time PCR, primers CIRC1L and CIRC4L, method re sults ................................................................. 21 3-2 Number of suspect Fusarium circinatum isolates retrieved in each seedlot using the blotter paper me thod ........................................................................... 21 4-1 Cost of consumables and time a ssociated wit h each seed screening method ... 26

PAGE 7

7 LIST OF FIGURES Figure page 2-1 Typical macroscopic sym ptoms from slash pine pathoge nicity test 12 weeks post inoculation, water control left, Fusarium circinatum right ............................ 17 3-1 Real-time PCR ampl ification plot for Fusarium circinatum DNA, used to determine Ct values to generate a standard curve, DNA concentrations ranged from 1-0.00001 ng per reaction. ............................................................. 20 3-2 Standard curve and correlation coefficients for Fusarium circinatum DNA, final concentration ranging from 1 to 1x10-5 ng l-1, for real-time PCR using primers CIRC1L and CIRC 4L. ............................................................................ 20 3-3 Means plot for lesion length on slash pine seedlings at 12 weeks following inoculation with suspect Fusarium circinatum isolates recovered from the blotter paper method. ......................................................................................... 22 4-1 Photo of a typical blotter paper method with numerous fungal colonies growing out of t he cru shed seeds ....................................................................... 26

PAGE 8

8 Abstract of Thesis Pres ented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Master of Science DEVELOPMENT OF AN IMPROVED SEED SCREENING METHOD FOR Fusarium Circinatum CAUSAL AGENT OF PITCH CANKER DISEASE By Tyler Dreaden May 2010 Chair: Jason Smith Major: Forest Resources and Conservation Fusarium circinatum is a serious pathogen of Pinus spp. worldwide, causing pitch canker disease. The pathogen can contaminate seeds both in ternally and externally and is readily disseminated via contaminated seed. Many countries require pine seeds to be screened for the pathogen before they can be imported. The currently accepted screening method is based on culturing the pat hogen and identifying it morphologically. This method is time consuming and does not necessarily identify the pathogen to the species level. A high throughput, economic al and specific seed screening method is needed. A real time PCR procedure and a bul k DNA extraction to screen seeds for the presence of F. circinatum were developed. The real-time PCR method detected the pathogen in 5 of 6 commercial seed lots test ed and has a detection limit of 1x10-5 ng of F. circinatum DNA. The culture based method detected Fusarium spp. in 4 out of 6 of the same seedlots. The real-time PCR me thod can screen a seedlot in two days while the culture based method require s a minimum of one to two w eeks. This new real-time PCR seed screening method allows for fast, s ensitive screening of slash pine seed and can handle large volumes of seed.

PAGE 9

9 CHAPTER 1 INTRODUCTION Pitch cank er, caused by Fusarium circinatum Nirenberg & ODonnell ( F subglutinans [Wollenweb and Reinking] Nelson, Toussoun, and Marasas f. sp. pini [teleomorph: Gibberella circinata Nirenberg and ODonne ll]), is a serious disease of Pinus spp. in many parts of the world. It was first described in 1946 by Hepting and Roth in North Carolina (10). The pathogen is now known to occur in many parts of the world including Chile, Italy, Po rtugal, Spain, and South Africa (10, 22, 6, 16) and was intercepted and eradicated in New Zealand (15). F. circinatum can infect a susceptible host at any point in its life cycle: flower, seed, seedling, and mature tree (3). The pat hogen may also infect almost any part of a susceptible host including: shoots, branches cones, seeds, stem s, and exposed roots (21). The exact symptoms can vary betw een hosts and location. Typical symptoms include flagging, or dieback of lateral or terminal shoot s caused by the pathogen girdling the shoot (21). The xylem tissue of the infected shoot becomes impregnated with resin and this is excreted on the outside of the shoots where it will frequently cause the dead needles to adhere to the dead shoot for over a year. Pitch canker can also cause significant losses in nurseries where symptoms include damping off and dieback, (21, 11). Pitch canker poses a threat to susceptible Pinus spp. in both native and planted forests around the world. Because F. circinatum is readily transported in and on Pinus seed, many countries require Pinus seed to be screened for the presence of the pathogen before they can be imported (2). Currently the International Seed Testing Association (ISTA) and United States Department of Agriculture seed screening method

PAGE 10

10 relies on culturing the pathogen out of s eed on blotter paper and identifying suspect colonies morphologically (7). This method does not reliably identify suspect colonies to the species level because coiled hyphae, wh ich are needed to identify colonies as F. circinatum, are not always produced. This lack of certainty at species level can cause false positives due to mis-identification of su spect colonies. This method can also lead to false negatives because F. circinatum isolates can be easily overlooked because of the many fungi that can grow out of the s eeds and their close prox imity to each other. This method makes screening large numbers of seeds difficult because of the 1-2 or more weeks and many hours of time needed to screen a seed lot. Because of these limitations a new F. circinatum seed screening method is needed that is high throughput, accurate, and cost effective. Two real-time PCR methods for detecting F. circinatum have been published. The first, by Schwiegkofler et al (18), was used to measure ai rborne conidia and not tested on seeds. The second method was developed by I oos et al. (12), this method was used to detect F. circinatum in seed using a bio-enrichment step and extracting DNA from a sub-sample of the seed. In our study a batch DNA extraction procedure was used in an attempt to yield a faster yet sensitive and accurate F. circinatum seed screening method. The objectives of this study were to 1) develop an improved real-time PCR screening method for F. circinatum in seeds; 2) screen commercial slash pine ( P. elliottii var. elliottii) seed lots with the blotter paper based method (6, 1) and the new real time PCR based method (16); and 3) compare the detection results, cost, and time needed for both methods.

PAGE 11

11 CHAPTER 2 METHODS Seed Lots Six commercially available seedlots of Pinus elliottii Engelm. var. elliottii consis ting of approximately 5000 seed each where used in the study. The seedlots were collected between 2003 and 2007 from three different orchard lo cations (3 from southern Mississippi, 1 from southern G eorgia, and 1 from southern Loui siana). All of the seeds used were obtained from the International Fo rest Company (Moultrie, Georgia). The seeds were stored at 4C before they were processed. Extraction of DNA DNA was extracted from 400 seeds (approximately 15 g) per seedlot. A CTAB (hexadecyl trimethyl-ammoni um bromide)-based DNA extrac tion method was used (5, 8, 13). For each lot, seeds were ground with liquid nitrogen using a mortar and pestle. The ground seed was placed in 250 ml cent rifuge bottles with 90 ml of nuclear extraction buffer (60 ml nucl ear lysis buffer (200 mM Tris (tris(hydroxymethyl)aminom ethane), 50 mM EDTA (ethylenediaminetetraacetic acid), 2 M NaCl, 2% (g/ml) CTAB, pH to 7.5 with HCl )), 40 ml water and 0.8 g Na bisulphate, 18 ml of 5% (g/ml) N-laurol sarcosine, and 10 ul RNAse A (Thermo Scientific Epsom, Surrey, UK), which was then inverted 5-6 times to mix. The centrifuge bottles were incubated at 65 C for 20 min; then chilled on ice to room temperature. An equal volume of 25:24:1 phenol (pH 7.9):choloform:Iso-Amyl alcohol was added and mixed by inverting 30 times, then centrifuged for 15 min at 15,300 rcf (relative centrifugal force). The supernatant was transferred to a new 250 ml tube where an equal volume of chloroform was added and inverted 30 times to mix before being centrifuged for 15 min

PAGE 12

12 at 15,300 rcf. The supernatant was transfe rred to a new 250 ml tube and isopropanol (0.6 times the volume of supernatant) was added, inverted 5-6 times to mix, and centrifuged for 15 min at 3220 rcf. The DNA pellet was left at the bottom of the tube while the supernatant was poured off and disca rded. The DNA pellet was washed with 2 ml of 75% ethanol and centrifuged at 3220 rc f for 5 min. The ethanol wash was discarded and the DNA pellet was left to air dry before being re -dissolved in 2 ml of TE buffer (10 mM Tris, 1 mM EDTA, bring to pH 8 with HCl). All DNA extractions were visualized on a 1.5% (g /ml) agarose gel to check genomic DNA quality. Each DNA extraction was purified using PVPP (polyvinylpolypyrrolidone) columns adapted from Schena and Ippolito (18). The bottom of the spin column (Fisher Scientific Inc., Suwanee, Georgia) was removed, approximately 40 mg of PVPP was placed inside the spin column and the column was placed in a collection tube. 400 l of water was added to the columns and centrif uged at 3,380 rcf for 3 min; this was repeated with 200 l of water to pack the PVPP in the columns. The columns were placed in new 1.5 ml collection tubes, 50 l of DNA was added and centrifuged at 3,380 rcf for 3 min. The flow-through cont aining the purified DNA was retained. The concentration of the purified DNA was determined using a ND-1000 spectrophotometer (NanoDrop Technologies In c. Wilmington, Delaware) and all seed DNA extractions were diluted with water to 50 ng/l for use with real-time PCR. Real-Time PCR Protocol Testing and Optimization Two different real-time PCR protocols were tested to determine if o ne method was better suited for the detection of F. circinatum in seed. The first was developed by Ioos et al. (12) and uses a dual-labeled probe as the detection method. The second real-

PAGE 13

13 time PCR protocol was developed by Schwei gkofler et al. (19) and uses SYBR Green as the detection method. Dual-Labeled Probe Real-Time PCR The dual-labeled probe based pr otocol (12), using primers FCIR-F and FCIR-R and probe FCIR-P, Table 2-1, was tested using F. circinatum DNA extracted from a pure culture and DNA extracted from F. circinatum contaminated seed. Multiple, longer than expec ted (250-1000 bp), amplicons we re observed when the real-time PCR products were analyzed on a 1.5% (g/ml) agar ose gel while using the published protocol (12). A range of MgCl2 concentrations, 2-6 mM, and two commercial polymerases were used to eliminate the additional amplicons; how ever, they persisted. This method was not used in the study because of the pr oblems with additional amplicons and low sensitivity. SYBR Green Real-Time PCR The SYBR Green based real-time PCR prot ocol, using the primers CIRC1A and CIRC4A, was developed by Schweigk ofler et al. (19) to detect and quantify airborne conidia of F. circinatum When using the PCR reaction and thermocycling protocol described in the paper, primer dimer formati on was consistently a problem. Several polymerases, magnesium concentrations, and al terations to the thermocycling protocol were tried but none eliminated the primer dimer, thus a new method was employed. The software program, Primer3 (7), was used to assess the compatibility of the primers with themselves and the inter-genic spacer (IGS) region of the rDNA of F. circinatum Results indicated that by adding four bases to the 3 end of primer CIRC1A and three bases to the 3 end of primer CIRC4 A, the primers would be more compatible

PAGE 14

14 with each other, Table 2-1. Using the m odified primers, renam ed CIRC1L and CIRC4L, a single amplicon, without prim er dimer, was achieved. For SYBR Green real-time P CR, each reaction consisted of 2.5 l of 10x PCR buffer, 2.5 l of 2 mM deoxy nucleoside triphosphate, 1 l of 10 mM CIRC1L, 1 l of 10 mM CIRC4L, 0.4 l of 10x SYBR Green solu tion (Lonza Inc., Rockland, Maine), 0.1 l Platinum Taq polymerase (Invitrogen Corp ., Carlsbad, California), 15.45 l H2O, and 1 l of DNA template. Integrated DNA Technolog ies Inc. (Skokiw, Illinois) synthesized all of the primers and probes used in this study A range (63-72C) of primer annealing temperatures was tested with 66C being optim al (data not shown). The thermocycling profile consisted of denaturation for 180 s, followed by 45 cycl es of 95C for 35 s, 66C for 55 s, and 72C for 50 s and a melting curve analysis was performed upon completion. All real-time PCR reactions us ed in this experiment were replicated in triplicate using an Eppendorf Mastercycler ep Realplex (E ppendorf Inc., Hauppauge, NY). Blotter Paper Seed Screening Method The protocol for the bl otter paper s eed screening method can be found in the International Seed Testing Association Se ed Health Testing Methods (7) and was originally developed by Anderson (1). A summary of the method is presented here. Blue blotter paper, (House of Doolilittle. Chica go, Illinois) was cut to fit inside 125x125 mm autoclavable plastic boxes with trans parent lids. The paper, boxes, and PCNB (Pentachloronitrobenzene) medium (15 g peptone, 5 g MgSO4H2O, 1 g KH2PO4, 1 g Terraclor 75% WP (PCNB), 1 l ddH2O, after autoclaving add 1 g streptomycin sulphate and 0.12 g neomycin sulfate) was autoclaved then transferred to a laminar flow hood where all culture work was c onducted. One piece of blo tter paper was placed inside the

PAGE 15

15 box, 12 ml of PCNB broth was evenly applie d to the paper. After the medium was absorbed by the paper, 25 seeds were plac ed on the paper and cracked/crushed using a flame sterilized aluminum template/crusher; alternatively, a piece of ridged plastic can be used to crush seed as described in the ci tations above. Two drops of PCNB broth were applied to each of the cracked seeds. The lids were sealed with Parafilm and the boxes were placed in a growth chamber se t at 20C with a 12 h photo period for 7-10 days. All suspect Fusarium colonies were transferred to ca rnation water agar (20 ml of 2-4 mm carnation leaf fragment s, and 15 g agar in 1l of H2O (9)), and stored at 20C with a 12 h photo period for 7-10 days before colonies where identified morphologically as described by ISTA (7) and Anderson (1). The ISTA guidelines do not require/recommend subculturing suspect F. circinatum colonies on carnation water agar media but it was done to help differentiate between and identify t he large number of fungi that rapidly grew out of the seed. Pathogenicity Testing of Isolates Slash pine seedlings from the halfsib fa mily FA2 were grown from seed in a greenhous e for six months without the use of pesticides. Twel ve of the morphologically identified F. circinatum isolates from the blotte r paper seed screening method were plated on carnation water agar and grown at 20C with a 12 h photo period for 10 days before the spores were harvested by wash ing the plates with 2 ml of sterile H2O. The inoculations were performed the same day. The microand macroconidial spore suspensions were diluted to 1,000,000 spores per ml in sterile H2O using a hemacytometer. The experiment was set up as a complete block design with all 12 isolates and a water control present once in each of the 6 blocks (13 shoots per block). The shoot and upper portion of each seedling used was sprayed with 70% ethanol.

PAGE 16

16 After the ethanol had evaporated the tips of the shoots to be inoculated were excised using sharp flame-sterilized sciss ors. Within a few seconds of removing the shoot tip, 25 l of inoculum (or water control) was placed on the excised shoot tip so that the inoculum droplet did not fall off. After the seedling inocul ations were completed, the inoculum was streaked on PCNB agar plates to check the spore germination rates. Spore germination was determined 18 h later. The seedlings were maintained in a greenhouse without the use of pesticides. After three months, the lengths of necrotic lesions on shoots were measured before the s hoots were removed for isolation of the pathogen. Figure 2-1 shows typical macroscopi c symptoms. The shoots were trimmed to remove needles and excess resin, and then dipped in 95% ethanol, briefly flame sterilized, and the tips of the shoots where the inoculum was placed were removed while the remaining shoots were plated on P CNB agar. The colonies were grown at 20C with a 12 h photo period. After the col onies were 1-2 cm in diameter, suspect F. circinatum colonies were transferred to carn ation water agar for morphological identification as described above. Data Analysis Realplex 2. 0 software (Eppendorf Inc. Hauppauge, New York) was used to determine the Ct (count threshold) values fo r each reaction and the regression analysis needed to determine the amount of target DNA in each reaction using a standard curve. PASW Statistics 18 (SPSS Inc. Chicago, Illinois) was used to perform a Duncans multiple range tests comparing the necrotic lesion lengths in the F. circinatum pathogenicity study.

PAGE 17

17 Table 2-1. Primers and dual-labled probe used in the study Name Sequence (5'-3')a Product size (bp) CIRC1A b CTTGGCTCGAGAAGGG 360 CIRC4A b ACCTACCCTACACCTCTCACT CIRC1L c CTTGGCTCGAGAAGGGACA 360 CIRC4L c ACCTACCCTACACCTCTCACTTT FCIR-F d TCGATGTGTCGTCTCTGGAC 150 FCIR-R d CGATCCTCAAATCGACCAAGA FCIR-P d 5' /56-FAM/CGAGTCTGGCGGGACTTTGTGC/3BHQ_1/ 3' a 6-FAM = 6-carboxyfluorescein, BHQ1 = Black Hole Quencher 1, r egistered trademark of Biosearch Technologies Inc. b (16) c Based on (16) d (10) Figure 2-1. Typical macroscopic symptoms fr om slash pine pathogenicity test 12 weeks post inoculation, water control left, Fusarium circinatum right

PAGE 18

18 CHAPTER 3 RESULTS Real-Time PCR Results The CIRC1L/ CIRC4L primer combination showed a linear association between Ct and initial DNA concentration. Fi gure 3-1 presents the amp lification plot which shows the Ct values that are used to make the standard curve (Figure 3-2), and F. circinatum template DNA down to 1x10-5 ng per reaction. The lowest amount of F. circinatum template DNA that was detected was 1x10-6 ng in the real-time PCR reaction; however, this fell outside the linear response of the standard curve. F. circinatum DNA was detected in Seedlots 1, 2, 3, 4, and 6. In Seedlot 4, two of the three 400 seed replicates were positive (Table 3-1). In Seedlot 5, one of the replicates amplif ied but the Ct value was below the threshold of detection. Blotter Paper Results The Blotter paper method as described by the International Seed Testing Association (7) does not allow for identif ication of suspect colonies to the F. circinatu m level since this method does not reliably produce coiled hyphae, which are needed to identify the cultures as F. circinatum The blotter paper seed screening method detected suspect F. circinatum in all seedlots except Seedlot 5 (Table 3-1, Table 3-2). Only one suspect F. circinatum isolate was found in Seedlot 4 and after inoculating slash pine seedlings, it was found to not be pathogenic and is not F. circinatum resulting in a false positive. Pathogenicity Testing of Isolates The inoculum spore germination rates were all higher than 83% with an average of 93%. Nine of the 12 isolates, or 75%, used in the inoculation produ ced a mean necrotic

PAGE 19

19 lesion length of 34 mm and produced typical pitch canker symptoms (Figure 2-1). These isolates were considered pathogenic to the slash pine and considered to be F. circinatum Three of the 12 isolates, or 25%, us ed in the inoculation did not produce a significantly greater amount of shoot necrosis length (mean 4 mm) than the water controls, (Figure 3-3) using Duncans test with alpha = 0.05. These three isolates were considered to be nonpathogenic and not F. circinatum Suspect F. circinatum was reisolated out of 89% of the inoculated seedlings.

PAGE 20

20 Figure 3-1. Real-time P CR amplification plot for Fusarium circinatum DNA, used to determine Ct values to generate a standard curve, DNA concentrations ranged from 1-0.00001 ng per reaction. Figure 3-2. Standard curve and correlation coefficients for Fusarium circinatum DNA, final concentration ranging from 1 to 1x10-5 ng l-1, for real-time PCR using primers CIRC1L and CIRC4L.

PAGE 21

21 Table 3-1. Slash pine seed screening for the presence of Fusarium circinatum using the traditional blotter paper method and a new real-time PCR, primers CIRC1L and CI RC4L, method results Seedlot IFC # Seed lot number Blotter method CIRC1L-CIRC4L 63105 1+ + 63111 2+ + 63112 3+ + 64177 4-a + b 64281 5c 62667 6+ + a One suspect Fusarium circinatum isolate was recovered however after inoculating seedlings is was found not to be the pathogen F. circinatum b One of the three 400 seed replicates was negative for F. circinatum c One of the three 400 seed replicates was positive for F. circinatum but it fell outside of the reliable detection limit of 1x10-5 ng Table 3-2. Number of suspect Fusarium circinatum isolates retrieved in each seedlot using the blotter paper method Seedlot Number of colonies Number of isolates pathogenicity tested Number of pathogenic isolates 1 15 3 3 2 20 3 3 3 7 3 1 4 1 1 0 5 0 6 2 2 2

PAGE 22

22 Figure 3-3. Means plot for lesion length on slash pine seedlings at 12 weeks following inoculation with suspect Fusarium circinatum isolates recovered from the blotter paper method.

PAGE 23

23 CHAPTER 4 DISCUSSION Although real-time PCR has been used to detect F. circinatum in s eeds previously (12), no attempt has been made to apply this methodology to the standard of seed testing required by the ISTA. Our attemp ts to repeat or successfully modify the published methodology of Ioos et al. (12) repeatedly met with fa ilure. Thus, we modified the protocol of Schweigkofler et al.(19). Th is modification consistently led to highly sensitive detection of F. circinatum down to at least 1x10-5 ng per reaction. The value of the real-time PCR based method is illustrated by Seedlot 4. This method allowed detection of F. circinatum in two of the three 400 seed rep licates from Seedlot 4. The blotter paper method yielded a false positiv e for Seedlot 4 because the one suspect F. circinatum isolate was found to not be F. circinatum based on pathogenicity testing. The blotter paper method may have been able to detect F. circinatum from Seedlot 4 if three sets of 400 seeds were screened, as was the case with the real-time PCR method, instead of one but this would add c onsiderable time and cost to the seed screening. The potential for false negativ e results with the ISTA method appears to be high based on our study. This protocol calls for suspect F. circinatum colonies to be identified directly fr om the blotter paper. We found this was hard to accomplish because of the large number of fungi growing out of the seed in close proximity to each other (Figure 4-1). This can make it hard to distinguish individual colonies, causing F. circinatum to be missed because they are intermingl ed with other fungi. This problem is exacerbated if suspect colonies are not subcultured early and identified from the subcultures. Therefore, it was necessary to subculture the suspect colonies on

PAGE 24

24 carnation water agar before identification. Once suspect colonies are transferred, reliable identification of F. circinatum is further complicated by the inconsistent production of coiled hyphae a di stinguishing characteristic of this species (14). The potential for international movem ent of falsely certified seed lots threatening nurseries, forestry operations, and potentially native ec osystems would seem quite high with this methodology. Real-time PCR provides a means to avoid these pitfalls as it is highly sensitive and the method is not affected by mi xed samples or presence of other fungi. The potential for false positive results using the ISTA methodology is similarly high due to the fact that confirmati on of suspect colonies identity as F. circinatum is not recommended by the protocol. We chose to confirm identity based on pathogenicity tests as an additional step to address the issue of false positives. Indeed, some samples that were tentatively considered positive based on the ISTA protocol were not pathogenic in our test and woul d therefore, likely not be F. circinatum based on this criterion. Due to the specificity of the real-time PCR primers, only F. circinatum will amplify and be detected with this method. Thus, the chance for false positives is greatly reduced when this method is employed. In Table 4-1, the cost of consumabl es and time associated with each seed screening method is given. The times are an approximation because the times associated with screening seedlo ts are based on seed contamination levels, facilities, and personnel conducting the screening. In general, the blotter paper screening will take between 10-18 days and 9 hours with a cost of $4-17, depending on whether suspect colonies are subcultured before i dentification, while the real-time PCR based method will take 2 days and 3 hours with a cost of $3 per seedlot. The real-time PCR

PAGE 25

25 seed screening method does require more specialized equipment than some pathology labs have; however, larger centrifuges and real-time PCR machines are becoming more common. The real-time P CR based method allows more seeds to be screened with less cost and time than the blotter paper met hod; all of these factors are important in detecting the pathogen. The blotter paper method does have one advantage over the real-time PCR based method; it does not require any equipm ent that is not common in pathology labs. The detection of F. circinatum in two of the three 400 seed replicates in Seedlot 4 using the real-time PCR based method indica tes that it depends on which 400 seeds are sampled from a seedlot. If the ISTA guidelines were followed and only 400 seeds were sampled, F. circinatum might have been missed in seedlot 4 resulting in a false negative. This raises the question: How many seed per seedlot need to be screened? Ioos et al. (12) stated that there is a need for a statisti cally sound sampling method for detecting F. circinatum that might be unevenly distribut ed within a seedlot. The results from Seedlot 4 reinforce this need.

PAGE 26

26 Figure 4-1. Photo of a typical blotte r paper method with numerous fungal colonies growing out of the crushed seeds Table 4-1. Cost of consumables and time associated with each seed screening method Method Cost per seedlot ($) Average elapsed time per seedlot (days) Man hours per seedlot (hours) SYBR 3.4 2 2.7 Dual-Labeled Probe 2.3 2 2.7 Blotter Paper 16.6 18 9 Blotter Paper no subculturing 3.8 10 8.7

PAGE 27

27 LIST OF REFERENCES 1. Anderson, R.L. 1986. New method for as sessing cont amination of slash and loblolly pine seeds by Fusarium moniliforme var. subglutinans Plant Dis. 70:452-453. 2. Anonymous. Accessed 27 Nov 2009. PM 7/91(1): Gibberella circinata Pages 298309. in EPPO Bulletin Volume 39 Issue 3. 2009. Published Online DOI 10.1111/j.1365-2338.2 009.02317.x. accessed from http://www3.interscience.wiley.com/ cgi-bin/fulltext/123193600/HTMLSTART. 3. Barnard, E.L., Blakeslee, G.M. 1987 revis ed 2006. Pitch canker of southern pines. Florida Department of Agriculture and C onsumer Services, Division of Plant Industry, Gainesville. Plant Pathol. Circular No. 302. 4. Braganca, H., Diogo, E., Moniz, F., and Amar o, P. 2009. First report of Pitch canker on pines caused by Fusarium circinatum in Portugal. Plant Dis. 93:10. 5. Carlson, J.E., Tulsieram, L.K., Gl aubitz, J.C., Luk, V.W.K., Kauffeldt, C. and Rutledge, R. 1991. Segregati on of random amplified DNA markers in F1 progeny of conifers. Theor Appl Genet. 83:194. 6. Carlucci, A., Colatruglio, L., and Frisullo, S. 2007. First report of Pitch canker caused by Fusarium circinatum on Pinus halepensis and P. pinea in Apulia (Southern Italy). Plant Dis. 91:1683. 7. Don, E.R. 2002. Internati onal Seed Testing Association. Annexe to Chapter 7: Seed health testing methods. Pages 1-8. Seed Health Testing Methods. Bassersdorf, Switzerland. 8. Doyle, J.J., and Doyle, J.L. 1987. A rapi d DNA isolation procedu re for small quantities of fresh leaf tissue. Phytochem Bull. 19:11. 9. Fisher, N.L., L.W. Burge ss, T.A. Tousson, and P.E. Ne lson. 1982. Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathol. 72:151-153. 10. Hepting, G.H., and Roth, E.R. 1946. Pitch canker, a new disease of some southern pines. J. For. 44:724-744. 11. Huang, J.W., and Kuhlman, E.G. 1990. Fungi associated with damping-off of slash pine seedlings in Georgi a. Plant Dis. 74:27-30. 12. Ioos, R., Fourrier, C., Iancu, G., and Gordon, T.R. 2009. Sensitive detection of Fusarium circinatum in pine seed by combining an enrichment procedure with a real-time polymerase chain reaction us ing dual-labeled probe chemistry. Phytopathol. 99:582-590.

PAGE 28

28 13. Murray, M.G., and Thompson, W.F. 1980. Rapid isolation of high-molecular-weight plant DNA. Nuc Acids Res. 8:4321-4325. 14. Nirenberg, H.I., ODonnell, K. 1998. New Fusarium species and combinations within the Gibberella fujikuroi species. 1998. Mycologia. 90:434-458. 15. Ormsby, M. 2004. Report on the interception of Fusarium circinatum (Pitch canker) on imported seedlings of Douglas fir ( Pseudotsuga menziesii ) 11 February 2004. National Adviser, Import health st andards. MAF Biosecurity Authority. 16. Prez-Sierra, A., Landeras, E., Len, M., Berbegal, M., Ga rca-Jimnez, J., Armengol, J. 2007. Characterization of Fusarium circinatum from Pinus spp. in northern Spain. Mycol. Res. 111:832-839. 17. Rozen, S., and Skaletsky, H.J. 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawet z S, Misener S (eds) Bioinformatics Methods and Protocols: Methods Mol. Bi ol. Humana Press, Totowa, NJ, pp 365386. 18. Schena and Ippolito. 2003. R apid and sensitive detection of rosellinia necatrix in roots and soils by real time scorp ion-PCR. J.Plant Pathol. 85:15-25. 19. Schweigkofler, W., ODonnell, K., and Garbelotto, M. 2004. Detection and quantification of Fusarium circinatum the casual agent of pine Pitch canker, from two California sites by using a real-time PCR approach combined with a simple spore trapping method. Appl. Environ. Microbiol. 70:3512-3520. 20. Viljoen, A., Wingfield, M. J., Marasas, W.F.O., and Count inho, T.A. 1994. First report of Fusarium subglutinans f.sp. pini on seedlings in South Africa. Plant Dis. 78:309-312. 21. Wingfield, M.J., Hammerbacher, A., Ganl ey, R.J., Steenkamp, E.T., Gordon, T.R., Wingfield, B.D., and Coutinho, T.A. 2008. Pitch canker caused by Fusarium circinatum a growing threat to pine plantations and forests worldwide. Australas. Plant Pathol. 37:319-334. 22. Wingfield, M.J., Jacobs, J., Coutinho, T. A., Ahumada, R., and Wingfield, B.D. 2002. First report of the Pitch canker fungus, Fusarium circinatum on pines in Chile. Plant Pathol. 51:397.

PAGE 29

29 BIOGRAPHICAL SKETCH Tyler Dreaden grew up in Crestview, a town in the western Panhandle of Florida. It is here w here Tyler discovered his love of the outdoors and became interested in forestry. Tyler began his co llege career attending a then local community college, Northwest Florida State College, in Niceville Florida where he received his associates degree. From there, he transferred to the University of Florida where he graduated with his bachelors degree in forest management. It was Dr. Blakes lees Forest Health class that sparked his interest in forest pat hology and to make the decision to obtain a masters degree in forest pathology fr om the University of Florida.