<%BANNER%>

Biogenesis of Chloroplast Thylakoid Translocase Subunit cpTatC

Permanent Link: http://ufdc.ufl.edu/UFE0041417/00001

Material Information

Title: Biogenesis of Chloroplast Thylakoid Translocase Subunit cpTatC
Physical Description: 1 online resource (147 p.)
Language: english
Creator: Martin, Jonathan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: chloroplast, membrane, protein, tat, tatc, thylakoid, tic110, tic40
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: BIOGENESIS OF CHLOROPLAST THYLAKOID TRANSLOCASE SUBUNIT CPTATC Thylakoid membranes have a unique complement of proteins, most of which are synthesized in the cytosol, imported into the stroma, and translocated into thylakoid membranes by specific thylakoid translocases. Known thylakoid translocases contain a core multi-spanning, membrane-integrated subunit which is also nuclear-encoded and imported into chloroplasts before being integrated into thylakoid membranes. Thylakoid translocases play a central role in determining the composition of thylakoids, yet the manner by which the core translocase subunits are integrated into the membrane is not known. We used biochemical and genetic approaches to investigate integration of the core subunit of the chloroplast Tat translocase, cpTatC, into thylakoid membranes. In vitro import assays show that cpTatC correctly localizes to thylakoids if imported into intact chloroplasts, but it does not integrate into isolated thylakoids. In vitro transit peptide processing and chimeric precursor import experiments suggest that cpTatC possesses a stroma-targeting transit peptide. Import time course and chase assays confirmed that cpTatC targets to thylakoids via a stromal intermediate, suggesting that it might integrate through one of the known thylakoid translocation pathways. However, chemical inhibitors to the cpSecA-cpSecY and cpTat pathways did not impede cpTatC localization to thylakoids when used in import assays. Analysis of membranes isolated from Arabidopsis thaliana mutants lacking cpSecY or Alb3 showed that neither is necessary for cpTatC membrane integration or assembly into the cpTat receptor complex. These data suggest the existence of another translocase, possibly one dedicated to the integration of chloroplast translocases. Alb4 and Sec2 are recently discovered putative chloroplast protein translocases. Results from in vitro import experiments suggested that cpSecY2 and SecA2 both localize to chloroplasts. Inducible RNAi enabled a CPSECY2 transcript reduction to ~40% of wild type levels in Arabidopsis seedlings. Reductions to CPSECY2 transcripts resulted in bleached cotyledons and plastids that mostly lack thylakoids, similar to phenotypes that have been observed in cpTatC, Alb3, and cpSecY knockout mutants. Reduction of CPSECY2 transcripts gave way to reductions of cpTatC transcript and protein levels. TIC40, cpSecY, and TIC110 protein levels were also reduced in cpSecY2 RNAi seedlings, suggesting that cpSec2 may be involved in the biogenesis or stability of bacterially-conserved core thylakoid translocase subunits, and novel eukaryotic-derived subunits of the chloroplast import apparatus.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jonathan Martin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Cline, Kenneth C.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041417:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041417/00001

Material Information

Title: Biogenesis of Chloroplast Thylakoid Translocase Subunit cpTatC
Physical Description: 1 online resource (147 p.)
Language: english
Creator: Martin, Jonathan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: chloroplast, membrane, protein, tat, tatc, thylakoid, tic110, tic40
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: BIOGENESIS OF CHLOROPLAST THYLAKOID TRANSLOCASE SUBUNIT CPTATC Thylakoid membranes have a unique complement of proteins, most of which are synthesized in the cytosol, imported into the stroma, and translocated into thylakoid membranes by specific thylakoid translocases. Known thylakoid translocases contain a core multi-spanning, membrane-integrated subunit which is also nuclear-encoded and imported into chloroplasts before being integrated into thylakoid membranes. Thylakoid translocases play a central role in determining the composition of thylakoids, yet the manner by which the core translocase subunits are integrated into the membrane is not known. We used biochemical and genetic approaches to investigate integration of the core subunit of the chloroplast Tat translocase, cpTatC, into thylakoid membranes. In vitro import assays show that cpTatC correctly localizes to thylakoids if imported into intact chloroplasts, but it does not integrate into isolated thylakoids. In vitro transit peptide processing and chimeric precursor import experiments suggest that cpTatC possesses a stroma-targeting transit peptide. Import time course and chase assays confirmed that cpTatC targets to thylakoids via a stromal intermediate, suggesting that it might integrate through one of the known thylakoid translocation pathways. However, chemical inhibitors to the cpSecA-cpSecY and cpTat pathways did not impede cpTatC localization to thylakoids when used in import assays. Analysis of membranes isolated from Arabidopsis thaliana mutants lacking cpSecY or Alb3 showed that neither is necessary for cpTatC membrane integration or assembly into the cpTat receptor complex. These data suggest the existence of another translocase, possibly one dedicated to the integration of chloroplast translocases. Alb4 and Sec2 are recently discovered putative chloroplast protein translocases. Results from in vitro import experiments suggested that cpSecY2 and SecA2 both localize to chloroplasts. Inducible RNAi enabled a CPSECY2 transcript reduction to ~40% of wild type levels in Arabidopsis seedlings. Reductions to CPSECY2 transcripts resulted in bleached cotyledons and plastids that mostly lack thylakoids, similar to phenotypes that have been observed in cpTatC, Alb3, and cpSecY knockout mutants. Reduction of CPSECY2 transcripts gave way to reductions of cpTatC transcript and protein levels. TIC40, cpSecY, and TIC110 protein levels were also reduced in cpSecY2 RNAi seedlings, suggesting that cpSec2 may be involved in the biogenesis or stability of bacterially-conserved core thylakoid translocase subunits, and novel eukaryotic-derived subunits of the chloroplast import apparatus.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jonathan Martin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Cline, Kenneth C.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041417:00001


This item has the following downloads:


Full Text

PAGE 1

1 BIOGENESIS OF CHLOROPLAST THYLAKOID TRANSLOCASE SUBUNIT CPTATC By JONATHAN REED MARTIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Jonathan Reed Martin

PAGE 3

3 To my family and teachers

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisor and mentor, Ken Cline, and the members of my graduate committee, Drs.: Kevin Folta, David Oppenheimer, Gary Peter, and Mark Settles, for their advice, encouragement, and fellowship. I would also like to thank our collaborator, Dr. Donna Fernandez, and I acknowledge those who have sent materials that I needed for experiments, including Drs.: Danja Schunemann, Ralph Henry, Nam Hai Chua, Jodi Maple, Simon Moller, Felix Kessler, Danny Schnell, and Hsou -min Li. I would also like to acknowledge the members of Dr. Clines lab, whom have all helped me: Mike McCaffery, Carole Dabney -Smith, Fabien Gerard, Jose Celedon, Xianyue Ma, Ricardo Rodrigues, Cassie Aldridge, and Raphael Caban. I would also like to acknowledge the staff of the University of Florida, including Karen Kelley and ByungHo Kang of the Interd isciplinary Center for Biotechnology Research, Electron Microscopy and BioImaging lab for lending their help and expertise.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 8 LIST OF FIGURES .............................................................................................................................. 9 LIST OF ABBREVIATIONS ............................................................................................................ 11 ABSTRACT ........................................................................................................................................ 18 CHAPTER 1 MECHANISMS OF THYLAKOID BIOGENESIS ................................................................. 20 Summary ...................................................................................................................................... 20 Introduction ................................................................................................................................. 20 Thylakoid Lipids are Imported from the Envelope Membrane ........................................ 22 Vesicle transport from the inner envelo pe to thylakoid membranes ........................ 22 A second possibility for membrane internalization during thylakoid biogenesis: inner envelope invagination ..................................................................................... 24 Vesicles or invaginations? ........................................................................................... 25 Thylakoid Protein Translocases Determine Thylakoid Protein Composition ................. 26 Conclusions a nd Perspectives ............................................................................................. 30 2 LOCALIZATION AND INTEGRATION OF THYLAKOID PROTEIN TRANSLOCASE SUBUNIT CPTATC .................................................................................... 36 Introduction ................................................................................................................................. 36 Results .......................................................................................................................................... 37 Chloroplast TatC Precursors Possess a Stroma targeting Transit Peptide ....................... 37 The cpTatC Non -conserved Stromal Domain is not Necessary for Targeting to Thylakoid Membranes or Assembly into the 700 kD cpTat Receptor Complex ......... 38 Chloroplast TatC Precursor Import and Protease Accessibility Assays Reveal a Stromal mcpTatC ............................................................................................................. 39 Chloroplast TatC Targets to Thylakoid Membranes Via a Stromal Intermediate ........... 40 Chloroplast TatC is Neither Integrated by the cpTat nor the cpSecA/cpSecYE Pathways ........................................................................................................................... 41 Neither cpSecY nor Alb3 are Necessary for cpTatC Integration ..................................... 42 Discussion .................................................................................................................................... 43 3 CHLOROPLAST SEC2 ............................................................................................................. 59 Introduction ................................................................................................................................. 59 Results .......................................................................................................................................... 62

PAGE 6

6 Arabidopsis SecY2 is a Membrane Integrated Plastid Protein that can be Found in Envelope Membranes ...................................................................................................... 62 Arabidopsis SecA2 is a Plastid Protein .............................................................................. 64 Discussion .................................................................................................................................... 64 4 TESTING CHROMOPHORE -ASSISTED LIGHT INACTIVATION AS A MEANS TO DISRUPT THE FUNCTION OF CANDIDATE CPTATC INTEGRASES .................... 70 Introduction ................................................................................................................................. 70 Results .......................................................................................................................................... 71 Chloroplast Precursors are Translocated into Isolated Chloroplasts Despite Exposing Chloroplasts to Harsh CALI Conditions ........................................................ 71 The Tetra Cys Tag Does not Alter Targeting of Two Chloroplast Precursor Proteins that are to be Used for CALI Feasibility Experiments .................................................. 72 Radiolabeled Precursors to cpTatC and Substrates of the Known Thylakoid Translocase Pathways are Translo cated into and Targeted to Native Localizations Within Isolated Arabidopsis Chloroplasts In Vitro ....................................................... 73 CALI Dye Will Cross Chloroplast Membranes and Bind a Stromal Target Protein ...... 74 In Vitro CALI ...................................................................................................................... 75 Discussion .................................................................................................................................... 75 5 INDUCIBLE RNAI AS A MEANS TO KNOCKDOWN THE EXPRESSION OF CANDIDATE CPTATC INTEGRASES .................................................................................. 82 Introduction ................................................................................................................................. 82 Results .......................................................................................................................................... 84 Hairpin Sequences were Constructed for Estrogen Inducible RNAi of Alb4, cpSecY, and cpSecY2 in Arabidopsis ............................................................................ 84 Estrogen Induces Pale Phenotypes in cpSecY and cpSecY2 RNAi Lines, but Ca uses no Change to Alb4 RNAi or Empty Vector Control Lines .............................. 85 Induced Alb4 -, cpSecY and cpSecY2 -RNAi Lines Experience Transcript Knockdown ...................................................................................................................... 86 Knocking Down cpSecY or cpSecY2 Transcript Abundance Results in Disruption to Thylakoid Structure ..................................................................................................... 88 Knocking Down cpSecY2 Transcript Abundance Results in Reduced Levels in Plas tid Envelope and Thylakoid Localized Protein Translocases ................................ 89 Discussion .................................................................................................................................... 90 APPENDIX: EXPERIMENTAL PROCEDURES ....................................................................... 113 Hairpin Construction for Inducible RNAi of Thylakoid Translocases .......................... 113 Construction of Precursors ................................................................................................ 114 Preparation of Radiolabeled Precursors ........................................................................... 115 Preparation of Bacterially Expressed Proteins and Antibodies ...................................... 115 Plant growth conditions, preparation of Chloroplasts, Stromal Extract, and Total Cell Membranes ............................................................................................................. 116 Chloroplast Import and Thylakoid Protein Integration Assays ...................................... 118

PAGE 7

7 Protease accessibility assay ............................................................................................... 120 In Organello Competition Assay ...................................................................................... 120 Nigericin/Valinomyci n Inhibition Assay ......................................................................... 121 Azide Inhibition Assay ...................................................................................................... 121 Chloroplast Exposure to Light and Prolonged Incubation .............................................. 122 Transforming Agrobacterium and Arabidopsis ............................................................... 122 Arabidopsis Genomic DNA Isolation and PCR Screening ............................................. 123 RNA Isolation and Quantitative RT PCR ........................................................................ 123 Imaging and Electron Microscopy .................................................................................... 124 Dye Binding to a 2TC Tagged Ta rget Protein in Situ in Isolated Chloroplasts ............ 124 Immunoprecipitation ......................................................................................................... 125 In Vitro CALI .................................................................................................................... 126 Electrophoresis ................................................................................................................... 126 LIST OF REFERENCES ................................................................................................................. 132 BIOGRAPHICAL SKETCH ........................................................................................................... 147

PAGE 8

8 LIST OF TABLES Table page A 1 Primers that were used to amplify Arabidopsis gene fragments for hairpin RNA construction .......................................................................................................................... 128 A 2 Primers that were used to screen transformed Arabidopsis plants for hairpin constructs to cpSecY2, cpSecY, and Alb4. ........................................................................ 130 A 3 Primers used to quantify transcripts to in Arabidopsis c DNA isolated from estrogen induced empty vector and RNAi lines. ............................................................................... 131

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Transmission electron micrographs of a chloropl ast ........................................................... 33 1 2 Nuclear encoded thylakoid proteins are targeted to thylakoids by chloroplast protein translocases ............................................................................................................................. 34 1 3 Chloroplast inner membrane internalization ........................................................................ 35 2 1 Precursor to cpTatC possesses a stromal targeting transit peptide ..................................... 48 2 2 Identification an d modification of the cpTatC N terminal stromal non -conserved domain. .................................................................................................................................... 49 2 3 The cpTatC non conserved stromal domain is not necessary for cpTatC localization ...... 50 2 4 Soluble cpTatC is located in the stroma, not the envelope intermembrane space51 2 5 Stromal cpTatC behaves like a stromal targeting intermediate. .......................................... 52 2 6 Stromal intermediate cpTatC is a direct precursor to thylakoid -integrated cpTatC. ......... 53 2 7 In organello competition indicates that c pTatC integration does not proceed via the cpTat or cpSec pathways. ..................................................................................................... 54 2 8 pcpTatC targeting is unaffected by protonophores .............................................................. 55 2 9 pcpTatC targeting is unaffected by azide. ............................................................................ 56 2 10 Neither Alb3 nor SecY are necessary for cpTatC integration ............................................. 57 2 11 Antibod ies that detect psAlb3 protein, cross react with atAlb4, but not atAlb3 ............... 58 3 1 Arabidopsis SecY2 is a membrane integrated plastid protein. .......................................... 67 3 2 Arabidopsis plastid SecY2 localizes to the envelope membranes ...................................... 68 3 3 Arabidopsis SecA2 is a plastid protein ................................................................................. 69 4 1 In vitro import of chloroplast precursor proteins proceeds after chloroplasts are exposed to CALI conditions .................................................................................................. 77 4 2 Tetra -Cys tagged precursors are targeted to native locations during im port into isolated chloroplasts. .............................................................................................................. 78 4 3 In vitro import of substrates to various thylakoid translocases and chloroplast fractionation are both feasible when using Arabidopsis chloroplasts ................................. 79

PAGE 10

10 4 4 CALI dye binds a target protein within intact chloroplasts. ................................................ 80 4 5 In vitro CALI. ......................................................................................................................... 81 5 1 Hairpin construction scheme for inducible RNAi ................................................................ 97 5 2 Conservation and divergence between the sequences used to construct RNAi hairpins and those of non-target gene family members. .................................................................... 98 5 3 PCR screens confirm Alb4, cpSecY, and cpSecY2 hairpin constructs are present in Arabidopsis T1 lines ............................................................................................................ 101 5 4 Representative phenotypes that were induced in various RNAi lines. ............................. 102 5 5 Non -induced phenotypes in various RNAi lines ................................................................ 103 5 6 Average levels of target and nontarget transcripts in induced RNAi lines. .................... 104 5 7 Average levels of target transcripts in green leaves of induced RNAi lines. .................. 105 5 8 Representative phenotypes of induced RNAi seedlings over time. ................................. 106 5 9 Representative early growth phenotypes that were induced in RNAi lines ..................... 108 5 10 Relative abundance of various transcripts in induced RNAi lines .................................... 109 5 11 Representative TEM micrographs of plastids from induced RNAi lines ......................... 110 5 12 Immunoblotting membrane and soluble pro teins from induced RNAi lines. .................. 111 5 13 Representative TEM micr ographs of cells from induced RNAi lines .............................. 112

PAGE 11

11 LIST OF ABBREVIATION S 2TC Tandem tetra Cysteine Protein tag for Chromophore Assisted Light Inactivation ADP Adenosine diphosphate Alb3 Albino 3. A membrane integrated subunit of the cpSRP protein translocase. Alb3.1 Alb3 of Chlamydomonas reinhardtii Alb3.2 Alb3 like protein of Chamlydomonas reinhardtii Alb4 Albino4. Putative thylakoid protein translocase that is homologous to Alb3 Anti Antibodies to Arf ADP ribosylation fact or. Small GTPase involved in endomembrane vesicle trafficking at Arabidopsis thaliana antibodies ATP Adenosine triphosphate AVI Anthocyanic vesicle inclusion Az Sodium azide B1 A specific Invitrogen Gateway recombinase site B2 A specific Invitrogen Gat eway recombinase site B5 A specific Invitrogen Gateway recombinase site B5rA specific Invitrogen Gateway recombinase site BLAST Basic local alignment search tool BN Blue Native CALI Chromophore Assisted Light Inactivation CAO Chlorophyllide a Oxygenase Chl Chlorophyll cm Centimeters of distance

PAGE 12

12 CO3 Carbonate Col 0 Arabidopsis Columbia ecotype CF0II Membrane -integrated subunit of the mitochondrial ATPase protein complex Cp Chloroplast cpOxa1p Chloroplast homolog of bacterial YidC, which is similar to mi tochondrial Oxa1p. Chloroplast Oxa1p is also known as Alb3. cpSecA Subunit A of the cpSec protein translocase cpSecA2 Subunit A of the cpSec2 protein translocase cpSecE Subunit E of the cpSec protein translocase cpSecE2 Hypothetical cpSec2 protein translocase subunit E. cpSecY Subunit Y of the cpSec protein translocase cpSecY2 Subunit Y of the cpSec2 protein translocase cpSRP43 The 43 kilodalton subunit of the cpSRP protein translocase cpSRP54 The 54 kilodalton subunit of the cpSRP protein translocase cp Tat Twin arginine protein translocase of chloroplast thylakoids cpTatC Subunit C of the cpTat protein translocase CTAB Centrimonium bromide Cys Cysteine Deletion mutation DNA Deoxyribonucleic acid DPM Disintegrations per minute DTT Dithiothreitol E Envel ope membrane fraction EDT2 Ethane dithiol ER Endoplasmic reticulum

PAGE 13

13 FtsY Filamentous thermosensitive Y. A thylakoid membrane associated subunit of the cpSRP protein translocase. Also known as the cpSRP receptor G/C Guanine/Cytosine content (in percent) fo und within a given stretch of DNA sequence GFP Green fluorescent protein GspB 286 kilodalton cell wall anchored protein of Strepococcus gordonii GTP Guanosine triosphosphate GV3101 A strain of Agrobacterium tumefaciens that is used to transform plants Hcf1 06 High chlorophyll fluorescence 106. A membrane integrated subunit of the cpTat translocase HK HEPES -KOH pH 8. A buffer used to hypotonically lyse isolated chloroplasts in vitro Hsp70 The 70 kilodalton heat shock protein of chloroplasts Hsp93 The 93 ki lodalton heat shock protein of chloroplasts i Intermediate processed form of a translocated chloroplast protein IB Import buffer IP Immunoprecipitation kD Kilodalton LHCP Light -harvesting chlorophyll -binding protein M Chloroplast membrane fraction -M Mola r concentration m Mature processed form of a translocated chloroplast protein g Micrograms of mass min Minutes on time mL Milliliter of volume L Microliter of volume

PAGE 14

14 mm Millimeters of distance mM Millimolar concentration M Micromolar concentration Mr M olecular weight markers mRNA Messenger ribonucleic acid MS Murashige and Skoog medium mW Milliwatts of power NC The non -conserved peptide region of cpTatC ng Nanograms of mass nm Nanometers of distance N/V Nigericin Valinomycin NigVal Nigericin Valinomyci n OE Oxygen evolving complex subunit OP Orthophenanthroline Oxa1p Oxidase Assembly 1. Mitochonrial inner membrane protein integrase that is homologous to YidC in bacteria and Alb3 of chloroplasts. Oxa2 Oxidase Assembly 2. Similar to Oxa1p P Pellet p P recursor form of a translocated chloroplast protein P1 A specific Invitrogen Gateway recombinase site P2 A specific Invitrogen Gateway recombinase site P5 A specific Invitrogen Gateway recombinase site P5r A specific Invitrogen Gateway recombinase site P36 Chloroplast envelope phosphate translocator -PAGE Polyacrylimide gel electrophoresis PC Plastocyanin

PAGE 15

15 PCR Polymerase chain reaction pET 14b A member of the bacterial pET expression vector series PG Post -germination Plsp1 Chloroplast signal peptidase pM DC7 Arabidopsis binary vector that contains the estrogen inducible system PMF Proton Motive Force PMSF Phenylmethanesulfonyl fluoride Pre Precursor form of protein in question PS Photosystem ps Pisum sativum antibodies Psb Photosystem II subunit Psa P hotosystem I subunit qRT -PCR Quantitative reverse transcription polymerase chain reaction Rab Sub -family of small GTPases that are involved in in endomembrane trafficking RB47 An mRNA binding protein of Chlamydomonas reinhardtii that is involved in chloro plast protein translation RNAi RNA interference RT Reverse transcription RUBISCO Ribulose bisphosphate carboxylase oxygenase S Chloroplast soluble fraction S Supernatant SDS Sodium dodecyl sulfate, protein denaturing detergent. Sec Secretory protein tran slocase of chloroplast thylakoids SOE Splicing by overlap extension

PAGE 16

16 SP6 Phage DNA dependent RNA polymerase that is used to synthesize mRNA in vitro SRP Signal recognition particle protein translocase of chloroplast thylakoids SSU RUBISCO small subunit +T Chloroplast membrane fraction that has been treated with thermolysin protease T1 The first segregating generation produced from self pollinating transformed Arabidopsis T2 The second segregating generation produced from self -pollinating YidC2 TBS Tris buff ered saline solution TCA Trichloroacetic acid TEM Transmission Electron Microscopy T DNA Transfer DNA Th Thermolysin protease Tha4 Thylakoid Assembly 4. A membrane integrated subunit of the cpTat protein translocase Thy Thylakoids TIC Translocon at the in ner envelope membrane of plant chloroplasts TIC40 40 kilodalton subunit of the translocon at the inner envelope membrane of plant chloroplasts TIC110 110 kilodalton subunit of the translocon at the inner envelope membrane of plant chloroplasts TIGR The Ins titute for Genomics Research TLCK N Tosyl -L Lysinyl Chloromethylketone TM Transmembrane domain TOC Translocon at the outer envelope membrane of plant chloroplasts TOC75 75 kilodalton subunit of the translocon at the outer envelope membrane of plant chlor oplasts

PAGE 17

17 TOC132/120 132 and 120 kilodalton subunits of the translocon at the outer envelope membrane of plant chloroplasts TOC159 159 kilodalton subunit of the translocon at the outer envelope membrane of plant chloroplasts Tp Translation product tp Transi t peptide Tr Trypsin protease UTR Untranslated region W Watts of power Ws Wassilewskija ecotype of Arabidopsis VIPP1 Vesicle inducing protein in plastids 1 YidC Bacterial membrane protein integrase that is similar to Alb3 of chloroplasts and Oxa1p of mitoc hondria YidC2 Bacterial membrane protein that is similar to YidC

PAGE 18

18 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BIOG ENESIS OF CHLOROPLAST THYLAKOID TRANSLOCASE SUBUNIT CPTATC By Jonathan Reed Martin May 2010 Chair: Kenneth C. Cline Major: Plant Molecular and Cellular Biology Thylakoid membranes have a unique complement of proteins, most of which are synthesized in the cytosol, imported into the stroma, and translocated into thylakoid membranes by specific thylakoid translocases. Known thylakoid translocases contain a core multi -spanning, membrane integrated subunit which is also nuclear -encoded and imported into chlo roplasts before being integrated into thylakoid membranes. Thylakoid translocases play a central role in determining the composition of thylakoids, yet the manner by which the core translocase subunits are integrated into the membrane is not known. We use d biochemical and genetic approaches to investigate integration of the core subunit of the chloroplast Tat translocase, cpTatC, into thylakoid membranes. In vitro import assays show that cpTatC correctly localizes to thylakoids if imported into intact chl oroplasts, but it does not integrate into isolated thylakoids. In vitro transit peptide processing and chimeric precursor import experiments suggest that cpTatC possesses a stroma targeting transit peptide. Import time course and chase assays confirmed that cpTatC targets to thylakoids via a stromal intermediate, suggesting that it might integrate through one of the known thylakoid translocation pathways. However, chemical inhibitors to the cpSecA -cpSecY and cpTat pathways did not impede cpTatC localiza tion to

PAGE 19

19 thylakoids when used in import assays. Analysis of membranes isolated from Arabidopsis thaliana mutants lacking cpSecY or Alb3 showed that neither is necessary for cpTatC membrane integration or assembly into the cpTat receptor complex. These dat a suggest the existence of another translocase, possibly one dedicated to the integration of chloroplast translocases. Alb4 and Sec2 are recently discovered putative chloroplast protein translocases. Results from i n vitro import experiments suggested that cpSecY2 and SecA2 both localize to chloroplasts. Inducible RNAi enabled a CPSECY2 transcript reduction to ~40% of wild type levels in Arabidopsis seedlings. Reductions to CPSECY2 transcripts resulted in bleached cotyledons and plastids that mostly lack thylakoids, similar to phenotypes that have been observed in cpTatC, Alb3, and cpSecY knockout mutants. Reduction of CPSECY2 transcripts gave way to reductions of cpTatC transcript and protein levels. TIC40, cpSecY, and TIC110 protein levels were also reduced in cpSecY2 RNAi seedlings, suggesting that cpSec2 may be involved in the biogenesis or stability of bacterially -conserved core thylakoid translocase subunits, and novel eukaryotic -derived subunits of the chloroplast import apparatus.

PAGE 20

20 CHAPTER 1 MECH ANISMS OF THYLAKOID BIOGENESIS Summary Pigments, lipids, and proteins are the materials that constitute chloroplast thylakoids. The arrangement of lipids and pigments and the organization of macromolecular complexes of proteins in thylakoid membranes enab le oxygenic photosynthesis, which supports Earths biosphere by transforming electromagnetic radiation into chemical energy. The expression and activity of chloroplast envelope and endoplasmic reticulum membrane -localized lipid synthesis and transport pr oteins determines chloroplast lipid content. Inner envelope membranes are internalized to become thylakoid membranes by two hypothetical processes: inner envelope membrane invagination and/or vesicle transport. Photosynthetic proteins reach thylakoids th rough the help of specific chloroplast envelope and thylakoid protein translocases. Here, I review several aspects of thylakoid membrane internalization and protein transport, and discuss how each contributes to thylakoid biogenesis. Introduction Plant ch loroplasts are derived from an ancient endosymbiotic event in which a photosynthetic cyanobacterium took up residence within a mitochondria containing eukaryote (Dyall et al., 2004) The subsequent loss or transfer of most endosymbiont genes to the host genome created a complex genetic system that coordinates nuclear anterograde and chloroplast retrograde signaling with a reduced endosymbiont genome and nuclear dominance over chloroplast gene expression (Woodson and Chory, 2008) Nuclear dominance allowed plant cells to coordinate plastid development with the developmental priorities of the plant, relegating the endosymbiont to organelle status. The plastid is distinguish ed from its bacterial relative by an ability to differentiate among several plastid types, each with distinctive structure,

PAGE 21

21 composition, and chemistry. Proplastids are progenitor plastids present in meristematic cells; they are small semi -spherical organe lles that mostly lack internal membranes (Figure 1 1) (Buchanan et al., 2000) Etioplasts arise from proplastids that have received some, but not all, of the environmental cues that are needed to trigger chloropl ast development. Etioplasts contain a large paracrystalline mass of internal lipids called the prolamellar body. Prolamellar bodies contain chlorophyll biosynthetic proteins and other pre -chloroplast proteins that can be used for rapid differentiation in to thylakoids (Figure 1 1) (Blomqvist et al., 2008) Etioplasts accumulate in plant tissues until light induced genes direct inner membrane re-differentiation and thylakoid biogenesis. Similar to cyanobacteria, chloroplasts possess internal photosynthetic thylakoid membranes made up of densely packed protein complexes that are embedded in membrane lamellae. Chloroplast thylakoid lamellae are either exposed to the stroma or arranged as stacks called grana. The s troma is an aqueous compartment that is analogous to the cytoplasm of the original endosymbiont. The stroma is contained within a bilayered inner envelope membrane (Figure 1 1). The outer envelope is a second membrane that falls outside the inner envelope. The envelope inter -membrane space and the thylakoid lumen are aqueous compartments of chloroplasts that are topologically analogous to the periplasm of the original endosymbiont. Studies of chloroplast biogenesis have led to interesting discoveries and developmental questions regarding when and how plastid inner membranes accumulate the lipids and proteins that define thylakoid identity. Such research has identified proteins that synthesize, modify, and internalize plastid inner membrane lipids. Other studies describe protein translocases that target nuclear and plastid -encoded proteins to thylakoid membranes. The following review discusses how chloroplast lipid internalization and protein translocation contribute to thylakoid biogenesis.

PAGE 22

22 Thylakoid L ipids are Imported from the Envelope Membrane Thylakoid lipids are synthesized through the dual activity of chloroplast envelope and endoplasmic reticulum -derived prokaryotic and eukaryotic synthesis pathways respectively, but the final steps of thylakoid lipid synthesis occur in the envelope (Benning, 2008) The mechanisms of envelope to thylakoid lipid transport are poorly understood, but some evidence suggests thylakoids acquire lipids through vesicle transport from, and/or direct continuity with, the inner envelope membrane. Vesicle transport from the inner envelope to thylakoid membranes Rapidly developing chloroplasts contain stromal vesicles that are thought to traffic lipids from the inner envelope to thylakoid me mbranes. Vesicles and stroma -facing buds of the inner envelope membranes have been observed in thin sections of mature chloroplasts in Arabidopsis and pea ( W estphal et al., 2001b; Kroll et al., 2001; Morre et al., 1991) Increased numbers of vesicles appear to accumulate from inner envelope buds in chloroplasts within leaves that are incubated at decreasing temperatures (Morre et al., 1991) In cold temperatures, chloroplast vesicle accumulation is correlated with slow transport of radiolabeled lipids from the envelope to thylakoids in an in vitro lipid synthesis and transport assay (Andersson et al., 2001) Cold temperature is also known to reduce vesicle transport in the endomembrane system. For instance, cold temperature caused increased transitional endoplasmic reticulum (ER) vesicle accumulation and reduced vesicle fusi on with the cis Golgi in animal cells (Morre et al., 1989) Biochemical studies have suggested that proteins similar to those used for cytosolic vesicle trafficking mediate chloroplast vesicle transport. Cytosolic v esicle trafficking is facilitated by a number of small guanosine triphosphate (GTP) binding proteins such as Arf proteins, which initiate ER vesicle budding and coat protein recruitment, and Rab protein family members, which regulate vesicle docking to, an d fusion with, endomembranes ( Gillingham and Munro,

PAGE 23

23 2007; Haucke, 2003) Stromal vesicles did not accumulate in chloroplasts that were incubated in the cold with non -hydrolysable forms of GTP (Westphal et al., 2001b) The dependence of stromal vesicle formation on GTP was put in context when stromal vesicles accumulated in chloroplasts that were incubated with inhibitors to known cytosolic vesi cle fusion proteins such as protein phosphatase 1 and calmodulin, which are involved homotypic membrane fusion during yeast vacuole formation (Westphal et al., 2001b ; Mayer et al., 1996; Mayer, 1999) Aside from observations of chloroplast ultrastructure and the results of biochemical experiments, other evidence for envelope to thylakoid vesicle transport has come from studies of Vesicle Inducing Protein in Plastids 1 ( VIPP1 ). VIPP1 got its name from mutants in plants and cyanobacteria that exhibit a lack of stromal vesicles and an inability to maintain thylakoid membranes (Kroll et al., 2001; West phal et al., 2001a) VIPP1 function appears to be involved in thylakoid maintenance because Arabidopsis vipp1 mutants germinate and initially develop as wild type seedlings. It isnt until several weeks after germination that vipp1 mutants lose their th ylakoids (Kroll et al., 2001) In cold temperatures, reduced lipid trafficking between the chloroplast envelope and thylakoids is correlated with an increase in stromal vesicles, but cold induced stromal vesicles ar e missing in vipp1 mutants (Andersson et al., 2001; Kroll et al., 2001) Together, these studies suggest that VIPP1 is involved in a chloroplast vesicle transport system that moves li pids between the envelope and thylakoid membranes. However, the hypothesis that VIPP1 is involved in vesicle transport was challenged by genetic studies in cyanobacteria. Complete loss of VIPP1 reduced the abundance of photosystem I complexes, and inducib le depletion of VIPP1 reduced photosynthetic activity in cyanobacteria without resulting in thylakoid membrane loss (Fuhrmann et al., 2009; Gao and Xu, 2009) Further, VIPP1 depletion re duced cell viability before any disruption to thylakoid membrane

PAGE 24

24 structure. The above findings have been met by a hypothesis that VIPP1 function in cyanobacteria is different than the function of VIPP1 in plant thylakoids. A study in Arabidopsis showed t hat decreased VIPP1 protein levels did not affect the assembly of thylakoid protein complexes, and instead, affected thylakoid membrane formation (Aseeva et al., 2007) The differences between VIPP1 function in cyanobacteria and plant chloroplasts might be expected if vesicular transport from the inner envelope to thylakoids arose after endosymbiosis, as a function that was inherited from the eukaryotic cell (Vothknecht a nd Soll, 2005) Indeed, chloroplast vesicles have only been observed in embryophytes and not cyanobacteria or other photosynthetic eukaryotes such as charophytes, chlorophytes, glaucocystophytes, or rhodophytes (Westphal et al., 2003) A second possibility for membrane internalization during thylakoid biogenesis: inner envelope invagination The view that chloroplast inner envelope invaginations represent early developing thylakoid membranes mostly stems from stru ctural studies that revealed proplastid and chloroplast envelope invaginations that emanate into the stroma (Morre et al., 1991; Carde et al., 1982) Similar to conditions that stimulate stromal vesicle accumulation, cold temperatures also brought on inner envelope invaginations in mature chloroplasts from tobacco and pea (Morre et al., 1991) These studies relied on electron microscopy, which kills t he specimen during sample preparation, preventing one from following the potential development of inner envelope invaginations into thylakoid lamellae. Leech et al. tried to follow thylakoid biogenesis by observing membrane structure in developing chloroplasts along the length of greening maize leaves (Leech et al., 1973) In between proplastids at the leaf base and mature chloroplasts at the leaf tip, were plastids that contained elongated pre -granal thylakoids that extended across the pre chloroplast. The pre -granal thylakoids appeared to converge at either end of the plastid, but

PAGE 25

25 it was unclear if the thylakoid lamellae were continuous with the inner envelope membrane. The process was easier to observe in Chlamydomonas reinhardtii in which chloroplast greening produced envelope invaginations that appeared to take on thylakoid structure, ultimately resulting in thylakoids that were attached to the envelope membranes (Hoober et al., 1991) Modern cryo-fixation methods and three dimensional electron tomography (3D EM) have presented chloroplast internal membrane structure with better detail and preservation than was previously possible from using thin sections of chemically fi xed specimens (Staehelin, 2003) Interestingly, 3D EM micrographs revealed attachment sites between thylakoid membranes and the inner envelope or cell membranes in plant chloroplasts or cyanobacteria, respectively (van de Meene et al., 2006; Shimoni et al., 2005) Vesicles or invaginations? Existing evidence for chloroplast vesicle transport needs to be substantiated by studies that characterize me chanisms of vesicle budding from the inner envelope, transport through the stroma, and fusion with thylakoid membranes. The results of chemical inhibitor experiments suggest that proteins similar to those involved in endomembrane vesicle transport mediate vesicle budding and transport. Bioinformatics studies have identified several predicted chloroplast proteins that bear homology to vesicle budding GTPases (Andersson and Sandelius, 2004) but evidence to confirm the chloroplast localization or specific biochemical function of any candidate protein in a chloroplast vesicle transport pathway has not been reported. Vesicle transport persists as a potential mode of chloroplast lipid internalization, but unti l chloroplast vesicle transport mechanisms and their associated proteins are better characterized, the process will remain hypothetical. Ultrastructural studies of chloroplasts in plants and C. reinhardtii have revealed inner envelope membrane invagination s and thylakoid biogenesis from inner envelope invaginations,

PAGE 26

26 respectively. These studies and the discovery of envelope thylakoid membrane contact sites in cyanobacteria and plant and algal chloroplasts support the hypothesis that inner envelope invaginat ions give rise to thylakoids. However, more functional characterization is needed to understand the mechanisms that invaginate the inner envelope membrane. Thylakoid Protein Translocases Determine Thylakoid Protein Composition The plastid genome encodes r oughly 50 thylakoid proteins whereas about half of thylakoid membrane proteins and all thylakoid lumen proteins are encoded in the nucleus (Kieselba ch and Schroder, 2003; Peltier et al., 2002; Race et al., 1999) Much of what is known about the localization of nuclear -encoded thylakoid protein translocases has come from biochemical studies of isolated mature chloroplasts. Nuclear encoded thylakoid proteins are synthesized in the cytosol and are imported into the chloroplast by novel translocases of the outer (TOC) and inner (TIC) chloroplast envelope membranes (Inaba and Schnell, 2008) TOC and TIC speci fically bind chloroplast precursor proteins at N -terminal chloroplast transit peptides, which are cleaved by a transit peptidase as chloroplast precursors are imported into the stroma (Figure 1 2). For thylakoid precursor proteins that possess bipartite t ransit peptides, cleavage of the chloroplast transit peptide reveals a second targeting peptide that is cleaved by a thylakoid lumen peptidase upon protein transport into the thylakoid (Schunemann, 2007) Other thylak oid proteins lack cleavable thylakoid targeting transit peptides and instead contain non -cleaved internal hydrophobic targeting peptides. In either case, c leavage of the chlor oplast transit peptides reveals sequences that target proteins for integration i nto or transport across thylakoid membranes by one of several bacterially conserved thylakoid protein translocation pathways: the Twin Arginine ( cpTat ), chloroplast Signal Recognition Particle ( cpSRP), chloroplast Secretory (cpSec ), or the spontaneous pathway (Figure 1 2 ) (Cline and Dabney-Smith, 2008)

PAGE 27

27 The cpTat translocase is known to utilize the trans thylakoid membrane proton motive force to transport folded proteins across chloroplast thylakoid membrane s (Cline and Theg, 2007) Nuclear -encoded Light Harvesting Chlorophyll Binding Proteins (LHCPs) are multi spanning membrane proteins that are targeted to photosynthetic thylakoid membranes post translationally throug h the interaction of stromal intermediate LHCP with cpSRP (Reed et al., 1990; Payan and Cline, 1991; Yuan et al., 1993; Li et al., 1995). LHCPs are inserted into thylakoid membranes by a membrane integrated translocase called Alb3 (Moore et al., 2000) which is homologous to a known bacterial membrane protein integrase, YidC. Chloroplast Sec tran slocates partially unfolded soluble proteins and hydrophobic proteins across or into thylakoid membranes, respectively (Schunemann, 2007) During reconstituted translation of plastid encoded photosystem II reaction ce nter protein D1 an emerging hydrophobic stretch of D1 was observed to cross -link with cpSRP, implicating cpSRP in co translational protein targeting in chloroplasts (Nilsson and van Wijk, 2002) Soluble subunit of the cpSRP translocase target D1 to the cpSec translocase (Zhang et al., 2001) Plastid -encoded cytochrome f is also cotranslationally inserted into thylakoids by the cpSec translocase, but cytochrome f requi res cpSecA for insertion (Nohara et al., 1996; Rohl and van Wijk, 2001) Chloroplast SecA is related to bacterial SecA, an ATPase motor that assists hydrophilic domains of Sec substr ates through the Sec channel protein, SecY (Dalbey and Chen, 2004) Chloroplast Sec substrates are also known to translocate via cpSec without a need for cpSecA (van Wijk et al., 1995) Several proteins integrate into thylakoid membranes in vitro in the absence of ATP or a proton motive force (PMF) ; integration is thought to occur spontaneously because it proceeds despite pre -treating thylakoids with proteases that degrade thylakoid translocases. Among proteins known to integrate spontaneously are single spanning proteins such as the ATPase CFoII

PAGE 28

28 subunit, and photosystem II (Psb) subunits X, Y, and W (Robinson et al., 1996; Michl et al., 1994; Lorkovic et al., 1995; Kim et al., 1996) A few polytopic thylakoid membrane proteins are also known to be inserted spontaneously: the early light inducibl e protein 2, PsbS, and photosystem I (Psa ) subunits G, K, and S ( Kim et al., 1998; Kim et al., 1999; Mant et al., 2001; Woolhead et al. 2001) Genetic studies suggest that wild type thylakoid membrane structure is sustained by translocase assisted insertion of photosynthetic proteins into thylakoid membranes. When translocases are missing, thylakoid membranes lose their structure or va nish completely, which has been observed when loss of function mutations arise in gene s that encode thylakoid translocases such as Alb3, cpTatC cpSecY cpSecA FtsY, or double mutants of the 54 and 43kD subunits of cpSRP (Roy and Barkan, 1998; Skalitzky, 2006; Sundberg et al., 1997; Hutin et al., 2002; Asakura et al., 2004; Asakura et al., 2008; Motohashi et al., 2001) Pleotropic effects that come from mutating genes that encode thylakoid protein translocases preclude making specific conclusions about translocase function during thylakoid bioge nesis; however, genetic studies show that translocases are necessary for proper thylakoid biogenesis and maintenance of thylakoid structure. The localization and function of thylakoid protein translocases has mostly been studied in mature isolated chloropl asts. The same studies have not been performed with differentiating proplastids because isolating significant numbers of proplastids is not feasible. As a result, little is known about when photosynthetic proteins are inserted into developing thylakoid m embranes. Proteins could be inserted before lipids are internalized, on the envelope membrane itself, or on budded vesicles or invaginated lamellae. Experiments are needed to understand when and where photosynthetic proteins are inserted during thylakoid biogenesis. Learning when thylakoid

PAGE 29

29 protein translocases are expressed and where they localize in developing chloroplasts will define when and where chloroplast inner membranes become thylakoids. Biogenesis of the photosynthetic apparatus during thylakoi d biogenesis The timing and location(s) at which photosynthetic proteins are inserted into early developing thylakoids are not known, but indirect evidence suggests that photosynthetic proteins can integrate into inner envelope membranes. Chlamydomonas reinhardtii RB47 and several other mRNA binding proteins, that help translate plastid -encoded photosynthetic proteins, co-fractionated with low density chloroplast membranes whose lipid composition is identical to that of inner envelope membranes (Zerges and Rochaix, 1998) Density gradient centrifugation separated the mRNA binding proteins and low -density membranes into two different fractions. The first fraction contained isolated inner envelope membranes, a nd the second contained thylakoidassociated inner envelope membranes. Zerges and Rochaix interpreted their data to suggest that thylakoid associated inner envelope membranes could exist as vesicles or part of continuous attachments between envelope and t hylakoid membranes. Associations between chloroplast mRNA binding proteins and the inner envelope membrane are particularly interesting in light of studies that found that chlorophyll is synthesized and assembled with LHCPs at inner envelope membranes in g reening Chlamydomonas reinhardtii. Dark grown wild type and mutant y -1 both accumulate mRNA that encode thylakoid membrane proteins, but unlike wild type, y -1 does not synthesize thylakoid membrane proteins or chlorophyll in the dark (Hoober and Stegeman, 1976) During y -1 chloroplast greening, light elicits chlorophyll synthesis, which in turn elicits Photosystem (PS) I and II biogenesis and LHCP assembly into light harvesting complexes at the inner envelope membrane (Hoober et al., 1982; Maloney et al., 1989; Hoober et al., 1991) PSI and PSII seem

PAGE 30

30 to localize in close proximity to one another in the membrane because their activities couple shortly after greening is initiated (White and Hoober, 1994) Chlorophyllide a Oxygenase (CAO), which plays a role in chlorophyll synthesis, is also localized to the inner envelo pe membranes of greening Chlamydomonas and the inner envelope and thylakoid membranes in both Arabidopsis and pea chloroplasts (Eggink et al., 2004; Reinbothe et al., 2006) The resul ts of recent studies into the function and localization of chloroplast signal peptidase, Plsp1, indirectly suggest that the photosynthetic apparatus is assembled at the inner envelope membranes during thylakoid biogenesis. The 75 kD subunit (TOC75) of the TOC translocase is not processed in Arabidopsis that harbor a homozygous knockout mutation in the gene that encodes Plsp1 (Inoue et al., 2005) Interestingly, the thylakoid lumen targeting transit peptides of soluble plastocyanin and the 23 and 33kD subunit of the oxygen-evolving complex (OE33) are also not processed in Arabidopsis pls1p mutants ( ShipmanRoston et al., 2010; Inoue et al., 2005) The ability to process both envelope and thylakoid proteins is thought to be related to a dual localization of Pls1p to the inner envelope and prothylakoids in proplastids and to thylakoids in mature chloroplasts, respectively (Shipman and Inoue, 2009) Although the role that Pls1p plays during thylakoid biogenesis is still unclear, Pls1p localization studies have drawn a connection between the inner envelope and thylakoid membranes before and after th ylakoid biogenesis. Conclusions and Perspectives Until the mechanisms for chloroplast vesicle transport and inner envelope membrane invagination are clarified, both remain possible modes for chloroplast membrane internalization. Existing data points to in ner envelope invaginations as the initial site of thylakoid biogenesis, and vesicle transport as a means to maintain thylakoids (Figure 1 3). On the other hand, vesicle

PAGE 31

31 transport might not be necessary if thylakoid membranes and inner envelope membranes w ere continuous, because membrane continuity would allow for lateral lipid transfer. The membrane c ontinuity hypothesis implies that inner envelope and thylakoid membranes are different domains of a chloroplast inner membrane system. Such a relationship would not be unique to chloroplast inner membranes, as several organelles possess membranes with multi domain structure. The endoplasmic reticulum has lamellar, tubular, and nuclear envelope domains (English et al., 2009) The mitochondria inner membrane is organized into tubular cristae that span the organelle and peripheral stretches that are located near the outer mitochondria membrane (Mannella, 2006) Recent use of 3D EM tom ography has described the multi -domain architecture of thylakoid membranes, which are organized into stromal and stacked grana lamellae (Shimoni et al., 2 005; Garab and Mannella, 2008; Mustardy et al., 2008) Membrane domains can be defined by differences in membrane structure and protein composition. Similarly, both the inner envelope and thylakoid membranes share identical lipid composition and bilayer leaflet distribution (Rawyler et al., 1995; Rawyler et al., 1992; Benning, 2008) but differ in membrane structure and protein composition. T hylakoid protein t ran slocase expression, localization and activity determine when and where most photosynthetic proteins integrate into chloroplast inner membranes. Findings that show the photosynthetic apparatus is assembled at inner envelope membranes, and that translocase s are needed to insert photosynthetic proteins, together suggest that biogenesis of the photosynthetic apparatus requires protein translocases to be in place at the inner envelope to facilitate thylakoid biogenesis. The cpSec translocase integrates plastid -encoded thylakoid membrane proteins such as those that are bound by inner envelope membrane associated mRNA binding proteins, and

PAGE 32

32 cpSRP and Alb3 target and integrate LHCPs into thylakoid membranes in pea chloroplasts (Zhang et al., 2001; Li et al., 1995; Moore et al., 2000) Associations between these translocated substrates and the inner envelope imply that Alb3 and cpSec protein translocases need to be present a t inner envelope membranes in advance of thylakoid biogenesis. Interestingly, cp Sec Y localizes to both thylakoids and inner envelope mem branes or cell membranes in cyanelles or cyanobacteria (Yusa et al., 2008; Nakai et al., 1993) and i ndirect evidence suggests that TatC exists at the cell membrane in cyanobacteria (Spence et al., 2003) The cpTat translocase is comprised of subunits cpTatC, Tha4 and Hcf106, which are all detected in the inner envelope and thylakoid membranes of pea chloroplasts (Fincher et al., 2003) Verifying the localization of thylakoid protein translocases in the envelope membranes of early developing chloroplasts could support the available data that suggest thylakoid biogenesis occurs at the inner envelope. Furthermore, learning how protein translocases are integrated into chloroplast inner membranes will clarify early developmenta l steps in chloroplasts that precede thylakoid biogenesis.

PAGE 33

33 Figure 1 1. Transmission electron micrographs of a chloroplast A), proplastid B), and an etioplast C). Plastid compartments are labeled. The edge of the chloroplast is expanded to illustrate the relative arrangement of the envelope compartments. Images were provided by Dr. Brian Gunning (Gunning, 2003)

PAGE 34

34 Figure 1 2 Nuclear -encoded thylakoid proteins are targeted to thylakoids by chloroplast pr otein translocases (model adapted from (Cline and Dabney -Smith, 2008) ). Thylakoid precursor proteins are imported into chloroplasts by the envelope localized TOC/TIC translocases. Once inside the chloropl ast, a stromal transit peptidase (scissors in stroma) cleaves the stromal targeting transit peptide, revealing targeting sequences that direct thylakoid precursor proteins to one of several bacterially -conserved protein translocase pathways. Once inserted into thylakoid membranes, or transported into the thylakoid lumen, a lumenlocalized peptidase (scissors in lumen) cleaves thylakoid targeting peptides from thylakoid-targeted proteins.

PAGE 35

35 Figure 1 3. Chloroplast inner membrane internalization. The thy lakoid membranes of mature chloroplasts are thought to arise through inner envelope membrane invagination and/or vesicle transport between the inner envelope and internal membranes of pre chloroplasts such as proplastids.

PAGE 36

36 CHAPTER 2 LOCALIZATION AND INT EGR ATION OF THYLAKOID P ROTEIN TRANSLOCASE SUBUNIT CPTATC Introduction Most of what is known about thylakoid protein translocation comes from studies of developed chloroplasts. Following import into the plastid, all nuclear -encoded thylakoid proteins studied to date are inserted into thylakoids from the plastid stroma by one of four conserved translocation pathways, all of which are evolutionarily derived from a bacterial endosymbiont (Schunemann, 2007) Some membrane pro teins integrate into thylakoids by an unassisted or spontaneous mechanism. The remaining known membrane proteins and lumenal proteins are inserted by translocases. The cpSRP -FtsY -Alb3 translocase integrates a class of light harvesting membrane proteins the cpSecA -cpSecYE translocase transports globular lumenal proteins and integrates some membrane proteins, and the cpTat translocase transports folded lumenal proteins and integrates a very limited number of membra ne proteins (Schunemann, 2007) The cpSecYE and SRP subunits also appear to cotranslationally integrate at least one p lastid -encoded membrane protein ( Zhang et al., 2001; Nilsson and van Wijk, 2002) Little is known about how membrane -bound translocase subunits integrate into thylakoid membranes. Some translocase subunits, e.g. cpSecE and the cpTat subunits Hcf106 and Tha4, spontaneously integrate into the membrane ( Steiner et al., 2002; Fincher et al., 2003) In fact, Hcf106 and Tha4 are found in the envelope as well as the thylakoids, as might be expected of proteins that integrate spontaneously. However, the mechanism of integration of the multi spanning core subunits cpSecY, Alb3, and cpTatC, is completely unknown. We have begun to examine the targe ting pathway of the core subunits. The present work focuses on cpTatC because we have an efficient biochemical assay for its localization. When incubated with intact chloroplasts, pcpTatC is imported, integrated into thylakoids, and

PAGE 37

37 assembled into the cpTat receptor complex (Fincher et al., 2003) In contrast to spontaneously integrating membrane proteins, membrane integration of cpTatC appears to require a translocase because neither the precursor nor the mature form of cpTatC integrates into isolated thylakoids under any e xperimental conditions examined (Fincher et al., 2003) Here, we present evidence that cpTatC targets to thy lakoid membranes via a stromal intermediate, and that cpTatC membrane integration is not altered by competition with precursors of the cpSec and cpTat pathways. Furthermore, cpTatC was found integrated and assembled into the cpTat receptor complex in membranes isolated from Arabidopsis seedlings that carry loss of function mutations in genes encoding Alb3 and cpSecY. These data suggest cpTatC integrates via a translocase other than those already known to exist at thylakoid membranes. The possible involve ment of two new candidate translocases will be discussed. Results Chloroplast TatC Precursors Possess a Stroma -targeting Transit P eptide cpTatC is synthesized as a precursor (pcpTatC) with a 50 residue amino terminal targeting peptide that is cleave d upon import into chloroplasts (Mori et al., 2001) Two experiments were conducted to determine if pcpTatC possesses a stroma targeting transit peptide. First, radiolabeled pcpTatC was incubated with isolate d stroma to determine if its transit peptide is cleaved by the stromal transit peptidase (Richter and Lamppa, 1999) Isolated stroma cleaved pcpTatC to a protein the size of mature cpTatC (mcpTatC), similar to cleavage of the precursor to the small subunit of ribulose bisphosphate carboxylase oxygenase (pSSU) to mature size SSU (mSSU) (Figure 2 1A ). Reduction in size was due to amino terminal processing because stroma had no effect on in vitro translated mcpTatC. Processing was conducted by the stromal peptidase because ortho -phenanthroline, an inhibitor of the stromal transit peptidase, prevented processing of pcpTatC as well as pSSU (Figure 2 1A ).

PAGE 38

3 8 In a second experiment, the tran sit peptides and small portions of the mature domain of pSSU and pcpTatC were swapped (Figure 2 1B, 2 2B ), and the chimeric precursor proteins were assayed for localization in a chloroplast import assay. As shown in Figure 2 1C pcpTatC is imported into c hloroplasts, processed to mature size, and localized primarily to the membranes. Integration into the membranes is shown by the appearance of characteristic degradation products upon treatment of the membranes with thermolysin (Mori et al., 2001) The same import and localization pattern was obtained for SSUtpcpTatC, which was directed by the known stroma targeting SSU transit peptide, except that import was more efficient. Similarly, the cpTatC transi t peptide directed cpTatCtpSSU import into the stroma, albeit much less efficiently than the homologous transit peptide. These results demonstrate that cpTatC possesses a stroma targeting transit peptide. The cpTatC Non-conserved S tro mal Domain is not Nec essary for Targeting to Thylakoid Membranes or Assembly into the 700 kD cpTat Receptor C omplex Precursors that possess stroma -targeting transit peptides do not necessarily reach the chloroplast stroma. For example, the outer envelope translocase subunit T OC75 also has a cleavable stroma targeting transit peptide, but a second peptide sequence stops transfer before TOC75 reaches the stroma (Inoue and Keegstra, 2003) The possibility that cpTatC possesses a similar membrane retention domain was examined by looking for sequence elements that might serve as localization signals. Targeting signals are frequently extra peptides that have reduced sequence conservation among orthologous protein s as they do not constitute functional domains of the protein (Bruce, 2001) Mature cpTatC proteins possess long hydrophilic aminoterminal extensions before the first transmembrane domain (Mori et al., 2001) whereas bacterial TatC proteins have short hydrophilic amino termini (Buchanan et al., 2002) Alignment of cpTatC proteins from a variety of plant species revealed a conserved region constituting transmembrane

PAGE 39

39 domains, soluble loops, and 29 residues amino-proximal to the first transmembrane domain. Most sequence divergence was found in regions that represented transit peptides and the first ~ 50 residues of the amino terminus of the mature protein (Figure 2 2A ). To assess its potential role in targeting, the nonconserved region (NC) was deleted from SSUtpcpTatC, producing SSUtp NCc pTatC (Figure 2 2A, 2 2B ). This precursor imported into chloroplasts, localized to thylakoids, and produced the same degradation product s as wild type pcpTatC (Figure 2 3B ). In thylakoids, cpTatC is present in a ~700 kD receptor complex that can be detec ted by Blue Native PAGE (BN PAGE) (Cline and Mori, 2001) Imported NCcpTatC also assembled into a large receptor complex, but with a reduced molecular weight (Figure 2 3B ). The lower molecular weight would be expected if all of the cpTatC subunits in the complex were NCcpTatC although that remains to be determined. Treating the digitonin -solubilized membrane extract with Hcf106 antibodies before BN -PAGE caused a band shift to higher molecular weight, verifying that NCcpTatC is assembled with Hcf106 in the cpTat receptor complex (data not shown). Thus, the non -conserved stromal domain of cpTatC is not necessary for targeting of cpTatC to thylakoid membranes or assembly into the 700 kD cpTat r eceptor complex. Chloroplast TatC Precursor Import and Protease Accessibility Assays Reveal a S tromal mcpTatC A small percentage of imported cpTatC is always found in the soluble fraction of chloroplasts recovered from import assays (Figure 2 3B lane 3). A protease accessibility assay was performed to test whether the soluble cpTatC was stromal or located in the inter -envelope membrane space (Jackson et al., 1998) When incubated with intact chloroplasts, thermolysin digests exposed outer envelope proteins, but it cannot penetrate the o uter envelope membrane (Figure 2 4B ). Trypsin can cross the outer envelope to access the intermembrane space, allowing digestion of TOC75, but it cannot cross the inner envelope membrane, preventing

PAGE 40

40 digestion of TIC110 (Figure 2 4B ). Radiolabeled pcpTatC was imported into chloroplasts and the chloroplasts were then treated with buffer, trypsin, or thermolysin. After treatment, repurified chloroplasts were fractionated into soluble and membrane fractions. The percentage of soluble cpTatC from the trypsin treated chloroplasts was essentially the same as that from the thermolysin treated chloroplasts, indicating that the soluble mcpTatC is located in the stroma rather than the inter -envelope memb rane space (Figure 2 4A ). Chloroplast TatC Targets to Thylakoid Membranes Via a Stromal I ntermediate In order to determine whether the stromal mcpTatC is a stromal intermediate or a dead -end import p roduct, a rapid stopping time course of a protein import assay was conducted (Reed et al., 1990) During the first five minutes of import, mcpTatC accumulated in the stroma at a rate similar to im p ort into chloroplasts (Figure 2 5A ), after which its accumulation slowed and then declined. Initially, membrane associated mcpTatC accumulated more slowly, but it continued to accumulate after stromal mcpTatC accumulation leveled off and declined. Simila r accumulation kinetics were obtained from three independent ex periments (Figure 2 5B ). These import kinetics are similar to those exhibited by thylakoid proteins that are known to target via stromal intermediates (Reed et al., 1990; Cline et al., 1992) An import -chase assay was conducted to determine if stromal cpTatC is the direct precursor to thylakoid -integrated cpTatC (Reed et al., 1990; Li and Schnell, 2006) After a brief period of pSSUtpcpTatC import, all remaining precursor was removed from the chloroplast surface by treatment with thermolysin Chloroplasts were returned to import reaction conditions, and samples were removed at subsequent time points to follow the sorting of imported protein between the internal chloroplast compartments. pSSUtpcpTatC was used in this experiment instead of pc pTatC, because the SSU transit peptide imparts increased import efficiency upon cpTatC (Figure 2 1C ), and produces proportionally more stromal mcpTatC at early time points.

PAGE 41

41 The data show that cpTatC chases from stroma to thylakoids (Figure 2 6A) Similar results were obtained from three independent ch ase experiments (Figure 2 6B). Taken together, the results of the time course and chase experiments indicate that cpTatC targets to thylakoid membranes via a stromal intermediate. Chloroplast TatC is Neither I ntegrated by th e cpTat nor the cpSecA/cpSecYE P athways Targeting of cpTatC to thylakoid membranes via a stromal intermediate suggests that a conserved thylakoid translocase might serve as the cpTatC integrase (See Discussion). We used in organello competition to determine if cpTatC is integrated either by the cpSec or cpTat pathways (Cline et al., 1993) In organello competition involves pre -importing chemical quantities of either a cpSec or cpTat pat hway precursor into chloroplasts before adding radiolabeled test precursor to the assay. The TOC TIC import apparatus imports chloroplast precursor proteins much faster than the cpSec or cpTat apparatus can transport them from the stroma, which results in amounts of stromal intermediate that saturates the thylakoid translocases. Radiolabeled stromal intermediate accumulates if both stromal species use the same thylakoid translocase. As shown in Figure 2 7 pre import of the cpTat precursor pOE23 or the c pSec pathway precursor pOE33 neither caused accumulation of stromal cpTatC nor a decrease in membrane associated cpTatC. The efficacy and specificity of the competition is shown in Figure 2 7B and 2 7C for control proteins: radiolabeled pOE23, which accum ulates as intermediate only when competing with pre -imported pOE23, and radiolabeled pOE33, which accumulates as intermediate only after pre import of pOE33. Other inhibitors were applied to import assays: 1) azide to inhibit the ATPase domain of cpSecA an d 2) ionophores to dissipate the proton gradient, which is required by the cpTat and which stimulates the cpSecA/cpSecYE and SRP/Alb3 pathways. Neither treatment had a significant effect on cpTatC tar geting to thylakoids (Figures 2 8, and 2 9 ).

PAGE 42

42 Neither cp SecY nor Alb3 are Necessary for cpTatC I ntegration In bacteria, SecYE and YidC, the bacterial orthologs to cpSecYE and Alb3, operate with other translocase subunits in a modular fashion, e.g. SRP can target precursors to SecYE or YidC, and SecA is not alwa ys required to integrate membrane proteins through SecYE (Fa ndl et al., 1988; Valent et al., 1998; Scotti et al., 1999; Bloois et al., 2004) T o more directly determine if Alb3 or cpSecY are necessary to integrate cpTatC, membranes were isolated from Arabidopsis seedlings carrying loss of function mutations in ge nes that encode either Alb3 or cpSecY (Skalitzky, 2006; Sundberg et al., 1997) Chloroplasts could not be analyzed from mutant seedlings, which contai n grossly deformed plastids with few internal membranes. The isolated membranes were tested for the presence, membrane integration, and assembly status of cpTatC. Thylakoids isolated from wild type Arabidopsis were also analyzed to help identify transloc ase specific and non -speci fic bands. As shown in Figure 2 10A c pTatC was detected in membranes from both mutants. Carbonate did not extract cpTatC from mutant membranes (Figure 2 10C ) (Mori et al., 200 1) indicating that cpTatC is integrally associated with the membranes. Moreover, cpTatC was found assembled into the 700 kD Tat receptor complex in membranes from mutant seedlings (Figure 2 10B ). Samples of membranes from mutant seedlings were also que ried using antibodies that detect core translocase subunits Alb3, cpSecY, or Alb4 (Figure 2 10A and 2 10C ). Neither Alb3 nor cpSecY were detected in membranes isolated from each respective mutant (Figure 2 10A ). The minor band migrating slightly below th e Alb3 band in the alb3 membranes is a non -specific band that is extracted by alkaline carbonate (Figure 2 10C ). Interestingly Alb4 and cpSecY were present in the alb3 membranes and Alb3 and Alb4 were present in the secy membranes (Figure 2 10A ). Antibod ies to Pisum Alb3 were used to detect Alb4 in isolated Arabidopsis membranes because Pisum Alb3 antibodies were found to cross -react with Arabidopsis Alb4 (Figure 2 11). Alkalin e carbonate extraction (Figure 2 10C )

PAGE 43

43 verified that Alb3, cpSecY, and Alb4 wer e integrally associated with the wild type and mutant membranes, although Alb3 was frequently low in abundance in alkaline extraction experiments with secy membranes. We occasionally observed a double banding pattern when detecting cpSecY (Figure 2 10A ); the lower band may result from some partial degradation during isolation. In addition to showing that cpTatC does not require either cpSecY or Alb3 for integration, these findings raise important questions regarding the integration machinery for other tra nslocase subunits Alb3, Alb4, and cpSecY Discussion Cavalier -Smith classified cell membranes into two categories: genetic and derived (Cavalier -Smith, 2000) Genetic membranes alw ays arise by growth and division, and they are continuously maintained through the germ line from cell to daughter cell. Genetic membranes acquire proteins through the action of specific translocases and frequently synthesize their own polar lipids. Deri ved membranes obtain lipids and proteins from genetic membranes by membrane flow, e.g. vesicles. The endoplasmic membrane and plastid inner envelope membrane are examples of genetic membranes, whereas the tonoplast and Golgi membranes are derived. The th ylakoid membrane of plant chloroplasts has features of both genetic and derived membranes. In mature chloroplasts, thylakoids take up their unique complement of proteins through a set of specific translocases (Cline and Theg, 2007; Schunemann, 2007) and thylakoids are passed to daughter chloroplasts by division (Cran and Possingham, 1972) Conv ersely, during chloroplast biogenesis, thylakoids are thought to arise from the inner envelope by membrane invagination and fission (Carde et al., 1982; Benning et al., 2006; Kobayashi et al., 2007) This poses the question. At what point do inner plastid envelope invaginations become thylakoids? The key may lie in determining when, where, and how thylakoid translocases are

PAGE 44

44 inserted into the membranes because they play a central role in determining the protein composition of the thylakoid membrane and lumen. Chloroplast TatC, SecY, an d Alb3 are thylakoid translocase proteins derived from the cyanobacterial progenitor of chloroplasts (Dalbey and Kuhn, 2000) In bacteria, the orthologous prote ins are co -translationally integrated into the cytoplasmic or thylakoid membranes by SRP and SecY/E/G and/or YidC, similar to other multi -spanning membrane proteins. Co translational insertion insures that highly hydrophobic proteins are not exposed to the aqueous environment where they would aggregate. As the chloroplast evolved, genes encoding thylakoid translocases were relocated to the nucleus, precluding a co translational mode of integration and necessitating alternate strategies to integrate these proteins into the membrane. One strategy might integrate cpTatC into the inner envelope during plastid import by a novel insertion mechanism. Such a strategy is used by a class of mitochondrial inner membrane proteins and at least two chloroplast inner e nvelope proteins ( Brink et al., 1995; Knight and Gray, 1995; Sirrenberg et al., 1996) Membr ane flow might relocate cpTatC to thylakoids. Another possibility would be to import cpTatC to the stroma allowing it to enter a conserved, but altered, translocation pathway. The localization of LHC apoproteins is an example of this latter strategy. pr eLHC apoproteins are imported into the plastid stroma where they bind cpSRP, a modified SRP adapted to post -translational insertion, which targets them to a conserved FtsY receptor before subsequent integration via Alb3. Our studies show that cpTatC posse sses a stromal targeting transit peptide, appears to lack an envelope retention domain, and proceeds to thylakoids via a stromal intermediate. This suggests that cpTatC is integrated by a conserved translocase, either directly into the thylakoid membrane or, alternatively, into the inner envelope membrane. In that regard, a small amount of

PAGE 45

45 envelope associated cpTatC was generally detected in protein import assays (Fincher et al., 2003) althou gh it was not technically feasible to determine if envelope associated cpTatC is an intermediate or an off -pathway product.. At the time of this study, three conserved translocases were known: cpSecA/cpSecY/E, cpSRP/cpFtsY/Alb3, and cpTat, all of which ar e thylakoid localized in mature chloroplasts (Fincher et al., 2003) Chloroplast SecA is homologous to SecA, an ATP powered translocation motor required to move large hydrophilic domains acros s the membrane through a SecYE channel (Andersson and Heijne, 1993) Chloroplast SRP and cpFtsY are involved in targeting precursors to Alb3 (Moore et al., 2000) A number of genetic studies have ruled out certain accessory subunits from being involved in cpTatC integration. The cpTat substrate OE23 was correctly localized to the thylakoid lumen in maize seedlings that lack cpSecA (Voelker et al., 1997) Mature size OE23 was also detected in membranes isolated from Arabidopsis plants that carry loss of function mutations in SRP subunits cpSRP54 and SRP43 (Hutin et al., 2002) The chloroplast Tat pathway was indirectly ruled out by the fact that in vitro integrated Tha4 complemented cpTat transport function of maize thylakoids from a Tha4 null mutant line (Fincher et al., 2003) Our biochemical studies verify that cpTatC does not employ the cpSec and cpTat translocases in the known configurations. Asakura et al. previously detected cpSecY and cpTatC in protein extracts from maize see dlings harboring a loss of function mutation in the gene encoding FtsY; and more recently, cpTatC and cpSecY were detected in protein extracts from Arabidopsis alb3 and ftsy mutants (Asakura et al., 2004; Asakura et al., 2008) We extend these findings by showing that cpTatC is integrated into membranes and assembled into the cpTat receptor complex in the absence of Alb3 or cpSecY. These findings are part icularly relevant because in E. coli indirect evidence suggests that TatC is integrated in a SecYE dependent manner (Yi et al., 2003)

PAGE 46

46 We also found that cpSecY and Alb4 were integrated in membra nes from alb3 mutant seedlings and Alb3 and Alb4 were integrated in membranes from cpsecy mutant seedlings. This is contrary to evidence from E. coli that suggests the Alb3 homolog, YidC, is integrated in a Sec and SRP dependent manner (Koch et al., 2002) We cannot rule out the possibility that Alb3 alone integrates Alb3 and that cpSecY/E integrates cpSecY; however, it is clear from our results that cpTatC is not integrated b y any of the known translocases, implying the existence of an uncharacterized plastid translocase. Although the translocase may be novel, it is more likely to be conserved because cpTatC is derived from the bacterial endosymbiont, which originally integra ted this multi-spanning protein from the topologically equivalent (i.e. to stroma) cytoplasm. Two new conserved candidate cpTatC integrases were recently discovered: Alb4 and SecY2 (Gerdes et al., 2006; Skalitzky, 2006) Alb4 is homologous to Alb3 and is located in the thylakoid membranes in chloroplasts. SecY2 possesses a predicted transit peptide, and when incubated with intact chloroplasts, i s imported, processed to a smaller protein, and is recovered with the membrane fraction (unpublished results of the authors). The general importance of Alb4 is unclear as anti -sense RNA and T DNA insertion lines failed to show a striking phenotype (Gerdes et al., 2006) On the other hand, Arabidopsis plants that are homozygous for loss of function mutations in SecY2 are embryo lethal. In addition, promoter swapping experiments between cpSecY and SecY2 showed that these two proteins perform non redundant functions (Skalitzky, 2006) Certainly this second plastid SecY is a candidate for insertion/translocation of proteins not accommod ated by the known translocases. This arrangement is demonstrated by certain gram positive bacteria which possess an additional SecY that translocates a specific subset of proteins (Siboo et al., 2008) Considering the essential

PAGE 47

47 nature of the plastid SecY2, deciphering its function will require a conditional mutation or an inducible silencing approach.

PAGE 48

48 Figure 2 1 Precursor to cpTatC possesses a stroma l targeting transit peptide. A ) Radiolabel ed pSSU, pcpTatC, and mature cpTatC (mcpTatC) were each incubated with isolated stroma and 3 mM PMSF with or without 10 mM 1,10 phenanthroline (OP), as shown above the panel, at 25C, for 30 minutes. Samples were analyzed usin g SDS PAGE and fluorography. B) Scheme illustrating swapping of the pSSU and pcpTatC transit peptides. Numbers above constructs represent the number of amino acids from the translation start site. C ) Radiolabeled pcpTatC, SSUtpcpTatC, pSSU, and cpTatCtpSSU were each incubated with chloroplasts in a protein import assay (Experimental Procedures Appendix) for 20 minutes. Chloroplasts were treated with 100 g/mL thermolysin and then re purified, washed, lysed, and fractionated. Translation product (Tp) equivalent to 5% of each assay, chloroplasts (Cp), stroma (S), membranes (M), and thermolysin treated membranes (+T) were analyzed using SDS -PAGE and fluorography. The positions of m olecular weight markers are shown at left.

PAGE 49

49 Figure 2 2. Identification and modification of the cpTat C N -terminal stromal non -conserved domain. A) The Pisum cpTatC precursor peptide sequence was used to BLAST all available plant gene indices at TIGR Multalin was used to compare peptide sequences from the BLAST result The non -conserved region of Pis um cpTatC begins with amino acids -CFAV and ends with amino acids RSAI The remainder of the Pisum cpTatC peptide sequence, and that for each homolog, are omitted. B) MluI and BssHII restriction sites were inserted in pSSU and pcpTatC. Restrictio n -based cloning was used to swap the transit peptides between each precursor and to delete the non -conserved stromal region from the SSUtpcpTatC precursor. Straight lines run adjacent the SSU (above text) and cpTatC (below text) transit peptides, and jagge d lines run adjacent the cpTatC non -conserved region.

PAGE 50

50 Figure 2 3 The cpTatC non -conserved stromal domain is not necess ary for cpTatC localization. A ) Scheme illustrating deletion of the cpTatC non -conserved region (NC region). Numbers above const ructs represent the number of amino acids from the translation start site. B ) Radiolabeled pcpTatC and SSUtp chloroplasts in a protein import assay ( Experimental Procedures Appendix) for 20 minutes. Chloroplasts were treated with 100 g/mL thermolysin, re -purified, washed, lysed, and fractionated i nto stroma and membranes. Translation product (Tp) equivalent to 5% of each assay, chloroplasts (Cp), stroma (S), membranes (M), and thermolysin -treated membranes (+T) were analyzed us ing SDS -PAGE and fluorography. Membranes were also dissolved in 1% digi tonin and analyzed using Blue Native PAGE and fluorography. The positions of molecular weight markers (Mr), or monomeric (440 kD) and dimeric (880 kD) ferritin for BN -PAGE, are shown at left.

PAGE 51

51 Figure 2 4. Soluble cpTatC is located in the stroma, not t he e nvelope intermembrane space. A ) Radiolabeled pcpTatC was incubated with chloroplasts in a protein import assay (Experimental Procedures Appendix) for 10 minutes. Recovered chloroplasts were treated with IB ( -), trypsin, or thermolysin. Proteases we re inhibited before chloroplast re -isolation, lysis, and fractionation. Translation product (Tp) equivalent to 5% of each assay, stroma (S), and membrane (M) fractions were analyzed using SDS -PAGE and fluorography. Gel band extraction was used to quantif y radiolabeled cpTatC in each chloroplast fraction for each treatment. Numbers below bands represent the relative percentages of cp TatC found in each fraction. B ) Chloroplasts from IB ( ), trypsin (Tr), and thermolysin treated (Th) samples were also analyzed by SDS PAGE and immunoblotting with antibodies to TOC75 (applied at 1:2500) or TIC110 (applied at 1:5000). The positions of m olecular weight markers (Mr) are shown at left.

PAGE 52

52 Figure 2 5. Stromal cp TatC behaves like a stromal targeting intermedia te. A ) Radiolabeled pcpTatC was incubated with chloroplasts in an import time course assay (Experimental Procedures Appendix). At the times indicated, samples of the import reaction were transferred to 3.3 mM HgCl2 to terminate import and localization. Chloroplasts in each sample were treated with 100 g/mL thermolysin, repurified, brought to equal chlorophyll concentration, lysed, and fractionated into membranes and stroma. Translation product (Tp) equivalent to 5% of each assay, chloroplasts (Total i mported), stroma, membranes, and thermolysin -treated membranes (Membrane -integrated) were analyzed using SDS PAGE and fluorography. Gel band extraction was used to quantify radiolabeled cpTatC in each chloroplast fraction at each time point. M olecules of cpTatC per chloroplast estimated from DPMs in bands and chlorophyll content of each sample are plotted for e ach fraction and time point. B) Three import time course experiments were conducted ( see Experimental Proceedures Appendix). Radiolabeled cpTa tC in each chloroplast fraction was quantified. T he average percentages of stroma and membraneassociated cpTatC relative to total imported cpTatC are plotted for each time point across three replicate cpTatC import time course experiments.

PAGE 53

53 Figure 2 6 Stromal intermediate cpTatC is a direct precursor to thylakoid -integrated cpTatC. A) Chloroplasts and radiolabeled SSUtpcpTatC (Tp) were incubated in a import chase time course assay (Experimental Procedures Appendix ). After 5 minutes of import, ch loroplasts were diluted, treated with thermolysin, repurified, resuspended to the original import reaction volume, and placed back in import reaction conditions. At time points, samples of chloroplasts were re isolated, washed, lysed, and fractionated. C hloroplasts (Total imported), stroma, membranes, and thermolysin treated membranes (Membrane integrated) were analyzed using SDS -PAGE and fluorography. The positions of m olecular weight markers (Mr) are shown at left. Radiolabeled cpTatC in each chlo roplast fraction was quantified from DPMs in bands and chlorophyll content of each sample. T he molecules of cpTatC per chloroplast of stroma, membrane, and sum of stroma and membrane cpTatC were plotted for each time point. B) Three import chase time cou rse experiments were conducted ( see Experimental Proceedures Appendix). Radiolabeled cpTatC in each chloroplast fraction was quantified. Plotted are the average percentages of stroma and membrane associated cpTatC relative to total imported cpTatC at each time point across three replicate cpTatC import chase time course experiments

PAGE 54

54 Figure 2 7. In organello competition indicates that cpTatC integration does not proceed via the cpTat or cpSec pathways. Chloroplasts were incubated with 5 mM ATP, 1 .5 mM DTT, and either 0.3 M urea ( ) or unlabeled bacterially expressed pOE23 or pOE33 (competitor) at the final concentrations depicted above the panels for 7 min in the light. Radiolabeled pcpTatC A), pOE23 B), or pOE33 C ) was added to the reaction mixt ures and the import reaction allowed to continue for an additional 15 minutes. Chloroplasts from pcpTatC reactions were recovered, lysed, and fractionated into stroma (S) and membranes (M). An aliquot of the membrane fraction was treated with thermolysin (+T). Samples were analyzed by SDS -PAGE and fluorography. Chloroplasts from import reactions with radiolabeled pOE23 or pOE33 were recovered and directly analyzed. Gel band extraction was performed to quantify the relative percentages of stromal and mem brane associated cpTatC, which are represented by num bers below the bands in panel A ). The positions of molecular weight markers (Mr) are shown at left.

PAGE 55

55 Figure 2 8. pcpTatC targeting is unaffected by protonophores. Radiolabeled pOE23 or pcpTatC was i ncubated with chloroplasts, that were pretreated with (Nig/Val) or without ( ) 0.5 M nigericin and 1 M valinomycin, in a protein import assay (Supplemental Procedures Appendix ) for 20 minutes. Chloroplasts were treated with 100 g/mL thermolysin and repurified. Chloroplasts from pcpTatC import reactions were lysed, and fractionated. Chloroplasts from pOE23 import reactions and total imported cpTatC (T), stroma (S), membrane (M), and thermolysin -treated membrane fractions (+T) were analyzed using SDS -PAGE and fluorography. Gel band extraction was used to quantify radiolabeled intermediate OE23 (iOE23), and mature OE23 (mOE23) and cpTatC (mcpTatC) in each chloroplast fraction for each treatment. Numbers below bands represent the relative percentages of cpTatC or OE23 found in each fraction. Translation products (Tp). The positions of molecular weight markers (Mr) are shown at left.

PAGE 56

56 Figure 2 9. pcpTatC targeting is unaffected by azide. Radiolabeled pcpTatC, pOE33, or pOE23 was incubated with chl oroplasts, that were pretreated without ( ) or with 5 mM or 10 mM sodium azide, in a pr otein import assay (Experimental Procedures Appendix) for 15 minutes. Chloroplasts from pcpTatC import reactions were repurified, lysed, and fractiona ted as described in Experimental Procedures. Chloroplasts from pOE23 and pOE33 import reactions and total imported cpTatC (T), stroma (S), membrane (M), and thermolysin treated membrane fractions (+T) were analyzed using SDS -PAGE and fluorography. Gel band extraction was used to quantify radiolabeled mature cpTatC (mcpTatC) in each chloroplast fraction for each treatment. Numbers below bands represent the relative percentages of cpTatC found in each fraction. Translation products (Tp).

PAGE 57

57 Figure 2 10. Neither Alb3 nor SecY are neces sary for cpTatC integration. A ) Arabidopsis seedlings were germinated on MS media, grown, and harvested as described (Experimental Procedures Appendix). Membranes were isolated from seedlings and samples of equal tissue mass were analyzed by SDS -PAGE and immunoblotting. B ) Isolated membranes were also dissolved in 2% digitonin and analyzed by BN -PAGE and immunoblotting u sing antibodies to atcpTatC. C ) Membranes were subjected to alkaline carbonate ( CO3) or mock extraction (IB). Supernat ants (S) and membrane pellets (P) from each extraction were analyzed using SDS -PAGE and immunoblotting. Thylakoids (Thy) prepared from isolated Arabidopsis chloroplasts were analyzed in the far right lanes of each SDS -PAGE gel to provide reference bands f or the other lanes. (*) Non -specific bands (refer to page 36) All antibodies were applied at 1:5000.

PAGE 58

58 Figure 2 11. Antibodies that detect psAlb3 protein, cross -react with atAlb4, but not atAlb3. A ) Radiolabeled precursors to atAlb3, atAlb4, and psAl b3 were translated in vitro and analyzed by SDS PAGE and fluorography or immunoblotting with antibodies to psAlb3 (applied at 1:40000). The positions of molecular weight mar kers (Mr) are shown at left. B ) Isolated Arabidopsis thylakoids were analyzed by SDS -PAGE and immunoblotting with antibodies to psAlb3 (applied at 1:5000) and atAlb4 (applied at 1:5000). The positions of molecular weight markers (Mr) are shown between lanes.

PAGE 59

59 CHAPTER 3 CHLOROPLAST SEC2 Introduction Conservative sorting is said to occu r when bacterially derived chloroplast precursor proteins reach their final localization through mechanisms that evolved from the bacterial endosymbiont (Cline and Henry, 1996) Targeting of cpTatC via a stromal intermediate implies that cpTatC integrates into thylakoid membranes through a conserved thylakoid translocase. Alb3 and cpSecY are conserved thylakoid translocases that integrate membrane proteins. Loss of function mutants for either translocase exhibit the same seedling lethal phenotype as cpTatC mutants, but neither Alb3 nor cpSecY are required for cpTatC integration (Martin et al., 2009) It is possible that cpTatC integrates into thylakoid membranes via some alternative pathway. Alb3, Alb4, and cpSecY might also rely on such a pathway because Alb4 integration does not require Alb3 or cpSecY and neither Alb3 nor cpSecY is required to integrate cpSecY or Alb3, respectively (Martin et al., 2009) It is possible that stromal intermediate cpTatC integrates into thylakoids through one of two recently discovered putative translocases, Alb4 or SecY2 (Accession number NM_128710) (Gerdes et al., 2006; Skalitzky, 2006) Alb4 was originally reported to be an Alb3 like domain of a larger more complicated chloroplast inner envelope protein called Artemis (Fulgosi et al., 2002) A later study of the Alb3 like domain revealed that it was not a domain of Artemis, but a separate integral thylakoid membrane protein (Gerdes et al., 2006) T he authors named the protein Alb4 by virtue of its high protein sequence homology to the thylakoid translocase Alb3. Alb4 and Alb3 are members of a family of membrane protein integrases that includes Oxa1p and YidC from mitochondria and bacteria (Luirink et al., 2001) Similar to chloroplast Alb proteins, two Oxa proteins exist within the mitochondria of plants, fungi, and animals (Funes et al ., 2004) Experiments in fungi

PAGE 60

60 suggest that Oxa1p integrates membrane proteins co translationally, whereas Oxa2 integrates membrane proteins post -translationally (Preuss et al., 2005) Some ba cteria also possess two YidC proteins; YidC2 was recently characterized in Streptococcus mutans as having a partially redundant function to YidC1 (Hasona et al., 2005; Dong et al., 2008; Funes et al., 2009) Two Alb proteins are also present in Chlamydomonas reinhardtii The first paralog, Alb3.1, is involved in light -harvesting complex assembly, but it is not required for cell viability. Alb3.2 is necessary for cell viability and is involved in photosystem assembly and/or stability (Gohre et al., 2006) Plant Alb3 is nece ssary for integration of light harvesting chlorophyll binding proteins into thylakoid membranes, but no Alb4 substrates are currently known (Moore et al., 2000) As is the case for a loss of funct ion mutant of Alb3.2, a plant Alb3 loss of function mutation produces a seedling lethal phenotype (Sundberg et al., 1997) An Alb4 loss of function mutant has not been identified; however, knocking down Arabidopsis Alb4 protein expression to 10% of wild type levels resulted in normal looking plants that exhibited slightly de -stacked thylakoid grana within larger and more spherical chloroplasts (Gerdes et al., 2006) Because homozygous cpTatC mutation produces an albino seedling lethal phenotype, Alb4 appears an unlikely cpTatC integrase (Motohashi et al., 2001) Nevertheless, unt il an Alb4 knockout mutant is available, Alb4 must be considered a potential cpTatC integrase. A predicted open reading frame found in the Arabidopsis genome was initially named SECY2 based on sequence homology to CPSECY (Mori and Cline, 2001) Similar to Arabidopsis cpSecY, Arabidopsis SecY2 is predicted to contain ten transmembrane domains and a 34 amino acid chloroplast transit peptide (Hofmann and Stoffel, 1993; Emanuelsson et al., 2000) Screens for embryo lethal mutations in Arabidopsis independently identified putative SECY2 (Ska litzky, 2006) Arabidopsis that harbor a homozygous knockout mutation in SECY2

PAGE 61

61 are embryo lethal due to a developmental arrest at the globular stage of embryo development (Skalitzky, 2006) SecY2 appears to have a fu nction distinguishable from cpSecY because promoter swap, complementation experiments demonstrated that CPSECY and SECY2 are not functionally redundant (Skalitzky, 2006) The Arabidopsis genome also contains a predicted chloroplast protein that bears 47% identity and 62% similarity to chloroplast SecA (cpSecA). Chloroplast SecA is a soluble ATP powered motor that aids the transport of cpSec substrates through the cpSecYE channel (Mori and Cline, 2001) Similar to cpSecA, SecA2 (Accession number NM_102014) is predicted to possess a 58 amino acid plastid targeting transit peptide (Emanuelsson et al., 2000) Disruption of the SecA2 gene results in an embryo lethal phenotype (Donna Fernandez, personal communication). Arabidopsis SecY2 and SecA2 may represent subunits of a second chloroplast Sec system, cpSec2. Most of what is known about Sec 2 translocases comes from genetic and biochemical studies in gram positive bacteria. Sec2 translocates large glycosylated cell surface adhesins that serve as virulence factors for several pathogenic bacteria ( Bensing et al., 2004; Wu et al., 2007; Mistou et al., 2009; Bensing and Sullam, 2002) Interestingly, a particula r cell surface adhesin, GspB of Streptococcus gordonii is translocated by Sec2, but does not possess a signal peptide (Bensing et al., 2004) The lack of a signal peptide or signal anchor for th e export of a Sec substrate is unusual (Mori and Ito, 2001) and might signify a mode of translocation that is unique to Sec2. Also interesting are the hypotheses about how Sec2 translocases arose in gram -positive bacteria. In one instance, Wu et al. (2007) observed low G/C content and a putative transposase gene amidst the genes that encode the Sec2 subunits in Streptococcus parasanguis Wu et al.

PAGE 62

62 (2007) interpret that Sec2 arose in S. parasanguis through horizontal gene transfer as a part of a gene island from another bacterium. Similar to bacterial Sec translocases, the Sec translocase of chloroplasts includes Y, E, and A subunits ( Mori and Ito, 2001) Unfolded thylakoid Sec substrates proceed through a membrane integrated cpSecYE channel with assistance from a soluble cpSecA subunit (Schunemann, 2007) The essential nature of Arabidiopsis (at -) SecY2 and SecA2 for embryo development makes them candidate cpTatC integrases and possibly responsible for other essential plastid functions. However, first it was important to obtain experimental evidence for their localization to plastids. Here, I p resent biochemical evidence for plastid localization of both SecY2 and SecA2 from Arabidopsis. Results Arabidopsis SecY2 is a Membrane Integrated Plastid Protein that can be Found in Envelope Membranes To determine if SecY2 is capable of localizing to plas tids, in vitro translated radiolabeled precursor to Arabidopsis SecY2 (pcpSecY2) was incubated with isolated pea chloroplasts in an in vitro import assay. Radiolabeled pcpSecY2 was imported into isolated pea chloroplasts, processed to a mature 48.3 kD siz e, and localized to membranes (Figure 3 1A, lanes 2 and 4). Carbonate extracted membranes retained cpSecY2, indicating that cpSecY2 is integrated into the membrane (Figure 3 1B). Protease treating membranes produced two degradation products that measured 24.1 kD and 18.2 kD in size (Figure 3 1A, +T long exposure). Degradation products are expected from protease treatment of membrane -integrated proteins that possess both exposed and membrane protected regions (Mori et al., 2001) Together, these results represent one piece of evidence that shows Arabidopsis SecY2 is a membrane integrated plastid protein.

PAGE 63

63 In lanes 2 and 4 of Figure 3 1, and later in Figure 3 2 (compare lanes 2 and 6 to lane 8), total imported and enve lope cpSecY2 migrates as smaller proteins than does thylakoid cpSecY2. Rubisco is a highly abundant 49 kD protein that could interfere with the migration of a less abundant 48.5 kD protein such as cpSecY2. The differences in cpSecY2 migration seen in chl oroplasts and stroma, versus what is observed in membranes, might be due to the fact that chloroplasts and stroma both contain Rubsico whereas membranes are mostly free of Rubisco. Although cpSecY localizes to membranes in plant plastids, SecY is found in both the cell and thylakoid membranes of cyanobacteria, and in the envelope and thylakoid membranes of cyanelles (Nakai et al., 1993; Laidler et al., 1995; Yusa et al., 2008) As such, cpSecY2 localization was studied to address the possibility that cpSecY2 associates with envelope membranes. Chloroplast SecY2 localization was compared to that of a radiolabeled inner envelope phosphate translocator (P36), the precursor of which was co-imported with pcpSecY2 (Block et al., 1983; Flugge and Heldt, 1979) (Figure 3 2). Fractionation quality was judged by the relative amounts of envelope and thylakoid marker proteins, TIC110 and cpTatC, that could be found in each respective fraction. The envelope fraction was free of thylakoid contamination because cpTatC was only found in the thylakoid fraction. However, fractionation was not complete, because a small amount of TIC110 was found in the thylakoid fraction (Figure 3 2, lower panels). Conversely, P36 was fo und in the thylakoid fraction, indicating that the thylakoid fraction was partly contaminated with envelope membranes (Figure 3 2, upper panel). If cpSecY2 were localized to thylakoids only, I would have expected a fractionation pattern similar to that of cpTatC. The results of this experiment suggest cpSecY2 that at least some cpSecY2 is localized to envelope membranes.

PAGE 64

64 Arabidopsis SecA2 is a Plastid Protein In vitro translated radiolabeled precursor to Arabidopsis SecA2 was incubated with isolated pea c hloroplasts in an in vitro import reaction in order to test if SecA2 is capable of plastid localization. SecA2 was imported into chloroplasts and processed to a mature 116 kD size protein that localized to the stroma (Figure 3 3). Two smaller translation products were also imported into chloroplasts and localized to the stroma (Figure 3 3, Truncated mcpSecA2). These precursors likely arose from premature termination of pcpSecA2 translation because they possessed enough of the pcpSecA2 N terminus to be imported into chloroplasts. Discussion The above experiments provide biochemical evidence that Arabidopsis SecY2 and SecA2 are plastid proteins because i n vitro chloroplast import assays were previously shown to verify in vivo plastid localization (Chua and Schmidt, 1978) However, the results do not rule out the possibility that Arabidopsis cpSecA2 or cpSecY2 are also targeted to mitochondria (Carrie et al., 2009) In future studies, an in vitro dual localization assay could address possible mitochondrial localization (Pavlov et al., 2007) Potential localization of Arabidopsis SecY2 to mitochondria might alternatively be tested in vivo by isolated Arabidopsis mitochondria. My data do not indicate whether or not cpSecY2 or cpSecA2 are present in chloroplasts, i.e. as opposed to other types of plastids. Transcription profiling data available fr om Genevestigator show that cpSecY2 is transcribed predominantly in the shoot tissue, and less so in the roots, whereas cpSecA2 is expressed at low levels in all tissues (Hruz et al., 2008) Thus the expression data suggest cpSecY2 and cpSecA2 are present in chloroplasts. The membrane and stroma localizations of in vitro imported cpSecY2 and cpSecA2 match the localizations of the corresponding cpSec subunits, cpSecY and cpSecA. It is inte resting that imported cpSecY2 is found in the envelope membranes. One could interpret that the envelope

PAGE 65

65 membrane is an intermediate location for cpSecY2 that is on pathway for ultimate targeting to thylakoid membranes. Alternatively, if envelope cpSecY2 functions as a translocase to integrate membrane proteins, the envelope membrane might serve as an interesting integration site for translocase proteins such as Alb3, cpSecY, and cpTatC. Instead of direct integration from the stroma to thylakoid membranes cpTatC might integrate into th e envelope membrane, then move to thylakoids through membrane transport. Such an integration pathway might be particularly relevant in proplastids, which contain few thylakoid membranes. This work makes fundamental contri butions to the characterization of an important plastid Sec translocase, but much work remains. For example, no cpSecE2 has been identified. Chloroplast SecE is conserved in bacteria and exists in a complex with cpSecY at thylakoid membranes (Schuenemann et al., 1999) The bacterial homolog is involved in SecA binding to the Sec channel complex, highlighting the importance of this subunit to Sec function (Karamanou et al., 2008) In future studies, mass spectroscopic analysis might identify cpSecE2 if it is co immunoprecipitated with cpSecY2 antibodies. Perhaps more difficult than identifying cpSecE2, and necessary to prove that cpSec2 functions a s a translocase, is the discovery of a cpSec2 substrate. Substrate -translocase relationships have been previously established by linking the chemical inhibition of substrate translocation to the energetic requirements of putative thylakoid translocases. Such was the case for translocation of OE33 and Plastocyanin (PC), which is prevented by ATPase inhibitor sodium azide (Yuan et al., 1994) The significance of azide inhibition was relevant to a plant ho molog of the bacterial SecA translocase subunit, which also has an ATPase domain that is inhibited by azide (Fortin et al., 1990) The role of cpSecA in thylakoid translocation was demonstrated w hen purified cpSecA protein substituted for stromal extract in facilitating the

PAGE 66

66 transport of cpSec substrates into isolated thylakoid membranes in vitro (Yuan et al., 1994) Conversely, cpSecA specific a ntibodies inhibited translocation of OE33 and PC into isolated thylakoids in vitro (Nakai et al., 1994) Similar experiments could be used to test candidate cpSec2 substrates. If azide inhibited the ATPase domain of cpSecA2, cpSec2 substrates could be identified as thylakoid proteins that are not translocated in the presence of azide or inhibitory antibodies to cpSecY2 or cpSecA2, but that are translocated in the presence of inhibitory antibodies to cpSecY or cpSecA (Nakai et al., 1994; Mori et al., 1999) Aside from testing cpSec2 substrates, specific inhibitory antibodies might also be used t o test the promiscuity of cpSecY and cpSecY2 for either cpSecA. Unfortunately, inhibitory antibodies cannot be used to test cpTatC integration via cpSecY2 because cpTatC does not integrate into isolated thylakoid membranes in an in vitro as say (Fincher et al., 2003) Interestingly, azide did not prevent cpTatC integration into thylakoids during an in vitro import reaction (Martin et al., 2009) If cpSecA2 were not involved in cpTatC integration, cpTatC might still be directly translocated by cpSecY2. Alternatively, cpTatC translocation might still involve cpSecA2 if cpSecA2 were resistant to inhibition by azide, as was observed for spinach cpSecA (Berghofer et al., 1995) In short, the inability of azide to prevent cpTatC integration into thylakoids does not rule out cpSec2 as a possible cpTatC integrase. The embryo lethal phenotype caused by cpSecY2 knockout p revents assaying mutant tissue for membrane integrated cpTatC, as was previously done to test the necessity of cpSecY and Alb3 to cpTatC integration. Hence, inducible disruption of cpSecY2 is an attractive strategy to assess the necessity of cpSecY2 for c pTatC integration.

PAGE 67

67 Figure 3 1. Arabidopsis SecY2 is a membrane integrated plastid protein. A) Radiolabeled precursor to SecY2 (pcpSecY2) was incubated with isolated chloroplasts in an in vitro import reaction for 30 minutes (see Experimental Procedur es, Appendix). Chloroplasts were treated with 100 g/mL thermolysin, repurified, washed, lysed, and fractionated into stroma and membranes. Translation product (Tp) equivalent to 5% of the assay, chloroplasts (Cp), stroma (S), membranes (M), and thermol ysin treated membranes (+T) were analyzed using SDS -PAGE and fluorography. A longer exposure of thermolysin-treated membranes is shown to visualize mcpSecY2 degradation products. Chloroplasts, stroma, and membranes were also analyzed by SDS -PAGE and immu nodetection with antibodies to TIC110 (applied at 1:5000) or cpTatC (applied at 1:20000). B) Membranes from the pcpSecY2 import reaction were subjected to alkaline carbonate extraction (see Experimental Procedures, Appendix). The supernatant (S) and me mbrane pellet (P) were analyzed using SDS PAGE and fluorography The positions of molecular weight markers (Mr) are shown at left.

PAGE 68

68 Figure 3 2. Arabidopsis plastid SecY2 localizes to the envelope membranes. Radiolabeled precursors to P36 (pP36) and c pSecY2 (pcpSecY2) were each incubated with isolated chloroplasts in in vitro import reactions for 15 minutes (see Experimental Procedures, Appendix). Both precursors were also co-imported into isolated chloroplasts for 15 minutes. Chloroplasts from all three import reactions were repurified, and washed. Chloroplasts that underwent coimport were lysed and fractionated (see Experimental Procedures, Appendix). Translation products (Tp) equivalent to 5% of each assay, chloroplasts (Cp), envelope membra nes (E), stroma (S), and thylakoid membranes (T) were analyzed by SDS PAGE and fluorography. Chloroplasts and fractions from pcpSecY2/pP36 coimport underwent were analyzed by immunodetection with antibodies to TIC110 (applied at 1:5000) or cpTatC (applie d at 1:20000). The weights of molecular markers (Mr) are shown at left.

PAGE 69

69 Figure 3 3. Arabidopsis SecA2 is a plastid protein. Radiolabeled precursor to SecA2 (pcpSecA2) was incubated with isolated chloroplasts in an in vitro import reaction for 45 mi nutes (see Experimental Procedures, Appendix). Chloroplasts were treated with 100 g/mL thermolysin, repurified, washed, lysed, and fractionated into stroma and membranes. Translation product (Tp) equivalent to 0.8% of the assay, chloroplasts (Cp), str oma (S), membranes (M), and thermolysin treated membranes (+T) were analyzed using SDS -PAGE and fluorography. Shown are translation products that were exposed for the length of time of chloroplasts and chloroplast fractions. The positions of molecular weight markers (Mr) are shown at left.

PAGE 70

70 CHAPTER 4 TESTING CHROMOPHORE -ASSISTED LIGHT INACT IVATION AS A MEANS T O DISRUPT THE FUNCTION OF CANDIDATE CPTATC INTEGRASES Introduction Chromophore Assisted Light Inactivation (CALI) could potentially provide a spa tially and temporally selective means of disrupting protein function in situ in chloroplasts isolated from a normally grown plant CALI involves a modified membrane permeable chromophore that specifically binds to a small tetra -cysteine peptide: CCPGCC. The excited chromophore is exceptionally efficient at generating oxygen radicals, which chemically disrupt the target protein to which the tetra -Cys tag is genetically fused (Tour et al., 2003) Here, CALI would be used to disrupt the candidate cpTatC integrase cpSecY2 within isolated chloroplasts in vitro Although Alb4 is also a candidate cpTatC integrase, no known knockout mutants are available. A knockout in the gene that encodes the targe t protein is needed in order to replace the endogenous gene with a tetra Cys tagged version. Endogenous replacement ensures that all target proteins possess the tetra Cys tag, maximizing disruption of the target protein when CALI is applied. To study the involvement of cpSecY2 in cpTatC integration, chloroplasts would be isolated from transgenic Arabidopsis in which the endogenous cpSecY2 was replaced by a tetra Cys tagged cpSecY2. After incubating isolated chloroplast s with dye light would be applied to disrupt tagged cpSecY2 The chloroplasts would then be used for in vitro import of radiolabeled pre cursor to cpTatC. Chloroplast fractions would be analyzed for cpTatC abundance. Accumulation of stromal cpTatC would constitute one line of evidence that cpTatC employs cpSecY2 for integration. CALI holds the potential to disrupt candidate cpTatC integrases but it is a relatively new method and is untested in chloroplasts. Furthermore, CALI has never been scaled up to prepare

PAGE 71

71 chemical quantities of a rea gent for a biochemical assay. As such, the application of CALI to the stu dy of cpTatC biogenesis requires several feasibility experiments which were conducted in vitro before committing the time and effort needed to replace endogenous cpSecY2 in Arabidop sis. Results Chloroplast Precursors are Translocated into Isolated Chloroplasts Despite E x posing Chloroplasts to Harsh CALI Conditions In order to apply CALI to study what role cpSecY2 may play in cpTatC integration, chloroplasts must be able to transloca te radiolabeled proteins after having undergone CALI. Under such circumstances, chloroplasts would experience intense prolonged light exposure and extended wai ting periods before use in a p cpTatC import reaction. Fortunately, exposing isolated chloroplas ts to intense light or extended incubation on ice did not prevent thylakoid accumulation of cpSec or cpTat substrates during an in vitro import assay (Figure 4 1). The data show that the tested precursors are both imported into chloroplasts and transporte d into thylakoids. This is shown by relatively even mature protein band intensity across all time points in each treatment series. The even densities seen across the mature protein bands stand in contrast to the accumulation of intermediate sized protein s in samples that were treated with cpSec or cpTat inhibitors: Azide or Nigericin/Valinomycin. The cpSec and cpTat substrates that each localize to the thylakoid lumen via a stromal intermediate were used in these experiments to test the effects of CALI co nditions on thylakoid protein translocation in the context of a chloroplast import assay. The originally intent was to use CALI to test effects on cpTatC integration in to thylakoid membranes; however, CALI feasibility experiments were conducted before de monstrating that stromal cpTatC is a direct

PAGE 72

72 precursor to thylakoid -integrated cpTatC. Hence, pcpTatC was not included in the above experiments. The Tetra -Cys Tag D oes not Alter Targeting of T wo Chloroplast Precursor Proteins that are to be U sed f or CALI F easibility Experiments Successful application of CALI to this study relies on an ability to bind exogenously applied dye to specific target proteins located within isolated chloroplasts. In an attempt to meet this technical requirement, tandem tetra -Cys ( 2TC) tagged precursors to t he soluble OE23 (p OE23 2TC) and membrane integrated cpTatC (pcpTatC 2TC) proteins were prepared as targets that could be used to test dye binding in vitro CALI dyes are very expensive. Hence, b efore applying either protein to dye bindi ng experiments, I tested if pOE23 2TC and pcpTatC 2TC would each target to their native localization within chloroplasts. Correct localization is necessary to demonstrate that CALI dye can cross membrane barriers to access a protein target. Alt hough not a substitute for cpSecY2 import, I also sought data that suggested a 2TC tag would not disrupt the localization of chloroplast precursors. Precursor to OE23 2TC was expressed in E. coli purified as inclusion bodies, then imported into isolated p ea chloroplasts. Antibodies that react with OE23 detected m ature OE23 2TC (mOE23 2TC) in thylakoids after import (Figure 4 2A). Mature size OE23 2TC is visible as a processed band running larger than endogenous OE23. Mature size OE23 2TC does not accumulate if impor t is conducted in the presence n igericin a nd valinomycin; as expected only stromal intermediate (iOE23 2TC) is visible. Tandem ly tagged cpTatC was found assembled into the 700 kD cpTat receptor complex in thylakoid membranes that were isola ted after import (Figure 4 2 B). Although tetra -cys tagged cpTatC appeared to accumulate in the cpTat receptor complex at lower efficiency than did the unmodified cpTatC, results from the import of the latter

PAGE 73

73 precursor st ood as a particularly encouraging e xample of a polyt opic thylakoid membrane protein whose localization and assembly will accommodate a C terminal tetra Cys tag. Radiolabeled Precursors to cpTatC and Substrates of the Known T hyl akoid Translocase Pathways are Translocated into and Targeted to Native Localizations Within I solated Ar abidopsis Chloroplasts In Vitro Pea chloroplasts are useful for CALI feasibility experiments because they are easy to isolate and exhibit robust translocation activity in vitro Although many CALI feasibility experi ments can be conducted using pea chloroplasts, the ultimate CALI experiments require genetic replacement of endogenous cpSecY2 with a tetra Cys tagged version. Endogenous replacement of cpSecY2 requires rescue of a heterozygous mutant, which can only be d one using Arabidopsis, as no cpSecY2 mutant is available in pea. Controls for the specific effects of CALI in Arabidopsis would involve the import of radiolabeled substrates of nontarget thylakoid translocases. Assessing translocation on nontarget pathw ays would speak to the specificity of CALI for cpSecY2. As all of our in vitro assays involve pea chloroplasts, I had to learn to isolate and use Arabidopsis chloroplasts in import assays. Large quantities of chloroplasts can be isolated from the leaves of soil grown Arabidopsis plants in a manner similar to that which is used to isolate pea chloroplasts (Schulz et al., 2004) ; however, these chloroplasts exhibit low protein translocation ac tivity in in vitro import assays (data not shown). Arabidopsis chloroplasts that are isolated from young developing tissue exhibit superior translocation activity. Young leaf tissue is harvested from densely arranged populations of seedlings that are gro wn on sucrose media (Smith et al., 2003) Radiolabeled precursors to c pTatC, LHCP OE33 and OE23 were each imported into Arabidopsis chloroplasts that were isolated from young leaves. Proper localization of LHCP, OE33, or OE23 was observed as mature size proteins that accumulated in chloroplasts from each import assay (Figure 4 3A, right panel). Following import and chloroplast fractionation

PAGE 74

74 radiolabeled mature cpTatC was found associated with thylakoid membranes, as expected (Figure 4 3A, left panel). Successful fractionation was evidenced by enrichment of envelope and thylakoid markers, TIC110 and cpSecY, in each respective chloroplast fr action (Figure 4 3B). It was important to demonstrate effective subfractionation of Arabidopsis chloroplasts following in vitro import because fractionation would be required to assess any relative changes in the proportions of stromal and thylakoid integ rated cpTatC that might accumulate as a result of cpSecY2 disruption. CALI Dye Will Cross Chloroplast Membranes and Bind a S tr omal Target P rote in Precursor to OE23 2TC is a target that is better suited than pcpTatC 2TC for testing in situ dye binding becau se larger amounts of stromal OE23 can be generated within chloroplasts during an in vitro import assay. A stromal target is critical to dye binding because binding requires reducing conditions (Cabantous et al., 2005) which are present in the stroma. Large quantities of stromal OE23 accumulate if bacterially expressed pOE23 is applied to a chloroplast import assay (Cline et al., 1993) Str omal OE23 accumulates because expressed protein can be added in large enough quantities to saturate the thylakoid cpTat translocase. Saturation is possible because cpTat transport of intermediate OE23 occurs at a slower rate than import of pOE23 (Cline et al., 1993) The same cannot be done using pcpTatC because, to date, it has not been possible to express pcpTatC in bacteria. In situ dye binding was tested on chloroplasts containing imported pOE23 or p OE23 2TC. D ye crossed the envelope to bind stromal i OE23 2TC but not OE23 (Figure 4 4B). N on specific dye binding to other chloroplast proteins other than iOE23 2TC, was also visible (Figure 4 4A ). The results of the above experiment also suggest tha t dye will bind a tetra Cys tag that is fused to the stromal domain of a membrane -integrate d thylakoid translocase subunit,

PAGE 75

75 as would be the case for cpSecY2. However, non-specific binding of dye may preclude the application of CALI to experiments involving chloroplasts. In V itro CALI CALI efficacy is typically observed as reduced target protein activity in the context of a micro -scale biochemical assay (Vitriol et al., 2007; Tour et al., 2003) I t is not possible to assess cp SecY2 activity using a biochemical assay because cpSecY2 is a newly discovered translocase with no known substrate(s) Instead, I attempted to test CALI efficacy by observing any effect it had on the targeting of pcpTatC to the thylakoid membrane after being imported into isolated chloroplasts in vitro In this type of assay, Precursor to tetra -Cys tagged cpTatC, that was treated with dye and light, targeted to thyla koids slightly less efficiently than precursor that had received dye but not light (Figure 4 5A, compare lanes 10 and 8). The same was not observed for pcpTatC that lacked a tetra Cys tag (Figure 4 5A, compare lanes 10 and 8 with 5 and 3). Although CALI showed some effect on the localization of the target protein, it was unclear what caused the reduction. Possible side chain modification might be one such mechanism, which might disrupt protein function or translocation without breaking peptide bonds. Dis cussion The results of several feasibility experiments suggest CALI can be applied to in situ thylakoid translocase disruption within isolated chloroplasts in advance of a chloroplast protein import assay. Chloroplasts tolerate high light exposure and lon g periods of handling before use in an in vitro import reaction. Tetra -Cys tagged chloroplast precursor proteins import into isolated chloroplasts, and are targeted to their native localization within chloroplasts. CALI dye will cross the chloroplast env elope to bind stromal tetra Cys tagged proteins. However, nonspecific dye binding to non target chloroplast proteins would complicate the application of CALI for disruption of specific thylakoid translocases (Figure 4 4A). Buffer washes reduced non-

PAGE 76

76 spec ific dye binding, but did not remove it completely. In the context of a CALI experiment, non -specific binding could negatively affect the potency of light treatments for cpSecY2 disruption, if non-specifically labeled non target proteins competed for phot ons that would otherwise disrupt tagged cpSecY2. Non -specific CALI could confuse the cause of potential cpTatC accumulation in the stroma, if it were unclear which chloroplast protein was being disrupted. Despite the complications that could arise from no n -specific dye binding, CALI did appear to have an effect on the targeting of a chloroplast precursor when the precursor was treated with dye and light in advance of import into the chloroplast. However, it is still not known if CALI will specifically dis rupt a thylakoid translocase protein in situ in isolated chloroplasts. CALI remains an evolving method that can provide the spatiotemporal resolution needed to study the function of necessary proteins such as thylakoid translocases. Perhaps CALI will bec ome useful to study thylakoid translocase function when the above problems are addressed.

PAGE 77

77 Figure 4 1. In vitro import of chloroplast precursor proteins proceeds after chloroplasts are exposed to CALI co nditions. Samples of isolated p ea chloroplasts w ere treated with Nigericin/Valinomycin (N/V), Az ide (Az), extended exposure to 17 mW/cm2 of 570nm light, or allowed to incubate on ice for increasing periods of time (see Experimental Procedures Appendix). Chloroplasts that received extended incubation on ice were incubated with r adi olabeled precursors to OE23 (pOE23) or Plastocyanin (p PC) in 20 minute import reactions (see Experimental Procedures, Appendix). p OE23 was incubated with light treated chloroplasts in 20 minute import reactions After i mport, chloroplasts were repurified, washed, and analyzed usi ng SDS -PAGE and fluorography. The molecular weights of m arkers (M r) are shown at left.

PAGE 78

78 Figure 4 2. Tetra Cys tagged precursors are targeted to native locations during import into isolated c hloroplasts. A) Chloroplasts were treated with nothing or Nigericin/Valinomycin (N/V) on ice for 10 minutes. Tandem tetra -Cys tagged precursor to OE23 ( pOE23 2TC) that had been expressed in E. coli was purified as inclusion bodies, and solubilized to 1. 5 M in 8 M Urea. Soluble pOE232TC was imported into untreated and N/V treated chloroplasts for 20 minutes (see Experimental Procedures, Appendix) B) Radiolabeled precursor cpTatC (pcpTatC) or tandem tetra Cys tagged cpTatC (p cpTatC 2TC) was imported into chloroplasts for 30 minutes. Chloroplasts from (a) and (b) were each treated with 100 g/mL thermolysin on ice for 30 minutes, repurified, washed, and fractionated (for pcpTatC import), or analyzed directly using SDS -PAGE (for pOE23 import). Eighty ng of pOE23 2TC (Tp) was analyzed alongside chloroplasts from the pOE23 2TC import reactions. OE23 was visualized by immunodetection using antibodies to OE23 (applied at 1:10000). The membrane fraction of chloroplasts from (b) was analyzed using BN PAGE and fluorography. The molecular weights of markers (Mr) are shown.

PAGE 79

79 Figure 4 3 In vitro import of substrates to various thylakoid translocases and chloroplast fractionation are both feasible when using Arabidopsis chloroplasts. A) Radiolabeled pr ecursors (Tp) to Arabidopsis cpTatC (patTatC) or pea OE23 (pOE23) OE33 (pOE33), or LHCP (pLHCP) were translated in vitro then imported into isolated Arabidopsis chloroplasts for 30 minutes (see Experimental Procedures, Appendix). Samples of c hloroplasts from patTatC import were fractionated into envelope membranes (E), stroma (S), and thylakoids (T ) by differential centrifugation (see Experimental Procedures, Appendix). Chloroplasts (Cp) from each import and chloroplast fractions from patTatC import we re analyzed using SDS -PAGE and fluorography. B) Chloroplast fractions from (a) were also subjected to immunoblotting to verify the efficacy of chloroplast sub-fractionation. Gels were blotted to nitrocellulose and probed with antibodies to atTIC110 and a tSecY (each applied at 1:5000) The m olecular weights of markers (Mr) are shown to the left.

PAGE 80

80 Figure 4 4 CALI dye binds a target protein with in intact chloroplasts. A ) Urea ( ) or urea solubilized precursors to OE23 ( p OE23 import) or tandem tetra Cys tagged OE23 (p OE23 2TC import) were imported into isolated pea chloroplasts for 20 minutes (see Experiment Procedures, Appendix) Samples of chloroplasts from each import reaction were inc ubated with 0 L, 0.75 L, or 1.5 L Lumio Green dye. Treated c hloroplasts were washed, lysed and fractionated into stroma a nd thylakoids. A sample of s troma from the 0 L dye binding reaction was combined with 0.35 L Lumio Green dye (0 + 0.35). Samples of stroma from each dye treatment were analyzed using SDS -PAG E. Dye labeled proteins were visualized in gels by fluorescence imaging (see Experimental Procedures, Appendix). B ) Stromal samples from pOE23 or pOE23 2TC import reactions, that received 1.5 L Lumio Green dye, were immunoprecipitated using OE23 antib odies linked to Protein -A Sepharose (see Experimental Procedures, Appendix) Immunoprecipitated proteins were analyzed by replicate SD S PAGE gels. The proteins in one gel were visualized by transfer to nitrocellulose and immunodetection using antibodie s to OE23 (applied at 1:10000). The second gel was visualized using fluorescence imaging The molecular weights of markers (Mr) are shown at left.

PAGE 81

81 Figure 4 5. In vitro CALI. Radiolabeled precursors (Tp) to cp TatC ( pcpTatC) and tetra -Cys tagged cp Tat C (pcpTatC 2TC ) were translated in vitro then incubated with Lumio Red dye ( D) or EDT2 buffer ( -E ) for 15 min utes (see Experimental Procedures, Appendix). Samples were treated with (L ) or without (D ) ligh t, then imported into isolated pea chloroplast s for 20 minutes (see Experimental Procedures, Appendix) Chloroplasts were treated with 100 g/mL thermolysin on ice for 30 minutes, repurified, washed, and fractionated. Membranes were treated ( B) or not treated (A ) with thermolysin then analyzed usi ng SDS -PAGE and fluorography. The m olecular weights of markers (Mr) are shown at left

PAGE 82

82 CHAPTER 5 INDUCIBLE RNAI AS A MEANS TO KNOCKDOWN T HE EXPRESSION OF CANDIDATE CPTATC INTEGRASES Introduction Membranes from cpSecY or Alb3 mutants were previously probe d for the presence of cpTatC to test if either translocase is required to integrate cpTatC (Martin et al., 2009) The same approach cannot be used to assess whether Alb4 or cpSecY2 are required to integrate cpTatC because Alb4 knockout mutants are not available and knocking out cpSecY2 is embryo lethal (Skalitzky, 2006; Gerdes et al., 2006) Inducible RN Ai is a potential means to silence Alb4 or cpSecY2 expression during any chosen stage of plant development. As such, inducible RNAi could be used to knock down cpSecY2 expression in seedlings that germinate from embryos that have had a chance to develop normally. Alb4 could also be silenced in Arabidopsis seedlings. Several systems have been developed to induce expression of genes of interest in Arabidopsis. These systems work with inducers such as heat, dexamethasone, alcohol, or estrogen (Zuo et al., 2000; Schena et al., 1991; Roslan et al., 2001; Masclaux et al., 2004) At the outset, heat or steroid inducible systems are less applicable to a study of cpTatC integration due to the concern that either inducer alone could incite a phenotype in wild type Arabidopsis seedlings (Donna Fernandez personal communication). For this project, I would need to be confident that the phenotype arising from induction was due to RNAi of a target translocase and not to the inducer itself. The alcohol inducible system is unattractive because it is leaky in plants that are grown on sucrose media (van Hoewyk, personal communication) Hence, leaky silencing could kill transgenic T1 seedlings during selection on sucrose media preventing the capture of lines that silence CPSECY2 most effectively.

PAGE 83

83 The estrogen inducible expression system lacks the above problems: estrogen neither causes aberrant phenotypes when applied to wild type plants, nor does it exhibit leaky expression in plants due to culture on sterile media (Zuo et al., 2006; Zuo et al., 2000) The estrogen inducible system works as follows. In the presence of estrogen, a constitutively expressed XVE transcription factor binds a promoter to trigger expression of an open reading frame of inte rest (Zuo et al., 2000) The estrogen inducible system can be employed for RNAi by inserting a hairpin construct made up of sequence that is homologous to a target gene of interest (Hirano et al., 2008) The hairpin is inserted downstream of the estrogen inducible promoter Hairpin constructs to cpSecY, Alb4, or cpSecY2 would be prepared to silence each respective gene through estrogen inducible RNAi in Arabid opsis. Chloroplast SecY serves as a positive control for the efficacy of inducible silencing because cpSecY mutants exhibit a pale seedling lethal phenotype (Skalitzky, 2006) After Alb4, cpSecY or cpSecY2 RNAi has been induced by estrogen, membranes could be isolated and probed for the presence of cpTatC. If either Alb4 or cpSecY2 is responsible for cpTatC integration, a reduction in membrane integrated cpTatC may be met with a corresponding i ncrease in soluble cpTatC because soluble cpTatC is a precursor to thylakoid membrane integrated cpTatC, and soluble cpTatC is not degraded by extended incubation in stroma (Figure 2 1A ). On the other hand, in vitro assays that previously assessed cpTatC targeting in intact chloroplasts were conducted over a period of a few hours, whereas inducible RNAi would be conducted over several days or weeks As such, non integrated cpTatC may be degraded instead of accumulated as a soluble protein. The latter wou ld result in reduction in the abundance of membrane -integrated cpTatC without a corresponding increase in the abundance of soluble cpTatC.

PAGE 84

84 Results Hairpin Sequences were Constructed for Estrogen Inducible RNAi of Alb4, cpSecY, and cpSecY2 in Arabidopsis RN Ai could possibly degrade transcripts to both CPSECY2 and CPSECY if sequence that is used to construct a hairpin for CPSECY2 is highly homologous to CPSECY, and vice versa (Van Houdt et al., 20 03) The same is true for ALB4; if the ALB4 hairpin sequence is nearly identical to sequence from ALB3, RNAi could potentially silence both ALB4 and ALB3. Fortunately, sizable portions of ALB4 and CPSECY2 sequence diverge from ALB3 and CPSECY, respectiv ely, allowing large hairpins to be produced without broadening the specificity of RNAi to the transcripts of nontarget gene family members. In particular, sequence within the first exon of CPSECY2 is distinct from sequence found within the CPSECY gene (F igure 5 2A and 5 2B). This region of CPSECY2 includes sequence that encodes the transit peptide. Sequence found within the third exon of CPSECY diverges from sequence found within CPSECY2 (Figure 5 2B), and sequence found within the ALB4 3 untranslated region (UTR) diverges from sequence found within ALB3 (Figure 5 2C). Further, the first, third, and last exons of CPSECY2, CPSECY and ALB4, respectively, are not homologous to other genes in Arabidopsis. Not only are the above described sequences diverge nt from other Arabidopsis genes, but they are also large; each spans over 500 base pairs. Large hairpin constructs have been shown to be more potent inducers of RNAi in Arabidopsis (Bleys et al., 2006; Wesley et al., 2001) Hairpin sequences for each target transcript were constructed using Two Fragment Multisite Gateway recombination (Invitrogen, Carlsbad, CA). Exonintron and exon fragments were initial ly amplified using PCR primers that were flanked by Gateway recombination sites. Recombination fused each exon intron with a cooresponding inverted exon fragment to construct

PAGE 85

85 an inverted hairpin repeat. Recombination simultaneously cloned each hairpin in the pMDC7 estrogen inducible binary vector (Figure 5 1A) (Curtis and Grossniklaus, 2003) Each construct was introduced into Arabidopsis thaliana by Agrobacterium mediated floral dip tr ansformation (Zhang et al., 2006) T1 lines carrying estrogen inducible constructs were initially identified based on resistance to hygromycin selection. PCR screening of genomic DNA from hygromycinr esistant seedlings initially involved vector primers that were designed to anneal outside the hairpin construct, but outside primers failed to amplify products (data not shown). This was likely due to complications that arise from trying to replicate a ha irpin amplicon by PCR. Therefore, sets of primers designed to anneal to pMDC7 and the intron sequences of each hairpin construct (Figure 5 3A) were used. These produced fragments of expected size from Alb4 cpSecY -, and cpSecY2 RNAi genomic DNA, which suggested that hairpin constructs for each target successfully integrated into Arabidopsis complete with upstream and downstream sequence from the estrogen inducible system (Figure 5 3B and 5 3C). Additionally, Sanger sequencing of each PCR product confirm ed sequence identity to the estrogen inducible vector and the corresponding target gene (data not shown). Several lines contained hairpin constructs to each target: four Alb4 RNAi lines, six cpSecY lines, and nine cpSecY2 lines. Once deemed resistant to hygromycin and in possession of hairpin constructs, seedlings were transferred to soil to collect T2 seed. Estrogen Induces Pale Phenotypes in cpSecY and cpSecY2 -RNAi Lines, but Causes no Change to Alb4 -RNAi or Empty Vector Control Lines Arabidopsis T2 li nes that contained an empty estrogen inducible construct or those containing hairpin constructs to Alb4, cpSecY, or cpSecY2 were grown on selective media for two weeks, receiving exogenous 10 M estrogen to shoots and roots every day. Alternatively, seedl ings were grown on selective media for two weeks then transferred to estrogen media and

PAGE 86

86 grown for two more weeks. Neither induction regiment produced a visible phenotype in cpSecY2 -RNAi or Alb4 RNAi plants that was distinct from the phenotype exhibited by control seedlings (data not shown). When germinated directly on estrogen-containing media, lines containing hairpin constructs to cpSecY and cpSecY2 produced a range of phenotypes. After growing on 10 M estrogen media for two weeks, cpSecY RNAi lines b ore pale cotyledons and small green true leaves, whereas cpSecY2 RNAi seedlings exhibited bleached or variegated cotyledons and green true leaves (Figure 54). Chloroplast SecY -RNAi line number ten (cpSecY 10) was the most responsive cpSecY -RNAi line, sho wing pale cotyledons when induced by estrogen. Chloroplast SecY2 RNAi line number five (cpSecY2 -5) exhibited the strongest responses to inducer: bleached cotyledons with no variegation. Chloroplast SecY2 RNAi line nine (cpSecY2 9) seedlings exhibited ble ached or variegated cotyledons; the remainder of cpSecY2 RNAi lines exhibited variegated cotyledons. Chloroplast SecY and cpSecY2 -RNAi seedlings were also stunted compared to the size of empty vector control seedlings (Figure 5 4). ALB4 RNAi seedlings a ppeared as green as the empty vector plants (data not shown). All pale, bleached, and variegated lines were green and indistinguishable from empty vector seedlings when germinated on media that lacked estrogen (Figure 5 5). Induced Alb4 -, cpSecY -, and cpS ecY2 -RNAi Lines Experience Transcript Knockdown Quantitative RT PCR (qRT PCR) was used to compare the expression levels of target and non target transcripts in whole seedlings of induced empty vector control and RNAi lines. Quantitative RT PCR measured a 20% reduction in ALB4 transcript abundance in each of three lines that contained inducible hairpin constructs to ALB4 (Figure 5 6). In ALB4 RNAi lines, non target transcripts to CPSECY and CPSECY2 were at least as abundant those in the empty vector control line, and CPTATC transcripts were generally unaffected. Measuring cpSecY

PAGE 87

87 transcript abundance in cpSecY2 RNAi lines and cpSecY2 in cpSecY RNAi lines served to assess whether RNAi was specific for targeted gene family members. Chloroplast SECY transcrip t abundance was reduced at least 50% in induced cpSecY RNAi lines. ALB4 and CPSECY2 transcripts were regularly more abundant than control in cpSecY RNAi lines, and CPTATC was comparable to that of the control. Chloroplast SECY2 fell 20% to 40% in induced cpSecY2 -RNAi lines. In cpSecY2 RNAi lines, transcripts to CPSECY were at least as abundant as those measured in empty vector control, whereas CPTATC transcripts were below that of the control in cpSecY2 -RNAi line five (Figure 5 6). Weak SecY2 transcript knockdown in cpSecY2 RNAi seedlings was unexpected in plants that exhibited pale cotyledons. Apparently weak silencing was probably due to the isolation of RNA for qRT -PCR from both green and pale tissues of induced RNAi seedlings (Figure 5 4). Support f or this interpretation came from qRT PCR analysis of the green leaf tissue of induced cpSecY 10, cpSecY2 5, and cpSecY29 seedlings (Figure 5 7). Little or no silencing was evident in these tissues. Therefore, RNAi seedling growth was observed over two w eeks to identify a stage showing the maximum phenotypic effects (Figure 5 8). At five to six days post germination, only pale or bleached cotyledons were observed in seedlings from cpSecY or cpSecY2 -RNAi lines, whereas empty vector seedlings were green ( Figure 5 -9). I also observed that pale true leaves emerged from induced seedlings if they were plated with space left between individual plants (Data not shown). Green true leaves were more common among seedlings that were plated together in dense clumps (Figure 5 8). CPSECY transcript abundance was reduced to 10% of empty vector when cpSecY 10 seedlings were assayed at six days post germination (Figure 5 10A). Chloroplast SecY2 5 seedlings exhibited a 60% reduction in CPSECY2 transcript levels, effectively doubling the

PAGE 88

88 degree of transcript knockdown when compared to seedlings that were assayed at 14 days post germination (compare Figures 5 10A and 5 6). Chloroplast SECY transcripts were not reduced in cpSecY2 RNAi lines, nor was CPSECY2 transcript abund ance reduced in cpSecY RNAi seedlings (Figure 5 10A). It was necessary to monitor the transcript abundance of nontarget thylakoid translocases in order to test whether a potential reduction in cpTatC protein levels would be specific to a reduction in the thylakoid translocase that was targeted for RNAi, and not from an indirect effect of silencing a nontarget translocase. Because so little is known about cpSecY2 function, it is possible that transcripts of a non -target translocase could be down regulated if the protein they encoded were integrated by cpSecY2. Reducing cpSecY2 expression could result in feedback regulation and reduced transcript abundance of a non target translocase (Woodson and Chory, 2008) Such a result would prevent me from concluding that cpTatC is integrated by cpSecY2. CPTATC transcript abundance was unaffected in cpSecY RNAi seedlings, but it was reduced in both cpSecY2 5 and 9, with lower levels measured in cpSecY2 -5 (Figure 5 10B). The abundances of ALB3 and ALB4 transcripts were also reduced in cpSecY2 RNAi lines, with cpSecY2 5 again experiencing a more severe knockdown. Three subunits of the plastid import apparatus were also surveyed. TOC75 transcript abundanc e was slightly lower than control in cpSecY 10 and cpSecY29 lines, whereas cpSecY2 5 experienced a 40% knockdown. Interestingly, transcripts to TIC40 and TIC110 were unaffected in all three lines in which they were at least as abundant as those levels measured in control. Knocking Down cpSecY or cpSecY2 Transcript Abundance Results in Disruption to Thylakoid Structure After six days on inductive media, the cotyledons of empty vector control seedlings contained plastids with large starch grains, extensive thylakoids, and numerous grana stacks

PAGE 89

89 (Figure 5 11). Chloroplast SecY29 plastids contained fewer thylakoids than control, but not as few as were observed in cpSecY2 5 plastids (Figure 5 11). cpSecY 10 plastids mostly contained stromal vesicles and lacke d thylakoid lamellae. In rare cases, cpSecY 10 plastids contained lamellae that spanned the plastid, but no grana were present (data not shown). Chloroplast SecY 10 plastids also contained inclusions that were roughly the same size and shape as starch gr ains, but they stained differently (Figure 5 11). Reduced numbers of thylakoids seen in cpSecY2 and cpSecY RNAi lines is similar to what has been observed in the plastids of seedlings harboring knockout mutations in genes that encode core subunits of thy lakoid protein translocases such as ALB3, SECY, and TATC (Roy and Barkan, 1998; Motohashi et al., 2001; Su ndberg et al., 1997) Knocking Down cpSecY2 Transcript Abundance Results in Reduced Levels in Plastid Envelope and Thylakoid Localized Protein Translocases Membranes and soluble proteins that were extracted from each of the estrogen induced lines were p robed for the relative abundances of Actin, Hsp70, TOC75 Alb4, cpTatC cpSecY, TIC110, and TIC40 to assess effects that reducing cpSecY2 expression had on the abundance of target and nontarget proteins. Chloroplast SecY2 could not be assessed because an tibodies to cpSecY2 are not available. Actin was used as a loading control because it is a soluble non plastid protein whose abundance might not not be affected by reduced cpSecY2 expression. Hsp70 was tested as a chloroplast -specific protein that locali zes to the stroma, and would not likely be affected by changes in the expression of chloroplast inner membrane translocase such as cpSecY2. The abundance of Actin, Hsp70, and TOC75 were largely unaffected in induced cpSecY2 5 knockdown seedlings (Figure 5 12). Small fluctuations in the abundance of Alb4 protein could be observed across RNAi lines. Chloroplast TatC protein was decreased in cpSecY2 5, but not in cpSecY2 9. cpSecY protein abundance is almost undetectable in

PAGE 90

90 cpSecY 10 and cpSecY25 seedlin gs, and TIC40 and TIC110 abundances were specifically decreased in cpSecY2 5 RNAi seedlings. Discussion In this study, an estrogen -inducible expression system was employed to provide temporal control over targeting Alb4, cpSecY, and cpSecY2 for post transc riptional gene silencing. An inducible approach was required because no Alb4 knockout mutant yet exists, and knocking out cpSecY2 causes embryo lethality (Gerdes et al., 2006; Skalitzky, 2006) Inducible RNAi was initially sought as a means to follow changes in cpTatC transcript and protein abundance that might arise in response to reductions in Alb4 or cpSecY2 transcript and protein levels. Ho wever, inducible RNAi also facilitated my following the expression of other chloroplast protein translocases, both at the transcriptional and protein levels. My attempts were fruitful in so much as I acquired Arabidopsis lines that responded to estrogen i nduction by knocking down Alb4, cpSecY, and cpSecY2 transcript abundance. I started by surveying lines of estrogen-treated seedlings for pale or albino phenotypes, which are exhibited by several lines of Arabidopsis that contain knockout mutations in genes that encode thylakoid protein translocases. Alb4 transcript levels were reduced to ~80% of wild type in estrogen -treated Alb4 RNAi seedlings. Alb4 RNAi seedlings were green and grew as wild type. My results reflect those of a previous attempt to knockout Alb4, in which protein levels were reduced to 10% of wild type without producing any visible phenotype (Gerdes et al., 2006) Because I was unable to achieve a better knockdown, and that no Alb4 line appeared pale, I discontinued analysis of Alb4 RNAi lines. Chloroplast SecY knockout mutants are albino (Skalitzky, 2006) whereas inducible knockdown mutants for cpSecY were pale yel low. Although cpSecY2 knockout mutations cause an embryo lethal phenotype, the albino phenotype exhibited by induced cpSecY2 RNAi seedlings was somewhat expected because constitutive

PAGE 91

91 expression of a GFP -tagged cpSecY2 previously produced white sectoring i n Arabidopsis shoots (Donna Fernandez, personal communication). White sectoring was thought to arise from cpSecY2 silencing or a dominant negative effect from over -expression of a potentially deleterious cpSecY2 fusion protein (Donna Fernandez, personal c ommunication). Furthermore pale and albino phenotypes in cpSecY and cpSecY2 RNAi lines were inducible; if not provided with estrogen, seedlings from each RNAi line grew green as wild type. Chloroplast SecY2 RNAi seedlings appeared to contain large quanti ties of anthocyanins, which were observed as purple coloration in the aerial portions of seedlings and apparently produced large dark spots in electron micrographs (Figure 5 13 and 5 8). Anthocyanins are synthesized in the cytoplasm before transport to th e vacuole, where they accumulate as anthocyanic vesicle inclusions (AVIs) (Davies and K, 2003; S, 2006) At this point, it is unclear why the putative AVIs in cpSecY2 RNAi cotyledon cells are present in the cytoplasm instead of the vacuole. Anthocyanins are produced in response to biotic and abiotic stress, particularly in response to photo -oxidative stress (Chalker Scott, 1999) Chloroplast SecY RNAi lines were small and pale without over producing anthocyanins. From the results in this study, it would appear anthocyanin production results from a di rect or indirect effect of decreased cpSecY2 expression, and not from general photo-oxidative stress that would presumably also take place in the pale tissues of cpSecY RNAi seedlings. Aside from anthocyanin accumulation, plastids in cpSecY2 5 cotyledon c ells contained large white inclusions, and mostly lacked thylakoid membranes. The plastids of cpSecY RNAi cotyledon cells contained numerous vesicles and reduced quantities of thylakoids. A lack of thylakoid membranes and/or the accumulation of plastid v esicles are exhibited by plastids from seedlings that harbor mutations to other thylakoid

PAGE 92

92 protein translocases such as ALB3, CPSECY, and TATC ( Sundberg et al., 1997; Roy and Barkan, 1998; Motohashi et al., 2001) Quantitative RT PCR was first used to measure the abundances of transcripts to cpSecY or cpSecY2 in induced cpSecY and cpSecY2 RNAi seedlings. I was satisfied to find that cpSecY transcripts were reduced to 10% of wild type, without non-specific silencing of cpSecY2, and that cpSecY2 transcripts could be reduced to about 40% of wild type without any reduction in cpSecY transcript levels. It was som ewhat surprising that an albino phenotype could result from an arguably modest reduction of cpSecY2 transcript abundance in induced cpSecY2 RNAi seedlings. Perhaps cpSecY2 is so important that seedlings cannot tolerate more severe reductions in cpSecY2 ex pression. Alternatively, if cpSecY2 silencing were occurring through partial degradation of the transcript, which could disrupt cpSecY2 translation and protein stability or function, and not complete transcript degradation, my qRT PCR primers might have a mplified such transcript fragments during my qRT PCR survey. In such a case, qRT -PCR would register truncated cpSecY2 mRNA as expressed transcripts without regard for transcript intactness, which is more relevant to protein synthesis. The latter possibil ity is supported by the results of maize cpSecY2 gene structure studies and RT -PCR experiments, which revealed a pre mature stop codon that is in frame with the translation start site (data not shown). Alternative splicing gives rise to a cpSecY2 transcri pt that lacks the pre -mature stop codon, which suggests that transcript truncation may be a way in which maize cpSecY2 expression is regulated. Unfortunately, I was unable to confirm protein cpSecY2 protein knockdown in RNAi lines because no antibodies ar e yet available. This is partly due to the fact that cpSecY2 is a newly discovered protein and is still in need of extensive characterization.

PAGE 93

93 With confidence that RNAi of cpSecY or cpSecY2 was inducible and specific, I went on to survey the expression of other nuclear -encoded chloroplast genes on the transcriptional and protein levels. TOC75 or Alb4 protein levels were mostly unaffected by reductions in cpSecY or cpSecY2 transcripts, but cpTatC protein and transcript abundance were both reduced when cpSe cY2 transcripts were targeted for RNAi in cpSecY2 5. The specific cause of cpTatC down regulation is unknown, but one could hypothesize that cpTatC and cpSecY2 are co -regulated, and that reducing cpSecY2 expression results in decreased cpTatC expression. Co regulation could result from cpSecY2 being a cpTatC integrase; in such a case, reducing expression of cpSecY2 could result in feedback inhibition of cpTatC expression. Alternatively, cpTatC expression could be reduced as an indirect effect of cpSecY2 silencing. Perhaps cpSecY2 down regulation disrupts the translocation of a protein that is required for cpTatC gene expression or cpTatC protein integration or stability in the membrane. Although I cannot definitely conclude that cpSecY2 is a cpTatC inte grase, the data from my inducible silencing experiments does not rule out cpSecY2 as a candidate cpTatC integrase. On the contrary, my data maintains cpSecY2 as a strong candidate cpTatC integrase. Aside from my primary interest in cpTatC biogenesis, were interesting reductions in chloroplast proteins in cpSecY2 5 seedlings that could not be explained by reductions in transcript abundance. T IC40, TIC110, and cpSecY fit this category. Although it is interesting to interpret that cpSecY2 integrates TIC110 and TIC40, it is still possible that TIC110, TIC40, and cpSecY integration or membrane stability is indirectly regulated by cpSecY2. TIC110 plays a general role in the import of chloroplast precursor proteins (Inaba et al., 2005) TIC40 links TIC110 to the stromal, inner envelope membrane associated chloroplast chaperone, Hsp93 (Chou et al., 2003) Although heterozygous TIC110 T DNA insertion mutants exhibit reduc ed

PAGE 94

94 import efficiency (Kovacheva et al., 2005) reduced TIC110 protein levels in cpSecY2 -RNAi lines are apparently not sufficient to affect the import rates of stromal Hsp70 and thylakoid integrated A lb4. The results of in vitro import and localization assays place cpSecY2 at the envelope membrane, which is expected for a protein that would integrate TIC40 and TIC110 Involvement in TIC110 and TIC40 integration suggests that the cpSecY2 pore is topologically oriented toward the stroma because both TIC40 and TIC110 move through the stroma en route to the inner envelope membrane (Li and Schnell, 2006; Lubeck et al., 1997) Stroma facing topology would be consistent with other bacterially conserved chloroplast inner membrane protein translocases, including cpSecY. SecY integrates SecY in bacteria (Swidersky et al., 1992) and data here suggests that cpSecY2 is directly or indirectly involved in cpSecY integration or stability. I have observed cpSecY2 to be localized to thylakoid membranes during in vitro import assa ys, but in vivo localization data is still needed to examine whether cpSecY2 localizes to both thylakoid and inner envelope membranes. Perhaps after developing cpSecY2 specific antibodies, in vivo localization and topology studies could verify the inner e nvelope localization of cpSecY2 and its possible orientation toward the stroma. The results of recent investigations into TIC40 and TIC110 biogenesis suggest that TIC40 is partly involved in both TIC40 and TIC110 integration (Chiu and Li, 2008) Evidence comes from the observed buildup of stromal intermediates to TIC110 and TIC40 when radiolabeled precursors to TIC110 and TIC40 are imported into isolated tic40 mutant chloroplasts in vitro Such experime nts showed that TIC40 and TIC110 still integrate into the inner envelope membranes of tic40 chloroplasts, but that integration is slowed. The authors explain that TIC40 might help TIC40 and TIC110 integration. It would seem that TIC40 is not required for TIC110

PAGE 95

95 insertion because mutant studies have shown that TIC40 mutant seedlings are pale, slow growing, and viable, whereas TIC110 mutants do not advance beyond the globular stage of embryo development (Chou et al., 2003; Kovacheva et al., 2005) If TIC40 were necessary for TIC110 biogenesis, one could expect that TIC40 mutants would also suffer embryo lethal effects. The embryo lethal phenotype of TIC110 muta nts is more congruent with the phenotype of cpSecY2 knockout mutations, which are embryo lethal, and also do not develop beyond the globular stage of embryo development (Skalitzky, 2006) In ligh t of the previous TIC110 and TIC40 biogenesis studies and the data presented here, it is tempting to speculate that cpSecY2 is involved in TIC110 and TIC40 integration. TIC40 integration would not seem to require cpSecA2 because TIC40 integrates without a need for ATP or stroma (Li and Schnell, 2006) TIC110 might require cpSecA2 because TIC110 integration is ATP dependent (Vojta et al., 2007) Chloroplast SecA requires ATP to help transport proteins through the cpSecY channel (Schunemann, 2007) Chloroplast SecA2 is a stromal protein that may function in an ATP -dependent manner similar t o cpSecA, but future studies are required to test this hypothesis. The results of this study are exciting because they suggest that cpSecY2 is a translocase that is involved in the biogenesis of both bacterially conserved and novel chloroplast protein tran slocases. Such a translocase might have facilitated the biogenesis of novel translocases within the cyanobacterial endosymbiont, which would have served to establish a key biochemical relationship as the endosymbiont developed to become a plastid. Evolut ion from endosymbiont to chloroplast was accompanied by relocation of genes that encode conserved thylakoid protein translocases to the nucleus. Bacterially conserved chloroplast proteins, including cpSecY2, are expressed from nuclear -encoded genes and re ly on novel translocases of

PAGE 96

96 the chloroplast inner and outer envelope for translocation into the chloroplast. Paradoxically, the results of this study suggest that cpSecY2 is a translocase that is both required for and depends on the biogenesis of novel su bunits of the chloroplast import apparatus.

PAGE 97

97 Figure 5 1 Hairpin construction scheme for inducible RNAi A) For each target gene, primers (half arrows) flanked with Gateway recombination sites (numbers and letters) were used to PCR amplify exonintron (large white arrow line) and exon (large white arrow) target gene fragments f rom Arabidopsis genomic DNA. For each target Multisite Gateway recombination (Invitrogen, Carlsbad, CA) oriented exon -intron and exon fragments into an inverted repeat during s imultaneous insertion into the estrogen inducible binary vector, pMDC7 B) Exons (boxes), untranslated regions (gray boxes), and introns (lines) are shown for each target gene. Regions bracketed by red lines were amplified for hairpin construction. Blue triangles point to the locations of sequences that were amplified for quantitative RT -PCR.

PAGE 98

98 Figure 5 2. Conservation and divergence between the sequences used to construct RNAi hairpins and those of nontarget gene family members. Sequences (highligh ted black) that were used to construct hairpins to Alb4 (A), cpSecY (B), or cpSecY2 (C), are aligned with those belonging to each corresponding homologous translocase.

PAGE 99

99 Figure 5 2. Continued

PAGE 100

100 Figure 5 2. Continued

PAGE 101

101 Figure 5 3. PCR screens confirm Alb4, cpSecY, and cpSecY2 hairpin constructs are present in Arabidopsis T1 lines. A) Scheme illustrating combinations of primer s designed to screen T1 lines for successful transformation Primers A and 2 anneal to pMDC7 vector sequence that flanks each hairpin construct, whereas primers B and 1 anneal to the intron sequences of each hairpin construct. B ) Examples of PCR products that resulted from screening primers and genomic DNA from several T1 cpSecY2 RNAi lines. C) Examples of PCR products that res ulted from screening primers and genomic DNA from several T1 cpSecY and Alb4 RNAi lines. The sizes of DNA markers (Mr) are shown alongside each gel. Col 0, Arabidiopsis wild type genomic DNA; pMDC7, empty vector plasmid.

PAGE 102

102 Figure 5 4. Representative p henotypes that were induced in various RNAi lines. Arabidopsis seeds from lines containing inducible hairpin constructs to empty vector, cpSecY, or cpSecY2 were grown on media containing 10 M estrogen for 14 days (see Experimental Procedures, Appendix ). Scale bars indicate 1 mm.

PAGE 103

103 Figure 5 5. Non -induced phenotypes in various RNAi lines. Arabidopsis seeds from lines containing inducible hairpin constructs to empty vector, cpSecY, or cpSecY2 were grown on selective media lacking estrogen for two we eks (see Experimental Procedures, Appendix). Shown are single seedlings from each line at one and two weeks post -germination. Scale bars indicate 1 mm.

PAGE 104

104 Figure 5 6. Average levels of target and nontarget transcripts in induced RNAi lines. A rabidopsis plants from lines that contained empty vector, Alb4 -, cpSecY and cpSecY2 -RNAi constructs were grown on media containing 10 M estrogen for 14 days (see Experimental Procedures, Appendix). mRNA was isolated from seedlings in each line, equal quantities of mRNA from each line were used to synthesize cDNA, and cDNA was used for qRT PCR. The average amounts of target and non-target transcripts are plotted for several RNAi lines relative to empty vector control. Error bars depict standard error for each transcript in each line, which were calculated from two technical replicates for each of three biological replicates. Alb4 RNAi cpSecY RNAi cpSecY2 RNAi

PAGE 105

105 Figure 5 7 Average levels of target transcripts in green leaves of induced RNAi lines. Arabidopsis plants from lines that c ontained empty vector, cpSecY -, or cpSecY2 RNAi constructs were grown on media containing 10 M estrogen for 21 days (see Experimental Procedures, Appendix). mRNA was isolated from seedlings in each line, equal quantities of mRNA from each line were use d to synthesize cDNA, and cDNA was used for qRT -PCR. Plotted are the average amounts of target transcripts in several RNAi lines relative to empty vector control. Error bars depict standard error for each transcript in each line, which were calculated fr om three technical replicates for each of three biological replicates.

PAGE 106

106 Figure 5 8. Representative phenotypes of induced RNAi seedlings over time. Arabidopsis seeds from lines containing inducible hairpin constructs to empty vector, cpSecY, or cpSecY2 were grown on selective media containing 10 M estrogen for two weeks (see Experimental Procedures, Appendix). Shown are groups of seedlings from each line at time points beginning at five days post germination. Scale bars indicate 1 mm. White arrows point at emerging green true leaves in seedlings that initially develop pale cotyledons.

PAGE 107

107 Figure 5 8. Continued.

PAGE 108

108 Figure 5 9. Representative early growth phenotypes that were induced in RNAi lines. Arabidopsis seeds from lines containing empty vec tor or inducible hairpin constructs to Alb4, cpSecY, or cpSecY2 were grown on media containing 10 M estrogen for six days (see Experimental Procedures, Appendix). Scale bars indicate 1 mm.

PAGE 109

109 Figure 5 10. Relative abundance of various transcripts in i nduced RNAi lines. Arabidopsis plants from lines that contained empty vector, cpSecY and cpSecY2 -RNAi constructs were grown on media containing 10 M estrogen for six days (see Experimental Procedures, Appendix). mRNA was isolated from seedlings in e ach line, equal quantities of RNA from each line were used to synthesize cDNA, and cDNA was used for qRT -PCR. (A) The average amounts of target and non-target transcripts are plotted for several RNAi lines relative to empty vector control. Error bars depict standard error for each transcript in each line. Data was had from three technical replicates for each of three biological replicates.

PAGE 110

110 Figure 5 11. Representative TEM micrographs of plastids from induced RNAi lines. Arabidopsis seeds from lines containing empty vector or inducible hairpin constructs to Alb4, cpSecY, or cpSecY2 were grown on media containing 10 M estrogen for six days (see Experimental Procedures, Appendix). Seedlings were harvested and plastids in the cotyledons were imaged using TEM (see Experimental Procedures, Appendix). Scale bars indicate 500 nm.

PAGE 111

111 Figure 5 12. Immunoblotting membrane and soluble proteins from induced RNAi lines. Arabidopsis plants from lines that contained empty vector, cpSecY -, and cpSecY2 RNAi c onstructs were grown on media containing 10 M estrogen for six days (see Experimental Procedures, Appendix). Membranes and soluble proteins were isolated from seedlings then analyzed by SDS PAGE and immunoblotting, using antibodies to atcpTatC (1:5000) atcpSecY (1:5000), psOxa1p (1:5000), atTIC110 (1:5000), atTIC40 (1:5000), atTOC75 (1:2500), Hsp70 (1:5000), Actin (1:5000), or atAlb3 (1:2500). S amples were loaded as equal mass tissue

PAGE 112

112 Figure 5 13. Representative TEM micrographs of cells from induc ed RNAi lines. Arabidopsis seeds from lines containing empty vector or an inducible hairpin construct cpSecY2 were grown on media containing 10 M estrogen for six days (see Experimental Procedures, Appendix). Seedlings were harvested and cotyledon cel ls in the were imaged using TEM (see Experimental Procedures, Appendix). Scale bars indicate 5 m.

PAGE 113

113 APPENDIX EXPERIMENTAL PROCEDU RES Hairpin Construction for Inducible RNAi of Thylakoid Translocases Two gene fragments were amplified from Arabidopsis ge nomic DNA to prepare hairpin constructs for CPSECY, CPSECY2, or ALB4. Exon -introns to each target were amplified using primers flanked with B1 and B5r Gateway recombination sites (Invitrogen, Carlsbad, CA). Each exon intron fragment was cloned into the P1 -P5r Multisite Gateway 2.0 entry vector using BP Clonase II (Invitrogen). Each second fragment was made up of the exon from the first fragment, and was amplified using primers flanked with B5 and B2 Gateway recombination sites. The second fragments were cloned in the P5 P2 Multisite Gateway 2.0 entry vector using BP clonase II. Gateway LR clonase II (Invitrogen) was used to assemble fragment pairs as inverted hairpins while simultaneously sub-cloning the inverted hairpin repeat into the estrogenind ucible binary vector, pMDC7 (Curtis and Grossniklaus, 2003) The third CPSECY exon and the following intron were used to construct the CPSECY hairpin (Figure 5 1B). Each of the two CPSE CY fragments that were used to construct the hairpin were produced as nested PCR products that were amplified from a larger CPSECY gene fragment. The larger CPSECY gene fragment was synthesized by fusing two smaller CPSECY gene fragments that were amplifi ed by from Arabidopsis genomic DNA by splicing by overlap extension (SOE) (Horton et al., 1989) The protein coding sequence in the first CPSECY2 exon and the sequence of the following intron were used to produce the cpSecY2 hairpin. The exonintron cpSecY2 fragment was amplified directly from Arabidopsis genomic DNA. The second exon fragment was produced by fusing two half fragments of the cpSecY2 exon together by SOE. The last intron and exon were used to produce the Alb4 hairpin. The 3 Untranslated Region (3 -UTR) and intron Alb4 fragment was produced by fusing two smaller ALB4

PAGE 114

114 fragments together by SOE. The 3 -UTR fragment was amplified directly from Arabidopsis genomic DNA. All primer sets that we re used to synthesize the hairpin constructs are listed below (Table A 1). Construction of Precursors T ranscription clones ( Sp6 promoter) for mature size cpTatC (mcpTatC) and precursors to the light harvesting chlorophyll binding protein (pLHCP), plastocya nin (pPC), envelope phosphate translocator (pP36), cpTatC (pcpTatC), the small subunit of RuBisCO (pSSU), atAlb4, atAlb3, psAlb3 (previously called cpOxa1p), and the 23 kD (pOE23) and 33 kD (pOE33) subunits to the oxygen-evolving complex were each previous ly described ( Anderson and Smith, 1986; Cline et al., 1989; Last and Gray, 1989; Cline et al., 1993; Moore et al., 2000; Mori et al., 2001; Gerdes et al., 2006; Schnell et al., 1990) Dr. Donna Fernandez provided SP6 transcription clones for precursors to cpSecY2 (pcpSecY2) and cpSecA2 (pcpSecA2). All novel restriction sites were inserted into constructs via Quickchange Mutagenesis (Stratagene). Reciprocal swaps between the transit peptides and mature domains of SSU and cpTatC were made as follows. MluI restriction sites were inserted twenty and eight amino acids after the stromal transit peptidase cleavage sites of pS SU and pcpTatC respectively, and the reciprocal chimeric precursors constructed by sub-cloning of restriction fragments ( Figure 2 2B ). In order to prepare cpTatC precursors lacking the non conserved amino terminal domain, a BssHII restriction site was ins erted into pcpTatC 47 residues after the stromal transit peptidase cleavage site. Precursors containing either the cpTatC or SSU transit peptide and cpTatC lacking the nonconserved amino terminus ( NCcpTatC) were prepared by an MluI BssHII double restri ction digest and subsequent ligation of fragments. The junction in SSUtp cpTatC consisted of amino

PAGE 115

115 acids 1 79 from pSSU and residues 198 353 from cpTatC (Figure 2 1B). The TatCtp NCcpTatC fusion lacked pcpTatC residues 101 197 (Figure 2 3A) Nucleotide s equence encoding the first 126 amino acids of Arabidopsis pcpTatC was amplified from a cDNA clone by a polymerase chain reaction using primers flanked with NdeI and BamHI restriction sites. The PCR product was sub -cloned in pET 14b (Novagen) to produce an N terminal 6x histidine tagged fusion protein (pET14batcpTatC). The tandem tetra Cys tag (2TC) is composed of the following amino acids: AEAAAREACCPGCCARARSAEAAAREACCPGCCARA (Tour et al., 2003) The tag was synthesized by GeneArt. Restriction cloning was used to fuse the tag to the C -terminus of SP6 transcription clones of precursors to OE23 or cpTatC. Restriction cloning was used to place precursors to pea OE23 and OE232TC in the pETh3C bac terial expression vector. Preparation of Radiolabeled P recursors RNA transcripts were produced by transcription with SP6 polymerase (Promega) and translated with a homemade wheat germ translation system in the presence of 3[H] leucine (Cline, 1986) Where indicated, in vitro -coupled transcription, translation with wheat germ TnT (Promega and NEN Life Science Products) was performed following the manufactures guidelines. Translation products were dilute d with one volume of 60 mM leucine in 2X import buffer (IB, 1X = 50 mM HEPES/KOH, pH 8.0, 0.33 M sorbitol) prior to use unless otherwise indicated in the figure legend. Preparation of Bacterially Expressed Proteins and A ntibodies pOE23 pOE33 and tetra -cy s tagged pOE23 from pea were each expressed in E. coli and purified as inclusion bodies as previously described (Cline et al., 1993) Inclusion bodies were dissolved in 10 M urea, 10 mM DTT before use in in organello competition experiments. The amino -terminal 126 amino acids from atpcpTatC were expressed in E. coli (strain BL21) from

PAGE 116

116 the pET 14b plasmid and purified as inclusion bodies as above. Inclusion bodies were dissolved in 6 M Urea and subject ed to Ni affinity purification according to manufacturers instructions (GE Healthcare), with the modification that all buffers contained 6 M Urea. Affinity purified atcpTatC peptide was used for the production of antibodies in rabbits (Cocalico Biological s). Antibodies to psAlb3 have been described (Mori et al., 2001) I found that the psAlb3 antibodies react with the atAlb4 protein but n ot the atAlb3 protein (Figure 2 11). psAlb3 antibodies were used to dete ct Arabidopsis Alb4 in western blotted nitrocellulose membranes (Figure 2 10). Antibodies to atcpSecY (Schuenemann et al., 1999) atAlb3 (Moore et al., 2000) atActin monoclonal clone C4 (ICN Biochemicals, Irvine, CA), atTIC110 (Bauer et al., 2000) atTOC75 (Hilt brunner et al., 2001) atTIC40 (Chou et al., 2003) psTOC75 (Ma et al., 1996) psTIC110 (Kessler and Blobel, 1996) psTatC (Cline and Mori, 2001) psOE23 (K. Cline, unpublished) and atAlb4 (Gerdes et al., 2006) have been described. Plant growth conditions, preparation of Chloroplasts, Stromal Extract, and Total Cell M embranes Peas ( Pisum sativum L. cv. Laxton's Progress 9 Improved) used for chloroplast isolation were gro wn as described (Cline, 1986) Intact chloroplasts were isolated from 9 to 10-day old pea seedlings and were resuspended in IB at 1 mg/mL of chlorophyll. For preparation of stromal extract, chloroplas ts were lysed hypotonically by resuspension in 10 mM HEPES/KOH, pH 8.0 and incubation on ice for 10 minutes followed by centrifugation at 150,000 x g for 30 minutes at 2 e determined according to Arnon (Arnon, 1949) Arabidopsis seed harboring a knockout mutation in the gene encoding Alb3 wer e obtained from the Arabidopsis Biologica l Resource Center (Stock# CS16) (Rhee et al., 2003) The cpSecY knockout mutant (Ws ecotype) contains a T DNA insertion in the third exon and was previ ously designated scy1 -2 (Skalitzky, 2006) Arabidopsis seeds were sterilized, plated to

PAGE 117

117 media, and grown for 2 or 4 weeks (20 C, 16 hour photoperiod, 100 E/m2/s of light) before total membrane o r intact chloroplast isolation (Smith et al., 2003) Media used to grow alb3 mutant seedlings contained 20 mg/L hygromycin. Seeds for Arabid opsis RNAi and empty vector lines were grown on MS media containing 25 mg/L hygromycin and 10 M -estradiol with a 24-hour photoperiod in 100 E m2 sec1 of light, at 20 C +/ 2 C for six or 14 days. P ale alb3 or secy mutant seedlings were harvested from plates for total membrane isolati on, using a method adapted from (Schaller et al., 1995) Equal masses of tissue from wild type or mutant Arabidopsis seedlings were subjected to probe homogenization (PT1035, Kinematica GmBH) in ice -cold membrane extraction buffer (30 mM Tris pH 8, 20% glycerol, 5 mM EDTA, 5mM EGTA, 1mM PMSF) and filtration through Miracloth (Calbiochem). Filtrate underwent centrifugation at 150,000 x g for 30 minutes, at 2 C. Membrane pellets were resuspended in IB to equivalent concentrations of tissue mass per volume Total proteins were extracted from six -day old estrogen -induced Arabidopsis seedlings by following the EZ extraction procedure (Martinez Garcia et al., 1999) Sterile pestles and microfuge tubes were used to homogenize tissue in volumes of E buffer ( 125 mM Tris HCl pH 8.8, 1% SDS, 10% glycerol, 50 mM Na2S2O5) that were equal to two times the mas s of tissue that was harvested. Homogenates underwent centrifugation at >13,000 x g for 10 minutes, at room temperature. A 1/10th volume of Z buffer ( 125 mM Tris HCl pH 6.8, 12% SDS, 10% glycerol, 22% -mercaptoethanol 0.001% bromophenol blue ) was adde d to each sample. For membrane isolation, sterile pestles and microfuge tubes were used to homogenize tissue in volumes of buffer [30 mM Tris -HCl pH 8, 20% glycerol, 5 mM EDTA, 5 mM EGTA, 26 L/mL Sigma Plant Protease inhibitors (Sigma Aldrich, P9599), 1 g/mL chymostatin, 1 g/mL antipain, 1 g/mL apr otinin, 2 mM PMSF, 2.7 L/mL -mercaptoethanol] equal to ten times the

PAGE 118

118 mass of tissue that was harvested. Homogenates were filtered through equal -sized pieces of buffer -wetted Miracloth then spun at 150,000 x g for 30 minutes, at 2 C. Membrane pellets were resuspended to volumes equal to the mass of tissues harvested using IB that contained the above protease inhibitors. Supernatants were TCA precipitated and resuspended using IB containing the above inhibitors to volumes equal to those of the membrane fractions. Chloroplast Import and Thylakoid Protein Integration A ssays Radiolabeled precursor proteins were incubated with isolated chloroplasts (0.33 mg/mL chlorophyll), 5 mM MgATP, and IB, in 120 E of ligh t in a 25 C water bath for times specified in figure legends. After import, samples were treated with 100 g/mL thermolysin on ice for 30 minutes. Proteolysis was stopped by addition of 0.5 M EDTA to a final concentration of 10 mM, and chloroplasts were re isolated by centrifugation through 35% Percoll, 5 mM EDTA, in IB. Intact chloroplasts were washed, resuspended to equal concentrations of chlorophyll, then analyzed using SDS -PAGE. Alternatively, chloroplasts were lysed hypotonically by resuspension i n 10 mM HEPES/KOH, pH 8.0 and incubation on ice for 10 minutes. Lysed chloroplasts were analyzed using SDS -PAGE and/or fractionated into membranes and stroma by differential centrifugation (12,000 x g 10 minutes, 4 C). Membranes were resuspended in IB a nd analyzed using SDS -PAGE, and/or combined with 100 g/mL thermolysin on ice for 30 minutes. Proteolysis was stopped by addition of 10 mM EDTA before analysis by SDS -PAGE and fluorography. Chloroplast fractionations that involved separation into envelope membranes, stroma, and thylakoids were conducted as follows. Chloroplasts were spun at 1500 x g for 3 minutes, at 2 C. Chloroplasts were lysed by resuspension to 0.5 mg chlorophyll/mL in 10 mM HEPES -KOH pH 8.0 (10HK) and incubating them on ice for 10 mi nutes. A sample of lysate was taken aside

PAGE 119

119 for analysis. Remaining chloroplast lysate was next spun at 3850 x g for 25 seconds, in a swing bucket microfuge, at 2 C. The clear supernatant (Super1) was transferred to a separate tube. The remaining partial ly pelleted chloroplasts were washed in excess (1mL) 10HK then spun at 3300 x g for 8 minutes, in a swing bucket centrifuge, at 2 C. The supernatant (Super2) was transferred to a separate tube. Both supernatants were spun at 150,000 x g for 30 minutes, at 2 C. Super1, which represented the stroma, was transferred to a fresh tube. Super2 was discarded. The pellets, which represented the envelope membranes, were combined and resuspended in a volume of IB equal to the original lysate volume. Thylakoids were also resuspended in a volume of IB equal to the original lysate volume. Arabidopsis chloroplasts were fractionated by hypotonic lysis and centrifugation at 2600 x g at 2 C, for 25 seconds in a swing bucket microfuge. The thylakoid pellet was washed in 0.5 mL HK and spun at 700 x g at 2 C, for 5 minutes. Supernatants from lysate and thylakoid centrifugation were each spun at 150,000 x g at 2 C, for 30 minutes. Following centifugation, the lysate supernatant was retained as the stroma fraction, wh ile the thylakoid supernatant was discarded. The pellets, representing envelope membranes, were resuspended and combined in a volume of IB equal to that of the stroma sample. Washed thylakoids were also resuspended to stroma volume using IB. For import t ime course assays, reaction samples were rapidly stopped with 3.3 mM HgCl2 and analyzed as described (Reed et al., 1990) Chase time course assays were done similar to (Li and Schnell, 2006) Chloroplasts and MgATP were pre -incubated for 10 minutes, at 25 C, in 120 E of light. SSUtpcpTatC precursor was then added and incubation continued for 5 minutes. Chloroplasts were diluted five -fold in ice -cold IB a nd treated with 200 g/mL thermolysin on ice for 15 minutes to remove surface -bound precursor. Chloroplasts were then

PAGE 120

120 washed, resuspended to the original reaction volume in IB, 5 mM MgATP and incubated in the light at 25 C. At time points, samples of chloroplasts were taken for re isolation by centrifugation through 35% Percoll cushions. Intact chloroplasts were lysed, quantified, adjusted to equal chlorophyll concentrations, and fractionated. Chloroplasts, fractions, and thermolysintreated membranes w ere analyzed by SDS PAGE and fluorography. Radiolabelled proteins were extracted from excised gel bands and quantified by scintillation counting (Cline, 1986) Protease accessibility assay Radiolabeled pcpTatC was imported into chloroplasts for 10 minutes. Aliquots of the import reaction were treated with 200 g/mL trypsin (Sigma, 6300 BAEE units/mg), 100 g/mL thermolysin, or IB for 30 minutes on ice (Li and Sch nell, 2006) Thermolysin and trypsin were inhibited by a 10 minute incubation on ice in the presence of 10 mM EDTA or trypsin inhibitors (1 mM PMSF, 0.05 mg/mL TLCK, 0.1 mg/mL soybean trypsin inhibitor, and 2 g/mL aprotinin). Chloroplasts were re -isola ted, washed, quantified, adjusted to equal chlorophyll concentration, lysed, and fractionated in the presence of all respective protease inhibitors. Stroma and membrane fractions were analyzed using SDS PAGE and fluorography as well as by immunoblotting w ith antibodies to TOC75 or TIC110. In Organello Competition A ssay In organello competition for the cpTat and cpSec pathways was conducted essentially as described (Cline et al., 1993) Briefly, unlabele d inclusion bodies of pOE23 or pOE33 were dissolved in 10 M urea, 10 mM DTT for 1 hr at 37 0C. Chloroplasts, 5 mM MgATP, and 1.5 mM DTT were then incubated with the unlabeled competitors for 7 minutes in light at 25 0C in order to accumulate the stromal i ntermediates iOE23 and iOE33, respectively. Competitors were aliquotted from stocks, such that the final competitor concentration was either 0.5 or 0.75 M, or

PAGE 121

121 no competitor, and the urea concentration was 0.3 M in all assays. Radiolabeled precursors pcpT atC, pOE23, or pOE33 were then added (1/6 volume) and the incubation continued for an additional 15 minutes. Intact chloroplasts were recovered from assays by centrifugation through Percoll cushions. Recovered chloroplasts from the radiolabeled pOE23 and pOE33 assays were analyzed directly. Chloroplasts from cpTatC assays were lysed in 10 mM HEPES/KOH pH 8.0, 10 mM MgCl2 buffer, the membranes recovered by centrifugation at 3,200 x g for 8 minutes and the resulting supernatant centrifuged at 100,000 x g f or 20 minutes to obtain stroma. An aliquot of the membrane fraction at ~1 mg Chl per mL IB was treated with 150 g/mL thermolysin per mL for 40 minutes at 4 0C. Proteolysis was terminated with EDTA (10 mM final concentration), the membranes recovered by centrifugation and washed with IB, containing 14 mM EDTA. Nigericin/ Valinomycin Inhibition A ssay Isolated chloroplasts were treated with IB, or 0.5 M Nigericin and 1.0 M Valinomycin (NigVal) for 10 minutes on ice. Radiolabeled pOE23 and pcpTatC were imp orted into IB or NigVal treated chloroplasts for 20 minutes. Un imported precursor was removed by thermolysin. Chloroplasts were re isolated, washed, lysed, quantified, adjusted to equal chlorophyll concentration, and fractionated. Isolated thylakoids were treated with thermolysin. Chloroplasts from pOE23 import samples and chloroplasts and fractions from cpTatC import reactions were analyzed using SDS -PAGE and fluorography. Gel band extraction and scintillation counting was used to measure the relati ve percentages of stromal and thylakoid membrane associated cpTatC and OE23. Azide Inhibition A ssay Isolated chloroplasts were treated with IB, or 5 mM or 10 mM sodium azide for 10 minutes on ice. Radiolabeled pcpTatC was imported into IB -, or azide -treat ed chloroplasts for 15 minutes. Chloroplasts were re -isolated, washed, and lysed. To fractionate chloroplast lysate,

PAGE 122

122 stroma and envelope membranes were first separated from thylakoid membranes by differential centrifugation (3700 x g, for 30 seconds, at 4 separated by high speed differential centrifugation (150,000 x g, for 30 minutes, at 2 Thylakoid and envelope membranes were resuspended in a volume of IB equal to that of the isolated stroma. Isolated thylakoids were treated with thermolysin. Chloroplasts from pOE33 and pOE23 import samples and chloroplasts and fractions from cpTatC import reactions were analyzed using SDS -PAGE and fluorography. Gel band extraction and scintillation counting was used t o measure the relative percentages of stromal and thylakoid membrane associated cpTatC. Chloroplast Exposure to Light and Prolonged Incubation Import buffer, 10 mM Sodium Azide, or 0.5 M Nigericin/1.0 M Valinomycin was incubated with chloroplasts for 10 minutes on ice. Chloroplasts incubated with Azide or Nigericin/Valinomycin were directly used for in vitro import reactions. 50 g aliquots of mock treated chloroplasts were incubated on ice for 0.5, 1.0, 1.5, 2.0, or 2.5 hours before being used in in vitro import assays. Other 50 g aliquots of mock treated chloroplasts were exposed to 17 W/cm2 of 561 nm light for 5, 15, or 30 minutes. A Shimadzu RF5301 PC spectrofluorometer produced the light, which was reflected off a front -side mirror into samples o f chloroplasts that had been aliquoted into wells of a 96 well plate. After light treatment, 200 L of IB was added to each well. Chloroplasts were transferred to microcentrifuge tubes, spun at 2200 x g at 2 C, for 5 minutes, resuspended to 50 uL using IB, and used in in vitro import assays. Transforming Agrobacterium and Arabidopsis pMDC7 plasmids containing no insert or hairpin fragments to target transcripts were each used to transform Agrobacterium GV3101 according to (Orlic) Antibiotic resistant bacteria

PAGE 123

123 were next used to transform Arabidopsis ecotype Columbia by the floral dip method according to (Bechtold and Pelletier) Arabidopsis Genomic DNA Isolation and PCR Screening 3 cm2 of leaf tissue was ground in 300 L DNA extraction buffer (1% CTAB, 50 mM Tris HCl pH 8.0, 0.7M NaCl, 10 mM EDTA, 0.1% -mercaptoethanol) and incubated for an hour at 60 C. Samples were given equal volume of chloroform, vigorously agitated, then sedimented at >10,000 x g for five minutes, at room temperature. The supernatant was removed and combined wi th 600 L of ethanol then incubated at 20 C for 30 minutes. Five minutes of >10,000 x g centrifugation were followed by supernatant aspiration and pellet resuspension in 20 L of sterile water. Arabidopsis genomic DNA from RNAi lines was PCR screened fo r hairpin constructs using screening primers described below (Table A 2). In PCR reactions, forward screening primers for each gene were paired with the MDC7 reverse primer, and reverse screening primers were each paired with the MDC7 forward primer. RNA Isolation and Quantitative RT PCR The RNeasy Plant Mini Kit (Qiagen, Valencia, CA) was used to isolate mRNA from estrogen induced Arabidopsis seedlings that contained an empty estrogeninducible vector or estrogen inducible hairpin constructs to ALB4, CPSE CY, or CPSECY2. cDNA was synthesized from isolated mRNA by using 10 M oligo -dT primers and the Omniscript Reverse Transcriptase kit (Qiagen) according to manufacturers instructions. A Step One Plus Real Time PCR System (Applied Biosystems, Foster City, CA) was used to measure the abundance of specific transcripts in samples of cDNA. Reactions contained 1/50 diluted cDNA, Sybr Green Power Mix (Applied Biosystems), and primers to TOC75, TIC110, TIC40, CPSECY, CPSECY2, ALB4, or CPTATC (Table A 3). The abu ndance of transcripts in Alb4 cpSecY

PAGE 124

124 and cpSecY RNAi seedlings was calculated using the comparative CT method, taking into consideration the amplification efficiencies of each primer set (Pfaffl, 2 001) Imaging and Electron Microscopy Arabidopsis seedlings were observed growing on estrogen containing MS media at time points noted in figure legends using a Leica MZ 12.5 stereoscope (Leica Microsystems Inc., Bannockburn, IL). Images were captured by a SPOT RT Slider CCD camera and Spot Basic imaging software (Diagnostic Instruments, Sterling Heights, MI). Membrane structures in Arabidopsis cotyledon cell plastids were observed and imaged by performing the following. Leaf samples were fixed in 4% par aformadehyde, 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.24. Fixed tissues were processed with the aid of a Pelco BioWave laboratory microwave (Ted Pella, Redding, CA, USA). The samples were washed in 0.1 M sodium cacodylate pH 7.24, pos t fixed with 2% OsO4, water washed and dehydrated in a graded ethanol series 25%, 50%, 75%, 95%, 100% followed by 100% acetone. Dehydrated samples were infiltrated in graded acetone/Spurrs epoxy resin 30%, 50%, 70%, 100% and cured at 60 C. Cured resin bloc ks were trimmed, thin sectioned and collected on formvar copper slot grids, post -stained with 2% aqueous Uranyl acetate and Reynolds lead citrate. Sections were examined with a Hitachi H 7000 TEM (Hitachi High Technologies America, Inc. Schaumburg, IL) a nd digital images acquired with a Veleta 2k x 2k camera and iTEM software (Olympus Soft Imaging Solutions Corp, Lakewood, CO). Dye Binding to a 2TC Tagged Target Protein in Situ in Isolated Chloroplasts Inclusion bodies of pOE23 and pOE23 2TC were each sol ubilized by incubation in 8 M Urea, at 37 C, for one hour. 3 M of each precursor was incubated with isolated pea chloroplasts in an in vitro import assay for times specified in figure legends. Following import,

PAGE 125

125 chloroplasts underwent quantification, cen trifugation, and resuspension to 1 mg chlorophyll per mL in IB. Three equal volumes of chloroplasts were split into new microfuge tubes. Samples of chloroplasts were incubated with 0, 0.75, or 1.5 L Lumio Green dye (Invitrogen, Carlsbad, CA) for 60 minu tes, at 25 C, in the dark. Following another round of centrifugation, chloroplasts were resuspended in 1 M ethanedithiol IB and incubated on ice for 30 minutes. Chloroplasts were hypotonically lysed and fractionated. A 5 L aliquot of stroma from the 0 L dye treatment was spiked with 0.35 L of Lumio Green dye. Samples of all stroma fractions were incubated in non reducing sample buffer before analysis by SDS PAGE. Gels were visualized by a Molecular Imager FX, set to 532 nm excitation, and Quantity One software (Biorad, Hercules, CA). Immunoprecipitation Stroma from Lumio dye treated chloroplasts was combined with an equal volume of 2xTBS (1xTBS: 50 mM Tris HCl pH 7.4, 150 mM NaCl), brought to 100 L using water, combined with 100 L 2% SDS, 1 mM EDT A, TBS, and incubated at 37 C for 5 minutes. Samples were spun at 19,000 x g for 5 minutes and supernatants were transferred to low retention tubes containing 0.5 mL IP (1% Triton X 100, 0.5% DOC, 1 mM EDTA, TBS) and 40 L of a 40% slurry of anti OE23 lin ked protein A Sepharose beads. Antibodies were covalently linked to Sepharose beads according to manufacturers instructions (Amersham Biosciences, Pittsburg PA). Solutions were mixed end over -end at 4 C for 1.5 hours then spun at 200 x g for one minute, at 2 C in a swing bucket microfuge. Samples were washed three times by resuspension in IP, centrifugation, and removal of the supernatant after each centrifugation step. Beads were washed with 1 mL of 0.05% Triton X 100, TBS, then resuspended in 100 L TBS and transferred to Wizard Mini columns (Promega, Madison, WI) in two successive rounds.

PAGE 126

126 Columns were spun at 200 x g at 2 C, for one minute then transferred to new microfuge tubes. Columns received 25 L of 8M Urea, 5% SDS, 125 mM Tris HCl pH 6.8 an d 1.5 hours of incubation at room temperature. Columns were spun again. Aliquots of liquid flow through were combined with equal volumes of nonreducing sample buffer. Samples were incubated at room temperature for one hour, then analyzed by SDS PAGE. Fluorescently labeled protein was visualized by a Molecular Imager FX and Quantity One software (Biorad, Hercules, CA), as above. In Vitro CALI Radiolabeled precursors to cpTatC and cpTatC 2TC were translated in vitro Replicate samples of each translatio n product were incubated with 100 nM Lumio Red dye (Invitrogen, Carlsbad, CA) or 3 M EDT2 for 15 minutes at room temperature. All samples were aliquoted into low retention tubes. For each translation product, one pair of dye or buffer treated samples wa s exposed to the dark for 15 minutes. All other samples were exposed to 17 W/cm2 of 560 nm light for 15 minutes. After light or dark treatment, precursors were each imported into isolated pea chloroplasts. Electrophoresis cpTatC -containing samples destined for SDS PAGE were incubated in sample buffer (0.1M Tris -HCl pH6.8, 8M urea, 5% SDS, 20% glycerol, 10% -mercaptoethanol) for one hour at room temperature before electrophoresis, to prevent cpTatC aggregation. Samples destined for Blue Native PAGE were prepared as described (Gerard and Cline, 2007) except that 2% digitonin was included in solubilization buffers used to prepare Arabidopsis membranes. Gels were processed for fluorography or a nalyzed by immunoblotting (Cline, 1986; Cline and Mori, 2001) Immunolabeled proteins were visualized by using the ECL method (Amersham

PAGE 127

127 Biosciences Pitt sburg, PA ). Radiolabeled proteins were extracted from dried gel slices and quantified by scintillation counting (Cline, 1986) The number of molecules of mcpTatC, iOE23, or mOE23 were calculated from t he dpm of an extracted band, the specific activity of the leucine used in the translations, the number of leucine residues per molecule, and the efficiency of radiolabeled leucine incorporation during precursor synthesis in vitro Leucine residues for eac h molecule were derived from amino acid sequence data. Gel band extraction and quantitative immunoblotting were each used to quantify precursors from in vitro translation reactions (Fincher et al., 2003) Leucine incorporation efficiency was determined by comparing the amount of radiolabeled precursor to the amount of total precursor produced from an in vitro synthesis reaction. Chloroplasts per import assay sample were calculated from the chlorophyll concentration and the number of chloroplasts per microgram of chlorophyll, which was typically about 1 x 106.

PAGE 128

1 28 Table A 1. Primers that were used to amplify Arabidopsis gene fragments for hairpin RNA construction. The Gateway recombination site and corresponding sequence are underlined for all relevant primers. Primer Sequence (5 3) Outside cpSecY forward GCATGATTGATGATGGTTGC cpSecY SOE reverse GCAACTTTGGATAGACTTGAGC cpSecY SOE forward GCTCAAGTCTATCCAAAGTTGC Outside cpSecY reverse GCGAGG CATAATTGAGCGG B1 cpSecY forward GGGGACAAGTTTGTACAAAA AAGCAGGCT CTTCAGCTGC TATTGAGGACAGTTCC B5r cpSecY reverse GGGGACAACTTTTGTATACA AAGTTG CCTGAAAAACTTT GCTTGTTAGACTATATAAGCATACC B5 cpSecY forward GGGGACAACTTTGTATACAA AAGTTG CTGAACATATACT ATCCCGAGTACCAAGAGG B 2 cpSecY reverse GGGGACCACTTTGTACAAGA AAGCTGGGT CTTCAGCTGC TATTGAGGACAGTTCC B1 cpSecY2 forward GGGGACAAGTTTGTACAAAA AAGCAGGCT GTGTTTTGAC CTTGATAATGTTTTTGCAGGAGACCC B5r cpSecY2 reverse GGGGACAACTTTTGTATACA AAGTTG CTCACCCAGTTCC TCTATCAAAAACATAAAATGTTAACTACAAATAC B5 cpSecY2 forward GGGGACAACTTTGTATACAA AAGTTG ATGAGAACACTC ACCAACAGAACCCGAGACAAAGC cpSecY2 SOE reverse GTAGTGTGTTGGAGACAGC cpSecY2 SOE forward GCTGTCTCCAACACACTAC B2 cpSecY2 reverse GGGGACCACTTTGTACAAGA AAGCTGGGT GTGTTTTGA CCTTGATAATGTTTTTGCAGGAGACCC B1 Alb4 reverse GGGGACAAGTTTGTACAAAA AAGCAGGCT GACTAAACTAT TATCGTATTAGTGTAACACCAGTGAACGAGGAC Alb4 SOE forward GGACGAGACTACGAATG Alb4 SOE reverse CATTCGTAGTCTCGTCC

PAGE 129

129 Table A 1. Continued Primer Sequence (5 3) B5r Alb4 forward GGGGACAACTTTTGTATACA AAG TTG GTAACCAAATCTT CTAAAATGTGTCATCATTCGTTCCTAGAAGCTG B5 Alb4 forward GGGGACAACTTTGTATACAA AAGTTG GCTGCTGAAAGA GCAAGAAGCAAAGAGACGTCGAG B2 Alb4 reverse GGGGACCACTTTGTACAAGA AAGCTGGGT GACTAAACTAT TATCGTATTAGTGTAACACCAGTGAACGAGGAC

PAGE 130

130 Table A 2. Primers that were u sed to screen transformed Arabidopsis plants for hairpin constructs to cpSecY2, cpSecY, and Alb4. Primer Sequence (5 3) MDC7 forward CGCTGAAGCTAGTCGACTCTAGC MDC7 reverse CGAAAGCTGGGAGGCCTGGATCG Alb4 hairpin screen forward GTGTCATCATTCGTTCCTAGAAGC A lb4 hairpin screen reverse GCTTCTAGGAACGAATGATGACAC cpSecY hairpin screen forward GGTATGCTTATATAGTCTAACAAGC cpSecY hairpin screen reverse GCTTGTTAGACTATATAAGCATACC cpSecY2 hairpin screen forward GATAGAGGAACTGGGTGAG cpSecY2 hairpin screen reverse CTCACC CAGTTCCTCTATC

PAGE 131

131 Table A 3. Primers used to quantify transcripts to in Arabidopsis cDNA isolated from estrogeninduced empty vector and RNAi lines. Primer Sequence (5 3) Ubiquitin10 qRT PCR forward GGCCTTGTATAATCCCTGATGAATAAG Ubiquitin10 qRT PCR reve rse AAAGAGATAACAGGAACGGAAACATAGT cpSecY2 qRT PCR forward GCTGGAATGCAACCTGTTCTC cpSecY2 qRT PCR reverse AGGTGAACCCAGAATACTTGCAA Alb4 qRT PCR forward TCCTCTTTCTCCACAGGCAAA Alb4 qRT PCR reverse CGGTGTGTGGCTGAAACG cpTatC qRT PCR forward CAACGCCGGAGCAAAGG cpTatC qRT PCR reverse TGGTGAATCGTCGTCATTGAG TIC40 qRT PCR forward AAGAGGTAATGGATGTGTTCAACAAG TIC40 qRT PCR reverse GCTTTTTCAACCCGTCATTCC TIC110 qRT PCR forward CATTTCTTCTGGAGTGGATGGTT TIC110 qRT PCR reverse AGACATGGCAGTCTCTCTGGATAA TOC75 III qRT PCR forward ACCTCTAGCCGTAGCCTCAGTCT TOC75 III qRT PCR reverse CAGAACCGACGGAAGATTCG cpSecY qRT PCR forward CGGACGACGTGAGTGAACAA cpSecY qRT PCR reverse CAGGTCGGACTAGAGGGATTGA

PAGE 132

132 LIST OF REFERENCES Anderson, S. and Smith, S.M. (1986) Synthesis of the small subunit of ribulose -bisphosphate carboxylase from genes cloned into plasmids containing the SP6 promoter. Biochem. J. 240, 709 715. Andersson, H. and Heijne, G.v. (1993) Sec dependent and sec independent assembly of E. coli inner membrane proteins: the topological rules depend on chain length. EMBO J 12, 683 691. Andersson, M.X., Kjellberg, J.M. and Sandelius, A.S. (2001) Chloroplast biogenesis. Regulation of lipid transport to the thylakoid in chloroplasts isolated from expanding and fully expanded leaves of pea. Plant Physiol 127, 184 193. Andersson, M.X. and Sandelius, A.S. (2004) A chloroplast -localized vesicular transport system: a bio informatics approach. BMC Genomics 5 40. Arnon, D.I. (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta Vulgaris Plant Physiology 24, 1 15. Asakura, Y., Hirohashi, T., Kikuchi, S., Belcher, S., Osborne, E., Yano, S., Terashima, I., Barkan, A. and Nakai, M. (2004) Maize mutants lacking chloroplast FtsY exhibit pleiotropic defects in the biogenesis of thylakoid membranes. Plant Cell 16, 201 214. Asakura, Y., Kikuchi, S. and Nakai, M. (2008) Non-identical contributions of two membrane bound cpSRP components, cpFtsY and Alb3, to thylakoid biogenesis. Plant J 56, 1007 1017. Aseeva, E., Ossenbuhl, F., Sippel, C. et al. (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid protein complexes. Plant Physiol Biochem 45, 119 128. Bauer, J., Chen, K., Hiltbunner, A., Wehrli, E., Eugster, M., Schnell, D. and Kessler, F. (2000) The major protein import receptor of plastids is essential for chloroplast biogenesis. Nature 403, 203 207. Benning, C. (2008) A role for lipid trafficking in chloroplast biogenesis. Prog Lipid Res 47, 381 389. Benning, C., Xu, C. and A wai, K. (2006) Non-vesicular and vesicular lipid trafficking involving plastids. Current Opinion in Plant Biology 9 241 247. Bensing, B.A., Gibson, B.W. and Sullam, P.M. (2004) The Streptococcus gordonii platelet binding protein GspB undergoes glycosylati on independently of export. J Bacteriol 186, 638 645.

PAGE 133

133 Bensing, B.A. and Sullam, P.M. (2002) An accessory sec locus of Streptococcus gordonii is required for export of the surface protein GspB and for normal levels of binding to human platelets. Mol Microbi ol 44, 1081 1094. Berghofer, J., Karnauchov, I., Herrmann, R.G. and Klosgen, R.B. (1995) Isolation and characterization of a cDNA encoding the SecA protein from spinach chloroplasts. Evidence for azide resistance of Sec -dependent protein translocation acro ss thylakoid membranes in spinach. J Biol Chem 270, 18341 18346. Bleys, A., Vermeersch, L., Van Houdt, H. and Depicker, A. (2006) The frequency and efficiency of endogene suppression by transitive silencing signals is influenced by the length of sequence homology. Plant Physiol 142, 788 796. Block, M.A., Dorne, A.J., Joyard, J. and Douce, R. (1983) Preparation and characterization of membrane fractions enriched in outer and inner envelope membranes from spinach chloroplasts. I. Electrophoretic and immunoche mical analyses. J Biol Chem 258, 13273 13280. Blomqvist, L.A., Ryberg, M. and Sundqvist, C. (2008) Proteomic analysis of highly purified prolamellar bodies reveals their significance in chloroplast development. Photosynth Res 96, 37 50. Bloois, E.v., Haan, G.J., Gier, J.W.d., Oudega, B. and Luirink, J. (2004) F1F0 ATP synthase subunit c is targeted by the SRP to YidC in the E. coli inner membrane. FEBS Letters 576, 97 100. Gunning, B.E.S. (2003) Plant Cell Biology on DVD. Brink, S., Fischer, K., Klosgen, R -B. and Flugge, U. -I. (1995) Sorting of Nuclear encoded Chloroplast Membrane Proteins to the Envelope and the Thylakoid Membrane. J Biol Chem 270, 20808 20815. Bruce, B.D. (2001) The paradox of plastid transit peptides: conservation of function despite di vergence in primary structure. Biochemica et Biophysica Acta Molecular Cell Research 1541, 2 21. Buchanan, B., Gruissem, W. and Jones, R. (2000). Biochemistry and Molecular Biology of Plants. Rockville, MD: American Society of Plant Biologists. Buchanan, G., Leeuw, E.d., Stanley, N.R., Wexler, M., Berks, B.C., Sargent, F. and Palmer, T. (2002) Functional complexity of the twinarginine translocase TatC component revealed by site -directed mutagenesis. Molecular Microbiology 43, 1457 1470. Cabantous, S., Te rwilliger, T.C. and Waldo, G.S. (2005) Protein tagging and detection with engineered self assembling fragments of green fluorescent protein. Nat Biotechnol 23 102 107.

PAGE 134

134 Carde, J. -P., Joyard, J. and Douce, R. (1982) Electron Microscopic Studies of Envelope Membranes from Spinach Plastids. Biology of the Cell 44, 315 324. Carrie, C., Giraud, E. and Whelan, J. (2009) Protein transport in organelles: Dual targeting of proteins to mitochondria and chloroplasts. FEBS J 276, 1187 1195. Cavalier -Smith, T. (2000) Me mbrane heredity and early chloroplast evolution. Trends in Plant Science 5 174 182. Chalker -Scott, L. (1999) Environmental Significance of Anthocyanins in Plant Stress Responses. Phytochemistry and Photobiology 70, 1 9. Chiu, C.C. and Li, H.M. (2008) Tic40 is important for reinsertion of proteins from the chloroplast stroma into the inner membrane. Plant J 56, 793 801. Chou, M.L., Fitzpatrick, L.M., Tu, S.L., Budziszewski, G., Potter -Lewis, S., Akita, M., Levin, J.Z., Keegstra, K. and Li, H.M. (2003) Tic40, a membraneanchored co chaperone homolog in the chloroplast protein translocon. EMBO J 22, 2970 2980. Chua, N.H. and Schmidt, G.W. (1978) Post translational transport into intact chloroplasts of a precursor to the small subunit of ribulose 1,5 bisphospha te carboxylase. Proc Natl Acad Sci U S A 75, 6110 6114. Cline, K. (1986) Import of proteins into chloroplasts. Membrane integration of a thylakoid precursor protein reconstituted in chloroplast lysates. J Biol Chem 261, 14804 14810. Cline, K. and Dabney -Sm ith, C. (2008) Plastid protein import and sorting: different paths to the same compartments. Curr Opin Plant Biol 11, 585 592. Cline, K., Fulsom, D.R. and Viitanen, P.V. (1989) An imported thylakoid protein accumulates in the stroma when insertion into thy lakoids is inhibited. J Biol Chem 264, 14225 14232. Cline, K. and Henry, R. (1996) Import and routing of nucleus encoded chloroplast proteins. Annu Rev Cell Dev Biol 12, 1 26. Cline, K., Henry, R., Li, C. and Yuan, J. (1993) Multiple pathways for protein t ransport into or across the thylakoid membrane. EMBO J 12, 4105 4114. Cline, K. and Mori, H. (2001) Thylakoid DeltapH -dependent precursor proteins bind to a cpTatC Hcf106 complex before Tha4 dependent transport. J Cell Biol 154, 719 729. Cline, K., Henry, R., Li, C. -J. and Yuan, J. (1992) Pathways and Intermediates for the Biogenesis of Nuclear Encoded Thylakoid Proteins. Research in Photosynthesis III, 149 156. Cline, K. and Theg, S.M. (2007) The Sec and Tat Protein Translocation Pathways in Chloroplasts. In The Enzymes (Dalbey, R., Koehler, C. and Tamanoi, F., eds). Elsevier, pp. 1 25.

PAGE 135

135 Cran, D.G. and Possingham, J.V. (1972) Two forms of division profile in spinach chloroplasts. Nature New Biology 235, 142. Curtis, M.D. and Grossniklaus, U. (2003) A gateway cloning vector set for highthroughput functional analysis of genes in planta. Plant Physiol 133, 462 469. Dalbey, R.E. and Chen, M. (2004) Sec translocase mediated membrane protein biogenesis. Biochim Biophys Acta 1694, 37 53. Dalbey, R.E. and Kuhn, A. (2000) Evolutionarily Related Insertion Pathways of Bacterial, Mitochondrial, and Thylakoid Membrane Proteins. Annual Review of Cell and Developmental Biology 16, 51 87. Davies, K. and K, S. (2003) Transcriptional regulation of secondary metabolism. Functio nal Plant Biology 30, 913 925. Dong, Y., Palmer, S.R., Hasona, A., Nagamori, S., Kaback, H.R., Dalbey, R.E. and Brady, L.J. (2008) Functional overlap but lack of complete cross -complementation of Streptococcus mutans and Escherichia coli YidC orthologs. J Bacteriol 190, 2458 2469. Dyall, S.D., Brown, M.T. and Johnson, P.J. (2004) Ancient invasions: from endosymbionts to organelles. Science 304, 253 257. Eggink, L.L., LoBrutto, R., Brune, D.C., Brusslan, J., Yamasato, A., Tanaka, A. and Hoober, J.K. (2004) S ynthesis of chlorophyll b: localization of chlorophyllide a oxygenase and discovery of a stable radical in the catalytic subunit. BMC Plant Biol 4 5. Emanuelsson, O., Nielsen, H., Brunak, S. and von Heijne, G. (2000) Predicting subcellular localization of proteins based on their N terminal amino acid sequence. J Mol Biol 300, 1005 1016. English, A.R., Zurek, N. and Voeltz, G.K. (2009) Peripheral ER structure and function. Curr Opin Cell Biol 21, 596 602. Fandl, J.P., Cabelli, R., Oliver, D. and Tai, P.C. (1988) SecA suppresses the temperature sensitive SecY24 defect in protein translocation in Escherichia coli membrane vesicles. PNAS 85, 8953 8957. Fincher, V., Dabney Smith, C. and Cline, K. (2003) Functional assembly of thylakoid deltapH dependent/Tat prot ein transport pathway components in vitro. Eur J Biochem 270, 4930 4941. Flugge, U.I. and Heldt, H.W. (1979) Phosphate translocator in chloroplasts: Identification of the funcational protein and characterization of its binding site. In Function and Molecul ar Aspects of Biomembrane Transport (al., I.Q.e., ed). Amsterdam: Elsevier, pp. 373. Fortin, Y., Phoenix, P. and Drapeau, G.R. (1990) Mutations conferring resistance to azide in Escherichia coli occur primarily in the secA gene. J Bacteriol 172, 6607 6610.

PAGE 136

136 Fuhrmann, E., Gathmann, S., Rupprecht, E., Golecki, J. and Schneider, D. (2009) Thylakoid membrane reduction affects the photosystem stoichiometry in the cyanobacterium Synechocystis sp. PCC 6803. Plant Physiol 149, 735 744. Fulgosi, H., Gerdes, L., Westp hal, S., Glockmann, C. and Soll, J. (2002) Cell and chloroplast division requires ARTEMIS. Proc Natl Acad Sci U S A 99, 11501 11506. Funes, S., Hasona, A., Bauerschmitt, H., Grubbauer, C., Kauff, F., Collins, R., Crowley, P.J., Palmer, S.R., Brady, L.J. an d Herrmann, J.M. (2009) Independent gene duplications of the YidC/Oxa/Alb3 family enabled a specialized cotranslational function. Proc Natl Acad Sci U S A 106, 6656 6661. Funes, S., Nargang, F.E., Neupert, W. and Herrmann, J.M. (2004) The Oxa2 protein of N eurospora crassa plays a critical role in the biogenesis of cytochrome oxidase and defines a ubiquitous subbranch of the Oxa1/YidC/Alb3 protein family. Mol Biol Cell 15, 1853 1861. Gao, H. and Xu, X. (2009) Depletion of Vipp1 in Synechocystis sp. PCC 6803 affects photosynthetic activity before the loss of thylakoid membranes. FEMS Microbiol Lett 292, 63 70. Garab, G. and Mannella, C.A. (2008) Reply: On Three Dimensional Models of Higher -Plant Thylakoid Networks: Elements of Consensus, Controversies, and Fut ure Experiments. The Plant Cell Online 20, 2549. Gerard, F. and Cline, K. (2007) The thylakoid proton gradient promotes an advanced stage of signal peptide binding deep within the Tat pathway receptor complex. J Biol Chem 282, 5263 5272. Gerdes, L., Bals, T., Klostermann, E., Karl, M., Philippar, K., Hnken, M., Soll, J. and Schnemann, D. (2006) A Second Thylakoid Membrane associated Alb3/OxaI/YidC Homologue Is Involved in Proper Chloroplast Biogenesis in Arabidopsis thaliana. J Biol Chem 281, 16632 16642. Gillingham, A.K. and Munro, S. (2007) The small G proteins of the Arf family and their regulators. Annu Rev Cell Dev Biol 23, 579 611. Gohre, V., Ossenbuhl, F., Crevecoeur, M., Eichacker, L.A. and Rochaix, J.D. (2006) One of two alb3 proteins is essential for the assembly of the photosystems and for cell survival in Chlamydomonas. Plant Cell 18, 1454 1466. Hasona, A., Crowley, P.J., Levesque, C.M., Mair, R.W., Cvitkovitch, D.G., Bleiweis, A.S. and Brady, L.J. (2005) Streptococcal viability and diminished s tress tolerance in mutants lacking the signal recognition particle pathway or YidC2. Proc Natl Acad Sci U S A 102, 17466 17471. Haucke, V. (2003) Vesicle budding: a coat for the COPs. Trends Cell Biol 13 59 60.

PAGE 137

137 Hiltbrunner, A., Bauer, J., Vidi, P.A., Infa nger, S., Weibel, P., Hohwy, M. and Kessler, F. (2001) Targeting of an abundant cytosolic form of the protein import receptor at Toc159 to the outer chloroplast membrane. J Cell Biol 154, 309 316. Hirano, H., Harashima, H., Shinmyo, A. and Sekine, M. (2008) Arabidopsis RETINOBLASTOMA -RELATED PROTEIN 1 is involved in G1 phase cell cycle arrest caused by sucrose starvation. Plant Mol Biol 66, 259 275. Hofmann, K. and Stoffel, W. (1993) TMbase A database of membrane spanning proteins segments. Biol. Chem. Ho ppe -Seyler 374, 166. Hoober, J.K., Bednarik, D., Keller, B.J. and Marks, D.B. (1982) Regulatory aspects of thylakoid membrane formation in Chlamydomonas reinhardtii y 1. Prog Clin Biol Res 102 Pt B 127 137. Hoober, J.K., Boyd, C.O. and Paavola, L.G. (1991) Origin of Thylakoid Membranes in Chlamydomonas reinhardtii y1 at 38 degrees C. Plant Physiol 96, 1321 1328. Hoober, J.K. and Stegeman, W.J. (1976) Kinetics and regulation of synthesis of the major polypeptides of thylakoid membranes in Chlamydomonas rei nhardtii y 1 at elevated temperatures. J Cell Biol 70, 326 337. Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K. and Pease, L.R. (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61 68. Hru z, T., Laule, O., Szabo, G., F, W., S, B., L, O., P, W., W, G. and P, Z. (2008) Genevestigator V3: a reference expression database for the meta analysis of transcriptomes. Advances in Bioinformatics 420747. Hutin, C., Havaux, M., Carde, J.P., Kloppstech, K ., Meiherhoff, K., Hoffman, N. and Nussaume, L. (2002) Double mutation cpSRP43--/cpSRP54 -is necessary to abolish the cpSRP pathway required for thylakoid targeting of the light -harvesting chlorophyll proteins. Plant J 29, 531 543. Inaba, T., Alvarez -Huer ta, M., Li, M., Bauer, J., Ewers, C., Kessler, F. and Schnell, D.J. (2005) Arabidopsis tic110 is essential for the assembly and function of the protein import machinery of plastids. Plant Cell 17, 1482 1496. Inaba, T. and Schnell, D.J. (2008) Protein traff icking to plastids: one theme, many variations. Biochem J 413, 15 28. Inoue, K., Baldwin, A.J., Shipman, R.L., Matsui, K., Theg, S.M. and Ohme -Takagi, M. (2005) Complete maturation of the plastid protein translocation channel requires a type I signal pepti dase. J Cell Biol 171, 425 430.

PAGE 138

138 Inoue, K. and Keegstra, K. (2003) A polyglycine stretch is necessary for proper targeting of the protein translocation channel precursor to the outer envelope membrane of chloroplasts. The Plant Journal 34, 661 669. Orlic, I .J.D. Introduction of plasmid into Agrobacterium (Method II). Jackson, D.T., Froehlich, J.E. and Keegstra, K. (1998) The Hydrophilic Domain of Tic110, an Inner Envelope Membrane Component of the Chloroplastic Protein Translocation Apparatus, Faces the Stro mal Compartment. Journal of Biological Chemistry 273, 16583 16588. Karamanou, S., Bariami, V., Papanikou, E., Kalodimos, C.G. and Economou, A. (2008) Assembly of the translocase motor onto the preprotein-conducting channel. Mol Microbiol 70, 311 322. Kessl er, F. and Blobel, G. (1996) Interaction of the protein import and folding machineries of the chloroplast. Proc Natl Acad Sci U S A 93, 7684 7689. Kieselbach, T. and Schroder, W.P. (2003) The proteome of the chloroplast lumen of higher plants. Photosynth R es 78, 249 264. Kim, S.J., Jansson, S., Hoffman, N.E., Robinson, C. and Mant, A. (1999) Distinct "assisted" and "spontaneous" mechanisms for the insertion of polytopic chlorophyll -binding proteins into the thylakoid membrane. J Biol Chem 274, 4715 4721. Ki m, S.J., Robinson, C. and Mant, A. (1998) Sec/SRP independent insertion of two thylakoid membrane proteins bearing cleavable signal peptides. FEBS Lett 424, 105 108. Kim, S.J., Robinson, D. and Robinson, C. (1996) An Arabidopsis thaliana cDNA encoding PS II-X, a 4.1 kDa component of photosystem II: a bipartite presequence mediates SecA/delta pH independent targeting into thylakoids. FEBS Lett 390, 175 178. S, K. (2006) Transport of Flavonoids. In The Science of Flavonoids (Grotewold, E., ed). New York: Spri nger, pp. 123146. Knight, J.S. and Gray, J.C. (1995) The N Terminal Hydrophobic Region of the Mature Phosphate Translocator Is Sufficient for Targeting to the Chloroplast Inner Envelope Membrane. The Plant Cell 7 1421 1432. Kobayashi, K., Kondo, M., Fukuda, H., Nishimura, M. and Ohta, H. (2007) Galactolipid synthesis in chloroplast inner envelope is essential for proper thylakoid biogenesis, photosynthesis, and embryogenesis. PNAS 104, 17216 17221. Koch, H. G., Moser, M., Schimz, K.L. and Mueller, M. (20 02) The Integration of YidC into the Cytoplasmic Membrane of Escherichia coli Requires the Signal Recognition Particle, SecA and SecYEG. Journal of Biological Chemistry 277, 5715 5718.

PAGE 139

139 Kovacheva, S., Bedard, J., Patel, R., Dudley, P., Twell, D., Rios, G., Koncz, C. and Jarvis, P. (2005) In vivo studies on the roles of Tic110, Tic40 and Hsp93 during chloroplast protein import. Plant J 41, 412 428. Kroll, D., Meierhoff, K., Bechtold, N., Kinoshita, M., Westphal, S., Vothknecht, U.C., Soll, J. and Westhoff, P. (2001) VIPP1, a nuclear gene of Arabidopsis thaliana essential for thylakoid membrane formation. Proc Natl Acad Sci U S A 98, 4238 4242. Laidler, V., Chaddock, A.M., Knott, T.G., Walker, D. and Robinson, C. (1995) A SecY homolog in Arabidopsis thaliana. S equence of a full -length cDNA clone and import of the precursor protein into chloroplasts. J Biol Chem 270, 17664 17667. Last, D.I. and Gray, J.C. (1989) Plastocyanin is encoded by a single -copy gene in the pea haploid genome. Plant Mol Biol 12, 655 666. Leech, R.M., Rumsby, M.G. and Thomson, W.W. (1973) Plastid Differentiation, Acyl Lipid, and Fatty Acid Changes in Developing Green Maize Leaves. Plant Physiol 52, 240 245. Li, M. and Schnell, D.J. (2006) Reconstitution of protein targeting to the inner enve lope membrane of chloroplasts. J Cell Biol 175, 249 259. Li, X., Henry, R., Yuan, J., Cline, K. and Hoffman, N.E. (1995) A chloroplast homologue of the signal recognition particle subunit SRP54 is involved in the posttranslational integration of a protein into thylakoid membranes. Proc Natl Acad Sci U S A 92, 3789 3793. Lorkovic, Z.J., Schroder, W.P., Pakrasi, H.B., Irrgang, K.D., Herrmann, R.G. and Oelmuller, R. (1995) Molecular characterization of PsbW, a nuclear -encoded component of the photosystem II re action center complex in spinach. Proc Natl Acad Sci U S A 92, 8930 8934. Lubeck, J., Heins, L. and Soll, J. (1997) A nuclear -coded chloroplastic inner envelope membrane protein uses a soluble sorting intermediate upon import into the organelle. J Cell Bio l 137, 1279 1286. Luirink, J., Samuelsson, T. and de Gier, J.W. (2001) YidC/Oxa1p/Alb3: evolutionarily conserved mediators of membrane protein assembly. FEBS Lett 501, 1 5. Ma, Y., Kouranov, A., LaSala, S.E. and Schnell, D.J. (1996) Two components of the c hloroplast protein import apparatus, IAP86 and IAP75, interact with the transit sequence during the recognition and translocation of precursor proteins at the outer envelope. J Cell Biol 134, 315 327. Maloney, M.A., Hoober, J.K. and Marks, D.B. (1989) Kine tics of Chlorophyll Accumulation and Formation of Chlorophyll Protein Complexes during Greening of Chlamydomonas reinhardtii y 1 at 38 degrees C. Plant Physiol 91, 1100 1106. Mannella, C.A. (2006) Structure and dynamics of the mitochondrial inner membrane cristae. Biochim Biophys Acta 1763, 542 548.

PAGE 140

140 Mant, A., Woolhead, C.A., Moore, M., Henry, R. and Robinson, C. (2001) Insertion of PsaK into the thylakoid membrane in a "Horseshoe" conformation occurs in the absence of signal recognition particle, nucleoside triphosphates, or functional albino3. J Biol Chem 276, 36200 36206. Martin, J.R., Harwood, J.H., McCaffery, M., Fernandez, D.E. and Cline, K. (2009) Localization and integration of thylakoid protein translocase subunit cpTatC. Plant J Martinez Garcia, J.F ., Monte, E. and Quail, P.H. (1999) A simple, rapid and quantitative method for preparing Arabidopsis protein extracts for immunoblot analysis. Plant J 20, 251 257. Masclaux, F., Charpenteau, M., Takahashi, T., Pont -Lezica, R. and Galaud, J.P. (2004) Gene silencing using a heat -inducible RNAi system in Arabidopsis. Biochem Biophys Res Commun 321, 364 369. Mayer, A. (1999) Intracellular membrane fusion: SNAREs only? Curr Opin Cell Biol 11, 447 452. Mayer, A., Wickner, W. and Haas, A. (1996) Sec18p (NSF) -driv en release of Sec17p (alpha SNAP) can precede docking and fusion of yeast vacuoles. Cell 85, 83 94. Michl, D., Robinson, C., Shackleton, J.B., Herrmann, R.G. and Klosgen, R.B. (1994) Targeting of proteins to the thylakoids by bipartite presequences: CFoII is imported by a novel, third pathway. EMBO J 13, 1310 1317. Mistou, M.Y., Dramsi, S., Brega, S., Poyart, C. and Trieu -Cuot, P. (2009) Molecular dissection of the secA2 locus of group B Streptococcus reveals that glycosylation of the Srr1 LPXTG protein is required for full virulence. J Bacteriol 191, 4195 4206. Moore, M., Harrison, M.S., Peterson, E.C. and Henry, R. (2000) Chloroplast Oxa1p homolog albino3 is required for post translational integration of the light harvesting chlorophyll binding protein int o thylakoid membranes. J Biol Chem 275, 1529 1532. Mori, H. and Cline, K. (2001) Post -translational protein translocation into thylakoids by the Sec and DeltapH -dependent pathways. Biochim Biophys Acta 1541, 80 90. Mori, H. and Ito, K. (2001) The Sec prote in translocation pathway. Trends Microbiol 9 494 500. Mori, H., Summer, E.J. and Cline, K. (2001) Chloroplast TatC plays a direct role in thylakoid (Delta)pH -dependent protein transport. FEBS Lett 501, 65 68. Mori, H., Summer, E.J., Ma, X. and Cline, K. (1999) Component specificity for the thylakoidal Sec and Delta pH -dependent protein transport pathways. J Cell Biol 146, 45 56.

PAGE 141

141 Morre, D.J., Minnifield, N. and Paulik, M. (1989) Identification of the 16 degrees C compartment of the endoplasmic reticulum in rat liver and cultured hamster kidney cells. Biol Cell 67, 51 60. Morre, D.J., Sellden, G., Sundqvist, C. and Sandelius, A.S. (1991) Stromal Low Temperature Compartment Derived from the Inner Membrane of the Chloroplast Envelope. Plant Physiol 97, 1558 156 4. Motohashi, R., Nagata, N., Ito, T., Takahashi, S., Hobo, T., Yoshida, S. and Shinozaki, K. (2001) An essential role of a TatC homologue of a Delta pH dependent protein transporter in thylakoid membrane formation during chloroplast development in Arabid opsis thaliana. PNAS 98, 10499 10504. Mustardy, L., Buttle, K., Steinbach, G. and Garab, G. (2008) The three -dimensional network of the thylakoid membranes in plants: quasihelical model of the granum -stroma assembly. Plant Cell 20, 2552 2557. Nakai, M., Go to, A., Nohara, T., Sugita, D. and Endo, T. (1994) Identification of the SecA protein homolog in pea chloroplasts and its possible involvement in thylakoidal protein transport. J Biol Chem 269, 31338 31341. Nakai, M., Sugita, D., Omata, T. and Endo, T. (19 93) Sec -Y protein is localized in both the cytoplasmic and thylakoid membranes in the cyanobacterium Synechococcus PCC7942. Biochem Biophys Res Commun 193, 228 234. Bechtold, N. and Pelletier, G. In -planta Agrobacterium mediated transformation of adult Ara bidopsis thaliana plants by vacuum infiltration and floral dip. EMBO Course: Practical Course on Genetic and Molecular Analysis of Arabidopsis 5 Nilsson, R. and van Wijk, K.J. (2002) Transient interaction of cpSRP54 with elongating nascent chains of the c hloroplast -encoded D1 protein; 'cpSRP54 caught in the act'. FEBS Lett 524, 127 133. Nohara, T., Asai, T., Nakai, M., Sugiura, M. and Endo, T. (1996) Cytochrome f encoded by the chloroplast genome is imported into thylakoids via the SecA -dependent pathway. Biochem Biophys Res Commun 224, 474 478. Pavlov, P.F., Rudhe, C., Bhushan, S. and Glaser, E. (2007) In vitro and in vivo protein import into plant mitochondria. Methods Mol Biol 372, 297 314. Payan, L.A. and Cline, K. (1991) A stromal protein factor mainta ins the solubility and insertion competence of an imported thylakoid membrane protein. J Cell Biol 112, 603 613. Peltier, J.B., Emanuelsson, O., Kalume, D.E. et al. (2002) Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis de termined by experimentation and genome -wide prediction. Plant Cell 14, 211 236.

PAGE 142

142 Pfaffl, M.W. (2001) A new mathematical model for relative quantification in real time RT -PCR. Nucleic Acids Res 29, e45. Preuss, M., Ott, M., Funes, S., Luirink, J. and Herrmann, J.M. (2005) Evolution of mitochondrial oxa proteins from bacterial YidC. Inherited and acquired functions of a conserved protein insertion machinery. J Biol Chem 280, 13004 13011. Race, H.L., Herrmann, R.G. and Martin, W. (1999) Why have organelles reta ined genomes? Trends Genet 15, 364 370. Rawyler, A., Meylan -Bettex, M. and Siegenthaler, P.A. (1995) (Galacto) lipid export from envelope to thylakoid membranes in intact chloroplasts. II. A general process with a key role for the envelope in the establish ment of lipid asymmetry in thylakoid membranes. Biochim Biophys Acta 1233, 123 133. Rawyler, A., Meylan, M. and Siegenthaler, P.A. (1992) Galactolipid export from envelope to thylakoid membranes in intact chloroplasts. I. Characterization and involvement i n thylakoid lipid asymmetry. Biochim Biophys Acta 1104, 331 341. Reed, J.E., Cline, K., Stephens, L.C., Bacot, K.O. and Viitanen, P.V. (1990) Early events in the import/assembly pathway of an integral thylakoid protein. Eur J Biochem 194, 33 42. Reinbothe, C., Bartsch, S., Eggink, L.L., Hoober, J.K., Brusslan, J., Andrade -Paz, R., Monnet, J. and Reinbothe, S. (2006) A role for chlorophyllide a oxygenase in the regulated import and stabilization of light -harvesting chlorophyll a/b proteins. Proc Natl Acad Sc i U S A 103, 4777 4782. Rhee, S.Y., Beavis, W., Berardini, T.Z. et al. (2003) The Arabidopsis Information Resource (TAIR): a model organism database providing a centralized, curated gateway to Arabidopsis biology, research materials and community. Nucleic Acids Res 31, 224 228. Richter, S. and Lamppa, G.K. (1999) Stromal Processing Peptidase Binds Transit Peptides and Initiates Their ATP -dependent Turnover in Chloroplasts. Journal of Cell Biology 147 33 44. Robinson, D.R., Karnauchov, I., Herrmann, R.G., K losgen, R.B. and Robinson, C. (1996) Protease -sensitive thylakoidal import machinery for the Sec DeltapH and signal recognition particle -dependent protein targeting pathways, but not for CF0II integration. Plant Journal 10, 149 155. Rohl, T. and van Wij k, K.J. (2001) In vitro reconstitution of insertion and processing of cytochrome f in a homologous chloroplast translation system. J Biol Chem 276, 35465 35472. Roslan, H.A., Salter, M.G., Wood, C.D. et al. (2001) Characterization of the ethanol inducible alc gene -expression system in Arabidopsis thaliana. Plant J 28, 225 235.

PAGE 143

143 Roy, L.M. and Barkan, A. (1998) A SecY homologue is required for the elaboration of the chloroplast thylakoid membrane and for normal chloroplast gene expression. J Cell Biol 141, 385 395. Schaller, G.E., Ladd, A.N., Lanahan, M.B., Spanbauer, J.M. and Bleeker, A.B. (1995) The Ethylene Response Mediator ETR1 from Arabidopsis Form a Disulfide linked Dimer. J Biol Chem 270, 12526 12530. Schena, M., Lloyd, A.M. and Davis, R.W. (1991) A ste roid inducible gene expression system for plant cells. Proc Natl Acad Sci U S A 88, 10421 10425. Schnell, D.J., Blobel, G. and Pain, D. (1990) The chloroplast import receptor is an integral membrane protein of chloroplast envelope contact sites. J Cell Bio l 111, 1825 1838. Schuenemann, D., Amin, P., Hartmann, E. and Hoffman, N.E. (1999) Chloroplast SecY is complexed to SecE and involved in the translocation of the 33kDa but not the 23kDa subunit of the oxygen-evolving complex. J Biol Chem 274, 12177 12182 Schulz, A., Knoetzel, J., Scheller, H.V. and Mant, A. (2004) Uptake of a fluorescent dye as a swift and simple indicator of organelle intactness: import -competent chloroplasts from soil grown Arabidopsis. J Histochem Cytochem 52, 701 704. Schunemann, D. (2007) Mechanisms of protein import into thylakoids of chloroplasts. Biol Chem 388, 907 915. Scotti, P.A., Valent, Q.A., Manting, E.H., Urbanus, M.L., Driessen, A.J.M., Oudega, B. and Luirink, J. (1999) SecA Is Not Required for Signal Recognition Particle -mediated Targeting and Initial Membrane Insertion of a Nascent Inner Membrane Protein. J Biol Chem 274, 29883 29888. Shimoni, E., Rav -Hon, O., Ohad, I., Brumfeld, V. and Reich, Z. (2005) Three Dimensional Organization of Higher -Plant Chloroplast Thylakoid Membranes Revealed by Electron Tomography. The Plant Cell 17, 2580 2586. Shipman-Roston, R.L., Ruppel, N.J., Damoc, C., Phinney, B.S. and Inoue, K. (2010) The Significance of Protein Maturation by Plastidic Type I Signal Peptidase 1 for Thylakoid Developme nt in Arabidopsis thaliana Chloroplasts. Plant Physiol Shipman, R.L. and Inoue, K. (2009) Suborganellar localization of plastidic type I signal peptidase 1 depends on chloroplast development. FEBS Lett 583, 938 942. Siboo, I.R., Chaffin, D.O., Rubens, C.E. and Sullam, P.M. (2008) Characterization of the accessory Sec system of Staphylococcus aureus. J Bacteriol 190, 6188 6196. Sirrenberg, C., Bauer, M.F., Guiard, B., Neupert, W. and Brunner, M. (1996) Import of carrier proteins into the mitochondrial inner membrane mediated by Tim22. Nature 384, 582 585.

PAGE 144

144 Skalitzky, C.A. (2006) Genetic Analysis of SCY1 and SCY2 Function in Arabidopsis thaliana. Botany Master of Science 62. Smith, M.D., Fitzpatrick, L., Keegstra, K. and Schnell, D.J. (2003) In Vitro Analysis of Chloroplast Protein Import. In Current Protocols in Cell Biology eds). pp. 16.1 16.21. Spence, E., Sarcina, M., Ray, N., Moller, S.G., Mullineaux, C.W. and Robinson, C. (2003) Membrane -specific targeting of green fluorescent protein by the Tat pathway i n the cyanobacterium Synechocystis PCC6803. Mol Microbiol 48, 1481 1489. Staehelin, L.A. (2003) Chloroplast structure: from chlorophyll granules to supra -molecular architecture of thylakoid membranes. Photosynth Res 76, 185 196. Steiner, J.M., Kocher, T., Nagy, C. and Loffelhardt, W. (2002) Chloroplast SecE: evidence for spontaneous insertion into the thylakoid membrane. Biochem Biophys Res Commun 293, 747 752. Sundberg, E., Slagter, J.G., Fridborg, I., Cleary, S.P., Robinson, C. and Coupland, G. (1997) ALB INO3, an Arabidopsis nuclear gene essential for chloroplast differentiation, encodes a chloroplast protein that shows homology to proteins present in bacterial membranes and yeast mitochondria. Plant Cell 9 717 730. Swidersky, U.E., Rienhofer -Schweer, A., Werner, P.K., Ernst, F., Benson, S.A., Hoffschulte, H.K. and Mueller, M. (1992) Biochemical analysis of the biogenesis and function of the Escherichia coli export factor SecY. European Journal of Biochemistry 207, 803 811. Tour, O., Meijer, R.M., Zacharia s, D.A., Adams, S.R. and Tsien, R.Y. (2003) Genetically targeted chromophore assisted light inactivation. Nat Biotechnol 21, 1505 1508. Valent, Q.A., Scotti, P.A., High, S., Gier, J.W.L.d., Heijne, G.v., Lentzen, G., Wintermeyer, W., Oudega, B. and Luirin k, J. (1998) The Escherichia coli SRP and SecB targeting pathways converge at the translocon. EMBO J 17, 2504 2512. van de Meene, A.M., Hohmann-Marriott, M.F., Vermaas, W.F. and Roberson, R.W. (2006) The three -dimensional structure of the cyanobacterium Sy nechocystis sp. PCC 6803. Arch Microbiol 184, 259 270. Van Houdt, H., Bleys, A. and Depicker, A. (2003) RNA target sequences promote spreading of RNA silencing. Plant Physiol 131, 245 253. van Wijk, K.J., Knott, T.G. and Robinson, C. (1995) Evidence for Se cA and delta pH independent insertion of D1 into thylakoids. FEBS Lett 368, 263 266. Vitriol, E.A., Uetrecht, A.C., Shen, F., Jacobson, K. and Bear, J.E. (2007) Enhanced EGFP chromophore assisted laser inactivation using deficient cells rescued with funct ional EGFP -fusion proteins. Proc Natl Acad Sci U S A 104, 6702 6707.

PAGE 145

145 Voelker, R., Mendel -Hartvig, J. and Barkan, A. (1997) Transposon-disruption of a maize nuclear gene, tha1, encoding a chloroplast SecA homologue: in vivo role of cp -SecA in thylakoid prot ein targeting. Genetics 145, 467 478. Vojta, L., Soll, J. and Bolter, B. (2007) Requirements for a conservative protein translocation pathway in chloroplasts. FEBS Lett 581, 2621 2624. Vothknecht, U.C. and Soll, J. (2005) Chloroplast membrane transport: interplay of prokaryotic and eukaryotic traits. Gene 354, 99 109. Wesley, S.V., Helliwell, C.A., Smith, N.A. et al. (2001) Construct design for efficient, effective and high throughput gene silencing in plants. Plant J 27, 581 590. Westphal, S., Heins, L., S oll, J. and Vothknecht, U.C. (2001a) Vipp1 deletion mutant of Synechocystis: a connection between bacterial phage shock and thylakoid biogenesis? Proc Natl Acad Sci U S A 98, 4243 4248. Westphal, S., Soll, J. and Vothknecht, U.C. (2001b) A vesicle transpor t system inside chloroplasts. FEBS Lett 506, 257 261. Westphal, S., Soll, J. and Vothknecht, U.C. (2003) Evolution of chloroplast vesicle transport. Plant Cell Physiol 44, 217 222. White, R.A. and Hoober, J.K. (1994) Biogenesis of Thylakoid Membranes in Chlamydomonas reinhardtii y1 (A Kinetic Study of Initial Greening). Plant Physiol 106, 583 590. Woodson, J.D. and Chory, J. (2008) Coordination of gene expression between organellar and nuclear genomes. Nat Rev Genet 9 383 395. Woolhead, C.A., Thompson, S.J ., Moore, M., Tissier, C., Mant, A., Rodger, A., Henry, R. and Robinson, C. (2001) Distinct Albino3 -dependent and independent pathways for thylakoid membrane protein insertion. J Biol Chem 276, 40841 40846. Wu, H., Bu, S., Newell, P., Chen, Q. and Fives -Taylor, P. (2007) Two gene determinants are differentially involved in the biogenesis of Fap1 precursors in Streptococcus parasanguis. J Bacteriol 189, 1390 1398. Yi, L., Jiang, F., Chen, M., Cain, B., Bolhuis, A. and Dalbey, R.E. (2003) YidC Is Strictly Re quired for Membrane Insertion of Subunits a and c of the F1F0ATP Synthase and SecE of the SecYEG Translocase. Biochemistry 42, 10537 10544. Yuan, J., Henry, R. and Cline, K. (1993) Stromal factor plays an essential role in protein integration into thylakoi ds that cannot be replaced by unfolding or by heat shock protein Hsp70. Proc Natl Acad Sci U S A 90, 8552 8556. Yuan, J., Henry, R., McCaffery, M. and Cline, K. (1994) SecA homolog in protein transport within chloroplasts: evidence for endosymbiont -derived sorting. Science 266 796 798.

PAGE 146

146 Yusa, F., Steiner, J.M. and Loffelhardt, W. (2008) Evolutionary conservation of dual Sec translocases in the cyanelles of Cyanophora paradoxa. BMC Evol Biol 8 304. Zerges, W. and Rochaix, J.D. (1998) Low density membranes a re associated with RNA binding proteins and thylakoids in the chloroplast of Chlamydomonas reinhardtii. J Cell Biol 140, 101 110. Zhang, L., Paakkarinen, V., Suorsa, M. and Aro, E.M. (2001) A SecY homologue is involved in chloroplast -encoded D1 protein biogenesis. J Biol Chem 276, 37809 37814. Zhang, X., Henriques, R., Lin, S.S., Niu, Q.W. and Chua, N.H. (2006) Agrobacterium mediated transformation of Arabidopsis thaliana using the floral dip method. Nat Protoc 1 641 646. Zuo, J., Hare, P.D. and Chua, N.H. (2006) Applications of chemical inducible expression systems in functional genomics and biotechnology. In Methods in moleculare biology eds). Clifton: Humana Press, pp. 329342. Zuo, J., Niu, Q.W. and Chua, N.H. (2000) Technical advance: An estrogen recep tor -based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant J 24, 265 273.

PAGE 147

147 BIOGRAPHICAL SKETCH Jonathan Martin took an early interest in biology. His brother and he had much exposure to biology while hunting, fishi ng, and backpacking with their father, who worked as a wildlife biologist with the State of California. After he entered UC Davis to pursue a B.S. in Biology, Jon quickly felt that his major was too broad. In his early course work, Jon was most impressed by discoveries made in molecular scale plant biology. Jon focused his major on Plant Biotechnology, which provided more exposure to plant biochemistry, and molecular and cellular biology. Jon initially worked with Dr. John Duniway on developing a means t o biologically control Vericillium Wilt in Strawberry. Working in Dr. Duniways lab was a good experience: Jon made friends and experienced what lab science was like, but Dr. Duniway did not study biology on a molecular scale. Some persistence earned Jon a job at the National Science Foundation Center for Engineered Plant Resistance Against Pathogens, working with Drs. Lincoln and Gilchrist. Jon managed a few small projects, and made friends with Jagger Harvey, a PhD candidate in the genetics program, wh o encouraged Jon to pursue a PhD in plant molecular biology. Jon enjoyed his interview for a graduate research assistantship in the Program for Plant Molecular and Cellular Biology at the University of Florida. After rotating through three labs, Jon accep ted Dr. Ken Clines invitation to study thylakoid protein translocation. Jons experiences as a graduate student have been trying and rewarding. Along with help from Dr. Cline, his committee members, and lab colleagues, Jon is glad to have attained PhD c andidacy, published his work in a prestigious journal of plant biology, and to have had an opportunity to present his work at a prestigious scientific meeting.