<%BANNER%>

Mitochondrial Fusion and Fission Dynamics in Aging

Permanent Link: http://ufdc.ufl.edu/UFE0041463/00001

Material Information

Title: Mitochondrial Fusion and Fission Dynamics in Aging
Physical Description: 1 online resource (116 p.)
Language: english
Creator: Seo, Arnold
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aging, apoptosis, biogenesis, fission, fusion, longevity, mitochondria, mitophagy, oxidative, resistance, respiration, stress, yeast
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: A faulty regulation of mitochondrial dynamics is one of the intrinsic causes of mitochondrial dysfunction that potentially leads to oxidative stress and cell death with age. We investigated the role of mitochondrial fusion and fission during chronological aging using molecular genetic techniques and calorie restriction (CR) interventions in Saccharomyces cerevisiae. Chronological aging was measured by determining the number of colony forming units in a stationary phase culture in which cells do not divide, but are metabolically active. We found that both fission and fusion are required for chronological longevity in a normal glucose medium. The deletion of FIS1, DNM1, MDV1 or SHE9, which is required for fission, and the deletion of FZO1 or MGM1, which is required for fusion, reduced chronological life-span (CLS) in the normal glucose medium. However, only mitochondrial fusion genes, namely FZO1 and MGM1, were required for extension of CLS by CR. Wild-type (WT) and fission deficient strains exhibited an extended CLS with CR, but fusion deficient strains did not. To further test the involvement of fusion and fission on aging, mitochondrial morphology, oxidative stress resistance, mtDNA integrity, and cellular respiration were examined. During chronological aging, WT yeast mitochondria gradually became fragmented following growth in the normal glucose, whereas under CR growth conditions, yeast showed a markedly fused network-like mitochondria. As expected, the transition to a network mitochondrial morphology during CR was observed in fission-deficient yeast, but not in fusion-deficient yeast. CR increased cellular resistance to oxidative stress and attenuated oxidative damage in WT and fission-deficient yeast during chronological aging. However, fusion-deficient yeast were highly sensitive to oxidative stress and failed to ameliorate oxidative damage during CR. Although chronological aging reduced mtDNA integrity and cellular respiration, CR completely prevented the loss of mtDNA integrity and enhanced respiration in WT as well as fission-deficient yeast. In contrast, the fusion genes FZO1 and/or MGM1 were required for maintaining mtDNA content and promoting cellular respiration during CR. Our findings indicate that mitochondrial fusion, but not fission, is necessary for CR-mediated CLS extension, and that the anti-aging effects of CR require the modulation of mitochondrial structure and function during chronological aging.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Arnold Seo.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Leeuwenburgh, Christiaan.
Local: Co-adviser: Aris, John P.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041463:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041463/00001

Material Information

Title: Mitochondrial Fusion and Fission Dynamics in Aging
Physical Description: 1 online resource (116 p.)
Language: english
Creator: Seo, Arnold
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aging, apoptosis, biogenesis, fission, fusion, longevity, mitochondria, mitophagy, oxidative, resistance, respiration, stress, yeast
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: A faulty regulation of mitochondrial dynamics is one of the intrinsic causes of mitochondrial dysfunction that potentially leads to oxidative stress and cell death with age. We investigated the role of mitochondrial fusion and fission during chronological aging using molecular genetic techniques and calorie restriction (CR) interventions in Saccharomyces cerevisiae. Chronological aging was measured by determining the number of colony forming units in a stationary phase culture in which cells do not divide, but are metabolically active. We found that both fission and fusion are required for chronological longevity in a normal glucose medium. The deletion of FIS1, DNM1, MDV1 or SHE9, which is required for fission, and the deletion of FZO1 or MGM1, which is required for fusion, reduced chronological life-span (CLS) in the normal glucose medium. However, only mitochondrial fusion genes, namely FZO1 and MGM1, were required for extension of CLS by CR. Wild-type (WT) and fission deficient strains exhibited an extended CLS with CR, but fusion deficient strains did not. To further test the involvement of fusion and fission on aging, mitochondrial morphology, oxidative stress resistance, mtDNA integrity, and cellular respiration were examined. During chronological aging, WT yeast mitochondria gradually became fragmented following growth in the normal glucose, whereas under CR growth conditions, yeast showed a markedly fused network-like mitochondria. As expected, the transition to a network mitochondrial morphology during CR was observed in fission-deficient yeast, but not in fusion-deficient yeast. CR increased cellular resistance to oxidative stress and attenuated oxidative damage in WT and fission-deficient yeast during chronological aging. However, fusion-deficient yeast were highly sensitive to oxidative stress and failed to ameliorate oxidative damage during CR. Although chronological aging reduced mtDNA integrity and cellular respiration, CR completely prevented the loss of mtDNA integrity and enhanced respiration in WT as well as fission-deficient yeast. In contrast, the fusion genes FZO1 and/or MGM1 were required for maintaining mtDNA content and promoting cellular respiration during CR. Our findings indicate that mitochondrial fusion, but not fission, is necessary for CR-mediated CLS extension, and that the anti-aging effects of CR require the modulation of mitochondrial structure and function during chronological aging.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Arnold Seo.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Leeuwenburgh, Christiaan.
Local: Co-adviser: Aris, John P.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041463:00001


This item has the following downloads:


Full Text

PAGE 1

1 MITOCHONDIAL FUSION AND FISSION DYNAMICS IN AGING By ARNOLD YOUNG SEO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Arnold Young Seo

PAGE 3

3 To my parents, for their unconditional love and support throughout the years

PAGE 4

4 ACKNOWLEDGMENTS I thank my mentors, Dr. Christiaan Leeuwenbu rgh and Dr. John P. Aris, and my committee (D r. Jae Sung Kim and Dr. Christy Carter) for provid ing me with great training and for helping me become a scientist. I also deeply appreciate endless support from my parents and my fiancŽe. I could never have come this far without them.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES................................................................ .............................................7 LIST OF FIGURES................................ ..........................................................................8! ABSTRACT................................ ....................................................................................10! CHAPTER 1 NEW INSIGHT INTO ROLE OF MITOCHONDRIA DYNAMICS IN AGING............ 12! Role of Mitochondria in the Aging Process................................ .............................12! Mitochondrial Fusion and Fission Dynamics................................ ...........................14! Regulation of Mitochondrial Fusion and Fission ...............................................14! Mitochondrial Dynamics in Mitochondrial Biology................................ .............17! Mitochondrial genome maintenance................................ ..........................17! Mitochondrial biogenesis................................ ............................................19! Mitophagy................................ ...................................................................21! Apoptosis................................ ....................................................................23! Abnormal Mitochondrial Dynamics in Human Diseases................................ ...26! Neurodegenerative diseases................................ ......................................26! Obesity and type 2 diabetes................................ .......................................29! Mitochondrial Dynamics and Aging................................ .........................................30! Summary................................ .................................................................................33! 2 THE ROLE OF MITOCHONDRIAL FUSION AND FISSION IN Saccharomyces cerevisiae DURING CHRONOLOGICAL AGING .................................................... 38! Introduction................................ ..............................................................................38! Results....................................................................................................................41! Global Effects of Aging and Calorie Restriction on Mitochondrial Morphology, Oxidative Stress, and Cell Death..............................................41! Mitochondrial morphology changes during chronological aging and in low glucose medium................................................................................41! Low glucose medium attenuates oxidative stress and cell death as well as increases oxidative stress resistance during chronological aging......42! A network mitochondrial structure is associated with oxidative stress resistance................................................................................................44! The Role of Mitochondrial Fusion and Fission Genes in Chronological Aging.45! Low glucose medium modulates fusion and fission gene expression during chronological aging......................................................................45! Mitochondrial fusion is required for the formation of network mitochondria............................................................................................46

PAGE 6

6 Mitochondrial fusion genes are n ecessary for chronological longevity ...... 47! The Impact of Fusion Enhancement on Oxidative Stress, mtDNA Integrity and Cellular Respiratory Function ................................ ................................ 48! Mitochondrial fusion is required for oxidative st ress resistance ................. 48! Mitochondrial fusion is required for preventing accumulation of oxidative damage ................................ ................................ ................................ ... 50! Mitochondrial fusion is required for maintaining mtDNA contents and cellular respiration ................................ ................................ ................... 52! Discussion ................................ ................................ ................................ ............... 54! 3 CONCLUDING REMARKS AND FUTURE DIRECTIONS......................................77 4 MATERIALS AND METHODS................................................................................81! Yeast Strains...........................................................................................................81! General Microbiological Methods............................................................................81! Methods for Yeast Calorie Restriction.....................................................................81! Determination of Chronological Life Span...............................................................82! Stress Resistance Test...........................................................................................82! Evaluation of Mitochondrial Morphology.................................................................82! Determination of RNA/DNA Oxidation.....................................................................83! Determination of Cell Death....................................................................................84! Determination of mRNA Levels...............................................................................84! Determination of mtDNA Copy Number..................................................................86! Measurement of Cellular Respiration......................................................................87! Statistical Analysis...................................................................................................87! APPENDIX A CLS IN CEN.PK STRAINS......................................................................................92! B STRESS RESISTANCE TEST................................................................................93! C WATER-WASH AND CELLULAR RESPIRATION..................................................94! D MITOCHONDRIAL FUSION AND FISSION GENE EXPRESSION DURING CLS.........................................................................................................................95! LIST OF REFERENCES................................................................................................96! BIOGRAPHICAL SKETCH..........................................................................................116

PAGE 7

7 LIST OF TABLES Table page 2 1 The components of mitochondrial fusion and fission in yeast ............................. 76 4 1 Yeast strains ................................ ................................ ................................ ....... 88 4 2 Sequence of primers ................................ ................................ ........................... 91

PAGE 8

8 LIST OF FIGURES Figure page 1 1 The role of oxidative stress, mitochondrial senescence, and cell death in the aging process ................................ ................................ ................................ ...... 34 1 2 Schematic illustration depicting the core proteins of the molecular machineries modulating mitochondrial fusion and fission in yeast and mammals. ................................ ................................ ................................ ............ 35 1 3 Possible relations hip between mitochondrial fusion, fission, biogenesis and mitophagy.. ................................ ................................ ................................ ......... 36 1 4 Model for the role of mitochondrial fusion and fission in aging. .......................... 37 2 1 Mitochondrial morphologies observed during chro nological aging and under low glucose growth conditions. ................................ ................................ ........... 62 2 2 Low glucose medium increases network mitochondria during chronological aging. ................................ ................................ ................................ .................. 63 2 3 Low glucose medium decreases oxidative stress a nd cell death during chronological aging. ................................ ................................ ............................ 64 2 4 Low glucose medium increases stress resistance against oxidative stress during chronological aging. ................................ ................................ ................. 65 2 5 Increased stress resistance against oxid ants correlates with mitochondrial morphological changes. ................................ ................................ ...................... 66 2 6 Expression of fusion and fission genes during chronological aging. ................... 67 2 7 Gallery of images showing mitochondrial morphology in fus ion and fission mutants. ................................ ................................ ................................ .............. 68 2 8 Mitochondrial morphology changes during chronological aging in fusion and fission mutants. ................................ ................................ ................................ ... 69 2 9 Chronological life spans of fusion and fission deficient cells du ring calorie restricted growth conditions. ................................ ................................ ............... 70 2 10 Mitochondrial fusion is required for increasing oxidative stress resistance by the low glucose medium during chronological aging. ................................ ......... 71 2 11 Water w ash intervention enhances oxidative stress resistance in the fission deficient cells, but not in fusion deficient cells. ................................ ................... 72

PAGE 9

9 2 12 Low glucose medium is not sufficient to delay the accumulation of oxidative stress in fusion defi cient cells. ................................ ................................ ............ 73 2 13 Low glucose medium preserves mtDNA content in the presence of mitochondrial fusion components. ................................ ................................ ...... 74 2 14 Low glucose medium enhances cellular respiration in WT and fission defic ient strains, but not in fusion deficient strains. ................................ ............ 75 4 1 Schematic illustration depicting two routine methods for calorie restriction during yeast chronological aging ................................ ................................ ........ 89 4 2 Schematic illustratio n depicting method for stress resistance test during yeast chronological aging ................................ ................................ ............................. 90

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirem ents for the Degree of Doctor of Philosophy MITOCHONDRIAL FUSION AND FISSION DYNAMICS IN AGING By Arnold Young Seo May 2010 Chair: Christiaan Leeuwenburgh Cochair: John P. Aris Major: Medical Sciences Molecular Cell Biology The dynamic regulation of mi tochondrial fusion and fission processes is a key mechanism that modulates cellular redox status, mtDNA integrity, organellar function, and cell death. Thus, a faulty regulation of mitochondrial dynamics may be one of the intrinsic causes of mitochondrial dysfunction that accelerates the aging process. We investigated the role of mitochondrial fusion and fission during chronological aging using molecular genetic techniques and calorie restriction (CR) interventions in Sac charomyces cerevisiae Chronological aging was measured by determining the number of colony forming units in a stationary phase culture in which cells do not divide but are metabolically active. We found that both fission and fusion are required for chronological longevity in a normal glucos e medium. The d eletion of FIS1 DNM1 MDV1 or SHE9 which is required for fission, and the deletion of F ZO1 or MGM1 which is required for fusion, reduced chronological life span (CLS) in the normal glucose medium. However, only mitochondrial fusion genes, namely FZO1 and MGM1 w ere required for extension of CLS by CR Wild type (WT) and fission deficient yeast exhibited an extended CLS with CR, but fusion deficient strains did not. To further test

PAGE 11

11 the involvement of fusion and fission on aging mitochondri al morphology, oxidative stress resistance, mtDNA integrity, and cellular respiration were examined. During chronological aging, WT yeast mitochondria gradually became fragmented following growth in the normal glucose, whereas under CR growth conditions, y east cells showed a markedly fused "network" of mitochondria As expected, the transition to a "network" mitochondrial morphology during CR was observed in fission deficient yeast, but not in fusion deficient yeast. CR increased cellular resistance to oxid ative stress and attenuated oxidative damage in WT and fission deficient yeast during chronological aging. However, fusion deficient yeast cells were highly sensitive to oxidative stress and failed to ameliorate oxidative damage during CR Although chronol ogical aging reduced mtDNA integrity and cellular respiration, CR completely prevented the loss of mtDNA integrity and enhanced respiration in WT as well as fission deficient yeast In contrast, the fusion genes FZO1 and/ or MGM1 were required for maintaini ng mtDNA content and promoting cellular respiration during CR. Our findings indicate that mitochondrial fusion, but not fission, is necessary for CR mediated CLS extension, and that the anti aging effects of CR require the modulation of mitochondrial struc ture and function during chronological aging. Our study provide s new insight into the contribution of the dynamic nature of mitochondria to the aging process giving us integrated and comprehensive knowledge on the relation between mitochondrial function a nd the fusion and fission dynamics in the aging process The m echanisms discovered in our study may lead to the discovery of biological targets to develop specific therapeutic interventions that can improve mitochondrial function, thereby reducing the inci dence of aging related diseases in human.

PAGE 12

12 CHAPTER 1 NEW INSIGHT INTO ROL E OF MITOCHONDRIA DY NAMICS IN AGING Role o f Mitochondria in the Aging Process The aging process results in a gradual and progressive structural and functional deterioration of biomole cules that is associated with many pathological conditions, including cancer, neurodegenerative diseases, as well as sarcopenia and liver dysfunction (Chung et al., 2009; Chung et al., 2008; Seo et al., 2006) Alth ough several theories have been proposed to explain the fundamental mechanisms mediating these age related diseases and conditions, the free radical theory of aging is by far the most popular. This theory proposes that cumulative damage to biological macro molecules by oxygen radicals (reactive oxygen species; ROS) leads to irreversible cell damage and an overall functional decline (Harman, 1956) Consistent with a connection between the mitochondri al genome and its roles in redox biology, this theory has been extended to include mitochondria on the basis that the accumulation of mtDNA mutations and deletions associated with aging can impair respiratory chain function and enhance ROS production (Chomyn and Attardi, 2003; Harman, 1972) The increased ROS production can subsequently lead to a vicious cycle of exponentially increasing mtDNA damage and oxidative stress levels within the cell (Bandy and Davison, 1990; Hiona and Leeuwenburgh, 2008; Kujoth et al., 2006; Seo et al., 2006; Seo et al., 2008) (Fig. 1 1). Although various genetic problems in mitochondria cause phenotypes that resemble premature aging (Wallace and Fan, 2009) additional support of this theory was provided by studies showing a direct link between mtDNA mutations and mammalian aging. In particular, mice with a proof reading deficient version of PolgA, the catalytic subunit of the mitochondrial D NA polymerase (POLG) accumulate mtDNA mutations

PAGE 13

13 that are associated with impaired respiratory chain function and increased levels of cell death (apoptosis). These mtDNA mutator mice with accelerated levels of mutations had a shorter life span and display ed aging related phenotypes (i.e., hair loss, kyphosis, osteoporosis and sarcopenia) at an early age (Kujoth et al., 2005; Trifunovic et al., 2004) Interestingly, these changes were not accompanied by increa sed le vels of oxidative stress. These oxidative stress findings have since been confirmed in humans (Hutter et al., 2007) and have resulted in much controversy regarding the idea that mtDNA mutations contribute to aging through increased ROS production and enhanced oxidative stress levels with in mitochondria. However, it is possible that the accumulation of mtDNA mutations that occur with age leads to alternation in cell signaling pathways that can induce cell dysfunction and initiate apoptosis, irrespective of elevations in ROS production and oxidative stress in mitochondria. Whether mtDNA mutations play a causal role in the aging process is still an ongoing debate; however, the functional decline in mitochondria with age and the critical role of proper functioning mitochondria in longevity and age related diseases cannot be refuted. It is well established that mitochondria are highly motile and remarkably plastic organelles that continuously undergo fusion and fission to actively alter their morphology. In addition, the dynamic regulation of mitochondrial fusion and fission processes is found to be an important mechanism that modulates cellular redox status, mtDNA integrity, organellar function, and cell death (Liesa et al., 2009) Notably, genetic defects in mitochondrial fusion and fission components lead to severely altered mitochondrial shape, loss of mtDNA integrity, increased oxidative stress and apoptotic cell death, subsequently causing de velopmental abnormality, neuromuscular

PAGE 14

14 degeneration and metabolic disorders in human (Chen and Chan, 2009) However, despite these premis es, the relevance of mitochondrial fusion and fission to underlying mechanisms of aging has not been fully appreciated in the field, especially considering that the precise role s of many events underlying the aging process ha ve not been fully elucidated. I n this chapter, we discuss current topics of mitochondrial fusion and fission dynamics and mitochondrial structure and function in relation to key cellular events including mtDNA homeostasis, mitochondrial biogenesis, autophagy, and cell death. By acquirin g a basic understanding of mitochondrial fusion and fission and their general function in these critical biological processes during normal stable environmental conditions, we hope to assemble an image portraying how mitochondrial fusion and fission events contribute to the mitochondrial dysfunction that is commonly associated with aging. Mitochondrial Fusion and Fission D ynamics Regulation of Mitochondrial Fusion and F ission Mitochondria are highly complex and dynamic organelles that have the ability to al ter their organization, shape, and size, depending on intracellular and extracellular signals (Bereiter Hahn and Voth, 1994; Rube and van der Bliek, 2004) Mitochondria undergo a continuous cycle of fusion and fiss ion and the balance between these opposing events determines the morphology of the organelle (Chen and Chan, 2004) (Fig. 1 2). Therefore, while a loss of fusion results in mitochondrial fragmentation through excessive fission, a decrease in the fission process can genera te long and highly interconnected mi tochondria (Sesaki and Jensen, 1999) During the last decade, various cellular components have been identified as key mediators in the fusion and fission processes in yeast (Hoppins et al., 2007; Merz et al.,

PAGE 15

15 2007; Okamoto and Shaw, 2005) Many are structurally and functionally conserved in mammals, indicating the ubiquitous importance of the fusion and fission pathway in mitochondrial bio logy (for a detailed review, see (Liesa et al., 2009; Schafer and Reichert, 2009; Westermann, 2008) ) (Fig. 1 2A). In mammals, the most studied proteins involved in mitochondrial fusion are the dynamin related guano sine triphosphatases (GTPases), mitofusin 1 and 2 (Mfn1 and Mfn2). Mfn1 and Mfn2, the human orthologues of Drosophila and yeast Fuzzy onion (Fzo) proteins, are anchored to the mitochondrial outer membrane through the C terminal membrane binding domain with the N terminal GTPase domain present within the cytoplasm (Rojo et al., 2002) Both Mfn proteins mediate fusion through their active GTPase domains by tethering opposing mitochondria membranes (Chen et al., 2003; Eura et al., 2003) Mammalian paralogues Mfn1 and Mfn2 have greater than 70% sequence similarity and share much of the same functional domain organization (Zhang and Chan, 2007) Despite the redundancies in function, these proteins possess sev eral distinct properties suggesting that they fulfill different roles in the fusion process (de Brito and Scorrano, 2008; Eura et al., 2003; Ishihara et al., 2004) Moreover, while both genes are widely expressed, Mfn2 is highly abundant in heart and skeletal muscle with low levels being reported in numerous other human tissues (Bach et al., 2003; Santel et al., 2003) The recent discovery of Mfn2's involvement in several ot her cellular processes including, oxidative metabolism, cell cycle progression, and cell death, to name a few, has raised much interest in the physiological role of this protein and its involvement in human pathology.

PAGE 16

16 Mitochondrial fusion involves multiple steps, including mitochondrial tethering and fusion of outer membranes, docking and fusion of the inner membranes, and mixing of intramitochondrial components (Ishihara et al., 2004) Inner membrane fusion is cont rolled by another dynamin related GTPase, Opa1 (yeast orthologue, Mgm1p) which was first identified through its linkage to a neurodegenerative disease known as autosomal dominant optic atrophy (ADOA). Opa1 is targeted and imported to mitochondria by a clea vable N terminal presequence and exists as both a full length integral inner membrane protein and a soluble intermembrane space poly peptide (Alexander et al., 2000) Alternative splicing of the OPA1 transcript gene rates several isoforms of this protein that are differentially expressed in a wide variety of species (Delettre et al., 2001) Although the precise function of these isoforms is not known, Opa1 is believed to play a constitutive role in inner membrane fusion and remodeling of mitochondrial cristae structure (Frezza et al., 2006) To complicate matters further, the levels of Opa1 are also controlled by proteolytic cleavage an d a decrease in the amount of long/short isoforms, for example, has been shown to be important in mitochondrial fragmentation mediated cell death (Arnoult et al., 2005; Duvezin Caubet et al., 2006) The regulation of mitochondrial fission in mammalian cells is controlled by two key proteins, dynamin related protein 1 (Drp1; Dnm1p in yeast) and fission protein 1 (Fis1) (Fig. 1 2B). Drp1 is predominately located in the cytosol and is recruited to mitochondrial surfa ces, where it associates with Fis1 and assembles into foci that serve as potential scission sites for future fission events (Smirnova et al., 2001) Earlier studies revealed that when Drp1 was inhibited, wild type mitochondria were transformed into long and interconnected organelles (Pitts et al., 1999) and conversely

PAGE 17

17 overexpression of Drp1 in cells resulted in mitochondrial fragmentation (Arnoult et al., 2005) The finding that Drp1 activity is post translationally mo dified (i.e., by phosphorylation, ubiquitination, and sumoylation) has introduced another level of cellular control whereby complex intracellular signaling pathways regulate mitochondrial morphology during altered states of mitochondrial function by modula ting activity of Drp1 (Wasilewski and Scor rano, 2009) In contrast to Drp1, mammalian Fis1 is primarily localized to the mitochondrial outer membrane (MOM) by a transmembrane domain located in the C terminal region (Suzuki et al., 2003) Fis1 overexpress ion in cultured cells results in mitochondrial fragmentation and depletion of Fis1 leads to elongated mitochondria (Yoon et al., 2003) The role of Fis1 in mitochondrial fission is primarily as an anchor protein fo r Drp1, which is supported by its lack of GTPase activity (Wasilewski and Scorrano, 2009) In mammalian cells, fission also requires several accessory proteins including MTP18 (Tondera et al., 2005) endophilin B1/Bif 1 (Karbowski et al., 2004; Takahashi et al., 2005) GDAP1 (Niemann et al., 2005) and DAP3 (Mukamel and Kimchi, 2004) Extensive research is ongoing to understand the cellular and molecular mechanisms regulating mitochondria morphology in mammalian cells. However, more work is required to identify new proteins involved in regulating mitochondrial dynamics and more importantly the upstream events that trigger and contro l mitochondrial dynamics. Mitochondrial Dynamics in Mitochondrial B iology Mitochondrial genome maintenance Mitochondria are unique in animal cells in that they contain their own genome organized in nucleoids throughout mitochondrial matrix (Bibb et al., 1981; Legros et al.,

PAGE 18

18 2004) The maintenance of mitochondrial DNA (mtDNA) is crucial because mtDNA encodes proteins that are critical for oxidative phosphorylation and ATP synthesis (Wallace and Fan, 2009) Mito chondrial dynamics is imperative for the segregation and transmission of mtDNA and numerous studies have shown a relationship between mitochondrial morphology and genomic stability. These observations were originally reported in yeast in studies showing th at defects in Fzo1p and Mgm1p (orthologues of mammalian Mfns and Opa1, respectively) resulted in slow growth on rich medium and loss of mtDNA (Hermann et al., 1998; Rapaport et al., 1998) Later studies in mammalia n cells were in agreement with these findings and confirmed the role of Mfn1, Mfn2, and Opa1 in mtDNA maintenance (Chen et al., 2007) Interestingly, depletion of Drp1 in HeLa cells also results in mitochondrial dysfunction through a loss in mtDNA, suggesting the importance of Drp1 in the proper maintenance of mitochondrial inheritance, as well as mitochondrial function (Parone et al., 2008) Of equal inte rest was the finding that loss of Drp1 and Fis1 in human cells increased the relative levels of mutant mtDNA. This study suggests that alterations in fission proteins can influence the segregation of mutant and wild type mtDNA and speculates that the selec tion of mtDNA variants is a result of the complex interplay between the fusion and fission apparatus, redox signals on mtDNA replication, and mitochondrial damage control proc ess (autophagy) (Malena et al., 2009) Recently, it has been also postulated that the size and complexity of mtDNA nucleoid structure can influence the progression of mtDNA damage accumulation through mitochondrial fusion and fission pathways in the aging process of many somatic tissues (Bogenhagen, 2009) In particular, mi tochondrial fusion mediated genetic complementation in the large nucleoids containing multiple

PAGE 19

19 mtDNA impedes the removal of mtDNA deletions and/or point mutations. In contrast, in the case of a cell containing simpler mtDNA nucleoid organization with fewer mtDNA copies (e.g., oocytes), mitochondrial fission may promote the removal of mtDNA insults by targeting the dysfunctional mitochondria to autophagic degradation. However, although significant advancements have been made in understanding the role of mito chondrial dynamics in mtDNA transmission, segregation and stability, additional studies are required to establish a direct association between mitochondrial morphology proteins and organization of mtDNA nucleoids in the aging process. Moreover, the possibi lity that the fusion and fission components affect the levels of other regulatory proteins involved in mtDNA maintenance (i.e., mitochondrial DNA polymerase gamma and mitochondrial transcription factor A) cannot be ruled out and requires further analysis. Mitochondrial biogenesis A constant renewal of mitochondria is critical to maintain healthy mitochondria with age. Accurate organellar turnover requires the coordination between two key cellular processes; mitochondrial biogenesis and selective degradatio n (autophagy). Although a clear understanding of the molecular details controlling mitochondrial turnover is lacking, what is known is that increased mitochondrial number and mass results from the growth and division of pre existing organelles. The capaci ty for mitochondrial biogenesis diminishes with age and this is an important parameter in the mitochondrial dysfunction associated with aging (Fannin et al., 1999; Sugiyama et al., 1993) The induction of organell e biogenesis can occur in response to several physiological stimuli including muscle myogenesis, exercise, cold exposure, and calorie restriction (Civitarese et al., 2007; Holloszy, 1967; Holloszy and Booth, 1976;

PAGE 20

20 K lingenspor, 2003; Moyes et al., 1997) Interestingly, tissues with high rates of aerobic metabolism such as skeletal muscle and heart have pronounced mitochondrial networks with a high capacity for mitochondrial biogenesis (Bakeeva et al., 1978; Hood, 2001; Kirkwood et al., 1986) Peroxisome proliferators activated receptor coactivator 1 (PGC 1 ) is the most well known intracellular mediator of organelle biogenesis (Scarpulla, 2008) and is a transcriptional coactiv ator that coordinates the activity of key nuclear encoded mitochondrial genes that are required for the proper functioning of the organelle (Mootha et al., 2004; Wu et al., 1999) Interestingly, PGC 1 has recently been reported to induce the expression of mitochondrial fusion genes (Mfn1 and Mfn2) (Cartoni et al., 2005; Soriano et al., 2006) Specifically, PGC 1 and nuclear receptor estrogen receptor alpha (ERR ) expressio n were shown to precede the upregulation of Mfn1 and Mfn2 mRNA in human subjects following endurance exercise (Cartoni et al., 2005; Garnier et al., 2005) Furthermore, calorie restriction induced mitochondrial bio genesis in mice increases Mfn1 and Mfn2 expression levels in several tissues (Nisoli et al., 2005) Among the many activators of PGC 1 AMP activated kinase (AMPK) appears to be the most critical in the regulation of mitochondrial metabolism and biogenesis in aging. Reduced AMPK activity has been reported in aged animals and is directly linked with age related insulin resistance and impaired fatty acid oxidation (Qiang et al ., 2007; Reznick et al., 2007) Moreover, endurance training (Coggan et al., 1992; Jubrias et al., 2001; Menshikova et al., 2006) and calorie restriction (Baker et al., 200 6; Coggan et al., 1992; Hepple et al., 2006; Jubrias et al., 2001) have been reported to increase mitochondrial biogenesis and attenuate the age associated phenotype in skeletal muscle by increasing PGC 1 levels.

PAGE 21

21 Collectively, these studies indicate that alteration of mitochondrial morphology is a key component in the m itochondrial adaptations that occur in response to mitochondrial biogenesis. However, these studies are not sufficient to reveal the functional relationship between mitochondrial dynamics and biogenesis and how fusion and fission events contribute to mitoc hondrial turnover. Further characterization of the relationship between mitochondrial dynamics, biogenesis, and degradation will be imperative in providing better insight into the mechanisms by which age disrupts the homeostatic regulation of mitochondrial turnover (Fig. 1 3). Mitophagy The cell contains a number of intracellular repair and renewal mechanisms, one of the most prominent being autophagy, which sequesters and degrades intracellular components by lysosomal machinery (Yorimitsu and Klionsky, 2005) In healthy cells, autophagy is essential for the removal of damaged or energy deficient mitochondria that would otherwise accumulate and induce mitochondria mediated cell death (Wohlgemuth et al., 2010) The selective degradation of damaged mitochondria (also known as mitophagy) has been shown in fibroblasts from patients harboring mtDNA mutations and a greater autophagic response has been observed in these patient cells when compared to control cells (James et al., 1996) The degradation of mitochondria is particularly important for long lived postmitotic cells that possess a low regenerative capacity and experience high levels of oxidative damage. Indeed, reduced lysosomal degradative capacity and au tophagy have been reported in aged hepatocytes (Donati et al., 2001; Terman, 1995) and more recently been shown in skeletal muscle from aged Fisher 344 rats (Wohlgemuth et al., 2010) Interestingly, numerous studies have reported the accumulation of enla rged (often

PAGE 22

22 referred to as giant) or highly interconnected mitochondria in aging cells (Murakoshi et al., 1985; Tandler and Hoppel, 1986) These mitochondria are typically characterized by low ATP production, loss of cristae structure, and a swollen morphology (Terman and Brunk, 2005) Although the role of these giant mitochondria remains unclear, it has been postulated that the formation of these mitochondria is due to dysregulated mitochondrial morphology processes This is corroborated by studies conducted in both replicative senescence models and aging animals, where abnormal mitochondria were associated with an overall shift towards greater fusion events resulting predominately from the downregulation of fission proteins (Lee et al., 2007; Yoon et al., 2006) Repression of Fis1 has been shown to cause prolonged mitochondrial elongation (fusion) and senescence related phenotypes (i.e. reduced mitochondrial membrane potenti al #$ m and increased ROS), whereas overexpressed Fis1 inhibits senescence (Lee et al., 2007; Yoon et al., 2006) Intriguingly, in response to oxidant induced damage, mitochondrial fission generates daughter mitocho ndria with dissimilar properties (i.e., #$ m) that can subsequently be targeted for degradation by autophagy (Gomes and Scorrano, 2008; Twig et al., 2008) These depolarized mitochondria no longer have the capacity to fuse with other mitochondria which is consistent with the lower Opa1 levels observed in these cells. The fragmentation of mitochondria is a prerequisite for autophagy (Twig et al., 2008) which may be physiologi cally favorable because smaller mitochondria sh ould be autophagocytosed more easily than larger ones and require less energy. Therefore, in healthy cells, fission may function to prevent the sustained elongation of mitochondria that may induce cellular se nescence and may do this in part through autophagy and the selective clearance of damaged organelles. It is important to

PAGE 23

23 note that prolonged mitochondrial elongation in these conditions was not associated with mitochondrial biogenesis but with impaired mi tochondrial respiration activity and higher ROS production (Lee et al., 2007; Yoon et al., 2006) This response drastically differs from previous findings where mitochondrial fusion promotes complementation of mtDN A mutations, preserving the function of healthy organelles and attenuating further damage to the cell (Ono et al., 2001; Sato et al., 2006; Sato et al., 2009; Westermann, 2002) Apoptosis It is well known that mito chondria play a crucial role in mediating apoptosis (Green, 1998) and a key event in this process involves the permeabilization and remodeling of mitochondrial membranes, permitting the release of apopto genic factors such as cytochrome c (Liu et al., 1996) and AIF (Susin et al., 1999) from the in t ermembrane space into the cytosol (Kro emer et al., 2007) These apoptogenic factors can then initiate apoptosis through caspase dependent or independent pathways (Green and Kroemer, 2004) In addition to various physiological and electrochemical factors including oxidative stress and Ca 2+ signals, mitochondrial outer membrane permeabilization (MOMP) depends on the relative abundance of various pro apoptotic (e.g., Bax and Bak) and anti apoptotic proteins o f the Bcl 2 family, their sub cellular localization, and oligomerization states (Kroemer et al., 2007) It is well established that apoptosis is increased in aging and significantly contributes to the loss of cells and the pathogenesis of several age related diseases (Marzetti et al., 2008) First described less than a decade ago, mitochondria in cells undergoing apoptosis were drastically altered and converted from long reti cular tubules to small puncta like organelles (Frank et al., 2001) Since then, mitochondrial fusion and

PAGE 24

24 fission proteins have been shown to be widely involved in apoptosis, regulating not only mitochondrial morpho logy but also mitochondria dependent cell death (Yamag uchi and Perkins, 2009) This is primarily based on the finding that overexpression of the dominant negative mutant Drp1 K38A induces mitochondrial fusion and confers resistant to apoptosis by preventing a loss in #$ m and inhibiting cytochrome c release (Breckenridge et al., 2003; Brooks et al., 2009; Frank et al., 2001; Karbowski et al., 2002) Moreover, these studies revealed that silencing of Drp1 was not associated with reduced Bax translocation to mitochondria, suggesting that Drp1 functions downstream of Bax during apoptosis. Drp1 mediated cytochrome c release is selective, as Drp1 induced cristae remodeling does not affect the release of SMAC (second mitochondria derived activator caspases)/Diablo, a pro apopt otic protein located in the intermembrane space (Arnoult et al., 2005; Germain et al., 2005; Parone et al., 2006; Scorrano et al., 2002) The role of Drp1 as a pro fission and pro apoptotic protein is dependent on its stable association to the mitochondrial membrane and governed by sumoylation and Bax/Bak (Wasiak et al., 2007) as well as other posttranslational modification pathways (Chang and Blackstone, 2007; Cribbs and Strack, 2007) Similar to Drp1, downregulation of Fis1 significantly enhances fusion and inhibits cell death (Lee et al., 2004) However, in some cell types, mitochondrial f ragmentation has been shown to occur following MOMP and cytochrome c release (Dinsdale et al., 1999; Gao et al., 2001; Parone et al., 2006; Zhuang et al., 1998) and also in the absence of any detectable cell death (Alirol et al., 2006) Once again, this illustrates that while the role of fission components in mitochondrial morphology and cell death are closely associated, they are clearly distinct from one another.

PAGE 25

25 As menti oned above, Mfn2 colocalizes with Drp1 and Bax within mitochondrial foci (Karbowski et al., 2002) and directly associates with anti apoptotic family members (Delivani et al. 2006) and Bak (Brooks et al., 2007) Mitochondrial fusion has been shown to be inhibited following MOMP (Brooks et al., 2007) and this is primarily due to repression of Mfn2 activity by Bax (Karbowski et al., 2002; Karbowski et al., 2006) Moreover, overexpression of Mfn2 or inhibiting its presence in mitochondrial foci prevents the translocation of Bax to mitochondria and/or dela ys MOMP (Karbowski et al., 2006; Neuspiel et al., 2005) A decrease in mitochondrial fusion, as a result of reduced Opa1, can also influence the progression of cell death pathways (Lee et al., 2004; Olichon et al., 2003) Knock down of Opa1 using small interfering RNA (siRNA) results in increased mitochondrial fission and decreased #$ m in HeLa cells, leading to abnormal alterations in mitochondrial cristae, mitochondrial fragmentation, and the release of cytochrome c (Olichon et al., 2003) In summary, these studies support a model whereby cross talk between mitochondrial fus ion and fission machinery and members of the Bcl 2 family allow fine control of mitochondrial pore formation and release of apoptogenic factors from the mitochondria. What is more, these studies collectively highlight the strong relationship between mitoch ondrial morphology and the susceptibility to apoptosis. However, the real challenge has been drawing a clear distinction between mitochondrial morphology events and the induction of cell death, which is particularly relevant in aging where tissues are high ly susceptible to increased oxidative stress and have high incidence of apoptosis (Dirks and Leeuwenburgh, 2005; Dupont Versteegden, 2005; Seo et al., 2008) Given that increased fusion and/or decreased fission app ear to confer resistance

PAGE 26

26 to cell death, manipulating the levels of mitochondrial fusion and fission machinery may be a potential way to ameliorate unwanted cell death and delay the onset of age related conditions such as sarcopenia, metabolic diseases, and neurodegenerative disorders. Abnormal Mitochondrial D ynamics in Human D iseases Neurodegenerati ve d iseases The vital roles that mitochondria perform are especially important in neuronal health and function. This is because the structural dynamic nature of mitochondria is critical for neuronal high energy demands for axonal and dendritic transport of intracellular cargo and the packaging and release of neurotransmitters at the synapse. Additionally, dynamic reconfiguration of mitochondrial membrane structure is required for maintaining neuronal membrane potentials and Ca 2+ homeostasis, both of which are crucial for the health of neurons (Knott et al., 2008) This is why the roles of mitochondrial dynamics in neuronal function are manifested in various neuro pathies caused by inherited genetic mutations in several proteins of mitochondrial fusion and fission machinery including ADOA (mutations in OPA1), Charcot Marie Tooth neuropathy type 2A (mutations in Mfn2), and Charcot Marie Tooth neuropathy type 4A (muta tions in GDAP1) (Liesa et al., 2009) Moreover, many recent studies have also revealed mitochondrial dynamics as a component in the age associated major neur odegenerative diseases including Alzheimer's disease (AD) and Huntington's disease (HD), as well as Parkinson's disease (PD). As frequently observed in age associated degenerative diseases, augmented oxidative stress is a common risk factor for both genet ic and lifestyle related pathologic progression of AD (Nunomura et al., 2006) In addition to oxidative stress, it has been also suggested that the accumulation of senile plaques (deposits of amyloid % peptide)

PAGE 27

27 in the brain is believed to play an important role in the etiology of AD (Akama et al., 1998) Although how the p athogenic amyloid % peptides are involved in the process of neuronal cell degeneration is still ambiguous, recent studies suggest that amyloid % peptide induces oxidative stress including nitric oxide stress through the activation of NF & B redox signaling and impairs mitochondrial fusion and fission balance (Barsoum et al., 2006) Subsequent findings in a neuronal cell line, indeed, showed that the overexpression of both wildtype and mutant amyloid precursor protein (APP) leads to mitochondrial fragmentation through decreasing protein levels of Dlp1/Drp1 as well as Opa1, but increasing levels of Fis1 (Wang et al., 2008) The involvement of cytotoxic amyloid % peptide in mitochondrial destruction is further substantiated through similar findings in the brain of AD patients (Wang et al., 2009b) These observations implicate that tr anslational imbalance in fusion and fission components due to neurotoxic amyloid % peptide can cause mitochondrial and neuronal dysfunction in AD. Recently, a pioneer study by Cho et al ha s provided new insight into the molecular mechanism by which amylo id % peptide modulates mitochondrial fusion and fission dynamics (Cho et al., 2009) The study discovered that the amyloid % induced mitochondrial fission is, in part, due to S nitro sylation of Drp1, which enhances its activity. And, elevated levels of S nitrosylated Drp1 were found in brains of AD patients (Cho et al., 2009) indicating imbalanced activity of fusion and fission by S nitrosylated Drp1 leads to excessive mito chondrial fragment ation in brains of AD patients. Like AD, the pathogenesis of HD is also involved with oxidative stress induced by neurotoxic aggregates of misfolded protein. The accumulation of misfolded protein is due to the expansion of a trinucleotide CAG repeat in the huntingtin gene, resulting in a

PAGE 28

28 stretch of polyglutamines. Apart from the fact that mutant huntingtin has been well correlated with mitochondrial dysfunction, more recent studies suggest a causal role of the mutant huntingtin in the regu lation of mitochondrial dynamics. It was shown that mutant huntingtin aggregates impair mitochondrial mobility in cultured primary cortical neurons and in the animal model (Chang et al., 2006; Trushina et al., 2004) This impairment in mitochondrial trafficking was found to be due to mutant huntingtin interfering with the association of microtubule transport proteins with mitochondria (Orr et al., 2008) Additionally, overex pression of mutant huntingtin in HeLa ce lls lead to mitochondrial fragmentation and decreased fusion (Wang et al., 2009a) Moreover, 3 nitropropionic acid, an inhibitor of complex II of the mitochondrial respirator y chain that causes HD like symptoms also lead to an increase in mitochondrial fragmentation (Liot et al., 2009) These findings suggest that the involvement of mitochondrial fusion and fission pathways in the inci dence of HD, yet the precise molecular mechanisms are still unidentified. The impairment in mitochondrial fusion and fission also has been linked to a portion of PD cases. It was found that inherited mutations in the genes, Parkin and PINK1, play an import ant role in the pathogenesis of PD. The loss of Parkin function in the proteasome mediated protein degradation pathway has been linked causally to the pathogenesis of PD, particularly the accumulation of aggregated proteins and inclusion bodies (Ardley et al., 2003; Chung et al., 2001; Kim et al., 2003; Shimura et al., 2001; Tsai et al., 2003) Intriguingly, a protective role has been attributed to Parkin in maintaining mitochondrial function and the mitochondrial s haping process (Mortiboys et al., 2008) For instance, loss of Parkin leads to mitochondrial fragmentation in a Drp1

PAGE 29

29 dependent manner (Deng et al., 2008; Lutz et al., 2009; Poole et al., 2008) This coincides with increased oxidative stress and mitochondrial dysfunction in both mice and flies (Clark et al., 2006; Greene et al., 2003; Palacino et al., 2004; Pesah et al., 2004) Simila rly, loss of PINK1 function has been linked to increase in oxidative stress and defects in mitochondrial respiration (Gautier et al., 2008; Gegg et al., 2009; Gispert et al., 2009; Marongiu et al., 2009; Papa et al. 2009) These effects have also been shown to include aspects of mitochondrial dynamics, as PINK1 deficiency increases mitochondrial fragmentation in human cells (Dagda et al., 2009; Lutz et al., 2009) Moreover, genetic studies in Drosophila have shown that PINK1 has a role in promoting mitochondr ial fission (Deng et al., 2008) While whether PINK1 is involved in mitochondrial fusion or fission is not clear PINK1 seems to play a role affecting mitochondrial morphology. Obesity and type 2 d iabetes Besides neurodegenerative disorders, mitochondrial structural abnormality has been also reported in various age related chronic disease conditions such as obesity and diabetes (Liesa et al., 2009) The insulin resistance state of obesity and type 2 diabetes greatly affect skeletal muscle function, reducing the tissue's ability to properly and efficiently oxidize glucose and lipid substrates for the generation of energy by mitochondria. Not surprisingly, mitochondrial dysfunction has been reported in the skeletal muscle of obese subjects and of type 2 diabetic patients, of which both mitochondrial number and size has been found to be decreased (Liesa et al., 2009; Zorzano, 2009) Among the regulatory proteins involved in mitochondrial dynamics, Mfn2 has emerged as a key player in the mitochondrial dysfunction observed in obesity and the metabolic syndrome. In addition to their role in the maintenance of

PAGE 30

30 mitochondrial architecture, Mfn2 has several other functions including the regulation of cellular metabolism and energy homeostasis. Specifically, Mfn2 repression by RNAi leads to a decline in glucose oxidation, reduced oxy gen consumption, decreased #$ m and even decreased expression and activities of proteins of the mitochondrial respiratory chain (Bach et al., 2005; Pich et al., 2005) Accordingly, decreased levels of Mfn2 expression have been found in the skeletal muscle of obese and type 2 diabetic subjects (Bach et al., 2003; Kelley et al., 2002) Interestingly, Mfn2 expression is regulated by key mitochondrial biogenesis proteins, PGC 1 and PGC 1 % through the activity of the nuclear hormone receptor ERR binding to the Mfn2 promoter (Liesa et al., 2008; Soriano et al., 2006) These findings have important implications of the contribution of Mfn2 defects as a potential c ause of insulin resistance. Mitochondrial Dynamics and A ging Aging involves a multitude of complex biological phenomena but a decline in mitochondrial turnover caused by a reduction in mitochondrial biogenesis and/or inefficient degradation pathways appea rs to be a critical factor in this process (Terman et al., 2010) In healthy cells, mitochondrial fusi on provides a synchronized internal cable for translocating metabolites and exchanging mitochondrial components during biogenesis, while mitochondrial division allows the dilution of damaged organelles and their selective degradation through autophagy. How ever, it has become increasingly clear that these protective mechanisms are markedly impaired in aging and may be involved in the progression of age related diseases. Mitochondria are highly dynamic structures, adaptable to a wide range of intra and extr acellular stimuli. Aging compromises the plasticity of the or ganelle by reducing the capacity for mitochondrial biogenesis, through a decline in AMPK mediated PGC 1

PAGE 31

31 activity that is instigated by an age related increase in ROS (Qiang et al., 2007; Reznick et al., 2007) The finding that PGC 1 regulates Mfn2 expression has provided a direct link between mitochondrial biogenesis and mitochondrial architecture (Cartoni et al., 2005) The association between reduced Mfn2 levels and mito chondrial metabolism in obese and type 2 diabetic subjects has established its importance in age related pathologies (Bach et al., 2005) In line with these observations, the ability of exercise to improve mitochon drial oxidative capacity both in healthy and insulin resistant individuals suggests the adaptability of the fusion and fission proteins and their potential role in enhancing mitochondrial biogenesis (Menshikova et a l., 2005) Mitochondrial dynamics is also important in mitochondrial turnover by affecting mitochondrial degradation pathways. Although there is conflicting evidence of the effect of aging on the various proteolytic pathways (reviewed in (Attaix et al., 2005; Combaret et al., 2009) ), the lysosomal autophagy system has been reported to decline in a variety of tissues with age (Cuervo and Dice, 2000; Donati et al., 2001; Wohl gemuth et al., 2010) The appearance of giant mitochondria in aging cells would signify that these organelles possess deregulated degradation pathways. This is consistent with reports regarding senescent cells in which Fis1 is reduced in abnormal mitochon dria and overexpression of this protein can block the senescence related phenotype and maintain cells in a proliferating state (Lee et al., 2007; Yoon et al., 2006) The link between morphology proteins and mitocho ndrial turnover has been illustrated in neuronal cells and with the observation that Fis1 activates autophagy and the selective degradation of depolarized mitochondria (Twig et al., 2008)

PAGE 32

32 To complicate matters fu rther, cell death pathways are also induced in postmitotic aging cells leading to irreversible damage to mitochondrial proteins and DNA and the loss of nuclei. Mitochondrial fragmentation due to elevated fission events has been reported to both precede and follow the release of apoptogenic factors from the mitochondrial in t ermembrane in many cell types. Interestingly, autophagy is also described following the opening of the mitochondrial permeability transition pore and the depolarization of the membrane su ggesting that autophagy may play a protective role by preventing the cellular damage caused by apoptosis (Elmore et al., 2001; Kim et al., 2007) This idea is further corroborated in a recent study demonstrating th at autophagy is negatively correlated with oxidative damage and apoptosis in skeletal muscle from aged rodents (Wohlgemuth et al., 2010) In yeast, autophagy is required for chronological longevity (Alvers et al., 2009) and to prevent damage to mitochond ria in chronologically old cells (Seo et al. unpublished data). However, it is currently unclear what determines if a mitochondrion will be selectively degraded by autophagy or targeted for cell death during aging. One possibility is that during aging, whe n the homeostatic regulation of mitochondrial fusion and fission balance and the organellar turnover process governed by biogenesis and autophagy can no longer efficiently maintain functional mitochondria (resulting in mitochondrial senescence) and oxidati ve damage surpasses a critical threshold, apoptosis is triggered leading to substantial changes in mitochondrial structure and irreversible cell death (Fig. 1 4). In order to answer this question conclusively, detailed studies examining the specific effect s of aging on mitochondrial fusion and fission proteins, mitochondrial morphology, and mitochondrial turnover processes in a wide range of cells and tissues are required.

PAGE 33

33 Summary In summary, the balance between mitochondrial fusion and fission affects not only structural and functional features of mitochondria but also is deeply involved in maintaining mtDNA stability. Faulty or imbalanced fusion and fission have been associated with apoptotic cell death, various neurodegenerative diseases and aging. Furthe rmore, evidence indicates that mitochondrial fusion and fission are required for mitocho ndrial quality control, whereby damaged mitochondria are renewed by biogenesis and degradation. In addition, mitochondrial dynamics can affect mitochondrial energy prod uction and oxidant generation. Th is strongly suggests that not only do mitochondrial fusion and fission play an important role in the normal mitochondrial biology but also that impaired mitochondrial fusion and fission would likely causes functional and s tructural impairment as seen in the aging process. With these premises, we postulate that age associated alterations in mitochondria fusion and fission dynamics may bring about a decline in mitochondrial function and increase susceptibility toward cell dea th against various stresses during advancing aging. Therefore, mitochondrial fusion and fission can be a new target for anti aging strategies.

PAGE 34

34 Figure 1 1 The role of oxidative stress, mitochondrial senescence, and cell death in the aging process. Tox ic reactive oxygen species (ROS) generated during normal biological activity gradually impairs cellular homeostatic pathways (e.g., antioxidant systems, damage repair processes, and cellular component biogenesis / degradation) and damages mitochondrial con stituents including the electron transfer chain (ETC) and mitochondrial DNA (mtDNA). Mitochondrial oxidative insults in turn, are responsible for a substantial deficiency in the organelle's life sustaining roles such as transduction of energy, biogenesis o f metabolites, Ca 2+ homeostasis, and regulation of redox biology with age, thus causing a viscous cycle of mitochondrial functional crisis, which ultimately culminates in apoptotic and necrotic cell death.

PAGE 35

35 Figure 1 2. Schematic illustration depicting t he core proteins of the molecular machineries modulating mitochondrial fusion and fission in yeast and mammals. (A) Fusion protein Mfn1/2 (mammalian othologue of yeast Fzo1p) contains four heptad repeats, one GTPase domain, and two transmembrane domains. O pa1 (mammalian othologue of yeast Mgm1p) is another fusion protein locate d in the mitochondrial inner membrane and inter membrane space. The fusion process requi res three steps: docking, outer membrane (OM) fusion, and inner membrane (IM) fusion. Mfn1/2 is thought to play an important role in the process of docking and OM fusion. Opa1 seems to be involved in the formation of cristae junction as well as IM fusion, which occurs in GTP dependent manner. (B) The fission protein Drp1 is the mammalian orthologue o f yeast Dnm1p and contains one N terminal GTPase domain, a C terminal GED (GTPase effector domain), and a hydrophilic region in the middle. Drp1 self oligomerizes and assembles a scission machine around the mitochondrial OM. Fis1 (mammalian othologue of ye ast Fis1p) is a mitochondrial OM protein and is thought to recruit Drp1 to the OM via adaptor proteins.

PAGE 36

3 6 Figure 1 3. Possible relationship between mitochondrial fusion, fission, biogenesis and mitophagy. Ongoing fusion and fission cycles allow mitochond rial functional and genetic complementatio n and the proper distribution of newly synthesized mitochondria during cell division. However, due to an imbalance of fusion and fission (i.e., more frequent fission events than fusion events), the fusion and fissi on cycle presumably increases the total number of small mitochondria per cell if there is no elimination of the extra mitochondria by mitophagy. In addition, mitochondrial biogenesis is also required to compensate for the decreased mitochondrial biomass ow ing to mitochondrial degradation process (Berman et al., 2009; Twig et al., 2008) Therefore, any imbalance occurring between fusion, fission, biogenesis, and degradation may invoke substantial changes in mitochond rial number, biomass, shape, and function. P indicates a phagophore by which targeted mitochondria are engulfed during the sub cellular organelle sequestering process, mitophagy.

PAGE 37

37 Figure 1 4. Model for the role of mitochondrial fusion and fission in agi ng. Aging compromises the plasticity of mitochondria by disrupting homeostatic regulation of the fusion and fission pathways and results in abnormal mitochondrial structure. Mitochondrial fragmentation due to a decline in fusion and/or increased fission ev ents can reduce the capacity of maintaining mtDNA integrity, mitochondrial structural and functional complementation, and biogenesis, all of which can lead to mitochondrial dysfunction. On the other hand, enlarged mitochondria as a result of inhibited fiss ion processes can diminish mitochondrial turnover by impairing mitophagy and biogenesis, leading to accumulation of damaged mitochondria in aged cells. In both cases, the abnormal mitochondria are unable to fulfill their life sustaining roles. Therefore, a ge associated alterations in mitochondrial fusion and fission dynamics may play a causative role in mitochondrial dysfunction and increased susceptibility to cell death against various stresses during advancing aging.

PAGE 38

38 CHAPTER 2 THE ROLE OF MITOCHONDRIAL F USION AND FISSION IN S accharomyces cerevi s iae DURING CHRONOLOGICAL AGING Introduction Mitochondria play a pivotal role in converting chemical fuels in to ATP, synthesiz ing essential metabolites such as heme (the major functional form of iron) and control li ng cellular Ca 2+ homeostasis (Bernardi and Rasola, 2007; Gunter et al., 2000; Halliwell and Gutteridge, 2007; Pandolfo, 2006) Moreover, th is organelle is thought to regulate cellular redox signaling and maintain t he continuing existence of a cell because mitochondria l respiration actively utilizes sub cellular oxygen to reduce electrons and a large set of pro apoptotic molecules are located in mitochondria re s pectively (Halliwell and Gutteridge, 2007) Therefore, gradual damage in mitochondria due to age associated faulty regulation of cellular redox h omeostasis is believed to impair mitochondrial life sustaining functions and accelerate the vicious cycle of oxidative stress and cell death (Bandy and Davison, 1990; Harman, 1956; Harman, 1972; Hiona and Leeuwenbur gh, 2008; Kujoth et al., 2006; Seo et al., 2006; Seo et al., 2008) A substantial amount of correlative evidence demonstrates that age dependent mitochondrial dysfunction is associated with mitochondrial structural and genomic damage, reactive oxygen spec ies (ROS) generation and increased cell death (Boveris and Navarro, 2008; Figueiredo et al., 2008; Leeuwenburgh and Prolla, 2006; Van Remmen and Richardson, 2001) A number of studies report that enhanced mitochon drial function by means of its respiratory activity correlates with longevity in various species (Bishop and Guarente, 2007; Caldeira da Silva et al., 2008; Katic et al., 2007; Lin et al., 2002; Nisoli et al., 2005; Speakman et al., 2004; Zid et al., 2009) In

PAGE 39

39 addition, various genetic problems in mitochondria cause phenotypes that resemble premature aging (Wallace and Fan, 2009) Although a causative relation between mitochondrial dys function, and ROS gener ation as well as cel l death is still controversial, r ecent studies reveal that mtDNA mutation is responsible for accelerating the aging process without increasing cellular oxidative damages (Kujoth et al., 2005; Tri funovic et al., 2004) suggesting that a loss of mitochondrial genomic integrity may precede the age associated increase in oxidative stress and the destruct ion of organismal integrity by unwanted cell death. I t also has been postulated that enhanced mito chondria l respiration is a prerequisite for preventing oxidative stress, increasing resistance to oxidative stress and extending life span in yeast (Bonawitz et al., 2007; Bonawitz and Shadel, 2007) Furthermore, anti aging interventions and cellular pathways that are known to modulate the aging process (e.g., calorie restriction and target of rapamycin pathway ) appear to regulate the longevity of yeast, worms, files and rodent s by enhancing mitochondrial metaboli c activity (Bonawitz et al., 2007; Harrison et al., 2009; Kaeberlein et al., 2005; Kapahi et al., 2004; Vellai et al., 2003) These findings strongly implicate the intact functions of mitochondria play ing a pivotal role in the determination of longevity Y et how mitochondrial function declines with age and how dysfunctional mitochondria amass cellular oxidative stress that leads to unwanted cell death are still poorly understood Recently, studies reveal that mitoc hondria are highly motile and remarkably plastic organelles, constantly interacting with cytoskeletal tracks and chang ing their shape spontaneously. Indeed, a large body of evidence has demonstrated that from yeast to human, mitochondria appear to frequent ly go through fusion and fission processes to

PAGE 40

40 actively change their number, morphology and function in response to environmental stimuli (i.e., oxidative stress and apoptotic signals). In addition, the dynamic regulation of mitochondrial fusion and fissio n processes is found to be a n important mechanism that modulates cellular redox status, mtDNA integrity, organellar function, and cell death (Liesa et al., 20 09) Notably, genetic defects in mitochondrial fus ion and fission components lead to severely altered mitochondrial shape, loss of mtDNA integrity, increased oxidative stress and apoptotic cell death, subsequently c ausing developmental abnormalities neur omuscular degeneration and metabolic disorders in human (Chen and Chan, 2009) Thus, a faulty regulation of mitochondrial dynamics might be one of the intrinsic causes of mitochondrial dysfunction that possibly accelerates the aging process. However, the precise molecular role of mitochondrial fusion and fission underlying the aging process remains largely unknown Therefore, we studied t he role of mitochondria l fusion and fission dynamics during chronological aging in yeast We also utilize d calorie restriction (CR) as an intervention to promote longevity and to better understand the basic mech anisms of CR relative to the mitochondrial fu nction and the fusion and fission processes. W e hypothesi zed that impaired mitochondrial fusion and fission dynamics are causal to the decline in mitochondrial function with age and that CR increases mitochondrial fusion and improves mitochondrial function resulting in extension of chronological life span (CLS)

PAGE 41

41 Result s Global Effects of Aging and Calorie Restriction on Mitochondrial Morphology, Oxidative Stress and Cell Death Mitochondrial morphology changes during c hronological a ging and in low glucose medium Optimal cellular function is highly dependent on efficiently respiring functional mitochondria as well as on an intact mitochondrial structure Hence age associated changes in mitochondrial function might be in part related to alterations in mitoch ondrial shape. Therefore w e first monitored mitochondria l morphological change s during chronological aging with green fluorescence protein ( GFP ) localized to the mitochondrial matrix (Westermann and Neupert, 2000) Interestingly, we routinely observed three distinctive GFP staining patterns (i.e. punctate, linear, and network) during chronological aging in a normal (2%) glucose medium and a low glucose (0.4%) medium (Fig. 2 1). To further investigate whether chron ological aging and a reduced glucose medium modulate mitochondrial shape we categorized each GFP labeled cell according to the mitochondrial morphology and calculated the percentage of cells out of total cell count for each mitochondrial characteristic (F ig. 2 2 ). We found that in the normal glucose medium, yeast cells containing the linear shape of the GFP stain ed mitochondria gradually disappear ed yet the number of cells containing fragmented mitochondria increased until Day 2 then decreased after Day 3 as cell viability declined (Fig. 2 2A and 2C). In the low glucose medium, a similar extent of cells contain ing th e linear shape d mitochondria were observed at Day 1. However, after 2 d ay s of growing in the low glucose medium, a large portion of cells took the shape of a highly interconnected network of mitochondria which was maintained throughout chronological aging (Fig. 2 2B and 2D) Of note is that network shape d mitochondria

PAGE 42

42 were observed exceptionally in cells grown under low glucose medium condition but not in the normal medium. This impl ies that the chronological aging of cells in a low glucose medium induce s a mitochondrial structural change possibly as a consequence of modulating th e fusion and fission processes. Low glucose medium attenuates o x idative s tress and c ell d eath as well as increase s oxidative stress r esistance d uring chronological a ging CR is believed to reduce protein and lipid oxidation and prevent loss of viability in aged yeast cells (Reverter Branchat et al., 2004) Therefore, we investigated whet her CR would attenuate oxidat i ve damage and prevent e cell death during chronological aging Given the importance of intact RNA for normal cellular function equal to DNA integrity, we determined not only DNA oxidation levels as a marker of oxidative damage, but also RNA oxidation in chronologically aged cells grown under normal glucose medium versus those grown in a low glucose medium. In parallel, we also determined changes in cell density as well as cell viability (Fig. 2 3). We found that in the normal gl ucose medium, both RNA and DNA oxidation were increased in proportion to chronological age whereas the low glucose medium significantly ameliorated the levels of RNA and DNA oxidation (Fig. 2 3A and 3 B). In agreement with a study by Herker et al who show ed that yeast chronological aging can lead to apoptotic cell death (Herker et al., 2004) we also found that the proportion of metabolically active cells ( FUN 1 positive cell s) decreases during chronological aging in a normal glucose medium (Fig. 2 3C). However, the percentage of dead cells d id not increase but rather the viable cells w ere maintained over the course of time when the yeast cell s w ere grown under low glucose medium conditions (Fig. 2 3C). Notably, there w ere no substantial differences in cell density between the two glucose con ditions during chr onological

PAGE 43

43 aging, suggesting that cell growth may not be affected by the different glucose levels (Fig. 2 3D). This is in agree ment with the previous observation showing that CR attenuate s age associated cell loss by promoting resistance to oxidative stress (Marzetti et al., 2008) T herefore we further investigate d whether low glucose medium promotes cellular resistance to oxidative stress during aging (Fig. 2 4). During chronological aging, the a ged cell replica was exposed to the freshly prepared nutrition rich media (YPD) with no stressors, oxidants ( 2.5 mM hydrogen peroxide (H 2 O 2 ) and 30 M menadione) or mutagen (1.5 mM methyl methan sulfonate (MMS)) Then, c ell viability was determined by calc ula ting colony forming units (CFU). Under normal medium conditions cell viability gradually declined over the course of aging (Fig. 2 4A). H 2 O 2 and menadione significantly lowered cell viability while MMS did not change cell viability (Fig. 2 4B, 4C and 4 D). In contrast, yeast cells grown under low glucose medium conditions could maintain its viability and displayed significantly increased resistance to H 2 O 2 and menadione at Day 1 (Fig. 2 4A, 4B and 4C). Interestingly, the cellular resistance to H 2 O 2 and m enadione increased further followed by 2 3 days of growth in the low glucose medium in dicating that calorie restricted cells may need a certain period of adaptation to acquire the maximum resistance to oxidative stress. Coincidently, this time dependenc y in cellular oxidative stress resistance was also observed during the transition of mitochondrial morphology a s shown in F igure 2D In particular i n the low glucose medium, it took ~2 days to observe a large portion of cells exhibiting network mitochondr ia indicating a possible association between network mitochondrial morphology and oxidative stress resistance

PAGE 44

44 A network mitochondrial structure is associated with oxidative stress r esistance Given that oxidative stress fragments mitochondria and that mit ochondrial fusion is believed to protect cells from oxidative stress (Sato et al., 2006) we hypothesized that a CR mediated increase in cellular oxidative stress resistance is, in part, associated with mitochondrial morphological change In yeast, two routine CR regimes can be appl ied during chronological aging: growth in a low glucose medium and growth in a normal glucose (2%) medium followed by washing with water (Fabrizio and Longo, 2003; Piper, 2006) Thus, we tested cellular stress resi stance against oxidants, 2.5 mM H 2 O 2 and 30 M menadione in the cells expressing mitochondrial matrix targeting GFP under the two CR regimes versus normal glucose growth condition s At the same time, we also evaluated mitochondrial morphology change s t o find the direct correlation between oxidat ive stress resistance and the mitochondrial shap ing process (Fig 2 5). We found that in Day 0.5 (log phase ; OD 600 = ~0.5 ) and Day 1 (post diauxic phase ; OD 600 = ~1.0), the low glucose medium could not increase the percentage of cells that contain network m itochondria and was ineffective in prevent ing cell death induced by H 2 O 2 although the resistance to menadione increased slightly (Fig. 2 5A). However, c ellular stress resistance to both oxidants increased further after 2 days of growth in the low glucose medium At the same time, the percentage of live cells containing network mitochondria dramatically increased and the cellular oxidative stress resistance and the percentage of cells containing network mito chondria were maintained throughout the aging pro cess. Intriguingly water washed yeast cells also displayed a time dependent cellular adaptation in oxidative stress resistance and mitochondrial morphology change. In particular, despite that the water wash method could not increase cellular oxidative str ess resistance and a portion of cells containing network mitochondria until Day 4

PAGE 45

45 (post water wash Day 1), these yeast cells became highly resistant to H 2 O 2 and menadione at Day 5, corresponding to the post water wash d ay 2. Moreover, we observe d network m itochondria (Fig. 2 5A and 5B). Of note is that 1.5 mM MMS did not affect cell viability during aging and the CR interventions. Also, we observed no change in cell density by the CR interventions, yet similar to the low glucose medium conditions, the water wash intervention attenuate d cell death during chronological aging compared to yeast cell s grown under normal glucose medi um (Fig. 2 5C and 5D). These observations strongly suggest that network mitochondria are associated with increased cellular resistanc e to oxidative stress. Moreover, not only low glucose medium conditions but also water wash intervention seems to increase cellular resistanc e to oxidative stress, modulate mit ochondrial shape, and attenuate cell death during chronological aging, impl ying that these CR regimes may share a similar pathway. The Role of Mitochondrial Fusion and Fission Genes in Chronological Aging L ow glucose medium modulates fusion and fission gene expression during c hronological a ging Upon various stimuli (i.e. oxidative s tress, carbon sources, and cell death signals) mitochondria actively change their shape via the fusion and fission p athway s (Church and Poyton, 1998; Goldberg et al., 2009; Magherini et al., 2009; Pletjushkina et al ., 2006; Visser et al., 1995) The fusion process combines the mitochondrial membranes from two opposing mitochondria, whereas the fission process divides one mitochondri on into two mitochondria Over the past decade, several key components of the fusion and fission pathway s have been extensively identified in yeast ( Table 2 1 ) Besides various regulatory proteins, two core machineries are known to pursue the mitochondrial outer and inner membra ne fusion process in yeast : Fzo1 p in the outer membrane, and

PAGE 46

46 M gm1 p in the inner m embrane. In the fission pathway two proteins build the core machinery of mitochondrial outer membrane division in yeast: Dn m1p and Fis1 p together with additional regulatory proteins. Thus, we reasoned that an alteration in mitochondrial morphology during chronological ag ing and with CR is possibly through the modulation of the fusion and fission pathways To confirm this, we measured transcript levels of FZO1 and MGM1 as well as DNM1 and FIS1 by real time quantitative PCR (QPCR) follow ing grown cells under normal glucose medium versus low glucose medium conditions during chronological aging (Fig. 2 6). We found that both fusion and fission transcript levels dramatically declined with age when cells were grown in a normal glucose medium, whereas the low glucose medium significantly increased the mRNA levels of FZO1 and maintained mRNA levels of MGM1 during chronological aging (Fig. 2 6A and 6B). Although the DNM1 transcript level did not change, the FIS1 transcript level decreased signifi cantly during chronological aging in the low glucose medium (Fig. 2 6C and 6D) indicat ing that the low glucose medium increase d overall fusion activity by transcriptionally increasing FZO1 expression but decreasing FIS1 expression Therefore, we conclude d that mitochondrial fusion and fission processes are involved in the changes in mitochondrial morphology during chronological aging and with CR. Mitochondrial fusion is required for the forma tion of network mitochondria To co nfirm the possible involvement of fusion and fission processes in mitochondrial morpholog ical change during chronological aging we transformed fusion deficient (fzo1 mgm1 and ups1 ) and fission deficient (dnm1 fis1 and she9 ) cells with pVT100U mtGFP which expresses mitochond rially targeted GFP (Westermann and Neupert, 2000) and monitored mitochondrial morphology during

PAGE 47

47 chronological aging (Fig. 2 7 and 8 ). Over the course of 5 days in the normal glucose medium WT and both fusion and fission deficient cells displayed a decreased pr oportion of linear mitochondria, that was inversely related with an increased percentage of dead cells (Fig. 2 8 A). However, in the low glucose medium, a large portion of fission deficient cells displayed net work mitochondria as similar to that of the WT cells whereas the fusion deficient ( fzo1 and mgm1 ) cells failed to show network mitochondria and displayed only fragmented mitoch o ndria (Fig. 2 8 B). However, unlike fzo1 and mgm1 cells, the fusion mutant ups1 strain displayed the WT like network mitochondria during chronological agi ng in the low glucose medium (Fig. 2 8 ). Mitochondrial fusion genes are necessary for chronological l ongevity CR mediated changes in mitochondrial morphology might be causal in increasing mitochondrial function subsequently lead ing to CLS extension To dissect the possible role of fusion and fission genes in organismal longevity, we determin ed the life spans of the fusion and fission deficient cells (Fig. 2 9 ). Mutants defect ive in fission showed a range of effects on CLS in the normal glucose medium. The CLS of the fission mutant fis1 was significantly reduced whereas the CLS of fission mutant she9 cells was not (Fig. 2 9 A and 9 C). In the low glucose medium, all fission mutants exhibited an extension of CLS to the same extent as the wild type (WT) strain (Fig. 2 9 B). S imilar ly water washed fission deficient cells also showed a significantly extended CLS equal to the WT strain, yet the water washed fis1 strain displayed a relatively lower survival rate (Fig. 2 9 D). In contrast, the fusion mu tant fzo1 and mgm1 strains exhibited a very short en ed CLS in the normal medium, and only a minor extension of CLS in the low glucose medium as well as by the wat er wash intervention (Fig. 2 9 ). S imilar trends we re observed with a fzo1 cell in the CEN.PK background strain during growth in the

PAGE 48

48 low glucose medium although the water wash ed fzo1 cells displayed significantly increased CLS ( Appendix A ). Unlike the other fusion deficient strains, the ups1 strain had a CLS similar to the WT strain in the norma l glucose medium and an extended CLS in the low glucose medium as well. UPS1 encodes a mitochondrial protein that regulates proteolytic processing and sorting of the mitochondrial protein Mgm1p in a carbon source dependent manner (Sesaki et al., 2006) A redundant Ups1p like activity is de repressed in cultures with low glucose levels, such as the saturated cultures used in our CLS experiments. Thus, the absence of an effect on CLS in the ups1 strain m a y be due to the absence of an effect on mitochondrial morphology in an aging culture (Fig. 2 7 and 8) This strongly indicat es that network mitochondria correlate with chronological longevity. Taken together, these obser vations imp ly that although both fusion and fission genes are required for attaining normal CLS, mitochondrial fission may not be necessary for CR mediated CLS extension, while the fusion process is critical to maintain a cell's longevity as well as to max imize CLS by CR. The Impact of Fusion Enhancement on Oxidative Stress, mtDNA Integrity and Cellular Respiratory Function Mitochondrial fusion is required for oxidative stress resistance Given the well known importance of oxidative stress in chronological aging, we reasoned that impaired mitochondrial fusion in fzo1 and mgm1 strains shortened CLS possibly by increased sensitivity to oxidative stress. Indeed, oxidative stress i s proposed as a possible mechanism for inducing mitochondrial fragmentation, whi ch can eventually lead to cell death (Pletjushkina et al., 2006) In addition, Jendrach et al. have shown that recovery of transiently impaired mitochondrial fusion and fission induced by oxidative stress requires the fusion of tubular mitochondria as well as the synthesis of

PAGE 49

49 mitochondrial components, suggesting that fusion deficiency can be detrimental when cells are exposure to such environments (e.g. aging) where oxidative stress is increased constantly (Jendrach et al., 2008) Thus, we hypothesized that a CR mediated increa se in resistance to oxidative stress (as shown in F ig. 2 5) might be in part a consequence of enhanced mitochondrial fusion. To test this, we examined oxidative stress resistance in mitochondrial fusion and fission deficient strains during chronological a ging in the normal medium versus the low glucose medium. The w ater wash CR regime was also tested in a parallel study We initially focused on three fusion mutants (fzo1 mgm1 and ups1 ) and two fission mutants (dnm1 and fis1 ) that exhibit a range of effects on CLS. During the CLS experiments, the cell replica w as pro duced in a YPD agar medium without or with oxidant s ( i.e., H 2 O 2 and menadione). Doeses of 2.0 mM and 2.4 mM H 2 O 2 were used as direct source s of ROS because peroxides easily diffuse across cell membranes. Thirty M menadione was used to raise the intracellular production of ROS. As a control of oxidative s tress, resistance to 1.5 mM MMS (mutagen) was tested (Fig. 2 10 and 11 ). Dur ing aging in the normal medium, the fusi on and fission mutants were more sensitive to H 2 O 2 than the WT strain. Yet, we did not see any significant differences in resistance to mena dione among these strains although the short lived mutant fis1 cells exhibited significantly increased resistance to menadione at Day 1. However, s imilar to the WT strain, both dnm1 and fis1 mutants exhibited significantly increased resistance to H 2 O 2 as well as menadione in th e low glucose medium. Moreover, a nother fission mutant she9 also was resistant to H 2 O 2 and menadione in the l ow glucose medium ( Appendix B ). This trend was comparable to the long lived fusion mutant ups In contrast, even though resistance to mednadione

PAGE 50

50 slightly increased with chronological aging in both the fzo1 and mgm1 strains these fusion deficient yeast cells were highly sensitive to H 2 O 2 and menadione even in the low glucose medium (Fig. 2 10). Intriguingly, we were able to see a similar trend i n yeast cells treated with the water wash CR regime (Fig. 2 11). In particular, the relatively short lived fis1 cells failed to increase resistance to H 2 O 2 but became resistant to menadione followed by the water wash intervention during aging. The water washed dnm1 cells exhibited increased resistance to H 2 O 2 and menadione that was comparable to the WT strain as well as the long lived ups1 cells However, not surprisingly the water wash intervention failed to increase or maintain resistance to H 2 O 2 an d menadione in both fzo1 and mgm1 cells during chronological aging. These observations strongly suggest that components regulating mitochondrial morphology play an important role in resistance to oxidative stress. Furthermore, our results signify a role for mitochondrial fusion in oxidative stress resistance during chronological aging. It is worthwhile to note that during aging, either neither the low glucose medium n or the water wash intervention subsequently affect ed stress resistance to MMS in the fusi on deficient yeast compared t o WT and fission deficient cells. This finding indicates that although oxidative stress can significantly decrease cell viability when there is a mitochondrial fusion deficiency, DNA stress may not further decrease cell viabili ty in fusion deficient cells during chronologi cal aging. Mi tochondrial fusion is r e quired for preventing accumulation of oxidative d amage Given that excessively fragmented mitochondria are commonly observed during apoptosis with increased oxidative stress fusion enhancement might be important in counteract ing oxidative stress mediated alterations in the mitochondrial shape, thereby preventing cell death during chronological aging. To investigate the role of fusion and

PAGE 51

51 fission genes in cellular oxidative da mage, we measured levels of 8 oxo guanosine (oxidized form of RNA) as an indicator of oxidative damage in cellular components and determined the cell viability in fusio n mutants (fzo1 and mgm1 ) and fission mutants (dnm1 fis1 and she9 ) during chronol ogical aging (Fig. 2 12). We found that RNA oxidation increased in proportion to chronological age, while cell viability gradually declined in the fission deficient cells grown under normal glucose medium conditions (Fig. 2 12A and 12B). Although the fissi on deficient fis1 cells accumulated RNA oxidation greater after Day 3 and declined in cell viability faster that the other fission deficient cells in the normal glucose medium the low glucose medium was able to completely prevent the age associated accum ulation of RNA oxidation as well as loss of cell viability in all three fission deficient cells to the same extent as the WT strain (Fig. 2 12C and 12D). However, the fusion deficient fzo1 and mgm1 cells exhibited relatively higher levels of RNA oxidatio n as cell viability declined during aging in the normal glucose medium (Fig. 12A). More remarkably, unlike WT cells and fission deficient cells the fzo1 and mgm1 cells in the low glucose medium accumulated RNA oxidation without loss of the cell viabilit y during chronological aging, implying the accumulating oxidative damage in the fusion deficient cells may precede cell death during chronological aging (Fig. 2 12C and 12D). These observations suggest that a low glucose medium prevents loss of cell viabil ity, but is not sufficient to delay age associated accumulation of RNA oxidation in the absence of FZO1 and MGM1 Therefore, we concluded that FZO1 and MGM 1 might play an important role in preventing the accumulation of oxidative damage and cell death duri ng chronological aging.

PAGE 52

52 Mitochondrial fusion is required for maintaining mtDNA contents and cellular respiration How fusion deficiency increases cellular oxidative damage, decreases resistance to oxidative stress, and finally shortens CLS is not clear. How ever, loss of mtDNA integrity due to impaired mitochondrial fusion might be one of the mechanisms by which cells become senescent with time (Guarente, 2008) Hence, we hypothesized that enhanced mitochondrial fusion by CR might help to maintain mitochondrial genetic and functional integrity, leading to the extension of CLS. To test whether the fusion and fission processes are required for maintaining mtDNA integrity during aging, we investigated whether chronological age changes mtDNA integrity in WT cells fusion defici ent cells (fzo1 and mgm1 ) and fission deficient cells (dnm1 and fis1 ) (Fig. 2 13). We evaluated mtDNA integrity by measuring the relative amounts of mtDNA from the cells of the chronological age s, Day 1 and Day 5. The relative ratio of the mitochondri al gene COXI to ACT 1 which is encoded in nuclear DNA, was determined to estimate the relative mtDNA contents During chronological aging in the normal glucose medium, the levels of mtDNA were significantly decreased in the WT strain and fission deficient fis1 cells although there was no age associated decrease of mtDNA contents in the other fission deficient dnm1 cells (Fig. 2 13A). Intriguingly, the low glucose medium could prevent loss of mtDNA in the WT cells as well as the dnm1 and fis1 cells (Fig 2 13B). However, the relative amounts of mtDNA were not detectable in fusion deficient fzo1 and mgm1 cells during aging in the normal glucose medium (Fig. 2 13A). Additionally, the low glucose medium was not able to preserve the mtDNA integrity in the s e fusion deficient cells indicating that a lack of FZO1 and MGM1

PAGE 53

53 severely impairs mitochondrial genome maintenance regardless of chronological age and glucose conditions (Fig. 2 13B). Since mitochondrial aerobic respiration largely relies on mtDNA integri ty, we reasoned that the impaired mtDNA integrity in the fusion deficient cells could give rise to impaired cellular aerobic respiration. To test this, we monitored the rate of cellular oxygen consumption using a standard potentiometric Clark type electrod e in WT cells fusion deficient cells (fzo1 and mgm1 ) and fission deficient cells (dnm1 and fis1 ) during chronological aging (Fig. 2 14). In the normal glucose medium, chronological aging significantly r educed cellular respiration in WT cells as well as the fusion and fission deficient cells However, fzo1 and mgm1 cells displayed relative lower rates of respiration than the WT and fission deficient dnm1 and fis1 cells while t he relatively short lived fis1 cells respired only at Day 1, but not a fter Day 2 (Fig. 2 14A). Interestingly, WT cells had significantly increased oxygen consumption and w ere able to maintain their aerobic respiration during chronological ag ing in the low glucose medium. These results are comparable to those of fission defi cient dnm1 and fis1 cells In contrast, the low glucose medium failed to increase aerobic respiration in fusion deficient fzo1 and mgm1 cells suggesting that impaired mtDNA integrity is indeed directly associated with declined cellular respiration (Fig. 2 1 4B) It is worthwhile to mention that the water wash intervention w as also able to revive and maintain cellular aerobic respiration in WT cells during chronological aging ( Appendix C ) impl ying that similar to growth in the low glucose medium, water washed cells may increase CLS by enhancing cellular respiration (Fig 2 9D).

PAGE 54

54 Discussion Given that d efect s in mitochondrial fusion and fission disrupt mtDNA integrity, mitochondrial energy metabolism and the homeostatic regulation of redox biology and cell deat h (Liesa et al., 2009) it is possible that the age associated perturbation in the fusion and fission pathway s might play a pivotal role in the aging process per se as well as in the incidence of various mitochondrial dysfunction mediated degenerative diseases and metabolic disorders. Here, we have investigated the role of mitochondrial fusion and fission in Saccharomyces cerevisiae during chronological aging. Although most of the yeast chronological life span (CLS) studies have been performed in glucose containing a nutrition rich media, such as a non defined rich medium and a synthetic complete medium (e.g., YPD and SC D respectively), our study was carried o ut using cells grown in a glucose containing synthetic dextrose minimal (SD) medium, which might closely mimic growth conditions of yeast in the wild as prototrophs (Alvers et al., 2009) Furthermore, this drop in medium might be well suited for the study of the physiological role s of mitochondria in chronological aging. This is because in such environments where cells encounter nutrient scarcity (namely, nitrogen and carbon source s ), the mitochondrion's life sustai ning roles in energy metabolism, redox biology and synthesis of various metabolites are critical to maintain ing cellular viability and protecting against e nvironmental stresses (e.g., oxidative stress ) but without much usable nutrition for a prolonged per iod of time (Allen et al., 2006; Aragon et al., 2008) We found that mitochondria undergo substantial morphological change with time and during growth under calorie restricted conditions (i.e., low glucose medium a nd water wash growth condition s ) possibly via transcriptional regulation of mitochondrial fusion and fission components. More importantly, we found that the absence of

PAGE 55

55 mitochondrial fusion increase s sensitivity to oxidative stress, disrupts mtDNA maintenan ce, and impairs cellular aerobic respiration, eventually increasing cell death and shortening CLS. In contrast, under calorie restricted growth conditions, we found that mitochondrial fission i s not necessary to the exten sion of CLS and i s not required for counteracting age associated alterations in organellar morphology, cellular redox sensitivity, and mtDNA integrity as well as cellular aerobic respiratory function. Thus, we believe that for the first time, we have shed light on important genetic roles of mitochondrial fusion and fission in the process of unicellular organismal chronological senescence and a potential mechanism by which CR ameliorates the age associated increase in mitochondria dysfunction, oxidative stress, and cell death, all of which ar e believed to accelerate the process of aging. Although a f ew studi es have previously speculated the potential involvement of mitochondr ial fusion and fission dynamics in the aging process (Bossy Wetzel et al., 2003 ; Sohal, 1975) a pioneering study by Scheckhuber et al. has directly demonstrated that genetically reduced mitochondrial fission delays age associated increase s in mitochondrial fragmentation, oxidative stress and susceptibility toward apoptotic cell de ath leading to increase d cellular fitness and replicative life span (RLS) in fungal aging models (Scheckhuber et al., 2007) Consistent with their observations, we also found that the aging process increases mitoc hondrial fragmentation with augmented oxidative damage and declined cell viability (Fig. 2 2 and 2 3) while interconnected mitochondria (i.e., network mitochondria; Fig. 2 1) ameliorate these age associated changes, and are positively related to the exten ded CLS (Fig. 2 9). However, different from their RLS results using dnm1 and fis1 strains in the BY4741 background, none

PAGE 56

56 of the fission deficient cells in the BY4742 background strain, including dnm1 and fis1 cells, displayed extended CLS in our normal glucose growth condition (SD containing 2% glucose; Fig. 2 9A and C). Instead, deletion of FIS1 considerably diminished CLS (Fig. 2 9A and C) as well as cell viability (Fig. 2 12B) in the normal glucose medium. Furthermore, although the authors mentioned that a mutation in FZO1 did not affect RLS, our results in the fusion deficient cells of both the BY4742 and CEN.PK background strains exhibited dramatically shortened CLS (Fig. 2 9; Appendix A). To explain this discrepancy in life span results, it is impo rtant to mention that unicellular organisms like budding yeast can exist as two different growth conditions. First, in nutrition rich environments, yeast cells continuously produce daughter cells until completely losing its mitotic capacity which is kno wn as replicative senescence. In laboratory experiments, RLS is thus determined by the total number of daughter cells generated from a dividing mother cell (Mortimer and Johnston, 1959) On the other hand, upo n stress from nutrient scarcity, yeast cells cease cell division, trigger a shift from a growth based metabolism to a survival based metabolism, and become senescent as various intra and extra cellular damage accumulates chronologically. Thus, CLS is meas ured based on the longevity of a mitotically quiescent cell population loss of mitotic ability and/or viability over the course of time (Fabrizio and Longo, 2003; Longo et al., 2005; Skulachev and Longo, 2005) Sev eral studies suggest that both RLS and CLS are related (Ashrafi et al., 1999; Fabrizio et al., 2001; Laun et al., 2001; Lin et al., 2000; Longo et al., 1996) but the mechanisms involved in the regulation of re p lic ative aging and chronological aging appear to be distinct (Fabrizio and Longo,

PAGE 57

57 2003) Hence, it is possible that the role of fusion and fission genes in the determination of RLS and CLS might differ. For instance, during rep licative aging, mitochondrial fusion might be less important than the fission process. This is because mitochondrial division might be more important for distribution of the organelle to newly generated da ughter cells Therefore, defects in the fission process might generate daughter cells possessing unevenly distributed mitochondria potentially increas ing mitochondrial deficiency in the culture over time although reduced fission may not affect the mother cells' mitotic capacity in the presence of a sufficient energy source This hypothesis explain s why a lack of fusion did not affect RLS in the previous study, and why our fusion deficient cells did not show any significant changes in the rate of cell grow th in the log phase (data not shown). Also, our result showing selectively reduced CLS in the fission deficient strains m ay explain why aged cell cultures from fission deficient strains lose mitotic capacity faster than the culture from the WT stain (i.e., shortened CLS). Consistently fission deficiency i s reported to accelerate replicative senescence in mammalian cell culture s (Lee et al., 2007; Yoon et al., 2006) Conversely, inhibition of mitochondrial fragmenta tion by the fusion process might be critical to maintaining cell viability during chronological aging as fragmented mito chondria due to fusion deficiency has been related with the loss of mtDNA integrity, oxidative stress and apoptotic cell death (Benard et al., 2007; Jendrach et al., 2008; Okamoto and Shaw, 2005; Olichon et al., 2003; Palermo et al., 2007; Pletjushkina et al., 2006) This seems also to be true of mother cell s during replicative aging as the previ ous study by Scheckhuber et al. indicated (Scheckhuber et al., 2007) Goldberg et

PAGE 58

58 al. have hypothesized that translationally reduced mitochondrial fusion destructs a mitochondria l intact structure during chronologi cal ag ing, yet a low glucose medium impedes mitochondrial fragmentation and prevent s mitochondrial mediated cell death, possibly by increasing mitochondrial fusion (Goldberg et al., 2009) We also found tha t in the absence of FZO1 and MGM1 yeast cells are highly sensitive to oxidative stress in both the normal glucose medium and under calorie restricted conditions (Fig. 2 10 and 11) In addition, the fusion deficient cells exhibited severely impaired mtDNA integrity regardless of either chronological age or growth conditions while the age associated decrease in mtDNA contents in the WT and fission deficient (dnm1 and fis1 ) cells was completely ameliorated by CR (Fig. 2 13), suggesting that mitochondrial fusion genes are, in part, of importance in mtDNA maintenance during aging. This finding is not surprising as fusion components are well known to play an im portant role in mtDNA maintenance (Okamoto and Shaw, 2005) Moreover, the fusion process is hypothesized as essential in maintaining intracellular power transmitting cable properties of mitochondria and in allow ing mitochondrial genetic and structural complementati on (Sato et al., 2006; Sato et al., 2009; Skulachev, 2001) However, the precise role of mitochondrial fusion and fission in the regulation of mtDNA maintenance remains ambiguous needing further stud y Over the pa st decade, several key components of the fusion and fission pathway s have been extensively identified in yeast (Merz et al., 2007) E ither knockout experiments or gain of function studies revealed that balanced events betwee n fusion and fission play a n important role in determining and affecting mitochondrial morphology and function (Okamoto and Shaw, 2005) Although how cells modulate mitochondrial

PAGE 59

59 fusion and fission activities is not clear yet, besides post translational modificatio ns, the activity of fusion and fission can be regulated at the transcriptional level (Honda and Hirose, 2003) Accordingly we found that mitochondrial morphological reconfiguration during aging coincides with a dramatic decline in both fusion and fission gene expressions ( A ppendix D ). Moreover, we also observed that CR (using the low glucose medium ) was able to modulate cellular levels of mitochondrial fusion and fission gene expressions (Fig. 2 6). In particular, most fusion and fission gene transcript levels were maintaine d over the course of time ( Appendix D ), but the expression levels of FZO1 notably increased while FIS1 transcript level was significantly decreased during chronological aging (Fig. 2 6). Given that either enhanced fusion or diminished fission can transit m itochondria into a highly interconnected network structure (Okamoto and Shaw, 2005) these transcriptional changes in fusion and fission genes ( FZO1 versus FIS1 ) could explain the appearance of the network mitochondria observed in cells grown in the low glucose med ium during aging. What is more, the fact that fusion deficient ( fzo1 and mgm1 ) cells exclusively displayed puncta like mitochondria when the cells were grown in the low glucose medium further emphasizes that transcriptionally enhanced fusion is required for inducing the network of mitoc hondria by CR (Fig. 2 7 and 8). It is important to mention that in yeast two routine CR regimes can be applied during chronological aging: growth in a low glucose medium and growth in normal (usually 2%) glucose followed b y washing with water (Fabrizio and Longo, 2003; Piper, 2006) Although we could not test whether the water wash CR regime modulates the fusion and fission gene expressions, the water washed cells were able to produ ce a

PAGE 60

60 network of mitochondria (Fig. 2 5). In addition, these two routine CR regimes were able to increase cellular oxid ative stress resistance and viability during chronological aging (Fig. 2 4 and 5), indicating that two different CR methods may have a sim ilar impact on the regulation of mitochondrial fusion and fission pathways as well as cellular stress response s More interestingly, the fact that fusion deficient ( fzo1 and mgm1 ) cells, but not fission deficient (dnm1 fis1 and she9 ) cells failed to gain cellular oxidative stress resistance by these CR interventions (Fig 2 10 and 11; Appendix B) strongly impli es that enhanced resistance to oxidative stress dur ing aging is directly related to the mitochondrial fusion process. Th ese results further support the idea in that network mitochondria, in part, play a role in protecting aged cells from oxidative stress over the course of time. However, the possibility th at the fusion and fission components affect levels of other regulatory proteins involved in oxidative stress (i.e., superoxide dismutases ) cannot be ruled out and requires further analysis. Although how CR uniquely delays the aging process in various speci es is not fully understood CR might be intricately associated with modulating cellular and systemic redox status and regulating gene expressions related to cell death and survival (Carter et al., 2007; Chung et al. 2009; Guarente, 2008; Marzetti et al., 2008) Despite the fact that mitochondrial respiration is thought to generate inevitable oxidative stress, studies hypothesize that CR improves mitochondrial aerobic respiration and decreases the generation of oxid ative stress as a result of more efficient electron transfer chain coupling and less leakage of electrons (Bonawitz et al., 2007; Bonawitz and Shadel, 2007) eventually decreas ing mitochondrial oxidative damage and leading to extension of life span (Bonawitz et al., 2007; Bonawitz and Shadel, 2007; Guarente, 2008; Lin et

PAGE 61

61 al., 2002) W e also found that not only the WT cells grown in the low glucose medium but also the water w ashed WT cells significantly enhance cellular respiration during chronological aging (Fig. 2 14; Appendix C). However, CR failed to boost cel lular respiration in the fusion deficient (fzo1 and mgm1 ) cells whereas the fission deficient (dnm1 and fis1 ) cells were able to increase cellular respiration Considering t he fact that mtDNA encodes few, but very critical components for mitochondrial respiration (Wallace and Fan, 2009) this is reasonable since the fusion deficient cells displayed severely impaired mtDNA integrity (Fig. 2 13). This finding strongly indicat es that mitochondrial fusion, not fission, is required for maintaining mtDNA integrity and enhancing cellular aerobic respiration by CR. Interestingly, increased cellular respiration correl ates with CLS, but was inversely related with cellular levels of RNA oxidation (Fig. 2 12A and B). Based on these results, we were able to conclude that a CR mediated increase in CLS is associated with enhanced cellular respiration and that mitochondrial f usion is required for attenuat ing a loss of mtDNA and oxidative damage as well as extending CLS. In summary, we have identified the potential roles that mitochondrial fusion and fission genes play in the regulation of yeast chronological aging. A fundamen tal finding of our study is that both mitochondrial fusion and fission play important role s in normal CLS, but enhanced mitochondrial fusion by CR further increases cellular resistance to oxidative stress, prevents oxidative damage, reinforces mtDNA integr ity, and boosts cellular respiration, subsequently retarding chronological aging. It will be interesting to investigate whether enhanced mitochondrial fusion influence s the aging process in other organisms, especially in mammals.

PAGE 62

62 Figure 2 1 Mitochondr ial morphologies observed during chronological aging and under low glucose growth condition s Mitochondria were stained by mitochondrial matrix targeted GFP. Three distinct mitochondrial patterns were routinely observed following growth of yeast in minimal synthetic dextrose medium containing normal ( 2% ) or low ( 0.4% ) glucose: punctate (a) linear with less branched (b), network with highly branched (c) Staining with erythrocin B re veals dead (D) cells. Bar, 1 m.

PAGE 63

63 Figure 2 2. Low glucose medium in creas es network mitochondria during chronological aging (A) Schematic images depicting mitochondrial morphology cha nges in yeast cells are shown (g reen structures describe mitochondria). Mitochondrial targeted GFP expressing yeast cells were grown in a synthet ic dextrose minimal medium (SD) containing either ( B ) 2% glucose or ( C ) 0.4% glucose M orphological changes of mitochondria in cells were visually scored as the percentage of cells displaying : N et (interconnected network), L ine s (linear with less branches) D ot (punctate or a single small dot), N one (no GFP positive, but erythrocin B negative), and D ead ( D; eryth r ocin B positive ). At each time point, approximately, 200 cells were evaluated. Data w ere collected from three biological replicates Error bars re present the standard deviation.

PAGE 64

64 Figure 2 3. Low glucose medium decreases oxidative stress and cell d eath during chronological aging Y east cells w ere grown in a synthetic dextrose minimal medium containing either 2% glucose or 0.4% glucose. At each tim e point, (A) RNA oxidation (8 oxoG; 8 oxo Guanosine) and (B) DNA oxidation (8 oxodG; 8 oxo deoxy Guanosine) were quantified using a HPLC method. (C) Cell viability and (D) density w ere determined by using the vital dye (FUN 1) and by measuring optical dens ity (OD 600 ) respectively during chronological aging

PAGE 65

65 Figure 2 4. Low glucose medium increases stress resistance against oxidative stress during chronological aging Sensitivity to damage inducing agents such as hydrogen peroxide (H 2 O 2 ), menanione (Men ) and methyl methanesulfonate (MMS) were measured by determining cell viability over time grown in a synthetic dextrose minimal medium containing 2% glucose versus 0.4% glucose. At each time point, s erial 5 fold dilutions of chronologically aged culture r eplica were produced onto (A) rich medium (YPD) (B) YPD + 2.5 mM H 2 O 2 (C) YPD + 30 M Men, and (D) YPD + 1.5 mM MMS and the number of viable cells were estimated V iability is expressed as the log of colony forming units per mL of cultures. Data were col lected from three independent experiments. Error bars represent the standard deviation.

PAGE 66

66 Figure 2 5. Increased stress resistance against oxidants correlates with mitochondrial morphological change s (A) C ellular resistance to oxidants (e.g., 2.5 mM hydr ogen peroxide (H 2 O 2 ) and 30 M menadione (Men)) and mitochondrial morphology were determined in mitochondrial targeted GFP expressing cells grown under a synthetic dextrose minimal medium containing either 2% glucose (2%) or 0.4% glucose (0.4%), as well as after water wash (WW) during chronological aging. (B) Representative image s of mitochondria in control cells and w ater washed cells from Day 7 are shown ( a and b respectively ) E rythrocin B positive dead cells are shown in red (b and e) (C) C ell density and (D) death w ere concomitantly determined by measuring the optical density at 600 nm ( OD 600 ) and by calculating the percentage of erythrocin B stained cells from Day 1 to 5 # w ater wash d ay 0; Bar 1 m

PAGE 67

67 Figure 2 6. Expression of fusion and fission genes during chronolog ical aging RNA was extracted from cells grown in a synthetic dextrose minimal medium (SD) containing either 2% glucose or 0.4% glucose, and the r elative transcript levels of fusion and fission genes were determined by the comparativ e Ct method ( Ct) using Q PCR with specific oligonucleotides (see Table 4 1) 18S RNA was used as an endogenous reference The difference in threshold cycle values ( # Ct, namely Ct target genes Ct 18S RNA) was used as a measure of the relative expression l evels of the target genes. The # Ct value of Day 1 cells grown in SD containing 2% glucose was taken as a reference, then the relative mRNA levels of (A) FZO1 (B) MGM1 (C) DNM1 and (D) FIS1 w ere calculated by the following equation: R=2 ## Ct where R is t he calculated ratio and # # Ct is the # Ct analyzed class # Ct reference class value. Data were collected from three independent experiments. Error bars represent standard deviation. p < 0.05 (*); p < 0.01 (**) ; p < 0.001 (***) versus Day 1 of each growth cond ition

PAGE 68

68 Figure 2 7 Gallery of images showing mitochondrial morphology in fusion and fission mutants WT, fusion deficient (fzo1 mgm1 and ups1 ) and fission deficient (dnm1 fis1 and she9 ) strains were labeled with mitochondrial targeted GFP an d grown in either 2% glucose or 0.4% low glucose medium Representative images of GFP labeled mitochondria from D ay 1 and D ay 3 were shown Asterisks indicate dead cells (red) Bar, 5 m.

PAGE 69

69 Figure 2 8 Mitochondrial morphology change s during chronologic al aging in fusion and fission mutants Mitochondrial targeted GFP expressing WT cells as well as fusion deficient (fzo1 mgm1 and ups1 ) and fission deficient (dnm1 fis1 and she9 ) cells were grown in a synthetic dextrose minimal medium containing either (A) 2% glucose or (B) 0.4% glucose and m itochondrial morphology w as evaluated as described previously (see F igure 2 2). At each time point, 100 to 200 cells were evaluated.

PAGE 70

70 Figure 2 9 Chronological life spans of fusion and fission deficient cells during calorie restricted growth conditions. C hronological longevity was determined in WT, fusion deficient ( fzo1 mgm1 and ups1 ) and fission deficient (dnm1 fis1 mdv1 and she9 ) cell s The BY4742 background strains were used and grown in a synthetic dextrose minimal medium (SD) either containing (A and C) 2% glucose and (B) 0.4% glucose or (D) follow ed by water wash on Day 3 after growth in SD with 2% glucose The w ater wash step was repeated every 2 3 day s Via bility is expressed in terms of colony forming unit s per mL of culture and is plotted as the log of the percentage of viability on D ay 1. Result s reported in A and B represent experiments conducted at the same time as were the experiments reported in C and D

PAGE 71

71 Figure 2 10. Mitochondrial fusion is required for increasing oxidative stress resistance by the low glucose medium during chronological aging WT, fusion deficient (fzo1 mgm1 and ups1 ) and fission deficient (dnm1 and fis1 ) cell s were grown in a synthetic dextrose minimal medium containing 2% glucose and 0.4% glucose At each time point serial 5 fold diluted (5x dilu.) culture repl ica were plated onto rich medium (YPD) in the presence or absence of 2.0 mM and 2.4 mM hydrogen peroxide (H 2 O 2 ), 30 M menadione (Men), or 1.5 mM methy l methanesulfonate (MMS). The plates were incubated at 30 ¡ C for 3 days to visualize viable colonies

PAGE 72

72 F igure 2 11. Water wash intervention enhances oxidative stress resistance in the fission deficient cells, but not in fusion deficient cells WT, fusion deficient (fzo1 mgm1 and ups1 ) and fission deficient (dnm1 and fis1 ) cell s were grown in a synthetic dextrose minimal medium containing 2% glucose and /or water washed on Day 3. At each time point, serial 5 fold diluted (5x dilu.) culture replica wer e produced onto rich medium (YPD) in the presence or absence of 2.0 mM and 2.4 mM hydrogen peroxide (H 2 O 2 ), 30 M menadione (Men), or 1.5 mM methy l methanesulfonate (MMS). The plates were incubated at 30 ¡ C for 3 days to visualize viable colonies.

PAGE 73

73 Figur e 2 12. Low glucose medium is not sufficient to delay the accumulation of oxidative stress in fusion deficient cells WT, fusion deficient (fzo1 and mgm1 ) and fission deficient (dnm1 fis1 and she9 ) strain s were grown in a synthetic dextrose minimal medium containing (A and B) 2% glucose or (C and D) 0.4% glucose At each time point, RNA oxidation (8 oxoG; 8 oxo Guanosine) was quantifi ed using a HPLC method. Cell viability was determined by calculating the percentage of erythrocin B unstained cells

PAGE 74

74 Figure 2 13. Low glucose medium preserves mtDNA content in the presence of mitochondrial fusion components. WT, fusion deficient (fzo1 and mgm1 ) and fission deficient (dnm1 and fis1 ) strain s were grown in a synthetic dextrose minimal medium containing (A) 2% glucose or (B) 0.4% glucose The relative amount of mtDNA to nuclear DNA was determined using a QPCR method with specific oligo nucleotides (see Table 4 1). Data were collected from three independent experiments. Error bars represent the standard deviation. p < 0.05 (*); p < 0.01 (**) versus Day 1 of each strain

PAGE 75

75 Figure 2 14. Low glucose medium enhances cellular respiration in WT and fission deficient strains, but not in fusion deficient strains Cellular oxygen consumption rate was determined using a Clark type oxygen electrode in WT fusion deficient (fzo1 and mgm1 ) and fission deficient (dnm1 and fis1 ) strains grown in a synthetic dextrose medium containing (A) 2% glucose or (B) 0.4% glucose during chronological aging. Data were collected from three independent experiments. Error bars represent the standard deviation. ND indicates no detectible respiration in the indicated chronological age (Day)

PAGE 76

76 Table 2 1. The components of mitochondrial fusion and fission in yeast Gene n ame Subcellular l ocation Function FZO1 Mitochondrial outer membrane Mi tochondrial outer membrane fusion MGM1 Mitochondrial inner membrane and intermembrane space Mitochondrial inner membrane fusion UGO1 Mitochondrial outer membrane Interaction with Fzo1p and Mgm1p UPS 1 Mitochondrial intermembrane space Mgm1p processing PCP 1 Mitochondrial inner membrane Mgm1p processing MDM 30 Mitochondrial outer membrane and cytosol Fzo1p turnover DNM 1 Mitochondrial outer membrane Mitochondrial outer membrane fission FIS 1 Mitochondrial outer membrane Mitochondrial outer membrane fissio n SHE 9 Mitochondrial inner membrane Mitochondrial inner membrane fission CAF4 Mitochondrial outer membrane and cytosol Mitochondrial outer membrane fission MDV1 Mitochondrial outer membrane and cytosol Mitochondrial outer membrane fission

PAGE 77

77 CHAPTER 3 CO N CLUDING REMARKS AND FUTURE DIRECTION S A decline in mitochondrial function plays a key role in the aging process and increases the incidence of age related disorders. A deeper understanding of the intricate nature of mitochondrial dynamics, described as a balance between fusion and fission, has highlighted functional and structural alterations in m itochondrial morphology that is important in several key pathologies associated with aging. Indeed, a recent wave of studies has demonstrated the pleiotropic ro le of fusion and fission proteins in numerous cellular processes including mitochondrial metabolism, redox signaling, m itochondrial genomic maintenance, and cell death. Additionally, mitochondrial fusion and fission, together with autophagy have been propo sed to form a quality maintenance mechanism to facilitate the removal of damaged mitochondria from the cell. Thus, a faulty regulation of mitochondrial dynamics that is governed by fusion and fission may be one of the intrinsic causes of mitochondrial dysf unction that contributes to oxidative stress and cell death during the aging process. Although the precise role of mitochondrial fusion and fission dynamics in multicellular organisms is less understood, Sohal reported that mitochondrial structure (i.e. s ize and number) changes in flight muscle of Drosophila with age and suggested that reconfiguration of mitochondrial morphology stems from a result of altered balance of fusion and fission events with age (Sohal, 1975) Recently, it has been found that heterozygous mutation in Drosophila Opa1 elevates oxidative stress increases sensitivity to oxidative stress, and impairs mitochondrial respiratory chain complex activity. Interestingly, the authors further revealed that functional changes in mitochondria due to mutan t Opa1 destruct muscle mitochondrial morphology and

PAGE 78

78 shorten life span while an antioxidant intervention restored life span These results suggest that mitochondrial fusion, in part, plays a protective role against oxidative stress during aging (Tang et al., 2009) Related to aging in mammals, bo th aged heart and other tissues often display altered mitochondrial integrity (i.e. number), possibly due to dysregulation of mitochondrial fusion and fission (Bossy Wetzel et al., 2003) A recent study has reported that aged rat heart exhibits a greater level of cytosolic Opa1, which may not be actively involved in the inner membrane fusion process. However, Drp1 was higher in the mitochondrial fraction compared to the young control, implying age associated changes in the balance of mitochondrial fusion and fission processes (Ljubicic et al., 2009) These studies strongly indicate a potential involvement of mitochondrial fusion and fission pathways in mammalian aging To make matter s s more complicated, i t is important to mention that impac t of mitochondria fusion and fission might vary depending on cell types in multicellular organisms. For instance, the fusion event might be an important process as a defense mechanism in non dividing cells or during chronological aging. Since fused mitocho ndria provide a synchronized internal cable for translocating metabolites and energy source efficiently, mitochondrial fusion may ameliorate damages on mitochondrial components and mutations in mtDNA through mitochondria complementation (Sato et al., 2006; Sato et al., 2009) This is in agreement with in vivo and in vitro observations in mammalian cells whereby the fusion process rescues genetic and functional damages in mitochondria through exchange of mtDNA (Nakada et al., 2001; Ono et al., 2001; Sato et al., 2003; Sato et al., 2004) In contrast, proper fission might be important for dividing cells such as stem cells since impaired fission

PAGE 79

79 might fail to distribute newly s ynthesized mitochondria to the daughter cells during cell division. Indeed, Lee et al. demonstrated that mammalian cells lacking Fis1 exhibited senescence related phenotypes, including reduced rate of cell proliferation and elevated staining for acidic sen escence associated galactosidase activity, whereas the depletion of both Fis1 and O pa 1 markedly prevent the presence of cell senescence phenotypes (Lee et al., 2007) In addition, Yoon et al, also reported enlarged mitochondria observed in replicative senescence models w ere related to reduced levels of Fis1 (Yoon et al., 2006) Therefore, to better understand precise roles of mitochondrial fusion and fission in the aging process of multicellular organisms, it will be important to determine cell type specific roles of the fusion and fission pathways (e.g., mitotic cells versus post mitotic cells) in the regulation of mitochondrial and cellular function. In summary, m ajor advancements have been made in the area of mitochondrial dynamics and understanding the association between mitochondrial morphology and mitochondrial functional metrics. However, given the dynamic nature of mitochondria and the difficulty in visualizing fusion and fission events in an in vivo model of mammalian aging, progress in the field has been exceptionally slow. Recent advancements in live cell and tissue imaging techniques in consort with fluorescent labeling of proteins and 3D reconstruction of tissue mitochondrial electron micrographic images has paved the way for the study of mitochondrial dynamics in vivo in animal models. E xtensive research on the role of mitochondrial dynamics in basic biological processes has led to the consensus that mitochondrial morphology is vital f or proper mitochondrial function but a full appreciation of the multifaceted role of the fusion and

PAGE 80

80 fission proteins has not been ascertained. For example, we would like to know what are the upstream signaling molecules that regulate these proteins and the ir specific binding partners, and even more so, where in the agin g process they are integrated. Thus, the development of genetic tools to manipulate the levels of mitochondrial morphology proteins, in addition to imaging techniques will be critical for und erstanding the physiological relevance of these proteins and their potential use to delay the aging process and prevent the onset of age related diseases.

PAGE 81

81 CHAPTER 4 MATERIALS AND METHOD S Yeast Strains Yeast derived from BY4742 (Brachmann et al., 1998) contained KanMX4 marked deletions generated as part of the systemic gene deletion project (Winzeler et al., 1999) and yeast strains was obtained from EUROSCARF. The strains for our study are listed in Table 4 1. General Microbiological Methods Rich medium (YPD) containing 2% glucose and synthetic dextrose ( SD ) medium containing either 2% glucose or 0.4% glucose were prepared as followed by Sherman (Sherman, 2002) A final (active) concentration of G 418 sulfate (250 g/mL) was supplied to the culture medium (Mediatech, Inc, Manassas VA). Yeast cells were grown at 30¡C and the cell density was measured by diluting yeast cultures tenfold in water and determining the optical density at 600 nm (OD 600 ) using a Beckman DU 640 spectrophotometer (Fullerton, CA). Methods for Yeast Calorie Restriction Calorie restriction (CR) was done using two different approaches (i.e. culturing yeast cells in SD medium containing low glucose (0.4%) and in SD medium containing 2% glucose followed by washing with sterilized water; see Fig. 4 1). Briefly, Yeast strains from frozen stocks at 80¡C were patched onto YPD agar plates. After 2 days of growth at 30¡C, cells from patches were inoculated into 5 mL of 2% glucose SD medium in 14 mL polypropylene tubes and grown overnight at 30¡C in a drum rotator at ~15 rpm. After ~24 h growth, the yeast culture was tenfold diluted into 5 mL of 2% glucose SD medium and grow n overnight at 30¡C. After ~24h later, the yeast culture was diluted

PAGE 82

82 1/100 into the SD medium containing either 2% glucose as a normal glucose condition or 0.4% glucose as a calorie restricted condition. For the water wash CR, the cells grown in 2% glucose SD medium were collected by centrifugation at chronological day 3, d issolved in the equal volume of distilled water, and grown at 30¡C in a drum rotator at ~15 rpm. The water wash step was repeated every 2 3 days. Determination of Chronological Life Span Measurements of chronological life span (CLS) were performed accordin g to Alvers et al (Alvers et al., 2009) Stress Resistance Test During a chronological life span experiment, sensitivity to damage inducing agents such as hydrogen peroxide (H 2 O 2 ), menadione, and methyl methanesul fonate (MMS) was measured by testing cell viability (i.e., colony forming units). Briefly, on e hour prior to the stress resistance test, YPD agar plates containing without or with stressors were freshly prepared. A serial 5 fold diluted culture w as plated on to the prepared YPD agar medium in the presence or absence of stressors Then, the replica plates were incubated at 30¡C for 3 days to visualize viable colonies (Fig. 4 2). CFU per mL of culture s w ere plotted as a log scale. Evaluation of Mitochondrial M orphology Plasmid pVT100U mtGFP was obtained from B. Westerman and W. Neupert (Ludwig Maximilians Universitaet Muenchen, Muenchen, Germany) (Westermann and Neupert, 2000) The transformants were generated using lit hium acetate (Gietz and Woods, 2002) grown on 2% glucose SD agar plates, and prepared as single colonies. Duri ng CLS experiment, mitochondrial morphology in individual live transformants were evaluated according to the GFP staining patterns: punctate, linear, and network by

PAGE 83

83 using fluorescence microscopy. The percentage number of cells out of total cell counts (~20 0 cells) were calculated based on categories: net (interconnected network), line (linear with less branches), dot (punctate including a single small dot), none (no GFP positive, but erythrocin B negative), and dead (erythocin B positive ). Data were collect ed on a Zeiss Axiophot microscope equipped with a 100 # Neofuar objective lens and a CCD based digital camera using the single color channel mode. Determination of RNA/DNA Oxidation Freshly prepared patches for yeast strains were inoculated into 5 mL of SD medium in 14 mL Falcon 2059 polypropylene tubes (Fisher Scientific, Waltham, MA) and grown overnight at 30 ¡C in a drum rotator at ~15 rpm. After ~24 h of growth (on day 0), overnight cultures were diluted 1/100 into either 65 mL or 1L (for DNA extraction ) of SD medium to be used in the experiment (e.g. 2% SD and 0.4% SD) in Erlenmeyer and Fernbach flasks, respectively Then, cells were grown in an incubator shaker at 30 ¡C. To prepare nucleic acid extracts for the measurement of RNA oxidation, equivalent amounts of yeast from each chronological day (e.g. 10 OD units; 1 mL of culture at OD 600 = 10) were collected by centrifugation at 2000 rpm for 5 min washed with TE buffer (10 mM Tris HCl, 1 mM EDTA, pH8), and stored as frozen pellets at 80 ¡C. To incre ase DNA extraction efficiency, 200 mL of yeast cultures (~ 0.3g net wet weight) was collected by centrifugation at 5000 rpm and 4 ¡C for 5 min, washed with distilled water and used to prepare spheroplasts as described by Aris and Blobel (Aris and Blobel, 1991) The spheroplasts were chilled on ice, centrifuged, and stored as frozen pellets at 80 ¡C Then, total nucleic acids were prepared using a glass beads/phenol method. Meas urement of oxidative damage in nucleic acids (i.e. RNA and DNA) was performed as described by Hofer et al (Hofer et al., 2006) with slight

PAGE 84

84 modification to allow simultaneous analysis of RNA and DNA oxidation. Bri efly, the nucleic acid pellets were dissolved in 30 $ M DFOM and hydrolyzed using 4 U Nuclease P1 (MP Biomedicals, Irvine, CA) and 5 U alkaline phosphatase (Sigma Aldrich, St. Louis, MO ) in 30 mM sodium acetate, 20 $ M ZnCl 2 pH 5.3 at 50¡C for 60 min. After filtration to remove enzymes, nucleosides were separated using HPLC EC UV and analyzed for Guo (RNA) and dGuo (DNA) by UV, and 8 oxoGuo (RNA) and 8 oxodGuo (DNA) electrochemically using a Coulochem detector from ESA Inc. (Chelmsford, MA). Determination of Cell Death The cell death was determined by measuring the viability of chronologically aged cells as modified from Bonawitz et al (Bonawitz et al., 2007) Briefly, viability was assayed by staining a 10 l sample of the culture with 25 g/ml erythrocin B using ~ 200 individual cells per strain per time point to calculate percentage viability. Alternatively, the vital dye FUN 1 was used as described by the supplier (Invitrogen, Carlsbad, CA), Determination of mRNA Levels The relative amount of mRNA levels was determined using a quantitative real time PCR (Q PCR) method. All primers used for the study are listed in table 4 2. Briefly, freshly prepared patches for yeast strains were inoculated into 5 mL of SD medium in 14 mL Falcon 2059 polypropylene tubes (Fisher Scientific, Waltham, MA) and grown overnight at 30¡C in a drum rotator at ~15 rpm. After ~24 h of growth (on day 0), overnight cultures were diluted 1/100 into 65 mL of SD medium to be used in the experiment ( e.g. 2% SD and 0.4% SD) in Erlenmeyer flasks and grown in an incubator shaker at 30¡C and ~165 rpm. To prepare total RNA extracts, equivalent amounts of yeast from each chronological day (e.g. 5 10 OD units; 1 mL of culture at OD 600 = 10) were collected by centrifugation at 2000 rpm for 5 min, washed with TE buffer (10 mM

PAGE 85

85 Tris HCl, 1 mM EDTA, pH8), and stored as frozen pellets at 80 ¡C. Total RNA was isolated using a glass beads/phenol method as described previously (Ausubel et al. 1993 ) (Ausubel, 1987) The RNA pellet was then dissolved in n uclease free water and quantified by absorbance at 260 nm. The possible DNA contamination was removed by using the TURBO DNA free kit from Ambion as per the manufacturer's directions (Foster City, CA). After DNase treatment, RNA concentration and purity were deter mined spect rophotometrically (i.e., 260 nm to 280 nm ratio). To synthesize cDNA, a r everse transcription reaction was performed using the High capacity cDNA reverse transcription kit (ABI, Foster Cithy, CA). Briefly, 2L of 10X buffer, 0.8 L of 100 mM dNTP's, 2L of 10X random hexamers, 1 L of 100 mM dNTP mix, 1 L of 50 U/L reverse tr anscriptase, 1 L of 20 U/L of RNase inhibitor, and nuclease free wa ter were mixed and added to 2 ug of the extracted total RNA. The resulting mixture was incubated at 25¡C for 10 min followed by 37¡C for 2 h, and enzyme activity was terminated by heating to 85¡C for 5 min. The sy nthesized cDNA was used for a Q PCR reaction using Power SYBR Green PCR Master Mix (ABI, Foster Cit y, CA) as per the manufacturer's directions. The method has been validated by primer limiting experiments to determine the proper pr imers concentrations (200 nM for each primer pair) and by evaluating the equal reaction efficiency of the two amplicons. Each sample was analyzed in triplicated and fluorescence spectra were monitored by ABI 7500 real time PCR system (ABI, Foster City, CA) The difference in threshold cycle values ( % Ct, namely Ct target genes Ct 18S RNA) was used as a measure of the relative expression levels of the target genes. Day 1 of WT strain grown under 2% glucose SD medium was taken as a reference, then the relati ve level of target gene was calculated

PAGE 86

86 by the following equation: R=2 %% Ct where R is the calculated ratio and % Ct is the % Ct analyzed class % Ct reference class value. Determination of mtDNA Copy Number The relative amount of mtDNA to nuclear DNA was det ermined using a Q PCR strategy according to previously described procedure with slight modification (Taylor et al., 2005) Briefly, freshly prepared patches for yeast strains were inoculated into 5 mL of SD medium i n 14 mL Falcon 2059 polypropylene tubes (Fisher Scientific, Waltham, MA) and grown overnight at 30¡C in a drum rotator at ~15 rpm. After ~24 h of growth (on day 0), overnight cultures were diluted 1/100 into 65 mL of SD medium to be used in the experiment (e.g. 2% SD and 0.4% SD) in Erlenmeyer flasks and grown in an incubator shaker at 30¡C and ~165 rpm. To prepare DNA extracts, equivalent amounts of yeast from each chronological day (e.g. 10 OD units; 1 mL of culture at OD 600 = 10) were collected by centri fugation at 2000 rpm for 5 min, washed with TE buffer (10 mM Tris HCl, 1 mM EDTA, pH8), and stored as frozen pellets at 80¡C. Then, total DNA extracts were prepared using a glass beads/phenol method. Total DNA pellet was dissolved in 200 L TE buffer containing DNase free RN ase A (50 g/mL), digested for 15 min at 37 ¡C and used in a QPCR reaction by using Power SYBR Green PCR Master Mix (ABI, Foster Cit y, CA). Both PCR reaction for measuring amplification of the nuclear ACT1 gene and the mtDNA encoded COX I gene was performe d in the individual well of a 96 well Optical Reaction Plate (ABI, Foster City, CA) by us ing primers indicated in Table 4 2 The method has been validated by primer limiting experiments to determine the proper primers concentrations (200 nM for each primer pair) and by evaluating the equal reaction efficiency of the two amplicons. Each sample was analyzed in triplicated and fluorescence spectra were monitored by ABI 7500 real

PAGE 87

87 time PCR system (ABI, Foster City, CA). The difference in threshold cycle values ( % Ct, namely Ct COX1 Ct ACT1) was used as a measure of the relative abundance of mitochondrial genome. To compare the mtDNA amount among strains of different age and glucose conditions (i.e. 2% and 0.4%), the day1 WT strain grown under 2% SD medium was tak en as a reference, then the relative amount of mtDNA to nuclear DNA was calculated by the following equation: R=2 %% Ct where R is the calculated ratio and % Ct is the % Ct analyzed class % Ct reference class value. Measurement of Cellular Respiration During a chronological life span experiment, the rate of oxygen consumption was monitored using a Clark type oxygen electrode Oroboros Oxygraph 2K (Oroboros, Austria) 2 mL of culture at the indicated time points was transferred to an airtight chamber maintained at 30¡C with magnetic stirrer and oxygen content was monitored for at least 20 min. The rate of oxyg en consumption was normalized with cell density ( OD 600 ) and expressed as p mol per sec per OD unit Statistical Analysis Statistical analysis was performe d using Prism 4 (GraphPad Software Inc., San Diego, CA). The significance level was set at p < 0.05 using Student's t test.

PAGE 88

88 Table 4 1 Yeast strains Strain Genotype BY4742 MAT his3! 1, leu2! 0, lys2! 0, ura3! 0 WT BY4742 ho!::KanMX4 fzo1! BY4742 fzo1!: :KanMX4 mgm1! BY4742 mgm1!::KanMX4 ups1! BY4742 dnm1!::KanMX4 dnm1! BY4742 dnm1!::KanMX4 fis1! BY4742 fis1!::KanMX4 she9! BY4742 she9!::KanMX4 mdv1! BY4742 she9!::KanMX4 CEN.PK MAT his3! 1, leu2 3,112, trp1 289, ura3 52 fzo1! CEN.PK fzo1!::KanMX4 mdv1! CEN.PK mdv1!::KanMX4

PAGE 89

89 Figure 4 1 Schematic illustration depicting t wo routine me thods for calorie restriction during yeast chronological aging

PAGE 90

90 Figure 4 2. Schematic illustration depicting meth od for stress resistance test during yeast chro nological aging

PAGE 91

91 Table 4 2. Sequence of primers Name Sequence FZO1 5' GCACTTCTCAATGCGTTGGA 3' TGACCGAGGCCCTGATATTT MGM 1 5' AAAGTCCGTTGGTGCACTTACA 3' TGGCATGTGCTGATCTGTGA UGO1 5' GCAACGTCAAGGGCACAGAT 3' CGCTATACCCAGCATTGAAAGA UPS1 5' AAGAAGGAAAT TTGCGCACAA 3' GACCCATGTGGGCAGCTTT PCP1 5' TCGATACGTACGTTTGAACAGGTT 3' GATTGCCGCCGCTTCTC MDM30 5' GACTGCTTCACACAACCTCATGA 3' TCCCTTCCTGTGGCCCTATC DNM1 5' GCCGTCTCTCCAGCTAACGT 3' GGTCTACCTCTCTGGCCAACTTT FIS1 5' AAGGACGCATACGAACCACTCT 3' GACTTGC TGGCGCAGAATC SHE9 5' GCGTGGTCTTCGAGCGATT 3' GCATTCAAGGCGTCATTTTTG CAF4 5' AGGAGCCCTCCAATGTTACAAC 3' TCGCACAATGCCATCTTTTG MDV1 5' CAGACGAACCAAGTGTCCAGATAT 3' CGACGCAAGACCAGCTTTC 18S RNA 5' ACGGAGCCAGCGAGTCTAAC 3' CGACGGAGTTTCACAAGATTACC 25S RN A 5' GGACGGTGGCCATGGA 3' CATTCGGCCGGTGAGTTG ACT1 5' TCGTTCCAATTTACGCTGGTT 3' CGGCCAAATCGATTCTCAA COX I ( for mt DNA) 5' CTACAGATACAGCATTTCCAAGA 3' GTGCCTGAATAGATGATAATGGT ACT 1 (for mt DNA) 5' GTATGTGTAAAGCCGGTTTTG 3' CATGATACCTTGGTGTCTTGG

PAGE 92

92 APPENDI X A CLS IN CEN.PK STRAIN S

PAGE 93

93 APPENDIX B STRESS RESISTANCE TE ST

PAGE 94

94 APPENDIX C WATER WASH AND CELLULAR RE SPIRATION #, water wash day 0

PAGE 95

95 APPENDIX D MITOCHONDRIAL FUSION AND FISSION GENE EX PRESSION DURING CLS

PAGE 96

96 LIST OF REFERENCES Akama, K. T., Albanese, C. Pestell, R. G. and Van Eldik, L. J. (1998). Amyloid beta peptide stimulates nitric oxide production in astrocytes through an NFkappaB dependent mechanism. Proc Natl Acad Sci U S A 95 5795 800. Alexander, C., Votruba, M., Pesch, U. E., Thiselton, D. L., Mayer, S., Moore, A., Rodriguez, M., Kellner, U., Leo Kottler, B., Auburger, G. et al. (2000). OPA1, encoding a dynamin related GTPase, is mutated in autosomal dominant optic atrophy linked to chromosome 3q28. Nat Genet 26 211 5. Alirol, E., James, D., Hu ber, D., Marchetto, A., Vergani, L., Martinou, J. C. and Scorrano, L. (2006). The mitochondrial fission protein hFis1 requires the endoplasmic reticulum gateway to induce apoptosis. Mol Biol Cell 17 4593 605. Allen, C., Buttner, S., Aragon, A. D., Thomas, J. A., Meirelles, O., Jaetao, J. E., Benn, D., Ruby, S. W., Veenhuis, M., Madeo, F. et al. (2006). Isolation of quiescent and nonquiescent cells from yeast stationary phase cultures. J Cell Biol 174 89 100. Alvers, A. L., Fishwick, L. K., Wood, M. S., Hu D., Chung, H. S., Dunn, W. A., Jr. and Aris, J. P. (2009). Autophagy and amino acid homeostasis are required for chronological longevity in Saccharomyces cerevisiae. Aging Cell 8 353 69. Aragon, A. D., Rodriguez, A. L., Meirelles, O., Roy, S., Davidson, G. S., Tapia, P. H., Allen, C., Joe, R., Benn, D. and Werner Washburne, M. (2008). Characterization of differentiated quiescent and nonquiescent cells in yeast stationary phase cultures. Mol Biol Cell 19 1271 80. Ardley, H. C., Scott, G. B., Rose, S. A., Tan, N. G., Markham, A. F. and Robinson, P. A. (2003). Inhibition of proteasomal activity causes inclusion formation in neuronal and non neuronal cells overexpressing Parkin. Mol Biol Cell 14 4541 56. Aris, J. P. and Blobel, G. (1991). Isolation of yeast nuclei. Methods Enzymol 194 735 49. Arnoult, D., Rismanchi, N., Grodet, A., Roberts, R. G., Seeburg, D. P., Estaquier, J., Sheng, M. and Blackstone, C. (2005). Bax/Bak dependent release of DDP/TIMM8a promotes Drp1 mediated mitochondrial fission and mitop tosis during programmed cell death. Curr Biol 15 2112 8. Ashrafi, K., Sinclair, D., Gordon, J. I. and Guarente, L. (1999). Passage through stationary phase advances replicative aging in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 96 9100 5. Attaix D., Mosoni, L., Dardevet, D., Combaret, L., Mirand, P. P. and Grizard, J. (2005). Altered responses in skeletal muscle protein turnover during aging in anabolic and catabolic periods. Int J Biochem Cell Biol 37 1962 73.

PAGE 97

97 Ausubel, F. M. (1987). Current pr otocols in molecular biology. Brooklyn, N. Y. Bach, D., Naon, D., Pich, S., Soriano, F. X., Vega, N., Rieusset, J., Laville, M., Guillet, C., Boirie, Y., Wallberg Henriksson, H. et al. (2005). Expression of Mfn2, the Charcot Marie Tooth neuropathy type 2A gene, in human skeletal muscle: effects of type 2 diabetes, obesity, weight loss, and the regulatory role of tumor necrosis factor alpha and interleukin 6. Diabetes 54 2685 93. Bach, D., Pich, S., Soriano, F. X., Vega, N., Baumgartner, B., Oriola, J., Dau gaard, J. R., Lloberas, J., Camps, M., Zierath, J. R. et al. (2003). Mitofusin 2 determines mitochondrial network architecture and mitochondrial metabolism. A novel regulatory mechanism altered in obesity. J Biol Chem 278 17190 7. Bakeeva, L. E., Chentsov Yu, S. and Skulachev, V. P. (1978). Mitochondrial framework (reticulum mitochondriale) in rat diaphragm muscle. Biochim Biophys Acta 501 349 69. Baker, D. J., Betik, A. C., Krause, D. J. and Hepple, R. T. (2006). No decline in skeletal muscle oxidative c apacity with aging in long term calorically restricted rats: effects are independent of mitochondrial DNA integrity. J Gerontol A Biol Sci Med Sci 61 675 84. Bandy, B. and Davison, A. J. (1990). Mitochondrial mutations may increase oxidative stress: impli cations for carcinogenesis and aging? Free Radic Biol Med 8 523 39. Barsoum, M. J., Yuan, H., Gerencser, A. A., Liot, G., Kushnareva, Y., Graber, S., Kovacs, I., Lee, W. D., Waggoner, J., Cui, J. et al. (2006). Nitric oxide induced mitochondrial fission i s regulated by dynamin related GTPases in neurons. EMBO J 25 3900 11. Benard, G., Bellance, N., James, D., Parrone, P., Fernandez, H., Letellier, T. and Rossignol, R. (2007). Mitochondrial bioenergetics and structural network organization. J Cell Sci 120 838 48. Bereiter Hahn, J. and Voth, M. (1994). Dynamics of mitochondria in living cells: shape changes, dislocations, fusion, and fission of mitochondria. Microsc Res Tech 27 198 219. Berman, S. B., Chen, Y. B., Qi, B., McCaffery, J. M., Rucker, E. B., 3 rd, Goebbels, S., Nave, K. A., Arnold, B. A., Jonas, E. A., Pineda, F. J. et al. (2009). Bcl x L increases mitochondrial fission, fusion, and biomass in neurons. J Cell Biol 184 707 19. Bernardi, P. and Rasola, A. (2007). Calcium and cell death: the mitoc hondrial connection. Subcell Biochem 45 481 506.

PAGE 98

98 Bibb, M. J., Van Etten, R. A., Wright, C. T., Walberg, M. W. and Clayton, D. A. (1981). Sequence and gene organization of mouse mitochondrial DNA. Cell 26 167 80. Bishop, N. A. and Guarente, L. (2007). Gen etic links between diet and lifespan: shared mechanisms from yeast to humans. Nat Rev Genet 8 835 44. Bogenhagen, D. F. (2009). Does mtDNA nucleoid organization impact aging? Exp Gerontol (in press). Bonawitz, N. D., Chatenay Lapointe, M., Pan, Y. and Sh adel, G. S. (2007). Reduced TOR signaling extends chronological life span via increased respiration and upregulation of mitochondrial gene expression. Cell Metab 5 265 77. Bonawitz, N. D. and Shadel, G. S. (2007). Rethinking the mitochondrial theory of ag ing: the role of mitochondrial gene expression in lifespan determination. Cell Cycle 6 1574 8. Bossy Wetzel, E., Barsoum, M. J., Godzik, A., Schwarzenbacher, R. and Lipton, S. A. (2003). Mitochondrial fission in apoptosis, neurodegeneration and aging. Cur r Opin Cell Biol 15 706 16. Boveris, A. and Navarro, A. (2008). Brain mitochondrial dysfunction in aging. IUBMB Life 60 308 14. Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P. and Boeke, J. D. (1998). Designer deletion strains d erived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR mediated gene disruption and other applications. Yeast 14 115 32. Breckenridge, D. G., Stojanovic, M., Marcellus, R. C. and Shore, G. C. (2003). Caspase cleavage prod uct of BAP31 induces mitochondrial fission through endoplasmic reticulum calcium signals, enhancing cytochrome c release to the cytosol. J Cell Biol 160 1115 27. Brooks, C., Wei, Q., Cho, S. G. and Dong, Z. (2009). Regulation of mitochondrial dynamics in acute kidney injury in cell culture and rodent models. J Clin Invest 119 1275 85. Brooks, C., Wei, Q., Feng, L., Dong, G., Tao, Y., Mei, L., Xie, Z. J. and Dong, Z. (2007). Bak regulates mitochondrial morphology and pathology during apoptosis by interacti ng with mitofusins. Proc Natl Acad Sci U S A 104 11649 54. Caldeira da Silva, C. C., Cerqueira, F. M., Barbosa, L. F., Medeiros, M. H. and Kowaltowski, A. J. (2008). Mild mitochondrial uncoupling in mice affects energy metabolism, redox balance and longev ity. Aging Cell 7 552 60.

PAGE 99

99 Carter, C. S., Hofer, T., Seo, A. Y. and Leeuwenburgh, C. (2007). Molecular mechanisms of life and health span extension: role of calorie restriction and exercise intervention. Appl Physiol Nutr Metab 32 954 66. Cartoni, R., Le ger, B., Hock, M. B., Praz, M., Crettenand, A., Pich, S., Ziltener, J. L., Luthi, F., Deriaz, O., Zorzano, A. et al. (2005). Mitofusins 1/2 and ERRalpha expression are increased in human skeletal muscle after physical exercise. J Physiol 567 349 58. Chang C. R. and Blackstone, C. (2007). Cyclic AMP dependent protein kinase phosphorylation of Drp1 regulates its GTPase activity and mitochondrial morphology. J Biol Chem 282 21583 7. Chang, D. T., Rintoul, G. L., Pandipati, S. and Reynolds, I. J. (2006). Mut ant huntingtin aggregates impair mitochondrial movement and trafficking in cortical neurons. Neurobiol Dis 22 388 400. Chen, H. and Chan, D. C. (2004). Mitochondrial dynamics in mammals. Curr Top Dev Biol 59 119 44. Chen, H. and Chan, D. C. (2009). Mitoc hondrial dynamics -fusion, fission, movement, and mitophagy -in neurodegenerative diseases. Hum Mol Genet 18 R169 76. Chen, H., Detmer, S. A., Ewald, A. J., Griffin, E. E., Fraser, S. E. and Chan, D. C. (2003). Mitofusins Mfn1 and Mfn2 coordinately regula te mitochondrial fusion and are essential for embryonic development. J Cell Biol 160 189 200. Chen, H., McCaffery, J. M. and Chan, D. C. (2007). Mitochondrial fusion protects against neurodegeneration in the cerebellum. Cell 130 548 62. Cho, D. H., Nakam ura, T., Fang, J., Cieplak, P., Godzik, A., Gu, Z. and Lipton, S. A. (2009). S nitrosylation of Drp1 mediates beta amyloid related mitochondrial fission and neuronal injury. Science 324 102 5. Chomyn, A. and Attardi, G. (2003). MtDNA mutations in aging an d apoptosis. Biochem Biophys Res Commun 304 519 29. Chung, H. Y., Cesari, M., Anton, S., Marzetti, E., Giovannini, S., Seo, A. Y., Carter, C., Yu, B. P. and Leeuwenburgh, C. (2009). Molecular inflammation: underpinnings of aging and age related diseases. Ageing Res Rev 8 18 30. Chung, J. H., Seo, A. Y., Chung, S. W., Kim, M. K., Leeuwenburgh, C., Yu, B. P. and Chung, H. Y. (2008). Molecular mechanism of PPAR in the regulation of age related inflammation. Ageing Res Rev 7 126 36.

PAGE 100

100 Chung, K. K., Zhang, Y. Lim, K. L., Tanaka, Y., Huang, H., Gao, J., Ross, C. A., Dawson, V. L. and Dawson, T. M. (2001). Parkin ubiquitinates the alpha synuclein interacting protein, synphilin 1: implications for Lewy body formation in Parkinson disease. Nat Med 7 1144 50. Chu rch, C. and Poyton, R. O. (1998). Neither respiration nor cytochrome c oxidase affects mitochondrial morphology in Saccharomyces cerevisiae. J Exp Biol 201 1729 37. Civitarese, A. E., Carling, S., Heilbronn, L. K., Hulver, M. H., Ukropcova, B., Deutsch, W A., Smith, S. R. and Ravussin, E. (2007). Calorie restriction increases muscle mitochondrial biogenesis in healthy humans. PLoS Med 4 e76. Clark, I. E., Dodson, M. W., Jiang, C., Cao, J. H., Huh, J. R., Seol, J. H., Yoo, S. J., Hay, B. A. and Guo, M. (2 006). Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441 1162 6. Coggan, A. R., Spina, R. J., King, D. S., Rogers, M. A., Brown, M., Nemeth, P. M. and Holloszy, J. O. (1992). Skeletal muscle adaptatio ns to endurance training in 60 to 70 yr old men and women. J Appl Physiol 72 1780 6. Combaret, L., Dardevet, D., Bechet, D., Taillandier, D., Mosoni, L. and Attaix, D. (2009). Skeletal muscle proteolysis in aging. Curr Opin Clin Nutr Metab Care 12 37 41 Cribbs, J. T. and Strack, S. (2007). Reversible phosphorylation of Drp1 by cyclic AMP dependent protein kinase and calcineurin regulates mitochondrial fission and cell death. EMBO Rep 8 939 44. Cuervo, A. M. and Dice, J. F. (2000). Regulation of lamp2a levels in the lysosomal membrane. Traffic 1 570 83. Dagda, R. K., Cherra, S. J., 3rd, Kulich, S. M., Tandon, A., Park, D. and Chu, C. T. (2009). Loss of PINK1 function promotes mitophagy through effects on oxidative stress and mitochondrial fission. J Bio l Chem 284 13843 55. de Brito, O. M. and Scorrano, L. (2008). Mitofusin 2 tethers endoplasmic reticulum to mitochondria. Nature 456 605 10. Delettre, C., Griffoin, J. M., Kaplan, J., Dollfus, H., Lorenz, B., Faivre, L., Lenaers, G., Belenguer, P. and Ham el, C. P. (2001). Mutation spectrum and splicing variants in the OPA1 gene. Hum Genet 109 584 91. Delivani, P., Adrain, C., Taylor, R. C., Duriez, P. J. and Martin, S. J. (2006). Role for CED 9 and Egl 1 as regulators of mitochondrial fission and fusion d ynamics. Mol Cell 21 761 73.

PAGE 101

101 Deng, H., Dodson, M. W., Huang, H. and Guo, M. (2008). The Parkinson's disease genes pink1 and parkin promote mitochondrial fission and/or inhibit fusion in Drosophila. Proc Natl Acad Sci U S A 105 14503 8. Dinsdale, D., Zhua ng, J. and Cohen, G. M. (1999). Redistribution of cytochrome c precedes the caspase dependent formation of ultracondensed mitochondria, with a reduced inner membrane potential, in apoptotic monocytes. Am J Pathol 155 607 18. Dirks, A. J. and Leeuwenburgh, C. (2005). The role of apoptosis in age related skeletal muscle atrophy. Sports Med 35 473 83. Donati, A., Cavallini, G., Paradiso, C., Vittorini, S., Pollera, M., Gori, Z. and Bergamini, E. (2001). Age related changes in the regulation of autophagic pro teolysis in rat isolated hepatocytes. J Gerontol A Biol Sci Med Sci 56 B288 93. Dupont Versteegden, E. E. (2005). Apoptosis in muscle atrophy: relevance to sarcopenia. Exp Gerontol 40 473 81. Duvezin Caubet, S., Jagasia, R., Wagener, J., Hofmann, S., Tri funovic, A., Hansson, A., Chomyn, A., Bauer, M. F., Attardi, G., Larsson, N. G. et al. (2006). Proteolytic processing of OPA1 links mitochondrial dysfunction to alterations in mitochondrial morphology. J Biol Chem 281 37972 9. Elmore, S. P., Qian, T., Gri ssom, S. F. and Lemasters, J. J. (2001). The mitochondrial permeability transition initiates autophagy in rat hepatocytes. FASEB J 15 2286 7. Eura, Y., Ishihara, N., Yokota, S. and Mihara, K. (2003). Two mitofusin proteins, mammalian homologues of FZO, wi th distinct functions are both required for mitochondrial fusion. J Biochem 134 333 44. Fabrizio, P. and Longo, V. D. (2003). The chronological life span of Saccharomyces cerevisiae. Aging Cell 2 73 81. Fabrizio, P., Pozza, F., Pletcher, S. D., Gendron, C. M. and Longo, V. D. (2001). Regulation of longevity and stress resistance by Sch9 in yeast. Science 292 288 90. Fannin, S. W., Lesnefsky, E. J., Slabe, T. J., Hassan, M. O. and Hoppel, C. L. (1999). Aging selectively decreases oxidative capacity in rat heart interfibrillar mitochondria. Arch Biochem Biophys 372 399 407. Figueiredo, P. A., Mota, M. P., Appell, H. J. and Duarte, J. A. (2008). The role of mitochondria in aging of skeletal muscle. Biogerontology 9 67 84. Frank, S., Gaume, B., Bergmann Lei tner, E. S., Leitner, W. W., Robert, E. G., Catez, F., Smith, C. L. and Youle, R. J. (2001). The role of dynamin related protein 1, a mediator of mitochondrial fission, in apoptosis. Dev Cell 1 515 25.

PAGE 102

102 Frezza, C., Cipolat, S., Martins de Brito, O., Micaro ni, M., Beznoussenko, G. V., Rudka, T., Bartoli, D., Polishuck, R. S., Danial, N. N., De Strooper, B. et al. (2006). OPA1 controls apoptotic cristae remodeling independently from mitochondrial fusion. Cell 126 177 89. Gao, W., Pu, Y., Luo, K. Q. and Chang D. C. (2001). Temporal relationship between cytochrome c release and mitochondrial swelling during UV induced apoptosis in living HeLa cells. J Cell Sci 114 2855 62. Garnier, A., Fortin, D., Zoll, J., N'Guessan, B., Mettauer, B., Lampert, E., Veksler, V and Ventura Clapier, R. (2005). Coordinated changes in mitochondrial function and biogenesis in healthy and diseased human skeletal muscle. FASEB J 19 43 52. Gautier, C. A., Kitada, T. and Shen, J. (2008). Loss of PINK1 causes mitochondrial functional d efects and increased sensitivity to oxidative stress. Proc Natl Acad Sci U S A 105 11364 9. Gegg, M. E., Cooper, J. M., Schapira, A. H. and Taanman, J. W. (2009). Silencing of PINK1 expression affects mitochondrial DNA and oxidative phosphorylation in dop aminergic cells. PLoS One 4 e4756. Germain, M., Mathai, J. P., McBride, H. M. and Shore, G. C. (2005). Endoplasmic reticulum BIK initiates DRP1 regulated remodelling of mitochondrial cristae during apoptosis. EMBO J 24 1546 56. Gietz, R. D. and Woods, R. A. (2002). Transformation of yeast by lithium acetate/single stranded carrier DNA/polyethylene glycol method. Methods Enzymol 350 87 96. Gispert, S., Ricciardi, F., Kurz, A., Azizov, M., Hoepken, H. H., Becker, D., Voos, W., Leuner, K., Muller, W. E., Ku din, A. P. et al. (2009). Parkinson phenotype in aged PINK1 deficient mice is accompanied by progressive mitochondrial dysfunction in absence of neurodegeneration. PLoS One 4 e5777. Goldberg, A. A., Bourque, S. D., Kyryakov, P., Gregg, C., Boukh Viner, T. Beach, A., Burstein, M. T., Machkalyan, G., Richard, V., Rampersad, S. et al. (2009). Effect of calorie restriction on the metabolic history of chronologically aging yeast. Exp Gerontol 44 555 71. Gomes, L. C. and Scorrano, L. (2008). High levels of Fis 1, a pro fission mitochondrial protein, trigger autophagy. Biochim Biophys Acta 1777 860 6. Green, D. R. (1998). Apoptosis. Death deceiver. Nature 396 629 30. Green, D. R. and Kroemer, G. (2004). The pathophysiology of mitochondrial cell death. Science 3 05 626 9.

PAGE 103

103 Greene, J. C., Whitworth, A. J., Kuo, I., Andrews, L. A., Feany, M. B. and Pallanck, L. J. (2003). Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. Proc Natl Acad Sci U S A 100 4078 83. Guarente, L. (2008) Mitochondria -a nexus for aging, calorie restriction, and sirtuins? Cell 132 171 6. Gunter, T. E., Buntinas, L., Sparagna, G., Eliseev, R. and Gunter, K. (2000). Mitochondrial calcium transport: mechanisms and functions. Cell Calcium 28 285 96. Halliwe ll, B. and Gutteridge, J. M. C. (2007). Free radicals in biology and medicine. Oxford ; New York: Oxford University Press. Harman, D. (1956). Aging: a theory based on free radical and radiation chemistry. J Gerontol 11 298 300. Harman, D. (1972). The biol ogic clock: the mitochondria? J Am Geriatr Soc 20 145 7. Harrison, D. E., Strong, R., Sharp, Z. D., Nelson, J. F., Astle, C. M., Flurkey, K., Nadon, N. L., Wilkinson, J. E., Frenkel, K., Carter, C. S. et al. (2009). Rapamycin fed late in life extends life span in genetically heterogeneous mice. Nature 460 392 5. Hepple, R. T., Baker, D. J., McConkey, M., Murynka, T. and Norris, R. (2006). Caloric restriction protects mitochondrial function with aging in skeletal and cardiac muscles. Rejuvenation Res 9 219 22. Herker, E., Jungwirth, H., Lehmann, K. A., Maldener, C., Frohlich, K. U., Wissing, S., Buttner, S., Fehr, M., Sigrist, S. and Madeo, F. (2004). Chronological aging leads to apoptosis in yeast. J Cell Biol 164 501 7. Hermann, G. J., Thatcher, J. W., M ills, J. P., Hales, K. G., Fuller, M. T., Nunnari, J. and Shaw, J. M. (1998). Mitochondrial fusion in yeast requires the transmembrane GTPase Fzo1p. J Cell Biol 143 359 73. Hiona, A. and Leeuwenburgh, C. (2008). The role of mitochondrial DNA mutations in aging and sarcopenia: implications for the mitochondrial vicious cycle theory of aging. Exp Gerontol 43 24 33. Hofer, T., Seo, A. Y., Prudencio, M. and Leeuwenburgh, C. (2006). A method to determine RNA and DNA oxidation simultaneously by HPLC ECD: greate r RNA than DNA oxidation in rat liver after doxorubicin administration. Biol Chem 387 103 11. Holloszy, J. O. (1967). Biochemical adaptations in muscle. Effects of exercise on mitochondrial oxygen uptake and respiratory enzyme activity in skeletal muscle. J Biol Chem 242 2278 82. Holloszy, J. O. and Booth, F. W. (1976). Biochemical adaptations to endurance exercise in muscle. Annu Rev Physiol 38 273 91.

PAGE 104

104 Honda, S. and Hirose, S. (2003). Stage specific enhanced expression of mitochondrial fusion and fissio n factors during spermatogenesis in rat testis. Biochem Biophys Res Commun 311 424 32. Hood, D. A. (2001). Invited Review: contractile activity induced mitochondrial biogenesis in skeletal muscle. J Appl Physiol 90 1137 57. Hoppins, S., Lackner, L. and N unnari, J. (2007). The machines that divide and fuse mitochondria. Annu Rev Biochem 76 751 80. Hutter, E., Skovbro, M., Lener, B., Prats, C., Rabol, R., Dela, F. and Jansen Durr, P. (2007). Oxidative stress and mitochondrial impairment can be separated fr om lipofuscin accumulation in aged human skeletal muscle. Aging Cell 6 245 56. Ishihara, N., Eura, Y. and Mihara, K. (2004). Mitofusin 1 and 2 play distinct roles in mitochondrial fusion reactions via GTPase activity. J Cell Sci 117 6535 46. James, A. M. Wei, Y. H., Pang, C. Y. and Murphy, M. P. (1996). Altered mitochondrial function in fibroblasts containing MELAS or MERRF mitochondrial DNA mutations. Biochem J 318 ( Pt 2) 401 7. Jendrach, M., Mai, S., Pohl, S., Voth, M. and Bereiter Hahn, J. (2008). S hort and long term alterations of mitochondrial morphology, dynamics and mtDNA after transient oxidative stress. Mitochondrion 8 293 304. Jubrias, S. A., Esselman, P. C., Price, L. B., Cress, M. E. and Conley, K. E. (2001). Large energetic adaptations of elderly muscle to resistance and endurance training. J Appl Physiol 90 1663 70. Kaeberlein, M., Powers, R. W., 3rd, Steffen, K. K., Westman, E. A., Hu, D., Dang, N., Kerr, E. O., Kirkland, K. T., Fields, S. and Kennedy, B. K. (2005). Regulation of yeast replicative life span by TOR and Sch9 in response to nutrients. Science 310 1193 6. Kapahi, P., Zid, B. M., Harper, T., Koslover, D., Sapin, V. and Benzer, S. (2004). Regulation of lifespan in Drosophila by modulation of genes in the TOR signaling pathway Curr Biol 14 885 90. Karbowski, M., Jeong, S. Y. and Youle, R. J. (2004). Endophilin B1 is required for the maintenance of mitochondrial morphology. J Cell Biol 166 1027 39. Karbowski, M., Lee, Y. J., Gaume, B., Jeong, S. Y., Frank, S., Nechushtan, A., Santel, A., Fuller, M., Smith, C. L. and Youle, R. J. (2002). Spatial and temporal association of Bax with mitochondrial fission sites, Drp1, and Mfn2 during apoptosis. J Cell Biol 159 931 8. Karbowski, M., Norris, K. L., Cleland, M. M., Jeong, S. Y. and Youle, R. J. (2006). Role of Bax and Bak in mitochondrial morphogenesis. Nature 443 658 62.

PAGE 105

105 Katic, M., Kennedy, A. R., Leykin, I., Norris, A., McGettrick, A., Gesta, S., Russell, S. J., Bluher, M., Maratos Flier, E. and Kahn, C. R. (2007). Mitochondrial gene expression and increased oxidative metabolism: role in increased lifespan of fat specific insulin receptor knock out mice. Aging Cell 6 827 39. Kelley, D. E., He, J., Menshikova, E. V. and Ritov, V. B. (2002). Dysfunction of mitochondria in human ske letal muscle in type 2 diabetes. Diabetes 51 2944 50. Kim, I., Rodriguez Enriquez, S. and Lemasters, J. J. (2007). Selective degradation of mitochondria by mitophagy. Arch Biochem Biophys 462 245 53. Kim, S. J., Sung, J. Y., Um, J. W., Hattori, N., Mizun o, Y., Tanaka, K., Paik, S. R., Kim, J. and Chung, K. C. (2003). Parkin cleaves intracellular alpha synuclein inclusions via the activation of calpain. J Biol Chem 278 41890 9. Kirkwood, S. P., Munn, E. A. and Brooks, G. A. (1986). Mitochondrial reticulum in limb skeletal muscle. Am J Physiol 251 C395 402. Klingenspor, M. (2003). Cold induced recruitment of brown adipose tissue thermogenesis. Exp Physiol 88 141 8. Knott, A. B., Perkins, G., Schwarzenbacher, R. and Bossy Wetzel, E. (2008). Mitochondrial f ragmentation in neurodegeneration. Nat Rev Neurosci 9 505 18. Kroemer, G., Galluzzi, L. and Brenner, C. (2007). Mitochondrial membrane permeabilization in cell death. Physiol Rev 87 99 163. Kujoth, G. C., Hiona, A., Pugh, T. D., Someya, S., Panzer, K., W ohlgemuth, S. E., Hofer, T., Seo, A. Y., Sullivan, R., Jobling, W. A. et al. (2005). Mitochondrial DNA mutations, oxidative stress, and apoptosis in mammalian aging. Science 309 481 4. Kujoth, G. C., Leeuwenburgh, C. and Prolla, T. A. (2006). Mitochondria l DNA mutations and apoptosis in mammalian aging. Cancer Res 66 7386 9. Laun, P., Pichova, A., Madeo, F., Fuchs, J., Ellinger, A., Kohlwein, S., Dawes, I., Frohlich, K. U. and Breitenbach, M. (2001). Aged mother cells of Saccharomyces cerevisiae show mark ers of oxidative stress and apoptosis. Mol Microbiol 39 1166 73. Lee, S., Jeong, S. Y., Lim, W. C., Kim, S., Park, Y. Y., Sun, X., Youle, R. J. and Cho, H. (2007). Mitochondrial fission and fusion mediators, hFis1 and OPA1, modulate cellular senescence. J Biol Chem 282 22977 83. Lee, Y. J., Jeong, S. Y., Karbowski, M., Smith, C. L. and Youle, R. J. (2004). Roles of the mammalian mitochondrial fission and fusion mediators Fis1, Drp1, and Opa1 in apoptosis. Mol Biol Cell 15 5001 11.

PAGE 106

106 Leeuwenburgh, C. and Pr olla, T. A. (2006). Genetics, redox signaling, oxidative stress, and apoptosis in mammalian aging. Antioxid Redox Signal 8 503 5. Legros, F., Malka, F., Frachon, P., Lombes, A. and Rojo, M. (2004). Organization and dynamics of human mitochondrial DNA. J C ell Sci 117 2653 62. Liesa, M., Borda d'Agua, B., Medina Gomez, G., Lelliott, C. J., Paz, J. C., Rojo, M., Palacin, M., Vidal Puig, A. and Zorzano, A. (2008). Mitochondrial fusion is increased by the nuclear coactivator PGC 1beta. PLoS One 3 e3613. Liesa M., Palacin, M. and Zorzano, A. (2009). Mitochondrial dynamics in mammalian health and disease. Physiol Rev 89 799 845. Lin, S. J., Defossez, P. A. and Guarente, L. (2000). Requirement of NAD and SIR2 for life span extension by calorie restriction in Sa ccharomyces cerevisiae. Science 289 2126 8. Lin, S. J., Kaeberlein, M., Andalis, A. A., Sturtz, L. A., Defossez, P. A., Culotta, V. C., Fink, G. R. and Guarente, L. (2002). Calorie restriction extends Saccharomyces cerevisiae lifespan by increasing respir ation. Nature 418 344 8. Liot, G., Bossy, B., Lubitz, S., Kushnareva, Y., Sejbuk, N. and Bossy Wetzel, E. (2009). Complex II inhibition by 3 NP causes mitochondrial fragmentation and neuronal cell death via an NMDA and ROS dependent pathway. Cell Death D iffer 16 899 909. Liu, X., Kim, C. N., Yang, J., Jemmerson, R. and Wang, X. (1996). Induction of apoptotic program in cell free extracts: requirement for dATP and cytochrome c. Cell 86 147 57. Ljubicic, V., Menzies, K. J. and Hood, D. A. (2009). Mitochon drial dysfunction is associated with a pro apoptotic cellular environment in senescent cardiac muscle. Mech Ageing Dev Longo, V. D., Gralla, E. B. and Valentine, J. S. (1996). Superoxide dismutase activity is essential for stationary phase survival in Sac charomyces cerevisiae. Mitochondrial production of toxic oxygen species in vivo. J Biol Chem 271 12275 80. Longo, V. D., Mitteldorf, J. and Skulachev, V. P. (2005). Programmed and altruistic ageing. Nat Rev Genet 6 866 72. Lutz, A. K., Exner, N., Fett, M E., Schlehe, J. S., Kloos, K., Lammermann, K., Brunner, B., Kurz Drexler, A., Vogel, F., Reichert, A. S. et al. (2009). Loss of parkin or PINK1 function increases Drp1 dependent mitochondrial fragmentation. J Biol Chem 284 22938 51.

PAGE 107

107 Magherini, F., Carp entieri, A., Amoresano, A., Gamberi, T., De Filippo, C., Rizzetto, L., Biagini, M., Pucci, P. and Modesti, A. (2009). Different carbon sources affect lifespan and protein redox state during Saccharomyces cerevisiae chronological ageing. Cell Mol Life Sci 6 6 933 47. Malena, A., Loro, E., Di Re, M., Holt, I. J. and Vergani, L. (2009). Inhibition of mitochondrial fission favours mutant over wild type mitochondrial DNA. Hum Mol Genet 18 3407 16. Marongiu, R., Spencer, B., Crews, L., Adame, A., Patrick, C., Tr ejo, M., Dallapiccola, B., Valente, E. M. and Masliah, E. (2009). Mutant Pink1 induces mitochondrial dysfunction in a neuronal cell model of Parkinson's disease by disturbing calcium flux. J Neurochem 108 1561 74. Marzetti, E., Lawler, J. M., Hiona, A., M anini, T., Seo, A. Y. and Leeuwenburgh, C. (2008). Modulation of age induced apoptotic signaling and cellular remodeling by exercise and calorie restriction in skeletal muscle. Free Radic Biol Med 44 160 8. Menshikova, E. V., Ritov, V. B., Fairfull, L., F errell, R. E., Kelley, D. E. and Goodpaster, B. H. (2006). Effects of exercise on mitochondrial content and function in aging human skeletal muscle. J Gerontol A Biol Sci Med Sci 61 534 40. Menshikova, E. V., Ritov, V. B., Toledo, F. G., Ferrell, R. E., G oodpaster, B. H. and Kelley, D. E. (2005). Effects of weight loss and physical activity on skeletal muscle mitochondrial function in obesity. Am J Physiol Endocrinol Metab 288 E818 25. Merz, S., Hammermeister, M., Altmann, K., Durr, M. and Westermann, B. (2007). Molecular machinery of mitochondrial dynamics in yeast. Biol Chem 388 917 26. Mootha, V. K., Handschin, C., Arlow, D., Xie, X., St Pierre, J., Sihag, S., Yang, W., Altshuler, D., Puigserver, P., Patterson, N. et al. (2004). Erralpha and Gabpa/b sp ecify PGC 1alpha dependent oxidative phosphorylation gene expression that is altered in diabetic muscle. Proc Natl Acad Sci U S A 101 6570 5. Mortiboys, H., Thomas, K. J., Koopman, W. J., Klaffke, S., Abou Sleiman, P., Olpin, S., Wood, N. W., Willems, P. H., Smeitink, J. A., Cookson, M. R. et al. (2008). Mitochondrial function and morphology are impaired in parkin mutant fibroblasts. Ann Neurol 64 555 65. Mortimer, R. K. and Johnston, J. R. (1959). Life span of individual yeast cells. Nature 183 1751 2. Moyes, C. D., Mathieu Costello, O. A., Tsuchiya, N., Filburn, C. and Hansford, R. G. (1997). Mitochondrial biogenesis during cellular differentiation. Am J Physiol 272 C1345 51.

PAGE 108

108 Mukamel, Z. and Kimchi, A. (2004). Death associated protein 3 localizes to th e mitochondria and is involved in the process of mitochondrial fragmentation during cell death. J Biol Chem 279 36732 8. Murakoshi, M., Osamura, Y. and Watanabe, K. (1985). Mitochondrial alterations in aged rat adrenal cortical cells. Tokai J Exp Clin Med 10 531 6. Nakada, K., Inoue, K., Ono, T., Isobe, K., Ogura, A., Goto, Y. I., Nonaka, I. and Hayashi, J. I. (2001). Inter mitochondrial complementation: Mitochondria specific system preventing mice from expression of disease phenotypes by mutant mtDNA. Na t Med 7 934 40. Neuspiel, M., Zunino, R., Gangaraju, S., Rippstein, P. and McBride, H. (2005). Activated mitofusin 2 signals mitochondrial fusion, interferes with Bax activation, and reduces susceptibility to radical induced depolarization. J Biol Chem 28 0 25060 70. Niemann, A., Ruegg, M., La Padula, V., Schenone, A. and Suter, U. (2005). Ganglioside induced differentiation associated protein 1 is a regulator of the mitochondrial network: new implications for Charcot Marie Tooth disease. J Cell Biol 170 1067 78. Nisoli, E., Tonello, C., Cardile, A., Cozzi, V., Bracale, R., Tedesco, L., Falcone, S., Valerio, A., Cantoni, O., Clementi, E. et al. (2005). Calorie restriction promotes mitochondrial biogenesis by inducing the expression of eNOS. Science 310 31 4 7. Nunomura, A., Castellani, R. J., Zhu, X., Moreira, P. I., Perry, G. and Smith, M. A. (2006). Involvement of oxidative stress in Alzheimer disease. J Neuropathol Exp Neurol 65 631 41. Okamoto, K. and Shaw, J. M. (2005). Mitochondrial morphology and dy namics in yeast and multicellular eukaryotes. Annu Rev Genet 39 503 36. Olichon, A., Baricault, L., Gas, N., Guillou, E., Valette, A., Belenguer, P. and Lenaers, G. (2003). Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. J Biol Chem 278 7743 6. Ono, T., Isobe, K., Nakada, K. and Hayashi, J. I. (2001). Human cells are protected from mitochondrial dysfunction by complementation of DNA products in fused mitochondria. Nat Genet 28 272 5. Orr, A. L., Li, S., Wang, C. E., Li, H., Wang, J., Rong, J., Xu, X., Mastroberardino, P. G., Greenamyre, J. T. and Li, X. J. (2008). N terminal mutant huntingtin associates with mitochondria and impairs mitochondrial trafficking. J Neurosci 28 2783 92. Palacino, J. J., Sagi, D., Goldberg, M. S., Krauss, S., Motz, C., Wacker, M., Klose, J. and Shen, J. (2004). Mitochondrial dysfunction and oxidative damage in parkin deficient mice. J Biol Chem 279 18614 22.

PAGE 109

109 Palermo, V., Falcone, C. and Mazzoni, C. (2007). Apoptosis and aging in mitochondrial morphology mutants of S. cerevisiae. Folia Microbiol (Praha) 52 479 83. Pandolfo, M. (2006). Iron and Friedreich ataxia. J Neural Transm Suppl 143 6. Papa, S., Sardanelli, A. M., Capitanio, N. and Piccoli, C. (2009). Mitochondrial respiratory dysfunction and mutations in mitochondrial DNA in PINK1 familial parkinsonism. J Bioenerg Biomembr 41 509 16. Parone, P. A., Da Cruz, S., Tondera, D., Mattenberger, Y., James, D. I., Maechler, P., Barja, F. and Martino u, J. C. (2008). Preventing mitochondrial fission impairs mitochondrial function and leads to loss of mitochondrial DNA. PLoS One 3 e3257. Parone, P. A., James, D. I., Da Cruz, S., Mattenberger, Y., Donze, O., Barja, F. and Martinou, J. C. (2006). Inhibit ing the mitochondrial fission machinery does not prevent Bax/Bak dependent apoptosis. Mol Cell Biol 26 7397 408. Pesah, Y., Pham, T., Burgess, H., Middlebrooks, B., Verstreken, P., Zhou, Y., Harding, M., Bellen, H. and Mardon, G. (2004). Drosophila parkin mutants have decreased mass and cell size and increased sensitivity to oxygen radical stress. Development 131 2183 94. Pich, S., Bach, D., Briones, P., Liesa, M., Camps, M., Testar, X., Palacin, M. and Zorzano, A. (2005). The Charcot Marie Tooth type 2A gene product, Mfn2, up regulates fuel oxidation through expression of OXPHOS system. Hum Mol Genet 14 1405 15. Piper, P. W. (2006). Long lived yeast as a model for ageing research. Yeast 23 215 26. Pitts, K. R., Yoon, Y., Krueger, E. W. and McNiven, M. A (1999). The dynamin like protein DLP1 is essential for normal distribution and morphology of the endoplasmic reticulum and mitochondria in mammalian cells. Mol Biol Cell 10 4403 17. Pletjushkina, O. Y., Lyamzaev, K. G., Popova, E. N., Nepryakhina, O. K. Ivanova, O. Y., Domnina, L. V., Chernyak, B. V. and Skulachev, V. P. (2006). Effect of oxidative stress on dynamics of mitochondrial reticulum. Biochim Biophys Acta 1757 518 24. Poole, A. C., Thomas, R. E., Andrews, L. A., McBride, H. M., Whitworth, A. J. and Pallanck, L. J. (2008). The PINK1/Parkin pathway regulates mitochondrial morphology. Proc Natl Acad Sci U S A 105 1638 43. Qiang, W., Weiqiang, K., Qing, Z., Pengju, Z. and Yi, L. (2007). Aging impairs insulin stimulated glucose uptake in rat skele tal muscle via suppressing AMPKalpha. Exp Mol Med 39 535 43.

PAGE 110

110 Rapaport, D., Brunner, M., Neupert, W. and Westermann, B. (1998). Fzo1p is a mitochondrial outer membrane protein essential for the biogenesis of functional mitochondria in Saccharomyces cerevis iae. J Biol Chem 273 20150 5. Reverter Branchat, G., Cabiscol, E., Tamarit, J. and Ros, J. (2004). Oxidative damage to specific proteins in replicative and chronological aged Saccharomyces cerevisiae: common targets and prevention by calorie restriction. J Biol Chem 279 31983 9. Reznick, R. M., Zong, H., Li, J., Morino, K., Moore, I. K., Yu, H. J., Liu, Z. X., Dong, J., Mustard, K. J., Hawley, S. A. et al. (2007). Aging associated reductions in AMP activated protein kinase activity and mitochondrial bioge nesis. Cell Metab 5 151 6. Rojo, M., Legros, F., Chateau, D. and Lombes, A. (2002). Membrane topology and mitochondrial targeting of mitofusins, ubiquitous mammalian homologs of the transmembrane GTPase Fzo. J Cell Sci 115 1663 74. Rube, D. A. and van de r Bliek, A. M. (2004). Mitochondrial morphology is dynamic and varied. Mol Cell Biochem 256 257 331 9. Santel, A., Frank, S., Gaume, B., Herrler, M., Youle, R. J. and Fuller, M. T. (2003). Mitofusin 1 protein is a generally expressed mediator of mitochond rial fusion in mammalian cells. J Cell Sci 116 2763 74. Sato, A., Endo, H., Umetsu, K., Sone, H., Yanagisawa, Y., Saigusa, A., Aita, S. and Kagawa, Y. (2003). Polymorphism, heteroplasmy, mitochondrial fusion and diabetes. Biosci Rep 23 313 37. Sato, A., Nakada, K. and Hayashi, J. (2006). Mitochondrial dynamics and aging: Mitochondrial interaction preventing individuals from expression of respiratory deficiency caused by mutant mtDNA. Biochim Biophys Acta 1763 473 81. Sato, A., Nakada, K. and Hayashi, J. (2009). Mitochondrial complementation preventing respiratory dysfunction caused by mutant mtDNA. Biofactors 35 130 7. Sato, A., Nakada, K., Shitara, H., Yonekawa, H. and Hayashi, J. (2004). In vivo interaction between mitochondria carrying mtDNAs from dif ferent mouse species. Genetics 167 1855 61. Scarpulla, R. C. (2008). Nuclear control of respiratory chain expression by nuclear respiratory factors and PGC 1 related coactivator. Ann N Y Acad Sci 1147 321 34. Schafer, A. and Reichert, A. S. (2009). Emerg ing roles of mitochondrial membrane dynamics in health and disease. Biol Chem 390 707 15. Scheckhuber, C. Q., Erjavec, N., Tinazli, A., Hamann, A., Nystrom, T. and Osiewacz, H. D. (2007). Reducing mitochondrial fission results in increased life span and f itness of two fungal ageing models. Nat Cell Biol 9 99 105.

PAGE 111

111 Scorrano, L., Ashiya, M., Buttle, K., Weiler, S., Oakes, S. A., Mannella, C. A. and Korsmeyer, S. J. (2002). A distinct pathway remodels mitochondrial cristae and mobilizes cytochrome c during ap optosis. Dev Cell 2 55 67. Seo, A. Y., Hofer, T., Sung, B., Judge, S., Chung, H. Y. and Leeuwenburgh, C. (2006). Hepatic oxidative stress during aging: effects of 8% long term calorie restriction and lifelong exercise. Antioxid Redox Signal 8 529 38. Seo A. Y., Xu, J., Servais, S., Hofer, T., Marzetti, E., Wohlgemuth, S. E., Knutson, M. D., Chung, H. Y. and Leeuwenburgh, C. (2008). Mitochondrial iron accumulation with age and functional consequences. Aging Cell 7 706 16. Sesaki, H., Dunn, C. D., Iijima, M., Shepard, K. A., Yaffe, M. P., Machamer, C. E. and Jensen, R. E. (2006). Ups1p, a conserved intermembrane space protein, regulates mitochondrial shape and alternative topogenesis of Mgm1p. J Cell Biol 173 651 8. Sesaki, H. and Jensen, R. E. (1999). Di vision versus fusion: Dnm1p and Fzo1p antagonistically regulate mitochondrial shape. J Cell Biol 147 699 706. Sherman, F. (2002). Getting started with yeast. Methods Enzymol 350 3 41. Shimura, H., Schlossmacher, M. G., Hattori, N., Frosch, M. P., Trocken bacher, A., Schneider, R., Mizuno, Y., Kosik, K. S. and Selkoe, D. J. (2001). Ubiquitination of a new form of alpha synuclein by parkin from human brain: implications for Parkinson's disease. Science 293 263 9. Skulachev, V. P. (2001). Mitochondrial filam ents and clusters as intracellular power transmitting cables. Trends Biochem Sci 26 23 9. Skulachev, V. P. and Longo, V. D. (2005). Aging as a mitochondria mediated atavistic program: can aging be switched off? Ann N Y Acad Sci 1057 145 64. Smirnova, E., Griparic, L., Shurland, D. L. and van der Bliek, A. M. (2001). Dynamin related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 12 2245 56. Sohal, R. D. (1975). Mitochondrial changes in flight muscles of normal and fl ightless Drosophila melanogaster with age. J Morphol 145 337 53. Soriano, F. X., Liesa, M., Bach, D., Chan, D. C., Palacin, M. and Zorzano, A. (2006). Evidence for a mitochondrial regulatory pathway defined by peroxisome proliferator activated receptor ga mma coactivator 1 alpha, estrogen related receptor alpha, and mitofusin 2. Diabetes 55 1783 91.

PAGE 112

112 Speakman, J. R., Talbot, D. A., Selman, C., Snart, S., McLaren, J. S., Redman, P., Krol, E., Jackson, D. M., Johnson, M. S. and Brand, M. D. (2004). Uncouple d and surviving: individual mice with high metabolism have greater mitochondrial uncoupling and live longer. Aging Cell 3 87 95. Sugiyama, S., Takasawa, M., Hayakawa, M. and Ozawa, T. (1993). Changes in skeletal muscle, heart and liver mitochondrial elect ron transport activities in rats and dogs of various ages. Biochem Mol Biol Int 30 937 44. Susin, S. A., Lorenzo, H. K., Zamzami, N., Marzo, I., Snow, B. E., Brothers, G. M., Mangion, J., Jacotot, E., Costantini, P., Loeffler, M. et al. (1999). Molecular characterization of mitochondrial apoptosis inducing factor. Nature 397 441 6. Suzuki, M., Jeong, S. Y., Karbowski, M., Youle, R. J. and Tjandra, N. (2003). The solution structure of human mitochondria fission protein Fis1 reveals a novel TPR like helix b undle. J Mol Biol 334 445 58. Takahashi, Y., Karbowski, M., Yamaguchi, H., Kazi, A., Wu, J., Sebti, S. M., Youle, R. J. and Wang, H. G. (2005). Loss of Bif 1 suppresses Bax/Bak conformational change and mitochondrial apoptosis. Mol Cell Biol 25 9369 82. Tandler, B. and Hoppel, C. L. (1986). Studies on giant mitochondria. Ann N Y Acad Sci 488 65 81. Tang, S., Le, P. K., Tse, S., Wallace, D. C. and Huang, T. (2009). Heterozygous mutation of Opa1 in Drosophila shortens lifespan mediated through increased re active oxygen species production. PLoS One 4 e4492. Taylor, S. D., Zhang, H., Eaton, J. S., Rodeheffer, M. S., Lebedeva, M. A., O'Rourke T, W., Siede, W. and Shadel, G. S. (2005). The conserved Mec1/Rad53 nuclear checkpoint pathway regulates mitochondrial DNA copy number in Saccharomyces cerevisiae. Mol Biol Cell 16 3010 8. Terman, A. (1995). The effect of age on formation and elimination of autophagic vacuoles in mouse hepatocytes. Gerontology 41 Suppl 2 319 26. Terman, A. and Brunk, U. T. (2005). The a ging myocardium: roles of mitochondrial damage and lysosomal degradation. Heart Lung Circ 14 107 14. Terman, A., Kurz, T., Navratil, M., Arriaga, E. A. and Brunk, U. T. (2010). Mitochondrial turnover and aging of long lived postmitotic cells: the mitochon drial lysosomal axis theory of aging. Antioxid Redox Signal 12 503 35. Tondera, D., Czauderna, F., Paulick, K., Schwarzer, R., Kaufmann, J. and Santel, A. (2005). The mitochondrial protein MTP18 contributes to mitochondrial fission in mammalian cells. J C ell Sci 118 3049 59.

PAGE 113

113 Trifunovic, A., Wredenberg, A., Falkenberg, M., Spelbrink, J. N., Rovio, A. T., Bruder, C. E., Bohlooly, Y. M., Gidlof, S., Oldfors, A., Wibom, R. et al. (2004). Premature ageing in mice expressing defective mitochondrial DNA polymer ase. Nature 429 417 23. Trushina, E., Dyer, R. B., Badger, J. D., 2nd, Ure, D., Eide, L., Tran, D. D., Vrieze, B. T., Legendre Guillemin, V., McPherson, P. S., Mandavilli, B. S. et al. (2004). Mutant huntingtin impairs axonal trafficking in mammalian neur ons in vivo and in vitro. Mol Cell Biol 24 8195 209. Tsai, Y. C., Fishman, P. S., Thakor, N. V. and Oyler, G. A. (2003). Parkin facilitates the elimination of expanded polyglutamine proteins and leads to preservation of proteasome function. J Biol Chem 27 8 22044 55. Twig, G., Elorza, A., Molina, A. J., Mohamed, H., Wikstrom, J. D., Walzer, G., Stiles, L., Haigh, S. E., Katz, S., Las, G. et al. (2008). Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. EMBO J 27 43 3 46. Van Remmen, H. and Richardson, A. (2001). Oxidative damage to mitochondria and aging. Exp Gerontol 36 957 68. Vellai, T., Takacs Vellai, K., Zhang, Y., Kovacs, A. L., Orosz, L. and Muller, F. (2003). Genetics: influence of TOR kinase on lifespan in C. elegans. Nature 426 620. Visser, W., van Spronsen, E. A., Nanninga, N., Pronk, J. T., Gijs Kuenen, J. and van Dijken, J. P. (1995). Effects of growth conditions on mitochondrial morphology in Saccharomyces cerevisiae. Antonie Van Leeuwenhoek 67 243 53 Wallace, D. C. and Fan, W. (2009). The pathophysiology of mitochondrial disease as modeled in the mouse. Genes Dev 23 1714 36. Wang, H., Lim, P. J., Karbowski, M. and Monteiro, M. J. (2009a). Effects of overexpression of huntingtin proteins on mitochond rial integrity. Hum Mol Genet 18 737 52. Wang, X., Su, B., Lee, H. G., Li, X., Perry, G., Smith, M. A. and Zhu, X. (2009b). Impaired balance of mitochondrial fission and fusion in Alzheimer's disease. J Neurosci 29 9090 103. Wang, X., Su, B., Siedlak, S. L., Moreira, P. I., Fujioka, H., Wang, Y., Casadesus, G. and Zhu, X. (2008). Amyloid beta overproduction causes abnormal mitochondrial dynamics via differential modulation of mitochondrial fission/fusion proteins. Proc Natl Acad Sci U S A 105 19318 23. W asiak, S., Zunino, R. and McBride, H. M. (2007). Bax/Bak promote sumoylation of DRP1 and its stable association with mitochondria during apoptotic cell death. J Cell Biol 177 439 50.

PAGE 114

114 Wasilewski, M. and Scorrano, L. (2009). The changing shape of mitochondr ial apoptosis. Trends Endocrinol Metab 20 287 94. Westermann, B. (2002). Merging mitochondria matters: cellular role and molecular machinery of mitochondrial fusion. EMBO Rep 3 527 31. Westermann, B. (2008). Molecular machinery of mitochondrial fusion an d fission. J Biol Chem 283 13501 5. Westermann, B. and Neupert, W. (2000). Mitochondria targeted green fluorescent proteins: convenient tools for the study of organelle biogenesis in Saccharomyces cerevisiae. Yeast 16 1421 7. Winzeler, E. A., Shoemaker, D. D., Astromoff, A., Liang, H., Anderson, K., Andre, B., Bangham, R., Benito, R., Boeke, J. D., Bussey, H. et al. (1999). Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285 901 6. Wohlgemuth, S. E. Seo, A. Y., Marzetti, E., Lees, H. A. and Leeuwenburgh, C. (2010). Skeletal muscle autophagy and apoptosis during aging: Effects of calorie restriction and life long exercise. Exp Gerontol 45 138 148. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Ad elmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R. C. et al. (1999). Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC 1. Cell 98 115 24. Yamaguchi, R. and Perkins, G. (2009). Dynam ics of mitochondrial structure during apoptosis and the enigma of Opa1. Biochim Biophys Acta 1787 963 72. Yoon, Y., Krueger, E. W., Oswald, B. J. and McNiven, M. A. (2003). The mitochondrial protein hFis1 regulates mitochondrial fission in mammalian cells through an interaction with the dynamin like protein DLP1. Mol Cell Biol 23 5409 20. Yoon, Y. S., Yoon, D. S., Lim, I. K., Yoon, S. H., Chung, H. Y., Rojo, M., Malka, F., Jou, M. J., Martinou, J. C. and Yoon, G. (2006). Formation of elongated giant mitoc hondria in DFO induced cellular senescence: involvement of enhanced fusion process through modulation of Fis1. J Cell Physiol 209 468 80. Yorimitsu, T. and Klionsky, D. J. (2005). Autophagy: molecular machinery for self eating. Cell Death Differ 12 Suppl 2 1542 52. Zhang, Y. and Chan, D. C. (2007). New insights into mitochondrial fusion. FEBS Lett 581 2168 73.

PAGE 115

115 Zhuang, J., Dinsdale, D. and Cohen, G. M. (1998). Apoptosis, in human monocytic THP.1 cells, results in the release of cytochrome c from mitochon dria prior to their ultracondensation, formation of outer membrane discontinuities and reduction in inner membrane potential. Cell Death Differ 5 953 62. Zid, B. M., Rogers, A. N., Katewa, S. D., Vargas, M. A., Kolipinski, M. C., Lu, T. A., Benzer, S. and Kapahi, P. (2009). 4E BP extends lifespan upon dietary restriction by enhancing mitochondrial activity in Drosophila. Cell 139 149 60. Zorzano, A. (2009). Regulation of mitofusin 2 expression in skeletal muscle. Appl Physiol Nutr Metab 34 433 9.

PAGE 116

116 BIOGRAPHICAL SKETCH Arnold Y. Seo was born in Austin, T exas in 1977. He is the only born child to Arran Kim and Youn g Tae Seo Arnold moved back to Jinhae, Korea in 1978 with his parents and graduated from Docheon elementary school in 1989, Jinhae junior high school in 1993, and Masan high s chool in 1996. After that he attended SungKyunKwan Univer s ity from 1996 2003, w here he majored genetic engineering and studied biological sciences He earned a Bachelor of Science in 2003 During his college years, he fulfilled his mandated military service in R epublic of Korea Navy for 28 months. After graduation, Arnold moved to the United States to join the interdisciplinary program in biomedical sciences at the University of Florida, College of Med icine in Gainesville, Florida. He did his graduate work in Dr. Christiaan Leeuwenburgh 's laboratory of the Department of Aging and G eriatrics and completed h is Ph.D. dissertation in May 20 10 Arnold has accepted a postdoctoral position with Dr. Jennifer Lippincott Schwartz at the National Institute s of Health where he will investigate the regulation of mitochondrial dynamics in mamma lian cell s