<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-12-31.

Permanent Link: http://ufdc.ufl.edu/UFE0041307/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-12-31.
Physical Description: Book
Language: english
Creator: Chawla, Aarti
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Aarti Chawla.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Lamont, Richard J.
Electronic Access: INACCESSIBLE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041307:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041307/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-12-31.
Physical Description: Book
Language: english
Creator: Chawla, Aarti
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Aarti Chawla.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Lamont, Richard J.
Electronic Access: INACCESSIBLE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041307:00001


This item has the following downloads:


Full Text

PAGE 1

1 ROLE OF PG1237 A NOVEL TRANSCRIPTIONAL REGULATOR IN BIOFILM FORMATION IN PORPHYROMONAS GINGIVALIS By AARTI CHAWLA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIRE MENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Aarti Chawla

PAGE 3

3 To All The People Who Supported Me During My Graduate Program

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my mentor Dr. Richard Lamont for his excel lent guidance and support he provided during my Masters program. I would also like to thank my committee members Dr. Ann Progulske-Fox, D r. Thomas Brown and Dr. Graciel a Lorca for their time and helpful guidance. My warmest thanks are extended to the members of the Lamont Lab; Dr. Brian Bainbridge for his invaluable guidance and suggestions; Dr. Catherine Moffatt, Dr. Peng Xue, Brittany Dickinson, Sarah Whitmore for all their help and for making work a pleasant place. I also appreciate Joyce Conners for her continual support towards the completion of my program especially for paperwork. I would also like to thank my parents and sister for all their support and love. I would also like to thank my friends at UF for keeping me strong and being there for me when ever I needed them.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...................................................................................................... 4 LIST OF TABLES ................................................................................................................ 7 LIST OF FIGURES .............................................................................................................. 8 ABSTRACT ........................................................................................................................ 10 CHAPTER 1 INTRODUCTIO N TO PERIODONTAL DISEASE AND PORPHYROMONAS GINGIVALIS ................................................................................................................ 12 Periodontal Disease A Significant Health Concern .................................................. 12 Ris k Factors ................................................................................................................ 14 Dental Plaque Relationship Of Specific Organisms To Periodontal Disease .......... 14 Porphyromonas Gingivalis ................................................................................... 15 General characteristics ................................................................................. 15 Virulence factors ............................................................................................ 17 2 ORAL BIOFILM FORMATION AND ITS REGULATION ........................................... 20 Biofilms -Their General Properties .............................................................................. 20 Dental Plaque An Oral Biofilm ................................................................................... 21 Quorum Sensing In Biofilm Communities .................................................................. 24 Biofilm Formati on And Its Regulation In Porphyromonas Gingivalis ........................ 25 Key players in regulating p. Gingivalis biofilm formation .................................... 26 LuxS ............................................................................................................... 26 Ltp1 ................................................................................................................ 26 Mfa ................................................................................................................. 27 Pg1237-A Luxr Family Novel Transcriptional Regulator .................................... 27 3 MATERIALS AND METHODS ................................................................................... 29 Bacteria and Culture Conditions ................................................................................ 29 Construction of Mutant and Complemented Strains : ............................................... 29 Production of PG1237 Recombinant Protein: ............................................................ 31 Homotypic P. gingivalis Biofilm Formation : .............................................................. 31 Heterotypic P. gingivalis -S. gordonii Biofilms: ........................................................... 32 Quant itative Real Time RT -PCR: ............................................................................... 32 Electrophoretic Mobility Shift Assay : ......................................................................... 33 Consortia of Oral Bacteria: ......................................................................................... 34 Detection of Mfa and FimA : ....................................................................................... 34

PAGE 6

6 General Molecular Techniq ues .................................................................................. 35 Statistical Analysis ...................................................................................................... 35 4 RESULTS .................................................................................................................... 36 Homotypic Biofilm Formation by P. gingivalis is Enhanced in the Absence of PG1237 .................................................................................................................... 36 PG1237 Deficiency Enhances Accumulation of Heterotypic P. gingivalis -S. gordonii Communities .............................................................................................. 37 luxS and mfa1 Production are Controlled by PG1237 .............................................. 38 luxS Production is Controlled by PG1237 in a Cell Density Dependent Manner ..... 39 AI 2 Represses PG1237 and Ltp1 Production ......................................................... 40 Ltp1 Causes Increased Production of PG1237 in a P. gingivalis biofilm .................. 40 Interaction of S. gordonii with P. gingivalis Causes Increased PG1237 and Decreased Mfa1 Production ................................................................................... 41 Interaction of S. gordonii with 1237 Causes Increased Production of LuxS and Mfa1 ......................................................................................................................... 41 Interaction of S. gordonii with P. gingivalis Causes Increased Ltp1 Production ...... 42 Binding of PG1237 Protein to the Promoter Region of luxS and mfa1 ..................... 43 PG1237 Regulates Expression of Mfa protein .......................................................... 44 Complementation of 1237 with Wild -type 1237 Restored Production of LuxS and Mfa1 to Wild-type Levels .................................................................................. 44 5 DISCUSSION .............................................................................................................. 64 LIST OF REFERENCES ................................................................................................... 72 BIOGRAPHICAL SKETCH ................................................................................................ 78

PAGE 7

7 LIST OF TABLES Table page 3 -1 List of bacterial strains and plasmids used ........................................................... 29 3 -2 Primers Used in this Study ..................................................................................... 33

PAGE 8

8 LIST OF FIGURES Figure page 4 -1 PG1237 controls homotypic P. gingivalis biofilm growth ...................................... 46 4 -2 PG1237 regulates heterotypic P. gingivalis -S. gordonii biofilms. S. gordonii stained with hexidium iodide (red) was cultured on glass plates. P. gingivalis strains were stained with fluorescein (green) and reacted with the S. gordonii biofilms for 24 h ...................................................................................................... 47 4 -2 PG1237 regulates heterotypic P. gingivalis -S. gordonii biofilms. S. gordonii stained with hexidium iodide (red) was cultured on glass plates .......................... 48 4 -3 Ratio of P .gingivalis/S. gordonii in 33277 vs. P. gingivalis -S. gordonii community ................................................................................................ 49 4 -4 Biofilm thickness of 33277 vs. P. gingivalis -S. gordonii community ............................................................................................................. 50 4 -5 Total P. gingivalis accumulation in 33277 vs. 1237 strain in P. gingivalis -S. gordonii community measur ed by area analysis ................................................... 51 4 -6 Total P. gingivalis accumu lation in 33277 vs. 1237 strain in P. gingivalis -S. gordonii community measured by volume analysis .............................................. 52 4 -7 mfa1 and luxS genes are differentially expressed in the 1237 mutant .............. 53 4 -8 luxS gene is differentially expressed in the 1237 mutant in a growth phase dependent manner ................................................................................................. 54 4 -9 1237 and ltp1 genes are differentially expressed in the luxS mutant ................ 55 4 -10 The P. gingivalis1237 gene is differentially expressed in the ltp1 mutant biofilm ...................................................................................................................... 56 4 -11 1237 and mfa1 genes are differentially expressed in the P. gingivalis S. gordonii community as compared to P. gingivalis mono biofilm. Gene expression was measured by quantitative RT -PCR on P. gingivalis -S. gordonii, P. gingivalis -S. cristatus or P. gingivalis mono biofilm grown for 24 hours anaerobically ................................................................................................ 57 4 -12 luxS and mfa1 genes are differentially expressed in the P. g ingivalis S. gordonii community as compared to P. gingivalis mono biofilm ........................... 58 4 -13 ltp1 gene is differentially expressed in the P. gingivalis -S. gordonii community as compared to P. gingivalis mono biofilm ............................................................ 59

PAGE 9

9 4 -14 Interaction of rPG1237 with the promoter region of luxS. EMSA were performed in the presence or absence of rPG1237 and 20 fmol biotin -labeled DNA ........................................................................................................................ 60 4 -15 Interaction of rPG1237 with the promoter region of mfa1. EMSA were performed in the presence or absence of rPG1237 and 20 fmol biotin -labeled DNA ........................................................................................................................ 61 4 -16 Interaction of rPG1237 with the promoter region of fimA EMSA were performed in the presence or absence of rPG1237 and 20 fmol biotin -labeled DNA ....................................................................................................................... 61 4 -17 Expression of Mfa is increased in the absence of PG1237 .................................. 62 4 -18 Expression of FimA is not increased in the absence of PG1237 ......................... 62 4 -19 C omplementation of the 1237 mutant with the wildtype (WT) 1237 gene restores expression of luxS and mfa1 genes to close to WT levels ..................... 63 5 -1 Schematic representation of the AI 2 -PG1237Ltp1 positive feedback model .. 70 5 -2 Schematic representation of functionality of Ltp1 and PG1237 in constraining P. gingivalis -S. gordonii community formation. ..................................................... 71

PAGE 10

10 Abstract of Thesi s Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for th e Degree of Master of Science ROLE OF PG1237A NOVEL TRANSCRIPTIONAL REGULATOR IN BIOFILM FORMATION IN PORPHYROMONAS GINGIVALIS By Aarti Chawla December 2009 Chair: Richard Lamont Major: Medical Sciences Chronic periodontitis is a widely prevalent disease in the United States and one of the major organisms implicated in its etiology is Porphyromonas gingivalis Biofilm formation with primary c olonizers of the tooth such as Streptococcus gordonii is one of the main mechanisms by which P. gingivalis colonizes the tooth and the periodontium. Understanding the biology and mechanism of P. gingivalis biofilm formation is crucial for the development o f more effective treatments against chronic periodontitis. The luxR family of transcriptional regulators are widely found in prokaryotes and have been found to regulate biofilm formation and other virulence properties in many bacteria. In this study the role of PG1237, a LuxR family transcriptional regulator in homotypic and heterotypic biofilm formation of P. gingivalis was investigated. We characterized the role of PG1237 through the use of mutants that lack PG1237 and showed that PG1237 activity constrains both monospecies biofilm development and community development with the primary oral biofilm constituent Streptococcus gordonii We found that PG1237 regulates transcriptional activity of luxS and thus impacts AI -2 dependent signalling in biofilm comm unities. Also PG1237 regulates production of Mfa, the minor fimbriae protein that is necessary for community

PAGE 11

11 formation with S. gordonii We also found that PG1237 directly regulates luxS and mfa1 by binding to their promoter regions. In the absence of PG 1237 transcription of luxS and mfa1 was increased in the mutant resulting in both greater homotypic biofilm formation as well as greater heterotypic community formation with S. gordonii We also showed that Ltp1, a low molecular weight tyrosine phosphatase which has a regulatory role in biofilm formation might be regulating the expression of PG1237. Complementation of the pg1237 mutation with wild -type pg1237 restored homotypic biofilm formation as well as luxS and mfa1 expression to wild type levels. Colle ctively, these results show that PG1237, a LuxR family transcriptional regulator controls and regulates several pathways that are important for the biofilm formation of P. gingivalis

PAGE 12

12 CHAPTER 1 INTRODUCTION TO PERI ODONTAL DISEASE AND PORPHYROMONAS GINGI VALIS Periodontal Disease A Significant Health Concern Periodontal diseases are a group of inflammatory diseases that affect the supporting tissues of the dentition. The most prevalent periodontal diseases result from the interaction of specific bacterial species with components of the host immune response in disease susceptible individuals. They are currently classified as plaque induced gingival diseases, early onset, chronic adult and aggr essive periodontitis (Armitage 1999). Plaque induced gingival dis eases are limited to the gingivae (gingivitis) and are characterized by erythema, edema, hemorrhage and enlargement of the gingival tissues. Plaque induced gingivitis is nearly pandemic in children and young adults and is reversible with plaque removal. I n contrast, early onset, chronic and aggressive periodontitis are irreversible forms of periodontal disease that culminate in tooth loss if left untreated. Estimates of the prevalence of periodontitis vary with the clinical criteria used to define disease status; however, the Third National Health and Nutrition Survey (NHANES III) reported a 14% prevalence of moderate to severe periodontitis in the United States population >20 years of age (Oliver et al. 1998). The inflammatory lesion in periodontitis extends from the gingiva to include deeper connective tissues resulting in the loss of periodontal ligament and alveolar bone Gingival epithelium migrates into the area of periodontal ligament and alveolar bone destruction, creating a periodontal pocket arou nd the affected tooth. The formation of a periodontal pocket is a characteristic feature of periodontitis in humans. Recruited into the connective tissue adjacent to the periodontal pocket is an intense cellular infiltrate

PAGE 13

13 consisting of polymorphonuclear leucocytes, monocytes/macrophages, B and T cell lymphocytes (Ebersole et al. 2000) The periodontal pocket is colonized by bacteria that exist in a stratified, highly ordered ecosystem, termed a dental biofilm or plaque, consisting of bacteria, bacterial pr oducts such as endotoxin/LPS and an extracellular matrix of polysaccharides, proteins and inorganic compounds. The organization of the dental biofilm optimizes bacterial cell proliferation, while providing protection from host defence mechanisms as well as externally applied anti microbials. However, discreet complexes of bacterial species have been described in association with periodontal disease status and progr ession (Socransky and Haffajee 2005). Plaque samples from periodontally healthy subjects consi st largely of Gram -positive aerobic species. A shift towards increasing numbers of Gram negative species, including the appearance of Fusobacterium nucleatum and various Treponema species, occurs in samples from subjects with plaque-induced gingivitis. The shift towards Gram -negative bacteria increases in plaque samples from subjects with chronic periodontitis with nearly 85% of the bacterial species reported as Gram negative anaerobic or facultative anaerobic species including Aggregatibacter actinomycetem comitans serotypes a and b, Campylobacter rectus, Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythia and Treponema denticola In particular, P. gingivalis T. forsythia and T. denticola have been associated with the progressing plaque fr ont in chronic periodontitis (Dzink et al. 1988). However, colonization with a specific periodontal pathogen appears necessary but not sufficient for periodontal disease progression, since the majority of sites colonized remain quiescent for extended perio ds of time. During progression of the periodontal

PAGE 14

14 lesion, the host may be exposed to increased antigenic challenge in sites with active extracellular matrix destruction since serum IgG antibody to P. gingivalis in particular has been reported to be elevated in subjects with periodontitis and further elevated with disease progression (Craig et al. 2002). Risk Factors Evidence supports the existence of several risk factors which increase an individuals likelihood of developing periodontal disease. Some of t he major risk factors are poor oral hygiene, pregnancy, use of oral contraceptives and menopause also increase the risk of periodontitis (Boggess, 2008). Other major risk factors are cigarette smoking and poorly controlled diabetes mellitus. Obesity, osteoporosis, socioeconomic status and HIV infection were also found to be risk factors (Borrell, 2005). There is a genetic predisposition of certain individuals to periodontal disease ( Loos et al. 2005). Herpes virus infection (Wu et al. 2006) and autoimmune d iseases such as Crohns disease, multiple sclerosis, rheumatoid arthritis are also associated with a higher incidence of periodontal disease. Also deficiency of vitamin C could contribute to periodontal disease (Amaliya et al. 2007). Therefore, a multitude of factors can influence the development and progression of periodontal disease. Dental Plaque Relationship Of Specific Organisms To Periodontal Disease Socr ansky ( Socransky and Haffajee 1992) proposed the following criteria for an organism to be a per iodontal pathogen: 1 ASSOCIATION: A pathogen should be found more frequently and in higher numbers in disease states than in healthy states 2 Elimination: Elimination of the pathogen should be accompanied by elimination or remission of the disease.

PAGE 15

15 3 Host Res ponse : There should be evidence of a host response to a specific pathogen which is causing tissue damage. 4 Virulence Factors : Properties of a putative pathogen that may function to damage the host tissues should be demonstrated. 5 Animal Studies : The abilit y of a putative pathogen to function in producing disease should be demonstrated in an animal model system. The two periodontal pathogens that have most thoroughly fulfilled Socransky's criteria are Aggregatibacter actinomycetemcomitans in the form of per iodontal disease known as localized aggressive periodontitis (LAP), and Porphyromonas gingivalis in the form of periodontal disease known as adult periodontitis or chronic periodontitis Porphyromonas Gingivalis General characteristics Porphyromonas gingiv alis is a black pigmented, Gram n egative, anaerobic asaccharolytic rod that is the major cause of chronic periodontitis. This bacteria is also implicated as a possible risk factor for the development of certain types of cardiovascular disease (Renvert et al. 2006) and pregnancy complications (Contreras et al. 2006). In vitro growth of P. gingivalis is routinely performed on blood agar plates supplemented with hemin and vitamin K1. Early colonies of P. gingivalis appear tan in color b ut after several days of growth the colonies become strongly black -pigmented. This characteristic results from the storage of acquired heme on the bacterial cell surface (Lamont and Jenkinson, 1998). P. gingivalis obligately requires iron for growth and hemin satisfies this re quirement (Lamont and Jenkinson, 1998). P. gingivalis has to rely on small peptide molecules for its nutrition because of its inability to effectively utilize sugars as an energy source (Lamont and Jenkinson, 1998). This nutrient

PAGE 16

16 requirement requires P. gi ngivalis to express several proteases which along with hydrolyzing proteins into small peptides and amino acids, also simultaneously can damage host tissues. P. gingivalis has been characterized into six serogroups designated K1-K6 based on the antigenicit y of its capsular carbohydrates (Laine et al. 2006). Also, the LPS of P. gingivalis has been characterized into three serogroups, O1 to O3. Bacteria isolated from disease sites display a wide variety of K and O antigen combinations and chronic periodontiti s does not appear to rise from any single specific combination. Porphyromonas gingivalis fimA which encodes fimbrillin, a subunit of fimb riae, has been classified into 6 genotypes (types I to V and Ib) (Kuboniwa et al. 2009) based on their nucleotide sequ ences. Among the P. gingivalis positive healthy adults, the most prevalent fimA type is type I followed by type V. In contrast, a majority of the periodontitis patients carry type II fimA organisms followed by type IV. There are both diseaseassociated and nondiseaseassociated strains of P. gingivalis and their infectious traits influencing periodontal health status can be differentiated based on the clonal variation of fimA genes. (Amano et al. 2000). P. gingivalis has the ability to invade gingival e p ithelial cells (Lamont et al.1 995; Tribble et al. 2006) The mechanism of invasion involves cytoskeletal arrangement (Lamont and Jenkinson 1998).The recently described haloacid dehalogenase family phosphatase SerB, has been demonstrated to play an important role in the invasion process (Tribble et al. 2006). This bacteria also has the ability to override host cell apoptotic programs which probably maintains a favorable intracellular environment for bacterial survival.

PAGE 17

17 Virulence factors Any factor that increases the ability of a pathogen to damage its host tissue is considered a virulence factor. The presence of a capsule in P. gingivalis has been considered an important anti -phagocytic virulence factor by many investigators. A strong relationship was found t o exist between the extent of P. gingivalis encapsulation and several important biological functions that could have a significant effect on its ability to function as an oral pathogen. The highly encapsulated P. gingivalis strains exhibit decreased auto a gglutination, lower buoyant densities and are more hydrophilic t han the less enc apsulated strains Increased encapsulation was also correlated with increased resistance to phagocytosis, serum resistance,and decreased induction of polymorphonuclearleukocyte chemiluminescence (Holt, 2000).The decreased tendency for the highly encapsulated strains to be phagocytosed has been proposed due to the increased hydrophilicity of the strains and their decreased ability to activate the alternate complement pathway. P. gingivalis produces major fimbriae which are composed of FimA subunits and are associated with the ability to adhere to different surfaces. Different regions of P. gingivalis fimbriae have been found to interact with various substrates such as lactoferrin fibronectin and erythrocytes demonstrating the dynamic adhering properties of this bacterial structure (Lamont and Jen kinson 1998). FimA mutants were shown to have impaired adherence as well as a deficiency in invading host cells (Weinberg et al. 1997). The FimA mutant phenotype allowed for the discovery of minor fimbriae (Hamada et al. 1996). The minor fimbriae are composed of Mfa subunits encoded by the mfa1 gene. mfa1 mutant strains were completely incapable of forming biofilms (Lin et al.

PAGE 18

18 2006). This provides evidence that minor fimbriae are important for cell -cell interactions in P. gingivalis Also, minor fimbriae have demonstrated interaction with the SspA/B antigen of Streptococcus gordonii It is evident that minor fimbriae complement the adhesive characteristics of major fimbriae and both are important P. gingivalis virulence factors. The most potent and important proteinases produced are ArgX and Lys X proteases or gingipains. It is estimated that around 85% of proteolytic activity of P. gingivalis is attributable to gingipa ins (Potempa et al. 2007). Some functions of gingipains are that they give P. gingivalis the ability to affect gingival crevicular fluid production by inducing vascular permeability, increasing inflammation through activation of blood coagulation pathway and preventing blood clotting through degradation of fibrinogen (Imamura, 2003). Also gingipains promote in vivo colonization of P. gingivalis and by their proteolytic activity cause formation of periodontal pocket and eventual tooth loss (Potempa et al. 2001). They also prevent activation of leukocytes and they bind and lyse erythrocytes for heme acquisition (Imamura, 2003). P. gingivalis lipopolysaccharide (LPS) is also an important virulence factor. It is less immunostimulato ry than LPS from enteric bacteria such as E. coli. It functions by inducing chemokine induction, natural killer cell activation, induction of tumor necrosis factor alpha and nitrous oxide. LPS stimulates the production of interleukin IL-1, IL -6 and IL-8 in human gingival fibroblasts which in turn activates osteoclasts in vitro (Wang et al. 1999). P. gingivalis also possesses several hemagglutinins and hemolysins. These molecules also help in iron acquisition through binding of erythrocytes and their

PAGE 19

19 eventu al lysis. Most notable of the hemagglutinins are the proteins HagA E (Progulske Fox, 1995). Iron acquisition is associated with quorum sensing systems in P. gingivalis P. gingivalis shows a strong preference for iron in the form of hemin and expresses a n umber of heme/hemin uptake systems. These hemin uptake mechanisms include the TonB -linked outer membrane hemin binding proteins HmuR and Tlr and the hemin binding lipoprotein FetB (IhtB). Hemin uptake mechanisms are regulated by an external AI -2 signal pro duced by the action of LuxS. Furthermore, it is apparent that the AI 2 signal allows P. gingivalis to switch between different mechanisms of hemin and iron uptake as dictated by environmental conditions. (James et al. 2006).

PAGE 20

20 CHAPTER 2 ORAL BIOFILM FORMAT ION AND ITS REGULATI ON Biofilms -Their General Properties A biofilm is an aggregate of microorganisms in which cells are stuck to each other and/or to a surface. These adherent cells are frequently embedded within a self produced matrix of extracellular pol ymeric substance (EPS). Biofilm EPS, which is also referred to as "slime," is a polymeric mass of DNA, proteins and polysaccharides. Biofilms may form on living or non living surfaces, and represent a prevalent mode of microbial life in natural, industrial and hospital settings (Stoodley et al. 2004). The cells of a microorganism growing in a biofilm are physiologically distinct from planktonic cells of the same organism, which by contrast, are single-cells that may float or swim in a liquid medium. Microbe s form a biofilm in response to many factors, which may include cellular recognition of specific or non-specific attachment sites on a surface, nutritional cues, or in some cases, by exposure of planktonic cells to subinhibitory concentrations of an tibiot ics (Karatan et al. 2009) When a cell switches to the biofilm mode of growth, it undergoes a phenotypic shift in behavior in which large suites of genes are differentially regulated. Biofilms are ubiquitous. Nearly every species of microorganism, not only bacteria and archaea, have mechanisms by which they can adhere to surfaces and to each other. Some common properties of bacterial biofilms are m icroorganisms are arranged in microcolonies the m icrocolonies are surrounded by a protective matrix, m icroor ganisms have different communication systems such as Quorum sensing and m icroorganisms in the biofilm are more resistant to antibiotics, antimicrobials, and host response as compared to planktonic cells.

PAGE 21

21 The stages of biofilm development are initial attach ment, irreversible attachment, maturation and dispersal. Biofilms have been found to be involved in a wide variety of microbial infections in the body. Infectious processes in which biofilms have been implicated include common problems such as urinary tra ct infections catheter infections, middle ear infections formation of dental plaque, gingivitis coating contact lenses and less common but more lethal processes such as endocarditis infections in cystic fibrosis and infections of permanent indwellin g devices such as joint prostheses and heart valves (Lewis, 2001). More recently it has been noted that bacterial biofilms may impair cutaneous wound healing and reduce topical antibacterial efficiency in healing or treating infected skin wounds (Suman et al. 2009) Dental Plaque An Oral Biofilm Dental plaque is a complex and dynamic biofilm that accumulates through the sequential and ordered colonization of over 500 different species of bacteria (Marsh, 1995). In addition to the bacterial cells, plaque contains a small number of epithelial cells, leukocytes, and macrophages. The cells are contained within an extracellular matrix, which is formed from bacterial products and saliva. The extracellular matrix contains protein, polysaccharide and lipids. Inorgan ic components are also found in dental plaque; largely calcium and phosphorus which are primarily derived from saliva. The inorganic content of plaque is greatly increased with the development of calculus. The process of calculus formation involves the cal cification of dental plaque. Dental plaque can be classified in several different ways. Plaqu e can be classified as supragingival or subgingival based on its relationship to the gingival margin. Supragingival plaque is evident on the tooth above the gingiv al margin. Plaque can also

PAGE 22

22 be classified by its relationship to the tooth surface, as either attached or unattached plaque. The unattached subgingival plaque is more closely associated with the wall of the subgingival tissues than is the attached plaque. Lastly, plaque has been classified by association with disease state as "healthassociated" or "diseaseassociated". The latter classification is related to differences in the microbial composition of dental plaque in health versus disease (Schwartz et al. 1 995). The pellicle-coated tooth surface is colonized by Gram positive bacteria such as Streptococcus sanguis and Actinomyces naeslundii These organisms are examples of the "primary colonizers" of dental plaque. Bacterial surface molecules interact with co mponents of the dental pellicle to enable the bacteria to attach or adhere to the pellicle -coated tooth surface. For example, specific protein molecules found as part of the bacterial fimbriae on both Streptococcus sanguis and Actinomyces naeslundii inter act with specific proteins of the pellicle (the proline-rich proteins) with a "lock and key" mechanism that results in the bacteria firmly sticking to the pellicle -coating on the tooth surface (Mergenhagen et al. 1987). Within a short time after cleaning a tooth, these Gram positive species may be found on the tooth surface. After the initial colonization of the tooth surface, plaque increases by two distinct mechanisms: 1 ) the multiplication of bacteria already attached to the tooth surface, and 2) the subsequent attachment and multiplication of new bacterial species to cells of bacteria already present in the plaque mass. The secondary colonizers include Gram negative species such as Fusobacterium nucleatum, Prevotella intermedia, and Capnocytophaga specie s. A key property of these microorganisms appears to be the ability to adhere to Gram positive species already present in the existing plaque mass.

PAGE 23

23 These organisms would typically be found in plaque after 1 to 3 days of accumulation. When the structure of dental plaque from this time period is observed, the presence of a complex array of bacterial cocci, rods and filaments is apparent (Sbordone et al. 2003). After one week of plaque accumulation, other Gram -negative species may also be present in plaque. T hese species represent what is considered to be the "tertiary colonizers", and include Porphyromonas gingivalis, the oral spirochetes ( Treponema species) and other Gram negative anaerobes. The structural characteristics of dental plaque in this time period reveal complex patterns of bacterial cells of cocci, rods, fusiform, filaments, and spirochetes. In particular, specific associations of different bacterial forms have been observed. For example, the adherence of cocci to filaments results in a typical fo rm referred to as "test -tube brushes" or "corn -cob" structures. The structural interactions of the bacteria probably are partially a reflection of the complex metabolic interactions that are known to occur between different plaque microorganisms. One example of this is the production of succinic acid from Campylobacter species that is known to be used as a growth factor by Porphyromonas gingivalis (Takahashi 2005) The overall pattern observed in dental plaque development is a very characteristic shift from the early predominance of Gram positive facultative microorganisms to the later predominance of Gram negative anaerobic microorganisms, as the plaque mass accumulates and matures. This developmental progression is also reflected in the shifts in predominant microorganisms that are observed in the transition from health to disease. Studies of plaque taken from sites of health or disease and examined either

PAGE 24

24 microscopically or by culturing have demonstrated distinct differences in health versus diseaseassoci ated microbial populations (Socransky et al. 2000). Quorum Sensing In Biofilm Communities Population density is used by bacteria as a cue for the regulation of diverse cellular functions. Quorum (density dependent) sensing involves the synthesis of small s ignalling molecules that accumulate in the local environment. As the bacterial population density increases, the concentration of signalling molecules also increases until a threshold, or quorum, is reached, triggering the expression of target genes. In Gr am negative bacteria, the best described and most widespread signalling molecule is acyl homoserine lactone (AHL) (Fuqua et al. ., 2001 ). In the archetypal quorum -sensing system of the marine symbiotic bacterium Vibrio fischeri AHL is synthesized by LuxI p rotein. At a threshold concentration, the membrane-diffusible AHL interacts with and activates the intracellular LuxR transcriptional activator resulting, in the case of V. fischeri in expression of genes required for bioluminescence. LuxI/R homologues ha ve now been described in a large group of diverse bacteria including numerous plant and animal pathogens and, in many instances, two or more LuxI/R systems may function in a single species. AHL -based quorum sensing is known to regulate a range of cellular functions including bioluminescence, motility, production of secondary metabolites, expression of virulence factors and plasmid conjugal transfer (Fuqua et al. ., 2001). Signalling through AHLs has also been shown to be important for biofilm formation in so me organisms ( Davies et al. ., 1998). It became clear from molecular studies of V. harveyi that there existed a second signalling system, based on an unrelated autoinducer (AI 2), that was species nonspecific ( Bassler et al. ., 1994 ). The luxS gene encoding AI -2 synthase revealed no

PAGE 25

25 similarity to other autoinducer synthase genes ( Surette et al. 1999 ). Moreover, by using a mutant strain of V. harveyi able to detect AI 2 but not AI -1, it was soon demonstrated that culture supernatants of strains of Escherichia coli and Salmonella enterica serovar Typhimurium ( S. typhimurium) were able to induce bioluminescence, indicating that AI -2 production was not restricted to V. harveyi and that interspecies communication was possible ( Surette et al. ., 1999 ). Following its discovery in V. harveyi various homologues of luxS in a wide range of organisms, including a number of important human pathogens were found. A role for LuxS signaling as both a global regulator and as important for expression of virulence traits is thus emerging. In Porphyromonas gingivalis AI 2 can control expression of genes involved in hemin uptake and in haemagglutination (Chang et al. 2002 ). In A. actinomycetemcomitans production of leukotoxin, an important virulence factor, and ironuptake proteins is regulated in response to LuxS ( Fong et al. 2001 ). The luxS gene is also present in a range of pathogenic Gram -positive bacteria including Streptococcus mutans Streptococcus pyogenes and Clostridium perfringens (Lyon et al. 2001 ; Ohtani et al. 2002; W en & Burne 2 004). Biofilm Formation And Its Regulation In Porphyromonas Gingivalis Biofilm development in general proceeds through a series of ordered developmental steps ie. surface attachment, microcolony formation and biofilm maturation( Stanley and Laz azzera 2004 ). In the case of P. gingivalis S. gordonii consortia, the first step is a multivalent coadhesive interaction mediated by two distinct adhesin receptor pairs. The P. gingivalis long fimbriae (FimA) bind to glyceraldehyde3 phosphate dehydrogenas e (GAPDH) present on the streptococcal surface ( Maeda et al. 2004). In addition, the P. gingivalis short fimbriae (Mfa) engage the streptococcal

PAGE 26

26 SspA/B (antigen I/II) adhesins (Park et al. 2005 ) through an approximately 27 aa binding epitope of SspA/B termed BAR (Daep et al. 2006). Following co adhesion, LuxS dependent signaling is required for further development of the heterotypic biofilm communities ( McNab et al. 2003 ). With regard to monospecies P. gingivalis biofilms, initial attachment depends on an internalin family protein, InlJ ( Capestany et al. 2006 ), and development requires expression of the short fimbriae and the universal stress protein UspA ( Lin et al. 2006 ). Limitation of biofilm development appears to be important for P. gingivalis and such mechanisms in general are thought to arise in order to optimize exposure to oxygen (either maximal or minimal), or to facilitate influx of nutrients and efflux of waste ( Rainey and Rainey 2003). Key players in regulating p. Gingivalis biofilm formation LuxS LuxS is an enzyme that converts S -ribosylhomocysteine (RH) to 4,5 dihydroxy -2,3 pentanedione (DPD) and homocysteine (Schauder et al. 2001). DPD gets spontaneously converted to AI 2 which is required for formation of mixed species biofilm with Streptoc occus gordonii (McNab 2003) Ltp1 Ltp1 is a low molecular weight tyrosine phosphatase. It has a role in constraining both monospecies biofilm formation as w ell as mixed species community formation with S. gordonii It constrains biofilm formation by regulat ing exopolysaccharide synthesis as well as regulation of luxS at the t ranscriptional level. Thus, Ltp1 limits cellto -cell communication as well as exopolysaccharide synt hesis. Deletion mutants of ltp1showed both increased monos pecies and mixed species com munity formation proving that Ltp1 negatively regulates biofilm formation (Maeda et al. 2008).

PAGE 27

27 Mfa Mfa is the minor fimbriael protein that is the main building block of minor fimbriae. Mfa is required for development of both monospecies as well as mixed species biofilm formation with S. gordonii through its interaction with SspA/B. mfa1 deletion mutants showed no monospecies or mixed species biofilm formation indicating that Mfa is critical for P. gingivalis biofilm formation. Pg1237 A Luxr Family Novel Tra nscriptional Regulator DNA sequence analysis shows that PG1237 belongs to the LuxR family. Sequence analysis showed that it contained the helix -turn helix domain at its C terminal which is a characteristic of proteins belonging to the LuxR family. Also, t he PG1237 helix -turn-helix domain showed a high degree of similarity to HTH domain of GerE, a LuxR family transcriptional regulator which regulates spore formation in B.subtilis Similar to the expression regulated by other members of LuxR family, expressi on of the pg1237 gene is regulated in a cell density dependent manner. Generally, LuxR proteins sense the autoinducers, acyl homoserine lactones, which are synthesized by members of the LuxI protein family (Fuqua, 1996). However, LuxI and acyl homoserine l actones have not been found in P. gingivalis Previous work has shown that PG1237 is required for the expression of hmuY and hmuR but not other iron acquisition -related genes, such as fetB and tlr which also encode hemin binding proteins (Wu et al. 2009) .It was shown that PG1237 controls the expression of the hmu operon in a cell density dependent manner (Wu et al. 2009). Interestingly, another cell density dependent sensory system, LuxS AI -2, appears to be also involved in the regulation of hemin and ir on acquisition pathways in P. gingivalis

PAGE 28

28 LuxS proteins function as a key synthase that generates an autoinducer, AI 2. Previous studies have shown that expression levels of Tonlinked hemin binding protein (Tlr) and the lysine -specific protease Kgp are reduced in a luxS mutant, whereas expression levels of some other iron acquisition-related genes, including hmuR are upregulated in the mutant (James et al. 2006).These results suggest there could be a potential interplay between regulatory pathways of PG1237 and LuxS and that PG1237 could be regulating other virulence properties of P. gingivalis such as biofilm formation by regulating LuxS pathway. Hence, we decided to investigate the role of PG1237 in both monospecies and mixed species biofilm formation w ith S. gordonii

PAGE 29

29 CHAPTER 3 MATERIALS AND METHOD S Bacteria and Culture Conditions P. gingivalis ltp1 (Simionato et al. 2006), 1237 (Wu et al. luxS (McNab et al. 2003) were cultured in Trypticase Soy Broth (TSB), supplemented with hemin (5 g ml1) and menadione (1 g ml1), anaerobically at 37C (85% N2, 10% H2, 5% CO2, were incorporated into the medium. S. gordonii DL1 and S. cristatus CC5A were cultured anaerobically at 37C in Brain Heart Infusion (BHI). Escherichia coli strains were grown aerobically at 37C in LB ml). Table 3 1 List of bacterial strains and plasmids used Strain or Plasmid Source P. gingivalis ATCC 33277 A merican Type Culture Collection P. gingivalis 33277 Laboratory stock (Wu) P. gingivalis 33277 ltp1 Laboratory stock (Maeda) P. gingivalis 33277 Laboratory stock (McNab) P. gingivalis 33277 C This study TUNER DE3 pET30b 1237 Laborator y stock S. gordonii DL1 Laboratory stock S.cristatus CC5A Laboratory stock pT COW Laboratory stock E.coli J53 Laboratory stock E.coli R751 Laboratory stock TOP10 Competent Cells Invitrogen BL21 (DE3) Competent Cells Novagen Construction of Mutant and Complemented Strains : Insertional pg1237 mutant was a kind gift from Dr. Xie at University of Tennessee. An insertional pg1237 mutant was generated by using ligation-independent cloning of

PAGE 30

30 PCR -mediated mutagenesis. A 2.1kb ermF -ermAM cassette was int roduced into the pg1237 gene by three steps of PCR to yield a pg1237erm -pg1237 DNA fragment.The fragment was then introduced into P. gingivalis 33277 by electroporation. The pg1237 deficient mutant was generated via a double crossover event that replaces the pg1237 gene with the pg1237 -erm pg1237 DNA fragment in the 33277 chromosome. The mutants were selected on TSB plates cont mutation was confirmed by PCR analysis, and the mutants were designated P. gingivalis 1237E (Wu et al. 2009). Reverse transcription PCR showed that PG1236 and PG1237 form an operon. A DNA sequence including th e PG1236 and PG1237 ORFs along with 300 bp upstream of the PG1236 initiation codon and 100 bp downstream of the PG1237 termination codon was amplified from P. gingivalis chromosomal DNA, The primers were engineered to contain the following restriction s ites : NheI -EagI. The shuttle vector plasmid pT -COW was digested with the appropriate restriction enzymes to allow cloning of the PCR product into the tetC region. The resulting plasmids were transformed into E. coli TOP10 and selected on ampicillin(100g/ ml) plates. Colonies were screened by colony PCR and restriction digestion. The plasmids with the correct restriction profile were designated pT -1237 and these plasmids were introduced into the 1237 strain by conjugation. The conjugation reaction mixture also contained helper E. coli J53 containing R751, an IncP plasmid used to mobilize vectors from E. coli to a Bacteroides recipient (Shoemaker 1987). The conjugation mixture had a donor -to recipient ratio of 0.2 .The mating was performed in a candle jar on pre-reduced blood agar plates for 16 h, and transconjugants were selected with gentamicin and tetracycline. The presence of

PAGE 31

31 wild type pg1237 gene was confirmed by PCR. The resulting st rains were designated C 1237. Production of PG1237 Recombinant Protein : The DNA fragment encoding ORF of PG1237 was amplified by PCR with primers r1237F -EcoRV and r1237R -HindIII, which produced a 600bp PCR product (Wu et al. 2009). The PCR products were then cloned into pCRII -TOPO (Invitrogen, Carlsbad, CA). The recombinant PG1237 (rPG1237) was expressed in E. coli by using a pET protein expression system (Novagen, Madison, WI). The DNA fragment of pg1237 was subcloned into the pET -30b downstream of a histidine tag. The rPG1237 was expressed in E. coli BL21(DE3) cells carrying the pET -30b/pg1237 pla smid in the presence of IPTG (isopropyl -Dthiogalactopyranoside) and kanamycin(50g/ml). His tagged rPG1237 was purified with Ni2+-charged His bind resin (Novagen, Madison, WI) The protein was washed on the column with 60 mM imidazole and then eluted w it h 1M imidazole. Purity was greater than 97% as determined by SDS -PAGE Coomassie staining. Protein was then dialysed against TBS. Homotypic P. gingivalis Biofilm Formation : Homotypic biofilm formation by P. gingivalis was quantified by a microtiter plate a ssay ( OToole and Kolter 1998 ), as adapted for P. gingivalis (Capestany et al. 2008). Parental and mutant strains in early log phase (2 108 cells) were incubated in microtiter plate wells at 37C anaerobically for 24 h. The resulting biofilms were washed thrice with PBS, stained with 1% crystal violet, and destained with 95% ethanol. Absorbance at 595 nm was determined with a Benchmark microplate reader. Biofilm assays were repeated independently three times with each strain in triplicate and analyzed with a Students unpaired two-tailed t test.

PAGE 32

32 Heterotypic P. gingivalis -S. gordonii Biofilms: Heterotypic P. gingivalis -S. gordonii communities were generated and analyzed as described previously ( Kuboniwa et al. 2006 ). S. gordonii cells were labeled with hexid ) (Kuboniwa et al. 2006), then cultured for 16 h anaerobically with rocking in a CultureWell coverglass system (Grace Biolabs). Fluorescein-labeled P. gingivalis cells (2 106 in pre-reduced PBS)(Kuboniwa et al. 2006) were reacted wi th the S. gordonii biofilm for 24 h anaerobically at 37C with rocking. The resultant communities were examined on a Yokogawa spinning disc confocal scanning laser microscope system with a 60x 1.4 N.A. objective. Images were digitally reconstructed (2D image; x -z section, y -z section and x -y section, 3D image; x y z section), and quantitation of P. gingivalis -specific fluorescence was determined with Imaris software (Bitplane). Quantitation of S. gordonii -specific fluorescence ensured equivalent levels of t he streptococcal substratum were present in each experiment. Biofilm assays were repeated independently three times with each strain in triplicate and analyzed with a Students unpaired two tailed t test. Area, volume and biofilm height were calculated us ing Image J software. Quantitative Real Time RT -PCR: Primers (Table 2) for real time RT -PCR were designed by using Primer 3 software. 16S rRNA was included as a control. Predicted product sizes were in the 100 to 200 bp range. Bacterial cells were grown upto desired O.D and RNA was extracted using the RNeasy mini kit (QIAGEN). The iScript cDNA synthesis kit (Bio -Rad) was used to under investigation were synthesized from chromosomal DNA using standard PCR. Real time RT -PCR was performed on a Bio -Rad iCycler using SYBR Green Supermix

PAGE 33

33 (Bio -Rad). Results were analyzed with the iCycler iQ Optical System software version 3.0a. The melt curve profiles were examined to verify a single peak for each sample, and transcript copy number was calculated as described ( Yin et al. 2001 ). RNA extracts were prepared in duplicate from independent experiments and cDNA samples were loaded in triplicate. Table 3 2. Primers Used in this Study Gene Primer Sequence 16S F AGGAACTCCGATTGCGAAGG R TCGTTTACTGCGTGGACTACC luxS F GAATGAAAGAGCCCAATCG R GTAATGGCCTCGCATCAG Mfa1 F TGCGGCGAAGTCGTAATG R ATCTTCAGCACTCTCCACAAG Ltp1 F TTCAGCAGTAGCGGTATTCACG R TGCGGATAGGGAGGAGTTGTC 1237 F CCACGCCACAGTAGAGGAAT R GCTCCTCGCCAATCTCTTTG Gppx F AGTTTCTCCTTGCAGCCAAA R ATGGTGGAGCAACCTACGAC Electrophoretic Mobility Shift Assay : Electrophoretic mobility shift assays (EMSA) were performed using the LightShift chemiluminescent EMSA kit (Pierce, Rockford, IL) as described previously (Wu et al. 2007). Biotinlabeled DNA fragments were generated by using 5' biotin-incorporated primers.The binding of rPG1237 to DNA was carried out in a 20 -l reaction mixture containing 20 fmol biotin-labeled DNA,10 mM Tris (pH 7.5), 50 mM KCl,1 mM dithiothreitol, 10 ng/l poly(dI -dC), 2% glycerol, 0.05% NP 40, and 2 mM MgCl with various amounts of purified rPG1237 protein (0, 0.5 1 and 2 g) at room temperature for 30 min. Samples were then loaded and run into a 5% nondenaturing polyacrylamide gel in 0.5 x Tris borate -EDTA buffer. The DNA and protein complexes were then transferred to a positively charged nylon membrane (380 mA, 30 min). The biotin end-

PAGE 34

34 labeled DNA was detected using the streptavidinhorseradish peroxidase conjugate and the chemiluminescent substrate. Each EMSA was repeated three times. Consortia of Oral Bacteria: Bacteria were cultivated to midexponential phase, harvested, washed and resuspended in phosphate -buffered saline (PBS) to an OD600 of 1.0. P. gingivalis par ent or mutant strains (108) were mixed with an equal number of S. gordonii or S. cristatus cells in 1 ml of PBS. The cell mixtures were pelleted by centrifugation (10,000 g for 1 min) and incubated at 37C anaerobically for 24 hours. The total RNA was e xtracted using RNeasy mini kit (QIAGEN). The iScript cDNA synthesis kit (Bio DNA standards for the genes under investigation were synthesized from chromosomal DNA using standard PCR. Real t ime RT -PCR was performed as described previously. D etection of Mfa and FimA : For Western blotting, P. gingivalis strains in early -log phase (O.D600 0.5), mid log phase (O.D600 0.7) and late-log phase (O.D6001.0) were lysed with bacterial cell lysis buffer (Sigma ) and the proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (10% gel) and transferred to a nitrocellulose membrane by electroblotting. Membranes were blocked using 5% milk in TBS -T (TBS buffer containing 0.01% Tween -20) and reacted with rabbit polyclonal antibodies against re combinant Mfa (rMfa) (1:20,000) or rFimA, (1:10,000) overnight at 4C. The next day the membranes were reacted with horseradish peroxidase-conjugated goat anti -rabbit secondary antibody (1:5, 000). Bound antibody was detected with an enhanced chemiluminescence system (Amersham).

PAGE 35

35 General Molecular Techniques Recombinant DNA techniques were performed as described previously (Sambrook et al. 2001). Restriction enzymes and DNA modifying enzymes wer e purchased from New England BioLabs. Chromosomal DNA was isolated using a Wizard genomic DNA purification kit (Promega). RNA was extracted using RNeasy mini kit from QIAGEN. Plasmid DNA was isolated from E. coli by using a Plasmid mini prep kit from PROME GA. Standard PCR conditions were 95C for 6 min and 30 cycles of 94C for 30 s, 58C for 30 s, and 72C for 3 min, followed by a final extension at 72C for 7 min. E.coli electrocompetent cells were prepared by suspending early logphase cells in chilled d istilled water (Dower et al. 1988) For electroporation, cells were incubated with 2 g of a plasmid in water and pulsed with a Bio-Rad gene pulser at 2.5 kV Statistical Analysis The Students unpaired two tailed t test was used to determine relationship of distribution of P. gingivalis wild type and mutant stain in monospecies biofilm formation and of P. gingivalis wild type and mutant stain with S. gordonii in heterotypic community formation. Statistical significance was set at p value < 0.05. The role of PG1237 in expression of mfa1, luxS, ltp1, 16S, hmuR in P. gingivalis S. gordonii and S. cristatus strains were analysed using Students unpaired two tailed t test. Statistical significance was set at p value < 0.001.

PAGE 36

36 CHAPTER 4 RESULTS Homotypic Biofilm Formation by P. gingivalis is Enhanced in the Absence of PG1237 PG1237 is a LuxR family transcriptional regulator which is thought to have a regulatory role in the LuxS pathway. Hence we wanted to investigate if PG1237 has any role in P. gingival is biofilm formation. The ability of P. gingivalis to form biofilms on oral surfaces contributes to the persistence of the organism and increases the potential for periodontal tissue destruction. Hence we investigated whether PG1237 mediated control functions to regulate the accumulation of homotypic P. gingivalis biofilms. We examined the relative biofilm forming capabilities of the pg1237 mutant strain of P. gingivalis compared to the parent strain. Monospecies biofilm formation was first tested in the mi crotiter plate assay with crystal violet staining (OToole and Kolter 1998 ). As shown in Fig.41 the pg1237 mutant showed greater biofilm accumulation than the parental strain, and biofilm formation by the complemented pg1237 strain was restored to wild -ty pe levels. Hence, PG 1237 is required to constrain P. gingivalis homotypic biofilm development, and in the absence of PG1237, more luxuriant biofilms are formed by P. gingivalis For construction of the complemented mutant a DNA sequence including the PG1236 and PG1237ORFs along with 300 bp upstream of the PG1236 initiation codon and 100 bp downstream of the PG1237 termination codon was amplified from P. gingivalis chromosomal DNA, The primers were engineered to contain the following restriction sites : Nh eI -EagI. The shuttle vector plasmid pT -COW was digested with the appropriate restriction enzymes to allow cloning of the PCR product into the tetC region. The resulting plasmids were transformed into E. coli TOP10 and selected on ampicillin

PAGE 37

37 (100g/ml) plat es. Colonies were screened by colony PCR and restriction digestion. The plasmids with the correct restriction profile were designated pT -1237 and these plasmids were introduced into the 1237 strain by conjugation. The conjugation reaction mixture also contained helper E. coli J53 containing R751, an IncP plasmid used to mobilize vectors from E. coli to a Bacteroides recipient (Shoemaker 1987). The presence of wild type pg1237 gene was c onfirmed by PCR. The resulting strains were designated C 1237. PG1237 Deficiency Enhances Accumulation of Heterotypic P. gingivalis S. gordonii Communities The biofilms that develop in vivo on oral surfaces are complex multispecies communities (Rosan and Lamont, 2000). Successful bacterial colonizers of oral biofilms, therefore, are frequently capable of interacting synergistically with other biofilm inhabitants. Of particular relevance to this study, the presence of a substratum of the antecedent colonizer S. gordonii stimulates attachment and biofilm formation by P. gingivalis (Kuboniwa et al. 2006). Accumulation of P. gingivalis into heterotypic communities with S. gordonii proceeds through a series of interactive events ( Kuboniwa et al. 2006). P. gingivalis cells are first recruited from the fluid to the solid phase where accretion into rudimentary biofilm microcolonies occ urs. To investigate the role of PG1237 in the development of he terotypic P. gingivalis -S. gordonii communities, the accumulation of P. gingivalis parental and mutant strains on substrata of S. gordonii was examined. A biofilm of hexidium iodide -labeled S. gordonii cells was first generated on glass coverslips. Fluores cein -labeled P. gingivalis cells were reacted anaerobically with the S. gordonii biofilm, and accumulations of heterotypic biofilms were observed by confocal

PAGE 38

38 microscopy as described above. As the P. gingivalis cells were suspended in buffer, any increase i n number is unlikely to be due to cell division. Therefore, this assay models one of the early stages of biofilm development: the recruitment, coadhesion, and accumulation of P. gingivalis cells from the planktonic phase into a sessile biofilm. This proces s is contingent on interbacterial signaling events and occurs prior to a further increase in number through growth and division (Kuboniwa et al. 2006). x -y and x -z images of the heterotypic P. gingivalis -S. gordonii biofilms are shown in Fig. 4 2 A and B. S. gordonii cells developed biofilms that extensively covered the glass surface, and cells of parental P. gingivalis formed a few discrete microcolony accumulations clearly separated from each other, whereas the pg1237 mutant showed both increased number and size of microcolonies (Fig. 42 B and D ). The total fluorescence analysis performed using Imaris software showed statistically significant (ie. p value < 0.05 ) increased accumulation of the mutant compared to the wild type level (Fig.43). In addition to total fluorescence, biofilm parameters such as height, area and volume analysed using Image J software were significantly elevated (ie. p value < 0.05 ) in the mutant as compared to the wild type (Fig. 4 -4 to Fig. 4-6). These results suggest that PG1237 has a role in constraining development of heterotypic P. gingivalis communities. luxS and mfa1 Production are Controlled by PG1237 Maturation of dual and single species P. gingivalis biofilms also requires the activity of the AI 2 family of signaling mole cules ( McNab, 2003 ). We reasoned, therefore, that PG1237 may also control expression of the LuxS enzyme that is responsible for AI 2 formation. P. gingivalis is one of only a few organisms in which LuxS production and AI -2 activity is regulated at the level of luxS transcription ( James et

PAGE 39

39 al. 2006). Expression of luxS in planktonic cells of wild type and mutant P. gingivalis was monitored by real time RT -PCR. Loss of PG1237 resulted in an approximately 3 fold increase in the levels of luxS mRNA (Fig. 4 -7). Thus, enhanced biofilm formation by the PG1237 mutant may arise from an increase in AI 2 mediated signaling Minor fimbriae are also important for the maturation of dual and single species P. gingivalis biofilms. Hence, we wanted to investigate whether PG 1237 controls transcription of mfa1 Expression of mfa1 in planktonic cells of wild type and mutant P. gingivalis was monitored by real time RT -PCR. Loss of PG1237 resulted in an approximately 10 fold increase in the levels of mfa1 mRNA (Fig. 4 -7). Thus, i ncreased expression of the minor fimbriae in addition to increased luxS expression may be responsible for the enh anced biofilm formation by the pg1237 mutant. luxS Production is Controlled by PG1237 in a Cell Density Dependent Manner It has been shown that PG1237 is differentially expressed during different growth phases (Wu et al. 2008). Hence, we wanted to investigate whether PG1237 regulates luxS production in a growth phase or cell density dependent manner. Wild type and pg1237 mutant strains were grown to O.D600 of 0.5 (early log phase), 0.7 (mid log phase) and 1.0 (late log phase). RNAs were extracted from the bacterial cells collected from the different time points, and expression levels of luxS were determined using real time RT -PCR Loss of PG1237 resulted in an approximately 9 fold increase in the levels of luxS mRNA at O.D600 of 0.5 (Fig.4 8). At O.D600 of 0.7 and 1.0 the fold increase in levels of luxS mRNA were much less pronounced almost returning to wild type levels at O.D600 of 1.0.

PAGE 40

40 These re sults show that PG1237 regulates production of LuxS in a growth phase phase or cell density dependent manner. AI 2 Represses PG1237 and Ltp1 Production We know that AI -2 is required for the for the formation of both mono biofilms and mixed species commun ities of P. gingivalis .(McNab et al. 2003) Hence, we wanted to investigate the effect of AI -2 on PG1237 and Ltp1 production. We used luxS ie. luxS deletion mutant as this strain would have no production of AI -2 as LuxS is the enzyme required for AI 2 production. RNA was extracted from the wild type and luxS strains and pg1237 expression levels were measured using real time RT -PCR. Loss of AI 2 resulted in an approximately 3 fold increase in the levels of pg1237 and ltp1 (fig.4 9) in the mutant as compared to the wild type strain. These results show that AI -2 represses PG1237 and Ltp1 production. Ltp1 Causes Increased Production of PG1237 in a P. gingivalis biofilm Previous studies have shown that Ltp1 regulates both dual and single species biofilm formation in P. gingivalis by regulating luxS production and exopolysaccharide production (Maeda et al. 2008). We wanted to investigate whether Ltp1 could be regulating biofilm formation by regulating PG1237 production. RNA was extracted from wild type, ltp1 and C ltp1 biofilms grown anaerobically for 24 hours and pg1237 mRNA levels were determined using real time RT -PCR. Loss of ltp1 r esulted in approximately a 2.5 fold decrease in pg1237 levels in the mutant as compared to the wild type and the expression of pg1237 returned to wild type levels in the complemented strain (Fig.410) showing that the change in pg1237 mRNA levels in the mutant was indeed due to the loss of ltp1

PAGE 41

41 These results suggest that Ltp1 regulates P. gingivalis biofilm formation by increasing the production of PG1237. Interaction of S. gordonii with P. gingivalis Causes Increased PG1237 and Decreased Mfa1 Production Previous studies have shown that contact with S. gordonii caused decreased mfa1 promoter activity in P. gingivalis (Park et al. 2006). We wanted to test the involvement of PG1237 in this down regulation of mfa1 We extracted RNA from a S. gordonii P. gingiv alis community grown for 24 hours anaerobically and measured expression levels of mfa1 and pg1237 We saw an approximately 2.5 fold decrease in the levels of mfa1 and a 2.6 fold increase in the levels of pg1237 in the mixed biofilm as compared to P. gingiv alis only biofilm (Fig.4 11). To ensure that these effects were not the result of a non-specific effect on global mRNA levels the same experiments were done on S. cristatus -P. gingivalis community and we saw no change in the mRNA levels of mfa1 and pg1237 as compared to P. gingivalis only biofilm. These results suggest that contact with S. gordonii regulates biofilm formation by down regulating mfa1 production via. u p -regulating pg1237 expression. Interaction of S. gordonii with 1237 Causes Increased Production of LuxS and Mfa1 In this study we have seen that the 1237 mutant shows both increased monospecies biofilm as well as mixed biofilm formation with S. gordonii as compared to the wild type strain. We also saw increased expr ession of luxS and mfa1 in the mutant as compared to the wild type using planktonic cells.We wanted to investigate whether the increased biofilm formation of the mutant with S. gordonii could be due to increased production of LuxS and Mfa1.

PAGE 42

42 We extracted RN A from a S. gordonii wild type P. gingivalis and S. gordonii communities grown for 24 hours anaerobically and measured expression levels of mfa1 and luxS We saw an approximately 2.5 fold decrease in the levels of mfa1 and a 3 fold decrease in the levels of luxS in the wild type mixed community as compared to P. gingivalis only biofilm (Fig.4 12). In contrast in the 1237 mixed community there was a 2.2 fold increase in luxS levels and a 3 fold increase of mfa1 levels as compared to 1237 only biofilm (Fig.412).To ensure that these effects were not the result of a non specific effect on global mRNA levels the same experiments were done on S. cristatus wild type P. gingivalis and S. cristatus communities and we saw no change in the mRNA levels of mfa1 and luxS as compared to P. gingivalis only biofilm. The se results suggest that PG1237 regulates P. gingivalis biofilm formation with S. gordonii by regulating expression of luxS and mfa1 and that the increased S. gordonii community formation is due to increased LuxS and Mfa1 production. Interaction of S. gordonii with P. gingivalis Causes Increased Ltp1 Production Previous studies have shown that loss of Ltp1 resulted in increased S. gordonii P. gingivalis biofilm formation as compared to the parental strain (Simionato et al. 2004).suggesting that Ltp1 h ad a role in regulating biofilm formation. Hence, we wanted to investigate whether contact between S. gordonii and P .gingivalis caused a change in the expression level of ltp1 We extracted RNA from a S. gordonii wild type P. gingivalis and S. gordonii community grown for 24 hours anaerobically and measured expression levels of ltp1 We saw an approximately 2.5 fold increase in the levels of ltp1 in the wild type mixed community as compared to P. gingivalis only biofilm (Fig.4-13). In the 1237 mi xed community there was a 1.7 fold increase in ltp1 levels as compared to 1237

PAGE 43

4 3 only biofilm (Fig.4 13).To ensure that these effects were not the result of a non-specific effect on global mRNA levels the same experiments were done on S. cristatus wild type P. gingivalis and S. cristatus communities and we saw no change in the mRNA levels of ltp1 as compared to P. gingivalis only biofilm. These results strongly suggest that Ltp1 has a regulatory role in S. gordonii -P. gingivalis community formation. Bi nding of PG1237 Protein to the Promoter Region of luxS and mfa1 In this study we have shown that PG1237 regulates expression of luxS in both planktonic and biofilm P. gingivalis cells by using real time RT -PCR analysis. Hence, we wanted to investigate whet her PG1237 directly regulates luxS expression. To determine if the transcriptional regulator PG1237 directly interacts with the promoter region of luxS and mfa1 we performed an EMSA. pfs is the gene upstream to luxS and pfs and luxS form an operon. DNA f ragment s 200bp upstream of pfs initiation codon and 200bp upstream of mfa1 initiation codon were generated by PCR with the 5 biotin-labeled primers (Table 2 ). The promoter region of fimA a geneencoding component of the long fimbriae of P. gingivalis wa s used as a control. rPG1237 was expressed in a pET expression system and purified from E. coli As shown in Fig.414 and Fig. 415. the DNA fragments upstream of pfs and mfa1 were shifted in the presence of the rPG1237. As the concentration of rPG1237 was increased, the retarded protein-DNA complex became more evident, with a parallel loss of uncomplexed DNA. We also saw that DNA binding activity of rPG1237 was blocked in the presence of excess unbiotinylated DNA, and that no DNA shift was detected when rPG1237 was incubated with the promoter region of fimA This suggests that the shift we saw was specific.

PAGE 44

44 These results suggest that PG1237 directly regulates expression of luxS and mfa1 by binding to their promoter region. PG1237 Regul ates E xpression of M fa protein In this study we have shown that PG1237 regulates expression of mfa1 in both planktonic and biofilm P. gingivalis cells by using real time RT -PCR analysis. Hence, we wanted to investigate whether the increased mfa1 expression at the transcriptional level in the PG1237 mutant translated into increased Mfa protein production in the mutant Wild type and 1237 strains were grown to early, mid and late log phase .Total bacterial proteins were extracted at the different growth phases using cell lytic buffer and probed with antibodies to FimA, Mfa by Western blotting. The blot analysis showed that expression of Mfa was increased in the 1237 mutant at early log phase ie.O.D600 of 0.5 (Fig.4-17). No change in expression of Mfa was seen during mid and lat e log phases. No change in expression of FimA was detected in the mutant (Fig.4-18) confirming that Mfa is indeed induced in the mutant. These results suggest that the increased mfa1 expression at the transcriptional level in the PG1237 mutant translated into increased Mfa protein production in the mutant and that PG1237 has a role in regulating expression of Mfa protein. Complementation of 1237 with Wild -type 1237 Restored Production of LuxS and Mfa1 to Wild-type Levels To confirm expression changes of l uxS and mfa1 we saw in the 1237 mutant was due to the loss of 1237, we complemented the mutant strain with a wild-type 1237 allele. Expression of luxS and mfa1 in planktonic cells of wild type, mutant and complemented mutant P. gingivalis was monitored b y real time RT -PCR.

PAGE 45

45 Complementation of mutant restored expression levels of luxS and mfa1 to almost wild type levels (Fig. 419). These results suggest that the expression changes we found in the were due to the loss of 1237

PAGE 46

46 WT 1237O.D595 0 0.1 0.2 0.3 0.4 0.5 0.6 C 1237 Figure 41. PG1237 controls homotypic P. gingivalis biofilm growth. Microtiter plate biofilms after 24 h were stained with crystal violet and washed, and then the crystal violet was released with 95% ethanol. Biofilm accumulation was measu red by absorbance at 595 nm for parental strain 33277 and pg1237 mutant 1237 and complemented strain C 1237. de notes P values of <0.05 (t test) for comparison to 33277.

PAGE 47

47 Y Z XA. WT A. B. 1237 Y Z X B. Figure 42. PG1237 regulate s heterotypic P. gingivalis -S. gordonii biofilms. S. gordonii stained with hex idium iodide (red) was cultured on glass plates. P. gingivalis strains were stained with fluorescein (green) and reacted with the S. gordonii biofilms for 24 h. Colocalized bacteria appear yellow. Mixed-species biofilm accumulations were viewed by confocal microscopy A)Confocal laser scanning microscopy images of x -y and x -z projections of parental strain 33277 B)Confocal laser scanning microscopy images of x -y and x -z projections of mutant strain 1237 C)3 -D view of parental strain 33277 D)3-D view of mut ant strain

PAGE 48

48 D. C. WT C. D. 1237 D. Figure 42. PG1237 regulate s heterotypic P. gingivalis -S. gordonii biofilms. S. gordonii stained with hexidium iodide (red) was cultured on glass plates. P. gingivalis st rains were stained with fluorescein (green) and reacted with the S. gordonii biofilms for 24 h. Colocalized bacteria appear yellow. Mixed-species biofilm accumulations were viewed by confocal microscopy A)Confocal laser scanning microscopy images of x -y a nd x -z projections of parental strain 33277 B)Confocal laser scanning microscopy images of x -y and x -z projections of mutant strain 1237 C)3 -D view of parental strain 33277 D)3-D view of mutant strain

PAGE 49

49 0 0.5 1 1.52 2.5 3 Ratio of Intensity (Green/Red)WT 1237 Mutant* Figure 4 3 Ratio of P .gingivalis/ S. gordonii in 33277 vs. P. gingivalis -S. gordonii community. denotes pvalue<0.05 ( t test) in comparison to 33277.

PAGE 50

50 0 5 10 15 20 25 30 Biofilm Thickness ( m)WT 1237 Mutant Fig ure 44 Biofilm thickness of 33277 vs. P. gingivalis -S. gordonii community. denotes pvalue<0.05 ( t test) in comparison to 33277.

PAGE 51

51 Area ( m2) 0 2000 4000 6000 8000 10000 12000 Figure 4 5 Total P. gingivalis accumulation in 33277 vs. 1237 strain in P. gingivalis -S. gordonii community measured by area analysis. denotes pvalue<0.05 ( t test) in comparison to 33277

PAGE 52

52 Volume ( m3)WT 1237 0 5000 10000 15000 20000 25000 30000 35000 40000 45000 Figure 4 -6 Total P. gingivalis accumu lation in 33277 vs. 1237 strain in P. gingivalis S. gordonii community measured by volume analysis. denotes pvalue<0.05 (t test) in comparison to 33277.

PAGE 53

53 luxS mfa1 hmuR 16S 2 4 6 8 10-24 6* *Fold Difference in mRNA Copy Number ( 1237mutant/WT)No difference Figure 4 7 mfa1 and luxS genes are differentially expressed in t he 1237 mutant. Gene expression was measured by quantitative RT -PCR on wildtype (WT) or 1237 cultures grown t o early (OD600 0.5) exponential phase. Fold change was calculated by dividing the copy number of the gene transcript (per microgram of RNA) in the 1237 mutant by the copy number in the WT. The 16S rRNA gene was used as a control. Significant differences ( P < 0.001 by t test) are labeled with asterisks. hmuR was used as a positive control as other groups have previously s h own that hmuR is down -regulated in 1237 mutant

PAGE 54

54 0.5 0.7 1.0 0.5 0.7 1.0luxS 16SFold Difference in mRNA Copy Number ( 1237 Mutant/WT) 2 4 6 8 10* *No difference Figure 4 8 luxS gene is differentially expressed in the 1237 mutant in a growth phase dependent manner. Gene expression was measured by quantitative RT -PCR on wild-type (WT) or 1237 cultures grown to early (OD600, 0.5), middle (OD600, 0.7) or late (OD600, 1.0) exponential phase. Fold change was calculated by dividing the copy number of the gene transcript (per microgram of RNA) in the 1237 mutant by the copy number in the WT. The 16S rRNA gene was used as a control. Significant differences ( P < 0.001 by t test) are labeled with asterisks

PAGE 55

55 1237 ltp1 16Sd Difference in mRNA Copy Number ( luxS mutant/WT) 2 4* *No difference Figure 4 9 1237 and ltp1 genes are differentially expressed in the luxS mutant. Gene expression was measured by quantitative RT -PCR o n wild-type (WT) or luxS cultures grown to mid (OD600, 0.7) exponential phase. Fold change was calculated by dividing the copy number of the gene transcript (per microgram of RNA) in the luxS mutant by the copy number in the WT. The 16S rRNA gene was used as a control. Significant differences ( P < 0.001 by t test) are labeled with asterisks.

PAGE 56

56 -2 2No Difference1237 16SFold Difference in mRNA Copy number (mutant/WT)* ltp1 C ltp1 ltp1 C ltp1 Figure 4 10 The P. gingivalis 1237 gene is differentially expressed in the ltp1 mutant biofilm. Gene expression was measured by quantitative RT -PCR on wild -type (WT) or ltp1 or C ltp1 biofilm grown for 24 hours anaerobically. Fold change was calculated by dividing the copy number of the gene transcript (per microgram of RNA) in the ltp1 mutant by the copy nu mber in the WT. The 16S rRNA gene was used as a control. Significant differences ( P < 0.001 by t test) are labeled with asterisks.

PAGE 57

57 Fold Difference in mRNA Copy Number (Strep + PG / PG alone) 2 4 2 4No difference1237 mfa1 16SSG + PG SG + PG SG + PG SC + PG SC + PG SC + PG* Figure 4 11 1237 and mfa 1 genes are differentially expressed in the P. gingivalis -S. gordo nii community as compared to P. gingivalis mono biofilm. Gene expression was measured by quantitative RT -PCR on P. gingivalis -S. gordonii P. gingivalis -S. cristatus or P. gingivalis mono biofilm grown for 24 hours anaerobically. Fold change was calculated by dividing the copy number of the gene transcript (per microgram of RNA) in the S. gordonii or S. cristatus community with P. gingivalis by the copy number in the P. gingivalis mono biofilm. The 16S rRNA gene was used as a control. Significant differenc es ( P < 0.001 by t test) are labeled with asterisks. SG= Streptococcus gordonii, SC= Streptococcus cristatus

PAGE 58

58 WT+SG WT+SG WT+SC WT+SC 1237+SG 1237+SG 1237+SC 1237+SCluxS mfa1 24-2 -4Fold Difference In mRNA Copy No. Strep +PG/PG only* *No difference Figure 4 12 luxS and mfa 1 genes are differentially expressed in the P. gingivalis -S. gordonii community as compared to P. gingivalis mono biofilm. Gene expression was measured by quantitative RT -PCR on P. gingivalis -S. gordonii P. gingivalis -S. cristatus or P. gingivalis mono biofilm grown for 24 hours anaerobically. Fold change was calculated by dividing the copy num ber of the gene transcript (per microgram of RNA) in the S. gordonii or S. cristatus community with P. gingivalis by the copy number in the P. gingivalis mono biofilm. The 16S rRNA gene was used as a control. Significant differences ( P < 0.001 by t test) are labeled with asterisks. SG= Streptococcus gordonii, SC= Streptococcus cristatus

PAGE 59

59 -2 2Fold Difference In mRNA Copy No. Strep +PG/PG onlyWT+SG WT+SC 1237+SG 1237+SCltp1No difference* Figure 4 13 ltp1 gene is differentially expressed in the P. gingivalis S. gordonii community as compared to P. gingivalis mono biofilm. Gen e expression was measured by quantitative RT -PCR on P. gingivalis -S. gordonii P. gingivalis S. cristatus or P. gingivalis mono biofilm grown for 24 hours anaerobically. Fold change was calculated by dividing the copy number of the gene transcript (per mic rogram of RNA) in the S. gordonii or S. cristatus community with P. gingivalis by the copy number in the P. gingivalis mono biofilm. The 16S rRNA gene was used as a control. Significant differences ( P < 0.001 by t test) are labeled with asterisks. SG= Stre ptococcus gordonii, SC= Streptococcus cristatus

PAGE 60

60 DNA +500ng r1237 DNA only DNA + 1 g r1237 DNA +2 g r1237 DNA + excess unlabelled DNA + 1 g r1237 Figure 4 14 Interaction of rPG1237 with the promoter region of luxS EMSA were performed in the presence or absence of rPG1237 and 20 fmol biotin -labeled DNA Increasing amounts of rPG1237(500 ng to 2 g) were used in the assays. For testing specificity of bind ing 200-fold excess amounts of competitor oligonucleotide was added to the reaction mixture with the labeled probe.

PAGE 61

61 DNA only DNA + 500ng r1237 DNA + 1 g r1237 DNA + 2 g r1237 DNA + excess unlabelled DNA + 1 g r1237 Figure 4 15 Inte raction of rPG1237 with the promoter region of mfa1. EMSA were performed in the presence or absence of rPG1237 and 20 fmol biotin -labeled DNA In creasing amounts of rPG1237(500 ng to 2 g) were used in the assays. For testing specificity of bind ing 200-fol d excess amounts of competitor oligonucleotide was added to the reaction mixture with the labeled probe. DNA only DNA+500ng r1237 DNA+1 g r1237 DNA+2 g r1237 DNA+1 g r1237+unlabelled DNA Figure 4 16 Interaction of rPG1237 with the promoter region of fimA EMSA were performed in the presence or absence of rPG1237 and 20 fmol biotin -labeled DNA Increasing amounts of rPG1237(500 ng to 2 g) were used in the assays

PAGE 62

62 WT O.D6000.5 1237 O.D6000.5 Figure 417. Expression of Mfa is increased in the absence of PG1237. Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (10% gel) and transferred to a nitrocellulose membrane by electroblotting. Membranes were blocked using 5% milk in TBS -T (TBS buffer containing 0.01% Tween -20) and reacted with rabbit polyclonal antibodies against recombinant Mfa (rMfa) (1:20,000) overnight at 4C. The next day the membranes were reacted with horseradish peroxidase -conjugated goat anti rabbit secondary antibody (1:5,000). Bound antibody was detected with an enhanced chemiluminescence syste m (Amersham). WT O.D6000.5 1237 O.D6000.5 Figure 4-18 Expression of FimA is not increased in the absence of PG1237. Proteins were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (10% gel) and transferred to a nitrocellulose membrane by electroblotting. Membranes were blocked using 5% milk in TBS -T (TBS buffer containing 0.01% Tween -20) and reacted with rabbit polyclonal antibodies against recombinant FimA (rFimA) (1:10,000) overnight at 4C.The next day the membranes were r eacted with horseradish peroxidase -conjugated goat anti rabbit secondary antibody (1:5,000). Bound antibody was detected with an enhanced chemiluminescence system (Amersham).

PAGE 63

63 Fold Difference in mRNA Copy number (mutant/WT) 24 6 8 10No difference 1237 C 1237 1237 1237 C 1237 C 1237 mfa1 luxS 16S ** Figure 4 -19. Complementation of the 1237 mutant with the wild-type (WT) 1237 gene restores expression of luxS and mfa1 genes to close to WT levels.The transcript copy number (per microgram of RNA) was determined by real -time PCR for the WT, C 1237, or 1237 strain grown to early exponential phase. The 16S rRNA gene was used as a control. Significant differences ( P < 0.001 by t test) are labeled with asterisks.

PAGE 64

64 CHAPTER 5 DISCUSSION An association between LuxR family transcriptional regulators and biofilm formation has been observed with other bacteria. It has been reported that VanT, a L uxR fa mily transcriptional regulator regulates biofilm formation in Vibrio anguillarum and that a vanT mutant of V.anguillarum could not form biofilms properly (Croxatto et al. 2002). Similarly, in Pseudomonas aeruginosa, mutation of lasR causes reduced biofilm formation hence showing that LasR, a LuxR family transcriptional regulator regulates biofilm formation in P.aeruginosa (Pesci et al. 1997). It was also reported that LeuO, a LuxR family transcriptional regulator is important for biofilm formation i n Vibrio cholerae (Stratmann et al. 2008). Thus a number of organisms utilize LuxR transcriptional regulators to regulate their biofilm formation. LuxR -family proteins such as PG1237 for which there is no obvious cognate LuxI synthase are known as LuxR Solos or Orphans. Unlike synthase associated LuxR proteins, orphan LuxR homologs do not directly control the synthesis of autoinducers, but can interact with them to expand the existing regulatory network of the bacterium. AHLs appear to be the most preval ent activating signal for orphan LuxR homologs, though other mechanisms of regulatory action such as heterodimer formation or activation by plant signals also exist (Ledgham et al. 2001, Ferluga et al. 2002).These proteins are found in bacteria which posse ss a complete AHL QS system as well as in bacteria that do not. It is emerging that these proteins could allow bacteria to respond to endogenous and exogenous signals produced by their neighbours and have diverse roles in bacterial interspecies communication.

PAGE 65

65 Several factors can justify the increased prevalence of orphan LuxR regulators in quorum -sensing systems of bacteria. These regulators can utilize the existing quorum sensing signal in the bacteria and alleviate the cost associated with making additi onal signal molecules. Gain of response regulators also leads to expansion of the existing regulatory networks. For instance, QscR of P. aeruginosa utilize the existing AHL signal molecules to extend their regulatory control beyond that of the cognate LuxR /I pair (Lequette et al. 2006). Also, orphan LuxR regulators could be recruited for perceiving exogenous signals for intercellular communication. Several instances of intercellular communication have been reported for orphan LuxR regulators for eg. in Serratia sp. ATCC39006, carbapenem synthesis by CarR is modulated by the interspecies communication system of LuxS/AI 2 (Coulthurst et al. 2005). Genetic and structural studies indicated that nine residues are identical in at least 95% of LuxR -type proteins (Z hang et al. 2002). Six of those residues in the N -terminal domain (W57, Y61, D70, P71, W85, and G113) were involved in binding to the cognate autoinducer while three in the C -terminal domain (E178, L182, and G188) were associated with DNA binding (Nasser and Reverchon 2007). Structure-function analysis has indicated that the DNA -binding domain is largely conserved, while the autoinducer binding domain tends to vary in several LuxR -type proteins, perhaps to accommodate the variety of activating signals (Bott omley et al. 2007). PG1237 followed this pattern as it contained none of the six conserved N -terminal residues at its N -terminal but contained two of the three conserved C -terminal residues at its C -terminus. This indicates that some signal other than aut o inducer binding might be regulating PG1237. Sequence analysis indicated that PG1237 contains the well conserved DNA binding,

PAGE 66

66 helix -turn helix (HTH) domain of about 65 amino acids, present in transcription regulators of the LuxR/FixJ family of response regulators. HTH domain of PG1237 showed 43% homology with HTH domain of LuxR from V. fischeri and 68% homology with HTH domain of GerE from B. subtilis. Sequence analysis showed that PG1237 belongs to GerE family. Biofilm development in general proceeds through a series of ordered developmental steps (Stanley et al. 2004). In the case of P. gingivalis -S. gordonii consortia, the first step is a multivalent coadhesive interaction mediated by two distinct adhesin receptor pairs. The P. gingivalis long fimbriae ( FimA) bind to glyceraldehyde3 phosphate dehydrogenase (GAPDH) present on the streptococcal surface (Maeda et al. 2004). In addition, the P. gingivalis short fimbriae (Mfa) engage the streptococcal SspA/B (antigen I/II) adhesins ( Park et al. 2005) thro ugh an approximately 27 amino acid binding epitope of SspA/B termed BAR ( Daep et al. 2006 Demuth et al. 2001 ).. Following co adhesion, LuxS dependent signaling is required for further development of the heterotypic biofilm communities ( McNab et al. 2003). With regard to monospecies P. gingivalis biofilms, initial attachment depends on an internalin family protein, InlJ (Capestany et al. 2006), and development requires expression of the short fimbriae (Mfa). Limitation of biofilm development appears to be important for P. gingivalis and such mechanisms in general are thought to arise in order to optimize exposure to oxygen (either maximal or minimal), or to facilitate influx of nutrients and efflux of waste (Rainey and Rainey 2003). P. gingivalis has the po tential to be an aggressive pathogen in periodontal disease. The organism colonizes the biofilms that accumulate on oral non-shedding

PAGE 67

67 surfaces and can damage periodontal tissues through the production of arginine and lysine specific proteases and other tox ic factors. Paradoxically, P. gingivalis is also present in the oral cavity in the absence of tissue destruction, implying that mechanisms to restrain pathogenic potential are operational in the organism. The results of this study indicate that the LuxR fa mily transcriptional regulator, PG 1237 occupies a central position in regulating several aspects of P. gingivalis virulence such as biofilm formation and hemin uptake. In the absence of PG1237 mfa1 and luxS were upregulated determined by real time RT PC R in planktonic cells as well as P. gingivalis -S. gordonii communities. Phenotypically the pg1237 mutant showed increased monospecies biofilm formation as well as increased community formation with S. gordonii Using electrophoretic mobility shift assay (E MSA) we showed that PG1237 binds to the promoter regions of mfa1 and luxS Complementation of the mutant with wild-type pg1237 led to restoration of monospecies biofilm formatio n and expression of mfa1 and luxS to wildtype levels. Control of P. gingivali s biofilm development by PG1237 was associated with a decrease in both luxS and mfa1 expression. Mfa (minor fimbriael protein) is necessary for development of both monospecies P. gingivalis biofilms and heterotypic P. gingivalis -S. gordonii communities. Mu tants of P. gingivalis that lack Mfa show impaired formation of both monospecies biofilms (Lin et al. 2006) and heterotypic biofilms with S. gordonii (Park et al. 2005). PG1237 constrains biofilm formation by decreasing Mfa production both at the transcrip tional level and at the protein processing level. AI 2 dependent signaling is required for recruitment of P. gingivalis cells from the fluid phase and incorporation into the sessile communities. Consistent with this, PG1237 activity in

PAGE 68

68 P. gingivalis biofil m cells negatively regulates expression of LuxS, an enzyme responsible for AI 2 production. Thus, PG1237 exerts negative regulation of biofilm development through limitation of cell -cell communication, in addition to minor fimbriael protein production. Lt p1 is a low molecular weight tyrosine phosphatase that was found to be differentially regulated in P. gingivalis biofilms. Ltp1 functions in constraining both monospecies biofilm formation as well as community formation with S. gordonii by regulating exopolysaccharide synthesis as well as luxS transcription. The expression of pg1237 was reduced in the ltp1 mutant biofilm determined using real time RT -PCR suggesting that Ltp1 in a biofilm increases the production of PG1237 which would then target luxS and mf a1 to limit biofilm formation. Hence, Ltp1 and PG1237 link together for the purpose of controlling biofilm and mixed species communities formation. The results of the current study would thus allow us to propose the following model (Fig. 5 -1) During early exponential growth LuxS produces AI 2 which suppresses the production of Ltp1 and PG1237 which in turn leads to increased Mfa production leading to biofilm formation. Subsequently, as the P. gingivalis community becomes established the LuxS and AI -2 leve ls are reduced which cause increased production of Ltp1 and PG1237 which in turn repress the production of LuxS and Mfa causing constrained biofilm formation. This is a good example of a positive feedback system. However this positive feedback is growth ph ase or optical density dependent. Using real time RT PCR we saw that there was not much regulation of luxS expression by PG1237 during middle and late log phase ie. O.D 0.7 and 1.0. This suggests that the positive feedback between AI -2, PG1237 and Ltp1 is mainly active during early log or early exponential

PAGE 69

69 phase. This model predicts that a PG1237 -deficient mutant would show an increased biofilm phenotype which was indeed exhibited by our pg1237 mutant increasing our confidence in the model. The results of t his study also allow us to propose the following model in terms of heterotypic P. gingivalis -S. gordonii communities.(Fig. 5-2) Contact of S. gordonii and P. gingivalis causes increased production of Ltp1 which in turn causes increased production of PG1237 which represses LuxS and Mfa production leading to constrained heterotypic P. gingivalis -S. gordonii community formation. This model predicts that a PG1237deficient mutant would show an increased heterotypic P. gingivalis -S. gordonii biofilm phenotype which was indeed exhibited by our pg1237 mutant increasing our confidence in the model. The results of this study suggest that both PG1237 and Ltp1 could be potential targets for drugs and other therapeutics being developed in the treatment of chronic periodontitis. Further research involving DNAse I footprinting to map the binding region of PG1237 to mfa1 and luxS electrophoretic mobility shift assay to see whether PG1237 is autoinduced heterotypic P. gingivalis -S. gordonii biofilm assays with compleme nted PG1237 strains and potential interaction between Ltp1 and PG1237 still needs to be carried out.

PAGE 70

70 AI -2 1237 LuxS Ltp1 Mfa1 Increased Biofilm Formation Figure 51 Schematic representation of the AI 2 -PG1237 Ltp1 positive feedback model

PAGE 71

71 S.gordonii+ P.gingivalis Ltp1 PG1237 Biofilm formation LuxS Mfa1 Figure 5 2 Schematic representation of functionality of Ltp1 and PG1237 in constraining P. gingivalis -S. gordonii community formation.

PAGE 72

72 LIST OF REFERENCES Amaliya Timmerman,MF. Abbas,F. Loos,B.G. and Winkelhoff, AJ 2007 Java project on periodontal dis eases: the relationship between vitamin C and the severity of periodo ntitis. J Clin Periodontol. 34: 299304. Amano,A., Kuboniwa, M., Nakagawa, I., Akiyama, S., Morisaki, I. and Hamada, S. 2000 Prevalence of Specific Genotypes of Porphyromonas gingivalis f imA and periodontal health status. J Dent Res 79: 16641668. Armitage, G.C 2000 Classifying periodontal diseases a long standing dilemma. Periodontol 30: 9 23. Bassler, B. L. 2000 Small talk: cell-to -cell commu nication in bacteria. Cell 109: 421 -424. Beesto n, A. L., and M. G. Surette. 2002 pfs -dependent regulation of autoinducer 2 production in Salmonella enterica serovar Typhimurium. J. Bacteriol. 184: 3450 3456 Boggess KA; 2008 Society for Maternal -Fetal Medicine Publications Committee. Maternal oral health in pregnancy. Obstet Gynecol. 111(4): 976-986. Borrell,L.N and Papapanou, P.N 2005 Analytical epidemiology of periodontitis. J Clin Periodontol 32 Supplement 6: 132158. Bottomley MJ Muraglia E, Bazzo R & Carfi A 2007. Molecular insights into quorum sens ing in the human pathogen Pseudomonas aeruginosa from the structure of the virulence regulator LasR bound to its autoinducer J Biol Chem 282: 13592 13600. Capestany, C. A., M. Kuboniwa, I. Y. Jung, Y. Park, G. D. Tribble, and R. J. Lamont. 2006. Role of t he Porphyromonas gingivalis InlJ protein in homotypic and heterotypic biofilm development. Infect. Immun. 74:30023005. Capestany CA, Tribble GD, Maeda K, Demuth DR, Lamont RJ. 2008 Role of the Clp system in stress tolerance, biofilm formation, and intracellular invasion in Porphyromonas gingivalis. J Bacteriol. 190: 14361446. Contreras, A., Herrera, J.A., Soto, J.E., Arce, R.M., Jaramillo, A. and Botero, J.E. 2006 Periodontitis is associated with preeclampsia in pregnant women. J Periodontol 2006; 77: 182-1 88 Coulthurst SJ Barnard AM & Salmond GP 2005 Regulation and biosynthesis of carbapenem antibiotics in bacteria. Nat Rev Microbiol 3 : 295 306.

PAGE 73

73 Croxatto A, Chalker V.J, Lauritz J, Jass J, Hardman A, Williams P, Camara M and Milton D.L. 2002 VanT, a Homolog ue of Vibrio harveyi LuxR, Regulates Serine, Metalloprotease, Pigment, and Biofilm Production in Vibrio anguillarum Journal of Bacteriology 184: 1617 -1629. Daep CA, James DM, Lamont RJ, Demuth DR. 2006 Structural characterization of peptide mediated inhibi tion of Porphyromonas gingivalis biofilm formation. Infect Immun. 74:5756 5762. Dower WJ, Miller JF, Ragsdale CW. 1988 Nucleic Acids Res. 16 (13) :6127 6145. Ferluga S Bigirimana J Hfte M & Venturi V 2007 A LuxR homologue of Xanthomonas oryzae pv. oryzae i s required for optimal rice virulence. Mol Plant Pathol 8 : 529 538. Fong, K. P., W. O. Chung, R. J. Lamont, and D. R. Demuth. 2001. Intra and interspecies regulation of gene expression by Actinobacillus actinomycetemcomitans LuxS. Infect. Immun. 69:76257 634. Fuqua, C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR LuxI family of quorum -sensing transcriptional regulators. Annu. Rev. Microbiol. 50:727-751 Haffajee AD, Socransky SS. 1994 Microbial etiological agents of destructive periodontal diseases. Periodontol 5:78 111. Hamada,N., Sojar, H.T., Cho, M.I and Genco R.J.1996 Isolation and characterization of a minor fimbriae from Porphyromonas gingivalis Infect. Immun., 64: 47884794. Holt SC, Kesavalu L, Walker S, Genco CA. 2000 Virulence factors of Porphyromonas gingivalis Periodontol 2000 20:168 238. Holt, S. C., and J. L. Ebersole. 2005. Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia: the "red complex", a prototype polybacterial pathogenic consortium in periodontitis. Periodontol 2000 38:72122. Imamura, T. 2003 The Role of Gingipains in the Pathogenesis of Periodontal Disease. J Periodontol 74(1): 111 -118. James CE, Hasegawa Y, Park Y, Yeung V, Tribble GD, Kuboniwa M, Demuth DR, L amont RJ. 2006 LuxS involvement in the regulation of genes coding for hemin and iron acquisition systems in Porphyromonas gingivalis Infect Immun. 74:3834 3844. Karatan, E. and Watnick, P. 2009 Signals, Regulatory Networks, and Materials That Build and Br eak Bacterial Biofilms. Microbiology and Molecular Biology Reviews 73: 310347.

PAGE 74

74 Kuboniwa M, Tribble GD, James CE, Kilic AO, Tao L, Herzberg MC, Shizukuishi S, Lamont RJ. 2006 Streptococcus gordonii utilizes several distinct gene functions to recruit Porphy romonas gingivalis into a mixed community. Mol Microbiol. 60:121 139. Kuboniwa M, Amano A, Inaba H, Shizukuishi S 2009 Homotypic biofilm structure of Porphyromonas gingivalis is affected by FimA type variations Oral Microbiol Immunol 24: 260263. Laine ML, Appelmelk BJ, van Winkelhoff. AJ. 1996 Novel polysaccharide capsular serotypes in. Porphyromonas gingivalis J Periodontal Res 31:278 284. Lamont RJ, Jenkinson HF. 1998 Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis Microbiol Mol Biol Rev. 62:1244 1263. Lamont, R. J., A. El -Sabaeny, Y. Park, G. S. Cook, J. W. Costerton, and D. R. Demuth. 2002. Role of the Streptococcus gordonii SspB protein in the development of Porphyromonas gingivalis biofilms on streptococcal substrates. Mi crobiology 148:16271636. Ledgham F Ventre I Soscia C Foglino M Sturgis JN & Lazdunski A 2003 Interactions of the quorum sensing regulator QscR : interaction with itself and the other regulators of Pseudomonas aeruginosa LasR and RhlR Mol Microbiol 48 : 199 210. Lequette Y Lee JH Ledgham F Lazdunski A & Greenberg EP 2006 A distinct QscR regulon in the Pseudomonas aeruginosa quorum -sensing circuit J Bacteriol 188 : 3365 3370 Lin X, Wu J and Xie H 2006. Porphyromonas gingivalis minor fimbriae are required for cell -ce ll interactions. Infect. Immun ; 74:6011 -6015. Loos, B.G, John, R.P and Laine M.L 2005 Identification of genetic risk factors for periodontitis and possible mechanisms of action. J Clin Periodontol 32 Supplement 6: 159 -179. Lyon, W. R., J C. Madden, J. C. Levin, J. L. Stein, and M. G. Caparon. 2001. Mutation of luxS affects growth and virulence factor expression in Streptococcus pyogenes. Mol. Microbiol. 42:145157 Maeda K, Nagata H, Nonaka A, Kataoka K, Tanaka M, Shizukuishi S. 2004 Oral streptococcal glyceraldehyde -3 -phosphate dehydrogenase mediates interaction with Porphyromonas gingivalis fimbriae Microbes Infect. 6:1163 1170 Maeda K, Tribble G, Tucker C, Anaya C, Shizukuishi S, LewisJ ,Demuth D and Lamont RJ. 2008 A Porphyromonas gingivalis Tyrosine Phosphatase is a Multifunctional Regulator of Virulence Attributes Mol. Microbiol. 69(5): 11531164

PAGE 75

75 Marsh PD, Bradshaw DJ. 1995 Dental plaque as a biofilm. J Ind Microbiol. 15(3):1691 75. McNab R, Ford SK, El -Sabaeny A, Barbier i B, Cook GS, Lamont RJ. 2003 LuxS -based signaling in Streptococcus gordonii : autoinducer 2 controls carbohydrate metabolism and biofilm formation with Porphyromonas gingivalis J Bacteriol. 185:274 284. Nasser W & Reverchon S 2007 New insights into the r egulatory mechanisms of the LuxR family of quorum sensing regulators Anal Bioanal Chem 387: 381 390. Ohtani, K., H. Hayashi, and T. Shimizu. 2002. The luxS gene is involved in cell -cell signaling for toxin production in Clostridium perfringens Mol. Micro biol. 44:171 179. OToole GA, Kolter R. 1998 Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol. 28:449 461. Park Y, Simionato MR, Sekiya K, Murakami Y, James D, Chen W, Hackett M, Yoshimura F, Demuth DR, Lamont RJ. 2005 Short fimbriae of Porphyromonas gingivalis and their role in coadhesion with Streptococcus gordonii. Infect Immun. 73:3983 3989. Potempa J, Sroka A, Imamura T, Travis J. 2003 Gingipains, t he major cysteine proteinases and virulence factors of Porphyromonas gingivalis : structure, function and assembly of multidomain protein complexes. Curr Protein Pept Sci. 2003;4:397 407. Rainey PB, Rainey K. 2003 Evolution of cooperation and conflict in ex perimental bacterial populations. Nature. 425:72 74. Renvert, S., Pettersson, T., Ohlsson, O. and Persson, G.R 2006 Bacterial profile and burden of periodontal infection in subjects with a diagnosis of acute coronary syndrome J Periodontol 77: 11101119. R osan, B., and R. J. Lamont. 2000. Dental plaque formation. Microbes Infect. 2:1599 1607 Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Press, Cold Spring Harbor, NY. Sbordone, L., Bortolaia, C. 2003 Oral microbial biofilms and plaque-related diseases: microbial communities and their role in the shift from oral health to disease. Clin Oral Invest 7:181-188. Schwartz M, Lamster IB, Fine JB 1995 Clinical Guide to Periodontics 126:224.

PAGE 76

76 Simionato MR, Tuc ker CM, Kuboniwa M, Lamont G, Demuth DR, Tribble GD, Lamont RJ. 2006 Porphyromonas gingivalis genes involved in community development with Streptococcus gordonii. Infect Immun. 74:6419 6428. Socransky, S. S., Haffajee, A. D. 2000 Periodontal Microbial Ecol ogy. Periodontology 38:135187. Stanley NR, Lazazzera BA. 2004 Environmental signals and regulatory pathways that influence biofilm formation. Mol Microbiol. 52:917 924. Stoodley, L., Costerton, J.W. and Stoodley, P. 2004 Bacterial biofilms: from the nat ural environment to infectious diseases. Nat. Rev. Microbiol. 2(2): 95 -108. Suman E, Madhavi R, Kotian MS 2009 Role of bacterial biofilms in chronic non healing ulcers and effect of subinhibitory concentrations of Betadine and hydrogen peroxide on biofilms Journal of Hospital Infection 73(1):8789. Surette, M. G. and B. L. Bassler. 1999. Regulation of autoinducer production in Salmonella typhimurium. Mol. Microbiol. 31:585 595. Tribble GD, Mao S, James CE, Lamont RJ. 2006 A Porphyromonas gingivalis haloacid dehalogenase family phosphatase interacts with human phosphoproteins and is important for invasion. Proc Natl Acad Sci U S A. 103:11027 11032. Wang, P.L., Shirasu, S., Shinohar, M.,Azuma Y., Daito, M., Yasuda, H. and Ohura, K. 1999 IL 10 Inhibits Porphyromonas gingivalis LPS Stimulated Human Gingival Fibroblasts Production of IL-6. Biochemical and Biophysical Research Communications 263: 372377. Waters CM, Bassler BL. 2005 Quorum sensing: cell -to -cell communication in bacteria. Annu Rev Cell Dev Biol. 2 1:319 346. Wu J, Lin X and Xie H 2009 Regulation of Hemin Binding Proteins by a Novel Transcriptional Activator in Porphyromonas gingivalis. Journal of Bacteriology, 191: 115 -122 Ximenez -Fyvie LA, Haffajee AD, Socransky SS. 2000 Comparison of the micr obiota of supra and subgingival plaque in health and periodontitis. J Clin Periodontol. 27:648 657. Yin, J. L., N. A. Shackel, A. Zekry, P. H. McGuinness, C. Richards, K. V. Putten, G. W. McCaughan, J. M. Eris, and G. A. Bishop. 2001. Real time reverse tr anscriptasepolymerase chain reaction (RT -PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I. Immunol. Cell Biol. 79:213221.

PAGE 77

77 Zhang RG Pappas T Brace JL Miller PC Oulmassov T Molyneaux JM Ander son JC Bashkin JK Winans SC & Joachimiak A 2002 Structure of a bacterial quorum sensing transcription factor complexed with pheromone and DNA Nature 417 : 971 9 75

PAGE 78

78 BIOGRAPHICAL SKETCH Aarti Chawla was bo rn in Kolkata, India. After graduating from Delhi Public School, New Delhi, India she attended College of Pharmacy, Delhi University where she earned her Bachelor of Pharmacy degree in 2006. In Fall 2006 she joined the IDP graduate program at University of Florida. After joining the laboratory of Dr. Richard Lamont she worked on the project of investigating the role of PG1237 a transcription regulator in biofilm formation in Porphyromonas gingivalis and completed her masters program