<%BANNER%>

Molecular Interplay Among the Redox-Responsive Regulator AaAp1, the Two-Component Histidine Kinase and the Mitogen-Activ...

Permanent Link: http://ufdc.ufl.edu/UFE0041460/00001

Material Information

Title: Molecular Interplay Among the Redox-Responsive Regulator AaAp1, the Two-Component Histidine Kinase and the Mitogen-Activated Protein (MAP) Kinases in Alternaria Alternata of Citrus
Physical Description: 1 online resource (170 p.)
Language: english
Creator: Lin, Ching-Hsuan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: alternaria, citrus, histidine, host, mapk, ros, signal
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Alternaria brown spot is caused by the tangerine pathotype of Alternaria alternata. The disease affects tangerine, grapefruit and their hybrids, resulting in severe agronomic and economic losses in Florida. This research determined the important roles of signaling pathways that are mediated by three MAP kinases (AaHOG1, AaSLT2 and AaFUS3), a redox-responsive transcription regulator (AaAP1), and a two-component histidine kinase (AaHSK1) in the life cycle of A. alternata. The results revealed that AaAP1 is necessary for cellular response and adaption to oxidative stresses. Disruption of the AaAP1 gene in A. alternata abolished antioxidant activities and increased sensitivity to H2O2. The AaAP1 null mutant failed to induce any visible necrotic lesions on citrus leaves, primarily due to its inability to detoxify ROS produced by the host plant. Molecular characterization of a conserved AaFUS3 gene, encoding a FUS3-type MAP kinase, from A. alternata revealed that AaFUS3 is required for vegetative growth, conidiation, pathogenicity, and production of several hydrolytic enzymes. Two genes encoding putative Major Facilitator Superfamily (MFS) transporters were identified from a suppression subtractive hybridization library. Expression of these two genes was coordinately regulated by AaAP1 and AaFUS3, suggesting a synergistic regulation between AaFUS3 MAP kinase and redox-responsive regulator AaAP1. Furthermore, the AaHSK1 gene encoding a group III ?two-component? histidine kinase, the AaHOG1 gene encoding a HOG1-type MAP kinase, and the AaSLT2 gene encoding a SLT2 MAP kinase, were also cloned and characterized in A. alternata. AaHSK1 is a primary regulator for cellular resistance to sugar osmotic stress and for sensitivity to dicaboximide or phenylpyrrole fungicides. AaHOG1, which conferred cellular resistance to salts and oxidative stress, bypasses AaHSK1 even though deletion of AaHSK1 affected AaHOG1 phosphorylation. These functions are likely modulated by unknown mechanisms rather than directly by the AaHOG1?mediated pathway. AaSLT2 is necessary for conidiation, maintenance of cell-wall integrity, and fungal virulence but is dispensable for toxin production. As with AaAP1 and AaFUS3, AaHOG1 and AaSLT2 are necessary for fungal pathogenicity; yet AaHSK1 is completely dispensable for pathogenicity. Fungal mutants impaired in AaHSK1, AaHOG1, AaAP1, AaSLT2 or AaFUS3 were all hypersensitive to 2-chloro-5-hydroxypyridine (CHP) or 2,3,5-triiodobenzoic acid (TIBA). Overall, this study highlights the dramatic flexibility and uniqueness in the signaling pathways that are involved in pathogenicity and respose to diverse environmental stimuli in Alternaria alternata.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ching-Hsuan Lin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Chung, Kuang-Ren.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041460:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041460/00001

Material Information

Title: Molecular Interplay Among the Redox-Responsive Regulator AaAp1, the Two-Component Histidine Kinase and the Mitogen-Activated Protein (MAP) Kinases in Alternaria Alternata of Citrus
Physical Description: 1 online resource (170 p.)
Language: english
Creator: Lin, Ching-Hsuan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: alternaria, citrus, histidine, host, mapk, ros, signal
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Alternaria brown spot is caused by the tangerine pathotype of Alternaria alternata. The disease affects tangerine, grapefruit and their hybrids, resulting in severe agronomic and economic losses in Florida. This research determined the important roles of signaling pathways that are mediated by three MAP kinases (AaHOG1, AaSLT2 and AaFUS3), a redox-responsive transcription regulator (AaAP1), and a two-component histidine kinase (AaHSK1) in the life cycle of A. alternata. The results revealed that AaAP1 is necessary for cellular response and adaption to oxidative stresses. Disruption of the AaAP1 gene in A. alternata abolished antioxidant activities and increased sensitivity to H2O2. The AaAP1 null mutant failed to induce any visible necrotic lesions on citrus leaves, primarily due to its inability to detoxify ROS produced by the host plant. Molecular characterization of a conserved AaFUS3 gene, encoding a FUS3-type MAP kinase, from A. alternata revealed that AaFUS3 is required for vegetative growth, conidiation, pathogenicity, and production of several hydrolytic enzymes. Two genes encoding putative Major Facilitator Superfamily (MFS) transporters were identified from a suppression subtractive hybridization library. Expression of these two genes was coordinately regulated by AaAP1 and AaFUS3, suggesting a synergistic regulation between AaFUS3 MAP kinase and redox-responsive regulator AaAP1. Furthermore, the AaHSK1 gene encoding a group III ?two-component? histidine kinase, the AaHOG1 gene encoding a HOG1-type MAP kinase, and the AaSLT2 gene encoding a SLT2 MAP kinase, were also cloned and characterized in A. alternata. AaHSK1 is a primary regulator for cellular resistance to sugar osmotic stress and for sensitivity to dicaboximide or phenylpyrrole fungicides. AaHOG1, which conferred cellular resistance to salts and oxidative stress, bypasses AaHSK1 even though deletion of AaHSK1 affected AaHOG1 phosphorylation. These functions are likely modulated by unknown mechanisms rather than directly by the AaHOG1?mediated pathway. AaSLT2 is necessary for conidiation, maintenance of cell-wall integrity, and fungal virulence but is dispensable for toxin production. As with AaAP1 and AaFUS3, AaHOG1 and AaSLT2 are necessary for fungal pathogenicity; yet AaHSK1 is completely dispensable for pathogenicity. Fungal mutants impaired in AaHSK1, AaHOG1, AaAP1, AaSLT2 or AaFUS3 were all hypersensitive to 2-chloro-5-hydroxypyridine (CHP) or 2,3,5-triiodobenzoic acid (TIBA). Overall, this study highlights the dramatic flexibility and uniqueness in the signaling pathways that are involved in pathogenicity and respose to diverse environmental stimuli in Alternaria alternata.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ching-Hsuan Lin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Chung, Kuang-Ren.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041460:00001


This item has the following downloads:


Full Text

PAGE 1

1 MOLECULAR INTERPLAY AMONG THE REDO X-RESPONSIVE RE GULATOR AaAP1, THE TWO-COMPONENT HISTIDINE KINA SE AND THE MITO GEN-ACTIVATED PROTEIN (MAP) KINASES IN Alternaria alternata OF CITRUS By CHING-HSUAN LIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Ching-Hsuan Lin

PAGE 3

3 To my wife, Ms. Hui-Yu Hsieh, and my sist ers Ms. Mei-Ling Lin and Mei-Jyun Lin for their thorough suppor t and encouragement

PAGE 4

4 ACKNOWLEDGMENTS This research project would not have been possible without the support of many people. I would like to expr ess my gratitude to my super visor, Dr. Kuang-Ren Chung, whose expertise, understanding, and patienc e, added considerably to my graduate experience. I appreciate his invaluable vast knowledge and skills in many areas and his assistance in my writing. I would like to thank the other members of my committee, Dr. Fredy Altpeter, Dr. Jeffrey A. Rollins, and Dr. Jeffrey B. Jones for their helpful assistance and critical evaluati on of this dissertation. Spec ial thanks also to all my graduate friends: Andrew Funk, Franklin Behlau, Qiang Chen, Xiaoen Huang, and Chang-Hua Huang, Sarsha, and Carol. They each helped make my time in the PhD program more fun and interesting. I also w ant to thank our Lab me mbers, Siwy Ling Yang, Nan-Yi, Wang and Mr. Lenny Venderpool for their assist ance to some aspects of my research project. Most im portantly, I thank my family for the support they provided me through my entire life and in particular, I must acknowledge my wife without her endless love and encouragement I would not have finished this thesis.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 ABSTRACT ................................................................................................................... 13 CH APTER 1 INTRODUCTION AND LI T ERATURE REVIEW ..................................................... 15 Introduction of Alternaria alternata (Fr.) Ke issler .................................................... 15 Taxonomy ......................................................................................................... 15 Host-Selective Toxins Produced by A. alternata to Citru s ................................ 15 Disease Symptoms of Al ternaria Br own Spot ................................................... 16 Life Cycle .......................................................................................................... 17 Economic Significance and Dise ase Control .................................................... 17 Oxidative Burst and Strategy of Antioxidant Defense in Fungi ................................ 18 Roles of Reactive Oxygen Species in Plants .................................................... 18 Detoxification of ROS and Fungal Pathogenesis .............................................. 19 Transcriptional Regulation in Re sponse to Oxi dative Stress ............................ 20 Signal Transduction Cascades That Regulate Fungal Development and Virulenc e .............................................................................................................. 21 MAP Kinase Ca scade ...................................................................................... 21 Two-Component Histidine Ki nases .................................................................. 23 Mitogen-Activated Protein Kinase (MAPK) Ne twork ......................................... 24 Research Overview................................................................................................. 26 2 THE Alternaria alternata AaAP1 TRANSCRIPTION FACTOR INVOLVED IN DETOXIFICATION OF REACTIVE OXYGEN SPECIES IS A KEY PATHOGENICITY FACT OR ON CI TRUS .............................................................. 31 Introduc tion ............................................................................................................. 32 Materials and Methods ............................................................................................ 34 Fungal Strains and Cu lture Condi tions ............................................................. 34 Lipid Peroxidat ion Assay s ................................................................................ 35 Detection of H2O2 in Citrus Leaves ................................................................... 35 Cloning of AaAP1 ............................................................................................. 36 Creation and Identif ication of the AaAP1 Nu ll Mutants ..................................... 36 Genetic Complementation of an AaAP1 Disrupted Mutant .............................. 37 AaAP1 Loca lization .......................................................................................... 38 Sensitivity Test of AaAP1 Null Mu tants ............................................................ 38 Pathogenicity Assay s ....................................................................................... 38 Purification of ACT Ho st-Sele ctive Toxin .......................................................... 39

PAGE 6

6 Microscopy ....................................................................................................... 40 Enzymatic Assays ............................................................................................ 40 Molecular Te chniques ...................................................................................... 43 Results .................................................................................................................... 44 Stress Responses of Citr us Leaves Inoculated with A. alternata ..................... 44 Characterization of an AP1 Homol og in A. alternata ........................................ 44 Targeted Disruption of AaAP1 .......................................................................... 45 AaAP1 Is Required for Re sistan ce to Oxidative St ress .................................... 46 AaAP1 Null Mutants Have Defective H2O2 Metabolism .................................... 46 Expression of AaAP1 Is Induced by Oxidative Stress ...................................... 47 Nuclear Localization of Aa AP1::sGFP upon Expos ure to H2O2 ........................ 47 Regulation of ROS-Related Enzy matic Activities by AaAP1 ............................. 47 Identification of the Genes Who se Expression is Regulated by AaAP1 ........... 48 AaAP1 Is Required for the Virulenc e in A. alternata ......................................... 48 The AaAP1 Null Mutan t Is Impaired in Penetration and Colonization Stages... 49 Disruption of the AaAP1 Gene Did Not Affec t Ho st-Selective Toxin Producti on ..................................................................................................... 49 NADPH Oxidase Inhibitors Partia lly Res tore Pathogenicity of the AaAP1 Null Mut ant .................................................................................................... 50 Discussion .............................................................................................................. 50 3 THE FUS3-TYPE MITOGEN-ACTIVAT ED PR OTEIN KINASE AND THE REDOX-RESPONSIVE AP1 REGULATOR FUNCTION COOPERATIVELY IN Alternaria alternata ................................................................................................. 70 Introduc tion ............................................................................................................. 70 Materials and Methods ............................................................................................ 72 Fungal Strains and Growth Condi tions ............................................................. 72 Cloning of AaFUS3 ........................................................................................... 73 Identification of AaF US3 Null Mu tants .............................................................. 73 Genetic Complementation of AaF US3 -Null Mu tant .......................................... 73 Create Double Mutations at AaF US3 and AaAP1 Genes in A. alternata .......... 74 Miscellaneous Assays for En zymatic Activities ................................................ 74 Pathogenicity Test ............................................................................................ 77 Detection of Phosphor y lated AaFU S3 M APK ................................................... 77 Results .................................................................................................................... 78 Cloning and Characterization of A Fu s3 MAP kinase Gene Homolog in A. alternata of Citrus .......................................................................................... 78 Targeted Disruption of AaFU S3 of A. alternata ................................................ 79 AaFUS3 Is Required for Vegetative Gr owth, Resistance to Copper Fungicide but Negatively Modul ates Salt Tolerance ..................................... 79 AaFUS3 Is Essential fo r Conidi ation ................................................................ 80 The AaFUS3 Is Required for Fungal Viru lence ................................................ 80 Expression of the AaF US3 Gene Is Highly Induced by Leaf Extracts .............. 81 AaFUS3 Regulates th e Production of Hy drolytic Enzymes and Melanin .......... 81 AaFUS3 and AaAP1 Share Common Phenotypes and Confer Pleiotropic Drug Resistance ............................................................................................ 82

PAGE 7

7 Double Mutation at Aa FUS3 and AaAP1 Genes in A. alternata Caused Greater Sensitivity to TIBA or CHP ............................................................... 82 Expression of the AaF US3 and AaAP1 Genes in Response to Chemical Stress in A. alternata ..................................................................................... 83 Activation of AaFUS3 MAP Kinase Phosph ory lation ........................................ 83 A Synergistic Regulation of Express ion of Two MFS Transporters by AaFUS3 and AaAP1 ..................................................................................... 84 Discussion .............................................................................................................. 84 4 DISTINCT AND SHARED ROLES OF THE TWO-COMPONENT HISTIDINE KI NASE (AaHSK1)AND THE MITOGE N-ACTIVATED KINA SE (AaHOG1)MEDIATED SIGNALING PATHWAYS IN RESPONSE TO OSMOTIC STRESS AND FUNGICIDES IN Alternaria alternata ........................................................... 100 Introduc tion ........................................................................................................... 100 Materials and Methods .......................................................................................... 104 Cloning of AaH SK1 and AaHOG1 .................................................................. 104 Construction and Ident ific ation of the AaHSK1 and AaHOG1 -Null Mutants .. 104 Genetic Complementation of an AaHSK1 -Nul l Mu tant ................................... 105 Molecular Te chniques .................................................................................... 105 Detection of Phos pho-AaHOG1 MAPK .......................................................... 106 Nucleotide Sequence ..................................................................................... 106 Results .................................................................................................................. 106 Cloning of the AaH SK1 and AaHOG1 Genes of A. alternata ......................... 106 Targeted Disruption of AaH SK1 and AaHOG1 in A. alternata ........................ 107 Phenotypic Characte ri zation of the AaHSK1 and AaHOG1 Null Mutants ....... 108 AaHOG1 but not AaH SK1 Is Required for F ungal Pathogeni city ................... 109 AaHOG1 Phosphorylation Is Reg ulated by AaHSK1 ...................................... 109 Discussion ............................................................................................................ 109 5 SPECIALIZED AND SHAR ED F UNCTIONS OF THE MITOGEN-ACTIVATED PROTEIN KINASES, THE TWO-COMPON ENT HISTIDINE KINASE, AND THE REDOX-RESPONSIVE REGULATOR OF Alternaria alternata IN STRESS RESPONSES AND VIRULENCE ......................................................................... 120 Introduc tion ........................................................................................................... 121 Materials and Methods .......................................................................................... 123 Fungal Strains ................................................................................................ 123 Cloning of AaSLT2 ......................................................................................... 123 Creation and Identification of Aa SLT2 mutants .............................................. 123 Genetic Complementation of Aa SLT2 -Null Mutant ......................................... 124 Pathogenicity Test .......................................................................................... 124 Statistical Analysis .......................................................................................... 124 Sensitivity of Cell-WallDegrading Enz ymes (CWDEs ) and Generation of Fungal Prot oplasts ...................................................................................... 124 RNA Quantitative analyses ............................................................................. 125 Western-Blot Analysis .................................................................................... 125

PAGE 8

8 Molecular Te chniques .................................................................................... 125 Results .................................................................................................................. 126 Cloning of the AaSLT2 Gene in A. alternata ................................................... 126 Targeted Disruption of AaSLT2 ...................................................................... 126 AaSLT2 Is Required fo r Virul ence .................................................................. 126 Production of Conidia and Protoplasts by A. alternata ................................... 127 Phenotypic Assays in A. alternata .................................................................. 127 AaAP1, AaFUS3, AaSLT2 AaHOG1 and AaHSK1 Cooperatively Regulate the Express ion of a MFS Transporter Coding Gene ................................... 128 Transcriptional Feed back Regul ation ............................................................. 128 Cross-Talk between Signaling Path way s ....................................................... 128 Discussion ............................................................................................................ 129 APPEN DIX A SUPPLEMENTAL DATA FO R CHAPTER 2 TO 5 ................................................ 143 B SUPPLEMENTAL DATA FOR CHAPTER 3 ......................................................... 146 C SUPPLEMENTAL DATA FOR CHAPTER 5 ......................................................... 147 LIST OF RE FERENCES ............................................................................................. 150 BIOGRAPHICAL SKET CH .......................................................................................... 170

PAGE 9

9 LIST OF TABLES Table page 2-1 Expression sequence tags (EST) that are poss ibly regulat ed by AaAP1 were recovered from the wild ty pe cDNA library after subt racted with that of the AaAP1 null mutant .............................................................................................. 56 5-1 Phenotypic characteri z ation of wild type (WT) and mutant strains of Alternaria alternata grown on potato dextrose agar amended with oxidants, sugars, salts, fungici des, or c hemicals ............................................................. 134 A-1 Sequence of primers. ....................................................................................... 143 C-1 Statistical analysis of disease in c idence caused by the wild type and AaSLT2 on citrus leaves ................................................................................ 147

PAGE 10

10 LIST OF FIGURES Figure page 1-1 Symptoms of Alte rnari a brown spot .................................................................... 28 1-2 Disease cycle of Alter naria brown s pot, caused by the tangerine pathotype of Alternaria alternata ............................................................................................. 29 1-3 The S. ce revisiae mating (FUS3), filamentation (KSS1), cell integrity (SLT2) and high osmolarity glycerol (HOG1) MAPK pathways ....................................... 30 2-1 Detection of lipid peroxidation and H2O2 in Minneola leaves inoculated with A. alternata .............................................................................................................. 58 2-2 Functional domains of AaAP1 in the tangerin e pathotype of A. alternata ........... 59 2-3 Targeted disruption of AaAP1 in A. alternata ..................................................... 60 2-4 The AaAP1 gene plays a crucial role in resistance to oxidant s.. ........................ 61 2-5 The A. alternata Aa AP1 is required for H2O2 detoxification and expression of AaAP1 in response to ox idative stress ............................................................... 62 2-6 Oxidative stress-r egulated nuclear localizat i on of AaAP1::sGFP ....................... 63 2-7 AaAP1 regulates the production of antioxidant activities in A. alternata ............. 64 2-8 Identification of the ge nes that are r egulated by AaAP1 ..................................... 65 2-9 The A. alternata Aa AP1 is required for pathogenicity on citrus cv. Minneola ..... 66 2-10 Light microscopy of Minneola leav es inoculated with the wild type, AaAP1 mutants and the comple mentation strains of A. alternata ................................... 67 2-11 The A. alternata Aa AP1 gene is not required for the production of hostspecific ACT toxin ............................................................................................... 68 2-12 NADPH oxidase inhibitors parti ally res tored pathogenicity of the AaAP1 -null mutant ................................................................................................................ 69 3-1 The Alternaria alternata AaFUS3 c onserved domains and targeted disruption of the AaFUS3 gene ........................................................................................... 88 3-2 The AaFU S3 gene whose product is necessary for vegetative growth and involved in response to sa lt and fungicide resistance ......................................... 89 3-3 The AaFU S3 -disrupted mutants are defective in c onidiation .............................. 90

PAGE 11

11 3-4 The AaFU S3 gene is required for f ungal penetration and lesion development ... 91 3-5 The Alternaria alternata AaFUS3 is required for full viru lence ............................ 92 3-6 Expression of AaFUS3 wa s up-regulated by leaf extracts .................................. 93 3-7 AaFUS3 is involv ed in the production of hydrolytic enzymes, cutinase activities and mel anin ......................................................................................... 94 3-8 Sensitivity tests of the wild type, AaFUS3(M1 and M2) and AaAP1 (Y1 and Y2) null mutants, and their c omplementation strains (YCp1, 2 and MCp1, 2) to different chemicals .......................................................................................... 95 3-9 Schematic illustrat ion of a s trategy used for creation of an AaFUS3/AaAP1 double mutation and phenot ypic assays ............................................................. 96 3-10 Induction of the AaAP1 or AaF US3 gene transcript in A. alternata ..................... 97 3-11 Immunological detection of AaFUS3 phosph ory lation ........................................ 98 3-12 A synergistic regulation of two MFS membrane trans porters coding genes by AaFUS3 and AaAP1 ........................................................................................... 99 4-1 Functional domains of AaHSK1 a nd AaHOG1 ................................................. 113 4-2 Gene replacement of AaH SK1 in A. alternata .................................................. 114 4-3 Targeted disr uption of the AaH OG1 gene in A. alternata ................................. 115 4-4 Phenotypic characterization of the wild type (WT), two AaH SK1 -disrupted strains (Hk1 and Hk2), two AaHSK1 complementation st rains (Cp1 and Cp2), and two AaHOG1 null mutants (Hg1 and H g2) ................................................. 116 4-5 Sensitivity of t he wild type (WT), two AaHSK1 mutants (Hk1 and Hk2), and two AaHOG1 deletion strains (Hg1 and Hg2) to different fungicides ................ 117 4-6 The A. alternata Aa HOG1, but not AaHSK1, is required for pathogenicity ....... 118 4-7 Immunological detection of Aa HOG1 phosphorylation ..................................... 119 5-1 Conserved domains of AaSLT2 and targeted dis ruption of the AaSLT2 gene 135 5-2 AaSLT2 is required for full virulenc e of Alternaria alternata as assayed on citrus cv. Minneola uniformly spra yed with conidial suspension ....................... 136 5-3 Quantitative analysis of c onidia produced by the w ild type (WT) and mutant strains of Alternaria alternata grown on PDA .................................................... 137 5-4 Protoplasts released from the Alternaria alternata strains ................................ 138

PAGE 12

12 5-5 Expression of two MF S coding genes in A. alternata ....................................... 139 5-6 Transcriptional regulation in Alternaria alternata .............................................. 140 5-7 Phosphorylation of AaFUS3 or AaHOG1 protein in Alternaria alternata ........... 141 5-8 Summary of signal transduction m odulated by the redox-res ponsive transcription regulator (AaAP1), the mi togen-activated prot ein (MAP) kinases (AaFUS3, AaSLT2, and AaHOG1), and the two-component histidine kinase (AaHSK1)-mediated pathways, in a s pecific and synergistic manner in Alternaria alternata ........................................................................................... 142 B-1 The AaF US3 null mutants of Alternaria alternata are resistant to high osmolarity of KCl and NaCl .............................................................................. 146 C-1 Sensitivity tests of the wild type (WT), the AaAP1, the AaH SK1, the AaFUS3-, the AaSLT2, and the AaHOG1 -disrupted mutant strains ................ 148 C-2 Schematic illustrati on of transc riptional regulations between the AaAP1 the AaHSK1 the AaFUS3 the AaSLT2, and the AaHOG 1 genes in Alternaria alternata ........................................................................................................... 149

PAGE 13

13 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR INTERPLAY AMONG THE REDO X-RESPONSIVE RE GULATOR AaAP1, THE TWO-COMPONENT HISTIDINE KINA SE AND THE MITO GEN-ACTIVATED PROTEIN (MAP) KINASES IN Alternaria alternata OF CITRUS By Ching-Hsuan Lin May 2010 Chair: Kuang-Ren Chung Major: Plant Pathology Alternaria brown spot is caus ed by the tanger ine pathotype of Alternaria alternata The disease affects tangerine, grapefruit and their hybrids, re sulting in severe agronomic and economic losses in Florida. This resear ch determined the important roles of signaling pathways t hat are mediated by three MA P kinases (AaHOG1, AaSLT2 and AaFUS3), a redox-res ponsive transcription regulator (AaAP1), and a twocomponent histidine kinase (AaHSK1) in the life cycle of A. alternata The results revealed that AaAP1 is necess ary for cellular response and adaption to oxidative stresses. Disruption of the AaAP1 gene in A. alternata abolished antioxidant activities and increased sensitivity to H2O2. The AaAP1 null mutant failed to induce any visible necrotic lesions on citrus leaves, prim arily due to its inabili ty to detoxify ROS produced by the host plant. Molecular characterization of a conserved AaFUS3 gene, encoding a FUS3-type MAP kinase, from A. alternata revealed that AaFUS3 is required for vegetative growth, conidiation, pathogenicity, and production of several hydrolytic enzymes. Two genes encoding putative Major Facilitator Superfamily (MFS) transporters were identified from

PAGE 14

14 a suppression subtractive hybridization lib rary. Expression of these two genes was coordinately regulated by AaAP1 and AaFU S3, suggesting a synergistic regulation between AaFUS3 MAP kinase and r edox-responsive regulator AaAP1. Furthermore, the AaHSK1 gene encoding a group III two-component histidine kinase, the AaHOG1 gene encoding a HOG1-type MAP kinase, and the AaSLT2 gene encoding a SLT2 MAP kinase, were also cloned and characterized in A. alternata. AaHSK1 is a primary regulator for cellular re sistance to sugar os motic stress and for sensitivity to dicaboximide or phenylpyrro le fungicides. AaHOG1, which conferred cellular resistance to salts and oxidativ e stress, bypasses AaHSK1 even though deletion of AaHSK1 affected AaHOG1 phosphorylation. These functions are likely modulated by unknown mechanisms rather than directly by the AaHOG1mediated pathway. AaSLT2 is necessary for c onidiation, maintenance of ce ll-wall integrity, and fungal virulence but is dispensable fo r toxin production. As with AaAP1 and AaFUS3 AaHOG1 and AaSLT2 are necessary for fungal pathogenicity; yet AaHSK1 is completely dispensable for pathogenicity. Fungal mutants impaired in AaHSK1 AaHOG1, AaAP1, AaSLT2 or AaFUS3 were all hypersensitive to 2-ch loro-5-hydroxypyridine (CHP) or 2,3,5-triiodobenzoic acid (TIBA). Overall, this study highlights the dramatic fl exibility and uniqueness in the signaling pathw ays that are involved in pathogenicity and respose to diverse environmental stimuli in Alternaria alternata

PAGE 15

15 CHAPTER 1 INTRODUCTION AND LI TE RATURE REVIEW Introduction of Alternaria alternata (Fr.) Keissler Taxonomy Alternaria brown s pot is ca used by the necrotrophic fungus, Alternaria alternata (Fr.) Keissler that belongs to the kingdom Fungi, phylum As comycota, class Dothideomycetes, subclass Pleosporomyc etidae, order Pleos porales, and family mitosporic Pleosporaceae. Alternaria br own spot was first reported on Emperor mandarin ( Citrus reticulate Blanco) in Australia in 1903 (Cobb 1903). The causal agent was identified as a species of Alternaria in 1959 (Kiely 1964) and grouped as Alternaria citri Ellis & Perce (Pegg 1966) Later, the pathogen which a ffects tangerines and rough lemon was re-classified as A. alternata (Kohmoto et al. 1979). Alternaria species usually form dark-col ored mycelia and produce short conidiophores bearing single or branched chains of conidia. Conidi a are dark-pigmented, long, or pear shaped and multi-ce llular with both transverse and longitudinal cross walls with the size 25-40 10-15 m (Timmer 1999). Host-Selective Toxins Produced by A. alternata to Citrus Many pathotypes of A. alternata produce phytotoxins and in total more than 70 phytotoxins are know n to be produced by A. alternata (Nishimura and Kohmoto 1983; Walton 1996). On citrus, th ree diseases caused by Alternaria species have been identified (Akimitsu et al. 2003). Al ternaria black spot, caused by A. citri Ellis & Pierce is a post-harvest problem affecting all commercia l citrus worldwide (Akimitsu et al. 2003). Alternaria brown spot is caus ed by the tangerine pathotype of A. alternata (Fr.) Keissler, whereas Alternaria leaf spot is caused by the rough lemon pathotype of A. alternata

PAGE 16

16 These two pathotypes are indistinguis hable using phylogenetic and morphological analyses. Yet, each pathotype produces a host-s elective toxin with a distinct mode of action (Peever et al. 2003). The tangerine pathotype produces the host-selective ACT toxin containing a core structure of 9,10-epoxy-8-hydroxy-9-methyl-decatrienoic acid. ACT toxin causes rapid electrolyte leakage from susceptible citrus hosts, such as tangerine ( Citrus reticulata), grapefruit ( C. paradise Macfad.), their hybrids, and hybrids from tangerines and sweet oranges ( C. sinensis (L.) Osbeck) (Kohmoto et al. 1993). In contrast, the rough lemon pathotype, producing the host-sel ective ACRL toxin, primarily attacks rough lemon ( Citrus jambhiri Lush) and Rangpur lime ( Citrus limonia Osbeck). ACRL toxin affects mitochondrial func tions by causing metabolite leakage and malfunction of oxidative phosphor ylation (Gardner et al. 1986) ACRL toxin is not toxic to tangerines, grapefruit, and their hybrids. Host-selective toxins produced by A. alternata have long been known to be essential fo r fungal pathogenesis (Gardner et al. 1986; Kohmoto et al. 1993) and important determinants of host ranges (Kohmoto et al.1991; Otani et al. 1995). The genes involved in the biosynthesis of host-selective toxins in Alternaria species are often clustered on a conditionally dispensable chromosome (Hatta et al. 2002). Disease Symptoms of Alternaria Brown Spot The tangerine pathotype of A. alternata infec ts young fruit, leaves and twigs inducing brown spots within 24 hours of infect ion (Timmer et al. 2000). Lesions usually display brown spots surrounded by a yellow halo which is ca used by the host-selective ACT-toxin (Kohmoto et al. 1993). Necrotic lesions can extend along the veins even beyond the area of tissue coloniza tion as the toxin is translocated through the vascular

PAGE 17

17 system (Fig. 1-1). On fruit, le sions can vary from small spot s to large crater-like lesions (Akimitsu et al. 2003). Life Cycle Alternaria alternata has no known sexual stage and has a relatively simple life cycle in citrus (Fig. 1-2) (Ti mmer 1999). Conidia (fungal spor es) with dark-pigmented cell walls can tolerate unfavorable environmental conditions. Conidia are produced from infected leaves and can survive for a long peri od of time in the field. Conidia can be dispersed by wind or rain splash. Under humid conditions, conidi a quickly germinate to form penetration hyphae on susceptible hosts (Akimitsu et al. 2003). The minimum period for symptom appearance is around 48 hours under favorable conditions (Canihos et al. 1999). The optim um temperature for infecti on is 27C (Canihos et al. 1999). Penetration can occur through stomata without the formation of appressoria or direct penetrate the host cuticle with the fo rmation of appressoria (Solel and Kimchi 1998). Economic Significance and Disease Control Alternaria brown s pot has been widespread in Flor ida since first appeared in 1974 (Whiteside 1976). The disease was later doc umented in Israel (Solel 1991), South Africa (Schutte et al. 1992), Turkey (Canihos et al. 1997), Spain (Vicent et al. 2000), Brazil and Argentina (Peres et al. 2003) Alternaria brown spot can be a major problem on many citrus cultivars because the disease weakens tree development and damages the fruit. Alternaria brown s pot needs to be controlled, pa rticularly if the fruit are intended for the fresh mark et. One of the effective strategi es to control Alternaria brown spot is frequent application of fungicides. Many fungicides, such as phthalimides (captan, folpet), dithiocarbamates (m aneb, metiram), dicarboximide fungicides

PAGE 18

18 (iprodione, procymido ne), prochloraz manganese, flutri afol, and copper fungicides are effective against A. alternata (Solel et al. 1996). However, frequent application of fungicides also raises concerns of pat hogen resistance and off-target environmental effects. Oxidative Burst and Strategy of Antioxidant Defense in Fungi Roles of Reactive Oxygen Species in Plants Plants c ope with many th reats from the environment through efficient defense systems that protect them from biotic and abiotic stresses (Benhamou 1996). Upon exposure to pathogen attack, plants may induce various defense mec hanisms to restrict or kill pathogens. Those defense reactions ma y include modification of preexisting cell wall structures, production of phytoalex ins, phenolic compounds and antimicrobial proteins, induction of hypersensitive res ponse and programmed cell death (Kombrink 1995). One of earliest defense re sponses to pathogen attacks in plants is the oxidative burst, described as a rapid transient producti on of large amounts of reactive oxygen species (ROS) around the infection site (Greenberg 1997). RO S include superoxide radicals (.O2 -), hydrogen peroxide (H2O2) and hydroxyl radicals (.OH). ROS can be generated at low levels in chloroplasts and mitochondria during normal metabolic processes, but are dr amatically induced in response to pathogens (Wojtaszek 1997). In plants, the main source of ROS is pr imarily generated by a membrane-bound NADPHoxidase which converts NADPH and O2 to form O2 and further to H2O2 (Lamb and Dixon 1997). Since production of ROS is rapid and transient, the roles of ROS may vary, depending on the intimate interactions bet ween plants and the challenging factors (Doke et al. 1996; Lindner et al. 1988; Davis et al. 1993).

PAGE 19

19 ROS is virtually toxic to all macromolecul es including proteins, nucleic acids, and lipids. In addition to antimicrobial effects, H2O2 is involved in linkage of cell wall polymers. H2O2 can also serve as a signal for induction of programmed cell death, a characteristic of hypersensitive reactions (Greenberg 1997; Neill et al. 2002; Veal et al. 2007). In plants, ROS act as a secondary messengers for abscisic acid (ABA) and ethylene-mediated signaling pat hways during stress (Chen et al. 1993; Leon et al. 1995). Apart from stress responses ROS also modulates plant growth and development. In Arabidopsis H2O2-induced MAPK cascade represses aux in-inducible gene expression (Walker and Estelle 1998). Detoxification of ROS and Fungal Pathogenesis Antioxidant s can be produced via enzym atic or non-enzymatic mechanisms (Cessna et al. 2000; Mayer et al. 2001; Moye-Rowley 2003). Several antioxidant enzymes are known from the microbial wo rld. These include superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (Gpx). SOD is involved in conversion of O2 and .OH to O2 and H2O2. Hydrogen peroxide c an be further converted to oxygen and water by catalases and peroxidases (Mayer 2001). Glutathione (GSH) and thioredoxin are small prot eins that serve as non-enzym atic antioxidants (CarmelHarel and Storz 2000). Glutathione and thioredoxin convert .OH and H2O2 to O2 and water by oxidation and theref ore function directly as free radical scavengers (CarmelHarel and Storz 2000). The oxidized glutathione (GSSG) and thioredoxin can be reverted by an NADPH-dependent reaction, thus resetting the cycles. In S. cerevisiae mutation in either gpx3, trx2 (encoding thioredoxin), trr1 trr2 (encoding thioredoxin reductase) or tpx (encoding thioredoxin peroxidase) resulted in strains that are

PAGE 20

20 hypersensitive to H2O2 and t -butyl-hydroperoxide (Kuge et al. 1994; Inoue et al. 1999; Machado et al. 1997; Pedrajas et al. 1999). The roles of ROS-detoxification in relation to pathogenesis vary among phytopathogenic fungi. For ex ample, disruption of an sod gene (encoding SOD) in Claviceps purpurea (Moore et al. 2002), or disruption of a cat1 cat2 or cat3 gene in Cochliobolus heterostrophus (Robbertse et al. 2003) result ed in fungal strains that are hypersensitive to oxidizing agents but rema in pathogenic to their hosts. However, the Botrytis cinerea bcsod1 mutant defective in superoxide dismutase was reduced considerably in lesion develop ment (Rolke et al. 2004). Transcriptional Regulation in Response t o Oxidative Stress The mechanisms regulating the fungal response to oxidative challenge can be broadly classified into two types. In S. cerevisiae the mechanisms are primarily regulated by the Yap1p-mediated detoxification systems (Kuge et al. 2001). In contrast, Schizosaccharomyces pombe utilizes a Sty1 mitogen-activated protein kinase (MAPK) to regulate oxidative-stress tolerance (Toone and Jones 1999). YAP1 protein homologs have been identified in a number of fungal specie s, such as Pap1 in S. pombe, Cap1 in Candida albicans Yap1 in Ustilago maydis Chap1 in C. heterostrophus and AfYap1 in Aspergillus fumigatus (Toone and Jone 1999; Molina and Kahmann 2007; Lev et al. 2005; Lessing et al. 2007). All AP 1-like proteins contain a bas ic leucine zipper (bZIP) and two cysteine rich domains, called t he amino terminal(n-CRD) and carboxy terminal(c-CRD) domains (reviewed in Toone and Jone 1999). Kuge and colleagues (1997) first demonstrated that subcellular localization of Yap1 occurs in response to oxidative stress. This change depends on another protein transporte r called Crm1 that binds to the nuclear export sequence (NES) in Pap1 and functions as a nuclear exporter

PAGE 21

21 (Toone et al. 1998). Crm1 actively transfers Yap1 proteins from the nucleus to the cytoplasm under normal condi tions. Deletion of the crm1 gene or a point mutation within the NES region of Yap1 blocks Crm1 binding to NE S, thus Yap1 regulators are dominantly localized in the nucleus (Toone et al. 1998). The Sty1-mediated signaling pathway of S. pombe resembles the HOG1 (h igh o smolarity g lycerol) MAP kinase pathway in S. cerevisiae and the mammalian JNK and p38 protein kinase cascades (Toone and Jones 1998). In response to environmental stress, Wak1 (a MAPKKK) is firs t phosphorylated within the TX Y (threonine/X/tyrosine) motif. The phosphorylated Wak1 subsequently phosphorylates the downstream Wis1 (a MAPKK), which in turn phosphor ylates Sty1 (Samejima et al. 1997; Shieh et al. 1998). In response to oxidative stress, the phos phorylated Sty1 activates a second bZIP containing transcription activator, called Atf1, in addition to PaP1. Atf1 is phosphorylated directly by Sty1 and transferred into the nucleus upon exposure to oxidative stress (Shieh et al. 1998). Several HOG1-like MAP kinases have also been found to be required for resistance to ROS in ph ytopathogenic fungi, including those from B. cinerea C. heterostrophus and Mycosphaerella graminicola (Igbaria et al. 2008; Liu et al. 2008; Mehrabi et al. 2006). In S. pombe, the H2O2-dependent activation of the Sty1 pathway is mediated via a histidine-cont aining phosphotransferase (Mcs4) that is regulated by the two-component histidine se nsor kinases Mak2 and Ma k3 (Buck et al. 2001). Signal Transduction Cascades That Regulate Fungal Development and Virulence MAP Kinase Cascade In euk aryotic cells, MAP kinases are res ponsible for transducing a variety of extracellular signals for cell gr owth and differentiation (Gustin et al. 1998; Kultz 1998). In S. cerevisiae five MAP kinase-mediated signali ng pathways have been characterized

PAGE 22

22 and demonstrated to control di verse functions. Filamentous fungi have three analogous MAP kinases: FUS3/KSS1, SLT2, and HOG1 -type signal transduction pathways (Banuett 1998; Gustin et al. 1998; Hersko witz 1995; Xu 2000). The FUS3 and KSS1 pathways in S. cerevisiae are partially redundant in that both share a number of components through the MAPKKK -MAPKK signaling pathway (Fig. 1-3). However, FUS3 is responsible for regulating the mati ng process, whereas KSS1 is involved in filamentous growth (Madhani and Fink 1998). In the maize pathogenic fungus U. maydis the mating process is absol utely required for pathogenesis (Banuett 1995). Deletion of a ubc3 gene, a FUS3 homolog, strongly attenuated the fo rmation of dikaryotic hyphae, blocked pheromone secretion and response and reduced virulence (reviewed in Xu 2000). Fus3-like MAP kinases have also been shown to be involved in fungal development, formation of conidia and/or appressoria, penetration and pathogenicity in many phytopathogenic fungi (C ho et al. 2007; Zheng et al. 2000; Lev et al. 1999; Takano et al. 2000; Jenczmionka et al. 2003; Pietro et al. 2001; Xu and Hamer 1996; Ruiz-Roldan et al. 2001; Solomon et al. 2005; Rauyaree et al. 2005). In S. cerevisiae the SLT2 MAP kinase-mediated signaling pathway is mainly responsible for cell wall integrity and cyto skeletion reorganization (Lee et al. 1993). The M. grisea MPS1 an SLT2 homolog, is required for sporul ation, appressoria formation, cell wall integrity and penetration to its host (X u et al. 1998). Similarly, deletion of an SLT2-like gene in C. purpurea or C. heterostrophus created fungal strains defective in conidiation and pathogenicity, and increased sensitivity to lytic enzymes (Mey et al. 2002; Igbaria et al. 2008).

PAGE 23

23 The high osmolarity glycerol (HOG) pathway is not only responsible for cellular response to osmotic stress, but also is required for responses to heat shock, UV radiation, cold, and oxidative stresses in the budding yeast (Shieh et al. 1998). In filamentous fungi, HOG1 kinase homologs also play an important role in stress response. For example, a HOG1 homolog, SakA in Aspergillus nidulans or Fphog1 in Fusarium proliferatum is required for osmotic, oxi dative and heat shock stresses (Adam et al. 2008; Kawasaki et al 2002). In some phytopathog enic fungi, maintenance of intracellular osmotic balance and generation of tu rgor pressure are cr ucial for vegetative growth and pathogenicity (Howard and Valent 1996; Money and Howard 1996). In the rice blast fungal pathogen M. grisea turgor pressure in the appressorium is generated due to the accumulation of intracellular glycerol (de Jong et al. 1997). However, accumulation of glycerol or generation of tur gor pressure in appressoria is not controlled by a HOG1 ortholog ( OSM1 ) in M. grisea because the gene deletion strains were still pathogenic (Dixon et al. 1999). In contrast, the HOG1 -type MAP kinase gene homologs are required for pathogenicity in C. heterostrophus and Botrytis cinerea (Igbaria et al. 2008; Segmuller et al. 2007). Two-Component Histidine Kinases Similar to MAP k inases, a two-component histidine kinase (HK) has been shown to regulate diverse cellular processes, includi ng differentiation, metabolite production and virulence in fungi (Alex et al. 1996). In prokaryotes, two-component signaling systems contain a histidine kinase (HK) and a respons e regulator (RR); each is encoded by a separate gene (Parkinson and Kofoid 1992). In c ontrast to prokaryotic HKs, all fungal HKs harbor both the HK and RR domains within the same peptide (West and Stock 2001; Wolanin et al. 2002). In response to environmental changes, a series of

PAGE 24

24 phosphate transfers between histid ine (His) and aspartate (Asp) residues takes place in a pattern of His-Asp-His-Asp (Loomis et al 1997; Thomason and Kay 2000). First, the HK is autophosphorylated at a conserv ed His residue. The phosphate is then transferred to a conserved Asp residue located within the RR protein, then to a protein containing a His phosphotransfer (HPt) domai n, and subsequently to Asp of a second RR protein. This activated RR in turn regulates downstream si gnaling pathways, such as mitogen-activated protein (MAP) ki nase cascades, and eventually produces a change in gene expression (Wurgler-Murphy and Saito 1997; Thomason and Kay 2000; Kruppa and Calderone 2006). In yeasts and fungi, osmosensing or fungicide resistance is modulated via two-component HK systems, often in conjunction with the HOG1 signaling pathway (Ota and Varshavsky 1993; Dongo et al. 2009; Kojima et al. 2004; Yoshimi et al. 2005). Ho wever, deletion of a HKor a HOG1 gene may result in distinct phenotypes among yeasts and fungi. For example, deletion of a histidine kinase gene homolog, OS-1/NIK in Neurospora crassa or dic1 in C. heterostrophus generated fungal mutants that were hyper sensitive to salt and sugar st resses (Schumacher et al. 1997; Yoshimi et al. 2004). However, deletion of a histidine kinase homolog, HIK1 in M. grisea yielded fungi that were onl y hypersensitive to sugars, but not to salts (Motoyama et al. 2005). These discrepancies open a window of opportunity for elucidation of the evolutionary relationships in the context of osmotic adaptati on mechanisms in different fungi. Mitogen-Activated Protei n Kinase (MAPK) Netw ork Cross talk between the MAP kinaseand cAMP-mediated signaling pathways for regulation of mating, appressoria forma tion, and filamentous growth have been documented in various fungi (Banuett 1998; Xu 2000). Furthermore, different MAP

PAGE 25

25 kinase pathways may also interact antagonistically or synergistically (Gustin et al. 1998). For example, pheromone treat ment simultaneously activates both FUS3 and SLT2mediated signaling pathways in S. cerevisiae (Zarzov et al. 1996). FUS3 and KSS1 MAPK pathways share several upstream components (Schwart z and Madhani 2004). The C. heterostrophus chk1 (a FUS3 homolog) mutants appear to have both the phenotypes observed in M. grisea pmk1 (a FUS3 homolog) and mps1 (a SLT2 homolog) mutants (Lev et al. 1999; Xu et al. 1996). However, in each of the pathways, divergent components have evolved to ensure pathway s pecificity. For exam ple, trimeric G protein, Ste5 and FUS3 are exclusively us ed for the mating process but not in the filamentous (KSS1) pathway (Elion 2001). Moreover, HOG1 MA P kinase is specifically required for response to osmo tic stress (ORourke and Hers kowitz 1998) (Fig. 1-3). Furthermore, it has been widely proposed that scaffold protei ns that can bind two or more signaling components of a pathway pr omotes signaling spec ificity and prevents cross-talk between pathways. Ste5 and Pbs2 scaffold proteins in FUS3and HOG1type MAP kinase pathways (Elion 2001; Harris et al. 2001; ORourke and Herskowitz 1998), respectively, appear to regulate and mainta in the response specificity (Fig. 1-3). Finally, activation of one pathway can caus e the inactivation of the other pathway. During mating response, the activated FUS3 kinase may inhibit the downstream Tec1 transcription factor specifica lly required for filamentous dev elopment (Gavrias et al. 1996; Zeitlinger et al. 2003; S hock et al. 2009). The HOG1 MAP kinase may activate expression of Msg5 encoding a phosphatase which in turn dephosphorylates FUS3 and KSS1 MAP kinases, thereby suppressing their functions (Bardwell et al. 1996; Andersson et al. 2004).

PAGE 26

26 Research Overview The major goal for this re search was to determine t he functions of the redoxresponsive transcriptional factor AaAP1, th ree MAP kinase proteins (AaHOG1, AaSLT2 and AaFUS3), and a two-component hist idine kinase protein (AaHSK1) in Alternaria alternata. Specific objectives were to determine the regulati on of AaAP1, each of the MAP kinase and a two-component histidine kinas e; and to identify if any cross-talk occurs between them. Through genetic and mole cular analyses, I intend to investigate the fungal response to host-gener ated reactive oxygen species by characterizing the AaAP1 gene of A. alternata which encodes a polypeptide resembling many YAP1-like transcriptional activators implicated in cellular responses to stress. I provide experimental evidence to s upport the idea that RO S detoxification is critical in the pathogenicity of A. alternata (Chapter 2). Downstream genes whose expression is regulated by AaAP1 were also identified us ing suppression subtractive hybridization (Chapter 2). Target ed disruption of a FUS3 MAP kinase gene homolog resulted in fungal strains that are nonpathog enic to citrus (Chapter 3). I also demonstrate that A. alternata utilizes specialized or synergistic regul atory interactions between the AP1 and MAPK signaling pathways for diverse physiol ogical functions (Chapter 3). Functional characteriztion of a gene encoding a group III histidine kinase ( AaHSK1 ) and a yeast HOG1 analog ( AaHOG1 ) shows that the two gene products to operate, both uniquely and synergistically, in a number of physiologic al and pathological functions (Chapter 4). Disruption of AaHSK1 acquired resistance to dica rboximide and phenylpyrrole fungicides and displayed hypers ensitivity only to sugar osmo tic stress. By contrast, AaHOG1 plays minor role in fungicide sensitivity and is involved in cellular resistance to oxidants and salts, but not s ugars (Chapter 4). Further studi es revealed that fungal

PAGE 27

27 mutants impaired in AaHSK1 AaHOG1, AaAP1 AaSLT2 or AaFUS3 are all hypersensitive to 2-chloro-5-h ydroxypyridine (CHP) or 2,3, 5-triiodobenzoic acid (TIBA) (Chapter 3, 4 and 5). These phenotypes ar e completely novel and have never been described in any fungus previously. Overa ll, the results derived from my studies highlight a dramatic flexib ility and uniqueness in the signaling pathways that are involved in responding to dive rse environmental stimuli in Alternaria alternata.

PAGE 28

28 Figure 1-1. Symptoms of Al ternaria brown s pot. (A) Alte rnaria brown lesions on the leaves of Minneola tangelo. (B) Alter naria brown spots on Dancy tangerine. (C) Fungal infection occurs early in t he season leading to large lesions and may induce defoliation. (D) Lesions with corky protuberances on the fruit of Minneola tangelo (Courtesy Dr. L. W. Timmer). A C D B

PAGE 29

29 Figure 1-2. Disease cycle of Alternaria brown s pot, caused by the tangerine pathotype of Alternaria alternata (Redrawn based on the work of Timmer 1999).

PAGE 30

30 Figure 1-3. The S. cerevisiae mating (FUS3), filamentation (KSS1), cell integrity (SLT2) and high os molarity glycerol (HOG1) MAPK pathways. Mating pathway-specific com ponents: open circles, only one of several possible transcription factor combinations depicted; Filamentation pathw ay-specific components: open squares; SLT2 pathway-specific components: filled ellipase; HOG1 pathway-specific components: open hexagons, one of several known transcription factors depicted. Shared com ponents: filled diamonds (Redrawn based on the work of Schwartz and Madhani 2004; Jurgen et al. 1999).

PAGE 31

31 CHAPTER 2 THE Alternaria alternata AaAP1 TRANSCRIPTION FACTOR INVOLVED IN DETOXIFICATION OF REACTIVE OXYGEN SPECIES IS A KEY PATHOGENICITY FACTOR ON CITRUS Due to the universal toxic effects of reactive oxygen species (ROS) and their important roles in plant defens e responses, plant pathogens mu st develop strategies to breakdown ROS. In this work, a YAP1 homolog, designated AaAP1, was characterized in the necrotrophic fungus, Alternaria alternata, and found to play an important role in ROS detoxification and pat hogenesis to citrus. The A. alternata AaAP1 contains all conserved domains required for cellular lo calization of YAP1 and for YAP1-mediated resistance to oxidative damage. Upon exposure to H2O2, the AaAP1::sGFP (synthetic green fluorescent protein) fusi on protein became localized in the nucleus. Expression of AaAP1 was responsive to oxidative stress. Disruption of the AaAP1 gene resulted in mutants that are hi ghly sensitive to H2O2, menadione, and tert-butyl-hydroperoxide and displayed a marked reduction in several antioxidant enzymatic activities. The AaAP1null mutants retained normal co nidiation and ACT toxin production but failed to incite necrotic lesions on Minneola leaves. Applicati on of NADPH oxidase in hibitors partially restored lesion formation in the AaAP1 -disrupted mutants. Furthermore, several downstream genes potentially regulated by AaAP1 were i dentified by subtractive suppressive hybridization. Introduction of a full-length AaAP1 into the AaAP1 disruptant restored resistance to oxidative stresses as well as pathogenicity to wild type levels. Taken together, I present information below that AaAP1 plays an essential role for ROS detoxification and lesion development and thus, is an important pathogenicity factor in A. alternata.

PAGE 32

32 Introduction In res ponse to pathogen invasion, plant cells often rapidly and transiently generate reactive oxygen species (ROS), including superoxide (O2 -), hydrogene peroxide (H2O2), and hydroxyl radical (.OH) (Greenberg 1997). This defense -associated process is called the oxidative burst. ROS may have antimicrobial effects, as well as ability to trigger programmed cell death and hypersensitive response (HR) at the site of infection (Greenberg 1997). ROS may also serve as a signal for activation of other defense responses against pathogen attacks (Neill et al. 2002; Veal et al. 2007) To survive within the harsh oxidative environment of host plants, f ungal pathogens must develop st rategies to detoxify or repress ROS-mediated defense system via enzymatic or nonenzymatic mechanisms (Cessna et al. 2000; Mayer et al. 2001; Moye-Rowley 2003). Indeed, plant pathogens may produce a wide array of enzymes t hat are capable of breaking down ROS produced by host plants. Those enzymes include superoxide dismutases (SOD), catalases (CAT), peroxidases, glutathione pe roxidases, glutathione reductases, as well as thioredoxin reductases and thioredoxin peroxidases (S taples and Mayer 1995). In Saccharomyces cerevisiae the YAP1 transcription fa ctor has been intensively studied for controlling oxidative-stress response (Moye-Rowl ey 2003). YAP1 was identified as an ortholog of mammalian AP-1 tr anscriptional activator based on its ability to bind to an AP-1 response element (ARE : TGACTAA) in the promoter region (Harshman et al. 1988) YAP1, containing a basic leucine zipper (bZIP) domain, is responsible for cellu lar resistance to H2O2, drugs and heavy metals (Toone et al. 2001). Two cysteine-rich domains: carobxyl terminus (c-CRD) and amino terminus (n-CRD) are required for appropriate nuclear exportation and subcellular localization, and thus are

PAGE 33

33 critical for YAP1-mediated resistance to oxidative stress (Coleman et al. 1999; Delaunay et al. 2000; Kuge et al. 2001). In addition, a char acteristic nuclear export sequence (NES) carrying a short stretch of leucine amino acids is present in the c-CRD domain of YAP1. This domain is required fo r binding by nuclear export protein Crm1p under normal conditions (Toone et al. 1998). Upon exposure to oxidative stress, redox signals induce formation of intramolecular di sulfide bonds within YAP1, resulting in conformational changes. Since the NES is invisible to Crm1p, YAP1 remains localized in the nucleus and activates oxidative stress-related genes (Toone and Jones 1999). Indeed, numerous genes under YAP1 regulation have been identified to be related to oxidative damage in Saccharomyces cerevisiae (Toone et al. 2001). Those include GSH1 encoding a r -glutamylcysteine synthetase for gl utathione synthesis (Stephen et al. 1995; Wu et al. 1994); GSH2 encoding a protein for glutathione biosynthesis (Sugiyama et al. 2000); GLR1 encoding a glutathione reducta se (Grant et al. 1996); GPX2 encoding a GSH peroxidase (Inoue et al. 1999); TRR1 encoding a thioredoxin reductase (Lee et al. 1999); TRX2 encoding a thioredoxin (Kuge and Jones 1994); FLR encoding a multidrug resistance transporter (Nguyen et al. 2001); YCF1 encoding an ABC transporter essential for cadmium toler ance, and many others (Morgan et al. 1997). The YAP1 transcription factor involved in ROS detoxification has been identified as an essential virulence factor in the biotrophic maize pathogen Ustilago maydis (Molina and Kahmann 2007) and the oppor tunistic human pathogen Candida albicans (Enjalbert et al. 2007). However, disruption of a YAP1 gene homolog, chap1 in Cochliobolus heterostrophus (Lev et al. 2005) or AfYap1 in Aspergillus fumigatus (Lessing et al. 2007) did not change virulence on the respective hosts. Thus, the role of ROS in host defense

PAGE 34

34 against fungal pathogens remains elusive. The interactions may depend on the lifestyle of the pathogen (Glazobrook 2005) and the effectiveness of its own ROS detoxification machinery. In this Chapter, I report on the cloning and characterization of a gene, designated AaAP1 ( A lternaria a lternata AP-1 like), encoding a yeast YAP1 homolog from the tangerine pathotype of A. alternata My objectives are to determine whether AaAP1 is involved in the oxidative stress response, to identify possible downstream genes regulated by AaAP1, and to evaluate whether fungal antioxidant sy stems are important for A. alternata pathogenicity. Materials and Methods Fungal Strains and Culture Conditions The wild type EV-MIL31 s train of Alternaria alternata (Fr.) Keissler used in this study was single-conidium cu ltured from diseased leaves of Minneola tangelo, a hybrid between Duncan grapefruit (Citrus paradise Macfad.) and Dancy tangerine ( Citrus reticulate Blanco ) in Florida. Fungal isolates were cultured on pot ato dextrose agar (PDA, Difco Laboratories) at 28 Conidia were harvested fr om fungal cultures grown on PDA under cool-white fluorescent light fo r 3 to 4 days. For DNA and RNA purification, fungal strains were grown on PDA overlaid with sterile cellophane for 2 days. For preparation of protoplasts, fungal isolates were grown in 50 ml of potato dextrose broth (PDB, Difco Laboratories) for 5 days, blende d, mixed with fresh 200 ml PDB, and incubated for an additional 24 h. Fungal mycelia were collected afte r centrifugation at 6,500 g at 4C for 10 min and resuspended in a wash solution (1 M NaCl, 10 mM CaCl2). Fungal protoplasts released after trea ting with cell-wall-degrading enzymes for 2

PAGE 35

35 h were harvested by centrifugation at 3000 g for 10 min, and resuspended in sterile STC solution (1.5 M sorbitol, 10 mM CaCl2, 10 mM Tris-Cl pH 7.5) as described (Chung et al. 2002). Transformation of A. alternata EV-MIL31 using a CaCl2 and polyethylene glycol-mediated method was performed by mi xing PCR fragments or plasmid construct with protoplasts (1 106/ml) as described previously (Chung et al. 2002). Fungal transformants were regenerated and sele cted on regeneration medium (RMM) amended with hygromycin or sulfonylurea (Chung et al. 2002). Lipid Peroxidation Assays Lipid peroxidation as says were pe rformed based on the production of malondialdehyde (MDA) from lipid derivatives reacting with thiobarbituric acid (TBA) during the oxidation of polyuns aturated fatty acid (Zawoznik et al. 2007). Briefly, 0.2 g Minneola leaves inoculated with or without conidial suspension was grounded in 2 ml of 20% trichloroacetic acid (T CA) and centrifuged at 10,000 g for 10 min at room temperature. The supernatant was collected and mixed with equal volume of 0.5% TBA and 100 l of butylhydroxitoluene (B HT; 40 mg/ml). MDA was fo rmed after heating at 95 for 30 min and measured spectrophotomet rically at 532 nm. Absorbance value measured at 532 nm was normaliz ed by subtracting that of non-specific absorption at 600 nm. The MDA concentration was calculat ed using its extinction coefficient 155 mM-1 cm-1. Detection of H2O2 in Citrus Leaves H2O2 accumulated in the citrus leaves wa s identified by the formation of brown polymerization product of 3, 3-diaminobenzidine (DAB) as described (Orozco-Cardenas and Ryan 1999) with some modifi cations. As described above, 5 l conidial

PAGE 36

36 suspensions (1 104 / ml) of A. alternata were inoculated onto detached Minneola leaves for 12 to 24 h. Leaves with no vis ualized lesions were immersed in 5 mM DAB solution (pH 3.8) in darkness for 16 h at room temperature. Leav es were photographed after decolorization by soaking in 95% ethanol for 2 days. Cloning of AaAP1 A 0.6-kb AaAP1 DNA fragment was amplified from genomic DNA of the A. alternata EV-MIL31 strain using a Go-Taq DNA polym erase (Promega) with two degenerate primers AP-1F and AP-1R (Table A-1). T he primers are comp lementary to the conserved N-terminal cysteine-rich domain. The amplicon was cloned into a pGEM-T easy vector (Promega). Sequence analysis rev ealed that the amplif ied DNA fragment displayed amino acid similarity to many AP1like proteins. The entire AaAP1 open reading frame (ORF) as well as its promot er region was obtained with two inverse primers yap-31 and yap-32 from Xho I-digested and self-ligated DNA templates of A. alternata. ORF and exon/intron locations were veri fied by comparisons of genomic and cDNA sequences. The promoter region was analyzed using regulatory sequence analysis tools (van Helden 2003) Functional domains were predicted according to the PROSITE database using ExPASy (Henikoff et al. 2000) or Motif/ProDom and Block programs. The A. alternata AaAP1 sequence has been deposited in the EMBL/GenBank Data Libraries with accession number FJ376607. Creation and Identification of the AaAP 1 Null Mutants All oligonucleotide primers us ed in this study are shown in Table A-1. To disrupt AaAP1 a 1.7-kb DNA fragment containing the entire AaAP1 ORF was amplified with two primers yap1DF2 and yap1DR2 and cloned into pGEM-T ea sy vector to create T-

PAGE 37

37 yapDFR2. A 1.6-kb hygrom ycin phosphotransferase ( HYG ) gene cassette under control of the A. nidulans trpC promoter was obtained from pU CATPH (Lu et al. 1994) after digestion with Bam HI. The fragment was end-filled and cloned into T-yapDFR2 at the blunted Nru I site to generate a disruption construc t, T-yapHyg. A split -marker strategy was used for gene disruption (Choquer et al 2005). Two truncated but overlapping HYG fragments fused with eit her 5 or 3 end of AaAP1 were amplified. A 1.5-kb DNA fragment containing 5 AaAP1 and 3 HYG was amplified with pr imers yapDR2 and hyg3; a 2.1-kb DNA fragment encompassing 3 AaAP1 and 5 HYG was obtained with two primer yapDR2 and hyg4 (Fig. 2-3A). PCR fragments were di rectly transformed into protoplasts prepared from the wild type EV-MIL 31 strain, using CaCl2 and polyethylene glycol as previously described (Chung et al 2002). Fungal transformants were selected on RMM medium with 200 g/ml hygromycin (Roche App lied Science), tested for the sensitivity to H2O2, and further confirmed by Souther n and Northern blot analyses. Genetic Complementation of an AaAP1 Disrupted Mutant To complement an AaAP1 null mutant, a 3.8-kb DNA fragment containing functional AaAP1 with its endogenous promoter was amplified from A. alternata genomic DNA with two primers hypo1 and yap-taa using a high-fidelity DNA polymerase (Roche Applied Science). The amplified DNA products were co-transformed with the pCB1532 plasmid carrying the Magnaporthe grisea acetolactate synthase gene ( SUR ) cassette that confers sulfonylu rea resistance (Sweigard et al. 1997) into protoplasts of the AaAP1 null mutant. Transformants were selected on a medium containing 5 g/ml sulfonylurea (chlorimur on ethyl) (Chem Servic e, West Chester, PA U.S.A.) and tested for H2O2 sensitivity.

PAGE 38

38 AaAP1 Localization A joining PCR method was performed to generate a fusion construct between the AaAP1 and GFP genes (Fig. 2-6A). A 4.0-kb DNA fragment containing a functional AaAP1 gene and its endogenous promoter was am plified with two primers hypo1 and AP1::sGFP by a PFU DNA pol ymerase (Stratagene). A synt hetic green fluorescent protein (sGFP)-coding DNA fragment was am plified from the plasmid pTdsGFP::ToxA with the primers sGFP::AP1 and sGFP.nos The resulting fragments were mixed and further amplified with t he primers hypo-1 and sGFP .nos to form a 5.0-kb AaAP1::sGFP fusion construct. Primers AP1::sGFP and sGFP::AP1 shar e complementary sequences. The AaAP1::sGFP fusion construct was co-transform ed with pCB1532 into protoplasts prepared from an AaAP1 null mutant. Transformants we re selected on RMM medium containing sulfonylurea at 5 g/ml and tested for H2O2 sensitivity and for green fluorescence. Sensitivity Test of AaAP1 Null Mutants Ass ays for sensitivity to H2O2 or other chemicals were conducted by transferring fungal mycelia as a toothpick point inocul ation onto PDA agar cont aining oxidants or compounds and incubating under constant fluores cent light. Fungal radial growth was measured at 4-5 days. Pathogenicity Assays Pathogenicity assays were conducted on de tached Minneola leaves (4-6 days after emergence and approximate 2 to 3 cm) inoculated with conidial suspension. Conidia were isolated as previously described (Peever et al. 2000). Briefly, fungal strains for inoculation were incubated at 27 under cool-white fluorescent light for 5-6 days and

PAGE 39

39 conidia were harvested in sterile wa ter with low-speed centrifugation (5000 g). The concentration of conidia was adjusted to 1 104 conidia/ml. On each spot, 5 l conidial suspension was inoculated on the Minneola l eaves and the inoculated leaves were incubated in a moist chamber for lesion development for 2-6 days. Purification of ACT Host-Selective Toxin Production of ACT toxin by A. alternata was carried out in a modified Richards medium (25 g of gl ucose, 10 g of KNO3, 5 g of KH2PO4, 2.5 g of MgSO4, 0.02 g of FeCl3, and 0.005 g of ZnSO4 per liter) as described (Kohmot o et al. 1993). Fungal isolates were grown in 200 ml Richards medium at room temperatur e for 24 days. Fungal mycelia were harvested by filtration through th ree layers of filter paper. The culture fluid was adjusted to pH 5.5 with 10% sodium phosphate buffer and mi xed with 30 g of Amberlite XAD-2 resin (Aldrich) in a constant stir for 2 h. Amberlite XAD-2 was packed in a column and ACT toxin was eluted with 400 ml of methanol. Methanol was evaporated and the remaining solution was parti tioned five times with equal volume of ethyl acetate. The organic so lvents were collected, comb ined, and evaporated at 50 The final residue was dissolved in methanol and analyzed spectrophotometrically or separated by thin-layer chromatography utilizing TLC plat es coated with a 60F254 fluorescent silica gel (5 by 20 cm; Selecto Scientific). The solvent system contained benzene/ethyl acetate/acetic acid (50:50:1, v/v). ACT toxin was visualized as a band using a hand-held UV light (UVP, San Gabriel, CA). Bands were marked, scraped from the plate, eluted with methanol, and tested for toxicity. A leaf necrosis assay for the toxicity of ACT toxin wa s performed by placing 5-10 l of solution on detached Minneola leaves as described (Kohmoto et al. 1993). T he treated citrus leaves were incubated in

PAGE 40

40 a moist chamber at 25 under light and examined daily for appearance of necrotic lesions. Microscopy Conidial viability was tested by treating conidi a with or without 0.1% H2O2 for 30 min and staining with 0.1% Evans blue dye as described (Taylor and West 1980). The percentage of non-blue cells over total cells wa s used as the index of viability. To visualize A. alternata strains within the Minneola leaves, 5 l conidial suspensions (1 104 conidia/ml) prepared fr om wild type and the AaAP1 disrupted mutant were point inoculated on the leaves. After 2 days postinoculation (dpi), leaf samples were fixed with 3% glutaraldehyde dissolved in 0.1 M potassium phosphate buffer (pH 7.2) and 2% osmium tetroxide. The plant tissue s were embedded in Spurrs plastic after dehydration with an acetone seri es. Samples were sectioned and examined by light microscopy (Leica Micros ystems Inc., Exton, PA, U.S.A). GFP fluorescence was detected using a Leitz Laborlux phase contrast microscope equipped with a 450 to 490-nm excitation filt er and a 520-nm barrier filter (Leica Microsystems). Fungal nuclei were stained wi th 4-6-diamidine-2-phenylindole (DAPI) fluorescence as previously described (Chung et al. 2002) and detected using a 340-380 nm excitation filter and a 425 nm barrier filter. Enzymatic Assays Fungal prot eins extracted with ice cold 250 mM potassium phosphate buffer (pH 7.0) after grinding fungal my celia in liquid nitrogen were collected by centrifugation at 10,000 g for 15 min at 4 Concentration of crude prot eins was determined by a protein assay kit (Bio-Rad, He rcules, CA, U.S.A.). Total cellular catalase activity was

PAGE 41

41 determined by measuring the decomposition of H2O2 with a colorimetric reagent (200 ml of 34.2 mM purpald dissolved in 480 mM hydroc hloric acid) (Johanson and Borg 1988). Briefly, 50 g of fungal proteins were mi xed with 95% methanol and 10 l of 0.3% H2O2 and incubated at room temperature for 20 min. The reaction was stopped by adding 100 l of 7.8 M potassium hydrox ide, mixed with 34.2 mM pur pald (4-amino-3-hydrazino-5mercapto-1,2,4-triazole), s pun for 10 min to remove prec ipitate (Purple color), and measured at A550. One unit of catalase is defined as that required to decompose 1.0 mM H2O2 per min at pH 7.0 at 25 Peroxidase activity was determined by the formation of purpurogallin (2,3,4,6tetrahydroxy-5H-benzocycloheptene5-one) from pyrogallol (ACRO S) in the presence of H2O2 (Abrash et al. 1989). The enz ymatic reaction containing 50 g crude extract proteins, 0.5% H2O2, and 5% pyrogallol in 100 mM phosphate buffer (pH 6.0) was incubated at 25 for 1 min and measured at A420. The overall activity of superoxide dismutase (SOD) was determined by the reduction of nitrotetrazolium blue (NBT) chloride to NB T-diformazan by superoxide radical that is generated by x anthine oxidase during conversion of xanthine to uric acid and H2O2 (Giannopolitis and Ries 1997). The reaction containing 50 g/ml of fungal protein extracts, 0.75 mM NBT, 3 mM xanthine, and 4.4 l of 10 nM of xanthine oxidase, was incubated for 30 s and absorbance measured at A550. One unit of SOD inhibits 50% of NBT-diformazan formation under the conditions of assay. Standard curves were constructed using pure catalase, peroxidase, or SOD (Sigma). Lignin-type peroxidase activity was deter mined by formation of yellow color after reaction with 1 mM 3,3-diaminobenzid ine (DAB) dissolved in 50 mM potassium

PAGE 42

42 phosphate. Fungal proteins (30 g/ml) were mixed with 100 l DAB for 1 h and the reaction was measured at A482 (Archibald 1992). The Mn-type peroxidase using phenol red as a colorimetric reagent was evaluated as described (Kuwahara et al. 1984). Fungal proteins (30 g) were added into a sodium phosphate buffer (pH 4.5) containing 0.2 mM MnSO4, 0.1 mM H2O2, and 0.0025% phenol red. The reaction was performed at 25 for 1 h and absorbance measure at A 431. Ascorbate peroxidase (APX) activity wa s assayed according to the method of Nakano and Asada (1981). The hydrogen pero xide-dependent oxidat ion of ascorbate was determined by a decrease in the absorbanc e at 290 nm. The reaction mixture (2 ml) contained 50 mM potassium phosphate buffer (pH 7.0), 0.1 mM EDTA, 0.5 mM ascorbate, 0.02% H2O2 and 30 g protein sample. APX activi ty was expressed as mmol ascorbate oxidized min-1g-1 fungal dry weight. Glutathione peroxidase (G px) was measured at A340 for decreasing absorbance after adding NADPH and tert-butyl-hydroperoxide into 0.1 M phosphate buffer (pH 7.0) containing fungal proteins, reduced glutat hione (GSH), and glut athione reductase as described (Wheeler et al. 1990). Glutathione reductase (GR) wa s measured at A340 for decreasing absorbance in the presence of oxidized glutathione (GSSG), EDTA, and NADPH. One unit of glutathione per oxidase or reductase forms 1.0 mol NADP+ from NADPH per min at pH 7.0 at 25 Glutathione-S-transferase (GST) activi ty was determined by the formation of p nitroanilide from glutamic acid p -nitroanilide (Zablotowicz et al. 1995). Fungal proteins (30 g) were mixed with 50 l of 20 mM glutathione and 20 mM 1-chloro-2,4-

PAGE 43

43 dinifrobenzene dissolved in 95% ethanol, inc ubated for 30 min, and measured at A450. The regression line was established using pure glutathione-S-tran sferase (Sigma). Laccase activity was determined spectrophotometrically using ABTS [2,2:azinobis(3-ethylbenzthiazoline-6-sulfonic ac id)] as a substrate (Niku-Paavola et al. 1998). The laccase reaction contai ned 0.5 ml of extracellular culture fluid and 14 nM of ABTS dissolved in 50 mM glycine-HCl (pH 3.0). The reaction was monitored by measuring the change in A436 for 5 min. The laccase ac tivity was expressed as nanokatals (nanomoles/second). The exti nction coefficient of 29,300 M-1 cm-1 was used to calculate the amounts of the oxidized ABTS. Total sulfhydryl content was determined by formation of thio -bis-nitrobenzene (TNB) after reacting with 5,5-dithio-bis-nitrobenz oic acid (DTNB) (Hol mgren 1977). Fungal proteins (30 g) were mixed with 780 l of 0.2 M Tris-HCl (pH 8.0) and 20 l of 5 mM DTNB, incubated at 25 for 30 min, and measured at A 412. All experiments were carried out two times with at least th ree replicates. The enzyme activities of the wild type, the AaAP1 mutants and the complem entation strains were compared by Analysis of Va riance (ANOVA) within the SPSS statistical analysis software (SPSS Inc.). A p -value of < 0.05 was interpreted as a significant difference. Molecular Techniques Plas mids propagated in Escherichia coli DH5were isolated with a Wizard DNA purification kit (Promega). Fungal DNA wa s purified with a DNeasy Plant Mini kit (Qiagen, Valencia, CA, U.S.A. ). RNA was extracted with a TRIZOL RNA isolation kit (Invitrogen, Carlsbad, CA, U.S.A.). DNA pr obes for Southern and Northern blot analyses were labeled with digoxigenin (DIG )-11-dUTP (Roche App lied Science) by

PAGE 44

44 PCR with specific primer s yap-31 and yap-atg. Procedu res and conditions for prehybridization, hybridization, washing and immunological dete ction of the probe with a CSPD chemofluorescent su bstrate for alkaline phosphatas e were performed following the manufacturers recommendations (Roche Applied Science). Results Stress Responses of Citrus Le aves Inoculated with A. alternata Lipid peroxidation is one of the hallmarks of cellular inju ry in plants and often used as an indicator of oxidative stress in ce lls and tissues (Hodges et al. 1999). To determine if A. alternata would induce lipid peroxi dation, Minneola leaves were inoculated with conidial suspension prepared from the wild type strain. As shown in Fig. 2-1A, citrus leaves inoculated with A. alternata accumulated malondialdehyde (MDA), which is one of the most abundant carbonyl products of lipid peroxidation (Fig. 2-1A). Accumulation of H2O2 in citrus leaves was dete rmined using 3,3-diaminobenzidine (DAB) as a substrat e. Inoculation of A. alternata in Minneola leaves resulted in brown polymerization as being the indicative of H2O2 accumulation (Fig. 2-1B). The results implicate the accumulation of ROS in citrus responding to A. alternata Characterization of an AP1 Homolog in A. alternata The AaAP1 gene c loned from the t angerine pathotype of A. alternata has a 2021bp ORF interrupted by two introns (50 and 81 bp). Further analysis of 832-bp upstream sequence from the putative ATG translational initiation codon found a putative stress responsive element (STRE: AG GGG) that can be induced by various stresses including oxidative damage in yeasts (Marchler et al. 1993). The AaAP1 gene encodes a polypeptide of 629 am ino acids, showing 44-87% similarity and 33-81% identity to numerous of AP1-like proteins in yeasts and fungi.

PAGE 45

45 AaAP1 protein is most similar to the AP1-like proteins of Pyrenophora tritici-repentis (XP_001931984) and C. heterostrophus (AAS64313). The predicted AaAP1 polypeptide contains several conserv ed domains of YAP1 orthologs (Fig. 2-2A and B): a basic leucine zipper (b-ZIP) DNA binding dom ain (amino acids 161-224), an N-terminal cysteine-rich domain (n-CRD; amino acids 387-429), and a carboxyl-terminal cysteinerich domain (c-CRD; amino ac ids 572-605). Additionally, a put ative hydrophobic nuclear export sequence (NES; amino acids 564-577) located in c-CRD was found. This site can be recognized and bound by the Crm1p-like exporter (Yan et al. 199 8) and is critical for subcellular localization of AaAP1 during oxidative stress. Targeted Disruption of AaAP1 Two s plit-marker fragments carrying a truncated hygr omycin phosphotransferase gene ( HYG ) fused with eit her 5or 3AaAP1 sequence were amplified from the disruption construct (T-yapHyg) and directly transformed into wild type for targeted gene disruption. In total, two of 35 transfo rmants recovered from media containing hygromycin were hypersensitive to 0.1% H2O2 and were analyzed further. Southern blot hybridization of Spe I-digested genomic DNA from wild type detected an expected 2.4-kb hybridizing band. However, two putative AaAP1 disrupted mutants showed a 4.0-kb band, resulting from inserti on of an additional 1.6-kb HYG gene cassette at AaAP1 locus (Fig. 2-3B). The putative AaAP1 -disrupted mutants were further analyzed by Northern blotting (Fig. 2-3C ), confirming that the AaAP1 gene has been successfully disrupted in A. alternata Analysis of Spe I-digested genomic DNA isolated from six transformants that we re resistant to both hygromycin and H2O2 by Southern blot hybridization identifi ed the 2.4-kb bands similar to t hat of wild type (Fig. 2-3D).

PAGE 46

46 AaAP1 Is Required for Resistance to Oxidative Stress The AaAP1 mutants showed 30% growth r eduction compared to wild type on PDA. Growth of AaAP1 null mutants was inhibited by 0.1% H2O2, 2 mM menadione, 0.02% tert-butyl-hydroperoxi de, or 1 mg/ml KO2 to various degrees (Fig. 2-4A and some data not shown). However, the AaAP1 mutants were not sensitiv e to 0.1% SDS, 1 mg/ml MTT ([4,5-dimethylthiazol-2yl] -2,5-diphenyl tetrazolium brom ide), 1 M sorbitol, mannitol, NaCl, or KCl (Fig. 2-4A). Introduction of a functional AaAP1 gene with its endogenous promoter into a null mutant restored all def ective phenotypes, as exemplified in the CP1 and Cp2 strains (Fig. 2-4A). The toxicity of H2O2 to A. alternata was further eval uated for the viab ility of conidia after staining with 1% Ev ans blue. Dead cells cannot exclude dye and stain blue, whereas live cells effectively export dye and remain clear. In the absence of H2O2, all strains were viable and stayed clear with no obvious difference throughout the assay period. Conidia of both wild type and the Cp1 strain remai ned clear and viable in the presence of hydrogen peroxide (Fig 2-4B). After exposure to H2O2 for 30 min, greater than 90% of the conidia of the AaAP1 null mutant were stained blue, indicative of cell death (Fig. 2-4C). AaAP1 Null Mutants Have Defective H2O2 Metabolism To determine if A. alternata strains are able to detoxify H2O2, fungal cultures of the wild type, the AaAP1 mutants, and the complementati on Cp1 strain were immersed with 0.1% H2O2 for 30 min and stained with DAB. H2O2 reacted with DAB, forming a brownish polymer around fungal colonies. The AaAP1 mutant colonies became dark brown 5 h after staining wi th DAB, indicating H2O2 accumulation around the fungal hyphae (Fig. 2-5A). However, the wild type and Cp1 colonies remained largely white. To

PAGE 47

47 further evaluate if the AaAP1 null mutant was impaired in H2O2 metabolism, detoxification of hydrogen peroxide by Alternaria strains was assessed by measuring H2O2 reduction over time in solution. The w ild type and Cp1 strains quickly consumed H2O2: more than 65% of H2O2 was consumed or detoxified wi thin 30 min (Fig. 2-5B). In contrast, degradation of H2O2 by the AaAP1 null mutant was signi ficantly slower. Expression of AaAP 1 Is Induced by Oxidative Stress Northern blot hybridization was perform ed to evaluate if expression of the AaAP1 gene responds to oxidants in ax enic culture. The wild type AaAP1 transcript was barely detectable when the fungal cult ure was grown on PDA, but ac cumulated to higher level after H2O2, menadione, or tert -butyl-hydroperoxide treatment, and to a lesser extent in response to KO2 (Fig. 2-5C). Treatment with SDS, rose Bengal, or MTT did not induce AaAP1 expression. Nuclear Localization of AaAP1::sGFP upon Exposure to H2O2 To investigate the mode of AaAP1 activation, the AaAP1 gene was fused translationally in frame with the gene encoding a synthetic green fluorescent protein ( sGFP ) (Fig. 2-6A). To ensure that the Aa AP1::sGFP fusion protein was functioning correctly, the fusion constr uct was transformed into an AaAP1 null mutant and only strains with restored phenotype for H2O2 resistance were chosen for microscopic analysis. In the absence of H2O2, the AaAP1::sGFP fusion protein shows diffuse fluorescence in cytoplasm (Fig. 2-6B). After treatment with H2O2, the fusion protein became localized in the nucleus. Regulation of ROS-Related En z ymatic Activities by AaAP1 Compared to the wild type and the complementation strains, the AaAP1 null mutants displayed a marked reduction in gl utathione-S-transferase (GST), glutathione

PAGE 48

48 peroxidase (Gpx), glutathione reductase (Grx), catalase, peroxidase, and SOD activities (Fig. 2-7). The AaAP1 null mutants also showed a significant reduction in lignin-type peroxidase activity. In contrast, AaAP1 null mutants did not alte r Mn-type peroxidase, ascorbic peroxidase, laccase activities, total sulfhydryl (-SH) or gl utathione (non-proteinSH) contents (data not shown). Identification of the Genes Whose Expression is Regulated by AaAP1 More than 40 expression sequence tags (EST) using suppression subtractive hybridization (SSH) were recovered form the wild type cDNA library subtract ed with that of the AaAP1 null mutant (Table 2-1). Northern blot analyses revealed that deletion of the AaAP1 gene downregulated expression of the clones #2 (encoding a conserved hypothetical protein), #8 (encoding a putative fatty acid synthase subunit reductase), #10 (encoding a NmrA-like Hscarg dehydrogenas e), #19 (encoding a MFS transporter), and #54 (encoding another MFS tr ansporter) (Fig. 2-8). Ex pression of the clone #62 (encoding a non-ribosomal peptide sy nthase) was up-regulated in the AaAP1 mutant. AaAP1 Is Required for the Viru lence in A. alternata To determine if the AaAP1 gene product plays an essential role during fungal pathogenesis, conidia prepared form the wild type, the AaAP1 mutants (D1 and D2), and the complementation strains (Cp1 and C p2) were inoculated on detached Minneola leaves using point or spray inoculation techniques. The AaAP1 disruptants failed to incite visible lesions on unwounded leaves at 4 days postinoculatio n (dpi), whereas both the wild type and Cp1 strains developed typi cal necrotic lesions surrounded by yellow halos at 2-4 dpi (Fig. 2-9A). As much as 18% of total spots inoculated by AaAP1 null mutants induced small lesions at 4 dpi (Fig. 2-9B), which probably were caused by the host-selective ACT toxin produced by the AaAP1 mutants. Pathogenicity assessment

PAGE 49

49 carried out by spray inoculat ion also verified that the AaAP1 null mutants cannot cause visible symptoms on Minneola leaves (Fig. 2-9C). Furthermore, wounding the leaves prior to inoculation did not facilitate colonization and lesion formation by the AaAP1 mutants D1 and D2 (Fig. 2-9D). The AaAP1 Null Mutant Is Impaired in Penetration and Colonization Stages Minneola leaves inoculated with the wild type, the AaAP1 disruptant (D1), and the complementation Cp1 strains were investigated using light microscopy. The wild type and the Cp1 strains successfully invaded pl ant cells and disrupted epidermal layers and cellular organelles (Fig. 2-10A and C). By c ontrast, the disrupted mu tant did not cause degradation of cell organelles and c onidia were arrested on the leaf surface (Fig. 2-10B). Disruption of the AaAP1 Gene Did Not Affect Host-Selective Toxin Production The tangerine pathotype of A. alternata produc es the host-selective ACT toxin that has been demonstrated to be essential for fungal pathogenesis (Hatta et al. 2002). Northern blot hybridization of RN A prepared form the wild type, the AaAP1 null mutant, and the complementation strains to an AKT homolog (encoding a 9,10-epoxy-8hydroxy-9-methyldecatrienoic acid for ACT toxin biosynthesis) probe (Masunaka et al. 2000) identified a 3.6-kb transcri pt with similar intensities (Fig. 2-11A). A leaf necrosis assay was used to determine if ACT toxin was produced by A. alternata in axenic culture (Kohmoto et al. 1993). Cult ure filtrates of wild type, the AaAP1 mutant, and the complementation Cp1 strains all induced si milar necrotic lesions on Minneola leaves (Fig. 2-11B). ACT toxin was purified using Amberlite XAD-2 resin and ethyl acetate from culture filtrates. Spectrophot ometric scanning revealed that the ethyl acetate extracts prepared from all test strains displayed a strong absorbance at 210 nm (Fig. 2-11C). Thin-layer chromatography (TLC) analysis al so revealed no significant differences

PAGE 50

50 among the culture filt rates (Fig. 2-11D). One of the bands ( Rf 0.53, the ratio of the distance migrated by a substance compared wi th the solvent front ) was scraped from the silica gel and showed to incite necrotic lesions on detached Minneola leaves (Fig. 211E). An Rf 0.58 band did not cause any visible le sions (data not s hown). Therefore, deletion of the AaAP1 gene in A. alternata did not affect ACT toxin production. NADPH Oxidase Inhibitors Partially Rest ore Pathogenicity of the AaAP1 Null Mutant In plants, NADPH oxidases are involved in the production of H2O2 and superoxide in response to pathogens (Doke et al. 1996). A NADPH oxidase inhibitor, apocynin (hydroxyl-3 methoxyacetophenone) or diphenyl ene iodonium (DPI) was co-applied with conidia of the AaAP1 mutant on detached Minneol a leaves to determine if the inhibitors would affect pathogenicity of the mutant. Co-inoculation of the AaAP1 disruption mutant with apocynin or DPI induced necrotic lesions at 5 dpi, and the lesions continued to expand at 8 dpi (Fig. 2-12). However, applicat ion of NAPHD oxidase inhibitors or the AaAP1 null mutant did not incite any visible lesions on Minneola leaves. The wild type strain of A. alternata induced necrotic lesions on Minneola leaves at 2 dpi; thus, the NADPH oxidase inhibitors only partially restored virulence of the AaAP1 disruption mutant. Discussion Redox reg ulation is one of the import ant mechanisms for controlling cellular differentiation, cellular defense, and cell signalin g in all eukaryotic cells (Aguirre et al. 2005; Apel and Hirt 2004; Mittler 2002; Neill et al. 2002). Of the key determinants that trigger a battery of defensive reactions duri ng the hypersensitive cell death, one of the early responses is the transient producti on and accumulation of toxic ROS near the

PAGE 51

51 infection courts (Greenberg and Yao 2004). In plants, the defense response mechanism by generating ROS is triggered by pathogen invasion. ROS can induce considerable damage to macromolecules, including fatty acids, proteins, enzymes, sugars and nucleic acids and may further result in programmed death to protect cells against biotic or abiotic stress (Glazebrook 2005; Spoel et al. 2007). In additi on to ROS, lipid peroxidation derived from the ox ygenated byproducts of lipid also plays a crucial role in plant early defensive responses (Deighton et al. 1999). As s hown in the present study, citrus cv. Minneola attacked by A. alternata quickly provoked lip id peroxidation and accumulated H2O2 around the inoculation site, indica tive of early defense responses. In budding yeast, regulation of gene expression by ox idative stress has been demonstrated to be mediated by the bZIP-containing transcription regulator, YAP1 (Moye-Rowley 2003). Similar to YAP1 in S. cerevisiae AaAP1 transcription factor contains a bZIP domain, two CRDs, and a NES that have been shown to be important for YAP1 cellular localization in the budding yeast. The genes, whose products are involved in the detoxification of ROS, such as catalase, peroxidase, SOD, glutathione reductase, glutathione synthase, thioredo xin reductase, and multidrug resistance transporter, have been demonstrated to be re gulated by YAP1 (Godon et al. 1998). Similar mechanisms might be applicable in A. alternata as well. Indeed, deletion of the AaAP1 gene resulted in a fungal strain that is hypersensitive to several oxidants and impaired in H2O2 metabolism. Several antioxi dant enzymes involved in ROS detoxification were shown to be controlled by AaAP1. They include catalase, SOD, peroxidase, glutathione reductase, glutathione peroxidase, and glutathione-Stransferase. Thus, the A. alternata AaAP1 is a crucial regulat or for ROS detoxification

PAGE 52

52 when cells are exposed to ox idative stress. Moreover, I demonstrated that two genes encoding putative fatty acid synthase subunit reductase and NmrA-like hscarg dehydrogenase recovered from the SSH library were positively regulated by AaAP1. However, I did not recover any genes encodi ng putative catalase, SO D, or peroxidase from the library. Interestingly, NPS encoding a putative non-ri bosomal peptide synthase was negatively regulated by AaAP1. In C. heterostrophus the nonribosomal peptide synthase ( NPS6 ) has been shown to be required fo r virulence, siderophore-mediated iron metabolism, and resistance to oxidative st ress (Lee et al. 2005; Oide et al. 2006). Nevertheless, the results indicated that Aa AP1 is functioning in the regulation of the genes involving in the redox homeostasis and ROS detoxification. The nuclear export sequence (NES) within the CRD domain of YAP1 has been known to promote nuclear expo rtation and subcellular localization of YAP1 in yeasts and fungi (Lessing et al. 2007; Molina and Kahmann 2007; Toone et al. 1998). In yeast, nuclear localization of YAP1 is a critical step for the function of YAP1 in transcriptional regulation (Coleman et al. 1999). A nuclear export protein, Crm1p is a negative regulator of YAP1. Under the condition of oxidative stress, Crm1p fails to bind to the NES because YAP1 is induced to experience a conformation change that simply masks the nuclear export sequence (Yan et al. 1998) Nuclear localizati on of the YAP1-like proteins responding to oxidative stress has been well established in yeasts (Toone et al. 2001) and A. fumigatus (Lessing et al. 2007) as well as in phytopathogenic fungi (Lev et al. 2005; Molina and Kahmann 2008). It is likely that AaAP1 of A. alternata also complies with this function based on the conserved domains and cysteine residues.

PAGE 53

53 Indeed, nuclear localization of AaAP1 was observed in A. alternata when cells encountered H2O2. ROS has been shown to play diverse roles in plant-microbe interactions and the production of ROS is strongly associated with HR (Lamb and Dixon 1997). If plants use ROS as a defensive response against micr oorganisms, successful pathogens may have evolved unique abilities to c ounteract toxic effects of ROS (Apel and Hirt 2004; Miller and Britigan 1997; Moye-Rowle y 2003; Toone and Jones 1999). Unlike biotrophic fungi, most of the necrotrophic pathogens produce to xins or cell wall-degrading enzymes to kill the plant cells prior to invasion (D ivon and Fluhr 2007). Many necrotrophic fungi obtain nutrients from the oxidative response-induced cell death to facilitate colonization (Cessna et al. 2000; Govrin and Levine 2000; Keon et al. 2007). To thrive in harsh environments, necrotrophic fungi have to evolve intricate strategies against the toxicity of ROS. The production of ROS is not only essent ial for differentiation, development, and signaling (Aguirre et al. 2005; Apel and Hirt 2004), but is also critical for cellular defense against pathogens in both animals and plants. However, the roles of ROS-responsive mechanisms and YAP1-mediated antioxidant acti vity in relation to fungal pathogenicity or virulence are divergent among species and highly dependent on the types of plantmicrobe interactions (Giesbert et al. 2008; Gl azebrook 2005; Keon et al. 2007; Lev et al. 2005; Mayer et al. 2001; Molina and Kahmann 2007; Tanaka et al. 2006). For example, YAP1 homolog in the biotrophic fungal pathogen U. maydis was shown to pl ay a role in fungal virulence (Molina and Kahmann 2007). However, deletion of a YAP1 -related gene, chap1 in the necrotrophic plant pathogen C. heterostrophus did not affect fungal

PAGE 54

54 virulence (Lev et al. 2005). Similarly, the AfYap1 -disrupted mutant of Aspergillus fumigatus remains normal virulence (Les sing et al. 2007). Disruption of Nox -like gene encoding a NADPH oxidase in Magnaporthe grisea Claviceps purpurea, and Botrytis cinerea prevented in-planta growth (Egan et al. 2007; Gies bert et al. 2008; Segmuller et al. 2008). However, in the Epichlo festuca -ryegrass interaction, NoxA is essential for maintaining a mutualistic interaction with ryegrass. Mutation of the noxA gene in Epichlo festuca enhanced fungal virulence, causi ng severe stunting on ryegrass and thus, disrupting the symbiotic interactions between E. festucae and its host (Takemoto et al. 2006). Many Alternaria species produce host-selective toxins (HSTs) with unique modes of toxicity. HSTs have been demonstrated to play a profound role during fungal invasion and lesion formation in various plantAlternaria interactions (Ito et al. 2004). As assayed on detached Minneola leaves, AaAP1 null mutants were nonpathogenic to the host plants even when inoculated onto wounded l eaves. It seems that AaAP1 is not required for production of host-specific ACT toxin, conidiation, and germination (data not shown). Recently, a YAP1 homolog RLAP1 was shown to be essential for fungal pathogenicity in the r ough lemon pathotype of A. alternata (Yang et al. 2010). It seems likely that the inability of the AaAP1 -disrupted mutant to incite necrotic lesions is related to defects in detoxifying ROS-mediated plant defense. Indeed, several antioxidantrelated enzymes and oxidative-responsive genes have been identified to be regulated by AaAP1 in this study. Increasing evidence indicates that peroxide-signaling mechanisms via antioxidant enzymes are requi red for sensing and detoxifying hydrogen peroxide in living cells (Mayer et al. 2001). Th is hypothesis was further supported by the

PAGE 55

55 fact that co-application of conidial suspension of the AaAP1 null mutant with a NADPH oxidase inhibitor, apocynin or diphenyle ne iodonium, partially re stored its pathogenic ability. Thus, in a low-ROS setting, AaAP1 -disrupted mutants were able to infect and exert pathogenicity. It seems very likely that t he YAP1-mediated antioxidant ac tivity is not a common mechanism by which all fungal pathogens allevi ate the toxicity of ROS-mediated plant defenses. The relative importance may be like ly dependent on the type of plant-microbe interactions and affected by the balance between ROS-generating and ROS-detoxifying systems in hosts and pathogens. The results der ived from my studies strongly not only support the host-selective toxin produced by A. alternata being important for fungal pathogenicity, but also that AP1-mediated detoxificat ion of ROS is necessary for successful colonization in citrus. Thus, t he results contribute to the understanding of how necrotrophic plant pathogens deal with toxi c ROS, which they may confront during infection.

PAGE 56

56 Table 2-1. Expression sequence tags (EST) that are possibly r egulated by AaAP1 were recovered from the wild type cDNA library after subtracted with that of the AaAP1 null mutant. Clone # Size (bp) Accession # Putative function E-value Closest blast match (accession #) 2 602 GS597457 Conserved hypothetical protein 6e-71 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001940113) 3 489 GS597458 Conserved hypothetical protein 1e-68 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001935364) 4 86 GS597459 Conserved hypothetical protein 5e-25 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001934325) 6 350 GS597460 Hypothetical protein 1e-08 Phaeosphaeria nodorum SN15 (EAT87598) 7 235 GS597461 Hypothetical protein 4e-21 Phaeosphaeria nodorum SN15 (XP_001797068) 8 566 GS597462 fatty acid synthase subunit reductase 1e-83 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001938586) 9 140 GS597463 RMM domain containing protein 1e-24 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001937566) 10 193 GS597464 Hscarg dehydrogenase 0.063 Talaromyces stipitatus ATCC 10500 (XP_002483465) 12 153 GS597465 50S ribosomal protein L3 7e-06 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001934243) 13 246 GS597466 Inorganic phosphate transporter 14 / Pi cotransporter 2e-19 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001933101) 15 113 GS597467 NADH-ubiquinone oxidoreductase 49 kDa subunit 0.14 Ajellomyces dermatitidia SLH14081 (EEQ78553) 16 227 GS597468 Conserved hypothetical protein 2e-13 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001936347) 18 296 GS597469 MFS transporter 1e-10 Asperigillus clavatus NRRL 1 (XP_001268842) 19 529 GS597470 MFS transporter 2e-40 Asperigillus clavatus NRRL 1 (XP_001268842)

PAGE 57

57 Table 2-1. Continued. 23 145 GS597471 Hypothetical protein 5.9 Aspergillus nidulans FGSC A4 (XP_681241) 25 232 GS597472 MFS transporter 6e-07 Asperigillus clavatus NRRL 1 (XP_001268842) 27 145 GS597473 Hypothetical protein 5.9 Aspergillus nidulans FGSC A4 (XP_681241) 28 231 GS597474 MFS transporter 4.5 Neosartorya fischeri NRRL 181 (XP_001257529) 35 485 GS597475 24-dehydrocholesterol reductase precursor 1e-54 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001940134) 36 151 GS597476 Cell wall biogenesis protein phosphatase 1e-11 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001931192) 41 263 GS597477 Scytalone dehydratase 3e-17 Cochliobolus heterostrophus (ABK63478) 48 200 GS597478 Aspartate aminotransferase 0.18 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001933414) 49 389 GS597479 Conserved hypothetical protein 5e-22 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001936201) 50 310 GS597480 Predicted protein 1e-19 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001933182) 54 582 GS597481 MFS gliotoxin efflux transporter GliA 6e-07 Microsporum canis CBS 113480 (EEQ30939) 57 240 GS597482 Putative efflux pump gene 0.065 Xylaria sp. BCC 1067 (EF456734) 58 262 GS597483 Conserved hypothetical protein 7.7 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001934450) 59 199 GS597484 Aspartate aminotransferase 0.18 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001933414) 62 401 GS597485 Non-ribosomal peptide synthetase 6e-07 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001930982) 65 78 GS597486 Conserved hypothetical protein 5e-15 Pyrenophora tritici-repentis Pt-1C-BFP (XP_001941440)

PAGE 58

58 Figure 2-1. Detection of lipid per oxidation and H2O2 in Minneola leaves inoculated with A. alternata (A) Lipid peroxidation was determined by the content of malondialdehyde (MDA) generated from th iobarbituric acid (TBA). Timecourse analyses of lipid peroxidation of citrus leaves after challenged with A. alternata (WT) or water only. (B) Detecti on of hydrogen perox ide in Minneola leaves inoculated with conidial su spension for 24 h was determined by staining with 3,3-diaminobenzidine (DAB) before any necrotic lesions were visible. A B

PAGE 59

59 Figure 2-2. Functional domains of AaAP1 in the tangerine pathotype of A. alternata (A) Schematic illustration of the putative AaAP1 containing 629 amino acids showing a basic region leucin zipper (b ZIP) domain, a trans cription factor PAP1, an Nterminal cysteine rich domain, a C-terminal cysteine rich domain and the position of the nucl ear export sequence (NES). (B) Alignment of bZIP domains, (C) n-CRD, or (D) c-CRD of AP-1 homolog proteins of C. heterostrophus C. albicans S. cerevisiae and U. maydis Upper letters and indicate that all proteins are identical ; whereas lowercase letters and colons (:) indicate that three or more proteins are similar. A B C D

PAGE 60

60 Figure 2-3. Targeted disruption of AaAP1 in A. alternata (A ) Schematic illustration of the split-marker strategy for AaAP1 gene disruption. (B ) Southern blot analysis of Spe I-digested genomic DNA of t he wild type (WT) and two putative disruption mutants (D1 and D2) were hybridized with a specific AaAP1 probe as indicated in A. (C) Nort hern blot analysis identified a 2.0-kb transcript from the wild type but not from two AaAP1 deletion strains, D1 and D2. (D) Southern blot hybridization of Spe1 -digested DNA isolated from the wild type, transformants (T 3 to T8) displaying resist ance to both hygromycin and H2O2, and an AaAP1 -complemented strain (Cp1) to an AaAP1 probe. A B C D

PAGE 61

61 Figure 2-4. The AaAP1 gene plays a crucial role in re sistance to oxidants. (A) Sensitivity test of the wild type, the AaAP1 null mutants (D1 and D2), and the complementation strains (Cp1 and Cp2) of A. alternata was determine by radial growth on PDA supplemented with different oxidants or compounds as indicated. MTT: methylth iazolyldiphenyl-tetrazolium bromide; SDS. Sodium dodecyl sulfate. (B) The toxicity of H2O2 to A. alternata was determined by the inability of the fungus to export Evans bl ue. Live cells export dye and remain clear; whereas dead cells stain blue. (C) Quantitative determination of conidial viability of A. alternata treated with or without H2O2 for 30 min. A B C

PAGE 62

62 Figure 2-5. The Altern aria alternata AaAP1 is required for H2O2 detoxification and expression of AaAP1 in response to oxidative st ress. (A) The wild type, the AaAP1 null mutant D1, and the complement ation Cp1 strains were cultured on potato dextrose agar, flooded with H2O2, and stained with 3,3diaminobenzidine (DAB) to form browni sh polymers. (B) Consumption of H2O2 by A. alternata strains was determined by monitoring a decrease of absorbance at 240 nm over time. The mock control contains no fungal hyphae. (C) Accumulation of the AaAP1 transcript in response to oxidative stress in A. alternata MND: menadione; t-BHP: tert -butyl-hydroperoxide; MTT: methylthiazolyldiphenyl-tetrazolium brom ide; RB: rose benga l; SDS: sodium dodecyl sulfate. A B C

PAGE 63

63 Figure 2-6. Oxidative stre ss -regulated nuclear localizat ion of AaAP1::sGFP. (A) Schematic representation of AaAP1::sGFP with an endogenous promoter. The putative NES region is indicat ed. (B) Nuclear localization of AaAP1::sGFP upon exposure to 0.01% H2O2 for 0, 20, 40, and 60 min. Samples were analyzed by fluorescenc e microscopy. 4-6-diamidine-2phenylindole (DAPI) fluorescence indicate s distribution of nuclei as indicated by arrows. B A

PAGE 64

64 Figure 2-7. AaAP1 regulat es the production of antioxidant activities in A. alternata Total proteins were extracted with cold phosphate buffer. The AaAP1 deletion strains D1 or D2 displayed reduced activi ties in catalase (A), peroxidase (B) superoxide dismutase, SOD (C), glut athione S transferase, GST (D), glutathione peroxidase, Gpx (E), glut athione reductase, Grx (F), and lignintype peroxidase (G), compared to the wild type (WT) and the complementation stra ins Cp1 or Cp2. a, b, and c were different groups ( p < 0.05). B A C D E F G a a a a a a a a a b a b a a b a a b b c c c c c c c b

PAGE 65

65 Figure 2-8. Identification of the genes that are regul ated by AaAP1. Total RNA prepared from the wild type (WT) and the AaAP1 -disrupted mutant (D1) was hybridized to a digoxigenin-labeled AaAP1 probe. Gel stained with ethidium bromide indicates relative loading of the RNA samples.

PAGE 66

66 Figure 2-9. The A. alternata Aa AP1 is required for pathogenicity on citrus cv. Minneola. (A) Pathogenicity was assayed on detached Minneola leaves inoculated with 5 l of conidial suspension (104 conidia/ml) from the wild type (WT), the AaAP1 -disrupted mutants D1 and D2, and th e complementation strains Cp1 and Cp2. (B) Quantit ative analysis of lesion formation on Minneola leaves inoculated with conidia suspension of A. alternata strains. (C) Fungal pathogenicity assayed on detached Minneola leaves uniformly sprayed with conidial suspension of A. alternata strains. (D) Development of necrotic lesions by the A. alternata WT and AaAP1 null mutants D1 and D2 on detached Minneola leaves with wounding prior to inoculation. The mock controls were treat ed with water only. B C D A

PAGE 67

67 Figure 2-10. Light microscopy of Minneola leaves inoculated with (A) the wild type and (C) the complement ation strains of A. alternata 2 dpi, revealing deformed plant tissues and fungal hyphae (Hp) within the plant tissues. (B) Inoculation of the AaAP1 -disrupted mutant did not s how destruction and fungal hyphae within the plant cells. Fungal hyphae (H p) and conidia (Cn) are indicated by arrows. A B C

PAGE 68

68 Figure 2-11. The A. alternata AaAP1 gene is not required for the production of hostspecific ACT toxin. (A) RNA purified from the wild type (WT), the AaAP1 null mutant (D1), and the complem entation strain (Cp1) of A. alternata was hybridized with an ACT biosynthetic gene probe. (B) Culture filtrates of the WT, D1, and Cp1 strains grown in modifi ed Richards medium (Kohmoto et al. 1993) were applied onto detached Minneol a leaves. (C) Spectrophotometric scanning of the ethyl acetat e crude extracted from WT and D1 strains. (D) Thin-layer chromatography (TLC) analys is of the ethyl acetate extract separated displaying two major bands with Rf 0.58 and Rf 0.53. (E) Detached Minneola leaves treated with Rf 0.53 bands recovered form silica gel and eluted with methanol, developing simila r necrotic lesions. The mock controls were treated with methanol (5 l) only. A B C D E

PAGE 69

69 Figure 2-12. NADPH oxidase inhibitors parti ally restored pathogenicity of the AaAP1 null mutant. Conidial suspension (5 l of 104 conidial/ml) of the AaAP1 null mutant was applied with or without NA DPH oxidase inhibitor, apocynin (APC) or diphenylene iodonium (D PI) onto detached Minneola leave. The inoculated leaves were incubated in a moist chamber for lesion development. The mock controls were treated with APC or DP I dissolved in dimethyl sulfoxide (DMSO).

PAGE 70

70 CHAPTER 3 THE FUS3-TYPE MITOGEN-ACTIVATED PR OTEIN KINASE AND THE REDOXRESPONSIVE AP1 REGULATOR FUNCTION COOPERATIVELY IN Alternaria alternata Mitogen-activated protein (MAP) kinases are involved in cellular signal transduction pathways and play diverse roles for differentiation, pathogenes is, and growth. In this study, a well-conserved Fus3 -type MAP kinase gene homolog, AaFUS3 from A. alternata was characterized. Ou r studies revealed that AaFUS3 is required for vegetative growth, conidiat ion, fungicide resistance, melanin biosynthesis, and penetration ability on it s citrus hosts. AaFUS3 deletion strains were highly resistant to salt stress and displayed altered activities in several hydrolytic enzymes. A mutant disrupted in both AaFUS3 / AaAP1 genes increased sensitivit y to 2,3,5-triiodobenzoic acid (TIBA), 2-chloro-5-hyd roxypyridine (CHP), and diethy l maleate (DEM) compared to the strain mutated at AaFUS3 or AaAP1 alone. Expression of AaFUS3 and AaAP1 as well as phosphorylation of AaFUS3 were also induced by TIBA, CHP, and DEM. Phosphorylation of AaFUS3, however, was negatively regulated by AaAP1. Furthermore, two putative MFS coding ge nes were regulated by both AaFUS3 and AaAP1. Thus, our results indicate that a synergistic regulatio n occurs between the FUS3-type MAP kinase and the redox-respons ive transcription regulator AaAP1 for diverse physiological functions. Introduction Lik e all living organisms, fungi are challenged by environmental changes. Thus, fungal pathogens may have evolved strategies to perceive chemical and physical signals from environments and effectively respond with intracellular physiological changes. In eukaryotic cells, the mitogen-activated protein (MAP) kinases have been

PAGE 71

71 shown to be capable of responding to a variet y of exterior stimu li. The MAP kinasemediated signaling pathway is required for re gulation of numerous cellular activities, such as mitosis, differentiation, and cell survival (Pelech and Sanghera 1992; Robinson and Cobb 1997). This signaling cascade consists of three serine/threonine protein kinases: MAP kinase kinase kinase (MAPKKK or MEKK), MAPK ki nase kinase (MAPKK or MEK) and MAP kinase (M APK). MAPKKKK phosphorylates MAPKK, which in turn phosphorylates and activates MA PK (Gustin et al. 1998; Ku ltz 1998). The MAP kinasesmediated signaling cascade is evolutionarily well-conserved from yeasts to mammals (Herskowitz 1995; Xu 2000). Ho wever, the biological f unctions of each component kinase are highly dependent on the lifestyles of the sp ecies and their environment (Bardwell 2006). In Saccharomyces cerevisiae several MAP kinase-mediat ed pathways involved in mating responses (Fus3-type MAPK), fila mentous growth (Kss1-type MAPK), cell integrity (Slt2-type MAPK) and osmotic stre ss response (Hog1-type MAPK) have been identified (Banuett 1998; Gustin et al. 1998; Herskowitz 1995). One of the best-studied MAP kinases is the Fus3/Kss1-type MAP ki nase which is responsible for the mating pheromone response, nitrogen star vation, and filamentous growth in yeasts. Both Fus3 and Kss1 pathways are regulated by Ste 20, MEKK (Ste11) and MEK (Ste7) (Madhani and Fink 1998) (Fig. 1-3). The Fus3-type MAP kinase homologs have recently been shown to play an important role for pathogenicity in various fungal pathogens, including Alternaria brassicicola (Cho et al. 2007), Botrytis cinerea (Zheng et al. 2000), Cochliobolus heterostrophus (Lev et al. 1999), Collectotrichun lagenarium (Takano et al. 2000),

PAGE 72

72 Fusarium graminearum (Jenczmionka et al. 2003), F. oxysporum (Pietro et al. 2001), Magnaporthe grisea (Xu and Hamer 1996), Pyrenophora teres (Ruiz-Roldan et al. 2001), Stagonospora nodorum (Solomon et al. 2005), Ustilago maydis (Mayorga and Gold 1999), and Verticillium dahlia (Rauyaree et al. 2005). In addi tion, Fus3-like MAP kinases are required for the formati on of conidia and/or appressoria in the fungal pathogens. The M. grisea PMK1 a Fus3 homolog, is essential for formation of appressoria and conidia (Xu and Hamer 1996). De letion of a Fus3 homolog, CHK1 in C. heterostrophus and PTK1 in P. teres resulted in poorly developed aer ial hyphae and affected the formation of both conidia and appressoria (Lev et al. 1999; Ruiz-Roldan et al. 2001). Disruption of BMP1 in gray mold fungus B. cinerea or FMK1 in F. oxysporum however, did not affect conidiation, yet compro mised fungal pathogenicit y (Zheng et al. 2000; Pietro et al. 2001). Fus3 MAP kinases also play important roles for production of cellwall-degrading enzymes (CWDE) and hydrolyt ic enzymes as evidenced in several phytopathogenic fungi (Cho et al 2007; Pietro et al. 2001). Previous studies have shown that YAP1like transcription regul ators are essential for A. alternata pathogenicity to citrus by detoxifyin g reactive oxygen species (ROS) (Lin et al. 2009; Yang et al. in press). In this Chapter, I characterized a Fus3 gene homolog, designated AaFUS3 ( A lternaria a lternata Fus3 -type MAP kinase) and revealed a critical role in pathogenesis. I also provided a possi ble link or synergistic interaction between AaFUS3 and AaAP1. Materials and Methods Fungal Strains and Growth Conditions The wild type EV-MIL31 s train of A. alternata (Fr.) Keissler used for transformation, mutagenesis, and conidia isolation has been pr eviously described (Lin et al. 2009).

PAGE 73

73 Cloning of AaFUS3 To obtain a Fus 3 MAP kinase homolog, a 0.5-kb DNA fragment was amplified with two primers MAPK-5F and MAPK-6R (T able A-1) from genomic DNA of A. alternata by using a Go-Taq DNA polymerase (Table A-1) (Promega). The resulting amplicon was cloned into a pGEM-T easy vector (Promega) for sequence analysis. The cloned gene was named AaFUS3 Subsequently, the entire AaFUS3 ORF sequences as well as its promoter region were amplif ied with two inverse primer s MAPK-98 and MAPK-293 from restriction enzyme-digested and self-ligated DNA templates. Sequence data from this chapter can be found in the EMBL/GenBank Data Librar ies under accession number GQ414506 ( AaFUS3 ). Identification of AaFUS3 Null Mutants To dis rupt AaFUS3 a 1.2-kb DNA fragment containing the entire AaFUS3 ORF was amplified with two pr imers MAPK-atg and MAPK-taa and cloned into pGEM-T easy to create T-AfMK1. A 2.2-kb HYG gene cassette under the control of the A. nidulans trpC promoter was amplified fr om pUCATPH (Lu et al. 1994) with the primers M13F and M13R, end-filled, and cloned into the Nco I site of T-AfMK1 to generate T-AfMKhyg. Two truncated HYG fragments fused with eit her 5 or 3 end of AaFUS3 were amplified, mixed, and transforme d into the wild type protoplasts A 2.4-kb frag ment encompassing 5 AaFUS3 and 3 HYG was amplified with the primer s MAPK-atg and hyg4; a 1.5-kb fragment containing 3 AfMK1 and 5 HYG was obtained with the primers MAPK-taa and hyg3 (Figure 3-1B). Genetic Complementation of AaFUS3 -Null Mu tant For genetic complementation, a 2.6-kb DNA fragment cont aining the entire AaFUS3 and its endogenous promoter region was amplified from genomic DNA with the

PAGE 74

74 primers MAPK-P1 and MAPK-taa using a hi gh fidelity PCR system (Roche Applied Science). The amplified pr oduct was co-transformed into a null mutant with the pCB1532 plasmid (Swe igard et al. 1997). Create Double Mutations at AaFUS3 and AaAP 1 Genes in A. alternata To disrupt AaAP1 gene in the AaFUS3 null mutant, a PCR fusion method was performed to create split-marker DNA fr agments (Fig. 3-9A). A 1.8-kb SU and a 1.7kb UR fragments overlapping within the acetolactate synthase gene cassette ( SUR ) were amplified from pCB1532 (Sweigard et al. 1997) with the primers SUR-1/DR3 and surR and the primers SUR-2/DF3 and surF, respectively. A 0.8kb DNA fragment containing the 5 AaAP1 was amplified with the prim ers yap1DF2 and SUR1-DR3. A 0.8-kb 3 AaAP1 fragment was amplified with the pr imers yap1DR2 and SUR2-DF3. In second-round PCR, a 2.6-kb DNA fragment containing 5 AaAP1 fused with UR was amplified with primers yapDF2 and surR from the PCR products described above. A 2.5-kb DNA fragment having 3 AaAP1 fused with SU was amplified wi th the primers surF and yap-DR2. PCR fragments were direct ly transformed into protoplasts prepared from an AaFUS3 null mutant strain of Alternaria alternata Fungal transformants were selected on the RMM medium with 5 g/ml of sulfonylurea, tested for the sensitivity to H2O2, and further confirmed by PCR analyses with two AaAP1 -specific primers yap1-atg and yap1-taa. Miscellaneous Assays for Enzymatic Activities Ass ays of endo-polygalacturase activi ties were carried out on the modified complete medium (Chen et al. 2005) by substituting glucose with 1% polygalacturonic acid as the sole carbon source. The pH of media was adjusted to 5 with 0.6 M Tris buffer. Fungal mycelia were blended and spr ead onto agar plates. T he inoculated plates

PAGE 75

75 were incubated at 27 for 3 days, overlaid with 1% hexadecyltrimethyl ammonium bromide, and examined daily for the formati on of clear halos around the fungal colonies (Hubbell et al. 1978). Proteolytic activities were determined by measuring the forma tion of clear zone around the fungal colonies on 10% skim milk medium (Difco Laboratories) dissolved in 0.05 M phosphate buffer (Ogryd ziak and Mortimer 1977). The alkaline and acid phosphatase activities were determined by the quantity of p nitrophenol liberated from 4p -nitrophenylphosphate (NPP) (Sigma) at 30 and measured at A410 (Dorn and Rivera 1996). Fungal stra ins were grown in 2-ml liquid minimal medium without phosphate for 3-4 hours. The culture filtrates were mixed with NPP (1:4 vol/vol) dissolved in 0.6 M Tr is buffer (pH 9.5) for analysis alkaline phosphatase, whereas the culture filtrates mixed with NPP (1:4 vol/vol) dissolved in 0.6 M acetate buffer (pH 4.8) for me asuring acid phosphatase activity. Assays for lipolytic activities using 1% Tween-20 as a subs trate were performed based on the appearance of visible precipitat ion around the fungal colonies grown on a Tween-20 agar medium (10 g pe ptone, 5 g NaCl, 0.1 g CaCl2 .H2O, 20 g agar, and 10 ml Tween-20 in 1000 ml) (Gopi nath et al. 2005). Extracellular cutinase activity was dete rmined by the formation of a yellow color after reaction with 5 mM para -nitrophenyl butyrate (P NPB) dissolved in 50 mM potassium phosphate (pH 5.0) (Stahl and Schafer 1992). Fungal isolates were grown on CM containing 0.1% 16-hydrox yhexadecanoic acid (HHDA; dissolved in 1% sodium acetate) for 5 days for induction before enz ymatic assays. The supernatant of each

PAGE 76

76 culture was mixed with PNPB solution (1:1, vol/vol), incubated for 1 h and measured at A405. One unit of cutinase releases 1 mol p -nitrophenol per minute. Extracellular activities of CWDEs were determined by measuring t he amounts of reducing sugar released from 1% polygalacturonic acid (PGA), 1% citrus pectin, 0.5% carboxymethyl-cellulose (CMC ), or 0.5% xylan (hemicellulose), and reacted with dinitrosalicylic acid (DNS) reagent under alka line conditions as described (Bailey et al. 1993). Enzyme activiti es were calculated using a standard curve established with glucose. One unit of enzyme is defined as that required to release 1 mol of glucose from the substrate per minute. Briefly, fungal isolat es were grown on modified CM containing a polysaccharide as the sole ca rbon source for 7 days. Four agar plugs bearing fungal mycelia (5 mm) were inoculat ed in 0.1 M sodium acetate buffer (pH 5.0) containing 0.5% CMC or xylan, or in Tris buffer containing 1% PGA or citrus pectin (pH 4.5 and 7.6) and incubated at 50 for 1 h. Culture filtrate (800 l) was mixed with 200 l DNS reagent, boiled at 95 for 5 min, cooled down to room temperature, and measured spectrophotom trically at A540. Melanin was extracted from myce lia with 2% NaOH boiled at 100 for 2 h and acidified to pH 2.0 with 5 N HCl. The pi gment was separated by centrifugation at 6000 g for 15 min, dissolved in 1 ml 2% NaOH, and measured at A405nm (Babitskaya et al. 2000). The enzyme activities of the wild type, the AaFUS3 mutants and the complementation strains were compared by Analysis of Variance (ANOVA ) of the SPSS statistical analys is software. A p -value of < 0.05 was interpreted as a significant difference.

PAGE 77

77 Pathogenicity Test Determination of fungal pathogenic ity wa s conducted on detache d Minneola leaves inoculated with mycelial mass. Briefly, fungal mycelia on PDA agar were transferred using sterile toothpicks onto detached Minneola le aves slightly away from the midribs. The inoculated leaves were inc ubated in a mist chamber at 27 for lesion formation. Detection of Phosphorylated AaFUS3 MAPK Fungal c ulture grown in complete medi um for 3 days was tr eated with 2.5 mM 2,3,5-triiodobenzoic acid (TIBA), 2.5 mM 2cholor-5-hydroxypyri dine (CHP), 0.1% diethyl maleate (D EM), or 0.1% H2O2 for 2 hours. Fungal my celia were collected by filtration through three layers of filter paper. Crude proteins were ex tracted by grinding fungal mycelia in liquid nitrogen, mixed with ice-cold extrac tion buffer (10 mM Tris-Cl pH 7.5, 150 mM NaCl, 5 mM EDTA, 10 mM NaN3, 1% Triton X-100), and collected via centrifugation at 10,000 g for 15 min at 4C. The protein samples were denatured in 2X SDS sample buffer [62.5 mM Tr is-HCl (pH 6.8), 2% SDS, 0.02% -mercaptoethanol, 20% glycerol, 50 mM DTT and 0.002% bromopheno l blue] by heating at 100C for 10 min. Proteins were fracti onated on a denaturing 12% SDS-pol yacrylamide gel and either stained with Comassie brilliant blue or electr oblotted onto a nitrocellulose membrane (Bio-Rad). Protein concentra tion was determined by a protein assay kit (Bio-Rad, Hercules, CA, U.S.A.). The transferred membranes were incubated in a blocking buffer [TBS (20 mM TrisHCl pH 7.6, 137 mM NaCl), and 0.1% Tween-20 with 5% w/v nonfat dry milk] for 1 h at room temperature and washed three time with TBS/T (T BS, 0.1% Tween-20). A rabbit anti-phosphate-p44/42 MAPK kinas e antibody (Cell signali ng Technology, Boston,

PAGE 78

78 MA) and Fus3 (y-40) rabbit pol yclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at a 1:1000 dilution was used as primary antibodies. The anti-rabbitIgG antibody conjugated horseradish peroxidase (HRP) (Cell signaling Technology) at a 1:2000 dilution was used as a secondary antibod y. Detection of the HRP was performed using LumiGLO (Cell signaling Technology) as a chemofluorescent substrate. Results Cloning and Characte rization of A Fus3 MAP kinase Gene Homolog in A. alternata of Citrus I have previously shown that the A. alternata AaAP1 gene, encoding a YAP1-like transcription factor is essential for resistan ce to reactive oxidative species (ROS) and fungal pathogenicity. In the current study, I cloned and characterized a Fus3 MAPK homolog from the tangerine pathotype of A. alternata using two primers that are complementary to the Amk1 gene of A. brassicicola (accession number AY515257; Cho et al. 2007). My goals we re to determine if oxidative stre ss tolerance is also regulated by a Fus3 MAP kinase signaling pathway and if such a regulation cr oss-talks with the YAP1 signaling pathway. Sequence analysis of a 0.5-kb DN A fragment revealed that the deduced amino acids have high similarity to many Fus3-type MAP kinase proteins. The cloned gene was designated AaFUS3 ( A lternaria a lternata Fus3 MAP k inase gene ). The A. alternata AaFUS3 gene contains a 1264-bp ORF interr upted with four introns of 50, 53, 53, and 49 bp. The conceptually pred icted AaFUS3 polypeptide has 74% to 98% similarity and 57% to 96% identity to a number of Fus3 MAP kinase homologs in fungi and yeasts. Phylogenetic analysis revealed that AaFUS3 is most similar to A. brassicicola AMK1, Pyrenophora teres PTK1, Bipolaris oryzae BMPK1, and Cochliobolus heterostrophus ChK1, yet has less similarity to M. grisea PMK1,

PAGE 79

79 Botryotinia fuckeliana BMP1, and Mycosphaerella graminicola (data not shown). Further analysis of AaFUS3 protein identified a conserve serine/threonine protein kinase domain (Fig. 3-1A) with an ATP-binding regi on (amino acids 26-50), a characteristic MAP kinase signature (amino acids 54-156) and a protein kinase active site (threonine/glutamic acid/tyrosine; TEY; amino acids 180-183). Targeted Disruption of AaFUS 3 of A. alternata To disrupt the AaFUS3 gene, split-marker fragments ca rrying truncated hygromycin phosphotransferase B gene ( HYG) flanked by 5 or 3 AaFUS3 sequences were amplified from the T-AfMKhyg disruption construct (Fig. 31B) and directly transformed into protoplasts prepared from the wild type strain of A. alternata In total, 2 of 15 transformants recovered from media containing hygromycin exhibited reduced radial growth and were considered putative AaFUS3 -disrupted mutants. Southern-blot hybridization of the wild ty pe genomic DNA digested with Xho I and Bgl II to an AaFUS3 probe identified an expected 1.0-kb hybridizing band. The putative AaFUS3 mutants (M1 and M2) had 3.0-kb hybridizing bands, resu lting from the inse rtion of the 2.2-kb HYG gene cassette (Fig. 3-1C). Northern-blot analysis also detected a 1.2-kb transcript in RNA prepared from the wild type but not from putative AaFUS3 mutants (Fig. 3-1D). Thus, I concluded that they are AaFUS3 null mutants. AaFUS3 Is Required for Vegetative Gro wth, Resistance to Copper Fungicide but Negatively Modulates Salt Tolerance Both M1 and M2 muta nts deleted at the AaFUS3 locus showed an average of 48% radial growth retardation on PDA compared to that of wild type (Fig. 3-2A and B). By contrast, the genetically complemented strains MCp1 and MCp2, containing a functional copy of AaFUS3 fully restored radial growth to wild type level (Fig. 3-2B). AaFUS3 null

PAGE 80

80 mutants were not sensitive to 0.1% H2O2, 0.002% tert-butyl-hydroxyperoxide, 14 mM KO2, 10 M hematoporphyrin, eosin Y, cercosporin phytotoxin, or diethylenetriamine/NO (Fig. B-1 and some data not shown). Howeve r, growth of the AaFUS3 deletion strains was partia lly restored by 1 M glucos e, but not by mannitol, sucrose, or sorbitol (Fig. 32C and Fig. B-1). Moreover, the AaFUS3 null mutants were highly resistant to 1 M KCl or NaCl, exhibiti ng faster growth compar ed with the wild type or the complementation stra ins (Fig. 3-2D and E). The AaFUS3 -disrupted mutants displayed hypersensitivity to c opper fungicide (Fig. 3-2F and G). AaFUS3 Is Essential for Conidiation Inves tigation through light mi croscopy revealed that the AaFUS3 -disrupted mutants were defective in conidiation. The wild type strain produced mature conidia with both cross and longitudinal septae (F ig. 3-3A). Howeve r, no fully developed conidia were observed from the deletion mutants whos e granulated hyphae were aberrant with distinct septae, often expanded in to spherical swellings occurring chains (Fig. 3-3B to F). Although growth of the AaFUS3 null mutants was restored by NaCl, KCl, or glucose, none of these compounds was capable of re storing conidiation (data not shown). Furthermore, applying exogenous cAMP at various concen trations also could not restore conidial formation to the null mut ants (data not shown) By contrast, the complementation strains MCp1 and MCp2 produc ed conidia morphologically similar to those produced by wild type (Fig. 3-3G and H). The AaFUS3 Is Required for Fu ngal Virulence Because the AaFUS3 null mutants produced no mature conidia, pathogenicity tests were performed on detached Minneola leaves us ing mycelial mass. The wild type and the genetically complemented strain Cp1 in duced conspicuous necrotic lesions on

PAGE 81

81 Minneola leaves at 4 dpi (Fig. 3-4A). In contrast, the leaves inoculated with the AaFUS3 -disrupted mutants (M1 and M2) failed to develop visible lesions (Fig. 3-4A). However, M1 and M2 strains in cited necrotic lesions similar to those of WT and MCp1 when leaves were wounded prio r to inoculation (Fig.34B). The results implicated AaFUS3 as being important for fungal penetration to citrus. When fungal inoculum was placed near the midribs, AaFUS3 deletion strains (M1 and M2) caused necrotic lesions in some of the leaves (Fig. 3-5A) but with considerably less mycelia mass (Fig. 3-5B). Expression of the Aa FUS3 Gene Is Highly Induced by Leaf Extracts To evaluate what fa ctors might affect AaFUS3 gene expression, Northern blot analysis was performed. The AaFUS3 transcript accumulated to relatively higher levels when the fungus was grown on potato dextrose agar or minimal medium (MM) containing leaf extracts from Mi nneola or rough lemon (Fig. 3-6). However, expression of the AaFUS3 gene was not affected by the types of nitrogen or by eliminating nitrogen or carbon sources from the medium (Fig. 3-6). AaFUS3 Regulates the Production of Hy dr olytic Enzymes and Melanin The extracellular activities of CWDEs, hydrolytic enzymes and melanin produced by the wild type, the AaFUS3 -disrupted mutants (M1 and M2), and the complementation (Cp1 and Cp2) strains were measured. Deletion of AaFUS3 resulted in a fungal mutant that produced higher levels of alkaline phosphat ase, lypolytic, and cutinase activities compared to the wild type and the genetically reverted strain s (Fig. 3-7A, B and C). By contrast, M1 and M2 produced lower endo-PG activities and melanin than WT, Cp1, and Cp2 (Fig. 3-7D and E) However, there were no signific ant differences in proteolytic,

PAGE 82

82 acid phosphatase, xylanase, pectinas e and cellulose activities in all Alternaria strains tested (data not shown). AaFUS3 and AaAP 1 Share Common Phenotypes and Confer Pleiotropic Drug Resistance The AaFUS3 -disrupted mutants were insensitive to H2O2, t -butyl-hydroperoxide, menadione, KO2, hematoporphyrin, cercos porin, and eosin Y (Fig. B-1 and some data not shown). I further tested whether or not AaFUS3 was required for thiol-oxidizing agent resistance. Unexpectedly, both AaFUS3 and AaAP1 null mutants were hypersensitive to 2-chloro-5-h ydroxypyridine (CHP; Matrix Scientific, Columbia, SC). This phenotype was discovered accidentally (Fig 3-8). Irrelevant to the authentic thioloxidizing compound, diamide (Sigma-Aldrich), 2-chloro-5-hydroxypyridine, is also named diamide by the carrier (Matrix Scient ific). Sensitivity tests revealed that the AaFUS3 null mutants were highly sensitive to 2,3,5-triiodobenzoic acid (TIBA), dithiobis2-nitrobenzoic acid (DTNB), rose bengal (R B), pyridoxine, pyri doxal-5-phosphate, diethyl maleate (DEM), and 2,6dichloroisonicotinic acid (I NA), and diamide (Fig. 3-8). Interestingly, the AaAP1 null mutants were also hypers ensitive to CHP, TIBA, DTNB, diethyl maleate, INA, and diamide (Fig. 3-8). The AaAP1 null mutants were slightly sensitive to RB and pyridoxal-5-phosphate. All genetically complemented strains expressing a functional copy of AaFUS3 in the M1 or AaAP1 in the AaAP1 mutant restored chemical resistance to wild type levels. Double Mutation at AaFUS3 an d AaAP1 Genes in A. alternata Caused Greater Sensitivity to TIBA or CHP To understand if a cooperative regul ation exists between AaFUS3and AaAP1mediated signaling pathways, a fungal strain carrying disruption at both AaFUS3 and AaAP1 genes was created. Transformation of split-marker fragments containing

PAGE 83

83 truncated acetolactate synthase gene ( SUR) flanked by either 5 or 3 AaAP1 sequence (Fig. 3-9A) into an AaFUS3 null mutant resulted in sulfurylurea-resistant transformants. Those transformants were screened by PCR with two AaAP1 -specific primers yap1-atg and yap1-taa. The primers pr oduced an expected 2.0-kb DN A fragment from genomic DNA of the wild type or the AaFUS3 -null mutant, whereas a 4. 7-kb band was amplified in a transformant pres umably disrupted in the AaAP1 gene (Fig. 3-9B). Sensitivity assays revealed that the double mutant exhi bited an elevated sens itivity to CHP and TIBA compared to the strain mutated at AaFUS3 or AaAP1 alone (Fig. 3-9C and D). The double mutant, similar to the AaAP1 null mutant, was also highly sensitive to oxidants (Fig. 3-9C and D). The results im plicated a synergistic association between AaFUS3 and AaAP1 Expression of the Aa FUS3 and AaAP1 Genes in Response to Chemical Stress in A. alternata Expression of the AaAP1 gene was increased w hen fungal cultures were shifted to a medium containing TI BA, CHP, DEM, or H2O2 (Fig. 3-10). Similarly, accumulation of the AaFUS3 gene transcript was also elevated in res ponse to these compounds (Fig. 3-10), even though the effects were not as great as those observ ed for the expression of the AaAP1 gene. Activation of AaFUS3 MAP Kinase Phosph orylation The phosphorylation levels of AaFUS3 were assessed by Western blot analyses using a phospho-p44/42 monoclonal antibody. T he results revealed that a 40 kDa band was detected in the samples of wild type (WT) and the AaAP1 null mutant (Y1), yet no signal was detected in the AaFUS3 (M1) or the AaFUS/AaAP1 (YM) deletion strain (Fig. 3-11A). After treating with CHP DEM, or low concentration of TIBA (0.1 mM or 1 mM),

PAGE 84

84 AaFUS3 was phosphorylated to higher levels (Fig. 3-11B and C). By contrast, when fungal cultures were treated with H2O2 or 2.5 mM TIBA, phosphorylation of AaFUS3 was decreased slightly or unchanged (Fig. 3-11B and C). Interestingly, disruption of the AaAP1 gene promoted phosphorylation of AaFUS3 (Fig. 3-11B), indicating AaAP1 suppressed AaFUS3 phosphorylation in A. alternata A Synergistic Regulati on of Expression of Tw o MFS Transporters by AaFUS3 and AaAP1 TIBA is an inhibitor for a transporter of the plant horm one indoleacetatic acid (IAA) (Prusty et al. 2004). Sensitivity of the AaFUS3 or AaAP1 null mutant to TIBA was probably attributable to defective functions of some membr ane transporters. Expression of three genes encoding putative membrane transporters was examined. The gene clones were recovered from the wild type cDNA library after subtraction with that of an AaAP1 null mutant using the suppression subtra ctive hybridization (SSH) (Chapter 2). Northern blot analyses revealed that expressions of the gene clones #19 and #54 encoding putative MFS were down-regulated in fungal mutants disrupted in the AaFUS3 or AaAP1 gene (Fig. 3-12). The gene clone #57 encodi ng a putative efflux pump was only down-regulated in the AaFUS3 null mutant (Fig. 3-12). Discussion MAP k inase-mediated signal transducti on pathways have been demonstrated to play diverse roles in fungi and yeasts (D ickman and Yarden 1999; Herskowitz 1995; Xu 2000). Three distinct MAP kinase pathways were identified in filamentous fungi. The pheromone response signaling pathway contro lled by the Fus3/KSS1-type MAPK is necessary for pathogenesis, mating, conidiation, and appressoria formation. The HOG1-type MAPK cascade controls resistance to high osmolari ty. The SLT2 is primarily

PAGE 85

85 involved in cell wall integrity, conidiation a nd pathogenicity. In this study, I characterized the function of A. alternata AaFUS3 gene which has high similarity to Fus3 of S. cerevisiae PMK1 of M. grisea, and many Fus3 homologs of other phytopathogenic fungi (Madhani and Fink 1998; Xu and Hamer 1996; Ruiz-Roldan et al. 2001; Mayorga and Gold 1999; Zheng et al. 2000). Deletion of the AaFUS3 gene rendered defects in fungal penetration, pathogenicity, and several physiological functions in A. alternata In A. nidulans and Colletotrichum lagenarium the HOG1-type MAP kinases ar e phosphorylated under high osmotic conditions or stresses induced by fludioxonil fungicides (Kojim a et al. 2004; Furukawa et al. 2005). AaFUS3 was shown to be responsible for resistance to copper fungicide in A. alternata. Moreover, the AaFUS3 null mutants displayed an increased resistance to salt stress. Possible interactions between FU S3and HOG1-type MAP kinases signaling pathways will be descri bed in Chapter 5. The AaFUS3 deletion strains failed to produce ma ture conidia. Applying exogenous cAMP did not restore conidi ation. The FUS3-type kinase has been characterized to be essential for pathogenicity in many fungal pathogens (Zheng et al. 2000; Lev et al. 1999; Pietro et al. 2001; Xu and Hamer 1996; Mayo rga and Gold 1999; Cho et al. 2007). It is not surprising that AaFUS3 also plays an important role in pathogenicity. It seems that the inability of the AaFUS3 null mutants to cause necrotic lesion was primarily due to the loss of penetration ability. As dem onstrated in the pr esent study, the AaFUS3 null mutants failed to cause any necrotic lesions unless the leaves were wounded prior to inoculation.

PAGE 86

86 Cell-wall-degrading enzymes (CWDE) have been shown to promote fungal virulence although the relative importance of CWDE varies among fungi (Rogers et al. 2000; ten Have et al. 1998; Tonukari et al 2000; Voigt et al. 2005). MAP kinases are also known to be required for expr ession of the CWDE-coding genes in F. oxysporum C. heterostrophus and A. brassicicola (Gomez-Gomez et al. 2001; Lev and Horwitz 2003; Cho et al. 2007). The AaFUS3 deletion strains exerted lo wer endo-PGase activity, even though endo-PGase is not required for the disease development in A. alternata (Isshiki et al. 2001). Similar resu lts were also reported in the Gpmk1 -disrupted mutant of F. graminearum (Jenczmionka and Schafer 2005). The product of AaFUS3 negatively regulated the production of lipolytic enzymes, alkaline phosphatases, and cutinase activities. In A. brassicola expression of the cutinase a nd lipase coding genes by the Amk1 null mutant was also slightly increased in axenic culture but decreased during infection (Cho et al. 2007). It appears that t he FUS3-type MA P kinase may have distinct functions as a negative or positive regul ator in the producti on of CWDE during saprophytic growth or plant infection (Cho et al. 2007). Disruption of the AaFUS3 gene yielded fungi that were highly sensitive to CHP, TIBA, DTNB, pyridoxine, py ridoxal-5-phosphate, and INA. These phenotypes were not previously found to be associated with t he FUS3-type MAP kinase signaling pathway. Interestingly, the AaAP1 deletion mutants defective in the oxidative stress response also displayed severe growth retardation in the presence of CHP, TIBA, and diethyl maleate (DEM). The AaFUS3 or AaAP1 gene transcript was up-r egulated after chemical treatments. Furthermore, AaFUS3 was phosphorylated to higher levels in response to TIBA, CHP, or DEM in the w ild type strain or in the AaAP1 deletion strain. Finally, the

PAGE 87

87 genetically modified mutant defective in both AaFUS3 and AaAP1 genes displayed an increased hypersensitivity to TIBA and CHP. These results implied that AaFUS3and AaAP1-mediated signaling pathways may function in an additive manner in A. alternata The toxicity of TIBA to the AaFUS3 or AaAP1 mutant strains might be likely due to the defect regulation for expression of the genes encoding membrane transporters or efflux systems (Gulshan and Moye-Rowley 2007) Indeed, I observed that two genes encoding putative MFS transporters were coordinately regulated by AaFUS3 and AaAP1. Taken together, this study demonstrates that the AaFUS3-mediated signaling pathway regulates physiological functions development, the CWDE production and pathogenicity of A. alternata Most importantly, I provide several lines of evidence to support the notion that a syner gistic regulation, by cont rolling membrane transporters, exists between the AaFUS3 MAP kinase-me diated signaling pathw ay and the redoxresponsive transcripti on factor AaAP1 in A. alternata

PAGE 88

88 Figure 3-1. The Altern aria alternata AaFUS3 conserved domains and targeted disruption of the AaFUS3 gene. (A) Schematic illustration of AaFUS3 consvered domains (B) Predicted physical maps of the AaFUS3 locus before and after disruption by inserting a 2. 2-kb hygromycin phosphotransferanse gene ( HYG ). (C) Southern blot hybridization of Bgl II/ Xho I digested genomic DNA of the wild type and two putative AaFUS3 disruptants (M1 and M2) to a DNA probe as indicated in B. (D) Northern blot analysis identifie d a 1.2-kb hybridizing band from the wild type, but not from RNA of two putative mutants M1 and M2. A B C D

PAGE 89

89 Figure 3-2. The AaFU S3 gene whose product is necessary for vegetative growth and involved in response to salt sensitiv ity and fungicide resistance. (A) Radial growth of the wild type and the AaFUS3 null mutant (M1 and M2) strains grown on potato dextrose agar for 7 days. (B to G) Growth rates of the A. alternata strains were determined by measuring the colony diameter over time. Each point is the mean the standard deviation of the colony diameter from two independent expe riments with at least three replicates. D E F G B C A

PAGE 90

90 Figure 3-3. The AaFU S3 -disrupted mutants are defective in conidiation. Conidia of the A. alternata wild type (A), AaFUS3 null mutants (B, C, D, E, and F), and complementation strains (G and H) we re examined with light microscopy. C H G F E D B A

PAGE 91

91 Figure 3-4. The AaFU S3 gene is required for fungal penetration and lesion development. (A) Inoculation of my celial mass of wild type, the AaFUS3 mutants (M1 and M2), and the comple mentation (Cp1) strains on unwound detached Minneola leaves at 4 dpi. (B ) Mycelial mass was inoculated onto pre-wounded Minneola leaves at 2 dpi. B A

PAGE 92

92 Figure 3-5. The Alternaria alternata AaFUS3 is required for full virulence. (A) Mycelial mass of wild type (WT), the AaFUS3 null mutants (M1 and M2), and the complementation strains (Mcp1) was inoculated on the midribs of unwound Minneola at 4 dpi. (B) Di ameter of fungal hyphae was determined by measuring the fungal growth on the leaves shown in A. a, b, and c were different groups ( p < 0.05). A B a a b c

PAGE 93

93 Figure 3-6. Expression of AaF US3 was up-regulated by leaf ex tracts. Northern blot hybridization of tota l RNA prepared from the wild type strain of A. alternata grown on PDA, minimal medium (MM), modified MM containing exogenous nitrogen, leaf extracts of Minneola or rough lemon, or no nitrogen or carbon source to an AaFUS3 probe. The RNA samples loaded in the gel were stained with ethidium bromide.

PAGE 94

94 Figure 3-7. AaFU S3 is involved in the production of hydrolytic enzymes, cutinase activities and melanin. (A) Lipolytic acti vities were assay ed by measuring the formation of visible precipitations around the fungal colonies on the Tween-20 agar plates. (B) Alkaline phosphatase was determined by measuring the p nitrophenol liberated from p -nitrophenyl phosphate (NPP) at 30 at A410 nm. (C) Cutinase acitivites were determined by formation of a yellow color after reaction with para -nitrophenyl butyrat e and measured at A405. (D) Endo-PG activities were determined by measuring the amounts of reducing sugar release from 1% polygalacturonic acid (PGA) and reacted with 1% hexadecyltrimethyl ammonium bromide. (E) Production of melanin pigment was measured at A459. a, b, c, and d were different groups ( p < 0.05). A B C D E a a a a a a a a d d a a a a d b c b b b c b c b c

PAGE 95

95 Figure 3-8. Sensitivity tests of the wild type, AaFUS3(M1 and M2) and AaAP1 (Y1 and Y2) null mutants, and their complem entation strains (Y Cp1, 2 and MCp1, 2) to different chemical s. Sensitivity of all A. alternata strains was determined by radial growth on PDA containi ng a chemical as indicated and was quantified by calculating by the percentage of growth reduction of AaFUS3 or AaAP1 -disrupted mutants compared to the wild type strain.

PAGE 96

96 Figure 3-9. Schematic illustration of a s trategy used for creation of an AaFUS3/AaAP1 double mutation and phenotypic assays. (A) Physical map of the split-marker fragments fused with an overlapping SUR (acetolactate synthase gene) for targeted disruption of the AaAP1 gene in an AaFUS3 null mutant. (B) Two primers yap1-atg and yap1-taa was used to amplify the genomic DNA from WT, the AaFUS3 null mutant, and a putative AaFUS3/AaAP1 double mutant. (C) Radial growth of fungal strain s on potato dextrose agar (PDA) in the presence of TIBA, CHP, H2O2, t -BHP, menadione was measured. (D) Percentage of growth reduction was calcul ated as a cumulative percentage of growth of WT and null mutants (M1: AaFUS3 ; Y1: AaAP1 ; YM: AaFUS3/AaAP1 ) grown on the sa me plate. B A C D WT M1 Y1 YM

PAGE 97

97 Figure 3-10. I nduction of the AaAP1 or AaF US3 gene transcript in A. alternata Northern blot hybridization of to tal RNA with a di goxigenin-labeled AaFUS3 or AaAP1 probe. The wild type isolate wa s grown on PDA with a layer of cellophane for 3 days and shifted to medi a containing TIBA, CHP, DEM, or H2O2. The mock treatment (WT) contains RNA from fungal cu lture shifted to the nonamended PDA. A gel stained with ethidium bromide is shown to indicate the relative amount s of the RNA samples.

PAGE 98

98 Figure 3-11. Immunological det ec tion of AaFUS3 phosphorylat ion. (A) Western blots of total proteins of the WT, the AaFUS3 null mutant (M), the AaAP1 -disrupted mutant (Y), and the AaFUS3/AaAP1 double mutant (YM) were probed with anti-dually phosphorylated P 44/42 and anti-FUS3 ant ibodies. (B) Overall proteins of the AaAP1 null mutant or WT grown on CM in the presence of TIBA, CHP, DEM, and H2O2 were probed with anti-phospho P44/42 or antiFUS3 antibodies. (C) Western blotti ng of the wild type grown on CM containing 0.1, 1, or 2.5 mM TIBA we re detected by using anti-phospho P44/42 or anti-FU S3 antibodies. B C A

PAGE 99

99 Figure 3-12. A synergist i c regulation of two MFS membrane transporters coding genes by AaFUS3 and AaAP1. Total RNA prepared fr om the wild type, the AaFUS3 null mutant, and the AaAP1 -disrupted mutant was hy bridized to digoxigeninlabeled probes as indicated.

PAGE 100

100 CHAPTER 4 DISTINCT AND SHARED ROLES OF THE TWO-COMPONENT HISTIDINE KINASE (AaHSK1)AND THE MITOGEN-ACTI VATED KI NASE (AaHOG1)-MEDIATED SIGNALING PATHWAYS IN RESPONSE TO OSMOTIC STRESS AND FUNGICIDES IN Alternaria alternata The AaHSK1 gene, encoding a group III histidine kinase and the AaHOG1 gene encoding a mitogen-activated prot ein kinase (MAPK) of Alternaria alternata were cloned and characterized. Mutational inactivation in AaHSK1 or AaHOG1 resulted in fungal strains displaying distinct phenotypic alterations, yet sharing several common deficiencies as well. The AaHSK1 null mutant acquired resist ance to the dicarboximide and phenylpyrrole fungicides, and exerted hypersensitivity to sugar but not salt osmotic stress. In contrast, AaHOG1 played a moderate role in fungicide sensitivity. AaHOG1 was required for resistance to oxi dants and salts but not sugars. The AaHOG1 null mutants were impaired in virulence, while the AaHSK1 mutants remained pathogenic to citrus. Fungal mutants disrupted at AaHSK1 or AaHOG1 were hypersensitive to 2chloro-5-hydroxypyridine (CHP) or 2, 3,5-triiodobenzoic acid (TIBA). Unlike Neurospora crassa or Aspergillus nidulans the A. alternata two-component AaHSK1-mediated signaling pathway had little connection with the AaHOG1 MAPK pathway for osmotic, oxidative stress, and fungicide sensitivit y. Yet, both AaHSK1 and AaHOG1 shared common functions for resistance to CHP or TIBA. The results implicate a complex regulatory network in response to environmental stimuli in A. alternata Introduction The phos phorelay transduction pathway involving two-component histidine kinases (HK) is essential for perception and adaptati on to the environments in bacteria, fungi and plants (Alex and Simon 1994; Chang et al. 1993). Saccharomyces cerevisiae has a single HK, yet Schizosaccharomyces pombe contains three HKs. The whole genome

PAGE 101

101 analyses in filamentous fungi have revealed that Neurospora crassa Cochliobolus heterostrophus Fusarium verticillioides and Botrytis cinerea contain multiple HK proteins that can be divided into 11 clas ses (Catlett et al 2003). Among them, six groups including III, V, VI, VIII, IX, and X HK s are commonly found in many filamentous fungal species (Catlett et al. 2003). Except for group III HK, the function of other histidine kinases remains largely unknown. Group III histidine kinase such as the OS1 (also known as NIK1) in Neurospora crassa has been characterized in relation to osmo tic resistance and fungicide sensitivity. This group HK contains unique HAMP (H Ks, a denylate cyclases, m ethyl-accepting chemotaxis proteins, and p hosphatases) domain repeats in the N-terminal region (Catlett et al. 2003). Di sruption of group III histidine kinase homologs in Alternaria brassicicola Alternaria longipes C. heterostrophus B. cinerea Magnaporthe grisea, and N. crassa created fungal mutants t hat were resistant to fludioxonil fungicide but sensitive to osmotic stress (Avenot et al. 2005; Dongo et al. 2009; Luo et al. 2008; Motoyama et al. 2005; Ochiai et al. 2001; Oshima et al. 2001; Yoshimi et al. 2005). Furthermore, a point mutation within the HAMP domain of BcOS-1 in B. cinerea resulted in fungi highly resistant to decarboxyimide fungicide and se nsitive to osmotic stress (Oshima et al. 2001). Similar phenotypes were also found in N. crassa and C. heterostrophus mutated by changing a single amino acid in the HAMP repeats (Ochiai et al. 2001; Yoshimi et al. 2004). In addition to HK, cellular signaling pathways mediated by MAPKKK-MAPKKMAPK cascades have also been well characte rized in many fungi (Dickman and Yarden 1999; Lengeler et al. 2000; Xu 2000). However, the activators acting in the upstream

PAGE 102

102 cascade and the regulatory mechanisms of phos phorylation of MAPKs in filamentous fungi remain unclear. In budding yeast Saccharomyces cerevisiae the HOG1-type MAP kinase signal pathway is involved in adaptati on to high-osmolarity response. This is regulated by two osmosensors: the sole two-component histidine kinase Sln1p and the membrane protein Sho1 (Fig. 1-3). Sln1p is required for osmotic adaption through the Sln1p-Ypd1p (a histidine phosphotransfer )-Ssk1p or Skn7p (response regulator) pathway (Posas et al. 1996; Li et al 1998). Under normal osmolarity, Sln1p is autophosphorylated and subsequent ly activates Ypd1p and Ssk1p by a phosphorelay mechanism (Maeda et al. 1995; Posas and Sa ito 1998). The phosphorylated Ssk1p is inactive. In contrast, high os molarity results in Sln1p in activation and prevents Ssk1p from being phosphorylated. The unphosphorylated Ssk1p can activate Ssk2/22p (MAPKKK) that subsequently activates Pbs2p and Hog1 (M aeda et al. 1995; Posas and Saito 1998). The osmosensing receptor S ho1 triggers Hog1 ac tivity through the stimulation of Ste11p (MAPKKK) and Pbs2p (M APKK) in response to high osmotic stress (Maeda et al. 1995). In S. pombe the H2O2-dependent activation of the Hog1 ortholog (Sty1) pathway is also activated by two-component sensor kinases, Mak2 and Mak3, in response to the oxidative stress (Samejima et al. 1997; Shieh et al. 1998). Several studies in several filamentous f ungi have shown that group III HK often regulates HOG1 during osmosensing (D ongo et al. 2009; Yoshimi et al. 2005). The HKHOG1 signaling pathway is also responsible fo r fungicide sensitivity (Kojima et al. 2004). However, this regulation may vary among yeasts and fungal species. For example, disruption of the hik1 gene (a group III HK homolog) in the rice blast fungus, M. grisea resulted in fungi with an increased sensitivity to sugar but not salt stress (Motoyama et

PAGE 103

103 al. 2005). The N. crassa os-1 mutants or the C. heterostrophus dic1 deletion strains, likely defective in the HK-Hog1 pathway, we re sensitive to both salts and sugars (Schumacher et al. 1997; Yoshimi et al 2004). However, the HOG1-like MAP kinase Sak1 of Botrytis cinerea was negatively regulated by the histidine kinase Bos1 and was not involved in fungicide sensitivity (Liu et al. 2008). For some fungi such as M. grisea building intracellular osmotic pressure in appressoria is critical for penetration into host plant (de Jong et al. 1977; Howard and Valent 1996; Money and Howard, 1996). Generati on of turgor pressure in appressoria has been documented to be mediated via the HK-HOG1 regulatory mechanism in M. grisea However, deletion of the osm1 gene, a Hog1 homolog, in M. grisea did not alter fungal pathogenicity (Dixon et al. 1999). Unlike M. grisea the B. cinerea BOS1 gene encoding a HK like protein is required for full virulence (Viaud et al. 2006). Thus, the pathological function of group III histidine ki nase in conjunction wi th HOG1 MAP kinase may rely on different lifestyle of each species and their hosts. Previous studies hav e shown that the A. alternata AaFUS3 MAP kinase was not involved in the oxidative response (Lin et al. 2010). However, Aa FUS3 cooperating with the redox-responsive AaAP1 transcription regul ator confers resistance to diverse chemicals. Little is known about the rela tionships between HOG1 MAPK and histidine kinase in A. alternata In the present study, I cl oned and characterized two genes: AaHSK1 and AaHOG1, encoding a Group III two-com ponent HK and a HOG1 MAP kinase, respectively, in the tangerine pathotype of A. alternata I provided experimental evidence to define their roles for pathogeni city, cellular responses to osmotic and

PAGE 104

104 oxidative stresses, sensitivity to fungicides, and resistance to multiple drugs in this important citrus pathogen. Materials and Methods Cloning of AaHSK1 and AaHOG1 The AaHSK1 gene was amplified from genomic DNA of the A. alternata with two primers HSK-2 and HSK8 that are complementary to a group III histidine kinase gene of A. brassicicola (Table A-1). The amplified fragm ent was cloned into pGEM-T easy vector (Promega) for sequence analysis. The 5AaHSK1 as well as its promoter region were amplified with two inverse primer s HSK-69 and HSK-136 from restriction enzymedigested and self-ligated DNA templates. The 3-end of AaHSK1 gene was obtained by PCR with two inverse primers HSK-548 and HSK-564 (Table A-1). The primers Hog-1Fand H og-1R were used for PC R amplification of an AaHOG1 gene fragment. The full-length AaHOG1 and its 5 and 3-flanking sequences were obtained with two sets of inverse primers: Hog-256R paired with Hog-316F and Hog1001R paired with Hog1068F (Table A-1). Construction and Identification of the AaHSK1 and AaHOG1 -Null Mutan ts For AaHSK1 gene disruption, a 1.3-kb DNA fr agment was amplified with two primers Hsk-2 and Hsk-2374 and cloned into pGEM-T easy vector to generate THskDM. The AaHSK1 disruption construct, T-HskDMhyg was created by inserting the hygromycin phosphotransferase gene ( HYG ) cassette at a Bgl II site of T-HskDM. A 2.2-kb DNA fragment containing 5 AaHsk1 ::5 HYG fusion DNA was amplified with the primers HSK-2 and hyg3. A 2.1kb fragment encompassing 3 AaHsk1 and 3 HYG was amplified with two primers HSK-2374 and hy g4. The amplified fr agments were mixed, and transformed into the wild type protoplasts (Fig. 4-2A).

PAGE 105

105 To disrupt AaHOG1 a PCR fusion method wa s carried out to create AaHOG1/HYG split-marker fragments as illustrated (Fig. 4-3A). The HY/g and h/YG of HYG were amplified using the primers M13R/hyg3 and M13F /hyg4 primers, respectively, from pUCATPH. The 5 AaHOG1 was amplified with the pr imers Hog-316F and Hog-F2. The 3 AaHOG1 was amplified with Hog-tr and Hog-F3 (Fig. 4-3) In second round PCR, a 2.2-kb DNA fragment (5 AaHOG1 :: h/YG ) was amplified with primers Hog-316F and hyg4, whereas a 1.8-kb HY/g ::3 AaHOG1 was amplified with pr imers Hog-tr and hyg3. The putative AaHSK1 and AaHOG1 disruptants were screened fo r sensitivity to 1 M glucose and 1 M NaCl, respec tively, and further confirmed by Southern and Northern blot analyses. Genetic Complementation of an AaHS K1 -Null Mutant For genetic complementation, a 5.7-kb DNA fragment cont aining the entire AaHSK1 gene and its endogenous promoter was amplified with the primers HSK-P1 and HSK-tga using a high fidelity DNA pol ymerase (Roche Applied Science). The amplified product was co-transformed with a pCB1532 plasmid (Swe igard et al. 1997) into protoplasts prepared from an AaHsk1 null mutant. Molecular Techniques An AaHSK1 cDNA fragment was amp lified with the primers Hsk-up and Hsk-tga. A cDNA fragment of AaHOG1 was amplified with the primers Hog1-atg and Hog-tr. Both AaHOG1 and AaHSK1 DNA probes were labeled with digoxigenin (DIG)-11-dUTP (Roche Applied Science) by PCR with gene-sp ecific primers Hog-316F / Hog-F2 or Hsk2/Hsk-2374, respectively.

PAGE 106

106 Detection of Phospho-AaHOG1 MAPK Fungal s trains of A. alternata were grown in complete medium (CM) for 3 days at room temperature, treated with 0.6 M NaCl, 0.05% H2O2, or 1 g/ml iprodione, and incubated for additional 2 hours. A rabbi t anti-phosphate-p38 MAPK kinase antibody (Cell Signaling Technology, Boston, MA) and anti-Hog1 rabbit polyclonal antibody (Santa Cruz Biotechnology) at a 1:1000 dilution were us ed as primary antibodies. The anti-rabbitIgG antibody conjugated horser adish peroxidase (HRP) (Cell Signalling Technology, Boston, MA) at a 1:2000 dilution was used as a secondary antibody. Nucleotide Sequence Sequenc e data from this chapter can be found in the EMBL/GenBank Data Libraries under Accession no. GQ414508 ( AaHSK1 ) and GQ414509 ( AaHOG1 ). Results Cloning of the AaHS K1 and AaHOG1 Genes of A. alternata A 3.7-kb DNA fragment was amplified from A. alternata genomic DNA. Sequence analysis revealed that the deduced amino acid sequence shares high similarity to many group III histidine kinases and the cloned gene was named AaHSK1 By comparing with the cDNA sequences, the overall AaHSK1 open reading frame (ORF) contains 4275-bp nucleotides interrupted with six introns of 50, 49, 55, 49, 51, and 58 bp. The deduced 1329 amino acids showed 96% to 99% similarity to two-component histidine kinases of A. longipes A. brassicicola or C. heterostropus and 76% similarity to Os1 (NIK1) of N. crassa The AaHSK1 polypeptide has a HAMP repeat domain (h istidine kinase domain, a denylyl cyclases, m ethyl-accepting chemotaxis proteins, and p hosphatases), a response regulator domain, a histidine kinase-like ATPase domain, and a signal receiver domain (sensor domain) (Fig. 4-1A).

PAGE 107

107 The primers Hog-1F and Hog-1R amplified a 0.9-kb DNA fragment from the tangerine pathotype of A. alternata The predicted amino acid sequence displayed high similarity to many HOG1-t ype MAP kinases of yeasts and fungi and thus was designated AaHOG1 (A lternaria a lternata HOG1 -like gene). AaHOG1 contains a 1409 bp ORF interrupted by seven introns of 50, 50, 49, 48, 50, 47, and 47 bp. AaHOG1 contains several conserved domains: a protein kinases ATP-binding region (amino acids 26-50), a MAP kinase (amino acids 55153) and a serine/threonine protein kinase signature (amino acids 137-149) (F ig. 4-1B). AaHOG1 is most similar to the HOG1-like MAP kinases of Pyrenophora tritici-repentis (XP_001935555) and Phaeosphaeria nodorum (QOU4L8), showing 98 to 100% identities. Targeted Disruption of AaHSK1 and AaHOG1 in A. alternata Trans formation of split AaHSK1/HYG fragments into the wild type strain of A. alternata recovered 19 transforma nts from medium containi ng hygromycin. Among them, four were highly sensitive to 1 M gl ucose and were considered as putative AaHSK1 disruption mutants. Souther n-blot analysis revealed that hybridization of Xho I-digested genomic DNA of four put ative disruptants to an AaHSK1 probe detected a 4.7-kb hybridizing signal, owing to the integration of HYG cassette. In contrast, a 2.5-kb hybridizing band was detected in the wild ty pe DNA (Fig. 4-2B). Furthermore, Northernblot analysis further confirmed that the four putative dis putants did not accumulate any detectable transcript of the AaHSK1 gene (Fig. 4-3C), indicating that they are AaHSK1 null mutants. Transformation of two fr agments containing truncated HYG flanked by either 5 or 3 AaHOG1 sequence (Fig. 4-3A) into wild type pr otoplasts identified three putative mutants out of four transfor mants recovered. These three mutants were highly sensitive

PAGE 108

108 to 1 M NaCl and KCl and were considered as the putative AaHOG1 -disrupted mutants. Southern-blot hy bridization of Nru I and Eco RV-digested genomic DNA isolated from three AaHOG1 mutants and wild type to an AaHOG1 -specific probe revealed very different hybridizing pattern s (Fig. 4-3B), indicating su ccessful integration of HYG within AaHOG1 Northern-blot analysis further confirm ed that the putative disruptants did not produce AaHOG1 transcript (Fig. 4-3C). Phenotypic Characterization of the AaHS K1 and AaHOG1 Null Mutants Sensitivity tests revealed that the AaHSK1 -disrupted mutants were highly sensitive to glucose, sucrose, sorbit ol, and mannitol, but not to tert -butyl-hydroxyperoxide, H2O2, menadione, NaCl, or KCl (Fig. 4-4A). The complem ented strains by expressing a functional AaHSK1 fully restored the defec tive functions to wild type levels. In contrast, the AaHOG1 -impaired mutants displayed hyper sensitivity to NaCl, KCl, H2O2, menadione, or tert -butyl-hydroxyperoxide but not to sugar stre ss (Fig. 4-4B). The AaHOG1 null mutants did not produc e protoplasts (see details in Chapter 5) and was not complemented. Interestingly, both AaHSK1 and AaHOG1 deletion strains were highly sensitive to TIBA and CHP (See details in Chapter 5). The AaHSK1 and AaHOG1 null mutants were tested for sensitivity to dicarboximide (iprodione and vinclozolin) and phenylpyrrole (f ludioxonil) fungicides. The wild type A. alternata was extremely sensitive to iprodione, vinclozolin, or fludioxonil. However, deletion of the AaHSK1 gene resulted in fungi highly resi stant to these fungicides (Fig. 4-5). The AaHOG1 null mutant was only slightly resist ant to those fungicides (Fig. 4-5), suggesting a limited link between AaHSK1 and HOG1-type M AP kinase signaling pathways in the context of fungicide sensitivity.

PAGE 109

109 AaHOG1 but not AaHSK1 Is Required for Fungal Pathogenicit y Pathogenicity assays performed on det ached Minneola leaves using point inoculation revealed th at wild type, the AaHSK1 null mutants and the Cp1 strain all incited necrotic lesions at 3 days posti noculation (dpi) on wounded or unwounded leaves (Fig. 4-6A). By contrast, inoculation of the AaHOG1 -disrupted mutants did not induce necrotic lesions (Fig. 4-6B). Sim ilar results were observed using a spray inoculation technique, indicating that Aa HOG1, but not AaHSK1, promotes fungal pathogenicity (Fig. 4-6C). AaHOG1 Phosphorylation Is Regulated by AaHSK1 An anti-phos phate-p38 MAPK ki nase antibody was used to detect phosphorylation of AaHOG1 MAP kinase. Co mpared with the untreated c ontrol, AaHOG1 was highly phosphorylated in wild type after being treated with 0.6 M NaCl, 0.05% H2O2, or 1 g/ml Iprodine fungicide (Fig. 4-7). Inte restingly, disruption of the AaHSK1 gene apparently reduced AaHOG1 phosphorylation (Fig. 4-7). Discussion euk aryotic cells can sense and respond to osmotic stress. This response plays important roles in growth and pathogenicity in filamentous fungi (de Jong et al. 1977; Howard and Valent 1996; Viaud et al. 2006). Cellular adaptation to changes in osmolarity has been investigated primarily in yeasts or N. crassa (Maeda et al. 1995; Posas and Saito 1998; Samejima et al. 1997; Schum acher et al. 1997; Shieh et al. 1998; Zhang et al. 2002), and osmotic response wa s poorly understood in plant pathogenic fungi. In the current study, I identified the AaHSK1 gene encoding a group III twocomponent histidine kinase and the AaHOG1 gene encoding a HOG1-type MAP kinase. Genetic analysis defined their functions in the signal transduction pathways related to

PAGE 110

110 osmotic stress in A. alternata Similar to the N. crassa OS-1 histidine kinase, the A. alternata AaHSK1 contains a HAMP repeat, a sensor and a response regulator conserved domains that are likely associ ated with fungicide sensitivity and osmotic resistance. The A. alternata AaHOG1 MAP kinase belonging to the protein kinase C superfamily was shown to be involved in res ponse to oxidative, osmotic, and fungicide stresses. In N. crassa the OS-1-mediated signal transduction pathway comprised of os-1 ( NIK), os-2 ( HOG1-like ), os-4 (MAPKKK ), and os-5 (MAPKK ), has been shown to be involved in response to the dicarboximi de fungicides and osmotic adaptation (Noguchi et al. 2007). In contrast, the AaHSK1 (OS-1 homolog) and the AaHOG1 (OS-2 homolog)-mediated signal pathways seems to have very different regulatory functions in response to environmental stimuli in A. alternata The N. crassa os-1 or os-2 mutants are hypersensitive to both salts and sugars but are resistant to fludioxonil fungicide (Noguchi et al. 2007; Schumacher et al. 1997; Zhang et al. 2002). However, disruption of the AaHSK1 gene in A. alternata resulted in fungi that were highly sensitive to glucose, sucrose, sorbitol, and mannitol, but not to NaCl and KCl. Disruption of the AaHOG1 gene, however, created fungi hypersensitive to NaCl, KCl, and oxidants, but insensitive to non-ionic osmoticant s. The results indicated that A. alternata may have the ability to distinguish sugar from salt stimuli to cope with osmolarity conditions, using AaHOG1 or AaHSK1-mediat ed signaling pathway. The AaHSK1 null mutants showed an elevated resistance to the dicarboximide and the phenylpyrrole fungicides. However, the AaHOG1 -disrupted strains were slightly re sistant to these antifungal agents compared to wild type. Unlike other fungal syst ems (Furukawa et al. 2005; Noguchi et al.

PAGE 111

111 2007), group III histidine kinase-mediated fungic ide sensitivity is not fully associated with the AaHOG1 MAP kinase signaling pathway in A. alternata Thus, there may be one or more unknown signal rout es under control of AaHSK1 for fungicide sensitivity. However, as demonstrated later (Chapter 5), both the AaHSK1 and AaHOG1 disruption mutants were hypersensitive to TIBA and CHP, suggesting the ex istence of shared functions between AaHSK1 and AaHOG1-signaling pathways. Indeed, a MFStransporter coding gene (clone # 19) was f ound to be commonly regulated by AaHSK1 and AaHOG1 (Chapter 5). Western blot analyses indicated that the AaHSK1 histidine kinase interferes with AaHOG1 phosphorylation in A. alternata. Unlike AaHOG1, AaHSK1 plays little or no role in resistance to H2O2, KCl and NaCl. In Aspergillus nidulans and N. crassa the Hog1 MAP kinase-mediated signa ling pathway is primarily activated by the group III two-component histidine kinase in response to osmotic stress or fungicides (Furukawa et al. 2005; Noguchi et al. 2007). Accumulation of glycerol in appressoria by the rice blast fungus is vital for generation of mechanical force that is absol utely required for penetration to the leaf surfaces (de Jong et al. 1997; Money and Ho ward 1996). However, turgor generation and glycerol accumulation in appr essoria were not controlled by OSM1 (a HOG1 ortholog) in M. grisea ; the OSM1 gene deletion strain was pathogenic (Dixon et al. 1999). Inactivation of a histidine kinase gene ( HIK1 ) in M. grisea had no effects on pathogenicity either (Motoyama et al. 2005), even though both OSM1 and HIK1 were required for resistance to high osmolarity. However, the hi stidine kinase gene homolog, BOS1, of the phytopathogenic fungus Botrytis cinerea is essential for colonization to its

PAGE 112

112 host (Viaud et al. 2006). HOG1 homologs have been studied in many phytopathogenic fungi, including M. grisea Bipolaria oryzae, B. cinerea and Cryphonectria parasitica for their roles in pathogenicit y. The Hog1 homologs in B. cinerea and in Cryphonectria parasitica are essential for fungal pathogenicity (Park et al. 2004; Segmuller et al. 2007). However, disruption of a HOG1 homolog in M. grisea or B. oryzae did not alter fungal virulence (Dixon et al. 1999; Moriwaki et al. 2006). In A. alternata AaHSK1 played no role in virulence. In contrast, AaHOG1 -disruptants failed to incite any visible necrotic lesions even though citrus leaves were pr e-wounded. AaHOG1 is likely involved in oxidative detoxification of ROS, similar to the previously characte rized redox-responsive AaAP1 regulator. The conserved HK-HOG1 signaling transduc tion pathway often functions together in the same cascade in many fungi (Furukawa et al. 2005; Noguchi et al. 2007). In A. alternata, the AaHSK1-mediated sugar resistance has little connecti on with the HOG1 pathway. Similarly, resistance to salt stress primarily modu lated by AaHOG1 is also not effected by mutation of the AaHSK1 hist idine kinase. The di carboximide and the phenylpyrrole fungicides mainly target AaHSK1 rather t han AaHOG1. Thus, it becomes apparent that A. alternata has evolved unique mechanism s to adapt to environmental stresses.

PAGE 113

113 Figure 4-1. Functional domains of AaHSK1 and AaHOG1. (A) Schematic illustration of AaHSK1 showing several conserved dom ains similar to group III histidine kinases of fungi. They include a repeat HAMP domain, a response regulator, and a receiver domain. (B) Physical m ap of AaHOG1 belonging to a protein kinase C superfamily contains a protein kinase ATP-binding region (I: aa 26 to 50), a MAP kinase signature (II: aa 55-153) and a serine/threonine protein kinase active site (III: aa 137-149). B A

PAGE 114

114 Figure 4-2. Gene replacement of AaH SK1 in A. alternata (A) Schematic illustration of generation of the truncated AaHSK1 gene fused with an overlapping hygromycin phosphotransferase gene ( HYG ) under control by the Aspergillus nidulans trpC promoter for AaHSK1 gene replacement using a split-marker approach. (B) Southern bl ot hybridization of Xho I digested genomic DNA with the AaHSK1specific probe as indicated in (A). (C) Northern bl otting of RNA prepared from the wild type (WT) and 4 putative AaHSK1 mutants with an AaHSK1 probe. A gel image stained with et hidium bromide indicates the relative amounts of RNA samples. B C A

PAGE 115

115 Figure 4-3. Targeted disruption of the Aa HOG1 gene in A. alternata (A) Predicted physical maps of the AaHOG1 locus before and after targeted disruption by hygromycin phosphotransferanse gene ( HYG ). (B) DNA blot of Nru I and Eco RV double digested genomic DNA of the wild type (WT), an ectopic strain (N), and three putative AaHOG1 disruptants, was hy bridized with an AaHOG1 probe as indicated. (C) Northern hybridiz ation of fungal RNA isolated from the WT, N and three putative disruptants with an AaHOG1 probe. B C A

PAGE 116

116 Figure 4-4. Phenotypic c haracterization of the wild type (WT), two AaHSK1 -disrupted strains (Hk1 and Hk2), two AaHSK1 complementation st rains (Cp1 and Cp2), and two AaHOG1 null mutants (Hg1 and Hg2). (A) The AaHSK1 null mutants displayed hypersensitive to glucose, sucrose, sorbitol, and mannitol. (B) Deletion of the AaHOG1 gene in A. alternata resulted in an elevated sensitivity to H2O2, menadione, t -BHP ( tert -butyl-hydroperoxide), NaCl, or KCl. One representative r eplicate is shown. B A

PAGE 117

117 Figure 4-5. Sensitivity of the wild type (WT), two AaHSK1 mutants (Hk1 and Hk2), and two AaHOG1 deletion strains (Hg1 and Hg2) to different fungicides. Fungal strains were grown on potat o dextrose agar amended with 10 g/ml of iprodine, vinclozolin (d icarboximide) or 0.1 g/ml fludioxonil (phenylpyrrole) and incubated at 28 for 3-4 days.

PAGE 118

118 Figure 4-6. The A. alternata Aa HOG1, but not AaHSK1, is required for pathogenicity. (A) Pathogenicity assays were per formed on detached Minneola leaves inoculated with 5 l of conidial suspension (104 conidia/ml) prepared from the wild type (WT), the AaHSK1 -disrupted mutants Hk1 and Hk2, and the complementation strain Cp1. (B) Minneola leaves inoculated with WT and two AaHOG1 null mutants Hg1 and Hg2 were in cubated in a moist chamber. (C) Fungal pathogenicity was assayed on detached Minneola leaves uniformly sprayed with conidial suspension of A. alternata strains. Images were taken 3-4 days postinoculation (dpi). The mock controls were treated with water only. B A C

PAGE 119

119 Figure 4-7. Immunological detection of Aa HOG1 phos phorylation. (A) Total proteins were prepared from the wild type (WT), the AaHSK1 null mutant and the AaHOG1 -disrupted mutant grown in comp lete medium (CM) or in CM supplemented with 0.05% H2O2, 1 g/ml iprodione or 0.6 M NaCl. The AaHOG1 was detected by anti-phosphor ylated P38 and anti-Hog1 antibodies.

PAGE 120

120 CHAPTER 5 SPECIALIZED AND SHAR ED F UNCTIONS OF THE MITOGEN-ACTIVATED PROTEIN KINASES, THE TWO-COMPON ENT HISTIDINE KINASE, AND THE REDOX-RESPONSIVE REGULATOR OF Alternaria alternata IN STRESS RESPONSES AND VIRULENCE The Alternaria alternata AaSLT2 gene, encoding an ortholog of the SLT2 mitogenactivated protein (MAP) kinase of Saccharomyces cerevisiae was cloned and characterized. AaSLT2 was necessary for coni diation, maintenance of cell-wall integrity, melanin accumulation and fungal virulence but dispensable for toxin production. I compared the phenotypes of the mut ants disrupted in each of three MAPK genes ( AaFUS3 AaHOG1 and AaSLT2), the AaHSK1 gene, or the AaAP1 gene. This study revealed possible interactions among these pathways at transcriptional and posttranslational levels, leading to proper regulation of a wide diversity of biological functions. Compared to the AaSLT2 null mutants, AaHSK1 and AaHOG1 null mutants were less sensitive to cell-wall-degr ading enzymes. Accumulation of the AaHOG1 gene transcript was highly elevated in the AaSLT2 null mutant and was slightly increased in the AaFUS3 disruptant. AaSLT2 promoted AaFUS3 expression and vice versa. AaSLT2 elevated AaAP1 expression, whereas AaAP1 inhibited AaSLT2 expression. Furthermore, phosphorylation of AaHOG1 or AaFUS3 was affected when other genes were inactivated, indicating a functional antagonism or synergism among these signal transduction pathways. Interestingly, signaling trans duction pathways-mediated by AaAP1, AaHSK1, AaH OG1, AaSLT2, and AaFU S3 play a critical and non-redundant roles in resistance to 2-ch loro-5-hydroxypyridine (CHP) and 2,3,5-triiodobenzoic acid (TIBA) in A. alternata.

PAGE 121

121 Introduction Mitogen-activated protein (MAP) k inases -mediated signal transduction pathways are involved in diverse biological functi ons (Gustin et al. 1998; Kultz 1998; Xu 2000). The Saccharomyces cerevisiae SLT2 (MPK1) kinase pathway is involved in the formation of cytoskeleton components, cell wall in tegrity, polarization of cell growth, and responses to nutrient availabi lity (Lee et al. 1993; Torres et al. 1991). SLT2 kinase is activated by the MAPKKK Bck1, which is activated by two redundant MAPKKs Mkk1 and Mkk2 (Irie et al. 1 993; Kamada et al. 1995). In the rice blast fungus, Magnaporthe grisea an SLT2 homolog (Mpks) is essential for pathogen penetration and rearrangement of actin cytoskeleton (Xu et al. 1998). Similarly, an SLT2-like MAP kinase homolog in Claviceps purpurea Cochliobolus heterostrophus or Fusarium graminearum is involved in developmental processes associated with sexual reproduction, plant in fection, and cell wall integrity (Hou et al. 2002; Mey et al. 2002; Igbaria et al. 2008). Although each of the MAP kinase pathway s has been extensively studied in a number of fungi, interconnections between thes e signal pathways are not yet clear. In S. cerevisiae the mating pathway medi ated by FUS3 and the filamentous pathway by KSS1 are commonly regulated by multiple components including Ste20, Ste11, and Ste7 (Fig. 1-3) (Schwartz and Madhani 2004). Different MA P kinase pathways may also interact in a cooperative or antagonistic ma nner (Xu 2000), further diversifying their specificities. In S. cerevisiae the specificity of MAP kinase signaling pathways is mainly determined by insulating the components in distinct subce llular compartments or by mutual inhibition (Whitmarsh and Davis 1998; Schwartz and M adhani 2004). For example, the KSS1 pathway has been shown to suppress the FUS3 or HOG1 pathway

PAGE 122

122 by degrading a Tec1 transcription factor or by preventing DN A binding from Tec1 (Gavrias et al. 1996; Zeitlinger et al. 2003; Shock et al. 2009) Tec1 is a regulator for hyphal development and exclus ively involved in the KSS 1 signal pathway (Madhani and Fink 1997). Tec1 often cooperat es with Ste12 during filam entous growth. In contrast, the Hog1 MAP kinase activates an Msg5 gene, encoding a phosphatase that facilitates dephosphorylation in FUS3 and KSS1, thereby blocking their fu nctions (Bardwell et al. 1996; Andersson et al. 2004). Three MAP kinase genes and their func tions have been characterized in the pathogenic fungus M. grisea A FUS3/KSS1 homolog (Pmk1) is responsible for appressoria formation and pathogenicity. A HOG1 homolog is involved in osmoregulation but dispensable for pathogenesis. A SLT2 homolog is essential for pathogenicity and cell wall integrit y (Xu 2000). Moreover, the C. heterostrophus mutant disrupted in a FUS3 homolog displayed defective phenot ypes similar to the mutants disrupted in a SLT2 homolog. Those common phenoty pes include autolytic appearance, reduction in virulence and conidiation, sugge sting that several downstream genes were co-regulated by FUS3 and SLT2 MAPKs (Igbaria et al. 2008). The C. heterostrophus HOG1 is responsible for resistance and adaption to hyperosmotic and oxidative stresses (Igbaria et al. 2008). In this study, I fi rst characterized an SLT2 MAP kinase gene homolog (designated AaSLT2) I further compared the si gnaling pathways that are mediated via three MAP kinases (AaHOG1, AaSLT2 and AaFUS3), a redox-responsive transcription regulator (AaAP1), or a two-component histidine kinase (AaHSK1) in A. alternata The studies revealed possible interactions among these pathways at transcriptional and post-

PAGE 123

123 translational levels, leading to proper regulat ion for a wide diversity of biological functions. Materials and Methods Fungal Strains The wild type EV-MIL31 s train of Alternaria alternata (Fr.) Keissler has been described in Chapter 2. The genetically altered strains, defective in AaAP1 AaHSK1 AaFUS3 or AaHOG1 were generated from previous studies. Cloning of AaSLT2 A 0.9-k b DNA fragment was amplified by a Go-Taq DNA pol ymerase (Promega) from genomic DNA of A. alternata EV-MIL31 with two prim ers Slt2-1F and Slt2-1R (Appendix Table 1). The amplicon was cloned in to pGEM-T easy vector (Promega) for sequence analysis. The cloned gene was named AaSLT2. The 5AaSLT2 sequence as well as its promoter region were amplified with two inverse primers SLT-21R and SLT-52F, whereas the 3-end of AaSLT2 was amplified with two inverse primers SLT946R and SLT-1024F from restriction endonucl eases and self-ligated DNA templates. Sequence of AaSLT2 has been deposited with EMBL/GenB ank Data Libraries under accession no. GQ414510. Creation and Identification of AaSLT 2 mutants To disrupt AaSLT2, a PCR fusion method was used to create split-marker fragments (Fig. 5-1B ). The fragments HY/g and h/YG overlapping within the hygromycin phosphotrans ferase cassette ( HYG ) were amplified from pUCATPH (Lu et al. 1994) with two sets of primers M13R/hyg3 and M13F/hyg 4. A 1.0-kb DNA fragment of 5 AaSLT2 was amplified with the primers SLTpro and SLT2-F2 and a 0.9-kb of 3 AaSLT2 amplified with the primers SLT2-t aa and SLT2-F3. Primers SLT2-F2 and F3

PAGE 124

124 contain sequences complementary to M 13F and M13R primer s, respectively. Subsequently, a 2.9-kb DNA fragment fused with 5 AaSLT2 and h/YG was amplified with the primers SLT-pro and hyg4. A 1.9-kb DNA fragme nt fused with HY/g and 3 AaSLT2 was amplified with the primers SLT-taa and hyg3. Genetic Complementation of AaSLT2-Nul l Mutant To complement an AaSLT2 null mutant, a 2.4-kb DNA fragment was amplified with the primers SLT-pro and SLT2-taa using a high fidelity PCR sy stem (Roche Applied Science). The amplified PCR product was co-transformed wi th pCB1532 plasmid into protoplasts prepared from an AaSLT2 null mutant. Transformants were selected on a medium containing 5 g/ml sulfonylurea and tested for phenotypic restoration. Pathogenicity Test Fungal pathogenic ity assays were conducted on detached Minneola leaves inoculated with conidial suspension as descri bed in Chapter 2. Conidi a were isolated as previously described (Peever et al. 2000). Statistical Analysis A two-tailed t -test was performed to indic ate if changes in disease incidence were statistically significant. A p -value of < 0.05 in the twotail t -test was interpreted as a significant difference, while p -values 0.05 were insignificant. Sensitivity of Cell-Wall-Degrading En z ymes (CWDEs) and Generation of Fungal Protoplasts Assays for sensitivity to 0.4 mg/ml -glucanase or a CWDE mixture containing driselase, -D-glucanase, -glucuronidase, and lyticase were determined by the number of protoplasts releas ed from fungal hyphae over ti me and examined by light microscopy (Leica Microsystems Inc., Exton, PA, U.S.A). Enzymes were dissolved in an

PAGE 125

125 osmotic buffer for fungal protoplasts preparat ion as described previ ously (Chung et al. 2002). RNA Quantitative analyses Quantitative analys es with TotalLAB TL100 software (Nonlinear Dynamics) were performed to assess the intensity of each hybridizing band. 1D gel analysis is performs an automatic analysis using the selected modes following the manuscript instruction. Western-Blot Analysis Fungal is olates were grown in a complete medium for 3 days at room temperature and total proteins were extracted as previ ously described (Chapter 3). The procedures for protein separation, blotti ng to nitrocellulose membranes hybridization, and washing have also been described in Chapter 3. Ph osphorylation of AaFU S3 and AaHOG1 was detected by anti-phosphor ylated P38 and P44/42 antibody, respectively. Molecular Techniques Proc edures used for manipulation of nucleic acids were described in Chapter 2. The AaSLT2 cDNA fragment was amp lified with the primers SLT-atg and SLT-taa using a high fidelity PCR Taq polym erase (Roche Applied Scienc e) and cloned into pGEM-T easy vector for sequence analysis. DNA probes for Southern or No rthern blot analysis were labeled with digoxigenin (DIG)-11-dU TP (Roche Applied Science) by PCR using gene-specific primers: yap-atg / yap-alta3 ( AaAP1 ), MAPK-98/ MAPK-taa ( AaFUS3 ), Hog-atg / Hog-tr ( AaHOG1 ), Hsk-2 /Hsk-2374 ( AaHSK1 ), and SLT-52F/SLT-946R ( AaSLT2). (Appendix Table A-1).

PAGE 126

126 Results Cloning of the AaSLT2 Gene in A. alternata The A. alternata AaSLT2 gene has a 1677-bp ORF interrupted with five introns of 52, 52, 117, 50, and 155 bp. The translat ed AaSLT2 conding sequence contains 416 amino acids with a conserved serine/thr eonine domain (Fig. 5-1A ). The AaSLT2 MAP kinase protein is most simila r to SLT2-like proteins of A. brassicicola (AAU11317), C. heterostrophus (ABM54149) and Ajellomyce capsulatus (XP_001538584) showing 85 to 99% identity (data not shown). Targeted Disruption of AaSLT2 As described in previ ous chapters, a split HYG marker strategy was performed to disrupt AaSLT2 gene in A. alternata (Fig.5-1B). Of six tr ansformants screened, five exhibited reduced growth on PDA and we re analyzed further. Southern blot hybridization of Sal I and Stu I digested genomic DNA to an AaSLT2 probe detected an expected 1.2-kb band in the wild type. In contrast, a 3.4-kb hybridizing band was detected in DNA of five putative transformants owing to integration of the HYG gene cassette (Fig. 5-1C). Three putative AaSLT2 disruptants were anal yzed further by Northern blotting (Fig. 5-1D ), confirming that the AaSLT2 gene was successfully disrupted in A. alternata AaSLT2 Is Required for Virulen ce Pathogenicity assessed on Minneola leaves sprayed uniformly with conidial suspensions revealed an apparent reduction of necrotic lesions induced by the AaSLT2 null mutant compared to those induced by wild type (Fig. 5-2). Statistical analysis using t -test indicated that the m ean lesion number per leaf (Mean=40, n=10) induced by wild

PAGE 127

127 type was significantly differ ent from those induced by an AaSLT2 null mutant (Mean=12.3, n=10, p 0.05) (Table C-1). Production of Conidi a and Protoplasts by A. alternata Disruption of the AaSLT2 gene in A. alternata res ulted in a drastic reduction of conidia production (1.0 0.25 105) compared to the wild type strain (3.75 0.55 106). Deletion of the AaFUS3 gene completely blocked conidial formation, consistent with previous findings (Fig 5-3 and Chapter 4). After treatment with cellwall-degrading enzymes, the AaSLT2-impaired mutant released more protoplasts than wild ty pe (Fig. 5-4A and B), whereas the AaHSK1 null mutant released fewer protoplasts. No protoplasts were produced by the AaHOG1 null mutant even after prolonged incubation with CWDEs. Phenotypic Assays in A. alternata In contra st to wild type, the AaAP1 and AaHOG1 null mutants were highly sensitive to oxidants (Table 5-1 or Fig. C-1). The AaHSK1 -disrupted mutants exhibited hypersensitivity to sugars, whereas the AaHOG1 null mutants were hypersensitive to salts. The AaFUS3 and AaSLT2 deletion strains grew slowly on PDA. Inclusion of KCl or NaCl in PDA ma rkedly enhanced radial growth of the AaFUS3 and AaSLT2 null mutants. The AaHSK1 null mutants, but not the AaAP1 AaFUS3 or AaSLT2 -disrupted strains, became highly resistant to fludioxonil fungicide. The AaHOG1 null mutant displayed a slightly increased resistance to fludioxonil. In terestingly, all disrupted mutants were highly sensit ive to TIBA or CHP.

PAGE 128

128 AaAP1, AaFUS3, AaSLT2, AaHOG1 and AaHSK1 Cooperatively Regulate the Expressio n of a MFS Transporter Coding Gene TIBA is an inhibitor of the plant hormone indoleacetatic acid (IAA) transporter (Prusty et al. 2004). Previous studies re vealed that two gene cl ones (#19 and #54), encoding membrane-bound major facilitator s uperfamily (MFS) transporters, were regulated by both AaAP1 and Aa FUS3 (Chapter 3). Further analysis indicated that expression of the gene clone #19 was down-regul ated considerably in fungal mutants disrupted in AaAP1, AaFUS3, AaSLT2, AaHOG1 or AaHSK1 (Fig. 5-5). Expression of the gene clone #54 was also down-regulated in the AaAP1, AaFUS3, AaSLT2 and AaHSK1 deletion strains, but slightly up-regulated in the AaHOG1 null mutant (Fig. 5-5). Transcriptional Feedback Regulation Acc umulation of the AaAP1 gene transcript was elevated in the AaHSK1 null mutant, but decreased in the AaSLT2 -disrupted mutant (Fig. 56). Expression of the AaHSK1 gene was up-regulated in the null mut ants defective in either of the AaAP1 AaFUS3 AaSLT2 or AaHOG1 gene (Fig. 5-6). Expression of the AaFUS3 gene was slightly up-regulated in the AaHSK1 and AaHOG1 null mutant. Disruption of the AaAP1 AaHSK1 or AaHOG1 gene increased accumulation of the AaSLT2 gene transcript. Expression of the AaSLT2 gene was down-regulated in the AaFUS3 null mutant and vice versa. Expression of the AaHOG1 gene was greatly up-regulated in the AaSLT2 null mutant and only slightly elevated in the AaAP1 or AaFUS3 -disrupted mutant (Fig. 5-6). Cross-Talk between Signaling Pathways Wes tern blot analyses revealed that phosphorylation of AaFUS3 was reduced considerably in the AaHSK1 null mutant and was slightly increased in the AaAP1

PAGE 129

129 AaSLT2 or AaHOG1 null mutant (Fig. 5-7A). P hosphorylation of AaHOG1 was repressed in the AaHSK1 and AaSLT2 null mutants. The AaFUS3 null mutant had an apparent increased in AaHOG1 p hosphorylation (Fig. 5-7B). Discussion In S cerevisiae each of the MAP kinase ca scades responds to different environmental signals. Mounting evidence indicates that intricate interactions between these MAP kinase pathways occur in S. cerevisiae For example, treatment of pheromone not only activates the FUS3-mediated signaling pat hway, but also increases the cell wall integrity pathway and the ty rosine phosphorylation mediated by SLT2 MAP kinase (Zarzov et al. 1996). On the other hand, the Ste11 (MAPKKK) is involved in the regulation of three (FUS3, KSS1 and HOG1 ) MAP kinase pathways (Fig 1-3). Thus, different MAP kinase pathways may interact with each other to regulate cellular responses to different environmental stimuli including perhaps infection cycles in fungal pathogens as well (Xu 2000). In this study, three types of MAP kinase homologs, AaFUS3 AaHOG1 and AaSLT2, were independently disrupt ed. Deletion of the AaFUS3 and the AaHOG1 gene created mutants with distinct phenotypes in terms of the susceptibility to osmotic st resses. This observation indi cated that FUS3and HOG1type MAP kinase signaling pathways functi on antagonistically to regulate osmotic adaption imposed by salts. The antagonistic interactions between AaFUS3 and AaHOG1 occurred at both tran scriptional and post-translati onal levels, as judged by Northern blot and Western blot analyses. Inactivation of the AaHOG1 gene resulted in an increased accumulation of the AaFUS3 transcripts and phosphorylation of AaFUS3. Similarly, disruption of the AaFUS3 gene promoted expression of the AaHOG1 gene and phosphorylation of AaHOG1. However, the mechanism of how AaFUS3 and

PAGE 130

130 AaHOG1 negatively regulate each other in A. alternata remains unclear. In S. cerevisiae the HOG1 MAP kinase acti vates expression of a phos phatase-coding gene ( Msg5) whose product specifically dephosphorylates FUS3 and KS S1 MAP kinases proteins and thus, inhibits their func tions (Bardwell et al. 1996; Andersson et al. 2004). Fungal strains defective in either AaSLT2 or AaFUS3 displayed growth retardation compared to wild type. However, addition of NaCl or KCl restored radial growth to the AaSLT2 and AaFUS3 null mutants. Thus, AaSLT2 and AaFUS3 negatively regulated salt tolerance. At the trans criptional level, AaSLT2 and Aa FUS3 positively regulate each other. AaSLT2 functions as a negativ e regulator for expression of the AaHOG1 gene and vise versa. However, disruption of the AaSLT2 gene promoted phosphorylation of AaFUS3 but decreased phosphor ylation of AaHOG1. In C. heterostophu s, phosphorylation of a SLT2-like MA P kinase was increased if the HOG1 gene was inactivated (Igbaria et al. 2008). Although the AaHSK1-mediated signaling pathway had little connection with AaHOG1 (Chapter 4), accumulation of the AaHSK1 gene transcripts apparently was increased in the mutant strains disrupted in AaAP1 AaFUS3 AaSLT2 or AaHOG1 Inactivation of AaHS K1 reduced phosphorylation of both AaHOG1 and AaFUS3. These results indicated additive or antagonistic interactions at both transcriptional and translational regulatory levels in A. alternata Both AaHOG1 and AaAP1 -disrupted mutants were highly sensitive to oxidants. However, expression of the AaAP1 gene was slightly up-regulated by the AaHOG1 null mutant, but was po sitively regulated by AaSLT2. In Schizosaccharomyces pombe the Sty1 kinase, a HOG1 MAP kina se homolog, directly regulates a bZIP transcription factor, Atf1, rather than the AP1 -like gene during oxidative stress response (Toone and Jones

PAGE 131

131 1998). The mechanism by which proteins modulate AP1-like gene is still unknown. Interestingly, recent studies in this l ab revealed that deleti on of a NADPH oxidasecoding gene ( NOXA ) resulted in fungi hypersensit ive to oxidants and impaired expression of the AaAP1 gene (Siwy Ling Yang, persona l communication). NOXA may function in the production of hydrogen peroxi de. It becomes apparent that intracellular hydrogen peroxide is important for AaAP1 expression and cellular responses to oxidative stress require both AaAP1 and NOXA The SLT2-like MAP kinases have been characterized to be involved in cell wall integrity and conidial production in yeas ts and filamentous fungi (Hou et al. 2002; Igbaria et al. 2008; Mey et al. 2002; Xu et al. 1998; Zhang and Gurr 2001; Zarzov et al. 1996). The A. alternata AaSLT2 was also required for maintenance of cell wall integrity and conidiation. In contrast, AaHOG1 and AaHSK1 had a negative role in cell wall integrity since del etion of either AaHOG1 or AaHSK1 gene generated fungi that were highly resistant to CWDEs. Both AaFUS3 and AaSL T2 were shown to be requir ed for conidial production. In filamentous fungi, conidiation is often c ontrolled by the membrane-bound heterotrimeric G proteins containing three subunits G G and G (Li et al. 2007; Liu and Dean 1997; Wendland 2001). The G subunit is activated once it is released from G subunits. The active G in turn regulates downstream effe ctors, such as adenylate cyclase, phospholipase, and MAPK for nume rous biological functions (Neves et al. 2002). The A. alternata AaG1 encoding a fungal Class I G subunit of GTP-bindi ng protein, was recently cloned and disrupted. The AaG1 disruption mutant produced fewer conidia

PAGE 132

132 compared to the wild ty pe (Wang et al. 2010), suggesting a possible link between AaG1, AaFUS3 and AaSLT2 in the context of conidiation. Both AaFUS3 and Aa HOG1 were demonstrated to be required for pathogenicity. The A. alternata AaSLT2 gene was also required for full virulence. In C. heterostrophus all three MAP kinases were essential for virulence to its host (Igbaria et al. 2008). However, in M, grisea only FUS3 and SLT2 homologs were ne cessary for fungal pathogenicity (Xu 2000). The HOG1 homolog ( OSM1 ) of M. grisea had no role in the pathogenicity (Xu 2000). Thus, the biological processed downstream of each MAP kinase could be highly divergent among species (Bardwell 2006). One of the most important findings of this study is the discovery of the common phenotypes that fungal strains disrupted in AaAP1 AaFUS3 AaSLT2 AaHSK1 or AaHOG1 gene were hypersensitive to TIBA and CHP. It is te mpting to propose that the phenotypes were likely mediated via regulation of common membr ane transporters. As demonstrated in the present study, an MFS transporter coding gene (clone #19) was synergistically regulated by AaAP1, AaFUS3 AaSLT2, AaHSK1 and AaHOG1. Expression of another MFS membrane transporter-coding gene (clone #54) was also regulated by AaAP1, AaFUS3 AaSLT2 and AaHSK1. Over all, my studies have established functional links and possible interactions involving different signaling pathways by phenotypic comparisons and molecular analys es at both transcriptional and translational levels (Fig. 5-8 and Fig. C2). Thus, a regulatory interaction exists between AP1-, HKand MAPK-medi ated signaling pathways in A. alternata In conclusion, the pioneering studies in S. cerevisiae and M. grisea may provide useful guidelines, but may not be directly applicable to under stating the functions and

PAGE 133

133 regulatory mechanisms of these signa lling pathways in all fungal pathogens. Understanding each of the co mponents in MAP kinase-medi ated pathways and potent interactions with differ ent signaling pathways in A. alternata will provide valuable information regarding molecular mechanisms under lying the infection processes as well as the evolution of fungal pathogenicity.

PAGE 134

134 Table 5-1. Phenotypic characterization of wi ld type (WT) and mutant strains of Alternaria alternata grown on potato dextrose agar amended with oxidants, sugars, salts, fungicides, or chemicals. Phenotype WT AaAP1 AaFUS3 AaHOG1 AaSLT2 AaHSK1 Oxidative stress 0.1% H2O2 R S R S R R 100 mM Cycloptentnedion R S R S R R Osmotic stress 1 M Glucose R R R R R S 1 M Surcrose R R R R R S 1 M Sorbitol R R R R R S 1 M Mannitol R R R R R S Salt stress 1 M KCl R R Rr S Rr R 1 M NaCl R R Rr S Rr R Fungicide 0.1 g/ml Fludioxonil S S S r S R Chemical Stress 10 mM TIBA R S S S S S 5 mM CHP R S S S S S R: resistant; S: suscep tible; Rr; highly resist ant; r: minor resistant

PAGE 135

135 Figure 5-1. Conserved domains of AaSLT2 and targeted dis ruption of the AaSLT2 gene. (A) Physical map of AaSL T2 (416 amino acids) s howing a serine/threonine protein kinase domain. (B) Schematic illust ration of a split-marker strategy for disruption of AaSLT2 by inserting a hygromycin phosphotransferanse gene ( HYG ) under control of the Aspergillus nidulans trpC promoter. (C) Southern blot hybridization of SalI / Stu I-digested genomic DNA of the wild type and five putative AaSLT2 disruptants (D1 to D5) to a spec ific probe as indicated in B. (D) Northern blot analysis identified a 1.6-kb hybridized band from the wild type, but not three putativ e mutants D1, D2 and D3. B C D A

PAGE 136

136 Figure 5-2. AaSLT2 i s required for full virulence of Alternaria alternata as assayed on citrus cv. Minneola uniformly sprayed with conidial suspension. Lesions were recorded at (A) 2 dpi and (B) 4 dpi. B A

PAGE 137

137 Figure 5-3. Quantitat ive analys is of conidia produced by the wild type (WT) and mutant strains of Alternaria alternata grown on PDA. Each column represents the mean number of conidia the standard error fr om two independent experiments, with at least three replicated.

PAGE 138

138 Figure 5-4. Protoplas ts released from the Alternaria alternata strains. Production of protoplasts was determined over time af ter the fungal strain s were exposed to cell-wall-degrading enzymes contai ning lyticase, driselase, -glucanase and glucuronidase cocktail (A) or -glucanase alone (B). Release of protoplasts was determined with a hemocytometer by microscopy. Each point represents the mean number of protoplasts released the standard error from two independent experiments with at least three replicates. B A

PAGE 139

139 Figure 5-5. Expression of two MFS c oding genes in A. alternata Total RNA prepared from the wild type (WT) and mutant strains was hy bridized to digoxigeninlabeled probes (# 19 or #54). A gel stai ned with ethidium br omide is shown to indicate the relative amounts of the RNA samples.

PAGE 140

140 Figure 5-6. Transcriptional regulation in Alternaria alternata (A) Northern blot hybridization of total RNA purified from the wild type (WT) and mutant strains to digoxigenin-labeled probes as indi cated. Ribosomal RNA strained with ethidium bromide indicates relative loading of the samples. (B) The relative intensities of hybridizing bands after normalizing from those of actin gene transcript using TotalLAB TL100 software. B A

PAGE 141

141 Figure 5-7. Phosphorylation of AaFUS3 or AaHOG1 protein in Alter naria alternata Western blots of total prot eins of the wild type (WT) and mutant strains were probed with anti-dually phosphorylated P 44/42 and anti-FUS3 antibodies (A) or anti-phosphorylated P38 and anti-HOG1 antibodies (B). B A

PAGE 142

142 Figure 5-8. Summary of s ignal transduction modulated by the redox-responsive transcription regulator (AaAP1), the mi togen-activated prot ein (MAP) kinases (AaFUS3, AaSLT2, and AaHOG1), and t he two-component histidine kinase (AaHSK1)-mediated pathways, in a specific and synergistic manner in Alternaria alternata An arrow indicates positive regulation, whereas a T-bar indicates negative regulation based on the Western blot analyses (Fig. 5-7)

PAGE 143

143 APPENDIX A SUPPLEMENTAL DATA FOR CHAPTER 2 TO 5 Table A-1. Sequenc e of primers Primer name Sequence (5-3) Gene AP-1F 5-aargaraarcayytnaargay-3 AaAP1 AP-1R 5-ggytcnggnswngtncc-3 AaAP1 hypo1 5-cgctcagcatatctgtgcgcat-3 AaAP1 yap1DF2 5-ggctcagacgagcgacacca-3 AaAP1 yap1DR2 5-ggagaaccgtatccagtgttgagg-3 AaAP1 yap-31 5-ccagggagtccgccaaaacg-3 AaAP1 yap-32 5-ccccaggcgctatgacaggca-3 AaAP1 yap-atg 5-atggccggaactaccaacgac-3 AaAP1 yap-taa 5-ttatcc gaggagcttatctttcgg-3 AaAP1 AP1::sGFP 5-ctcctcgcccttgct caccagtccgaggagcttatctttcggt-3 AaAP1 sGFP::AP1 5-accgaaagataagctcct cggaatggtgagcaagggcgaggag-3 sGFP sGFP.nos 5-gatctagtaacatagatgacac-3 sGFP hyg3 5-ggatgcctccgctcgaagta-3 HYG hyg4 5-cgttgcaagaactgcctgaa-3 HYG M13F 5-cgccagggttttcccagtcacgac-3 HYG M13R 5-agcggataa caatttcacacagga-3 HYG MAPK-5F 5-tgccagtacttcatctaccagac-3 AaFUS3 MAPK-6R 5-atcttcttcttgaacggcag-3 AaFUS3 MAPK-98 5-ttgaggag cagattggagggc-3 AaFUS3 MAPK-293 5-gcggaaagc ctctgttcccag-3 AaFUS3 MAPK-atg 5-atgccaccagcggggagcg-3 AaFUS3 MAPK-taa 5-ttatcgcat aatctcctggtagatg-3 AaFUS3 MAPK-P1 5-cgagccttgagcttcggtgatg-3 AaFUS3 SUR-1/DR3 5-cggtgaatccacccgggacat gtggggcacgagagtcgtttgcggtattcgc-3 SUR,AaAP1

PAGE 144

144 Table A-1. Continued. SUR-2/DF3 5-gattattgcacgggaattgcaagatctc-acgtacgcactccaccactcgctg-3 SUR,AaAP1 surR 5-ggatgctccgctcgaagta-3 SUR surf 5-cgttgcaaga actgcctgaa-3 SUR HSK-2 5-aggtgcgagagatcgccgta-3 AaHSK1 HSK-4 5-tcaaagacaccgtcaacgac-3 AaHSK1 HSK-5 5-ctcgcaaactggacaccatc-3 AaHSK1 HSK-7 5-cgtgccgtcttgtcattgtc-3 AaHSK1 HSK-8 5-atccgtctgatccaccgcca-3 AaHSK1 HSK-69 5-gaaacttgtgcgctgaagctgg-3 AaHSK1 HSK-136 5-cccggagagcgaggagaagac-3 AaHSK1 HSK-548 5-gccgactgtggcgcaccgga-3 AaHSK1 HSK-564 5-cccacagctcgatacacgaggc-3 AaHSK1 Hsk-2374 5-gggcgttcggatctcgtgagaca-3 AaHSK1 HSK-P1 5'-cactaacccgtgttaagccacaag-3' AaHSK1 Hsk-up 5-atggccgcagagacgtactcga-3 AaHSK1 HSK-tga 5-tcagctactgtgactccgcagca-3 AaHSK1 Hog-1F 5-gaattcgtacgcgcccagat-3 AaHOG1 Hog-1R 5-gctccgtaatgatggagaattgg-3 AaHOG1 Hog-256R 5'-gtatgccc gcacctgctggta-3' AaHOG1 Hog-316F 5'-gtacaccgacatgcagcccg-3' AaHOG1 Hog1001R 5'-tgccatgtgagcatgatctcagg-3' AaHOG1 Hog-1068F 5'-cgccgagatgctcgagggcaagc-3' AaHOG1 Hog1-atg 5'-atggcggagttcgtacgcgc-3' AaHOG1 Hog-tr 5'-ttagctgccgttgttctcttgctcc-3' AaHOG1 Hog-F2 5'-gtcgtgac tgggaaaaccctggcgccac gctttggaagtcagcacat-3' AaHOG1,HYG Hog-F3 5'-tcctgtgtgaaattgttatccg ctccactccgctggtgttgtgcac-3' AaHOG1,HYG

PAGE 145

145 Table A-1. Continued. Slt2-1F 5-gccatcaagaaggtcaccaacg-3 AaSLT2 Slt2-1R 5-gggtcgaaagcgagcatgc-3 AaSLT2 SLT-21R 5-gcaaggatcttcttgctgaagacg-3 AaSLT2 SLT-52F 5-gccctgcgcgagattaagct-3 AaSLT2 SLT-946R 5-gcgaacgtagtcctgggcacg-3 AaSLT2 SLT-1024F 5-gacgcgctcgacttgctcga-3 AaSLT2 SLT-atg 5'-atgggcgacctcgccaaccg-3' AaSLT2 SLT-pro 5'-gacacgagt cgagccacgttttgt-3' AaSLT2 SLT2-taa 5'-tcatcgcatgcgaccgtcaag-3' AaSLT2 SLT2-F2 5'-gtcgtgactgggaaaaccct ggcgtgcttctcgg accaggggtttc-3' AaSLT2,HYG SLT2-F3 5'-tcctgtgtgaaattgttatccgctactcgtcaacgccgactgcgag-3' AaSLT2,HYG

PAGE 146

146 APPENDIX B SUPPLEMENTAL DATA FOR CHAPTER 3 Figure B-1. The AaF US3 null mutants of Alternaria alternata are resistant to high osmolarity of KCl and Na Cl. Sensitivity of A. alternata wild type (WT), AaFUS3 deletion strains M1 and M2, and tw o complementation strains Cp1 and Cp2 was determined by radial growth on potato dextrose agar (PDA). Only one representative replicate is shown.

PAGE 147

147 APPENDIX C SUPPLEMENTAL DATA FOR CHAPTER 5 Table C-1. Statistical anal ys is of disease incidence ca used by the wild type and AaSLT2 on citrus leaves. Disease incidence t -test: paired two samples for means Wild type AaSLT2 Wild type AaSLT2 44 10 Mean 40 12.3 27 10 Observations 10 10103 5 Hypothesized Mean Difference 0 75 10 Degree of freedom 9 17 10 t Statistic 2.83763221 12 8 P(T<=t) one-tail 0.00973913 28 18 t Critical one-tail 1.83311292 25 10 P(T<=t) two-tail 0.01947827 44 20 t Critical two-tail 2.26215715 25 22 SUMMARY Groups Average Wild type 40 a AaSLT2 12.3 b a and b show statistically different groups ( t -test )

PAGE 148

148 Figure C-1. Sensitivity test s of the wild type (WT), the AaAP1, the AaH SK1, the AaFUS3-, the AaSLT2and the AaHOG1 -disrupted mutant strains. Radial growth of fungal strain s was measured 4-7 days a fter incubation on potato dextrose agar (PDA) in different stresses or PDA containing oxidants, sugars, salts, fungicides, or chemicals. Only one represent photo is shown.

PAGE 149

149 Figure C-2. Schematic illustration of transcriptiona l regulations between the AaAP1 the AaHSK1 the AaFUS3 the AaSLT2 and the AaHOG 1 genes in Alternaria alternata. The transcriptional feedback r egulation was determined based on the results described in Fig. 5-6B. Furt her details are discussed in the text. Positive regulation is indicated by an arrow. Negative regul ation is indicated by a T-bar.

PAGE 150

150 LIST OF REFERENCES Abras h, H. I., Sh ih, D., Elias, W., and Malekmehr, F. 1989. A Kinetic-study of the air oxidation of pyrogallo l and purpurogallin. Int. J. Chem. Kinet. 21:465-476. Adam, A., Kohut, G., and Hornok, L. 2008. Fphog1 a HOG -type MAP kinase gene, is involved in multistress response in Fusarium proliferatum J. Basic Microbiol. 48:151-159. Agrios, G. N. 2004. Plant Pathology. 5th ed. San Diego. Ac ademic Press. Aguirre, J., Rios-Momberg, M., Hewitt, D., and Hansberg, W. 2005. Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol. 13:111-118. Alex, L. A., Borkovich, K. A., and Simon, M. I. 1996. Hyphal development in Neurospora crassa : Involvement of a two-co mponent histidine kinase. Proc. Natl. Acad. Sci. U.S.A. 93:3416-3421. Alex, L. A., and Simon, M. I. 1994. Protein histidine kinases and signal transduction in prokaryotes and eukaryotes Trends Genet. 10:133-138. Akimitsu, K. A., Peever, T. L., and Timmer, L. W. 2003. Molecular, ecological and evolutionary approaches to understanding Alternaria diseases of citrus. Mol. Plant Pathol. 4:435-446. Andersson, J., Simpson, D. M., Qi, M., Wang, Y., and Elion, E. A. 2004. Differential input by Ste5 scaffold and Msg5 phosphatase route a MAPK cascade to multiple outcomes. EMBO J. 23:2564-2576. Apel, K., and Hirt, H. 2004. Reactive oxygen species: Me tabolism, oxidative stress, and signal transduction. Annu. Re v. Plant Biol. 55:373-399. Archibald, F. S. 1992. A new assay for lignin-type peroxidas es employing the dye azure B. Appl. Environ. Microbiol. 58:3110-3116. Avenot, H., Simoneau, P., Iacomi-Vasilesc u, B., and Bataille -Simoneau, N. 2005. Characterization of mutations in th e two-component histidine kinase gene AbNIK1 from Alternaria brassicicola that confer hi gh dicarboximide and phenylpyrrole resistance. Curr. Genet. 47:234-243. Babitskaya, V. G., Shcherba, V. V., Filim onova, T. V., and Gri gorchuk, E. A. 2000. Melanin pigments from the fungi Paecilomyces variotii and Aspergillus carbonarius Appl. Biochem. Microbiol. 36:128-133. Bailey, M. J., Buchert, J., and Viikari, L. 1993. Effect of pH on production of xylanase by Trichoderma reesei on xylan-and cellulose-based medi a. Appl. Microbiol. Biotech. 40:224-229.

PAGE 151

151 Banuett, F. 1998. Signaling in the yeasts: an informational cascade with links to the filamentous fungi. Microbiol. Mol. Biol. Rev. 62:249-274. Banuett, F. 1995. Genetics of Ustilago maydis, a fungal pathogen that induces tumors in maize. Annu. Rev. Genet. 29:179-208. Bardwell, L. 2006. Mechanisms of MAPK signali ng specificity. Bioc hem. Soc. Transact. 34:837-841. Bardwell, L., Cook, J. G., Chang, E. C., Cairns B. R., and Thorner, J. 1996. Signaling in the yeast pheromone response pathway: spec ific and high-affinity interaction of mitogen-activated protein (MAP) kinases Kss1 and Fus3 with the upstream MAP kinase kinase Ste7. Mol. Cell Biol. 16:3637-3650. Benhamou, N. 1996. Elicitor-induced plant def ence pathways. Trends Plant Sci. 1:233240. Buck, V., Quinn, J., Soto Pi no, T., Martin, H., Saldanha, J., Makino, K., Morgan, B. A., and Millar, J. B. A. 2001. Peroxide sensor s for the fission yeas t stress-activated mitogen-activated protein kinase pat hway. Mol. Cell Biol. 12:407-419. Canihos, Y., Erkilic, A., and Timmer L. W. 1997. First report of Alternaria brown spot of Minneola tangelo in Turkey. Plant Dis. 81:1214-1214. Canihos, Y., Peever, T. L., and Timmer, L. W. 1999. Temperature, leaf wetness, and isolate effects on infection of Minneola tangelo leaves by Alternaria sp. Plant Dis. 83:429-433. Carmel-Harel, O., and Storz, G. 2000. Roles of t he glutathioneand thioredoxindependent reduction systems in the Escherichia coli and Saccharomyces cerevisiae responses to oxidative stress. Annu. Rev. Microbiol. 54:439-461. Catlett, N. L., Yoder, O. C. and Turgeon, B. G. 2003. W hole-genome analysis of twocomponent signal transduction genes in fungal pathogens Eukaryot. Cell 2:1151-1161. Cessna, S. G., Sears, V. E., Dickman, M. B., and Low, P. S. 2000. Oxalic acid, a pathogenicity factor for Sclerotinia sclerotiorum suppresses the oxidative burst of the host plant. Plant Cell 12:2191-2199. Chang, C., Kwok, S. F., Bl eecker, A. B., and Meyerowi tz, E. M. 1993. Arabidopsis ethylene-response gene ETR1 : similarity of product to two-component regulator. Science 262:539-544.

PAGE 152

152 Chen, H. Q., Dekkers, K. L., Rollins, J. A., Ko, N. J., Ti mmer, L. W., and Chung, K. -R. 2005. A gene with domains related to tr anscription regulation is required for pathogenicity in Colletotrichum acutatum causing Key lime anthracnose. Mol. Plant Pathol. 6:513-525. Chen, Z., Shilva, H., and Klessi g, R. F. 1993. Active oxygen species in the induction of plant systemic acquired resistance by SA. Science 262:1883-1886. Cho, Y., Cramer, R. A., Kim, K. H., Davis, J. Michell, T. K., Fiquli, P., Pryor, B. M., Lemasters, E., and Lawrence, C. B. 2007. The Fus3/K ss1 MAP kinase homolog Amk1 regulated the expression of genes encoding hydrolytic enzymes in Alternaria brassicicola Fungal Genet. Biol. 44:543-553. Choquer, M., Dekkers, K. A., Chen, H. Q., Cao, L., Ueng, P. P., Daub, M. E., and Chung, K. -R. 2005. The CTB1 gene encoding a fungal polyketide synthase is required for cercosporin biosynthesis and fungal virulence of Cercospora nicotianae Mol. Plant-Microbe Interact. 18:468-476. Chung, K. -R., Ehrenshaft, M., and Daub, M. E. 2002. Functional expression and cellular localization of cercosporin-resist ance proteins fus ed with the GFP in Cercospora nicotianae Curr. Genet. 41:159-167. Chung, K. -R., Shilts, T., Li, W., and Timmer, L. W. 2002. Engineering a genetic transformation system for Colletotrichum acutatum the causal fungus of lime anthracnose and postbloom fruit drop of citrus. FEMS Microbiol. 213:33-39. Cobb, N. A. 1903. Letters on the diseases of plantsAlternaria of the citrus tribe. Agri. Gaz. N.S.W. 14:955-986. Coleman, S. T., Epping, E. A., Steggerda, S. M., and Moye-R owley, W. S. 1999. Yap1p activates gene transcription in an oxidant-specific fash ion. Mol. Cell. Biol. 19:8302-8313. Davis, D., Merida, J., Legendre, L., Low, P. S., and Heinstein, P. F. 1993. Independent elicitation of the oxidative burst and phyto alexin formation in cultured plant cells. Phytochemistry 32:607-611. Deighton, N., Muckenschnabel, I., Goodman, B. A., and Williamson, B. 1999. Lipid peroxidation and the oxi dative burst associated with infection of Capsicum annuum by Botrytis cinerea Plant Journal 20:485-492. de Jong, J. C., McCormack, B. J., Smirnoff, N., and Tal bot, N. J. 1997. Glycerol generates turgor in rice blast. Nature 389:244-245. Delaunay, A., Isnard, A. D., and Toleda no, M. B. 2000. H2O2 sensing through oxidation of the Yap1 transcription factor. EMBO J. 19:5157-5166.

PAGE 153

153 Dickman, M. B., and Yarden, O. 1999. Serine/threoni ne protein kinases and phosphatases in filamentious fung i. Fungal Genet. Biol. 16:99-117. Divon, H. H., and Fluhr, R. 2007. Nutrition acquisition strategies during fungal infection of plants. FEMS Microbiol. 266:65-74. Dixon, R. A., Harris on, M. J., and Lamb, C. J. 1994. Ea rly events in the activation of plant defense response. Annu. Rev. Phytopathol. 32:479-501. Dixon, K. P., Xu, J. -R., Smirnoff, N., and Talbot, N. J. 1999. Independent signaling pathways regulate cellular tu rgor during hyperosmotic stress and appressoriummediated plant infection in Magnaporthe grisea Plant Cell 11:2045-2058. Doke, N., Miura, Y., Sanchez, L. M., Park, H. J., Nori take, T., Yoshioka, H., and Kawakita, K. 1996. The oxi dative burst protects plants against pathogen attack: Mechanism and role as an emergency si gnal for plant bio-defence A review. Gene 179:45-51. Dongo, A., Bataille-Simoneau, N., Campion, C., Guillemette, T., Hamon, B., IacomiVasilescu, B., Katz, L., and Simoneau, P. 2009. The group III two-component hidtidine kinase of f ilamentous fungi is involved in the fungicidal activity of the bacterial polyketide ambruticin. A ppl. Environ. Microbiol. 75:127-134. Dorn, G., and Rive ra, W. 1996. Kinetics of fungal gr owth and phosphatase formation in Aspergillus nidulans J. Bacterio l. 92:1618-1622. Egan, M. J., Wang, Z. Y., J ones, M. A., Smirnoff, N., and Ta lbot, N. J. 2007. Generation of reactive oxygen species by fungal NADP H oxidases is required for rice blast disease. Proc. Natl. Acad. Sci. U.S.A. 104:11772-11777. Elino, E. A. 2001. The Ste5p sc affold. J. Cell Sci. 114:3967-3978. Enjalbert, B., MacCallum, D. M., Odds, F. C., and Brown, A. J. P. 2007. Niche-specific activation of the oxidative stress response by the pathogenic fungus Candida albicans Infect. Immun. 75:2143-2151. Furukawa, K., Hoshi, Y., Maeda, T ., Nakajima, T., and Abe, K. 2005. Aspergillus nidulans HOG pathway is activated only by two-component signalling pathway in response to osmoti c stress. Mol. Microbiol. 56:1246-1261. Gardner, J. M., Kono, Y., and Chandler, J. L. 1986. Bioassay and host-selectivity of Alternaria citri toxins affecting rough lemon and mandarins. Physiol. Mol. Plant Pathol. 29:293-304.

PAGE 154

154 Gavrias, V., Andrianopoulos, A., Gimeno, C. J., and Timberlake, W. E. 1996. Saccharomyces cerevisiae TEC1 is required fo r pseudophphal growth. Mol. Microbiol. 19:1255-1263. Giannopolitis, C. N., and Ries, S. K. 1977. Superoxide dismutases: Occurrence in higher plants. Plant Physiol. 59:309-314. Giesbert, S., Schurg, T., Scheele, S., and Tudzynski, P. 2008. The NADPH oxidase Cpnox1 is required for full pathog enicity of the ergot fungus Claviceps purpurea Mol. Plant Pathol. 9:317-327. Glazebrook, J. 2005. Contrasting mechani sms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43:205-227. Godon, C., Langniel, G., Lee, J., B uhler, J. M., Kieffer, S., Perrot, M., Boucherie, H., Toledano, M. B., and Labarre, J. 1998. The H2O2 stimulon in Saccharomyces cerevisiae J. Biol. Chem. 273:22480-22489. Gomez-Gomez, E., Roncero, M. I. G., Di Pietro A., and Hera, C. 2001. Molecular characterization of a novel endo-beta-1,4xylanase gene from the vascular wilt fungus Fusarium oxysporum Curr. Genet. 40:268-275. Gopinath, S. C. B., Aubu, P., and Hilda, A. 2005. Extracellula r enzymatic activity profiles in fungi isolated from oil-rich environments. Mycoscience 46:119-126. Govrin, E. M., and Levine, A. 2000. The hy persensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea Curr. Biol. 10:751-757. Grant, C. M., MacIver, F. H., and Dawes, I. W. 1996. Stationary-phase induction of GLR1 expression is mediated by the yAP-1 transcriptional regulatory protein in the yeast Saccharomyces cerevisiae Mol. Microbiol. 22:739-746. Greenberg, J. T. 1997. Programmed cell deat h in plant-pathogen in teractions. Annu. Rev. Plant Physiol. Pl ant Mol. Biol. 48:525-545. Greenberg, J. T., and Yao, N. 2004. The role and regulati on of programmed cell death in plant-pathogen interactions. 6:201-211. Gulshan, K., and Moye-Rowley, W. S. 2007. Multidrug resist ance in fung i. Eukaryot. Cell 6:1933-1942. Gustin, M. C., Albertyn, J., Alexander, M., and Davenport, K. 1998. MAP kinase pathways in the yeast Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev. 62:1264-1300.

PAGE 155

155 Harris, K., Lamson, R. E., Ne lson, B., Hughes, T. R., and Ma rton, M. J. 2001. Role of scaffolds in MAP kinase pathway specificity reveal ed by custom design of pathway-dedicated signaling prot eins. Curr. Biol. 11:1815-1824. Harshman, K. D., Moyerowley, W. S., and Park er, C. S. 1988. Trans criptional activation by the SV40 AP-1 rec ognition element in yeast is m ediated by a factor similar to AP-1 that is distinct from GCN4. Cell 53:321-330. Hatta, R., Ito, K., Hosaki, Y., Tanaka, T., Tanaka, A., Yamamoto, M., Akimitsu, K., and Tsuge, T. 2002. The conditionally di spensable chromosome controls hostspecific pathogenicity in the fungal plant pathogen Alternaria alternata Genetics 161:59-70. Heinisch, J. J., Lorberh, A., Sc hmitz, H. -P., and Jacoby, J. J. 1999. The protein kinase C-mediated MAP kinase pathway involved in the maintenance of cellular integrity in Saccharomyces cerevisiae Mol. Microbiol. 32:671-680. Henikoff, J. G., Greene, E. A., Pietrokovski, S., and He nikoff, S. 2000. Increased coverage of protein families with the blocks database serv ers. Nucleic Acid Res. 28:228-230. Herskowitz, I. 1995. MAP ki nase pathways in yeast: For mating and more. Cell 80:187197. Hodges, D. M., DeLong, J. M., Forney, C. F., and Prange, R. K. 1999. Improving the thiobarbituric acid-reactive-substances as say for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207:604-611. Holmgren, A. 1977. Bovine thio redoxin system. Purification of thioredoxin reductase from calf liver and thymus and studies of it s function in disulfide reduction. J. Biol. Chem. 252:4600-4606. Hou, Z., Xue, C., Peng, Y. Katan, T., Kistler, H. C., and Xu, J.-R. 2002. A mitogenactivated protein kinase gene ( MGV1 ) in Fusarium graminearum is required for female fertility, heterokaryon formation, and plant infection. Mol. Plant-Microbe Interact. 15:1119-1127. Howard, R. J., and Valent, B. 1996. Break ing and entering: Host penetration by the fungal rice blast pathogen Magnaporthe grisea Ann. Rev. Microbiol. 50:491-512. Hubbell, D. H., Morales, V. M., and Umali-Garc ia, M. 1978. Pectolytic enzymes in Rhizobium Appl. Environ. Microbiol. 35:210-213.

PAGE 156

156 Igbaria, A., Lev, S., Rose M. S., Lee, B. N. Hadar, R., Degani, O., and Horwitz, B. A. 2008. Distinct and combined role s of the MAP kinases of Cochliobolus heterostrophus in virulence and stress response s. Mol. Plant-Microbe Interact. 21:769-780. Inoue, Y., Matsuda, T., Sugiya ma, K., Izawa, S., and Kimura A. 1999. Genetic analysis of glutathione peroxidase in oxidative stress response of Saccharomyces cerevisiae J. Biol. Chem. 274:27002-27009. Irie, K., Takase, M. Lee, K. S., Levi n, D. E., Araki, H., Mats umoto, K., and Oshima, Y. 1993. MKK1 and MKK2 which encode Saccharomyces cerevisiae mitogenactivated protein kinase-kinase homologs, function in the pathway mediated by protein kinase C. Mol. Cell Biol. 13:3076-3083. Isshiki, A., Akimitsu, K., Yama moto, M., and Yamamoto, H. 2001. Endopolygalacturonase is essential for citrus blak rot caused by Alternaria citri but not brown s pot caused by Alternaria alternata Mol. Plant-Microbe Interact. 14:749-757. Ito, K., Tanaka, T., Hatta, R., Yamamoto, M., Akimit su, K., and Tsuge, T. 2004. Dissection of the host range of the fungal plant pathogen Alternaria alternata by modification of secondary metabolis m. Mol. Microbiol. 52:399-411. Jenczmionka, J. N., Maier, F. J., Los ch, A. P., and Schafer W. 2003. Mating, conidiation and pathogenicity of Fusarium graminearum the main causal agent of the head-blight disease of wheat, ar e regulated by the MAP kinase pgmk1. Curr. Genet. 43:87-95. Jenczmionka, N. J., and Schafer, W. 2005. The Gpmk1 MAP kinase of Fusarium graminearum regulates the induction of specif ic secreted enzymes. Curr. Genet. 47:29-36. Johansson, L. H., and Borg, L. A. H. 1988. A spectrophotometric method for determination of catalase activity in small tissue samples. Anal. Biochem. 174:331-336. Kamada, Y., Jung, U. S., Piotrowski, J., and Levin, D. E. 1995. T he protein kinase Cactivated MAP ki nase pathway of Saccharomyces cerevisiae mediates a novel aspect of the heat shock re sponse. Gene Dev. 9:1559-1571. Kawasaki, L., Sanchez, O., Shiozaki, K., and A quirre, J. 2002. SakA MAP kinase is involved in stress signal transduction, sexual development and spore viability in Aspergillu nidulans Mol. Microbiol. 45:1153-1163.

PAGE 157

157 Keon, J., Antoniw, J., Carzaniga, R., Deller, S., Ward, J. L., Baker, J. M., Beale, M. H., Hammond-Kosack, K., and R udd, J. J. 2007. Transcr iptional adaptation of Mycosphaerella graminicola to programmed cell death (P CD) of its susceptible wheat host. Mol. Plant-Mic robe Interact. 20:178-193. Kiely, T. B. 1964. Brown s pot of emperor mandarin. Agri Gaz. N.S.W. 75:854-856. Kohmoto, K., Akimitsu, K. and Otani, H. 1991. Corre lation of resistance and susceptibility of citrus to Alternaria alternata with sensitivity to host-specific toxins. Phytopathology 81:719-722. Kohmoto, K., Itoh, Y., Shimom ura, N., Kondoh, Y., Otani, H., Kodama, M., Nishimura, S., and Nakatsuka, S. 1993. Isolation and biol ogical-activities of 2 host-specific toxins from the tangerine pathotype of Alternaria alternata Phytopathology 83:495-502. Kohmoto, K., Scheffer, R. P. and Whiteside, J. O. 1979. Ho st-selective toxins from Alternaria citri Phytopathology 69:667-671. Kojima, K., Takano, Y., Yosh imi, A., Tanaka, C., Kikuch i, T., and Okuno, T. 2004. Fungicide activity through activation of a f ungal signaling pathway. Mol. Microbiol. 53:1785-1796. Kombrink, E., and Somssich, I. E. 1995. Defense responses of plants to pathogens. Adv. Bot. Res. 21:1-34. Kruppa, M., and Calderone, R. 2006. Twocomponent signal transduction in human fungal pathogens. FEMS Ye ast Res. 6:149-159. Kuge, S., Arita, M., Murayama, A., Maeta, K. Izawa, S., Inoue, Y ., and Nomoto, A. 2001. Regulation of the yeast Yap1p nuclear export signal is m ediated by redox signalinduced reversible disulfide bond forma tion. Mol. Cell. Biol. 21:6139-6150. Kuge, S., and Jones, N. 1994. YAP1 dependent activation of TRX2 is essential for the response of Saccharomyces cerevisiae to oxidative stress by hydroperoxides. EMBO J. 13:655-664. Kuge, S., Jones, N., and Nomo to, A. 1997. Regulation of y AP1 nuclear localization in response to oxidative st ress. EMBO J. 16:1710-1720. Kultz, D. 1998. Phylogenetic and functional classification of mitogenand stressactivated protein kinases. J. Mol. Evol. 46:571-588. Kuwahara, M., Glenn, J. K. Morgan, M. A., and Gold, M. H. 1984. Separation and characterization of two extracellular H2O2-dependent oxidases from ligninolytic cultures of Phanerochaete chrysosporium. FEBS Lett. 169:247-250.

PAGE 158

158 Lamb, C., and Dixon, R. A. 1997. The oxidative burst in plant disease resistance. Annu. Rev. Plant Physiol. Pl ant Mol. Biol. 48:251-275. Lee, B. N., Kroken, S., Chou, D. Y. T. Robbertse, B., Yoder, O. C., and Turgeon, B. G. 2005. Functional analysis of all nonr ibosomal peptide synthetases in Cochliobolus heterostrophus reveals a factor, NPS6, involved in virulence and resistance to oxidative st ress. Eukaryo t. Cell 4:545-555. Lee, J., Godon, C., Lagni el, G., Spector, D., Garin, J., Labarre, J., and Toledano, M. B. 1999. Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J. Bio. Chem. 274:16040-16046. Lee, K. S. Irie, K., Gotoch, Y., Watanabe, Y., Araki, H., Ni shida, E., Matsumoto, K., and Levin, D. E. 1993. A yeast mitogen-acti vated protein kinase homologue (Mpk1p) mediates signaling by protein kinas e C. Mol. Cell Biol. 13:3067-3075. Lengeler, K. B., Davidson, R. C., DSouza, C., Harashima, T., Shen, W. -C., Wang, P., Pan, X., Waugh, M., and Heitamn, J. 2000. Signa l transduction cascades regulating fungal development and virulence. Microbiol. Bol. Biol. Rev. 64:746785. Leon, J., Lawton, M. A. and Raskin, I. 1995. H2O2 stimulates salicylic acid biosynthesis in tobacco. Plant Ph ysiol. 108:1673-1678. Lev, S., Hadar, R., Amedeo, P., Baker, S. E., Y oder, O. C., and Horw itz, B. A. 2005. Activation of an AP1-like transcription factor of the maize pathogen Cochliobolus heterostrophus in response to oxidative stress and plant signals. Eukaryot. Cell 4:443-454. Lev, S., and Horwitz, B. A. 2003. A mitogen-activated protei n kinase pathway modulates the expression of two cellulase genes in Cochliobolus heterostrophus during plant infection. Plant Cell 15:835-844. Lev, S., Sharon, A., Hadar, R ., Ma, H., and Horwitz, B. A. 1999. A mitogen-activated protein kinase of the corn leaf pathogen Cochliobolus heterostrophus is involved in conidiation, appressori um formation, and pathogenicity: diverse roles for mitogen-activated protein kinase holologs in foliar pathogens. Proc. Natl. Acad. Sci. U.S.A. 96:13542-13547. Lessing, F., Kniemeyer, O., Wozniok, W. Loeffler, J., Kurzai O., Haertl, A., and Brakhage, A. A. 2007. The Aspergillus fumigatus transcriptional re gulator AfYap1 represents the major regulator for defense against reactive oxygen intermediates but is dispensable for pathogenicity in an intranasal mouse infection model. Eukaryot. Cell 6:2290-2302.

PAGE 159

159 Li, L., Wright, S. J., Krystofo va, S., Park, G., and Borkovich, K. A. 2007. Heterotrimeric G protein signaling in filamentous fungi. Annu Rev. Microbiol. 61:423-452. Li, S., Ault, A., Malone, C. L., Raitt, D., D ean, S., Johnston, L. H. Deschenes, R. J., and Fassler, J. S. 1998. The yeast histi ndine protein kinase, Sln1p, mediates phosphotransfer to two response regul ators, Ssk1p and Skn7p. EMBO J. 17:6952-6962. Lin, C. -H., Yang, S. L., and Chung, K. -R. 2009. The YA P1 homolog-mediated oxidative stress tolerance is crucial for pathogenicity of the ne crotrophic fungus Alternaria alternata in citrus. Mol. Plant-Microbe Interact. 22:942-952. Lin, C. -H., Yang, S. L. Wang, N. -Y., and Chung, K. -R. 2010. The FUS3 MAPK signaling pathway of the citrus pathogen Alternaira alternata functions independently or cooperativel y with the fungal redox-reponsive AP1 regulator for diverse developmental, physiological and pathogenic processes. Fungal Genet. Biol. 47:381-391. Linder, W. A., Hoffman, C., and Grisebach, H. 1988. Rapid elicitor-induced chemiluminescence in soybean cell suspension cultures. Phytochemistry 27:2502503. Liu, S., and Dean, R. S. 1997. G protein subunit genes controls growth, development, and pathogenicity of Magnaporthe grisea Mol. Plant-Microbe Interact. 10:10751086. Liu, W., Leroux, P., and Fillinger, S. 2008. The HOG1-like MAP kinase Sak1 of Botrytis cinerea is negatively regulated by the upstream histidine kinase Bos1 and is not involved in dicarboximi deand phenylpyrrole-resistance. Fungal Genet. Biol. 7:1062-1074. Loomis, W. F., Shaulsky, G., and Wang, N. 1997. Histidine kinases in signal transduction pathways of eukaryotes. J. Cell Sci. 110:1141-1145. Lu, S. W., Lyngholm, L., Yang, G., Bronson, C., Yoder, O. C., and Turgeon, B. G. 1994. Tagged mutations at the Tox1 locus of Cochliobolus heterostrophus by restriction enzyme-mediated integrati on. Proc. Natl. Acad. Sc i. U.S.A. 91:12649-12653. Luo, Y., Yang, J., Zhu, M., Yan, J., Mo, M., and Zhqng, K. 2008. Characterization of mutations i n AlHK1 gene from Alternaria longipes : Implication of limited function of two-component histidine kinase on conferring dicarboximide resistance. J. Microbiol. Biotechnol. 18:15-22. Machado, A. K., Morgan, B. A., and Merrill, G. F. 1997. Thioredoxin reductasedependent inhibition of MCB ce ll cycle box activity in Saccharomyces cerevisiae J. Biol. Chem. 272:17045-17054.

PAGE 160

160 Madhani, H. D., and Fink, G. R. 1997. Combinatorial control required for the specificity of yeast MAPK signali ng. Science 28:1314-1317. Madhani, H. D., and Fink, G. R. 1998. The control of f ilamentous differentiation and virulence in fungi. Tr ends Cell Biol. 8:348-353. Maeda, T., Takekawa, M., and Saito, H. 1995. Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH3-c ontaining osmosensor. Science 269:554558. Marchler, G., Schuller, C., Adam, G., and Ruis, H. 1993. A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcripti on in response to a variety of stress condit ions. EMBO J. 12:1997-2003. Masunaka, A., Tanaka, A., Tsuge, T., Peever T. L., Timmer, L. W., Yamamoto, M., Yamamoto, H., and Akimitsu, K. 2000. Di stribution and characterization of AKT homologs in the tangerine pathotype of Alternaria alternata Phytopathology 90:762-768. Mayer, A. M., Staples, R. C., and Gil-ad, N. L. 2001. Mechanisms of survival of necrotrophic fungal plant pathogens in ho sts expressing the hypersensitive response. Phytochemistry 58:33-41. Mayorga, M. E., and Gold, S. E. 1999. A MAP kinase encoded by the ubc3 gene of Ustilago maydis is required for filmentous growth and full virulence. Mol. Microbiol. 34:485-497. Mehrabi, R., Zwiers, L. -H., de Wa rrd, M. A., and Kema, G. H. 2006. MgHog1 regulates dimorphism and pathogenicity in the fungal wheat pathogen Mycosphaerella graminicola Mol. Plant-Microbe Interact. 19:1262-1269. Mey G., Held, K., Sche ffer, J., Tenberge, K. B., and Tudzynski, P. 2002. CPMK2, an SLT2-homologous mitogen-activated prot ein (MAP) kinase, is essential for pathogenesis of Claviceps purpurea on rye: evidence for a second conserved pathogenesis-related MAP kinase casc ade in phytopathogenic fungi. Mol. Microbiol. 46:305-318. Miller, R. A., and Britigan, B. E. 1997. Role of oxidants in microbial pathophysiology. Clin. Microbiol. 10:1-18. Mittler, R. 2002. Oxidative stress, antioxi dants and stress toleranc e. Trends Plant Sci. 7:405-410. Molina, L., and Kahmann, R. 2007. An Ustilago maydis gene involved in H2O2 detoxification is required for virulence. Plant Cell 19:2293-2309.

PAGE 161

161 Money, N. P., and Howard, R. J. 1996. Confirmation of a link between fungal pigmentation, turgor pressure, and pathogenicity using a new method of turgor measurement. Fungal Genet. Biol. 20:217-227. Moore, S., De Vries, O. M. H., and Tudzynski, P. 2002. The major Cu,Zn SOD of the phytopathogen Claviceps purpurea is not essential for pathogenicity. Mol. Plant Pathol. 3:9-22. Morgan, B. A., Banks, G. R., Toone, W. M., Rai tt, D., Kuge, S., an d Johnston, L. H. 1997. The Skn7 response regulator contro ls gene expression in the oxidative stress response of the budding yeast Saccharomyces cerevisiae EMBO J. 16:1035-1044. Moriwaki, A., Kubo, E., Arase, S., and Kihara, J. 2006. Disruption of Srm1 a mitogenactivated protein kinase gene, affects s ensitivity to osmotic and ultraviolet stressors in the phytopathogenic fungus Bipolaris oryzae FEMS Microbiol. Lett. 257:253-261. Motoyama, T., Kadokura K., Ohira, T., Ichiishi, A., Fujimura, M., Yamaguchi, I., and Kudo, T. 2005. A two-component histidine kinase of the rice blast fungus is involved in osmotic stress response and fungicide action. Fungal Genet. Biol. 42:200-212. Moye-Rowley, W. S. 2003. R egulation of the transcriptional response to oxidative stress in fungi: similarities and differences. Eukaryot. Cell 2:381-389. Nakano, Y., and Asada, K. 1981. Hydr ogen peroxide is scavenged by ascorbatespecific peroxidase in spinach chlor oplasts. Plant Cell Physiol. 22:867-880. Neill, S., Desikan, R., and H ancock, J. 2002. Hydrogen peroxid e signalling. Curr. Opin. Plant Biol. 5:388-395. Neves, S. R., Ram, P. T. and Iyengar, R. 2002. G prot ein pathways. Science 296:16361639. Nishimura, S., and Kohmoto, K. 1983. Host-specific toxins a nd chemical structures from Alternaria species. Annu. Rev. Phytopathol. 21:87-116. Nguyen, D. T., Alarco, A. M., and Raymond, M. 2001. Multiple Yap1p-binding sites mediate induction of the yeast major fac ilitator FLR1 gene in response to drugs, oxidants, and alkylating agent s. J. Bio. Chem. 276:1138-1145. Niku-Paavola, M. L., Kar hunen, E., Salola, P., and Rauni o, V. 1988. Ligninolytic enzymes of the white-rot fungus Phlebia radiata Biochem. J. 254:877-884.

PAGE 162

162 Noguchi, R., Banno, S., Ichikawa R., Fukumori, F., Ichiishi A., Kimura, M., Yamaguchi, I., and Fujimura, M. 2007. Identificat ion of OS-2 MAP kinae dependent genes induced in response to osmotic stress, antifungal agent fludioxonil, and heat shock in Neurospora crassa Fungal Genet. Biol. 44:208-218. Ochiai, N., Fujimura, M., Motoyama, T., Ic hiishi, A., Usami, R ., Horikoshi, K., and Yamaguchi. I. 2001. Characterization of mu tations in the two-component histidine kinase gene that confer fludioxonil resi stance and osmotic sensitivity in the os-1 mutants of Neurospora crassa Pset Manag. Sci. 57:437-442. Ogrydziak, D. M., and Mortim er, R. K. 1977. Genetics of extracellular protease production in Saccharomycopsis lipolytica Genetics 87:621-632. Oide, S., Moeder, W., Krasnoff, S., Gibson, D., Haas, H., Yoshioka, K., and Turgeon, B. G. 2006. NPS6 encoding a nonribosomal peptide synthetase involved in siderophore-mediated iron metabolism, is a conserved virulence determinant of plant pathogenic ascomycete s. Plant Cell 18:2836-2853. ORourke, S. M., and Herskowitz, I. 1998. T he Hog1 MAPK prevents cross talk between the HOG and pheromone response MAPK pathways in Saccharomyces cerevisiae Genes Dev. 12:2874-2886. Orozco-Cardenas, M., and Ry an, C. A. 1999. Hydrogen peroxide is generated systemically in plant leaves by woundi ng and systemin via the octadecanoid pathway. Proc. Natl. Acad. Sci. U.S.A. 96:6553-6557. Oshima, M., Fujimura, M., B anno, S., and Hashimoto, C. 20 01. A point mutation in the two-component histidine kinase BsOS-1 gene confers dicar boximide resistance in field isolates of Botrytis cinerea Phytopathology 92:75-80. Ota, I. M., and Varshavsky, A. 1993. A yeast protein similar to bacterial two component regulators. Science 262:566-569. Otani, H., Kohmoto, K. and Kodama, M. 1995. Alternaria toxins and their effects on host plants. Can. J. Bot. 73:S453-S458. Park, S. M., Choi, E. S., Kim, M. J., Cha, B. J., Yang, M. S., and Kim, D. H. 2004. Characterization of HOG1 homologue, CpMK1, form Cryphonectria parasitica and evidence for hypovirus-mediated pertu rbation of its phosphorylation in response to hypertonic stre ss. Mol. Microbiol. 51:1267-1277. Parkinson, J. S., and Kofoid, E. C. 1992. Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26:71-112.

PAGE 163

163 Pedrajas, J. R., Kosmidou, E., Miranda-Vizuete, A., Gustafsson, J. A., Wright, A. P. H., and Spyrou, G. 1999. Identification and functional char acterization of a novel mitochondrial thioredoxin system in Saccharomyces cerevisiae J. Biol. Chem. 274:6366-6373 Peever, T. L., Olsen, L., I banez, A., and Timmer, L. W. 2000. Genetic differentiation and host specificity am ong populations of Alternaria spp. causing brown spot of grapefruit and tangerine grapefruit hybrids in Flor ida. Phytopathology 90:407414. Peever, T. L., Su, G., Carpenter-Boggs, L., and Timmer, L. W. 2003. Molecular systematics of citrus-associated Alternaria species. Mycologia 96:119-134. Pegg, K. G. 1966. Studies of a strain of Alternaria citri Pierce, the causal organism of brown spot of Emperor mandarin. Queensland J. Agri c. Anim. Sci. 23:14-18. Pelech, S. J., and Sanghera, J. S. 1992. MAP kinases: charti ng the regulatory pathways. Science 257:1355-1356. Peres, N. A. R., Agostini, J. P., and Timmer, L. W. 2003. Outbreaks of Alternaria brown spot of citrus in Brazil and Argentina. Plant Dis. 87:750. Pietro, A. D., Garcia -Maceira, F. I., Meglecz, E., and Roncero, M. S. G. 2001. A MAP kinase of the vascular wilt fungus Fusarium oxysporum is essential for root penetration and pathogenesis. Mol. Microbiol. 39:1140-1152. Pos as, F., and Saito, H. 1998. Activation of the yeast S SK2 MAP kinase kinase kinase by the SSK1 two-component response regulator. EMBO J. 17:1385-1394. Posas, F., Wurgler-Murphy S. M., Maeda, T., Wi tten, E. A., Thai, T. C., and Saito, H. 1996. Yeast HOG1 MAP kinase casc ade is regulated by a multistep phosphorelay mechanism in the SLN1-YPD1-SSK1 two-component osmosensor. Cell 86:865-875. Prusty, R., Grisafi, P., and Fink, G. R. 2004. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae Proc. Natl. Acad. Sci. U.S.A. 101:4153-4157. Rauyaree, P., Ospina-Giraldo, M. D., Kang, S., Bhat, R. G. Subbarao, K. V., Grant, S. J., and Dobinson, K. F. 2005. Mutations in VMK1, a mitogen-activated protein kinase gene, affect microsclerot ia formation and pathogenicity in Verticillium dahlia Curr. Genet. 48:109-116.

PAGE 164

164 Robbertse, B., Yoder, O. C., Nguyen, A., Schoch, C. L., and Turgeon, B. G. 2003. Deletion of all Cochliobolus heterostrophus monofunctional catalase-encoding genes reveals a role for one in sensitivity to oxidative stress but none with a role in virulence. Mol. Plant -Microbe Interact. 16:1013-1021. Robinson, M. J., and Cobb, M. H. 1997. Mitogen-activa ted protein kinase pathways. Curr. Opin. Cell Biol. 9:180-186. Rogers, L. M., Kim, Y. -K., Guo, W., Gonzalez-Candelas, L. Li, D., and Kolattukudy, P. 2000. Requirement for either a host-o r a pectin-induced pectate lyase for infection of Pisum sativum by Nectria haematococca Proc. Natl. Acad. Sci. U.S.A. 97:9813-9818. Rolke, Y., Liu, S., Quidde, T ., Williamson, B., Schouten, A., We ltring, K. -M., Siewers, V., Tenberge, L. B., Tudzynski, B., and Tudzynski, P. 2004. Functional analysis of H2O2-generating systems in Botrytis cinerea : the major Cu-Zn-superoxide dismutase (BCSOD1) contributes to virulence on French bean, whereas a glucose oxidase (BCGOD1) is dispens able. Mol. Plant Pathol. 5:17-27. Ruiz-Roldan, M. C., Maier, F. J., and Schafer, W. 2001. PTK1 a mitogen-activatedprotein kinase gene, is requi red for conidiation, appr essorium formation, and pathogenicity of Pyrenophora teres on barley. Mol. Plant-Microbe Interact. 14:116-125. Samejima, I., Mackie, S., and Fantes, P. A. 1997. Mutiple modes of activation of the stress-responsive MAP kinase pathway in fission yeast. EM BO J. 16:6162-6170. Schumacher, M. M., Enderlin, C. S., and Selitrennikoff, C. P. 1997. The osmotic-1 locus of Neurospora crassa encodes a putative histidine ki nase similar to osmosensors of bacteria and yeast. Curr. Microbiol. 34:340-347. Schutte, G. C., Lesar, K. H., du Pelser, P. T., and Swart, S. H. 1992. The use of tebuconazole for the control of Alternaria alternata on Minneola tangelos and its potential to control post-har vest decay when applied as a pre-harvest spray. Proc. Int. Soc. Citricult. 7:1070-1074. Schwartz, M. A., and Madhani H. D. 2004. Principles of MAP kinase signaling specificity in Saccharomyces cerevisiae Annu. Re. Genet. 38:725-748. Segmuller, N., Ellendor f, U., Tudzynski, B., and Tudzyn ski, P. 2007. BcSAK1, a stressactivated mitogen-activated protein kinase, is involved in vegetative differentiation and pathogenicity in Botrytis cinerea Eukaryot. Cell 6:211-221. Segmuller, N., Kokkelink, L. Giesbert, S., Odinius, D., v an Kan, J., and Tudzynski, P. 2008. NADPH Oxidases are involved in differentiation and pathogenicity in Botrytis cinerea Mol. Plant-Microbe Interact. 21:808-819.

PAGE 165

165 Shieh, J. C., Wilkinson, M. G., and Millar, J. B. 1998. T he Win1 mitotic regulator is a component of the fission yeast stress-acti vated Sty1 MAPK pathway. Mol. Biol. Cell 9:311-322. Shock, T. R., Thompson, J. Yates III, J. R., and Madhani, H. D. 2009. Hog1 mitogenactivated protein kinase (MAPK) interr upts signal transduction between the Kss1 MAPK and the Tec1 transcription factor to ma intain pathway specificity. Eukaryot. Cell 8:606-616. Solel, Z. 1991. Alternaria brown spot on Minneola tangelos in Israel. Plant Pathol. 40:145-147. Solel, Z., Oren, Y., and Kimchi M. 1996. Control of Alter naria brown spot of Minneola tangelo with fungicides. Crop Prot. 16:659-664. Solel, Z., and Kimchi, M. 1998. Histopathology of infect ion of Minneola tangelo by Alternaria alternata pv. citri and the effect of host and environmental factors on lesion development. J. Phytopathology 146:557-561. Solomon, R. S., Waters, O. D. C., Simmonds, J., Cooper, R. M., and Oliver, R. P. 2005. The Mak2 MAP kinase signal transduction pathw ay is required for pathogenicity in Stagonospora nodorum Curr. Genet. 48:60-68. Spoel, S. H., Johnson, J. S., and Dong, X. 2007. Regulation of tr adeoffs between plant defenses against pathogens with different lifestyles. Proc Natl. Acad. Sci. U.S.A. 104:18842-18847. Stahl, D. J. and Schafer, W. 1992. Cutinase is not required for fungal pathogenicity on pea. Plant Cell 4:621-629. Staples, R. C., and Mayer, A. M. 1995. Putative virulence factors in Botrytis cinerea acting as a wound pathogen. FE MS Microbiol. 134:1-7. Stephen, D. W. S., Rivers, S. L., and Jamieson, D. J. 1995. The role of the YAP1 and YAP2 genes in the regulation of the adapt ive oxidative stress responses of Saccharomyces cerevisiae. Mol. Microbiol. 16:415-423. Sugiyama, K., Izawa, S. and Inoue, Y. 2000. The Yap1p-dependent induction of glutathione synthesis in heat shock response of Saccharomyces cerevisiae J. Bio. Chem. 275:15535-15540. Sweigard, J. A., Chumley, F ., Carroll, A., Farrall, L., and Valent, B. 1997. A series of vectors for fungal transformation. Fungal Genet. Newsl. 44:52-53.

PAGE 166

166 Takano, Y., Kikuchi, T., Kubo, Y., Hamer, J. E., Mise, K., and Furusawa, I. 2000. The Colletotrichum lagenarium MAP kinase gene CMK1 regula ted diverse aspects of fungal pathogenesis. Mol. Plant-M icrobe Interact. 13:374-383. Takemoto, D., Tanaka, A., and Scott, B. 2006. A p67phox-like regulator is recruited to control hyphal branching in a fungal-gra ss mutulistic symbiosis. Plant Cell 18:2807-2821. Tanaka, A., Christensen, M. J., Takemoto, D., Pa rk, P., and Scott, B. 2006. Reactive oxygen species play a role in regulati ng a fungus-perennial ryegrass mutualistic interaction. Plant Cell 18:1052-1066. Taylor, J. A., and West, D. W. 1980. The use of Evans blue stain to test the survival of plant cells after exposure to high salt and high osmotic pressu re. J. Exp. Bot. 31:571-576. ten Have A., Mulder, W., Visser, J., and van Kan J. A. L. 1998. The endopolygalacturonase gene Bcpg1 is required for full virulence of Botrytis cinerea Mol. Plant-Microbe Interact. 11:1009-1016. Thomason, P., and Kay, R. 2000. Eukaryotic signal transduction via histidine-aspartate phosphorelay. J. Cell Sci. 18:3141-3150. Timmer, L. W. 1999. Diseases of fruit and foliage. In Ci trus Health Managemnet (Timmer, L.W. and Duncan, L.W., eds), pp. 107-115. St. Paul MN: APS Press. Timmer, L. W., Darhower, H. M ., Zitko, S. E., Peever, T. L ., Ibanez, A. M., and Bushong, P. M. 2000. Environmental fact ors affecting the severity of Alternaria brown spot of citrus and their potential use in timing fungicide applications. Plant Dis. 84:638643. Tonukari, N. J., Scot t-Craig, J. S., and Wa lton, J. D. 2000. The Cochliobolus carbonum SNF1 gene is required for cell wall degr ading enzyme expression and virulence on maize. Plant Cell 12:237-247. Toone, W. M., and Jones, N. 1999. AP-1 transcription factor s in yeast. Curr. Opin. Genet. Dev. 9:55-61. Toone, W. M., Morgan, B. A., and Jones, N. 2001. Redox cont rol of AP-1-like factors in yeast and beyond. Oncogene 20:2336-2346. Toone, W. M., Kuge, S. Samuels, M., Morgan, B. A., Toda, T., and Jo nes, N. 1998. Regulation of the fission yeast transcri ption factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (E xportin) and the stressactivated MAP kinase Sty1/S pc1. Genes De v. 12:1453-1463.

PAGE 167

167 Torres L., Martin, H., Garcia -Saez, M. I., Arroyo, J., Molina, M., Sanchez, M., and Nombela, C. 1991. A prot ein kinase gene complements the lytic phenotype of Saccharomyces cerevisiae lyt2 mutants. Mol. Microbiol. 5:2845-2854. van Helden, J. 2003. Regulatory sequence analysis tools. Nucleic Acids Res. 31:25933596. Veal, E. A., Day, A. M. and Morgan, B. A. 2007. Hydrogen peroxide sensing and signaling. Mol. Cell 26:1-14. Viaud, M., Fillinger, S., Lir, W., Polepalli, J. S., Pecheu r, P. L., Kunduru, A. R., Leroux, P., and Legendre, L. 2006. A cl ass III histidine kinase acts as a novel virulence factor in Botrytis cinerea Mol. Plant-Microbe Interact. 19:1042-1050. Vicent, A., Armengol, J., Sa les, R., and Garcia-Jimenez, J. 2000. First report of Alternaria brown spot of citrus in Spai n. Plant Dis. 84:1044. Voigt, C. A., Schafer, W., and Salom on, S. 2005. A secreted lipase of Fusarium graminearum is a virulence factor required fo r infection of cereals. Plant J. 42:364-375. Walker, L., and Estelle, M. 1998. Molecular mechanism of auxin action. Curr. Opin. Plant Biol. 1:434-439. Walton, J. D. 1996. Host-selective toxins: Agents of compatibilit y. Plant Cell 8:17231733. Wang, N. -Y., Lin, C. -H., and Chung, K. -R. 2010. A G subunit gene is essential for conidiation and potassium efflux but dispensable for pathogenicity of Alternaria alternata on citrus. Curr. Genet. 56:43-51 Wendland, J. 2001. Comparis on of morphogenetic networks of filamentous fungi and yeast. Fungal Genet. Biol. 34:63-82. West, A. H., and Stock, A. M. 2001. Histidine kinases and response regulator proteins in two-component signaling systems. Trends Biochem. Sci. 26:369-376. Wheeler, C. R., Salzman, J. A. Elsayed, N. M., Om aye, S. T., and Ko rte, D. W. 1990. Automated assays for superoxide dismut ase, catalase, glutathione peroxidase, and glutathione reductase. A nal. Biochem. 184:193-199. Whiteside, J. O. 1976. A newly recorded Alternaria-induced br own spot disease on Dancy tangerines in Florida. Plant Dis. Rep. 60:326-329.

PAGE 168

168 Whitmarsh, A. J., and Davis, R. J. 1998. Structural organization of MAP-kinase signaling modules by scaffold proteins in yeast and manmals. Trends Biochem. Sci. 23:481-485. Wolanin, P. M., Thomason, P. A., and Stock, J. B. 2002. Hi stidine protein kinases: key signal transducers outside the animal kingdom. Genome Biol. 3:3013.1.8. Wojtaszek, P. 1997. Oxidative burst: an ear ly plant response to pathogen infection. Biochem. J. 332:681-692. Wu, A. L., and Moyero wley, W. S. 1994. GSH1 which encodes gammaglutamylcysteine synthetase, is a target gene for yAP-1 transcriptional regulation. Mol. Cell. Biol. 14:5832-5839. Wurgler-Murphy, S. M., and Saito, H. 1997. Two-comp onent signal transducers and MAPK cascades. Trends Biol. Sci. 22:172-176. Xu, J. -R. 2000. MAP kinases in Fungal Pathogens. Fungal Genet. Biol. 31:137-152. Xu, J. -R., and Hamer, J. E. 1996. MAP kinase and cAMP signaling regulate infection structure formation and pathogenic grow th in the rice blast fungus Magnaporthe grisea Genes 10:2696-2706. Xu, J. -R., Staiger, C. J., and Hamer J. E. 1998.Inactivati on of the mitogen-activated protein kinase Mps1 from the rice blast fungus prev ents penetration of host cells but allows activation of plant defense re sponses. Proc. Natl. Acad. Sci. U.S.A. 95:12713-12718. Yan, C., Lee, L. H., and Davi s, L. I. 1998. Crm1p mediates regulated nuclear export of a yeast AP-1-life transcription factor. EMBO J. 17:7416-7429. Yang, S. L., Lin, C.-H., and C hung, K. -R. 2009. Coordinate c ontrol of oxidative stress tolerance, vegetative grow th, and fungal pathogenicity via the AP1 pathway in the rough lemon pathotype of Alternaria alteranta Physiol. Mol. Plant Pathol. (doi: 10.1016/j.pmpp.2009.09.007) Yos himi, A., Kojima, K., Takano, Y., and Tanak a, C. 2005. Group III histidine kinase is a positive regulator of Hog1-type mitogen-activated protei n kinase in filamentous fungi. Eukaryot. Cell 4:1820-1828. Yoshimi, A., Tsuda, M., and Tanaka, C. 2004. Cloning and characterization of the histidine kinase gene Dic1 from Cochliobolus heterostrophus that confers dicarboximide resistance and osmoti c adaptation. Mol. Genet. Genomics 271:228-236.

PAGE 169

169 Zablotowicz, R. M., Hoadland, R. E., Locke, M. A., and Hickey, W. J. 1995. GlutathioneS-transferase activity and metabolism of glutathione conjugates by rhizosphere bacteria. Appl. Envir on. Microbiol. 61:1054-1060. Zarzov, P., Mazzoni, C., and Mann, C. 1996. The SLT2 ( MPK1 ) MAP kinase is activated during periods of polariz ed cell growth in yeast. EMBO. J. 15:83-91. Zawoznik, M. S., Groppa, M. D., Tomaro, M. L., and Benavides, M. P. 2007. Endogenous salicylic acid potentiates cadmium-induced oxidative stress in Arabidopsis thaliana Plant Science 173:190-197. Zeitlinger, J., Simon, I., Harb ison, C. T., Hanett, N. M. and Volkert, T. L. 2003. Program-specific distribution of a tran scription factor dependent on partner transcription factor and MA PK signaling. Cell 113:295-404. Zhang, Z., and Gurr, S. J. 2001. Expr ession and sequence analysis of the Blumeria graminis mitogen-activated protein kinase genes, mpk1 and mpk2 Gene 266:5765. Zhang, Y., Lamm, R., Pillone l, C., Lam, S., and Xu, J. -R. 2002. Osmoregulation and fungicide resistance: the Neurospora crassa os-2 gene encodes a HOG1 mitogen-activated protein ki nase homologue. Appl. Envi ron. Microbiol. 68:532538. Zheng, L., Campbell, M., Murphy, J. Lam, S., and Xu J. -R. 2000. The BMP1 gene is essential for pathogenicity in the gray mold fungus Botrytis cinerea Mol. PlantMicrobe Interact. 13:724-732.

PAGE 170

170 BIOGRAPHICAL SKETCH Ching-Hs uan Lin was born in 1975 in Taiw an. He received a Bachelor of Science of Medical Technology in Chung Shan Medical University in 1997. After he finished his compulsory military service, he became a medical technologist in the Biochemistry Laboratory Department in Jiann Ren Hospitial in 1999. He later joined in the Institute of Molecular Biology in the National Chung-Hsi ng University and received his Master of Science degree in May of 2004 and continued wo rking in the same laboratory from 2004 to 2006. During that period, he was invo lved in several research projects, but mainly focused on the function and regulatory mechanism of a small heat shock protein in Xanthomonas campestris pv. campestris. Ching-Hsuan was awarded a Grinter Fellowship from the University of Florida and a Hunt Br others Research Scholarship from the Citrus Research and Education Center, Depar tment of Plant Pathology, University of Florida bef ore he joined Dr. Kuang-Ren Chungs Lab. Ching-Hsuans doctoral studies focus on determining the importance of redox-responsive AaAP1 transcriptional factor involved in detoxification of reactive oxygen species of citrus and the interaction and regulation between the AaAP1, mitogen-activated protein kinases and the histidine kinase in Alternaria alternata a necrotrophic fungal pathogen of citrus. He was awarded a Doctor of Philosophy degree in May 2010.