<%BANNER%>

Inhibition, Characterization, and Crystallization of Glutamine-Dependent Asparagine Synthetase

Permanent Link: http://ufdc.ufl.edu/UFE0041411/00001

Material Information

Title: Inhibition, Characterization, and Crystallization of Glutamine-Dependent Asparagine Synthetase
Physical Description: 1 online resource (155 p.)
Language: english
Creator: Meyer, Megan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: asparagine, bacterial, crystallization, human, inhibitor, mutagensis, sulfoximine, synthetase
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Acute lymphoblastic leukemia is commonly treated using the enzyme L asparaginase, which hydrolyzes asparagine to aspartic acid, leaving the tumor cells unable to obtain asparagine from the circulating plasma. Several lines of evidence suggest that resistance to L-asparaginase treatment is correlated to up-regulation of the enzyme responsible for the biosynthesis of asparagine, asparagine synthetase. Recent work has shown that a sulfoximine derived inhibitor of asparagine synthetase with nanomolar potency can suppress the proliferation of drug-resistant MOLT-4 leukemia cells in the presence of L-asparaginase, a result that supports the use of inhibitors of asparagine synthetase in the clinical treatment of acute lymphoblastic leukemia. This work strives to develop second-generation inhibitors of asparagine synthetase by gaining a better understanding of the active site-inhibitor interactions, reaction mechanism, and structure of this enzyme. Sulfoximine derived inhibitors of asparagine synthetase were designed to increase the bioavailability and potency of the molecule. Steady-state kinetic analysis of these compounds found that a localized negative charge on the inhibitor that mimics the phosphate group is essential to ligand binding in asparagine synthetase. These findings place an important constraint on the design of future inhibitors of asparagine synthetase. Work to understand the reaction mechanism and validate a computational model of asparagine synthetase focused on a conserved glutamate residue which was hypothesized to act as the general base for the deprotonation of ammonia in the transition state. However, site-directed mutagenesis, kinetic analysis, and isotopic labeling studies of the glutamine-dependent asparagine synthetase from E. coli found that this residue is critical to formation of the ?AspAMP intermediate. Finally in an effort to understand the structure-function relationships of asparagine synthetase, we sought to obtain a high resolution crystal structure of asparagine synthetase. Through the preparation of a doubly inhibited form of the enzyme, we hoped to lock the enzyme into an active conformation that promoted crystallization. Unfortunately, preliminary crystallization trials did not produce crystals suitable for diffraction but important information regarding the stability of the enzyme was obtained
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Megan Meyer.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Richards, Nigel G.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041411:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041411/00001

Material Information

Title: Inhibition, Characterization, and Crystallization of Glutamine-Dependent Asparagine Synthetase
Physical Description: 1 online resource (155 p.)
Language: english
Creator: Meyer, Megan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: asparagine, bacterial, crystallization, human, inhibitor, mutagensis, sulfoximine, synthetase
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Acute lymphoblastic leukemia is commonly treated using the enzyme L asparaginase, which hydrolyzes asparagine to aspartic acid, leaving the tumor cells unable to obtain asparagine from the circulating plasma. Several lines of evidence suggest that resistance to L-asparaginase treatment is correlated to up-regulation of the enzyme responsible for the biosynthesis of asparagine, asparagine synthetase. Recent work has shown that a sulfoximine derived inhibitor of asparagine synthetase with nanomolar potency can suppress the proliferation of drug-resistant MOLT-4 leukemia cells in the presence of L-asparaginase, a result that supports the use of inhibitors of asparagine synthetase in the clinical treatment of acute lymphoblastic leukemia. This work strives to develop second-generation inhibitors of asparagine synthetase by gaining a better understanding of the active site-inhibitor interactions, reaction mechanism, and structure of this enzyme. Sulfoximine derived inhibitors of asparagine synthetase were designed to increase the bioavailability and potency of the molecule. Steady-state kinetic analysis of these compounds found that a localized negative charge on the inhibitor that mimics the phosphate group is essential to ligand binding in asparagine synthetase. These findings place an important constraint on the design of future inhibitors of asparagine synthetase. Work to understand the reaction mechanism and validate a computational model of asparagine synthetase focused on a conserved glutamate residue which was hypothesized to act as the general base for the deprotonation of ammonia in the transition state. However, site-directed mutagenesis, kinetic analysis, and isotopic labeling studies of the glutamine-dependent asparagine synthetase from E. coli found that this residue is critical to formation of the ?AspAMP intermediate. Finally in an effort to understand the structure-function relationships of asparagine synthetase, we sought to obtain a high resolution crystal structure of asparagine synthetase. Through the preparation of a doubly inhibited form of the enzyme, we hoped to lock the enzyme into an active conformation that promoted crystallization. Unfortunately, preliminary crystallization trials did not produce crystals suitable for diffraction but important information regarding the stability of the enzyme was obtained
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Megan Meyer.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Richards, Nigel G.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041411:00001


This item has the following downloads:


Full Text

PAGE 1

1 I NHIBITION, CHARACTERIZATION, AND CRYSTALLIZATION OF GLUTAMINE -DEPENDENT ASPARAGINE SYNTHETASE By MEGAN ELIZABETH MEYER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Megan E. Meyer

PAGE 3

3 To the Meyer family

PAGE 4

4 ACKNOWLEDGMENTS This project was funded in part by the T -32 NIH training grant in Cancer Biology (CA09126) by providing support for my studies while pursuing this degree. I would like to thank my advisor, Dr. Nigel Richards, for allowing me to work on this project and providing me with the opportunities and guidance to succeed. I would like ackno wledge my committee: Dr. Nicole Horenstein, Dr. Aaron Aponick, Dr. Gail Fa nucci, and Dr. Mike Kilberg for their support. A special thanks to Dr. James and Ale Maruniak, wi thout their help this project would not have succeeded. I would also like to thank Drs. Inari Kursula and Rosie Bradshaw for their guidance an d hospitality while I was visiting their labs oversea s. A special thanks to the members of the Richards group, p ast and present, for providing a fun environment to work in for the past 5 years. I would especially like to thank Dr. Cory Toyota for his friendship, useful scientific discussions, and endless patience I would like to thank all of the friends I have met here in Gainesville, especially Dan, Travis, Jen, and Lindsay for providing a sense of belonging when I was far away from home. I also thank Dustin for his unconditional love, support, and understanding while I was finishing this degree. I am forever gr ateful to my parents and family for their unconditional love and support throughout my life and always believing in my ability to succeed.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...................................................................................................... 4 LIST OF TABLES ................................................................................................................ 8 LIST OF FIGURES .............................................................................................................. 9 LIST OF ABBREVIATIONS .............................................................................................. 13 ABSTRACT ........................................................................................................................ 15 CHAPTER 1 INTRODUCTION ........................................................................................................ 17 Acute Lymp hoblastic Leukemia ................................................................................. 17 Asparagine Synthetase .............................................................................................. 18 Enzyme Mechanism ............................................................................................. 21 Enzyme Structure ................................................................................................. 25 Inhibitor Studies of ASNS .................................................................................... 31 Research Objectives ................................................................................................... 33 2 A CRITICAL ELETROSTATIC INTERACTION MEDIATES INHIBITOR RECOGNITION BY HUMAN AS PARAGINE SYNTHETASE ................................... 36 Introduction ................................................................................................................. 36 Results and Discussion .............................................................................................. 39 Experimental Section .................................................................................................. 50 Materials ............................................................................................................... 50 Expression and Purific ation of Recombinant Human Asparagine Synthetase .. 51 Enzyme Assays .................................................................................................... 51 Cloning, Expression, Purification, and Characterization of K449 Mutants ......... 54 3 FUNCTIONAL ROLE OF A CONSERVED ACTIVE SITE GLUTAMATE IN GLUTAMINE -DEPENDENT ASPARAGINE SYNTHETASE FROM Escherichia coli ............................................................................................................................... 57 Introduction ................................................................................................................. 57 Results ........................................................................................................................ 62 Cloning of asnB to Contain a C -terminal Poly histidine Tag .............................. 62 Expression and Purification His6-tagged AS B and E348 Mutants .................... 64 Characterization of His6-tagged AS B ................................................................. 64 Glutaminase Activity of AS -B and E348 Mutants ................................................ 67 Asparagine,Pyrophosphate, and Glutamate Production ..................................... 69 Kinetic Parameters for E348D mutant ................................................................. 71

PAGE 6

6 18O transfer experiments ...................................................................................... 72 Positional Isotope Exchange ............................................................................... 74 Discussion ................................................................................................................... 81 Characterization of His6-AS-B ............................................................................. 81 Steady -State Kinetic Assays with E348 mutants ................................................ 82 18O Isotopic Labeling Studies .............................................................................. 86 Co nclusions ................................................................................................................ 90 Experimental Section .................................................................................................. 90 Materials ............................................................................................................... 90 Cloning of His6-tagged AS -B and E348 Mutants ................................................ 91 Expression and Purification of His6-tagged AS -B and E348 Mutants ................ 91 Glutaminase Activity ............................................................................................ 92 Pyrophosphate Production .................................................................................. 93 Asparagi ne and Glutamate Production ............................................................... 93 Synthesis of 18O Aspartic Acid ............................................................................. 94 18O transfer studies .............................................................................................. 94 PIX Experiments .................................................................................................. 96 4 CRYSTALLIZATIO N TRIALS OF GLUTAMINE -DEPENDENT ASPARAGINE SYNTHETASE ............................................................................................................ 97 Introduction ................................................................................................................. 97 Results and Discussion ............................................................................................ 105 Expressi on and Purification of hASNS for Crystallography Trials .................... 105 Inhibition of hASNS with DON ........................................................................... 106 Inhibition of hASNS with AMP -CPP .................................................................. 106 Characterization of His6-tagged AS B Truncation Mutants .............................. 111 Small angle X -ray Scattering of His6-AS -B and 40 mutant ............................ 115 Crystallization Trials of His6-tagged AS -B Truncation Mutants ........................ 118 Conclusions .............................................................................................................. 118 Materials and Methods ............................................................................................. 120 Ma terials ............................................................................................................. 120 Obtaining a High Titer Viral Inoculum ............................................................... 120 Expression and Purification of hASNS for Crystallization ................................ 121 Inhibition of hASNS with DON ........................................................................... 121 Inhibition of hASNS with AMP -CPP .................................................................. 122 Preparation of hASNS for Crystallization Trials ................................................ 122 Crystallization Trials of hASNS .......................................................................... 122 Cloning, Expression and Purification of His6tagged AS -B Truncation Mutants ........................................................................................................... 123 Characterization of His6-tagged AS B Truncation Mutants .............................. 125 Crystallization Trials and SAXS measurements of His6-tagged AS -B and Truncation Mutants ......................................................................................... 126 5 CONCLUSIONS AND FUTURE WORK .................................................................. 127 Conclusions .............................................................................................................. 127

PAGE 7

7 Inhibition of hASNS ............................................................................................ 127 Functional Role of a Conserved Glutamate Residue ....................................... 127 Crystallization of hASNS and AS -B ................................................................... 128 Future Work .............................................................................................................. 128 Design of Future Inhibitors ................................................................................. 128 Crys tallization of hASNS .................................................................................... 129 Expression of hASNS in E. coli ......................................................................... 129 Thrombin Cleavage of His6-tagged AS -B .......................................................... 130 ASNS from Mycobacterium tuberculosis ........................................................... 131 APPENDIX A PROTEIN AND DNA SEQUENCES OF ASPARAGINE SYNTHETASE ............... 132 B PRIMERS USED FOR MUTAGENSIS AND CLONING ......................................... 134 C 31P NMR SPECTRA OF PIX EXPERIMENTS UTILIZING 18O6-ATP ............... 135 LIST OF REFERENCES ................................................................................................. 141 BIOGRAPHICAL SKETCH .............................................................................................. 155

PAGE 8

8 LIST OF TABLES Table page 2 -1 Glutaminase activity of Wild-type AS -B and K449 mutants .................................. 48 3 -1 Steady -state kinetic parameters for His6-tagged AS B determined at pH 8.0 ..... 67 3 -2 Kinetic constants for the glutaminase activity of His6-tagged AS B and E348 mutants at pH 8.0 with or without added ATP. ...................................................... 68 3 -3 Product ratios for the ammonia and glutamine dependent synthetase activities of His6-tagged AS B and E348 mutants at pH 8.0 measured under saturating substrate conditions. ............................................................................. 69 3 -4 Kinetic constants for the ammonia and glutamine-dependent synthetase activity of His6-tagged AS -B and E348D determined at pH 8.0. ........................... 72 3 -5 Relative abundance of 18O4-Aspartic Acid based upon [M -H]-ions. ..................... 95 4 -1 Glutaminase activity of His6-tagged AS -B and truncation mutants at pH 8.0. ... 114 4 -2 Ammonia and glutamine dependent production of PPi, Asn, and Glu in wild type His6-tagged AS -B and truncation mutants determined under saturating conditions at pH 8.0 ............................................................................................. 114 4 -3 List of experimental conditions screened for crystallization of hASNS .............. 124 B-1 Sequence of primers for cloning and site-directed mutagenesis studies ........... 134

PAGE 9

9 LIST OF FIGURES Figure page 1 -1 Reaction catalyzed by glutamine-dependent asparagine synthetase. ................. 20 1 -2 Proposed mechanism of glutamine dependent asparagine synthetase. ............. 22 1 -3 Proposed kinetic model for glutamine dependent asparagine synthetase. ........ 24 1 -4 Crystal structure of E. coli ASB (1CT9) complexed to AMP and glutamine.. ..... 26 1 -5 Residues defining the PPi loop motif in computational model of AS-B/PPi/ AspAMP. .............................................................................................. 27 1 -6 Intramolecular tunnel of AS -B connects the glutaminase domain active site to the synthetase domain active site. ........................................................................ 29 1 -7 AS-B and LS catalyze similar reactions and are structurally homologous.. ....... 30 1 -8 Chemical structures of previously characterized inhibitors of hASNS.. ............... 32 1 -9 Effect of the N adenylated sulfoximine on MOLT -4 proliferation in the absence and presence of 1U ASNase. ................................................................. 34 2 -1 Chemical structures of adenylated sulfoximine derivative 1 and adenylated sulfamide 2 which are nanomolar inhibitors of hASNS. Chemical structures of adenylated sulfoximine derivatives 3 and 4 the novel compounds to be characterized. ......................................................................................................... 38 2 -2 Ammonia-dependent production of PPi in the presence of increasing amounts of the funct ionalized sulfoximine 3 ......................................................... 40 2 -3 Glutaminedependent production of PPi in the presence of increasing amounts of the functionalized sulfoximine 3 ........................................................ 41 2 -4 Ammonia-dependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4 ................................................................. 43 2 -5 Glutaminedependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4 .................................................................. 44 2 -6 Ratio of asparagine to pyrophosphate production (M) in the presenc e and absence of 1 mM of the functionalized sulfoximine 3 and 4 ............................... 45 2 -7 Conjugate base of the functionalized acylsulfamate 2 and functionalized acylsulfamide 3 ...................................................................................................... 47

PAGE 10

10 2 -8 Chemical structures of N benzoylsulfamate 5 sulfanilamide, and methanesulfonamide compounds that were used to estimate pKa values of 2 and 3 ...................................................................................................................... 47 2 -9 The interaction between the Lys -449 side chain and the phosphate group of the AspAMP intermediate .................................................................................... 49 2 -10 Kinetic model for slow onset inhibition .................................................................. 53 3 -1 Computational model of the N adenylated sulfoximine inhibitor docked int o the synthetase site of AS -B. ................................................................................... 58 3 -2 Proposed reaction mechanism for the synthetase reaction of ASNS. ................. 60 3 -3 Reactions catalyzed by AS -B, LS, and CPS and s tructural ov erlay of the conserved catalytic dyad in LS CPS with the substituted residues in AS -B ..... 61 3 -4 Construction of pET -21 c (+) vector to contain a poly -histidine tag. .................... 63 3 -5 Purification of His6-tagged AS -B using IMAC ........................................................ 65 3 -6 Silver stained SDS -PAGE gel of untagged and His6tagged AS -B and E348 mutants .................................................................................................................. 66 3 -7 Production of PPi in the presence and absence of aspartate for the ammoniadependent and glutamine dependent reactions of AS -B and E348 mutants. .... 70 3 -8 18O transfer reaction using 18O -labeled aspartic acid. .......................................... 73 3 -9 31P NMR spectrum of the reaction mixture obtained with His6-tagged AS -B and 18O -labeled aspartate acid. ............................................................................. 73 3 -10 31PNMR spectrum of the reaction mixture obtained from 18O labeled aspartate and E348D mutant. ................................................................................ 75 3 -11 31P NMR spectrum of reaction mixture obtained from E348A mutant.. ................ 76 3 -12 Comparison of the relative amounts of each 31P containing compound detected in wild type, E348D, and E 348A reactions. ............................................ 77 3 -13 Two possible PIX reactions catalyzed by AS B. ................................................... 79 3 -14 31P NMR spectra of the -P of ATP and P of ATP indicate that no PIX is observed for wild type, E348A, or E348D after 3.5 hours .................................... 80 3 -15 E348 is the only charged residue at the base of the intramolecular tunnel. ..... 83 3 -16 Propo sed kinetic model for glutamine dependent asparagine synthetase. ......... 85

PAGE 11

11 3 -17 Structural overlay of the P loop of AS -B, a rgininosuccinate synthetase and LS ......................................................................................................................... 89 3 -18 Representative HPLC chromatogram for the separation and quanitification of asparagine and glutamate. .................................................................................... 95 4 -1 Crystalli zation by vapor diffusion ........................................................................... 99 4 -2 DON reacts with the Cys -1 residue of ASNS to form a covalent adduct. .......... 101 4 -3 Fraction of original glutaminase activity remaining after treatmen t of hASNS with 5.88 mM DON. .............................................................................................. 103 4 -4 The solved crystal structure of AS B is missing the fin al 37 residues of the protein. .................................................................................................................. 104 4 -5 Fraction of glutaminase, ammoniadependent synthetase, and glutamine dependent synthetase activity remaining after treatment of hASNS with 15 mM DON. .............................................................................................................. 107 4 -6 Chemical structure of AMP CPP and production of PPi ( M) in the presence of 0.1 mM and 1 mM of AMP -CPP. ..................................................................... 109 4 -7 Number of clear drops in comparison to the number of drops containing precipitated protein as a function of pH or precipitating reagent for the pHclear suite.. ....................................................................................................... 110 4 -8 Formation of microcrystals in a protein drop containing hASNS, 15 mM DON, 0.2 M sodium/potassium phosphate, 20 % (w/v) PEG 3350. ............................. 112 4 -9 SDS-PAGE analysis of His6-tagged AS -B truncation mutants stained with Commassie Brillant blue.. .................................................................................... 113 4 -10 Distance distribution for wild type His6-tagged AS .............. 116 4 -11 Wild type His6-ASB and 40 SAXS structure superimposed on AS B crystal str ucture dimer. .................................................................................................... 117 4 -12 Glutaminase activity of His6-tagged AS -B in the pres ence and absence of 15 mM DON. ......................................................................................................... 119 A-1 DNA sequence of asnB ........................................................................................ 132 A-2 Protein sequence of AS B. .................................................................................. 132 A-3 DNA sequence of hASNS ................................................................................... 133 A-4 Protein sequence of hASNS ................................................................................ 133

PAGE 12

12 C -1 Full 3118O6ATP prior to the addition of enzyme. ........... 136 C -2 Full 31P NMR spectra of the PIX reaction of His6-AS incubated with Laspartic 18O6-ATP for 210 minutes. .............................................................. 137 C -3 Full 31P NMR spectra of the PIX reaction of E348A incubated with Laspartic 18O6-ATP for 210 minutes. .............................................................. 138 C -4 31PMR spectra of the -P of ATP as a function of time for the reaction of His6-tagged AS B and E348A in the presence of [ -18O6] -ATP and aspartic acid. ...................................................................................................................... 139 C -5 31PMR spectra of the -P of ATP as a function of time for the reaction of His6tagged AS -B and E348A in the presence of [ -18O6] ATP and aspartic acid. 140

PAGE 13

13 LIST OF ABBREVIATION S ADP Adenosine diphosphate ALL Acute lymphoblastic leukemia AMP Adenosine monophosphate AMP -CPP Methyleneadenosine 5 -triphosphate AS-B Glutaminedependent asparagine synthetase from E. coli ASNS Glutaminedependent asparagine synthetase Asp L -Aspartic acid Asn L -Asparagine ATP Adenosine triphosphate Beta aspartyl adenosine monophosphate int ermediate Beta -lactam synthetase CPS Carbapenam synthetase CEA N2-(carboxylethyl) L arginine D2O Deuterium oxide DGPC Deoxyguandinoproclavaminic acid DMSO Dimethyl sulfoxide DNFB 2,4-Dinitro -1 -f lurobenzene dNTP Deoxyribonucleotide triphosphate DON 6 -diazo 5 oxo-L -norleucine DTT 1,4d ithio -DL -threitol EDTA Ethylenediaminetetraacetic acid EMBL The European Molecular Biology Laboratory EPPS 4 -(2 hydroxyethyl)piperazine 1 propanesulfonic acid Glu L -Glutamic Acid

PAGE 14

14 Gln L -Glutamine GPAT Glutamine 5phosphoribosyl pyrophosphate amidotransferase GFAT Glutamine fructose 6-phosphate amidotransferase HEPES 4 -(2 hydroxyethyl)piperazine 1 ethanesulfonic acid HPLC High Performance Liquid Chromatography hASNS Glutaminedependent asparagine synthetase from H omo Sapiens GTP Guanosine triphosphate IMAC Immobilized metal affinity chromatography Lys L -Lysine MOI Multiplicity of infection Ni -NTA Nickel -nitriloacetic acid NAD+ Nicotinamide adenine dinucleotide NADH Nicotinamide adenine dinucleotide (reduced form) NMR Nuclear magnetic resonance PCR Polymerase chain reaction PEG Polyethylene glycol PIX Positional isotope exchange PPi Pyrophosphate ppm Parts per million SAXS Small angle X -ray scattering SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophores is Sf9 Cell line derived from pupal ovarian tissue of the Fall armyworm Spodoptera frugiperda TCEP Tris(2 -carboxyethyl)phosphine

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INHIBITION, CHARACTERIZATION, AND CRYSTALLIZATION OF GLUTAMINE DEPENDENT ASPARAGINE SYNTHETASE By Megan Elizabeth Meyer May 2010 Chair: Nigel Richards Major: Chemistry Acute lymphoblastic leukemia is commonly treated using the enzyme L asparaginase, which hydrolyzes asparagine to aspartic acid, leaving the tumor cells unable to obtain asparagine from the circulating plasma. Several lines of evidence suggest that r esistance to Lasparaginase treatment is correlated to up-regulation of the enzyme responsible for the biosynthesis of asparagine, asparagine synthetase Recent work has shown that a sulfoximine derived inhibitor of asparagine synthetase with nanomolar potency can suppress the proli feration of drug -resistant MOLT -4 leukemia cells in t he presence of Lasparaginase, a result that supports the use of inhibitors of asparagine synthetase in the clinical treatment of acute lymphoblastic leukemia. This work st rives to develop second-generation inhibitors of asparagine synthetase by gaining a better understand ing of the active siteinhibitor interactions, reaction mechanism, and structure of this enzyme. Sulfoximine derived inhibitors of asparagine synthetase were designed to increa se the bioavailability and potency of the molecule. Steady -state kinetic analysis of these compounds found that a localized negative charge on the inhibitor that mimics the phosphate group is essential to ligand binding in asparagine synthetase. These

PAGE 16

16 fin dings place an important constraint on the design of future inhibitors of asparagine synthetase. Work to understand the reaction mechanism and validate a computation al model of asparagine synthetase focused on a conserved glutamate residue which was hypo thesized to act as the general base for the deprotonation of am monia in the transition state. However, s ite directed mutagenesi s, kinetic analysis, and isotopic labeling studies of the glutamine dependent asparagine synthetase from E. coli found that this residue Finally i n an effort to understand the structure-function relationships of asparagine synthetase, we sought to obtain a high resolution crystal structure of asparagine synthetase. Through the preparation of a doubly inhibited form of the enzyme, we hoped to lock the enzyme into an active conformation that promoted crystallization. Unfortunately, preliminary crystallization trials did not produce crystals suitable for diffraction but important information regarding the stability of the enzyme was obtained

PAGE 17

17 CHAPTER 1 INTRODUCTION Acute Lym phoblastic Leukemia Acute lymphoblastic le ukemi a (ALL) is a cancer of the white blood cells characterized by an excess of lymphoblasts in the blood. Over 5,000 new cases were diagnosed in the Un ited States in 2008. ALL is ten times more likely to be diagnosed in children than in adults, with 72% of all childhood le ukemia cases diagnosed as ALL. Survival rates have increased significantly over the last 40 years as treatment regiments have improved and now exceed 65% for adults and 85% for children (1 ). The most widely used chemotherapeutic treatment for ALL employs L asparaginase ( 2 -4 ) an enzyme that catalyzes the hydrolysis of Lasparagine to L aspartic acid ( 5 ). The exact mechanism by which this treatment works is still poorl y understood; however, i t is believed that leukemic blasts cannot produce sufficient levels of asparagine and therefore must rely on the uptake of asparagine from the circulating plasma (6, 7 ) L asparaginase depletes the levels of asparagine in the blood which leaves leukemic bl asts unable to obtain th is essential amino acid This leads to cell cycle arrest likely due to impaired protein synthesis ( 8 10). Al though this treatment is successful in a large number of cases, patients who relapse often show resistance to further L asparaginase treatment. Resistance to Lasparaginase treatment has been correlated with up regulation of asparagine synthetase (ASNS ) ( 1 1 16) an enzyme that catalyzes the biosynthesis of L asparagine. The inverse relationship between AS NS levels and resista nce to L asparaginase treatment was first observed in the late 1960s in mouse lymphoma ( 12, 17, 18) and leukemia cells (16 ) and later identified in a human lymphoma cel l line (14 ).

PAGE 18

18 These studies found that c ells resistant to Lasparaginase treatment showed elevated levels of AS NS activity The first studies on patient blood and bone marrow samples were conducted in 1969. In this study, Haskell and Canellos observed that s amples taken from patients resistant to Lasparaginase treatment had a 7-fold increase in ASNS levels (11 ). A more recent study using patient bone marrow samples found that low levels of AS NS expression correlated with sensitivity to Lasparaginase treatment ( 13) although other s tudies have argued against this hypothesis ( 1921 ). In addition, studies on ovarian cancer cells lines have found that ASNS expression levels can predict the susceptibility of ovarian cancer cells to Lasparaginase activity ( 22, 23). These studies suggest that understanding the underlying mechanisms by which L asparaginase treatment and ASNS expression are correlated could further the use of L asparaginase for the treatment of other types of cancer. Detailed s t udies involving a MOLT -4 human leukemia cell line have begun to better explain the correlation betwe en Lasparaginase resistance and ASNS levels. One study demonstrated that asparagine synthetase mRNA levels protein level s and enzyme activity are all elevated in a d rug-resistant cell line after short term exposure to L asparaginase, an effect that is not fully reversible (15 ). A more striking observation demonstated that over expres sion of asparagine synthetase by a retrovirus can induce the drug-resistance phenotype (24 ). Furthermore, a potent inhibitor of ASNS was found to suppress the proliferation of a drug resistant MOLT -4 cell line (25 ), a finding that supports the use of potent inhibitors of ASNS in the clinical treatment of ALL. Asparagine Synthetase Glutaminede pendent asparagine synthetase (EC 6.3.5.4) is an enzyme that catalyzes the biosynthesis of L asparagine from L aspartic acid in an ATP dependent

PAGE 19

19 reaction that utilizes glutamine as a nitrogen source in vivo (Figure 1 1) In the absence of glutamine, the enzyme can utili ze ammonia as a nitrogen source, and in the absence of aspartate the enzyme functions as a glutaminase by catalyzing the hydrolysi s of glutamine to ammonia and glutamate. The three distinct reactions catalyzed by asparagine synthetase are listed below: 1 ) L -Gln + L -Asp + ATP L -Asn + L-Glu + AMP + PPi 2 ) NH3 + L -Asp + ATP L -Asn + AMP + PPi 3 ) L -Gln + H2O L -Glu + NH3 Reactions 1 and 2 ind icate the glutamine and ammonia dependent reactions of asparagine synthetase, respectively and reaction 3 is the glutaminase reaction. Glutaminedependent asparagine synthetase (ASNS) belongs to the glutaminedependent amidotransferase famil y of enzymes that catalyze the transfer of amide nitrogen from glutamine to an acceptor substrate ( 26) ASNS has been cloned or isolated from yeast ( 27), bacteria (28 -30 ), plants (31, 32 ), and mammals (33 36) Early studies on the mammalian enzyme utilized asparagine synthetase isolated from bovine (3740) and remain t he only studies on the native mammalian enzyme to date. Early r ecombinant expression systems for human asparagine synthetase in Saccharomyces cerevisiae ( 41 ) and Escherichia coli (42) yi elded low amounts of protein and enzymes with irreproducible kinetic values. However, the recent development of a baculovirus expression system for the expression of recombinant human asparagine synthetase has allowed for the production of milligram quantities of kinetically reproducible enzyme and has greatly enabled the studying of the enzymes mammalian form ( 25, 43, 44). Due to the previous difficulties in obtaining sufficient quantities of mammalian asp aragine synthetase, the glutaminedependent asparagine synthetase from

PAGE 20

20 Figure 11. Reaction catalyzed by glutamine-dependent asparagine synthetase.

PAGE 21

21 Escherichia coli (ASB) has been the primary source for kinetic studies (4547) although some work has also been done on the enzyme from Vibrio cholera (29) Interestingly, prokaryotes encode two genes for asparagine synthetase, asnA and asnB which encode for the ammonia and glutamine -dependent asparagine synthetases respectively ( 48) ; however, the two enzymes are not structurally or evolutionarily related ( 49) and the ammonia dependent enzyme will not be discussed in further detail. Enzyme Mechanism In the proposed mechanism for ASNS (Figure 12 ), the side chain carboxylate of aspartic acid attacks the phosphate of ATP to form the a spartyl intermediate and pyrophosphate ( PPi). The formation been confirmed by isotopic labeling experiments utilizing 18O -labeled aspartic acid for both the E. coli (46, 48 ) and bovine enzyme ( 36) In a distinct active site, glutamine is hydrolyzed to glutamate and ammonia via a thioester interm ediate utilizing the N terminal cysteine residue of the protein (50 ). Replacement of this fully conserved residue (Cys 1) in asparagine synthetase with a serine or alanine residue abolishes all glutaminase and glutamine dependent activity of the enzyme although the ammoniadependent synthetase activity is unaffected (43, 51, 52 ). The ammonia then travels through an intramolecular tunnel where it attacks the AspAMP intermediate to form asparagine and AMP via a tetrahedral intermediate. Although this mechanism suggests that the two active sites should be tightly coupled, glutamate and asparagine production are not fully coordinated in ASNS (46 ). ASNS maintains high levels of glutaminase activity in the absence of other substrates and glutaminase activity is only slightly stimulated in the presence of other substrates (46) This is in stark contrast to other glutamine-dependent amidotransferases where

PAGE 22

22 Figure 12 Proposed m echanism of glutamine-dependent asparagine synthetase.

PAGE 23

23 the active sites are strictly coordinated and glutaminase activity is significantly enhanced in the presence of the correct acceptor molecule ( 53, 54). However, studies o n AS -B ( 46 ) and the enzyme isolated from Vibrio cholera (29 ) have found that asparagine is a competitive inhibitor of the glutaminase reaction ( KI: 5060 M ) and thus represents a potential method for regulating and preventing futile glutamine hydrolysis in vivo (55) Based on previous studies s everal models for the order of substrate binding and product release have been suggested ( 46, 47, 56) However, only one kinetic model can explain the hyperbolic relationship of the glutamate to asparagine ratio observed as the concentration of glutamine is increased. This model suggests that the active sites are only weakly coupled (47 ). In this prop o sed kinetic model (Figure 1 3), ATP or glutamine can bind to the free form of the enzyme. If glutamine binds first, it is subsequently hydrolyzed to glutamate and ammonia. The E.ATP complex can either bind glutamine, resulting in glutamine hydrolysis or it can bind aspartate. Once the E.Asp.ATP complex is formed and if concentration of glutamine is low, the reaction proceeds thru formation of the AspAMP intermediate (k3), then binds glutamine and subsequently forms products (k7). However, as the concentr ation of glutamine is increased, the enzyme favors formation of the quaternary complex (E.ATP.Asp.Gln). From this point, the enzyme can undergo futile hydrolysis to form glutamate (k10) or it may catalyze formation of the intermediate (k12) and formation of products (k7). This branching point for the E.ATP.Asp complex explains the previously observed glutamate:asparagine ratio of 1.8:1 under saturating substrate conditions ( 46 ). This model assumes that ammonia cannot leak from the tunnel, as has been demonstrat ed for other glutamine-dependen t

PAGE 24

24 Figure 13 Proposed kinetic model for glutaminedependent asparagine synthetase. Reprinted with permission from Archive of Biochemistry and Biophysics vol 413. Tesson, A.R, Soper, T.S., Ciusteau, M., Richards, N.G.J. Pages 23 -31. Copyright 2003.

PAGE 25

25 amidotransferases (57 ), and that the active sites are coordinated after formation of the AspAMP intermediate. Enzyme Structure In 1999, the crystal structure of AS B was solved to 2.0 ( 58) The structure was solved for the C1A mutant, which can bind but not hydrolyze glutamine ( 51) complexed with AMP and glutamine (Figure 1 -4). The crystal structure showed, as was expected from sequence alignments (26, 59 ) and studies using monoclonal antibodies on bovine ASNS (39 ), that the enzyme is composed of two distinct domains that catalyze two reactions, the N -terminal glutaminase domain and C -terminal synthetase domain. The N -terminal domain is responsible for the binding and hydrolysis of glutamine and belongs to the class II or Ntn glutamine-dependent amidotransferase family of enzymes. This family of enzymes includes glutamine 5phosphoribosyl pyrophosphate amidotransferase (GPAT) (60, 61 ), glutamine fructose 6phosphate amidotransferase (GFAT) ( 62) and glutamine synthase ( 63) All members of this fami ly use a conserved N -terminal cysteine residue as the nucleophile for hydrolysis of glutamine (26 ). The C -terminal domain of ASNS is responsible for the binding of aspartate and ATP and catalyzes formation of the AspAMP intermediate as well as breakdown of the interm ediate to form asparagine. The C -terminal domain belongs to the ATP pyrophosphatase family of enzymes that are characterized by a signature SGGXDS sequence, a motif referred to the P loop This motif is observed in enzyme domains that catalyze hydrolysis of ATP to AMP and PPi (Figure 1 -5) (64) This family includes GMP synthetase ( 65) arginosuccinate synthetase ( 66) ATP sulfurylase (67 ), -lactam synthetase ( 68, 69 ), carbapenam synthetase ( 70 ), 4 -thiouridine synthetase (71 ) NAD+ synthetase ( 72) The two domains are separated by approximately 20 and

PAGE 26

26 Figure 14. Crystal structure of E. coli AS-B (1CT9) complexed to AMP and glutamine. The glutamina se and synthetase domains are shown in green and blue, respectively. Bound glutamine and AMP are shown in sphere representation. Image rendered in PyMOL ( 73)

PAGE 27

27 Figure 15. Residues defining the PPi loop motif in computational model of AS B/PPi/ AspAMP. The signature SGGXDS residues are shown in yellow interacting with bound Mg/PPi (both shown in stick representation) The AspAMP intermediate is also shown in stick representation. Color scheme: C -green, H yellow, N blue, O -red, P orange, Mg-light green. Image rendered in PyMOL (73 ).

PAGE 28

28 are connected via a solvent -inaccessible intramolecular tunnel responsible for the translocation of ammonia between the two active sites (Figure 16) ( 58 ). Unfortunately, disorder in the C -terminal domain of the crystal structure did not allow observation of several loop regions (Ala 250-Leu 267 and Cys422Ala 426) as w ell as the final 37 amino acids of the protein. It is possible that these terminal residues are important for binding of aspartic acid and may become ordered upon binding ( 58 ). In 1999, Ding generated a computational model of the AS -B active site using t he evolutionarily related lactam synthetase ( LS) as a homol ogy model ( 74, 75 ). LS is an essential enzym e in the biosynthesis of clavulanic acid (68 ) and catalyzes the formation of deoxyguandinoproclavaminic acid (DGPC) f rom N2-(carboxylethyl) L arginine (CEA). Both enzymes catalyze adenylation of the substrate to form an activated AMP derivative followed by attack of the carbonyl group by a nucleophilic nitrogen. However, LS catalyzes intramolecular attack whereas AS B utilizes ammonia to catal yze intermolecular attack (Figure 1 7 A). These two enzymes are clearly evolutionarily related, as their overall three dimensional structures are nearly identical and the residues for substrate adenylation are highly conserved (Figure 17B). Therefore, using the LS/CEA/AMPCPP structure as a model, as well as knowledge about the binding of aspartic acid from studies involving constrained analogs ( 76) a model of AS -B was generated (Ding, unpublished results) where the missing loops regions were modeled in and the AspAMP/MgPPi complex is bound in the active site. This model has been useful in gaining an understanding of the critical residues involved in catalysis although some work must be done to further validate this computational model and determine if it will be a useful model for drug discorvery ( 77).

PAGE 29

29 Figure 16 Intramolecular tunnel of AS -B connects the glutaminase domain active site to the synthetase domain active site. The glutaminase domain is shown in blue and the synthetase domain shown in cyan. AMP and glutamine are represented as spheres. Color scheme: C gray, N -blue, O yellow, P o range. Image rendered in PyMOL ( 73)

PAGE 30

30 Figure 17. AS -B and LS catalyze similar reactions an d are structurally homologous. A) Chemical reactions catalyzed by AS B and LS. B) Structure overlay of AS-B (pdb1CT9) (red) and LS from Strepomyces clavuligerus (pdb 1JGT) (blue). Image rendered in PyMOL (73 ). A B

PAGE 31

31 Inhibitor S tudies of ASNS The observation that resistance to Lasparaginase was correlated to elevated levels of ASNS provoked interest in the identification of inhibitors of ASNS. Several studies involving substrate analogs of glutamine and aspartic acid fa iled to identify any compounds with significant ability to inhibit ASNS either in vitro or in vivo (78, 79) Because there ar e a large number of enzymes that utilize glutamine as a nitrogen source the design of future inhibitors was targeted to the synthetase domain. Kinetic studies suggested that the AspAMP intermediate must be stabilized within the active site ( 46) and suggested that analogs of this intermediate and the transition state leading to asparagine formation should act as tight binding inhibitors (80 ). This important kinetic information as well as the recent development of an efficient exp ression system for the human enzyme (43 ) prompted identification and characterization of the first two nanomolar inhibitors of human asparagine synthetase (Figure 1-8) (25, 81). The N acylsulfonamide ( 81 ) was synthesized as a non -hydrolyzable analog for the intermediate. In this compound, the sulfonamide group acts as a stable analog for the phosphate group. This compound exhibited slow onset inhibition with a KI value of 728 nM. The N adenylated sulfoximine was initially synthesized as a transition state analog for the attack of ammonia of the AspAMP intermediated of ammonia-dependent asparagine synthetase (AS A)(82 ). However, it was also found to be a potent inh ibitor of both ammonia and glutamined ependent asparagine synthetase from E. coli (82, 83) It has also been fully characterized (as a mixture of diastereomers) in vitro as a transition st ate analog that is a slow onset, tight binding inhibitor of human ASNS with low nanomolar affinity (KI of 2.46 nM) (25 ). In this compound, the tetrahedral sulfur atom is a good mimic for the rehybridization of the tetrahedral carbonyl carbon in the

PAGE 32

32 Figure 18. Chemical structures of previously characterized inhibitors of hASNS. A) The N acylsulfonamide is a stable analog f or the AspAMP intermediate. B) The N adenylated sulfoximine is a transition state analog for the attack of ammonia on the intermediate. A B

PAGE 33

33 transition state after attack by ammonia. Furthermore, examination of the electrostatic potential shows that the methyl group has a positive electrostatic potential that mimics the attack of ammonia in the transition state. The most significant aspect of this comp ound is its ability to inhibit the proliferation of drug -resistant MOLT -4 human leukemia cells in a concentration-dependent manner an effect that was stimulated by the presence of 1U of ASNase (Figure1 -9 ) (25 ). This effect provides the first direct evidence that sulfoximine derived compounds can act as potential therapeutic agents in the treatment of drugresistant ALL. Research Objectives Th e long-term goal of this research project is to obtain a small molecule inhibitor of glutamine -dependent asparagine synthetase that can be utilized in the clinical treatment of ALL. The development of an expression system for human asparagine synthetase a s well as the identification of potent, small molecule inhibitors is a large step forward in achieving this goal. However, the N adenylated sulfoximine is limited in its clinical utility due to the high concentrations necessary (up to 1 mM) to exert its biological effect. Therefore, new compounds are desired that have increased bioavailability and potency. The design of new inhibitors of human ASNS is greatly facilitated by a detailed knowledge of the ASNS active site as well as a better understanding of the residues involved in the reaction mechanism. Although the crystal structure for ASNS from E. coli has been solved, the crystal structure of human asparagine synthetase has proved elusive and will aid in the development of new inhibitor compounds of A SNS. Furthermore, s ite -directed mutagenesis of highly conserved residues in ASNS provide a better understanding of the reaction mechanism as well as test our current computational model and understanding of the ASNS active site.

PAGE 34

34 Figure 19. Effect of the N adenylated sulfoximine on MOLT -4 proliferation in the absence and presence of 1U ASNase. Reprinted with permission from Chemistry and Biology vol 13. Gutierrez, J.A., Pan, Y., Koroniak, L., Hiritake, J., Kilberg, M.S., Richards, N.G.J. Pages 1339 -1347. Copyright 2006.

PAGE 35

35 The specific goals of this presented work are the following: 1) characterization of second -generation sulfoximine based inhibitors of human asparagine synthetase, 2) understanding the specific role of E348 in the reaction mechanism of AS -B, and 3) obtaining a crystal structure o f human asparagine synthetase.

PAGE 36

36 CHAPTER 2 A CRITICAL ELETROSTATIC INTERACTION MEDI ATES INHIBITOR RECOG NITION BY HUMAN ASPARAGINE SYNTHETASE1Introduction Approximately 5,000 new cases of ALL are diagnosed in the United States each year with a vast majority of those cases in children The clinical treatment for ALL utilizes the enzymatic depletion of asparagine from the blood and along with other chemotherapeutic agents, such as prednisone and vincristine remission rates in childhood ALL have reached 95% (4 ) ; although those patients that relapse are often resistant to further L asparaginase treatment. The effectiveness of L asparaginase as a treatment protocol is a topic of debate but it is believed that leuk emic blasts rely on the uptake of asparagine from the blood ( 6, 7) and L asparaginase works by depleting the levels of asparagine in the blood leading to cell cycle arrest ( 8 -10 ). It is hypothesized that resistance to Lasparaginase is the result of increased levels of Lasparagine due to upregulation of asparagi ne synthetase (ASNS), the enzyme responsible for the biosynthesis of Lasparagine ( 84). A human leukemia cell line (MOLT -4) has shown that exposure to Lasparaginase causes an increase in AS NS levels (both mRNA and protein) and that over expression of AS NS can result in the L a sparaginase resistant phenotype ( 24) The most recent evidence to support this hypothesis has come as a result of work by the Richards lab, which has demonstrated that proliferation of L asparaginase resistant cells is suppressed in the presence of Lasparaginase and the N adenylated sulfoximine 1 (Fi gure 2 -1) ( 25) This compound acts as a transition state analog for the attack of ammonia on the As pAMP intermediate 1 Reprinted in part with permission from Bioorganic and Medicinal Chemistry, vol 17. Ikeuchi, H., Meyer, M E., Hiratake, J., and Richards, N.G.J. Pages 6641 6650. Copyright 2009. (A)

PAGE 37

37 and acts as a potent inhibi tor of human asparagine synthetase (hASNS)(25 ) as well as both bacterial forms of asparagine synthetase (82, 83) Although compound 1 acts as a low nanomolar inhibitor of human asparagine synthetase in vitro concentrations of 0.1-1 mM were required to observe a n effect in vivo (25) S everal factors may contribute to the necessity of using high concentrations of the compound but o ur hypothesis is that the presence of ionized groups on the molecule prevents its entry into the cell. One possible w ay around this issue is to use pro drugs with groups that are chemically labile within cells to substitute for the phosphate group (85 ). However, compound 1 is difficult to synthesize and modifications to the synthetic pathway t o allow for the development of pro drugs did not represent an ideal situation. Therefore, we wanted to pursue the design and synthesis of novel molecules where the phosphate group was substituted for a functional group with more drug-like properties (86 ). In addition, previous work in our lab demonstrated that the phosphate group can be replaced with a sulfamate group to yield an acyl -sulfamide (compound 2 ), which was previously shown to be a high nanomolar inhibitor of hASNS (81) Therefore, we decided to prepare and characterize funct ionalized sulfoximines 3 and 4 (Figure 2 1 ). Sulfoximine 3 where an amine connects the sulfur to the ribose ring, was preferred to adenosylsulfamate 4 because of the tendency of 4 to cyclize to form cycloadenosine due to the leaving group ability of the sulfamate group (87 ). Synthesis of compounds 3 and 4 was completed by Hideyuki Ikeuchi and Jun Hiratake at the Institute of Chemical Research, Kyoto University, Kyoto, Japan and details of the synthetic route can be found in (44 ). This chapter will report of the ability of 3 and 4 to act as inhibitors of hASNS in vitro.

PAGE 38

38 Figure 21. Chemical structures of adenylated sulfoximine derivative 1 and aden ylated sulfamide 2 which are nanomolar inhibitors of hASNS. Chemical structures of adenylated sulfoximine derivatives 3 and 4 the novel compounds to be characterized

PAGE 39

39 Results and D iscussion The effect of sulfoximine 3 (as a mixture of four diastereoisomers) on ammonia and glutamine dependent asparagine synthesis was assayed by measuring the rate of inorganic pyrophosphate (PPi) production ( 88) (Figures 2 -2 and 23) Although the compound exhibited slow onset kinetics (89 ), these experiments showed that 3 was a much less effective inhibitor of h ASNS than the adenylated sulfoximine 1 A control experiment confirmed that 3 did not affect the coupling enzyme. The observed progress curves were analyzed using a standard kinetic model for slow onset inhibition ( 89 ), where it is assumed that the inhibitor binds to the free enzyme and is competitive with ATP, as was shown previously for functionalized sulfoximine 1 (25 ). C urve fitting gave values for k5 and k6 of 0.0024 0.0004 s1 and 0.0025 0.0005 s1, respecti vely, and values of 20 10 M and 10 6 M for KI and KI*, respectively, when glutamine was used as a nitrogen source Although this compound was assayed as a mixture of four diastereoisomers there is strong evidence that tight binding inhibition of functionalized sulfoximines show stereochemical dependence ( 82, 90, 91 ). When diastereoisomeric and/or enantiomeric sulfoximine deriv atives have been separated, one enatiomer acts as a potent inhibitor; wheras the other enatiom er shows weak inhibition (92, 93) This idea is supported by experimental ( 94) and computational ( 95) studies involving serine proteases, where hydrogen bonds stabilize one epimer of th e tetrahedral intermediate when activated carbonyls are attacked by nucleophiles. Therefore, if only one of the four d iastereoisomers of 3 is active, then the KI* value for the resolved compound would be expected to be approximately four fold lower However, this represents a KI* value

PAGE 40

40 Figure 22. Ammonia dependent production of PPi in the presence of increasing amounts of the functionalized sulfoximine 3 : open circles, 0 M; open squares, 10 M; open diamonds, 50 M; crosses, 100 M; closed diamonds, 500 M; closed triangles, 1 mM; closed circles, 10 M N adenylated sulfoximine 1. Solid lines represent the best fit lines using equation ( 2 -1) (see experimental section).

PAGE 41

41 Figure 23. Glutamine dependent production of PPi in the presence of increasing amounts of the functionalized sulfoximine 3 : open circles, 0 M; open squares, 10 M; open diamonds, 50 M; crosses, 100 M; closed diamonds, 500 M; closed triangles, 1 mM; closed circles, 10 M N adenylated sulfoximine 1. Solid lines represent the best fit lines using equation (1) (see experimental section).

PAGE 42

42 that i s three orders of magnitude higher than the adenylated sulfoximine 1 indicating this compound is a much weaker inhibitor of h ASNS than the previously studied sulfoximine 1 Given the significant increase in KI and the difficulty in finding chromatographic conditions to s eparate sulfoximine 3 we decide to pursue the characterization of functionalized sulfoximine 4 There are numerous examples of potent inhibitors where the phosphate moiety has been replaced by either sulfamide or sulfamate functional groups (96 -98 ), including the acylsulfonamide 2 which showed sub mic romolar potency in human ASNS ( 81 ). Surprisingly, t hese experiments showed that the functionalized sulfamate 4 had no effect on either the ammonia or glutamine dependent synthetase activity of the human enzyme at concentrat ions up to 1 mM (Figures 24 and 25). An important control experiment was performed in the presence and absence of 1 mM of 3 and 4 to verify that neither compound perturbed the 1:1 Asn:PPi ratio by stimulating ATP hydrolysis. It was found, within experimental error, that neither compound affect ed the Asn: PPi ratio (Figure 26). Comparison of the previously characterized nanomolar inhibitors with the observations made here are consistent with a model where the presence of a negative charge on the phosphate group of the AspAMP intermediate is essential to ligand recognition by the synt hetase site of human ASNS. This conclusion, however, assume s that the compounds bind in a similar or identical fashion within the synthetase active site. T he adenosyl moieties will most certainly bind within the well-defined ATP pocket, which is very tightly defined to ensure the use of ATP rather than GTP as a substrate (99) Furthermore, previous studies indicate that ASNS binds the carboxylate and

PAGE 43

43 Figure 24. Ammonia dependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4 : open circles, 0 M; open squares, 10 M; open diamonds, 50 M; crosses, 100 M; closed diamonds, 500 M; closed triangles, 1 mM. Solid line represents the linear production of PPi as a function of time in the absence of inhibitor for ASNS.

PAGE 44

44 Figure 25. Glutamine dependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4 : open circles, 0 M; open squares, 10 M; open diamonds, 50 M; crosses, 100 M ; closed diamonds, 500 M; closed triangles, 1 mM. Solid line represents the linear production of PPi as a function of time in the absence of inhibitor for ASNS

PAGE 45

45 Figure 26. Ratio of asparagine to pyrophosphate production (M) in the presence and absence of 1 mM of inhibitor. A) Asparagine to pyrophosphate prodution in the presence and absences of f unctionalized sulfoximine 3 B) Asparagine to pyrophosphate production in the presence and absences of functionalized sulfoximine 4 Error bars represent the standard deviation of three individual experiments. 0 10 20 30 40 50 600 mM 3 1 mM 3M 0 5 10 15 20 25 30 35 40 0 mM 4 1 mM 4 M A B

PAGE 46

46 amino groups of a spartate with high specificity ( 76) Therefore, because the adenylated sulfoximine 1 bears an ionized phosphoramidate moiety, it can bind to the synthetase active site with high affinity, and is the most potent inhibitor o f h ASNS reported t o date. The functionalized sulfamate 2 and sulfamide 3 derivatives can only form this interaction within the active site if they bind as their nega tively charged conjugate bases (Figure 27) The pKa of the sulfamate 2 NH, based on chemical consideration is expected to be much lower than that of sulfamide 3 thus resulting in sulfamate 2 acting as a more potent inhibitor than that of sulfamide 3 Sulfamate inhibitor studies on the adenylating enzyme, MbtA ( 100) from Mycobacterium tuberculosis quantified the acylsulfamate linkage of a N -benzoyl derivative 5 as 2.8 (Figure 28) ( 101). Therefore, the pKa of N acylsulfamate 2 is likely in the range of 4 5 because the carbonyl group on 2 is less electron deficient. T he pKas of methansulfonamide and sulfanilamide are 10.87 and 10.43 (Figure 2 8) respectively, thus the pKa of fuctionalized sulfamide 3 is likely in the range of 9 10. Therefore, under the conditions used in the assay, pH 8.0, more N acylsulfamate 2 is present in the ionized form than the N acylsulfamide 3 which leads to a lower KI* value. Finally, this model explains why functionalized sulfamate 4 cannot act as an inhibitor of hASNS. The absence of an ionizable group in 4 means that this compound can only interact with the enzyme in its neutral form and thus cannot bind within the active site. This model is consistent with a intermediate is bound within the synthetase active site of Escherchia coli AS -B (Ding, unpublished). Although the model is based on the E. coli variant, all residues within the

PAGE 47

47 Figure 27. Conjugate base of the functionalized acylsulfamate 2 and functionalized acyl sulfamide 3 Figure 28. Chemical s tructure s of N benzoylsulfamate 5 (101 ), sulfanilamide a nd methanesulfonamide compounds that were used to estimate pKa values of 2 and 3

PAGE 48

48 active site are conserved. In this model, a lysine residue, 449 (E. coli numbering), which corresponds to Lys 466 in the human enzyme, is positioned directly above the pho sphate gro9). This residue is fully conserved in all known glutaminedependent asparagine synthetases, which suggests that this electrostatic interaction is critical for ATP binding and catalysis. This is further supported by sitedirected mutagenesis of the Lys 449 in E. coli to alanine and arginine. The arginine mutant retained glutaminase activity similar to the wild type indicating that the overall protein structure was intact. However, the al anine mutant showed significant deviations from wild type behavior suggesting the overall integrity of the protein had been compromised (Table 2-1). Both mutants lacked any detectable levels of synthetase activity, even at elevated levels of ATP. W ith no f urther means with which to assay the synthetase activity of the K449A/R mutants of AS -B, all we can conclude is that this residue is critical for enzyme catalysis Table 2 1. Glutaminase activity of Wild-type AS -B and K449 mutants Enzyme Km (app) Gln (m M) kcat (s1) kcat/Km (M1 s1) Wild Type 2.4 0.2 2.2 0.1 9 20 K449R 1.9 0.3 3.1 0.1 16 00 K449A 29 7 1.3 0.2 4 5 Recent work on the evolutionarily related enzymes, LS and carbapenam synthetase (CPS) further confirmed the importance of this conserved lysine residue in the reaction mechanism. Crystallographic snapshots of showed that Lys -443 (corresponds to Lys 449 or Lys 466 in ASNS) is hydrogen bonded to the nonbridging -phosphate of ATP (74, 75 ) -lactam carbonyl oxygen of DG PC. It was proposed through site-directed mutagenesis and pH dependent studies

PAGE 49

49 Figure 29 The interaction between the Lys -449 side chain and the phosphate group of the AspAMP intermediate (both shown in stick representations) in a computational model of the AS -B/Gln/acyl adenylate complex (Ding, unpublished). The protein backbone is shown by the blue ribbon. Color scheme: C, green; H, white; N, blue; O, red; P, orange. This image was generated in PYMOL ( 73 ). Lys 449 AspAMP

PAGE 50

50 -lactam synthesis( 102). In addition, recent work on carbapenam synthetase (CPS), another evolutionarily related enzyme, demonstated that mutation of Lys 443 to alanine and methionine results in complete loss of activity ; it was proposed to act as a gen eral acid in the mechanism and to be required for stabilization of the intermediate (103) W e conclude that potent inhibitors of ASNS must possess functional groups that mimic the negative charge of the phosphate group in order to maintain this critical interaction with the lysine side chain This is an important finding for the future design of sulfoximine derived libraries and future ASNS inhibitors that can be easily taken up into leukemia cells. Experimental Section Materials Functionalized sulfoximines 3 and 4 were synthesized and generously provided by Hidey uki Ikeuchi and Jun Hiratake at the Institute for Chemical Research, Kyoto, Japan. Details of the sy nthesis can be found in the following reference (44 ). Unless otherwise stated, all chemicals and reagents were purchased from Sigma Aldrich (St. Louis, MO) and were of the highest purity available. Protein concentrations were dete rmined using the Bradford Assay (104) (Pierce, Rockford, IL), and are cor rected as previously described ( 47) L -glutamine was recrystallized prio r to use in all kinetic assays ( 47) PCR primers were obtained from Integrated DNA technologies, Inc (Coraville, IA) and DNA sequencing reactions were performed by the DNA sequencing core of the Interdisciplinary Center for Biotechnology Research at the Universit y of Florida (Gainesville, FL).

PAGE 51

51 Expression and Purification of Recombinant Human Asparagine S ynthetase C -terminal ly tagged recombinant human asparagine synthetase was expressed and purified from Sf9 cells as previously described ( 43) Briefly, 1 L of Sf9 cells at 1 x 106 cells/ mL were infected at a MOI of 1 with recombinant baculovirus containing the h asns insert Cells were harvested 64 hours post infection by centrifugation at 2,000 x g for 10 min. The cellular pellet was lysed by sonication and cellular debris removed by centrifugation at 50, 000 x g for 20 min The resulting supernatant was filtered using a 0.45 m filter and loaded onto a 3 mL Ni -NTA (Qiagen Valencia, CA ) column equilibrated with lysis buffer (50 mM EPPS, pH 8.0, 300 mM NaCl, 1% triton X, 10 mM imidazole, and 1 mM DTT) Human ASNS was eluted using buffer containing 50 mM EPPS, pH 8.0, 300 mM NaCl, 250 mM imidazole, and 1 mM DTT. Fractions containing human ASNS were identified by SDS -PAGE, pooled and dialyzed exhaustively versus 50 mM EPPS, pH 8.0, 100 mM NaCl, and 5 mM DTT. Glycerol was added to 20% final concentration and the protein was stored at -80 C Enzyme Assays The ability of 3 and 4 to inhibit ASNS was measured by monitoring their effect on the production of PPi under steady state conditions. Production of PPi was determined using a continuous based assay (88 ) in which the production of PPi is co upled to the consumption of NADH monitored at 340 nm (Sigma Technical Bulletin B1-100). The concentration of sulfamide derivative 3 was varied (0, 10, 50, 100, 500, 1000 M) in the presence of 100 mM EPPS, pH 8.0, 0.5 mM ATP, 25 mM L-Gln or 100 mM NH4Cl, 10 mM L -Asp, 10 m g M MgCl2, and 350 L of pyrophosphate reagent (1 mL final volume). The reaction was initiated by the addition of 2 g of ASNS and the production of PPi monitored spectrophot ometrically at 37 C for 20 min. S ulfamate derivative 4

PAGE 52

52 was examined under identical conditions, except that progress curves were generated at 25 C because this compound can undergo cyclization to form the cycloadenosine at higher temperatures. Each data point represents the average of triplicate experiments. Co ntrol experiments using known amounts of PPi in the presence of 3 and 4 confirmed that coupling reagent was unaffected by the presence of the inhibitors. Progress curves were analyzed by fitting the data, using the Kaleidagraph v3.5 software pack age (Syner gy, Reading, PA), to equation 2 -1 (89 ) where [PPi] is the concentration of inorganic pyrophosphate formed at time t, vo and vss are the initial and steady -state rates, respectivel y, and k is th e apparent first o rder rate constant for the isomerization of EI to EI*. [ PPi] = + ( 0 ) ( 1 ) (2 -1) It was assumed that compound 3 binds to the free enzyme and is competitive with respect to ATP, in accordance with the known behavior of the adenylated sulfoximine 1 (25) as shown in the kinetic model for slow onset inhibition (Figure 2 -10) (89 ): Values for k vo and vss were obtained by curve fitting to equation 2 1 for each concentration of the functionalized sulfoximine 3 and used to compute an estimate of k6, using equation 2 -2. 6= 0 (2 -2) Using the calculated value for k6 the values of KI and k5 were determined by fitting the variation of k wit h the concentration of 3 using equation 23, where I is the concentration of the inhibitor, Ka is the Km for ATP (0.1 mM) (43 ), and [ATP] = 0.5 mM. k = k6+ k5 I K I ( 1 +[ ATP ] K a + I / KI (2 -3)

PAGE 53

53 Figure 2 10. Kinetic model for slow onset inhibition

PAGE 54

54 The overall inhibition constant, KI* was t hen computed using equation 2 4. Error measurements on KI, KI *l, k5, and k6 represent the error in the fit. = 65+ 6 (2 -4) An HPLC b ased assay (47 ) was performed to measure the amount of L asparagine produced under the cond itions of the inhibitor assay. Recombinant human ASNS (2 g) was incubated in the presence and absence of 1 mM of compound 3 or 4 (at 37 C and 25 C respectively) for 20 minutes in 100 mM EPPS, pH 8.0, contai ning 0.5 mM ATP, 100 mM NH4Cl, 10 mM MgCl2, 10 mM aspartic acid (1 mL total volume). The reaction was quenched with tricholoroacetic acid (TCA) to a final concentration of 4% (v/v) Following enzyme precipitation, the solution was neutralized using 10 M Na OH, and a portion of the reaction mixture (40 L) was taken for derivatization in a mixture of 400 mM Na2CO3 buffer, pH 9 (80 L), DMSO (20 L), and a solution of 1 -fluoro 2,4 dinitrobenzene ( DNFB ) dissolved in absolute ethanol (60 L). This reaction was incubated at 50 C for 50 min befo re the addition of glacial acetic acid to quench the reaction. The derivitized reaction mixture was separated by reverse phase HPLC on a Varian C18 Microsorb column (Varian, Palo Alto, CA) using a step gradient of 40 mM formic acid, pH 3.6, and CH3CN. DNP -L asparagine was detected at 365 nm and quantified by comparison to asparagine derivatized in the same manner. Cloning, Expression, P urification, and C haracterization of K449 M utants Site -directed mutagenesis of residue K449 to arginine and alanine in AS-B was completed using Quick Change Mutagenesis kit (Stratagene La Jolla, CA ). The pET 21c (+) vector (Novagen San Diego, CA ) containing the asnb insert followed by a 6X poly histidine tag was used as a template and t he primers were designed to introduce

PAGE 55

55 the respective mutation (see appendix B for primer sequences). Each PCR consisted of the appropriate primer pairs (~125 ng of each primer), 10 ng of pET -21c (+) vector containing the asnb insert followed by a 6X poly h istidine tag, 1X Pfu turbo buffer, 20 M dNTPs, and 1 L of Pfu turbo DNA polymerase (2.5U) in a 50 L volume. The reaction was heated to 95 C for 30 sec, followed by 15 cycles of 95 C for 30 sec, 55 C for 1 min, and 68 C for 8 min. A final extension at 68 C was performed for 10 minutes following the 15 cycles. The reaction mixture was treated with 1 L of Dpn1 (New England Biolabs Ipswich, MA ) at 37 C for 1 hr in order to digest the methylated template DNA. Super competent JM109 E. coli were subsequently transformed with nicked plasmid containing the desired mutation. P lasmid DNA isolated from successful transformants was sent for sequencing to confirm the desired mutation. Expression of K449R and K449A was performed as previously descr ibed for AS B( 51) and purified by Ni -NTA affinity chromatography following the same protocol as described in chapter 3. Glutaminase activity was determined by an endpoint assay in which the glutamate produced in the reaction is converted by L ketoglutarate in a reaction that reduces a molecule of NAD+ to NADH. Reaction mixtures (100 mM EPPS, pH 8.0, 100 mM NaCl, 8 mM MgCl2, and 0.2-50 mM o f L -glutamine in a 200 L total volume) wer e initiated by the addition of 1.5 g of enzyme and run for 20 minutes at 37 C before quenching with TCA to a final concentration of 4%. This solution was added to a solution containing 300 mM glycine -250 mM hydrazine buffer, pH 9.0, 1.5 mM NAD+, and 1 mM ADP followed by the addition of 2 units of L -glutamic dehydrogenase in a final volume of 500 L (Sigma G2626). Absorbance readings at 340 nm were taken after 30 minutes and corrected for the absorbance at 340 nm before the

PAGE 56

56 addition of coupling enzyme. The amount of glutamate produced was quantified by comp arison to glutamate standards. Error represents the error in the fit.

PAGE 57

57 CHAPTER 3 FUNCTIONAL ROLE OF A CONSERVED ACTIVE SITE GLUTAMATE IN GLUTAMINE -DEPENDENT ASPARAGINE SYNTHETASE FROM E scherichia coli Introduction Potent inhibitors of asparagine synthetase ( ASNS) are useful tools to study the inverse correlation between ASNS activity and L asparagi nase resist ance in acute lymphoblastic leukemia ( ALL) patients and represent a viable method for the treatment of L aspar a ginase resistant ALL patients (84 ). Using information obtained from kinetic studies of AS B as well as structural information obt ained from an x -ray crystal structure of AS -B, o ur group has recently reported two mechanism based, potent inhibitors of ASNS ( 25, 81) that are nanomolar inhibitors of the enzyme. However, analogs of these compounds lacked a localized negative charge found to be critical to inhibitor binding (44 ). This findin g highlights the importance of understanding the crit ical interactions in the synthetase active within the context of the enzymatic mechanism. As part of th is work, computational studies involving the N adenylated sulfoximine, a potent transition state analogue of E. coli asparagine synthetase A ( 82 ), E. coli asparagine synthetase B ( 83) and human asparagine synthetase ( 25) found that one diastereoisomer could be positioned correctly in the synthetase active site of the glutamine dependent asparagine synthetase from E. coli (AS-B) relative to the base of the tunnel (84 ). In this computational model (Figure 31), a glutamate residue is positioned dir ectly below the methyl group, thus possibly acting as a mimic for the nucleophilic attack of ammonia. This glutam ate residue (E348) is fully conserved in all known glutamine dependent asparagine synthetase s and represents the only charged residue within the interio r of the intramolecular tunnel.

PAGE 58

58 Figure 31 Computational model of the N adenylated sulfoximine inh ibitor docked into the synthetase site of AS -B. Note the close distance (approximately 4 ) between t he carboxylate side chain of E 348 and the electron deficient methyl group (cyan) of the adenylated sulfoximine. Computational model was generated by Dr. N igel Richards and figure modified from ( 84) Image rendered in PyMO L ( 73 ).

PAGE 59

59 Furthermore, in the proposed mechanism of asparagine synthetase, the carboxylate side chain of aspartate is adenylated by ATP to form the Asp AMP intermediate (46 ). Ammonia produced from the hydrol ysis of glutamine, travels through the intramolecular tunnel to the synthetase domain where it attacks the AspAMP intermediate to produce AMP a nd asparagine v ia a tetrahedral intermediate. One consequence of this mechanism is the need for the ammonia mol ecule to be deprotonated in the tetrahedral transition state before asparagine and AMP can be formed (Figure 32). Therefore, we hypothesized that this conserved glutamate residue act s as the general base for the deprotonation of ammonia in the transition state. In support of this hypothesis, recent wor k on the evolutionarily related enzymes -lactam synthetase ( LS) and carbapenam synthetase (CPS) identified a conserved tyrosyl glutam yl catalytic dyad that was found to be the critical base leading to -lactam formation ( 105). ASB, LS and CPS catalyze acyl adenylation of their substrate to form an activated intermediate; however LS and CPS catalyze intramolecular attac k wi th a secondary amine rather than intermolecular attack with ammonia, as in AS -B (Figure 33A). Alanine mutants of the tyrosine and glutamate residues in LS and CPS catalyze the first half -reacti on ( acyl adenylation) but cannot catalyze the second hal f reaction (nucel eophilic acyl substitution, i.e., lactam formation) This supports the role of these residues as a general base for deprotonation of the secondary amine leading to -lactam formation. Based on sequence alignments and a structural overlay of the enzymes, this catalytic dyad (Y345 and E380 in CPS and Y348 and E382 in LS is replaced by residues E348 and D384 in AS B (Figure 33B) (105) Residue D348 is involved in binding the amine of aspartic acid ( 74) and mutagenesis of this residue

PAGE 60

60 Figure 32. Proposed reaction mechanism for the synthetase reaction of ASNS attacked by ammonia to form asparagine and AMP via a tetrahedral intermediate.

PAGE 61

61 Figure 33. AS-B, CPS, and LS catalyze similar reactions and utilize conserved residues for chemistry. A) Reactions catalyzed by AS -B, LS, and CPS B) Structural overlay of the conserved catalytic dyad in LS (Y348 and E382) and CPS (Y345 and E380) with the substituted residues in AS B (E348 and D348). AS -B (pdb 1CT9) LS (pdb 1MBZ) and CPS (pdb 1Q19) are shown in yellow, blue, and green, respectively. Figure modified from ( 105). Image rendered in PyMOL ( 73 ). A B

PAGE 62

62 resulted in loss of all synthetase activity However, E348 may act as the general base necessary for asparagine formation and thus represent a critical divergence in the structure of asparagine synthesizing enzymes and how their chemistry is altered to perform intermolecular attack with ammonia. This chapter presents a detailed mechanistic study of this conserved glutamate residue (E348) of the glutaminedep endent asparagine synthetase from E. coli (AS-B). Substitution of this glutamate residue to a lanine, aspartate, and glutamine probed the functional role of this conserved residue. T hrough the use of steady state kinetics and 18O -isotope labeling studies, the functional role of this conserved residue was examined in the cont e xt of the reaction mechanism Results Cloning of asnB to Contain a C -terminal Poly -histidine Tag Previous stu dies (77 ) involving E348D and E348A substituted AS -B proteins resulted in conflicting and unreliable results that indicated the presence of a contaminant in the enzyme stock due to the purific ation procedure. Therefore, a poly histidine tag for purification by immobilized metal -ion affinity chromatography (IMAC) was added to the protein construct The asnB gene was previously cloned in to the pET -2 1c (+) vector using the Nde1 restriction site However, the pET 21c (+) vector contains an optional C -terminal poly -histidine tag and r emoval of the plasmid DNA fragment between the 3 end of the asnB gene and the vectors poly histidine tag resulted in a gene that encodes for a C terminal poly histidine tagged AS -B protein (Figure 34A). A thrombin site was also engineered between the asnB gene and the poly histidine tag for removal of t he tag, if desired. Upon re -construction of the vector, the HindIII restriction site was destroyed, which allowed fo r screening of the desired

PAGE 63

63 Figure 34 Construction of pET -21 c (+) vector to contain a poly histidine tag. A) Cloning str ategy for placing the optional C terminal poly -histidine tag directly after asnB (B) 1% DNA agarose gel stained with ethidium bromide of pET -21c (+) vector containing tagged and untagged asnB Lane 1 is the 1 kb DNA ladder. Lanes 24 are the vector containing un-tagged asnB uncut, cut with Nde1, and cut with HindIII, respectively. Lanes 5 7 are the vector containing tagged asnB uncut, cut with Nde1, and cut with HindIII, respectively. Note that Nde1 cuts the vector twice due to an Nde1 site within the asnB gene. A B

PAGE 64

64 clone by restriction digest analysis (Figure 34B). The vector containing the untagged asnB is linearized by both Nde1 and HindIII restriction enzymes (lanes 3 and 4) whereas the vector with the poly histidine tag in frame with asnB cannot be cut with HindIII. The final clone was isolated and fully sequenced to confirm the addition of the thrombin site and C -terminal poly histidine tag. Expression and P urification His6-tagged AS B and E348 Mutants The pET -21c (+) expression vector places asnB under control of the T7 lac promoter (106) and when established in a DE3 lysogen, such as BL21(DE3) E. coli cells, is inducible by IPTG (107 ). Upon addition of IPTG, T7 RNA polymerase is transcribe d by the E. coli RNA polymerase which then readily transcribes the asnB gene ultimately resulting in overexpression of the target protein The cells are then collected and lysed for purification of the soluble protein. The addition of a C -terminal poly histidine tagged greatly aided in the purification procedure, resulting in pur e protein using a Ni -NTA affinity column (Fig ure 3 -5 ). Although some protein was lost in the flow through and wash fractions approximately 20 mg of purified enzyme per liter of cell culture was obtained. A silver stained SDS PAGE gel indicated that no c ontaminating proteins were detected in the purified His6tagged AS -B and E348 mutants whereas a large amount of contaminating proteins are evident when no purification tag was used (Figure 36 ). Characterization of His6-tagged AS B His6-tagged AS B was assayed for steady -state kinetic parameters to ensure the addition of a C -terminal tag did not affect enzyme catalysis. It was previously reported that placing a C -terminal tag on human asparagine synthetase displayed reproducible steady -state kinetic parameters ( 43 ). His6-tagged AS -B demonstrated reproducible

PAGE 65

65 Figure 35. Purification of His6tagged AS -B using IMAC. Lane 1: Protein molecular weight marker, lane 2: whole cell fraction 3 hours post induction, lane 3: lysate, lane 4: cleared lysate, lane 5: IMAC column flow though, lane 6: wash fraction, lane 7: pooled elution fractions. Gel sta ined with Commassie Brillant blue. Details of the purification procedures can be found in materials and methods. The molecular weight of His6tagged AS -B is 64 kDa

PAGE 66

66 Figure 36 Silver stained SDS -PAGE gel of untagged and His6-tagged AS -B and E348 mu tants. Lane 1: Protein molecular weight marker, lane 2: untagged AS -B, lane 3: His6-tagged AS -B, lane 4: His6tagged E348D, lane 5: His6-tagged E348A, lane 6: His6-tagged E348Q. Approximately 2 g of each protein was loaded into each lane.

PAGE 67

67 kinetic par ameters for both the ammonia and glutamine dependent activities (Table 3 -1) as well as the glutaminase activity (Table 3 -2). Overall, the values for KM (app) are in agreement with the previously reported kinetic parameters for untagged AS B ( 47, 108). For instance, the previously reported values of KM (app) for ATP and Asp were 0.26 mM and 0.85 mM, respectively, for glutamine dependent synthetase activity as opposed to the newly reported values of 0.10 mM and 0.58 mM. Th e synthetase activity, kcat, is consistently 2 -fold less than previously reported numbers This reduction in kcat is likely due to removal of a contaminating enzyme that was overestimating the concentration of pyrophosphate produced in the reaction. Howev er, all catalytic efficiencies, measured as kcat/ KM, are similar to those previously reported ( 47, 108 ). Based on these kinetic results placing a C -terminal poly histidine tag on AS -B does not significantly alter enzyme catalysis. Table 3 1. Steady -state kinetic parameters for His6-tagged AS -B determined at pH 8. 0 K M (app) (mM) k cat (s 1 ) k cat / K M (M 1 s 1 ) Ammonia dependent synthetase ATP 0.11 0.03 0.96 0.02 8700 Aspartic Acid 1.2 0.1 (0.53) a 0.75 0.03 (1.09) a 630 (800) a Glutamine dependent synthetase ATP 0.10 0.01 (0.26) b 0.90 0.01 (2.18) b 9000 (8384) b Aspartic Acid 0.58 0.04 (0.85) b 0.67 0.02 (1.56) b 1200 (1835) b a Values in parentheses are the previous values of kinetic constants at pH 8.0 for the ammonia dependent synthetase activity of AS -B reported in ( 108) and values of kcat have been corrected for the overestimation of enzyme concentration by a factor a 2.73 ( 109). b Values in parentheses are the previous values of the kinetic constants as for AS -B reported in (47 ). Glutaminase Acti vity of AS B and E348 Mutants One consequence of site-directed mutagenesis studies is the possibility of gross structural damage to the enzyme caused by the amino acid substitution. ASB is

PAGE 68

68 comprised of two distinct active sites that catalyze distinct rea ctions. Therefore if a point mutation is made in the synthetase domain, the structural integrity of the whole enzyme can be assessed by monitoring the glutaminase activity of the mutant enzyme. If glutaminase activity is unaffected, it is assumed that t he enzyme is correctly folded. Although, this assumes that correct folding of one domain ensures the correct folding of the second domain. All substituted proteins retained glutaminase activi ty similar to the wild type (Table 32 ) indicating that the mut ation does not cause gross structural damage to the enzyme. Although ATP is not required for glutaminase activity, it was previously reported that glutaminase activity is stimulated in the presence of 5 mM ATP ( 110). When 5 mM ATP was added to the reaction, t he specificity constant, kcat/ Km, was stimulated 3-fold for wild type ASB, in accordance with previous results (110) E348D showed a 6 -fold increase in glutaminase activity in the presence of ATP whereas E348A and E348Q showed only minimal stimulation of glutaminase a ctivity in the presence o f ATP. This suggests that E348 may be important for coordination of the two active sites and removal of the negatively charged carboxylate group affects communication between the two active sites. Table 3 2. Kinetic constants for the glutaminase activity of His6-tagged AS B and E348 mutants at pH 8.0 with or without added ATP ATP absent 5.0 mM ATP present K m k cat k cat /K m K m k cat k cat /K m mM s 1 M 1 s 1 mM s 1 M 1 s 1 Wild type a 5.2 1.4 6.2 0.2 1200 1.7 0.5 6.6 0.1 3900 E348D 2.7 0.4 4.09 0.09 1500 1.1 0.2 10.02 0.07 9100 E348A 5.8 0.8 6.37 0.04 1100 3.5 0.7 5.8 0.2 1700 E348Q 5.0 0.9 3.8 0.2 760 4.0 0.3 4.45 0.07 1100 a Previously reported values for glutaminase activity of AS B were reported in ( 47) as 1.67 mM, 3.38 s1 and 2020 M1s1 in the absence of ATP and 1.30 mM, 5.91 s1, and 4540 M1s1 for Km, kcat, and kcat/Km, respectively.

PAGE 69

69 Asparagine, Pyrophosphate, and Glutamate Production Pyrophosphate (PPi) and asparagine are formed in a 1:1 ratio for His6-tagged AS-B in the ammoniadependent (Table 3 3) and glutamine -dependent reactions ( data not shown) in accordance with previous results ( 111). E348D also forms PPi to asparagine in a 1:1 ratio, although at approximately half the rate of wild type. E348A and E348Q produced no detectable level of asparagine and retained very little ability to produce PPi ( less than 10% of wild type activ ity), even when the concentration of aspartic acid was over 100 times Km. Table 3 3 Product ratios for the ammonia and glutaminedependent synthetase activities of His6-tagged AS B and E348 mutants at pH 8.0 measured under saturating substrate conditionsa. Ammonia dependent synthetase Glutamine dependent synthetase Asn PP i Asn: PP i Asn Glu Glu: Asn mol min 1 mg 1 mol min 1 mg 1 Wild type 0.63 0.03 0.59 0.05 1:1 0.1 0.64 0.04 4.6 0.2 7.2: 1 0.5 E348D 0.328 0.007 0.33 0.06 1:1 0.2 0.36 0.04 6.5 0.7 18: 1 3 E348A no Asn 0.04 0.01 --no Asn 2.8 0.3 --E348Q no Asn 0.07 0.0 1 --no Asn 4.1 0.4 --aSaturating conditions were 10 mM Asp, 5 mM ATP, 10 mM MgCl2 and either 100 mM NH4Cl or 20 mM Gln. Production of PPi in the absence of aspartate wa s approximately 10% of activity in the presence of aspartate for the wild type enzyme (Figure 3 -7 ), confirming that the enzyme catalyzes ATP hydrolysis in the absence of aspartate. For E348A and E348Q, the activity in the presence and absence of aspartate was identical Interestingly for E348D, the level of ATP hydrolysis in the absence of aspartate exceeds 50% of the activity in the presence of aspartate for both the glutamine and ammonia-dependent reactions. However when aspartate is present, futile ATP hydrolysis must cease in this mut ant because only one molecule of PPi is produced for every one molecule of asparagine produced (Table 3-3). Although this is an interesting observation, it does

PAGE 70

70 Figure 37. Production of PPi in the presence and absence of aspartate for AS B and E348 mutants. A) Ammonia dependent activity. B) G lutamine-dependent activity. Error bars represent the standard deviation of triplicate measurements. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 WT WT no Asp E348D E348D no Asp E348A E348A no Asp E348Q E348Q no Asp Specific Activity ( mol PPi/min/mg E) 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 WT WT no Asp E348D E348D no Asp E348A E348A no Asp E348Q E348Q no Asp Specific Activity ( mol PPi/min/mg E) B

PAGE 71

71 appear to affect the enzyme when all substrates are present. The amount of PPi produced in the absence of added enzyme was subtracted from all activities. His6-tagged AS B produces 7 molecules of glutamate for each molecule of asparagine produced (Table 3-4). Previous work on AS -B found a Glu:Asn ratio of 1.8:1 for high concentrations of glutamine ( 46, 47 ). W e suspect that the C terminal tag may be affecting this ratio. However, all mutants also contain a C -terminal poly -histidine tag so a direct comparison of properties is possible. E348D further uncouples the Glu:Asn ratio to 18:1; a result of slightly increased glutamate production and decreased production of asparagine. This is highly inefficient as 17 molecules of glutamine (and ammonia) are wasted for the product ion of one molecule of asparagine E348Q produces glutamate at the same level as wild type whereas E348A produces glutamate at approximately 60% of wild type. However, neither E348A n or E348Q produces any detectable levels of asparagine. Therefore, any ammonia (measured by Glu production) produced by this mutant is wasted, as no asparagine can be formed. These results suggest that the formation of the intermediate is slowed in the E348D mutant and impossible for the E348A and E348Q mutants. As a control, the ratio of PPi to asparagine was determined to be 1:1 for His6tagged AS-B and E348D in the glutaminedependent reaction. Kinetic Parameters for E348D mutant Steady -state kinetic parameters for the E348D mutant are shown below in Table 3 -4 Most striking is the 5 -fold reduction of the aspartate KM (app) for both ammonia and glutamine dependent synthetase activity when compared to the His6-tagged wild type AS -B. In addition, there is a reduction of the KM (app) for ATP for both glutamine and ammoniadependent acti vities an effect that is more pronounced in the glutamine-

PAGE 72

72 dependent reaction. In all cases, the kcat was approximately one-half of the wild type in agreement with the measurements of asparagine and PPi production under saturating conditions. The lowering of KM (app) and lowering of kca t causes an overall increase in kcat/ KM an effect that is most pronounced for the glutamine dependent reaction when the concentration of ATP is varied. However, the greatest overall change in kcat/ KM is a 4 -fold difference which corresponds to approximately 3 kc al/mol in energy (112) and is not an overly significant enhancement in the rate. Kinetic parameters were not determined for E348A and E348Q as the production of PPi at low concentrations is below the linear ra nge of the assay. Table 3 4. Kinetic constants for the ammonia and glutaminedependent synthetase activity of His6-tagged AS -B and E348D determined at pH 8.0 ATP Aspartic Acid K m k cat k cat /K m K m k cat k cat /K m mM s 1 M 1 s 1 mM s 1 M 1 s 1 Ammonia dependent synthetase Wild type 0.11 0.03 0.96 0.02 8700 1.2 0.1 0.75 0.03 630 E348D 0.03 0.01 0.43 0.03 14000 0.23 0.07 0.30 0.02 1304 Glutamine dependent synthetase Wild type 0.10 0.01 0.90 0.01 9000 0.58 0.04 0.67 0.02 1200 E348D 0.013 0.004 0.51 0.02 39000 0.13 0.01 0.451 0.007 3500 18O transfer experiments 18O transfer experiments can be us ed to verify the formation of acyl adenylated intermediates by phosphorous NMR. When an 18O -labeled substrate (such as aspartic acid) is used and an acyl adenylated intermediate is formed, the 18O label is transferred from the substrate to AMP u pon breakdown of the intermediate (Figure 3-8 ). 31P NMR is used to detect this transfer as a phosphorous bonded to 18O has a h igher chemical shift (0.02 ppm) than a phosphorous bonded to 16O ( 113). In 1998, Bo e hlein et al. used 18O -labeled aspartic acid to confirm the formation of the AspAMP intermediate in the

PAGE 73

73 Figure 38. 18O transfer reaction using 18O labeled aspartic acid. Upon formation of the aspartyl AMP intermediate the 18O -label is transferred to AMP. Figure 39. 31P NMR spectrum (300 MHz) of the reaction mixture obtained with His6-tagged ASB and 18O labeled aspartate acid. Peaks are referenced to -phosphorous of ATP. The peaks for 18O and 16O labeled AMP are separated by 0.02 ppm (inset). 18O16O AMP

PAGE 74

74 AS-B reaction via 31P-NMR ( 46). This technique was used to characterize His6-tagged AS-B and the E348 mutants on t heir ability to form the AspAMP intermediate. Incubation of His6-tagged AS B with 18O labeled aspartic acid, ATP, and ammonia produced a spectrum that consisted of 10 peaks (Figure 39). Seven of the peaks can be attributed to unreacted ATP (using -P at 10.14 ppm, and a doublet for the -P at 15.50 ppm. Two peaks, separated by 0.02 ppm, were observed for AMP, which confirms the formation of the intermediate (Figure 3 -9 inset) (113115). The remaining peak is for PPi a singlet at 15.11 ppm, ( 115) I dentification of the 18O labeled AMP peak was confirmed by the addition of 16O AMP. When E348D was incubated with 18O labeled a spartic acid, ATP, and ammonia, the same 10 peaks were produced (Figure 3-10). In addition, two peaks separated by 0.02 ppm, were observed for the AMP peak, indicating the formation of the intermediate in this mutant. T he relative levels of AMP and PPi are decreased, in accordance with the reduced synthetase activity of this mutant (Figure 3-12). In co ntrast, the spectr um for E348A (Figure 3 11) consisted of only unreacted ATP indicating that no detectable levels of AMP or PPi were produced in this reaction. Although this result, along with kinetic studies, suggests that this mutant cannot for the AspAMP intermediate, positional isotope exchange was used in an effort to verify that E348A cannot for the intermediate. Positional Isotope Exchange Positional isotope exchange (PIX) was first used as a mechanistic tool to investigate the reaction cataly zed by glutamine synthetase (116 ) and has since been used extensively as a tool to understand mec hanisms for a variety of enzyme-catalyzed reactions, most notably those that utilize ATP as a substrate (117 -120 ). PIX is used to

PAGE 75

75 Figure 310 31PNMR spectrum (300 MHz) of the reaction mixture obtained from 18O labeled aspartate and E348D phosphorous of ATP. The peaks for 18O and 16O labeled AMP are separated by 0.02 ppm (inset). 16O18O AMP

PAGE 76

76 Figure 3 11 31P NMR spectrum (300 MHz) of reac tion mixture obtained from E348A mutant. No detectable levels of AMP or PPi was produced in the reaction.

PAGE 77

77 Figure 3 12 Comparison of the relative amounts of each 31P containing compound detected in wild type -P of ATP was the smallest peak detected and set as a value of 1. 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 P ATP P ATP P ATP PPi AMP Relative amount 31P nuclei Wild type E348D E348A

PAGE 78

78 study a reaction in which one of the functional groups within a substrate becomes torsionally equivalent upon formation of an intermediate; thus, it is ideally suited for reactions in which phosphate or PPi is formed during the reaction. The use of isotopicall y labeled ATP and the coupling of this technique to 31P NMR allows for easy detection of the PIX ( 114) due to the change in chemical shift when an 18O is bonded to the phosphorous of ATP (113) The two possible PIX reactions cat alyzed by AS -B are detailed in F igure 3 13. Incubation of AS -B in the presence of [ -18O6] -ATP and a spartic ac id (in the absence of a nitrogen source), results in formation of the AspAMP intermediate and PPi (46 ). Upon formation of PPi, t he 18O labels on this molecule scramble either by rotation around the original -phosphorous or by flipping within the active site. If the reaction is reversible and rotation occurs, upon reformation of ATP the 18O label has a 67% chance of being incorporated into the -bridging oxygen and lost from one of the non-bridging oxygens. If PPi can flip within the active site or dissociate from the active site, the 18O -label will again be transferred to the -bridging oxygen but a 16O will be found in the p osition. If both rotation and flipping are possible, a mixture of the two results will be obtained. However, it is possible that the rotation of oxygen around the PPi is restricted or formation of the intermediate is not fully reversible. In either of t hese cases, no PIX will be observed. No change was observed in the -P peak of ATP when [ -18O6] ATP was incubated for 3.5 hours with aspartic acid and either His6-tagged AS B, E348A or E348D in the absence of a nitrogen source (Figure 3 -14 A). Furthermore, no change was detected upon the addition of His6tagged AS -B, E348A, or E348D in the relative

PAGE 79

79 Figure 313. Two possible PIX reactions catalyzed by AS -B.

PAGE 80

80 Figure 314. No PIX was observed for Wild-type, E348A, or E348D after 3.5 hours. A) 31P NMR spectra of the -P of ATP. B) 31P NMR spectra of the P of ATP. A B

PAGE 81

81 size of the 18O or 16O peak for the -P peak of ATP (Figure 3 -14B). Taken together, this suggests that no PIX occurred for either His6-tagged AS -B, E348A or E348D. Importantly, a control experiment confirmed that the addition of EDTA quenched the reaction by measuring the peak area of Asn by HPLC following the standard quench (4% TCA) versus the peak area after quenching with EDTA. The peak areas were found to be 960 90 and 930 6 for the TCA and EDTA quench, respectively. Discussion Characterization of His6AS B Previous work in our lab involving this residue gave conflicting results due to the presence of a contaminant in the purif ied enzyme stock that became evident during the slow turnover of the alanine mutant. The addition of a C -terminal His6-tag removed this contaminant while retaining similar kinetic constants to those in the literature (46, 121) Surprisingly AS-B will hydrolyze ATP to AMP and PPi in the absence of aspartic acid ; however, because the Asn:PPi ratio is 1:1, this hydrolysis must cease when aspartic acid is present Further confirmation of the purity of the enzyme was determined from the 31P NMR spectrum. F or the first time, the products of the reaction, AMP and PPi were detected using 31P NMR for both wild type and E348D enzymes (Figures 39 and 3 -10) confirming the removal of the pyrophosphatase contaminant ( 46 ). Previous work involving A S -B resulted in 31P NMR spectra with signals for ADP, further indicating contamination in the enzyme stock which complicated interpretation of kinetic data ( 77). The 31P NMR spectra collected using the His6-tagged enzymes contain peaks for only the substrates and products of the reaction, indicating the enzyme purification is free of interfering contaminants.

PAGE 82

82 Previous studies on AS -B found that the product ion of glutamate and asparagine was not strictly coordinated, resulting in glutamine hydrolysis without the production of asparagine. When the concentration of glutamine is high, the glutamate to asparagine ratio was reported as 1.8:1 for AS -B ( 47) This uncoupling of activities is in contrast to most other class II amidotransferases, such as IGPS ( 122) and CPS (123, 124), where the glutaminase and synthetase activities are well coordinated. The addition of a C -terminal His6-tag further uncoupled these activities to prod uce 7 molecules of glutamate per molecule of asparagine. Unfortunately, the crystal structure of AS -B (99 ) is missing the last 40 amino acid residues and it is therefore difficult to imagine where the C -terminal tag is located with respect to the synthetase site. A ttempts to remove the tag were unsuccessful However, because all kinetic constant s and product ratios are compared to His6-tagged AS -B, a direct comparison is possible. It is interesting to note that this further uncoupling of activities was not seen when a C -terminal tag was placed on hASNS ( 25) and represents another slight differ ence between the two enzymes Steady -State Kinetic Assays with E348 mutants G lutaminase activity is stimulated 3 -fold in the wild type enzyme upon the addition of 5 mM ATP, in accordance with previous results ( 121). However, t his effect is more pronounced in the E348D mutant (Table 3 -2) The 6-fold increase in the glutaminase activity upon the addition of 5 mM ATP in E348D suggests that mutagenesis of this residue chan ges the coordination between the two active sites. E348 is the only charged residue at the base of the intramolecular tunnel and may act as a gatekeeper for access to the intermediate (Figur e 315 ). When ATP is present, glutaminase activity is switched on (possibly by a conformational change ) and more glutamate (and hence ammonia) is produced. In the case of E348A and E348Q, the

PAGE 83

83 Figure 315 E 348 is the only charged residue at the base of the intramolecular tunnel. Glutaminase and syntheta se domain are shown as ribbons in blue and cyan, respectively. AMP and glutamine are rendered as spheres and selected residues (R 30, A 399 V401, M329, L232, and E348) are shown as sticks. Color scheme: C green, N blue, O red, S yellow, P orange. Image rendered in PyMOL ( 73 ).

PAGE 84

84 enzyme does not stimulate glutaminase activity when ATP is present in the reaction. Therefore, w hen the ca rboxylate moiety is removed, coordination between the acti ve sites is lost. E348 is the first residue indentified within the synthetase domain to be involved in coordination of the active sites; whereas previous studies on residues in the glutaminase domain found that Arg 30 was involved in coordinati on of the active sites (121 ). Although the mechanism by which these residues act to coordinate the two active sites is unclear, it is clear that they are both key players. T he E348D mutant works at approximately half the rate of the wild type enzyme, although it does not uncouple the Asn: PPi ratio for either the glutamine or ammonia dependent reactions. However, it does uncouple the glutamate to asparagine ratio to 18:1 by increasing the production of g lutamate while slowing the asparagine production. T his enzyme wastes 17 molecu les of ammonia (measured by production of glutamate) for each molecule of asparagine formed. This suggest that formation of the AspAMP intermediate is slowed in the E348D mutant and the change s in Asn:Glu can be understood in the context of the proposed kinetic mechanism of AS -B (47 ). When formation of intermediate becomes more difficult (i.e. k3 and k12 are decreased ), the mutant favors the pathway that forms the E. ATP.Asp.Glu complex (Figure 3-16 ). Because the rate of glutamine hydrolysis (k8, k9, and k10) is unchanged ( or possibl y even increased in this mutant) more glutamine is hydrolyzed prior to formation of the intermediate. This results in glutamate production without t he production of asparagine and a further uncoupling of the Asn:Glu ratio. In the case of E348A and E348Q the intermediate cannot be formed and thus no asparagine is formed. Therefore, glutamate production is governed by the rates of k3 k9, and k12; al l of which result in glutamate

PAGE 85

85 Figure 316 Proposed kinetic model for glutamine dependent asparagine synthetase. Reprinted with permission from Archive of Biochemistry and Biophysics vol 413. Tesson, A.R, Soper, T.S., Ciusteau, M., Richards, N.G.J. Pages 23 -31. Copyright 2003.

PAGE 86

86 production without production of asparagine. This argues against the role of this residue as a general base in the reaction; although it is possible that E348 plays a role in the formation of the intermediate and also acts as a general base in the reaction. The role of this residue in the formation of the intermediate is not clear within the structural context of the enzyme. The residue may play a role in positioning aspartic acid and ATP within the active site or stabiliz ing the pentacoordinate intermediate that Mg2+ ion required for synthetase activity (Boehlein, unpublished resu lts); however, a B found that this residue was at located least 3.9 away from the Mg2+ ion. It should be noted that only one crystal structure of AS -B is currently available and different conformations of the enzyme ma y show different 18O Isotopic Labeling Studies Although kinetic studies suggest that E348A cannot form the intermediate, a PIX experiment was performed in an effort t o prove that removal of the carboxylate group prevented the enzyme from forming the AspAMP intermediate. However, because n o PIX was observed for the wild type E348D, or E348A, it is not possible using the methods described here, to confirm formation o f the intermediate without the formation of products in AS -B. However, the lack of observable PIX for AS -B is an interesting observation, as most enzymes that catalyze acyl adenylation undergo PIX. This result stands in contrast to 18O transfer studies us ing 18O -labeled aspartic acid which confirm ed the formation of the acyl adenylate intermediate for both His6-tagged AS B and E348D T he observation of PIX in an enzymatic reaction is not possible if (1) all substrates must

PAGE 87

87 be present prior to formation of the intermediate (2) the phosphate group cannot rotate on the enzyme, or (3) formation of the intermed iate is not fully reversible (114, 125 ). The first caveat can be eliminated because it has been demonstrated for AS-B that incubation of ATP and aspartic acid in the absence of a nitrogen source exhibited burst kinetics when either the production of AM P or PPi was monitored (46, 83) However, it is possible that PIX was not obs erved due to either reason 2 or 3. Asparagine synthetase may restrict rotation of the oxygen atoms around the phosphate group by coordination of the oxygen atoms of PPi to a Mg2+ ion. In the structurally related agininosuccinate synthetase, no PIX was observed even though this enzyme does form an adenylated intermediate in the absence of the nucleophile ( 126, 127). It was concluded that rotation of the phosphate group must be restricted in this enzyme which prevented the observation of PIX. Argininosuccinate synthetase and the C -terminal domain of AS -B belong to the ATP pyrophosphatases family of enzymes (58, 64, 66). Other members of this family include GMP synthetase ( 65) ATP sulfurylase (67) -lactam synthetase ( 68, 69), carbapenam synthetase( 70) 4 thiouridine synthetase (71 ), and NAD+ synthetase ( 72) They all contain a signature SGGXDS sequence, referred to as the P loop, that is seen in enzymes dom ains that catalyze hydrolysis of ATP to AMP and PPi (64 ). In a structural overlay of AS argininos uccinate synthetase, the P loops superimpose directly on top of each other (Figure 317) In addition, the PPi is coordinated to at leas t one Mg2+ ion, which likely restrict s rotation of the oxygen atoms around the phosphorous. Furthermore in this structural motif, PPi is bound deep within the active site and likely cannot di ssociate from the active site or regain access to the active site. Therefore, it is possible that this

PAGE 88

88 structural motif may prevent the observation of PIX by restricting bond rotation and preventing PPi from dissociating from the active site. To date, GMP synthetase is the only member of the P loop family of enzymes reported to undergo PIX, although the e xperiment has not been reported for a number of the enzymes ( 128) It is also possible that PIX was not observed because formation of the AspAMP intermediate is not fully rever sible in AS -B. Analogous to the PIX results and in contrast to most other acyl adenylating enzymes no conditions were found in which AS-B exhibited ATP/PPi exchange ( 46) This was proposed to result from a large forward commitment to asparagine formation that made formation of the intermediate functionally irreversible. In the evolutionarily related LS and CPS ATP/ PPi exchange was only observed when the pH was lowered or when mutants critical to the second half reaction, lactam formation, were studied (102, 105) This, presumably, lowered the commitment of -lactam formation thus allowing rev ersible formation of the acyl adenylate intermediate. Unfortunately no PIX experiment has been reported to date on these enzymes. Irreversible formation of the intermediate is arguably necessary in AS -B because, in contrast to other glutamine-dependent amidotransferases, the glutaminase and synthetase activities of AS -B are not well coordinated. Thus, if formation of the intermediate is not coupled to glutamine hydrolysis, the enzyme must tig htly bind and protect the intermediate to e nsure it is present in the active site when ammonia arrives. Previous studies found that the hydrolysis of the intermediate is approximately 1500 times slower than the rate in the presence of a nitrogen s ource, suggesting that the intermediate is protected by the residues in the active site (46 ). Therefore, once the

PAGE 89

89 Figure 31 7 Structural o verlay of the P loop of AS -B, a rgininosuccinate synthetase (pdb1KP3) and LS (pdb 1MBZ) shown in green, yellow, and blue respectively. Mg2+ ion is shown as a sphere in magenta. E348 and D238 residues of AS -B and the AspAMP intermediate are shown in stick r epresentation. Color scheme: C green, N blue, O red, P orange, Mgmag enta. Image rendered in PyMOL ( 73 ).

PAGE 90

90 intermediate is formed, the enzyme locks down so as to prevent either re attack by PPi or hydrolysis of the intermediate. Conclusions Based on 18O labeling and PIX experiments, the formation of the intermediate in E348 cannot be fully excluded. However, with no means by which to verify acyl adenylation without formation of asparagine for the wild type enzyme (i.e. the enzyme does not PIX) it is also impossible to prove that E348A does form the intermediate. Based on the currently proposed kinetic model for AS B and the kinetic data of E348D, E348Q, and E348A, we conclude that this residue is involved in formation of the AspAMP intermediate, a finding that is in contrast to the proposed role of this residue. We also find that E348 is involved in the coordination of the glutaminase and synthetase domains and removal of the carboxylate group prevents coordination of these two domains. Experimental Section Materials Unless otherwise stated, all chemicals were purchased from Sigma (St. Louis, MO ) or Fischer Scientific (Pittsburgh, PA) and were of the highest purity available. L glutamine was recrystallized prior to use as previously described (109 ). Protein concentration was determined using the Bradford Assay (Pier ce, Rockford, IL) based on a standard curve using bovine serum albumin (104 ) and corrected as previously described (47 ). PCR primers were obtained from Integrated DNA technologies, Inc (Coraville, IA) and DNA sequencing reactions were performed by the DNA sequencing core of the Interdisciplinary Center for Biotechnology Research at the University of Florida, Gainesville, FL.

PAGE 91

91 Cloning of His6-tagged AS B and E348 M utants The gene encoding asnB was cloned into pET -21c (+) vector to contain a thrombin site followed by a C -terminal p oly histidine tag. The pET -21c (+) vector containing asnB insert was used a s a template and primers were designed to remove the vector portion between the stop codon and the poly -histidine tag on pET 21c (+) as well as introduce a thrombin cleavage site (see Appendix B for primer sequences). Reactions consisted of 200 ng of each primer, 5 ng of template DNA, 200 M dNTPs, 1X Pfu turbo buffer, and 1 L (2.5 U) of Pfu turbo DNA polymerase in a 50 L volume. Reactions were heated at 95 C for 30 seconds, cooled to 55 C for 30 seconds, and then h eated at 68 C for 7 minutes. This cycle was repeated 16 times and the resulting reactions were purified using Wizard PCR preps DNA purification kit (Promega, Madison, WI). Purified DNA was ligated at room temperature for 24 h using T4 DNA ligase and transformed into JM109 E. coli cells. Successful transformants were screened by the loss of HindIII restriction site and sequences verified. E348 mutants were cloned using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) using the pET -21c (+) vect or containing asnB followed by a poly -histidine tag as the template and primers containing the desired mutations Expression and Purification of His6-tagged AS B and E348 M utants Expression of His6-tagged AS -B was performed as previously described for AS -B (51) A single colony was grown overnight i n 5 mL of SOB media supplemented with 10 mM MgCl2, and 100 g/mL of ampicillin at 37 C A small portion (0.5 mL) of the overnight culture was inoculated into 500 mL of M9 minimal media supplemented with 0.75% glucose and 100 g/mL of ampicillin The cells were grown at 37 C with vigorous shaking for approximately 4-5 hours until an OD600 between 0.3 and 0.5 was

PAGE 92

92 reached. C ells were induced at 37 C by the addition of 100 M IPTG and ha rvested after 3 hours by centrifugation at 2,000 x g for 20 min. Cellular pellets were stored overnight at -20 C until use in purification procedures. For purification, t he cellular pellet was resuspended in 50 mL of lysis buffer (50 mM EPPS pH 8 .0 300 mM NaCl, 10 mM imidazole, 1% Triton X, 0.5 mM DTT) and lysed by sonication. C ellular debris was collected by centrifugation at 10,000 x g for 20 min at 4 C and the resulting supernatant was loaded onto a 3 mL Ni -NTA column (Qiagen, Valencia, CA ). The co lumn was washed with 15 mL of wash buffer (50 mM EPPS pH 8.0 300 mM NaCl, 20 mM imidazole, and 0.5 mM DTT) before elution with 30 mL of elution buffer (50 mM EPPS pH 8.0 300 mM NaCl, 250 mM imidazole, 0.5 mM DTT). All purification procedures were comple ted at 4 C The fractions were analyzed by SDS -PAGE and those containing AS -B were pooled and dialyzed exhaustively against 50 mM EPPS and 5 mM DTT. Glycerol was added to a final concentration of 20% and aliquots stor e d at 80 C Glutamina se Activity Glutaminase activity was determined by incubating reactions containing enzyme (1.5 g) in the presence or absence of 5 mM ATP, 100 mM EPPS, pH 8.0, 100 mM NaCl, 8 mM MgCl2, and 0.2 50 mM of L glutamine in a 200 L volume for 20 minutes at 37 C before quen ching TCA to a final concentration of 4%. This solution was added to a solution containing 300 mM glycine -250 mM hydrazine buffer, pH 9.0, 1.5 mM NAD+, and 1 mM ADP followed by the addition of 2.5 units of L -glutamic dehydrogenase (Sigma G2626) in a tot al volume of 500 L Reactions were incubated at room temperature and absorbance readings at 340 nm were taken after 30 minutes and

PAGE 93

93 corrected for the absorbance at 340 nm before the addition of coupling enzyme. The amount of glutamate produced was quantif ied by comparison to glutamate standards. Pyrophosphate P roductio n Production of pyrophosphate (PPi) was monitored spectrophotometrically during the AS -B reaction using a coupled enzyme assay (Sigma Technical Bulletin No. BI -100). The reaction consisted of 100 mM EPPS pH 8 .0 5 mM ATP, 100 mM NH4Cl or 20 mM L-glutamine 10 mM MgCl2, 20 mM aspartic acid and 350 L of PPi reagent in a 1 mL total volume. Reactions were initiated by the addition of 2 -4 g of enzyme and monitored at 37 C for 20 min. The amount of PPi produced was determined by moni toring the change in absorbance at 340 nm. Kinetic constants were determined using the same assay by varying the concentration of either ATP (0 3 mM) or L-Asp (0 -10 mM) while holding the other substr ates at saturating conditions. Kinetic constants were fit using KaleidaGraph software, version 3.5 ( Synergy software, Reading, PA) and errors represent the error in the fit. Asparagine and Glutamate P roduction Asparagine and glutamate production was determined using an HPLC based endpoint assay following methods previously described ( 47). Reactions containing enzyme (2 -4 g) and 100 mM EPPS pH 8 .0 5 mM ATP, 100 mM NH4Cl or 20 mM L -glutamine 10 mM MgCl2, and 10 mM aspartic acid in a 1 mL volume were incubated for 20 minutes at 37 C before being quenched with glacial acetic acid (4%). Following precipitation of the enzyme, the solution was neutralized with 10 M NaOH. A portion of the reaction mixture (40 L) was taken for derivatization in a total volume of 200 L with 400 mM Na2CO3 pH 9, 20 L DMSO, and 60 L of 2,4 dinitrofluorobenzene (DNFB) saturated in absolute ethanol. Caution: Use extreme care when handling sol utions of

PAGE 94

94 2,4 dinitrofluorobenzene. It is a potent allergen that will penetrate many types of laboratory gloves ( 129). D eri vatization reactions were incubated at 50 C for 50 minutes before quenching with glacial acetic acid. D erivatized amino acids were separated by reverse phase HPLC using a Varian C18 Microsorb column (Varian, Palo Alto, CA) using a step gradient of 40 mM formic acid, pH 3.6 and acetonitrile. The initial concentration of acetonitrile was 14 % After 30 minutes the concentration of acetonitrile was increased to 20% for an additional 10 minutes. Derivatized asparagine and glutamate were detected at 365 nm and the amount of asparagine and glutamate was quantified by comparison to asparagine and glutamate standards derivatized in the same manner. Figure 3-18 shows a representative chromatogram of the separation between asparagine, aspartic acid, glutamine, and glutamate. Synthesis of 18O Aspartic Acid Aspartic acid label ed with 18O at all positions was synthesized following the previously publis hed method (109) Briefly, 0.0597 g of Laspartic acid was added to 700 L of 95% H2O18. Concentrated HCl was added to pH ~1 then the mixture was sealed and heated to 80 C for 14 days. The reaction mixture was lyophilized and the remaining aspar tic acid was dissolved in water to a final concentration of 2.1 M and the pH adjusted with 10 M NaOH to pH 8 The presence of the 18O label wa s confirmed by mass spectrometric analysis via isocratic C18 HPLC/UV/( -)ESI MSn (Mass Spectrometry Facility, Chemistry Department, UF) using a ThermoFinnigan LCQ MS (Table 3-5) and was found to be approximately 87% enriched. 18O transfer studies Samples were prepared following methods previously described ( 109 ). Reactions were prepared with 100 mM EPPS, pH 8.0, 10 mM ATP, 100 mM NH4Cl,

PAGE 95

95 Table 3 5 Relative abundance of 18O4-Aspartic Acid based upon [M H]-ions. Number 18 O [M H] Peak Area Percent Total 0 132 0 0.0 1 134 23,279 0.2 2 136 1,1026,361 7.9 3 138 4,832,736 37.4 4 140 7,046,859 54.9 Fi gure 318 Representative HPLC chromatogram for the separation and quanitification of asparag ine and glutamate. The retention time for asparagine and glutamate are approximately 20 min and 41.5 min, respectively.

PAGE 96

96 20 mM MgCl2, 20 mM labeled or unlabeled aspartic acid and 200 g of enzyme in a 1 mL volume. Reactions were incubated for 3 hours at 37 C then quenched with TCA to 4% final concentration. Enzyme was precipitated by centrifugation and 700 L of the supernatant was transferred to a new tube containing 0.0287 g of EDTA, 0.045 g of glycine, and 200 L of D2O. The pH was adjusted to 9.5 with 1 0M NaOH and 800 L was transferred to an NMR tube for analysis. The NMR instrument used was a Mercury 300 with a 7T (300 MHz) magnet (NMR facility, Chemistry Department, University of Florida Gainesville, FL ). Spectra were obtained using 500 scans with an acquisition -phosphorous of ATP as a reference. PIX Experiments [ -18O6] -ATP was a generous gift from Dr. Frank Raushel of Texas A &M University College Station, TX Reactions contained 5 mM [ -18O6] -ATP,10 mM L Asp, 10 mM MgCl2, 100 mM EPPS, pH 8.0, and 3 M AS -B in a total volume of 4 mL. Reactions were incubated at 37 C and 500 L aliquots removed every 30 minutes for 3.5 hours. Aliquots were quenched by the addition of 125 L of 1.0M EDTA and 125 L of D2O and transferred to an NMR tube for analysis. A control reaction confirmed that the addition EDTA was sufficient to quench the reaction by removing the Mg2+ ions. The NMR instrument used was a Mercury 300 with a 7T (300 MHz) magnet (NMR facility, Chemistry Department, University of Florida) All spectra were obtained using 3000 scans with an acquisition time of 4 s.

PAGE 97

97 CHAPTER 4 CRYSTALLIZATION TRIALS OF GLUTAMINE-DEPENDENT ASPARAGINE SYNTHETASE Introduction In 1999, the crystal structure of glutamine dependent asparagine synthetase from E. coli (AS -B) was solved in a ternary complex with glutamine and AMP to 2 resolutio n (58 ). The crystal structure revealed that the enzyme i s composed of two distinct domains the N -terminal glutaminase domain and C -terminal synthetase domain. The active sites of these two domains are connected by a solvent -inaccessible intramolecular tunnel responsible for the translocation of ammonia (58 ). The glutaminase domain is well -resolved in the structure and has been well characterized by site -directed mutagenesis and kinetic studies (45, 121, 130, 131). Unfortunately, t he synthetase domain is not as well -resol v ed in the structure as it is missing several loop regions and the f inal 37 resi dues of the protein. A computational model that positioned the AspAMP intermediate within the synthetase active s ite (Ding, un published) has been useful for understanding structure-function relationships and the development of small molecule inhibitors However, a better understanding of the enzyme on a structural level will be gained by solving a new crystal structure of asparagine synthetase Although the active sites of E. coli and human asparagine synthetase are fully conserved, slight differences h ave been observed between the two homologs ( 132). Furthermore, the goal of identifying small molecule inhibitors is to target human asparagine synthetase for the clinical treatment of ALL. Therefore, we will pursue the crystal structure of the human enzyme, an endeavor that is now possible du e to the availability of large quantities of recombinant human asparagine synthetase ( 43 ).

PAGE 98

98 Obtaining a crystal suitable for diffraction is a large obstacle to overcome when pursuing a crystal structure. Crystals form when the concentration of protein is brought from a soluble state to a state of supersaturation. Supersaturation is achieved at a balance between the concentration of protein and the concentration of additives that destabilize the protein solubility, commonly ref erred to as precipitation agents ( 133). Common precipitating reagents include hydrophilic poly mers (i.e. PEG), salts detergents, and alcohols. Also o ther conditions, including pH and buffer com position affect the protein solubility. The se reagents and conditions can be altered to find conditions that favor supers aturation and crystal formation. Several methods have been d eveloped for obtaining crystals; the most common being vapor diffusion by either the hanging drop or sitting drop method. In vapor diffusion, a drop containing the protein sample and reservoir solution is suspended above the reservoir solution containing the precipitating reagent T o reach equilibrium, water diffuse s from the drop into the reservoir (Figure 41A) (133). This causes an increase in protein concentration and precipitating agent which can ultimately result in supersaturation of the protein drop (Figure 41 B). Once nucleation conditions are reached (blue drop) crystals begin to form. M icrocrystal formation, precipitation, denaturation, or inclusion of the p rotein into the growing crystal decreases t he protein concentration to a level that is better suited for crystal growth (red drop) ( 134). Conversely if the conditions are un favorable for the protein structure, it will quickly precipitate out of solution. It is also possible for the protein to remain in an un saturated state which will never lead to crystal formation (green drop). In either of the l atter two cases, the protein concentration and/or solubility decreasing parameter must be altered.

PAGE 99

99 Figure 41 Crystallization by vapor diffusion. A) Schematic diagram of sittingdrop vapor diffusion technique B) Phase diagram of crystallization by vapor diffusion A B

PAGE 100

100 It is impossible to predict the exact conditions that promote crystallization for a particu lar protein, and g iven the nearly infinite combinations of possible conditions obtaining a crystal is a major bottleneck in obtaining a highresolution crystal structure. Commerci ally available crystallization kits are designed to analyze conditions that promote crystallization, based on both systematic and sparse matrix analysis of the conditions previously found to successfully yield crystals ( 135, 136). Once initial conditions are found to promote crystallization, samples can then be systematically optimized to obtain crystals suitable for fur ther analysis. Proteins, especially enzymes, are dynamic systems that undergo conformational changes during the catalytic cycle. Therefore, one must determine the enzymatic form that produces the best crystals. Asparagine synthetase is a two domain, dy namic enzyme that likely undergoes conformation al changes during the catalytic cycle. Our strategy is to lock the enzyme into an active conformation by preparing both the singly and doubly inhibited form of the enzyme. The glutamine analog, 6 diazo-5 oxo L norleucine (DON) will be used as an inhibitor of the glutaminase domain. DON is an irreversible, competitive inhibitor of glutamine that forms a covalent complex with the N terminal cysteine residue (Figure 42 ) ( 50, 137, 138 ). This covalent complex (EDON) mimics the putative glutamyl thioester covalent intermediate formed during glutamine hydrolysis (26 ). DON has been us ed successfully for the crystallization of other glutamine -dependent amidotransferases such as GPATase (54 ), GFAT (139), glutamate synthase (GltS) ( 140), and NAD+ synthetase ( 141). The N adenylated sulfoximine, a transition state analog, will be used as the synthetase domain inhibitor because it exhibits tight binding inhibition (KI 2.46 nM) with a half life of 7.4 hours. This

PAGE 101

101 Figure 42. DO N reacts with the Cys -1 residue of ASNS to form a covalent adduct.

PAGE 102

102 compound is competitive with ATP and binds to the free form of the enzyme. Furthermore, it will provide a snapshot of the enzymatic structure during catalysis because it is a transition state analog for the attack of ammonia on the AspAMP intermediate (25 ). Previous work in the Richards lab found that incubation of hASNS with 5.88 mM DON at 22 C for 20 minutes resulted in a 90% loss of glutaminase activity, wheras the ammonia dependent synthetase activity remained unaffected (Berry, unpublished) (Figure 43 ). Treatment of the DON inhibited enzyme (EDON) with 16 M of the N ad enylated sulfoximine resulted in near complete loss of the ammonia-dependent activity. The calculated KI value for the N adenylated sulfoximine of the EDON complex was determined to be 2.9 nM (Berry, unpublished) This number is in close agreement with the previously reported KI of 2.46 nM for free hASNS ( 25); this result confirms that the N adenylated sulfoximine binds to the EDON complex and acts as a slow onset tight bindi ng inhibitor. Although a crystal structure of hASNS is highly desired, there are several technical advantages to also pursuing a crystal structure of AS -B. First, large quantities of AS -B are readily expressed in E. coli a nd easily purified using Ni affinit y chromatography. In addition, a large number of mutant constructs have been generated for AS -B, which may be more amiable to crystallization. Specifically, in the solved crystal structure of AS -B, the last 37 amino acid residues are not resolved leaving a visible hole in the synthetase active site (Figure 44). These residues are likely important for the binding of aspartic acid and may become ordered upon binding. We hypothesize that because these residues are not vis ible in the crystal structure they are

PAGE 103

103 Figure 43 Fraction of original glutaminase activity remaining after treatment of hASNS with 5.88 mM DON. Figure courtesy of Alexandria Berry. 0 0.2 0.4 0.6 0.8 1 0 5 10 15 20 25 30 35Fraction of Glutaminase Activity Remaining after Incubation with 5.88 mM DON Incubation Time (min)

PAGE 104

104 Figure 44. The solved crystal structure of AS -B (pdb 1CT9) is missing the final 37 residues of the protein. The last residues seen in the structure are highlighted in yellow. The glutaminase and synthetase domains are shown in gray and blue, respectively. Bound AMP and glutamine are shown as spheres. Image render ed in PyMOL( 73)

PAGE 105

105 disor dered or in motion; therefore removal of these residue s may help to stabilize the protein structure for crystal formation. Furthermore, by studying AS B trunca tion mutants, we hope to gain an understanding of the structural and/or functional roles of these residues in the AS B reaction. This chapter will detail the preparation of hASNS for crystallization trials in both the single and doubly inhibited form s as well as discuss preliminary crystallographic trials. In addition, the crystallization trials, kinetic studies, and SAXS measurements of AS-B truncation mutants will be discussed. Results and Discussion Expression and P urification of hAS NS for Crystallography T rials Prior to expression of hASNS in Sf9 cells, a high titer viral stock of the baculovirus inoculum containing the hasns gene must be obtained. This ensures that healthy Sf9 cells are infected at the appropriate multiplicity of infectio n ( MOI ) for efficient expression of the recombinant protein. A fresh baculovirus inoculum was prepared and determined to have a TCID50/mL (142) value of 1.58 x 108 infectious particles/mL. This fresh inoculum was used for expression of hAS NS for crystallography trials. It is common practice amongst crystallographers to use freshly prepared, never fr ozen enzyme for all crystallization trials. However, it was discovered during these enzyme preparations that purified hASNS will precipitate out of solution at concentrations higher than approximately 0.5 mg/mL when stored on ice in 50 mM EPPS buffer, pH 8.0 and 1 mM TCEP for extended periods of time Therefore, all purified samples of hASNS were diluted directly following purification and stored as dilute solutions until the protein was concentrated prior to crystallization trials.

PAGE 106

106 Inhibition of hASNS with DON DON acts as an irreversible inhibitor of hASNS by forming a covalent complex with the Cys -1 residue of the protein (138 ). The glutaminase activity and both ammonia and glutamine dependent activities of hASNS were determined after incubation with 15 mM DON at room temperature for 20 minutes All measurements were collected after removal of excess DON from the EDON complex by filtration. This served to i nsured that the enzyme was covalently modified as well as remove excess DON found to interfere with the coupling assays. The presence of DON significantly affects the glutaminase activity whereas ammonia-dependent synthetase activity is unaffected (Figure 45) The glutamine dependent activity of the EDON complex is ~20% of the uninhibited enzyme, in accordance with glutaminase activity This confirms that 15 mM DON does inhibit glutaminase activity while leaving the ammoniadependent s ynthetase activity unaffected and represents a useful approach for the preparation of enzyme for crystallography trials. Inhibition of hASNS with AMP -CPP Methyleneadenosine 5 -triphosphate (AMP -CPP) is a nonhydrolyzable analog for ATP where a methy lene group replaces the bridging oxygen of ATP. (Figure 46A). This compound is expected to serve as a competitive inhibitor of ATP for enzymes that utilize ATP to form an acyl -AMP intermediate and PPi. It has been successfully used in the crystallization of LS (75 ), NAD+ synthetase (143), and carbapenam synthetase (70 ), which have homologous synthetase domains to asparagine synthetase. We investigated the ability of this compound to act as an inhibitor of hASNS with hopes to use this commercially available compound in crystallization trials. However, at concentrations up to 1 mM, AMP -CPP showed only a

PAGE 107

107 Figure 45. Fractio n of glutaminase, ammonia-dependent synthetase, and glutaminedependent synthetase activity remaining after treatment of hASNS with 15 mM DON. Error bars represent the standard deviation of three individual measurements. 0 0.2 0.4 0.6 0.8 1 1.2 No DON 15 mM DONFraction of activity Glutaminase Ammonia dependent synthetase Glutamine dependent synthetase

PAGE 108

108 slight decrease in the ability o f the enzyme to produce PPi (Figure 46B). Therefore, this compound does not represent a viable compound to use for crystallization trials as it does not tightly bind to the enzyme at the concentrations tested. Crystallization Trials of hASNS D ifferent f orms of the enzyme were prepared for numerous crystallization screens to identify conditions suitable for crystallization of hASNS. An initial screen using the JCSG plus suite (136 ) and the EDON/sulfoxmine complex found that an initial concentration of 10 mg/mL was too high f or crystallization screens; all wells contained precipitated protein immediately following set up. The concentration was diluted to 7 mg/mL and used for crystallization screens utilizing the high-throughput crystallization facility at the EMBL in Hamburg, Germany (see Table 43 for chosen crystallographic screens) ( 144). In t hese trials, zero conditions were found that promoted crystallization. F ew wells contained clear protein drops and most drops contained fully precipitated protein immediately following set -up. Due to the large number of drops containing precipitated prot ein, it was determined that the concentration of protein was still too high. Therefore, hASNS was treated with 15 mM DON only, diluted to 3.5 mg/mL, and subjected to another set of crystallization trials. In these trials, a clear trend was found using the Qiagen pH clear suite. As the pH of the reservoir solution was increased, the number of clear drops increased, an effect that was most pronounced when a high concentration of salt (up to 4M NaCl) was included in solution (Figure 47). This suggests that the protein is more soluble at a higher pH with the addition of NaCl. These conditions c an

PAGE 109

109 Figure 46 AMP-CPP is not an inhibitor of hASNS. A) Chemical structure of AMP -CPP B) Production of PPi ( M) in the presence of 0.1 mM and 1 mM of AMP -CPP Error bars represent the standard deviation of three individual measurements. 0 1 2 3 4 5 6 7 8 9 0 mm AMP CPP 0.1 mM AMP CPP 1 mM AMP CPP M production of PPi A B

PAGE 110

110 Figure 47 Number of clear drops in comparison to the number of drops containing precipitated protein for the pH clear suite. A) Number of clear drops as a function of pH. B) Number of clear drops as a function of precipi tating reagent. The number of total wells containing a particular pH or precipitating reagent was 16 and 24, respectively. 0 2 4 6 8 10 12 14 16 18 pH 4 pH 5 pH 6 pH 7 pH 8 pH 9 Nmber of drops ppt clear 0 5 10 15 20 25 30 sodium chloride PEG ammonium sulfate MPDNumber of drops ppt clear A B

PAGE 111

111 be used for future enzyme pr eparations which will stabilize the protein and allow for higher protein concentrations to be achieved ( 133). Aft er 11 days, several wells in the Qiagen PACT suite demonstrated microcrystal formation Figure 4 8 illustrates the progression of the drop from initial set up to the appearance of micro -crystals. The four wells contained 20% PEG 3350 and 0.2 M of either sodium bromide, sodium sulfate, sodium/potassium tartrate, or sodium/potassium phosphate. Unfortunately, optimization of these con ditions did not lead to crystal formation. Characterization of His6tagged AS B Truncation Mutants Given the lack of initia l success in the crystallization trials of hASNS, His6-tagged truncation mutants were prepared by removing the last 10, 20, 30, and 40 amino acid residues of the His6tagged AS-B protein (full length AS B contains 553 residues). SDS-PAGE analysis of the truncation mutants confirms the different size of each truncation mutant; as more residues are removed, the protein migrates at a slightly slower rate (Figure 4-9) Removal of such a large number of residues however, could compr omise the overall struc tural integrity of the enzyme. G lutaminase activities of 10 and 20 are only slightly lower than wild type ; whereas, 30 and slightly increased glutaminase activity (Table 41). However, these changes are within th e range of wild type activity and it was concluded that removal of these residues does not interfere with the proper folding of the enzyme. Truncation mutants demonstrated low levels of PPi production and no detectable levels of asparagine (Table 42), even at concentrations up to 100 mM of aspartic acid. The low levels of PPi production can be attributed to ATP hydrolysis, as the level

PAGE 112

112 Figure 48. Formation of microcrystals in a protein drop containing hASNS, 15 mM DON, 0.2 M sodium/potassium phosphat e, 20 % (w/v) PEG 3350.

PAGE 113

113 Figure 49. SDS PAGE analysis of His6tagged AS -B truncation mutants stained with Commassie Brillant blue Lane 1: molecular weight ladder, lane 2: His6tagged AS -B, lane 3: 10 His6tagged AS -B, lane 4: 20 His6-tagged AS B, lane 5: 30 His6-tagged AS -B, lane 6: 40 His6-tagged AS -B. The molecular weight of His6tagged AS -B is approximately 64 kDa.

PAGE 114

114 Table 4 1. Glutaminase activity of His6-tagged AS B and truncation mutants at pH 8.0. Enzyme K m (Gln) (mM) k cat (s 1) k cat /K m Wild type 2.4 0.2 2.22 0.06 930 3.3 0.8 1.54 0.08 470 4.1 0.5 2.1 8 0.0 8 540 3.1 0.7 6.0 0.3 1900 3.3 0.9 5.3 0.3 1600 Tab le 42. Ammonia and glutamine-dependent production of PPi, Asn, and Glu in wild type His6-tagged AS -B and truncation mutants determined under saturating conditionsa at pH 8.0 Ammonia dependent synthetase Glutamine dependent synthetase PP i Asn PP i Asn Glu mol min 1 mg 1 mol min 1 mg 1 Wild type 2.3 0.1 3.1 0.3 1.1 0.02 1.5 0.1 8.3 0.5 0.24 0.05 No Asn 0.174 0.002 No Asn 6.0 0.1 0.22 0.04 No Asn 0.11 0.02 No Asn 7.31 0.04 0.21 0.02 No Asn 0.11 0.02 No Asn 7.0 0.4 0.25 0.002 No Asn 0.34 0.01 No Asn 9.6 0.3 a Saturating conditions were 10 mM Asp, 5 mM ATP, 10 mM MgCl2 and either 100 mM NH4Cl or 20 mM Gln. i s the same in the presence and absence of aspartic acid. Glutamate production is unaffected in each of these mutants, confirming the results from the glutaminase assay. Therefore, removal of the last 10 to 40 amino acid residues of the AS -B does not affec t the glutaminase domain or reaction, but significantly affects the synthetase activity of the protein. It is likely that these residues are important in the binding of aspartic acid. Previous work found that the C523A mutant of AS -B caused an 80-fold inc rease in the Km for aspartic acid while only having a 2-fold decrease on the kcat suggesting its role in the binding of aspartic acid (145 ). However, without further means by which to probe the function of these residues, all that can be concluded is removal of the final 10, 20, 30, or 40 amino acid residues renders the protein unable to produce asparagine and thus these residues must be critical to the enzymes structure and/ or function.

PAGE 115

115 Small angle X -ray Scattering of His6AS B and 40 mutant Small angle X -ray scattering ( SAXS) is a technique that gives structural information of a molecule based on the inhomogeneities in the electron density of the solution ( 146, 147). The advantage of this technique is that macromolecules can be studied in solution; as such, the process of crystallization is avoided. However, SAXS can only give information regarding the global structure of the molecule but will not yield information on interatomic distances, thus making it a low resolution technique. Nonetheless, useful information about the overall tertiary structure of the protein can be obtained. When SAXS was performed on the His6-tagged wild type protein and 40 mutant, the distance distribution curves (Figure 4-1 0 ) indicated that the protein was indeed a globular p article. As expected, the wi ld mutant; however the part differing f unfolded. This finding supports the lack of electron density observed for the final 40 residues of the protein in the crystal structure(58 ). If these residues are highly unordered, they will likely be in motion and not be resolved in the crystal structure. An overlay of the crystal structure of the AS -B dimer and the SAXS structure for the His6-tagged wild type mutant are shown in Figure 4 -11 The SAXS structure roughly represents the global core shape of the AS predicted by the distance distribution curve. The long tail of the SAXS structure is the result of minor aggreg ation of the protein. Importantly, removal of the last 40 amino acid residues did not affect the global fold of t he protein, thus the use of truncation mutants for crystallography experiments may represent a viable approach for obtaining a crystal structu re.

PAGE 116

116 Figure 410 Distance distribution for wild type His6-tagged AS Figure courtesy of Dr. Inari Kursula, DESY, Hamburg, Germany. 0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 0 5 10 15 20 25DistributionDistance (nm) Wild type delta 40

PAGE 117

117 Figure 411. Superimposition of the AS -B crystal structure and SAXS structure. A) Wild t ype His6-ASB SAXS structure superimposed on AS B crystal structure dimer. B) 40 SAXS structure superimposed on AS -B crystal structure dimer. The SAXS structure is represented by balls in purple and yellow, respectively, and the crystal structure is shown in cartoon representation in red. The extra tail present in both structures is an artifact of the SAXS measurement. Figure courtesy of Dr. Inari Kursula, DESY, Hamburg, Germany. A B

PAGE 118

118 Crystallization Trials of His6-tagged AS B Truncation Mutants Prior to crystallization trials involving the His6-tagged AS B and other truncation mutants it was confirmed that analogous to hASNS, DON could act as a covalent inhibitor of the AS -B enzyme. The addition of 15 mM DON to His6-tagged AS -B (incubated for 20 min utes at room temperature) eliminated nearly all glutaminase activity (Figure 4 -12), while the synthetase activity remained unaffected The crystallization trials of His6tagged AS -B truncation mutants in the presence of 15 mm DON and 1 mM of the N adenylat ed sulfoximine found several conditions that appeared to promote crystallization, with more crystal promoting conditions present as more residues were removed. This provides evidence that removal of these residues may stabilize the protein and help promote crystallization. The conditions are in the process of being optimized by collaborators in the Kursula lab at DESY in Hamburg, Germany. Conclusions Although no crystals suitable for diffraction were formed during these crystallization trials important information was obtained during enzyme preparation and crystallization trials. hASNS is a sensitive to changes in concentration and must be kept dilute if it is to be stored on ice for long periods of time This complicates the crystallization attempts a s the protein is not stable fo r extended period of time on and must be concentrated directly prior to use. However, the enzyme is stabilized at a higher pH and with the addition of high concentrations of sodium chloride. The use of these conditions in the purification and storage of hASNS may stabilize the protein and allow for higher concentrations of protein to be used. Although AS B truncation mutants

PAGE 119

119 Figure 412. Glutaminase activity of His6tagged AS -B in the presence and absence of 15 mM DON. Error bars represent the standard deviation in triplicate experiments. 0 0.2 0.4 0.6 0.8 1 1.2 No DON 15 mM DON Relative Activity

PAGE 120

120 were unable to produce asparagine, they did have significant levels glutaminase activity indicating the removal of these residues did not disrupt the glutaminase domain. In addition, SAXS measurements confirmed that the overall structure of the enzyme was maintained. I nitial crystallization trials with truncation mutants are promising and removal of t he last 40 amino acid residues may prove to be a viable method for the crystalliza tion of this protein. Materials and Methods Materials Unless otherwise stated, all chemicals were purchased from Sigma (St. Louis, MO ) or Fischer Scientific (Pittsburgh, PA) and were of the highest purity available. L -glutamine was recrystallized prior to use as previously described ( 109). The N adenylated sulfoxmine was synthesized as previously reported ( 82 ). PCR primers were obtained from Integrated DNA technologies, Inc (Coraville, IA) and DNA sequencing reactions were performed by the DNA sequencing core of the Interdisciplinary Center for Biotechnology Research at the University of Florida (Gainesville, FL ). Crystallization kits were purchased from Qiagen (Valencia, CA) or Molecular dimensions (Cambridge, UK) Obtaining a High Titer Viral Inoculum Old v iral inoculum with an estimated titer of 1 x 108 infectious particles/mL was used to infect 100 mL of Sf9 cells at 1 x 106 cells/mL with an MOI of 1 for 3 days at 28 C Sf9 cells were collected by centrifugation and the viral containing supernatant removed from the cellular pellet. Serial dilutions of the viral supernatant r anging from 101 to 108 were prepared and 100 L of each dilution was added to 50 L of cells (1 x 104 cells) in a 96 well plate. The virus and cells were covered with 2 drops of mineral oil

PAGE 121

121 and placed at 28 C for approximately 1 week. Importantly a c ontrol well with cells in the absence of virus was also prepared to monitor the health of uninfected cells The TCID50 was calculated according to the method of Reed and Muench (142) using equation 4-1 In the equation, A i s the last dilution where all lanes are infected, B is the correction factor for the dilution of the virus, C is the number of infected wells in the lane after the lane where all cells are infected (the lane used to get the value of A) plus any infected wells in the preceding lane, and D is the number of wells used for inoculation of each viral dilution 50= 10 10 10 / 100 5 (4 1) Expression and Purification of hASNS for C rystallization hASNS was expressed and purified as desc ribed in C hapter 2. Following purification, the enzyme was diluted approximately 2 fold with dialysis buffer, shipped to Germany, and stored on ice until crystallization experiments commenced. No glycerol was added to the purified enzyme and it was never frozen prior to crys tallization experiments. Inhibition of hASNS with DON hASNS (12 g) was incubated with 15 mM DON for 20 minutes at room temperature in a total volume of 17 L. Excess DON was removed by filtration using 30,000 nominal molecular weight limit (Daltons) Mic rocon Centrif ugal Filter Devices spin column (Mill ipore Corporation, Bedford, MA). A control reaction was prepared in the same manner except no DON was added to the solution. Glu taminase activity was determined by incubation of free enzyme or the EDON com plex in the presence of 100 mM EPPS, pH 8.0, 10 mM NaCl, 8 mM MgCl2, and 25 mM L-Gln in a 200 L total volume After 20 minutes the reaction was quenched by the addition of 30 L of 20%

PAGE 122

122 TCA and the amount of glutamine produced was determined using the glutamatic dehydrogenase coupled assay as detailed in C hapter 2. Inhibition of hASNS with AMP -CPP hASNS (2.4 g) was incubated with AMP -CPP (0 mM, 0.1mM, or 1 mM) in the presence of 100 mM EPPS, pH 8.0, 10 mM Asp, 100 mM NH4Cl, 10 mM MgCl2, and 350 L of pyrophos phate reagent in a 1 mL volume for 10 minutes at room temperature. The reaction was initiated by the addition of 0.5 mM ATP (10 L of 50 mM ATP) and the production of pyrophosphate monitored at 340 nm for 10 minutes at 37 C for the using the coupled enzyme assay (Sigma Technical Bulletin No. BI -10 ). Preparation of hASNS for Crystallization T rials Purified protein was concentrated to 10 mg/mL using an Amicon Ultra 15 c entrifugal filter unit with U ltracel -30 membrane (Mill ipore Corporation, Bedford, MA). Enzyme was incubated with 15 mM DON for 30 min at room temperature and excess DON was removed by dialysis versus 50 mM EPPS, pH 8.0, 100 mM NaCl, and 5 mM DTT. In trials involving the N adenylated sulfoximine, a final con centration of either 200 M or 1 mM was added to the EDON complex prior to plate set -up (see Table 43). The final concentration of MgCl2 when present, was 10 mM. Protein concentrations were determined by measuring the absorbance at 280 nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific San Jose, CA ) and the calculated extinction coefficient for hASNS ( = 80,220 M1 cm1). Crystallization T rials of hASNS All screens were performed using the sitting drop method. Manual screens were set -up as 96 well plates on MRC 3 well crystallization plates (Hampton Research, Aliso Viejo, CA) using 0.5 L of the protein solution mixed with 0.5 L of the mother liquor.

PAGE 123

123 High -throughput screens were performed using the high -throughput crystallization faci lity at EMBL Hamburg at DESY in Hamburg, Germany (144). Table 4 -3 lists of all of the screening suites used in these trials as well which ligands were present The detailed compositions of each screening suite can be found online at www.moleculardimensions.com or www.qiagen.com O ptimization screen of the Qiagen PACT conditions was performed by varying the concentration of PEG 3350 from 1030% in 5% increments while also varying the concentration of sodium tartrate and sodium sulfate from 0.10.5 M in 0.1 M increments. Cloning, Expression and Purification of His6-tagged AS B Truncation Mutants The pet 21-c (+) vector containing the asnB insert followed by a polyhistidine tag was used as a template and primers were designed to anneal t o the 6X polyhistidine tag of the gene and the last residue desired in the truncation mutant. One primer contained a 5 phosphate group to allow for re ligation of the vector following PCR. Reactions consisted of 125 ng of each primer, 5 ng of template DNA, 20 0 M dNTPs, 1X Pfu turbo buffer, and 1 L (2.5 U) of Pfu turbo DNA polymerase in a 50 L volume. Reactions were heated at 95 C for 30 seconds, cooled to 55 C for 30 seconds, and then heated at 68 C for 7 minutes. This cycle was repeated 16 times and th e resulting reactions were purified using Wizard PCR preps DNA purification kit (Promega, Madison, WI). Purified DNA was treated with Dpn1 to digest methylated template DNA and ligated overnight at 16 C using T4 DNA ligase. Ligation reactions were used to transform JM109 E. coli cells. Successful transformants were purified and sequenced to confirm the desired mutation. His6-tagged truncation mutants were expressed and purified as detailed for His6-tagged wild type enzyme as described in Chapter 3.

PAGE 124

124 Table 4 3. List of experimental conditions screened for crystallization of hASNS Screen Manufacturer Protein concentration Ligands Manual or HTS JCSG plus Molecular dimensions 10 mg/mL DON a Manual Classics Qiagen 7 mg/mL DON, sulfoximine b HTS Classics II Qiagen 7 mg/mL DON, sulfoximine HTS PEG Qiagen 7 mg/mL DON, sulfoximine HTS AmSO 4 Qiagen 7 mg/mL DON, sulfoximine HTS Classic Qiagen 3.5 mg/mL DON HTS Classics II Qiagen 3.5 mg/mL DON HTS PEG II Qiagen 3.5 mg/mL DON HTS PACT Qiagen 3.5 mg/ mL DON HTS pH Clear Qiagen 3.5 mg/mL DON HTS Morpheus Molecular dimensions 3.5 mg/mL None Manual Morpheus Molecular dimensions 3.5 mg/mL DON Manual Morpheus Molecular dimensions 3.5 mg/mL DON, sulfoximine, MgCl2 Manual ProPlex Molecular dimensions 3.5 mg/mL None Manual ProPlex Molecular dimensions 3.5 mg/mL DON Manual ProPlex Molecular dimensions 3.5 mg/mL DON, sulfoximine, MgCl2 c Manual JCSG plus Molecular dimensions 3.5 mg/mL DON, sulfoximine d MgCl 2 Manual a Concentration of DON used in all trials was 15 mM b Sulfoximine refers to the N adenylated sulfoximine. Concentration used in all trials was 200 M. c Concentration of MgCl2 used in all trials was 10 mM. d Concentration used in this trial was 1 mM.

PAGE 125

125 Characterization of His6tagged AS B Truncation M utants G l utaminase activity was determined by incubating reactions containing enzyme (1.5 g), 100 mM EPPS, pH 8.0, 100 mM NaCl, 8 mM MgCl2, and varied concentrations of L -glutamine (between 0.2 50 mM ) in a 200 L volume for 20 minutes at 37 C before quenching with TCA to a final concentration of 4% (v/v) This solution was added to the coupled enzyme assay solution for Lglutamic dehydrogenase (Signma G2626) as detailed in C hapter 2. Production of pyrophosphate (PPi) was monitored spectrophotometrically during the AS -B reaction using a coupled enzyme assay ( Sigma Technical Bulletin No. BI 100). The reaction consisted of 100 mM EPPS pH 8 .0 5 mM ATP, 100 mM NH4Cl or 20 mM L-glutamine 10 mM MgCl2, 20 mM aspartic acid and 350 L of PPi reagent in a 1 mL total volume. Reactions were initiated by the addition of 2 -4 g of enzyme and monitored at 37 C for 20 min. The amount of PPi produced was determined by moni toring the c hange in absorbance at 340 n m using the coupled enzyme assay. Asparagine and glutamate production was determined using an HPLC based end-point assay following methods previously described (47 ) and detail ed in C hapter 3. Briefly, r eactions containing enzyme (2 -4 g) and 100 mM EPPS pH 8 .0 5 mM ATP, 100 mM NH4Cl or 20 mM L -glutamine, 10 mM MgCl2, and 10 mM aspartic acid in a 1 mL volume were incubated for 20 minutes at 37 C before being quenched with TC A (4%). A mino acids were derivatized using 2,4 dinitrofluorobenzene and separated using a reverse phase HPLC C18 Microsorb column (Varian Palo Alto, CA ) using step gradient of 40 mM formic acid, pH 3.6 and acetonitrile. Derivitized amino acids were dete cted at 365 nm and the concentration quantified by comparison to authentic standards.

PAGE 126

126 Crystallization T rials and SAXS measurements of His6-ta gged AS -B and Truncation M utants His6-tagged truncation mutants were concentrated using an Amicon Ultra 15 Centrifugal filter unit with Ultracel 30 membrane to 5 mg/mL. Enzyme was incubated with 15 mM DON for 30 min at room temperature and excess DON was removed by dialysis versus 50 mM HEPES, pH 8.0, 100 mM NaCl, and 1 mM DTT. The EDON complex was t reated with 1 mM of the N adenylated sulfoximine and 10 mM of MgCl2. Trials were set -up using the JCSG plus suite and with a 1:1 ratio of protein to mother liquor and stored at 25 C Protein concentrations were determined by measuring the absorbance at 2 80 nm using a NanoDrop 2000 spectrophotometer(Thermo Scientific San Jose,CA ) and the calculated extinction coefficient for AS -B ( = 93,21 0 M1 cm1). Samples for SAXS analysis were the apo enzyme concentrated to 5 mg/mL. Measurements were collected by Dr Petri Kursula, University of Oulu, Oulu, Finland.

PAGE 127

127 CHAPTER 5 CONCLUSIONS AND FUTURE WORK Conclusions Inhibition of hASNS The identification of the N adenylated sulfoximine, potent inhibitor of hASNS that suppresses the proliferation of drug -resistant MOLT -4 cells re-ignited the search for new inhibitors of hASNS that could be used in the clinical treatment of ALL. The goal of the first functional analogs was to substitute more druglike functional groups for the phosphate moiety of the N adenylated sulfoximine. It was anticipated that these compounds would exhibit similar binding affinity but improved bioavailability. S teady state kinetic characterization of these compounds found that the presence of a l ocalized negative charge that mimics the phosphate group is key to inhibitor recognition within the active site. This finding is further supported by a computational model of AS -B, where a conserved lysine residue was found to be positioned directly above the phosphate group. Mutagenesis of this residue results in catalytically inactive enzyme. This conclusion places a further constraint on the design of sulfoxmine -derived compounds and the discovery of ASNS inhibitors with increased potency and bioavail ability. Functional Role of a Conserved Glutamate Residue A key step in the mechanism of AS -B is the deprotonation of ammonia in the tetrahedral transition state prior to formation of asparagine and AMP. A computational model with the N adenylated sulfox imine docked into the synthetase active site suggested that a conserved glutamate residue (E348) is correctly positioned to act as the general base in this reaction. However, 18O -isotopic labeling experiments and

PAGE 128

128 functional characterization of this residu e suggest it is critical to formation of the AspAMP intermediate. Crystallization of hASNS and AS B The use of DON and the N adenylated sulfoxmine was shown to be a viable approach to the crystallization of hASNS and AS -B. Unfortunately initial crysta llization trials involving hASNS did not produce any crystals suitable for diffraction. However, several important issues were resolved that will aid in future crystallization trials. Although preliminary screens involving truncation mutants did not yield crystals suitable for diffraction, results were more promising than screens involving full -length AS -B. Therefore, these mutants may represent a viable method for obtaining crystals of the enzyme by removing a highly flexible and unordered portion of the protein. Work on these mutants as well as hASNS is currently ongoing in collaboration with Dr. Inari Ku at DESY in Hamburg, Germany Future Work Design of Future I nhibitors Although initial efforts to obt ain inhibitors with more druglike funct ionality le d to compounds which were weaker inhibitors of hASNS much information was gained in the characterization of these compounds New molecules must contain a localized negative charge to maintain the critical electrostatic interaction with the lys ine side chain. New compounds will strive to replace the adenosyl moiety with heterocycles as well as alter the charged c arboxylate and amine groups Also, the use of prodrugs should be explored. In addition, stu dies involving the fate of the N adenylat ed sulfoximine, when given to MOLT -4 cells will help to guide the development of future inhibitors of ASNS.

PAGE 129

129 Crystallization of hASNS M ore effort must be put forth in order to obtain a crystal suitable for X -ray crystallography experiments. hASNS eithe r in the EDON form or EDON /sulfoximine form has been through a rigorous screening process with no success Although the use of a poly histidine tag is helpful during the purification process, these tags are often removed prior to crystallography screens. These tags are usually thought to be floppy and prevent the protein from cry stallization. In the case of ASNS, we hypothesize that the C -terminal tail is already in motion, since it is not visible in the E. coli crystal structure. Therefore it is like ly that the C terminal poly histidine tag is also in motion. It would be beneficial to re -design the baculovirus expression system to contain a cleavage site that will allow for the removal of the poly -histidine tag following purifi cation. Another viable option for crystallography screens is t o prepare the C1A mutant of hASNS. This mutant binds but does not hydrolyze glutamine ( 130), and was used previously in the determination of the crystal structure of AS -B ( 58). Finally, a recent crystal structure was obtained by limited proteolysis of the protein with trypsin to remove the solvent accessible and flexible regions of the protein prior to crystallization (148) and this technique should be explored for use with hASNS. Expression of hASNS in E. coli Although the baculovirus expre ssion system is successful in the expression and purification of milligram quantit ies of enzyme, it is expensive and time consuming to prepare mutant forms of the enzyme due to re-transfect ing and prepar ing a high titer viral stock for each desired mutant. Ideally, expression of the human enzyme in E. coli would allow for large quantities of the enzyme to be produced and mutants to be prepared and characterized in a much shorter time period. Previous attempts to

PAGE 130

130 express the enzyme in E. coli or yeast were unsuccessful ( 41, 42). However, protein expression technologies evolved over the past few decades and the use of fusion proteins has allowed for successful and soluble expression of many eukaryotic proteins in E. coli (149, 150) ASNS presents a difficult challenge in the use of N -terminal fusion proteins because the Cys 1 residue is catalytic and absolutely required for glutaminedependent activity. Therefore, cleava ge of the N -terminal fusion protein must occur to leave cysteine as the first residue of the protein. Tobacco etch virus protease (TEV) represents a viable solution to this problem as it has been shown to cleave with a variety of amino acid residues in the P1 position (151) Furthermore, cleavage of an N terminal His -tag of AS -B resulted in an enzyme with unaltered ki netics for the glutamine dependent reaction (Meyer, unpublished) This provide s evidence that cleavage of an N -terminal tag from ASNS by TEV is a viable approach for production of h ASNS and the use of fusion protein for the expression of hASNS should be explored. Thrombin C leavage of His6-tagged AS B Although it was not necessary for kinetic experiments involving AS B, removal of the 6X poly -histidine tag by thrombin may be beneficial to future work involving crystallization of AS-B. Thrombin contains multiple disulfide bonds and reducing agents sever ely affect its catalytic activity ( 152). On the other hand, reducing agents, such as DTT and TCEP must be used when working with AS -B in order to keep the crit ical Cys 1 residue of the protein reduced. Therefore, these two opposing conditions must be carefully balanced. Unfortunately, preliminary experiments using thrombin yielded poor cleavage and inactive enzyme. Future work involving the cleavage reaction may find optimal conditions for cleavage that yield fully cut and active enzyme which would be

PAGE 131

131 better suited for future crystallography trials. Furthermore, the use of other cleavage sites, such as TEV ( 151) and TVMV ( 153), that do not contain critical disulfide bonds may represent a better alternative to cleavage of the poly histidine tag from AS -B. ASNS from Mycobacterium tuberculosis In 2006, Ren and Liu reported that inactivation of asnB gene in Mycobacterium smegmatis has a dramatic effect on the sensitivity of M. smegmatis to ant ibiotics such as rifampinn, erythromycin,and novobiocin (154) Given that most mycobacterium are resistant t o common antibiotics this finding suggests that inhibition of the asnB gene in M. tuberculosis represents a method to re-sensitize the mycobacterium to antibiotics for the treatment of tuberculosis. Although no further work has been done regarding this correlation, characterization of ASNS from M. tuberculosis may give insight into differences between the human and mycobacterium forms of the enzyme and suggest a potential way to develop a specific inhibitor of the M. tuberculosis enzyme.

PAGE 132

132 APPENDIX A PROT EIN AND DNA SEQUENCE S OF ASPARAGINE SYNT HETASE 1 atgtgttcaa tttttggcgt attcgatatc aaaacagacg cagttgagct gcgtaagaaa 61 gccctcgagc tgtcacgcct gatgcgtcat cgtggcccgg actggtccgg tatttatgcc 121 agcgataacg ccattctcgc ccacgaacgt ctgtcaattg ttgacgttaa cgcgggggcg 181 caacctctct acaaccaaca aaaaacccac gtactggcgg taaacggtga aatctacaac 241 caccaggcat tgcgcgccga atatggcgat cgttaccagt tccagaccgg gtctgactgt 301 gaagtgatcc tcgcgctgta tcaggaaaaa gggccggaat ttctcgacga cttgcagggc 361 atgtttgcct ttgcactgta cgacagcgaa aaagatgcct acctgattgg tcgcgaccat 421 ctggggatca tcccactgta tatggggtat gacgaacacg gtcagctgta tgtggcctca 481 gaaatgaaag cgctggtgcc agtttgccgc acgattaaag agttcccggc ggggagctat 541 ttgtggagcc aggacggcga aatccgttct tactatcatc gcgactggtt cgactacgat 601 gcggtgaaag ataacgtgac cgacaaaaac gagctgcgtc aggcactgga agattcagtt 661 aaaagccatc tgatgtctga tgtgccttac ggtgtgctgc tttctggtgg tctggattcc 721 tcaattattt ccgctat cac caagaaatac gcagcccgtc gcgtggaaga tcaggaacgc 781 tctgaagcct ggtggccgca gttacactcc tttgctgtag gtctgccggg ttcaccggat 841 ctgaaagcag cccaggaagt ggcaaaccat ctgggcacgg tgcatcacga aattcacttc 901 actgtacagg aaggtctgga tgccatccgc gacgtgattt accacatcga aacttatgat 961 gtgaccacta ttcgcgcttc aacaccgatg tatttaatgt cgcgtaagat caaggcgatg 1021 ggcattaaaa tggtgctgtc cggtgaaggt tctgatgaag tgttcggcgg ttatctttac 1081 ttccacaaag caccgaatgc caaagaactg catgaagaga cggtgcgtaa actgctggcc 114 1 ctgcatatgt atgactgcgc gcgtgccaac aaagcgatgt cagcctgggg cgtggaagca 1201 cgcgttccgt tcctcgacaa aaaattcctt gatgtggcga tgcgtattaa cccacaggat 1261 aaaatgtgcg gtaacggcaa aatggaaaaa cacatcctgc gtgaatgttt tgaagcgtat 1321 ctgcctgcaa gcgtggcctg gcggcagaaa gagcagttct ccgatggcgt cggttacagt 1381 tggatcgaca ccctgaaaga agtggctgcg cagcaggttt ctgatcagca actggaaact 1441 gcccgcttcc gcttcccgta caacacgcca acctctaaag aagcgtactt gtatcgggag 1501 atctttgaag aactattccc gcttccgagc gccgctgagt gcgtgccggg cggtccttcc 1561 gtcgcttgtt cttccgctaa agcgatcgaa tgggatgaag cgttcaagaa aatggacgat 1621 ccgtctggtc gcgcggttgg tgttcaccag tcggcgtata agctcgttcc acgcggcagc 1681 caccaccacc accaccac tg a Figure A 1. DNA sequence of asnB followed by a thrombin cleavage sequence and poly histidine tag sequence (underlined) 1 csifgvfdi ktdavelrkk alelsrlmrh rgpdwsgiya sdnailaher lsivdvnaga 61 qplynqqkth vlavngeiyn hqalraeygd ryqfqtgsdc evilalyqek gpeflddlqg 121 mfafalydse kdayligrdh lgiiplymgy dehgqlyvas emkalvpvcr tikefpagsy 181 lwsqdgeirs yyhrdwfdyd avkdnvtdkn elrqaledsv kshlmsdvpy gvllsgglds 241 siisaitkky aarrvedqer seawwpqlhs favglpgspd lkaaqevanh lgtvhheihf 301 tvqegldair dviyhie tyd vttirastpm ylmsrkikam gikmvlsgeg sdevfggyly 361 fhkapnakel heetvrklla lhmydcaran kamsawgvea rvpfldkkfl dvamrinpqd 421 kmcgngkmek hilrecfeay lpasvawrqk eqfsdgvgys widtlkevaa qqvsdqqlet 481 arfrfpyntp tskeaylyre ifeelfplps aaecvpggps vacssakaie wdeafkkmdd 541 psgravgvhq sayk lvprgs hhhhhh Figure A2. Protein sequence of AS -B. Underlined residues correspond to the C terminal thrombin cleavage site and 6X poly -histidine tag

PAGE 133

133 1 atgtgtggca tttgggcgct gtttggcagt gatgattgcc tttctgttca gtgtctgagt 61 gctatgaaga ttgcacacag aggtccagat gcattccgtt ttgagaatgt caatggatac 121 accaactgct gctttggatt tcaccggttg gcggtagttg acccgctgtt tggaatgcag 181 ccaattcgag tgaagaaata tccgtatttg tggctctgtt acaatggtga aatctacaac 241 cataagaaga tgcaacagca ttttgaattt gaataccaga ccaaagtgga tggtgagata 301 atccttcatc tttatgacaa aggaggaatt gagcaaacaa tttgtatgtt ggatggtgtg 361 tttgcatttg ttttactgga tactgccaat aagaaagtgt tcctgggtag agatacatat 421 ggagtcagac ctttgtttaa ag caatgaca gaagatggat ttttggctgt atgttcagaa 481 gctaaaggtc ttgttacatt gaagcactcc gcgactccct ttttaaaagt ggagcctttt 541 cttcctggac actatgaagt tttggattta aagccaaatg gcaaagttgc atccgtggaa 601 atggttaaat atcatcactg tcgggatgaa cccctgcacg ccctctatga caatgtggag 661 aaactctttc caggttttga gatagaaact gtgaagaaca acctcaggat cctttttaat 721 aatgctgtaa agaaacgttt gatgacagac agaaggattg gctgcctttt atcagggggc 781 ttggactcca gcttggttgc tgccactctg ttgaagcagc tgaaagaagc ccaagtacag 841 tatcctctcc agacatttgc aattggcatg gaagacagcc ccgatttact ggctgctaga 901 aaggtggcag atcatattgg aagtgaacat tatgaagtcc tttttaactc tgaggaaggc 961 attcaggctc tggatgaagt catattttcc ttggaaactt atgacattac aacagttcgt 1021 gcttcagtag gtatgta ttt aatttccaag tatattcgga agaacacaga tagcgtggtg 1081 atcttctctg gagaaggatc agatgaactt acgcagggtt acatatattt tcacaaggct 1141 ccttctcctg aaaaagccga ggaggagagt gagaggcttc tgagggaact ctatttgttt 1201 gatgttctcc gcgcagatcg aactactgct gcccatggtc ttgaactgag agtcccattt 1261 ctagatcatc gattttcttc ctattacttg tctctgccac cagaaatgag aattccaaag 1321 aatgggatag aaaaacatct cctgagagag acgtttgagg attccaatct gatacccaaa 1381 gagattctct ggcgaccaaa agaagccttc agtgatggaa taacttcagt taagaattcc 144 1 tggtttaaga ttttacagga atacgttgaa catcaggttg atgatgcaat gatggcaaat 1501 gcagcccaga aatttccctt caatactcct aaaaccaaag aaggatatta ctaccgtcaa 1561 gtctttgaac gccattaccc aggccgggct gactggctga gccattactg gatgcccaag 1621 tggatcaatg ccactgaccc ttctgcccgc acgctgaccc actacaagtc agctgtcaaa 1681 gctgaacaa aaactcatc tcagaagag gatctgctc gagcaccac caccaccac 1741 cactag Figure A 3. DNA sequence of hASNS. Underlined sequences correspond to the C terminal c -myc and 6X poly histidine tag. 1 cgiw alfgs ddclsvqcls amkiahrgpd afrfenvngy tnccfgfhrl avvdplfgmq 61 pirvkkypyl wlcyngeiyn hkkmqqhfef eyqtkvdgei ilhlydkggi eqticmldgv 121 fafvlldtan kkvflgrdty gvrplfkamt edgflavcse akglvtlkhs atpflkvepf 181 lpghyevldl kpngkvasve mvkyhhcrdv plhalydnve klfpgfeiet vknnlrilfn 241 navkkrlmtd rrigcllsgg ldsslvaatl lkqlkeaqvq yplqtfaigm edspdllaar 301 kvadhigseh yevlfnseeg iqaldevifs letydittvr asvgmylisk yirkntdsvv 361 ifsgegsdel tqgyiyfhka pspekaeees erllrelylf dvlradrtta ahglelrvpf 421 ldhrfssyyl slppemripk ngiekhllre tfedsnlipk eilwrpkeaf sdgitsvkns 481 wfkilqeyve hqvddamman aaqkfpfntp ktkegyyyrq vferhypgra dwlshywmpk 541 winatdpsar tlthyks avk aeqkliseedllehhhhhh Figure A 4. Protein sequence of hASNS. Underlined residues correspond to the C terminal c -myc and 6X poly histidine tag.

PAGE 134

134 APPENDIX B PRIMERS USED FOR MUTAGENSIS AND CLONING Table B -1. Sequence of primers for cloning and site -directed mutagenesis studies Primer Sequence 5 3 HisAS B forward PHOSCGCGGCAGCCACCACCACCACCAC HisAS B reverse TGGAACGAGCTTATACGCCGACTGGT K44R forward CTGGCGGCAGCGTGAGCAGTTCTCC K449R reverse GGAGAACTGCTCACGCTGCCGCCAG K449A forward TGGCGGCAGGCAGAGCAGTTCTCC K449A reverse GGAGAACTGCTCTGCCTGCCGCCAG E348D forward GGTGCTGTCCGGT GAT GGTTCTGATGAAGTG E348D reverse CACTTCATCAGAACC ATC ACCGGACAGCACC E348A forward GGTGCTGTCCGGT GCT GGTTCTGATGAAGTG E348A reverse CACTTCATCAGAACC AGC ACCGGACAGCACC E348Q forward GGTGCTGTCCGGTCAAGGTTCTGATG E348Q reverse CACATCAGAACCTTGACCGGACA AS B delta 10 reverse TGGAACGAGGCGACCAGACGGAT AS B delta 20 reverse TGGAACGAGCGCTTCATCCCATTC AS B delta 30 reverse TGGAACGAGAGAACAAGCGACGGAA AS B delta 40 reverse TGGAACAAGGCACTCAGCGGCGCT

PAGE 135

135 APPENDIX C 31P NMR SPECTRA OF PIX EXPERIMENTS UTILIZING 18O6-ATP

PAGE 136

136 Figure C -1. Full 31P 18O6-ATP prior to the addition of enzyme. The triplet at -20 ppm, doublet at 10 ppm, and doublet at 4.5 ppm are the peaks for ATP. The other small speaks represent contaminants in the of 18O6ATP.

PAGE 137

137 Figure C -2. Full 31P NMR spectra of the PIX reaction of His6-AS incubated with L aspartic acid and 18O6ATP for 210 minut es. The triplet at 20 ppm, doublet at -10 ppm, and doublet at 4.5 ppm are the peaks for ATP. The other 18O6-ATP

PAGE 138

138 Figure C -3. Full 31P NMR spectra of the PIX reaction of E348A incubated with Lasparti c acid and 18O6-ATP for 210 minutes. The triplet at 20 ppm, doublet at -10 ppm, and doublet at 4.5 ppm are the peaks for ATP. The other 18O6-ATP

PAGE 139

139 Figure C -4. 31PMR spectra of the -P of ATP as a function of time. A) -P of ATP in the presence of His6-tagged AS -B, [ -18O6] ATP and aspartic acid. B) -P of ATP in the presence of E348A, [ -18O6] -ATP and aspartic acid. B A

PAGE 140

14 0 Figure C -5. 31 31PMR spectra of the -P of ATP as a function of time. A) -P of ATP in the presence of His6-tagged AS -B, [ -18O6] -ATP and aspartic acid. B) -P of ATP in the presence of E348A, [ -18O6] -ATP and aspartic acid. A B

PAGE 141

141 L IST OF REFERE NCES 1. (2008) Cancer Facts and Figures 2008, American Cancer Society. 2. Ertel, I. J., Nesbit, M. E., Hammond, D., Weiner, J., and Sather, H. (1979) Effective Dose of L -Asparaginase for Induction of Remission in Previously Treated Children with Acute Lymphocytic -Leukemia Report from Childrens Cancer Study -Group, Cancer Res. 39 38933896. 3. Clarkson, B., Krakoff, I., Burchenal, J., Karnofsky, D., Golbey, R., Dowling, M., Oettgen, H., and Lipton, A. (1970) Clinical results of treatment with E. coli Lasparagin ase in adults with leukemia, lymphoma, and solid tumors, Cancer 25 279-305. 4. Muller, H. J., and Boos, J. (1998) Use of Lasparaginase in childhood ALL, Crit. Rev. Oncol. Hematol. 28, 97 -113. 5. Aghaiypour, K., Wlodawer, A., and Lubkowski, J. (2001) St ructural basis for the activity and substrate specificity of Erwinia chrysanthemi Lasparaginase, Biochemistry 40, 5655 -5664. 6. Graham, M. L. (2003) Pegaspargase: a review of clinical studies, Adv. Drug Delivery Rev. 55 12931302. 7. Broome, J. D. (1981) L-Asparaginase: discovery and development as a tumor inhibitory agent, Cancer Treat. Rep. 65 Suppl 4 111-114. 8. Ueno, T., Ohtawa, K., Mitsui, K., Kodera, Y., Hiroto, M., Matsushima, A., Inada, Y., and Nishimura, H. (1997) Cell cycle arrest and apoptosis of leukemia cells induced by Lasparaginase, Leukemia 11 18581861. 9. Cooney, D. A., and Handschumacher.Re. (1970) L-Asparaginase and LAsparagine Metabolism, Annu. Rev. Pharmacol. 10 421-&. 10. Ohnuma, T., Holland, J. F., Freeman, A., and Sinks, L. F. (1970) Biochemical and Pharmacological Studies with Asparaginase in Man, Cancer Res. 30 22972305. 11. Haskell C. M., and Canellos, G. P. (1969) Lasparaginase resistance in human leukemia --asparagine synthetase, Biochem. Pharmacol. 18 25782580. 12. Prager, M. D., and Bachynsky, N. (1968) Asparagine synthetase in normal and malignant tissues: correlation with tumor sensitivity to asparaginase, Arch. Biochem. Biophys. 127, 645654.

PAGE 142

142 13. Leslie, M., Case, M. C., Hall, A. G., and Coulthard, S. A. (2006) Expression levels of asparagine synthetase in blasts from children and adults with acute lymphoblastic leukaemia, Br. J. Haematol. 132 740 -742. 14. Kiriyama, Y., Kubota, M., Takimoto, T., Kitoh, T., Tanizawa, A., Akiyama, Y., and Mikawa, H. (1989) Biochemical characterization of U937 cells resistant to Lasparaginase: the role of asparagine synthetase, Leukemia 3 294 -297. 15. Hutson, R. G., Kitoh, T., Amador, D. A. M., Cosic, S., Schuster, S. M., and Kilberg, M. S. (1997) Amino acid control of asparagine synthetase: Relation to asparaginase resistance in human leukemia cells, Am. J. Physiol. Cell. Physiol. 41, C1 691-C1699. 16. Horowitz, B., Madras, B. K., Meister, A., Old, L. J., Boyse, E. A., and Stockert, E. (1968) Asparagine Synthetase Activity of Mouse Leukemias, Science 160, 533535. 17. Prager, M. D., and Bachynsky, N. (1968) Asparagine synthetase in aspar aginase resistant and susceptible mouse lymphomas, Biochem. Biophys. Res. Commun. 31, 43 -47. 18. Broome, J. D., and Schwartz, J. H. (1967) Differences in the production of l asparagine in asparaginase-sensitive and resistant lymphoma cells, Biochim. Bioph ys. Acta Nucleic Acids and Protein Synthesis 138 637 -639. 19. Fine, B. M., Kaspers, G. J. L., Ho, M., Loonen, A. H., and Boxer, L. M. (2005) A GenomeWide View of the In vitro Response to L -Asparaginase in Acute Lymphoblastic Leukemia, Cancer Res. 65 29 1 299. 20. Stams, W. A. G., den Boer, M. L., Beverloo, H. B., Meijerink, J. P. P., Stigter, R. L., van Wering, E. R., Janka-Schaub, G. E., Slater, R., and Pieters, R. (2003) Sensitivity to L asparaginase is not associated with expression levels of asparag ine synthetase in t(12;21)+ pediatric ALL, Blood 101 27432747. 21. Appel, I. M., den Boer, M. L., Meijerink, J. P. P., Veerman, A. J. P., Reniers, N. C. M., and Pieters, R. (2006) Up-regulation of asparagine synthetase expression is not linked to the cl inical response Lasparaginase in pediatric acute lymphoblastic leukemia, Blood 107, 4244 -4249. 22. Lorenzi, P. L., and Weinstein, J. N. (2009) Asparagine Synthetase: A New Potential Biomarker in Ovarian Cancer, Drug News Perspect. 22 61 64.

PAGE 143

143 23. Lorenzi, P. L., Reinhold, W. C., Rudelius, M., Gunsior, M., Shankavaram, U., Bussey, K. J., Scherf, U., Eichler, G. S., Martin, S. E., Chin, K., Gray, J. W., Kohn, E. C., Horak, I. D., Von Hoff, D. D., Raffeld, M., Goldsmith, P. K., Caplen, N. J., and Wein stein, J. N. (2006) Asparagine synthetase as a causal, predictive biomarker for Lasparaginase activity in ovarian cancer cells, Mol. Cancer Ther. 5 26132623. 24. Aslanian, A. M., Fletcher, B. S., and Kilberg, M. S. (2001) Asparagine synthetase expressi on alone is sufficient to induce l asparaginase resistance in MOLT -4 human leukaemia cells, Biochem. J. 357 321-328. 25. Gutierrez, J. A., Pan, Y. X., Koroniak, L., Hiratake, J., Kilberg, M. S., and Richards, N. G. J. (2006) An inhibitor of human asparagine synthetase suppresses proliferation of an Lasparaginase -resistant leukemia cell line, Chem. Biol. 13, 1339 -1347. 26. Zalkin, H., and Smith, J. L. (1998) Enzymes utilizing glutamine as an amide donor, Adv. Enzymol. Relat. Areas Mol. Biol. 72, 87 -144. 27. Dang, V. -D., Valens, M., Bolotin -Fukuhara, M., and Daignan -Fornier, B. (1996) Cloning of the asns1 and asns2 genes enc oding asparagine synthetases in Saccharomyces cerevisiae : differential regulation by the CCAAT -box binding factor, Mol. Microbiol. 22 681692. 28. Reitzer, L. J., and Magasanik, B. (1982) Asparagine Synthetases of Klebsiella aerogenes: Properties and Reg ulation of Synthesis, J. Bacteriol. 151, 1299 -1313. 29. Fresquet, V., Thoden, J. B., Holden, H. M., and Raushel, F. M. (2004) Kinetic mechanism of asparagine synthetase from Vibrio cholerae, Bioorg. Chem. 32 6375. 30. Scofield, M., Lewis, W., and Schus ter, S. (1990) Nucleotide sequence of Escherichia coli asnB and deduced amino acid sequence of asparagine synthetase B, J. Biol. Chem. 265 12895-12902. 31. Rognes, S. E. (1975) Glutamine dependent asparagine synthetase from Lupinus luteus, Phytochemistry 14 19751982. 32. Streeter, J. G. (1973) In vivo and in vitro studies on asparagine biosynthesis in soybean seedlings, Arch. Biochem. Biophys. 157 613-624. 33. Andrulis, I. L., Chen, J., and Ray, P. N. (1987) Isolation of human cDNAs for asparagine sy nthetase and expression in Jensen rat sarcoma cells, Mol. Cell. Biol. 7 24352443.

PAGE 144

144 34. Sheng, S., Moraga, D. A., Van Heeke, G., and Schuster, S. M. (1992) High-level expression of human asparagine synthetase and production of monoclonal antibodies for enz yme purification, Protein Expression Purif. 3 337-346. 35. Hongo, S., and Sato, T. (1983) Some molecular properties of asparagine synthetase from rat liver, Biochim. et Biophys. Acta, Protein Structure and Mol. Enzymol. 742, 484489. 36. Luehr, C. A., and Schuster, S. M. (1985) Purification and characterization of beef pancreatic asparagine synthetase, Arch. Biochem. Biophys. 237, 335 -346. 37. Markin, R. S., Luehr, C. A., and Schuster, S. M. (2002) Kinetic mechanism of beef pancreatic Lasparagine synthetase, Biochemistry 20 7226 -7232. 38. Mehlhaff, P. M., Luehr, C. A., and Schuster, S. M. (2002) Studies of the ammonia dependent reaction of beef pancreatic asparagine synthetase, Biochemistry 24, 1104 -1110. 39. Pfeiffer, N. E., Mehlhaff, P. M., Wylie, D. E., and Schuster, S. M. (1987) Topographical separation of the catalytic sites of asparagine synthetase explored with monoclonal antibodies, J Biol. Chem. 262, 1156511570. 40. Larsen, M. C., and Schuster, S. M. (1992) The topology of the glutamine and ATP binding sites of human asparagine synthetase, Arch. Biochem. Biophys. 299, 1522. 41. Van Heeke, G., and Schuster, S. M. (1990) Expression of human asparagine synthetase in Saccharomyces cerevisiae, Protein Eng. 3 739744. 42. Van Heeke, G., and Schuster, S. M. (1989) Expression of human asparagine synthetase in Escherichia coli, J. Biol. Chem. 264, 5503 -5509 43. Ciustea, M., Gutierrez, J. A., Abbatiello, S. E., Eyler, J. R., and Richards, N. G. (2005) Efficient expression, purification, and characterization of C terminally tagged, recombinant human asparagine synthetase, Arch Biochem Biophys 440, 1827. 44. Ikeuchi, H., Meyer, M. E., Di ng, Y., Hiratake, J., and Richards, N. G. J. (2009) A critical electrostatic interaction mediates inhibitor recognition by human asparagine synthetase, Bioorg. Med. Chem. 17 66416650. 45. Boehlein, S. K., Rosa-Rodriguez, J. G., Schuster, S. M., and Richards, N. G. J. (1997) Catalytic Activity of the N -Terminal Domain of Escherichia coli Asparagine Synthetase B Can Be Reengineered by Single-Point Mutation, J. Am. Chem. Soc. 119 57855791.

PAGE 145

145 4 6. Boehlein, S. K., Stewart, J. D., Walworth, E. S., Thirumoorthy, R., Richards, N. G., and Schuster, S. M. (1998) Kinetic mechanism of Escherichia coli asparagine synthetase B, Biochemistry 37 13230 -13238. 47. Tesson, A. R., Soper, T. S., Ciustea, M., a nd Richards, N. G. J. (2003) Revisiting the steady state kinetic mechanism of glutamine-dependent asparagine synthetase from Escherichia coli, Archives of Biochemistry and Biophysics 413, 2331. 48. Cedar, H., and Schwartz, J. H. (1969) The asparagine synthetase of Escherichia coli. II. Studies on mechanism, J. Biol. Chem. 244 41224127. 49. Nakatsu, T., Kato, H., and Oda, J. (1998) Crystal structure of asparagine synthetase reveals a close evolutionary relationship to class II aminoacyl tRNA synthetase, Nat. Struct. Biol. 5 15 19. 50. Schnizer, H. G., Boehlein, S. K., Stewart, J. D., Richards, N. G. J., and Schuster, S. M. (1999) Formation and Isolation of a Covalent Intermediate during the Glutaminase Reaction of a Class II Amidotransferase, Biochemis try 38 36773682. 51. Boehlein, S., Richards, N., and Schuster, S. (1994) Glutamine dependent nitrogen transfer in Escherichia coli asparagine synthetase B. Searching for the catalytic triad, J. Biol. Chem. 269 7450 7457. 52. Van Heeke, G., and Schuster, S. (1989) The N -terminal cysteine of human asparagine synthetase is essential for glutamine -dependent activity, J. Biol. Chem. 264, 1947519477. 53. Miles, B. W., and Raushel, F. M. (2000) Synchronization of the Three Reaction Centers within Carbamoyl Phosphate Synthetase Biochemistry 39 5051 -5056. 54. Kim, J. H., Krahn, J. M., Tomchick, D. R., Smith, J. L., and Zalkin, H. (1996) Structure and Function of the Glutamine Phosphoribosylpyrophosphate Amidotransferase Glutamine Si te and Communication with the Phosphoribosylpyrophosphate Site, J. Biol. Chem. 271, 1554915557. 55. Li, K. K., Beeson, W. T. t., Ghiviriga, I., and Richards, N. G. (2007) A convenient gHMQC based NMR assay for investigating ammonia channeling in glutamine dependent amidotransferases: studies of Escherichia coli asparagine synthetase B, Biochemistry 46 4840 -4849. 56. Markin, R. S., Luehr, C. A., and Schuster, S. M. (1981) Kinetic mechanism of beef pancreatic Lasparagine synthetase, Biochemistry 20 7226 -7232.

PAGE 146

146 57. Mullins, L. S., and Raushel, F. M. (1999) Channeling of Ammonia through the Intermolecular Tunnel Contained within Carbamoyl Phosphate Synthetase, Journal of the American Chemical Society 121 38033804. 58. Larsen, T. M., Boehlein, S. K., Schuster, S. M., Richards, N. G. J., Thoden, J. B., Holden, H. M., and Rayment, I. (1999) ThreeDimensional Structure of Escherichia coli Asparagine Synthetase B: A Short Journey from Substrate to Product, Biochemistry 38 16146-16157. 59. Richards, N. G ., and Schuster, S. M. (1998) Mechanistic issues in asparagine synthetase catalysis, Adv. Enzymol. Relat. Areas Mol. Biol. 72, 145198. 60. Tso, J. Y., Zalkin, H., van Cleemput, M., Yanofsky, C., and Smith, J. M. (1982) Nucleotide sequence of Escherichia coli purF and deduced amino acid sequence of glutamine phosphoribosylpyrophosphate amidotransferase., J. Biol. Chem. 257, 35253531. 61. Tso, J. Y., Hermodson, M. A., and Zalkin, H. (1982) Glutamine phosphoribosylpyrophosphate amidotransferase from cloned Escherichia coli purF. NH2-terminal amino acid sequence, identification of the glutamine site, and trace metal analysis., J. Biol. Chem. 257, 35323536. 62. Badet, B., Vermoote, P., Haumont, P. Y., Lederer, F., and Le Goffic, F. (2002) Glucosamine synthetase from Escherichia coli: purification, properties, and glutamine -utilizing site location, Biochemistry 26 19401948. 63. van den Heuvel, R. H. H., Curti, B., Vanoni, M. A., and Mattevi, A. (2004) Glutamate synthase: a fascinating pathway from Lglutam ine to L-glutamate, Cell. Mol. Life Sci. 61, 669681. 64. Bork, P., and Koonin, E. V. (1994) A P looplike motif in a widespread ATP pyrophosphatase domain: Implications for the evolution of sequence motifs and enzyme activity, Proteins: Struct., Funct., Genet. 20 347-355. 65. Tesmer, J. G., Klem, T. J., Deras, M. L., Davisson, V. J., and Smith, J. L. (1996) The crystal structure of GMP synthetase reveals a novel catalytic triad and is a structural paradigm for two enzyme families, Nat. Struct. Biol. 3 74 -86. 66. Lemke, C. T., and Howell, P. L. (2001) The 1.6 Crystal Structure of E. coli Argininosuccinate Synthetase Suggests a Conformational Change during Catalysis, Structure 9 11531164. 67. Sun, M., and Leyh, T. S. (2006) Channeling in Sulfate Act ivating Complexes Biochemistry 45, 1130411311.

PAGE 147

147 68. Bachmann, B. O., Li, R., and Townsend, C. A. (1998) Lactam synthetase: A new biosynthetic enzyme, Proc. Natl. Acad. Sci. U. S. A. 95, 9082 -9086. 69. Bachmann, B. O., and Townsend, C. A. (2000) Kinetic Mechanism of the Lactam Synthetase of Streptomyces clavuligerusae, Biochemistry 39 1118711193. 70. Miller, M. T., Gerratana, B., Stapon, A., Townsend, C. A., and Rosenzweig, A. C. (2003) Crystal Structure of Carbapenam Synthetase (CarA), J. Biol. Chem. 278, 40996-41002. 71. Mueller, E. G., and Palenchar, P. M. (1999) Using genomic information to investigate the function of ThiI, an enzyme shared between thiamin and 4thiouridine biosynthesis, Protein Sci. 8 2424 -2427. 72. Rizzi, M., Bolognesi, M., and Coda, A. (1998) A novel deamido NAD(+) -binding site revealed by the trapped NAD adenylate intermediate in the NAD(+) synthetase structure, Structure 6 11291140. 73. DeLano, W. L. (2008) The PyMOL Molecular Graphics System, DeLano Scientific Software LLC, Palo Alto, CA. 74. Miller, M. T., Bachmann, B. O., Townsend, C. A., and Rosenzweig, A. C. (2001) Structure of -lactam synthetase reveals how to synthesize antibiotics instead of asparagine, Nat. St ruct. Biol. 8 684689. 75. Miller, M. T., Bachmann, B. O., Townsend, C. A., and Rosenzweig, A. C. (2002) The catalytic cycle of lactam synthetase observed by x -ray crystallographic snapshots, Proc. Natl. Acad. Sci. U. S. A. 99 1475214757. 76. Parr, I. B., Boehlein, S. K., Dribben, A. B., Schuster, S. M., and Richards, N. G. (1996) Mapping the aspartic acid binding site of Escherichia coli asparagine synthetase B using substrate analogs, J. Med. Chem. 39 23672378. 77. Gutierrez, J. A. (2006) 2006, p 104, Univeristy of Florida, Gainesville, FL. 78. Cooney, D. A., Driscoll, J. S., Milman, H. A., Jayaram, H. N., and Davis, R. D. (1976) Inhibitors of L-Asparagine Synthetase, Invitro, Cancer Treat. Rep. 60 14931557. 79. Cooney, D. A., Jones, M. T., Milman, H. A., Young, D. M., and Jayaram, H. N. (1980) Regulators of the metabolism of asparagine: A search for endogenous inhibitors, Int. J. Biochem. 11 519539. 80. Wolfenden, R. (1969) Transition State Analogues for Enzy me Catalysis, Nature 223, 704-705.

PAGE 148

148 81. Koroniak, L., Ciustea, M., Gutierrez, J. A., and Richards, N. G. (2003) Synthesis and characterization of an N acylsulfonamide inhibitor of human asparagine synthetase, Org. Lett. 5 2033 2036. 82. Koizumi, M., Hirat ake, J., Nakatsu, T., Kato, H., and Oda, J. i. (1999) A Potent TransitionState Analogue Inhibitor of Escherichia coli Asparagine Synthetase A, Journal of the American Chemical Society 121 57995800. 83. Boehlein, S. K., Nakatsu, T., Hiratake, J., Thirum oorthy, R., Stewart, J. D., Richards, N. G. J., and Schuster, S. M. (2001) Characterization of Inhibitors Acting at the Synthetase Site of Escherichia coli Asparagine Synthetase B, Biochemistry 40, 1116811175. 84. Richards, N. G., and Kilberg, M. S. (200 6) Asparagine synthetase chemotherapy, Annu. Rev. Biochem. 75 629 -654. 85. Rooseboom, M., Jan N. M. Commandeur, Nico P. E. Vermeulen. (2004) Enzyme Catalyzed Activation of Anticancer Prodrugs, Pharmacol. Rev. 56 53 102. 86. Lipinski, C. A., Lombardo, F ., Dominy, B. W., and Feeney, P. J. (1997) Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings, Adv. Drug Delivery Rev. 23 3 25. 87. Shuman, D. A., Robins, R. K., and Robins, M. J. (2002) Synthesis of adenine 5' O -sulfamoyl nucleosides related to nucleocidin, J. Am. Chem. Soc. 91 33913392. 88. O'Brien, W. E. (1976) A continuous spectrophotometric assay for argininosuccinate synthetase based on pyrophosphate formation, Anal. Bioche m. 76, 423430. 89. Morrison, J. F., and Walsh, C. T. (1988) The behavior and significance of slow binding enzyme inhibitors, Adv. Enzymol. Relat. Areas Mol. Biol. 61 201-301. 90. Tokutake, N., Hiratake, J., Katoh, M., Irie, T., Kato, H., and Oda, J. i. (1998) Design, synthesis and evaluation of transition-state analogue inhibitors of Escherichia coli [gamma] -glutamylcysteine synthetase, Bioorg. Med. Chem. 6 19351953. 91. Hiratak e, J. (2005) Enzyme inhibitors as chemical tools to study enzyme catalysis: rational design, synthesis, and applications, Chem. Rec. 5 209-228.

PAGE 149

149 92. Campbell, E. B., Hayward, M. L., and Griffith, O. W. (1991) Analytical and preparative separation of the diastereomers of buthionine (SR) -sulfoximine, a potent inhibitor of glutathione biosynthesis, Anal. Biochem. 194, 268277. 93. Manning, J. M., Moore, S., Rowe, W. B., and Meister, A. (1969) Identification of L -methionine S -sulfoximine as the diastereoisom er of L methionine SR sulfoximine that inhibits glutamine synthetase, Biochemistry 8 2681 2685. 94. Wilmouth, R. C., Edman, K., Neutze, R., Wright, P. A., Clifton, I. J., Schneider, T. R., Schofield, C. J., and Hajdu, J. (2001) X -ray snapshots of serine protease catalysis reveal a tetrahedral intermediate, Nat. Struct. Biol. 8 689694. 95. Topf, M., Va rnai, P., and Richards, W. G. (2002) Ab Initio QM/MM Dynamics Simulation of the Tetrahedral Intermediate of Serine Proteases: Insights into the Active Site HydrogenBonding Network, J. Am. Chem. Soc. 124 1478014788. 96. Bernier, S., Akochy, P. M., Lapoi nte, J., and Chnevert, R. (2005) Synthesis and aminoacyl -tRNA synthetase inhibitory activity of aspartyl adenylate analogs, Bioorg. Med. Chem. 13 6975. 97. Heacock, D., Forsyth, C. J., Shiba, K., and MusierForsyth, K. (1996) Synthesis and aminoacyl -tRN A synthetase inhibitory activity of prolyl adenylate analogs, Bioorg. Chem. 24 273 -289. 98. Ueda, H., Shoku, Y., Hayashi, N., Mitsunaga, J., In, Y., Doi, M., Inoue, M., and Ishida, T. (1991) X -Ray Crystallographic Conformational Study of 5' O N -(L Alany l) -Sulfamoyl Adenosine, a Substrate -Analog for Alanyl Transfer Rna Synthetase, Biochim. Biophys. Acta 1080 126-134. 99. Larsen, T. M., Boehlein, S. K., Schuster, S. M., Richards, N. G., Thoden, J. B., Holden, H. M., and Rayment, I. (1999) Threedimension al structure of Escherichia coli asparagine synthetase B: a short journey from substrate to product, Biochemistry 38 1614616157. 100. Quadri, L. E. N., Sello, J., Keating, T. A., Weinreb, P. H., and Walsh, C. T. (1998) Identification of a Mycobacterium tuberculosis gene cluster encoding the biosynthetic enzymes for assembly of the virulence -conferring siderophore mycobactin, Chem. Biol. 5 631645. 101. Somu, R. V., Boshoff, H., Qiao, C., Bennett, E. M., Barry, C. E., and Aldrich, C. C. (2005) Rationally Designed Nucleoside Antibiotics That Inhibit Siderophore Biosynthesis of Mycobacterium tuberculosis, J. Med. Chem. 49 31 -34.

PAGE 150

150 102. Raber, M. L., Freeman M. F., and Townsend, C. A. (2009) Dissection of the Stepwise Mechanism to -Lactam Formation and Elucidation of a Ratedetermining Conformational Change in Lactam Synthetase, J. Biol. Chem. 284, 207-217. 103. Arnett, S. O., Gerratana, B., and Townsend, C. A. (2007) RateLimiting Steps and Role of Active Site Lys443 in the Mechanism of Carbapenam Synthetase, Biochemistry 46, 9337 -9345. 104. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utili zing the principle of proteindye binding, Analytical Biochemistry 72 248254. 105. Raber, M. L., Arnett, S. O., and Townsend, C. A. (2009) A Conserved Tyrosyl Glutamyl Catalytic Dyad in Evolutionarily Linked Enzymes: Carbapenam Synthetase and Lactam Synthetase, Biochemistry 48, 4959 -4971. 106. Dubendorff, J. W., and Studier, F. W. (1991) Controlling basal expression in an inducible T7 expression system by blocking the targer T7 promoter with lac repressor, J. Mol. Biol. 219 45 59. 107. Studier, F. W., and Moffatt, B. A. (1986) Use of Bacteriophage -T7 RNA Polymerase to direct selective high-level expresion of cloned genes, J. Mol. Biol. 189, 113-130. 108. Boehlein, S. K., Richards, N. G., Walworth, E. S., and Schuster, S. M. (1994) Arginine 30 and asparagine 74 have functional roles in the glutamine dependent activities of Escherichia coli asparagine synthetase B, J Biol Chem 269, 2678926795. 109. Boehlei n, S. K., Stewart, J. D., Walworth, E. S., Thirumoorthy, R., Richards, N. G. J., and Schuster, S. M. (1998) Kinetic Mechanism of Escherichia coli Asparagine Synthetase B, Biochemistry 37 1323013238. 110. Boehlein, S. K., Walworth, E. S., Richards, N. G., and Schuster, S. M. (1997) Mutagenesis and chemical rescue indicate residues involved in beta aspartyl AMP formation by Escherichia coli asparagine synthetase B, J. Biol. Chem. 272, 12384-12392. 111. Sheng, S., Moraga-Amador, D., van Heeke, G., Allison, R., Richards, N., and Schuster, S. (1993) Glutamine inhibits the ammonia dependent activities of two Cys -1 mutants of human asparagine synthetase through the formation of an abortive complex, J. Biol. C hem. 268, 1677116780. 112. Voet, D., and Voet, J. (l990) Biochemistry John Wiley and Sons, New York.

PAGE 151

151 113. Cohn, M., and Hu, A. (1980) Isotopic oxygen -18 shifts in phosphorus 31 NMR of adenine nucleotides synthesized with oxygen 18 in various positions, J. Am. Chem. Soc. 102, 913916. 114. Villafranca, J. J. (1989) Positional isotope exchange using phosphorus -31 nuclear magnetic resonance, Methods Enzymol. 177, 390403. 115. Vanwazer, J. R., Callis, C. F., Shoolery, J. N., and Jones, R. C. (1956) Princ iples of Phosphorus Chemistry 2. Nuclear Magnetic Resonance Measurements, J. Am. Chem. Soc. 78 5715 -5726. 116. Midelfort, C. F., and Rose, I. A. (1976) A stereochemical method for detection of ATP terminal phosphate transfer in enzymatic reactions. Glutamine synthetase, J. Biol. Chem. 251 5881 5887. 117. Raushel, F. M., and Villafranca, J. J. (1980) Phosphorus 31 nuclear magnetic resonance application to positional isotope exchange reactions catalyzed by Escherichia coli carbamoyl-phosphate synthetase: analysis of forward and reverse enzymic reactions, Biochemistry 19 31703174. 118. Mullins, L. S., Hong, S.-B., Gibson, G. E., Walker, H., Stadtman, T. C., and Raushel, F. M. (1997) Identification of a Phosphorylated Enzyme Intermediate in the Catalytic Mechanism for Selenophosphate Synthetase, J. Am. Chem. Soc. 119, 66846685. 119. Williams, L., Fan, F., Blanchard, J. S., and Raushel, F. M. (2008) Positional Isotope Exchange Analysis of the Mycobacterium smegmatis Cysteine Ligase (MshC) Biochemistry 47 48434850. 120. Williams, L., Zheng, R., Blanchard, J. S., and Raushel, F. M. (2003) Positional Isotope Exchange Analysis of the Pantothenate Synthetase Reaction, Biochemistry 42, 5108 -5113. 121. Boehlein, S., Richards, N., Walworth, E., and Schuster, S (1994) Arginine 30 and asparagine 74 have functional roles in the glutamine dependent activities of Escherichia coli asparagine synthetase B, J. Biol. Chem. 269 2678926795. 122. Myers, R. S., Jensen, J. R., Deras, I. L., Smith, J. L., and Davisson, V. J. (2003) Substrate-Induced Changes in the Ammonia Channel for Imidazole Glycerol Phosphate Synthase, Biochemistry 42, 7013 -7022. 123. Miles, B. W., Banzon, J. A., and Raushel, F. M. (1998) Regulatory Control of the Amidotransferase Domain of Carbamoyl Phosphate Synthetase, Biochemistry 37, 1677316779.

PAGE 152

152 124. Mullins, L. S., and Raushel, F. M. (1999) Channeling of Ammonia through the Intermolecular Tunnel Contained within Carbamoyl Phosphate Synthetase, J. Am Chem Soc 121 38033804. 125. Raushel, F. M., and Villafranca, J. J. (1988) Positional Isotope Exchange, Crit. Rev. Biochem. Mol. Biol. 23 1 -26. 126. Ghose, C., and Raushel, F. M. (1985) Determination of the mechanism of the argininosuccinate synthetase reaction by static and dynamic quench experiments, Biochemistry 24, 5894 -5898. 127. Hilscher, L. W., Hanson, C. D., Russell, D. H., and Raushel, F. M. (1985) Measurement of position al isotope exchange rates in enzyme-catalyzed reactions by fast atom bombardment mass spectrometry: application to argininosuccinate synthetase, Biochemistry 24 5888 5893. 128. Von der Saal, W., Crysler, C. S., and Villafranca, J. J. (1985) Positional is otope exchange and kinetic experiments with Escherichia coli guanosine 5' monophosphate synthetase, Biochemistry 24, 5343 -5350. 129. Thompson, J. S., and Edmoinds, O. P. (1980) Safety Aspects of hadling the potent allergen FDNB, Ann Occup Hyg 23 2733. 130. Boehlein, S. K., Richards, N. G., and Schuster, S. M. (1994) Glutamine dependent nitrogen transfer in Escherichia coli asparagine synthetase B. Searching for the catalytic triad, J. Biol. Chem. 269 7450 7457. 131. Boehlein, S. K., Schuster, S. M., and Richards, N. G. (1996) Glutamic acid gamma monohydroxamate and hydroxylamine are alternate substrates for Escherichia coli asparagine synthetase B, Biochemistry 35 3031 3037. 132. Li, K. (2007) Intramolecular tunnel and regulatory mechanisms of asparagine synthetase, in Dept of Chemistry p 120, University of Florida, Gainesville, FL. 133. Ducruix, A., Giege, R. (Ed.) (1992) Crystallization of Nucleic Acids and Proteins: A Practical Approach Oxford University Press New York. 134. Weber, P. C., and Charles W. Carter, Jr. (1997) Overview of protein crystallization methods, in Methods Enzymol. pp 13 22, Academic Press. 135. Jancarik, J., and Kim, S. H. (1991) Sparse matrix sampling: a screening method for crystallization of proteins, J. Appl. Crysta llogr. 24 409411.

PAGE 153

153 136. Newman, J., Egan, D., Walter, T. S., Meged, R., Berry, I., Ben Jelloul, M., Sussman, J. L., Stuart, D. I., and Perrakis, A. (2005) Towards rationalization of crystallization screening for small to medium -sized academic laboratories: the PACT/JCSG+ strateg y, Acta Crystallogr., Sect. D: Biol. Crystallogr. 61 14261431. 137. Jayaram, H. N., Cooney, D. A., Milman, H. A., Homan, E. R., and Rosenbluth, R. J. (1976) Don, conv and donv -I. Inhibition of L asparagine synthetase in vitro, Biochem. Pharmacol. 25, 1 571-1582. 138. Mehlhaff, P. M., and Schuster, S. M. (1991) Bovine pancreatic asparagine synthetase explored with substrate analogs and specific monoclonal antibodies, Arch. Biochem. Biophys. 284, 143150. 139. Mouilleron, S., Badet Denisot, M. -A., and Golinelli -Pimpaneau, B. (2006) Glutamine Binding Opens the Ammonia Channel and Activates Glucosamine6P Synthase, J. Biol. Chem. 281, 4404 -4412. 140. van den Heuvel, R. H. H., Svergun, D. I., Petoukhov, M. V., Coda, A., Curti, B., Ravasio, S., Vanoni, M. A. and Mattevi, A. (2003) The Active Conformation of Glutamate Synthase and its Binding to Ferredoxin, J. Mol. Biol. 330, 113-128. 141. LaRonde LeBlanc, N., Resto, M., and Gerratana, B. (2009) Regulation of active site coupling in glutamine dependent NAD+ synthetase, Nat. Struct. Mol. Biol. 16 421-429. 142. Reed, L. J., and Muench, H. (1938) A simple methods of estimating fifter per cent endpoints, Am. J. Epidemiol. 27 493-497. 143. McDonald, H. M., Pruett, P. S., Deivanayagam, C., Protasevich, I. I., C arson, W. M., DeLucas, L. J., Brouillette, W. J., and Brouillette, C. G. (2007) Structural adaptation of an interacting nonnative C terminal helical extension revealed in the crystal structure of NAD+ synthetase from Bacillus anthracis, Acta Crystallograp hica Section D 63 891-905. 144. Mueller -Dieckmann, J. (2006) The openaccess highthroughput crystallization facility at EMBL Hamburg, Acta Crystallogr., Sect. D: Biol. Crystallogr. 62 14461452. 145. Boehlein, S. K., Walworth, E. S., and Schuster, S. M. (1997) Identification of cysteine 523 in the aspartate binding site of Escherichia coli asparagine synthetase B, Biochemistry 36 10168 -10177. 146. Vachette, P., and Svergun, D. (1995) Small X -Ray Scattering by Solutions of Biological Macromolecules, i n Spectroscopic Techniques in Biophysics (Giacometti, G. M., and Giacometti, G., Eds.), IOS Press, Amsterdam.

PAGE 154

154 147. Pilz, I. (1982) Proteins, in Small Angle X -Ray Scattering (Glatter, O., and Kratky, O., Eds.), pp 239293, Academic Press, New York. 148. Tremblay, L. W., Fan, F., Vetting, M. W., and Blanchard, J. S. (2008) The 1.6 Crystal Structure of Mycobacterium smegmatis MshC: The Penultimate Enzyme in the Mycothiol Biosynthetic Pathway Biochemistry 47 1332613335. 149. Georgiou, G., and Valax, P. (1996) Expression of correctly folded proteins in Escherichia coli, Curr. Opin. Biotechnol. 7 190197. 150. Hammarstrom, M., Hellgren, N., van den Berg, S., Berglund, H., and Hard, T. (2002) Rapid screening for improved solubility of small human proteins produced as fusion proteins in Escherichia coli, Protein Sci. 11 313-321. 151. Kapust, R. B., Tozser, J., C opeland, T. D., and Waugh, D. S. (2002) The P1' specificity of tobacco etch virus protease, Biochem. Biophys. Res. Commun. 294, 949-955. 152. Jenny, R. J., Mann, K. G., and Lundblad, R. L. (2003) A critical review of the methods for cleavage of fusion proteins with thrombin and factor Xa, Protein Expression Purif. 31 1 11. 153. Nallamsetty, S., Kapust, R. B., Tozser, J., Cherry, S., Tropea, J. E., Copeland, T. D., and Waugh, D. S. (2004) Efficient site-specific processing of fusion proteins by tobacco ve in mottling virus protease in vivo and in vitro, Protein Expression Purif. 38, 108115. 154. Ren, H., and Liu, J. (2006) AsnB is involved in natural resistance of Mycobacterium smegmatis to multiple drugs, Antimicrob. Agents Chemother. 50 250-255.

PAGE 155

155 BIOGRAPHICAL SKETCH Megan Elizabeth Meyer was born in Lakewood, OH in September of 1983. After graduating from Vermilion High School, she went to Seton Hall University in South Orange, NJ to pursue a college softball career and biochemistry degree. After winning two Big East softball championships with the Pirates and successfully obtaining a biochemistry degree, she moved to Gainesville, FL to become a Florida Gator. While at University of Florida she pursued a PhD in chemistry under the direction of Dr. Nigel Richards working on the characterization of asparagine synthetase.