<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2013-04-30.

Permanent Link: http://ufdc.ufl.edu/UFE0041465/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2013-04-30.
Physical Description: Book
Language: english
Creator: KIRKLAND,BRETT HENRY
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by BRETT HENRY KIRKLAND.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Keyhani, Nematolah.
Electronic Access: INACCESSIBLE UNTIL 2013-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0041465:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041465/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2013-04-30.
Physical Description: Book
Language: english
Creator: KIRKLAND,BRETT HENRY
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by BRETT HENRY KIRKLAND.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Keyhani, Nematolah.
Electronic Access: INACCESSIBLE UNTIL 2013-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0041465:00001


This item has the following downloads:


Full Text

PAGE 1

1 STUDIES OF BEAUVERIA BASSIANA PATHOGENICITY, SURFACE CHARACTERISTICS AND HYDROPHOBINS By BRETT KIRKLAND A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Brett Kirkland

PAGE 3

3 To JC

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my committee chair and mentor Dr. Nemat Keyhani and the other members of my committee Dr. Triplet, Dr. de Cr cy, Dr. Gurley and Dr. Boucias for their guidance and support. A special thanks to the Major Analytical Instrumentation Center (MAIC) for giving me have access to the Atomic Force Microscope. Finally, I would like to thank my family ; Mom, Dad, Laquita and Mary.

PAGE 5

5 TABLE OF CONTENTS Upage 4TACKNOWLEDGMENTS4T ................................................................................................. 4 4TLIST OF FIGURE S4T ......................................................................................................... 8 4TLIST OF ABBREVIATIONS4T .......................................................................................... 10 4TABSTRACT4T .................................................................................................................. 11 4TCHAPTER 4T1 PATHOGENESIS O F Beauveria bassiana TOWARDS TICKS .............................. 14 4TIntroduction4T ............................................................................................................ 14 4TLiterature Review4T ................................................................................................... 15 4TGeneral Biology of Beauveria bassiana4T ........................................................... 15 4TBiocontrol of Ticks4T ........................................................................................... 16 4TOxalate as an Acaracidal Virulence Factor4T ...................................................... 18 4TMaterials and Methods4T ........................................................................................... 19 4TTicks4T ................................................................................................................ 19 4TFungal Cultivation and Maintenance4T ................................................................ 19 4TBioassays4T ........................................................................................................ 20 4TScanning Electron Micr oscopy (SEM)4T ............................................................. 21 4TOxalic Acid Virulence Assays4T .......................................................................... 21 4TResults4T ................................................................................................................... 23 4TFungal Pathogenicity to Amblyomma maculatum and Amblyomma americanum Adults and Nymphs4T .................................................................. 23 4TConidial Germination on Tick Cuticle4T ............................................................... 25 4TEffect of Cuticular Lipids on Conidial Germination4T ........................................... 26 4TPathogenicity Towards Ixodidae Tick Species4T ................................................. 26 4TOxalate as an Acaracidal Virulence Factor4T ...................................................... 29 4TDiscussion4T .............................................................................................................. 33 4TPathogenicity4T ................................................................................................... 33 4TDifferential Susceptibility4T .................................................................................. 35 4TOxalic Acid Acaracidal Activity4T ......................................................................... 38 4T2 SURFACE CHARACTERISTICS AND HYDROPHOBINS OF Beauveria bassiana ................................................................................................................. 58 4TIntroduction4T ............................................................................................................ 58 4TLiterature Review4T ................................................................................................... 59 4TSurface Charac teristics of Entomopathogenic Fungi4T ....................................... 59 4THydrophobins4T................................................................................................... 62 4TMaterials and Methods4T ........................................................................................... 68 4TCultivation of Microorganisms and Chemical Reagents4T ................................... 68

PAGE 6

6 4TMicrobial Adhesion to Hydrocarbons (MATH) Assay4T ....................................... 69 4THydrophobic Interactions Chromatography (HIC) Assay4T ................................. 69 4TRNA Extraction4T ................................................................................................ 70 4TSemi quantitative Reverse Transcriptase PCR Analysis4T ................................. 71 4TIsolation and Construction of nHyd2 Gene into the pTWIN1 Expression Vector4T ........................................................................................................... 72 4TExpression and Purification4T ............................................................................. 72 4TAtomic Force Microscopy (AFM) and Transmission Electron Microscopy (TEM)4T ............................................................................................................ 74 4TThT Assay4T........................................................................................................ 74 4THyd2 Glass Surface Modification4T ..................................................................... 75 4TWater Contact Angle Measurements4T ............................................................... 76 4TLangmuir Blodgett Isotherms4T ........................................................................... 77 4T yd yd 2 Knockout Generation4T .......................................................... 77 4TTrans hyd 24T .................................................................... 78 4TResults4T ................................................................................................................... 79 4TAFM: Cell Surface Morphology4T ........................................................................ 79 4TMeasurement of Cell Surface Hydrophobicity4T .................................................. 80 4TGene Expression Analysis of the Beauveria bassiana hyd1 and hyd2 Genes4T ........................................................................................................... 80 4TProtein Expression of Recombinant Hyd24T ....................................................... 82 4TThioflavin T Self Assembly Assay4T .................................................................... 84 4TTransmission Electron Microscopy (TEM)4T ....................................................... 84 4TLB Blodgett Analysis4T ........................................................................................ 84 4TnHyd2 Surface Modification4T ............................................................................. 85 4TWater Contact Angle (WCA) Measurements4T ................................................... 85 4T hyd hyd hyd 2 Trans complementation4T ......................... 86 4TDiscussion4T .............................................................................................................. 88 4TSurface Characteristic s4T .................................................................................... 88 4TcDNA Cloning and Expression Analysis of Hydrophobins4T ............................... 92 4THydrophobin Production and Purification4T ......................................................... 93 4TnHyd2 Self assembly4T ....................................................................................... 95 4TTrans Comple hyd24T ................................................................... 98 4TAPPENDIX SURFACE MODIFICATION: ANTIMICROBIAL FILMS ....................... 120 4TLIST OF REFERENCES4T............................................................................................. 131 4TBIOGRAPHICAL SKETCH4T ......................................................................................... 148

PAGE 7

7 LIST OF TABLES UTable U Upage 4T1 14T 4TWeekly mortality rates for A. maculatum and A. americanum adults and nymphs treated with fungal suspensions4T............................................................ 44 4T1 24T 4TEffect of inoculum composition on B. bassiana mediated mortality towards adult A. maculatum and A. americanum.4T............................................................ 45 4T1 34T 4TEffect of cuticular lipid extracts derived from adult A. maculatum and A. americanum on B. bassiana spore germination and germ tube length4T .............. 46 4T1 44T 4TEffect of inoculum composition on B. bassiana induced mortality against R. sanguineus D. variabilis and I. scapularis4T ........................................................ 52 4T1 54T 4TAcaracide activity towards adult A. americanum oxalic acid concentration, and pH of cell free B. bassiana culture supernatants.4T ........................................ 53 4T2 14T 4TPrimer sequences and product sizes for semi quantitiative RT PCR F, forward; R, reverse.4T .......................................................................................... 103 4T2 24T 4TList of primers used in this study4T ...................................................................... 104 4T2 34T 4TBuffer concentrations for refolding Hyd2 protein from inclusion bodies4T ........... 105 4T2 4 Contact angle of glass surface modified with recombinant Hyd24T ..................... 115 4T2 54T 4TpH dependence of trans complementation4T ...................................................... 118

PAGE 8

8 LIST OF FIGURES UFigure U Upage 4T1 1 B. bassiana host range4T....................................................................................... 42 4T1 2 Six well culture plates with stryofoam plugs used for tick bioassays.4T ................. 42 4T1 3 Percent mortality 28 days post infection of unfed adult A. maculatum and A. americanum .4T ...................................................................................................... 43 4T1 4 Representative electron micrographs of the B. bassiana conidia mediated infection process.4T ............................................................................................... 46 4T1 5 Beauveria bassiana spore germination on tick cuticular extracts.4T ...................... 47 4T1 6 Percentage of mortality 28 d postinfection of adult R. sanguineus I scapularis and D. variabilis inoculated with B. bassiana blastospores 4T ............. 48 4T1 74T 4TWeekly mortality rates for adult R. sanguineus I. scapularis and D. variabilis inoculated with B. bassiana blastospores4T ........................................... 49 4T1 8 Weekly mortality rates for R. sanguineus I. scapularis and D. variabilis nymphs inoculated with buffer controls4T .............................................................. 50 4T1 9 Electron micrographs of the B. bassiana conidiamediated infection process.4T ... 51 4T1 10 Oxalic acid induced mortality in adult A americanum ticks.4T ............................... 54 4T1 11 pH dependence of oxalic acidinduced mortality in adult A americanum ticks.4T 55 4T1 12 Mutant screens of oxalic acid nonproducers. 4T ................................................... 56 4T1 134T 4TConcentration of oxalic acid secreted into the medium during growth in SDY broth, wildtype B bassiana, mutants A + 15 and A + 16, and mutant A+ 17 .4T 57 4T2 14T 4TPossible model for hydrophobin rodlet formation. .4T ......................................... 102 4T2 24T 4TSequence of Hyd2 and Hyd1, indicating conserved disulfide bonding pattern. .4T ............................................................................................................. 102 4T2 34T 4TVector constructs of nHyd2 and nHyd2 derivatives (see appendix).4T ................ 105 4T2 44T 4TAtomic force micrographs of B. bassiana spore types and germinating conidia. .4T ........................................................................................................... 106 4T2 54T 4TCell surface hydrophobicity of the three B. bassiana spore types assessed by MATH assay and HIC.4T ................................................................................. 107

PAGE 9

9 4T2 64T 4TExpression analysis of hyd1 and hyd2. .4T .......................................................... 108 4T2 74T 4TVector construction of the hyd2 gene inserted into pTWIN1 vector. 4T .............. 109 4T2 84T 4TLDS PAGE analysis of purified nHyd2 protein4T ................................................. 110 4T2 94T 4TnHyd2 rodlet formation timecourse as monotered by ThT binding. 4T ................ 111 4T2 104T 4TTEM micrograph of purified nHyd2 on formvar grid.4T ........................................ 112 4T2 114T 4TSurface pressure versus area isotherm of Hyd24T .............................................. 113 4T2 124T 4TSchematic diagram of drop surface transfer method used to coat glass surfaces with Hyd2 protein..4T ............................................................................. 114 4T2 134T 4TImages of receding water contact angle measurements used to determine relative change in hydrophobicity of glass surface modified with recombinant Hyd2. 4T ............................................................................................................. 116 4T2 14 AFM surface topology ...................................................................................... 4T117 4T2 154T 4TSurface phenotype of rodlet layer. 4T ................................................................. 117 4T2 164T 4T Hyd2 conidia Trans complimented with nHyd2 over a 30 day time course. 4T 118 4T2 174T 4TAFM micrographs of Gluteraldehyde fixed, UV treated, or Heat killed Hyd2 conidia that have been trans complemented. 4T ................................................. 119 4TA 14T 4TVector construction of Hyd2 derivatives.4T .......................................................... 126 4TA 24T 4TSDS PAGE gels of Hyd2 antimicrobial derivates. 4T .......................................... 127 4TA 34T 4TCleavage optim ization experiment .4T .................................................................. 128 4TA 44T 4TVector construction of A) cysHyd2 with N terminal intein and B) CM4 with C Terminal Intein.4T ................................................................................................ 129 4TA 54T 4TIPL reaction of Antimicrobial peptide with Hyd2 for surface modification.4T ........ 130

PAGE 10

10 LIST OF ABBREVIATION S AFM Atomic Force Microscop y SEM Scanning Electron Microscopy TEM Transmission Electron Microscopy PDT Potato Dextrose agar supplemented with 5 g/ml trimethoprim SAB Sabouraud Dextrose SDY Sabouraud Dextrose with Yeast Extract TFA Triflouroacetic Acid WCA Water Contact A ngle RFU Relative Fluorescence U nits DTT Dithiothreitol IPTG Isopropyl thio D galactoside SDS Sodium dodecyl sulfate PAGE Polyacrylamide gel electrophoresis PCR Polymerase chain reaction LB Luria Bertani broth

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy STUDIES OF BEAUVERIA BASSIANA S PATHOGENICITY, SURFACE CHARACTERISTICS AND HYDROPHOBINS By Brett Kirkland May 2011 Chair: Nemat Keyhani Major: Microbiology and Cell Science The entomopathogenic fungus, Beauveria bassiana represents a promising bio l ogical control agent f or insects and other arthropods, and is increasingly being studied as a model organism for examining fungal development and pathogenesis. Fungal host pathogen interactions were examined by studying B. bassiana virulence towards a range of human and animal relevant tick species including Dermacentor variabilis Ixodes scapularis, Rhipicephalus sanguineus Amblyomma ameri canum and Amblyomma maculatum Fungal development and pathogenesis was studied via elucidation of the surface characteristics of the B. b assiana conidial spore, the major dispersal and infectious propagule produced by the fungus. Ticks are considered major vectors of animal and human diseases second only to mosquitoes The effective reduction and control of tick populations remains difficult, and the ability of B. bassiana to infect a range of tick species was examined. Adult and nymphal ticks were treated with different B. bassiana cell phenotypes D ose dependent mortality toward Dermacentor variabilis, Rhipicephalus sanguineus and Ixod es scapularis the latter the major disease vector for the Lyme disease causing spirochete, was determined. These data demonstrated that B. bassiana could be effective in

PAGE 12

12 targeting ticks. A differential susceptibility towards certain tick species e.g. A. maculatum and A. americanum was noted with the former very susceptible and the latter more resistant to fungal infection. R esults indicated that inoculum conditions can gre atly affect successful virulenc e and subsequent mortality towards ticks. Treatment of ticks with fungal cells and their cell free culture supernatant resulted in increased mortality HPLC analysis of the spent growth media revealed oxalic acid as a major metabolite secreted by B. bassiana during growth suggest ing that oxalic acid may c ontribute to virulence in B. bassiana. This hypothesis was supported by experiments which suggest that oxalic acid displays a pH dependent toxicity towards ticks, indicating that its secretion by the fungus during infection of target hosts plays a role in virulence. Cell surface attachment is the first step in establishing mycosis and studies examining the attachment properties of the different B. bassiana cell types revealed that aerial conidia are able to adhere rapidly to both hydrophobic and hydrophilic surfaces Cell surface hydrophobicity, adhesion, and spore dispersal are partl y attributed to a proteinacious sporecoat called the rodlet layer, presumably consisting of proteins known as hydrophobins Hydrophobins are small amphipathic proteins involved in the for mation of aerial structures, attachment of fungal cells to surfaces and self assemble into characteristics 2 dimensional arrays. The B. bassiana hyd2 gene which codes for the Hyd2 hydrophobin was expressed in Escherichia coli as a f usion prot ein in partner with the Ssp DnaB intein domain 0Tderived from the 0T 2TSynechocystis sp0T 2T DnaB intein0T. The protein was purified from inclusion bodies and reconstituted in an active form. Self assembly of the purified

PAGE 13

13 protein was monitored via microscopy (AFM and SEM), an amyloid assembly assay based upon Thioflavin T binding, and by contact angle measurements. In addition, the purified protein was used in trans complementation assays of a B. bassiana hyd2 targeted gene knockout.

PAGE 14

14 CHAPTER 1 PATHOGENESIS OF Beauveria b assiana TOWARDS TICKS Introduction Infection by B. bassiana is a result of direct penetration of insect cuticle. This penetration uses a combination of chemical, enzymatic and mechanical methods that allows for a wide array of host susceptibility. Strains of B. bassiana have been shown to be pathogenic towards hard and soft ticks, especiall y members of the Ixodidae and Arg asidae family of ticks and we postulate that it is a promising method for their control (Benjamin et al. 2002; Kirkland et al. 2004b) In order to better understand the efficacy of B. bassiana as a biocontrol agent towards ticks, an investigation into the virulence towards hard tick species Dermacentor variabilis, Ixod e s scapularis Rhipicephalus sanguineus, Am b lyomma americanum and A mblyomma maculatum has been made. Our objective was to investigate the virulence of B. bassiana towards these important disease carrying tick species The hypothesis was that the entomopathogenic fungi B. bassiana can be used as an effective means for the reduction and control of tick populations. To further elucidate the specific mode of action during host pathogen interactions between B. bassiana and tick species we have determined that a secondary metabolite called oxalic acid is secreted and plays a role in its diverse host pathogenicity. Metabolic acids have been shown to mediate virulence towards some species of grasshopper (Bidochka & Khachatourians, 1991) High concentrations of oxal ic acid in plants are thought to discourage insect foraging and have been shown to be toxic t o honey bees and other plant pests (Alverson, 2003; Franceschi & Horner, 1980; Gregorc & Poklukar, 2003; Horner & Zindlerfrank, 1980; McConn & Nakata, 2002; Nakata,

PAGE 15

15 2002) Treatment of ticks with fungal cells and thei r cell free culture supernatants resulted in >50% mortality within 14 days as compared to almost no mortatality using d eionized HR2R0 or fresh growth media. This would indicate the presence of some important virulence factors secreted into the spent media. HPLC analysis of the spent growth media revealed oxalic acid as a major metabolite. My hypothesis was that oxalic acid is an entomopathogenic virulence factor of B. bassiana My objective was to investigate the acaracidal activity of cell free fungal culture supernatants. The results suggest ed that oxalic acid displays a pH dependent toxicity towards tick s and that its secretion may help account virulence against insects (Kirkland et al. 2005) Literature Review General Biology of Beauveria bassiana Beauveria bassiana is a filamentous fungus of the Deuteromycete (Ascomycota) in the order of Hy pocreales. It is a haploid organism with eight chromosomes and a genome size of 3444Mb (Viaud et al. 1996) Named after Augistino Bassi in the 1830s it was discovered initially infecting silkworms. It is an opportunistic entomopathogen and endophytic organism. B b assiana is found on the surface of insects as wh ite to yellowish conidios pores (Fig 1 1 ). The life cycle is most often biotrophic beginning with attached conidios pore penetrating, colonizing, exploiting, and finally producing progeny conidiospores for dis persal onto other susceptible hosts. It is under study as a biological control agent due to its broad entomopathogenic host range (Clarkson & Charnley, 1996; Ferron, 1981; Kaaya & Munyinyi, 1995; Klinger et al. 2006; Kucera & Samsinak.A, 1968; Leathers et al. 1 993; Maurer et al. 1997; McCoy, 1990; Reithinger et al. 1997) and contains a sporecoat protein composed of hydrophobins (Bidochka et al. 1995b; Holder & Keyhani, 2005) B. bassiana produces

PAGE 16

16 three mononucleated cell types; aerial conidia, blastospores, and submerged conidia (Bidochka et al. 1987; Thomas et al. 1987) Aerial conidia are 45 m in size with a round or oval shape and contain an outer rodlet layer. They are produced on solid nutrient substrates such as insect and plant hosts, or nutr ient agar. Blastospores are 612 m in size and have a hot dog shape and do not contain a rodlet layer. These spores are produc ed in nutrient liquids such as s abouraud dextrose media. Submerged conidia are the smallest of the spores ranging from 24 m i n size with a round to oblong shape and also do not contain a rodlet layer (Holder & Keyhani, 2005) Each cell type has unique surface binding properties allowing for differential attachment to substrata (Holder & Keyhani, 2005; Leland et al. 2005) Biocontrol of Ticks Biological control is the use of natural enemies towards an invasive host target. As an alternative to harsh chemical treatments, B. bassiana is widely used as an addition to integrated pest management strategies due to its broad host range. Because B. bassiana is considered to be nonpathogenic to humans it is a useful target for the study of alternative pest control that is both commercially viable and environment ally friendly. However, studies have shown B. bassiana carries reactive allergens, but the few cases of human infection by B bassiana have been seen in individuals who are immunocompr o mised (Henke et al. 2002; Kisla et al. 2000; Westwood et al. 2005) Currently, ticks a re considered one of the major vectors of human infectious diseases second only to mosquitoes in their ability to transmit diseases (Parola & Didier, 200 1) They are also a major concern for livestock animals in specific areas (Polar et al. 2008) Ticks are obligate hematophagous arthropods that parasitize almost every class of vertebrates. Lyme disease, babesiosis, tick borne encephalitis, granulocytic

PAGE 17

17 ehrlichiosis, tick bite fever (Rocky Mountain Spotted fever), and tularemia are transmitted when the tick engorges on a blood meal from an animal host (Coyle, 2002; Keirans et al. 1996; Mavtchoutko et al. 2000; Parola & Didier, 2001; Piesman et al. 1999; SinghBehl et al. 2003; Walker, 1998) Chemical acaracides such as organophosphates, carbamates, and pyrethroids are often used for successful reduction and control of tick populations (Taylor, 2001) However, these chemical acaracides are environmentally damaging and often toxic to humans and other beneficial organisms. Alternatives to harsh chemical treatment include entomopathogenic fungi and bacteri a and natural predators such as beetles, spiders, and ants but these also have their inherent drawbacks making it difficult to develop an effective non chemical tick management program (Eisler et al. 2003; George, 2000; Kaaya, 2000b; Kaaya & Hassan, 2000; Pegram et al. 2000; Samish, 2000; Sam ish et al. 2004) B eauveria bassiana and other entomopathogenic fungi have been used for the control of insects that harbor disease vector s such as mosquitoes and ticks; against agricultural pests such as whiteflies, caterpillars, grasshoppers, and borers; and against urban pests such as an ts and termites (Cruz et al. 2006; Reithinger et al. 1997; Scholte et al. 2004; Scholte et al. 2005) The conidia attach to surfaces by way of cell surface hydrophobicity (Boucias et al. 1988; Drozd & Schwartzbrod, 1996; Holder & Keyhani, 2005; Li et al. 2010) The fungal con idio spores will produce germ tubes which will penetrate into the host insect by physical mechanisms, mycotoxins, secondary metabolites, and proteases, lipases, and chitinases (Alverson, 2003; Clarkson & Charnley, 1996; Kirkland et al. 2005; Stleger et al. 1986) After penetration into the host it will proliferate in th e hemolymph as hyphal bodies, colonizing the entire host until

PAGE 18

18 conidiogenesis occurs Death of the host is due to colonization of the insect haemolymph, tissue damage, and nutrient depletion (Boucias & Pendland, 1991) Oxalate as an Acaraci dal Virulence Factor B eauveria bassiana is known to secrete an array of extracellular enzymes such as proteases, glycosidases, lipases and toxic metabolites during the infection process (Clarkson & Charnley, 1996; Gupta et al. 1992; Kucera & Samsinak.A, 1968; Stl eger et al. 1986) Metabolic acids have been shown to mediate virulence towards some species of grasshopper (Bidochka & Khachatourians, 1991) Ox alic acid (COOH)R2R is made by plants is a major organic acid secreted by several fungi (Gadd, 1999; Kubicek, 1987; Munir et al. 2001) and is a divalent cation chelator secreted during fungal metabolism. This acid has pKa values of 1.3 and 4. 3 acting as a source of both protons and electrons which makes it a potent virulence factor for both phytopathogenesis and entomopathogenesis (Alverson, 2003; Guimaraes & Stotz, 2004) It is synthesized via two maj or pathways, either from glyoxalate or Lascorbic acid. Both pathways produce oxaloacetate which is hydrolytically cleaved by the enzyme oxaloacetate acetylhydrolase (OAH) to produce oxalate and acetate (Caliskan & Cuming, 1998; Han et al. 2007) High concentrations of oxal ic acid in plants are thought to discourage insect foraging and have been shown to be toxic to honey bees and other plant bugs (Alverson, 2003; Franceschi & Horner, 1980; Gregorc & Poklukar, 2003; Horner & Zindlerfrank, 1980; McConn & Nakata, 2002; Nakata, 2002) Oxalic acid also plays a key role in the lignolytic activity and disruption of the plant cell wall of phytopathogenic fungi (Aguilar et al. 1999; Munir et al. 2001) Several pathways exist in fungi for oxal ic acid biosynthesis. In Aspergillus niger oxaloacetate hydrolase can catalyze the conversion of oxaloacetate to oxalate and

PAGE 19

19 acetate (Kubicek, 1987) whereas speci es of the phytopathogenic fungus Sclerotium can oxidize glyoxylate via the activity of a glyoxylate dehydrogenase (Balmforth & Thomson, 1984; Maxwell & Bateman, 1968) The se systems link oxal ic acid production to the tricarboxylic acid (TCA) and glyoxylate cycles, respectively. However, A. niger also possesses both a cytoplasmic pyruvate decarboxylase and oxaloacetate acetylhydrolase that would be capable of forming oxal ic acid without the reactions of the TCA cycle (Kubicek et al. 1988) In woodrotting fungi such as Fomitopsis palustris Gilbn. and Ryv., at least two additional oxal ic acid yielding routes, glyoxylate oxidase/oxaloacetase) and a flavohemoprotein glyoxylate dehydrogenase, have been described (Munir et al. 2001) Although the oxal ic acid biosynthetic pathway in B. bassiana remains to be elucidated, preliminary mapping experiments have indicated the putative presence of at least the cytoplasmic pathway similar to that described above for A. niger (Cho and N.O.K eyhani ., unpublis hed data). Materials and Methods Ticks Adult and nymphal ticks Amblyomma americanum Amblyomma maculatum Dermacentor variabilis, Rhipicephalus sanguineus and Ixodes scapularis were obtained from the Department of Entomology, Oklahoma State University Tick Rearing Facility (Stillwater, OK). Fungal Cultivation and Maintenance B. bassiana (ATCC 90517) isolated from Dysdercus sp in Peru (Gupta et al. 1992) and Metarhizium anisopliae (ATCC 20500) a soil isolate from Japan, were grown on potato dextrose agar (PDA) or S abouraud dextrose + 0.5% yeast extract on either agar plates (SDAY) containing 5 g/ml t rimethoprim, or in liquid broth (SDY). Agar

PAGE 20

20 plates were incubated at 26Po PC for 1012 days and aerial conidia were harvested by flooding the plate with sterile deionized HR2R0 containing 0.01% Tween20. Conidial suspensions were filtered through glass wool and final concentration determined by direct c ount using a haemocytometer. Liquid broth cultures were inoculated with conidia harvested from plates to a final concentration of 0.55 x 10P5P conidia/ml. Cultures were grown for 34 days at 26Po PC with aeration. Cultures were filter ed through glass wool or Mira cloth to remove mycelia, and the concentration of blastospores was determined by direct count. Filtered cell suspensions were harvested by centrifugation (10,000g, 15 min, and 4Po PC), washed two times with sterile deionized HR2RO + 0.02% Tween20, and resuspended to a concentration of 10P8P blastospores/ml. Serial dilutions were made into deionized HR2RO containing 0.01% Tween20. The culture supernatant (spent media) was filtered through a 0.22 m sterilization membrane and added back to harvested cells as indicated. Bioassays B. bassiana/ M. anisopliae: Fungal virulence towards ticks was determined using suspensions of varying spore concentrations of either plate harvested or liquid broth grown cells. Ticks were submerged for ~30 s ec in spore suspensions (ranging from 10P4P10P8P cells/ml) and the excess fungal suspension removed with either a pipet or a cotton swab. Sterile d eionized HR2RO containing 0.01% Tween 20 was applied to control ticks. Each trial included 2050 ticks, and trials at each concentration replicated three times. Ticks were placed in microtiter plates containing numerous needlepuncture holes (to allow for freeflow of air exchange) and stoppered with Styrofoam plugs (Fig 1 2). Specimens were placed in a humidity cha mber (>90% RH) with a 12 h our day ( 27Po PC )/ night (25Po PC) cycle, and the ticks were periodically examined microscopically for

PAGE 21

21 fungal growth with mortality recorded every 23 days. Tick mortality data were analyzed by PROC MIXED in SAS by using a linear mix ed model. The least significant difference (LSD) test was conducted for comparisons between treatments and control inoculations (Kuel, 2000) Scanning Electron Microscopy (SEM) Infect ed adults were examined by scanning electron microscopy (SEM) throughout the time course of the experiment. Ticks were treated with 10P8P conidia/ml B. bassiana ( replicates= 3 5 for each time point) and were examined at 24, 48, and 72 h our as well as 7 and 14 days post infection on both dorsal and ventral mounts. In instances where some mortality had occurred, both living and dead specimens were processed. Ticks were fixed in 6% glutaraldehyde in 0.1 M sodium cacodylate (pH 7.2) buffer at 4Po PC. Ticks were then washed with deionized HR2RO and dehydrated in a graded series of ethanol to absolute ethanol before treatment with hexamethyldisilazane for 30 min. Mounted samples were subsequently sputter coated with 30 nm of gold/palladium and observed using a Hitac hi S 570 scanning electron microscopy at 20KV Oxal ic Acid Virulence Assays Oxal ic acid (>99% purity) and other chemicals and reagents were purchased from Sigma (St. Louis, MO) and fisher (Pittsburgh, PA). Where indicated, culture supernatants (6 d ay ) were treated with proteinase K (MP Biomedicals, Aurora, OH) as follows: samples (2 ml) were incubated with 100 l of 10 mg/ml proteinase K solution (dissolved in dHR2R0) for 1 h our at 37Po PC. Ticks were submerged for ~60 sec in experimental solutions, and excess liquid was removed with either a pipet or a cotton swab. Test solutions included, B. bassiana culture supernatants, 50 mM sodium oxalate adjusted to pH values of 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0 by using either NaOH or

PAGE 22

22 HCl, and 1, 5, 10, 20, and 50 mM solutions of sodium oxalate, sodium formate, sodium phosphate, and sodium citrate adjusted to pH values of 7.0 and pH 4.0 with either NaOH or HCl. Each experiment included 2050 ticks, and experiments were repeated three times. Ticks were placed in conical tubes or microtiter plates containing numerous needle puncture holes (to allow for free flow of air exchange) and stoppered with Styrofoam plugs. Specimens were placed in a humidity chamber (>90%RH) with a 12 h our day (27Po PC) /night (25Po PC) cycle, w ith mortality recorded every day. Aliquots of cellfree culture supernatants were analyzed for carbohydrates and organic acids by high performance liquid chromatography (HPLC, HP Series II 1090, Hewlett Packard/Agilen, Wilmington, DE) by using an Aminex HP X 87H column (Bio Rad) run isocratically in a 4 mM HR2RSOR4R and coupled to both UV and refractive index detectors. The oxalate peak was quantified using a standard curve generated using the chemical compound. An aliquot of each supernatant was filtered through a 5,000 MW cutoff membrane (VivaScience, Binbrook Hill, Lincoln, UK), and the filtrate was acidified by addition of dilute sulfuric acid before injection (1020 l) onto the column. Chemical mutants of B. bassiana strain 90517 were produced using the a lkalyating reagent ethyl methanesulfonate (EMS) essentially as described by St. Leger et.al. (1999). Briefly, a spore suspension (0.1 ml of 15 X 10P7P conidia/ml) was added to 0.9 ml of 50 mM potassium phosphate buffer, pH 7.0, containing 10 l of EMS. C ells were incubated at 26PoP C for 5 8 h our with aeration. Samples (0.10.5 ml) were diluted 1:10 into buffer containing 10% (wt:vol) sodium thiosulfate and incubated for an additional 0.51 h our with aeration. Samples were diluted (typically to 0.51 X 10P3P viable cells/ml) and plated onto selection media (SDY containing 0.01% bromocresol purple;

PAGE 23

23 adjusted to pH 6.8). Plates were incubated at 26Po PC for 8 10 d ays Under these conditions, the wildtype B. bassiana strain produced yellow halos within 3 5 d ays (Fig 1 12). Colonies that lacked or had reduced zones of yellow (on pH 6.8 plates) were removed, and single spores were isolated and screened on solid pH indicator media over several generations (three to five times). Results Fungal Pathogenicity to Amb lyomma maculatum and A mblyomma americanum Adults and Nymphs Unfed adult A. maculatum were susceptible to the entomopathogenic fungi B. bassiana and M. anisopliae in a dosedependent manner (Fig. 13 ). B. bassiana conidia harvested from plates appeared to be more infectious against A. maculatum than B. bassiana blastospores harvested from liquid cultures. Fungal mediated mortality (55%, 28 days post infection) towards A. maculatum was observed at concentrations as low as 10P6P conidia/ml, with nearly 100% mortality at 10P8P conidia/ml (Fig. 13 B). Washed B. bassiana blastopores, however, caused little (7%) mortality at 10P6P cells/ml, but approached that of conidia harvested from agar plates at higher cell concentrations (10P8P cell/ml, Fig. 1B). M. anisopliae co nidia harvested from plates resulted in mortality against A. maculatum similar to that seen using B. bassiana blastospores. These data indicate that a critical concentration threshold of fungal cells (10P8P cell/ml) appears to be required for high mortality. B. bassiana conidia had less than 6% mortality against A. americanum (28 days post infection) Low mortality (17%, 28 days post infection) was also observed using B. bassiana blastospores, and widely variable mortality was observed using M. anisopliae co nidia (17% 15% SE).

PAGE 24

24 A time course of the percent mortality using 10P8P fungal cells/ml against A. americanum and A. maculatum is given in Table 1. The majority of the fungal induced mortality observed towards A. maculatum appeared to occur between 14 and 21 days. In all instances adult ticks treated with buffer control resulted in less than 5% mortality over course of the experiment. The susceptibility of A. americanum and A. maculatum nymphs was tested using B. bassiana a nd M. anisopliae conidia isolated from plates at 10P8P conidia/ml ( Table 1 1 ). A. americanum nymphs were more susceptible to both B. bassiana and M. anisopliae conidia (20 35% mortality) than adults, although mortality remained far lower than that observed against A. maculatum (nearly 100% mortality). A. maculatum nymphs were far more susceptible to the fungi than A. americanum nymphs or adults or A. maculatum adults, with 60% mortality observed 7 days post infectio n with B. bassiana conidia (as compared to 10% mortality in similarly treated adults). The addition of nutrients (supplement resulting in a final concentration equivalent to 10 fold dilution of Sabouraud media) to fungal cells washed into sterile dHR2RO + 0.01% Tween20 did not greatly affect the resultant mortality against either A. maculatum or A. americanum ( Table 1 2 ). A noticeable reduction in mortality was observed when using B. bassiana conidia harvested from plates (95% mortality) as compared to the same cells supplemented at 1:10 Sabouraud media (50% mortality). Mortality (60 70%) towards A. americanum was observed using B. bassiana blastospores harvested from broth culture (3 4 days, SDY, Table 1 2 ). Broth cultures were filtered through glass w ool to remove large aggregates and mycelium, resulting in a mixture of newly formed blastospores (70 80%) and residues of conidiospores (20

PAGE 25

25 30%) used to initially inoculate cultures Reduced virulence was observed when using washed blastospores, which coul d be restored by the addition of spent media, indicating that the harvesting and washing procedure did not have a deleterious effect on the blastospores The observed mortality resulting from use of blastospores directly from the media appeared not to be due to the availability of nutrients, since supplementation of washed fungal blastospores with SDY media did not result in an increase in mortality ( Table 1 2 ). These data indicate that secreted factor(s) found in 3 4 days spent media culture broth appear t o enhance B. bassianas virulence towards A. americanum ticks. Conidial Germination on Tick Cuticle A qualitative comparison of conidial binding and germination of B. bassiana on A. maculatum and A. americanum was performed using scanning electron microscopy of ticks infected throughout the time course of infection (Fig. 1 4 ). Conidial germination occurred on both tick species, although a greater number of germinating conidia and mycelial formation was visible earlier on A. maculatum than on A. americanum Examination of fixed samples indicated that conidial density and germination varied dramati cally by body region. Within 72 h our s of inoculation, most (germinating) conidia were found in the marginal groove and marginal body fold as well as around the anus and anal groove. In the early stages of infection ( A. maculatum ) comparatively few conidia were observed on the scutum, although patches of fungi could be found within the cervical groove and lateral carina. In several instances both B. bassiana and M. anisopliae were observed proliferating (in patches) on the cuticle surface of A. americanum ticks, although the extent was far lower than that observed for A. maculatum and several specimens contained hardly any germinating cells.

PAGE 26

26 Single colony isolates of fungi from A. maculatum and A. americanum were identified by PCR amplification and cloning of ribosomal RNA gene fragments. Sequencing results of a portion of the 18S rRNA gene and the 5.8S rRNA with its flank ing internal transcribed spacer sequences (ITS) were found to be 100% identical between the tick fungal isolate and the stock fungal strain used. Effect of Cuticular Lipids on Conidial Germination Pentane extracts of whole cuticular lipids derived from A. maculatum spotted on glass slides produced ~ 80% spore germination, similar to control assays with no epicuticular extract added (Table 1 3). In contrast, conidial germination was less than 20% in assays performed using A. americanum extracts (see Fig. 1 5 ). Of those conidia that had germinated, the average germ tube length of A. maculatum exposed, germinating conidia was more than four times greater than their A. americanum counterparts (18 1 3). Control experiments plating the same b atch of B. bassiana conidia on nutrient agar (SDAY) resulted in greater than 98% germination within 24 h our with conidia harvested using sterile dHR2RO and spotted onto glass slides, displaying greater than 60% germination after 36 h our s even without the addition of any nutrients or media. Pathogenicity Towards Ixodidae Tick Species Infection assays using fungal cell suspensions of M. anisopliae and B. bassiana washed into sterile dHR2RO containing 0.01% Tween20 resulted in significant mortality toward R. sang uineus ay s post infection) and I. scapularis (65% mortality) in a dosedependent manner, but only limited virulence against D. variabilis (Fig. 1 6 ). B oth blastospores (produced predominantly in Sabouraud dextrose broth 70 80% blastospores ) and conidia (isolated from Sabouraud dextrose agar plates,

PAGE 27

27 >95% conidia) were prepared and used as inocula on the ticks. Only small differences in virulence were observed between the B. bassiana blastospores and conidia or between B. bassiana and M. anisopliae. Experiments to determine the dose dependence of fungal virulence against the tested tick species indicated that a critical threshold of fungal cells (10P8 Pcells /ml) was required for mortality (>50%) in adult R. sanguineus and I. scapular is (Fig. 1 6 ). Mortality within a control group, inoculated with sterile dHR2RO containing 0.01% Tween20 was less than 5 2%. A time course of the mortality measured every 7 d ay s using 10P8P fungal cells /ml as inoculum indicated that for the susceptible spec ies ( R. sanguineus and I. scapularis ), significant mortality required at least 14 d ay s mortality occurring 14 21 d ay s postinfection (Fig. 1 7 ). Fungal mycelial outgrowth was visible 21 day s post infection on (dead) ti cks (Fig. 1 9 ). R. sanguineus nymphs were much more susceptible to fungal infection and subsequent mortality than their respective adults (using B.bassiana conidia, X=37.03, df=1, P<0.001; using blastospores, X=17.62, df=1, P<0.001). Both B. bassiana (10P8P conidia/ml ) and M. anisopliae (10P8P conidia/ml) resulted in >60% mortality within 14 d ay s, and >90% mortality within 21 day s postinfection against R. sanguineus nymphs (Fig. 1 8 ). D. variabilis nymphs also seemed to be more susceptible to fungal infection by B. bassiana conidia (but not blastospores) than their respective adults (using B. bassiana P2P = 9.52, df = 1, P = 0.002; using blastospores; P2P = 2.53, df = 1, P = 0.1114); however, mortality remained low (15 45%, 28 d ay postinfection). In cont rast, I. scapularis nymphs did not seem to be any more susceptible to the fungi than conspecific adults (Figs. 1 7 and 1 8 ).

PAGE 28

28 M D. variabilis infection assays only when B. bassiana cells were applied to the ticks directly from the broth culture, i.e., with culture supernatant Virulence decreased by washing the blastospores, but could be restored by suspension in spent media (Table 1 4). The data indicated differences ( P < 0.001) fo r comparisons between the treatment (unwashed blastospores or washed blastospores supplemented with spent broth) and control inoculations with deionized HR2RO or Sabouraud broth, inoculations using 10P7P conidia/ml or 10P8P conidia /ml (washed into dHR2RO), and was hed blastospores. The reduced mortality of blastospores towards D. variabilis was not due to availability of nutrients because fungal cells supplemented with Sabouraud media (1:10) did not result in any significant increase in mortality (Table 1 4). These data indicate that secreted factors found in spent culture supernatant caused virulence toward D. variabilis. Ticks were examined throughout the 28 d ay time course of the infections by scanning electron microscopy (Fig. 1 4 & 1 9 ). Comparable concentrations of conidia were visible 1 12 hour postinfection on all three ticks species tested, although the distribution of conidia was not uniform across the body of the ticks. Conidial germination and proliferation were much more evident on both I. scapularis and R. sanguineus ticks during the first week postinoculation, than on D. variabilis ticks, although a wide variation was observed. Germination of most of the bound conidia was visible within 24 48 h our postinfection. Hyphal growth was evident 2 14 day postinfection, although clear instances of appressoria or penetration events were difficult to distinguish on the surface of the tick Extensive fungal growth was visible on several distinct regions of the tick anatomy including the anal and genital grooves and apertures, and on the

PAGE 29

29 alloscutum. Patches of fungal growth also could be seen on the capitulum, especially around the mouthparts, and scattered around the idiosoma, particularly within the various lateral and marginal grooves along the surface contours of the organism. In several instances, bacteria or other fungi, clearly distinguishable from the inoculated organism ( B. bassiana ) could be seen on the ticks. B. bassiana cells were observed on living D. variabilis ticks throughout the time course of the experiments performed, including at the 28 d ay time point. Conidial binding, germination, and even mycelial growth was apparent on the surface of D. variabilis ticks, indicating that the observed low mortality rate may be due to inhibition of critical events required for penetration of the cuticle. Oxalate as an Acaracidal Virulence Factor Our previous results had indicated that addition of spent culture supernatant could increase fungal mediated mortality toward certain tick species (Kirkland et al. 2004a; Kirkland et al. 2004b) A dult A. americanum were susceptible to cell free culture supernatants derived from growth of the entomopathogenic fungi B. bassiana in Sab or SDY (Table 1 5). M ortality was observed within 14 day by using fun gal spent culture supernatant isolated from 6 d ay cultures grown in S ab (20%) or SDY (50%) media, with lower mortality seen using spent PD media (12%) and little to no mortality observed using culture supernatants from CzD media (<6%) A second treatment with S ab or SDY spent media applied 14 d ays after the initial treatment resulted in up to 65 85% (total) mortality within 28 d ays of the original treatment, whereas second applications of spent PD or CzD media did not result in any incr eased mortality. Similar experiments treating adult A. maculatum or I. scapularis ticks with SDY supernatants resulted in 50 10 and 32 15% (14 d ays post treatment) mortality, respectively. Control treatments

PAGE 30

30 with sterile media or dHR2RO resulted in less than 5% mortality throughout the time course of the experiments. To test the heat lability of the observed acaricide ac tivity, aliquots of 6 day S ab or SDY cell free culture supernatants were boiled for 10 min, allowed to cool to room temperature for 10 mi n, briefly spun to remove any precipitation, and then used to treat adult A. americanum ticks. Boiled supernatants resulted in 18 5 (Sab) and 40 10% (SDY) mortality after 14 d ay s. To test whether the acaricidal activity was primarily proteinaceous in nature, aliquots of S ab and SDY culture supernatants treated with proteinase K (1 mg/ml) for 1 h our at 37 C resulted in 24 6 and 50 10% mortality (14 d ay post treatment). By contrast, dialysis using a 10,000molecular weight cut off membrane of active culture supernatants against 50 mM Tris buffer, pH 7.0 (10 ml aliquot versus 2 by 2 liters, overnight), resulted in a reduction in the acaricide potency of the culture supernatants, with total mortality percentages dropping to 5 3% for SD and 9 3% for SDY media, 14 days post treatment of adult A. americanum ticks. These findings suggest that B. bassiana secretes a small heat stable acaric ide compound into Sab and SDY broth during growth. Acaricide activity was stable to repeated freeze thawing cycles (at least three) and at 4C for a least 1 month Analysis of cell free culture supernatants by HPLC revealed oxal ic to be the major organic acid present with minor amounts of formate, citrate and acetate also detected The oxalate concentrations as well as the pH of the culture supernatants used to treat the ticks were determined (Table 1 5). The concentration of oxalic acid and the resultant decrease in pH correlated with the acaricide activity of the culture supernatants. Oxalic acid at concentrations of 20 35 mM were produced when the fungal cells were grown in S ab or SDY media, whereas lower amounts of oxal ic acid

PAGE 31

31 produced when the cells were grown in CzD (<0.5 mM) under t he conditions tested. The acaracidal toxicity of oxal ic acid was tested by using the chemical compound to treat adult A. americanum ticks (Fig. 1 10). Greater than 60% (14 days post ic acid pH 4.0, respectively. No significant mortality was observed using a single treatment with lower concentrations of oxalate (1 10 mM), pH 4.0, or with solutions of oxalate at pH 7.0 (1 50 mM). Furthermore, no acaracidal activity was observed using single treatments of solutions of either of citrate, formate, or phosphate at pH values of either 4.0 or 7.0 and using concentrations up to 50 mM (Fig. 1 10). A second treatment 21 days after the initial treatment resulted in 75 85% total mortality by using either 20 or 50 mM oxalate, ays (35 days total). The pH dependence of the acaracidal activity of oxalate was investigated using oxalic acid solutions ranging from pH 4.0 to 7.0 (Fig. 1 11). Acaracidal activity was highest at pH <4.0 (>80% mortality, 14 days post treatment) with tick mortality rapidly decreasing as the pH of the oxalate solution was raised. Mortality at pH 4.5 was four fold lower than that observed for solutions of oxalate at pH 4.0. Second treatments, 14 d ays after the first, had a minor effect, resulting in up to 40% total mortality. To assess whether oxal ic acid production by B. bassiana was indeed a contributing factor in the acaracidal activity of culture supernatants, mutant screens were established to isolate oxal ic acid nonproducers. S urviving colonies of EMS treated conidia were plated onto SDY media supplemented with the pH indicator dye

PAGE 32

32 bromocresol purple (pHRinitialR 6.8). Approximately 5,000 mutant clones of B. bassi ana strain 90175 were screened on the indicator plates, and six mutants were identified that lacked or had reduced zones of surrounding yellow (acidification) (Fig. 1 12). Of these, three were shown to be false positives due to production of wild type like yellow zones when single spores were isolated and rescreened. The remaining three mutants, designated as clones A1 + 15, A1 + 16, and A1 + 17, seemed to retain their phenotype (no yellow zone of clearing, purple colonies) after at least three generations of rescreening on the indicator plates. Mutants A + 15 and A1 + 16 displayed altered conidiation effects, forming smaller colonies that grew slower but sporulated more rapidly than wild type on PDA, Sab and SDY agar plates. Mutant A1 + 17 also displayed altered colony morphology but sporulated poorly when grown on PDA, Sab, or SDY agar plates The concentration of oxal ic acid secreted by the mutants was quantified over a 15 d ay time course of growth in SDY broth (Fig. 11 3 ). These data indicated that two of the isolates, A1 + 15 and A1 + 16 produced no detectable oxal ic acid under the conditions tested. Interestingly, the third mutant (A1 + 17) was able to produce oxal ic acid (~12 mM) at approximately onehalf the levels as that of the wildtype strain. Culture supernatants (day 6) from the three mutants were used to treat adult A. americanum ticks in mortality experiments as described previously. Less than 10% mortality toward A. americanum ticks was observed using culture supernatants derived from any of the mutants grown in SDY including, A1 + 15, A1 + 16, and A1 + 17, even though the oxal ic acid concentration in the latter supernatant approached 12 mM.

PAGE 33

33 Discussion Pathogenicity B. bassiana and M. anisopliae strains have been used for control of insect pests in agricultural, ecological, and domestic settings in a number of countries (Ferron, 1981; Leathers et al. 1993; McCoy, 1990; Roberts & Humber, 1981) The use of these organisms in the biocontrol of arthropod pests, such as ticks, is gaining impetus. The pathogenicity of entomopathogenic fungi to different developmental stages of R. sanguineus has been investigated (Samish et al. 2001) In these studies, M. anisopliae was the most virulent isolate, with B. bassiana, M. flavoviride and Paecilomyces fumosoroseus strains resulting in significantly lower mortality under the conditions tested. The virulence of M. anisopliae also has been tested against unfe d and engorged adult R. appendiculatus. Fungal concentrations as low as 10P6P spores /ml caused 35% (unfed) and 80% (engorged) mortality in these ticks, respectively (Kaaya & Hassan, 2000) Similarly, almost 100% mor tality has been shown using M. anisopli ae at high conidia concentrations (4 10P9P spores/ml ) against unfed adult I. scapularis whereas only 10P7P spores /ml induced comparable mortality in engorged adult females (Benjamin et al. 2002; Zhioua et al. 1997) It is likely that increased exposure, and hence susceptibility occurs during engorgement due to the extension of the cuticle. These data indicate that lower infectious fungal concentrations may be effective in controlling infestations on feeding animals. Some caution, however, should be taken in extrapolating from laboratory results to effective onhost biocontrol. Although, M. anisopliae and B. bassiana induced high mortality in ticks confined in bags on Zebu cattle ears (Kaaya & Hassan, 2000) a preliminary report using M. anisopliae versus Boophilus microplus (Canes trini) ticks (unconfined) on stabled bulls, did not result in a

PAGE 34

34 reduction in the total number of ticks that continued to parasitize the animals (Correia et al. 1998) The effects of M. anisopliae also have been determined on non feeding I. scapularis adults (Benjamin et al. 2002) In the field, a mort ality of slightly >50% was noted among ticks collected from vegetation plots sprayed with an aqueous formulation of M. anisopliae. Here, too, the authors note that their results may contain an upward bias in the mortality rate due to two factors. First, collected ticks were placed in vials under optimum conditions for fungal growth and some may not have died under field conditions; and second, ticks were collectively housed in a single vial/plot, possibly resulting in horizontal transfer of infection from a subpopulation of infected ticks to uninfected ticks. Factors other than spore concentration that may influence the practical application of pathogenic fungi in tick biocontrol include formulations (aqueous versus oil), fungal growth conditions, and number of appl ications. For M. anisopliae aqueous formulations resulted in almost 65% mortality in potted grass tetrapacks, whereas oil formulations under identical conditions resulted in >80% mortality (Kaaya, 2000a) Furthermore, the results of this study should be interpreted with the understanding that other B. bassiana and M. anisopliae isolates may be more or less pathogenic toward ticks and that passage through tick species may select for more virulent or species specific isolates. Our results demonstrated dosedependent mortality toward unfed adult and nymphal R. sanguineus and I. sca pularis with limited mortality versus D. variabilis ticks by using the entomopathogenic fungi B. bassiana and M. anisopliae harvested from either agar plates or liquid media and washed into sterile dHR2RO containing 0.01%

PAGE 35

35 Tween20. The detergent was used to (i) increase the recovery of fungal cells from agar plates, (ii) decrease aggregation of the isolated conidia, and (iii) ensure a more even distribution of the cells during application. Surface growth of the fungi was observed on treated ticks and both B. bassiana and M. anisopliae could be recovered from infected specimens, although other fungal species were observed during fungal isolation from tick cadavers. A spore concentration of 10P8P spores/ml was required for effective mortality, presumably to overc ome tick defenses during penetration of the ticks cuticle and proliferation inside the host. Significant mortality against D. variabilis was observed only when B. bassiana blastospores with growth media carryover (i.e., supplemented with spent media) was used as the inoculum. Importantly, addition of fresh media to harvested cells did not induce any increase in mortality under the conditions tested. The most likely explanation for our observations is that B. bassiana secretes important virulence factors that can enhance or enable pathogenesis. Growth in various media, including Sabouraud/yeast extract, is known to result in secretion of hydrolytic and proteolytic enzymes, as well as various mycotoxins such as beauvericin and oosporein, and to result in the acidification of the media (Gupta et al. 1992; Kucera & Samsinak.A, 1968; Mazet et al. 1994; St Leger et al. 1997; St Leger et al. 1998) Further study of in oculum conditions to identify important virulence enhancing components may, therefore, lead to improvements in application formulation of these agents. Differential Susceptibility Both B. bassiana and M. anisopliae conidia or blastospores washed into sterile dHR2RO were found to be virulent towards A. maculatum ticks, but displayed limited mortality towards A. americanum ticks. Surface growth of the fungi was observed on treated ticks and both B. bassiana and M. aniso pliae could be recovered from infected

PAGE 36

36 specimens, although other fungal (and bacterial) species were occasionally observed during fungal isolation from tick cadavers. A critical spore concentration was required for effective mortality, presumably to overcome tick defenses during proliferation of the tick cuticle. Moderate mortality towards A. americanum was observed only when fungal cells directly from the growth media, i.e., with growth media carry over were used. Importantly, addition of fresh media to washed fungal cells did not increase mortality towards A. americanum (and in some instances appeared to decrease mortality against A. maculatum ). These data imply that fungal secretion products can help to mediate successful virulence against recalcitrant targets. Both B. bassiana and M. anisopliae are known to express and secrete a wide variety of compounds including proteases, glycosidases, lipases, peptide mycotoxins, and even organic molecules such as oxalate, all of which have been implicated as pathogenicity factors (Bidochka & Khachatourians, 1991; Gupta et al. 1991; Kucera & Samsinak.A, 1968; Roberts, 1981; St Leger et al. 1997; St Le ger et al. 1999) It is possible that secreted factors present when using unwashed fungal cells enables the fungus to ov ercome defenses found on A. americanum but not on A. maculatum An intriguing possibility is that these secreted factors may assist in overcoming the toxic effects of compounds present in A. americanum cuticles. Pentane derived cuticular hydrocarbon extrac ts of A. americanum but not of A. maculatum were shown to inhibit germination of B. bassiana conidia. Furthermore, of those conidia that had germinated, germ tube formation and hyphal growth was shorter in the presence of A. americanum lipid extracts as co mpared to A. maculatum and control samples. An analysis of the cuticular hydrocarbon content of several Amblyomma tick species reported the lipid

PAGE 37

37 composition to consist mostly of branched paraffins and olefins, with the number and carbonchain length of th e hydrocarbons distinct between A. maculatum and A. americanum (Hunt, 1986) although whether any of these differences can account for the observed differences in susceptibility to the entomopathogenic fungi tested is not known. Several studies have highlighted the complex interaction between cuticular lipids and conidial germination. Germination and hyphal growth of a B. bassiana strain virulent towards Ostrinia nubilalis but nonpathogenic towards Melolontha melolontha occurred in the presence of pentane cuticular extracts of the host insect ( O. nubilalis ) but was inhibited by lipid extracts derived from the non host insect ( M. melolontha) (Lecuona et al. 1997) The active compound responsible for hyphal growth inhibition was found mostly in the unsaturated hydrocarbon fraction. Cuticular lipids of the silverleaf whitefly ( Bemisia argentifolii ) were found to inhibit germination of B. bassiana conidia on nutrient agar but had no effect on germination rates in the absence of nutrients (James et al. 2003) Fungal germination rates also varied greatly between insect developmental stages, as well as between fungal species. Furthermore, fungal species displayed differential susceptibilities to the effects of li pids due to hydrophobicity. Synthetic long chain wax esters inhibited conidial germination of Paecilomyces fumosoroseus but not of B. bassiana (James et al. 2003) Studies on the stinkbug, N. viridula revealed that lipid fractions extracted from the exuviae of the insects inhibited germination of M. anisopliae conidia (SosaGomez et al. 1997) In these studies, the aldehyde ( E ) 2 decenal, a primary com ponent of the stick bug scent gland, was detected in the cuticle extracts and found to be fungistatic towards M. anisopliae. Further study on tick

PAGE 38

38 cuticular lipid composition and the existence of possible tick defense compounds, as well as on inoculum conditions may identify important virulence modulating components and can lead to rational design strategies for the improvement for the use of fungi as acaricidal biocontrol agents. Oxalic Acid Acaracidal Activity Although oxalic acid has been demonstrated to be an important virulence factor for the successful pathogenesis of phytopathogenic fungi during plant host infection, many plant species themselves produce oxalic acid, presumably to discourage insect foraging. Studies using oxalic acid have demonstrated oxalic acid to be toxic toward several insect species, including the tarnished plant bug (Alverson, 2003) and the migratory grasshopper (Bidochka & Khachatourians, 1991) In the latter report, metabolic acids produced by B. bassiana (including oxalate and c itrate) acted synergistically with fungal conidia to promote successful pathogenesis. With respect to the Acari, oxalic acid has been used to control varroosis, and practical applications have demonstrated reduced infestations of V. destructor in bee colonies under conditions that present low toxicity toward the bees themselves (Gregorc & Poklukar, 2003) Interestingly, entomopathogenic fungi such as M. anisopliae and B. bassiana have demonstrated virulence toward Varroa species, and has also been te sted for use in control of these mites in bee colonies (Kanga et al. 2002; Kanga et al. 2003) A. americanum ticks were predominately used in our studies due to the obs ervation that this species can resist fungal ( B. bassiana and M. anisopliae) infection (Kirk land et al. 2004b) Our results indicate that this resistance can be overcome and that (cell free) culture supernatants derived from the entomopathogenic fungus B. bassiana can be toxic toward these ticks (and others), depending upon the fungal

PAGE 39

39 growth and media composition. HPLC analysis of culture supernatants coupled to tick mortality experiments confirmed that one of the major acaricidal active ingredients in these supernatants was oxal ic acid although during fungal infection, secretion of factors such as hydrolytic enzymes, including proteases, glycosidases, and lipases, as well as other biologically active small molecules and toxins undoubtedly contributed to the establishment and progression of disease. Oxalic acid has a relatively simple chemical formula (COOH)R2R, that displays at least three important chemical properties: it can act as a proton donor, an electron donor, and as a strong chelator of divalent cations. Our results indicated that oxalate toxicity was pH dependent, with mortality rates dramatically decreasing at pH >4.5 (single application). These data suggest that (as a diprotic compound with pKRaR values of 4.2 8 and 1.29) the reducing potential of oxalate may be an important factor in its tick toxicity. The relatively high concentration of oxal ic acid 50 mM, required for inducing mortality (in single treatments) may suggest that for the fungal organism, oxal ic a cid acts synergistically with other factors in promoting pathogenesis. Oxal ic acid concentrations in culture supernatants did approach 30 35 mM, and it is possible that local oxal ic acid concentrations during the infection process could be appreciably high er. Furthermore, hosts are likely to be continuously exposed to the secreted metabolites (including oxal ic acid ) that are likely to increase their toxicity. Indeed, oxalic acid is able to solubilize several components of insect cuticles, including elastin and collagen, and has been demonstrated to disrupt the integrity of M. sanguinipes cuticle directly (Bidochka & Khachatourians, 1991)

PAGE 40

40 Using SDY pH indicator plates, three B. bassiana EMS derived mutants were isolated displaying lowered levels of secreted oxal ic acid (two of which produced <1% of the wild type levels of oxal ic acid under the conditions tested). Culture supernatants derived from all three mutants were nontoxic toward A. americanum ticks. Although these observations support the hypothesis that oxalic acid is an important fungal virulence factor during pathogenesis toward ticks, some caution should be taken in interpretation. Primarily, oxal ic acid may act as a marker for other fungal factors required for pathogenesis, and disruption of pH pathways may have pleiotropic effects. In M. anisopliae oxal ic acid production and the resultant reduction in extracellular pH are linked to protease production and activity (St Leger et al. 1999) ; mutants unable to acidify the media also were deficient in protease activity. This is similar to observations concerning phytopathogenic fungi where the secretion of oxalic acid leads to an acidic environment required for the expression and activities of many hydrolytic enzymes (Bateman & Beer, 1965; Rollins & Dickman, 2001) The virulence of the B. bassiana mutants was not assessed directly (i.e., by application of fungal cells to ti cks) because these clones probably contain multiple mutations that would have obscured interpretation of any results, particularly because the mutants displayed altered developmental and conidiation phenotypes. Future research using targeted gene knockouts of enzymes in the oxal ic acid biosynthetic pathway(s) (see below) of B. bassiana will probably help in understanding the physiological role of oxalate during pathogenesis. Finally, our results indicate that examining inoculum conditions that would favor o xal ic acid production could increase the efficacy of field applications of B. bassiana in

PAGE 41

41 biocontrol efforts. This increase may be achieved by the selection of oxal ic acid producing constitutive strains, optimization of the conditions for oxal ic acid production in already used strains, or even manipulation of dispersion formulas that maximize rapid oxal ic acid production.

PAGE 42

42 Fig ure 1 1. B. bassiana has an exceptionally broad host range that spans across Arthropoda classes from insects including; wasps (A), fire ants (B), bark beetles (C), and mole crickets (D) to arachnids such as mites and ticks (E). Cuticle penetration (F), and conidiogenesis (formation of new spores) from host cadaver (G) are also illustrated. (Images A,B,C,D courtesy of D. Boucias ). Fig ure 1 2 Six well culture plates with stryofoam plugs used for tick bioassays

PAGE 43

43 Fig ure 1 3. Percent mortality 28 days post infection of unfed adult A. maculatum and A. americanum () treated with B. bassiana blastospores (A), B. bassiana conidia (B), and M. anisopliae conidia (C) as a function of spore concentration. Values given are means of three experiments SE.

PAGE 44

44 Table 11 Weekly mortality rates for A. maculatum and A. americanum adults and nymphs treated with fungal suspensions Trea tment Mortality (%) A. maculatum (adults) Pa A. maculatum (nymphs) Pb A. americanum (adults) Pa A. americanum (nymphs)Pb B. bassiana (10 P 8 P blastospores/ml) 7 days post infection 8 2 65 10 5 3 7 3 14 days 13 3 80 10 10 5 18 5 21 days 64 10 95 5 13 6 21 6 28 days 86 5 98 4 18 2 35 12 B. bassiana (10 P 8 P conidia/ml) 7 days post infection 10 3 60 8 0 4 2 14 days 41 5 77 13 1 1 8 3 21 days 85 10 93 7 4 2 16 11 28 days 95 5 95 5 6 5 26 15 M. anisopliae (10 P 8 P conidia/ml) 7 days 3 1 30 5 1 1 3 2 14 days 19 6 62 12 5 1 8 5 21 days 37 10 88 10 8 1 16 10 28 days 61 17 99 1 13 2 21 2 PaP Mortality of (adult) ticks treated with sterile dHR2RO less than 5% throughout the time course of the experiments. PbP Mortality of A. maculatum and A. americanum nymphs treated with sterile dHR2RO reached up to 15 and 6%, respectively, within the time course of the experiments

PAGE 45

45 Table 1 2 Effect of inoculum composition on B. bassiana mediated mortality towards adult A. maculatum and A. americanum Treatment Mortality (%) A. maculatum A. americanum 10 P 7 P conidia/ml in Sab broth P a 7 days post infection 8 4 3 2 14 days 15 5 4 2 21 days 43 12 5 2 28 days 61 15 9 4 10 P 8 P conidia/ml in Sab broth P a P 7 days post infection 7 2 2 1 14 days 13 3 4 2 21 days 32 10 5 2 28 days 69 12 9 3 Washed 10 P 7 P blastospores/ml 7 days 5 2 0 14 days 12 6 2 1 21 days 19 8 4 2 28 days 32 15 8 2 Unwashed 10 P 7 P blastospores/ml P b P 7 days post infection 15 3 11 4 14 days 72 8 45 10 21 days 95 10 55 10 28 days 98 15 70 12 PaP Ticks were inoculated with B. bassiana suspensions in 1:10 dilution of Sabouraud broth. Mortality of ticks treated with sterile dHR2RO and sterile Sabouraud broth was less than 5 and 10%, respectively, throughout the time course of the experiments. PbP The cell culture was filtered through glass w ool to remove mycelial clumps and used directly as inoculum.

PAGE 46

46 Fig ure 1 4. Representative electron micrographs of the B. bassiana conidia mediated infection process. Conidia bound to A. americanum cuticle, 24 h our post infection (A), 7 days post infection (B), and 14 21 days post infection (C). Conidia bound to A. maculatum cuticle 24 h our post infection (D), 7 days post infection (E), and 14 21 days post infection (F). Table 13. Effect of cuticular lipid extracts derived from adult A. maculatum and A. americanum on B. bassiana spore germination and germ tube length Solvent/extract % spore germination 4T P a P 4T 4T P b P 4T Pentane 75 8 14 4 A. maculatum 80 9 18 7 A. americanum 18 10 4 2 PaP Values are expressed as means SD using three separate extracts and three to four replicates (each replicate consisting of at least two three fields of view) for each extract. PbP The germ tube length of a minimum of 100 germinating conidia for each extract was determined.

PAGE 47

47 Fig ure 1 5. Beauveria bassiana spore germination on tick cuticular extracts. Conidia were overlaid onto glass slides prespotted with pentane extracts of A. americanum (A) and A. maculatum (B) prepared as described in Section 2. Samples were incubated at 25 C at 95% humidity for 36 h our before addition of lactophenol blue for fungal cell wall visualization. Insets are higher magnifications of samples illustrating germ tube formation on individual conidia.

PAGE 48

48 Fig ure 1 6. Percentage of mortality 28 d postinfection of adult R. sanguineus ( ), I scapularis D. variabilis B. bassiana blastospores (A), B. bassiana conidia (B), and M. anisopliae conidia (C) as a function of spore concentration. Values given are means of three experiments SE

PAGE 49

49 Fig ure 1 7. Weekly mor tality rates for adult R. sanguineus I. scapularis and D. variabilis inoculated with B. bassiana blastospores (A), B. bassiana conidia (B), and M. anisopliae conidia (C) by using 10P8P fungal cells /ml Values given are means of three experiments SE

PAGE 50

50 F ig ure 1 8. Weekly mortality rates for R. sanguineus I. scapularis and D. variabilis nymphs inoculated with buffer controls (A), B. bassiana conidia (B), and M. anisopliae conidia (C) by using 10P8P fungal cells /ml Values given are means of three experimen ts SE

PAGE 51

51 Fig ure 1 9. Electron micrographs of the B. bassiana conidiamediated infection process. Conidia bound to tick cuticle, 1 hour postinfection (A, R. sanguineus 1,400). Conidial germination, 18 24 hour postinfection (B, I. scapularis 1,300; C, D. variaibilis 3,600). Proliferation and mycelial formation across the tick cuticle surface 7 14 d ats postinfection (D, I. scapularis 2,000; E, D. variabilis 3,400). Tick cadaver 21 28 days postinfection, illustrating extensive growth particularly in the posterior region of the tick (F, R. sanguineus 15; G, R. sanguineus 30). Conidiogenesis, outgrowth of conidia from tick cadaver 28 dats postinfection (H., D. variabilis 1,800)

PAGE 52

52 Table 14. Effect of inoculum composition on B. bassiana induced mor tality against R. sanguineus D. variabilis and I. scapularis Treatment D. variabilis Mortality P a P (%) R sanguineus I.scapularis Sab broth P a 7d post infection 0 2 2 0 14d 3 1 2 2 2 2 21d 5 3 6 3 6 2 28d 5 3 7 3 7 3 10 P 7 P conidia/ml in Sab broth P b 7d post infection 0 3 2 ND 14d 1 5 9 3 ND 21d 9 2 15 3 ND 28d 11 2 28 6 ND 10 P 8 P conidia/ml in Sab broth P c 7d post infection 0 4 2 2 1 14d 7 3 37 8 15 4 21d 15 5 44 10 40 10 28d 19 6 60 15 45 10 Washed 10 P 7 P blastospores/ml 7d post infection 0 4 2 2 1 14d 4 1 7 3 10 3 21d 8 3 12 5 20 5 28d 11 5 39 7 33 8 Unwashed 10 P 7 P blastospores/ml P d 7d post infection 6 3 4 2 6 2 14d 29 8* 32 3 15 3 21d 43 10* 50 11 44 5 28d 60 15* 65 12 53 8 Washed 10 P 7 P blastospores in spent broth Pe 7d post infection 5 2 3 1 10 5 14d 25 4* 26 4 22 7 21d 40 10* 43 4 39 10 28d 55 11* 58 10 55 12 ND, not determined P*P Indicates significant (P< 0.001) between test treatment and inoculations with washed blastospores, 10P8P condia per millil iter broth and controls (Tween20). PaPTicks were inoculated with a 1:10 dilution of Sabouraud (Sab) broth. Mortality of ticks treated with sterile dHR2R0 was < 5% t hroughout the time course of the experiments. PbPCondiia were resuspended in sterile dH 2 0 supplemented 1:10 with Sabouraud broth. PcPCell culture was filtered through glass wool to remove mycelia clumps and used directly as inoculum. PdPCells were filtered and harvested as described in Materials and Methods, washed once with sterile dHR2RO and resuspended in filter sterilized spent media (0.22 m filter). PePTicks were inoculated with sterile 1:10 dilution of Sabouraud media.

PAGE 53

53 Table 15. Acaracide activity towards adult A. americanum oxal ic acid concentration, and pH of cell free B. bassiana culture supernatants Spent growth media P a P (6 d ay culture supernatants) % mortalityPb [Oxal ic acid ]Pc pHPd A.americanum, 14d mM spent culture SD 20 8 18 4.5 SD + 1% yeast extract 48 15 23 4.2 PD 12 4 12 5.5 CzD 6 4 0.5 6.8 PaPFungal cells were removed from liquid cultures by centrifugation. The resultant supernatants were filtered through 0.22 mm filters and st ored until use. PbPIn all instances, <5% tick mortality was observed in control experiments using fresh media or sterile dHR2RO over the same course of the experiment. PcPNo oxal ic acid was detected in fresh media. PdPInitial pH values for the media were 5.6 (SD, SD + YE, and PD) and 7.3 (CzD).

PAGE 54

54 Fig ure 1 10. Oxalic acid induced mortality in adult A americanum ticks. Ticks were treated with solutions of 50 mM oxalic acid ic acid pH 4.0; and 50 mM oxal ic acid pH 7.0 (>); all other conditions tested including 1, 5, 10, 20, and 50 mM citrate, pH 4.0 and 7.0, 1, 5, 10, 20, and 50 mM formate, pH 4.0 and 7.0, 1, 5 and 10 mM oxalate, pH 4.0, and 1, 5, 10, and 20 mM oxal ic acid pH 7.0 (dashed lines between the X marks). Values given are means of three experiments SE

PAGE 55

55 Fig ure 1 11. pH d ependence of oxal ic acid induced mortality in adult A americanum ticks. Mortality of adult A americanum 14 d after treatment with 50 mM solutions of oxal ic acid at the indicated pH values (), and mortality 14 days later, after a second treatment on day 14 (28 d ays means of at least three experiments SE

PAGE 56

56 Fig ure 1 12. Mutant screens of oxal ic acid nonproducers. EMS treated conidia were plated on SDY media supplemented with bromcresol purple. A) Oxal ic acid producer B) Oxal ic acid nonproducer

PAGE 57

57 Fig ure 1 13. Concentration of oxal ic acid secreted into the medium during growth in SDY broth, wild type B bassiana mutant A

PAGE 58

58 CHAPTER 2 SURFACE CHARACTERIST ICS AND HYDROPHOBINS OF B eauveria bassiana Introduction Cell surface attachment is a required step in establishing mycosis during host pathogen interactions and can be considered a primary process mediating fungal pathogenicity (Boucias et al. 1988) The cell surface properties of many fungi form the bas is for the initial step mediating interactions with arthropod hosts (Boucias et al. 1988; Hajek & Eastburn, 2003; Hazen et al. 1990) These surface properties are often mediated by fungal spore coat proteins including a class of proteins known as hydrophobins which play an important role in attachment (Holder & Keyhani, 2005; Talbot et al. 1996; Tucker & Talbot, 2001; Wessels, 1997; Wosten et al. 1993) B. bassiana produces several mononucleated cell types that include aerial conidia, blastospores, and submerged conidia. These cell types display dis tinct cell wall characteristics, as exemplified by differences in hydrophobicity and lectinbinding properties (Boucias et al. 1988; Boucias & Pendland, 1991; Hegedus et al. 1992; Jeffs et al. 1999) The hydrophobic surface attachment property of B. bassiana aerial conidia is attributed to a proteinacious spore coat called the rodlet layer, which consist of hydrophobin proteins (Holder et al. 2007) Hydrophobins are a group of small (814kDa) secreted amphipathic proteins produced by filamentous fungi. Gene expression studies of two class I hydrophobin genes were performed to assess the relative abundance of these transcripts during the life cycle of the fungus including within the three cell types described above, namely aerial conidia, blastospores, and submerged conidia as well as during mycelia growth. The hyd1 gene was shown to be constitutively expressed during all growth periods and

PAGE 59

59 cell types whereas the hyd2 gene was primari ly expressed in growing mycelia. D ata reveal ed t he differential regulation of these genes, implying potential differing developmental roles for their protein products Hydrophobins can alter the hydrophobicity of glass HOPG, Teflon, polystyrene, and other commonly used materials (Linder et al. 2002; Lumsdon et al. 2005; vanderVegt et al. 1996; Wosten et al. 1993; Wosten et al. 1994) On the basis of these observations, hydrophobins have been suggested for use in a variety of biotechnical surface modification (Janssen et al. 2002; Scholtmeijer et al. 2002) However, due to the difficulty in the production and purification of homologous class I protein, it has been difficult to facilitate biotechnical surface modifications (Scholtmeijer et al. 2001) In response to these limitations, a modified hyd2 gene was successfully cloned and its protein product expressed in an Escherichia coli host using the pTWIN1 vector. The protein was purified from the recombinant E. coli host and characterized. The recombinant n Hyd2 protein was shown to self assemble into a 2 dimensional array on a glass surface and change the wetability of the surface. Also, the purified protein re stored the phenotype in trans complementation experiments of a B. bassiana hyd2 targeted gene knockout in a charge dependent manner. Literature Review Surface Characteristics of Entomopathogenic Fungi Insect cuticles represent a significant barrier to mic robial pathogen s with attachment and subsequent germination of infective fungal propagules essential to establishing mycosis (Boucias & Pendland, 1991; Fargues, 1984; Pendland et al. 1993) I nfection by B. bassiana depends on attachment of the spore to the host surface

PAGE 60

60 and is a prerequisite for virulence specific development such as germination, appres s oria formation, and secretio n of cuticle degrading enzymes. Current models that consider t he interactions that mediate surface adhesion between fungal cells and substrata involve a consolidation of adhesion by receptor ligand interactions and nonspecific interactions. Nonsp ecific interactions work by the action o f van der Waals forces, surface hydrophobicity, and electrostatic surface charge (Boucias et al. 1988; Smith et al. 1998) These forces are reversible and are dependent on environmental conditions and the nature of the substrata as well as that of the infecting spore (Boucias et a l. 1988; Dunlap et al. 2005; Holder & Keyhani, 2005; Smith et al. 1998) Cell surface hydrophobicity has been demonstrated to be an important factor in the pathogenicity of several fungal pathogens including Candida albicans an important human opportunistic fungal pathogen, Entomophage maimaiga, a lepidopteran specific pathogen, B bassiana and M anisopliae which are broad host entomopathogens (Boucias et al. 1988; Hajek & Eastburn, 2003; Holder & Keyhani, 2005; Smith et al. 1998) The level of surface hydrophobicity comes from the relationship between hydrophobic surface molecules and other hydrophilic regions in the cell wall (Smith et al. 1998) In view of the role of small surface proteins called hydrophobins, this relationship is especially important Hydrophobins are usually attrib uted to the strong surface hydrophobicity of aerial conidia (Bidochka et al. 1995b; Ebbole, 1997b; Holder & Keyhani, 2005; Holder et al. 2007; Lugones et al. 1996b; Paris et al. 2003; Talbot et al. 1996; Wessels, 1997; Wosten & de Vocht, 2000) However, there are a few instances of nonhydrophobic proteins being associated with cell surface hydrophobicity (Lugones et al. 2004) When the hydrophobin S C3 from S.

PAGE 61

61 commune was deleted there was a decreased ability, but not completely, to attach to hydrophobic surfaces which suggested other factors may be involved in the hydrophobic surface attachment. Lugones et.al demonstrated that a nonhydrophobic prot ein, SC15, was responsible for limited attachment in the absence of the SC3 hydrophobin (Lugones et al. 2004) S pecific binding proteins that are important in attachment include cell wall proteins, specific ligandreceptor moieties, and adhesins (Boucias et al. 1988; Doss et al. 1993; Lacroix & Spanu, 2009; Pendland & Boucias, 1991; Prados Rosales et al. 2009; Sharifmoghadam & Valdivieso, 2008; Szilvay et al. 2007; Tucker & Talbot, 2001) Cell surface polysaccharides may participate in both nonspecific and specific interactions, i.e. via cell surface charge masking or recognition by lectins respectively. The specific interactions are considered nonreversible due to the physiochemical forces involved. The specific surface carbohydrates include glucose, galactose, mannose N acetylglucoseamine and fucose which are implicated in cell adhesion, stress survival and immune evasion (Wanchoo et al. 2009) The MAD1 and MAD2 adhesins of the entomopathogenic fungus M anisopliae has been shown to mediate specific adhesion to insect and plant surfaces respectively (Wang & St Leger, 2007) Targeted gene disruption of these adhesi ns resulted in a 90% reduction in adherence insect and plant surfaces The disruption in MAD1 and MAD2 also showed a decrease in spore germination and an altered morphology accompanied by a down regulation of genes involved in the cytoskeleton and cell cycle (Wang & St Leger, 2007) This further demonstrates the crucial role of attachment and adherence forces in colonization during host pathogen interactions.

PAGE 62

62 Conidia, blastospores, and submerged conidia produced by B. bassiana c an be easily distinguished by size, shape, and surface characteristics (Holder & Keyhani, 2005; Holder et al. 2007) Studies on the adhesion properties of the B. bassiana cell types revealed that aerial conidia are able to adhere rapidly to both hydrophobic and hydrophilic surfaces; blastospores display a high degree of binding to hydrophilic substrates; and submerged conidia have a broad but weak binding capability to hyd rophobic, weakly polar, and hydrophilic substrates (Holder & Keyhani, 2005) The strong hydrophobic surface attachment property of aerial conidia is attributed to a proteinacious sporecoat called the r odlet layer (Boucias et al. 1988) This rodlet layer is an amyloidlik e filament structure of mosaic bundles approximately 1020 nm in length found on the surface of the spores of most filamentous fungi. The presence of a rodlet layer seems to increase the relative hydrophobicity whereas the absence of this structure result s in the more hydrophilic spore s. The B. bassiana rodlet layer has been extracted and determined to be composed of at least one protein known as a hydrophobin (Holder et al. 2007) Hydrophobins Hydrophobins are a family of low molecular weight amphip athic proteins unique to the Fungal K ingdom. Although there is little sequence conservation, they are commonly characterized by their hydrophobicity plots and the presence of eight spatially conserv ed cysteine residues (de Vocht et al. 2000; Kershaw et al. 2005; Kwan et al. 2008) They undergo spontaneous polymerization allowing them to assemble at the fungal cell wall and at hydrophobic/hydrophilic or liquid/air interfaces (Fan et al. 2006; Whiteford et al. 2004) Once self assembled, they form monol ayers that are highly insoluble. For example, t he extraction and solubilization process for some

PAGE 63

63 hydrophobins requires high concentrations of triflouroacetic acid or formic acid (Linder e t al. 2002; Zhao et al. 2007) Structural analysis of several hydrophobins has lead to the hypothesis that these proteins sheet (de Vocht et al. 1998; Fan et al. 2006; Kwan et al. 2006) In solution the protein exists in the monomeric state. Upon binding to a hydrophobic solid substrata, the hydrophobins helical state, where as self assembly at the liquid air interface is d sheet conformation (de Vocht et al. 2000) Studies on the self assembled form of EAS, a class I hydrophobin, revealed that it is barrel core wit sheet region. Furthermore all the charged amino acids are localized on the same interfacial surface, thereby conferring its amphipathic nature. Figure 2 1 shows a possible representation of how these hy drophobin monomers are stacked at the water/air interface or hydrophobic/hydrophilic interfaces One side of the monolayer is highly hydrophobic while the other i s highly hydrophilic allowing it, once polymerized, to for m a sheet at the water/air or hydrophobic/hydrophilic interfaces. Hydrophobins can be further categorized into two classes based upon the distribution of hydrophilic/hydrophobic residues and solubility characteristics. Class I hydrophobins are very stable under denaturing conditions s uch as 1% SDS, 60% ethanol and form a protein monolayer that appears in form to look like small rodlets, and that can only be dissolved in strong acids such as triflouroacetic acid (TFA). Class II hydrophobins are typically smaller in molecular weight than their class I counterparts and also form self assembled monolayers, but these are much less stable and can be

PAGE 64

64 solubilized by detergents and alcohols such as 1% SDS and 60% ethanol (Kwan et al. 2006; Wosten & de Vocht, 2000) T here is a high degree of sequence variation among hydrophobins with little to no primary amino acid conservation aside from the cysteines. However there is an amphipathic secondary core structure found in all hydrophobins examined to date that result s in conserved 3dimensional structural morphology and is responsible for self assembly property. Hydrophobins typically contain a secretion signal that targets the protein as extracellular This secretion signal is cleaved during maturation. There are also ei ght spatially conserved cysteine residues which form four intramolecular disulfide bonds (de Vocht et al. 2000; Kwan et al. 2008) These cysteine residues are important for proper stability, secretion, and cell wall localization of the protein (Kershaw et al. 2005) Disruption of some disulfide bridges in Mpg1 of M grisea revealed that these cysteine residues are essential for rodlet layer formation. Disruption of the Cys3Cys4 disulfide bridge did not inhibit self assembly but resulted in proteins that did not localize barrel core structure is stabilized by the disulfide linkages and appears to be necessary for the monomers to localize on the cell surface (Kershaw et al. 2005) Based upon structural modeling, Figure 22 shows the presumed disulfide linkages of the two class I hydrophobins, Hyd1 and Hyd2, of B bassiana This disulfide linkage profile has been demonstrated for class I and class II hydrophobins, EAS from Neur o spo ra cras sa RodA from Aspergillus nidulans HFBI and HGBII from Trichoderma reesei SC3 from Schizophyllum commune, and MPG1 from Magnaporthe grisae (de Vocht et al. 2000; Kwan et al. 2006)

PAGE 65

65 Thus far there have been over 50 hydrophobin genes isolated from fungal species from ascomycetes to basidiomycetes Most of the genes have been identified from either mRNAs or insoluble surface proteins. The regulation of th ese genes is controlled by several factors which include the following; parental mating seen in SC3, SC4, and SC6 of S commune, circadian patterning and nutrient starvation regulation of EAS in N crasssa and nutrient regulated expression of MPGI, HFBI and HFBII from M grisae and T reesei (Bellpedersen et al. 1992; Lau & Hamer, 1996; Talbot et al. 1993; Wessels, 1997) Differential expression of Le.hyd1 and Le.hyd2 hydrophobins from Lentinula edodes revealed the developmental regulation and specific expression during the fruiting proces s (Ng et al. 2000) Although the role of hydrophobins in some cell processes remains unclear; they have been implicated in a variety of developmental processes including pathogenesis, fr uit body formation, and sporulation, (Beckerman & Ebbole, 1996b; Bell Pedersen et al. 1992; Ebbole, 1997a; Girardin et al. 1999a; Kazmierczak et al. 2005b; Kershaw & Talbot, 1998; Lugones e t al. 1996a; Nishizawa et al. 2002) D ue to their unique biophysical properties such as self assembly at hydrophobic/hydrophilic interfaces and stability under normally denaturing conditions hydrophobins have been denoted as proteins with potential for a wide range of biotechnological applications (Hektor & Scholtmeijer, 2005) The se applications include hy drophobins as agents capable of surface modification, acting as antifoulants as components of biosensors, and as a scaffolding for 3D tissue engineering (Hektor & Scholtmeijer, 2005) Hydrophobins are currently being studied for their ability to alter hydrophobic surfaces such as Teflon and hydrophilic surfaces like mica (Corvis et al.

PAGE 66

66 2005; Janssen et al. 2002; Qin et al. 2007) In these studies, the native hydrophobin which is directly harvested from fun gal cells have been coated onto mica and teflon. Once coated, there is a significant difference in the surface hydrophobicity. When class I hydrophobin HGFI from Grifola frondosa was coated on to a hydrophobic surface such as teflon there was a decrease in water contact angle from 123.0PoP to 104.4PoP, when coated on a mildly hydrophilic surface (silanized glass) there was a decrease from 86.6PoP to 51.9PoP, and when coated onto a strongly hydrophilic surface (freshly cleaved mica) an increase of 0.3PoP to 17.9PoP was shown (Hou et al. 2009; Yu et al. 2008) Similar results have also been shown with class I hydrophobin EAS and SC 3 from Neurospora crassa and Schizophyllum commune respectively (Askolin et al. 2006; Kwan et al. 2008) This ability to alter the wettability of a surface is a key component in the design and fabrication of biotechnological surfaces. One such biotechnical application of hydrophobins has been in the fabrication process of silicon micromachining. A class I hydrophobin from Pleurotus ostreatus was coated onto a silicon or silicon oxide sample. The samples were then KOH etched as part of the silicon micromachining process. It was demonstrated that the hydrophobin provided an effective shielding against exposure to KOH (De Stefano et al. 2007) There is also work using modified hydrophobins to promote fibroblast growth. T he hydrophobin SC3 from Schizophyllum commune was genetically fused to the RGD adhesion peptide from fibronectin, resulting in a protein that did not alter the self assembly properties for the SC3 hydrophobin, but did increase binding of fibroblast to a t eflon surface (Janssen et al. 2002; Scholtmeijer et al. 2001) Also the class II HFBI from Trichoderma reesei was used as a immobilization platform for constructing an amperometric glucose biosensor which

PAGE 67

67 demonstrated that the hydrophobin had an ability to provide a immobilization matrix with biocom patibility and electroactivity (Zhao et al. 2007) More recently, the surface hydrophobin RodA from Aspergillus fumigatus has been shown to hide conidial spores from specific immune components Specifically the hydrophobin was unable to caus e stimulation of lymphocytes and CD4+ T cells or cause the maturation of dendritic cells (Aimanianda et al. 2009) This cell specific nonimmunogenic ity may become an attractive quality for targeted biomedical surface modification. Overall, the unique biophysical and biochemical properties of hydrophobins, such as self assembly, stability under normally denaturing condition, and their amphipathicity, make them interesting proteins for study. Using a phage display cDNA library two B. bassiana hydrophobins were isolated. These hydrophobins contained the hallmarks of hydrophobins such as low molecular weight, secretion signal, and the presence of eight spatially conserved cysteine residues. These class I hydrophobins genes were termed hyd 1 and hyd 2 (Cho et al. 2007a) The Hyd2 protein has been shown to be a part of the B. bassiana spore coat and Hyd1 was tho ught to be either secreted into l iquid cultures to lower water surface tension allowing fungal structures to grow into the air or to condition surfaces allowing the fungus to grow. T he addition of a pH induced self cleavable intein fusion partner and a step wise refolding of the class I hydrophobin recombinant nHyd2 from inclusion bodies results in active protein that is self assembling and can alter the surface hydrophobicity of glass I t will be show n that both B. bassiana hydrophobins Hyd1 and Hyd2 are responsible for the formation of the rodlet layer through targeted gene knockouts hyd1 hyd2) Also, a novel trans complementation system using

PAGE 68

68 recombinant nHyd2 hyd 2 conidia will be used to demonstrate a charge dependent self as sembly of nHyd2 on the cell surface. Materials and Methods Cultivation of Microorganisms and Chemical Reagents Beauveria bassiana (ATCC 90517) aerial conidia were grown on potato dextrose agar (PDA) or sabouraud dextrose + 0.5% yeast extract on agar plates (SDAY) containing 5ug/ml Trimethoprim a broad spectrum antibiotic to reduce bacterial contamination Agar plates were incubated at 26PoPC for 1012 days and aerial conidia were harvested by flooding the plate with sterile dHR2R0 containing 0.01% Tween20. Conidial suspensions were filtered through glass wool and final concentration determined by direct count using a haemocytometer. Liquid broth cultures ( b lastorspores) were inoculated (1:20) with conidia harvested from plates to a final concentration of 0. 5 5 x 10P5P conidia/ml. Cultures were grown for 34 days at 26PoPC with aeration. Cultures were filt ered through glass wool or Miracloth (Calbiochem Corp.) to remove mycelia, and the concentration of blastospores was determined by direct count. Filtered cel l suspensions were harvested by centrifugation (10,000 X g, 15 min, and 4PoPC), washed two times with sterile dHR2RO + 0.02% Tween20, and resuspended to a concentration of 10P8P spores/ml. S ubmerged conidia were produced in TKI liquid media ( 50.0 g Fructose, 10.0 g KNOR3R, 5.0 g KHR2RPOR4R, 2.0 g MgSOR4R*7HR2RO, 50 mg CaClR2R, 50.0 mg Yeast extract in 1L of HR2R0) with aeration for 34 days at 26PoPC. Submerged co nidia were filtered though Miracloth and the concentration was determined by direct count using a haemocytometer

PAGE 69

69 M icrobial Adhesion to Hydrocarbons (MATH) Assay Cell surface hydrophobicity was determined essentiall y as described by Smith et al. 1998. Briefly, aerial conidia, blastospores and submerged conidia were washed into PUM buffer (per liter: 22.2 g KR2RHPOR4R, 1.8 g urea, 0.2 g MgSOR4R*7HR2R0, final pH 7.1). Fungal cell suspensions were adjusted to ODR470R 1.4 and dispensed (3 ml) into acid washed glass tubes (12X75 mm). Hexadecane (300 l) was then added to each tube and the tubes were vortexed three times for 30 sec The vortexed tubes were allowed to stand at room temperature for 15 min before the hexadecane phase was carefully removed and discarded. Tubes were then cooled to 5PoPC and any residual solidified hexadecane removed. The tubes were then returned to room temperature and the AR470 Rof the resultant cell suspensions was determined. The hydrophobic index was calculated using the following equation: (AR470,control R AR470,hexadecane treated R)/ AR470,control Hydrophobic Interactions Chromatography (HIC) Assay Fungal cells (1 ml of 1 2 x 10P7Pcells/ml) washed in PUM buffer were loaded onto 1 ml columns containing either phenyl sepharose or unmodified (CL4B) sepharose (Sigma) pre equilibrated in PUM buffer. Columns were subsequently washed in PUM buffer (4 ml) and the n umber of fungal cells recovered in the eluate was determined using a haemocytometer. The hydrophobicity incex (HI) was calculated using the following equation: [(percentage cells eluted from unmodified sepharose) (percentage cells eluted from phenyl sep harose)]/(percentage cells eluted from unmodified sepharose).

PAGE 70

70 RNA Extraction Total RNA was extracted from B. bassiana cells using either RNAwiz or TRI Reagent (Ambion) according to the manufacturers recommendations, including the high salt precipitation step for removal of proteoglycans and polysaccharides. Culture conditions for RNA extraction were as follows: B. bass iana was grown on PD agar (PDA) or on Sabouraud dextrose + 1% yeast extract either on agar plates (SDAY) or in liquid broth (SDY). Plates were incubated at 26PoPC for 10 12 days and aerial conidia were harvested by flooding the plate with sterile dHR2RO. Con idial suspensions were filtered through Miracloth and final s p ore concentrations were determined by direct count using a haemocytometer. Liquid broth cultures were inoculated (1:50, v/v) with conidia harvested from plates to a final concentration of 0.55 X 10P5P conidia/ml. Blastospore cultures were grown for 34 days at 26PoPC with aeration. Cultures were filtered through glass wool or Mira cloth to remove mycelia, and the concentration of blastospores was determined by direct counting. Submerged conidia were isolated from TKI broth (per Liter: 50.0 g fructose, 10.0 g KNOR3R, 5.0 g KHR2RPOR4R, 2.0 g MgSOR4R*7HR2R0, 50.0 mg CaClR2R, 50.0 mg yeast extract), as previously described (Cho et al., 2006). A time course of growing mycelia was prepared by growing B. bassiana on PDA. At the desired time points (3, 5, 10, 18, and 28 days), conidia were removed by washing the plates by flooding two to three times with dHR2RO, and the mycelium was obtained by lightly scraping off the fungal biomass from the resultant agar plates. Mycelia were examined by light microscopy for the presence of conidia, and samples containing less than 1% conidia were used for further experimentation. Chitin and insect cuticle liquid broth cultures (50100 ml), consisting of 1:4 diluted Sabouraud dextr ose broth supplemented with 1% (wt/v) chitin (extracted from crabshells) 1% powdered,

PAGE 71

71 sterilized Manduca sexta cuticle (kind gift of D. Boucias, Dept. of Entomology and Nematology, University of Florida), or 1% chitin + 1% M. sexta cuticle, were inoculated with conidia harvested from plates to a final concentration 0.55 X10P5P conidia/ml and were grown for 3 days at 26PoPC, flash frozen in liquid nitrogen, and stored at 70PoPC. Semi quantitative Reverse Transcriptase PCR Analysis Total RNA isolated as described above was precipitated once with LiCl before being DNasetreated using the DNA free reagent (Ambion). RNA samples were then treated with SUPERaseIn (RNase inhibitor, Ambion) and stored at 70PoPC until use. Total RNA concentration was quantified for each sample preparation using the Ribogreen RNA quantification kit (Molecular Proves). cDNA for each sample was synthesized using 1.0 g of total RNA plus Superscript III reverst transcriptase with oligo dTP18P priming, following the manufacturers protocol (Invitrogen). PCR reactions were as follows: 1.0 l of a twofold dilution of the cDNA sample was PCR amplified using 6.0 l DNA polymerase Mastermix (Eppendorf), 0.3 l of 0.01 mM of each primer, and dHR2RO to a final volume of 17.0 l. Amplifications of portions of the B.bassiana actin and tubilin genes (See Table 2 1 ) were performed as controls during all reactions, and were used as internal standards to normalize the expression levels of the hyd1 and hyd2 genes in the various RNA samples. The relative intensity of the bands was determined after densitometric scanning using Adobe Photoshop. Primer sets used for the amplification of hyd1 hyd2 actin and tubulin are presented in table 21 In all experi ments, controls containing no template or no enzyme were performed. Each PCR reaction was performed twice with duplicate biological samples and cDNA preparations for each sample.

PAGE 72

72 Isolation and Construction of nHyd2 Gene into the pTWIN1 Expression Vector R estriction enzymes were obtained from NEB. E.coli competent cells Top 10, BL21 and Rosetta 2 (DE3) were purchased from Invitrogen. All other chemicals and reagents were purchased from Fischer Scientific. The open reading frame (ORF) corresponding to the h yd 2 gene without its predicted signal peptide was cloned into t he pTWIN1 plasmid of the IMPACT system encoding an N terminal modified Ssp DnaB self cleavable intein tag coupled to a chitin binding domain ( New England Biolabs Inc ) The hyd2 gene was isol ated from a B. bassiana EST library constructed by Dr. Cho as described previously (Cho et al. 2007a) The hyd2 was first cloned into a pCR TOPO TA cloning vector from Invitrogen. Primers for isolation of th e gene were constructed based upon the cDNA sequence of the hyd2 gene (Table 22 ). The signal peptide of the hyd2 gene was predicted by SignalP and not included in the vector construct. T he primers i ncluded restriction sites for 5 Sap I and 3 Pst I seque nces The PCR product was run on a 1% agarose gel, cut out and isolated using Qiagens QIAquick Gel Extraction Kit. Restriction d igestion of the hyd2 fragment and the vector expression plasmid, ligation and transformation into XL10 Gold ( Stragenene) chemically competent E. coli cells were performed using standard protocols. Transformants were then screened for the correct insert by PCR, Hind III/Nde I digestion, and DNA sequencing. A stock ( 1 ml ) of culture was then stored at 80PoPC in 7% glycerol fo r future work. Expression and Purification The pTWIN1 plasmid containing the hyd2 gene was transformed into E. coli Rosetta2 gami cells (Invitrogen) which contains the pRARE plasmid encoding for

PAGE 73

73 several rare tRNAs aga (Arg), agg (Arg) ata (Ile), cta (Le u) gga (Gly) ccc (Pro), cgg (Arg). These rare tRNAs are needed for expression of the nHyd2. The culture was expressed in 1 liter LB supplemented with ampicillin (60 g/ml) and chloramphenicol (30 g/ml). Cu lture was grown to an OD of 0.9 and induced w ith 1mM IPTG for 3 h ours at 37PoPC with shaking. The culture was then spun down (12,000Xg), resuspended in 100ml l ysis buffer (20 mM Tris, 300 mM NaCl, pH 8.5), sonicated using a Sonifier Cell Disruptor model 185 (Heat Systems Ultrasonics Inc.) for three 45 sec bursts and spun down again. The resulting pellet was then suspended in 100 ml denaturing buffer (7M guanidineHCl, 20 mM Tris, 300 mM NaCl, and 10 mM DTT, pH 8.5) for at least 1 h our at 4PoPC. The unfolded protein was then refolded by st epwise dialysis against decreasing concentrations of urea (Table 23 ) as previously described (Hackenberger et al. 2006) Each step was performed at 4PoPC for 24 hours. Roughly 1 L dialysis buffer was used for 1 L culture (100 ml of resuspended pellet in denaturing buffer). The refolded Inteinn Hyd2 fusion protein was then loaded on to a 10 mL chitin bead column (New England Biolabs). The column was then washed with 15 column volumes of wash buffer (20 mM Tris, 600 mM NaCl, pH 8.5). The pH mediated intein cleavage was initiated by addition 7 column volumes of cleavage buffer (20 mM Tris, 300 mM NaCl, 1 mM DTT, pH 6.5) for 2440 h ours at room temperature. T he n Hyd2 protein eluate was collected in 7X 1mL fractions of cleavage buffer. Protein co ncentration was determined by P i e rce 660 nm Protein Assay The purity of the protein was monitored by lithium dodecyl sulfate polyacrylamide gel electrophoresis (LDS PAGE) (Fig. 2 10) Aliquots of the prot ein samples were mixed with 4X lithium dodecyl sulfate (LDS) and run on a 10% bistris NuPAGE gel with MES running buffer along with protein molecular weight standards

PAGE 74

74 (Invitrogen). Protein bands were visualized using SimplyBlue SafeStain (Invitrogen). For identification of the n Hyd2 protein product, a protein band ~11kDa was excised from the PAGE gel and subjected to ingel tryptic digestion before LC MS/MS analysis ( performed by the ICBR Proteomics Core Laboratory at the University of Florida) Results w ere analyzed using Scaffold Viewer Proteome software v. 2.01.01. Atomic Force Microscopy (AFM) and Transmission Electron Microscopy (TEM) Atomic force micrographs were made using a Digital Instruments Multimode SPM atomic for ce microscope (model MMAFM2) p laced on a marble stone platform with a nitrogen suspension table. Images were taken in contact mode using a SiR3RNR4R probe (Digital Instruments, model NP 20, spring constant = 0.12 N mP1P). Fungal cells were placed on 1.2 m poresize Millipore filters and air dried for 14 h ours before examination. Images were collected at 512 samples/lines with a scan rate of 0.96Hz and tip velocity of 30.6 m sP1P. Data from the micrographs were analyzed using Nanoscope SPM v4.42 SPM Image Magic demo v1.10, or WsXM 3.0 Transmission electron micrographs were made using a Hitachi H7000. A 200 l drop of 0.18 g/ml hydrophobin protein was placed on top of a formvar grid. The grid was then incubated at room temperature overnight to allow the droplet to evaporate. The sample was then negatively stained with uranyl acetate. The resulting film was then visualized by ICBR electron microscopy department in order to determine the presence of recombinant nHyd2 protein. ThT Assay It has been previously shown that increased ag itation of hydrophobin solution promotes self assembly via conversion of the monomeric form to the two dimentsional arrays (Kwan et al. 2008) This property allows us to monitor the nHyd2 transition from

PAGE 75

75 the soluble form to the assembled form. sheets displays and increas sheet structure of hydrophobins in self assembled form, ThT can be used to monitor hydrophobin self assembly. Solutions containing various concentrations of purified nHyd2 and ThT were vortexed for v arying intervals and the fluorescence at 485nm was determined. The ThT binding assay was performed essentially as described (Kwan et al. 2008) Briefly, ~ 1 50 g/ml and ~75 g of E.coli produced Hyd2 and ~150 g/ml of n Hyd2 harvested from conidial surface was mixed with 38 M Th ioflavin T added to well s of a 96 well black fluorescence plate. The plate was then sealed using iCycler iQ Optical Quality Sealing Tape (BioRad). The samples were then vortexed for intervals of 0, 2, 5, 7, and 10 min. The addition of the nHyd2 and ThT was staggered such that all vorte xing time points ended simultaneously in order to read all samples using one plate. The sealant was removed and samples read using a SpectraMAX GeminiXS f luorescence spectrophometer (Gemini Devices). Fluorescence spectra were monitored over a wavelength range of 450 600 nm (with slit widths set at 10nm for excitation and emission) with an excitation of 435 nm and a cut off of 455 nm Results shown are from three separate replicates. Hyd2 Glass Surface Modification Glass cover slips were prepared by cleani ng the glass coverslips with detergent and copious rinsing with milliQ distilled HR2R0 followed by an acid wash (1M HCl) for 2 hours after which the coverslips were copious ly rinsed with diHR2RO. Purified protein 50 l dropl et of n Hyd2 (20 g/ml) in elution buffer was placed onto parafilm. The droplet was incubated overnight in a moist environment to allow self assembly at the water/air interface. The hydrophobin monolayer was then transferred to a prepared glass cover

PAGE 76

76 slip by bringing it in co ntact with the hydrophobin droplet. The glass cover slip was then washed 2X with diHR2RO 1% SDS, and 60% ethanol to remove any unbound protein. Assembled monol ayer was then visualized by AFM and used for water contact angle measurements. Water Contact A ngle Measurements Water contact angle and surface tension measurements of the self assembled recombinant n Hyd2 protein were carried out at the Particle Engineering Research Center using a RameHart model 500 advanced goni ometer wit h automated drop dispenser, tilting plate, and DropImage Advanced software. Glass slides were either unmodified, or modified with our recombinant n Hyd2. The unmodified glass slides were treated with buffer solution (20 mM Tris, 150 mM NaCl, pH 6.5). The modified glass slides we re either prepared by drop transfer method, a 100 l drop of 130 g/ml n Hyd2 was placed on to a parafilm strip and incubated at RT with relative humidity >90% overnight, glass slide was then placed on top of drop to transfer self assembled hydrophobin monomer onto its surface; or a 50 l of 130 g/ml drop was allowed to evaporate overnight on a glass cover slip. Glass slides were washed 3X with dHR2RO and 60% ethanol to remove any excess hydrophobin and/or buffer solution. Contact angle measurements wer e then determined using g lycerin and dHR2RO. The angle measurements were determined just prior to movement of the water drop. Briefly, a drop of water or glycerin was brought into contact with the unmodified g lass slide and glass slide that had been modified with the self assembled Hyd2 protein. Advancing and receding contact angles ( RAR RRR) were then determined. All experiments were done in triplicate and carried out at room temperature with a relative humidity of 5055% humidity. Contact angles measurements were taken from 4 separate experiments using

PAGE 77

77 15 angle measurements each. The resulting data was processed using ImageJ 1.42q software Langmuir Blodgett Isotherms LB isotherms were generated with t he kind help of Hrishi Basi and Dr. S. Talha m Pr essure area isotherms were generated using a KSV Mini Langmuir system (KSV Instruments) using ultra pure Milli Q water at pH 6.0, and T=24PoPC PoPC as the subphase. Purified Hyd2 (600 l, 130 g/ml in 20 mM Tris HCl, 150mM NaCl, pH 6.5) was spread along the subphase using a microsyringe; small droplets were spread about over the whole area (1200 cmP2P) in order to evenly distribute the sample before compression. Surface pressure was monitored with a small weight attached to a sensitive balance and the sample was allowed to stabilize for 1 hou r prior to compression. The monolayer was compressed and expanded at a rate of 250 mmP2P/min h yd h yd 2 Knockout Generation hyd1 and hyd2 gene knockouts were generated by Shizhu Zhang. The targeted disruption of hyd 1 and hyd 2 was carried using a blastospore mediated transformation system (Ying & Feng, 2006) Briefly, hyd 1 and hyd 2 were amplified using sequencial primer pair s H1F (tcagtctaatgtcgtggtggtggc) H1R (ccaatgttttcggaaccattacccactttgct), H2F (gccacacggcaggctctgagaga), and H2R (ccagcagctgtgcggctacgagat ) generating a ~4kb fragments The PCR product was then sub cloned into TOPO blunt end vector to generate pTOPO hyd 1 and pTOPO hyd 2. Reverse PCR was used to linearize the vectors using primer pairs H1KOF (gcatcgtgttgccgttgccg), H1 KOR (tcaaccagcttgtccccatcgac), H2 KOF (gcatcgtgttgccgttgccg), and H2 KOR (tcaaccagcttgtccccatcgac). The linearized vector was then ligated to herbicide resistance gene (bar) cassette amplified from pBARGPE

PAGE 78

78 to form the hyd1 and hyd2 KO vectors. B. bassiana competent blastospore generation and subsequent transformation were conducted by established procedures as described by Ying et.al (Ying & Feng, 2006) Identification of the gene disruption m utants was performed by PCR and DNA sequencing (data not shown). Trans complementation of h yd 2 Trans complementation was carried out on both h yd h yd 2 h yd1 and h yd2 con idia were grown on PDA for 14 21 days. Conidia were then harvested using an inoculation loop and the working solution was kept between 10P6P and 10P7P conidial/ml by direct count using a haemocytometer The conidia were harvested by scraping the culture plate with an inoculation loop. The conidia w ere then resuspended in a solution o f purified n Hyd2 (~130 g/ml) with 20 mM Tris and 150 mM NaCl. A pipette was used to vigorously agitate the mixture to generate bubbles and incubated at room temperature overnight. The liquid was then evaporated in a centri vap and the cell pellet resuspended in 100 l dHR2R0. The cells were then prepared for imaging by AFM by placing a 10 l drop onto a 1.2 m pore size Millipore filters and air dried for 14h. Successful trans complementation was determined by the presence of organized bundles hav ing an elongated shape and the presence of striations running lengthwise along the bundles. Quantation of trans complementation was determined by measuring the length and width of the at least 20 striated bundles (5 conidia each) and comparing to the wild type conidia. pH dependence of trans complementation was performed at pH ranges of 4.010. h yd 2 conidia were harvested at day 14 and 30 from the same plate. Cells were then trans complemented with purified nHyd2 solution where the pH had been adjusted to pH 4.0, 5.0, 6.0, 7.0, 8.0 and 10.0. Results were determined from at least 15 conidia at each pH. Reactions were also performed using h yd 2 conidia that

PAGE 79

79 were autoclaved, treated with 5% gluteraldehyde, or exposed to UV light. For autoclaving, conidia were placed in a 1.5 ml microcentrifuge tube and autoclaved at 137PoPC for 2 min. The gluteraldehyde fixed conidia were incubated at room temperature with 5 % gluteraldehyde overnight. The cells were then centrifuged at 16,000 x g for 5 min. The gulteral dehyde was then removed by decanting and the cells were washed 3 times with sterile distilled HR2R0 to remove residual gluteraldehyde. The conidia treated with UV light were smeared onto a Petri dish and exposed to a UV germicidal light for 1.5 hrs. After each treatment the cells were trans complemented with n Hyd2 solution as previously described and imaged by AFM. Results 7TAFM : Cell Surface Morphology Detailed surface topological features of live B. bassiana cellsP Pcould be distinguished by Atomic Force Microscopy ( AFM ) (Fig. 2 4 ). AFM allows theP Pvisualization of live cells without fixation, and was used toP Pprovide resolution at the micrometer level of surface featuresP Pof freshly harvested cells. Fascicle bundles, presumably composedP Pof assembled hydrophobin(s) protein rodlets, were clearly visibleP Pon B. bassiana aerial conidia (Fig. 2 4 a, d). Striated filame ntsP Pcould be distinguished within the elongated bundles (Fig. 2 4 g). In contrast, no bundles or f ilaments were visible on eitherP Pblastospores or submer ged conidia. The blastospore surface appearedP Psmooth (Fig. 2 4 b, e), whereas the submerged conidial surfaceP Pwas rough, and a circular ring was apparent on some of the latterP Pcells (Fig. 2 4 c, f). In several instances, bipolar germinationP Pwas noted for B. bas siana (Fig. 2 4 h), and this has beenP Preported to correlate with its infectious nature (Talaei Hassanloui et al. 2006) No fascicles were visible on the germ tubes orP Phyphae of germinating aerial conidia,

PAGE 80

80 although fascicles appearedP Pto remain on the conidium during germination (Fig. 2 4 i,P Pj). AFM images of the germinated conidi a revealed fasciclesP Pthroughout the mother cell, and the lack of fascicles on theP Pslopes of the images presented is due to cantilever artifactsP Pat the resolution employed. Measu rement of Cell Surface Hydrophobicity Two methods were used to assess the cell surface hydrophobicityP Pof the different B. bassiana cell types. In the first, a MATHP Passay in which cells partition between two immiscible solutionsP P(water and hexadecane) was used (Fig. 2 5 ). In this assay,P Pentities with a hydrophobicity index (HI) > 0.7 are considered hydrophobic (HI=no.P Pcells in organic phase/total no. cells). Aerial conidia wereP Pclearly hydrophobic and distributed into the organic phase (HI=0.88),P Pwhereas blas tospores were hydrophilic, predominantly localizingP Pto the aqueous phase (HI=0.4). Interestingly, submerged conidiaP Ppartitioned to a slightly greater extent into the organic phaseP Prather than the aqueous phase (HI=0.72), with cell surface characteristicsP Papparently on the borderline between hydrophobic and hydrophilic.P PA second assay, involving HIC, in which the binding of cellsP Pto phenyl Sepharose and unmodified Sepharose is used as an indicatorP Pof the hydrophobic nature of particle surfaces, resulted in data that was in close agreement with theP Presults of the MATH assay (Fig. 2 5 ). Gene Expression Analysis of the Beauveria bassiana hyd1 and hyd2 Genes The expression pattern s of the B. bassiana hyd1 and hyd2 genes w ere analyzed by semi quantitative RT PCR. Two internal controls, namely tubulin and actin, were used t o normalize the expression data. Data in which (i) the variation between samples of the total RNA/actin or total RNA/ tub u lin and (ii) the variation between biological samples was less than t wofold were used. In addition, a standard curve of actin

PAGE 81

81 concentration determined by PCR against the amount of RNA guantified by Ribogreen was generated. Only data that fell within the linear portion of the standard curve were considered valid. The relat ive expression level of the two genes was assessed in RNA pools derived from aerial conidia, blastospores, submerged conidia, growing mycelia, and from blastospores grown on insect cuticle, chitin (the main carbohydrate constituent of insect cuticles), and insect cuticle + chitin (Fig 2 6 ). The data presented were determined to be within the linear portion of the PCR analysis (25 cycles), with the actin concentration closely correlating to the amount of RNA quantified for each sample under test. Hydrophobin expression was normalized to the quantification of the actin band. B. bassiana hyd1 expression was detected in all developmental stages and media conditions tested. Hyd1 levels appeared to increase during mycelia growth, with the highest level of expression observed after 28 days of growth on agar plates, although caution should be take n in any interpretation of these results, as they derived from semi quantitative measurements. On agar plates cells began sporulating (i.e. producing aerial conidia) after ~14 days; however, conidia were washed from the plates of all the mycelia samples b efore RNA isolation. This was confirmed by direct count using microscopic visualization of the mycelia samples, in which <1% of the contaminating aerial conidia were visible in the mycelia preparations. Thus, the observed hyd 1 expression appears to be derived from the mycelia. Expression in aerial conidia was similar to that observed in either blastospores or submerged conidia, and was equivalent to that observed in 18 day mycelia. Cells growing in the presence of 1 % chitin,P P1 % cuticle, and 1 % chitin+1 % cuticle also showed robust expressionP Pof hyd1,

PAGE 82

82 similar to levels seen in blastospores and submergedP Pconidia, and 5 10 day mycelia. In contrast to hyd1 hyd2P Pappeared to be constitutively expressed and at about the sameP Plevel as actin throughout the gr owing mycelia stages (3 28P Pdays). Little or no hyd2 was observed in either blastosporesP Por aerial conidia. Some hyd2 transcript was detected in submergedP Pconidia, which corresponded to about 5 10 % of the levelsP Pseen in the mycelial samples. Intriguingly, hyd2 was expressedP P(at approximately the same levels as actin) in fungal cellsP Pgrowing on 1 % chitin or 1 % cuticle, but almost no transcriptP Pcould be detected when the cells were grown on 1 % chitin+1P P% cuticle. Protein Expression of Recombinant Hyd2 I n o rder to produce the hydrophobin protein in sufficient quantities for further characterization, a method for using an E. coli based production and purification system needed to be established. Numerous attempts were made to express the Hyd2 protein in E. coli, including constructing fusion partners with 5X His tags, Thioredoxin fusion moietys, and the V5 epitope. These systems however, did not produce significant amounts of the desired n Hyd2 protein, which lead to the use of the IMPACT (p TWIN1) system from NEB. The hyd 2 gene was cloned into the pTWIN1 vector, transformed into Top10 E.coli and confirmed by PCR, Hind III/Nde I digestion, and sequencing. In this expression system, an 2TSynechocystis 2Tsp DnaB intein fusion partner was coupled to t he N terminus of the Hyd2 protein (Fig. 2 7 ) The expression clone lacked the 17 amino acid signal peptide found in the cDNA ORF and the first three amino acids of the putative mature protein was changed from Ala Pro His to Gly Gly Ala. This change in am ino acids was done to optimize the autocatalytic activity of the intein fusion moiety. The pTWIN Hyd2 plasmid was then transformed into the Rosetta2 (DE3) for expression. The Rosetta2 (DE3) expression cells carry the pRARE plasmid, which codes for the

PAGE 83

83 rare tRNAs not found in E.coli, but are needed to produce the hydrophobin protein. Several strategies such as low temperature, reduced expression time, reduced IPTG concentration, 1% glucose, fusion partners, and constitutive expression were used to express the Hyd2 as a soluble protein, however these did not result in appreciable protein yields Therefore the n Hyd2 protein was purified from exclusion bodies. We decided to purify the n Hyd2 protein from the inclusion bodies. After solubilization of the in clusion bodies under denaturing conditions, the refolding process, in order to obtain functionally active protein, relied on a stepwise dialysis of decreasing urea concentrations at a basic pH ~8.5 (8 M Urea, 10 mM DTT; 6 M Urea, 1 mM DTT; 4 M Urea, 1 mM D TT; 2 M Urea, 1 mM reduced glutiothine; 0M Urea, 1 mM reduced glutathione). The stepwise dialysis allows for refolding of the protein, while the basic pH ensures that the fusion moiety is not prematurely removed. After expression and refolding the n Hyd2 protein extract was l oaded onto a chitin bead column, which was extensively washed and the final product was eluted by addition of buffer at pH of 6.0. LDS PAGE analysis revealed the presence of a ~11kDa protein in the elution fractions (Fig. 2 8 ). The eluted protein was then analyzed viaP Ptryptic digestion followed by MS peptide fingerprinting Four peptide fragments, LLAAECSPISVNVLLNQLVPIDNK, LTGPSVLSDLDLR, QQSICCGEQK, and TGDICGNGNTMHCCNDESVTNK were obtained. Peptide analysis of these fragments revealed them to correspond exactly to predicted fragments of Hyd2 amino acid sequence. Protein concentrations of the n Hyd2 fractions resulted in roughly 15025 0 g/ml for a total protein yield of 510 mg/L of initial E. coli culture as determined by the Pierc e 660nm protein assay.

PAGE 84

84 Thioflavin T Self Assembly Assay n Hyd2 at 150 g/ml displayed a fivefold increase from 130 2.5 to 650 37.8 relative fluorescence units ( RFUs ) in the first 7 minutes which then plateaud (Fig 29 ) At a n Hyd2 concentration of 75ug/ml the fluorescence signal increased ~2.5 fold. The hydrophobin, Hyd2, extracted directly from the conidial surface showed a similar assembly pattern (142 5.8 to 680 12.5 RFUs over 7 minutes) as that of the recombinant n Hyd 2 at similar protein concentrations Controls showed no significant increase in RFUs over all time periods. Transmission Electron Microscopy (TEM) In order to visually confirm the presence of a self assembled hydrophobins TEM was used. The purified hydrophobin solution was placed on a formvar grid and sent to ICBR for TEM analysis. The resulting micrographs showed the presence of small striated filaments (Fig 2 1 0 ). These filaments are 197.1 52.5 nm long and 24 3.5 nm wide. This further indicates t hat the E. coli produced hydrophobins are assembling into a monolayer just like hydrophobins isolated directly from the fungal surfaces. LB Blodgett Analysis To investigate the organization of the protein monolayer at the water/air interface, the n Hyd2 was subjected to Langmuir Blodgett compression. The surface pressure vs. area isotherm shows a moderately sharp rise in the surface pressure with a collapse point near 30mN/ m, with a mean molecular area of ~28 AP2P ( Fig 2 1 1 ) These results are consistent with the formation of a rigid monolayer and other hydrophobin monolayers formed at the water/air interface (Asakawa et al. 2009; Houmadi et al. 2008; Kisko et al. 2007)

PAGE 85

85 n Hyd2 Surface Modification Self assembly of nHyd2 onto a hydrophobic surface was visualized using AFM in contact mode. A monolayer of n Hyd2 was deposited upon three glass coverslip s using the drop transfer method. An area of 500 X 500 nm was scanned in order to clearly visualize the self assembled monolayer. Figure 2 1 2 shows the n Hyd2 coated onto a piece of glass using the drop surface transfer method. Experiments were also performed in which a drop of hydrophobin solution was allowed to evaporate on the glass slide. T he n Hyd2 treated glass slide shows a rigid monolayer. The average height of the monolayer domains seems to be between 24 nm which corresponds wel l to previously reported results (Houmadi et al. 2008) A roughness analysis showed the roughness (root mean square (RMS)) to be approximately 1 nm throughout the entire sample. The monolayer shows a complete homogenous coverage of the surface with the n Hyd2 protein. Water Contact Angle (WCA) Measurements A thin film monolayer was generated by coating a glass coverslip with n Hyd2 solution and used to determine the change in water contact angle of modified versus unmodified glass slides (Table 24 ) Water contact angle is a measurement of surface hydrophobicity. Contact angle is the angle at which a liquid/air interface comes in contact wi th a solid surface. When glycerin was used as the liquid substrate, the advancing contacting angle ( RA )R for the control was determined to be 88.9PoP while that of the modified glass slide was 56.8Po Pusing drop transfer (dt) and 68.5PoP using drop evaporation ( de). This is a change in WCA of 32Po Pand 20PoP respectively. The receding contact angle ( RRR) was determined to be 48.3PoP for control, 17.5PoP for dt, and 18.5PoP for de with changes in WCA of 31PoP and 30PoP respectively When water was used as the liquid

PAGE 86

86 substrat e RAR was found to be 75.9PoP for control, 70.8PoP for dt, and 72.9PoP for de. RR Ris 44.5PoP for control, 15.6PoP for dt, and 14.5PoP for de. Figure 21 3 shows images of glycerin and water drops, which clearly show a change in the geometry of the drops from control versus modified glass surfaces. h yd h yd h yd 2 Trans complementation G ene knockouts of the h yd 1 and hyd 2 genes in B. bassiana were constructed in the lab (S. Zhang) The wild type conidia of Beauveria bassiana have elongated bundles (L = 94.15 34.5 nm, W = 36.6 9.8 nm ; N = 5 cells, 20 bundles each) with striated filaments (3.8 1.7 filaments/bundle) running lengthwi se on the surface (Fig. 21 4 a). Aerial conidium in which the Hyd2 protein was no longer produced ( ) has a disrupted spore coat in which the clearly defined bundles and rodlet filaments are lost. I nstead a disordered cell surface landscape is noticeable ( Fig 2 1 4 c). In contrast, the hyd1 knockout show ed a dramatic disruption in the spore coat phenotype. These conidia lost all appearance of both the bundles and the rodlets found on the sporecoat showing a relatively smooth surface (Fig 21 4 d) The double mutant was similar to the hyd 1 knockout, although its surface actually appears less smooth than the hyd 1 mutant with some surface structures noticeable. Aerial conidia of filamentous fungi, including B. bassiana are coated by hydrophobins Although few studies have examined this process, it is thought that the rodlet layer is formed by spontaneous self assembly of the hydrophobins on the cell surface P revious results indicated that the primary component of the sporecoat to be Hyd2 (Holder & Keyhani, 2005) but analysis of the hyd hyd 2 mutants suggest a role for both proteins in the spore coat rodlet layer In order to provide more information regarding t he relationship between Hyd1 and Hyd2 on the surface of aerial conidia,

PAGE 87

87 attempts were made to complement h yd 2 conidial phenotype with recombinant Hyd2 protein solution added to B. bassiana fungal spores in solution. This t rans complementation of th e hyd 2 knockout with a n Hyd2 protein solution resulted in the appearance of patches of rodlet filaments, ie a partial or complete restoration of the phenotype (Fig. 2 1 5 ) The trans complimented conidial spore coat contained patches of ordered array s of striated bundles (L = 93.5 31.6 nm, W = 24.7 8.0 nm, 4.2 1.5 striations/bundle; N = 5 cells, 20 bundles each) similar to that seen on the wild type conidia. E xperiment s in which nHyd2 was added to hyd 1 conidia had no apparent effect on the morpholo gy of the spore coat. Trans complementation appeared to depend upon the age of the conidia harvested from PDA plates. C onidia that were >28 day old appeared to be unable to be trans complemented. In order to better define the conditions allowing for the trans complementation to occur, a time course using hyd2 conidia from the same plate at 10, 14, 21 and 30 day s were incubated with purified nHyd2. These data revealed t hat optimal trans complementation occurred between 10 and 14 day s, whereas day s 21 and 30 were unable to be trans complemented ( Fig 2 1 6 ). hyd2 conidia were then trans complemented at increasing pHs from 4.010 .0 to determine possible effect of ionic strength upon trans complementation (Table 25 ). hyd2 conidia harvested at day 14 showed an inability to be trans complement ed at hyd2 conidia could only be trans complement ed at a pH of 4.0. To assess whether the observed inability of trans complementation was due to the effect of pH on nHyd2 self assembly, the nHyd2 was monitored for self assembly by ThT assay over a pH range of 4.010. Results indicate that the pH did not inhibit self assembly (data not shown).

PAGE 88

88 In order to examine whether the trans complementation depended upon the living st ate of the conidia, yd2 conidia were heat killed, glut a raldehyde fixed, or UV exposed prior to being incubated with the purified n Hyd2 protein solution. The conidia were then imaged by AFM using contact mode as previously described (Fig. 21 7 ). No comp lementation was observed after any of the treatments described above. Discussion Surface Characteristics Fungal cells display a wide range of 7Tsurface7T physicochemicalP Pproperties that allow them to interact and adhere to substrata.P PCell 7Tsurface7T hydrophobici ty is associated with increased virulenceP Pof Candida strains and the hydrophobic rodlet layer of AspergillusP Pconidia appears to confer protection against specific host immune reactions (Hazen, 2004; Paris et al. 2003; Singleton et al. 2005) The determination of 7Tsurface7T biophysical featuresP Pof Aspergillus spores has revealed a role for the rodlet layersP Pa nd their hydrophobin constituents in contributing to hydrophobicity,P Padhesion and resistance to killing by alveolar macrophages ofP Pthe fungal cells (Dynesen & Nielsen, 2003; Girardin et al. 1999b; Paris et al. 2003; Stringer & Timberlake, 1 995; Thau et al. 1994) T he surface hydrophobin RodA was found to prevent host immune recognition of airborne fungal spores in A fumigatus (Aimanianda et al. 2009) Disruption mutants of RodA did not induce dentritic cells or alveolar macrophages, and could not activate helper T cells in vivo (Aimanianda et al. 2009) However, care should be taken in the interpretation of this immunological inertness, as healthy individuals are immune to infection by A. fumigatus 7TEntomopat hogenic7T fungal spore 7Tsurface7Ts rangeP Pfrom hydrophobic, exemplified by fungi such as Nomuraea rileyi ,P PMetarhizium anisopliae and Paecilomyces

PAGE 89

89 fumosoroseus all ofP Pwhich possess defined outer rodlet layers, to hydrophilic, asP Pseen in Hirsutella thompsonii and Verticillium lecanii, oftenP Pcharacterized by the lack of a rodlet layer but containing anP Pouter mucilaginous coat produced during spore maturation (Boucias & Pendland, 1991) AFM has been used to visualize the 7Tsurface7T P Pfeatures of live fungal cells (Dufrene, 2000; Holder & Keyhani, 2005; Zhao et al. 2005) .P P Other methods such as e lectro n m icroscopy are limited by the requirement of fixation and sample processing which precluded visualization of living cells. AFM, however, allows for a real time imaging of the surface characteristics which is essentially noninvasive and results in scanni ng and imaging at nanoscale resolutions. High resolution AFM micrographs of Aspergillus nidulans haveP Prevealed alterations to the spore rodlet layer during swellingP Pin aqueous solutions, and ultrastructural features of newlyP Pdeposited walls at hyphal tips as well as in mature walls (Ma et al. 2005; Ma et al. 2006) In the present study, AFM was used to examineP Psurface morphological differences among the different B. bassiana cell types thatP Pwere air dried 3 4 hours before imaging. Initial experiments usingP Pan aqueous AFM cell chamber resulted in images that were notP Pas clear as the ones presented, although future experimentsP Pimaging the cell types in an aqueous environment are warranted.P PB. 7Tbassiana7T aerial c onidia contained fascicle bundles that wereP Pnot present on either submerged conidia or blastospores. 7TSurface7TsP Pof blastospores were smooth, whereas those of submerged conidiaP Pwere more granulated in appearance. These results are consistentP Pwith the lack of SDS insoluble, trifluoroacetic acid (TFA) solubleP Pproteins in the latter two cell types and their presence inP Paerial conidia (Holder & Keyhani, 2005) Furthermore, no fascicles were visible on

PAGE 90

90 germ tu bes emanatingP Pfrom aerial conidia, suggesting little rodlet layer fluidity betweenP Pspores and the growing germ tube.P Hydrophobicity and zeta potential measurements have been usedP Pto predict the binding preferences of the fungal cells. AnalysisP Pof the cell 7Tsurface7T properties of Cryptosporidium oocytes hasP Prevealed a preference for adhesion to glass rather than hydrophobicP Pplastic materials, although cell 7Tsurface7T hydrophobicity increasesP Pwith increasing ionic strength of the medium (Drozd & Schwartzbrod, 1996) In contrast, conidia of the mycoparasite ConiothyriumP Pminitans are h ydrophobic, although in this case, conidial hydrophobicityP Pdecreases with culture age for some isolates (Smith et al. 1998) Similarly, a comparison of two cell types of TrichodermaP Pharzianum a potential biological control agent of phytopathogenicP Pfungi, reveals that aerial conidia display higher UV resistanceP Pand longer viability, and are more hydrophobic than submergedP Pconidia, which are hydrophilic (Munoz et al. 1995) ContactP Pangle measurements, microbial adhesion to solvents and zetaP Ppotential determinations of blastospores of the 7Tentomopathogenic7T P Pfungus P. fumosoroseus indicate that these cells have a hydrophilic,P Pbasic monopolar 7Tsurface7T, and are negatively charged under neutralP Pconditions (Dunlap et al. 2005) Hydrophobicity wasP Pexamined using two different methods: partitioning of cellsP Pin organic vs. aqueous solvents (MATH), and hydrophobic index chromatography (HIC) The first two m ethods gave almost identical HI valuesP Pfor the cells tested. Overall, aerial conidia are hydrophobic and represent the moreP Presistant spore type, but are slower growing than blastosporesP Pand submerged conidia. Hydrophobic interactions predominateP Pin the case of aerial conidia and are likely to be the mostP Pimportant force in

PAGE 91

91 the host pathogen interaction. AlthoughP Pthey are hydrophobic, the net negative 7Tsurface7T charge of aerialP Pconidia at neutral pH may help account for their ability toP Pbind hydrophilic 7Tsurface7Ts weakly (Holder & Keyhani, 2005) .P PA negative shift in the 7Tsurface7T electrostatic charge distributionP Pwas noted for aerial conidi a as they aged (Holder et al. 2007; Smith et al. 1998) This could be dueP Pto the production of increasing amounts of 7Tsurface7T anionic speciesP Pover time, or the unmasking of negative charges as the sporesP Pdry. Similar experiments could not be performed with blastosporesP Pand submerged conidia, as these cells are not stable and willP Peither grow (i.e. germinate or microcycle conidiate) if sufficientP Pnutrients are present or lose viability over a similar timecourse. The 7Tsurface7T charge distributionP Pof these cells is consistent with their ability to bind weaklyP Ppolar and hydrophilic substrata (Holder & Keyhani, 2005) .P PThe submerged conidia display intermediate 7Tsurface7T propertiesP Pin terms of hydrophobicity and electrostatic charge. These cellsP Pcan grow under nutrient limiting conditions and are likely toP Pexist on insect 7Tsurface7Ts and during host parasite competitionP Pfor nutrients. The intermediate 7Tsurface7T hydrophobicity valuesP Preported in this study again may hel p account for the adhesiveP Pnature of these cells, which were able to bind to hydrophobic,P Pweakly polar and hydrophilic 7Tsurface7Ts (Holder & Keyhani, 2005; Holder et al. 2007) .P The production of different infectious propagules and the wideP Prange of their 7Tsurface7T properties imply a diversification ofP Padaptations evolved by fungal pathogens in mediating attachmentP Pand adhesion to target insect 7Tsurface7Ts. The ability to produceP Pmore than one spore type with different 7Tsurface7T properties canP Pbe expected to increase the possibility of binding diverse rangesP Pof substrata. Biological control applications of 7Tentomopathogenic7T P Pfungi, including B. 7Tbassiana7T, often employ aerial conidia asP Pthe

PAGE 92

92 infective agent; however, the use of other singlecell propagules,P Psuch as blastospores and submerged conidia, has also been attempted.P cDNA Clon ing and Expression Analysis of Hydrophobins 7THydrophobins7T are unique fungal proteins that function in a diverseP Parray of physiological processes. Since 7Thydrophobins7T are oftenP Phighly expressed, the isolation of genes encoding these proteinsP Phas largely been accompli shed from genomic [e.g. expressed sequenceP Ptag (EST)] analyses or, in some cases, by purification of theP Pprotein product and stepwise 7Tcloning7T of genes using nucleotideP Pprimers based upon the available amino acid sequence data (Wessels, 1997; Wessels, 1999; Wosten & de Vocht, 2000) In B. bassiana, the hyd1 transcript was indeed highly expressed and found in our own EST libraries (Cho et al. 2006b) The hyd2 gene, however, was isolated by phage display (Cho et al. 2007a) The translated amino acid sequences of h yd 1 and h yd2 did notP Pmatch the 16 aa N terminal sequence of a putative hydrophobinP Pisolated from B. 7Tbassiana7T reported elsewhere, although the NP Pterminus of mature H yd 2 did show some homolog y ( 50 %) to theP Preported protein (Bidochka et al. 1995b) Similarly, althoughP Pnot an exact match, the N terminus of mature Hyd1 showed homologyP P( 40 %) to the N terminus (as determined by amino acid sequencing)P Pof what was termed an inner cell wall p rotein (cwp1) of B. 7Tbassiana7T P P(Bidochka et al. 1995a) 7TExpression7T analysi s indicated that hyd1 was highlyP Pexpressed under almost all growth conditions examined. These results are consistentP Pwith previous EST analyses of B. 7Tbassiana7T grown under differentP Pdevelopmental conditions (Cho et al. 2006a; Cho et al. 2006b) Notably, hyd1P Ptranscript was abundant in all the singlecell spo re types (aerialP Pconidia, in vitro blastospores and submerged conidia), whereasP Phyd2 transcripts were essentially

PAGE 93

93 absent from these cells. Thus,P Peven though the spore coat of aerial conidia is composed ofP Pthe Hyd2 protein, no hyd2 transcript was detected i n these cells.P PThis is perhaps not too surprising, since it is the aerial conidia that need to make hyd2 and its protein product, and therefore one would not expectP Pto see hyd2 transcript in the final product of this process,P Pnamely the aerial conidia them selves. Transcripts correspondingP Pto hyd2 were also detected in cells grown in 1 % chitin or 1P P% insect cuticle, but were not detected in cultures containingP Pchitin + cuticle, each at 1 % concentration. This result was observedP Pin two separate biological s amples in which actin was used asP Pa control. Although it is unclear why hyd2 transcript was notP Pdetected under the latter growth conditions, it could be dueP Pto the relative nutrient levels in the cultures. Cells growingP Punder 1 % chitin or 1 % cuticle conditions may be nutrient limited,P Pwhich would result in sporulation (i.e. conidiogenesis and henceP Phyd2 transcript production), whereas cultures containing bothP Pnutrient sources may grow in a vegetative state for a longerP Pperiod of time. Further experiments are necessary to determine how these hydrophobins genes are developmentally regulated. Hydrophobin P roduction and Purification The unique biophysical properties of hydrophobins i.e. their ability to form an amphipathic film on an array of surfaces, make them an interesting target for directed biotechnical applications. In order to fully explore these applications large quantities of the protein are required. However, one of the challenges in working with class I hydrophobins has been their production and purification. A number of c lass II hydrophobins such as HFBI and HFBII of Trichoderm a reesei and SC3 of Schiz ophyllum commune have been expressed at levels relatively high (> 200 mg/L) (Askolin et al. 2001) It is thought that there are foldases and chaperones that are

PAGE 94

94 necessary for correct folding of class I hydrophobins (Hektor & Scholtmeijer, 2005) therefore current production of hydrophobins relies on either extracting the rodlet layer dir ectly from the fungi or by expression of the protein in yeast. This method i s time consuming and may be contaminated with host hydrophobins. However, the class I hydrophobin from Neurospora crassa, EAS, has been expressed and purified from E.coli (Kwan et al. 2006) Here we utilize the E.coli intein purification system to allow for fast and efficient production of t he B. bassiana Hyd2 protein. Similar to many eukaryotic proteins expressed in E.coli and undoubtedly due to their unique structural characteristics, our results indic ate the n H yd2 forms insoluble inclusion bodies in the E. coli host. Purification from the inclusion bodies involved a stepwise refolding strategy and use of an intein fusion partner for purification. The use of an intein based affinity purification system was originally developed as a way of expressing proteins in which the mature protein product would not contain any extraneous tags that could limit protein activity (Xu et al. 2000) In order to make use of the autocatalytic activity of the intein, we resorted to a specific amino acid replacement on the N terminal of the Hyd2 protein. The first three amino acids ALA, PRO, and HIS which due to structural const raints reduce intein autocatalytic activity, were replaced with GLY, GLY and ALA respectively. The amino acid replacement allowed for optimal autocatalytic conditions for the removal of the intein fusion moiety Our results indicate that (i) addition of a pH induced self cleavable intein fusion partner and (ii) a step wise refolding of the class I hydrophobin inclusion bodies results in the yield of a reasonable amount of protein (5 10 mg/L). The expression and purification strategy described above has s everal advantages over traditional expression strategies. There is no need of a secondary

PAGE 95

95 enzymatic cleavage reaction to remove the fusion partner, self cleavage of the intein moiety results in no additional amino acids, and coexpression with a large fusion moiety can prevent any proteolytic degradation (Hong et al. 2001) Also, the successful removal of the intein in which there is a cysteine on the N termin al of the protein would generate the correct precursor for intein mediated protein ligation. This would allow the ligation of the target protein to a thioester group of additional peptide fusion partners; or the target protein can be hydrolyzed to reveal the free amino terminus which allow s for versatile usage of the protein with minimal preparation. n Hyd2 S elf assembly A primary biophysical property of hydrophobins is their ability to self assemble into a monolayer at hydrophobic/hydrophilic interfaces (Hektor & Scholtmeijer, 2005; Kwan et al. 2006; Linder et al. 2005; Szilvay et al. 2007) Reself assembly of hydrophobins obtai ned directly from the fungal surface has been demonstrated in many fungi including the Neurospora crassa EAS, Grifola frondosa HGFI, Schizophyllum commune SC3, and Trichoderma reesei HFBI (Beckerman & Ebbole, 1996a; Bellpedersen et al. 1992; Hakanpaa et al. 2006; Hektor & Scholtmeijer 2005; Lugones et al. 1996b; Paris et al. 2003; Szilvay et al. 2007; van Wetter et al. 2000) Any system used to produce and purify these proteins must maintain this key ability. Several lines of evidence were used to determine whether the recombinant n Hyd2 protein retained its activity of self assembly. These included Th T assay, LB isotherms, AFM, SEM surface tension, and Water Contact Angle (WCA) The resul ts of each of these experiments lead to the conclusion that the n Hyd2 retained its native activity. The presumptive self assembly assay of the recombinant n H yd2 protein was determined via t h ioflavin T (ThT) fluorescence. Thioflavin T is an aromatic dye that

PAGE 96

96 binds specifically to stacked sheet structures. It is commonly used in the diagnosis of amyloid fibrosis sheet structures of the amyloid plaques can be detected via binding of the ThT. H ydrophobins have been compared to amyloi d fibrils and the ThT assay as been applied for their characterization (Sunde et al. 2008) Hydrophobins exist in three structural states: a monomeric state which is soluble, an helical state, and a sheet state when the protein has self assembled at hydrophobic/hydrophilic interfaces such as the water/air interface (de Vocht et al. 2000) The Thioflavin T fluorescence assay allows for a rapid screening of the ability of a hydrophobin to self assemble into 2dimensional arrays Thioflavin T selectively binds to protei ns with stacked sheet amino acids, w hen the hydrophobin self assembles, it changes confirmation to a primarily sheet st ate which then can bind to the ThioflavinT. Using this assay we were able to confirm functional self assembly of the purified hydrophobin. The ThT assay indicate d that the Hyd2 protein self assembles over time when agitated was revealed by the increased fluorescence. V igorous agitation maximizes water air interaction of the hydrophobin leading to assembly, a fact often exploited in their purification (De Stefano et al. 2007) Also, our results indicated that there might be a concentration threshold to maximize the self assembly process A decrease in concentration from 150ug/ml to 75ug/ml showed significant decrease in the RFUs (650 to 250) over a 7 minute period. This could be due to a minimum concentration that is required to initiate the self assembly. Atomic force microscopy has widely been used to image a broad array of surfaces due to its noninvasive sample preparation and imaging technique. It is commonly used to visualize the surface of fungi and hydropho bin monolayer preparations (Dague et al.

PAGE 97

97 2008; De Stefano et al. 2007; de Vocht et al. 2000; Hakanpaa et al. 2004) In this work we used AFM determine s elf assembly and the homogeneity of the protein as it assembles on a glass substrate. Our micrographs confirmed the presence of a layer of hydrophobins a few nanometers thick. The hydrophobin monolayer seemed to be compact with few holes or irregularities in the areas covered. This is consistent with previous results showing films of homogeneous preparations of hydrophobin monolayers on different surfaces (de Vocht et al. 2000; Hakanpaa et al. 2004) AFM and T EM were used to visually confirm the presence of a hyd rophobin monolayer. This indicates that the hydrophobin can be used as a surface coating without discontinuities in the monolayer. This rigid monolayer is similar to other types of self assembling molecules such as S Layer proteins found on the surface of a large number of bacteria and A rchaea (Martin Molina et al. 2006) The amyloidlike filaments found after TEM analysis are similar to those found in AFM and SEM micrographs of HGFI and EAS hydrophobins (Mackay et al. 2001; Yu et al. 2008) Water contact angle was used to study the surface modification ability of the recombinant B. bassiana n Hyd2 protein. Hydrophobins have the characteristic of being able to alter the wettability of surfaces i .e. they can alter a hydrophobic substrate to a more hydrophilic substrate. This has been demonstrated for several class I hydrophobins including the Grifola frondosa HGFI and Schizophyllum commune SC3 (Askolin et al. 2006; Hou et a l. 2009; Yu et al. 2008) For example, a siliconized glass surface on which HGFI had been deposited resulted in the alteration of the water contact angle from 86.6PoP to 51.9PoP indicating an increase in surface hydrophilicity They also reported a sharp decrease in the surface tension with increasing concentrations of

PAGE 98

98 HFGI ( specifically between 1 and 2 uM ) (Yu et al. 2008) A dvancing and receding contact angles on nHyd2 protein solutions were measured and both measurements show a decrease in contact angle of roughly 30PoP on glass slides This indicates that the hydrophobin solution is altering the wettability characteristics of the glass slide making it more hydrophilic. Trans C omplementation h yd2 During fungal development, hydrophobins have been shown to have an array of different physiological roles extending from mediating cell substrate attachment, lowering of liquid surface tension to allow growth, and as an element of the fungal spore coat structure (Bidochka et al. 1995b; de Vocht et al. 1998; Ebbole, 1997b; Fuchs et al. 2004; Hektor & Scholtmeijer, 2005; Holder et al. 2007; Houmadi et al. 2008; Kazmierczak et al. 2005a; Linder et al. 2005; Lugones et al. 1996b; Paris et al. 2003) Gene knockouts of the class I hydrophobin MPGI from Magnaporthe grisea resulted in reduced pathogenicity due to reduced attachment, fewer appres sorium, and increased wettability (Talbot et al. 1996) Self assembly studies have shown that class I hydrophobins readily form rodlets in vitro ; however these rodlets are primarily seen after compression with a Langmuir Blodget system (Houmadi et al. 2008) Little is known, however, regarding the mechanisms by which the rodlets are generated on the surface of the conidia In the lab, knocko uts of hyd1 and hyd2 were constructed to determine their function and help characterize the self assembly process on the spore surface (S. Zhang and N.O. Keyhani, unpublished results) The surface of hyd1 aerial conidia showed a relatively smooth surface while the hyd2 mutant had cell surfaces which appeared disorganized. It was originally hypothesized that the double mutant hyd1 hyd 2 hyd1 mutant,

PAGE 99

99 hyd hyd 2 mutants implying that loss of both proteins may result in the exposure or uncovering of some underlying cell structures My current hypothesis is that both Hyd1 and Hyd2 act cooperatively to produc e the rodlet layer with H yd 2 acting as an organizational factor. We conclude that although a rough sporecoat can be formed without Hyd2, the conidia cannot complete the formation of the striated rodlet layer. Previous studies of rodlet proteins in A. fumigatus show ed that deletion of the rodB hydrophobin ha d no effect In addition ed a removal of the rodl et layer but was not (Dague et al. 2008) similar to our results in B. bassiana. Using purified recombinant n Hyd2, a trans hyd1 hyd2 was assayed on 14 30 day old conidia. These experiments showed that a solution of purified Hyd2 was able to complement the hyd 2 morphological phenotype. The restoration seemed to occur in patches on the surface of the spore as indicated by formation of the striated bundles of rodlets that is characteristic of the wild type sporecoat. As expected, the trans complementation of the wild type and hyd 1 had no apparent affect upon the surface morphology of the spore. Furthermore, hyd 2 conidia were unable to be trans compleme nted when the spores were harvested from agar plates that were over 21 days old. Previous studies on Coniothyrium minitans conidial age versus electrostatic charge reveals that as conidia age th ey become more negatively charged to a maxima after ~34 days (Smith et al. 1998) These results would correlate well with the expression pattern of hyd2 in which the gene seems to

PAGE 100

100 only be expressed at the beginning of conidiogenesis where presumably the cell surface would have the least negative charge. To determine the effect of ionic strength associated with nHyd2 assembl y on the conidial surface, the hyd 2 (harvested at 14 and 30 day) were trans complemented at increasing pH from 4.0 to 10.0. Results indicate that there is an optimal pH (pH 5 7) required for trans complementation to occur. Previous results have shown that as the pH of a conidial suspension increases, there is a decrease in surface charge (Holder et al. 2007) It is possible there fore, that the cell surface charge may influence the self assembly of hydrophobins on the cell surface. To our knowledge this is the first report of a recombinant hydrophobin protein being used to complement or regenerate the rodlet layer. Trans complementation of heat killed, glut a raldehyde fixed, and UV conidia indicated that Hyd2 cannot complement nonliving cells. These manipulations may have destroyed a critical secondary component needed for assembly of Hyd2 or the process may require energy or some cofactor. Further experiments are needed to define the parameters that determine hydrophobin assembly in living spores. In conclusion, the development of an efficient expression and purification system for functionally active nHyd2 has been developed. Production of functionally active recombinant Hyd2 allows for an indepth study of the self assembly process on the surface conidia. The current hypothesis is that Hyd1 and Hyd2 act cooperatively to produce the rodlet layer of aerial conidia with Hyd2 acting as an organizational factor. It has also been shown that trans complementation is an effective method for looking at the self assembly of the n Hyd2 (and Hyd1 in the future) into the rodlet layer. Finally, results show that the self assem hyd 2 conidia is surface

PAGE 101

101 charge dependent. Future work will include the expression and purification of recombinant Hyd1 as well as trans complementation studies using both nHyd1 and nHyd2.

PAGE 102

102 Fig ure 2 1 Possible model for hydrophobin rodlet formation. Schematic representation of hydrophobin monomers stacking at an hydrophobic or hydrophilic interface. Fig ure 2 2 Sequence of Hyd2 and Hyd1, indicating conserved disulfide bonding pattern. Disulfide bonds form between Cy sP1PCysP6P, CysP2PCysP5P, CysP3PCysP4P, and CysP7PCysP8P.

PAGE 103

103 Table 21. Primer sequences and product sizes for semi quantitiative RT PCR F, forward; R, reverse. Gene Product Primer Sequence 5 3 Hyd1 F: caccatggtggaaaggatctgcac R: ccgagaaggtgggaaagaagacca Hyd2 F: tgtcaagactggcgacatttgcg R: tcgatggggacaagctggttga Tubulin F: tccttcgtacggtgacctga R: cgagcttgcgaagatcagag Actin F: ttggtgcgaaacttcagcgtctagtc R: tccagcaaatgtggatctccaagcag

PAGE 104

104 Table 22 List of primers used in this study Primer Name Sequence Hyd2 F: ggtggttgctcttccaacggcggcgctggccgcggacgcagccacggccgcagt R: ggtggtctgcagttatccgaggacggtgat BK11 F1: gtgaaagtgaaagctccccacggacccagccacggc F2: ggtggttgctcttccaacttcaaggtgaaattcaaggtgaaagtgaaa R: ggtggtctgcagttatccgaggacggtgat BK14 F: ggtggttgctcttccaacggcggcgctggccgcggacgcagccacggccgcagt R1: caccttgaatttcaccttgaatccgaggacgttgatggg R2: ggtggtctgcagttacttcactttcaccttgaatttcaccttgaa BK15 F: gtgaaagtgaaagctccccacggacccagccacggc R: ggtggtctgcagttacttcactttcaccttgaatttcaccttgaa CM4 F1: cgctggaagatctttaaaaaaattgaaaaagtgggtcaaaacatcagagacggcatcg F2: ggtggtcatatgcgctggaagatctttaaaaaaatt R1: gatggtggcagcttgacctacaacagctactgctggaccagcttttacgatgccgtctc R2: ggtggttgctcttccgcag atggtggcagcttgacctacaac cysHyd2 F: ggtggttgctcttccaactgcggcggcgctggccgcggacgcagccacggccgcagt R: ggtggtctgcagttatccgaggacggtgat Forward and revese primers for the production of hyd2 construct, BK11 which has FKVKFKVKVK on Nterminus, BK14 which has FKVKFKVKVK on C terminus, BK15 which has FKVKFKVKVK on both termini, CM4 antimicrobial peptide, and Hyd2 with an Nterminal cysteine for IPL reaction.

PAGE 105

105 Table 23 Buffer concentrations for refolding Hyd2 protein from inclusion bodies I 8M Urea, 10mM DTT, 20mM Tris, 300mM NaCl II 6M Urea, 1mM DTT, 20mM Tris, 300mM NaCl III 4M Urea, 1mM DTT, 20mM Tris, 300mM NaCl IV 2M Urea, 1mM Reduced Glutathione, 20mM Tris, 300mM NaCl V 1mM Reduced Glutathione, 20mM Tris, 300mM NaCl Fig ure 2 3. Vector constructs of n Hyd2 and n Hyd2 derivatives (see appendix)

PAGE 106

106 Fig ure 2 4. Atomic force micrographs of B. bassiana spore types and germinating conidia. (a, d, g) Aerial conidia: note surface fascicles presumably composed of hydrophobin rodlets [rodlet filaments faintly visible in (g)]; (b, e) in vitro blastospores; (c, f) submerged conidia; (h) bipolar germination of aerial conidia. (i, j) Higher resolution of germinating aerial conidia: note the fascicles still present on the germinated conidia (arrow s).

PAGE 107

107 Fig ure 2 5. Cell surface hydrophobicity of the three B. bassiana spore types assessed by MATH assay and HIC.

PAGE 108

108 Fig ure 2 6 Expression analysis of hyd1 and hyd2 Semi quantitative RT PCR was used to determine the expression of the hyd1 (a) and hyd2 (b) genes in various B. bassiana cell types and during specific developmental conditions, as described in Methods. Only data within the linear portion of PCR amplification were considered valid, and the data shown are derived from 25 cycles of PCR amplification. Actin expression was used as an internal control for normalization of the data (similar results were obtained using tubulin). Expression of the hydrophobin and actin genes was examined during mycelial growth on PDA plates from which conidia were removed (3, 5, 10, 18 and 28 days), and from liquid cultures of blastospores (B), aerial conidia (C), submerged conidia (SC), and after 3 days of growth in the presence of chitin (1 %), insect cuticle (1 %), or chitin+insect cuticle (Cut+Chit; 1 % each).

PAGE 109

109 Figure 2 7 A) Vector construction of the hyd2 gene inserted into pTWIN1 vector. The hyd2 gene is first subcloned into the pCR2.1 vector and then cloned into the pTWIN1 vector. Ssp DnaB is directly upstream allowing its N terminal fusion during expres sion. B) Sequence confirmation of hyd2 inserted into pTWIN1 vector. Red is Ssp DnaB intein and Blue is hyd2 gene.

PAGE 110

110 Fig ure 28 L DS PAGE analysis of purified nHyd2 protein (lanes 57) using 12% bis tris gel after refolding and cleavage from Ssb DNaA N terminal intein fusion partner. Induced crude extract, Lane 1; Molecular Weight marker, Lane 2; Crude extract after refolding protocol, lane 3; Flowthrough, Lane 4; Chitin beads boiled in SDS, Lane 8.

PAGE 111

111 Fig ure 2 9 nHyd2 rodlet formation timecourse as monotered by ThT binding. 150 and 75 ug/ml n Hyd2 and 150ug/ul Native Hyd2 was mixed with 38uM ThT. The solution was then vortexed over a 0,2, 5, 7, and 10 minute period. Controls are ThT with protein elution buffer. Results are from 3 replicates. 0 100 200 300 400 500 600 700 800 0 min 2 min 5 min 7 min 10 minRFU 150ug/ul 75ug/ul Nat Hyd2 150ug/ul Control

PAGE 112

112 Fig ur e 2 1 0 TEM micrograph of purified nHyd2 on formvar grid. 2 00ul of 0.18 mg/ml protein was placed on top of a formvar grid and allowed to evaporate overnight Arrows point to striated nHyd2 filaments (L = 197 52.5 nm, W = 24 3.5 nm)

PAGE 113

113 Fig ure 2 1 1 Surface pressure versus area isotherm of Hyd2 at the water air interface at pH 6.0. Results are from 3 experiments. 5 0 5 10 15 20 25 30 35 0 10 20 30 40 50 60 70 80 Surface Pressure ( mN /m) Trough Area (mm2) nHyd2 isotherm

PAGE 114

114 Fig ure 2 1 2 A) Schematic diagram of drop surface transfer method used to coat glass surfaces with Hyd2 protein. B) AFM height images of 12ug/ml nHyd2 coated onto a glass slide via drop surface transfer. C) High resolution image of hydrophobin monolayer. AFM micrograph of 50ul drop of 12ug/ml Hyd2 protein allowed to dry on a glass slide D) amplitude image E) height image.

PAGE 115

115 Table 24 Co ntact angle of glass surface modified with recombinant Hyd2 Control Drop Surface Transfer Drop Evaporation R A 88.9 P o P 0.8 56.8 P o P 4.3 68.5 P o P 0.9 R R 48.3 P o P 6.6 17.5 P o P 7.7 18.5 P o P 10.8 H R 2 R 0 R A 75.9 P o P 0.7 70.8 P o P 2.9 72.9 P o P 3.7 R R 44.5 P o P 2.7 15.6 P o P 4.4 14.5 P o P 2.7

PAGE 116

116 Figure 21 3 Images of receding water contact angle measurements used to determine relative change in hydrophobicity of glass surface modified with recombinant Hyd2. Droplets of Glycerin or H20 were placed on A) unmodified glass surface, B) glass surface modified by touching glass surface on top of a 100ul drop of Hyd2 solution (see drop transfer method Figure 216a), C) a 50ul droplet of ~130ug/ml solution placed on glass slide and allowed to evaporate overnight. All surfaces w ere washed 3X with HR2R0 to remove any unbound protein or contaminants before taking measurements.

PAGE 117

117 Fig ure 21 4 AFM surface topology of A) WT conidia B) hyd1 hyd2 C) hyd2 D) hyd1 Fig ure 21 5 Surface phenotype of rodlet layer. A & B) WT; C& D) Hyd2 ; E & F) Hyd2 Trans comple mented with nHyd2.

PAGE 118

118 Figure 21 6 Hyd2 conidia Trans complimented with nHyd2 over a 30 day time course. Hyd2 conidia harvested from the same PDA agar plate were trans complemented with nHyd2 solution at A) 10 days B) 14 days C ) 21 days D) 30 days. Table 25 pH dependence of trans complementation pH 4 pH 5 pH 6 pH 7 pH 8 pH10 Day 14* /+ /+ +++ + Day 30* + *Results are from 57 replicates ** No significant impact of pH upon nHyd2 self assembly as determined by ThT assay

PAGE 119

119 Figure 21 7 AFM micrographs of Gluteraldehyde fixed, UV treated, or Heat killed Hyd2 conidia that have been trans complemented. Mutant conidia were killed with either 5% Gluteraldehyde, UV treatment, or Heat killed. Mutant conidia were then trans complemented with ~125ug/ml recombinant Hyd2 as described in materials and methods.

PAGE 120

120 APPENDIX SURFACE MODIFICATION: ANTIMICROBIAL FILMS Introduction Surface Modification: Antimicrobial Films Current research in surface modification involves improving the biocompatibility of polymers like polystyrene, polyurethane, mica, and Teflon (Anselme, 2000; Khire et al. 2007) The more interesting of these investigations involves targeting of specific tissues to maximize cell to substrate interactions. Janssen et.al. have shown that the addition of the RGD peptide to the N terminal domain of a class I hydrophobin,Sc3, and a truncated Sc3 (Tr Sc3) can be used to promote fibroblast growth on to a solid surface such as Teflon(Janssen et al. 2002; Scholtmeijer et al. 2002) In addition to efforts aimed at enhancing the biocompatibility of synthetic materials, bacterial proliferation on polymer surfaces and subsequent host infection are important concerns regarding surface materials used in medical devices (Cho et al. 2007b; Darouiche, 2004; Endo et al. 1987; Smith et al. 2005) The increasing resistance of bacteria to conventional antibiotics has resulted in the development of alternate strategi es to fight bacterial contamination. Antimicrobial peptides offer a promising alternative to combat these problems. Cationic antimicrobial peptides (CAPs) feature several beneficial qualities such as bactericidal activity, a broad antibacterial spectra, and synergism with other antibiotics. They generally work by a nonspecific interaction through permeabilization of microbial membranes and specific interactions with membrane targets (Oren et al. 2007; Tossi & Sandri, 2002; Zasloff, 2002) The amino acid sequence FKVKFKVKVK is sheet CAP that was used in the design and synthesis of an antibacterial conjugate (Cho et al. 2007b) In the Cho study, the antimicrobial peptide

PAGE 121

121 was conjugated on to PEG PS resin. The antibacterial, hemolytic, and antibiotic synergism effect was then tested. They concluded that this anti bacterial peptide conjugate had potent antibacterial activity, no hemolytic activity, an increase in permeability of lipid membranes, and synergism with the antibiotic vancomycin. Another antimicrobial peptide CM4 is also under study for its broad bacteri al susceptibility. This antimicrobial peptide is a highly cationic peptide of the cecropin family (Chen et al. 2008) It i s known that the N termini of class I and class II hydrophobins lie on the same face and are partitioned toward the more hydrophilic phase of the interfacial barrier. Also the 10 15 amino acids on the N and C termini are not crucial for the gross assembly properties of the hydrophobins (Janssen et al. 2002; Kwan et al. 2006) So our hypothesis is that due to the end sequence f lexibility and location on the hydrophilic phase of the self assembled monolayer, the N termini of the hydrophobin Hyd2 from Beauveria bassiana can be exploited to incorporate multifunctional activity into its assembly matrix for the modification of surfac es. The inclusion of an antimicrobial peptide to a hydrophobin has yet to be described in the literature. With the advancements in intein mediated protein ligation (IPL) technology, it is now possible to couple two proteins with relative ease. IPL is a means of thioester exchange in which a protein or peptide thioester is irreversibly ligated to an N terminal Cys protein or peptide. Materials and Methods Synthesis of BK11, BK14, BK14, cysHyd2, and CM4 Plasmid Constructs Several Hyd2 derivatives were constr ucted to incorporate antimicrobial activity into the self assembling properties of hydrophobins. Figure 23 shows the schematic

PAGE 122

122 diagram of the hydrophobin derivative constructed. The antimicrobial peptide, FKVKFKVKVK was added to the N termini, C termini or both N & C termini of Hyd2 by primer extension PCR (Table 21). The forward and reverse primers included SapI and PstI restriction sites respectively for insertion into the pTWIN1 vector. Each derivative was fused to the Ssp DnaB intein for expression and purification as per the NEB protocol. Expression and inclusion body refolding was performed as previously described. The CM4 antimicrobial peptide was synthesized according to Chen et.al. 2008 with modifications. Briefly, two overlapping primer set s CM4 F1 and CM4R1 were used to generate a recursive polymerase chain reaction product (rPCR). Next CM4 F2 and CM4R2 was again amplified containing SapI and NdeI restriction sites at the 5 and 3 ends respectively. The cys nHyd2 primer contained the Sa pI restriction site as well as the addition of three base pairs tgc coding for a cysteine on the 5 end. The addition of a cysteine residue on the N terminus of the hydrophobin allows for the intein mediated protein ligation. The cys nHyd2 gene was first subcloned into the pDRIVE vector using Qiagens PCR cloning kit. The cys nHyd2 was then cut from the pDRIVE using SapI and PstI. Resulting fragment was then gel purified and ligated with the pTWIN1 vector and transformed into Top10 competent cells. Pos itive transformants were analyzed by PCR, enzyme digest, and DNA sequencing. The plasmid vector was then transformed into Rosetta2 (DE3) gami (Novogen) competent cells using manufacturers protocol. Expression and purification of the cysHyd2 protein was carried our using the protocol described previously for the native Hyd2.

PAGE 123

123 Results Hyd2 Derivatives It has been shown that the N and C termini of class I and class II hydrophobins lie on the same face and are partitioned toward the more hydrophilic phase of the interfacial barrier (Kwan et al. 200 6) Also, truncations of the 1015 amino acids on the N and C termini are not necessary for the gross assembly properties of hydrophobins. This lead to the hypothesis that short cationic antimicrobial peptides can be immobilized with a high enough de gree to confer bactericidal activity without interfering in the gross self assembly of the hydrophobin. An antimicrobial peptide, FKVKFKVKVK (FKVK) that was originally synthesized by Cho et.al 2007 was genetically added to the N and/or C termini of the cl ass I hydrophobin Hyd2 from Beauveria bassiana. BK11 contains an antimicrobial peptide on the N termini, BK14 contains the antimicrobial peptide on the C termini and BK15 contains the antimicrobial peptide on both the N and C termini of Hyd2 (Fig. A 1 ). V ector constructs were sequenced by ICBR to make sure that the gene sequence is correct and inframe for expression. Each derivative was then expressed using the method developed for the native Hyd2. Despite many attempts at intein cleavage and stepwise r efolding procedures, it was discovered that we were unable to cleave off the Ssp DnaB intein (Figure A 2 ). The modified hydrophobin was subjected to a stepwise refolding strategy as described previously and lowered the pH to 6.0 and increased the temperat ure to 30PoPC. The cleavage of the intein takes place after a shift in pH from 8.3 to 7.0 and 24 hr incubation at RT The lowered pH and increased temperature was thought to increase cleavage efficiency. However under all conditions tested we were unable to induce cleavage of the intein from the modified Hyd2

PAGE 124

124 hydrophobin (Fig. A 3 ). Presumably this is due to an improper folding of the derivatives which inhibited pH induced self cleavage of the intein fusion partner. Intein Mediated Protein Ligation To con tinue testing the hypothesis that short cationic antimicrobial peptides can be immobilized in a Hyd2 monolayer a new strategy was developed. Intein mediated protein ligation allows the ligation of a protein with an N terminal cysteine residue and a peptide with a C terminal thioester forming a native peptide bond (New England Biolabs). To accomplish this goal the Hyd2 protein had to be modified to contain a cysteine on its N Terminal. An antimicrobial peptide with a C Terminal thioester was also generated by fusion to an intein (Fig. A 4 ). The antimicrobial peptide CM4 was expressed in a pTWIN1 vector with an Mxe GyrA intein which will generate a thioester on the C terminus. The presence of the CM4 in the vector was confirmed by PCR and sequencing The hydrophobin is generated with a cysteine residue on the N terminus. The antimicrobial peptide and Hyd2 are then mixed to produce a peptide bond generating a CM4Hyd2 fusion (Fig A 5 ). Discussion Hyd2 Surface Modification; Antimicrobial Films Our initial attemp ts to produce Hyd2 derivatives have thus far been unsuccessful Several Hyd2 derivatives were constructed, BK11, BK14, and BK15 consisting of an N terminal, CTerminal, and N&C terminal antimicrobial peptide FKVKFKVKVK by addition to the 5 or 3 ends of the cDNA sequence. Each derivative was cloned into the pTWIN1 vector and transformed into the Rosetta2 (DE3) strain of E.coli The derivative Hyd2 proteins were then expressed; however the intein moiety that was attached to the N terminus f or rapid purification was unable to be cleaved. Despite multiple experiments

PAGE 125

125 to refold and optimize the cleavage reaction, we were unable to remove the intein fusion partner from each derivative. We conclude that the protein was unable to fold properly a nd thus the unable to induce cleavage. To overcome this obstacle, we developed a different strategy for generation hydrophobin derivatives. We decided to generate the derivatives by way of intein mediated protein ligation (IPL). Using IPL, it is possible to allow the hydrophobin to self assemble on to the surface first and then couple another protein or peptide on to the monolayer. This reduces the risk of steric hindrance inhibiting self assembly and allows for designer peptide modification. However, w e have been unsuccessful thus far, but confident that continued work will result in the desired modifications. The applications for this become numerous from antimicrobial, antifungal, cell adhesion, and enzyme i mmobilization.

PAGE 126

126 Figure A 1 Vector const ruction of Hyd2 derivatives. Vector construction of hyd2 with A) a N terminal FKVKFKVKVK antimicrobial peptide, B) a C Terminal FKVKFKVKVK antimicrobial peptide, C) a N and C terminal F KVKFKVKVK antimicrobial peptide.

PAGE 127

127 Fig ure A 2 SDS PAGE gels of Hyd2 antimicrobial derivates. A) BK11, refolded protein product, lane 1; flowthrough after binding to chitin bead column lane 2; protein elution after intein cleavage reaction lane 4 and 5; fraction after boiling chitin bead in SDS, lane 6. B) BK14, elute a fter intein cleavage reaction, lane 1 and 2; fraction after boiling chitin beads in SDS. C) BK14 refolded protein product, lane 1; flowthough after binding to chitin beads, lane 3; elute after intein cleavage reaction lanes 4 7; fraction after boiling chi tin beads in SDS.

PAGE 128

128 Figure A 3. Cleavage optimization experiment on BK11.1. A)24hr, RT, pH 7.0 B) 24hr, RT, pH 6.0 C) 24hr, 30PoPC, pH 7.0 D) 24hr, 30PoPC, pH 6.0 E) 24hr, 16PoPC, pH 6.0.

PAGE 129

129 Figure A 4. Vector construction of A) cys Hyd2 with N terminal intein and B) CM4 with C Terminal Intein.

PAGE 130

130 Figure A 5. IPL reaction of Antimicrobial peptide with Hyd2 for surface modification.

PAGE 131

131 LIST OF REFERENCES Aguilar, C., Urzua, U., Koenig, C. & Vicuna, R. (1999). Oxalate oxidase from Ceripori opsis subvermispora: Biochemical and cytochemical studies. Archives of Biochemistry and Biophysics 366 275 282. Aimanianda, V., Bayry, J., Bozza, S. & other authors (2009). Surface hydrophobin prevents immune recognition of airborne fungal spores. Nature 460 1117U1179. Alverson, J. (2003). Effects of mycotoxins, kojic acid and oxalic acid, on biological fitness of Lygus hesperus (Heteroptera : Miridae). Journal of Invertebrate Pathology 83, 60 62. Anselme, K. (2000). Osteoblast adhesion on biomaterials. Biomaterials 21, 667 681. Asakawa, H., Tahara, S., Nakamichi, M., Takehara, K., Ikeno, S., Linder, M. B. & Haruyama, T. (2009). The Amphiphilic Protein HFBII as a Genetically Taggable Molecular Carrier for the Formati on of a Self Organized Functional Protein Layer on a Solid Surface. Langmuir 25, 88418844. Askolin, S., NakariSetala, T. & Tenkanen, M. (2001). Overproduction, purification, and characterization of the Trichoderma reesei hydrophobin HFBI. Applied Microb iology and Biotechnology 57 124 130. Askolin, S., Linder, M., Scholtmeijer, K., Tenkanen, M., Penttila, M., de Vocht, M. L. & Wosten, H. A. B. (2006). Interaction and comparison of a class I hydrophobin from Schizophyllum commune and class II hydrophobins from Trichoderma reesei Biomacromolecules 7 12951301. Balmforth, A. J. & Thomson, A. (1984). Isolation and Characterization of Glyoxylate Dehydrogenase from the Fungus Sclerotium Rolfsii. Biochemical Journal 218 113118. Bateman, D. F. & Beer, S. V. (1965). Simultaneous Production and Synergistic Action of Oxalic Acid and Polygalacturonase during Pathogenesis by Sclerotium Rolfsii. Phytopathology 55 204 &. Beckerman, J. L. & Ebbole, D. J. (1996a). MPG1, a gene encoding a fungal hydrophobin of Mag naporthe grisea, is involved in surface recognition. Molecular Plant Microbe Interactions 9 450 456. Beckerman, J. L. & Ebbole, D. J. (1996b). MPG1, a gene encoding a fungal hydrophobin of Magnaporthe grisea, is involved in surface recognition. Mol Plant Microbe Interact 9 450456.

PAGE 132

132 Bell Pedersen, D., Dunlap, J. C. & Loros, J. J. (1992). The Neurospora circadian clockcontrolled gene, ccg 2 is allelic to eas and encodes a fungal hydrophobin required for formation of the conidial rodlet layer. Genes Dev 6 23822394. Benjamin, M. A., Zhioua, E. & Ostfeld, R. S. (2002). Laboratory and field evaluation of the entomopathogenic fungus Metarhizium anisopliae (Deuteromyeetes) for controlling questing adult Ixodes scapularis (Acari : Ixodidae). Journal of Medi cal Entomology 39 723728. Bidochka, M. J., Pfeifer, T. A. & Khachatourians, G. G. (1987). Development of the Entomopathogenic Fungus Beauveriab assiana in Liquid Cultures. Mycopathologia 99 7783. Bidochka, M. J. & Khachatourians, G. G. (1991). The Im plication of Metabolic Acids Produced by Beauveriab assiana in Pathogenesis of the Migratory Grasshopper, Melanoplus sanguinipes Journal of Invertebrate Pathology 58 106 117. Bidochka, M. J., Stleger, R. J., Joshi, L. & Roberts, D. W. (1995a). An Inner CellWall Protein (Cwp1) from Conidia of the Entomopathogenic Fungus BeauveriaBassiana. Microbiology Uk 141, 10751080. Bidochka, M. J., Stleger, R. J., Joshi, L. & Roberts, D. W. (1995b). The Rodlet Layer from Aerial and Submerged Conidia of the Entomopathogenic Fungus Beauveriab assiana Contains Hydrophobin. Mycological Research 99, 403406. Boucias, D. G., Pendland, J. C. & Latge, J. P. (1988). Nonspecific Factors Involved in Attachment of Entomopathogenic Deuteromycetes to Host Insect Cuticle. Applied and Environmental Microbiology 54, 17951805. Boucias, D. G. & Pendland, J. C. (1991). Attachment of mycopathogens to cuticle. In The Fungal Spore and Diease Initiation in Plants and Anim als Edited by G. T. Cole & H. C. Hoch. New York: Plenum Press. Caliskan, M. & Cuming, A. C. (1998). Spatial specificity of H2O2generating oxalate oxidase gene expression during wheat embryo germination. Plant Journal 15 165171. Chen, Y. Q., Zhang, S. Q., Li, B. C., Qiu, W., Jiao, B., Zhang, J. & Diao, Z. Y. (2008). Expression of a cytotoxic cationic antibacterial peptide in Escherichia coli using two fusion partners. Protein Expression and Purification 57, 303 311. Cho, E. M., Boucias, D. & Keyhani, N. O. (2006a). EST analysis of cDNA libraries from the entomopathogenic fungus Beauveria (Cordyceps) bassiana. II. Fungal cells sporulating on chitin and producing oosporein. Microbiology Sgm 152, 28552864.

PAGE 133

133 Cho, E. M., Liu, L., Farmerie, W. & Keyhani, N. O. (2006b). EST analysis of cDNA libraries from the entomopathogenic fungus Beauveria (Cordyceps) bassiana. I. Evidence for stagespecific gene expression in aerial conidia, in vitro blastospores and submerged conidia. Microbiology Sgm 152 2843 2854. Ch o, E. M., Kirkland, B. H., Holder, D. J. & Keyhani, N. O. (2007a). Phage display cDNA cloning and expression analysis of hydrophobins from the entomopathogenic fungus Beauveria (Cordyceps) bassiana Microbiology Sgm 153, 34383447. Cho, W. M., Joshi, B. P ., Cho, H. & Lee, K. H. (2007b). Design and synthesis of novel antibacterial peptideresin conjugates. Bioorganic & Medicinal Chemistry Letters 17, 57725776. Clarkson, J. M. & Charnley, A. K. (1996). New insights into the mechanisms of fungal pathogenesi s in insects. Trends in Microbiology 4 197 203. Correia, A. D. B., Fiorin, A. C., Monteiro, A. C. & Verissimo, C. J. (1998). Effects of Metarhizium anisopliae on the tick Boophilus microplus (Acari : Ixodidae) in stabled cattle. Journal of Invertebrate P athology 71 189 191. Corvis, Y., Walcarius, A., Rink, R., Mrabet, N. T. & Rogalska, E. (2005). Preparing catalytic surfaces for sensing applications by immobilizing enzymes via hydrophobin layers. Analytical Chemistry 77, 16221630. Coyle, P. K. (2002). Lyme disease. Current Neurology and Neuroscience Reports 479 487. Cruz, L. P., Gaitan, A. L. & Gongora, C. E. (2006). Exploiting the genetic diversity of Beauveria bassiana for improving the biological control of the coffee berry borer through the use o f strain mixtures. Applied Microbiology and Biotechnology 71, 918926. Dague, E., Delcorte, A., Latge, J. P. & Dufrene, Y. F. (2008). Combined use of atomic force microscopy, X ray photoelectron spectroscopy, and secondary ion mass spectrometry for cell surface analysis. Langmuir 24, 29552959. Darouiche, R. O. (2004). Infections associated with surgical implants Reply. New England J ournal of Medicine 351 194 195. De Stefano, L., Rea, I., Armenante, A., Giardina, P., Giocondo, M. & Rendina, I. (2007). Self assembled biofilm of hydrophobins protects the silicon surface in the KOH wet etch process. Langmuir 23, 79207922.

PAGE 134

134 de Vocht, M L., Scholtmeijer, K., van der Vegte, E. W. & other authors (1998). Structural characterization of the hydrophobin SC3, as a monomer and after self assembly at hydrophobic/hydrophilic interfaces. Biophysical Journal 74, 20592068. de Vocht, M. L., Reviak ine, I., Wosten, H. A. B., Brisson, A., Wessels, J. G. H. & Robillard, G. T. (2000). Structural and functional role of the disulfide bridges in the hydrophobin SC3. Journal of Biological Chemistry 275, 28428 28432. Doss, R. P., Potter, S. W., Chastagner, G. A. & Christian, J. K. (1993). Adhesion of Nongerminated Botrytis Cinerea Conidia to Several Substrata. Applied and Environmental Microbiology 59, 17861791. Drozd, C. & Schwartzbrod, J. (1996). Hydrophobic and electrostatic cell surface properties of C ryptosporidium parvum Applied and Environmental Microbiology 62, 12271232. Dufrene, Y. F. (2000). Direct characterization of the physicochemical properties of fungal spores using functionalized AFM probes. Biophysical Journal 78, 32863291. Dunlap, C. A., Biresaw, G. & Jackson, M. A. (2005). Hydrophobic and electrostatic cell surface properties of blastospores of the entomopathogenic fungus Paecilomyces fumosoroseus Colloids and Surfaces B Biointerfaces 46, 261266. Dynesen, J. & Nielsen, J. (2003). S urface hydrophobicity of Aspergillus nidulans conidiospores and its role in pellet formation. Biotechnology Progress 19, 10491052. Ebbole, D. J. (1997a). Hydrophobins and fungal infection of plants and animals. Trends Microbiol 5 405 408. Ebbole, D. J. (1997b). Hydrophobins and fungal infection of plants and animals. Trends in Microbiology 5 405 408. Eisler, M. C., Torr, S. J., Coleman, P. G., Machila, N. & Morton, J. F. (2003). Integrated control of vector borne diseases of livestock pyrethroids: panacea or poison? Trends in Parasitology 19, 341 345. Endo, Y., Tani, T. & Kodama, M. (1987). Antimicrobial Activity of Tertiary Amine Covalently Bonded to a Polystyrene Fiber. Applied and Environmental Microbiology 53 2050 2055. Fan, H., Wang, X. Q., Zhu, J., Robillard, G. T. & Mark, A. E. (2006). Molecular dynamics simulations of the hydrophobin SC3 at a hydrophobic/hydrophilic interface. Proteins Structure Function and Bioinformatics 64, 863873.

PAGE 135

135 Fargues, J. (1984). Adhesion of the fungal spore to t he insect cuticle in relation to pathogenicity In Infection Process of Fungi pp. 90 110. Edited by D. Roberts & J. R. Aist. New York: Rockefeller Foundation. Ferron (1981). Pest Control by the Fungi Beauveria and Metarhizium In Microbial control of pest s and plant diseases 19701980 pp. 465 482. Edited by H. D. Burges. New York: Academic. Franceschi, V. R. & Horner, H. T. (1980). Calcium Oxalate Crystals in Plants. Botanical Review 46 361 427. Fuchs, U., Czymmek, K. J. & Sweigard, J. A. (2004). Five hydrophobin genes in Fusarium verticillioides include two required for microconidial chain formation. Fungal Genetics and Biology 41 852 864. Gadd, G. M. (1999). Fungal production of citric and oxalic acid: Importance in metal speciation, physiology and biogeochemical processes. Advances in Microbial Physiology, Vol 41 41, 47 92. George, J. E. (2000). Present and future technologies for tick control. Tropical Veterinary Diseases 916 583588. Girardin, H., Paris, S., Rault, J., Bellon Fontaine, M. N. & Latge, J. P. (1999a). The role of the rodlet structure on the physicochemical properties of Aspergillus conidia. Lett Appl Microbiol 29 364 369. Gregorc, A. & Poklukar, J. (2003). Rotenone and oxalic acid as alternative acaricidal treatments for Varroa destructor in honeybee colonies. Veterinary Parasitology 111, 351 360. Guimaraes, R. L. & Stotz, H. U. (2004). Oxalate production by Sclerotinia sclerotiorum deregulates guard cells during infection. Plant Physiology 136 3703 3711. Gupta, S. C., Leathers, T. D., Elsayed, G. N. & Ignoffo, C. M. (1991). Production of Degradative Enzymes by Metarhizium a nisopliae during Growth on Defined Media and Insect Cuticle. Experimental Mycology 15 310315. Gupta, S. C., Leathers, T. D., Elsayed, G. N. & Igno ffo, C. M. (1992). Insect Cuticle Degrading Enzymes from the Entomogenous Fungus Beauveriab assiana Experimental Mycology 16, 132 137. Hackenberger, C. P. R., Chen, M. M. & Imperiali, B. (2006). Expression of N terminal Cys protein fragments using an int ein refolding strategy. Bioorganic & Medicinal Chemistry 14, 50435048.

PAGE 136

136 Hajek, A. E. & Eastburn, C. C. (2003). Attachment and germination of Entomophaga maimaiga conidia on host and nonhost larval cuticle. Journal of Invertebrate Pathology 82, 12 22. Hakanpaa, J., Paananen, A., Askolin, S., Nakari Setala, T., Parkkinen, T., Penttila, M., Linder, M. B. & Rouvinen, J. (2004). Atomic resolution structure of the HFBII hydrophobin, a self assembling amphiphile. Journal of Biological Chemistry 279, 534 539. Hakanpaa, J., Szilvay, G. R., Kaljunen, H., Maksimainen, M., Linder, M. & Rouvinen, J. (2006). Two crystal structures of Trichoderma reesei hydrophobin HFBI The structure of a protein amphiphile with and without detergent interaction. Protein Science 15, 21292140. Han, Y., Joosten, H. J., Niu, W. L., Zhao, Z. M., Mariano, P. S., McCalman, M., van Kan, J., Schaap, P. J. & Dunaway Mariano, D. (2007). Oxaloacetate hydrolase, the C C bond lyase of oxalate secreting fungi. Journal of Biological Chemistry 282 95819590. Hazen, K. C., Lay, J. G., Hazen, B. W., Fu, R. C. & Murthy, S. (1990). Partial Biochemical Characterization of Cell Surface Hydrophobicity and Hydrophilicity of Candidaa lbicans Infection and Immunity 58, 34693476. Hazen, K. C. (2004). Re lationship between expression of cell surface hydrophobicity protein 1 (CSH1p) and surface hydrophobicity properties of Candida dubliniensis. Current Microbiology 48 447 451. Hegedus, D. D., Bidochka, M. J., Miranpure, G. S. & Khachatourians, G. G. (1992 ). A comparison of the virulence, stability and cell well surface characteristics of three spore types produced by the entomopathogenic fungus Beauveria bassiana. Applied Microbiology and Biotechnology 36, 785789. Hektor, H. J. & Scholtmeijer, K. (2005) Hydrophobins: proteins with potential. Current Opinion in Biotechnology 16 434 439. Henke, M. O., de Hoog, G. S., Gross, U., Zimmerman, G., Kraemer, D. & Weig, M. (2002). Human deep tissue infection with an entomopathogenic Beauveria species. Journal of Clinical Microbiology 40, 26982702. Holder, D. J. & Keyhani, N. O. (2005). Adhesion of the entomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Applied and Environmental Microbiology 71 5260 5266. Holder, D. J., Kirkland, B. H., Lewi s, M. W. & Keyhani, N. O. (2007). Surface characteristics of the entomopathogenic fungus Beauveria (Cordyceps) bassiana. Microbiology Sgm 153, 34483457.

PAGE 137

137 Hong, S. H., Toyama, M., Maret, W. & Murooka, Y. (2001). High yield expression and single step purifi cation of human thionein/metallothionen. Protein Expression and Purification 21, 243 250. Horner, H. T. & Zindlerfrank, E. (1980). Calcium Oxalate Crystals in Leaves of RhynchosiaCaribaea Dc and 2 Other Legumes Their Distribution, Structure, and Development. European Journal of Cell Biology 22, 458 458. Hou, S., Li, X. X., Li, X. Y., Feng, X. Z., Wang, R., Wang, C., Yu, L. & Qiao, M. Q. (2009). Surface modification using a novel type I hydrophobin HGFI. Analytical and Bioanalytical Chemistry 394, 7837 89. Houmadi, S., Ciuchi, F., De Santo, M. P., De Stefano, L., Rea, I., Giardina, P., Armenante, A., Lacaze, E. & Giocondo, M. (2008). Langmuir Blodgett Film of Hydrophobin Protein from Pleurotus ostreatus at the Air Water Interface. Langmuir 24, 12953129 57. Hunt, L. M. (1986). Differentiation between three species of Amblyomma ticks (acari: Ixodidae) by analysis of cuticular hydrocarbons. Annals of Tropical Medicine and Parasitology 80 245 249. James, R. R., Buckner, J. S. & Freeman, T. P. (2003). Cuticular lipids and silverleaf whitefly stage affect conidial germination of Beauveria bassiana and Paecilomyces fumosoroseus. Journal of Invertebrate Pathology 84, 67 74. Janssen, M. I., van Leeuwen, M. B. M., Scholtmeijer, K., van Kooten, T. G., Dijkh uizen, L. & Wosten, H. A. B. (2002). Coating with genetic engineered hydrophobin promotes growth of fibroblasts on a hydrophobic solid. Biomaterials 23, 48474854. Jeffs, L. B., Xavier, I. J., Matai, R. E. & Khachatourians, G. G. (1999). Relationships bet ween fungal spore morphologies and surface properties for entomopathogenic members of the genera Beauveria, Metarhizium, Paecilomyces,Tolypocladium, and Verticillium. Canadian Journal of Microbiology 45, 936948. Kaaya, G. P. & Munyinyi, D. M. (1995). Bio control Potential of the Entomogenous Fungi BeauveriaBassiana and Metarhizium Anisopliae for TsetseFlies (Glossina Spp) at Developmental Sites. Journal of Invertebrate Pathology 66, 237241. Kaaya, G. P. (2000a). The potential for antitick plants as components of an integrated tick control strategy. Tropical Veterinary Diseases 916 576 582.

PAGE 138

138 Kaaya, G. P. (2000b). Laboratory and field evaluation of entomogenous fungi for tick control. Tropical Veterinary Diseases 916 559 564. Kaaya, G. P. & Hassan, S. (2000). Entomogenous fungi as promising biopesticides for tick control. Experimental and Applied Acarology 24 913926. Kanga, L. H. B., James, R. R. & Boucias, D. G. (2002). Hirsutella thompsonii and Metarhizium anisopliae as potential microbial control agents of Varroa destructor a honey bee parasite. Journal of Invertebrate Pathology 81 175 184. Kanga, L. H. B., Jones, W. A. & James, R. R. (2003). Field trials using the fungal pathogen, Metarhizium anisopliae (Deuteromycetes : Hyphomycetes) to control the Ectoparasitic mite, Varroa destructor (Acari : Varroidae) in honey bee, Apis mellifera (Hymenoptera : Apidae) colonies. Journal of Economic Entomology 96, 10911099. Kazmierczak, P., Kim, D. H., Turina, M. & Van Alfen, N. K. (2005a). A hydrophobin of the chestnut blight fungus, Cryphonectria parasitica, is required for stromal pustule eruption. Eukaryotic Cell 4 931 936. Kazmierczak, P., Kim, D. H., Turina, M. & Van Alfen, N. K. (2005b). A Hydrophobin of the chestnut blight fungus, Cryphonectria parasitica, is required for stromal pustule eruption. Eukaryot Cell 4 931936. Keirans, J. E., Hutcheson, H. J., Durden, L. A. & Klompen, J. S. H. (1996). Ixodes (Ixodes) scapularis (Acari: Ixodidae): Redescription of all active stages, distribution, hosts, geographical variation, and medical and veterinary importance. Journal of Medical Entomology 33 297 318. Kershaw, M. J. & Talbot, N. J. (1998). Hydrophobins and repellents: proteins with fundamental roles in fungal morphogenesis. Fungal Genet Biol 23 18 33. Kershaw, M. J., Thornton, C. R., Wakley, G. E. & Talbot, N. J. (2005). Four conserved intramolecular disulphide linkages are required for secretion and cell wall localization of a hydrophobin during fungal morphogenesis. Molecular Microbiology 56 117 125. Khire, V. S., Lee, T. Y. & Bowman, C. N. (2007). Surface modification using thiol acrylate conjugate addition reactions. Macromolecules 40, 56695677. Kirkland, B. H., Cho, E. M. & Keyhani, N. O. (2004a). Differential susceptibility of Amblyomma maculatum and Amblyomma americanum (Acari : Ixodidea) to the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae. Biological Control 31 414421.

PAGE 139

139 Kirkland, B. H., Westwood, G. S. & Keyhani, N. O. (2004b). Pathogenicity of entomopathogenic fungi Beauveria bassiana and Metar hizium anisopliae to ixodidae tick species Dermacentor variabilis Rhipicephalus sanguineus and Ixodes scapularis Journal of Medical Entomology 41 705711. Kirkland, B. H., Eisa, A. & Keyhani, N. O. (2005). Oxalic acid as a fungal acaracidal virulence factor. Journal of Medical Entomology 42 346 351. Kisko, K., Szilvay, G. R., Vuorimaa, E., Lemmetyinen, H., Linder, M. B., Torkkeli, M. & Serimaa, R. (2007). Self assembled films of hydrophobin protein HFBIII from Trichoderma reesei Journal of Applied C rystallography 40, S355 S360. Kisla, T. A., Cu Unjieng, A., Sigler, L. & Sugar, J. (2000). Medical management of Beauveria bassiana keratitis. Cornea 19 405 406. Klinger, E., Groden, E. & Drummond, F. (2006). Beauveria bassiana horizontal infection betw een cadavers and adults of the Colorado potato beetle, Leptinotarsa decemlineata (Say). Environmental Entomology 35 992 1000. Kubicek, C. P. (1987). The Role of the Citric Acid Cycle in Fungal Organic Acid Fermentations. Biochemical Society Symposium 11 3 126. Kubicek, C. P., Schreferlkunar, G., Wohrer, W. & Rohr, M. (1988). Evidence for a Cytoplasmic Pathway of Oxalate Biosynthesis in Aspergillus Niger. Applied and Environmental Microbiology 54, 633637. Kucera, M. & Samsinak.A (1968). Toxins of Entomo phagous Fungus Beauveria Bassiana Journal of Invertebrate Pathology 12 316 &. Kuel, R. (2000). Design of experiments: statistical principles of research design and analysis. New York: Duxbury Press. Kwan, A. H., Macindoe, I., Vukasin, P. V. & other authors (2008). The Cys3 Cys4 loop of the hydrophobin EAS is not required for rodlet formation and surface activity. Journal of Molecular Biology 382 708 720. Kwan, A. H. Y., Winefield, R. D., Sunde, M., Matthews, J. M., Haverkamp, R. G., Templeton, M. D & Mackay, J. P. (2006). Structural basis for rodlet assembly in fungal hydrophobins. Proceedings of the National Academy of Sciences of the United States of America 103 36213626. Lacroix, H. & Spanu, P. D. (2009). Silencing of Six Hydrophobins in Cladosporium fulvum: Complexities of Simultaneously Targeting Multiple Genes. Applied and Environmental Microbiology 75, 542546.

PAGE 140

140 Lau, G. K. K. & Hamer, J. E. (1996). Regulatory genes controlling MPG1 expression and pathogenicity in the rice blast fungus Magnaporthe grisea Plant Cell 8 771781. Leathers, T. D., Gupta, S. C. & Alexander, N. J. (1993). Mycopesticides Status, Challenges and Potential. Journal of Industrial Microbiology 12 69 75. Lecuona, R., Clement, J L., Riba, G., Joulie, C. & Juarez, P. (1997). Spore germination and hyphal growth of Beauveria sp on insect lipids. Journal of Economic Entomology 90, 119123. Leland, J. E., Mullins, D. E., Vaughan, L. J. & Warren, H. L. (2005). Effects of media compos ition on submerged culture spores of the entomopathogenic fungus, Metarhizium anisopliae var. acridum, Part 1: Comparison of cell wall characteristics and drying stability among three spore types. Biocontrol Science and Technology 15 379 392. Li, J., Yin g, S. H., Shan, L. T. & Feng, M. G. (2010). A new nonhydrophobic cell wall protein (CWP10) of Metarhizium anisopliae enhances conidial hydrophobicity when expressed in Beauveria bassiana. Applied Microbiology and Biotechnology 85, 975984. Linder, M., Sz ilvay, G. R., NakariSetala, T., Soderlund, H. & Penttila, M. (2002). Surface adhesion of fusion proteins containing the hydrophobins HFBI and HFBII from Trichoderma reesei. Protein Science 11, 22572266. Linder, M. B., Szilvay, G. R., NakariSetala, T. & Penttila, M. E. (2005). Hydrophobins: the proteinamphiphiles of filamentous fungi. Fems Microbiology Reviews 29, 877 896. Lugones, L. G., Bosscher, J. S., Scholtmeyer, K., de Vries, O. M. & Wessels, J. G. (1996a). An abundant hydrophobin (ABH1) forms hy drophobic rodlet layers in Agaricus bisporus fruiting bodies. Microbiology 142 ( Pt 5) 13211329. Lugones, L. G., Bosscher, J. S., Scholtmeyer, K., deVries, O. M. H. & Wessels, J. G. H. (1996b). An abundant hydrophobin (ABH1) farms hydrophobic rodlet layers in Agaricus bisporus fruiting bodies. Microbiology Uk 142 1321 1329. Lugones, L. G., de Jong, J. F., de Vries, O. M. H., Jalving, R., Dijksterhuis, J. & Wosten, H. A. B. (2004). The SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in the absence of the SC3 hydrophobin. Molecular Microbiology 53 707 716. Lumsdon, S. O., Green, J. & Stieglitz, B. (2005). Adsorption of hydrophobin proteins at hydrophobic and hydrophilic interfaces. Colloids and Surfaces B Biointerfaces 44, 172178.

PAGE 141

141 Ma, H., Snook, L. A., Kaminskyj, S. G. W. & Dahms, T. E. S. (2005). Surface ultrastructure and elasticity in growing tips and mature regions of Aspergillus hyphae describe wal l maturation. Microbiology Sgm 151, 36793688. Ma, H., Snook, L. A., Tian, C., Kaminskyj, S. G. W. & Dahms, T. E. S. (2006). Fungal surface remodelling visualized by atomic force microscopy. Mycological Research 110 879 886. Mackay, J. P., Matthews, J. M., Winefield, R. D., Mackay, L. G., Haverkamp, R. G. & Templeton, M. D. (2001). The hydrophobin EAS is largely unstructured in solution and functions by forming amyloidlike structures. Structure 9 83 91. Martin Molina, A., Moreno Flores, S., Perez, E., Pum, D., Sleytr, U. B. & Toca Herrera, J. L. (2006). Structure, surface interactions, and compressibility of bacterial S layers through scanning force microscopy and the surface force apparatus. Biophysical Journal 90, 18211829. Maurer, P., Couteaudier, Y., Girard, P. A., Bridge, P. D. & Riba, G. (1997). Genetic diversity of Beauveria bassiana and relatedness to host insect range. Mycological Research 101, 159 164. Mavtchoutko, V., Vene, S., Haglund, M., Forsgren, M., Duks, A., Kalnina, V., Horling, J. & Lundkvist, A. (2000). Characterization of tick borne enchephalitis virus from latvia. Journal of Medical Virology 60, 216222. Maxwell, D. P. & Bateman, D. F. (1968). Oxalic Acid Biosynthesis by Sclerotium Rolfsii. Phytopathology 58, 1059&. Mazet, I., Hung, S. Y. & Boucias, D. G. (1994). Detection of Toxic Metabolites in the Hemolymph of Beauveria Bassiana Infected SpodopteraExigua Larvae. Experientia 50 142 147. McConn, M. M. & Nakata, P. A. (2002). Calcium oxalate crystal morphology mutants from M edicago truncatula. Planta 215 380386. McCoy, C. W. (1990). Entomogenous fungi as microbial pesticides. In New directions in biological control pp. 139159. Edited by R. R. Baker & P. E. Dunn. New York: A. R. Liss. Munir, E., Yoon, J. J., Tokimatsu, T., Hattori, T. & Shimada, M. (2001). A physiological role for oxalic acid biosynthesis in the woodrotting basidiomycete Fomitopsis palustris Proceedings of the National Academy of Sciences of the United States of America 98 11126 11130.

PAGE 142

142 Munoz, G. A., Agosin, E., Cotoras, M., Sanmartin, R. & Volpe, D. (1995). Comparison of Aerial and Submerged Spore Properties for Trichoderma Harzianum Fems Microbiology Letters 125 63 69. Nakata, P. A. (2002). Calcium oxalate crystal morphology. Trends in Plant Science 7 324324. Ng, W. L., Ng, T. P. & Kwan, H. S. (2000). Cloning and characterization of two hydrophobin genes differentially expressed during fruit body development in Lentinula edodes Fems Microbiology Letters 185, 139 145. Nishizawa, H., Miyazaki, Y ., Kaneko, S. & Shishido, K. (2002). Distribution of hydrophobin 1 gene transcript in developing fruiting bodies of Lentinula edodes Biosci Biotechnol Biochem 66, 19511954. Oren, E. E., Tamerler, C., Sahin, D., Hnilova, M., Seker, U. O. S., Sarikaya, M. & Samudrala, R. (2007). A novel knowledgebased approach to design inorganic binding peptides. Bioinformatics 23, 28162822. Paris, S., Debeaupuis, J. P., Crameri, R., Carey, M., Charles, F., Prevost, M. C., Schmitt, C., Philippe, B. & Latge, J. P. (2003). Conidial hydrophobins of Aspergillus fumigatus Applied and Environmental Microbiology 69, 15811588. Parola, P. & Didier, R. (2001). Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clinical Infectious Diseases 32 897 928. Pegram, R. G., Wilson, D. D. & Hansen, J. W. (2000). Past and present national tick control programs Why they succeed or fail. Tropical Veterinary Diseases 916 546554. Pendland, J. C. & Boucias, D. G. (1991). Attachment of mycopathogens to cuticle. In The fungal spore and disease initiation in plants and animals pp. 101127. Edited by G. T. Cole & H. C. Hoch. New York: Plenum Press. Pendland, J. C., Hung, S. Y. & Boucias, D. G. (1993). Evasion of Host Defense by inVivo Produced Protoplast Like Cells of the Insect Mycopathogen BeauveriaBassiana Journal of Bacteriology 175 59625969. Piesman, J., Clark, K. L., Dolan, M. C., Happ, C. M. & Burkot, T. R. (1999). Geographic survey of vector ticks ( Ixodes scapularis and Ixodes pacificus) for infection with the Lyme disease spirochete, Borrelia burgdorferi Journal of Vector Ecology 24 91 98. Polar, P., Moore, D., Kairo, M. T. K. & Ramsubhag, A. (2008). Topically applied myco acaricides for the control of cattle ticks: overcoming the challenges. Experimental and Applied Acarology 46, 119 148.

PAGE 143

143 Prados Rosales, R., Luque Garcia, J. L., Martinez Lopez, R., Gil, C. & Di Pietro, A. (2009). The Fusarium oxysporum cell wall proteome under adhesioninducing conditions. Proteomics 9 4755 4769. Qin, M., Wang, L. K., Feng, X. Z., Yang, Y. L., Wang, R., Wang, C., Yu, L., Shao, B. & Qiao, M. Q. (2007). Bioactive surface modification of mica and poly(dimethylsiloxane) with hydrophobins for protein immobilization. Langmuir 23, 44654471. Reithinger, R., Davies, C. R., Cadena, H. & Alexander, B. (1997). Evaluation of the fungus Beauveria bassiana as a potential biological control agent against phlebotomine sand flies in Colombian coffee plantations. Journal of Invertebrate Pathology 70, 131 135. Rober ts, D. & Humber, R. A. (1981).Entomogenous fungi. In Biolody of conidial fungi pp. 201236. Edited by G. T. C. a. B. Kendrick. New York: Academic. Roberts, D. W. (1981). Toxins of entomogenous fungi. In Microbial Control of Pests and Plant Diseases pp. 441 464. Edited by H. D. Burgess. New York: Academic Press. Rollins, J. A. & Dickman, M. B. (2001). PH signaling in Sclerotinia sclerotiorum : Identification of a pacC/RIM1 Homolog. Applied and Environmental Microbiology 67, 75 81. Samish, M. (2000). Bioc ontrol of ticks. Tropical Veterinary Diseases 916 172 178. Samish, M., Gindin, G., Alekseev, E. & Glazer, I. (2001). Pathogenicity of entomopathogenic fungi to different developmental stages of Rhipicephalus sanguineus (Acari : Ixodidae). Journal of Parasitology 87, 13551359. Samish, M., Ginsberg, H. & Glazer, I. (2004). Biological control of ticks. Parasitology 129, S389 S403. Scholte, E. J., Knols, B. G. J., Samson, R. A. & Takken, W. (2004). Entomopathogenic fungi for mosquito control: A review. Journal of Insect Science 4 Scholte, E. J., Ng'habi, K., Kihonda, J., Takken, W., Paaijmans, K., Abdulla, S., Killeen, G. F. & Knols, B. G. J. (2005). An entomopathogenic fungus for control of adult African malaria mosquitoes. Science 308, 16411642. Scholtmeijer, K., Wessels, J. G. H. & Woster, H. A. B. (2001). Fungal hydrophobins in medical and technical applications. Applied Microbiology and Biotechnology 56, 1 8.

PAGE 144

144 Scholtmeijer, K., Janssen, M. I., Gerssen, B., de Vocht, M. L., van Leeuwen, B. M., van Kooten, T. G., Wosten, H. A. B. & Wessels, J. G. H. (2002). Surface modifications created by using engineered hydrophobins. Applied and Environmental Microbiology 68, 13671373. Sharifmoghadam, M. R. & Valdivieso, M. H. (2008). The Schizosaccharomyce s pombe Map4 adhesin is a glycoprotein that can be extracted from the cell wall with alkali but not with betaglucanases and requires the C terminal DIPSY domain for function. Molecular Microbiology 69 14761490. SinghBehl, D., La Rosa, S. P. & Tomecki, K. J. (2003). Tick borne infections. Dermatologic Clinics 21, 237 +. Singleton, D. R., Fidel, P. L., Wozniak, K. L. & Hazen, K. C. (2005). Contribution of cell surface hydrophobicity protein I (Csh1p) to virulence of hydrophobic Candida albicans serotype A cells. Fems Microbiology Letters 244 373 377. Smith, S. N., Chohan, R., Armstrong, R. A. & Whipps, J. M. (1998). Hydrophobicity and surface electrostatic charge of conidia of the mycoparasite Coniothyrium minitans Mycological Research 102 243 249. Smith, V. H., Jones, T. P. & Smith, M. S. (2005). Host nutrition and infectious disease: an ecological view. Frontiers in Ecology and the Environment 3 268 274. SosaGomez, D. R., Boucias, D. G. & Nation, J. L. (1997). Attachment of Metarhizium anisopliae to the southern green stink bug Nezara viridula cuticle and fungistatic effect of cuticular lipids and aldehydes. Journal of Invertebrate Pathology 69, 31 39. St Leger, R. J., Joshi, L. & Roberts, D. W. (1997). Adaption of proteases and carbohydrates of saprophytic, phytopathogenic and entomopathogenic fungi to the requirements of their ecological niches. Microbiology 143 1983 1992. St Leger, R. J., Joshi, L. & Roberts, D. (1998). Ambient pH is a major determinant in the expression of cuticledegrading enzymes and hydrophobin by Metarhizium anisopliae. Applied and Environmental Microbiology 64, 709 713. St Leger, R. J., Nelson, J. O. & Screen, S. E. (1999). The entomopathogenic fungus Metarhizium anisopliae alters ambient pH, allowing extracellular protease production and activity. Microbiology Uk 145 26912699. Stleger, R. J., Cooper, R. M. & Charnley, A. K. (1986). Cuticle Degrading Enzymes of Entomopathogenic Fungi Cuticle Degradation Invitro by Enzym es from Entomopathogens. Journal of Invertebrate Pathology 47 167177.

PAGE 145

145 Stringer, M. A. & Timberlake, W. E. (1995). Dewa Encodes a Fungal Hydrophobin Component of the Aspergillus Spore Wall. Molecular Microbiology 16 33 44. Sunde, M., Kwan, A. H. Y., Templeton, M. D., Beever, R. E. & Mackay, J. P. (2008). Structural analysis of hydrophobins. Micron 39 773 784. Szilvay, G. R., Paananen, A., Laurikainen, K., Vuorimaa, E., Lemmetyinen, H., Peltonen, J. & Linder, M. B. (2007). Self assembled hydrophobin protein films at the air water interface: Structural analysis and molecular engineering. Biochemistry 46, 2345 2354. Talaei Hassanloui, R., Kharazi Pakdel, A., Goettel, M. & Mozaffari, J. (2006). Variation in virulence of Beauveria bassiana isolates and i ts relatedness to some morphological characteristics. Biocontrol Science and Technology 16, 525534. Talbot, N. J., Ebbole, D. J. & Hamer, J. E. (1993). Identification and Characterization of Mpg1, a Gene Involved in Pathogenicity from the Rice Blast Fung us MagnaportheGrisea Plant Cell 5 1575 1590. Talbot, N. J., Kershaw, M. J., Wakley, G. E., deVries, O. M. H., Wessels, J. G. H. & Hamer, J. E. (1996). MPG1 encodes a fungal hydrophobin involved in surface interactions during infectionrelated development of Magnaporthe grisea. Plant Cell 8 985 999. Taylor, M. A. (2001). Recent developments in ectoparasiticides. Veterinary Journal 161, 253 268. Thau, N., Monod, M., Crestani, B., Rolland, C., Tronchin, G., Latge, J. P. & Paris, S. (1994). Rodletless Mutants of A spergillus Fumigatus Infection and Immunity 62, 43804388. Thomas, K. C., Khachatourians, G. G. & Ingledew, W. M. (1987). Production and Properties of BeauveriaBassiana Conidia Cultivated in Submerged Culture. Canadian Journal of Microbiology 33, 12 20. Tossi, A. & Sandri, L. (2002). Molecular diversity in geneencoded, cationic antimicrobial polypeptides. Current Pharmaceutical Design 8 743 761. Tucker, S. L. & Talbot, N. J. (2001). Surface attachment and prepenetration stage development by plant pathogenic fungi. Annual Review of Phytopathology 39, 385+. van Wetter, M. A., Wosten, H. A. B. & Wessels, J. G. H. (2000). SC3 and SC4 hydrophobins have distinct roles in formation of aerial structures in dikaryons of Schizophyllum commune. Mole cular Microbiology 36 201 210.

PAGE 146

146 vanderVegt, W., vanderMei, H. C., Wosten, H. A. B., Wessels, J. G. H. & Busscher, H. J. (1996). A comparison of the surface activity of the fungal hydrophobin SC3p with those of other proteins. Biophysical Chemistry 57, 253 260. Viaud, M., Couteaudier, Y., Levis, C. & Riba, G. (1996). Genome organization in Beauveria bassiana: Electrophoretic karyotype, gene mapping, and telomeric fingerprint. Fungal Genetics and Biology 20, 175 183. Walker, D. H. (1998). Tick transmitted infectious diseases in the United States. Annual Review of Public Health 19 237 269. Wanchoo, A., Lewis, M. W. & Keyhani, N. O. (2009). Lectin mapping reveals stagespecific display of surface carbohydrates in in vitro and haemolymphderived cells of the entomopathogenic fungus Beauveria bassiana. Microbiology Sgm 155, 31213133. Wang, C. S. & St Leger, R. J. (2007). The MAD1 adhesin of Metarhizium anisopliae links adhesion with blastospore production and virulence to insects, and the MAD2 adhesin ena bles attachment to plants. Eukaryotic Cell 6 808 816. Wessels, J. G. H. (1997). Hydrophobins: Proteins that change the nature of the fungal surface. Advances in Microbial Physiology, Vol 38 38 1 45. Wessels, J. G. H. (1999). Fungi in their own right. F ungal Genetics and Biology 27 134145. Westwood, G. S., Huang, S.W. & Keyhani, N. O. (2005). Allergens of the entomopathogenic fungus Beauveria bassiana. Clinical and Molecular Allergy 3 Whiteford, J. R., Lacroix, H., Talbot, N. J. & Spanu, P. D. (200 4). Stage specific cellular localisation of two hydrophobins during plant infection by the pathogenic fungus Cladosporium fulvum Fungal Genetics and Biology 41 624 634. Wosten, H. A. B., Devries, O. M. H. & Wessels, J. G. H. (1993). Interfacial Self Assembly of a Fungal Hydrophobin into a Hydrophobic Rodlet Layer. Plant Cell 5 15671574. Wosten, H. A. B., Asgeirsdottir, S. A., Krook, J. H., Drenth, J. H. H. & Wessels, J. G. H. (1994). The Fungal Hydrophobin Sc3p Self Assembles at the Surface of Aerial Hyphae as a Protein Membrane Constituting the Hydrophobic Rodlet Layer. European Journal of Cell Biology 63, 122 129. Wosten, H. A. B. & de Vocht, M. L. (2000). Hydrophobins, the fungal coat unravelled. Biochimica Et Biophysica Acta Reviews on Biomembranes 1469, 79 86.

PAGE 147

147 Xu, M. Q., Paulus, H. & Chong, S. R. (2000). Fusions to self splicing inteins for protein purification. Applications of Chimeric Genes and Hybrid Proteins, Pt A 326 376 418. Ying, S. H. & Feng, M. G. (2006). Novel blastosporebased transformation system for integration of phosphinothricin resistance and green fluorescence protein genes into Beauveria bassiana. Applied Microbiology and Biotechnology 72 206 210. Yu, L., Zhang, B. H., Szilvay, G. R. & other authors (2008). Protein HGFI from the edible mushroom Grifola frondosa is a novel 8 kDa class I hydrophobin that forms rodlets in compressed monolayers. Microbiology Sgm 154, 1677 1685. Zasloff, M. (2002). Antimicrobial peptides in health and disease. New England Journal of Medicine 347 11991200. Zhao, L. M., Schaefer, D. & Marten, M. R. (2005). Assessment of elasticity and topography of Aspergillus nidulans spores via atomic force microscopy. Applied and Environmental Microbiology 71, 955 960. Zhao, Z. X., Qiao, M. Q., Yin, F. & other authors (2007). Amperometric glucose biosensor based on self assembly hydrophobin with high efficiency of enzyme utilization. Biosensors & Bioelectronics 22, 30213027. Zhioua, E., Browning, M., Johnson, P. W., Ginsberg, H. S. & LeBrun, R. A. (1997). Pathogenicity of the entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae). Journal of Parasitology 83, 815818.

PAGE 148

148 BIOGRAPHICAL SKETCH Brett Kirkland grew up under the wat chful eyes of Fred and Sandra Kirkland. He grew up enjoying baseball, fishing, and camping. As a youth he discovered that he had an interest in the sciences. Brett started his undergraduate career in the fall of 1997 at the University of Florida. In or der to put himself through college he began working a local hospital where he worked in the microbiology department. Eventually he began to want more out of his degree that just performing protocol microbiology. He began seeking a means for advancing his education that would lead to a career in science. During the early spring of 2004 he was given the opportunity to volunteer in a laboratory in the Department of Microbiology and Cell Science where he soon realized that research was the direction he wanted to pursue. Brett became a graduate student in the Department of Microbiology and Cell Science in the fall of 2005, where he will earn a PhD from the University of Florida. Brett is the first in his family to earn a PhD and would like to thank everyone who helped make it possible.