<%BANNER%>

Characterization of NPR1 Suppressors and Their Role in Plant Immunity

Permanent Link: http://ufdc.ufl.edu/UFE0041464/00001

Material Information

Title: Characterization of NPR1 Suppressors and Their Role in Plant Immunity
Physical Description: 1 online resource (130 p.)
Language: english
Creator: Defraia, Christopher
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: arabidopsis, elongator, plant, salicylic, transcription
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Plants have evolved inducible immune responses to pathogen infection. Pathogen-induced, isochorismate synthase-dependent salicylic acid (SA) biosynthesis promotes immunity to biotrophic pathogens, which keep the host alive as a long-term food source, partially through NPR1 (non-expresser of pathogenesis-related 1) activation. NPR1 also prevents harmful SA hyperaccumulation and SA cytotoxicity through an unknown mechanism. In this study, mutation of three genes was found to restore SA tolerance to npr1. Overexpression of one of these genes, the transcription factor ANAC1, was associated with increased pathogen resistance, but this gene was not essential for immunity. The other two genes, ELP2 (Elongator subunit 2) and ELP3 (Elongator subunit 3), encode subunits of the histone acetyltransferase Elongator, which is conserved in eukaryotes and functions in RNA polymerase II-dependent transcription, as well as in tRNA modification, exocytosis, and tubulin modification. Mutation of human ELP1 (Elongator subunit 1), causes the neural disorder familial dysautonomia. This study shows Elongator functions both upstream and downstream of SA to positively regulate biotrophic pathogen resistance, and does so in an NPR1-independent manner. Plants lacking ELP2 were susceptible to avirulent pathogen infection, possibly due to the delayed induction of defense genes including ICS1. Plants lacking both ELP2 and NPR1 were highly susceptible to avirulent pathogen infection compared to the single mutants, suggesting ELP2 and NPR1 act synergistically in plant immunity. However, pre-activation of defense genes during systemic acquired resistance (SAR) restored pathogen resistance to elp2 plants. In light of these results, a model is proposed where Elongator promotes immunity through the acceleration of defense gene activation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Christopher Defraia.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Mou, Zhonglin.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041464:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041464/00001

Material Information

Title: Characterization of NPR1 Suppressors and Their Role in Plant Immunity
Physical Description: 1 online resource (130 p.)
Language: english
Creator: Defraia, Christopher
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: arabidopsis, elongator, plant, salicylic, transcription
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Plants have evolved inducible immune responses to pathogen infection. Pathogen-induced, isochorismate synthase-dependent salicylic acid (SA) biosynthesis promotes immunity to biotrophic pathogens, which keep the host alive as a long-term food source, partially through NPR1 (non-expresser of pathogenesis-related 1) activation. NPR1 also prevents harmful SA hyperaccumulation and SA cytotoxicity through an unknown mechanism. In this study, mutation of three genes was found to restore SA tolerance to npr1. Overexpression of one of these genes, the transcription factor ANAC1, was associated with increased pathogen resistance, but this gene was not essential for immunity. The other two genes, ELP2 (Elongator subunit 2) and ELP3 (Elongator subunit 3), encode subunits of the histone acetyltransferase Elongator, which is conserved in eukaryotes and functions in RNA polymerase II-dependent transcription, as well as in tRNA modification, exocytosis, and tubulin modification. Mutation of human ELP1 (Elongator subunit 1), causes the neural disorder familial dysautonomia. This study shows Elongator functions both upstream and downstream of SA to positively regulate biotrophic pathogen resistance, and does so in an NPR1-independent manner. Plants lacking ELP2 were susceptible to avirulent pathogen infection, possibly due to the delayed induction of defense genes including ICS1. Plants lacking both ELP2 and NPR1 were highly susceptible to avirulent pathogen infection compared to the single mutants, suggesting ELP2 and NPR1 act synergistically in plant immunity. However, pre-activation of defense genes during systemic acquired resistance (SAR) restored pathogen resistance to elp2 plants. In light of these results, a model is proposed where Elongator promotes immunity through the acceleration of defense gene activation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Christopher Defraia.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Mou, Zhonglin.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041464:00001


This item has the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF NPR1 SUPPRESSORS AND THEIR ROLE IN PLANT IMMUNITY By CHRISTOPHER DEFRAIA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Christopher DeFraia

PAGE 3

3 This dissertation is dedicated to those who seek the truth.

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I thank Zhonglin Mou for his inspir ation, guidance, and patience. Sharing heated scientific discussion s and exciting results was a pleasure and a privilege. I thank all the members, past as present, of his laborat ory including Yuqing Xiong and Yongsheng Wang. I would espec ially like to thank Xudong Zhang for providing much of my training. Mrs. Zhang generated the data for the characterization of the 35S::ELP2-GFP plants and the determination of av irulent pathogen growth. I thank George Marek for mapping the anac1 mutant, and for counting me worthy to be his teacher. I thank Mary Wildermuth for providing the primers for ICS1 expression analysis, and Mieke Van Lijsebettens for the generous gift of the elo seeds. I thank Keelnatham Shanmugam, William Gurley, Eric Triplett, and David Oppenheimer for their advice and keen analysis. I thank my colleagues in the Department of Microbiology and Cell Science for technical assistance, use of equipment, and helpful discussions. I thank my parents, Gary and Isabelle and my brother, Dan for thei r love and support. I thank my great friends Maxim Salganik, Matthew Desarle, Matthew Reis, and Helen Mcguirk, for their encouragement and counsel. I thank all my teachers, who were a candle in the dark to me. Finally, I thank the National Science Foundation, Margaret Davidson, and the University of Flori da for funding my work.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................4 LIST OF TABLES............................................................................................................8 LIST OF FI GURES..........................................................................................................9 ABSTRACT ...................................................................................................................10 CHAPTER 1 INTRODUC TION....................................................................................................12 Why Study Plants and T heir Immuni ty?..................................................................12 Human Nutr ition...............................................................................................12 Non-Nutritional Applicat ions .............................................................................12 Impacts of Plant Disease..................................................................................13 Disease M anagement ......................................................................................13 Understanding Cell Biology Through Plant Immunity.......................................14 Pathogenes is..........................................................................................................15 Initial C ontact....................................................................................................15 Lifestyles of Plant Pa thogens ...........................................................................15 Model Organisms for the Study of Plant/Pathogen In teractions.......................16 Infection Outcome Depends on Signa l Potentiation and Suppression.............17 Recognit ion......................................................................................................17 Immune Res ponses .........................................................................................17 Signal Supp ression ..........................................................................................18 Salicylic Acid-Medi ated Imm unity...........................................................................19 Hormones Modulate Plant Immune Responses...............................................19 Salicylic Acid Metabolis m.................................................................................20 Regulation of SA Biosynthes is and Accu mulation............................................21 Fitness Costs of SA Hyperaccumu lation ..........................................................22 Systemic Acquir ed Resist ance.........................................................................22 Chromatin Remodeling is Associated wit h SA-Responsive Gene Activation....24 The NPR1 Pr otein............................................................................................26 Post-translational modification regulates NPR1 activity.............................26 NPR1 coor dinates the immune response through transcription factors.....27 NPR1 prevents harmful hyper-activ ation of the i mmune response............28 Dissection of Plant Immunity Using Suppresso r Screens.......................................29 Suppressors of npr1 .........................................................................................29 Identification and Characteri zation of Three Novel npr1 Suppressor Mutants..30 2 MATERIALS A ND METHOD S................................................................................32

PAGE 6

6 Mutant Screen and Genetic Anal ysis......................................................................32 Growth Conditions and Bi ological Ma terials............................................................32 Cloning and Trans formation....................................................................................33 Map-Based Cloning ................................................................................................33 Assessment of Pa thogen Gr owth...........................................................................34 Analysis of G ene Transcr ipts..................................................................................34 Analysis of Protein Expre ssion ...............................................................................36 Salicylic Acid Measurem ent....................................................................................36 Confocal Mi croscopy...............................................................................................37 Reproducibility of Ex periments and Statisti cal Anal ysis..........................................38 Locus Num bers.......................................................................................................38 3 ELP2 FUNCTIONS UPSTREAM AND DOWNSTREAM OF SALICYLIC ACID IN PLANT IMM UNITY.................................................................................................39 Isolation of snt1 .......................................................................................................39 Genetic Analysis of snt1 .........................................................................................40 Map-based Cloning of snt1 .....................................................................................40 ELP2 Functions in Defense Gene Ex pression and Pathogen Resistance..............41 ELP2 is Essential for Salic ylic Acid-Induced Immuni ty...........................................43 Initiation of Systemic Acquired Resist ance Restores Pathogen Resistance to elp2 ......................................................................................................................43 ELP2 is Essential for Effe ctor-Triggered Re sistance..............................................44 Subcellular Localization of the ELP2 Protein..........................................................45 4 ELP3 IS A POSITIVE REGULATOR OF PLANT IMMUNITY.................................70 Isolation and Genetic Analysis of snt3 ....................................................................70 Map-Based Cloning of snt3 .....................................................................................70 Characterization of snt3 Single Mu tants.................................................................71 5 THE ROLE OF ANAC1 IN PLANT IM MUNITY.......................................................77 Isolation and Genetic Analys is of snt2 ....................................................................77 Map-Based Cloning of snt2 .....................................................................................78 Characterization of ANAC1 single mu tants.............................................................79 6 DISCU SSION.........................................................................................................86 Functions of Elongator............................................................................................86 Elongator and Tr anscripti on.............................................................................86 Elongator and tRNA Modifica tion.....................................................................88 Elongator in Fam ilial Dysaut nomia ...................................................................89 ELP3 is Essential fo r Plant I mmunity......................................................................90 The Role of Elongator in Plant I mmunity.................................................................91 How Does Elongator Regula te Pathogen Re sistanc e?....................................96

PAGE 7

7 Transcription and Hist one Modifica tion......................................................96 tRNA Modification and Transla tion.............................................................96 Localizat ion......................................................................................................97 Dissecting Elongat or Func tion..........................................................................98 Possible Functions of ELP4-E LP6 in Plant Immunity.......................................98 Does Elongator Regulate Cro sstalk Between Hormone Signaling Pathwa ys?.....................................................................................................99 The Role of ANAC1 in Plant Imm unity..................................................................100 APPENDIX: SUPPLEMENTAL F IGURES AND TA BLES...........................................105 REFERENC ES............................................................................................................111 BIOGRAPHICAL SKETCH ..........................................................................................130

PAGE 8

8 LIST OF TABLES Table page A-1 Primers used for rough mappi ng......................................................................108 A-2 Primers used fo r fine mappi ng..........................................................................109 A-3 Primers used for mutant genotyp ing.................................................................110 A-4 Primers used in analysis of gene...................................................................... 110

PAGE 9

9 LIST OF FIGURES Figure page 3-1 snt1 suppresses SA toxicity and over-accumulation in npr1 ...............................47 3-2 Genetic analysis of snt1 .....................................................................................50 3-3 Disruption of ELP2 confers snt1 phenotyp es......................................................51 3-4 ELP2 regulates ICS1 and PR expre ssion...........................................................55 3-5 Characterization of elp2 single mu tants..............................................................56 3-6 ELP2 is essential for full-scale SA-induced re sistance.......................................59 3-7 Systemic acquired resistance in elp2 plants.......................................................61 3-8 Effector-triggered resistance in elp2 plants........................................................63 3-9 ELP2-GFP is a functi onal protein in planta.........................................................65 3-10 Subcellular lo calization of the ELP2 prot ein.......................................................69 4-1 snt3 suppresses SA toxicity and over-accumulation in npr1 ...............................72 4-2 Genetic analysis of the snt3 mutati on.................................................................73 4-3 Identification of the snt3 mutati on.......................................................................74 4-4 Growth of Psm in snt3 and elo3 single mu tants.................................................76 5-1 snt2 suppresses SA toxicity and over-accumulation in npr1 ...............................80 5-2 Genetic analysis of the snt2 mutati on.................................................................82 5-3 Identification of the snt2 mutati on.......................................................................83 5-4 Growth of Psm in snt2, anac1-1, and anac1-2 single mu tants ...........................85 A-1 Loss of SA tolerance in npr1-L .........................................................................105 A-2 ELP-GFP fluorescence in npr1 and INA-treated seedlings ...............................106

PAGE 10

10 Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy CHARACTERIZATION OF NPR1 SUPPRESSORS AND THEIR ROLE IN PLANT IMMUNITY Christopher DeFraia May, 2010 Chair: Zhonglin Mou Major: Microbiology and Cell Science Plants have evolved inducible imm une responses to pathogen infection. Pathogen-induced, isochorismate synthase-dependent salicylic acid (SA) biosynthesis promotes immunity to biotrophic pathogens, which keep the host alive as a long-term food source, partially through NPR1 ( non-expresser of pat hogenesis-related 1) activation. NPR1 also prevents harmful SA hyperaccumulation and SA cytotoxicity through an unknown mechanism. In this stud y, mutation of three genes was found to restore SA tolerance to npr1 Overexpression of one of these genes, the transcription factor ANAC1, was associated with incr eased pathogen resistance, but this gene was not essential for immunity. The other two genes, ELP2 (Elongator subunit 2) and ELP3 (Elongator subunit 3), encode subunits of the histone acetyltransferase Elongator, which is conserved in eukaryotes and functions in RNA polymerase II-dependent transcription, as well as in tRNA modification, exocytosis and tubulin modification. Mutation of human ELP1 (Elongator subunit 1), causes the neural disorder familial dysautonomia. This study shows Elongator functions both upstr eam and downstream of SA to positively regulate biotrophic pathogen re sistance, and does so in an NPR1-independent manner. Plants lacking ELP2 were susceptible to avirulent pathogen infection, possibly due to

PAGE 11

11 the delayed induction of defense genes including ICS1 Plants lacking both ELP2 and NPR1 were highly susceptible to avirulent pathogen infection compared to the single mutants, suggesting ELP2 and NPR1 act synergi stically in plant immunity. However, pre-activation of defense genes during system ic acquired resistance (SAR) restored pathogen resistance to elp2 plants. In light of these resu lts, a model is proposed where Elongator promotes immunity through the acceleration of defense gene activation.

PAGE 12

12 CHAPTER 1 INTRODUCTION Why Study Plants and Their Immunity? Human Nutrition Approximately one sixth of people wo rldwide are malnourished due to the uneven distribution of resources. Accordi ng to one study, six million people die each year from malnutrition, and ~800 million ar e malnourished. Most of the food supply comes directly from plants, and the rest is indirectly derived. Although enough food is produced to provide each person on earth with an adequate diet, poverty, plant disease, environmental disasters, and political strife cause local food shortages (Leathers and Foster, 2004). Understanding the factors that affect our f ood supply is essential for devising strategies to promote food security and fight malnutrition. Food supply is largely affected by agricul tural productivity. In the last century, agricultural production has greatly increased due to the use of industrial machinery and fertilizer. This increase has mostly been limited to industrialized countries, where agricultural problems affect profits more than nutrition. In developing countries, increases in agricultural production and farming cost reduction would increase access to cheaper food while keeping for-profit farmer s in business and subsistence farmers nourished (Leathers and Foster, 2004). Non-Nutritional Applications Other plant applications include biof uel production, phytoremediation, and phytochemical production (the plant kingdom can produce >100,000 metabolites).

PAGE 13

13 (McGuinness and Dowling, 2009; Turner, 2009) (Trethwewny, 2004). Plants are also sought after for their natural beauty. Impacts of Plant Disease One major factor affecting plant growth is disease. Disease results in lower crop yield and quality, and in most cases occurs after investments of water, fertilizer, and labor (Alam and Rolfe, 2006). The adoption of crop monoculture also contributes to the spread of disease. Monoculture of crops is an efficient method of production. However, it exacerbates disease outbreaks because non-host barriers do not interrupt large swaths of potential hosts (Zhu et al., 2000). The Irish potato famine, caused by Phytopthora infestans was responsible for the deaths of between two hundred thousand and 1.2 million people, though as is usually the case with famine, political, cultural, and economic conditions were also ma jor factors (Grda, 200 6). More locally, citrus canker ( Xanthomonas axonopodis ) and citrus greening (likely caused by Liberibacter species) are damaging t he Florida citrus industry (Parnell et al., 2009). Disease Management Currently, most disease management pr actices focus on prevention. Once a diseased plant is detected, it is often des troyed to prevent dissemination (Fry, 1982). Disease treatment in the clinical sense is rare. While knowledge of the mammalian immune system has allowed the invention and widespread use of medical drugs, the lack of understanding of plant diseases and plant immunity has limited such advancements for plants. Antibiotic therapies have been tried, but co st and other factors have limited their use (Daniels, 1982).

PAGE 14

14 Pesticides are used to contain disease and pests, but these applications can be detrimental to the environm ent and human health. The fact that these costs are not borne by the farmer, combined with the effect iveness of pesticides at increasing crop yield and quality, contributes to thei r widespread usage (Phipps, 1989). Chemical companies have designed crops around tolerance to pesticides and herbicides (Funke et al., 2006). Recent advancements in the understanding of plant immunity have led to the introduction of compounds that activa te the plants innate defenses. Though effective, the biological consequences of these treatments are not fully understood. A better understanding of the plant immune sys tem will facilitate the use of these treatments, and allow the rati onal design of disease treat ments and disease-resistant crops, reducing the need for toxic and costly pesticides. In the developing world, plant immunity research can inform crop select ion and management practices, while reducing the cost of farming, provided advances are effectively communicated and distributed. Understanding Cell Biology Through Plant Immunity Investigation of plant-pat hogen interactions has brought insights into diverse biological processes. Upon pat hogen infection, significant transcriptional reprogramming occurs (Tao et al., 2003) (Schenk et al ., 2000). Knowledge of defense gene regulation has led to a greater understanding of how genes are regulated generally. This is also the case for other cellular processes, as t he entire cell works in concert to combat the infection. Many cellular processes have been implicated in disease resistance. A few examples are apoptosis, metabolism, photos ynthesis, transport, cell wall synthesis, stomata closure, and signal transduction. Plant-pathogen inte ractions also provide an interesting case study of co-evolution (Kat agiri et al., 2002). The reproductive success

PAGE 15

15 of a pathogen often depends on its ability to infect its host, just as t he plant will be less successful if infected. Thus, plants and thei r pathogens are locked into an evolutionary arms race (Thompson and Burdon, 1992) (Bergelson et al., 2001). As discussed below, the race alternates between the pathogen suppr essing defense activation, and the plant countering this suppression. Pathogenesis Initial Contact Plants possess an innate immune system t hat protects them from microbial pathogens, but lack specialized immune cells and long-term immunological memory of mammals (Nurnberger et al., 2004). Due to the sessile nature of plant life, plants must quickly and effectively respond to changes in their environment or perish. Most often, when a microbe contacts the plant, entry is prevented by preformed and constitutive defenses such as the waxy cu ticle, the cell wall, antimic robial enzymes, and secondary metabolites (Martin, 1964) (Hahn et al., 1989) (Broglie et al., 1991) (Nicholson and Hammerschmidt, 1992). Elimination or ex clusion of the microbe occurs without activation of costly defenses. However, plant pathogens may gain entry by injuries to the plant tissue, enzymatic degradation of cell walls, or through stomata (Romantschuk and Bamford, 1986) (Vidal et al., 1998) (Davis et al., 1984). Lifestyles of Plant Pathogens Pathogens utilize two general strategies to gain access to the photosynthate inside plant cells. Necrotrophic pathogens rapi dly kill host cells using toxic molecules and lytic enzymes, resulting in rapid tissue necrosis. The necrotroph then grows saprophytically on the dead tissue (van Kan, 2006). Biotrophic pat hogens persist and

PAGE 16

16 multiply in live plant tissue, eventually resulting in starvation of the plant cells. Chlorosis and water soaking are followed by complete co llapse of the tissue. If successful, both kinds of pathogens eventually kill the infected tissue (Staskawicz et al., 2001) (Glazebrook, 2005). Model Organisms for the Study of Plant/P athogen Interactions The Arabidopsis thaliana / Pseudomonas syringae pathosystem has emerged as a model for the study of plant/biotrophic path ogen interactions (Katagiri et al., 2002). Genome sequences from both organisms are ava ilable, and a large fraction of their genes have been characterized or at least a ssigned putative functions (The Arabidopsis Genome Initiative, 2000) (Buell et al., 2003). Arabidopsis is also an ideal system for genetics due to its relatively small diploid genome, short generation time, high fertility, ease of growth, and small size. The availabili ty of many polymorph ic markers between two ecotypes greatly facilitates the identific ation of induced mutations, allowing forward genetic screens to be carried out efficiently (Jander et al., 2002). Pseudomonas syringae pv. maculicola ES4326 ( Psm ) is a hemibiotrophic, plant-pathogenic bacterum that is Gram-negative, rod-s haped, and has polar flagella. Pathovars of this species are assigned based on host range. Psm typically invades plants through wounds or stomata (Romantschuk, 1992) (Romantschuk and Bamfor d, 1986) (Kreig and Holt, 1984). It persists and multiplies in the apoplast, event ually causing leakage of water and photosynthate, which it uses to multiply and eventually over whelm plant defenses (Katagiri et al., 2002).

PAGE 17

17 Infection Outcome Depends on Signal Potentiation and Supp ression Recognition If the pathogen does invade the plant, it will likely be recognized by its pathogen associated molecular patterns (PAMPs), whic h are essential and conserved structural motifs that are present in pathogens but not in plants. Examples include the peptide flg22 and elongation factor (EF) Tu, which are components of flagella and the ribosome, respectively. PAMPS are recognized by transmembrane pattern recognition receptors (PRRs), each specific for its cognate PAMP. flg22 is recognized by the plant receptor FLS2 (flagellin sensitive 2), while EF-Tu is recognized by EFR (EF-Tu receptor) (Felix et al., 1999) (Gomez-Gomez et al., 1999) (Kun ze et al., 2006). After recognition, the pathogen signal is amplified through a MAP kinase cascade(s); eventually affecting the activity of transcription factors in the nuc leus and activating resistance (Nuhse et al., 2000) (Asai et al., 2002). PAMP recognition resu lts in PAMP-triggered immunity (PTI), which limits pathogen growth (Nimchuk et al., 2003). Immune Responses PTI includes diverse immune responses. Following pathogen infection, antimicrobial, low molecular weight com pounds known as phytoalexins are produced, and cell walls are reinforced by callose depo sition (Donofrio and Delaney, 2001) (Skou, 1985) (Keen and Bruegger, 1977) (Smith, 19 82). Additionally, antimicrobial pathogenesis-related (PR) proteins accumulate. These are low-molecular weight, thermostable, protease-resistant proteins; some of which degrade microbial cell walls and membranes (Edreva, 2005). Examples include the -1,3-glucanase PR-2 that breaks down fungal cell walls, and the t haumatin-like PR-5 pr otein, which has

PAGE 18

18 membrane permeabilizing activity. The PR-1 protein has an unknown function, but can comprise 1-2% of all protein during an in fection. During the presence of certain pathogenic effector proteins, plants cells may also undergo a form of programmed cell death, depriving the pathogen of nutrients and water (Holliday et al., 1981) (Goodman and Novacky, 1994). Since pathogens may enter the plant through st omata, stomatal closure also occurs during infection (Melotto et al., 2008). Collectively, these responses limit the growth and spread of the pathogen. The importance of these responses is emphasized by the discovery that they ma y be directly suppressed by pathogens to promote pathogenesis (Glawischni g, 2007) (Melotto et al ., 2008). Additionally, the pathogens attempt to short-circuit the PAMPgenerated signal, prevent ing the activation of these responses. Signal Suppression Pathogens may attempt to suppress PTI si gnaling by injecting effector proteins into the plant cell via a type III secretion system (TTSS). These effector proteins promote virulence and pathogen growth by reducing the plant defense response (Wei et al., 1999) (van Dijk et al., 1999) (Gopalan et al., 1996). An effector protein may, in turn, be recognized by its cognate plant resistance (R ) protein, present in resistant cultivars of a given species (Belkhadir et al., 2004). In th is case, the effector protein is referred to as an avirulence (Avr) factor, and activa tes effector-triggered immunity (ETI). Transcriptionally, ETI is qualitat ively similar to PTI, but wit h faster and stronger defense gene activation (Tao et al., 2003). Psm and another pathovars, Pseudomonas syringae pv. tomato (Pst) secretes over 30 effector proteins into plant cells, and can cause disease in Arabidopsis. Examples of effector proteins secreted by Pst DC3000 are

PAGE 19

19 AvrRpm1, which is recognized by the pl ant R protein RPM1; AvrRps2, which is recognized by RPS2; and AvrRpt2, also re cognized by RPS2 (Kunkel et al., 1993) (Boyes et al., 1998) (Ritter and Dangl, 1995) (Chen et al., 2000) (Yu et al., 1993). Recognition of AvrRpm1 by RPM1 is mediated by RIN4. AvrRpt2 is a cysteine protease that cleaves RIN4, preventing AvrRpm1 re cognition by RPM1 (Mackey et al., 2003). RIN4 can also bind to RPS2 and prevents it s inappropriate activation. AvrRpt2 cleavage of RIN4 triggers activation of RPS2 and resistance (Mackey et al., 2002). These observations have led to a Guard Hypothesis, wh ich states that R proteins function to detect changes in the targets (i.e. RIN4) of bac terial effector proteins (Jones and Dangl, 2006). The absence of either Av r or R protein results in disease if PTI defenses are insufficient (Jones and Takemoto, 2004; Nu rnberger et al., 2004). Addition of an avr gene to virulent pathogens renders them avirulent, and addition of R genes to plants confers resistance to pat hogens containing the cognate avr gene (Ronald et al., 1992) (Hammond-Kosack et al., 1998). Salicylic Acid-Mediated Immunity Hormones Modulate Plant Immune Responses Plants can customize their defense res ponse based on the type of pathogen they encounter. This is accomplished by m odulation and crosstalk of hormone-dependent signaling pathways. Salicylic acid (SA) jasmonates and jasmonic acid (JA) and ethylene (ET) are the main signaling molecules acting during disease resistance, although hormones like abscisic acid (ABA), auxin, and brassinosteroids also play a role (White, 1979) (Jacobs, 1952) (Jensen et al ., 1998) (Whenham et al., 1985) (Gundlach et al., 1992) (Lund et al., 1998) (Spoel and Dong, 2008). These hormones play

PAGE 20

20 significant roles in other physiological proc esses as well (Roberts et al., 1980) (Hildman et al., 1992). For example, SA regulates ge rmination, flowering, and heat generation (Raskin et al., 1989) (Hayat and Ahmed, 2007). It should be noted that salicylic acid is not a hormone in the strictest s ense, as it apparently does no t travel from its site of origin to elicit a response in another part of the plant (Vernooij et al., 1994). Nonetheless it is a central signaling molecule in plant i mmunity (Gaffney et al., 1993) (Lawton et al., 1995). Defense responses involving JA and ET are generally more effective against necrotrophic pathogens and chewing insects (T on et al., 2002) (Glazebrook et al., 2003). JAand ET-dependent responses ant agonize those of SA and vice versa, although these responses may also act synergist ically in some cases (Rojo et al., 1999) (van Wees et al., 2000) (Spoel et al ., 2003) (Kunkel and Brooks, 2002). Salicylic Acid Metabolism During infection, SA accumulates in cells and promotes pathogen resistance (Mtraux et al., 1990) (Durrant and D ong, 2004). Exogenous SA treatment or expression of ectopic SA biosynthesis genes re sults in resistance, while removal of SA causes susceptibility (Kauss et al., 1992) (V erberne et al., 2000) (Naw rath and Mtraux, 1999). In plants, SA is made through tw o metabolic pathways. Starting with phenylalanine, the phenylpropanoid pathway c onverts this amino acid into SA. Additionally, chorismate is converted to SA via isochorismate through the action of a chloroplastic isochorismate synthase (ICS 1), and a putative isochorismate pyruvate lyase (IPL). ICS1 is the rate-limiti ng enzyme for pathogen-induced SA biosynthesis during the immune respons e (Strawn et al., 2006).

PAGE 21

21 SA can be glucosylated through the activity of SA-glucosyltransferase and stored in the vacuole as 2-O -D-glucosylbenzoic acid (SAG) (Lee et al., 1995). SAG is biologically inert and accumulates to high levels during pathogen infection (Malamy et al., 1992). Regulation of SA Biosynthesis and Accumulation SA biosynthesis is amplified by posit ive-feedback regulati on. The interacting lipases PAD4 (phytoalexin deficient 4) and EDS1 (enhanced disease susceptibility 1) are upstream inducers of SA synthesis. In eds1 pad4 plants, ICS1 induction is diminished following infection (Falk et al., 1999) (Wiermer et al., 2005) (Zhou et al., 1998) (Jirage et al., 1999). In pad4 plants, EDS1 expression is lowered, while in eds1 plants, PAD4 expression is lowered, forming a positive feedback loop between PAD4 and EDS1, both of which promote SA accumulation. In turn, SA increases EDS1 and PAD4 expression, suggesting the existence of a positive feedback loop between EDS1/PAD4 and SA (Wiermer et al., 2005) (Del aney et al., 1995; Feys et al., 2001). EDS1 and PAD4 are also essential for PTI and ETI, suggesting they act to amplify the immune response (Durrant and Dong, 2004). SA biosynthesis is also subject to negative feedback regulation by NPR1 (nonexpr esser of PR genes 1) (Shah et al., 1997). This protein and its immune functions are discussed in detail below. Conversion of SA to methyl-SA and SAG may also modulate SA levels during infection. Overexpression of the SA glucosyltransfe rase SGT1 or an SA methyltransferase reduced SA accumulation and resistance duri ng pathogen infection (Koo et al., 2007) (Song et al., 2008). The Psm virulence factor coronatine is an analog of JA, and induces

PAGE 22

22 methyl-SA production, reducing free SA levels and increasing susceptibility (Song et al., 2008). Although conversion of SA to biolog ically inert compounds and negative feedback regulation by NPR1 serve to prevent SA hyperaccumulation during pathogen infection, ICS1 must also be repressed during norma l growth to avoid wasteful immune activation. Basal repression is accomplished by Ethylene Insensitive 3 (EIN3) and ethylene insensitive 3-lik e (EIL1). These transcrip tion factors bind to the ICS1 promoter and prevent transcription (Chen et al., 2009). Fitness Costs of SA Hyperaccumulation Constitutive accumulation of SA is detri mental to the plant. Indeed, plants may have evolved an inducible and ti ghtly regulated system of immuni ty to forgo the cost of constitutive defense activation. The SA analogues benzothiadiazole (BTH), and isonicotinic acid (INA) induce defense acti vation in plants without cytotoxic effects (Friedrich et al., 1996) (Mtraux et al., 1991) However, in the absence of pathogens, BTH incurs a fitness cost in the form of r educed seed yield and fresh weight (Heil et al., 2000) (Heil, 2002). Several Arabidopsis mutants that have elevated SA levels and constitutive defense responses also exhi bit reduced seed yield and dwarf phenotypes, indicating that unregulated defense activation r educes fitness. In some cases, reduced fitness in these mutants requires SA (Heidel et al., 2004) (Kirik et al., 2001) (Silva et al., 1999). Systemic Acquired Resistance SA is essential for systemic acquired resistance (SAR), a long lasting, broadspectrum resistance to pathogens in systemic tissue following an infection in distal

PAGE 23

23 tissue (Wildermuth et al., 2001) (Gaffney et al., 1993) (Mtraux, 2002) (Durrant and Dong, 2004). SAR, like ETI, is qualitatively similar to PTI, employing similar and overlapping signaling pathways (Maleck et al., 2000). However, defense activation is induced more slowly and to a lower level than during PTI or ETI (Ryals et al., 1996). PAMPs, avirulent and virulent pathogens, an d high doses of non-pathogenic bacteria all induce SAR (Mishina and Zeier, 2007). An SAR-inducing mobile signal that move s from local infected tissue to systemic tissue has been proposed (Ross, 1961) (Durr ant and Dong, 2004). The identity of the signal(s), and the molecular mechanism underlying its generation and perception has been the subject of intense study. Mutational analysis has revealed several genes that are required for the generation of the mobile signal. DIR1 (defective in induced resistance 1), a putative lipid transfer protein, lacks SAR but displays normal local pathogen resistance, suggesting DIR1 is involv ed in the generation and/or transmission of the mobile signal (Maldonado et al., 2002). FAD7, a fatty acid desaturase, the lipases EDS1, PAD4, and SA-binding protein 2 ( SABP2), as well as the dihydroxyacetone phosphate reductase SFD1 are essential for SAR (Chaturvedi et al., 2008) (Forouhar et al., 2005). These data suggest that a lipid or lipid-derived molecule may be a mobile signal in SAR. The aspartic protease CDR1 (constitutive disease resistance 1) is required for both local and systemic resistance, suggesting the possible involvement of a peptide signal in SAR (Xia et al., 2004). Although local SA synthesis and signaling are essential for SAR signal generation, SA and methyl-SA are probably not long-distance

PAGE 24

24 signals (Attaran et al., 2009). Following signal recognition, de-novo SA biosynthesis in systemic leaves occurs and activates resistance (Mtraux et al., 1990). Chromatin Remodeling is Associated w ith SA-Responsive Gene Activation DNA encodes all the information needed to build a cell. Further programming instructions in response to environmental cues can also be found on the histones associated with DNA that form ch romatin. These ancillary instructions come in the form of post-translational modification s to the N-terminal regions of histones 2, 3, and 4 (H2, H3, and H4). These largely reversible modifi cations include mono, di, and trimethylation, acetylation, phosphorylation, ubiquitination, and sumoylation (Loidl, 2004). Some of these modifications are associated with actively transcribed chromatin, while others are more closely associated with condensed and rela tively silent chromatin. This plant histone code for influencing gene expressi on via histone modifications is still being elucidated. These efforts are complicated by the fact that the effects of histone modifications can depend upon other modifications. Basal repression of defense genes is mediated by several factors that are thought to recruit chromatin-modifying fact ors that condense defense gene chromatin. SNI1 (suppressor of npr1 inducible 1) represses basal expression of defense genes and H3 di-acetylation at the PR-1 promoter (Li et al., 1999) (Mosher et al., 2006). HDA19 (histone deacetylase 19), a putative hi stone deacetylase, also represses basal expression of defense genes, possibly by re moving histone acetylations that are normally associated with open chromatin. However, HDA19 positively regulates pathogen resistance, and interacts with and possibly deactivates the immune repressor transcription factors WRKY38 and WRKY62 (Kim et al., 2008) SIZ1, a small ubiquitin-

PAGE 25

25 like modier (SUMO) protein, is also a repres sor of defense genes (Lee et al., 2007). The involvement of SNI1, HDA19, and SIZ1 in plant immunity suggests a role for histone modification in defense gene repressi on. However, genes t hat are directly targeted by these proteins have not been identified, with the exception of WRKY70 by the histone methylase ATX1 [Alvarez-Venegas, 2007 #6678]. Changes in chromatin m odification occur during plant defense induction. Treatment with exogenous SA leads to increased levels of H3Ac, H4Ac, H3K4me2, and H3K4me3 on the PR-1 promoter (Mosher et al., 2006). These modifications are generally, but not always, associated with acti vely transcribed chromatin. This increase is NPR1-dependent and correlates positively with PR induction. NPR1 also prevents SA-dependent H3 deacetylation (Butterbrodt et al., 2006) (Koornneef et al., 2008). These results suggest that NPR1 or another protein recruits a histone acetyltransferase(s) and a histone methyl transferase(s) to defense genes during pathogen infection and/or SA treatment. A histone methylase, ATX1, activates the expression of the WRKY70 gene (itself an ac tivator of defense genes), and directly establishes the H3K4me3 modification on WRKY70 nucleosomes, facilitating its transcription. A large number of genes (12%) depended on ATX for their expression, but only WRKY70 was shown to be a direct target of ATX (Alvarez-Venegas et al., 2007). The lack of characterized chromatin modi fying enzymes that target defense genes represents a gap in the knowledge of how defense genes are repressed, primed, and induced. In particular, although histone ac etylation is correlated with defense gene

PAGE 26

26 expression, no histone acetyltransferases hav e been shown to regulate plant immunity or modify defense gene chromatin. The NPR1 Protein In order to identify components of the SA signaling pat hway, researchers genetically screened for mutant s lacking SA-inducible PR expression. One mutant, npr1 was deficient in PR expression, susceptible to P. syringae and Hayaloperonospora parisitica and lacked SA-induced resistance and SAR (Ryals et al., 1997) (Shah et al., 1997) (Cao et al., 1994) These studies established NPR1 as a positive regulator of SA-dependant resistance that acts downstream of SA. NPR1 encodes a protein containing four ankyr in repeats and a BTB (Broad-Complex, Tramtrack and Bric-a-brac) dom ain, both of which are in volved in protein-protein interactions (Cao et al., 1997). Post-translational modification regulates NPR1 activity During normal growth, NPR1 is present as an oligomer in the cytosol and is transcriptionally induced during infection (Mou et al., 2003) (Kinke ma et al., 2000). During SAR, SA synthesized in the chloropl ast is transported to the cytosol, which becomes more oxidized, followed by a reduction in redox potential and an increase in reduced glutathione. NPR1 is reduced by glutathione, causi ng NPR1 to form monomers (Mou et al., 2003). NPR1 conformation is also controlled by nitrosylation. Upon SAR induction, NPR1 is S-nitrosylated by S-nitr osoglutathione, facilitat ing oligomerization, and possibly preventing protein degradation. Both NPR1 oligomerization and monomerization are essential for pathogen resi stance and PR expression. At the same time, thioredoxins catalyze the reduction of cysteine-156, disrupting intermolecular

PAGE 27

27 disulfide bonds and promoti ng monomerization (Tada et al., 2008). Monomeric NPR1 localizes to the nucleus where it functions as a transcriptional co-activator of defense genes (Kinkema et al., 2000). Spurious NPR1 nuclear accumulation is prevented by a CUL3-based ubiquitin ligase, which adds ubiquitin to NPR1, target ing it for degradation by the proteasome, and preventing PR expression in the absence of infection. NPR1 phosphorylation is essential for this degradation. Proteasome inhibition or mu tation of the ubiquitin ligase also prevents the induction of SAR, suggest ing NPR1 turnover is essential for its transcriptional co-activator activity (Spoel et al., 2009). NPR1 coordinates the immune r esponse through transcription factors Nuclear NPR1 interacts with several me mbers of the TGA tr anscription factor family (Zhang et al., 1999) (Desprs et al., 2003) (Johnson et al., 2003) (Desprs et al., 2000). The effects of these transcription factors are regulated at the level of NPR1 binding, protein turnover, and TGA factor disulfide reduc tion. Several TGAs have been shown to bind to SA-responsive cis -elements in the PR-1 promoter. TGA factors include both positive and negative regulators of SAR, three of which function redundantly (Fan and Dong, 2002) (Pontier et al., 2001) ( Niggeweg et al., 2000). The triple mutant tga2/5/6 (but not single or double mutants) disp layed normal local resistance but lacked SAR and had increased basal PR-1 (Zhang et al., 2003b). These data suggest that these transcription factors act in concert to ensure PR-1 is expressed at the appropriate time. NPR1 is also essential for the expre ssion of several WRKY transcription factors, some of which control PR expression (Wang et al., 2006) (Kim et al., 2008) (Yang et al., 1999). Thus, PR expression depends upon SA accumulation and NPR1 activation.

PAGE 28

28 Pathogen infection initiates transcriptional reprogramming, a fraction of which is SA-dependent. NPR1 controls a subset of these SA-dependent defense genes (Glazebrook et al., 2003) (Blanco et al., 2009). During infection, PR-1 PR-2 and PR-5 are differentially dependent upon SA and NPR1 for their expression. PR-1 almost completely depends upon NPR1 for its timely expression during pathogen infection. PR2 and PR-5 are partially npr1 -independant. PR-2 requires SA accumulation for its expression, while PR-5 is partially expressed i ndependently of SA (Nawrath and Mtraux, 1999) (Shah et al., 1997). The cellula r machinery involved in the induction of PR genes, and the basis for differential PR acti vation by distinct pathways, is not fully understood. During SAR, cytosolic oligomeric NPR1 is reduced to monomers which move into the nucleus to control both the expressi on of PR genes and genes involved in protein folding and transport, presumabl y for the folding and export of PR proteins (Kinkema et al., 2000) (Desprs et al., 2000) (Zhang et al., 1999; Desprs et al., 2000; Kinkema et al., 2000; Fan and Dong, 2002; Desprs et al., 2003; Johnson et al., 2003; Mou et al., 2003). Interruption of a protein chaperone re sults in leaf collapse and cell death following treatment with isonicotinic acid (INA), an SA analog, or tunicamycin, a protein misfolding agent (Wang et al., 2005). This suggests NPR1-regulated increases in protein folding and secretion capabilities are essential processes that must be coordinately regulated with defense responses for a non-to xic and effective resistance. NPR1 prevents harmful hyper-acti vation of the immune respon se Nuclear NPR1 alleviates the cytotoxic effects of high concentrations of SA (Zhang et al., 2009). NPR1 may accomplish this through its control of TGA factors, as

PAGE 29

29 the tga2/5/6 mutant lacks SA tolerance (Zhang et al., 2003b). Other proteins also likely contribute to SA tolerance. I dentification of these proteins would lead to a better understanding of the under lying causes of SA toxicity, which are thought to include oxidative stress (Rao et al., 1997). Nuclear NPR1 also prevents ICS1 overexpression and SA hyperaccumulation during the immune response and m oderates SA levels in mut ants that constitutively accumulate SA (Zhang et al., 2009) (Clarke et al., 1998). This moderation of SA accumulation may serve to prevent SA toxicity and reduced plant fitness, and/or to shut off the immune response once the infection subsides (Durrant and Dong, 2004). Hence, SA accumulation is subject to both positive and negative feedback regulation. How NPR1 moderates ICS1 expression is unknown. Dissection of Plant Immunity Using Sup pressor Screens Suppressors of npr1 Researchers have previously examined t he function of NPR1 by screening for mutations capable of suppressing npr1 phenotypes. These studies have been instrumental in the identification of components of the SA-depen dent defense signaling. Most npr1 suppressor mutants were isolated based on their ability to restore SAinduced PR expression to npr1 One class of npr1 suppressor mutants is the ssi (suppressor of SA insensitivity) group, which exhibit constitutive defense activation. SSI2 encodes a stearoyl-ACP desaturase, and disruption of this gene in ssi2 results in a ten-fold increase in 18:0 fatty acid content, suggesting involvement of a fatty acid signal molecule in plant immunity (Kachroo et al., 2001). A mutation in an R gene was responsible for the phenotypes of ssi4, which may be due to constitutive R protein

PAGE 30

30 activation (Shirano et al., 2002). Ac tivation of another R protein in snc1 (suppressor of npr1 constitutive 1) resulted in constitutive PR expression and pathogen resistance in npr1 (Zhang et al., 2003a). A screen for suppressors of snc1 led to the identification of several genes that were shown to be essential for plant immunity (Zhang and Li, 2005) (Zhang et al., 2005). The sni1 mutation, mentioned above, restored inducible PR expression and SAR to npr1 and selectively de-repressed NPR1-dependent genes (Li et al., 1999). The sni1 phenotypes were rescued by di sruption of Rad51d, a protein involved in homologous recombination (Durrant et al., 2007). These studies highlight the utility of suppressor screens in understanding t he function of the suppressed mutant gene as well as in identifying new components of plant immunity. Identification and Charact erization of Three Novel npr1 Suppressor Mutants Although the transcriptiona l co-activator activity of NPR1 has been studied extensively, its role in regulating SA accumulation and SA tolerance is not well understood. To identify genes involved in SA to lerance and SA accumulation, this study screened for mutations that suppressed SA toxicity and SA hyperaccumulation in npr1 Thirteen unique suppressor mutants were isol ated, and the affected genes in three of these mutants were identified. One muta tion was found in the transcription factor ANAC1, which is induced during pathogen infection. Two mutants carried mutations in subunits 2 and 3 of the Elongator complex, which functions in histone acetylation, tubulin acetylation, and tRNA synthesis. ELP2 and ELP3 were found to regulate pathogen resistance independently of NPR1. The elp2 mutants were characterized in detail, and ELP2 was found to function both upstream and downstream of SA by regulating the kinetics of def ense gene expression. This study establishes Elongator as

PAGE 31

31 an essential component of plant immunity. The mutant and transgenic plants characterized in this study will facilitate t he dissection of Elongators immune function. A greater understanding of plant immunity will aid in devising strategies for the management of plant disease and the rational design of disease-resistant crops.

PAGE 32

32 CHAPTER 2 MATERIALS AND METHODS Mutant Screen and Genetic Analysis Ethylmethylsulfonate (EMS) mutagenesis was carried out as described previously (Weigel and Glazebrook, 2002). Approximately 250,000 M2 seeds were surface sterilized, plated on strength Mu rashige and Skoog (MS) [Murashige, 1962 #31] medium supplemented with 0.5 mM SA at a density of ~150 seeds/10 cm plate, and vernalized for three days. Seeds were then germinated with 16 hr light/8 hr dark cycles at 25 C. 10-day-old seedlings with green cotyledons were transferred to strength MS medium without SA, grown fo r one week, and subsequently transplanted into soil. M3 seeds were tested for SAtolerance by germinating seeds on MS supplemented with 0.26 mM SA and visually scoring cotyledon color. The Mendelian inheritance of each mutant was det ermined by crossing to its parent, npr1 and scoring the F1, F2, and F3 progeny for SA-tolerance and morphology. Only seeds that germinated were scored. Prior to further characterization, mutants were backcrossed three times. Growth Conditions and Biological Materials Plants were grown in Metromix 200 soil und er 16 hr light/8 hr dark photoperiods at ~25 C. The Arabidopsis wild types used were Arabidopsis thaliana (L.) Heynh. Columbia (Col-0) ecotype and La ndsberg erecta (Ler) ecotype. Escherichia coli XL-1 Blue was grown in LB broth or on LB agar plates with 50 g/ml kanamycin. Psm was grown in Kings B broth or on trypti c soy agar plates supplemented with 50 g/ml streptomycin. The mutant npr1-3 has been described previously (Cao et al., 1997).

PAGE 33

33 Insertion mutant alleles were identified using the SIGnAL T-DNA Express Arabidopsis gene-mapping tool (http://signal.salk.edu/). All SALK lines were distributed by the NASC (http://arabidopsis.info/). All mutants in this study were identified by PCR using genespecific markers as described in Table A-3. Cloning and Transformation For construction of 35S:: ELP2-GFP transgenic plants, the ELP2 cDNA was obtained from the RIKEN BRC and amplified with a 20:1 T aq/Pfu mixture (to ensure replication fidelity) and fu sed to the 5 end of the GFP gene in pRTL2-mGFP (Stacey et al., 1999) under control of the constitutive 35S cauliflower mosaic virus promoter, and transformed into Escherichia coli XL-1 Blue by electroporation and subsequent selection with kanamycin. The plasmid was then transformed into Agrobacterium tumefaciens GV3101 (pMP90), and elp2 and elp2 npr1 plants were transformed using the floral dip method (Clough and Bent, 1998). T1 seeds we re screened on soil by spraying a 1/100 dilution of Finale (Bayer Cropscience). T2 lines containing a single transgene insertion and T3 plants homozygous for the transgene were isolated based on segregation of Finale resistance. Homozygous T3 lines were subjected to western blot analysis to determine transgene expression. One line from each mutant background that displayed wild type morphology and expressed the tr ansgene was selected for analysis of elp2 phenotypes and ELP2-GFP subcellular localization. Map-Based Cloning For rough mapping, genom ic DNA from ~100 F2 homozygous plants was extracted by the CTAB method [Jander, 2002 #6536] and chloroform extraction and subjected to bulked segregant analysis using a collection of 22 simple sequence length

PAGE 34

34 polymorphism (SSLP) marker s (Table A-1) spaced roughly evenly over the entire genome (Lukowitz et al., 2000) Fine mapping was carried out with homozygous plants using various markers from The Arabido psis Information Resource (TAIR) (http://arabidopsis.org/servlets/Search?acti on=new_search&type=marker), and markers generated in this study (Table A-2). DNA fr om genes within the mapping interval was amplified from the mutants by PCR, s equenced by Sanger sequencing (Sanger et al., 1977), and compared to the wild type sequence using CodonCode Aligner (CodonCode Corporation). Mutations were confirmed with derived CAPS markers in the original mutant plants and in 100 independent F2 plants from the mapping populations. Assessment of Pathogen Growth For analysis of basal resistanc e, plants were infected with Psm (OD600 NM = 0.0001) and pathogen titers were determined as previously described (Clarke et al., 1998). For determination of SA-induced resi stance, plants were soil-drenched with water or 1 mM SA solution 24 hour s prior to infection with Psm (OD600 NM = 0.001). For SAR evaluation, three lower leaves were infected with Psm (OD600 NM = 0.002) or 10 mM MgCl2 two days prior to secondary infect ion of two upper leaves with the Psm (OD600 NM = 0.001), which were then assa yed for pathogen growth. For determination of ETI, leaves were infected with Pst DC3000 carrying avrRpt2 gene (OD600 NM = 0.0001). Analysis of Gene Transcripts RNA extraction and RNA gel blot anal ysis were carried out as described previously ( Cao et al., 1994). 150 mg leaf ti ssue was ground to a fine powder in liquid nitrogen and extracted with warm phenol and RAPD buffer (100mM LiCl, 100mM Tris

PAGE 35

35 pH 8.0, 10mM EDTA, 1% SDS). The aqueous phase was extracted with chloroform, and the resulting aqueous phase ethanol-precipitated at -80 C overnight. RNA was pelleted by centrifugation and washed onc e with 70% ethanol, dried at room temperature, and resuspended in 40 l DEPC-treated ddH2O. For RNA Blot analysis, 10 g RNA was subjected to eletrophoresis on a formaldehyde-agarose gel, washed fi ve times in five volumes ddH2O, and transferred to a nylon membrane by vacuum transfer. Radioactive probes were synthesized by asymmetric PCR using P32-labeled dCTP and isolated DNA fragments. Primers used to make probes are listed in Tabl e A-4. Prehybridizat ion and hybridization were performed at 55 C overnight in 0.5 M Na2HP04, pH 7.2, 7% SDS, and 10 mg/mL BSA (Church and Gilbert, 1984). The blot was washed twice at 65 C for 20 min with 2x SSC (0.3 M NaCI, 0.03 M sodium citrate) and 1% SDS. The blots were then exposed to x-ray film and the film was then developed. For reverse transcription (RT), total RNA was treated with DNase I (Ambion) at 37C for 30 min. After inactivation of t he DNase, RT was performed using the M-MLV Reverse Transcriptase first-strand synthesis system (Promega) with 5 l of the DNasetreated RNA in a 20 l reaction. The resulting cDNA products were diluted 20-fold with water, and 2.5 l used for quantitative PCR. Quantit ative PCR was performed in an Mx3000P qPCR system (Stratagene). All PCR r eactions were performed in duplicate using the SYBR Green protoc ol (Applied Biosystems) under the following conditions: 94C for 3 min, 40 cycles (94C for 1 min, 56 C for 1 min, 72C for 1 min with a 12.5 l reaction volume and a 1 M primer concentration. The pr imers used are listed in Table

PAGE 36

36 A-4. The resulting Ct and E values were used to calculate the relative mRNA abundance according to the Ct method. The values were normalized to those for the reference gene UBQ5 Specific amplification was confirmed by examining melting curves after the run was completed. Semi-quantitative RT-PCR was carried out as above, except diluted RT products were subjected to 28 cycles of conventiona l PCR and subjected to electrophoresis with primers specific to UBQ5 as an internal control. Psm -treated samples were inoculated with an OD600 NM of 0.001 and leaves were harvested after one day. Analysis of Protein Expression Protein expression was determined by SDS-PAGE and western blot. For determination of protein expression of independent transgenic plant lines, 14-day-old seedlings were ground to a fine powder in liquid nitrogen and extracted in RIPA buffer (150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 50 mM Tris, pH 8.0.and a protease inhibitor cocktail). Pr otein samples were loaded onto a 10% SDS-PAGE gel and transferred to a nitrocellulo se membrane by electroblotting. The blot was probed with a green fluores cent protein monoclonal antibody (1:1000 dilution, Santa Cruz Biotech). The antibody bound proteins were detected by using a horseradish peroxidaseconjugated anti-mous e secondary antibody (1:5000 dilution, Pierce) followed by chemiluminescence. Salicylic Acid Measurement Soil-grown plants (4-weeks old) were infected with Psm (OD600 NM of 0.001) to induce SA accumulation. 100 mg of tissue was harvested, frozen in liquid nitrogen, ground to a fine powder, and sequentially extracted with 90% and 100% methanol.

PAGE 37

37 Samples were split into two tubes, sodium hydroxide was added to a final concentration of 2 mM, and the methanol/water mixture was evaporated to a final volume of ~20 l, and hydrolysis buffer (0.1M sodium acetate bu ffer pH 5.5) was added to a final volume of 250 l. Half the samples were incubated for 1.5 hr at 37C with 10U of -Glucosidase (EC3.2.1.21, from Sigma) for quantif ication of glucose-conjugated SA. 230 l of 10% trichloroacetic acid was added to all the sa mples, followed by centrifugation. The supernatant was extracted with 1 ml of ex traction buffer (50% cyclohexane, 50% ethyl acetate), and the organic phase transferred to a fresh Eppendorf tube containing 50 l hydrolysis buffer, evaporated to a final volume of ~20 l, and stored at -20C. Prior to HPLC analysis, samples were br ought to a final volume of 250 l with hydrolysis buffer and centrifuged through a 0.2 m filter. HPLC analysis of SA was performed with Agilents Chemstation with a reverse phase C18 column. The eluent was 0.2 M sodium acetate buffer pH 5.5 (90%) with methanol (10%) at a ow-rate of 0.8 mL/min. SA was detected by fluorescence at an emissi on wavelength of 412 nm and an excitation wavelength of 301 nm. The retention time for SA was approximately 18 min. This procedure had an ~60% recovery rate, as esti mated by extraction of known amounts of SA. Confocal Microscopy Confocal microscopy of live plant tissue was performed as described previously (Kinkema et al., 2000). Non-transgenic and 35S::ELP2-GFP plants were imaged using identical settings, while 35S::GFP plants were imaged using a lower exposure due to

PAGE 38

38 the high expression of GFP in these plants. Images were processed identically using the ImageJ software (Abramoff et al., 2004). Reproducibility of Experiment s and Statistical Anal ysis All experiments depicted in the Figures we re conducted at least three times with similar results. Statistical analys es were performed using Students t test for comparison of two data sets. A indicates a statistically si gnificant difference at the level of at least 95% confidence. Locus Numbers The locus numbers for the genes discussed in this article are as follows: ELP2 (At1g49540), ELP3 (At5g50320), ANAC1 (At1g01010), NPR1 (AT1G02450), ICS1 (At1g74710), UBIQUITIN (At4g05320), PR-1 (At2g14610), PR-2 (At3g57260), PR-5 (At1g75040.1) GST11 (At1g02920), LURP1 (At2g14560), SAG21 (At4g02380), EDR11 (At1g02930).

PAGE 39

39 CHAPTER 3 ELP2 FUNCTIONS UPSTREAM AND DOWNST REAM OF SALICYLIC ACID IN PLANT IMMUNITY Isolation of snt1 The suppressor screen was designed to isolate mutations that restored SA tolerance to npr1 To screen for suppressors of SA toxicity, npr1 seeds were mutagenized with ethyl-met hanesulfonate (EMS), and M2 seeds were germinated on strength MS medium supplemented with 0.5 mM SA. Seedl ings with green cotyledons were allowed to recover on MS medium for one week, then transferred to soil and allowed to self-fertilize. The SA-toleranc e phenotype was then confirmed in the M3 generation. We identified 13 unique mutants, based on complementation tests and phenotype analysis, which were true breeding for SA-tolerance. One mutant that restored SA tolerance to npr1 was snt1 (for s uppressor of n pr1-mediated SA-t oxicity-1) (Figure 3-1a). Despite their increased disease susceptibility, npr1 plants hyper-accumulate SA during pathogen infection. Since snt1 restored SA tolerance to npr1 plants, it may also suppress SA hyper-accumulation and pathogen su sceptibility. We first determined SA levels in snt1 npr1 after Psm inoculation. The snt1 mutation reduced free and total Psm induced SA accumulation in npr1 (Figure 3-1b). To determine if snt1 restores pathogen resistance, bacterial tite rs were determined after Psm infection of snt1 npr1 plants. Surprisingly, pathogen growth was higher in the snt1 npr1 double mutant than in npr1 plants (Figure 3-1c). These results suggest that although snt1 restores SA tolerance and normal SA accumulation to npr1 the snt1 gene functions in plant immunity at least partially independently of NPR1. The snt1 npr1 plants also exhibited a serrated and

PAGE 40

40 curly leaf phenotype, and were a lighter shade of green than npr1 (Figure 3-1d). These plants also displayed significantly reduc ed seed yield, short siliques, delayed silique senescence, and late flowering (not shown). Genetic Analysis of snt1 When the snt1 npr1 double mutant was backcrossed to the npr1 parent, the F1 progeny were not SA tolerant and had npr1 morphology. Of 139 F2 plants, 39, or roughly one quarter (P > 0.1, Figure 3-2a) had snt1 morphology suggesting snt1 is a single, recessive, nuclear mutation. The snt1 npr1 mutant was backcrossed two more times to remove secondary-site mutations before further char acterization. To determine if snt1 morphology and SA tolerance are caused by the same mutation, co-segregation analysis was carried out in the segregating F3 population. Nearly all of the progeny from parents with snt1 morphology were SA tolerant, while only a fraction of the progeny from npr1 -like plants were SA tolerant (Figure 32a and b). Therefore the suppression of SA-toxicity by snt1 likely also causes abnormal development. Map-based Cloning of snt1 The snt1 mutation was identified using a map-based cloning approach. To map the snt1 locus, we isolated a T-DNA insertion npr1 mutant in the Landsberg erecta background ( npr1-L ), which displayed SA toxicity similar to npr1 (Figure A-1). The snt1 npr1 double mutant was crossed to npr1-L to generate an F2 segregating population. This allowed rapid confirmation of elp2 homozygosity in F2 plants by analysis of SAtolerance in the F3 progeny. For rough mapping, ninety five plants homozygous for snt1 were identified on the basis of morphology. The snt1 allele was linked to the markers CIW1 and NGA280 on the lower arm of chromosome 1 (Figure 3-3a). Further three-

PAGE 41

41 point mapping of snt1 was carried out using a mappi ng population of 1198 homozygous snt1 plants using various CAPS markers, and t he mapping interval was narrowed to a region between markers CTD1 and CTD3. To identify the molecular lesion in snt1 the eleven open reading frames between these markers were amplified and sequenced in snt1 npr1 and compared to the wild type genome sequence. One G A transition, which formed a new stop codon, was found in t he sixth exon of At1g49540, which was confirmed using a derived CAPS marker [N eff, 2002 #6677] specific for the wild type allele (Figure 3-3b). This gene encodes the ELP2 protein, the 93 kD second subunit of the Elongator complex. ELP2 contains se veral WD-40 domains, which are known to mediate protein-protein intera ctions (Fellows et al., 2000) (Smith et al., 1999) The snt1 mutation is a nonsense mutation halfway thr ough the coding sequence, likely resulting in a truncated and non-functional protein. To confirm that SNT1 is ELP2 we isolated three loss-of -function T-DNA insertion elp2 mutants (Figure 3-3c). These mutants were then crossed with npr1 to obtain elp2 npr1 double mutants. All elp2 npr1 mutants restored SA tolerance and decreased SA accumulation, exacerbated pat hogen susceptibility, and had snt1 -like morphology (Figures 3-3d-g). The snt1 mutation was therefore renamed elp2-1 This data suggests the snt1 mutation destroys ELP2 function, and that ELP2 is essential for SA toxicity, SA hyperaccumulation, and pathogen resistance. ELP2 Functions in Defense Gene Expression and Pathogen Resistance The Elongator complex has been shown to control the expression of stressinduced genes in yeast (Ote ro et al., 1999). ICS1 is t he rate-limiting enzyme in SA

PAGE 42

42 biosynthesis during the immune response and is highly induced by pathogen infection. Since elp2 suppresses hyper-accumulation of SA in npr1 ICS1 expression in the elp2 npr1 mutants was examined. ICS1 expression was significantly lower in the elp2 npr1 double mutant than in npr1 (Figure 3-4a), suggesting ELP2 is essential for ICS1 overexpression and SA hyper-accumulation in npr1 Induction of PR gene transcription also occurs during pathogen infection, and is partially dependent on NPR1 (S hah, 2003). To determine the contribution of ELP2 to PR expression in npr1 expression of these genes was examined in elp2 npr1 plants during Psm infection. Compared to npr1 expression of PR-2 PR-5 and to a lesser extent PR-1 was delayed and reduced (Figure 3-4b) This data, together with the observation that elp2 npr1 plants are more susceptible than npr1 plants, suggests ELP2 controls an additional layer of defense activa tion on top of the defenses controlled by NPR1. Since ELP2 acts independently of NPR1 ELP2 may be essential for pathogen resistance when NPR1 is present. To determine the function of ELP2 in wild type plants, the elp2 npr1 mutant was crossed to wild type, and elp2 single mutants were isolated in the segregating F2 population by CAPS marker genotyping. The elp2 single mutant was morphologically indi stinguishable from elp2 npr1 The elp2 mutant exhibited less ICS1 expression and SA accumulation than wild type (Figures 3-5a and 3-5b). These differences were modest, but statistically significant and reproducible. Plants lacking ELP2 also had delayed and reduced PR expr ession compared to wild type (Figure 35c). Interestingly, PR-1 expression was delayed in elp2 plants, but eventually reached

PAGE 43

43 wild type levels. Pathogen resistance was also compromised in elp2 plants (Figure 35d). Pathogen titers in elp2 plants were typically 20-50-fold higher than in wild type, and elp2 leaves were more chlorotic than those of wild type (not shown). These results show that ELP2 is essential for defens e gene expression and pathogen resistance. ELP2 is Essential for Salic y lic Acid-Induced Immunity Pathogen susceptibility in the elp2 mutants may result from decreased SA accumulation, which in turn causes a reduction in SA-dependent gene expression. However, SA biosynthesis in elp2 plants was only moderatel y less than in wild type (Figure 3-5b). It seemed unlikely that th is moderate decrease in SA levels was responsible for the ma rked susceptibility of elp2 Therefore, the pos sibility that ELP2 regulates immune responses downstream of SA was explor ed by examining SAinducible resistance in elp2 plants. Exog enous SA provided elp2 plants with less protection than wild type against Psm infection (Figure 3-6A). Additionally, SA-inducible expression of PR-2 and PR-5 was decreased in elp2 plants (Figure 3-6B). These data suggest ELP2 acts downstream of SA as a positive regulator of defense responses. ELP2-independent SA-inducible resistance was al so observed in the form of partial SAinducible pathogen resistance and normal PR-1 and residual PR-2 and PR-5 expression. Initiation of Systemic Acquired Resistance Restores Pathogen Resistance to elp2 In order to explore the role of ELP2 in SAR, immune responses were preactivated by SAR inducement before a second infection with Psm The SAR-induced decrease in pathogen growth was similar in elp2 and wild type plants, though pathogen growth in SAR-induced elp2 plants was still somewhat greater than in wild type (Figure

PAGE 44

44 3-7a). In the npr1 negative control, high levels of pathogen growth were seen in both the mock-treated and SAR-induced plants. These results suggest ELP2, unlike NPR1, is not essential for SAR, and that SAR induction can partially rescue the susceptibility of elp2 plants. SAR-induced gene expression was then examined in elp2 plants. Of the six SAR-induced genes tested, three required ELP2 for their full expression, while all required NPR1. PR-1 and PR-2 were strongly NPR1-dependen t, while the other genes were partially expressed in the absence of NPR1. Expression of all six genes was higher in elp2 plants than in npr1 plants. These results suggest SAR-induced gene expression in elp2 plants is sufficient to limit pathogen growth, while in npr1 this is not the case. Notably, the more highly ex pressed genes were ELP2-dependent, while genes expressed at lower leve ls were not (Figure 3-7b). ELP2 is Essential for E ffector-Triggered Resistance ETI is considered a faster, stronger version of SAR and PTI. Since immune responses involving rapid transcriptional changes are deficient in elp2 the fastest and strongest immune response, ETI, may also be affected. Indeed, plants lacking ELP2 were susceptible to a low-dose infection of the avirulent pathogen Pst DC3000 avrRpt2 (Figure 3-8a). The npr1 plants were also susceptible. Removal of both NPR1 and ELP2 resulted in the complete elimination of ETI, suggesting NPR1 and ELP2 act synergistically in ETI. The fact that ELP2 is essential for basal resistance and ETI but not SAR may reflect the need for timely defense gene expression in locally infected naive tissues. If elp2 plants are allowed sufficient time following SAR activation, defense gene expression and pathogen resistance are comparable to wild type, suggesting delayed induction of defense genes may c ontribute to compromised immunity in elp2

PAGE 45

45 plants. To test this hypothesis, the expressi on profiles of several def ense genes that are strongly induced early in infection were examined in elp2 plants following infection with the ETI-inducing pathogen Pst DC3000 avrRpt2. PR-1 expression was monitored as a marker for late def ense gene induction. The npr1 and elp2 npr1 plants were also included to determine the specific contribut ions of NPR1 and ELP2 to early defense gene induction. Expression of these early defense genes in wild type plants peaked at 4-8 hpi, then rapidly decreased, suggesting a tight control of induction and suppression (Figure 3-8b). Induction of all genes except for WRKY18 was delayed in elp2 plants, but in some cases eventually reached levels simila r to wild type. This delay also occurred in the absence of NPR1. In contrast, gene induction in npr1 plants was generally not delayed, but expression failed to reach wild type levels for some genes. At5g47230 was completely ELP2-dependent, and also showed the narrowest expr ession window, with expression returning to basal levels by 8 hpi. Surprisingly, def ense gene expression in elp2 npr1 plants remained high long after repr ession had occurred in wild type, elp2 and npr1 plants, suggesting ELP2 and NPR1 act redundantly to repress gene expression at the appropriate time. Subcellular Localization of the ELP2 Protein To determine the subcellula r localization of ELP2, the ELP2 coding sequence was cloned downstream of the co nstitutive 35S promoter from cauliflower mosaic virus, and C-terminally tagged with gr een fluorescent protein. This construct was introduced into both elp2-1 and elp2-1 npr1 plants, and homozygous, single insertion transgenic plants that expresse d the ELP2-GFP protein were isolated (Figure 3-9a). The 35S::ELP2-GFP transgene complemented SA-induced PR expression and pathogen

PAGE 46

46 susceptibility phenotypes of elp2 (Figures 3-9b and 3-9c) The transgene also restored the SA toxicity, ICS1 overexpression, and SA hyper-accumulation phenotypes to elp2 npr1 plants (Figures 3-9d-f). The transgene also restored normal morphology to elp2 and elp2 npr1 plants (Figure 3-9g). These resu lts suggest that ELP2-GFP can complement elp2 phenotypes and is therefore a functional protein. ELP2-GFP was localized to the cytosol in epidermal cells, guard cells, and root tip cells (Figure 3-10a and 3-10b). The absen ce of NPR1 or tr eatment with the SA analog INA failed to visibly alter ELP2-GFP localization (Appendi x Figure A-2). These results suggest ELP2 is localized primarily to the cytosol of plant cells.

PAGE 47

47 A snt1 npr1 Figure 3-1. The snt1 mutation suppresses SA toxicity and over-accumulation in npr1. (A) SA-tolerance of snt1 npr1 Plants were grown on 1/2 MS medium containing 0.26 mM SA, and photographed 11 days after germination. (B) Accumulation of SA and SA + SAG in snt1 npr1. Leaves were infiltrated with Psm (OD600 NM = 0.001). SA levels were determined 24 hours after treatment. Values represent the average of three independent samples ( SD). (C) Morphology of the snt1 npr1 mutants. Plants were grown under longday conditions at 25 C and photographed 28 days after germination. (D) Growth of Psm in snt1 npr1 plants. Leaves of 4-week-old plants were pressure-infiltrated with a bacterial suspension of OD600 NM = 0.0001 and bacterial numbers determined at 0 and 3 da ys after inoculation (dpi). Values represent the mean of 4-10 samples ( SD).

PAGE 48

48 B* *Figure 3-1. Continued

PAGE 49

49 C *D Figure 3-1. Continued

PAGE 50

50 A Generation Narrow leaves Normal leaves F1 snt1 x npr1 0 10 F1 snt1 x npr1 0 10 F2 snt1 x npr1 39 139 F2 Morphology SA-tolerant SA toxic snt1 98.84 3.69% 1.15 3.69% npr1 16.31 10.74%83.69 10.74% B Figure 3-2. Genetic analysis of snt1 (A) Segregation of snt1 morph ology. (B) Cosegregation of snt1 morphology and SA tolerance.

PAGE 51

51 A BFigure 3-3. Disruption of ELP2 confers snt1 phenotypes. (A) Map-based cloning of snt1 Ninety-five F2 progeny homozygous for snt1 were used to determine the approximate position of the snt1 mutation using bulked segregant analysis. snt1 was linked to the markers CIW1 and NGA280. Out of a total mapping population of 1198 plants homozygous for snt1 16 were heterozygous at BEDSSLP1 and 2 were heterozygous at CIW1. Plants that were heterozygotes at these two markers we re mutually exclusive. Therefore snt1 is flanked by these two markers. Of the CIW1 heterozygotes, one was heterozygous at CTD1. Of the BEDSSLP1 heterozygotes, one was heterozygous at CTD2. No heterozygot es were found at CTD3. Molecular markers used in this study are presented in Table A-2. (B) DNA polymorphism between snt1 and wild type plants. Non-complementary primers were used to introduce a new BslI site unique to wild type. The DNA fragments flanking the BslI site were amplified from the wild type and snt1 plants, digested with BslI, and separat ed on an agarose gel. (C) Structure of the SNT1/ELP2 gene (At1g49540), the snt1 mutation, and the insertion sites of three T-DNA insertion mutants. Boxes denote the coding sequence, and lines between denote introns. (D) SA-tolerance of elp2 npr1 knockout mutants. Seedlings were grown on media supplemented with 0.26 mM SA and photographed after 10 days. (E) Accu mulation of SA and SA + SAG in independent elp2 npr1 mutants. Leaves were infiltrated with Psm (OD600 NM = 0.001). SA levels were determined 24 hours after inoculation. Values represent the average of three independent samples ( SD). (F) Growth of Psm in independent elp2 npr1 mutants. Leaves of 4-week-old plants were pressure-infiltrated with a bacterial suspension of OD600 NM = 0.0001 and bacterial numbers determined at 0 and 3 da ys after inoculation (dpi). Values represent the mean of 4-10 samples ( SD). (G) Morpho logy of independent snt1 npr1 mutants. Plants were grown under long-day conditions at 25 C and photographed 28 days after germination.

PAGE 52

52 C D Figure 3-3. Continued

PAGE 53

53 E* *Figure 3-3. Continued

PAGE 54

54 F *G Figure 3-3. Continued

PAGE 55

55 A B elp2-2 npr1 Figure 3-4. ELP2 regulates ICS1 and PR expression. (A) ICS1 expression in elp2 npr1 plants. Leaves were infiltrated with Psm (OD600 NM = 0.001). Relative transcript levels were determined 24 hr after treatment by quantitative realtime PCR as described in Methods. Expression levels were normalized with respect to the internal control UBQ5 Expression levels are displayed relative to untreated samples. Values repr esent the average value from three independent samples ( SD). (B) PR expression in elp2 npr1 plants. Leaves were infiltrated with Psm (OD600 NM = 0.001). Transcript levels were determined by RNA blot analysis. T he 25s rRNA band in the ethidium bromide-stained gel was photographed as a loading control before transferring to a nitroce llulose membrane. Blots were sequentially probed for the indicated genes.

PAGE 56

56 A *Figure 3-5. Characterization of elp2 single mutants. (A) Growth of Psm in elp2 plants. Leaves of 4-week-old plants were pr essure-infiltrated with a bacterial suspension of OD600 NM = 0.0001 and bacterial numbers determined at 0 and 3 days post inoculation ( dpi). Values represent the mean of 4-10 samples ( SD). (B) PR expression in Psm -infected elp2 plants. Transcript levels were determined by RNA blot analysis. T he 25s rRNA band in the ethidium bromide-stained gel was photographed as a loading control before transferring to a nitroce llulose membrane. Blots we re sequentially probed for the indicated genes. (C) Accumulation of free and total SA in elp2 plants. Leaves were infiltrated with Psm (OD600 NM = 0.001). SA levels were determined 24 hr after treatment. Valu es represent the average of three independent samples ( SD). (D) ICS1 expression in elp2 plants. Leaves were infiltrated with Psm (OD600 NM = 0.001). Relati ve transcript levels were determined 24 hr after treatment by quantitative real-time PCR as described in Methods. Expression levels were normalized with respect to the internal control UBQ5 Expression levels are displayed relative to untreated samples. Values represent the average value from three independent samples ( SD).

PAGE 57

57 B *Figure 3-5. Continued

PAGE 58

58 C D Figure 3-5. Continued

PAGE 59

59 A **Figure 3-6. ELP2 is essential for full-scale SA-induced resistance (A) SA-induced resistance of elp2 plants. Plants were treated with H2O or 1 mM SA 24 hr prior to Psm infection (OD600 NM = 0. 001), and bacterial numbers determined at 0 and 3 dpi. Values r epresent the mean of 4-10 samples ( SD). (B) SA-induced PR expression in elp2 plants. PR expression in Psm infected elp2 plants. Transcript levels were determined by RNA blot analysis. The 25s rRNA band in the ethidium bromide-stained gel was photographed as a loading control before transferring to a nitrocellulose membrane. Blots were sequentially probed for the indicated genes.

PAGE 60

60 B Figure 3-6. Continued

PAGE 61

61 A Figure 3-7. Systemic acquired resistance in el p2 plants. (A) Three lower leaves of 4week-old plants were pressure-infilt rated with a bacterial suspension of Psm (OD600 NM = 0.001). Two days later, tw o upper leaves were inoculated with the same dose of Psm and bacterial growth was determined. Values represent mean with standard deviation. (B) Expression of SAR-inducible genes was determined by qRT-PCR fo llowing infection two days after infection. Values represent the m ean of three independent samples with standard deviation.

PAGE 62

B 62 Figure 7. Continued

PAGE 63

63 A ** Figure 3-8. Effector-triggered resistance in elp2 plants. (A) Plants were inoculated with Pst DC3000 avrRpt2 (OD600 NM = 0.0001) and bacterial growth was determined after three days. (B) E xpr ession of early-response genes defense genes was determined by qRTPCR following infection with Pst DC3000 avrRpt2 (OD600 NM = 0.001). Gene expression was normalized to UBQ5 expression. Values represent the m ean of three independent samples with standard deviation.

PAGE 64

64 B Figure 3-8. Continued

PAGE 65

65 A B Figure 3-9. ELP2-GFP is a f unctional protein in planta. (A) ELP2-GFP expression in elp2 and elp2 npr1 lines. (B) Complementation of SA-induced PR expression in elp2 (C) Complementation of Psm resistance in elp2 (D) Complementation of SA tolerance in elp2 npr1 (E) Complementation of free and total SA hyper-accumulation in elp2 npr1 (F) Complementation of ICS1 overexpression in elp2 npr1 (G) Complementatio n of morphology in elp2 and elp2 npr1 (G) Protein expression of ELP2-GFP in elp2 and elp2 npr1 plants. Total protein was analyzed by western blot as described in Methods.

PAGE 66

66 C D Figure 3-9. Continued

PAGE 67

67 E *Figure 3-9. Continued

PAGE 68

68 F G Figure 3-9. Continued

PAGE 69

69 A B Figure 3-10. Subcellular localizat ion of the E LP2 protein. (A ) All three rows of images show, from left to right, GFP fluor escence, autofluorescence from chloroplasts, DIC images, and the over lay of all three channels. (B) GFP fluorescence from 5-day old root tips.

PAGE 70

70 CHAPTER 4 ELP3 IS A POSITIVE REGULAT OR OF PLANT IMMUNITY Isolation and Genetic Analysis of snt3 Another mutation that restored SA tolerance in npr1 was snt3 (Figure 4-1a). To determine the effect of snt3 on the enhanced pathogen susce ptibility phenotype of npr1 we infected snt3 npr1 plants with Psm and examined pathogen growth. Psm growth was ~3-fold greater in snt3 npr1 compared to npr1 (Figure 3-1b). These data suggest snt3 confers SA tolerance to npr1 and functions in plant immunity at least partially independently of NPR1. snt3 npr1 plants also exhibited wide leaves and a lighter green coloration (Figure 3-1c). To determine the heritability of snt3 snt3 npr1 was backcrossed to npr1 and progeny were observed. F1 progeny resembled npr1 suggesting snt3 is recessive or haplo-insufficient. Out of 72 F2 plants, 22 or roughly one quar ter (P > 0.1, Figure 4-2a) resembled snt3 npr1 further suggesting a recessive or haplo-insufficient mutation. To determine the co-segregation of the SA tolerant and snt3 morphology, progeny from F2 plants with either npr1 or snt3 morphology were examined. Progeny from snt3 -like parents were nearly all SA-tolerant, while only a fraction of the progeny from npr1like plants were SA tolerant (Figure 4-2b), suggesting SA-tolerance and snt3 morphology co-segregate in snt3 and are caused by the same mutation or two closely-linked mutations. Map-Based Cloning of snt3 For rough mapping, 100 plants homozygous for snt3 were identified on the basis of morphology. The snt3 mutation was linked to the markers CIW9 and CIW10 on the

PAGE 71

71 lower arm of chromosome 5. Further three-point mapping of snt3 was carried out using various CAPS and SSLP markers (Table A-2) and the mapping interval was narrowed to the interval between markers at the loci At5g50180 and At 5g50360 (Figure 4-3a). One gene within this interval was ELP3 (At1g50320), which encodes the catalytic third subunit of the HAT Elo ngator complex. Since snt1/elp2 phenotypically resembled snt2 and since ELP2 and ELP3 function in the same protein complex, SNT3 may be ELP3 The ELP3 coding region was ther efore amplified from snt3 npr1 and sequenced. A deletion of a cytosine was det ected in the first exon of ELP3 resulting in frameshift and likely resulting in a non-f unctional protein (Figure 4-3c ). This polymorphism was confirmed using a derived CAPS marker in the snt3 mutant (Figure 4-3b) and in 100 homozygous snt3 plants in the mapping p opulation (not shown). To determine if a loss of ELP3 function caused the snt3 phenotypes, we examined a second allele of ELP3 elo3-1, which was previously generated in the Ler background. elo3-1 npr1-L plants were more SA tolerant than npr1-L and morphologically resembled snt3 (not shown). Taken together, this data suggests the loss of ELP3 function is responsible for the phenotypes seen in snt3 npr1 and that SNT3 is ELP3 Characterization of sn t3 Single Mutants To determine the function of ELP3 in pathogen resistance, growth of Psm was measured in the elp3-1 and elp3-2 single mutants. The elp3-2 mutant is another elp3 allele generated in the Wassilewskija ecotype. Both of these mutants were significantly more susceptible than their respective wild types (Figures 4-3a and 4-4b), suggesting ELP3 plays an essential role in plant immune responses.

PAGE 72

72 A Col-0 npr1 snt3 npr1 B *Figure 4-1. snt3 suppresses SA toxicity and over-accumulation in npr1 (A) SAtolerance of snt3 npr1 Plants were grown on 1/2 MS medium containing 0.26 mM SA, and photographed 11 days after germi nation. (B) Morphology of the snt3 npr1 mutants. Plants were grown under long-day conditions at 25 C and photographed 28 days after germi nation. (C) Growth of Psm in snt3 npr1 plants. Leaves of 4-week-old plants we re pressure-infiltrated with a bacterial suspension of OD600 NM = 0.0001 and bacterial numbers determined at 0 and 3 days after inoculation (dpi). Val ues represent the mean of 4-10 samples ( SD).

PAGE 73

73 C npr1 snt3 npr1 Figure 4-1. Continued A F2 Morphology SA-tolerant SA toxic snt3 92.2 9.4% 7.7 9.5% npr1 16.31 10.7483.6 10.7 Generation Wide leaves Normal leaves F1 snt3 x npr1-3 0 10 F1 snt3 x npr1-3 0 10 F2 snt3 x npr1-3 22 50 B Figure 4-2. Genetic analysis of the snt3 mutation. (A) P henotypes of the progeny from backcrossed snt3 npr1 plants. (B) Phenotypes of F3 progeny from F2 plants scored in (A) with either snt3 or npr1 (wild type) morphology.

PAGE 74

74 A BFigure 4-3. Identif ication of the snt3 mutation. (A) Map-based cloning of snt3 100 F2 progeny homozygous for snt3 were used to determine the approximate position of the snt3 mutation using bulked segregant analysis. snt3 was closely linked to the markers CIW9 and CIW10. Out of a total mapping population of 1352 plants homozygous for snt3 72 were heterozygous or Ler at the marker At5g47570, and 180 were het erozygous or Ler at the marker PCD2. The recombinants found by these two markers were mostly mutually exclusive. Markers At5g50000, At 5g50120, and At5g50180 had 4, 3, and 2 heterozygotes respectively. Markers At5g50360, At5g50390, At5g50460, At5g50770, and At5g51130 had 1, 2, 5, 12, and 25 heterozygotes respectively. No crossover was observed between these two groups of markers. (B) DNA polymorphism between snt3 and wild type plants. Noncomplementary primers were used to introduce a new MwoI site unique to wild type. The DNA fragments flanking the MwoI site were amplified from the wild type and snt3 plants, digested with MwoI, and separated on an agarose gel. (C) Structure of the ELP3 gene (At5g50320), the snt3 elo3 and elp3-2 mutations. Boxes denote the coding s equence, and lines between denote introns. Col-0 snt3

PAGE 75

75 C elp3-1 elp3-2 Figure 4-3. Continued

PAGE 76

76 *Figure 4-4. Growth of Psm in elp3-1 and elo3-2 single mutants. (A) Psm growth in elp3 (B) Psm growth in elo-2. Leaves of 4-week-o ld plants were pressure-infiltrated with a bacterial suspension of OD600 NM = 0.0001 and bacterial numbers determined at 0 and 3 days after inoculat ion (dpi). Values represent the mean of 4-10 samples ( SD).

PAGE 77

77 CHAPTER 5 THE ROLE OF ANAC1 IN PLANT IMMUNITY Isolation and Genetic Analysis of snt2 A third mutation that restored SA tolerance in npr1 was snt2 (Figure 5-1a). snt2 npr1 plants also displayed reduced size and yellowing around the shoot apical meristem (Figure 5-1b). To determine if snt2 suppresses the enhanced pathogen susceptibility phenotype of npr1 we infected snt2 npr1 plants with Psm and examined pathogen growth. Psm growth was reduced by ~8-fold in snt2 npr1 compared to npr1 (Figure 51c). These results suggest snt2 confers pathogen resistance and SA tolerance to npr1 npr1 lacks SAR as well as local resistanc e. We tested the SAR response in snt2 npr1 but observed no significant decrease in pathogen growth compared to snt2 npr1 plants that received a mock primary infection. The same was true for npr1 whereas SAR was induced in the wild type. Therefore snt2 does not restore SAR to npr1 To determine the heritability of the yellowing phenotype we carried out genetic analysis by backcrossing snt2 npr1 to its parent, npr1 and observing the progeny. F1 progeny from reciprocal crosses resembled npr1 suggesting snt2 is recessive or haplo-insufficient. Out of 192 F2 plants, 64 resembled snt2 npr1 (Figure 5-1a), further suggesting an snt2 is possibly a recessive or haplo-insufficient allele (P < 0.1). To determine the co-segregation of the SA tolerant and yellowing phenotypes of snt2 we examined progeny from F2 plants with either npr1 or snt2 morphology. The snt2 progeny were nearly all SA-tolerant, while only a fraction of the progeny from npr1like plants were SA tolerant (Figure 5-1b), suggesting SA-tolerance and yellowing co -segregate and are caused by the same mutation or two closely-linked mutations.

PAGE 78

78 Map-Based Cloning of snt2 To map the snt2 locus, snt2 npr1 was crossed to npr1-L to generate an F2 segregating population. For rough mapping, 198 plants homozygous for snt2 were identified on the basis of morphology. The snt2 mutation was linked to the marker F12M12 on chromosome 1. Furt her three-point mapping of snt2 was carried out using the original 198 plants using various CAPS markers (Table A-2), and the mapping interval was narrowed to the telomeric si de of At1g01050 (Figure 52a). The progeny of the plants heterozygous at this mark er were all SA-tolerant, confirming snt2 homozygosity (not shown). The genes in th is region were then amplified from snt2 npr1 and sequenced. A transition point mutation was found in the first intron of At1g01010 (Figure 5-2c). This gene encodes a putat ive NAC (no apical meristem domain containing) transcription factor (ANAC1). This polymorphi sm was confirmed using a derived CAPS marker (F igure 3-2b) in the snt2 mutant and in 100 homozygous snt2 plants in the mapping population (not shown). Interestingly, intron 1 lacks a consensus branch-point sequence (Figure 5-3d). The snt2 mutation introduces such a sequence thirty-six bases upstream of the 3 splice site. To test the notion that snt2 phenotypes result from a loss of ANAC1 function, two lines containing T-DNA insertions in ANAC1 were isolated and crossed into an npr1 background. The double mutants did not exhibit SA tolerance, nor did they have any detectable morphological phenot ype (not shown), though ANAC1 mRNA levels were undetectable (Figure 3-3e). This data suggests that snt2 may be a gain-of-function mutation.

PAGE 79

79 Since snt2 is located in an intron, it may affect splicing of ANAC1 To test this, ANAC1 cDNA from snt2 was amplified by RT-PCR. T he single amplicon obtained was the same size as that from wild type. The cDNA was then sequenced and compared to the wild type cDNA sequence. The two sequences were 100% identical (not shown). This data suggests snt2 does not affect t he structure of the ANAC1 transcript. ANAC1 mRNA levels in snt2 were then tested using semi-quantitative RT-PCR. In snt2, ANAC1 transcript levels were higher than in npr1 suggesting snt2 may somehow increase the expression of this gene. This overex pression might be responsible for snt2 phenotypes. If snt2 overexpression were responsible for pathogen resistance in snt2 then this gene would be expected to be induced by pathogen infection. Indeed, ANAC1 expression is increased during pathogen infe ction (Figure 5-3e). Characterization of ANAC1 single mutants To determine the function of ANAC1 in pathogen resistance, we infected both anac1 T-DNA insertion mutants and the snt2 single mutant with Psm and measured pathogen growth. The snt2 single mutant, but neither kno ckout mutant, was significantly more resistant than wild type. This suggests that the snt2 mutation confers pathogen resistance, and acts independently of NPR1. The lack of detectable phenotypes in the knockout mutants suggests ANAC1 is not essential for resistance to Psm but that overexpression of ANAC1 may be sufficient to confer resistance.

PAGE 80

80 A Col-0 npr1 snt2 npr1 B Figure 5-1. The snt2 mutation suppresses SA toxicity and over-accumulation in npr1 (A) SA-tolerance of snt2 npr1 Plants were grown on 1/2 MS medium containing 0.26 mM SA, and photographed 10 days after germination. (B) Morphology of the snt2 npr1 mutants. Plants were grown under long-day conditions at 25 C and photographed 28 days after germination. (C) Growth of Psm in snt2 npr1 plants. Leaves of 4-week-old plants were pressureinfiltrated with a bacterial suspen sion of OD600 NM = 0.0001 and bacterial numbers determined at 0 and 3 days after i noculation (dpi). Values represent the mean of 4-10 samples ( SD). (D) Systemic acquired resistance of snt2 npr1 plants. Three lower leaves of 4-week-old plants were pressure-infiltrated with a bacterial suspension of OD600 NM = 0.002. Two days later, two upper leaves were inoculated (OD600 NM = 0.001) and bacterial growth was determined as in (C).

PAGE 81

81 C D Psm Psm Figure 5-1. Continued

PAGE 82

82 A Generation Yellowing Normal F1 snt2 x npr1-3 0 10 F1 snt2 x npr1-3 0 10 F2 snt2 x npr1-3 64 134 B F2 Morphology SA-tolerant SA toxic snt2 96.6 4.8% 3.8 5.7% npr1 16.31 10.7483.6 10.7 Figure 5-2. Genetic analysis of the snt2 mutation. (A) P henotypes of the progeny from backcrossed snt2 npr1 plants. (B) Phenotypes of F3 progeny from F2 plants scored in (A) with either snt2 or npr1 morphology.

PAGE 83

83 A B Col-0 snt 2 C ( anac1-2) ( anac1-1) Figure 5-3. Identif ication of the snt2 mutation. (A) Map-based cloning of snt2 198 F2 progeny homozygous for snt2 were used to determine the approximate position of the snt2 mutation using bulked segregant analysis. snt2 was closely linked to the marker F12M12. Out of a mapping population of the same 198 plants homozygous for snt2 11 were heterozygous at At1g01290, 10 were heterozygous at At1g01260, and one was heterozygous at At1g01050. Therefore snt2 is on the telomeric side of these markers. (B) DNA polymorphism between snt2 and wild type plants. Non-complementary primers were used to introduce a new DdeI site unique to wild type. The DNA fragments flanking the DdeI site were amplified from the wild type and snt2 plants, digested with DdeI, and separated on an agarose gel. (C) Structure of the ANAC1 gene (At1g01010), the snt2 mutation, and the insertion sites of two T-DNA insertion mutants. Boxes de note the coding sequence, and lines between denote introns. (D) Possible br anch-points in intron 1 of At1g01010. Bases in bold indicate possible branch points, with the branch-point consensus sequence for Arabidopsis shown above the sequence. The snt2 mutation is shown in red. (E) Expr ession of At1g01010. Gene expression was analyzed by semi-quantitative RT-P CR as described in Methods.

PAGE 84

84 D E Figure 5-3. Continued

PAGE 85

85 *Figure 5-4. Growth of Psm in snt2, anac1-1, and anac1-2 single mutants. Leaves of 4week-old plants were pressure-infilt rated with a bacterial suspension of OD600 NM = 0.0001 and bacterial number s determined at 0 and 3 days post inoculation (dpi). Values repr esent the mean of 4-10 samples ( SD).

PAGE 86

86 CHAPTER 6 DISCUSSION The isolation of two Elongator mutants with deficient immune responses from the same genetic screen strongly supports the noti on that this protein complex plays an important role in plant imm unity. Although efforts within the last decade have revealed diverse functions for Elongator, how Elongator accomplishes these functions is only beginning to be understood. Functions of Elongator Elongator and Transcription Elongator was first identified as an inte ractor of hyperphosphor ylated (elongating) RNA Polymerase II (RNAPII) in yeast, and subsequently co-pur ified with RNAPII in mammalian cells. Elongator is comprised of si x subunits. Holo-Elongator is a relatively unstable six-subunit comple x composed of two subcom plexes: core-Elongator, comprised of Elp1, Elp2, and Elp3 (Wittsch ieben et al., 1999) (Otero et al., 1999) (Fellows et al., 2000), and a sm aller three-subunit module co mprised of Elp4, Elp5, and Elp6 (Li et al., 2001b). All six subunits are highly conserved in eukaryotic organisms. The first and second subunits, ELP1 and ELP2, are WD40 proteins that act as scaffolds for complex assembly (Smith et al., 1999). ELP1 also contains a functional nuclear localization sequence (Fichtner et al., 2003). EL P3 is a histone acetyltransferase (HAT), and has been shown to acetylate histone 3 and po ssibly histone 4 (Winkler et al., 2002). Other than their requirement for ELP3 HAT activity, the functions of ELP4-6 are unknown. Multiply acetylated H3 and H4 ar e decreased in yeast Elongator mutants (Winkler et al., 2002). Additi onally, disruption of subunits in both Elongator and SAGA

PAGE 87

87 (another HAT) results in severe growth defec ts, while disruption of Elongator and H3 or H4 N-terminal tails results in synthetic let hality (Wittschieben et al., 2000). These results suggest Elongators HAT activity is important for its function. ELP3 also contains a putative radica l S-adenosyl methionine (SAM)-binding domain, suggesting Elongator may also contai n methyltransferase activity (Chinenov, 2002). In support of this notion, disrupti on of ELP1, ELP4, ELP3, and the ELP3 SAMbinding domain but not its HAT domain, prevented DNA demet hylation of paternal DNA in mouse zygotes (Okada et al., 2009). Howe ver, DNA methyltransferase or histone methyltransferase activity of EL P3 has not yet been demonstrated. Elongator preferentially ac etylates K14 on histone 3 (Winkler et al., 2002). This modification is generally associated with actively transcribed chromatin (Lusser, 2002) (Fransz and de Jong, 2002). Not surprisingly, Elongator has been shown to function in gene expression. Disruption of Elongator affected the activati on of many genes in yeast, while only a few constitutively expressed genes were affected (Krogan and Greenblatt, 2001). Removal of any of the six Elongator subuni ts or the ELP3 HAT domain results in slow adaptation to new growth conditions and environmental stresse s. The induction of genes required for growth in the new condition s was also delayed (Otero et al., 1999). These studies suggest Elongator functions in transcription activation. However, chromatin immunoprecipitation experiments failed to detect an interaction between Elongator and its target genes in yeast (Winkl er et al., 2002). In contrast, Elongator was detected at several target and non-target genes in human cell lines. Additionally, cells lacking Elongator displayed defects in neur onal migration, and several genes important

PAGE 88

88 for cell migration were under-expressed and their chromatin hypoacetylated only in the coding region (Close et al., 2006). In yeast elp mutants, total hi stone acetylation was decreased, yet no clear clustering of histone acetylation was observed in the promoter or coding regions (Winkler et al., 2002). Though these studies examined different histone modifications, organisms, and genes, further experiments are ne eded to test the notion that Elongator facilitates gene induction by histone modification. Elongator genes have also been identified in Arabidopsis, and disruption of all Elongator genes tested resulted in nearly identical developmental defects such as elongated leaves and reduced fertility (Nelissen et al., 2005). These results suggest that removal of any Elongator s ubunit abrogates the function of the entire complex, though an exception to this is discussed below. Elongator and tRNA Modification Although Elongator certainly plays a distinct role in transcription, elp mutants also display translational defects. Yeast elp mutants lack 5-methoxycarbonylmethyl (mcm5) and 5-carbamoylmethyl (ncm5) groups on uridines at the wobble position in 11 tRNA species, one of which was found to co-i mmunoprecipitate with El ongator (Huang et al., 2005). Overexpression of two of these tRNAs lacking the mcm5 side chain was sufficient to rescue the elp phenotypes, but not mcm5 and ncm5 synthesis (Esberg et al., 2006). Elongator also seems to interact with naked RNA (Otero et al., 1999). This data suggests Elongator may directly modify t RNAs, and defects in tRNA modification and translation may explain the phenotypes of elp mutants. Interestingly, an elp3 mutant has been isolated that is zymocin-insensitive (presumably lacks mcm5 and ncm5), yet does not display the other elp3 phenotypes (Jablonowski et al., 2001). This data calls into

PAGE 89

89 question the assertion that all the phenotypes of Elongator mutants are caused by tRNA modification defects. These studies raise an important question: Are the elp phenotypes due to defects in tRNA or chromatin modification? In other words, does a defect in translation then affect transcription, or vice versa? For example, in mouse zygotes, delayed translation of DNA demethylases resulting from decreased mcm5 and ncm5 levels in tRNA might result in delayed paternal DNA demethylation. Alternatively, Elongator might directly demethylate the paternal genome or acetylat e chromatin in genes important in this process, initiating a somatic cell transcriptional program. Elongator in Familial Dysautnomia In humans, a mutation resulting in a truncated ELP1 protein results in familial dysautonomia (FD), an autosomal recessive disease, resulting in abnormally low numbers of neurons in the autonomic and s ensory nervous systems. In FD cells, Elongator is not present at genes involv ed in neuron migration (Close et al., 2006). Underexpression of these genes in FD neurons was thought to contribute to lowered neuron numbers. Additionally, lowered -tubulin acetylation, which is involved in cell migration, was observed in cells lacking Elongator subunits. Expression of a nonacetylatable -tubulin mutant led to comparable def ects in cortical neurons. ELP3 associates with and prom otes acetylation of -tubulin, suggesting -tubulin may be a target of Elongator, and that -tubulin acetylation is essential for normal neuron migration (Creppe et al., 2009). In a s ubsequent study, the molecular basis of Polymicrogyria (abnormal devel opment of the cerebral cortex) was shown to be a

PAGE 90

90 mutation in an -tubulin variant of unknown function that is not susceptible to the acetylation that regulates microtubule function during cortical neuron migration (Abdollahi et al., 2009). These studies suggest -tubulin hypoacetylation due to Elongator disruption is the caus e of FD and possibly other neur al disorders. In light of these results, the possibilit y that hypoacetylation of -tubulin may underlie some or all of the Elongator mutant phenotypes in yeast and plants must be considered. ELP3 is Essential for Plant Immunity The isolation of two mutants with deficient immune responses that lack different subunits of Elongator strongly im plicates this complex in plant immunity. A discussion of the elp3 mutants is presented here, while a mo re detailed discussion of Elongators function in plant immunity is presented below in the context of elp2 characterization. The elp3 mutation was found to be a deletion of a cytosine and a subsequent frameshift, likely resulting in a non-functi onal protein. This wa s unexpected, as EMS mutagenesis normally causes transition mutations, and in rare cases (~1%), transversions (Kim et al., 2006). This deletion might have been due to a spontaneous mutation. Alternatively, another transiti on mutation may have occurred somewhere in the vicinity of the elp3 mutation, and the elp3 mutation was introduced during errorprone DNA repair. In a large-scale EMS mutagenesis reverse-genetic screen, Greene et al. reported several non-transition mutant s, some of which may have resulted from error-prone repair (Greene et al ., 2003). Regardless of how the elp3 mutation was generated, the data shows that disruption of ELP3 results in SA tolerance, susceptibility to Psm and abnormal leaf development.

PAGE 91

91 The wide leaf phenotype is somew hat surprising, given that the elp2 mutants and the elo3 mutant all exhibit a narrow leaf phenotype. The reason for this is not known. It is possible that a second-site mu tation that is closely linked to ELP3 causes this phenotype. Obtaining an independent mutant allele in Columbia background might address this question. However, mutant s containing a T-DNA insertion in ELP3 in this ecotype were unavailable. Another possibility is that loss of ELP3 function confers different phenotypes to different ecotypes of Arabidopsis. With the exception of leaf size, the elo3 mutant closely resembled the elp3 mutant, suggesting these mutants are allelic. The mapping of these mutations to the same gene confirms this notion. The phenoty pes of these alleles also suggest that Elongator functions in plant immunity in at least two Arabidopsis ecotypes. Although elo3 is more susceptible than wild type Ws, the difference between elo3 and Ws is less than the difference between elp3 and Col-0. This may be because Ws supports less Psm growth than Col-0 (Figure 4-3). The Role of Elongator in Plant Immunity The transcription coactivator NPR1 is a master regulator of plant immune responses. Mutations in the NPR1 gene block SAor IN A-induced defense gene expression and disease resistance and comple tely compromise SAR (Cao et al., 1994). To identify additional regulators of SAR two genetic screens for suppressors of npr1 have been performed (Bowling et al., 1997) (Cla rke et al., 1998) (Shah et al., 1999) (Li et al., 1999; Shah et al., 2001) (Li et al., 2001a). The suppressors identified in these screens either restored inducible defens e gene expression and pathogen resistance or displayed constitutive defense responses. In this study, a genetic screen was performed

PAGE 92

92 which selected for suppressors of npr1 based on the SA-nontolerant phenotype of npr1 on MS medium containing high concentrations of SA. Isolation a nd characterization of the npr1 -suppressor mutant elp2 revealed that the Elongator subunit 2 (ELP2) functions upstream and downstream of SA in plant i mmunity, and is an accelerator of plant immune responses, which primarily regulates the NPR1-independent defense pathway. Mutations in the ELP2 gene partially restored SA tolerance in npr1 (Figure 3-1a and 3-3d), suggesting that the wild-type ELP2 protein may play a role in producing SA cytotoxicity in npr1 ELP2 may negatively regulate t he expression of antioxidant genes that help scavenge reactive oxygen species (ROS) generated by high levels of SA, thus attenuating SA-caused oxidativ e damage to plant cells (Rao et al., 1997). Previous work has reported that elp mutant plants (including elp1 elp2 elp4 and elp6 ) are more resistant to oxidative stress caused by meth yl viologen and cesium chloride under light, which is correlated with increased expr ession of antioxidant genes such as CAT3 (encoding catalase 3) (Chen et al., 2006) (Z hou et al., 2009). The elevated antioxidant capacity in elp2 plants may alleviate oxidative dam age caused by SA, thus rendering npr1 plants more SA tolerant. This conclusion is in agreement with the result that SA cytotoxicity is partially caused by SA-induc ed oxidative stress (R ao et al., 1997). The Atelp2 mutations did not restore pathogen resistance in npr1 Instead, these mutations further compromised basal resistance of npr1 to the virulent pathogen Psm (Figure 3-1c and 3-3f), suggesting that ELP2 is essential for NPR1-independent immunity. Indeed, compared to npr1 Psm -induced expression of PR1 PR2 and PR5 is further delayed or reduced in elp2 npr1 plants (Figure 3-3B). elp2 exhibited reduced

PAGE 93

93 pathogen-induced ICS1 expression (Figure 3-5a) and SA biosynthesis (Figures 3-5b), indicating that ELP2 promotes imm unity upstream of SA. Consistently, elp2 mutations also suppressed pathogen-induced hyperaccumulation of ICS1 transcripts and SA in npr1 (Figures 3-4a, 3-1b, and 3-2e). Furthermore, elp2 mutations partially blocked SAinduced defense gene expression and pathogen resistance (Figure 3-6), suggesting that ELP2 also functions downstream of SA. The function of ELP2, both upstream and downstream of SA, may explain t he delayed or reduced expression of PR1 PR2 and PR5 (Figures 3-1c and 3-4b) and enhanced diseas e susceptibility (Figures 3-1c and 35d) of elp2 and elp2 npr1 plants. Surprisingly, SAR is nearly intact in elp2 plants. When SAR-inducible gene expression was monitored, all six genes te sted were induced and th ree of them were induced to wild-type levels (Figure 37b). The SAR-induced inhibition of pathogen growth was similar in wild type and elp2 plants (Figure 3-7a), indicating that SAR induction can compensate for the immune defects in elp2 These results, together with the delayed and reduced basal defense in elp2 indicate that ELP2 may function as an accelerator of defense responses in Arabidopsis. This conclusion is in agreement with the results from yeas t Elongator mutants ( elp ) (Otero et al., 1999). Yeast elp cells exhibit a delay in growth re covery when introduced to new growth conditions. However, once adapted to the new conditions, they grow with a doubling time comparable to wild type. The slow adaptation phenotype is most likely caused by delayed expression of genes induced by and required for growth under new conditions. For instance, when yeast elp cells were transferred from glucose to galactose, the transcript level of the

PAGE 94

94 galactose-inducible GAL1-10 gene was ~8-fold lower in elp cells after 30 minutes but reached wild-type levels after 2-4 hours. Si milarly, expression of the low-phosphate inducible PHO5 gene and the low-inositol inducible INO1 gene was significantly delayed when elp cells were transferred to low phosphate and low inositol media, respectively. These results suggest that Elongator is requi red for rapid transcriptional reprogramming in response to environmental changes. The role of AtELP2 as an accelerator in immune responses was further substantiated by the results from characterization of defense gene expression in elp2 plants during ETI. Following infect ion by the ETIinducing pathogen Pst DC3000/ avrRpt2 activation of defense genes was delayed in elp2 plants, but expression of some genes eventually reache d wild-type levels (Figure 3-8b). Among the genes tested, ELP2 is required for inducti on of At5g47230, suggesting the existence of ELP2-dependent genes. In c ontrast, gene activation in npr1 was mostly not delayed, but expression failed to reach wild-type levels. Inte restingly, the delayed gene activation in elp2 plants or decreased gene expression in npr1 plants only had a moderate effect on RPS2-mediated resistance (Figure 3-8b). However, RPS2-mediate resistance was completely abolished in the elp2 npr1 double mutant plants, i ndicating that ELP2 and NPR1 function primarily independ ently of each other in ETI. Characterization of the elp2 npr1 and elp2 npr1 mutant plants in this study provided new insight into the function of NP R1 and its relationship with ELP2 in plant immune responses. Both ELP2 and NPR1 are required for basal immunity and ETI, but only NPR1 is required for SAR. Mutations in either ELP2 or NPR1 significantly block the

PAGE 95

95 slow and weak basal immunity, but only moder ately affect the fast and strong ETI. The result that removal of both ELP2 and NP R1 completely abolishes the RPS2-mediated resistance demonstrates that both ELP2 and NP R1 are major positive regulators of ETI. ELP2 and NPR1 appear to act at different signaling nodes in immune responses. ELP2 is mainly essential for the timely activation of defense genes, whereas NPR1 mostly controls the scale of gene expression, t hough these two functions are not mutually exclusive. How much overlap exists between the functions of ELP2 and NPR1 remains to be determined. Interest ingly, expression of several defense genes in elp2 npr1 plants remained high long after repression had occurred in wild type, elp2 and npr1 plants, suggesting that ELP2 and NPR1 may function redundantly to repress the expression of these genes at later time points. These functions ma y help switch off immune responses once pathogen challenge s ubsides, and the underlying regulatory mechanism merits further investigation. How does Elongator pr omote pathogen resistance? Elongator most likely facilitates RNAPII transcription through acet ylation of histones. The yeast Elongator subunit 3, ELP3, was shown to have histone acet yltransferase (HAT) activity (Winkler et al., 2002). In mammals, several genes involved in cell motility, neurulation and vascular development were found to be direct target s for acetylation by the Elongator complex during transcription elongation (Close et al., 2006). In Arabidopsis, ELP3 was colocalized with euchromatin and the phosphorylated form of RNAPII, and reduced expression of two auxin-related genes was corre lated with reduced histone H3 lysine 14 acetylation at the coding region of these genes (Nelissen et al., 2009). Although ELP3s

PAGE 96

96 HAT activity has not been tested, it is po ssible that the Arabido psis Elongator complex directly promotes the induction of def ense genes through its interaction with the hyperphosphorylated form of RNAP II and subsequent acetylation of histones of these genes. This and other possibilit ies of the underlying mechani sm for Elongators immune function are discussed below, as well as future studies to address these possibilities. How Does Elongator Regulat e Pathogen Resistance? Transcription and Histone Modification Given Elongators multifunc tional nature, this protei n complex might positively regulate plant immunity through several di fferent, but not mutually exclusive, mechanisms. Elongator might directly prom ote the induction of defense genes through its interaction with RNAP and subsequent acetylation of hi stones. These modifications would convert chromatin to the open state, facilitating more efficient transcription. To test this hypothesis, defense gene chromati n will be immunoprecipitated with H3K9 and H3K14 antibodies to determine the effect of Elongator disrupti on on pathogen-induced H3 acetylation. Chromatin immunoprecipitat ion (ChIP) experiments will also test the possibility that Elongator acts directly on defense genes by probing Interactions between Elongator and defense gene chromatin bef ore and during pathogen infection. tRNA Modification and Translation Since defects in translation may be responsible for most elp phenotypes in yeast, these defects might also expl ain the immune deficiencies of elp plants. It will be interesting to see if plant elp mutants also lack mcm5 and ncm5 tRNA modifications, as these modifications are conserved in eukar yotes (de Crecy-Legard et al., 1990). If elp plants lack these modifications, the decreased transcription of defense genes in these

PAGE 97

97 mutants might be due reduced synthesis of proteins that regulate these genes. Future work will attempt to determine the effect of Elongator disruption on tRNA modification in plants. Localization NPR1 prevents SA toxicity and regulates defense genes through its co-activator activity in the nucleus (Zhang et al., 2009). Since Elongator interacts genetically with NPR1, Elongator may also carry out it s immune function in the nucleus. Although nuclear florescence in 35S::ELP2-GFP plant s could not be detected (Figure 3-10), nuclear localization of a fraction of Elongator seems likely. Previous studies established that yeast and human cells posses both cytoso lic and nuclear Elongator (Rahl et al., 2005) (Fichtner et al., 2003) (Creppe et al., 2009), and that th is dual localization is essential for Elongator function. The NL S sequence on the C-terminus of ELP1 is conserved (Rahl et al., 2005); suggesting plan t Elongator can enter the nucleus. Failure to detect nuclear ELP2-GFP by fluorescenc e microscopy may be due to low levels of nuclear Elongator, or masking of the GFP fluorophore by other proteins in the vicinity. Introduction of ELP2-GFP driven by its native promoter to elp2 mutants resulted in partial complementation of morphological phenotypes in three lines. However, none of these lines had detectable ELP2 -GFP protein levels (not shown). It is possible that fusion of GFP to ELP2 impedes its function, possibly by steric hindrance, and that overexpression of ELP2-GFP might alleviat e these effects. Even when driven by the strong 35S promoter, no single-in sertion transgenic lines were isolated that completely complemented the plant defense phenotypes of elp2 (Figure 9). In light of these results, other approaches may be needed to determine t he subcellular localization of ELP2.

PAGE 98

98 Efforts to detect nuclear ELP2-GFP via western blot from nuclear extracts are underway. In future work, the immune respons e of plants lacking the NLS of ELP1 will be tested to determine if nuclear localization is essential for Elongators immune function. Dissecting Elongator Function To determine Elongator function in plant immunity, transcriptional and translational defects need to be uncoupled in vivo and the immune responses of the resulting mutants characterized. Transcripti onal and translation inhibitors are unsuitable for this purpose because of their global and non-specific effects. Removal of the HAT domain and SAM-binding domain of ELP3, and the nuclear localization sequence of ELP1 may uncouple these defects, and will clarify the function of each motif. Possible Functions of ELP4-ELP6 in Plant Immunity In yeast, disruption of any Elongator subunit results in similar phenotypes. The only evidence for divergent functions bet ween Core-Elongator and Holo-Elongator comes from studies with Arabidopsis. Only mu tations in core Elongator subunits caused stomatal closure to be hypersensitive to ABA (Zhou et al., 2009). This is surprising, given that all six subunits are essential for histone acetylation, and suggests HAT activity may not be essential for Elongators function in ABA signaling. To determine if the non-core subunits ELP4-ELP6 ar e essential for plant immunity, elp1, elp4 and elp6 mutants have been isolated, and elo1 elo2 and elo3 plants were obtained and crossed into an npr1 background. All double mutants we re SA tolerant and both single and double mutants displayed elp2 -like morphology (not shown) Preliminary results show

PAGE 99

99 that these mutants are also susceptible to Psm infection, suggesting Elongators immune function may require both core and non-core subunits. Does Elongator Regulate Crosstalk Be tween Hormone Signaling Pathway s? Plant pathogens are known to use stom ata for entry into the leaf during pathogenesis. Pathogen-induced stomata closure requires ABA and SA signal transduction, and is antagonized by the viru lence factor coronatine, which is a jasmonate-mimic that antagonizes SA signal ing (Melotto et al., 2008). Elongator antagonizes ABA-mediated signaling (Zhou et al., 2009) and promotes SA signaling (this study), suggesting Elongator might modulate crosstalk between these two signaling networks. In this study, Psm was infiltrated directly into the apoplast, bypassing the leaf infiltration step in pathogenesis. During an infection where the pathogen must infiltrate an intact leaf, El ongator may act as both a negative (through antagonizing stomatal closure) and a positive (through its activation of defense genes) regulator of plant immunity. El ongator might also function in stomatal closure via its role in SA signaling. In plant immunity, virulent P. syringae induces ABA biosynthesis. ABA levels are correlated with pathogen susceptibility, and ABA represses SA accumulation and defense gene expression (Spoel and Dong, 2008). This suggests ABA might also promote virulence after infiltration occurs. However, in some cases ABA may function to promote resistance (Ton et al., 2009). Furt her experiments are needed to determine if elongation functions in plant immunity thr ough its role in ABA signaling. Regardless of how the Elongator complex r egulates defense gene transcription, this study clearly demonstrates that AtELP2 is an essential co mponent of plant immunity, which functions

PAGE 100

100 together with the transcription coactivato r NPR1, to orchestrate plant immune responses. The Role of ANAC1 in Plant Immunity In addition to Elongator, this study has implicated ANAC1 in SA tolerance and plant immunity. This genetic screen aimed to isolate mutants that restored SA tolerance to npr1 One such mutant was snt2 It was possible that snt2 might also affect plant immunity. The snt2 mutation partially restored pathogen resistance to npr1 and also conferred greater resistanc e to wild type plants. The snt2 mutation was mapped to ANAC1, and found to be a gain-of-function muta tion, as knockout alleles of ANAC1 did not confer snt2 phenotypes and ANAC1 expression was increased in snt2 Wild type and npr1 plants containing the 35S:ANAC1-GFP transgene were obtained to attempt to recapture the snt2 phenotype and show that SNT2 is ANAC1 Unfortunately, none of the transgenic lines expressed detectable am ounts of ANAC1-GFP ( not shown), nor did they display snt2 phenotypes. Therefore we could not confirm the identity of SNT2. Perhaps high expression levels of ANAC1 are lethal during embryogenesis, as ANAC1 expression is lowest during this stage of plant development (AK, 2006). Alternatively, the GFP fused to ANAC1 may somehow interf ere with its function. However this seems unlikely, as other ANAC-GFP fusions prot eins have been shown to be function normally in vivo (Bu et al., 2008). Transgenic overexpression of ANAC1 without GFP driven by a weaker or the ANAC1 native promoter might allow the isolation o ANAC1-overepressing plants. Surprisingly, the snt2 mutation was found in intron 1 of ANAC1. The fact that a single cDNA amplicon was obtained which was identical to the wild type cDNA suggests

PAGE 101

101 this gene is spliced correctly in snt2 ANAC1 expression was also increased in snt2 The possibility that alteration of an intron cis-element in snt2 caused ANAC1 overexpression was then examin ed. Three cis-elements are e ssential for intron splicing in plants. The first and second elements are located at the 5 and 3 splice junctions, respectively, and consist of several semi-conserved bases that span the intron/exon borders. The third element is the less conserved branchpoint sequence, with a consensus sequence of YTTNA N or, more stringently, CTRA Y). The Adenine is the absolutely conserved and essential branchpoint and functions in formation of the lariat intermediate. The branchpoint consensus is usually located -19 to -50 bases upstream of the 3 splice junction (Schuler, 2008). One possible explanation for ANAC1 overexpression in snt2 is that this mutation increases splicing efficiency by introducing a novel branchpoint, which in turn incr eases steady-state levels of mature ANAC1 mRNA and ANAC1 protein. Studies with two Arabidopsis mutants support the plausibility of this model. The det3-1 mutation destroys a consensus branch-point sequence that is 32 base pairs upstream of the 3 splice junction, and reduces expression of DET3 by half. The DET3 cDNA is unchanged, and overexpression of DET3 is sufficient for complementation of det3-1 (Schumacher et al., 1999). Th is suggests branch-point sequences may be essential for optimum gene expression. Another mutation, ap3-1, is a loss-of-function allele of the APATELA gene, which is involved in flower development. The mutant phenotype results from the skipping of exon 5 during splicing. An intragenic suppressor mutation, ap3-11 partially restores normal splicing and gene function. This

PAGE 102

102 mutation is located 32 nucleotides upstream fr om the 3 splice junction in intron 4, and creates a novel putative branch point through a G to A transi tion. The authors of this study propose this novel branchpoint may cause exon 5 to be more frequently recognized by the splicing machinery (Yi and Jack, 1998). The similarities between ap3-11 and snt2 are striking. Both are G to A transitions, both are found in the interval where branchpoints are commonly found, both introduce putative novel branchpoints, and both result in an increase in correctly spliced transcript levels. Therefore snt2 like ap3-11 may increase transcript levels by increasing exon recognition by the splicing machinery. ANAC transcription factors play diverse roles in Arabidopsis. The ANAC family is specific to plants and consists of 105 me mbers in Arabidopsis. These transcription factors posses a conserved N-terminal DN A-binding NAC domain and a variable Cterminal transactivation domain (Ooka et al., 2003). Several ANAC factors have been implic ated in pathogen resistance. ANAC55 and ANAC92 are essential for age-related resistance to Pst and H. parasitica and are induced by pathogen infection (Carviel et al., 2009). JA treatment induces ANAC55 and ANAC19. This induction is dependant on COI1 and AtMYC2, which are central mediators of the JA re sponse. Removal of both ANAC55 and ANAC19 but not one or the other alone, resulted in reduced JA-dependant defense gene expression, although this double mutant exhibited enhanced resistance to the necrotrophic pathogen B. cinerea Conversely, plants overexpressing ea ch of these genes showed enhanced JAinduced defense gene expre ssion (Bu et al., 2008).

PAGE 103

103 Overexpression of ANAC1 may increase pathogen resistance, but apparently ANAC1 is not essential for immunity (Figure 5-4). Perhaps ANAC1 functions redundantly with another ANAC, as is the case with ANAC19 and ANAC55 A BLASTP search against the C-terminal transactivati on domain of ANAC1 suggests ANAC68 is the only close homolog in Arabidopsis and may functionally overlap with ANAC1. However, according to micr oarray data (Genevestigator), ANAC68 is not induced by pathogen treatment. Analysis of an anac68 anac1 double mutant may address this question of redundancy. In another study, the NAC factor ATAF2 was found to positively regulate plant Tobacco Mosaic Virus (TMV) resistance in Tobacco, and was induced during infection and SA treatment. Interaction between ATAF and the TMV replicase may act to suppress the defense response. The data presented here adds ANAC1 to the list of NACs implicated in pathogen resistance. The following arguments suggest ANAC1 may play a role in plant immunity: 1) Plants overexpressing ANAC1 display increased pathogen resistance 2) ANAC1 expression is induced upon pathogen infection 3) ANAC1 interacts genetically with NPR1, a central regulator of plant imm une responses. However, these facts are insufficient to assign an immune function to ANAC1, and attempts to recapture the snt2 phenotype by ANAC1 overexpression were unsuccessful, as discussed above. Although an increase in ANAC1 expression was observed in snt2 the possibility that a fraction of ANAC1 transcripts were alternately spliced cannot be ruled out. Cloning and sequencing a large number of ANAC1 cDNAs mi ght address this possibility. In future

PAGE 104

104 work, SA accumulation and ICS1 expr ession in untreated and infected snt2 and snt2 npr1 plants will be determined. The yellowing near the shoot apical meristem in snt2 is reminiscent of other Arabidopsis mutants th at constitutively accumulate SA and are resistant to biotrophic pathogens (Clarke et al., 2000) (Zhang et al., 2003a). These mutants require ICS1 for their pathogen resistance phenotype. snt2 sid2-1 and snt2 npr1 sid2-1 mutants will be tested for SA accumulation, ICS1 expression, and pathogen resistance to determine if snt2 phenotypes also requi re ICS1-dependent SA accumulation.

PAGE 105

105 APPENDIX SUPPLEMENTAL FIGURES AND TABLES Ler npr1-L Figure A-1. Loss of SA tolerance in npr1-L The experiment was done as for Fi gure 31a, except that a concentration of 0.18 mM SA was used.

PAGE 106

106 Figure A-2. ELP-GFP fluorescence in npr1 and INA-treated seedlings. The experiment was done as for Figure 3-10.

PAGE 107

107 Figure A-2. Continued

PAGE 108

108 Table A-1. Primers used for rough mapping. Rough Map-Based Cloning Markers Chromosome (cM) Marker Forward Primer Reverse Primer Col (bp) Ler (bp) I (10) F21M12 GGCTTTCTCGAAATCTGTCC TTACTTTTTGCCTCTTGTCATTG 200 160 (39) ciw12 AGGTTTTATTGCTTTTCACA CTTTCAAAAGCACATCACA 128 115 (72) ciw1 ACATTTTCTCAATCCTTACT C GAGAGCTTCTTTATTTGTGAT 159 135 (81) nga280 CTGATCTCACGGACAATAGTGC GGCTCCATAAAAAGTGCACC 105 85 (113) nga111 CTCCAGTTGGAAGCTAAAGGG TGTTTTTTAGGACAAATGGCG 128 162 II (11) ciw2 CCCAAAAGTTAATTATACTGT CCGGGTTAATAATAAATGT 105 90 (30) ciw3 GAAACTCAATGAAATCCACT T TGAACTTGTTGTG AGCTTTGA 230 200 (50) nga1126 CGCTACGCTTTTCGGTAAAG GCACAGTCCAAGTCACAACC 191 199 (73) nga168 TCGTCTACTGCACTGCCG GAGGACATGTATAGGAGCCTCG 151 135 III (20) nga162 CATGCAATTTGCATCTGAGG CTCTGTCACTCTTTTCCTCTGG 107 89 (43) ciw11 CCCCGAGTTGAGGTAT T GAAGAAATTCCTAAAGCATTC 179 230 (70) ciw4 GTTCATTAAACTTGCGTGTGT TACGGT CAGATTGAGTGATTC 190 215 (86) nga6 TGGATTTCTTCCTCTCTTCAC ATGGAGAAGCTTACACTGATC 143 123 IV (10) ciw5 GGTTAAAAATTAGGGTTACG A AGATTTACGTGGAAGCAAT 164 144 (47) ciw6 CTCGTAGTGCACTTTCAT CA CACATGGTTAGGGAAACAATA 162 148 (65) ciw7 AATTTGGAGATTAGCTGGAAT CCATGTTGATGATAAGCACAA 130 123 (104) nga1107 GCGAAAAAACAAAAAAATCCA CG ACGAATCGACAGAATTAGG 150 140 V (10) CTR1 CCACTTGTTTCTCTCTCTAG TATCAACAGAAACGCACCGAG 159 143 (42) ciw8 TAGTGAAACCTTTCTCAG AT TTATGTTTTCTTCAATCAGTT 100 135 (71) PHYC CTCAGAGAATTCCCAGAAAAA TCT AAACTCGAGAGTTTTGTCTAGATC 207 222 (88) ciw9 CAGACGTATCAAATGAC AAATG GACTACTGCTCAAACTATTCGG 165 145 (115) ciw10 CCACATTTT CCTTCTTTCATA CAACATTTAGCAAATCAACTT 140 130

PAGE 109

109 Table A-2. Primers used for fine mapping. Fine Mapping Markers Marker Forward Primer Reverse Primer Restriction Enzyme Col (bp) Ler (bp) elp2-1 At1g49580 TGTACCCACCAACTGTCAAC ATCACAGTAATGCCATCGAAG MspI 270, 217 487 At1g49470 CTD1) CTTTGTGCCTGGTCTCTCAC GGTCCACTATCATTAGTGCG BamHI 566, 454 1020 At1g49550 (CTD3) GGCAGCTTTGTATCTCATATG AGTGACCAAGTCCAAGAGTG AciI 477, 274 751 At1g49610 TGCTTGACAGAGGAATTGATG TATGAACCCAATACGAAGGAG AccI 368, 234 602 At1g49580 (CTD2) TGTACCCACCAACTGTCAAC ATCACAGTAATGCCATCGAAG MspI 270, 217 487 BEDSSLP1F TTGGACAAAACTTGCTGCAC AAAATTTCCCTTAAGAAACATGC none 155 125 GAPB GGCACTATGTTCAGTGCTG TCTGATCAGTTGCAGCTATG BfaI 1211 850, 361 elp3-1 At5g47570 CCACTCAACCATGCCAATGC CGTCGGCAAACACATCGTCC ApoI 250 211, 39 At5g50270 CGGTTTGTTGACAGATCTTTG CATATCCTGCATACAAGACAG BstUI 758 521, 237 At5g50120 TTACCAAAGATTTCACTGCTCC CATCCTACTCATCATCCCATC Bbs1 500 248, 252 At5g50180 GAACCATGTGATATGTTTCACC GCAAGATTACTTCAAACCTTGC BtsCI 604 372, 232 At5g50210 TTGTTGGGTGGAGAGAGATC CCAGCTTGATCTAGGATGGC RsaI 793 463, 329 At5g50270 CGGTTTGTTGACAGATCTTTG CATATCCTGCATACAAGACAG BstUI 758 521, 237 At5g50300 TAGAAACAATGCATGCACAAGC AGTGGTGTGTGAGTGTGTACCG BsrI 228 197, 31 At5g50360 ACCACCAGATCCGTTCTTCG CACATCCAAAGGAGATTCGTG EcoRV 782 540, 242 At5g50390 CCACAAGAACACTTCCCTTC GGCAGATATACCAAAAAGTGG Tsp509I 318 216, 102 At5g50460 CCATTATTGCTCGTTAGTTAC TGGGATGCAATATTTTGGCC BslI 279 211, 68 At5g50770 CTAAGAGCCTCCATCATTGG GCAAGTTCATGACAAAGGAC DpnII 586 483, 103 AT5G51130 GCCTTACAGGAGGTTTCTA G GGTCGTAAAACAATCGTTCG ApoI 477 288, 189 PDC2 CAGTGGATCACTCCCAAGACGCCTC GCACTCAACTTAT ATATATTTCAG BamHI 425 360, 65 anac1 AT1G01440 CCCAAAGCTATACACGTCAG GAGA ATATACCACGGAGAG Taq I 267 236, 31 AT1G01290 GGGTTCTGTTCTTGATCTCTTG CGTAAGTCTACACGAACATGC MnlI 820 428, 392 AT1G01260 CGACAAAACAGGGAGCCGATAC GCACAG TTCTCTTCTTCTGAGCC BstF5I 897 517, 380 AT1G01050 GCACAGGTTCCTACACAAAG CAAGGTTAGATGAGAACAAAG HinfI 296 217, 79

PAGE 110

110 Table A-3. Primers used for mutant genotyping. Mutant Genotyping Markers Restriction enzyme Col0 (bp) Mutant (bp) Primer Forward Primer Reverse Primer SK_004690 ATGATGCCATTAGGGTGTGG CACTATCATCACTACTACGAG SK_011529 CTGCGAGAGTAAGACAAATGC TTACCTTATCTCCAGGAGCTG SK_084199 TGCACTGCATCGGTGGTATG GAGATTTGAGGCGCCAGAG SK_100099 GCAGAGACATGTCATCCACC GGATGGTTTGGTAGTGGTG SK_028216 CAGTGTCTTACTGTGTTACAG CAGAGTTATTGGCAGTGGTAC SK_003541 CAGCAAATTCTGCTCAAGCTC CCTTGTGTATGTTGAGGAATC SK_079193 CTGAGTTCCGTGTGTGATTA C GGATGCCACACAACCTTGG SK_143430 TGGATACTGTTATTGCAGCC GTTGGAGAAGCCCTTAGGTG SK_128571 CCTCTGTAAAATTTCCGGAGG GGA ACTTGCGCTGTAAGTTCCG SK_128569 CCTCTGTAAAATTTCCGGAGG GGA ACTTGCGCTGTAAGTTCCG Sail_228_B11 GGAGATGAACAACAAGACACC CAGCAAATCATGGCCAGCAG elp2-2 CATCCCAGACATTCACAACTC CGTTACACTGCTTCCAAACG elp2-3 CATCCCAGACATTCACAACTC CGTTACACTGCTTCCAAACG elp2-4 CTCACGGATAGCAAGTACTC CGTTACACTGCTTCCAAACG LBa1 TGGTTCACGTAGTGGGCCATCG LB3 TAGCATCTGAATTTCATAACCAATCTCGATACAC anac1dCAPS CTGAATTTCATTTGCAAG TAATCGACTTA CCTTGACCTCA ACAGATTCTCC Dde1 176, 25 201 elp2-1 dCAPS TGTTAGTAGCAGCAAAGAGTCCGAGAATT GACCTG ATCTTGGCTCACGGATAGC BslI 187, 26 213 elp31dCAPS-F CCTTTACCTGGCCGAGGTTG CATTTTATGTCTTTTCTGTTGCCTC MwoI 192 225 npr1-3 GGCCGACTATGTGTAGAAATACTAGCG TGAG ACGGTCAGGCTCGAGG HhaI sid2-1 AAGCTTGCAAGAGTGCAA TTTTAGCTGTCCTGCCAAT ~200 ~180, 20 snc1-1 TGATCGTGCAAAGTCCAAGG GTGAGATT GAGGTACTCGAG XbaI ~400 ~800 Gene Expression Analysis Primers RNA Blot Probe Primers Primer Set Forward Primer Reverse Primer PR1 CTCATACACTCTGGTGGG TTGGCACATCCGAGTC PR2 CAAATCGGAGTATGCTACGG CATCTCTGTAGCTCTGAACG PR5 AGATGTGTAACCGGAGACTG CTCGTTTCGTCGTCATAAGC Quantitative PCR primers Gene Forward Primer Reverse Primer ICS1 GAATTTGCAGTCGGGATCAG AA TTAATCGCCTGTAGAGATGTTG UBQ5 TCTCCGTGGTGGTGCTAAG GAACCTTTCCAGATCCATCG ANAC1 GAATCGACAGAGCAGGACAA CTACGACCTCTTACCAGAACATCAG At4g27280F ACGGTGCGTTGAATCAGATG TCCCAAATCTCTCCAGTGTC At5g47230F CGTTTCCGTTTGTAACGTCG TCCACGTCAGCATACACATC At2g38470 GAATCGTAGTGCAGACAACG TCCACATGTTTCCTCACTGG At2g35980 GATCAAGTTCAGGCTTAGGG AGAAGTCGAAGTCGCACTTG At4g39670 TTACACGGAAGTGTGTGCAC CTTCCATGTACCTCCTCATG GST11 CGAGCTCAAAGATGGTGAAC AGGGAGACAAGTTGGTTTCC EDR11 AGCCTTTCATCCTTCGCAAC ATGTCCTTGCCAGTTGAGAG SAG21 GGCTCGTTCTATCTCTAACG TTCTTCATCACAGCCGAAGC LURP1 TGGCTAACAACGTAGAGGAG CAACAGTGACGGAGAAATGG WRKY18 TTAGATGCTCGTTTGCACCG CCAAAGTCACTGTGCTTGAC PR1 CTCATACACTCTGGTGGG ATTGCACGTGTTCGCAGC PR2 ATCAAGGAGCTTAGCCTCAC TGTAAAGAGCCACAACGTCC Table A-4. Primers used in analysis of gene

PAGE 111

111 REFERENCES Abdo llahi, M.R., Morrison, E., Sirey, T., Molnar, Z., Hayward, B.E., Carr, I.M., Springell, K., Woods, G., Ahmed, M., Hattingh, L., Corry, P., Pilz, D.T., Stoodley, N., Crow, Y., Taylor, G.R ., Bonthron, D.T., and Sheridan, E. (2009). Mutation of the variant a-tubul in TUBA8 results in polymicrogyria with optic nerve hypoplasi a. The American Journal of Human Genetics 85, 737. Abramoff, M.D., Magelhaes, P.J., and Ram, S.J. (2004). Image processing with ImageJ. Biophotonics Inter national 11, 36-42. AK, G. (2006). Genevestigator. Facilitati ng web-based gene-expression analysis. Plant Physiology 141, 1164-1166. Alam, K., and Rolfe, J. (2006). Economi cs of plant disease outbreaks. Agenda 13, 161-174. Alvarez-Venegas, R., Abdallat, A.A., Guo, M., Alfano, J.R., and Avramova, Z. (2007). Epigenetic control of a transcripti on factor at the cross section of two antagonistic pathways. Epigenetics 2, 106-117. Asai, T., Tena, G., Plotniko va, J., Willmann, M.R., Chiu W.L., Gomez-Gomez, L., Boller, T., Ausubel, F. M., and Sheen, J. (2002). MAP kinase signalling cascade in Arabidopsis innate i mmunity. Nature. 415, 977-983. Attaran, E., Zeier, T.E., Griebel, T., and Zeierb, J. (2009). Methyl salicylate production and jasmonate signaling ar e not essential for systemic acquired resistance in Arabidops is. The Plant Cell 21, 954-971. Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004). Plant disease resistance protein signaling: NBSLRR proteins and their par tners. Curr Opin Plant Biol 7, 391-399. Bergelson, J., Kreitman, M., Stahl, E.A., and Tian, D. (2001). Evolutionary dynamics of plant R-genes Science 292, 2281-2285. Blanco, F., Salinas, P., Cecchini, N.M., Jordana, X., Hummelen, P.V., Alvarez, M.E., and Holuigue, L. (2009) Early genomic responses to salicylic acid in Arabidopsis. Plant Mol Biol. 70, 79-102. Bowling, S.A., Clarke, J.D., Liu, Y., Klessig, D.F., and Dong, X. (1997). The cpr5 mutant of Arabidopsis expre sses both NPR1-dependent and NPR1independent resistance. Plant Cell 9, 1573-1584.

PAGE 112

112 Boyes, D.C., Nam, J., and Dangl, J.L. (1998). The Arabidopsis thaliana RPM1 disease resistance gene product is a peripheral plasma membrane protein that is degraded coincident with the hy persensitive response. Proc. Natl. Acad. Sci., USA 95, 15849-15854. Broglie, R., Broglie, K., Chet, I., Roby, D., and Holliday, M. (1991). Chitinase expression in transgenic plants: a mo lecular approach to fungal disease resistance. UCLA Symposia on Molecula r and Cellular Biology. Journal of Cellular Biochemistry, 9. Bu, Q., Jiang, H., Li, C.-B., Zhai, Q., Zhang, J., Wu, X., Sun, J., Xie, Q., and Li, C. (2008). Role of the Arabidopsis thaliana NAC transcription factors ANAC019 and ANAC055 in regulating jasmonic acid-signaled defense responses. Cell Research 18, 756-767. Buell, R., Joardar, V., Linde berg, M., Selengut, J., P aulsen, I.T., Gwinn, M.L., Dodson, R.J., Deboy, R.T., Durkin, A.S., Kolonay, J.F., Madupu, R., Daugherty, S., Brinkac, L., Beanan, M.J., Haft, D.H., Nelson, W.C., Davidsen, T., Zafar, N., Zhou, L., Liu, J., Yuan, Q., Khouri, H., Fedorova, N., Tran, B., Russell, D., Berry, K., Utte rback, T., Aken, S.E.V., Feldblyum, T.V., D'Ascenzo, M., Deng, W.-L., Ra mos, A.R., Alfano, J.R., Cartinhour S., Chatterjee, A.K., Delaney, T.P ., Lazarowitz, S.G., Martin, G.B., Schneider D.J., Tang, X., Bender, C.L., White, O., Fraser, C.M., and Collmer, A. (2003). The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas syringa e pv. tomato DC3000. Proc. Natl. Acad. Sci. 100, 10181-10186 Butterbrodt, T., Thurow, C., and Gatz, C. (2006). Chromatin immunoprecipitation analysis of the tobacco PR-1a and the truncated CaMV 35S promoter reveals differences in salicylic acid-dependent TGA factor binding and histone acetylation Plant Molecular Biology 61, 665-674. Cao, H., Bowling, S.A., Go rdon, S., and Dong, X. (199 4). Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. The Plant Cell 6, 1583-1592. Cao, H., Glazebrook, J., Clark, J.D., Volko, S., and Dong, X. (1997). The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88, 57-63. Carviel, J.L., Al-Daoud, F., Neumann, M. Mohammad, A., Prov art, N.J., Moeder, W., Yoshioka, K., and Cameron, R. K. (2009). Forward and reverse genetics to identify genes involved in the age-related resistance response in Arabidopsis thaliana. Molecular Plant Pathology 10, 621-634.

PAGE 113

113 Chaturvedi, R., Krothapalli, K., Makandar R., Nandi, A., Sparks, A.A., Roth, M.R., Welti, R., and Shah, J. (2008). Plastid x3-fatty acid desaturasedependent accumulation of a systemic acquired resistance inducing activity in petiole exudates of Arabidopsis thalia na is independent of jasmonic acid. Plant J. 54, 106-117. Chen, H., Xue, L., Chintamanani, S., Germain, H., Lin, H., Cui, H., Cai, R., Zuo, J., Tang, X., Li, X., Guo, H., and Zhou, J.-M. (2009). ETHYLENE INSENSITIVE3 and ETHYLENE IN SENSITIVE3-LIKE1 Repress SALICYLIC ACID INDUCTION DEFICIEN T2 Expression to Negatively Regulate Plant Innate Immunity in Arabidopsis. Plant Cell Advance Online Publication. Chen, Z., Kloek, A.P., Boch, J., Kat agiri, F., and Kunkel, B.N. (2000). The Pseudomonas syringae avrRpt2 gene product promotes pathogen virulence from inside plant cells. Mo lecular Plant-Microbe Interactions 13, 1312-1321. Chen, Z., Zhang, H., Jablonowski, D., Zhou, X., Ren, X., Hong, X., Schaffrath, R., Zhu, J.-K., and Gong, Z. (2006). Mutations in ABO 1/ELO2, a subunit of Holo-Elongator, increase abscisic acid sensitivity and drought tolerance in Arabidopsis thaliana. Molecular and Cellular Biology 26, 6902 Chinenov, Y. (2002). A second catalytic domain in the Elp3 histone acetyltransferases:a candidate for hi stone demethylase activity? Trends in Biochemical Sciences 27, 115-117. Church, G.M., and Gilbert, W. (1984). G enomic sequencing. Proc. Natl. Acad. Sci. USA 81, 1991-1995. Clarke, J.D., Liu, Y., Klessig, D.F. and Dong, X. (1998). Uncoupling PR gene expression from NPR1 and bacterial re sistance: Characterization of the dominant Arabidopsis cpr6-1 mutant. The Plant Cell 10, 557-569. Clarke, J.D., Volko, S.M., Ledford, H., Ausubel, F.M., and Dong, X. (2000). Roles of salicylic acid, jasmonic acid, and ethylene in cpr -induced resistance in Arabidopsis. Plant Cell 12, 2175-2190. Close, P., Hawkes, N., Cornez, I., Cr eppe, C., Lambert, C.A., Rogister, B., Siebenlist, U., Merville, M.-P., Slaugenha upt, S.A., Bours, V., Svejstrup, J.Q., and Chariot, A. (2006). Transcr iption impairment and cell migration defects in Elongator-depleted cells: Im plication for familial dysautonomia. Molecular Cell 22, 521.

PAGE 114

114 Clough, S.J., and Bent, A.F. (1998). Floral Dip: a simplified method for Agrobacterium -mediated transformation of Arabidosis thaliana. Plant J. 16, 735-743. Creppe, C., Malinouskaya, L., Volvert, M.-L., Gillard, M., Close, P., Malaise, O., Laguesse, S., Cornez, I., Rahmouni, S ., Ormenese, S., Belachew, S., Malgrange, B., Chapelle, J.-P., Si ebenlist, U., Moonen, G., Chariot, A., and Nguyen, L. (2009). Elongator controls the migration and differentiation of cortical neurons through acetylati on of a-tubulin. Cell 136, 551-564. Daniels, M. (1982). Editorial: Possible adverse effects of antibiotic therapy in plants. Reviews of Infectous Diseases 4, 167-170. Davis, K.R., Lyon, G.D., Darvill, A.G., and Albersheim, P. (1984). Endopolygalacturonic acid lyase from Erwinia carotovora elicits phytoalexin accumulation by releasi ng plant cell wall fragments. Plant Physiol. 74, 52-60. de Crecy-Legard, V., Glaser, P., Lejeune, P., Sismeiro, O., Barber, C.E., Daniels, M.J., and Danchin, A. (1990). A Xanthomonas campestris pv. campestris protein similar to catabolite activation factor is involved in regulation of phytopathogenicity. J. Ba cteriol. 172, 5877-5883. Delaney, T.P., Friedrich, L., and Ryals, J.A. (1995). Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc. Natl. Acad. Sci. USA 92, 6602-6606. Desprs, C., DeLong, C., Glaze, S., Liu, E., and Fobert, P.R. (2000). The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP tr anscription factors. Plant Cell 12, 279-290. Desprs, C., Chubak, C., Rochon, A., Cla rk, R., Bethune, T., Desveaux, D., and Fobert, P.R. (2003). The Arabidopsis NP R1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain/leucine zipper transcr iption factor TGA1. The Plant Cell 15, 2181-2191. Donofrio, N.M., and Delaney, T.P. (2001). Abnormal callose response phenotype and hypersusceptibility to Per onospoara parasitica in defencecompromised arabidopsis nim1-1 and salicylate hydroxylase-expressing plants. Mol Plant Micr obe Interact 14, 439-450. Durrant, W.E., and Dong, X. (2004). Syst emic acquired resistance. Annu Rev Phytopathol 42, 185-209.

PAGE 115

115 Durrant, W.E., Wang, S., and Dong, X. (2007). Arabidopsis SNI1 and RAD51D regulate both gene transcription a nd DNA recombination during the defense response. Proc. Natl. Acad. Sci. 104, 4223 4227. Edreva, A. (2005). Pathogenesis-related protei ns: Research in the last 15 years. Gen. Appli. Plant Ph ysiology 31, 105-124. Esberg, A., Huang, B., Johansson, M.J. O., and Bystro, A.S. (2006). Elevated levels of two tRNA species bypass the requirement fo r elongator complex in transcription and exocytosis Molecular Cell 24, 139. Falk, A., Feys, B.J., Frost, L.N., Jones, J.D.G., Daniel s, M.J., and Parker, J.E. (1999). EDS1 an essential component of R gene-mediated disease resistance in Arabidopsis has homology to eukaryotic lipases. Proc. Natl. Acad. Sci. 96, 3292-3297. Fan, W., and Dong, X. (2002). In vi vo interaction between NPR1 and transcription factor TGA2 leads to sa licylic acid-mediated gene activation in Arabidopsis. Plant Cell 14, 1377-1389. Felix, G., Duran, J.D., Volko, S., and Bo ller, T. (1999). Plants have a sensitive perception system for the most conserv ed domain of bacterial flagellin. Plant J. 18, 265-276. Fellows, J., Erdjument-Bromage, H., Tempst, P., and Svej strup, J.Q. (2000). The Elp2 subunit of Elongator and elongati ng RNA Polymerase II Holoenzyme is a WD40 repeat protein. Journal of Biological Chemistry 275, 12896 12899. Feys, B.J., Moisan, L.J., Newman, M. -A., and Parker, J.E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO Journal 20, 5400-5411. Fichtner, L., Jablonowski, D., Schierhorn, A., Kitamoto, H.K., Stark, M.J.R., and Schaffrath, R. (2003). Elon gators toxin-target (T OT) function is nuclear localization sequence dependent and suppressed by post-translational modication. Molecular Microbiology 49, 1297 Forouhar, F., Yang, Y., Kumar, D., Chen, Y ., Fridman, E., Park, S.W., Chiang, Y., Acton, T.B., Montelione, G.T., Pichersky, E., Kle ssig, D.F., and Tong, L. (2005). Structural and biochemical st udies identify tobacco SABP2 as a methyl salicylate esterase and implicate it in plant innate immunity. Proc. Natl. Acad. Sci. 102, 1773-1778. Fransz, P.F., and de Jong, J.H. (2002). Ch romatin dynamics in plants. Current Opinion in Plant Biology 5, 560-567.

PAGE 116

116 Friedrich, L., Lawton, K., Reuss, W., Masner, P., Spe cker, N., Gut Rella, M., Meier, B., Dincher, S., Staub, T., Uknes, S., Mtraux, J.-P., Kessman, H., and Ryals, J. (1996). A benzothiadiazole induces systemic acquired resistance in tobacco. Plant J. 10, 61-70. Fry, W. (1982). Principles of plant disease management. Funke, T., Han, H., Healy-Fried, M.L. Fischer, M., and Schnbr unn, E. (2006). Molecular basis for the herbicide re sistance of roundup ready crops. Proc. Natl. Acad. Sci. 103, 13010-13015 Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessmann, H., and Ryals, J. (1993). Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261, 754-756. Glawischnig, E. (2007). Camale xin. Phytochemistry 68, 401-406. Glazebrook, J. (2005). Contrasting mec hanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43, 205-227. Glazebrook, J., Chen, W., Estes, B., C hang, H.-S., Nawrath, C., Mtraux, J.-P., Zhu, T., and Katagiri, F. (2003). T opology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant J. 34, 217-228. Gomez-Gomez, L., Felix, G., and Boller, T. (1999). A single locus determines the sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant J. 18, 277284. Goodman, R.N., and Novacky, A.J. (1994). The hyper sensitive response in plants to pathogens. (St. Paul: APS Press). Gopalan, S., Bauer, D.W., Al fano, J.R., Loniello, A.O., He, S.Y., and Collmer, A. (1996). Expression of the Pseudomonas syringae avirulence protein AvrB in plant cells alleviates its dependence on the hypersensitive response and pathogenicity (Hrp) secretion system in eliciting genotype-specific hypersensitive cell death. Plant Cell 8, 1095-1105. Grda, C.. (2006). Ireland's Great Fami ne:. University College Dublin Press. Greene, E.A., Codomoa, C.A., Taylora, N.E ., Henikoff, J.G., Till, B.J., Reynolds, S.H., Enns, L.C., Burtner, C., Johnson, J.E., Odden, A.R., Comai, L., and Henikoff, S. (2003). Spectrum of C hemically Induced Mutations From a Large-Scale Reverse-Genetic Screen in Arabidopsis Genetics 164, 731730.

PAGE 117

117 Gundlach, H., Muller, M.J., Kutchan, T.M., and Zenk, M. H. (1992). Jasmonic acid is a signal transducer in elicitor-induced plant cell cultures. Proc. Nat'l Acad. Sci. 89, 2389-2393. Hahn, M.G., Bucheli, P., Cervone, F., D oares, S.H., and O'Neil l, R.A. (1989). Roles of cell wall constituents in plant-pathogen interactions. In PlantMicrobe Interactions: Molecular and G enetic Perspectives, T. Kosuge and E.W. Nester, eds (New Yo rk: Macmilllan), pp. 343-379. Hammond-Kosack, K.E., Tang, S., Harri son, K., and Jones, J.D.G. (1998). The tomato Cf-9 disease resistance gene functions in tobacco and potato to confer responsiveness ot the fungal avrulenc e gene product Avr9. Plant Cell 10, 1251-1266. Hayat, S., and Ahmed, A. (2007). Salicylic acid a plant hormone. (Springer). Heidel, A.J., Clarke, J.D., Antonovics, J., and Dong, X. (2004). Fitness costs of mutations affecting the systemic acquired resistance pathway in Arabidopsis thaliana. Genetics 168, 2197-2206. Heil, M. (2002). Ecological costs of i nduced resistance. Current Opinion in Plant Biology 5, 345-350. Heil, M., Hilpert, A., Kaiser W., and Linsenmair, K.E. (2000). Reduced growth and seed set following chemical induction of pathogen defence: does systemic acquired resistance (SAR) in cur allocation costs? Journal of Ecology 88, 645-654. Hildman, T., Ebneth, M., Pena-Cortes, H., Sanchez-Serrano, J.J., Willmitzer, L., and Prat, S. (1992). General roles of abscisic and jasmonic acids in gene activation as a result of mechanica l wounding. Plant Cell 4, 1157-1170. Holliday, M.J., Keen, N.T., and Long, M. (1981). Cell death patterns and accumulation of fluorescent material in the hypersensitive response of soybean leaves to Pseudomonas syringae pv. glycinea Physiolog. Plant Pathol. 18, 279-287. Huang, B., Johansson, M.J.O., and Byst rom, A.S. (2005). An early step in wobble uridine tRNA modification requires the Elongator complex. RNA 11, 424-436. Jablonowski, D., Frohloff, F., Fichtner, L., Stark, M., and Schaffrath, R. (2001). Kluyveromyces lactis zymocin mode of action is linked to RNA polymerase II function via Elongator. Mo l Microbiol. 42, 1095-1105.

PAGE 118

118 Jacobs, W.P. (1952). The role of auxin in differentiation of xylem around a wound. Amer. J. Bot. 39, 301-309. Jander, G., Norris, S.R., Rounsley, S.D. Bush, D.F., Levin I.M., and Last, R.L. (2002). Arabidopsis map-based cloni ng in the post-genome era. Plant Physiol 129, 440-450. Jensen, P.J., Hangarter, R.P., and Estelle, M. (1998). Auxin tran sport is required for hypocotyl elongation in light-grown but not dark-grown Arabidopsis. Plant Physiol 116, 455-462. Jirage, D., Tootle, T.L., Reuber, T.L., Frost, L.N., Feys, B.J., Parker, J.E., Ausubel, F.M., and Glazebrook, J. (1999). Arabidopsis thaliana PAD4 encodes a lipase-like gene that is impor tant for salicylic acid signaling. Proc. Natl. Acad. Sci. 96, 13583-13588. Johnson, C., Boden, E., and Arias, J. ( 2003). Salicylic acid and NPR1 induce the recruitment of trans -activating TGA factors to a defense gene promoter in Arabidopsis. Plant Cell 15, 1846-1858. Jones, D.A., and Takemoto, D. (2004). Plant innate immunity direct and indirect recognition of general and specific pathogen-associated molecules. Curr Opin Immunol 16, 48-62. Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323329. Kachroo, P., Shanklin, J., Shah, J., Whittle, E.J., and Kle ssig, D.F. (2001). A fatty acid desaturase modulates the activation of defense signaling pathways in plants. Proc. Natl. Ac ad. Sci. 98, 9448-9453. Katagiri, F., Thilmony, R., and He, S.Y. (2002). The Arabidopsis Book: The Arabidopsis thaliana-Pseudomo nas syringae interaction. Kauss, H., Theisinger-Hin kel, E., Mindermann, R., and Conrath, U. (1992). Dichloroisonicotinic and salicylic acid, inducers of systemic acquired resistance, enhance fungal elicitor respons es in parsley cells. Plant J. 2, 655-660. Keen, N.T., and Bruegger, B. (1977). Phytoalexins and chemicals that elicit their production in plants. ACE Symp. Ser. 62, 1-26. Kim, K.-C., Lai, Z., Fan, B., and C hen, Z. (2008). Arabidopsis WRKY38 and WRKY62 transcription factors interact with histone deacetylase 19 in basal defense. Plant Cell 20, 2357-2371.

PAGE 119

119 Kim, Y.S., Schumaker, K.S., and Zhu, J.K. ( 2006). EMS mutagenesis of Arabidopsis. Kinkema, M., Fan, W., and Dong, X. ( 2000). Nuclear localization of NPR1 is required for activation of PR gene expression. Pl ant Cell 12, 2339-2350. Kirik, V., Bouyer, D., Schobinger, U., Bech told, N., Herzog, M., Bonneville, J.M., and Hulskamp, M. (2001). CPR5 is invo lved in cell proliferation and cell death control and encodes a novel transmembrane protein. Curr Biol 11, 1891-1895. Koo, Y.J., Kim, M.A., Kim, E.H., Song, J.T., Jung, C., Moon, J.-K., Kim, J.-H., Seo, H.S., Song, S.I., Ki m, J.-K., Lee, J.S., Cheon g, J.-J., and Choi, Y.D. (2007). Overexpression of salicylic acid carboxyl methyltransferase reduces salicylic acid-mediated pa thogen resistance in Arabidopsis thaliana. Plant Mol Biol. 64, 1-15. Koornneef, A., Rindermann, K., Gatz, C., and Pieterse, C.M. (2008). Histone modifications do not play a major ro le in salicylate-mediated suppression of jasmonate-induced PDF1.2 gene expr ession. Commun Integr Biol. 1, 143-145. Kreig, N.R., and Holt, J.G. (1984). Ber gey's Manual of Systematic Biology. Krogan, N.J., and Greenblatt, J.F. (2001). C haracterization of a six-subunit HoloElongator complex required for the regulated expression of a group of genes in Saccharomyces cerevisiae. Molecular and Cellular Biology 21, 8203. Kunkel, B.N., and Brooks, D.M. (2002). Cr oss talk between signaling pathways in pathogen defense. Curr Opin Plant Biol. 5, 325-331. Kunkel, B.N., Bent, A.F., Dahlbeck, D., I nnes, R.W., and Staska wicz, B.J. (1993). RPS2 an Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains expressing the avirulence gene avrRpt2. Plant Cell 5, 865-875. Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T., and Felix, G. (2006). Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125, 749-760. Lawton, K., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S., and Ryals, J. (1995). Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Molecular Pl ant Microbe Interactions 8, 863-870.

PAGE 120

120 Leathers, H.D., and Foster, P. (2004). The World Food Problem. (Boulder, CO: Lynne Rienner Pub). Lee, H.-I., Len, J., and Raskin, I. (1995). Biosynthesis and metabolism of salicylic acid. Proceedings of the Na tional Academy of Sciences, U.S.A. 92, 4076-4079. Lee, J., Nam, J., Park, H.C., Na, G., Miur a, K., Jin, J.B., Yoo, C.Y., Baek, D., Kim, D.H., Jeong, J.C., Ki m, D., Lee, S.Y., Salt, D.E., Mengiste, T., Gong, Q., Ma, S., Bohnert, H.J., Kwak, S.S ., Bressan, R.A., Hasegawa, P.M., and Yun, D.J. (2007). Salicylic ac id-mediated innate immunity in Arabidopsis is regulated by SIZ1 SU MO E3 ligase. Plant J 49, 79-90. Li, X., Clarke, J.D., Zhang, Y., and Dong, X. (2001a). Activation of an EDS1mediated R -gene pathway in the snc1 mutant leads to constitutive, NPR1independent pathogen resistance. Molecular Plant-Microbe Interactions 14, 1131-1139. Li, X., Zhang, Y., Clarke, J.D., Li, Y ., and Dong, X. (1999). Identification and cloning of a negative regulator of syst emic acquired resistance, SNI1, through a screen for suppressors of npr1-1 Cell 98, 329-339. Li, Y., Takagi, Y., Jiang, Y., Tokunaga, M., Erdjument-Bromage, H., Tempst, P., and Kornberg, R.D. (2001b). A multipro tein complex that interacts with RNA Polymerase II Elongator. Journal of Biological Ch emistry 276, 29628 Loidl, P. (2004). A plant dialect of the histone language. Trends in Plant Science 9, 1360-1385. Lukowitz, W., Gillmor C.S., and Scheible, W.-R. ( 2000). Positional cloning in Arabidopsis. Why it feels good to have a genome initiative working for you. Plant Physiol. 123, 795. Lund, S.T., Stall, R.E., and Klee, H.J. (1998). Ethylene regulates the susceptible response to pathogen infection in tomato. Plant Cell 10, 371-382. Lusser, A. (2002). Acetylated, methylated, remodeled: chromatin states for gene regulation. Current Opinion in Plant Biology 5, 437-443. Mackey, D., Holt, B.F., Wiig, A., and D angl, J.L. (2002). RI N4 interacts with Pseudomonas syringae type III effect or molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743-754.

PAGE 121

121 Mackey, D., Belkhadir, Y., Alonso, J.M. Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a tar get of the type III virulence effector AvrRpt2 and modulates RPS2-mediated re sistance. Cell 112, 379-389. Malamy, J., Hennig, J., and Klessi g, D.F. (1992). Temperature-dependent induction of salicylic acid and it s conjugates during the resistance response to tobacco mosaic virus in fection. Plant Cell 4, 359-366. Maldonado, A.M., Doerner, P., Dixon, R. A., Lamb, C.J., and Cameron, R.K. (2002). A putative lipid transfer prot ein involved in systemic resistance signalling in Arabidopsis Nature 419, 399-403. Maleck, K., Levine, A., Eulgem, T., Morgan, A., Schmid, J., Lawton, K., Dangl, J., and Dietrich, R. (2000). The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nature Genetics 4, 403-410. Martin, J. (1964). The role of the cuticl e in the defense against plant disease. Ann. Rev. Phytopat hol. 2, 81-100. McGuinness, M., and Dowling, D. (2009) Plant-associated bacterial degradation of toxic organic compounds in soil. In t J Environ Res Public Health 6, 2226-2247. Melotto, M., Underwood, W., and He, S.Y. (2008). Role of stomata in plant innate immunity and foliar bacterial dise ases. Annu. Rev. Phytopathol. 46, 101-122. Mtraux, J.-P. (2002). Recent breakthroughs in the study of salicylic acid biosynthesis. Trends in Plant Science 7, 332-334. Mtraux, J.-P., Ahl-Goy, P., Staub, T., S peich, J., Steinemann, A., Ryals, J., and Ward, E. (1991). Induced resistance in cucumber in response to 2,6dichloroisonicotinic acid and pathogens. In Advances in Molecular Genetics of Plant-Microbe Interactions H. Hennecke and D.P.S. Verma, eds (Dordrecht, The Netherlands: Kl uwer Academic Publishers), pp. 432439. Mtraux, J.P., Signer H., Ryals, J., Ward, E., Wyss-Benz, M., Gaudin, J., Raschdorf, K., Schmid, E., Blum, W., and Inverardi, B. (1990). Increase in salicylic acid at the onset of systemic acquired resistance in cucumber. Science 250, 1004-1006.

PAGE 122

122 Mishina, T., and Zeier, J. (2007). Pathogen-associated molecular pattern recognition rather than development of tissue necrosis contributes to bacterial induction of systemic acquir ed resistance in Arabidopsis. Plant J. 50, 500-513. Mosher, R.A., Durrant, W.E., Wang, D. Song, J., and Dong, X. (2006). A comprehensive structurefunction analysis of Arabidopsis SNI1 de nes essential regions and transcriptional repressor activity Plant Cell 18, 1750. Mou, Z., Fan, W., and Dong, X. (2003) Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935944. Nawrath, C., and Mtraux, J. -P. (1999). Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculat ion. Plant Cell 11, 1393-1404. Nelissen, H., Fleury, D., Bruno, L., Robles P., Veylder, L.D., Traas, J., Micol, J.L., Montagu, M.V., In ze, D., and Lijsebettens, M. V. (2005). The elongata mutants identify a functional Elongator complex in pl ants with a role in cell proliferation during organ growth. Proc. Natl. Acad. Sci. 102, 7754 Nelissen, H., Groeve, S.D., Fleury, D. Neyt, P., Bruno, L ., Bitonti, M.B., Vandenbussched, F., Straet end, D.V.D., Yamaguchie, T., Tsukayae, H., Wittersg, E., Jaegera, G.D., Houbenh, A., and Lijsebettens, M.V. (2009). Plant Elongator regulates auxin-rela ted genes during RNA polymerase II transcription elongation. Proc. Na tl. Acad. Sci. Early edition. Nicholson, R., and Hammerschmidt, R. (1992). Phenolic compounds and their role in disease resistance. A nnu. Rev. Phytopathol. 30, 369-389. Niggeweg, R., Thurow, C., Weigel, R., Pf itzner, U., and Gatz, C. (2000). Tobacco TGA factors differ with respect to interaction with NPR1, activation potential and DNA-binding properties. Plant Molecular Biology 42, 775788. Nimchuk, Z., Eulgem, T., Holt, B.F., 3r d, and Dangl, J.L. (2003). Recognition and response in the plant immune syst em. Annu Rev Genet 37, 579-609. Nuhse, T.S., Peck, S.C., Hirt, H., and Boll er, T. (2000). Microbial elicitors induce activation and dual phosphorylation of the Arabidopsis thaliana MAPK 6. J Biol Chem 275, 7521-7526.

PAGE 123

123 Nurnberger, T., Brunner, F., Kemmerling, B., and Piater, L. (2004). Innate immunity in plants and animals: st riking similarities and obvious differences. Immunol Rev 198, 249-266. Okada, Y., Yamagata, K., Hong, K., Waka yam, T., and Zhang, Y. (2009). A role for the elongator complex in zygot ic paternal genome demethylation. Nature 463, 554-558. Ooka, H., Satoh, K., Doi, K.j., Nagata, T., Otomo, Y. Murakami, K., Matsubara, K., Osato, N., Kawai, J., Carninci, P., Hayashizaki, Y., Suzuki, K.j., Kojima, K., Takahara, Y., Yamamoto, K.j., and Kikuchi, S. (2003). Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Research 10, 239. Otero, G., Fellows, J., Li, Y., Bizemont, T.d., Dirac, A.M.G., Gustafsson, C.M., Erdjument-Bromage, H., Tempst, P., and Svejstrup, J.Q. (1999). Elongator, a multisubuni t component of a novel RNA Polymerase II Holoenzyme for transcriptional elo ngation. Molecula r Cell 3, 109. Parnell, S., Gottwald, T., van den Bosch F., and Gilligan, C. (2009). Optimal strategies for the eradication of asiati c citrus canker in heterogeneous host landscapes. Phytopathology 99, 1370-1376. Phipps, T. (1989). Externalities and t he returns to agricultural research: discussion. American Journal of Agricultural Economics 71, 466-467. Pontier, D., Miao, Z.-H., and Lam, E. (2001). Trans-dominant suppression of plant TGA factors reveals their negative and positive roles in plant defense responses. Plant J. 27, 529-538. Rahl, P.B., Chen, C.Z., and Collins, R.N. ( 2005). Elp1p, the Yeast homolog of the FD disease syndrome protein, negatively regulates exocytosis independently of transcriptional elongation Molecular Cell 17. Rao, M.V., Paliyath, G., Ormrod, D.P., Murr, M.P., and Watkins, C.B. (1997). Influence of salicylic acid on H2O2 production, oxidative stress, and H2O2-metabolizing enzymes. Salicylic acid-mediated oxidative damage requires H2O2. Plant Physiol. 115, 137-149. Raskin, I., Turner, I.M., and Melander, W.R. (1989). Regulation of heat production in the inflorescences of Arum lily by endogenous salicylic acid. Proc. Natl. Acad. Sc i. USA 86, 2214-2218. Ritter, C., and Dang l, J.L. (1995). The avrRpm1 gene of Pseudomonas syringae pv. maculicola is required for virulence on Arabidopsis Mol. Plant-Microbe Interact. 8, 444-453.

PAGE 124

124 Roberts, J.A., Tucker, G.A., and Maunders, M.J. (1980). Ethylene and foliar senescence. In Senescence in Plants, K.V. Thimann, ed (Boca Raton, FL: CRC Press), pp. 267-275. Rojo, E., Leon, J., and Sanchez-Serrano, J.J. (1999). Cro ss-talk between wound signalling pathways determines local ve rsus systemic gene expression in Arabidopsis thaliana. Plant J 20, 135-142. Romantschuk, M. (1992). Attachment of plant pathogenic bacteria to plant surfaces. Annu. Rev. Phytopathol. 30, 225-243. Romantschuk, M., and Bamford, D.H. (1986). The causal agent of halo blight in bean, Pseudomonas syringae pv. phaseolicola, attaches to stomata via its pili. Microbial Pathogenesis 1, 139-148. Ronald, P.C., Salmeron, J.M., Carland, F.M., and Staskawicz, B.J. (1992). The cloned avirulence gene avrPto induces disease resistance in tomato cultivars containing the Pto resistance gene. J. Ba cteriol. 174, 1604-1611. Ross, A.F. (1961). System ic acquired resistance induced by localized virus infections in plants. Virology 14, 340-358. Ryals, J., Weymann, K., Lawton, K., Fri edrich, L., Ellis, D., Steiner, H.-Y., Johnson, J., Delaney, T.P., Jesse, T. Vos, P., and Uknes, S. (1997). The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor I kB. Plant Cell 9, 425-439. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., St einer, H.-Y., and Hunt, M.D. (1996). Systemic acquired resistance. Plant Cell 8, 1809-1819. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci., USA 74, 5463-5467. Schenk, P.M., Kazan, K., Wilson, I., A nderson, J.P., Richmond, T., Somerville, S.C., and Manners, J.M. (2000). Coordinated plant defense responses in Arabidopsis revealed by microarray anal ysis. Proc. Natl. Acad. Sci. 97, 11655-11660. Schuler, M.A. (2008). Splice site requireme nts and switches in plants. In Current Topics in Microbiology and Immunology ( Schumacher, K., Vafeados, D., McCarthy, M. Sze, H., Wilkins, T., and Chory, J. (1999). The Arabidopsis det3 mutant reveals a central role for the vacuolar H+-ATPase in plant growth and dev elopment. Genes and Development 13, 3259.

PAGE 125

125 Shah, J. (2003). The salicylic acid loop in plant defense. Current Opinion in Plant Biology 6, 365-371. Shah, J., Tsui, F., and Klessig, D. F. (1997). Characterization of a s alicylic a cidi nsensitive mutant ( sai1) of Arabidopsis thaliana identified in a selective screen utilizing the SA-inducib le expression of the tms2 gene. Molecular Plant-Microbe Interactions 10, 69-78. Shah, J., Kachroo, P., and Klessi g, D.F. (1999). The Arabidopsis ssi1 mutation restores pathogenesis-related gene expression in npr1 plants and renders defensin gene expression salicylic acid dependent. Plant Cell 11, 191-206. Shah, J., Kachroo, P., Nandi, A., and Kles sig, D.F. (2001). A recessive mutation in the Arabidopsis SSI2 gene confers SAand NPR1 -independent expression of PR genes and resistance against bacterial and oomycete pathogens. Plant Journal 25, 563-574. Shirano, Y., Kachroo, P., Shah, J., and Kle ssig, D.F. (2002). A gain-of-function mutation in an Arabidopsis toll inte rleukin receptornucleotide binding siteleucine-rich repeat type R gene triggers defense responses and results in enhanced disease resi stance. Plant Cell 14, 3149. Silva, H., Yoshioka, K., Dooner, H.K., and Klessig, D.F. (1999). Characterization of a new Arabidopsis mutant exhi biting enhanced disease resistance. Molecular Plant-Microbe Interactions 12, 1053-1063. Skou, J.P. (1985). On the enhanced callose deposition in barley with mlo powdery resistance genes. Ph ytopath. Z. 112, 207-216. Smith, D.A. (1982). Toxicity of phytoalexin s. In Phytoalexins, J.A. Bailey and J.W. Mansfield, eds (New York: J ohn Wiley and Sons), pp. 218-252. Smith, T.F., Gaitatzes, C., Saxena, K. and Neer, E.J. (1999). The WD-40 repeat: a common architecture for divers e functions. TIBS 24, 181-184. Song, J.T., Koob, Y.J., Seoc, H.S., Ki me, M.C., Choib, Y. D., and Kimf, J.H. (2008). Overexpression of AtSGT1, an Arabidopsis salicylic acid glucosyltransferase, leads to increased susceptibility to Pseudomonas syringae. Phytochemistry 69, 1128-1134 Spoel, S.H., and Dong, X. (2008). Making sense of hormone crosstalk during plant immune responses. Cell Host & Microbe 3, 348-351. Spoel, S.H., Mou, Z., Tada, Y., Spivey, N.W., Genschik, P., and Dong, X. (2009). Proteasome-mediated turnover of the transcription coactivator NPR1 plays dual roles in regulating plant immunity. Cell 137, 860.

PAGE 126

126 Spoel, S.H., Koornneef, A., Claessens, S.M. C., Korzelius, J.P., Van Pelt, J.A., Mueller, M.J., Buchala, A.J., Metraux J.-P., Brown, R ., Kazan, K., Van Loon, L.C., Dong, X., and Pieterse, C.M. J. (2003). NPR1 modulates crosstalk between salicylateand jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15, 760-770. Stacey, M.G., Hicks, S.N., and Arnim, A.G.v. (1999). Discrete domains mediate the light-responsive nuclear and cytopl asmic localization of Arabidopsis COP1. Plant Cell 11, 349-364. Staskawicz, B.J., Mudgett, M.B., Dangl, J.L., and Galan, J.E. (2001). Common and contrasting themes of plant and animal diseases. Science 292, 22852289. Strawn, M., Marr, S., Inoue, K., Inada, N., Zubieta, C., and Wildermuth, M. (2006). Arabidopsis isochorismate synthase functional in pathogeninduced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses 282, 5919 Tada, Y., Spoel, S.H., Pajerowska-Mukhta r, K., Mou, Z., S ong, J., Wang, C., Zuo, J., and Dong, X. (2008). Plant immunity requires conformational charges of NPR1 via S-nitrosylati on and thioredoxins. Science 321, 952955. Tao, Y., Xie, Z., Chen, W., Glazebrook, J. Chang, H.S., Han, B., Zhu, T., Zou, G., and Katagiri, F. (2003). Quantitat ive nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell 15, 317-330. The Arabidopsis Genome Initiative. ( 2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815. Thompson, J.N., and Burdon, J.J. (1992). Gene-for-gene coevolution between plants and parasites. Nature 360, 121-125. Ton, J., Flors, V., and Mauch-Mani, B. (2009). The multifaceted role of ABA in disease resistance. Trends Plant Sci 14, 310-317. Ton, J., Van Pelt, J.A., Van Loon, L.C., and Pieterse, C.M.J. (2002). Differential effectiveness of salicylate-dependent and jasmonate/ethylene-dependent induced resistance in Arabidopsis Molecular Plant-Microbe Interactions 15, 27-34. Trethwewny, R. (2004). Metabo lite Profiling as an Aid to Metabolic Engineering in Plants. Curr Opin Plant Biol. 7, 196-201.

PAGE 127

127 Turner, N. (2009). From dw arves to giants? Plant height manipulation for biomass yield. Nat Chem Biol 5, 567-573. van Dijk, K., Fouts, D.E., Rehm, A.H., Hill, A.R., Collm er, A., and Alfano, J.R. (1999). The Avr (effector) proteins HrmA (HopPsyA) and AvrPto are secreted in culture from Pseudomonas syringae pathovars via the Hrp (type III) protein secretion system in a temperatureand pH-sensitive manner. J. Bacter iol. 181, 4790-4797. van Kan, A.L. (2006). Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in Plant Science 11, 1360-1385. van Wees, S.C.M., de Swar t, E.A.M., van Pelt, J. A., van Loon, L.C., and Pieterse, C.M.J. (2000). Enhancement of induced disease resistance by simultaneous activation of salicylateand jasmonate-dependent defense pathways in Arabidopsis thaliana Proc. Natl. Acad. Sci. 97, 8711-8716. Verberne, M.C., Verpoorte, R., Bol, J. F., Mercado-Blanco, J., and Linthorst, H.J.M. (2000). Overproduction of salicyl ic acid in plants by bacterial transgenes enhances pathogen resistance. Nature Biotechnology 18, 779783. Vernooij, B., Friedrich, L., Morse, A., Reist, R., Kolditz-Ja whar, R., Ward, E., Uknes, S., Kessmann, H., and Ryals, J. (1994). Salicylic acid is not the translocated signal responsible for inducing systemic acquired resistance but is required in signal trans duction. Plant Cell 6, 959-965. Vidal, S., Eriksson, A.R.B., Montesano, M., Denecke, J., and Palva, E.T. (1998). Cell wall-degrading enzymes from Erwinia carotovora cooperate in the salicylic acid-independent induction of a plant defense response. Molec. Plant-Microbe Interact. 11, 23-32. Wang, D., Amornsiripanitch, N., and D ong, X. (2006). A genomic approach to identify regulatory nodes in the tr anscriptional network of systemic acquired resistance in plant s. PLoS Pathog. 2, e123. Wang, D., Weaver, N.D., Kesarwani, M., and Dong., X. (2005). Induction of protein secretory pathway is required for systemic acquired resistance. Science 308, 1036-1039. Wei, W., Plovanich-Jones, A., Deng, W.-L., Jin, Q.-L., Collmer, A., Huang H.C., and He, S.Y. (1999). The gene codi ng for the Hrp pilus structural protein is required for type III secr etion of Hrp and Avr proteins in Pseudomonas syringae pv. tomato. Proc. Natl. Acad. Sci. 97, 2247-2252

PAGE 128

128 Weigel, D., and Glazebrook, J. (2002). Arabidopsis: A Laboratory Manual. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press). Whenham, R.J., Fraser, R.S.S., and Snow A. (1985). Tobacco mosaic virusinduced increase in abscisic acid concentration in tobacco leaves: intracellular location and relationship to symptom severity and to extent of virus multiplication. Physiological Plant Pathology 26, 379-387. White, R.F. (1979). Acetylsalicylic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco. Virology 99, 410-412. Wiermer, M., Feys, B.J., and Parker, J. E. (2005). Plant immunity: the EDS1 regulatory node. Curr Opin Plant Biol 8, 383-389. Wildermuth, M.C., Dewdney, J., Wu G., and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414, 562-565. Winkler, G.S., Kristjuhan, A., Erdjument-B romage, H., Tempst, P., and Svejstrup, J.Q. (2002). Elongator is a histone H3 and H4 acetyltransferase important for normal histone acetylation levels in vivo. Proc. Natl. Acad. Sci. 99, 3517. Wittschieben, B.O., Otero, G., de Bizemont, T., Fello ws, J., Erdjument-Bromage, H., Ohba, R., Li, Y., Allis C.D., Tempst, P., and Svej strup, J.Q. (1999). A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol. Cell 4, 123. Wittschieben, B.., Fellows, J., Du, W., Stillman, D.J., and Svejstrup, J.Q. (2000). Overlapping roles for the histone acetyltransferase activities of SAGA and Elongator in vivo EMBO J. 19, 3060. Xia, Y., Suzuki, H., Borevi tz, J., Blount, J., Guo, Z., Patel, K., Dixon, R., and Lamb, C. (2004). An extracellula r aspartic protease functions in Arabidopsis disease resistance signaling. EMBO J. 23, 980-988. Yang, P., Chen, C., Wang, Z., Fan, B., and Chen, Z. (1999). A pathogenand salicylic acid-induced WRKY DNA-binding activity recognizes the elicitor response element of the tobacco class I chitinase gene promoter. Plant J. 18, 141-149. Yi, Y., and Jack, T. (1998). An intragenic suppressor of the Arabidopsis floral organ identity mutant apet ala3-1 functions by suppressing defects in splicing. Plant Cell 10, 1465.

PAGE 129

129 Yu, G.L., Katagiri, F., and Ausubel, F.M. (1993). Arabidopsis mutations at the RPS2 locus result in loss of resistance to Pseudomonas syringae strains expressing the avirulence gene avrRpt2 Molecular Plant-Microbe Interactions 6, 434-443. Zhang, X., Chen, S., and Mou, Z. (2009) Nuclear localization of NPR1 is required for regulation of salicylate tolerance, isochorismate synthase 1 expression and salicylate accumulation in Arabidopsis. Journal of Plant Physiology 167, 144 Zhang, Y., and Li, X. (2005). A putative nuc leoporin 96 is required for both basal defense and constitutive resistance responses mediated by suppressor of npr1-1, constitutive 1. Plant Cell 17, 1306. Zhang, Y., Goritschnig, S., Dong, X ., and Li, X. (2003a). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1 Plant Cell 15, 2636-2646. Zhang, Y., Tessaro, M.J., Lassner, M., and Li, X. (2003b). Knockout analysis of Arabidopsis transcription factors TGA2 TGA5 and TGA6 reveals their redundant and essential roles in systemic acquired resistance. Plant Cell 15, 2647-2653. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc. Natl. Acad. Sci. 96, 6523-6528. Zhang, Y., Cheng, Y.T., Bi, D., Palma, K., and Li, X. (2005). MOS2, a protein containing G-patch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Current Biology 15. Zhou, N., Tootle, T.L., Tsui, F., Kl essig, D.F., and Glazebrook, J. (1998). PAD4 functions upstream from salicylic ac id to control defense responses in Arabidopsis. Plant Cell 10, 1021-1030. Zhou, X., Hua, D., Chen, Z., Zhou, Z., and Gong, Z. (2009). El ongator mediates ABA responses, oxidative stress resi stance and anthocyanin biosynthesis in Arabidopsis. Plant J. Ad vanced Online Publication. Zhu, Y., Chen, H., Fan, J., Wang, Y., Li, Y., Chen, J., Fan, J., Yang, S., Hu, L., Leung, H., Mew, T.W., Teng, P.S., Wang, Z., and Mundt, C.C. (2000). Genetic diversity and disease control in rice. Nature 406, 718-722.

PAGE 130

130 BIOGRAPHICAL SKETCH Christopher Thomas DeFrai a was born in Kingston, New York, to parents Gary and Isabelle DeFraia. He has one younger br other, Daniel. In May 2005, he graduated with a Bachelor of Science degree in biot echnology from Rutgers University. In November of 2005, he joined the laboratory of Dr. Zhonglin M ou, where he studies plant immunity and is pursuing his Ph.D.