<%BANNER%>

Fifty years of anthropogenic pressure

Permanent Link: http://ufdc.ufl.edu/UFE0041433/00001

Material Information

Title: Fifty years of anthropogenic pressure Temporal genetic variation of the endemic Florida mouse (Podomys floridanus)
Physical Description: 1 online resource (59 p.)
Language: english
Creator: Rivadeneira, Catalina
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: diversity, genetic, microsatellites, podomys
Interdisciplinary Ecology -- Dissertations, Academic -- UF
Genre: Interdisciplinary Ecology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Habitat fragmentation is one of the most important threats to global biodiversity. Although, some of Florida?s ecosystems are naturally fragmented, human development has greatly increased this fragmentation and reduced available habitat for many species. Habitat fragmentation may impede gene flow between adjacent populations and may have significant consequences for population genetic structure. The Florida Mouse (Podomys floridanus) is the only mammal genus endemic to the Florida peninsula. It is considered a vulnerable species by the IUCN, based on the extensive loss of habitat in the last fifty years. Its narrow habitat specificity makes it especially vulnerable to habitat loss. Florida mouse habitat is in high demand for human development because of its high, dry, and well-drained soils, suitable for building homes and for agricultural uses. The objective of this study is to determine whether reduction in populations identified by different researchers over the last fifty years as a consequence of habitat loss can be identified through change in genetic variability. Using molecular markers, I compared genetic variation in two geographic areas, Highlands County (Archbold Biology Station) from 1957, 1983 and 2006, and Alachua County (San Felasco Hammock Preserve) from 1958 and 2009. Fourteen microsatellite loci were genotyped from museum skins and recently caught specimens from The Florida Museum of Natural History. These microsatellites are presented in this study as a tool for genetic population analysis and sixty-two additional microsatellites are described for future use. In Highlands County, population diversity declined from 1957 to 1983. Reduction in genetic diversity (Heterozygosity) suggested that this population underwent a bottleneck. In 2006, dramatic increases in heterozygosity suggest the possibility of a restoration of genetic diversity through gene flow. In San Felasco Preserve, I documented a reduction in the effective number of alleles and a reduction in effective population size over the last 50 years. San Felasco is identified as an area with limited opportunity for recolonization; therefore a decrease in population size appears to be driving a reduction in genetic variability through genetic drift. Comparing current populations of Florida mice from Highlands County (2009) and Alachua County (2006), I found that the Alachua population has fewer alleles, lower effective population size and lower heterozygosity than the Highlands population. This difference might be explained by the observation that San Felasco has limited opportunity for recolonization from neighboring populations. Further, differences in habitat in Highlands and Alachua Counties may account for some of the differences in genetic variability at the two sites.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Catalina Rivadeneira.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Reed, David L.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041433:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041433/00001

Material Information

Title: Fifty years of anthropogenic pressure Temporal genetic variation of the endemic Florida mouse (Podomys floridanus)
Physical Description: 1 online resource (59 p.)
Language: english
Creator: Rivadeneira, Catalina
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: diversity, genetic, microsatellites, podomys
Interdisciplinary Ecology -- Dissertations, Academic -- UF
Genre: Interdisciplinary Ecology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Habitat fragmentation is one of the most important threats to global biodiversity. Although, some of Florida?s ecosystems are naturally fragmented, human development has greatly increased this fragmentation and reduced available habitat for many species. Habitat fragmentation may impede gene flow between adjacent populations and may have significant consequences for population genetic structure. The Florida Mouse (Podomys floridanus) is the only mammal genus endemic to the Florida peninsula. It is considered a vulnerable species by the IUCN, based on the extensive loss of habitat in the last fifty years. Its narrow habitat specificity makes it especially vulnerable to habitat loss. Florida mouse habitat is in high demand for human development because of its high, dry, and well-drained soils, suitable for building homes and for agricultural uses. The objective of this study is to determine whether reduction in populations identified by different researchers over the last fifty years as a consequence of habitat loss can be identified through change in genetic variability. Using molecular markers, I compared genetic variation in two geographic areas, Highlands County (Archbold Biology Station) from 1957, 1983 and 2006, and Alachua County (San Felasco Hammock Preserve) from 1958 and 2009. Fourteen microsatellite loci were genotyped from museum skins and recently caught specimens from The Florida Museum of Natural History. These microsatellites are presented in this study as a tool for genetic population analysis and sixty-two additional microsatellites are described for future use. In Highlands County, population diversity declined from 1957 to 1983. Reduction in genetic diversity (Heterozygosity) suggested that this population underwent a bottleneck. In 2006, dramatic increases in heterozygosity suggest the possibility of a restoration of genetic diversity through gene flow. In San Felasco Preserve, I documented a reduction in the effective number of alleles and a reduction in effective population size over the last 50 years. San Felasco is identified as an area with limited opportunity for recolonization; therefore a decrease in population size appears to be driving a reduction in genetic variability through genetic drift. Comparing current populations of Florida mice from Highlands County (2009) and Alachua County (2006), I found that the Alachua population has fewer alleles, lower effective population size and lower heterozygosity than the Highlands population. This difference might be explained by the observation that San Felasco has limited opportunity for recolonization from neighboring populations. Further, differences in habitat in Highlands and Alachua Counties may account for some of the differences in genetic variability at the two sites.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Catalina Rivadeneira.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Reed, David L.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041433:00001


This item has the following downloads:


Full Text

PAGE 1

FIFTY YEARS OF ANTHROPOGENIC PRESSURE: TEMPORAL GENETIC VARIATION OF THE ENDEMIC FLORIDA MOUSE ( Podomys floridanus) By CATALINA G. RIVADENEIRA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010 1

PAGE 2

2010 Catalina G. Rivadeneira Canedo 2

PAGE 3

To God, who gave me a wonderful family. 3

PAGE 4

ACKNOWLEDGMENTS I am especially thankful to my advisor David Reed for his continued guidance, support and encouragement over t he course of this project. I would also like to thank the members of my committee Lyn Branch and James Austin for their comments. I would like to thank my entire family for their support: my husband for being part of this adventure and his suggestions and support, my parents, my brother and sister for their support throughout the years and my sons for giving me inspiration. Without the continued support from se veral organizations and people, this project would not be possible. Funding and logistic support wa s provided by University of Florida-School of Natural Resource s and Environment and Florida Museum of Natural History. I thank the San Felasco Hammock Preserve for allowing me to do fieldwork in the Preserve and for providin g scientific information. The following people must be thanked for their help with informati on, laboratory support and field work : Candace McCaffery, Larry Harris, Hopi Hoes kstra, Jesse Weber, Julie Allen, Jorge Pino, Angel Soto-Centeno, Lisa Barrow, Chelse y Spirson, Bret Pasch, Sergio Gonzalez, Daniel Pearson and Luis Ramos. I would also like to extend my gratitude to my friends: Candace McCaffery, Caroll Mercado, Marie Claude Arteaga, Heidy Resnikowski, Jorge Pino, Pilar Fuente Alba, Pablo Pinedo, Luis Ramos, Laura Magana, Antonio Rocabado and Mario Villegas for the encouragement given. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ..................................................................................................4 LIST OF TABLES ............................................................................................................7 LIST OF FIGURES ..........................................................................................................8 ABSTRACT .....................................................................................................................9 CHAPTER 1 INTRODUC TION....................................................................................................11 2 FOURTEEN MICROSATELLITE LOCI FOR GENETIC POPULATION STUDIES OF THE ENDEMIC FLORIDA MOUSE ( Podomys floridanus )...............15 2.1 Introduction .......................................................................................................15 2.2 Methods ............................................................................................................16 2.2.1 Primer Selection ....................................................................................16 2.2.2 DNA Amplification (PCR) of 14 Microsatellite Loci ................................17 3 FIFTY YEARS OF ANTHROPOGENI C PRESSURE: TEMPORAL GENETIC VARIATION OF THE ENDEMIC FLORIDA MOUSE ( Podomys floridanus) ............23 3.1 Introduction .......................................................................................................23 3.2. Methods ...........................................................................................................24 3.2.1 Sample Selection ..................................................................................24 3.2.3 DNA Amplification (PCR) ......................................................................26 3.2.4 Data Treatm ent and Statistics ...............................................................27 3.3 Results ..............................................................................................................28 3.3.1 Hardy-Weinberg Equilibrium .................................................................28 3.3.1.1 Archbold Biological Stat ions population, Highlands County ....28 3.3.1.2 San Felasco Hammock Pres erves populations, Alachua County ....................................................................................29 3.3.2 Genetic Diversity ...................................................................................29 3.3.2.1 Genetic diversity in Arc hbold Biological Station, Highlands County ....................................................................................30 3.3.2.2 Genetic diversity in San Felasco Hammock Preserve, Alachua County ......................................................................30 3.3.2.3 Genetic diversity co mparison between Highlands and Alachua populations ...............................................................31 3.3.3 Genetic Distance ...................................................................................31 3.3.4 Estimates of Effective Population Size (Ne) ..........................................32 3.3.5 Allele Frequency ....................................................................................32 3.3.6 Population Structure ..............................................................................32 5

PAGE 6

3.4. Discussion .......................................................................................................33 3.4.1 Historical and Contem porary Genetic Diversity .....................................33 3.4.1.1 Archbold Biological Station, Highlands County ........................33 3.4.1.2 San Felasco Hammock Preserve, Alachua County .................35 3.4.2. Contemporary P opulations Diversity ...................................................37 4 CONCLUS ION........................................................................................................39 REFERENCE LIST ........................................................................................................55 BIOGRAPHICAL SKETCH ............................................................................................59 6

PAGE 7

LIST OF TABLES Table page 2-1 Fourteen microsatellite primer pairs for Florida mouse population studies. ........20 2-2 Observed and expected heterozygosity and number of alleles (Na) for 14 microsatellite loci surveyed in 93 Florida mice. ...................................................20 2-3 Sixty-two primer pairs t hat amplify microsatellites in Florida mice (Size range for Peromyscus ) .................................................................................................21 3-1 Hardy Weinberg Equilibrium test fo r population ABS-1957. P-value (Fishers method), standard error and inbreeding coefficient (Fis) ....................................41 3-2 Hardy Weinberg Equilibrium test fo r population ABS-1983. P-value (Fishers method), standard error and inbreeding coefficient (Fis) ....................................41 3-3 Hardy Weinberg Equilibrium test fo r population ABS-2006. P-value (Fishers method), standard error and inbreeding coefficient (Fis) ....................................42 3-4 Hardy Weinberg Equilibrium test for population of SFH-1958. P-value (Fishers method), standard error and inbreeding coefficient (Fis) .....................42 3-5 Hardy Weinberg Equilibrium test for population of SFH-2009. P-value (Fishers method), standard error and inbreeding coefficient (Fis) .....................42 3-6 Genetic diversity per population (1957, 1983 and 2006) in Highlands County ...43 3-7 Genetic diversity per population (1958 and 2009) in Alachua County ................43 3-8 Genetic diversity comparison betw een historical populations (1957-1958) and current populations (2006-2009) in Highlands and Alachua counties. ................43 3-9 T-test: paired two samples for means in Heterozygosity (He), number of alleles (na) and number of effe ctive alleles (ne) by locus. ..................................43 3-10 Neis unbiased measured of genetic distance using 12 loci and 5 loci ...............44 3-11 Genetic differentiation, pairswise Fst comparison using 12 loci and 5 loci .........44 3-12 Effective population size from Highl ands and Alachua counties using Linkage disequilibrium method by two diff erent programs (LDNe and NeEstimator) .......44 3-13 Structure simulation summary ............................................................................44 7

PAGE 8

LIST OF FIGURES Figure page 2-1 Photo of Podomys floridanus trapped in San Felasco Hammock Preserve ........22 3-1 Distribution map of P. floridanus specimens collected in Florida at FLMNH .......45 3-2 Area of Study in San Felasco Hammock Preserve .............................................45 3-3 Allele frequencies for 12 loci fr om Highlands County from 1957, 1983 and 2006. ..................................................................................................................46 3-4 Allele frequencies for 5 loci from Alachua Count y from 1958 and 2006. ............49 3-5 Comparison of allele frequencies for 12 loci between current populations from Highlands and Alachua counties. ...............................................................50 3-6 Plot of population assignments and coancestry coefficients ( k=5) generated by STRUCTURE for P. floridanus. The five populations are ABS 1957 (yellow), ABS 1983 (blue), ABS 2006 (g reen), SFH 1958 (purple), and SFH 2009 (red). ..........................................................................................................53 3-7 Rarefaction curves showing the num ber of alleles found in one population as a function of increasing sample size. ..................................................................54 8

PAGE 9

Abstract of Thesis Pres ented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Master of Science FIFTY YEARS OF ANTHROPOGENIC PRESSURE: TEMPORAL GENETIC VARIATION OF THE ENDEMIC FLORIDA MOUSE ( Podomys floridanus ) By Catalina G. Rivadeneira May 2010 Chair: David Reed Major: Interdisciplinary Ecology Habitat fragmentation is one of the most im portant threats to global biodiversity. Although, some of Floridas ecosystems are naturally fragm ented, human development has greatly increased this fragmentation and reduced available habitat for many species. Habitat fragmentation may impede gene flow between adjacent populations and may have significant consequences for population genetic structure. The Florida Mouse ( Podomys floridanus ) is the only mammal genus endemic to the Florida peninsula. It is considered a vulnerable species by the IUCN, based on the extensive loss of habitat in the last fifty y ears. Its narrow habitat specificity makes it especially vulnerable to habitat loss. Flor ida mouse habitat is in high demand for human development because of its high, dry, and welldrained soils, suitable for building homes and for agricultural uses. The objective of this study is to det ermine whether reduction in populations identified by different researchers over the last fifty years as a consequence of habitat loss can be identified through ch ange in genetic variability. Using molecular markers, I compared genetic variation in two geographi c areas, Highlands County (Archbold Biology Station) from 1957, 1983 and 2006, and Alachua County (San Felasco 9

PAGE 10

Hammock Preserve) from 1958 and 2009. Fourt een microsatellite loci were genotyped from museum skins and recently caught specimens from The Florida Museum of Natural History. These microsatellites are pres ented in this study as a tool for genetic population analysis and sixty-two additional microsatellites ar e described for future use. In Highlands County, population divers ity declined from 1957 to 1983. Reduction in genetic diversity (Heterozygosity) suggested that this population underwent a bottleneck. In 2006, dramatic increases in heterozygosity suggest the possibility of a restoration of genet ic diversity through gene flow. In San Felasco Preserve, I documented a reduction in the effective number of alleles and a reduction in effective population si ze over the last 50 years. San Felasco is identified as an area wit h limited opportunity for recoloniza tion; therefore a decrease in population size appears to be dr iving a reduction in genetic variability through genetic drift. Comparing current populations of Florida mice from Highlands County (2009) and Alachua County (2006), I found that the Alachua population has fewer alleles, lower effective population size and lower heterozygosity than the Highlands population. This difference might be explained by the observation that San Felasco has limited opportunity for recolonization from neighbori ng populations. Further, differences in habitat in Highlands and Alachua counties may account for some of the differences in genetic variability at the two sites. 10

PAGE 11

CHAPTER 1 INTRODUCTION The Florida Mouse ( Podomys floridanus ) is the only mammal genus endemic to the Florida peninsula (Layne 1992). It is considered a vulnerable species by the IUCN, threatened by the Florida Committee on Rare and Endangered Plants and Animals (Kirkland 1998) and is considered a Species of Special Concern by the Florida Game and Fresh Water Fish Commission (Wood 1996, Kirkland 1998). Its narrow habitat specificity makes it especially vulnerable to habitat loss (Layne 1992). Florida mouse habitat is in high demand for human developm ent because of its high, dry, and welldrained soils, suitable for building homes and for agricultural uses (Layne 1992). P. floridanus was originally described in the genus Hesperomys (Chapman 1889). Later it was moved to the genus Peromyscus as Peromyscus floridanus (Bangs 1898) and was placed in the subgenus Podomys (Osgood 1909). Carleton (1980) elevated Podomys to the generic rank after a major revision of the genus Peromyscus P. floridanus is very similar in external morphology to Peromyscus but they are most closely related to the genera Habromys and Neotomodon (Layne 1992). A recent study of Peromyscus phylogenetics based on mitochondrial cytochromeb sequence data differs significantly from the most current taxonomic arrangement, placing Podomys, Habromys, Megadontomys, Neotomodon, Osgoodomys within Peromyscus (Bradley et al. 2007). Of the other rodents within the geographic range of Podomys it is most likely to be confused with Peromyscus gossypinus (the cotton mouse). They are very similar in appearance but the Florida mouse can be dist inguished by the presence of five well developed plantar tubercles on the soles of the hind feet in contrast to six in the cotton mouse. Typical of all Peromyscus relatives, P. floridanus has a fragile tail sheath, but 11

PAGE 12

larger eyes and ears than species of Peromyscus in Florida (Layne 1992) (Figure 2-1) Moreover P. floridanus has low levels of genetic variability compared with other species of Peromyscus (Smith 1973). The habitat for P. floridanus is primarily scrub and sandhill associations, restricted to fire-maintained, xeric and upland vegetation. Scrub may be the original and primary habitat of the Flori da mouse, while sandhill vege tation is a secondary habitat that may not have been generally occupied until historic times when the original habitat was degraded (Layne 1990, Layne 1992). These tw o vegetation types are closely linked ecologically and historically, however they are different in spec ies composition and physiognomy (Myers 1990): Sandhill, is dominated by open stands of longleaf pine ( Pinus palustris ) or south Florida slash pine ( Pinus elliottii ), deciduous oaks, turkey oak ( Quercus laevis ), and ground cover composed primarily of wire grass (Aristida stricta ). On the other hand, Sand pine scrub, is dom inated by a closed overstory of sand pine ( Pinus clausa ), rosemary ( Ceratiola ericoides ) with an understory of evergreen scrub oaks and a little or no herbaceous ground cover. Scrub habitat occurs on sand ridges or old dunes with deep, fine sand and consists of a closed to open canopy of sand pines ( P. clausa ) (Enge 1999). Many former sandhill and scrub sites hav e been converted to pine plantations, citrus groves and urban areas (Layne 1992, Myers 1990, Kirkland 1998). Human activities have reduced high pine areas by more than 90%, as well as the number and size of scrub patches (Myers 1990). As a re sult, Floridas scrub is one of the most endangered ecosystems in the southeastern Un ited States. Thirteen species of scrub plants and five vertebrates are listed as endangered or thr eatened under the U.S. 12

PAGE 13

Endangered Species Act (Clark et al. 1999). In addition, much of the sand pine scrub association along the Atlantic coast has been destroyed with resultant loss of Podomys populations (Layne 1992). From the early 1940s to 1980s, 64% of the xeric upland habitat suitable for Podomys in Highlands County was destroyed, and an additional 10% was disturbed (Peroni 1983, Layne 1992). In the late 1990s, Lake Wales Ridge, the oldest of Florida's ridges, had been reduced to a mere 15% of its original upland habitat ( Menges 1999 ). In addition, suppression of fire, and the resultant habitat conversion, has reduced P. floridanus populations in many of the remain ing sandhill and scrub habitats (Layne 1992). A longterm monitoring study on Fl orida mouse populations on Smith Lake sandhill in Putman County (Newman 1997) r eported a population dec line beginning in the 1980s. Similarly, trapping success of Fl orida mice showed the magnitude of the reduction. Eisenberg and Fr anz had trapping success of 43% in 1983, whereas Jones had trapping success of 12% from 19841988 and Newman had 1% success in 1996. All three studies use the same trapping te chnique in the same area of Smith Lake sandhills. Additionally, Smith (1973) reported low population dens ities in 26 localities in Florida. However, it should be noted that there are few studies of this type, which can assess long-term trends in population density or relative abundance of Florida mice. The commonality or rarity of P. floridanus in any given part of its range is largely unknown. Other scrub species, such as the Gopher Tortoise ( Gopherus polyphemus), have been affected by extensive land modification and have seen population reductions and extirpations. Gopher Tortoise populations have been drastically reduced in the last 13

PAGE 14

decade, with losses of 33% in some Florida counties (Auffenberg et al. 1981). In the same way, populations of Florida Scrub Jays ( Aphelocoma coerulescens ) have declined statewide by 50% over the last 100 years (Fitzpatrick et al. 1991). Scrub-jay population loss along the Lake Wales Ridge is estimat ed at 80% or more since pre-European settlement (Fitzpatrick et al. 1991). Some of Floridas ecosystems, such as scrub, are naturally fragmented and many species have fragmented distributi ons within scrub habitat (Menges 1999); however human development has further in creased this fragmentation and reduced the habitat for many species. Fragmentation and loss of habitat is a major problem facing biodiversity worldwide (Noss et al. 2006). Fragmentation can lead to isolation of populations, reduction in population size, and reduced gene flow, all of which can decrease genetic diversity (Frankham 1996). Loss of genetic diversity can decrease the ability of an organism to cope with novel environmental challenges (Scribner et al. 2006). Small and isolated populations tend to lose genetic variation over time through genetic drift. Inbreeding can result in lowe r survival and reproduction (Frankham 1995; Reed and Frankham 2003) as well as increasing risk of extinction (Amos and Balmford 2001; Lowe et al. 2004, Saccheri et al 1998; Westemeier et al. 1998). Based on the reported population declines of P. floridanus t he objective of this study is to determine whether there has been a significant change in genetic diversity in populations of P. floridanus over the last 50 years and whet her significant reductions in population size can be detected with molecular data. This thesis is divided in four chapters; the first chapter is the intr oduction, Chapter 2 is a description of 14 microsatellites markers for use in studies of the Florida mouse ( Podomys floridanus ). 14

PAGE 15

Chapter 3 is a comparison of genetic variability over a fifty-year time span in two Florida counties, and finally Chapter 4 is the conclusion of this study. CHAPTER 2 FOURTEEN MICROSATELLITE LOCI FOR GENETIC POPULATION STUDIES OF THE ENDEMIC FLORIDA MOUSE ( Podomys floridanus ) 2.1 Introduction Genetic variation is the raw material of evolution. Species that maintain a large degree of genetic diversity within populations have a greater chance to persist through times of adverse conditions. In recent years many molecular markers have been developed to measure genetic variation within and among populations. There are two categories of markers: Co-domin ant markers that allow us to identify all the alleles that are present at a particular locus; and dominant markers that reveal only a single dominant allele (Freeland 2005) Microsatellite loci (Co-dominant markers) were selected in this study, on t he basis of their effectivene ss in population genetic studies. Microsatellites are short t andem repeats of nucleotides lo cated throughout nuclear and chloroplast genomes and have been found in the mitochondrial genomes of some species (Freeland 2005). Microsatellites are one of the most popular molecular markers used in population genetics. They have high levels of polymorphism that result from a hi gh mutation rate of around 10 -3 or 10 -4 events per locus per replication in mice (Dallas 1992). This high polymorphism makes them very desirable fo r inferring relatively recent population genetic events (Freeland 2005, Allendorf and Luikart 2008). Moreover, homologous microsatellites can often be easily assay ed across a wide number of closely related species (Weber et al. 2009, Prince et al 2002). Homologous sequences in different 15

PAGE 16

species often show a degree of similarity to one another because they are descended from the same ancestral gene. Therefore, looking for molecular markers for one species by examining the genome of a closely related species is rapidly increasing the efficiency of finding new markers for population-level studies. The genus Podomys is nested within the genus Peromyscus based on molecular data (Bradley et al. 2007). Therefore, I evaluated 526 primer pairs that am plify microsatellite DNA loci for Peromyscus maniculatus bairdi (Weber et al. 2009). From this set I selected primers that successfully amplified microsatellites in P. floridanus A panel of fourteen microsatellites described in this chapter as well as a longer list of 62 additional primer pairs, can be very helpful for future popul ation genetic studies of P. floridanus 2.2 Methods 2.2.1 Primer Selection Primers used for DNA amplificati on were originally developed for Peromyscus maniculatus bairdii by Weber and colleagues from Harvard University (Hoeskstra laboratory). They described 526 primer pairs (Weber et al. 2009) that amplify microsatellite DNA loci for P. maniculatus bairdii From this set of 526, 480 primers were tested for three individual Florida mice (from DNA extracts of fresh tissue at approximately 40-50 ng/uL). In collaboration with Hoekstra Laborator y, PCR was performed in a reaction volumes of 15uL: 1uL template, 1.5uL of 10x bu ffer, 0.3uL of 10mM total dNTPs, 0.6uL forward primer (1um), 0.6uL reverse primer (10um), l abeled CAG Primer (5CAGTCGGGCGTCATCA 3), 0.3uL of MgCl 2 0.15uL taq and 10.01uL of water. The amplification had an initial denatur ation step at 94 C for 2 min, followed by 20 cycles of 20s at 94 C, 20s at 60 C (decreasing 5 C ) and 30s at 72 C. Then followed by 15 16

PAGE 17

cycles of 20s at 94 C; 20s at 50 C, 30s at 72 C and a final extension step of 72 C for 5 minutes. Amplifications were visualized wit h agarose gel electrophor esis. In total, 76 microsatellite loci successfully amplified for Podomys floridanus After several tests of these 76 microsatellites in the Reed Laboratory (University of Florida), I selected four teen microsatellites to anal yze temporal and geographic genetic variation in populations of P. floridanus (Chapter 3). 2.2.2 DNA Amplification (PCR) of 14 Microsatellite Loci PCR amplification was performed in a final volume of 25uL containing 12.5uL Microsatellite master mix (Q iagen), 9uL of water, 0.5uL of forward primers (1uM) and 0.5uL reverse primers (10uM), 0.5uL of dye 6-FAM (10uM) and 2uL of DNA template (40-50ng/uL). Forward primers in each pair were modified on the 5 end to include a sequence tag M-13 (5-CACGAC GTTGTAAAACGAC-3) allowing the use of a third oligonucleotide in the PCR that is fluorescently labeled for detection. The amplification was carried out under the following c ondition: initial denaturalization step at 95 C for 5 min, followed by 20 cycles of 30s at 95 C, 1min 30s at 60 C (decreasing 0.5 C each time) and 30s at 72 C. Then followed by, 15 cycles of 30s at 95 C; 1min 30s at 48 C, 30s at 72 C and a final extension step of 72 C for 30 min. 2.3. Results In Table 2-1 are fourteen primer pairs fo r microsatellites useful for population studies of P. floridanus The size of microsatellites ranged from 120-396 base pairs. Microsatellite repeats were di and tetra-nucleotide. These microsatellites were used to study the population geneti cs of Florida mice in Highlands County at 3 periods of time and in Alachua County at two periods of time 17

PAGE 18

(Chapter 3). All microsatellites were pol ymorphic, however two loci (pmbw392, pmbw400) were monomorphic for two populations The overall number of alleles (na) ranged from 4 to 27. The m ean expected heterozygosity is 0.79 and the mean observed heterozygosity is 0.66 (Table 2-2). Sixty-two additional primer pai rs that amplified in Flor ida mice are available in this chapter (Table 2-3). They were not used for population analysis, but they are a potential resource for future studies. 2.4. Discussion The use of primers developed for Peromyscus maniculatus bardii to amplify microsatellites in Podomys floridanus was sufficient to acquire enough variable markers for a population genetic study of P. floridanus The ability of these markers to achieve amplification beyond Peromyscus to Podomys extends the utility of the work by Weber et al. (2009), who also i dentified amplification in Peromyscus polionotus subgriseus Primer pairs developed in one species can often be used in closely related species because priming sites are generally chosen in highly conserved regions of sequence data (Allendorf et al. 2008). Many studies have reported cross-species amplification of microsatellit es. For example, of 18 microsatellite loci developed for Panthera tigris sumatrae, 16 of these markers produced a single band in all three tiger and ten non-tiger felid species (Williamson et al. 2002). Along the same lines, crossspecies amplification of 6 micros atellite loci in big brown bats ( Eptesicus fuscus), was successfully performed in species of t he family Vespetilionidae and Antrozoidae (Vonhof et al. 2002). 18

PAGE 19

The primer pairs presented in this study offer the first list of microsatellite markers that can be used for population genetics or genetic mapping studies in P. floridanus Many population analyses require large numbers of loci to be statistically sound, such as measuring the effects of bottleneck events, which require at least 10-20 polymorphic microsatellites (Lowe et al. 2006). There are other genetic markers available for Florida mice, such as mitochondrial markers (cytochrome b ) and proteins at the National Center for Biotechnology Information (Genbank; http://www.ncbi.nlm.nih.gov). However micros atellites are very suitable for inferring relatively recent population events. They can easily discriminate genetically between individuals and populations (Freeland 2005). 19

PAGE 20

Table 2-1. Fourteen microsatellite primer pairs for Florida mouse population studies. Locus Pmbw Forward Primers Reverse Primers Size Range 52 ACTGTGCAATCAGCCTAC ATGTTCCCCTTCTACCTC 272-304 206 CTTGTTGTGACTAGTGGAGG TCTTGATACGAAGGCAGC 220-250 217 ACACCATAAGATGGGCAGAC AGCTGAATTGGTCCAGTGAC 274-314 219 TGTCAAGGGTCCTCTATCTG TAACCCAAGCATTCTCACTG 278-336 220 TAATCCACTCACCTCATCTG TTAAGTTGAAGACCAACCTG 254-296 252 AGCTTCCCCCATTATTTG ACAACAGCCAGGAAATGC 184-296 264 TGGTTACAATCTCCCCTTTC TCCTGCTTTGCCTTTATCTC 196-396 274 GCTCAGTAAAAGAGCCTTGC CCAGCCAAACCTAGTCAGTG 218-264 294 AAATTCAGGCCAAGTGTG AACAGGAAAGCAGCAATG 122-170 392 TCTCTGGTCCAAACCTTTC TC TACTGTCACCTTGCTGTG 120-130 400 AATCTGGGTTTACAAAGGATAC ATGGCAGACATTACAAGAGC 146-154 403 AGACCCACCTACCCTTGC TACCAATAGTTCCCTAAACAC 156-238 421 TGTTTGCTTCAAGCTCGC GCCCTCTTACCTTACACCAC 166-284 428 TGAAGTGAGTAAAGGAAGCAG GTCCTCCAAGATTGAATGC 155-193 Table 2-2. Observed and expected heterozygos ity and number of alleles (Na) for 14 microsatellite loci surveyed in 93 Florida mice. Locus He observed He expected Na Pmbw 52 0.75 0.87 14 Pmbw 206 0.76 0.85 13 Pmbw 217 0.80 0.92 18 Pmbw 219 0.85 0.93 24 Pmbw 220 0.75 0.90 19 Pmbw 252 0.72 0.90 18 Pmbw 264 0.75 0.90 18 Pmbw 274 0.75 0.89 16 Pmbw 294 0.29 0.65 9 Pmbw 392 0.16 0.18 4 Pmbw 400 0.27 0.49 4 Pmbw 403 0.88 0.88 14 Pmbw 421 0.76 0.93 27 Pmbw 428 0.68 0.82 16 Mean 0.66 0.79 15 20

PAGE 21

Table 2-3. Sixty-two primer pai rs that amplify micr osatellites in Florida mice (Size range for Peromyscus ) Locus Pmbw Forward Primers Reverse Primers Size Range 12 TTCTGTGGCCTCTGTGAACG ACATTGGCTGTAAGTCTGGG 302-328 59 TCAGTGAGTAAAGGTGTTC AGTACATTGGATAGCATAC 308 89 ACTGATGCAAGCATAACC ACTTTCTGTGCCTTTGAG 235 91 CAAGTTTGGTGGGAAGGC TTGAGATGCAAATGGGTG 242 95 AAATTGGACTGTGGGTAG ATAGCCAGTGCATTCTTC 273-277 197 CACCCGATTGGTCTAATAAC TTCTAGCTCCAGGCATCTTC 186-279 210 TTCAGGCATGTCACAGATTC AGCATTCGGTAGCATAATTG 240-262 227 CCCAAGGCAAAGCGTATC ATCCCAGCAATGGAAACC 273-390 247 TAAAAGAGGCAAACCAAATG CTCCCAAAGGTGGCAGTG 305-314 251 AGCATTGATATGAGGGTTTG ATCTAGAACTGCTAAGGATTCC 271-279 260 GCAAGGGGAGAAGGCTAG GAAACCTTCCCATACCAGAG 279 263 CCTGGCTTCTCAGAGTGGTG TGCTGTTTAGAGGCATTTGG 305 272 AGACATAGAGTTTACCACAATC GTGTAGCTGAAAGTGGCAC 182-190 300 TTCCTTTTGTTCTCCCTG GATCTGTTAGTTTCTGACCTAC 247-307 302 GAACAACAAGGGACAAGC ATGCCATTTATTCATACCC 265-274 304 TGATCCCAACAGCTTACAC GAAGCCTAAGTCCATTCTTC 270-278 346 CCCTGAGGAAGACAATTTC GCCTAACAGGAGCTGAAC 145-179 348 TTAAAGCCAGTTACTCATCC CCAAAGTTCCAGGACATATC 156 349 TGAAAAGGCAGACTGGAAG AACTCTGAGAAGCTGTGAGG 273-283 356 CTCTGCTCTTCTTTGCCTAC CCTGTTCTGATGGGTTGG 299 363 GAACAATACCAAAGACTATCC TC AGTGTAACTCTACAGCATC 291 364 AGGTCGTGGCTGCTTATG TGTGCACAGAATGACTTTATC 153 393 TGCCTGTGACATCACCATC GCTGGAGGGGATGTATGAG 294-306 399 CACTGGGTGAACTACAACCTC ACCTCAGGGTTCCTACCTG 230-264 402 GAAAACCAGTTCTCCCATTC TTATCTGAGCAGTTAGGCAAG 254 406 CCTAACATCAACTGAAGTCTCC GCCAAAGTTTAGTGTTTATCTC 221-237 416 TCCACAAAGTTCCCTCTG ACCTACATGGTAACTGTCTTAC 109-118 429 AGTTTGAGGCCAACTTAGG TCAATTGATTTGTCCAAAAG 302-328 430 TGGACAGCCAGTTGATACAC AAGTGGACAGGGAAAAGC 175-186 431 ACTGTTAGCAGCACGAGC AGAGATGCCATCTGTCTGTC 281-285 433 CACTCCAGAAACAGAGGTAGG AAGCTTTGAACTCCTTATCAG 147-155 436 CAGAGGCAGGTGGGTCTC TCTCGCTCAGTTTCATTCC 220-250 448 TTTCTTTCACTTTCTTTGCC CATGATGTCAACCTCTGGTG 234 449 TCAGTGGCCTTTCTGTATC TTCCAGCTTCTAGTGTCTTC 251 455 GTTCTTTAACTCAGTCCCAAG CTTTACCCACCCACCTTC 190-228 457 ATGGCTGGCTTAGACTGG CTCTTTGAATTTATGGCCTC 259 467 CTCCCTGTCTGGGGTGAG GTTCAGTTCCCTGCTTGC ~ 100 469 TTTCAACAACTTCCAGGTC AG GCAGGTTTCATCATAAC 229 478 ATTAGAGGCCCAACAATG CTCCAGGTCAGTTAGACAGC 205 479 TGGGACTGTTTGGGTAGC CAAAATTACTGTGGTTCATCC 135-141 489 TTCAAAATCACCCTGATACTC ACAGAAAGACAGAAAGGACAG 264-276 491 ACACCTGGTTCCCTCCTC AACTGCTAAGTCAACAGAAAAG 242-251 492 ACTTCCTAGTAAGCCCTATTTC CTGCTCCCAAATTATCTGTC 141-145 500 GTAGCAGTAAACATTCCAGATC GGTATACAGCCTAGGTGGAG 272 21

PAGE 22

Table 2-3. Continued Locus Pmbw Forward Primers Reverse Primers Size Range 506 CTCATTCCTCAGCCATTTAC AGCCATGATATTTCTGTTCC 254-275 508 AGGGACACTGAGATGGCTAC GGAAATCTACTGATGGGCAC 223-233 518 AAAGGATGACAGGTTGGAAC AATACCCAGGGAAGAAGAAC 187 523 CAGACACTGCCAAGGAGG GCTAGAGCGGGTGGTTAG 260 526 TCACATTGATCTTGACAACTG CAAGCACTTTATCAAATAAGC 249-326 527 ATGGGTAAGAGGGAAAGG AGAAATTCTGATCCGAAATAG 274-282 533 TGAATCAGAGGGCAGAGC TGGAGAAGTGGCAAAGAAG 190-253 534 GCTTATTCCTCGGCCTCTAG GGTGGCTCCTCATGCTTC 118-127 574 TTCTTGCAGAGGTAATGAAGTC TCTCTTGAGGGTATGGTTATTC 242 581 ATACCACAGGTGAGGCTCTTC TTCTGACTCTTTCTTCCCAAC 298 586 CCTTAGTTTGTGATGATGG GCTGAGACAGGAGGATTGC 212-252 599 AGATTGTGAGCAACTGTATGG ACTGCCCTCTCAAGACAAAAG 239-251 604 ACTCAAACCCAGGTCATCG CTGCCCTCTCAAGACAAAAG 212-219 635 GGGGAGAATAGATTTGGTTAG CTGTGCGTCTGCCTGTC 312-327 639 GACAACAGACACCCCTAATC G TTCCCAGCACCCAAATAG 254-307 662 AGCCACCTCAAGAGTCATC CTTGGGACTTGCCATACAG 297 665 GGGCACACAAGCACTATTTC CCAGGCTGACCTCAAACTC 195 667 GCTGCCTGCTGAGAATC GAAGCCTGGTCTCAAGTAAC 229-269 Figure 2-1. Photo of Podomys floridanus trapped in San Felasco Hammock Preserve 22

PAGE 23

CHAPER 3 FIFTY YEARS OF ANTHROPOGENIC PRESSURE: TEMPORAL GENETIC VARIATION OF THE ENDEMIC FLORIDA MOUSE ( Podomys floridanus) 3.1 Introduction The Florida mouse (Fig. 2-1), the onl y endemic mammal of Florida, has undergone population declines lately In the last 50 years researchers reported a high reduction in habitat suited for this species and as consequence a decrease in population levels (Newman 1997, Layne 1992, Peroni 1983). In an effort to identify the degree to which this reduction has caused a loss in genetic diversity, I examined allele variation in museum and recently caught specimens from the Florida Museum of Natural History (FLMNH, Gainesville, Florida). Specimens stored in museum collections represent the genetic diversity of past populations often predating anthropogenic changes. Thus, museum specimens present the remarkable opportunity to step back in time and assess pre-disturbance levels of genetic diversity in populations that may be presently depleted or extirpated. Ancient DNA techniques allow the meas urement of temporal changes in allele frequencies and gene coalescence that at present can only be estimated from spatially distributed living populations (Roy et al. 1994). The FLMNH has a large collection of P. floridanus specimens. There are more than 1900 specimens collected by different re searchers since 1925 in twenty Florida Counties: Alachua, Brevard, Citrus, Clay, Gilchrist, Her nando, Highland, Taylor, Indian River, Lake, Levy, Marion, Na ssau, Orange, Palm Beach, Pi nellas, Putnam, St. Jones, St. Lucie, and Sumter (Figure 3-1). This collection represents an important genetic resource that will permit reconstruction of past population structure, the estimation of past bottlenecks and other population genetic estimates. 23

PAGE 24

Genetic diversity is one of the three forms of biodiversity recognized by the IUCN as deserving conservation, along with specie s and ecosystem diversity (McNeely et al. 1990). The amount of genetic va riation within a population gives insight into the demographic structure and evolutionary history of a populati on. For instance, lack of genetic variation may indicate that the population has gone through a recent, dramatic reduction in size (Allendorf and Luikart 2008). Understanding how much genetic variation has been lost over time in populations of Florida mice can play an important ro le in their conservation and management. Furthermore, as its habitat has become high ly developed, the data generated in this study will be useful for inferring possible loss of genetic variation in other areas with similar biologic and anthropogenic characteristics. 3.2. Methods 3.2.1 Sample Selection The FLMNH has P. floridanus specimens from twenty counties in Florida. Highlands and Alachua counties were selected for this study because they contained many geographically close samples that ran ged in collection dates from the 1950s to the present. Samples from other counties co ntained too few specimens from any single time period to be of use. A total of 93 specimens of Florida mice were studied from populations in Archbold Biological Station (ABS) in Highl ands County from 1957, 1983, 2006, and two populations from 1958 and 2009 from San Felasco Hammock Preserve (SFH) in Alachua County. All Samples from Archbold Biological Station were taken from the FLMNH collections, twenty specimens were taken from 1957, twenty from 1983 and nineteen specimens from 2006 (collect ed by different researchers). 24

PAGE 25

For San Felasco, twenty specimens from 1958 were taken from FLMNH, and fourteen individuals were trapped and released alive in 2009. I trapped within the trapping grid used by James Layne: Stations 21 and 31 (Figure 3.2) during his extensive studies of Podomys (Laynes field notes are held at the FLMNH). I trapped in collaboration with people from FLMNH for 8 nights between April 17 th and May 7 th Four hundred traps were set every night and a total of 14 Florida mice were captured. The distal portion of their tail (s ans vertebrae) was removed from each individual. Their tails were marked with permanent ink, treated with an antibiotic to stave off infection, then the mice were released within an hour of c apture. No individual mouse was sampled more than once (recapture was plainly evident by their tail tips being missing and ink on their tail). Lastly tails clips from fres h specimens were stored at -20C until DNA extraction. Liver tissue was taken from specimens collected in Highlands 2006 (10 mg) during the preparation of voucher specimens at the FLMNH. Tissue samples from historical museum specimens were taken fr om skin (10 mg), whic h was cut from the suture line on the ventral side of the prepared specimen and stored at -20C. 3.2.2 DNA Extraction The total DNA extraction was carried out using the Qiagen Kit for animal tissue following the manufactures instructions. In the case of museum skin samples we used the same protocol but tissues were firs t soaked in 250l 1X PBS overnight in the refrigerator. DNA extraction was suspended in a final volume of 200uL of elution buffer (for fresh tissue) and 60uL (for mu seum samples) and stored at -20 C. 25

PAGE 26

To reduce the chance of contamination, DNA extractions from historical skins were carried out in the ancient DNA laboratory at the FLMNH. All mate rials (tips, tubes, etc.) were UV irradiated prior to labwork. 3.2.3 DNA Amplification (PCR) Primers used for DNA amplificati on were originally developed for Peromyscus maniculatus bairdii by Weber and colleagues from Harvard University (see Chapter 2 of this thesis). For the present study I us ed 14 microsatellite lo ci: pmbw52, pmbw206, pmbw217, pmbw219, pmbw220, pmbw252, pmbw264, pmbw274, pmbw294, pmbw392, pmbw400, pmbw403, pmbw421, pmbw428 (Table 2.1). PCR amplification was per formed in a final volume of 25uL containing 12.5uL Microsatellite master mix (Q iagen), 9uL of water, 0.5uL of forward primers (1uM) and 0.5uL reverse primers (10uM), 0.5uL of dye and 2uL of DNA template (40-50 ng/mL). Forward primers in each pair were modified on the 5 to include a sequence tag M-13 (5-CACGACGTTGTAAAACGAC-3) a llowing the use of a third oligo in the PCR that is fluorescently labeled for detection. The amplification was carried out under the following c onditions: initial denaturation step at 95 C for 5 min, followed by 20 cycles of 30s at 95 C, 1 min 30s at 60 C (decreasing 0.5 C each time) and 30s at 72 C. Then followed by 15 cycles of 30s at 95 C, 1 min 30s at 48 C, 30s at 72 C and a final extension step of 72 C for 30 min. All PCR products were visualized on a 2% agarose gel for verification of amplification. In order to monitor contamination, negative controls were run for PCR and run on electrophoresis gels along with samples. Finally, 6uL of PCR product was sent for genotyping (ICBR Genetic Laborator yUniversity of Florida). 26

PAGE 27

3.2.4 Data Treatme nt and Statistics This study considered a total of five samples (three samples from Highlands County and two samples from Alachua County, collected at different per iods of time). To assign individuals to populations, I us ed the Bayesian clustering software STRUCTURE v. 2.2 (Pritchard et al. 2007). Th is software assigns individuals to 1 of k populations, allowing for admixture, without a priori knowledge of the source population. The value k is defined by the user and I evaluated values of k from 1 to 7. I allowed a burn-in of 10,000 replicates and sampled from the subsequent 2 million generations. Microsatellite alleles sometimes do not amplify during PCR (null alleles) and heterozygotes can be genotyped erroneously as homozygotes. To determine presence of null alleles, GENEPOP v.4 software was used. In addition, linkage disequilibrium was tested in order to identify non-random as sociation of alleles among loci using GENEPOP v.4. Loci were analyzed using Genemarker so ftware (Softgenetics). This program calculates allele (microsatellite) lengths. Fourteen microsatellite loci were successfully amplified for four of the five populations; only 7 loci could be genotyped for the 1958 population from San Felasco. Six genetic diversity paramet ers were estimated using the program PopGene (Yeh et al. 1999): allele frequencies, percent polymorphic loci (P), number of alleles per locus (Na), e ffective number of alleles per locus (ne), observed heterozygosity (Ho) and expect ed Heterozygosity (He, computed using Levene1949). Genetic distanc e among populations was also analyzed with PopGene. Significant differences among populations fo r He, Na and ne were tested with a paired ttest. Tests for deviations from Hardy Weinberg equilibrium (HWE) were performed across all loci using GENEPOP 4.0 (Rousset, 1997), applying the exact test with default 27

PAGE 28

settings of the Markov chain (Dememorizat ion: 10000, Batches: 20, Iterations per batch: 5000). To estimate population differentiation from allele frequency (Fst) and allele size (Rst), GENEPOP 4.0 software was used. GENEPOP was also used to estimate pairwise differentiation and degree of inbreeding (Fis) (Weir and Cockerham 1984). Effective population size (Ne) was calc ulated with NeEstimator version 1.3 ( Peel et al. 2004 ) using linkage disequilibrium method ( Hill 1981) and LDNE version 1.31 (Waples et al. 2008). 3.3 Results For the fourteen polymorphic loci surveyed, 214 alleles were observed among 93 individuals. The total number of alleles per locus ranged from 4 to 27 (see Table 2-2). There was significant departure from Hard y Weinberg Equilibrium (HWE) detected in the five populations analyzed (see below). Locus pmbw294 showed evidence of null alleles in 4 of the 5 popul ations studied, and significant linkage disequilibrium was detected between locus pmbw428 and 4 other loci (pmbw206, pmbw264, pmbw294, pmbw400). Thus, loci pmbw294 and pmbw428 were removed from further analysis. 3.3.1 Hardy-Weinberg Equilibrium 3.3.1.1 Archbold Biologi cal Stations populati on, Highlands County The three populations from Highlands (1957, 1983 and 2006) deviated from HardyWeinberg Equilibrium at = 0.05 (Tables 3-1 through 3-3). However for each population we can see that just a few loci show si gnificant departure from HWE, suggesting that these loci may be responsible for the previous significant result when comparing all loci. In the population from 1957 three of 12 loci were out of HWE, the removal of one locus (pmbw392), produced HWE estimates that were not significant (P=0.17). In 1983, I found similar results, two of 12 loci are highl y significant however removal of these loci 28

PAGE 29

(pmbw217, pmbw252) produced a non-significant test of HWE (P=0.0 8). In the same way, three loci from the 2006 population showed significant departure from HWE but removing these loci ( pmbw206, pmbw400, pmbw392) led to a non-significant test of HWE (P=0.19). For the 1957 population, three loci (pmbw252, pmbw392, and pmbw421) showed significant heterozygote deficiency (Fis) and all loci were polymorphic (Table 3-1). For 1983, four loci (pmbw52, pmbw217, pmbw 264, pmbw421) had signif icant heterozygote deficiency and two loci were monomorphic (pmbw392, pmbw400) (Table 3-2). In 2006, one locus (pmbw220) had a significant deficit of heterozygosity and all loci are polymorphic (Table 3-3). 3.3.1.2 San Felasco Hammock Preser ves populations, Alachua County The population from 1958 was found to be out of HWE, however a single locus was driving this departure from HWE. Af ter removing this locus (pmbw252), the population was within HWE expe ctations (P=0.06). Two loci were found to be monomorphic and Fis showed signif icant deficit of He for two loci (Table 3-4). Similar to the 1958 population, the current population (2009) had one locus (pmbw421) that was out of HWE. The total population was also out of HWE but in this case removing locus pmbw421 resulted in signi ficant difference from HWE. There was not a significant deficit of He in 2009 and all loci were polymorphic (Table 3-5). 3.3.2 Genetic Diversity The overall Fst for the five populations studied (Highlands and Alachua) was Fst=0.13. Fst values ranged from 0.05-0.25, which indica ted moderate genetic differentiation (Freeland 2005). The percent polymorphism per population ranged from 71.4% to 100%. The mean value of observ ed heterozygosity was Ho = 0.68 and the 29

PAGE 30

expected was He=0.80. All loci were pol ymorphic except for locus pmbw392 and locus pmbw400 from population ABS-Highlands 1983 and SFH-Alachua 1958, respectively. 3.3.2.1 Genetic diversity in Archbold Biological Station, Highlands County The total number of alleles in Arc hbold Station was 166. 120 alleles were identified in the Archbold population of 1957, 103 allele s in 1983 and 119 alleles in 2006. The maximum number of alleles per locus was 24 (pmbw421) and the minimum was 3 (pmbw392). All 12 loci were polymorphi c for the 3 populations except two loci (pmbw392 and pmbw400) that were monomorphic in the 1983 population. In Table 3-6 we see that from 1957 to 1983 there was a significant decline in heterozygosity (P=0.026) and a signific ant increase from 1983 and 2006 (P=0.049). Interestingly, there was no significant difference in heterozygosity between 1957 and 2006. Although number of alleles and effective number of alleles show the same pattern of reduction from 1957 to 1983 and increase in 2006, there was no significant difference among the values from the three time peri ods. In addition, private alleles and percent polymorphism exhibit the same pattern. Levels of genetic diversity averaged acro ss loci in Highlands County indicated moderate genetic differentiation, Fst = 0.07 (R st=0.005). However, pairwise Fst values indicated little genetic differentiation bet ween 1957 and 1983 (Fst=0.03; Rst=-0.01), moderate genetic differentiation between 19 57 and 2006 (Fst=0.08; Rst= 0.02); and moderate differentiation between 1983 and 2006, (Fst= 0.08; Rst=0.002) 3.3.2.2 Genetic diversity in San Fe lasco Hammock Preserve, Alachua County From the analysis of five mi crosatellite loci, 30 alleles were identified in the 1958 population and 21 alleles in 2009. The maximu m number of alleles per locus was 13 (pmbw421) and the minimum was 2 (pmbw392, pmbw400). Two loci were 30

PAGE 31

monomorphic (pmbw392 and pmbw400) in the 1958 population and the remaining loci were polymorphic in both populations. Genet ic differentiation between past and present populations was pronounced; Fst = 0.36, Rst=0.22 (>0.25, Freeland 2005). Table 3-7 shows a significant decrease in the effective number of alleles (P= 0.023) from 1958 to 2009. There was an incr ease in private alleles and polymorphic loci, however the there was neither a signifi cant difference in Heterozygosity (p= 0.13) nor number of alleles (p=0.054). 3.3.2.3 Genetic diversity comparison betw een Highlands and Alachua populations In 1957 and 1958 the populations from Highlands and Alachua counties do not showed significant differences in Heterozygos ity (P=0.20) or total number of alleles (P=0.078), but they did differ si gnificantly in the number of e ffective alleles (P=0.01). In contrast, the current population from Highlands had signific antly greater levels of heterozygosity (P=0.022), numbers of alleles (P < 0.001) and effective number of alleles (P < 0.001) compared to the current populat ion from Alachua county (Tables 3-8 and 39). 3.3.3 Genetic Distance Neis genetic distance values showed great er distance between populations from 1957 and 2006 than from 1957 and 1983 in Highl ands County (Table 3-10). Pairwise Fst indicated little differentiation betw een1957 and 1983 and moderate differentiation between1957 and 2006 (Table 3-11). The gr eatest genetic distance observed was between the 1958 and 2009 populations in Alac hua County (Table 3-10). This comparison also had the largest Fst estimate. 31

PAGE 32

3.3.4 Estimates of Effect ive Population Size (Ne) In Highlands County, there was inconsist ency in estimates of effective population size over the three times periods and bet ween the two methods used for estimation. Negative values estimate by LDNE for 1983 and 2006 are interpreted as infinitely large effective populations. In contrast, NeEstimator showed a reduction in effective population size from 1957 to 1983 and failed to es timate Ne in the population from 2006 (Table 3-12). The estimates for Alachua County, however, were more consistent between analytical methods. Both softw are programs estimated a reduction in population size from 1 958 and 2009 (Table 3-12). 3.3.5 Allele Frequency In Figure 3-3 we can see the allele frequen cy distribution for Archbold Biological Station (Highlands). Three periods of time (1957, 1983, and 2006) were compared by locus. Over time the allele frequencies changed in all loci. In total, 26 alleles since 1957 were lacking in 2006 and 19 new alleles were present in 2006. The 1958 population at San Felasco Preser ve also contained alleles lacking in the 2009 population (e.g., in locus pmbw252 six alle les are lost over time). In total for 5 loci, 18 alleles were absent in 2009 population and the current population contained 8 new alleles. Allele frequencies changed for all loci when comparing 1958 to 2009 (Figure 3-4). The current populations from Alachua and Highlands counties had different allele frequencies. Highlands had more alleles than Alachua (Figure 3-5). 3.3.6 Population Structure Structure analysis evaluated values of k (number of populatio ns) from 1 to 7 with the highest likelihood associated with k= 5 populations (Ln P(D) = -3853.3; Table 3-13 The populations correspond with the 5 populations we defined a priori Structure 32

PAGE 33

attempts to assign individuals to populations without knowle dge of where (or in this case, when) they were collected. The yello w, blue, and green bars represent individuals from the Archbold Biological Station in Highlands County, whereas the purple and red bars represent San Felasco Preserve in Al achua County (Figure 3-6). The output from Structure shows clear dist inction between Highlands Co unty and Alachua County with few individuals showing any affinity for the opposite locality. Howe ver, there was more continuity across time within a given locality For example, seve ral of the individuals from the 1957 Highlands populat ion (yellow) had a high probabi lity of being assigned to the 1983 Highlands populat ion (blue). If these were spat ially segregated populations, we would say that those indi viduals showing blue affinities in the 1957 population might be recent migrants. Howeve r, because we are talki ng about temporally sampled populations, we might conclude that a number of haplotypes fr om the 1983 population were retained through time from the earlier 1957 population. Visually, there seems to be more similarity between 1957 and 1983 than any other two comparisons. 3.4. Discussion 3.4.1 Historical and Contemporary Genetic Diversity 3.4.1.1 Archbold Biological Station, Highlands County From 1957 to 1983 the population declined in genetic diversity (heterozygosity, number of polymorphic allele s and private alleles). Genetic diversity may have been reduced by events such as habitat fragm entation where prev iously widespread populations are divided and effectively reduced in size (Lowe 2006). These results are coincident with the time (1980s ) when researchers reported a reduction in populations of Florida mice (Peroni 1983, Layne 1992). In Highlands County, Layne (1992) reported that 64% of suitable habitat was destroyed for Podomys from 1940-1981. Similar to the 33

PAGE 34

observations in Highlands County, Newman (1997) identifies a decline in 1980s in Smith Lake sandhill in Putnam County. Estimates of effective population size (from LDNE and NeEstimator) were inconsistent for Highlands County. Al though when a population undergoes a bottleneck its allelic diversity usually decreases and this can lead to reduced expectations of heterozygosity under HWE (Lowe 2006), which is what we see from 1957 to 1983. Given the overall loss of genetic diversity from 1957 to 1983, it is likely that the population experienced a bottleneck and t hat our analytical methods (LDNE and NeEstimator) were incapable of estimating Ne with enough accuracy to show this. It is possible that the poor estimates of Ne are the result of low sample sizes and could be improved greatly in future studies. Samples taken from 1957 and 1983 are geogr aphically closer (0.2 miles), than either is to the collecting site from 2006 (7 and 8 miles away, re spectively). It is critical when studying population genetic variation thr ough time that each temporal sample is taken from the same geographic locality to avoid sampling from distinctly different populations, and thus inferring genetic change ov er time erroneously. Populations from Highlands County are very close geographically with no obvious barriers between sites. Additionally, the average home range of Florida mice is 4,042 m 2 for males and 2,601 m 2 for females, and female home ranges do not overlap, except occasionally with juveniles (Jones 1995). Therefore, I am conf ident that differences between temporally sampled populations in Highland s County represent temporal changes in allele richness and frequency rather than spatial ones. Neve rtheless, the genetic distance between populations from 1957 and 2006 is large (0.49) with moderate differentiation (Fst = 0.08) 34

PAGE 35

between them. These differences could be ex plained either by spatial variation across known populations over a 7-8 mile distance or by temporal variation of a 50-year time span. After the decline in genetic diversity fr om 1957 to 1983 in Highlands County, we see that the 2006 population has a greater heterozygosit y, new private alleles and polymorphic alleles. It is possible that gene flow with neighboring p opulations restored previous levels of genetic variation. In additi on, I identified several new alleles present in the current (2006) population that were not found in previous populations. Whilst a population may rapidly recover in size after a bottleneck, the levels of genetic variation do not recover until restored by mutation or gene flow (Lowe 2006). Fluctuation in heterozygosity from 1957 to 2006 can be also related to changes in habitat quality through time, in response to the natural dynamic of fire. The rate and magnitude of post-fire recovery of reproduction by plants produc ing seeds or fruits used by animal species has important implications at the comm unity level (Abrahamson and Layne 2002). For example, acorns appear to be a major food source for Florida mouse, when available, and generally higher ac orn production correlates with greater abundance of Podomys (Layne 1990). Therefore, it is possible that we are seeing population cycling at one time scale (changes in Podomys abundance driven by food availability or the affects of fire on habitat) and population decline over a much longer time scale (due to habitat degradation). T easing these two apart would require far greater sampling than was attempted in this study. 3.4.1.2 San Felasco Hammock Preserve, Alachua County The pronounced levels of genetic differentiation (Fst = 0. 36) as well as the large genetic distance (1.15) between present and hi storic populations are perhaps surprising 35

PAGE 36

given that I was able to collect in precis ely the same area as the 1957 population (less than 0.2 miles). The large genetic differentiation over time, the small effective population size (Ne) and significant reduction in effe ctive number of allele s suggests that the original 1957 population may have undergone a bottleneck in some point in the past (similar to populations from Highlands County in 1983). After a bottleneck, populations from 1957 may have had limited opportunity for recolonization (Layne 1991) with less opportunity for an influx of genes from neighboring populations, to restore genetic diversity. This could lead to a population in 2009 with lower genetic variability. The high levels of genetic differentiation and distance between these populations can be the result of genetic drift, the effect of which is more profound in small populations (Freeland 2005). James Layne began working in San Felasco Hammock Preserve in 1957. He reported a reduction in Flori da mouse populations beginning in 1980 at these sites. Specifically, for Station 6 (sta. 6 is close to my study area) he mentioned that it appears that the Florida mouse population in this is olated sandhill site has gone extinct (Layne 1991). Thus, it is likely to expect local extinctions or reductions occurred in other stations in San Felasco. The two primary effects of genetic drift are changes in allele frequency and loss of genetic variation. The smaller the populati ons size, the greater the changes in allele frequency, because the new population will carry only a portion of the genetic diversity that was present in the source populat ion (Lowe 2006, Freeland 2005, Allendorf and Luikart 2008). Reduced levels of genetic di versity may render t he population unable to adapt to a changing environment. 36

PAGE 37

3.4.2. Contemporary P opulations Diversity Results suggest that the current popul ations from San Felasco Hammock Preserve (Alachua County) and Archbold Bi ological Station (Highlands County) have undergone a reduction in populati on size (bottleneck) in the past. However populations sampled from Alachua County contain fewe r alleles (a=70) and less heterozygosity (Ho=0.56) than those of Highlands Count y (a=119; Ho=0.81). Isolation and limited opportunity for recolonization in San Felasco (station 6) reported by Layne (1991) likely contributed to the low divers ity found in Alachua County. Is olated populations will have greater effects from genetic drift and lower genetic variation compared to populations that have greater gene flow with neighb oring populations (Freeland 2005). Patches of habitat suitable for Florida mice are often naturally fragmented. As a consequence of patchiness, habitat quality varies spatially, and many species are distributed as metapopulations linked by o ccasionally dispersal (Groom 2006). If dispersal between patches becomes impossible for Podomys due to distance or lack of corridors, then the populations may decline with less chance of source populations providing new migrants. Habitat differences in the two counties may also explain differences in genetic variability. Florida mice in Alachua Count y are found in sandhill habitats whereas the mice from Highlands are found in scrub habitat. Mice in sandhills are usually found in lower in abundance compared to populations in scrub. Layne (1990) identified higher population densities in scrub and smaller home range size. Scrub habitat may have a greater carrying capacity, perhaps because oaks are more abundant. Moreover, Layne attributed the decline of Florida mice in San Felasco to the chronically low carrying capacity of sandhill habitat (Layne 1991). 37

PAGE 38

For the conservation of species inhabiting fragmented habitats, securing dispersal corridors between local habita t patches appears to be a challenge. Connection between areas through biological corridors seems to be important for both study areas here, but especially important for San Fela sco Hammock Preserve, where genetic diversity is low and local extinctions and limited opportunity for recolonization were identified previously Layne (1991). Perhaps one area to take into consideration is the west side of the 75 highway recommended by Layne (1991), who indicated that this area could serve as a source of new animals to replenish declines he observed at San Felasco Hammock Preserve. The Florida mouse is narrowly restricted to fire-maintained habitat. Populations of Podomys decline as the habitat becomes dense and shady (Layne 1992). Thus, it is also recommended to continue with periodic burns; burned areas were found with an increase of open areas and more seedling stems (Jones 1990, Newman 1997). Jones (1990) referred to Podomys as a good colonist on high sandhills, (e.g., the Ordway property in Putnam County) consequent ly; an increase of habitat quality and connectivity may facilitate recolonization of Podomys populations in the Preserve. It is suggested for future studies to increase sample sizes and the number of microsatellite loci exam ined. For this study, I examined 14-20 specimens per population, which was sufficient for the prim ary questions addressed in this thesis. However, it is likely that better paramet ers estimates could have been achieved by increasing the number of individuals per popu lation and the number of loci examined (especially for the population from Alachua count y in 1958) to better locate rare alleles. Figure 3-7 shows the number of alleles observed by locus in relation to sample size 38

PAGE 39

used in this study (20 individuals, Highlands 1957). For the six loci shown, 100% of the alleles were identified in a sample of 12-18 individuals. However, in one locus (pmbw52) a new allele was found in the 20 th individual examined suggesting that more rare alleles could be found in the population with greater sampling effort. I suggested for future research an increase in both samp le size and the number of loci examined especially for tests of bottlenecks. CHAPTER 4 CONCLUSION This study provides evidence that in Highlands County, populations of Florida mice likely declined from the 1950s to the 1 980s as evidenced by a large decline in genetic diversity during that ti me period. However, esti mates of genetic diversity returned to 1950s levels by 2006, likely through the proce ss of gene flow with neighboring populations. Thus, there is no significant difference in genetic diversity when comparing the current populations of Hi ghlands County to those of the 1950s. In Alachua County, I found great er genetic differentiation and genetic distance over the same 50 year time span. Clear evidence of a population decline appears to be driving genetic differentiation in Alac hua County through genetic dri ft, likely because of reduced gene flow with neighboring populations, in contra st to the pattern in Highlands County. When we compare the current populat ions of Alachua County and Highlands County to one another, we see a significant difference in genetic diversity. The population from Alachua County has fewer a lleles, lower heterozygosity and lower effective population size than the Highl ands population. This difference can be explained by the fact that San Felasco is id entified as an area with limited opportunity for recolonization (Layne 1991) and perhaps by the fact that t hese populations have 39

PAGE 40

different habitats. Florida mouse density is reportedly lower in sandhills like San Felasco, and population isolation has been reported there previously. Seventy six primer pairs for P. floridanus DNA microsatellites described in this study will constitute a great tool for futu re population genetics and genetic mapping studies for P. floridanus Fourteen loci were used to conduct population genetic studies. More studies are needed on the population genetics of P. floridanus in order to know historic and current population structure better Understanding popul ation genetic change over time can guide management and cons ervation decisions for this species. To accomplish this I suggest to consider th e importance of scientif ic collection that museums provide, which allows reconstruction of past events though the use of historical specimens. 40

PAGE 41

Table 3-1. Hardy Weinberg Equilibrium test for population ABS-1957. P-value (Fishers method), standard error and inbreeding coefficient (Fis) Locus P-value S.E. Fis W&C Fis P-value Pmbw 52 0.1828 0.0215 -0.0441 0.19 Pmbw 206 0.8245 0.0105 -0.0772 0.88 Pmbw 217 0.0445 0.0104 0.0366 0.08 Pmbw 219 0.1703 0.0330 0.0216 0.08 Pmbw 220 0.4085 0.0296 -0.0688 0.80 Pmbw 252 0.2106 0.0266 0.1679 0.01 Pmbw 264 0.3366 0.0308 -0.0588 0.43 Pmbw 274 0.2093 0.0254 -0.0570 0.72 Pmbw 392 0.0255 0.0007 1.0000 0.02 Pmbw 400 1.0000 0.0000 -0.1515 1.00 Pmbw 403 0.9436 0.0087 -0.0688 0.84 Pmbw 421 0.0454 0.0167 0.1437 0.02 Probability 0.0399 Table 3-2. Hardy Weinberg Equilibrium test for population ABS-1983. P-value (Fishers method), standard error and inbreeding coefficient (Fis) Loci P-value S.E. Fis W&C Fis P-value Pmbw 52 0.0962 0.0063 0.2199 0.004 Pmbw 206 0.3238 0.0276 0.0943 0.31 Pmbw 217 0.0078 0.0037 0.1483 0.01 Pmbw 219 0.4552 0.0324 0.1000 0.27 Pmbw 220 0.1940 0.0213 0.1565 0.09 Pmbw 252 0.0057 0.0024 0.0603 0.18 Pmbw 264 0.4076 0.0250 0.1510 0.03 Pmbw 274 0.2191 0.0315 0.0471 0.36 Pmbw 392 monomorphic Pmbw 400 monomorphic Pmbw 403 0.9433 0.0035 -0.2245 1.00 Pmbw 421 0.0890 0.0169 0.2177 0.002 Probability 0.0031 41

PAGE 42

Table 3-3. Hardy Weinberg Equilibrium test for population ABS-2006. P-value (Fishers method), standard error and inbreeding coefficient (Fis) Loci P-value S.E. Fis W&C Fis P-value Pmbw 52 0.4098 0.0200 0.0847 0.39 Pmbw 206 0.0096 0.0050 0.2707 0.05 Pmbw 217 0.3484 0.0336 0.0270 0.39 Pmbw 219 0.4048 0.0433 0.0286 0.64 Pmbw 220 0.1313 0.0201 0.1751 0.01 Pmbw 252 0.1296 0.0133 0.1330 0.10 Pmbw 264 0.8347 0.0113 0.0319 0.32 Pmbw 274 0.8476 0.0202 0.0033 0.47 Pmbw 392 0.0383 0.0013 -0.5652 1.00 Pmbw 400 0.0004 0.0003 -0.5510 1.00 Pmbw 403 0.4365 0.0323 -0.0426 0.65 Pmbw 421 0.2518 0.0387 -0.0189 0.47 Probability 0.0013 Table 3-4. Hardy Weinberg Equilibrium test for population of SFH-1958. P-value (Fishers method), standard error and inbreeding coefficient (Fis) Loci P-value S.E. Fis W&C Fis P-value Pmbw 220 0.0682 0.0092 0.1795 0.02 Pmbw 252 0.0000 0.0000 0.5412 0.00 Pmbw 392 Monomorphic Pmbw 400 monomorphic Pmbw 421 0.2136 0.0204 0.1258 0.05 Probability Highly significant Table 3-5. Hardy Weinberg Equilibrium test for population of SFH-2009. P-value (Fishers method), standard error and inbreeding coefficient (Fis) Loci P-value S.E. Fis W&C Fis P-value Pmbw 220 0.0758 0.0088 0.0209 0.60 Pmbw 252 0.0731 0.0038 -0.0954 0.45 Pmbw 392 0.1133 0.0018 0.6486 0.11 Pmbw 400 --Pmbw 421 0.0056 0.0010 0.2753 0.12 Prob. Fishers m. 0.0015 42

PAGE 43

Table 3-6. Genetic diversity per populati on (1957, 1983 and 2006) in Highlands County Parameters ABS 1957 ABS 1983 ABS 2006 Number of different a lleles (na) 10 8.5 9.9 Number of effective Al leles (ne) 6.2 5.9 6.3 No. Private Alleles 1.5 0.47 1.0 % Polymorphic loci 100% 71,4% 100% Heterozygosity observed (Ho) 0.75 0.65 0.81 Unbiased expected Hetero z.(He) 0.75 0.73 0.81 Table 3-7. Genetic diversity per popul ation (1958 and 2009) in Alachua County Parameters SFH1958 (5 loci) SFH 2009 (5 loci) Number of different alleles (na) 6 4.2 Number of effective Alleles( ne) 4.5 2.6 No. Private Alleles 1.2 0.4 % Polymorphic loci 71,4% 100% Heterozygosity observed (Ho) 0.38 0.44 Unbiased expected Heteroz.(He) 0.52 0.49 Table 3-8. Genetic diversity comparison bet ween historical populations (1957-1958) and current populations (2006-2009) in Highlands and Alachua counties. Parameters ABS1957 (5 loci) SFH1958 (5 loci) ABS2006 (12 loci) SFH2009 (12 loci) Number of different alleles (na) 8.6 6 9.9 5.8 Number of effective Alle les( ne) 5.3 4.5 6.3 2.9 No. Private Alleles 1.4 0.5 1.0 1.2 % of Polymorphic loci 100% 71,4% 100% 100% Heterozygosity observed (Ho) 0.55 0.38 0.81 0.56 Unbiased expected Heteroz. (He) 0.60 0.52 0.81 0.59 Table 3-9. T-test: paired two samples for means in Heterozygosity (He), number of alleles (na) and number of effective alleles (ne) by locus. Populations p-value (He) pvalue (na) p-value (ne) ABS1957-ABS1983 (12 loci) 0.026 0.11 0.25 ABS1983-ABS2006 (12 loci) 0.049 0.12 0.21 ABS1957-ABS 2006 (12 loci) 0.22 0.43 0.34 SFH1958-SFH2009 (5 loci) 0.13 0.054 0.023 ABS1957-SFH1958 (5 loci) 0.20 0.078 0.01 ABS2006-SFH2009 (12 loci) 0.022 0.00083 0.0007 43

PAGE 44

Table 3-10. Neis unbiased measured of genetic distance using 12 loci and 5 loci Comparison Genetic distance (12 loci) Genetic distance (5 loci) ABS 1957-1983 0.17 0.05 ABS 1983-2006 0.36 o.41 ABS 1957-2006 0.44 0.39 SFH 1958-2009 1.13 0.80 SFH 1957-ABS 1958 0.30 0.10 SFH 2009-ABS 2006 0.68 0.35 Table 3-11. Genetic differentiation, pairswis e Fst comparison using 12 loci and 5 loci Comparison Pairwise Fst (12 loci) Pairwise Fst (5 loci) ABS 1957-1983 0.03 0.03 ABS 1983-2006 0.08 0.13 ABS 1957-2006 0.08 0.16 SFH 1958-2009 0.36 0.36 SFH 1957-ABS 1958 0.05 0.05 SFH 2009-ABS 2006 0.17 0.15 Table 3-12. Effective population size from Highlands and Alachua counties using Linkage disequilibrium method by two different programs (LDNe and NeEstimator) Population Ne Estimator Ne Lower 95%CI Upper 95%CI LDNe Ne Lower 95%CI Upper 95%CI ABS 1957 32.4 26.6 41.0 32.2 21 57 ABS 1983 11.9 10.1 4.3 -9.7 -11.2 Large ABS 2006 NaN NaN NaN -300.9 133.2 Large SFH 1958 22.4 9.2 Large -56.4 8 Large SFH 2009 4.2 3.8 4.8 2.8 1.9 3.3 NaN =not available (NeEst imator). Lowest allele frequency used was 0.05 (LDNE) Table 3-13. Structure simulation summary K Ln P(D) 1 -4604.5 2 -4225.0 3 -4146.5 4 -3963.5 5 -3853.3 6 -3866.3 7 -3975.3 44

PAGE 45

Figure 3-1. Distribution map of P. floridanus specimens collected in Florida at FLMNH Figure 3-2. Area of Study in San Felasco Hammock Preserve 45

PAGE 46

Figure 3-3. Allele frequencies for 12 loci from Highlands County from 1957, 1983 and 2006. 46

PAGE 47

Figure 3-3. Continued 47

PAGE 48

Figure 3-3. Continued 48

PAGE 49

Figure 3-4. Allele frequencies for 5 loci from Alachua Count y from 1958 and 2006. 49

PAGE 50

Figure 3-5. Comparison of allele frequencie s for 12 loci between current populations from Highlands and Alachua counties. 50

PAGE 51

Figure 3-5 continued 51

PAGE 52

Figure 3-5. Continued 52

PAGE 53

Figure 3-6. Plot of population assignments and coancestry coefficients ( k=5) generated by STRUCTURE for P. floridanus. The five populations are ABS 1957 (yellow), ABS 1983 (blue), ABS 2006 (g reen), SFH 1958 (purple), and SFH 2009 (red). 53

PAGE 54

Figure 3-7. Rarefaction curves showing the nu mber of alleles found in one population as a function of increasing sample size. 54

PAGE 55

REFERENCE LIST Abrahamson WG, Layne JN (2002) Post-fire recovery of acor n production by four oak species in southern ridge sandhill asso ciation in south-central Florida American journal of botany, 89,1, 119-123. Allendorf FW, Luikart G (2007) Conservation and the G enetic of Populations Blackwell Publishing. Oxford Amos W, Balmford A ( 2001) When does conservation genetics matter? Heredity 87,3, 257-65 Auffenberg W, Bury, R Bruce, Franz R (1981) The status and distribution of the gopher tortoise (Gopherus polyphemus). U.S. Dept. of the Interi or, Fish and Wildlife Service. Washington, D.C. Bangs O (1898) The land mammals of peninsular Florida and the coast region of Georgia. Boston Society of Natural History 28, 157-235. Bradley RD, Durish ND, Rogers DS, Miller JR Engstrom MD and Kilpatrick CW (2007) Toward a molecular phylogeny for Peromyscus : evidence from mitochondrial cytochrome-b sequences. Journal of Mammalogy 88 1146-1159. Carleton, MD (1980). Phylogenetic relationships in neotomine-peromyscine rodents (Muridae) and a reappraisal of the dic hotomy within New World cricetinae. Miscellaneous Publications Museum of Zoology, Univer sity of Michigan 157,1-146. Chapman F.M (1889). Preliminar y descriptions of two apparently new species of the genus Hesperomys from Florida. Bulletin of the American Museum of Natural History 2 ,117 Clark AM, Bowen BW, and Branch LC (1999) Effe cts of natural habit at fragmentation on an endemic scrub lizard ( Sceloporus woodi ): a historical perspective based on a mitochondrial DNA gene genealogy. Molecular Ecology 8 1093 Dallas JF (1992) Estimation of microsatelli te mutation rates in recombinant inbred strains of mouse. Mammalian Genome, 3 ,452-456 Enge KE (1999) Habitat occurrence of Florida' s native amphibians and reptiles. Florida. Game and Fresh Water Fish Commission. Stat e University System of Florida, PALMM Project. Fitzpatrick J W, Woolfenden GE Kopeny MT (1991) Ecology and development-related habitat requirements of the Florida scrub jay ( Aphelocoma coerulescens coerulescens ).Florida Game and Fresh Water Fi sh Commission .Tallahassee, Fl. 55

PAGE 56

Frankham R (1995) Inbreeding and ex tinction: a threshold effect. Conservation Biology 9 ,792 Frankham R (1996) Relationship of genetic va riation to population size in wildlife. Conservation Biology 10, 1500 Freeland JR (2005) Molecular Ecology. John Wiley & Sons Ltd. England Groom MJ, Meffe GK, Carroll CR (eds) (2006) Principles of Conservation Biology Massachusetts USA Hill, WG (1981). Estimation of effect ive population size from data on linkage disequilibrium. Genetical. Research 38, 209-216. Jones CA (1990) Microhabitat use by Podomys floridanus in the high pine land of Putnam County, Fl. PhD. disse rtation, The University of Florida, Gainesville,158 pp. Jones CA (1995) Habitat use and home range of Podomys floridanus on the Ordway preserve. Bulletin of the Florida Museum of Natural History. 38,195-209 Kirkland G (1998) Podomys floridanus in: North America Rodent Status Survey and conservation Action Plan. (eds Hafner D, Yensen E, Kirkland G.) UICN, Switzerland and Cambridge UK. Layne JN (1990). The Florida mouse in Burrow associates of the gopher tortoise (eds Dodd CK Jr., Ashton RE Jr., Franz R, Wester E). Proc.8 th Ann. Mtg. Gopher Tortoise Council. FLMNH, 134pp. Gainesville Fl. Layne JN (1991). Report on DNR research/Col lection Permit PI-o 22790-A Submitted to SAN Felasco Hammock Preserve. Layne JN (1992) Florida Mouse in Rare and Endangered Biota of Florida : Mammals, 1 (S.R. Humphrey ed.) Univ. Presses of Florida,pp250-264. Gainesville Florida. Levene H (1949) On a matching problem in genetics. Annals of Mathematical Statistics 20, 91-94. Lowe A, Harris S, Ashton P (2004) Ecological genetics, design, analysis and application Blackwell Publishing, Oxford. UK. Menges ES ( 1999) Ecology and conservation of Florida scrub. In The Savanna, Barren, and Rock Outcrop Communities of North America Anderson RC, Fralish JS, and Baskin J (eds.). Cambridge University Press Cambridge, UK 470 pp 56

PAGE 57

McNeely JA, Miller KR, Reid WV, Mittermei er RA, Werner TB. (1990). Conserving the worlds biological diversity. IUCN, Wo rld Resources Institute, Conservation International, WWF-US and the World Bank, Washington, DC. Myers RL (1990). Scrub and high pine. in Ecosystems of Florida. (eds Myers RL, Ewel JJ) pp150. University of Centra l Florida Press, Orlando, Fl. National Center for Biotechnology Informati on, U.S. National Li brary of Medicine. Genbank: http://www.ncbi.nlm.nih.gov Newman C (1997) The Florida Mouse ( Podomys Floridanus ): Long-Term dynamics of a population in the high Pine sandhills of Pu tman County, Florida. Master Thesis. 101pp The University of Florida. Gainesville. Noss R, Csuti B, Groom M ( 2006) Habitat fragmentation in Principles of Conservation Biology ( eds Groom MJ, Meffe GK Carroll CR and Contributors). Massachusetts. USA Osgood WH (1909). Revision of t he mice of the American genus Peromyscus. North American Fauna 28,1-285 Peel D, Ovenden JR, Peel SL (2004). NeEsti mator: software for estimating effective population size, Version 1. 3. Queensland Government Department of Primary Industries and Fisheries. Peroni, PA (1983). Vegetation history of t he southern Lake Wales Ridge, Highlands County, Florida. Bucknell University. Prince KL, Glenn TC, Dewey MJ (2002). Crossspecies amplification among Peromyscines of new microsatellite DNA loci from the Oldfield mouse ( Peromyscus polionotus subgriseus ). Molecular Ecology Notes 2 ,133-136. Pritchard JK, Wen X, Falush D. (2007). Documentation for structure software: Version 2.2. University of Oxford. Reed DH, Frankham R (2003) Correlation between population fitness and genetic diversity. Conservation Biology, 17, 230-237. Rousset F (2007) GENEPOP: a complete reimplementation of GENEPOP software for windows and Linux. Molecular Ecology Notes in press Roy MS, Girman DJ, Taylor AC, Wayne RK (1994). The use of museum specimens to reconstruct the genetic variability and re lationships of extinct populations. Experientia 50, 551. Saccheri I, Kuussaari M, Kankare M, Vikman P, ForteliusW, Hanski I (1998) Inbreeding and extinction in a butterfly metapopulation. Nature 392 491. 57

PAGE 58

Scribner KT, Meffe GK, Groom MJ (2006) Conservation Genetic in Principles of Conservation Biology (eds Groom MJ, Meffe GK y Carr oll CR) pp. 375-416. Sinauer. Sunderland, MA. Smith MH, Selander RK, Johnson WE (1973) Biochemical polymorphism and systematic in the genus Peromyscus. 3. Variation in the Florida deer mouse ( Peromyscus floridanus), a Pleistocene relict. Journal of. Mammalogy 54 ,1,1 Vonhof MJ, Davis CS, Fenton MB,. Strobeck C (2002) Characterization of dinucleotide microsatellite loci in big brown bats ( Eptesicus fuscus), and their use in other North American vespertilionid bats. Molecular Ecology Notes, 2 ,167-169. Waples RS, Do C (2008) LDNE: a program for estimating effective population size from data on linkage disequilibrium. Molecular Ecology Resources, 8 ,4, 753. Weber JN, Peters MB, Tsyusko OV, Linnen CR, Hagen C, Schable NA, Tuberville TD, Mckee AM, Lance S.L., Jones KL, Fisher HS, Dewey MJ, Hoekstra HE, Glenn TC (2009) Five hundred microsatellites loci for Peromyscus. Conservation Genetic. Technical notes Doi 10.1007/s1 0592-009-9941-x Weir BS, Cockerham CC. (1984) Estimating Fstatistics for the analysis of population structure. Evolution 38 1358-1370. Westermeier RL, Brawn JD, Simpson SA, Esker TL, Jansen RW, Walk JW, Kershner EL, Bouzat JL, Paige KN (1998) Tracking the long-term decline and recovery of an isolated population. Science 282 1695. Williamson JE, Huebinger RM, Sommer JA, Louis EE, Barber RC (2002) Development and cross-species amplification of eighteen microsatellite mark ers in the Sumatran tiger ( Panthera tigris sumatrae). Molecular Ecology Notes 2 110-112 Wood DA (1996) Floridas endangered specie s, threatened species and species of special concern: official list and the prim ary laws and regulations accommodating their welfare. Florida Game and Fresh Water Fish Commission. Bureau of Nongame Wildlife, Division of Wildlife. Tallahassee, Florida. Yeh FC, Yang R (1999) POPGENE VERSION 1.31. Microsoft Window-based Freeware for Population Genetic Analysis. Quick User Guide. University of Alberta. 58

PAGE 59

BIOGRAPHICAL SKETCH Catalina Rivadeneira C anedo was born in Mexico on Febr uary of 1975, but moved to La Paz, Bolivia at the age of three; she spent most of her youth there. In January 1993, she began college at Universida d Mayor de San Andres in La Paz-Bolivia, where she received her degree in biology (Licenciada en Biologa). She then moved to Santa CruzBolivia and worked for a Bolivian NGO in biodiversity conservation (Fundacin Amigos de la Naturaleza) for three years. She began graduate school in January of 2008 at The University of Florida, School of Natu ral Resource and Environment, and received her Master of Science degree in Interd isciplinary Ecology in May of 2010. 59