<%BANNER%>

Nf-E2 and Usf Cooperate to Regulate the Recruitment and Activity of RNA Polymerase II in the Beta-Globin Locus

Permanent Link: http://ufdc.ufl.edu/UFE0041233/00001

Material Information

Title: Nf-E2 and Usf Cooperate to Regulate the Recruitment and Activity of RNA Polymerase II in the Beta-Globin Locus
Physical Description: 1 online resource (151 p.)
Language: english
Creator: Zhou, Zhuo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: 2, 5, beta, chromatin, e2, epigenetics, gene, globin, hemoglobin, histone, ii, modification, nf, phosphorylation, polymerase, regulation, rna, serine, transcription, usf
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The beta-globin gene locus has been extensively studied as a model system for understanding tissue- and developmental stage-specific expression and long-range regulation of genes. In humans, it consists of five beta-like globin genes that are expressed exclusively in erythroid cells during development that are under the regulation of a far upstream locus control region (LCR). The LCR contains several DNase I hypersensitive (HS) sites, each of which are 200-400bp in length and separated by 2-4 kbp of flanking DNA. The HS sites contain binding sites for a variety of erythroid-specific and ubiquitously expressed transcription factors, which contribute to the recruitment of multiple transcription regulatory proteins including RNA polymerase II (RNA Pol II) and histone modification enzymes to the LCR through protein-DNA and protein-protein interactions. By using an in vitro assay to differentiate mouse embryonic stem (ES) cells into erythroid lineage, we show that RNA Pol II is recruited to the LCR prior to the erythroid differentiation. In addition, we show that the helix-loop-helix proteins USF and TFII-I play antagonistic roles with USF as an activator and TFII-I as a repressor in beta-globin gene regulation. I further show that the repressor function of TFII-I is maintained by recruiting polycomb repressive complex 2 (PRC2) to the locus. Next, by using an in vitro transfer/dissociation assay, I found that, while USF is required for RNA Pol II association to the LCR and NF-E2 is essential to transfer RNA Pol II from the LCR to the beta-globin gene promoter, the sufficient transfer of RNA Pol II requires a specific USF binding site at the promoter. Together with the findings that NF-E2, USF and RNA Pol II form a complex in differentiated mouse erythroid cells and NF-E2 directly interacts with USF1, these data suggest that USF may stabilize the binding of NF-E2 at the beta-globin promoter to continuously bring RNA Pol II from the LCR to the gene promoter. Interestingly, I also observed that NF-E2 is required for the recruitment of the CTD serine 5-phosphorylated form of RNA Pol II to the beta-globin locus to initiate transcription. The fact that the serine 5-phosphorylated RNA Pol II is first recruited to the LCR but not the beta-globin gene promoter at early erythroid differentiation suggests that the LCR initiates the recruitment of a transcriptional competitive protein complex prior to the transcription of downstream beta-globin gene. In summary, in this thesis, I present evidence showing that the beta-globin gene is highly regulated by the cooperation of erythroid-specific and ubiquitously expressed transcription factors and their interaction with the proximal (beta-globin gene promoter) and distal (LCR) DNA regulatory elements.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Zhuo Zhou.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Bungert, Jorg.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041233:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041233/00001

Material Information

Title: Nf-E2 and Usf Cooperate to Regulate the Recruitment and Activity of RNA Polymerase II in the Beta-Globin Locus
Physical Description: 1 online resource (151 p.)
Language: english
Creator: Zhou, Zhuo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: 2, 5, beta, chromatin, e2, epigenetics, gene, globin, hemoglobin, histone, ii, modification, nf, phosphorylation, polymerase, regulation, rna, serine, transcription, usf
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The beta-globin gene locus has been extensively studied as a model system for understanding tissue- and developmental stage-specific expression and long-range regulation of genes. In humans, it consists of five beta-like globin genes that are expressed exclusively in erythroid cells during development that are under the regulation of a far upstream locus control region (LCR). The LCR contains several DNase I hypersensitive (HS) sites, each of which are 200-400bp in length and separated by 2-4 kbp of flanking DNA. The HS sites contain binding sites for a variety of erythroid-specific and ubiquitously expressed transcription factors, which contribute to the recruitment of multiple transcription regulatory proteins including RNA polymerase II (RNA Pol II) and histone modification enzymes to the LCR through protein-DNA and protein-protein interactions. By using an in vitro assay to differentiate mouse embryonic stem (ES) cells into erythroid lineage, we show that RNA Pol II is recruited to the LCR prior to the erythroid differentiation. In addition, we show that the helix-loop-helix proteins USF and TFII-I play antagonistic roles with USF as an activator and TFII-I as a repressor in beta-globin gene regulation. I further show that the repressor function of TFII-I is maintained by recruiting polycomb repressive complex 2 (PRC2) to the locus. Next, by using an in vitro transfer/dissociation assay, I found that, while USF is required for RNA Pol II association to the LCR and NF-E2 is essential to transfer RNA Pol II from the LCR to the beta-globin gene promoter, the sufficient transfer of RNA Pol II requires a specific USF binding site at the promoter. Together with the findings that NF-E2, USF and RNA Pol II form a complex in differentiated mouse erythroid cells and NF-E2 directly interacts with USF1, these data suggest that USF may stabilize the binding of NF-E2 at the beta-globin promoter to continuously bring RNA Pol II from the LCR to the gene promoter. Interestingly, I also observed that NF-E2 is required for the recruitment of the CTD serine 5-phosphorylated form of RNA Pol II to the beta-globin locus to initiate transcription. The fact that the serine 5-phosphorylated RNA Pol II is first recruited to the LCR but not the beta-globin gene promoter at early erythroid differentiation suggests that the LCR initiates the recruitment of a transcriptional competitive protein complex prior to the transcription of downstream beta-globin gene. In summary, in this thesis, I present evidence showing that the beta-globin gene is highly regulated by the cooperation of erythroid-specific and ubiquitously expressed transcription factors and their interaction with the proximal (beta-globin gene promoter) and distal (LCR) DNA regulatory elements.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Zhuo Zhou.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Bungert, Jorg.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041233:00001


This item has the following downloads:


Full Text

PAGE 1

1 NF E2 AND USF COOPERATE TO REGULATE THE RECRUITMENT AND ACTIVITY OF RNA POLYMERASE II IN THE BETA -GLOBIN LOCUS By ZHUO ZHOU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2 010 Zhuo Zhou

PAGE 3

3 To my parents, grandparents, family and friends who always believe in me.

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my mentor, Dr Jrg Bungert, for the wonderful experience of working in his lab for my Ph.D. training. Dr. Bungert is a role model of a great scientist. His wisdom, dedication and enthusiasm for science always inspire me. I am grateful that he has been supportive and patient with me and my research in the lab. I really appreciate his long time support, encouragement and patience for me. If there are any achievements I have in these years, I owe them all to Dr.Bungert. He made me from a person nave in science, to a Ph.D. who has the courage and knowledge to face the challenges in the future. I also thank all of my committee members, Drs. Michael Kilberg, Thomas Yang, Linda Bloom and Kenneth Berns, for their long time support and inspiration. I am really grateful that they would take time from their busy schedule, participate in all of my committee meetings and give me precious suggestions on my projects. Their insightful suggestions and questions have broadened my mind on science. I would also like to thank my previous commit tee member, Dr. Brian Burke. He helped me to develop great interest in the cell nucleus related researches and provided me precious advice on my research. Dr. Burke moved to Singapore with his family this September. I must thank the department chair, Dr. James Flanegan and all the administrative and secretarial staff in our department. They work very hard to make us live easy in this department. I really appreciate the advice from Dr. Flanegan on my first Biochemistry Journal Club presentation. I am also very thankful for all the assistance kindly provided to me over the years by Pat Jones, Elise Feagle, Regina Corns, Miriam Williams, Denise Mesa and Mr. Bradley Moore and Terry Rickey. I also thank all of the past and present members of the Bungert lab. I a m grateful that Drs. Karen Vieira, Padraic Levings, Valerie Crusselle -Davis provided me great help when I first

PAGE 5

5 joined the lab. I thank all the other members, Dr. Felicie Andersen, Dr. Boris Thurisch, Shermi Liang, I Ju Lin, Tihomir Dodev, Joeva Barrow, Mi chael Rosenberg, Babak Moghimi, Archana Anantharaman and Dorjan Pantic for their friendships and for all of the serious and fun conversations we had over the years. I wish them all the best with their school and research. I would like to thank Shermi Liang for helping with the orders and making sure things we ordered arrived on time. I would especially thank Joeva Barrow for her extreme patience to help me improving my English for the upcoming interviews. I hope all the current lab members keep having fun w orking in the lab. I would like to thank my parents, Wenxue Zhou and Haiyan Zhang, for their long time encouragement and support to lead me in every step of my life. I am grateful that even when they found out I chose to go to Peking University instead of the number 1 medical school in China as they had been expected since I was little, they still respected my decision and gave me all their blessing. I would also like to thank my maternal and parental grandparents, Jin Zhang, Dongshi Zhou and Shuxian Zhang. They taught me to be a good person. I also thank all of my family members, who not only encourage me to peruse a career in science, but also help me to take care of my parents so I can feel free to study in a country 8000 miles away from home. At last bu t not least, I would like to thank my friends Dr. Nan Su, Dr. Xiaolei Qiu, Dr. Houda Darwiche, Dr. Hong Li, Gang Liu, Tong Lin, Justin Bickford, Dr. Xingguo Li and Dr. Patrick Corsino. They made my life in graduate school much easier by selflessly offering me help at any time. I thank Cortney Bouldin for help me with my first cover letter for a post doctoral position application. I especially thank Justin Bickford for helping me editing my thesis within such a short time. Also, I would like to thank Stephen Langevin, Quan Yuan and Qiu Lin for being my great friends.

PAGE 6

6 I am grateful that I have met all of these people above. With all the guidance, support and help from them, I get to become me, today.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF FIGURES .............................................................................................................................. 9 ABSTRACT ........................................................................................................................................ 11 CHAPTER 1 INTRODUCTION ....................................................................................................................... 13 -globin Related Diseases .............................................................................. 13 Thalassemia .............................................................................. 13 -Globin Disorders ..................................................................................... 16 Globin Gene Locus .......................................................................................................... 20 Overview .............................................................................................................................. 20 The Locus Control Region (LCR) ...................................................................................... 21 -Globin Gene Promoter and 3 Enhancer ....................................................... 25 Hemoglobin Switching ............................................................................................................... 27 Gene Com petition ................................................................................................................ 28 Autonomous Silencing ........................................................................................................ 28 Switching Factors ................................................................................................................ 30 The LCR an Globin Gene Promoter Interaction Models .............................................. 33 Globin Gene ...................... 33 -Globin Gene Expression .... 35 RNA Polymerase II (RNA Pol II) ...................................................................................... 35 GATA -1 ................................................................................................................................ 37 NF E2 ................................................................................................................................... 39 EKLF .................................................................................................................................... 41 USF ....................................................................................................................................... 42 TFII -I .................................................................................................................................... 44 Components of Chromatin Remodeling Complexes ......................................................... 47 CTCF .................................................................................................................................... 47 The Role of the LCR in Nuclear Localization ........................................................................... 48 Summation ................................................................................................................................... 48 2 MATERIALS AND METHODS ............................................................................................... 52 Cell Culture and Protein Isolation .............................................................................................. 52 In vitro Embryonic Stem Cell Differentiation ........................................................................... 53 Western Blotting ......................................................................................................................... 54 Chromatin Immunoprecipitation (ChIP) .................................................................................... 54 Coimmunoprecipitation (CoIP) and GST Pull -Down Assay .................................................. 55 RNA Isolation, Reverse Transcription, and Real Time PCR ................................................... 56 In vitro Transfer/Dissociation Assay ......................................................................................... 57

PAGE 8

8 3 REGULATION OF GLOBIN GENE EXPRESSION BY CIS AND TRANS REGULATORS ........................................................................................................................... 59 Introduction ................................................................................................................................. 59 Results .......................................................................................................................................... 64 Discussion .................................................................................................................................... 70 4 NF E2 AND USF CO OPERATE TO REGULATE RNA POLYMERASE II IN THE GLOBIN GENE LOCUS ........................................................................................................... 83 Introduction ................................................................................................................................. 83 Results .......................................................................................................................................... 88 Discussion .................................................................................................................................... 97 5 CONCLUSIONS AND FUTURE DIRECTIONS .................................................................. 115 In vitro ES Cell Erythroid Differentiation ............................................................................... 115 Overview ............................................................................................................................ 115 The Antagonistic Role of USF and TFII Globin Gene Regulation...................... 116 Globin Locus by TFII -I ........ 117 The Cooperative Role of NF Globin Gene Regulation ............................. 118 In Vitro Transfer/Dissociation Assay ............................................................................... 118 Globin Gene Regulation .......................... 119 NF E2 p45 Knockout Mice vs. NF E2 p45 Null Murine Erythroid Cells ..................... 120 Globin Gene Expression .............................................. 122 LIST OF REFERENCES ................................................................................................................. 124 BIOGRAPH ICAL SKETCH ........................................................................................................... 151

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Schematic of the structure of the human and mouse -globin gene loci and hemoglob in synthesis during development .......................................................................... 51 3-1 Sequential activation of globin gene transcription during in vitro erythroid differentiation of murine embryonic stem cell s ................................................................... 76 3-2 -globin locus during in vitro murine embryonic stem (ES) cells erythroid differentiation ..................... 77 3-3 -globin gene locus in MEF and OP9 cells ........................................................................................................................ 78 3-4 Interaction of USF and TFII -globin gene locus during erythroid differentiation of murine embryonic stem cells ................................................................... 79 3-5 Interaction of Suz12 with TFII I in K562 cells .................................................................... 80 3-6 -globin gene promoter decreases with increased -globin gene expression during erythroid differentiatio n of mouse embryonic stem cells ......................................................................................................................................... 81 3-7 TFII I and Suz12 do not interact wit h the LCR HS3/2 flanking region ............................. 82 4-1 DMSO mediated increase in USF, NF -globin expr ession in MEL but not CB3 cells ........................................................................................................................ 103 4-2 Lack of NF E2 (p45) reduces the assembly of protein complexes at LCR HS2 and at the adult maj -globin gene promoter .................................................................................. 106 4-3 Efficient recruitment of Pol II and CTD serine 5 and serine 2 phosphorylation at the -g lobin gene locus requires NF E2 ................................................................................... 107 4-4 Interactions of USF1 and USF2 with NF E2 (p45) and Pol II during erythroid differentiation of MEL and C B3 cells ................................................................................ 109 4-5 USF and NF E2 regulate the recruitment and dissociation of RNA Pol II to and from immobilized LCR templates ............................................................................................... 111 4-6 Model of NF -E2 and USF mediated assembly and transfer of elongation competent transcription complexes in the -globin gene locus ........................................................... 112 4-7 Interaction of protein complexes with the LCR HS3/2 flanking region in MEL, CB3 and CB3/NF -E2 cells ........................................................................................................... 113

PAGE 10

10 4-8 Interaction of RNA Pol II with the LCR HS3/2 flanking region or the GAPDH 3 untranslated region (UTR) in MEL, CB3 and CB3/NF E2 cells ...................................... 114

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NF E2 AND USF COOPERATE TO REGULATE THE RECRUITMENT AND ACTIVITY OF -GLOBIN LOCUS By Zhuo Zhou M ay 2010 Chair: J rg Bungert Major: Biochemistry and Molecular Biology -globin gene locus has been extensively studied as a model system for understanding tissue and developmental stage -specific expression and long -range regulation of genes. In huma ns, it consists of five -like globin genes that are expressed exclusively in erythroid cells during development that are under the regulation of a far upstream locus control region (LCR). The LCR contains several DNase I hypersensitive (HS) sites, each of which are 200 400bp in length and separated by 2 4 kbp of flanking DNA. The HS sites contain binding sites for a variety of erythroid -specific and ubiquitously expressed transcription factors, which contribute to the recruitment of multiple transcription regulatory proteins including RNA polymerase II (RNA Pol II) and histone modification enzymes to the LCR through protein DNA and protein -protein interactions. By using an in vitro assay to differentiate mouse embryonic stem (ES) cells into erythroid lineage we show that RNA Pol II is recruited to the LCR prior to the erythroid differentiation. In addition, we show that the helixloop -helix proteins USF and TFII I play antagonistic roles with USF as an activator and TFII I as a repressor in -globin gene regulation. I further show that the repressor function of TFII I is maintained by recruiting polycomb repressive complex 2 (PRC2) to the locus.

PAGE 12

12 Next, by using an in vitro transfer/dissociation assay, I found that, while USF is required for RNA Pol II association to the LCR and NF -E2 is essential to transfer RNA Pol II from the LCR to the -globin gene promoter, the sufficient transfer of RNA Pol II requires a specific USF binding site at the promoter. Together with the findings that NF E2, USF and RNA Pol II form a complex in differentiated mouse erythroid cells and NF -E2 directly interacts with USF1, these data suggest that USF may stabilize the binding of NF E2 at the -globin promoter to continuously bring RNA Pol II from the LCR to t he gene promoter. Interestingly, I also observed that NF -E2 is required for the recruitment of the CTD serine 5phosphorylated form of RNA Pol II to the -globin locus to initiate transcription. The fact that the serine 5 phosphorylated RNA Pol II is fir st recruited to the LCR but not the -globin gene promoter at early erythroid differentiation suggests that the LCR initiates the recruitment of a transcriptional competitive protein complex prior to the transcription of downstream -globin gene. In summary, in this thesis, I present evidence showing that the -globin gene is highly regulated by the cooperation of erythroid-specific and ubiquitously expressed transcription factors and their interaction with the proximal ( -globin gene promoter) a nd distal (LCR) DNA regulatory elements.

PAGE 13

13 CHAPTER 1 INTRODUCTION -globin R elated D iseases Hemoglobin (1) (Hb), the iron -containing metalloprotein presenting in large quantities in erythrocytes, is the protein responsible for transport of oxygen and carbon dioxide throughout the body in mammals and birds. Functional hemoglobin n ormally exists as a tetramer, containing like -like 22). Each of the globin chains has an embedded ring -shaped heme group containing a central iron atom, which is responsible for reversible oxygen binding. Hemoglobin synthesis requires the coordinated production of the two types of globin chains (2) (Figure 1 -1B). -globin from the -globin locus pair s -globin from the globin locus during the first six weeks of gestation in prim itive erythroid cells that originate in the embryonic yolk sac to form the embryonic hemoglobin (Hbs, 22). After the first ten weeks of embryogenesis, the -globin chains remain unaltered, while the -globin chains undergo Hemoglobin Switc hing during development During fetal liver hematopoiesis, -globin from the globin gene locus pairs with one of -chains G and A -globin locus to form the fetal hemoglobin (HbF, 22). Later during adult bone marrow hematopoiesis, -globin pairs with the adult and -globin to form the adult hemoglobin (HbA, 22). The expression of -like globin genes is closely balanced by unknown mechanisms. Balanced globin gene expre ssion is required for normal red blood cell function. Sickle Cell Anemia and -Thalassemia Currently, ~ 7% of the worlds population are carriers for different inherited disorders of hemoglobin, making them the commonest human monogenic diseases (2). The worldwide birth rate of people with symptomatic globin disorders is no less than 2.4 per 1000 births (3). Because

PAGE 14

14 of the protective effects of the hemoglobin disorders against malaria (4), these -globin disorders occur mainly in people from tropical or sub -tropical regions where malaria is or was common, such as Africa, Me diterranean countries, and India, etc. (5). There are two main types of human beta globin disorders: hemoglobin structural variants, and t halassemias. There is a third type of disorders called hereditary persistence of fetal hemoglobin (HPFP), displaying heterogeneous defects in the normal switch from fetal to adult hemoglobin production, although it has no clinical importance by itself the co -inherita nce of some forms of HPFH can modify the phenotypes associated with the sickle cell disease or thalassemias. Hemoglobin structural vari ants are mainly due to single amino acid substitution s Currently, over 700 structural variants have been identified. Amo ng them, the most well know n example is the sickle cell anemia, which is commonly caused by the hemoglobin variant, HbS (6). In this variant, the hy drophilic amino acid glutamic acid at position 6 of the hemoglobin beta chain is replaced by the hydrophobic amino acid valine. This mutation creates a hydrophobic pocket on the outside of the hemoglobin structure, which attaches to the hydrophobic region of the adjacent hemoglobin beta -chain, thus caus ing aggregation of hemoglobin into rigid fibers and leading to deformation of red blood cells, which adopt a sickle like configuration when hemoglobin is deoxygenated. The decrease of the elasticity of the si ckle shaped red blood cells causes the blockage of the small blood vessels. This blockage causes severe pain and organ damage and eventually causes severe long term symptoms such as stroke or bone necrosis and sometimes sudden death. The hemoglobin HbS als o causes erythroid hyperplasia and accelerated red blood cell destruction (7).

PAGE 15

15 Thalassemias are caused by defective and imbalanced globin gene expression. Over 200 mutations -globin gene have thalassemia patients. Except for a few deletions, these patients normally globin gene -globin gene function at transcriptional, translational, or post translational levels (8). -globin chain production, the excessive unbound insolub le globin chains precipitate in mature red blood cells and erythroid precursors which lead to ineffective erythropoiesis and hemolysis (2,5,7,9) The red blood cells of thalassemi a patients are pale and in tear drop shape, and they dont have enough functional hemoglobin to deliver oxygen to the body tissues. thalassemias have diverse clinical phenotypes, which are divided into three thalassemia major (also known as Cooleys anemia) (10) in which the patients carry -globin mutations that lead to severe anemia resu lting in death in the first year without blood transfusions. Affected individuals show growth retardation and may have enlarged spleens, livers, and hearts, and severe bone deformities (11) due to the expansion of hematopoietic sites (bone marrow and spleen), which attempt to thalassemia major. The syndromes appear early in the childhood or later in life. T he patients have mild to moderate anemia, but they can survive without blood transfusions. Afflicted individuals may still have slow growth and bone deformities but can manage a normal life, with the assistance of thalassemia thalassemia trait) patients -globin alleles. These mutations result in mild or no anemia

PAGE 16

16 and reduced blood cell counts. The patients have an increase level in hemoglobin HbA2 22) and a corresponding decrease in hemoglobin HbA 22) (8). Globin D isorders Currently, the -globin disorders are blood transfusion s for thalassemia and supportive care (mainly medication) for sickle cell anemia patients. Blood transfusion is life -saving and meant to correct anemia and to suppress massive erythropoiesis (2,7,9) However, it is a life -long treatment, and will c ause iron overload in patients, which is lethal if untreated. Ferritin is the key iron storage protein in the body (12,13) When there is excessive iron in the body that exceeds the capacity and detoxification activity of ferritin, free iron starts to accumulate in the blood and tissues. The free iron can catalyze the formation of hydroxyl radicals (OH-), which are highly reactive compounds that attack lipids, proteins, and DNA (13,14) Hepatocytes and cardiac cells are damaged by iron overload, which eventually can be deadly (15,16) Thus, chelation therapy with iron-binding chelators is necessary t o remove excess iron from the body, in order to prevent death from iron mediated organ defects (17) Currently, the most widely used iron chelator is desferrio xamine (18) It preferentially binds to iron at a one -to -one ratio. D esferrioxamine significantly prolongs the life of blood transfusion thalassemia major. However, this drug can only be given parentally and it is expensive and requires a sophisticated medical device for administration (19) Therefore, the prevention and treatment of iron overload are the main challenges of blood transfusion therapy. -globin disorders but for most of the patients, it is hard to identify a human leu k ocyte antigen (HLA) matched bone marrow donor (20,21)

PAGE 17

17 -globin gene therapy, which is to transduce autologous hematopoietic stem cells (HSCs) wi th highly regulated or globin gene constructs, and then to introduce these HSCs back into the patients by autotransplantation. This treatment not only provides possible cures for patients who lack matched donors, but also avoids the graft versus -host diseases (22) The ultimate goal of globin gene transfer is to generate tightly regulated, highlevel, erythroid -specific and sustained transgene expression. Retroviral vectors were the first viral vectors used to efficiently transfer -globin gene to the mouse HSCs (23,24) Incorporat ing a minimal 1 kb fragment of -globin LCR including the core elements of HS2, 3 and 4 into a retrovirus based globin gene increased the expression levels in mouse erythroleukemia cells, but the positional variabili ty of expression was a problem in these studies (25) Also, incorporating larger LCR fragments into retroviral vectors is hard to achieve because the instability of retroviral vectors and frequent genomic rearrangements. Lentiviral vectors have globin gene to HSCs. The advantages of the lentiviral vectors are their ability to transduce nondividing cells and the r elatively stable virus genome (26) The former one is of great importance, because most of the human HSCs are nondividing. In 2000, May et al. (26) first used a lentiviral TNS9 vector to successf -globin gene. The TNS9 vector globin 3 enhancer element, as well as a 3.2 kb LCR fragment spanning HS2, 3 and 4. This TNS9 vector transduction system maintained high -level and erythroid -globin gene expression in mice for up to 40 weeks. The safe use of lentiviral vectors relies on developing robust packaging systems, incorporating tissu e-restricted promoters and enhancers,

PAGE 18

18 as well as including other regulatory elements such as insulators into the vectors, to abolish the negative effects of random insertions and inappropriate activation of nearby genes but at the same time promote tissue globin gene (27,28) -globin disorders in mice models by using lentiviral vectors based globin gene transfer techniques (26,2931) encourages the start of human clinical trials. A phase I trial has begun for sickle cell thalassemia patients by using a lentiglobin vector (lentiviral vector for globin gene therapy) to tran sduce the HSCs of the patients and then returning them back to the patients (32) -globin gene with a single amino acid change at ly and has been shown to have anti -sickling activity (29) There is no data on efficiency yet. In sickle cell an emia, the vector -globin chain has to compete against the -globin chain for the binding to -globin chains. Therefore, it is of great interest to -globin chain, which has a higher affinity for the globin chain than -globin chain, to treat sickle cell anemia. In fact, the HPFP patients have much less severe -globin gene disorders, presumably due to compensatory high level fetal -globin expression in adults (33) In the treatment of hemoglobinopathies, there are currently two mechanisms to induce fetal hemoglobin synthesis. The first mechanism is to indirectly -globin gene expression through manipulation of the kinetics of erythropoiesis by using cell -cycle S -stage specific cytotoxic drugs (1). The S -stage -specific drugs pre vent -globin gene silencing by accelerating the rate of erythroid differentiation and maturation. Among all of these drugs, hydroxyurea (3436) is used clinically to treat sickle cell anemia patients because it is administrated orally, well tolerated, and has low risk of carcinogenicity. Hydroxyurea treatment

PAGE 19

19 reduces the mortality of adults with severe sickle cell anemia and improves the well -being of the patients by boosting a 1520% increase in fetal hemoglobin production (37) However, the effects of this drug are transient, not all patients respond to this treatment, and there are also significant variations in the levels of f etal hemoglobin synthesis in the patients. In addition, since hydroxyurea is cytotoxic, it may affect the growth and development of fetus and neonates. The effects of hydroxyurea thalassemia patients are currently controversial. The second mechanism o f -globin gene induction is mediated by drugs that directly reactivate -globin gene expression by modulating the DNA demethylation and histone acetylation at regulatory elements of the -globin gene locus. 5 -Azacytidine (38,39) is a potent inducer of fetal -globin gene expression firstly. It demethylates DNA of the globin gene locus by inhibiting DNA methyltransferase activity, and als o induces rapid erythroid regeneration (39) However, due to its toxicity and potential carcinogenicity, it is limited to treat severe -thalassemia (40) But yrate (41) a four carbon fatty acid, is another inducer of fetal hemoglobin production in patients (42) It functions as an inhibitor of histone deacetylase (HDAC) (43) and ultimately weakens the binding of the histone tail regions to linker and nucleosomal DNA, thus allowing transcription factor access to DNA. However, its exact clinical effectiveness still needs to be determined. Currently, the therapies of reactivating fetal globi n disorders are still under investigation. There is a great need for alternative strategies for the treatment of hemoglobin disorders. Presently, the most promising curative method for globin disorders is to either express a normal globin gene or react ivate -globin gene in red blood cells. This can be achieved by transducing the HSCs or embryonic stem (ES) cells of patients with globin gene containing lentiviral vectors. Therefore, understanding the mechanisms of -globin gene regulation during

PAGE 20

20 develop ment is necessary for designing precisely regulated efficient globin gene transfer systems. -Globin Gene Locus Overview -globin genes are among the most studied families of tissue -specific and developmentally regulated genes. The -globin locus embedded within one of many olfactory receptor gene arrays on human chromosome 11p15.4 has been extensively studied over the years as a model system for the developmental and tissue specific regulation of gene expression, mol ecular mechanisms of enhancer -promoter interactions, properties of insulator, and as a target for gene therapy as a cure for various hemoglobinopathies (1). The human -globin genes are expressed exclusively in erythroid cells. Its gene cluster consists of five genes (5'-G 3 globin genes ) arranged in the same order in which they are expres sed during development (1) (Figure 1 1A). globin gene is expressed in the embryonic yolk sac during the early stages of embryonic development, up to about week 10 of gestation. The two -globin genes, are then expressed during fetal liver hematopoiesis. Finally, expression of and -globin genes be comes predominant after birth and into adulthood during bone marrow hematopoiesis The globin gene expression level is less than 5% of the globin gene, likely due to a mutation of its TATA -box. The mouse -globin gene cluster located on chromosome 7, has a very similar structure compared to the human -globin locus (5'h1 maj min 3 globin genes ) (Figure 1 1A). The -globin genes are expressed in the embryonic yolk sac and the two adult genes, after birth in the fetal liver and adult bone marrow When aligning globin loci from all of the known mammalian globin gene clusters, it seems that

PAGE 21

21 the fetal expression of the two globin genes in human coincides roughly with the duplication of the genes in primate evolution (44) The L ocus C ontrol R egion (LCR) High level d evelopmental -stage specific expression of the like globin genes is regulated by cis acting DNA elements located both proximal and far away from the genes. The naturally thalassemia revealed that the locus control region (LC R) is an -globin gene expression (45) These thalassemia patients lack -globin gene. However, they bare a 35 kb deletion upstream of HS1 known as the Hispanic deletion, which suggested that this region contained cis acting regulatory globin gene expression. The LCR is located at about 50kb upstream of the hum -globin gene and contains four erythroid specific DNaseI hypersensitive sites (HS14) and a further upstream site (HS5) that is ubiquitously and constitutively hypersensitive and may demarcate the functional boundary of the cluster. Each HS site has a core sequence, about 200400bp in length, and they are separated from each other by 2 4 kbp flanking DNA (44) In the human genome, there also exists globin gene (46) HS sites are often associated with enhancer function. The LCR HS sites consist of binding sites for multiple ubiquitously expressed or erythroid specific transcription factors such as GATA 1 (47,48) NF E2 (49) USF (50) EKLF (51) Tal 1 (50) Bach1 (52) etc.. The binding motifs shared by all five 5HS sites include GATA 1 and NF E2. Also, the LCR HS sites are known to associate with RNA Pol II (47,53) components of chromatin remodeling complexes and chromatin modification enzymes (such as CBP and components of SWI/SNF and NuRD complexes) (54) and components of the basal transcription machinery (suc h as TFIIB and TBP (55) ). These LCR associated transcription

PAGE 22

22 regulato -globin gene expression (56) -globin locus have shown that in the globin expression levels are low relative to those of the endogenous mouse globin genes (5759) However, when the LCR (containing HS1 HS5) is -globin gene, a ll resulting transgenic mice lines express the gene at a levels -globin gene (60) These results demonstrate that the LCR exerts strong domainopening activity and confers highlevel globin gene expression in a position -globin genes or the LCR were globin cluster demonstrated that g ene order is important for correct developmental expression and that the LCR functions in an orientation dependent manner (61,62) Minimal LCR DNA sequences that confer position inde globin gene in transgenic mice have been determined to contain HS1 HS4 (63) The inversion of the LCR reduces globin genes by more than 70%. The effects observed in this study might be due to human HS5s insulator function. Chromatin insulators are elements that can block enhancer action and/or act as barriers to the inappropriate spread of heterochromatin. They demarcate domains in which an enhancer and the gene it regulates are separated from other expression domains or heterochromatin. The inversion of LCR HS sites positions human HS5 globin gene expression. Such insulating activity, characterized by enhancer blocking and heterochromatin suppressing effects, has been cl -globin cluster for the homologous site (cHS4) (6466) However, in contrast to the chicken globin gene

PAGE 23

23 locus, HS5 does not demar c ate the transition from a DNase I sensitive to DNase I insensitive chromatin configuration. HS5 therefore does not function as a boundary element. The LCR HS sites have specific functions. The HS2 and HS3 are considered to be the most powe like globin gene expression and formation of HS sites at all the developmental stages (67) globin expression. Deletio n of HS3 from -globin expression at the embryonic -globin failed to express during the definitive erythropoiesis (68) Neither HS2 nor HS3 deletions affected normal globin gene s witching during development. The deletion effects of HS1 and HS4 were less severe. The LCR enhancer activity mainly resides within HS2, 3, and 4 (44,46,69) Although HS1 does not contribute to the LCR enhancer activity, deletion of -globin genes at their specific developmental stages (70) globin gene expression at all of the erythroid developmental stages (71) -globin gene expression during the definite erythropoiesis in fetal liver and adult blood (72) HS5 f unctions as an insulator as described above. Many studies addressed the contribution of individual HS sites to the LCR function. Although conflicting results exist, which are likely due to different experimental systems (57,73) all studies show that individual or combinations of HS fragments are never able to reach the level of activity of the intact LCR. Even though some experiments suggested interactions between specific LCR HS sites and globin genes (74) the current model suggests that the LCR acts as a holocomplex in which all HS sites interact with each other and that the LCR holocomplex contacts only one globin gene at a time during erythroid development. Deletion of

PAGE 24

24 the LCR from the mouse genome by homologous recombination causes a reduction in globin expression to 1 4% of that of the wild type, and there is a major effect on RNA Polyme rase II (RNA Pol II) serine 5 -globin gene, even though the LCR deletion only decreases the assembly of transcription preinitiation complex -globin gene by twofold (57,75) Deletion of the LCR d oes not have a major effect on general DNase I sensitivity across the locus or on the histone acetylation pattern at the globin genes (75) These studies indicate that the -globin LCR functions as a strong enhancer and that the domain -opening activity observed in transgenic studies is not critical for establishing acces sible chromatin in the endogenous mouse locus. In contrast, deletion of the LCR from a human chromosome situated in a mouse hybrid-MEL cell line abolishes -globin gene transcription and the promoter is hyperacetylated, consistent with the idea that the L CR recruits histone modifying complexes including histone acetylases, which are required to modify the distant promoter (73) It is not clear what underlies these different results between mice and human but they could indicate that the mouse and human loci are regulated differently. Although del etion of a single HS by homologous recombination in mice had only mild effects on globin gene expression, deletion of the full LCR caused phenotypes similar to human thalassemias and is lethal in utero (76) Recently, intergenic transcripts were detected globin gene locus (77) These eryt hroid -specific transcripts originate globin promoters with subsequent initiation just 3 of the genes and transcription appears to proceed in a unidirectional manner towards the genes (78) Intergenic transcripts a re found over the LCR at all developmental stages whereas those around the globin genes are generated in a developmental stage -specific manner (79) A good correlation has been observed between the intergenic transcription and the histone acetylation

PAGE 25

25 -globin gene locus during development. Although the significance of intergenic transcription is not known yet, it may play a role in keeping the chromatin conformation in an open configuration. It has been shown that when deleting an endogenous intergenic transcript -g lobin genes, both of the chromatin accessibility and the -globin gene is affected (79) Globin Gene Promoter and 3 Enhancer The promoter of the human -globin gene is composed of three major sites, a noncanonical TATA -box (CATAAA) located 25 30 bp upstream of the transcription start site (80) a CCAAT -box at around 76, and a CACC -box at approximately 93 (8184) Mutations within the TATA like box disrupt the assembly of the basal transcription machinery, especially the association of the TFIID complex (85) whereas mutations within the CACC -box disrupt the association of Sp1/EKLF, an erythroid specific transcription factor required for to globin switching (86) There are five transcription factors that have been reported to bind the globin CCAAT -box in vitro : GATA 1, NF Y (CP1), C/EBP C/EBP and C/EBP (8791) GATA 1 is an erythroid specific transcription factor required for erythroid cell maturation (92) NF -Y is a ubiquitous CCAAT -box binding complex (93) and C/EBP C/EBP and C/EBP belong to the CCAAT/enhancer -binding protein family of basic leucine zipper (bZip) factors. It has been shown that in reporter assays, C/EBP cooperates with EKLF, which binds to the CACC -box, to active adult -globin transcription, whereas C/EBP inhibit s the activator function of EKLF on the -globin transcription (91) Another important sequence contributing to high level -globin gene transcription is a pyrimidine rich initiator (Inr) element, which is located at the transcr iption start site (94) The Inr cis -element is able to bind to trans acting factors to accurately place the transcription start site for the transcript ion machinery (95,96) and in some TATA less promoters, the Inr can itself

PAGE 26

26 me diate the initiation of transcription (97,98) Lewis et al. have shown that the Inr element within the human globin gene interacts with the TFIID complex in vitro and that mutations in the Inr reduce the transcription efficiency (94,99) Several reports suggest that USF, TFII I and YY1 associate with the Inr and stimulate transcription (95,100,101) In addition, Inr can be recognized by RNA polymerase II to facilitate active transcription (102) Interestingly, both of USF and TFII I bind to the human -globin Inr (103) In addition to the Inr element, the -globin gene promoter contains several E -box motifs (CANNTG) downstream of the transcription start site (103) The E-box / Inr and +60 E -box elements are conserved across species. The E -box/Inr motif overlaps with the Inr element, and the +60 E -box motif is located 60 bp downstream of the transcription start site Mutations within the +60 E -box or the E -box/Inr elements led to similar levels of transcription reduction in vitro USF and TFII I bind to the E -box/Inr, whereas USF1 and USF2 associate with the +60 E -box (103) There is a MARE/AP 1 like element located 24 bp downstream of the transcription start site, which interacts with low affinity with transcription factor NF -E2 (104) Although mutations of this putative NF E2 binding site yielded no effect on the transcription of the -globin gene in vitro NF -E2 could also be re cruited to the -globin gene promoter by trans -acting factors which bind to the adjacent regions through protein -protein interactions. Moreover, the -globin gene downstream core element (DCE) is localized within +10 to +45. Mutations within the DCE decrea sed transcription from the globin promoter. It has been shown that the DCE is bound by components of the TFIID complex, TAF1/TAF(II)250, and their association is required for the proper function of the DCE (99)

PAGE 27

27 -g lobin 3enhancer is located at 550 800 bp 3 to the polyadenylation site of the -globin gene (1 05) Deletion of this fragment in transgenic mice caused a 10 -fold reduction in the expression of the -globin gene (106) -globin 3enhancer contai ns four regions, each of which binds to the erythroid specific transcription factor GATA 1 and at least one other nontissue specific factor (107) Donovan Peluso et al. (105) have shown that the -globin 3 enhancer activity is erythroid -specific but not developmental stage or gene -specific. Hemoglobin Switching The most intriguing and widely studied event occurring in the -globin gene locus is hemoglobin switching, which means that suppression of the -globin gene is associated with a complementary increase in expression of the adult -globin gene (108) Studying this process is indeed very meaningful for the therapy of sickle cell a nemia and thalassemia, because it has been shown that the fetal -globin can be reactivated in patients with a defective adult -globin chain and can functionally substitute for the dysfunctional -globin gene (109,110) Understanding the mechanism(s) of hemoglobin switching is expected to contribute to the development of new therapies for hemoglobinopathies. In the transgenic mice studies, in the absence of the LCR, and -globin are still expressed in a developmental stage -specific manner. This suggests that the regulation of hemoglobin switching is largely directed by gene proximal regulatory elements. Human -globin gene expression undergoes two switches from the embryonic -globin gene to the fetal -globin gene and from the fetal globin genes to and globin genes (111) In contrast to humans, the mouse has a single switch from the embryonic and h1globin genes to the adult maj and -min globin genes (112) Human transgenes in mice only undergo one globin switch, with human and globin genes expressed along with mouse

PAGE 28

28 embryonic and h1 -globin genes, and human and -globin genes expressed along with mouse adult maj and -min globin genes (113) There are two main mechanisms that control the hemoglobin switching, gene competition and autonomous gene silencing. Gene Competition Transgenic studies in mice provided evidence for a gene competition mechanism during to -globin gene switching (114,115) When or -globin genes alone are linked to the LCR, they both failed to display the proper developmental stage -specific expression patterns. -globin was constantly acti ve during all the stages of development, and surprisingly, in the embryonic stage, the expression level of -globin is as high as the -globin gene level in adults. The globin gene was also expressed in the embryonic as well as, albeit at lower levels, i n the fetal/adult stages. Interestingly, however, when the and globin genes were linked together (with upstream of the -globin gene) and placed downstream of the LCR, their developmental stage -specific expression was restored with the globin ge ne expressed strictly during the embryonic stage of erythropoiesis and the -globin gene expressed only at the adult stage. The above observations can be explained by the proposed model that and globin genes compete for interactions with the LCR (115) In the fetal stage of development, the LCR preferably interacts with the fetal -globin gene, resulting in silencing of the -globin gene. On the other hand, in the adult stage of development, the adult -globin gene favorably interacts with the LCR, which leads to suppression of fetal -globin gene expression. Autonomous Silencing Automatic silencing means that the canonical ge ne and adjacent sequences contain all the elements responsible for turning off gene expression during development. This concept was firstly developed based on the following transgenic mice studies. In transgenic mice carrying the

PAGE 29

29 -globin gene, the -globin gene is only abundantly expressed when it is linked to the LCR. However, the expression of -globin gene is restricted to the embryonic yolk sac (116) Studies have shown that there are sequences within both proximal and distal -globin gene promoter responsible for the -globin silencing process in adults (117,118) Indeed, the fact that mutation of GATA 1, YY1 or SP1 sites in the upstream region of the of the -globin gene promoter abolished globin gene silencing implies that th e globin gene silencing involved multiple transcription factors which possibly form a silencing complex (119) In addition, the and -globin promoters contain direct repeat sequences named DR1 box, which are located near the CAAT box. It has been reported that a factor identical to the orph an nuclear receptor COUP TF binds to these DR elements (120) Also, a high molecular weight complex, -globin promoter (121) Mutations of the DR -globin gene expression in adult mice. These observations indicate that DR -globin gene silencing (120,122) Currently, the assumed mechanism of autonomous silenci ng is that during definite erythropoiesis, the silencing complex formed on the -gene by inhibiting the -globin gene and the LCR. The mechanisms of controlli ng globin gene expression seem to involve both gene competition and autonomous silencing. On the one hand, in the YAC mice studies, when -globin gene, it was expressed in both of the embryonic and fetal stages, but silenced in the adult stage (123,124) However, when the 378 to 730 region of the -globin gene promoter was deleted, it was observed that the -globin gene was expressed in the adult stage (125) suggesting that the 378 to 730 region contains sequences responsible for the autonomous silencing of the -globin gene. Furthermore, the fact that a mutation in the

PAGE 30

30 GATA site within this 378 to 730 region resulted in hereditary persistence of fetal hemoglobin (HPFH) in human (126) reinforced the above statement. Moreover, findings in transgenic mice carrying galago/human -globin gene hybrid promoters suggest that the CACCC box of the globin ge ne promoter is required for -globin gene silencing (127) On the other hand, the persistent -globin expression in the adults of -thalassemia and HPFH patients is best explained by the lack of gene competition due to the deletion of the adult -globin gene. Taken together, it is suggested that expression of the adult -globin gene is mainly -globin gene is regulated by autonomous sile ncing; and the expression of the -globin gene is regulated by gene competition and autonomous silencing. Switching Factors Many transcription factors have been discovered to regulate the stage -specific expression of the and globin genes, by binding t o the promoter elements. One of the most well -studied of these factors is EKLF (erythroid krp pel like factor ) (86) an erythroid specific transcription factor, which behaves as an adult switching factor. It has higher binding affinity to the adult CACCC box than the slightly different fetal CACCC box, and preferentially activates the globin gene (12 8,129) EKLF is necessary for -globin gene expression and is expressed more abundantly in the adult stage of development compared to the embryonic stage (130) Furthermore, -CACCC box mutations cause thalassemia and EKLF knockout mice die at E14.5 from lethal -thalassemia (131) Interestingly, in EKLF knockout mice, the embryonic hematopoiesis is not s everely affected, but the anemia occurs following the embryonic/fetal to adult globin developmental switch. Two EKLF homologous proteins, FKLF (also known as KLF11) and FKLF -2 (also known as KLF13), have been identified as candidates for fetal switching f actors. FKLF mainly functions

PAGE 31

31 -globin gene promoter and FKLF 2 at the -globin gene promoter (132,133) FKLF and FKLF2 activate globin gene expression predominantly by interacting with the CACCC box. Over expressing FKLF in K562 cells increase d the expression of the endogenous and globin genes, indicating that FKLF functions as a transcriptional activator in vivo In luciferase reporter assays, only FKLF 2 can activate a variety of erythroid specific promoters containing the CACCC -box plus -globin gene promoter elements, including a binding site for GATA 1. However, the expression of FKLF 2 is not erythroid specific. Interestingly, despite the fact that ectopic expression of FKLF in the bone marrow of transgenic mice carrying a basally active globin gene cassette is capable of inducing -globin gene expression in adult mice (134) FKLF knockout mice appear phenotypically normal, with no apparent impact on lifespan, fertility, viability and development. Also, there is no effect on erythropoiesis in the FKLF knockout mice (135) After examining FKLF-/mice crossed with mice expressing human globin gene it was found that the FKLF -/-globin mice express the same levels of the -globin gene as the FKLF+/+ -globin mice, suggesting that F KLF is not required for -globin gene expression in mice (135) FKLF 2 knockout mice have an enlarged thymus and spleen due to the decreased T cell apoptosis, as FKLF 2 functions as a repressor of the anti apoptosis factor Bcl xL. However, there is no defect in hema topoiesis in FKLF 2 knockout mice (136) The roles of FKLF and FKLF2 in switching are not clear Another factor that may be involved in hemoglobin switching is stage selector protein (SSP), which binds to the stage selector element (SSE) of the globin gene promoter. In transgenic mice studies, mutations in SSE, located at 50 region of the -globin gene promoter, results in an increase in -globin gene expression only in the early stage of fetal development and a prolonged the period it takes to complete the switch, suggesting that SSE contributes to the

PAGE 32

32 competitive ability of the -globin ge ne promoter during early fetal liver hematopoiesis (137) SSP is a heterodimer, consisting of a ubiquitously expressed CAAT binding protein CP2 and an erythroid -specific protein NF E4 (138) Loss of NF E4 binding to the SSE of the -globin gene promoter resulted in a loss of globin gene transcription relatively to that of the -globin gene, indicating that NF E4 preferentially activates over the -globin gene promoter, which lacks an SSE (137) In addition, overexpression of NF -E4 in cord blood progenitors resulted in upregulation of human globin gene expression with a concomitantly reduction of -globin gene expression (138) CP2 knockout mice showed no defects in growth, development, behavior and fertility, and displayed normal hematopoiesis, probably due to the compensation of homologous proteins, such as LBP 1a (139) The NF E4 knockout mice have not been reported yet. COUP -TFII (140) may play a role in hemoglobin switching. It is a retinoic acid orphan receptor corresponding to the erythroid specific binding activity of NF -E3 (141,142) COUP TFII binds to a consensus site in the gl obin gene promoter that includes the -globin CAAT element and may function as a repressor of the -globin gene expression (120) The PYR complex is also a putative switching factor (143,144) It is composed of several factors exhibiting SWI/SNF activity to promote chromatin modifications and remodeling (145) PYR is restricted in expression to adult definitive erythroid cells, where it binds to a pyr imidine rich DNA element located between the and -globin genes (146) Deletion of the PYR binding sit e from a human -globin gene construct resulted in delayed and prolonged human to globin switching in transgenic mice. Thus, PYR possibly functions as an adult stage -specific factor to facilitate the switch by repressing and activating -globin gene expression. The transcription factor Ikaros is the DNA binding component of the PYR complex (147)

PAGE 33

33 The LCR and the -G lobin G ene P romoter I nteraction M odels Recent studies by using chromatin immunoprecipitation ( ChIP ) and relatively new techniques such as capturing chromosome conformation (3C ), fluo rescence in situ hybridization (FISH ) and RNA TRAP (tagging and recovery of associated proteins) have revealed that LCR HS1 HS4 (148) are in close physical proximity to the actively transcribed -globin genes in mouse erythroid cells. The 3C data d emonstrate that physical proximity between the LCR and the -globin promoter is established at a time during differentiation of erythroid cells when the gene is actively transcribed (149) Currently, there are three models for LCR mediated globin gene activation. (1)Tracking Model: activators and chromatin remodeling complexes are recruited to the LC R first, then migrate to the promoter by tracking along the DNA and activate transcription (150) ; (2)Looping/Linking Model: a distant LCR and promoter contact each other directly or in directly through protein/DNA interactions. This interaction is independent of intervening DNA between them and can occur in trans (151,152) ; (3) Facilitated Tracking Model: activators and chromatin remodeling complexes track along the DNA from the LCR to the promoter without losing conta ct with the enhancer during the whole process, and eventually establish a loop between enhancer and promoter (153) Considering the recent data, the looping and facilitated tracking models are the favorite models for LCR mediated regulation of the globin gene (149) while the tracking model may apply for -globin gene regulation. The Activ e Chromatin Hub Model for LCR R egulating the -G lobin G ene The 3C experiments support the current Chromatin Hub model for LCR mediated globin gene activation. The 3C results demonstrate that i n mouse erythroid progenitor cells that do not express the globin genes the distal HS sites (3 HS1 and 5HS 60/ 62, wh ich are located 60 and 62 kb from -globin gene ) and part of the LCR (HS4 -6 ) interact to form a poised

PAGE 34

34 chromatin hub (148) In differentiated erythroid cells that express the -globin gene the remaining LCR HS1 HS3 sites as well as the globin gene promoter participate in long range chromosomal interactions and contribute to the formation of the active chromatin hub (ACH). The globin genes switch their association with the ACH depending on their development specific transcription activity. The flanking 3 HS1 and 5HS 60/ 62 regions are not required for globin gene expression. I f the -globin promoter is deleted together with HS3 (but not HS2) (154) the ACH fails to form at the adult stage. This is accompanied by decreases in both histone acetylation and DNaseI sensitivity at the LCR and gene promoters. CTCF has been shown to be required for th e formation of the poised chromatin hub in the globin gene locus However, the low level of globin gene expression in erythroid progenitor cells is not affected. The consequence of deleting the 3HS1 site (a CTCF binding site) on globin locus configuration was analyzed in ES cells that differentiated in vitro into erythrocytes. The data demonstrated that even though the pre -existing loop between 3HS1 and upstream sites (HS 85, HS 60/ 62 and HS5) is disrupted, the LCR HS4/5 maintained identical stron g interactions with the maj globin gene compared to wild type cells (155) Furthermore, deletion of 3HS1 and did not perturb globin gene expression These data demonstrate that the poised chromatin configuration in the globin gene locus is not required for proper globin ge ne regulation. Perhaps, this configuration is important for preventing regulatory elements located in the globin gene locus to affect expression of nearby genes. The erythroid specific transcription factors GATA 1, Erythroid kr p pel -lik e factor (EKLF) and co activator FOG 1 (friend of GATA) are required for ACH formation and/or stabilization (156,157) EKLF and GATA I could stabilize th e loop by binding to the LCR HS sites and the globin gene promoters. Interestingly, deletion of the -globin promoter itself did not disrupt loop

PAGE 35

35 for mation, which indicates that other regions within the gene contribute to interactions in the ACH (154) To form the loop, histone modifications might be required ahead of loop formation, because a relatively flexible chromatin fiber may facilitate loop formation. In this respect, EKLF and GATA 1 could be crucial for directing histone modifications to specific regions in the globin gene locus. As mentio ned before, CTCF is required for loop formation in the eryt h roid progenitor cells, but is not required for LCR globin gene contacts established in differentiated erythroid cells. Proteins I nvolved in the R egulation and E xpression of -G lobin G ene Ex pression RNA Polymerase II (RNA Pol II) RNA Pol II is responsible for the pre -mRNA synthesis in eukaryocytes. During transcription, RNA Pol II also scans for the DNA damage, modifies chromatin and serves as a platform for several mRNA processing factors. RNA Pol II has a unique C terminal domain (CTD) which consists of 2552 tandem repeats of the consensus sequence Tyr Ser -Pro Thr -Ser Pro -Ser (Y1S2P3T4S5P6S7) depending on the organism (158) Factors recruited to the CTD include the Mediator complex, which regulates transcription initiation, histone methyltranferases, mRNA capping enzymes, and polyadenylation factors that modify the 3 end of mRNA (159,160) The serine residues (ser2, ser5, and ser7) of the CTD are phosphorylated and dephosphorylated during the transcription cycle and the CTD can be hyperphosphorylated during the transition from a promoter bound complex to an active elongation complex (161) At the beginning of transcription, the CTD unph osphorylated RNA Pol II (RNAP IIA) assembles into a preinitiation complex on the promoter with general transcription factors (GTFs) TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and TFIIH (162,163) The CTD of the RNA Pol II is phosphorylated

PAGE 36

36 (RNAP IIO) at the time of transcription initiation by the CTD kinase Cdk7/Kin28, a subunit of TFIIH (164) Phosphorylation occurs specifically at ser5, which is impo rtant a process called promoter clearance and recruits capping enzymes and the histone H3K4 specific methyltransferase Set1, (165,166) The transcription complex is then paused near the transcriptional start site for pre -mRNA capping. Then another CTD kinase, Cdk9, which is part of the elongation factor P TEFb mediates CTD Ser2 phosphorylation to allow transcription elongation (167) The histone H3K36 specific methyltransferase Set2 preferentially associates with the hyperphosphorylated RNA Pol II, especially with the Ser2 phosphorylated CTD (168170) At the end of the transcription cycle, a CTD specific phosphatase removes dephosphorylates the CTD (171,172) By converting RNAP IIO to RNAP IIA, it a llows RNAP IIA to reenter the transcription cycle. Previous studies from Leach et al. (53) and Johnson et al. (47) have shown that RNA Pol II is recruited to the LCR and to the -major promoter in a GATA 1 dependent manner. Erythroid specific transcription factor NF -E2 p45 subunit is required for the loading of RNA Pol II to the globin gene promoter, but not to the L CR (49) It has been proposed that GATA 1 recruits RNA P ol II to the LCR, and NF -E2 assists RNA P ol II relocalization to the -globin gene promoter (47) Sawado et a l. (75) also demonstrated that NF E2 is recruited equally globin promoters of LCR deleted and wild type ( WT ) murine alleles. Deleting the LCR reduces preinitiation complex (PIC) assembly twofold -globin gene promoter but remarkably decrease s RNA P ol II C terminal domain (CTD) Ser ine 5 phosphorylation and affect s transcription elongation. However, the promoter histone acetylation is not affected by the deletion of the LCR. These results suggest that during -globin gene activation, the LC Rindependent chromatin opening, NF -E2 binding and partial PIC assembly at

PAGE 37

37 th -globin gene promoter take place prior to the a ctive transcription of the -globin gene that is mediated by LCR -dependent regulation of RNA Pol II elongation. Thus the LCR appears to function downstream of certain activator recruitment and partial PIC a ssembly at the globin gene promoter However, the fact that inactive transcription complexes are recruited to the promoter could also indicate that the LCR is required for the recruitment of transcription competent transcription complexes to the globin gene locus. GATA-1 GATA 1, also known as NF E1 (Nuclear Factor -Erythroid 1 ) belongs to the GATA family of transcription factors. It binds to the DNA consensus sequence (A/T)GATA(A/G) by two characteristic GATA family specific C4 (Cys-X2 Cys -X17 Cys -X2 Cys) zinc -finger motifs (173177) GATA 1 is expressed in both primitive and definite erythroid cells (178,179) megakaryocytes (180,181) mast cells (180) eosinophils (182) and Sertoli cells of the testis (176,183) GATA 1 is essential for normal erythropoiesis. GATA 1 deficient mouse embryonic stem (ES) cells are unable to contribute to the mature red blood cells in chimeric mice (131) Further analysis showed that in these chimeric mice, GATA 1 null erythroid cells have an arrest at the proerythroblast stage (184) This arrest has been further confirmed by the in vitro differentiation of GATA 1 deficient ES cells (185) The arrested precursor cells die due to apoptosis (186) These findings are consistent with the fact that GATA 1 deficient embryos die between embryonic day 10.5 (E10.5) and E11.5, due to severe anemia (178) GATA 1 consists of three functional domains: the N terminal transactivation domain, the Nterminal zinc finger (N -figure), and the C terminal zinc finger (C -finger) (187) The C -finger is crucial for recognizing the GATA 1 consensus sequence and binding to DNA. The N -finger is responsible for stabilizing the GATA 1/DNA complex and interacting with cofactors. The interaction between GATA 1 and FOG 1 is mediated through the N -finger (188) but when

PAGE 38

38 GATA 1 interacts with EKLF (175,189) and GATA 1 itself (190) t he C -finger also participates in complex formation. GATA 1 is known to interact with a variety of proteins. One of them is the well known GATA 1 cofactor FOG 1 (friend of GATA), which is coexpressed with GATA 1 in erythroid and megakaryocytes (191) FOG 1 contains nine zinc fingers, which interact with the GATA 1 N-finger through its 6th zinc finger (188) FOG 1 is essential for GATA 1 function, since FOG 1 null mice exhibit a phe notype similar to the one found in GATA 1 knockout mice, but it also appears that FOG 1 has GATA 1 independent functions in megakaryopoiesis (192) Although FOG 1 shows no DNA -binding activity, it can either activate or repress GATA 1 mediated transcription based on the context of the promoter (191,193) Recent data suggest that in erythroid cells, FOG 1 is fir st induced by GATA 1 (194) then it functions together with GATA 1 to regulate the -globin gene locus. Another protein that interacts with GATA 1 is EKLF. This interaction is dependent on the prese nce of DNA, such as promoter (189) The CACCC-box motifs that EK LF recognizes are found in close proximity to the GATA motifs in several promoters and enhancers, including the LCR (175) This suggests that EKLF and GATA 1 may have cooperative functions. It has been shown that GATA 1 can associate with itself in vitro (195) GATA 1 dimerization may facilitate interactions between enhancers and promoters. It is reported that GATA 1 interacts with histone acetyltransferases CBP and p300 both in vitro and in vivo (196,197) Recruiting histone acetyltransferases to the nucleosome can induce an open chromatin configuration, therefore activating transcription. Since CBP and p300 interact with various transcription factors, they can have a bridge function to connect component s located at the enhancer and promoter elements (198) Moreover, CBP and p300 can acetylate GATA 1 to stimulate its transcriptional activity (197,199) GATA 1 can also be phosphorylated

PAGE 39

39 (200) and sumoylated (201) Phosphorylated GATA 1 is induced in K562 cells leading to an increase in DNA binding (202) The function of sumoylated GATA 1 is unknown. GATA 1 was first identified to associate with the -globin 3 enhancer (203) Now it is known that GATA 1 binds to multiple regulatory regions in -globin gene loci (187,204) The GATA 1 null G1E erythroid cell line, which is derived from GATA 1 null embryonic stem cells, expresses low levels of adult globin, whereas the embryonic -globin are undetectable (205) In G1E cells, the GATA 2 mRN A is expressed at higher levels compared to wild type cells. This suggests that GATA 2 may partially replace the function of GATA 1 in GATA 1 null cells, since GATA binding sites are essential for the expression of -globin LCR driven transgenes (206) GATA 1 is also critical for megakaryocytes development (207) G1/S cell cycle progression (208) and reprogramming of hematopoietic precursors (209,210) Cell cycle control is th e most important regulation during hematopoietic differentiation, because the precursors need to proliferate to achieve further hematopoietic maturation, but in order to make the terminal differentiation to occur, the cells must exit the cell -cycle (208) GATA 1 target genes also include erythropoietin (Epo) receptor (Ep oR) (211) and Epo signaling is known to be important for prolifer ation, differentiation and survival of erythroid progenitors (212) Furthermore, Bcl -XL, a gene encoding an anti apoptotic protein, is regulated by GATA 1 as well (213) NF -E2 Transcription factor NF E2 (Nuclear Factor Erythroid 2) is found almos t exclusively in hematopoietic progenitors, and in the erythroid/ megakaryocyte/mast cell trilineage, and is known to regulate globin gene expression by acting through locus control regions (LCRs) upstream of the -globin gene clusters (214) NF E2 also associates with the globin gene promoter (49) NF E2 belongs to the basic leucine zipper (bZip) family and exists as a

PAGE 40

40 heterodimer. It consists of a hematopoietic -specific subunit p45 and a more ubiquitously e xpressed small Maf protein (p18) (215,216) Both of these subunits belong to the AP 1 superfamily. The p45 subunit is a m ember of the cap and collar (cnc ) family (217) The cnc domain that includes the bZip region was also found in NF E2 related proteins such as Nrf1, Nrf2, Bach1 and Bach2. But the function of the cnc domain is unknown. The N -terminus of p45 contains the transactivation domain, which is critical for NF E2s transcription activator function (214) The p1 8 small Maf protein binds to NF E2 p45 through its bZip domain (215,216) The small Maf subunit p18 lacks the transactivation domain. Its dimerization with the p45 subunit to form the NF E2 heterodimer is required for NF E2 DNA binding activity. The DNA binding site of NF -E2 contains a core AP 1 motif, (T/C) G CTGA(G/C)TCA(T/C) (AP 1 motif is bold and italicized). A mutation at the second position of the NF E2 site (G ) was shown to abolish NF -E2 binding, but not AP 1 binding (216) NF E2 binding site -globin LCR HS2, HS3 and HS4 (214,218) These binding sequences are closely related to Maf recognition elements (MAREs). Mutations of NF -E2 binding sites in the LCR HS2, 3, and 4 reduces DNase I hypers ensitivity (218,219) HS2 harbors enhancer function to regulate high -level and p osition independent expression of a human globin gene in transgenic mice (ref). The tandem MARE s in -globin LCR is crucial for its enhancer activit y of -globin gene expression but is not required for position -independent activation (220,221) The presence of NF E2 binding sites in HS2 al one is insufficient for high level expression of a linked human -globin gene in transgenic mice and mouse erythroleukemia (MEL) cells (222) Deletion of HS2 from one allele of the -globin locus in mice has no significant effect on the timing and extent of the expression of all the -like globin genes on the

PAGE 41

41 mutated chromosome. However, when homozygous, the deletion of HS2 resulted in normal expression of mouse embryonic genes, but the adult globin mRNA reduced 30%. (223) (224) NF E2 binding sites play a role in chromatin remodeling and transcription activation of glob in genes. The N -terminus of NF E2 p45 contains an activation domain, which can interact with other molecules such as cAMP -response element -binding protein (CREB) -binding protein (CBP) (225) and TAFII130 (a component of the TFIID complex) (226) Some studies showed that h omodimers of small Maf proteins repress transcription (217) Mice deficient for NF E2 p45 die shortly after birth due to defects in the megakaryocyte lineage (227) but they have no obvious phenotype in erythropoiesis, which suggests that other bZip proteins can substitute for p45s function in the red cell lineage (228) However, erythroleuke mia cells lacking functi onal NF E2 p45 fail to produce globin genes (229) which show that NF E2 p45 is important in erythropoiesis. MafK knock out mice have no obvious phenotype, which may suggest that small Maf proteins have functional redundancy (230) EKLF EKLF ( erythroid kr ppel like factor ) functions as an adult switching factor by interacting with the CACCC -globin gene promoter (86) EKLF preferentially activates -globin gene due to a higher affinity for the CACCC box located in the promoter regions of the genes (128,129) I n the absence of EKLF, DNase I HS sites do not form in the globin promoter and in LCR HS2 and HS3 The globin switch is disrupted and characterized by the persistence of high -globin levels and severe reduction of -globin chains (131,231,232) EKLF functions at least in part by recruiting a SWI/SNF remodeling complex to the LCR and to -globin promoter (233)

PAGE 42

42 USF The evolutionary conserved ups tream stimulating factors (USF), USF 1 (43KDa) and USF 2 (44KDa), belong to the basic Helix -LoopHelix Leucine -Zipper ( b HLH LZ) transcription factor family (234) They are highly related at their C terminal DNA binding domain (70% identity) and can form homo or heterodimers to interact with high affinity with the E-box regulatory elements ( Ebox: CANNTG, in most cases, NN are CG or GC), which are abundant in the genome of eukaryotes. The basic region is involved in DNA interaction with the E -box elements, whereas the HLH and LZ domains are mainly involved in dimerization. The integrity of the LZ domain is important for high affinity and specific DNA binding (235) USF1 and USF2 only have very limited homologous regions in their N terminus, which includes the transactivation domain, one of them is the highly conserved USF specific region (USR), which locates upstream of the basic region, and has been shown to be essential for transcription acti vation (236238) although how it functions is unknown. The ubiquitously expressed USF transcri ption factors play important roles in a variet y of transcriptional processes. First, USF has been found to stimulate gene transcription by binding to their cognate E box motifs (239) Secondly, USF1 interacts with the general and cell -specific transcription factors, such as SP1, Pea3 and MTF1 to cooperate in gene regulation (240242) Thirdly, USF mediates the recruitment of chromatin remodeling enzymes to DNA such as histone acetyltransferase PCA F, histone 3 lysine 4 ( H3K4 )-specific metyltransferase SET7/92 (64) and histone 4 arginine 3 (H4R3) -specific methyltransferase PRMT1 (243) Moreover, USF has been found to regulate topoisomer ase III (hTOP3 ) gene expression (244) Finally, USF1 directly interacts with TATA -containing and TATA -less promoters. Components of the TATA dependent preinitiation complex, e.g. TFIID (TBP plus TBP associated factors, TAFs), directly

PAGE 43

43 interact with USF1 (245249) In TATA less promoters, USF1 has been found to bind to the pyrimidine -r ich initiator (Inr) element near the transcription start site (95,97,250) More interestingly, Ferre DAmare et al. (239) used hydrodynamic measurements on the USF/DNA complex and showed that USF can exist as a bivalent homotetramer. Sha et al. (235) have shown that the USF homotetramer could potentially associate with two DNA recognition sites to facilitate DNA looping. Therefore it is important to study the gene regulation mechanism of USF in the con text of the -globin gene locus. Although USF1 and USF2 are expressed ubiquitously in a variety of tissues (251253) it has been found that the ratio of USF homodimers and heterodimers is cell type specific (253,254) Even for the USF dimers that have similar DNA -binding properties, they may control different target genes, by interacting with different transcription factors through their distinct N ter minal domains (237,255) In addition, USF1 and USF2 knock out mice are viable and exhibit distinct phenotypes, which indicate that they are not completely redundant (256,257) USF1 null mice are viable and fertile, with only slight behavior abnormalities. USF1 deficient mice exhibit and increase in USF2 expression, which may functionally compensate for the loss of USF1. In contrast, USF2 null mice contain reduced levels of USF 1 and have an obvious growth defect: they were 2040% smaller at birth compared to their wild -type or heterozygous littermates and maintained a smaller size throughout postnatal development. Ho wever, USF1/USF2 double knockout mice die early during embry o ge nesis, suggesting that USF is essential for embryonic development (234) It was recently shown that chicken USF1/USF2 heterodimers bind a divergent E box element (CACGGG) in the 5 HS4 insulator sequence of the globin locus and recruit the methyltransferase SET7/9 and the his tone H3 acetyl transferase PCAF (64) It is thought that

PAGE 44

44 recruitment of these proteins establish a barrier function that prevents the spread of hete rochromatin into the -globin locus. TFII -I TFII I was originally discovered as a basal transcription factor that binds and functions through the initia tor (Inr) core promoter element in vitro (95) Later it was sho wn that TFII -I functions as a multifunctional transcription factor with the ability not only to stimulate transcription from TATA less and Inr -containing promoters (258) but also through binding to unrelated upstream element s (E-box) that are usually recognized by helix -loop -helix (HLH) family proteins such as USF Importantly, TFII -I has been shown to cooperate with USF to interact with both E -box and Inr elements (95) These observations indicate that TFII -I can function as a basal factor and as an activator thus it may establish communications between the basal transcription machinery assembled at the promoter and activators associated with the upstream regulatory sites (95) TFII I is phosphorylated at both serine and tyrosine residues. Tyrosine phosphorylatio n of TFII I is required for its transcriptional functions (259) TFI II is regulated by extracellular signals and translocates to the nucleus (260) TFII I is cleaved by thrombin at the amino acid 677 and divided into two domains: the 70 KDa N -terminal domain (p70) which carries the DNA binding activity, and the 43 KDa C terminal s eparable activation domain (261) The N terminal p70 mutant functions as a dominant negative mutant of the wild type TFII -I. The C terminal 280 amino acids, when fused to the DNA binding domain of GAL4, are unable to activate transcription from a promoter which contained five GAL4 binding sites upstream of a TATA -box. Therefore, the C -terminus of TFII I is only partially responsible for the activation function, and it requires certain regions from the Nterminus of TFII -I to achieve appropri ate transcription activation.

PAGE 45

45 The multi -functional properties of TFII I may rely on its unique primary amino acids structure. TFII -I is composed of six direct reiterated I repeats, R1 R6, with each of them consisting a putative HLH motif (262) The N terminal DNA binding domain contains R1 -R4, whereas the C terminal transactivation domain contains R5 -R6. The basic region which is necessary for DNA binding locates only within R2. Since each of the I repeats displays a potential HLH motif, which serves as protein interaction surfaces, it is possible that each of them mediates a distinct prote in -protein interaction. Multiple TFII I isoforms are generated by alternative splicing in human and mice (263265) Besides the well characterized 957 amino acids form of TFIII (referred to as there are three additional isoforms in human and perhaps one more in mice and they are 2041 bps longer than the isoform. All of these isoforms contain the six Irepeats, the basic region, the N terminal putative LZ motif, and the nuclear localization signal (297304 amino acids in the isoform). It has been shown that these isoforms form homoand heteromeric interactions, which facilitates nuclear localization (263) The expression pattern s of these isoforms in a variety of cell types and species indicates that their functions are nonredundant. TFII I is activated by various extracellular signals thus linking signal transduction to transcription (260) In the absence of extracellular signals, TFII I is phosphorylated at both serine/threonine and tyrosine residues. Tyrosine phosphory lation of TFII I is required for its transcriptional functions (259) TFII I is involved in stress response (266) B -cel l signaling (267) and other diverse processes. In endoplasmic reticulum (ER) stress conditions, induced by depletion of stored endoplasmic calcium, which leads to increased expression of glucose regulated protein (GRP) genes, it is shown that TFII I increasingly binds to an upstream element

PAGE 46

46 named the endoplasmic reticulum stress response element (ERSRE) at the promoters of GRP genes (266,268) TFII I also interacts with ATF6 and N two signal induced transcription activators (268) Both USF and TFII I can either activate or repress gene expression, depending on which factors they associate with. Although ectopicall y expressed TFII -I only exhibits moderate effects on Inr dependent transcription, over co-expression of TFII I and USF1 dramatically enhances the transcription activity of TFII I at the Inr (262) TFII -I and USF also co -localized at the AdMLP upstream E -box element (95) Also, it has been shown that TFII I and USF physically interact both on and off the DNA (262) These facts further support the notion that TFII I and USF function together to facilitate the c ommunication between upstream activators and the basal transcription complex at the core promoter. In the -globin gene locus it was known that USF functions at the human -globin promoter and at the LCR HS2 enhancer element (269) Hardison et al. (50) showed that mutation of a canonical E box in the LCR HS2 core region diminishes the enhancer activity in transient transfection assays. Both USF and TFII I can recruit transcription complexes to TATA -less promoters and stabilize the transcription complex at TATA -containing promoters. Leach et al. (53) showed that in human K562 cells, in which the adult -globin gene is silenced, TFII -I interacts with the Inr; while in MEL cells, which express the -globin gene, USF1 and USF2 bind to the +60 E box region of the globin promoter. CrusselleDavis et al. (269) showed that globin gene activator. A re duction in USF activity reduced -globin expression and led to a significant decrease in acetylated H3, RNA Pol II, and cofactor recruitment to the LCR and to the adult -globin gene. On the contrary, TFII I functions as a globin gene repressor possibly by recruiting co-globin gene.

PAGE 47

47 Components of Chromatin Remodeling Complexes Multiple components of chromatin remodeling complexes have been found at the -globin gene promoter and at the LCR. The SWI/SNF complex is recruited to the -globin promoter by EKLF transcription factor (233) Purification studies of the complexes binding to the pyrimidine rich sequence upstream of the -globin gene have revealed an Ikaros -containing SWI/SNF protein complex called PYR complex (145) Further purification of this PYR complex showed that Ikaros is also associated with the NuRD complex and recruits both SWI/SNF (nucleosome remodeling ATPase) and NuRD (nucleosome remodeling deacetylase) complexes to this same sequence (270) In addition, SWI/SNF and MeCP1 (histone deacetylase complex) complexes have been shown to bind LCR HS2 in vitro (54) Recent C hIP studies showed that two components of the MeCP1 complex, BRG1 and hnRNPC, associate with both LCR HS2 as well as with the G A -globin gene promoters. Another SWI2/SNF2 related DNA dependent ATPase, HLTF, is recruited to the 115 to 140 regi on of the globin promoter (271) Large 2Mda protein complexes that associate with the LCR and with the -globin promoter have recently been fractionated from K562 nuclei (54,271) It is tempting to speculate that several of these multi ple protein complexes pre -exist in vivo and that one role of the LCR is to act as an organizer or bridge to assemble giant protein complexes from pre -existing large multiple protein subcomplexes present at the LCR and the globin gene promoters. CTCF CTCF is a zinc finger containing DNA -binding protein, which binds to specific insulator elements. The enhancer blocking activities of chicken HS4 insulator depends on CTCF (66) CTCF also binds to a sequence located downstream of the -globin locus and to both 5and 3of -globin loci. These regions vary in i nsulator strength, and their function in vivo is unclear (272) CTCFs binding sites at 5HS5 and 3 HS1 in the -globin locus

PAGE 48

48 participate s in ACH formation at both early and late developmental stag es. However, as mentioned before deletion of these sites do not affect globin gene expression (155) The Role of the LCR in Nuclear Localization In the interphase nucleus, the individual chromosomes form discontinuous structures called c hromosome territories (CTs). Transcription occurs at the surface of CTs. The space between CTs is called interchromatin compartment (IC). CTs may represent the relatively more condensed domain of chromosomes, hosting inactive or inaccessible genes. Activel y transcribed genes are brought to the surface of CTs where they bec o me accessible to protein complexes located in the ICs. Transcription complexes are believed to be located in the ICs where they form transcription factories (273) The LCR might play a role in the organization of genes within nuclei. FISH analysis of the localization of the endogenous murine -globin locus from different mature stage fetal liver cells showed that the globin LCR is required for efficiently re locating the -globin locus away from the nuclear periphery into the nuclear interior (274) It was also shown that the LCR is required to position the -globin locus close to transcription factories containing Ser ine 5 hyperphosphorylated RNA Pol II. Interestingly, -globin transcription initiates at the n uclear periphery but transcription levels increase along with the globin locus moving toward the nuclear interior. These results suggest that the LCR plays an important role in moving the -globin locus to transcriptionally active RNA Pol II complexes. Summation -globin gene loci have been model systems for the study of eukaryotic gene regulation and chromatin structure for a long time. The t issue and developmental stage specific expression of the -like globin genes is regul ated by a locus

PAGE 49

49 control region (LCR), which is composed of several DNase I hypersensitive sites in erythroid cells. Previous studies have shown that the LCR interacts with many proteins involved in transcription, such as RNA Pol II TBP, NF -E2, USF, TFII I etc. (49,55,269) and the LCR is required for high level -globin gene expression (75) The trans acting factors also play an important role in -globin gene regulation. It has been shown that a variety of transcription factors and chromatin modification enzymes can be recruited to the -globin gene locus directly and indirectly during erythroid cell maturation (145,275277) T hus our laboratory has proposed the model that the LCR may function as a transcription organizing center which recruits transcription factor complexes and RNA Pol II, and regulate globin gene expression by transferring these activities to the globin gene promoters (55) It has been shown previously that the erythroid specific transcription factor, NF E2, is essential for the recruitment of RN A Pol II to the globin gene promoter but not the LCR. The absence of NF -E2 leads to a significant decrease or abolishment of globin gene expression (49,228) The ubiquitously expressed transcription factor USF has been shown to b e partially required for the association of RNA Pol II at both the LCR and the -globin gene promoter (53) Over -expression of a dominant negative form of USF leads to a decrease in -globin gene expression (269) Interestingly, both NF E2 and USF are bound to the LCR and t he globin gene promoter (49,269) and they also interact with multiple histone methy ltransferases (such as MLL2 (277) G9a (276) PRMT1 (243) etc.) which may help to open the condensed chromatin structure to facilitate -globin gene transcription. The goal of this study is to examine the mechanism(s) by which the LCR assembled elongation competent transcription complexes at the globin gene promoters. A particular focus

PAGE 50

50 will be the examination of the relationship between NF E2 an d USF in globin locus regulation. Finally, it has been reported that TFII I functions as an inhibitor of calcium entry into the cells (278) an additional focus of this work is to examine if calcium entry has effects on -globin gene regulation.

PAGE 51

51 Figure 1 1. Schematic of the struc ture of the human and mouse globin gene loci and hemoglobin synthesis during development. (A globin gene loci consist of five (human) or four (mouse) genes that are expressed during development. -globin genes -globin genes are expressed in fetal and adult erythroid cells (152) -globin gene is globin genes are expressed at the globin genes are expressed at the adult stage. All t he genes are regulated by a locus control region (LCR) located far upstream of the genes and composed of several erythroid-specific DNase I hypersensitive (HS) sites. (B) Developmental stage -specific sequential activation of human em bryonic, fetal and adul t globin genes ((B) is adapted from Weatherall et. al. (5)).

PAGE 52

52 CHAPTER 2 MATERIALS AND METHOD S Cell Culture and Protein Isolation MEL cells were grown in Dulbecco's Modified Eagle Medium (DMEM) (Cellgro) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin antibiotic mixture. CB3 and CB3/NF E2 (stable CB3 cell line expressing ectogenic NF -E2 p45) cells were obtained from Dr. Paul Ney (St. Judes Children Research Hospital) and grown in DMEM (Gibco, cat. # 11885) supplemented with 10% fetal bovine serum, 200mM L -glutamine, and 1% penicillin/streptomycin antibiotic mixture. For DMSO induced cells, 1x105 cells/ml MEL or CB3 cells were incubated with 1.5% DMSO for 72 hours. K562 cells were grown in RPMI 1640 medium (Cellgro) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin antibiotic mixture Mouse embryonic fibroblasts (MEFs) were grown in DMEM (Gibco) and supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin antibiotic mixture. OP9 cells were grown in OP9 media ( -MEM) (Gibco cat. # 11900024) supplemented with 20% fetal bovine serum and 2% penicillin/streptomycin antibiotic mixture). All cells were grown in 5% CO2 at 37C. Nuclear Extracts used in co -immunoprecipitation experiments were prepared as described by Leach et al (103) Whole Cell Extracts used in the in vitro dissociation assay were prepared as described by Bungert et al. (245) Whole cell extracts used in western blotting experiments were prepared by incubating PBS washed cells with RIPA buffer (50mM Tris HCl (PH 7.4), 100mM NaCl, 10mM EDTA, 0.25% Na Deoxycholate, 1% NP 40, 0.1% SDS, and protease inhibitors cocktail, Roch) at 4C, and spinning slowly on a rotating wheel for 20min. The cell lysate was centrifuged at 14,000rpm for 15min at 4 C and the cell debris was removed.

PAGE 53

53 The cDNA for NF -E2 (murine p45 tethered to human MafG) (103,275) and A -USF (a USF dominant -negative mutant, a gift from Dr. Charles Vinson, NIH) (238) were subcloned in to pET 28a(+) and pET 19b vector (Novagen), respectively, and the recombinant His tagged NF E2 and A-USF proteins were expressed in E.coli and purified by H is Band Purification Kit (Novage n) according to the manufacturers protocol. All protein concentrations were measured by the Bradford protein assay In vitro Embryonic Stem Cell Differentiation Mouse embryonic stem (ES) cells were in vitro differentiated into hematopoietic cells on OP9 stromal cell monolayer s as described by Kitajima et al (279) Briefly, ESD3 cells (ATCC, CRL1934) were maintained on a monolayer of mouse embryonic fibroblasts (M EFs) in ES media (DMEM (high glucose) (Gibco, 12430054), 15% fetal bovine serum, 0.1mM 2 mercaptoethanol, 1x MEM non -essential amino acids solution (Cellgro, 25 -025CI), 1x EmbryoMax ES cell qualified nucleosides (Chemicon, ES 008D) and 1% penicillin/str eptomycin antibiotic mixture. ). Immediately before differentiation assay, ES cells were passaged twice to minimize the presence of MEF cells in the culture and grown on gelatinized flasks in ES media supplemented with 103 Units/mL ESGRO (LIF) (Chemicon, ES G1106). L eukemia inhibitory factor (LIF ) was added to prevent ES cell differentiation. At Day 0, 1 2x105/mL ES cells were seeded onto a confluent monolayer of OP9 cells grown in 6 -well plates in OP9 media as described in the Cell Culture and Protein Isolation section. From Day 3, erythropoietin (Epo, 1 Unit/mL ) was added into the culture medium throughout the rest of the ES differentiation procedure to prevent erythroid progenitors from apoptosis. At Day 5, the differentiated ES cells were treated with trypsin and 1 2x105/mL cells were seeded onto a new confluent monolayer of OP9 cells grown in 6-well plates. OP9 cells tend to aggregate into cell clumps and precipitate onto the bottom of the cell suspensions. To

PAGE 54

54 remove the OP9 cells from ES/OP9 cell mix ture, the trypsinized cells were kept at room temperature for 1 2 min, and only the cells from the supernatant were collected for further seeding. The same procedure was performed for Day 8 cells. 1 2x105/mL differentiated ES cells were trypsinized and reseeded onto a new confluent monolayer of OP9 cells grown in 6 -well plate for further differentiation until Day 12. During the entire ES cell differentiation process, the medium was changed every two days. At Day 0, 5, 8 and 12, an aliquot of cells were coll ected for RNA extraction and ChIP analysis. The RT -PCR primers of murine actin, Rex 1, -globin genes were described previously (280) Western Blotting Western blotting experiments were performed as described by Leach et al (103) A total of 20% Ready gel (Bio-Rad). The proteins were visua lized by ECL Plus chemiluminescence (Amersham Pharmacia Biotech). The following antibodies were used: GAPDH (FL 335; sc 25778), NF E2 (C 19; sc 291), NF -E2 p18 (MafK) (C 16; sc 477), USF1 (C 20; sc 229), USF2 (C 20; sc 862), TFIIB (C 18; sc 225), CBP (A 22; sc 369), p300 (N 15; sc 584), goat anti -mouse IgG -horseradish peroxidase (sc 2005) (all purchased from Santa Cruz Biotechnology), goat anti rabbit IgG -horseradish peroxidase (Kirkegaard & Perry Laboratories) and anti rabbit IgG Trueblot (eBioscience). Th ese antibodies were used for all the western blotting and for the coimmunoprecipitation experiments. The concentration of the antibodies used followed the manufacturers guidelines. Chromatin Immunoprecipitation (ChIP) The ChIP assay was performed essentially as described by Leach et al with minor modifications (103) After preclearing the diluted cell lysate with Protein A -Sepharose beads (GE Healthcare)

PAGE 55

55 assays using mouse IgM antibodies, Dynabeads Rat anti -Mouse IgM ( 110.39D, a gift from Scott R. Jamison, Invitrogen) was used instead of Protein A -Sepharose beads. The antibodies used were the s ame as those described for the w estern blotting experiments with the additional use of the following antibodies: normal mouse IgM (Santa Cruz), rabbit IgG (Bethyl Laboratories), RNA polymerase II, clone CTD4H8 05 623 (Upstate); RNA polymerase II 8WG16 monoclonal antibody, RNA polymerase II H14 (Ser5P -Pol II) monoclonal antibody (Covance), and RNA polymerase II CTD repeat YSPTSPS (phospho S2) antibody (Abcam, ab5095) Samples were analyzed by qu antitative real Time PCR using M yiQ (Bio Rad). The promoter and HS2 primers for ChIP samples used were described by Crusselle Davis et al (269) GAPDH and the HS3/2 flanking region we re analyzed using primers described by Levings et al. (280) The ChIP primers for murine GAPDH 3 UTR are: US, 5 GGCTACAGCAACAGGGTGGTGGAC 3, and DS, 5 GTTGGGGGCCGAGTTGGGATAG 3. The P -values were determined by three independent experiments and calculated by using Microsoft Excel t -test function. A P<0.05 (in some cases P<0.1) is considered to be statistically significant. Co -immunoprecipitation (CoIP) and GST Pull -Down Assay For e ach CoIP experiment, 1mg nuclear extract from MEL or CB3 cells was used. The nuclear extracts were precleared by incubating with anti rabbit immunoglobulin G (IgG) beads iate antibody with the precleared cell nuclear extract for 2.5 hours on a spinning wheel at 4C. The protein complexes were captured by incubating the antibody containing cell nuclear extracts with anti rabbit IgG beads for 2 hours. Then the beads were col lected by brief ly spinning in a microcentriguge and washed three times with RIPA buffer. All the incubations were performed at 4C on a spinning wheel. The immunoprecipitated protein complexes were eluted with

PAGE 56

56 Laemmli buffer (Bio Rad) at 95C for 10min, th en loaded onto 4 20% Ready Gels (Bio-Rad), and analyzed by western blotting. The antibodies used for CoIP are the same as those used for western blotting experiments, except that Pol II (N 20) sc 899 (Santa Cruz Biotechnology) was used for the Co IP experi ments. Full length or truncated human USF1 (hUSF1) cDNA was inserted into pGEX 5X 1 vector (Promega) as described by Huang et al. (243) The USF1 N construct was generated by digesting the pGEX 5X -1-USF1 plasmid that contains the full length USF1 with BlpI and XhoI, to delete the 202310 amino acids of USF1. The USF1 LZ construct was generated by digesting the pGEX 5X -1-USF1 plasmid with NheI and SacI to remove the 262291 amino acid residues of USF1. GST and GST -hUSF1 fusion proteins were expressed in and purified from E.coli. Equal amounts of the proteins were coupled to glutathione sepharose 4 fast flow beads (GE Healthcare, 17513201) according to the manufacturers instruction. Equal a mounts of protein coupled beads were incubated with recombinant NF -E2 (55) -down binding b uffer (50mM Tris HCl PH8.0, 2mM EDTA, 150mM NaCl, 0.1% NP PMSF and protease inhibitors cocktail, Roch ) for 1 hour at 4C. The beads were washed 3 5 times with 1mL pull -down binding buffer (without BSA), collected by brief ly spinning in a microcentrifuge, boiled with Laemmli sample buffer (Bio Rad), and loaded onto 4 20% Ready gels (Bio -Rad), followed by western blotting assay with antibody against NF E2 (C 19) (Santa Cruz, sc 291). RNA Isolation, Reverse Transcription, and Re al -Time PCR RNA was isolated by using the guanidine thiocyanate method (281) and reverse transcribed by using iScript cDNA synthesis kit (Bio -Rad) according to the manufacturers protocol. Quantitativ e PCR (qPCR) was performed using MyiQ (Bio -Rad) and reactions were carried out using iQ SYBR green super mix (Bio Rad). Real Time PCR for ChIP samples and

PAGE 57

57 cDNAs was performed and analyzed as described by Crusselle Davis et al. (269) except that for cDNA samples, the PCR conditions described above were modified as follows: 95C for 5min, actin was used as endogenous control for RT qPCR. The qP CR primers used for amplifying the globin gene were the same as previously described by Levings et al. (280) The RT actin are: US, 5 GTGGGCCGCTCTAGGCACCA3, and DS, 5 TGGCCTTAGGGTGCAGGGGG -3. In vitro Transfer/Dissociation Assay The in vitro Pol II transfer/dissociation analysis was performed as described by Vieira et.al. (55) with minor modifications Briefly, a plasmid containing the wild type human -globin LCR was linearized and immobilized on streptavidin -coated magnetic beads as described by Leach et al. (53) 1.5 g of the immobilized LCR was incubated with 500 g of MEL whole cell extracts for 30min at 30C. 1 g of wild type (pRS ) (103) or mutant human -globin gene construct was added in experiments in which dissociation was assayed in the presence of DNA templates. The three -globin gene mutants, pRS INImut (INImut), pRS +60E boxmut b (+60E boxmut), and pRS MAREa (NF E2mut1), were described previously by Leach et al (103) The -globin gene construct lacking the promoter ( ) was generated by deleting a ~1.2 Kbp region at the 5 end of the gene. After incubating beads -LCR -protein complexes with -globin gene constructs f or 30 min at 30C, the tubes were placed on a magnetic device and the supernatant was collected from each tube, and subjected to western blotting analysis. In some experiments, 60ng of recombinant NF E2, A -USF, or BSA was added with or without the globin gene construct during the dissociation reaction. The dissociation assays were performed following completely random experimental design (i.e. all -globin gene constructs and recombinant proteins were added to a random selected tube that contain LCR/protein complex es ). The experiments were repeated at

PAGE 58

58 least three times and the results were reproducible. To quantitate the efficiency of the transfer of Pol II from the LCR to the -globin gene template I modified the above described procedures as follows. After incubating the LCR coupled streptavidin beads with MEL nuclear extracts and removing unbound material, each sample was equally divided in half. One half of each sample was boiled with Laemmli sample buffer (Bio Rad), loaded onto 4 20% Rea dy gel (Bio -Rad), and then analyzed by western blotting using an antibody against Pol II (clone CTD4H8, 05623, Upstate). The other half of each sample was subjected to an in vitro transfer assay as described previously (55) The supernatants, plus or minus the -globin template, were collected at the end of the assay and cross linked with 0.5% formaldehyde at room temperature for 10min. Then, 0.125M glycine was added to each sample, incubating at room temperature for 5min to stop the cross -linking reactions. All samples were dialyzed against ChIP dilution buffer, and then subjected to immunoprecipitation (IP) analysis using the CIP assay described previously with antibodies against Pol II (clone CTD4H8 05623, Upstate) and rabbit IgG (Bethyl Laboratories). Precipitation of the globin gene template was monitored by quantitative R eal -T ime PCR. The primers for human -globin gene are: US, 5' -ATTGCATCAGTGTGGAAGTC 3', and DS, 5' ATTGCCCTGAAAGAAAGAGATTAG 3'.

PAGE 59

59 CHAPTER 3 REGULATION OF GLOBIN GENE EXPRESSI ON BY CIS AND TRANS REGULATO RS Introduction -globin gene is located on chrom osome 11 like globin genes (5 3), which are expressed in erythroid cells in a tissue and developmental stage -specific manner (Figure 1 1A). globin gene is express ed in the embryonic yolk sac blood islands are express ed in the fetal liver; and and -globin gene s are expressed during adult bone marrow hematopoiesis (1) -globin gene locus is located on chromosome 7. It is homologous to the -globin gene locus and consists like globin genes (5 -globin genes are expressed at -globin genes are expressed pr edominantly after birth. The locus control region (LCR) located at about 50kb upstream of the human -globin gene functions as a powerful enhancer to regulate expression of the like globin genes during development. Transgenic mice studies have shown that and globin expression levels are low relative to those of the endogenous mouse globin genes (5759) However, when the LCR (containing HS1 HS5) is linked to the huma n -globin gene, all globin gene (60) In addition, the Hispanic thalassemia deletion (deletion of HS2 5 and ~20 kb upstream of this region ) leads to an alternation of the general DNase I sensitivity of the -globin locus (45) These results suggest that the LCR not only functions as an enhancer, but also carries chromatin domain opening activity. The LCR contains several DNaseI hypersensitive sites (HS), which provide multiple binding sites for a variety of transcription factors. Among all of the HS sites within the LCR, HS2 exhibit s the most powerful enhancer activity (67) LCR HS2 contains

PAGE 60

60 multiple DNA motifs to provide binding sites for a variety of transcription factors, including two tandem ly repeated NF -E2 binding sites, one GATA 1 binding site, one EKLF binding site, and two E box elements, which serve as binding sites for helix-loophelix proteins such a s Tal1, USF and TFII -I (49) LCR HS3 also has enhancer activity and one study has shown that is preferentially activ ates and -globin gene expression (68) There is also one NF -E2 binding site and a tandem GATA 1 binding site in LCR HS3. Mutations within these NF E2 and/or GATA 1 binding sites in either H S2 or HS3 all lead to a decrease in downstream globin gene expression and loss of or reduced DNase I hypersensitivity (219) The ubiquitously expressed upstream stimulating factor (USF) has been shown to function as an activator for adult -globin gene expression in mouse erythroleukemia cell lines (269) USF belongs to the basic -helix loop -he lix leucine zipper (bHLH LZ) family, which interacts with the E-box elements with high affinity (234) USF has two homologous family members USF1 and USF2. These proteins have very similar C termini, which contain the basic region, the helix loop -helix, and the leucine zipper domain, and serve as a prote in -protein and protein DNA interaction domain. The N-terminus of USF1 and USF2 contains the transactivation domain and is less conserved between these proteins. Considering that USF1 and USF2 can interact with E boxes as heteroand homo-dimers, the dif ference in their N termini may provide unique regulatory functions. In the -globin locus, it has been shown that USF1 and USF2 interact with the +60 E -box element of the human -globin gene promoter at the adult stage, whereas USF2 together with TFII I interact with the initiator (Inr)/ E -box element of the -globin gene promoter at the embryonic stage (103) In addition, when overexpressing a dominant -negative form of USF (named A -USF) in MEL cells to sequester USF from binding to the DNA, the adult maj globin gene expression level decreased. Compl e mentarily, when overexpressing an ectopic USF1

PAGE 61

61 in MEL cell s, there was a dramatic increase in the maj globin gene expression (269) Moreover, USF1 interacts with histone acetyltransferase (HAT) p300 in MEL cells which express adult globin gene, but not in human K562 cells which express the -globin genes (282) These observations suggest that USF functions as an activator for adult -globin gene expression. Another helix-loophelix protein, TFII I, is also involved in the regulation of -globin gene expression. TFII I is a basal transcription factor that cooperates with USF to bind to the initiator (Inr) /E -box elements (103) Both K562 (embryonic stage erythroid cells) and MEL (adult stage erythroid cells) cells transfected with dominant -negative TFII I show increased levels of globin expression. Ectopically expressing TF III in MEL cells leads to a decrease in -globin gene expression. Interestingly, in K562 cells, USF1 mainly interacts with TFII I, but not with its homologous family member USF2; while in MEL cells, USF1 primarily interacts with USF2, which is accompanied by decreased interactions between USF1 and TFII -I (269) Together with the observation that TFII I interacts with the Inr/E -box motif at the globin gene promoter in embryonic stage K562 cells (103) a ll of the facts described above impl y that TFII I functions as an inhibitor for adult -globin gene expression. TFII I has several isoforms, but currently, their exact functions are still unknown. The association of RNA polymerase II (RNA Pol II) at the promoter of a gene is an essential marker of gene transcription. It has been shown that RNA Pol II associates with specific enhancer elements prior to transcription of the genes that the enhancer regulate s (280) The enhancer recruited RNA Pol II may be transferred to the gene promoter It has been shown th at the transcription pre -initiation complex (PIC) is required for recruiting RNA Pol II to the gene promoter (162,163) The PIC component TFI IB helps the correct positioning of RNA Pol II at

PAGE 62

62 the gene promoter, and TFIID interacts with RNA Pol II C terminal domain (CTD) to stabilize it on the gene (283) In the -globin gene locus, it has been shown that RNA Pol II is recruited to the LCR HS sites in vitro and in vivo (53,78,284,285) as well as to the promoters of the globin genes. Histone modifications serve as marks for accessible or condensed chromatin. Generally, ace tylated histones indicate an open chromatin environment. Histone acetyltransferases (HATs) add acetyl groups to histone tails, rendering the chromatin more accessible. On the contrary, a histone deacetylase (HDAC) can remove acetyl groups from histone tails, rendering the chromatin less accessible (286) The methylated histone residues, such as H3K9, K27, and H4K20 are normal ly associated with heterochromatin, which leads to transcription repression; while the methylated residues H3K4, K36, and K79 have been shown to associate with euchromatin, which correlates with transcription activation (287) It has been found that TFII -I interacts with HDAC3, a histone deacetylase, at the adult -globin gene promoter in K562 cells where the -globin gene is repressed (269) ; while USF1 interacts with p300, a histone acetyltransferase, at the adult -globin gene promoter in MEL cells (282) w here the globin gene is actively transcribed. Embryonic stem (ES) cells are derived from the inner cell mass (ICM) of day 5 8 blastocysts (288,289) or morula -stage embryos (290) ES cells are pluripotent cells that are capable of differentiating into cells of all lineages. ES cells are able to mai ntain a karyotypically stable prolonged self renewal status and have the potential to be differentiated into cells of the three germ layers, both in vitro and in vivo (288,289,291) The in vitro differentia tion capacity of the ES cells is limited, however, they can be induced in vitro to differentiate into hematopoietic cell lineages, and represent a powerful tool for investigating hematopoietic differentiation and

PAGE 63

63 development (279) Numerous studies have attempted to understand the mechanisms of ES cell unique properties, however, except for the identification of the pluripotency-associated transcription factors OCT4, NANOG and SOX2 as markers for ES cells (292) not much is known about the mechanisms regulating pluripotency. Recent studies indicate that epigenetic regulatory mechanisms may regulate the self renewal, pluripotency, and lineage-specific differentiation of ES cells (293) The genome of ES cells is mostly in an open an d accessible chromatin configuration, but upon ES cell differentiation, a more compact heterochromatic structure forms in these cells (294) Polycomb Group (PcG) proteins act as repressors of transcription. They were firstly purified from Drosophila embryos and found to be required for ma intaining the inactive state of homeotic and other important regulators during development (295) There are two polycomb repressor complexes, PRC1 and PRC2. The mammalian PRC2 complex contains EZH2, EED and Suz12 (296) The EZH2 protein is a h istone methyltransferase (HMTs) that adds methyl groups to lysine 27 of histone 3 (H3K27) and to a much lesser extent to H3K9 (296298) It has been shown that EE D is required for EZH2 mediated H3K27 methylation (299) and Suz12 is associated with developmentally important transcription factors, H3K27 trimethylation (H3K27me3) and gene repression (300) The methylated H3K27 serves as a docking site for PRC1 (301) Therefore, a current model for PcG mediated gene silencing proposes that the PRC2 complex first adds H3K27 methylation, then the methylated H3K27 mark interacts with the PRC1 complex and recruits it to the g ene locus, and finally the PRC1 complex further stabilizes the repressive chromatin structure by catalyzing monoubiquitin ylation of histone H 2A at lysine 119 (H2Aub1) and thereby impeding RNA Pol II elongation (302) (303) H3K27me3 has been found at the promoters of silent -lineage associated genes in mouse ES cells (304)

PAGE 64

64 By using an in vitro embryonic stem (ES) cell differentiation system I have sho wn that during differentiation along the erythroid lineage, RNA Pol II is recruited to the -globin gene LCR prior to its association with the downstream globin gene promoters. Also, along with ES cell differentiation into the erythroid lineage, the association of USF1 and USF2 to the LCR and -globin gene promoter increased, whereas the association of TFII I to these regions decreased when the erythroid lineage cells were transitioning to the adult stage. It is further shown here that TFII I interacts with Suz12, a component of the PRC2 complex. The data support the hypothesis that the LCR serves as the primary site of transcription complex recruitment in the globin gene locus. The data further suggest that TFII I contributes to the formation of an inacce ssible chromatin structure around the -globin gene promoter in undifferentiated and perhaps embryonic cells. Results Our laboratory ha s established a system by which mouse e mbryonic stem cells differentiate into globin gene expressing erythroid cells. The protocol was originally developed in the laboratory of Dr. Nakano and is based on the growth of mouse ES cells on a confluent layer of OP9 stromal cells in the presence of erythrop oietin (Epo) (279) Stromal cell lines can support the proliferation and differentiation of hematopoietic cells. The OP9 cells used here lack expression of macrophage colony-stimulating factor (M CSF) (305) thus avoiding macrophage proliferation and allowing efficient production of erythroid cells. L eukemia inhibitory factor (LIF) is required to maintain the undifferentiated state and pluripotency of ES cells. LIF is a member of interleukin 6 (IL 6) family of cytokines, and is known to bind its transmembrane receptor, LIFR, which heterodimerizes with the signal transduction receptor, gp130. The pluripotency of ES cells depends on the intracellular signal transduction pathway activated by the binding of LIF to its receptor, including the phosphorylation by the Janus family of tyrosine

PAGE 65

65 kinase (JAKs) (306) M ouse embryonic fibroblasts (MEFs) secrete LIF, IL -6 and other factors known to maintain ES cell pluripotency. Erythropoietin (Epo) is a major growth factor for erythroid cells. Epo interacts with its receptor EpoR, a cell surface receptor ex pressed in erythroid, megakaryocytic, and mast cells, activating signal cascades responsible for cell proliferation, differentiation and survival of erythroid progenitors (212) The ES cells were induced to differentiate along the erythroid lineage in the presence of E po as described in the Material and Methods section. At defined time points the cells were subjected to gene expression analysis using RT PCR, and to protein -chromatin interaction analysis using ChIP assays. It is shown that undifferentiated ES cells express neither n globin genes, while they do expres s the Rex 1 gene, a marker for early development (Figure 3 1). When induced to differentiate, the and globin genes are sequentially activated in a developmental manner such that the globin gene is expressed as early as Day 5 o f induction, whereas there is no or low level of -globin gene expression detectible at that time point. The -globin is expressed at a higher level at Day 8 and becomes predominant at Day 12, coinciding with a gradually decreased expression level of the -globin gene at these later stages of differentiation. The expression levels of the Rex 1 gene, relative to that of the actin gene, at Day 12 is reduced compared to Day 5 and Day 8. The fact that expression of the Rex1 gene is still detectible at Day 12 is probably due to unsynchronized ES cell differentiation, where a little portion of the cells are still in an undifferentiated stage even at Day 12, or that there is a fraction of differentiated cells that fail to silence the Rex 1 gene in vitro Overall, the RT -PCR data show that the ES/OP9 in vitro differentiation system used in this study is a powerful tool for analyzing gene regulation during erythroid differentiation.

PAGE 66

66 Next we examined the interactions of RNA Pol II, general transcription factors and histone modifications with the -globin gene locus during erythroid lineage-specific ES cell differentiation ( Figure 3 -2 ). Since it has been shown that HS2 and HS3 carry most of the enhancer activity of the LCR, we examined the association of the transcription regulatory proteins with LCR HS2 and HS3. We found that histone modifications that mark permissive chromatin such as dimethylated H3K4 (H3K4me2) and acetylated histone H4 (AcH 4) are already present at the LCR HS2 and HS3 core element regions in the undifferentiated cells (Day and globin genes. During differentiation, these histone marks are detected at both of the promoters of and globin concurring with the expression of these globin genes (Day 5 and Day 8). The observation that AcH4 but not as much H3K4me2 is detected at the -globin gene promoter at Day 5 of differentiation w hen the gene is silenced or expressed at very low level, suggests that the chromatin structure surrounding the -globin gene at this time point is already poised for activation. The above described histone modifications at the LCR at all differentiation stages are limited to the HS sites (HS2 and HS3) and are not found in regions located between the HS sites, such as the region between the HS2 and HS3 core elements (HS3/2 flank). This is consistent with observations from chromosome conformation capture ( 3C) experiments indicating that the LCR HS sites interact with each other during erythroid maturation (149) Consistent with the distribution of the transcriptionally active chromatin marks, RNA Pol II and general transcription factor TBP firstly interact with the LCR HS2 and HS3 but not with and globin gene promoters in the undifferentiated ES cells. During differentiation, the ass -globin gene promoter but not

PAGE 67

67 at the adult -globin gene promoter at Day 5. RNA Pol II and TBP are both detected at the and -globin genes at Day 12, coinciding with the expression pattern of these globin genes. At every stage of differentiation there is a small fraction of OP9 and MEF cells present in the culture taken for RT -PCR or ChIP analysis. Thus, I performed ChIP assays on MEF and OP9 cells to examine the associa tion of RNA Pol II and active histone marks with the globin gene locus ( Figure 3 -3 ). We observed that in both of the MEF and OP9 cells there is no RNA Pol II and globin gene promoters. As a positive control, I detected the interaction of RNA Pol II with the promoter of a housekeeping gene, glyceraldehyde 3 phosphate dehydrogenase (GAPDH) in these cells. Also, I used the human necdin gene, which is exclusively expressed in brain, as the negative control, and the data show that there is no RNA Pol II associated with the necdin gene promoter. However, I do detect low levels of the association of H3K4me2 throughout the -globin locus in MEF and OP9 cells. Considering the significantly low number (less than 10%) of MEF and OP9 cells present in the undifferentiated or differentiated ES cell cultures, I believe that the H3K4me2 levels detected at the -globin locus are mainly contributed by the ES cells. Previous studies have shown that the helix -loop -helix transcription factors USF and TFII -I antagonistically regulate -globin gene expression in K562 and MEL cells, indicating that USF functions as an activator whereas TFII I functions as an inhibitor for adult -globin gene expression (269) Here, by using the ES/OP9 in vitro dif ferentiation system to differentiate ES cells up to Day 8, I examined the interactions of USF and TFII I with the -globin LCR HS2 and the maj -globin gene promoter throughout differentiation ( Figure 3 -4). I analyzed H3K4me2 levels as a positive control for the ChIP assays. I observed that this histone modification which

PAGE 68

68 marks transcription competent chromatin is detectable at the LCR HS2 at all differentiation stages. The H3K4me2 association with the maj -globin gene promoter is at relatively low levels compared to that of LCR HS2 in the undifferentiated and early differentiated (Day 0 and Day 5) cells. But upon activation of the adult maj -globin gene at Day 8, the H3K4me2 mark is present at the maj -globin gene promoter at high levels. At Day 5, -globin gene is transcribed, USF1 only associates with the LCR HS2 but not with the adult maj -globin gene promoter. At Day 8, when the adult maj -globin gene is activated, USF1 associates with the LCR HS2 and with the maj -globin gene promoter. Interestingly, USF2 interacts with the LCR and the maj -globin gene promoter throughout differentiation, suggesting that USF1 and USF2 exert different functions during erythroid differentiation. Also, I observed that TFII I only interacts with LCR HS2 and the maj but not the adult maj -globin gene is expressed. I w as not able to detect interactions between TFII I and the globin locus at Day 0 or Day 8 cells, suggesting that TFII I may be involved in preventing premature -globin gene expression. The data support the hypothe s is that USF is an activator for adult -globin gene expression, while TFII I is a repressor. Also, consistent with the re sults from previous in vitro binding assays (103) here I show that USF and TFII I bind to the LCR and adult globin gene promoter in the context of intact cells. By using affinity chromatography, it has been shown that the PRC2 complex associates with histone deacetyltransferases (HDAC) (296) Our lab previously showed that TFII I and HDAC3 colocalize at the adult -globin gene promoter in K562 cells, which represent embryonic like erythroid cells (269) The protein interaction between TFII I and HDAC3 was further confirmed by co -immunoprecipitation (CoIP) assays and this interaction only occur red in K562 cells, but not in MEL cells which express the adult -globin gene upon dimethyl sulfoxide

PAGE 69

69 (DMSO) induction. To extend these studies I wished to examine interac tions between TFII I and components of the PRC2 complex. Thus, I performed CoIP assays by using whole cell extracts from K562 cells to and examined interactions between TFII I and Suz12, a component of PRC2 (Figure 3 -5 ). Indeed, when using antibodies against Suz12 to pull down its associated protein complex in K562 whole cell extracts, I did detect TFII I in the immunoprecipate. I also used an unspecific antibody against IgG as a negative control and showed that th ere was no interaction between IgG and TFII -I. Since the PRC2 complex acts as a repressor of gene transcription by methylating lysine 27 at histone 3 (H3K27) (296298) and previous data fro m our lab oratory show that TFII -I functions as a repressor of adult -globin gene expression, I therefore examined the interactions of TFII I, Suz12 and trimethylated H3K27 (H3K27me3) with the adult -globin gene promoter during in vitro differentiation of erythroid cells (Figure 3 -6). I found that after induction of erythroid differentiation, low levels of the adult maj globin gene was expressed in Day 5 cells. After 12 days of differentiation, there was more than a ~30 fold increase in the expression levels of the adult maj -globin gene compared to Day 5 cells (Figure 36A, B). I observed that TFII -I, Suz12, and the repressive histone modification mark H3K27me3 are associated with the adult maj -globin gene promoter in Day 5 cells but not in Day 12 cells (Figure 3 -6C). By performing quantitative Real Time PCR, I further show that the decreased association of Suz 12 with maj globin gene promoter from Day 5 to Day 12 is significant (Figure 3 6D). In addition, as a positive control, I found that the H3K4me2 levels associated with LCR HS2 at Day 5 and Day 12 did not change. I observed that there was no TFII I or Suz12 association with the negative control HS3/2 flanking region (Figure 3 -7 ). As has been shown previously (Figure 3 2) this

PAGE 70

70 region also does not interact with RNA Pol II, TBP, or permissive histone marks such as H3K4me2 and AcH4 during the in vitro differentiation of erythroid cells Discussion ES cells are pluripotent and capable of differentiating into every somatic cell type. Therefore, they must have the ability to initiate transcription profiles for all of these different cell types and maintain their self renewal properties at the same time. Various studies aimed at understanding the molecular mechanisms of pluripotency have been done, but our knowledge about this process is very limited. Recent studies suggest that epigenetic mechan isms contribute to the unique characteristics of ES cells. Epigen e tic regulatory mechanisms include histone modifications, DNA methylation, ATP -dependent nucleosome remodeling, incorporation of histone variants, etc, through which the gene expression profiles are tightly and dynamically regulated. Numerous studies have shown that epigenetic alterations play a prominent role during ES cell differentiation and mammalian development. Consistently, the reprogramming of somatic nuclei into pluripotent nuclei is associated with large scale epigenetic modifications (307) Indeed, it has been demonstrated that the chromatin structure of mouse ES cells is hyperdynamic, in which the core histone proteins loosely associate with DNA. These ES cells harbor a euchromatic chromatin environment, allowing them to be highly permissive for gene expression. On the contrary, upon development and differentiation, the genome structure becomes more condensed and heterochromatic, causing the loss of pluripotency (308) The results of the present studies show that ES cell differentiation into erythroid cells in vitro is associated with changes in histone modification patterns that correlate with the transcription of erythroid specific genes (Figure 3 2). In undifferentiated ES cells (Day 0), there is alre ady an open chromatin environment at the LCR, but not at the downstream globin gene

PAGE 71

71 promoters, which is indicated by the association of active H3K4me2 and AcH4 marks at the LCR core HS sites. RNA Pol II and the general transcription factor TBP associate w ith the LCR but not with the globin gene promoters in undifferentiated cells (280) These observations suggest that as early as Day 0, the LCR is permissive for gene transcription. In the later stages of ES cell differentiation (Day 5 and Day 12), we observe that the active chromatin marks (especially H3K4me2) as well as RNA Pol II and TBP are present at the globin gene promoters in a temporal manner coinciding w ith different developmental stages. It has been shown that there are intergenic transcripts that initiate within the LCR HS2 core element and proceed unidirectionally towards the globin genes (284) The findings of intergenic transcr ipts led investigators to propose that LCR recruited RNA Pol II tracks along the globin locus, thereby opening chromatin structure, and finally reaches the globin genes to generate globin mRNAs. Recent data from 3C experiments show interactions between the LCR and globin gene promoters in differentiated erythroid cells. Also, the LCR is relocated from within inaccessible chromatin territories (CT) to the surface of these heterochromatic regions during differentiation (309) Therefore, our observations that active histone modification marks and RNA Pol II as well as TBP a ssociate with the LCR in undifferentiated ES cells suggests that the LCR is alway associated with interchromosome compartments (IC), which is the space between CTs that is devoid of chromatin and enriched for RNA Pol II. The intergenic transcription dete cted in the LCR at early stages of differentiation could maintain the position of the LCR in the IC and if transcription proceed all the way to the globin genes it could reel the genes into the IC. Previous studies in our laboratory showed that USF int eracts with LCR HS2 and with the adult -globin gene promoter and functions as activator of adult -globin gene expression (269)

PAGE 72

72 Overexpression of USF1 in mouse erythroleukemia (MEL) cells that only express the adult globin gene leads to an increase in adult maj -globin gene expression, whereas introducing a dominant -negative form of USF1 (A -USF) in MEL cells cause a reduction in maj -globin gene expression. The decrease of maj -globin gene expression in A -USF transfected MEL cells is accompanied by a reduced association of RNA Pol II and histone acetyltransferase p300 at both LCR HS2 and the maj -globin gene promoter. Felsenfelds laboratory has shown that USF interacts with the coregulators p300, CBP, SET7/9 and PCAF and possibly recruits these factors to the cHS4 insulator in the chicken -globin locus (64) Our laboratory has found that p300 and CBP interacts with LCR HS2 and the maj -globin gene promoter in MEL cel ls (28 2) In human erythroleukemia K562 cells, which only express embryonic stage globin genes, p300 and CBP only interact with LCR HS2, but not with the globin gene promoters. Further data derived from CoIP assays show that USF1 only interacts with p300 in MEL cells, but not in K562 cells. T he fact that histone acetyltransferase p300 can add acetyl groups to lysine residues of N terminal histone tails suggests that USF1 recruits p300 to the adult globin gene promoter to facilitate chromatin opening and transcription activation. In K562 cells where the adult -globin gene is silenced, the recruitment of p300 and CBP to LCR HS2 are possibly mediated by GATA 1 and NF E2, both of them associate d with CBP (49,199) Our laboratory also previously identified TFII I as a repressor of adult -globin gene expression (269) By introducing ectopic TFII I in K562 cells, there is a decr ease in adult globin gene expression, whereas overexpressing a dominant negative form of TFII I (p70) in K562 cells leads to an increase in -globin gene expression. Interestingly, TFII I interacts with a histone deacetylase (HDAC) only in K562 cells, but not in MEL cells, and they co localize at the adult -globin gene promoter (269,282) HDACs are known to remove acetyl groups from

PAGE 73

73 histone N terminal tails to maintain a repressive heterochromatic environment. USF1 interacts mainly with TFII I in K562 cells and primarily with USF2 in MEL cells. This is consistent with our previous in vitro data suggesting that TFII I and USF2 associate with the adult -globin gene initiator (Inr)/ E -box element in K562 cells; whereas USF1 and USF2 associate with the +60 E box in MEL cells in which the gene is transcribed (53,103) In the present study, I further investigated the mechanism of the repressor activity of TFII I. Components of PRC2 are expressed at high levels in embryonic tissues and are required for early mammalian development. They occupy a set of developmental genes in ES cells and silence their expression to maintain the pluripotency of ES cells (304) The interaction between TFII I and Suz12 (Figure 3 5) suggests that at least part of the repressive activity of TFII I is mediated by the PRC2 complex. This is further supported by the observation that there is an enrichment of H3K27me3 at the adult globin promoter during early stages or erythroid in vitro differentiation. The PRC2 complex is known to methylate H3K27, which serves as a docking site for recruiting the PRC1 complex to further stabilize repressive chromatin structure by DNA methylation (303) I did not analyze the recruitment of the PRC1 complex to the globin gene locus and believe that PRC1 is likely not recruited because the -globin promoter is not methylated in embryonic erythroid cells (280) Here I show that during ES cells differentiation into the erythroid lineage, Suz12, H3K27me3 a s well as TFII -I interact with the LCR HS2 and with the maj globin gene promoter at early stages of differentiation (Day 5) to repress the adult maj -globin gene expression. The PRC2 mediated repression is removed by an unknown mechanism but could involve increased activity of USF1 competing with TFII I for heterodimerization with USF2 at Day 12 of differentiation, when adult maj -globin gene expression becomes dominant in these cells (Figure 3 6). Our observation of TFII I interacting

PAGE 74

74 with both of HDAC3 and Suz12 is consistent with a previous report, indicating that the PRC2 complex co purifies with HDAC proteins (296) Our data furt her suggest that TFII I act as a repressor for adult globin gene expression by recruiting HDAC and PRC2 complexes leading to the formation of repressive chromatin structure at the adult -globin gene. The erythroleukemia cell lines used in the previous s tudies to analyze the regulation of globin genes do not accurately reflect the identities of erythroid cells that differentiate during mammalian development. Therefore, in this study, I examined the association of USF and TFII I at the -globin locus during mouse ES cell erythroid differentiation. The ES cell system will likely not recapitulate precisely the steps involved in erythropoiesis as they occur in a living animal but certainly represents an advantage over transformed cell lines (Figure 3 1). The ES cell differentiation experiment shows that when the adult -globin gene is activated (Figure 3 4, Day 8), USF1 associates with and TFII I dissociates from the adult maj -globin gene promoter. In addition, at Day 5 when the embryoni c stage globin genes are primarily expressed, I observe that both USF1 and TFII I associate with LCR HS2 but that only TFII I interacts with the maj globin gene promoter. These results further suggest that TFII I act as repressor and USF as an activator of adult -globin gene expression, and furthermore that the LCR recruits not only components involved in activating globin gene e x pression but also potential repressor activities. Taken together, our present study is consistent with the hypothesis that the LCR recruits multiple transcription regulatory proteins (including RNA Pol II, histone modification enzymes, general transcription factors and transcription factors required for globin gene regulation) through protein -DNA and protein -protein interactions and organize them to form a transcriptional holocomplex prior to globin gene expression. We propose that the transcription

PAGE 75

75 complexes assembled at the LCR are subsequently delivere d to globin gene promoters by a looping mechanism. In order to understand t h e mechanism of LCR mediated globin gene activation it will be important to identify transcription regulatory proteins that are required for the transfer of transcription complexes from the LCR to the -globin gene promoter. Furthermore, the antagonistic function of HLH proteins USF and TFII -I with respect to globin gene regulation needs to be further examined. The identification of interacting proteins will be important to compre hend how these proteins function.

PAGE 76

76 Figure 3-1. Sequential activation of globin gene transcription during in vitro erythroid differentiation of murine embryonic stem ce lls. PCR analysis of DNase I treated and reverse-transcribed total RNA extracted fr om differentiating embryonic stem cells at the indicated time points. All primer sets sp an introns, with the exception of Rex-1, and the size of each RT-PCR product is as follows: Rex-1, ~600 bp; -actin, 480 bp; -globin, 400 bp; maj-globin, 220 bp. None of the samples showed genomic DNA amplification (not shown). (This ES cell differentiation experiment and RT-PCR are done by Dr. Padraic P. Levings and repeated by me.)

PAGE 77

77 Figure 3-2. Interaction of transcription factors and RNA polymerase II with the -globin locus during in vitro murine embryonic stem (ES) cells erythroid differentiation. Chromatin immunoprecipitation (ChIP) assa ys were performed on undifferentiated (Day 0) and differentiated (Day 5 and 12) ES cells. The cells were incubated in formaldehyde and the cross-linked chromatin was fragmented, isolated, and precipitated with antibodies specific for chicken anti-IgG (IgG) (as negati ve control), RNA polymerase II (Pol II), TATA binding protein (TBP), di-methylated histone H3 lysine 4 (H3K4me2), and acetylated histone H4 (AcH4). DNA purified from the precipitate was analyzed by PCR with primers corresponding to the LCR a nd the globin gene promoter regions in the murine -globin locus as indicat ed. (This ES cell differentiation experiment and ChIP analysis were performed by Dr. Padrai c P. Levings and the ChIP analyses of Day 0 cells are repeated by me.)

PAGE 78

78 Figure 3-3. RNA polymerase II (RNA Pol II) is not recruited to the -globin gene locus in MEF and OP9 cells. ChIP analysis of the associ ation of RNA Pol II and H3K4me2 with the murine -globin gene locus and GAPDH control gene was performed using Pol II, H3K4me2, and IgG-specific antibodies. The precipitated DNA was analyzed by PCR using sets of primers specific for LCR element HS2 and promoters for and majglobin gene, as well as Necdin and GAPDH. PCR amplification products were run on an acrylamide gel and stained with SYBR green.

PAGE 79

79 Figure 3-4. Interaction of USF and TFII-I with the -globin gene locus during erythroid differentiation of murine embryonic stem cells. Murine embryonic stem cells were cultured and induced to differentiate as pr eviously described by Levings et al. (280). At Day 5, after the addition of erythropoi etin (Epo), cells were collected and subjected to ChIP analysis using antibodies against di methylated histone H3K4 (H3K4me2), USF1, USF2, and TFII-I. IgG antib odies were used as negative controls in these experiments. The DNA was isolated from the precipitate and analyzed by PCR using sets of primers specific for LCR element HS2 and the maj-globin gene promoter.

PAGE 80

80 Figure 3-5. Interaction of Suz12 with TFII-I in K562 cells. K562 whole cell extracts (WCE) were precleared with anti-(rabbit) IgG-beads and precipitated with 2.5 g of antiSuz12 or anti-IgG (as negative control) an tibodies. The complexes were captured by incubation with anti-(rabbit IgG) beads. Co mplexes were eluted off the beads with Laemmli buffer by incubation at 95 C for 10 min and loaded onto a 10% Ready gel (Bio-Rad). The membrane was probed w ith anti-TFII-I antibody. The lane labeled K562 WCE represents a regular western bl ot for TFII-I with protein extract from K562 cells (as positive control).

PAGE 81

81 Figure 3-6. The interaction of Suz12 with the -globin gene promoter decreases with increased -globin gene expression during erythroi d differentiation of mouse embryonic stem cells. (A) RT-PCR analysis of and maj-globin gene expression during erythroid differentiation of mouse embryonic stem ce lls. RNA was isolated from the embryonic stem cells incubated in the presence of E po for 5 or 12 days, as indicated. The RNA was reverse transcribed and subjected to RT-PCR using primers specific for the control genes Rex-1 and -actin as well as the embryonic and adult maj-globin genes. (B) Quantitative RT-PCR analysis of maj-globin gene expression at Day 5 and 12 of erythroid different iation of mouse embryonic stem cells. RNA was isolated from the cells at the indicated time poin ts after addition of Epo and subjected to quantitative RT-PCR analysis using primers specific for the maj-globin gene. (C) Analysis of modified histones, Su z12 and TFII-I interactions with the maj-globin gene promoter at Days 5 and 12 of erythr oid differentiation. Cells were collected at the indicated time points and subjected to Ch IP analysis using an tibodies specific for histone H3 dimethylated at K4 (H3K4m e2), histone H3 trimethylated at K27 (H3K27me3), Suz12, TFII-I and the negative control IgG. (D) Quantitative analysis of Suz12 interactions with the maj-globin gene promoter at Day 5 and 12 of erythroid differentiation. Cells were taken at the indicat ed time points and subjected to ChIP with the indicated antibodies. The precipitated DNA was subjected to quantitative PCR using primers specific for the maj-globin gene. In the left panel, chromatin was precipitated with antibodies specific for histone H3 dimethylated at K4 (H3K4me2) and analyzed by quantita tive PCR using primers specific for LCR element HS2.

PAGE 82

82 Figure 3 -7 TFII I and Suz12 do no t interact with the LCR HS3/2 flanking region Quantitative analysis of TFII I and Suz12 interactions with the LCR HS3/2 flanking region at Day s 5 and 12 of erythroid differentiation of murine embryonic stem cells. Cells were taken at the indicated time points and subjected to ChIP with the indicated antibodies. The precipitated DNA was subjected to quantitative PCR using primers specific for the LCR HS3/2 flanking region (HS3/2 flank)

PAGE 83

83 CHAPTER 4 NF E2 AND USF COOPERATE TO REGULAT E RNA POLYMERASE II IN THE GLOBIN GENE LOCUS Introduction As a model system of tissue and stage -specific gene regulation during development, t globin gene locus has been extensively studied in the past three decades. Although the precise model of globin gene regulation is still controversial, it is well accepted that the -globin gene locus is regulated by proximal and distal DNA elements as well as by erythroid -specific and ubiquitously expressed transcription factors that act through the regulatory DNA elements. The most powerful distal regulatory element of the globin gene locus is the locus control region (LCR). Results from studies with transgenic mice suggest that the LCR carries strong enhancer and chromatin domain -opening activities, and it regulates downstream like globin gene expression in a copy -number dependent manner during development. Because of these intriguing properties of the LCR, it has been studied intensively during past twenty years. The human -globin LCR contains five DNase I hypersensitive sites, HS1 HS5. Among these, HS2 and HS3 feature the majority of the known activities of the LCR (310) HS2 is considered to be the most powerful enhancer element of the LCR in the regulation of -globin gene expression. By itself, HS2 can activate human globin gene expression at high levels in yeast artificial ch romosome ( YAC) transgenic mice (221,311) HS3 plays an important role in the embryonic globin gene expression and it cooperates with HS2 for longrange enhancer activity (312,313) LCR HS2 and HS3 contain multiple DNA motifs which serve as binding sites for a variety of erythroid -specific and ubiquitously expressed transcription factors. HS2 contains a tandem MARE ( Maf recognition element) sequence which serves as a binding s ite for NF -E2, a GATA 1 binding site, an EKLF binding site, two E Box elements which recruit helix -loophelix proteins such as USF, Tal1, and TFII -I, and a YY1 binding site ( Figure 4 1A ). In HS3, there is

PAGE 84

84 one NF -E2 binding site, two GATA 1 binding sites an d an EKLF binding site. It has been shown that these transcription factors are associated with the LCR in vivo and single and combinatorial mutations of these binding sites show decreased -globin gene expression as well as DNase I resistance. Therefore, it is suggested that the strong regulatory activity of the LCR is attained by the association of multiple transcription regulatory proteins to its HS sites. The most important proximal regulatory element of the -globin gene is its promoter. The upstream p romoter of the human -globin gene contains a noncanonical TATA box (CATAAA), a CACCC -box (EKLF binding site), and multiple GATA 1 binding sites (314) It has been shown that the non -canonical TATA box is essential for -globin gene transcription. Furthermore, EKLF and GATA 1 have been shown to interact with the -globin gene promoter in vivo (47,103) The downs tream promoter region contains an initiator (Inr) element, a MARE like sequence, and three E Box elements located at +20 at +60, and immediately downstream of the initiation site overlapping the initiator ( Figure 4 1A ) (103) The E -box at +20 is not conserved between mice and human. The combined initiator E -box interacts with TFII I and USF and the +60 E -box interacts with USF1 and USF2. Also, the association of NF E2 with the MARE -like sequence from the human -globin downstream promoter region has been observed in vitro Since the -globin gene is exclusively expressed in erythroid cells, it is reasonable to speculate that globin gene expression is regulated by b oth erythroid -specific and ubiquitously expressed transcription factors. To date, the most well -studied erythroid -specific transcription factors involved in -globin gene regulation are NF -E2, GATA 1 and EKLF. NF E2 belongs to the basic leucine zipper (bZi p) family of transcription factors. It consists of two subunits, p45, an tissue -specific protein containing a DNA binding and a transactivation

PAGE 85

85 domain, and a ubiquitously expressed small Maf protein, commonly p18/MafK, which contains a DNA binding domain but lacks a transactivation domain. The transactivation domain of p45 interacts with a variety of proteins to regulate globin gene expression. These proteins include histone acetyltransferase CBP, histone methyltransferases MLL2 and G9a, and comp onents of the basal transcription machinery, such as TAFII130 (226) The small p18 Maf protein dimerizes with NF -E2 p45 through their bZip domains and helps to stabilize the association of NF E2 with its cognate MARE sequence. Based on studies using mouse erythroleukemia (MEL) cell lines lacking the p45 subunit, NF -E2 p45 is thought to be required globin gene expression, hyperacetylation of histones and the association of RNA Pol II with the globin gene promoter. However, NF -E2 p45 deficient mice display normal hematopoiesis and express the adult -globin ge ne as high as ~70% of that of the wild type. The mechanisms that apparently compensate for the loss of p45 with regard to -globin gene regulation in vivo are currently unknown, but could involve NF E2 related proteins expressed in erythroid cells. Addit ionally, p18/MafK deficient mice also display a normal phenotype, which could be due to the functional compensation from other small Maf proteins, such as MafG (315) GATA 1 is required for normal erythropoiesis. It has been shown that in a mouse erythroid cell line deficient of GATA 1, the recruitment of RNA Pol II to LCR HS1 -HS3 and to -globin gene promoter is abolished. As a result, GATA 1 defi ci ency leads to embryonic lethality due to severe anemia. EKLF functions as an adult switching factor, essential for adult globin gene expression in mice. EKLF null mice express embryonic globin genes normally, but they fail to express the ad ult -globin gene and die in utero at around day 15 (316) Besides the general transcription factors, ubi quitously expressed transcription factors involved in -globin gene regulation include the helixloop -helix proteins USF and TFII I.

PAGE 86

86 Previously, based on studies using erythroid cells lines and in vitro erythroid lineage -specific ES cell dif ferentiation, we have shown that USF functions as an activator while TFII I functions as repressor of adult globin gene expression. Moreover, our laboratory recently successfully generated transgenic mice expressing an erythroid -specific dominant -negativ e form of USF (A USF) (317) T he founder A -USF transgenic mice is a male, but all of its transgenic male offsprings are embryonic lethal The male transgenic embryos were pale and reabsorbed at 14.5 days postcoitum ( dpc ). Thus it is likely that the transgene is integrated into the X chromosome and that the expression of A-USF in all erythroid cells affects survival. T he variations in the phenotypes of female transgenic mice are probably due to the difference in silencing the transgene Therefore adult female transgenic mice were treated with phenylhydrazine to induce hemolytic anemia. We det ected significantly reduced USF and RNA Pol II associations with the adult maj -globin gene promoter in the spleens of A -USF transgenic mice compared to the wild type littermates. The observations obtained from the A -USF transgenic mice further support tha t USF acts as an activator of adult -globin gene expression. Recent studies using the 3C technique has shown that, in differentiated mouse erythroid cells, the -globin locus forms an active chromatin hub (ACH) in which the LCR interacts with the adult -globin gene promoter (149) Since NF -E2, GATA 1, EKLF, USF, and TFII I have all been shown to interact with both LCR HS2 and the globin gene promoter in vivo it would be interesting to study whether they can function as a bridge to bring the LCR and globin gene promoter together. In fact, it has been shown that GATA 1 and EKLF are both required for ACH formation (156,157) Although it is unknown whether NF -E2 and USF function in -globin ACH formation, they may function in the context of the loop.

PAGE 87

87 RNA Pol II has been shown to associate with LCR HS1 HS4 and with the -globin gene promoter in vivo (47,280) In our previous in vitro ES cell differentiation system, we showed that RNA Pol II associates only with the LCR in undifferentiated ES cells, prior to the expression of the downstream globin gene. In addition, based on studies using an in vitro transfer system, our laboratorys previous data also suggest that the LCR is able to deliver its associated RNA Pol II to an adult -globin gene and the presence of additional NF -E 2 helps to promote the transfer of RNA Pol II (55) Moreover, in erythroid cells lacking endogenous NF E2 p45, the association of RNA Pol II to the -globin gene promoter is abolished, while its association with the LCR is remains relatively unperturbed. However, in the absence of functional USF, the interactions of RNA Pol II with both the LCR and the -g lobin gene promoter are reduced. Therefore, it is important to investigate the mechanisms of how RNA Pol II and other components of the transcription apparatus are transferred from the LCR to the -globin gene promoter. Based on studies using mouse erythroleukemia cells, I demonstrate that NF -E2 p45 is essential for the high level association of RNA Pol II and various transcription regulatory proteins to the LCR and the adult globin gene promoter in differentiated erythroid cells. Interestingly, the association of CTD phosphorylated RNA Pol II to the -globin gene locus requires the presence of NF -E2 p45. I also found that NF E2, USF and RNA Pol II interact with each other in differentiated erythroid cells. Moreover by using an in vitro transfer/dissociation assay, I show that NF E2 facilitates the transfer of RNA Pol II and several transcription factors previously associated with the LCR to the adult -globin gene promoter and that the transfer of RNA Pol II requ ires the presence of the +60 E box at the promoter. I further show that USF dissociates RNA Pol II from the LCR in the absence of a -globin gene promoter. Since USF directly interacts with NF E2, I propose a model in which the association and activi ty of RNA

PAGE 88

88 Pol II and transcription regulatory factors at the -globin locus is cooperatively regulated by two transcription factors, tissue -specific NF E2 and ubiquitously expressed USF. Results In the course of our studies I used three different cell lines : MEL, CB3 and CB3/NF E2 MEL cells are murine erythroleukemia cells that are arrested at a pro -erythroblast stage and can be differentiated by a variety of chemical inducers including dimethyl sulfoxide (DMSO). DMSO mediate d induction of MEL cell differentiation has been widely used to study gene regulatory mechanisms in the globin gene loci (49,52) Figure 41B shows that incubation of MEL cells for 3 days with 1.5% DMSO leads to a more than 50 -fold increase in expression of the adult maj -globin gene. The second cell line, CB3, is also derived from MEL cells but lacks expression of NF E2 (p45), due to viral insertion into the p45 gene locus (229) CB3 c ells fail to express the ad -globin gene upon exposure to DMSO ( Figure 4 1D ). The third cell line that was used was the CB3/NFE2 cell line These cells represent CB3 cells stably transfected with an expression construct for p45, the large subunit of NF -E2. These cells express relatively high levels of the adult maj -globin gene in the absence of DMSO induction (Figure 4 1F) but fail to increase globin gene expression in response to DMSO (data not shown). I compared the expression of several proteins previously implicated in globin gene regulation in uninduced and DMSO induced MEL (Figure 4 1C) and CB3 (Figure 4 1E) cells by western blotting analysis. The data demonstrate that the expression of transcription factors USF1, USF2, and NF -E2 (p45) increases during differentiation of MEL cells. In contrast, expression of RNA Pol II, TFIIB, MafK, CBP, and GAPDH remain similar between uninduced and induced MEL cells. The situation in CB3 cells is somewhat different in that th ese cells do not express NF E2 (p45) as expected, and do not reveal an increase in USF expression upon exposure to DMSO. In contrast to CB3 cells, CB3/NF-E2 cells express NF -E2 (p45) ( Figure 4 1G), however, the USF protein

PAGE 89

89 levels are difficult to compare between CB3 and CB3/NF -E2 cells due to the difference in intensi ties of the bands corresponding to the internal control GAPDH I next examined the interaction of the above -mentioned proteins with the globin gene locus in uninduced and DMSO induced MEL and CB3 cells (Figures 4 2 and 4 -3). I focused the attention on two elements that have previously been shown to be the major sites of interactions for both NF -E2 and USF, namely LCR element HS2 and the adult maj -globin gene promoter (269,318) Both of these elements harbor multiple E -box motifs and HS2 also contains t wo consensus MARE elements. NF E2 also interacts with the adult -major globin gene promoter although it lacks a consensus MARE sequence (104,318) As negative control s, I also examined the interaction of the proteins with either a DNA element located in between HS2 and HS3 (HS3/2 flanking region) or a GAPDH 3 untranslated region (UTR) The proteins examined here interact significantly less efficient ly with the negative control region in uninduced or induced MEL or CB3 cells (55,269,280,282) (Figure s 47 and 4 -8). F igure 4 -7 s how s that NF -E2 (p45), MafK, USF1, USF2, CBP and TFIIB do not interact with the negative contr ol HS3/2 flanking region in DMSO induced or uninduced MEL, CB3 and CB3/NF-E2 cells Some of the values for the IgG ChIP were zero after quantative PCR with DNA primers against HS3/2 flanking region, thus the ChIP data presented in Figure 4 7 and 4 8 are shown as fraction of input. Figure 4 2A demonstrates that NF -E2 (p45) MafK, USF1, USF2, CBP, and TFIIB are already associated with LCR element HS2 in uninduced MEL cells. Only USF2, MafK, and TFIIB are significantly enriched at the adult maj -globin gene promoter in uninduced MEL cells, while all the other factors are not enriched. Upon induction of MEL cell differentiation there is a 2 to 5 -fold increase in the association of all of the factors with LCR element HS2 and a 5 to 10 fold increase in the interaction of all factors with the adult -globin gene promoter. Only upo n

PAGE 90

90 induction of differentiation do NF E2 (p45), USF1, and CBP reveal significant enrichment at the adult -globin gene promoter. The situation is very different in CB3 cells ( Figure 4 2B ). The proteins MafK, USF1, USF2, CBP, and TFIIB reveal significant enr ichment at LCR element HS2 and at the adult maj -globin gene promoter, but at lower levels compared to MEL cells. None of the protein/chromatin interactions increase upon exposure of CB3 cells to DMSO. We next analyzed the interaction of NF -E2 and USF in C B3/NF E2 cells, in which expression of p45 has been restored by stable transfection with a p45 expressing DNA construct. The data demonstrate that NF -E2 binds efficiently at LCR HS2 and at the adult maj -globin gene promoter i n CB3 cells expressing p45 ( Figure 4 2C ). Interestingly, the level of NF E2 binding is higher than in uninduced MEL cells. Reexpression of p45 did not lead to dramatically increased interactions of USF1 and USF2 with LCR HS2 and the globin promoter. Previous work by Johnson et al. de monstrated that NF E2 is required for the recruitment of RNA Pol II to the adult -globin gene promoter but not to LCR element HS2 (49) RNA Pol II is recruited to DNA in its unphosphorylated form, is first phosphorylated at Ser 5 in the CTD during transcription initiation, and subsequently phosphorylated at Ser 2 in the CTD to allow efficient elongation (319) I examined the interaction of total RNA Pol II (Pol II/CTD), unphosphorylated RNA Pol II (Pol II/P ), Ser 5 phosphorylated RNA Pol II (Pol II/S5P), and Ser 2 phosphorylated RNA Pol II (Pol II/S2P) with the globin gene locus in uninduced and D MSO induced MEL and CB3 cells ( Figure 4 3A, B). The results demonstrate that RNA Pol II -globin gene promoter in uninduced MEL cells (Figure 4 3A). Interestingly, there was no Ser 5 phos phorylated RNA Pol -globin gene promoter in uninduced MEL cells. A positive control experiment demonstrated that Ser 5 phoshorylated RNA Pol II was efficiently recruited

PAGE 91

91 to the GAPDH gene in uninduced MEL cells (Figure 4-3D ). I observed a significant enrichment for the Ser 2 phosphorylated form of Pol II at LCR element HS2 but not at the maj globin gene promoter in uninduced cells. The presence of Ser 2 phosphorylated RNA Pol II indicates ongoing intergenic transcription within the LCR in uninduced MEL cells. After induction of differentiation, I detected a strong increase in the association of RNA Pol II, including unphosphorylated RNA Pol II as well as Ser 5 and Ser 2 phosphorylated forms of RNA Pol II, -globin gene promoter ( Figure 4 3A). I found that the Ser 5 phosphorylated form of RNA Pol II significantly associated with LCR HS2 but not with the maj globin gene promoter in MEL cells that were induced by 1.5% DMSO for only 24 hrs. This result suggests that elongation competent RNA Pol II complexes are first assembled at the LCR. In CB3 cells low but significant levels of Pol II were associated with LCR element HS2 but not with the ad ult -globin gene promoter (Figure 4 3B), consistent with previous observations made by Johnson et al. (49) There was no increase in the association of RNA Pol II with the globin locus associated elements upon incubat ion of CB3 cells with DMSO. Importantly, in contrast to MEL cells, there were no Ser 5 or Ser 2 phosphorylated forms of RNA Pol II were -globin gene promoter in CB3 cells either before or after incubation wit h DMSO (Figure 4 3B), demonstrating that NFE2 (p45) is required for the phosphorylation of RNA Pol II in the globin gene locus. Similar to what I observed at HS2, RNA Pol II is also recruited to HS3 and phosphorylation of RNA Pol II at HS3 is also dependent on NF E2 (p45) and erythroid differentiation (data not shown). I next addressed the question of whether re -expression of p45 in NF -E2 deficie nt CB3 cells would restore the -globin gene locus. Re -expression of NF E2 (p45) led to 4 -fold increase in the association of Pol II with LCR HS2 when compared to CB3

PAGE 92

92 cells (Figure 4 -3C). The levels of P ol II bound at HS2 in these cells were comparable to those detected in uninduced MEL cells. However, the association of RNA Pol II with the adult maj globin gene promoter was increased about 40-fold compared to CB3 cells and was much higher than in uninduced MEL cells. These data show that NF E2 is important for the efficient recruitment of RNA Pol II to the maj -globin gene. I did not observe an increase in Ser 5 phophorylated RNA Pol II at the LCR in CB3 cells expressing p45. In contrast there was a si gnificant increase of both Ser 5 and Ser 2 phosphorylated RNA Pol II at the adult -globin gene promoter. I also examined the interaction of the various forms of RNA Pol II with the negative control regions, HS3/2 flanking region or GAPDH 3 UTR (Figure 4 8) The interactions of total RNA Pol II (Pol II CTD) and unphosphorylated RNA Pol II (Pol II/P ) with the HS3/2 flanking region were undetectable in CB3 cells with or without DMSO induction (Figure 4 8A). S ince there was no recruitments of Ser 5 or Ser 2 phosphorylated RNA Pol II to the LCR HS2 or adult maj -globin gene promoter in CB3 cells, the interactions of these forms of RNA Pol II with HS3/2 flanking region were not examined. In uninduced MEL cells, there was a low level of total RNA Pol II (Pol II CTD) but no unphosphorylated RNA Pol II (Pol II/P -) associated with HS3/2 flanking region, whereas in MEL cells induced by DMSO for 3days, there were increased levels of the association of total and unphosphorylated RNA Pol II to the HS3/2 flanking region (Figure 4 8A) However, the interaction s of these forms of RNA Pol II were at 1020 times lower levels compared to the interaction s with LCR HS2 and the maj globin gene promoter in DMSO induced MEL cells Even in the uninduced MEL cells, the association of total RNA Pol II to both of LCR HS2 and the maj -globin gene promoter were significantly higher compared to levels detected at the HS3/2 flanking region.

PAGE 93

93 Figure 4 -8B shows that Ser 5 phosphorylated RNA Pol II (Pol II/S5P) was not associated with the HS3/2 flanking region or with the GAPDH 3 UTR in MEL cells induced by 1.5% DMSO for 1 or 3 days Since Ser 5 phosphorylated RNA Pol II is only present during transcription initiation and early elongation, the observation that it was undetectable at the GAPDH 3 UTR confirm ed that the RNA Pol II/S5P antibody I used here is specific and does not detect other forms of RNA Pol II The interaction of Ser 5 phosphorylated RNA Pol II with the HS3/2 flanking region in uninduced MEL cells was not examined, because Ser 5 phosphoryla ted RNA Pol II was undetectable at both LCR HS2 and the maj -globin gene promoter in MEL cells. Ser 2 phosphorylated RNA Pol II (Pol II/S2P) was undetectable at the HS3/2 flanking region in MEL cells in cubated with or without DMSO. There was no association of all forms of RNA Pol II to the HS3/2 flanking region in CB3/NF E2 cells (Figure 4 -8C). Because our data and those previously published by Johnson et al. suggest that USF and NF E2 are both required for the recruitment of RNA Pol II to the adult globin gene p romoter (49,269) I examined whether these proteins interact i n erythroid cells ( Figure 4 -4). In co immunoprecipitation experiments I found that USF1 and USF2 interact with NFE2 (p45) in uninduced MEL cells with comparable efficiency. After induction of differentiation there appeared to be an increase in interaction between USF2 and NF E2, relative to interacti ons between USF1 and NF E2 (Figure 4 -4). I performed reciprocal experiments in which I immunoprecipitated with a NF -E2 p45 antibody and performed the western blotting with USF antibodies and the results confirmed the interactions between USF and NF -E2 I also observed interactions of USF2 with USF1, NF E2, and RNA Pol II in DMSO induced MEL cells. There was a reproducible but weak signal for RNA Pol II in USF2 precipitated material from uninduced cells (compare the signal in the lane labeled USF2 with the signal in the lane labeled

PAGE 94

94 IgG), suggesting that USF2 but not USF1 interacts with RNA Pol II in undifferentiated MEL cells. The more efficient coimmunoprecipitation of USF with RNA Pol II in differentiated cells could be due to the fact that there is an increase in expression of USF during differentiation (320) or that there is an additional activity induced upon induction that mediates interactions between USF and RNA Pol II. This activity could in fact be the increased expression of NF E2. It is also interesting to note that in undifferentiated MEL c ells USF1 homodimers may be more abundant than USF1/USF2 heterodimers. This does not appear to be the case in differentiated MEL cells, in which we detected efficient interaction of USF2 with both USF1 and NF -E2 (p45). Furthermore, USF2 but not USF1 intera cts efficiently with the co activator CBP in MEL cells (Figure 4 -4). TFIIB precipitates together with USF2 in uninduced and induced MEL cells. In contrast to MEL cells I did not detect interactions between USF and RNA Pol II in CB3 cells although the interaction between USF2 and CBP are detectable (Figure 4 -4). I did not detect USF, NF E2, or CBP in samples precipitated with antibodies against RNA Pol II. This is likely because only a small fraction of nuclear RNA Pol II will associate with these proteins at any given time. All of the protein/protein interaction data here have been reproduced. NF E2 and USF could be part of a large protein complex and thus the interaction could either be direct or mediated by other p roteins. I carried out GST pull down assays using GST tagged recombinant USF1 and recombinant his -tagged NF -E2 (p45 tethered to mafG). The results demonstrate that USF1 directly interacts with NF E2. Since both proteins contain a leucine -zipper interaction domain, I analyzed the interaction of different mutants of USF1 with NF E2. The USF1 mutants contain either the truncated C terminal immediately downstream of USR (USF specific region) and the basic region, or with further downstream deletion of the helix loop -he lix domain as indicated in Figure 4 4B and C I detected efficient interactions only

PAGE 95

95 between full length USF1 and NF E2 demonstrating that the N terminus of USF1 is important for the interaction with NF -E2. I next analyzed USF1 N-terminal mutants an d results demonstrate that the Cterminus is also important for the interaction between USF1 and NF -E2. However, in contrast to the C -terminal mutants, deletion of the leucine zipper or the entire N terminus still allowed interactions between the two proteins albeit with much lower efficiency. This result demonstrates that the USF1 leucine zipper domain is not the most critical determinant among all the other USF1 domains for the specific interaction between USF1 and NF -E2. I next examined the mechanism(s) by which NF -E2 and USF could regulate LCR mediated recruitment of RNA Pol II to the adult -globin gene promoter using a protein d issociation/transfer assay (Figure 4 5A). Our laboratory previously established a method tha t allows the analysis of Pol II tran sfer from the LCR to the adult -globin gene promoter (55) A plasmid containing all 5 HS sites from the human -globin LCR is linearized, b iotinylated, and immobilized on streptavidin coated magnetic beads. The immobilized LCR is incubated with protein extracts from MEL cells. Studies from our laboratory previousl y demonstrated that under the applied conditions RNA Pol II is recruited to LCR elements HS2 and HS3 (53) After removing all material not bound to the LCR, the immobilized protein/DNA complex is incubated with DNA templates containing the a dult -g lobin promoter or mutants. In previous experiments from our laboratory, the globin gene template along with associated proteins from the immobilized LCR complex is removed and immunoprecipitation is performed with RNA Pol II specific an tibodies followed by PCR using globin gene specific DNA primers (55) In the initial experiments described here I removed all material from the LCR complex af ter incubation with or without -globin promoter containing templates and subjected the material to western blotting analysis using NF E2, USF, or RNA Pol II spec if ic antibodies as shown in Figure 4 -5B.

PAGE 96

96 In most of these experiments I -globin gene ). This experimental setup allows me to -globin promoter dependent dissociation of proteins from the LCR. The data demonstrate that there is an increase in the dissociation of USF1, USF2, NF -E2 (p45) and RNA -globin gene promoter (Fi gure 4 5B), suggesting that the promoter efficiently competes for the binding of these proteins. I observed a -globin templates are used that carry mutations in an E -box located 60bp downstream of the transcription initiation sites (+60Eboxmut, Figure 4-5C). Our laboratory previously demonstrated that this Ebox interacts with USF and is required for the efficient in vitro transcription of the -globin gene (103) A mutation of a partial MARE sequence (NF E2mut) in the downstream promoter region did not affect the increase in -g lobin promoter mediated dissociation of RNA Pol II from the LCR. Expression of a dom inant negative mutant of USF (A -USF) in MEL cells reduces recruitment of RNA Pol II to LCR HS2 and the adult -globin gene promoter (269) I nt erestingly, the addition of A -USF i ncreases the dissociation of Pol II from the LCR even in the absence of a -globin gene promoter, while BSA, AAV Rep protein, or NF E2 were all unable to do so (Figure 4 -5D). Previous studies from our laboratory have shown t hat NF -E2 increases the -globin gene promoter (55) I show here that NF -E2 only facilitates dissociation of RNA Pol II from the LCR in the presence -globin gene promoter (Figure 4 5D). The fact that the USF -binding site is required for efficient dissociation/transfer suggests th at USF may be required to stabilize NF E2 binding at the promoter, which lacks a consensus MARE sequence.

PAGE 97

97 I next verified some of the results from the in vitro dissociation experiment using a quantitative assay in which I performed the incubation experiments as described above but globin gene promoter using immunoprecipitation ( IP ) with RNA Pol II antibodies followed by quantitative PCR using primers that amplify a -globin gene ) (Figure 4 5E). The data show that RNA Pol II is t ransferred from the LCR to the -globin gene in a promoter dependent manner and that NF -E2, but not A -USF, facilita tes the transfer of RNA Pol II to the -globin gene. To control for the initial amount of Pol II recruited to the LCR, I performed western blotting experiments. The data demonstrate that all samples analyzed quantitatively had about the same amount of Pol II recruited to the LCR before dissociation/transfer was analyzed. The fact that A -USF did not increase recruitment of RNA Pol II to the -globin gene promoter even it dissociates USF and RNA Pol II from the LCR is likely due to that A -USF associated US F is unable to bind to the +60 E -box at the -globin promoter to facilitate the recruitment of RNA Pol II to the promoter. Discussion Previous studies have shown that -globin LCR HS sites recruit transcription complexes and that the LCR is required for the association of the globin gene locus with transcription factories (55,274,284,285) Furthermore, long intergenic noncoding transcripts originate from within or upstream of the LCR and are detectable throughout the globin gene locus in a developmental stage -specific manner (321) During the differentiation of erythroid cells transcription complexes and other activities first associate with the LCR before they are detectable at the globin gene promoters (280,322,323) These data suggest that the LCR is the primary attachment site for the recruitment of transcription complexes and that these complexes are delivered to the globin gene locus by a tracking, linking, or looping mechanism (324) Not

PAGE 98

98 consistent with this model, however, is the observation that even in the absence of the LCR RNA P ol II is efficiently recruited to the adult -globin gene promoter, although it exhibits defects in elongation of transcription (75) Sawado et al. discussed the possibility that the LCR provides activities for the efficient elongation of RNA Pol II at the -globin gene promoter (75) If RNA Pol II is first recruited to the LCR another possibility is that the elongation competent transcription complexes are assembled at the LCR and transferred to the high affinity globin gene promoters. To further elucidate how the LCR and interacting proteins mediate recruitment and activity of RNA Pol II in the -globin gene locus I analyzed MEL cells expressing or not expressing NF E2 (p45). NF E2 (p45) has previously been shown to be required for the recr uitment of RNA Pol II to the adult -globin gene promoter but not to the LCR. I demonstrate here that RNA Pol II is recru ited to LCR HS2 but not to the -globin gene promoter in undifferentiated MEL cells (Figure 4 -3 ). Recruitment of RNA Pol II to LCR HS2 is inefficie nt in the absence of NF E2 (p45 ). Perhaps more importantly, however, is the observati on that in the absence of NF -E2 (p45 ) there is no phosphorylated RNA Pol II detectable at LCR HS2 or the maj globin gene promoter. This result suggests that NF -E2 is not only important for the efficient recruitment of RNA Pol II to the globin gene locus but plays an role in converting RNA Pol II into an elongation competent form, as has been discussed previously by Sawado et al. (75,318) Re -expression of p45 in NF E2 deficient CB3 cells caused a strong increase in the recruitment of RNA Pol II with the maj globin gene promoter. Expression of p45 also led to the phosphorylation of RNA Pol II at the pr omoter but not at L CR HS2. This result is interesting and somewhat contrasts the findings in MEL cells showing that Ser5 -phosphorylated RNA Pol II is first detectable at the LCR during DMSO induced differentiation. Expression of relative high levels of p45 in uninduced CB3 cells

PAGE 99

99 likely causes the local remodeling of the chromatin structure at the maj globin gene promoter, consistent with findings from the Brandt and Bresnick laboratories (276,277) According to the transfer model the open chromatin structure at the promoter would lead to the efficient transfer of Ser5 -phosphorylated RNA Pol II to the promoter. Alternatively, the NF -E2 (p45 ) induced opening of the chromatin structure at the adult globin gene promoter may bypass the need for LCR mediated RNA Pol II recruitment. I detected low levels of RNA Pol II binding at the adult -globin promoter in uninduced MEL cells, which possibly attribute to the presence of cells that spontaneously differentiated in the absence of DMSO. Alternatively, low levels of RNA Pol II could be recruited to the maj globin gene in an LCR dependent or indepe ndent manner in undifferentiated cells. I observed that, along with RNA Pol II, USF2, M afK, and TFIIB are already associated w ith LCR HS2 and with the adult globin gene promoter in undifferentiated MEL cells, while USF1, CBP and NF E2 only are only a ssociated with HS2 in undifferentiated cells. Using Co IP I found that after differentiation of MEL cells there is an increased interaction of USF2 with NF E2 (p45), USF1, and RNA Pol II (Figure 4 -4). This is accompanied by an increased recruitment of all of these proteins to the globin gene locus. Previous studies had already shown that the NF E2 activity increases during differentiation of erythroid cells (3 25) My data suggest that increased expression of USF and NF -E2 facilitate the formation of large protein complexes that regulate RNA Pol II recruitment and activity in the -globin gene locus. Based on my data, I propose that partial elongation incompetent tr anscription complexes are first assembled at the LCR in undifferentiated MEL cells. This is in part mediated by USF2 and TFIIB. P revious data from our laboratory showing that expression of a dominant negative mutant of USF (A -USF) in undifferentiated MEL cells reduces the recruitment of RNA Pol II to

PAGE 100

100 LCR HS2 (269) are consistent with the hypothesis that USF participates in the recruitment of RNA Pol II to the LCR in undifferentiated MEL cells. During differentiation, an increase in expression of NF E2 (p45), USF, and other proteins leads to the efficient recruitment of additional activities to the LCR, i ncluding those that convert RNA Pol II from a transcriptionally inert to a transcriptionally competent form. The assembly of elongation competent transcription complexes is indispensible of the presence of NF -E2 and is also accompanied by a conformational change in the globin ge ne locus that brings the adult -globin gene in close proximity to the LCR (Figure.4 6) (149) The presence of high affinity basal promoter elements in the adult -globin gene promoter facilitates the transfer of elongation competent transcription complexes to the promoter. The transfer is mediated at least in part by NF E2. However, the associ ation of NF -E2 with the -globin gene promoter is likely stabilized through its interaction with USF and the presence of USF binding sites. The in vitro RNA Pol II transfer experiments revealed that NF -E2 is able to dissociate RNA Pol II from the LCR and that this proc ess req uires the presence of a -globin promoter template. The transfer to the promoter also required a USF binding sites. These data are consistent with our findings from MEL cells and further demonstrate that USF and NF -E2 cooperate to mediate the transfer/recruitment of RNA Pol II to the adult -globin promoter. The function of NF E2 in vivo is likely more complex and involves the remodeling of chromatin structure at the adult -globin gene promoter, which would further facilitate recruitment of th e transcription complex. The maintenance of proximity between the LCR and promoter guarantees the continued loading of elongation competent transc ription complexes to the adult -globin gene promoter (Figure 4 -6). It is also possible, however, that the con formational change bringing the -globin gene into close proximity to the LCR precedes the assembly of active transcription complexes.

PAGE 101

101 Our data do not clearly distinguish between these two possibilities. The only piece of evidence arguing for LCR mediated assembly of elongation competent transcription complexes is the observation that Ser -5 phosphorylated RNA Pol II is first detectable at LCR HS2 during the differentiation of MEL cells. In contrast to other hematopoietic specific transcription factors, like GATA 1, Fog 1, EKLF, and NL1, N F-E2 (p45) is not critical for mediating proximity between the LCR and the adult globin gene or for the formation of an active chromatin hub (ACH) (156,157,228,326) Howeve r, my data suggest that NF E2 and USF function in the context of the ACH and perhaps mediate the assembly of elongation competent transcription complexes at the LCR and at the adult -globin gene promoter. Dr. Suming Huang at UF ha s characterized proteins that associate with USF1 in HeLa cells (Huang et al., unpublished data). Interestingly, three of these proteins are implicated in the recruitment and activity of RNA Pol II. These proteins are TBP associated factors (TAFs) 4 and 6, as well as the elongation factor EFIA2. In this respect it i s interesting to note that USF1 only associates with RNA Pol II and the -globin gene locus after differentiation of erythroid cells. Many proteins contribute to expression of the globin gene locu s and NF E2 and USF function within a cascade of events that regulate accessibility and location of the globin genes in the nucleus (327) It will be increasingly important to determine how the different transcription factors function together to mediate extremely highlevel transcription of the -like globin genes during erythroid differentiation and development. Another protei n that acts at the adult -globin gene is EKLF, which recruits chromatin remodeling complexes to the promoter but also contacts c omponents of the transcription initiation complex (233,328) Future studies will address if and how EKLF communicates with USF and NF -E2 in regu lating expression of the adult -globin gene.

PAGE 102

102 Figure 4 1. DMSO mediated increase in USF, NF -globin expression in MEL but not CB3 cells. (A) Schematic of cis acting elements within LCR HS2 and sequence globin downstream promoter. The LCR HS2 contains a tandem NF E2 binding site, E box elements (E) CACC motif (EKLF binding site) and GATA -globin downstream promoter reg ion contains three E box elements and MARE/AP1 -like element in human (H), mouse (M) and rabbit (R) as indicated. The E -box elements overlapping the initiator and at +60 downstream of the transcription start site (+1) are conserved in all three species, whereas the one located at +20 is only present in the human and rabbit genes. (B) Quantitative RT -globin gene expression in MEL cells incubated with or without 1.5% DMSO for 3 days. RNA was isolated fr om MEL cells, reverse transcribed, and subjected to qPCR using primers specific for the adult -globin gene. The results are shown as the relative expression normalized to actin gene. The error bars represent the standard error of the mean (SEM) from three independent experiments. (C) Western blotting analysis of NF E2 (p45), USF1, USF2, Pol II, TFIIB, GAPDH, MafK, and CBP in MEL cells extracts was elec trophoresed in 4 20% Ready Gels (Bio Rad), transferred to nitrocellulose membranes and incubated with antibodies as indicated. (D) Quantitative RT -globin gene expression in CB3 cells incubated with or without 1.5% DMSO for 3 days. RNA was isolated and analyzed as described in B. (E) Western blotting analysis of NF E2 (p45), USF1, USF2, Pol II, TFIIB, GAPDH, MafK, and CBP in CB3 cells incubated with or without 1.5% DMSO for 3 days. Proteins were processed and analyzed as described in C. (F) Quantitative RT -globin gene expression in CB3 and CB3/NF E2 cells. RNA was processed and analyzed as described in A. (G) Western blotting analysis of NF E2/p45, USF1, USF2, and GAPDH expression in CB3 and CB3/NF -E2 cells. Proteins were p rocessed and analyzed as described in C. (Figure (A) is adapted from Johnson et al. (49) and Leach et. al. (103) .)

PAGE 103

103

PAGE 104

104 Figure 4 -2 Lack of NF -E2 (p45) reduces the assembly of protein complexes at LCR HS2 and at the adult maj -globin gene promoter. (A) ChIP analysis of protein chromatin interactions in LCR HS2 and the adult maj -globin gene promoter in MEL cells incubated with or without 1.5% DMSO for 3 days. After crosslinking MEL cells with 1% formaldehyde, chromatin was isolated, fragmented by sonication, and subjected to immunoprecipitation with antibodies against NF -E2 (p45), MafK, USF1, USF2, CBP, and TFIIB. Reactions with the IgG antibody served as a negative control. The DNA was purified from the precipitate and subjected to qPCR using primers specific for LCR HS2 and the adult maj -globin gene promoter as indicated. Error bars represent SEMs of three independent experiments. (B) ChIP analysis of protein chromatin interactions in LCR HS2 and the adult maj globin gene promoter in CB3 cells incubated with or without 1.5% DMSO for 3 days. DNA was isolated from immunoprecipitated material and analyzed as described in A. (C) Comparati ve ChIP analysis of protein chromatin interactions in CB3, MEL, and CB3/NF -E2 cells. Crosslinked chromatin was precipitated with IgG or antibodies against NF -E2, USF1, or USF2 and DNA was analyzed as described in panel A. In A and B, indicate p values o f <0.05, values of <0.1 between DMSO induced versus uninduced samples; ** indicate p -values of <0.05, -values of <0.1 between specific antibody versus IgG. In C, indicate p -values of <0.05, pvalues of 0.1 between MEL or CB3/NF -E2 cells versus CB3 cells; ** indicate p values of <0.05, -values of < 0.1 between CB3/NF E2 cells versus MEL cells; *** indicate p -values of <0.05 between CB3/NF -E2 cells versus MEL and CB3 cells.

PAGE 105

105

PAGE 106

106 Figure 4 3. Efficient recruitment of Pol II and CTD serine 5 and serine 2 phosphorylation at the -globin gene locus requires NF E2. (A) ChIP analysis of Pol II interactions in the globin gene locus in MEL cells incubated with or without 1.5% DMSO for 1 or 3 days. Chromatin was isolated from crosslinked MEL cells, fragmented by sonication, and immunoprecipitated with antibodies specific for the Pol II CTD (Pol II/CTD), for unphospho rylated Pol II (Pol II/P -), or for Pol II phosphorylated at serine 5 (Pol II/S5P) or serine 2 (Pol II/S2P) of the CTD. IgG or IgM antibodies were used in these experiments as negative controls. DNA was isolated from the precipitates and subjected to qPCR w ith DNA primers specific for LCR HS2 or the adult maj -globin gene promoter as indicated. Error bars represent SEMs from three independent experiments. (B) ChIP analysis of Pol II interactions in the -globin gene locus in CB3 cells incubated with or witho ut 1.5% DMSO for 3 days. Chromatin precipitation and DNA analysis by qPCR was performed as described in panel A. (C) Comparative ChIP analysis of Pol II interactions in CB3, MEL and CB3/NF E2 cells. Chromatin precipitation and DNA analysis by qPCR was perf ormed as described in panel A (D) ChIP analysis of Ser 5 phosphorylated Pol II at the GAPDH promoter in undifferentiated and DMSO induced MEL and CB3 cells (as indicated). Cells were grown in the absence or presence of DMSO (1.5% for 3 days). DNA was isol ated from immunoprecipitated material and analyzed by qPCR as described in A. In A, B and D, indicate p values of <0.05, -values of <0.1 between DMSO induced versus uninduced samples; ** indicate p values of <0.05 between specific antibody versus IgG. In C, indicate p -values of <0.05 between MEL or CB3/NF E2 cells versus CB3 cells; ** indicate p -values of <0.05, indicate p -values of <0.1 between CB3/NF -E2 cells versus MEL and CB3 cells.

PAGE 107

107

PAGE 108

108 Figure 4 4. Interactions of USF1 and USF2 with NF -E2 (p45) and Pol II during erythroid differentiation of MEL and CB3 cells. (A) Co immunoprecipitation experiments were performed by first subjecting nuclear extracts from MEL or CB3 cells incubated with or without 1.5% DMSO for 3 days to immunoprecipitation with antibodies specific for IgG, Pol II (N 20), USF1, USF2, and TFIIB. The immunoprecipitated material was electrophoresed using 4 20% Ready Gels (Bio-Rad) and transferred to nitrocellulose membranes. The nitrocellulose membranes were incubated with antibodies against Pol II, NF -E2, USF1, USF2, and CBP, as indicated, and subjected to ECL plus chemiluminescence (Amersham). (B) Generation and expression of USF1/GST fusion proteins in E.coli cDNA encoding ful l length or truncated USF 1 were ligated into the pGEX 5X 1 vector. Fusion proteins were expressed in and purified from E.coli and analyzed by SDS -PAGE. The following USF1 derived proteins were purified; USF1, fulllength USF1 protein; USF M1, deletion of the N terminal half; USF1 M2, deletion of the Nterminus and the basic region; M3, deletion of the N terminus, the basic region and the helix loop -helix (HLH) domain; USF1 LZ, deletion of the leucine zipper; USF1 -N, deletion of the C -terminus as well as the basic region, the HLH domain, and the LZ domain. (C) Interaction of USF1 with NF -E2. Equal amounts of GST -tagged wild type and mutant USF1 fusion proteins were incubated with His tagged NF -E2. After washing, proteins were eluted from the GST -beads, electro phoresed using SDS PAGE and subjected to western blotting analysis using an antibody specific for NF E2 (p45) Fast Green staining was performed to monitor the equal loading amount of all GST -fusion proteins prior to the antibody incubation with the membra ne.

PAGE 109

109

PAGE 110

110 Figure 4 5. USF and NF E2 regulate the recruitment and dissociation of RNA Pol II to and from immobilized LCR templates. (A) Scheme of the experimental strategy. A linerarized and biotinylated plasmid containing the -globin LCR was immobilized on streptavidin coated magnetic beads as described by Vieira et al. (55) The LCR was then incubated with whole cell extracts from MEL cells. Unbound material was removed and the LCR/protein complex was washed several times and incubated with different DNA templates in the presence or absence of recombinant NF -E2 (p45 tethered to MafG, 16, 37) or A -USF (dominant negative form of USF). Proteins that dissociate from the LCR after the incubation step were analyzed using western blotting analysis. Transfer of proteins to the -globin gene promoter was analyzed by immunoprecipitatio n ( IP ) followed by quantitative PCR. ( B) globin promoter mediated dissociation of RNA Pol II, NF -E2 (p45), USF1, and USF2, from the LCR in the presence of a plasmid containing the -globin gene with ( +) or without ( -) its promoter. Proteins and DNA wer e removed from the immobilized LCR after incubation for 30 min at 37C (C) Analysis of the effect of -globin promoter mutations on the dissociation of RNA Pol II. DNA plasmids containing the wild-type -globin promoter ( +) or the promoter with mutations in the initiator (INImut), the +60 E -box (+60Eboxmut), or the partial MARE sequence (NF E2mut) were incubated for 30 min with the immobilized LCR/protein complex in the presence of recombinant NF E2. Dissociated proteins were removed and analyzed by weste rn blotting experiments using an antibody specific for RNA Pol II. ( D ) Effect of NF E2 and A -USF on the dissociation of RNA Pol II from the immobilized LCR. The i mmobilized LCR/protein complex was incubated for 30 min with BSA, AAV Rep (Rep), NF -E2, or A -U SF in the absence or presence of a plasmid containing the wildtype globin gene promoter ( +). Dissociated proteins were removed and analyzed by western blotting experiments using an antibody specific for RNA Pol II. ( E) Quantitative PCR analysis of RNA Pol II transfer from immobilized LCR templates to the -globin gene promoter. Immobilized LCR/protein complex was incubated with or without a plasmid containing the -globin gene with ( +) or without ( ) its promoter region for 30 min at 37C. Unbound mat erial was subjected to immunoprecipitation using IgG or RNA Pol II specific antibodies. The DNA was isolated from the precipitate and subjected to quantitative Real Time PCR using primers specific for the -globin gene. The experiment has been repeated and the error bars represent the SEM. An aliquot was taken from the immobilized LCR/protein complex in each transfer/dissociation assay and analyzed by western blotting using a RNA Pol II specific antibody (shown above the g raph).

PAGE 111

111

PAGE 112

112 Figure 4 6. Model of NF -E2 and USF mediated assembly and transfer of elongation competent transcription complexes in the -globin gene locus. Incomplete elongation incompetent Pol II transcription complexes are first recruited to the LCR. This is mediated in part by USF2 and its associated co -factor CBP. After erhthroid differentiation, expression of NF E2 (p45) and USF increases and these proteins increasingly associate with the LCR. This leads to the recruitment or assembly of transcript ionally competent Pol II complexes, and phosphorylation of the Pol II CTD. The differentiation of erythroid cells is also accompanied by a conformational change in the globin locus that juxtaposes the adult globin gene with the LCR. This facilitates the tr ansfer of elongation competent transcription complexes from the LCR to the adult globin gene.

PAGE 113

113 Figure 4 -7 Interaction of protein complexes with the LCR HS3/2 flanking region in MEL, CB3 and CB3/NF -E2 cells (A) ChIP analysis of protein chromatin interactions in the LCR HS 3/ 2 flanking region (HS3/2 flank) in MEL cells incubated with or without 1.5% DMSO for 3 days. After crosslinking MEL cells with 1% formaldehyde, chromatin was isolated, fragmented by sonication, and subjected to immunop recipitation with antibodies against NF E2 (p45), MafK, USF1, USF2, CBP, and TFIIB. Reactions with the IgG antibody served as a negative control. The DNA was purified from the precipitate and subjected to qPCR using primers specific for LCR HS 3/2 flanking region as indicated. Error bars represent standard deviations of three independent experiments. (B) ChIP analysis of protein chromatin interactions in the LCR HS 3/ 2 flanking region in CB3 cells incubated with or without 1.5% DMSO for 3 days. DNA was isolated from immunoprecipitated material and analyzed as described in A. (C) ChIP analysis of protein chromatin interactions in CB3/NF E2 cells. Crosslinked chromatin was precipitated with IgG or antibodies against NF E2 (p45) USF1, or USF2 and DNA was a nalyzed as described in panel A. (D) Example of the extent of DNA fragmentation after sonication of crosslinked chromatin from MEL cells After sonication the DNA was electrophored in an a garose gel The resulting DNA fragments are generally between 100bp and 500bp.

PAGE 114

114 Figure 4 -8 Interaction of RNA Pol II with the LCR HS3/2 flanking region or the GAPDH 3 untranslated region ( UTR ) in MEL, CB3 and CB3/NF E2 cells (A B ) ChIP analysis of RNA Pol II interactions with the HS3/2 flanking region (HS3/2 flank) or the GAPDH 3 UTR in MEL and CB3 cells incubated wit h or without 1.5% DMSO for 1 or 3 days. Chromatin was isolated from crosslinked cells, fragmented by sonication, and immunoprecipitated with antibodies specific for the RNA Pol II CTD (Pol II/CTD), for unphosphorylated RNA Pol II (Pol II /P -) or for RNA Pol II phosphorylated at serine 5 (Pol II/S5P) or serine 2 (Pol II/S2P) of the CTD IgG or IgM antibod ies w ere used in these experiments as negative controls. DNA was isolated from the precipitates and subjected to qPCR with DNA primers specific for the LCR HS 3/ 2 flanking region or the GAPDH 3 UTR as indi cated. Error bars represent standard deviations from three independent experiments. (C) ChIP analysis of Pol II interactions with the LCR HS3/2 flanking region in CB3/NFE2 cells. Chromatin precipitation and DNA analysis by qPCR was per formed as described in panel s A and B. In A, indicate p values of <0.05 between DMSO induced versus uninduced samples; ** indicate p -values of <0.05 between specific antibody versus IgG.

PAGE 115

115 CHAPTER 5 CONCLUSIONS AND FUTU RE DIRECTIONS In vitro ES Cell Erythroid Differentiation Overview We have used an in vitro assay to induce murine ES cells to differentiate into the erythroid lineage and recapitulated the expression of -like globin genes in a developmental manner. By using this system, we ha ve observed that in the undifferentiated ES cells, there is no globin gene expression. The -globin genes are activated first as early as 5 days after differentiation and reaches their highest expression level at around Day 8. The adult m aj globin gene is first observed at low levels at Day 8 and then it is up-regulated upon the initiation of definitive erythropoiesis (Day 10 12). At the mean time, the expression of embryonic -globin genes decreased. These results suggest that the ES cell differentiation system we used is a powerful tool for investigating hematopoietic development and differentiation. However, from my data, it seems that the ES cells are not uniformly diffe rentiated, probably due to their different initial states. Thus the cells that I collected at each time point are a mixture of cells at different differentiation stages. Even though the RT-PCR results show that the majority of the cells are at the sam e developmental stage, it still need s to be concerned with the variation generated by the small population of cells that are in a different developmental stage. To eliminate this variation, one possibility is that we can use stem cell surface markers such as Oct4, Nanog and/or Sox2 to pre -sort the ES cells, followed by cell synchronization to arrest all the cells at the same stage before differentiation. However, due to the unique properties of ES cells, the effects of cell cycle arresting chemicals o n the ES cell pluripotency are still under investigation (329) It has been shown that nocodazole (a drug often used to arrest cells at G2/M phase) -s ynchronized mouse ES cells show specific downregulation of cyclin-dependent kinase

PAGE 116

116 (Cdk) 2, that establishes a somatic cell like cell cycle in mouse ES cells and induces expression of differentiation markers (330) Alternatively, the differentiated cells collected at each time point can be sorted based on their surface markers before subject to further analysis. CD117, ERY 1 and Ter 119 are the most widely used cell surface markers to identify erythroid cells at di fferent developmental stages. CD117 marks the most immature hematopoietic cells; ERY 1 is an intermediate mature marker; Ter 119 marks the mature erythroid cells (274) By sorting the cells with a combination of these three cell surface selection markers, we can obtain hematopoietic cells of the same developmental stage from our ES cells differentiation system. The Antagonistic Role of USF and TFII -G lobin Gene Regulation By using our ES cells differentiation assay, I observed that TFII -I is detectable at HS2 and the adult maj -globin gene promoter at Day 5, when embryonic -globin genes are expressed, while USF1 is found only at HS2 at this stage. At Day 8, USF1 interacts with both HS2 and the maj -globin gene promoter, while TFII I is no longer detectable at these regions. Previous studies in our laboratory have shown that, by overexpressing a dominant -negative form of USF (A-USF) or TFII I ( p70) in erythroid cells, USF activates and TFII -I represses adult -globin gene expression (269) The data presented here further suppor t this antagonistic regulatory role of USF and TFII I. However, even though the ES cell differentiation system has advantages over the erythroleukemia cell lines that are normally used for studying -globin gene regulation, it cannot accurately reflect the identities of erythroid cells that differentiate during mammalian development. Hence it would be important to investigate the functions of USF and TFII I during the differentiation and development of hematopoietic cells in animal models. Since USF or TFII I knockout mice are embryonic lethal, our laboratory proceeded to create USF knockdown mice by expressing the dominant -negative form of USF in the mice. By placing the A -USF cDNA

PAGE 117

117 under the control of the LCR and globin gene promoter and protecting them from position effects by a flanking pair of chicken HS4 insulators, these transgenes should be expressed exclusively in erythroid cells of the transgenic mice. Our laboratory has analyzed the A -USF transgenic mice and found that, although the heterozygous mice like ly have the transgene integrated into X chromaso me when subjected to hemolytic anemia induction by phenylhydrazine (PHZ), there is a decrease in adult maj -globin gene expression, accompanied by a reduction of RNA Pol II at the maj -globin gene promoter (317) The same strategy could be pursued to analyze the function of TFII I during erythroid development. For dominant negative TFII -I (p70) transgenic mice, we would expect to see effe cts on increased maj -globin gene expression levels early in erythroid development. Currently, no p70 transgenic mice have been generated. Recruitment of Histone Modification Enzymes to the -G lobin L ocus by TFII -I Covalent histone modifications, including methylation, acetylation, phosphorylation, ubiquitination, sumoylation and ADP ribosylation, take place at the long, flexible N terminal tails of the core histones. These modifications can alter chromatin structure by changing the histone DNA and histone histone contacts in order to create transcriptionally permissive or repressive chromatin environments around the genes (331) The enzymes that modify the histone tails are normally recruited to the gene by transcription factors. In this study, I investigated whether TFII I can recruit histone modifying enzymes to the globin gene locus. Previous studies have shown that TFII I interacts with HDAC3, a histone deacetyltransferase, which can remove acetyl groups from the lysine residues at the histone tails and promote chromatin condensation to aid in transcriptional repression (332) Here I show that TFII I also interacts with Suz12, a component of the PRC2 complex, in both embryonic and adult erythroid cells. The PRC2 complex contains another two main components, EED and the

PAGE 118

118 histone methyltransferase, EZH2. EZH2 preferentially methylates H3K27, and EED is required for this process (296,299) I o bserved that Suz12 and the repressive chromatin mark, H3K27me3, are detected at the silenced maj -globin gene promoter in vitro in Day 5 differentiated ES cells and that these associations disappear after 12 days of differentiation. To further prove that t he recruitment of Suz12 by TFII -I to the -globin locus does exert transcriptional repression, it would be essential to examine if EZH2 and EED are associated with the adult -globin gene promoter. Also, since the repressive function of PRC2 on gene transc ription is stabilized by recruitment of PRC1 to the H3K27 methylation site, it would be important to test if PRC1 is present at the -globin gene promoter. TFII I is composed of six direct reiterated I -repeats, R1 R6, with each of them consisting of a puta tive helix loop -helix (HLH) motif to interact with other proteins (262) Therefore it would be interesting to determine if TFII I interacts with both HDAC3 and Suz12 at the same time to exert strong repression, or if there is competition between HADC3 and Suz12. TFII I R5 and R6 domains are the transactivation domains. It has been reported that HDAC3 binds to the R3 and R4 domains of TFII -I (333) Therefore, it would be interesting to study if Suz12 binds to R3 and R4 as well or if it binds to other reiterated I repeats. This can be done by expressing recombinant TFII I mutants and Suz12 in E.coli and performing pull -down assays to see if they interact. The Cooperative Role of NF -E2 and USF -G lobin Gene Regulation In Vitro Transfer/Dissociation Assay From the in vitro transfer/dissociation assay, I show that NF E2 can dissociate RNA Pol II from the LCR in the presence of the wild type -globin gene, while a dominant negative form of USF (A -USF) can dissociate RNA Pol II f rom the LCR in the absence of the -globin gene. These results suggest that USF is required for the recruitment of RNA Pol II to the LCR, while

PAGE 119

119 NF E2 is essential for the transfer of RNA Pol II from the LCR to the -globin gene promoter. I also observed that NF E2 facilitated RNA Pol II transfer from the LCR to the -globin gene requires the presence of the +60 E box element at the promoter. Our laboratory's previous data show that, in the adult erythroid environment (MEL cells extract ) USF1 and USF2 bi nd to the +60 E -box element. Since NF -E2 is required for RNA Pol II transfer from the LCR to the globin promoter and NF -E2 interacts with USF, these data suggest that the transcription holocomplex including NF -E2, USF and RNA Pol II form on the LCR first and then USF binds to the +60 E -box at the -globin gene promoter. By directly interacting with NF E2, USF pulls NF E2 from the LCR to the globin gene promoter. Since NF -E2 also interacts with RNA Pol II, this process brings RNA Pol II to the globin promoter as well. This hypothesis is consistent with my ChIP and CoIP data shown in Chapter 4 in this thesis. It is also consistent with the results from a primer extension in vitro transcription experiment showing that the +60 E -box mutated globin ge ne is not transcribed. Due to the weak binding of NF -E2 to the MARE like sequence in the globin gene promoter, it is reasonable to speculate that other interactions may exist to stabilize NF E2 at the -globin promoter (103) To examine if USF1 can stabilize NF E2 at the -globin promoter thus to promote -globin gene expression, I could link a biotinylated wild -type or +60 E -box mutated -globin gene to the streptavidin beads and incubate the beads DNA construct with MEL nuclear extracts, then after removing unbound proteins, we can perform immunoblot analysis on the remaining bound proteins to detect NF -E2 and RNA Pol II. I would expect to see reduced NF E2 and RNA Pol II protein in the samples incubated with the +60 E -box mutated -globin gene. -G lobin Gene Regulation USF1 and USF2 can form homoor heterodimers to regulate gene expression. In transgenic mouse studies, USF1 knockout mice only show slight behavioral abnormalities, while

PAGE 120

120 USF2 knockout mice display obvious growth defects. It was shown that in USF1 knockout mice, there is an increased level of USF2, whereas in USF2 knockout mice, there is a reduced level of USF1 (234) These data suggest that the functions of USF1 and USF2 may not be completely redundant. Figure 3 4, 4 2, 4 4 (ChIP data from MEL/CB3 cells and ES differentiation, together with CoIP in MEL cells) and ChIP data show that USF2 and TFII I associate with adult globin gene promoter in embryonic stage K562 cells, whereas USF1 and USF2 associate with the same promoter in adult environment MEL cells (103) These data demonstrate that USF1 and USF2 may exhibit distinct functions in the regulation of the -globin locus. It is possible that USF1 functions as a globin gene activator, whereas USF2 functions as a dimerization partner which remains associated with the globin gene promoter during development. When the adult globin gene is activated, USF2 dimerizes with USF1 and binds to the +60 E -box of the -globin gene promoter; when the globin gene is silenced, USF2 dimerizes with TFII I and binds to the Inr/E-box of the promoter. In the undifferentiated mouse ES cells, we observe that USF2 is detectable at both LCR HS2 and the adul t maj globin gene promoter, which further supports our hypothesis that the function of USF2 is like p18/MafK, which can change its dimerization partners during development to repress or activate adult -globin gene NF -E2 p45 Knockout Mice vs. NF E2 p45 Null Murine Erythroid Cells From the studies utilizing NF E2 p45 null CB3 cells, NF -E2 p45 is thought to be required for -globin gene expression, recruitment of RNA Pol II to the globin promoter, and hyperacetylation of histones (49) However, NF E2 p45 deficient mice show normal erythropoiesis and express the -globin gene at ~70% of the levels observed in wild type mice (228) This difference was thought to be due to the presence of NF E2 related fa ctors (Nrfs), but in the NF E2 p45 knockout mice, although there is an increased binding of Nrf 2 at the LCR HS2, there is no change in the level of Nrf 2 association at the adult maj -globin gene promoter.

PAGE 121

121 Also, the association of p18/MafK is reduced at the LCR HS2 and almost lost at the maj -globin gene promoter. In addition, mice lacking both NF E2 p45 and Nrf 2 or Nrf -3 fail to display an erythroid defective phenotype more severe than NF E2 p45 knockout mice. The active chromatin hub (ACH) in NF -E2 p45 knockout mice still forms normally, which suggests that NF -E2 is not required for the ACH formation Therefore, further experiments such as generating NF E2/Nrf2/Nrf3 triple knockout mice n eed to be done to investigate whether functional compensation by Nr fs exists in the NF E2 knockout mice I suspect the striking differences between NF -E2 p45 null cells and null mice are due to failed ACH formation in CB3 cells which lack the endogenous NF E2. While it is known that GATA 1 and EKLF are required for ACH formation, the levels of GATA 1 and EKLF in CB3 cells are not altered as compared to wild type MEL cells. However, in the CB3 cells, the absence of NF E2 p45 causes the ~4 -fold reduction of GATA 1 associated to the maj -globin gene promoter and this reduction can be rescued by overexpressing NF -E 2 p45 in the CB3 cells (47) This observ ation leads us to suspect that the lack of NF E2 p45 in CB3 cells almost abolished GATA 1 binding at the maj -globin gene promoter. This may disrupt the ACH formation in CB3 cells, thus abolishing RNA Pol II association at the promoter due to the lack of N FE2 p45. In the NF E2 p45 knockout mice, RNA Pol II can still bind to the maj -globin gene promoter, which can be explained under the assumption that ACH formation is unperturbed in these mice. The transfer of RNA Pol II globin promoter may not necessarily require NF E2 p45. Perhaps some transcription factors which interact with RNA Pol II (such as USF) are automatically transferred from the LCR to the promoter together with RNA Pol II due to the higher affinities of the transcription factors to the promoter than to the LCR and the closeness between the LCR and the promoter. However, this cannot be achieved in CB3 cells because

PAGE 122

122 there is possibly no ACH formation. Thus the assistance of NF E2 is required for RNA Pol II loading to the promoter Th e difference is also possibly in part due to the somewhat artificial nature of CB3 cells, which are transformed cells that likely have very different expression profiles and chromatin structure. My data from the NF -E2 p45 transfected CB3 (CB3/NF -E2) cel ls are consistent with this hypothesis. I observe that, when overexpressing NF E2 p45 in CB3 cells, there is an increase of -globin gene expression ; although the level of expression is only 20% of that found in DMSO induced MEL cells. I also induced CB3/NF E2 cells with DMSO, however, -globin gene expression was not increased (data not shown) Thus we suspect that the low level expression of -globin gene expression in CB3/NF E2 cells is due to insufficient RNA Pol II loading onto the p romoter directly by NF E2 without the assistance of the LCR (since there is possibly no ACH in CB3 cells). My ChIP data show that there is no Serine 5 phosphorylated RNA Pol II associated with the LCR in CB3/NF E2 cells even when the globin gene is ex pressed, further confirming this hypothesis. Thus, I reason that the difference of -globin gene expression between NF E2 p45 null mice and CB3 cells could be related to the presence or absence of the ACH. Further experiments need to be performed to exam ine if the ACH exist in CB3 cells or not. It is possible that NF E2 p45 and USF are not required for the ACH formation, but they function in the context of the loop. However, the possible redundancy between NF -E2 and Nrfs cannot be ruled out. The Model of -G lobin Gene Expression Based on the previous and current data from our laboratory and others, we propose a model of LCR regulated globin gene expression as follows: Upon erythroid cell maturation, the LCR is relocated from within ina ccessible chromatin territories (CT) to the surface of these territories (309) which are enriched for transcription

PAGE 123

123 complexes in regions known as transcription factories (334) The association of the LCR with the transcription factories is mediated by USF and GATA 1, and synthesis of the unidirectional intergenic transcripts from the LCR t o the downstream globin gene (284) could reel the globin gene to the surface of CTs. If the LCR is fixed at the transcription factories, the globin gene promoter can be reeled to the LCR by continuous transcription of the inter vening intergenic region followed by association of the promoter with a transcription factory. Once the globin gene promoter is in close proximity to the LCR, GATA 1 and EKLF recruit the promoter to the LCR, while USF specifically binds to the +60 E-box of the promoter and loads NF E2, together with RNA Pol II, onto the promoter. At the beginning of this process, unphosphorylated RNA Pol II is present in the LCR. Upon the induction of erythroid maturation, NF E2 mediates RNA Pol II phosphorylation at t he LCR and helps to deliver this transcriptionally competent holocomplex from the LCR to the promoter with the assistance of USF, thus activating -globin gene expression.

PAGE 124

124 LIST OF REFERENCES 1. Stamatoyannopoulos G., N.A. (1994) Hemoglobin switching. The molecular basis of blood diseases. W. B. Saunders, Philadelphia, PA. 107155. 2. Weatherall, D.J. (2001) Phenotype -genotype relationships in monogenic disease: lessons from the thalassaemias. Na t Rev Genet 2 245255. 3. Angastiniotis, M. and Modell, B. (1998) Global epidemiology of hemoglobin disorders. Ann N Y Acad Sci 850, 251269. 4. Roth, E.F., Jr., Shear, H.L., Costantini, F., Tanowitz, H.B. and Nagel, R.L. (1988) Malaria in beta thalasse mic mice and the effects of the transgenic human beta -globin gene and splenectomy. J Lab Clin Med, 111, 35 41. 5. Weatherall, D.J., Clegg J. B. (2001) The thalassemia syndromes. Malden, Massachusetts: Blackwell Science. 6. Pauling, L., Itano, H.A. and et a l. (1949) Sickle cell anemia, a molecular disease. Science, 109, 443. 7. Steinberg, M.H., Forget, B.G., Higgs, D.R., Nagel, R.L. (2001) Disorders of hemoglobin: genetics, pathophysiology and clinical management. Cambridge: Cambridge University Press. 8. Ur binati, F., Madigan, C. and Malik, P. (2006) Pathophysiology and therapy for haemoglobinopathies. Part II: thalassaemias. Expert Rev Mol Med 8 1 26. 9. Weatherall, D.J., Clegg, J.B. (1981) The thalassemia syndrome. Oxford: Blackwell Scientific. 10. Cooley, T.B., Lee, P. (1925) A series of cases of splenomegaly in children with anemia and peculiar bone changes. Trans Am Pediatr Soc. 37, 29. 11. Jensen, C.E., Tuck, S.M., Agnew, J.E., Koneru, S., Morris, R.W., Yardumian, A., Prescott, E., Hoffbrand, A. V. and Wonke, B. (1998) High prevalence of low bone mass in thalassaemia major. Br J Haematol 103, 911915. 12. Otsuka, S., Maruyama, H. and Listowsky, I. (1981) Structure, assembly, conformation, and immunological properties of the two subunit classes of ferritin. Biochemistry 20, 52265232. 13. Gutteridge, J.M., Rowley, D.A. and Halliwell, B. (1981) Superoxide dependent formation of hydroxyl radicals in the presence of iron salts. Detection of 'free' iron in biological systems by using bleomycin -depende nt degradation of DNA. Biochem J 199, 263265.

PAGE 125

125 14. Bacon, B.R. and Britton, R.S. (1990) The pathology of hepatic iron overload: a free radical --mediated process? Hepatology 11, 127137. 15. Bonkovsky, H.L. (1991) Iron and the liver. Am J Med Sci 301, 3243. 16. Buja, L.M. and Roberts, W.C. (1971) Iron in the heart. Etiology and clinical significance. Am J Med 51, 209221. 17. Giardina, P.J. and Grady, R.W. (2001) Chelation therapy in beta thalassemia: an optimistic update. Semin Hematol 38, 360366. 18. Ley, T.J., Griffith, P. and Nienhuis, A.W. (1982) Transfusion haemosiderosis and chelation therapy. Clin Haematol 11, 437464. 19. Callender, S.T. and Weatherall, D.J. (1980) Iron chelation with oral desferrioxamine. Lancet 2 689. 20. Giardini, C. a nd Lucarelli, G. (1994) Bone marrow transplantation in the treatment of thalassemia. Curr Opin Hematol 1 170176. 21. Lucarelli, G., Clift, R.A., Galimberti, M., Angelucci, E., Giardini, C., Baronciani, D., Polchi, P., Andreani, M., Gaziev, D., Erer, B. et al. (1999) Bone marrow transplantation in adult thalassemic patients. Blood 93, 11641167. 22. Sadelain, M., Boulad, F., Galanello, R., Giardina, P., Locatelli, F., Maggio, A., Rivella, S., Riviere, I. and Tisdale, J. (2007) Therapeutic options for pat ients with severe beta thalassemia: the need for globin gene therapy. Hum Gene Ther, 18, 1 9. 23. Dzierzak, E.A., Papayannopoulou, T. and Mulligan, R.C. (1988) Lineage -specific expression of a human beta globin gene in murine bone marrow transplant recipie nts reconstituted with retrovirus transduced stem cells. Nature 331, 35 41. 24. Bender, M.A., Gelinas, R.E. and Miller, A.D. (1989) A majority of mice show longterm expression of a human beta globin gene after retrovirus transfer into hematopoietic stem cells. Mol Cell Biol 9 14261434. 25. Sadelain, M., Wang, C.H., Antoniou, M., Grosveld, F. and Mulligan, R.C. (1995) Generation of a hightiter retroviral vector capable of expressing high levels of the human beta globin gene. Proc Natl Acad Sci U S A 92 67286732. 26. May, C., Rivella, S., Callegari, J., Heller, G., Gaensler, K.M., Luzzatto, L. and Sadelain, M. (2000) Therapeutic haemoglobin synthesis in beta thalassaemic mice expressing lentivirus -encoded human beta -globin. Nature 406, 82 86. 27. Koh n, D.B., Sadelain, M. and Glorioso, J.C. (2003) Occurrence of leukaemia following gene therapy of X linked SCID. Nat Rev Cancer 3 477488.

PAGE 126

126 28. Emery, D.W., Yannaki, E., Tubb, J., Nishino, T., Li, Q. and Stamatoyannopoulos, G. (2002) Development of virus vectors for gene therapy of beta chain hemoglobinopathies: flanking with a chromatin insulator reduces gamma globin gene silencing in vivo. Blood 100, 20122019. 29. Pawliuk, R., Westerman, K.A., Fabry, M.E., Payen, E., Tighe, R., Bouhassira, E.E., Acharya, S.A., Ellis, J., London, I.M., Eaves, C.J. et al. (2001) Correction of sickle cell disease in transgenic mouse models by gene therapy. Science 294, 23682371. 30. Levasseur, D.N., Ryan, T.M., Pawlik, K.M. and Townes, T.M. (2003) Correction of a m ouse model of sickle cell disease: lentiviral/antisickling beta -globin gene transduction of unmobilized, purified hematopoietic stem cells. Blood 102, 43124319. 31. Puthenveetil, G., Scholes, J., Carbonell, D., Qureshi, N., Xia, P., Zeng, L., Li, S., Yu, Y., Hiti, A.L., Yee, J.K. et al. (2004) Successful correction of the human beta thalassemia major phenotype using a lentiviral vector. Blood 104, 34453453. 32. -globin gene thera py for betathalassemia. Ann N Y Acad Sci. 1054, 308316. 33. Bollekens, J.A. and Forget, B.G. (1991) Delta beta thalassemia and hereditary persistence of fetal hemoglobin. Hematol Oncol Clin North Am 5 399422. 34. Platt, O.S., Orkin, S.H., Dover, G., B eardsley, G.P., Miller, B. and Nathan, D.G. (1984) Hydroxyurea increases fetal hemoglobin production in sickle cell anemia. Trans Assoc Am Physicians 97, 268274. 35. Charache, S., Dover, G.J., Moore, R.D., Eckert, S., Ballas, S.K., Koshy, M., Milner, P.F ., Orringer, E.P., Phillips, G., Jr., Platt, O.S. et al. (1992) Hydroxyurea: effects on hemoglobin F production in patients with sickle cell anemia. Blood 79, 25552565. 36. Charache, S., Terrin, M.L., Moore, R.D., Dover, G.J., Barton, F.B., Eckert, S.V., McMahon, R.P. and Bonds, D.R. (1995) Effect of hydroxyurea on the frequency of painful crises in sickle cell anemia. Investigators of the Multicenter Study of Hydroxyurea in Sickle Cell Anemia. N Engl J Med 332, 13171322. 37. Platt, O.S. (2008) Hydroxyurea for the treatment of sickle cell anemia. N Engl J Med 358, 13621369. 38. Ley, T.J., DeSimone, J., Anagnou, N.P., Keller, G.H., Humphries, R.K., Turner, P.H., Young, N.S., Keller, P. and Nienhuis, A.W. (1982) 5 azacytidine s electively increases gamma -globin synthesis in a patient with beta+ thalassemia. N Engl J Med 307, 14691475. 39. Torrealba de Ron, A.T., Papayannopoulou, T., Knapp, M.S., Fu, M.F., Knitter, G. and Stamatoyannopoulos, G. (1984) Perturbations in the erythr oid marrow progenitor cell pools may play a role in the augmentation of HbF by 5 azacytidine. Blood 63 201210.

PAGE 127

127 40. Carr, B.I., Rahbar, S., Asmeron, Y., Riggs, A. and Winberg, C.D. (1988) Carcinogenicity and haemoglobin synthesis induction by cytidine analogues. Br J Cancer 57, 395402. 41. Perrine, S.P., Greene, M.F. and Faller, D.V. (1985) Delay in the fetal globin switch in infants of diabetic mothers. N Engl J Med 312, 334338. 42. Perrine, S.P., Ginder, G.D., Faller, D.V., Dover, G.H., Ikuta, T., Witkowska, H.E., Cai, S.P., Vichinsky, E.P. and Olivieri, N.F. (1993) A short term trial of butyrate to stimulate fetal -globin -gene expression in the beta globin disorders. N Engl J Med 328 81 86. 43. Sealy, L. and Chalkley, R. (1978) The effect of sodium butyrate on histone modification. Cell, 14, 115121. 44. Hardison, R., Slightom, J.L., Gumucio, D.L., Goodman, M., Stojanovic, N. and Miller, W. (1997) Locus control regions of mammalian beta globin gene clusters: combining phylogenetic analyses and experimental results to gain functional insights. Gene 205, 73 94. 45. Forrester, W.C., Epner, E., Driscoll, M.C., Enver, T., Brice, M., Papayannopoulou, T. and Groudine, M. (1990) A deletion of the human beta -globin locus activation region causes a major alteration in chromatin structure and replication across the entire beta globin locus. Genes Dev 4 16371649. 46. Stamatoyannopoulos, G.G., F. (2001) Hemoglobin switching. In: Molecular Basi s of Blood Disorders, 3rd edn. (ed. by G. Stamatoyannopoulos, P.W. Majerus, R.M. Perlmutter & H. Varmus) pp135182. WB Saunders, Philadelphia, PA. 47. Johnson, K.D., Grass, J.A., Boyer, M.E., Kiekhaefer, C.M., Blobel, G.A., Weiss, M.J. and Bresnick, E.H. (2002) Cooperative activities of hematopoietic regulators recruit RNA polymerase II to a tissue -specific chromatin domain. Proc Natl Acad Sci U S A 99, 1176011765. 48. Horak, C.E., Mahajan, M.C., Luscombe, N.M., Gerstein, M., Weissman, S.M. and Snyder, M (2002) GATA 1 binding sites mapped in the beta globin locus by using mammalian chIp -chip analysis. Proc Natl Acad Sci U S A 99, 29242929. 49. Johnson, K.D., Christensen, H.M., Zhao, B. and Bresnick, E.H. (2001) Distinct mechanisms control RNA polymeras e II recruitment to a tissue -specific locus control region and a downstream promoter. Mol Cell 8 465471. 50. Elnitski, L., Miller, W. and Hardison, R. (1997) Conserved E boxes function as part of the enhancer in hypersensitive site 2 of the beta -globin locus control region. Role of basic helix loop -helix proteins. J Biol Chem 272, 369378. 51. Bieker, J.J. and Southwood, C.M. (1995) The erythroid Kruppel -like factor transactivation domain is a critical component for cell -specific inducibility of a beta globin promoter. Mol Cell Biol, 15, 852 860.

PAGE 128

128 52. Brand, M., Ranish, J.A., Kummer, N.T., Hamilton, J., Igarashi, K., Francastel, C., Chi, T.H., Crabtree, G.R., Aebersold, R. and Groudine, M. (2004) Dynamic changes in transcription factor complexes during er ythroid differentiation revealed by quantitative proteomics. Nat Struct Mol Biol, 11, 73 80. 53. Leach, K.M., Nightingale, K., Igarashi, K., Levings, P.P., Engel, J.D., Becker, P.B. and Bungert, J. (2001) Reconstitution of human beta -globin locus control r egion hypersensitive sites in the absence of chromatin assembly. Mol Cell Biol 21, 26292640. 54. Mahajan, M.C., Narlikar, G.J., Boyapaty, G., Kingston, R.E. and Weissman, S.M. (2005) Heterogeneous nuclear ribonucleoprotein C1/C2, MeCP1, and SWI/SNF form a chromatin remodeling complex at the beta globin locus control region. Proc Natl Acad Sci U S A 102, 1501215017. 55. Vieira, K.F., Levings, P.P., Hill, M.A., Crusselle, V.J., Kang, S.H., Engel, J.D. and Bungert, J. (2004) Recruitment of transcription complexes to the beta globin gene locus in vivo and in vitro. J Biol Chem 279, 5035050357. 56. Letting, D.L., Rakowski, C., Weiss, M.J. and Blobel, G.A. (2003) Formation of a tissue specific histone acetylation pattern by the hematopoietic transcription factor GATA 1. Mol Cell Biol, 23, 13341340. 57. Schubeler, D., Groudine, M. and Bender, M.A. (2001) The murine beta globi n locus control region regulates the rate of transcription but not the hyperacetylation of histones at the active genes. Proc Natl Acad Sci U S A 98, 1143211437. 58. Epner, E., Reik, A., Cimbora, D., Telling, A., Bender, M.A., Fiering, S., Enver, T., Mar tin, D.I., Kennedy, M., Keller, G. et al. (1998) The beta -globin LCR is not necessary for an open chromatin structure or developmentally regulated transcription of the native mouse beta -globin locus. Mol Cell, 2 447455. 59. Bender, M.A., Reik, A., Close, J., Telling, A., Epner, E., Fiering, S., Hardison, R. and Groudine, M. (1998) Description and targeted deletion of 5' hypersensitive site 5 and 6 of the mouse beta -globin locus control region. Blood 92, 43944403. 60. Grosveld, F., van Assendelft, G.B., Greaves, D.R. and Kollias, G. (1987) Positionindependent, high level expression of the human beta globin gene in transgenic mice. Cell, 51, 975985. 61. Tanimoto, K., Liu, Q., Bungert, J. and Engel, J.D. (1999) Effects of altered gene order or orientation of the locus control region on human beta -globin gene expression in mice. Nature 398, 344348. 62. Enver, T., Ebens, A.J., Forrester, W.C. and Stamatoyannopoulos, G. (1989) The human beta globin locus activation region alters the developmental fate of a human fetal globin gene in transgenic mice. Proc Natl Acad Sci U S A 86, 70337037.

PAGE 129

129 63. Grosveld, F., Antoniou, M., Berry, M., De Boer, E., Dillon, N., Ellis, J., Fraser, P., Hanscombe, O., Hurst, J., Imam, A. et al. (1993) The regulation of human globin gene switching. Philos Trans R Soc Lond B Biol Sci 339, 183191. 64. West, A.G., Huang, S., Gaszner, M., Litt, M.D. and Felsenfeld, G. (2004) Recruitment of histone modifications by USF proteins at a vertebrate barrier element. Mol Cell, 16, 453463. 65. Pikaart, M.J., Recillas Targa, F. and Felsenfeld, G. (1998) Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators. Genes Dev 12, 28522862. 66. Chung, J.H., Whiteley, M. and Felsenfeld, G. (1993) A 5' element of the chicken beta globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila. Cell 74, 505514. 67. Bungert, J., Tanimoto, K., Patel, S., Liu, Q., Fear, M. and Engel, J.D. (1999) Hypersensitive site 2 specifies a unique function within the human beta globin locus control region to stimulate globin gene transcription. Mol Cell Biol 19, 30623072. 68. Navas, P.A., Peterson, K.R., Li, Q., Skarpidi, E., Rohde, A., Shaw, S.E., Clegg, C.H., Asano, H. and Stamatoyannopoulos, G. (1998) Developmental specificity of the interaction between the locus control region and embryonic or fetal globin genes in transgen ic mice with an HS3 core deletion. Mol Cell Biol, 18, 41884196. 69. Fraser, P. and Grosveld, F. (1998) Locus control regions, chromatin activation and transcription. Curr Opin Cell Biol, 10, 361365. 70. Fedosyuk, H. and Peterson, K.R. (2007) Deletion of the human beta -globin LCR 5'HS4 or 5'HS1 differentially affects beta -like globin gene expression in beta YAC transgenic mice. Blood Cells Mol Dis 39, 44 55. 71. Bungert, J., Dave, U., Lim, K.C., Lieuw, K.H., Shavit, J.A., Liu, Q. and Engel, J.D. (1995) Sy nergistic regulation of human beta globin gene switching by locus control region elements HS3 and HS4. Genes Dev 9 30833096. 72. Navas, P.A., Peterson, K.R., Li, Q., McArthur, M. and Stamatoyannopoulos, G. (2001) The 5'HS4 core element of the human beta globin locus control region is required for high -level globin gene expression in definitive but not in primitive erythropoiesis. J Mol Biol, 312, 17 26. 73. Schubeler, D., Francastel, C., Cimbora, D.M., Reik, A., Martin, D.I. and Groudine, M. (2000) Nucle ar localization and histone acetylation: a pathway for chromatin opening and transcriptional activation of the human beta -globin locus. Genes Dev 14, 940950. 74. Fraser, P., Pruzina, S., Antoniou, M. and Grosveld, F. (1993) Each hypersensitive site of th e human beta globin locus control region confers a different developmental pattern of expression on the globin genes. Genes Dev 7 106113.

PAGE 130

130 75. Sawado, T., Halow, J., Bender, M.A. and Groudine, M. (2003) The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation. Genes Dev 17, 10091018. 76. Bender, M.A., Bulger, M., Close, J. and Groudine, M. (2000) Beta globin gene switching and DNase I sensitivity of the endogenous beta globin locus in mice do not require the locus control region. Mol Cell, 5 387393. 77. Ashe, H.L., Monks, J., Wijgerde, M., Fraser, P. and Proudfoot, N.J. (1997) Intergenic transcription and transinduction of the human beta -globin locus. Genes Dev 11, 24942509. 78. Routledge, S.J. and Proudfoot, N.J. (2002) Definition of transcriptional promoters in the human beta globin locus control region. J Mol Biol 323, 601611. 79. Gribnau, J., Diderich, K., Pruzina, S., Calzolari, R. and Fraser, P. (2000) Intergenic tr anscription and developmental remodeling of chromatin subdomains in the human beta globin locus. Mol Cell 5 377386. 80. Wobbe, C.R. and Struhl, K. (1990) Yeast and human TATA -binding proteins have nearly identical DNA sequence requirements for transcrip tion in vitro. Mol Cell Biol, 10, 38593867. 81. Nienhuis, A.W., Anagnou, N.P. and Ley, T.J. (1984) Advances in thalassemia research. Blood 63, 738758. 82. Dierks, P., van Ooyen, A., Cochran, M.D., Dobkin, C., Reiser, J. and Weissmann, C. (1983) Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit beta globin gene in mouse 3T6 cells. Cell 32, 695706. 8 3. Cowie, A. and Myers, R.M. (1988) DNA sequences involved in transcriptional regulation of the mouse beta -globin promoter in murine erythroleukemia cells. Mol Cell Biol, 8 31223128. 84. Antoniou, M. and Grosveld, F. (1990) beta -globin dominant control r egion interacts differently with distal and proximal promoter elements. Genes Dev 4 1007-1013. 85. Stewart, J.J. and Stargell, L.A. (2001) The stability of the TFIIA -TBPDNA complex is dependent on the sequence of the TATAAA element. J Biol Chem 276, 30 07830084. 86. Miller, I.J. and Bieker, J.J. (1993) A novel, erythroid cell -specific murine transcription factor that binds to the CACCC element and is related to the Kruppel family of nuclear proteins. Mol Cell Biol, 13, 27762786. 87. deBoer, E., Antoniou, M., Mignotte, V., Wall, L. and Grosveld, F. (1988) The human beta globin promoter; nuclear protein factors and erythroid specific induction of transcription. Embo J 7 42034212.

PAGE 131

131 88. Delvoye, N.L., Destroismaisons, N.M. and Wall, L.A. (1993) Activation of the beta globin promoter by the locus control region correlates with binding of a novel factor to the CAAT box in murine erythroleukemia cells but not in K562 cells. Mol Cell Biol 13, 69696983. 89. Wall, L., Destroismaisons, N., Delvoye, N. and Guy, L.G. (1996) CAAT/enhancer binding proteins are involved in beta globin gene expression and are differentially expressed in murine erythroleukemia and K562 cells. J Biol Chem 271, 1647716484. 90. Zafarana, G., Rottier, R., Grosveld, F. and Philipsen, S. ( 2000) Erythroid overexpression of C/EBPgamma in transgenic mice affects gamma -globin expression and fetal liver erythropoiesis. Embo J 19, 58565863. 91. Gordon, C.T., Fox, V.J., Najdovska, S. and Perkins, A.C. (2005) C/EBPdelta and C/EBPgamma bind the CC AAT box in the human beta -globin promoter and modulate the activity of the CACC -box binding protein, EKLF. Biochim Biophys Acta 1729, 74 80. 92. Pevny, L., Simon, M.C., Robertson, E., Klein, W.H., Tsai, S.F., D'Agati, V., Orkin, S.H. and Costantini, F. (1 991) Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA 1. Nature 349, 257260. 93. Sinha, S., Maity, S.N., Lu, J. and de Crombrugghe, B. (1995) Recombinant rat CBF -C, the third subunit of CBF/NFY, allows formation of a protein DNA complex with CBF -A and CBF -B and with yeast HAP2 and HAP3. Proc Natl Acad Sci U S A 92, 16241628. 94. Lewi s, B.A. and Orkin, S.H. (1995) A functional initiator element in the human beta globin promoter. J Biol Chem 270, 2813928144. 95. Roy, A.L., Meisterernst, M., Pognonec, P. and Roeder, R.G. (1991) Cooperative interaction of an initiator -binding transcript ion initiation factor and the helix loop -helix activator USF. Nature 354, 245248. 96. Li, Y., Flanagan, P.M., Tschochner, H. and Kornberg, R.D. (1994) RNA polymerase II initiation factor interactions and transcription start site selection. Science 263, 805807. 97. Smale, S.T. and Baltimore, D. (1989) The "initiator" as a transcription control element. Cell, 57, 103113. 98. Zenzie Gregory, B., O'Shea Greenfield, A. and Smale, S.T. (1992) Similar mechanisms for transcription initiation mediated through a TATA box or an initiator element. J Biol Chem 267, 28232830. 99. Lewis, B.A., Kim, T.K. and Orkin, S.H. (2000) A downstream element in the human beta globin promoter: evidence of extended sequence -specific transcription factor IID contacts. Proc Natl Ac ad Sci U S A 97, 71727177.

PAGE 132

132 100. Seto, E., Shi, Y. and Shenk, T. (1991) YY1 is an initiator sequence -binding protein that directs and activates transcription in vitro. Nature 354, 241245. 101. Roy, A.L., Malik, S., Meisterernst, M. and Roeder, R.G. (199 3) An alternative pathway for transcription initiation involving TFII -I. Nature 365, 355359. 102. Weis, L. and Reinberg, D. (1992) Transcription by RNA polymerase II: initiator -directed formation of transcription -competent complexes. Faseb J 6 33003309. 103. Leach, K.M., Vieira, K.F., Kang, S.H., Aslanian, A., Teichmann, M., Roeder, R.G. and Bungert, J. (2003) Characterization of the human beta -globin downstream promoter region. Nucleic Acids Res 31, 12921301. 104. Kang, S.H., Vieira, K. and Bungert, J. (2002) Combining chromatin immunoprecipitation and DNA footprinting: a novel method to analyze protein -DNA interactions in vivo. Nucleic Acids Res 30, e44. 105. Donovan -Peluso, M., Acuto, S., O'Neill, D., Hom, A., Maggio, A. and Bank, A. (1991) The beta globin 3' enhancer element confers regulated expression on the human gamma globin gene in the human embryonic -fetal erythroleukemia cell line K562. Blood, 77, 855860. 106. Trudel, M. and Costantini, F. (1987) A 3' enhancer contributes to the stage -spec ific expression of the human beta globin gene. Genes Dev 1 954961. 107. Wall, L., deBoer, E. and Grosveld, F. (1988) The human beta -globin gene 3' enhancer contains multiple binding sites for an erythroid-specific protein. Genes Dev 2 10891100. 108. Stamatoyannopoulos G, G.F. (2001) Hemoglobin switching. In: Stamatoyannopoulos G, Perlmutter R, Majerus W, Varmus H (eds) The Molecular Basis of Blood Diseases. Saunders, Philadelphia, pp135165. 109. Wheatherall D, C.J. (1981) The Thalassemia Syndromes. O xford, UK Blackwell Scientific 110. Feingold, E.A. and Forget, B.G. (1989) The breakpoint of a large deletion causing hereditary persistence of fetal hemoglobin occurs within an erythroid DNA domain remote from the beta globin gene cluster. Blood, 74, 21782186. 111. Stamatoyannopoulos, G. (2005) Control of globin gene expression during development and erythroid differentiation. Exp Hematol 33, 259271. 112. Kingsley, P.D., Malik, J., Emerson, R.L., Bushnell, T.P., McGrath, K.E., Bloedorn, L.A., Bulger M. and Palis, J. (2006) "Maturational" globin switching in primary primitive erythroid cells. Blood 107, 16651672.

PAGE 133

133 113. Gaensler, K.M., Kitamura, M. and Kan, Y.W. (1993) Germ-line transmission and developmental regulation of a 150kb yeast artificial c hromosome containing the human beta globin locus in transgenic mice. Proc Natl Acad Sci U S A 90, 1138111385. 114. Behringer, R.R., Ryan, T.M., Palmiter, R.D., Brinster, R.L. and Townes, T.M. (1990) Human gamma to beta globin gene switching in transgeni c mice. Genes Dev 4 380389. 115. Enver, T., Raich, N., Ebens, A.J., Papayannopoulou, T., Costantini, F. and Stamatoyannopoulos, G. (1990) Developmental regulation of human fetal to adult globin gene switching in transgenic mice. Nature 344, 309313. 116. Raich, N., Enver, T., Nakamoto, B., Josephson, B., Papayannopoulou, T. and Stamatoyannopoulos, G. (1990) Autonomous developmental control of human embryonic globin gene switching in transgenic mice. Science 250, 11471149. 117. Raich, N., Papayannopoul ou, T., Stamatoyannopoulos, G. and Enver, T. (1992) Demonstration of a human epsilon-globin gene silencer with studies in transgenic mice. Blood 79, 861864. 118. Li, Q., Blau, C.A., Clegg, C.H., Rohde, A. and Stamatoyannopoulos, G. (1998) Multiple epsilo n-promoter elements participate in the developmental control of epsilon globin genes in transgenic mice. J Biol Chem 273, 1736117367. 119. Raich, N., Clegg, C.H., Grofti, J., Romeo, P.H. and Stamatoyannopoulos, G. (1995) GATA1 and YY1 are developmental r epressors of the human epsilon globin gene. Embo J 14, 801809. 120. Filipe, A., Li, Q., Deveaux, S., Godin, I., Romeo, P.H., Stamatoyannopoulos, G. and Mignotte, V. (1999) Regulation of embryonic/fetal globin genes by nuclear hormone receptors: a novel p erspective on hemoglobin switching. Embo J 18, 687697. 121. Tanabe, O., Katsuoka, F., Campbell, A.D., Song, W., Yamamoto, M., Tanimoto, K. and Engel, J.D. (2002) An embryonic/fetal beta type globin gene repressor contains a nuclear receptor TR2/TR4 heterodimer. Embo J 21, 34343442. 122. Tanimoto, K., Liu, Q., Gro sveld, F., Bungert, J. and Engel, J.D. (2000) Context dependent EKLF responsiveness defines the developmental specificity of the human epsilon -globin gene in erythroid cells of YAC transgenic mice. Genes Dev 14, 27782794. 123. Dillon, N. and Grosveld, F. (1991) Human gamma -globin genes silenced independently of other genes in the beta -globin locus. Nature 350, 252254. 124. Stamatoyannopoulos, G., Josephson, B., Zhang, J.W. and Li, Q. (1993) Developmental regulation of human gamma globin genes in transgenic mice. Mol Cell Biol, 13, 76367644.

PAGE 134

134 125. Harju, S., Navas, P.A., Stamatoyannopoulos, G. and Peterson, K.R. (2003) Role of gamma -globin gene silencing and chromatin sub-domain in globin gene switching. Blood Cells Mol Dis 331, 145146. 126. Luo, H.Y., Mang, D., Patrinos, G.P. et al. (2004) A mutation in a GATA 1 binding Site 5' -globin gene (nt 567, T>G) may be as sociated with increased levels of fetal hemoglobin. Blood (ASH Annual Meeting Abstracts) 104, Abstract 500. 127. Li, Q., Fang, X., Han, H. and Stamatoyannopoulos, G. (2004) The minimal promoter plays a major role in silencing of the galago gamma -globin ge ne in adult erythropoiesis. Proc Natl Acad Sci U S A 101, 80968101. 128. Asano, H. and Stamatoyannopoulos, G. (1998) Activation of beta -globin promoter by erythroid Kruppel like factor. Mol Cell Biol, 18, 102109. 129. Donze, D., Townes, T.M. and Bieker, J.J. (1995) Role of erythroid Kruppel -like factor in human gamma to beta -globin gene switching. J Biol Chem 270, 19551959. 130. Bieker, J.J. (1996) Isolation, genomic structure, and expression of human erythroid Kruppel -like factor (EKLF). DNA Cell Bio l 15, 347352. 131. Perkins, A.C., Sharpe, A.H. and Orkin, S.H. (1995) Lethal beta -thalassaemia in mice lacking the erythroid CACCC transcription factor EKLF. Nature 375, 318-322. 132. Asano, H., Li, X.S. and Stamatoyannopoulos, G. (1999) FKLF, a novel K ruppel -like factor that activates human embryonic and fetal beta like globin genes. Mol Cell Biol 19, 35713579. 133. Asano, H., Li, X.S. and Stamatoyannopoulos, G. (2000) FKLF 2: a novel Kruppel like transcriptional factor that activates globin and other erythroid lineage genes. Blood 95, 35783584. 134. Emery, D.W., Gavriilidis, G., Asano, H. and Stamatoyannopoulos, G. (2007) The transcription factor KLF11 can induce gamma -globin gene expression in the setting of in vivo adult erythropoiesis. J Cell Bio chem 100, 10451055. 135. Song, C.Z., Gavriilidis, G., Asano, H. and Stamatoyannopoulos, G. (2005) Functional study of transcription factor KLF11 by targeted gene inactivation. Blood Cells Mol Dis 34, 53 59. 136. Zhou, M., McPherson, L., Feng, D., Song, A., Dong, C., Lyu, S.C., Zhou, L., Shi, X., Ahn, Y.T., Wang, D. et al. (2007) Kruppel -like transcription factor 13 regulates T lymphocyte survival in vivo. J Immunol 178, 54965504. 137. Ristaldi, M.S., Drabek, D., Gribnau, J., Poddie, D., Yannoutsous, N., Cao, A., Grosveld, F. and Imam, A.M. (2001) The role of the 50 region of the human gamma -globin gene in switching. Embo J 20, 52425249.

PAGE 135

135 138. Zhou, W., Clouston, D.R., Wang, X., Cerrut i, L., Cunningham, J.M. and Jane, S.M. (2000) Induction of human fetal globin gene expression by a novel erythroid factor, NF E4. Mol Cell Biol, 20, 76627672. 139. Ramamurthy, L., Barbour, V., Tuckfield, A., Clouston, D.R., Topham, D., Cunningham, J.M. an d Jane, S.M. (2001) Targeted disruption of the CP2 gene, a member of the NTF family of transcription factors. J Biol Chem 276, 78367842. 140. Ritchie, H.H., Wang, L.H., Tsai, S., O'Malley, B.W. and Tsai, M.J. (1990) COUP TF gene: a structure unique for t he steroid/thyroid receptor superfamily. Nucleic Acids Res 18, 68576862. 141. Ronchi, A., Berry, M., Raguz, S., Imam, A., Yannoutsos, N., Ottolenghi, S., Grosveld, F. and Dillon, N. (1996) Role of the duplicated CCAAT box region in gamma -globin gene regu lation and hereditary persistence of fetal haemoglobin. Embo J 15, 143-149. 142. Ottolenghi, S., Mantovani, R., Nicolis, S., Ronchi, A. and Giglioni, B. (1989) DNA sequences regulating human globin gene transcription in nondeletional hereditary persistenc e of fetal hemoglobin. Hemoglobin, 13, 523541. 143. Vitale, M., Di Marzo, R., Calzolari, R., Acuto, S., O'Neill, D., Bank, A. and Maggio, A. (1994) Evidence for a globin promoter -specific silencer element located upstream of the human delta -globin gene. B iochem Biophys Res Commun, 204, 413418. 144. Acuto, S., Urzi, G., Schimmenti, S., Maggio, A., O'Neill, D. and Bank, A. (1996) An element upstream from the human delta -globin encoding gene specifically enhances beta globin reporter gene expression in murine erythroleukemia cells. Gene 168, 237241. 145. O'Neill, D., Yang, J., Erdjument Bromage, H., Bornschlegel, K., Tempst, P. and Bank, A. (1999) Tissue -specific and developmental stage -specific DNA binding by a mammalian SWI/SNF complex associated with hum an fetal to adult globin gene switching. Proc Natl Acad Sci U S A 96, 349354. 146. O'Neill, D., Bornschlegel, K., Flamm, M., Castle, M. and Bank, A. (1991) A DNA binding factor in adult hematopoietic cells interacts with a pyrimidine rich domain upstream from the human delta globin gene. Proc Natl Acad Sci U S A 88, 89538957. 147. Georgopoulos, K. (1997) Transcription factors required for lymphoid lineage commitment. Curr Opin Immunol 9 222227. 148. Carter, D., Chakalova, L., Osborne, C.S., Dai, Y.F. and Fraser, P. (2002) Long-range chromatin regulatory interactions in vivo. Nat Genet 32, 623 626. 149. Palstra, R.J., Tolhuis, B., Splinter, E., Nijmeijer, R., Grosveld, F. and de Laat, W. (2003) The beta globin nuclear compartment in development and erythroid differentiation. Nat Genet 35, 190194.

PAGE 136

136 150. Travers, A. (1999) Chromatin modification by DNA tra cking. Proc Natl Acad Sci U S A 96, 1363413637. 151. Dorsett, D. (1999) Distant liaisons: long range enhancer promoter interactions in Drosophila. Curr Opin Genet Dev 9 505 514. 152. Bulger, M. and Groudine, M. (1999) Looping versus linking: toward a model for longdistance gene activation. Genes Dev 13, 24652477. 153. Blackwood, E.M. and Kadonaga, J.T. (1998) Going the distance: a current view of enhancer action. Science, 281, 60 63. 154. Patrinos, G.P., de Krom, M., de Boer, E., Langeveld, A., Imam, A.M., Strouboulis, J., de Laat, W. and Grosveld, F.G. (2004) Multiple interactions between regulatory regions are required to stabilize an active chromatin hub. Genes Dev 18, 14951509. 155. Splinter, E., Heath, H., Kooren, J., Palstra, R.J., Klous, P., Grosveld, F., Galjart, N. and de Laat, W. (2006) CTCF mediates long range chromatin looping and local histone modification in the beta globin locus. Genes Dev 20, 23492354. 156. Drissen R., Palstra, R.J., Gillemans, N., Splinter, E., Grosveld, F., Philipsen, S. and de Laat, W. (2004) The active spatial organization of the beta -globin locus requires the transcription factor EKLF. Genes Dev 18, 24852490. 157. Vakoc, C.R., Letting, D.L., Gheldof, N., Sawado, T., Bender, M.A., Groudine, M., Weiss, M.J., Dekker, J. and Blobel, G.A. (2005) Proximity among distant regulatory elements at the beta globin locus requires GATA 1 and FOG 1. Mol Cell 17 453462. 158. Dahmus, M.E. (1994) The role of multisite phosphorylation in the regulation of RNA polymerase II activity. Prog Nucleic Acid Res Mol Biol, 48, 143179. 159. Hampsey, M. and Reinberg, D. (2003) Tails of intrigue: phosphorylation of RNA polymerase II mediates histone methylation. Cell 1 13, 429432. 160. Maniatis, T. and Reed, R. (2002) An extensive network of coupling among gene expression machines. Nature 416, 499506. 161. Dahmus, M.E. (1996) Reversible phosphorylation of the C terminal domain of RNA polymerase II. J Biol Chem 271, 1 900919012. 162. Conaway, R.C. and Conaway, J.W. (1993) General initiation factors for RNA polymerase II. Annu Rev Biochem 62, 161190. 163. Zawel, L. and Reinberg, D. (1995) Common themes in assembly and function of eukaryotic transcription complexes. An nu Rev Biochem 64, 533561. 164. Akoulitchev, S., Makela, T.P., Weinberg, R.A. and Reinberg, D. (1995) Requirement for TFIIH kinase activity in transcription by RNA polymerase II. Nature 377, 557560.

PAGE 137

137 165. Rodriguez, C.R., Cho, E.J., Keogh, M.C., Moore, C.L., Greenleaf, A.L. and Buratowski, S. (2000) Kin28, the TFIIH associated carboxy -terminal domain kinase, facilitates the recruitment of mRNA processing machinery to RNA polymerase II. Mol Cell Biol 20, 104112. 166. Orphanides, G. and Reinberg, D. (2002) A unified theory of gene expression. Cell 108, 439451. 167. Sawadogo, M. and Sentenac, A. (1990) RNA polymerase B (II) and general transcription factors. Annu Rev Biochem 59, 711754. 168. Li, J., Moaze d, D. and Gygi, S.P. (2002) Association of the histone methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. J Biol Chem 277, 4938349388. 169. Li, B., Howe, L., Anderson, S., Yates, J.R., 3rd and Workman, J.L. (2003) The Set2 histone methyltransferase functions through the phosphorylated carboxyl terminal domain of RNA polymerase II. J Biol Chem 278, 88978903. 170. Krogan, N.J., Kim, M., Tong, A., Golshani, A., Cagney, G., Canadien, V., Richards, D.P., Beattie, B.K., Em ili, A., Boone, C. et al. (2003) Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Mol Cell Biol 23, 42074218. 171. Chambers, R.S. and Dahmus, M.E. (1994) Purification and characte rization of a phosphatase from HeLa cells which dephosphorylates the C terminal domain of RNA polymerase II. J Biol Chem 269, 2624326248. 172. Chambers, R.S., Wang, B.Q., Burton, Z.F. and Dahmus, M.E. (1995) The activity of COOH terminal domain phosphata se is regulated by a docking site on RNA polymerase II and by the general transcription factors IIF and IIB. J Biol Chem 270, 1496214969. 173. Ko, L.J. and Engel, J.D. (1993) DNA -binding specificities of the GATA transcription factor family. Mol Cell Bio l 13, 40114022. 174. Martin, D.I., Zon, L.I., Mutter, G. and Orkin, S.H. (1990) Expression of an erythroid transcription factor in megakaryocytic and mast cell lineages. Nature 344, 444 447. 175. Merika, M. and Orkin, S.H. (1993) DNA -binding specificity of GATA family transcription factors. Mol Cell Biol, 13, 39994010. 176. Yamamoto, M., Ko, L.J., Leonard, M.W., Beug, H., Orkin, S.H. and Engel, J.D. (1990) Activity and tissue -specific expression of the transcription factor NF -E1 multigene family. Genes Dev 4 16501662. 177. Whyatt, D.J., deBoer, E. and Grosveld, F. (1993) The two zinc finger like domains of GATA 1 have different DNA binding specificities. Embo J 12, 49935005.

PAGE 138

138 178. Fujiwara, Y., Browne, C.P., Cunniff, K., Goff, S.C. and Orkin, S.H. (1996) Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA 1. Proc Natl Acad Sci U S A 93, 1235512358. 179. Lee, E.Y., Chang, C.Y., Hu, N., Wang, Y.C., Lai, C.C., Herrup, K., Lee, W.H. and Bradley, A. (1992) Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature 359, 288294. 180. Martin, D.I. and Orkin, S.H. (1990) Transcriptional activation and DNA binding by the erythroid factor GF 1/NF E1/Eryf 1. Genes Dev 4 18861898. 181. Ponka, P. (1997) Tissue -specific regulation of iron metabolism and heme synthesis: distinct control mechanisms in erythroid cells. Blood 89, 1 25. 182. Zon, L.I., Mathe r, C., Burgess, S., Bolce, M.E., Harland, R.M. and Orkin, S.H. (1991) Expression of GATA -binding proteins during embryonic development in Xenopus laevis. Proc Natl Acad Sci U S A 88, 1064210646. 183. Ito, E., Toki, T., Ishihara, H., Ohtani, H., Gu, L., Y okoyama, M., Engel, J.D. and Yamamoto, M. (1993) Erythroid transcription factor GATA 1 is abundantly transcribed in mouse testis. Nature 362, 466468. 184. Partington, G.A. and Patient, R.K. (1999) Phosphorylation of GATA 1 increases its DNA-binding affin ity and is correlated with induction of human K562 erythroleukaemia cells. Nucleic Acids Res 27, 11681175. 185. Warren, A.J., Colledge, W.H., Carlton, M.B., Evans, M.J., Smith, A.J. and Rabbitts, T.H. (1994) The oncogenic cysteine rich LIM domain protein rbtn2 is essential for erythroid development. Cell 78, 45 57. 186. Weiss, M.J., Keller, G. and Orkin, S.H. (1994) Novel insights into erythroid development revealed through in vitro differentiation of GATA 1 embryonic stem cells. Genes Dev 8 11841197. 187. Marin, M., Karis, A., Visser, P., Grosveld, F. and Philipsen, S. (1997) Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiation. Cell 89, 619628. 188. Fox, A.H., Kowalski, K., King, G.F., Mackay, J.P. and Crossley, M. (1998) Key residues characteristic of GATA N -fingers are recognized by FOG. J Biol Chem 273, 3359533603. 189. Gregory, R.C., Taxman, D.J., Seshasayee, D., Kensinger, M.H., Bieker, J.J. and Wojchowski, D.M. (1996) Functional interaction of GATA1 with erythroid Kruppel -like factor and Sp1 at defined erythroid promoters. Blood 87, 17931801. 190. Lipinski, M.M. and Jacks, T. (1999) The retinoblastoma gene family in differentiation and development. Oncogene 18, 78737882.

PAGE 139

139 191. Tsai, S.F., Strauss, E. and Orkin, S.H. (1991) Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA 1 as a positive regulator of its own promoter. Genes Dev 5 919931. 192. Tsai, S.F., Martin, D.I., Zon, L.I., D'Andrea, A.D., Wong, G.G. and Orkin, S.H. (1989) Cloning of cDNA for the major DNA binding protein of the erythroid lineage through expression in mammalian cells. Nature 339, 446451. 193. Fox, A.H., Liew, C., Holmes, M., Kowalski, K., Mackay, J. and Crossley, M. (1999) Transcriptional cofactors of the FOG family interact with GATA proteins by means of multiple zinc fingers. Embo J 18, 28122822. 194. Weiss, M.J. and Orkin, S.H. (1995) Transcription factor GATA 1 perm its survival and maturation of erythroid precursors by preventing apoptosis. Proc Natl Acad Sci U S A 92, 96239627. 195. Crossley, M., Merika, M. and Orkin, S.H. (1995) Self association of the erythroid transcription factor GATA 1 mediated by its zinc fi nger domains. Mol Cell Biol, 15, 24482456. 196. Hung, H.L., Lau, J., Kim, A.Y., Weiss, M.J. and Blobel, G.A. (1999) CREB Binding protein acetylates hematopoietic transcription factor GATA 1 at functionally important sites. Mol Cell Biol 19, 34963505. 197. Boyes, J., Byfield, P., Nakatani, Y. and Ogryzko, V. (1998) Regulation of activity of the transcription factor GATA 1 by acetylation. Nature 396, 594598. 198. Barrett, D.M., Gustafson, K.S., Wang, J., Wang, S.Z. and Ginder, G.D. (2004) A GATA factor m ediates cell type restricted induction of HLA E gene transcription by gamma interferon. Mol Cell Biol, 24, 61946204. 199. Blobel, G.A., Nakajima, T., Eckner, R., Montminy, M. and Orkin, S.H. (1998) CREB binding protein cooperates with transcription factor GATA 1 and is required for erythroid differentiation. Proc Natl Acad Sci U S A 95, 20612066. 200. Crossley, M. and Orkin, S.H. (1994) Phosphorylation of the erythroid transcription factor GATA 1. J Biol Chem 269, 1658916596. 201. Collavin, L., Gostiss a, M., Avolio, F., Secco, P., Ronchi, A., Santoro, C. and Del Sal, G. (2004) Modification of the erythroid transcription factor GATA 1 by SUMO 1. Proc Natl Acad Sci U S A 101, 88708875. 202. Osada, H., Grutz, G., Axelson, H., Forster, A. and Rabbitts, T.H. (1995) Association of erythroid transcription factors: complexes involving the LIM protein RBTN2 and the zinc -finger protein GATA1. Proc Natl Acad Sci U S A 92, 95859589.

PAGE 140

140 203. Wadman, I., Li, J., Bash, R.O., Forster, A., Osada, H., Rabbitts, T.H. and Baer, R. (1994) Specific in vivo association between the bHLH and LIM proteins implicated in human T cell leukemia. Embo J 13, 48314839. 204. Evans, T., Reitman, M. and Felsenfeld, G. (1988) An erythrocyte -specific DNA -binding factor recognizes a regulat ory sequence common to all chicken globin genes. Proc Natl Acad Sci U S A 85, 59765980. 205. Weiss, M.J., Yu, C. and Orkin, S.H. (1997) Erythroid -cell -specific properties of transcription factor GATA 1 revealed by phenotypic rescue of a gene -targeted cell line. Mol Cell Biol, 17, 16421651. 206. Pevny, L., Lin, C.S., D'Agati, V., Simon, M.C., Orki n, S.H. and Costantini, F. (1995) Development of hematopoietic cells lacking transcription factor GATA 1. Development 121, 163172. 207. Shimizu, R., Takahashi, S., Ohneda, K., Engel, J.D. and Yamamoto, M. (2001) In vivo requirements for GATA 1 functional domains during primitive and definitive erythropoiesis. Embo J 20, 52505260. 208. Whyatt, D., Lindeboom, F., Karis, A., Ferreira, R., Milot, E., Hendriks, R., de Bruijn, M., Langeveld, A., Gribnau, J., Grosveld, F. et al. (2000) An intrinsic but cell no nautonomous defect in GATA -1overexpressing mouse erythroid cells. Nature 406, 519524. 209. Kulessa, H., Frampton, J. and Graf, T. (1995) GATA1 reprograms avian myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts. Genes Dev 9 12501262. 210. Hirasawa, R., Shimizu, R., Takahashi, S., Osawa, M., Takayanagi, S., Kato, Y., Onodera, M., Minegishi, N., Yamamoto, M., Fukao, K. et al. (2002) Essential and instructive roles of GATA factors in eosinophil development. J Exp Med 195, 13791386. 211. Chiba, T., Nagata, Y., Kishi, A., Sakamaki, K., Miyajima, A., Yamamoto, M., Engel, J.D. and Todokoro, K. (1993) Induction of erythroid-specific gene expression in lymphoid cells. Proc Natl Acad Sci U S A 90, 1159311597. 212. Lacombe, C. and M ayeux, P. (1999) The molecular biology of erythropoietin. Nephrol Dial Transplant 14 Suppl 2 22 28. 213. Gregory, T., Yu, C., Ma, A., Orkin, S.H., Blobel, G.A. and Weiss, M.J. (1999) GATA 1 and erythropoietin cooperate to promote erythroid cell survival by regulating bcl xL expression. Blood 94, 87 96. 214. Kotkow, K.J. and Orkin, S.H. (1995) Dependence of globin gene expression in mouse erythroleukemia cells on the NF -E2 heterodimer. Mol Cell Biol, 15, 46404647.

PAGE 141

141 215. Andrews, N.C., Erdjument -Bromage, H ., Davidson, M.B., Tempst, P. and Orkin, S.H. (1993) Erythroid transcription factor NF E2 is a haematopoietic -specific basic leucine zipper protein. Nature 362, 722728. 216. Andrews, N.C., Kotkow, K.J., Ney, P.A., Erdjument Bromage, H., Tempst, P. and Or kin, S.H. (1993) The ubiquitous subunit of erythroid transcription factor NF -E2 is a small basic -leucine zipper protein related to the v -maf oncogene. Proc Natl Acad Sci U S A 90, 1148811492. 217. Blank, V. and Andrews, N.C. (1997) The Maf transcription factors: regulators of differentiation. Trends Biochem Sci 22, 437441. 218. Stamatoyannopoulos, J.A., Goodwin, A., Joyce, T. and Lowrey, C.H. (1995) NF E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta globin locus control region. Embo J 14, 106116. 219. Pomerantz, O., G oodwin, A.J., Joyce, T. and Lowrey, C.H. (1998) Conserved elements containing NF E2 and tandem GATA binding sites are required for erythroid -specific chromatin structure reorganization within the human beta -globin locus control region. Nucleic Acids Res 26 56845691. 220. Forsberg, E.C., Downs, K.M. and Bresnick, E.H. (2000) Direct interaction of NF E2 with hypersensitive site 2 of the beta -globin locus control region in living cells. Blood, 96, 334339. 221. Caterina, J.J., Ryan, T.M., Pawlik, K.M., Palm iter, R.D., Brinster, R.L., Behringer, R.R. and Townes, T.M. (1991) Human beta -globin locus control region: analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice. Proc Natl Acad Sci U S A 88, 16261630. 222. Talbot, D., Philipsen, S., Fra ser, P. and Grosveld, F. (1990) Detailed analysis of the site 3 region of the human beta -globin dominant control region. Embo J 9 21692177. 223. Ley, T.J., Hug, B., Fiering, S., Epner, E., Bender, M.A. and Groudine, M. (1998) Reduced beta globin gene expression in adult mice containing deletions of locus control region 5' HS 2 or 5' HS 3. Ann N Y Acad Sci 850, 45 53. 224. Fiering, S., Epner, E., Robinson, K., Zhuang, Y., Telling, A., Hu, M., Martin, D.I., Enver, T., Ley, T.J. and Groudine, M. (1995) Tar geted deletion of 5'HS2 of the murine beta globin LCR reveals that it is not essential for proper regulation of the beta globin locus. Genes Dev 9 22032213. 225. Cheng, X., Reginato, M.J., Andrews, N.C. and Lazar, M.A. (1997) The transcriptional integra tor CREB -binding protein mediates positive cross talk between nuclear hormone receptors and the hematopoietic bZip protein p45/NF E2. Mol Cell Biol 17, 14071416. 226. Amrolia, P.J., Ramamurthy, L., Saluja, D., Tanese, N., Jane, S.M. and Cunningham, J.M. (1997) The activation domain of the enhancer binding protein p45NF E2 interacts with

PAGE 142

142 TAFII130 and mediates longrange activation of the alpha and beta -globin gene loci in an erythroid cell line. Proc Natl Acad Sci U S A 94, 1005110056. 227. Shivdasani, R.A., Rosenblatt, M.F., Zucker Franklin, D., Jackson, C.W., Hunt, P., Saris, C.J. and Orkin, S.H. (1995) Transcription factor NF -E2 is required for platelet formation independent of the actions of thrombopoietin/MGDF in megakaryocyte development. Cell, 81, 695704. 228. Kooren, J., Palstra, R.J., Klous, P., Splinter, E., von Lindern, M., Grosveld, F. and de Laat, W. (2007) Beta -globin active chromatin Hub formation in differentiating erythroid cells and in p45 NF E2 knock -out mice. J Biol Chem 282, 16544-1 6552. 229. Lu, S.J., Rowan, S., Bani, M.R. and Ben David, Y. (1994) Retroviral integration within the Fli 2 locus results in inactivation of the erythroid transcription factor NF E2 in Friend erythroleukemias: evidence that NF E2 is essential for globin ex pression. Proc Natl Acad Sci U S A 91, 83988402. 230. Kotkow, K.J. and Orkin, S.H. (1996) Complexity of the erythroid transcription factor NF E2 as revealed by gene targeting of the mouse p18 NF E2 locus. Proc Natl Acad Sci U S A 93, 35143518. 231. Nue z, B., Michalovich, D., Bygrave, A., Ploemacher, R. and Grosveld, F. (1995) Defective haematopoiesis in fetal liver resulting from inactivation of the EKLF gene. Nature 375, 316318. 232. Perkins, A.C., Gaensler, K.M. and Orkin, S.H. (1996) Silencing of human fetal globin expression is impaired in the absence of the adult beta -globin gene activator protein EKLF. Proc Natl Acad Sci U S A 93, 1226712271. 233. Armstrong, J.A., Bieker, J.J. and Emerson, B.M. (1998) A SWI/SNF -related chromatin remodeling complex, E RC1, is required for tissue -specific transcriptional regulation by EKLF in vitro. Cell, 95, 93 104. 234. Corre, S. and Galibert, M.D. (2005) Upstream s timulating factors: highly versatile stress responsive transcription factors. Pigment Cell Res 18, 337348. 235. Sha, M., Ferre D'Amare, A.R., Burley, S.K. and Goss, D.J. (1995) Anti -cooperative biphasic equilibrium binding of transcription factor upstrea m stimulatory factor to its cognate DNA monitored by protein fluorescence changes. J Biol Chem 270, 1932519329. 236. Groenen, P.M., Garcia, E., Debeer, P., Devriendt, K., Fryns, J.P. and Van de Ven, W.J. (1996) Structure, sequence, and chromosome 19 loca lization of human USF2 and its rearrangement in a patient with multicystic renal dysplasia. Genomics, 38, 141148. 237. Luo, X. and Sawadogo, M. (1996) Functional domains of the transcription factor USF2: atypical nuclear localization signals and context -d ependent transcriptional activation domains. Mol Cell Biol, 16, 13671375.

PAGE 143

143 238. Qyang, Y., Luo, X., Lu, T., Ismail, P.M., Krylov, D., Vinson, C. and Sawadogo, M. (1999) Cell type -dependent activity of the ubiquitous transcription factor USF in cellular pro liferation and transcriptional activation. Mol Cell Biol, 19, 15081517. 239. Ferre D'Amare, A.R., Pognonec, P., Roeder, R.G. and Burley, S.K. (1994) Structure and function of the b/HLH/Z domain of USF. Embo J 13, 180189. 240. Andrews, G.K., Lee, D.K., Ravindra, R., Lichtlen, P., Sirito, M., Sawadogo, M. and Schaffner, W. (2001) The transcription factors MTF 1 and USF1 cooperate to regulate mouse metallothioneinI expression in response to the essential metal zinc in visceral endoderm cells during early development. Embo J 20, 11141122. 241. Ge, Y., Jensen, T.L., Matherly, L.H. and Taub, J.W. (2003) Physical and functional interactions between USF and Sp1 proteins regulate human deoxycytidine kinase promoter activity. J Biol Chem 278, 4990149910. 242. Liu, M., Whetstine, J.R., Payton, S.G., Ge, Y., Flatley, R.M. and Matherly, L.H. (2004) Roles of USF, Ikaros and Sp proteins in the transcriptional regulation of the human reduced folate carrier B promoter. Biochem J 383, 249257. 243. Huang, S., Li, X., Yusufzai, T.M., Qiu, Y. and Felsenfeld, G. (2007) USF1 recruits histone modification complexes and is critical for maintenance of a chromatin barrier. Mol Cell Biol, 27, 79918002. 244. Han, S.Y., Kim, J.C., Suh, J.M. and Chung, I.K. (2001) Cell type -depen dent regulation of human DNA topoisomerase III alpha gene expression by upstream stimulatory factor 2. FEBS Lett, 505, 57 62. 245. Bungert, J., Kober, I., During, F. and Seifart, K.H. (1992) Transcription factor eUSF is an essential component of isolated transcription complexes on the duck histone H5 gene and it mediates the interaction of TFIID with a TATA deficient promoter. J Mol B iol, 223, 885898. 246. Chiang, C.M. and Roeder, R.G. (1995) Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators. Science 267, 531536. 247. Meisterernst, M., Horikoshi, M. and Roeder, R.G. (1990) Recombinant yeast TFIID, a general transcription factor, mediates activation by the gene -specific factor USF in a chromatin assembly assay. Proc Natl Acad Sci U S A 87, 91539157. 248. Sawadogo, M. and Roeder, R.G. (1985) Interaction of a gene -specific transcriptio n factor with the adenovirus major late promoter upstream of the TATA box region. Cell, 43, 165175. 249. Sawadogo, M. (1988) Multiple forms of the human gene -specific transcription factor USF. II. DNA binding properties and transcriptional activity of the purified HeLa USF. J Biol Chem 263, 1199412001.

PAGE 144

144 250. Du, H., Roy, A.L. and Roeder, R.G. (1993) Human transcription factor USF stimulates transcription through the initiator elements of the HIV 1 and the Ad-ML promoters. Embo J 12, 501511. 251. Gregor, P.D., Sawadogo, M. and Roeder, R.G. (1990) The adenovirus major late transcription factor USF is a member of the helix -loophelix group of regulatory proteins and binds to DNA as a dimer. Genes Dev 4 17301740. 252. Sirito, M., Walker, S., Lin, Q., Kozl owski, M.T., Klein, W.H. and Sawadogo, M. (1992) Members of the USF family of helixloop -helix proteins bind DNA as homo as well as heterodimers. Gene Expr 2 231240. 253. Sirito, M., Lin, Q., Maity, T. and Sawadogo, M. (1994) Ubiquitous expression of t he 43 and 44 kDa forms of transcription factor USF in mammalian cells. Nucleic Acids Res 22, 427433. 254. Viollet, B., Lefrancois -Martinez, A.M., Henrion, A., Kahn, A., Raymondjean, M. and Martinez, A. (1996) Immunochemical characterization and transact ing properties of upstream stimulatory factor isoforms. J Biol Chem 271, 14051415. 255. Kirschbaum, B.J., Pognonec, P. and Roeder, R.G. (1992) Definition of the transcriptional activation domain of recombinant 43kilodalton USF. Mol Cell Biol 12, 5094-5 101. 256. Sirito, M., Lin, Q., Deng, J.M., Behringer, R.R. and Sawadogo, M. (1998) Overlapping roles and asymmetrical cross regulation of the USF proteins in mice. Proc Natl Acad Sci U S A 95, 37583763. 257. Casado, M., Vallet, V.S., Kahn, A. and Vaulont S. (1999) Essential role in vivo of upstream stimulatory factors for a normal dietary response of the fatty acid synthase gene in the liver. J Biol Chem 274, 20092013. 258. Roy, A.L., Carruthers, C., Gutjahr, T. and Roeder, R.G. (1993) Direct role for Myc in transcription initiation mediated by interactions with TFII I. Nature 365, 359361. 259. Novina, C.D., Cheriyath, V. and Roy, A.L. (1998) Regulation of TFII I activity by phosphorylation. J Biol Chem 273, 3344333448. 260. Yang, W. and Desiderio, S. (1997) BAP 135, a target for Bruton's tyrosine kinase in response to B cell receptor engagement. Proc Natl Acad Sci U S A 94, 604-609. 261. Cheriyath, V., Novina, C.D. and Roy, A.L. (1998) TFII I regulates Vbeta promoter activity through an initiator element. Mol Cell Biol, 18, 44444454. 262. Roy, A.L., Du, H., Gregor, P.D., Novina, C.D., Martinez, E. and Roeder, R.G. (1997) Cloning of an inr and E -box -binding protein, TFII -I, that interacts physically and functionally with USF1. Embo J 16, 70917104.

PAGE 145

145 263. Cheriyath, V. and Roy, A.L. (2000) Alternatively spliced isoforms of TFII I. Complex formation, nuclear translocation, and differential gene regulation. J Biol Chem 275, 2630026308. 264. Wang, Y.K., Perez Jurado, L.A. and Francke, U. (1998) A mouse single-copy gene, Gtf2i, the homolog of human GTF2I, that is duplicated in the Williams Beuren syndrome deletion region. Genomics, 48, 163170. 265. Perez Jurado, L.A., Wang, Y.K., Peoples, R., Coloma, A., Cruces, J. and Francke, U. (1998) A duplicated gene in the breakpoint regions of the 7q11.23 Williams Beuren syndrome deletion encodes the initiator binding protein TFII I and BAP 135, a phosp horylation target of BTK. Hum Mol Genet 7 325334. 266. Parker, R., Phan, T., Baumeister, P., Roy, B., Cheriyath, V., Roy, A.L. and Lee, A.S. (2001) Identification of TFII I as the endoplasmic reticulum stress response element binding factor ERSF: its autoregulation by stress and interaction with ATF6. Mol Cell Biol, 21, 32203233. 267. Novina, C.D., Kumar, S., Bajpai, U., Cheriyath, V., Zhang, K., Pillai, S., Wortis, H.H. and Roy, A.L. (1999) Regulation of nuclear localization and transcriptional activit y of TFII I by Bruton's tyrosine kinase. Mol Cell Biol, 19, 50145024. 268. Montano, M.A., Kripke, K., Norina, C.D., Achacoso, P., Herzenberg, L.A., Roy, A.L. and Nolan, G.P. (1996) NF kappa B homodimer binding within the HIV 1 initiator region and interactions with TFII -I. Proc Natl Acad Sci U S A 93, 1237612381. 269. CrusselleDavis, V.J., Vieira, K.F., Zhou, Z., Anantharaman, A. and Bungert, J. (2006) Antagonistic regulation of beta globin gene expression by helixloop -helix proteins USF and TFII I. Mo l Cell Biol, 26, 68326843. 270. Bank, A., O'Neill, D., Lopez, R., Pulte, D., Ward, M., Mantha, S. and Richardson, C. (2005) Role of intergenic human gamma -delta -globin sequences in human hemoglobin switching and reactivation of fetal hemoglobin in adult e rythroid cells. Ann N Y Acad Sci 1054, 48 54. 271. Mahajan, M.C. and Weissman, S.M. (2002) DNA dependent adenosine triphosphatase (helicaselike transcription factor) activates beta -globin transcription in K562 cells. Blood, 99, 348356. 272. Farrell, C.M. West, A.G. and Felsenfeld, G. (2002) Conserved CTCF insulator elements flank the mouse and human beta -globin loci. Mol Cell Biol, 22, 38203831. 273. Kosak, S.T. and Groudine, M. (2004) Form follows function: The genomic organization of cellular differentiation. Genes Dev 18, 13711384. 274. Ragoczy, T., Bender, M.A., Telling, A., Byron, R. and Groudine, M. (2006) The locus control region is required f or association of the murine beta -globin locus with engaged transcription factories during erythroid maturation. Genes Dev 20, 14471457.

PAGE 146

146 275. Hung, H.L., Kim, A.Y., Hong, W., Rakowski, C. and Blobel, G.A. (2001) Stimulation of NF E2 DNA binding by CREB -b inding protein (CBP) -mediated acetylation. J Biol Chem 276, 1071510721. 276. Chaturvedi, C.P., Hosey, A.M., Palii, C., Perez Iratxeta, C., Nakatani, Y., Ranish, J.A., Dilworth, F.J. and Brand, M. (2009) Dual role for the methyltransferase G9a in the main tenance of beta -globin gene transcription in adult erythroid cells. Proc Natl Acad Sci U S A 106, 1830318308. 277. Demers, C., Chaturvedi, C.P., Ranish, J.A., Juban, G., Lai, P., Morle, F., Aebersold, R., Dilworth, F.J., Groudine, M. and Brand, M. (2007) Activator -mediated recruitment of the MLL2 methyltransferase complex to the beta globin locus. Mol Cell 27, 573 584. 278. Caraveo, G., van Rossum, D.B., Patterson, R.L., Snyder, S.H. and Desiderio, S. (2006) Action of TFII I outside the nucleus as an inh ibitor of agonist induced calcium entry. Science 314 122125. 279. Kitajima, K., Tanaka, M., Zheng, J., Sakai Ogawa, E. and Nakano, T. (2003) In vitro differentiation of mouse embryonic stem cells to hematopoietic cells on an OP9 stromal cell monolayer. Methods Enzymol 365, 72 83. 280. Levings, P.P., Zhou, Z., Vieira, K.F., Crusselle Davis, V.J. and Bungert, J. (2006) Recruitment of transcription complexes to the beta globin locus control region and transcription of hypersensitive site 3 prior to erythro id differentiation of murine embryonic stem cells. Febs J 273, 746755. 281. Chomczynski, P. and Sacchi, N. (1987) Single -step method of RNA isolation by acid guanidinium thiocyanate -phenol -chloroform extraction. Anal Biochem 162, 156159. 282. CrusselleDavis, V.J., Zhou, Z., Anantharaman, A., Moghimi, B., Dodev, T., Huang, S. and Bungert, J. (2007) Recruitment of coregulator complexes to the beta -globin gene locus by TFII -I and upstream stimulatory factor. Febs J 274, 60656073. 283. Usheva, A., Maldonado, E., Goldring, A., Lu, H., Houbavi, C., Reinberg, D. and Aloni, Y. (1992) Specific interaction between the nonphosphorylated form of RNA polymerase II and the TATA -binding protein. Cell, 69, 871 881. 284. Tuan, D., Kong, S. and Hu, K. (1992) Transcription of the hypersensitive site HS2 enhancer in erythroid cells. Proc Natl Acad Sci U S A 89, 1121911223. 285. Johnson, K.D., Grass, J.A., Park, C., Im, H., Choi, K. and Bresnick, E.H. (2003) Highly restricted localization of RNA polymerase II within a lo cus control region of a tissue specific chromatin domain. Mol Cell Biol, 23, 64846493. 286. Kouzarides, T. (2007) Chromatin modifications and their function. Cell 128, 693705. 287. Strahl, B.D. and Allis, C.D. (2000) The language of covalent histone modifications. Nature 403, 41 45.

PAGE 147

147 288. Thomson, J.A., Itskovitz Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S. and Jones, J.M. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282, 11451147. 289. Stojkovic, M., Lako, M., Stojkovic, P., Stewart, R., Przyborski, S., Armstrong, L., Evans, J., Herbert, M., Hyslop, L., Ahmad, S. et al. (2004) Derivation of human embryonic stem cells from day 8 blastocysts recovered after three -step in vitro culture. Stem Cells 22, 790797. 290. Strelchenko, N., Verlinsky, O., Kukharenko, V. and Verlinsky, Y. (2004) Morula derived human embryonic stem c ells. Reprod Biomed Online 9 623629. 291. Evans, M.J. and Kaufman, M.H. (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154156. 292. Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P ., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G. et al. (2005) Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947956. 293. Meshorer, E. and Misteli, T. (2006) Chromatin in pluripotent embryonic stem cells and differentiation. Nat Rev Mol Cell Biol, 7 540 546. 294. Arney, K.L. and Fisher, A.G. (2004) Epigenetic aspects of differentiation. J Cell Sci 117, 43554363. 295. Ringrose, L. and Paro, R. (2004) Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu Rev Genet 38, 413443. 296. Kuzmichev, A., Nishioka, K., Erdjument Bromage, H., Tempst, P. and Reinberg, D. (2002) Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev 16, 28932905. 297. Muller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E. and Simon, J.A. (2002) Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell, 111, 197208. 298. Cao, R., Wang, L., Wang, H., Xia, L., Erdjument -Bromage, H., Tempst, P., Jones, R.S. and Zhang, Y. (2002) Role of histone H3 lysine 27 methylation in Polycombgroup silencing. Science 298, 10391043. 299. Kirmizis, A., Bartley, S.M., Kuzmichev, A., Margueron, R., Reinberg, D., Green, R. and Farnham, P.J. (2004) Silencing of human polycomb target genes is associated with methylation of histone H3 Lys 27. Genes Dev 18, 15921605. 300. Lee, T.I., Jenner, R.G., Boyer, L.A., Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B., Johnstone, S.E., Cole, M.F., Isono, K. et al. (2006) Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301313.

PAGE 148

148 301. Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A. and Pirrotta, V. (2002) Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell, 111, 185196. 302. Zhou, W., Zhu, P., Wang, J., Pascual, G., Ohgi, K .A., Lozach, J., Glass, C.K. and Rosenfeld, M.G. (2008) Histone H2A monoubiquitination represses transcription by inhibiting RNA polymerase II transcriptional elongation. Mol Cell, 29, 69 80. 303. Bantignies, F. and Cavalli, G. (2006) Cellular memory and dynamic regulation of polycomb group proteins. Curr Opin Cell Biol 18, 275283. 304. Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wernig, M., Tajonar, A., Ray, M.K. et al. (2006) Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349-353. 305. Kodama, H., Nose, M., Niida, S., Nishikawa, S. and Nishikawa, S. (1994) Involvement of the c kit receptor in the adhesion of hematopoietic stem cells to stromal cells. Exp Hematol 22, 979984. 306. Heinrich, P.C., Behrmann, I., Haan, S., Hermanns, H.M., Muller Newen, G. and Schaper, F. (2003) Principles of interleukin (IL) -6-type cytokine signalling and its regulation. Biochem J 374, 1 20. 307. Armstrong, L., Lako, M., De an, W. and Stojkovic, M. (2006) Epigenetic modification is central to genome reprogramming in somatic cell nuclear transfer. Stem Cells 24, 805814. 308. Morgan, H.D., Santos, F., Green, K., Dean, W. and Reik, W. (2005) Epigenetic reprogramming in mammals Hum Mol Genet 14 Spec No 1, R47 58. 309. Ragoczy, T., Telling, A., Sawado, T., Groudine, M. and Kosak, S.T. (2003) A genetic analysis of chromosome territory looping: diverse roles for distal regulatory elements. Chromosome Res, 11, 513525. 310. Collis P., Antoniou, M. and Grosveld, F. (1990) Definition of the minimal requirements within the human beta -globin gene and the dominant control region for high level expression. Embo J 9 233240. 311. Ryan, T.M., Behringer, R.R., Martin, N.C., Townes, T.M., Palmiter, R.D. and Brinster, R.L. (1989) A single erythroid-specific DNase I super -hypersensitive site activates high levels of human beta globin gene expression in transgenic mice. Genes Dev 3 314323. 312. Bresnick, E.H. and Tze, L. (1997) Synergism between hypersensitive sites confers longrange gene activation by the beta globin locus control region. Proc Natl Acad Sci U S A 94, 45664571. 313. Jackson, J.D., Petrykowska, H., Philipsen, S., Miller, W. and Hardison, R. (1996) Role of DNA sequences outside the cores of DNase hypersensitive sites (HSs) in functions of the

PAGE 149

149 beta globin locus control region. Domain opening and synergism between HS2 and HS3. J Biol Chem 271, 1187111878. 314. Efstratiadis, A., P osakony, J.W., Maniatis, T., Lawn, R.M., O'Connell, C., Spritz, R.A., DeRiel, J.K., Forget, B.G., Weissman, S.M., Slightom, J.L. et al. (1980) The structure and evolution of the human beta -globin gene family. Cell 21, 653668. 315. Blank, V., Kim, M.J. an d Andrews, N.C. (1997) Human MafG is a functional partner for p45 NF E2 in activating globin gene expression. Blood 89, 39253935. 316. Wijgerde, M., Gribnau, J., Trimborn, T., Nuez, B., Philipsen, S., Grosveld, F. and Fraser, P. (1996) The role of EKLF in human beta -globin gene competition. Genes Dev 10, 28942902. 317. Liang, S.Y., Moghimi, B., Crusselle Davis, V.J., Lin, I.J., Rosenberg, M.H., Li, X., Strouboulis, J., Huang, S. and Bungert, J. (2009) Defective erythropoiesis in transgenic mice expressing dominant -negative upstream stimulatory factor. Mol Cell Biol, 29, 59005910. 318. Sawado, T., Igarashi, K. and Groudine, M. (2001) Activation of beta -major globin gene transcription is associated with recruitment of NF E2 to the beta -globin LCR and gene promoter. Proc Natl Acad Sci U S A 98, 1022610231. 319. Sims, R.J., 3rd, Belotserkovskaya, R. and Reinberg, D. (2004) Elongation by RNA polymerase II: the short and long of it. Genes Dev 18, 24372468. 320. Lin, I.J., Zhou, Z., Crusselle -D avis, V.J., Moghimi, B., Gandhi, K., Anantharaman, A., Pantic, D., Huang, S., Jayandharan, G., Zhong, L. et al. (2009) Calpeptin increases the activity of upstream stimulatory factor and induces high level globin gene expression in erythroid cells. J Biol Chem 284, 2013020135. 321. Miles, J., Mitchell, J.A., Chakalova, L., Goyenechea, B., Osborne, C.S., O'Neill, L., Tanimoto, K., Engel, J.D. and Fraser, P. (2007) Intergenic transcription, cell -cycle and the developmentally regulated epigenetic profile of the human beta -globin locus. PLoS One 2 e630. 322. Bottardi, S., Aumont, A., Grosveld, F. and Milot, E. (2003) Developmental stage -specific epigenetic control of human beta globin gene expression is potentiated in hematopoietic progenitor cells prior to their transcriptional activation. Blood 102, 39893997. 323. Bottardi, S., Ross, J., Pierre -Charles, N., Blank, V. and Milot, E. (2006) Lineage -specific activators affect beta globin locus chromatin in multipotent hematopoietic progenitors. Embo J 25, 35 863595. 324. Levings, P.P. and Bungert, J. (2002) The human beta -globin locus control region. Eur J Biochem 269, 15891599.

PAGE 150

150 325. Nagai, T., Igarashi, K., Akasaka, J., Furuyama, K., Fujita, H., Hayashi, N., Yamamoto, M. and Sassa, S. (1998) Regulation of NF -E2 activity in erythroleukemia cell differentiation. J Biol Chem 273, 53585365. 326. Song, S.H., Hou, C. and Dean, A. (2007) A positive role for NLI/Ldb1 in long-range beta globin locus control region function. Mol Cell 28, 810822. 327. Kim, S.I. and Bresnick, E.H. (2007) Transcriptional control of erythropoiesis: emerging mechanisms and principles. Oncogene 26, 67776794. 328. Bieker, J.J. (2001) Kruppel like factors: three fingers in many pies. J Biol Chem 276, 3435534358. 329. Burdon, T., Smith, A. and Savatier, P. (2002) Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol 12, 432438. 330. K oledova, Z., Raskova Kafkova, L., Calabkova, L., Krystof, V., Dolezel, P. and Divoky, V. (2009) Cdk2 inhibition prolongs G1 phase progression in mouse embryonic stem cells. Stem Cells Dev 331. Jenuwein, T. and Allis, C.D. (2001) Translating the histone code. Science 293, 10741080. 332. Bulger, M. (2005) Hyperacetylated chromatin domains: lessons from heterochromatin. J Biol Chem 280, 2168921692. 333. Wen, Y.D., Cress, W.D., Roy, A.L. and Seto, E. (2003) Histone deacetylase 3 binds to and regulates the multifunctional transcription factor TFII -I. J Biol Chem 278, 18411847. 334. Cook, P.R. (1999) The organization of replication and transcription. Science, 284, 17901795.

PAGE 151

151 BIOGRAPHICAL SKETCH Zhuo Zhou was born on April 13 1979 in the beautiful city of Harbin in Heilongjiang Province, China. She grew up in the neighborhood of Harbin Medical University, where her parents were working, and had decided to work on something related to medical science since she was little. She graduated from Middle School Attached to Harbin Normal University in 1997 and then attended Peking University, China with a grade in the top 0.0 1 % on the National Matriculation Examination. In 2001, Zhuo was awarded a B.S. degree in Physiology and Biophysics from the College of Life Science at Peking University. She then worked as research assistant in Key Laboratory of Cell Biology and Genetics in College of Life Sciences, Peking University until 2004. In 2004, Zhuo attended the IDP as a Ph.D. candidate in College of Medicine, University of Florida, mentored by Dr. J rg Bungert. In May 2010, she graduated with her Ph.D. degree from Department of Biochemistry and Molecular Biology, College of Medicine, University of Florida. She is also e xpecting to receive her M.S. degree in Statistics in August 2010. Zhuo intends to acquire a post doctoral fellowship investigating the role of chromatin structure on gene regulation. In the long term, she would like to pursue work in academia.